<%BANNER%>

Population Genetics Analysis of Two Citrus Pathogens in Florida and in the Caribbean Region

MISSING IMAGE

Material Information

Title:
Population Genetics Analysis of Two Citrus Pathogens in Florida and in the Caribbean Region
Physical Description:
1 online resource (76 p.)
Language:
english
Creator:
Matos Casado, Luis Antonio
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
Folimonova, Svetlana Yuryevna
Committee Members:
Song, Wen-Yuan
Jones, Jeffrey B
Killiny-Mansour, Nabil Abd El Moneim
Hilf, Mark E

Subjects

Subjects / Keywords:
citrus -- citrustristezavirus -- huanglongbing -- vntr
Plant Pathology -- Dissertations, Academic -- UF
Genre:
Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Citrus is one the most important crops in America, with a direct contribution into a socio-economical aspect by generating thousands of jobs.  Citrus tristeza virus (CTV) and Huanglongbing (HLB) are considered to be the two major diseases that cause the loss of millions of dollars.  In order to evaluate the genetic population of CTV in the Dominican Republic, samples were collected in eight agricultural regions and were analyzed by reverse-transcription polymerase chain reaction using specific primers that amplified three different regions in the CTV genome followed by sequencing analysis.  After the characterization of 163 CTV isolates a dramatic change in the populations that occurred over the last ten years was observed: the VT genotype has spread throughout the country in addition to the T30 genotype that has been widely distributed. The T3 genotype was found, however, it was determined to be restricted to a few of the regions sampled. In addition, two new for the Dominican Republic strains were found: theT36 and RB.  Examination of populations of Candidatus Liberibacter asiaticus (CLas) was done based on analysis of Variable Number of Tandem Repeats (VNTR) in four loci within the genome of CLas. We demonstrated that these VNTR remain stable upon passage of the pathogen in citrus and psyllid hosts as well as over a period of five years, which suggests that they appear to be good markers for examination of the pathogen populations. In addition we characterized HLB populations in Florida, the Caribbean region, Central America (CA), and Mexico.  The HLB populations in Florida and Mexico are composed of two different groups, while in the Caribbean and CA countries was composed of only one group, which was similar to the most prevalent group in Florida.  Finally, we did a comparison between HLB populations found in these countries with a number of samples collected in Brazil, China, and Japan. Based on our results, two samples coming from Brazil have a similar to the less prevalent isolate group in Florida.  The samples from China and Japan that were tested in this work did not show any similarity to the samples collected indifferent places in America.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Luis Antonio Matos Casado.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Folimonova, Svetlana Yuryevna.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045817:00001

MISSING IMAGE

Material Information

Title:
Population Genetics Analysis of Two Citrus Pathogens in Florida and in the Caribbean Region
Physical Description:
1 online resource (76 p.)
Language:
english
Creator:
Matos Casado, Luis Antonio
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
Folimonova, Svetlana Yuryevna
Committee Members:
Song, Wen-Yuan
Jones, Jeffrey B
Killiny-Mansour, Nabil Abd El Moneim
Hilf, Mark E

Subjects

Subjects / Keywords:
citrus -- citrustristezavirus -- huanglongbing -- vntr
Plant Pathology -- Dissertations, Academic -- UF
Genre:
Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Citrus is one the most important crops in America, with a direct contribution into a socio-economical aspect by generating thousands of jobs.  Citrus tristeza virus (CTV) and Huanglongbing (HLB) are considered to be the two major diseases that cause the loss of millions of dollars.  In order to evaluate the genetic population of CTV in the Dominican Republic, samples were collected in eight agricultural regions and were analyzed by reverse-transcription polymerase chain reaction using specific primers that amplified three different regions in the CTV genome followed by sequencing analysis.  After the characterization of 163 CTV isolates a dramatic change in the populations that occurred over the last ten years was observed: the VT genotype has spread throughout the country in addition to the T30 genotype that has been widely distributed. The T3 genotype was found, however, it was determined to be restricted to a few of the regions sampled. In addition, two new for the Dominican Republic strains were found: theT36 and RB.  Examination of populations of Candidatus Liberibacter asiaticus (CLas) was done based on analysis of Variable Number of Tandem Repeats (VNTR) in four loci within the genome of CLas. We demonstrated that these VNTR remain stable upon passage of the pathogen in citrus and psyllid hosts as well as over a period of five years, which suggests that they appear to be good markers for examination of the pathogen populations. In addition we characterized HLB populations in Florida, the Caribbean region, Central America (CA), and Mexico.  The HLB populations in Florida and Mexico are composed of two different groups, while in the Caribbean and CA countries was composed of only one group, which was similar to the most prevalent group in Florida.  Finally, we did a comparison between HLB populations found in these countries with a number of samples collected in Brazil, China, and Japan. Based on our results, two samples coming from Brazil have a similar to the less prevalent isolate group in Florida.  The samples from China and Japan that were tested in this work did not show any similarity to the samples collected indifferent places in America.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Luis Antonio Matos Casado.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Folimonova, Svetlana Yuryevna.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045817:00001


This item has the following downloads:


Full Text

PAGE 1

1 POPULATI ON GENETIC S ANALYSIS OF TWO MAJOR CITRUS PATHOGENS IN FLORIDA AND IN THE CARIBBEAN REGION By LUIS ANTONIO MATOS CASADO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFI LLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Luis Antonio Matos Casado

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS After approximately 14 years of waiting to be enroll ed into a PhD program, finally it bec a me a reality fo ur years ago when I started my study program under the supervision of Dr. Svetlana Y. Folimonova. During my program many different researchers and co workers provided various help or assistanc e for me. First of all, I would like to acknowledge all of my committee members for their guidance during my time in the PhD program. Special thanks to my major advisor Dr. Svetlana Y. Folimonova for giv ing me this opportunity and advis ing me in the right direction, helping me to accomplish and fulfill the requirements of PhD program, for which I would like to express all of my appreciation and respectfulness for her. I thank Dr s Jeff Jones and Wen Yuan Song for all helpful comments and suggestion s in my research and for sharing their experience in how to follow rules of the graduate school at UF. Similarly I give my thanks to Dr. Nabil Killiny for his advice and positive encouragement th r ough my research project. Finally, I specifically thank Dr. Mark Hilf for all his support, suggestions and good guidance during the whole process of my program and even prior to that. It was an invaluable help that I in particular, with sequencing and technical support which was provided by Ken Sims a technical I would like : Craig Davis and Turksen Shilts who help ed me from the beginning of the program postdocs Ok Kyung Kim, Sung Hwan Kang Maria Bergua and her h usband David Franco and I t was a real pleasure to share lab and technical experiences with all of them I would like also say thank you to Dr. William O. Dawson for his help ful suggestion s and help with editing manuscripts and for allow ing our group to use his lab and facility for a period of time A t

PAGE 5

5 the same time I would like to thank all of the members of his lab : Cecile Robertson, Carmen Bierman Cheryl Graffam, and Drs. Siddarame Gowda, Scott H arper and Choaa El Mohtar E ach one of them helped me in a different way and I really appreciate that so much. I also want to say a big hank from the bottom of my heart to Dr. Stephen M. Garnsey I do not even think that I have enough words t o express all of my appreciation and describe the invaluable help I have received from Steve since I met him more than 15 years It was a really indescribable moment in my professional life : all of his knowledge w as at some point a big motivation for me. A possibility to use t he facilities of lab relocation to the main campus in Gainesville was a big contribution in order to get done all the work needed to finish my research projects I greatly appreciate this a nd thank Dr. Loria and the members of her lab. My thanks to Dr. Gal Sapir and his family : it was a really good oportunity to meet them and to get into a nice friendship My gratitude is going also to all faculty members at the Plant Pathology Department especially those from who I learned during each lecture I had received. In addition, I would like to thank many people in the Dominican Republic. I would like to thank Ing. Rafael Prez Duverg, Executive Director of Instituto Dominicano de Inv e stigaci on es A gropecuarias y Forestale s (IDIAF) who support ed m y interest for getting enrolled into th e PhD program. Extensive appreciation goes to all members of my lab at the Agriculture and Biotechnology Center (CENTA IDIAF), especially to Xiomara Cayetano and A ndrea Feliz for their help with collecting and processing samples for the Citrus tristeza virus related projects in the Dominican Republic, to all members of the Technical Committee and Dr. Modesto Reyes for his support and for

PAGE 6

6 pushing me to wards entering the PhD program. I express a v ery special hank you to Dr. Julio Borbn who encourage d me to get better professional ly and to do all necessary things in order to get a PhD degree, for which I will be indebt forever in addition for all of the support g iven to my family during my absence A special hanks is for the Dominican community in Gainesville, especially to Jose Diaz and his family I greatly appreciate his support. I appreciate the support received from the Ministry of Higher Education, Sci ence, and Technology through the Project number 2008 2 DI 033. Finally, my deepest hank to my parents Alfonso G. Matos and Marelys Casado ( e ven though she already passed away) : even despite their humble situation they always found ways how to keep the family moving on particularly in giving the education for their children Thanks for all the support and motivation received from my brothers Richard and Wilkin and from my sister Raquel Matos I really appreciate all their su pport and the support from their respective famil ies Finally, the bigge st and deepest to those who have been my big motivation to continu e moving ahead in all my personal projects : to my daughter Dominique, my son Alfonso and my wife Dominga Pozo for all unconditional support and endless love that I have always received from all of them GOD blesses all of you I think it is the appropriate moment to say to GOD for mak ing this moment happen ed after 18 years I think GOD knows I a m worth it.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHARTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 Economic Importance of Citrus in America ................................ ............................. 13 Citrus Pathogens and Diseases ................................ ................................ .............. 13 General Information about Citrus tristeza virus ................................ ....................... 14 Citru s tristeza virus in the Dominican Republic ................................ ....................... 16 Overview of Citrus Huanglongbing ................................ ................................ ......... 19 Variable Number of Tandem Repeat (VNTR) as a Genetic Marker ........................ 22 2 MATERIALS AND METHODS ................................ ................................ ................ 26 Citrus Sample Collection for CTV ................................ ................................ ........... 26 Analysis of Virus Pop ulation Accumulated in Citrus Trees ................................ ...... 26 Cloning and Sequencing Analysis for CTV ................................ ............................. 26 Phylogenetic and Bioinformatic Analysis ................................ ................................ 27 Collection of Samples for Examination of HLB Populations in Different Regions ... 28 CLas DNA Extraction ................................ ................................ .............................. 28 Primers, PCR and Cloning for C Las ................................ ................................ ....... 29 Evaluation of Stability of VNTR after Passage of the Pathogen through Citrus and Psyllid Hosts ................................ ................................ ................................ 30 Field Samples Collection and Composition ................................ ............................. 32 3 RESULTS ................................ ................................ ................................ ............... 35 Incidence of CTV in Citrus Producing Regions of the Dominican Republic ............ 35 Distribution of CTV Genotypes in Different Citrus Growing Regions in the Dominican Republic ................................ ................................ ............................. 35 Phylogenetic and Bioinformatic Analysis ................................ ................................ 37 CTV Genotypes in Different Citrus Varieties ................................ ........................... 39 Characterization of Florida HLB Population Using Four Loci Containing VNTR ..... 39 Validation of VNTR Based Approach for HLB Population Differentiation ................ 40 Distribution of HLB Population in Florida Counties ................................ ................. 43 Characterization of HLB Populations in the Caribbean and Central America Countries ................................ ................................ ................................ ............. 44

PAGE 8

8 Comparison of Florida HLB Populations with those from Brazil, China and Japan ................................ ................................ ................................ ................... 44 4 DISCUSSION ................................ ................................ ................................ ......... 58 LIST OF REFERENCES ................................ ................................ ............................... 63 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 76

PAGE 9

9 LIST OF TABLES Table page 2 1 Sequences of marker primers used for characterization of Citrus tristeza virus genotypes from the Dominican Republic ................................ .................... 33 2 2 List primers sequences used to amplified four loci in the CLas genome with VNTR ................................ ................................ ................................ .................. 34 3 1 Occurrence of different genotypes of Citrus tristeza vi rus in citrus producing regions in the Dominican Republic determined by analysis with genotype specific primers ................................ ................................ ................................ ... 46 3 2 Marker profiles of Citrus tristeza virus genotypes ................................ ............... 47 3 3 Summary of genotype combinations found in the Dominican Republic .............. 48 3 4 Neutrality test, polymorphisms and recombination evens for genotype in the .... 48 3 5 Analysis Molecular of Variance (AMOVA), using K17 region in the CTV genome. Significant variation were found among populations ( P< 0.001 ) .......... 48 3 6 Analysis of VNTR stability upon transmission of the pathogen from Duncan grapefruit containing IG5 isolate ................................ ................................ ......... 49 3 7 Analysis of VNTR stability upon transmission of the path ogen from field Duncan grapefruit containing IG13 isolate ................................ .......................... 49 3 8 Analysis of VNTR stability upon transmission of the pathogen from field grown mandarin containing IG13 isolate ................................ ............................ 50 3 9 Analysis of VNTR stability over a period of five years ................................ ........ 50 3 10 Distribution of HLB populations in Florida counties ................................ ............ 51 3 11 Analysis of HLB populations in the Caribbean and Central America countries and Mexico ................................ ................................ ................................ ......... 51 3 12 Examination of a few HLB isolates from China, Japan, and Brazil ..................... 52

PAGE 10

10 LIST OF FIGURES Figure page 3 1 Distribution of CTV g enotypes in eight citrus growing regions in the Dominican Republic. A, Virus distribution according to the earlier study ............ 53 3 2 Phylogenetic relationships between sequences of CTV isolates from the Dominican Republic and other CTV sequences from around the globe. ............ 54 3 3 Distribution pattern of the CTV strains in different citrus hos t. (A), distribution of CTV Strains in Persian lime, (B) strains distributions in sweet oranges, (C) .. 55 3 4 The genetic structure of Citrus tristeza virus using K17 genome region, there were clustered in four goups or clusters (K=4). A, T36 and RB strains, B, VT ... 56 3 5 Agarose gel showing the typical pattern of samples belonging to IG5. M, DNA Markers; C No DNA negative control; IG5, positive control for IG5 .. ....... 56 3 6 Agarose gel showing the typical pattern of samples collected in Lake county Florida. M, DNA Markers; C No DNA negative control; IG5, positive . ........... 57

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy POPULATION GENETIC S ANALYSIS OF TWO MAJOR CITRUS PATHOGENS IN FLORIDA AND IN THE CARIBBEAN REGION By Luis Antonio Matos Casado August 2013 Chair: Svetlana Y. Folimonova Major: Plant Pathology Citrus is one the most important crops in Amer ica, with a direct contribut ion into a socio economical aspect by generati ng thousands of jobs. Citrus tristeza virus (CTV) and Huanglongbing (HLB) are considered to be the two major diseases that cause the loss of millions of dollars. In order to evalua te the genetic population of CTV in the Dominican Republic, samples were collected in eight agricultural regions and were analyzed by reverse transcription polymerase chain reaction using specific primers that amplified three different regions in the CTV g enome followed by sequencing analysis. After the characterization of 163 CTV isolates a dramatic change in the populations that occurred over the last ten years was observed: the VT genotype has spread throughout the country in addition to the T30 genotyp e that has been widely distributed. The T3 genotype was found, however, it was determined to be restricted to a few of the regions sampled. In addition, two new for the Dominican Republic strains were found: the T36 and RB. Examination of populations of Candidatus Liberibacter asiaticus ( C Las) was done based on analysis of Variable Number of Tandem Repeats (VNTR) in four loci within the genome of C Las. We demonstrated that these VNTR remain stable upon passage of the pathogen in citrus and psyllid hosts a s well as over a period of five

PAGE 12

12 years, which suggests that they appear to be good markers for examination of the pathogen populations. In addition we characterized HLB populations in Florida, the Caribbean region, Central America (CA), and Mexico. The HLB populations in Florida and Mexico are composed of two different groups, while in the Caribbean and CA countries was composed of only one group, which was similar to the most prevalent group in Florida. Finally, we did a comparison between HLB populations found in these countries with a number of samples collected in Brazil, China, and Japan. Based on our results, two samples coming from Brazil have a similar to the less prevalent isolate group in Florida. The samples from China and Japan that were tested in this work did not show any similarity to the samples collected in different places in America.

PAGE 13

13 CHAPTER 1 INTRODUCTION Economic I mportance of C itrus in America Citrus is one of the most important crops that grow in areas starting at 40 latitu de of the equator (45 ). It has been proposed that t he origin of citrus is southeast ern Asia H owever some evidence that is based on molecular analysis of citrus varieties and relatives indicate that most likely citrus ha s been evolving in Aus tralasia (45 ). There is an estimation that around 54 % of citrus is produced in America s (122) where Brazil and Florida USA are the most importan t citrus producers in the world ( 45, 47 ). In addition there are about 700 thousa nd hectares (Ha) of citrus in the Caribbean Central America and Mexico (93). Mexico has around 526 ,000 Ha (132 ) followed by the Dominican Republic with about 30,000 Ha (82 ), Costa Rica with nearly 29,000 Ha (134 ) and Belize with around 25, 000 Ha ( 22, 122). In Florida citrus is one of the most important crops, with an estimated value of around 9 billion dollars (62). Similarly, in other countries in America citrus has a great economic impact by generating thousands of jobs. Besides its economical importance, citrus is a sourc e of products, including fresh fruit and juice with high vitamin C content, which is very beneficial for human health. Citrus P athogens and D iseases Citrus is affected by a wide variety of agents such as mites, insects, fungi, nematodes, bacteria, viruses and viroids that can severely affect citrus tree productivity (108, 129). Different soil borne pathogens such as Phytophthora spp. and Pythium spp. can severely affect the root system causing root rot and making citrus plants weak by interrupting water up take (48). Similarly, citrus trees could be affected by different

PAGE 14

14 graft transmissible diseases such as virus es and viroid s and some prokaryotes. Many diseases caused by viruses and viroids have been reported to affect citrus production such as Citrus tristeza virus (CTV), Citrus psorosis virus (CPsV), and Citrus exocortis viroid (CEVd ) (108). The most important members of prokaryotes that cause diseases in citrus are Xanthomonas axonopodis pv citri that causes citrus canker (46), Xy lella fastidiosa w hich is the causal agent of citrus variegated chlorosis disease in Brazil (16), and Candidatus Liberibacter spp., which have been associated with citrus Huanglongbing (HLB) disease. General I nformation about Citrus tristeza virus CTV is the most destructi ve viral pathogen of citrus (91 ). It is also the largest member of the Closteroviridae family, which contains viruses with mono bi and tripartite genomes transmitted by a range of insect vectors, including aphids, whiteflies, and mealybugs ( 2 7 27 2 8 66 ). CTV has long flexuous virions (2,000 by 10 to 12 nm) encapsidated by two coat proteins (CPs) and a single stranded RNA genome of approximately 19.3 kb. The RNA genome of CTV contains 12 open reading frames (ORFs) (67 96 ). ORFs 1a and 1b are expr essed from the genomic RNA and encode polyproteins required for virus replication. terminal subgenomic RNAs (56 57, 68 ) and encode the following proteins: major (CP) and minor (CPm) CPs, p65 (HSP70 homolog), and p61 that are involved in assembly of vir ions (112 ); a hydrophobic p6 protein with a proposed role in vi rus movement (27 125 ) ; p20 and p23, which, along with the CP, were shown to be suppressors of RNA silencing in Nicotiana benthamiana (78 ); and p33, p13, an d p18, which function in ex tending the vi rus host range (126 ). CTV has numerous isolates with distinctive biological and genetic characteristics, which can be classified into six major CTV

PAGE 15

15 genotype groups or strains: T3, T30, T36, VT, T68, and RB, with so me isolates unclassified ( 38 52, 53 5 7, 71 10 5, 111 112 ). Strains are defined as phylogenetically distinct lineages of CTV based upon analysis of nucleotide sequences of the 1a ORF ( 38 56 57 ). This region of the genome shows high genetic diversity between CTV variants, with levels of sequence identity of 72.3 to 90.3% ( 52 57 7 1, 77 85, 110, 111 ). regions of the genomes of isolates from different CTV strains. Each strain is composed of isolates with minor sequence divergence, generally less than 5% throughout the ent ire genome ( 5 3 57 91 ). At the same time, isolates of a strain may have significant variations in symptoms and symptom severity. Remarkably, field trees harbor complex populations of CTV, which are often composed of mixtures of different genotypes and r ecomb inants between these genotypes ( 4 9 71, 77, 80 102, 111 13 7, 138 ) The host range of CTV is limited to citrus and citrus relatives in which the virus infects only phloem associated cells. CTV infection is associated with two devastating diseases of citrus, which have had a major impact on global citrus production ( 5, 6 9 1 ). Depending on the virus isolate and the variety rootstock combination, CTV can cause decline, which is a graft incompatibility, or stem pitting. The first disease results in a death of sweet orange ( Citrus sinensis (L.) Osbeck), mandarin ( C. reticulata Blanco), or grapefruit ( C. paradisi Macfadyen) trees grafted on sour orange ( C.aurantium L.) rootstocks. During the last century, decline causing CTV isolates caused severe epidem ics in many different citrusgrowing areas worldwide, which resulted in the loss of almost 100 million trees propagate d on the popular sour or ange (91 ). Isolates of strains T36 or VT have been found associated with the decline syndrome. Stem pitting, ofte n

PAGE 16

16 caused by some of the severe isolates of strains VT, T3, or T68, substantially reduces growth and fruit quality of grapefruit, sweet orange, and lime ( C. aurantifolia (Christm.) Swingle) trees regardless of the rootstock used, thus limiting a number of v arieties that can be grown commercially whe re these strains a re present (39 57 91, 107, 10 8 ) CTV dissemination to new regions occurs mainly via movement of infected plants or propagation of infected budwood followed by further local spr ead by several ap hid spe cies (91 ). The first large dispersal of the virus from its presumed origin in South East Asia into new regions resulted from an active movement of different citrus varietie s at the end of 1 9th century (9 1 ). Since then, multiple examples of inadver tent introduction of exotic isolates of CTV into different citrus producing countries, which resulted from the international movement of citrus varieties, have been documented (91 ). The detection in 2000 in California of exotic severe stem pitting CTV iso lates in mandarin plantings, which originated from illegal budwood imports (M. Polek and R. Yokomi, personal communication ), and the discovery of VT isolates in commercial citrus in Florida (56 119 ) represent recent examples. Because the introduction of aggressive virus isolates from outside sources or their emergence from unrecognized existing infections appears to be a continuing threat to the citrus industries in many different countries, proactive identification and eradication of the infected trees a s well as the development of means to protect new plantings against aggressive isolates become critical for virus suppression. Citrus tristeza virus in the Dominican Republic CTV has been a major concern for the citrus industry in the Dominican Republic, which encompasses more than 30,000 Ha Sweet orange varieties represent about 70% of all plantings, followed by Persian lime, Mexican lime, mandarin, and grapefruit

PAGE 17

17 (82) The virus presence in the commercial plantations was initially reported in 1990 bu t the infected trees did not show obvious disease symptoms ( 73 ). S urveys made during 1990 to 1992 indicated that CTV w as not yet widely distributed (12 ). In 1992, the brown citrus aphid ( Toxoptera citricidus Kirk.) was found in the Central region of the country. With the brown citrus aphid being the most efficient insect vector of CTV (91 105 ), its presence apparently provided favorable conditions for dispersal of the virus into different areas ( 1, 31 ). From 1992 to 1995, repeated surveys showed a rapi d diffusion of CTV into commercial citrus plantings (39 ). At that time, none of the virus containing samples reacted with the monoclonal antibody MCA 13 (98 ), which indicated that the endemic isolates only had the T30 genotype, and no visible evidence of quick decline or stem pitting was found (39 ). By 1995, the incidence of the T30 isolates of CTV has risen to almost 50 to 90% in many citrusgrowing areas ( 40 ). The first occurrence of severe isolates of CTV leading to decline or stem pitting in citrus tr ees in the Dominican Republic was reported in 1996 in Valencia sweet orange in Hato Mayor, one of the major commercial production areas in the East region of the country (39; 40 Fig. 3 1A ). One year later, Persian lime trees with typical CTV related vein clearing and stem pitting symptoms were found in the Monte Plata area in the Central region ( 40 ; Fig. 3 1A ). Samples collected from the symptomatic trees in both regions reacted with the MCA 13 antibody, indicating dispersion of isolates new to the countr y. Analysis of the genotype composition of those isolates revealed the presence of the VT and T3 genotypes ( 40, 41 ). Although the trees carrying exotic isolates were detected in two geographically distant areas, subsequent surveys showed that their incid ence was very low, ranging between 2 to 5.4% in the East and 0.5 to 1.75% in the Central regions in

PAGE 18

18 1997 ( 39, 40 ). Since then, the increasing occurrence of CTV associated decline of sweet orange trees grafted on sour orange rootstock and development of se vere stem pitting symptoms in a large proportion of sweet orange and Persian lime trees in many agricultural regions throughout the country were observed. During the following years, a great number of sweet orange trees grown on sour orange rootstock have declined, and those were replaced with sweet orange propagated on decline resistant rootstocks (82 ). Although new replantings were done using MCA 13 negative budwood sources, many trees developed severe stem pitting symptoms within a few years, particula rly over the last decade; stem pitting became the major economically damaging dise ase of citrus in the country (82 ). A significant increase in the number of diseased trees correlated with a change in the serological characteristics of the CTV isolates. A great majority of the virus samples collected from field citrus trees in recent years react ed with the MCA 13 antibody (82 ). Altogether, those observations suggested that field populations of CTV were changing. The CTV pathosystem in the Dominican Republ ic represents a unique opportunity to examine the evolution of virus populations within a defined geographical area. As discussed above, the distribution and genotype composition of CTV isolates in the country has been examined previously at different tim e points. The data of earlier studies provided a possibility to assess changes in the composition of virus populations over a period of time. To evaluate the current population complexity of CTV in the Dominican Republic, we conducted a comprehensive exa mination of samples collected in different commercial citrus production areas. Using a reverse transcription polymerase chain reaction (RT PCR) assays with genotype specific molecular markers

PAGE 19

19 coupled with sequencing analysis, we characterized molecular co mposition of 163 CTV isolates collected from several locations within the country. Overall, our data demonstrate a dramatic change in the CTV populations that occurred within the last 10 years in the Dominican Republic, which is characterized by increased dissemination of the previously identified genotypes in new regions, with the VT genotype are now widely spread throughout the country ; th is includes the presence of two new virus genotypes, and the predominance of complex virus populations composed of di fferent genotypes. Overview of Citrus Huanglongbing Citrus greening or Huanglongbing (HLB) is considered to be one of the most economically important citrus diseases around the world. HLB is the cause of losses of millions of citrus trees in many citrus g rowing areas whereve r the disease has been reported (11, 47). The disease was first observed in the 18 th cent ury in India (47 ). Later in 19 th century similar symptoms were observed in southern China where the disease was referred to as yell ow shoot disea se (45 69, 70 ). Since then, the disease has been reported in Taiwan, Japan, South Africa, Indonesia and others countries in Asia (84 86, 89, 132 ). In Americas, the first report of HLB was in 2004 in Sao Pau lo, Brazil (16 ) and i n 2005 in Florida (51 ). After the initial find ing s, the disease has spread all over the Caribbean and Central America countries in a relatively short period of time. In 2007 it was foun d in Cuba (81 ), followed by the detection in the Dominican Repu blic in 2008 (83), Belize in 20 10 (79) and almost simultaneously in Costa Rica, Nicaragua, and Honduras in Central America (93, 94), and more recently in Puerto Rico (C. Estevez, unpublished data) and Jamaica (13). The bacteria could be transmitted by graft propagation of the infected m aterial and by psyllid vectors, which are responsible for spreading the bacterium from tree to

PAGE 20

20 tree in the field Asian citrus psyllid Diaphorina citri transmits both C Las and C lam while African psyllid Trioza eryitreae is responsible for C laf transmissio n (11). C Las is thought to cause the HLB disease in Florida. In the infected plants the bacterium invades most of the plant parts: leaves, stems, flowers, fruits, seed coats, and roots where it resides within phloem sieve elements (36, 55, 65). One of th e first symptoms produced is the development of a yellow shoot or a group of leaves showing asymmetric blotchy mottling or other chlorotic patterns, while the rest of the plant remains symptomless. The infected leaves sometimes become thicker and have cork y veins. The fruit produced are small, lopsided, poor tasting, and often abcise from a tree (11 20 21 37, 47, 79 ) As the disease progresses the infected trees decline. Typically, trees die w ithin a few years after the appearance of initial symptoms CLas is able to produce intercellular and anatomical disorders such as excessive starch production and swelling of the m i ddle lamella between cells wall and around sieve elements, and in addition considerable changes in the metabolism in sweet oranges (34, 38 ). Thus far, no citrus species have shown resistant to the disease; however, different citrus species have demonstrated different levels of tolerance to the disease. This evaluation of responses of different citrus species again CLas isolates from Flo rida demonstrated that there are differences in host response to HLB, and they were grouped in three categories which are, sensitive, moderately tolerant, and tolerant. The sensitive species were Citrus. halimii B. C. Stone; Nules clementine mandarin, Va lencia sweet orange Madam Vinous sweet orange, grapefruit Ruby red grapefruit, and Minneola tangelo ( C. tangelo J. Ingram & H. E. Moore) The moderately tolerant are Volkamer lemon ( C. volkameriana (Pasq) Tan Sun Chu Sha, mandarin, Sour

PAGE 21

21 orange, Citro n ( C. medica L.) and Mexican lime whereas the most tolerant are Eureka lemon ( C. limon (L) Burm. f ) Persian lime ( C. latifolia, Tan. ) Swingle Carrizo citrange ( Poncirus trifolia X C. sinensis ) Severinia buxifolia and Poncirus trifoliate (L) Raf ., (37, 103 ). The CLas bacterium is able to invade most parts of citrus plant parts such as leaves, stems, flower s fruits, roots; additionally, high level s of bacteri al colonization in seed coats of seeds from the infected plants has been demonstrated ( 55, 65) The genetic variability of CLas has been examined using the sequence of 16S/23S rRNA and the outer membrane protein ( omp) genes. In addition to these genes, the rplKAJL rpoBC operon sequence, nusG rplK and bacteriophage type DNA polymerase region ( 8, 9 0,128,132 ) have been used for genetic differentiation of the CLas. The completion of the CLas ge nome sequence (29 ) has allowed identifying different regions of the genome with variable number of tandem repeat (VNTR) (140) In 2010 174 samples from Guang dong, China and Florida in the USA were characterized using the locus of CLIBASIA _01645 based on the presence of the tandem repeat sequ ence AGACACA (14 ). In those 174 isolates a number of the AGACACA motif varied from 3 to 16. The isolates were divided into two groups The first group contained the motif repeated less than 10 times, and the other more than 10 times. Among 109 isolates that were collected in Florida, more than 90% of the isolates belong to the first group and they were more prevalent in Florida counties, however isolates from the second group were found in only four counties in the central Florida. This suggested that at least two different introduction of HLB occurr ed in Florida (14 ) These data, however, were obtained based on the anal ysis of a single locus, which may not provide enough information for discrimination between different strains of CLas. For

PAGE 22

22 this reason, another study tested four different loci including the motif AGACACA to differentiate CLas stra ins in Japan (69, 70 ). More recently, seven microsatellite DNA markers associated with hypervariable sequence regions were implica ted for the differentiation of HLB isolates collected from different parts of the world (61 ). Although these publications demonstrated the usefulnes s of VNTR based approach for differentiating between strains of HLB, the question that remained was: how stable are these repeats upon multiplication of the pathogen in a host over an extended period of time or upon its passaging from a host to a host? Bot h of these questions were addressed in this work. The presence of two different populations of CLas in Florida provided an excellent opportunity to examine the stability of seven loci containing VNTR in the CLas genome after passage the pathogen in citrus host and psyllid hosts In continuation with this work we conducted an extended analysis of HLB populations in different locations within Florida and in several countries of the Caribbean and Central America regions and we compared those with isolates co llected from locations where the disease was present for a much longer time. Variable Number of Tandem Repeat (VNTR) as a Genetic Marker VNTR also known as microsatellites, which are tandem repetitive DNA sequences with a motif length of 2 to 6 or more bas e pair (bp) ( 134 ). VNTR are among the most variable types of DNA sequence in the genome and are derived mainly from variability in length rather than differences in the primary sequence (30 ). Molecular markers were not widely available until the 1980s ( 30, 95 ) but after the development of polymerase chain reaction (PCR) many molecular marker s such as single nucleotide polymorphism (SNP), a mplified fragment length polymorphism (AFLP), etc. were used to characterize of different species such as human s a nima ls and other

PAGE 23

23 organisms (30, 43 ). Parentage analysis, genetic mapping, finger or genetic structure analyses are some of the applications of m icrosatellites which have been in use since the late eighties (30). Even though, it is not clear as to what is t he mutation rate of microsatellites. It appears to be higher than that of other parts of the genome, ranging from 10 2 to 10 6 per locus per generation Microsatellites are known to be highly polymorphic markers; however they have been used in a considera ble number of studies covering most varied areas of genetics (118 ). S ome of the mechanisms suggested to explain the high mutation rate s of microsatellites are e rrors during recombination, unequal crossing over and polymerase slippage duri ng DNA replicati on or repair ( 4, 10, 74, 115, 116 118, 121 ). F unctional recombination has been proposed as one of the mechanism s however strains with and without this mechanism had similar mutation rate suggesting that recombination is not the predominant mechanism fo r microsatellite variability. Another mec hanism proposed is DNA slippage It is assumed that during DNA replication the new strand and the template realign out of the complementary sequences so if the DNA synthesis continues on this molecule, the number of repeats of the microsatellite change s (117, 118 ) However there was a dis agreement between in vitro and in vivo experiments suggesting that DNA slippage occurs at high er rates in vitro than it is expected in vivo ( 54 ) but this can be explained by tw o process es : primary slippage rate and the efficie ncy of a mismatch repair system in an organism ( 118, 122 ) It h a s been demonstrated th at the mutation rate s var y widely between loci within species ( 121 124 ) O ne advantage of loci with a high mutation ra te is that genetic differentiation r eaches equilibrium faster, giving a possibility of obtaining estimates from larger and more widely spaced populations ( 24, 25 ) U sing

PAGE 24

24 microsatellite s for genetic analysis o f populations suggested that microsatellite loc i with more repeats generally show higher mutation rates, which is probably due to DNA slippage that increases proportion ally to the number of repeats So if genetic diversity depends on the mutation rate and the mutation rate itself depends on the numbe r of repeats subsequently there should be a relationship between microsatellite genetic diversity and the mean number of repeats (99) In general some possible function s of microsatellite s have been investigated T he most direct evidence of involvement of microsatellites in gene function comes from studies of human genetic disorders that result in an expansion and in particular strong correlation between the repeat length, age of onset and severity of disease. In addition some gene regulation has been f ound to occur (88 ). A good understanding of microsatellite s evolution combined with their high information content will result in a continued intere st in the use of microsatellite as genetic markers (11 5 116 118 ). The number of repeats is a n important f actor in determin ation of the evolutionary dynamics of microsatellite s DNA. An interesting question is which parameters affect their length. Under the simplest model of microsatellite evolution, DNA slippage is a symmetrical process; so on averag e the sa me number of repeats is added and removed. This process can lead to loss of gain repeats ( 104, 115 ) After the development of PCR methodology and the development of different software to analyze data coming from th e se marker s ( 60, 97, 100, 125, 131) analysis and genotyping of microsatellite polymorphism became the preferred marker in genome mapping and population genetics studies (30 ). M any questions in molecular ecology can be addressed with a limited number of highly polymorphic markers s uch as

PAGE 25

25 microsatellites particularly, after the emergence of new genome wide approaches to study genetic variation F or that reason microsatellites remain to be the most popular markers in population genetic s studies (50 ) Microsatellites show ed a high lev el of stability including post mortem tissue ( 59 ). M icrosatellites have been used to characterize many plant species such as tomato, potato wheat, rice and many other crops ( 72, 101 106 ). Recently the genetic structure of Phytophthora ramorum, the ca usal agent of sudden oak death, was determined using microsatellite s analysis of a population collected in the nurseries of the west cost of the United States (44 ). Others plant and animal fungi have been characterized by a microsatellites marker such as Saccharomyces cerevisiae ( 35 ), Sclerotinia trifoliorum ( 92 ). However, not many plant pathogenic bacteria have been characterized using VNTR as a marker, with the first one being Xylella fastidiosa in Brazil (17 ). With the availab ility of bacterial genome s sequences it is known now that bacterial genomes contain a considerable number of intragenic tandem rep eats (23 26 ). It has been suggested that many uncharacterized tandem repeats in bacteria may be functioning in pathogenesis or in adaptation to e nvi ronmental stress (15 ).

PAGE 26

26 CHAPTER 2 MATERIALS AND METHODS Citrus Sample C ollection for CTV Samples for RT PCR analysis were petioles from young leaves or pedicels from young fruit, which were collected from individual field trees. Six petioles or three pe dicels were collected from each tree. Trees were sampled regardless of their outward appearance but many trees that were sampled expressed symptoms of severe stem pitting. In total, 192 samples were collected in 38 citrus farms from 24 provinces in the ei ght agricultural regions in the Dominican Republic (Fig. 3 1 ). Analysis of V irus Population Accumulated in Citrus T rees To examine CTV population in citrus trees, 150 mg of tissue was ground with liquid nitrogen, and total RNA was extracted with the Trizo l Reagent (Invitrogen) according to the procedure of the manufacturer. Total RNA was subjected to RT PCR using the Titan One Tube RT protocol. A universal CTV CP primer set was used first to detect the p resence of the virus, followed by genotype specific primers complimentary to sequences within the ORFs 1a 1b of the VT, T30, T3, T68, T36, or RB genomes to identify individual genotypes wi thin each CT V positive sample (3 53 57, 58 67 85, M. E. Hilf and S. J. Harper, personal communication ; Table 2 1 ). Each isolate was analyzed using 18 marker primer sets designed to specifically amplify distinct genomic regions within the ORFs 1a C loning and Sequencing A nalysis for CTV Selected RT PCR products amplifi ed using primers corresponding to the genomes of the VT, T30, T3, T36 or RB genotypes as indicated above (reactions

PAGE 27

27 carried out using the T68 specific primers did not yield any products) were cloned into pGEM T vector (Promega Corp., Madison, WI) according instructions and were submitted for sequencing (Macrogen USA, Rockville MD) in both sense and antisense directions usin g vector specific M13 primers. Sequence chromatograms were checked for errors, and the sense and antisense sequen ces for each fragment were assembled. Completed sequences of CTV were deposited in the GenBank NCBI database (Accession numbers JQ281780 JQ281788) and compared with the GenBank database using the BLASTn network service in the National Center for Biotechno logy Information. Phylogenetic and B ioinformatic A nalysis U sing Clus talX 1.83 (13 0 ), the assembled fragments were aligned against a series of CTV sequences representative of each of the major genotypes: T30 ( 3), T385 (137 ), T36 (66 ) VT (85 ), NZ B18 and N Z M16 (52 ), NZRB M12, NZRB M17 a nd NZRB G90 (53), B165 (110 ), H A18 1 (87 ), T3, B370 and B59 (57 ) from around the globe. Neighbor joining p hylogenies (113 ) were create d using the Tamura Nei model (124 ) wi th MEGA 5.0 (124 ). Bootstrap values were generated from 1000 replicates. Neutrality test, recombination events and nucleotide diversity w ere analyzed using DnaSP and (76) The analysis of molecular variance (AMOVA) and molecular diversity calc ulations were performed with AR LEQUIN 3.1, applying Kimura 2 parameter model for pairwise sequences distance estimation (32, 33) The program STRUCTURE 2.3.1 (100) was also used for a clustering algorithm based on a Bayesian model to assign individual strains of the Citrus tristeza vir us to a specified number of clusters (K)

PAGE 28

28 Collection of Samples for E xamination of HLB Populations in Different R egions Examination of the composition of HLB populations in this work was conducted based on the analysis of 390 samples. Among those, 81 sam ple represented DNA extracts produced from plant tissue harvested from individual HLB infected trees maintained in the greenhouse at the Citrus Research and Education Center, Polk county, Florida, USA (7 samples) or from trees grown in citrus orchards in P olk, Hendry, Marion, and Alachua Florida counties (29, 5, 20, and 20 samples, respectively). Harvested tissue consisted of midribs from at least five leaves coming from individual infected plants and was processed for nucleic acid extraction as described b elow. The rest of the samples analyzed represented DNA extracts of tissue collected from individual infected field trees of mostly sweet orange or grapefruit varieties grown in different locations throughout Florida (97 samples), eight countries in Centra l America and the Caribbean region (170 samples), Mexico, Brazil, China, and Japan (28, 2, 9, and 3 samples, respectively) kindly provided by other researchers CLas DNA Extraction Leaf midribs collected from leaves showing typical HLB related symptoms we re used for DNA extraction according to the procedure described by Garnsey et al. (2002) and Irey et al. (2006). Two hundred mg were pulverized using a Kleco tissue pulverizer ( Kinetic Laboratory Equipment Compa ny, Visalia, CA 93292) in 2.5 mL extraction b uffer (0.1 M NaCl, 10mM EDTA, 50mM Tris, pH 9.0, and 10 mM DTT) Two hundred L of 10% Sodium Dodecyl Sulfate was added, and the mixture was kept at 65 C for 30 to 45 mi nutes, followed by adding 500 L of 5M potassium acetate and incubation on ice for 20 min and centrifugation for 1 0 min at 15 rpm. Five hundred L of the supernatant was precipitated with 500 L of isopropanol. The D NA pellet was washed with 500 L of

PAGE 29

29 70% ethanol, dissolved in 100 L of RNase free water, and kept at 20 0 C for further analysis. Primers, PCR and C loning for C Las As a first step, all DNA extracts were su bjected to PCR analysis using HLBaspr (75 ) to confirm infection of the corresponding trees from which tissue was collected with the C Las bacterium. This was followed by examination of the number of repeats in loci within th e C Las genome containing Motifs A, B, C, and D via PCR analysis using primer sets listed in Table 2 2 In addition to the primers developed in previous publications, another primer set was developed here that generated a shorter fragment about 400 450 nts to allow in gel differentiation of amplified products. At the beginning of this work we also conducted a similar analysis for three additional loci containing the motifs TTTAA and TTTACATC that were previously examined in the earlier study by Islam e t al. (2012) using primers described in the corresponding publication. However, examination of a limited number of samples showed no consistency in the number of repeats for these motifs between different samples, so these three loci were then omitted in the further analysis. PCR reactions were carried out using the SpeedSTAR HS DNA polymerase from TaKaRa (Clontech Laboratories, Inc. Madison, WI) Each reaction mixture of 25 L contained 2.5 L of 10x Fast Buffer I, 2 L of 2.5 mM dNTPs, 0.5 M of each pr imer, 0.125 L of Taq DNA polymerase (5U/L), 16.38 L of water, and 0.2 g DNA template. The following PCR conditions were used: four min at 94 C, followed by 30 repetitive cycles with 30 s econds at 94 C, 45 seconds at 55 C, and 30 seconds at 72 C, and a final step of 5 min at 72 C. PCR products were analyzed in a 2 % agarose gel stained with ethidium bromide. For sequencing analysis PCR products were excised from a gel

PAGE 30

30 and extracted using a Geneclean Kit III from MP Biomedicals (Ohio, USA) according to the manufacturer instructions. DNA fragments were then cloned into pGEM T vector (Promega Corp., Madison, WI). In general, for each plant sample 5 to 15 clones generated for each locus were subjected to sequencing analysis. Evaluation of Stability of VNTR after P assage of t he Pathogen through Citrus and Psyllid H osts A greenhouse propagated DG plant infected with a IG5 group isolate (see details on isolate grouping in the Results) was used as a source of inoculum to transmit the pathogen to other citrus pl ants as well as a source for psyllid acquisition of the pathogen. Tissue from the plant was used to graft inoculate young seedling of sweet orange MV and another young DG plant. Additionally, the source DG plant was introduced in a cage with healthy psylli ds where those were allowed to feed for at least a week. Some of the psyllids were collected and used for DNA extraction followed by analysis for the presence of C Las as discussed above. Two of the psyllids shown to be C Las positive were subjected to furth er analysis for the number of VNTR in the four loci containing Motifs A, B, C, and D as described above. The remaining psyllids that fed on the infected DG source plant were placed into another cage with young healthy seedlings of eight different citrus sp ecies and allowed to feed on these receptor plants for two weeks. After this period of time the plants were sprayed with an insecticide to kill the psyllids and moved to the greenhouse where they were maintained and observed for the development of symptoms during 10 18 months along with graft inoculated plants. Plants that develop an infection as was confirmed by PCR with C Las specific primers were further used for analysis of VNTR in the same four loci In additional parallel experiments we used two field trees, DG and mandarin that were shown to be

PAGE 31

31 infected with the IG13 isolate group as inoculum source for subsequent grafting of two plants of DG and two of MV receptor plants, which then were allowed to develop infection over several months and used for fu rther analysis. In all these experiments, for each of the four loci eight to ten clones obtained from each receptor plant or each psyllid were used for sequencing in order to determine the number of repeats for each motif. In order to evaluate the stabilit y of those repeats after a period of five years we used DNA extracts or plants that remained from an early experiment conducted in 2007 in greenhouse facilities at the CREC. Two plants, Citrus macrophylla Wester (Cmac1) and Citrus micrantha Wester (Cmi), u sed in that experiment still remained in the greenhouse in 2012. DNA extract produced in 2007 from the Cmac1 plant and stored at 20 0 C was available. No DNA prepared in 2007 from the Cmi plant was found. For this reason, we selected another DNA extract pro duced from another Cmac2 plant in 2007. Importantly, all three plants, Cmac1, Cmac 2, and Cmi, were inoculated at the same time in 2007 using the same HLB inoculum source (this experiment is described in a publication by Folimonova et al. (2009). To assess whether VNTR profiles changed over a period of 5 years, DNA was extracted from the remaining Cmac1 and Cmi plants and subjected to further analysis for the number of repeats in the four loci The four loci profiles were then compared using DNA prepared fr om Cmac1 and Cmac2 in 2007 and DNA extracted in 2012 from Cmac1 and Cmi plants. DNA extracts from healthy MV and DG plants were used as negative controls to demonstrate lack of cross reaction between primers used to amplify C las DNA. As

PAGE 32

32 another control, t he primers used to amplify four loci within C Las genome were tested against C Lam DNA to show their specificity to C Las regions only. Field Samples C ollection and C omposition collec ted 173 samples in ten counties (Table 3 7 ), which were analyzed with primers to amplify two loci that contain VNTR. The number of samples per counties varies from 6 to 40 where the most common citrus hosts sampled were sweet oranges and grapefruit. To d etermine relationship between symptoms and repeats a number of samples were collected in the field and after evaluation of symptoms in the greenhouse after infection of those grafted plants, PCR and sequences were accomplished to determine that relationshi p between symptoms and number of repeats.

PAGE 33

33 Table 2 1 Sequences of marker primers used for characterization of Citrus tristeza virus genotypes from the Dominican Republic Target Position 5' 3 Size Reference CP 16,152 (+) atg gac g ac gaa aca aag aaa ttg 671 21 16,823 ( ) tca acg tgt gtt gaa ttt ccc a T30 2 792 (+) tac ggc ttg gtg ctc tga ggc c 843 Hilf Unpub? 1,635 ( ) a cgc ctg cga acc gcc gac T30 K17 4848 (+) gtt gtc gcg cct aaa gtt cgg ca 409 21 5256 ( ) tat gac atc aaa aat agc tga a T30POL 10,772 (+) gat gct agc gat ggt caa at 696 21 11,467 ( ) ctc agc tcg ctt tct cac at VT 3 2,246 (+) ca g gtg aga att ctc cat cgt 824 Hilf Unpub? 3,070 ( ) aga atc agg caa acg ccc VT K17 4824 (+) gtt gtc gcg ctt taa gtt cgg ta 409 21 5232 ( ) tac gac gtt aaa aat ggc tga a VT POL 10,745 (+) gac gct agc gat ggt caa gc 695 21 11,440 ( ) ctc ggc tcg ctt tct tac gt T36 3 2,323 (+) ctt ctt tta act cga caa gga 739 Hilf Unpub? 3,062 ( ) tgt gat tat cag gga gtt a T36 K17 4865 (+) caa cac atc aaa aat agc tag t 409 21 5273 ( ) gtt ttc tcg ttt gaa gcg gaa a T36POL 10,79 1 (+) tga cgc taa cga cga taa cg 717 21 11,508 ( ) acc ctc ggc ttg ttt tct tat g T3 2 962 (+) gtg ttg agg tcc cga gcg tc 652 Hilf Unpub? 1,614 ( ) gat cga gac ggt tta gag atg T3 K17 4871 (+) gtt atc acg cct aaa gtt tgg t 409 21 5279 ( ) cat gac atc gaa gat agc cga a T3 5 6133 (+) tcc ttt gcc atc aat tgt atc ac 397 Hilf Unpub? 6530 ( ) cac gtg gaa agt tcc acg acg BR NZ 1404 (+) aca gtg ggt gca ttt aag gct tat 1731 This study 3135 ( ) gag cat tac ttg ctg gtt ctc act RB K17 4847 (+) gtt ttc acg tct gaa acg aaa g 409 This study 5256 ( ) cca aca cat caa aaa tag cct g RB NZ 7424 (+) ggt tcg agg tca tgc tag gg 721 This study 8145 ( ) gaa cca acc cat cat tgc ag T68 1 1771 (+) cga gta taa acc gga agt tcc 743 This study 2415 ( ) aca gac gac cca aaa cta tgc T68K17 4840 (+) cct ttt cgc agc taa agt gca gc 571 This study 5411 ( ) ctt atc aaa ggc ttt agc act t T68 2 5716 (+) gga gtt aac tag tgg tgg tag 1304 This study 7020 ( ) ctt cat act aaa cgc gtt acg aPrimers were generated against an alignm ent of extant CTV genomes (3, 53, 56, 68, 85 ). Genomic positions of T68 and T3 markers were derived from pairwise alignment with the T36 g enomic sequence as described (56 ; M. E. Hilf, personal communication).

PAGE 34

34 Table 2 2. List primers sequences used to amplified four loci in the CLas genome with VNTR Motif Sequence Genome position 3' Reference A AGACACA 354493 354527 (+) gacatttcaacggtatcgac Chen et al. (2010) ( ) gcgacataatctcactcctt (+) ttgaaggacgaaaccgatgg this paper ( ) cctgtacgaggtttgatcag B TACAGAA 255591 255646 (+) gaagtagctctgcaatatctga Katoh et al. (2011) ( ) ggtgaattaggatggaaatgc (+) cgcctacaggaatttcgttacg Is lam et al. (2012) ( ) tctcatcttgttgcttcgtttatcc C CAGT 537729 537760 (+) ttgataatatagaaagaggcgaagc Katoh et al. (2011) ( ) tccatacccaaaagaaaagca D TTTG 655277 655332 (+) gactgatggcaaaagatgg Katoh et al. (2011) ( ) agacacgccaaacaaggaat a All numerical subscripts represent the number of time this motif appears in the CLas genome, based in populations of HLB in the Caribbean and Central America countries.

PAGE 35

35 CHAPTER 3 RESULTS Incidence of CTV in Citrus Producing R egions of the Dominican Republic In order to analyze the dynamics of CTV populations in the Dominican Republic, we first examined what proportion of samples obtained from different citrus plantations throughout the country contained the virus. Tissue samples were collected in the citrus producing areas in the ei ght agricultural regions (Fig ure 3 1 ). A total of 192 samples were collected from trees with various degrees of symptoms, ranging from none or very mild symptoms to more advance d stages of stem pitting The samples were analyze d by RT PCR using primers derived from a r egion within the CP ORF (Table 2 1 ) that is highly conserved in different CTV genotypes, and thus, these primers are expected to amplify from a wide range of CTV genotypes. CTV was detected in 163/192 (84.9%) sampl es from all eig ht agricultural regions (Table 3 1 ). The incidence of virus appeared to be high in all those regions, ranging from 80 to 100% in most areas (Table 3 1 ). CTV was detected in 163/192 (84.9%) samples from all eig ht agricultural regions (Table 3 1) Distribution of CTV Genotypes in Different Citrus G rowing R egions in the Dominican Republic Earlier genetic marker studies of CTV populations in the Dominican Republic detected three distinct genotypes : T30, VT, and T3 (39 57 ). The T30 genotype was widely spread in six of eight citrus growing regions, whereas the VT and T3 were detected only in the Central and East regions in a low proportion of trees ( 39 ; Fig. 3 1 A ). To assess possible changes in the structure of CTV populations in the Dominican Re public, we conducted RT PCR analyses of collected isolates using genotype specific marker primers that selectively amplify sequences of particular genotypes of the virus and thus, allow for discriminat ing between different genotypes and identify ing individ ual

PAGE 36

36 compo nents of virus isolates (Table 2 1 ). The p resence of a genotype in the isolate was determined based on the similarity of the marker pattern to the marker profiles of the reference isolates of the T30, VT, T36, T3, RB, and T68 genotypes ( Tabl e 3 2 ) and further confirmed by following sequencing analysis. Analysis of 163 CTV isolates collected from different citrus growing regions demonstrated wide distribution of the T30 genotype, which correlated with the previous observations. This genotype was d etected in 68.7 % (112/163) of CTV positive samples from seven of the eight regions, with new findings in the Southwes t and Northeast regions (Table 3 1 and Fig ure 3 1 B ). The T30 genotype was not detected in samples from the North region, where it was det ected in the original study This result may likely be due to a small number of samples collected in that area. Remarkably, in addition to previous widely distributed T30 genotype the VT genotype has spread to all of the citrus producing areas and was th e most prevalent genotype of CTV throughout the country, detected in 95.7% (156/163) of the CTV positive samples (Table 3 1 and Fig ure 3 1 B ). The occurrence of the VT genotype appeared to be similar in different regions of the country, ranging between 80 100%, which indicated highly effective spread of this genotype from the initial introduction site (Table 3 1 ). Among the VT containing samples, 26.9% (42/156) was infected singly by this genotype, whereas most of the samples were found to be co infected w ith T30: 56.4% (88/156) of those samples had only the VT and T30 genotypes and 10.9% (17/156) contained those genotypes along with some additional genotypes of the virus (Table 3 3 ). Interestingly, the T3 genotype, which has also been found in the two main citrus growing regions (Central and East regions) during the previous surveys, did not appear to spread as well as the

PAGE 37

37 above genotype. The T3 was detected only in the Central, South and Southwest regions in a low proportion (8.6% or 14/163) of samples in mixed infections with either T30 (1/14), VT (6/14) or both T30 and VT (7/14) genotypes (Table 3 1 and Table 3 3 and Fig ure 3 1 ). Further examination of samples revealed the presence of two genotypes RB and T3 that have not been reported in the Dominican Republic (Table 3 1). The RB and T36 genotypes were each present in four of the eight regions at a low incidence (4.9%) and were found in mixed infections with the VT and T30 genotypes (Table 3 1 and Table 3 3 and Fig ure 3 1B). Phylogenetic and B ioinforma tic A nalysis Neighbor joining analysis indicated that sequences amplified with primers specific to the K17 region within ORF 1a of the indicated genotype (Table 2 1 ) clustered with representative and the type sequences of that genotype (Fig. 3 2 ). These r esults corroborated that the marker data and confirmed the presence of the T36 and RB genotypes as well as the previously reported the VT, T3, and T30 genotypes. Results of BLASTn analysis of the DR 65 RB (JQ281780) and DR 67 RB (JQ281781) K17 sequences s howed approximately 98% identity to sequences of recognized RB isolate NZRB M12 fro m New Zealand (FJ525431) (Fig. 3 2 ). The DR 48 T36 (JQ281787) and DR 80 T36 (JQ281788) K17 sequences had 96 .6 100% identity with the type T36 isolate from Florida (U16304). The DR 26 VT (JQ281782) and DR 52 VT (JQ281783) K17 sequences were 98% identical to corresponding sequence of the Israeli VT isolate (U56902). The sequence identities of the DR 13 T3 (JQ281785) and DR 32 T3 (JQ281786) K17 regions ranged between 95.2 99. 6% to T3 isolates, with the DR 13 T3 shown 99.6% similarity to Florida T3 sequence (AY756314). The DR 35 T30

PAGE 38

38 (JQ281784) was identical (100%) to the type T30 isolate from Florida (AF260651). Forty six clones corresponding to different PCR products obtained with specific primers for those already known CTV strains that amplify a fragment of 409 bp in the K17 regions in the 1a ORF of the CTV genome. K 17 sequences were used to analyze neutrality test and rate of evolution, polymorphism and recombination event s between those strains (Table 3 4 ). From those sequences seven correspond ed to RB, fifteen to VT, seven to T30, eight to T36 and 9 to T3. Based o n the neutrality test T30 strain has the higher nucleotide diversity, follow ed by T3 and VT. Howe ver the RB and T36 which appear to be the most distant group compares with the others four CTV strains have very low nucleotide diversity. B the null model can be rejected, due to all isolates RB, T36, VT and T30 have more than twice the deviation standard away from cero except for T3 isolate which has a positive value of 1.6218 and it looks like is under a natural selection phenomenon or genetic bottleneck. It can explain why this strain, even when it was fou nd in 1997 at the same time a s VT, is restricted to two different regions in the DR (Table 3 4 ). The AMOVA results showed significant differences among population with a 93.08 percentage of variation followed for 6.93 percentage of variation between populations. The index of fixation was 93.02 percent which means a high level of variation among four identified populations (Table 3 5 ). At the same time clustering groups by using Structure showed that four major groups or cluster (K=4) were found (Figure 3 4 ) ; however based on the genet ic information CTV can be grouped into six well defined strains. Since T36 and RB group s are very close to each other, most likely

PAGE 39

39 they formed a single group ; both of them are the most distant groups when compare d with the rest of CTV strains CTV G enot yp es in Different Citrus V arieties Samples collected during our study were mainly sweet orange, Persian lime and Mexican lime, which allowed us to compare the incidence of each CTV genotype among these economically important citrus varieties. The VT genotyp e was the most prevalent in all of the varieties tested and was found with a similar incidence of 92.2 100%, followed by the T30 genotype, which was detected in 82.8, 63.1 and 66.7% of CTV positive samples from sweet orange, Persian lime, and Mexican lime, respectively. The frequencies of the RB and the T36 genotypes varied more significantly between citrus varieties (Figure 3 3) The presence of the RB genotype ranged from 1.0% in virus samples from Persian lime to 8.6% in sweet orange and 20% in Mexica n lime virus containing samples. The T36 genotype was detected in 5.8% of Persian lime, 2.9% of sweet orange, and 6.7% of Mexican lime CTV positive samples. The T3 genotype was found only in Persian lime (in 13.6% of virus positive samples). Characteriza tion of Florida HLB Population Using F our L oci C ontaining VNTR Previous analysis of the locus containing AGACACA tandem repeats in samples obtained from field citrus trees in F lorida conducted by Chen et al. (14) suggested that two di fferent populations o f HLB may have been introduced in the state. In our work we extended examination of Florida HLB populations, since it was not known that the composition of both populations in the next three loci with VNTR polymorphisms. We collected 18 samples in differe nt places in Polk county including three samples from the greenhouse and 15 from the field. PCR and sequencing were performed to evaluate the composition of each sample in the four loci with VNTR. Seven samples were found

PAGE 40

40 to contain repetitions of the re peat A (AGACACA) 4, 5 and 6 times this motif, 5 of the seven samples have 5 repetitions. Based in 11 sequences coming from the 18 samples, the same motif w as found 12, 13, and 14 times, only one sequences has 12 and one for 14, the rest of sequences have 13 times the motif The next repeat to be analyzed was repeat B (TACAGAA) for those seven samples that contains five times the repeat A, in these cases they have 9 and 10 times and the remaining eleven have 15 and 16 times. The following analysis was d one for the repeat C (CAGT) and we found 8 times this motif for the seven samples and 9 times in the eleven remaining samples, not variation in term s of the number of repetitions was found in this particular repeat Finally, the repeat D (TTTG) was found to be 14 times in the seven samples and only 8 times in the eleven samples. Based on the number of repetitions for motif A, which was the motif used to differentiate the Florida HLB populations, hereafter we refer IG5 and IG13 for both groups, since, the y most likely belong to different group s or populations. Based on these differences we investigate d the relationship between both group and symptom expression. Field samples with typical blotchy mottle, zinc deficie ncies and sectored yellow shoot s ymptom s were examined by using PCR analysis and sequencing. Simultaneously, we examined symptom development in the greenhouse for those graft infected plants, but did not notice symptoms differences in number of repeats and symptoms expression. Lack of corre lat ion of symptoms with isolate type was con firmed with evaluation of other trees from which samples were collected for studies described below. Validation of VNTR Based Approach for HLB Population D ifferentiation The data presented above along with the obse rvations provided in earlier publications suggest that the analysis on VNTR containing loci can be applied to

PAGE 41

41 examine polymorphism of the HLB pathogen populations. Our next goal was to further validate the usefulness of this approach and assess how stable these repeats upon multiplication of the pathogen in a host over time or upon its passaging from a host to a host. In order to evaluate the stability of tandem repeats, we assessed whether the number of repeats changes upon sequential passaging of the pat hogen into new plant and psyllid hosts. The sequence composition for each of the four loci in C Las genome was analyzed using samples collected from the citrus plants that served as a source of inoculum for further propagation of the pathogen and compared with that in receptor plants that were graft inoculated using tissue obtained from the source plants. Two citrus varieties, DG and a mandarin, were used as donor or inoculum source plants in this experiment along with plants of several additional citrus v arieties that were grafted and used as receptor plants (Table 3 6 ). Similarly, the sequence composition of the four loci was analyzed in samples from psyllids that became infected after feeding on the source plants. In all cases, when isolates IG5 or IG13 were used as inoculum sources, a number of repeats characteristic for a corresponding isolate group was found in all the four loci in samples from the grafted receptors plants or psyllids after the pathogen acquisition (Table 3 6, Table 3 7 and Table 3 8 ) variation in the number of repeats of Motifs A and B was seen in samples from both source and receptor plants, while no variation in the number of tandem repeats of Motifs C and D was noted. For the IG5 group, Motifs A and B were present in most samples 5 and 9 times, respectively. A s mall proportion of samples contained Motif A repeated 4 or 6 ti mes and Motif B 10 times (Table 3 6 ). Most samples of the IG13 type isolates showed the presence of these motifs 13 or 16 times, respectively, with a minor

PAGE 42

42 proportion of samples having Motif A repeated 12, 15 or 17 times and Mo tif B 14 or 15 times (Tables 3 7 and Table 3 8 ). The data discussed above allowed us to assess whether there is a certain correlation between a particular i solate group and citrus hosts. Evaluation of samples obtained from three citrus genotypes, Duncan grapefruit, Madam Vinous sweet orange, and C. macrophylla demonstrated that both isolate groups could inhabit these varieties. Among 5 DG plants used, IG5 is olate was detected in two and IG13 in 3 plants. Two MV sweet orange plants contained IG5 type and 3 IG13. Three C. macrophylla plants were infected with IG5 and one with IG13. This observation was correlated with the results of the analysis conducted with many more samples in this work as described below. In addition to evaluation the stability of tandem repeats upon passage through citrus and psyllid hosts, we were also interested in assessing whether a number of repeats could significantly change while th e pathogen is present in a host during an extended period of time. This study was done using a limited number of greenhouse propagated HLB infected plants remained from another experiment that was conducted in 2007 as well as DNA extracts obtained from the se plants in 2007 and stored at 20 C as well as new extracts produced from some of the plants that were still present in the upon the analysis of the four genomic loci of the pathogen among DNA samples obtained at the time points, which had 5 years interval (Table 3 10 ). Therefore, our results suggest that number of tandem repeats in the four loci tested generate d Florida HLB

PAGE 43

43 isolate groups. For each of these isolate groups some minor (plus one/ minus one repeat) variation could be found in the number of tandem repeats located in the two of the four loci tested (Motifs A and B), while other two tandem repeats (Moti fs C and D) remain invariable. Remarkably, the VNTR upon passage the isolates in citrus and psyllid hosts as well as upon multiplication of the pathogen within a host over a period of time. This suggests that VNTR b ased approach represent s a valid methodology for differentiating between different types or isolate groups (could be also referred to as strains) of C Las and provides a good way of analyzing pathogen population in various geographical regions. Distribution of HLB Population in Florida Counties In the following step, we examined the distribution of the two HLB populations among eleven Florida counties. A total of 178 samples that tested HLB positive based on real time PCR (qPCR) amplification using HLB speci fic prim ers described by Li et al. (75 ) were further subjected to a VNTR based analysis using two loci containing AGACACA (Motif A) and TACAGAA (Motif B) tandem repeats. According to our data, the IG5 is widely distributed in all sampled counties, except P olk, Marion, and Alachua counties where IG13 was more prevalent (Table 3 10 ). The presence of IG13, however, was determined in single or mixed infections in all sampled counties except in Hendry county. This suggests that the spread of this isolate group i s increasing with the time, since IG13 was not found during pre vious surveys by Chen et al. (14), and Islam et al. (61) in the counties tested here, except Polk county. This work showed highest incidence of IG13 isolates: 24 out of 40 trees sampled showe d an infection with this isolate in addition to 9 t rees in which IG13 was present in mixed infections with IG5 (Table 3 10 ).

PAGE 44

44 Characterization of HLB P opulations in the Caribbean and Central America Countries HLB was reported in most of the Caribbean and C entral America (CA) countries few years after it was found in Florida. To examine whether pathogen populations in these countries are similar to those found in Florida, we analyzed samples from nine countries in the Caribbean and Central America regions in cluding Mexico. Two loci that contain Motifs A and B were used to evaluate 198 samples collected in those countries. The primer set s used to amplify a sequence containing Motif A generates a 400 bp long fragment when the motif is repeated 5 times and 450 b p long product when the repeat is present 13 times (Figure 3 5 and Figure 3 6 ) Similarly, for Motif B, SSR A primer set amplifies a 300 bp fragment when the repeat appears 9 times and a 350 bp product when repeat s are present 16 times This allows for d ifferentiat ion between the two isolate groups analyzing the amplified PCR products in the agarose gel. All samples tested produced only 400 bp long and 300 bp long products in PCR reactions with the primers specific for Motifs A and B, respectively, sugge sting presence of the IG5 isolate group in these regions. None of the samples generated fragments characteristic to the IG13 group (Table 3 7). Further sequencing of the obtained pro ducts confirmed those findings. Comparison of Florida HLB P opulations with those from Brazil, China and Japan Compared to being a century old disease in South Asia, HLB is relatively new to Americas where it was initially found in Brazil following by the detection in Florida, the Caribbean and Central America. To assess how HLB populations in the latter three regions relate to those present in other areas, we analyzed several additional samples obtained from Brazil, China and Japan and compared with the samples discussed

PAGE 45

45 above. According to our results, there is some similarity between Brazilian isolates and the IG13 isolates found in Florida. Most common numbers of repetitions found in Motifs A, B, C, and D for the IG13 Florida isolates are 13, 16, 9, and 8, respectively. For the Br azilian isolates used here there were 15, 18, 9, and 8 for the same motifs, respectively (Table 3 12 ). The isolates coming from Japan and China tested appear to be very different from isolates in Florida and the Caribbean and Ce ntral America countries (Table 3 11 ). However, we tested a very limited number of samples from the first two regions. Because the HLB disease has been present in those locations for a much longer time, the pathogen could have evolved into multiple distinct lineages, which were not among those we analyzed. Therefore, we cann ot exclude a possibility that types of C Las that are more similar to Florida isolates could exist in those countries, and so, China and/or Japan could be a source of the pathogen that was introduced into the US.

PAGE 46

46 Table 3 1 Occurrence of different genoty pes of Citrus tristeza virus in citrus producing r egions in the Dominican Republic determined by analysis with genotype specific primers Number of Number of CTV Frequency of CTV genotypes C ollected P ositive T30 VT T3 T36 RB Regions samples S amples Central 35 28 75.0 a (21/28) b 100.0 (28/28) 3.6 (1/28) 0.0 (0/28) 7.1 (2/28) East 42 36 86.1 (31/36) 97.2 (35/36) 0.0 (0/36) 2.8 (1/36) 5.6 (2/36) Northeast 30 27 63.0 (17/27) 96.3 (26/27) 0.0 (0/27) 18.5 (5/27) 0.0 (0/27) Southwest 32 29 41.4 (12/ 29) 100.0 (29/29) 41.4 (12/29) 0.0 (0/29) 0.0 (0/29) South 26 20 65.0 (13/20) 80.0 (16/20) 5.0 (1/20) 5.0 (1/20) 15.0 (3/20) Northwest 15 15 100.0 (15/15) 93.3(14/15) 0.0 (0/15) 6.7 (1/15) 6.7 (1/15) North 8 4 0.0 (0/4) 100.0 (4/4) 0.0 (0/4) 0.0 (0/ 4) 0.0 (0/4) Northcentral 4 4 75.0 (3/4) 100.0 (4/4) 0.0 (0/4) 0.0 (0/4) 0.0 (0/4) Total 192 163 68.7 (112/163) 95.7(156/163) 8.6 (14/163) 4.9 (8/163) 4.9 (8/163) a Percentage of CTV positive samples in which a particular virus genotype was detecte d. b Number of samples containing a particular genotype out of a total number of CTV positive samples collected in a region.

PAGE 47

47 Table 3 2 Marker profiles of Citrus tristeza virus genotypes CTV genotype Marker T30 VT T36 T3 RB T68 CP 1 a 1 1 1 1 1 T30 2 1 1 0 0 0 0 T30 K17 1 0 0 0 0 0 T30 POL 1 0 0 0 0 0 VT 3 0 1 0 0 0 0 VT K17 0 1 0 0 0 0 VT POL 0 1 0 1 0 1 T36 3 0 0 1 0 0 0 T36 K17 0 0 1 0 0 0 T36 POL 0 0 1 0 0 0 T3 2 0 0 0 1 0 0 T3 K17 0 0 0 1 0 0 T3 5 0 0 0 1 0 0 RB 1404 0 0 0 0 1 0 RB K17 0 0 0 0 1 0 RB 7424 0 0 0 0 1 0 T68 1771 0 0 0 0 0 1 T68 K17 0 0 0 0 0 1 T68 5716 0 0 0 0 0 1 a 1 indicates marker amplification and 0 indicates no amplification. Marker patterns resulted from RT PCR amplification using RNA extracts from designat ed reference isolates, each representing a particular genotype: T30, T3, T36, T68, and 701 (VT genotype) fr om Florida (3, 3 8, 56 68 Z. Xiong and S. J. Harper, personal communication). The expected marker profile for the RB genotype is presented accor ding to the previous studies (53 S. J. Harper, personal communication).

PAGE 48

48 Table 3 3. Summary of genotype combinations found in the Dominican Republic Region T30 VT T3+T30 T3+T30+VT T3+VT T30+T36 T30+T36+VT T30+T36+VT +RB T30+VT T30+VT+RB T36+VT+RB VT+RB Total No. isolates Central 0 a 7 0 1 0 0 0 0 18 2 0 0 28 East 1 4 0 0 0 0 0 0 29 1 1 0 36 Northeast 1 10 0 0 0 0 5 0 11 0 0 0 27 Southwest 0 11 0 6 6 0 0 0 6 0 0 0 29 South 3 5 1 0 0 0 0 1 8 0 0 2 20 Northwest 0 0 0 0 0 1 0 0 13 1 0 0 15 North 0 4 0 0 0 0 0 0 0 0 0 0 4 Northcentral 0 1 0 0 0 0 0 0 3 0 0 0 4 Total 5 42 1 7 6 1 5 1 88 4 1 2 163 a Number of isolates Table 3 4 Neutrality test, polymorphisms and recombination evens for genotype in the Dominican Republic CTV Strain s Sequ ence s # # h aplotyp e (alleles) S W D Fu & Fu & R m RB 7 2 9 0.0093 3.673 1.5944 1.6866 1.824 0 VT 15 7 21 0.0118 6.458 2.0380 2.2816 2.546 0 T30 7 4 82 0.1052 33.46 1.2716 1.1583 1.311 4 T3 9 4 36 0.0634 13.24 1.6218 1.5062 1.721 0 T36 8 2 1 0.000 91 0.386 1.0548 1.1263 1.203 0 All 46 20 185 0.2119 41.88 0.1225 0.8352 0.570 33 Table 3 5 Analysis Molecular of Variance (AMOVA) using K17 region in the CTV genome. Significant variation were found among populations ( P< 0.001 ) Source of variati on D egree freedom Sum of squares Variance components Percentage of variation P Among populations 4 1502.402 46.51748 Va 93.08 a <0.001 Within populations 36 124.585 3.46070 Vb 6.92 T otal 40 1626.987 49.97818 a Index of fixation

PAGE 49

49 Table 3 6 Anal ysis of VNTR stability upon transmission of the pathogen from Duncan grapefruit containing IG5 isolate Sample No. of Repeats Motif A Motif B Motif C Motif D DG GH a 5 (10/10 e ) 10 (9/10) 8 (5/5) 14 (9/9) 1/(10/9) Psy 1 b 5 (3/6) 9 (6/6) 8 (4/4) 14 (5/5) 4 (3/6) Psy 2 b 5 (2/4) 9 (8/8) 8 (6/6) 14 (4/4) 6 (2/4) DG c 5 (4/6) 9 (6/7) 8 (5/5) 14 (5/5) 6 (2/6) 10 (1/7) MV c 5 (4/5) 9 (7/7) 8 (5/5) 14 (5/5) 6 (1/5) Receptor plants d 5 (5/8) N/A N/A N/ A 6 (3/8) a C Las infected greenhouse grown Duncan grapefruit (DG GH) used as inoculum source for graft or psyllid transmission of the pathogen. b Psyllids that acquired the pathogen after feeding on DG GH plant. c DG and MV plants graft inoculat ed using tissue from the source DG GH. d Receptor plants (DG, MV, Citrus macrophylla Sun Chu Sha and Clementine mandarins, sour orange) that became infected upon psyllid transmission of the bacterium from the source DG. e Number of clones contained a part icular number of repeats out of total clones sequenced Table 3 7 Analysis of VNTR stability upon transmission of the pathogen from field Duncan grapefruit containing IG13 isolate Samples No. of Repeats Motif A Motif B Motif C Motif D DG Field a 13 (9/9 c ) 16 (9/10) 9 (9/9) 8 (9/9) 15 (1/10) DG b 13 (10/10) 16 (8/9) 9 (9/9) 8 (9/9) 17 (1/9) MV b 13 (19/20) 16 (13/13) 9 (10/10) 8 (13/13) 14 (1/20) a C Las infected field grown Duncan grapefruit (DG Field) use d as inoculum source for graft transmission of the pathogen. b DG and MV plants graft inoculated using tissue from the source DG Field. c Number of clones contained a particular number of repeats out of total clones sequenced.

PAGE 50

50 Table 3 8 Analysis of VN TR stability upon transmission of the pathogen from field grown mandarin containing IG13 isolate Sample No. of Repeats Motif A Motif B Motif C Motif D Man Field a 13 (7/8 c ) 16 (8/8) 9 (8/8) 8 (10/10) 12 (1/8) MV b 13 (5/7) 16 (5/6) 9 (5/5) 8 (4/ 4) 14 (1/7) 15 (1/6) 15 (1/7) CM b 13 (3/7) 16 (4/4) 9 (3/3) 8 (3/3) 14 (4/7) DG b 13 (6/6) 16 (4/4) 9 (2/2) 8 (3/3) a C Las infected field grown mandarin (Man Field) used as inoculum source for graft transmission of the pathogen. b MV, Citr us macrophylla (CM), and DG plants graft inoculated using tissue from the source Man Field. c Number of clones contained a particular number of repeats out of total clones sequenced. Table 3 9 Analysis of VNTR stability over a period of five years No. of Repeats Sample DNA extraction date Motif A Motif B Motif C Motif D Cmac1 05/22/07 5 (6/6) 9 (3/4) 8 (4/4) 14 (3/3) 10 (1/4) Cmac2 10/24/07 5 (6/8) 9 (4/4) 8 (4/4) 14 (3/3) 4 (2/8) Cmi 05/15/12 5 (5/5) 9 (2/2) 8 (2/2) N/A a Cmac1 03/15/ 12 5 (8/8) 9 (6/9) 8 (10/10) 14 (6/10) 10 (3/9) a N/A, not assayed

PAGE 51

51 Table 3 10 Distribution of HLB populations in Florida counties Isolate Group County No. of Samples IG5 IG13 IG5+IG13 Polk 40 7 24 9 Indian River 15 13 1 1 Charlotte 1 2 10 0 2 Highland 15 12 3 0 Lake 15 9 1 5 Marion 20 4 16 0 Hardee 15 10 1 4 Hendry 5 5 0 0 St Lucie 6 4 0 2 De Soto 15 12 1 2 Alachua 20 3 17 0 Total 178 89 64 25 Table 3 11 Analysis of HLB populations in the Caribbean and Central America cou ntries and Mexico Country No. of Samples Tested No. of Samples with IG5 isolate No. of Samples with IG13 isolate DR 64 64 0 Costa Rica 21 21 0 Nicaragua 21 21 0 Belize 20 20 0 Honduras 10 10 0 Puerto Rico 13 13 0 Guatemala 20 20 0 Me xico 28 17 11 Cuba 1 1 0 Total 198 187 11

PAGE 52

52 Table 3 1 2 Examination of a few HLB isolates from China, Japan, and Brazil Country Locality Sample Motif A Motif B Motif C Motif D China Guang Dong Si Hui 1 6 25/26 6 7 2 6 26 6 11 3 7 20/2 1 6 10/11 Guang Xi Yang Shou 1 6 14 7 7 2 6 26 7 10 3 6 24/26 7 10 Guang Xi Gong Cheng 1 6 26 8 8 2 8 26/27 7 12 3 9 20/21 7 13 Japan Japan 1 12 26 7 9 2 11 11 7 7 3 8 14 8 8 Brazil Sao Paulo 1 15 18 8 9 2 15 18 8 9

PAGE 53

53 F i gure 3 1 Distribution of CTV genotypes in eight citrus growing regions in the D ominican Republic. A, Virus distribution according to the earlier study conducted by Garnsey et al. (40) ; B, Current distribution of different genotypes of CTV based on the dat a presented in this work. Different virus genotypes are shown by symbols as indicated on the figure Km Km VT T3 RB T36 T30 VT T3 T30 km km

PAGE 54

54 Figure 3 2 Phylogenetic relationships between sequences of CTV isolates from the Dominican Republic and other CTV sequences from around the globe. Neighbor joining analysis was applied to the K17 regions of the ORF 1a of selected CTV sequences from the Dominican Republic. Bootstrap values from 1000 replicates are shown

PAGE 55

55 Figure 3 3. Distribution pattern of the CTV strains in different citrus hos t. (A), distribution of CTV Strains in Persian lime, (B) strains distributions in sweet oranges, (C) strains distribution in Mexican lime. (D) Strains distribution in others citrus host such grapefruit, mandarin etc. 0 50 100 150 200 Total samples collected Total positive T30 VT T3 T36 RB NoCTV 0 10 20 30 40 50 60 Total samples collected Total positive T30 VT T3 T36 RB NoCTV 0 5 10 15 20 25 30 Total samples collected Total positive T30 VT T3 T36 RB NoCTV 0 5 10 15 20 25 Total samples collected Total positive T30 VT T3 T36 RB NoCTV

PAGE 56

56 Figu re 3 4 The genetic structur e of Citrus tristeza virus using K17 genome region, there were clustered in four goups or clusters (K=4). A, T36 and RB strains, B, VT group, C, T3 cluster and D, T 30 cluster. Figure 3 5 Agarose gel showing the typical pattern of samples belonging to IG5. M, DNA Markers; C No DNA negative control; IG5, positive control for IG5 isolates group coming from a greenhouse infected plant; IG13, positive control for IG13 group coming from field HLB infected plant. Lanes 1 and 2: samples from Belize; Lane s 3 and 4: samples from the Dominican Republic; Lanes 5 and 6: samples from Costa Ric; Lanes 7 and 8: samples from Honduras; and Lane 9: samples from Puerto Rico.

PAGE 57

57 Figure 3 6 Agarose gel showing the typical pattern of samples collected in Lake count y Florida. M, DNA Markers; C No DNA negative control; IG5, positive control for IG5 coming from greenhouse infected plant; IG13, positive control for IG13 group coming from field HLB infected plant. Lanes 1, 4, 5, 7, and 9: samples belonging to IG5 grou p. Lanes 2, 3 and 6: samples mixed infected with IG5 and IG13. Lane 9: a sample of the IG 13 group.

PAGE 58

58 CHAPTER 4 DISCUSSION The results of this study provide an example of rapid and significant changes in the distribution and composition of virus popula tions in a defined geographical region, characterized by the increased dissemination of the existing isolates, occurrence of new distinctly different genotypes of the virus, and development of complex virus populations composed of mixtures of different gen otypes. For the last ten years, the VT isolates of CTV that were previously restricted to two areas have now spread from initial foci to all citrus growing plantations. The level of infection by those isolates tremendously increased, reaching nearly 100% for most citrus varieties in different agricultural regions, which even exceeded the incidence of the benign T30 isolates present in the Dominican Republic for much longer. At the same time the isolates of the T3 genotype that were discovered earlier in the same two locations as the VT isolates invaded only two other regions, South and Southwest of the country, showing relatively low rates of spread and were associated particularly with Persian lime plantings. In addition to the previously reported virus genotypes, two new virus genotypes, the T36 and RB, were detected. Both genotypes were found in a very small proportion of different varieties of citrus suggesting that introduction of those isolates into commercial plantings could possibly be a more rece nt event. Alternatively, the genotypes could be present for a longer time. In particular, the sequence of the RB genotype has b een determined only recently (52, 53 ), and thus primers for the specific detection of this genotype were not available earlier. This makes it difficult to estimate how long the RB genotype has been in the Dominican Republic. For the T36, tests with the T36 genotype specific primers were conducted earlier, yet did not yield positive results ( 39, 40 57 ), which may suggest

PAGE 59

59 that eith er the T36 was present earlier at levels below possible detection or it was introduced in the region more recently. Now these genotypes are beginning to spread into different areas. Remarkably, the VT isolates of CTV were able to move in and spread in com mercial citrus despite the fact that prior to their introduction into the country most citrus trees have been already infected with mild T30 isolates of the virus ( 39 ). The pre existing isolates of the T30 genotype apparently did not provide protection ag ainst the isolates of the VT genotype. The same was true for the T3 as well as for newly found T36 and RB genotypes. These viruses were able to superinfect trees that appeared to be infected with other genotypes of the virus prior to their invasion. Mult iple infections of trees resulted in formation of complex virus populations composed of various combinations of different genotypes. These observations very well correlate with the recent findings of our study on CTV cross protection mechanism in which we demonstrated that CTV isolates that have established a systemic infection in citrus trees prevent superinfection by an isolate of the same genotype, but not by isolates from other genotype groups of the virus (38 ). Thus, widely spread isolates of the T30 genotype could not prevent dissemination of the isolates of the VT and T3 genotypes that were introduced in the Dominican Republic later as well as pre existing infection with isolates of all these genotypes could not exclude further invasion of isolates of the two ot her genotypes, the T36 and RB. Dissemination of severe isolates of CTV is an important concern for the citrus industry of the Dominican Republic, which is anticipating a significant reduction in its profitability. Taking into consideration hi gh occurrence of severe isolates in the

PAGE 60

60 commercial citrus and the presence of the brown citrus aphid that could efficiently vector the virus from a tree to a tree, it would be critical to develop measures to prevent new plantings from infection with those isolates. P resent ly the only means to protect commercial citrus varieties from severe CTV stem pitting is cross protection with appropriate mild CTV isolates. Development of an effective cross protection system against aggressive isolates of CTV in the D ominican Republic could provide a means to mitigate their impact on citrus production. Selection of mild protecting isolates has enabled the efficient control of stem pitting disease of sweet oranges and limes in Brazil and Peru (9 1 8) and grapefruit in Australia and South Africa ( 19 135 ). Yet, in the past finding protecting isolates has been empirical, and in many other cases mild CTV isolates failed to protect or provided only limited short term prote ction against severe dis ease (109 ). The results of our recent research on CTV cross protection discussed above make finding protecting isolates relatively straightforward. Based on understanding that sustained protection against a severe isolate of a particular CTV genotype (strain) can be achieved only by using mild isolates of the same genotype ( 38 ), the first objective for development an effective cross protection system is to identify the genotype of the severe isolate that needs to be controlled. Then a mild isolate of that same genotype needs to be found. The results of the research presented here provide useful information for the first objective. It seems clear that isolates of the VT genotype widely distributed throughout the country is the cause of the economically damaging stem pitting seen i n citrus groves all over the Dominican Republic. Additionally, isolates of the T3 genotype could be responsible for the stem pitting symptoms in Persian lime plantings. Both genotypes have been known to be

PAGE 61

61 associated with this disease of citrus in differ ent parts of the world ( 39 57 ). Identification of mild asymptomatic isolates of these genotypes would be a sound starting point for a program that tests the protective capabilities of these isolates. Therefore, we feel that data of this study provide th e information needed to develop a management strategy for stem pitting disease caused by CTV, which would benefit directly the industry in the Dominican Republic, but which also would be an effective demonstration of how information derived from basic mole cular genetics research on interactions of different virus genotypes can be used to develop an effective management program. After evaluation of seven loci that contains VNTR in the C Las genome, four of them have shown to be stable since they were always f ound in all analyzed samples, however three of the seven loci evaluated were inconsistently found, it means some time repeats are found sometime they are not, and the number of time were similarly inconsistently. After passages through citrus host and psy llids we did not find significant differences based o n host and always the same patter n was found. However polymorphisms was found basically in two loci for AGACACA motif in the IG5 the number of repeats were consistently found going up to 6 or going down to 4 with a repeat diffe rences. Since we did analysis on samples which the DNA was extracted in 2007 and compared with 2012 extraction and those samples are coming from the same sources with around five years differences between them, and they were show ing the patter n similar to plants grafted and evaluated ten to 18 months after to be infected with HLB. No differences in this patter n were found for each HLB Florida group IG5 and IG13. Based on the analysis of four loci Florida HLB populations belong t o two different

PAGE 62

62 groups, which have different distribution in Florida citrus farms. In 2010 Chen et al. (14) and 2012 Islam et al. (61) found the IG13 in four and three different Florida counties. However the number of positive samples in all counties samp led is a clear indication of the spread of the IG5 genotype. S ince psyllids populations can increase basically in those abandoned citrus orcha rds they could be a good source of new inoculum the C Las bacterium. However it has been found in all previous su rvey that indicate that IG5 genotype is the most prevalent population in Florida, our results indicate that from Polk county to the north the IG13 is most prevalent than IG5, especially in Marion and Alachua counties. It may be a clear indication that at the moment of the introduction of IG 13 in the state, the IG 5 has not been reached at least Polk county where we found the greastest level of presence of IG13 After HLB was report ed in Brazil and Florida a couple of years later the disease was reported in most Caribbe an and Central America counties. A ccording to our data the same or similar phenomenon has occurred in the distribution in all of those countries, since there is only one type (IG5) of genotype of the bacterium s pread in all Caribbean and CA. In other hand, two of those four Motifs A and B have shown a high level of polymorphism, since the study of microsatellite in other species especially in human has shown some correlation between the number of repeats and severity of some diseases, it will be an interested point to elucidate if there is certain differences level in the severity in those populations found in Florida. Since HLB has been found in other places in USA, it remains unknown, if these populations correspond to same found in Florida and which one of them could the most spread into the country.

PAGE 63

63 LIST OF REFERENCES 1. Abud, A. J. 1992. fido vector de la Tristeza de los Ctricos en Repblica Dominicana. Naturalista Postal. Herbario Universidad Aut noma de Santo Domingo, (UASD). NP 2/92. 2. Agranovsky, A. A. 1996. Principles of molecular organization, expression, and evolution of closteroviruses: over the barriers. Adv. Virus Res. 47: 58 119. 3. Albiach Mart, M. R., Mawassi, M., Gowda, S., Satyanayanan a, T., Hilf, M. E., Shanker, S., Almira, E. C., Vives, M. C., Lpez, C., Guerri, J., Flores, R., Moreno, P., Garnsey, S. M., and Dawson, W. O. 2000. Sequences of citrus tristeza virus separated in time and space are essentially identical. J. Virol. 74: 685 6 6865. 4. Amos, W., Sawcer, S. J., Feakes, R. W., and Rubinsztein, D. C. 1996 Microsatellites show mutational bias and heterozygote instability.Nature Genetics 13:390 391. 5. Bar Joseph, M., Che, X., Mawassi, M., Gowda, G., Satyanarayana, T., Aylln, M. A., Albiach Mart, M. R., Garnsey, S. M., and Dawson, W. O. 2002. The continuous challenge of citrus tristeza virus molecular research. Pages 1 7 in: Proc. 15 th Conf. Int. Organ. Citrus Virol. J. V. N. Duran Vila, R. G. Milne, and J. V. da Graa eds. Internat ional Organization of Citrus Virologists, University of California, Riverside, CA. 6. Bar Joseph, M., Garnsey, S. M., and Gonsalves, D. 1979. The closteroviruses: a distinct group of elongated plant viruses. Adv. Virus. Res. 25: 93 168. 7. Bar Joseph, M., Mar cus, R., and Lee. R. F. 1989. The continuous challenge of citrus tristeza virus control. Annu. Rev. Phytopathol. 27, 291 316 8. Bastianel, C., Garnier Semancik, M., Renaudin, J., Bov, J.M., Eveillard, S. 2005. Appl. Environ. Microbiol. 71: 6473 6478. 9. Bederski, K., Roistacher, C. N., and Mller, G. W. 2005. Cross protection against the severe citrus tristeza virus: Stem pitting in Peru. Pages 117 126 in: P roc. 16 th Conf. Int. Organ. Citrus Virol. M. E. Hilf, N. Duran Vila, and M. A. Rocha Pea, eds. International Organization of Citrus Virologists, University of California, Riverside, CA. 10. Belkum, A. V. 1999. Short sequence repeats in microbial pathogenesi s and evolution. Cellular and Molecular Life Sciences 56:729 734. 11. Bove, J. M. 2006. Huanglongbing: a destructive, newly emerging, century old disease of citrus. J. Plant Pathol. 88: 7 37.

PAGE 64

64 12. Borbn, J. C., Abud, A. J., Millan, P. J., Asitico, J., and Abre u, N. 1992. Presencia de la Tristeza de los Ctricos y Toxoptera citricidus (Kilkaldy) en la Repblica Dominicana. Pages 95 101 in: Proc. Workshop on Citrus Tristeza Virus and Toxoptera citricida in Central America: Development of Management Strategies and Use of Biotechnology for Control. R. Lastra, R. Lee, M. Rocha Pena, C. Niblett, F. Ochoa, S. Garnsey, and R. Yokomi (eds.) Maracay, Venezuela, Sep. 14 19, 1992. 13. Brown, S.E., Oberheim, A. P., Barrett, A., and McLaughlin, W. A. 2011. First Report of Can didatus Cleome rutidosperma, Pisonia aculeate and Trichostigma actandrum in Jamaica New Disease Report 24 25. http://dx.doi.org/10.5197/j.2044 0588.2011.024.025 14. Chen, J., Deng, X., Sun, X., Jones, D, Irey, M., and Civerolo, E. 2010. Guangdong Candidatus genomic locus with short tandem repeats. Phytopathology 100 (6):567 572. 15. Coil, D. A., Vandersmissen, L., Ginevra, C ., Jarraud, S., Lammertyn, E., and Ann, J. 2008. Intragenic tandem repeat variation between Legionella pneumophila Strains. BMC Microbiology 8: 218. 16. Coletta Filho, H. D., Targon, M. L., Takita, M. A., De Negri, J. D., Pompeu, J. J., and Machado M.A. 2004 Candidatus Plant Disease 88: 1382. 17. Coletta Filho, H. D., Takita, M. A., Alves de Souza, A., Aguilar Vildoso, C. I., and Machado, M. A. 2001. Differentiation of Strai ns of Xylella fastidiosa by a Variable Number of Tandem Repeat Analysis. Applied and Environmental Microbiology Vol. 67, No. 9 p. 4091 4095. 18. Costa, A. S., and Mller, G. W. 1980. Tristeza control by cross protection; a U. S. Brazil cooperative success. Plant Dis. 64:538 541. 19. Cox, J. E., Fraser, L. R., and Broadbent, P. 1976. Grapefruit stem pitting field protection by mild strains. Pages 64 70 in: Proc. 7th Conf. Int. Organ. Citrus Virol. E. C. Calavan, ed. International Organization of Citrus Virolo gists, University of California, Riverside, CA. 20. da Graa, J.V. 1991. Citrus greening disease. Annu. Rev. Phytopathol. 29: 109 135. 21. da Graa, J. V., and Korsten, L. 2004. Citrus huanglongbing: Review, present status and future strategies. Pages 229 245 i n: Diseases of Fruits and Vegetables Vol. I (S. A. M. H. Naqvi, ed.). Kluwer Acad. Press, Dordrecht

PAGE 65

65 22. Delgado, J. Evaluacin los sistemas de vigilancia epidemiolgica en campo y de diagnstico de laboratorio del HLB en los pases de OIRSA. 2012. Informe Fin al de Consultora TCP/RLA/3311 FAO. 60 pp 23. Denoeud, F., and Vergnaud, G: 2004. Identification of polymorphic tandem repeats by direct comparison of genome sequence from different bacterial strains: a web based resource. BMC Bioinformatics 5:4. 24. Di, R. A., Donnelly, P., Toomajian, C., Sisk, B., Hill, A., Petzl Erle, M. L., Haines, G. H., and Barch, D. H. 1998. Heterogeneity of microsatellite mutations within and between loci, and implications for human demographic histories. Genetics 148:1269 1284 25. Di, R. A ., Peterson, A. C., Garza, J. C., Valdes, A. M., Slatkin, M., and Freimer, N. B. 1994. Mutational processes of simple sequence repeat loci in human populations. Proceeding of National Academy of Sciences 91:3166 3170. 26. Dib, C., Faure, S., Fizames, C., Sams on, D., Drouot, N., Vignal, A., Millasseau, P., Marc, S., Hazan, J., and Seboun, E. 1996. A comprehensive genetic map of the human genome based on 5, 264 microsatellites. Nature, 380: 152 154. 27. Dolja, V. V, Karasev, A. V., and Koonin, E. V. 1994. Molecul ar biology and evolution of closteroviruses: sophisticated build up of large RNA genomes. Annu. Rev. Phytopathol. 32: 261 285. 28. Dolja, V. V., Kreuze, J. F., and Valkonen, J. P. T. 2006. Comparative and functional genomics of closteroviruses. Virus Res. 1 17: 38 51. 29. Duan, Y., Zhou, L., Hall, D. G., Li, W., Doddapaneni, H., Lin, H., Liu, L., Vahling, C. M., Gabriel, D. W., Williams, K. P., Dickerman, A., Sun, Y., and Gottwald, T. 2009. Candidatus Microbe Interact. 22:1011 1020. 30. Ellegren, H. 2004. Microsatellites: simple sequences with complex evolution. Nature Review, 5: 435 445. 31. Etienne, J., Abud, A. J., Reyes M. Y., and Daz, F. 1992. Toxoptera citricida (Homoptera Aphididae) en la Repblica Dominicana: Una amenaza para las plantaciones de ctricos. XXVIII Reunin Anual de la Sociedad Caribea de Cultivos Alimenticios. Santo Domingo, Repblica Dominicana, Agosto 9 15, 1992.

PAGE 66

66 32. Exco ffier, L., Smouse, P., and Quattro J. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131: 479 491. 33. Excoffier, L., and Schneider S. 2005 Arlequin v er 3.0: an integrated software package for population genetics data analysis. Evol Bioinform Online 1: 47 50. 34. Fan, J., Chen, C., Brlansky, R. H., Gmitter Jr, F. G., and Li, Z. G. 2010. Changes in carbohydrate metabolism in Citrus sinensis Candidatus Liberibacter 1043. 35. Field, D., and Wills, C. 1996. Abundant microsatellite polymorphism in Saccharomyces cerevisiae and the different distributions of microsatellites in eight prokaryotes and S. cerevisiae re sult from strong mutation pressures and a variety of selective forces. Proc. Natl. Acad. Sci. USA Vol. 95, pp. 1647 1652, February 1998 36. Folimonova, S. Y., and Achor, D. S. 2010. Early events of citrus greening (Huanglongbing) disease development at the ul trastructural level. Phytopathology 100:949 958. 37. Folimonova, S. Y., Robertson, C. J., Garnsey, S. M., Gowd a, S., and Dawson, W. O. 2009. Examination of the responses of different genotypes of citrus to huanglongbing (citrus greening) under different cond itions. Phytopathology 99:1346 1354. 38. Folimonova, S. Y., Robertson, C. J., Shilts, T., Folimonov, A. S., Hilf, M. E., Garnsey, S. M., and Dawson, W. O. 2010. Infection with strains of citrus tristeza virus does not exclude superinfection by other strains o f the virus. J. Virol 84:1314 1325. 39. Garnsey, S. M., Gottwald, T. R., and Borbn. J. C. 1996. Rapid dissemination of mild isolates of citrus tristeza virus following introduction of Toxoptera citricida in the Dominican Republic. Pages 92 103 in: Proc. 13 th Conf. Int. Organ. Citrus Virol. J. V. da Graa, P. Moreno, and R. K. Yokomi, eds. International Organization of Citrus Virologists, University of California, Riverside, CA. 40. Garnsey, S. M., Gottwald, T. R., Hilf, M. E., Matos L., and Borbn, J. C. 2000 Emergence and spread of severe strains of citrus tristeza virus in the Dominican Republic. Pages 57 68 in: Proc. 14 th Conf. Int. Org. Citrus Virol. J. V. da Graa, R. F. Lee, and R. K. Yokomi, eds. International Organization of Citrus Virologists, Univer sity of California, Riverside, CA.

PAGE 67

67 41. Garnsey, S. M., Civerolo, E. L., Gumpf, D. J., Paul, C., Hilf, M. E., Lee R. F., Brlansky, R. H., Yokomi, R. K., and Hartung, J. S. 2005. Biological characterization of an international collection of citrus tristeza virus (CTV) isolates. Pages 75 93 in: Proc. 16 th Conf. Int. Organ. Citrus Virol. M. E. Hilf, N. Duran Vila, and M. A. Rocha Pea, eds. International Organization of Citrus Virologists, University of California, Riverside, CA. 42. Garnsey, S.M. Zies, D. L., I rey, M., Sieburth, P.J., Semancik, J.S., Levy L., and Hilf. M.E. 2002. Practical Field Detection of Citrus Viroids in Florida by RT PCR. 15 th IOCV, 219 229. 43. Garvin, M. R., Saitoh, K., and Gharrett, A. J. 2010. Application of single nucleotide polymorphis ms to non model species: a technical review. Molecular Ecology Resources 10, 915 934 44. Goss E. M., Larsen, M., Chastagner, G. A., Givens, D. R., Niklaus J., and Grunwald, N. J. 2009. Population Genetic Analysis Infers Migration Pathways of Phytophthora ramo rum in US Nurseries. PLoS Pathog 5(9): e1000583. doi:10.1371/journal.ppat.1000583. 45. Gottwald, T. R. 2010. Current epidemiological understanding of citrus Huanglongbing. Annu. Rev. Phytopathol. 48:119 139. 46. Gottwald, T. R., Graham, J. H., and Schubert, T. S 2002. Citrus canker: The pathogen and its impact. Online. Plant Health Progress doi:10.1094/PHP 2002 0812 01 RV 47. Gottwald, T. R., da Graca, J. V., and Bassanezi, R. B. 2007. Citrus huanglongbing: the pathogen and its impact. Plant Health Progr. doi:10.10 94/PHP 2007 0906 01 RV. 48. Graham, J. H., Timmer, L. W., Drouillard, D. L., and Peever, T. L. 1998. Characterization of Phytophthora spp. causing outbreaks of citrus brown rot in Florida. Phytopathology 88:724 729. 49. Grant, T. J., and Higgins, R. P. 1957. Occ urrence of mixtures of tristeza virus strains in citrus. Phytopathology 47: 305 317. 50. Guichoux, E. 2011. Current trends in microsatellite genotyping. Molecular Ecology Resources 11, 591 611 51. Halbert, S. E. 2005: The discovery of huanglongbing in Florida. Proceedings of the 2 nd International Citrus Canker and Huanglongbing Research Workshop 2005, Orlando Florida,USA, p50.

PAGE 68

68 52. Harper, S. J., Dawson, T. E., and Pearson, M. N. 2009. Complete genome sequences of two distinct and diverse citrus tristeza virus isol ates from New Zealand. Arch. Virol. 154:1505 1510. 53. Harper, S. J., Dawson, T. E., and Pearson, M. N. 2010. Isolates of citrus tristeza virus that overcome Poncirus trifoliata resistance comprise a novel strain. Arch. Virol. 155:471 480. 54. Hentschel C. C.198 2. Homocopolymer sequences in the spacer of a sea urchin histone gene repeat are sensitive to S1 nuclease. Nature 295:714 716 55. Hilf, M. E. 2011. Colonization of citrus seed coats by Candidatus Liberibacter asiaticus': Implications for seed transmission of the bacterium. Phytopathology 101:1242 1250. 56. Hilf, M. E., Karasev, A. V., Pappu, H. R., Gumpf, D. J., Niblett, C. L., and Garnsey, S. M. 1995. Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208: 576 582. 57. Hilf, M. E., Mavrodieva, V. A., and Garnsey, S. M. 2005. Genetic marker analysis of a global collection of isolates of citrus tristeza virus: characterization and distribution of CTV genotypes and association with symptoms. Phytopathology 95: 909 917. 58. Hilf, M., Ga rnsey, S., Robertson, C., Gowda, S., Satyanarayana, T., Irey, M., Sieburth, P., and Dawson, W. 2007. Characterization of recently introduced HLB and CTV isolates. Proc. Fla. State Hort. Soc. 120:138 141. 59. Hoff Olsen, P. Jacobsen, S., Mevag, B., Olaisen, B. 2001. Microsatellite stability in human post mortem tissues. Forensic Science International, 119 (3): 273 298. 60. Hubisz, M. J., Falush, D., Stephens, M., and Pritchard, J. K. 2009. Inferring weak population structure with the assistance of sample group in formation. Molecular Ecology Resources, 9: 1322 1332 61. Islam Md S., Glynn, J. M., Bai, Y., Duan, Y. P., Coletta Filho, H. D., Kuruba, G., Civerolo, E. L., and Lin, H. 2012. Multilocus microsatellite analysis of 'Candidatus Liberibacter asiaticus' associated with citrus Huanglongbing worldwide. BMC Microbiology 12:39 62. Irey, M. S., Gast, T., and Snively, J. 2008. Economic Impact of Managing Huanglongbing in Groves at southern gardens citrus. Workshop on Huanglogbing ( Candidatus Liberibacter spp) and the Asia n Citrus Psyllid ( Diaphorina citri ). Hermosillo, Mexico.

PAGE 69

69 63. Irey, M. S., Gast, T., and Gottwald, T. 2006. Comparison of visual assessment and PCR assay testing to estimate the incidence of the huanglongbin pathogen in commercial Florida citrus. Proc. Fla. St ate Hortic. Soc. 42:17 21. 64. Jagoueix, S., Bove, J. M., and Garnier, M. 1994. The phloem limited bacterium of greening disease of citrus is a member of the alpha subdivision of the Proteobacteria. Int. J. Syst. Bacteriol. 44:379 386 65. Johnson E., Bright D. B., and Graham J. H. 2012. Early root infection and damage in citrus huanglongbing disease development. Phytopathology 102:S4.59. 66. Karasev, A. V., Boyko, V. P., Gowda, S., Niklaeva, O. V., Hilf, M. E., Koonin, E. V., Niblett, C. L., Cline, K., Gumpf, D. J. Lee, R. F., Garnsey, S. M., and Dawson, W. O. 1995. Complete sequence of the citrus tristeza virus RNA genome. Virology 208: 511 520. 67. Karasev, A. V., Hilf, M. E., Garnsey, S. M., and Dawson, W. O. 1997. Transcriptional strategy of closteroviruses: mapp subgenomic RNAs. J. Virol. 71: 6233 6236. 68. Karasev, A. V. 2000. Genetic diversity and evolution of closteroviruses. Annu. Rev. Phytopathol. 38: 293 324. 69. Katoh, H., Davis, R., Smith, M. W., Weinert, M., and I wanami, T. 2012. Differentiation Candidatus isolates on the basis of simple sequence repeat and single nucleotide polymorphism profiles at 25 loci. Ann. Appl. Biol. 160:291 297. 70. Ka toh, H., Subandiyah, S., Tomimura, K., Okuda, M., Su H. J., and Iwanami, T. 2011. tandem repeat analysis. Appl Environ Microbiol 77(5):1910 1917. 71. Kong, P., Rubio, L., Polek M., and Falk, B. W. 2000. Population structure and genetic diversity within California citrus tristeza virus (CTV) field isolates. Virus Genes 21: 139 145. 72. Kun Sheng, W., and Tanksley, S. D. 1993. Abundance, polymorphism and genetic mapping of microsat ellites in rice. Mol Gen Genet 241:225 235 73. Lee, R. F. 1990. A survey for virus and virus like diseases of tropical fruit in the Dominican Republic. Report to Junta Agroempresarial de Consultora y Coinversiones (JACC), June 3 8, 1990.

PAGE 70

70 74. Levinson, G., Gutma n, G. A. 1987 Slipped strand mispairing: a major mechanism for DNA sequence evolution. Mol Biol Evol. 4:203 221 75. Li W., Hartung J. S., and Levy L. 2006. Quantitative real time PCR for detection and identification of Candidatus Liberibacter species assoc iated with citrus huanglongbing. J Microbiol Methods; 66:104 15. 76. Librado, P., and Rozas, J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451 1452. 77. Lpez, C., Aylln, M. A., Navas Castillo, J., Guerri J., Moreno, P., and Flores, R. 1998. Phytopathology 88: 685 691. 78. Lu, R., Folimonov, A. S., Shintaku, M., Li, W. X., Falk, B. W., Dawson, W. O., and Ding, S. W. 2004. Three distinct suppressors of RNA silen cing encoded by a 20 kb viral RNA genome. Proc. Natl. Acad. Sci. USA 101: 15742 15747. 79. Manjunath, K. L., Ramadugu, C., Majil, V. M., Williams, S., Irey, M., and Lee, R. F. 2010. First Report of the Citrus Huanglongbing Associated Bacterium Candidatus L Citrus Psyllid in Belize. Plant Disease 94 (6) 781. 80. Martin, S., Sambade, A., Rubio, L., Vives, M. C., Moya, P., Guerri, J., Elena, S. F., and Moreno P. 2009. Contribution of recombination a nd selection to molecular evolution of Citrus tristeza virus. J. of Gen. Virol. 90: 1527 1538. 81. Martnez, Y., Llauger, R., Batista, L. M., Iglesia, A., Collazo, C., Pea, I., Casn, J. C., Cueto, J., and Tablada, L. M. 2008. Candidatus Li associated with Huanglongbing in Cuba. BS Plant Pathology 18, August 2008 to January 2009. 82. Matos, L. A., and Borbn, J. C. 2008. El Virus de la Tristeza de los Ctricos (CTV) en Plantaciones Comerciales y Viveros de la Repblica Dom inicana. Proceeding of 44th annual meeting of the Caribbean Food Crops Society. Miami, Florida, USA. 83. Matos, L. Hilf, M. E., Camejo, J. 2009. Candidatus Liberibacter Plant Disease 93:668 84. Matsumoto, T. M. Wang, M. C., Su, H. J. 1961. Studies on likubin. In:Price WC (ed) Proceedings of the second conference of the International Organization of Citrus Virologists. University of Florida, Gainesville, pp 121 125.

PAGE 71

71 85. Mawa ssi, M., Mietkiewska, E., Gofman, R., Yang, G., and Bar Joseph, M. 1996. Unusual sequence relationships between two isolates of citrus tristeza virus. J. Gen. Virol. 77: 2359 2364. 86. McClean, A. D., and Oberholzer, P. J. 1965. Greening disease of sweet oran ge: Evidence that it is caused by a transmissible virus. S. Afr. J. Agric. Sci. 8:253 276 87. Melzer, M. J., Borth, W. B., Sether, D. M., Ferreira, S., Gonsalves, D., and Hu, J. S. 2010. Genetic diversity and evidence for recent modular recombination in Hawai ian citrus tristeza virus. Virus Genes 40:111 118. 88. Michalakis, Y., and Veuille, M. 1996 Length variation of CAG/CAA trinucleotide repeats in natural populations of Drosophila melanogaster and its relation to the recombination rate. Genetics 143:1713 1725 89. Miyakawa, T., and Tsuno, K. 1989. Occurrence of citrus greening disease in the southern islands of Japan. Ann. Phytopathol. Soc. Jpn. 55:667 670. 90. Miyata, S. I., Kato, H., Davis, R., Smith, M. W., Weinert, M., and Iwanami, T. 2011. Asian common strains o Candidatus Northeast India, Papua New Guinea and Timor Leste. J. Gen. Plant Pathol. 77:43 47. 91. Moreno, P., Ambros, S., Albiach Marti, M. R., Guerri, J., and Pea, L. 2008. Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol. Plant Pathol. 9:251 268. 92. Njambere, E. N., Vandemark, G., and Chen, W. 2010. Development and characterization of microsatellite markers of the fungal plant pathogen Sclerotinia trifoliorum Genome, Jun ; 53 ( 6): 494 500. 93. OIRSA (Organismo Internacional Regional de Sanidad Agropecuaria). 2011. Taller Sensibilizacin sobre Certificacin en la Produccin Material Vegetativo. Santo Domingo, Repblica Dominicana. Septiembre 2011. 94. OIRSA (Organismo Internacional Reg ional de Sanidad Agropecuaria). 2012. Programa de Campaa Fitosanitaria para el Control del Huanglongbing de los Ctricos en Belize, Honduras, Nicaragua, Guatemala y Repblica Dominicana a operar con recursos del Ministerio de Agricultura y OIRSA. Propuest a. OIRSA, San Salvador, El Salvador. 35 pp 95. Oliveira, J. E., Gomes, J. P., Zucchi, M. I., Vencovsky, R., and Carneiro Vieira, M. L. 2006. Origin, evolution and genome distribution of microsatellites. Genetics and Molecular Biology 29, 2, 294 307

PAGE 72

72 96. Pappu, H. R., Karasev, A.V., Anderson, E. J., Pappu, S. S., Hilf, M. E., Febres, V. J., Eckloff, M. G., McCaffery, M., Boyko, V., Gowda, S., Dolja, V. V., Koonin, E. V., Gumpf, D. J., Cline, K. C., Garnsey, S. M., Dawson, W. O., Lee, R. F., and Niblett, C. L. 19 94. Nucleotide sequence and organization of eight open reading frames of the citrus tristeza cloterovirus genome. Virology 199: 35 46. 97. Peakall, R., and Smouse, P.E. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and r esearch. Molecular Ecology Notes 6, 288 295. 98. Permar, T.A., Garnsey, S. M., Gumpf, D. J., and Lee, R. F. 1990. A monoclonal antibody which discriminates strains of citrus tristeza virus. Phytopathology 80:224 228. 99. Petit R. J., Deguilloux, M. F., Chat, J. Grivet, D., Garnier Gr, P., and Vendramin, G. G. 2005. Standardizing for microsatellite length in comparisons of genetic diversity. Molecular Ecology 14:885 890 100. Pritchard J, Stephens M, Donnelly P. 2000. Inference of population structure using multilo cus genotype data. Genetics, 155:945 959 101. Provan, J., Powell, W., and Waugh, R. 1996. Microsatellite analysis of relationships within cultivated potato (Solanum tuberosum). Theor Appl Genet. 92:1078 1084. 102. Raccah, B. G., Loebenstein, G., and Singer, S. 198 0. Aphid trasmissibility variants of citrus tristeza virus in infected citrus trees. Phytopathology 70: 89 93. 103. Ramadugu, C., Manjunah, K. L., Halbert, S. E., Brlansky, R. H., Roose, M., and Ca ndidatus 104. Rico, C., Rico, I., Hewitt, G. 1996. 470 million years of conservation of microsatellite loci among fish species. Proc R Soc Lond B Biol Sci 263:549 557 105. Rocha Pea, M. A., Lee, R. F., Lastra, R. C., Niblett, C. L., Ochoa Corona, F. M., Garnsey, S. M., and Yokomi. R. K. 1995. Citrus tristeza virus and its vector toxoptera citricida. Plant Dis. 79:437 445. 106. Roder, M. S., Plaschke, J., Borner, A., Sorrells, M. E., Tanksley, S. D., Ganal, M. W. 1995. Abundance, variability and chromosomal location of microsatellites in wheat. Mol Gen Genet 246:327 333.

PAGE 73

73 107. Roistacher, C. N., and Moreno, P. 1991. The worldwide threat from destructive isolates of citrus tristeza virus. Pages 76 82, in: Proc. 8 th Conf. Int. Organ. Citrus Virol. E. C. Calavan, S. M. Garnsey, and L. W. Timmer, eds. International Organization of Citrus Virologists, University of California, Riverside, CA. 108. Roistacher, C.N. 1991. Graft Transmissible D iseases of Citrus. Handbook for Detection and Diagnosis. Rome: FAO 109. Roistacher, C. N., and Dodds, J. A. 1993. Failure of 100 mild citrus tristeza virus isolates from California to cross protect against a challenge by severe sweet orange stem pitting isolat es. Pages 100 107 in: Proc. 12 th Conf. Int. Organ. Citrus Virol. P. Moreno, J. V. da Graa, and L. W. Timmer, eds. International Organization of Citrus Virologists, University of California, Riverside, CA. 110. Roy, A., Manjunath, K. L., and Brlansky, R. H. 20 05. Assessment of sequence terminal region of citrus tristeza virus from India. Virus Res. 113: 132 142. 111. Roy, A., and Brlansky, R. H. 2010. Genome analysis of an orange stem pitting citrus tristeza virus isolate reveals a novel recombi nant genotype. Virus Res. 151: 118 130. 112. Rubio, L., Ayllon, M. A., Kong, P., Fernandez, A., Polek, M. L., Guerri, J., Moreno, P., and Falk, B. W. 2001. Genetic variation of citrus tristeza virus isolates from California and Spain: evidence for mixed infect ions and recombination. J. Virol. 75: 8054 8062. 113. Saitou, N., and Nei, M. 1987. The neighbour joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. and Evolution 4, 406 425. 114. Satyanarayana, T., Gowda, S., Mawassi M., Albiach Marti, M. R., Ayllon, M. A., Robertson, C., Garnsey, S. M., and Dawson, W. O. 2000. Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology 1278: 253 265. 115. Schltterer, C. 2000. Evolutionary d ynamics of microsatellite DNA. Chromossoma 109:365 371. 116. Schltterer, C., Amos, B., and Tautz, D. 1991. Conservation of polymorphic simple sequence loci in cetacean species. Nature 354:63 65. 117. Schltterer, C., and Tautz, D. 1992. Slippage synthesis of simp le sequence DNA. Nucleic Acids Res 20:211 215.

PAGE 74

74 118. Schltterer, C., and Wiehe, T. 1999. Microsatellites, a neutral marker to infer selective sweeps. In: Goldstein, D., Schltterer, C. (eds) Microsatellites: evolution and applications. Oxford University Press, Oxford, pp 238 248 119. Sieburth, P. J., and Nolan, K. G. 2005. Survey of stem pitting Citrus tristeza virus in commercial citrus groves in Florida. Proc. Fla. State Hort. Soc. 118: 40 42. 120. Strand, M., Prolla, T. A., Liskay, R. M., and Petes, T. D. 1993. Dest abilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365:274 276. 121. Streisinger G, and Owen, J. E. 1985. Mechanisms of spontaneous and induced frameshift mutation in bacteriophage T4. Genetics 109:633 6 59 122. Tapia, G. 2011. Estrategia Regional para el Control del HLB en la Regin del OIRSA Presentacin reunin FAO Chile, 20 de junio 2011. 75 pp. 123. Tamura, K., and Nei, M. 1993. Estimation of the number of nucleotide substitutions in the control region of m itochondrial DNA in humans and chimpanzees. Mol. Biol. and Evolution 10: 512 526 124. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary dista nce, and maximum parsimony methods. Mol. Biol. and Evolution. 125. Tatineni, S., Robertson, C. J., Garnsey, S. M., Bar Joseph M., Gowda, S., and Dawson, W. O. 2008. Three genes of Citrus tristeza virus are dispensable for infection and movement throughout some varieties of citrus trees. Virology 376: 297 307. 126. Tatineni, S., Robertson, C. J., Garnsey, S. M., and Dawson, W. O. 2011. A plant virus evolved by acquiring multiple nonconserved genes to extend its host range. Proc. Natl. Acad. Sci. USA 108:17366 17371. 127. Teixeira, D. C., Eveillard, Sirand Pugnet, P., Wulff, A., Saillard, C., Ayres, A. J., and Bov J M. 2008.The tufB secE nusG rplKAJL rpoB gene cluster of the liberibacters: sequence comparisons, phylogeny and speciation. Int J. Syst Evol Microbiol 58:14 14 21 128. Timmer, L.W., Garnsey, S.M., and Graham, J.H. 2000. Compendium of Citrus Diseases. St Paul, MN: APS Press. 129. Tirtawidjaja, S., Hadiwidjaja, T., and Lasheen, A. M. 1965. Citrus veinphloem degeneration virus, a possible cause of citrus chlorosis in Jav a. Proc Am Soc Hortic Sci 86:235 243

PAGE 75

75 130. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. 1997. The ClustalX window interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids R es. 25, 4876 4882. 131. Tomimura, K., Miyata, S., Furuya, N., Kubota, K., Okuda, M., Subandiyah, S., Hung, T. H., Su, H. J., and Iwanami, T. 2009. Evaluation of genetic diversity P hytopathology 99(9):1062 1069. 132. Trujillo Arriaga, J., Sanchez, H., and Robles, P. 2008. Situacin actual y perspectivas del huanglongbing y el pslido asitico de los ctricos en Mxico. Workshop on Huanglogbing ( Candidatus Liberibacter spp) and the Asian Citrus Psyllid ( Diaphorina citri ). Hermosillo, Mexico. 133. van Belkum, A. 1998. Shortsequence DNA repeats in prokaryotic genomes. Microbiol. Mol. Biol. Rev 62:275 293. 134. van Vuuren, S. P., Collins, R. P., and da Graa, J. V. 19 93. Evaluation of citrus tristeza virus isolates for cross protection of grapefruit in South Africa. Plant Dis. 77:24 28. 135. Villalobos, W., Rivera, C., and Harnmond, T. 1996. Occurrence of citrus viroids in Costa Rica. Rev. Biol. Trop., 45 (3): 983 987 136. Viv es, M. C., Rubio, L., Lpez, C., Navas Castillo, J., Albiach Mart, M. R., Dawson, W. O., Guerri, J., Flores, R., and Moreno, P. 1999. The complete genome sequence of the major component of a mild citrus tristeza virus isolate. J. Gen. Virol. 80:811 816. 137. Vives, M. C., Rubio, L., Sambade, A., Mirkov, T. E., Moreno, P., and Guerri, J. 2005. Evidence of multiple recombination events between two RNA sequence variants within a citrus tristeza virus isolate. Virology 331: 232 237. 138. Weng, Z., Barthelson, R., Gow da, S., Hilf, M. E., Dawson, W. O., Galbraith, D. W., and Xiong, Z. 2007. Persistent infection and promiscuous recombination of multiple genotypes of an RNA virus within a single host generate extensive diversity. PLOS ONE 2: e917. 139. Zhou, L., Powell, C. A. Hoffman, M. T., Li, W., Fan, G., Liu, B., Lin, H., and Duan Y. 2011. Diversity and Plasticity of the Intracellular Plant Pathogen and Insect Candidatus Prophage Genes with Intrage nic Tandem R epeats. Environ. Microbiol. 77(18):6663.

PAGE 76

76 BIOGRAPHICAL SKETCH Luis A. Matos Casado was born in El Pinar, a little town in San Jos de Ocoa province in the in the Dominican Republic. H e received his primary and secondary education in Escuela Central del P inar. Later he joined the Autonomy University of Santo Domingo (UASD) where he got a B achelor degree in Agronomy in 1993 and a Master degree in Integrated Pest Management (IPM) in 2008. During the following seven year s Luis was working for the private s ector in Dominican Agribusiness Council (JAD) where he started as assistant at the diagnostic p hytopatholog ical laboratory working with different plant pathogens such as soil borne fungi in ornamentals and vegetables including some virus es such as Tomato yellow lea f curl virus (TYLCV). However mor e than 50% of his time was dedicated to working on the epidemiology of Citrus tristeza virus (CTV) in collaboration with the United State Department of Agriculture (USDA) particularly, with Dr. Stephen Garnsey and Dr. Tim Gottwald. In 2003 Luis got a position of an Assistant Research er at the Instituto Dominicano de Investigaciones Agropecuarias y Forestales (IDIAF) where he continu ed to work on CTV. In August of 2009 Luis joined a Ph D ., program at the Plant Pathology Department at the University of Florida under the supervision of Dr. Svetlana Folimonova. During this time Luis has been working on genetic characterization of two pathogens that cause major citrus diseases d on p opulation genetic s analysis of CTV in the Dominican Republic and c haracterization of Candidatus Liberibacter asiaticus using Variable Number of Tandem Repeat as molecular marker s Finally, he received his Ph. D ., in Plant Pathology from the Universit y of Florida in the summer of 2013.