<%BANNER%>

Aptamer-Mediated DNA Nanomedicines for Targeted Cancer Theranostics

MISSING IMAGE

Material Information

Title:
Aptamer-Mediated DNA Nanomedicines for Targeted Cancer Theranostics
Physical Description:
1 online resource (212 p.)
Language:
english
Creator:
Zhu, Guizhi
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Physiology and Pharmacology (IDP)
Committee Chair:
Tan, Weihong
Committee Members:
Schultz, Gregory Scott
Chan, Edward K
Walter, Glenn A
Batich, Christopher D

Subjects

Subjects / Keywords:
aptamers -- cancer-theranostics -- dna -- molecular-engineering -- nanomedicine -- self-assemble -- targeted-drug-delivery
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Cancer has been one of the worldwide leading causes of death for a longtime, and the advancement of cancer theranostics has been integral to the improvement of cancer patient healthcare. Current cancer patient healthcare suffers from limited abilities of timely cancer prognosis or diagnosis which retard cancer therapy, as well as limited efficacious cancer therapy withserious side effects that harm normal tissues. To address these limitations, we aim at cancer theranostics capable of 1) early cancer detection that can resultin timely therapy, and 2) targeted cancer therapy with potent anticancerefficacy and reduced side effects. Deoxyribonucleic Acid (DNA), the natural molecular carrier of genetic information, has been extensively exploited as a biomaterial in biomedicine,and specifically in my research, DNA aptamers and nanostructures have been used to develop nanomedicines for cancer theranostics.  Aptamers emerge as excellent probes for selective recognition of cancer cells. Aptamers are short single-stranded DNA (ssDNA) with unique three-dimensional structures that allow them to bind to cognate targets with high binding affinities and selectivity. Theyare able to distinguish cancer cells from healthy cells through selective recognition of biomarkers that are exclusively overexpressed on membranes of cancerous cells, but not healthy cells. Thus,aptamers have been studied as recognition elements in cancer cell detection and active targeted anticancer therapy. My thesis work focused on developing DNA nanomedicines and drug-DNA conjugates foraptamer-mediated targeted cancer theranostics. A bispecific aptamer drug carrier was developed to overcome limitations caused by cancer heterogeneity in targeted drug delivery, and aptamers were also incorporated with photoactivatible pro drug to achieve spatiotemperal activation of therapeutic activity. To address the high cost of conventional drug-aptamer conjugates in translational study, I have developed a simple,yet efficient and versatile covalent drug-DNA adduct and aptamer-tethered DNA “nanotrains”,for cancer theranostics. Both models achieved targeted cancer therapy in vivo. Fluorescent DNA “nanotrains” were also built insitu on target living cell surfaces for pinpoint bioanalysis orbioregulation. Recently, using elongated DNA polymers, I developed multifunctional DNA nanoflowers via assembly not relying on DNA hybridization, and applied them in target cell recognition, bioimaging, and targeted drug delivery.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Guizhi Zhu.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Tan, Weihong.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045712:00001

MISSING IMAGE

Material Information

Title:
Aptamer-Mediated DNA Nanomedicines for Targeted Cancer Theranostics
Physical Description:
1 online resource (212 p.)
Language:
english
Creator:
Zhu, Guizhi
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Physiology and Pharmacology (IDP)
Committee Chair:
Tan, Weihong
Committee Members:
Schultz, Gregory Scott
Chan, Edward K
Walter, Glenn A
Batich, Christopher D

Subjects

Subjects / Keywords:
aptamers -- cancer-theranostics -- dna -- molecular-engineering -- nanomedicine -- self-assemble -- targeted-drug-delivery
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Cancer has been one of the worldwide leading causes of death for a longtime, and the advancement of cancer theranostics has been integral to the improvement of cancer patient healthcare. Current cancer patient healthcare suffers from limited abilities of timely cancer prognosis or diagnosis which retard cancer therapy, as well as limited efficacious cancer therapy withserious side effects that harm normal tissues. To address these limitations, we aim at cancer theranostics capable of 1) early cancer detection that can resultin timely therapy, and 2) targeted cancer therapy with potent anticancerefficacy and reduced side effects. Deoxyribonucleic Acid (DNA), the natural molecular carrier of genetic information, has been extensively exploited as a biomaterial in biomedicine,and specifically in my research, DNA aptamers and nanostructures have been used to develop nanomedicines for cancer theranostics.  Aptamers emerge as excellent probes for selective recognition of cancer cells. Aptamers are short single-stranded DNA (ssDNA) with unique three-dimensional structures that allow them to bind to cognate targets with high binding affinities and selectivity. Theyare able to distinguish cancer cells from healthy cells through selective recognition of biomarkers that are exclusively overexpressed on membranes of cancerous cells, but not healthy cells. Thus,aptamers have been studied as recognition elements in cancer cell detection and active targeted anticancer therapy. My thesis work focused on developing DNA nanomedicines and drug-DNA conjugates foraptamer-mediated targeted cancer theranostics. A bispecific aptamer drug carrier was developed to overcome limitations caused by cancer heterogeneity in targeted drug delivery, and aptamers were also incorporated with photoactivatible pro drug to achieve spatiotemperal activation of therapeutic activity. To address the high cost of conventional drug-aptamer conjugates in translational study, I have developed a simple,yet efficient and versatile covalent drug-DNA adduct and aptamer-tethered DNA “nanotrains”,for cancer theranostics. Both models achieved targeted cancer therapy in vivo. Fluorescent DNA “nanotrains” were also built insitu on target living cell surfaces for pinpoint bioanalysis orbioregulation. Recently, using elongated DNA polymers, I developed multifunctional DNA nanoflowers via assembly not relying on DNA hybridization, and applied them in target cell recognition, bioimaging, and targeted drug delivery.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Guizhi Zhu.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Tan, Weihong.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045712:00001


This item has the following downloads:


Full Text

PAGE 1

1 APTAMER MEDIATED DNA NANOMEDICINES FOR TARGETED CANCER THERANOSTICS By GUIZHI ZHU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Guizhi Zhu

PAGE 3

3 To my family, friends, and the love

PAGE 4

4 ACKNOWLEDGMENTS It has been about five years since I started my graduate study in University of Florida in 2008 This is an interesting journey filled with encourage, support, friendship preservation determination, and, of course, difficulties There hav e been tremendous memories I will remember for my whole life First of all I would like to express my deep gratitude to my advisor, Dr. Weihong Tan, who has guided me through out my graduate study As a stuent from IDP under College of Medicine, I appreciate Dr. Tan for offering me the opportunity to work in his group to exploit biotechnology, which is of my primary interest. As my mentor, Dr. Tan guide me in my research ask critical questions off er valuable suggestions, and point out critical problems to address in my research. Actually, the most impressive lesson I learnt from him would be problem driven research, which has led me to develop the nanotrains and the drug DNA adduct technologies for cancer theranostics. I also thank him for encourag ing me to freely persue my research interest, to build my future career and life I appreciate Dr. Tan for providing me the opportunity to work in Hunan University for about 4 months, which left me valuabl e experience and beautiful memories. Most importantly, I met my love during this experience I also would like to thank all my other committee members: Dr. Glenn A Walter Dr. Edward K Chan Dr. Christopher D Batich and Dr. Gregory Schultz Their suggestions and encouragement have helped me to refine this dissertation. I also would like to thank Dr. Kathryn R. Willams for his help with manuscript review and help with my research. Also, I appreciate the great help from IDP, Concentration of Phyiolog y and Pharmacology, and the Department of Chemistry

PAGE 5

5 I appreciate the collaborati on between Tan lab and Dr. Chen Liu s lab, and the tremendous efforts from Trinh Thu Le and Xiaokui (Lucy) Zhang on in vivo evaluation of our technologies I thank the Tan group Life has all taste s but the Tan group family constantly feel s confortable. I have been tremendously benefited from this family. I am more than proud and grateful to be a member of this family. I thank Dr. Yan Chen, Dr. Ling Meng, Dr. Liu Yang, Dr. Huaizhi Kang, Dr. Zhi Zhu, Dr. Hui Wang, Dr. Yanrong Wu, Dr. Jin Huang, Dr. Kwame Sefah, Dr. Meghan O'Donoghue Altman who have train ed me with related knowledge, almost starting from scratch I thank Dr. Erqun Song, Dr. Jing Zheng, Dr. Chunmei Li, Dr. Jian Wang, Dr. Kejing Zhang, Dr. Xilin Xiao for their valuable help with my research. I thank Weijun Chen Fei Huang etc. for their long time friendship, which has been more than motivative for me. I tha nk my family, who has been constantly support me and encourage me to persue my interest and desiration. I thank their education which will definitely guide and benefit me in my whole life. I thank my girlfriend, Lei Mei, who has brought me tremendous happ iness. Without you nothing is possible I am more than glad to thank you all at this special moment.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ .......... 10 LIST OF FIGURES ................................ ................................ ................................ ........ 11 LIST OF ABBREVIATIONS ................................ ................................ ........................... 16 ABSTRACT ................................ ................................ ................................ ................... 20 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 22 Cancer ................................ ................................ ................................ .................... 22 DNA Aptamers for Cancer Theranostics ................................ ................................ 23 Aptamers for Cancer Cell Recognition ................................ ............................. 23 Cell SELEX ................................ ................................ ................................ ...... 25 Aptamers as Therapeutics ................................ ................................ ................ 28 Aptamers for Targeted Delivery of Therapeutics ................................ .............. 29 Other Applications of Aptamers in Cancer Theranostics ................................ .. 33 Overview of Dissertation Research ................................ ................................ ......... 35 2 SELF ASSEMBLED, APTAMER TETHERED DNA NANOTRAINS FOR TARGETED CANCER THERANOSTICS ................................ ............................... 40 S i gnificance and background ................................ ................................ .................. 40 Results and Discussion ................................ ................................ ........................... 42 Construction and C haracterization of A ptNTrs. ................................ ................ 42 Selective R ecognition A bility of A ptNTrs ................................ .......................... 43 High D rug P ayload C apacity of A ptNTrs ................................ .......................... 44 Selective D rug T ransport ation via A ptNTrs and R eal time M onitoring of I ntracellular D rug U nloading. ................................ ................................ ......... 46 In Vi tro S elective C ytotoxicity of A nticancer D rugs T ransported by A ptNTrs .... 47 In V ivo E fficacy of A nticancer D rugs T ransported via A ptNTrs ......................... 48 Conclu d ing Remarks ................................ ................................ ............................... 50 Materials and Methods ................................ ................................ ............................ 51 Preparation of S gc8 NTrs and D rug L oading into N anotrains .......................... 5 1 DNA Synthesis, Labeling, Purification and Quantification ................................ 51 Cell Lines and Cell Culture ................................ ................................ ............... 52 Agarose Gel Electrophoresis ................................ ................................ ............ 52 Atomic Force Microscopy ................................ ................................ ................. 52 Transmission Electron Microscopy (TEM) Study of AuNP Loaded Nanotrains ................................ ................................ ................................ ..... 53

PAGE 7

7 Drug Loading Study by Fluorescence Spectrometry ................................ ........ 53 Stability of Sgc8 NTr Dox by a Drug Diffus ion Assay ................................ ....... 53 Laser Scanning Confocal Microscopy Imaging ................................ ................ 54 Internalization Assay Using Flow Cytometry ................................ .................... 54 Binding A ssay U sing F low C ytometry ................................ ............................... 54 In V itro C ytotoxicity A ssay ................................ ................................ ................ 55 In Vivo A nticancer E fficacy E valuation ................................ ............................. 55 3 BUILDING FLUORESCENT DNA NANODEVICES ON T ARGET LIVING CELL SURFACES ................................ ................................ ................................ ............ 71 S i gnificance and Background ................................ ................................ ................. 71 Results and Discussi on ................................ ................................ ........................... 73 Anchoring of Preformed Fluorescent AptNDs ................................ ................... 73 Chemically modified Fluorescent AptNDs ................................ ........................ 75 Label free Fluorescent AptNDs ................................ ................................ ........ 76 FRET AptNDs ................................ ................................ ................................ ... 77 In Situ Assembly of AptNDs on Target Living Cells Surfaces ........................... 78 Conclu d ing Remarks ................................ ................................ ............................... 81 Materials and Methods ................................ ................................ ............................ 82 DNA Synthe sis, Labelling, Purification and Quantification ................................ 82 Self assembly of Aptamer tethered DNA NDs ................................ .................. 82 Agarose Gel Electrophoresis ................................ ................................ ............ 83 Fluo rescence Spectrometry ................................ ................................ .............. 83 Cell Lines and Cell Culture ................................ ................................ ............... 84 Flow Cytometric Analysis ................................ ................................ ................. 84 Confocal Microscopy Imaging ................................ ................................ .......... 85 In S itu Self assembly of NDs on Target Cell Surfaces ................................ ..... 85 4 NONCANONICAL SELF ASSEMBLY OF MULTIFUN CTIONAL DNA NANOFLOWERS FOR BIOM EDICAL A PPLICATIONS ................................ ......... 99 S i gnificance and Background ................................ ................................ ................. 99 Results and Discussion ................................ ................................ ......................... 102 Self ass embly of Monodisperse, Size tunable, and Densely Packed Multifunctional DNA NFs ................................ ................................ ............. 102 NF Assembly Driven by DNA Liquid Crystallization ................................ ........ 106 Exceptional Stability of DNA NFs ................................ ................................ ... 108 Biomedical Applications of Multifunctional DNA NFs ................................ ...... 109 Conclu d ing Remarks ................................ ................................ ............................. 112 Materials and Methods ................................ ................................ .......................... 114 DNA Preparation ................................ ................................ ............................ 114 Self assembly of DNA NFs Using RCR ................................ .......................... 114 Agarose Gel Electrophoresis ................................ ................................ .......... 115 Drug Loading into NFs ................................ ................................ ................... 115 Characterization of NFs ................................ ................................ .................. 116 Evaluation of the Stability of NFs ................................ ................................ .... 116

PAGE 8

8 Cell Lines and Cell Culture ................................ ................................ ............. 117 Specific Recognition Ability to Target Cancer Cells ................................ ........ 117 Bioimaging of Intracellular Behaviors of NFs and Dox Delivered by NFs ....... 117 Targeted Drug Delivery Using NFs ................................ ................................ 118 5 SELF ASSEMBLED APTAMER BASED DRUG CARRIERS FOR BI SPECIFIC CYTOTOXICITY TO CANC ER CELLS ................................ ................................ 130 S i gnificance and Background ................................ ................................ ............... 130 Results and Discussion ................................ ................................ ......................... 132 Self assembly of Multi aptamers ................................ ................................ .... 132 SD for Bi specific Cancer Cell Recognition ................................ .................... 133 Internalization of SD Into Target Cancer Cells ................................ ............... 134 SD for Bi specific Anticancer Drug Delivery ................................ ................... 135 Conclu d ing Remarks ................................ ................................ ............................. 138 Materials and Methods ................................ ................................ .......................... 139 Preparation of DNA ................................ ................................ ........................ 139 Cell Lines a nd Cell Culture ................................ ................................ ............. 140 Aptamer Binding Assay ................................ ................................ .................. 140 Detection of Target Cancer Cells in Cell Mixtures Using SD .......................... 141 Self assembly and Characterization of SD Dox ................................ ............. 141 Dox Release Study ................................ ................................ ......................... 142 Aptamer Internalization and Drug Uptake ................................ ....................... 142 Cytotoxicity Assay ................................ ................................ .......................... 143 6 DRUG DNA ADDUCT AS NUCLEA SE RESISTANT CONJUGATES FOR TARGETED CANCER THER APY ................................ ................................ ........ 156 S i gnificance and Background ................................ ................................ ............... 156 Results and Discus sion ................................ ................................ ......................... 158 Preparation, Validation, and Characterization of DDA ................................ .... 158 DDA Building Blocks for Nanostructure Assembly ................................ ......... 161 DDA Prepared Using Aptamers for Selective Target Recogniti on .................. 162 DAA for Targeted Cancer Therapy ................................ ................................ 162 Conclu d ing Remarks ................................ ................................ ............................. 165 Materials and Methods ................................ ................................ .......................... 166 DNA Preparation ................................ ................................ ............................ 166 DDA Preparation ................................ ................................ ............................ 167 DDA Determination and Quantification ................................ ........................... 167 Resistance of DDA to Nuclease Degradation ................................ ................. 168 Determination of Binding Abilities and Binding Affinities ................................ 168 In Vitro Cytotoxicity Assay ................................ ................................ .............. 169 In Vivo Evaluation of DAA for Target Cancer Therapy ................................ ... 169 Western Blotting Analysis ................................ ................................ ............... 170 Cell Cycle Analysis Using Propidium Iodide ................................ ................... 171 7 FUTURE DIRECTIONS AN D CONCLUSIONS ................................ .................... 187

PAGE 9

9 Future Directions ................................ ................................ ................................ .. 187 Conclu d ing Remarks ................................ ................................ ............................. 188 LIST OF REFERENCES ................................ ................................ ............................. 192 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 212

PAGE 10

10 LIST OF TABLES Table page 1 1 Examples of nucleic acid aptamers to targets of therapeutic interest. ................ 36 1 2 Aptamers for targeted therapeutic delivery. ................................ ........................ 36 2 1 Sequences of DNA probes. ................................ ................................ ................ 57 3 1 Sequences of DNA probes. ................................ ................................ ................ 87 4 1 Sequences of DNA probes. ................................ ................................ .............. 119 5 1 Sequences of DNA probes.. ................................ ................................ ............. 144 5 2 Comparison of K d s (nM) of bi specific aptamer ST and SD with the K d s (nM) of the parent monovalent aptamers sgc8c, TDO5 and sgd5a. ......................... 145 6 1: Sequences of DNA probes. ................................ ................................ .............. 172 6 2 Copy numbers of drug conjugated on one DNA ( sgc8 5T biotin ) in DDA mixtures and the DDA percentages calculated from ESI MS data. .................. 173

PAGE 11

11 LIST OF FIGURES Figure page 1 1 Schematic representation of cell SELEX ................................ ............................ 37 1 2 Monitoring of cell SELEX and characterization of selected aptamers ................ 38 1 3 An aptamer identified through cell SELEX for in vivo imaging of Ramos subcutaneous xenograft ................................ ................................ ..................... 39 2 1 Schematics of the self assembly of aptamer tethered DNA nanotrains (aptNTrs) for theranostic applications ................................ ................................ 58 2 2 Flow cytometric results indicating that sgc8 trigger maintained binding abilities ................................ ................................ ................................ ............... 59 2 3 Optimization of the self assembly of aptNTrs by agarose gel electrophoresis ... 59 2 4 Characterization of the formation, selective cancer cell recognition, and internalization of sgc8 NTrs ................................ ................................ ................ 60 2 5 Verification of aptNTr formation ................................ ................................ .......... 61 2 6 Flow cytometric analysis indicating the specific recognition of AS1411 and AS1411 NTrs to target Huh7 cells ................................ ................................ ...... 61 2 7 Flow cytometric analysis indicating the selective binding and internalization of sgc8 NTrs ................................ ................................ ................................ ........... 62 2 8 TEM images of 13 nm gold nanoparticles loaded on sgc8 NTrs ........................ 63 2 9 Targeted drug transport using aptNTrs with high payload capacity and stability ................................ ................................ ................................ ............... 64 2 10 Fluorescence intensities of molecular drugs with increasing molar equivalents of sgc8 NTrs ................................ ................................ .................... 65 2 11 Stability and integri ty of Dox loaded with sgc8 NTrs ................................ .......... 65 2 12 Confocal laser scanning microscopy images displaying the time dependent intracellular behaviors of drugs ................................ ................................ ........... 66 2 13 Selective cytotoxi city of molecular drugs transported by aptNTrs. ...................... 67 2 14 Selective cancer cell recognition ability of aptNTrs and selective cytotoxicity induced by Dox delivered via biocompatible aptNTrs ................................ ......... 68 2 15 MTS assay results showing the targeted cytotox icities of m olecular drugs, DNR and EPR transported by sgc8 NTrs ................................ ........................... 69

PAGE 12

12 2 16 Potent antitumor efficacy and reduced side effects of drugs transporte d via aptNTrs ................................ ................................ ................................ ............... 70 3 1 Illustration of the construction of fluorescent DNA nanodevices on target living cell surfaces based on an aptND platform ................................ ................. 88 3 2 Flow cytometric results verifying that sgc8 trigger and TDO5 trigger maintained selective binding abilities ................................ ................................ .. 89 3 3 Selective anchoring of chemically modified fluorescent DNA nanodevices on target cell surfaces ................................ ................................ ............................. 90 3 4 Agarose gel electrophoresis images verifying the ND self assembly ................. 91 3 5 Anchoring of Quasar 570 labeled sgc8 NDs specifically on target CEM cell surfaces, but not on nontarget Ramos cells ................................ ....................... 92 3 6 Fluorescence enhancement of fluorogenic EG upon intercalation into DNA aptNDs ................................ ................................ ................................ ............... 93 3 7 S/N of label free aptNDs for a series of different EG concentrations and aptNDs with a constant aptamer equivalent concentration ................................ 93 3 8 Flow cytometric results indicating the selective anchoring of label free fluorescent sgc8 and TDO5 NDs on the corresponding target cell surfaces ..... 94 3 9 Development and determination of the energy transfer efficiency of FRET DNA nanodevices built on target cell surfaces ................................ ................... 95 3 10 Fluorescence spectrometric results verifying energy transfer from physically associated EG in the duplex boxcars to chemically labeled Cy3 on M1 and M2 on the lin ear aptNDs platform ................................ ................................ ....... 96 3 11 Flow cytometric analysis and statistical analysis of the geometric mean fluorescence intensities (Gmean) of target CEM cells with sgc8 NDs assembled in situ on cell surfaces by a time series ................................ ............ 97 3 12 Confocal microscopy images displaying the progressive assembly of fluorescent nanodevices (sgc8 NDs) through HCR ................................ ............ 98 4 1 Schematic illustration of noncanonical self assembly of multif unctional DNA nanoflowers (NFs) ................................ ................................ ............................ 120 4 2 Predicted secondary structures of the linear template (T 1) ............................. 121 4 3 Flow cytometry data showing selective recognition ability of mo nomeric template complement ................................ ................................ ....................... 121

PAGE 13

13 4 4 An image of agarose gel (2%) electrophoresis indicating the elongation of DNA through RCR ................................ ................................ ............................ 122 4 5 Characterization of small monodisperse hierarchical DNA NFs ....................... 123 4 6 Noncanonical and progressive self assembly of size tunable NFs thr ough DNA liquid crystallization ................................ ................................ .................. 124 4 7 SEM images of RCR products from RCR 0.5 and RCR 2. ................................ .... 125 4 8 SEM images of sonicated NF particles from RCR 24. ................................ ......... 125 4 9 SEM images of products from RCR using a series of inc reasing template concentrations ................................ ................................ ................................ .. 126 4 10 TE M images of NF 0.2 s displaying ultrathin sheet sections ................................ 126 4 11 Exceptional stability of NFs ................................ ................................ ............... 127 4 12 Versatile incorporation of fluores cent bioimaging agents into NFs ................... 127 4 13 Biomedical applications of multifunctional NFs for selective cancer cell recognition, intracellular bioimaging, and ta rgeted anticancer drug delivery .... 128 4 14 Two photon microsc opy (TPM) images displaying intracellular FITC signal in HeLa cells treated with NF 0.2 s incorporated with FITC and sgc8 ...................... 129 4 15 MTS assay results verifying the biocompatibility of NF 0.2 s in both CEM cells and Ramos cells ................................ ................................ ............................... 129 5 1 Scheme for a self assembly of apt amer based drug carrier SD for bi specific cytotoxicity ................................ ................................ ................................ ........ 146 5 2 The formation of bi specific aptamer SD with a dsDNA linker and tri specific by agarose gel electrophoresis ................................ ................................ .............. 146 5 3 The specific binding abilities to both target CEM and Ramos cells were mainta ined for bi specific aptamers S T ................................ ............................ 147 5 4 Bi specific binding ability of drug carrier SD ................................ ..................... 148 5 5 Aptamer binding assay showed the specific binding abilities of SDT to these cells. ................................ ................................ ................................ ................. 149 5 6 The distinct morphologies of target CEM/Toledo cells from that of the non target NB4 cells shown in flow cytometric analysis ................................ ........... 150

PAGE 14

14 5 7 Confocal microscopy study showing that SD was readily internalized into CEM and Toledo cells after 2 h incubation at 37C ................................ .......... 151 5 8 Characterization of Dox loading into drug carrier SD ................................ ........ 152 5 9 Kinetics of the self assembly of SD Dox indicated rapid Dox intercalation into SD ................................ ................................ ................................ .................... 153 5 10 Bi spe cific binding and Dox delivery abilities of drug carrier SD ....................... 153 5 11 Free Doxorubicin induced cytotoxicity and inhibited cell proli feration in Toledo and NB4 cells in a dose dependent manner ................................ ..................... 154 5 12 Bi specific cytoto xicity of Dox delivered by SD. ................................ ................ 155 6 1 Nature inspired nuclease resistant drug DNA adduct (DDA) for targeted cancer therapy. ................................ ................................ ................................ 174 6 2 HPLC purification data showing the absorbance as a function of retention time ................................ ................................ ................................ ................... 175 6 3 An agarose gel electrophoresis image acquired under UV irradiation displaying the band for DDA ................................ ................................ ............. 176 6 4 Determination and characterization of DDA. ................................ .................... 177 6 5 Images showing free drug (Dox), pure DNA (sgc8 5T), control (DDA reaction solution without formaldehyde), and DDA (sgc8 5T Dox adduct) in bright field and under UV irradiation ................................ ................................ ................... 178 6 6 An image of agarose gel electrophoresis showing that DNase I premixed with DDA maintained sufficient enzymatic activity to degrade the DNA. .................. 178 6 7 Wide applicability of DDA platform. ................................ ................................ .. 179 6 8 Average drug copy numbers in one DNA in adducts prepared from Dox and polynucleo tides (A20, G20, C20 and T20) ................................ ........................ 179 6 9 Nanostructure formation using DDA as building blocks.. ................................ .. 180 6 10 Specific recognition abilities of DAA. ................................ ................................ 181 6 11 Specific recognition abilities of DAAs to target cancer cells ............................. 182 6 12 Confocal laser scanning microscopy images at different time points indicated the rapid entry of free Dox to CEM cells.. ................................ ........................ 183 6 13 DAA (sgc8 Dox adduct) for ta rgeted anticancer drug delivery .......................... 184

PAGE 15

15 6 14 S pecific recognition ability of AS1411 to Huh7 liver cancer cells. .................... 185 6 15 In vivo evaluation of DAA for targeted cancer therapy.. ................................ .... 186

PAGE 16

16 LIST OF ABBREVIATIONS AFM Atomic force microscopy ALL Acute lymphoblastic leukemia AMA Ammonium hydroxide: methylamine 1:1 AML Acute myeloid leukemia ANOVA Analysis of variance ATCC American Type Culture Collection ATP Adenosine triphosphate BB Binding Buffer (WB, 1g/L BSA and 100mg/L tRNA) BP Base pair BSA Bovine serum albumin C ASPASE C ysteine asp artic prote ase C DNA Complementary DNA CEM Human T Cell Acute Lymphoblastic Leukemia cell line LSCM Laser scanning confocal microscopy CPG Control led pore glass bead C Y 3 C yanine derivative 3 C Y 5 C yanine derivative 5 C Y 5.5 C yanine derivative 5 .5 DAA Drug aptamer adduct DAPI 4',6 diamidino 2 phenylindole DDA Drug DNA adduct DLS Dynamic light scattering DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid

PAGE 17

17 DN ASE D eoxyribonuclease DNR Daunorubicin D NTP D eo xyribonucleotide triphosphate DPBS Dulbecco's phosphate buffered saline D ox Doxorubicin DS Double stranded DS DNA Double stranded DNA EB Ethedium bromide ECM Extracellular matrix EDTA Ethylenediaminetetraacetic acid EG EvaGreen EPR Epirubicin ESI MS Electrospray ionization mass spectrometry FACS F luor escence activated cell sorting FBS Fetal bovine serum FITC F luorescein isothiocyanate FRET Fluorescence resonance energy tr ansfer FSC Forward Scatter HCR Hybridization chain reaction HeLa Henrietta Lacks's cervical cancer cell line HPLC High pressure liquid chromatography HRP H orseradish peroxidase IDT Integrated DNA Technologies I G Immunoglobulin like domains K D Disassociation constant

PAGE 18

18 K D A KiloDalton LC Liquid crystal MTD Maximum tolerated dosage MTS 3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulfophenyl) 2H tetrazolium MW Molecular weight ND Nanodevice NF Nanoflower NP Nanoparticle NTr Nanotrain N U PACK DNA and RNA secondary structure prediction program PBS Phosphate buffered saline PE Phycoerythrin PEG Polyethylene glycol PI P ropidium iodide P OLY A Polydeoxya denosine P OLY C Poly deoxycytidine P OLY G Polydeoxyguanosine P OLY T Polyt hymidine PTK7 Protein tyrosine kinase 7 RCR Rolling cycle replication RNA Ribonucleic acid RPMI 1640 Commonly used cell media SA Streptavidin SD sgc8 sgd5a SELEX Systematic Evolution of Ligands by EXponential enrichment

PAGE 19

19 SEM Scanning electron micr oscopy SI RNA Small interfering RNA S/N Signal/noise SSC Side Scatter SS DNA Single stranded deoxyribonucleic acid TBE Tris/Borate/EDTA buffer TDT Targeted drug transport TEAA Triethylammonium acetate buffer TEM Transmission electron microscopy T RIS HC L Tris(hydroxymethyl)aminomethane HCl T RNA Transfer RNA UF University of Florida UV Ultra violet UV V IS UV Visible WB Washing buffer (PBS, 4.5g/L glucose, 1M MgCl2)

PAGE 20

20 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy APTAMER MEDIATED DNA NANOMED ICINES FOR TARGETED CANCER THERANOSTICS By Guizhi Zhu August 2013 Chair: Weihong Tan Major: M edical Sciences -Physiology and Pharmacology Cancer has been one of the worldwide leading causes of death for a long time, and the advancement of cancer thera nostics has been integral to the improvement of cancer patient healthcare. Current cancer patient healthcare suffe rs from limited abilities of timely cancer prognosis or diagnosis which retard cancer therapy as well as limited ef ficacious cancer therapy with serious side effects that harm normal tissues To address these limitations, we aim at cancer theranostics cap able of 1) early cance r detection that can result in timely therapy and 2) targeted cancer therapy with potent anticancer efficacy and reduced side effects. Deoxyribonucleic A cid (DNA), the natural molecular carrier of genetic information, has been extensively exploited as a biomaterial in biomedicine and specifically in my research, DNA aptamers and nanostructures have been used to develop nanomedicines for cancer theranostics. Aptamers emerge as excellent probes for selective recognition of cance r cells. Aptamers are short single stranded DNA (ssDNA) with unique three dimensional structures that allow them to bind to cognate targets with high binding affinities and selectivity. They are able to distinguish cancer cells from healthy cells through s elective recognition of biomarkers that are exclusively

PAGE 21

21 overexpressed on membranes of cancer ous cells, but not healthy cells. Thus, aptamers have been studied as recognition elements in cancer cell detection and active targeted anticancer therapy. My thes is work focused on developing DNA nanomedicine s and drug DNA conjugates for aptamer mediated targeted cancer theranostics. A b ispecific aptamer drug carrier was developed to overcome limitations caused by cancer heterogeneity in targeted drug delivery, and aptamers were also incorporated with photoactivatible prodrug to achieve spatiotemperal activation of therapeutic activity. To address the high cost of conventional drug aptamer conjugates in translation al study I have developed a simple, yet efficient and versatile covalent drug DNA adduct and aptamer tethered DNA nanotrains for cancer theranostics. Both models achieved targeted cancer therapy in vivo F luorescent DNA nanotrains were also built in situ on target li ving cell surfaces for pinpoin t bioanalysis or bioregulation Recently, u sing elongated DNA polymers, I developed multifunctional DNA nanoflowers via assembly not relying on DNA hybridization, and applied them in target cell recognition, bioimaging, and ta rgeted drug delivery.

PAGE 22

22 CHAPTER 1 INTRODUCTION Cancer Cancer is still one of the leading causes of death worldwide There are 3 main reasons for the high death rate: a ) Lack of knowledge about risk factors leads to difficult prediction and prevention of cancer Some risk factors are ionization radiation exposure, benzene exposure, certain chemotherapies, family history, and viral infection. However, many more risk facto rs for cancer are actually still unknown yet. b ) Lack of more effective and efficient strategies for early diagnosis. Many types of cancer are difficult to diagnose or current technologies are not capable of diagnosing cancers at the stages of curability T he diagnosis strategies such as blood tests and bone marrow biopsy examination are usually not efficient. c ) Lack of effective cancer therapies with low side effects. C ancer treatment by traditional cancer chemotherapy is always hindered by the side effe cts caused by the non specificities of drug toxicit ies, especially to healthy tissue s However, American Cancer Society reported that many cancer deaths can be prevented by early detection and removal of pre cancerous lesions through regular screening exam inations and targeted therapy has played an more and more important role in cancer therapy ( 1 ) Therefore, it would be highly advantageous to develop strategies for more efficient diagnosis and therapy to improve cancer patient healthcare and decrease cancer patient death rate. Research in cancer biology over the past few decades has elucidated many factors that contribute to cancer pathogenesis, and suggested various targets for cancer Note: this chapter was parti ally r eprinted with permission from : Z hu G et al. (2012) Nucleic acid aptamers: an emerging frontier in cancer therapy. Chemical Communications

PAGE 23

23 diagnosis and therapy. However, current technologies still have limited capabilities of early cancer cell detection, which would lead to early cancer treatment and improved outcome. Also, the majorities of current c ancer therapy suffer from limited efficacy, mainly resulting from limited therapeutic potency or serious side effects, including nonselective harm in healthy tissues. To facilitate early c ancer detection and improve cancer therapy, it is highly desirable t o develop recognition elements that are capable of selective and sensitive recognition of cancer cells thereby achieving sensitive cancer prognosis or diagnosis, as well as targeted therapy in which cancer cells are eradicated but toxicity in healthy cell s is reduced. Among various types of recognition elements, such as antibodies, aptamers, and small molecules (folate acids), a ptamers have emerged as a promising candidate for specific recognition of cancer ous cells Aptamers are single stranded nucleic a cid probes (eg. ss DNA, ss RNA), which can bind to targets, ranging from ions, to macromolecules, and mammalian cells, with high specificity and selectivity ( 2 3 ) In my study, a ptamers that can selectively recognize cancer cells were utilized for the development of DNA nanomedicine for cancer theranostics. DNA Aptamers for Cancer Theranostics Aptamers for Cancer Cell Recognition Nucleic acid aptamers are single stranded (ss) oli gonucleotides with unique intramolecular conformations and specific recognition abilities to targets. They are isolated from large libraries containing 10 13 10 16 random nucleic acid sequences through Systematic Evolution of Ligands by Exponential Enrichmen t (SELEX). ( 4 5 ) Since the pioneering isolations of aptamers against organic dyes ( 4 ) and T4 DNA polymerase ( 5 ) respectively, in 1990, a wide variety of aptamers have been identified

PAGE 24

24 using the SELEX technique. The targets of aptamers range from small molecules, ( 4 6 7 ) to proteins, ( 5 8 14 ) virus infected cells, ( 15 ) stem cells, ( 16 ) and cancer cells ( 17 24 ) and a wide variety of targets of high therapeutic interest were used as targets for aptamer identification (Table 1 1 ). The binding affinities of aptamers to their targets ( K d s usually of picomolars nanomolars) are comparable, or sometim es stronger than, those of other molecular recognition elements, such as antibodies. ( 25 ) The SELEX method has been further developed in combination with various other techniques, including capillary electrophoresis, ( 26 ) microfluidics, ( 27 ) flow cytometry, ( 28 ) and fluorescence activated cell sorting (FACS). ( 29 ) It has also been modified for higher selection efficiency, including the selection of aptamers with improved biostability or bioavailability. For instance, the Ellington group developed an automated SELEX, by which RNA aptamers can be generated within a few days. ( 30 ) SELEX has also been utilized to select aptamers using complex targets, ( 31 32 ) including cell fragments, cell membrane fractions, red blood cell ghosts, bacteria, mammalian cancer cells, and even implanted tumors ( 33 ) Recently, our group developed cell SELEX, ( 28 ) in which whole live cells were used to i dentify aptamers with specific recognition abilities to target cells. Aptamers have been selected using a wide range of diseased cells. ( 17 24 34 ) Cell SELEX is also capable of generating aptamers that target diseased cells, but without having prior knowledge of particular protein signatures. This novel way to identify disease associated biomarkers is poised to increase our understanding of molecula r oncology and guide targeted therapy. Aptamers hold many advantages over antibodies, which have been widely used as recognition elements ( 15 ) Briefly, aptamers can be developed against a wide range

PAGE 25

25 of targets, including those toxic to organisms and therefore beyond the reach of antibody development. Thus, aptamers can be generated for toxic therapeutics and the targeted transport of toxic drugs. Moreover, aptamer identification through in vitro SELEX is usually more efficient and cost effective than antibody development. The advancement of automated nucleic acid synthesis enables easy, cost effective chemical synthesis and modification of functional moieties, as well as large scale commerc ial production. Other advantages include high stability and long shelf life, rapid tissue penetration based on the relatively small molecular weights, low immunogeneity, ( 35 ) and ease of antidote development. ( 36 37 ) These advantages makes aptamers more than attractive for clinical or biomedical applications, such as disease diagnosis and therapy. In addition, the tertiary molecular structures of some aptamer/protein target complexes have already been elucidated, whi ch further indicated that noncovalent interactions formed between specific nucleic acid and target conformations, including hydrogen bonding, van der Waals contacts, stacking interactions, contributes to aptamer target interaction at the molecular levels. ( 38 41 ) The elucidation of aptamer target interaction is also anticipated to facilitate drug design, drug screening and discovery of new drugable sites on disease biomarkers. Cell SELEX Cell SELEX is a technique that uses living cells as targets to isolate aptamers (Figure 1 1) ( 9 32 ) In vitro cell SELEX (and the subsequent cellular application) is usually performed in a buffer solution which does not contain nuclease, ensuring the stability of nucleic acid probes during aptamer selection. Cell SELEX pr ovides a unique set of capabilies: identification of aptamers that target molecules which need cofactors

PAGE 26

26 or post translational modification to form functional conformations on cell surfaces; aptamer identification without prior knowledge of the molecular d ifferences between targets and nontargets; simultaneous generation of a panel of aptamers, which may have different molecular targets; further application of the resultant aptamers for disease biomarker identification, which could, in turn, help in underst anding protein expression patterns on diseased cell surfaces, unravelling the pathogenesis of complex, intractable diseases, and opening new therapeutic avenues. Using cell SELEX, our group has successfully identified DNA aptamers against cells of several cancers, including acute lymphoblastic leukemia (ALL) (T cell leukemia), ( 17 ) liver cancer, ( 19 ) acute myeloid leukemia (AML) leukemia, ( 20 ) lung cancer, ( 21 24 ) ovarian cancer, ( 23 ) B cell lymphoma, ( 42 ) colorectal cancer, ( 43 ) and breast cancer ( 44 ) Shangguan, et al. enriched DNA pools that specifically recognized CEM cells, a cultured precursor T cell ALL cell line, but did not recognize the nontarget ure 1 2 ). ( 17 ) To monitor the progress of aptamer enrichment during selection and verify the specific recognition abilities of resultant aptamers to target cells, flow cytometry was employed, in which cells bound by f luorophore labeled DNA probes displayed larger fluorescence intensities compared to those cells not specifically bound by these DNA probes. Some aptamers identified from the enriched pools were capable of revealing the molecular differences of cancer cells from clinical smaples. ( 45 ) The dissociation constants ( K d s) of these aptamers range from picomolar to nanomolar range. For instance, aptamer sgc8 was shown to have a dissociation constant of 0.80 nM to CEM cells, in dicating robust binding affinity.

PAGE 27

27 Aptamers are also able to distinguish cells that are closely related. Sefah et al. selected aptamers using three types of AML cells (HL60, K562 and NB4 cells). ( 20 ) One aptamer, KH1C12, showed significant sele ctivity to target HL60 cells with a dissociation constant of 4.5 nM, but it did not bind to nontarget K562 or NB4 cells. KH1C12 maintained the ability to recognize the target cells in normal bone marrow aspirates and clinical samples, respectively. More im portantly, this provided, for the first time, molecular probes that could distinguish two types of leukemic cells that are closely related morphologically. It is worth noting that two other aptamers, KK1B10 and KK1D04, showed different binding abilities to undifferentiated cells and chemically induced differentiated cells. For instance, with induction by all trans retinoic acid (ATRA), HL60 cells differentiate in a granulocytic pathway, whereas sodium butyrate, another type of chemical inducer of HL60, indu ces differentiation in a monocytic pathway. Fluorophore with ATRA intensity with HL60 cells induced with sodium butyra te. The ability of aptamers to probe cell differentiation stages would enable researchers to study the molecular basis of cell differentiation or cancer pathogenesis. Aptamers selected using cultured cells through cell SELEX were further shown to be capable of specific recognition of ex vivo and in vivo tumor cells (Fig ure 1 3 ), ( 46 47 ) and they have been widely used as recognition probes for targeted cancer cell detection and isolation, ( 48 ) cell ce ll interaction, ( 49 ) and transport of chemotherapeutics, ( 50 53 ) antibodies ( 54 ) nanostructures, ( 52 54 ) and viruses. ( 55 )

PAGE 28

28 Aptamers as T herapeutics In addition to specific recognition abilities, some aptamers can bind to and further modulate the biological activities of the molecular targets which are involved in pathogenesis. As a consequence, aptamers, as therapeutics, can readily regulate biologica l pathways and interfere with disease development. The therapeutic application of nucleic acid aptamers dates back to 1990, when Sullenger et al. reported the inhibition of HIV 1 viral infection in host cells by overexpressing a Trans Activation Response (TAR) decoy. This nucleic acid worked as an aptamer, prevented the activation of viral gene expression, and consequently inhibited the viral replication. ( 56 ) Moreover, the development of SELEX tec hniques by Ellington and Gold, et al. enabled the rapid generation of aptamers for a wide range of therapeutically relevant targets. The therapeutic potential and rapid in vitro identification of aptamers make them attractive as therapeutic agents. Since then, many aptamers have been developed and have undergone clinical evaluation. One example is pegaptanib (marketed as Macugen), an anti VEGF aptamer that can recognize the majority of human VEGFA isoforms. Pegaptanib was developed by Pfizer and Eyetech, a nd it was approved by the U.S. FDA in 2004 for the treatment of age related macular degeneration (AMD). The most advanced aptamer for cancer therapy is AS1411, a G rich aptamer previously known as AGRO001. ( 57 ) AS1411 is a ble to bind nucleolin ( 58 ) and can be internalized into target cells to interfere with intracellular pathways ( 59 ) The exact mechanism of its inhibition of cell proliferation is not yet fully understood, but a few of the pathways involved include the destabilization of BCL 2 mRNA and the inhibition of NF ( 59 ) AS1411 can inhibit cell proliferation in a broad range of cancers and it is currently in Phase II clinical trials for AML. In 2010,

PAGE 29

29 Bates, et al. reported that cancer selective antiproliferative activity might be generally applicable to some G rich oligodeoxynucleotides and was associated, for example, with G quadruple x formation, cellular internalization and protein binding. ( 60 ) This may effectively lead to the isolation or design of aptamers with G quadruplex structures and aid in elucidating the antiproliferative effect of G quadruplex forming aptamers. Other aptamers under clinical evaluation include MOX A12 targeting CCL2 and NU172 targeting thrombin, among others. ( 15 ) Aptamers for T argeted D elivery of T herapeutics Aptamers can work as recognition moieties and guide a variety of therapeutics to target disease d sites (Table 1 2). It is well known that conventional chemotherapy dilated cardiomyopathy or congestive heart failure. ( 61 ) The targeted delivery of chemotherapeutics to diseased sites is essential to improve therapeutic efficacy. Antibodies and aptamers are the two major types of recognition moieties. The development of antib ody drug conjugates has been intensively studied in pharmaceutical companies in the past few years. ( 62 63 ) Ap tamers, owing to their intrinsic advantages over antibodies, are poised to play an important role in targeted delivery of therapeutics. The ability of some aptamers to recognize diseased cells, but not healthy cells, enabled them to be designed as targetin g moieties and selectively transport drugs to diseased sites. The high stability of nucleic acid aptamers provides tremendous opportunities for scientists to design conjugates of aptamers and chemotherapeutics through a variety of chemical reactions or phy sical complexation. In addition, the ease of site specific chemical modification of aptamers enables the

PAGE 30

30 conjugation of aptamers with drugs, including chemotherapeutics and photosensitizers, or nanomaterials, such as carbon nanotubes or gold nanoparticles. ( 64 65 ) The high recognition specificity and selectivity of aptamers make them excellent molecular probes for targeted delivery of therapeutics. The chemical stability and ease of modification of aptamers enable them to be chemically conjugated with many functiona l moieties, including therapeutics, ranging from small molecule chemotherapeutics to photosensitizers, toxins, siRNA, and radionuclides (Table 1 2). Our group has conjugated a DNA aptamer, PTK7 targeting sgc8c, and Doxorubicin (Dox), one of the most widely used chemotherapeutic drugs in clinical medicine. The resultant conjugate was able to specifically deliver the drug and induce inhibition of cancer cell proliferation in target CEM cells, but not in nontarget cells, indicating high selectivity. In a simil ar manner, a photosensitizer, Chlorin e6, was conjugated to aptamer TD05. The resultant selective cytotoxicity of this aptamer drug conjugate demonstrated the principle of using aptamers for targeted drug delivery in photodynamic therapy (PDT). Moreover, s iRNA, which is an emerging new type of nucleic acid therapeutics, has also been chemically conjugated with aptamers. The resultant chimeric aptamer siRNA conjugates were able to specifically deliver siRNA and knock down the target genes. ( 66 69 ) In addition, by taking advantage of the noncovalent interactions between oligonucleotides and some therapeutics, physical conjugates of aptamers and drugs have been developed for targeted therapy. For instance, we have developed a bi specific DNA aptamer based drug carri er, SD, in which two different aptamers were self assembled through a double stranded linker with preferential Dox loading sites. Dox

PAGE 31

31 can be physically complexed with SD through intercalation into dsDNA linker,and transported into two distinct target cells to induce bi specific cytotoxicity in a mixed cell environment. ( 70 ) The past few decades have witnessed the rapid advancement in both aptamer development and nanotechnology. Suitably modified nanomaterials can be combined with aptamers for targeted drug delivery. Aptamers provide aptamer nanomaterial conjugates with specific targeting ability, and nanomaterials provide an excellent platform for drug loading in the interior spaces or on the surface, as imaging agents via their unique optical characteristics or as therapeutic agents themsel ves. As an example, our group has developed a smart multifunctional nanostructure (SMN) composed of porous hollow magnetite nanoparticles (PHMNP), PEG ligands, and aptamers. ( 71 ) The PHMNP was capable of encapsulating Doxorubicin and also worked as an imaging agent for MRI. The aptamer enabled the targeted delivery of SMN Dox complexes into target CEM cells. The Dox release was facilitated upon internalization of SMN Dox by endocytosis resulting in inhibition of target cell proliferation. Other than metallic nanomaterials, polymeric nanomaterials in combination with aptamers have also been investigated for targeted transport of therapeutics. For instance, a diacyl moiety was tethered at one end of an aptamer sequence by automated solid phase DNA synthesis. The resultant chimeric lipid aptamers self assembled into monodispersed lipid nanoparticles, termed micelles. ( 72 ) The aptamer coated lipid micelles were further studied as a vector for targeted delivery. ( 73 ) In this study, aptamer TD05 was conjugated with micelles, and the resultant TD05 micelles

PAGE 32

32 showed improved bindi ng ability at physiological temperature and enhanced aptamer binding affinity by approximately 750 fold as a consequence of multivalency. These aptamer tethered micelles were able to integrate with the cellmembrane and facilitate the delivery of a dye dope d into cells. Strikingly, the authors also demonstrated that these aptamer micelles showed dynamic specificity in flow channel systems mimicking drug delivery in a circulation system. The specific recognition and facilitated transport of loaded model molec ules make aptamer micelles promising as vectors for targeted drug delivery. In addition to serving as drug carriers, nanomaterials conjugated with aptamers can also work as therapeutics themselves. Huang et al have conjugated multiple copies of aptamer sg c8 onto the surfaces of gold nanorods (AuNRs), which have high absorption efficiency of near infrared light for hyperthermia effect. ( 74 ) The resultant sgc 8 NRs were then capable of selectively binding to target CEM cells and induce cytotoxicity by hyperthermia. In another example, an acrydite phosphoramidite was conjugated to the 5' end of aptamers by automated solid phase DNA synthesis, and the resultant a crydite aptamer chimera were able to polymerize in the presence of ammonium persulfate (APS) and tetr amethylethylenediamine (TEMED) ( 75 ) The preforme d polymeric aptamers were able to specifically bind and be internalized into target cells. More importantly, the internalized aptamer tethered polymers led to cytotoxicity in target cancer cells, including those exhibiting multidrug resistance. In the past decade or so, intensive study in genome sequencing and proteomics has produced a wealth of information at the genomic, genetic, and proteomic levels. However, disease biomarkers remain scarce, especially those that can be used as drug

PAGE 33

33 targets. In parallel the limited number of drugable biological activity sites on molecular biomarkers has hampered the discovery of new drugs that could otherwise target those sites. Aptamer selection against targets without prior knowledge at the molecular level provides an excellent platform to identify biomarkers and drugable sites on biomarkers. Other Applications of Aptamers in Cancer Theranostics As described above, aptamer selection does not require prior knowledge of, for instance, a particular protein conformation. This property, combined with the ability of aptamers to distinguish diseased cells and healthy cells, makes it conceivable to identify previously unknown disease biomarkers. Towards this goal, Tan and colleagues have successfully identified target biomarke rs of aptamers through a chemical biology approach. In one example, a biotinylated aptamer, sgc8 ( 17 ) was generated to bind target CEM cells with subsequent crosslinkage to cell membrane proteins. The resultant cells were then lysed, and the crosslinked aptamer protein complexes were extracted using magnetic beads, purified using gel electrophoresis, and subjected to mass spectrometric analysis. MS data subsequently verified that the target biomarker wa s PTK7 (protein tyrosine kinase 7), a pseudokinase without detectable catalytic tyrosine kinase activity. ( 76 77 ) Although PTK7 was reported to be upregulated in many types of cancers, the biomedical relevance of this upregulation remains unclear, and P TK7 still has no clinical application. ( 78 ) Our further i nvestigation demonstrated that silencing PTK7 genes through RNAi induced apoptosis in colon cancer HCT116 cells via a mitochondrial pathway. ( 78 ) The successful identification and important biological role of PTK7 in cancer cell proliferation and apoptosis suggest that aptamers are promising in the discovery of biomarkers of therapeutic interest.

PAGE 34

34 In addition, t he generally strong binding affinitie s of aptamers to targets and the high stability of aptamer target interactions have enabled the elucidation of the crystal structures of these complexes, including aptamers with thrombin, ( 38 39 ) HIV TAR, ( 40 ) and NF ( 41 ) These structures shed light on the loci of aptamer/target interaction, which could be further applied to rational structure based drug design and screening. To this end, aptamers have been used as both templates and substitutes in high throughput drug screening. That is, small molecule dru gs that compete with aptamers for target binding were identified as drug candidates. ( 79 88 ) In 2007, Famulok, et al. reported the identification of a small molecule inhibitor, SY 3E4, against HIV reverse transcriptase, which plays a vital role in viral replication. ( 81 ) This inhibitor was identified through the displacement of aptamers from reverse transcriptase with small molecule drug candidates and further verified to inhibit viral replication. More importantly, the structure analysis of this target protein revealed that this drug binding site had not been previously considered as a drugable site for viral therapy. ( 81 ) Thus, the structural analysis of aptamer target complexes is a new avenue for investigating aptamers as templates for drug design, high throughput drug screening and discovery of alternative drugable sites. During the two decades since aptamers were first described, many challenges for therapeutic aptamer application s have come to the forefront, particular ly issues of biostability, bioavailability, therapeutic formulation and pharmacokinetics, and cost of large scale DNA production. Nonetheless, the advantages of nucleic acid aptamers over other counterparts, including antibodies, offer tremendous opportuni ties. For instance, antibody drug conjugates (ADC) ( 89 ) and bi specific antibodies ( 90 91 ) are tw o

PAGE 35

35 areas of tremendous interest and opportunities in pharmaceutical research and development. However, while the use of antibodies is always associated with complicated and time consuming genetic engineering, limited stability, and high cost, In contrast, b i specific aptamer or aptamer drug conjugate engineering is fairly straightforward as a consequence of facile modification, high stability and programmability. ( 49 53 54 92 95 ) With further understanding and improvement of aptamers, as well as the advancement of DNA synthesis technology, nucleic acid aptamers are poised to revolutionize the next generation of cancer thera nos tics. With the variety of potential aptamer applicatio ns in cancer theranostics, I have focused on utilizing aptamers to develop DNA nanomedicines for targeted cancer theranostics. Overview of Dissertation Research My thesis work focused on the develop ment of DNA nanomedicine s for targeted cancer theranostic s through DNA molecular engineering and innovative drug DNA conjugation chemistry I developed aptamer tethered DNA nanotrains and a simple, yet efficient drug DNA adduct, and both models reduced cost and achieved targeted cancer therapy in vivo Fluore scent DNA nanotrains were also built in situ on target living cell surfaces for pinpoint bioanalysis/regulation. Recently, multifunctional DNA hydrogel nanoparticles were self assembled through a noncanonical strategy that is driven by liquid crystallization of long DNA polymers, and the resultant nanoflowers were applied for target cell recognition, bioimaging, and targeted therapy. I also developed aptamers in tegrat ed with photo cleava ble prodrug for spatio temporal ly controll able phototherapy, and a bispecific aptamer drug carrier to overcome the complications caused by cancer heterogeneity. In the following chapters, I will explain in

PAGE 36

36 more details about developing aptamer mediated DNA nanomedicines for cancer theranostics. T able 1 1 Examples of nucleic acid aptamers to targets of therapeutic interest Aptamers Molecular targets References Vascular endothelial growth factor Age related macular degeneration ( 96 ) Nucleolin Cancer ( 97 ) Protein tyrosine Kinase 7 Cancer ( 76 ) Immunoglobulin Heavy Chains (IGHM) Lymphoma ( 42 ) Prostate specific membrane antigen Cancer ( 98 ) Tenascin C Cancer ( 9 ) Mucin 1 Cancer ( 99 ) Immunoglobulin E Allergy ( 100 ) Cancer ( 101 ) thrombin Thrombosis ( 11 ) HIV gp120 Viral infection ( 14 ) NF Cancer ( 102 ) E2F transcription factor Cancer ( 103 104 ) HER3 Cancer ( 13 ) Plasminogen activator inhibitor 1 Tumor metastasis ( 105 ) Table 1 2 Aptamers for targeted therapeutic delivery Aptamers Therapeutic cargoes Ref erence s sgc8c Chemotherapeutics, photosensitizers, nanorods, liposomes, nanogel, viral capsids, DNA origami, antibodies ( 52 54 55 70 74 92 106 108 ) TD05 Micelle nanoparticles, photosensitizers ( 73 93 ) AS1411 Chemotherapeutics, photosensitizers, nanoparticles, liposomes ( 64 65 ) A10 Chemotherapeutics, siRNA, protein toxin, nanoparticles, quantum dots ( 67 68 109 114 ) APT Radionuclides, chemotherapeutics, quantum dots ( 115 117 )

PAGE 37

37 Figure 1 1 Schematic representation of cell SELEX. DNA sequences that have specific recognition to target cells are enrich ed through iterative screening and evolved to have overall greater binding ability The enriched DNA pools are sequenced to identify individual aptamers that can selectively recognize target cells

PAGE 38

38 Figure 1 2. Monitoring of cell SELEX and characterization of selected aptamers. (A) Flow cytometry assay to monitor the binding of selected pools and enrichment of aptamers with CEM cells (target) and Ramos cells (control). For target CEM cells, there was an increase in binding ability of the pool as the selection was progressing, whereas there was little enhancement for the control cells. (B) Flow cytometry assay for the binding of the FITC labele d sequences sga16 and sgc8 obtained from the above selection. s

PAGE 39

39 Figure 1 3 An aptamer identified through cell SELEX for in vivo imaging of Ramos subcutaneous xenograft. (A) Optical and fluorescent imaging of tumors in mice using Cy5 dye and Cy5 labeled aptamers. Target Ramos cells were injected subcutaneously on the back of BALB/c nude mice. Cy5 dye, Cy5 labeled sgc8a (control), o r Cy5 labeled TD05 was subsequently injected intravenously, and images of the dorsal side of live mice were taken at various time points after injection. Images a, b and c represent the optical photographs, the fluorescent images before injection, and 3.5 h after injection, respectively. (B) Quantification of the signal to background ratio for Cy5 labeled TD05 and Cy5 labeled sgc8a. The number of mice used to derive statistical information for each probe is 5. Data represent mean standard error.

PAGE 40

40 CHAPTER 2 SELF ASSEMBLED, APTAMER TETHERED DNA NANOTRAINS FOR TARGETED CANCER THERANOSTICS S i gnificance and Background While chemotherapeutic drugs are widely used in cancer therapy, they lack specificity and can induce cytotoxicity in both cancerous and healthy cells, causing side effects ( 61 ) limited MTD and reduced therapeutic efficacy ( 118 119 ) A theranostic ( 120 ) platform with targeted and efficient drug transport would solve these problems, and, by its programmability, DNA nanotechnology has been utilized for the rational assembly of one two and three dimensional nanostructures ( 121 124 ) which have been further studied for biomedical applications, including the passive targeted transport of thera nostic agents ( 50 54 125 131 ) In addition aptamer s, as specific recognition elements, have been studied for active targeted transport of conventional chemotherapeutic drugs ( 15 50 54 92 109 132 ) Nucleic acid aptamers are single stranded oligonucleotides with unique intramolecular conformations and specific reco gnition abilities to cognate targets, including mammalian cancer cells ( 4 5 17 28 46 ) R ecent biotechnological advancements have led to a variety of TDT strategies based on aptamer drug conjugates or aptamer nanomaterial assemblies ( 15 50 54 92 109 132 133 ) However, these strategies have unique limitations that could hamper the transition to clinical application, including 1) complicated design laborious and uneconomical bulky preparation of myriad ssDNA as building blocks to construct sophisticated nucleic acid based nanomaterials or laborious and inefficient preparation Note: this work was r eprinted with permission from : Zhu G et al. (2013) Self assembled, aptamer tethered DNA nanotrains for targeted transport of molecular drugs in cancer theranostics. Proceedings of the National Academy of Sciences

PAGE 41

41 of aptamer drug conjugates ( 54 92 125 128 129 131 ) ; 2) L imited drug payload capacity and the attendant high cost hampering production scale up ( 54 92 109 125 128 129 131 1 33 ) ; 3) poor biodegradability, causing chronic accumulation of nanomaterials in vivo ( 52 134 ) ; and 4 ) limited universality by the requirement of specific aptamer for drug loading ( 109 ) However, we have designed and engineered a DNA nanostructure able to circumvent these limitations ( 135 ) Specifically, we report an aptamer tethered DNA nanotrain (aptNTr), which is a long linear DNA nanost ructure self assembled simply from two relatively short DNA building blocks upon initiation of aptamer tethered trigger probes, through a hybridization chain reaction (HCR) ( 124 ) ( Fig ure 2 1) The programmable, periodic, and biodegradable nature of these nanostructures provides unprecedented opportunities for biomedical applications ( 136 138 ) The conditional formation of aptNTrs upon initiation from engineered aptamer trigger probes ensures that each resultant nanotrain is tethered with an aptamer moiety on one end of the nanoconstruct These aptamer moieties, capable of selective recognition of cognate target cancer cells, operate like locomotives guiding a series of tandem dsDNA s Importantly, the periodically aligned boxcar segments provide a large number of spatially addressable sites allowing high capacity loading of therapeutics or bioimaging agents. These features are expected to reduce the cost for DNA preparation increase MTD reduce side effects, and improve therapeutic efficacy in cancer therapy The intrinsic biodegradability of DNA is expected to avoid the otherwise in vivo chronic accumulation of nanomaterials. Moreover, aptamers in these

PAGE 42

42 nanostructures are interchangeable, and this system should be able to apply to RNA based systems and some ot her drugs, ensuring the wide applicability of this platform. Our results show that these long aptNTrs could be easily prepared through self assembly Specific aptamer target interaction permitted selective recognition and internalization into target cance s allow ed for high drug payloads, and the drug loaded apt NTr complexes show ed high stability. AptNTrs can be constructed using aptamers targeting a variety of cancer cells, and can be loaded with many types of therapeutic or bioimaging agents, indicating the wide applicability. In addition to good biocompatibi li ty shown under our experimental conditions, these nanotrains selectively transported anticancer drug payload to target cancer cells and offloaded drug s to induce potent cyto to xicity while dramatically reducing drug toxicity in nontarget cells, indicating selective cytotoxicity and the enhancement of MTD In vivo evaluation of this TDT system using a xenograft mouse tumor model demonstrated potent antit umor efficacy and reduced side effects of drugs delivered via aptNTrs. Moreover, an array of fluorophores modified on building blocks allowed imaging of intracellular behaviors of nanotrains in target cancer cells. U pon drug offloading, drug fluorescence d equenching also served as a real time imaging and signaling mechanism of drug release at target cells Overall, these results make aptNTrs a promising and novel TDT platform for targeted cancer theranostics Results and Discussion Construction and C haracterization of A ptNTrs. As a proof of concept, two hairpin monomers (M1, M2 sequences shown in Table 2 1 ) were designed such that the stored energy in the loops is protected by the corresponding stems, preventing their polymerization in the absence o f a n initiation

PAGE 43

43 probe. To construct aptNTrs, aptamer sgc8 was chosen as a model. Sgc8 can bind to target protein PTK7, which is overexpressed on target CEM cell membrane but not on nontarget Ramos cells ( 17 76 ) To initiate NTr self assembly, a DNA trigger probe was modifi ed on the 5' end of sgc8. The selective recognition ability of this chimeric aptamer trigger probe (sgc8 trigger) was verified (Fig ure 2 2 ). Introduction of sgc8 trigger to a mixture of M1 and M2 initiates the autonomous polymerization of these building bl ocks through mutual hybridization, resulting in the self assembly of sgc8 tethered DNA nanotrains (sgc8 NTrs) (Fig ure 2 1A ). The molar ratio of sgc8 trigger to monomers in the initial reaction mixture was optimized ( Fig ure 2 3 ), and a 1:10 ratio was used in subsequent studies. The aptamer initiated nanotrain formation was demonstrated using atomic force microscopy (AFM). In contrast to unpolymerized monomers ( Fig ure 2 1A1 ), nanotrains of up to hundreds of nanometers were observed ( Fig ure 2 1A2 ). Agarose ge l electrophoresis followed by fluorescence imaging of FITC labeled on sgc8 trigger and Ethidium Bromide (EB) for all DNA species further verified the assembly of long nanotrains in the presence of sgc8 trigger ( Fig ure 2 4A ) and the incorporation of sgc8 to these nanotrains ( Fig ure 2 5 ). The long nanochains provided Selective R ecognition A bility of A ptNTrs The selective binding ability of sgc8 NTrs to target CEM cells, but n ot to nontarget Ramos cells, was verified through flow cytometric analysis ( Fig ure 2 4 B C ), providing a basis for the locomotive action of aptamer moiety guiding nanotrains toward target sites. The amplified fluorescence signal intensities of CEM cells bou nd by sgc8 NTrs further suggested the presence of multiple building blocks in one nanotrain. To study the universality of aptamers for aptNTr construction, another aptamer, AS1411

PAGE 44

44 ( 57 ) was used to construct AS1411 tethered nanotrains, which showed specific recognition of target Huh7 cells (human hepatoma cells) ( Fig ure 2 6 ). However, in this study, sgc8 NTrs were used for subsequent studies. For efficient drug transport, it is essential that macromolecular dr ug transporters be internalized by diseased cells. Previous work showed that sgc8 was specifically internalized by target CEM cells via endocytosis ( 139 ) When compared with the results of a study using sgc8 NTrs at 4 C ( Fig ure 2 7 ), TAMRA labeled sgc8 NTrs were selectively internalized into target CEM cells at physiological temperature (37 C, Fig ure 2 4 D,E ). Thus, the large sizes, selective recognition and internalization capability of aptNTrs all poin t to their potential as TDT drug transporters with high payload capacity. High D rug P ayload C apacity of A ptNTrs The sgc8 NTrs were then evaluated as carriers for cargo loading. It was previously noted that the DNA building blocks in these nanotrains provid e many spatially addressable sites for functionalization, allowing cargos to be loaded by either chemical modification or physical association. In this study, two types of cargos were loaded: 13 nm gold nanoparticles (AuNPs) and chemotherapeutic drugs. The AuNPs were attached to the thiol groups modified on the 5' ends of M1 and M2. The AuNPs loaded nanotrains were then confirmed by transmission electron microscopy (TEM) ( Fig ure 2 8 ). This allows loading nanotrains with cargos that can be conjugated with AuNPs. Chemotherapeutic drugs were also loaded on the nanotrains. Chemotherapy is still one of the primary cancer therapies, but the lack of specificity and potential side effects, as well as limited MTD and therapeutic efficacy, of these drugs ( 61 118 ) make targeted and high capacity drug transport particularly important. Several widely used anthracyc line anticancer drugs, including Doxorubicin (Dox), Daunorubicin (DNR) and

PAGE 45

45 Epirubicin (EPR), were utilized as drug cargo models. Since it is well known that these drugs can preferentially intercalate into double stranded 5' GC 3' or 5' CG 3', resulting in ( 70 109 133 ) M1 and M2 were designed such that all their sequences would form drug intercalation sites (ACG/CGT) in nanotrains, with each pair of M1 and M2 contributing an average of 16 sites. Consequently, each individual nanotrain needs only one aptamer locomotive for targeting, while all are used to carry a high payload of drug s thus reducing the amount of DNA otherwise required to transport a specific amount of drugs. Drug loading on nanotrains by intercalation, as verified by fluorescence spectrometry, showed the gradual quenching of fluorescence with increasing equivalents of sgc8 NTrs ( Fig ure 2 9 A for Dox and Fig ure 2 10 for DNR and EPR). Since the molar ratio of sgc8 trigger to M1/M2 in the initial reaction mixture was 1:10, one nanotrain should theoretically average about 160 drug loading sites. Under these conditions, drug fluo rescence with a sgc8 NTr/drug molar ratio of 1/50 was dramatically quenched ( Fig ure 2 9 A ). This verified the high drug payload capacity, and 1/50 of this ratio was used in subsequent studies. It is worth not ing that high drug payload capacity and the use o f short DNA building blocks should substantially reduce the overall cost of reproducing this type of DNA based TDT nanostructure s Dox was used as a model drug in our further study, and we next evaluated the stability of sgc8 NTr Dox complexes through a d rug diffusion experiment using mini dialysis units, and results showed negligible drug diffusion from sgc8 NTrs in contrast to fast diffusion from a free drug solution, indicating the high stability of sgc8 NTr Dox complexes ( Fig ure 2 9 B ). Furthermore, the stability and integrity of these complexes

PAGE 46

46 were also demonstrated by AFM images displaying comparable morphologies and length frequency distributions of unloaded sgc8 NTrs and sgc8 NTr Dox complexes ( Fig ure 2 1 A2, A3 and Fig ure 2 11 ). Selective D rug T ran sport ation via A ptNTrs and R eal time M onitoring of I ntracellular D rug U nloading To evaluate the selectivity of sgc8 NTrs for transport of molecular drugs, drug uptake was studied with CEM and Ramos cells ( Fig ure 2 9 C F ). Cells were treated with free Dox, as a control, or Dox transported by sgc8 NTrs, respectively, followed by microscopic examination. In addition, transferrin Alexa633 was used to locate the endosomes ( 139 ) The recovery of Dox fluorescen from nanotrains enabled the real time signaling of intracellular drug unloading. Strong Dox fluorescence signals were observed in both CEM and Ramos cells treated with free Dox ( Fig ure 2 9 C E ). When cells were treated w ith sgc8 NTr Dox ( Fig ure 2 9 D F ), Dox fluorescence intensity comparable to that of the corresponding cells treated with free Dox was observed only in CEM cells, but not in Ramos cells. This indicate s the selectivity of Dox transport mediated by aptNTrs. P r esumably Dox unloading from internalized nanotrains is through simple diffusion and facilitated by intracellular factors such as pH, ionic environment, and nuclease degradation ( 109 125 126 ) Moreover, in CEM cells treated w ith sgc8 NTr Dox, colocalization of Dox and Alexa633 signal s was observed, indicating that some Dox was unloaded after sgc8 NTr Dox was internalized through endocytosis. The cytosolic Dox signal outside the endosomes might have resulted from the escape of Dox from the endosomes or from Dox uptaken by cells following release from nanotrains at the cell membrane. To further examine the intracellular behavior s of drugs and nanotrains in target cells a fluorophore Cyanine 5

PAGE 47

47 (Cy5), was used as a model and chem ically modified on M1 and M2 to construct sgc8 NTr s. CEM cells were then treated with free Dox and sgc8 NTr Dox for different time lengths, followed by confocal microscopy observation of Dox and Cy5 fluorescence. In cells treated with free Dox ( Fig ure 2 12 A ), drug was diffused into cells within a short period of time. Whereas i n cells treated with sgc8 NTr Dox, Dox fluorescence intensity was gradually enhanced ( Fig ure 2 12 B ). Moreover, when compared with free Dox, Dox transported by aptNTrs was initially co localized with nanotrains and then gradually unloaded and distributed in other intracellular areas in a time dependent manner. Overall, sgc8 NTrs selectively delivered Dox into target cells, and fluorophores modified on nanotrains as well as drug fluorescence dequenching enabled both intracellular signaling of drug unloading and intracellular monitoring of drug and nanotrain behavior s at target cancer cells providing the basis for future theranostic applications In Vi tro S elective C ytotoxicity of A nticancer D rugs T ransported by A ptNTrs Having established that Dox can be selectively transported into target cells by nanotrains, the resultant cytotoxicity was evaluated by an MTS assay I n this assay, both target CEM cells and nontarget Ramos cells were treated with free Dox and sgc8 NTr Dox complexes, respectively. Free drug showed dose dependent cytotoxicity in both CEM cells and Ramos cells. In contrast, only in target CEM cells ( Fig ure 2 13 A,B ) did Dox transported by sgc8 NTrs induce dose depend ent cytotoxicity comparable to that of free Dox. This demonstrated the robust cytotoxic efficacy of sgc8 NTr Dox in target cells and the excellent selective cytotoxicity of this molecular drug transported by aptNTrs. In contrast, the lack of cytotoxicity o f sgc8 NTrs in either CEM or Ramos cells indicate s the biocompatibility of these transporters under our experimental conditions ( Fig ure 2 14 A ). We next studied whether aptNTrs maintained selectivity in cancer cell

PAGE 48

48 recognition as well as drug delivery under a physiological environment, where nucleases could cleave DNA based drug carriers before reaching target cells, resulting in loss in selectivity. In this study using cell culture medium containing fetal bovine serum (FBS) at 37 C, the selective recogniti on ability of sgc8 NTrs was verified using target CEM cells and nontarget Ramos cells ( Fig ure 2 14 B D), and potent cytotoxicity was confirmed for Dox delivered via sgc8 NTrs in CEM cells, but much less cytotoxicity in nontarget Ramos cells ( Fig ure 2 14 E,F) This indicates the selectivity of cancer cell recognition and drug delivery under a simulated physiological environment, providing the basis for subsequent in vivo evaluation of this TDT platform. In addition, the selective cytotoxicity of DNR and EPR tr ansported by sgc8 NTr s was demonstrated with CEM cells and Ramos cells using an MTS assay ( Fig ure 2 15 ). In nontarget Ramos cells which simulate normal tissue cells in vivo the dramatic reduction of cytotoxicities induced by drugs delivered by aptNTrs compared to free Dox suggests the increase of MTD in nontarget cells in vitro, and is expected to increase MTD of drugs transported by aptNTrs in vivo The selective and potent in vitro therapeutic efficacy indicated that aptNTr is a promising TDT platfor m. In V ivo E fficacy of A nticancer D rugs T ransported via A ptNTrs We next evaluated the in vivo therapeutic efficacy (i.e., anticancer therapeutic potency and side effects ) of anticancer drugs (Dox) delivered by this TDT platform using a CEM subcutaneous x enograft mouse tumor model, which was developed by subcutaneous injection of CEM cells in the back of NOD. Cg Prkdc (scid) IL2 mice After dorsal tumor nodules grew to 100 mm 3 mice were divided into three groups for comparative efficacy studies in which t he following regimens were administered by intravenous injections every other day: (i) sgc8 NTrs, (ii) free Dox, and (iii) sgc8 NTr

PAGE 49

49 Dox. The Dox dosage was kept the same in groups i) and ii) at 2 mg/kg, which has been reported for use in this mouse strai n ( 133 ) and the aptNTr dosage in group i) was accordingly maintained the same to that in group iii). T umor size and body weight were monitored every othe r day. R esults ( Fig ure 2 16A ) showed that, compared to blank drug carriers (sgc8 NTrs), both sgc8 NTr Dox and free Dox caused significant inhibition of tumor growth, with stronger potency of sgc8 NTr Dox formulation than free Dox. The stronger potency of s gc8 NTr Dox than free Dox was attributed to such features of aptNTrs as specific targeting ability and larger molecular weight which lead to relatively long drug clearance time from blood relatively high concentration of accumulated drugs and long drug retention time in tumor Consistently, both sgc8 NTr Dox and free Dox leaded to longer mouse survival time than sgc8 NTrs, with longer survival time in sgc8 NTr Dox treated group than free D ox treated group ( Fig ure 2 16 B). The inhibition of tumor growth a nd the elongation of mouse survival time demonstrated the potent anticancer efficacy of drugs delivered via aptNTr s One primary aim of developing TDT platforms is to reduce the potential nonspecific toxicity in normal tissues and the resultant side effect s of drugs. To study whether aptNTrs reduced the side effects of Dox, mouse body weight variations before and after drug administration were examined. Results in Figure 5C indicate that mice treated with free Dox lost significant more weight than those tre ated with sgc8 NTr Dox, while those treated with sgc8 NTrs showing slight body weight increase. These results clearly demonstrated the reduction of drug side effects using aptNTrs, as well as the biocompatibility of aptNTrs. As shown before, increased MTD of sgc8 NTr Dox compared to free Dox was demonstrated using an in vitro nontarget Ramos cells simulating normal tissue cells in vivo. We thus speculate

PAGE 50

50 that, with the use of MTD of sgc8 NTr Dox (higher than that of free Dox) stronger therapeutic potency w ould be achieved than using MTD of free Dox in this study. Detailed study of this would be our interest in future. Overall, these data demonstrated the potent antitumor efficacy and the reduced side effects of drugs delivered via aptNTr s Conclu d ing Remarks In su mmary, we have developed a new TDT platform using self assembled, aptamer tethered DNA nanotrains. This platform presents some remarkable features : 1) Easy design and preparation : automated DNA synthesis, only three DNA building blocks needed and the consequent simple DNA sequence design and preparation, and simple DNA nanotrain self assembly and aptNTr drug complex formation; 2) High payload capacity. The unique configuration of aptNTrs allowed all the duplex boxcar DNA, which posses sed many address able sites in one single nanotrain to maximally contribute to cargo loading, resulting in high payloads of drug s or bioimaging agents; 3 ) Reduction of the cost of DNA preparation in reproducing this type of drug carriers, due to a) the use of short DNAs i n aptNTrs leading to a relatively high DNA synthesis yield compared to the use of long ones, and b) the maximal contribution of DNA in aptNTrs to cargo loading resulting in the use of a relatively low amount of DNA to deliver a specific amount of cargo; 4) Aptamer tethered nanotrains allow for specific targeting in cancer therapy, as demonstrated by selective cancer cell recognition and anticancer drug delivery, selective in vitro cytotoxicity, enhanced MTD, and reduced side effects with potent antitumor ef ficacy in vivo; 5 ) Bioimaging agents coupled on nanotrains and drug f luorescence dequenching upon release allow for real time signaling of behaviors of nanotrains and drugs at target cells ; and 6 ) By simple aptamer or drug substitution, our

PAGE 51

51 design can be a pplied to a variety of target cell types and drugs. This platform should also be applicable to RNA based systems. These make this TDT platform widely applicable. Furthermore, the degradability of DNA would prevent a chronic accumulation of nanomaterials wi th MWs above the renal filtration cutoff and the long linear nanostructure of this drug transporter is expected to increase circulation time in vivo, as shown in studies using filomicelles ( 140 ) Collectively, these features are poised to make aptNTrs uniquely attractive for the development of novel TDT platforms in cancer theranostics Materials and Methods Preparation of S gc8 NTrs and D rug L oading into N anotrains Probes M1, M2 and sgc8 trigger were individually snap cooled (heated at 95 C for 3 min, incubated on ice for 3 min), and then left at room temperature for 2 h. The mixture of sgc8 trigger, M1 (5 M) and M2 (5 M) was left at room temperature for 24 h. sgc8 NTr Dox was prepared by mixing Dox (Fisher Scientific, Houston, TX) and prepared sgc8 2 (5 mM). DNA S ynthesis, L abeling, P urification and Q uantificatio n A ll DNA probes were synthesized on an ABI3400 DNA/RNA synthesizer (Applied end of these DNA probes was Fluorescein (FITC) or Biotin, unless otherwise noted. The completed sequences were then deprotecte d in AMA (ammonium hydroxide/40% aqueous methylamine 1:1) at 65C for 30 min and further purified by reversed phase HPLC (ProStar, Varian, Walnut Creek, CA, USA) on a C 18 column using 0.1 M triethylamine acetate (TEAA Glen Research Corp.) and acetonitr ile (Sigma Aldrich, St. Louis, MO) as the eluent. The

PAGE 52

52 collected DNA products were dried and detritylated by dissolving and incubating DNA products in 200 L 80% acetic acid for 20 minutes. The detritylated DNA product was precipitated with NaCl (3 M, 25 L ) and ethanol (600 L). UV Vis measurements were performed with a Cary Bio 100 UV/Vis spectrometer (Varian) for probe quantification. Cell L ines and C ell C ulture Cell lines CCRF CEM (Human T cell ALL) and Ramos (human B lymphoma) were obtained from the American Type Culture Collection (Manassas, VA). Cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (heat inactivated, GIBCO) and 100 IU/mL penicillin streptomycin (Cellgro) at 37 C in a humid atmosph ere with 5% CO 2 The cell density was determined prior to each experiment using a hemocytometer. Agarose G el E lectrophoresis Formation of the resultant aptamer tethered nanotrains was confirmed by agarose gel (3%) electrophoresis (90 V, 60 min), followed by UV imaging and fluorescent imaging using a Typhoon 9410 variable mode imager. Atomic F orce M icroscopy An AFM study was per formed on a Nanoscope IIIa (Veeco, Santa Barbara, CA) using tapping mode in ambient air. The unpolymerized M1 and M2, preformed sgc8 NTrs and sgc8 NTr Dox were diluted 50x, deposited on APS mica surfaces for 3 min, rinsed with double distilled H 2 O and drie d using argon gas. The radius of curvature of the silicone tip was about 10 nm. Topographic images were obtained with 512 x 512 pixels 2 at a scan rate of 2 Hz. To calculate the frequency distributions, the lengths of nanotrains were measured using the Imag eJ software.

PAGE 53

53 Transmission E lectron M icroscopy (TEM) S tudy of AuNP L oaded N anotrains Samples were prepared by incubating AuNPs (13 nm) with preformed aptNTrs, in which M1 and M2 were labeled with thiol, for 1 h. The resultant sample was placed on a copper grid, and dried at room temperature. TEM images were obtained on a Hitachi H 7000 NAR transmission electron microscope. Afterwards, the samples were imaged by using TEM at a working voltage of 100 kV. Drug L oading S tudy by F luorescence S pectrometry The dru g loading was monitored by fluorescence spectrometry (Ex: 480 nm), using a Fluorolog Tau 3 spectrofluorometer (Jobin Yvon, Edison, NJ). Stability of S gc8 NTr Dox by a D rug D iffusion A ssay Free Dox (30 M, 300 L) and sgc8 NTr Dox (30 M Dox equivalent, 300 L) were prepared and transferred into MINI Dialysis Units (3.5 MWKO, Thermo Scientific, Waltham, MA). Each unit bottom was immersed in 3 mL PBS buffer (supplemented with 5 mM Mg 2+ ) in an individual well of a 12 well plate, with a magnetic rod at the b ottom of each well. The plate was placed on a magnetic stirrer (130 rpm). At the indicated time points, a 120 L aliquot was collected from each well for Dox fluorescence measurement (Ex: 480 nm; Em: 590 nm) using a Fluorolog Tau 3 spectrofluorometer (Jobi n Yvon, Edison, NJ). The collected samples were then returned to the corresponding wells. Data points for each sample were fit by nonlinear regression using Origin 8 software to a first order release model: F released exp( ln(2) t / t 1/2 )] [2 1 ] W here t is the time (h), t 1/2 is the diffusion half fluorescence intensity of the released drug.

PAGE 54

54 Laser S canning C onfocal M icroscopy I maging All cell fluorescent images were collected on a Leica TCS SP5 confocal microscope (Leica Microsystems Inc., Exton, PA) with a 100x oil immersion objective and Leica Confocal Software. Cells were observed in DIC mode. Ar 488 nm, He Ne 543 and He Ne 633 nm lasers were used for excitations of Dox, TAMRA and Alexa633 or Cy5, respectively. Cells (2 10 5 in 200 L medium) were incubated with sgc8 NTrs, free Dox or sgc8 NTr Dox for 2 h. Cells were washed with washing buffer, suspended in medium (200 L), treated with transferrin alexa633 (60 nM), and incubated for 0.5 h. The resultant cells were washed and resuspended in binding buffer for microscopic observation. Internalization A ssay U sing F low C ytometry The internalization of TAMRA labeled aptNTrs into cells was studied by incubating sgc8 NTrs (120 nM aptamer equivalents ) with cells (210 5 ) in bindi ng buffer (200 L) at 37 C. The internalization was terminated by putting cells on ice. Cells were washed with washing buffer, trypsinized (if applicable) with trypsin EDTA (1X, 500 L, Cellgro, Manassas, VA) for 15 min, washed twice with washing buffer, and suspended in binding buffer (200 mL). The TAMRA fluorescence intensities of cells were then determined by flow cytometric analysis on a FACSAria II system (BD Bioscience, Franklin Lakes, NJ). Data were analyzed with FCS Express 4 software (De Novo Soft ware, Los Angeles, CA). Binding A ssay U sing F low C ytometry The binding abilities of DNA probes or sgc8 NTrs were determined by incubating dye labeled aptamers or as prepared aptamer tethered nanotrains (200 nM aptamer equivalents ) with cells (210 5 ) in bi nding buffer or cell culture medium (200 L)

PAGE 55

55 containing FBS (10%) on ice or at 37 C for 30 min, followed by washing with washing buffer and suspending in binding buffer (200 L). Random sequences (lib) were used as controls. The fluorescence intensities of cells were determined with a FACScan cytometer (Becton Dickinson Immunocytometry S ystems, San Jose, CA). Data were analyzed with the WinMDI or the FlowJo software. In V itro C ytotoxicity A ssay In vitro c ytotoxicity was determined using CellTiter 96 Cell Proliferation Assay (Promega, Madison, WI, USA). Briefly, cells (510 4 cells/well) were treated with sgc8 NTrs, free drug, or drug loaded on sgc8 NTrs (sgc8 NTr drug) in medium ( without FBS unless denoted otherwise; 37 C ; 5% CO 2 ) for 2 h; then cells were precipitated by centrifugation. 80% supernatant medium was removed, and fresh medi um (10% FBS, for 1 2 h. The absorbance (490 nm) was recorded using a plate reader (Tecan Safire microplate reader, AG, Switzerland). Cell viability was calculated as described by the manufacturer. In V ivo A nticancer E fficacy E valuation NOD. Cg Prkdc (scid) IL2 mice were purchased from Jackson Laboratory (Bar Harbor, ME) and maintained under pathogen free conditions. The animal use protocol was approved by the University of Florida Institutional Animal Care and Use Committee on animal care. The mouse xenograft tumor model was developed by subcutaneously injecting 8 10 6 in vitro propaga ted CEM cells (in 100 L PBS buffer) into Cg Prkdc (scid) IL2 mice on the back. Dorsal t umor nodules were allowed to grow to a volume of 100 mm 3 before treatment initiation Tumor bearing mice were randomly assigned to

PAGE 56

56 three group s, with 5 mice in each gr oup: (i ) treated with sgc8 NTrs; ( ii ) treated with free Dox; and ( iii ) treated with sgc8 NTrs D ox complexes The Dox dosage was kept the same in groups ii) and iii) at 2 mg/kg the aptNTr dosage in group i) was accordingly maintained the same to that in gr oup iii) Drugs were injected through tail vein s every other day, and tumor length and width for each mouse were measured with calipers every other day. T umor volume was calculated using the following equation : Tumor volume = length width 2 /2 [2 2] T he body weight of each mouse was also measured every other day to monitor the potential drug toxicity volume exceeded 2000 mm 3 or developed ulceration.

PAGE 57

57 Table 2 1 Sequences of DNA probes. FITC, TAMRA, or Cy5 if appl icable, were labeled at the 5' ends of M1 and M2; Thiol group was labeled at the 3 ends of M1 and M2 (In sgc8 trigger, the red sequence indicates the trigger probe, black indicates the linker, and purple indicates the aptamer. Sequences in the same colors in M1 and M2 are complementary.) Sequence s (5 3 ) M1 CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCTG CTGC M2 TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAAG CCGT Sgc8 trigger TGCTGCTGCTGCTGCTGCACGACGTTTATCTAACTGCTGCGCCGC CGGGAAAATACTGTACGGTTAGA Sgc8 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA

PAGE 58

58 Figure 2 1. Schematics of the self assembly of aptamer tethered DNA nanotrains (aptNTrs) for theranostic applications (A) S elf assembly of aptNTrs from short DNA building blocks (1) upon initiation from a chimeric aptamer tethered trigger probe. The resultant long nanotrains (2) were tethered with aptamers loaded with molecul ar drugs (3). AFM images (1 3) showed the morphologies of the corresponding nanostructures. (B) The drugs were specifically transported to target cancer cells via aptNTrs, unloaded, and induced onto nanotrains upon drug unload ing

PAGE 59

59 Figure 2 2. F low cytometr ic results indicating that sgc8 trigger maintained binding abilities to target CEM cells, but not to nontarget Ramos cells. Lib (random sequences) sgc8 and sgc8 trigger were labeled with FITC Figure 2 3 Optimization of the self assembly of aptNTrs by agarose gel electrophoresis. A series of increasing concentrations of sgc8 trigger ( 0 to 4 M as marked above each lane ) were added to mixtures of M1 and M2 ( 5 M each) followed by agarose gel electrophoresis. T he smallest initial ratio of sgc8 trigger to each monomer with the largest amount of monomers consumed is 1:10, which was used in subsequent studies

PAGE 60

60 Figure 2 4. Characterization of the formation, selective cancer cell recognition, and internalization of sgc8 NTr s (A) A garose gel electrophoresis showing the self assembly of sgc8 NTrs initiated by sgc8 trigger. (B, C) Flow cytometric results showing the selective recognition abilities of sgc8 NTrs to CEM cells ( B ), but not to Ramos cells ( C ). The presence of multiple monomers on one nanotrain resulted in signal amplification of sgc8 NTr bound CEM cells (lib, sgc8, M1, M 2: labeled with FITC; (M1+M2): unpolymerized M1 and M2.) (D,E) Confocal laser scanning microscopy images displaying the internalization of sgc8 NTrs into target CEM cells. Cells were incubated with sgc8 NTrs (100 nM sgc8 trigger equivalents ) at 37 C for 2 h, followed by transferrin Alexa633 staining. The intracellular TAMRA fluorescence signal (denoted by arrows in D ) colocalized with Alexa633 signal indicates the internalization of sgc8 NTrs (M2: labeled with TAMRA; scale bars: D : 100 m; E : 10 m)

PAGE 61

61 F igure 2 5 Verification of aptNTr formation. Images of f luorescent native agarose gel electrophoresis (same as those shown in Fig ure 2 4 ) scanned at two wavelengths showing the self assembly of sgc8 tethered DNA nanotrains initiated by sgc8 trigger and the incorporation of FITC labeled aptamer (sgc8) moiet y in nanotrains. The samples were depicted above the corresponding lanes, and t he upper band for sgc8 trigger resulted from its homodimers. ( A : all DNA species stained by EB. B : FITC on sgc8 trigger. C : merged signals) Figure 2 6 Flow cytometric analysis indicating the specific recognition of AS1411 and AS1411 NTrs to target Huh7 cells ( human hepatoma cells ). AS1411, M1 and M2 in AS1411 NTrs were labeled with FITC. Data were analyzed using the FlowJo software.

PAGE 62

62 Figure 2 7 (A,B) Flow cytometric analysis indicating the selective binding and internalization of sgc8 NTrs into target CEM cells (A), but not to nontarget Ramos cells (B). sgc8 NTrs were prepared from sgc 8 trigger, M1 and TAMRA labeled M2. Cells were incubated with sgc8 NTrs (100 nM in terms of sgc8 trigger) at 4 C or 37 C for 1 or 2 h as denoted, trypsinized if applicable, and subjected to flow cytometric analysis. Since t rypsinization digested cell surface protein, cell surface bound sgc8 NTrs were removed After trypsinization, the enhanced fluorescence intensities of CEM cells incubated with sgc8 NTrs at 37 C compared with those at 4 C indicated that these nanotrains were internalized (A). Ramo s cells incubated with sgc8 NTrs at 37 C showed little signal enhancement (B). This demonstrated the selectiv ity. Data were analyzed using the FCS Express software. (C) Confocal laser scanning microscopy images displaying the binding of sgc8 NTrs (100 nM sgc8 trigger equivalents ) on target CEM cells at 4 C for 2 h, followed by transferrin Alexa633 staining. sgc8 NTrs stayed on cell membrane (M2: labeled with TAMRA; scale bars: 100 m).

PAGE 63

63 Figure 2 8 TEM images of 13 nm gold nanoparticles loaded on sgc8 NTrs. Scale bars were as denoted

PAGE 64

64 Figure 2 9 Targeted drug transport using aptNTrs with high payload capacity and stability (A) Fluorescence spectra of Dox (2 M) with increasing equivalents of sgc8 NTrs (from top to bottom). (B) F luorescence int ensities of Dox diffused from free Dox or sgc8 NTr Dox (Dox: 30 M) during dialysis to outside PBS buffer. Data were fit to a drug release model (solid line ). (C F) Confocal laser scanning microscopy images displaying the intracellular signaling of drug an d selective drug transport to target cells by sgc8 NTrs. CEM cells ( C, D ) and Ramos cells ( E, F ) were treated with free Dox ( C, E; 2 M) and sgc8 NTr Dox ( D, F; 2 M Dox equivalents ) (Insets: enlarged cells )

PAGE 65

65 Figure 2 10 F luorescence intensities of molecular drugs ( 2 M) with increasing molar equivalents of sgc8 NTr s The fluorescence quenching indicated that drugs were loaded into sgc8 NTrs. (Ex: 480 nm; Em: 590 nm) Figure 2 11 Stability and integrity of Dox loaded with sgc8 NTrs. (A B) AFM images depicting the morphologies of unloaded sgc8 NTrs and sgc8 NTrs loaded with Dox. (C) Frequency distributions of length range of nanotrains. The comparable morphologies and length frequen cy distributions of unloaded nanotrains and nanotrains loaded with Dox demonstrated the integrity and stability of sgc8 NTr Dox.

PAGE 66

66 Figure 2 12 C onfocal laser scanning microscopy images displaying the time dependent intracellular behaviors of free Dox (A ), and Dox and aptNTrs delivered by sgc8 NTr Dox (B) in CEM cells. (A) CEM c ells were treated with free Dox (Dox: 2 M) for different time lengths, as denoted on the left. The Dox fluorescence intensity kept constant within the time length studied, and the drug was distributed evenly within a short period of time (B) CEM c ells were treated with sgc8 NTr Dox ( 2 M Dox equivalents ) for 0.5 h, 1 h, 2 h, and 3 h. The intracellular Dox fluorescence intensity of cells was gradually enhanced, indicating g radual Dox unloading from sgc8 NTrs. Dox was initially colocalized with nanotrains and then gradually distributed in other cytoplasmic areas (M1 and M2: labeled with Cy5; [Dox]/[sgc8 NTr]=50:1; scale bar: 20 m)

PAGE 67

67 Figure 2 13 Selective cytotoxicity of molecular drugs (Dox) transported by aptNTrs. (A, B) MTS assay results showing that Dox transported by sgc8 NTrs (sgc8 NTr Dox) selectively induced potent cytotoxicity and inhibited cell proliferation in target CEM cells ( A ), but not in nontarget Ramos cells ( B ), in contrast to nonselective cytotoxicity induced by free Dox in both target and nontarget cells

PAGE 68

68 Figure 2 1 4 Selective cancer cell recognition ability of aptNTrs and selective cytotoxicity induced by Dox delivered via biocompatible aptNTr s, under simulated physiological environment. (A) MTS assay results suggesting no apparent cytotoxicity induced by sgc8 NTrs in CEM cells and Ramos cells, indicating good biocompatibility of DNA nanotrain based drug transporters. (B D) Flow cytometric anal ysis indicating the selective recognition of sgc8, sgc8 trigger, and sgc8 NTrs to target CEM cells (B,C), but not to nontarget Ramos cells (D), both in binding buffer (B) and in FBS (10%) containing cell culture medium (C,D), at 37 C. lib: random sequences; lib, sgc8, sgc8 trigger, M1 and M2 in sgc8 NTrs were labeled with FITC. Data were analyzed using the FlowJo software. (E, F) MTS assay results showing in FBS (10%) containing cell culture medium, the selective cytotoxicit y of Dox transported by sgc8 NTrs in target CEM cells (E), but much less cytotoxicit y in nontarget Ramos cells (F), compared to nonselective cytotoxicity induced by free Dox in both CEM cells and Ramos cells Compared to the same assay using cell culture medium without FBS, th e loss of some viability of Ramos cells treated with sgc8 NTr Dox is presumably due to the nuclease cleavage of sgc8 NTrs during 2 h incubation.

PAGE 69

69 Figure 2 1 5 MTS assay results showing the t argeted cytotoxicit ies of molecular drugs DNR (A, B) and EPR (C, D) transported by sgc8 NTrs compared with that of the corresponding free drugs, using target CEM cells (A, C) and nontarget Ramos cells (B, D)

PAGE 70

70 Figure 2 1 6 Potent antitumor efficacy and reduced side effects of drugs transpor ted via aptNTrs. CEM xenograft mouse tumor model was developed by subcutaneous injection of CEM cells in the back of NOD. Cg Prkdc (scid) IL2 mice Mice were divided into three groups that are respectively treated by intravenous injections of (i) sgc8 NTrs (ii) free Dox and (iii) sgc8 NTr Dox, with 2 mg/kg Dox or Dox equivalent dosages in ii) and iii) and accordingly 23 mg/kg sgc8 NTrs in i) (A) Tumor volume up to day 1 0 after treatment initiation (mean s.d.; n = 5 ). A sterisk on day 10 represents signi ficant differences between tumor volumes of free Dox and sgc8 NTr Dox treated mice ( *p < 0.05 n = 5; Student s t test) (B) S urvival percentage of mice after treatment initiation (C) Mouse body weight loss at day 10 compared to day 0, after treatment in itiation (mean s.d.; n = 5 ) A sterisk represents significant differences between weight loss of free Dox and sgc8 NTr Dox treated mice ( ***p < 0.001 n = 5; One way ANOVA with Newman Keuls post hoc test).

PAGE 71

71 CHAPTER 3 BUILDING FLUORESCENT DNA NANO DEVICES ON TARGET LI VING CELL SURFACES S i gnificance and Background C ell membrane is the interface of the intracellular and extracellular environment s where intracellular biological activities are regulated via signal transduction between membrane bo und receptors and signaling molecules, including hormones, neurotransmitters, or therapeutics from complex extracellular environment s. ( 141 ) In situ analysis and regulation of these key role players is necessary for both 1) a complete, comprehensive understanding of biological pathways with high spatial and temporal resolution and 2) specific biological and therapeutic applications. Previous tactics to accomplish these goals have involved cell surface engineering through genetic approaches ( 142 143 ) and chemical modification. ( 144 153 ) C ell surface modifi cation with proteins has typically been achieved through genetic engineering, i n which cells are transformed with plasmid s or transfected with viruses containing genes that encode proteins of interest. This results in protein express ion and secret ion, and hence, modification of cell surfaces with recombinant proteins. ( 142 143 ) However, this approach suffers from intrinsic drawbacks including complex manipulation, prolonged protein expression and secretion limited range of protein targets and difficult construction of nanostructures using these proteins. ( 145 ) As an alternative chemical modification of cell surfaces with such moieties as proteins, DNA, or nanomaterials has provided a new direction for cell surface Note: this work was repinted with permission from: Zhu G et al. (2013) Building Fluorescent DNA Nanodevices on Target Living Cell Surfaces. Angewandte Chemie International Edition 52(21):5490 5496.

PAGE 72

72 engineering. ( 144 150 152 153 ) The interface of chemistry, material sciences and biomedical sciences has provided many opportunities to modify and manipulate cells ( 145 150 152 154 155 ) For example, using Staudinger ligation Bertozzi et al. modified mammalian cell surfaces wit h DNA and imparted specific recognition capability to cells, enabling programmed assembly of 3 dimensional microtissues ( 148 ) Similarly, Peterson et al. modified cell surfaces with artificial human Fc receptor, which can recognize the Fc region of human IgG and internalize this antibody ( 156 ) However, this approach is often associated with complicated chemical reactions, potential harmful effects on cells, and limited ability to modify specific target cells under complex environments. Beyond these strategies, DNA combined with nucleic acid aptamers offers a simple method to engineer n anodevices in situ on target cell surfaces. Owing to unique Watson Crick base pairing and sequence programmability, oligonucleotides have been extensively explored as building blocks for the construction of various DNA nanostructures. ( 123 ) Selected through a process known as Systematic Evolution of Ligands by EXponential e nrichment (SELEX) aptamers which are single stranded DNA or RNA can bind cell specific biomarkers on target cell surfaces with high affinit ies ( 4 5 157 ) Thus, aptamers make excellent molecular pr obes for selective recognition and can provide the basis for selective modification and manipulation of target cell surfaces under complex environments. Based on aptamer tethered DNA nanodevices (aptNDs) we developed 1) the anchoring of preformed fluoresc ent aptNDs and 2) the in situ self assembly of fluorescent aptNDs on target living cell surfaces ( 158 ) Fluorescen ce has been

PAGE 73

73 at tractive for noninvasive sensing in living cells and the ability of pin point modification of DNA with fluor ophores enable s versatile application of fluorescence in DNA nanotechnology. The aptND is a long linear DNA nanostructure self assembled via a hybr idization chain reaction (HCR) ( Figure 3 1 ), by which many DNA nanoassemblies have been constructed ( 124 137 ) T he dsDNA portions in the preformed nanodevices work like a series of train boxcars, which can be loaded with fluorophores by either chemical modification on ssDNA monomers or p hysical association with dsDNA, while t he aptamer moieties can guide the nanodevices to target cell surfaces. T he features of multiple, repetitive and alternating DNA b uilding blocks in the resultant aptNDs provide an excellent platform for appropriate po sitioning of multi chromophore arrays or multi componen t nanofactories, ( 137 150 159 160 ) implicating the future in situ construction of nanofactories on target living cell surfaces for pinpoint biomolecular/pharmaceutical analysis or manipulation of biological activities. Results and Discussion A nchoring of P reformed F luorescent A ptNDs We first designed two partially complementary hairpin monomers, M1 and M2 to construct aptNDs. These self assembled nanodevices were anchored to the target cell surface as proof of concept. T he stored energy in each loop of mo nomers was protected by the corresponding stem, preventing their hybridization and polymerization in the absence of an initiator trigger probe. Aptamers sgc8 and TDO5 were chosen to construct our model aptNDs. Sgc8 binds to target protein PTK7, which is ov erexpressed on target CEM cell surface s but not on nontarget Ramos cell surfaces. ( 76 ) TDO5 binds to th e heavy chain of immunoglobulin M, which is overexpressed on Ramos cell surfaces, but not on CEM cells. ( 18 42 )

PAGE 74

74 To engineer aptamer tethered probes to trigger the self assembly of na nodevices, a DNA initiator probe was modified on the 5' ends of aptamers (aptamer trigger; see sequences in Table 3 1). The specific targeting abilities of the chimeric aptamer trigger probes were verified with a binding assay ( Figure 3 2 ). Upon the initia tion of aptamer trigger probes, nanodevices were self assembled in a cascading manner from M1 and M2 via HCR ( Figure 3 1A), as confirmed by agarose gel electrophoresis ( Figure 3 3 A). Nanodevices were observed only in mixed monomers in the presence of aptam er trigger probe, which further verified the conditional nanodevice formation and assured the presence of aptamer on the end s to guide all nanodevices, providing the basis for specific recognition. The gel results also confirmed that one aptND carr ied mult iple monomer s, working like train boxcars, as indicated in Figure 3 1A which were implemented for chemical labeling (covalent) of multiple copies of fluorophores or physical association (noncovalent) with multiple fluorogenic dsDNA intercalating fluorophores on each nanodevice. C orresponding to the different types of fluorescence signal transduction widely used in bioanalysis three different types of fluorescent aptNDs were constructed and selectively anc hored on target cell surfaces: 1) a chemically modified fluorescent aptND, in which fluorophores were chemically modified on the end s of monomers; 2) a label free fluorescent aptND, in which fluorogenic molecules were physically associated with dsDNA boxca rs ; and 3) a FRET aptND, in which two fluorophores were chemically modified on monomers and physically associated with boxcar, respectively, to enable energy transfer between the two ( Figure 3 1A).

PAGE 75

75 Chemically modified F luorescent A ptNDs To build chemicall y modified fluorescent aptNDs, monomers were labeled with f luorescein isothiocyanate (FITC) as a model. Nanodevice formation was confirmed by agarose gel electrophoresis ( Figure 3 4 A ). To test whether these nanodevices, each carrying multiple copies of flu orophores, could be anchored on target cell surfaces, a binding assay w as performed using flow cytometry The sgc8 and TDO5 tethered DNA nanodevices were studied with CEM and Ramos cells. Compared with target cells incubated with FITC labeled aptamers only those cells incubated with the corresponding aptNDs displayed significant enhancement of fluorescence intensity, whereas nontarget cells did not ( Figure 3 3B, C ). This indicates that these aptNDs were anchored selectively on their corresponding targe t cell surfaces. In addition since a single nanodevice was loaded with multiple copies of fluorophore s nanodevice anchored target cells displayed enhanced fluorescence intensities compared to the corresponding cells labeled with aptamers only The less f luorescence intensity enhancement (ca. 10 fold) shown in flow cytometric results than theoretical estimation (20 fold, based on 1:10:10 of aptamer trigger: M1: M2 molar ratio), is presumably due to the self quenching of FITC on nanodevices or some dissocia tion of nanodevices from cell surfaces prior to measurement. C onsistently, in confocal microscopy stud y high fluorescence intensities were observed on surfaces of aptND labeled target cells ( Figure 3 3 D E ) again demonstrating that aptNDs were selectively immobilized on target cell surfaces. The higher fluorescence intensity of Ramos cells labeled with TDO5 N D s, compared to CEM cells labeled with sgc8 N D s, presumably results from the higher receptor density of TDO5. ( 17 18 161 ) When another fluorophore, Quasar 570

PAGE 76

76 was utilized to construct chemically modified fluorescent sgc8 NDs, the y were also successfully anchored on the target CEM cell surface s ( Figure 3 5 ). L abel f ree F luorescent A ptND s We next studied building label free fluorescent DNA nanodevices on target cell surfaces. The development of label free fluorescent devices avoids chemical modification and allows for real time signal monitoring. ( 159 162 ) Man y of these devices were constructed based on the noncovalent interaction o f dsDNA and fluorogenic dyes including YOYO 1, TOTO 1, and EvaGreen, which are capable of intercalating into dsDNA with relatively high affinities compared to ssDNA resulting in a dramatic enhancement of fluorescence intensi ty. ( 163 165 ) As a result of its low cell permeability and low background signal, E vaGreen (EG), a dsDNA bisintercalator with high binding affinity and no apparent sequence dependence, was utilized in this study. AptNDs were prepared using non labeled M1 and M2. The fluorogenic property of EG was demonstrated using the resultant aptNDs ( Figure 3 6 ). Label free fluorescent nanodevices were constructed by mixing EG and aptNDs to allow EG intercalation into aptNDs. T he signal to noise ratio (S/N) of this nanodevice was optimized ( Figure 3 7 ), and a n EG: aptND molar ratio of 40: 1 was used in the subsequent study. The EG intercalated aptNDs were then evaluate d for selective anchoring on cell surfaces As shown by flow cytometric data in Figure 3 8 EG intercalated sgc8 NDs were selectively anchored on target CEM cell surfaces, but not on nonta rget Ramos cells Similarly, EG intercalated TDO5 NDs were selectively anchored on target Ramos cell surfaces, but not on nontarget CEM cells. Th is demonstrates the selective anchoring of label free fluorescent nanodevices on cell surfaces.

PAGE 77

77 FRET A ptND s We then studied building FRET nanodevices on living cell surfaces In nature, FRET is utilized by photosynthesis systems to improve efficiency and wavelength sensitivity. ( 166 ) For instance, phycobiliprotein s can capture light energy, which is then passed on to chlorophylls ( 167 ) T the length scales in FRET based platforms to distances on the order of <10 nm ( 168 ) The ability of FRET to shift emission wavelengths enables the excitation of a wider range of fluorophores with limited laser sources in b ioanalysis. Indeed, based on FRET, a panel of multifluorophore conjugates ( e.g. phycoerythrin Cy5.5) has already been developed. ( 169 ) Moreover, FRET has been widely used to construct activatable biosensors In a similar manner, our FRET nanodevices were constructed to capture one form of energy and pass it on. Structurally, this was made possible by the programmability of aptNDs and the tandem positioning of multiple FRET components by both covalent and noncovalent means ( Figure 3 4 B). In this nanodevice, EG ( energy donor ) was intercalated into dsDNA boxcars in aptNDs and Cy3 ( energy acceptor ) was chemically modified on the 3 ends of M1 and M2. The intercalated EG was designed to work as an antenna to absorb short wavelength light and then transfer the energy to nearby densely positioned and evenly distributed Cy3 on the aptNDs Since each monomer contains 48 bases, the distance between EG and Cy3 molecules in the boxcars of aptNDs would theoretically be no longer than one fourth of the length of one monomer, which is about 4 nm. T his close proximity between energy donors and ac ceptors is essential to high efficiency energy transfer. ( 168 170 ) FRET efficiency was calculated based on donor quenching Figure 3 9 A shows efficient ( ca. 89.5% ) FRET

PAGE 78

78 from intercalated EG to chemically attached Cy3 for 800 nM EG and 20 nM aptNDs. The FRET efficiency for a series of different EG concentrations was also determined ( Figure 3 9 B, gray line). We further determined the S/N by ratiometric measurement s which provide a built in correction for environmental effects ( 171 ) Figure 3 9B also displays the S/N with a series of different EG concentrations and a constant Cy3 labeled aptND concentration. Overall, these results confirmed the utility of our FRET based fluorescent nanodevices. For bioanalysis or bio reg ulation nanodevices anchored on the cell surface s depend on the flawless operation of FRET. Therefore, we next tested FRET on living cells. Using flow cytometry, th e fluorescence intensities of EG and Cy3 were monitored on target CEM cells. The high FRET efficiency of this nanodevice was verified with 488 nm excitation in buffer solution as shown in Figure 3 10 C ompared to cells modified with label free fluorescent aptNDs and Cy3 labeled aptNDs, the cells modified with the FRET aptNDs displayed reduced f luorescence signal intensity from EG ( Figure 3 9 C) but enhanced intensity from Cy3 ( Figure 3 9 D). Based on the geometric mean of fluorescence intensities obtained from flow cytomet ry the S/N was ca. 19.9. Overall, these data demonstrate that aptNDs successfully transferred energy when anchor ed on living cell surfaces and the principle of excitation of multi chromophore arrays with a single laser source provid ing the basis for future engineering and operation of related nanofactories on cell surface s to signal and regulate biological activities. In Situ Assembly of AptNDs on Target Living Cells Surfaces The ability to build preformed nanodevices on cell surfaces would allow a wide variety of sophisticated nanodevices to be constructed before being an choring on cell surface. However, s ituations arise making it difficult to transport preformed devices to,

PAGE 79

79 or anchor them on, target cells. Construction of such devices may also be hindered by the absence of local stimuli. Under these situations, in situ na nodevice assembly would be highly demanded. Thus we further exploited the i n situ self assembly of fluorescent DNA nano devices on target living cell surfaces These aptNDs were built by 1) cascading alternative hybridization of two partially complementary non hairpin monomers and 2) HCR, a relatively difficult reaction ( Figure 3 1B). In approach 1), the reaction is relatively simple, and it was used first to demonstrate the principle of in situ nanodevice assembly on target cell surfaces. A ptamer sgc8 was modified with a capture sequence (sgc8 cap) to work as the seed probe for nanodevice assembly. S gc8 cap was first incubated with target CEM cells to allow aptamer binding, and e xcess sgc8 cap was removed prior to the introduction of FITC la beled building blocks, P1 and P2 ( see sequences in Table 3 1) Subsequent incubation for different time periods (10 min, 30 min, 1 h, 1.5 h and 2 h) allowed in situ self assembly of sgc8 NDs starting from the initiator aptamer seed probes bound on the cell surfaces. The resultant cells were washed and subject ed to flow cytometric analysis. As shown in Figure 3 11 A C after the introduction of building blocks the fluorescence intensities of CEM cells increased with increas ing incubation time, indicating the cascading self assembly of fluorescent DNA nanodevices on cell surfaces. In contrast, the control aptamer, TDO5, did not allow nanodevice assembly on nontarget CEM cells, suggesting the selectivity of in situ self assembly. In approach 2) i n situ nanodevice assembly w as carried out via HCR. Compared with the approach 1) HCR is a slow reaction which requires strand displacement in each elongation step, and previous studies have usually performed HCR in a nonliving

PAGE 80

80 cell environment without the requi rement for rapid kinetics. To study such reaction in a living cell environment, sgc8 trigger seed probes were incubated with target CEM cells to allow aptamer binding followed by the removal of excess sgc8 trigger and introduction of FITC labeled M 1 and M 2. The continuous enhancement of fluorescence intensities indicated the progressive in situ self assembly of fluorescent DNA nanodevices on target cell surfaces ( Figure 3 11 B, D ). In contrast, no nanodevice assembly took place on nontarget CEM cells by TDO5 initiator probe, indicating selectivity. C ompared to the approach 1) t he relatively slow enhancement of fluorescence intensities in flow cytometric results also suggests that in situ nanodevice assembly by HCR is a relatively slow process. We further investigated in situ assembly of sgc8 NDs on target cell surfaces in cell mixtures containing both target cells (CEM) and nontarget cells (Ramos). A biotinylated aptamer TDO5, combined with streptavidin conjugated PE Cy5.5, was utilized to label Ramos cells. Again, sgc8 trigger was first incubated with cell mixtures, followed by removal of excess probes in solution and then introduction of FITC labeled M1 and M2. The resultant solutions were incubated at room temperature for a series of time leng ths to allow in situ nanodevice assembly by HCR, which was terminated by washing away free probes. TDO5 was introduced 30 min before the end of assembly, followed by removal of free aptamers and introduction of streptavidin conjugated PE Cy5.5. The resulta nt cell solutions were observed using confocal microscopy. As shown in Figure 3 12 with increasing assembly time, increasing FITC fluorescence intensities were observed on target CEM cell surfaces (not labeled with TDO5), while Ramos cells (labeled with T DO5) did not display FITC signal. This clearly demonstrated selective

PAGE 81

81 fluorescent nanodevice assembly in situ on living target cell surfaces in a complex mixture The ability of in situ self assembly of nano devic es on target cells in cell mixtures using a slow reaction is anticipated to be useful in localized engineering of complex biological nanofactories for biomolecule detection and regulation of biological pathways. C onclu d ing Remarks To achieve the long term goal of pinpoint bioanalysis or manipulation of biol ogical activities on target living cell membranes in complex extracellular environments, we have successfully built fluorescent DNA nanodevices on target living cell surfaces by anchoring preformed model nanodevices and by in situ self assembly of nanodevi ces. These fluorescent DNA nanodevices consisted of aptamer tethered nanodevices formed by cascading polymerization of monomeric building blocks. The concept of tethered aptamer moieties on nanodevices ( a ptNDs) provide s the basis for selectively building nanodevice s on target cell surfaces through specific aptamer target interaction. The features of multiple, repetitive and alternating DNA building blocks in nanodevices provide an excellent platform for appropriate loading and positioning of multi compone nt molecular arrays through either chemical modification or physical association. Based on this a ptND platform, three types of fluorescent DNA nanodevices were self assembled as models and successfully anchored on target cell surfaces: chemically labeled f luorescent nanodevices, label free fluorescent nanodevices, and FRET nanodevices. We further demonstrated the principle of in situ self assembly of nanodevices on target cell surfaces in heterogeneous cell mixtures. The ability of nanodevice s to be self as semble d in situ on target living cells under a complicated environment could be useful in localized engineering of complex biological

PAGE 82

82 nanofactories on cell membranes for bio analysis and the regulation of biological activities Both fluorescence signaling a nd fluorescence activity of energy transfer were shown to be functional in these nanodevices. In the future, w e envision that building nanodevices on target living cell surfaces could be useful for real time tracking of target cell s or sensing analytes in extracellular environments cell surface engineering, targeted drug delivery and manipulation of biological pathways. Materials and Methods DNA S ynthesis, L abel l ing, P urification and Q uantification All DNA synthesis reagents were purchased from Glen Research, and all DNA probes were synthesized on an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA, USA). FITC Quasar570, or Cy3 were synthesized on the 3 end of these DNA probes unless otherwise specified DNA sequences were deprotect ed in AMA (ammonium hydroxide/40% aqueous methylamine 1:1) at 65C for 30 min followed by purification with reversed phase HPLC (ProStar, Varian, Walnut Creek, CA, USA) on a C 18 column using 0. 1 M triethylamine acetate (TEAA, Glen Research Corp.) and acetonitrile (Sigma Aldrich, St. Louis, MO) as the eluent. The collected DNA products were dried and detritylated by dissolving and incubating DNA products in 200 L 80% acetic acid for 20 minutes. The detritylated DNA product was precipitated with NaCl (3 M, 25 L) and ethanol (600 L). UV Vis measurements were performed with a Cary Bio 100 UV/Vis spectrometer (Varian) for probe quantification. Self assembly of A ptamer tethered DNA NDs A ptamer trigger probes M 1 and M 2, were first snap cooled (heat ed at 95 C for 2 min, incubate d on ice for 2 min, then left at room temperature for 1 h ). They were then mixed (molar ratio of aptamer: M 1: M 2=1 M : 10 M : 10 M

PAGE 83

83 supplemented with 5 mM MgCl 2 and left at room temperature for 24 h The formation of nanodevices was confirmed using agarose gel ( 3 %) electrophoresis. To construct different types of fluorescent DNA nanodevices, M1 and M2 with or without the corresponding chemically modified fluorophores were utilized. Agarose G el E lect rophoresis Formation of aptamer tethered nanodevices was confirmed by agarose gel (3%) electrophoresis ( 10 0 V, 5 0 min), stained with Ethidium Bromide (EB), followed by imaging under UV irradiation Fluorescence S pectrometry The fluorescence of EvaGreen (B iotium, Inc.) and Cy3 was monitored in supplemented with Mg 2+ (5 mM) on a Fluorolog Tau 3 spectrofluorometer (Jobin Yvon, Edison, NJ). The excitation wavelength was 440 nm or 488 nm as specified. The slit width was 5 nm. In the study of FRET nanodevices, the aptND concentration was 20 nM, unless specified otherwise. FRET efficiency was calculated based on the fluorescence quenching of donor (EG), according to Equation 3 1 : FRET efficiency = 1 FDA/FD [3 1] W here the fluorescence intensity ratio of EG was calculated in the presence (FDA) and absence (FD) of acceptor Cy3 T he signal to noise ratio was calculated according to Equation 3 2: S/N= ( ( FCy3/FEG ) DA)/( ( FCy3/FEG ) D) [3 2] W here relative fluorescence intensity ratio of acceptor to donor ( FCy3/FEG ) is calculated in the presence ( ( FCy3/FEG ) DA) and absence ( ( FCy3/FEG ) D) of acceptor Cy3.

PAGE 84

84 Cell Lines and Cell C ulture Cell lines CCRF CEM (Human T cell ALL) and Ramos (Human B lympho ma) were obtained from the American Type Culture Collection (Manassas, VA). The cells were cultured in RPMI 1640 medium ( GIBCO ) supplemented with 10% fetal bovine serum (FBS) (heat inactivated, GIBCO) and 100 IU/mL penicillin streptomycin (Cellgro) at 37 C in a humid atmosphere with 5% CO 2 The cell density was determined using a hemocytometer and evaluated prior to each experiment. Flow C ytometric A nalysis Experiments were performed in buffer contain ing 4.5 g/L glucose and 5 mM MgCl 2 Sigma). The binding abilities of aptamers or preformed aptamer tethered DNA nanodevices were determined by incubating these probes or nanodevices (final aptamer or aptamer equivalent concentration: 50 nM) with the corresponding cells (210 5 ) on ice for 30 min, followed by washing twice with buffer (1 mL) and then suspending in buffer (200 L) The resultant cell solutions were subject ed to flow cytometric analysis on a FACScan cytometer (BD Immunocytometry Systems) or on a BD FACSVerse flow cytometer The molar ratio of EG/aptND for flow cytometric analysis of cells with label free fluorescent nanodevices and FRET nanodevices was 20/1. Data were analyzed with the Flow J o or FCSExpress software Random DNA sequences (lib) of the same corresponding concen trations were used as negative controls. The S / N was calculated according to Equation 3 3 : S/N= ( ( GCy3/GEG ) DA)/( ( GCy3/GEG ) D) [3 3] W here relative geometric fluorescence intensity ratio of acceptor to donor ( GCy3/GEG ) is calcula ted in the presence ( ( GCy3/GEG ) DA) and absence ( ( GCy3/GEG ) D) of acceptor Cy3 and geometric fluorescence intensities GCy3 and

PAGE 85

85 GEG were the corresponding net fluorescence intensities (with background fluorescence intensity of cells subtracted ). Confocal M icroscopy I maging E xperiments were performed in buffer containing 4.5 g/L glucose and 5 mM MgCl 2 C ellular fluorescent images were collected on the FV500 IX81 confocal microscope (Olympus America Inc., Melville, NY) with 60x oil i mmersion objective (NA=1.40, Olympus, Melville, NY) and the Fluoview analysis software or on a Leica TCS SP5 confocal microscope (Leica Microsystems Inc., Exton, PA) with a 63 x oil immersion objective and Leica Confocal Software. Cells (210 5 200 L) wer e incubated on ice with aptamers or preformed aptamer tethered DNA nanodevices followed by two wash es with 1 mL washing buffer at 4 C and resuspension in 200 L binding buffer before observation A volume of cell suspension (100 L) was dropped on poly d lysine coated 35 mm glass bottom dishes (Mat Tek Corp.), and fluorescence intensities were observed after a 3 min settling time. In S itu S elf assembly of NDs on T arget C ell S urfaces A ptamer tethered capture probes (100 nM) were first incubated with target cells on ice for 0.5 h. The resultant cells were washed twice with washing buffer (1 mL 4.5 g/L glucose and 5 mM MgCl 2 )) and then resuspended in 100 L binding buffer (with yeast tRNA (0.1 mg/mL) (Sigma Aldrich) and BSA (1 mg/mL) (Fisher Scientific) in the washing buffer ). P robes P1, P2 or M 1, M 2 (1 M each) were introduced into the resultant cell solution at different time points to allow in situ self assembly (room temperature) for a specified time and the assembly of all groups was terminated by washing cells at the same time (twice) with washing buffer (1 mL) and re suspending in binding buffer ( 100 L ). For nanodevice assembly in cell

PAGE 86

86 mixture s biotinylated TDO5 was introduced 30 min before termination of assembly followed by washing away excess probes and further incubation with streptavidin PE Cy5.5 for 20 min, prior to washing and resuspension. All the resultant samples were subjected to flow cytometric analysis or confocal microscopic observation of cell fluor escence intensities using the same instrument setting s.

PAGE 87

87 Table 3 1 Sequenc es of DNA probes. Sequences were designed using website nu pack .org. ( 172 ) Name Sequence (5' 3') Sgc8 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA TDO5 AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCC GGTG Sgc8 trigger GACCCTAAGCATACATCGTCCTTCATTTTATCTAACTGCTGCGCC GCCGGGAAAATACTGTACGGTTAGA TDO5 trigger GACCCTAAGCATACATCGTCCTTCATTTTAACACCGTGGAGGATA GTTCGGTGGCTGTTCAGGGTCTCCTCCGGTG M1 ATGAAGGACGATGTATGCTTAGGGTCGACTTCCATAGACCCTAA GCATACAT M2 GACCCTAAGCATACATCGTCCTTCATATGTATG CTTAGGGTCTAT GGAAGTC Sgc8 trigger (FRET) TGCTGCTGCTGCTGCTGCACGACGTTTATCTAACTGCTGCGCCG CCGGGAAAATACTGTACGGTTAGA TDO5 trigger (FRET) TGCTGCTGCTGCTGCTGCACGACGTTT AACACCGTGGAGGATAG TTCGGTGGCTGTTCAGGGTCTCCTCCGGTG M1 (FRET) CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCT GCTGC M2 (FRET) TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAA GCCGT Sgc8 cap GACCCTAAGCATACATCGTCCTTCATTTTATCTAACTGCTGCGCC GCCGGGAAAATACTGTACGGTTAGA TDO5 cap GACCCTAAGCATACATCGTCCTTCATTTTAACACCGTGGAGGATA GTTCGGTGGCTGTTCAGGGTCTCCTCCGGTG P1 ATGAAGGACGATGTATGCTTAGGGTCCCGACCTCGACCTACAGA GACCACAG P2 GACCCTAAGCATACATCGTCCTTCATCTGTGGTCTCTGTAGGTC GAGGTCGG

PAGE 88

88 Figure 3 1 I llustrati on of the construction of fluorescent DNA nanodevices on target living cell surface s based on an aptND platform, where A ) three types of fluorescent DNA nanodevices preformed via HCR based self assembly upon initiation by aptamer tethered trigger probes, are anchored on target cell surfaces or B ) aptamer seed probe s initiate in situ self assembly of fluorescent DNA nanodevices on target cell surfaces by either I) cascading alternative hybridization of two partially complementary monomers or II) HCR.

PAGE 89

89 Figure 3 2. Flow cytomet ric results verifying that sgc8 trigger and TDO5 trigger maintained selective binding abilit ies to target CEM and Ramos cells, respectively, but not to the corresponding nontarget cells (Ramos cells for sgc8; CEM cells for TDO5) Unmodified sgc8 and TDO5 were utilized as positive controls, and Lib (random sequences) was used as a negative control. All probes were labeled with FITC.

PAGE 90

90 Figure 3 3. Selective anchoring of chemically modified fluorescent DNA nanodevices on target cell surfaces. A, An agarose gel electrophoresis image verifying the self assembly of sgc8 NDs upon the initiation of sgc8 trigger. M1 and M2 (Lane 4) did not react unless sgc8 trigger was present. B C, Flow cytometric results indicating that fluorescent sgc8 and TDO5 nanodevices we re selectively anchored on the surfaces of CEM cells (B) and Ramos cells (C), respectively, but not the corresponding nontarget cells. Fluorescent nanodevice anchored target cells displayed enhanced fluorescence intensities, compared to cells bound by the corresponding aptamers only. D E, Confocal microscopy images indicating that fluorescent sgc8 and TDO5 NDs were selectively anchored on the surfaces of CEM cells (D) and Ramos cells (E), respectively. (Scale bar: 50 m; Lib: random sequences; lib, sgc8, T DO5, M1, M2: labeled with FITC.)

PAGE 91

91 Figure 3 4. A garose gel electrophoresis images verifying the self assembly of A) sgc8 NDs FITC, B) sgc8 NDs Cy3, and C) TDO5 N D s upon the initiation of the corresponding chimeric aptamer trigger probes. The upper band in lane 2 of C) presumably resulted from the dimerization of the TDO5 trigger.

PAGE 92

92 Figure 3 5. Anchoring of Quasar 570 labeled sgc8 N Ds specifically on target CEM cell surfaces but not on nontarget Ramos cells, as demonstrated by f low cytometric study (A) and confocal microscopy study (B) (Scale bar: 50 m).

PAGE 93

93 Figure 3 6. F luorescence enhancement of fluorogenic EvaGreen (EG) upon intercalation in to DNA aptNDs ( Final aptND concentration: 20 nM aptamer equivalent; Ex: 440 nm). Figure 3 7. S/N of label free fluorescent aptNDs for a series of different EG concentrations and aptNDs with a constant aptamer equivalent concentration An EG/ nanodevices molar ratio of 40/1 was used in subsequent studies, unless specified otherwise (Ex: 440 nm).

PAGE 94

94 Figure 3 8. Flow cytometric results indicating the s elective anchoring of label free fluorescent sgc8 and TDO5 N Ds on the corresponding target cell surface s These label free fluorescent NDs were built by intercalation of a fluorogenic dsDNA i ntercalating dye, EvaGreen, into aptNDs.

PAGE 95

95 Figure 3 9. Development and determination of the energy transfer efficiency of FRET DNA nanodevices built on target cell surfaces. A, Fluorescence spectrometric results indicating energy transfer on aptNDs with chemically labeled Cy3 (acceptor) on M1 and M2 and physically associated EG (donor) in the duplex. Arrows denote the fluorescence changes (aptNDs: 20 nM; EG: 800 nM; Ex: 440 nm). B, FRET efficiency (gray) and S/N (black) of these aptNDs with a series of EG concentrations (aptNDs: 20 nM; Ex: 440 nm). C D, Flow cytometric results indicating the anchoring of FRET aptNDs on target CEM cell surfaces by monit oring EG (C) and Cy3 (D) signals. Dotted lines denote the geometric mean fluorescence signal intensities, and arrows indicate 488 nm).

PAGE 96

96 Figure 3 10. Fluorescence spectrometric results verifying energy transfer from physically associated EG in the duplex boxcars to chemically labeled Cy3 on M1 and M2 on the linear aptNDs platform. FRET efficiency was calculated as 94.8% (Ex: 488 nm).

PAGE 97

97 Figure 3 11. Flow cytometric analysis (A, B) and statistical analysis of the geometric mean fluorescence intensities (Gmean) (C, D) of target CEM cells with sgc8 NDs assembled in situ on cell surfaces by a time series. Nanodevices were self assembled via cascading alte rnative hybridization of two FITC labeled partially complementary DNA strands (A, C; approach I), or HCR of two FITC labeled monomers (B, D; approach II). The increase of fluorescence intensities indicates progressive nanodevice assembly (P1, P2, M1, and M 2: labeled with FITC). Also see color graph of A and B in Supporting Information Figure S8.

PAGE 98

98 Figure 3 12. Confocal microscopy images displaying the progressive assembly of fluorescent nanodevices (sgc8 NDs) through HCR for 0.5 h (A), 1 h (B), 1.5 h (C) 2 h (D), 2.5 h (E) and 3 h (F), in situ on surfaces of target CEM cells in a cell mixture also containing nontarget Ramos cells, which were labeled with Cy5.5 conjugated TDO5. (Scale bar: 100 m; M1, M2: labeled with FITC)

PAGE 99

99 CHAPTER 4 N ONCANONICAL SELF ASSEMBL Y OF MULTI FUNCTIONAL DNA NANOFLOWERS FOR BIOMEDICAL APPLI CATIONS S i gnificance and Background Owing to the unique feature of predictable Watson Crick base pairing, DNA has emerged as a building block material for a wide variety of DNA nanostructur es, in which the built in functionalities enable the applications in biomedicine, biotechnology, and nanoelectronics ( 121 122 173 174 ) Conventional approaches to DNA nanostructure construction typically rely on bottom up assembly through Watson Crick base pairing between short DNA building blocks. However, these approaches have some intrinsic drawbacks, including 1) complicated design resulting from the myriad of different DNA strands needed to assemble relatively large and sophisticated nanostructures; 2) the large amount of DNA needed for bulky preparation; 3) the limited compaction result ed from steric hindrance of DNA strands notwithstanding highly compact DNA is typically favored for applications in nano therapeutics and bio imaging nanoassemblies ; 4) the extensive intrinsic nicks i.e., broken phosphodiester bonds in the DNA backbone of each short building block which serve as potential cleavage sites of many exonucleases ( 175 177 ) thus posing a threat to stability in biomedical applications; and 5) dissociation that accompanies denaturation or extremely low concentrations such as that in an in vivo circulation system, resulting in loss of nanostructure integrity. Therefore, it would be highly desirable to assemble densely compacted multifunctional DNA nanostructures using elongated non nicked building blocks made from a low amount of only a few DNA strands, without relying on Watson Crick b ase pairing. Towards this end, nature provides instructional examples. Specifically, in the nuclei of a living organism, a tremendous amount of genomic dsDNA is densely

PAGE 100

100 compacted in a manner that does not rely on Watson Crick base pairing For example, in a typical somatic human cell, 46 chromosomal dsDNAs with a total length of about one meter, carrying more than 30,000 genes, can be assembled into a single nucleus particle of tens of cubic micrometers ( 178 ) Th is dense DNA compaction is attributed to the highly ordered alignment of chromosomal DNA with the assistance of sophisticate d cellular machinery which allows long chromosomal DNA to be sequentially assembled to nucleosomes, beads on a ring DNA fibers and eventually typical X shaped chromosome structures ( 179 ) Likewise, in a a type of flagellate protist t he DNA concentration in the nucleus was estimated to be up to 200 mg / m L, which is up to 80 times more than that in a human somatic cell ( 180 ) These densely packed genomic DNAs were documented to be liquid crystalline, a characteristic feature of highly ordered and densely packed molecular assemblies ( 180 182 ) Ind eed, in vitro synthetic short dsDNAs with concentrations equivalent to genomic DNA in nuclei were reported to be liquid crystalline as well, and these highly concentrated and orderly aligned DNA s self assembled into segregated structures in a manner of end to end stacking that does not rely on Watson Crick base pairing ( 183 187 ) Inspired by nature we present herein the noncanonical self a ssembly of hierarchical DNA nanoflowers (NFs) with densely packed DNA and built in multifunctional moieties for biomedical applications (Fig ure 4 1). Using only a low amount of two DNA strands (one designer template and one primer), long building blocks we re generated through Rolling Cycle Replication (RCR), an isothermal enzymatic reaction involv ing the replication of many circular genetic DNA s (e.g. plasmids or viral genomes ( 188 ) ), the regulation of some eukaryotic tandem genes ( 189

PAGE 101

101 190 ) and applications in scientific research and biotechnology ( 173 176 191 195 ) Without reli ance on Watson Crick base paring NFs were self assembled through liquid crystallization of the resultant long non nicked building blocks, instead of conventional ly us ed short DNA The sparsity of nick sites in the elongated building blocks and the compact ness of DNA in NFs are expected to increase the resistance of NFs to nuclease degradation, denaturation, or dissociation at low concentrations. The exceptional biostability was demonstrated by the maintenance of NF structural integrity under the treatment with nucleases, human serum, high temperature, urea, or dilution, and is anticipated to make NFs amenable for versatile future applications, especially under biomedical situations. The NFs are monodisperse and size tunable, with diameters ranging from 200 nm to up to 4 m by adjusting such parameters as reaction time or template sequences. The ability to fine tune NF sizes and construct NFs using essentially any designer templates suitable for RCR will allow versatile future appli cation of NFs. By rational design of RCR templates, the elongated DNA building blocks can carry a large amount of concatemer structural and functional moieties, which were further compacted into NFs. In our proof of principle study, we have successfully in corporated functionalities including aptamers, fluorophores, and drug loading sites into NFs. The as prepared NFs were capable of selective cancer cell recognition, cell bioimaging, and targeted anticancer drug delivery. Overall, driven by DNA liquid cryst allization, these self assembled DNA NFs are promising for versatile biomedical applications.

PAGE 102

102 Results and Discussion Self assembly of Monodisperse, Size tunable, and Densely Packed Multifunctional DNA NFs To generate building blocks of NFs through RCR, 29 DNA polymerase, which is capable of processive DNA replication with a circular template, was used. The high efficiency and strand displacement ability of 29 is critical to generate long and non nicked DNA strands. Since the templates for RCR can be tai lor designed, various structural and functional moieties can be incorporated into templates and further built in RCR products. Indeed, DNA functional moieties have been intensively explored, including specific recognition elements (e.g., aptamers), therape utics (e.g., antisense oligonucleotides ( 196 ) aptamers ( 15 ) and immunostimulatory CpG motifs ( 197 ) ), and specific drug association sequences (e.g., double stranded CG or GC sequences for anthracycline drugs ( 70 ) ). In this study, to construct NFs with built in multifunctionalities, the RCR template ( T 1 sequence shown in Table 4 1 and predicted structure in Figure 4 2 A ) was designed such that the resultant RCR products would be decorated with a series of aptamers and drug loading sites for Doxorubicin (Dox), a widely used chemotherapeutic for many typ es of cancer. The concatemer aptamers in elongated ssDNA are expected to enhance the binding affinity of the resultant NFs to target cells through synergistic multivalent binding, and provide insight for future construction of NFs incorporated with therape utic aptamers. The tremendous drug association sequences in NFs are expected to endow NFs with high drug payload capacity. Aptamer sgc8, which can specifically recognize PTK7 overexpressed on various types of cancer cells ( 17 76 ) was used as a model. A flow cytometry study verified the selective recognition ability of the monomeric template complement to target CEM cells

PAGE 103

103 (T cell leukemia), but not to nontarget Ramos cells (B cell lymphoma) ( Figure 4 3 ). T 1 was circularized using a ligation template and a T4 DNA ligase. The resultant circular template was then used in RCR, in which the previous ligation template also served as the primer (Figure 4 1 ). The primer was then elongated by 29 to generate DNA with a myriad of aptamers and drug loading moieties ( Figure 4 2 B). The enzymatic reaction was verified using gel electrophoresis ( Figure 4 4 A). Despite the high stability of the 3 way junction structure of T 1 ( Figure 4 2 A), the robust strand displacement ability of 29 allowed it to overcome the topologica l constraints and efficiently generate DNA, which is consistent with previous reports ( 194 ) The above generated DNA then served as building blocks to assemble NFs. RCR products obtained after reaction for n hours were denoted as RCR n Scanning electron microscopy (SEM) observation indicated that NFs were formed in RCR 10 with diameters of about 200 nm and pe tal like structures on the surfaces ( Figure 4 5 A). NFs from RCR 10 are monodisperse, as shown in SEM images in a zoomed out view an d determination with dynamic light scattering (DLS) in a bulky solution ( Figure 4 5 B). DLS results revealed an average radius of 112 12 nm, which is consistent with the SEM data. Characterization of RCR 10 using transmitted electron microscopy (TEM) ( Figu re 4 5 C) and atomic force microscopy (AFM) ( Figure 4 4 B) further verified the size and morphology. In addition, TEM images displayed hierarchical internal structures in NFs. Even though large sticky RNA microsponges and bulky DNA metamaterial hydrogel have been constructed through similar strategies ( 191 198 ) our results represent the first to build m onodisperse DNA nanomaterials with diameters as small as 200 nm through RCR. The ability to build monodisperse nanoassemblies with dimensions within

PAGE 104

104 a few hundred nanometers is highly significant, especially for biomedical applications. For instance, due t o enhance d permeation and retention (EPR) effect, nanomaterials with diameters of as small as a few hundred nanometers are more likely to penetrate leaky blood vasculature be taken up b y cancer cells, and have enhanced retention at tumor site ( 199 201 ) The one step self assembly of small monodisperse NFs prevents the otherwise physical cutting for aggregate partition or physical compaction for size reduction which could be difficult to precisely manipulate and could damage DNA functionalit ies in NFs ( 191 198 ) We next studied the detailed process of NF assembly. The process could be influenced by such factors as tertiary structures of DNA templates, starting template concentration, substrate (dNTP) concentration, and reaction time. The influence of reaction time was first investigated. We expect that a r eaction for a longer time until the exhaust of substrate would generate more DNA s for NF assembly. To study this, RCR for a series of different time lengths was performed, followed by SEM imaging to reveal the structures obtained at each time point. Result s shown in Figure 4 6 A and Figure 4 7 suggest a progressive process of NF assembly. In particular, amorphous bulky structures were observed in RCR 0.5 RCR 1 displayed some crystal like structures on the surfaces of bulky matrices ( Figure 4 6 A). These crysta l like structures proceeded to form pe t al like structures on the surfaces of RCR 2 ( Figure 4 7 ), and flower like spherical structures gradually formed on the matrices of RCR 3 through RCR 10 ( Figure 4 6 A). In the meantime, the NFs were gradually pinched off f rom the surfaces of bulky matrices and separated from each other, forming monodisperse NFs with diameters of around 200 nm in RCR 10 We further examined RCR 15 (d= ca. 700 nm), RCR 20 (d= ca. 1.5 m),

PAGE 105

105 and RCR 30 (d= ca. 3 4 m) and found that NFs kept growing with longer reaction time, presumably until the exhaust of substrate. NFs as big as ca. 4 m in diameter were observed in RCR 30 These data clearly indicated a time dependent process of NF self assembly, allowing us to fi ne tune NF sizes for versatile applications simply by adjusting RCR time, given that NFs of different sizes would be suitable for different applications. To simplify the notation, NFs with diameters of approximate n m are denoted as NF n The monodisperse NF 2 s from RCR 24 are shown in Figure 4 6 B as an example of microscale NFs with pleated pe t als on the surfaces. To examine the internal structures of NFs, RCR 24 was subjected to sonication, resulting in the chopping of these large NFs in to smaller DNA partic les. Under SEM observation, the hierarchical structures on the surfaces of the sonicated DNA particles provide clear evidence of the internal hierarchical structures of the original NFs and the dense DNA packaging in NFs ( Figure 4 8 ). These internal hierar chical structures and dense DNA packaging could be used for physical encapsulation in porous structures or integration on DNA, respectively, of nanoscale or molecular functional moieties, such as therapeutics, imaging agents, or catalytic agents. Overall, the progressive assembly of NFs allows for fine tun ing the sizes of monodisperse and densely packed DNA NFs for versatile applications. We next studied the influence of template DNA sequences on NF assembly. Based on the above designed RCR template (T 1), NF building blocks could be crosslinked via inter and intrastrand hybridization ( Figure 4 2B ). On one han d, the crosslinking could faci litate DNA association during NF assembly; on the other hand, the crosslinked DNA networks could hinder the enzymatic reaction inside these networks and hence retard NF assembly. To examine the influence of template

PAGE 106

106 sequence, we designed another template, T 2. T 2 was design by substituting all sequences in T 1, except the primer complement used for template circularization and primer hybridization, with d eoxyadenosine (A). Therefore, the resultant RCR products would carry a long polyT motif that is not fav ored in DNA hybridization. Again, T 2 was circularized by ligation and then used for RCR. SEM imaging indicate s that NFs were also formed in RCR 10 using T 2, and the NF sizes ( Figure 4 6 C ; diameter of ca. 500 nm) were much larger than those formed using T 1 for the same reaction time. The larger NF sizes could be attributed to the relatively loose internal structure of the circular T 2 and the resultant less hindrance to enzymatic activity as well as less inter and intrastrand DNA hybridization of RCR pro ducts leading to more loose DNA compaction. The ability to form NFs using a template that is not amenable to DNA crosslinking by hybridization provides strong evidence that the NF assembly does not rely on conventional Watson Crick base pairing. T his e ssen tially avoids the conventional complicated sequence design in nanostructure construction by DNA hybridization, and allows the incorporation of versatile DNA functional moieties into NFs, thereby making this strategy to build DNA nanostructures noncanonical and widely applicable. Furthermore, these data imply that NF sizes can also be tuned by adjusting template sequences. NF A ssembly Driven by DNA Liquid Crystallization As mentioned above, both genomic DNA and synthetic short DNA have been documented to be liquid crystalline at high local concentration ( 178 180 187 ) Given the capability of RCR to create highly concentrated DNA, we then studied whether NFs were also assembled through DNA liquid crystallization. P olymer (e.g. DNA) liquid crystals (LC) are formed above a critical concentration ( 183 ) Under the hypothesis that

PAGE 107

107 RCR with an increasing template concentration within a specif ied time period would produce an increasing local DNA concentration under optimal conditions and that LC would be formed when DNA reached above the critical concentration, the effect of template DNA concentration on NF formation was investigated. As shown in Figure 4 9 with increasing template (T 1) concentrations (10 nM, 30 nM, 100 nM, and 200 nM) in RCR, NF shaped structures were not formed within 10 h until T 1 concentration increased up to 100 nM. Moreover, the NFs from RCR with 100 nM and 200 nM templ ate were not as monodisperse as those observed with 300 nM template. C ombined with the fact that NFs were not formed until RCR for a sufficient time to accumulate local DNA, this result suggests that NFs were only assembled when the local DNA concentration achieved a critical concentration, providing the basis of NF assembly through DNA liquid crystallization. The liquid crystalline structures of NFs were directly validated using polarized light microscopy, which revealed that s pherulite NFs viewed between crossed polarizers were birefringent, an optical property of anisotropic materials ( Figure 4 6 D). The optical texture of one NF, characterized by a disc shaped phase, was consistent with that observed from the nematic liquid crystalline phase of segregated short DNA (6 20 bases) domains resulted from dense DNA packaging and ordering ( 184 186 ) Additional evidence for LC formation in NFs include 1) TEM imaging of NFs revealing ultrathin sheet sections on DNA NFs ( Figure 4 10 ), and 2) both SEM imaging and TEM imaging illustrated hierarchical structures on NF surfaces or inside NFs, as mentione d above. The ultrathin sheet sections and hierarchical structures suggest an anisotropic process of NF assembly, consistent with characteristic anisotropic molecular alignment in polymer crystallization. Overall, these

PAGE 108

108 results demonstrate that NFs were sel f assembled noncanonically through liquid crystallization of DNA, rather than through conventional DNA hybridization, and in turn suggest NFs as excellent carriers for DNA functional moieties. Exceptional Stability of DNA NFs The stability of nanoassembli es is critical to its practical application especially under complicated environments of biomedical applications. For instance, when delivered systematically to a physiological environment, DNA nanoassembly degradation or dissociation could be facilitated by ubiquitous nucleases, dilution to very low concentrations by large volumes of circulating blood, and strong shear force. To assess the stability of NFs under nuclease treatment, NFs were incubated with DNase I for 24 h followed by SEM imaging to exami ne the structural integrity of NFs. DNase I is a ubiquitous endonuclease that can cleave both ssDNA and dsDNA ( 175 ) and is responsible for at least 90% of the deoxynuclease activity in human plasma ( 202 ) Results in Figure 4 11 A B verified the structural integrity of NFs after treatment with up to 5 U/ m L DNase I, which is cons iderably higher than the DNase I concentration in human blood (less than 1 U/mL) ( 175 202 ) The stability of NFs was further evaluated using human serum, and SEM observation verified t hat the resultant NFs still had flower shape after treatment for 24 h ( Figure 4 11C ). Conventional DNA nanostructures assembled from short DNA building blocks tend to dissociate at a fairly low concentration after systematic injection into the human body ( 203 ) To evaluate the structural integrity in diluted solutions, NF solutions were diluted 100 times in water and stayed for 0.5 h. The SEM results shown in Figure 4 11D again verified the structural integrity of NFs. In addition, we evaluated the stability of NFs under denatu ration conditions, which could disrupt hydrogen bonding and eventually cause nanoassembly

PAGE 109

109 dissociation ( 204 ) and SEM results confirmed the stability of NFs at high temperature (170 C. Figure 4 11E ) or treated with 5 M urea ( Figure 4 11F ). These data clearly demonstrate the remarkable stability of DNA NFs. The exceptional stability is presumably attributed to severa l features of NFs including 1) long building blocks, which avoid the otherwise many nick sites sensitive to nuclease cleavage; 2) high density of DNA packed in each NF, reducing nuclease accessibility; and 3) extensive inter and intrastrand weaving of lo ng DNA building blocks, preventing denaturation or dissociation. Furthermore, in case the outer layer of NFs is dissociated or cleaved, it should be noted that the inner layers could maintain their functionalities. The high stability makes NFs promising fo r applications under complicated biomedical situations, such as clinical diagnosis, biomedicine, and biotechnology. Biomedical Applications of Multifunctional DNA NFs Not relying on Watson Crick base pairing, NFs can be assembled using essentially any DNA templates suitable for RCR. Therefore, various DNA functional moieties can be incorporated during NF assembly for versatile applications. For example, during the de novo generation of NF building blocks, functionalities can also be incorporated via 1) chemically functionalized deoxynucleotides that can be utilized as substrates in RCR and 2) customized design of templates and primers. In this study, we used both of these approaches to incorporate different fluorescent bioimaging agents, aptamers, and drug loading sites. The incorporation of fluorescent bioimaging agents into NFs was first studied. Fluorescence imaging is usually less invasive and has been extensively used in bioimaging. In the first approach ( Figure 4 12A ) to incorporate fluorophores, FITC, as a model, was chemically modified on one end of RCR primer, such that multiple copies of

PAGE 110

110 fluorophores can be integrated into one NF that is composed of many copies of DNA building blocks. In the second approach, bioimaging agents were incorporated enzymatically via chemically modified deoxynucleotides ( Figure 4 12D ). To demonstrate this principle, a Cyanine 5 (Cy5) modified dUTP, which can work as a substrate for many DNA polymerases, including 29 ( 205 206 ) was used in RCR to incorporate Cy5 into NFs. T he morphology of these two types of NFs was verified by SEM ( Figure 4 12 B,E), and their fluorescence properties were validated through fluorescence microscopy ( Figure 4 12 C,F). The successful incorporation of fluorophores into NFs through different approaches provides the basis for applications of NFs in bioimaging. As mentioned above, by design of RCR template (T 1), the complements of a cancer targeting aptamer (sgc8) and drug loading sequences (ds(CG) and ds(GC)) for Dox were incorporated so that the RCR products could carry concatemer aptamers and drug loading sequences ( Figure 4 2 ). Given the small size promis ing for future in vivo application, NF 0.2 s were used to evaluate NF functionalities for selective cancer cell recognition and targeted drug delivery. Using flow cytometry, NF 0.2 s incorporated with FITC, drug loading sites, and sgc8 were demonstrated to sel ectively recognize target HeLa cells ( Figure 4 13 A) and CEM cells ( Figure 4 13B ), but not nontarget Ramos cells ( Figure 4 13C ). This provides the basis for potential applications in cancer imaging and active cancer therapy. T hese NFs were then studied fo r intracellular bioimaging and targeted anticancer drug delivery. To achieve efficient intracellular drug delivery, nanocarriers have been developed that can be internalized into diseased cells. Nanomaterials within an appropriate size range can be interna lized by cancer cells ( 199 201 ) Fortunately, with

PAGE 111

111 fine tuning, our NFs can be made small enough to fall into this range. In addition, molecular elements e.g., aptamers ( 44 50 139 207 ) antibodies ( 208 ) and folic acid ( 209 ) have all been explored for receptor mediated internalization. Specifically, sgc8 was shown to be internalized into target cancer cells via endocytosis ( 139 ) Using con focal microscopy imaging, the intracellular fluorescence (FITC) signals of NFs were identified in target HeLa cells as an example ( Figure 4 13D ), indicating the internalization of these NFs. The internalization of these NFs into HeLa cells was additionally demonstrated using two photon microscopy (TPM) ( Figure 4 14 ), an imaging technique characterized by l ess excitation light absorbed by tissues out of focal volume deep tissue penetration l and l ess tissue photo damage, compare d to fluorescence microscopy or confocal microscopy. These results demonstrate the application of fluorophore incorporated NFs for bioimaging, and the revealed internalization ability of NFs into target cancer cells allows for efficient drug delivery media ted by NF drug carriers. For biomedical applications, DNA nanomaterials have attracted tremendous interest, owing to the typical biocompatibility and biodegradability. In particular, the biocompatibility of NFs was verified by an MTS assay that showed neg ligible inhibition of proliferation in cancer cells ( Figure 4 15 A). The high density of DNA drug loading sequences and internal hierarchical structures make NFs intriguing for high capacity loading of therapeutics via either association with specific drug loading sequences or by physical encapsulation To load Dox into NFs, Dox and NF 0.2 s were mixed and stayed at room temperature to allow saturation of drug loading, followed by centrifugation and removal of free Dox in the supernatant. The amount of removed Dox was determined,

PAGE 112

112 and the drug loading capacity of the NFs was calculated accordingly. The resultant NF Dox complexes, whose structural integrity was confirmed by SEM ( Figure 4 15 B), were then evaluated for targeted drug delivery. Specifically, target C EM cells and HeLa cells, and nontarget Ramos cells, were all treated with free Dox and NF Dox, respectively, at the equivalent drug concentrations. Using HeLa cells as an example, the intracellular distribution of Dox delivered via NFs was examined using c onfocal microscopy, and results verified the intracellular uptake and accumulation of Dox ( Figure 4 15 C). The cell viabilities were then evaluated using an MTS assay. In target cells, Dox delivered by NFs induced only slightly less inhibition of cell proli feration than free Dox (HeLa: Figure 4 13 E; CEM: Figure 4 13 F), while in nontarget Ramos cells, NF Dox complexes induced considerably less inhibition of cell proliferation than free Dox ( Figure 4 13G ). In contrast to nonselective cytotoxicity of free Dox in both target and nontarget cells, selective cytotoxicity induced by NF Dox complexes in target cells demonstrated the applicability of NFs for targeted drug delivery. Overall, these results clearly demonstrated the capability of intracellular imaging and targeted drug delivery mediated by multifunctional NFs. Conclu d ing Remarks Inspired by the natural high packaging efficiency of genomic DNA or synthetic DNA in a manner that does not rely on Watson Crick ba se pairing, we herein present ed a noncanonical strategy to build monodisperse multifunctional DNA nanostructures, termed as nanoflowers (NF s ) and demonstrated their versatile biomedical applications. These hierarchical NFs were self assembled from elongat ed DNA building blocks generated through Rolling Cycle Replication (RCR). Unlike a large amount of myriad DNA strands typically used in conventional DNA nanostructure construction, only a low

PAGE 113

113 amount of two strands (one template and one primer) are needed i n NF assembly. T he unnecessity of Watson Crick base pairing for NF assembly avoids the otherwise complicated design of DNA sequences for inter or intrastrand hybridization in conventional nanostructure assembly. Further investigation demonstrated that NFs are assembled through the liquid crystallization of DNA, an anisotropic process for orderly alignment of polymers at a high concentration. The DNA in NFs is thus densely packed, a desirable feature for high capacity encapsulation of DNA moieties, such as therapeutics and bioimaging agents. The NFs are size tunable, with diameters ranging from approximately 200 nm to a few micrometers, by manipulating such factors as the RCR reaction time or template sequences. The unnecessity of Watson Crick base pairing a nd the size tunability enable NFs promising for versatile applications. DNA NFs are exceptional ly resistant to nuclease treatment, dilution to low concentration, or denaturation by heating or urea treatment. The high stability of NFs is attributed to their characteristic features including long and non nicked DNA building blocks that provide relative less cleavage sites for nucleases, and dense DNA packaging. The high stability is critical for the biomedical and biotechnological applications of NFs. Import antly, various functionalities can be simply incorporated into NFs during self assembly. As a proof of principle study, through template design, NFs were incorporated with 1) fluorescent bioimaging agents by attaching fluorophores either on primers or on d eoxynucleotide triphosphates (dUTP), 2) cancer cell targeting aptamers for selective cancer cell recognition, and 3) drug loading sequences for targeted anticancer drug delivery. T he resultant multifunctional NFs were further implemented for bioimaging, se lective cancer cell recognition, and targeted anticancer drug delivery. Collectively, a

PAGE 114

114 noncanonical strategy was presented for the self assembly of multifunctional DNA NFs in a way that does not rely on Watson Crick base pairing, and the resultant NFs wer e featured by size tunability, dense DNA packaging, exceptional stability, and ease of functionalization. As such, these NFs can be equipped with various functionalities for versatile biomedical applications. Materials and Methods DNA Preparation All DNA synthesis reagents were purchased from Glen Research (Sterling, VA) and all DNA probes were synthesized on an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA, USA) based on solid state phosphoramidite chemistry at a or phosphate was coupled on the 5 end s of primers and templates, if applicable DNA sequences were deprotected according to manufacturer s guidance. Deprotected DNA was further purified with reversed phase HPLC (ProStar, Varian, Walnut Creek, CA, USA) on a C 18 column using 0. 1 M triethylamine acetate (TEAA, Glen Research Corp.) and acetonitrile (Sigma Aldrich, St. Louis, MO) as the eluent. The collected DNA products were dried and detritylated by dissolving and incubating DNA products in 200 L 80% acetic a cid for 20 minutes. The detritylated DNA product was precipitated with NaCl (3 M, 25 L) and ethanol (600 L). UV Vis measurements were performed with a Cary Bio 100 UV/Vis spectrometer (Varian) for DNA quantification. Self assembly of DNA NFs Using RCR A phosphorylated linear template (0.6 M) and a primer (1.2 M, serving as a ligation template) were mixed and annealed in DNA ligation buffer ( 5 mM Tris HCl 1 mM MgCl 2 0. 1 mM ATP 1 mM Dithiothreitol ) by heating at 95 C for 2 min followed by gradual c ooling to room temperature over 3 h. The annealed product was incubated

PAGE 115

115 with T4 DNA ligase (10 U/ L ; New England Biolabs, Ipswich, MA) at room temperature for 3 h. For RCR, the resultant circularized template (0.3 M, unless otherwise denoted) was incubate d with 29 DNA polymerase (2 U/ L), dNTP (2 mM/ L), and BSA (1X) in buffer solution ( 50 mM Tris HCl 10 mM (NH 4 ) 2 SO 4 10 mM MgCl 2 4 mM Dithiothreitol ) (New England Biolabs, Ipswich, MA) at 30 C Cyanine 5 dUTP (200 M ; Enzo Lifescicence, Farmingdale, NY ) was added to the reaction mixture, if applicable. Reactions were terminated by heating at 75 C for 10 min. The NFs were washed with double distilled H 2 O, precipitated by centrifugation, and stored at 4 C for future use. Agarose Gel Electrophoresis The sizes of DNA template, primer, and NFs were estimated by agarose gel electrophoresis using an agarose gel (2%) for 40 min (100 V). The gel was stained with Ethidium Bromide (EB) and imaged under UV irradiation Drug Loading into NFs Doxorubicin (Dox) ( 1 mM) wa s incubated with the DNA NF 0.2 s ( from 20 L raw NF products ) dispersed in 100 L PBS (Sigma Aldrich, St. Louis MO) at room temperature for 24 h followed by centrifug ation at 10 000 rpm for 1 5 min. T he free Dox in the supernatant were isolated and Dox at 480 nm on a Cary Bio 100 UV/Vis spectrometer (Varian). The Dox loading amount into NF 0.2 s was calculated as shown in Equation 4 1 Loading amount = T otal Dox amount Dox amount in supernatant [ 4 1] The precipitate (NF Dox complexes) was then dispersed in PBS (100 L).

PAGE 116

116 Characterization of NFs To examine NFs using scanning electron microscopy, the products were deposited on silicone matrices, dried, and coated with Au, followed by observation on an S 4800 scanning electron microscope ( H I TACHI Japan). Additionally, NFs were characterized using transmission electron microsco py on an F 2010 TEM microscope ( JEOL Japan) at a working voltage of 100 kV Atomic force microscopy of samples was performed on a Nanoscope IIIa (Veeco, Santa Barbara, CA) using tapping mode in ambient air Dynamic light scattering on a Nano zs90 Zetasize r ( Malvern Instruments Ltd UK) was used for size determination, and polarized light and an Optipho 2 polarizing microscope ( Nikon Japan) were used for polarized light microscopy. Fluorescent NFs were observed under a DM6000 B fluorescence microscope (Lei ca Microsystems, Germany). Evaluation of the Stability of NFs The stability of NFs under nuclease cleavage, dilution to low concentration, heating, and urea denaturation was evaluated, respectively. Specifically, for nuclease cleavage, NFs were treated w ith DNase I (New England Biolabs, Ipswich, MA) of specified concentrations, or 10% human serum ( Asterand Detroit, MI ) diluted in PBS (Sigma Aldrich, St. Louis MO) at 37 C for 24 h, prior to nuclease deactivation by heating at 75 C for 10 min. For dilution, NFs were diluted 100 times in PBS from the original NF solution; for heating, NFs were kept at 170 C for 0.5 h; and for denaturation, NFs were treated with urea (5 M) for 0.5 h, prior to washing with double distilled water. The morphologies of the resultant NFs were then examined using SEM.

PAGE 117

117 Cell Lines and Cell Culture Cell lines CCRF CEM (Human T cell ALL) Ramos (Human B lymphoma) and HeLa cells ( Human cervical carcinoma) were obtained from the Americ an Type Culture Collection (Manassas, VA). C ells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (heat inactivated, GIBCO) and 100 IU/mL penicillin streptomycin (Cellgro) at 37 C in a humid atmosphere with 5% CO 2 C ell den sity was determined using a hemocytometer prior to each experiment. Specific Recognition Ability to Target Cancer Cells The binding abilities of aptamers or aptamer incorporated NFs were determined using flow cytometry on a FACScan cytometer (BD Immunocyt ometry Systems) A ptamers ( 200 nM) or aptamer incorporated NFs (10 L equivalent NF reaction solution ) were incubat ed with cells (210 5 ) in binding buffer (200 L; 4.5 g/L glucose 5 mM MgCl 2 0.1 mg/mL yeast tRNA (Sigma Aldrich, St. Louis MO) and 1 mg/mL BSA (Fisher Scientific Pittsburg PA ) on ice for 30 min, followed by washing twice with washing buffer (1 mL 4.5 g/L glucose and 5 mM MgCl 2 Cells were suspend ed in binding buffer (200 L) prior to flow cytometric analysis. Data were analyzed with the FlowJo software ( Tree Star, Inc., Ashland, OR ). Random DNA sequences (lib) were used as a negative control. Bioimaging of Intracellular Behaviors of NFs and Dox Delivered by NFs Bioimaging was performed using c onfocal laser scanning microscopy (CLSM) on a Leica TCS SP5 confocal microscope (Leica Microsystems Inc., Exton, PA) in DIC mode. A n A r laser (for FITC and Dox) and He Ne laser (for Cy5) were used for excitation. Cells (210 5 ) in buffer ( 200 L 4.5 g/L glucose and 5 mM MgCl 2 in ) were incubated with NFs (10 L equivalent NF reaction solution) or

PAGE 118

118 NF Dox complexes (2 M Dox equivalent ) in a cell culture incubator for 2 h followed by washing with washing buffer (1 mL) twice and addition of (200 L) before imaging. Targeted Drug Delivery Using NFs The cytotoxicity of NFs, free drug, or drug NF complexes were evaluated using CellTiter 96 cell proliferation assay (Promega, Madison, WI, USA). Cells (5 10 4 CEM or Ramos, or 5 10 3 HeLa cells/well) were treated with NFs, free Dox or Dox NF complexes in FBS free medium. After incubation for 2 h in a cell culture incubator was added for further cell growth (48 h) Then medium was again removed, and CellTiter reagent FBS free incubated for 1 2 h. The absorbance (490 nm) was recorded using a microplate reader (Tecan Safire microplate reader, AG, S witzerland). Cell viability was determined according to the s description.

PAGE 119

119 Table 4 1. Sequences of DNA probes. FITC was labeled at the 5' ends if applicable. Sequence s (5 3 ) T 1 ( RCR template 1 complementary drug loading site Sgc8) P hosphate TTCCCGGCGGCGCAGCAGTTAGATGCTGCTGCAGCGAT ACGCGTATCGCTATGGCATATCGTACGATATGCCGCAGC AGCATCTAACCGTACAGTATT T 2 ( RCR template 2) P hosphate TTCCCGGCGGCGCAGCAGTTAGA TTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TCTA ACCGTACAGTATT Primer TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAG A Sgc8 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTA GA

PAGE 120

120 Figure 4 1. Schematic illustration of noncanonical self assembly of multifunctional DNA nanoflowers (NFs). The designer linear ssDNA template was first ligated to form a circular template which then served as the template for RCR using 29 DNA polymerase and a primer. RCR generated a large amount of elongated non nicked concatemer DNA with each unit complementary to the template These DNAs then served as building blocks to self assemble monodisperse, densely packed, and hierarchical DNA NFs. NF sizes are tunable with diameters ranging from approximately 200 nm to several micrometers, as shown by the representative SEM images. NF assembly does not rely on W atson Crick base pairing between DNA building blocks, enabling tailored design of the template to carry multiple complements of functional nucleic acids e.g., aptamers and drug loading sites. Functionalities could also be incorporated via primers or modif ied deoxynucleotides such as Cy5 dUTP for bioimaging as shown here as an example. The multifunctional NFs were applied for selective target cancer cell recognition, bioimaging, and targeted drug delivery.

PAGE 121

121 Figure 4 2. Predicted secondary structures of the linear template (T 1) with 3 way junction structure ( A ) and octameric concatemer RCR products ( B ) with branched aptamer structures protruding and aligning on alternative sides and many dsDNA (for drug loading) on the b ack bone and stem. Structures were predicted using the Nupack software ( 172 ) Figure 4 3. Flow cytometry data showing selective recognition ability of monomeric template complement to target CEM cells, as an example, but not to nontarget Ramos cells.

PAGE 122

122 Figure 4 4. ( A ) A n image of agarose gel (2%) electrophoresis indicating the elongation of DNA t hrough RCR. ( B ) An AFM image displaying monodisperse NFs and the size determination.

PAGE 123

123 Figure 4 5. Characterization of small monodisperse hierarch ic al DNA NFs. ( A ) SEM images of NFs from RCR 10 displaying monodisperse DNA NFs with pe tal like structures on NF surfaces. ( B ) DLS data revealing the size distribution of NFs from RCR 10 ( C ) A u ranyl acetate stained TEM image displaying the structure of a NF from RCR 10 with hierarchical internal structures.

PAGE 124

124 Figure 4 6. Noncanonical and progressive self as sembly of size tunable NFs through DNA liquid crystallization. ( A ) SEM images of RCR 1 to RCR 30 indicating the time dependent NF self assembly process: 1) pe t al shaped structures formed on the surfaces of bulky matrices (1 3 h); 2) spherical structures starting to form on matrix surfaces (3 10 h); 3) spherical structures separated from each other to form small monodisperse NFs (10 h); and 4) larger NFs formed with longer RCR reaction time (>10 h). This process suggests an approach to fine tuning NF sizes ( B ) SEM images of the hierarchical NFs from RCR 24 (diameters: ca 2 m) with characteristic pe t al shaped surface structures. ( C ) SEM images showing monodisperse NFs (diameters: ca. 500 nm) self assembled in RCR 10 using T 2. ( D ) Optical microscopy images of NFs observed under bright field (upper), and between crossed polarizers (lower), where spherulite NFs display ed dis c shaped optical texture s resulted from birefringence of liquid crystalline NFs.

PAGE 125

125 Figure 4 7. SEM images of RCR products from RCR 0.5 and RCR 2. Figure 4 8. SEM images of sonicated NF particles from RCR 24. The hierarchical structures on the surfaces of these sonicated DNA particles reflect the internal structures and the high density of DNA in the original NFs.

PAGE 126

126 Figure 4 9. SEM images of products from RCR using a series of increasing template concentrations. Results indicate that NFs started to be formed with template concentrations up to 100 nM (RCR: 10 h). Figure 4 10. TEM images of NF 0.2 s displaying ultrathin sheet sections (indicated by arrows).

PAGE 127

127 Figure 4 11. Exceptional stability of NFs. ( A C ) SEM images of NFs treated with DNase I ( A,B 5 U/mL) and human serum ( C 10% diluted) for 24 h at 37 o C. ( D F ) SEM images displaying NFs heated at 170 o C for 0.5 h ( D ), diluted 100 times ( E ), and treated with urea (5 M) for 0.5 h ( F ). The maintenance of NF structural integrity indicates the high stability of NFs. Figure 4 12. Versatile incorporation of fluorescent bioimaging agents into NFs. ( A D ) Schematic representation of the incorporation of fluorophores into NFs via chemical attachment of FITC on primers ( A ), and via chemically modified deoxynucleotides (Cy5 dUTP) ( D ). The resultant NFs were characterized by SEM imaging ( B : FITC NF 0.5 s; E : Cy5 NF 0.3 s) and fluorescence microscopy imaging ( C : FITC NF 2 s; F : Cy5 NF 2 s).

PAGE 128

128 Figure 4 13. Biomedical applications of multifunctional NFs for selective cancer cell recognition, intracellular bioimaging, and targeted anticancer drug delivery. ( A C ) Flow cytometry results demonstrating the selective recognition of sgc8 incorporated NF 0.2 s (FITC incorporated on primers) to target HeLa cells ( A ) and CEM cells ( B ), but not to nontarget Ramos cells ( C ). ( D ) Confocal microscopy images displaying that these NF 0. 2 s were internalized into target HeLa cells after incubation at 37 C for 2 h. ( E G ) MTS assay results showing selective cytotoxicity of Dox delivered by these NFs in target HeLa cells ( E ) and CEM cells ( F ), but much less in nontarget Ramos cells ( G ), in contrast to nonselective cytotoxicity of free Dox in both target cells and nontarget cells. The selective cytotoxicity of Dox delivered via NFs indicates its capability of targeted drug delivery.

PAGE 129

129 Figure 4 14. Two photon microscopy (TPM) images d isplaying intracellular FITC signal in HeLa cells treated with NF 0.2 s incorporated with FITC and sgc8, following internalization of NFs after incubation at 37 C for 2 h. Figure 4 15. ( A ) MTS assay results verifying the biocompatibility of NF 0.2 s in both CEM cells and Ramos cells (1 U NF corresponds to the NF concentration for 10 M Dox in NF 0.2 Dox). ( B ) SEM images of NF 0.2 s loaded with Dox ( NF Dox ). ( C ) Confocal microscopy images displaying Dox distribution in HeLa cells treated with NF Dox (2 M Dox equivalent) for 2 h.

PAGE 130

130 CHAPTER 5 SELF ASSEMBLED APTAMER BASED DRUG CARRIERS FOR BI SPECIFIC CYTOTOXICITY TO CANC ER CELLS S i gnificance and Background Drug delivery systems that specifically recognize cancer cells and induce targeted cytotoxicity will reduce side effects caused by nonspecific drug toxicity. Specific recognition can be realized by using antibodies or aptamers ( 32 62 75 210 211 ) Aptamers, which are selected through Systematic Evolution of Ligands by EXponential enrichment (SELEX), are single stranded DNA or RNA molecules that can specifically and selectively bind to targets ( 32 210 ) The targets of aptamers range from metal ions, small molecules, to proteins, and even mammalian cells ( 8 46 210 ) Recently, our group developed cell SELEX to select aptamers against whole cells, using target cells for positive selection and non target cells for negative selection ( 32 157 212 ) With this technology, aptamers have been selected against cell lines such as CCRF CEM (human T cell acute lymphoblastic leukemia (ALL)) and Ramos (human B ( 157 ) Compared with antibodies, nucleic acid aptamers have many distinct advantages, such as easy synthesis and modification, reproducible batch to batch fabrication, and low cytotoxicity and immunogenicity ( 2 32 35 210 ) As such, aptamers are prom ising for future biomedical application such as targeted anticancer drug delivery. However, recent aptamer binding tests with patient samples indicated that a single type of aptamer did not bind all samples from different patients with the same Note: this work was reprinted with permission from: Zhu G et al. (2012) Self Assembled Aptamer Based Drug Carriers for Bispecific Cytotoxicity to Cancer Cells. Chemistry An Asian Journal 7(7):1630 1636.

PAGE 131

131 type of cancer ( 213 214 ) presumably resulting from the heterogeneity of cell surface biomarkers among different patient samples. This suggests that monovalent aptam ers selected against cultured cancer cells may not be able to overcome the problem of heterogeneity among different patient samples. Yet, cancer heterogeneity has been widely reported ( 215 219 ) and more recently, it was further demonstrated by direct single cell analysis such as genomic sequencing ( 220 ) and dissection of tumor cell transcription ( 221 ) Therefore, improvement of aptamers for broader range of recognition capabilities would be highly significant for future clinical applications in targeted cancer therapy. In this context, we propose de veloping multi specific aptamer based drug carriers that are capable of recognizing and inducing targeted cytotoxicity in different subtypes of cancer s These carriers were designed to be self assembl ed from modified monovalent aptamer s. The assembly would simultaneously form drug loading sites in the double stranded linker region. As a model, a bi specific drug carrier, sgc8c sgd5a (SD), was developed from monovalent aptamers sgc8c and sgd5a, and evaluated in this study. An anticancer drug Doxorubicin which is used in chemotherapy of a wide range of cancers, including acute lymphoblastic and myeloblastic leukemias malignant lymphomas as well as breast cancer ( 222 ) was chosen in this study Dox binds preferentially to ds DNA between adj acent GC or CG base pairs through intercalation and the association of Dox with DNA is reversible ( 109 ) Dox was loaded into the multiple intercalation sites designed in the dsDNA linker region of SD to study the bi specific ability of SD for Dox delivery and target cell cytotoxicity. While the recognition abilities of monovalent aptamers are necessarily lim ited, the broader recognition

PAGE 132

132 capability of the bi specific aptamer based drug carrier, SD allowed the cytotoxic effects of Dox to be bi specifically directed to more types of target cells. Under these conditions, bi specific aptamer based drug carriers c an sidestep the problem of cancer heterogeneity and, as a consequence, facilitate clinical aptamer applications in targeted therapy of many types and subtypes of cancers that respond to the same therapeutic methods. Results and Discussion Self assembly of Multi aptamers In order to develop bi or tri specific aptamer based drug carriers we first constructed bi and tri specific aptamers (multi aptamers) and studied their recognition capabilities Engineering multi aptamers is similar to multivalency engineering, which has been previously reported for antibodies ( 90 ) and aptamers ( 223 228 ) using chemical linkages or nanomaterials for binding affinity improvement, targeted therapy, cell cell interaction, etc. In this study, chemical linkages were used. As an example shown in Fig ure 5 1, two monovalent aptamers that recognize different cancer subtypes form a bi specific aptamer via dsDNA linkage. Monovalent aptamers able to recognize CEM cells ( 157 161 ) TDO5 (T) against Ramos cells ( 229 ) and sgd5a (D) against Toledo cells ( 213 ) (sequences in Table 5 1). To study the ge nerality of linkers, different linkers including a polyT linker, a PEG linker and a dsDNA linker were used to construct S T20 T, S PEG T, S hyb T and S hyb D (SD), respectively. Bi specific aptamers with either polyT or PEG linkers were designed to be synt hesized on a automated DNA synthesizer, and those with dsDNA linkers were self assembled by hybridization of two

PAGE 133

133 aptamers. To further enhance the recognition range of drug carriers a tri specific aptamer, sgc8c sgd5a TDO5 (SDT), was developed using a Y shaped dsDNA linker. The formation and purity of multi aptamers linked by dsDNA were confirmed by agarose gel electrophoresis ( Fig ure 5 2 ). For drug carriers to realize bi or tri spe cificity, each monovalent aptamer domain must retain its specific binding ability. To test this, an aptamer binding assay was performed with target cells of the parent aptamers. Either FITC or Cy5.5 was used to monitor aptamer binding. Using flow cytometry specific binding abilities were confirmed at 4C for bi specific aptamers S T20 T ( Fig ure 5 3 A), S hyb T ( Fig ure 5 3 B), S PEG T ( Fig ure 5 3 C), S hyb D (SD) ( Fig ure 5 4 ), and tri specific aptamer S D T (SDT) ( Fig ure 5 5 ). Furthermore, the dissociation constants (K d ) to target cells were determined for S T20 T, S hyb T and SD. As shown in Table 5 2, the binding affinities of these bi specific aptamers to their target cells were comparable to those of the corresponding monovalent aptamers. Therefore, the binding specificity and affinity to both/all target cells were maintained in these multi aptamers, indicating bi or tri specificity. SD for Bi specific Cancer Cell Recognition To develop drug carriers with multi specific cytotoxicity using multi aptamers bi specific aptamer SD was chosen as a model. It is well known that temperature change can result in aptamer conformation change and, hence, binding ability. Thus, the binding ability of SD was characterized and verified at physiological temperature (37 C) ( Fig ure 5 3 D). For future application of SD as a drug carrier in complicated clinical samples, the ability of SD to selectively detect both types of target cells was evaluated in cell mixtures containing non target cells. To do so, SD binding assays wer e performed with

PAGE 134

134 cell mixtures containing a series of target CEM/Toledo cells of different concentrations into non target NB4 cells of a fixed concentration. Because the morphology of NB4 cells is distinct from those of either CEM or Toledo cells, the popu lations of target and non target cells in flow cytometric results can be easily distinguished and gated for respective fluorescence analysis ( Fig ure 5 6 A). With as low as 5% target cells in a total mixture of 15,000 cells, both types of target cells were still easily detected, indicating bi specificity of SD for sensitive cell detection in cell mixtures ( Fig ure 5 6 ). Next, a quantitative analysis was performed to compare the recognition capabilities of monovalent aptamers sgc8c and sgd 5a with that of SD in cell mixtures. Again, 50,000 CEM and/or 50,000 Toledo cells were spiked into 200,000 NB4 cells. Using a binding assay, these cell mixtures were tested with sgc8c, sgd5a and SD respectively. Similarly as described above, flow cytometr ic data were analyzed to determine the percentage of cells with fluorescence signal enhancement resulting from aptamer binding. As shown in Fig ure 5 4 B, 15.35% and 14.4% cells tested with sgc8c and sgd5a, respectively, showed signal intensities located in M1 (marker for enhanced fluorescence signal range), while the percentage for SD was 26.89%, approximately twice that of either sgc8c or sgd5a alone. Overall, the results show ed that SD ha d broader recognition capability to target cells than either sgc8c or sgd5a parent aptamers alone in the same cell mixtures. The broader recognition capabilit y of SD is in turn, expected to enhance the recognition range of SD based drug carrier in targeted drug delivery, thus overcoming the problem of cancer heterogeneity discussed above. Internalization of SD Into Target Cancer Cells Another key concern integral to intracellular drug delivery is the ability of drug carriers to be internalized. Regarding aptamer based drug carriers, s ome aptamers ( 58

PAGE 135

135 230 ) have already been reported to be specificall y internalized into target cells. In our case, it is critical for SD to be internalized into both target cells for successful drug delivery. Therefore, the internalization capability of TAMRA labeled SD was evaluated through confocal microscopy, and, as sh own by the images in Fig ure 5 7 SD was successfully internalized into both CEM and Toledo cells. SD for Bi specific Anticancer Drug Delivery To develop a self assembled drug carrier using SD for bi specific drug delivery and target cell cytotoxicity, Dox orubicin (Dox) was used in this study Dox is one of the most utilized chemotherapeutic drugs for a wide spectrum of cancers ( 231 ) However, lack of specificity leads to many side effects, such as myelosupp ression and mucositis ( 232 ) Interestingly, many anthracycl ine drugs, including Dox and daunorubicin, can preferentially intercalate into tandem GC or CG sites in dsDNA, resulting in the quenching of Dox fluorescence ( 52 109 131 233 234 ) Accordingly, SD was designed with a dsDNA linker having 10 Dox intercalation sites (Table 5 1). As such, a drug carrier based on SD could be self assem bled through hybridization of the two complementary sequences modified on each aptamer, and the Dox intercalation sites would be simultaneously formed in the dsDNA linker, resulting in further self assembly of SD Dox. The loading of Dox into drug carrier SD was studied using fluorescence spectrometry. As shown in Fig ure 5 8 A, Dox fluorescence signal was gradually quenched with increasing fractions of SD. At an SD/Dox molar ratio of 0.1, Dox fluorescence was significantly quenched. To assure the least amount of free Dox in solution, an SD/Dox molar ratio of 0.12 was used in cytotoxicity studies. By fluorescence titration, the overall dissociation constant (Kd) was determined to be

PAGE 136

136 415.5 nM ( Fig ure 5 8 A). By studying Dox intercalation with different SD components (sgc8, sgd5a and dsDNA linker only), we confirmed that the Dox intercalation sites were mostly localized in the linker ( Fig ure 5 9B ). T he loading of Dox into carrier was further confirmed by the en hancement of Dox fluorescence anisotropy with increasing SD fraction ( Fig ure 5 8 B). As a consequence of the rapid kinetics of DNA hybridization and Dox intercalation, the self assembly of SD Dox complexes is also fairly rapid, and intercalation equilibrium is achieved in less than 10 seconds ( Fig ure 5 9 A). Moreover, the slow Dox release from SD Dox in buffer indicated good stability for at least 5 days under our experiment condition ( Fig ure 5 8 C). Next, the bi specificity of the complex SD Dox was confirme d using flow cytometry, as indicated by the selective binding abilities to target CEM and Toledo cells, but not to NB4 cells ( Fig ure 5 10 A). Furthermore, the ability of SD Dox to selectively deliver Dox to target cells was studied by confocal microscopy. I n this experiment, cells were incubated with 0.5 M free Dox or SD Dox with the equivalent Dox concentration. After 2 h incubation, cells were washed and observed for Dox fluorescence intensity by confocal microscopy. The uptake of Dox by cells treated wit h SD Dox is presumably through two pathways: 1), binding of SD Dox on target cell surfaces and then internalization of the entire SD Dox before gradual Dox release inside cells; or 2), uptake of free Dox that diffuses from the highly concentrated SD Dox on target cell surfaces. As shown in Fig ure 5 10 B, the Dox signal intensities in CEM and Toledo cells treated with SD Dox were more comparable to those of the corresponding cells treated with free Dox, than those of non target NB4 cells. The slightly lower D ox fluorescence

PAGE 137

137 intensities in target cells treated with SD Dox than those treated with free Dox could be explained by 1), The efficiency of Dox transportation via a macromolecul ar drug carrier (SD) is lower than uptake of free Dox into cells; 2), The Dox that were not released from SD Dox yet were still quenched, resulting in low er fluorescence. Overall, these results indicated that this aptamer based drug carrier SD bi sp ecifically delivered Dox into target cells. Finally, MTS assays were performed to study the specific cytotoxicity of Dox delivery by SD. First, the cytotoxicity of free Dox was investigated for CEM, Toledo and NB4 cells. CEM was reported to show dose dependent response to free Dox ( 235 ) as did Toledo a nd NB4 (Fig ure 5 11 ). Then, the cytotoxicity of SD Dox to these cells was studied. Because the IC 50 s of Dox to these three cell types were not exactly the same, they were treated with Dox or SD Dox at the respective Dox concentrations w hich could cause about 30% cell viability (CEM: 0.5 M, Toledo: 0.7 M, NB4: 0.35 M). The resultant cell viabilities of each type of cells were then normalized, with 30% cell viability of the corresponding cells treated with free Dox. While free Dox induc ed 30% normalized cell viabilities, SD Dox with the equivalent Dox concentrations induced approximately 50%, 50% and 75% normalized cell viability in CEM, Toledo, and NB4 cells, respectively (Fig ure 12 A). This indicated that Dox delivered by SD induced hig her cytotoxicity in both target CEM and Toledo cells than in non target NB4 cells. However, neither SD alone nor dsDNA linker Dox showed significant cytotoxicity. We reason that the greater cell viabilities of CEM and Toledo cells treated with SD Dox than those treated with free Dox were caused by less efficient Dox uptake via SD Dox in the limited

PAGE 138

138 treatment time (2h), which is consistant with the Dox delivery efficiency discussed above. Furthermore, to mimic clinical situation where target cells were in c ell mixtures containing miscelleneous non target cells, the cytotoxicity specificity of Dox delivered by SD was further examined in cell mixtures containing 50,000 CEM, 50,000 Toledo and 100,000 NB4 cells. Cell mixtures were treated with S Dox, D Dox and S D Dox, respectively, with 0.5 M Dox. The treated cell mixtures were stained with Propidium iodide (PI), which accumulated inside dead cells and could be analyzed by flow cytometry. As discussed before, the cell morphologies of CEM/Toledo cells can be eas ily distinguished from that of NB4 cells by flow cytometry. Again, target cell populations were gated for PI fluorescence intensity analysis. The results indicated that SD Dox induced approximately the sum of target cell deaths induced by S Dox and D Dox, respectively ( Fig ure 5 12 B). Overall, these results clearly demonstrated the bi specific cytotoxicity of Dox delivered by SD, thus broadening the range of targeted cytotoxicity in aptamer based drug delivery Previous studies showed that monovalent aptamer directed drugs induced cytotoxicities only in the corresponding target cells ( 111 235 ) However, because of the broadened recognition capability of S D, Dox delivered by SD could induce bi specific cytotoxicities in the cells targeted by both apamers sgc8c and sgd5a. Conclu d ing Remarks In conclusion, we report an facilely self assembled aptamer based drug carrier for bi specific ity cytotoxicity The bi specificity resulted from the ability of the drug carrier SD to bi specifically recognize target cells. In particular, SD was able to specifically bind and detect both target cells (CEM and Toledo), but not non target cells (NB4), in

PAGE 139

139 cell mixture s. SD was also shown quantitatively to possess broader recognition capability to target cancer cells than its parent monovalent aptamers. This bivalent solution to the problem of heterogeneity in cancer subtypes is expected to overcome many diagnostic and therapeutic complications. As such, SD w as then utilized to deliver Dox, an anticancer drug widely used for cancer chemotherapy in order for bi specific cytotoxicity Through aptamer engineering, this carrier, SD, was designed for easy self assembly and s imultaneously forming multiple Dox intercalation sites on the dsDNA linker. The further drug loading and self assembly of SD Dox is rapid, easy to characterize via Dox fluorescence change and the SD Dox complex showed good stability for at least 5 days. T he multiple Dox intercalation sites on each SD enable d high drug loading capacity. Furthermore, the Dox loaded SD SD Dox, maintained bi specific abilities in target cell binding and targeted Dox delivery. Most importantly, Dox delivered by SD induced bi s pecific cytotoxicity in both seperate and mixed cancer cell solutions, indicating a broad recognition range of targeted therapy. While the recognition abilities of monovalent aptamers are necessarily limited, the broader recognition capability of bi specif ic aptamer based drug carriers allowed drug cytotoxicity to be specifically directed to more subtypes of cancer cells. Under these conditions, bi specific aptamer based drug carriers can sidestep the problem of cancer heterogeneity altogether and, as a con sequence, facilitate clinical aptamer applications in targeted therapy of many subtypes of cancers that respond to the same therapeutic methods Materials and Methods Preparation of DN A All DNA synthesis reagents were purchased from Glen Research, and all DNA probes were synthesized on an ABI3400 DNA/RNA synthesizer (Applied Biosystems,

PAGE 140

140 (FITC), Biotin, or Cy5, unless otherwise noted. The completed sequences were then deprotected in AMA (ammonium hydroxide/40% aqueous methylamine 1:1) at 65C for 30 min and further purified by reversed phase HPLC (ProStar, Varian, Walnut Creek, CA, USA) on a C 18 column using 0.1 M trithylamine acetate (TEAA Glen Research Corp.) and acetonitrile (Sigma Aldrich, St. Louis, MO) as the eluent. The collected DNA products were dried, and detritylation was performed by dissolving and incubating DNA products in 200 L 80% acetic acid for 20 minutes. The detritylated DNA product was precipitated with NaCl (3 M, 25 L) and ethanol (600 L). UV Vis measurements were performed with a Cary Bio 100 UV/Vis spectrometer (Varian) for probe quantification. Cell Lines and Cell Culture Cell lines CCRF CEM (Human T cell ALL), Ramos (human B lymphoma) and Toledo (CRL 2631, B lymphocyte, human diffuse large cell lymphoma) were obtained from the American Type Culture Collection (Manassas, VA). NB 4 (acute promyelocytic leukemia) w as obtained from the School of Medicine, Department of Pathology, at the University of Florida. The cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (heat inactivated, GIBCO) and 100 IU/mL penicillin streptomycin (Cell gro) at 37 C in a humid atmosphere with 5% CO 2 The cell density was determined prior to each experiment using a hemocytometer. Aptamer B inding A ssay The binding abilities of aptamers were determined by incubating dye labeled aptamers (400 nM, unless oth erwise noted) with cells (210 5 ) on ice for 30 min, followed by washing twice with washing buffer (1 mL) and suspending in binding buffer (200 L), before flow cytometric analysis. Random sequences (lib) were used as a

PAGE 141

141 negative control. The fluorescence in tensities of cells were determined with a FACScan cytometer (BD Immunocytometry Systems). Data were analyzed with WinMDI software. Binding affinities of aptamers were determined using a series of aptamer concentrations. As negative controls, similar assay s were performed using random sequences at the same corresponding concentrations. The increased mean fluorescence intensities of cells bound by dye labeled aptamers compared with those of random sequences were used to calculate the equilibrium dissociation constant (K d ) by fitting the dependence of fluorescence intensity (F) on aptamer concentration (L) to the equation F= Bmax[L]/ (K d +[L]) ( 235 ) where Bmax represents binding capacity and reflects the density of binding sites. Bmax/2 was the n used as the binding constant. The binding assay was repeated at least three times. Detection of T arget C ancer C ells in C ell M ixtures U sing SD A series of different concentrations of CEM or Toledo cells was spiked into a fixed concentration of NB4 cells in binding buffer. Cell mixtures were then used for binding assay (as described above). The populations of CEM/Toledo cells were gated based on t heir distinct sizes and applied to fluorescence intensity analysis. A similar assay was used to quantitatively compare the recognition capabilities of monovalent aptamers and SD. Specifically, 50,000 CEM/Toledo cells were spiked into 200,000 NB4 cells in binding buffer. Aptamers sgc8c, sgd5a, SD and random sequences were used for the binding assay to determine the percentage of cells that showed fluorescence signal enhancement. Self assembly and C haracterization of SD Dox A ptamer based carrier drug compl ex, SD Dox was formed by mixing Dox (Fisher Scientific, Houston, TX) and SD. The formation of SD Dox was monitored (Ex:

PAGE 142

142 480 nm, Em: 590 nm) on a Fluorolog Tau 3 spectrofluorometer (Jobin Yvon, Edison, NJ). The titration experiment by fluorescence spectrom etry was performed by sequential addition of increasing fractions of SD to Dox (1 M) in PBS (Sigma). The fluorescence of the resultant solution was recorded to monitor Dox intercalation efficiency. The dissociation constant (K d ) was determined by fitting the recorded fluorescence intensities to F= Bmax[L]/ (K d +[L]) ( 235 ) as explained above. Similarly, fluorescence anisotropy was studied with Dox (10 M) and increasing SD fraction (Ex: 480 nm, Em: 590 nm). Dox R elease S tudy Free Dox (20 M, 200 L) and SD Dox complexes (20 M Dox, [SD]: [Dox]=1.2:10, 200 L) were prepared and transferred into MINI Dialysis Units (3.5 MWKO, Thermo Scientific, MA). The unit bottoms were immersed in 3 mL PBS buffer in an individual well of a 6 well plate, with a magnetic rod in each well. The plate was placed on a magnetic stirrer (150 rpm). At the indicated time points, a 120 L aliquot from each well was collected for Dox fluorescence measurement and then returned to the corresponding well. A ptamer Internaliza tion and Drug U ptake All cellular fluorescent images were collected on the FV500 IX81 confocal microscope (Olympus America Inc., Melville, NY) with a 60x oil immersion objective (NA=1.40, Olympus, Melville, NY). Excitation wavelength and emission filters: TAMRA, 543 nm laser line excitation, BP 580 20 nm filter; Dox: 488 nm laser line excitation, emission BP 580 20 nm filter. Cells (210 5 in 200 L) were incubated at 37 C with aptamers, Dox, or SD Dox assembly for 2 h, followed by washing with washing buffer (1

PAGE 143

143 mL) twice at 4 C and suspending in binding buffer (200 L) before imaging. Each experiment was repeated three times and analyzed with Fluoview software. Cytotoxicity A ssay The cytotoxicity for each individual type of cells was determined using CellTiter 96 cell proliferation assay (Promega, Madison, WI, USA). Cells (5 10 4 cells/well) were treated with SD, Dox, linker Dox or SD Dox in medium without FBS (37C, 5% CO 2 ). After incubation for 2 h, cells were precipitated by centrifugation, 80% supernatant 2 h. The absorbance (490 nm) was recorded using a plate reader (Tecan Safire microplate reader, AG, Switzerland). Cell viability was determined as described by the manufacturer. The cytotoxicity of aptamer drug complexe s to mixed cells was determined using PI (Invitrogen, Carlsbad, CA). Cell mixtures (50,000 CEM or Toledo cells, 100,000 NB4 cells, in 500 L FBS free medium) were treated with aptamer drug complexe s for 1.5 h, Ce lls were stained with 1 g/mL PI at room temperature for 20 min to test target cell death by flow cytometry. Target cell populations were gated in flow cytometric results to f dead cell amount (in the range of M1 in Fig 5 B) to total cell amount.

PAGE 144

144 Table 5 1. Sequences of DNA probes Aptamer sequences were checked using NUPACK ( 172 ) to make sure the secondary structures of individual aptamer domain were minimally affected by the engineering for multi aptamer s Sgc8c ST, TDO5 ST, sgc8c SD and sgd5a SD : for the corresponding bi specific aptamer; Sgc8c SDT, TDO5 SDT and sgd5a SDT : for tri specific aptamer SDT. bi Sgc8c and biSgd5a : for S Dox or D Dox, respectively. S equences in bold were used for hybridization. Sgc8c ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA Sgd5a ACTTATTCAATTATCGTGGGTCACAGCAGCGGTTGTGAGGAAGAA AGGCGGATAACAGATAATAAG TDO5 CACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGT G Sgc8c T10 TDO5 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTT TTTTT ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG Sgc8c PEG TDO5 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA (PEG)6 ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG Sgc8c ST ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTT GTCTAGTCTTGCACCACGAG TDO5 ST CACCGGGAGGATAG TTCGGTGGCTGTTCAGGGTCTCCTCCCGGT GTTTTTTCTCGTGGTGCAAGACTAGAC Sgc8c SDT ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTT TTTTTGTCTAGTCTTGCACCACGAG TDO5 SDT AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCG GTGTTTTTTTTTTGTGTGATCGAAAGACTAGAC Sgd5a SDT TTT ACTTATTCAATTATCGTGGGTCACAGCAGCGGTTGTGAGGAAG AAAGGCGGATAACAGATAATAAG TTTTTTTCTCGTGGTGC TCGATC ACAC Sgc8c SD ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTA CGACGACGACGACGACGACGACGACGACG Sgd5a SD ACTTATTCAATTATCGTGGGTCACAGCAGCGGTTGTGAGGAAGAA AGGCGGATAACAGATAATAAGT TTCGTCGTCGTCGTCGTCGTCGT CGTCGTCGT bi Sgc8c ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTT C GACGACGACGACGATCGTCGTCGTCGTCG biSgd5a ACTTATTCAATTATCGTGGGTCACAGCAGCGGTTGTGAGGAAGAA AGGCGGATAACAGATAATAAGTTT CGACGACGACGACGATCGTCG TCGTCGTCG

PAGE 145

145 Table 5 2. Comparison of K d s (nM) of bi specific aptamer ST and SD with the K d s (nM) of the parent monovalent aptamers sgc8c, TDO5 and sgd5a. (ND: not determined) Cells CEM Ramos Toledo Sgc8c 0.780.10 ND ND TDO5 ND 74.78.7 ND Sgd5a ND ND 1.020.26 S T20 T 3.250.48 113.710.8 ND S hyb T 0.680.08 76.53.1 ND S hyb D 1.390.17 ND 1.350.11

PAGE 146

146 Figure 5 1. Scheme for a self assembl y of aptamer based drug carrier SD for bi specific cytotoxicity. Bi specific aptamer based drug carrer, SD, was self assembled from molecularly engineered aptamers S and D, simultaneously forming Dox intercalation sites in the dsDNA linker. Subsequently, Dox was loaded into SD through site specific Dox intercalation, bi specifically delivered into target cells in cell mixtures, and ind uce bi specific cytotoxicity. Figure 5 2. The formation of bi specific aptamer SD with a dsDNA linker and tri specific agarose gel electrophoresis. The red arrows indicate the bands for SD or SDT

PAGE 147

147 Figure 5 3. The specific bin ding abilities to both target CEM and Ramos cells were maintained for bi specific aptamers ST constructed through ( A ) a polyT linker (S T20 T), ( B ) a dsDNA linker (S hyb T), and ( C ) a PEG linker (S PEG T), respectively. ( D ) At 37 C, SD also maintained bi specific binding abilities to target CEM and Toledo cells, but not to non target NB4 cells.

PAGE 148

148 Figure 5 4 Bi specific binding ability of drug carrier SD. ( A ) SD maintained selective binding abilities to target CEM / Toledo cells, but not to non target NB4 cells. ( B ) flow cytometric analysis of CEM and Toledo cells in cell mixtures indicated that SD ha d broader recognition capabilities than sgc8c or sgd5a alone. C ell mixtures contain ed 50 ,000 CEM 50,000 Toledo and 200 ,000 NB4 cells. (M1: Ma rker of CEM/Toledo cells with enhanced fluorescence intensities )

PAGE 149

149 Figure 5 5. A ptamer binding assay showed the specific binding abilities of SDT to these cells. Cy5 FITC and PE were labeled on domains of sgc8c TDO5 and sgd5a respectively. The fluorescence intensity enhancement for all 3 fluorophores on cells tested with SDT indicated the tri specific ity of SDT recognition

PAGE 150

150 Figure 5 6. ( A ) The distinct morphologies of target CEM / Toledo cells from th at of the non target NB4 cells shown in f low cytometric analysis. ( B C ) SD specifically detected CEM (B) or Toledo (C) cells in cell mixtures containing NB4 cells as shown by a nalysis of the fluorescence intensity of CEM/Toledo cell population s gated from dot plots (in A) The last 4 curves show apparent fluorescence signal enhancement ( target cell density was as low as 5% ) indicating sensitive detection ability of SD in cell mixtures. (N umbers indicate the ratios of CEM /Toledo cell amount to NB4 cell amount )

PAGE 151

151 Figure 5 7. Confocal microscopy study showing that SD was readily internalized into CEM and Toledo cells after 2 h incubation at 37C. The TAMRA signal inside cells indicated the internalization of TAMRA labeled aptamers. The higher TAMRA intensities of cells incubated with S D compared to the corresponding cells with sgc8c or sgd5a can be explained by the fact that each aptamer domain of SD was modified with a TAMRA. (Scale bar: 50 m)

PAGE 152

152 Figure 5 8. Characterization of Dox loading into drug carrier SD. (A), The quenching of D ox fluorescence indicated loading of Dox into SD (also shown by the fluorescent image). K d was determined from F 590nm (B), The enhancement of fluorescence anisotropy with increasing SD fraction also indicated the association of Dox and SD. (C), Compared with free Dox, the slow Dox release from SD Dox suggested its good stability for up to 5 days.

PAGE 153

153 Figure 5 9. ( A ) Kinetics of the self assembly of SD Dox indicat ed rapid Dox intercalation into S D. ( B ) Fluorescence study indicating that the Dox intercalation sites are mostly localized in the dsDNA linker portion. Figure 5 10 Bi specific binding and Dox delivery abilities of drug carrier SD (A), SD Dox complex maintained bi specific binding ability to target CEM/Toledo cells, but not to non target NB4 cells. (B), Confocal microscopy study showed Dox was bi specifically delivered by SD and released into CEM/Toledo cells, as indicated by the more comparability of Dox fluorescence intensities in Dox and SD Dox treated CEM/Toledo cells, than that of NB4 cells. (Scale bar: 50 m).

PAGE 154

154 Figure 5 11. Free Doxorubicin induced cytotoxicity and inhibited cell proliferation in Toledo and NB4 cells in a dose dependent manner All data were from 3 independent experiments.

PAGE 155

155 Figure 5 12. Bi specific cytotoxicity of Dox delivered by SD. (A), MTS assay results showed that SD Dox complex induced higher normalized cytotoxicity in CEM/Toledo cells than in NB4 cells, indicating bi specific cytotoxicity in individual cells. (B), In cell mixtures, SD Dox also showed bi specific cytotoxicity compared with S Dox or D Dox, by PI staining. (M1: dead target cells with enhanced PI fluorescence intensity) Target cell death percentages (pe rcentage of target cells within M1 in total mixed cells) were calculated from the flow cytometric results above.

PAGE 156

156 CHAPTER 6 DRUG DNA ADDUCT AS NUCLEA SE RESISTANT CONJUGATES FOR TARGETED CANCER THERAPY S i gnificance and Background Conventional cancer chemotherapy suffers from side effects due to nonspecific toxicity to healthy cells ( 61 ) It is thus desirable to develop targeted therapy, in which drugs can specifically target cancer cells ( 200 ) Active targeting achieve s this by using targeting elements that can specif ically bind to overexpressed receptors on target cancer cells ( 236 ) The targeting elements range from antibodies ( 62 ) and aptamers to growth factors and vitamins ( 237 ) Passive targeting exploits the characteristic leaky blood vasculature and poor lymphatic drainage in tumors that allow nanocarriers to accumulate at tumor by the enhanced permeability and retention (EPR) effect ( 200 ) The nanocarriers include polymers ( 238 ) liposomes ( 65 ) gold nanoparticles ( 239 ) and nucleic acid nanostru ctures ( 125 127 131 ) DNA, essential for enco d ing transmit ting and express ing genetic information in nature, has been explored in development of targeting elements ( 109 133 ) polymer based drug carriers ( 240 ) and nanocarriers ( 125 131 ) in both active and passiv e targeted drug delivery. Aptamers, single stranded DNA (ssDNA) or RNA screened via Systematic Evolution of Ligands by EXponential enrichment (SELEX) ( 4 5 ) are excellent candidates as targeting elements for active targeted therapy ( 15 ) Recently, our group developed cell SELEX to select aptamers against living cells ( 212 ) thereby identif ied DNA aptamers against various cancer, including leukemia ( 17 20 ) lymphoma ( 18 ) and breast cancer ( 44 ) As targeting elements, aptamers possess many remarkable features such as automated chemical synthesis and modification, reproducible batch to batch fabrication, and low cytotoxicity and immunogenicity ( 15 35 ) DNA has also been

PAGE 157

157 extensively studied to develop polymer or nanostructure based drug carriers in passive targeted therapy, owing to the biodegrada bility and sequence programmability of DNA. Various DNA nanocarriers have been developed, including DNA origami ( 125 ) and DNA tetrahedral ( 127 ) Moreov er, DNA can serve as therapeutics, including antisense oligonucleotides ( 196 ) aptamers ( 15 ) and immunostimulatory CpG motifs ( 197 ) allowing multimodal combinat ion therapy in DNA based drug delivery systems. Overall, DNA is promising in the development of versatile target ed drug delivery systems. I t is therefore essential to effective ly conjugate drugs with DNA To accomplish this previous studies have used both noncovalent associations ( 70 109 133 ) and co valent conjugation of drugs and DNA ( 92 ) However, noncovalent associations typically require specific DNA sequences and hence modification with additional sequences for drug loading. For instance, many anthracycline drugs preferentially intercalate into double stranded (CG) sites ( 70 109 133 ) and TMPyp4 requires G quadruplex structures ( 107 ) Moreover, curren t covalent drug DNA conjugation typically involves chemical modification of DNA with functional groups, as well as complicated organic synthesis with low yield ( 92 ) It is also well known that DNA based drug delivery systems have generally low resistance to enzymatic degradatio n ( 241 ) Current strategies to prevent this include chemical modifications such as phosphorothioate linkages and 2 O methyl modification ( 241 ) and physical protection that prevents the access of nucleases ( 242 ) However, these strategies rely on either chemical modification of DNA or the involvement of other nanomaterials. It is therefore d esirable to develop a simple, yet versatile and efficient platform for drug DNA c onjugation which is resistant to nuclease degradation.

PAGE 158

158 This call s for the development of a new chemical species, or adduct, enabling covalent conjugation of drugs with DNA ( aptamer s or building blocks of nanocarrier s) such that the resultant drug DNA ad duct ( DDA ) is additionally endowed with resistance to nuclease cleavage In nature, adducts can be formed between genomic DNA ( dsDNA) and drugs such as Doxorubicin (Dox), Platinum, and Pyrrolobenzodiazepine ( 243 248 ) Indeed, add uct form ed between genomic DNA and drugs or hazardous chemicals is one of the mechanisms of their genotoxicity ( 249 ) Inspired by this we develop ed DDA in vitro using anticancer drugs and synthetic ssDNA (aptamers and DNA building blocks for drug carriers) fo r targeted cancer therapy (Figure 6 1). Results and Discussion Preparation, Validation, and Characterization of DDA As a model, a ssDNA sgc8 5T (sequences in Table 6 1), which was modified from aptamer sgc8 ( 17 ) was used for DDA preparation. Dox, a widely used drug in cancer therapy and naturally forms adducts with genomic DNA, was chosen in our study. Formaldehyde, widely used for protein or nucleic acid crosslinking ( 250 ) was used as a reducing and crosslinking agent for adduct formation. DDA was prepared by incuba ting DNA, and excessive drug and formaldehyde in reaction buffer at 10 C overnight (Figure 6 1A ), and purified by h igh performance liquid chromatography (HPLC) to remove residual drug and formaldehyde. In HPLC ( Figure 6 2 A ), DDA displayed strong absorbanc e at both 490 nm (exclusively from drug) and 260 nm (from both drug and DNA), while free DNA or reaction solution without formaldehyde displayed no apparent absorbance at 490 nm. This indicates the covalent conjugation of drug and DNA (DDA), which was furt her verified by gel electrophoresis ( Figure 6 3 ). Purified DDA was lyophilized, desalted, and stored at 20 C T he solid evidence of DDA formation came

PAGE 159

159 from electro spray ionization mass spectrometry (ESI MS) analysis, in which the DNA mass peaks shifted f rom 14592.8 Da to a series of larger molecular weights ( Figure 6 4A,B ). The mass differences between DDAs and pure DNA correspond to the molecular weights of ca. 1 to 6 copies of drug and methylene linker (Table 6 2 ), indicating conjugation of multiple copies of drug on one DNA. UV Vis spectrometry results further indicated the characteristic drug absorbance around 490 nm in DDA s but not in the control having no formaldehyde ( Figure 6 4 C 6 5 ). A red shift of DDA ab sorbance compared to free drug was also observed ( Figure 6 5B ) M olar extinction coefficients of 11,500 M 1 cm 1 at 480 nm for free Dox and 7,677 M 1 cm 1 at 506 nm for Dox in DDA were used for quantification ( 246 ) which showed DDA had 5.1 0.3 (s.d. n=3) drug molecules per DNA. The fewer average number of drug molecules ( ca. 3.21) attached on one DNA observed in ESI MS than that from UV Vis spectrometry presumably resulted from the degradation of DDA prior to ESI MS analysis. F luorescence spectrometry study showed the dramatic quenching of drug fluorescence in DDA ( Figure 6 4D 6 5C ) providing a simple basis for determining DDA formation. Adducts formed using genomic DNA and anthracycline drugs are heat labile ( 244 ) We therefore investigated the stability of DDA at 4 C in physiological buffer solution. A series of DDA aliquots were incubated at 4 C for different time lengths, respectively, followed by determining the amount of liberated drug using HPLC. No signifi cant amount of free drug was detected over 8 h, indicating high stability of DDA ( Figure 6 4E ). However, for most effective inhibition of cell proliferation, it is essential for Dox delivered by drug carriers to be release d and enter the nucleus ( 249 ) Thus, drug release from DDA was studied. A series of DDA aliquots were incubated at 37 C for

PAGE 160

160 different time lengths. Drug release monitori ng indicated that drug was released from DDA with a first order half life of 1.16 h and the maximum release of 38.4% of the initial drug amount under this condition ( Figure 6 4E ). Overall, DDA is exceptionally stable at a relatively low temperature (4 C ), but drug is still released at an appreciable rate at physiological temperature, providing the basis for high efficacy of drugs delivered by DDA based systems. The ability of DNA based drug carriers to resist nuclease degradation would be highly desirabl e. The biostability of DDA was then studied. DDA and its DNA counterpart were treated with DNase I and analyzed using gel electrophoresis. While DNA was rapidly degraded, DDA was much less susceptible to enzymatic cleavage than its DNA counterpart ( Figure 6 4F ). To rule out the possibility that the enzymatic activity was inhibited by DDA, DNase I was premixed with DNA and DDA, respectively, followed by introduction of a longer DNA (DNA ). DNA was degraded in both mixtures, indicating the DNase I premixed w ith DDA maintained enzymatic activity ( Figure 6 6 ). The mechanism of the resistance to enzymatic degradation remains unknown but it presumably involves conformational constraint result ing from drug conjugation. DDA provides a novel approach to protecting DNA during biomedical application. DDA formation was demonstrated to be applicable to various DNA and drugs. It is notable that thousands of anthracycline drugs have structures analogous to Dox, including the commonly used Daunorubicin (DNR) and Epirubic in (EPR) in cancer therapy. DNR and EPR also formed DDAs with sgc8 5T ( Figure 6 7A ). Furthermore, a panel of aptamers (KK1B10, TDO5, AS1411) ( 18 20 57 ) modified aptamers (sgc8 (CGA) 10 ), and non aptameric DNA sequences ((CGA) 10 (GC) 10 ) with distinct nucleotide

PAGE 161

161 compositions or sequences also formed Dox DNA adduct ( Figure 6 7B ). Even though Dox could intercalate in dsDNA, the physically intercalated Dox was removed during purification, as suggested in Figure 6 2B for sgc8 (CGA) 10 We fur ther studied the reactivities of different Deoxynucleo s ide s to form DDA. P revious studies using dsDNA and Dox showed that the methylene group generated from formaldehyde linked between the 3 NH 2 group of Dox on one side and the 2 NH 2 of mainly G uanine on t he other side ( 245 ) Since ssDNA was mostly used in our study and Adenosine and Cytosine also have NH 2 groups, 20 mer polyA, polyG, polyC and polyT were used for preliminary studies. Results showed that G had high reactivity, while A, C and T showed very low to negligible reactivity ( Figure 6 8 ), implying that the number of drugs conjugated onto one DNA should be determined mainly by G content and could guide DNA design to develop DDA based drug delivery systems. In another way, this demonstrates the wide applicability of DNA for DDA formation. Adduct formation primarily on Guanosine is also speculated to cause drug fluorescence quenching in DDA ( Figure 6 1B ), given that Guanosine can quench fluorescence of some prox imal fluorophores through electron transfer ( 251 ) DDA Building Blocks for Nanostructure Assembly To study the applicability of DDAs as building blocks of drug carriers, we then studied whether the DNA backbone in DDAs maintained the ability o f hybridization, which is fundamental to assemble DNA nanocarriers. A bi specific aptameric nanocarrier, assembled by hybridization of the two toeholds extending from aptamers sgc8 and KK1B10 ( 70 ) was used as a model ( Figure 6 9A ) The monomers sgc8 hyb and KK1B10 hyb were first used to prepare DDAs with Dox, and the DDAs were mixed to allow hybridization. Agarose gel electrophoresis ( Figure 6 9B ) clearly showed the

PAGE 162

162 formation of a bivalent aptameric structure using DDA building bloc ks, demonstrating the ability of DDAs to form nanostructures by hybridization. DDA Prepared Using Aptamers for Selective Target Recognition We next evaluated whether the DNA aptamer backbone in DDA retain ed the ability to fold into aptamer structures and specifically recognize targets. As mentioned above, a modified aptamer sgc8 was intentionally used to prepare DDA, or drug aptamer adduct (DAA). S gc8 can bind to target protein PTK7 a pseudokinase over expressed on many types of cancer cells including targ et CEM cells ( 17 76 ) but not on nontarget Ramos cells. The binding ability of DAA prepared from biotin ylated sgc8 was monitored by using a streptavidin PE Cy5.5 dye conjugate in flow cytometry. The dramatic enhancement of fluorescence intensity of cells incubated with sgc8 Dox adduct compared to negative control suggests the selective binding ability of th is DAA to target CEM cells ( Figure 6 10A ), but not to nontarget Ramos cells ( Figure 6 10B ). DAA has strong binding affinity to target CEM cells, as indicated by the dissociation constant ( K d = 5.98 0.78 nM) ( Figure 6 11 ) which is slightly higher than sgc 8 alone ( K d = 0.8 nM) ( 17 ) presumably due to minor probe conformational changes caused by drug conjugation. DAAs formed from aptamer and DNR and EPR also specifically recognize target cells with strong binding affinities ( Figure 6 10C 6 11B,C ). So did DAAs formed from KK1B10, TDO5, modified aptamers sgc8 (CGA) 10 ( Figure 6 10D 6 11D,E ). This indicates that DDA maintained its ability of three dimen s ional structure folding, providing the basis for universal DAA application in targeted drug delivery. DAA for Targeted Cancer Therapy We then studied the application of DAA in targeted drug delivery. The intracellular behaviors of free drug and drug deli vered via DAA (sgc8 Dox adduct as a

PAGE 163

163 model) were examined by confocal laser scanning microscopy (CLSM). Target CEM cells were incubated with free Dox and sgc8 Dox adduct, respectively, followed by staining with transferrin Alexa633 to localize endosomes pri or to microscopy observation at various time points. Free Dox rapidly entered cells and accumulated in the nucleus ( Figure 6 12 ), and cells treated with DAA also displayed gradual drug uptake and release from DAA and subsequent accumulation in the nucleus ( Figure 6 13A ). Compared to free drug, the corresponding weaker drug fluorescence in DAA treated cells is presumably due to the slower uptake of DAA than free drug and the quenched drug fluorescence in DAA until release Furthermore, CLSM ( Figure 6 13B ) id entified Dox in cytoplasm during the early stages of cell permeation and gradually accumulating in the nucleus, while aptamer staying in the cytoplasm. Dox release from DAA and accumulation in the nucleus provide the basis to inhibit cell proliferation. T he cytotoxic ity of sgc8 Dox adduct was then evaluated using an MTS assay with free Dox as a control F ree Dox showed dose dependent cytotoxicity in both CEM cells and Ramos cells ( Figure 6 13C,D ) In contrast, only in target CEM cells did sgc8 Dox adduct induce cytotoxicity comparable to that of free Dox, indicating robust cytotoxic ity of sgc8 Dox adduct in target cells and the selectiv ity of cytotoxicity mediated by DAA As a control, aptamer (without drugs) with the same treatment and purifi cation by HPLC failed to induce significant cytotoxicity ( Figure 6 13E ). This demonstrates the biocompatibility of the aptamer and removes the concern that formaldehyde, as a carcinogen, would remain in product and induce cytotoxicity. In vivo evaluation of the application of DAA for targeted cancer therapy was performed in a liver cancer xenograft mouse model, in which aptamer AS1411 was

PAGE 164

164 chosen as a model because of its promising application in cancer treatment ( currently in phase II clinical trials ) ( 252 ) It binds to plasma membrane nucleolin ( 253 ) that is highly expressed on many types of cancer cell s ( 254 ) AS1411 specifically bound to liver cancer cells with strong affinity ( 6 15A ) w hich w as confirmed by paraffin embedded HCC patient samples ( Figure 6 1 5 B ). Overall, t hese results indicate that AS1411 is promising for application in targeted liver cancer therapy. AS1411 Dox adduct was prepared and determined to have 5.4 0.1 (s.d., n = 3) c opies of Dox moieties per AS1411 strand, and a control DNA ((CGA) 10 ) was used to prepare adduct with Dox. AS1411 Dox adduct specifically bound to Huh7 cells with strong affinity ( K d = 57.3 8.1 nM ) ( Figure 6 14 A, 6 1 5 A ) which is comparable to that of AS1411. In contrast, neither the control DNA nor its DDA bound to Huh7 cells ( Figure 6 1 4 B ). CLSM demonstrated specific uptake and Dox release of AS1411 Dox adduct in Huh7 cells ( Figure 6 1 4 C ). Furthermore, the in vitro specific cytotoxic ity of this adduct in Huh7 cells was again confirmed by an MTS assay whereas neither aptamer AS1411 nor control DNA Dox adduct induced potent cytotoxicity ( Figure 6 1 4 D ) With in vitro validation of AS1411 Dox adduct for selective inhibition of liver cancer cell proliferation, the in vivo therapeutic efficacy was evaluated. NOD. Cg Prikdc (scid) IL2 mice inoculated with Huh7 cells were divided into four groups After tumor initiation, t hey were treated through tail vein injection with AS1411 alone, AS1411 Dox adduct, control DNA Dox adduct and free Dox itself respectively T umor size and mouse weight, as an indicator of side effects, were measured every other day and the average tumor growth rate s ( Figure 6 1 5 C ) were calculated accordingly The mice treated with free Dox or AS1411 Dox adduct all had significant ly lower rate s of tumor

PAGE 165

165 growth than those treated with AS1411 or control DNA Dox adduct The more inhibition of tumor progressi on induced by control DNA Dox adduct than that of AS1411 is presumably because the gradual release of Dox from adduct at physiological temperature before clearance. AS1411 Dox adduct showed potent antitumor efficacy (comparable to that of free Dox ) with, more importantly dramatically reduced side effect s as indicated by reduced weight loss At the end of treatment, the mice treated with Dox lost 22.4% of their weight on average, while AS1411 Dox adduct group lost only 7.17% body weight (P<0.01) ( Figure 6 15D ). The s ide effect s were further studied by Western Blotting to examine induced apoptosis as indicated by the present of cleaved Caspase 3 which indicates the activation of Caspase 3 in heart and kidney of treated mice Results showed that cleaved C aspase 3 was present in tumor samples of mice treated with AS1411 Dox adduct, control DNA Dox adduct and free Dox, indicating cytotoxicity towards tumor, while there was no detectable amount of cleaved Caspase 3 in tumor samples from AS1411 treated mice ( F igure 6 15E ). This result agreed with that More importantly, only in free Dox treated mice, was the cleaved Caspase 3 identified in heart and kidney, suggesting the specific cytotoxicity and reduced si de effects of DAA Alt ogether these data indicate that AS1411 Dox adduct show ed potent anti tumor therapeutic eff icacy but with reduced side effects Conclu d ing Remarks Aiming at targeted cancer therapy, we report a simple yet versatile and efficient platform o f DDA as covalent drug DNA conjugates, inspired by natural adduct formation. DDA formation was widely applicable, without any modification of DNA for drug conjugation. O ne routine unmodified ssDNA could be typically conjugated with multiple

PAGE 166

166 copies of drug. Preliminary studies indicated that DDAs were formed mainly on Guanine, providing insight into future DNA design for the development of DDA based drug delivery systems. DDA was less susceptible to enzymatic degradation, provid ing a new strat egy to combat nuclease degradation for DNA based drug delivery systems. DDA was exceptionally stable at relatively low temperature (4 C in our study) but gradually released drugs at physiological temperature (37 C ). DDAs retained the ability to assemble nano carrier s by hybridization, which could be further used as drug nanocarriers in targeted drug delivery. DAA formed from aptamers maintained the selectivity in cancer cell recognition and drug delivery. We established the feasibility of aptamer AS1411 f or specific liver cancer recognition, and the in vivo evaluation of AS1411 Dox adduct, as a model of DAA, was performed in a xenograft liver cancer mouse model. The DAA showed potent antitumor efficacy with reduced side effects compared to free drugs. This clearly demonstrated the applicability of DAA for targeted cancer therapy. Overall, t he se results make DDA promising for broad application and production scale up in DNA based target cancer therapy Materials and Methods DNA Preparation All DNA synthesi s reagents were purchased from Glen Research, and all DNA probes ( see sequences in Table S 1) were synthesized on an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA, USA) based on solid state phosphoramidite C biotin or Cy5 was coupled on the 5 or 3 end s of these DNA probes (see Table S1 for sequences), if applicable DNA sequences were deprotected in AMA (ammonium hydroxide/40% aqueous methylamine 1:1) at 65C for 30 min. Deprotected DNA was further purified with reversed phase

PAGE 167

167 HPLC (ProStar, Varian, Walnut Creek, CA, USA) on a C 18 column using 0. 1 M triethylamin e acetate (TEAA, Glen Research Corp.) and acetonitrile (Sigma Aldrich, St. Louis, MO) as the eluent. The collected DNA products were dried and detritylated by dissolving and incubating DNA products in 200 L 80% acetic acid for 20 minutes. The detritylated DNA product was precipitated with NaCl (3 M, 25 L) and ethanol (600 L). UV Vis measurements were performed with a Cary Bio 100 UV/Vis spectrometer (Varian) for DNA quantification. DDA P reparation Using a modified protocol ( 246 ) DDAs were prepared by incubating drugs (500 M), DNA (20 M), and formaldehyde (0.37%) in reaction buffer ( 20 mM sodium phosphate, 150 mM NaCl, and 0.5 mM EDTA ; pH 7.0 ) at 10 C overnight. The r esultant DDA was purified by reverse phase h igh performance liquid chromatography (HPLC) (ProStar, Varian, Walnut Creek, CA, USA) on a C 18 column using 0.1 M Triethylamine Acetate (TEAA Glen Research Corp.) and acetonitrile (Sigma Aldrich, St. Louis, MO) as the eluent. Samples were lyophilized using a freeze dryer ( Thermo Electron Co .), subjected to desalting or buffer exchange using DPBS buffer ( Sigma Aldrich ), and stored at 20 C for future use. DDA D etermination and Q uantification DDA formation was verified and quantified by agarose gel electrophoresis (3%, 100 V, 50 min, 4 C ), electrospray ionization mass spectrometry (ESI MS) (Novatia, Inc.), and UV Vis spectrometry using a Cary B io 100 UV Vis spectrometer (Varian) M olar extinction coefficients of 11,500 M 1 cm 1 at 480 nm for free Dox and 7,677 M 1 cm 1 at 506 nm for covalently bound Dox in DDA were used for adduct quantification by UV Vis spectrometry

PAGE 168

168 Resistance of DDA to N uclease D egradation DNA (2 M) or DDA (4 M DNA equivalents) were diluted into DNase I reaction buffer ( 10 mM Tris HCl 2.5 mM MgCl 2 0.5 mM CaCl 2 pH 7.6 at 25C ). DNase I (0.05 U/ L) was added to the resultant solutions followed by incubation for 10 min at room temperature and deactivation by heating at 75 C for 5 min prior to agarose gel electrophoresis analysis. To study the enzymatic activity of DNase I premixed with DDA, either DNA (4 M) or DDA (8 M DNA equivalents) was again diluted into DNase I reaction buffer and incubated with DNase I (0.1 U/ L) for 5 min at room temperature, followed by addition of DNA (4 M) and further incubation for 5 min at room temperature. The resultant samples were deactivated by heating at 75 C for 5 min and then subjected to agarose gel electrophoresis (3%, 100 V, 50 min, 4 C ). Determination of B inding A bilities and B inding A ffinities The binding abilities of aptamers or drug aptamer adducts (final DNA or DNA equivalent concentration: 200 nM) were determined by incubating with the corresponding cells (210 5 ) in binding buffer (200 L 4.5 g/L glucose 5 mM MgCl 2 0.1 PBS (Sigma) ) on ice for 30 min, followed by w ashing twice with washing buffer (1 mL 4.5 g/L glucose and 5 mM MgCl 2 Streptavidin dye (PE Cy5.5, PE, or Alexa488) conjugates were then added and incubated in binding buffer (100 L) for 20 min, followed by washing twice with washing buffer. Precipitated cells were suspend ed in binding buffer (200 L) prior to flow cytometric analysis on a FACScan cytometer (BD Immunocytometry Systems) Data were analyzed with the WinMDI software R andom DNA sequences (lib) were used as negative controls.

PAGE 169

169 Binding affinities of DAAs were determined using a series of probe concentrations. As negative controls, similar assays were performed using random sequences at the same corresponding concentration s. The increased mean fluorescence intensities of cells bound by dye labeled DAAs compared with those of random sequences were used to calculate the equilibrium dissociation constant ( K d ) by fitting the dependence of fluorescence intensity of cells bound b y probes ( F ) on probe concentration ( L ) to equation 1 : F = B max [ L ]/ ( K d +[ L ]) [ 6 1] W here B max represents the maximum binding capacity. The binding assay was repeated three times. In V itro C ytotoxicity A ssay The cytotoxicity of free drug or DAA s was evaluated using CellTiter 96 cell proliferation assay (Promega, Madison, WI, USA). Cells (5 10 4 cells/well) were treated with free Dox and DAAs in medium without FBS (37C, 5% CO 2 ). After incubation for 1 h, cells were precipitated by centrifugation, 8 5 % supernatant medium was removed, was added for further cell growth (48 h) Then cells were again precipitated, and medium was removed ach well and incubated for 1 2 h. The absorbance (490 nm) was recorded using a microplate reader (Tecan Safire microplate reader, AG, Switzerland). Cell viability was determined according to the s description. In V ivo E valuation of DAA for T arget C ancer T herapy NOD. Cg Prkdc (scid) IL2 mice were purchased from Jackson Laboratory (Bar Harbor, ME) and maintained under pathogen free conditions. The animal use protocol

PAGE 170

170 was approved by the University of Florida Institutional Animal Care and Use Co mmittee on animal care. The tumor xenograft mouse model was developed by subcutaneously injecting 5 10 6 in vitro propagated Huh7 HCC cells (in 100 L DPBS buffer) into Cg Prkdc (scid) IL2 mice on the back. Dorsal t umor nodules were allowed to grow to a volume of 100 mm 3 before treatment initiation Tumor bearing mice were randomly assigned to four group s, with 5 mice in each group: (i ) treated with AS1411; ( ii ) treated with free Dox; ( iii ) treated with control DNA Dox adduct; a nd (iv) treated with AS1411 Dox adduct The Dox dosage was kept the same at 2 mg/kg the AS1411 in group (i) dosage was accordingly maintained the same to that in group (iv) Drugs were injected through tail vein s every other day, and tumor length and widt h for each mouse were measured with calipers every other day. T umor volume was calculated using the following equation : Tumor volume = length width 2 /2 [ 6 2] T he body weight of each mouse was also measured every other day to monitor the potential drug toxicity Mice were killed when tumor volume exceeded 2000 mm 3 or developed ulceration. Western B lotting A nalysis Heart, kidney and tumor tissues were harvested from experimented mice and lysed in RIPA buffer containing Proteinase Inhibitor C oc ktail (Sigma Aldrich) and incubated on ice for 30 min. After centrifugation at 13300 g for 15 min at 4 C, the supernatant was transferred to a fresh tube and the concentration of the protein was determined by Bio Rad Protein Assay (Bio Rad) according to manufa cture prot oc ol. 20 g of protein were subjected to SDS PAGE on 12% gels. The proteins then were transferred onto nitr oc ellulose membranes and probed with cleaved caspase 3 antibody

PAGE 171

171 (Cell Signaling Technology, Inc.), followed by the appropriate secondary an tibody with HRP conjugated (Santa Cruz Biotechnology, Inc.). Immunoreactive bands were detected using SuperSignal West Pico Substrate (Thermo Scientific). Cell C ycle A nalysis U sing Propidium Iodide Huh7 liver cancer cells were seed in 6 well plate at 100,0 00 cells/well and treated with 5 M of AS1411 for 24 h or 48 h. At the end of the treatment, cells were trypsinized, collected and washed twice in ice cold PBS. Cells were then fixed with ice cold 70% ethanol at 20 C for 30 min. Cells were then collected and washed twice in cold PBS and subsequently incubated with freshly made 20 g/m L PI and 100 g/m L RNaseA in cold PBS for 1 h at 4 C in the dark. Cell cycle was analyzed by flow cytometry and data were analyzed by FlowJo software.

PAGE 172

172 Table 6 1 Sequences of DNA probes Biotin or Cy5 were synthesized on the 3 ends, if applicable. Sequence (5' 3') Sgc8 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA Sgc8 5T ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAT TTTT DNA TTCCCGGCGGCGCAGCAGTTAGATGCTGCTGCAGCGATACG CGTATCGCTATGGCATATCGTACGATATGCCGCAGCAGCATC TAACCGTACAGTATT KK1B10 ATCCAGAGTGACGCAGCAGATCAGTCTATCTTCTCCTGATGG GTTCCT ATTTATAGGTGAAGCTGGACACGGTGGCTTAGT TDO5 AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCT CCGGTG AS1411 GGTGGTGGTGGTTGTGGTGGTGGTGG (CGA) 10 (Control DNA for A S1411) CGACGACGACGACGACGACGACGACGACGA (GC) 10 GCGCGCGCGCGCGCGCGCGC S gc8 (CGA) 10 ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAT TTCGACGACGACGACGACGACGACGACGACGA A 20 AAAAAAAAAAAAAAAAAAAA G 20 GGGGGGGGGGGGGGGGGGGG T 20 TTTTTTTTTTTTTTTTTTTT C 20 CCCCCCCCCCCCCCCCCCCC sgc8 hyb ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAT TTTTGTCTAGTCTTGCACCACGAG KK1B10 hyb ATCCAGAGTGACGCAGCAGATCAGTCTATCTTCTCCTGATGG GTTCCTATTTATAGGTGAAGCTGGACACGGTGGCTTAGTTTTT TCTCGTGGTGCAAGACTAGAC

PAGE 173

173 Table 6 2. Copy numbers of drug conjugated on one DNA ( sgc8 5T biotin ) in DDA mixtures and the DDA percentages calculated from ESI MS data (Fig. 2 A B ). The highest mass peak for each peak cluster was used as the representative mass for drug copy estimation, and the drug copy numbers were estimated using the following equation: Drug copy = D e lta Mass /MW (drug+linkage) where MW (drug+linkage) is the th eoretical molecular weight difference (557.5 Da) resulted from the addition of one drug copy on DNA through methylene linkage. The measured d elta m ass was slightly larger than the corresponding predicted delta mass, which presumably resulted from the conju gation of DDA with other moieties such as formaldehyde. Mass (Da) Delta Mass (Da) Drug copies %Total DNA 14592.8 DDA 1 15189.5 596.7 1.07 10.9 DDA 2 15730.5 1137.7 2.04 11.0 DDA 3 16297.0 1704.2 3.06 23.5 DDA 4 16853.3 2260.5 4.05 25.2 DDA 5 17429.2 2836.4 5.09 16.4 DDA 6 17958.0 3365.2 6.04 5.9 Subtotal 92.9

PAGE 174

174 Figure 6 1. N ature inspired nuclease resistant drug DNA adduct (DDA) for targeted cancer therapy. A DDA was constructed by conjugating multiple copies of chemotherapeutic drugs with synthetic ssDNA, mainly on the 2 NH 2 of Guanine, with formaldehyde as a crosslinker. DDA was resistant to nuclease degradation and maintained the functionalities of DNA backbones for aptamer structure folding and nanostructure formation by hybri dization, features important for targeted drug delivery. Drug fluorescence was quenched upon conjugation to DNA. B the resultant DDA prepared from Dox and aptamer was studied for targeted cancer theapy.

PAGE 175

175 Figure 6 2. HPLC purification data showing the absorbance as a function of retention time for pure DNA, control (DNA + Dox), and DDA (DNA + Dox + formaldehyde), where DNA in A) was sgc8 5T, and in B) was sgc8 (CGA) 10

PAGE 176

176 Figure 6 3. An agarose gel electrophoresis image acquired under UV irradiation displaying the band for DDA (sgc8 5T Dox adduct, lane 3) and that of DNA only (sgc8 5T, lane 2). The bright field image shows a red band corresponding to the DDA.

PAGE 177

177 Figure 6 4. Determinati on and characterization of DDA. A B Deconvoluted ESI MS spectra of sgc8 5T biotin ( A ) and DDA prepared from Dox and sgc8 5T biotin ( B ). Compared with free DNA, the peaks (DDA1 6) shifted to larger molecular weights in ( B ), corresponding to DDA with 1 6 drugs conjugated on one DNA (Table S2). C UV Vis absorbance spectra of DDA and control (reaction solution without formaldehyde). D Fluorescence spectra of free Dox (2 M), DDA (2 M Dox equivalents), and control. E Drug release study by HPLC indicating the high stability of DDA at 4 C and conditional drug release at physiological temperature (37 C ). (Fit curves: solid lines) F An image of agarose gel electrophoresis showing DDA (2 M DNA equivalent) resisting nuclease (0.05 U/L DNase I) degradation (Lanes: 1, DNA; 2, DNA + DNase I; 3, DDA; 4, DDA + DNase I; 5, DNA ladder).

PAGE 178

178 Figure 6 5. A B Images showing free drug (Dox), pure DNA (sgc8 5T), control (DDA reaction solution without formaldehyde), and DDA (sgc8 5T Dox a dduct) in bright field ( A ) and under UV irradiation ( B ). The DDA color resulted from the absorption of drug ( A ), and the drug fluorescence in DDA under UV irradiation was greatly quenched ( B ). DDA I and DDA II are replicates. C UV Vis absorption spectra of free drug (Dox) and DDA (sgc8 5T Dox adduct), indicating the red shift of DDA compared to free Dox. Figure 6 6. An image of agarose gel electrophoresis showing that DNase I (0.05 U/L) premixed with DDA maintained sufficient enzymatic activity to degrade the 98 mer DNA segment, DNA' (2 M), implying that the negligible DDA cleavage by DNase I resulted from the nuclease resistance of DDA, rather than the loss of enzymatic activity of DNase I. DNA: sgc8 5T biotin; DDA: prepared from sgc8 5T biotin a nd Dox.

PAGE 179

179 Figure 6 7. Wide applicability of DDA platform. A DDA formation using DNR and EPR. Purified DDA was quantified by absorbance at 506 nm, which was normalized to that of the corresponding control ( reaction without formaldehyde). B DDA formation with Dox and various DNA. (Control: reaction using sgc8 5T without formaldehyde) Figure 6 8. Average drug copy numbers in one DNA in adducts prepared from Dox and polynucleotides (A20, G20, C20 and T20). Data suggest that Guanine has the high est reactivity for forming adduct with this drug.

PAGE 180

180 Figure 6 9. Nanostructure formation using DDA as building blocks. A Schematic representation of nanostructure (bi specific aptamer sgc8 KK1B10) formation by hybridization of two DDA building blocks. B An agarose gel electrophoresis image displaying the formation of this nanostructure from sgc8 Dox and KK1B10 Dox adduct building blocks. The upper bands in lanes 2, 3, and 4 resulted from self dimers, and the lower band in lane 5 resulted from excess mono meric KK1B10 hyb Dox adduct, according to size comparison. The pinkness of the band denoted by the arrow in the bright field image resulted from the absorption of drug moiety in DDA.

PAGE 181

181 Figure 6 10. Specific recognition abilities of DAA. A B Flow cytometry data showing the selective recognition ability of DAA to target CEM cells ( A ), but not to nontarget Ramos cells ( B ). C D Flow cytometry data verifying the specific recognition abilities of sgc8 DNR and sgc8 EPR adducts ( C ), and sgc8 (CGA) 10 Dox adduct ( D ) to target CEM cells. (lib: random sequences)

PAGE 182

182 Figure 6 11. Specific recognition abilities of DAAs to the corresponding target cancer cells. A B Binding affinities of sgc8 DNR and sgc8 EPR adducts to target CEM cells, as determined by flow cytometry. C D Flow cytometry results indicating that DAA constructed from different aptamers maintained specific binding abilities to the corresponding targe t cells (K562 cells for KK1B10, Ramos cells for TDO5). lib: random sequences.

PAGE 183

183 Figure 6 12. Confocal laser scanning microscopy images at different time points indicated the rapid entry of free Dox (2 M) to CEM cells. Transferrin Alexa633 (60 nM) was used to localize endosomes (Scale bar: 100 m).

PAGE 184

184 Figure 6 13. DAA (sgc8 Dox adduct) for targeted anticancer drug delivery. A, Confocal laser scanning microscopy (CLSM) images displaying delivery and release of Dox from sgc8 Dox adduct (2 M Dox equiva lents) into CEM cells at different time points. Transferrin Alexa633 (60 nM) was used to localize endosomes. B, CLSM images displaying the intracellular behaviors of Dox and Cy5 labeled sgc8 in CEM cells treated with sgc8 Dox adduct (2 M Dox equivalents) for 2 h. Insets are enlarged cells. C E, MTS assay results indicating selective cytotoxicity induced by sgc8 Dox adduct in CEM cells (C), but much less in Ramos cells (D), whereas sgc8 that went through the same preparation procedure without drugs in reaction solution did not induce apparent cytotoxicity, indicating good biocompatibility (E).

PAGE 185

185 Figure 6 14 A Flow cytometry results indicating specific recognition ability of AS1411 to Huh7 liver cancer cells. B Dissociation constant ( K d ) of AS1411 Dox adduct binding to Huh7 cells indicates strong binding affinity of this adduct to target liver cancer cells, as determined by flow cytometry. C Flow cyto metry results indicating that H 5 h7 cells were not able to be specifically recognized by the control DNA or the control DNA Dox adduct. D Confocal laser scanning microscopy images displaying uptake of Dox into Huh7 cells from free Dox, AS1411 Dox adduct, and control DNA Dox adduct, respe ctively. Cells were stained with Hoechst 33342 to localize nucleus. (Scale bar: 50 m) E MTS assay results indicating the specific and potent cytotoxicity in target Huh7 cells induced by AS1411 Dox adduct. Cells were also treated with free Dox, AS1411, an d control DNA adduct, respectively, as controls.

PAGE 186

186 Figure 6 15 I n vivo evaluation of DAA for targeted cancer therapy. A, flow cytometry data showing the specific recognition ability of AS1411 and AS1411 Dox adduct to HCC Huh7 cells. B, Biotinylated AS1411 (200 nM) stained membrane nucleolin on tumor tissues, but not on non tumor parts in Paraffin embedded patient samples. Signal was developed using HRP conjugated streptavidin and DAB peroxidase substrate. C,D, Potent antitumor efficacy and reduced side eff ects of DAA ( AS1411 Dox adduct), as shown by tumor progression (C) and mouse weight (D) up to day 10 (mean s.d.; n = 5). Huh7 xenograft mouse tumor model was developed by subcutaneous injection of Huh7 cells in the back of NOD. Cg Prkdc (scid) IL2 mice. Mice were divided into four groups that are respectively treated by intravenous injections of AS1411 (black), Dox (red), AS1411 Dox adduct (green) or Control DNA Dox adduct (blue), with 2 mg/kg Dox or Dox equivalent dosages. E, Western Blotting assay showing the activation of Caspase 3 in tumors, heart and kidney of mice with different treatments.

PAGE 187

187 CHAPTER 7 FUTURE DIRECTIONS AN D CONCLUSIONS Future Directions We envision continuing our work in t he following directions: explor ation of more theranostic applications of the technologies we developed and evaluation of the systems we have developed in animals and in clinic for disease theranostics The basic technologies we have developed have the potential to fi nd versatile biomedical applications including theranostics. For instance, our DNA nanotrains can be used for further bioanalysis of disease related biomarkers either in non biological environment, in extracellular matrix, on cell membrane, or inside cells These nanotrains can also be applied for targeted delivery of other therapeutic agents, including siRNA, immunostimulatory CpG, small molecular drugs, etc. Our nanoflowers are also pioneering in t his field, and should deserve deeper study regarding the a ssembly mechanism, unique NF properties, as well as manipulation of NF assembly, and should also find various applications in biomedicine. So does our DDA technology, which provides an unprecedently simple yet efficient and versatile platform for covalent and stable DNA drug conjugation. The DDA s ability to resist nuc lease degradation empowers it with structural integrity during application in complicated biological environments. The ability to conjugate multiple copies of drugs with one synthetic DNA enables the resultant drug delivery systems with high drug payload c apacity. This technology has been evaluated in a xenograft liver cancer mouse model, and demonstrated the capability of targeted cancer therapy achieved potent therapeutic efficacy with reduced side effects. Future studies could be performed to study a w ider range of therapeutics using this technology, and also exploit the possibility of using the

PAGE 188

188 resultant DDA building blocks to construct drug nanocarriers for targeted drug delivery. Furthermore, it is worth to note that Antibody drug conjugate is a hot topic in pharmaceutic industry these days, however, the sensitivity of antibody to environment is a potential harm for harsh and complicated conjugation preparation. In contrast, our DDA provide a dramatically easier platform for aptamers, as a counterpart of antibody. Our simple multi aptamer platform also represent a unique advantage over its counterpart, multi antibody, the development of which is important for biomedicine but is simultaneously tedious and complicated. Thi s platform holds promise in mult i target recognition during disease theranostics Conclu d ing Remark s As a biomaterial, DNA holds unique advantages over other counterparts in the field of nanomedicine. Specifically for targeted cancer theranostics, there are two main fields which DNA mainly con tributes to: aptamers as specific recognition probes and DNA nanostructures used as drug nanocarriers. DNA aptamers can be selected rapidly and conveniently against a wide range of targets, including cancer cells and tissues. Therefore, they have been exte nsively studied for specific cancer cell or tissue recognition in theranostics. DNA n anotechnology has allowed the constructi on of various nanostruc tu res for various applications, including biomedicine. Furthermore, the programmability of DNA allows DNA nanostructures to be self assembled through versatile approaches. In this work, we focused on the development of aptamer mediated DNA nanomedinces for cancer cell analysis and targeted cancer therapy. In Chapter 2, we developed aptamer tethered DNA nanotrains (aptNTrs) as carriers for targeted drug transport (TDT) in cancer therapy Long a ptNTrs were self assembled from only two short DNA upon initiation by modified aptamers, which work ed

PAGE 189

189 like locomotives guiding nanotrains toward target cancer cells Meanwhile, tandem d as carriers with high payload capacity of drug s that were transported to target cells and induce d selective cytotoxicity. AptNTrs enhanced MTD in nontarget cells. Potent anti tumor efficacy and reduced side effects of drugs delivered by biocompatible aptNTrs were demonstrated in a xenograft mouse tumor model. Moreover, fluorophores on nanotrains and d rug fluorescence dequenching upon release allowed intracellular signaling of nanotrains and drug s These results make aptNTrs a promising TDT platform for cancer t heranostics. In Chapter 3, we report 1) the anchoring of preformed DNA nanodevices and 2) the in situ self assembly of DNA nanodevices on target living cell surfaces. To achieve the first goal, three types of fluorescent DNA nanosensors were built using an aptamer tethered DNA nanotrain (aptNTr) platform. These aptNTrs were self assembled through a hybridization chain reaction (HCR) and anchored on cell surface s by target specific aptamer recognition. To achieve the second goal, an aptamer tethered seed probe was attached to the cell surface to provide a protruding toehold for subsequent cascading hybridization of two partially complementary monomers. This in situ nanodevi ce assembly was further demonstrated on the surfaces of target cells in complex cell mixtures As a tool for bioanalysis and bio regulation these fluorescent DNA nanosensors were capable of exhibiting fluorescence emission and undergoing fluorescence energ y transfer to detect molecular interactions. As such, we envision future in situ construction of nanofactories on target living cell surfaces for pinpoint analysis and importantly, regulation of biological activities.

PAGE 190

190 In Chapter 4, we developed the nonca nonical self assembly of multifunctional DNA nanostructures, termed as nanoflowers (NFs), and the versatile biomedical applications These NFs were assembled from long DNA building blocks generated via Rolling Circle Replication (RCR) of a designer templat e. A number of evidence indicates that NF assembly was driven by liquid crystallization and dense packaging of building blocks, without relying on Watson Crick base pairing between DNA strands, thereby avoiding the otherwise conventional complicated DNA se quence design. NF sizes were readily tunable in a wide range (diameters: ca. 200 nm 4 m in our study), by simply adjusting such parameters as assembly time and template sequences. NFs were exceptionally resistant to nuclease degradation, denaturation, o r dissociation at extremely low concentration, presumably resulting from the dense DNA packaging in NFs. The exceptional biostability is critical for biomedical applications. By rational design, NFs can be readily incorporated with myriad functional moieti es. All these properties make NFs promising for versatile applications. As a proof of principle demonstration in this study, NF s were integrated with multiple functional moieties, including aptamers bioimaging agents, and drug loading sites, and the resultant multifunctional NFs were demonstrated for selective cancer cell recognition, bioimaging, and targeted anticancer drug delivery. In Chapter 5, t o address heterogeneity among cancer subtypes for targeted drug delivery, as a model, we developed a dr ug carrier with broad er recognition range of cancer subtypes. This carrier (SD) was self assembled from two modified monovalent aptamers. It showed bi specific recognition abilities to target cells in cell mixtures thus broad ening the recognition capabili ties of its parent aptamers. The self assembly of SD

PAGE 191

191 simultaneously formed multiple drug loading sites for anticancer drug Doxorubicin (Dox). The Dox loaded SD ( SD Dox ) also showed bi specific abilities of target cell binding and drug delivery. Most import antly, SD Dox induced bi specific cytotoxicity in target cells in cell mixtures. Therefore, b y broadening the otherwise limited recognition capabilities of monovalent aptamers, bi specific aptamer based drug carriers would facilitate aptamer applications f or clinically heterogeneous cancer subtypes which respond to the same cancer therapy. And in Chapter 6, we report nature inspired drug DNA adduct (DDA) as covalent conjugat es of synthetic DNA and drugs for targeted cancer therapy. With typically multiple drug copies conjugated on one DNA, DDA showed strong resistance to nuclease degradation, enhancing the biostability of DNA based drug carriers in vivo DDA was stable (4 C ), yet gradually released drugs at physiological temperature (37 C ). DDA building b locks form ed nanostructures by hybridization and drug aptamer adduct (DAA) maintained selectivity in cancer cell recognition and drug delivery. In a tumor xenograft mouse model, DAA demonstrated potent antitumor efficacy with reduced side effects. These r esults make DDA promising for targeted cancer therapy.

PAGE 192

192 LIST OF REFERENCES 1. Society AC (2013) Cancer Facts & Figures 2013. 2. Khati M (2010) The future of aptamers in medicine. Journal of Clinical Pathology 63(6):480 487. 3. Zhu G et al. (2012) Nucleic acid aptamers: an emerging frontier in cancer therapy. Chemical Communications 4. Ellington AD & Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 3 46(6287):818 822. 5. Tuerk C & Gold L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249(4968):505 510. 6. Huizenga DE & Szostak JW (1995) A DNA Aptamer That Binds Adenosine and ATP. Biochemistry 34(2):656 665. 7. Hermann T & Patel DJ (2000) Adaptive Recognition by Nucleic Acid Aptamers. Science 287(5454):820 825. 8. Mallikaratchy P, Stahelin RV, Cao Z, Cho W, & Tan W (20 06) Selection of DNA ligands for protein kinase C delta. Chemical Communications (30):3229 3231. 9. Daniels DA, Chen H, Hicke BJ, Swiderek KM, & Gold L (2003) A tenascin C aptamer identified by tumor cell SELEX: Systematic evolution of ligands by exponent ial enrichment. Proceedings of the National Academy of Sciences United States of America 100(26):15416 15421. 10. Parekh P, Tang Z, Turner PC, Moyer RW, & Tan W (2010) Aptamers Recognizing Glycosylated Hemagglutinin Expressed on the Surface of Vaccinia Vi rus Infected Cells. Analytical Chemistry 82(20):8642 8649. 11. Bock LC, Griffin LC, Latham JA, Vermaas EH, & Toole JJ (1992) Selection of single stranded DNA molecules that bind and inhibit human thrombin. Nature 355(6360):564 566. 12. Hu J et al. (2011) A G Quadruplex Aptamer Inhibits the Phosphatase Activity of Oncogenic Protein Shp2 in vitro. Chembiochem 12(3):424 430. 13. Chen C hB, Chernis GA, Hoang VQ, & Landgraf R (2003) Inhibition of heregulin signaling by an aptamer that preferentially bi nds to the oligomeric form of human epidermal growth factor receptor 3. Proceedings of the National Academy of Sciences United States of America 100(16):9226 9231.

PAGE 193

193 14. Khati M et al. (2003) Neutralization of Infectivity of Diverse R5 Clinical Isolates of Hum an Immunodeficiency Virus Type 1 by gp120 Binding 2 F RNA Aptamers. Journal of Virology 77(23):12692 12698. 15. Keefe AD, Pai S, & Ellington A (2010) Aptamers as therapeutics. Nature Rev Drug Discov 9(7):537 550. 16. Guo K T et al. (2006) A New Tec hnique for the Isolation and Surface Immobilization of Mesenchymal Stem Cells from Whole Bone Marrow Using High Specific DNA Aptamers. STEM CELLS 24(10):2220 2231. 17. Shangguan D et al. (2006) Aptamers evolved from live cells as effective molecular prob es for cancer study. Proceedings of the National Academy of Sciences of the United States of America 103(32):11838 11843. 18. Tang Z et al. (2007) Selection of aptamers for molecular recognition and characterization of cancer cells. Analytical Chemistry 79(13):4900 4907. 19. Shangguan D et al. (2008) Identification of liver cancer specific aptamers using whole live cells. Analytical Chemistry 80(3):721 728. 20. Sefah K et al. (2009) Molecular recognition of acute myeloid leukemia using aptamers. Leukemia 23(2):235 244. 21. Chen HW et al. (2008) Molecular recognition of small cell lung cancer cells using aptamers. Chemmedchem 3(6):991 1001. 22. Bayrac AT et al. (2011) In Vitro Selection of DNA Aptamers to Glioblastoma Multiforme. ACS Chemical N euroscience 2(3):175 181. 23. Simaeys DV et al. (2010) Study of the Molecular Recognition of Aptamers Selected through Ovarian Cancer Cell SELEX. Plos One 5(11). 24. Zhao Z et al. (2009) Recognition of subtype non small cell lung cancer by DNA aptamers selected from living cells. Analyst 134(9):1808 1814. 25. molecule atomic force microscopy on live cells compares aptamer and antibody rupture forces. Analytical and Bioanalytical Chemistry 402(10):3205 3209. 26. Mosing RK, Mendonsa SD, & Bowser MT (2005) Capillary Electrophoresis SELEX Selection of Aptamers with Affinity for HIV 1 Reverse Transcriptase. Analytical Chemistry 77(19):6107 6112. 27. Mosing RK & Bowser MT (2007) Microfluidic selection and a pplications of aptamers. Journal of Separation Science 30(10):1420 1426.

PAGE 194

194 28. Sefah K, Shangguan D, Xiong X, O'Donoghue MB, & Tan W (2009) Development of DNA aptamers using Cell SELEX. Nature Protocols 5(6):1169 1185. 29. Mayer G et al. (2010) Fluorescen ce activated cell sorting for aptamer SELEX with cell mixtures. Nat. Protocols 5(12):1993 2004. 30. Cox JC, Rudolph P, & Ellington AD (1998) Automated RNA Selection. Biotechnology Progress 14(6):845 850. 31. Shamah SM, Healy JM, & Cload ST (2008) Complex Target SELEX. Accounts of Chemical Research 41(1):130 138. 32. Fang X & Tan W (2009) Aptamers Generated from Cell SELEX for Molecular Medicine: A Chemical Biology Approach. Accounts of Chemical Research 43(1):48 57. 33. Mi J et al. (2010) In vivo selection of tumor targeting RNA motifs. Nat Chem Biol 6(1):22 24. 34. Tang Z, Parekh P, Turner P, Moyer RW, & Tan W (2009) Generating Aptamers for Recognition of Virus Infected Cells. Clinical Chemistry 55(4):813 822. 35. Group TES (2002) Preclinical and phase 1A clinical evaluation of an anti VEGF pegylated aptamer (EYE001) for the treatment of exudative age related macular degeneration. Retina 2(22):143 152. 36. Rusconi CP et al. (2004) Antidote mediated control of an a nticoagulant aptamer in vivo. Nat Biotech 22(11):1423 1428. 37. Oney S et al. (2009) Development of universal antidotes to control aptamer activity. Nat Med 15(10):1224 1228. 38. Padmanabhan K, Padmanabhan KP, Ferrara JD, Sadler JE, & Tulinsky A (1993) The structure of alpha thrombin inhibited by a 15 mer single stranded DNA aptamer. The Journal of biological chemistry 268(24):17651 17654. 39. Long SB, Long MB, White RR, & Sullenger BA (2008) Crystal structure of an RNA aptamer bound to thrombin. RNA Pu bl. RNA Soc. 14(12):2504 2512. 40. Lebars I et al. (2008) Exploring TAR RNA aptamer loop loop interaction by X ray crystallography, UV spectroscopy and surface plasmon resonance. Nucleic Acids Research 36(22):7146 7156.

PAGE 195

195 41. Huang DB et al. (2003) Cryst al structure of NF kappa B (p50)(2) complexed to a high affinity RNA aptamer. Proceedings of the National Academy of Sciences of the United States of America 100(16):9268 9273. 42. Mallikaratchy P et al. (2007) Aptamer Directly Evolved from Live Cells Re cognizes Membrane Bound Immunoglobin Heavy Mu Chain in Burkitt's Lymphoma Cells. Molecular & Cellular Proteomics 6(12):2230 2238. 43. Sefah K et al. (2010) DNA Aptamers as Molecular Probes for Colorectal Cancer Study. Plos One 5(12). 44. Zhang K et al. (2012) A Novel Aptamer Developed for Breast Cancer Cell Internalization. Chemmedchem 7(1):79 84. 45. Shangguan D, Cao Z, Li Y, & Tan W (2007) Aptamers evolved from cultured cancer cells reveal molecular differences of cancer cells in patient samples. Clinical Chemistry 53(6):1153 1155. 46. Shi H et al. (2010) In vivo Fluorescence Imaging of Tumors using Molecular Aptamers Generated by Cell SELEX. Chemistry an Asian Journal 5(10):2209 2213. 47. Shi H et al. (2011) Activatable aptamer probe for contr ast enhanced in vivo cancer imaging based on cell membrane protein triggered conformation alteration. Proceedings of the National Academy of Sciences of the United States of America 108(10):3900 3905. 48. Xu Y et al. (2009) Aptamer b ased m icrofluidic d evice for e nrichment, s orting, and d etection of m ultiple c ancer c ells. Analytical Chemistry 81(17):7436 7442. 49. Liu X, Yan H, Liu Y, & Chang Y (2011) Targeted c ell c ell i nteractions by DNA n anoscaffold t emplated m ultivalent b ispecific a ptamers. Small 7( 12):1673 1682. 50. Tan W et al. (2011) Molecular aptamers for drug delivery. Trends in Biotechnology 29(12):634 640. 51. Huang Y F, Kim Y, Meng L, & Tan W (2009) Assembly of aptamer conjugates as molecular tools in therapeutics. Chimica Oggi Chemistry T oday 27(5):52 54. 52. Luo Y L, Shiao Y S, & Huang Y F (2011) Release of p hotoactivatable d rugs from p lasmonic n anoparticles for t argeted c ancer t herapy. ACS Nano 5(10):7796 7804. 53. Mallikaratchy P et al. (2009) Using aptamers evolved from cell SELEX to engineer a molecular delivery platform. Chemical Communications (21):3056 3058.

PAGE 196

196 54. Douglas SM, Ba chelet I, & Church GM (2012) A l ogic g ated n anorobot for t argeted t ransport of m olecular p ayloads. Science 335(6070):831 834. 55. Tong GJ, Hsiao SC, Carrico ZM, & Francis MB (2009) Viral c apsid DNA a ptamer c onjugates as m ultivalent c ell t argeting v ehicles. Journal of the American Chemical Society 131(31):11174 11178. 56. Sullenger BA, Gallardo HF, Ungers GE, & Gilboa E (1990) Overexpression of TAR sequences renders cells resistant to human immunodeficiency virus replication. Cell 63(3):601 608. 57. Ireson CR & Kelland LR (2006) Discovery and development of anticancer aptamers. Molecular Cancer Therapeutics 5( 12):2957 2962. 58. Soundararajan S et al. (2009) Plasma m embrane n ucleolin i s a r eceptor for the a nticancer a ptamer AS1411 in MV4 11 l eukemia c ells. Molecular Pharmacology 76(5):984 991. 59. Soundararajan S, Chen W, Spicer EK, Courtenay Luck N, & Fernandes DJ (2008) The n ucleolin t argeting a ptamer AS1411 d estabilizes Bcl 2 m essenger RNA in h uman b reast c ancer c ells. Cancer Research 68(7):2358 2365. 60. Choi EW, Nayak LV, & Bates PJ (2010) Cancer selective antiproliferative activity is a general p roperty of some G rich oligodeoxynucleotides. Nucleic Acids Research 38(5):1623 1635. 61. Minotti G, Menna P, Salvatorelli E, Cairo G, & Gianni L (2004) Anthracyclines: m olecular a dvances and p harmacologic d evelopments in a ntitumor a ctivity and c ardiotoxi city. Pharmacological Reviews 56(2):185 229. 62. Hughes B (2010) Antibody drug conjugates for cancer: poised to deliver? Nat Rev Drug Discov 9(9):665 667. 63. Webb S (2011) Pharma interest surges in antibody drug conjugates. Nat Biotech 29(4):297 298. 6 4. Shieh Y A, Yang S J, Wei M F, & Shieh M J (2010) Aptamer Based Tumor Targeted Drug Delivery for Photodynamic Therapy. ACS Nano 4(3):1433 1442. 65. Cao Z et al. (2009) Reversible c ell s pecific d rug d elivery with a ptamer f unctionalized l iposomes. Angewandte Chemie International Edition 48(35):6494 6498. 66. Zhou J et al. (2009) Selection, characterization and application of new RNA HIV gp 120 aptamers for facile delivery of Dicer substrate siRNAs into HIV infected cells. Nucleic Acids Research 37 (9):3094 3109.

PAGE 197

197 67. McNamara JO et al. (2006) Cell type specific delivery of siRNAs with aptamer siRNA chimeras. Nature Biotech 24(8):1005 1015. 68. Dassie JP et al. (2009) Systemic administration of optimized aptamer siRNA chimeras promotes regression of PSMA expressing tumors. Nat Biotech 27(9):839 846. 69. Zhou J, Li H, Li S, Zaia J, & Rossi JJ (2008) Novel Dual Inhibitory Function Aptamer siRNA Delivery System for HIV 1 Therapy. Mol Ther 16(8):1481 1489. 70. Zhu G et al. (2012) Self Assembled Apta mer Based Drug Carriers for Bispecific Cytotoxicity to Cancer Cells. Chemistry An Asian Journal 7(7):1630 1636. 71. Chen T et al. (2011) Smart Multifunctional Nanostructure for Targeted Cancer Chemotherapy and Magnetic Resonance Imaging. ACS Nano 5(10):7 866 7873. 72. Liu H et al. (2010) DNA Based Micelles: Synthesis, Micellar Properties and Size Dependent Cell Permeability. Chemistry a European Journal 16(12):3791 3797. 73. Wu Y, Sefah K, Liu H, Wang R, & Tan W (2010) DNA aptamer micelle as an efficient detection/delivery vehicle toward cancer cells. Proceedings of the National Academy of Sciences of the United States of America 107(1):5 10. 74. Huang Y F, Sefah K, Bamrungsap S, Chang H T, & Tan W (2008) Selective Photothermal Therapy for Mixed Cancer Cells Using Aptamer Conjugated Nanorods. Langmuir 24(20):11860 11865. 75. Yang L et al. (2011) Engineering Polymeric Aptamers for Selective Cytotoxicity. Journal of the American Chemical Society 133(34):13380 13386. 76. Shangguan D et al. (2008) Cell specific aptamer probes for membrane protein elucidation in cancer cells. Journal of Proteome Research 7(5):2133 2139. 77. Shin W S et al. (2008) Soluble PTK7 inhibits tube formation, migration, and invasion of endothelial cells and angiogenesis. Biochemical and Biophysical Research Communications 371(4):793 798. 78. Meng L et al. (2010) Silencing of PTK7 in Colon Cancer Cells: Caspase 10 Dependent Apoptosis via Mitochondrial Pathway. Plos One 5 (11). 79. Green LS, Bell C, & Janjic N (2001) Aptamers as reagents for high throughput screening. Biotechniques 30(5):1094

PAGE 198

198 80. Srivatsan SG & Famulok M (2007) Functional nucleic acids in high throughput screening and drug discovery. Combinatorial Chemis try & High Throughput Screening 10(8):698 705. 81. Yamazaki S et al. (2007) Alternative small molecule target sites aptamer displacement identifies that escape viral resistance. Chemistry & Biology 14(7):804 812. 82. Hafner M et al. (2008) Displacement of protein bound aptamers with small molecules screened by fluorescence polarization. Nature Protocols 3(4):579 587. 83. Famulok M (2009) Exploring Chemical Space with Aptamers. Journal of Medicinal Chemistry 52(22):6951 6957. 84. Mayer G, Faulhammer D, Graettinger M, Fessele S, & Blind M (2009) A RNA Based Approach towards Small Molecule Inhibitors. Chem B io C hem 10(12):1993 1996. 85. Yamazaki S & Famulok M (2009) Screening of Novel Inhibitors of HIV 1 Reverse Transcriptase with a Reporter Ribozyme Assay Methods in Molecular Biology, Methods in Molecular Biology 535, 187 199. 86. Niebel B et al. (2010) ADLOC: An Aptamer Displacement Assay Based on Luminescent Oxygen Channeling. Chemistry a European Journal 16(36):11100 11107. 87. Auslaender D, Wieland M, Auslaender S, Tigges M, & Fussenegger M (2011) Rational design of a small molecule responsive intramer controlling transgene expression in mammalian cells. Nucleic Acids Research 39(22). 88. Mueller M, Ackermann D, & Famulok M (2011) Nucleic acid based tools for pharmacology and nano engineering. Comptes Rendus Chimie 14(9):819 825. 89. Payloads to Monoclonal Antibodies. Bioconjugate Chemistry 21(1) :5 13. 90. Wolf E, Hofmeister R, Kufer P, Schlereth B, & Baeuerle PA (2005) BiTEs: bispecific antibody constructs with unique anti tumor activity. Drug Discovery Today 10(18):1237 1244. 91. Beck A, Wurch T, Bailly C, & Corvaia N (2010) Strategies and cha llenges for the next generation of therapeutic antibodies. Nat Rev Immunol 10(5):345 352. 92. Huang Y F et al. (2009) Molecular Assembly of an Aptamer Drug Conjugate for Targeted Drug Delivery to Tumor Cells. Chem B io C hem 10(5):862 868.

PAGE 199

199 93. Mallikaratchy P, Tang Z, & Tan W (2008) Cell specific aptamer photosensitizer conjugates as a molecular tool in photodynamic therapy. Chem M ed C hem 3(3):425 428. 94. Boltz A et al. (2011) Bi specific aptamers mediating tumour cell lysis. Journal of Biological Chemistry 286(24):21896 21905. 95. Mallikaratchy PR et al. (2011) A multivalent DNA aptamer specific for the B cell receptor on human lymphoma and leukemia. Nucleic Acids Research 39(6):2458 2469. 96. Gragoudas ES, Adamis AP, Cunningham ET, Feinsod M, & Guyer D R (2004) Pegaptanib for Neovascular Age Related Macular Degeneration. New England Journal of Medicine 351(27):2805 2816. 97. Bates PJ, Laber DA, Miller DM, Thomas SD, & Trent JO (2009) Discovery and development of the G rich oligonucleotide AS1411 as a no vel treatment for cancer. Experimental and Molecular Pathology 86(3):151 164. 98. Lupold SE, Hicke BJ, Lin Y, & Coffey DS (2002) Identification and Characterization of Nuclease stabilized RNA Molecules That Bind Human Prostate Cancer Cells via the Prostat e specific Membrane Antigen. Cancer Research 62(14):4029 4033. 99. Ferreira CSM, Matthews CS, & Missailidis S (2006) DNA aptamers that bind to MUC1 tumour marker: Design and characterization of MUC1 binding single stranded DNA aptamers. Tumor Biology 27(6):289 301. 100. Wiegand T et al. (1996) High affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. The Journal of Immunology 157(1):221 230. 101. Mi J et al. impairs endothelial cell growth and survival. Biochemical and Biophysical Research Communications 338(2):956 963. 102. Lebruska LL & Maher LJ (1999) Selection and Characterization of an RNA Decoy for Transcription Factor NF Biochemistry 38(10):3168 3174. 103. Martell RE, Nevins JR, & Sullenger BA (2002) Optimizing Aptamer Activity for Gene Therapy Applications Using Expression Cassette SELEX. Mol Ther 6(1):30 34. 104. Ishizaki J, Nevins JR, & Sullenger BA (1996) Inhibition of cell proliferation by an RNA ligand that selectively blocks E2F function. Nature Medicine 2(12):1386 1389.

PAGE 200

200 105. Blake CM, Sullenger BA, Lawrence DA, & Fortenberry YM (2009) Antimetastatic Potential of PAI 1 Specifi c RNA Aptamers. Oligonucleotides 19(2):117 128. 106. based nanostructure for aptamer directed delivery. Chemical Communications 46(2):249 251. 107. Wang K et al. (2011) Self Assembly of a Bifunctio nal DNA Carrier for Drug Delivery. Angewandte Chemie International Edition 50(27):6098 6101. 108. Kang H et al. (2011) Near Infrared Light Responsive Core Shell Nanogels for Targeted Drug Delivery. ACS Nano 5(6):5094 5099. 109. Bagalkot V, Farokhzad OC, Langer R, & Jon S (2006) An Aptamer Doxorubicin Physical Conjugate as a Novel Targeted Drug Delivery Platform. Angewandte Chemie International Edition 45(48):8149 8152. 110. Chu TC et al. (2006) Aptamer:Toxin Conjugates that Specifically Target Prostate Tumor Cells. Cancer Research 66(12):5989 5992. 111. Kim D, Jeong YY, & Jon S (2010) A Drug Loaded Aptamer Gold Nanoparticle Bioconjugate for Combined CT Imaging and Therapy of Prostate Cancer. ACS Nano 4(7):3689 3696. 112. Bagalkot V et al. (2007) Quan Cancer Imaging, Therapy, and Sensing of Drug Delivery Based on Bi Fluorescence Resonance Energy Transfer. Nano Letters 7(10):3065 3070. 113. Dhar S, Kolishetti N, Lippard SJ, & Farokhzad OC (2011) Targeted delivery of a cisplatin prodrug for safer and more effective prostate cancer therapy in vivo. Proceedings of the National Academy of Sciences 108(5):1850 1855. 114. Gu F et al. (2008) Precise engineering of targeted nanoparticles by using self assembled biointegrated block copolymers. Proceedings of the National Academy of Sciences United States of America 105(7):2586 2591. 115. Pieve CD, Perkins AC, & Missailidis S (2009) Anti MUC1 aptamers: radiolabelling with 99mTc and biodistribution in MCF 7 tumour bearing mice. Nuclear Medicine and Biology 36(6):703 710. 116. Savla R, Taratula O, Garbuzenko O, & Minko T (2011) Tumor targeted quantum dot mucin 1 aptamer doxorubicin conjuga te for imaging and treatment of cancer. Journal of Controlled Release 153(1):16 22.

PAGE 201

201 117. Tan L, Gee Neoh K, Kang E T, Choe W S, & Su X (2012) Designer tridentate mucin 1 aptamer for targeted drug delivery. Journal of Pharmaceutical Sciences 101(5):1672 16 77. 118. Cardinale D et al. (2010) Anthracycline Induced Cardiomyopathy: Clinical Relevance and Response to Pharmacologic Therapy. J Am Coll Cardiol 55(3):213 220. 119. Andrew MacKay J et al. (2009) Self assembling chimeric polypeptide doxorubicin conj ugate nanoparticles that abolish tumours after a single injection. Nature Mater 8(12):993 999. 120. Lammers T, Aime S, Hennink WE, Storm G, & Kiessling F (2011) Theranostic Nanomedicine. Accounts of Chemical Research 44(10):1029 1038. 121. Seeman NC (201 0) Nanomaterials Based on DNA. Annual Review of Biochemistry 79(1):65 87. 122. Bath J & Turberfield AJ (2007) DNA nanomachines. Nature Nanotech 2(5):275 284. 123. Pinheiro AV, Han D, Shih WM, & Yan H (2011) Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech 6(12):763 772. 124. Dirks RM & Pierce NA (2004) Triggered amplification by hybridization chain reaction. Proceedings of the National Academy of Sciences United States of America 101(43):15275 15278. 125. Jiang Q et al. (2012) DNA Origami as a Carrier for Circumvention of Drug Resistance. Journal of the American Chemical Society 134(32):13396 13403. 126. Luo D & Saltzman WM (2000) Synthetic DNA delivery systems. Nature Biotech 18(1):33 37. 127. Lee H et al. (2012) Molecularly self assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery. Nat Nano 7(6):389 393. 128. Schller VJ et al. (2011) Cellular Immunostimulation by CpG Sequence Coated DNA Origami Structures. ACS Nano 5(12):9696 9702. 129. Li J et al. (2011) Self Assembled Multivalent DNA Nanostructures for Noninvasive Intracellular Delivery of Immunostimulatory CpG Oligonucleotides. ACS Nano 5(11):8783 8789. 130. Tan SJ, Kiatwuthinon P, Roh YH, Kahn JS, & Luo D (2011) Engineering Nan ocarriers for siRNA Delivery. Small 7(7):841 856.

PAGE 202

202 131. Chang M, Yang C S, & Huang D M (2011) Aptamer Conjugated DNA Icosahedral Nanoparticles As a Carrier of Doxorubicin for Cancer Therapy. ACS Nano 5(8):6156 6163. 132. Yang L et al. (2011) Aptamer conj ugated nanomaterials and their applications. Advanced Drug Delivery Reviews 63(14 15):1361 1370. 133. Meng L et al. (2012) Targeted Delivery of Chemotherapy Agents Using a Liver Cancer Specific Aptamer. Plos One 7(4):e33434. 134. Ruggiero A et al. (201 0) Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences United States of America 107(27):12369 12374. 135. Zhu G et al. (2013) Self assembled, aptamer tethered DNA nanotrains for targeted transport of mol ecular drugs in cancer theranostics. Proceedings of the National Academy of Sciences United States of America 136. Venkataraman S, Dirks RM, Ueda CT, & Pierce NA (2010) Selective cell death mediated by small conditional RNAs. Proceedings of the National Academy of Sciences United States of America 107(39):16777 16782. 137. Choi HMT et al. (2010) Programmable in situ amplification for multiplexed imaging of mRNA expression. Nature Biotech 28(11):1208 1212. 138. Wang F, Elbaz J, Orbach R, Magen N, & Will ner I (2011) Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires. Journal of the American Chemical Society 133(43):17149 17151. 139. Xiao Z, Shangguan D, Cao Z, Fang X, & Tan W (2008) Cell specific internalization study of an aptamer from whole cell selection. Chemistry A European Journal 14(6):1769 1775. 140. Geng Y et al. (2007) Shape effects of filaments versus spherical particles in flow and drug delivery. Nature Nanotech 2(4):249 255. 141. Geiger B, Bershadsky A, Pankov R, & Yamada KM (2001) Transmembrane crosstalk between the extracellular matrix and the cytoskeleton. Nat Rev Mol Cell Biol 2(11):793 805. 142. Kulwichit W et al. (1998) Expression of the Epstein Barr virus latent membrane p rotein 1 induces B cell lymphoma in transgenic mice. Proceedings of the National Academy of Sciences United States of America 95(20):11963 11968.

PAGE 203

203 143. Lpez Casillas F et al. (1991) Structure and expression of the membrane proteoglycan betaglycan, a comp onent of the TGF Cell 67(4):785 795. 144. Networks Grown on Cell Surface Marker Sites: Application in Diagnostics. ACS Nano 5(3):2109 2117. 145. Mahal LK & Berto zzi CR (1997) Engineered cell surfaces: Fertile ground for molecular landscaping. Chemistry & Biology 4(6):415 422. 146. Kellam B, De Bank PA, & Shakesheff KM (2003) Chemical modification of mammalian cell surfaces. Chemical Society Reviews 32(6):327 337. 147. Stephan MT, Moon JJ, Um SH, Bershteyn A, & Irvine DJ (2010) Therapeutic cell engineering with surface conjugated synthetic nanoparticles. Nat Med 16(9):1035 1041. 148. Gartner ZJ & Bertozzi CR (2009) Programmed assembly of 3 dimensional microtissue s with defined cellular connectivity. Proceedings of the National Academy of Sciences United States of America 106(12):4606 4610. 149. Hochbaum AI & Aizenberg J (2010) Bacteria Pattern Spontaneously on Periodic Nanostructure Arrays. Nano Lett. 10(9):3717 3721. 150. Fernandes R, Roy V, Wu H C, & Bentley WE (2009) Engineered biological nanofactories trigger quorum sensing response in targeted bacteria. Nature Nanotech 5(3):213 217. 151. Chittasupho C, Shannon L, Siahaan TJ, Vines CM, & Berkland C (2011) Nanoparticles Targeting Dendritic Cell Surface Molecules Effectively Block T Cell Conjugation and Shift Response. ACS Nano 5(3):1693 1702. 152. Koyfman AY, Braun GB, & Reich NO (2009) Cell Targeted Self Assembled DNA Nanostructures. Journal of t he American Chemical Society 131(40):14237 14239. 153. Wilson JT et al. (2011) Cell Surface Engineering with Polyelectrolyte Multilayer Thin Films. Journal of the American Chemical Society 133(18):7054 7064. 154. Stevens MM & George JH (2005) Exploring and engineering the cell surface interface. Science 310(5751):1135 1138. 155. Zhao WA, Teo GSL, Kumar N, & Karp JM (2010) Chemistry and material science at the cell surface. Mater. Today 13(4):14 21.

PAGE 204

204 156. Boonyarattanakalin S, Martin SE, Sun Q, & Peterson BR (2006) A synthetic mimic of human Fc receptors: Defined chemical modification of cell surfaces enables efficient endocytic uptake of human immunoglobulin G. Journal of the American Chemical Society 128(35):11463 11470. 157 Shangguan D et al. (2006) Aptamers evolved from live cells as effective molecular probes for cancer study. Proceedings of the National Academy of Sciences United States of America 103(32):11838 11843. 158. Zhu G et al. (2013) Building Fluorescent DNA Nanodevices on Target Living Cell Surfaces. Angewandte Chemie International Edition 52(21):5490 5496. 159. Benvin AL et al. Fluorescent Labels Based on Intercalating Dye Arrays Assembled on Nanostructured DNA Templates. Journal of the American Chemical Society 129(7):2025 2034. 160. Teo YN & Kool ET (2012) DNA Multichromophore Systems. Chemical Reviews 112(7):4221 4245. 161. Chen Y et al. (2009) Mapping Receptor Density on Live Cells by Using Fluorescence Correlation Spectroscopy. Chemistry A European Journal 15(21):5327 5336. 162. Hunt HK & Armani AM (2010) Label free biolog ical and chemical sensors. Nanoscale 2(9):1544 1559. 163. Rye HS et al. (1992) Stable fluorescent complexes of double stranded DNA with bis intercalating asymmetric cyanine dyes: properties and applications. Nucleic Acids Research 20(11):2803 2812. 164. Mao F, Leung W Y, & Xin X (2007) Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. B MC Biotechnology 7. 165. Larsson A, Carlsson C, Jonsson M, & Albinsson B (1994) Characterization of the Binding of the Fluorescent Dyes YO and YOYO to DNA by Polarized Light Spectroscopy. Journal of the American Chemical Society 116(19):8459 8465. 166. Melkozernov AN, Barber J, & Blankenship RE (2005) Light Harvesting in Photosystem I Supercomplexes Biochemistry 45( 2):331 345. 167. Glazer AN (1989) Light guides. Directional energy transfer in a photosynthetic antenna. Journal of Biological Chemistry 264(1):1 4.

PAGE 205

205 168. Chance RR, Prock A, & Silbey R (2007) Molecular Fluorescence and Energy Transfer Near Interfaces. Advances in Chemical Physics 1 65. 169. Hulspas R et al. (2009) Flow cytometry and the stability of phycoerythrin tandem dye conjugates. Cytometry Part A 75A(11):966 972. 170. Chen Y et al. (2010) A Surface Energy Transfer Nanoruler for Measuring Bind ing Site Distances on Live Cell Surfaces. Journal of the American Chemical Society 132(46):16559 16570. 171. Zhang P, Beck T, & Tan W (2001) Design of a molecular beacon DNA probe with two fluorophores. Angewandte Chemie International Edition 40(2):402 40 5. 172. Zadeh JN et al. (2010) NUPACK: Analysis and design of nucleic acid systems. Journal of Computational Chemistry 32(1):170 173. 173. Drmanac R et al. (2010) Human Genome Sequencing Using Unchained Base Reads on Self Assembling DNA Nanoarrays. Science 327(5961):78 81. 174. Genereux JC & Barton JK (2009) Mechanisms for DNA Charge Transport. Chemical Reviews 110(3):1642 1662. 175. Tamkovich SN et al. (2006) Circulating DNA and DNase Activity in Human Blood. Annals of the New York Academy of Sci ences 1075(1):191 196. 176. Hamblin GD, Carneiro KMM, Fakhoury JF, Bujold KE, & Sleiman HF (2012) Rolling Circle Amplification Templated DNA Nanotubes Show Increased Stability and Cell Penetration Ability. Journal of the American Chemical Society 134(6):2 888 2891. 177. Keum J W & Bermudez H (2009) Enhanced resistance of DNA nanostructures to enzymatic digestion. Chemical Communications (45):7036 7038. 178. Venter JC et al. (2001) The Sequence of the Human Genome. Science 291(5507):1304 1351. 179. Olins DE & Olins AL (2003) Chromatin history: our view from the bridge. Nat Rev Mol Cell Biol 4(10):809 814. 180. Chow MH, Yan KTH, Bennett MJ, & Wong JTY (2010) Birefringence and DNA Condensation of Liquid Crystalline Chromosomes. Eukaryotic Cell 9(10):1577 1587. 181. Rill RL, Strzelecka TE, Davidson MW, & Van Winkle DH (1991) Ordered phases in concentrated DNA solutions. Physica A: Statistical Mechanics and its Applications 176(1):87 116.

PAGE 206

206 182. Livolant F (1984) Cholesteric organization of DNA i n the stallion sperm head. Tissue and Cell 16(4):535 555. 183. Strzelecka TE, Davidson MW, & Rill RL (1988) Multiple liquid crystal phases of DNA at high concentrations. Nature 331(6155):457 460. 184. Nakata M et al. (2007) End to End Stacking and Liqui d Crystal Condensation of 6 to 20 Base Pair DNA Duplexes. Science 318(5854):1276 1279. 185. Zanchetta G, Nakata M, Buscaglia M, Bellini T, & Clark NA (2008) Phase separation and liquid crystallization of complementary sequences in mixtures of nanoDNA oli gomers. Proceedings of the National Academy of Sciences United States of America 105(4):1111 1117. 186. Bellini T et al. (2012) Liquid crystal self assembly of random sequence DNA oligomers. Proceedings of the National Academy of Sciences United States of America 109(4):1110 1115. 187. Livolant F, Levelut AM, Doucet J, & Benoit JP (1989) The highly concentrated liquid crystalline phase of DNA is columnar hexagonal. Nature 339(6227):724 726. 188. Johne R, Mller H, Rector A, van Ranst M, & Stevens H (20 09) Rolling circle amplification of viral DNA genomes using phi29 polymerase. Trends in Microbiology 17(5):205 211. 189. Cohen S, Agmon N, Yacobi K, Mislovati M, & Segal D (2005) Evidence for rolling circle replication of tandem genes in Drosophila. Nucle ic Acids Research 33(14):4519 4526. 190. Fire A & Xu SQ (1995) Rolling replication of short DNA circles. Proceedings of the National Academy of Sciences United States of America 92(10):4641 4645. 191. Lee JB et al. (2012) A mechanical metamaterial made from a DNA hydrogel. Nat Nano 7(12):816 820. 192. Zhao W et al. (2012) Bioinspired multivalent DNA network for capture and release of cells. Proceedings of the National Academy of Sciences United States of America 109(48):19626 19631. 193. Anderson JP, Reynolds BL, Baum K, & Williams JG (2010) Fluorescent Structural DNA Nanoballs Functionalized with Phosphate Linked Nucleotide Triphosphates. Nano Lett. 10(3):788 792.

PAGE 207

207 194. Lin C, Xie M, Chen JJL, Liu Y, & Yan H (2006) Rolling Circle Amplification of a DNA Nanojunction. Angewandte Chemie International Edition 45(45):7537 7539. 195. Larsson C et al. (2004) In situ genotyping individual DNA molecules by target primed rolling circle amplification of padlock probes. Nat Meth 1(3):227 232. 196. Alama A, Barbieri F, Cagnoli M, & Schettini G (1997) Antisense oligonucleotides as therapeutic agents Pharmac ological Research 36(3):171 178. 197. Weiner GJ, Liu H M, Wooldridge JE, Dahle CE, & Krieg AM (1997) Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective Proceedings of the Natio nal Academy of Sciences United States of America 94(20):10833 10837. 198. Lee JB, Hong J, Bonner DK, Poon Z, & Hammond PT (2012) Self assembled RNA interference microsponges for efficient siRNA delivery. Nat Mater 11(4):316 322. 199. Zhao F et al. (2011 ) Cellular Uptake, Intracellular Trafficking, and Cytotoxicity of Nanomaterials. Small 7(10):1322 1337. 200. Peer D et al. (2007) Nanocarriers as an emerging platform for cancer therapy. Nat Nano 2(12):751 760. 201. Petros RA & DeSimone JM (2010) Strate gies in the design of nanoparticles for therapeutic applications. Nat Rev Drug Discov 9(8):615 627. 202. Nadano D, Yasuda T, & Kishi K (1993) Measurement of deoxyribonuclease I activity in human tissues and body fluids by a single radial enzyme diffusion method. Clinical Chemistry 39(3):448 452. 203. Shu D, Shu Y, Haque F, Abdelmawla S, & Guo P (2011) Thermodynamically stable RNA three way junction for constructing multifunctional nanoparticles for delivery of therapeutics. Nat Nano 6(10):658 667. 204. H erskovits TT (1963) Nonaqueous Solutions of DNA; Denaturation by Urea and Its Methyl Derivatives Biochemistry 2(2):335 340. 205. Shalon D, Smith SJ, & Brown PO (1996) A DNA microarray system for analyzing complex DNA samples using two color fluorescent p robe hybridization. Genome Research 6(7):639 645. 206. Credo GM et al. (2012) Label free electrical detection of pyrophosphate generated from DNA polymerase reactions on field effect devices. Analyst 137(6):1351 1362.

PAGE 208

208 207. Chen C hB et al. (2008) Aptamer based endocytosis of a lysosomal enzyme. Proceedings of the National Academy of Sciences United States of America 105(41):15908 15913. 208. Chari RVJ (2007) Targeted Cancer Therapy: Conferring Specificity to Cytotoxic Drugs. Accounts of Ch emical Research 41(1):98 107. 209. Low PS, Henne WA, & Doorneweerd DD (2007) Discovery and Development of Folic Acid Based Receptor Targeting for Imaging and Therapy of Cancer and Inflammatory Diseases. Accounts of Chemical Research 41(1):120 129. 210. K eefe AD, Pai S, & Ellington A (2010) Aptamers as therapeutics. Nat Rev Drug Discov 9(7):537 550. 211. Tang Z et al. (2010) Aptamer Target Binding Triggered Molecular Mediation of Singlet Oxygen Generation. Chemistry an Asian Journal 5(4):783 786. 212. S efah K, Shangguan D, Xiong X, O'Donoghue MB, & Tan W (2010) Development of DNA aptamers using Cell SELEX. Nat. Protocols 5(6):1169 1185. 213. Shangguan D, Cao ZC, Li Y, & Tan W (2007) Aptamers Evolved from Cultured Cancer Cells Reveal Molecular Difference s of Cancer Cells in Patient Samples. Clin Chem 53(6):1153 1155. 214. Sefah K et al. (2009) Molecular recognition of acute myeloid leukemia using aptamers. Leukemia 23(2):235 244. 215. Kampalath B, Barcos MP, & Stewart C (2003) Phenotypic Heterogeneity of B Cells in Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma. American Journal of Clinical Pathology 119(6):824 832. 216. Burmeister T et al. (2005) Molecular heterogeneity of sporad ic adult Burkitt type leukemia/ lymphoma as reveal ed by PCR and cytogenetics: correlation with morphology, immunology and clinical features. Leukemia 19(8):1391 1398. 217. Heuser M et al. (2009) Modeling the functional heterogeneity of leukemia stem cells: role of STAT5 in leukemia stem cell self renewa l. Blood 114(19):3983 3993. 218. Calin G et al. (2005) A microRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med 353:1793 1801. 219. Heppner GH (1984) Tumor Heterogeneity. Cancer Research 44(6):2259 2265. 220. Navin N et al. (2010) Tumour evolution inferred by single cell sequencing. Nature 472(7341):90 94.

PAGE 209

209 221. Dalerba P et al. (2011) Single cell dissection of transcriptional heterogeneity in human colon tumors. Nat Biotech advance online publication. 222. Andrew MacKay J et al. (2009) Self assembling chimeric polypeptide doxorubicin conjugate nanoparticles that abolish tumours after a single injection. Nat Mater 8(12):993 999. 223. Min K et al. (2011) Dual aptamer based delivery vehicle of doxorubicin to both Biomaterials 32(8):2124 2132. 224. Kim Y, Cao Z, & Tan W (2008) Molecular assembly for high performance bivalent nucleic acid inhibitor. Proceedings of the National Academy o f Sciences United States of America 105(15):5664 5669. 225. Mallikaratchy PR et al. (2010) A multivalent DNA aptamer specific for the B cell receptor on human lymphoma and leukemia. Nucleic Acids Research 226. Boltz A et al. (2011) Bi specific aptamer s mediating tumour cell lysis. Journal of Biological Chemistry 227. Liu X, Yan H, Liu Y, & Chang Y (2011) Targeted Cell Cell Interactions by DNA Nanoscaffold Templated Multivalent Bispecific Aptamers. Small 228. Kim Y, Dennis DM, Morey T, Yang L, & Tan W (2010) Engineering Dendritic Aptamer Assemblies as Superior Inhibitors of Protein Function. Chemistry an Asian Journal 5(1):56 59. 229. Tang Z et al. (2007) Selection of Aptamers for Molecular Recognition and Characterization of Cancer Cells. Anal ytical Chemistry 79(13):4900 4907. 230. Xiao Z, Shangguan D, Cao Z, Fang X, & Tan W (2008) Cell Specific Internalization Study of an Aptam er from Whole Cell Selection. Chemistry A European Journal 1769 1775. 231. Weiss RB, Sarosy G, Clagettcarr K, Russ o M, & Leylandjones B (1986) A nthracycline analogs the past, present and future Cancer Chemother. Pharmacol. 18(3):185 197. 232. Wiernik PH (1980) Current Status and New Developments. Academic Press, New York 233. Kim D, Jeong YY, & Jon S (2010) A Drug Loaded Aptamer Gold Nanoparticle Bioconjugate for Combined CT Imaging and Therapy of Prostate Cancer. ACS Nano 4(7):3689 3696.

PAGE 210

210 234. Chaires JB, Herrera JE, & Waring MJ (1990) Preferential binding of daunomycin to 5'TACG and 5'TAGC sequences revealed by footprinting titration experiments. Biochemistry 29(26):6145 6153. 235. Huang YF et al. (2009) Molecular Assembly of an Aptamer Drug Conjugate for Targeted Dr ug Deliver y to Tumor Cells. ChemBioChem 862 868. 236. Allen TM (2002) Ligand targeted therapeutics in anticancer therapy. Nat Rev Cancer 2(10):750 763. 237. Santra S, Kaittanis C, Santiesteban OJ, & Perez JM (2011) Cell Specific, Activatable, and Theran ostic Prodrug for Dual Targeted Cancer Imaging and Therapy. Journal of the American Chemical Society 133(41):16680 16688. 238. Duncan R (2006) Polymer conjugates as anticancer nanomedicines. Nat Rev Cancer 6(9):688 701. 239. Wang F et al. (2011) Doxorubicin Tethered Responsive Gold Nanoparticles Facilitate Intracellular Drug Delivery for Overcoming Multidrug Resistance in Cancer Cells. ACS Nano 5(5):3679 3692. 240. Bagalkot V et al. (2009) A Combined Chemoimmunotherapy Approach Using a P Molecular Pharmaceutics 6(3):1019 1028. 241. Wilson C & Keefe AD (2006) Building oligonucleotide therapeutics using non natural chemistries. Current Opinion in Chemical Biology 10(6):607 614. 242. Rosi NL et al. (2006) Oligon ucleotide Modified Gold Nanoparticles for Intracellular Gene Regulation. Science 312(5776):1027 1030. 243. Cullinane C, Cutts SM, van Rosmalen A, & Phillips DR (1994) Formation of adriamycin DNA adducts in vitro. Nucleic Acids Research 22(12):2296 2303. 244. van Rosmalen A, Cullinane C, Cutts SM, & Phillips DR (1995) Stability of adriamycin induced DNA adducts and interstrand crosslinks. Nucleic Acids Research 23(1):42 50. 245. Cutts SM & Phillips DR (1995) Use of oligonucletides to define the site of in terstand cross links induced by Adriamycin. Nucleic Acids Research 23(13):2450 2456. 246. Zeman SM, Phillips DR, & Crothers DM (1998) Characterization of covalent Adriamycin DNA adducts. Proceedings of the National Academy of Sciences United States of Ame rica 95(20):11561 11565.

PAGE 211

211 247. Luce RA, Sigurdsson ST, & Hopkins PB (1999) Quantification of Formaldehyde Mediated Covalent Adducts of Adriamycin with DNA Biochemistry 38(27):8682 8690. 248. Antonow D & Thurston DE (2010) Synthesis of DNA Interactive Pyrrolo[2,1 c][1,4]benzodiazepines (PBDs). Chemical Reviews 111(4):2815 2864. 249. Swift LP, Rephaeli A, Nudelman A, Phillips DR, & Cutts SM (2006) Doxorubicin DNA Adducts Induce a Non Topoisomerase II Medi ated Form of Cell Death. Cancer Research 66(9):4863 4871. 250. Puchtler H & Meloan SN (1985) On the chemistry of formaldehyde fixation and its effects on immunohistochemical reactions. Histochemistry 82(3):201 204. 251. Heinlein T, Knemeyer J P, Piestert O, & Sauer M (2003) Photoinduced Electron Transfer between Fluorescent Dyes and Guanosine Residues in DNA Hairpins. The Journal of Physical Chemistry B 107(31):7957 7964. 252. Bates PJ, Laber DA, Miller DM, Thomas SD, & Trent JO (2009) Discovery and development of the G rich oligonucleotide AS1411 as a novel treatment for cancer. Experimental and molecular pathology 86(3):151 164. 253. Soundararajan S, Chen W, Spicer EK, Courtenay Luck N, & Fernandes DJ (2008) The nucleo lin targeting aptamer AS1411 destabilizes Bcl 2 messenger RNA in human breast cancer cells. Cancer research 68(7):2358 2365. 254. DiPaola RS (2002) To arrest or not to G(2) M Cell cycle arrest : commentary re: A. K. Tyagi et al., Silibinin strongly synerg izes human prostate carcinoma DU145 cells to doxorubicin induced growth inhibition, G(2) M arrest, and apoptosis. Clin. C ancer R es. 8: 3512 3519, 2002

PAGE 212

212 BIOGRAPHICAL SKETCH Guizhi Zhu was born in Hubei China. He spent his first 18 years in beautiful Enshi Hubei After high school education in 2004 he decided to fly far away from hometown, so he moved far north to Tianjin to attend Nankai University, where he obtained his B.S. degree in Biotechnology in 2008. He is interesting in biomedial engineerin g, so he decided to study more in graduate school. Then he flied even farther to Florida in 2008 and attended the Interdis ci plinary Program in Biomedical Sciences (IDP) in College of Medicine, where he was mentored by Prof. Weihong Tan. His interest during graduate study is to develop aptamer mediated, DNA based nanomedicines for cancer diagnosis and targeted cancer therapy. He received his Ph.D. in Medical Sciences Phys iology and Pharmacology from the University of Florida in the fall of 201 3.