<%BANNER%>

Long-Term Effects of Metabolic Imprinting and Calf Management Systems following Early-Weaning on Growth and Reproductive...

MISSING IMAGE

Material Information

Title:
Long-Term Effects of Metabolic Imprinting and Calf Management Systems following Early-Weaning on Growth and Reproductive Performance of Beef Calves
Physical Description:
1 online resource (159 p.)
Language:
english
Creator:
Moriel, Philipe
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Animal Sciences
Committee Chair:
Arthington, John David
Committee Members:
Hersom, Matthew J
Johnson, Sally E
Vendramini, Joao Mauricio Bueno
Gerrard, David E
Mccann, Mark

Subjects

Subjects / Keywords:
early-weaning -- heifers -- imprinting -- metabolic -- steers
Animal Sciences -- Dissertations, Academic -- UF
Genre:
Animal Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Two 2-yr experiments evaluated the long-term effects of metabolic imprinting and different nutritional management systems for EW beef calves (Bos spp.). Experiment 1 evaluated the growth performance, carcass characteristics and muscle gene expression of beef steers, while experiment 2 evaluated the liver gene expression, growth and reproductive performance of beef heifers. In both experiments, calves were normally weaned (NW) at 250 d of age (d 180), or early-weaned (EW) at 70 d of age (d 0) and randomly assigned to 1 of 3 EW calf management systems: 1) EW and limit-fed a high-concentrate diet in drylot for at least 180 d; 2) EW and limit-fed a high-concentrate diet in drylot for 90 d, then bahiagrass grazing until the time of NW (d 180); and 3) EW and ryegrass grazing for 60 to 90 d, then bahiagrass grazing until the time of NW.  Experiment 1 demonstrated that overall growth performance of EW steers was similar or greater than NW steers. Early-weaned calves provided a high-concentrate diet in drylot for at least 90 d had greater body weight at the time of NW, and enhanced growth performance during the first 28 d of the finishing phase, when compared to NW and EW steers grazing annual ryegrass pastures. Also, feeding a high-concentrate diet to EW steers for at least 90 d enhanced plasma concentrations of IGF-1, and the expression of genes associated with growth (muscle IGF-1 receptor and paired box gene 7) and adipose tissue formation (peroxisome proliferator-activated receptor ?). However, early-exposure to high-concentrate diets did not affect the overall carcass characteristics and marbling scores of steers slaughtered at a common backfat thickness. Experiment 2 demonstrated that EW heifers provided a high-concentrate diet for at least 90 d in drylot and EW heifers grazed on ryegrass pastures, had similar or greater growth performance than NW heifers. Furthermore, it provided evidence that early-exposure to a high-concentrate diet lead to metabolic imprinting effects, such as altered liver IGF-1 expression (during periods of similar nutritional management) and early puberty achievement of Bos indicus-influenced beef heifers. Calf weaning at the onset of the breeding season enhanced cow growth performance, and tended to enhance reproductive performance of multiparous cows.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Philipe Moriel.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Arthington, John David.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045739:00001

MISSING IMAGE

Material Information

Title:
Long-Term Effects of Metabolic Imprinting and Calf Management Systems following Early-Weaning on Growth and Reproductive Performance of Beef Calves
Physical Description:
1 online resource (159 p.)
Language:
english
Creator:
Moriel, Philipe
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Animal Sciences
Committee Chair:
Arthington, John David
Committee Members:
Hersom, Matthew J
Johnson, Sally E
Vendramini, Joao Mauricio Bueno
Gerrard, David E
Mccann, Mark

Subjects

Subjects / Keywords:
early-weaning -- heifers -- imprinting -- metabolic -- steers
Animal Sciences -- Dissertations, Academic -- UF
Genre:
Animal Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Two 2-yr experiments evaluated the long-term effects of metabolic imprinting and different nutritional management systems for EW beef calves (Bos spp.). Experiment 1 evaluated the growth performance, carcass characteristics and muscle gene expression of beef steers, while experiment 2 evaluated the liver gene expression, growth and reproductive performance of beef heifers. In both experiments, calves were normally weaned (NW) at 250 d of age (d 180), or early-weaned (EW) at 70 d of age (d 0) and randomly assigned to 1 of 3 EW calf management systems: 1) EW and limit-fed a high-concentrate diet in drylot for at least 180 d; 2) EW and limit-fed a high-concentrate diet in drylot for 90 d, then bahiagrass grazing until the time of NW (d 180); and 3) EW and ryegrass grazing for 60 to 90 d, then bahiagrass grazing until the time of NW.  Experiment 1 demonstrated that overall growth performance of EW steers was similar or greater than NW steers. Early-weaned calves provided a high-concentrate diet in drylot for at least 90 d had greater body weight at the time of NW, and enhanced growth performance during the first 28 d of the finishing phase, when compared to NW and EW steers grazing annual ryegrass pastures. Also, feeding a high-concentrate diet to EW steers for at least 90 d enhanced plasma concentrations of IGF-1, and the expression of genes associated with growth (muscle IGF-1 receptor and paired box gene 7) and adipose tissue formation (peroxisome proliferator-activated receptor ?). However, early-exposure to high-concentrate diets did not affect the overall carcass characteristics and marbling scores of steers slaughtered at a common backfat thickness. Experiment 2 demonstrated that EW heifers provided a high-concentrate diet for at least 90 d in drylot and EW heifers grazed on ryegrass pastures, had similar or greater growth performance than NW heifers. Furthermore, it provided evidence that early-exposure to a high-concentrate diet lead to metabolic imprinting effects, such as altered liver IGF-1 expression (during periods of similar nutritional management) and early puberty achievement of Bos indicus-influenced beef heifers. Calf weaning at the onset of the breeding season enhanced cow growth performance, and tended to enhance reproductive performance of multiparous cows.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Philipe Moriel.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Arthington, John David.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045739:00001


This item has the following downloads:


Full Text

PAGE 1

1 LONG TERM EFFECTS OF METABOLIC IMPRINTING AND CALF MANAGEMENT SYSTEMS ON GROWTH AND REPRODUCTIVE PERFORMANCE OF EARLY WEANED BEE F CALVE S By PHILIPE MORIEL A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY O F FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Philipe Moriel

PAGE 3

3 To my family, and also to my friends

PAGE 4

4 ACKNOWLEDGMENTS I wou ld like to t hank God and my parents, Antonio Claudi ner Felippe Moriel and Selma Correa Gomes Moriel, for all the effort and support given to me throughout my entire life. I also would like to thank Dr. John Arthington for the opportun ity, trust, support, f riendship and mentorship I also would like to thank all committee members (Dr. Joao Vendramini, Dr. Sally Johnson, Dr. David Gerrard, Dr. Mark McCann, Dr. Matthew Hersom) and other internal and external faculty member s (Dr. Reinaldo Cooke, Dr. Alan Ealy a nd Dr. Joel Yelich) for their crucial guidance during my research and laboratory analysis I would like to thank all the staff involved on my doctorate program, but in particular, Mrs. Andrea Dunlap, Mr. Austin Bateman, Mr. Clay Newman, Mr. Tom Fussell and Mr. Ryann Nevling. I also would like to thank my former advisors Dr. Jose Luiz Moraes Vasconcelos and Dr. Bret Hess for the previous opportunities given to me, and for the training and friendship that were extremely important for my career. Last, but not least, I would like to thank Bruno Ieda Cappellozza, Vitor Mercadante, Paula Mercadante, Guilherme Marquezine, Daniel Abe, and Fabio Vicentini for their collaboration and friendship for so many years.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 14 2 LITERATURE REVIEW ................................ ................................ .......................... 16 Developmental P rogramming and M etabolic I mprinting ................................ .......... 16 Potential Mechanisms of Metabolic Imprinting ................................ ................. 16 Organ structure ................................ ................................ .......................... 17 Alterations in cell number ................................ ................................ ........... 17 Clonal selection ................................ ................................ .......................... 18 Epigenetics ................................ ................................ ................................ 18 Evidences of Metabolic Imprinting in Multiple Species ................................ ..... 20 Mice and humans ................................ ................................ ....................... 20 Dairy cattle ................................ ................................ ................................ 22 Normally weaned beef calves ................................ ................................ .... 25 Early weaned beef calves ................................ ................................ .......... 29 Additional benefits of early weaning ................................ .......................... 36 Endocrine and Molecular Controls of Muscle and Adipose Tissue Growth, and Puberty A chievement ................................ ................................ .......................... 38 Somatotropic Axis ................................ ................................ ............................ 38 Muscle and Adipose Tissue Growth ................................ ................................ 42 Somatotropic axis vs. muscle and adipose tis sue growth .......................... 49 Puberty Achievement ................................ ................................ ....................... 50 Somatotropic axis vs. puberty ................................ ................................ .... 53 Strategies to Explore the Metabolic Imprinting Effects in Beef Cattle Production Systems ................................ ................................ ................................ ............... 56 3 EFFECTS OF METABOLIC IMPRINTING AND CALF MANAGEMENT SYSTEMS ON GROWT H PERFORMAN CE AND CARCAS S CHARACTERISTICS OF BEEF STEERS ................................ .............................. 58 Materials and Methods ................................ ................................ ............................ 59 Animals and Diets ................................ ................................ ............................ 59

PAGE 6

6 Data Collection ................................ ................................ ................................ 62 Plasma and Muscle Tissue Analysis ................................ ................................ 64 Statistical Analysis ................................ ................................ ............................ 66 Results and Discussion ................................ ................................ ........................... 67 4 EFFECTS OF METABOLIC IMPRINTING AND CALF MANAGEMENT SYSTEMS ON GRO W TH AND REPRODUCTIVE PERFORMANCE OF BEEF HEIFERS ................................ ................................ ................................ ................ 92 Materials and Methods ................................ ................................ ............................ 93 Animals and Diets ................................ ................................ ............................ 93 Data Collection ................................ ................................ ................................ 96 Plasma and Liver Tissue Analysis ................................ ................................ .... 98 Statistical Analysis ................................ ................................ ............................ 99 Results and Dis cussion ................................ ................................ ......................... 101 Heifers ................................ ................................ ................................ ............ 101 Cows ................................ ................................ ................................ .............. 110 LIST OF REFERENCES ................................ ................................ ............................. 129 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 159

PAGE 7

7 LIST OF TABLES Table page 3 1 Ingredient and c hemical composition o f high concentrate diets fed to steers during the drylot (0 to 180) and grazing period (0 to 270), and concentrate provided during the finis hing phase (d 274 to slaughter) ................................ .... 79 3 2 Nucleotide sequence of bovine specific primers used in the quantitative real time reverse transcription PCR to determine the longissimus muscle expression of ribosomal protein P0 (RpP0), IGF 1, IGF 1 receptor (IGF1R), p aired box gene 7 (Pax7) and peroxisome proliferator mRNA ................................ ................................ ................................ .. 81 3 3 Average daily gain (kg/d) and carcass characteristics of beef steers developed on different calf management systems from the ti me of early weaning (d 0) until the time of normal weaning (d 180) ................................ ...... 82 3 4 Herbage mass and herbage allowance of pastures grazed by steers from the time of early weaning (d 0) until the time of normal weaning (d 180) ................. 83 3 5 Plasma concentrations of IGF 1 and muscle mRNA expression of genes associated with muscle and adipose tissue growth of beef steers developed on different calf ma nagement systems from the time of early weaning (d 0) until the time of normal weaning (d 180). ................................ ............................ 84 3 6 Pearson correlation coefficients among ADG, longissimus muscle mRNA expression of IGF 1, IGF 1 receptor (IGF1R), paired box gene 7 (Pax7), peroxisome proliferator activated receptor 1 concentrations of steers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) ... 86 3 7 Growth performance during the finishing phase and carcass characteristics of beef steers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) in yr 1 .............. 87 4 1 Ingredient and c hemical composition of high concentrate diets fed heifers during the drylot (d 0 to 180) and grazing period (d 0 to 390). .......................... 112 4 2 Nucleotide sequence of bovine specific primers used in the quantitative real time reverse transcription PCR to determine the hepatic expression of 18S ribosomal RNA (18S), GH receptor 1A (G HR 1A), IGF 1 and IGFBP 3 mRNA 114 4 3 Growth and reproductive performance of beef heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) ................................ ................................ ................ 115

PAGE 8

8 4 4 Herbage mass and allowance of pastures grazed by heifers from the time of earl y weaning (d 0) until the time of normal weaning (d 180) ........................... 117 4 5 Pearson correlation coefficients among ADG and liver mRNA expression of GHR 1A, IGF 1, and IGFBP 3 of heifers developed on diff erent calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) ................................ ................................ .................... 118 4 6 Growth performance and BCS of cows that had their calves early weaned on d 0 (EW) o r normally weaned on d 180 (NW) ................................ ................... 119 4 7 Growth and reproductive performance of cows that had their calves early weaned on d 0 (EW) or normally weaned on d 180 (NW) ................................ 120 4 8 Calving distribution (% of pregnant cows) of cows that had their calves early weaned (EW) on d 0 or normally weaned (NW) on d 180. ............................... 121

PAGE 9

9 LIST OF FIGURES Figure page 3 1 Body weight of steers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) in yr 1 ................................ ................................ ................................ ......................... 88 3 2 Body weight of steers developed on different calf management systems from the time of early weaning (d 0) until the time o f normal weaning (d 180) in yr 2 ................................ ................................ ................................ ......................... 89 3 3 Plasma ceruloplasmin concentrat ions (mg/dL) of steers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) in yr 2 ................................ ......................... 90 3 4 Plasma haptoglobin concentrations (mg/mL) of steers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) in yr 2 ................................ ................................ ....... 91 4 1 Body weight of heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) ......... 122 4 2 Body weight of heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) in yr 1 ................................ ................................ ................................ ....................... 123 4 3 Body weight of heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) in yr 2 ................................ ................................ ................................ ....................... 124 4 4 Liver GHR 1A mRNA expression of heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) in yr 1 ................................ ................................ ......... 1 25 4 5 Liver IGF 1 mRNA expression of heifers developed on different calf management systems fro m the time of early weaning (d 0) until the time of normal weaning (d 180) ................................ ................................ .................... 126 4 6 Plasma IGF 1 concentrations of heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) ................................ ................................ .................... 127 4 7 Accumulative puberty achievement (% of total heifers) of heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180) ................................ ........................... 128

PAGE 10

10 LIST OF ABBREVIATIONS BCS Body condition score BF Backfat BW Body weight CEBP CCAAT/enhancer binding protein CL Corpora lutea DE Digestible energy DM Dry matt er DMI Dry matter intake EW Early weaning FSH Follicle stimulating hormone GH Growth hormone GHR Growth hormone receptor GHRH Growth hormone releasing hormone G N RH Gonadotropin releasing hormone HSL Hormone sensitive lipase I G Immunoglobulin IGF 1 Insulin like growth factor 1 IGF1R Insulin like growth factor 1 receptor IVOMD In vitro organic matter digestibility KPH Kidney, pelvic and heart LH Luteinizing hormone LPL Lipoprotein lipase hormone ME Metabolizable energy MRF Myogenic regulatory factor

PAGE 11

11 M TOR Mamm allian target of rapamycin M YF 5 Myogenic factor 5 M YO D Myogenic differentiation 1 NEFA Nonesterified fatty acids NPY Neuropeptide Y NW Normal weaning P AX 7 Paired box gene 7 PPAR Peroxisome proliferator activated receptor PPI Postpartum interval REA Ribeye area SC Satellite cells SREBP 1 Sterol regulatory element binding protein 1 TG Triglycerides

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy LONG TERM EFFECTS OF METABOLIC IMPRINTING AND CALF MANAGEMENT SYSTEMS ON GROWTH AND REPRODUCTIVE PERFORMANCE OF EARLY WEANED BEE F CALVES By Philipe Moriel August 2013 Chair: John D. Arthington Major: Animal Sciences Two 2 yr experiments evaluated the long term effects of metabolic imprinting and different nutritional management systems for EW beef calves ( Bos spp.) Experiment 1 evaluated the growth performance, carcass characteristics and muscle gene expr ession of beef st eers while experiment 2 evaluated the liver gene expression, growth and reproductive performanc e of beef heifers In both experiments, c alves were normally weaned (NW) at 250 d of age (d 180) or early weaned (EW) at 70 d of age (d 0) and randomly assigne d to 1 of 3 EW calf management systems: 1) EW and limit fed a high concentrate diet in drylot for at least 180 d; 2) EW and limit fed a high concentrate diet in drylot for 90 d then bahiagrass grazing until the time of NW (d 180) ; and 3) EW and ryegrass g razing for 60 to 90 d then bahiagrass grazing until the time of NW. Experiment 1 demonstrated that overall growth performance of EW steers was similar or great er than NW steers. Early weaned c alves provided a high concentrate diet in drylot for at least 90 d had greater body weight at the time of NW, and enhanced growth performance during the first 28 d of the finishing phase when compared to NW and EW steer s graz ing annual ryegrass pastures. Also, feeding a high concentrate diet

PAGE 13

13 to EW steers for at leas t 90 d enhanced plasma concentrations of IGF 1 and the expression of genes associated with growth (muscle IGF 1 receptor and paired box gene 7) and adipose tissue formation (peroxisome proliferator However, early exposure to high co ncentrate diets did not affect the overall carcass characteristic s and marbling scores of steers slaughtered at a common backfat thickness. Experiment 2 demonstrated that EW heifers provided a high concentrate diet for at least 90 d in drylot and EW heifer s graz ed on ryegrass pastures, had similar or greater growth performance than NW heifers. Fu rthermore, it provided evidence that early exposure to a high concentrate diet lead to metabolic imprinting effects, such as altered liver IGF 1 expression ( during periods of similar nut ritional management) and early puberty achievement of Bos indicus influenced beef heifers. C alf weaning at the onset of the breeding season enhance d cow growth performance and tended to enhance reproductive performance of multiparous cows.

PAGE 14

14 CHAPTER 1 INTRODUCTION Recently, there is a significant concern about effects of nutrition on subsequent human health (Barker, 1993) and animal production (Bach, 2012; Du et al., 2013). Evidence ha s sh ow n that postnatal nutrition has long term c onsequences on health, well being and performance until adulthood (Koletzko, 2005; Koletzko et al. 2009) and Garza, 1999). Specifically, data from human epidemiologic stu dies and animal models strongly suggest that perinatal nutrition enhances the predisposition to adult obesity (Lucas, 1991; Barker, 1992), which increases the risk for a variety of chronic metabolic diseases, such as type 2 diabetes, hypertension, hypercho lesterolemia and heart disease (Malnick and Knobler, 2006). A large potential exists for the application of this knowledge on preventive approaches to improve health, reduce the costs for health care, and enhance the productivity of societies (Koletzo et a l., 2011). Further, the concept that metabolic imprinting ha s lifetime consequences on animal development has biological and economical implications for agriculture, and should be explored in order to improve the performance of animals destined for food pr oduction. A potential model to study the effects of metabolic imprinting on beef cattle production is the use of early weaned beef calves. Early weaning (EW) is a management practice consisting of permanent c alf removal at ages often less than 5 mo. Early weaning improved the reproductive performance of primiparous beef cows when performed prior to the breeding season (Arthington and Kalmbacher, 2003), increased the gr owth performance of beef steers during the receiving feedlot period (Arthington et al., 2005) and enhanced the carcass quality of beef steers fed high

PAGE 15

15 concentrate diets immediately following EW (Myers et al., 1999a,b). However, few beef producers are willing to adopt this management practice due to the lack of information on nutritional mana gement of EW calves Care of the EW calf is an important consideration with this management system because most beef cattle producers are not experienced in managing 70 to 90 d old calves (Arthington et al., 2005), and due to its potential for affect ing the future performance of these calves. Therefore, the evaluation of different nut ritional management systems for EW beef calves and its long term consequences on calf performance is required.

PAGE 16

16 CHAPTER 2 LITERATURE REVIEW Developmental P rogrammi ng and M etabolic I mprinting perturbations (e.g. nutrition ) during critical prenatal development stag e s, may have lasting impacts on growth and adult function (Caton and Hess, 2010). However, in most mammalian species, organ development is not complete at birth and continues in the immediate postnatal period. For instance, maturation of pancreatic islets and development of neuronal systems in the hypothalamus of rats continue during the suckling period (Kaung, 1994). Early in postnatal life, organism s ha ve the ability to respond to environmental situations that are alien to normal development through adap tations at the cellular, molecular and biochemical levels (Patel and Srinivasan, body responses to specific nutritional conditions that occur during a limited period of susc eptibility in early postnatal life These responses may permanently change the physiology and metabolism of the organism (Lucas, 1991; Waterland and Garza, 1999; Patel and Srinivasan, 2011). Potential Mechanisms of Metabolic Imprinting Waterland and Garza (1999) proposed a list of potential mechanisms by which perinatal nutrition m ay persistently affect an 1) induced variations in organ structure, 2) alterations in cell number, 3) clonal selection, and 4) epigen etics.

PAGE 17

17 Organ structure Morphologic alterations that occur during organogenesis may affect the ability of individual cells to generate and respond to external signals within the organism. For example, nutrition induced alterations on organ vascularization may affect the cell ular responses to blood borne nutrients or hormonal signals. During limited periods of organogenesis, the fate of cells depends on externally derived signals from adjacent and distant cells. Consequently, it is reasonable to postulate th at local co ncentrations of nutrients and metabolites may modulate the end result of organogenesis (Waterland and Garza, 1999). Alterations in cell number During development, organ mass increase s either by increasing the number of cells (hyperpla sia) or ce ll size (hypertrophy). H owever, different tissues experience diverse, limited periods of hyperplastic and hypertrophic growth. Cell growth rate is nutrient dependent, and hence, nutritional deprivation or surplus during critical periods of cell division may lead to permanent changes in cell number, regardless of subsequent nutrient surplus (Waterland and Garza, 1999). For instance offspring born from ewes fed 50 % of their total digestible nutrients (TDN) requirements from d 28 to 78 of gestation had less er secondary muscle fibers compared to offspring born from nutrient unrestricted ewes (Zhu et al., 2004). The number of muscle fibers is determined during the prenatal muscle development and does not increase during the postnatal life. Thus, prenatal nutr ition has profound effects on muscle growth and development during the later postnatal life (Zhu et al., 2004).

PAGE 18

18 Clonal selection Cellular proliferation of all organs involves the proliferation of a finite population of founder cells. As cell proliferation proceeds, the early genetic and epigenetic modifications that occur within individual cells distinguish them from others in subpopulations of rapidly dividing cells. Thus, the nutrient environment may induce an incorrect base pairing during deoxyribonucle ic acid (DNA) replication and result in subtle effect s on cellular metabolism that may be transmitted to daughter cells (Waterland and Garza, 1999; Fenech, 2010). Vitamins and minerals serve as cofactors for enzymes and protein structure s involved in DNA synthesis repair and maintenance of genome integrity (Neibergs and Johnson, 2012). Hence, suboptimal intake of vitamins and minerals may permanently damage the DNA and alter the genomic stability (Fenech, 2010). Epigenetics The epigenetic process is a ge netic modification that cannot be expla ined by chang es in DNA sequence (Riggs et al., 1996), and likely occurs during periods of genome reprogramming, such as embryogenesis and gestation (Jirtle and Skinner, 2007). Epigenetic mechanisms induced by dietary modifications include methylation, histone modifications, non coding small ribonucleic acid (ncRNA), and chromatin associated proteins (Neibergs and Johnson, 2012). Methylation of DNA molecules is highly correlated with gene expression and consists of DN A methyltransferases adding methyl groups at cytosine purine guanine (CpG) islands that are often associated with the promoter region of genes (Simmons, 2011). Hypomethylation at the promoter regions of DNA enhances messenger RNA (mRNA) transcription throu gh chromatin remodeling, whereas hypermethylation is

PAGE 19

19 associated with suppressed mRNA transcription (Simmons, 2011). The methylation pattern varies among cells in different tissues (i.e. oocytes and sperm DNA are less methylated compared to cells in somatic tissues, such as muscle) and is maintained during DNA replication, which allows the specific methylation pattern to be transmitted to progeny cells (Waterland and Garza, 1999). In mice, dietary restriction of methyl donor molecules, such as folic acid, m ethionine, vitamin B 12 and choline were associated with DNA hypomethylation, whereas post weaning supplementation of such methyl donors increased methylation of a wide variety of genes (Neibergs and Johnson, 2012; Bermingham et al., 2013). In eukaryoti c nucle i DNA is packaged with histone proteins and other DNA binding proteins in a highly compact configuration, called chromatin. The chromatin structure is highly correlated with gene expression (Riggs and Porter, 1996) and can be presented in an open, active (euchromatin) or closed, inactive configuration (heterochromatin). The primary unit of chromatin structure is the nucleosome, which consists of approximately 146 base pairs of DNA wrapped around a histone octamer (Thiagalingam et al., 2003), which serve s as a target for methylation, acetylation, ubiquitination and phosphorylation of lysine residues (Fenech et al., 2011; Zheng et al., 2011). Histone acetylation is associated with regions of open chromatin configuration (Turner, 1991) and may serve a s an epigenetic marker to identify DNA regions that should be maintained in a transcriptional active configuration (Waterland and Garza, 1999). Dietary factors, such as diallyl disulfide, sulforaphen, and butyrate have the ability to inhibit histone deacet ylase inhibitor enzymes, which result s in enhanced histone acetylation and altered gene expression (Li and Li, 2006; Li et al., 2007).

PAGE 20

20 Methylation of DNA and histone modifications are the major contributors to chromatin modification and are the main e pigenetic mechanism by which tissue specific gene expression patterns are established and maintained (Thiagalingam et al., 2003). Recent studies discovered the existence of classes of RNA that are not translated into protei ns (ncRNA), and yet participate i n the process of transcription, epigenetics and gene function (Dunham et al., 2012; Rinn and Chang, 2012) by inhibiting translation or degradation of the mRNA transcript (Ross and Davis, 2011). These ncRNAs participate in the regulation of almost every ce llular process that has been investigated, including post implantation embryo developmen t (Suh et al., 2011) cells (Melman Zehavi et al., 2011). Dietary factors including folate, choline, retinoic acid, vitamin D, vitamin E, selenium, omega 3 fatty acids, butyrate, and phytochemicals modify the expression of ncRNA and their targets during processes such as apoptosis, cell cycle regulation, differentiation, inflammation, angiogenesis, metastasis and stress response (Dauncey, 2013). Evidence of Metabolic Imprinting in Multiple Species Mice and humans One a pproach to alter nutrition during the suckling period of mice, has been to either increase or decrease litter size, which changes the amount of mil k and calories available to new born rat pups (Patel and Srinivasan, 2010). McCance (1962) demonstrated that rats from a large litter size were substantially lighter than those from smaller litter s during a 21 d suckling period. F ollowing the suckling period, the growth rate continued to diverge compared to rats from small litter size, despite placing the animals on the same plane of nutrition. Subsequent studies observed that rats from small litters (3 pups/dam) were overweight, hyperinsulinemic, hyperleptinemic and

PAGE 21

21 hyperglycemic during the suckling period compared with n ormal litter rats (10 pups/dam). Thereafte r, rats from small litters continued to express hyperphagia and heavier BW throughout life (Plagemann et al., 1992) and ultimately developed insulin resistance and obesity in the post weaning period (Glavas et al., 2010). Nutritional composition of isoca loric diets provided to rat pups during the early postnatal life also had long term consequences on their metabolism. Newborn rat pups were provided a high carbohydrate (56 % carbohydrate, 20 % fat, and 24 % protein) or high fat milk (8 % carbohydrate, 72 % f at, and 24 % protein) for the first 24 d of postnatal life, and provided the same diet from 25 to 100 d of age. At 12 d of age, rats provided high carbohydrate milk had greater plasma concentrations of insulin following a glucose tolerance test, increased h exokinase activity, altered pancreatic function, increased mRNA expression of insulin precursor (preproinsulin), acetyl CoA carboxylase, glucose transporter 2, and orexigenic neuropeptides, but decreased mRNA expression of anorexigenic neuropeptides, insul in and leptin receptors in the hypothalamus (Srinivasan et al., 2008; Patel et al., 2009). At 100 d of age, rats fed high carbohydrate milk continued to express hyperinsulinemia, hypephagia, greater body weight (BW) cell mass a nd increased preproinsulin mRNA compared to rats provided the high fat milk (Srinivasan et al., 2008). Furthermore the offspring of female rats fed high carbohydrate milk spontaneously developed chronic hyperinsulinemia and adult obesity without having to undergo any dietary modification (Vadlamudi et al., 1995). In humans, rapid weight gain during the first 4 mo of life (greater than 0.1 kg monthly) increased the odds for o verweight at 7 and 20 yr of age by 17 and 422 %

PAGE 22

22 respectively (Ong et al. 200 9). Singhal et al. (2010) demonstrated that increasing the dietary concentrations of protein by 28 and 43 % increased fat mass of infants at 5 8 yr of age by 22 38 % compared to infants provided standard diets. Further, infant feeding method, dietary energy intake at 4 mo of age, soy protein and peanut oil exposure, BW gain of early life, and maternal mineral and folate intake were associated with a wide range of health outcomes including obesity, impaired neurodevelopment, intelligence quotient at 9 yr of a ge, asthma, peanut allergy, diabetes, insulin resistance and bone health (Lack et al., 2003; Ong and Dunger, 2004; Shaheen et al., 2005; Gunnell et al., 2005; Ong et al., 2006; Toschke et al., 2007). Dairy cattle It is well know that colostrum intake during the first hours of life has long term consequences on health and performance of calves. Faber et al. (2005) observed that calves consuming 4 vs. 2 L of colostrum at birth had 10 and 15 % greater milk production during their first and second lactati ons, respectively. The exact mechanism by which greater colostrum intake enhanced milk production of cows is unknown, but are likely attributed to metabolic modifications induced by colostrum constituents, such as insulin like growth factor 1 (IGF 1), insu lin, growth hormone (GH), epidermal growth factor, leptin and prolactin (Faber et al., 2005; Bach, 2012). Although the milk concentration of hormones and growth factors is lesser compared with colostrum (Bach, 2012), it is possible that hormones and growth factors present in whole milk, and absent in milk replacer, have imprinting effects on the metabolism of calves. In agreement, milk production increased by 4 to 13 % in calves provided whole milk vs. milk replacer during the first 45 to 60 d of life (Shama y et al., 2005; Moallem et al., 2010).

PAGE 23

23 The concept of enhanced early nutrition is not recent (Khouri and Pickering, dairy calves increased substantially during the last decade (Diaz et al., 2001; Brown et al., 2005a,b; Moallem et al., 2010; Bach, 2012; Soberon and Van Amburgh, 2013). During the first 45 to 60 d following birth, conventional methods of dairy calf feeding provide relatively low amounts of milk or milk replacer (approximately 10 % of calf BW, as fed; CP and fat = 20 to 22 % of DM) in order to stimulate early consumption of concentrate and ruminal development (Khan et al., 2007a, 2011). Conversely, intensified nutrition methods utilize milk or milk replacer with greater concentrations of protein and less fat (20 30 % CP and < 20 % fat; DM basis) that are provided at approximately 20 % of calf BW (as fed; Brown et al., 2005a,b; Tikofsky et al., 2001; Khan et al., 2007a, 2011), which is similar to the milk consum ption observed in 4 wk old calves suckling their dams (Hafez and Lineweaver, 1968). The intensified nutrition methods increased lean tissue growth and efficiency of BW gain (Diaz et al., 2001; Tikofsky et al., 2001; Rius et al., 2012), serum concentrations of immunoglobulin (Ig) A and IgG (Khan et al., 2007b), Escherichia coli induced oxidative burst capacity of neutrophils (Balou, 2012), as well as had long term consequences on puberty and future milk production (Brown et al., 2005a,b; Raeth Knight et al., 2009; Moallem et al., 2010; Sobero n and Van Amburgh, 2013). Davis Rincker et al. (2011) observed that heife rs provided intensive nutrition had greater ADG from 2 to 42 d of age (0.64 vs. 0.44 kg/d) and were 29 d younger at puberty (271 vs. 300 d) compare d with heifers provided conventional milk replacer However, the decreased age at puberty of heifers provided intensive nutrition was observed despite the similar BW from 12 to 100 wk of age (Davis

PAGE 24

24 Rincker et al., 2011), which suggests that enhanced nutrit ion prior to 2 mo of age had imprinting effects on their reproductive axis. Enhancing the growth rate of heifers by feeding high energy diets may decrease age at calving and costs associated with raising replacement heifers (Radcliff et al., 2000). Howeve r, from 3 to 10 mo of age, the mammary gland grows at a faster rate than the whole body. Conseq uently, feeding levels that result in ADG of dairy heifers above 0.60 to 0.70 kg/d may reduce mammary parenchyma mass, enhance fat accumulation in the mammary gl and and decrease subsequent milk production (Sejrsen et al., 2000). In contrast, enhancing the plane of nutrition of calves prior to 60 d of age decreased age at calving (Raeth Knight et al., 2009; Moallem et al., 2010; Davis Rincker et al., 2011), without impairing mammary gland growth and milk production (Brown et al., 2005a,b; Soberon et al., 2009; Soberon and Van Amburgh, 2013). In fact, intensive calf nutrition from birth to 60 d of age enhanced mammary gland growth and milk production at first lactati on. Brown et al. (2005a) reported that Holstein heifers assigned to receive high levels of protein and energy (30.3 % CP, 15.9 % fat; fed at 2.0 % of BW; DM basis) from 1 to 7 wk of age had greater total parenchyma tissue mass, parenchymal DNA and RNA compa red with heifers provided milk replacer containing moderate levels of protein and energy (21.3 % CP and fat; fed at 1.1 % of BW; DM basis). Soberon and Van Amburgh (2013) conducted a meta analysis involv ing 13 studies and over 600 calves that were provided e ither a conventional (ADG = 0.30 to 0.40 kg/d) or an enhanced (ADG = 0.60 to 0.80 kg/d) plane of nutrition prior to weaning. These authors observed that calves provided enhanced nutrient intake during the preweaning phase were 2 fold more likely to have greater milk production at first lactation than calves that were

PAGE 25

25 limit fed Also, first lactation milk yield was increased by 1,551 kg for every 1 kg increase of preweaning ADG (Soberon and Van Amburg, 2013). Normally weaned beef calves The major nutriti onal factors affecting preweaning calf growth and body composition at weaning are the milk production of the dam, and the quantity and quality of nutrients from pasture and supplements that were provided prior to and following birth (Greenwood and Cafe, 20 07). Limited information is available regarding the long term effects of the nutrition of suckling beef calves at an early stage of life on subsequent growth performance (Stuedemann et al., 1968; Berge, 1991; Abdelsamei et al., 2005; Greenwood et al., 20 06; Cafe et al., 2006). Stuedemann et al. (1968) evaluated the growth performance and carcass characteristics of Hereford calves born from dams assigned to 5 distinct groups based on their level of milk production (very restricted, restricted, normal, hig h and very high). At weaning (8 mo of age), ADG, ribeye area (REA), backfat (BF) thickness, carcass weight and marbling scores linearly increased with the increasing level of milk production. Although days on feed linearly decreased with the increasing lev el of milk production, the milk production of cows did not affect calf BW at slaughter, carcass weight, dressing percentage and marbling scores of calves slaughtered at a common BW. Similar results have been reported by others (Palsson and Verges, 1952a,b; Clutter and Nielsen, 1987; Lewis et al., 1989; Abdelsamei et al., 2005). Further, herbage allowance on rangeland (440 to 2,800 kg of DM/100 kg of BW) by Brahman cow calf pairs also affected the calf BW at weaning, with the increasing grazing pressure lin early decreasing the BW at weaning (Philips et al. 1991). However, subsequent finishing performance, carcass weight, yield grade and dressing percentage

PAGE 26

26 of calves were not affected by differences on preweaning herbage allowance Likewise, forage type duri ng preweaning grazing had little effect on finishing performance of calves (Holloway and Butts, 1983). At calving, cow calf pairs were assigned to either tall fescue ( Festuca arundinacea ) or tall fescue legume grazing (70% tall fescue, and 30 to 40% legum e mixture of red clove, Korean and Kobe lespedeza and ladino clover) until the time of weaning (240 d of age). Calves grazing fescue legume pastures were 22 kg heavier at weaning, 5 d younger at slaughter and had 11 kg heavier carcass weight at slaughter c ompared to calves grazing tall fescue pastures. However, REA, yield grade, marbling scores, and kidney, pelvic and heart fat (KPH) percentage were not affected by forage type during the preweaning grazing (Holloway and Butts, 1983). N utrient restriction d uring growth may reduce the energy require ments for maintenance of cattle (Sainz et al., 1995), but following realimentation, it may increase the subsequent feed intake (Fox et al., 1972; Drouillard et al., 1991; Sainz et al., 1995), liver blood flow and O 2 consumption (Hersom et al., 2003), BW gain (Fox et al., 1972; Carstens et al., 1991; Sainz et al., 1995; Hersom et al., 2003), and the efficiency of ME used for gain compared to cattle that did not experience nutrient restriction during growth (Fox et al ., 1972; Carstens et al., 1991; Hersom et al., 2003). However, an interaction between age at and the severity of the nutrient restricti on has been reported (Berge, 1991). The capacity for long term compensatory growth diminishes as the age at nutrient rest riction declines (Greenwood and Cafe, 2007). On average, compensatory gain in calves restricted prior to 6 mo of age is low and practically independent of the severity of restriction, whereas in calves nutrient restricted after 6 mo of life, the degree of compensatory gain increase s with the severity of the restriction (Berge, 1991). For

PAGE 27

27 instance, calves nutrient restricted at less than 7 mo of age required 14 to 18 mo to compensate 70 to 80 % of their growth delay (Bond et al., 1972; Keane and Drennan, 1983 ), whereas calves restricted from 10 to 22 mo of age required 4 to 7 mo to achieve similar compensatory gain (McCarrick et al. 1963; Lawrence and Pearce, 1964). These results were supported by recent findings (Hennessy and Morris, 2003; Greenwood et al., 2 005, 2006). It is well reported that BW at weaning may be increased if limited or unlimited creep feed supplementation is provided to beef calves (Stricker et al., 1979; Hixon et al., 1982; Lusby and Wettemann, 1986; Faulkner et al., 1994; Sexten et al., 2004; Moriel and Arthington, 2013a,b). In addition, creep fed calves may experience enhanced DMI (Faulkner et al., 1994; Moriel and Arthington, 2013) and BW gain during the receiving period (Arthington et al., 2008), which represents the period with great est frequency of health problems in newly received calves. Therefore, enhanced nutrient intake during the receiving period is crucial for stress recovery and disease resistance (Loerch and Fluharty, 1999). Indeed, creep fed calves have decreased incidenc e of morbidity and mortality than calves receiving no preweaning supplementation (Fluharty and Loerch, 1996). In a 2 yr study, Lancaster et al. (2007a,b) evaluated the long term consequences of limit fed, creep feed supplementation for approximately 90 d p rior to weaning on pre and post weaning growth performance and carcass characteristics of beef calves. In both yr, preweaning BW was increased due to creep feed supplementation. In yr 1, but not yr 2, creep fed calves had greater carcass weights, dressin g percentage, BF thickness, and carcass value compared with calves provided no preweaning supplementation (Lancaster et al., 2007b). Nevertheless most studies

PAGE 28

28 did not observe long term effects of creep feed supplementation on finishing growth performance and carcass traits of beef steers (Tarr et al., 1994; Myers et al., 1999; Shike et al., 2007). C reep feed supplementation has been shown to affect milk production of beef heifers (Hixon et al., 1982; Sexten et al., 2004). Unlimited corn based, creep feed supplementation to beef heifers for 90 d before weaning increased BW at weaning by 17 kg, did not affect milk production on d 60 of first lactation (4.1 vs. 5.0 kg/d), but decreased milk production on d 120 (3.5 vs. 4.5 kg/d) compared to no creep feed su pplementation (Hixon et al., 1982). Likewise, heifers provided free choice access to soybean hull based, creep feed supplements (14 or 18 % CP) for 84 d prior to weaning were o n average 25 kg heavier at weaning, but produced 12 to 21 % less milk from d 52 to 164 postpartum compared with heifers receiving no creep feed supplementation (Sexten et al., 2004). However, in both studies, the subsequent pre weaning ADG and BW at weaning was similar between calves born fr o m creep fed and non creep fed heifers (Hixon et al., 1982; Sexten et al., 2004), which suggests that calves compensate for the decreased dam milk production by increasing their forage intake (Barker and Barker, 1978; Ansotegui et al., 1991). In addition, heifers creep fed supplements containing 18 % CP had greater milk production on d 52 and 108 postpartum compared with heifers fed creep feed supplements with 14 % CP (Sexten et al., 2004). Thus, increasing the dietary concentrations of CP may alleviate the negative effects of enhanced BW gain on prepub ertal mammary gland development (Van Amburgh et al., 1998; Whitlock et al., 2002) and subsequent milk production (Sexten et al., 2004).

PAGE 29

29 Early weaned beef calves Early weaning is a management practice often applied during periods of forage shortage. Howe ver, EW may also improve the growth (Neville and McCormick, 1981; Arthington and Kalmbacher, 2003) and reproductive performance of cows (Laster et al., 1973; Arthington and Kalmbacher, 2003; Arthington and Minton, 2004), as well as, the growth efficiency o f cows and calves (Peterson et al., 1987; Arthington and Minton, 2004). Milk supplies approximately 86 % of the digestible energy (DE) consumed by a 44 d old beef calf, but only 19 % of DE consumed at the time of weaning (Bailey and Lawson, 1981). Consequ ently, milk production explained 40 to 88 % of the variation on calf weight gain (Totusek and Arnett, 1965 ). Although calves gradually increase forage intake as milk production of the cow declines (Abdelsamei et al., 2005), seasonal variation in forage nutr itive value may limit the growth performance of fall born calves during a period of high growth potential, which may be avoided if calves are EW and placed on high planes of nutrition. After 8 wk of age, calves are able to meet the majority of their energ y requirements from solid feed (Davis and Clark, 1981) and thus, high concentrate diets or forages with high nutritive value may be u sed for EW calf development. Early weaned calves are often man aged in drylot with concentrate plus hay (Green and Buric, 1 953; Cole et al., 1979; Lusby and Wettemann, 1986; Peterson et al., 1987; Myers et al., 1999a) or concentrate plus silage (Wertz et al., 2002; Schoonmaker et al., 2002a,b, 2004; McCann et al., 2011). Thrift and Thrift (2004) summarized spring and fall ca lving situations comparing the pre and post weaning growth performance and carcass traits of calves weaned at 3 to 5 vs. 6 to 8 mo of age. In this summary, 14

PAGE 30

30 of 20 studies reported similar or heavier BW at weaning for EW vs. NW calves, and 14 of 19 compa risons reported equal or greater ADG for EW vs. NW calves (Thrift and Thrift, 2004). Likewise, recent studies also reported enhanced growth performance of EW calves (Gasser et al., 2006b; McCann et al., 2011; Waterman et al., 2012b,c). Heifers EW at 104 d of age and limit fed a high concentrate diet ( 2.5 to 3.1% of BW ) until the time of NW (208 d of age) had greater ADG (1.19 vs. 1.07 kg/d) and BW at NW (250 vs. 200 kg) compared to NW heifers (Gasser et al., 2006b). Pasture based management systems are fe asible alternative s for EW calf development (Harvey et al., 1975; Lusby et al., 1981; Neville and McCormick, 1981; Harvey and Burns, 1988a,b; Myers et al., 1999b; Arthington and Kalmbacher, 2003; Arthington et al., 2005; Vendramini et al., 2006; Vendramini and Arthington, 2007, 2008; Arthington, 2008; Vendramini et al., 2013; Moriel et al., 2013). Mild winters in southern USA allow beef producers to rais e calves on annual cool season forages with high nutritive value. For instance, annual ryegrass ( Lolium m ultiflorum ) contains approximately 20 % CP (DM basis) and 80 % in vitro organic matter digestibility (IVOMD) during the first 60 d of grazing (Arthington, 2008) and supports nearly 2,000 kg of BW/ ha for 75 to 100 d (Rouquete et al., 1997). However, due to t he limited ruminal capacity of EW calves and the low DM concentrations of ryegrass, EW calves grazing solely ryegrass have poor ADG (0.30 kg/d). Thus, concentrate supplementation should be provided to EW calves grazing cool season grasses in order to meet their nutritional requirements. Vendramini et al. (2006) reported that line ar increments on supplement offer (1.0, 1.5 and 2.0 % of BW) linear ly increase d the ADG of EW calves (0.74, 0.81 and 0.89 kg/d).

PAGE 31

31 Long term effects of calf management following EW on growth and reproductive performance of beef heifers (Gasser et al., 2006a,b,c,d), and growth and carcass quality of beef steers have been reported (Myers et al., 1999a,b; Arthington et al., 2005; McCann et al., 2011; Waterman et al., 2012b,c). Although 12 of 18 studies reported ADG of EW calves equal or lesser than NW calves during the feedlot phase, 10 of 14 studies reported equal or greater feed efficiency for EW vs. NW calves (Thrift and Thrift, 2004). Calves provided a high concentrate diet at 177 vs. 231 d of age had 11 % greater (0.17 vs. 0.15) overall feed efficiency during the feedlot phase (Myers et al., 1999a). Further, calves EW at 89 d of age and supplemented with concentrate at 1.0 % of BW on ryegrass pastures for 211 d had similar DMI, but great er ADG (0.87 vs. 0.40 kg/d) and feed efficiency (0.15 vs. 0.08) during the receiving period in the feedlot compared to NW calves entering the feedlot at 300 d of age (Arthington et al., 2005). Although a lighter BW at feedlot entry and previous exposure to concentrate may have contributed to the improved feed efficiency of EW vs. NW calves, Arthington et al. (2005) also reported lesser plasma concentrations of ceruloplasmin and haptoglobin in EW calves. These proteins are synthesized by the liver followin g stimulation from proinflammatory cytokines, which increase muscle catabolism to support the inflammatory response (Johnson, 1997). Thus, the decreased inflammatory response in EW calves may have resulted in lesser nutrient partitioning and muscle mobiliz ation compared to NW calves, and may partially explain the improved growth performance during the feedlot receiving period. Although intramuscular fat is thought to be a later ma turing fat depot in cattle (Anderson, 1991), intramuscular fat deposition can be anticipated if cattle are placed on

PAGE 32

32 a high energy diet at young ages (Williams et al., 1975; Fluharty et al., 2000; Schoonmaker et al., 2002a). In a 2 yr study, Myers et al. (1999a) reported that providing high concentrate diets at 177 vs. 213 d of age enhanced the percentage of carcasses grading average Choice or better (93 vs. 68 and 81 vs. 58 % for EW and NW calves in yr 1 and 2, respectively) and increased marbling scores (1,198 vs. 1,132, and 1,168 vs. 1,123 for EW and NW calves in yr 1 and 2, respe ctively). Thereafter, numerous studies proposed that feeding high concentrate diets to calves at 3 to 6 vs. 7 mo of age or older could be an alternative to enhance carcass quality and marbling scores. However, inconsistent results of the effects of age at feedlot entry on carcass quality and marbling scores have been reported. Of 13 studies comparing carcass characteristics of EW vs. NW calves, only 4 studies reported greater percentages of carcasses grading Choice or better (yr 1 and 2 in Myers et al., 199 9a; Story et al., 2000; Meyer et al., 2005), whereas only 6 studies reported greater marbling scores for EW vs. NW calves (yr 1 and 2 in Myers et al., 1999a; Schoonmaker et al., 2002b; Meyer et al., 2005; McCann et al., 2011; location 1 in Waterman et al., 2012c). Reasons for the inconsistent results among those studies may be attributed to differences on common end point at slaughter (BW, age or BF thickness), calf age at the start of the study, diet composition (e.g. starch concentration), timing and numb er of steroid implants and interaction among those factors. For instance, free choice access to high concentrate diets increased the intramuscular fat deposition of EW Angus x Simmental steers during the growing phase compared to EW steers provided high f orage diets However, these differences i n intramuscular fat concentrations diminished when steers were placed on the same finishing diet and did not differ at slaughter (Schoonmaker et al., 2003). In a similar

PAGE 33

33 experiment, Schoonmaker et al. (2004b) repor ted no differences on intramuscular fat concentration during the growing phase and marbling scores at slaughter between Holstein steers fed ad libitum high concentrate vs. high forage diets for 153 d following EW. Early exposure to high concentrate die ts for EW calves may enhance marbling scores, but substantial amounts of energy may also be partitioned to subcutaneous fat. T hereby physiological maturity is accelerated (Myers et al., 1999a; S choonmaker et al., 2001, 2002b), and c onsequently, lighter ca rcasses with smaller Longissimus dorsi muscles are produced in steers slaughtered at a constant age or fat thickness (Schoonmaker et al., 2004a). However, inconsistent effects related to carcass weight of calves provided high concentrate diets at young age s have also been reported. In 14 studies comparing the carcass weight of EW vs. NW calves fed high concentrate diets, 5 studies reported decreased (Barker Neef et al., 2001; Schoonmaker et al., 2002b, 2004a; locations 1 and 2 in Waterman et al., 2012c), wh ereas 4 studies reported increased carcass weights for EW vs. NW calves (yr 1 and 2 in Myers et al., 1999a; Meyer et al., 2005; McCann et al., 2011). Reasons for the inconsisten t results are likely the same described previously for marbling scores and carc ass quality. When sorting the previously described studies into groups of studies with or without positive effects of early exposure to high energy diets on carcass quality and marbling scores, the exact factor responsible for the enhanced carcass quality and marbling scores i s not apparent. This response suggests that interactions among the potential previously described candidates occur (i.e. interaction between diet composition and breed effects). Although the results were not consistent, the potential

PAGE 34

34 for long term effects of calf nutrition during early life on growth performance and carcass characteristics of beef steers exists and deserves further evaluation. Also, it is plausible that plane of nutrition prior to the start of the studies mentioned above including prenatal phase, may have influenced the outcome of dietary exposure to high energy diets. For instance, Greenwood et al. (2006) reported that bulls of low birth BW (28.6 kg) had greater REA (91.1 vs. 87.2 cm 2 ) compared to bulls of high bir th BW when bulls were placed on a high growth rate until weaning (ADG = 0.88 kg/d). However, REA (89.9 vs. 90.5 cm 2 ) did not differ when both groups of bulls were placed on a low growth rate (ADG = 0.55 kg/d). Further, heifers born from dams exposed to p rotein deficient diets (70 vs. 240 % of protein requirements) during second trimester of gestation had greater skeletal muscle mRNA expression of insulin growth like factor 1 receptor (IGF1R) at approximately 400 d of age (Micke et al., 2011). Since, IGF 1 is one of the ma jor factors responsible for postnatal growth, permanent effects on skeletal muscle expression of IGF 1 and IGF1R mRNA may also affect postnatal muscle mass accretion (Micke et al., 2011). However, further studies evaluating the interactio n between pre and post natal nutrition on calf performance are required. Body weight gain after weaning is a major variable that influences age and weight at puberty (Patterson et al., 1992). Growth rate between traditional weaning age ( NW; 6 to 8 mo o f age) and puberty, and from EW to the time of NW (3 to 6 8 mo of age) were negatively associated with age at puberty (Smith at el. 1976; Ferrel, 1982; Gasser et al., 2006a,b,c,d). Gasser et al. (2006a) demonstrated that enhancing the ADG of EW heifers (1. 27 vs. 0.85 kg/d) anticipated puberty achievement by approximately 100 d (262 vs. 368 d of age) and increased the percentage of heife rs

PAGE 35

35 achieving precocious puberty (puberty at less than 300 d of age; 100 vs. 0 % ). Later, Gasser et al. (2006b) reported tha t the hastened puberty achievement in EW heifers fed high concentrate diet was attributed to the high energy consumption and not due to a direct effect of EW, once EW and NW heifers fed to achieve similar growth rates had similar age at puberty (308 vs. 3 30 d). In addition, Gasser et al (2006b) reported spontaneous precocious puberty occurred in approximately 53 % of NW and E W heifers fed a control diet which is in agree ment with Wehrman et al. (1996), and further suggest that the plane of nutrition provid ed to heifer s and dams before EW is a potential source of early puberty stimulation. Timing of enhanced growth rate has different outcomes on BW and age at puberty. Across breeds, heifers that were fed to achieve the great er ADG (0.80 vs. 0.40 kg/d) star ting at 7 mo of age tended to be younger (372 vs. 387 d of age) and heavier at puberty (322 vs. 301 kg) compared with heifers achieving lesser growth rates (Ferrell, 1982). However, EW heifers experiencing faster growth rates beginning at 70 d of age ac hieved puberty earlier, but at similar (Gasser et al., 2006b) or lighter BW (Gasser et al., 2006a) compared to heifers on a lower plane of nutrition. Lynch et al. (1997) evaluated the effects of timing of BW gain starting at 6 8 mo of age on reproductive performance of beef heifers. Those authors observed that delaying the majority of the BW gain until the last third of the developmental period before the onset of the breeding season had no detrimental effects on reproductive performance, but reduced fe ed costs by 2.5 to 12 % compared to heifers achie ving even gain from NW until breeding season. Thus, as long as heifers achieve a dequat e BW at breeding, the timing of enhanced BW gain following NW had no effect on age at puberty. However, EW studies

PAGE 36

36 demonst rated that timing of BW gain in EW heifers influences the age at puberty. In a 2 x 2 factorial design, Gasser et al. (2006d) evaluated the effects of providing a high concentrate (60% corn; H) or control (30% corn; C) during phase 1 (126 to 196 d) and/or p hase 2 (196 to 402 d of age), resulting in 4 treatment combinations (HH, HC, CH and CC). Those authors observed that HH and HC heifers had similar age at puberty (271 vs. 283 d) and were younger than CC heifers (331 d), w hereas CH were inter mediate (304 d) In summary, tho se results indicate the existence of a critical time in which nutritional management may induce early activation of the reproductive axis and have long term consequences on age at puberty achievement. Additional benefits of early weaning Early weaning calves at 67 d of age increased the overall ADG of primiparous and multiparous cows by 0.39 and 0.27 kg/d, respectively, compared to cows that had their calves weaned at approximately 250 d of age (Neville and McCormick, 1981). Likewise, fir st calf heifers that had their calves weaned at 82 vs. 282 d of age had greater BW gain (73 vs. 19 kg) from EW to NW and BCS at the time of NW (6.3 vs. 4.8; Arthington and Kalmbacher, 2003) which is in agreement with others (Peterson et al., 1987; Myers e t al., 1999a; Arthington and Minton, 2004; Waterman et al., 2012). However, improvements on reproductive performance of beef cows have been inconsistent, particularly in multiparous beef cows. Laster et al. (1973) reported that weaning calves at 55 d of ag e (8 d before the start of the breeding season) had no effect on postpartum interval (PPI), but increased overall conception rates by 26, 16 and 8 % in 2 3 yr old co ws, respectively, compared to NW cows. Lusby et al. (1981) observed that weaning calves at 49 vs. 210 d of age reduced the PPI (73 vs. 91 d) and increased the overall pregnancy rate (97 vs. 59 % ) of first calf heifers. Likewise,

PAGE 37

37 EW primiparous cows had lesser PPI (15 vs. 24 wk; Arthington and Minton, 2004), and greater pregnancy rates than NW primiparous cows (90 vs. 50, and 96 vs. 79 % in yr 1 and 2, respectively; Arthington and Kalmbacher, 2003) Conversely, enhanced pregnancy ra tes in multiparous cows due to EW were observed by Myers et al. (1999a,b), but not by others (Lusby and Parra, 1981; Lusby and Wettemann, 1986; Myers et al., 1999b), despite the greater BW gain and BCS change of EW vs. NW multiparous cows (Neville and McCo rmick, 1981; Lusby and Parra, 1981; Myers et al., 1999b; Waterman et al., 2012a). Waterman et al. (2012a) observed greater pregnancy rates to AI (65 vs. 53 % ) and overall pregnancy rates (93 vs. 88 % ) for EW vs. NW cows in Exp. 3, but not in Exp. 1 and 2. Sm ith and Vicent (1972) and Story et al. (2000) also reported no effects of calf weaning age on overall pregnancy rates of primiparous and multiparous cows. In summary the general consensus of these studies imply that BW gain and BCS were improved in EW vs. NW cows, whereas enhanced reproductive performance was inconsistent and dependent on cow age. For instance, c alf removal increased the conception rates to AI in cyclic, but not in anestrous cows of 5 yr of age or older (Geary et al., 2001). Further, BCS a t the time of EW also influences the subsequent reproductive response to EW. At 25 d post weaning, 100 % of the EW cows with BCS greater than 5 (1 to 9 scale) initiated luteal activity, whereas only 43 % of EW cows with BCS less than 5 had luteal activity (B ishop et al., 1994) Thus, d ifferences on BCS at the start of the breeding season, pasture quality and herbage mass during the breading season, and the use of estrus synchronization protocols may explain the inconsistency on reproductive performance of mul tiparous beef cows.

PAGE 38

38 Maintenance energy requirements are approximately 20 % greater for lactating vs. nonlactating beef cows (NRC, 2000). Further, the daily energy requirements (Mcal) to produce 8 kg of milk represents nearly 40 % of the total energy require ments of a 450 kg beef cow at 9 wk postpartum (NRC, 2000). Thus, management practices that decrease cow DMI and enhance productivity may impact the sustainability of cow calf production syste ms Arthington and Minton (2004) observed that EW cows i n drylot and supplemented with hay consumed 59% less TDN (supplemental hay + concentrate) than NW cow calf pairs. Peterson et al. (1987) evaluated the economical impacts of weaning calves at 110 vs. 222 d of age, and reported that EW calves had greater BW gain (95 vs. 66 kg) and total feed cost ($ 51 vs. 0) than NW calves after 112 d on feed. However, EW cows consumed 45 % less hay TDN and had lesser total feed cost than NW cows ($ 101 vs. 190). Therefore, EW cow calf pairs were 44 % more efficient on converting kg o f TDN into kg o f calf gain, and had $ 95 less income loss than NW cow calf pairs. Endocrine and M olecular C ontrols of M uscle and A dipose T issue G rowth, and P uberty A chievement Somatotropic A xis The somatotropic axis is an essential constituent of multipl e systems controlling growth (Le Roith et al., 2001) and reproduction (Wettemman et al., 2003; Hess et al., 2005). The major components of the somatotropic axis include GH, GH receptors (GHR 1A, 1B and 1C), IGF 1, IGF1R and IGF 1 binding proteins (IGFBPs ; Lucy et al., 2001; Le Roit h et al., 2001). Growth hormone is a single chain, poly peptide hormone secreted by the anterior pituitary with direct and indirect effects on lactation, growth and reproduction (Spicer and Echternkamp, 1995; Lucy et al., 2001). Pituitary release of GH

PAGE 39

39 is primarily modulated by hypothalamic GH releasing hormone (GHRH) and somatostatin, but is also stimulated by ghrelin, and inhibited by IGF 1 via a negative feedback loop (Berelowitz et al., 1981; Kojima et al., 1999). Growth hormo ne attenuates insulin induced lipogenesis, and stimulates lipolysis in adipose tissue, muscle protein accretion in growing animals, milk protein synthesis in lactating cows (Bell, 1995; Knapp et al., 1992; Etherton and Bauman, 1998), and enhances hepatic s ecretion of IGF 1 (Smith et al., 2002). The physiological actions of GH are initiated when GH binds to GHR, causing a conformational change in the GHR that activates the Janus kinase 2 second messenger system (Carter Su et al., 1996). Badinga et al. (1991) demonstrated that the binding of GH to GHR 1A increased with the calf age, leading to enhanced synthesis of IGF 1 and declining serum concentrations of GH as calves developed In cattle, GHR mRNA contains a short 5' untranslated sequence (exon 1 sequence) an open reading frame for protein translation (exons 2 through 10) and 3' untranslated sequence (exon 10). There are three GHR promoters in cattle that transcrib es three different exon 1 se quences (GHR 1A, 1B, and 1C; Lucy et al., 1998). Although the m RNA is different in exon 1, the receptor protein is the same because the GHR protein is encoded in exons 2 through 10 of the mRNA (Lucy et al., 1998). The GHR 1A mRNA is only present in the liver, in which it represents the bulk of liver GHR mRNA, whereas GHR 1B and 1C mRNA are expressed in a wide variety of tissues, including muscle and adipose tissue (Lucy et al., 1998, 2001). Bovine IGF 1 is a single chain polypeptide hormone with a molecular weight of approximately 7.6 kDa (Etherton, 2004) that is i nvolved in carbohydrate, protein and fat metabolism, and cell proliferation and differentiation (Jones and Clemmons, 1995) L iver

PAGE 40

40 is the primary source of circulating IGF 1 and the main responsible for the systemic effects of IGF 1 (Yakar et al., 1999), wh ereas IGF 1 synthesized by non hepatic tissues mainly exert autocrine and paracrine effects (McGuire et al., 1992 ). The activity of IGF 1 within target tissues is modulated by the binding of IGF 1 to IGFBPs and IGF1R (Thissen et al., 1994; Le Roith et al., 2001). Less than 5 % of circulating IGF 1 is free and is rapidly cleared from circulation (Jones and Clemmons, 1995), whereas over 90 % of IGF 1 in blood is bound to one of six IGFBPs of different length and molecular weight (Shimasaki and Ling, 1992; Thiss en et al., 1991, 1994). The IGFBPs bind to IGF 1 with high affinity and are responsible for transporting IGF 1 among body tissues, extending its half life and enhancing or blocking its binding to IGF1R (Le Roith et al., 2001). Approximately 90 % of circula ting IGF 1 is bound to IGFPB 3 (Martin and Baxter, 1992), whereas the remainder is bound to IGFBP 1, IGFBP 2, or IGFBP 4 (Clemmons, 1991). The binding of IGF 1 to IGFBP 3 generates a complex that is incapable of crossing the capillary endothelium (Binoux a nd Hossenlopp, 1988). Therefore, IGF 1 must be released from IGFBP 3 and associate with 4 to 5 fold smaller complexes (IGFBP 1 and IGFBP 2) that are capable of crossing the capillary endothelium and reaching the target tissues (Thissen et al., 1994). The IGF1R is widely expressed in the body tissues, including muscle, adipose tissue, hypothalamus, pituitary, gonads and reproductive tract (Codner et al., 2002; Vestergaard et al., 2003), and shares similarity with insulin receptor of approximately 60 and 85 % at the amino acid level and tyrosine kinase domain, respectively (Ullrich et al., 1986; Thissen et al., 1994). The intracellular domain of IGF1R contains the tyrosine kinase activity that becomes phosphorylated upon binding of IGF 1 which triggers a casc ade of intracellular events (Thissen et al., 1994)

PAGE 41

41 that ultimately lead to insulin like effects, including enhancing glucose and amino acid uptake, and glycogen synthesis (Dimitriadis et al., 1992). In addition to the age dependent production of IGF 1 (Ba dinga et al., 1991), gender and nutrition also modulate the somatotropic axis. Govoni et al. (2003) reported similar serum concentrations of IGF 1 between males and females calves up to 16 wk of age, but increased serum concentrations of IGF 1 and IGFBP 3 in male vs. female calves from 17 wk to 1 yr of age. Age and nu trition had little or no effect on GHR 1B mRNA expression in the semitendinosus muscle and subcutaneous adipose tissue (Lucy et al., 2001; Smith et al., 2002). In contrast, GHR 1A mRNA expressi on increased with age (Lucy et al., 2001) and growth rate of calves (Smith et al., 2002; Radcliff et al., 2004). Binding of GH to hepatic membrane is highly correlated with GHR 1A mRNA expression (Radcliff et al., 2003), which is also highly correlated wit h hepatic expression of IGF 1 mRNA (Lucy et al., 2001). Increased expression of GHR 1A mRNA has been observed in lactating dairy cows following chronic infusions of insulin (Butler et al., 2003). Thus, an increased hepatic expression of GHR 1A enhances the capacity for GH binding (Lapierre et al., 1982), and consequently, IGF 1 synthesis (Radcliff et al., 2004). High feeding levels have been shown to affect multiple components of the somatotropic axis of cattle (Smith et al., 2002; Vestergaard et al., 2003 ; Radcliff et al., 2004). Prepubertal heifers provided free choice access to a high concentrate diet for 5 wk had greater ADG, increased hepatic GH binding, L. dorsi muscle IGF1R density, plasma concentrations of insulin, IGFBP 3, free and total IGF 1, but decreased plasma concentrations of GH and IGFBP 2 compared to heifers provided free choice access to a high forage diet (Vestergaard et al., 2003). Smith et al. (2002) reported that newborn

PAGE 42

42 calves provided increased nutrient intake had greater plasma conc entrations of insulin and IGF 1, but no effect on semitendinosus muscle expression of GHR and IGF 1 mRNA. Conversely, pigs provided increased dietary concentrations of protein had greater mRNA expression of IGF 1 in the semitendinosus muscle, but not in th e L. dorsi muscle (Maltin et al., 1990). The increased circulating concentrations of IGF 1 following increased nutrient intake (Smith et al., 2002; Vestergaard et al., 2003; Radcliff et al., 2004; Moriel et al., 2012) is a combinatorial effect of increased energy and protein intake (Vestergaard et al., 2003). Elsasser et al. (1989) demonstrated that the effects of increasing CP intake on plasma concentrations of IGF 1 were dependent on the level of metabolizable energy (ME) intake. Increasing dietary CP con centrations (8, 11 and 14 % of DM) linearly increased plasma concentrations of IGF 1 when steers consumed 17 Mcal of ME daily, but had no effect on plasma concentrations of IGF 1 when steers consumed 12.5 Mcal of ME. In addition, greater serum concentration s of IGF 1 have been observed by feeding high carbohydrate (80 % of non protein calories) vs. high lipid diets (72 % of non protein calories; Snyder et al., 1989), and essential vs. nonessential amino acids (Clemmons et al., 1985). The increased IGF 1 concen trations following high energy and protein intake are facilitated by the insulin stimulating effects on hepatic expression of GHR1A mRNA and GH binding (Butler et al., 2003). However, the synthesis of IGF 1 may also be affected by insulin independent chan ges in post receptor mechanisms and impaired IGF 1 gene expression (Maiter et al., 1989; Thissen et al., 1994). Muscle and A dipose T issue G rowth Myogenesis is the developmental process leading to muscle fiber formation. Bovine skeletal muscle comprises ab out 55 to 60 % of total carcass weight (Callow,

PAGE 43

43 1961), and is largely determined by the number and size of muscle fibers (Owen et al., 1995). During myogenesis, myofibers acquire their specific contractile and metabolic properties, and can be classified int o slow (type I) and fast twitch (type IIA, IIX, IIB) myofibers. In cattle, the prenatal myogenesis is divided into primary (early gestation) and second ary myogenesis (mid gestation; Bonnet et al., 2010; Du et al., 2013). Given that muscle growth potential depends on the total number of myofibers (Hocquette, 2010), which is set by the end of the second trimester of gestation (Picard et al., 2002), the prenatal stage becomes a crucial period for subsequent muscle growth (Du et al., 2013). Thereafter, postnat al muscle growth occurs through hypertrophy of existing muscle fibers (Dayton and White, 2008), and once the present fiber nuclei are unable to divide, fiber hypertrophy requires additional nuclei adhesion. N early 60 to 90 % of DNA found in skeletal muscle fibers is provided by satellite cells ( SC ) that accumulated during postnatal growth (Allen et al., 1979). Satellite cells encompass nearly 30 % of muscle nuclei in a newborn animal, but only 2 to 10 % on muscle nuclei in mature animals (Cardasis and Cooper, 1975). Additionally, the remaining SC in mature animals lo se their proliferative capacity which lead s to a growth plateau (Cardasis and Cooper, 1975). Therefore, SC proliferation is crucial for postnatal muscle growth, repair and regeneration (Moss and Le blond, 1971; Bischoff, 1975). Satellite cells are small mononucleate d cells in a quiescent state located between the basal lamina and sarcolemma of muscle fibers (Machida and Booth, 2004). Following hormone stimulation or muscle injury, quiescent SC beco me activated and undergo asymmetric divisions to partially restore their population (Zammit et al., 2004) and to generate new cells that proliferate, differentiate and fuse with existing myofibers

PAGE 44

44 (Cooper et al., 1999). Pre and postnatal myogenesis is un der the control of a number of regulatory proteins, including paired box gene 7 (Pax7) and myogenic regulatory factors (MRF), such as myogenic differentiation 1 (MyoD), myogenic factor 5 (Myf5) and myogenin (Bailey et al., Hyatt et al., 2008). The expressi on Pax7 is required for bovine SC specification (Seale et al., 2000) and ensures SC survival (Relaix et al., 2006), consequently, Pax7 is widely used as a marker for both quiescent and activated SC (Li et al., 2011). Upon activation, SC induce the expressi on of Myf5 that induces cell proliferat ion and stimulate the expression of MyoD, which further up regulates the expression of myogenin and down regulates the expression of Pax7. Thereafter, myogenin expressing cells undergo differentiation and fuse with th e existing myofibers (Perdiguero et al., 2009). Satellite cells not expressing Myf5 will restore the self renewing population of stem cells (Kuang et al., 2007; Li et al., 2011). Adipose tissue is a heterogeneous connective tissue containing substantial a mounts o f blood vessels and nerves, and originates from mesenchymal cells similar to those generating myocytes, chondrocytes and fibroblasts (Hausman et al., 2009). Adipose tissue encompasses 5 to 35 % of cattle BW depending on age, genotype and nutrition ( Bonnet et al., 2010), and is not solely an energy storage site, but also an endocrine organ secreting adipokines that regulate whole body energy balance (Du et al., 2013). The growth of adipose tissue occurs through hyperplasia and hypertrophy, with relati ve contributions of each process varying among tissue location and age (Cianzio et al., 1985; Bonnet et al., 2010). Adipogenesis is the formation of new adipocytes from precursor cells in the adipose tissue (Hausman et al., 2001), and involves the prolifer ation, differentiation and conversion of preadipocytes into lipid

PAGE 45

45 assimilating cells within the adipose tissue (Hausman et al., 2009). Adipocyte hyperplasia occur s lifelong, primarily during fetal and early postnatal stages (Bonnet et al., 2010; Du et al., 2010), but gradually decreases with the declining population of progenitor cells as animals become older (Du et al., 2013). Hyperplasia may also arise during later stages after adipocytes reach a critical size (Cianzio et al., 1985; Schoonmaker et al., 20 04), which is dependent on the anatomical locatio n of adipocytes (Vernon, 1986). The first wave of adipogenesis follows a transient up regulation of CCAAT/enhancer binding pro tein 24 h following activation, induce adipocyte proliferation (T ang et al., 2003) and stimulate the expression of C/EBP r Li et al., 2010). The appe differentiated state of the adipocytes (Rosen, 2005). Following activation by C/EBP and which subsequently reinforces differentiation. Peroxisome proliferator stimulate adipocyte differentiation (Rosen et al., 2002). Additional proteins such as sterol regulatory element bindi ng protein 1 (SREBP 1) are expressed during early by up regulating a wide range of genes associated with triglycerides (TG) uptake and storage, such as fatty acid binding protein, acyl CoA synthetase, fatty acid transport protein 1, lipoprotein lipase (LPL), and others (Rosen and MacDougald, 2006).

PAGE 46

46 Adipose tissue development in grow ing cattle occurs primarily through hyp ertrophy (Cianzio et al., 1985). T he volume of adipocytes increases more than 100 fold in perirenal adipocytes, but to a lesser extent (4 to 10 fold) in subcutaneous, intermuscular and omental (surrounding the stomac h) adipocytes of cattle between 150 and 600 d of age (Vernon, 1986). Adipose hypertrophy in any fat depot results from the balance between TG synthesis and degradation that are controlled by multiple nutrients and hormones (Bonnet et al., 2010). Synthesis of TG requires the formation of glucose derived glycerol and nonesterified fatty acids (NEFA), which may be obtained by either de novo synthesis from glucose, lactate or acetate, or from direct incorporation of pre formed fatty acids (Pethick et al., 2004) Fatty acids are subsequently esterified and stored as TG in lipid droplets. Conversely, fatty acids release from TG molecules is catalyzed by hormone sensitive lipase (HSL), whose actions are highly regulated by dietary energy intake (Smith and McNamara, 1990). There are 4 major adipose tissue depots in livestock: visceral, subcutaneous, intermuscular, and intramuscular (Du et al., 2013). Adipocytes surge before mid gestation in beef cattle (Bonnet et al., 2010), and are detectable in perinatal and inter muscular fat around d 80 and 180 of gestation, respectively (Taga et al., 2011), whereas visceral adipocyte formation occurs from mid gestation to early postnatal stage (Robelin, 1981). In the subcutaneous tissue, adipocytes are formed between mid gestatio n and NW (Hood and Allen, 1973), whereas intramuscular adipocytes formation mainly occurs during late gestation to nearly 250 d of age (Du et al., 2010, 2013). Further, marked metabolic differences among fat depots occur (Hausman et al., 2001). M esenteric fat cells are smaller, less sensitive to insulin induced effects on glucose

PAGE 47

47 metabolism, and have greater lactate production rates than fat cells from other adipose depots (DiGirolamo et al., 1998). Intramuscular adipocytes have lesser maximum diameter (Smi th and Crouse, 1984), preadipocyte differentiation capability (Grant et al., 2008), insulin induced lipogenic and lipolytic efficiency, and mRNA expression of leptin, IGF 1 and adiponectin (Garden et al., 2006), but greater glucose transporter 4 mRNA expre ssion (Hocquette et al., 2010) compared to subcutaneous adipocytes. Further, intramuscular and subcutaneous adipocytes differ at their main energy source. Acetate provided 70 80 % of the acetyl units for in vitro lipogenesis in subcutaneous adipose tissue, but only 10 25% in intramuscular adipocytes. In contrast, glucose represented 1 10 % of the acetyl units in subcutaneous adipose tissue, but 50 75 % in intramuscular adipocytes (Smith and Crouse, 1984). Marbling is the term referring to the visible intramu scular fat between the bundles of muscle fibers that has positive influences on sensory quality traits, such as flavor (Hocquette et al., 2010). Intramuscular fat content depends on genetic background and nutrition (Pethick et al., 2004; Wang et al., 2009) and is the last adipose tissue deposited in finishing animals, although adipocyte differentiation and accumulation may initiate at earlier stages (Schoonmaker et al., 2003; Harper and Pethick, 2004). At 7 mo of age, Wagyu crossbred beef steers had greate r expression of multiple adipogenic and lipogenic genes, such as fatty acid binding protein 4 and fatty acid synthase, compared to Piedmontese crossbred steers (Wang et al., 2009). Thus, the early adipocyte differentiation suggests the existence of a windo w in which early nutritional interv ention may enhance intramuscular fat deposition (Wang et al., 2009). Due to differences i n glucose metabolism (Smith and Crouse, 1984) and timing of adipocyte hyperplasia

PAGE 48

48 among different adipose tissue depots (Du et al., 2010), multiple studies attempted to identify potential mechanisms that could enhance marbling scores without affecting overall adiposity of the animal. Those studies includ ed the effects of maternal nutrition during gestation (Du et al., 2010) and dietary composition provided to steers immediately following EW (Schoonmaker et al., 2003, 2004; Graugnard et al., 2009, 2010). Indeed, Schoonmaker et al. (2003) reported greater intramuscular fat concentration, measured via ultrasound at 218 d of age, in beef st eers provided free choice access to high concentrate vs. high forage diets, which may be attributed to greater starch intake leading to earlier adipocyte differentiation (Graugnard et al., 2009; 2010). Further, the increase on Longissimus lumborum mRNA exp was greater in Angus x Simmental crossbred steers provided high starch diets compared to Angus steers provided high and low starch diets, and Angus x Simmental crossbred steers provided low starch diets (Graugnard et al., 2009). These res ponses indicate that intramuscular fat deposition is dependent on the interaction between dietary composition and genetics. Producing cattle with a desirable lean to fat ratio is an economic challenge for the beef industry, and the result of a dynamic ba lance between the number and size of muscle and adipose cells (Bonnet et al., 2010). Adipose and muscle cells are linked by competition or prioritization in their commitment, differentiation and nutrient metabolism (Bonnet et al., 2010). For instance, PPAR suppressed muscle specific transcription factors, such as Myf5, MyoD, myogenin, and MRF4 (Hu et al., 1995), suggesting that adipogenic transcription factors may be also involved in SC differentiation (Chung and Johnson 2008). In addition, an

PAGE 49

49 interconversion of muscle SC into adipocytes has been reported in vitro (Kook et al., 2006; Chung and Johnson, 2008). Nutrient partitioning among muscle and adipose tissue is a dynamic process that is dependent on complex interacti ons among environmental temperature, stress, nutritional status, age, sex and exercise (Welch et al., 2012). In addition to the distinct adipocyte characteristics among fat depots, muscle composition also varies among muscle locations and is dependent on muscle function, size and fiber type (glycolytic vs. oxidative metabolism), which further contributes to the nutrient partitioning process among body tissues (Welch et al., 2012). For example, glucose is used for oxidation via glycolysis or storage as glyc ogen in muscle (Welch et al., 2012), but it is also the main source of acetyl units for intramus cular fat deposition (Smith and Crouse, 1984). Additionally, the somatotropic axis, primarily via IGF 1, regulates both muscle and adipose tissue growth. Somat otropic axis vs. muscle and adipose tissue growth In growing cattle, the accretion rate of L. dorsi muscle was positively correlated with serum IGF 1 (r = 0.82) and IGF1R density (r = 0.52) (Vesteergard et al., 2003). Insulin like growth factor 1 stimulat ed SC proliferation and differentiation in a time and concentration dependent way (Florini et al., 1996; Oskbjerg et al., 2004). Because, proliferation and differentiation are mutually excluding processes, it was puzzling that IGF 1 could stimulate cell p roliferation and differentiation by acting through a single receptor (Florini et al., 1996). Subsequent research demonstrated that different intracellular signaling pathways are responsible for proliferative vs. differentiating effects of IGF 1 (Coolican e t al. 1997). Initially, IGF 1 suppresses myogenin expression via Ras/Raf 1/MAP kinase pathway, which causes SC to proliferate and then, IGF 1 enhances myogenin expression via PI3 kinase/p70 S6k pathway, caus ing SC to exit the

PAGE 50

50 proliferation state and undergo differentiation (Coolican et al., 1997). In addition, skeletal muscle expresses IGFBP 2, 4, 5, and 6 following insulin and IGF 1 stimulation (Florini et al., 1996), but the amount and timing of release of each IGFBP differ during proliferation and dif ferentiation (Oksbjerg et al., 2004). Furthermore, IGF 1 stimulates muscle protein synthesis via activation of mammalian target of rapamycin (mTOR), and inhibits muscle protein degradation via inhibition of transcription factors of FoxO family (Dayton and White, 2008). Adipocytes and preadipocytes synthesize and secrete local IGF 1 and IGFBPs. Insulin like growth factor 1 increases the proliferation and differentiation of preadipocytes (Hausman et al., 2001), whereas it stimulates lipogenesis, glucose upt ake and oxidation, and the synthesis LPL in mature adipocytes (Hossner, 2005). In vitro expression of IGF 1 is initially low but gradually increases during differentiation of preadipocytes into mature adipocytes (Hossner, 2005). In rats, local synthesis o f IGFBP 2 and 3 is restricted to preadipocytes, while IGFBP 5 is secreted by both preadipocytes and mature adipocytes (Hossner, 2005). In pigs, accumulation of IGFBP 1 in developing adipose tissue was correlated with inhibition of adipocytes proliferation (Hausman et al., 2009). Although, overall proliferative effects of GH on adipocytes are mediated by IGF 1, GH is also a strong lipolytic hormone that causes a net reduction in adipose mass even though it stimulates IGF 1 actions (Hausman et al., 2009). Pu berty A chievement Economic efficiency of a cowherd is optimized when heifers calve first at 2 vs. 3 yr of age (Lesmeister et al., 1973; Nunez Dominguez et a l., 1991). Heifers calving at 2 yr of age weaned more calves, had greater total kg of weaned calf a nd lesser development cost than those calvi ng at 3 yr of age over their lifetime (Nunez

PAGE 51

51 Dominguez et al., 1991). In order to calve at approximately 2 yr of age, replacement heifers should be able to conceive at 14 to 16 mo of age (Schillo et al., 1992). H owever, due to the reduced conception rates at first vs. third estrus (Byerley et al., 1987), heifers should achieve puberty at approximately 12 mo of age (Schillo et al., 1992; Bagley, 1993). Failure to reach puberty at an appropriate time remains a major reason that heifers do not become pregnant during their first breeding season (Yelich et al., 1996). In 1994, approximately 95 % of heifers in northern and central USA were comprised mainly of Bos taurus genetics and calved first at 2 yr of age. Conversely less than 50 % of B. indicus influenced heifers in Florida calved first at 2 yr of age (Short et al., 1994), which is likely attributed to B. indicus influenced heifers being less responsive to gonadotropin releasing hormone (GnRH) stimuli and the delayed puberty achievement (Griffen and Randel, 1978; Martin et al., 1992; Rodrigues et al., 2002). Consequently, nutritional strategies that anticipate puberty achievement of B. indicus influenced heifers are warranted. Research published from 1960s to 1980s r eported negative effects of limited post weaning growth on age at puberty and pregnancy rates (Wiltbank et al., 1966; Short and Belows, 1971; Byerley et al., 1987). Conversely, recent research indicated that developing heifers to achieve lighter BW at bree ding (50 57 vs. 60 65 % of mature BW) did not impair reproductive performance and reduced costs with heifer development (Funston et al., 2012). These responses may be associated with 1) a shift from calving at 3 to 2 yr of age and subsequent pressure for de creased age at puberty, 2) the association between scrotal circumference in bulls and age at puberty in their daughters, and 3) altered fertility of pubertal estrus compared with subsequent estrous

PAGE 52

52 cycles (Funston et al., 2012; Endecott et al., 2013). Patt erson et al. (1989) demonstrated that B. taurus heifers assigned to achieve either a high or low mature BW (65 vs. 55 % ) at the st art of breeding had similar pregnancy rate s (91 vs. 81 % ). H owever, B. indicus heifers assigned to achieve low matur e BW at bree ding had lesser pregnancy rate than heifers achieving high mature BW at breeding (63 vs. 90 % ). Consequently, further research is warranted to determine the effects of pre and post weaning growth rate on reproductive performance of B. indicus influenced he ifers, these heifers should achieve between 60 to 65 % of mature BW at the start of the breeding season. Day and Anderson (1998) proposed that the period from birt h to puberty in beef heifers could be divided into infantile, developmental, static and perip ubertal periods. During infantile period (birth to 2 mo of age), pulsatile secretion of luteinizing hormone (LH) is established (Anderson et al., 1986) and ovary follicles become visible (Evans et al., 1992). Thereafter, during the developmental phase (2 t o 6 mo of age), GnRH secretion increases, which stimulates follicular growth and result in increased peripheral concentrations of estradiol. The LH secretion and number of follicles in the ovary peak at 3 4 mo of age (Evans et al., 1994). However, LH secre tion is highly sensitive to estradiol negative feedback by as early as 2 mo of age (Moseley et al., 1984), and thus, the concentration of LH and number of follicles declines until 7 8 mo of age (Day and Anderson, 1998) and remains at a relatively low level throughout the static phase (6 to 10 mo of age). Follicles grow in a wave like pattern from birth to puberty, increasing the circulating concentration of estradiol and size of follicles as heifers approach puberty (Evans et al., 1994; Melvin et al., 1999) Puberty occurs following the dynamic changes

PAGE 53

53 occurring during the peripubertal phase (10 to 12 mo of age), which includes a decrease in the negative feedback of estradiol and an increase in GnRH induced LH secretion (Rodriguez and Wise, 1989) that lead s to final growth and maturation of ovarian follicles, and subsequently first ovulation (Day and Anderson, 1998). As previously described, puberty is anticipated by increasing the growth rates following EW or NW (Smith at el. 1976; Ferrel, 1982; Yelich et al., 1995, 1996; Wehrman et al., 1996; Gasser et al., 2006a,b,c,d; Waterman et al., 2012b). Gasser et al. (2006a,b,c) evaluated multiple components of the reproductive axis and demonstrated that providing high concentrate diets to EW heife rs, starting at a pproximately 90 d of age, increased the frequency of LH pulse (Gasser et al., 2006a), mean LH concentrations (Gasser et al., 2006c), follicular growth and duration of the follicular wave, circulating concentrations of estradiol (Gasser et al., 2006b), and anticipated the decline in estradiol negative feedback on LH secretion (Gasser et al., 2006c). Some of those differences were evident as early as 190 d of age and before BW started to diverge among treatments, which indicates that through dietary manipulat ion, heifers can forego the static phase and move directly from the developmental phase to the peripubertal period (Gasser, 2013). Subsequently, Gasser et al. (2006d) reported that feeding a high concentrate diet for the first 70 d following EW was suffi cient to achieve similar age at puberty compared with EW heifers provided high concentrate diets for 276 d, and suggest ed the existence of a critical window for early activation of the reproductive axis. Somatotropic axis vs. puberty The nutrition induced signals leading to early activation of the reproductive axis in heifers are unknown. However, a simultaneous increase in serum concentrations of

PAGE 54

54 IGF 1 and LH has been detected in heifers approaching puberty (Yelich et al., 1996), whereas immunization agai nst GHRH between 3 and 6 mo of age decreased seru m concentrations of GH and IGF 1 and delayed puberty achievement in beef heifers (Schoppee et al., 1996). Thus, a potential candidate involved in the early puberty achievement is the somatotropic axis (Gasse r et al., 2006d). Local and systemic GH and IGF 1 can exert stimulatory or permissive roles at each level of the hypothalamic pituitary gonadal axis (Chandrashekar et al., 2004). The concentrations of IGF 1 increase during puberty in ruminants (Yelich et al., 1996 ), rats and primates (Daftary and Gore, 2005). Despite similar ADG, heifers that achieved puberty had greater plasma concentrations of IGF 1 than non pubertal heifers (Cooke et al., 2007). Likewise, beef cows resuming estrus at 20 wk postpartum h ad greater serum concentrations of IGF 1 and IGFBP 3 compared with anestrous cows (Roberts et al., 1997). In rats and primates, chronic administration of exogenous IGF 1 anticipated puberty (Hiney et al., 1996; Wilson, 1995). In vivo GH dose response studi es showed that GH effects on follicle development act primarily through increased circulating concentrations of insulin and IGF 1 (Gong et al., 1997). However, GH also directly affects oocyte maturation (Sirotkin and Makarevich, 2002), functional corpora l utea (CL) formation and age at first conception (Zaczek et al., 2002). In GHR deficient mice, the reduced ovulation rate, decre ased number of antral follicles and increased number of follicles undergoing atresia were not reversed by IGF 1 treatment (Bachel ot et al., 2002), which supports the existence of direct effects of GH. In cattle, GHR mRNA was not detected in ovary follicles (Lucy et al., 1999), whereas GH administration did not affect proliferation and steroidogenesis of bovine granulose cells (Gong et al., 1994).

PAGE 55

55 Conversely, large luteal cells of bovine CL expressed GHR and responded to GH treatment (Lucy et al., 1999). Insul in like growth fator 1 receptor IGF 1 and IGFBPs mRNA are present in the brain, pituitary, gonads and reproductive tract (Co dner et al., 2002; Wettemann et al., 2003; Chandrashekar et al., 2004). In vitro studies observed an increased GnRH mRNA expression in GnRH secreting neurons and secretion of LH and follicle stimulating hormone (FSH) following IGF 1 treatment (Daftary and Gore, 2005). In the ovaries, local and systemic IGF 1 stimulated cell proliferation and steroidogenesis (Spicer and Echternkamp, 1995), whereas IGFBPs activity decreased during terminal development of follicles (Funston et al., 1996), thereby increasing t he availability of IGF 1 to follicles (Wettemann et al., 2003). Furthermore, levels of gonadal estrogen modulate the effects of IGF 1 Hashizume et al. (2002) reported that GnRH induced LH release by bovine anterior pituitary cells occurred at a greater ex tent when estradiol and IGF 1 were added together compared to either estradiol or IGF 1 alone. In the hypothalamus, IGF 1 stimulates the expression and function of estrogen receptors (Aronica and Katzenellenbogen, 1993), whereas estrogen stimulates hypotha lamic expression of IGF1R and IGFBPs (Pons and Torres Aleman, 1993). In vivo studies indicated that both the IGF1R and estrogen receptor are required for neuronal modifications that occur during the estrous cycle (Fernandez Galaz et al., 1999), while chron ic administration of IGF 1 to adolescent primates lowered the negative feedback of estradiol on LH release and anticipated puberty achievement (Wilson, 1995). Additional signals that may potentially contribute to triggering the mechanisms leading to puber ty include leptin (Maciel et al., 2004) and neuropeptide Y (NPY; Garcia

PAGE 56

56 et al., 2002). Increasing concentrations of leptin have been associated with puberty attainment in heifers (Garcia et al., 2002). However, leptin appears to have more of a permissive r ole than a stimulatory role in puberty attainment of heifers (Maciel et al., 2004; Hess et al., 2005). In agreement, Cooke et al. (2003) observed that chronic GH treatments 14 d apart increased plasma concentrations of IGF 1 and hastened puberty achievemen t in beef heifers, despite the decreased plasma concentrations of leptin compared to saline treated heifers. Allen et al. (2012) observed that heifer s fed high concentrate diets following EW had decreased the hypothalamic expression of NPY and GHR compared with heifers provided high forage diets. Neuropeptide Y signals the metabolic status to the central reproductive axis (Pierroz et al., 1996), and it has receptors in GnRH neurons (Li et al., 1999) Treatment with NPY inhibited pulsatile release of GnRH an d LH in cows (Gazal et al., 1998), while hypophysectomy in rats reduced hypothalamic expression of NPY mRNA, which was restored to levels similar to control animals following GH treatment (Chan et al., 1996) and indicates a GHR mediated regulation of NPY expression (Allen et al., 2012). Thus, decreased hypothalamic expression of NPY and GHR following high concentrate diets may be an additional signal triggering early puberty achievement. Strategies to E xplore the Effects of M etabolic I mprinting in B eef C at tle P roduction S ystems M etabolic imprinting effects are associated with a critical and transitory window in which early nutritional interventions may result in long term co nsequences on animal metabolism. Therefore, identifying strategies that are able to explore those critical periods of development and enhance calf performance may provide unique opportunities to optimize feed resources and increase the profitability of beef cattle

PAGE 57

57 management systems. Early weaning beef calves prior to the breeding season is a strategy that may increas e the reproductive performance of primiparous cows and decrease feed costs, but it may simultaneously provid e an opportunity to enhance the carcass quality of beef steers and reproductive performance of beef heifers. However, few beef producers are willing to adopt this management practice due to 1) the lack of information on calf management following EW, and 2) the high costs associated with feeding concentrate based diets throughout the entire period of calf feeding. Therefo re, the evaluation of alternative nutritional management systems for EW be ef calves, such as grazing cool season grasses during the winter and short periods of feeding high concentrate diets in drylot, and their long term consequences on the performance of fall born calves is required. Further, it remains unknown if a short period of exposure to high concentrate diets immedia tely after EW and followed by pasture grazing, is capable of causing imprinting effects These effects could lead to carcasses qual ity similar to those from calves fed high concentrate diets for their entire life but greater carcass quality than those from calves NW at 250 d of age Also, it remains unknown if this short period of exposure to high concentrate diets is able to hasten puberty achievement in B. indicus infl uenced heifers that are known for reach ing puberty at older ages compared to B. taurus beef heifers.

PAGE 58

58 CHAPTER 3 EFFECT S OF METABOLIC IMPRINTING AND CALF MANAGEMENT SYSTEMS ON GROWT H PERFORMANCE AND CARCASS CHAR ACTERISTICS OF BEEF STEERS Metabolic imprinting is the process by which nutrition during the critical and transitory window of early life may permanently affect the metabolism and pe rformance of livestock (Lucas et al. 1998; Du et al., 2010). Thus ident ifying strategies that are able to enhance the calf performance during those critical periods of development may provide unique opportunities to optimize feed resources and increase the profitability of beef cattle management systems. Further the g rowth performance of early weaned (EW) calves is highly efficient and the early exposure to high concentrate diets may improve feedlot perfo rmance and marbling scores (Myers et al., 1999a ,b ). However, few beef producers are willing to adopt this management pra ctice due to the lack of information on calf management following EW and the high costs of feeding concentrate based diets for extended period s Therefore, the evaluation of alternative nutritional management systems for EW beef calves and their long term consequences on calf performance is warranted I t remains unknown if a short term period of exposure to high concentrate diets immediately after EW followed by pasture grazing before the finishing period in feedlot is capable of causing metabolic impri nting effects and enhanced carcass quality We hypothesized that providing high concentrate diet s for at least 90 d following EW would induce permanent alterations on growth related an d adipogenic genes, and increase the marbling scores at slaughter The refore, our objectives were to evaluate the effects of post EW calf management systems on growth performance muscle gene expression and carcass characteristics of beef steers

PAGE 59

59 Materials and Methods All procedures for the 2 yr study (2011 and 2012) conduct ed at the Range Cattle Research and Education Center (RCREC; Ona, FL ; 27 ) were approved by the University of Florida, Institute of Food and Agricultural Scien ces, Animal Research Committee Animals and D iets Seventy eight Brahm an x British crossbred steers (n = 40 and 38 steers in yr 1 and 2, respectively) were utilized to evaluate the effe cts of calf management systems following EW on growth performance muscle gene expression and carcass characteristics of beef steers. The stu dy was initiated on the day of EW ( d 0; January 11 and 25 for yr 1 and 2, respectively) On d 0, steers were stra tified by BW and age (mean BW = 95 14 kg; age = 74 14 d), and randomly assigned to a control treatment that was normally weaned on d 180 (N W; n = 10 steers annually), or to 1 of 3 EW treatmen ts : (1) EW and grazed on annual ryegrass ( Lolium multiflorum ) pastures until d 60 (yr 1; n = 10 steers) or 90 (yr 2; n = 8 steers) then on bahiagrass ( Paspalum notatum ) pastures until d 180 (EWRG), (2) E W and limit fed a high concentrate diet in drylot until d 180 (EW180; n = 10 steers annually), or (3) EW and metabolically imprinted by limit feeding a high concentrate diet in drylot until d 90 then grazed on bahiagrass pastures until d 180 (EW90; n = 10 steers annually). Following treatment assign ment, NW cow calf pairs returne d to their respective bahiagrass pastures whereas EW steers remained in the cow pens for 7 d with free choice access to long stem stargrass ( Cynodon nlemfuensis ) hay, water and a preconditioning receiving ration rina Feed LLC, Gray Summit, MO; as fed basis : 14 % CP 2 % NPN, 1.0 % fat, 18 % fiber, 0.75 % Ca, 0.40 % P, and 0.40 % NaCl). Average consumption

PAGE 60

60 of the preconditioning concentrate was 0.90 kg / calf d aily ( as fed) and n o health problems were reported during the preconditioning period. On d 7, EW steers were allocated to their respective treatments. I n order to avoid confounding effects with maternal plane of nutrition during gestation, all cow s used in yr 1 w ere not utilized in yr 2. Calves in drylot were gradually adapted to the final high concentrate diet over a 14 d period The adaptation d iet (Table 3 1) w as offered from d 7 to 20, starting at 1.5 % of BW (as fed basis) and then gradually increased to p rovide ad libitum consumption (average intake, as fed = 3.2 0.79, and 3.4 0.92 % of BW in yr 1 and 2, respectively) On d 21, steers were transitioned to the final high concentrate diet (Table 3 1), with the average intake from d 21 to 59 being 4.2 0. 80 and 4.2 0.72 % of BW in yr 1 and 2, respectively. Two cases of bloat were detected on d 59 of yr 1. T hereafter, the final hi gh concentrate diet was limit fed at 3.5 % of BW (as fed) and chopped stargrass hay was top dressed at 0.45 kg/steer daily (as f ed) for the remaining period in drylot S imilar bunk management was applied in yr 2, even though no cases of metabolic disorders were detected. O n d 90 EW90 steers were transferred to bahiagrass pastures and the high concentrate diet offer was gradually decreased from 3.5 to 1.0 % of BW (0.5 % of BW every 5 d) During the respective grazing period (d 0 to 180 and 90 to 180 for EWRG and EW90 steers, respectively) EWRG and EW90 steers were supplemented with the final h igh concentrate diet at 1.0 % of BW (as fed) whereas NW steers did not receive concentrate supplementation from d 0 to 180. Free choice access to water and a complete commercial mineral/vitamin mix (Cattle Select Essentials Range, Lakeland Animal Nutrition, Lakeland, FL; 6.0, 0.10, 0.10, 0.30, 63 and 1.0 % of

PAGE 61

61 Ca, K, Mg, S, NaCl and P, respectively, and 50, 1,500, 800, 210, 500, 40 and 3,000 mg/kg of Co, Cu, Fe, I, Mn, Se and Zn, respectively ) were provided t o steers throughout the study Ryegrass herbage allowance was below 0.50 kg of DM/kg of c alf BW and not sufficient for a complete 90 d grazing period in yr 1, so steers were transferred to bahiagrass pastures 30 d prior to the estimated date (d 60 of yr 1) From d 0 to 60 (yr 1) and 90 (yr 2), EWRG steers were allocated into 1 of 2 ryegrass pa stures (0.3 ha each) using a fixed and continuous stocking rate ( n = 5 and 4 EWRG steers/pasture in yr 1 and 2, respectively). From d 90 to 180, EW 90 and EWRG steer s were allocated i nto 1 of 4 bahiagrass pastures (0. 4 ha each ; 2 pastures/treatment ) in a fix ed and continuous stocking rate ( n = 5 EW90 steer s/ pasture in both yr, and 5 and 4 EWRG steers/pasture in yr 1 and 2, respectively). Calves were not implant ed throughout the study and were vaccinated on d 60 and 180 against Mannheimia haemolytica (2 m L subcutaneous; One Shot; Zoetis Animal Health New York, NY) in fectious bovine rhinotracheitis bovine virus diarrhea (Type 1 and 2), parainfluenza 3 virus and bovine respiratory syncytial virus (2 mL i ntramuscular; Bovi Shield Gold 5; Zoetis Animal Heal th Exton, PA ) Clostridium Chauvoei Septicum Haemolyticum Novyi Sordellii Perfringens Types C and D (5 mL subcutaneous; Ultraback 8; Zoetis Animal Health, Exton, PA) and treated for internal parasites (10 mL oral; Safeguard; Merck Animal Health, Summit, N J). On d 180 of yr 1, NW steers were weaned and transferred i nto 1 of 2 bahiagrass pastures ( 0.4 ha each ) Steers in yr 2 were not sent to the feedlot finishing period and therefore, the study was terminated on d 180. From d 180 until the time of shipping (d

PAGE 62

62 270), NW, EW90 and EWRG steers remained on bahiagrass pastures receiving the final high concentrate diet at 1.0 % of BW (as fed), whereas EW180 steers remained in drylot and were limit fed the final high concentrate diet at 3.5 % of BW (as fed). On d 2 7 0 all steers were loaded onto a commercial livestock trailer and transported for approximately 1 400 km to the feedlot facility at Virginia Tech University ( McCormick farm, Steeles Tavern VA). Immediately f ollowing transportation (d 271) steers were ind ividually weighed and then remained on tall fescue ( Festuca arundinacea ) pastures for 3 d with free choice access to corn silage (38.2 % DM; 8.9 % CP, 71.2 % TDN, 23.8 % ADF, 40.8 % NDF, 32.7 % starch, 46.2 % NFC, 0.19 % Ca, 0.25 % P, 0.17 % Mg and 1.09 % K; DM basi s). On d 274, steers were transferred to the feedlot facility (1 pen/trt) and individually fed in Calan gate feeders (American Calan Inc., Northwood, NH) until the time of slaughter, which occurred when steers achieved 1.27 cm of backfat (BF) thickness A ll steers, except for EW180 steers, were transitioned from a 90 % corn silage based diet to the final finishing diet (70 % concentrate and 30 % corn silage; as fed basis) by gradually increasing the concentrate inclusion over 56 d (15 percentage points every 14 d; Table 3 1). Because EW180 steers were on a high concentrate diet prior to the finishing phase, the diet adaptation for EW180 steers was faster and included only one adaptation diet (60 % con centrate and 40 % corn silage; a s fed b asis) that was provid ed for 28 d prior to the final finishing diet. All diets were offered in amounts to ensure ad libitum consumption until the time of slaughter Data C ollection Steers were individually weighed every 30 d from d 0 to 270 and every 28 d from d 274 until slau ghter, following a 6 h period of feed and water withdrawal. On d 0, 3 steers/t reatment were randomly selected for muscle biopsies on d 90 and 180.

PAGE 63

63 F ollowing the techniques described by Arthington and Corah (1995), m uscle samples were collected via needle b iopsy from Longissimus dorsi muscle between the 11 th and 12 th rib and always collected from the right side of steers. Immediately after collection, ap proximately 100 mg of wet muscle tissue was placed in to 1 mL of RNA stabilization solution (RNAlater, Am bion Inc., Austin, TX), then kept on ice for 6 h and stored at 8 0C. Muscle biopsies were collected following the 6 h period of feed and water withdrawal. Blood samples were collected via jugular venipuncture in sodium heparin (158 USP) containing tubes (Vacutainer, Becton Dickinson, Franklin Lakes, NJ) on d 90 and 180 of yr 1 and 2, and d 270, 271, 274 and 278 of yr 1 only In yr 1, blood samples were collected on d 90, only from steers selected for liver biopsies, but from all steers on d 180 of yr 1 and d 90 and 180 of yr 2. Blood samples were im mediately placed on ice after collection and then centrifuged at 1,200 g for 25 min at 4 C. Plasma was stored frozen at 20 C until laboratory analysis. Herbage mass (HM) was determined monthly from d 0 to 180 as describe d by Vendramini and Arthington (2008). Average herbage allowance (HA) w as c alculate d as the average HM (kg of DM /ha) multiplied by the area of each experimental unit (ha), and divided by total calf BW (kg) on the experimental unit (Sollenberger et al., 2005). H and plucked samples of pas tures were collected monthly from d 0 to 390. These samples were dried at 60C in a forced air oven for 72 h, and ground in a Wiley mill (Model 4, Thomas Wiley Labora tory M ill, Thomas Scientific, Swedes boro, NJ) to pass a 1 mm stainless steel screen Ryegr ass CP was calculated as 6.25 x N concentration, which was measured using modifications of the aluminum block digestion technique (Gallaher

PAGE 64

64 et al., 1975). In vitro OM digestibility (IVOMD) concentration was determined by the 2 stage procedure developed by Tilley and Terry (1963) and modified by Moore and Moot (1974). Average n utritiv e value of ryegrass pastures was 18 % CP (DM basis) and 73 % IVOMD. Bahiagrass pasture and stargrass hay samples were pooled by yr and sent in duplicate to a commercial laborator y for wet chemistry analysis (Dairy One Laboratory, Ithaca, NY). Average nutritive value (DM basis) of bahiagrass pastures and stargrass hay were 10.9 and 8.3 % CP and 42.4 and 50 % TDN respectively During the finishing phase, s teers were trained to eat fr om to Calan feeder f rom d 274 to 302. T hus, individual DMI was not obtained and only average DMI of each pen was reported. Thereafter, individual feed intake was obtained daily and DMI was estimated using the daily feed intake (as fed) multiplied by the average DM concentration of corn silage and concentrate. In yr 1 and 2, steers were scanned twice between the 12 th and 13 th ribs on d 30, 1 80 and 270 (yr 1 only) using an Aloka real time ultrasound scanner (3.5 MHz linear array transducer, Aloka 500V, C orimetrics Medical Systems, Inc., Wallingford, CT ). Carcass images were used to assess the longissimus muscle area and BF thickness. Hot carcass wt, BF thickness, percen tage of kidney, pelvic and heart fat (KPH), longissimus muscle area, marbling score s an d USDA quality grade were determined by a trained personnel 48 h after slaughter. Plasma and Muscle Tissue A nalysis Plasma samples collected on d 90 and 180 were u tilized to determine the plasma concentrations of IGF 1 u sing a human specific commercial ELI SA kit (SG100; R&D Systems, Inc., Minneapolis, MN) with 100 % cr oss reactivity with bovine IGF 1 and previously validated for bovine samples as described by Moriel et al. (2012) In each

PAGE 65

65 ELISA plate, a standard plasma sample was assayed in quadrup licate to calculat e the inter and int r a assay CV for IGF 1 assays which were 7.9 and 3.2 % respectively Plasma concentrations of haptoglobin were determined in duplicate, using a biochemical assay that measur ed the haptoglobin hemoglobin complex by the estimation of differences in peroxidase activity (Makimura and Suzuki, 1982). Results were obtained as arbitrary units resulting from the absorption reading at 450 nm and converted into mg/mL, as described by Cooke and Arthington ( 2012). Inter and intra a ssay CV f or haptoglobin assays were 3.9 and 4.3 % respectively. Plasma ceruloplasmin oxidase activity was measured in duplicate samples by using the colorimetric procedures reported by Demetriou et al. (1974) and expressed as mg/dL as described by King (1965). I nter and intra a ssay CV for ceruloplasmin assays were 3.6 and 2.2 % respectively. Muscle tissue was homogenized using 10 mL of STAT 60 (Tel Test Inc., Friendswoods, TX) and a mechanical tissue disruptor, followed by nucleic acid extraction with 2 mL of chloroform, RNA precipitation by isopropanol, and pellet formation after centrifugation (10,000 g for 10 min). Thereafter, RNA purification was performed using TRIzol Plus RNA Purif ication Kit (Invitrogen, Carls bad, CA). The quantity and quality of extra cted RNA were measured via UV absorbance at 260 nm and 260/280 nm ratio, respectively (GeneQuant spectrophotometer, Amersham Ph armacia Biotech, Cambridge, UK). O nly RNA samples containing a 260/280 ratio above 1.9 were used for further analysis, whereas RN A samples containing ratio less than 1.9 were discarded and the respective muscle tissue sample was selected for a second RNA extraction. As described by Gonzalez et al. (2008), r eal time reverse

PAGE 66

66 transcription PCR analysis were performed to assess the mRN A expression of IGF 1, IGF 1 receptor (IGF1R), paired box gen e 7 (Pax 7) and peroxisome proliferator activated using bovine specific primer sets (Table 3 2 ). Primers were designed using the Primer BLAST ( http://www.ncbi.nlm.nih.gov/tools/primer blast/ ), and p rimer efficiency was eva lua ted using serial dilutions of cDNA. Threshold cycle (Ct) valus for r ibosomal protein P0 (RpP0) d id not differ among treatments ( P 0.48) and were used as the housekee values and subsequent calculation of the relative f old change (2 t ), as described by Ocn Grove et al. (2008). A standard RNA sample was included in each PCR plate for the intra and inter CV calculations. Intra and inter assay CV were, respectively, 0.8 and 6.8 % for RpP0, 1.3 and 1.3 % for IGF 1, 1.2 a nd 2.9 % for IGF1R, 2.0 and 3.6 % for Pax7 and 2.1 and 2.9 % for PPAR assays Statistical A nalysis All d ata were analyzed as a completely randomized design using the MIXED procedure of SAS (SAS Institute Inc., Cary, NC, USA, version 9.2) with Satterthwaite approximation to dete rmine the correct denominator degrees of freedom for the test of fixed effects Pen was the experimental unit. Body weight of steers on d 0 was included as a covariate for BW and ADG analysis. Pen(treatment x yr) and steer(pen) were u sed as the random effects in all data, except for pasture evaluation, which included pasture(treatment x yr) as the random effect. As suggested by Owens et al. (1993), t he growth curve of steers was divided into 2 periods (d 0 to 90 and 90 to 180) in orde r to better determine when treatments responses were evident. Monthly BW of steers within each growth period, pasture evaluation, and plasma concentrations of ceruloplasmin and haptoglobin were analyzed as repeated measures. The c ovariance structures were

PAGE 67

67 selected based on the lowest Akaike information criterion. The compound symmetry covariance structure was used for growth performance and pasture evaluation, whereas the autoregressive covariance structure was used for plasma concentrations of ceruloplasmi n and haptoglobin. Average daily gain, BF thickness longissimus muscle area and muscle gene expression were tested for fixed effects of treatment, yr and its interaction. If treatment x time x yr effect was detected ( P 0.10) then treatment x time effec t s w ere analyzed separately within each yr. All results are reported as least squares means. Data were separated using the PDIFF if a significant preliminary F test was detected. Significance was set at P 0.05, and tendencies if P > 0.05 and 0.10. Resu lts and Discussion A treatment x time x yr effect was detected ( P = 0.02 ) for BW of steers from d 0 to 90 a nd thus, growth performance was tested separately within each yr. Treatment x time effects were detected ( P 0.00 3 ) for BW from d 0 to 90 in both y r. From d 30 to 90 of yr 1, EW180 and EW90 steers were heaviest ( P < 0.0001), whereas EWRG steers had greater BW on d 60 ( P = 0.003) and similar BW on d 90 ( P = 0.22) compared with NW steers (Figure 3 1) From d 0 to 90 of yr 2, EWRG and NW steers had si milar BW ( P 0.11), but both were lighter ( P 0.05) than EW 180 and EW90 steers on d 90 (Figure 3 2) These results reflect the annual differences on ADG from d 0 to 60 of NW steers (Table 3 3) Early weaned steers on ryegrass pastures had similar ( P = 0.80) ADG from d 0 to 60 in yr 1 vs. 2. However, NW steers had greater ( P = 0.000 2) ADG in yr 2 vs. 1 which result ed in similar BW from d 0 to 60 of yr 2 compared with EWRG steers Although initial ryegrass HM and HA were greater than previously reported by others (Ven dramini and Arthington, 2007), the average amount of rainfall received from

PAGE 68

68 d 0 to 60 in yr 1 and 2 were, respectively, 85 and 74 % of the average rainfall received during 2010 (261, 222 and 193 mm for 2010, 2011 and 2012, respectively) and influenced the subsequent HM production (Table 3 4). In yr 1, ryegrass HM after 60 d of grazing was 396 kg of DM/ha and was not sufficient f or the remaining grazing period. H ence, EWRG steers were transferred to bahiagrass pastures 30 d earlier than expected. Likewise, ryegrass HM and HA on d 70 of yr 2 were 980 kg of DM/ha and 0.47 kg of DM/kg of BW, respectively. The HA on d 70 of yr 2 was slightly below the threshold of 0.50 kg of DM/kg of BW that was previously reported to limit the growth performance of EW calves (V endramini et al., 2006) and likely explain s the lesser ADG from d 60 to 90 of EWRG vs. NW steers (Table 3 3). Nevertheless, those results indicate that the gr owth performance of EW calves may be similar or better than NW calves during the first 3 mo foll owing EW if high nutritive diets similar to those used in our study are provided. Bahiagrass HM decreased ( P 0.05) from d 105 to 165 and increased from d 165 to 195 (Table 3 4). Sollenberger and Moore (1997) demonstrated that when forage is the sole source of nutrients for grazing cattle, HA less than 1.0 kg DM / kg of BW is insufficient for ad libitum consumpti on. Further, forage intake decreases if concentrate supplementation is above 0.5 % of BW (Horn and McCollum, 1987). T he bahiagrass HA ranged from 0.84 to 3.13 kg of DM/kg of BW (Table 3 4), and hence it was adequate for ad libitum consumption for steers su pplemented with concentrate at 1.0% of BW Bahiagrass HA was always greater ( P 0.05) for EWRG vs. EW90 steers in yr 2, but similar ( P may be attributed to EWRG steers being lighter ( P < 0.0001) than EW90 steers in yr 1,

PAGE 69

69 and the lesser stocking rate of EWRG treatm ent in yr 2 vs. 1 (10 vs. 12.5 steers/ha, respectively). Nevertheless, EW180 steers were always heaviest ( P < 0.0001) at the time of NW (d 180). On d 180 of yr 1, EWRG steers were lightest ( P < 0.0001) and EW90 steers heavier ( P = 0.05; Figur e 3 1 ) than N W steers, whereas EW90, EWRG and NW steers had similar BW on d 180 of yr 2 ( P 0.14; Figure 3 2 ). Thus, placing EW steers on ryegrass pa stures for 60 to 90 d or on a high concentrate diet in drylot for at least 90 d resulted in similar or greater growth performance compared to NW steers, and were good alternatives for calf manage ment system s following EW. The somatotropic axis is an essential constituent of multiple systems controlling growth (Le Roith et al., 2001) L iver is the primary source of cir culating IGF 1 (Ya kar et al., 1999 ) a lthough IGF 1 can be synthesized by almost every body tissue (Le Roith et al., 2001) In the present study, plasma concentrations of IGF 1 were similar ( P among NW, EW180 and EW90 steers, and least ( P for EWRG steers on d 90 (Table 3 5) On d 180 plasma concentrations of IGF 1 were greatest ( P EW180 steers and similar ( P 5). Circu lating concentrations of IGF 1 increases as nutrient intake and growth rate increase (Smith et al., 2002; Radcliff et al., 2004 ; Moriel et al., 2012 ). In agreement, plasma concentrations of IGF 1 tended ( P = 0.07) to be positively correlated with ADG from d 90 to 180 (Table 3 6). The lack of positive correlation between ADG from d 0 to 90 and plasma concentrations of IGF 1 on d 90 (Table 3 6), and the similar plasma concentrations of IGF 1 between NW and EW steers in drylot, likely reflect the age dependent production of IGF 1. Badinga et al. (1991) observed that the binding of GH to

PAGE 70

70 its hepatic rec eptor increased from d 0 to 180 d of age leading to greater hepatic synthesis of IGF 1 as calves developed Although nutrition affects the concentrations of IGF 1 in blood, inconsistent effects of nutrition on local expression of I GF 1 have been reported. Muscle expression of IGF 1 mRNA was greater for fed vs. fasted chickens (Guernec et al., 2004). Conversely, Smith et al. (2002) reported that newborn calves with increased nutrient intake had greater plasma concentrations of IGF 1, but no effect on semitendinosus muscle expression of IGF 1 Cooke et al. (2008) reported that increasing the frequency of concentrate supplementation increased the ADG of beef heifers, but did not affect the longissimus muscle expression of IGF 1. In agreement longissimus muscle expression of IGF 1 mRNA did not differ ( P on d 90 and 180 (Table 3 5). The participation of circulating IGF 1 on growth has been questioned (Yakar et a l., 1999; LeRoith et al., 2001). However, recent studies suggest that hepatic IGF 1 also affects growth (Nordstrom et al. 2011) with local expression of IGF 1 having greater participation on mus cle growth compared with hepatic IGF 1 (Ya kar et al., 1999) In our stud y, the numerical differences on muscle expression of IGF 1 (Table 3 5) corresponded with differences on ADG ( Table 3 3). Also, muscle expression of IGF 1 mRNA on d 90 and ADG from d 0 to 90, as well as, plasma concentrations of IGF 1 on d 180 and ADG from d 90 to 180 were positively correlated ( P 6), which further suggests that both local and hepatic IGF 1 may be involved on growth of cattle. Activity of IGF 1 is modulated by the binding of IGF 1 to its binding proteins and IGF1R (Thissen et al., 1994; Le Roith et al., 2001) In th e present study, muscle mRNA expression of IGF1R on d 90 was greater ( P = 0.06) for EW180 vs. EW90 steers, but

PAGE 71

71 both greater ( P P = 0.67) IGF1R mRNA expression (Table 3 5) On d 180, a treatment x yr effe ct was detected ( P = 0.0006) for muscle expression of IGF1R In yr 1, muscle mRNA expression of IGFR was greater ( P = 0.005) for NW vs. EW180 steers, and both were greater ( P 0.05) than EW90 and EWRG steers, which had similar ( P = 0.96) IGF1R mRNA expres sion (Table 3 5). However, muscle mRNA expression of IGF1R did not differ ( P 0.65) among treatments in yr 2 Despite the greater IGF1R mRNA expression for NW steers on d 90, the observed differences on IGF1R mRNA expression like ly reflect the differences on nut ritional status and growth rate. I n support, IGF1R mRNA expression on d 90 was positively correlated with ADG from d 0 to 90 (Table 3 6). Likewise, Vesteergard et al. (2003) reported that p repubertal heifer s assigned to recei ve free choice access to a high concentrat e based diet for 5 wk had greater ADG and longissimus muscle IGF1R density than heifers provided roughage based diet. The binding of IGF 1 to IGF1R triggers a cascade of intracellula r events (Thissen et al., 1994) that ultimately lead to insulin like effects, including enhanced glucose and amino acid uptake (Dimitriadis et al., 1992) muscle protein synthesis and decreasing muscle protein degradation (Dayton and White, 2008) In growi ng cattle, the accretion rate of longissimus m uscle was positively correlated with serum concentrations of IGF 1 and IGF1R density (Vesteergard et al., 2003). Thus, our results indicate that the enhanced growth performances of EW180 and EW90 steers from d 0 to 90, and of EW180 and NW steers from d 90 to 180 w ere mediated by an increase on IGF1R that likely provided additional binding sites for local and system ic IGF 1

PAGE 72

72 P ostnatal muscle growth occurs through hypertrophy of existing muscle fibers (Dayton and White 2008), which are unable to divide and requires additional nuclei adhesion. Nearly 60 to 90 % of DNA found in skeletal muscle fibers is provided by satellite cells that accumulated during postnatal growth (Allen et al., 1979). T he expression Pax7 is re quired for bovine satellite cell specification and s urvival (Seale et al., 2000 ; Relaix et al., 2006), and is widely used as a marker for both quiescent and activated satellite cells (Li et al., 2011). In our study, a treatment x yr effect was detected ( P = 0.04) for Pax7 mRNA expression on d 180, but not ( P = 0.58) on d 90 (Table 3 5). On d 180 of yr 1, EW180 steers had greater ( P expression of Pax 7 than NW, EW90 and EWRG steers. I n yr 2, NW steers had greater ( P ( P = 0.22) expression compared with EW180 steers (Table 3 5) Besides en hancing the net muscle protein accretion, IGF 1 also stimulates the proliferation of satellite cells (Florini et al., 1996; Oskbjerg et al., 2004). In agreement, plasma concentrations of IGF 1 on d 180 tended ( P = 0.10) to be positively correlated with mus cle mRNA expressi on of Pax7 (Table 3 6). Further, positive correlations were detected between muscle mRNA expression of Pax7 and ADG, and muscle expression of Pax7 and IGF1R on d 90 and 180 (Table 3 6). However, muscle mRNA expression of Pax7 did not diffe r ( P = 0.32) among treatments on d 90. Li et al. (2011) reported that the number of bovine satellite cells of young animas declined at a faster rate than progenitor cells from adult animals, and also that this decline coincided with satellite cells undergo ing differentiation as indicated by the parallel increase in myogenin expression Insulin like growth factor 1 also stimulates satellite cell differentiation (Florini et al., 1996; Oskbjerg

PAGE 73

73 et al., 2004), and o nce differentiated, satellite cells do not ex press Pax7 (Perdiguero et al., 2009). Thus, it is plausible that the lack of treatment effects on muscle expression of Pax7 on d 90 may have been a re sult of EW180 and EW90 steers having a greater population of satellite cells undergoing differentiat ion a nd consequently, decreased mRNA expression of Pax7. Long term effects of post EW calf management on carcass quality of beef steers have been reported (Myers et al., 1999a,b; Arthington et al., 2005; McCann et al., 2011). In a 2 yr study, Myers et al. (199 9a) reported that providing high concentrate diets to beef steers at 177 vs. 213 d of age enhanced the marbling scores, which is likely a result of early adipocyte differentiation and fatty acid accumulation ( Schoonmaker et al., 2003; Harper and Pethick, 2 004). The expression promotes terminal differentiation of adipocytes by up regulating a wide range of genes associated with triglyceride s uptake and storage (Rosen and MacDougald, 2006). In the present study, PPAR mRNA expression on d 90 tended ( P = 0.07) to be grea ter for EW180 steers and was greater ( P = 0.008) for EW90 steers compared to EWRG steers, but similar ( P = 0.25) between EW180 and NW steers (Table 3 5) On d 180, muscle mRNA expression of PPAR was greater ( P and EWRG stee rs. In addition, positive correlations were detected ( P 1 on d 90 and 180 (Table 3 6). Those responses are likely due to local and systemic actions of I GF 1, which has been shown to enhance the proliferation and differentiation of preadipocyte s (Hausman et al., 2001). Thus, early exposure to high concentrate diets enhanced the growth performance of EW calves, and induced early

PAGE 74

74 differentiation of adipocyte s, as indicated by the greater expression of PPAR It was hypothesized that via metabolic imprinting effects, the muscle mRNA expression of PPAR would be permanently expressed at high levels in EW90 steers, and consequently stimulate greater adipocyte differentiation compared with steers on pasture. However, muscle mRNA expression of PPAR on d 180 was similar ( P = 0.71) between EW90 vs. NW and EWRG steers (Table 3 5). Therefore, long term effects caused by the short term exposure of beef steers to high concentrate diets immediately following EW wer e not detected for muscle mRNA expression of and other growth related genes analyzed in the present study. Normally weaned steers in yr 1 had the least ( P 0.0006) ADG and EW180 steers had the greatest ( P < 0.0001) ADG, whereas EW90 and EWRG had si milar ( P = 0.72) and intermediate ADG from d 180 to 270 (Table 3 3). The decreased ADG of NW steers following weaning is in agreement with others (Arthington et al., 2005; 2008) and is likely attributed to the stress of weaning and transition to a new die t inducing an inflammatory response and muscle tissue mobilization. At the time of shipping and at the start of the finishing period, EW180 steers were heaviest ( P < 0.0001), EW90 steers intermediate, and EWRG and NW steers lightest ( P 0.0008; Table 3 7). Pre shipping calf management systems did not affect ( P = 0.39) the percentage of BW loss following transportation (Tab le 3 7). However, EW180 steers began the finishing period with greater ( P 0.003) BF thickness and longissimus musc le area compared to NW, EW90 and EWRG steers (Table 3 3). Despite the 90 d period on a high concentrate diet, EW90 steers had similar ( P = 0.32) BF thickness compared to NW steers, which may

PAGE 75

75 suggest that EW90 and NW steers had a similar degree of fatness a t the start of the finishing phase. From d 274 to 302, EW180 steers had the least ADG ( P 0.09), whereas EW90 steers had similar ( P = 0.19) ADG compared with EWRG steers, but greater ( P = 0.03) ADG than NW steers. Arthi ngton et al. (2005) demonstrated that EW calves ( 89 d of age ) supplemented with concentrate at 1.0 % of BW on annual and peren ial pastures for 211 d prior to feedlot entry, had similar DMI, but greater ADG (0.87 vs. 0.40 kg/d) and feed efficiency (0.15 vs. 0.08) during the post weaning receiving period compared to NW calves ( 300 d of age ) These responses were attributed to the lesser inflammatory response as indicated by the lesser plasma concentrations of ceruloplasmin and haptoglobin in EW vs. NW steers (Arthington et al., 2005). In the present study, a treatment x time effect was detected ( P = 0.0002) for plasma concentrati ons of ceruloplasmin (Figure 3 3) On d 27 0, EW180 steers had lesser ( P < 0.06) plasma ceruloplasmin concentrations than EW90 and EWRG steers, but similar ( P = 0.17) plasma ceruloplasmin concentrations compared with NW steers. On d 27 8, EW180 steers had gr eater ( P plasma ceruloplasmin concentrations than NW, EW90 and EWRG steers. A tendency for a treatment x time effect was detected ( P = 0.10) for plasma concentrations of haptoglobin (Figure 3 4) On d 271 EWRG steers tended ( P = 0.09) to have greater plas ma haptoglobin concentrations than NW steers and had greater ( P On d 27 8, NW tended ( P = 0.10) to have greater plasma haptoglobin concentrations than EWRG steers and had greater ( P .03) plasma haptoglobin concentrations than EW90 and EW180 steers. In the present study, NW calves were weaned approximately

PAGE 76

76 90 d prior to feedlot entry, which may have alleviated the inflammatory response during the post weaning receiving period Further, plasma concentrations of ceruloplasmin and haptoglobin are influenced by dietary concentrations of Cu (Arthington et al., 1996) and metabolizable protein supply (Moriel and Arthington, 2013), and thus the fluctuating plasma concentrations of these protei ns may be a reflection of differences on dietary composition and DMI during the first wk of the finishing period. Nonetheless, the greater plasma ceruloplasmin concentrations of EW180 steers on d 27 8 and the greater plasma concentrations of haptoglobin f or NW steers on d 278 compared to EW90 and EWRG steers indicate a greater inflammatory response, and partially explain the enhanced growth performance of EW90 and EWRG steers during the first 28 d of the finishing phase. From d 303 to slaughter, ADG and feed efficiency (G:F) did not differ ( P 0.18) among treatments. However, DMI did not differ ( P = 0.33) among NW, EW180 and EWRG steers, but was greatest ( P 0.0 5) for EW90 steers (Table 3 5) This may be attributed to the previous experience with concen trate feeding in concrete bunk s It was expected that EW180 steers would also express greater DMI during the receiving period due to the previous experience with concrete bunks. H owever, EW180 steers did not consume the corn silage based diet promptly, lik ely because these steers have been exposed to high concentrate diets with high concentrations of DM for most of the study In agreement, Fluharty and Loerch (1996) demonstrated that calves initially prefer diet s that are similar in moisture and texture to feeds with which they were familiar. Creep fed calves exposed to a dry corn and alfalfa pellet diet during the postweaning receiving period had greater DMI and ADG than calves not creep fed. However, when calves

PAGE 77

77 were fed corn silage based diets during th e receiving period n on creep fed calves had greater DMI and ADG compared with creep fed calves (Fluharty and Loerch, 1996). Overall, carcass characteristics were not affected by previous the calf management system. Backfat thickness, B W at slaughter, hot carcass wt and yield grade did not differ ( P 5). Lon gissimus muscle area was greatest ( P and tended to be greater ( P for EW90 vs. NW and EWRG steers. However, longissimus muscle area did not diff er ( P = 0.27) among treatments after covariate adjusted for hot carcass wt. It was hypothesized that EW steers provided high concentrate diets immediately following EW would have enhanced marbling scores compared to NW steers. However, marbling scores at the time of slaughter did not differ ( P = 0.75) among treatments (Table 3 7). Further, we also hypothesized that a short term exposure to high concentrate diets immedia tely after EW and followed by pasture grazing until the finishing period in the feedl ot would cause imprinting effects and lead to carcasses with similar marbling scores compared with EW180, but greater than NW steers. Despite the earlier adipocyte differentiation 5 ), marbling scores at the time of slaughter did not differ between EW90 and NW steers I n agreement Schoonmaker et al. (2003) reported greater intramuscular fat concentration at 218 d of age but similar marbling scores at slaughter of EW steers provided free choice access to high co ncentrate vs. high forage diets. Of 13 studies comparing carcass characteristics of EW vs. NW calves, only 6 studies reported greater marbling scores for EW vs. NW calves (yr 1 and 2 in Myers et al., 1999a; Schoonmaker et al., 2002b; Meyer et al., 2005; McCann et al., 2011; location 1 in Waterman et al., 2012c).

PAGE 78

78 Reasons for the inconsistent results among those studies may be attributed to the differences related to common end point at slaughter (BW, age or back fat thickness), c alf age at the start of the study, diet composition ( e.g. starch concentration), timing and quantity of steroid implant ation and interaction among those factors. In conclusion, early weaned steers provided a high concentrate d iet in drylot, for at least 90 d were heavier at the time of normal weaning and at shipping than steers normally weaned at 250 d of age, and early weaned steers grazed on ryegrass pasture s for 60 to 90 d and supplemented with concentrate at 1.0% of BW Also, feeding a high concentra te diet immediately following early weaning enhanced the muscle expression of growth related and adipogenic genes which likely contributed to the enhanced growth performance of early weaned steers in drylot However, metabolic imprinting effects were not detected for muscle gene expression, c arcass characteristics and marbling scores at slaughter.

PAGE 79

79 Table 3 1. Ingredient and chemical composition of high concentrate diets provid ed to steers during the drylot (0 to 180) and grazing period (0 to 270), and co ncentrate provided during the finishing phase (d 274 to slaughter). Calf d iet Finishing Item Adaptation 1 Final 2 Concentrate 3 -------------% As fed basis -------------Cottonseed hulls 30.0 15.0 Cottonseed meal 18.5 15.7 Soybean hulls 15.6 21.0 Wheat middlings 6.5 8.8 36.5 Dried distillers grains + solubles 5.9 8.0 Corn gluten feed 10.5 Citrus pulp pellets 5.9 8.0 Cracked corn 5.8 7.8 Corn meal 5.8 7.8 50 Soybean meal 4.0 5.4 Sugarcane molasses 1.5 2.0 Corn gluten feed Calcium carbonate 0.37 0.50 2 Trace minerals 0.04 0.05 0.30 Bovatec 90 0.03 0.04 Vitamin E 0.01 0.02 Vitamin ADE premix 0.04 Rumensin 0.02 Tylan 0.05 Se 0.05 1 Adaptation diet was provided from d 7 to 20 in amounts to ensu re free choice consumption. 2 Final high concentrate diet was provided in amount s to ensure free choice consumption from d 21 to 59. Starting on d 60, final diet was limit fed at 3.5 % of BW (as fed) for the remaining period in drylot. Final high concentrat e diet was used as th e supplement for steers on pasture. 3 Finishing concentrate was included at 70% (as fed) of the finishing high concentrate diet (30% corn silage; as fed basis).

PAGE 80

80 Table 3 1. Continued Calf d iet Finishing Item Adaptation 1 Final 2 Concentrate 3 ----------DM basis 4 ----------DM, % 90.0 87.6 88.3 TDN 5 % 72.0 74.0 76.3 ME 6 Mcal/kg 2.60 2.65 2.67 NEm, Mcal/kg 1.70 1.74 1.76 NEg, Mcal/kg 1.10 1.14 1.09 CP, % 19.9 22.9 12.1 RDP, % of CP 70.0 67.0 ND NDF, % 49.0 41.6 ND peND F, % of NDF 33.0 20.0 ND ADF, % 36.7 29.3 ND Ca, % 0.61 0.90 0.89 P, % 0.54 0.68 0.50 Mg, % 0.37 0.46 0.21 K, % 1.23 1.53 0.57 Na, % 0.10 0.24 0.26 Fe, mg/kg 253 269 38 Zn, mg/kg 60.0 62.0 11 Cu, mg/kg 10.0 10.3 6.3 Mn, mg/kg 40.0 46.0 10.7 Mo, mg/kg 0.80 0.93 ND ND = not determined. 1 Adaptation diet was provided from d 7 to 20 in amounts to ensure free choice consumption. 2 Final high concentrate diet was provided in amount s to ensure free choice consumption from d 21 to 59. Starting on d 60, final d iet was limit fed at 3.5 % of BW (as fed ) for the remaining period in drylot. Final diet was used as th e supplement for steers on pasture. 3 Finishing concentrate was included at 70% (as fed) of the finishing high concentrate diet (30% corn silage; as fed ba sis). 4 Average chemical composition of samples collected every 2 mo and sent in duplicate to a commercial laboratory for wet chemistry analysis (Dairy One Laboratory, Ithaca, NY). 5 Calculated as described by Weiss et al. (1992). 6 Metabolizable energy valu es were calculated by back transforming NEg concentration of each feed, obtained from a commercial laboratory (Dairy One), to ME concentration using equations from NRC (2000).

PAGE 81

81 Table 3 2. Nucleotide sequence of bovine specific primers used in the quantit ative real time reverse transcription PCR to determine the longissimus muscle expression of ribosomal protein P0 (RpP0), IGF 1, IGF 1 receptor (IGF1R), p aired box gene 7 (Pax7) and peroxisome proliferator Target gene Primer se quence 1 Product size, bp Accession no. RpP0 227 NM_001012682.1 Forward 5 CAACCCTGAAGTGCTTGACAT 3 Reverse 5 AGGCAGATGGATCAGCCA 3 IGF 1 118 NM_001077828.1 Forward 5' TTGGTGGATGCTCTCCAGTTC 3' Reverse 5' AGCAGCACTCATCCACGATTC 3' IGF1R 105 NM_001244612.1 Forward 5' AAGAACCATGCCTGCAGAAGG 3' Reverse 5' GGATTCTCAGGTTCTGGCCATT 3' Pax7 146 XM_616352.6 Forward GGGCTCAGATGTGGAGTCAG Reverse GCTCCTCTCGGGTGTAGATG PPAR 172 NM_181024.2 Forward 5' TGCCATCAGGTTTGGGCGCAT 3' Reverse 5' CGCCCTCGCCTTTGCTTTGG 3' 1 Primer s sequence designed using primer BLAST.

PAGE 82

82 Table 3 3. Average daily gain 1 and carcass characteristics of beef steer s developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180). Treatment 2 P value Item 3 NW EW180 EW90 EWRG SEM Tr ea t ment Yr Tr eatment x Yr ADG, kg/d d 0 to 60 Yr 1 0.45 a 0. 90 c 0.96 c 0.64 b 0.050 < 0.0001 0.98 0.0005 Yr 2 0.71 b 0.82 c 0.80 b c 0.62 a P 4 0.0002 0.20 0.03 0.80 d 60 to 90 0.92 b 1.24 c 1.18 c 0.72 a 0.065 0.002 0.05 0.86 d 9 0 to 18 0 0. 91 b 1 29 c 0. 65 a 0.6 8 a 0.0 3 9 <0.0 00 1 0.1 5 0. 20 d 180 to 2 70 5 0.16 a 0.77 b 0.41 b 0.39 b 0.044 <0.0 00 1 Backfat thickness 6 cm d 180 0.33 0.36 0.34 0.34 0.012 0.34 0.98 0.60 d 270 5 0.34 a 0.39 b 0.35 a 0.34 a 0.007 0.0001 Longissimus muscle area 6 cm 2 d 180 40.7 a 51. 2 b 43.1 a 40.9 a 1.11 0.0003 0.92 0.60 d 270 5 44.5 a 57.2 c 48.1 b 42.0 a 1.35 0.005 a,b Within a row, means without common superscript differ ( P 0.05). 1 Calculated using shrunk BW after 6 h of feed and water withdrawal. 2 NW = steer s remained with cows until d 180; EW180 = steer s early weaned and limit fed a high concentrate diet in drylot until d 180; EW90 = steer s early weaned and metabolically imprinted by limit feeding a high concentrate diet in drylot until d 90 then grazed on bahiagrass pastures until d 180; EWRG = steer s early weaned, grazed on ryegrass pastures until d 60 (yr 1) or 90 (yr 2) then on bahiagrass pastures until d 180. From d 0 to 180, steers on pasture were supplemented with concentrate at 1.0 % of BW (as fed). 3 Means pooled by treatment if treatment x yr effect was not detected ( P > 0.10). 4 Yr comparison within each treatment. 5 Average daily gain of steers in yr 1 only. In y r 2, the study was terminated on d 180. 6 Mean of 2 carcass images obtained via ultrasound and m easured between the 12 th and 13 th rib.

PAGE 83

83 Table 3 4. Herbage mass and allowance of pastures grazed by beef steers from the time of early weaning (d 0) until the tim e of normal weaning (d 180). Day of study Effect Item 1 Yr 10 40 70 SEM Time Tr eatmen t x time x yr Ryegrass Herbage mass, kg DM/ha 2 381 c 20 59 b 6 88 a 73 0.0 1 Herbage allowance, kg DM/kg BW 2 08 c 1. 48 b 0. 47 a 0. 07 0.000 1 Day of study 105 135 165 195 Bahiagrass Herbage mass, kg DM/ha 5 418 d 2 599 b 25 32 a 3 371 c 103 < 0.0001 0. 37 Herbage allowance, kg DM/kg BW EW90 1 2. 38 c 1. 05 b 0 87 a 1.1 6 b 0.0 98 < 0.0001 0.0 7 EWRG 1 2 82 c 1. 26 b 1. 00 a 1. 34 b P 2 0. 009 0. 16 0. 37 0. 23 EW90 2 2.2 2 a 0 95 ab 0. 83 a 1.0 5 b EWRG 2 3. 13 c 1. 26 ab 1. 13 a 1. 41 b P 2 < 0.0001 0.0 4 0.0 5 0.0 3 a,b Within a row, means without a common superscript differ ( P 1 Means pooled by treatment if treatment x yr effect was not detected ( P > 0.10). 2 Treatment comparison within sampling day.

PAGE 84

84 Table 3 5. Plasma concentrations of IGF 1 and muscle mRNA expression 1 of genes associated with muscle and adipose tissue growth of beef steers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180). Treatment 2 P value Item 3 NW EW180 EW90 EWRG SEM Tr eatment Yr Tr eatment x Yr Plasma IGF 1, ng/mL d 90 106 b 128 b 109 b 75 a 9.6 0.10 0.01 0.15 d 180 101 a 130 b 88 a 97 a 8.6 0.04 0.72 0.93 Muscle IGF 1 d 90 0.63 1.42 1.30 1.05 0.418 0.27 0.63 0.88 d 180 1.02 1.45 0.87 1.18 0.226 0.39 0.69 0.19 Muscle IGF1R d 90 0.71 a 2.00 c 1.46 b 0.59 a 0.278 0.003 0.79 0.12 d 180 Yr 1 3.38 c 1.53 b 0.49 a 0.52 a 0.398 0.008 0.18 0.006 Yr 2 1.00 1.23 0.97 1.12 P 4 0.0006 0.60 0.40 0.30 a,b Within a row, means without common superscript differ ( P 0.05). 1 Muscle gene values expressed as relative fold change using ribosomal protein P0 as the housekeeping gene Samples were collected from Longissimu s dorsi muscle located above the 12 th and 13 th rib always at the right side of the animal. 2 NW = steer s remained with cows until d 180; EW180 = steer s early weaned and limit fed a high concentrate diet in drylot until d 180; EW90 = steer s early weaned and metabolically imprinted by limit feeding a high concentrate diet in drylot until d 90 then grazed on bahiagrass pastures until d 180; EWRG = steer s early weaned, grazed on ryegrass pastures until d 60 (yr 1) or 90 (yr 2) then on bahiagrass pastures until d 180. From d 0 to 180, steers on pasture were supplemented with concentrate at 1.0% of BW (as fed). 3 Means of yr 1 and 2 were pooled by treatment if treatment x yr effect was not detected ( P > 0.10). 4 Yr comparison within each treatment.

PAGE 85

85 Table 3 5. Continued Treatment 2 P value Item 3 NW EW180 EW90 EWRG SEM Tr eatment Yr Tr eatment x Yr Muscle Pax7 d 90 1 33 2 53 1 85 0 96 0. 614 0. 32 0. 58 0. 58 d 180 Yr 1 0.86 a 2.23 b 0.79 a 1.34 a 0.390 0.04 0.59 0.04 Yr 2 1.89 b 1.32 a b 0.77 a 0.71 a P 4 0.04 0.06 0.98 0.24 d 90 0.90 a b 1.41 b c 1.93 c 0.53 a 0.340 0.04 0.65 0.75 d 180 1.95 a 4.59 b 1.06 a 0.57 a 0.912 0.03 0.27 0.27 a,b Within a row, means without common superscript differ ( P 0.05). 1 Muscle gene values expressed as relative fold change using ribosomal protein P0 as the housekeeping gene Samples were collected from Longissimu s dorsi muscle located above the 12 th and 13 th rib always at the right side of the animal. 2 NW = steer s remained with cows until d 180; EW180 = steer s early weaned and lim it fed a high concentrate diet in drylot until d 180; EW90 = steer s early weaned and metabolically imprinted by limit feeding a high concentrate diet in drylot until d 90 then grazed on bahiagrass pastures until d 180; EWRG = steer s early weaned, grazed on ryegrass pastures until d 60 (yr 1) or 90 (yr 2) then on bahiagrass pastures until d 180. From d 0 to 180, steers on pasture were supplemented with concentrate at 1.0% of BW (as fed). 3 Means of yr 1 and 2 were pooled by treatment if treatment x yr effec t was not detected ( P > 0.10). 4 Yr comparison within each treatment.

PAGE 86

86 Table 3 6. Pearson correlation coefficients 1 ,2 among ADG, longissimus muscle mRNA expression of IGF 1, IGF 1 receptor (IGF1R), paired box gene 7 (Pax7), peroxisome proliferator ac IGF 1 concentrations of beef steers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180). ADG d 0 90 ADG d 90 180 IGF 1 d 90 IGF1R d 90 Pax 7 d 90 PPAR d 90 IGF 1 d 180 IGF1R d 180 Pax7 d 180 PPAR d 180 Plasma IGF 1 d 90 ADG d 90 180 0.29 0.18 IGF 1 d 90 0.50 0.17 0.02 0.44 IGF1R d 90 0.54 0.35 0.64 0.01 0 .11 0.00 08 Pax7 d 90 0.41 0.29 0.20 0.60 0.06 0.21 0.37 0.00 3 PPAR d 90 0.52 0.01 0.64 0.65 0.43 0.01 0.97 0.00 1 0.00 09 0.05 IGF 1 d 180 0.41 0.32 0.24 0.09 0.13 0.31 0.05 0.14 0.25 0.66 0.55 0.15 IGF1R d 180 0.14 0.12 0.03 0.12 0.07 0.17 0.08 0.52 0.58 0.87 0.59 0.77 0.43 0.72 Pax7 d 180 0.13 0.41 0.03 0.19 0.04 0.02 0.16 0.70 0.56 0.06 0.90 0.39 0.85 0.92 0.48 0.00 02 PPAR d 180 0.16 0.50 0.03 0.42 0.20 0.09 0.47 0.43 0.40 0.48 0.02 0.87 0.0 4 0.36 0.67 0.02 0.03 0.06 Plasma IGF 1 d 90 0.01 0.15 0.02 0.08 0.17 0.11 0.14 0.17 0.14 0.03 0.98 0.50 0.94 0.71 0.46 0.62 0.53 0.43 0.53 0.88 Plasma IGF 1 d 18 0 0.18 0.39 0.01 0.17 0.23 0.35 0.12 0.53 0.36 0.47 0.14 0.42 0.07 0.97 0. 45 0.32 0.11 0.59 0.01 0.10 0.02 0.53 1 Upper row = correlation coefficients; lower row = P values. 2 n = 24

PAGE 87

87 Table 3 7. Growth performance and carcass characteristics of beef steer s developed on different calf management systems from the time of early weani ng (d 0) until the time of normal weaning (d 180) in yr 1. Treatment 1 Item NW EW180 EW90 EWRG SEM P value BW kg d 270 245 a 391 c 295 b 245 a 11 <0.0001 d 271 228 a 360 c 277 b 229 a 10 <0.0001 Shrink, % of BW on d 270 6.9 7.9 6.0 6.4 0.76 0.39 d 274 232 a 366 c 286 b 235 a 10.3 <0.0001 ADG 2 kg/d d 274 to 302 1.26 b 1.03 a 1.57 c 1.39 bc 0.096 0.002 d 303 to slaughter 1.17 1.11 1.18 1.08 0.069 0.70 DMI 3 kg/d d 274 to 302 5.7 3.8 6.3 5.8 d 303 to slaughter 8.2 a 8.4 a 9.3 b 8.0 a 0.31 0.03 Gain:Feed d 274 to 302 0.22 0.27 0.25 0.24 d 303 to slaughter 0.14 0.13 0.13 0.14 0.005 0.18 Backfat thickness, cm 1.09 1.27 1.12 1.07 0.109 0.59 Days on finishing phase 202 b c 141 a 187 b 227 c 14.9 0.002 BW at slaughter, kg 473 514 508 484 16.2 0.22 Hot carcass wt, kg 295 321 320 301 10.2 0.22 Longissimus muscle area 4 cm 2 69.8 a 79.4 b 76.5 b 69.7 a 2.86 0.04 Adj. longissimus muscle area 5 cm 2 72.5 77.4 74.7 71.2 2.32 0.27 Kidney, pelvic and heart fat 4 % 2.39 a 3.05 b 2.25 a 2.33 a 0.169 0.005 Yield grade 3.12 3.15 2.98 3.14 0.196 0.91 Marbling 6 404 401 456 418 41.4 0.75 a,b Within a row, means without common superscript differ ( P 0.05). 1 On d 180, NW steers were weaned and supplemented with high concentrate die t at 1.0 % of BW until d 270, whereas EW steers remained on their respective treatments. Steers were unloaded on d 271 and remained on tall fescue pastures until d 273. From d 274 to slaughter, steers were provided free choice access to a high concentrate finishing diet (70 % concentrate and 30 % corn silage, as fed basis). 2 Calculated using shrunk BW after 6 h of feed and water withdrawal. 3 From d 274 to 302, steers were trained to eat from Calan feeder and t hus average DMI of each pen was reported. 4 Mean o f 2 carcass images from each animal obtained via ultrasound and m easured between the 12 th and 13 th rib 5 Covariate adjusted for hot carcass wt. 6 Modest = 400 to 499.

PAGE 88

88 Figure 3 1. Body weight of steers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180) in yr 1 From d 0 to 180, NW steers remained with cow s on bahiagrass pasture s ; EW180 steers were limit fed a high concentrate diet in drylot from d 0 to 180; EW90 s teers were limit fed a high concentrate diet in drylot until d 90, then grazed bahiagrass pastures until d 180 ; and EWRG steer s grazed ryegrass pastures until d 6 0 then bahiagrass pasture s until d 180. T reatment x time ( P < 0.0001) effects w er detected for BW of steer s from d 0 to 90 (SEM = 2. 8 ) and d 90 to 180 (SEM = 4.2).

PAGE 89

89 Figure 3 2. Body weight of steers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of no rmal weaning (d 180) in yr 2 From d 0 to 180, NW steers remained with cow s on bahiagrass pasture s ; EW180 steers were limit fed a high concentrate diet in drylot from d 0 to 180; EW90 s teers were limit fed a high concentrate diet in drylot until d 90, then grazed bahiagrass pastures until d 180 ; and EWRG steer s grazed ryegrass pastures until d 90 then bahiagrass pasture s until d 180. T reatment x time ( P 0.00 3 ) effects w ere detected for BW of steer s from d 0 to 90 (SEM = 4 1 ) and d 90 to 180 (SEM = 8.6).

PAGE 90

90 Figure 3 3. Plasma ceruloplasmin concentrations (mg/dL) of steers developed on different calf management sy stems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180) in yr 1 From d 0 to 180, NW steers remained with cow s on bahiagrass pasture s ; EW180 steers were limit fed a high concentrate diet in drylot from d 0 to 180; EW90 s teers we re limit fed a high concentrate diet in drylot until d 90, then grazed bahiagrass pastures until d 180 ; and EWRG steer s grazed ryegrass pastures until d 90 then bahiagrass pasture s until d 180. A t reatment x time ( P = 0.000 2 ) effect w as detected for plasm a ceruloplasmin concentrations (SEM = 1 12 ) a,b Within sampling day, means without a common superscript differ ( P ). b b b a a a b a b b b b a b a

PAGE 91

91 Figure 3 4. Plasma haptoglobin concentrations (mg/mL) of steers developed on different ca lf management systems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180) in yr 1 From d 0 to 180, NW steers remained with cow s on bahiagrass pasture s ; EW180 steers were limit fed a high concentrate diet in drylot from d 0 to 180 ; EW90 s teers were limit fed a high concentrate diet in drylot until d 90, then grazed bahiagrass pastures until d 180 ; and EWRG steer s grazed ryegrass pastures until d 90 then bahiagrass pasture s until d 180. A tendency for t reatment x time ( P = 0. 10 ) ef fect w as detected for plasma ceruloplasmin concentrations (SEM = 0 08 ) a,b Within sampling day, means without a common superscript differ ( P 10 ). b a a a b a a a

PAGE 92

92 CHAPTER 4 EFFECTS OF METABOLIC IMPRINTING AND CALF MANAGEMENT SYSTEMS ON GRO W TH AND REPRODUCT IVE PERFORMANCE OF BEEF HEIFERS Metabolic imprinting is the process by which nutrition during early life may permanently affect the metabolism and performance of livestock (Lucas et al. 1998; Du et al., 2010). Thus, i dentifying strategies that are able to enhance calf performance during early postnatal life may provide unique opportunities to optimize feed resources and increase the profitability of beef cattle management systems. For instance, m ild winters in southern USA allow beef producers to rais e fall born, early weaned (EW) calves on annual cool season grasses such as ryegrass pastures (Arthington and Kalmbacher, 2003; Vendramini et al., 2006; Vendramini and Arthington, 2008; Moriel et al., 2013). Bos t aurus heifers provided a high concentrat e diet beginning at 90 d of age, had greater puberty attainment at the onset of the breeding season than heifers normally weaned (NW) at 7 mo of age (Gasser et al., 2006 a,b ). However, l imited information related to alternative nutritional management s for EW calves and their long tem impact on reproductive performance of beef heifers has been reported Further, it remains unknown if a short period of exposure to high concentrate diets immediately after EW is able to hasten the puberty achievement of B. in dicus influenced heifers that are known for reaching puberty at older ages compared to B. taurus beef heifers (Rodrigues et al., 2002). We hypothesized that providing high concentrate diet s to EW heifers, for at least 90 d would increase the growth and re productive performance of EW beef heifers. Therefore, our objectives were to evaluate the effects of post weaning

PAGE 93

93 nutrition al management systems on growth and reproductive performance of B. indicus influenced beef heifers. Materials and Methods All procedu res for the 2 yr study (2011 and 2012) conducted at the Range Cattle Research and Education Center (RCREC; Ona, FL ; 27 ) were approved by the University of Florida, Institute of Food and Agricultural Scien ces, Animal Research Comm ittee Animals and D iets Seventy eight Brahman x British crossbred heifers (n = 40 and 38 heifers in yr 1 and 2, respectively) were utilized to evaluate the effe cts of calf management systems following EW on growth and reproductive performance of beef heifers The study began on the day of EW (d 0; January 11 and 25 for yr 1 and 2, respectively) which co rresponded with the start of a 3 mo breeding season. On d 0, heifers were stratified by BW and age (mean BW = 89 16 kg; age = 72 13 d), and randoml y assigned to a control treatment that was normally weaned on d 180 (NW; n = 10 heifers annually), or to 1 of 3 EW treatments: (1 ) EW and limit fed a high concentrate diet in drylot until d 180 (EW180; n = 10 heifers annually); ( 2 ) EW and metabolically imp rinted by limit feeding a high concentrate diet in drylot until d 90 then grazed on bahiagrass pastures until d 180 (EW90; n = 10 heifers annually) ; and (3) EW and grazed on ryegrass ( Lolium multiflorum ) pastures until d 60 (yr 1; n = 10 heifers) or 90 (y r 2; n = 8 heifers) then on bahiagr ass pastures until d 180 (EWRG) Following treatment assig nment, NW heifers and all multiparous cows (n = 80 and 76 cows in yr 1 and 2, respectively; mean BW = 456 50 kg; age = 7 3 yr) returned to their respective ba hiagrass ( Paspalum notatum ) pastures, whereas EW heifers remained in the cow pens for 7 d with free choice

PAGE 94

94 access to long stem stargrass ( Cynodon nlemfuensis ) hay, water and a preconditioning ummit, MO: guaranteed analysis, as fed : 14 % CP 1.0 % fat, 18 % fiber, 0.75 % Ca, 0.40 % P, and 0.40 % NaCl). Average consumption of the preconditioning concentrate was 0.90 kg / calf d aily (as fed) and n o health problems were reported during the preconditioning period. On d 7, EW heifers were allocated to their respective treatments. In order to avoid confounding effects of maternal plane of nutrition during gestation, any cow used in yr 1 was not utilize d in yr 2. Calves in drylot were gradually adapted to the final high concentrate diet over a 14 d period (Table 4 1) The adaptation d iet w as offered from d 7 to 20, starting at 1.5 % of BW (as fed basis) and then gradually increased to allow free choice consumption (average intake = 3.2 and 3.4 0.82 % of B W in yr 1 and 2, respectively; a s fed) On d 21, heifers were transitioned to the final high concentrate diet (aver age intake from d 21 to 59 = 4.1 and 4.2 0.73 % of BW in yr 1 and 2, respectively). Two cases of bloat were detected on d 59 of yr 1 T hereafter, the final high concentrate diet was limit fed at 3.5 % of BW (as fed) and chopped stargrass hay was top dressed at 0.45 kg/heifer daily (as fed) for the remaining period in drylot The s ame bunk management was applied in yr 2, even though no cases of meta bolic disorders were detected. O n d 90 EW90 heifers were transferred to bahiagrass pastures and the high concentrate diet offer was gradually decreased (0.5 % of BW every 5 d) from 3.5 to 1.0 % of BW (as fed ) During the grazing period (d 7 to 180), EW h ei fers on pasture were supplemented with the final h igh concentrate diet at 1.0 % of BW (as fed).

PAGE 95

95 Ryegrass herbage allowance was bellow 0.5 kg of DM/kg of calf BW and not sufficient for a 90 d grazing period in yr 1, so heifers were transferred to bahiagrass pastures 30 d prior to the estimated date. From d 0 to 60 (yr 1) and 90 (yr 2), EWRG heifers were allocated into 1 of 2 ryegrass pastures (0.3 ha each) in a fixed and continuous stocking rate ( n = 5 and 4 heifers/pasture in yr 1 and 2, respectively). From d 90 to 180, EW 90 and EWRG heif e r s were allocated onto 1 of 4 bahiagrass pastures (0. 4 ha each ; 2 pastures/treatment ) in a fix ed and continuous stocking rate ( n = 5 EW90 heifer s/ pasture in both yr, and n= 5 and 4 EWRG heifers/pasture in yr 1 and 2, respec tively). Heifers were vaccinated on d 60 and 180 against Mannheimia haemolytica (2 mL subcutaneous; One Shot; Zoetis Animal Health New York, NY) in fectious bovine rhinotracheitis bovine virus diarrhea (Type 1 and 2), parainfluenza 3 virus and bovine r espiratory syncytial virus (2 mL i ntramuscular; Bovi Shield Gold 5; Zoetis Animal Health Exton, PA ) Clostridium Chauvoei Septicum Haemolyticum Novyi Sordellii Perfringens Types C and D (5 mL subcutaneous; Ultraback 8; Zoetis Animal Health, Exton, PA) and treated for internal parasites (10 mL oral; Safeguard; Merck Animal Health, Summit, NJ). On d 1 80 NW heifers were weaned and all heifers were grouped by treatment and allocated i nto 1 of 8 bahiagrass pastures ( 0.8 ha each ; 1 pasture/treatment ) Thereaft er, heifers were rotated among pastures every 10 d and supplemented with the final h igh concentrate diet at 1.5 % of BW until d 390. On d 330, y earling Brahman x British crossbred bulls were placed with heifers (1 bull/group) and then rotated among groups every 10 d until d 390 During the breeding season, the total concentrate offer

PAGE 96

96 per pasture was increased by 10 % (as fed) to adjust for bull consumption, and f ree choice access to long stem stargrass hay was provided when pasture availability was limited. Free choice access to water and a complete commercial mineral/vitamin mix (Cattle Select Essentials Range, Lakeland Animal Nutrition, Lakeland, FL; 6.0, 0.10, 0.10, 0.30, 63 and 1.0 % of Ca, K, Mg, S, NaCl and P, respectively, and 50, 1,500, 800, 210, 500, 40 and 3,000 mg/kg of Co, Cu, Fe, I, Mn, Se and Zn, respectively ) were provided t o heifers throughout the study Data C ollection Heifers were individually weighed every 30 d from d 0 to 390, following a 6 h period of feed and water withdrawal. On d 0 of bo th yr 3 heifers/treatment were randomly selected for liver biopsies on d 90, 180 and 270. Liver samples were collected via needle biopsy following the techniques described by Arthington and Corah (1995). Immediately after collection, ap proximately 100 mg of wet liver tissue was placed in to 1 mL of RNA stabilization solution (RNAlater, Ambion Inc., Austin, TX), kept on ice for 6 h 0C. Blood samples were collected via jugular venipuncture in sodium heparin (158 USP) containing tubes (Vacutainer, Becton Dickinson, Franklin Lakes, NJ) on d 0 90, 180 and 270, following feed and water withdrawal and also every 10 d from d 180 to 390 prior to concentrate supplementation. In yr 1, blood samples were collected on d 90 only from heifers selected for liver biopsies, then from all heifers for the re mainin g blood collection days. In yr 2 blood samples were collected fro m all heifers at all collection days. Blood samples were immediately placed on ice after collection and

PAGE 97

97 then centrifuged at 1,200 g for 25 min at 4 C. Plasma was stored frozen at 20 C until laboratory analysis. Heifers were scanned twice between the 12 th and 13 th ribs on d 1 80 and 270 using an Aloka real time ultrasound scanner (3.5 MHz linear array transducer, Aloka 500V, Corimetrics Medical Systems, Inc., Wallingford, CT ). Carcass images were used to assess the Longissimus dorsi muscle area and backf at (BF ) thickness Pregnancy status of heifers was determined by transrectal ultrasonography (5 MHz linear array transducer, Aloka 500V, Corimetrics Medical Systems, Inc., Wallingford, CT) on d 490 and 456 in yr 1 and 2, respectively, whereas pregnancy sta tus of multiparous cows was determined by a trained veterinarian via rectal palpation, on d 163 and 150 of yr 1 and 2, respectively. Pregnancy rates of heifers and cows were confirme d at calving Herbage mass (HM) w as determined monthly from d 0 to 180 a s describe d by Vendramini and Arthington (2008). Average herbage allowance (HA) w as c alculate d as the average herbage mass (kg of DM /ha) multiplied by area of each experimental unit (ha), and divided by total calf BW (kg) on the experimental unit (Sollenbe rger et al., 2005). H and plucked samples of pastures were collected monthly from d 0 to 390. These samples were dried at 60C in a forced air oven for 72 h, ground in a Wiley mill (Model 4, Thomas Wiley Labora tory M ill, Thomas Scientific, Swedes boro, NJ) t o pass a 1 mm stainless steel screen Ryegrass CP was calculated as 6.25 x N concentration, which was measured using modifications of aluminum block digestion technique (Gallaher et al., 1975). In vitro OM digestibility (IVOMD) concentration was determined by the 2 stage procedure of Tilley and Terry (1963) and modified by Moore and Moot (1974). Average nutritive value of ryegrass pastures was 18 % CP (DM basis) and 73 %

PAGE 98

98 IVOMD. Bahiagrass samples from d 90 to 180 and stargrass hay samples were pooled by yr a nd sent in duplicate to a commercial laboratory for wet chemistry analysis (Dairy One Laboratory, Ithaca, NY). Average nutritive value of bahiagrass pastures and stargrass hay were, respectively, 10.9 and 8.3 % CP and 42.4 and 50 % TDN (DM basis) Plasma an d Liver Tissue A nalysis Plasma samples collected on d 9 0, 180 and 270 were used to determine the plasma concentrations of IGF 1, whereas plasma samples collected from d 180 to 390 were obtained to determine the plasma concentrations of progesterone ( P4 ). Heifers were considered pubertal if 2 consecutive samples had plasma concentrations of P4 1.5 ng/mL (Cooke et al ., 2007) then puberty attainment was declared on the first day of high plasma P4 concentration. Plasma concentrations of IGF 1 were determined in singles using a human specific commercial ELISA kit (SG100; R&D Systems, Inc., Minn eapolis, MN) with 100 % cr oss reactivity with bovine IGF 1 In each ELISA plate, a standard plasma sample was assayed in quadrup licate to calculate the intra and int er assay CV for IGF 1 assay s P lasma c oncentrations of P4 were analyzed in singles using C oat A Count solid phase 125 I RIA kit (DPC Diagnostic Products Inc., Los Angeles, CA). Standard plasma samples containing high and low plasma concentrations of P4 were analyzed in quadruplicate in each assay to determine the intra and inter CV for P4 ass ay s Int ra and int er assay CV were respectively, 3.2 and 7 8 % for IGF 1, and 7.0 and 8.1 % for P4 assays Liver tissue was homogenized using 10 mL of STAT 60 (Tel Test Inc., Friendswoods, TX) and a mechanical tissue disruptor, followed by nucleic acid

PAGE 99

99 ex traction with 2 mL of chloroform, RNA precipitation by isopropanol, and pellet formation after centrifugation (10,000 g for 10 min). Thereafter, RNA purification was performed using a commercial RNA p urif ication k it ( TRIzol Plus ; Invitrogen, Carls bad, CA ). The quantity and quality of extracted RNA were measured via UV absorbance at 260 nm and 260/280 nm ratio, respectively (GeneQuant spectrophotometer, Amersham Ph armacia Biotech, Cambridge, UK). O nly RNA samples containing a 260/280 ratio above 1.9 were u sed for further analysis, whereas RNA samples containing ratio less than 1.9 were discarded and the respective liver tissue sample was selected for a second RNA extraction. As described by Gonzalez et al. (2008), r eal time reverse transcription PCR analys is was performed to assess the mRNA expression of growth hormone receptor 1 A (GHR 1A), IGFBP 3 and IGF 1, using bovine specific primer sets (Table 4 2). B ovine 18S ribosomal RNA (18S) threshold cycle (Ct) values did not differ among treatments ( P 0.64) and were used as housekee ping gene for computation of values and subsequent calculation of the relative fold change (2 t ), as described by Ocn Grove et al. (2008). A contr ol RNA sample was included in each PCR plate for the intra and inter CV ca lculations. Intra and inter assay CV were, respectively, 0.9 and 7.0 % for 18S, 0.5 and 2.3 % for GHR 1A, 0.5 and 3.5 % for IGF 1, and 0.4 and 3.3 % for IGFBP 3 assays Statistical A nalysis All d ata except for reproductive performance of heifers and cows, we re analyzed as a completely randomized design using the MIXED procedure of SAS (SAS Institute Inc., Cary, NC, USA, version 9.2) with Satterthwaite approximation to determine the denominator degrees of freedom for the test of fixed effects. Pen was the exp erimental unit in all analysis except for growth and reproductive performance of cows in which

PAGE 100

100 cow was considered the experimental unit Body weight of heifers on d 0 was included as a covariate for BW and ADG analysis. Pen(treatment x yr) and heifer(pen ) were used as the random effects in all data, except for growth and reproductive performance of cows and pasture evaluation which included cow(treatment x yr) and pasture(treatment x yr) as the random effect s, respectively The growth curve of heifers wa s divided into 3 periods (d 0 to 90, 90 to 180, and 180 to 390) in order to better determine when treatments responses were evident, as suggested by Owens et al. (1993). Monthly BW of heifers within each growth pe riod, liver gene expression, plasma concent rations of IGF 1, herbage mass and allowance were analyzed as repeated measures. The covariance structure was selected based on the lowest Akaike information criterion. Autoregressive 1 covariance structure w as used for the analysis of growth performance o f cows and heifers whereas compound symmetry was used for the analysis of liver gene expressi on, plasma IGF 1 concentrations and pasture evaluation A p rediction equation for age at puberty was developed using the stepwise REGRESSION proce dure of SAS. P re dictors having P values > 0.10 were removed from the final model. Pearson correlation coefficients were calculated for all liver gene expression, plasma IGF 1 concentrations and growth performance using the CORR procedure of SAS Reproductive performance of heifers and cows were analyzed using the GLIMMIX procedure of SAS. If treatme nt x time x yr effect was detected ( P 0. 10 ) then treatment x time effect was analyzed separately within each yr. All results are reported as least squares means. Data were s eparated using the PDIFF if a significant preliminary F test was detected, whereas BW and BCS of cows were separated using the SLICE option of SAS. Significance was set at P 0.05, and tendencies if P > 0.05 and 0.10.

PAGE 101

101 Results and Discussion Heifers N o health problems were observed for EW heifers and no correlations were detected ( P 0.12) between age at EW and ADG throughout the study. A treatment x time effect was detected ( P < 0.0001) for BW of heifers from d 0 to 90. From d 0 to 90, EW180 and EW90 heifers were heavier ( P 0.02) than NW and EWRG heifers, whereas NW heifers had similar BW ( P 0.12) from d 0 to 60 and tended ( P = 0.09) to be heavier on d 90 compared to EWRG heifers ( Figure 4 1). A treatment x yr effect was detected ( P 0.10) for AD G of heifers from d 0 to 60 and 60 to 90 (Table 4 3). From d 0 to 60, EWRG heifers had greater ( P = 0 .05) ADG in yr 1, but similar ( P = 0 .28) ADG in yr 2 compared with NW heifers. During the same period, h owever, EWRG and NW heifers had lesser ( P 0 .06) A DG than EW180 and EW90 heifers. Those results indicate that calves weaned around 70 d of age may have similar or better growth performance than NW calves if high nutritive diets similar to those used in the current study are provided. Furthermore the enh anced performance of EW calves at this time of the year allow s beef producers to explore a period of highly efficient BW gain and high calf prices (Arthington and Kalmbacher, 2003). Ryegrass HM was similar ( P = 0.47) betwee n d 10 and 40 and decreased ( P 0.004) on from d 40 to 70 whereas HA decreased ( P 0.006) from d 10 to 70 (Table 4 4). Although initial ryegrass HM and HA were greater than previously reported by others (Vendramini and Arthington, 2007), the average amount of rainfall received from d 0 to 60 in yr 1 and 2 were 85 and 74 % respectively, of the average rainfall received during 2010 ( 261, 222 and 193 mm for 2010, 2011 and 2012, respectively ) at the RCREC and influenced the subsequent HM production (Table 4 4). In yr 1, ryegrass HM after 60 d of

PAGE 102

102 grazing was 430 kg of DM/ha and not sufficient f or the remaining grazing period. H ence, EWRG heifers were transferred to bahiagrass pastures 30 d earlier than expecte d. Likewise, ryegrass HM and HA on d 70 of yr 2 were 774 kg of DM/ha and 0.39 kg of DM/kg of BW, respectively. This HA on d 70 is slightly below the threshold of 0.50 kg of DM/kg of BW that was previously reported to limit the growth performance of EW calves (Vendramini et al., 2006) and likely explain the lesser ADG of EWRG vs. NW h eifers from d 60 to 90 (Table 4 3). Bahiagrass HM decreased ( P 0.05) from d 105 to 165 and increased on d 195 (Table 4 4). Sollenberger and Moore (1997) demonstrated that when forage is the sole source of nutrients for grazing cattle, HA lesser than 1.0 kg DM / kg of BW is insufficient for ad libitum consumption. Furt her, forage intake decreas es if concentrate supplementation is above 0.5 % of BW (Horn and McCollum, 1987). T he bahiagrass HA ranged from 0.77 to 3.21 kg of DM/kg of BW (Table 4 4), and therefore, it was adequate for ad libitum consumption by heifers supple mented with concentrate at 1.0 % of BW. Bahiagrass HA was always greater ( P 0.004) for EWRG vs. EW90 heifers in yr 2, but similar ( P = 0.35) between EWRG and EW90 heifers on d 165 of yr 1. In addition, due to the lower stocking rate used in yr 2 vs. 1, EWRG heifers likely had greater opportunity for forage selection and enhanced nutrient intake, which may explain the greater ( P = 0.02) ADG from d 90 to 180 in yr 2 vs. 1 (Table 4 3). Nevertheless, EW180 heifers were always heaviest ( P < 0.0001) at the time of NW (d 180). In yr 1, EWRG heifers were lightest ( P < 0.0001), whereas EW 90 and NW heifers had similar BW ( P = 0.58; Figure 4 2). Conversely EW90, EWRG and NW heifers achieved similar BW on d 180 of yr 2 ( P 0.18; Figure 4 3). Thus, placing EW heifers on ryegrass pa stures for 60 to 90 d or

PAGE 103

103 on a high concentrate diet in drylot for at least 90 d were good alternatives for EW calf management system s compared to NW heifers. Despite the similar nutritional mana gement from the time of NW until the end of the breeding season, EW180 heifers had less ( P heifers but similar ( P = 0.12) ADG compared with NW heifers. The lesser ADG of EW180 heifers may be attributed to the stress associat ed with dietary modifications, moving to a n unfamiliar location and differences on body fat concentration that led to greater nutrient requirements. A s the initial body fat concentration increases, the ME allowable for growth decreases (NRC, 2000) which in turn reduce the g rowth rate and feed efficiency of cattle In agreement, EW180 heifers had greatest ( P BF thickness on d 180 and 270 (Table 4 3), which indicates that EW180 heifers had a greater degree of fatness compared to EW90, EWRG and NW heifers Likewise, when calves were slaughtered at the time of NW EW steers fed high concentrate diets for 60 d had greater BF thickness and abdominal fat wt compared to NW steers ( Schoonmaker et al., 2001) In addition NW heifers had less ( P = 0.03) ADG than E WRG heifer s from d 180 to 390 (Table 4 3). T he capacity for compensatory growth diminishes as the ag e at nutrient restriction declines ( Berge, 1991; Greenwood and Cafe, 2007). C alves that were nutrient re stricted from 4 to 8 mo of age experienced compensatory gain following realimentation but not calves that were nutrient restricted before 4 mo of age ( Morgan, 1972) On d 60 of study, heifers were in average 4 mo of age H ence, the nutrient restriction experienced by NW heifers from d 0 to 60, may have decreased their subsequent capacity for compensatory gain. In contrast, the nutrient restriction experi enced by EWRG heifers from d 60 to 180 allowed a certain degree of

PAGE 104

104 compensatory gain from d 180 to 390. Despite the slight differences on ADG EW180 heifers were always heaviest ( P 0.04 ) and EWRG heifers lightest ( P 0.05), whereas EW90 and NW heifers had similar ( P 0.55 ) BW from d 180 to 390 of yr 1 ( Figure 4 2) From d 180 to 390 of yr 2, EW180 heifers were also heaviest ( P 0.003), whereas EWRG, EW 90 and NW heifers had simil ar ( P 0.37 ) BW (Figure 4 3). The somatotropic axis is an essential constituent of multiple systems controlling growth (Le Roith et al., 2001) and reproduction (Wettemman e t al., 2003) The binding of GH to GHR 1A stimulates hepatic synthesis of IGF 1 (S mith et al., 2002) and is highly correlated with the hepatic mRNA expression of GHR 1A and IGF 1 (Lucy et al., 2001 ; Radcliff et al., 2003 ). Hepatic synthesis of IGF 1 is regulated primarily at the transcriptional level (Thissen et al., 1991) and is the major source of cir culating IGF 1 (Ya kar et al., 1999), which is also responsible for stimulating the hepatic expression of IGFBP 3 (Thissen et al., 1994). Thus, an increase d hepatic expression of GHR 1A mRNA enhances the capacity for GH binding (Lapierre et al., 1982) and the hepatic synthesis of IGF 1 (Radcliff et al., 2004). This mutual regulation among the components of the somatotropic axis is supported by our results T he liver mRNA expression of GHR 1A, IGF 1 and IGFBP 3 were positively correlated a t any sampling date (Table 4 5), whereas the liver IGF 1 mRNA expression and plasma IGF 1 concentrations were positively correlated ( P 0.005) on d 90 (r = 0.68) and 180 (r = 0.58). A tendency for treatment x time x yr effect was detected ( P = 0.09) for hepatic expression of GHR 1A mRNA. In yr 1, a treatment x time effect was detected ( P = 0.001) for liver GHR 1A mRNA (Figure 4 4; SEM = 0.22), whereas in yr 2, a treatment ( P = 0.04), but not treatment x time ( P = 0.38) effect, was detected for liver e xpression

PAGE 105

105 of GHR 1A mRNA (1.42, 1.02, 1.62 and 1.10 0.130 fold increase for NW, EW180, EW90 and EWRG heifers, respectively). In yr 2, EW90 heifers had similar ( P = 0.30) liver GHR 1A mRNA expression compared with NW heifers but greater than EW180 and EWRG heifers, whereas NW heifers tended ( P 0.11) to have greater liver GHR 1A mRNA expression than EW180 and EWRG heifers. Treatment x time effects were also detected ( P for liver IGF 1 mRNA expression (Figure 4 6; SEM = 0.18) and plasma concentrations of IGF 1 (Figure 4 7; SEM = 11.4), but not for liver IGFBP 3 mRNA ( P = 0.33 ). Liver IGFBP 3 mRNA expression also did not differ ( P = 0. 12 ) among treatments (1.13, 1.08, 1.11 and 0.87 0.077 for NW, EW180, EW90 and EWRG heifers, respectively). Nutrient intake posi tive ly affects the hepatic expression of GHR 1A, IGF 1 and IGFBP 3 (Thissen et al., 1994 ; Smith et al., 2002; Radcliff et al., 2004 ) In agreement, liver mRNA expression of IGFBP 3 and IGF 1 on d 90 were positively correlated ( P 0.05) with the ADG from d 0 to 90, whereas liver IGF 1 mRNA expression on d 180 was positively correlated ( P = 0.0002) with the ADG from d 90 to 180 (Table 4 5). In addition, p lasma concentrations of IGF 1 and ADG were positively ( P 0.03) correlated on d 90 (r = 0.39), 180 (r = 0.49) a nd 270 (r = 0.26 ). Th erefore the nutrient restriction experienced by EWRG heifers from d 60 to 90 decreased ( P the liver mRNA expression and plasma concentrations of IGF 1 on d 90 compared to EW heifers in drylo t (Figure 4 5 and 4 6) Surprisingly, NW heifers had greatest ( P 0.02 ) expression of GHR 1A on d 90 (Figure 4 4), and similar ( P = 0.56 ) liver expression of IGF 1 on d 90 and 180 compared with EW180 heifers (Figure 4 5), which may be associated w ith the nutrient components of milk and the timing of tissue and blood sample collection Hepatic synthesis of IGF 1 is dependent on the dietary

PAGE 106

106 concentrations of energy and protein (Elsasser et al., 1989) and dietary aminoacid profile (Clemmons et al., 1985). Fu rther, liver biopsies and blood samples were collected 6 h after feed and water withdrawal which could have decreased the magnitude of differences on liver gene expression and plasma concentrations of IGF 1 among treatments. Long term effects of calf man agement following EW on reproductive performance of beef heifers have been reported ( Gasser et al., 2006a,b,c,d) Growth rate between the time of NW (6 to 8 mo of age) and puberty, and from EW to the time of NW (3 to 6 8 mo of age) w ere negatively associat ed with age at puberty (Smith at el. 1976; Gasser et al., 2006a,b,c,d). In agreement EW180 heifers were youngest ( P 0.01) at puberty (Table 4 3). However, the t iming of enhanced growth rate has different outcomes on BW and age at puberty. H eifers achiev ing greate r BW gain starting at 7 mo of age tended to be younger and heavier at puberty than heifers on lesser grow th rates (Ferrell, 1982). Conversely EW heifers experiencing faster growth rates beginning at 70 d of age achieved puberty earlier but at similar (Gasser et al., 2006b) or lighter BW (Gas ser et al., 2006a) compared to heifers in lower plane s of nutriti on. In the present study EW heifers tended ( P = 0.11) to achieve puberty at lighter BW than NW heifers (Table 4 3). These differences on age and BW at puberty may be associated with imprinting effects that were induced by the enhanced growth performance i mmediately following EW rather than a direct effect of the EW practice once Gasser et al. (2006b) reported no differences on age at puberty between EW and NW heifers fed to achieve similar growth rates.

PAGE 107

107 Surprisingly, beginning at d 260, a greater percen tage ( P 0.07) of EW90 heifers achieved puberty compared to NW heifers (Figure 4 7), despite their similar BW for the majority of the study. Except for d 270 and 390, accumulative puberty achievement did not differ ( P 0.15) between EWRG and NW heifers. At the s tart of the breeding season (d 330), the accumulative percentage of pubertal heifers was greatest ( P 0.02) f or EW180, intermediate for EW90 and least ( P 0.06) for EWRG and NW heifers (100, 80, 57.5 and 50 8.8 % of EW180, EW90, EWRG and NW heifers, re spectively). Feeding high concentrate diets to EW heife rs, starting at approximately 90 d of age, increased the frequency of LH pulse (Gasser et al., 2006a), mean LH concentrations (Gasser et al. 2006c), follicular growth, duration of the follicular wave, circulating concentrations of estradiol (Gasser et al., 2006b), and anticipated the decline in estradiol negative feedback on LH secretion (Gasser et al., 2006c) However, such responses were observed only after 120 d of feeding the high concentrate diet and thus, likely explain the differences on age at puberty between EW180 heifers and remaining treatments, but not why EW90 heifers achieved puberty earlier than NW heifers. Day and Anderson (1998) proposed that the period from birth to puberty in beef he ifers could be divided into infantile, developmental, static and peripubertal periods D uring the developmental phase (2 to 6 mo of age) which corresponds to d 0 to 90 of our study, GnRH secretion and follicular growth increases with LH secretion and num ber of ovarian follicles peak ing at 3 to 4 mo of age Thereafter the LH secretion and number of follicles decline, and remain at a relatively low level throughout the static phase (6 to 10 mo of age) which corresponds with d 90 to 180 of our study. Thus, although EW90 and NW heifers achieved similar BW on d 180, the period of enhanced

PAGE 108

108 ADG of EW90 heifers occurred during the developmental phase, wherein the enhanced nutrient intake could have hastened follicle growth at greater extent than at later stages, and potentially when the susceptibility to metabolic imprinting effects is higher. In addition, liver IGF 1 expression of EW90 heifers on d 270 was similar ( P = 0.17) to EWRG heifers, but greater ( P than NW and EW 1 80 heifers despite heifers being placed on same plane of nutrition (Figure 4 5), which further supports the concept of metabolic imprinting effects on puberty achievement of beef heifers Despite the differences on percentage of pubertal heifers at the start of the breeding season, pregn ancy rates did not differ ( P = 0.20; Table 4 3), which was expected due to the relatively small number of observations used in our study The nutrition mediated mechanism that leads to early activation of the reproductive axis in beef heifers is unknown. H owever, a simultaneous increase in serum concentrations of IGF 1 and LH has been detected in heifers approaching puberty (Yelich et al., 1996). Also, IGF1R IGF 1 and IGFBPs mRNA were found in the brain, pituitary, gonads and reproductive tract (Chandrashe kar et al., 2004). Several studies observed that IGF 1 increased the GnRH mRNA expression in hypothalamus (Daftary and Gore, 200 5), stimulated steroidogenesis in the ovaries (Spicer and Echternkamp, 1995), and lowered the negative feedback of estradiol on LH release that ultimately led to earlier puberty achievement (Wilson, 1995). In our study, the results that were obtained through stepwise regression further support the involvement of IGF 1 on early activation of the reproductive axis. Following the step wise regression, the predictors for age at puberty remaining in the final model (intercept slope = 540.4 43.66; P < 0.0001) included ADG from d 0 to 90 (slope = 127.5 55.24; P = 0.03), and

PAGE 109

109 plasma concentrations of IGF 1 on d 90 (slope = 0.58 0.335; P = 0.09) and 180 (slope = 0.61 0.276; P = 0.03). Thus, the age at puberty decreased in average 0.59 d for every 1 ng/mL increase on plasma concentrations of IGF 1 on d 90 and 180. Although plasma concentrations of IGF 1 is often used as an indicator o f nutritional status and growth rate, the ADG and plasma concentrations of IGF 1 significantly affected the age at puberty of heifers. Based on adjusted R 2 the ADG from d 0 to 90 and the plasma concentrations of IGF 1 on d 90 and 180 explained approximate ly 34% of the variability on age at puberty, and had relative contributions of 26, 2, and 6 % respectively. Cooke et al. (2013) demonstrated that GH administration to beef heifers at 14 d intervals, from 7 to 14 mo of age, did not affect BW gain, but incre ased plasma concentrations of IGF 1 and anticipated puberty achievement compared to saline injections. Thus, our results and those from Cooke et al. (2013) suggest that strategies that are able to increase the plasma concentrations of IGF 1, during early l ife, may hasten puberty achievement independently of growth rate. However, further research is warranted to confirm this hypothesis. Taken together, our results support the concept that puberty achievement of EW heifers in drylot was associated with a crit ical window, in which nutritional management s that enhance the growth performance and plasma IGF 1 concentrations may induce early activation of the reproductive axis. Nevertheless, the EW heifer management systems evaluated in this study altered the BW at the time of NW and were good alternatives for heifer development compared to traditionally weaning heifers at 8 to 9 mo of age

PAGE 110

110 Cows In our study, EW cows slightly lost BW ( P for 60 d following weaning then increased ( P 01 ) BW until the ti me of NW, whereas NW cows lost BW ( P 0.0 3 ) for 60 d and required additional 60 d to fully recover ( P = 0. 20 ) their initial BW (Table 4 6). Likewise, BCS of EW cows increased ( P 0.01 ) from the time of EW to NW, whereas NW cows lost ( P < 0.0 1 ) BCS for 3 0 d and required additional 60 d to achieve similar ( P = 0. 35 ) initial BCS (Table 4 6). Thus, greater ( P < 0.0001) BW and BCS change from the time of EW until the time of NW were observed for EW vs. NW cows (Table 4 7), which is in agreement with others ( Lusby and Parra, 1981; Peterson et al., 1987; Arthington and Kalmbacher, 2003 ; Waterman et al., 2012 a). Laster et al. (1973) reported that weaning calves at 55 d of age (8 d before the start of the breeding season) increased overall conception rates by 26 16 and 8 % in 2 3 yr old co ws, respectively, compared to NW cows. Likewise, EW primiparous cows had lesser postpartum (15 vs. 24 wk; Arthington and Minton, 2004) and calving interval (384 vs. 404 d; Arthington and Kalmbacher, 2003) but greater pregnancy rates than NW primiparous cows (93 vs. 65 % ; Arthington and Kalmbacher, 2003). Conversely Waterman et al. (2012a) observed a tendency for greater overall pregnancy rates (93 vs. 88 % ) of EW vs. NW mature cows in only 1 of 3 experiments, and simil ar calving interval between EW and NW cows in all 3 experiments (approximately 377 d). In the present study, EW cows tended ( P = 0.11) to have greater pregnancy rates than NW cows (Table 4 7 ), which is similar in magnitude compared to the results of Laster et al. (1973) and Waterman et al. (2012a). Calf removal increased the conception rates to AI in cyclic but not in anestrous cows of 5 yr of age or older (Geary et al., 2001). Further, BCS at the time of EW also influences the subsequent reproductive resp onse

PAGE 111

111 to EW. At 25 d post weaning, 100 % of the EW cows with BCS greater than 5 (1 to 9 scale) initiated luteal activity, whereas only 43 % of EW cows with BCS less than 5 had luteal activity (Bishop et al., 1994) In our study, approximately 14 % more ( P = 0. 03) NW cows calved on d 2 66 compared to EW cows (Table 4 8), which may be attributed to the BCS of EW cows being lesser than 5 at the time of EW and also the stress of weaning. However, 1 1 % more ( P 0.10) EW cows calved from d 3 08 to 3 36, except for d 31 5 (Table 4 8), which corresponds with the period of hastened nutritional status and may explain the numerically lesser calving interval for EW vs. NW cows (Table 4 7). Statistically significant differences on pregn ancy rates and calving interval were not detected which likely reflect s the relatively small number of NW vs. EW cows (20 and 60 cows/yr, respectively). Therefore, the reasons for the lack of consistent positive effects of EW on reproductive performance of multiparous cows may be attributed to t he relatively small number of observations per treatment and the lesser magnitude of increase on pregnancy rates of multiparous vs. primiparous cows following EW. In summary, limit feeding high concentrate diets at 3.5% of BW for at least 90 d in drylot and ryegrass grazing for 60 to 90 d with concentrate supplementation at 1.0% of BW, were effective alternatives for EW calf management systems and may be explored by beef producers. Furthermore our study provides evidences that metabolic imprinting effec ts, likely via IGF 1 enhanced the puberty achievement of Bos indicus influenced beef heifers.

PAGE 112

112 Table 4 1. Ingredient and c hemical composition of high concentrate diets provided to heifers during the drylot (d 0 to 180) and grazing period (d 0 to 390). Diet Adaptation 1 Final 2 ------% As fed basis ------Cottonseed hulls 30.0 15.0 Cottonseed meal 18.5 15.7 Soybean hulls 15.6 21.0 Wheat middlings 6.5 8.8 Dried distillers grains + soluble 5.9 8.0 Citrus pulp pellets 5.9 8.0 Cracked corn 5.8 7.8 Corn meal 5.8 7.8 Soybean meal 4.0 5.4 Sugarcane molasses 1.5 2.0 Calcium carbonate 0.37 0.50 Trace minerals 0.04 0.05 Bovatec 90 0.03 0.04 Vitamin E 0.01 0.02 1 Adaptation diet was provided from d 7 to 20 in amounts to ensure free choice consu mption. 2 Final high concentrate diet was provided in amount s to ensure free cho ice consumption from d 21 to 59, and limit fed at 3.5 % of BW (as fed) for the remaining period in drylot. Final diet was used as the supplement for heifers on pasture.

PAGE 113

113 Table 4 1. Continued Diet Adaptation 1 Final 2 ----------DM basis 3 ----------DM, % 90.0 87.6 TDN 4 % 72.0 74.0 ME 5 Mcal/kg 2.60 2.65 NEm, Mcal/kg 1.70 1.74 NEg, Mcal/kg 1.10 1.14 NFC 6 % 19.0 33.0 CP, % 19.9 22.9 RDP 6 % of CP 70.0 67.0 NDF, % 49.0 41.6 peNDF, % of NDF 33.0 20.0 ADF, % 36.7 29.3 Ca, % 0.61 0.90 P, % 0.54 0.68 Mg, % 0.37 0.46 K, % 1.23 1.53 Na, % 0.10 0.24 Fe, mg/kg 253 269 Zn, mg/kg 60.0 62.0 Cu, mg/kg 10.0 10.3 Mn, mg/kg 40.0 46.0 Mo, mg/kg 0.80 0.93 1 Adapta tion diet was provided from d 7 to 20 in amounts to ensure free choice consumption. 2 Final high concentrate diet was provided in amount s to ensure free choi ce consumption from d 21 to 59, and limit fed at 3.5 % of BW (as fed) for the remaining period in dr ylot. Final diet was used as the supplement for heifers on pasture. 3 Average chemical composition of samples collected every 2 mo and sent in duplicate to a commercial laboratory for wet chemistry analysis (Dairy One Laboratory, Ithaca, NY). 4 Calculated a s described by Weiss et al. (1992). 5 Metabolizable energy values were calculated by back transforming NEg concentration of each feed, obtained from a commercial laboratory (Dairy One), to ME concentration using equations from NRC (2000). 6 Estimated using t he level 2 of Cornell Net Carbohydrate and Protein System (CNCPS; version 5.0.29).

PAGE 114

114 Table 4 2. Nucleotide sequence of bovine specific primers used in the quantitative real time reverse transcription PCR to determine the hepatic expression of 18S ribosom al RNA (18S), GH receptor 1A (GHR 1A), IGF 1 and IGFBP 3 mRNA Target gene Primer sequence 1 Product size, bp Accession no. 18S Forward 5 CCCTGTAATTGGAATGAGTCCACTT 3 100 DQ222453 Reverse 5 ACGCTATTGGAGCTGAATTACC 3 GHR 1A Forward 5 CCAGCCTCTGTTTCAGGAGTGT 3' 2026 AY748827 Reverse 5' TGCCACTGCCAAGGTCAAC 3' IGF 1 Forward 5' ATGCCCAAGGCTCAGAAG 3' 841 NM_001077828 Reverse 5' GGTGGCATGTCATTCTTCACT 3' IGFBP 3 Forward 5' ACAGACACCCAGAACTTCTCCTC 3' 2434 NM_174556 Reverse 5' GTTCAGGAACTTGAGGTGGTTC 3' 1 Primer sequence for 18S was obtained from Liao et al. (2008 ), and from Coyne et al. (2011) for GHR 1A, IGF 1 and IGFBP 3.

PAGE 115

115 Table 4 3. Growth and reproductive performance of beef heifers developed on different calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180). Treatment 1 P value Item 2 NW EW180 EW90 EWRG SEM Tr eatmen t Yr Tr eatment x Yr ADG 3 kg/d d 0 to 60 Yr 1 0.49 a 0 .84 c 0.87 c 0.59 b 0.039 < 0.01 0.04 0.01 Yr 2 0.65 a 0.83 b 0.82 b 0.71 a P 4 0.003 0.90 0.32 0.03 d 60 to 90 Yr 1 0.90 b 0.94 b 1.14 c 0.47 a 0.072 < 0.01 0.57 0.08 Yr 2 0.87 b 1.05 c 1.03 c 0.59 a P 4 0.79 0.01 0.29 0.27 d 90 to 180 Y r 1 0.87 b 1.16 c 0.53 a 0.52 a 0.049 <0.01 0.10 0.10 Y r 2 0.80 b 1.19 c 0.61 a 0.72 a b P 4 0.33 0.66 0.26 0.02 d 180 to 390 0.69 ab 0.64 a 0.71 bc 0.76 c 0.02 0 0.02 0.15 0.86 a,b Within a row, means without common superscript differ ( P 0.05). 1 NW = heifers remained with cows without concentrate supplementation until d 180; EW180 = heifers early weaned and limit fed a high concentrate diet at 3.5 % of BW (as fed) in drylot until d 180; EW90 = heifers early weaned and limit fe d a high concentrate diet at 3.5 % of BW (as fed) in drylot until d 90 then grazed on bahiagrass pastures until d 180; EWRG = heifers early weaned, grazed on ryegrass pastures until d 60 (yr 1) or 90 (yr 2) then on bahiagrass pas tures until d 180. On d 180, NW heifers were weaned, and all heifers were grouped by treatment and rotated among bahiagrass pastures every 10 d. From d 0 to 180 and 180 to 390, heifers on pasture were supplemented with concentrate at 1.0 and 1.5 % of BW (as fed), respectively. 2 Means pooled by treatment if treatment x yr effect was not detected ( P > 0.10). 3 Calculated using shrunk BW after 6 h of feed and water withdrawal. 4 Yr comparison within each treatment.

PAGE 116

116 Table 4 3. Continued Treatment 1 P value I tem 2 NW EW180 EW90 EWRG SEM Tr eatmen t Yr Tr eatment x Yr Backfat thickness 5 cm d 180 0.33 a b 0.36 c 0.34 b 0.32 a 0.005 <0.001 0.72 0.20 d 270 5 0.35 a 0.39 b 0.35 a 0.33 a 0.008 0.04 0.94 0.13 Longissimus muscle area 5 cm 2 d 180 38.8 a 46 .5 b 40.4 a 39.5 a 0.98 0.002 0.06 0.18 d 270 5 43.6 a 50.1 b 44.8 a 44.2 a 1.00 0.005 0.03 0.17 Age at puberty d 397 c 292 a 347 b 379 c 13 0.001 0.007 0.24 BW at puberty 6 kg/d 316 287 283 296 10 0.11 0.05 0.32 Pregnancy rate, % of total heifers 70 89 60 63 11 0.2 0 0. 26 0. 3 6 a,b Within a row, means without common superscript differ ( P 0.05). 1 NW = heifers remained with cows without concentrate supplementation until d 180; EW180 = heifers early weaned and limit fed a high concentrate diet at 3.5% of BW (as fed) in drylot until d 180; EW90 = heifers early weaned and limit fe d a high con centrate diet at 3.5% of BW (as fed) in drylot until d 90 then grazed on bahiagrass pastures until d 180; EWRG = heifers early weaned, grazed on ryegrass pastures until d 60 (yr 1) or 90 (yr 2) then on bahiagrass pastures until d 180. On d 180, NW heifer s were weaned, and all heifers were grouped by treatment and rotated among bahiagrass pastures every 10 d. From d 0 to 180 and 180 to 390, heifers on pasture were supplemented with concentrate at 1.0 and 1.5% of BW (as fed), respectively. 2 Means pooled by treatment if treatment x yr effect was not detected ( P > 0.10). 3 Calculated using shrunk BW after 6 h of feed and water withdrawal. 4 Yr comparison within each treatment. 5 Mean of 2 carcass images measured between the 12 th and 13 th rib using ultraso und. 6 C alculated by interpolating shrunk BW measurements obtained every 30 d

PAGE 117

117 Table 4 4. Herbage mass and allowance of pastures grazed by heifers from the time of early weaning (d 0) until the time of normal weaning (d 180). Day of the study Effect It em 1 10 40 70 SEM Time Tr eatmen t x time x yr Ryegrass Herbage mass, kg DM/ha 2150 b 2043 b 602 a 146 0.006 Herbage allowance, kg DM/kg BW 1.97 c 1.62 b 0.37 a 0.14 0.0008 Day of the study Yr 105 135 165 195 Bah iagrass Herbage mass, kg DM/ha 5337 d 2782 b 2548 a 3154 c 57 < 0.0001 0.28 Herbage allowance, kg DM/kg BW EW90 1 2.81 c 1.24 b 1.06 a 1.13 ab 0.062 < 0.0001 0.06 EWRG 1 3.08 c 1.4 0 b 1.15 a 1.41 b P 2 0.009 0.09 0.35 0 .008 EW90 2 2.28 c 1.18 b 0.77 a 1.03 b 0.062 EWRG 2 3.21 c 1.49 b 1.26 a 1.57 b P 2 < 0.0001 0.004 0.001 < 0.0001 a,b Within a row, means without a common superscript differ ( P 1 Means of yr 1 and 2 were pooled b y treatment if treatment x yr effect was not detected ( P > 0.10). 2 Treatment comparison within sampling day.

PAGE 118

118 Table 4 5. Pearson correlation coefficients 1 ,2 among ADG and liver mRNA expression of GHR 1A, IGF 1, and IGFBP 3 of heifers developed on dif ferent calf management systems from the time of early weaning (d 0) until the time of normal weaning (d 180). ADG d 0 90 ADG d 90 180 ADG d 180 270 IGFBP 3 d 90 IGFBP 3 d 180 IGFBP 3 d 270 GHR 1A d 90 GHR 1A d 180 GHR 1A d 270 IGF 1 d 90 IGF 1 d 180 ADG d 90 180 0.13 0.25 ADG d 180 270 0.12 0.41 0.32 0.00 02 IGFBP 3 d 90 0.4 2 0.33 0.23 0.05 0.12 0.27 IGFBP 3 d 180 0.36 0.06 0.14 0.28 0.10 0.78 0.53 0.20 IGFBP 3 d 270 0.17 0.05 0.34 0.00 0.19 0.43 0.82 0.11 0.99 0.39 GHR 1A d 90 0.09 0.00 0.04 0.46 0.13 0.11 0.70 0.9 9 0.85 0.03 0.57 0.63 GHR 1A d 180 0.12 0.24 0.04 0.15 0.43 0.02 0.20 0.61 0.29 0.86 0.50 0.04 0.94 0.40 GHR 1A d 270 0.27 0.17 0.12 0.05 0.09 0.81 0.38 0.02 0.21 0.42 0.59 0.82 0.69 <0.0001 0.07 0.93 IGF 1 d 90 0.47 0.41 0.4 7 0.46 0.16 0.15 0.59 0.30 0.26 0.03 0.05 0.02 0.03 0.47 0.50 0.00 04 0.19 0.24 IGF 1 d 180 0.18 0.62 0.24 0.13 0.22 0.12 0.30 0.63 0.06 0.57 0.43 0.00 2 0.29 0.56 0.33 0.61 0.19 0.00 2 0.81 0.01 IGF 1 d 270 0.23 0.18 0.03 0.07 0.11 0.76 0.18 0.23 0.88 0.08 0.01 0.29 0.40 0.90 0.74 0.63 <0.0001 0.40 0.30 <0.0001 0.73 0.98 1 Upper row = correlation coefficients; lower row = P values. 2 n = 72.

PAGE 119

119 Table 4 6. Growth performance and BCS of multiparous cows 1 that had their calves early weaned on d 0 (EW) or normally weaned on d 180 (NW). Day of the study 0 30 60 90 120 150 180 SEM Treatment x time BW, kg EW 456 a 446 a 447 b 474 c 501 d 518 e 520 e 5.3 <0.0001 NW 454 c 438 b 423 a 429 a 465 c 465 c 467 c 8.6 P 2 0.91 0.42 0.02 <0.0 001 0.0007 <0.0001 <0.0001 BCS 3 EW 4.7 a 4.9 b 5.2 c 5.4 d 5.9 e 6.2 f 6.7 g 0.08 0.005 NW 4.6 b 4.3 a 4.4 a 4.5 ab 4.7 b 4.9 b 4.9 b 0.12 P 2 0.35 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 1 n = 20 and 60 (yr 1), and 20 and 56 (yr 2) for NW and EW multiparous cows, respectively. 2 Treatment comparison within day using the SLICE option of SAS. 3 Average scores from 2 technicians at each collection date using a 1 to 9 scale (1 = emaciated and 9 = obese).

PAGE 120

120 Table 4 7. Growth and reproductive performance of multiparous cows 1 that had their calves early weaned on d 0 (EW) or normally weaned on d 180 (NW). Treatment Effect Item NW EW SEM Trea t ment Y r Treatmen t x Y r BW, kg d 0 45 4 45 6 8 0.99 0.22 0.48 d 180 46 7 52 0 13 0.00 1 0.08 0.22 BW change 1 3 64 5 <0.0001 0.31 0.6 0 BCS 2 d 0 4.6 4.7 0.12 0.44 0.002 0.97 d 180 4.9 6.7 0.13 <0.0001 0.01 0.79 BCS change 0.3 2.0 0.15 <0.0001 0.76 0.82 Pregnancy rate 3 % 81 9 1 3.1 0.11 0.45 0.23 Calving interval, d 391 381 5.7 0.12 0.01 0.74 1 n = 20 and 60 (yr 1), and 20 and 56 (yr 2) for NW and EW multiparous cows, respectively. 2 Average scores from 2 technicians at each collection date using a 1 to 9 scale (1 = emaciated and 9 = obese). 3 Pregnancy rates confirmed at calving.

PAGE 121

121 Table 4 8. Calving distribution (% of pregnant cows) of multiparous cows 1 that had their calves early weaned (EW) on d 0 or normally weaned (NW) on d 180. Day of the study Item 252 25 9 266 273 280 287 294 301 308 315 322 329 336 343 350 357 364 371 SEM P 2 NW 3.3 6.7 26.7 30.0 42.6 51.8 61.0 63.9 69.8 82.4 82.4 82.4 85.3 94.1 94.1 94.1 97.1 100 2.98 0.02 EW 2.0 6.0 13.0 28.0 33.8 45.6 58.0 69.5 81.0 89.5 93.3 93.3 95.2 96.2 97.2 97.2 100 100 5.29 P 3 0.83 0.91 0.03 0.74 0.15 0.31 0.62 0.35 0.07 0.24 0.07 0.07 0.10 0.73 0.61 0.61 0.61 1.00 1 n = 20 and 60 (yr 1), and 20 and 56 (yr 2) for NW and EW multiparous cows, respectively. 2 Treatment x time effect. 3 Treatment comparison within day using the SLICE option of SAS.

PAGE 122

122 Figure 4 1. Body weight of heifers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180). From d 0 to 90, NW heifers remained with cow s on bahiagrass pasture s without concentrate supplementation ; EW180 and EW90 heifers were limit fed a high concentrate diet in drylot; and EWRG heifers grazed ryegrass pastures until d 60 (yr 1) and 90 (yr 2). A treatment x ti me ( P < 0.0001) w as detected for BW of heifers from d 0 to 90 (SEM = 2.0).

PAGE 123

123 Figure 4 2 Body weight of heifers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of norma l weaning (d 180) in yr 1 From d 90 to 180, NW heifers remained with cows on bahiagrass pastures without concentrate supplementation; EW180 heifers were limit fed a high concentrate diet in drylot until d 180; and EW90 and EWRG heifers grazed bahiagrass pastures until d 180. On d 180, NW heifers were weaned, and all heifers were grouped by treatment and rotated among bahiagrass pasture s until d 390. A treatment x time effect was detected from d 9 0 to 18 0 ( P < 0.0001 ; SEM = 3.9 ), but not from d 180 to 390 ( P = 0.89 ; SEM = 4.1 ).

PAGE 124

124 Figure 4 3 Body weight of heifers developed on different calf management systems fr om the time of early weaning (d 0 ) until the time of normal weaning (d 180) in yr 2 From d 90 to 180, NW hei fers remained with cows on bahiagrass pastures without concentrate supplementation; EW180 heifers were limit fed a high concentrate diet in drylot until d 180; and EW90 and EWRG heifers grazed bahiagrass pastures until d 180. On d 180, NW heifers were wea ned, and all heifers were grouped by treatment and rotated among bahiagrass pasture until d 390. A treatment x time e ffect was detected from d 90 to 1 8 0 ( P < 0.0001 ; SEM = 5.1 ), but not from d 180 to 390 ( P = 0.82 ; SEM = 9.2 ).

PAGE 125

125 Figure 4 4 Liver GHR 1A mRNA expression of heifers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180) in yr 1 From d 0 to 180, NW heifers remained with c ows on bahiagrass pastures without concentrate supplementation; EW180 heifers were limit fed a high concentrate diet in drylot; EW90 heifers were limit fed a high concentrate diet until d 90 then grazed on bahiagrass pastures until d 180; and EWRG heifer s grazed on ryegrass pastures until d 60 then on bahiagrass pastures until d 180. On d 180, NW heifers were weaned, and all heifers were grouped by treatment and rotated among bahiagrass pasture until d 390. Within each sampling day d ata was reported as fold increase relative to 18S expression. In yr 1, a treatment x time effect was detected ( P = 0.001) for liver GHR 1A mRNA. a b Within sampling da y means without a common superscript differ ( P a b b b a a b b a a a a

PAGE 126

126 Figure 4 5 Liver IGF 1 mRNA expression of heifers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180). From d 0 to 180, NW hei fers remained with cows on bahiagrass pastures without concentrate supplementation; EW180 heifers were limit fed a high concentrate diet in drylot; EW90 heifers were limit fed a high concentrate diet until d 90 then grazed on bahiagrass pastures until d 180; and EWRG heifers grazed on ryegrass pastures until d 60 (yr 1) and 90 (yr 2) then on bahiagrass pastures until d 180. On d 180, NW heifers were weaned, and all heifers were grouped by treatment and rotated among bahiagrass pasture until d 390. Within each sampling day d ata was reported as fold increase relative to 18S expression. A treatment x time effect was detected ( P = 0.003) for liver IGF 1 mRNA expression (SEM = 0.18). a b Within sampling da y means without a common superscript differ ( P a a a b a a b b a a b ab

PAGE 127

127 Figure 4 6 Plasma IGF 1 concentrations of heifers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180). From d 0 to 180, NW heifers remai ned with cows on bahiagrass pastures without concentrate supplementation; EW180 heifers were limit fed a high concentrate diet in drylot; EW90 heifers were limit fed a high concentrate diet until d 90 then grazed on bahiagrass pastures until d 180; and E WRG heifers grazed on ryegrass pastures until d 60 (yr 1) and 90 (yr 2) then on bahiagrass pastures until d 180. On d 180, NW heifers were weaned, and all heifers were grouped by treatment and rotated among bahiagrass pasture until d 390. A treatment x ti me effect was detected ( P = 0.008) for plasma concentrations of IGF 1 (SEM = 11.4). a b Within sampling day, means without a common superscript differ ( P a a a b a b a a a a a a

PAGE 128

128 Figure 4 7 Accumulative puberty achievement (% of total heifers) of heifers developed on different calf management systems from the time of early weaning ( d 0 ) until the time of normal weaning (d 180). From d 0 to 180, NW heifers remained with cows on bahiagrass pastures without concentrate supplementation; EW180 heifers were limit fed a high concentrate diet in drylot; EW90 heifers were limit fed a high concentrate diet until d 90 then grazed on bahiagrass pastur es until d 180; and EWRG heifers grazed on ryegrass pastures until d 60 (yr 1) and 90 (yr 2) then on bahiagrass pastures until d 180. On d 180, NW heifers were weaned, and all heifers were grouped by treatment and rotated among bahiagrass pasture until d 390. Breeding season occurred from d 33 0 to 390. Treatment x time ( P < 0.0001 ) was detected for accumulative puberty rate.

PAGE 129

129 LIST OF REFERENCES Abdelsamei, A. H., D. G. Fox, L. O Tedeschi, M. L. Thonney, D. L. Ketchen, and J. R. Stouffer. 2005. The eff ect of milk intake on forage intake and growth of nursing calves. J. Anim. Sci. 83:940 947. Allen, C. C., B. R. C. Alves, X. Li, L. O. Tedeschi H. Zhou, J. C. Paschal, P. K. Riggs, U. M. Braga Neto, D. H. Keisler, G. L. Williams and M. Amstalden. 2012. G ene expression in the arcuate nucleus of heifers is affected by controlled intake of high and low concentrate diets J. Anim. Sci. 90:2222 2232. Allen, R. E., R. A. Merkel, and R. B. Young. 1979. Cellular aspects of muscle growth: Myogenic cell prolifera tion. J. Anim. Sci. 49:115 127. Anderson, P. T. 1991. Trenbolone acetate as a growth promotant. Comp Cont. Ed. Pract. Vet. 13:1179 1190. Anderson, W. J., D. W. Forrest, B. A. Goff, A. A. Shaikh, and P. G. Harms. 1986. Ontogeny of ovar ian inhibition of p ulsatile lu teinizing hormone secretion in postnatal Holstein heifers Domest. Anim. Endocrinol. 3 :107 116. Ansotegui, R. P., K. M. Havstad, J. D. Wallace, and D. M. Hallford. 1991. Effects of milk intake on forage intake and performance of suckling range calves. J. Anim. Sci. 69:899 904. Aronica S M and B. S. Katzenelle nbogen 1993. St imulation of estrogen receptor mediated transcription and alteration in the phosphorylation state of the rat uterine estrogen receptor by estrogen, cyclic adenosine mono phosphate, and insulin like growth factor I. Mol Endocrinol 7:743 752. Arthington, J. D. 2008. Early weaning: A management alternative for Florida beef cattle producers. http://edis.ifas.u fl.edu/pdffiles/AN/AN13100.pdf (Accessed 6 May 2013) Arthington, J. D., and J. E. Minton. 2004. The effect of early calf weaning on feed intake, growth, and postpartum interval in thin, Brahman crossbred primiparo us cows. Prof. Anim. Sci. 20:34 38. Arth ington, J. D., and L. R. Corah. 1995. Liver biopsy procedures for determining the trace mineral status in beef cows. Part II. (Video, AI 9134). Extension TV, Dep. Commun. Coop. Ext. Serv., Kansas State Univ., Manhattan. Arthington, J. D., and R. S. Kalmba ch er. 2003. Effect of early weaning on the performance of three year old, first calf beef heifers reared in the su btropics. J. Anim. Sci. 81:1136 1141.

PAGE 130

130 Arthington, J. D., J. W. Spears, and D. C. Miller. 2005. The effect of early weaning on feedlot perfo rmance and measures of stress in be ef calves. J. Anim. Sci. 83:933 939. Bach, A. 2012. Nourishing and managing the dam and postnatal calf for optimal lactation, reproduction, and immunity. J. Anim. Sci. 90:1835 1845. Bachelot A P. Monget, P. Imbert Bo llore, K. Coshigano, J. J. Kopchick, P. A. Kelly, and N. Binart. 2002. Growth hormone is required for ovarian follic ular growth. Endocrinology 143:4104 4112. Badinga, L., R. J. Collier, W. W. Thatcher, C. J. Wilcox, H. H. Head, and F. W. Bazer. 1991. On togen y of hepatic bovine growth hor mone receptors i n cattle. J. Anim. Sci. 69:1925 1934. Bagley, C. P. 1993. Nutritional management of replacement beef heifers: A review. J. Anim. Sci. 71:3155 3163. Bailey, C. B., and J. E. Lawson. 1981. Estimated water and forage intake in nursing beef calves. Can. J. Anim. Sci. 61:415 421. Bailey, P., T. Holowacz, and A. B. Lassar. 2001. The origin of skeletal muscle stem cells in the embryo and the adult. Curr. Opin. Cell Biol. 13:679 689. Ballou, M. A. 2012. Immune responses of Holstein and Jersey calves during the preweaning and immediate postweaned periods when fed varying planes of milk replacer. J. Dairy Sci. 95:7319 7330. Barker D J. 1992. Fetal growth and adult disease. Br J Obstet Gynaecol 99:275 27 6. Barker, D. J. 1993. Fetal nutrition and cardiovascular disease in adult life. Lancet 341:938 941. Barker, R. D., and J. M. Barker. 1978. Milk fed calves. 4. The effect of herbage allowance and milk intake upon herbage intake and performance of grazing ca lves. J. Agric. Sci. 87:187 196. Barker Neef, J. M., D. D. Buskirk, J. R. Blackt, M. E. Doumit and S. R. Rust. 2001. Biological and economic performance of early weaned Angus steers. J. Anim. Sci. 79:2762 2769. Bell, A. W. 1995. Regulation of organic nut rient metabolism during transition from late pregnancy to early lactation. J. Anim. Sci. 73:2804 2819.

PAGE 131

131 Berelowitz M M. Szabo, L. A. Frohman, S. Firestone, L. Chu, and R. L. Hintz 1981 Somatomedin C mediates growth hormone negative feedback by effect s on both the hypothalamus and the pituitary. Science 212 : 1279 1281. Berge, P. 1991. Long term effects of feeding during calfhood on subsequent performance in beef cattle (a review). Livest. Prod. Sci. 28:179 201. Bermingham E. N., S. A. Bassett W. Young, N. C. Roy, W. C. McNabb, J. M. Cooney, D. T. Brewster, W. A. Laing, and M. P. G. Barnett. 2013. Post weaning selenium and folate supplementation affects gene and protein expression and global DNA methylation in mice fed high fat diets BMC Med Genomics. 6:7 18. Binoux, M., and P. Hossenlopp. 1988. Insulin like growth factor (IGF) and IGF binding proteins: comparison of human serum and lymph. J. Clin. Endocrinol. Metab. 67:509 514 Bischoff, R. 1975. Regeneration of single skeletal muscle fibers in vitro. Anat. Rec. 182:215 235. Bishop, D. K., R. P. Wettemann and L. J. Spicer 1994. Body energy reserves influence the onset of luteal activity after early weaning of beef cows J. Anim. Sci. 72:2703 2708. Bond, J., N. W. Hooven, E. J. Warwick, R. L. Hiner, and G. V. Richardson. 1972. Influence of breed and plane of nutrition on performance of dairy, dual p urpose and beef steers. II. From 180 days of age to slaughter. J. Ani m. Sci., 34:1046 1053. Bonnet, M., I. Cassar Malek, Y. Chilliard, and B. Picard. 2010. Ontogenesis of muscle and adipose tissues and their interactions in ruminants and other species. Animal 4:1093 1109. Brown, E. G., M. J. VandeHaar, and K. M. Daniels. 2005a. Effect of increasing energy and protein intake on body growth and carcass composition of heifer calves. J. Dairy Sci. 88:585 594. Brown, E. G., M. J. VandeHaar, K. M. Daniels, J. S. Liesman, L. T. Chapin, J. W. Forrest, R. M. Akers, R. E. Pearson, and M. S. W. Nielsen. 2005b. Effect of increasing energy and protein intake on mammary development in heifer calves. J. Dairy Sci. 88:595 603. Butler, S. T., A. L. Marr, S. H. Pelton, R. P. Radcliff, M. C. Lucy, and W. R. Butler. 2003. Insulin restores GH responsiveness during lactation induced negative energy balance in dairy cattle: Effects on expression of IGF I and GH receptor 1A. J. Endocrinol. 176 :205 217.

PAGE 132

132 Byerley, D. J., R. B. Staigmiller, J. B. Berardinelli, and R. E. Short. 1987. Pregnancy rates of beef heifers bred either on puber t al or third estrus. J. Anim. Sci. 65:645 650. Cafe, L M H. Hearnshaw, D. W. Hennessy and P. L. Greenwood 2006 Growth and carcass characteristics at heavy market weights of Wagyu sired steers following slow or ra pid growth to weaning. Aus J. Exp Agri 46 : 951 955. Callow, E. H. 1961. Comparative studies of meat VII. A comparison between Hereford, Dairy Shorthorn and Friesian steers on four levels of nutrition. J. Agric. Sci. 56:268 282. Capuco, A. V., J. J. Smi th, D. R. Waldo, and C. E. Rexroad, Jr. 1995. Influence of prepubertal dietary regimen on mammary growth of Holstein heifers. J. Dairy Sci. 78:2709 2725. Cardasis, C. A., and G. W. Cooper. 1975. An analysis of nuclear numbers in individual muscle fibers d uring differentiation and growth: A satellite cell muscle fiber gro wth unit. J. Exp. Zool. 191:347 358. Carstens, G. E., D. E. Johnson, M. A. Ellenburger, and J. D. Tatum. 1991. Physical and chemical co mponents of the empty body dur ing compensatory growth in bee f steers. J. Anim. Sci. 69:3251 3264. Carter Su, C., J. Schwartz, and L. S. Smit. 1996. Molecular mechanism of growth hormone action. Annu. Rev. Physiol. 58: 187 207. Chan, Y. Y., D. K. Clifton, and R. A. Steiner. 1996. Role of NPY neurons in GH dependent feedback signalling to the brain. Horm. Res. Suppl. 1:12 14. Chandrashekar, V., D Zaczek, and A Bartke 2004. The consequences of altered somatotropic system on r eproduction B iol. R eprod. 71 : 17 27 Chung K. Y. and B. J. Johnson 2008. Appli cation of cellular mechanisms to growth and development of food producing animals J A nim. S ci. 86:E226 E235. Cianzio, D. S., D. G. Topel, G. B. Whitehurst, D. C. Beitz, and H. L. Self. 1985. Adipose tissue growth and cellularity: Changes in bovine adipo cyte size a nd number. J. Anim. Sci. 60:970 976. Clemmons, D. R. 1991. Insulin like growth factors binding proteins In: D. LeRoith (ed) Insulin l ike g rowth f actors: Molecular and c ellular a spects. CRC Press, Boca Raton, FL p 151 179. Clemmons D R M. M. Seek, and L. E. Underwood 1985 Supplemental e ssential amino acids augment the somatomedin C/insulin like growth factor I response to refeeding after fasting. Metabolism 34:391 395

PAGE 133

133 Clutter, A.C. and M. K Nielsen 1987. Effect of level of beef cow mil k production on pre and postweaning calf growth. J. Anim. Sci. 64:1313 1322. Codner E and F. Cassorla. 2002. Growth hormone and reproductive function. Mol Cell Endocrinol 186:133 136. Cole, N. A., M. R. Irwin, and J. B. McLaren. 1979. Influence of p re tra nsit feeding re gime and pos t transit B vitamin supplement ation on stressed feed er steers. J. Anim. Sci. 49:310 317. Cooke, R. F., and J. D. Arthington, J. D. 2012. Concentrations of haptoglobin in bovine plasma determined by ELISA or a colorimetric method based on peroxidase activity. J. Anim. Phys. and Anim. Nut. Published online on April 5th, 2012. DOI: 10.1111/j.1439 0396.2012.01298.x Cooke, R. F., J. D. Arthington, C. R. Staples, W. W. Thatcher, and G. C. Lamb. 2007 Effects of supplement type o n performance, reproductive, and physiological responses of Brahman crossbred females. J Anim Sci. 85:2564 25 74. Cooke, R. F., J. D. Arthington, D. B. Araujo, G. C. Lamb, and A. D. Ealy. 2008. Effects of supplementation frequency on performance, reprodu ctive, and metabolic responses of Brahman crossbred females. J. Anim. Sci. 86:2296 2309. Cooke, R. F., D. W. Bohnert, C. L. Francisco, R. S. Marques, C. J. Mueller and D. H. Keisler 2013. Effects of bovine somatotropin administration on growth, physiolog ical, and reproductive responses of replacement beef heifers http://www.journalofanimalscience.org/content/early/2013/03/09/jas.2012 6082 (Accessed on 11 May 201 3) Coolican, S. A., D. S. Samuel, D. Z. Ewton, F. J. McWade, and J. R. Florini. 1997. The mitogenic and myogenic actions of insulin like growth factors utilize distinct signaling pathways. J. Biol. Chem. 272:6653 6662. Cooper, R. N., S. Tajbakhsh, V. Mou ly, G. Cossu, M. Buckingham, and G. S. Butler Browne. 1999. In vivo satellite cell activation via Myf5 and MyoD in regenerating mouse skeletal muscle. J. Cell Sci. 112:2895 2901. Coyne, G. S., D A. Kenny, and S M. Waters. 2011. Effect of dietary n 3 po lyunsaturated fatty acid supplementation on bovine uterine endometrial and hepatic gene expression of the insulin like growth factor system Theriogenology 75 : 500 512 D aftary S. S., and A C. G ore 2005. IGF 1 in the brain as a regulator of reproductive neuroendocrine f unction Exp Biol. Med. 230:292 306.

PAGE 134

134 Dauncey, M. J. 2013. Genomic and Epigenomic Insights into Nutrition and Brain Disorders Nutrients. 5:887 914 Davis, C.L., and J.H. Clark. 1981. Ruminant digestion and metabolism. Dev. Ind, Microbio l. 22:247 259 Davis Rincker, L. E., M. J. VanderHaar, C. A. Wolf, J. S. Liesman, L. T. Chapin, and M. S. Weber Nielsen. 2011. Effect of intensified feeding of heifer calves on growth, pubertal age, calving age, milk yield, and economics. J. Dairy Sci. 94 :3554 3567. Day, M. L., and L. H. Anderson. 1998. Current concepts on the control of puberty in cattle. J. Anim. Sci. 76:1 15. Dayton W. R. and M. E. White 2008. Cellular and molecular regulation of muscle growth and development in meat animals J A ni m. S ci. 86:E217 E225. Demetriou, J. A., P. A. Drewes, and J. B. Gin. 1974. Ceruloplasmin. Pages 857 864 in Clinical Chemistry. D. C. Cannon, and J. W. Winkelman, ed. Harper and Row, Hagerstown, MD. Diaz, M. C., M. E. Van Amburgh, J. M. Smith, J. M. Kelse y, and E. L. Hutten. 2001. Composition of growth of Holstein calves fed milk replacer from birth to 105 kilogram body weight. J. Dairy Sci. 84:830 842. DiGirolamo M J. B. Fine, and K. R. Tagra. 1998 Qualitative regional differences in adipose tissue growth and cellularity in male Wistar rats fed ad libitum. Am. J. Physiol. 274 : R1460 R1467. Dimitriadis, G., M. Parry Billings, S. Bevan, D. Dunger, T. Piva, U. Krause, G. Wegener, and E. A. Newsholme. 199 2. Effects of insulin like growth factor I on the rates of glucose transport and utilization in rat skeletal muscle in vitro. Biochem. J. 285:269 274. Drouillard, J. S., T. J. Klopfenstein, R. A. Britton, M. L. Bauer, S. M. Gramlich, T. J. Wester, and C. L. Ferrell. 1991. Growth, body composition, and vi sceral organ mass and metabolism in lambs during and after metabolizable protein or net energy rest rictions. J. Anim. Sci. 69:3357 3375. Du, M., J. Tong, J. Zhao, K. R. Underwood, M. Zhu, S. P. Ford and P. W. Nathanielsz. 2010. Fetal programming of skelet al muscle development in ruminant animals. J. Anim. Sci. 88:E51 E60. Du, M., Y. Huang, A. K. Das, Q. Yang, M. S. Duarte, M. V. Dodson and M. J. Zhu 2013. Manipulating mesenchymal progenitor cell differentiation to optimize performance and carcass value o f beef cattle J A nim. S ci. 91:1419 1427.

PAGE 135

135 Dunham, I., A. Kundaje, S. F. Aldred, P. J. Collins, C. A. Davis, F. Doyle, C. B. Epstein, S. Frietze, J. Harrow, R. Kaul, et al. 2012. An integrated encyclopedia of DNA elements in the human genome. Nature 489 : 57 74. Elsasser, T. H., T. S. Rumsey, and A. C. Hammond. 1989. Influence of diet on basal and growth hormone stimulated plasma concentrations of IGF 1 in beef cattle. J. Anim. Sci. 67:128 141. Endecott, R. L., R. N. Funston, J. T. Mull iniks, and A. J. R oberts. 2013. Implications of beef heifer development systems and lifetime productivity. J. Anim. Sci. 91:1329 1335. Etherton, T. D. 2004. Somatotropic function: The somatomedin hypothesis revisited. J. Anim. Sci. 82(E. Suppl.):E239 E244. Etherton T D and D. E. Bauman 1998 Biology of somatotropin in growth and lactation of domestic animals. Physiol Rev 78 :745 761 Evans, A.C.O., G. P. Adams, and N. C. Rawlings. 1994 Follicular and hormonal development in prepubertal heifers from 2 to 36 weeks of age. J. Reprod. Fertil. 102:463 470. Evans, A.C.O., W. D. Currie, and N. C. Rawlings. 1992. Effects of naloxone on circulating gonadotropin concentrations in prepubertal heifers. J. Reprod. Fertil. 96847 855. Faber, S. N., N. E. Faber, T. C. McCauley, a nd R. L. Ax. 2005. Case study: Effects of colostrum i ngestion on lactational performance. Prof. Anim. Sci. 21:420 425. Faulkner, D. B., D. F. Hummel, D. D. Bu skirk, L. L. Berger, D. F. Par rett, and G. F. Cmarik. 1994. Performance and nutrient metabolism b y nursing calves supplemented with limited or unlimited corn or soyhulls. J. Anim. Sci. 72:470 477. Fenech, M. F. 2010. Dietary refere nce values of individual micro nutrients and nutriomes for genome damage prevention: Cur rent status and a road map to the future. Am. J. Clin. Nutr. 91(Suppl.):1438S 1454S. Fernandez Galaz, M. C., F. Naftolin, and L. M. Garcia Segura. 1999. Phasic synaptic remodeling of the rat arcuate nucleus during the estrous cycle depends on insulin like growth factor I receptor activati on. J Neurosci Res 55:286 292. Ferrell, C. L. 1982. Effects of postweaning rate of gain on onset of puberty and productive performance of heifers of different breeds. J Anim. Sci. 55: 1272 1283. Flegal, K. M., M. D. Carroll, C. L. Ogden, and L. R. Cu rtin. 2010. Prevalence and trends in obesity among US adults, 1999 2008. J. Amer. Medic. Assoc. 303:235 241.

PAGE 136

136 Florini, J. R., D. Z. Ewton, S. A. Coolican 1996. Growth hormone and the insulin like growth factor system in myogenesis Endocr. Rev. 17 : 481 517 Fluharty, F. L., and S. C. Loerch. 1996. Effect of dietary energy source and level on performance of newly arrived feedlot cattle. J. Anim. Sci. 74:504 513. Fluharty, F. L., S. C. Loerch, T. B. Turner, S. J. Moeller, and G. D. Lowe. 2000. Effects of wea ning age and diet on growth and carcass characteristics i n steers. J. Anim. Sci. 78:1759 1767. Fox, D. G., R. R. Johnson, R. L. Preston, T. R. Dockerty, and E. W. Klosterman. 1972. Protein and energy utilization during compensatory growth in beef cattle. J. Anim. Sci. 34:310 318. Funston, R. N., G. E. Seidel, J. Klindt, and A. J. Roberts. 1996. Insulin like growth factor I and i nsulin like growth factor bind ing proteins in bovine serum and follicular fluid before and after the preovulatory surge of lutein izing hormone. Biol. Reprod. 55:1390 1396. Funston, R. N., J. L. Martin, D. M. Larson, and A. J. Roberts. 2012. Nutritional aspects of developing replacement heifers. J. Anim. Sci. 90:1166 1171. Gallaher, R. N., C. O. Weldon, and J. G. Futral. 1975. An a luminum block digester for plant and soil analysis. Soil Sci. Soc. Am. J. 39:803. Garcia, M. R., M. Amstalden, S. W. Williams, R. L. Stanko, C. D. Morrison, D. H. Keisler, S. E. Nizielski, and G. L. Williams. 2002. Serum leptin and its adipose gene expres sion during pubertal development, the estrous cycle, and different seasons in cattl e. J. Anim. Sci. 80:2158 2167. Gardan D F. Gondret and I. Louveau 2006. Lipid metabolism and secretory function of porcine intramuscular adipocytes compared with subcu taneou s and perirenal adipocytes. Am. J. Physiol. Endoc. Metab. 291:E372 E380. Gasser, C. L. 2013. Considerations on puberty in replacement beef heifers. J. Anim. Sci. 91:1336 1340. Gasser C. L., D. E. Grum, M. L. Mussard, F. L. Fluharty, J. E. Kinder, and M. L. Day 2006a. Induction of precocious puberty in heifers I: enhanced secretion of luteinizing hormone. J Anim Sci 84:2035 2041. Gasser C. L., C. R. Burke, M. L. Mussard, E. J. Behlke, D. E. Grum, J. E. Kinder, and M. L. Day. 2006b. Induction of precocious puberty in heifers II: Advanced ovarian follicular development. J Anim Sci 84: 2042 2049.

PAGE 137

137 Gasser C. L., G. A. Bridges, M. L. Mussard, D. E. Grum, J. E. Kinder, and M. L. Day. 2006c. Induction of precocious puberty in heifers III: Hastene d of estradiol negative feedback on secretion of luteinizing hormone. J Anim Sci 84: 2050 2056. Gasser C. L., E. J. Behlke, D. E. Grum, and M. L. Day. 20 06d. Ef fect of timing of feeding high concentrate diet on growth and attainment of puberty in early weaned heifers. J Anim Sci 84: 3118 3122. Gazal, O. S., L. S. Leshin, R. L. Stanko, M. G. Thomas, D. H. Keisler, L. L. Anderson, and G. L. Williams. 1998. Gonadotropin releasing hormone secretion into third ventricle cerebrospinal fluid of cattle: Corr espondence with the tonic and surge release of luteinizing hormone and its tonic inhibition by suckling and neuropeptide Y. Biol. Reprod. 56:676 683. Geary, T. W., J C Whittier, D M Hallford and M D MacNeil 2001. Calf removal improves conception r ates to the Ovsynch and CO Synch protocols. J A nim. S ci. 79:1 4. Gibb, D. J., and T. A. McCallister. 1999. The impact of feed intake and feeding behaviour of cattle on feedlot and feedbunk management. In: D. Korver and J. Morrison, editors, Proceedings o f the 20 th Western Nutrition Conference on Marketing to the 21 st century, p. 101 106. Glavas M M M. A. Kirigiti, X. Q. Xiao, P. J. Enriori, S. K. Fisher, A. E. Evans, B. E. Grayson, M. A. Cowley, M. S. Smith, and K. L. Grove 2010. Early overnutri tion results in early onset arcuate leptin res istance and increased sensitivity to hi gh fat diet. Endocrinology.151:1598 1610. Gong, J. G., G. Baxter, T. A. Bram ley, and R. Webb. 1997. Enhance ment of ovarian follicle development in heifers by treatment with r ecombinant bovine somatotrophin: A dose response s tudy. J. Reprod. Fertil. 110:91 97. Gong, J. G., D. McBride, T. A. Bramley, and R. Webb. 1994. Effects of recombinant bovine somatotroph in, insulin like growth factor I and insulin on bovine granulosa cell steroidogenesis i n vitro. J. Endocrinol. 143:157 164. Govoni, K. E. T. A. Hoagland and S. A. Zinn 2003. The ontogeny of the somatotropic axis in male and female Hereford calves from birth to one year of age J A nim. S ci. 81:2811 2817. Gonzalez, J. M R. D. Dijkhuis, D. D. Johnson, J. N. Carter and S. E. Johnson 2008. Differential response of cull cow muscles to the hypertrophic actions of ractopamine hydrogen chloride J Anim Sci 86:3568 3574.

PAGE 138

138 Grant A C G. Ortiz Colon, M. E. Doumit, R. J. Tempelman, and D. D. Buskirk 2008. Differentiation of bovine intramuscular and subcutaneous stromal vascular cells exposed to dexamethasone and troglitazone. J Anim. Sci. 86 : 2531 2538. Graugnard D P. Piantoni, M. Bionaz, L. L. Berger, D. B. Faulkner and J. J. Loor. 2009. Adipogenic and energy metabolism gene networks in longissimus lumborum during rapid post we aning growth in Angus and Angus x Simmental cattle fed high or low starch diets. BMC Genomics 10 : 142 156 Graugnard, D. E., L. L. Berger, D B. Faulkner, and J. J. Loor. 2010. High starch diets induce precocious adipogenic gene network up regulation in longissimus lumborum of early weaned Angus cattle. Br J. Nutr. 103:953 963. Green, W. W ., and J. Buric. 1953. Compara tive performance of bee f calves weaned at 90 and 180 days of age. J. Anim. Sci. 12:561 572 Greenwood, P. L., and L. M. Cafe. 2007. Prenatal and pre weaning growth and nutrition of cattle: long term consequences for beef production. Animal. 1:1283 1296. Greenwood P L A. S. Hunt, J. W. Hermanson, and A. W. Bell. 2000. Effects of birth weight and postnatal nutrition on neonatal sheep: II. Skeletal muscle growth and development. J Anim Sci 78:50 61. Greenwood P L L. M. Cafe, H. Hearnshaw and D. W. Hennessy 2005. Con sequences of nutrition and growth retardation early in life for growth and composition of cattle and eating quality of beef. Rec Adv Anim Nut Aus 15 : 183 195. Greenwood P L L. M. Cafe, H. Hearnshaw, D. W. Hennessy, J. M. Thompson and S. G. Morris 2006. Long term consequences of birth weight and growth to weaning for carcass, yield and beef quality characteristics of Piedmontese and Wagyu sired cattle. Aus J. Exp Agric 46 : 257 269. Griffen, J. L. and R.D. Randel. 1978. Reproductive studies of Brahman cattle: II. Luteinizing hormone patterns in ovariectomized Brahman and Hereford cows before and after injection of gonadotropin releasing hormone. Theriogenology 9:437 446. Guernec, A., B. Chevalier, M. J. Duclos. 2004. Nutrient supply enhances bo th IGF I and MSTN mRNA levels in chicken skeletal muscle. Domes Anim Endoc 26 :143 154 Gunnell D L. L. Miller, I. Rogers, J. M. Holly, and ALSPAC Study Team. 2005. Association of insulin like growth factor I and insulin like growth factor binding pr otein 3 with intelli gence quotient among 8 to 9 y r old children in the Avon Longitudinal Study of Parent s and Children. Pediatrics 116:e681:e686.

PAGE 139

139 Hafez, E. S. E., and L. A. Lineweaver. 1968. Suckling behaviour in natural and artificially fed neonate cal ves. Z. Tierpsychol. 25:187 198. Harper G S ., and D. W. Pethick 2004. How m ight m arbling b egin? Aus J. Exp Agric 44 : 653 662. Harvey, R. W., and J. C. Burns. 1988a. Creep grazing and early weaning effects on cow and calf productivity. J. Anim. Sci. 66:1109 1114 Harvey, R. W ., and J. C. Burns. 1988b. For age species, concentrate feeding level and cow management system in combination with early weaning. J. Anim. Sci. 66:2722 2727. Harvey, R. W., J. C. Burns, T. N. Blumer, and A. C. Linnerud. 1975. In fluence of early weaning on calf and pasture pro ductivity. J. Anim. Sci. 41:740 746. Hashizume, T., A. Kumahara, M. Fujin o, and K. Okada. 2002. Insulin like growth factor I enhances gonadotropin releasing hormone stimulated luteinizing hormone release fr om bovine anterior pituitary cells. Anim. Reprod. Sci. 70:13 21. Hausman, D. B., M. DiGirolamo, T. J. Bartness, G. J. Hausman, and R. J. Martin. 2001. The bio logy of white adipocyte proliferation. Obes. Rev. 2:239 254. Hausman, G. J., M. V. Dodson, K. Aj uwon, M. Azain, K. M. Barnes, L. L. Guan, Z. Jiang, S. P. Poulos, R. D. Sainz, S. Smith, M. Spurlock, J. Novakofski, M. E. Fernyhough, and W. G. Bergen. 2009. The biology and regulation of preadipocytes and adipocytes in meat animals. J. Anim. Sci. 87:1218 1246. Hennessy D W ., and S. G. Morris 2003. Effect of a preweaning growth restriction on the subsequent growth and meat quality of yearling steers and heifers. Aus J Exp Agri 43 : 335 341. Hersom, M. J., C. R. Krehbiel, G. W. Horn, and J. G. Kirkpa trick. 2003. Effect of the live weight gain of steers during winter grazing on digestibility, acid base balance, blood flow, and oxygen consumption by splanchnic tissues during adaptation and subsequent feeding of a high grain diet. J. Anim. Sci. 81:3130 3 140. Hess, B. W., S. L. Lake, E. J. Scholljegerdes, T. R. Weston, V. Nayigihugu, J. D. C. Molle, and G. E. Moss. 2005. Nutritional controls of beef cow reproduction. J. Anim Sci. 83:E9 0 106E. Hiney J K V. Srivastava, C. L. Nyberg, S. R. Ojeda, and W. L. Dees. 1996. Insulin like growth factor I of peripheral origin acts centrally to accelerate the initiation of female puberty. E ndocrinology 137:3717 3728

PAGE 140

140 Hixon, D. L., G. C. Fahey, D. J. Kesler, and A. L. Neumann. 1982. Effects of creep feeding and m onensin on reproductive performance and lactation of beef heifers. J. Anim. Sci. 55:467 474 Hocquette J. F. 2010. Endocrine and metabolic regulation of muscle growth and body composition in cattle Animal 4:1797 1809 Hocquette, J. F., F. Gondret, E. B aza, F. Mdale, C. Jurie and D. W. Pethick. 2010. Intramuscular fat content in meat producing animals: development, genetic and nutritional control, and identification of putative markers. Animal 4:303 319. Hodgson, J. 1971. The development of solid food intake in calves. 5. The relationship between liquid and solid food intake. Anim. Prod. 13:593 597. Holloway, J. W., and W. T. Butts, Jr. 1983. Influence of preweaning nutrition on growth of Angus calves provided a postweaning nutritional system resultin g in discontinuous growth. J Anim. Sci. 56:1407 1415. Hood, R. L., and C. E. Allen. 1973. Cellularity of bovine adipose tissue. J. Lipid Res. 14:605 610. Horn, G. W., and F. T. McCollum. 1987. Energy supplementation of grazing ruminants. In: M. Ju dkins (Ed.) Proc. Grazing Live stock N utrition Conf., Jackson, WY. p. 125 136. Hossner, K. L. 2005. Hormones, growth factors and adipose tissue. In: K. L. Hossner, editor, Hormonal regulation of farm animal growth. CABI Publishing, Cambridge, MA. p. 163 180. Hu E., P. Tontonoz, and B. M. Spie gelman. 1995. Transdifferentia tion of myoblasts by c. Natl. Acad. Sci. USA 92:9856 9860. Hyatt, J. P. K., G. E. McCall, E. M. Kander, H. Zhong, R. R. Roy, and K. A. Huey. 2008. Pax3/7 expression coincides with myo D during chronic skeletal muscl e overload. Muscle Nerve 38:861 866. Jirtle, R. L., and M. K. Skinner. 2007. Environmental epigenomics and disease suscept ibility. Nat. Rev. Genet. 8:253 262. Johnson, R. W. 1997. Inhibition of growth by pro inflammatory cy tokines: An integra ted view. J. Anim. Sci. 75:1244 1255. Jones, J. I., and D. R. Clemmons. 1995. Insulin like growth factors and their binding proteins: biolog ical actions. Endocr. Rev. 16:3 34.

PAGE 141

141 Kaung H L .1994. Growth dynamics of pancreatic islet cell populations during fetal and neo na tal development of the rat. Dev Dyn. 200:163 175. Keane, M. G. and M. J. Drennan 1983. Supplementation of grassfed calves. 3 Effects of con centrate level and protein con tent, and subsequent performance to sla ughter. It. J. Agric. Res., 22: 113 125. Khan, M. A., H. J. Lee, W. S. Lee, H. S. Kim, K. S. Ki, T. Y. Hur, G. H. Suh, S. J. Kang, and Y. J. Choi. 2007b. Structural growth, rumen development, and metabol ic and immune responses of Hol stein male calves fed milk through step down and conventional methods. J. Dairy Sci. 90:3376 3387. Khan, M. A., H. J. Lee, W. S. Lee, H. S. Kim, S. B. Kim, K. S. Ki, J. K. Ha, H. G. Lee, and Y. J. Choi. 2007 a Pre and postweaning performan ce of Holstein female calves fed milk through step down and conventiona l methods. J. Dairy Sci. 90:876 885. Khan, M. A., D. W. Weary, and M. A. G. von Keyserlingk. 2011. Invited review: Effects of milk ration on solid feed intake, weaning, and performanc e in dairy heifers. J. Dairy Sci. 94:1071 1081. Khouri, R. H., and F. S. Pickering. 1968. Nutrition of the milk fed calf I. Performance of calves fed on different levels of whole milk relative to body weight. N.Z. J. Agric. Res. 11:227 236. King, J. 1965 Ceruloplasmin. Pages 108 110 in Practical Clinical Enzymology. Van Nostrand, London. Knapp, J. R., H. C. Freetly, B. L. Reis, C. C. Calvert, and R. L. Baldwin. 1992. Effects of somatotropin and substra tes on patterns of liver metabo lism in lactating dai ry cattle. J. Dairy Sci. 75:1025 1035. Kojima M H. Hosoda, Y. Date, M. Nakazato, H. Matsuo and K. Kangawa 1999 Ghrelin is a growth hormone releasing acylated peptide from stomach. Nature 402 :656 660. Koletzko, B. 2005. Early nutrition and its later consequences: new opportunities. Adv. Exp. Med. Biol. 569:1 12. Koletzko B T. Decsi D. Molnar, and A. de la Hunty 2009. Early nutrition programming and health outcomes in later lif e: obesity and beyond. Springer 646:198p. Koletzo, B., M. Symonds, and S. Olsen. 2011. Programming research: where are we and where do we go from here? Am. J. Clin. Nutr. 94:2036S 2043S.

PAGE 142

142 Kook, S. H., K. C. Choi, Y. O. Son, K. Y. Lee, I. H. Hwang, H. J. Lee, J. S. Chang, I. H. Choi, and J. C. Lee. 2006. Satellite cells isolated from adult Hanwoo muscle can proliferate and differentiate into myoblasts and adipos e like cells. Mol. Cells 22:239 245. Kuang S K. K uroda, F. Le Grand, and M. A. Rudnicki 2007. Asymmetric self renewal and commitment of satellite s tem cells in muscle. Cell 129:999 1010. Lack G D. Fox, K. Northstone, J. Golding, and ALSPAC Study Team. 2003 Factors associated with the development of peanut allergy in childhood. N Engl J Med 348 : 977 985. Lancaster, P. A., J. B. Corners, L. N. Thompson, M. R. Ellersieck, and J. E. Williams. 2007a. Effects of distillers dried grains with solubles as a protein source in a creep feed. 1. Suckling calf and dam performance. Prof. Anim. Sci. 23:83 90. Lancaster, P. A., J. B. Corners, L. N. Thompson, M. R. Elle rsieck, C. D. Buckner, and J. E. Williams. 2007b. Effects of distillers dried grains with solubles as a protein source in creep feed. 2. Subsequent feedlot performance, carcass measurements, and plasma parameters. Prof. Anim. Sci. 23:91 103. Lapierre, H., C. K. Reynolds, T. H. Elsasser, P. Gaudreau, P. Brazeau, and H. F. Tyrrell. 1992. Effects o f growth hormone releasing fac tor and feed intake on energy metabolism in growing beef steers: net hormone metabolism by portal drained viscera and liver. J. Anim. Sci. 70:742 751. Laster, D. B., H. A. Glimp, and K. E. Gregory. 1973. Effects of early weaning on postpartum reproduction of cows. J. Anim. Sci. 36:734 740. Lawren ce, T.L.J., and J. Pearce. 1964 Some effects of wintering yearling beef cattle on differ en t planes of nutrition. I. Liveweight gain, feed consumption and body measurement changes during the winter period and subsequent grazi ng period. J. Agric. Sci. Camb. 63:5 21. Le Roith, D., C Bondy, S Yakar, J Liu, a nd A Butler 2001. The s omatomedin h ypothesis: 2001 Endocr. Rev. 2001 22: 53 74. Lewis, J.M., Klopfenstein, T.J., Nielsen, M.K., Stock, R.A. and Hunt, C., 1989. Forage versus grain finishing systems and the fate of increased weaning weight due to an increased level of milk. Beef Cattle Rep ort 1989. The Agricultural Researc h Division, I.A.N.R., Univ. Ne braska Lincoln, p. 29 31. Lesmeister, J. L., P. J. Burfening, and R. L. Blackwell. 1973. Date of first calving in beef cows and subsequent calf production. J. Anim. Sci. 36:1 6.

PAGE 143

143 Li, C., P. Chen, and M. S. Smith. 1999. Morphological evidence for direct interaction between arcuate nucleus neuropeptide Y (NPY) neurons and gonadotropin releasing hormone neurons and the possible involvement of NPY Y1 receptors. Endocrinology 140:5382 5390. Li, C J., R. W. Li, Y. H. Wang, and T. H. Elsasser. 2007. Pathway analysis identifies perturbation of genetic networks induced by butyrate in a bovine kidney epithelial cell line. Funct. Integr. Genomics 7:193 205. Li, E. 2002. Chromatin modification and epig enetic reprogramming in mammalian development. Nat. Rev. Genet. 3:662 673. Li, H., L. Xiao, C. Wang, J. Gao, and Y. Zhai. 2010. Epigenetic regulation of adipocyte differentiation and adipogenesis. Biomed. Biotechnol. 11:784 791. Li, J., J. M. Gonzalez, D K. Walker, M. J. Hersom, A. D. Ealy and S. E. Johnson 2011. Evidence of heterogeneity within bovine satellite cells isolated from young and adult animals J A nim. S ci. 89:1751 1757. Li, R. W., and C. Li. 2006. Butyrate induces profound changes in gene expression related to multiple signal pathways in bovine kidney epithelial cells. BMC Genomics 7:234. Loerch, S. C., and F. L. Fluharty. 1999. Physiolo gical changes and di gestive capabilities of newly received feedlo t cattle. J. Anim. Sci. 77:1113 1119. Lowe Jr W L S. R. Lasky D. LeRoith, and C. T. Roberts Jr 1988 Distribution and regulation of rat insulin like growth factor I messenger ribo nucleic acids encoding alternative carboxy terminal E peptides: evidence for differential processing and regu lation in liver. Mol. Endocrinol. 2:528 535 Lowe Jr., W L C. T. Roberts Jr, S. R. Lasky and D. LeRoith 1987 Differential expression of alternative 5 un translated regions in mRNAs en coding rat insulin like growth factor I. P roc. Natl. Acad. Sci. USA 84:8946 8950 Lucas A. 1991. Programming by early nutrition in man. Ciba Found Symp .156:38 50. Lucy, M. C., C. K. Boyd, A. T. Koeni gsfeld, and C. S. Okamura. 1998. Ex pression of somatotropin receptor messenger ribonucleic acid in bovine tis sues. J. Dai ry Sci. 81:1889 1895. Lucy, M. C., C. R. Bilby, C. J. Kirby, W. Yuan, and C. K. Boyd. 1999. Role of growth hormone in the maintenance of follicles and corpora lutea. J. Reprod. Fertil. Suppl. 54:49 59.

PAGE 144

144 Lucy, M. C., H. Jiang, and Y. Kobayashi. 2001. Chan ges in the somatotrophic axis associated with the initiation of l actation. J. Dairy Sci. 84:E113 E119. Lusby, K. S., and A. A. Parra. 1981. Effects of early weaning on calf performance and on reproduction in mature cows. Oklahoma Agric. Exp. Stn. Rep., O klahoma State Univ., Stillwater. MP 108:6 4 68. Lusby, K. S., and R. P. Wettemann. 1986. Effects of limit fed high pro tein creep feed or early weaning on performance of fall born calves and their dams. Oklahoma Agric. Exp. Sta. Res. Rep. MP 118:202. Lusby K. S., R. P. Wettemann, and E. J. Tur man. 1981. Effects of early weaning calves from first calf heifers on calf and heifer performance. J. Anim. Sci. 53:1193 1197. Lynch, J. M., G. C. Lamb, B. L. Miller, R. T. Brandt, Jr, R. C. Cochran and J. E. Minton 1997. Influence of timing of gain on growth and reproductive performance of beef replacement heifers. J. Anim. Sci. 75:1715 1722. Machida, S. and F. W. Booth. 2004. Insulin like growth factor 1 and muscle growth: implication for satellite cell proliferat ion. Proc. Nutr. Soc. 63:337 340. Maciel, M. N., D. A. Zieba, M. Amstalden, D. H. Keisler, J. P. Neves, and G. L. Williams. 2004 Chronic administration of recombinant ovine leptin in growing beef heifers: Effects on secretion of LH, metabolic hormones, a nd timing of puberty. J. Anim. Sci. 82:2930 2936. Makimura, S., and N. Suzuki. 1982. Quantitative determination of bovine serum haptoglobin and it elevation in some inflammatory d isease. Jpn. J. Vet. Sci. 44:15 21. Malnick, S. D., and H. Knobler. 2006. T he medical complications of obesity. QJM. 99:565 579. Maltin C A ., M. I. Delday, S. M. Hay, G. M. I nnes, and P. E. V. Williams 1990 Effects of bovine pituitary growth hormone alone or in combination with the agonist clenbuterol on muscle growth and composition in veal calves. Br J Nutr 63:535 45. Maiter, D., T. Fliesen, L. E. Underwood, M. Maes, G. Gerard, M. L. Davenport, J. M. Ketelslegers. 1989. Dietary protein restriction decreases insulin like grow th factor I independent of insulin and liver growth hormone binding. Endocrinology 124:2604 2611. Martin, J. L., and R. C. Baxter. 1992. Insulin like growth factor binding protein 3: biochemistry an d physiology. Growth Regul. 2 :88 99.

PAGE 145

145 Martin, L. C., J. S. Brinks, R. M. Bourdon, and L. V. Cundiff. 1992. Genetic effects on beef heifer puberty and subsequent reproduction. J. Anim. Sci. 70:4006 4017. McCance, R. A. 1962. Food growth and time. Lancet 2: 271 272. McCann, M. A., J. M. Scheffler, S. P. Greiner M. D. Hanigan, G. A. Bridges, S. L. Lake, J. M. Stevenson, H. Jiang, T. L. Scheffler, and D. E. Gerrard. 2011. Early metabolic imprinting events increase marbling scores in fed cattle. J. Anim. Sci. 89( Suppl. ) :24. McCarrick, R. B., D. Harrington, and A. Conway 1963. The e ffect of energy restriction be tween 20 24 months of age on subsequent growth and carcass development of beef cattle. Ir. J. Agric. Res., 2: 131 147. McGuire, M. A., J. L. Vicini, D. E. Bauman, and J. J. Veenhuizen. 1992. Insulin like gr owth factors and binding proteins in ruminants and their nutritional regulation. J. Anim. Sci. 70:2901 2910. Melkman Zehavi T R. Oren, S. Kredo Russo, T. Shapira, A. D. Mandelbaum, N. Rivkin, T. Nir, K. A. Lennox, M. A. Behlke, Y. Dor, and E. Hornstein 2011. miRNAs control insulin content is pancreatic b cells via downregulation of transcriptional repressors. E urop. M ol. B iol. O rg. J. 30:835 45. Melvin, E. J., B. R. Lindsey, J. Quintal Franco, E. Zanella, K. E. Fike, C. P. Van Tassell, and J. E. Kinde r. 1999. Estradiol, luteinizing hormone, and follicle stimulating hormone during waves of ov ar ian follicular development in prepubert al cattle. Biol. Reprod. 60:405 412. Meyer, D. L., M. S. Kerley, E. L. Walker, D. H. Keisler, V. L. Pierce, T. B. Schmidt, C. A. Stahl, M. L. Linville, and E. P. Berg. 2005. Growth rate, body composition, and meat tenderness in early vs. traditionally weaned beef calves. J. Anim. Sci. 83:2752 2761. Micke, G. C., T.M. Sullivan, I.C. McMillen, S. Gentili, and V.E.A. Perry 20 11. Protein intake during gestation affects postnatal bovine skeletal muscle growth and relative expression of IGF1, IGF1R, IGF2 and IGF2R Mol. Cel. Endocrinol. 332:234 241. Mies, W. L. 1992. Determining the value of stocker cattle. Pages 45 47 in Easte rn Oklahoma Stocker Cattle Conference. Moallem, U., D. Werner, H. Lehrer, M. Zachut, L. Livshitz, S. Yakoby, and A. Shamay. 2010. Long term effects of ad libitum whole milk prior to weaning and prepubertal protein supplementation on skeletal growth rate a nd first lactation milk pr oduction. J. Dairy Sci. 93:2639 2650. Moore, J. E., and G. O. Mott. 1974 Recov ery of residual organic matter from in vitro digestion of forages. J. Dairy Sci. 57:1258 1259

PAGE 146

146 Moore K J K. J. Rayner, Y. Surez, and C. Fernnde z Hernando. 2010. microRNAs and cholesterol metabolism. Trends Endocrinol Metab. 21:699 706. Morgan, J. H. L. 1972. Effect of plane of nutrition i n early life on subsequent live weight gain, carcass and muscle characteristics and eating quality of meat in cattle J. Agric. Sci. 78:417 423. Moriel, P., and J. D. Arthington. 2013a. Effects of trace mineral fortified, limit fed preweaning supplements on performance of pre and postweaned beef calves. J. Anim. Sci. 91:1371 1380. Moriel, P., and J. D. Arthingt on. 2013b. Effects of molasses based creep feeding supplementation on growth performance of pre and postweaned beef calves. Livest. Sci. 151:171 178. Moriel, P., P. G. Martins, A. D. Aguiar, J. M. Vendramini and J. D. Arthington. 2013. Effects of diffe rent calf management systems following early weaning on growth performance of beef calves. Southern Section of ASAS. 1 3 185 (Abstr.) Moriel, P., R. F. Cooke, D. W. Bohnert, J. M. B. Vendramini and J. D. Arthington. 2012. Effects of energy supplementation frequency and forage quality on performance, reproductive, and physiological responses of replacement beef heifers. J. Anim. Sci. 90:2371 2380. Moseley, W. M., T. G. Dunn, C. C. Kaltenbach, R. E. Short, and R. B. Staigmiller. 1984. Negative feedb ack control of luteinizing hor mone secretion in prepubertal beef heifers at 60 and 200 days of age. J. An i m Sci. 58:145 150. Moss, F. P., and C. P. Leblond. 1971. Satellite cells as the source of nuclei in muscles of growing rats. Anat. Rec. 170:421 435. Myers, S. E., D. B. Faulkner, F. A. Ireland, L. L. Berger, and D. F. Parrett. 1999a Production systems comparing early weaning to normal weaning with or without creep feeding for be ef steers. J. Anim. Sci. 77:300 310. Myers, S. E., D. B. Faulkner, F. A Ireland, and D. F. Parrett. 1999 b Comparison of three weaning ages on cow calf performance and steer carca ss traits. J. Anim. Sci. 77:323 329. Neibergs, H. L., and K. A. Johnson. 2012. Alpharma beef cattle nutrition symposium: Nutrition and the genome J. Anim. Sci. 90:2308 2316. Neville, W. E., and W. C. McCormick. 1981. Performance of early and normal weaned beef calves and their dams. J. Anim. Sci. 52:715 724.

PAGE 147

147 Nissen P M ., V. O. Danielsen, P. F. Jorgensen, and N. Oksbjerg 2003. Increased ma ter nal nutrition of sows has no benefici al effects on muscle fiber num ber or postnatal growth and has no impact on the meat quality of the offspring. J Anim Sci 81:3018 3027. Nordstrom, S. M., J. L. Tran, B. C. Sos, K. Wagner, and E. J. Weiss. 2011. Liver derived IGF I contributes to GH dependent increases in lean mass and bone mineral density in mice with comparable levels of circulating GH. Mol. Endocrinol. 25:1223 1230. NRC. 2000. Nutrient Requirements of Beef Cattle. revised 7th ed. Natl. Acad. Press, Washington, DC. Nunez Dominguez, R., L. V. Cundiff, G. E. Dickerson, K. E. Gregory and R. M. Koch. 1991. Lifetime production of beef heifers calving first at two vs three years of age. J. Anim. Sci. 69:3467 3479. Ocn Grove, O. M., F. N. T. Cooke, I. M. Alvarez, S. E. Johnson, T. L. Ott, and A. D. Ealy. 2008. Ovine endometrial expression of fi broblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Domest. Anim. Endocrinol. 34 :135 145. R M J. L. Zh ao, and D. S. Rao. 2011. MicroRNA function in myeloid biology. Blood. 118:2960 296 9. Ong, K. K., and D. B. Dunger. 2004. Birth weight, infant growth and insulin resistance. Eur. J. Endocrinol. 151:U131 U139. Ong K. K., P. Emmett K. Northstone, J. Goldi ng, I. Rogers, A. R. Ness J C. Wells and D B. Dunger 2009. Infancy weight gain predicts childhood body fat an d age at menarche in girls. J Clin Endo crinol. Met 94 :1527 1532. Ong K K P. M. Emmett, S. Noble A. Ness, D. B. Dunger, and ALSPAC Study Team. 2006 Dietary energy intake at the ag e of 4 months predicts postnatal weight gain and childhood body mass index. Pediatrics 117 :e503 e508. Oksbjerg, N., F. Gondret, and M. Vestergaard. 2004. Basic principles of muscle development and growth in meat producing mammals as affected by the insuli n like growth factor (IGF) system. Dom est Anim. Endoc rinol 27:219 240. Owens, F. N., D R Gill, D S Secrist, and S W Coleman 1995. Review of some aspects of growth and development of feedlot cattle. J A nim. S ci. 73:3152 31 72 Owens, F. N., P Du beski and C F Hanson 1993. Factors that alter the growth and development of ruminants. J A nim. S ci. 71:3138 3150.

PAGE 148

148 Palsson, H. and J. B. Verges. 1952a. Effects of the plane of nutrition on growth and development of carcass quality in lambs. Part I. The effects of high and low planes of nutrition at different ages. J. Agr. Sci. 42:1 92 Palsson, H. and J. B. Verges. 1952b. Effects of the plane of nutrition on growth and the develop ment of carcass quality in lambs. Part II. Effects on Iambs of 30 lb. car cass weight. J. Agr. Sci. 42:93 149 Patel, M., and M. Srinivasan. 2002. Metabolic programming: Causes and consequences. J. Bio. Chem. 277:1629 1632. Patel, M. S., and M. Srinivasan. 2010. Metabolic programming d u e to alterations in nutrition in the imme diate postnatal p eriod J. Nutr. 140:658 661. Patel, M. S. and M. Srinivasan. 2011. Metabolic programming in the immediate postnatal life Ann. Nutr. Metab. 58 :18 28. Patel M S M. Srinivasan and S. G. Laychock 2009. Metabolic programming: role o f nutrition in the immediate postnatal life. J Inherit Metab Dis. 32:218 28. Patterson, D. J., L. R. Corah, G. H. Kiracofe, J. S. Stevenson, and J. R. Brethour. 1989. Conception rate in Bos taurus and Bos indicus crossed heifers after postweaning energ y manipulation and synchronization of estrus with melengestrol acetate and fenprostalene. J. Anim. Sci. 67:1138 1147. Patterson D. J., R. C. Perry, G. H. Kiracofe, R. B. Bellows R. B. Staigmiller, and L. R. Corah. 1992. Management considerations in hei fer development and puberty. J. Anim. Sci. 70:4018 4035. Perdiguero, E., P. Sousa Victor, E. Ballestar, and P. Muoz Cnoves. 2009. Epigenetic regulation of myogenesis. Epigenetics 4:541 550. Peterson, G. A., T. B. Turner, K. M. Irvin, M. E. Davis, H. W. Newland, and W. R. Harvey. 1987. Co w and calf performance and eco nomic considerations of early weaning of fall born beef calves. J. Anim. Sci. 65:15 22 Pethick, D. W., G. S. Harper, and V. H. Oddy. 2004. Growth, development and nutritional manipulation of marbling in cattle: a review. Aust. J. Exp. Agric. 44:705 715. Phillips, W. A., J W. Holloway, and S. W. Coleman. 1991. Effect of pre and postweaning management system on the performance on Brahman crossbred feeder calves. J. Anim. Sci. 69: 3102 311 1. Picard B L. Lefaucheur, C. Berri and J. M. Duclos 2002. Muscle fibre ontogenesis in farm animal species. Reprod Nut Develop 42 : 415 431.

PAGE 149

149 Pierroz, D. D., C. Catzeflies, A. C. Aebi, J. E. Rivier, and M. L. Aubert. 1996. Chronic administration of ne uropeptide Y into the lateral ventricle inhibits both the pituitary testicular axis and growth hormone and insulin like growth factor 1 secretion in intact adult male rats. Endocrinology 137:3 12. Plagemann, A., I. Heidrich, F. Gotz, W. Rohde, and G. Dorn er. 1992. Obesity and enhanced diabetes and cardiovascular risk in adult rats due to early postnatal overfeeding. Exp. Clin. Endocrinol. 99:154 158. Plagemann A T. Harder, A. Rake, M. Voits, H. Fink, W. Rohde, and G. Dorner 1999a. Perinatal eleva tion of hyp othalamic insulin, acquired mal formation of hypothalamic galaninergic neurons, and syndrome X like alterations in adulthood of neonatally overfed rats. Brain Res 836:146 155. Plagemann A T. Harder, A. Rake T. Waas, K. Melchior, T. Ziska, W. Ro hde, and G. Dorner .1999b. Observat ions on the orexigenic hypotha lamic neuropeptide Y system in neonatally overfed weanling rats. J Neuroendocrinol.11:541 546. Pons S and I. Torres Aleman 1993 Estradiol modulates insulin like growth factor I recepto rs and binding proteins in neurons from the hypothalamus. J Neuroendocrinol. 5:267 271 Radcliff, R. P., B. L. McCormack, B. A. Crooker, and M. C. Lucy. 2003. Growth hormone (GH) binding and expression of GH receptor 1A mRNA in hepatic tissue of peripart urient dairy cows. J. Dairy Sci. 86:3920 3926. Radcliff, R. P., M. J. Vandehaar, L. T. Chapin, T. E. Pilbeam, D. K. Beede, E. P. Stanisiewski, and H. A. Tucker. 2000. Effects of diet and injection of bovine somatotropin on prepubertal growth and first lac tation milk yields of Hol stein cows. J. Dairy Sci. 83:23 29. Radcliff, R. P., M. J. VandeHaar, Y. Kobayashi, B. K. Sharma, H. A. Tucker, and M. C. Lucy. 2004. E ffect of dietary energy and somatotropin on components of the somatotropic axis in holstein hei fers. J. Dairy Sci. 87:1229 1235. Raeth Knight, M., H. Chester Jones, S. Hayes, J. Linn, R. Larson, D. Ziegler, B. Ziegler, and N. B roadwater. 2009. Impact of con ventional or intensive milk replacer programs on Holstein heifer performance through six mont hs of age and during first lactation. J. Dairy Sci. 92:799 809. Reik, W. 2007. Stability and flexibility of epigenetic gene regulation in mammal ian development. Nature 447:425 432. Relaix F D. Montarras, S. Zaffran, B. Gayraud Morel, D. Rocancourt, S. Tajbakhsh, A. Mansouri, A. Cumano, and M. Buckingham. 2006. Pax3 and Pax7 have distinct and overlapping functions in adult muscle progenitor cells. J Cell Biol 172 : 91 102.

PAGE 150

150 Riggs A D and T. N. Porter TN. 1996. Overview of epigenetic mechanisms. In: V. E. Russo, R. A. Martienssen, A. D. Riggs editors, Epigenetic mechanisms of gene regulation. Cold Spring Harbor Laboratory Press, Plainview, NY p. 29 46. Riggs A D R. A. Martienssen V. E. Russo. 1996. Introduction. In: V. E. Russo, R. A. Martien ssen, A. D. Riggs editors, Epigenetic mechanisms of gene regulation. Cold Spring Harbor Laboratory Press, Plainview, NY p. 1 4. Rinn, J. L., and H. Y. Chang. 2012. Genome regulation by long noncoding RNAs. Annu. Rev. Biochem. 81 :145 166. Rius, A. G., H. A. Weeks, J. Cyric, R. M. Akers, B. J. Bequette, and. M. D. Hanigan. 2012. Protein and energy intakes affected amino acid concentrations in plasma muscle, and liver, and cell signaling in the liver of growing dairy calves. J. Dairy Sci. 95:1983 1991. Robelin, J. 1981. Cellularity of bovine adipose tissues: Developmental changes from 15 to 65 percent mature w eight. J. Lipid Res. 22:452 457. Roberts, A. J., R. A. Nugent, 3rd, J. Klindt, and T. G. Jenkins. 1997. Circulating insulin like growth factor I, insulin like growth factor binding proteins, growth hormone, and resumption of estrus in postpartum cows subjected to dietary energy restriction. J. Anim. Sci. 75:1909 1917. Rodriguez, R. E., and M. E. Wise. 1989. Ontogeny of pulsatile secretion of gonado tropin releasing hormone in the bull calf during infantile and pubertal development. Endocrinology 124: 248 256. Rodrigues, H. D., J. E. Kinder, and L. A. Fitzpatrick. 2002. Estradiol regulation of luteinizing hormone secretion in heifers of two breed type s that reach puberty at different ages. Biol. Reprod. 66:603 609. Rosen, E. D. 2005. The transcriptio nal basis of adipocyte develop ment. Prostaglandins Leuk ot. Essent. Fatty Acids 73:31 34. Rosen, E. D., and O. A. MacDougal d. 2006. Adipocyte differentia t ion from the inside out. Nat. Rev. Mol. Cell Biol. 7:885 896. Rosen, E. D., C. H. Hsu, X. Wang, S. Sakai, M. W. Freeman, F. J. Gonzalez, and B. M. Spiegelman. 2002. C/EBP induces adipogenesis through PPAR : A un ified pathway. Genes Dev. 16:22 26. Ross, A., and C. D. Davis. 2011. MicroRNA, nutrition, and c ancer Prevention. A dv. Nutr. 2:472 485

PAGE 151

151 Rouquette, F. M. J., D. I. Bransby, and M. E. Riewe. 1997. Grazing management and use of ryegrass. In F. M. J. Rouquette and L. R. Nelson (ed). Ecology, productio n, and management of Lolium for forage in USA. ASA, CSSA, and SSSA, Madison, WI. p. 79 100. Sainz, R. D., F. Del Torra, and J. W. Oltjen. 1995. Compensatory growth and carcass quality in growth restricted and refed bee f steers. J. Anim. Sci. 73:2971 2979. Schillo, K. K., J. B. Hall, and S. M. Hileman. 1992. Effects of nutrition and season on the onset of puberty in the beef heifer. J. Anim. Sci. 70:3994 4005. Schoonmaker, J. P., F. L. Fluharty, S. C. Loerch, T. B. Turner, S. J. Moeller, and D. M. Wulf. 2 001. Effects of weaning status and implant regimen on growth, performance, and carcass characteristics of steers. J. Anim. Sci. 79:1074 1084. Schoonmaker, J. P., M. J. Cecava, D. B. Faulkner, F. L. Fluharty, H. N. Zerby, and S. C. Loerch. 2003. Effect of source of energy and rate of growth on performance, carcass characteristics, ruminal fermentation, and serum glucose and insulin of early weaned steers. J. Anim. Sci. 81:843 855. Schoonmaker, J. P., F. L. Fluharty, and S. C. Loerch. 2004b. Effect of sourc e and amount of energy and rate of growth in the growing phase on adipocyte cellularity and lipogenic enzyme activity in the intramuscular and subcutaneous fat depots of Holstein steers. J. Anim. Sci. 82:137 148. Schoonmaker, J. P., M. J. Cecava, F. L. Fl uharty, H. N. Zerby, and S. C. Loerch. 2004a. Effect of source and amount of energy and rate of growth in the growing phase on performance and carcass characteristics of early and normal weaned steers. J. Anim. Sci. 82:273 282. Schoonmaker, J. P., S. C. Loerch, F. L. Flu harty, T. B. Turner, S. J. Moeller, J. E. Rossi, W. R. Dayton, M. R. Hathaway, and D. M. Wulf. 2002a. Effect of an accelerated finishing program on performance, carcass characteristics, and circulating insulin like growth factor I concen tration of early weaned bulls and steers. J. Anim. Sci. 80:900 910. Schoonmaker, J. P., S. C. Loerch, F. L. Flu harty, H. N. Zerby, and T. B. Turner. 2002b. Effect of age at feedlot entry on performance and carcass characteristics of bulls and steers. J. Anim. Sci. 80:2247 2254. Schoppee, P. D., J. D. Armstrong, M. A. Harvey, M. D. Whitacre, A. Felix, and R. M. Campbell. 1996. Immunization against growth hormone releasing factor or chronic feed restriction initiated at 3.5 months of age reduces ovarian r esponse to pulsatile admin is tration of gonadotropin releasing hormone at 6 months of age and delays onset of puberty in heifers. Biol. Reprod. 55:87 98.

PAGE 152

152 Seale P L. A. Sabourin, A. Girgis Gabardo, A. Mansouri, P. Gruss, and M. A. Rudnicki 2000. Pax7 is required for the specification of myogenic satellite cells. Cell 102:777 786. Sejrsen, K. J., S. Purup, M. Vestergaard, and J. Foldager. 2000. High body weight gain and reduced bovine mammary growth: physiological basis and implications for milk yield po tential. Domest. Anim. Endocrinol. 19:93 104. Sexten, W. J., D. B. Faulkner, and F. A. Ireland. 2004. Influence of creep feeding and protein level on growth and maternal performance of replacement beef heifers. Prof. Anim. Sci. 20:211 217. Shaheen S O R. B. Newson, A. J. Henderson, J. E. Headley, F. D. Stratton, R. W. Jones, D. P. Strachan, and ALSPAC Study Team. 2005 Prenatal paracetamol exposure and ri sk of asthma and elevated immu noglobulin E in childhood. Clin Exp Allergy 35 : 18 25. Shamay, A. D. Werner, U. Moallem, H. Barash, and I. Bruckental. 2005. Effect of nursing management and skeletal si ze at wean ing on puberty, skeletal growth rate, and milk production during first lactation of dairy heifers. J. Dairy Sci. 88:1460 1469. Shike, D. W., D. B. Faulkner, M. J. Cecava, D. F. Parrett, and F. A. Ireland. 2007. Effects of weaning age, creep feeding, and type of creep on steer performance, carcass traits, and economics. 23:325 332. Shimasaki S and N. Ling 1992 Identifi cation and molecular character ization of insuli n like growth factor binding proteins (IGFBP 1, 2, 3, 4, 5 and 6). Prog Growth Factor Res 3:243 266 Short, R. E., and R. A. Bellows. 1971. Relationships among weight gains, age at puberty and reproductive performance i n heif ers. J. Anim. Sci. 32:127 131. Short, R. E., R. B. Staigmiller, R. A. Bellows and R. C. Greer. 1994. Breeding heifers at one year of age: Biological and economical considerations. In: M. J. Fields and R. S. Sand ed itors, Factors Affecting Calf Crop. CRC Press, Boca Raton, FL. p. 55 68. Sie, K. K., J. Li, A. Ly, K. J. Sohn, R. Croxford, and Y. I. Kim. 2013. Effect of maternal and postweaning folic acid supplementation on global and gene specific DNA methylation in the liver of the rat offspring. Mol. Nutr Food Res. Mar 6. doi: 10.1002/mnfr.201200186. [Epub ahead of print] Simmons, R. 2011. Boyd Orr lecture: Epigenetics and mate rnal nu trition: Nature v. nurture. Proc. Nutr. Soc. 70:73 81.

PAGE 153

153 Singhal, A., K. Kennedy, J. Lanigan, M. Fewtrell, T. J. Cole, T Stephenson, A. Elias Jones, L. T. Weaver, S. Ibhanesebhor, P. D. MacDonald, J. Bindels, and A. Lucas. 2010. Nutrition in infancy and long term risk of obesity: evidence from 2 randomized controlled trials. Am J Clin Nutr 92:1133 11 44. Sirotkin A V and A. V. Makarevich. 2002. Growth hormone can regulate func tions of porcine ovarian granulosa cells through the cAMP/protein kinase A system. Anim Reprod Sci 70:111 126. Smith G. M., H. A. Fitzhugh Jr., L. V. Cundiff, T. C. Cartwright, and K. E Gregory 1976. A genetic analysis of maturing patterns in straightbred and crossbred Hereford, Angus and Shorthorn cattle. J. Anim. Sci. 43: 389 395. Smith, L. E., Jr ., and C. K. Vincent. 1972. Ef fects of early weaning and exogenous hor mone tre atment on bovine postpartum re pr oduction. J. Anim. Sci. 35:1228 1232. Smith, J. M., M. E. Van Amburgh, M. C. Diaz, M. C. Lucy and D. E. Bauman 2002. Effect of nutrient intake on the development of the somatotropic axis and its responsiveness to GH in Holstein bul l calves J Anim Sci 80:1528 1537. Smith, S. B., and J. D. Crouse. 1984. Relative contributions of acetate, lactate and glucose to lipogenesis in bovine intramuscular and subcutaneous adipose tissue. J. Nutr. 114:792 800. Smith, T. R., and J. P. McNam ara. 1990. Regulation of Bovine Adipose Tissue Metabolism During Lactation. 6. Cellularity and Ho rmone Sensitive Lipase Activity as Affected by Genetic Merit and Energy Intake. J. Dairy Sci. 73:772 783. Soberon, F., and M. E. Van Amburgh. 2013. The effect of nutrient intake from milk or milk replacer of preweaned dairy calves on lactation milk yield as adults: A meta analysis of current data. J. Anim. Sci. 91:706 712. Sollenberger, L. E., and J. E. Moore. 1997. Assessing forage allowance animal performanc e relationships on grazed pasture. In : Agronomy abstracts. ASA, Madison, WI. p. 140 141 Sollenberger, L. E., J. E. Moore, V. G. Allen, and C. G. S. Pedreira. 2005. Reporting forage allowance in grazing experiments. Crop Sci. 45:896. Spicer, L. J., and S. E. Echternkamp. 1995. The ovarian insulin and insulin like growth factor system with an emphasis on domestic animals. Domest. Anim. Endocrinol. 12:223 245.

PAGE 154

154 Srinivasan M P. Mitrani G. Sadhanandan C. Dodds S. Shbeir ElDika S. Thamotharan H. Gha nim P. Dandona S. U. Devaskar and M. S. Patel 2008. A high carbohydrate diet in the immediate postnatal life of rats induces adaptations predisposing to adult onset obesity. J Endocrinol. 197:565 5 74. Story, C. E., R. J. Rasby, R. T. Clark, and C. T. Milton. 2000. Age of calf at weaning of spring calving beef cows and the effect on cow and calf performance and production e conomics. J. Anim. Sci. 78:1403 1413. Snyd er, D. K., D. R. Clemmons, and L. E. Underwood. 1989 Dietary carbohydrate content determ ines responsiveness to growth hormone in energy restricted humans. J Clin Endocrinol Metab 69:745 752 Stricker, J. A., A. G. Matches, G. B. Thompson, V. E. Jacobs, F. A. Martz, H. N. Wheaton, H. D. Currence, and G. F. Krause. 1979. Cow calf productio n on tall fescue ladino clover pastures with and without nitrogen fertilization or creep feeding: Spring calves. J. Anim. Sci. 48:13 25 Stuedemann, J. A., J. J. Guenther, S. A. Ewing, R. D. Morrison, and V. Odell. 1968. Effect of nutritional level impose d from birth to eight monhts of age on subsequent growth and development patterns of full fed beef calves. J. Anim. Sci. 27:234 241. Suh N, and R. Blelloch 2011 Small RNAs in early mammalian development: from gametes to gastrulation. Development. 138:1 653 61. Taga, H., M. Bonnet, B. Picard, M. C. Zingaretti, I. Cassar Malek, S. Cinti, and Y. Chilliard. 2011. Adipocyte metabolism and cellularity are related to differences in e fe tuses. J. Anim. Sci. 89:711 721. Tang, Q. Q., T. C. Otto, and M. D. Lane 2003. CCAAT/enhancer binding protein is required for mitotic clonal expansion during adipogenesis. Proc Natl Acad Sci 100 :850 855. Tarr, S. L., D. B. Faulkner, D. D. Buskirk, F. A. Ireland, D. F. Parrett, and L. L. Berger. 1994.The value of creep feeding during the last 84, 56, or 28 d ays prior to weaning on growth performance of nursing calves grazing endophyte infected tall fescue. J. Anim. Sci. 72:1084 1094. Thiagalingam, S., K. Cheng, H. J. Lee, N. Mineva, A. Thiagalingam, and J. F. Ponte. 2003. Histone deacetylases: Unique players in shaping the epigenetic histone code. Ann. N. Y. Acad. Sci. 983:84 100. Thissen, J. P., J. M. Ketelslegers, and L. E. Underwood. 1994. Nutritional regulation of the insulin like gro wth factors. Endocr. Rev. 15:80 101.

PAGE 155

155 Thissen J P S. Triest, B. M. Moats Staats, L. E. Underwood, T. Mauer H off, D. Maiter, and J. M. Ketelslegers 1991 Evidence that pretrans lational and translational defects decrease serum IGF I concentra tions during dietary protein rest riction. Endocrinology 129:429 435 Thrift, F. A ., and T. A. Thrift. 2004. Review: Ramifications of weaning spring and fall born calves early or late relative to weaning at conventional ages. Prof. Anim. Sci. 20:490 502. Tikofsky, J. N., M. E. Van Amburgh, and D. A. Ross. 2001. Effect of varying carbo hydrate and fat content of milk replacer on body composition of Holstein bull calves. J. Anim. Sci. 79:2260 2267. Tilley, J. A. and R. A. Terry. 1963. A two stage technique for the in vitro digestion of forage crops. J. Brit. Grassl. Soc. 18:104 111 To schke A M R. M. Martin, R. von Kries J. Wells, G. D. Smith, and A. R. Ness. 2007. Infant feeding method and obe sity: body mass index and dual energy X ray ab sorptiometry measurements at 9 10 y r of age from the Avon Longitudinal Study of Parents and Children (ALSPAC). Am J Clin Nutr 85 : 1578 1585. Totusek, R., and D. Arnett. 1965. Estimates of milk production in beef cows. J. Anim. Sci. 24:906. (Abstr.) Turner B M. 1991. Histone acetylation and control of gene expression. J Cell Sci 99:13 20. Ullrich A A. Gray A. W. Tam, T. Yang Feng, M. Tsubokawa, C. Collins, W. Henzel, T. Le Bon, S. Kathuria, E. Chen, S. Jacobs, U. Francke, J. Ramachandran, and Y. Fujita Yamaguchi 1986 Insulin like growth factor I receptor primary structu re: compariso n with insulin re ceptor suggests structural determinan ts that define functional specificity. Europ. Medic. Biol. Org. J. 5:2503 2512 Vadlamudi S S. C. Kalhan and M. S. Patel 1995. Persistence of metabolic conse quences in the progeny of rats fed a HC formula in their early postnatal life. Am J. Physiol. 269:E731 73 8. Van Amburgh, M. E., D. M. Galton, D. E. Bauman, R. W. Everette, D. G. Fox, L. E. Chase, and H. N. Erb. 1998. Effects of three prepubert al body growth rates on perfor mance of Holst ein he ifers during first lacta tion. J. Dairy Sci. 81:527 538 Vendramini, J. M. B., and J. D. Arthington. 2007. Effect s of supplemental yeast fermen tation p roduct on performance of early weaned calves on pastures and measures of stress and performance during a feedlot receiving period. Prof. Anim. S ci. 23:709 714.

PAGE 156

156 Vendramini, J. M. B., and J. D. Arthington. 2008. Effects of supplementation strategies on performance of early weaned calves raised on pastures. Prof. Anim. Sci. 24:445 450. Vendramini, J. M. B., L. E. Sollenberger, J. C. B. Dubeux Jr., S. M. Interrante, R. L. Stewart Jr., and J. D. Arthington. 2006. Concentrate supplementation effects on forage characteristics and performance of early weaned calves grazing rye ryegr ass pastures. Crop Sci. 46:1595 16 00. Vendramini, J. M., J. D. Arthington, A. Blount, A. D. Aguiar, P. Moriel, and R. S. Hallworth. 2013. Evaluation of early weaned beef calves grazing annual ryegrass or annual ryegrass triticale mixtures in south Florida. Southern Section of ASAS. 13 129 (Abstr.) Vernon R G 1986. The growth and metabolism of adipocytes. In : P J Buttery, N B H aynes and D. B. Lindsay, eds, Control and Manipulation of Animal Growth. Butterworths, London, UK. p. 67 83. Vestergaard, M., S. Purup, J. Frystyk, P. Lvend ahl, M. T. Srensen, P. M. Riis, D. J. Flint and K. Sejrsen 2003. Effects of growth hormone and feeding level on endocrine measurements, hormone receptors, muscle growth and performance of prepubertal heifers J A nim. S ci. 81:2189 2198. Vicini, J. L., F C. Buonomo, J. J. Veenhuizen, M. A. Miller, D. R. Clemmons, and R. J. Collier. 1991. Nutrient balance and stage of lactation affect responses of insulin, insulin like growth factors I and II, and insulin like growth factor binding protein 2 to somatotrop in administration i n dairy cows. J. Nutr. 121:1656 1664. Wang, Y. H., N. I. Bower, A. Reverter, S. H. Tan, N. De Jager, R. Wang, S. M. McWilliam, L. M. Cafe, P. L. Greenwood, and S. A. Lehnert. 2009. Gene expression patterns during intramuscular fat devel opment in cattle. J. Anim. Sci. 87:119 130. Waterman, R. C., T. W. Geary, J. A. Paterson, and R. J. Lipsey. 2012a. Early weaning in Northern Great Plains beef cattle production systems: I. Performance and reproductive response in range beef cows. Lives. S ci. 148:26 35. Waterman, R. C., T.W. Geary, J.A. Paterson, and. R.J. Lipsey. 2012b. Early weaning in Northern Great Plains beef cattle production systems: II. Developmen t of replacement heifers weaned at 80 or 215d of age. Lives. Sci. 148:36 45. Waterman R. C., T. W. Geary, J. A. Paterson, R. J. Lipsey, W. R. Shafer, L. L. Berger, D. B. Faulkner, and J. W. Homm. 2012c. Early weaning in Northern Great Plains beef cattle production systems: III. Steer weaning, finishing and carcass characteristics. Lives. Sci. 148:282 290.

PAGE 157

157 Wehrman, M. E., F. N. Kojima, T. Sanchez, D. V. Mariscal, and J. E. Kinde. 1996. Incidence of precocious puberty in developing beef heifers. J Anim. Sci. 74: 2462 2467. Weiss, W. P., H. R. Conrad, and N. R St. Pierre. 1992. A theoreti cally based model for predicting total digestible nutrient values of forages and concentrates. A nim. Feed Sci. Technol. 39:95 110. Welch, C. M., M. McGee, T. A. Kokta, and R. A. Hill. 2012. Muscle and adipose tissue: potential roles in driving variation i n feed efficiency. In: R. A. Hill, editor, Feed efficiency in the beef industry. John Wiley and Sons, Inc. Ames, IA. p. 175 198. Wertz, A. E., L. L. Berger, P. M. Walker, D. B. Faulkner, F. K. McKeith, and S. L. Rodri guez Zas. 2002. Early weaning and pos t weaning nutritional management affect feedlot performance, carcass merit, and the relationship of 12th rib fat, marbling score, and feed efficiency among Angus and Wa g yu heifers. J. Anim. Sci. 80:28 37. Wettemann, R. P., C. A. Lents, N. H. Ciccioli, F J. White, and I. Rubio. 2003. Nutritional and suckling mediated anovulation in beef cows. J. Anim. Sci. 81(E. Suppl. 2):E48 E59. Whitlock, B. K., M. J. VanderHaar, L. F. P. Silva, and H. A. Tucker. 2002. Effect of dietary protein on prepubertal mammary development in rapidly growing dairy heifers. J. Dairy Sci. 85:1516 1525. Williams, D. B., R. L. Vetter, W. Burroughs, and D. G. Topel. 1975. Effects of ration protein level and diethylstilbestrol implants on early weaned be ef bulls. J. Anim. Sci. 41:1525 1531. Wilson M E. 1995. IGF I administration advances the decrease in hyper sensitivity to oestradiol negative feedback inhibition of serum LH in adolescent female rhesus monkeys J. Endocrinol. 145:121 130 Wiltbank, J. N., C. W. Kasson, and J. E. Ingalls. 1969. Puberty in crossbred and straightbred beef heifers. J. Anim. Sci. 29:602 605. Yakar, S., J. Liu, B. Stannard, A. Butler, D Accili, B. Sauer, and D. LeRoith. 1999. Normal growth and development in the absence of hepatic insulin like growth factor. Proc Natl. Acad. Sci. USA. 96:7324 7329. Yelich, J. V., R. P. Wetteman, H. G. Dolezal, K. S. Lusby, D. K. Bishop, and L. J. Spicer. 1995. Effects of growth rate on carcass composition and lipid partitio ning at puberty and growth hor mone, insulin like growth factor I, insulin, and metabolites be fore puberty in beef heifers. J. Anim. Sci. 73:2390 2405.

PAGE 158

158 Yelich, J. V., R. P. Wetteman, T. T. Marston, and L. J. Spicer. 1996. Luteinizing hormone, growth ho rmone, insulin like growth fac tor I, insulin and metabolites before puberty in heifers fed to gain at two rates. Domest. Anim. Endocrinol. 13:325 338. Zaczek D J. Hammond, L. Suen, S. Wandji, D. Service, A. Bartke, V. Chandrashekar, K. T. Coschigano, and J. J. Kopchick. 2002. Impact of growth hormon e resistance on female reproductive function: new insights from growth hormone receptor k nockout mice. Biol. Reprod. 6 7:1115 1124. Zammit, P. S., J. P. Golding, Y. Nagata, V. Hudon, T. A. Partridge, and J. R. Beauchamp. 2004. Muscle satellite cells adopt divergent fates: a mechanism for self renewal? J. Cell Biol. 166:347 357. Zheng, S., M. Rollet, and Y. X. Pan. 2011. Maternal protein restric tion during pregnancy indu ces CCAAt/enhancer binding pro tein (C/EBP beta ) expression through the regulation of his tone modification at its promoter regio n in female offspring rat skel etal muscle. Epigenetics 6:161 170. Zhu, M. J., S. P. Ford, P. W. Nathanielsz, and M. Du. 2004. Effect of maternal nutrient restriction in sheep on the development of fetal skeleta l musc le. Biol. Reprod. 71:1968 1973.

PAGE 159

159 BIOGRAPHICAL SKETCH Philipe Moriel was born in S o Paulo, Brazil, in 1985. He is son of Antonio Claudiner Felippe Moriel and Selma Correa Gomes Moriel. Philipe obtained his B.S. in animal sciences from S o Paulo State Unive rsity (UNESP, Botucatu, Brazil) in 2008. In 2009, Philipe began his Master of Science program at the University of Wyoming (Laramie, WY), advised by Dr. Bret W. Hess. The focus of his research at the University of Wyoming focused on strategies to enhance t he reproductive performance of beef heifers and cows. In 2010, Philipe obtained his M.S. degree in Animal and Veterinary Sciences, and immediately moved to Gain esville FL to begin his Ph.D. program, advised by Dr. John D. Arthington. During his doctorate program, Philipe focused on strategies to alleviate stress and enhance the pre and post weaning growth performance of newly received stressed beef calves, as well as, the long term impact s of metabolic imprinting and nutritional management systems follow ing early weaning on growth and reproductive performance, c arcass quality and gene expression of beef calves. In April 2013, Philipe was hired as the Assistant Professor Mountain Livestock Specialist at the North Carolina State University Philipe will be responsible for implementing innovative applied research program on the Mountain and Upper Mountain Research stations, and for developing statewide extension program, d esigned to enhance livestock production in the region.