<%BANNER%>

Characterization of Transgenic Mouse Lines Carrying the Human Beta-Globin Locus Control Region

Permanent Link: http://ufdc.ufl.edu/UFE0045572/00001

Material Information

Title: Characterization of Transgenic Mouse Lines Carrying the Human Beta-Globin Locus Control Region
Physical Description: 1 online resource (37 p.)
Language: english
Creator: Chamales, Pamela A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: bungert -- control -- globin -- locus -- region
Biochemistry and Molecular Biology -- Dissertations, Academic -- UF
Genre: Biochemistry and Molecular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The beta-globin locus control region is a powerful cis-regulatory element that is essential for high-level transcription in the beta-globin gene locus. During activation of the globin genes, the locus has been shown to co-localize in fluorescence in situ hybridization experiments with focal accumulations of active RNA polymerase II, or transcription factories.  We aim to create mouse lines carrying the human beta-globin locus control region without the presence of the globin genes themselves.  Utilizing this tool in the future, we can ask if the LCR alone is able to form associations with transcription factories, without influence from the genes.  In this study, 4 pLCR transgenic lines were created to help us answer this question. Using a variety of techniques we investigated the integration site, copy number, and binding by mouse endogenous transcription factors of the transgenic human LCR inserts.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Pamela A Chamales.
Thesis: Thesis (M.S.)--University of Florida, 2013.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045572:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045572/00001

Material Information

Title: Characterization of Transgenic Mouse Lines Carrying the Human Beta-Globin Locus Control Region
Physical Description: 1 online resource (37 p.)
Language: english
Creator: Chamales, Pamela A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: bungert -- control -- globin -- locus -- region
Biochemistry and Molecular Biology -- Dissertations, Academic -- UF
Genre: Biochemistry and Molecular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The beta-globin locus control region is a powerful cis-regulatory element that is essential for high-level transcription in the beta-globin gene locus. During activation of the globin genes, the locus has been shown to co-localize in fluorescence in situ hybridization experiments with focal accumulations of active RNA polymerase II, or transcription factories.  We aim to create mouse lines carrying the human beta-globin locus control region without the presence of the globin genes themselves.  Utilizing this tool in the future, we can ask if the LCR alone is able to form associations with transcription factories, without influence from the genes.  In this study, 4 pLCR transgenic lines were created to help us answer this question. Using a variety of techniques we investigated the integration site, copy number, and binding by mouse endogenous transcription factors of the transgenic human LCR inserts.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Pamela A Chamales.
Thesis: Thesis (M.S.)--University of Florida, 2013.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045572:00001


This item has the following downloads:


Full Text

PAGE 1

1 GLOBIN LOCUS CONTROL REGION By PAMELA ANN CHAMALES A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Pamela Ann Chamales

PAGE 3

3 To the univ erse, for sending me on my path May I always open my heart and soul to whatever it has to offer me.

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank Dr. Jrg Bungert, who has always supported me, even in my most difficult times at UF. He dedicated priceless time and energy toward advis ing and counseling me in my academic and professional development. I would especially like to thank him for encouraging me to do what I felt right for me when I made t he decision to leave UF with a m me accept that I know that research is not the right profession for me. His passion for his work has always inspired me, and I will go on to further adventures in my life always seeking the work passion I have witnessed in him. I would like to thank my committee ( Drs. Thomas Yang and James Resnick) for committing time and energy toward supporting my academic experience. I am grateful to Dr. Yang for his ever so motivating energy. If ever I am to mentor students I can only hope to challenge and motivate them in su ch a fashion as Dr. Yang. His excitement and enthusiasm for molecular biology is unmatched and admirable. His presence on my committee always helped me feel capable and ready for the next challenge. I am grateful to Dr. Resnick for his honesty and unders tanding and approachable demeanor. Since the first day I met Dr. Resnick I felt understood by him and having him on my committee has helped me feel safe throughout these several years. I will always aspire to be as honest and approachable with my students or clients as Dr. Resnick. I thank the members of the Bungert laboratory for always supporting and accepting me. I especially thank Joeva Barrow for being a wonderful student mentor and friend, and Jared Stees, for his friendship and support and for alw ays cultivating an amicable atmosphere in the lab. I know I will remain connected with them through this

PAGE 5

5 experience forever. I thank Alex Fan for providing much helpful research related advice and counsel and Blanca Ostmark for her helpful assistance. I a m grateful to my mother and father, for letting me grow and make my own decisions over the past 3 years. Their continued support has always given me strength and determination. I thank Karin Koff, Tracy Brown, and Roberta Seldman, my therapists, who have provided me with the tools and trust I have needed to explore my way through the past 3 years of obstacles. Their support has been nurturing, accepting, encouraging, and continuous and I truly believe I could not have come this far without them. I thank my sister for providing me with deep camaraderie; it is wonderful to go through graduate school with someone who understands you, and your every experience, each step of the way. I thank my brother for being himself and showing me that it is okay to not k now the answer to everything I may ever want in life. I thank Celeste Meyer, Tanya Saraiya, Alea Wise, Stephanie Morton, Emily Warnock, Anna Batistatos, Laura Grossman, and Marisol Bayona for comprising the most soulful, authentic, loving, and effective s upport system I have ever known in my life. I will remain forever grateful to have known these wonderful women throughout my time at UF and forever into the future.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURE S ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 globin locus ................................ ................................ .......... 11 Promoters, Enhancers and Loc us Control Regions ................................ ................ 12 Chromatin Organization and Structure ................................ ................................ ... 14 Transcription Factories ................................ ................................ ........................... 16 Ques tion ................................ ................................ ................................ ................. 17 2 MATERIALS AND METHODS ................................ ................................ ................ 19 Generation of pLCR Transgenic Lines ................................ ................................ .... 19 Inverse PCR Mapping Technique ................................ ................................ ........... 19 Real time Quantitative PCR for Determination of Copy number ............................. 20 Chromatin Immunoprecipitation ................................ ................................ .............. 20 3 RESULTS ................................ ................................ ................................ ............... 22 pLCR Mapping in Transgenic Lines ................................ ................................ ........ 22 pLCR Copy Number Determination ................................ ................................ ........ 24 Mouse Endogenous Transcription Factor Binding at pLCR ................................ .... 26 Limitations ................................ ................................ ................................ ............... 28 4 CONCLUSIONS AND FUTURE DIRECTIONS ................................ ...................... 30 Generation and Characterization of pLCR Transgenic Lines ................................ .. 30 Further Experimentation ................................ ................................ ......................... 31 Association of the Globin Locus with Transcription Factories .............................. 31 LIST OF REFERENCES ................................ ................................ ............................... 33 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 37

PAGE 7

7 LIST OF TABLES Table page 2 1 Oligonucleotide sequences ................................ ................................ ................ 21 3 1 LCR insertion sites ................................ ................................ ............................. 24 3 2 Human LCR copy number determined by qPCR ................................ ................ 26

PAGE 8

8 LIST OF FIGURES Figure page 1 1 globin loci.. ................................ ......... 12 1 2 Schematic indicating the experimental question. ................................ ................ 17 3 1 Results of inverse PCR on three transgenic lines using SacI restriction digestion. ................................ ................................ ................................ ............ 22 3 2 Sequ encing results of inverse PCR on three transgenic lines using SacI restriction digestion. ................................ ................................ ............................ 23 3 3 Sample standard c urves from copy number analysis ................................ ......... 25 3 4 RNA polymerase II binding in multiple copy LCR transgenic E14.5 fetal liver cells.. ................................ ................................ ................................ .................. 26 3 5 RNA polymerase II binding in single copy LCR transgenic E14.5 fetal liver cells.. ................................ ................................ ................................ .................. 27 3 6 RNA polymerase II and USF 1 binding in multiple copy LCR tra nsgenic E14.5 fetal liver cells ................................ ................................ ........................... 28

PAGE 9

9 LIST OF ABBREVIATIONS 3C Chromosome conformation capture C H IP Chromatin Immunoprecipitation C HR Chromosome DNA Deoxyribonucleic acid DNA FISH DNA fluorescence in situ hybridization E12 Embryonic day 12 HS2 Hypersensitive site 2 K BP Kilobase pairs P OL II RNA polymerase II RNA Ribonucleic acid USF 1 Upstream stimulatory factor 1

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Master of Science GLOBIN LOCUS CONTROL REGION By Pamela Ann Chamales May 2013 Chair: Jrg Bungert Major: Biochemistry and Molecular Biology globin locus control region is a powerful cis regulatory element that is essential for high globin gene locus. During activation of the globin genes, the locus has been shown to co localize in fluorescence in situ hybridi zation experiments with focal accumula ions of active RNA polymerase II, or globin locus control region without the presence of the globin genes themselves. Utilizing this tool in the future, we can ask if the LCR alone is able to form associations with transcription factories, without influence from the genes. In this study, 4 pLCR transgenic lines were created to help us answer this question. Using a variety of techniques we inve stigated the integration site, copy number, and binding by mouse endogenous transcription factors of the transgenic human LCR inserts.

PAGE 11

11 CHAPTER 1 INTRODUCTION globin locus Hemoglobin is a tetrameric protein expressed and stored in erythrocytes that is composed of four alpha h glob in) that each contains a tightly bound hem e group that is needed for the transport of oxygen and carbon dioxide through the bloodstream (1, 2) As human development occurs, the subunits that make up the heterodimers undergo two switches to produce slightly different forms of hemoglobin with different affinities for oxygen (3) Defects in hemoglobin pr oduction result in many disease states, such as sickle cell anemia and a variety of thalassemias. Hemoglobinopathies are the most prevalent group of monogenic diseases in the world (4) The globin locus in the human genome is located on chromosome 11 and in the mouse genome is located o n chromosome 7. The genes of the globin locus are organized in a manner reflecting developmental stage specific expression (Figure 1 1 ) Expression of the globin genes occurs in erythroid cells produced from the hematopoietic cell lineage in various ti ssues throughout development. For example, in human the globin gene is expressed in the embryonic yolk sac through the first 5 6 weeks of development. After this period, expression of this gene in this tissue is turned off and expression of and gl obin genes in the fetal liver are turned on. This persists until birth when the globin genes are turned off in the fetal liver and the adult globin genes are turned on in the adult bone marrow. Most other animals undergo one molecular switc h instead of the two persisting in human. The regulation

PAGE 12

12 and arrangement of the genes in the mouse is conserved, allowing the use of this model globin gene expression (3) The globin locus also contains an upstream 15 kbp c is regulatory element known as the locus control regio n (LCR) (5 7) In humans, this region contains five DNaseI hypersensitive sites that have been shown to conta in cis regulatory elements that attract trans acting factors for binding and regulation of the globin genes (8, 9) The LCR has been shown to be essential for globin gene activation and can confer transcriptional activity in a position independ ent and copy number dependent manner (10) Without the LCR, globin gene expression i s dramatically reduced (10 13) Figure 1 1 globin loci. A) Human glob in locus B) Mouse globin locus. Promoters, Enhancers and Locus Control Regions Promoters, enhancers and locus control regions are cis regulatory elements that generally serve to regulate the timing and frequency of gene transcription. Promoters

PAGE 13

13 are absol utely essential for gene transcription and enhancers are somewhat supplementary in that they enhance low levels of transcription to produce higher transcriptional output. Promoters are located proximal to the gene they activate and serve as the docking st ation for RNA polymerase II before gene transcription begins. Enhancers are distal cis regulatory elements that contain binding sites for various ubiquitous and cell type specific transcription factors that regulate gene activation. Locus control regions a re regions containing multiple different types of positive and negative cis regulatory elements that regulate complex genetic loci (14) Promoters ar e usually located just upstream (but can be located downstream or within the body of a gene) of the transcriptional start site and contain a diversity of core promoter elements like TATA box initiator, downstream promoter element (DPE), CG rich regions an d others (14, 15) The diversity of promoters allows for greater complexity of transcriptional programs during development (15) Promoters can cause focused or dispersed transcription depending on the number of start sites they contain. The promoter recruits RNA polymerase II with the help of the basal transcription machinery. These proteins come in and bind to the basal elements of the promoter and interact with each other, allowing for RNA polymerase II to dock and be positioned and prepared for transcription initiation (14) Enhancers are functionally defined as cis acting elements that cause gene activation regardless of the location or orientation of the element relative to the gene promoter it enhances (16, 17) Enhancers are about the same size as promoters (200 400bp) and bind va rious regulatory factors, but generally do not contain any of the basal promoter elements present in promoters and can be positioned thousands of base pairs

PAGE 14

14 away from the genes they regulate. Enhancers work with promoters to modulate expression of a gene t o acquire a particular level of expression in a specific cell type at a specific stage in development (14) Like promoters, they are generally found t o colocalize with regions of DNaseI hypersensitivity, due to lack of nucleosome occupancy and abundance of trans factor binding (18, 19) Locus control regions are functionally defined by the ability to confer position independent and copy number dependent expression to linked genes (10) They have the ability to restructure chromatin into an open and decondensed state allowing for the activation of nearby genes. They are usually comprised of multiple enhancer elements globin locus, it has been observed that in the absence of the LC R the genes still express globin, but transcripts are produced at a fraction of the normal rate (20) LCRs also carry out the complex regulation of multiple genes in one genetic locus, as i n the globin locus (14) Chromatin Organization and Structure globin locus are an integ ral component of globin gene activation. Differences in chromatin state exist between the transcriptionally active globin locus present in erythroid cells and the transcriptionally silent globin locus present in non erythroid cells. Part of understanding globin switching involves elucidating the dynamic changes in chromatin during gene activation. In erythroid cells, the entire globin locus is sens itive to DNaseI digestion and the hypersensitive sites of the LCR are hypersensitive, whereas in non erythroid cells the HS sites are DNaseI insensitive (21) Additionally, erythroid cells have increased histone acetylation at the globin locus as compared with non erythro id cells (22) Within

PAGE 15

15 the nucleus, chromosomes occupy separate territories but portions of chromosomes have been found to intermingle (23) In globin locus has been found to loop out of the chromosome territory prior to gene activation (24) This suggests that active genes leave the chromosome territory to achieve hig h levels of transcription. It has also been found that the nuclear periphery seems to be a zone of inactivation whereas the interior of the nucleus harbors more active genes. Molecular tethering of genes to the nuclear periphery results in transcriptional repression (25, 26) globin locus. In early erythroid progenitor globin locus is found at the nuclear periphery. As differentiation continues a nd the transcriptional activity increases, the locus moves to the interior of the nucleus (27) These observations indicate a difference in the chromatin compaction and accessibility state between the two cell types; in cells where the globin locus is active the chromatin takes on a more open state and in cells where t he globin locus is inactive the chromatin takes on a more closed state. During globin gene activation, the hypersensitive sites of the LCR communicate through physical interactions via the looping out of intervening DNA and the interaction of protein comp lexes bound at the surface of the hypersensit ive site cores. A looping model has been proposed, whereby the LCR is capable of activating the globin genes through physical interactions with the promoter s of the genes (28 30) It has been observed that in erythroid cells, the LCR is in close proximity to the globin gene being expressed, whereas in n on erythroid cells, the LCR and genes do not show proximity These 3C experiments suggest looping of the globin locus serves to bring the LCR

PAGE 16

16 within proximity of the globin genes in order to facilit ate transcriptional activation (30, 31) Transcription Factories Transcription factories were first described after immuno gold labeling of mRNA transcripts and RNA polymerase II, as microscopic accumulations of nascent RNA transc ripts co localizing with RN A Pol II in the nuclei of cells (32) It seems that transcription within the nucleus occurs at these distinct focal po ints enriched with Pol II (32, 33) These factories are a subset of nuclear bodies that carry out different essential functions (34) Different cell types have been shown to harbor different numbers of transcription factories (35) Some evidence suggests that transcription factories are anchored to a proteinaceous nuclear substructure (36, 37) It has been shown, using DNA immunoFISH, that active genes co localize with transcription factories and that silent genes do not and that genes dynamically move in and out of transcription factories depending o n their level of activity (35) Additionally, in erythroid cells, KLF1 regulated genes have been shown to associate with the same transcription factory containing KLF1 (38) There are two current models for the mechanism by which a transcription factory forms and associates with a gene. One suggests that transcription factories are already established in the nuclei of cells, with genes being recruite d from their nuclear position and reeled into the factory to facilitate a high level of transcriptional activation (39) The other model suggests nucleation of transcription factories at highly acti ve genes. RNA polymerase II could be recruited to the genes themselves, establishing a transcription factory wherever a new gene is being activated (40, 41) Regardless of the method of transcription factory formation, it has been shown that in e rythroid cells, during times of high globin transcription, the

PAGE 17

17 globin locus consistently co localizes with immuno staining for active RNA polymerase II (27) In cells where the LCR is not pr esent this co localization does not occur globin locus is similar to that of other sporadically active genes, instead of exhibiting the high level of activity it normally possesses (20, 27) This evidence suggests that the LCR is necessary for the globin locus to associa te with a transcription factory and cause high leve l activation of transcription. Question We want to ask if the LCR alone has the ability to associate with transcription factories. globin locus associates with transcription factories and that the genes alone do not. We inte nd to ask if the LCR alone makes this association. Figure 1 2. Schematic indicating the experimental question. To answer this, we created a set of transgenic mouse lines carrying the 15kbp human LCR. The genomic location of the insertion of the LCR in each lines was determined using inverse PCR, the copy number of each line was determined using real time

PAGE 18

18 quantitative PCR, and finally chromatin immun oprecipitation was used to investigate the binding of mouse endogenous RNA polymerase II and USF2 to the transgenic human LCR.

PAGE 19

19 CHAPTER 2 MATERIALS AND METHODS Generation of pLCR Transgenic Lines ClaI and NotI globin locus control region from a plasmid (pRS316/LCR) previously described (42) The products were run on a 1% agarose gel and the 15kbp band containing the LCR was cut from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, 2 8706). The DNA was diluted to concentrations of 1ng/uL and 0.5ng/uL in injection buffer and injections were performed using fertilized FVB oocytes. Eggs were implanted into the uterus of pseudopregnant prepared by incubating the tissue overnight in DNA lysis buffer containing Proteinase K and subsequently purified using a series of one phenol, one phenol chloroform/isoamyl alcohol, and one chloroform/isoamyl alcohol extraction. PCR was used to confirm transgenic and non transgenic genotypes. Please see Table 2 1 for all primer sequences. Inverse PCR Mapping Technique g transgenic mouse genomic DNA was digested using SacI and then run on a 1% agarose gel t g of this digested DNA w as used in a 400uL intramolecular ligation reaction and then the DNA was purified using phenol chloroform/isoamyl alcohol extraction and ethanol precipitation. PCR reactions using inverse PCR primers complementary to sequences f the inserted LCR were performed and the products were run on 1% agarose gels Resulting bands were purified using the Q IA quick Gel Extraction kit and were ligated with the pGEM T vector ( Promega, A3600). These plasmids were then transformed into Stbl2 co mpetent cells (Invitrogen, 10268 019) and selected using Ampicillin. Colonies were

PAGE 20

20 picked and selected by colony PCR (using the same inverse PCR primers) for posit ive clones. Minipreps (QIAprep Spin Miniprep Kit, 27106 ) were performed and the samples were sent for Sanger Sequencing. Real time Quantitative PCR for Determination of C opy number Real time quantitative PCR for copy number determination was carried out as previously described with minor modifications (43) 3 4 mice from each transgenic line were analyzed on at least 2 separate occasions with reactions prepared in triplicate. The 2 Ct method was used for analysis and results were confirmed using the standard curve method (44) Mouse HS2 primers were used to amplify a ref erence sequence and DNA from the human YAC line was used as a one copy calibrator (43, 45) Chromatin Immunoprecipitat ion DMEM with 10% FBS and 1% Penicillin/Streptomycin. Tissue from the head of the mouse was used for genotyping, which was carried out as noted above. The fetal liver cells were separa ted using a cell strainer and syringe plunger and washed with more media. The cells were then resuspended in 10mL media and ChIP was carried out as previously described (46) Briefly, cells were crosslinked using 1% formaldehyde. Crosslinking was stopped using 0.125M glycine and cells were washed twice with PBS. The cells were then froze n as pellets at 80C until genotyping results were acquired (2 3 days). Cells from WT and transgenic livers were selected and thawed on ice. Cells were lysed, nuclei pelleted, and DNA was sonicated to an average size of 500bp and cleared using centrifuga tion. Samples were diluted to yield 1mL of chromatin per antibody sample and pre beads per mL of diluted chromatin. After 2 hours of rotation for pre clearing and removal

PAGE 21

21 of beads by centrifugation, a appropriate antibody was added to each for rotation overnight. Antibodies used were anti RNA polymerase II, clone CTD4H8 (Millipore, 05 623), anti RNA polymerase II CTD repeat YSPTSPS (phosphoS2) antibody (Abcam, ab 5095), anti USF 1 (Santa Cruz Biotechnology, sc 8983), anti USF 2 (Santa Cruz Biotechnology, sc 861), and Anti rabbit IgG (Bethyl Laboratories, P120 101). The next day, antibody protein or 2 hours. Inputs were reserved and then washes were performed to remove any non specifically binding along with the inputs. qPCR with reactions prepared in triplicate wa s performed to analyze the results. Table 2 1. Oligonucleotide sequences NAME SEQUENCE PLCR 622 AACTCGGTGATGATGGAAGC PLCR 629 GCGTCAGAAACTGTGTGTGG GAAAACAGGAGTGCAGAGGC AATGGTCCAAGATGGTGGAG PRIMER 123 TAGCTCGAGTCTAGCCCCAC AGGAGTTTG PRIMER 122 ACTCTCGAGCTTGCTCACTT GCCAATCCT HUMAN LCR CND F CCTTGGTCAAGCTGCAACTT HUMAN LCR CND R AAGACGGAGCCAATGGGTTA MOUSE LCR CND F ACATGGTGCTTTTGGGATAT AG MOUSE LCR CND R CATGTGTGGGATGCCTTACT A HUMAN LCR HS2 F CGCCTTCTGGTTCTGTGAA HUMAN LCR HS2 R GAGAACATCTGGGCACACAC HUMAN HS2 3 LINKER F CTATTTGCTAACAGACAATA GAGTAG HUMAN HS2 3 LINKER R GTTACATATGCAGAAAGCCA CAAATC MAJ PRO F AAGCCTGATTCCGTAGAGCC ACAC MAJ PRO R CCCACAGGCCAGAGACAGCA GC MOUSE LCR HS2 F TGCAGTACCACTGTCCAAGG MOUSE LCR HS2 R ATCTGGCCACACACCCTAAG

PAGE 22

22 CHAPTER 3 RESULTS pLCR Mapping in Transgenic Lines We used inverse PCR to identify the genomic location of the LCR inserts in each of the transgenic lines. The genomic context of the insert is important to consider when evaluating the results of experiments in the future. The surrounding chromatin enviro nment could affect the results we see in immunoFISH. After restriction digestion human LCR, genomic DNA from mouse lines 617, 622, and 629 yielded the products shown i n Figure 3 1. Line 617 was later sacrificed. Figure 3 1. Results of inverse PCR on three transgenic lines using SacI restriction digestion.

PAGE 23

23 Each of the PC R products was sequenced after ligation into the pGEM T vector and mapped back to the mouse genome and human LCR. Th e results are shown in Figure 3 2. Figure 3 2 Sequencing r esults of inverse PCR on three transgenic lines using SacI restriction digestion. A B C D E F

PAGE 24

24 Table 3 1 indicates the results from the inverse PCR analy sis. Insertion sites were mapped for two of four transgenic lines. Table 3 1 LCR insertion sites Transgenic Line Location 622 Inserted into the last exon of the GrpelI gene, which is a nuclear gene tha t encodes a protein, GrpE like 1, th at is part of the mitochondrial protein transport complex PAM 629 Inserted into an intron of the gene Homer2, which encodes a post synaptic dens ity scaffolding protein which is expressed in the olfactory bulb, hippocampus, thalamus and heart Line 622 seems to have the LCR contained within a gene that is constitutively active whereas in line 629 the LCR integrated within a gene body that is active only in specific cell types, probably not in erythroid cells. The genomic location of line 622 was end of the LCR, as indicated by our inverse PCR results. We will attempt to map t he two rem ai ning transgenic lines using a technique called splinkerette PCR (47) pLCR Copy Number Determination The copy number of the LCR inserts in each of the lines was determined using real time quantitative PCR and will be confirmed using Southern blot. It ha s been well documented that qPCR can be used to determine copy number if the appropriate controls are used and measures taken to eliminate error (43, 44, 48) In our 2 t YAC mouse DNA containing one copy of the human LCR was used as a one copy calibra tor (43, 45) Primers for human and mouse HS2 were designed using specific parameters as previously described to att empt to reduce variations in efficiency between the two primer sets (48) Figure 3 1 shows the standard curves from one qPCR run. The slopes

PAGE 25

25 of the standard curves are about equal and the amp lification is near 100 percent efficiency for both primer sets. The mouse target at each DNA concentration amplifies just one cycle ahead of the human target, as it should because there should be two copies of the mouse target for every one of the human ta rget. Figure 3 3 Sample standard curves from copy number analysis. SYBR corresponds to the mouse HS2 target and SYBR1 corresponds to the human HS2 target. Two three biological samples per transgenic line were run in triplicate in three separate expe riments and data was analyzed using the 2 t method (44) The analysis for line 682 has not yet been completed, bu t preliminary experiments indicate that the copy number of this line is low.

PAGE 26

26 Table 3 2. Human LCR copy number determined by qPCR TG Line 2 t mean Upper limit mean Lower limit mean 622 4.64 6.70 3.28 629 1.77 2.76 1.18 680 0.89 1.20 0.67 682 YAC 1.00 1.55 0.68 It appears that we have created two lines containing higher copy number LCR inserts (lines 622 and 629) and two lines containing lower copy number inserts (lines 680 and 682). It is difficult to know exactly how many copies are contained within each line without a second method to confirm these results; therefore, Southern blot will be used to verify this data. Mouse Endogenous Transcription Factor B inding at pLCR We investigated whether mouse endogenous transcription fact ors were binding at the transgenic human LCR in the pLCR mice using chromatin immunoprecipitation. Figure 3 4 shows RNA polymerase II occupancy at human HS2 and the negative control human HS2 3 linker region in the DNA of E14.5 transgenic LCR embryos. Figure 3 4 RNA polymerase II binding in multiple copy LCR transgenic E14.5 fetal liver cells. The antibody for RNA pol II used RNA pol II, clone CTD4H8. Two embryos from line 622 were analyzed and data presented represent the average of these two sampl es SEM.

PAGE 27

27 It appears that Pol II binding levels at HS2 are nearly two fold greater than IgG levels at hHS2 in this multiple copy line (622). Pol II pulls down no greater amount of hHS2 3 linker DNA than IgG. The results proved similar when we examined a predicted single copy line (680). Results are shown in Figure 3 5. major promoter was used a positive control. Figure 3 5 RNA polymerase II binding in single copy LCR transgenic E14.5 fetal liver cells. Antibody used was against RNA pol II phosphoserine2. Two embryos from line 680 were analyzed and data presented represent the average of these two samples SEM. The binding of RNA pol II and of the transcription factor USF 1 at HS3 were investigated in transgenic line 682 (low co py number). USF is a ubiquitously expressed globin gene

PAGE 28

28 transcription (49) Figure 3 6 shows the results obtained from 4 tra nsgenic embryos. The levels of binding at mouse HS2 were also measured. Figure 3 6 RNA polymerase II and USF 1 binding in multiple copy LCR transgenic E14.5 fetal liver cells. The antibody for RNA pol II used was against RNA pol II phosphoserine2. F our embryos from line 682 were analyzed and data presented represent the average of these four samples SEM. It appears that active mouse endogenous RNA polymerase II and USF 1 are indeed binding at the transgenic human LCR, at levels comparable to those found at mouse HS2. This suggests that transcription complexes are forming and that transcription is occurring globin genes. Limitations It is possible that the binding of RNA pol II seen at human HS2 in the transgenic mice is due to the presence of active endogenous genes nearby interacting with the LCR. If the LCR does come into the proximity of nearby genes, it is possible that Pol II could be pulled down at the LCR because of its binding at the other gene and not

PAGE 29

29 specifically at the LCR. It would additionally be interesting to check to see if genes nearby the human LCR undergo any changes in gene expression due to the presence of the LCR. This is unlikely in most tissues but could be relevant in erythroid cells, due to the tissue specific activity of the LCR and the promoters of nearby genes (5, 50) globin genes are not linked to the transgenic LCR, the mouse globin genes are still present in the nuclei. It is possible that the transgenic human LCR could be associating wi th the mouse globin genes in trans and this could be the cause of RNA pol II binding at the transgenic LCR (51) This will need to be investigated in the future using DNA FISH or 3C experiments.

PAGE 30

30 CHAPTER 4 CONCLUSIONS AND FUTURE DIRECTIONS Generation and Characterization of pLCR Transgenic Lines In this study, transgenic m globin locus control region were created. The sites of insertion, number of LCR copies, and the binding of trans acting factors were investigated. We found that we have 2 lines carrying 2 copies of the human LCR and two lin es carrying 4 6 copies of the LCR. This will be useful for experimentation because we can observe the effects of a varying number of copies of the LCR in these mice. We also investigated the genomic location of the LCR insertions. The genomic environment surrounding the LCR is important to be aware of because it could potentially have some effect on experimental results seen in future studies. Finally, the occupancy of RNA polymerase II and the transcription factor USF 1 at the LCR were investigated. RNA p ol II and USF 1 binding levels seem to be comparable to the binding of Pol II at mouse HS2. Based on previous reports, RNA polymerase II was expected to be present at HS2. It has been shown that P ol II is recruited to the LCR in vivo before it is present a t the globin gene promoter (8) Indeed, we found that active RNA polymerase II is present at HS2 in the transgenic human LCR, without the globin genes present. This further supports a model whereby the LCR recruits transcription complexes prior to their recruitment to the globin gene promoter. A mouse containing the human LCR will serve as a useful tool for studying the activity and function of the LCR without the presence of the globin genes. It is generally accepted that the LCR is the regulatory element responsible for the high level of

PAGE 31

31 activation of globin gene transcription in vivo When the LCR is deleted from the globin locus, globin transcript levels are dramatically reduced (20, 28) The LCR mice will be a powerful tool in investigating how this phenomenon relates to main dri ving force responsible for transcription factory association, but it is possible that the active genes themselves are required for that association. Additionally, it will be interesting to investigate the transcription of non coding RNAs originating from the LCR without the presence of the genes. Various groups have found ncRNA transcripts originating from the hypersensitive sites of the LCR (52 54) The functions of these transcripts are currently unknown. In the future we will ask if these transcripts are still present in the absence of the genes. Further Ex perimentation It will be important to verify the number of copies of the LCR in each line using Southern blotting. Locus control regions have been shown to exhibit copy number dependent effects (10) Because the globin locus only contains a single copy of the LCR it seems pertinent to know exactly how many copies are contained within our mouse models. Additionally, the genomic location of each insert must be confirmed using PCR. This can be done usi of the LCR and another primer that will be complementary to a mouse endogenous sequence close to the end of the LCR. If a product of the expected size is obtained we can be confident that the genomic location is kn own. Association of the Globin Locus with Transcription Factories In the future, these transgenic lines will be used to investigate the association of the LCR with transcription foci in the nuclei of E14.5 fetal liver cells using DNA

PAGE 32

32 immunoFISH. Transcr iption factories will be labeled using an antibody for active RNA polymerase II as performed previously. The human LCR will be labeled with a biotin tagged, sequence specific probe and detected using streptavidin conjugated with a fluorophore. We can compa re the frequency of association with that of the mouse endogenous LCR with transcription factories. These human LCR mice will also be crossed with AUSF mice (from a line that contains a dominant negative mutant form for the ubiquitously expressed transcrip tion factor USF) to investigate the role of USF in the association of the LCR with transcription factories. USF has been shown to be essential for high level expression of the beta globin genes. We hypothesize that this is due to the lack of recruitment of RNA polymerase II when USF is not present at HS2 (49) It will be interesting to see if the LCR can still associate with transcription foci in the absence of USF and the resultant reduced binding of RNA pol II.

PAGE 33

33 LIST OF REFERENCES 1. Stamatoyannopoulos G, Nienhuis AW, Majerus PW, & Varmus H (1994) The Molecular Basis of Blood Diseases (W. B. Saunders Company Philadelphia). 2. Perutz MF (1960) Brookhaven symposia in biology 13, 165 183. 3. Stamatoyannopoulous A & Nienhuis G (1994) in The Molecular Basis of Blood Dieases (W.B. Saunders Compa ny, Philadelphia), pp. 107 155. 4. Weatherall DJ (1994) in The Molecular Basis of Blood Diseases (W. B. Saunders Company, Philadelphia), pp. 157 205. 5. Grosveld F, van Assendelft GB, Greaves DR, & Kollias G (1987) Cell 51, 975 985. 6. Tuan D, Solomon W, Li Q, & London IM (1985) Proceedings of the National Academy of Sciences of the United States of America 82, 6384 6388. 7. Forrester WC, Thompson C, Elder JT, & Groudine M (1986) Proc Natl Acad Sci U S A 83, 1359 1363. 8. Vieira KF, Levi ngs PP, Hill MA, Crusselle VJ, Kang SH, Engel JD, & Bungert J (2004) J Biol Chem 279, 50350 50357. 9. Hager GL, Archer TK, Fragoso G, Bresnick EH, Tsukagoshi Y, John S, & Smith CL (1993) Cold Spring Harb Symp Quant Biol 58, 63 71. 10. Li Q, Peterson KR, Fa ng X, & Stamatoyannopoulos G (2002) Blood 100, 3077 3086. 11. Ryan TM, Behringer RR, Martin NC, Townes TM, Palmiter RD, & Brinster RL (1989) Genes and Development 3, 314 323. 12. Fiering S, Epner E, Robinson K, Zhuang Y, Telling A, Hu M, Martin DI, Enver T Ley TJ, & Groudine M (1995) Genes and Development 9, 2203 2213. 13. Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E, Groudine M, & Ley TJ (1996) Molecular and Cellular Biology 16, 2906 2912. 14. Stees J, Varn F, Huang S, Strouboulis J, & Bungert J (2012) Biology 1, 778 793. 15. Juven Gershon T & Kadonaga JT (2010) Developmental Biology 339, 225 229. 16. Banerji J, Olson L, & Schaffner W (1983) Cell 33, 729 740. 17. Gillies SD, Morrison SL, Oi VT, & Tonegawa S (1983) Cell 33, 717 728.

PAGE 34

34 18. Elgin SC (1988) J Biol Chem 263, 19259 19262. 19. Gross DS & Garrard WT (1988) Annu Rev Biochem 57, 159 197. 20. Schubeler D, Groudine M, & Bender MA (2001) Proc Natl Acad Sci U S A 98, 11432 11437. 21. Bulger M & Groudine M (1999) Genes and Development 13 2465 2477. 22. Schubeler D, Francastel C, Cimbora DM, Reik A, Martin DI, & Groudine M (2000) Genes Dev 14, 940 950. 23. Branco MR & Pombo A (2007) Trends Cell Biol 17, 127 134. 24. Ragoczy T, Telling A, Sawado T, Groudine M, & Kosak ST (2003) Chromosome Res 11, 513 525. 25. Reddy KL, Zullo JM, Bertolino E, & Singh H (2008) Nature 452, 243 247. 26. Andrulis ED, Neiman AM, Zappulla DC, & Sternglanz R (1998) Nature 394, 592 595. 27. Ragoczy T, Bender MA, Telling A, Byron R, & Groudine M (2006) Genes and Deve lopment 20, 1447 1457. 28. Bender MA, Mehaffey MG, Telling A, Hug B, Ley TJ, Groudine M, & Fiering S (2000) Blood 95, 3600 3604. 29. Wijgerde M, Grosveld F, & Fraser P (1995) Nature Genetics 377, 209 213. 30. Carter D, Chakalova L, Osborne CS, Dai YF, & Fr aser P (2002) Nature Genetics 32, 623 626. 31. Tolhuis B, Palstra RJ, Splinter E, Grosveld F, & Laat Wd (2002) Molecular Cell 10, 1453 1465. 32. Iborra FJ, Pombo A, Jackson DA, & Cook PR (1996) J Cell Sci 109 ( Pt 6), 1427 1436. 33. Jackson DA, Hassan AB, Errington RJ, & Cook PR (1993) EMBO J 12, 1059 1065. 34. Shevtsov SP & Dundr M (2010) Nature Cell Biology

PAGE 35

35 35. Osborne CS, Chakalova L, Brown KE, Carter D, Horton A, Debrand E, Goyenechea B, Mitchell JA, Lopes S, Reik W et al. (2004 ) Nat Genet 36, 1065 1071. 36. Jackson DA & Cook PR (1985) EMBO J 4, 919 925. 37. Iborra FJ, Pombo A, McManus J, Jackson DA, & Cook PR (1996) Exp Cell Res 229, 167 173. 38. Schoenfelder S, Sexton T, Chakalova L, Cope NF, Horton A, Andrews S, Kurukuti S, Mi tchell JA, Umlauf D, Dimitrova DS et al. (2010) Nature Genetics 42, 53 62. 39. Fraser P (2006) Curr Opin Genet Dev 16, 490 495. 40. Palstra RJ, Tolhuis B, Splinter E, Nijmeijer R, Grosveld F, & de Laat W (2003) Nat Genet 35, 190 194. 41. Patrinos GP, de Krom M, de Boer E, Langeveld A, Imam AM Strouboulis J, de Laat W, & Grosveld FG (2004) Genes Dev 18, 1495 1509. 42. Leach KM, Nightingale K, Igarashi K, Levings PP, Engel JD, Becker PB, & Bungert J (2001) Mol Cell Biol 21, 2629 2640. 43. B allester M, Castello A, Ibanez E, Sanchez A, & Folch JM (2004) Biotechniques 37, 610 613. 44. Livak KJ & Schmittgen TD (2001) Methods 25, 402 408. 45. Bungert J DU, Lim KC, Lieuw KH, Shavit JA, Liu Q, Engel JD. (1995) Genes and Developement 9, 3083 3096. 4 6. Leach KM, Vieira KF, Kang SH, Aslanian A, Teichmann M, R.G. R, & Bungert J (2003) Nucleic Acids Research 31, 1292 1301. 47. Potter CJ & Luo L (2010) PLoS One 5, e10168. 48. D'Haene B, Vandesompele J, & Hellemans J (2010) Methods 50, 262 270. 49. Liang S Y, Moghimi B, Crusselle Davis VJ, Lin IJ, Rosenberg MH, Li X, Strouboulis J, Huang S, & Bungert J (2009) Mol Cell Biol 29, 5900 5910. 50. Blom van Assendelft G, Hanscombe O, Grosveld F, & Greaves DR (1989) Cell 56, 969 977.

PAGE 36

36 51. Brown JM, Green J, das Neves RP, Wallace HA, Smith AJ, Hughes J, Gray N, Taylor S, Wood WG, Higgs DR et al. (2008) J Cell Biol 182, 1083 1097. 52. Ling J, Baibakov B, Pi W, Emerson BM, & Tuan D (2005) J Mol Biol 350, 883 896. 53. Tuan D, Kong S, & Hu K (1992) Proc Natl Acad Sci U S A 89, 11219 11223. 54. Miles J, Mitchell JA, Chakalova L, Goyenechea B, Osborne CS, O'Neill L, Tanimoto K, Engel JD, & Fraser P (2007) PLoS One 2, e630.

PAGE 37

37 BIOGRAPHICAL SKETCH Pamela Chamales w as born in Chicago, Illinois in 1987 to Carol Ann Chamales and Peter James Chamales of Orland Park, Illinois. She lived and attended high school in Orland Park and graduated with honors from Carl Sandburg High School in 2006. During the summer of 2006, Pam ela began studying at Morraine Valley Community College and in the fall of 2007 transferred to Ohio University with the support of her parents. In June of 2010, Pamela graduated with a Bachelor of Science in Cellular and Molecular Biology. She began gradua te school in August of 2010 and was awarded the University of Florida Grinter Fellowship. After graduating from the University of Florida she plans to study counseling psychology and art therapy and one day aspires to be an art therapist and healer.