<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2015-08-31.

DARK ITEM
MISSING IMAGE

Material Information

Title:
Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2015-08-31.
Physical Description:
Book
Language:
english
Creator:
Vitale, Krystyn
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Medicine
Committee Chair:
Kladde, Michael P
Committee Members:
Brown, Kevin D
Baker, Henry V

Subjects

Subjects / Keywords:
Medicine -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility:
by Krystyn Vitale.
Thesis:
Thesis (M.S.)--University of Florida, 2013.
Local:
Adviser: Kladde, Michael P.
Electronic Access:
INACCESSIBLE UNTIL 2015-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045604:00001

MISSING IMAGE

Material Information

Title:
Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2015-08-31.
Physical Description:
Book
Language:
english
Creator:
Vitale, Krystyn
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Medicine
Committee Chair:
Kladde, Michael P
Committee Members:
Brown, Kevin D
Baker, Henry V

Subjects

Subjects / Keywords:
Medicine -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility:
by Krystyn Vitale.
Thesis:
Thesis (M.S.)--University of Florida, 2013.
Local:
Adviser: Kladde, Michael P.
Electronic Access:
INACCESSIBLE UNTIL 2015-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045604:00001


This item has the following downloads:


Full Text

PAGE 1

1 ESTABLISHMENT OF A STABLE COLORECTAL ADENOCARCINOMA CELL LINE CONDITIONALLY EXPRESSING ONCOGENIC KIRSTEN (K) RAS By KRYSTYN VITALE A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Krystyn Vitale

PAGE 3

3 T o Mom, Dad, Alex and Grams

PAGE 4

4 ACKNOWLEDGMENTS I thank my family for supporting me throughout my academic career both academically and emotionally ; without you I would not have made it. I thank Dr. Kladde for all owing me to work in his lab and committee members Drs. Kevin Brown and Henry Baker I thank Carolina Pardo for being my teacher and my guide through this experience. Finally, I thank the Kladde lab for never ending optimism, laughs, and patience: Nancy Nabilsi, Russell Darst, Mayank Talwar, Rosha Poudyal, and Ashley Peraza Penton.

PAGE 5

5 TABLE OF CO NTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF FIGURES ................................ ................................ ................................ .......... 6 LIST OF ABBREV IATIONS ................................ ................................ ............................. 8 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 Background and Significance ................................ ................................ ................. 11 State of Research ................................ ................................ ................................ ... 12 Epigenetics and its Role in Canc er ................................ ................................ ... 12 Epigenetics ................................ ................................ ................................ 12 Epigenetics in cancer ................................ ................................ ................. 13 Chroma tin Structure Changes during Epigenetic Silencing .............................. 15 Chromatin changes precede DNA methylation ................................ .......... 15 DNA methylation precedes chromatin changes ................................ ......... 16 Kirsten (K) Ras in Epigenetic Silencing ................................ ............................ 17 Goals and Outline ................................ ................................ ................................ ... 18 2 METHODOLOGY ................................ ................................ ................................ .... 20 Cell Lines and Cultu ring ................................ ................................ .......................... 20 Recombinant Constructs for Inducible K Ras G12V Expression ............................ 20 Recombinant DNA Methods ................................ ................................ ................... 22 Toxi city Assay ................................ ................................ ................................ ......... 24 Lentiviral Transduction ................................ ................................ ............................ 24 Antibiotic and Clonal Selection ................................ ................................ ............... 26 Luciferase Assays ................................ ................................ ................................ ... 27 Transient Transfection of K Ras G12V Plasmid Clones ................................ ......... 28 Protein Collection and Quantification ................................ ................................ ...... 28 Protein Immunoblotting ................................ ................................ ........................... 29 3 RESULTS ................................ ................................ ................................ ............... 30 4 DISCUSSION ................................ ................................ ................................ ......... 39 LIST OF REFERENCES ................................ ................................ ............................... 41 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 46

PAGE 6

6 LIST OF FIGURES Figure page 1 1 The Lenti X Tet On 3G system induces the expression of K Ras G12V in the presence of doxycycline (dox) by binding the transactivator and allowing it to bind to the TRE3G promoter. ................................ ................................ .............. 19 2 1 Vector map for the plasmid containing the reverse tetracycline transactivator, pLenti CMV rtTA3.. ................................ ................................ ............................. 20 2 2 Vector map of the expression vector pLVX TRE3G mCherry.. ........................... 21 2 3 To estimate the transfection eff iciency of pLenti CMV rtTA3 and helper plasmids into HEK293T cells a parallel transfection of pGIPZ GFP into HEK293T cells was performed.. ................................ ................................ ......... 25 3 1 Preparation of vector and insert for the Infusion cloning reaction.. ..................... 30 3 2 Infusion cloning a dds homology of the expression vector to the K Ras G12V insert after polymerase chain reaction (PCR) amplification. ............................... 31 3 3 Colony PCR of K Ras G12V insert from 24 bacterial clones transformed with pLVX pTRE mCherry K Ras G12V. ................................ ................................ ... 32 3 4 A restriction digest was performed to independently verify the results of the colony PCR of bacterial clones transformed wi th pLVX pTRE mCherry K Ras G12V ................................ ................................ ................................ ........... 32 3 5 Quantification of the activity of rtTA3 activity and basal activity in clones L2 and L21 by luciferase assay at indicated concentrations of doxycycline. ........... 34 3 6 Expression of K Ras from pLVX pTRE mCherry K Ras G12V clones 2, 4, and 5 transiently transfected in clone L2 cultured with or without doxycycline was assayed by western blotting with anti K Ras antibody. ............................... 35 3 7 Transduction efficiency of pLVX pTRE mCherry K Ras G12V into the Caco 2 rtTA3 clonal population was estimated with mCherry expression by fluorescence microscopy.. ................................ ................................ .................. 36 3 8 Protein immunoblotting was used to verify that L2 K Ras G12V resulted in low basal expression of K Ras without doxycycline and an increase of K Ras with doxycycline. ................................ ................................ ................................ 37 3 9 To show that L2 K Ras G12V resulted in activation of the K Ras signaling cascade, an immunoblot of L2 K Ras G12V cells cultured in doxycycline for 2 months was performed. ................................ ................................ ................... 38

PAGE 7

7 3 10 The Ras signaling cascade activates kinases Raf, MEK, and ERK/MAPK. Phosphorylated ERK/MAPK activate transcription factors in response to a stimulus. ................................ ................................ ................................ ............. 38

PAGE 8

8 LIST OF ABBREVIATIONS CFU C olony forming units ChIP Chromatin immunoprecipitation CMV Cytomegalovirus Dnmt3A2 DNA methyltransferase 3A2; de novo methyltransferase Dnmt3B DNA methyltransferase B; de novo methyltransferase Dnmt3L DNA methyltransferase 3 like; no enzymatic activity EDTA Ethylenediaminetetraacetic acid ESC Embryonic stem cell EZH2 Enhancer of Zeste homolog 2; the methyltransferase component of PRC2 that tri methylates H3K27 FBS Fetal bovine serum GAP GTPase activating protein GEF Guanine nucleotide exchange factor H3K27 The twenty seventh residue, K or lysine, on the N terminus of histone H3 H3K4 The fourth residue, K or lysine, on the N terminus of histone H3, H3K9 The ninth residue, K or lysine, on the N terminus of histone H3 HAT Histone acetyltr ansferase HDAC Histone deacetylase HMT Histone methyltransferase ICR Imprinting control region LB Lysogeny broth LINE 1 L ong interspersed nuclear element 1 MAPit Methyltransferase Accessibility Protocol for individual templates M E CP2 Methyl CpG binding pr otein 2

PAGE 9

9 MEM Mini mal essential medium eagle MLL/CBP Myeloid/lymphoid, or mixed lineage, leukemia protein/CREB binding protein PBS Phosphate buffered saline PCR Polymerase chain reaction PRC2 Polycomb repressive complex 2; the complex tri methylates H3K27, a mark associated with inactive transcription PVDF Polyvinylidene difluoride RESE Ras epigenetic silencing effector SWI/SNF Switch/sucrose non fermentable; ATP dependent chromatin remodeling complex TBST Tris buffered saline and Tween 20 TRE Tet response element

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science ESTABLISHMENT OF A STABLE COLORECTAL ADENOCARCINOMA CELL LINE CONDITIONALLY EXPRESSING ONCOGENIC KIRSTEN (K) RAS By Krystyn Vitale August 2013 Chair: Michael Kladde Major: Medical Sciences Epigenetic gene silencing of tumor suppressor genes is a common event in cancer initiation and progression. Genes that are silenced epigenetically undergo both structural changes in the chromatin, including alterations in histone modifications and compaction of nucleosomes, and changes in the DNA methylation levels. However, there is no evidential consensus on the process that initiates epigenetic gene silencing O ncogenic transformation by K Ras can result i n downstream epigenetic gene silencing and this approach was used t o investigate the temporospatial sequence of events. Here I describe the establishment of a stable colorectal adenocarcinoma cell line conditionally expressing oncogenic Kirsten (K) Ras that induces down stream epigenetic gene silencing The cell line was sequentially transduced to combine a transactivator with a transgene that in duces an oncogenic K Ras The transactivator conditionally activates t he expression of oncogenic K Ras G12Vwhen cultured in the presence of doxycycline. This inducible, Tet On cell line is the system that will allow the changes in chromatin structure and DNA methylation to be studied during controlled period s so structural changes can be observed from beginning to end in the process of gene silencing

PAGE 11

11 CHAPTER 1 INTRODUCTION Background and Significance K Ras is a commonly mutated oncogene in cancer and is therefore widely used as a tool in studying gene silencing during oncogenic transformation of cells. Pertinent to my study, it has been shown, previously, that K Ras dependent transformation of cells results in epigenetic gene silencing. Epigenetic silencing of tumor suppressor genes is a common event in cancer initiation and progression and is as relevant in cancer as oncogene activation and tumor suppressor gene inactivating mutations. Because e pigenetics is a relatively recent area of investigation there are still gaps of knowledg e in the mechanisms that drive this silencing Specifically, the re is no consensus concerning the temporospatial events that result in chromatin condensation and transcriptional repression. To understand the sequence of events in epigenetic gene silencing this study establishes a cell line that conditionally expresses a K Ras oncoprotein with a gain of function amino acid substitution that result s in downstream epigenetic gene silencing Conditional expression o f oncogenic K Ras allows monitoring of the time course of epigenetic changes e.g. in chromatin structure and DNA methylation Understanding the mechanism of the sequential order of events could aid in the design of therapies that potentially interfere with cancer progression or reverse epigenetic gene silencing in cancer patients

PAGE 12

12 State of Research Epigenetics an d its Role in Cancer Epigenetics the DNA sequence is not altered but chromatin structure and, consequently, gene transcription has been changed. A reas of epigenetics that have been heavily studied are methylation of DNA sequences at CpG dinucleotides and post translational modifications of the N termini of histone tails in nucleosomes 1 DNA methylation. Methylation of cytosine in CpG dinucleotide s po sition by de novo DNA methyltransferases Dnmt3a and Dnmt3b has been shown to be required for the proper development of mammals 2 and a homozygous null mutation of the maintenance DNA methyltransferase Dnmt1 results in embryonic lethality 3 CpG dinucleot ides are depleted in the genome except for in CpG rich clusters termed CpG islands which genes 4 Methylation of CpG islands is associated with gene transcriptional silencing. Methylation rep resses transcription via different mechanisms including blocking a protein from binding to DNA and carrying out its normal function. For example, DNA methylation blocks CTCF from binding to the imprinting control region ( ICR ) of the H19/Igf2 locus resulting in the expression of Igf2 rather than H19 Conversely, H19 and not Igf2 is expressed when the ICR is unmethylated 5 Also, it has been shown that proteins such as methyl CpG binding protein 2 ( MeCP2 ) bind methylated DNA and function in repr essing transcription 6 Histone tail modifications. Nucleosome core particles are comprised of a histone octamer and the DNA that is wrapped ar ound it. The histone octamer includes

PAGE 13

13 two H2A H2B dimers and one H3 H4 tetramer 7 Each of the histone proteins con tains a globular domain and an N terminal domain termed the histone tail 8 The N terminal tail is a disordered structure that extends beyond the interaction of the globular domain and the DNA and is subsequently available for recognition and modification b y histone modifying enzymes 9 Histone tails can be extensively modified, e g. methylated, acetylated, and ubiquitinated among other modifications 9 It was thought that modifications of histone tails, such as acetylation, worked to disrupt the interaction of the globular domain and the DNA resulting in a structural change to facilitate transcriptional change 10 However, it is now thought that modifications of specific amino acid residues create a pattern of binding that recruit specific chromatin remodeling 9 1 1 Different histone modifications are found in varying areas of the genome and have been shown to correlate with regulatory regions. Specifically, histone acetylation is abundant in active promoters and has been correlated with transcriptional activation 1 1 disrupt ing higher order folding or compaction of chromatin fibers 12 Histone methylation is a complex modification that can result in mono di and tri methylationof specific residues along each of the h istone tails. For example, tri methylation of H3K4 is found in active or poised promoters 12 13 while mono methylation of H3K4 is found in enhancers 13 The tri methylation of H3K27 and H3K9 are associated with inactive heterochromatin 14 Epigenetics in c ancer Genetic abnormalities were thought to be the only hallmark of cancer before a report in 1983 (ref 15) analyzed the methylated cytosine of CpGs in metastatic neoplasms, benign neoplasms, and normal tissues. Gama Sosa et al. showed that

PAGE 14

14 metastatic neo plasms had significantly lower global cytosine methylation compared to the benign and normal tissues. In recent years, it has been shown that this global DNA hypomethylation results in genomic instability, chromosomal rearrangements 16 activation of long interspersed nuclear element 1 ( LINE 1 ) retrotransposons 17 and direct activation of oncogenes 18 each of these culminating in mutations that enhance the cancer phenotype. G lobal DNA hypomethylation in tumors is accompanied by local or regional hypermethy lation 1 9 in the CpG island promoters of t umor suppressor genes and DNA repair genes effe ctively resulting in a loss of expression 1 9 For example, in retinoblastoma, DNA hypermethylation of the RB1 gene promoter, a tumor suppressor gene that regulates cell g rowth 20 results in abnormal cell proliferation. Hypermethylation in colorectal cancers of the promoter of the hMLH1 gene 2 1 which encodes a mismatch repair protein results in microsatellite instability. These reports of epigenetically silenced genes in fa milial diseases suggest that epigenetics might have a direct causal role in oncogenesis. While aberrant DNA methylation can result in the formation of tumors, mutations initi ating mis regulation of histone modifying enzymes, such as histone acetyltransferases ( HATs ) histone deacetylases ( HDACs ) and chromatin remodeling complexes, such as SWI/SNF, have been linked to cancer 21 as well. The translocation t(11;16)(q23;p13.3) results in the fusion of Mixed Lineage Leukemia protein with CREB Bind ing Protein ( MLL C BP ) 2 2 MLL is a family of histone methyltransferase s (HMTs) that methylates H3K4, a residue associated with transcriptional activation, and C BP is a HAT. When these proteins become fused, the result is a gain of function aberrant ly

PAGE 15

15 regula ting gene expression initiating un regulated growth 2 2 This translocation is associated with hematologic disorders such as acute myeloid leukemia 2 3,24 In many cancers, HDACs are overexpressed and cause aberrant gene expression by deacetylating tumor suppr essor genes such as p21 (ref. 25) resulting in abnormal cell proliferation. Mutations in components of the SWI/SNF complex that dysregulate its stability have been shown to cause a predisposition to rhabdoid cancers 2 6 while mutations in the subunit BRG1 are mutated in many cancer cell lines 2 7 Chromatin Structure Changes during Epigenetic Silencing There is no evidential consensus regarding the temporal mechanisms in gene transcriptional sil encing in either cancerous or normal cells. The interplay between DNA methylation and ch anges in chromatin structure is understood in the sense that genes with unmethylated CpG island containing promoters exhibit a l ess compact conf o rmation than those promoters that are hypermethyl ated 28 However, it is unknown whether DNA methylation is established before the chromatin is remodeled or if chromatin remodeling silences genes and in turn, DNA methylation is established after the structure changes Chromatin changes precede DNA methy lation It has been shown that during X inactivation, changes in chromatin structure precede de novo DNA methylation 29 Nevertheless, without the added stability of DNA methylation, the X chromosome can reactivate as shown in a mouse human hybrid cell line treated with 5 azacytidine 30 Hinshelwood et al. (2009) showed that p16 INK A 4 is silenced prior to establishment of DNA methylation at this locus 3 1 Evidence suggests that histone modifications, which help to regulate chromatin structure, also regulate the methylation of DNA. It has been shown that Dnmt3L can

PAGE 16

16 only recruit DNMT3a to de novo methylate DNA in the presence of unmodified H3K4 (refs. 32, 33 ) ; when H3K4 is methylated Dnmt3L cannot interact with the DNA. Conversely, it has been shown in embryonic stem cells (ESCs) that promoters that are ma rked with H3K27 tri methylation, set by the PRC2 complex are more likely to be subject to de novo DNA methylation upon lineage commitment than promoter s without H3K27 tri methylation 3 4 I t has also been shown th at the H3K27 methyltransferase EZH2 interact with Dnmt3A and Dnmt3B in vitro 3 5 indicating a possible in vivo mechanism The same study showed that more than 50% of targets of de novo methylation in ESCs are inactive before cells differentiate 3 4 indicating that the change in chromatin structure preceded DNA methylation. DNA methylation precedes chromatin changes There is evidence support ing a model in which DNA methylation precedes changes in chromatin structure It was shown that methylated DNA sequences transfected into fibroblasts recruited histones with high H3K9 tri methylation and low H3K9 acetylation marks associated with transcriptional repression, while unmethylated DNA sequences recruite d histones with H3K9 acetylation only 36 MeCP2 h as been shown to interact with HDACs and, consequently, recruit them to promoters with high levels of DNA methylation resulting in a structural change and transcriptional repression 37 39 Specifically, de novo methylation has been shown to initiate confor mational changes of chromatin at the GSTP1 (ref. 40 ) and the p16 INK4 (ref 41 ) loci Because other evidence suggests that p16 INK4 is initially regulated by chromatin conformational changes 31 this locus is a good example of how epigenetic gene silencing is poorly understood and resulting in a lack of consensus in the field

PAGE 17

17 Kirsten (K) Ras in Epigenetic Silencing K Ras is one of three isoforms in the Ras family of proteins that was first iden tified in 1973 in a rat sarcoma virus 42 However, K Ras was not shown to be a human oncogene until 1982 when it was identified as a transforming sequence in a human bladder sarcoma cell line 43 K Ras is a transmembrane protein that regulates cell activiti e s, e.g. proliferation and survival when extracellular signal s such as growth factors bind to its cell surface receptor 44 When stimulated, guanine nucleotide exchange factor s (GEFs) exchange GDP for GTP to activate K Ras In the absence of the GTP signal, K Ras is inactivated by interacting with GTPase activating proteins (GAPs) that stimulate it to hydrolyze GTP to GDP 44 K Ras becomes transform ing when the cyclic GDP/GTP exchange is impaired. When K Ras undergoes a point mutation pre dominantly in codons 12, 22, or 61 (ref 45) though other codon mutations have been reported as well 46 the protein is no longer sensitive to GAPs and hydrolysis of GTP to GDP decreases. The result is a gain of function mutation and constitutively active GTP bound K Ras as well as unregulated proliferation and survival pathways 47 In a recent paper 48 Roberts et al. (2006) used a n early stage colorectal adenocarcinoma cell line, Caco 2, to over express the constitutively active protein K RasG12V. Caco 2 cells are an interme diate stage of colorectal adenocarcinoma 48 with inactivating mutations in APC 49 and no detectable p53 expression 5 0 While the cells did not show over expression of total K Ras, the active form K Ras GTP was significantly up regulated as were downstream components of the pathway pAKT and pERK1/2.

PAGE 18

18 Roberts et al. showed that there were subset s of genes that were up and down regulated due to K Ras G12V over expression. K Ras oncogen ic transformation results in downstream signals that silence gene transcription epigenetically, specifically at the Fas locus that encodes a pro apoptotic protein 51, 52 Gazin et al. (2007) identified 28 Ras epigenetic silencing effectors (RESE s ) th at mediate the epigenetic silencing of Fas and five other genes including Sfrp1, Par4 / Pawr Plagl1, H2 K1 and Lox 5 3 When Gaz in et al. (2007) knocked down the RESEs transcription of Fas increased compared to the scramble control. RESEs include well known epigenetic mediators including HMTs, HDACs, DNA methyltransferases, chromatin remodeling enzymes, and other transcriptionally repressive factors 53 Goals and Outline T o understand the series of events involved in epigenetic silencing of gene transcription in a temporospatial manner, oncogenic K Ras was conditionally overexpressed in Caco 2 cells. Roberts et al. (2006) showed that constitutive overexpression (rather than conditional) of oncogenic K Ras i n Caco 2 cells resulted in downregulation of a subset of genes In addition, Gazin et al. (2007) showed that constitutive K Ras overexpression induce d downstream epigenetic silencing My goal was to generate a s table Caco 2 cell line conditionally expressing oncogenic Kirsten (K) Ras in order to initiate and follow the progression of epigenetic gene silencing over time After inducing expression of oncogenic K Ras g ene silencing would be assayed over time by quantifying the transcript abundance of target genes and changes in chromatin structure and DNA m ethylation

PAGE 19

19 The cell line employs an inducible system that regulates the expression of oncogenic K Ras in order to follow gene expression changes from a known beginning Caco 2 cells were transduced with a vector encoding a reverse transactivator (binds to DNA in the presence of doxycycline) and a t etracycline inducible K Ras G12V construct to allow for control led expression of the oncogenic protein The syst em uses a Tet On 3G s ystem from Clontech that expresses K Ras G12V only in the presence of doxycycline Doxycycline binds to the tet transactivator protein conferring a conformational change that allows it to bind to the Tet r esponse e lement (TRE) in the promoter of the K Ras G12V expression vector 54 (Figure 1 1 ) inducing trans cription The following chapters describe the establishment of the cell line including the methodology in Chapter 2, the results in Chapter 3, and the discussion in Chapter 4. Figur e 1 1 The Lenti X Tet On 3G s ystem induces the expression of K Ras G1 2V in the presence of doxycycline (dox) by binding the transactivator and allowing it to bind to the TRE3G promoter.

PAGE 20

20 CHAPTER 2 METHODOLOGY Cell Lines and Cultur ing The Caco 2 colorectal adenocarcinoma cel l l ine was purchased from the A merican T ype C ulture C ollection ( Manassas, Virginia ). Cells were grown in complete Mini mal essential medium eagle media (MEM; Corning Cellgro #10 010 CV) supplemented with 20% Tet s ystem a pproved fetal bovine serum ( FBS ; Clontech, #631101) and were maintained at 37 o C in 5% CO 2 in accordance with supplier recommendations Doxycycline hyclate (Sigma, # D9891) was used t o induce transgene expression B lasticidin (Invitrogen, #A11139 03) and p uromycin (Invitrogen, #A11138 03) were used in antibiotic selection of transduced Caco 2 cells. Recombinant Constructs for Inducible K Ras G12V Expression Cells were sequentially transduced with two constructs First, Caco 2 cells were transduced with pLenti CMV rtTA 3 (Addgene, #2642 9 ) containing a blasticidin selectable marker (Blast r ) and ampicillin resistance (Amp r ) (Figure 2 1) Figure 2 1. Vector map for the plasmid containing the reverse tetracycline transactivator, pLenti CMV rtTA3. The CMV promoter constitutively expresses rtTA3, the transactivator that binds to the K Ras G12V expression vector only in the presence of doxycycline.

PAGE 21

21 This plasmid co des for the reverse tetracycline transactivator (rtTA) constitutively expressed from the cytomegalovirus (CMV) promoter. In conditional expression systems using this vector, the rtTA transactivator binds to a tetracycline (doxycycline) inducible promoter to provide conditional expression of a transgene of interest. In the present stu dy, the transgene oncogenic K Ras G12V was obt ained from pDONR K Ras G12V (Addgene, #31200). K Ras G12V was subcloned into the multiple cloning site (MCS) of the second construct pLVX pTRE mCherry ( Clontech, #631352 ) as shown in Figure 2 2. Figure 2 2. Vector map of the express ion vector pLVX TRE3G mCherry. K Ras G12V was cloned into the multiple cloning site (MCS ). The promoter contains a Tet response e lement (TRE). The rtTA protein in the presence of doxycycline binds to TRE and induces the expression of mCherry and K Ras G12V. An intern al ribosome entry site (IRES) is present between mCherry and K Ras G12V, driving K Ras G12V translation. In the resulting construct, pLVX pTRE mCherry K Ras G12V, t he promoter of the transgene contains a TRE to which the rtTA binds and initiates transcrip tion of a single transcript encoding both mCherry and K Ras G12V in the presence of doxycycline Translation of K Ras G12V initiates from an internal ribosome binding site

PAGE 22

22 (IRES) pLVX pTRE mCherry K Ras G12V, containing a puromycin selectable marker (Puro r ) was transduced into Caco 2 rtTA3 clone L2 cells as described below, and selected for resistance to puromycin. Generation of L inearized Infusion Vectors Bacterial c ultures containing the constructs pLVX pTRE mCherry and pDONR K Ras G12V were grown in lysogeny broth ( LB ) plus 100 g/ml a mpicillin 12 16 hr at 37 o C with shaking. Plasmid DNA was purified from 4ml bacterial culture using the QIAprep spin m iniprep k it ( Qiagen #27104). The pLVX pTRE mCherry vector was linearized with MluI and gel purified usi ng the QIAEXII gel extraction k it (Qiagen, #20051). The K Ras G12V inse r t was generated by polymerase chain reaction ( PCR ) using CloneAmp HiFi PCR p remix (Clontech #639298); 0.016 M forward and reverse I nfusion primers (Forward: T ACCGAGCTCGGATCCACCATGA CTGAATATAAACTTGTG ; Reverse: AAACGGGCCCTCTAGATT ACATAATTACACACTTTGTCTTTGAC ) ; 5ng of pDONR K R as G12V diluted in water to a final volume of 50 l. Cycling conditions were : 95 o C for 2 min ; 98 o C for 10 sec ; 59 o C for 10 sec ; 72 o C for 10 sec ; cycled from step s 2 to 4 a total of 35 times; and a last extension step at 72 o C for 3 min The PCR products were electrophoresed on a 1%agarose gel containing 10 g/ml ethidium bromide and purified with the QIAEXII gel extraction k it (Qiagen, #20051). Recombinant DNA M ethods The Infusion HD cloning kit (Clontech, #639636) was used to subclone the K Ras G12V insert generated by Infusion PCR into the pLVX pTRE mCherry linearized vector: 40 ng of the insert; 100 ng of the linear vector; and Infusion enzyme premix was mixed with water to bring to o C

PAGE 23

23 for 15 min and then the ligated vector was transformed into Stellar competent cells (Clontech Laboratories) The cells were plate d according to the Infusion HD cloning k it p rotocol on LB /agar o C 12 16 hr Bacteria transformed with pLVX pTRE mCherry K Ras G12V and grown on selective LB/agar plus 100 g/ml ampicillin plates were screened for positive clones that contained the plasmid. To test for presence of the plasmid, the K Ras G12V insert was amplified by colony PCR for 24 bacterial colonies Bacterial colonies formed on the plate were picked and placed in a 0.2 ml tube containing ampicillin. Three m icroliters of cells from each culture were added to another tube : 1X CoralLoad Buffer; 2 5 pM of forward and reverse Infusion primers (used in generation of vector) ; 1.5 units of HotStar Taq Plus DNA p olymerase; and sterilized water. Samples were subjected to thermocycling : 95 o C for 8 min ; 94 o C for 50 sec ; 59 o C for 50 sec ; 75 o C for 90 sec ; cycled from steps 2 to 4 for 30 cycles ; and 72 o C for 10 min Samples were electrophoresed on a 1% agarose gel containing 10 g/ml ethidium bromide and checked for amplification of the 596 bp K Ras G12V insert As an independent verif ication of the colony PCR amplification, a restriction digest was performed on three positive clones. Purified plasmid DNA from each of these clones was subject to digestion with MluI to release the K Ras G12V insert from the plasmid : 500ng of the appropriate DNA pla smid; buffer NEB3 (NEB, #B70038); 5 units of MluI (NEB, #R01988) or 5 0% glycerol for a negative control; and water to a fi nal volume of 2 0 l. Samples were incubated at 37 o C for 30 min and heat inactivated at

PAGE 24

24 6 5 o C for 2 0 min Samples were electrophoresed on a 1% agarose gel containing 10 g/ml ethidium bromide. Toxicity Assay Toxicity assays were performed for the two selecti on antibiotics used in this study blasticidin and puromycin It was necessary to know the minimum concentration of antibiotic to use that would selectively kill cells not transduced with the plasmid without killing all of the cells regardless of plasmid t ransduction. For each independent toxicity assay cells were plated in 24 well plates at a concentration of 4x10 4 cells/well. Cells were treated with increasing concentrations of blasticidin (0, 2, 5, 10, 12, 15, 17, 20 g/ml) or puromycin (0, 1, 2, 4, 8, 10, 12, 14, 16 g/ml). Antibiotic containing media was changed every 3 days A double antibiotic kill curve was also performed with a combination of blasticidin/puromycin to simulate a double selection The concentration of antibiotic chosen was the dose below the one tha t killed every cell in the well after 12 days for blasticidin( 15 g/ml ) and 5 days for puromycin ( 12 ) Lentiviral Transduction Lenti X HTX packaging mix and Xfect reaction b uffer (Clontech, #631352) were used to transfect HEK293T cel ls for lentiviral particle production according to manufacturer instructions. Briefly, HEK293T cells were plated at a density of 3 x10 4 cells in a T25 flask plate in D MEM ; Corning, Cellgro, #10 013 CV) supplemented with 10% Tet s ystem a pproved FBS. Cells were incubated overnight at 37 o C at 5% CO 2 Transfection mixture was prepared by mixing : 7 g of the vector DNA (pLenti CMV r tTA3 pLVX pTRE mCherry K Ras G12V 2 or pGIPZ GFP) ; 36 l of Lenti X HTX packaging m ix ; and Xfect reaction b uffer (Clontech, #631352) in a final volume of 600

PAGE 25

25 l in a microcentrifuge tube In a second microcentrifuge tube, 592.5 l of Xfect reaction b uffer and 7.5 l of Xfect p oly mer were mixed in a total volume of 600 l The content of the 2 tubes was combined, vortexed for 10 sec and incubated at ro om temperature for 10 min The transfection mixture was added to the HEK293T cells and the cells were incubated at 37 o C in 5%CO 2 overnight. The cells were recovered in complete m edia and were grown for 48 hr to allow virus production To determine transduction efficiencyof pLenti CMV rtTA into Caco 2 cells, a parallel transduction of GFP into Caco 2 cells was performed and assayed by flu orescence microscopy (Figure 2 3 ). A B Figure 2 3 To estimate the transfection efficiency of pLenti CMV rtTA3 and helper plasmids into HEK293T cells, and anticipate successful production of virus particles, a parallel transfection of pGIPZ GFP into HEK293T cells was performed. Expression of pGIPZ GFP as show n by fluorescence microscopy indicates the pLenti CMV rtTA3 transfection was successful. A) HEK293T cells post transfection with pGIPZ GFP. B) GFP expression in HEK293T cells post transfection with pGIPZ GFP. To determine the transduction efficiency of pV X pTRE mCherry K Ras G12V into the Caco 2 rtTA, two transductions were performed and one flask of cells was induced with 500 ng/ml of doxycycline for 24 hr after the start of selection. Expression of mCherry was assayed by fluorescence microscopy.

PAGE 26

26 The len tiviral supern atants were harvested at 48 hr and the media was recovered and filtered through a cellulose acetate 0.45 m filter. Virus production was verified with Lenti X GoStix (Clontech, # PT5185 2 ).A ll tests gave positive results, which indicate d that supernatants contained >5 x 10 5 colony forming units ( C FU ) /ml For transduction of both pLenti CMV rtTA and pLVX pTRE mCherry K Ras G12V 300,000 cells were plated in T 25 flasks and grown for 12 hr after which 5 ml of virus containing supernatant was added to the cells. Cells were transduced for 24 hr L entiviral media was replaced with fresh complete media with the appropriate antibiotic(s) for selection. Antibiotic and Clonal Selection After the tr ansduction of pLenti CMV rtTA 3 into Caco 2 cells, the complete media was supplemented with 15 g/ml blasticidin. The cells transduced with pLenti CMV rtTA 3 were maintained w ith media changes and passaging for 2 month s without doxycycline until a blasticidin resistant population was obtained. To select clones from the population, the Caco 2 rtTA 3 cells were diluted to 5 cells/ml in complete media in addition to 15 g/ml of blasticidin One hundred microliters of the dilution were added to each well of four 96 well plates in an effort to plate only on e cell per well Cells were grown in the 96 well pla tes for 2 weeks Only tho se wells that contained one colony were removed w ith 1X t rypsin, ethylenediaminetetraacetic acid ( EDTA ) (Corning Cellgro #25 053 Cl) a nd expanded to a plate with a larger surface area in complete media with 15 g/ml blasticidin. This process of expansion for each clone was repeated until a resistant population of cells was obtained T he dose of blasticidin was reduced to the maintenance d ose of 7.5 g/ml for each final resistant clonal population after 2 month s of antibiotic selection

PAGE 27

27 After testing for induction capacity with doxycycline and low basal activity t he Caco 2 rtTA 3 clone L 2 was transduced wit h pLVX pTRE mCherry K Ras G12V following the above procedure. T he cells were cultured in complete media, 7.5 g/ml blasticidin, and the selection dose for the pLVX pTRE mC herry K Ras G12V vector of 12 g/ml puromycin. The selection media was changed every 3 days and the cells were pass aged for 2 month s until a puromycin resistant population was obtained. Luciferase Assay s The Dual Glo luciferase assay s ystem (Promega #E2920) was used to assay the rtTA activity of the Caco 2 clones transduced with pLenti CMV rtTA3. The vector pLVX pTRE Luc iferase was transfected into Caco 2 clones containing the rtTA3 vec tor Cells were seeded in 24 well plates at a density of 4x10 4 cells/well. Twenty four hr later in four tubes: 100 l of antibiotic and serum free MEM; 500ng /reaction of the pLVX pTRE Luciferase; 0.5 l /reaction of Plus r eagent was added to the media and incubated at room temperature for 5 min. L ipofectamine reagent, 1.25 l (Lipofectamine LTX and Plus reagent, Invitrogen, #15338 100) was added to each tube an d gently mixed Complexes were allowed to form for 30 min a t room temperature in the dark and subsequently added to the corresponding wells as the plate was being gently shaken. Cell s were incubated overnight at 37 o C in 5%CO 2 Twenty four hr later, the com plete media was recovered and 0, 100, 500 or 1000ng/ml of doxycycline was added to each well After 48 hr in the presence of doxycycline the media was aspirated from the wells of each sample and they were washed with PBS. One hundred microliters of 1X l ysis buffer was added to each well and the plate was rocked for 20 min at room temperature. The lysates were transferred to pre chilled 1.7ml tubes, vortexed for 10

PAGE 28

28 sec and centrifuged at 16,000 Xg speed for 30 sec Twenty microliters of the s upernatant was added in triplicate in a 96 well plate. Firefly luciferase activity was measured using the FLUOstar OPTIMA instrument Transient Transfection of K Ras G12V Plasmid C lones Three clones of pLVX pTRE K Ras G12V were previously shown to contain the insert To verify that the plasmids produced the oncogenic K Ras protein, clones 2, 4, and 5 plus a positive control were transiently transfected into the Caco 2 rtTA cells and induced with doxycycline Two wells of a 24 well plate were seeded with 4x10 4 cells/we ll for each plasmid to be assayed. The transfection was performed as described above. C ells were recovered in complete media (MEM and 20% Tet system a pproved FBS ) without blasticidin or puromycin For each plasmid vector, each well contained either 0 or 500ng/ml of doxycycline Production of the protein was verified by western blot. Protein Collection and Quantification Protein was collected in cold RIPA buffer ( 50 mM Tris HCl pH 7.4, 150 mM NaCl, 0.1% SDS, 1% NP 40, 0.5% sodium deoxycholate 1 mM EDTA 1 mM PMSF, 10 mM DTT, 0.1 mM glycerol phosphate, and 0.1 mM NaF). Protein was solubilized on ice for 1 hr and was centrifuged at 16 ,000 Xg for 15 min at 4 o C. The protein containing supernatant was transferred to a new pre chilled tube and was quantified. T he Bradford assay was used t o quantify protein concentrations A standard curve was generated by measuring the absorbance at 595 nmof 5, 10, 15 20 and 25 g/ml of bovine serum albumin standard (NEB, #B9001S) in 1ml water containing 20% protein assay dye reagent c oncentrate (BioRad, #500 0006). The samples were subsequently incubated at room temperature for 10 min The concentration versus the absorbance of each standard was plotted and a linear regression and its equation was

PAGE 29

29 generated. A 5 l aliquot of each protein sample was measured at 595nm in 1ml water containing 20% protein assay dye reagent c oncentrate. The absorbance of each sample was used to calculate the concentration using the linear regression Protein Immunoblotting The quantified protein was mixed with 4 X sample loading buffer (50 mM Tris HCl, pH 6.8, 2% SDS, 10% glycerol, 1% mercaptoethanol, 12.5 mM EDTA, 0.02% bromophenol blue) and denatured at 95 o C for 5 min before loading o n a 12% polyacrylamide gel. The samples were run at 40 V for 30 min and 100 V for approximately 2 hr Protein was transferred to a polyvinylidene difluoride ( PVDF ) membrane (iBlot gel transfer s tacks PVDF Mini, Invitrogen, #IB4010 02) using an iBlot. After transfer, m embranes were blocked with 5% milk in Tris buffere d s aline and Tween 20 ( TBST ) for 1 hr rocking at room temperature Membranes were incubated with appropriate concentration of primary antibodies [( K Ras, 21 kD (Santa Cruz, #sc 30) at 1:1000; bactin, 43 kD (Santa Cruz, #sc 81178) at 1:500; MLH1, 85 kD (BD Pharmigen, #51 1327GR) at 1:1000; Phospho ERK1/2 45 k D (Cell Signaling, #9102) at 1:1000 ] diluted in 5% milk in TBST and incubated 12 16 hr at 4 o C with rocking Membranes were washed three times in TBST rocking at room temperature for 20 min They were incubated with the appropriate secondary antibody (rabbit anti mouse IgG HRP (Santa Cruz, #sc 358917) at 1:2500 ) in 5% milk in TBST rocking at room temperature for 1 hr Membranes were then washed three times with TBST for 15 min rocking at room temperature and were subsequently incubated with ECL Prime w estern blotting detection r eagent (GE Healthcare, #RPN2232) for 5 min before being exposed to film.

PAGE 30

30 C HAPTER 3 RESULTS The establishment of a Caco 2 cell line with inducible oncogenic K Ras expres sion requires the sequential transduction of the transactivator and the K Ras G12V expression vector. To begin construction of the conditional Caco 2 cell line, the K Ras G12V insert was cloned into the expre ssion vector pLVX pTRE mCherry pLVX pTRE mCherr y clones were linearized with MluI (Figure 3 1 A) and clone 2 (Lane 3) was chosen for the cloning reaction. The K Ras G12V insert was PCR amplified with the Infusion primer s (Figure 3 1 B) and l anes 1 and 2 were both excised from the gel and pooled. The vector and the insert were gel purified. A B Figure 3 1 Preparation of vector and insert for the Infusion cloning reaction. A) pLVX pTRE mCherry clones were linearized by restriction digest with MluI. B) K Ras G12V insert was ampl ified from pDONR K Ras G12V with Infusion primers.

PAGE 31

31 The K Ras G12V expression vector was generated using Infusion cloning which is based on the p rinciple that the 596 bp K Ras G12V insert contains homology to the pLVX pTRE mCherry vector PCR Infusion primer s used in the amplification of the K Ras G12V insert (Figure 3 1B) are designed to contain a 15 bp homology to the expression vector After PCR amplification with those primers, the resulting K Ras G12V insert would contain homology to the expression vector T he linearized pLVX pTRE mCherry and the K Ras G12V insert were incubated with the Infusion enzyme p remix. A n exonuclease in the Premix creates single stranded ends on both the vector and the insert allowing the insert to be directionally fused int o the vector (Figure 3 2) Figure 3 2 Infusion cloning adds homology of the expression vector to the K Ras G12V insert after polymerase chain reaction( PCR ) amplification When the expression vector and the K Ras G12V insert are incubated in the Premix, an exonuclease creates single strand overhangs on both the vector and the insert resulting in directional cloning. T he recombinant vectors were transform ed into Stellar competent cells and colony PCR was used to assay the efficiency of incorporation of K Ras G12V into pLVX pTRE mCherry. Out of the 24 clones assayed 23 were positive for c ontaining the insert (Figure 3 3 ).

PAGE 32

32 Figure 3 3 Colony PCR of K Ras G12V insert from 24 bacterial clones transformed with pLVX pTRE mCherry K Ras G12V The efficiency of the Infusion cloning reaction was 23/24. To independently verify this result that the expression vector contains the K Ras G12V insert a restriction digest was performed. Three of the 23 positive colonies were cultured and plasmid DNA was isolated. Clones 2, 4, and 5 were digested with MluI which released the 596 bp insert from the ~9 kb vector (Figure 3 4). Figure 3 4 A restriction digest was performed to independently verify the results of the colony PCR of bacterial clones transformed with pLVX pTRE mCherry K Ras G12V. Bacterial clones 2, 4 and 5 were digested with MluI to release the 596 bp K Ras G12V insert from the ~9 kb pLVX pTRE mCherry.

PAGE 33

33 The three clones showed that the purified vector contained the insert. They were sequenced to verify that there were no PCR generated mutations in the K Ras G12V cDNA and to confirm that the K Ras cDNA contained the point mutation from glycine to valine at residue 12 (G12V). This mutation impairs the cyclic GDP/GTP exchange resulting in a constitutively active K Ras being bound only to GTP. To establish the inducible system, the colorectal adenocarcinoma cells, Caco 2, were sequentially transduced with the tet transactivator vector and then the K Ras G12V expression vector. Caco 2 cells were transduced lentivirally with pLenti CMV rtTA3, the tet transact blasticidin added to the complete media for 2 months until a resistant cell population was obtained. Clonal populations of Caco 2 cells containing pLenti CMV rtTA3 were obtained by selecting single cells and expanding the clonal populations for 2 months. Out of 36 initial Caco 2 pLenti CMV rtTA3 clones, only 14 clonal populations survived expansion. Out of the 14 resistant populations, 2 were shown to have inducible activity. Clones 2 and 21, hereafter L2 and L21, were tested for inducible transactivator activity and lowest basal expression with the luciferase assay. Each clone was transfected with pLVX pTRE mCherry Luc and subsequently cultured with increasing concentrations of doxycycline. T he pLVX pTRE mCherry Luc plasmid was chosen because it contained a promoter identical to the K Ras G12V expression vector and could indicate how the Caco 2 rtTA cell system would function in the presence of pLVX pTRE mCherry K Ras G12V. Both clones L2 and L21 showed low basal activityin the absence of doxycycline and activation of luciferase transcription after induction by addition of doxycycline (Figure 3 5).

PAGE 34

34 After obtaining Caco 2 rtTA clones that showed tet transactivator activity, the K Ras G12V expre ssion vectors generated (bacterial clones 2, 4, and 5) were assayed for expression K Ras G12V in the context of the Caco 2 pLenti CMV rtTA3 clones. Figure 3 5 Quantification of the activity of rtTA 3 activity and basal activity in clones L2 and L21 by luciferase assay at i ndicated concentrations of doxycycline. K Ras G12V expression vector constructs 2, 4, and 5 were transiently transfected into the clone L2 population and cultured with or without doxycycline. The protein from each sample was collected, quantified, and assayed by western blot for K Ras (21 kD) production (Figure 3 6 ) 0 50 100 150 200 250 300 350 400 450 500 (-) Dox 100 ng/ml 500 ng/ml 1000 ng/ml Luciferase fold induction (+dox/ dox) L2 L21

PAGE 35

35 Figure 3 6 Expression of K Ras from pLVX pTRE mCherry K Ras G12V clones 2, 4, and 5 transiently transfected in clone L2 cultured with or without doxycycline was assayed by western blotting with anti K Ras antibody. Only constructs 2 and 4 showed positive expression of K Ras when cultured with doxycycline, although construct 4 showed a higher expression level of K Ras than construct 2. Both of the constructs that expressed K Ras showed slight expression in the uninduced sample. The K Ras G12V expression vector construct 2 was transduced into the clone L2 cell population to complete the sequential transduction in the establishment of this ce ll line. The K Ras G12V expression vector contained mCherry in addition to K Ras G12V. Twenty four hr after recovery from the transduction, one flask was cultured without doxycycline and the other with 500 ng/ml doxycycline. The transduction efficiency was estimated by fluorescence microscopy. Expression of mCherry confirmed that a majority of cells induced K Ras G12V expression after addition of doxycycline (Figure 3 7).

PAGE 36

36 A B Figure 3 7 Transduction efficiency of pLVX pTRE mCherry K Ras G12V into the Caco 2 rtTA3 clonal population was estimated with mCherry expression by fluorescence microscopy. A) Caco 2 rtTA3 cells post transduction. B) mCherry expression in Caco 2 rtTA3 cells post transduction. Doxycycline (500 ng/ml) was used to induce expression. After the transduction, the L2 pLVX pTRE K Ras G12V population, hereafter L2 K Ras until a resistant population was obtained After the selection, the L2 K Ras G12V population wa s induced with increasing amounts of doxycycline to test the efficiency of the regulatory system (Figure 3 8).

PAGE 37

37 Figure 3 8 Protein immunoblotting was used to verify that L2 K Ras G12V resulted in low basal expression of K Ras without doxycycline and a n increase of K Ras with doxycycline. The level of K Ras expression in the L2 K Ras G12V population correlated with increasing doses of doxycycline and basal K Ras expression was similar to Caco 2. The L2 K Ras G12V sample cultured without doxycycline sho wed a similar amount of expression of K Ras compared with Caco 2 cells. When the population was induced with 500 ng/ml and 1000 ng/ml doxycycline, there was an increase in K Ras expression compared to the uninduced. To verify that overexpression of K Ras l ed to induction of its signaling pathway, half of the L2 K Ras G12V population was cultured in 500 ng/ml doxycycline for 2 months while the other half was cultured without doxycycline. Protein from Caco 2 cells and the induced sample was collected and west ern blots for K Ras and its effector proteins, pERK1/2, were performed (Figure 3 9).

PAGE 38

38 Figure 3 9 To show that L2 K Ras G12V resulted in activation of the K Ras signaling cascade, an immunoblot of L2 K Ras G12V cells cultured in doxycycline for 2 months was performed. The result was in increase in expression of K Ras and accumulation of phosphorylated ERK, a K Ras signal pathway effector K Ras expression in the L2 K Ras G12V cells increased compared to Caco 2 cells after 2 months. Additionally, pERK, an effector protein in the pathway, accumulated in L2 K Ras G12V cells cultured with doxycycline compared to Caco 2 cells. ERK is phosphoryla ted and consequently activated by MEK when the K Ras signal cascade is induced (Figure 3 10). pERK activates transcription factors and modulates gene transcription. Accumulation of the active form of ERK indicated that the K Ras signaling pathway was acti ve in L2 K Ras G12V cells after 2 months of induction. Figure 3 10 The Ras signaling cascade activates kinases Raf, MEK, and ERK/MAPK. Phosphorylated ERK/MAPK activate transcription factors in response to a stimulus. Ras Raf MEK ERK/MAPK Transcription Factors

PAGE 39

39 CHAPTER 4 DISCUSSION This study resulted in the e stablishment of a colorectal adenocarcinoma, Caco 2, cell line that overexpresses K Ras G12V and induces the K Ras pathway when cultured with doxycycline. The regulation of this system responds to increasing concentrations of doxycycline and maintains a si milar steady state of K Ras G12V expression in its presence. The completion of this cell line requires the expansion of clones from the L2 K Ras G12V population and further verification of K Ras G12V regulation. Construction of this cell line was demandin g, specifically due to the needed growth expansion of individual clones Caco 2 cells. This was time intensive as this line does not grow well clonally. Therefore, clonal expansion required 2 to 3 months of culture and expansion until a sizable population o f resistant cells was obtained for each transduction. The efficiency of this process was very low. Out of 36 initial clonal populations of Caco 2 cells transduced with pLenti CMV rtTA3, and subsequently expanded, only 14 survived Though those 14 were sel ected for antibiotic resistance, only clones L2 and L21 were able to induce and regulate expression of a Tet On luciferase vector. The transduction of clone L2 with the expression vector pLVX pTRE mCherry K Ras G12V resulted in a low efficiency of selectab le clones, as well. Out of 9 initial clonal populations of L2 K Ras G12V, only 2 were promising in the current expansion. Out of the 2 healthy clonal populations, only 1 clone showed mCherry expression when induced with doxycycline (data not shown). It wi ll be necessary in future studies to select more L2 K Ras G12V clones to identify one with expression of K Ras G12V when induced and low, leaky expression of

PAGE 40

40 K Ras G12V when uninduced. It is important that the amount of K Ras expression should not be too h igh so as to cause off target effects. The goal is to express the oncogene to induce oncogenic transformation resulting in downstream epigenetic gene silencing. Because this cell line will be used to elucidate global chromatin changes, it is necessary to assure the universal nature of observed results. Therefore, it will be necessary to construct at least one more colorectal adenocarcinoma cell line with this inducible system for comparison. The cell lines chosen would need to exhibit wild type K Ras expre ssion and, preferably, show more rapid growth than Caco 2. This study was useful because it created the system that will be used to study the temporospatial changes in chromatin structure during gene silencing. Once L2 K Ras G12V clones have been successf ully expanded and characterized, a time course of gene silencing should be established by qRT PCR and examined globally by microarray. Structural assays, i.e. Methyltransferase Accessibility Protocol for individual templates (MAPit ) 55 and chromatin immunop recipitation (ChIP), could then be used to follow chromatin changes over the established time course.

PAGE 41

41 LIST OF REFERENCES 1. Sawan C Vaissire T Murr R Herceg Z. 2008. Epigenetic drivers and genetic passengers on the road to cancer. Mutat Res 642 :1 13. 2. Okano M, Bell DW, Haber DA, et al. 1999. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99: 247 257. 3. Lei H Oh S P Okano M Juttermann R Goss K A ., Jaenisch R., Li E. 1996. De novo DNA cytosine methyltransferaseactivities in mouse embryonic stem cells. Development 122: 3195 3205. 4. Larsen F Gundersen G Lopez R Prydz H 1992 CpG islands as gene markers in the human genome Genomics 13 : 1095 1107. 5. Bell A.C., Felsenfeld G. 2000. Methylation of a CTCF dependent boundary controls imprinted expression of the Igf2 gene. Nature 405 :482 485. 6. Bird A., Wolffe A.P. 1999. Methylation induced repression Belts, braces and chromatin. Cell 99 :451 454. 7. Luger K Mader A W Richmond R K Sargent D F Richmond T J 1997. Crystal structure of the nucleosome core particle at 2.8 resolution Nature 389 : 251 260. 8. Wolffe, A. P. &Hayes, J. J. 1999 Chromatin disruption and modification. Nucleic Acids Res 27: 711 720. 9. Strahl B D Allis C D. 2000. T he language of covalent histone m odifications. Nature 403 :41 45. 10. Hansen, J. C., Tse, C. & Wolffe, A. P. 1998. Structure and function of the core histone N termini: more than meets the eye. Biochemistry 37: 17637 17641. 11. Jenuwein T Allis C D. 2001 Translating the histone code. Science 293 :1074 1080 12. Zheng C Lu X Hansen J C Hayes J J. 2005. Salt dependent intra and internucleosomal interactions of the H3 tail domain in a model oligonucleosomal array. J Biol Chem 280 :33552 33557. 13. Hon G C Hawkins R D Ren B. 2009. Predictive chromatin signatures in the mammalian genome Hum. Mol. Genet 1 8 :R195 201. 14. Li B., Carey, M., Workman, J.L. 2007. The role of chromatin during transcription. Cell 128: 707 719.

PAGE 42

42 15. Gama Sosa M A Slagel V A Trewyn R W Oxenhandler R Kuo K C Gehrke C W Ehrlich M 1983. The 5 methylcytosine content of DNA from human tumors. Nucleic Acids Res 11:6883 6894 16. Qu G.Z. ,Grundy P.E. Narayan A., Ehrlich M. 1999. Frequent hypomethylation in Wilms tumors, of pericentromeric DNA in chromosomes1 and 16. Cancer Genet Cytogene t .109: 34 39. 17. Sunami E de Maat M Vu A Turner R R Hoon D S B. 2011. LINE 1 hypomethylation during primary colon cancer progression. PLoS ONE. 6:e18884. 18. Feinberg A P Vogelstein B. 1983. Hypomethylation distinguishes genes of some human cancers from their normal counterparts Nature 301 : 89 92. 19. Jones P.A., Baylin S.B. 2002. The fundamental role of epigenetic events in cancer. Nat. Rev. Genet 3: 415 428 20. Stirzaker C., Millar D.S., Paul C.L., Warnecke P.M., Harrison J., Vincent P.C., Frommer M., Clark S.J. 1997. Extensive DNA methylation spanning the Rb promoter in retinoblastoma tumors. Cancer Res 57: 2229 2237. 21. Herman J.G., Umar A., Polyak K., Graff J.R., Ahuja N., Issa J.P., Markowitz S., Willson J.K., Hamilton S.R., Kinzler K.W., Kane M. F., Kolodner R.D., Vogelstein B., Kunkel T.A., Baylin S.B .1998. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinom a Proc. Natl. Acad. Sci 95: 6870 6875. 22. Cairns B.R Emerging roles for chromatin remodeling in cancer biology. 2001. Trends Cell Biol 11: S15 S21. 23. Sobulo O M Borrow J Tomek R Reshmi, S., Harden A., Schlegelberger B., Housman D., Doggett N.A., Rowley J.D., Zeleznik Le N.J 1997. MLL is fused to C BP a histone acetyltransferase, in therapy related acute myeloid leukemia with a t(11;16)(q23;p13.3 ) P Natl Acad Sci USA 94 (16):8732 8737. 24. Lavau C Du C Thirman M Zeleznik Le N. 2000. Chromatin related properties of C BP fused to MLL generate a myelodysplastic like syndrome that evolves into myeloid leukemia. EMBO J 19 :4655 4664. 25. Huang B H Laban M Leung C H Lee L Lee C K Salto Tellez M Raju G.C., Hooi S.C 2005. Inhibition of histone deacetylase 2 increases apoptosis and p21Cip1/WAF1 expression, independent of histone deacetylase 1. Cell Death Differ 12 : 395 404.

PAGE 43

43 26. Sevenet N. Sheridan E., Amram D., Schneider P., Handgretinger R., Delattre O. 1999. Constitutional mutations of the hSNF5/INI1 gene predispose to a variety of cancers. Am. J. Hum. Genet. 65: 1342 1348. 27. Wong A.K. Shanahan F., Chen Y., Lian L., Ha P., Hendricks K., Ghaffari S., Iliex D., Penn B., Woodland A.M., Smith R., Salada G., Carillo A., Laity K., Gupte J., Swedlund B., Tactigian S.V., Teng D.H ., Lees E. 2000. BRG1, a component of the SWI SNF complex, is mutated in multiple human tumor cell lines. Cancer Res. 60: 6171 6177. 28. Suzuki, M. M. & Bird, A. 2008. DNA methylation landscapes: provocative insights from epigenomics Nature Rev. Genet. 9: 465 476. 29. Lock L.F., Takagi N. & Martin G. R. 1987. Methylation of the Hprt gene on the inactive X occurs after chromosome inactivation Cell. 48 : 39 46. 30. Mohandas T., Sparkes R.S., Shapiro L.J. 1981. Reactivation of an inactive human X chromosome: evidence for X inactivation by DNA methylation. Science 211: 393 396. 31. Hinshelwood R A Melki J R Huschtscha L I Paul C Song J Z Stirzaker C Reddel R R Clark S J. 2009. Aberrant de novo methylation of the p16INK4A CpG island is initiated post gene silencing in association with chromatin remodelling and mimics nucleosome positioning. Hum. Mol. Genet 18 :3098 3109. 32. Ooi S. K. Qiu C., Bernstein E., Li K., Jia D., Yang Z., Erdjument Bromage H., Tempst P., Lin S.P., Allis C.D., C heng X., Bestor T.H. 2007. DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA Nature. 448 : 714 717. 33. Jia D., Jurkowska R. Z., Zhang X., Jeltsch A. & Cheng X. 2007. Structure of Dnmt3a bound to Dnmt3L suggests a model for de n ovo DNA methylation Nature. 449 : 248 251. 34. Mohn F. Weber M., Rebhan M., Roloff T.C., Richter J., Stadler M.B., Bibel M., Schubeler D. 2008. Lineage specific polycomb targets and de novo DNA methylation define restriction and potential of neuronal progenitors Mol. Cell. 30 : 755 766. 35. Vire E. Brenner C., Deplus R., Blanchon L., Fraga M., Didelot C., Morey L., Van Eynde A., Bernard D., Vanderwinden J.M., Bollen M., Esteller M., Di Croce L. de Launoit Y., Fuks F. 2006. The Polycomb group protein EZH2 directly controls DNA methylation Nature. 439 : 871 874.

PAGE 44

44 36. Hashimshony T., Zhang J., Keshet I., Bustin M. & Cedar H. 2003. The role of DNA methylation in setting up chromatin structure during development Nature Genet. 34 : 187 192. 37. Nan X. Ng H.H., Johnson C.A., Laherty C.D., Turner B.M., Eisenman R.N., Bird A. 1998. Transcriptional repression by the methyl CpG binding protein MeCP2 involves a histone deacetylase complex Nature. 393: 386 389. 38. Jones P. L. Veenstra G.J., Wade P.A., Vermaak D., Dass S.U., Landsberger N., Strouboulis J., Wolffe A.P. 1998. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription Nature Genet. 19 : 187 191. 39. Nguyen C T Gonzales F A Jones P A 2001 Altered chromatin structure associated with methylation induced gene silencing in cancer cells: correlation of accessibility, methylation, MeCP2 binding and acetylation. Nucleic Acids Res 29 :4598 4606. 40. Stirzaker C Song J Z Davidson B Clark S J. 2004. Transcriptional gene silencing promotes DNA hypermethylation through a sequential change in chromatin modifications in cancer cells. Cancer Res 64 :3871 3877. 41. Wong D J Foster S A Galloway D A Reid B J 1999. Progressive region specific de novo methylation of the p16 CpG island in primary human mammary epithelial cell strains during escape from M(0) growth arrest. Mol Cell Biol 19: 5642 5651. 42. Scolnick E.M., Rands E., Williams D. & Parks W. P. 1973. Studies on the nucleic acid sequences of Kirsten sarcoma virus: a model for formation of a mammalian RNA containing sarcoma virus J. Virol. 12: 458 463. 43. Shih C. & Weinberg R. A. 1982. Isolation of a transforming sequence from a human bladder sarcoma cell line Cell. 29 : 161 169. 44. Mitin N., Rossman K.L. & Der C. J. 2005. Signaling interplay in Ras superfamily function. Curr. Biol 15: R563 R574 45. Miyakura Y Sugano K Fukayama N ., Konishi F. Nagai H. 2002. Concurrent mutations of K ras oncogene at codons 12 and 22 in colon cancer. Jpn J Clin Oncol 32 :219 221. 46. Naguib A Wilson C H Adams D J Arends M J. 2011. Activation of K RAS by co mutation of codons 19 and 20 is transforming J Mol Signal 6 :2. 47. White M. A. Nicolette C., Minden A., Polverino A., Van Aelst L., Karin M., Wigler M.H. 1995. Multiple Ras functions can contribute to mammalian cell transformation. Cell. 80: 533 541.

PAGE 45

45 48. Roberts M L Drosopoulos K G Vasileiou I Stricker M Taoufik E Maercker C Guialis A Alexis M N Pintzas A. 2006. Microarray analysis of the differentia l transformation mediated by Kirsten and Harvey Ras oncogenes in a human colorectal adenocarcinoma cell line. Int J Cancer 118:616 627. 49. Ilyas M Tomlinson I P Rowan A Pignatelli M Bodmer W F. 1997. Betacatenin mutations in cell lines established from human colorectal cancers. Proc Natl Acad Sci USA 94:10330 4. 50. Djelloul S Forgue Lafitte M E Hermelin B Mareel M Bruyneel E, Baldi A Giordano A Chastre E Gespach C. 1997. Enterocyt e differentiation is compatible with SV40 large T expression and loss of p53 function in human colonic Caco 2 cells: status of the pRb1 and pRb2 tumor suppressor gene products. FEBS Lett. 406:234 42. 51. Fenton R G Hixon J A, Wright P W Brooks A D Sayers T J. 1998. Inhibition of Fas (CD95) expression and Fas mediated apoptosis by oncogenic Ras. Cancer Res. 58:3391 3400. 52. Peli J. Schroter M., Rudaz C., Hahne M., Meyer C., Reichmann E., Tschopp J. 1999. Oncogenic Ras inhibits Fas ligand mediated apop tosis by downregulating the expression of Fas. EMBO J 18:1824 1831. 53. Gazin C., Wajapeyee N., Gobeil S., Virbasius C.M Green M.R. 2007. An elaborate pathway required for Ras mediated epigenetic silencing. Nature 449 : 1073 1077. 54. Lenti X Tet On 3G Inducible Expression System User Manual. Clontech Laboratories, Inc. 2012 55. Pardo C E Darst R P Nabilsi N H Delmas A L Kladde M P 2011. Simultaneous single molecule mapping of protein DNA interactions and DNA methylation by MAPit. Curr Prot oc Mol Biol. CHAPTER: Unit 21.22.

PAGE 46

46 BIOGRAPHICAL SKETCH Krystyn Vitale was born to Anthony and Rebecca Vitale and s he h as a younger sister named Alexandra. She graduated from the International Baccalaureate program May of 2007. She attended the University of South Florida in Tampa, Florida beginning in August of 2007 and it was there that she first became interested in epigenetic regulation of transcription She graduated from USF in May of 2011 with Honors earning a Bachelor of Science degree in b iology concentrating in molecular and cellular b iol ogy and a minor in p sychology. the Univers ity of Florida and received a Master of Science degree in August of 2013. She is interested in continuing in the scientific field as a biomedical science educator.