Mouse Muscleblind-Like Compound Knockout Models of Myotonic Dystrophy

MISSING IMAGE

Material Information

Title:
Mouse Muscleblind-Like Compound Knockout Models of Myotonic Dystrophy
Physical Description:
1 online resource (125 p.)
Language:
english
Creator:
Lee, Kuang Yung
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Genetics (IDP)
Committee Chair:
Swanson, Maurice S
Committee Members:
Harfe, Brian
Resnick, James Lewis
Zolotukhin, Serge

Subjects

Subjects / Keywords:
dm1 -- mbnl -- mouse
Genetics (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Myotonic dystrophy (DM), which is the most common adult onset muscular dystrophy, is caused by unstable (CTG)n repeat expansion in the  3’ UTR of DMPK gene and a CCTG intronic expansion in CNBP. When transcribed, these repeat expansions generate toxic C(C)UG RNAs that directly sequester the muscleblind-like (Mbnl) proteins. Mbnl proteins regulate alternative splicing during the developmental transition from fetal to adult life. Among the three paralogs of the Mbnl family, Mbnl1 is expressed abundantly in skeletal muscle while Mbnl2 expression is higher in the central nervous system (CNS). Mbnl1 knockout mice recapitulate (DM)-relevant skeletal muscle symptoms including myotonia, but show only mild CNS phenotypes. In contrast, Mbnl2 knockout mice exhibit DM-associated CNS abnormalities, including sleep dysregulation without major skeletal muscle deficits. To evaluate the effect of compound loss of Mbnl gene expression, we crossed Mbnl1 and Mbnl2 knockout lines but double knockout mice were inviable. Interestingly, we discovered that Mbnl1deltaE3/deltaE3; Mbnl2+/deltaE2 homozygous; heterozygous double knockout mice exhibited a shorter life span, severe myotonia, muscle weakness, enhanced histopathology and neuromuscular junction (NMJ) deficits. Additionally, Mbnl1deltaE3/deltaE3; Mbnl2+/deltaE2 knockouts developed cardiac conduction block accompanied by fibrosis and cardiomyopathy in the heart consistent with the heart phenotype in DM. In both skeletal and cardiac muscles, enhanced splicing alterations could underlie these pathological changes. To overcome the embryonic lethality of Mbnl1deltaE3/deltaE3; Mbnl2deltaE2/deltaE2 double knockouts, we employed a conditional knockout strategy and created Mbnl1deltaE3/deltaE3; Mbnl2cond/cond ; Nestin+/- mice with constitutive loss of Mbnl1 but neuron-specific depletion of Mbnl2. These mice also showed reduced lifespan, muscle weakness and severe motor deficits. Moreover, pronounced splicing alterations in the brain were detected and hippocampal dysfunction was uncovered by electrophysiological analysis. We conclude that both Mbnl1 and Mbnl2 play critical roles in skeletal muscle, heart and brain during development and their depletion by CUG and CCUG expansion RNA in DM leads to the characteristic multisystemic manifestations of this neuromuscular disease. These results suggest that alternative therapeutic approaches should be developed which are designed to restore the totality of MBNL activity in DM tissues.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Kuang Yung Lee.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Swanson, Maurice S.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045720:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 MOUSE MUSCLEBLIND LIKE COMPOUND KNOCKOUT MODELS OF MYOTONIC DYSTROPHY By KUANG YUNG LEE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGR EE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Kuang Yung Lee

PAGE 3

3 To m y f amily: Sarah, Hubert, Jasper and Nathaniel

PAGE 4

4 ACKNOWLEDGMENTS I thank my boss Dr. Maurice Swanson for helping me compl ete my graduate career. He is a perfect role model and I was motivated every day hoping that one day I will also be an outstanding scientist. I appreciate the help from my wife Sarah, a master biologist who received her degree from Stanford University and understands the difficulty of a biomedical career path. Without her support and the care of our three lovely boys, Hubert, Jasper and Nathaniel, it would have been impossible for me to survive these challenging years in graduate school. I appreciate my pa rents, who are my best listeners at e very glorious and frustrated moment. I thank my committee members at Chang Gung Memorial Hospital in Keelung, Taiwan who provided me the flexibility to make my research dream come true. I am grateful to have the suppor t of m any col leagues: Dr. Moyi Li ( my mentor and partner on my major projects ), Dr. Mike Po u los ( for his instruction and assistance during my rotation project ), Mini Manchanda, Dr s. Chris Chamberlain and Kostas Charizanis A poorva Mohan, Dustin Finn Hanna h Hong and Drs. Ashok Kumar, Tom Foster, Laura Ranum ( for assistance with the Mbnl double knockout project ) I also thank my collaborators Dr s Takashi Kimura, Chaolin Zhang Mario Gomes Pereira, Seiji Nishino, Nicolas Charlet Berguerand for papers publish ed or in preparation. I acknowledge my committee members Dr s Jim Resnick, Brian Harfe and Sergei Zolotukhin for their helpful advice Finally I appreciate all the former and current Swanson/Ranum lab members mouse house veterinarians and technicians, d epartmental administrative members, mentors during rotations, IDP office staff, and church brothers and sisters that I have not mentioned individually for their kind support throughout these years.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 15 C H APTER 1 OVERVIEW OF MYOTONIC DYSTROPHY AND ALTERNATIVE RNA PROCESSING ................................ ................................ ................................ ........ 17 Introduction ................................ ................................ ................................ ............. 17 Myotonic Dystrophy (DM) is a Microsatellite Expansion Disor der .................... 17 Myotonic Dystrophy (DM) is a Multisystemic Disease ................................ ...... 19 Mouse Models for Studying Myotonic Dystrophy ................................ .............. 21 Regulation of Gene Expression at the Co/post transcription Level: ........................ 24 Overview of Alternative RNA Processing ................................ ......................... 24 Alternative Splicing Misregulation in DM ................................ .......................... 27 2 ALTERNATIVE SPLICING CHANGES IN MBNL1 KNOCKOUT AND DM1 PATIENT BRAINS ................................ ................................ ................................ .. 31 Introduction ................................ ................................ ................................ ............. 31 Mbnl1 in DM Skeletal Muscle Pathogenesis ................................ ..................... 31 Mbnl1 in DM Brain Pathogenesis ................................ ................................ ..... 31 Results ................................ ................................ ................................ .................... 32 Splicing Misregulation in Mbnl1 Knockout Brain ................................ ............... 32 Splicing Misregulati on in DM1 Brain Autopsy Samples ................................ .... 33 Discussion ................................ ................................ ................................ .............. 33 3 LOSS OF MBNL2 LEADS TO SPLICING DYSREGULATION IN THE BRAIN: IMPLICATIONS FOR DM 1 CNS DISEASE ................................ ............................ 40 Introduction ................................ ................................ ................................ ............. 40 Earlier Studies of Mbnl2 Gene Trap Mouse Models ................................ ......... 40 Additional Potential Mbnl2 Functions ................................ ............................... 40 Results ................................ ................................ ................................ .................... 41 Mbnl2 Regulates Hundreds of Alternative Splicing Events i n the Brain ............ 41 Enhanced Seizure Propensity in Mbnl2 Knockout Mice ................................ ... 44 Mbnl2 Knockout Mice Recapitulate REM Sleep Propensity Chang es in DM .... 45 Discussion ................................ ................................ ................................ .............. 46 Mbnl2 Depletion Plays a Major Role in DM Brain Pathogenesis ...................... 46 Missplicing of Mbnl2 Targets May Contribute to CNS Symptoms .................... 47

PAGE 6

6 4 COMPOUND Mbnl KNOCKOUT MICE AS A DM DISEASE MODEL ..................... 58 DM is a Disease Characterized by Compound Loss of Mbnl Gene Expression ...... 58 Results ................................ ................................ ................................ .................... 58 Mbnl1 and Mbnl2 Double Knockou ts Are Embryonic Lethal ............................. 58 Characterization of 1KO; 2HET Mice Showed Enhanced Skeletal Muscle Phenotypes ................................ ................................ ................................ ... 59 Neuromuscular Juncti on Deficits in 1KO2HET mice ................................ ........ 61 Compound Mbnl Knockout Mice Exhibit Abnormal Heart Phenotypes ............. 61 Upregulation of Mbnl2 Expression and Relocalization into Nuclei in the Absence of Mbnl1 ................................ ................................ ......................... 63 Mbnl2 is Re Targeted to Mbnl1 Targets in Mbnl1 Knockout Muscle ................ 64 Mbn Splicing Changes in the Brain ................................ ................................ ....... 65 Discussion ................................ ................................ ................................ .............. 65 Compensatory Functions fo r MBNL2 in Skeletal Muscle ................................ .. 65 Mbnl2 Functions and the DM Heart ................................ ................................ .. 66 5 MBNL COMPOUND CONDITIONAL KNOCKOUT MICE AS DM DISEASE MODELS ................................ ................................ ................................ ................. 83 Introduction ................................ ................................ ................................ ............. 83 Results ................................ ................................ ................................ .................... 83 Reduced Body Size, Life Span and Mo tor Deficits in Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ mice ................................ ................................ .................... 83 Aberrant Splicing in the Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ Brain ................. 84 Reduced NMDA Mediated Excitatory Post Synaptic Potential (EPSP) in Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ mice ................................ .................... 86 Discussion ................................ ................................ ................................ .............. 86 Potential Involvement of Mbnl1 in Learning and Memory ................................ 86 6 CONCLUDING REMARKS AND FUTURE DIRECTIONS ................................ ...... 96 Summary of th e Projects ................................ ................................ ......................... 96 Future Experimental Directions and Therapeutic Implications ................................ 96 7 MATERIALS AND METHODS ................................ ................................ .............. 101 Mice Mbnl Knockout Models ................................ ................................ ................. 101 Splicing Assay and Quantitative PCR ................................ ................................ ... 101 Human RNA and RT PC R Analysis ................................ ................................ ...... 102 PTZ Tests ................................ ................................ ................................ ............. 102 Sleep Analysis ................................ ................................ ................................ ...... 102 Rotarod Test ................................ ................................ ................................ ......... 103 Grip Strength Test ................................ ................................ ................................ 103 Electromyography ................................ ................................ ................................ 103 Histology and Immun ofluorescent Study ................................ ............................... 104

PAGE 7

7 Surface ECG ................................ ................................ ................................ ......... 104 ECG gated Cine Cardiac MRI ................................ ................................ ............... 104 Western Blot for Protein Analysis ................................ ................................ ......... 105 NMJ Staining ................................ ................................ ................................ ........ 105 HITS CLIP ................................ ................................ ................................ ............ 106 Electrophysiology ................................ ................................ ................................ .. 106 LIST OF REFERENCES ................................ ................................ ............................. 108 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 125

PAGE 8

8 LIST OF TABLE S Table page 2 1 Primers for Mbnl1 brain targets validation ................................ .......................... 36 3 1 Primers used for Mbnl2 knockout mice studies ................................ .................. 49 4 1 Primers for RT PCR in 1KO2HET studies ................................ .......................... 69 5 1 Primers for RT PCR in Mbnl compound conditional knockout mice studies. ...... 88

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Mbnl1 regulates Clcn1 alternative splicing. ................................ ........................ 29 1 2 The R NA mediated pathogenesis model for myotonic dystrophy (DM) .............. 30 2 1 Loss of Mbnl1 causes splicing changes in brain target RNA .............................. 37 2 2 Camk2d splicing in Mbnl1 KO mice and during normal development. ................ 38 2 3 Novel targets are also mis spliced in DM1 autopsy brains ................................ 39 3 1 No splicing changes in Mbnl2 knockout skeletal and cardiac muscles. .............. 50 3 2 Mbnl2 knockout mice showed significant splicing misregulation in the brain ...... 51 3 3 RT PCR validation of novel targets discovered by splicing sensitive microarrays ................................ ................................ ................................ ........ 52 3 4 Gel images of splicing patterns between hippocampal and c erebellar tissues ... 54 3 5 Enhanced seizure phenotype in Mbnl2 knockouts ................................ .............. 55 3 6 Mbnl2 knockout mice recapitulate abnormal sleep pattern of DM1 patients ....... 57 4 1 Mbnl1 and Mbnl2 double knockouts are embryonic lethal ................................ .. 70 4 2 The Mbnl1 KO; Mbnl2 HET (1KO2HET) mice were smaller and had a shorter lifespan ................................ ................................ ................................ ............... 71 4 3 1KO2HET mice exhibit motor deficits ................................ ................................ 72 4 4 1KO2HET mice showed enhanced my otonia ................................ ..................... 73 4 5 1KO2HET mice showed enhanced skeletal muscle pathology ........................... 74 4 6 1KO2HET mice showed a consistent defect in NMJ str ucture ........................... 75 4 7 Cardiac conduction block in 1KO2HET mice. ................................ ..................... 76 4 8 The heart of 1KO2HET mice showed structural and physiological a bnormalities. ................................ ................................ ................................ ..... 77 4 9 1KO2HET hearts showed fibrosis and enhanced splicing perturbation 1KO2HET. ................................ ................................ ................................ .......... 78 4 10 Up regulation and relo calization of Mbnl2 in Mbnl1 knockout mice .................... 79

PAGE 10

10 4 11 Auto and cross regulation of Mbnl1 and Mbnl2. ................................ ................ 80 4 12 Mbnl2 HITS CLIP on W T and Mbnl1 KO quadriceps ................................ .......... 81 4 13 RT PCR analysis of splicing in 2KO1HET mice for Mbnl2 targets ...................... 82 5 1 Nestin DKO mice were smaller and showed reduced lifespan ........................... 89 5 2 Nestin DKO mice display an array of motor defects ................................ ........... 90 5 3 Nestin DKO mice hippoc ampal samples showed enhanced splicing anomalies on DM1 brain targets. ................................ ................................ ........ 91 5 4 Nestin DKO mice showed enhanced splicing deficits in Mbnl2 brain targets. ..... 92 5 5 Nestin DKO mice hippocampal samples showed enhanced splicing alterations ................................ ................................ ................................ ........... 93 5 6 Bar graph of splicing assay results. ................................ ................................ .... 94 5 7 Deterioration of hippocampal functions in Nestin DKO mice .............................. 95 6 1 A proposed model for Mbnl splicing regulation ................................ ................... 99 6 2 Upregulation and relocation of Mbnls in the absence of their partner ............... 100

PAGE 11

11 LIST OF ABBREVIATIONS 1KO Mbnl1 knockout 1KO2 HET Mbnl1 knockout; Mbnl2 heterozygous knockout 2KO1 HET Mbnl2 knockout ; Mbnl1 heterozygous knockout AAV Adeno associated virus A CH R Acetylcholine receptor A DD 1 Adducin 1 A NK 1 Ankyrin 1, erythroid App Amyloid beta precursor protein A RHGEF 7 R ho guanine nucleotide exchange factor (GEF7) AS Alternative splicing A TP 2 A 1 ATPase ca lcium transporting, cardiac muscle, fast twitch 1(Serca1) AV Atrioventricular B IN 1 Bridging integrator 1 C ACNA 1 D Calcium channel, voltage dependent, L type, alpha 1D subunit C ACNA 1 S Calcium channel, voltage dependent, L type, alpha 1S subunit C AMK 2 D Calc ium/calmodulin dependent protein kinase II delta C AMKK 2 Calcium/calmodulin dependent protein kinase kinase 2, beta CDM Congenital myotonic dystrophy CELF1 CUGBP1 and ETR like factor 1 C LASP 2 CLIP associating protein 2 C LCN 1 Chloride channel 1 CNBP Cellular nucleic acid binding protein (Znf9) CNS Central nervous system C SDA Cold shock domain protein A (Ybx3)

PAGE 12

12 C SNK 1 D Casein kinase 1 delta C TNT Cardiac troponin T (troponin T2) CUGBP CUG binding protein D CLK 1 Doublecortin like kinase 1 D CTP Deoxycytidine tr iphosphate DDX5 Dead box polypeptide 5 D GKH Diacylglycerol kinase eta DKO Double knockout DM M yotonic dystrophy DM1 Myotonic dystrophy type 1 DM2 Myotonic dystrophy type 2 DMPK M yotonic dystrophy protein kinase EC Excitation contraction ECG Electrocardiog raphy EMG Electromyography FMR 1 Fragile X mental retardation syndrome FTD ALS Frontal temporal dementia and amyotrophic lateral sclerosis FXTAS Fragile X tremor and ataxia syndrome GA Gastrocnemius G ABA Gamma aminobutyric acid Grin1 Glutamate receptor, ionotropic, NMDA1 HITS CLIP High throughput sequencing crossed linked immunoprecipitation HN RNP Heterogeneous nuclear ribonucleoprotein HSA Human skeletal actin HTT Huntingtin

PAGE 13

13 K CNMA 1 Potassium large conductance calcium activated channel, subfamily M, alp ha member 1 L DB 3 LIM domain binding 3 L NP Limb and neural patterns M APT Microtubule associated protein Tau MBNL Muscleblind like MHC Myosin heavy chain M PRIP Myosin phosphatase Rho interacting protein MRI Magnetic resonance image M TMR Myotubularin relate d protein N DRG 4 N myc downstream regulated gene 4 Nestin DKO ( Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ ) N FIX Nuclear factor I/X NLS Nuclear localization signal NMJ Neuromuscular junction NREM Non rapid eye movement PER1 Period circadian clock 1 P PP 1 R 12 A Protein phosphatase 1, regulatory subunit 12a PSG Polysomnography PTBP Polypyrimidine tract binding protein PTZ Pentylenetetrazole RAN Repeat associated non ATG initiated translation R BFOX RNA binding protein fox 1 homolog RBP RNA binding protein REM R apid eye movement RNA S EQ RNA sequencing

PAGE 14

14 RT PCR Reverse transcription polymerase chain reaction RT TA R everse tetracycline transactivation R YR 1 R yanodine receptor 1 SCA8 Spinal cerebellar ataxia type 8 SCN Suprachiasmatic nucleus SE Splicing enhancer S ERCA 1 S arcoplasmic/endoplasmic calcium ATPase 1 (Atp2a1) S LAIN 2 SLAIN motif family member 2 S LITRK 4 SLIT and NTRK like family, member 4 S ORBS 1 S orbin a nd SH3 domain containing 1 S PAG 9 Sperm associated antigen 9 S PNA 2 S pectrin alpha 2 SS Splicing silencer S T 3 GAL 3 ST3 beta galactoside alpha 2,3 sialyltransferase 3 TA T ibialis anterior T ANC 2 Tetratricopeptide repeat, ankyrin repeat, a nd coiled coil containing 2 Tmem63b T ransmembrane protein 63b T NNT 2 Cardiac troponin T (cTNT) T NNT 3 Troponin T3 T TN Titin UTR Untranslated region VF Ventricular fibrillation VT Ventricular tachycardia

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Ph ilosophy MOUSE MUSCLEBLIND LIKE COMPOUND KNOCKOUT MODELS OF MYOTONIC DYSTROPHY By Kuang Yung Lee August 2013 Chair: Maurice Swanson Major: Medical Sciences Genetics Myotonic dystrophy (DM) which is the most common adult onset muscular dystrophy i s caused by an unstable (C T G) n repeat expansion in the UTR of the DMPK gene (DM1) or a ( CCTG ) n intronic repeat expansion in the CNBP gene (DM2). When transcribed, these repeat expansions generate toxic C(C)UG RNAs that directly sequester the muscleblin d like (M BNL ) proteins. M BNL proteins regulate alternative splicing during the developmental transition from fetal to adult life Among the three paralogs of the M BNL family, M BNL1 is express ed abundantly in skeletal muscle while M BNL 2 express ion is higher in the central nervous system (CNS). Mbnl1 knockout mice recapitulate (DM) relevant skeletal muscle symptoms including myotonia but show only mild CNS phenotypes. In contrast, Mbnl2 knockout mice exhibit DM associated CNS abnormalities, including sleep d y s regulation w ithout major skeletal muscle deficits To evaluate the effect of com pound loss of Mbnl gene expression we crossed Mbnl1 and Mbnl2 knockout lines but double knockout mice were inviable Interestingly, we discovered that Mbnl1 ; Mbnl2 homozygous; heterozygous double knockout mice exhibit ed a shorter life span, severe myotonia, muscle weakness enhanced histo pathology and neuromuscular junction (NMJ) deficits Additionally, Mbnl1 ;

PAGE 16

16 Mbnl2 knockouts develop ed cardiac conduction block accompanied by fibrosis and cardiomyopathy in the heart consistent with the heart phenotype in DM In both skeletal and cardiac muscles, enhanced splicing alterations could underlie these pathological changes. To overcome the em bryonic lethality of Mbnl1 ; Mbnl2 double knockouts, we employed a conditional knockout strategy and created Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ mice with constitutive loss of Mbnl1 but neuron specific depletion of Mbnl2. These mice also showed reduced life span m uscle weakness and severe motor deficit s. Moreover, pronounced splicing alterations in the brain were detected and hippocampal dys function was uncovered by electrophysiological analysis. We conclude that both Mbnl1 and Mbnl2 play critical roles in skeletal muscle, heart and brain during development and their depletion by CUG and CCUG expansion RNA in DM lead s to the characteristic multisystemic manifestations of this neuromuscular disease. These results suggest that alternative therapeutic approaches should be developed which are designed to restore the totality of MBNL activity in DM tissues.

PAGE 17

17 CHAPTER 1 OVERVIEW OF MYOTONIC DYSTROPHY AND ALTERNATIVE RNA PROCESSING Introduction Myotonic Dystrophy (DM) is a M icrosatellite E xpansion D isorder Myotonic dystr ophy (DM) is the most common adult onset muscular dystrophy with a prevalence of 1 in 8000 ( Harper, 2001 ; Lee and C ooper, 2009 ) Along with skeletal muscle weakness and atrophy, the characteristic feature of this disease is myotonia a delay in relaxation after muscle contraction ( Barroso and Nogues, 2009 ; Wang and Huang, 2011 ) However, skeletal muscle is not the only system affected in DM. Patients also develop neuropsychiatric symptoms, cardiac conduction block and sudden death, insulin resistance testicular atrophy, gastrointestinal symptoms a nd cataract. Twenty one years ago, when the type 1 DM ( DM 1 ) genetic loc us and causative mutation was first described it was unclear how a single m utation in a single gene could acc ount for all of these sym p toms. DM belongs to a group of diseases called microsatellite expansion disorder s Microsatellites are short tandem nucleotide repeats and their sizes are variable (polymorphic) among normal individuals. More than twenty diseases are caused by microsatellite repeats when the repeats expand beyond a certain threshold ( Batra et al., 2010 ) These repeats are located in different gene regions and generate pathologic effects thro ugh protein gain of function, transcription al interference or RNA gain of function mechanisms ( Nelson et al., 2013 ) For example, Huntington disease is caused by protein gain of function in which pathologic al (CAG) n repeats locate d in the coding region of the HTT gene generate toxic huntingtin protein which accumulates in intr a nuclear inclusions ( La Spada and Taylor, 2010 ) When repeat s are located in a

PAGE 18

18 non coding region suc h as (CGG) n ( full mutation, n>200) repeats in the FMR1 gene in Fragile X mental retardation syndrome ( FRAXA ) they adversely affect gene expression through hypermethylation ( Swanson and Orr, 2007 ) Repeats in non coding region s may also generate toxicity through an RNA gain of function mechanism An interesting example is Fragile X trem or ataxia syndrome (FXTAS) which is caused by FMR1 (CGG) n ( permutation, n=55~200) expansions These repeats are shorter than those present in FRAXA but expression of these (CGG) 55 200 expansions leads to upregulation of FMR1 mRNA levels, nuclear retention of these mutant RNAs in the nucleus and sequestration of several RNA binding proteins (RBP) including hnRNP A2/B1 and PURA. ( Jin et al., 2007 ; Sofola et al., 2007 ) Interestingly, sense and antisense transcription of repeat expansion regions may contribute in different ways to pathogenesis. In spinal cerebellar ataxia type 8 (SCA8), protein gain of function and RN A gain of function mechanisms have been suggested to be associated with disease with both sense (coding, ATXN8 gene) and antisense (non coding, ATXN8OS ) RNAs expressed ( Daughters et al., 2009 ; Moseley et al., 2006 ; Ranum and Cooper, 2006 ) In 2011, a (GGGGCC) n (G 4 C 2 ) repeat in the first intron of the C9ORF 72 gene was reported in families affected by frontal temporal dementia and amyotrophic lateral sclerosis ( FTD / ALS) ( DeJesus Hernandez et al., 2011 ; Renton et al., 2011 ) One of the proposed mechanism s for this disease is that (G 4 C 2 ) repeats may trap RBPs and two groups have reported potential sequestered factors ( Mori et al., 2013 ; Polymenidou et al., 2012 ; Xu et al., 2013 ) These new findings have dr a w n more attention to the field of microsatellite expansion disorders.

PAGE 19

19 DM type 1 ( DM1 ) is the first example of an RNA gain of functio n disease and DM type 2 ( DM2 ) is a perfect example of a different but structurally related, repeat on a different gene tha t cause s similar pathological symptoms via the same molecular mechanism. For DM1, unstable (C T G) n expansion s containing > 50 repeats are located in the the DMPK gene ( Brook et al., 1992 ; Buxton et al., 1992 ; Fu et al., 1992 ; Mahadevan et al., 1992 ) In DM2, unstable (CC T G) n expansion s containing > 75 repeats are located in the first intron of CNBP /ZNF9 ( Liquori et al., 2001 ; Ranum et al., 1998 ; Ricker et al., 1994 ) The congenital form of DM is referred to as CDM, which is caused by (C T G) >1,000 expansion s in DMPK ( O'Rourke and Swanson, 2009 ; Poulos et al., 2011 ; Ranum and Cooper, 2006 ; Ranum and Day, 2002 2004 ; Shin et al., 2009 ) In both of the se cases, (CUG) n or (CCUG) n transcript s accumulate i n ribonuclear foci and these foci colocalize with several RBPs most prominently the m uscleblind like (Mbnl) proteins ( Fardaei et al., 2001 ; Fardaei et al., 2002 ; Mankodi et al., 2003 ) Myotonic Dystrophy (DM) is a M ultisystemic D isease While muscle pathologies may be considered as the most overt sympto ms of DM this disease is multi systemic in nature. I n addition to skeletal muscle symptoms DM patients also experience problems involving the central nervous system (CNS) cardiovascular functions metabolic and endocrine systems, as well as the reproduct ive and visual system s ( Ashizawa and Sarkar, 2011 ; Wells and Ashizawa, 2006 ) These systemic manifestations could be the presenting features and impose additional physiological and psychological burden s on patients and their families Therefore, rather than muscle symptoms, these non muscle symptoms may cause a more p rofound impact on their quality of life The presentation of these various symptoms also cause s mis diagnosis and increase s the chance of a medical emergency On the other hand,

PAGE 20

20 this disease presented a significant challenge for scientist s to generate a pathogenic model to explain th is multisystemic disease DM associated CNS involvement includes excessive daytime sleepiness ( hypersomnia ) ( Dauvilliers and Laberge, 2012 ) spatial learning deficits ex ecutive dysfunction, cognitive and linguistic impairment, apathy and social phobia, anxiety and depression, attention deficits and hyperactivit y in the case of children ( Meola and Sansone, 2007 ; Modoni et al., 2008 ; Sansone et al., 2007 ) These symptoms are a major concern of patients and their partners and have a profound impact on their daily performance and quality of life ( Ashizawa, 1998 ) Arrhythmia is the most commo n cardiac symptom. Although most DM1 patients develop first degree AV block without any overt sign s of heart failure, these mild AV block s could suddenly evolve into advanced ventricular tachycardia (VT) and ventricular fibrillation (VF) resulting in sudd en death ( Groh et al., 2008 ; Petri et al., 2012 ; Wahbi et al ., 2012 ) Other symptoms include insulin resistance testicular atrophy ( infertility ) and subcapsular ocular cataract s S ubjective complaints from DM patients include hand and arm problems, fatigue and sleep disturbance ( Heatwole et al., 2012 ) Patients with CDM are hypotonic and appear as floppy infant s A ssisted ventilation is frequently required and c lub feet (talipes) and mental retardation are commonly obs erved ( Campbell et al., 2004 ; Roig et al., 1994 ) DM patients are also sensitive to benzodiazepine s barbitu r ate s ( Harper, 2001 ) and neuromuscular blocking drugs S urgical complications are frequently encountered and the risk s of an esthesia are higher than in normal individual s ( Kashiwai et al., 2012 ; Mathieu et al., 1997 ; Nishi et al., 2004 ) DM patients also have higher risk s of sleep apnea ( Kiyan et al., 2010 ) and fracture ( de Die Smulders et al., 1998 )

PAGE 21

21 M ouse Models for Studying Myotonic Dystrophy Since the discovery of the ( CTG ) n expansion in the DMPK a number of mouse models have been generated to clarify DM1 disease mechanisms ( Gomes Pereira et al., 2011 ) They can be categorized into four groups: 1) D mpk knockout mice; 2) (CU G) n expansion or poly(CUG) mice; 3) CUGBP 1 overexpression mice ; 4) Mbnl knockout mice. Initial pathogenic models proposed that (C T G) n repeats alter the transcription of the DMPK gene ( Krahe et al., 1995 ) Therefore, D mpk knockout mice were created to determine if loss of Dmpk expression could reproduce the characteristic manifestations of DM disease However, Dmpk knockout mice failed to develop myotonia and showed only a modest late onset myopathy ( Jansen et al., 1996 ) Since loss of Dmpk expression failed to recapitulate DM phenotypes, another possibility was that the (CU G) n expansion itself could generate the pathological effects regardless of the gene context. To test this hypothesis, the HSA LR transgenic model for DM was generated in which a (C T G) 250 repeat UTR of the human skeletal ac tin ( HSA ) gene Th is (C T G) 250 transgene was expressed specifically in skeletal muscle by the actin promoter. The HSA LR model developed myotonia while control short repeat, or (C T G) 5 mice ( HSA SR ) remained asymptomatic ( Mankodi et al., 2000 ) To simula te the multi system expression of DMPK in humans, several mutant DMPK (C T G) n transgenic lines were created. The DM300 328 line contains a 45 kb genomic fragment from a DM1 patient with a (C T G) 300 expansion mutation ( Lia et al., 1998 ; Seznec et al., 2001 ; Seznec et al., 2000 ) Surprisingly th is repeat size jumpe d to around 600 repeats in DMXL and later on more than 1000 in DM SXL lines, which recapitulate s the intergenerational instabilities seen in DM1 patients ( G omes Pereira et

PAGE 22

22 al., 2007 ; Huguet et al., 2012 ) The SXL model also show s splicing alterations in multiple systems although the degree of mis spli ci ng is very modest since the expression of transgenes with large expansions is repressed In skeletal muscle weakness/atrophy was detectable ( Huguet et al., 2012 ) and in the CNS behavioral abnormalities and synaptic defects were present ( Hernandez Hernandez et al., 2013 ) The main limitation of these transgenic mouse lines is they exhibit individual variabilit y a nd are time consuming to generate ( Gomes Pereira et al., 2011 ) The EpA960 transgenic line contains an interrupted CTG repeat cloned into the DMPK UTR w hich can be crossed to a tamoxifen inducible transgenic Cre line. T wo mouse models have been created that express the DMPK (CUG) 960 transgene in skeletal muscle and in heart in a spatial and temporal manner. The skeletal muscle transgenic mouse EpA960/HSA Cre ER T2 showed severe muscular atrophy and myotonia ( Orengo et al., 2008 ) while the cardiac transgenic mouse EpA960/MCM(MerCreMer), displayed arrhythmia, card iomyopathy and early mortality as early as two weeks after induction ( Wang et al., 2009 ) ( Wang et al., 2007 ) In both cases, upregulation of CUGBP1 hereafter referred to as CELF1, has been demonstrated to be an early event involved in splicing alteration and pathological phenotypes. The major function of CELF1 is to promote the production of fetal protein isoform s and phosphoryla tion of CELF1 by (CUG) n repeat induced protein kinase C (PKC) stabilize s and increase s steady state CELF1 level s ( Kuyumcu Martinez et al., 2007 ; Wang et al., 2009 ) However, CELF1 overexpression cause s early lethality ( Ho et al., 2005 ; Timchenko et al., 2004 ) To overcome this problem, a tissue specific tetracycline inducible system was utilized. Bitransgenic MHC rtTA/TRECUGBP1 (MHC:

PAGE 23

23 tetracycline transactivation) mice overexpress ing C ELF 1 in the heart ( Koshelev et al., 2010 ) and MDAFrtTA/TRECUGBP1 mice ove rexpress ing CELF1 in skeletal muscle ( Ward et al., 2010 ) were subsequently created While d ilated cardiomyopathy AV conduction block and early mortality were observed in heart specific C ELF 1 overexpress ing mice ( Koshe lev et al., 2010 ) c entralized nuclei and splicing mis regulation were seen in the skeletal muscle specific C ELF 1 overexpression model ( Ward et al., 2010 ) Although the EpA960 and CELF 1 overexpression model s recapitulated some DM1 heart and skeletal muscle phenotypes it is not clear if CELF 1 overexpression is a cause or a consequence of CUG repeat expansion expression A s an alternative to the CELF1 gain of function model DM pathogenesis may result from protein loss of function due to sequestration on repeat expansion RNAs, which are predicted to form sta ble RNA hairpin structures A primary candidate for this type of sequestered factor in DM is the muscleblind like ( MBNL ) proteins ( Miller et al., 2000 ) MBNL pro teins bind to dsCUG and dsCCUG RNA T his binding is proportional to repeat length and MBNL co localizes with (CUG) n repeat expansion RNAs in ribonuclear foci in DM1 patient cells and tissues ( Mankodi et al., 2003 ) Based on these observations we proposed the MBNL loss of function (LOF) model for DM and t o test this hypothesis, we generated Mbnl1 knockout (KO) mice. In agreement with the MBNL LOF model, these KO mice recapitulate multiple features of DM1 muscle including myotonia, myopathy with centralize d nuclei and split fibers subcapsular cataract s and specific alteration s in RNA splicing observed in this disease ( Kanadia et al., 2003a ) F urther support for this model came from experiments using AAV mediated Mbnl1 overexpression i n HSA LR mice

PAGE 24

24 ( Kanadia et al., 2006 ) T he same homologous recombination strategy used to generate Mbnl1 KO mouse was employed to ge ner ate Mbnl2 KO mice, which fail to recapitulate DM muscle manifestations but do display disease associated CNS phenotype s including abnormal rapid eye movement (REM) sleep regulation impaired hippocampal function and increased seizure propensity ( Charizanis et al., 2012 ) We u se HITS CLIP (High Throughput Sequencing combined with Crosslink ing and Immunoprecipitation) and RNA s eq analysis for Mbnl 2 KO hippocampus and identif y hundreds of mis sp licing events. Another study use d a similar approach on the Mbnl1 KO model and suggest ed that MBNL proteins are also required for normal RNA localization through specific binding t o the s of its targets ( Wang et al., 2012 ) These reports support the hypothesis that MBNL LOF is a fundamental event in DM and also imply that MBNL proteins control co/post transcripti onal regulation of RNAs Regulation of Gene Expression at the Co/post transcription Level : Overview of Alternative RNA Processing A lternative splicing (AS) is a complex process that requires a high level of precision to generat e the myriad of protein is oforms necessary for different developmental stages and metabolic conditions ( Blencowe, 2006 ) Data generated from RNA seq of the human transcriptome suggest s t hat > 95% of human multi exon genes produce multiple transcripts ( Pan et al., 2008 ; Wang et al., 2008 ) These AS events are involved in various biological process es and are critical for different periods throughout the lifetime of the organism ( Irimia and Blencowe, 2012 ) Alternative splicing mis regulation has been linked to various human diseases, particularly neurological diseases and cancers ( Cooper et al., 2009 ; Licatalosi and Darnell, 2006 ; Wang and Cooper, 2007 ) Although some indivi dual AS events appear to be linked to certain

PAGE 25

25 phenotypes, recent evidence ind i cates that the complex AS network impact s protein protein interaction s and signaling pathways ( Buljan et al., 2012 ; Weatheritt and Gibson, 2012 ) The accurate control of splicing is determined by both cis and tran acting factors. In cis, relatively conserved sequences a t exon intron junction and bra n ch point regions of pre mRNA s provide s specific cue s for recruitment of the spliceosome, a n RNA protein complex that bind s to both (ss) via RNA RNA base pairing although protein protein interactions a re also involved ( Wahl et al., 2009 ) However, these conserved sequences are degenerate and additional regulatory sequences in both intron and exon region s are required to facilitate spliceosome recognition and binding These additional sequences f unction as splicing enhancers (exonic and intronic splicing enhancer, ESE and ISE, respectively) or silencers ( exonic and intronic splicing silencer, ESS and ISS respectively) to either promote or inhibit spliceosome recruitment ( Wang and Burge, 2008 ) S erine arginine rich (SR) and heterogeneous nuclear ribonucleoproteins ( hnRNP ) proteins are ubiquitously expressed RNPs that bind to these regulatory sequences. SR proteins often function as splicing activators and hnRNPs as repressors although these activities are switched for some splicing events ( Cartegni et al., 2002 ) Mutations in several RNPs have been associated with human diseases ( Lukong et al., 2008 ) In addition, tissue spe cific RNPs have been identified and characterized using high throughput methods including HITS CLIP, microarray and RNA s eq. For example, Nova ( Darnell, 2006 ) M bnl 2 ( Charizanis et al., 2012 ) and Rbfox proteins ( Gehman et al., 2 012 ; Gehman et al., 2011 ) play important splicing roles in the brain while Mbnl1 and C ELF 1 are more important for skeletal and

PAGE 26

26 cardiac muscle splicing regulation U sing HIT S CLIP, a YGCY motif has been shown to be the prin c ipal binding site for Mbnl proteins while a YCAY motif is required for Nova proteins ( Charizanis et al., 2012 ; Ule et al., 2006 ) Bayesian model s also suggest interactive network s between Nova and Rbfox proteins indicating possible functional cross talk between RBPs ( Zhang et al., 2010 ) Importantly, alterations in either cis or trans acting component s of the AS machinery could result in disease. While cis element mutation s could affect splicing such as the many mutations in the DMD gene in Duchen ne muscular dystrophy, loss of function of a trans acting factor such as hnRNPA2/B1 or PURA, could cause Fragile X associated tremor / ataxia syndrome (FXTAS) ( Cooper et al., 2009 ) In recent years, several RBPs have been identified and alterations of these RBPs have been shown to cause neurological diseases : 1) NOVA protein s and paraneoplastic syndr ome ( Darnell and Posner, 2003 ) ; 2) RBFOX1 a nd epilepsy ( Gehman et al., 2011 ) and RBFOX2 and cerebellar degeneration ( Gehman et al., 2012 ) These examples may be viewed as the tip of an iceberg since many neurological diseases do not have a known cause. Very recently, mutation s in the genes encoding hnRNP A2B1 and hnRNP A1 ha ve been reported in amyotrophic lateral scle rosis patients ( Kim et al., 2013 ) How do mi sregulated events in AS impact biological processes and human health? A lternative splicing play s a critical role in the regulation of multiple gene expression steps including transcription and the processing, turnover and translation of RNAs ( de Almeida and Carmo Fonseca, 20 12 ) Additionally factors that control chromatin structure and the transcription al machinery also affect splicing and vice versa ( Luco et al., 2011 ; Luco and Misteli, 2011 ; Luco et al., 2010 ) This dynamic, cooperative

PAGE 27

27 and interactive process ensures fidelity in the control of gene expression in a highly spatial a nd temporal manner ( Braunsch weig et al., 2013 ) Alternative Splicing Misregulation in DM After the DM1 mutation was mapped to UTR of the DMPK gene the CELF1 protein was s h own to interact with short (CUG) 8 repeats ( Timchenko et al., 1996a ; Timchenko et al., 1996b ) Increased CELF1 protein level s and i nsulin receptor (IR) mis splicing were observed in DM1 patients and CELF1 overexpression studies in cell culture systems was shown to shift the splicing of IR ( Savkur et al., 2001 ) Similarly, cTNT ( Philips et al., 1998 ) and CLCN1 ( Charlet et al., 2002 ) splicing events were shown to be CELF1 depend ent so CELF1 was thought to play an important role in DM1 pathogenesis. The discovery that MBNL proteins specifically recognize (CUG) n repeat expansions introduced the possibility that t he change in CELF protein levels w as not a primary event in DM pathoge nesis The consequence of MBNL sequestration is the failure of developmental splicing transition s that disrupts the conversion of fetal to adult isoform expression during postnatal development ( Kalsotra and Cooper, 2011 ; Lin et al., 2006 ) For example, the specific mis splicing of CLCN1 exon 7a cause s myotonia (Figure 1 1) ( Charlet et al., 2002 ; Mankodi et al., 2002 ) Indeed, antisense oligonucleotide s can be used to correct splicing pattern of the mouse Clcn1 pre mRNA which results in the reversal of myotonia ( Wheeler et al., 2007b ) Therefore, DM1 is a spliceopathy and sequestration of MBNL proteins result s in the specific splicing events that are mis regulated in DM In fact, in the past decade, more genes have been found to be mis spliced in DM In the brain, mis splicing of MAPT (microtubule associated protein Tau ) ( Sergeant et al., 2001 ) G RIN 1 (NMDAR1) and APP ha ve been documented in DM1 patients ( Jiang et

PAGE 28

28 al., 2004 ) In skeletal musc le, mis splicing of R YR 1 (ryanodine receptor 1) S ERCA 1 (sarcoplasmic/endoplasmic reticulum calcium transporting ATPase) ( Hino et al., 2007 ; Kimura et al., 2005 ) MTMR (microtubularin related 1 gene) ( Buj Bello et al., 2002 ) B IN 1 (bridging integrator 1) ( Fugier et al., 2011 ) CACNA1S (calcium channel, voltage dependent, L type, alpha 1S subunit) ( Tang et al., 2012 ) ha ve also been reported Many of these genes are implicated in calcium homeostasis and excitation contraction coupling Based on these findings, RNA GOF leading to MBNL LOF appears to be the best current model for DM (Figure 1 2) However, additional splicing factor s such as hnRNP H and hnRNP F ( Jiang et al., 2004 ) Staufen1 ( Ravel Chapuis et al., 2012 ) and the RNA helicase P68 (DDX5) ( Laurent et al., 2012 ) have been implicated in DM pathogenesis. Moreover, a novel translational mechanism repeat associated no n ATG translation ( RAN translation ) has also been proposed to play a role in this disease ( Zu et al., 2011 ) The development of effective therapies for DM1 and DM2 r equires a fundamental understanding of the pathogenic events that cause this neuromuscular disease. Therefore, the objective of this thesis was to determine if the majority of DM disease manifestations can be explained by MBNL LOF.

PAGE 29

29 Figure 1 1 Mbnl1 regulates Clcn1 alternative splicing. In normal adult s Mbnl1 functions as a splicing regulator that promotes exon 7a skipping The CLC 1 protein is the major chloride channel on the skeletal muscle cytoplasmic membrane or sarco lemma which regulates chloride ion transport into the cell. In DM1, (CUG) n repeat expansions sequester Mbnl1 and the fetal CLCN1 isoform which includ es exon 7a become s predominant in adult muscle The inclusion of exon 7a causes a frameshift and induce s degradation of Clcn1 via the NMD pathway. The consequence is loss of ClC 1 protein impaired chloride ion flow and myotonia.

PAGE 30

30 Figure 1 2 The RNA mediated pathogenesis model for myotonic dystrophy (DM) DM is caused by ( C T G ) n repeat expansions in the DMPK At the RNA level, these expanded repeats form a double stranded hairpin which sequesters M BNL proteins. Since M BNL proteins are splicing factors that promote adult type splicing, the sequest ration of M BNL s by RNA hai rpin s causes a splicing shift towards the fetal pattern. For example, M BNL s facilitate Serca1 exon 22 inclusion but skipping of the Tnnt3 fetal exon By an unknown mechanism, the (CUG) n hairpin has been proposed to activate PKC leading to stabilization of CUGBP1 by hyperphosphorylation promoting fetal pattern splicing

PAGE 31

31 CHAPTER 2 ALTERNATIVE SPLICING CHANGES IN MBNL1 KNOCKOUT AND DM1 PATIENT BRAINS Introduction Mbnl1 in DM Skeletal Muscle Pathogenesis There are three paralog ous proteins, Mbnl1 Mbnl2 and Mbnl3 in the Mbnl family ( Pascual et al., 2006 ) While Mbnl1 and Mbnl2 are expressed mainly in adult tissues, Mbnl3 is expressed during embryonic stage s ( Kanadia et al., 2003b ) Mbnl1 knockout mice develop many symptoms of DM includ ing skeletal muscle pathology ( centralized nuclei split fibers myotonia ), subcapsula r cataract s, a low penetrant cardiovascular defect and reduced fertility ( Kanadia et al., 2003a ) Also, Mbnl1 knockout mice show DM1 associated splicing changes including mis splicing of Tnnt3 and Clcn1 in the skeletal muscle and Tnnt2 in the heart. Mbnl1 in DM Brain Pathogenesis Gross morphological changes in the brain did not occur in Mbnl1 KO mice D ue to the myotonia and its effects on mobility, behavioral tests that require locomotion are unreliable. Nevertheless, Mbnl1 behavioral analysis has been performed previously by an other group and this report concluded that Mbnl1 KOs have motivational deficit s suggesting loss of Mbnl1 may contribute to certain CNS symptoms of DM patients ( Matynia et al., 2010 ) Unfortunately, Mbnl1 brain specific conditional KO mice have not been generated Mbnl1 protein is both nucle ar and cytoplasm ic in neuron s and the overall expression level is abundant in the brain ( Daughters et al., 2009 ) Moreover DM 1 brain tissue shows significant sp licing misregulation for specific targets including the NMDA receptor G RIN 1 and microtubule associated protein tau (MAPT). To date no high

PAGE 32

32 throughput method has been applied to any of the DM mouse models. Since we hypothesize that splicing misregulation is a fundamental event in DM, we tested the hypothesis that Mbnl1 KO brains would show a broader array of mis splicing events compared to WT. Therefore, we collaborated with Dr. Manuel Ares (University of California at Santa Cruz) to perform splicing micro array analysis on Mbnl1 knockout brain. Results Splicing M isregulation in Mbnl1 K nockout B rain First, we tested DM1 brain targets that were found in previous human stud ies ( Jiang et al., 2004 ; Sergeant et al., 2001 ) However, significant splicing changes in GRIN1 exon 4 (human exon 5), MAPT exon s (3,4 human exon 2,3) and exon 9 (human exon 10) as well as APP exon s 7,8 were not detected ( d ata not shown). To identify novel splicing targets, splicing events were compared between adult Mbnl1 KOs and WT mice using splicing sensitive microarray s Previous studies applying the same method ology have shown that targe ts with s epscore s (the absolute value of log 2 skip/include ratio, see M aterial s and M ethod s ) >0.3 are generally valid ated by subsequent RT PCR ( Du et al., 2010 ) Unex pectedly, the overall sepscore s for Mbnl1 KO versus WT were < 0.3 and only less than 10 genes showed a sepscore of >0.3. We validated these potential targets by RT PCR using forward and reverse primers in the flanking exons (Table 2 1) and found 4 splicing events ( Sorbs1 exon 2 5 Spag9 exon 31 Sorbs1 exon 6 and Dclk1 exon 19 ) that show ed significant difference s between WT and Mbnl1 KOs in hippocampus and cerebellum (Figure 2 1) These differences were generally small (~10 15%) although a 40% splicing shif t of Sorbs1 exon 25 was noted in Mbnl1 KO heart. We also identif ied a splicing shift within an extensively spliced region

PAGE 33

33 of Camk2d a target identified by splicing microarray analysis Using primers located in flanking exons, we discovered a hippocampal s pecific isoform shift in Mbnl1 KO brain We observed that the WT mice, increased in Mbnl1 KO hippocampus but not in cerebellum. This isoform is very abundant in the early perinatal stage as shown in P1 whole brain and P6 forebrain samples but it decrease s dramatically in P42 f orebrain indicating that is the fetal isoform (Figure 2 2 ). Splicing M isregulation in DM1 B rain A utopsy S amples To see if these splicing changes could also be detected in DM patients, we collaborated with Dr. Takashi Kimura ( Hyogo University Japan ) a nd tested splicing patterns in human autopsy brain samples. Using primers specific for human cDNA sequence s significant difference s were uncovered in S ORBS 1 exon 26, DCLK1 e xon 19 and MPRIP exon 9 by RT PCR. Also a significant increase of the w as observed pattern in 2 3) Discussion This study reported the first splicing alterations in the brain of Mbnl1 KO mice Although these tar gets have not been analyzed by HITS CLIP to d e termine if they are direct bi n ding targets of Mbnl1, these novel targets contain multiple repeats of the MBNL binding motif YGCY WT fetal and adult sample s are used as control s in the splicing micro array so fe tal isoform retention in Mbnl1 KOs was read i ly detectable Sorbs1 is a vinculin binding protein and is ubiquitously expressed in tissue s inc l uding in the brain where it is expressed in neurons including cerebellar Purkinje cells ( Lebre et al., 2001 ) Th is expression pattern is coincident with the expression of Mbnl1 in the

PAGE 34

34 brain ( Suenaga et al., 2012 ) It has been suggested that Sorbs1 is involved in macrophage function, and is also critical for insulin signaling and cytoskeletal organization ( Lebre et al., 2001 ; Lesniewski et al., 2007 ; Lin et al., 2001 ) Interestingly, exon 25 contains a nuclear localization signal so loss of this exon could cause a change in subc ellular localization ( Lebre et al., 2001 ) Camk2 is a serine/threonine protein kinase that phosphorylate s a variety of substrate s, including cytoskeleton component s and factors that regulate calcium homeostasis such as the ryanodine receptor Ryr. Though the expression level of is lower than other isoforms, it is highly expressed in vasopressin positive neurons in the suprachiasmatic nucleus (SCN) and has been shown to play a critical role in the induction of PER1 and PER2 gene expression ( Nomura et al., 2003 ; Yokota et al., 2001 ) The alternative ly spliced exon 14b (33bp) contain s a NLS and the retains in the cytopl asm due to exon 14b skipping ( Takeuchi et al., 1999 ; Xu et al., 2005 ) Th is isoform switch may be important for circadian rhythm regulation and might be a factor causing excessive daytime sleepiness in DM patients. DCLK1 is a protein kinase that could regulate microtubule polymerization ( Lin et al., 2000 ) Since MAPT splicing dysregulation and Tau pathology have been reported in DM1 patients, the role of DCLK1 i n Tau regulation deserve s further investigation. Skipping of exon 19 alters autophosphorylation activity and this event may play a role in neuronal migration ( Burgess and Reiner, 2002 ) Mbnl1 KO skeletal muscle is characterized by > 200 splicing events with a s epscore >0.3 ( Du et al., 2010 ) Targets previously shown to have splicing shifts in DM1 brain (Grin1, MAPT, APP) were not detected by splicing microarray analysis of these mutants These results suggest that loss of Mbnl1 alone is not enough to explain the

PAGE 35

35 splicing changes seen in DM1 brains and s ome other splicing factor might compensate for Mbnl1 loss. Thus splicing regulation in the Mbnl2 KO brain was investigated

PAGE 36

36 Table 2 1 Primers for Mbnl1 brain targets validation Gene Gene ID sep exon bp primer fwd primer rev Sorbs1 20411 1.11 25 168 ccagctgattacttggagtccacagaag gttcaccttcataccagttctggtcaatc Bbs9 319845 0.99 2 56 gctgcttggcaggattctgtctg ccactgttgtccacatcagccaag Camk 2d 108058 0.90 21 89 catcgcatacattcggctcacac cgtgtcacatgataagatgacgtgtcac Camk2d 108058 14 16 cagccaagagtttattgaagaaaccaga ctttcacgtcttcatcctcaatggtg Camk2d 108058 14 16 ggaagtccagttcgagtgttcagatga ctttcacgtcttcatcctcaatggtg Spag9 70834 0.63 31 39 ggactggaaatggtgtcattatctccat gggactgccacaaagaatttcacag Mtdh 67154 0.62 11 157 gacactagagaagagcttccagtgaatacctc tgtcttccagcactgtgtattctgttgac Tax1bp1 52440 0.57 10 147 ggcaacacggcaagaacttatctttc gggtctgtatttattgaagcatcgttca Acly 104112 0.51 14 30 ccagca cccagtaggacagcatct cgtctcgggaacacacgtagtcaa Fcmd 246179 0.51 3 138 cccaagagaacaccatagaccaatgagt gctatcaaatccaactcgattcccttt Zmynd11 66505 0.46 4 162 gctggtattgaacaggaaggatattggt cccatttcctgcttgttagagtgctt Sorbs1 20411 0.38 6 90 ctgcatctgggaagactcgcct g acttgctttcatgcttcggagattc Mprip 26936 0.37 9 108 gcacatggaaaccaacatgctgat gcttggttagccagcctttcttga Dclk1 13175 0.37 19 74 gctgtcagtagctggcaaaatcaaga ctcctcacatcctggttgcgtctt Mbp 17196 0.37 5 78 cagagacacgggcatccttgact gggagccataatgggtagttctcgt Hnrpd 11991 0.24 7 147 ggaacagtatcagcagcagcagca gcctggatactttcccataaccactct Nfix 18032 0.13 10 148 ggcaggactcgctgaaggagttt ctgagactgctgtgggatgttcagaa Grin1 14810 4 63 tcatcctgctggtcagcgatgac agagccgtcacattcttggttcctg Mapt 17762 3,4 87,87 aagaccatgctggagatt acactctgc ggtgtctccgatgcctgcttctt Mapt 17762 9 93 cccatgccagacctaaagaatgtcag gcttgtgatggatgttccctaacgag App 11820 7,8 168,57 caaccaccactgagtccgtggag gacattctctctcggtgcttggctt

PAGE 37

37 Figure 2 1. Loss of Mbnl1 cause s splicing changes in brain target RNA A) Top ranked genes acquired from splicing microarray analysis were validated by RT PCR using WT and Mbnl1 KO hippocampal RNA s For Sorbs1 exon 25 splicing in the heart, loss of Mbnl1 caused a ~ 40% shift to the fetal isoform. However, in either hippocampus or cerebellum, the splicing shifts were only ~10 15%. Subtle but consistent splicing changes were also detectable for Spag9 exon 31, Sorbs1 exon 6 and Dclk1 exon 19. A splicing change in Mprip exon 9 was not detectable Developmental assays are included on the right side of each gene to show the corresponding fetal (P6) and adult (P42) forebrain (fb) default splicing pattern. (percent inclusion) changes except in Mprip Both unpaired t test and permutation test were used for p value calculation. (* p value <0.05 and ** p value <0.01)

PAGE 38

38 Figure 2 2 Camk2d splicing in Mbnl1 KO mice and during normal development. A) Location of primers and the composition of different Camk2d isoforms. We designed primers within flanking exons around this region with three alternative spliced cassettes. B) Splicing assay showed a spatial and temporal specific splicing pattern for Camk2d A n increase of the was observed in the Mbnl1 KO. However, this change was only detectable in hippocampus and not in cerebellum. Developmental assay s are shown on the right using P1 whole brain (wb), P6 forebrain (fb) and hindbrain (hb) as fetal and P42 fb and hb a nd during the fetal stage but decrease s dramatically in adult s C) Statistical analysis of Camk2d Mbnl1 KO hippocampus (* p value <0.05)

PAGE 39

39 Figure 2 3 Novel targets are also mis spliced in DM1 autopsy brains. A) T argets from the splicing microarray study were tested using DM1 patient autopsy samples. Individual s without symptoms (control) or with neurological disease (disease) and sample s from fetal t issue were used as controls. B) Significant changes in SORBS1 exon 26, DCLK1 exon 19 and MPRIP exon 9 were observed and reproduced the fetal pattern. C) Composition of different Camk2d isoforms in human. D) Camk2d isoform analysis in different samples. Fet E) Statistical analysis revealed an increase in the a decrease in the DM1 samples which is also recapitulates the fetal pattern.

PAGE 40

40 CHAPTER 3 LOSS OF MBNL2 LEADS TO SPLICING DYS REG ULATION IN THE BRAIN : IMPLICATION S FOR DM1 CNS DISEASE Introduction Earlier Studies of Mbnl2 Gene Trap Mouse Models Mbnl2, one of the Mbnl family member s drew the attention of DM researchers after the successful Mbnl1 knockout model was generated and cha racterized As mentioned earlier, an in vitro minigene reporter study suggested that Mbnl2 may have similar effects as Mbnl1 in splicing regulation ( Ho et al., 2004 ) Due to the possibility that loss of Mbnl2 could cause splicing changes and reproduce DM phenotypes, two different Mbnl2 gene trap mice were created by targeting different introns. The Mbnl2 GT4 line, which has a Geo cassette insertion in intron 4 of the M bnl2 gene failed to show any significant phenotype s ( Lin et al., 2006 ) In contrast, the Mbnl2 GT 2 line which contains the same gene trap cassette in intron 2, intr on 2 exhibit ed a mild skeletal muscle phenotype and myotonia ( Hao et al., 2008 ) These discordant results suggest ed that M BNL 2 may have a role in DM pathogenesis but it was not clear if MBNL 1 and MBNL 2 possessed similar or different activities Additional P otential Mbnl2 Functions A n early study provided evidence that Mbnl2 play s a role in RNA localization ( Adereth et al., 2005 ) and a recent HITS CLIP study showed that Mbnl family members bind to the s of target gene s ( Wang et al., 2012 ) These results suggest that MBNL proteins m ay have roles beyond that as solely splicing factor s regulating m any aspect s of gene expression. Following a comparison of Mbnl1 knockout and HSA LR that Mbnl2 might regulate extracellular matrix related genes by controlling mRNA levels or localization ( Du et al., 2010 ) I n terestingly,

PAGE 41

41 Mbnl2 morpholino induced knockdown in zebrafish showed some splicing changes and disruption of myofibrils and some evidence was provided for a role in regeneration ( Machuca Tzili et al., 2011 ) Mbnl2 expression is higher during early development in skeletal muscle and decline s in adults and Mbnl2 expression increases in Duchene muscular dystrophy patient muscle ( Holt et al., 2009 ) Interestingly, the Mbnl2 gene also undergoes a rhythmical expression pattern in rat pineal gland s uggesting a role in circadian rhythm control ( Kim et al., 2009 ) Taken together, these results indicate that Mbnl2 play s a global role from splicing to mRNA turnover in skeletal muscle and possibly in the brain. To address the roles of MBNL2 in DM, we generated and characterized Mbnl2 kno c kout mice using a conventional homologous recombination approach During this study, we discovered that the expression level of Mb nl2 varies among adult tissues with high expression in various regions of the brain moderate expression in heart and much lower expression in skeletal muscle. Mbnl2 is also express ed in hippocampal pyramidal cells and Purkinje cells in the cerebellum. In either case, the Mbnl2 localizes to the nucleus suggesting an important role in splicing regulation ( Charizanis et al., 2012 ) Results Mbnl2 Regulates Hundreds of Alternative Splicing Events in the Brain Despite the controversial results generated by the gene trap mice, we decided to create a n Mbnl2 null mouse model by a traditional gene knockout approach using homologous recombination to remove exon 2 contain i ng the first ATG start codon. Although there is an alternative initiation codon in exon 3, this isoform knockout strategy eliminated all Mbnl2 protein expression Mbnl2 E2/ E2 KO mice hereafter referred to as Mbnl2 KOs, were born small but the body weight was rest o red to WT levels by weaning

PAGE 42

42 and the se KO mice did not show any overt muscle abnormalities However, some male mice were hyperactive prior to weaning Since Mbnl2 was a potential splicing factor, splicing regulation was tested in different t issues by primer pairs specifically designed for splicing assay (Table 3 1). Unexpectedly, we failed to observe significant splicing shifts in most of the Mbnl1 targets For example, the splicing patterns of Clcn1 and Serca1 in skeletal muscle as well as Tnnt2 and Sorbs1 in cardiac muscle were identical to WT mice (Figure 3 1 A and 1B ) Due to robust expression of Mbnl2 in the brain, we dissected hippocampal tissue from WT and Mbnl2 KO mice and performed splicing assay s on DM1 brain targets as well as ta rgets that were uncovered during the Mbnl1 knockout study. RT PCR screening of these targets (Ryr2 mis splicing was tested based on ( Takasawa et al., 2010 ) ) u ncovered five genes with significant splicing changes in Mbnl2 KO mice, including Grin1 exon 5 Mapt exon s 2 and 3 Camk2d exon 14b 16 Dclk1 exon 19 and Ryr2 exon s 4 and 5 Th is study provided the first evidence that Mbnl2 regulates splicing in the CNS (Figure 3 2). S plicing sensitive microarray s were employed to confirm these findings and also uncover novel Mbnl2 brain targets. Unlike Mbnl1 K O s, massive splicing changes were discovered and a total of 389 genes were identified with a s epscore >0.3 the threshold indicating most of them could be validated by PCR. Firstly, t op t welve targets were selected for validation These targets include d Tanc2 exon 23a, Kcnma1 exon 25a, Limch1 exon E9, Spna2 exon 23, St3gal3 exon 3, Ndrg4 exon 14, Csnk1d exon 9, Ppp1 r12a exon 14, Cacna1d exon 12a Add1 exon 15 Clasp2 exon 16a,b and Mbnl1

PAGE 43

43 exon 7 By comparing these mis splicing events with the normal changes in splicing pattern during postnatal development all the predicted Mbnl2 targets showed a shift towards the fe tal pattern (Figure 3 3 A ) These results in the brain are similar to the effect of blocking Mbnl1 expression in skeletal muscle Among the top 10 transcripts that showed splicing mis regulation Cacna1d (Ca v 1.3) a voltage sensitive calcium channel, showed the most dramatic shift between WT and Mbnl2 KO mice (Figure 3 3 B ) For most Mbnl2 splicing targets t he default splicing pattern and the isoform switch in Mbnl2 KOs are very similar in hippocampus and cerebellum. These results indicate that these splicin g changes are universal throughout the brain, but some region specific difference s could be detected in some genes (Figure 3 4). To confirm the se targets and perform a more comprehensive survey, RNA seq was performed on WT and Mbnl2 KO hippocampus In colla boration with Chaolin Zhang and Robert Darnell ( Rockefeller University ) we f ound 531 alternative ly spliced cassette s that showed difference s between WT and mutant brain exact test with Benjamini correction). In agreement with the splicing sensitive microarray data, a top candidate was N myc down regulated gene 4 ( Ndrg4 ), a gene associated with learning and memory ( Yamamoto et al., 2011 ) Validation of a select set of these targets identified by RNA s eq confirmed that this experimental approach was highly reliable (e.g., see Dgkh exon 27 and Slain2 exon 7 in Figure 4 1 3 ). T o determine if Mbnl2 is directly binding to these target s HITS CLIP was performed and this approach confirmed that the majority of the targets identified by either microarray or RNA s eq were direct binding targets The RNA binding moti f for Mbnl2 was also identified as YGCY, identical to the Mbnl1 binding motif To test if these

PAGE 44

44 novel targets found in Mbnl2 KO mice were also mis regulated in DM1 brain we collaborated with Takashi the top 12 targets, 10 out of 12 s howed significant changes in DM1 temporal lobe and recapitulated the fetal splicing pattern. The gene that showed the largest difference between control and DM1 brain was CACNA1D which was the same result noted in the Mbnl2 KO study ( Charizanis et al., 2012 ) These splicing changes were not observed in the cerebellum sample, and this difference may be due to the shorter (CUG) n repeats in DM cerebellar tissue ( Lopez Castel et al., 2011 ) To date we have discovered hundred s of high confiden ce splicing targets and we validated > 20 targets by RT PCR. These result s support the hypothesis that Mbnl2 is a critical splicing regulator during development and that loss of Mbnl2 in the brain causes a splicing shift towards fetal pattern recapitulating the mis spliced events in DM1 brain The next step was to determine if Mbnl2 KO mice recapitulate DM relevant brain phenotypes. Enhanced Seizure Propensity in Mbnl2 Knockout Mice A potentially interesting phenotype that emerged from our initial KO colony was the hyperactivity phenotype in some Mbnl2 KO males Because of the unus u al hyperactivity phenotype, the s e mice were referred to as pinball males Since not all knockout mice exhibit ed seizure s we perform ed a seizure assay following low dose (40 mg/kg) intraperitoneal injection s with pentylenetetrazole (PTZ), a GABA antag onist. Remarkably both male and female Mbnl2 KO mice tested developed tonic clonic seizures followed by hindli m b extension and death. Mbnl2 heterozygous knockouts also showed enhanced seizure susceptibility although with a longer latency period and less s evere seizure s as rated on a modified Racine S cale Since seizures are not a routine

PAGE 45

45 clinical finding in DM1 or DM2, the DMSXL poly(CUG) mouse model for DM1 was also tested and this transgenic model also show ed higher seizure suscep t ibil ity (Figure 3 5A) To identify the specific aberrant splicing events that contribute d to this phenotype eight gene targets, previously implicated in human epilepsy, were tested and Cacna1d and Ryr2 showed significant difference between WT heterozygous and homozygous knockou ts. In the case of Cacna1d the splicing assay showed a dose effect so that Mbnl2 heterozygous KOs also showed elevated levels of the fetal splicing pattern (Figure 3 5 B and Figure 3 5C) Mbnl2 Knockout Mice Recapitulate REM Sleep Propensity Changes in DM Excessive daytime sleepiness, or hypersomnia is a hallmark symptom in DM1 patients. Patients suffer from an irresistible onset of short sleep events that can occur in the middle of a talk or during a meeting result ing in problems with social interactions and prevent ing them from gaining employment Previous studies have shown frequent rapid eye movement (REM) sleep propensity increases and sleep fragmentation i n DM1 patients during polysomnography (PSG) ( Yu et al., 2011 ) However, none of the existing DM mouse model s recapitulate d th is DM1 sleep phenotype Therefore, we collaborate d with Seiji Nishino ( Stanford University ) in the Sleep and Circadian Neurobiology (SCN ) C enter to characterize Mbnl2 KO sleep physiology Eight male WT and Mbnl2 KO sibs (males are used to avoid estrous cycle effects on sleep ) were used in this study Mbnl2 knockouts exhibit a normal amount of wakefulness and non REM (NREM) sleep but increa se d number of REM sleep episodes during the dark cycle ( the active period for mice) and successfully recapitulate the sleep phenotype seen in DM1 patients. This abnormal REM sleep phenotype could be further enhanced by sleep deprivation (Figure 3 6) This i s the first time that a DM mouse model has successfully recapitulate d the DM

PAGE 46

46 sleep phenotype, and thus Mbnl2 KOs provide a good model for future therapeutic intervention studies Discussion Mbnl2 Depletion Plays a Major Role in DM Brain Pathogenesis The l ack of phenotypes in the two previous Mbnl2 gene trap mouse models misled the DM field into the idea that Mbnl2 function is redundant with Mbnl1 In contrast, Mbnl2 knockout mice al l owed the characterization of hundreds of high confidence splicing targets and the corresponding splicing shifts occur in DM1 brain Th erefore, Mbnl2 sequestration by C(C)UG repeats RNAs appears to be an important event in the development of DM relevant CNS pathology In this study, w e confirmed that Mbnl2 is a critical splicing regulator during development and loss of Mbnl2 results in a splicing shift toward fetal isoform s in adult tissues However, aberrant splicing in Mbnl2 KOs was only seen in the brain and not in skeletal or cardiac muscle. This result highlights important d ifference s between in vivo and in vitro stud ies and that spatial and temporal distribution of gene expression is critical in the evaluation of pathogenic pathways Loss of Mbnl2 contribute s to a very distinct phenotype in the CNS, which contrast s with Mbnl 1 KO mice and a skeletal muscle phenotype. Importantly, Mbnl2 KO is the first DM1 model that recapitulates multiple DM CNS symptoms including REM sleep propensity increases spatial learning deficit s and seizure enhancement Of note, the REM sleep abnorm ality is exactly the same as a recent finding from DM1 patients and indicates a primary central sleep regulation dysfunction ( Dauvilliers and Laberge, 2012 ; Laberge et al., 2013 ; Yu et al., 2011 )

PAGE 47

47 It has been noticed that DM1 patients are sensitive to benzodiazepine s and barbitu r ates, two drugs that bind to GABA A receptor ( Harper, 2001 ) Although seizure s are not a common clinical symptom in DM it is important for patients and physicians to avoid any drug that might lower the seizure threshold. For example, DM patients should avoid sleep deprivation alcohol withdraw and caffeine use. Physicians should exercise caution when prescribing methylphenidate for treating hypersomnia ( Puymirat et al., 2012 ) although whether this drug lower s seizure threshold is debatable ( Santos et al., 2013 ) The new findings in this study provide answers to long standin g questions in the DM field and have additional experimental support for the MBNL LOF model for DM Similar to other RNA binding protein s such as Nova, Rbfox and PTBP, Mbnl2 is an important splicing factor in the brain and MBNL2 mutations could underlie so me neurological diseases. Missplicing of Mbnl2 Targets May Contribute to CNS Symptoms During our analysis, we showed that Mbnl2 knockout mice display Grin1 and Mapt splicing abnormalities that have been documented in DM1 brain For example, mis splicing o f G RIN 1 exon 5 in human has been shown to cause age related cognitive decline and re direct G RIN 1 localization in dendrites ( Modoni et al., 2008 ; Pal et al., 2003 ) The exclusion of MAPT exon 2 could alter protein protein interactions and promote the formation of neurofibrillary tangles. S everal RNA splicing targ e ts uncovered during this study have also been linke d to learning and memory. For example, Tanc2 Ndrg4 and Cacna1d knockout mice develop learning deficits ( Han et al., 2010 ; McKinney et al., 2009 ; Yamamoto et al., 2011 ) Another set of genes dysregulated in Mbnl2 KOs have been linked to epilepsy and we conclude that Cacna1d and Ryr2 are the most likely candi dates to account for the hyperactivity phenotype in this model

PAGE 48

48 Interestingly, Cacna1d mis splicing was also found in Rbfox1 KOs and these mice display kainic acid induced seizure s ( Gehman et al., 2011 ) Although Ryr2 mis splicing has not been linked to seizure susceptibility leaky Ryr2 channel s caused by mutation s have been found in mouse model s ( Lehnart et al., 2008 ) and in human case report s ( Nagrani et al., 2011 ) Moreover, Cacna1d and Ryr2 colocalize and interact with each other in the hippocampus ( Kim et al., 2007 ) These results indicate that perturbation of brain RBPs could potentially cause seizure prone effects in the brain. Of note, Ryr2 Camk2d Csnk1d and Kcnma1 are factors that regulate circadi an rhythm s ( Etchegaray et al., 2009 ; Meredith et al., 2006 ; Montgomery et al., 2013 ; Nomura et al., 2003 ; Pfeffer et al., 2009 ) I soform switch ing could alter circadian cycles and potentially contribute to the hypersomnia p henotype in DM Based on these results, we propose that M BNL proteins promote the sw i tch to adult isoform s during development and MBNL protein sequestration of C(C)UG RNAs leads to fetal isoform retention and DM symptoms While loss of M BNL 1 primarily cau ses the DM skeletal muscle phenotype, loss of Mbnl2 is the primary event leading to the DM CNS phenotype.

PAGE 49

49 Table 3 1. Primers used for Mbnl2 knockout mice studies Gene exon bp forward primer reverse primer Tanc2 23a 30 gccatgattgagcatgttgactacagt (in e xon 22: 133 bp) cctcttccatcagcttgctcaaca (in exon 23b: 92 bp) Kcnma1 25a 81 gattcacacctcctggaatggacagat (in exon 24: 114 bp) gtgaggtacagctctgtgtcagg gtcat (in exon 25b: 131 bp) Limch1 9 36 cggaagttgccagatgtgaagaaa (in exon 8: 253 bp) cctcctcacaccgcatg tcaaa (in exon 10: 127 bp) Clasp2 16a,16 b 27_27 gttgctgtgggaaatgccaagac (in exon 15: 102 bp) gctccttgggatcttgcttctcttc (in exon 16c: 171 bp) Spna2 23 60 gattggtggaaagtggaagtgaatgac (in exon 22: 149 bp) tgatccactgctgtaactcgtttg ct (in exon 24: 199 bp) S t3gal3 3 48 gcctcttcctggtcctgggattt (in exon 2: 145 bp) caggaggaagcccagcctatc atact (in exon 4: 43 bp) Ndrg4 14 39 cttcctgcaaggcatgggctaca (in exon 13: 52 bp) gggcttcagcaggacacctcca t (in exon 15: 1942 bp) Csnk1d 9 63 gatacctctcgcatgtccacctcaca (in exon 8: 140 bp) gcattgtctgcccttcacagcaa a (in exon 10: 2166 bp) Ppp1r1 2a 14 171 caagcaccacatcaacaccaacagtt (in exon 13: 168 bp) cttcgtccctaacaggagtgag gtatga (in exon 15: 91 bp) Cacna1 d 12a 60 catgcccaccagcgagactgaa (in exon 11: 88 bp) caccaggacaatcaccagcca g taaa (in exon 13: 161 bp) Add1 15 37 ggatgagacaagagagcagaaaga gaaga (in exon 14: 99 bp) ctgggaaggcaagtgcttctga a (in exon 16: 1836 bp) Mbnl1 7 54 ggctgcccaataccaggtcaac (in exon 6: 258 bp) gggagaaatgctgtatgctgctg taa (in exon 8: 154 bp) Grin1 4 63 tcatcc tgctggtcagcgatgac (in exon 3:177 bp) agagccgtcacattcttggttcct g (in exon 5: 101 bp) Camk2 d 14b 16 33_60_ 42 cagccaagagtttattgaagaaaccag a (in exon 14a: 38 bp ) ctttcacgtcttcatcctcaatggt g (in exon 17: 49 bp) Mapt 3,4 87_87 aagaccatgctggagattacactctgc (in e xon 2: 113 bp) ggtgtctccgatgcctgcttctt (in exon 5: 66 bp) Ryr2 4,5 21_15 cggacctgtctatctgcacctttgt (in exon 3: 105 bp) cataccactgtaggaatggcgt agca (in exon 6: 75 bp) Dlg2 17b 42 ccattctacaagaacaaggagcagag tga (in exon 17a: 100 bp) gcctcgtgacaggttcatagga aaga (in exon 18: 51 bp)

PAGE 50

50 B Figure 3 1 No splicing changes in Mbnl2 knockout skeletal and cardiac muscles. A) Splicing pattern s of DM1 skeletal muscle targets Clcn1 and Serca1 and heart targets Tnnt2 and Sorbs1 are shown. In contrast to Mbnl1 kno ckouts, Mbnl2 KOs showed the same splicing pattern as WT control s B) Bar graph showing that o nly Mbnl1 KOs showed significant splicing changes compared with WT

PAGE 51

51 A B Figure 3 2 Mb nl2 knockout mice showed significant splicing misregulation in the b rain A) RT PCR analysis of Mbnl2 knockout hippocampal and cerebellar tissues. Screened targets included DM1 CNS targets (Grin1, Mapt, App, Camk2d), Mbnl1 targets (Sorbs1, Dclk1, Camk2d Spag9 ) and the alternative ly spliced cassette of Ryr family members ( Ryr1, Ryr2 Ryr3 ). B) S tatistical analysis of hippocampal samples confirmed that splicing changes were s ig nificant between Mbnl2 KOs and WT sibs for five targets

PAGE 52

52 Figure 3 3. RT PCR validation of novel targets discovered by splicing sensitive mi croarrays. A) Using hippocampal RNA from WT, Mbnl1 KO and Mbnl2 KO mice, 12 mis splicing events were confirmed. B) Bar graph showing that all Mbnl2 KO samples showed significant differences compared with WT (n 3 in each group, p test).

PAGE 53

53 Figure 3 3. Continued

PAGE 54

54 Figure 3 4 Gel images of splicing pattern s between hippocampal and cerebellar tissues. In most of the targets tested, a similar default splicing pattern was observed betwee n hippocampi and cerebella. The only exception was Kcnma1 in which the default splicing pattern is quite different between these two brain regions. In most case s hippocampal samples showed large r splicing shifts compared to cerebell um which may indicate that loss of Mbnl2 has a larger impact on hippocampal splicing regulation.

PAGE 55

55 Figure 3 5. Enhanced seizure phenotype in Mbnl2 knockouts A) PTZ tests were performed on Mbnl2 knockouts and DMSXL mice and the latency between PTZ injection and seizure act ivity were recorded. Decreased latencies were observed in Mbnl2 heterozygous KOs and Mbnl2 null KO mice and a difference between DMSXL mutants and WT controls was also seen (left). Bar graph of Modified Racine Score showed a significant increase in seizur e severity in Mbnl2 heterozygous, homozygous KOs and DMSXL mutants. B) The top Mbnl2 targets previously linked to human seizure syndromes were also assayed. C) Bar graph showing that only Cacna1d and Ryr2 showed a significant difference between WT and Mbnl 2 heterozygous KOs.

PAGE 56

56 Figure 3 5. Continued.

PAGE 57

57 Figure 3 6 Mbnl2 knockout mice recapitulate abnormal sleep pattern of DM1 patients. A) T otal wakefulness and NREM sleep remained similar to WT while REM sleep increased significantly in Mbnl2 KOs particu larly during the dark (awake) period B) REM sleep total episodes increased in Mbnl2 KOs. C) REM latency is shorter in Mbnl2 KOs. D) REM sleep percentage increase s were enhanced by sleep deprivation.

PAGE 58

58 CHAPTER 4 COMPOUND Mbnl KNOCKOUT MICE AS A DM DISEASE MODEL DM is a Disease Characterized by Compound Loss of Mbnl Gene Expression The Mbnl1 knockout project provided strong support for the hypothesis that DM is an RNA mediated disease caused by loss of MBNL activity. Importantly, loss of Mbnl1 recapitulated DM asso c iated skeletal muscle pathogenesis while the Mbnl2 knockout project indicated that Mbnl2 is not redundant with Mbnl1 but, instead, Mbnl2 is a key player in DM brain pathogenesis. However, DM is a multi systemic disease and loss of Mbnl1 or Mbnl2 al one failed to fully explain the array of symptoms seen in DM1 patients. For example, adult DM1 patients suffer from skeletal muscle weakness and atrophy and have cardiac conduction block and arrhythmia resulting in sudden death In addition, congenital DM (CDM) is characterized by a severe phenotype including muscle hypotonia ( floppy infant ) club feet and cognitive dysfunction while j uvenile onset DM manifests with devastating symptoms and shortened lifespan. During our studies on Mbnl1 and Mbnl2 single KO s muscle weakness and atrophy was not a routine finding in either model. Although a low penetrant cardiac defect was observed for Mbnl1 KO mice, the effects on heart function were both mild and inconsistent (data not shown ). To test the hypothesis that co mpound depletion of Mbnl activity explains the missing DM1 phenotypes in single KO models we generated Mbnl1 ; Mbnl2 double KOs (DKOs) Results Mbnl1 and Mbnl2 Double Knockouts Are Embryonic Lethal To obtain Mbnl1 ; Mbnl2 DKO mice, we set up mating using mixed BL6; 129 background Mbnl1 ; Mbnl2 mice The reason to choose a heterozygous instead of homozygous mating protocol was due to the fact that

PAGE 59

59 Mbnl1 KO mice are poor breeders. Afte r generating > 200 pups, we did not obtain any DKO m ice The results of this mating scheme indicated that Mbnl1 ; Mbnl2 DKO mice were embryonic lethal. Although w e have not performed a comprehensive study of embryos at different time gestation al stages Mbnl1 ; Mbnl2 MEFs were obtained from overtly normal E13.5 embryo s so lethality occurs sometime between this stage and birth Therefore, it is possible that Mbnl1 ; Mbnl2 DKOs are a good model for CDM and this possibility is being pursued As a b yproduct of this mating scheme, we generated Mbnl1 ; Mbnl2 (1KO ; 2 HET ) and Mbnl1 ; Mbnl2 (2KO ; 1 HET ) mice although the number of progeny obtained was lower than expected for Mendelian ratios (Figure 4 1) The number of viable 2KO ; 1HET mice was extremely low so adequate number s wer e not available for further study. Characterization of 1KO ; 2 HET Mice Show ed Enhanced Skeletal Muscle Phenotypes Although we failed to obtain viable Mbnl1 ; Mbnl2 DKO mice from heterozygous mating s the 1KO2 HET mice were ~ 30% smaller in body weight compar ed with Mbnl1 KO mice from weaning to 3 months of age (Figure 4 2 A). These 1KO2HET mice had shorter lifespan s compared with Mbnl 1 KO mice and all died by ~ 22 weeks of age (Figure 4 2B) Rotarod analysis showed decreased latencies to fall for 1KO2 HET mice c ompared with WT and Mbnl1 KO controls at 8 weeks of age indicating impaired motor activity ( Figure 4 3A ) To evaluate if this rotarod deficit reflected elevated muscle weakness, grip strength was also assessed at different time points. S ignificantly reduc ed muscle power was observed for 1KO2 HET mice (1 3 months of age) compare d with control mice ( WT and Mbnl 1 KO). After 10 weeks of age grip strength dropped to

PAGE 60

60 ~50% of control mice (Figure 4 3B ). Since Mbnl2 knockout mice did not show muscle abnormalities 1KO2 HET m ouse model was the first Mbnl knockout that developed skeletal muscle weakness. Another interesting phenotype of 1KO2 HET mice was the elevated degree of myotonia To quantify the severity of myotonia, electromyography (EMG) was performed on Mbnl1 KO and 1KO2 HET mice on both gastrocnemius (GA) and tibialis anterior (TA) muscles While Mbnl1 KO mice are characterized by robust myotonia the 1KO2 HET showed a significant enhancement in myotonia duration and amplitude (Figure 4 4A) Almost every insert ion of the EMG needle electrode elicit ed myotonia in 1KO2 HET muscle and most myotonic runs (repetitive series of action potentials) lasted longer > 30 sec. T he durations of myotonic discharges in 1KO2 HET muscles were about 2.5 to ~4 fold compared to Mbnl1 K Os while amplitudes increased ~ 3 fold (Figure 4 4B ). Importantly, this increased myotonia was the result of an almost complete splicing shift towards fetal pattern for Clcn1 ( Figure 4 4C ) (Table 4 1) and a loss of Clcn1 protein from the muscle sarcolemma ( Figure 4 4D ) Although Mbnl1 KO mice develop DM like skeletal muscle pathologic features, the 1KO2 HET mice exhibited an increase in pathological muscle features including numerous centralized nuclei and split fibers as well as evidence of muscle fiber deg eneration (Figure 4 5A ). To determine if 1KO2HET mice reproduced of the splicing changes previously observed in DM1 skeletal muscle, RT PCR assays were perfo r med on a number of Mbnl1 splicing targets including Ryr1 (exon 70) Serca1 (exon 22) Cacna1s ( exon 29) which have been previously implicated in calcium homeostasis and excitation contraction (EC) coupling ( Tang et al., 2012 ) Alternative splicing of Bin1 exon

PAGE 61

61 11 which has been suggested to cause DM1 muscle weakness ( Fugier et al., 2011 ) Tnnt3 F exon and Nfix exon 8 which have shown splicing changes in the Mbnl1 KO model were also tested ( Du et al., 2010 ) For most of these genes, 1KO2 HET mice showed statistically significant enhan ced splicing changes while several, Serca1 and Tnnt3 were equivalent to Mbnl1 KO muscle (Figure 4 5 B). Collec tively, these results indicate d that 1KO2 HET mice have higher percentage of fetal isoform retention in adult skeletal muscle and these changes may account for the elevated levels of myotonia and muscle weakness in this compound mutant line Neuromuscular J unction Deficits in 1KO2HET mice Since marked deterioration of motor activity was noted in 1KO2HET mice, the effect of compound loss of Mbnl1 and Mbnl2 on the neuromuscular junction (NMJ) was examined S evere alterations in NMJ morphology were present in 1 KO2 HET TA muscle with fragmented and blunt ed innervating nerve branch ing as well as aberrant endplate structures which were quite distinct from normal neurofilament staining and pretzel shaped endplate structures seen in WT mice (Figure 4 6A) Multiple (n => 100 ) NMJs on each muscle were categorized into four morphological groups The 1KO2HET mice showed a significant decrease of mature NMJ s and a n increase in fragmented structures (Figure 4 6B). These morphological changes were accompanied by alternative s plicing changes of cold shock domain protein A (Csda) exon 6, a repressive transcription factor which binds to the myogenin promoter and represses AchR gene expression in both Mbnl 1 KO and 1KO2HET mutant muscles (Figure 4 6C) Compound Mbnl Knockout Mice Exhibit A bnormal Heart Phenotypes Under normal husbandry condition s several 1KO2 HET mice died unexpectedly without showing signs of dyspnea or lethargy the day before death. Therefore, the

PAGE 62

62 possibility that death resulted from cardiac dysfunction was pursu ed Although these mice are vulnerable to anesthesia ele ctrocardiography (ECG) studies revealed the heart rate under anesthesia in WT Mbnl1 KO and 1KO2 HET mice was not significantly different (Figure 4 7 A) However, consistent increases in P R interval an d QRS prolongation were observed in 1KO2 HET mice (Figure 4 7 B) A > 50% PR interval increase was noted between WT and 1KO2HET mice (Figure 4 7 C) accompanied by a ~ 30% increase in QRS interval (Figure 4 7 D) H eart to body weight ratio s by also indicated a 61 % increase in 1KO2 HET compared with WT mice (Figure 4 8 A) A notable feat u re of the 1KO2 HET heart was an enlarged right atrium as s hown by magnetic resonance imag ing (MRI) (Figure 4 8 B to F). The 1KO2HET mice also exhibit ed an end diastolic volume (EDV) d ecrease (Figure 4 8 B) and an increase in whole volume (WV)/EDV ratio (Figure 4 8E). MRI also highlighted enlargement of the right atrium during both systolic and diastolic phases. An i ncrease ventricular wall thickness was also present and especially prom inent in the left ventricle indicat ing myocardia l hypertrophy (Figure 4 8 G ) Although ejection fraction (EF) rate which indicates heart failure, was not significantly different between 1KO2HET and WT hearts myocardi al hypertroph y might be a compensatory mechanism that retains E F within the normal range for anesthetized animals and a telemetry heart assessment is required to determine if this is a possibility D iffuse fibrosis in valvular areas as well as ventricular base and papillary muscles wa s also obs erved in 1KO2HET heart sections (Figure 4 9 A). In some cases, fibrosis could also be seen in the dilated right atrium (data not shown). S plicing assay s on Mbnl1 heart targets showed that Tnnt2 splicing was dramatically shift ed toward the fetal isoform with elevated exon 5 inc l usion in 1KO2 HET

PAGE 63

63 mice The same trend of enhanced splicing shifts to fetal isoforms was seen for Ryr2 exon s 4,5 of a candidate gene for arrhythmia and Cacna1s exon 29 a DM1 heart target ( Tang et al., 2012 ) In addition, top ranked targets from the Mbnl1 KO heart splicing sensitive microarray analysis, such as Sorbs1 exon 25 Tmem63b exon 4 Spag9 exon 31 Mbnl1 exon 7 and A r hge f 7 exon 16 showed a consistent augmentation of fetal splicing changes in 1KO2 HE T heart compared to Mbnl1 KOs strain (Figure 4 9B) although only Arhgef7 did not reach ed statistical significance (Figure 4 9 C) Upregulation of Mbnl2 Expression and Relocalization into Nuclei in the Absence of Mbnl1 Previously, we have provided evidence t hat splicing of Mbnl1 and Mbnl2 pre mRNAs is auto and cross regulated (Charizanis et al, 2012, Zhang et al, 2013). Interestingly, immunoblot analysis of Mbnl2 demonstrated a remarkable up regulation of Mbnl2 protein in Mbnl1 KO mice particularly in skel etal muscle (Figure 4 10 A) but could also be seen in heart and brain This upregulation of Mbnl2 protein level was due to e ither increased Mbnl2 transcription or decreased RNA turnover since q RT PCR showed a 4.6 fold increase of Mbnl2 mRNA (Figure 4 10B) ( Table 4 1) In support of our previous studies of auto and cross regulation in the Mbnl gene family, b oth Mbnl1 exon 7 and the corresponding Mbnl2 exon 6 contain a nuclear localization signal (NLS) and in Mbnl1 KO and 1KO2HET quadriceps more exon 6 conta ining Mbnl2 isoforms were produced (Figure 4 10C) which suggested that Mbnl2 protein relocalization into nuclei was increased following Mbnl1 loss Following subcellular fractionation, immunoblot analysis confirmed that Mbnl2 upregulation coincided with a predomina n t nuclear localization pattern in the absence of Mbnl1 (Figure 4 1 0 D) In addition to Mbnl2 exon 6,

PAGE 64

64 three other alternative spliced cassettes were also affected in the absence of Mbnl1 and th ese cassettes were further shift ed in 1KO2HET mice. T h e most evident change after Mbnl1 ablation was the splicing of Mbnl1 exon 7 (54 nt ) in skeletal muscle while t he most significant change after alteration of Mbnl2 level s was the corresponding Mbnl 2 exon 6 (54 nt ) in the heart (Figure 4 11 A ) Compared to WT and Mbnl1 KO s all four alternatively spliced cassette exons in the two organs (quadriceps and heart) showed significant differences (Figure 4 11B) Mbnl2 is Re Targeted to Mbnl1 Targets in Mbnl1 Knockout Muscle During the analysis of Mbnl2 KO mice, skeletal muscle abnormalities including myotonia, splicing changes or loss of Clcn1 were not detected However, an enhancement of the Clcn1 exon 7a splicing shift was observed in 1KO2HET mice. What RNA targets does Mbnl2 bind and does this interaction l ead to alternative splicing changes for these targets ? Is the splicing of these RNA targets different in the presence or absence of Mbnl1 ? Our hypothesis was, in the absence of Mbnl1, Mbnl2 would prioritize its binding to those targets co regulated by Mbnl 1 due to the critical role of Mbnl1 in skeletal muscle splicing On the other hand, the binding of Mbnl2 on Mbnl2 targets might decrease when Mbnl1 is depleted To address these possibilities Mbnl2 HITS CLIP was performed on WT and Mbnl1 KO muscles The HITS CLIP data show ed an ~ 40% increase of the number of unique Mbnl2 tags likely due to up regulation of Mbnl2 in the absence of Mbnl1. For alternative ly spliced cassette s the CLIP tag peak heights increase dramatically in Mbnl1 KO muscle For example, f or Ldb3 the number of Mbnl2 CLIP tags was 39 in WT and 218 in Mbnl1 KO an increase of 5.6 fold. For Ttn the numbers were 36 in WT and 165 in Mbnl1 KO

PAGE 65

65 an increase of 4.6 fold while for Atp2a1, 53 tags were sequenced in WT but 130 in Mbnl1 KO muscle an increase of 2.5 fold (Figure 4 12) Mbnl1 Knockout Mice Show Complementary Splicing Changes in the B rain Although the number of Mbnl1 ; Mbnl2 (1HET2KO) mice was significantly lower (Table 1) mice that survived until weaning were indistinguishable from their litte rmates. All 1HET2KO mice (n=5) survived > 6 months of age However, RT PCR analysis of Mbnl2 brain RNA targets showed a splicing shift enhancement in 1HET 2KO mice (Figure 4 1 3 ) The se result s indicate that Mbnl2 is primarily responsible for alternative spli cing regulation during postnatal development in the brain and Mbnl1 compensate d for Mbnl2 loss in Mbnl2 KOs Conditional brain specific Mbnl1 ; Mbnl2 DKO mice are requi r ed to confirm these findings. Discussion Compensatory Functions for MBNL2 in Skeletal Mu scle Previous studies have shown that Mbnl2 is expressed at a very low level in skeletal muscle compared with other tissues and no splicing changes for Mbnl1 skeletal muscle targets were reported in Mbnl2 knockout mice ( Charizanis et al., 2012 ; Holt et al., 2009 ) Therefore, loss of Mbnl2 alone did not result in a skeletal muscle phenotype while Mbnl1 wa s expres sed However, further loss of Mbnl2 in muscle cause s enhanced physiological and splicing phenotype s The 1KO2HET mouse model provides the first evidence that Mbnl2 is critical for normal skeletal muscle and heart functions In DM1 patients, muscle weaknes s and atrophy and myotonia are cha ra cteristic manifestations of disease These 1KO2HET mice appear to be a good model for DM1 muscle pathology since there are signs of degeneration and regeneration grip strength

PAGE 66

66 weakness and NMJ deficits NMJ defects have been previously reported in DM1 patients ( Allen et al., 1969 ; Coers et al., 1973 ) M uscle biopsy stud ies on DM1 patients also indicate that ribonuclear foci are detected in subjunctional nuclei and Mbnl1 is sequestered at high levels in these foci ( Wheeler et al., 2007a ) Our studies show that NMJ structure is severely affected in 1KO2HET mice particularly maturation defects and signs of early degenerative changes ( Kummer et al., 2004 ; Sahashi et al., 2012 ; Valdez et al., 2010 ) We also discovered that the splicing of Csda a repressive transcription factor bound to the my ogenin promoter was abnormal in 1KO2HET mice and this mis splicing event might promote this phenotype ( Berghella et al., 2008 ; Ferraro et al., 2012 ) Mbnl2 Functions and the DM Heart In the heart of 1KO2HET mice we characterized a conduction block and structural changes Various type s of arrhythmia have been report ed in DM1, however, first degree AV blo ck is the most common abnormal cardiac finding in DM1. Conduction block and sudden death due to arrhythmia have been widely recognized as important pathological features of this disease and recent studies suggest that preventive cardiac pacemaker implanta tion is important ( Groh et al., 2008 ; Wahbi and Duboc, 2012 ; Wahbi et al., 2012 ) Fibrosis and fatty infiltration s have also been found in the conduction system and cardiac regions in DM1 patients and c hamber dilatation and myocardia hypertrophy in the ventricle are also reported features ( Ashizawa and Sarkar, 2011 ; Motta et al., 1979 ; Nguyen et al., 1988 ) In our s tudy, we successfully characterized first degree AV block and abnormal cardiac morphology in 1KO2HET mice a lthough physiological evaluation revealed that the ejection fraction (EF) rate was not changed However EF rate decreases reflecting left ventricul ar dysfunction is not observed in

PAGE 67

67 DM1 patients < 40 year of age Analysis of the literature reveals that DM1 echocardiogram analysis has shown that lower EF (<50%) is observed. NMJ defects have been reported in DM1 patients ( Allen et al., 1969 ; Coers et al., 1973 ) although a different study suggest ed less severe involvement in DM1 patients. ( Bhakta et al., 2010 ) Another study also concluded that structural defects appeared earlier than EF decreases ( De Ambroggi et al., 1995 ) In summary, our cardiac results on 1KO2HET mice ar e compatible with previous stud ies o n DM1 patients. We know in other RBP families it is not uncommon that more than one family member is involved in similar but not identical function s For example, both Rbfox1 and 2 are CNS specific RBPs and loss of e ach protein resulted in distinctly different phenotypes ( Gehman et al., 2012 ; Gehman et al., 2011 ) When one Rb fox protein is knocked out, the other protein is upregulated putatively to compensate for loss of the paralog We observed a similar phenomenon in the Mbnl family with upregulation of Mbnl2 in the absence of Mbnl1. However, Mbnls are broadly expressed in t issues, and Mbnl1 and Mbnl2 have functions that appear to be special iz ed for different tissues In the brain, Mbnl2 is highly expressed in the nuclei of hippocampal pyramidal neurons and cerebellar Purkinje cells while Mbnl1 is express ed in both the nucle us and cytoplasm ( Charizanis et al., 2012 ) In skeletal muscle, Mbnl1 is highly expressed and localized predominantly in the nucleus while Mbnl2 is primarily cytoplasmic. These difference s in distribution pattern s impl y their primary functions vary in different organ system s However, when one protein is depleted by C(C)UG RNA sequestration the other compensates by overexpression and re localization to the nuc leus These results

PAGE 68

68 do not conflict with prior suggestions that Mbnl proteins also possess functions other than splicing ( Adereth et al., 2005 ; Wang et al., 2012 )

PAGE 69

69 Table 4 1. Primers for RT PCR in 1KO2HET studies Gene Exon Bp Forward primer Reverse primer Clcn1 7a 79 ggaatacctcacactcaaggcc cacggaacacaaaggcactga atgt Ryr1 70 15 gcgtgaagaacagaacttcgtggtc cttg gtgcgttcctgatctgagc Cacna1s 29 57 gagatccttggaatgtgtttgacttcct ggttcagcagcttgaccagtctc at Serca1 22 41 gctcatggtcctcaagatctcac gggtcagtgcctcagctttg Bin1 11a 45 cagaacctcaatgatgtcctggtca ctctggctcatggttcactctgatc t Ryr1 83 18 cttcgagaggcagaacaaggcag aacag gtcctgtgtgaactcgtc atc Tnnt3 9 39 tctgacgaggaaactgaacaag tgtcaatgagggcttggag Nfix 8 123 ggagagtccagtagatgatgtgttct atcct ggatgatggacgtggaaggga a Tnnt2 4,5,6, 11_12_3 0 gccgaggaggtggtggaggagta gtctcagcctcaccctcaggctc a Ryr2 4,5 21_15 c ggacctgtctatctgcacctttg t cataccactgtaggaatggcgt agca Sorbs1 25 168 ccagctgattacttggagtccacaga ag gttcaccttcataccagttctggtc aatc Tmem63 b 4 39 ctggctctggacttcatgtgctttc gagacggaggtgagacgctca tacc Spag9 31 39 ggactggaaatggtgtcattatctcca t gggactgccacaaagaatttca cag Mbnl1 7 54 ggctgc ccaataccaggtcaac gggagaaatgctgtatgctgctg taa Afhgef7 16 225 gcagacgaaggtcacatctgtgagc cacagcgaactcctcgtccgaa g Mbnl2 6 54 tcaccctcctgcacacttgcag ctctttggtaagggatgaagagc acc Mbnl1 9 95 tattgtgcatgacacccgctacaagt tgtgacgacagctctacatctgg gtaa Mbnl2 8 95 cgtct tgcactaccagcaggctc gacatagcagaactagccttag ggttgtg Csnk1d 9 63 gatacctctcgcatgtccacctcaca gcattgtctgcccttcacagcaa a Cacna1d 12a 60 catgcccaccagcgagactgaa caccaggacaatcaccagcca gtaaa Mapt 3,4 87_87_ aagaccatgctggagattacactctg c ggtgtctccgatgcctgcttctt Dgkh 3 0 131 gcacagtctttcgcatagtgccaaa gggagggttccgttcaagctcttt Slain2 7 78 cagtcttccaaacctatcccgaacat ggtggtttgtgtgaactgggtagtt tc

PAGE 70

70 Figure 4 1 Mbnl1 and Mbnl2 double knockout s are embryonic lethal. Expected and actual number s of mice obtained with each genotype are shown The exact numbers and percentages are shown below. These results indicate compound knockouts are p r one to embryonic lethality

PAGE 71

71 Figure 4 2 The Mbnl1 KO; Mbnl2 HET (1KO2HET) mice were smaller and had a shorter lifespan. A) The bo dy weight of 1KO2HET was about ~ 30% less than Mbnl1 KOs B) Kaplan Meier c urve for Mbnl1 KO versus 1KO2HET

PAGE 72

72 Figure 4 3 1KO2HET mice exhibit motor deficits A) The r otarod test was performed on mice 8 weeks of age Mbnl1 KOs showed decreased latency t o fall while 1KO2HET mice showed further decline. B) Grip strength test at different developmental stages.

PAGE 73

73 Figure 4 4 1KO2HET mice showed enhanced myotonia A) Representative figures of myotonic discharges recorded during electromyography. Mbnl1 KO (left) showed a fast tapering of myotonic discharges in 10 sec, however, the 1KO2HET showed prolonged, consistent and robust myotonia. B) Bar graph showing features of myotonic discharges. In two different muscles (gastrocnemius and tibialis anterior) the 1KO2HET mice showed a 2.5 to 4 fold increase in myotonic discharge duration and amplitude compared with Mbnl1 KO s C) Enhanced myotonia in 1KO2HET mice correlated with increased mis splicing change of Clcn1. In 1KO2HET mice, splicing was shifted almost com pletely to the fetal isoform which include s exon 7a. The inclusion Clcn1 exon 7a induce s nonsense mediated decay D) Loss of Clcn1 protein in 1KO2HET muscle compared with WT (r ed, Clcn1 staining; b lue, DAPI staining)

PAGE 74

74 Figure 4 5 1KO2HET mice showed e nhanced skeletal muscle pathology A) H&E staining of cross section s from tibialis anterior muscles. The Mbnl1 KO showed some centralized nuclei and split fibers (middle panel) compared with WT (left panel). The 1KO2HET showed an increase in muscle abnorma lities accompanied with signs of fiber degeneration. B) Splicing assay on known DM1 skeletal muscle targets. A consistent increase (or at least the same in the case of Serca1) in mis splicing towards fetal isoform patterns was seen. G ene transcripts showed significant changes ( except Nfix ) between Mbnl1 KO and 1KO2HET mice.

PAGE 75

75 Figure 4 6 1KO2HET mice showed a consistent defect in NMJ structure A) NMJ staining of WT, Mbnl1 KO and 1KO2HET are shown from top to bottom. While WT and Mbnl1 KO muscles showed pretzel shaped end plates and distinct terminal axonal branches, 1KO2HET exhibits signs of NMJ degeneration (fragmentation of endplates sprouting of synapses and decreased number of mature innervated NMJs ) B) B ar graph of various NMJ morphological defect s. C) Csda splicing misregulation with b ar graph show ing a significant difference between these three groups of mice ( n =3 in each group, p<0.01)

PAGE 76

76 Figure 4 7 C ardiac conduction block in 1KO2HET mice A) Baseline ECG recording s on WT Mbnl1 KO and 1KO2 HET hearts. B) Prolonged PR and QRS interval s in 1KO2HET mice C) Bar graph showing the PR interval difference between three groups. The 1KO2HET showed a significant PR interval prolongation compared with the other groups. D) Significant QRS interval prolo ngation was also seen in 1KO2HET mice ( n =5 in each group)

PAGE 77

77 Figure 4 8 The heart of 1KO2HET mice showed structural and physiological abnormalities. A) Heart e nlargement 1KO2HET mice ( right ) compared with WT (left) and Mbnl1 KO (middle) (left panel) After normaliz ing for body weight, 1KO2HET mice showed significant increase s in heart weight/body weight ratio (right panel) B to F) Bar graphs of MRI results showing that 1KO2HET hearts develop decreased end diastolic volume (EDV) increased WV/EDV and i ncreased RA areas. G) MRI four chamber view show ing increased thickness of LV wall and increased size of RA ( ESV, end systolic volume; WV, whole volume; EDV, end diastolic volume; EF, ejection fraction; RA, right atrium; LA, left atrium; RV, right ventricl e; LV, left ventricle)

PAGE 78

78 Figure 4 9 1KO2HET hearts showed fibrosis and enhanced splicing perturbation. A) Trichrome staining o f WT and 1KO2HET heart section s Fibrosis (blue) was detectable around the aortic valve area, at the left ventricular base a nd in papillary muscle of the left ventricle. B) Splicing assay on Mbnl1 heart targets. A d ramatic change was seen for Tnnt2 exon 5 between Mbnl1 KO and 1KO2HET Enhanced splicing changes were also evident for other targets. C) Bar graph showing transcript s that with significant splicing changes ( except Arhgef7 ) between Mbnl1 KO and 1KO2HET

PAGE 79

79 Figure 4 10 Up regulation and relocalization of Mbnl2 in Mbnl1 knockout mice. A) Immunoblots show ing Mbnl2 protein expression in quadriceps Mbnl2 was highly upreg ulated in Mbnl1 KOs B) Bar graph of q RT PCR showing that Mbnl2 mRNA level s increased 4.6 fold in Mbnl1 KO quadriceps C) Relocation of Mbnl2 and splicing regulation. Elevated Mbnl2 exon 6 splicing occurred in Mbnl1 knockout mice. D) Immunoblot of subcellu lar fractionation s from WT and Mbnl1 KO mice quad r iceps with Mbnl2 (top), n ucleolin (nuclear marker, middle) and LDHA (cytoplasmic marker, bottom) shown.

PAGE 80

80 Figure 4 11. A uto and cross regulation of Mbnl1 and Mbnl2. A) Splicing assay show ed Mbnl1 exon 7 and 9 and Mbnl2 exon 6 and 8 in WT Mbnl1 KO and 1KO2HET heart. Loss of Mbnl1 caused a significant increase in the inclusion of all alternative exon s B) Increased exon inclusions were seen in 1KO and 1KO2HET compared with Wt, although some of them did not reach statistical significance between 1KO and 1KO2HET.

PAGE 81

81 Figure 4 1 2 Mbnl2 HITS CLIP on WT and Mbnl1 KO quadriceps. The t op five targets show ing the largest Mbnl2 CLIP peak heights in Mbnl1 KO mice were selected. A 2.5 7.8 fold increase was observed for these targets.

PAGE 82

82 Figure 4 1 3 RT PCR analysis of splicing in 2KO1 HET mice for Mbnl2 targets. D ue to limited mouse available we only tested one 2KO1HET mouse for these assay s The results showed subtle but consistent enhancem ents of splicing alteration in 2KO1HET mice

PAGE 83

83 CHAPTER 5 MBNL COMPOUND CONDITIONAL KNOCKOUT MICE AS DM DISEASE MODELS Introduction To overcome the embryonic lethality of Mbnl1 ; Mbnl2 constitutive DKO s a conditional knockout strateg y was used The Mbnl1 co nditional KO model has not been created yet but we do have mice carrying Mbnl2 conditional allele. S o a tissue specific knockout for Mbnl2 using Nestin c re mice from JAX lab was applied Nestin c re mediated recombination occurs primarily in neurons in the brain and expression begins at E 10.5 to 11.5 and is complete by E14.5 to 15.5 N estin is also expressed at a much lower level in heart, s omite derived tissues and k i dneys Previous stud ies have shown the recombination occurs in different genetic backgroun d s ( Dubois et al., 2006 ) Results Reduced Body Size, Life Span and M otor D eficits i n Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ mice Crosses between Mbnl1 Mbnl2 cond/cond ; Nestin +/ and Mbnl1 Mbnl2 cond/cond ; Nestin / generated Mbnl1 Mbnl2 cond/cond ; Nestin +/ (Nestin DKO ) mice. The se mice were ~ 4 0% smaller at the age of weaning (Figure 5 1A ) These mice either died or had to be euthanized by 22 weeks of age although many survive d < 15 weeks of age (Figure 5 1B) Motor function s were severely affected (Figure 5 2A) and leg contracture s were noted (Figure 5 2B) All the mice of other genotypes generated from this mating did not show similar phenotypes. To make our data more convincing, we chose mice of seven other genotypes to serve as control. These mice are Mbnl1 + / + Mbnl2 +/+ ; Nestin / ; Mbnl1 + / + Mbnl2 +/+ ; Nestin +/ ; Mbnl1 Mbnl2 +/+ ; Nestin / ; Mbnl1 Mbnl2 +/+ ; Nestin + / ; Mbnl1 + / + Mbnl2 cond/cond ; Nestin / ; Mbnl1 + / + Mbnl2 cond/cond ; Nestin + / ; Mbnl1 Mbnl2 cond/cond ; Nestin / The Nestin DKO mice

PAGE 84

84 and seven other control mice were tested on Rotarod. Rotarod analysis at 5 weeks of age demonstrated that Nestin DKO mice showed a significant decline in motor performance and w hile control mice improved during the consecutive 4 day trial Nestin DKO failed to show a sign ificant improvement (Figure 5 2 C ) At the age of 9 weeks, Nestin DKO showed further decline s However, control mice with the Mbnl1 allel e also started to show a decline (data not shown), compatible with the Rotarod results in a previous constitutive compound knockout study. G rip strength testing was also performed at 6 weeks and 12 weeks of age and Nestin DKO mice showed less strength compared with control mice (Figure 5 2 D) Due to facial muscle weakness malocclusion was also evident so teeth had to be trimmed frequently. Facia l weakness is a common clinical feature in DM1 ( Harper, 2001 ) Aberrant Splicing in the Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ Brain To test if in Nestin DKO mice display enhanced mis splicing validated targets were se l e c ted from the previous microarray studies for Mbnl1 and Mbnl2 single knockout mice (Table 5 1) We selected three different ge notypes as controls for the splicing assay including Mbnl1 +/+ ; Mbnl2 +/+ ; Nestin +/ Mbnl1 ; Mbnl2 cond/cond ; Nestin / and Mbnl1 +/+ ; Mbnl2 cond/cond ; Nestin +/ mice representing WT Mbnl1 KO and Mbnl2 KO phenotypes, respectively. Since mis splicing of G RIN1 (NMDAR1) and MAPT (Tau) have been reported in DM1 patients these two targets were tested initially Mbnl1 +/+ ; Mbnl2 cond/cond ; Nestin +/ mice reproduced the splicing shifts seen in Mbnl2 constitutive KOs but the (percent spliced in) for Nes tin DKO mice was ~ 7 fold greater compared with WT For Mapt splicing, Mbnl2 Nestin DKO showed a reduction of isoforms containing exon 2 (top two bands, +/ exon 3), however, Nestin DKO mice showed a complete loss of adult

PAGE 85

85 isoforms. Indeed, Nestin DKO mice fully recapitulate d the P6 fetal splicing pattern (Figure 5 3) Cacna1d and Csnk1d two of the top ten rank ed targets in the Mbnl2 KO splicing microarray study were also evaluated. The splicing of Cacna1d shifted to the fetal isoform which excludes al ternative exon 12a. In Nestin DKO the Cacna1d adult isoform was totally eliminated For Csnk1d Mbnl2 conditional KOs shifted splicing towards the isoform excluding exon 9 and was further reduced in Nestin DKO s Again the splicing pattern in Nestin DKO s was identical to the P6 fetal pattern (Figure 5 3) We noticed duri n g our Mbnl2 knockout studies that some targets shifted towards the fetal isoform but still this shift was partial and not similar to the default fetal pattern. We selected four genes ( Add1 Clasp2 Ndrg4 and Kcnma1 ) in this category and splicing analysis showed a dramatic switch from the default adult to fetal pattern in Nestin DKO s The most dramatic splicing shift was seen for Kcnma1 which show ed a modest shift in Mbnl2 Nesti n conditional KOs (similar to Mbnl2 null mice). In Nestin DKO mice, this splicing shifted to the fetal isoform which exclud es exon 25a, and change d from 100 to 7, the largest shift of all brain targets tested to date (Figure 5 4). We also tested the top Mbnl1 targets. Sorbs1 and Camk2d were mis regulated in the brain of Mbnl1 KOs as well as DM1 patients. While Mbnl1 KOs showed subtle splicing changes in Sorbs1 Mbnl2 Nestin conditional KOs showed no changes and Nestin DKO s showed a 40% shi ft towards the fetal isoform excluding exon 25. On the other of Camk2d ha s been identified in both mice and human as the fetal isoform and also the predominant isoform in DM1 patients. In agreement with pr i o r

PAGE 86

86 reports Mbnl1 KOs show a small increase in the and Mbnl2 N estin conditional KOs show a 15% increase of the increased dramatically or up to 50% and became the most abundant isoform which recapitulate d the fetal splicing pattern (Figure 5 5) Previously, some lower ranked targets on the Mbnl2 splicing microarray list were not significant so two of these targets, Camkk2 and Slitrk4 were evaluated in the Nestin DKO. In the case of Slitrk4 shifting towards fetal sp licing o c curred with a 15 20% change between WT and Nes tin DKO s but the splicing pattern did not switch complete ly to fetal pattern (Figure 5 5) For the twelve targets tested, Nestin DKO s showed significant difference s compared with Mbnl1 +/+ ; Mbnl2 cond/co nd ; Nestin +/ (Figure 5 6) (Grin 1 p <0.05; all other genes p <0.01 in unpaired t test for two groups ) Reduced NMDA Mediated Excitatory Post Synaptic Potential (EPSP) in Mbnl1 ; Mbnl2 cond/cond ; Nestin +/ mice In the Mbnl2 constitutive KOs loss of Mbnl2 led to learning and memory deficits by the Morris W ater M aze test as well as electrophysiological changes including LTP deficits Therefore, we also tested Nestin DKO s together with three control lines A significant difference in NMDA mediated EPSP between Nestin DKO and the controls was observed ind i cat ing that Nestin DKO s have abnormal hippocampal function in synaptic transmission (Figure 5 7 ). Discussion Potential Involvement of Mbnl1 in Learning and Memory Although our previous studies on Mbnl 1 KO brain revealed subtle splicing and behavioral change s Mbnl1 did not appear to possess essential functions in the CNS However, Nestin DKO mice provided evidence that Mbnl1 may play significant role

PAGE 87

87 when Mbnl2 is depleted. For many of the Mbnl2 target s in which Mbnl2 KO mice did not show a complete switch to the fetal splicing pattern Nestin DKO s did Int eresting ly many of these targets have been linked to learning and memory. For example, Grin1, Mapt ( Sergeant et al., 2001 ) Add1 ( Vukojevic et al., 2012 ) Ndrg4 ( Yamamoto et al., 2011 ) Clasp2 ( Beffert et al., 2012 ) Kcnma1 ( Bell et al., 2008 ) and Camkk2 ( Mairet Coello et al., 2013 ; P eters et al., 2003 ) were all reported to contribute to learning deficits. In a C.elegans study the C adducin (Add1) includes a lysine rich region that is important for binding with spectrin and actin. Spliced isoforms containing that region could rescue the Add1 mutant (tm3760) memory defect s while other isoform s could not ( Vukojevic et al., 2012 ) Our EPSP s t udy showed a significant difference between Nestin DKO and controls, which is consistent with our prediction One of the target s Slitrk4 was interesting because whole genome DNA chip analysis of DM1 embryonic stem cell s showed downregulation of S litrk4 and Slitrk4 mis expression account s for neurite growth and synaptogenesis ( Marteyn et al., 2011 ) Although current understanding of Slitrk4 function is relatively limited, the six Slitrk family members are highly expressed in the CNS and many of them have been linked to neuropsychiatric disorders ( Aruga and Mikoshiba, 2003 ; Proenca et al., 2011 ) W e detecte d a significant splicing change in Nes tin DKO s towards the fetal patter n

PAGE 88

88 Table 5 1 Primers for RT PCR in Mbnl compound conditional knockout mice studies Gene Exon Bp Forward primer Reverse primer Grin1 4 63 tcatcctgctggtcagcgatgac agagccgtcacattcttggttcctg Mapt 3,4 87,87 aagaccatgctggaga ttacactc tgc ggtgtctccgatgcctgcttctt Cacna1d 12a 60 catgcccaccagcgagactgaa caccaggacaatcaccagccag taaa Csnk1d 9 63 gatacctctcgcatgtccacctcac a gcattgtctgcccttcacagcaaa Add1 15 37 ggatgagacaagagagcagaaa gagaaga ctgggaaggcaagtgcttctgaa Clasp2 16a, 16b 27_27 gttgctgtgggaaatgccaagac gctccttgggatcttgcttctcttc Ndrg4 14 39 cttcctgcaaggcatgggctaca gggcttcagcaggacacctccat Kcnma1 25a 81 gattcacacctcctggaatggaca gat gtgaggtacagctctgtgtcaggg tcat Sorbs1 25 168 ccagctgattacttggagtccacag aag gttcaccttcataccagttctggtca atc Camk2d 14b, 15,16 33_60_42 cagccaagagtttattgaagaaac caga ctttcacgtcttcatcctcaatggtg Camkk2 16 43 ggtgaccgaagaggaggtcgag aa agggaccacctttcacaagagc actt Slitrk4 2 72 gctccctctctctgcttggacatga ccactgatatgtcagaatctgcatt tgtagaa Csda 6 207 atggagttcctgtagaaggg agtc gctat aacctcgggcggtaagtcggat Dag1 2b 57 gaacacctgctgctgctcccttt caagccaccagttgctaaggaa gaaa

PAGE 89

89 Figure 5 1. Nestin DKO mice were smaller and showed reduced lifespan A) Nestin DKO mice with a control mouse (left). A verage body weight of Nestin DKO mic e was ~ 40% less than control s at P21 and th is difference dropped to 20 25% by 8 weeks of age B) Kapl an M eier curve of control versus Nestin DKO mice The genotypes of seven other control mice were mentioned in the main section.

PAGE 90

90 Figure 5 2. Nestin DKO mice display an array of motor defects. A) Nestin DKO showed a tendency to fall poor righting reflex (left) and limb weakness during locomotion (right). B) Nestin DKO mice showed limb contracture at ~ 3 months of age (left). C) Nestin DKO showed motor def icits by the r otarod assay D) G rip strength test showing that Nestin DKO s had decreased grip strength compared with controls at two time points.

PAGE 91

91 Figure 5 3 Nestin DKO mice hippocampal samples showed enhanced splicing anomalies on DM1 brain targets. F or Grin1, exon 5 inclusion increase d in Nestin DKO. For Mapt, exon 2 inclusive isoforms were reduced in Nestin DKO s For Cacna1d the exon 12a inclusive isoform was decreased and Csnk1d also showed a reduction of exon 9 inclusion in Nestin DKO mice.

PAGE 92

92 Fi gure 5 4 Nestin DKO mice showed enhanced splicing deficit s in Mbnl2 brain targets In Mbnl2 KOs splicing shift ed towards the fetal pattern although adult isoforms were still predominant. In Nestin DKO,a the splicing pattern became indistinguishable from the fetal pattern (P6 forebrain).

PAGE 93

93 Figure 5 5 Nestin DKO mice hippocampal samples showed enhanced splicing alterations Nestin DKO s showed effects on the splicing of Sorbs1 and Camk2d For Camkk2 and Slitrk4 Nestin DKO showed splicing switch es that w ere close but not identical to P6 fetal forebrain.

PAGE 94

94 Figure 5 6 Bar graph of splicing assay results. Nestin DKO exhibit ed significant splicing difference s compared to the other groups, especially for the six gene transcripts shown ( right ) All the targets show significant differences between Mbnl2 Nestin conditional KOs and Nestin DKO s (Grin1 p <0.05, all others p < 0.01 in unpaired t test for two groups; p <0.01 using One way Anova test for four groups).

PAGE 95

95 Figure 5 7 Deterioration of hippocampa l functions in Nestin DKO mice. Nestin DKO mice showed decreased NMDA mediated EPSP The input output curve was not significant ly different (data not shown n =3 in each group)

PAGE 96

96 CHAPTER 6 CONCLUDING REMARKS AND FUTURE DIRECTIONS S ummary of the Projects T o date, a handful of DM m ouse models have provide d insights into the disease mechanism. However, most of these mice are transgenic models, which randomly integrate transgene s into genomic loci and may be expressed at a high level. High level expression of a transgene may be toxic and therefore some models show overt phenotype s more severe than observed in DM1. Although we have shown distinct phenotypes in Mbnl1 and Mbnl2 single knockout mice, they did not fully recapitulate DM1 symptoms. For example, muscle weakness / wasting and robust cardiac phenotype s are absent in these two models. Here, we demonstrate that Mbnl1 and Mbnl2 DKO mice are not viable. Also, we report two Mbnl1 and Mbnl2 compound KO models In the 1KO2HET model, Mbnl2 level s increase and i n th e Nestin DKO model, Mbnl2 is deleted only in neurons. In both cases, we saw disease relevant phenotypes and enhanced splicing changes Previously, we determined that Mbnl1 is specific for splicing regulation in muscle systems while Mbnl2 functions primaril y in the brain Both of these Mbnl proteins serve as backup splicing regulator s during the postnatal developmental transition in specific tissues (Figure 6 1) While one Mbnl is ablated, the other Mbnl is upregulated and shift s into the nucle us (Figure 6 2 ) Overall, t hese results provide novel support for the Mbnl loss of function hypothesis and further strengthen the RNA gain of function model in DM. Future Experimental Direction s and Therapeutic Implications Mbnl1 and Mbnl2 DKOs recapitulate adult DM1 p henotypes but failed to model CDM disease Mbnl1 ; Mbnl 2 constitutive DKO s can be identified at E13.5 without overt

PAGE 97

97 defects b ut a detailed study is required to determine when these pups fail to survive during late, or early perinatal stages. T he next step is to generate Mbnl1 ; Mbnl2 ; Mbnl3 conditional knockout s Currently, a comprehensive analysis of Nestin DKO mice remains to be done. For electrophysiology, discrepancies between our current data and the Mbnl2 null experiments require further investigati on Although we observed a difference between Nestin DKO and controls, the value of NMDA mediated EPSP is similar to previous results in Mbnl2 null mice ( Chariz anis et al., 2012 ) Also we must complete the LTP study to evaluate synaptic plasticity in these mice. Because Mapt mis splicing was uncovered in the Nestin DKO brain we expect to see pathological findings indicating a tauopathy (e.g., neurofibrillary tangles) in Nestin DKO brain s For the motor deficit, we anticipate pathological changes in motor neurons, either in anterior horn cells or pyramidal neurons in the brain. Cerebellar Purkinje cell s may also show morphological and/or physiological changes s ince Mbnl1 and Mbnl2 were highly expressed in these neurons For the conditional KO projects, Myogenin c re DKO mice have been generated by mating with Myogenin (Myog) cre mice ( Li et al., 2005 ) The preliminary data of this skeletal muscle specific Mbnl1 ; Mbnl2 DKO s showed severe muscle pathology with centralized nuclei in nearly every muscle fiber and prominent muscle fiber degeneration. Severe NMJ defect s and splic ing alteration s were also discovered and these abnormalities were apparently more profound than in 1KO2HET mice ( d ata not shown). This model would recapitulate late stage DM1 muscle pathology and would be a valuable model in elucidating DM molecular pathog enesis and novel therapies and also

PAGE 98

98 could serve as a compl e mentary model for determin ing the functions of Mbnl1 and Mbnl2 in muscles and nerves For example, the 1KO2HET showed NMJ defects but it is not clear if this results from muscle or neuronal dysfunc t i on (or both) Currently Mbnl1 and Mbnl3 conditional whole locus knockouts are being generated Once these models are available, triple Myog conditional knockouts will also be an option. Our current stud ies provide d valuable information for DM treatment i n the future and emphasized the importance of total M BNL protein replacement therapies. Recently antisense oligonucleotide (AON) therapies have shown promise in early trials. Using gapmer s design to introduce DNA sequences in an RNA based AON RNase H was activated and the DMPK mutant transcript could be effectively cleav ed ( Wheeler et al., 2012 ) P hosphorodiamidate morpholino oligomer (PMOs) based (CAG) n repeats which redistribute Mbnl1 and force expansion RNAs into the cytoplasm is another strategy ( Wheeler et al., 2009 ) However, whether these blocked RNA hairpins w ould undergo RAN translation remains to be determined Although the function of DMPK is not fully understood, D mpk knockout mouse models have s uggested that Dmpk may be important for maintaining the integrity of skeletal muscle and the nuclear envelope ( Harmon et al., 2011 ; Kaliman and Llagostera, 2008 ) Therefore, degradation of DMPK transcript s might not be a safe strategy. Since AAV mediated overexpression of Mbnl1 ha s prove n effective in rescu ing the abnormal muscle phenotype in the poly(CUG) mouse model ( Kanadia et al., 2006 ) and overexpression of Mbnl1 is tolerable in a transgenic mouse model ( Chamberlain and Ranum, 2012 ) we anticipate M BNL replacement therapy will be an alternative therapeutic str ategy once the technolog ical hurdles have been overcome

PAGE 99

99 Figure 6 1 A proposed model for Mbnl splicing regulation. Mbnl1 regulates major developmental splicing events in skeletal muscle and heart while Mbnl2 control s alternative splicing of specific targets in the brain. The Mbnl proteins promote adult isoform formation.

PAGE 100

100 Figure 6 2. Upregulation and relocation of Mbnl proteins in the absence of their partner. In normal skeletal muscle, Mbnl1 regulates splicing in the nucle us and Mbnl2 remains in the cytoplasm. In the absence of Mbnl1, Mbnl2 is upregulate d and enter s the nucle us to control splicing. On the contrary, Mbnl2 is normally in the nucle us and regulates splicing in the brain while Mbnl1 is cytoplasm ic When Mbnl2 is ablated, Mbnl1 shuffle s into the nucle us to regulate splicing

PAGE 101

101 CHAPTER 7 MATERIALS AND METHODS Mice M bnl Knockout Models Detailed information on the generation of Mbnl1 and Mbnl2 knockout mice have been published mentioned previously ( Charizanis et al., 2012 ; Kanadia et al., 2003a ) C onstitutive compound double knockouts were generated on a mixed BL6/129 background by crossing Mbnl1 +/ DE3 and Mbnl2 +/DE2 males and females together. Mbnl1 DE3 / DE3 ; Mbnl2 cond/cond ; Nestin +/ m ice were generated by crossing male Mbnl1 +/ DE3 ; Mbnl2 cond/cond ; N e stin +/ with female Mbnl1 +/ DE3 ; Mbnl2 cond/cond ; N e stin / mice All animal procedures were reviewed and approved by IACUC at University of Florida. Splicing Assay and Quantitative PCR M ouse RNA from quadriceps muscle, heart and brain (hippocampi and cerebelli) were extracted by Tri reagent (Sigma, St. Louis) and cDNA was obtained by using 5 g of RNA and reverse transcription with SuperScript III (Invitrogen). For each PCR reaction, 2.5 Ci 32 P] dCTP (PerkinElmer Life Sciences) were used followed by autoradiography and phosphorimaging detected by typhoon phosphoimager (9200 GE healt hcare life science) and quantified with ImageQuant software (GE healthcare life Quantitative RT PCR to determine Mbnl2 RNA levels was performed using Wt and Mbnl1 knockout quadriceps muscle and MyiQ single color real time PCR detection system (Biorad CA ). First strand cDNA was prepared as described above and Mbnl2 transcripts containing exon 2 were amplified using 2X iQ SYBR Green Supermix (Biorad CA ) and 250 nM of primer pairs for Mbnl2 or Gapdh. Real time PCR reaction conditions

PAGE 102

102 were 95.0C for 10 min, 45 cycles of 95.0C for 15 sec, 55.0C for 30 sec and 72.0C for 30 sec followed by 7 min at 72C. Human RNA and RT PCR Analysis Autopsy was performed from tempor al lobe and cerebellum of donated DM1 and disease control brain s. Normal adult and fetal control samples were purchased from different venders. RNA was isolated using ISOGEN procedure (Nippon G ene) and 1 3 ug of RNA was used for cDNA synthesis We used cap illary electrophoresis (Hitachi Electronics) to analyze RNA quality and PCR products and Mann Whitney U test for the statistical analysis. PTZ T ests To test the seizure susceptibility in Mbnl2 knockout (heterozygous and homozygous) and DMSXL mice, we in jected low dose of PTZ (pentylenetetrazol; 40 mg/kg) into control and mutant mice peritoneum and recorded their behavioral activities in the following 60 minutes. The onset of seizure was noted and scores were determined by a modified Racine Scale. Sleep Analysis Eight mice of 6 months old W t and Mbnl2 knockout mice each were implanted with electrodes in the brain and EEG /EMG w ere recorded simultaneously. Wakefulness, NREM and REM sleep were determined based on EEG/EMG criteria which have been described in detail elsewhere. In short, low amplitude and mixed frequency ( > 4 Hz) EEG combined with large EMG fluctuation indicates wakefulness; High amplitude/low frequency (0.5 4 Hz) EEG with EMG fluctuation indicates NREM sleep; Low amplitude/high frequency EEG a ccompanied theta waves (7 9 Hz) and low amplitude

PAGE 103

103 EMG indicate REM sleep. These experiments were performed at the Sleep and Circadian Neurobiology (SCN) lab at Stanford University. Rotarod T est Mice (8 weeks for constitutive knockout mice and controls, n=5; 5 weeks for were tested four times a day for consecutive four days using an accelerating rotarod (AccuScan Instruments) These mice were allowed to acclimate to the behavioral test room for 30 minutes befor e they were placed on the rotarod. In between each test, mice were allowed to rest 10 minutes in the ir cage s A constant acceleration program which started at the speed of 4 rpm, increased to 40 rpm in the first 5 minutes and continue d at 40 rpm for anothe r 5 minutes was used for all mice and l atency to fall from the rotating bar was recorded Grip Strength Test Mice (n=6 for each genotype and time point) were assessed for forelimb grip strength using a grip strength meter (Columbia Instruments). Mice we re tested five times and the numbers were averaged. Electromyography Electromyography (EMG) was performed on Mbnl1 knockout and 1KO2HET mice (2 3 months of age, n=4 each genotype) skeletal muscles ( tibialis anterior and gastrocnemius) under general anesth esia (intraperitoneal injection of ketamine, 100 mg/kg and xylazine, 10 mg/kg). Mice were placed on a t hermostatic heating pad and 30G concentric needle electrodes (CareFusion Teca Elite, n=4 5 insertions/muscle) were used with the TECASynergy EMG system ( VIASYS Healthcare). Myotonic amplitudes were measured 8 sec post insertion

PAGE 104

104 Histology and Immunofluorescent Study Frozen transverse s ections of 10 um thickness were made from tibialis anterior muscle at Leica Cryostat. S ections were incubated in hematoxy lin and eosin (H&E) to determine the extent of DM related muscle pathology. For Clcn1 staining, fixed cross section s were d etected by Clcn1 antibody ( Alpha Diagnostic Tx) For cardiac analysis, h eart sections (5 um) were made and fibrosis was detected by M stain. Surface ECG A d etail ed procedure of ECG acquisition has been described elsewhere ( Gehrmann and Berul, 2000 ; Kasahara et al., 2001 ) Briefly, mice were anesthetized with 1.5% isoflurane and cardiac electrical activities were recorded by six surface leads. These ECG recordings were acquired by a multichannel amplifier and converted to dig ital signals for analysis. (MAClab system; AD Instruments. Milford, Massachusetts) ECG gated Cine Cardiac MRI Detailed materials and methods for cardiac MRI have been described previously ( Slawson et al., 1998 ) In short, m ice were anesthetized with 1.5% isofluorane and a warm air fan (SA Instruments, Stony Brook, NY) was use d to maintain stable body temperature. MRI images were acquired from a 4.7 T esla, bore si ze 33cm horizontal scanner (Agilent, Palo Alto, CA) This system includes a 12 cm inner diameter active shield gradient coil and has a 40G/cm gradient strength and rise time of 135 s A home made quadrature saddle shaped transceiver surface coil of 20x30 mm in size was used M ice were positioned with the heart in the magnet iso center, and for the long and short axis orientation of the heart was scouted using a gradient echo sequence S himming and pulse calibration were performed automatically prior to ea ch

PAGE 105

105 experiment. Cine FLASH was used to acquire temporally resolved dynamic short axis and long axis images of the heart with the following parameters: TReff = RR interval, TE = 1.8 ms flip angle = 30 field of view 2525 mm 2 ; acquisition matrix 128128 pixels; and slice thickness 1 mm. The number of frames per cardiac cycle was adapted to the heart rate of each mouse to cover the whole cardiac cycle. Western Blot for Protein Analysis Dissected t issue from quadriceps, heart and brain were homogenized wi th lysis buffer (20 mM HEPES KOH, pH 8.0, 100 mM KCl, 0.1% Igepal CA 630 (Sigma), 0.5 mM phenylmethysulfonyl fluoride, 5 mg/ml pepstain A, 1 mg/ml chymostatin, 1 mM e aminocaproic acid, 1 mM p aminobenzamidine, 1 mg/ml leupeptin, 2 mg/ml aprotinin) on ice, followed by sonication and centrifugation (16,100 g 15 min, 4C) as reported previously ( Charizanis et al., 2012 ) Proteins were detected by immunoblotting (50 g lysate/lane) using rabbit polyclonal anti Mbnl1 antibody A2764 (gift of C. Thornton, University of Rochester), mouse monoclonal (mAb) anti Mbnl2 3B4 (Santa Cruz Biotechnology CA ), mouse anti Gapdh mAb 6C5 (Abcam MA ), rabbit polyclonal anti nucleol in (Abcam MA ), rabbit polyclonal anti Ldha (Cell Signaling Technology MA ) and HRP conjugated anti mouse or anti rabbit secondary antibody followed by ECL (GE Healthcare). Subcellular fractionations were performed using NE PER Nuclear and Cytoplasmic Extr action Reagents (Thermo Scientific). NMJ Staining Tibialis anterior (TA) muscles were dissected from Wt, Mbnl1 knockout and 1KO2HET mice and fixed overnight in 1% formaldehyde. After PBS wash, TA was teased into 5 10 smaller muscle bundles. Accetylcholine receptors were stained with 1g/ml BTX) conjugated with Alexa Fluor 594 (Invitrogen) Axons and

PAGE 106

106 synaptic detection were performed by incubating with c hicken polyclonal a nti neurofilaments (NFH 1) antibody ( Encor Biotechnology, Gainesville, FL) followed by Alexa 488 goat an ti chicken IgG (Invitrogen) HITS CLIP Quadriceps muscle was dissected from Wt, Mbnl1 and Mbnl2 knockout mice (15 16 weeks of age n=3 ), snap frozen in liquid nitrogen, powdered in liquid N 2 and crosslinked with UV light using a UV Stratalinker 1800 (Str atagene). Immunoprecipitation was performed using anti Mbnl2 mAb 3B4 (7.5 g/2 mg lysate) (Santa Cruz Biotechnology, CA) and RNA tags were generated using RNase A concentrations of 38.6 U/ml and 0.0386 U/ml for high and low RNase, respectively. cDNA librari es were generated and sequenced and raw reads were filtered and aligned to the reference genome sequence using Burrow Wheeler Aligner (BWA). Unique CLIP tags were identified after removing PCR duplicates computationally Electrophysiology Details for el ectrophysiology have been noted elsewhere ( Charizanis et al., 2012 ) In short, h i ppocampal slices were made using fresh brain tissue and incubated in standard artificial cerebrospinal fluid (ACSF) within a holding chamber under room temperature. The recording chamber was ( Harvard Apparatus ) perfused with oxygenated AC SF under proper flow rate PH level, humidity and temperature. Slices were transferred to the r ecording chamber 30 60 minutes before recording Extracellular synaptic field potential were recorded with glass micropipettes A single diphasic stimulus pulse was generated from a stimulator (Grass Instrument Co.) to the Shaffer collateral commissural p athway and signals were filtered and recorded followed by comput ational analysis. For N methyl D aspartate receptor (NMDAR) mediated EPSP

PAGE 107

107 slices were incubated in ACSF containing low magnesium, picrotoxin (PTX) and 6,7 dinitroquinoxaline 2,3 dione (DNQX).

PAGE 108

108 LIST OF REFERENCES Adereth, Y., Dammai, V., Kose, N., Li, R., and Hsu, T. (2005). RNA dependent integrin alpha3 protein localization regulated by the Muscleblind like protein MLP1. Nature cell biology 7 1240 1247 Allen, D.E., Johns on, A.G., and Woolf, A.L. (1969). The intramuscular nerve endings in dystrophia myotonica -a biopsy study by vital staining and electron microscopy. Journal of anatomy 105 1 26. Aruga, J., and Mikoshiba, K. (2003). Identification and characterization of Slitrk, a novel neuronal transmembrane protein family controlling neurite outgrowth. Mol Cell Neurosci 24 117 129. Ashizawa, T. (1998). Myotonic dystrophy as a brain disorder. Archives of neurology 55 291 293. Ashizawa, T., and Sarkar, P.S. (2011). Myo tonic dystrophy types 1 and 2. Handb Clin Neurol 101 193 237. Barroso, F.A., and Nogues, M.A. (2009). Images in clinical medicine. Percussion myotonia. N Engl J Med 360 e13. Batra, R., Charizanis, K., and Swanson, M.S. (2010). Partners in crime: bidire ctional transcription in unstable microsatellite disease. Human molecular genetics 19 R77 82. Beffert, U., Dillon, G.M., Sullivan, J.M., Stuart, C.E., Gilbert, J.P., Kambouris, J.A., and Ho, A. (2012). Microtubule plus end tracking protein CLASP2 regulat es neuronal polarity and synaptic function. J Neurosci 32 13906 13916. Bell, T.J., Miyashiro, K.Y., Sul, J.Y., McCullough, R., Buckley, P.T., Jochems, J., Meaney, D.F., Haydon, P., Cantor, C., Parsons, T.D. et al. (2008). Cytoplasmic BK(Ca) channel intr on containing mRNAs contribute to the intrinsic excitability of hippocampal neurons. Proc Natl Acad Sci U S A 105 1901 1906. Berghella, L., De Angelis, L., De Buysscher, T., Mortazavi, A., Biressi, S., Forcales, S.V., Sirabella, D., Cossu, G., and Wold, B.J. (2008). A highly conserved molecular switch binds MSY 3 to regulate myogenin repression in postnatal muscle. Genes Dev 22 2125 2138. Bhakta, D., Groh, M.R., Shen, C., Pascuzzi, R.M., and Groh, W.J. (2010). Increased mortality with left ventricular s ystolic dysfunction and heart failure in adults with myotonic dystrophy type 1. American heart journal 160 1137 1141, 1141 e1131. Blencowe, B.J. (2006). Alternative splicing: new insights from global analyses. Cell 126 37 47.

PAGE 109

109 Braunschweig, U., Guerousso v, S., Plocik, A.M., Graveley, B.R., and Blencowe, B.J. (2013). Dynamic integration of splicing within gene regulatory pathways. Cell 152 1252 1269. Brook, J.D., McCurrach, M.E., Harley, H.G., Buckler, A.J., Church, D., Aburatani, H., Hunter, K., Stanton V.P., Thirion, J.P., Hudson, T. et al. (1992). Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell 68 799 808. Buj Bello, A., Furling, D., Tronche re, H., Laporte, J., Lerouge, T., Butler Browne, G.S., and Mandel, J.L. (2002). Muscle specific alternative splicing of myotubularin related 1 gene is impaired in DM1 muscle cells. Human molecular genetics 11 2297 2307. Buljan, M., Chalancon, G., Eusterm ann, S., Wagner, G.P., Fuxreiter, M., Bateman, A., and Babu, M.M. (2012). Tissue specific splicing of disordered segments that embed binding motifs rewires protein interaction networks. Mol Cell 46 871 883. Burgess, H.A., and Reiner, O. (2002). Alternati ve splice variants of doublecortin like kinase are differentially expressed and have different kinase activities. J Biol Chem 277 17696 17705. Buxton, J., Shelbourne, P., Davies, J., Jones, C., Van Tongeren, T., Aslanidis, C., de Jong, P., Jansen, G., An vret, M., Riley, B. et al. (1992). Detection of an unstable fragment of DNA specific to individuals with myotonic dystrophy. Nature 355 547 548. Campbell, C., Sherlock, R., Jacob, P., and Blayney, M. (2004). Congenital myotonic dystrophy: assisted venti lation duration and outcome. Pediatrics 113 811 816. Cartegni, L., Chew, S.L., and Krainer, A.R. (2002). Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nature reviews Genetics 3 285 298 Chamberlain, C.M., and R anum, L.P. (2012). Mouse model of muscleblind like 1 overexpression: skeletal muscle effects and therapeutic promise. Human molecular genetics. Charizanis, K., Lee, K. Y., Batra, R., Goodwin, M., Zhang, C., Yuan, Y., Shiue, L., Cline, M., Scotti, M.M., Xi a, G. et al. (2012). Muscleblind like 2 Mediated Alternative Splicing in the Developing Brain and Dysregulation in Myotonic Dystrophy. Neuron 75 437 450. Charlet, B.N., Savkur, R.S., Singh, G., Philips, A.V., Grice, E.A., and Cooper, T.A. (2002). Loss o f the muscle specific chloride channel in type 1 myotonic dystrophy due to misregulated alternative splicing. Mol Cell 10 45 53.

PAGE 110

110 Coers, C., Telerman Toppet, N., and Gerard, J.M. (1973). Terminal innervation ratio in neuromuscular disease. II. Disorders o f lower motor neuron, peripheral nerve, and muscle. Archives of neurology 29 215 222. Cooper, T.A., Wan, L., and Dreyfuss, G. (2009). RNA and disease. Cell 136 777 793. Darnell, R.B. (2006). Developing global insight into RNA regulation. Cold Spring Ha rbor symposia on quantitative biology 71 321 327. Darnell, R.B., and Posner, J.B. (2003). Paraneoplastic syndromes involving the nervous system. N Engl J Med 349 1543 1554. Daughters, R.S., Tuttle, D.L., Gao, W., Ikeda, Y., Moseley, M.L., Ebner, T.J., Swanson, M.S., and Ranum, L.P. (2009). RNA gain of function in spinocerebellar ataxia type 8. PLoS genetics 5 e1000600. Dauvilliers, Y.A., and Laberge, L. (2012). Myotonic dystrophy type 1, daytime sleepiness and REM sleep dysregulation. Sleep medicine r eviews 16 539 545. de Almeida, S.F., and Carmo Fonseca, M. (2012). Design principles of interconnections between chromatin and pre mRNA splicing. Trends in biochemical sciences 37 248 253. De Ambroggi, L., Raisaro, A., Marchiano, V., Radice, S., and Meo la, G. (1995). Cardiac involvement in patients with myotonic dystrophy: characteristic features of magnetic resonance imaging. European heart journal 16 1007 1010. de Die Smulders, C.E., Howeler, C.J., Thijs, C., Mirandolle, J.F., Anten, H.B., Smeets, H. J., Chandler, K.E., and Geraedts, J.P. (1998). Age and causes of death in adult onset myotonic dystrophy. Brain 121 ( Pt 8) 1557 1563. DeJesus Hernandez, M., Mackenzie, I.R., Boeve, B.F., Boxer, A.L., Baker, M., Rutherford, N.J., Nicholson, A.M., Finch, N.A., Flynn, H., Adamson, J. et al. (2011). Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p linked FTD and ALS. Neuron 72 245 256. Du, H., Cline, M.S., Osborne, R.J., Tuttle, D.L., Clark, T.A., Donohue, J.P., Ha ll, M.P., Shiue, L., Swanson, M.S., Thornton, C.A. et al. (2010). Aberrant alternative splicing and extracellular matrix gene expression in mouse models of myotonic dystrophy. Nature structural & molecular biology 17 187 193. Dubois, N.C., Hofmann, D., Kaloulis, K., Bishop, J.M., and Trumpp, A. (2006). Nestin Cre transgenic mouse line Nes Cre1 mediates highly efficient Cre/loxP mediated recombination in the nervous system, kidney, and somite derived tissues. Genesis 44 355 360.

PAGE 111

111 Etchegaray, J.P., Machid a, K.K., Noton, E., Constance, C.M., Dallmann, R., Di Napoli, M.N., DeBruyne, J.P., Lambert, C.M., Yu, E.A., Reppert, S.M. et al. (2009). Casein kinase 1 delta regulates the pace of the mammalian circadian clock. Mol Cell Biol 29 3853 3866. Fardaei, M., Larkin, K., Brook, J.D., and Hamshere, M.G. (2001). In vivo co localisation of MBNL protein with DMPK expanded repeat transcripts. Nucleic acids research 29 2766 2771. Fardaei, M., Rogers, M.T., Thorpe, H.M., Larkin, K., Hamshere, M.G., Harper, P.S., an d Brook, J.D. (2002). Three proteins, MBNL, MBLL and MBXL, co localize in vivo with nuclear foci of expanded repeat transcripts in DM1 and DM2 cells. Human molecular genetics 11 805 814. Ferraro, E., Molinari, F., and Berghella, L. (2012). Molecular cont rol of neuromuscular junction development. Journal of cachexia, sarcopenia and muscle 3 13 23. Fu, Y.H., Pizzuti, A., Fenwick, R.G., Jr., King, J., Rajnarayan, S., Dunne, P.W., Dubel, J., Nasser, G.A., Ashizawa, T., de Jong, P. et al. (1992). An unstabl e triplet repeat in a gene related to myotonic muscular dystrophy. Science 255 1256 1258. Fugier, C., Klein, A.F., Hammer, C., Vassilopoulos, S., Ivarsson, Y., Toussaint, A., Tosch, V., Vignaud, A., Ferry, A., Messaddeq, N. et al. (2011). Misregulated a lternative splicing of BIN1 is associated with T tubule alterations and muscle weakness in myotonic dystrophy. Nature medicine 17 720 725. Gehman, L.T., Meera, P., Stoilov, P., Shiue, L., O'Brien, J.E., Meisler, M.H., Ares, M., Jr., Otis, T.S., and Black D.L. (2012). The splicing regulator Rbfox2 is required for both cerebellar development and mature motor function. Genes Dev 26 445 460. Gehman, L.T., Stoilov, P., Maguire, J., Damianov, A., Lin, C. H., Shiue, L., Ares, M., Jr., Mody, I., and Black, D.L (2011). The splicing regulator Rbfox1 (A2BP1) controls neuronal excitation in the mammalian brain. Nature genetics 43 706 711. Gehrmann, J., and Berul, C.I. (2000). Cardiac electrophysiology in genetically engineered mice. J Cardiovasc Electrophysiol 1 1 354 368. Gomes Pereira, M., Cooper, T.A., and Gourdon, G. (2011). Myotonic dystrophy mouse models: towards rational therapy development. Trends in molecular medicine 17 506 517. Gomes Pereira, M., Foiry, L., Nicole, A., Huguet, A., Junien, C., Munnic h, A., and Gourdon, G. (2007). CTG trinucleotide repeat "big jumps": large expansions, small mice. PLoS genetics 3 e52.

PAGE 112

112 Groh, W.J., Groh, M.R., Saha, C., Kincaid, J.C., Simmons, Z., Ciafaloni, E., Pourmand, R., Otten, R.F., Bhakta, D., Nair, G.V. et al. (2008). Electrocardiographic abnormalities and sudden death in myotonic dystrophy type 1. N Engl J Med 358 2688 2697. Han, S., Nam, J., Li, Y., Kim, S., Cho, S.H., Cho, Y.S., Choi, S.Y., Choi, J., Han, K., Kim, Y. et al. (2010). Regulation of dendritic spines, spatial memory, and embryonic development by the TANC family of PSD 95 interacting proteins. J Neurosci 30 15102 15112. Hao, M., Akrami, K., Wei, K., De Diego, C., Che, N., Ku, J.H., Tidball, J., Graves, M.C., Shieh, P.B., and Chen, F. (2008). Mu scleblind like 2 (Mbnl2) deficient mice as a model for myotonic dystrophy. Developmental dynamics : an official publication of the American Association of Anatomists 237 403 410. Harmon, E.B., Harmon, M.L., Larsen, T.D., Yang, J., Glasford, J.W., and Pe rryman, M.B. (2011). Myotonic dystrophy protein kinase is critical for nuclear envelope integrity. J Biol Chem 286 40296 40306. Harper, P.S. (2001). Myotonic Dystrophy, 3rd edn (London: WB Saunders). Heatwole, C., Bode, R., Johnson, N., Quinn, C., Marte ns, W., McDermott, M.P., Rothrock, N., Thornton, C., Vickrey, B., Victorson, D. et al. (2012). Patient reported impact of symptoms in myotonic dystrophy type 1 (PRISM 1). Neurology 79 348 357. Hernandez Hernandez, O., Guiraud Dogan, C., Sicot, G., Hugue t, A., Luilier, S., Steidl, E., Saenger, S., Marciniak, E., Obriot, H., Chevarin, C. et al. (2013). Myotonic dystrophy CTG expansion affects synaptic vesicle proteins, neurotransmission and mouse behaviour. Brain 136 957 970. Hino, S., Kondo, S., Sekiya H., Saito, A., Kanemoto, S., Murakami, T., Chihara, K., Aoki, Y., Nakamori, M., Takahashi, M.P. et al. (2007). Molecular mechanisms responsible for aberrant splicing of SERCA1 in myotonic dystrophy type 1. Human molecular genetics 16 2834 2843. Ho, T. H., Bundman, D., Armstrong, D.L., and Cooper, T.A. (2005). Transgenic mice expressing CUG BP1 reproduce splicing mis regulation observed in myotonic dystrophy. Human molecular genetics 14 1539 1547. Ho, T.H., Charlet, B.N., Poulos, M.G., Singh, G., Swans on, M.S., and Cooper, T.A. (2004). Muscleblind proteins regulate alternative splicing. The EMBO journal 23 3103 3112. Holt, I., Jacquemin, V., Fardaei, M., Sewry, C.A., Butler Browne, G.S., Furling, D., Brook, J.D., and Morris, G.E. (2009). Muscleblind l ike proteins: similarities and differences in normal and myotonic dystrophy muscle. The American journal of pathology 174 216 227.

PAGE 113

113 Huguet, A., Medja, F., Nicole, A., Vignaud, A., Guiraud Dogan, C., Ferry, A., Decostre, V., Hogrel, J.Y., Metzger, F., Hoefl ich, A. et al. (2012). Molecular, physiological, and motor performance defects in DMSXL mice carrying >1,000 CTG repeats from the human DM1 locus. PLoS genetics 8 e1003043. Irimia, M., and Blencowe, B.J. (2012). Alternative splicing: decoding an expansi ve regulatory layer. Current opinion in cell biology 24 323 332. Jansen, G., Groenen, P.J., Bachner, D., Jap, P.H., Coerwinkel, M., Oerlemans, F., van den Broek, W., Gohlsch, B., Pette, D., Plomp, J.J. et al. (1996). Abnormal myotonic dystrophy protein kinase levels produce only mild myopathy in mice. Nature genetics 13 316 324. Jiang, H., Mankodi, A., Swanson, M.S., Moxley, R.T., and Thornton, C.A. (2004). Myotonic dystrophy type 1 is associated with nuclear foci of mutant RNA, sequestration of muscle blind proteins and deregulated alternative splicing in neurons. Human molecular genetics 13 3079 3088. Jin, P., Duan, R., Qurashi, A., Qin, Y., Tian, D., Rosser, T.C., Liu, H., Feng, Y., and Warren, S.T. (2007). Pur alpha binds to rCGG repeats and modula tes repeat mediated neurodegeneration in a Drosophila model of fragile X tremor/ataxia syndrome. Neuron 55 556 564. Kaliman, P., and Llagostera, E. (2008). Myotonic dystrophy protein kinase (DMPK) and its role in the pathogenesis of myotonic dystrophy 1. Cellular signalling 20 1935 1941. Kalsotra, A., and Cooper, T.A. (2011). Functional consequences of developmentally regulated alternative splicing. Nature reviews Genetics 12 715 729. Kanadia, R.N., Johnstone, K.A., Mankodi, A., Lungu, C., Thornton, C .A., Esson, D., Timmers, A.M., Hauswirth, W.W., and Swanson, M.S. (2003a). A muscleblind knockout model for myotonic dystrophy. Science 302 1978 1980. Kanadia, R.N., Shin, J., Yuan, Y., Beattie, S.G., Wheeler, T.M., Thornton, C.A., and Swanson, M.S. (200 6). Reversal of RNA missplicing and myotonia after muscleblind overexpression in a mouse poly(CUG) model for myotonic dystrophy. Proc Natl Acad Sci U S A 103 11748 11753. Kanadia, R.N., Urbinati, C.R., Crusselle, V.J., Luo, D., Lee, Y.J., Harrison, J.K., Oh, S.P., and Swanson, M.S. (2003b). Developmental expression of mouse muscleblind genes Mbnl1, Mbnl2 and Mbnl3. Gene expression patterns : GEP 3 459 462. Kasahara, H., Wakimoto, H., Liu, M., Maguire, C.T., Converso, K.L., Shioi, T., Huang, W.Y., Mannin g, W.J., Paul, D., Lawitts, J. et al. (2001). Progressive atrioventricular conduction defects and heart failure in mice expressing a mutant Csx/Nkx2.5 homeoprotein. J Clin Invest 108 189 201.

PAGE 114

114 Kashiwai, A., Suzuki, T., and Ogawa, S. (2012). Sensitivity to rocuronium induced neuromuscular block and reversibility with sugammadex in a patient with myotonic dystrophy. Case reports in anesthesiology 2012 107952 Kim, H.J., Kim, N.C., Wang, Y.D., Scarborough, E.A., Moore, J., Diaz, Z., MacLea, K.S., Freibaum, B., Li, S., Molliex, A. et al. (2013). Mutations in prion like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS. Nature 495 467 473. Kim, J.S., Coon, S.L., Weller, J.L., Blackshaw, S., Rath, M.F., Moller, M., and Klein, D.C. (200 9). Muscleblind like 2: circadian expression in the mammalian pineal gland is controlled by an adrenergic cAMP mechanism. Journal of neurochemistry 110 756 764. Kim, S., Yun, H.M., Baik, J.H., Chung, K.C., Nah, S.Y., and Rhim, H. (2007). Functional inter action of neuronal Cav1.3 L type calcium channel with ryanodine receptor type 2 in the rat hippocampus. J Biol Chem 282 32877 32889. Kimura, T., Nakamori, M., Lueck, J.D., Pouliquin, P., Aoike, F., Fujimura, H., Dirksen, R.T., Takahashi, M.P., Dulhunty, A.F., and Sakoda, S. (2005). Altered mRNA splicing of the skeletal muscle ryanodine receptor and sarcoplasmic/endoplasmic reticulum Ca2+ ATPase in myotonic dystrophy type 1. Human molecular genetics 14 2189 2200. Kiyan, E., Okumus, G., Cuhadaroglu, C., a nd Deymeer, F. (2010). Sleep apnea in adult myotonic dystrophy patients who have no excessive daytime sleepiness. Sleep Breath 14 19 24. Koshelev, M., Sarma, S., Price, R.E., Wehrens, X.H., and Cooper, T.A. (2010). Heart specific overexpression of CUGBP1 reproduces functional and molecular abnormalities of myotonic dystrophy type 1. Human molecular genetics 19 1066 1075. Krahe, R., Ashizawa, T., Abbruzzese, C., Roeder, E., Carango, P., Giacanelli, M., Funanage, V.L., and Siciliano, M.J. (1995). Effect o f myotonic dystrophy trinucleotide repeat expansion on DMPK transcription and processing. Genomics 28 1 14. Kummer, T.T., Misgeld, T., Lichtman, J.W., and Sanes, J.R. (2004). Nerve independent formation of a topologically complex postsynaptic apparatus. J Cell Biol 164 1077 1087. Kuyumcu Martinez, N.M., Wang, G.S., and Cooper, T.A. (2007). Increased steady state levels of CUGBP1 in myotonic dystrophy 1 are due to PKC mediated hyperphosphorylation. Mol Cell 28 68 78. La Spada, A.R., and Taylor, J.P. (2 010). Repeat expansion disease: progress and puzzles in disease pathogenesis. Nature reviews Genetics 11 247 258.

PAGE 115

115 Laberge, L., Gagnon, C., and Dauvilliers, Y. (2013). Daytime sleepiness and myotonic dystrophy. Current neurology and neuroscience reports 1 3 340. Laurent, F.X., Sureau, A., Klein, A.F., Trouslard, F., Gasnier, E., Furling, D., and Marie, J. (2012). New function for the RNA helicase p68/DDX5 as a modifier of MBNL1 activity on expanded CUG repeats. Nucleic acids research 40 3159 3171. Lebre A.S., Jamot, L., Takahashi, J., Spassky, N., Leprince, C., Ravise, N., Zander, C., Fujigasaki, H., Kussel Andermann, P., Duyckaerts, C. et al. (2001). Ataxin 7 interacts with a Cbl associated protein that it recruits into neuronal intranuclear inclusion s. Human molecular genetics 10 1201 1213. Lee, J.E., and Cooper, T.A. (2009). Pathogenic mechanisms of myotonic dystrophy. Biochem Soc Trans 37 1281 1286. Lehnart, S.E., Mongillo, M., Bellinger, A., Lindegger, N., Chen, B.X., Hsueh, W., Reiken, S., Wro nska, A., Drew, L.J., Ward, C.W. et al. (2008). Leaky Ca2+ release channel/ryanodine receptor 2 causes seizures and sudden cardiac death in mice. J Clin Invest 118 2230 2245. Lesniewski, L.A., Hosch, S.E., Neels, J.G., de Luca, C., Pashmforoush, M., Lum eng, C.N., Chiang, S.H., Scadeng, M., Saltiel, A.R., and Olefsky, J.M. (2007). Bone marrow specific Cap gene deletion protects against high fat diet induced insulin resistance. Nature medicine 13 455 462. Li, S., Czubryt, M.P., McAnally, J., Bassel Duby, R., Richardson, J.A., Wiebel, F.F., Nordheim, A., and Olson, E.N. (2005). Requirement for serum response factor for skeletal muscle growth and maturation revealed by tissue specific gene deletion in mice. Proc Natl Acad Sci U S A 102 1082 1087. Lia, A.S ., Seznec, H., Hofmann Radvanyi, H., Radvanyi, F., Duros, C., Saquet, C., Blanche, M., Junien, C., and Gourdon, G. (1998). Somatic instability of the CTG repeat in mice transgenic for the myotonic dystrophy region is age dependent but not correlated to the relative intertissue transcription levels and proliferative capacities. Human molecular genetics 7 1285 1291. Licatalosi, D.D., and Darnell, R.B. (2006). Splicing regulation in neurologic disease. Neuron 52 93 101. Lin, P.T., Gleeson, J.G., Corbo, J.C ., Flanagan, L., and Walsh, C.A. (2000). DCAMKL1 encodes a protein kinase with homology to doublecortin that regulates microtubule polymerization. J Neurosci 20 9152 9161.

PAGE 116

116 Lin, W.H., Huang, C.J., Liu, M.W., Chang, H.M., Chen, Y.J., Tai, T.Y., and Chuang, L.M. (2001). Cloning, mapping, and characterization of the human sorbin and SH3 domain containing 1 (SORBS1) gene: a protein associated with c Abl during insulin signaling in the hepatoma cell line Hep3B. Genomics 74 12 20. Lin, X., Miller, J.W., Mankod i, A., Kanadia, R.N., Yuan, Y., Moxley, R.T., Swanson, M.S., and Thornton, C.A. (2006). Failure of MBNL1 dependent post natal splicing transitions in myotonic dystrophy. Human molecular genetics 15 2087 2097. Liquori, C.L., Ricker, K., Moseley, M.L., Jac obsen, J.F., Kress, W., Naylor, S.L., Day, J.W., and Ranum, L.P. (2001). Myotonic dystrophy type 2 caused by a CCTG expansion in intron 1 of ZNF9. Science 293 864 867. Lopez Castel, A., Nakamori, M., Tome, S., Chitayat, D., Gourdon, G., Thornton, C.A., a nd Pearson, C.E. (2011). Expanded CTG repeat demarcates a boundary for abnormal CpG methylation in myotonic dystrophy patient tissues. Hum Mol Genet 20 1 15. Luco, R.F., Allo, M., Schor, I.E., Kornblihtt, A.R., and Misteli, T. (2011). Epigenetics in alte rnative pre mRNA splicing. Cell 144 16 26. Luco, R.F., and Misteli, T. (2011). More than a splicing code: integrating the role of RNA, chromatin and non coding RNA in alternative splicing regulation. Current opinion in genetics & development 21 366 372. Luco, R.F., Pan, Q., Tominaga, K., Blencowe, B.J., Pereira Smith, O.M., and Misteli, T. (2010). Regulation of alternative splicing by histone modifications. Science 327 996 1000. Lukong, K.E., Chang, K.W., Khandjian, E.W., and Richard, S. (2008). RNA b inding proteins in human genetic disease. Trends in genetics : TIG 24 416 425. Machuca Tzili, L.E., Buxton, S., Thorpe, A., Timson, C.M., Wigmore, P., Luther, P.K., and Brook, J.D. (2011). Zebrafish deficient for Muscleblind like 2 exhibit features of my otonic dystrophy. Disease models & mechanisms 4 381 392. Mahadevan, M., Tsilfidis, C., Sabourin, L., Shutler, G., Amemiya, C., Jansen, G., Neville, C., Narang, M., Barcelo, J., O'Hoy, K. et al. (1992). Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science 255 1253 1255. Mairet Coello, G., Courchet, J., Pieraut, S., Courchet, V., Maximov, A., and Polleux, F. (2013). The CAMKK2 AMPK Kinase Pathway Mediates the Synaptotoxic Effects of Abeta Oligomers throug h Tau Phosphorylation. Neuron 78 94 108.

PAGE 117

117 Mankodi, A., Logigian, E., Callahan, L., McClain, C., White, R., Henderson, D., Krym, M., and Thornton, C.A. (2000). Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat. Science 289 1769 1773. Mankodi, A., Takahashi, M.P., Jiang, H., Beck, C.L., Bowers, W.J., Moxley, R.T., Cannon, S.C., and Thornton, C.A. (2002). Expanded CUG repeats trigger aberrant splicing of ClC 1 chloride channel pre mRNA and hyperexcitability of skeletal muscle in myotoni c dystrophy. Mol Cell 10 35 44. Mankodi, A., Teng Umnuay, P., Krym, M., Henderson, D., Swanson, M., and Thornton, C.A. (2003). Ribonuclear inclusions in skeletal muscle in myotonic dystrophy types 1 and 2. Annals of neurology 54 760 768. Marteyn, A., M aury, Y., Gauthier, M.M., Lecuyer, C., Vernet, R., Denis, J.A., Pietu, G., Peschanski, M., and Martinat, C. (2011). Mutant human embryonic stem cells reveal neurite and synapse formation defects in type 1 myotonic dystrophy. Cell stem cell 8 434 444. Mat hieu, J., Allard, P., Gobeil, G., Girard, M., De Braekeleer, M., and Begin, P. (1997). Anesthetic and surgical complications in 219 cases of myotonic dystrophy. Neurology 49 1646 1650. Matynia, A., Ng, C.H., Dansithong, W., Chiang, A., Silva, A.J., and R eddy, S. (2010). Muscleblind1, but not Dmpk or Six5, contributes to a complex phenotype of muscular and motivational deficits in mouse models of myotonic dystrophy. PLoS One 5 e9857. McKinney, B.C., Sze, W., Lee, B., and Murphy, G.G. (2009). Impaired lon g term potentiation and enhanced neuronal excitability in the amygdala of Ca(V)1.3 knockout mice. Neurobiology of learning and memory 92 519 528. Meola, G., and Sansone, V. (2007). Cerebral involvement in myotonic dystrophies. Muscle Nerve 36 294 306. Meredith, A.L., Wiler, S.W., Miller, B.H., Takahashi, J.S., Fodor, A.A., Ruby, N.F., and Aldrich, R.W. (2006). BK calcium activated potassium channels regulate circadian behavioral rhythms and pacemaker output. Nature neuroscience 9 1041 1049. Miller, J. W., Urbinati, C.R., Teng Umnuay, P., Stenberg, M.G., Byrne, B.J., Thornton, C.A., and Swanson, M.S. (2000). Recruitment of human muscleblind proteins to (CUG)(n) expansions associated with myotonic dystrophy. The EMBO journal 19 4439 4448. Modoni, A., Si lvestri, G., Vita, M.G., Quaranta, D., Tonali, P.A., and Marra, C. (2008). Cognitive impairment in myotonic dystrophy type 1 (DM1): a longitudinal follow up study. Journal of neurology 255 1737 1742.

PAGE 118

118 Montgomery, J.R., Whitt, J.P., Wright, B.N., Lai, M.H. and Meredith, A.L. (2013). Mis expression of the BK K(+) channel disrupts suprachiasmatic nucleus circuit rhythmicity and alters clock controlled behavior. American journal of physiology Cell physiology 304 C299 311. Mori, K., Lammich, S., Mackenzie, I. R., Forne, I., Zilow, S., Kretzschmar, H., Edbauer, D., Janssens, J., Kleinberger, G., Cruts, M. et al. (2013). hnRNP A3 binds to GGGGCC repeats and is a constituent of p62 positive/TDP43 negative inclusions in the hippocampus of patients with C9orf72 mut ations. Acta neuropathologica 125 413 423. Moseley, M.L., Zu, T., Ikeda, Y., Gao, W., Mosemiller, A.K., Daughters, R.S., Chen, G., Weatherspoon, M.R., Clark, H.B., Ebner, T.J. et al. (2006). Bidirectional expression of CUG and CAG expansion transcripts and intranuclear polyglutamine inclusions in spinocerebellar ataxia type 8. Nature genetics 38 758 769. Motta, J., Guilleminault, C., Billingham, M., Barry, W., and Mason, J. (1979). Cardiac abnormalities in myotonic dystrophy. Electrophysiologic and his topathologic studies. Am J Med 67 467 473. Nagrani, T., Siyamwala, M., Vahid, G., and Bekheit, S. (2011). Ryanodine calcium channel: a novel channelopathy for seizures. The neurologist 17 91 94. Nelson, D.L., Orr, H.T., and Warren, S.T. (2013). The uns table repeats -three evolving faces of neurological disease. Neuron 77 825 843. Nguyen, H.H., Wolfe, J.T., 3rd, Holmes, D.R., Jr., and Edwards, W.D. (1988). Pathology of the cardiac conduction system in myotonic dystrophy: a study of 12 cases. J Am Coll Cardiol 11 662 671. Nishi, M., Itoh, H., Tsubokawa, T., Taniguchi, T., and Yamamoto, K. (2004). Effective doses of vecuronium in a patient with myotonic dystrophy. Anaesthesia 59 1216 1218. Nomura, K., Takeuchi, Y., Yamaguchi, S., Okamura, H., and Fuku naga, K. (2003). Involvement of calcium/calmodulin dependent protein kinase II in the induction of mPer1. Journal of neuroscience research 72 384 392. O'Rourke, J.R., and Swanson, M.S. (2009). Mechanisms of RNA mediated disease. J Biol Chem 284 7419 742 3. Orengo, J.P., Chambon, P., Metzger, D., Mosier, D.R., Snipes, G.J., and Cooper, T.A. (2008). Expanded CTG repeats within the DMPK 3' UTR causes severe skeletal muscle wasting in an inducible mouse model for myotonic dystrophy. Proc Natl Acad Sci U S A 105 2646 2651. Pal, R., Agbas, A., Bao, X., Hui, D., Leary, C., Hunt, J., Naniwadekar, A., Michaelis, M.L., Kumar, K.N., and Michaelis, E.K. (2003). Selective dendrite targeting of mRNAs of

PAGE 119

119 NR1 splice variants without exon 5: identification of a cis acti ng sequence and isolation of sequence binding proteins. Brain research 994 1 18. Pan, Q., Shai, O., Lee, L.J., Frey, B.J., and Blencowe, B.J. (2008). Deep surveying of alternative splicing complexity in the human transcriptome by high throughput sequenci ng. Nature genetics 40 1413 1415. Pascual, M., Vicente, M., Monferrer, L., and Artero, R. (2006). The Muscleblind family of proteins: an emerging class of regulators of developmentally programmed alternative splicing. Differentiation; research in biologi cal diversity 74 65 80. Peters, M., Mizuno, K., Ris, L., Angelo, M., Godaux, E., and Giese, K.P. (2003). Loss of Ca2+/calmodulin kinase kinase beta affects the formation of some, but not all, types of hippocampus dependent long term memory. J Neurosci 23 9752 9760. Petri, H., Vissing, J., Witting, N., Bundgaard, H., and Kober, L. (2012). Cardiac manifestations of myotonic dystrophy type 1. International journal of cardiology 160 82 88. Pfeffer, M., Muller, C.M., Mordel, J., Meissl, H., Ansari, N., Del ler, T., Korf, H.W., and von Gall, C. (2009). The mammalian molecular clockwork controls rhythmic expression of its own input pathway components. J Neurosci 29 6114 6123. Philips, A.V., Timchenko, L.T., and Cooper, T.A. (1998). Disruption of splicing reg ulated by a CUG binding protein in myotonic dystrophy. Science 280 737 741. Polymenidou, M., Lagier Tourenne, C., Hutt, K.R., Bennett, C.F., Cleveland, D.W., and Yeo, G.W. (2012). Misregulated RNA processing in amyotrophic lateral sclerosis. Brain resear ch 1462 3 15. Poulos, M.G., Batra, R., Charizanis, K., and Swanson, M.S. (2011). Developments in RNA splicing and disease. Cold Spring Harbor perspectives in biology 3 a000778. Proenca, C.C., Gao, K.P., Shmelkov, S.V., Rafii, S., and Lee, F.S. (2011). Slitrks as emerging candidate genes involved in neuropsychiatric disorders. Trends in neurosciences 34 143 153. Puymirat, J., Bouchard, J.P., and Mathieu, J. (2012). Efficacy and tolerability of a 20 mg dose of methylphenidate for the treatment of daytim e sleepiness in adult patients with myotonic dystrophy type 1: a 2 center, randomized, double blind, placebo controlled, 3 week crossover trial. Clin Ther 34 1103 1111. Ranum, L.P., and Cooper, T.A. (2006). RNA mediated neuromuscular disorders. Annual re view of neuroscience 29 259 277.

PAGE 120

120 Ranum, L.P., and Day, J.W. (2002). Dominantly inherited, non coding microsatellite expansion disorders. Current opinion in genetics & development 12 266 271. Ranum, L.P., and Day, J.W. (2004). Myotonic dystrophy: RNA pa thogenesis comes into focus. American journal of human genetics 74 793 804. Ranum, L.P., Rasmussen, P.F., Benzow, K.A., Koob, M.D., and Day, J.W. (1998). Genetic mapping of a second myotonic dystrophy locus. Nature genetics 19 196 198. Ravel Chapuis, A ., Belanger, G., Yadava, R.S., Mahadevan, M.S., DesGroseillers, L., Cote, J., and Jasmin, B.J. (2012). The RNA binding protein Staufen1 is increased in DM1 skeletal muscle and promotes alternative pre mRNA splicing. J Cell Biol 196 699 712. Renton, A.E., Majounie, E., Waite, A., Simon Sanchez, J., Rollinson, S., Gibbs, J.R., Schymick, J.C., Laaksovirta, H., van Swieten, J.C., Myllykangas, L. et al. (2011). A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21 linked ALS FTD. Neuron 72 257 268. Ricker, K., Koch, M.C., Lehmann Horn, F., Pongratz, D., Otto, M., Heine, R., and Moxley, R.T., 3rd (1994). Proximal myotonic myopathy: a new dominant disorder with myotonia, muscle weakness, and cataracts. Neurology 44 1448 1452. Roig, M., Balliu, P.R., Navarro, C., Brugera, R., and Losada, M. (1994). Presentation, clinical course, and outcome of the congenital form of myotonic dystrophy. Pediatric neurology 11 208 213. Sahashi, K., Hua, Y., Ling, K.K., Hung, G., Rigo, F., Horev, G., Kats uno, M., Sobue, G., Ko, C.P., Bennett, C.F. et al. (2012). TSUNAMI: an antisense method to phenocopy splicing associated diseases in animals. Genes Dev 26 1874 1884. Sansone, V., Gandossini, S., Cotelli, M., Calabria, M., Zanetti, O., and Meola, G. (200 7). Cognitive impairment in adult myotonic dystrophies: a longitudinal study. Neurological sciences : official journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology 28 9 15. Santos, K., Palmini, A., Radziuk, A .L., Rotert, R., Bastos, F., Booij, L., and Fernandes, B.S. (2013). The impact of methylphenidate on seizure frequency and severity in children with attention deficit hyperactivity disorder and difficult to treat epilepsies. Developmental medicine and chil d neurology. Savkur, R.S., Philips, A.V., and Cooper, T.A. (2001). Aberrant regulation of insulin receptor alternative splicing is associated with insulin resistance in myotonic dystrophy. Nature genetics 29 40 47.

PAGE 121

121 Sergeant, N., Sablonniere, B., Schraen Maschke, S., Ghestem, A., Maurage, C.A., Wattez, A., Vermersch, P., and Delacourte, A. (2001). Dysregulation of human brain microtubule associated tau mRNA maturation in myotonic dystrophy type 1. Human molecular genetics 10 2143 2155. Seznec, H., Agbulu t, O., Sergeant, N., Savouret, C., Ghestem, A., Tabti, N., Willer, J.C., Ourth, L., Duros, C., Brisson, E. et al. (2001). Mice transgenic for the human myotonic dystrophy region with expanded CTG repeats display muscular and brain abnormalities. Human mol ecular genetics 10 2717 2726. Seznec, H., Lia Baldini, A.S., Duros, C., Fouquet, C., Lacroix, C., Hofmann Radvanyi, H., Junien, C., and Gourdon, G. (2000). Transgenic mice carrying large human genomic sequences with expanded CTG repeat mimic closely the DM CTG repeat intergenerational and somatic instability. Human molecular genetics 9 1185 1194. Shin, J., Charizanis, K., and Swanson, M.S. (2009). Pathogenic RNAs in microsatellite expansion disease. Neuroscience letters 466 99 102. Slawson, S.E., Roma n, B.B., Williams, D.S., and Koretsky, A.P. (1998). Cardiac MRI of the normal and hypertrophied mouse heart. Magn Reson Med 39 980 987. Sofola, O.A., Jin, P., Qin, Y., Duan, R., Liu, H., de Haro, M., Nelson, D.L., and Botas, J. (2007). RNA binding protei ns hnRNP A2/B1 and CUGBP1 suppress fragile X CGG premutation repeat induced neurodegeneration in a Drosophila model of FXTAS. Neuron 55 565 571. Suenaga, K., Lee, K.Y., Nakamori, M., Tatsumi, Y., Takahashi, M.P., Fujimura, H., Jinnai, K., Yoshikawa, H., Du, H., Ares, M., Jr. et al. (2012). Muscleblind like 1 knockout mice reveal novel splicing defects in the myotonic dystrophy brain. PLoS One 7 e33218. Swanson, M.S., and Orr, H.T. (2007). Fragile X tremor/ataxia syndrome: blame the messenger! Neuron 55 535 537. Takasawa, S., Kuroki, M., Nata, K., Noguchi, N., Ikeda, T., Yamauchi, A., Ota, H., Itaya Hironaka, A., Sakuramoto Tsuchida, S., Takahashi, I. et al. (2010). A novel ryanodine receptor expressed in pancreatic islets by alternative splicing from type 2 ryanodine receptor gene. Biochem Biophys Res Commun 397 140 145. Takeuchi, Y., Yamamoto, H., Matsumoto, K., Kimura, T., Katsuragi, S., Miyakawa, T., and Miyamoto, E. (1999). Nuclear localization of the delta subunit of Ca2+/calmodulin dependent p rotein kinase II in rat cerebellar granule cells. Journal of neurochemistry 72 815 825.

PAGE 122

122 Tang, Z.Z., Yarotskyy, V., Wei, L., Sobczak, K., Nakamori, M., Eichinger, K., Moxley, R.T., Dirksen, R.T., and Thornton, C.A. (2012). Muscle weakness in myotonic dyst rophy associated with misregulated splicing and altered gating of Ca(V)1.1 calcium channel. Human molecular genetics 21 1312 1324 Timchenko, L.T., Miller, J.W., Timchenko, N.A., DeVore, D.R., Datar, K.V., Lin, L., Roberts, R., Caskey, C.T., and Swanson, M.S. (1996a). Identification of a (CUG)n triplet repeat RNA binding protein and its expression in myotonic dystrophy. Nucleic acids research 24 4407 4414. Timchenko, L.T., Timchenko, N.A., Caskey, C.T., and Roberts, R. (1996b). Novel proteins with bindi ng specificity for DNA CTG repeats and RNA CUG repeats: implications for myotonic dystrophy. Human molecular genetics 5 115 121. Timchenko, N.A., Patel, R., Iakova, P., Cai, Z. J., Quan, L., and Timchenko, L.T. (2004). Overexpression of CUG triplet repea t binding protein, CUGBP1, in mice inhibits myogenesis. J Biol Chem 279 13129 13139. Ule, J., Stefani, G., Mele, A., Ruggiu, M., Wang, X., Taneri, B., Gaasterland, T., Blencowe, B.J., and Darnell, R.B. (2006). An RNA map predicting Nova dependent splicin g regulation. Nature 444 580 586. Valdez, G., Tapia, J.C., Kang, H., Clemenson, G.D., Jr., Gage, F.H., Lichtman, J.W., and Sanes, J.R. (2010). Attenuation of age related changes in mouse neuromuscular synapses by caloric restriction and exercise. Proc Na tl Acad Sci U S A 107 14863 14868. Vukojevic, V., Gschwind, L., Vogler, C., Demougin, P., de Quervain, D.J., Papassotiropoulos, A., and Stetak, A. (2012). A role for alpha adducin (ADD 1) in nematode and human memory. The EMBO journal 31 1453 1466. Wah bi, K., and Duboc, D. (2012). Arrhythmia management in myotonic dystrophy type 1 reply. Jama 308 337 338. Wahbi, K., Meune, C., Porcher, R., Becane, H.M., Lazarus, A., Laforet, P., Stojkovic, T., Behin, A., Radvanyi Hoffmann, H., Eymard, B. et al. (2012 ). Electrophysiological study with prophylactic pacing and survival in adults with myotonic dystrophy and conduction system disease. Jama 307 1292 1301. Wahl, M.C., Will, C.L., and Luhrmann, R. (2009). The spliceosome: design principles of a dynamic RNP machine. Cell 136 701 718. Wang, E.T., Cody, N.A.L., Jog, S., Biancolella, M., Wang, T.T., Treacy, D.J., Luo, S., Schroth, G.P., Housman, D.E., Reddy, S. et al. (2012). Transcriptome wide Regulation of Pre mRNA Splicing and mRNA Localization by Musclebl ind Proteins. Cell 150 710 724.

PAGE 123

123 Wang, E.T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S.F., Schroth, G.P., and Burge, C.B. (2008). Alternative isoform regulation in human tissue transcriptomes. Nature 456 470 476. Wang, G. S., and Cooper, T.A. (2007). Splicing in disease: disruption of the splicing code and the decoding machinery. Nature reviews Genetics 8 749 761. Wang, G.S., Kearney, D.L., De Biasi, M., Taffet, G., and Cooper, T.A. (2007). Elevation of RNA binding protei n CUGBP1 is an early event in an inducible heart specific mouse model of myotonic dystrophy. J Clin Invest 117 2802 2811. Wang, G.S., Kuyumcu Martinez, M.N., Sarma, S., Mathur, N., Wehrens, X.H., and Cooper, T.A. (2009). PKC inhibition ameliorates the ca rdiac phenotype in a mouse model of myotonic dystrophy type 1. J Clin Invest 119 3797 3806. Wang, Z., and Burge, C.B. (2008). Splicing regulation: from a parts list of regulatory elements to an integrated splicing code. RNA 14 802 813. Wang, Z.J., and Huang, X.S. (2011). Images in clinical medicine. Myotonia of the tongue. N Engl J Med 365 e32. Ward, A.J., Rimer, M., Killian, J.M., Dowling, J.J., and Cooper, T.A. (2010). CUGBP1 overexpression in mouse skeletal muscle reproduces features of myotonic dy strophy type 1. Human molecular genetics 19 3614 3622. Weatheritt, R.J., and Gibson, T.J. (2012). Linear motifs: lost in (pre)translation. Trends in biochemical sciences 37 333 341. Wells, R.D., and Ashizawa, T. (2006). Genetic Instabilities and Neurol ogical Diseases, 2nd edn (Burlington: Elsevier Inc.). Wheeler, T.M., Krym, M.C., and Thornton, C.A. (2007a). Ribonuclear foci at the neuromuscular junction in myotonic dystrophy type 1. Neuromuscular disorders : NMD 17 242 247. Wheeler, T.M., Leger, A.J ., Pandey, S.K., MacLeod, A.R., Nakamori, M., Cheng, S.H., Wentworth, B.M., Bennett, C.F., and Thornton, C.A. (2012). Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Nature 488 111 115. Wheeler, T.M., Lueck, J.D., Swanson, M.S., Dirks en, R.T., and Thornton, C.A. (2007b). Correction of ClC 1 splicing eliminates chloride channelopathy and myotonia in mouse models of myotonic dystrophy. J Clin Invest 117 3952 3957. Wheeler, T.M., Sobczak, K., Lueck, J.D., Osborne, R.J., Lin, X., Dirksen R.T., and Thornton, C.A. (2009). Reversal of RNA dominance by displacement of protein sequestered on triplet repeat RNA. Science (New York, N Y ) 325 336 339.

PAGE 124

124 Xu, X., Yang, D., Ding, J.H., Wang, W., Chu, P.H., Dalton, N.D., Wang, H.Y., Bermingham, J.R. Jr., Ye, Z., Liu, F. et al. (2005). ASF/SF2 regulated CaMKIIdelta alternative splicing temporally reprograms excitation contraction coupling in cardiac muscle. Cell 120 59 72. Xu, Z., Poidevin, M., Li, X., Li, Y., Shu, L., Nelson, D.L., Li, H., Hales, C.M., Gearing, M., Wingo, T.S. et al. (2013). Expanded GGGGCC repeat RNA associated with amyotrophic lateral sclerosis and frontotemporal dementia causes neurodegeneration. Proc Natl Acad Sci U S A. Yamamoto, H., Kokame, K., Okuda, T., Nakajo, Y., Yanam oto, H., and Miyata, T. (2011). NDRG4 protein deficient mice exhibit spatial learning deficits and vulnerabilities to cerebral ischemia. J Biol Chem 286 26158 26165. Yokota, S., Yamamoto, M., Moriya, T., Akiyama, M., Fukunaga, K., Miyamoto, E., and Shiba ta, S. (2001). Involvement of calcium calmodulin protein kinase but not mitogen activated protein kinase in light induced phase delays and Per gene expression in the suprachiasmatic nucleus of the hamster. Journal of neurochemistry 77 618 627. Yu, H., La berge, L., Jaussent, I., Bayard, S., Scholtz, S., Raoul, M., Pages, M., and Dauvilliers, Y. (2011). Daytime sleepiness and REM sleep characteristics in myotonic dystrophy: a case control study. Sleep 34 165 170. Zhang, C., Frias, M.A., Mele, A., Ruggiu, M., Eom, T., Marney, C.B., Wang, H., Licatalosi, D.D., Fak, J.J., and Darnell, R.B. (2010). Integrative modeling defines the Nova splicing regulatory network and its combinatorial controls. Science 329 439 443. Zu, T., Gibbens, B., Doty, N.S., Gomes Pere ira, M., Huguet, A., Stone, M.D., Margolis, J., Peterson, M., Markowski, T.W., Ingram, M.A.C. et al. (2011). Non ATG initiated translation directed by microsatellite expansions. Proc Natl Acad Sci U S A 108 260 265.

PAGE 125

125 BIOGRAPHICAL SKETCH Kuang Yung (Ky le) Lee was born in Taipei, Taiwan, in 1968. Beside s an elder sister, he is the only son born to Hsin Min Lee and Shu Jen Chen. Kyle attended M edical S chool in China Medical University at Taichung, Taiwan from 1987 to 1994 and earned M.D. degree in 1994. A fter two years of military service as a lieutenant physician, he started his residency at Taipei Municipal Jen Ai Hospital and Chang Gung Memorial Hospital (CGMH) Keelung branch. During 2000 2005, Kyle became a board certified neurologist and was an attend ing physician in D epartment of N eurology at the Keelung branch of CGMH. Kyle committed himself to medical research and started his career in Dr. Jin 2007. In 2007, Kyle was recruited by I nterd isciplinary P rogram in B iomedical S cience at the University of Florida, College of Medicine. During the past six years, Kyle did his graduate research with Dr. Maurice Swanson in the D epartment of Molecular Genetics and Microbiology and completed his Ph.D. dissertation in August, 2013. Kyle plans to return to CGMH at Keelung, Taiwan and continue his biomedical research career as a physician scientist.