Functions and Therapeutic Targeting of Chemokines and Chemokine Receptors in Glioblastoma Progression

MISSING IMAGE

Material Information

Title:
Functions and Therapeutic Targeting of Chemokines and Chemokine Receptors in Glioblastoma Progression
Physical Description:
1 online resource (118 p.)
Language:
english
Creator:
Pham, Kien Trung
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Physiology and Pharmacology (IDP)
Committee Chair:
Harrison, Jeffrey K
Committee Members:
Law, Brian Keith
Siemann, Dietmar W
Streit, Wolfgang Jakob

Subjects

Subjects / Keywords:
antiangiogenic -- chemokine -- glioblastoma -- microglia
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
WHO grade IV GBM is one of the most aggressive forms of primary brain cancer, due to its lethality, mortality, and high resistance to intensive therapies. Median survival for patients with GBM is under 15 months following standard of care therapy with surgery, radiation, and TMZ. Moreover, there is no effective therapy following recurrence. Heterogeneity within the tumor microenvironment, the presence of a stem-like subpopulation, a prominent tumor vascularization, and limited drug delivery through BBB are major impediments to chemotherapy directly targeting GBM cells. Hence, therapeutic strategies that indirectly attack tumor cells by targeting vital components in tumorigenic regulation receive major attentions. Having diverse functions in many aspects of cancer biology, chemokine systems are potential candidates for this new approach. In this project, we were interested in the roles of chemokine systems within GBM microenvironment. The research objectives were addressed from several angles including how chemokine systems contribute to GBM progression through recruitment of immune cells to the tumor, how they regulate stem-like properties of tumor cells; and how changes in tumor microenvironment, as a result of anti-VEGF therapy, impact the expression and function of chemokine systems. In the first part of this project, we elucidated the role chemokine CCL5 and its receptors CCR1, CCR3, and CCR5 in the recruitment of microglia into GBM microenvironment, using an immune-competent murine GBM model. We reported that CCL5, CCR1, and CCR5 were expressed in GBM. Individual deletion of CCR1 or CCR5 had little to no effect on the survival of tumor bearing mice, as well as the numbers of GBM-infiltrated microglia and lymphocytes. CCL5 promoted in vitro migration of wild type, CCR1- or CCR5-deficient microglia that was blocked by the CCR1/CCR5 dual antagonist, Met-CCL5. These data suggest that CCL5 may direct the infiltration of microglia into GBM microenvironment through CCR1 and CCR5 in a redundant manner. The study reported in the second phase of this project followed up on results previously generated in this laboratory that focused on the heterogeneity of chemokine receptors CXCR4 and CXCR7 in regulating cancer stem-like properties of GBM cells. Using different primary patient-derived GBM cell lines, we showed that these two chemokine receptors were expressed by all of the examined GBM cell lines and that subpopulations containing either CXCR4-/CXCR7-, CXCR4-/CXCR7+, CXCR4+/CXCR7-, or CXCR4+/CXCR7+ cells were able to generate tumors in vivo. In addition to regulating other in vitro functions, CXCL12 also stimulated the in vitro tube formation of one of the GBM lines. CXCL12 no effect on the distribution of CXCR4- and CXCR7-expressing cells in either the apoptotic and non-apoptotic subpopulations evident after treatment with TMZ. Moreover, we showed that CXCL11, another ligand for CXCR7, did not have an effect on CXCR7-mediated functions of GBM cells. This study provides additional evidence to support functional heterogeneity of CXCR4 and CXCR7 in the regulation of cancer stem-like properties. The final part of this project focused on investigating the effect of anti-VEGF therapy on the expression and function of chemokine receptor CXCR4 in primary patient-derived GBM cell lines and tumors. Data established from in vitro and in vivo studies strongly indicated that VEGF/VEGFR inhibition could increase the expression of CXCR4 in VEGFR-positive cells lines, but not in VEGFR-negative lines. The increase in CXCR4 by anti-VEGFR therapies also enhanced the migratory effect of CXCL12 in the VEGFR-positive cells. Kaplan-Meier survival analysis indicated a statistically significant difference in the survival of tumor bearing mice that received combined treatment of AMD3100 (a CXCR4 antagonist) and Cediranib (a VEGFR inhibitor), when compared to control, AMD3100, or Cediranib treated cohorts. Further analysis pointed to a mechanism for the increase in CXCR4 expression stimulated by VEGFR inhibitors that was dependent on TGFß/TGFßR, but not the HGF/MET signaling pathway. This study contributes a valuable understanding for the de novo mechanism that leads to enhanced invasive phenotype post anti-VEGF therapy and suggests new therapeutic approaches to target GBM.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Kien Trung Pham.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Harrison, Jeffrey K.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-02-28

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045777:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 FUNCTIONS AND THERAPEUTIC TARGETING OF CHEMOKINES AND CHEMOKINE RECEPTORS IN GLIOBLASTOMA PROGRESSION By KIEN PHAM A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Kien Pham

PAGE 3

3 To my warm family, dear friends, and everyone I love

PAGE 4

4 ACKNOWLE D GEMENT S I would like to express my deep appreciation to my mentor, Dr. Jeffrey K. Harrison, for his advice, support, and patience during my PhD training, without his guidance and persistent help, this dissertation would not have been possible. I would like to thank my committee members, Drs. Brian K. Law, Dietmar W. Siemann, and Wolfgang J. Streit, for their consistent support, encouragement constructive criticism and directions during the course of this dissertation. I am thankful to have a chance to collaborate with Defang Luo and Che Liu, for their support and help, and for providing me a stress free work environment. In addition, many thanks to my classmates Stephan Jahn and Nikkolett Molnar for their generosity when giving me advice, sharing thoughts, and of course, making me laugh with funny jokes I also wish to thank everyone who has helped me, in every aspect of my life, during the past 5 years Finally, I would like to devote my d eepest gratitude to my parents who sacrifice their li v e s for their children. Without their unconditional love and support, I would not be who I am today.

PAGE 5

5 TABLE OF CONTENT S ACKNOWLEDGEMENT S ................................ ................................ ............................... 4 LIST OF TABLE ................................ ................................ ................................ .............. 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 Glioblastoma ................................ ................................ ................................ ........... 16 Overview of Disease ................................ ................................ ........................ 16 Treatments ................................ ................................ ................................ ....... 16 Therapeutic Resistance ................................ ................................ .................... 17 Subcla sses ................................ ................................ ................................ ....... 18 Microglial Infiltration in GBM ................................ ................................ ................... 21 Glioma Stem Like Cancer Cells ................................ ................................ .............. 22 Angiogenesis and Anti Angiogenic Therapy in GBM ................................ .............. 24 Chemokines and Chemokine Receptors ................................ ................................ 26 Chemokine Systems in Cancers ................................ ................................ ............. 27 CCL5/CCR1/CCR3/CCR5 ................................ ................................ ................ 29 CXCL11/CXCL12 and CXCR4/CXCR7 ................................ ............................ 29 GBM Models ................................ ................................ ................................ ........... 32 Murine Glioma 261 (GL261) Model ................................ ................................ .. 32 Human Gliomasphere Model ................................ ................................ ............ 33 Significance and Specific Aims ................................ ................................ ............... 34 2 MATERIALS AND METHODS ................................ ................................ ................ 37 Animals ................................ ................................ ................................ ................... 37 Cell Culture ................................ ................................ ................................ ............. 37 Primary Microglia Isolation ................................ ................................ ...................... 38 Reverse Transcription Polymerase Chain Reaction ................................ ............... 39 Cytokine Protein Array ................................ ................................ ............................ 39 In Situ Hybridization ................................ ................................ ................................ 40 Immunocytochemistry ................................ ................................ ............................. 40 Immunohi stochemistry ................................ ................................ ............................ 41 Flow Cytometry ................................ ................................ ................................ ....... 42 Migration Assay ................................ ................................ ................................ ...... 42 Short Term Proliferation Assay ................................ ................................ ............... 43

PAGE 6

6 Sphere Formation Assay ................................ ................................ ........................ 43 Apoptosis Assay ................................ ................................ ................................ ..... 43 Tube Formation Assay ................................ ................................ ............................ 44 Intracranial Injection of Glioma Cells ................................ ................................ ...... 44 AMD3100 and Cediranib Treatments ................................ ................................ ...... 45 Kaplan Meier Survival Analysis ................................ ................................ .............. 45 Statistical Analysis ................................ ................................ ................................ .. 45 3 ROLE OF CCL5 IN MICROGLIA/MACROPHAGES GBM CROSSTALK ............... 47 Results ................................ ................................ ................................ .................... 48 CCL5 Is Expressed by Murine GL261 and Human GBM Cell Lines ................. 48 CCL5, CCR1, and CCR5 Are Present in Murine GL261 GBM ......................... 49 Neither CCR1 nor CCR5 Deficiency Contributed to the Infiltration of Immune Cells into GBM or Impacted the Survival of Tumor Bearing Mice ................................ ................................ ................................ ............. 50 CCL5 Interacted with Its Microglia/Macrophages Expressed Receptors, CCR1 and CCR5, in a Redundant Manner ................................ .................. 51 Discussion ................................ ................................ ................................ .............. 52 4 HETEROGENEITY OF CXCR4 AND CXCR7 IN GBM ................................ ........... 60 Results ................................ ................................ ................................ .................... 61 CXCR4, CXCR7, CXCL11, and CXCL12 Were Expressed in Primary Patient Derived GBM Cell Lines and/or Tumors ................................ .......... 61 Both CXCR4+ and CXCR7+ Cells Were Capable of Generating Tumors In Vivo ................................ ................................ ................................ .............. 61 CXCL12 Stimulated Tube Formation of L0 Cells through CXCR4 .................... 62 CXCL12 Had No Effect on TMZ Induced Apoptosis in CXCR4+ and CXCR7+ Cells ................................ ................................ .............................. 62 CXCL11 Contributed No Impact on In Vitro Functions of GBM Cell Lines ....... 63 Discussion ................................ ................................ ................................ .............. 64 5 EXPRESSION AND FUNCTION OF CXCR4 IN GBM AFTER ANTI ANGIOGENIC THERAPY ................................ ................................ ....................... 73 Results ................................ ................................ ................................ .................... 74 Heterogeneous Expression of VEGF Receptors by Different Primary Patient Derived GBM Cell Lines ................................ ................................ ... 74 Anti VEGF/VEGFR Agen ts Increased the Expression of CXCR4 in Primary Patient Derived GBM Cell Lines and Xenograft Tumors that Were Positive for VEGFRs ................................ ................................ ........... 75 Anti VEGFR Drugs Enhanced the Migratory Effect of VEGFR(s) Expressing GBM Cell Lines toward CXCL12 ................................ ............... 76 The Combination of a CXCR4 Antagonist and a VEGFR Inhibitor Provided a Greater Beneficial Effect on the Survival of GBM Bearing Animals ........... 76

PAGE 7

7 Anti Angiogenic Agents Stimulated CXCR4 Expression in a HGF/MET ................................ .. 77 Disc ussion ................................ ................................ ................................ .............. 79 6 GENERAL DISCUSSION ................................ ................................ ....................... 91 Summary of Main Findings ................................ ................................ ..................... 91 Clin ical Impact and Future Directions of the Findings ................................ ............. 94 LIST OF REFERENCES ................................ ................................ ............................... 98 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 118

PAGE 8

8 LIST OF TABLE Table page 2 1 List of primers used for RT PCR analyses ................................ ......................... 46

PAGE 9

9 LIST OF FIGURES Figure page 3 1 Expression of CCL5 by murine GL261 and human GBM cell lines ..................... 56 3 2 Expression of CCL5 and its receptors CCR1 and CCR5 in murine GL261 glioblastomas ................................ ................................ .......... 57 3 3 Effect of CCR1 and CCR5 deficiency on infiltration of immune cells into glioblastoma an d s urvival of tumor bearing mice ................................ ......... 58 58 3 4 In vitro expression of CCR1 and CCR5 by primary microglia cultures and the effect of Met CCL5 on C CL5 stimulated migration of microglia ............. 59 4 1 CXCR4, CXCR7, CXCL11, and CXCL12 were expressed in primary patient derived GBM cell lines and/or tumors ................................ ..................... 68 4 2 CXCR4 + CXCR7 + and CXCR4 + /CXCR7 + cells generated t umors in vivo ........ 69 4 3 CXCL12 stimulation of L0 tube formation in vitro was mediated by CXCR4 ...... 70 4 4 Differential impact of TMZ on the distribution of CXCR4 and CXCR7 expressing apoptotic and non apoptotic subpopulations ....................... 71 4 5 CXCL11 had no effect on in vitro functions of GBM cell lines ............................ 72 5 1 VEGFRs were heterogeneously expressed by different primary P atient derived GBM cell lines ................................ ................................ ............ 85 5 2 VEGFR inhibitors upregulated CXCR4 in VEGFR expressing GBM cell lines ................................ ................................ ................................ ..... 86 5 3 VEGFR inhibitors enhanced the migratory effect of CXCL12 on S2 and S3 cells ................................ ................................ ................................ ... 87 87 5 4 Combination of CXCR4 and VEG FR inhibitors prolonged survival of S3 tumor bearing mice ................................ ................................ ...................... 88 5 5 Upregulation of CXCR4 expression by anti angiogenic drugs was independent of HGF/MET signaling ................................ ............................ 89 89 5 6 Increased CXCR4 expression by anti angiogenic drugs ................................ ........................ 90

PAGE 10

10 LIST OF ABBREVIATIONS AKT v akt murine thymoma viral oncogene homolog 1 AMD3100 [1,4 Phenylenebis(methylene)]bis [1,4,8,11 tetraazacyclotetradecane] APC Allophycocyanin BBB Blood brain barrier bFGF Basic fibroblast growth factor CCDN2 Cyclin D2 gene CDK4 Cyclin dependent kinase 4 CSF 1 Colony stimulated factor 1 CSLC Cancer stem like cell DMEM DNA Deoxyribo nucleic acid EBRT External beam radiotherapy EDTA Ethylenediaminetetraacetic acid EGF Epidermal growth factor EGFR Epidermal growth factor receptor EMEM ERK/MAPK Extracellular signal regulated kinase/Mitogen activated protein kinase FACS Fl uo rescent activated cell sorting FBS Fetal bovine serum FGF Fibroblast growth factor GABRA1 Gamma aminobutyric acid A receptor alpha 1 GBM Glioblastoma G CSF Granular colony stimulated factor GIM Glioma infiltrated microglia/ma crophages GPCR G protein couple receptor GSLC Glioma stem like cell

PAGE 11

11 HBSS Hank's balanced salt solution HEPES 2 [4 (2 hydroxyethyl)piperazin 1 yl]ethanesulfonic acid HGF Hepatocyte growth factor HIF1 Hypoxia induced factor 1 alpha IDH1 Iso citrate dehydrogenase 1 IL Interleukin IMRT Intensity modulated radiotherapy ISH In situ hybridization JAK/STAT Janus kinase/Signal transducer and activator of transcription MET Hepatocyte growth factor receptor MGMT O 6 methylguanine DNA methyltransf erase MHC Major histocompatibility complex MMP Matrix metalloproteinase mTOR Mammalian target of rapamycin NBI 74330 N [1 [3 (4 ethoxyphenyl) 4 oxopyrido[ 2,3 d]pyrimidin 2 yl]ethyl] 2 [4 fluoro 3 (trifluoromethyl)phenyl] N (pyridin 3 ylmethyl)acetamide NEFL Neurofilament, light polypeptide NES Nestin NF1 Neurofibromin 1 NF B Nuclear factor kappa light chain enhancer of activated B cells protein complex NKX2 2 NK2 homeobox 2 NOTCH3 Neurogenic locus notch homolog protein 3 NSG NOD scid IL2R null OLIG2 Oligodendrocyte lineage transcription factor 2 PDGF Platelet derived growth factor PDGFR Platelet derived growth factor receptor PE Phycoerythrin

PAGE 12

12 PFS P rogression free survival PI 3K Phosphatidylinositol 3 and 4 kinase PTEN Phosphatase and tensin homolog PTP1B Protein tyrosine phosphatase 1B RANTES Regulated on activation, normal T cell expressed and secreted RB Retinoblastoma protein RELB V rel r eticuloendotheliosis viral oncogene homolog B RPMI Roswell Park Memorial Institute medium RT Radiotherapy RT PCR Reverse transcription p olymerase chain reaction SLC12A5 Solute carrier family 12 (potassium/chloride transporter), member 5 SMO Smoothened p rotein SOX 2 SRY (sex determining region Y) box 2 SYT1 Synaptotagmin I TCGA The cancer genome atlas TGF Transforming growth factor beta TGF R Transform ing growth factor beta receptor TMZ Temozolomide TNFRSF1A Tumor necrosis factor receptor superfamily, member 1A TP53 Tumor protein 53 TRADD Tumor necrosis factor receptor type 1 associated DEATH domain protein VEGF Vascular endothelial growth factor VEGFR Vascular endothelial growth factor receptor WHO World Health Organization

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy FUNCTIONS AND THERAPEUTIC TARGETING OF CHEMOKINES AND CHEMOKINE RECEPTORS IN GLIOBLASTOMA PROG RESSION By Kien Pham August 2013 Chair: Jeffrey K. Harrison Major: Medical Sciences Physiology and Pharmacology WHO grade IV glioblastoma ( GBM ) is one of the most aggressive forms of primary brain cancer, due to its lethality, mortality and high resistance to intensive therapies. Median survival for patients with GBM is under 15 months following standard of care therapy with surgery, radiation, and Temozolomide ( TMZ ) Moreover, there is no effective therapy following recurrence. Heterog eneity within the tumor microenvironment, the presence of a stem like subpopulation, a prominent tumor vascularization, and limited drug delivery through the blood brain barrier ( BBB ) are major impediments to chemotherapy directly targeting GBM cells. Henc e, therapeutic strategies that indirectly attack tumor cells by targeting vital components in tumorigenic regulation receive major attention. Having diverse functions in many aspects of cancer biology, chemokine systems are potential candidate s for this ne w approach. In this project, we were interested in the roles of chemokine systems within GBM microenvironment. Th e research objectives w ere addressed from several angles including how chemokine systems contribute to GBM progression through recruit ment of immune cells to the tumor how they regulat e stem like properties of tumor cells; and

PAGE 14

14 how change s in tumor microenvironment, as a res ult of anti vascular endothelial growth factor ( VEGF ) therapy, impact the expression and function of chemokine systems. In the first part of this project, we elucidated the role chemokine CCL5 and its receptors CCR1, CCR3, and CCR5 i n the recruitment of microglia into GBM microenvironment, using an immune competent murine GBM model. We reported that CCL5, CCR1, and CCR5 were expressed in GBM Individual deletion of CCR1 or CCR5 had little to no effect on the survival of tumor bearing mice, as well as the numbers of GBM infiltrated microglia and lymphocytes. CCL5 promoted in vitro migration of wild type, CCR1 or CCR5 deficient microglia that was blocked by the CCR1/CCR5 dual antagonist, Met CCL5. These data suggest that CCL5 may direct the infiltration of microglia into GBM microenvironment through CCR1 and CCR5 in a redundant manner. The study reported in the second phase of t his project follow ed up on resu lts previously generated in this laboratory that focused on the heterogeneity of chemokine receptors CXCR4 and CXCR7 in regulating cancer stem like properties of GBM cells. Using different primary patient derived GBM cell lin es, we showed that these two chemokine receptors were expressed by all of the examined GBM cell lines and that subpopulation s containing either CXCR4 /CXCR7 CXCR4 /CXCR7 + CXCR4 + /CXCR7 or CXCR4 + /CXCR7 + cells w ere able to generate tumor s in vivo In addition to regulating other in vitro functions, CXCL12 also stimulated the in vitro tube formation of one of the GBM lines. CXCL12 had no effect on the distribution of CXCR4 and CXCR7 expressing cells in either the apoptotic a nd non apoptotic subpopul ations evident after treatment with TMZ Moreover, we showed that CXCL11, another ligand for CXCR7, did not have an effect on CXCR7 mediated functions of GBM cells. This study provides

PAGE 15

15 additional evidence to support functional heterogeneity of CXCR4 and CX CR7 in the regulation of cancer stem like properties. The final part of this project focused on investi gati ng the effect of anti VEGF therapy on the expression and functi on of chemokine receptor CXCR4 in primary patient derived GBM cell lines and tumors. Data from in vitro and in vivo studies strongly indicated that VEGF/ vascular endothelial growth factor receptor ( VEGFR ) inhibition could increase the expression of CXCR4 in VEGFR positive cells lines, but not in VEGFR negative lines. Th e increase in CXCR4 by anti VEGFR therapies also enhanced the migratory effect of CXCL12 in the VEGFR positive cells. Kaplan Meier survival analysis indicated a statistically significant difference in the survival of tumor bearing mice that received combined treatment of AMD3 100 (a CXCR4 antagonist ) and Cediranib (a VEGFR inhibitor ) when compared to control, AMD3100, or Cediranib treated cohort s Further analy sis pointed to a mechanism for the increase in CXCR4 expression stimulated by VEGFR inhibitors that was dependent on transforming growth factor ( TGF ) / transforming growth factor receptor ( TGF R ) but not the hepatocyte growth factor ( HGF ) / hepatocyte growth factor receptor ( MET ) signaling pathway. This study elucidates a de novo mechanism that lead s to an enhanced inv asive phenotype post anti VEGF therapy and suggests new therapeutic approaches to target GBM

PAGE 16

16 CHAPTER 1 INTRODUCTION Glioblastoma Ove rview of D isease GBM accounts for 52% of all primary brain tumor cases and 20% of all intracranial tumors. According to the World Health Organization ( WHO ) classification for brain cancers, GBM was categorized as grade IV based on WHO grading system, due to its morbidity and mortality Two features that guide pathologists to distinguish this grade IV GBM from other lowe r grade gliomas are the presence of necrotic areas surround ed by anaplastic cells within the tumor and extremely marked presence of tumor blood vessel network s ( 1, 2) GBM is one of the most malignant and aggressive forms of primary brain tumor since it is characterized with poor prognosis and hi gh rate of therapeutic resistance, that together lead to a short median survival time Despite standard treatment giving to patients with GBM, the median survival is usually less than 15 months after diagnosis. Less than 2% of patients suffering with GBM will surv ive longer than 5 years, which frequently occurs in the younger age group G BM has received extensive attention from researchers and thus significant advances in understanding the molecular biology of this type of tumor and in therapeutic strategies target ing GBM have been achieved within the past 23 years. Treatment s T he standard treatment for patients with GBM consists of surgical resection, followed by radiotherapy ( RT ) and chemotherap y (3) Surgery is the first stage of GBM treatment in the effort of rem oving the burden of the tumor mass Because the percentage of tumor removal

PAGE 17

17 method has been examined in which a fluorescent dye, named 5 aminolevulinic acid was used as a guide for surgeon to significantly increase the higher rate of complete resection (4, 5) After surgery, radiation is the mainstay of treatment for GBM patient s The traditional method used for standard RT is focal, fractionated external beam radiotherapy ( EBRT ) However, intensity modulated radiotherapy ( IMRT ) i n which the becomes widely used over traditional EBRT (6 ) because this advanced technology allows radiation to precisely target tumor with minimal effect on healthy tissue around tumor site Because GBM contains the presence of necrotic areas, which are highly resistant to radiation, the use of chemotherapy, in combination with radiation, improve s survival rate s of patients. TMZ is one of the most popular alkylating agents used to treat GBM (7) Besides these standard treatment s therapeutic molecular targeted agents have been widely explored for investigation due to its promising effectiveness on specific targeting aberrant signaling pathways that regulate angioge nesis or tumor progression such as epithelial growth factor ( EGF ) platelet derived growth factor ( PDGF ) hepatocyte growth factor ( HGF ) phosphatidylinositol 3 and 4 kinase ( PI 3K ) A bnormalities in these signaling pathways were reported in GBM. These defects include mutation s or dys regulation of single or multiple factors in these pathways causing constitutive activation of downstream events, resulting in tumor development and progression (8 15) Therapeutic R esistance Despite advances in aggressive treatment for this lethal tumor, GBM still holds a significantly high rate of resistance due to various fac to rs within the tumor

PAGE 18

18 microenvironment. In chemotherapy for instance the common mechanism for resistance to alkylating agents, such as TMZ, is through O 6 methylguanine DNA methyltransferase ( MGMT ) gene (16) Methylation of the promoter region of this gene silences it, leading to greater sensitivity to TMZ (17) Thus GBM patients that have methylated MGMT promoter ar e more susceptible to chemotherapy, when compared to patients with un methylated MGMT promoter Recentl y, increasing evidence suggest s a crucial role of cancer stem like cells ( CS LCs ) in therapeutic resista nce in GBM. In a study of radioresistance in GBM using cell cultures derived from primary human tumor specimens and xenograft tumor s Bao et al., showed that the population of cells enriched for glioma CS L Cs was dramatically increased by irradiation and that irradiated CS L Cs have survival advantages rel ative to the non CS L C population. Radioresistant tumors displayed an increased percentage of CD133 + cells compared with the parent al cell population. Furthermore, radiation had little effect on the a bility of CS L Cs to regrow tumors (18) The resistance to radiation of the cell population enriched in CS L Cs may be the result of activation of deoxyribonucleic acid ( DNA ) damage repair mechanism s Subclasses T he heteroge neity at different levels with in the tumor microenvironment contri butes to ineffectiveness in treatment for GBM This molecular heterogeneity suggests the exist e nce of multiple molecular subtypes among different GBM cases. Integrated genomic analyses have identified 4 different molecular subtypes of GBM, based on profiles of gene expression from the cancer genome atlas ( TCGA ) Research Network database (19 21) These classifications include classical, mesenchymal, proneural, and neural subtypes.

PAGE 19

19 Classical : c hromosome 7 amplification paired with chromosome 10 loss and high level of epithelial growth factor receptor ( EGFR ) expression are 2 hall marks of this subtype. The abnormality in EGFR amplification which is caused by a point or constitutively active vIII EGFR mutation (a EGFR class III variant that lacks 267 amino acids from its extracellular domains) in most of the case s was observed in 97% of the classical and infrequently in other subtypes. Moreover, while tumor protein 53 ( TP53 ) is the most frequently mutated gene in GBM, there i s a lack of this mutation in a subset of this subclass. Besides EGFR, aberrant expression of retinoblastoma protein ( RB ) pathway components, such as RB1, cyclin dependent kinase 4 ( CDK4 ) and cyclin D2 ( CCDN2 ) as well as neural precursors and stem cell ma rkers nestin ( NES ) neurogenic locus notch homolog protein 3 ( NOTCH3 ) smoothened protein ( SMO ) w ere also ev ident in the classical subtype. Using data from the brain transcriptome database to define gene sets associated with different cell types (2 2) they also found that the genetic profile of the cla ssical group was strongly associated with the muri n e astrocytic signature. Mesenchymal : lower expression or the loss of neurofibromin 1 ( NF1 ) due to focal hemizygous deletions of a region at 17q11 .2 is the feature o f this subclass. The loss of NF1 function is not due to gene silencing as no methylation probes were detected in or adjacent to the NF1 locus. The mutation of NF1 gene frequently correlates to that of phosphatase and tensin homolog ( PTEN ) The higher necrosis and inflamma t ory infiltration in the mesenchymal subtype may be the con s equence of high expression of genes in the tumor necrosis factor superfamily and nuclear factor kappa light chain enhancer of activated B cells protein complex ( N F B ) pathways, such as

PAGE 20

20 tumor necrosis factor receptor type 1 associated death domain protein ( TRADD ) v rel reticuloendotheliosis viral oncogene homolog B ( RELB ) tumor necrosis factor receptor superfamily member 1A ( TNFRSF1A ) Regarding neural cell types, the mesenchymal class was strongly associated with the microglial and cultured astroglial signatures (23) Proneural : this subclass was characterized with the alteration of platelet derived growth factor receptor ( PDGFRA ) and point mutation in iso citrate dehydrogenase 1 ( IDH1 ) which contribute to abnormal cell growth TP53 mutations and loss of heterozygosity were frequent events in this subtype. In addition, one of the features of classical group, chromosome 7 amplification paired with chromosome 10 loss, was sometimes occurred but only in 54% of proneural samples. Thi s class was enriched in the oligodendrocytic, but not astrocytic signature. This can be explained by the high expression of oligodendrocytic development genes such as PDGFRA, NK2 homeobox 2 ( NKX2 2 ) and oligodendrocyte lineage transcription factor 2 ( OLIG 2 ) Besides the difference in gene expression profile, t his subtype is also distinct from other groups with re spect to clinical correlat es GBM patients classified as the proneural group were significantly younger, and thus tended to have longer survival times However, TCGA data analysis revealed that aggressive treatment did not alter survival of patients in the proneural group while other subtypes responded well to treatment (24) Neural : this subclass was identified by the expression of neuron markers such as ne urofilament light polypeptide ( NEFL ) gamma aminobutyric acid A receptor 1 ( GABRA1 ) synaptotagmin 1 ( SYT1 ) and solute carrier family 12 member 5 ( SLC12A5 ) While this group also shared mutations in many of the same gene, it did not stand out from the ot hers as it did not have significantly lower or higher rates of mutations. The

PAGE 21

21 neural class showed association with oligodendrocytic and astrocytic signatures, in addition to strong enrichment for neuronal expressing genes. This subtype also contained relat ively olde r patients. Understanding the gene expression based molecular classification of GBM brings vital implication s for therapeutic strategies targeting GBM. The i dentification of molecular signatures among differ ent GBM subtypes could lead to diagno s tic test s to classify a patient to a specific subclass. These findings also suggest a rational e for developing personalized therapies in order to provide better beneficial effect in treatment of GBM patients Microglial I nfiltration in GBM A large proportion of microglia/macrophages cells are found within this type of malignant human glioma as well as mouse models of the disease (25 27) Generally, the se myeloid derived, macrophage like microglial cells function as the main form of immune defense in the central nervous system (28 32) When activated by pathological changes in the brain, they transform from a resting state to a pro inflammatory phenotype that is capable of phagocytosis, cytotoxicity, and antigen presentation through the high expression of major histocompatibility c omplex ( MHC ) class II molecules (28, 33 36) Opposite to their normal function in the immune system, glioma infiltrated microglia/macrophages show an anti inflammatory phenotype, in which the expression of MHC class II molecules is down regulated, especially in brain tumors with high malignancy (37 44) possibl y by glioma secreted factors, including interleukin 4 ( IL 4 ) interleukin 6 ( IL 6 ) interleukin 10 ( IL 10 ) and prostaglandin E2, (27) A positive

PAGE 22

22 correlation between the number of infiltrating microglia/macrophages and the proliferation rate of the tumor is also evident (25, 45) Thus, these immune cells are believed to contribute to the local immunosuppressive milieu of glioma, as well as promote tumor progression (46 48) Despite the potential importance of microglia/macrophages in glioma tumorigenesis, t he mechanism by which microglia/macrophages infiltrate into the tumor is still unknown. Increasing evidence supports the hypothesis that glioma regulates this mechanism through different factors, including HGF colony stimulated factors 1 ( CSF 1 ) granular colony stimulated factor ( G CSF ) (49 51) or possibly matrix metalloprotein ase 2 and 9 ( MMP 2 and MMP 9 ) which are found abundantly within glioma (52) Current studies strongly suggest this localization may require the presence of chemokines, a family of chemoattractant cytokines, in the tumor microenvironment (53 56) Glioma Stem Like Cancer Cells Within the microenvironment of GBM, CS L Cs lay at the pinnacle of the cellular hierarchy. The evidence for their existence was first reported in acute myeloid leukemia by fluorescent activated cell sorting ( FACS ) based on the expression of cell surface markers associated with normal hematopoietic stem cells (57) Since then, increasing studies demonstrated the presence of CS L Cs in other s olid tumors including breast, bone, liver, colon, prostate, pancreas, head and neck squamous cell carcinoma, and melanoma (58 64) The presence of CS L Cs in gliomas called glioma stem like cells ( GS L Cs ) was also documented (65, 66) In accordance with the similarity in cell surface marke rs to normal neural stem cells, GS L Cs should have an ability to maintain its own subpopulation via self renewal while recapitulat ing the phenotype of the parental tumor.

PAGE 23

23 Although the concept for the existence of G S L Cs is widely accepted, the standard for identifying this population both in vitro and in vivo with cell markers remains a point of debate CD133 (Prominin 1) is the first cell surface neural stem cell marker to be identified in human specimens (67) and is now widely used as a GS L C en riching marker O ther markers include CD44, CD24, CD15, Nestin, and sex determining region Y box 2 ( SOX2 ) It is reported that CD133 positive tumor cells share a similar gene expression profile with that of embryonic stem cells (68) Moreover, CD133 positive G SCs isolated from human GBM were capable of t umor initiation while the CD133negative cells from the same patients were not a ble to form solid tumors (58, 59, 65, 69, 70) Several studies have also reported the tumorigenic capacity of CD133 negative cells (69, 71, 72) This population with apparent stem cell like properties but disti nct molecular profiles and growth characteristics in vitro and in vivo (69) It is likely that these CD133 negative GS L C s express other stage specific embryonic antigen, such as AB5 and CD44, which were reported to enrich for GSCs independent of CD133 (72 74) Relating to a clinical aspect, CD133 positive cells showed more resistance to radiation or chemotherapy, when compared to the CD133 negative population (18) These data suggest that CD133 expression may correlate to poor prognosis, tumor recurrence, or fatal malignancy of GBM. Presented as a rare subpopulation within the heterogenous tumor microenvironment, GS L Cs have attract ed considerable attention. Increasing evidence suggest s that the GS L C population tends to locate to specific tumor niches that associate with either perivascular dom ains or hypoxi c regions Using different cancer stem cell markers, a number of s tud ies have shown that G SLC s are co localized with

PAGE 24

24 vascular endothelial cell markers such as CD34 and CD31 (75, 76) It is believed that residing in perivascular niches is necessary for GS L Cs to maintai n their cancer stem like properties, and to induce tumor growth in vivo (77, 78) The bidirectional interplay between GS L Cs and tumor vascular niches was elucidated when in vivo studies showed that GSCs can trans differentiate into endothelial cells (79 81) or into vascular pericytes to support vascular functions and tumor growth (82) In addition to the perivascular niche, the prevalence of a hypoxic niche in maintaining GS L Cs properties was also evident (83, 84) It has been show n that hypoxia inducible factor 1 ( HIF1 ) a critical indicator of hypoxia, could raise the stem like population over five fold determined by the percentage of CD133 expressing cells, in neurospheres. This enhancement paralleled the increase in clonogenicity by two fold (85) as well as the expansion of GS L Cs (86) Angiogenesis and Anti A ngiogenic Therapy i n GBM Prominent tumor vascularization is one of the two hallmarks of GBM that are used to distinguish it from the lower grade III glioma. In contrast to highly organized normal brain vas cul ature, tumor vessels in GBM are disorganized, highly permeable, hav e abnormal endothelial cell walls, pericyte coverage, and basement membrane structure (87) The presence of this abnormal tumor vascul ar network impair s BBB which results in brain edema, a serious life threatening symptom of patients with GBM. The formation of tumor blood vessels occurs through angiogenesis, which is mediated by the proliferation and migration of local endothelial cells, and vasculogenesis, which originates from bone marrow derived cells migrating to the tumor site (88, 89) Th e angiogenic process is orchestrated by the simultaneous increase in gene expression of

PAGE 25

25 VEGF FGF IL 6, IL 8 HIF 1 and angiopoietins. Among these fac tors, VEGF is the most common denominator required for angiogenesis through the VEGF receptor signaling pathway in GBM. Thus, it becomes a potential therapeutic target for GBM treatment. Targeting tumor angiogenesis has received significant attention becau se of its pivotal role in tumor progression. Therapeutic strategies that target angiogenesis have been proposed as an alternative treatment and have received great attention due to its beneficial effectiveness, particularly in highly vascularized tumors, s uch as GBM Tumor angiogenesis is strongly regulated by the VEGF/VEGFR system, of which both ligands and receptors have been found in malignant GBM (90 92) Thus, t argeting this signaling pathway may exert a detrimental effect on angiogenesis and improve survival benefit to patients with GBM. Data from clinical trials suggested that, in some pat ients with recurrent GBM treated with either anti VEGF antibodies (Bevacizumab, Aflibercept, etc.) or small molecular VEGF receptor tyrosine kinase inhibitors (e.g. Cediranib or Vandetanib), these agents could enhance 6 month progression free survival ( PFS ) as well as radio graphic responses (93 97) These promising clinical results prompt extensive studies on other potential VEGF/VEGFR signaling inhibitors for anti angiogenic therapy. Despite these achievements in prolonging the PFS, t hey failed to maintain an enduring overall survival benefit to patients. Under VEGF pathw ay inhibition with Bevacizumab for instance, a statistically significant increase in infiltrative tumor progression was identified in Bevacizumab responders (98 100) Several underl ying mechanisms for the tumor recurrence after anti VEGF therapy have been proposed (99) First, blocking VEGF signaling may stimulate other pro angiogenic factors to re

PAGE 26

26 establish tumor neovascularization, s uch as FGFs and angiopoietins (96, 101) Second, the depletion in oxygen and nutrient, as a result of vessel regression during anti angiogenic therapy, could recruit various bone marrow derived vascular progenitor cells to the tumor site in order to elicit new blood vessel network s (102 108) Third, the impair ment of neo vascular network by anti angiogenic agents can result in an increase in pericyte coverage to enhance tumor blood vessel integrity and protect them from disruption (88, 109 111) L astly, the suppression of neo vascularization after anti angiogenic therapy can induce novel invasive mechanism(s) to assist tumor cells to escape oxygen and nutrient deprivation (103, 112 114) The enhanced infiltrative relapse following Bevacizumab was observed when this agent was evaluated as either first or second line treatment (98, 100, 115) Even though the evidence suggests that enhanced tumor invasion may be a direct consequence of anti angiogenic therapy, the underlying mechanism that controls this phenomenon is still not completely understood. A recent published study proposed that the HGF/c MET signaling pathway may be involved in this enhanced invasive phenotype post anti angiogen ic therapy targeting VEGFRs (116) In the presence of anti angiogenic agents, VEGFR2 forms h eterodime rs with MET and this interaction causes the dissociation of protein tyrosine phosphatase 1B ( PTP1B ) from MET, thereby unmasking MET activity stimulating invasion of GBM cells. These data suggest that integrating VEGFR and MET inhibitors will prev ent tumor recurrence after anti angiogenic therapy. Chemokines and Chemokine Receptors Chemokines are small chemo attractant cytokines that contain over 5 0 members (117, 118) They are classified into four subgroups C, CC, CXC, and CX3C, based on

PAGE 27

27 the location of the first two cysteine residues at the N terminal region of the sequence These chemokines function through their seven transmemb rane G protein couple receptors ( GPCRs ) While the CC and CXC families have multiple members, the C family has only two chemokines (XCL1, 2) and one receptor (XCR1), and the CX3C family has one chemokine (CX3CR1) and one receptor (CX3CL1). In the CXC family the ligand s are further divided into two groups, according to the presence or abs ence of a Glu Leu Arg (ELR) motif (119) This ELR motif is located at the N terminus adjacent to the first cysteine amino acid residue. ELR + CXC chemokines have opposite functions to ELR CXC chemokines regarding angioge nesis (120) The ELR + chemokines promote angiogenesis by regulating neutrophil migration (117, 120, 121) On the other hand, ELR chemokines are angiostatic peptides (120, 122, 123) Most chemokines are secreted with the exception of CX3CL1 and CXCL16 (124) The relationship between chemokines and their receptors are promiscuous as s ome chemokine s bind to multiple receptors and some receptors in turn bind multiple chemokines, whereas certain chemokines interact with single receptor and some receptors bind only one chemokine As a result, there is a h igh degree of redundancy in their binding specificity and in the activation of downstream signaling pathways regulated by chemokine systems. First discovered as critical factor s that regulate leukocyte homing, chemokines and their receptors are commonly kn own for their functions not only in homeostasis but also in inflammatory response s during p ath ological processes (121, 122, 125 135) Chemokine Systems in Cancers Because of their contribution in inflammation, it is not surprising that chemokine systems have roles in cancer biology. Due to their chemoattractant property,

PAGE 28

28 chemokines and chemokine receptors are well known for guiding the migration of cells (118, 13 6 140) and thus regulating metastasis In this pivotal characteristic of cancer, chemokine r eceptors may potentially facil itate tumor dissemination at each of the key steps of metastasis, inc luding adherence of tumor cells to endothelium, extravasation from blood ve ssels, metastatic colonization, and protection from the host response via activation of key survival pathways such as extracellular signal regulated kinase ( ERK ) / motigen activated protein kinase ( MAPK ) phosphatidylinositol 3 and 4 kinase ( PI 3K ) / ( v akt murine thymoma viral oncogene homolog 1( AKT ) / mammalian target of rapamycin ( mTOR ) or Janus kinase ( JAK ) / signal transducer and activator of transcription ( STAT ) (141, 142) Moreover, d uring tumorigenesis, ch emokine networks play important roles in many processes required for tumor development, such as tumor growth, proliferation, invasion, angiogenesis and recruitment of immune cells to tumor microenvironment (143 147) In the case of GBM treatment with the CXCR4 antagonist, AMD 3100, inhibits growth of murine intracranial GBM and reduces the proliferation of tumor cells (148) We have determined that the CXCR3 antagonist, NBI 74330, decreases tumor growth and prolongs survival in glioma bearing mice (149) With regard to the interaction between microglia/macrophages and glioma, increasing evidence supports the participation of chemokines in glioma microglia/macrop hages crosstalk (150, 151) For example, CCL2 is a well described candidate for this function as an anti CCL2 antibody prevented the migration of microgli a/macrophages in response to CCL2 (152, 153) In contrast, recent evidence indicated that CCL7 (monocyte chemo attractant protein 3), but not CCL2, is indeed the chemokine responsible for this function since CCL7 was predominantly express ed in glioma cell

PAGE 29

29 lines and the expression level of CCL7 is correlated to the percentage of glioma infiltrated microglia/macrophages (GBM ) in glioma tissues (154) CCL5/CCR1/CCR3/CCR5 Another member of the CC family, CCL5 (alternatively named regulated on activation normal T cell expressed and secreted, or RANTES) also promotes macrophage and lymphocyte infiltration in various types of human cancers (155, 156) In a transplantable model of breast carcinoma, CCL5 was determined to be expressed by tumor cells, while its receptor, CCR5, was localized to infiltrating macrophages and lymphocytes. Furthermore, the dua l CCR1/CCR5 antagonist, Met CCL5, was able to reduce tumor growth and inhibit the migration of macrophages and lymphocytes into 410.4 tumors, suggesting a potential role of CCL5 in tumor promoting macrophage/lymphocyte infiltration (155) A query of the NCI REMBRANDT (National Cancer Institution REpository for Molecular BRAin Neoplasia DaTa) database using CCL5 as the search term, revealed an association between CCL5 expression and was evident in tumors having high CCL5 as compared to those characterized by intermediate levels of CCL5 ; insufficient numbers of patients with low CCL5 limited analysis of this patient population. The observations suggest a significant role of CCL5 within glioma, as well as a potential mechanism of immune and tumor cells interaction, through this ligand. CX CL11/CXCL12 and CXCR4 /CXCR7 CXCR4 and its ligand CXCL12 (SDF 1 ) is one of the common chemokine receptor/c hemokine pairs studied in the tumorigenesis Present in different types of

PAGE 30

30 cancer, including but not limited to pancreatic cancer (127) colon cancer (157) ovarian cancer (158) lymphoma (159) medu lloblastoma and glioma (134, 141, 148, 160) CXCL12 and CXCR4 are best known for their roles in metastasis, angiogenesis, and tumor growth (103, 127, 138, 141, 142, 148, 157, 158, 161 175) E vidence for CXCL12/CX CR4 function in metastasis has been described (138) The se investigators showed that CXCR4 was expressed by primary breast cancer cells while the ligand CXCL12 was highly detected in the lymph nodes, lungs, liver, and bone, all of which are frequent metastatic sites of breast cancer. Moreover, blocking CXCL12/CXCR4 interaction s with a neutralizing anti CXCR4 antibody impaired the metastasis of breast cancer cells to regional lymph nodes and lung in a xenograft model In the context of glioma, CXCR4 is elevated in GBM and grade III glioma co mpared with grade II glioma (176) L ike other cancers, the CXCL12/CXCR4 axis also contributes diverse role s in the malignancy of gliomas. CXCR4 is overexpressed in GBM derived sphere cultures when compared with the differentiated tumor cells and th e coexpression of CX CR4 with the progenitor cell marker CD133 was detected within cancer ous populations in specimens of human GBM (173) Moreover, studies from our group demonstrated the expression of CXCR4 was increased in the slow cycling population of primary patient derived GBM cells, which are enriched in GS L C markers (177) The presence of both CXCL12 and CXCR4 in the tumor regions characterized by necrosis and angiogenesis suggests the possibility for their involvement in angiogenic regulation (161, 178) CXCR4 expression is primarily under the control of HIF 1 in hypoxic pseudopalisading cells in and around areas of ne crosis, whereas VEGF released by these cells is responsible for CXCR4 upregulation in microvessels (169, 179) The activation of CXCR4 by CXCL12 also

PAGE 31

31 promo ted mobilization of bone marrow cells, which were the n recruited to form new vessels (103) The fact that CXCL12 is strongly expressed in neurons, blood vessels, subpial regions, and whit e matter tracts that form the basis of structures, and that CXCR4 is dominant in invading glioma cells implies additional function of CXCL12/CXCR4 in tumor invasion and growth possibly through the activation of metalloproteinases MMP 2 and MMP 9 (179) Although no direct in vivo studies for CXCL12 regulated gl ioma invasion were reported, evidence for promoting in vitro migration of glioma cells by CXCL12 a re well established (146, 162, 177) In addition, targeting CXCR4 with AMD3100, a CXCR4 antagonist, inhibited the growth of murine intracranial GBM and the proliferation of tumor cells (180) Besides CXCR4, CXCL12 was recently found to have additional interaction s with another chemokine receptor, named CXCR7. The presence of this receptor was discovered when murine fetal liver cells from CXCR4 knockout mice could still bind CXCL 12 and discrepancies were observed between CXCR4 expression and CXCL12 binding affinity in several human cancer cell lines (165) The expression of CXCR7 was reported in many tumor cell lines, in tumor associated endothe lial cells as well as in vascular endothelium (165, 181, 182) These characte ristics suggest that CXCR7 plays a role in regulat ing cancer biology. Unlike CXCR4 the property of CXCR7 in GPCR mediat ed signaling transduction is not understood Several mechanisms underlying CXCR7 function have been proposed. One role that CXCR7 may play is to scavenge or sequester CXCL12, thereby gen erating gradients of CXCL12 that lead to di fferential signaling by CXCR4 (183) Another role for the receptor is that it may ser ve as a co receptor for CXCR4 and enhanc ing CXCL12 mediate d G i/o pro tein signaling via CXCR4

PAGE 32

32 as the two receptors form heterodimers in the context of overexpression in transiently transfected cells. These observations suggest that ligand binding to CXCR7 results in crosstalk with CXCR4 mediated by intr acellular signaling molecules (184, 185) More arrestin in a ligand arrestin bias ed r eceptor (184) In GBM a recent study has reported that while CXCR4 is involved in regulating cancer stem like functions of tumor cells, CXCR7 ha s a distinct role in controlling apopto sis of bulk tumor population of cells (186) However, our results show that CXCR4 and CXCR7 have overlapping functions in the regulation of stem like properties of GBM cells (177) Therefore, the CXCL12 CXCR4 CXCR7 axis in cancers could be more complicated and the direct and indirect activities of CXCR7 may play crit ical roles in tumor progression. G BM Models Murine Glioma 261 (GL261) Model The GL261 model was originally developed by Seligman and Shear through intracranial implantation of 20 methylcholanthrene pellets into the brains of C57BL/6 mice (187) This syngeneic model mimics closely the growth properties and immune response of human GBM. Pathological analyses showed that GL261 tumors represent diffusely infiltrating and invasive characteristics. The invading cells in this model display secondary structure of Scherer. Similar to human GBM, GL261 tumors also have highly vascular and necro tic area which express CXCR4, CD31, HIF 1, and VEGF (71) Based on the similar characteristics with human GBM and the immune sufficient property (188) GL261 is a strong model for our study that focuses on the role of

PAGE 33

33 chemokine CCL5 and its re ce ptors CCR1/CCR3/CCR5 in crosstalk mechanisms betwe en tumors and host immune cells within the tumor microenvironment. Human Gliomasphere Model With the appreciation of the concept of cancer stem like cells i n glioma biology, the utility of neuros p heres as a model to study GBM has received extensive attent ion from researchers (189) Fine and colleagues have proposed that GBM stem cells from the gliomasphere culture model have a considerable advantage over traditional serum cultured models in which tumor cell lines were cultured as an adherent monolayer (190) When cultured in stem cell enriched gliomasphere conditions ( NBE, serum free medium supplemented with B27, human recombinant EGF, and b F GF) tumor cells derived from primary GBMs have remarkable simila rity to normal neural stem cells including the ability to form neurospheres in vitro potential for indefinite self renewal, ability for differentiation into glial and neuronal lineages, the resemblance of gene expression profile to NSCs, and genetic stab ility through serial in vitro passage. More importantly, tumor cells cultured in NBE condition harbor all genetic aberration s and in vivo phenotype of the parental primary GBM from which they were derived. Taking advantage of this model, we have establishe d our studies on neurospheres from five different primary patient derived GBM cell lines, which have been confirmed to have genotypic and phenotypic similarity to parental tumors. Moreover, these gliomaspheres expressed chemokine and chemokine receptor pat terns of interest The diversity in different GBM cell lines and the unique characteristic of gliomaspheres provided us a powerful tool to explore the role of chemokine system s in regulating GBM progression.

PAGE 34

34 Significance and Specific Aims Chemokines and chemokine receptors have significant contributions in many physiological processes required for normal development as well as tumorigenesis. C hemokine systems control many different tumor events, including but not limited to tumor growth, migration, angiogenesis, metastasis, and recruitment of immunosuppressive cells into the tumor microenvironment. Thus targeting chemokine systems are an emergi ng therapeutic strategy to treat cancer. Indeed, a vast number of studies have been conducted in many different types of cancer However, the roles of chemokine systems in gliomagenesis and progression remain un characteriz ed Studying chemokine and chemoki ne receptor functions in the scheme of GBM is a challenging task due to the heterogeneity of GBM microenvironment and the promiscuous relationship between chemokines and their receptors. In this project, we elucidated the roles of various chemokine system s in different aspects of glioma biology. Focusing on the functions of chemokine systems in GBM will not only provide more understanding of basic mechanisms of tumor biology but also suggest potential therapeutic strategy for future treatment of GBM. The S pecific A ims of this project include d : 1. Detect ing the expression of chemokines and chemokine receptors in murine and human GBM cell lines and in xenograft tumors. Understanding the expression profile of chemokines and chemokine receptors is crucial for fur ther analysis of their functions in GBM. Expression of different chemokines and receptors in murine GL261, traditionally used human GBM cells and primary patient derived GBM cell lines was characterized Reverse transcription polymerase chain reaction ( RT PCR ) flow cytometry,

PAGE 35

35 immunocytochemistry, and protein array analyses were used to detect in vitro mRNA and protein levels of various chemokines and chemokine receptors under study Their in vivo expression was also examined using in situ hybridization and immunohistochemi cal methods. 2. Evaluat ing the impact of chemokine receptor deficiency in the recruitment of microglia and other immune cells into GBM Chemokine receptors were hypothesized to mediate the migration of microglia and lymphocytes into tumors. The chemokine expression profile determined in aim 1 provided us candidate chemokine receptors to study the recruitment of tumor infiltrating immune cells. Using multiple chemokine receptor deficient mice, we examined the number of microglia and lymphocytes within GBM tumors from wild type and chemokine receptor deficient animals. 3. Determin ing the role of chemokine systems in regulating cancer stem like cell properties of GBM The role of chemokine system in cancer stem like propert ies of glioma cells was not well defined. In this project, we elucidated the role of chemokines and their receptors in regulating the stem like functions of primary patient derived GBM cell lines using different in vitro functional assays, including migrat ion, sphere formation, short term proliferation, and tube formation. The ability of these cells to initiat e tumor s in vivo was also evaluated through the implantation of these cells to the brain s of immune deficient mice. 4. Study ing the impact of chemokine r eceptor deficiency on the survival of GBM bearing mice. A goal related to Aim 3 involved evaluat ing inhibiti on of chemokine receptors using pharmacological approaches in order to test the possibility of using chemokine

PAGE 36

36 receptor antagonists as chemotherapy drugs. Murine and human GBM cells were co incubated with chemokines and paired receptor inhibitors to determine the tumor cell growth rates in vitro In addition, glioma bearing animals were treated with a specific chem okine receptor antagonist and Kaplan Me i er survival analysis was performed to address this aim. 5. Address ing underl ying mechanism s that regulate chemokine receptor post anti VEGF /VEGFR inhibition It is crucial to understand the underl ying mechanism that re gulates a biological event Taking the complexity of signaling network in cancer biology, the crosstalk between signaling pathways to mediate tumor cell functions is not uncommon. In this study we stud ied the underl ying mechanism that regulated the VEGFR d ependent expression of CXCR4. The impact of HGF/Met and TGF /TGF R signaling pathways on the regulation of CXCR4 expression by VEGFR inhibitors was evaluated with pharmacological approaches, including exogenous ligands and inhibitors targeting these pathwa ys. The effect of these molecular targeted agents o n CXCR4 expression was measured with flow cytometry.

PAGE 37

37 CHAPTER 2 MATERIALS AND METHODS Animals Wild type (WT) C57BL/6 mice were obtained from either Jack son Laboratories (Bar Harbor, ME) or Taconic Inc. (Hudson, NY) CCR1 and CCR5 mice, backcrossed to the C57BL/6 background for greater than 10 generations, were obtained from Taconic Inc. and Jackson Laboratories respectively NOD scid IL2R null (NSG) m ice were from Jackson Laboratories All procedures involving mice were carried out in accordance with the guidelines of the University of Florida Institutional Animal Care and Use Committee (IACUC). Cell Culture The GL261 glioma cell line was maintained i n Roswell Park Memorial Institu t e medium ( RPMI ) 1640 medium supplemented with 10 % heat inactivated fetal bovine serum ( FBS ) 1% penicillin streptomycin, 4 mM L glutamine. The U118 glioma cell line w as maintained in DME M ) supplemented with 10 % heat inactivated FBS 1% penicillin streptomycin, 2 mM L glutamine. The T98G, and U87 glioma cell lines were maintained in EMEM ) supplemented with 10 % heat inactivated FBS, 1% penicillin streptomycin, 1% sodium pyruvate and 2 mM L glutamine. All gliomaspheres (GS) were cultured in DMEM/F12 medium supplemented with 2% B27, 20 ng/m L of epithelial growth factor ( EGF ) and basic fibroblast growth factor ( b FGF ) L of heparin and 1% penicillin streptomycin. All the cells were grown in a humidified incubator at 37 C with 5% CO2. DMEM, EMEM RPMI 1640, DMEM/F12 medium, B27, EGF, bFGF, L glutamine and

PAGE 38

38 antibiotics were obtained from Gib co BRL (Invitrogen ). Sodium pyruvate and heparin were purchased f rom Sigma Aldrich FBS was from HyClone (Thermo Scientific ). Primary Microglia Isolation Primary microglia were harvested from postnatal one day old mouse pups using a previously published protocol (191) Brief ly, brain tissue was removed, mechanically and enzymatically dissociated, and kept in medium A containing 0.585% of glucose (Sigma Aldrich), 15 mM 2 [4 (2hydroxyethyl)piperazin 1 yl] ethane sulfonic acid ( HEPES ) 100 L penicillin, and 100 g/m L streptom ycin in solution ( HBSS ) (Gibco). The finely minced brain tissue was incubated in 0.25% trypsin medium (Gibco) for 30 45 min at 37 o C. T he medium was aspirated and replaced with trypsin inhibitor medium (Invitrogen). After incubation for 4 min at room temperature, the tissue was triturated with a fire polished glass pipette and then centrifuged for 15 min at 100xg. The supernatant was aspi rated and the cell suspension was plated in T75 flasks with DMEM/F12 medium supplemented with 10% FBS, 1% sodium pyruvate, and 1% penicillin and streptomycin. Culture medium was changed every 3 4 days. After 15 days, cultures were treated with 0.0625% tryp sin ethylenediaminetetraacetic acid ( EDTA ) (diluted in DMEM/F12) for 1 h at 37 o C to lift astrocytes and neurons from the flasks, leaving an essentially pure culture of primary microglia. The cultures were checked for purity and found to be greater than 97% microglia as measured by cell type specific expression of CD11b. Purified primary microglia were collected using 2.5% trypsin with EDTA for RT PCR and migration analyses.

PAGE 39

39 Reverse Transcription Po lymerase Chain Reaction Total RNA was isolated from gliom a cells with the TRIzol reagent (Invitrogen) removed by RQ1 RNase free DNase treatment (Promega ). Total RNA was then quantified and stored at 80C. RNA (1 with iScript complementary DNA (cDNA) synth esis kit (Bio Rad ). Synthesized cDNA was subjected to polymerase chain reaction analysis. Polymerase chain reaction (PCR) was performed by heating for 96 C for 2 min, followed by amplification for 35 cycles: 96 C for 30s, 56C for 1 min and 72C for 1 min. Touchdown PCR was utilized in some cases. For touchdown PCR, the annealing temperature started at 65C and was decreased by 1C every cycle for 15 cycles and reached 50C. 50C was then used for the remaining number of cycles. The parameters of denaturing and elongating temperatures were the same as regular PCR protocol. All primers used in the studies and p redicted PCR pro duct sizes are listed in Table 2 1 Cytokine Protein Array The presence of cytokines in GL261 cell conditioned medium was determined by mouse cytokine antibody array (R&D System, Minneapolis, MN). Membranes were treated with blocking buffer and incubated for 30 min at room temperature. The membrane was then exposed to an aliquot (1 m L ) of GL2 61 conditioned medium and incubated for 1 h at room temperature. After this incubation period, the membranes were washed five times with a washing buffer and incubated for 1 h at room temperature with biotin conjugated antibodies against murine cytokines ( dilution: 1:250 dilution). Thereafter, the membranes were washed five times, incubated for 1 h at room

PAGE 40

40 temperature with horseradish peroxidase (HRP) conjugated streptavidin (dilution: 1:1000) and washed five times again. Finally, the reaction was developed in a mixture of SuperSignal West Pico luminol/enhancer and stable peroxide solutions (Thermo Scientific, Rockford, IL) and exposed to X ray film. The densities of signals on films were then analyzed with ImageJ software (NIH). This experiment was performe d in duplicate. In Situ Hyb ridization In situ hybridization ( ISH ) was performed as described prev iously (Harrison et al., 2003). Briefly, ISH probes were generated by PCR using cDNA synthesized from total RNA extracted from GL261 glioma cells. DNA fragments were cloned into pGEM 7 (Promega). To generate the antisense and sense (c)RNA hybridization probes, plasmids were linearized and then subjected to in vitro transcription using eit her T7 or SP6 RNA polymerase in the presence of [ 33 P]UTP. Brain sections were hybridized separately with antisense and sense probes. In all cases, no signals were detected in apposed to film and subsequently dipped in LM 1 emulsion and stored at 4 C. Slides were developed (after exposure for 1 4 weeks), fixed, and counterstained with hematoxylin and eosin. Multiple sections from tumor bearing animals were analyzed and included the following number of mice: 11 wild type (JAX Laboratory); 9 wild type (Taconic Inc ) ; 7 CC R1 / ; 2 CCR5 / Immunocytochemistry Gliomaspheres were harvested and gently dissociated with diluted Accumax solution in PBS (1:500). Cells were then blocked with 2% BSA in PB S for 1 hr, incubated with mouse anti human CXCR4 antibody (R&D Systems) for 1 hr and with

PAGE 41

41 goat anti mouse IgG Alexa 488 for 1 hr. Washing steps were performed with PBS (3 times, 5 min each) between the staining s teps Finally, the sections were counterstained with DAPI, mounted with aqueous mounting solution and subjected to photography with Zeiss fluorescent microscope at 20X and 40X objectives Immunohistochemistry For immunohistochemistry, brain sections were heated for 30 min at 70 o C, depara ffinized in Xylene (3x 5 min), and then rehydrated by ste pwise immersion in 100% EtOH (2x 5 min ), 95% EtOH (2x5 min), and 70% EtOH (1x3 min) After deparaffinization, the samples were rinsed with deionized water and processed to antigen retrieval with sodium citrate buffer, pH 6, for 30 min at 98 o C. After cooled down to room temperature, the samples were washed with deionized water for 5 min, quenched with 3% H 2 O 2 for 10 min at room temperature to block endogenous peroxidase activities, and processed to stand ard immunohistochemistry staining. Briefly, the sections were initially blocked with 5 % BSA in TBS T for 1 hr, incubated with primary antibodies overnight at 4 o C, and then with secondary antibodies for 1 hr at the room temperature. Washing step s were performed with TBS T (3 times, 5 min each). Finally, the sections were counterstained with DAPI for imaging with fluorescent microscope diamino benzidine (DAB) kit as manufacture r The following primary antibodies were used: rat anti CD4 (dilution 1:50, BD Pharmingen), rat anti CD8 (dilution 1:50, Serotec), rat anti CD11b (dilution 1:50, Serotec), mouse anti human Nestin (dilution 1:100, Thermo Fisher Scientific, MA), rabbit anti human Nestin (1:100, Abcam), mouse anti h uman CXCR4 (dilution 1:50, R&D Systems). The secondary antibodies were used: goat anti rat IgG Alexa 594, goat anti rabbit IgG Alexa 594, goat

PAGE 42

42 anti mouse IgG Alexa 594, goat anti mouse IgG Alexa 488 (1:500, Invitrogen), goat anti mouse HRP conjugated IgG ( 1:3000, Perkin Elmer). For quantification of CD4+, CD8+, and CD11b+ cells, the number of cells in three high powered field s ( the visible area under 20X magnificatio n) in three sections from multiple animals were calculated to determine the mean and standar d error of mean. The data were subjected to statistical analysis (one tail T test). The numbers of animals used in each group are indicated in the graphs. Flow Cytometry Gliomaspheres were dissociated with Accumax solution (Innovative Cell Technologies, Inc.) washed with ice cold PBS and subsequently incubated in blocking solution containing in 5% BSA diluted in PBS for 15 min at room temperature. Cells were then incubated with specifi c antibody for 30 min on ice. Mouse anti human CXCR4 allophycocyanin ( APC ) mouse anti CXCR7 phycoerythrin ( PE ) mouse anti CXCR3 PE (dilution 1:10, R&D Systems) Samples were then washed and analyzed with BD LSR II system (BD Biosciences). Dead cells were excluded by DAPI staining. All data were analyzed by FlowJo software version 7.6 (Tree Star). Each experiment was repeated at least three times with different cell preparations. Migration Assay In vitro migration assays were performed using 24 well trans well units with 8 polycarbonate filters (BD Falcon, Franklin Lakes, NJ). After tr ypsinization with 2.5% trypsin, microglia (2x10 4 cells) were placed in the top compartment free DMEM/F12 with or without 50nM of Met CCL5. The bottom well of serum free DMEM/F12 with or without 20nM of CCL5.The plates were incubated for

PAGE 43

43 24 hours at 37 0 C. Non migrating cells were removed by wiping the upper side of the insert with a cotton swab. Migrating cells were fixed with 4% paraformaldehyde for 20 min at room tempera ture, stained with hematoxylin, and quantified by counting the number of cells on 4 random areas on the lower side of the membrane. Each experiment was performed in triplicate and repeated three times using differ ent microglial preparations. Short T erm Proliferation Assay Cells were plated in 48 well plates at a density of 10 cells per l and treated with multiple concentration of CXCL11 (0.3 nM, 1 nM, 3 nM, 10 nM, 30 nM). After 7 days with L0 and 9 days with L1 l ine, spheres were dissociated with Accumax solution and counted. Cells cultured in medium without CXCL11 served as the control. Each experiment was performed in triplicate and three independent experiments were repeated with different ba tch es of cell prepa ration s Sphere Formation Assay Primary sphere formation assays were performed to quantify stem like cell frequency within primary GBM cells. Cells were plated in 384 well plates at a density of 500 cells per well per 50 multiple concentrations of CXCL11 (0.3 nM, 1 nM, 3 nM, 10 nM, 30 nM) Sphere numbers were quantitated after 9 days of incubation. Each experiment w as performed in triplicate and three independent experiments were established. Apoptosis Assay Cells were pl ated in 6 well plates at a density of 5x10 4 cells per m L at day 0 in culture medium. To induce apoptosis, TMZ at a concentration of 500 M (Sigma

PAGE 44

44 Aldrich, MO) was added to the sphere cultures at day 4, 5, and 6, in the presence and absence of CXCL12 (5 nM) At day 7, cells were collected, stained with a cell permeable, FITC conjugated irreversible pan caspase inhibitor (ApoStat, R&D Systems, Minneapolis, MN) according to the man u cytometry analysis to quantitate caspase activity of cells undergoing apoptosis. Unstained samples were included as controls to determine nonspecific staining in each treated group. The experiment was performed at least three times independently. Tube Formation Assay Cell were dispersed into single cells and cultured in Matrigel (BD Biosciences, CA) coated 48 well plate s at a density of 45,000 cells per well, with serum free M131 medium supplemented with 5% of microvascular growth supplement (Invitrogen, CA). the cell s were treated with 20 nM of CXCL12, with or without 1 M of AMD3100, or 100 nM of CCX733, CCX771, or CCX704. After 48hr, cells were stained with 2 g/m L of AM Calcein fluorescent dye (BD Biociences, CA) and photographed with Zeiss inverted microscope. Tota l tube length, tube area, and branch points were measured using Metamorph software. Three experiments were repeated independently. Intracranial Injection of Glioma Cells GL261 glioma cells or primary patient derived GBM cells (10 5 cells/ L /brain) were injected 3 mm deep into the right cerebral hemisphere (1 mm posterior and 2 mm lateral from Bregma) of wild type C57/B6, CCR1 and CCR5 deficient mice or NSG mice Tumor bearing mice were enthanized using sodium pentobarbital (32 mg/kg) and subsequently perfused with 0.9% saline followed by buffered 4% paraformaldehyde (PFA). Brains were surgically removed and post fixed with 4% PFA. After fixation,

PAGE 45

45 brains were processed to paraffin embedment sectio ned using a microtome and subjected to H&E staining, in situ hybridization, or immunohistochemi cal analysis. AMD3100 and Cediranib Treatments AMD3100 was purchased from To cr is Bioscience (UK) and Cediranib (AZD 2171) was generously provided by Dr. Dietma r Siemann. Cediranib was delivered with oral gavage at the dose of 6 mg/kg, once a day, in 10% Tween 80 diluted in PBS after 2 week of surgery, for 4 weeks. Animals also received AMD3100 treatment alone or in combination with Cediranib, at the dose of 5 mg /kg, twice a day in sterile PBS injected subcutaneously, beginning from the 4 th week after implantation for 2 weeks A control group of mice was treated with vehicle only. Number s of mice in each treated group are indicated on the survival curve. Kaplan Meier Survival Analysis For Kaplan Meier survival analysis, percentages of surviving mice in each group of animals were recorded daily after GBM cells implantation. The endpoint was defined by a lack of physical activity and a body weight reduction of greater than 15 %. The data were subjected to Log rank analysis in order to determine if significant differences existed in survival between the experimental groups. Statistical Analysis All data were presented as mean and s tandard error of mean. The difference in mean s between group s w ere subjected to analy sis using s test with one tailed distribution and alpha 0.05 Survival data were subjected to log rank test to determine statistically significant differences between groups. Result with a p value <0.05 was considered significant and was indicated in the figures or figure legends.

PAGE 46

46 Table 2 1 List of primers used for RT PCR analyses. Genes Primers Product Sizes (base pair) Murine CCL5 ggtaccatgaagatctctgca 335 R: agcaagccatgacagggaagc Murine CCR1 gtggtgggcaatgtcctagt 628 tcagattgtagggggtccag Murine CCR5 tcagttccgacctatatctatg 540 gtggaaaatgaggactgcatgt Murine CX3CR1 atgccatgtgcaaagctca 508 R: cttcatgtcacaactggg Murine GAPDH aaatggtgaaggtcggtgtg 314 tctccatggtggtgaagaca Human CCL5 cgtgcccacatcaaggag 207 ggacaagagcaagcagaaac Human CXCL11 cctggggtaaaagcagtgaa 768 R: tggggaaagagtgtgtatttg Human CXCR4 ggccctcaagaccacagtca 352 ttagctggagtgaaaacttgaag Human CXCR7 gcagagctcacagttgttgc 726 ccggcagtaggtctcattgt Human Actin ctcttccagccttccttcct 442 R: caccttcaccgttccagttt Human VEGF gaagtggtgaagttcatggatgtc 541 cgatcgttctgtatcagtctttcc Human VEGFR1 gcaccttggttgtggctgac 585 cgtgctgcttcctggtcc Human VEGFR2 gtcaagggaaagactacgttgg 591 R: agcagtccagcatggtctg Human VEGFR3 cccacgcagacatcaagacg 380 tgcagaactccacgatcacc Human HGF ctcacacccgctgggagtac 104 tccttgaccttggatgcattc Human c Met acagtggcatgtcaacatcgct 656 R: gctcggtagtctacagattc tggtggaaacccacaacgaa 627 tggtggaaacccacaacgaa tcttcccctccgaaaatgcc 636 aaagtggacgtaggcagcaa acccaggaaaacaccgagtc 498 R: atcctcattgtccacgccttt caaccgcactgtcattcacc 701 cttcaggggccatgtaccttt gcacgttcagaagtcggatgt 514 gaggctgatgcctgtcactt cggcttgaaaataatgcagagg 645 R: cacgatttcaggtcgggtga

PAGE 47

47 CHAPTER 3 ROLE OF CCL5 IN MICROGLIA/MACROPHAGES G BM CROSSTALK The presence of microglia/macrophages cells is documented within tumor environment of human glioma as well as mouse models of the disease (25 27, 192) Opposite to their normal function in the immune system, glioma infiltrated microglia/macrophages show an anti inflammatory phenotype, in which the expression of MHC cl ass II molecules is down regulated, especially in brain tumors with high malignancy (37, 40, 41, 193, 194) A positive correlation between the number of infiltrating microglia/macrophages and the proliferation rate of the tumor is also evident (25, 45) Thus, these immune cells are believed to contribute to the local immunosuppressive milieu of glioma, as well as promote tumor progression (195 197) Despite the pote ntial importance of microglia/macrophages in glioma tumorigenesis, the mechanism by which microglia/macrophages infiltrate into the tumor is still unknown. Current studies strongly suggest this localization may require the presence of chemokines, a family of chemoattractant cytokines, in the tumor microenvironment (56, 152, 153, 198) A query of the NCI REMBRANDT (National Cancer Institution REpository for Molecular BRAin Neoplasia DaTa) database using CCL5 as the search term, revealed patients. A significantly shorter mean survival time was evident in tumors having high CCL5 as compared to those characterized by intermediate levels of CCL5; insufficient numbers of patients with low CCL5 limited analysis of this patient population. The observations suggest a significant role of CCL5 within glioma, as well as a potential mechanism of immune and tumor cells interaction, through this ligand.

PAGE 48

48 Although the expression of CCL5 and its receptors, CCR1 and CCR5, is documented in different cancer models, no study on the role of the CCL5/CCR1/CCR5 axis in GBM has been reported. Herein, we establish that CCL5 is highly expressed in murine and human GBM cell lines, and found a bundantly in tumors of GBM bearing mice where CCR1 and CCR5 are also expressed. Individual deletion of either CCR1 or CCR5 had little to no impact on survival rates of GBM bearing or the numbers of tumor infiltrated immune CD11b + CD4 + and CD8 + cells. An in vitro analysis showed that CCR1 and CCR5 were expressed by primary microglia suggesting functional redundancy in this system. Indeed, the dual CCR1/CCR5 antagonist, Met CCL5, was able to inhibit CCL5 dependent migration of wild type, CCR1 and CCR5 defi cient microglia. Collectively, the results indicate that the infiltration of microglia/macrophages into GBM as well as the survival of tumor bearing mice, does not solely depend on either CCR1 or CCR5 but suggests a potential mechanism of redundancy, wher e CCL5 directs the infiltration of microglia/macrophages into GBM through both CCR1 and CCR5. Results CCL5 Is Expressed by Murine GL261 and Human GBM Cell Lines Because the chemokine CCL5 has been found in various types of tumor, including prostate, cervical, and breast cancers (199, 200) we were interested in determining if CCL5 was also present in GBM The expression of CCL5 in vitro was assessed by RT PCR analysis in the murine GL261 GBM cell line. The re sults showed that CCL5 mRNA was present in cells cultured as adherent monolayers and under culture condition s that favored formation of gliomaspheres; increased levels of CCL5

PAGE 49

49 mRNA were noted in the gliomaspheres. In addition, CCL5 peptide was detected in the GL261 conditioned medium, using a cytokine protein array ( Fig. 3 1 A ), indicating that GL261 cells are capable of both producing and releasing CCL5 protein. The expression of this chemokine was also identified in several different human GBM cells. CCL5 mRNA, detected by RT PCR analysis, was found in primary patient derived lines L0, L1, and L2 that were cultured under serum free condition in the presence of EGF and bFGF, as well as the commonly used GBM lines T98G, U87, and U118 cultured in the presence of serum ( Fig. 3 1 B ). None of the lines expressed CCR1 and CCR5 (data not shown). CCL5, CCR1, and CCR5 Are Present in Murine GL261 G BM The in vivo expression of CCL5 in the tissues taken from GL261 GBM bearing wild type mice was evaluated by RT PCR and in situ hybridization analyses. In both cases, mRNA levels of CCL5 were significantly elevated in the tumor tissue, when compared to the normal brain area ( Fig. 3 2 A, B ). Together with the in vitro data above, these results suggested that tumor cells are the primary source for CCL5 production within GBM In addition, the two major receptors of this chemokine, CCR1 and CCR5, were strongly detected in the tumor tissues ( Fig. 3 2 A, C ). We also evaluated the expression of CCR3, another low affinity CCL5 receptor. The lack of signal of this receptor from in situ hybridization analysis indicated that CCR3 was not expressed in intracranial GL261 GBM s ( Fig. 3 2C ). Immunohistochemical localization of CCR1 and CCR5 within the tumors was evaluated but the lack of availab ility of suitable antibodies precluded definitive identification of these receptors.

PAGE 50

50 The expression of CCL5 and its receptors, CCR1 and CCR5, was also analyzed in the tissues collected from tumor bearing CCR1 / and CCR5 / mice. In situ hybridization anal ysis showed that CCL5 was expressed at high levels within tumors of these animals, suggesting that CCR1 and CCR5 deficiency did not affect the expression of this chemokine within the tumor. In contrast, while both CCR1 and CCR5 were present in the tumors f rom wild type mice, the signals for CCR1 and CCR5 were obviously diminished in GBM s from CCR1 / and CCR5 / mice, respectively ( Fig. 3 2C ). This observation indicates that intratumoral CCR1 and CCR5 expressing cells are derived from the recipient mice, a nd not from the culture derived GL261 GBM cells that were implanted into the animals. Neither CCR1 nor CCR5 Deficiency Contributed to the Infiltration of Immune Cells into G BM or Impacted the Survival of Tumor Bearing Mice To evaluate the hypothesis that CCL5 directs the localization of microglia/macrophages into GBM in a CCR1 or CCR5 dependent manner, we characterized immune cell infiltration and animal survival in tumor bearing CCR1 and CCR5 deficient mice. Immunohistochemical analysis was performed to investigate if CCR1 and CCR5 regulated the infiltration of immune cells, including CD11b + microglia/macrophages, CD4 + and CD8 + T cells, into GBM Quantitative analysis did not show any statistically significant differences in the number of these cells loca ted within the GBM s of tumor bearing CCR1 / and CCR5 / mice, as compared to the wild type animals ( Fig. 3 3A ). The effect of CCR1 and CCR5 deficiency on the survival of GBM bearing mice among wild type, CCR1 / and CCR5 / groups was also assessed using Kaplan Meier survival analysis. No significant difference in the survival rate between tumor bearing wild type and CCR5 / groups were evident (p value = 0.77). The life

PAGE 51

51 span of GBM bearing CCR1 / mice, however, was slightly shorter than t he life span of the wild type (p value = 0.0007). The median survival time of tumor bearing CCR1 / mice after GL261 cell implantation was 19 days, while that of GBM bearing wild type mice was 22 days ( Fig. 3 3B ). Together, these results suggest that CCR1 and CCR5 deficiency had no impact on the infiltration of CD11 + CD4 + and CD8 + immune cells into GBM and at best, only a modest effect on the survival rate of tumor bearing mice. CCL5 Interacted with Its Microglia/Macrophages Expressed Receptors, CCR1 an d CCR5, in a Redundant Manner The in vitro expression of CCR1 and CCR5 was determined on primary cultures of microglia derived from wild type, CCR1 / and CCR5 / mice. Both CCR1 and CCR5 mRNAs were detected in microglia using RT PCR analysis, suggestin g that these CCL5 receptors are co expressed by these cells in vitro (Fig. 3 4A). The absence of CCR1 and CCR5 mRNA signals in CCR1 / and CCR5 / mice, respectively, confirmed that these gene products were deleted in the microglia derived from the CCR1 a nd CCR5 deficient animals. CX3CR1, a microglia/macrophages expressed chemokine receptor, was detected in microglial cultures from all of the animals. We also pursued the expression of CCR1 and CCR5 protein by microglia in vitro but similar to our attempts to detect these receptors in vivo the lack of quality antibodies reactive towards murine CCR1 and CCR5 posed significant challenges to identifying these receptors. The presence of CCL5 receptors CCR1 and CCR5 in microglia encouraged us to ask the questio n if CCL5 could direct the migration of microglia in vitro Using modified Boyden chamber assay, we showed that microglia migrated toward CCL5 gradient in a dose dependent manner (Fig. 3 4B). Moreover, this migratory effect may be regulated by MMP2, MMP9, and MMP14, as mRNA levels were upregulated by CCL5 (Fig. 3 4C).

PAGE 52

52 These matrix metalloproteinases are well known for their function in migratory process of tumor cells. Opposite to these in vitro data, our in vivo data reported above showed that neither CCR1 nor CCR5 contribute individually to the action of CCL5 on the localization of microglia/macrophages into GBM, as well as the survival of tumor bearing mice. We next examined the possibility that CCL5 may interact with CCR1 and CCR5 in a redundant manner. Indeed, migration of wild type, as well as CCR1 / and CCR5 / microglia was stimulated by CCL5. Met CCL5, a modified form of CCL5 that has antagonist activity at both CCR1 and CCR5, completely blocked the migration by CCL5 in all groups (Fig. 3 4D). Discu ssion The presence of a high number of infiltrated microglia/macrophages within glioma, confirmed by various studies both in human glioma and rodent models of the disease (25, 26, 192), has prompted further investigations into the role of these immune competent cells within the tumor microenvironment. Accumulating evidence suggests that microglia/macrophages facilitate glioma growth by contributing to the immunosuppressive environment and directly assisting in tumor growth and invasion (45, 150, 197, 201, 202). U nderstanding the mechanisms by which microglia/macrophages cells are localized to glioma will provide novel therapeutic targets for intervention. Here we report on the expression of CCL5 and its receptors, CCR1 and CCR5, in GBM. Our data demonstrate that C CL5 is highly expressed by human GBM and murine GL261 GBM cells in vitro as well within intracranial GBMs in vivo Moreover, CCL5 is upregulated in GL261 cells cultured under conditions that favors growth of the cells as spheres; cells cultured under thes e conditions exhibit a

PAGE 53

53 more malignant phenotype (188, 190). Its receptors CCR1 and CCR5, on the other hand, are expressed by cultured microglia, but not by GBM cells, and are also highly expressed within intracranial tumors. The loss of CCR1 and CCR5 in si tu hybridization signals from tumor sections from CCR1 and CCR5 deficient mice also indicates that the GBM cells do not express either of these receptors. In vitro CCL5 could mediate the migratory function of microglia in a dose dependent manner through the induction of MM P 2, MMP9, MMP14. These data support the hypothesis that GBM expressed CCL5 may be a key regulator in the crosstalk between GBM and microglia/macrophages, through an interaction with microglia/macrophages expressed CCR1 or CCR5, and that blocking either CCR1 or CCR5 could prevent the GBM localization of microglia/macrophages. G BM growth and numbers of intra tumoral microg lia/macrophages cells, together with CD4 + and CD8 + T cells, were evaluated in mice individually deficient in either CCR1 or CCR5. Our data sh owed that microglia/macrophages infiltration was not attenuated in either CCR1 or CCR5 deficient tumor bearing animals. CD4 + and CD8 + cells were also similar in tumors from receptor deficient and wild type mice. Moreover, there was on ly a modest, in the case of CCR1 deficiency, or no difference, with CCR5 deficiency, in survival rates between GBM bearing wild type mice and the chemokine receptor deficient tumor bearing animals. Our explanation for these observations is that CCL5 has a high affinity for both CCR1 and CCR5, and blocking either one of them individually is not sufficient to inhibit the actions of this chemokine. Due to the promiscuous interactions of chemokines and chemokine receptors, this redundant mechanism needs to be c onsidered. Indeed, this issue has been addressed in several

PAGE 54

54 studies (130, 194, 203, 204) In a recent study that characterized the role of these receptors in a periodontal disease model, Repeke and colleagues found that CCR1 and CCR5 deficient mice present a lower leukocyte infiltration and alveolar bone loss than wild type mice, yet inhibiting both of these receptors by Met CCL5 (a dual CCR1/CCR5 antagonist) severely attenuated the inflammatory bone resorption (204) A redundancy mechanism in GBM is consiste nt with our in vitro investigation which indicates that CCR1 and CCR5 are co expressed by primary microglia in vitro and that the dual antagonist Met CCL5 could completely block the migratory effect of CCL5 on these cells regardless of whether the cells e xpressed CCR1 or CCR5. Nonetheless, our data does not exclude the possibility that CCL5 may act through another unidentified receptor(s). While the evidence for a cooperative role of CCR1 and CCR5 is suggested from the in vitro study, a redundancy of these chemokine receptors in this murine GBM model has not yet been evaluated in vivo A combined CCR1 and CCR5 deficient mouse would offer a model system to test the redundancy hypothesis. However, the CCR1 and CCR5 genes are located adjacent to each other on murine chromosome 9, providing a major limitation in generating the double knockout mice by simply breeding CCR1 and CCR5 deficient lines. Alternative pharmacologically based approaches are worth considering but these also have limitations. Although Met CCL5 has been used as a dual antagonist for both CCR1 and CCR5 in in vitro studies (155, 205) effectively targeting these receptors located within the brain would require the peptide to penetrate the blood brain barrier, one of the m ost important obstacles that restricted the delivery of molecularly targeted therapy to glioma (206) A combined pharmacological and

PAGE 55

55 genetic approach is an alternative strategy worthy of consideration. In particular, CCR1 deficient mice could be treated with a CCR5 antagonist, e.g. TAK 779, while CCR5 deficient mice would be treated with the CCR1 antagonist, BX 741. Both of these drugs have been tested for their effective delivery to the CNS, when administered systemically (207, 208) However, as BX 741 and TAK 779 were specifically designed for human CCR1 and CCR5 respectively, the low binding affinity for mouse CCR1 and CCR5 is a primary concern. These obstacles together provide significant challenges for addressing the re dundan cy hypothesis through in vivo experimentation. The interaction between microglia/macrophages and GBM is complex and likely to involve bi directional signaling. After recruitment into the tumor milieu by GBM cells, microglia/macrophages lose control of their immune surveillance property and, in turn, help facilitate tumor progression. Since the recruitment of microglia/macrophages likely depends on their interaction with numerous GBM secreted factors or by ot her components in the tumor microenvironment, it is not surprising that this process is regulated in a redundant manner. Our findings support the notion that the function of CCL5 in GBM is not dependent on individual interactions with either CCR1 or CCR5. To the contrary, the CCL5/CCR1/CCR5 network likely involves a redundant mechanism, adding more complexity to GBM microglia/macrophages crosstalk and signaling a need to block both receptors to prevent the actions of this chemokine in this highly malignant form of brain cancer.

PAGE 56

56 Figure 3 1. Expression of CCL5 by murine GL261 and human GBM cell lines. A) Left: RT PCR analysis detecting CCL5 mRNA in murine GL261 cells, cultured as either adherent monolayers (A) or gliomaspheres (S). GAPDH served as a control. Right: CCL5 protein detected in GL261 conditioned medium, using cytokine protein array. B) RT P CR analysis of CCL5 mRNA in different human GBM cell lines, L0, L1, and L2 as well as commonly used standard GBM cell lines, T98G, U87, and U118. GAPDH served as a control.

PAGE 57

57 Figure 3 2. Expression of CCL5 and its receptors CCR1 and CCR5 in murine GL261 GBM s. A) RT PCR analysis in normal (N) and tumor (T) tissues. In situ hybridization (ISH) analysis depicting the expression of B) CCL5 in normal (N) and tumor (T) sections from a glioma bearing wild type (WT) C57BL/6 mouse, and C) CCL5, CCR1, CCR3, and CCR5 in WT, CCR1 and CCR5 deficient mice.

PAGE 58

58 Figure 3 3. Effect of CCR1 and CCR5 deficiency on infiltration of immune cells into GBM and survival of tumor bearing mice. A) Numbers of intra GBM CD11b+, CD4+, and CD8+ in CCR1 (left, black) and CCR5 (right, black) deficient mice, compared to WT (white) mice. B) Kaplan Meier survival plots of GBM bearing CCR1 (left,square) and CCR5 (right,square) deficient mice, compared to WT (circle) mice. N is the number of animal that was used in each group.

PAGE 59

59 Figure 3 4 In vitro expression of CCR1 and CCR5 by primary microglia cultures and the effect of Met CCL5 on CCL5 stimulated migration of microglia. A) RT PCR analysis of CCR1 and CCR5 expressed by WT, CCR1 (CCR1 / ), and CCR5 (CCR5 / ) deficient microglia. CX3CR1 and GAPDH served as controls. B) WT microglia migrated toward CCL5 in a concentration dependent manner. C) CCL5 stimulated the mRNA expression of MMP2, MMP9, and MMP14 in WT microglia detected by RT PCR analysis D) Migration of WT, CCR1 and CCR5 deficient microg lia treated with CCL5 (black), or with CCL5 and Met CCL5 (stripe), compared to control (white). *p < 0.05, **p<0.001, ***p<0.0001.

PAGE 60

60 CHAPTER 4 HETEROGENEITY OF CXCR4 AND CXCR7 IN GBM Increasing evidence suggest s that the poor prognosis and the failure of current advanced treatments targeting GBM are sustained by a distinct group of glioma cancer stem like cells. This rare subpopulation displays stem like properties, including proliferation, self renewal, multipotency, and expression of different stem cell markers. The current therapies are thought to focus only on tumor mass but show minimal impact on this stem like subpopulation, which is capable of driving tumor recurrence and regrowth. CXCR4, a well known chemokine r eceptor for its diverse roles in tumor biology, and a related receptor, CXCR7, are found in human GBM. Although the presence of these receptors in GBM is well documented, their function(s) in modulating glioma stem cell like subpopulations is not thoroughl y understood. A current hypothesis states that CXCR4 regulates the stem like features of glioma cells while CXCR7 is responsible for inhibition of apoptosis of the bulk population of tumor cells (186) Fro m our perspective, t he roles of these receptors in GBM are more complicated. Our previous study illustrated a high degree of heterogeneity in surface expression patterns of CXCR4 and CXCR7 among different primary patient derived GBM cell lines. CXCR4 and CXCR7 have variable a ctivities in in vitro functions, including sphere formation, migration, short term proliferation, u nder the stimulation of CXCL12 (177) Following up on these findings, we expanded our investigation on the mRNA/protein expression of CXCR4/CXCR7/CXCL11/CXCL12 by primary patient derived GBM cell lines and/or tumors T he ability of CXCR4 and CXCR7 sub populations to initiate in vivo tumor formation of GBM cell lines was also examined The impact of CXCL11 on CXCR7

PAGE 61

61 stimulated in vitro functions and the effect of CXCL12 on tube formation and apoptosis of these cell lines a re also described in studies pres ented herein. Results CX CR4, CXCR7, CXCL11, and CXCL12 Were Expressed in Primary Patient Derived GBM Cell Lines and/or T umors It has been reported that CXCR4 and CXCR7, together with their shared ligand CXCL12 were expressed in human GBM and normal brain (186) In this study, we were interested in determining if these chemokine receptors and th ei r ligands, CXCL11 and CXCL12, were also expressed in various primary patient derived GBM cell lines and xenograft model, using RT PCR and IHC analyses. Our results showed that at a mRNA level, CXCR4, CXCR7, and CXCL11 were present while CXCL12 was absen t or at undetectable level s in all GBM cell lines ( Fig. 4 1A). T hese chemokines and chemokine receptors w ere also e valuated in the tumors derived from immune deficient mice implanted with primary patient derived GBM cell lines using IHC analysis CXCR4, CXCR7, CXCL11, and CXCL12 were all found in the tumor sections of xenografts ( Fig. 4 1B ). Both CXCR4 + and CXCR7 + Cel ls Were Capable of Generating Tumors In Vivo In a previous study from the laboratory we found that CXCR4 + and CXCR7 + cells were more abundant in the slow cycling subpopulation, which is enriched with cancer stem cell markers. We hypothesized that CXCR4 and/or CXCR7 might regulate cancer stem cell phenotypes. To test this, we evaluated the ability of in vivo tumor formation of CXCR4 and CXCR7 expressing cells. Subpopulations containing either CXC R4 + CXCR7 + CXCR4 + /CXCR7 + (double positive), or CXCR4 /CXCR7 (double negative) were isolated f rom GBM L0 line using FACS and implanted intracranially in immune

PAGE 62

62 deficient NSG mice. This line was chosen as the model system since it was the only one that sh owed effects of CXCL12 on in vitro sphere formation, a property often associated with a tumor initiating subpopulation. Our result showed that all subpopulations successfully initiated tumors in vivo ( Fig 4 2 ). These data suggest that neither CXCR4 n or CX CR7 are directly involve d in regulating phenotype s of tumor initiating cells. CXCL12 Stimulated Tube Formation of L0 Cells through CXCR4 Transdifferentiation of GBM tumor derived endothelial cells has been documented by multiple groups (79 81) and CXCL12 has been reported to promote in vitro tube formation and VEGF production of endot helial cells (169, 209) Therefore we tested the hypothesis that CXCL12 might be involved in phenotypic changes associated with the differentiation of GBM cells into endothelial cells. CXCL12 promoted tube for mation of GBM L0 cells (Fig. 4 3 A). Total tube area, t otal tube length, and total branch points were significantly increased by CXCL12 when compared to con trol treated L0 cells (Fig. 4 3B ). The effects of CXCL12 were blocked by AMD3100 but not CCX733 or CCX771, indicating that CXCR4, but not CXCR7, is involve d in the CXCL12 stimulated tube formation of L0 cells. CXCL12 had no effect on tube formation of the L1, L2, and S2 lines (data not shown). CXCL12 Had No Effect on TMZ Induced Apoptosis in CXCR4 + and CXCR7 + Cells An anti apoptotic effect mediated by stimu lation of CXCR7, but not CXCR4, has been reported in GBM cell lines (186) We evaluated the impact of CXCL12 on TMZ induced apoptosis in various primary GBM cell lines. TMZ induced apoptosis in all four lines ( Fig. 4 4A ). A d ifferential effect of TMZ treatment on the relative percentages of

PAGE 63

63 CXCR4 and CXCR7 expressing subpopulations was evident ( Fig. 4 4B ). The percentage of CXCR4 + cells was increased in lines L0, L1, and L2 after TMZ treatment. TMZ did not impact the percentage of CXCR4 expressing subpopulation in the S2 line. CXCR7 + subpopulations were increased in all lines after TMZ treatment. Moreover, heterogeneous expression of CXCR4 and CXCR7 was observed between apoptotic and non apoptotic subpopulations a mong the various cell lines after TMZ treatment. The percentage of CXCR4 expressing cells in the non apoptotic subpopulation remained unchanged in L0 cells, increased in the L1 and L2 cells, and decreased in the S2 line. The percentage of CXCR7 expressing cells undergoing apoptosis increased in all lines. Increases in the CXCR7 + cells in the non apoptotic subpopulation occurred in the L0, L1, and L2 cells but not in the S2 line after TMZ treatment. In all lines, CXCL12 had no effect on the distribution of C XCR4 and CXCR7 expressing cells in either the apoptotic and non apoptotic subpopulations. CXCL11 Contributed No Impact on In Vitro Functions of G BM Cell Lines In previous study, our group demonstrated that CXCR4 and CXCR7 heterogeneously regulated in vitro functions of different primary patient derived GBM cell lines. In the presence of CXCL12, both CXCR4 and CXCR7 stimulated the migration in L0 and S2 lines and short term proliferation in L0 and L1 cells, while only CXCR7, but not CXCR4, initiated sph ere formation of L0 ; involvement of these specific receptors was determined using selective antagonists for CXCR4 and CXCR7. Because CXCL11 is an additional ligand of CXCR7, we evaluated the impact of this chemokine on the in vitro functions that were regu lated by CXCR7 in GBM cell lines, as reported previously. Our data showed that CXCL11 contributed no impact on sphere formation

PAGE 64

64 (L0, Figure 4 5 A), prol iferation (L0 and L1, Figure 4 5 B), and migration (L0 and S2, Fi gure 4 5 C) of the GBM lines tested. These results suggest that CXCR7 regulation of in vitro functions in primary patient derived GBM cell lines is solely dependent on CXCL12, but not CXCL11. Discussion CXCR4, with its sole ligand CXCL12, were reported to be present in human GBM (166, 169, 173 175, 177, 209 214) and their expression correlated with survival rate of GBM patients. CXCR4 and CXCL12 have been well documented for their various roles in GBM development and pr ogression, i ncluding promoting tumor growth facilitating tumor cell invasion toward a CXCL12 source, and initiating angiogenesis (173, 174, 177, 209, 211 213) CXCR7, a n additional receptor for CXCL12, was also present in h uman GBM tissue. Unlike CXCR4, the role of CXCR7 in GBM is poorly understood. A previous study has shown that CXCR4 is upregulated in stem like GBM cells while CXCR7 is elevated in differentiated GBM cells (186) The proposed function of CXCR7 is to prevent GBM cells from apoptosis, which may contribute to the resistance to therapy. Although the mechanism regulated by CXCR7 was unclear, there is evidence suggesting that CXCR7 may serve as a CXCR4 signaling regulator by 1) depl eting extracellular CXCL12 or 2) dimerizing with CXCR4 to either block or facilitate CXCR4 regulated signal transduction Based on this complex interaction, it is not surpris ing that CXCR4 and CXCR7 have overlapp ing functions in controlling GBM progression Indeed, our previous studies have demonstrated a high degree of heterogeneity in surface expression of CXCR4 and CXCR7 in different primary patient derived GBM cell lines. Variable percentages of CXCR4 + CXCR7 + and CXCR4 + /CXCR7 + (double

PAGE 65

65 positive) popul ations were evident in different GBM cell lines: GBM L0 had a relatively higher percentage of CXCR4 + cells than CXCR7 + cells while GBM L1 and L2 contained more CXCR7 + cells, GBM S2 meanwhile showed comparable percentages of CXCR4 + a n d CXCR7 + cells. In contrast, chemokine receptors CCR3 and CXCR3 were co expressed on a small but similar percentage of cells in all cell lines. Sub population of cells that have both CXCR4 and CXCR7 were observed in all GBM lines. A slow cycling sub population of cells, which express stem like cell markers and exhibit high tumorigenic frequencies, were enriched for CXCR3, CXCR4, and CXCR7. In vitro functional studies showed that both CXCR4 and CXCR7 played multiple roles in promoting tumor cell growth, migration, a nd sphere formation, depending on specific GBM cell lines. The fact that both CXCR4 and CXCR7 were enriched in slow cycling sub population that contained stem like markers and that both CXCR4 + and CXCR7 + cells were able to initiate spheres in vitro suggest e d that these receptors may regulat e cancer stem like phenotypes of these cells. To confirm the role of these chemokine receptors in this context, we asked the question if cells expressing CXCR4, CXCR7, or both were able to generate tumor s in vivo L0 was chosen for this study because it is the only line that displayed CXCL12 regulated in vitro sphere formation, among the four examined lines. The data reported in this chapter confirmed that both CXCR4 and CXCR7 expressing cells were capable of forming tumo rs in immune deficient mice. Together with in vitro data, this direct evidence suggested that tumor formation is independent of CXCR4 or CXCR7.

PAGE 66

66 Based on the results of Hattermann et al. (186) we also anticipated that stimul ation of CXCR7 would have protected GBM cells from apoptosis induced by TMZ. However, while all lines were sensitive to TMZ induced apoptosis, none were protected from apoptosis by CXCL12. Moreover, CXCR4 and CXCR7 presented in a heterogeneous expression p attern between apoptotic and non apoptotic sub populations among different GBM cell lines T here was no evidence for the correlation between CXCR4 or CXCR7 expression and apoptotic phenomenon. This lack of a CXCR7 effect to inhibit apoptosis is likely rela ted to the nature of the cell culture system used to evaluate this phenomenon. The CXCR7 phenotype reported previously was found in adherent GBM cells grown in serum, which is distinct from the stud y reported here that were performed on sphere cultures, i. e. non adherent serum free conditions. In fact, data from Hattermann and colleagues indicated that CXCR7 stimulation had little to no effect on Camptothecin induced apoptosis in a GBM stem like cell line (186) These autho rs attributed the lack of effect as a result of low level expression of CXCR7 in the stem like cells. In cancer biology, unlike CXCR4/CXCL12 axis that has earned considerable attention on its role, the involvement of recently discovered CXCR7 as another re ceptor for CXCL12 remains less well understood In our studies reported previously and herein, we showed that, under the stimulation of CXCL12, CXCR7 regulated proliferation, sphere formation, and migration of GBM cells. Besides CXCL12, CXCR7 can also bind to CXCL11, an established ligand for CXCR3. Thus, we expanded our study to address i f CXCL11 c ould stimulate CXCR7 regulated functions of GBM cells. The results, however, did not support this possibility. Consistent with these data,

PAGE 67

67 previous published stu dy showed that GBM cells did not migrate toward a CXCL11 gradient alone. However, at the low dose, CXCL11 could enhance the migration of tumor cells toward a CXCL12 gradient (215) This observation suggests that CXCL11 may work in a cooperative manner with CXCL12 to direct CXCR7 activities.

PAGE 68

68 Figure 4 1. CXCR4, CXCR7, CXCL11, and CXCL12 were expressed in primary patient derived GBM cell lines and/or tumors. A) Expression of CXCL11, CXCR4, and CXCR7 mRNAs in GBM cell lines, using RT PCR analysis. Note that all cell lines express CXCL11, CXCR4, and CXCR7 but none are positive for CXCL12. Actin served as control. B) Expression of CXCR4, CXCR7, CXCL11, and CXCL12 in xenografts, detected by immunohistochemistry. Representative fluorescent micrographs depict the expression of CXCR4 and CXCL12 (left), CXCR7 and CXCL11(middle), CXCL11 and Nestin (right) within high power fields in the tumors derived from immuno deficien t mice implanted with primary patient derived GBM cells

PAGE 69

69 Figure 4 2. CXCR4 + CXCR7 + and CXCR4 + /CXCR7 + cells generated tumors in vivo Representative sections from tumors derived from L0 sub populations. The various sub populations indicated in the figures were implanted intracranially into NSG mice. Shown are representative sections subjected to anti human Nestin immunohistochemistry. Note that all sub populations are capable of forming tumors in vivo

PAGE 70

70 Figure 4 3 CXCL12 stimulation of L0 tube formation in vitro was mediated by CXCR4. A) Representative images of control and CXCL12 (20 nM) treated GBM L0 cells. B) CXCL12 (20 nM) significantly increased total tube length, total tube area, and total branch points of L0 cells. AMD3100 (1 M) inhibited CXCL12 stimulation of tube f ormation of L0 cells. CXCR7 inhibitors did not block the stimulation of CXCL12. All co nditions contained 0.1% DMSO. *p<0.05; **p <0.01. Representative results of three individual experiments performed in triplicate are shown.

PAGE 71

71 Figure 4 4 Differential impa ct of TMZ on the distribution of CXCR4 and CXCR expressing apoptotic and non apoptotic subpopulations. A) GBM lines were treated with TMZ as described in Methods. Apoptotic subpopulations, determined by positive ApoStat staining, were detected in TMZ trea ted samples in all cell lines. Histograms are representative from three independent experiments. B) Heterogeneity in CXCR4 and CXCR7 expressing subpopulations in the apoptotic and non apoptotic subpopulations after TMZ treatment, as determined by flow cyt ometry analysis. Bar graphs represent the average of three independent experiments.

PAGE 72

72 Figure 4 5 CXCL11 had no effect on in vitro functions of GBM cell lines. CXCL11 concentration response assessment indicated that CXCL11 contribute d no effect on A) sphere formation of L0 cells, B) short tern proliferation of L0 and L1, C) migration of L0 and S2.

PAGE 73

73 CHAPTER 5 EXPRESSION AND FUNCTION OF CXCR4 IN GBM AFTER ANTI ANGIOGENIC THERAPY Patients diagnosed with GBM receive standard treatments including surgical removal of the tumor, followed by radiation in combination with chemotherapy. These interventions, however, only provide a modest impact on patient survival. Because GBM is one of t he most vascularized solid tumors, anti angiogenic agents, which target VEGF signaling pathways and block the formation of new tumor blood vessels, have been evaluated as an alternative treatment strategy for GBM patients. Data from clinical trials suggest ed that, in some patients with recurrent GBM treated with either anti VEGF antibodies (Bevacizumab, Aflibercept, etc.) or small molecular VEGF receptor tyrosine kinase inhibitors (e.g. Cediranib or Vandetanib), these agents could enhance 6 month progressio n free survival rate, as well as radio graphic response. In spite of these promising achievements, they failed to maintain an enduring survival benefit to patients. Under VEGF pathway inhibition, however, a significant fraction of tumors begin growing back in a more invasive manner. A recent published study (116) proposed that the HGF/MET signaling pathway may be involved in this e nhanced invasive phenotype post anti angiogenic therapy targeting VEGFRs. In the presence of anti angiogenic agents, VEGFR2 forms heterodimers with MET, and this interaction causes the dissociation of PTP1B from MET, thereby unmasking MET activity in GBM c ells. These data suggest that integrating VEGFR and MET inhibitors will prevent tumor recurrence after anti angiogenic therapy. Herein, we propose an additional mechanism in which anti angiogenic therapies might regulate the enhanced invasive phenotype thr ough a pathway involving chemokine receptor CXCR4. We provide evidence that anti

PAGE 74

74 angiogenic agents elevate the expression of CXCR4 in primary patient derived GBM cell lines expressing VEGFRs, and in tumors derived from one of these cell lines. This upregul ation is independent of HGF/ MET serine/threonine kinase activity. Moreover, the combination of an anti angiogenic agent (Cediranib) and a CXCR4 antagonist (AMD3100) provided the most survival benefit to tumor beari ng animals, compared to either agent used as a single treatment. These to the invasive phenotype of recurrent tumors after anti angiogenic therapy. Thus, the combination of VE may provide an alternative strategy to halt tumor progression and provide more substantial benefit to patients with GBM. Results Heterogeneous Expression of VEGF Receptors by Different Primar y Patient D erive d GBM Cell L ines G BM is one of the most vascularized tumors. VEGFR2, a well studied VEGF receptor responsible for formation of physiological vasculogenesis and pathological angiogenesis, has been found in both initial and recurrent high gr aded gliomas (90, 91) The mRNA expression pattern of VEGF and its thre e receptor isoforms, VEGFR1, VEGFR2, and VEGFR3, were evaluated in various primary patient derived GBM cell lines. While VEGF was expressed by all five examined GBM cell lines, RT PCR analysis showed that expression of VEGFRs varied amongst these lines: al l three VEGFR mRNAs were found in S2 and S3 lines. However, none of them were detected in the L0, L1, and L2 lines (Fig. 5 1A). Consistent with in vitro mRNA expression data, immunohistochemistry analysis showed that VEGFR2 was detected in the tumor

PAGE 75

75 derived from S3, but not L0, cell line. The co localization of VEGFR2 and human Nestin indicated that VEGFR2 was expressed by human S3 GBM cells (Fig. 5 1B). These data indicate heterogeneity in the expression of VEGFRs in different primary patient derived GBM cell lines. Anti VEGF/VEGFR Agents Increased the Expression of CXCR4 in Primary Patient D erived GBM Cell Lines and Xenograft T umors that Were P ositive for VEGFRs Most, if not all, GBM patients receiving anti angiogenic agents were reported to have tu mor relapse with an associated enhanced invasive phenotype after initial response to therapy (98 100, 115) The factors and mechanisms regulating this phenomenon are currently ill defined. As a chemoki ne receptor that is widely found in GBM cell lines and tumor tissues and well known for its role in stimulating tumor invasion, CXCR4 may be potentially involved in the tumor invasiveness initiated by anti angiogenic therapy. To test this hypothesis, we fi rst examined the impact of anti angiogenic agents on the surface expression of CXCR4 in our different primary patient derived GBM lines. Both flow cytometry and immunocytochemical analyses showed that CXCR4 expression was significantly increased in VEGFR(s ) positive S2 and S3 cells but not in the VEGFR(s) negative L0 cell line, after the lines were treated with two different small molecule VEGFR protein kinase inhibitors, i.e. Cediranib or Vandetanib (Fig. 5 2A, B). CXCR4 was also increased in the S3 line w ith Bevacizumab treatment. The VEGFR kinase inhibitors had no impact on the expression of CXCR7, another receptor for CXCL12, in either VEGFR positive or VEGFR negative GBM cell lines (data not shown). Consistent with the in vitro data, CXCR4 was also high ly elevated in VEGFR positive S3 derived tumors from NSG mice treated with Cediranib, while fewer CXCR4 expressing cells were detected in tumors from vehicle treated animals.

PAGE 76

76 Moreover, our data demon s trated that the increase in CXCR4 expression was evident in both normoxic and hypoxic zones, as determined by proximity to cells expressi ng HIF1 GBM is not solely regulated by hypoxia induced by an anti angiogenic agent (Fig. 5 2C). These in vitro and in vivo results suggest that anti angiogenic drugs can enhance the expression of CXCR4 in GBM cell lines and VEGFR(s) expressing tumors. Anti VEGFR Drugs Enhanced the Migratory Effect of VEGFR(s) Expressing GBM Cell L ines toward CXCL12 Our published data showed that CXCR4 regulated the in vitro migration of S2, but not S3 GBM cells, toward a CXCL12 gradient (177) Because CXCR4 was elevated by anti angiogenic drugs, we then determined if these agents could enhan ce the migratory effect of CXCL1 2 on these cell lines. Consistent with our previous results, in the absence of Cediran ib or Vandetanib pre treatment, CXCL12 induced the migration of S2, but not S3 cells. However, Cediranib or Vandetanib pre treatment enhanced the CXCL12 directed migration in S2 and induced a migratory effect of S3 cells (Fig. 5 3). Based on the findings d escribed above, this enhanced migratory effect of CXCL12 in these cells may be due to the increase in CXCR4 expression stimulated by Cediranib or Vandetanib. The Combination of a CXCR4 A ntagonist and a VEGFR Inhibitor Provided a Greater Beneficial Effect o n the Survival of GBM Bearing A nimals Based on the upregulation of CXCR4 by anti angiogenic agents reported herein, we sought to determine whether antagonism of CXCR4 after anti angiogenic therapy could provide an enhanced beneficial effect on the surviva l of tumor bearing mice. To address this question, VEGFR positive S3 cells were intracranially implanted to NSG

PAGE 77

77 mice and tumors were allowed to initiate in this xenograft model for 2 weeks. After this period, tumor bearing animals were sequentially treated with or without Cediranib. Following an additional two weeks, control and C ediranib treated mice were further subdivided into vehicle and AMD3100 (CXCR4 antagonist) treatment groups,(treatment scheme is depicted in Fig. 5 4A Kaplan Meier survival analysi s showed that combined treatment of Cediranib and AMD3100 provided the greatest survival advantage to tumor bearing mice, when compared to control (p<0.0001), AMD3100 (p<0.0001), or Cediranib (p=0.0085) treated groups. Although single treatment with Cediranib also contributed statistically significant benefit to animal survival (p=0.0003), no effect of monotherapy with AMD3100 on survival on tumor bearing mice was evident (p=0.1027), when compared to the control treated cohort (Fig. 5 4B) These resu lts strongly suggest that an alternative therapy scheme that targets both VEGFR and CXCR4 signaling might render an advantage over single treatment with agents that target either of these receptor pathways. Anti Angiogenic Agents Stimulated CXCR4 Expressi on in a HGF/MET anner Lu and colleagues reported that anti VEGF agents regulated an enhanced invasiveness phenotype in GBM by unmasking MET signaling inhibition (116) Because MET was shown to be an upstream regulator of CXCR4 (175) we initially hypothesized that the increase in CXCR4 expression seen after VEGF/VEGFR inhibition is directly regulated by the HGF/MET signaling pathway The effect of HGF on CXCR4 expression was then evaluated in the absence or presence of Vandetanib. Flow cytometry analysis showed that exogenous HGF did not impact CXCR4 levels (Fig. 5 5B). The lack of an exogenous HGF effect could be due to the presence of endogenous HGF generated by

PAGE 78

78 these cell lines, as evident by RT PCR analysis (Fig. 5 5A). However, a MET inhibitor, BMS777607, was unable to inhibit the Vandetanib effect on CXCR4 expression (Fig. 5 5C ). Hence, the lack of effect of HGF or MET inhibitor s indicates that the anti angiogenic regulation of CXCR4 expression is independent of the HGF/MET signaling pathway. TGF is known for its roles in both pro and anti inflammatory regulation and in tumor progression (216 220) In GBM, previously published data from a xenograft model indicated that TGF was highly expressed in the tumor receiving anti angiogenic treatment (221) Thus, we then hypothesized that TGF is a factor involved in the anti angiogenic stimulation of CXCR4 expression. RT PCR analysis determine d that mRNA levels of at least two forms of TGF (TGF 1, TGF 2, TGF 3) and all TGF Rs (TGF R1, TGF R2, TGF R3) were found in all of the cell lines under study (Fig. 5 6A). Moreover, stimulation of GBM cells with exogenous TGF in the absence or presence of Cediranib or Vandetanib, indicated that TGF could only synergize with Cediranib, but not Vandetanib, to provide prominent effects on CXCR4 expression in VEGFR positive S3, but not the VEGFR negative L0, cell line. Despite the presence of VEGFR, TGF did not contribute significant impact on Cediranib enhanced CXCR4 expression in S2 line (Fig. 5 6B and data not shown). We also used a TGF R inhibitor as a pharmacological approach to test the dependence of this pathway on the Cediranib or Vandetanib regulatio n of CXCR4. The TGF R inhibitor suppressed the Cediranib, but not Vandetanib, effect on the expression of CXCR4 in S3, and little in S2, lines (Fig. 5 6C). These findings strongly support a mechanism in which the enhancement of CXCR4 expression by anti ang iogenic agents is controlled by TGF /TGF R signaling.

PAGE 79

79 Discussion As the most common and aggressive primary brain tumor in adults with extremely poor prognosis, GBM has received major attention for therapeutic strategy, in order to improve survival rate of patient s with this disease. In an effort to seek advanced intervention to halt GBM progression, anti angiogenic therapy obtained an accelerated approval from US Food and Drug Administration for treatment of recurrent GBM, because of its favorable outcomes during phase I and II clinical trials. While drugs targeting VEGF and/or VEGFR signaling pathways are now evaluated for frontline regimen s for GBM, increasing evidence is rais ing concern since tumor relapse post anti angiogenic treatment occurs in most, if not all, GBM patients. Data from both laboratory and clinical studies indicate that after initial adaptive response to anti angiogenic drugs, tumor s tend to grow back in a more invasive and uncontrollable manner (95, 98 100, 221) The underl ying mechanism responsible for this tumor resistance remains elusive. While searching for an involvement of chemokine receptor CXCR4 in post anti angiogenic phenomenon, we found that surface expression o f CXCR4 was up regulated by either VEGF or VEGFRs targeting inhibit ors (Bevacizumab, Cediranib, and Vandetanib) in VEGFR positive GBM cell lines The lack of Cediranib or Vandetanib effect on CXCR4 expression in VEGFR negative GBM cell lines suggested that these small molecule kinase inhibitors targeted VEGFRs, but not other receptor kinases as these VEGFR inhibitors did impact CXCR4 in L0, L1, and L2 cells. These lines were categori z ed in the classical (or proliferative) subclass in which high expres sion of EGFR i s evident In addition, this effect seemed to be specific to the expression of CXCR4 as no stimulation was observed with CXCR7 level when examined in the same study (data

PAGE 80

80 not shown). Consistent with these data, our in vivo observation reporte d an increase in CXCR4 expression in the tumors derived from VEGFR positive GBM cells implanted animals after receiving Cediranib treatment. Moreover, the greatest survival rate was documented in the cohort of tumor bearing animals treated with a combinati on of Cediranib and AMD3100, a CXCR4 inhibitor, when compared to vehicle or single agent treated group s Using pharmacological approaches, we demonstrated that the mechanism for up regulation of CXCR4 by anti angiogenic agents is dependent on TGF /TGF Rs, but not HGF/MET signaling transduction. One of the remarkable features of GBM that contribute to poor prognosis and therapy resistance is the great heterogeneity within and across tumors. Because of this, it is not surprising to see diverse mRNA expression of VEGFRs among our different primary patient derived GBM cell lines. While VEGF was observed in all lines, it wa s not the case with VEGF R s. All VEGFRs (VEGFR1, VEGFR2, and VEGFR3) were only expressed by selective GBM cell lines namely S2 and S3 The abs ence of VEGFRs in some GBM cell lines may be due to the down regulation of these receptors to undetectable levels. Indeed, when comparing fold change (>= 0.5: down regulated, <=0.5: up regulated) in the expression of VEGF, VEGFR1, and VEGFR2, based on tumo r/normal ratio using TCGA database, we found that VEGF was prominently up regulated in 390 samples (99.2%) and only 3 samples w ere shown to be down regulated (0.8%), in a total of 393 samples. In contrast, the change in gene expression of VEGFR1 and VEGFR2 was more heterogeneous among GBM patient samples: 197 up regulated (77.3%) and 58 down regulated (22.7%) with VEGFR1, 174 up regulated

PAGE 81

81 (76.7%) and 53 down regulated (23.3%) with VEGFR2 (data not shown). The gene expression of VEGFR3 was not analyzed due t o the lack of information in the database GBM progression i nvolves multiple processes, including, but not limited to, tumor cell proliferation, infiltration, and angiogenesis. The formation of new blood vessels from pre existing ones appears to be the cr itical step in tumor malignancy, as it will provide nutrient supply for tumor cells in order to perform other activities. Hence, it was theoretically assumed that blocking angiogenesis might arrest overall activities of tumor progression and thus sustain s urvival benefit to patient with GBM. Laboratory and clinical studies, however, have questioned this approach The lack of effectiveness of anti angiogenic therapy on GBM progression can be explained by two possibilities. First, inhibition of angiogenic for mation may preclude the expansion of tumor growth, due to the lack of nutrient supply, but contribute little to no effect on the infiltrative component of tumor cells which is angiogenesis dependent. This hypothesis is based on the observation in anaplast ic astrocytoma, in which no vascular proliferation was evident. The infiltration of tumor cells in this grade III glioma relie d on a pre established vascular network in the brain. Second, angiogenic blockage has direct impact on the infiltrative nature of tumor cells and thus promotes an enhanced invasive phenotype. A p revious report suggest s that the introduction of anti VEGF antibody could unmask the signaling activity of MET by removing inhibition due to protein tyrosine phosphatase 1B, thus promoting the invasive phenotype of tumor cells through this receptor (116) E vidence from our study indicates at an additional possibilit y. CXCR4, together with its ligand CXCL12, are well known for its migrating property in many different types of cancer, including GBM (127, 166, 214, 222) The fact that CXCR4 was up regulated by

PAGE 82

82 anti angiogenic agents in primary patient derived GBM cell lines and in Cediranib treated tumors, points to a potential mechanism in which anti angiogenic therapy promotes invasion of tumor cells by elevating the expression of CXCR4. This proposal i s supported by our in vitro data, which s howed that VEGFRs inhibitors were able to induce or enhance migrat ion toward CXCL12 of VEGFRs positive cell lines. Despite the promising observation from this preliminary in vitro data, further in vivo analysis focusing on combined effect s of anti angiogen ic therapy and CXCR4 in tumor invasion will be needed to support this hypothesis. In the context of the heterogeneity and complexity within the tumor microenvironment, it is inevitable that an event is regulated by multiple factors or signaling pathways. W hile previous studies support a relation ship between anti angiogenesis and HGF/MET signaling pathway in GBM (116) our data provide a possibility for an additional mechanism in which the enhanced invasiveness phenotype post anti angiogenic therapy is regulated through CXCR4 signaling pathway. Of additional int erest, our data suggest an involvement of TGF /TGF Rs signaling, as an intermediat e in this crosstalk. Indeed, in the U87 GBM xenograft model, Piao Y et al. showed that the expression of TGF was markedly increased in the tumors treated with either Bevaci zumab, or Sunitinib, or combined Bevacizumab and Sunitinib, when compared with tumors in the control group (221) The TGF dependent upregulation of CXCR4 was also evident in a different study Hardee et al. showed that LY364947, a small molecule inhibitor of TGF type 1 receptor kinase was able to inhibit the increase in CXCR4 expression stimulated by radiation in murine GL261 neurospheres (89) T ogether with these observations, our data support a potential interaction among three

PAGE 83

83 signaling pathways VEGF/VEGFRs, TGF /TGF Rs, and CXCL12/CXCR4: inhibition of anti angiogenesis by blocking VEGF/VEGFRs signaling will induce TGF /TGF R activity, resulting in its stimulation of CXCL12/CXCR4 pathways, which in turn promote s tumor invasiveness. Our study demonstrated that the up regulation of CXCR4 by anti angiogenic agents is dependent on TGF /TGF Rs. However, a link for the direct effect of these d rugs on TGF /TGF Rs is still missing. It will be interesting to see if anti angiogenic agents are able to induce the activation of TGF /TGF Rs in our VEGFRs positive cell lines and tumors. This information will provide more convinci ng evidence for the poss ibility of mutual crosstalk among these three signaling pathways. Given the complexity and heterogeneity with in and around tumor microenvironment s the idea of utilizing combined therapy for cancer treatment is gaining appreciat ion In GBM the combination of Bevacizumab and chemotherapy exhibited a trend in clinical effectiveness with selective cytotoxic agents, compared to monotherapy (115, 223 225) The combination of anti angiogenic therapy and molecularly targeted agents ha s also received attention, yet the effectiveness of this approach has not be addressed in a rigorous manner Our study, for the first time, provide s evidence for a synergetic effect of AMD3100 a nd Cediranib on the survival of animals bearing GBMs Although a modest effect was seen with single treatment of Cediranib, but not AMD3100, when compared to the control group, combined treatment of AMD3100 and Cediranib contributed greater benefit than mono treatment s It is reported that, by controlling edema, Cediranib increased the survi val of animals with GBM despite persistent tumor growth (96) On the other hand, published studies showed that AMD3100 treatment significantly impaired intracranial growth of U87 GBM

PAGE 84

84 (180) or migration of U87 and LN308 cell lines in hypoxic condition (169) Based on these data, the beneficial effect on survival we observed in our study with combined Cediranib and AMD3100 may be due to the alleviation of edema, controlled by Cediranib, and the reduction in tumor growth, and possibly invasion, controlled by AMD3100. Fu ture efforts studying the impact of this combined treatment on tumor burden at different time points during the treatment will be very useful. With the advantage of using multiple primary patient derived GBM models, various types of anti angiogenic agent, and versatile pharmacological approaches, we established strong evidence for the up regulation of CXCR4 stimulated by anti angiogenesis in a TGF dependent but HGF/MET independent manner. More importantly, our promising survival analysis represents a significant scientific rationale for clinical evaluation of a combined therap eutic approach that targets both VEGF/VEGFRs regulated angi o genesis and CXCL12/CXCR4 controlled tumor progression. This proposed regimen may provide a major therapeutic advantage over monotherapy for patients with GBM

PAGE 85

85 Figure 5 1. VEGFRs were heterogeneously expressed by different primary patient derived GBM cell lines. RT PCR analysis identifi ed VEGFR1,2,3 mRNAs in S2 and S3, but not in L0, L1, and L2 cells. VEGF mRNA was expressed by all cell lines. Actin was used as a control.

PAGE 86

86 Figure 5 2. VEGFR inhibitors upregulated CXCR4 in VEGFR expressing GBM cell lines and tumors. A) Flow cytometry analysis determined that CXCR4 is increased in either Cediranib (500nM) or Vandetanib (500nM) treated S2 and S3 cells, but not in L0 cells; Bevacizumab (125g/m L ) also increased CXCR4 in S3 cells. Non immune IgG was included for staining control. B) High expression of CXCR4 (green) was evident in S2 and S3 cells treated with Cediranib, compared to control treated cells as detected by immunoflourescent staining. C) Immunohistochemical analysis showing increased CXCR4 (green) in tumor section from S3 tumor bearing NSG mice treated with Cediranib, compared to vehicle treated tumor bearing mice in both normoxic and hypoxic regions, as defined by the expression of HIF1

PAGE 87

87 Figure 5 3. VEGFR inhibitor enhanced the migratory effect of CXCL12 on S2 and S3 cells. Migration assays were performed with S2 (left) and S3 (right) cell lines in the absence or presence of CXCL12 (3nM). Cells were treated w ith Vandetanib (500nM) for 16hr prior to the migration assay. *p<0.05, **p<0.01, ***p<0.005

PAGE 88

88 Figure 5 4. Combination of CXCR4 and VEGFR inhibitors prolonged survival of S3 tumor bearing mice. A) Treatment scheme for survival analysis of S3 tumor bearing NSG mice. B) Kaplan Meier survival analysis showed that the longest survival was achieved with combined treatment (n=9, median=49 days, p<0.0001), compared to vehicle treated (n=9, median=35 days), single treatment with AMD3100 (n=9, median=38 days, 1), or Cediranib (n=9, median=44 days, p=0.0003, AMD3100+Cediranib group

PAGE 89

89 Figure 5 5. Upregulation of CXCR4 expression by anti angiogenic drugs was independent of HGF/MET signaling A) RT PCR analysis detected HGF and MET in all GBM lines. B) Recombinant HGF (100 ng/m L ) contributed no effect on CXCR4 expression in the absence or presence of Cediranib or Vandetanib in S2 and S3 cells. C) MET kinase inhibitor ( BMS777607 1M) did not b locked the effect of Cediranib or Vandetanib (500nM) induced CXCR4 expression in both S2 and S3 cell lines.

PAGE 90

90 Figure 5 6. The increase in CXCR4 expression by anti angiogenic drugs was regulated by TGF /TGF R signaling pathway. A) RT PCR analysis detecte L ) enhanced the effect of Cediranib (500nM) on CXCR4 1M) blocked the effect of Vandetanib (500nM) induced CXCR4 exp ression in both S2 and S3 cell lines.

PAGE 91

91 CHAPTER 6 GENERAL DI SCUSSION Among more than 120 types of brain cancer, GBM is the most aggressive form due to its rapid growth rate, high invasiveness to surrounding normal tissues, ability to escape the host immune system, great heterogeneity and presence of cancer stem like population within the tumor microenvironment. The se fa ctors not only contribute to the mortality and lethality of this life threatening disease but also preclude the effective ness of current treatments through resistan ce mechanisms. Thus, it is urgent for scientists to accelerate the search of novel therapeut ic strategies, in the process of halting tumor progression Well known for their roles in many physiological and pathological processes, chemokine systems also function in tumorigenesis, such as metastasis, tumor growth and invasion, angiogenesis, CSC re gulation, as well as communication between tumor cells and the host. Hence, targeting chemokines and their receptors may provide an advantage to cancer treatment. In this project, we evaluated the functions and therapeutic potential of various chemokine s/c hemokine receptors in different aspects of GBM biology, including the recruitment of immune cells to GBM, glioma stem like properties, and tumor resistance after anti VEGF therapy. Summary of Main Findings The Role of Chemokines and Chemokine Receptors in Microglia and Tumor Crosstalk Using murine GL261 and human GBM cell lines w e show ed that CCL5 was highly expressed in these lines and in tumors of GBM bearing mice where CCR1 and CCR5, but not CCR3, were also expressed. Using a syngeneic model which is immuno

PAGE 92

92 competent we demonstrated that t he infiltration of CCR1 and CCR5 expressing microglia into CCL5 expressing glioma, as well as the survival of tumor bearing mice, are not solely dependent on individual CCR1 or CCR5 r eceptor, as numbers of glioma infiltrated microglia and survival rates of tumor bearing CCR1 or CCR deficient mice, are similar to that of tumor bearing wild type animals. CCL5 promoted in vitro migration of wild type, CCR1 or CCR5 deficient microglia. Thi s migration of the genotypically distinct microglia was effectively blocked by the dual CCR1/CCR5 antagonist, Met CCL5. These data suggest that CCL5 functions within the glioma microenvironment through neither CCR1 n or CCR5 individually, but in a redundant manner. The Heterogeneous Expression and Function of Chemokine Receptors in GBM According to our recently published data, Liu et al. showed a high degree of heterogeneity in surface expression patterns of CXCR4 and CXCR7 receptors among different prima ry patient derived GBM cell lines. CXCR4 and CXCR7 have variable activities in in vitro functions, including sphere formation, migration, short term proliferation, under the stimulation of CXCL12 (177) To follow up this finding, we wanted to complete our understanding by addressing mRNA and protein expression of CXCR4 CXCR7 CXCL11 and CXCL12 by primary patient derived GBM cell lines and tumors and elucidating other in vitro function s. T he ability of specific CXCR4 and CXCR7 expressing subpopulations to initiate in vivo tumor formation was also a goal that needed addressing Finally, t he impact of CXCL11 another ligand for CXCR7, on CXCR7 stimulated in vitro functions was also described in this extended study. RT PCR analysis showed that CXCR4, CXCR7, and its ligand CXCL11 was expressed by all examined GBM cell lines, while no evidence for CXCL1 2 expression was observed. We

PAGE 93

93 also demonstrated that any of these subpopulations derived from L0 cell lines, including CXCR4 /CXCR7 CXCR4 + /CXCR7 CXCR4 /CXCR7 + and CXCR4 + /CXCR7 + was able to initiate tumor formation in vivo In addition to other in vit ro functions, L0 also stimulated tube formation of GBM cells fro m L0, but not from other lines. CXCL12 had no effect on the distribution of CXCR4 and CXCR7 expressing cells in either the apoptotic and non apoptotic subpopulations Our study also indicated that CXCL11 did not contribute any impact on CXCR7 in vitro activities, which had been shown to be regulated by CXCL12. Involvement of Chemokine Receptor i n t he GBM Enhanced Invasive Phenotype after Anti VEGF Therapy Tumor recurrence with enhanced invas iveness after anti VEGF therapy is well reported. However, the mechanism (s) that regulates this phenomenon is still not thoroughly understood In this project, we elucidated the expression and function of CXCR4 in primary patient derived GBM cell lines and tumors receiving anti VEGF therapy. When characterizing several primary patient derived GBM cell lines, we found heterogeneity in the level of expression of VEGFRs; some lines were VEGFR positive while others were VEGFR negative. The levels of CXCR4 were elevated, both in vitro and in vivo after VEGF/VEGFR inhibitor treatment (Bevacizumab, Cediranib or Vandetanib) only in VEGFR expressing GBM cells, while CXCR7 was not affected by VEGFR pathway inhibition. Based on a recently published finding describing a role of HGF in enhanced invasive phenotype after anti VEGF therapy in GBM (116) we initially hypothesized that the upregulation of CXCR4 by VEGFR inhibitor was regulated by HGF/MET activation. Surpri si ngly, our data strongly suggested that t his regulation is independ ent of the

PAGE 94

9 4 serine/threonine kinase activity Of i nterest, the combination of the CXCR4 antagonist AMD3100 and Cediranib enhanced the survival of tumor bearing mice implanted with VEGFR expressing GBM ce lls. These data provide supportive evidence for an additional therapeutic strategy involving blocking both CXCR4 and VEGFR signaling pathways. Clinical Impact and Future Directions of the Findings GBM exhibits a high resistance rate to various treatment strategies The failure of monotherapy in GBM treatment prompted us to search for more effective interventions, among which is combined therapy. In term s of complexity of the tumor microenvironment where tumor cells are directly impacted by heterogeneous factors t he concept of combined therapy is well appreciated because it targets multiple events at the same time and thus provides better beneficial effect s on suppressing tumor growth Taking advantage of versatile GBM models and pharma co logical approach es, we provide more mechanistic understanding o f the role of chemokines and their receptors in GBM progression, and also suggest the potential of using anti chemokine system agents in combination with other therapies. In the study of CXCR4 regulation by an ti VEGF therapy, our Kaplan Meier survival analysis that showed a synergistic effect of a CXCR4 antagonist and a VEGFR inhibitor on survival of tumor bearing animals, suggest ing a promising combined therapeutic treatment approach for GBM patients. Besides the concept of combined therapy to target multiple events during tumorigenesis, personalized regimen s are another prospective approach to improve the effectiveness of cancer treatment. This idea is f ue led by the heterogen ous characteristics of cancer among different patients. With t he ability of having multiple

PAGE 95

95 primary GBM cell lines derived from various patients we have demonstrated marked heterogeneity in chemokine receptor expression and function among different examined GBM cell lines, suggesting that selective strateg ies targeting these receptors may be considered, based on the expression pattern in each individual Moreover we also showed heterogeneity in VEGFR ( s ) expression among various primary human derived GBM cell lines and tumors. This obs ervation might explain in part, the intrinsic non responsive resistance that is evident in some patients where no discernible beneficial effect of anti VEGF therapy was achieved (96, 99) Thus, identifying the expression profile of VEGFRs in GBM from individual patient s could provide a better rationale for choosing anti VEGF therapy. The failure of cancer treatment can be the consequence of redundancy in regulating tumorigenic mechanisms. If an activity of tumor cells is mediated by multiple components, therapy targeting a specific factor will not likely completely suppress it. Indeed, the concept of redundancy has been demonstrated in several area s of this project. When determining the role of CCL5 in the recruitment of microglia into GBM microenvironment using CCR1 or CCR5 deficient microglia and a dual antagonist for CCR1 and CCR5, we provide evidence that tumor secreted CCL5 may direct the infiltration of microglia through both CCR1 and CCR5. The presence of more than one derived cell lines also raises the questions for the rol e of these fac tors Do these isoforms regulate similar activity in a redundant manner or do they serve distinct functions in tumor biology ? Addressing this question will provide insights for designing novel therapeutic approach e s

PAGE 96

96 The findings reported he rein suggest versatile roles for chemokine s and their receptors in many aspects of GBM including directing the recruitment of microglia into tumor microenvironment, regulating the stem like properties of glioma cells, and mediating the tumor response after anti VEGF therapy. Despite the crucial impact of chemokine systems in tumor progress ion molecular and /or cellular mechanism s controlling these events are still elusive This can be addressed in further investigation s that focus on the signaling communication between different chemokine receptors, such as CCR1 and CCR 5 or CXCR4 and CXCR7 In addition, signaling networks that include chemokine receptors and other signaling pathways, e.g. CXCR4 VEGFR and TGF R are also worthy of future study Elucidation of these crosstalk mechanisms will be crucial for not only provid ing insight s into the critical roles of chemokine systems in GBM but also for identifying new therapeutic targets for GBM treatment Evidence for the roles of chemokine systems in GBM progression were established not only with GBM cell lines but also with GBM mouse models which were carefully chosen to address specific questions. In the first project, we used the GL261 murine GBM model to evaluate the role of CCL5 and its receptors in the infiltration of the host immune cells into G BM. The advantage of this chemically ind uced rodent cell lines grafted in syngeneic immunocompetent mice is that both the innate and acquired immune systems are present during the development of the tumor. One drawback, however, is in the histological characteristics of this mouse glioma Althou gh tumors developed in this model system display some level of invasion, they fail to show single cell infiltration to the hemisphere and microvascular abnormality, a hallmark of human GBM. In an effort to use a model system that more closely re sembles hum an GBM

PAGE 97

97 within the CNS, we generated an orthotropic xenograft GBM model in which primary patient derived GBM cell lines containing stem like properties when cultured in serum free condition were intracranial ly transplanted into the brain of immune deficient mice. T his orthotopic xenograft model was utilized in several instances to test the effect of therapeutic approaches on GBM progression. The major advantage of this model is the ability of stem like cancer cells to establish extensive infiltrative lesions when transplanted into CNS. Nonetheless, a significant pitfall associated with human xenograft GBM model using immune deficient mice, is the concern that the host immune system has been disrup ted This deficiency in immunity may alter the characteristics of human GBM during tumor development and progression, or impact the evaluation of therapeutic outcomes form this model system.

PAGE 98

98 LIST OF REFERENCES 1. Schneider T, Mawrin C, Scherlach C, Skalej M, Firsching R. Gliomas in adults. Dtsch Arztebl Int. 2010;107:799 807 2. McComb RD, Bigner DD. The biology of malignant gliomas -a comprehensive survey. Clin Neuropathol. 1984;3:93 106. 3. Clarke J, Butowski N, Chang S. Recent advances in therapy for glioblastoma. Arch Neurol. 2010;67:2 79 83. 4. Stummer W, Pichlmeier U, Meinel T, Wiestler OD, Zanella F, Reulen HJ, et al. Fluorescence guided surgery with 5 aminolevulinic acid for resection of malignant glioma: a randomised controlled multicentre phase III trial. Lancet Oncol. 2006;7:392 401. 5. Pichlmeier U, Bink A, Schackert G, Stummer W, Group AGS. Resection and survival in glioblastoma multiforme: an RTOG recursive partitioning analysis of ALA study patients. Neuro Oncol. 2008;10:1025 34. 6. Narayana A, Yamada J, Berry S, Shah P, Hun t M, Gutin PH, et al. Intensity modulated radiotherapy in high grade gliomas: clinical and dosimetric results. Int J Radiat Oncol Biol Phys. 2006;64:892 7. 7. Quinn JA, Jiang SX, Reardon DA, Desjardins A, Vredenburgh JJ, Rich JN, et al. Phase II trial of temozolomide plus o6 benzylguanine in adults with recurrent, temozolomide resistant malignant glioma. J Clin Oncol. 2009;27:1262 7. 8. Chi AS, Wen PY. Inhibiting kinases in malignant gliomas. Expert Opin Ther Targets. 2007;11:473 96. 9. Prados MD, Chang SM, Butowski N, DeBoer R, Parvataneni R, Carliner H, et al. Phase II study of erlotinib plus temozolomide during and after radiation therapy in patients with newly diagnosed glioblastoma multiforme or gliosarcoma. J Clin Oncol. 2009;27:579 84. 10. Brown P D, Krishnan S, Sarkaria JN, Wu W, Jaeckle KA, Uhm JH, et al. Phase I/II trial of erlotinib and temozolomide with radiation therapy in the treatment of newly diagnosed glioblastoma multiforme: North Central Cancer Treatment Group Study N0177. J Clin Oncol. 2008;26:5603 9. 11. Wen PY, Yung WK, Lamborn KR, Dahia PL, Wang Y, Peng B, et al. Phase I/II study of imatinib mesylate for recurrent malignant gliomas: North American Brain Tumor Consortium Study 99 08. Clin Cancer Res. 2006;12:4899 907.

PAGE 99

99 12. Reardon DA, Egorin MJ, Quinn JA, Rich JN, Gururangan S, Gururangan I, et al. Phase II study of imatinib mesylate plus hydroxyurea in adults with recurrent glioblastoma multiforme. J Clin Oncol. 2005;23:9359 68. 13. Galanis E, Buckner JC, Maurer MJ, Kreisberg JI, Ball man K, Boni J, et al. Phase II trial of temsirolimus (CCI 779) in recurrent glioblastoma multiforme: a North Central Cancer Treatment Group Study. J Clin Oncol. 2005;23:5294 304. 14. Cloughesy TF, Wen PY, Robins HI, Chang SM, Groves MD, Fink KL, et al. Phase II trial of tipifarnib in patients with recurrent malignant glioma either receiving or not receiving enzyme inducing antiepileptic drugs: a North American Brain Tumor Consortium Study. J Clin Oncol. 2006;24:3651 6. 15. Brandsma D, van den Bent MJ. M olecular targeted therapies and chemotherapy in malignant gliomas. Curr Opin Oncol. 2007;19:598 605. 16. Kitange GJ, Carlson BL, Mladek AC, Decker PA, Schroeder MA, Wu W, et al. Evaluation of MGMT promoter methylation status and correlation with temozolom ide response in orthotopic glioblastoma xenograft model. J Neurooncol. 2009;92:23 31. 17. Kitange GJ, Carlson BL, Schroeder MA, Grogan PT, Lamont JD, Decker PA, et al. Induction of MGMT expression is associated with temozolomide resistance in glioblastoma xenografts. Neuro Oncol. 2009;11:281 91. 18. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature. 2006;444:756 60. 19. Mischel PS, Shai R, Shi T, Horvath S, Lu KV, Choe G, et al. Identification of molecular subtypes of glioblastoma by gene expression profiling. Oncogene. 2003;22:2361 73. 20. Brennan C, Momota H, Hambardzumyan D, Ozawa T, Tandon A, Pedraza A, et al. Glioblastoma subclasses ca n be defined by activity among signal transduction pathways and associated genomic alterations. PLoS One. 2009;4:e7752. 21. Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, et al. Integrated genomic analysis identifies clinically relevant sub types of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell. 2010;17:98 110. 22. Cahoy JD, Emery B, Kaushal A, Foo LC, Zamanian JL, Christopherson KS, et al. A transcriptome database for astrocytes, neurons, and oligod endrocytes: a new resource for understanding brain development and function. J Neurosci. 2008;28:264 78.

PAGE 100

100 23. Thiery JP. Epithelial mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2:442 54. 24. Murat A, Migliavacca E, Gorlia T, Lambiv W L, Shay T, Hamou MF, et al. Stem cell related "self renewal" signature and high epidermal growth factor receptor expression associated with resistance to concomitant chemoradiotherapy in glioblastoma. J Clin Oncol. 2008;26:3015 24. 25. Graeber M, Scheitha uer B, Kreutzberg G. Microglia in brain tumors. Glia. 2002;40:252 9. 26. Liu C, Luo D, Streit W, Harrison J. CX3CL1 and CX3CR1 in the GL261 murine model of glioma: CX3CR1 deficiency does not impact tumor growth or infiltration of microglia and lymphocytes Journal of Immunology 2009;198:98 105. 27. Charles N, Holland E, Gilbertson R, Glass R, Kettenmann H. The brain tumor microenvironment. Glia. 2011;1180:1169 80. 28. Gehrmann J, Matsumoto Y, Kreutzberg G. Microglia: Intrinsic immuneffector cell of the brain. Brain Research Reviews. 1995;20:269 87. 29. Streit W. Microglia and macrophages in the developing CNS. Neurotoxicology. 2001;22:619 24. 30. Alliot F, Godin I, Pessac B. Microglia derive from progenitors, originating from the yolk sac, and which proliferate in the brain. Developmental Brain Research. 1999;117:145 52. 31. Chan W, Kohsaka S, Rezaie P. The origin and cell lineage of microglia: new concepts. Brain Research Reviews. 2007;53:344 54. 32. Rivest S. Regulation of innate immune responses in the brain. Nature Reviews Immunology. 2009;9:429 39. 33. Davalos D, Grutzendler J, Yang G, Kim J, Zuo Y, Jung S, et al. ATP mediates rapid microglial response to local brain injury in vivo Nature Neuroscience. 2005;8:752 8. 34. Fetler L, Amigorena S. Brain Under Surveillance : The Microglia Patrol. Science. 2005;309:392 3. 35. Nimmerjahn A, Kirchhoff F, Helmchen F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo Science. 2005;308:1314 8.

PAGE 101

101 36. Stoll M, Capper D, D ietz K, Warth A, Schleich A, Schlaszus H, et al. Differential microglial regulation in the human spinal cord under normal and pathological conditions. Neuropathology and Applied Neurobiology. 2006;32:650 61. 37. Badie B, Bartley B, Schartner J. Differenti al expression of MHC class II and B7 costimulatory molecules by microglia in rodent gliomas. Journal of Neuroimmunology. 2002;133:39 45. 38. Bettinger I, Thanos S, Paulus W. Microglia promote glioma migration. Acta Neuropathologica. 2002;103:351 5. 39. F lgel A, Labeur M, Grasbon Frodl E, Kreutzberg G, Graeber M. Microglia only weakly present glioma antigen to cytotoxic T cells. International journal of Developmental Neuroscience. 1999;17:547 56. 40. Morantz R, Wood G, Foster M, Clark M, Gollahon K. Macr ophages in experimental and human brain tumors. Part 2: studies of the macrophage content of human brain tumors. Journal of Neurosurgery. 1979;50:305 11. 41. Tran C, Wolz P, Egensperger R, Ksel S, Imai Y, Bise K, et al. Differential expression of MHC cla ss II molecules by microglia and neoplastic astroglia: relevance for the escape of astrocytoma cells from immune surveillance. Neuropathology and Applied Neurobiology. 1998;24:293 301. 42. Badie B, Schartner J. Role of microglia in glioma biology. Microscopy Research and Technique. 2001;54:106 13. 43. Watters J, Schartner J, Badie B. Microglia function in brain tumors. Journal of Neuroscience Research. 2005;81:447 55. 44. Roggendorf W, Strupp S, Paulus W. Distribution and characterization of micro glia/macrophages in human brain tumors. Acta Neuropathologica. 1996;92:288 93. 45. Morimura T, Neuchrist C, Kitz K, Budka H. Monocyte subpopulations in human gliomas: expression of Fc and complement receptors and correlation with tumor proliferation. Acta Neuropathologica. 1990;80:287 94. 46. Hussain S, Yang D, Suki D, Aldape K, Grimm E, Heimberger A. The role of human glioma infiltrating microglia/macrophages in mediating antitumor immune responses. Neuro Oncology. 2006;8:261 79. 47. Yang I, Han S, Kaur G, Crane C, Parsa A. The role of microglia in central nervous system immunity and glioma immunology. Journal of Clinical Neuroscience. 2010;17:6 10.

PAGE 102

102 48. Markovic D, Glass R, Synowitz M, Rooijen N, Kettenmann H. Microglia stimulate the invasiveness of glio ma cells by increasing the activity of metalloprotease 2. Journal of Neuropathology and Experimental Neurology. 2005;64:754 62. 49. Badie B, Schertner J, Klaver J, Vorpahl J. In vitro modulation of microglia motility by glioma cells is mediated by hepatoc yte growth/scatter factor. Neurosurgery. 1999;44:1077 82. 50. Alterman R, Standley E. Colony stimulating factor 1 expression in human glioma. Molecular and Chemical Neuropathology. 1994;21:177 88. 51. Nitta T, Sata K, Allegretta M, Brocke S, Lim M, Mitch ell D, et al. Expression of granulocyte colony stimulating factor and grannulocyte macrophage colony stimulating factor genes in human astrocytoma cell lines and in glioma specimens. Brain Research. 1992;571. 52. Nakada M, Okada Y, Yamashita J. The role o f matrix metalloproteinases in glioma invasion. Frontier in Bioscience. 2003;8:261 9. 53. Scium G, Santoni A, Bernardini G. Chemokines and glioma: invasion and more. Journal of Neuroimmunology. 2010;224:8 12. 54. Kielian T, van Rooijen N, Hickey W. MCP 1 expression in CNS 1 astrocytoma cells: implications for macrophage infiltration into tumors in vivo Journal of Neuro Oncology. 2002;56:1 12. 55. Platten M, Kretz A, Naumann U, Aulwurm S, Egashira K, Isenmann S, et al. Monocyte chemoattractant protein 1 increases microglial infiltration and aggressiveness of gliomas. Annals of Neurology. 2003;54:388 92. 56. Leung S, Wong M, Chung L, Chan A, S Y. Monocyte chemoattractant protein 1 expression and macrophage infiltration into gliomas. Acta Neurophathology. 1997;93. 57. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nature medicine. 1997;3:730 7. 58. Hemmati HD, Nakano I, Lazareff JA, Masterman Smith M, Geschwind DH, Bronner Fraser M, et al. Cancerous stem cells can arise from pediatric brain tumors. Proceedings of the National Academy of Sciences of the United States of America. 2003;100:15178 83. 59. Galli R, Binda E, Orfanelli U, Cipelletti B, Gritti A, De Vitis S, et al. Isolation and characterization of tumorigenic, stem like neural precursors from human glioblastoma. Cancer research. 2004;64:7011 21.

PAGE 103

103 60. Monnier J, Boissan M, L'Helgoualc'h A, Lacombe M L, Turlin B, Zucman Rossi J, et al. CXCR7 is up regulated in human and murine hepatocellular carcinoma and is specifically expressed by endothelial cells. European journal of cancer (Oxford, England : 1990). 2011;48:138 48. 61. Piccirillo SG, Reynolds BA, Zanetti N, Lamorte G, Binda E, Broggi G, et al. Bone morpho genetic proteins inhibit the tumorigenic potential of human brain tumour initiating cells. Nature. 2006;444:761 5. 62. Schatton T, Murphy GF, Frank NY, Yamaura K, Waaga Gasser AM, Gasser M, et al. Identification of cells initiating human melanomas. Nature 2008;451:345 9. 63. Boiko AD, Razorenova OV, van de Rijn M, Swetter SM, Johnson DL, Ly DP, et al. Human melanoma initiating cells express neural crest nerve growth factor receptor CD271. Nature. 2010;466:133 7. 64. Quintana E, Shackleton M, Sabel MS, F ullen DR, Johnson TM, Morrison SJ. Efficient tumour formation by single human melanoma cells. Nature. 2008;456:593 8. 65. Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, et al. Identification of a cancer stem cell in human brain tumors. Can cer research. 2003;63:5821 8. 66. Vescovi AL, Galli R, Reynolds BA. Brain tumour stem cells. Nat Rev Cancer. 2006;6:425 36. 67. Uchida N, Buck DW, He D, Reitsma MJ, Masek M, Phan TV, et al. Direct isolation of human central nervous system stem cells. Pro c Natl Acad Sci U S A. 2000;97:14720 5. 68. Ben Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, et al. An embryonic stem cell like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet. 2008;40:499 507. 69. Beier D Hau P, Proescholdt M, Lohmeier A, Wischhusen J, Oefner PJ, et al. CD133(+) and CD133( ) glioblastoma derived cancer stem cells show differential growth characteristics and molecular profiles. Cancer research. 2007;67:4010 5. 70. Singh SK, Hawkins C, Cla rke ID, Squire JA, Bayani J, Hide T, et al. Identification of human brain tumour initiating cells. Nature. 2004;432:396 401. 71. Wu A, Oh S, Wiesner SM, Ericson K, Chen L, Hall WA, et al. Persistence of CD133+ cells in human and mouse glioma cell lines: detailed characterization of GL261 glioma cells with cancer stem cell like properties. Stem cells and development. 2008;17:173 84.

PAGE 104

104 72. Ogden AT, Waziri AE, Lochhead RA, Fusco D, Lopez K, Ellis JA, et al. Identification of A2B5+CD133 tumor initiating cells in adult human gliomas. Neurosurgery. 2008;62:505 14; discussion 14 5. 73. Anido J, Sez Borderas A, Gonzlez Junc A, Rodn L, Folch G, Carmona MA, et al. TGF Initiating Cell Population in Hu man Glioblastoma. Cancer Cell. 2010;18:655 68. 74. Tchoghandjian A, Baeza N, Colin C, Cayre M, Metellus P, Beclin C, et al. A2B5 cells from human glioblastoma have cancer stem cell properties. Brain Pathol. 2010;20:211 21. 75. Calabrese C, Poppleton H, K ocak M, Hogg TL, Fuller C, Hamner B, et al. A perivascular niche for brain tumor stem cells. Cancer Cell. 2007;11:69 82. 76. Lathia JD, Gallagher J, Myers JT, Li M, Vasanji A, McLendon RE, et al. Direct In Vivo Evidence for Tumor Propagation by Glioblasto ma Cancer Stem Cells. PLoS ONE. 2011;6:e24807 e. 77. Shen Q, Goderie SK, Jin L, Karanth N, Sun Y, Abramova N, et al. Endothelial cells stimulate self renewal and expand neurogenesis of neural stem cells. Science. 2004;304:1338 40. 78. Oka N, Soeda A, Ina gaki A, Onodera M, Maruyama H, Hara A, et al. VEGF promotes tumorigenesis and angiogenesis of human glioblastoma stem cells. Biochem Biophys Res Commun. 2007;360:553 9. 79. Ricci Vitiani L, Pallini R, Biffoni M, Todaro M, Invernici G, Cenci T, et al. Tumo ur vascularization via endothelial differentiation of glioblastoma stem like cells. Nature. 2010;468:824 8. 80. Wang R, Chadalavada K, Wilshire J, Kowalik U, Hovinga KE, Geber A, et al. Glioblastoma stem like cells give rise to tumour endothelium. Nature. 2010;468:829 33. 81. Soda Y, Marumoto T, Friedmann Morvinski D, Soda M, Liu F, Michiue H, et al. Transdifferentiation of glioblastoma cells into vascular endothelial cells. Proceedings of the National Academy of Sciences of the United States of America. 2011;108:4274 80. 82. Cheng L, Huang Z, Zhou W, Wu Q, Donnola S, Liu JK, et al. Glioblastoma stem cells generate vascular pericytes to support vessel function and tumor growth. Cell. 2013;153:139 52. 83. Bar EE. Glioblastoma, cancer stem cells and hypoxi a. Brain Pathol. 2011;21:119 29.

PAGE 105

105 84. Yoshida Y, Takahashi K, Okita K, Ichisaka T, Yamanaka S. Hypoxia enhances the generation of induced pluripotent stem cells. Cell Stem Cell. 2009;5:237 41. 85. Bar EE, Lin A, Mahairaki V, Matsui W, Eberhart CG. Hypoxia increases the expression of stem cell markers and promotes clonogenicity in glioblastoma neurospheres. Am J Pathol. 2010;177:1491 502. 86. Soeda A, Park M, Lee D, Mintz A, Androutsellis Theotokis A, McKay RD, et al. Hypoxia promotes expansion of the CD133 positive glioma stem cells through activation of HIF 1alpha. Oncogene. 2009;28:3949 59. 87. Jain RK, di Tomaso E, Duda DG, Loeffler JS, Sorensen AG, Batchelor TT. Angiogenesis in brain tumours. Nat Rev Neurosci. 2007;8:610 22. 88. Bergers G, Song S Meyer Morse N, Bergsland E, Hanahan D. Benefits of targeting both pericytes and endothelial cells in the tumor vasculature with kinase inhibitors. J Clin Invest. 2003;111:1287 95. 89. Hardee ME, Marciscano AE, Medina Ramirez CM, Zagzag D, Narayana A, Lo nning SM, et al. Resistance of glioblastoma initiating cells to radiation mediated by the tumor microenvironment can be abolished by inhibiting transforming growth factor 29. 90. Plate KH, Breier G, Millauer B, Ullrich A, Risau W. Up regulation of vascular endothelial growth factor and its cognate receptors in a rat glioma model of tumor angiogenesis. Cancer Res. 1993;53:5822 7. 91. Plate KH, Breier G, Weich HA, Mennel HD, Risau W. Vascular endothelial growth factor and glioma angiogenesis: coordinate induction of VEGF receptors, distribution of VEGF protein and possible in vivo regulatory mechanisms. Int J Cancer. 1994;59:520 9. 92. Samoto K, Ikezaki K, Ono M, Shono T, Kohno K, Kuwano M, et al. Expression of vascular endotheli al growth factor and its possible relation with neovascularization in human brain tumors. Cancer Res. 1995;55:1189 93. 93. Hofer S, Elandt K, Greil R, Hottinger AF, Huber U, Lemke D, et al. Clinical outcome with bevacizumab in patients with recurrent high grade glioma treated outside clinical trials. Acta Oncol. 2011;50:630 5. 94. Reardon DA, Wen PY, Desjardins A, Batchelor TT, Vredenburgh JJ. Glioblastoma multiforme: an emerging paradigm of anti VEGF therapy. Expert Opin Biol Ther. 2008;8:541 53. 95. Iw amoto FM, Fine HA. Bevacizumab for malignant gliomas. Arch Neurol. 2010;67:285 8.

PAGE 106

106 96. Batchelor TT, Sorensen AG, di Tomaso E, Zhang WT, Duda DG, Cohen KS, et al. AZD2171, a pan VEGF receptor tyrosine kinase inhibitor, normalizes tumor vasculature and allev iates edema in glioblastoma patients. Cancer Cell. 2007;11:83 95. 97. Drappatz J, Norden AD, Wong ET, Doherty LM, Lafrankie DC, Ciampa A, et al. Phase I study of vandetanib with radiotherapy and temozolomide for newly diagnosed glioblastoma. Int J Radiat Oncol Biol Phys. 2010;78:85 90. 98. Iwamoto FM, Abrey LE, Beal K, Gutin PH, Rosenblum MK, Reuter VE, et al. Patterns of relapse and prognosis after bevacizumab failure in recurrent glioblastoma. Neurology. 2009;73:1200 6. 99. Bergers G, Hanahan D. Modes of resistance to anti angiogenic therapy. Nature reviews Cancer. 2008;8:592 603. 100. de Groot JF, Fuller G, Kumar AJ, Piao Y, Eterovic K, Ji Y, et al. Tumor invasion after treatment of glioblastoma with bevacizumab: radiographic and pathologic correlation in humans and mice. Neuro Oncol. 2010;12:233 42. 101. Fernando NT, Koch M, Rothrock C, Gollogly LK, D'Amore PA, Ryeom S, et al. Tumor escape from endogenous, extracellular matrix associated angiogenesis inhibitors by up regulation of multiple proangiogenic factors. Clin Cancer Res. 2008;14:1529 39. 102. Petit I, Jin D, Rafii S. The SDF 1 CXCR4 signaling pathway: a molecular hub modulating neo angiogenesis. Trends Immunol. 2007;28:299 307. 103. Du R, Lu KV, Petritsch C, Liu P, Ganss R, Passegu E, et al. HIF1alpha induces the recruitment of bone marrow derived vascular modulatory cells to regulate tumor angiogenesis and invasion. Cancer Cell. 2008;13:206 20. 104. Ceradini DJ, Kulkarni AR, Callaghan MJ, Tepper OM, Bastidas N, Kleinman ME, et al Progenitor cell trafficking is regulated by hypoxic gradients through HIF 1 induction of SDF 1. Nat Med. 2004;10:858 64. 105. De Falco E, Porcelli D, Torella AR, Straino S, Iachininoto MG, Orlandi A, et al. SDF 1 involvement in endothelial phenotype and ischemia induced recruitment of bone marrow progenitor cells. Blood. 2004;104:3472 82. 106. Aghi M, Cohen KS, Klein RJ, Scadden DT, Chiocca EA. Tumor stromal derived factor 1 recruits vascular progenitors to mitotic neovasculature, where microenvironment influences their differentiated phenotypes. Cancer Res. 2006;66:9054 64.

PAGE 107

107 107. Shaked Y, Ciarrocchi A, Franco M, Lee CR, Man S, Cheung AM, et al. Therapy induced acute recruitment of circulating endothelial progenitor cells to tumors. Science. 2006;313:178 5 7. 108. Sathornsumetee S, Cao Y, Marcello JE, Herndon JE, McLendon RE, Desjardins A, et al. Tumor angiogenic and hypoxic profiles predict radiographic response and survival in malignant astrocytoma patients treated with bevacizumab and irinotecan. J Cli n Oncol. 2008;26:271 8. 109. Benjamin LE, Hemo I, Keshet E. A plasticity window for blood vessel remodelling is defined by pericyte coverage of the preformed endothelial network and is regulated by PDGF B and VEGF. Development. 1998;125:1591 8. 110. Darl and DC, Massingham LJ, Smith SR, Piek E, Saint Geniez M, D'Amore PA. Pericyte production of cell associated VEGF is differentiation dependent and is associated with endothelial survival. Dev Biol. 2003;264:275 88. 111. Song S, Ewald AJ, Stallcup W, Werb Z Bergers G. PDGFRbeta+ perivascular progenitor cells in tumours regulate pericyte differentiation and vascular survival. Nat Cell Biol. 2005;7:870 9. 112. Blouw B, Song H, Tihan T, Bosze J, Ferrara N, Gerber HP, et al. The hypoxic response of tumors is d ependent on their microenvironment. Cancer Cell. 2003;4:133 46. 113. Rubenstein JL, Kim J, Ozawa T, Zhang M, Westphal M, Deen DF, et al. Anti VEGF antibody treatment of glioblastoma prolongs survival but results in increased vascular cooption. Neoplasia. 2000;2:306 14. 114. Kunkel P, Ulbricht U, Bohlen P, Brockmann MA, Fillbrandt R, Stavrou D, et al. Inhibition of glioma angiogenesis and growth in vivo by systemic treatment with a monoclonal antibody against vascular endothelial growth factor receptor 2. Cancer Res. 2001;61:6624 8. 115. Narayana A, Gruber D, Kunnakkat S, Golfinos JG, Parker E, Raza S, et al. A clinical trial of bevacizumab, temozolomide, and radiation for newly diagnosed glioblastoma. J Neurosurg. 2012;116:341 5. 116. Lu KV, Chang JP, Parachoniak Ca, Pandika MM, Aghi MK, Meyronet D, et al. VEGF Inhibits Tumor Cell Invasion and Mesenchymal Transition through a MET/VEGFR2 Complex. Cancer cell. 2012;22:21 35. 117. Luster AD. Chemokines -chemotactic cytokines that mediate inflammation. The New England journal of medicine. 1998;338:436 45.

PAGE 108

108 118. Allen SJ, Crown SE, Handel TM. Chemokine: receptor structure, interactions, and antagonism. Annual review of immunology. 2007;25:787 820. 119. Murphy PM. International Union of Pharmacology. XXX. Up date on chemokine receptor nomenclature. Pharmacological reviews. 2002;54:227 9. 120. Strieter RM, Burdick MD, Mestas J, Gomperts B, Keane MP, Belperio JA. Cancer CXC chemokine networks and tumour angiogenesis. European journal of cancer. 2006;42:768 78. 121. Belperio JA, Keane MP, Arenberg DA, Addison CL, Ehlert JE, Burdick MD, et al. CXC chemokines in angiogenesis. Journal of leukocyte biology. 2000;68:1 8. 122. Strieter RM, Kunkel SL, Arenberg DA, Burdick MD, Polverini PJ. Interferon gamma inducible p rotein 10 (IP 10), a member of the C X C chemokine family, is an inhibitor of angiogenesis. Biochemical and biophysical research communications. 1995;210:51 7. 123. Maione TE, Gray GS, Petro J, Hunt AJ, Donner AL, Bauer SI, et al. Inhibition of angiogenes is by recombinant human platelet factor 4 and related peptides. Science. 1990;247:77 9. 124. Matloubian M, David A, Engel S, Ryan JE, Cyster JG. A transmembrane CXC chemokine is a ligand for HIV coreceptor Bonzo. Nature immunology. 2000;1:298 304. 125. B alashov KE, Rottman JB, Weiner HL, Hancock WW. CCR5(+) and CXCR3(+) T cells are increased in multiple sclerosis and their ligands MIP 1alpha and IP 10 are expressed in demyelinating brain lesions. Proceedings of the National Academy of Sciences of the Unit ed States of America. 1999;96:6873 8. 126. Jones D, Benjamin RJ, Shahsafaei A, Dorfman DM. The chemokine receptor CXCR3 is expressed in a subset of B cell lymphomas and is a marker of B cell chronic lymphocytic leukemia. Blood. 2000;95:627 32. 127. Koshi ba T, Hosotani R, Miyamoto Y, Ida J, Tsuji S, Nakajima S, et al. Expression of stromal cell derived factor 1 and CXCR4 ligand receptor system in pancreatic cancer: a possible role for tumor progression. Clin Cancer Res. 2000;6:3530 5. 128. Zujovic V, Benav ides J, Vige X, Carter C, Taupin V. Fractalkine modulates TNF alpha secretion and neurotoxicity induced by microglial activation. Glia. 2000;29:305 15. 129. Fischer FR, Luo Y, Luo M, Santambrogio L, Dorf ME, Gehrmann J, et al. RANTES induced chemokine cascade in dendritic cells. Journal of immunology. 2001;167:1637 43.

PAGE 109

109 130. Remick DG, Green LB, Newcomb DE, Garg SJ, Bolgos GL, Call DR. CXC chemokine redundancy ensures local neutrophil recruitment during acute inflammation. The American journal of patholo gy. 2001;159:1149 57. 131. Volin MV, Woods JM, Amin MA, Connors MA, Harlow LA, Koch AE. Fractalkine: a novel angiogenic chemokine in rheumatoid arthritis. The American journal of pathology. 2001;159:1521 30. 132. Luo Y, Berman Ma, Zhai Q, Fischer FR, Abr omson Leeman SR, Zhang Y, et al. RANTES stimulates inflammatory cascades and receptor modulation in murine astrocytes. Glia. 2002;39:19 30. 133. Blaschke S, Koziolek M, Schwarz A, Benohr P, Middel P, Schwarz G, et al. Proinflammatory role of fractalkine ( CX3CL1) in rheumatoid arthritis. The Journal of rheumatology. 2003;30:1918 27. 134. Bonavia R, Bajetto A, Barbero S, Pirani P, Florio T, Schettini G. Chemokines and their receptors in the CNS: expression of CXCL12/SDF 1 and CXCR4 and their role in astrocy te proliferation. Toxicology letters. 2003;139:181 9. 135. Halks Miller M, Schroeder ML, Haroutunian V, Moenning U, Rossi M, Achim C, et al. CCR1 is an early and specific marker of Alzheimer's disease. Annals of neurology. 2003;54:638 46. 136. Wilkinson P, Sedgwick JD, Schwender S, Imrich H, Drries R, Butcher GW, et al. Cell Locomotion and Chemotaxis: Basic Concepts and Methodological Approaches. Methods. 1996;10:74 81. 137. Cross AK, Woodroofe MN. Chemokines induce migration and changes in actin polyme rization in adult rat brain microglia and a human fetal microglial cell line in vitro Journal of neuroscience research. 1999;55:17 23. 138. Mller A, Homey B, Soto H, Ge N, Catron D, Buchanan ME, et al. Involvement of chemokine receptors in breast cancer metastasis. Nature. 2001;410:50 6. 139. Sanchez Alcaniz JA, Haege S, Mueller W, Pla R, Mackay F, Schulz S, et al. Cxcr7 controls neuronal migration by regulating chemokine responsiveness. Neuron. 2011;69:77 90. 140. Zabel Ba, Lewn S, Berahovich RD, Ja n JC, Schall TJ. The novel chemokine receptor CXCR7 regulates trans endothelial migration of cancer cell s. Molecular cancer. 2011;10:73

PAGE 110

110 141. Barbero S, Bonavia R, Bajetto A, Porcile C, Pirani P, Ravetti JL, et al. Stromal cell derived factor 1alpha sti mulates human glioblastoma cell growth through the activation of both extracellular signal regulated kinases 1/2 and Akt. Cancer research. 2003;63:1969 74. 142. Wu M, Chen Q, Li D, Li X, Huang C, Tang Y, et al. LRRC4 inhibits human glioblastoma cells prol iferation, invasion, and proMMP 2 activation by reducing SDF 1 alpha/CXCR4 mediated ERK1/2 and Akt signaling pathways. Journal of cellular biochemistry. 2008;103:245 55. 143. Forstreuter F, Lucius R, Mentlein R, Robinson SC, Scott Ka, Wilson JL, et al. Vascular endothelial growth factor induces chemotaxis and proliferation of microglial cells. Journal of neuroimmunology. 2002;132:93 8. 144. Kakinuma T, Hwang ST. Chemokines chemokine receptors and cancer metastasis. 2006;79:639 51. 145. Mantovani A, Savino B, Locati M, Zammataro L, Allavena P, Bonecchi R. The chemokine system in cancer biology and therapy. Cytokine & growth factor reviews. 2010;21:27 39. 146. Bajetto A, Barbieri F, Dorcaratto A, Barbero S, Daga A, Porcile C, et al. Expression of CXC chemokine receptors 1 5 and their ligands in human glioma tissues: role of CXCR4 and SDF1 in glioma cell proliferation and migration. Neurochem Int. 2006;49:423 32. 147. Tan MC, Goedegebuure PS, Belt BA, Flaherty B, Sankpal N, Gillanders WE, et al. Disru ption of CCR5 dependent homing of regulatory T cells inhibits tumor growth in a murine model of pancreatic cancer. Journal of immunology. 2009;182:1746 55. 148. Rubin JB, Kung AL, Klein RS, Chan JA, Sun Y, Schmidt K, et al. A small molecule antagonist of CXCR4 inhibits intracranial growth of primary brain tumors. Proceedings of the National Academy of Sciences of the United States of America. 2003;100:13513 8. 149. Liu C, Luo D, Reynolds Ba, Meher G, Katritzky AR, Lu B, et al. Chemokine receptor CXCR3 pro motes growth of glioma. Carcinogenesis. 2011;32:129 37. 150. Fetler L, Amigorena S, Boehme Sa, Lio FM, Maciejewski Lenoir D, Bacon KB, et al. Brain Under Surveillance : The Microglia Patrol. Journal of immunology. 2005;309:397 403. 151. Markovic DS, Glas s R, Synowitz M, Rooijen NV, Kettenmann H, Ni J, et al. Microglia Stimulate the Invasiveness of Glioma Cells by Increasing the Activity of Metalloprotease 2. British Journal of Pharmacology. 2005;64:754 62.

PAGE 111

111 152. Kielian T, van Rooijen N, Hickey WF, Lafuent e JV, Adn B, Alkiza K, et al. MCP 1 expression in CNS 1 astrocytoma cells: implications for macrophage infiltration into tumors in vivo Journal of neuro oncology. 2002;56:1 12. 153. Platten M, Kretz A, Naumann U, Aulwurm S, Egashira K, Isenmann S, et al Monocyte chemoattractant protein 1 increases microglial infiltration and aggressiveness of gliomas. Annals of neurology. 2003;54:388 92. 154. Okada H, Lieberman FS, Walter KA, Lunsford LD, Kondziolka DS, Bejjani GK, et al. Autologous glioma cell vaccine admixed with interleukin 4 gene transfected fibroblasts in the treatment of patients with malignant gliomas. Journal of translational medicine. 2007;5:67. 155. Robinson S, Scott K, Wilson J, Thompson R, Proudfoot A, Balkwill F. A chemokine receptor antag onist inhibits experimental breast tumor growth. Cancer Research. 2003;63:8360 5. 156. Soria G, Ben Baruch A. The inflammatory chemokines CCL2 and CCL5 in breast cancer. Cancer Letters. 2008;267:271 85. 157. Zeelenberg IS, Ruuls Van Stalle L, Roos E. The chemokine receptor CXCR4 is required for outgrowth of colon carcinoma micrometastases. Cancer Res. 2003;63:3833 9. 158. Hall JM, Korach KS. Stromal cell derived factor 1, a novel target of estrogen receptor action, mediates the mitogenic effects of estra diol in ovarian and breast cancer cells. Mol Endocrinol. 2003;17:792 803. 159. Bertolini F, Dell'Agnola C, Mancuso P, Rabascio C, Burlini A, Monestiroli S, et al. CXCR4 neutralization, a novel therapeutic approach for non Hodgkin's lymphoma. Cancer resear ch. 2002;62:3106 12. 160. Schuller U, Koch A, Hartmann W, Garre ML, Goodyer CG, Cama A, et al. Subtype specific expression and genetic alterations of the chemokinereceptor gene CXCR4 in medulloblastomas. International journal of cancer Journal internation al du cancer. 2005;117:82 9. 161. Rempel SA, Dudas S, Ge S, Gutirrez JA. Identification and localization of the cytokine SDF1 and its receptor, CXC chemokine receptor 4, to regions of necrosis and angiogenesis in human glioblastoma. Clin Cancer Res. 2000 ;6:102 11. 162. Zhou Y, Larsen PH, Hao C, Yong VW. CXCR4 is a major chemokine receptor on glioma cells and mediates their survival. J Biol Chem. 2002;277:49481 7.

PAGE 112

112 163. Guleng B, Tateishi K, Ohta M, Kanai F, Jazag A, Ijichi H, et al. Blockade of the stro mal cell derived factor 1/CXCR4 axis attenuates in vivo tumor growth by inhibiting angiogenesis in a vascular endothelial growth factor independent manner. Cancer research. 2005;65:5864 71. 164. Kucia M, Reca R, Miekus K, Wanzeck J, Wojakowski W, Janowska Wieczorek A, et al. Trafficking of normal stem cells and metastasis of cancer stem cells involve similar mechanisms: pivotal role of the SDF 1 CXCR4 axis. Stem cells. 2005;23:879 94. 165. Burns JM, Summers BC, Wang Y, Melikian A, Berahovich R, Miao Z, et al. A novel chemokine receptor for SDF 1 and I TAC involved in cell survival, cell adhesion, and tumor development. The Journal of experimental medicine. 2006;203:2201 13. 166. Ehtesham M, Winston Ja, Kabos P, Thompson RC. CXCR4 expression mediates gliom a cell invasiveness. Oncogene. 2006;25:2801 6. 167. Luker KE, Luker GD. Functions of CXCL12 and CXCR4 in breast cancer. Cancer letters. 2006;238:30 41. 168. Sugiyama T, Kohara H, Noda M, Nagasawa T. Maintenance of the hematopoietic stem cell pool by CXCL 12 CXCR4 chemokine signaling in bone marrow stromal cell niches. Immunity. 2006;25:977 88. 169. Zagzag D, Lukyanov Y, Lan L, Ali MA, Esencay M, Mendez O, et al. Hypoxia inducible factor 1 and VEGF upregulate CXCR4 in glioblastoma: implications for angioge nesis and glioma cell invasion. Lab Invest. 2006;86:1221 32. 170. Furuya M, Suyama T, Usui H, Kasuya Y, Nishiyama M, Tanaka N, et al. Up regulation of CXC chemokines and their receptors: implications for proinflammatory microenvironments of ovarian carcin omas and endometriosis. Human pathology. 2007;38:1676 87. 171. Yang L, Jackson E, Woerner BM, Perry A, Piwnica Worms D, Rubin JB. Blocking CXCR4 mediated cyclic AMP suppression inhibits brain tumor growth in vivo Cancer research. 2007;67:651 8. 172. Zagzag D, Esencay M, Mendez O, Yee H, Smirnova I, Huang Y, et al. Hypoxia and vascular endothelial growth factor induced stromal cell derived factor 1alpha/CXCR4 expression in glioblastomas: one plausible explanation of Scherer's structures. The American journal of pathology. 2008;173:545 60. 173. Ehtesham M, Mapara KY, Stevenson CB, Thompson RC. CXCR4 mediates the proliferation of glioblastoma progenitor cells. Cancer Lett. 2009;274:305 12.

PAGE 113

113 174. do Carmo A, Patricio I, Cruz MT, Carvalheiro H, Oliveira CR, Lopes MC. CXCL12/CXCR4 promotes motility and proliferation of glioma cells. Cancer biology & therapy. 2010;9:56 65. 175. Esencay M, Newcomb EW, Zagzag D, Gilbertson RJ, Lathia JD, Hitomi M, et al. HGF upregulates CXCR4 expression in gliomas via NF kap paB: implications for glioma cell migration. Journal of neuro oncology. 2010;99:33 40. 176. Stevenson CB, Ehtesham M, McMillan KM, Valadez JG, Edgeworth ML, Price RR, et al. CXCR4 expression is elevated in glioblastoma multiforme and correlates with an in crease in intensity and extent of peritumoral T2 weighted magnetic resonance imaging signal abnormalities. Neurosurgery. 2008;63:560 9; discussion 9 70. 177. Liu C, Pham K, Luo D, Reynolds BA, Hothi P, Foltz G, et al. Expression and Functional Heterogenei ty of Chemokine Receptors CXCR4 and CXCR7 in Primary Patient Derived Glioblastoma Cells. PLoS One. 2013;8:e59750. 178. Rao S, Sengupta R, Choe EJ, Woerner BM, Jackson E, Sun T, et al. CXCL12 Mediates Trophic Interactions between Endothelial and Tumor Cell s in Glioblastoma. PLoS ONE. 2012;7:e33005 e. 179. Zagzag D, Esencay M, Mendez O, Yee H, Smirnova I, Huang Y, et al. Hypoxia and vascular endothelial growth factor induced stromal cell derived factor 1alpha/CXCR4 expression in glioblastomas: one plausibl e expl anation of Scherer's structures. The American journal of pathology. 2008;173:545 60. 180. Rubin JB, Kung AL, Klein RS, Chan Ja, Sun Y, Schmidt K, et al. A small molecule antagonist of CXCR4 inhibits intracranial growth of primary brain tumors. Proce edings of the National Academy of Sciences of the United States of America. 2003;100:13513 8. 181. Miao Z, Luker KE, Summers BC, Berahovich R, Bhojani MS, Rehemtulla A, et al. CXCR7 (RDC1) promotes breast and lung tumor growth in vivo and is expressed on tumor associated vasculature. Proceedings of the National Academy of Sciences of the United States of America. 2007;104:15735 40. 182. Wang J, Shiozawa Y, Wang Y, Jung Y, Pienta KJ, Mehra R, et al. The role of CXCR7/RDC1 as a chemokine receptor for CXCL12 /SDF 1 in prostate cancer. J Biol Chem. 2008;283:4283 94. 183. Luker KE, Steele JM, Mihalko LA, Ray P, Luker GD. Constitutive and chemokine dependent internalization and recycling of CXCR7 in breast cancer cells to degrade chemokine ligands. Oncogene. 201 0;29:4599 610.

PAGE 114

114 184. Decaillot FM, Kazmi Ma, Lin Y, Ray Saha S, Sakmar TP, Sachdev P. CXCR7/CXCR4 heterodimer constitutively recruits {beta} arrestin to enhance cell migration. The Journal of biological chemistry. 2011;286:32188 97. 185. Lipfert J, Kraft R, Hajek P, Abraham G. The Presumed Atypical Chemokine Receptor CXCR7 Signals Through G i / o Proteins in Primary Rodent Astrocytes and Human Glioma Cells. Glia. 2011;000:1 10. 186. Hattermann K, Held Feindt J, Lucius R, Muerkoster SS, Penfold ME, Schall TJ, et al. The chemokine receptor CXCR7 is highly expressed in human glioma cells and mediates antiapoptotic effects. Cancer research. 2010;70:3299 308. 187. Ausman JI, Shapiro WR, Rall DP. Studies on the chemotherapy of experimental brain tumors: develop ment of an experimental model. Cancer research. 1970;30:2394 400. 188. Pellegatta S, Poliani PL, Corno D, Menghi F, Ghielmetti F, Suarez Merino B, et al. Neurospheres enriched in cancer stem like cells are highly effective in eliciting a dendritic cell me diated immune response against malignant gliomas. Cancer research. 2006;66:10247 52. 189. Jacobs VL, Valdes PA, Hickey WF, De Leo JA. Current review of in vivo GBM rodent models: emphasis on the CNS 1 tumour model. ASN Neuro. 2011;3:e00063. 190. Lee J, K otliarova S, Kotliarov Y, Li A, Su Q, Donin NM, et al. Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum cultured cell lines. Cancer cell. 2006;9:391 403. 19 1. Saura J, Tusell JM, Serratosa J. High yield isolation of murine microglia by mild trypsinization. Glia. 2003;44:183 9. 192. Charles Na, Holland EC, Gilbertson R, Glass R, Kettenmann H. The brain tumor microenvironment. Glia. 2011;59:1169 80. 193. Bett inger I, Thanos S, Paulus W. Microglia promote glioma migration. Acta neuropathologica. 2002;103:351 5. 194. Ford BAL, Foulcher E, Lemckert FA, Sedgwick JD, Lemos CD, Christensen JE, et al. Microglia induce CD4 T lymphocyte final effector function and dea th. J Exp Med. 1996;184:1737 45. 195. Hussain SF, Yang D, Suki D, Aldape K, Grimm E, Heimberger AB. The role of human glioma infiltrating microglia/macrophages in mediating antitumor immune responses. Neuro oncology. 2006;8:261 79.

PAGE 115

115 196. Yang I, Han SJ, Ka ur G, Crane C, Parsa AT. The role of microglia in central nervous system immunity and glioma immunology. Journal of clinical neuroscience : official journal of the Neurosurgical Society of Australasia. 2010;17:6 10. 197. Markovic DS, Vinnakota K, Chirasan i S, Synowitz M, Raguet H, Stock K, et al. Gliomas induce and exploit microglial MT1 MMP expression for tumor expansion. 2009;106:1 6. 198. Scium G, Santoni A, Bernardini G. Chemokines and glioma: invasion and more. Journal of neuroimmunology. 2010;224:8 12. 199. Vaday G, Peehl D, Kadam P, Lawrence D. Expression of CCL5 (RANTES) and CCR5 in prostate cancer. The Prostate. 2006;66:124 34. 200. Niwa Y, Akamatsu H, Niwa H, Sumi H, Ozaki Y, Abe A. Correlation of tissue and plasma RANTES levels with disease course in patients with breast or cervical cancer. Clinical Cancer Research. 2001;7:285 9. 201. Chan WY, Kohsaka S, Rezaie P, Sliwa M, Markovic D, Gabrusiewicz K, et al. The origin and cell lineage of microglia: new concepts. Brain research reviews. 2007; 53:344 54. 202. Zhai H, Heppner FL, Tsirka SE. Microglia/macrophages promote glioma progression. Glia. 2011;59:472 85. 203. Iida N, Nakamoto Y, Baba T, Kakinoki K, Li Y Y, Wu Y, et al. Tumor cell apoptosis induces tumor specific immunity in a CC chemokine receptor 1 and 5 dependent manner in mice. Journal of leukocyte biology. 2008;84:1001 10. 204. Repeke CE, Ferreira SB, Claudino M, Silveira EM, de Assis GF, Avila Campos MJ, et al. Evidences of the cooperative role of the chemokines CCL3, CCL4 and CCL5 and its receptors CCR1+ and CCR5+ in RANKL+ cell migration throughout experimental periodontitis in mice. Bone. 2010;46:1122 30. 205. Proudfoot aE, Power Ca, Hoogewerf aJ, Montjovent MO, Borlat F, Offord RE, et al. Extension of recombinant human RANTES by the retention of the initiating methionine produces a potent antagonist. The Journal of biological chemistry. 1996;271:2599 603. 206. Kavitha CV, Agarwal C, Agarwal R, Deep G. Asiatic Acid Inhibits Pro Angiogenic Effects of VEGF and Human Glioma s in Endothelial Cell Culture Models. 2011;6. 207. Longden J, Cooke EL, Hill SJ. Effect of CCR5 receptor antagonists on endocytosis of the human CCR5 receptor in CHO K1 cells. British journal of pharmacology. 2008;153:1513 27.

PAGE 116

116 208. Maeda K, Das D, Ogata a oki H, Nakata H, Miyakawa T, Tojo Y, et al. Structural and Molecular Interactions of CCR5 Inhibitors with CCR5 *. 2006;281:12688 98. 209. Ping Y f, Yao X h, Jiang J y, Zhao L t, Yu S c, Jiang T, et al. The chemokine CXCL12 and its receptor CXCR4 promote g lioma stem cell mediated VEGF production and tumour angiogenesis via PI3K / AKT signalling. Seven. 2011:344 54. 210. Calatozzolo C, Canazza A, Pollo B, Di Pierro E, Ciusani E, Maderna E, et al. Expression of the new CXCL12 receptor, CXCR7, in gliomas. Can cer Biology & Therapy. 2011;11:242 53. 211. Terasaki M, Sugita Y, Arakawa F, Okada Y, Ohshima K, Shigemori M, et al. CXCL12/CXCR4 signaling in malignant brain tumors: a potential pharmacological therapeutic target. Brain Tumor Pathology. 2011;12:89 97. 2 12. Tseng D, Vasquez medrano DA, Brown JM. Targeting SDF 1 / CXCR4 to inhibit tumour vasculature for treatment of glioblastomas. British Journal of Cancer. 2011;104:1805 9. 213. Sciaccaluga M, Fioretti B, Catacuzzeno L, Pagani F, Bertollini C, Rosito M, e t al. CXCL12 induced glioblastoma cell migration requires intermediate conductance Ca2+ activated K+ channel activity. American journal of physiology Cell physiology. 2010;299:C175 84. 214. Komatani H, Sugita Y, Arakawa F, Ohshima K, Shigemori M. Expression of CXCL12 on pseudopalisading cells and proliferating microvessels in glioblastomas : An accelerated growth factor in glioblastomas. 2009:665 72. 215. Miekus K, Jarocha D, Trzyna E, Majka M. Role of I TAC binding receptors CXCR3 and CXCR7 in pr oliferation, activation of intracellular signaling pathways and migration of various tumor cell lines. Folia histochemica et cytobiologica / Polish Academy of Sciences, Polish Histochemical and Cytochemical Society. 2010;48:104 11. 216. Roth P, Silginer M Goodman SL, Hasenbach K, Thies S, Maurer G, et al. Integrin control of the transforming growth factor 2013;136:564 76. 217. Gold LI. The role for transforming growth factor beta (TGF beta) in human cancer. Crit Rev Onco g. 1999;10:303 60. 218. Fontana A, Bodmer S, Frei K, Malipiero U, Siepl C. Expression of TGF beta 2 in human glioblastoma: a role in resistance to immune rejection? Ciba Found Symp. 1991;157:232 8; discussion 8 41.

PAGE 117

117 219. Kuczynski EA, Patten SG, Coomber BL VEGFR2 expression and TGF in initial and recurrent high grade human glioma. Oncology. 2011;81:126 34. 220. Zhang M, Kleber S, Rhrich M, Timke C, Han N, Tuettenberg J, et al. Blockade of TGF I kinase inhibitor LY2109 761 enhances radiation response and prolongs survival in glioblastoma. Cancer Res. 2011;71:7155 67. 221. Piao Y, Liang J, Holmes L, Zurita AJ, Henry V, Heymach JV, et al. Glioblastoma resistance to anti VEGF therapy is associated with myeloid cell infiltr ation, stem cell accumulation, and a mesenchymal phenotype. Neuro Oncol. 2012;14:1379 92. 222. Zagzag D, Lukyanov Y, Lan L, Ali MA, Esencay M, Mendez O, et al. Hypoxia inducible factor 1 and VEGF upregulate CXCR4 in glioblastoma: implications for angiogen esis and glioma cell invasion. Laboratory investigation; a journal of technical methods and pathology. 2006;86:1221 32. 223. Kreisl TN, Kim L, Moore K, Duic P, Royce C, Stroud I, et al. Phase II trial of single agent bevacizumab followed by bevacizumab pl us irinotecan at tumor progression in recurrent glioblastoma. J Clin Oncol. 2009;27:740 5. 224. Mller S, Grunnet K, Hansen S, Schultz H, Holmberg M, Sorensen M, et al. A phase II trial with bevacizumab and irinotecan for patients with primary brain tumor s and progression after standard therapy. Acta Oncol. 2012;51:797 804. 225. Reardon DA, Desjardins A, Peters KB, Gururangan S, Sampson JH, McLendon RE, et al. Phase II study of carboplatin, irinotecan, and bevacizumab for bevacizumab nave, recurrent glio blastoma. J Neurooncol. 2012;107:155 64.

PAGE 118

118 BIOGRAPHICAL SKETCH Kien Pham was born in 1982 in the highland central of Vietnam. She started her undergrad study at the College of Natural Science, National University of Vietnam in Ho Chi Minh City with a major in g eneral b iology, and finished with her bachelor degree in M olecular and Cellular Biology at the University of Arizona in 2006. Here, she continued to earn her Professional Science Master degree in Applied Biosciences in 2008. With the interest in cancer biology, she decided to achieve her higher education further and received her PhD degree from the University of Florida with major in Biomedical Kien spent most of her time studying the role of various chemokine systems in different aspects of gliob lastoma. Her works were well appreciated in several national scientific conferences and published in two peer review journals. She was also the recipient of several awards from the University of Arizona and the University of Florida. With a passion for res earch in cancer biology, Kien hopes that her studies will contribute to the understanding of tumorigenesis, as well as to the discovery of new therapies for cancer treatment.