<%BANNER%>

Investigation of the Role of Gata2 in the Activation of the Beta-Globin Locus Control Region during Early Erythropoiesis

Permanent Link: http://ufdc.ufl.edu/UFE0045520/00001

Material Information

Title: Investigation of the Role of Gata2 in the Activation of the Beta-Globin Locus Control Region during Early Erythropoiesis
Physical Description: 1 online resource (59 p.)
Language: english
Creator: Morton, Stephanie N
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: brg1 -- erythropoiesis -- gata2
Biochemistry and Molecular Biology -- Dissertations, Academic -- UF
Genre: Biochemistry and Molecular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The beta-globin locus control region (LCR) is a powerful enhancer region located 50 kilobasepairs upstream of the human beta-globin genes that has been shown to be necessary for the high-level expression of these genes. Many events in the activation of the beta-globin gene locus have been shown to first occur at the LCR and subsequently occur at the genes themselves. Thus, understanding the activation of the LCR is crucial to understanding the activation of the beta-globin genes. BRG1, the central catalytic subunit of the SWI/SNF chromatin remodeling complex, is thought to be the protein responsible for opening the chromatin of the LCR early in erythropoiesis. It is unknown which factor is responsible for the specific targeting and recruitment of BRG1 to the LCR in early erythropoiesis. The experiments presented in this thesis address the hypothesis that GATA2, a transcription factor with a zinc finger DNA-binding domain, is the initial factor that binds to hypersensitive site 2(HS2) of the LCR and recruits BRG1 to open the LCR. Chromatin immunoprecipitation experiments were performed to confirm the co-occupancy of GATA2 and BRG1 at HS2 in early erythropoiesis. Co-immunoprecipitation experiments were attempted to detect an interaction between GATA2 and BRG1, but results from these experiments were inconclusive.Finally, small interfering RNA techniques were utilized to knock down GATA2 to see any indirect effects on the occupancy of BRG1 at HS2 of the LCR. Further work will need to be done to elucidate the potential role of GATA2 in the recruitment of BRG1.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Stephanie N Morton.
Thesis: Thesis (M.S.)--University of Florida, 2013.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045520:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045520/00001

Material Information

Title: Investigation of the Role of Gata2 in the Activation of the Beta-Globin Locus Control Region during Early Erythropoiesis
Physical Description: 1 online resource (59 p.)
Language: english
Creator: Morton, Stephanie N
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: brg1 -- erythropoiesis -- gata2
Biochemistry and Molecular Biology -- Dissertations, Academic -- UF
Genre: Biochemistry and Molecular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The beta-globin locus control region (LCR) is a powerful enhancer region located 50 kilobasepairs upstream of the human beta-globin genes that has been shown to be necessary for the high-level expression of these genes. Many events in the activation of the beta-globin gene locus have been shown to first occur at the LCR and subsequently occur at the genes themselves. Thus, understanding the activation of the LCR is crucial to understanding the activation of the beta-globin genes. BRG1, the central catalytic subunit of the SWI/SNF chromatin remodeling complex, is thought to be the protein responsible for opening the chromatin of the LCR early in erythropoiesis. It is unknown which factor is responsible for the specific targeting and recruitment of BRG1 to the LCR in early erythropoiesis. The experiments presented in this thesis address the hypothesis that GATA2, a transcription factor with a zinc finger DNA-binding domain, is the initial factor that binds to hypersensitive site 2(HS2) of the LCR and recruits BRG1 to open the LCR. Chromatin immunoprecipitation experiments were performed to confirm the co-occupancy of GATA2 and BRG1 at HS2 in early erythropoiesis. Co-immunoprecipitation experiments were attempted to detect an interaction between GATA2 and BRG1, but results from these experiments were inconclusive.Finally, small interfering RNA techniques were utilized to knock down GATA2 to see any indirect effects on the occupancy of BRG1 at HS2 of the LCR. Further work will need to be done to elucidate the potential role of GATA2 in the recruitment of BRG1.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Stephanie N Morton.
Thesis: Thesis (M.S.)--University of Florida, 2013.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045520:00001


This item has the following downloads:


Full Text

PAGE 1

1 INVESTIGATION OF THE ROLE OF GATA2 IN THE ACTIVATION OF THE BETA GLOBIN LOCUS CONTROL REGION DURING EARLY ERYTHROPOIESIS By STEPHANIE NOEL MORTON A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Stephanie Noel Morton

PAGE 3

3 To m y friends and family, with love

PAGE 4

4 ACKNOWLEDGMENTS It is most important that I thank my magnificent friend Pamela Chamales for her love, support, and guidance through these difficult two years. She helped me to grow when I needed it most, and to become a stronger, wiser, and gentler person than I thought I could be. She is irreplaceable in my life and I know that I was sent to this lab to meet her. I would like to thank Dr. J rg Bungert for his willingness to take me on as a graduate student. He offered me ceaseless support in my laboratory work, despite many bouts of b ad luck. His ever present optimism and his ability to find the good in every experiment helped me feel better when my experiments did not turn out well. I am thankful for his flexibility, kindness, and understanding. I would also like to thank Drs. Art Edison and Michelle Gumz for serving on my committee. They offered tremendously helpful advice and reassurance at times when I truly needed it. I appreciate the many members of the Bungert lab who have given me assistance during my graduate program, including Joeva Barrow, Jared Stees, Dr. Xiu cheng Fan, Fred Varn, Jude Masan net David Vu, and Casey Chamberlain Special thanks are due to a past member of the Bungert lab, Dr. Shermi Liang, who trained me wealth of information she worked hard to accumulate during her years in t he lab, as well as her wonderful guidance with my knitting projects. I would like to thank my parents, Tim and Maribel Morton, for enduring numerous conversations about beta globin and pipetting. I am grateful that they ha ve been here to support me in my brief stint in basic research and to carry my furniture up far too many flights of stairs I would like to tha nk my friends, Alice B., Kelly M., and Tanya S. for

PAGE 5

5 their support and kindness, as well as for their residence in places in which I like to take vacations. Finally, I would like to thank Dr. Phillip Laipis and Mr. Rob Bailey, without whom I never would have gotten to where I am now. I appreciate their openness to trying new things. I am extremely grateful for the many hours they have put into helpi ng make the supplemental instruction program a success. I am also grateful for their support in my personal endeavors, including all the assistance they gave me in applying to medical school.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 14 Chromat in Structure and Remodeling ................................ ................................ ..... 14 Histone Modifications ................................ ................................ ....................... 14 Chromatin Remodeling Complexes ................................ ................................ .. 16 Promoter and Enhancer R egions ................................ ................................ ............ 17 Promoter Regions ................................ ................................ ............................ 17 Tissue specific promoters ................................ ................................ .......... 18 Housekeeping promoters ................................ ................................ ........... 18 Enhancer Regions ................................ ................................ ............................ 19 Organization and Regulation of the Beta Globin Gene Locus ................................ 20 The Locus Control Region (LCR) ................................ ................................ ..... 20 Activation of the Beta Globin Gene Locus ................................ ........................ 21 Upstream Stim ulatory Factor (USF) ................................ ........................... 21 Co regulator BRG1 ................................ ................................ .................... 22 GATA2 ................................ ................................ ................................ ....... 23 Summation ................................ ................................ ................................ .............. 23 2 MATERIALS AND METHODS ................................ ................................ ................ 24 Design and Construction of shRNA Expressing Vectors ................................ ........ 24 Cell Culture and Transfections ................................ ................................ ................ 25 shRNA Transfections ................................ ................................ ....................... 25 siRNA Transfections ................................ ................................ ......................... 25 RNA E xtraction and Complementary DNA (cDNA) Creation ................................ .. 26 Chromatin Immunoprecipitation (ChIP) ................................ ................................ ... 26 Quantitative Polymerase Chain Reaction (qPCR) ................................ .................. 26 Protein Extraction and Western Blotting ................................ ................................ 27 Co Immunoprec ipitation ................................ ................................ .......................... 28

PAGE 7

7 3 CO OCCUPANCY OF GATA2 AND BRG1 AT THE LOCUS CONTROL REGION IN EARLY ERYTHROPOIESIS ................................ ................................ 31 Introduction ................................ ................................ ................................ ............. 31 Results ................................ ................................ ................................ .................... 31 Discussion ................................ ................................ ................................ .............. 31 4 THE ASSOCIATION OF GATA2 AND BRG1 ................................ ......................... 34 Introduction ................................ ................................ ................................ ............. 34 Results ................................ ................................ ................................ .................... 34 Discussion ................................ ................................ ................................ .............. 35 5 STABLE KNOCKDOW N OF GATA2 USING SMALL HAIRPIN RNA ..................... 38 Introduction ................................ ................................ ................................ ............. 3 8 Results ................................ ................................ ................................ .................... 38 Discussion ................................ ................................ ................................ .............. 40 6 TRANSIENT KNOCKDOWN OF GATA2 THROUGH SMALL INTERFERING RNA ................................ ................................ ................................ ........................ 44 Introduction ................................ ................................ ................................ ............. 44 Results ................................ ................................ ................................ .................... 44 Discussion ................................ ................................ ................................ .............. 45 7 CONCLUSIONS AND FUTURE DIRECTIONS ................................ ...................... 48 APPENDIX: PROTOCOL FOR SHRNA DESIGN AND TRANSFECTIONS .................. 51 LIST OF REFERENCES ................................ ................................ ............................... 56 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 59

PAGE 8

8 LIST OF TABLES Table page 2 1 List of human shRNA oligomer sequences ................................ ......................... 29 2 2 List of human primers used for qPCR experiments ................................ ............ 30

PAGE 9

9 LIST OF FIGURES Figure page 3 1 ChI P analysis of BRG1, GATA2, and RNA pol II binding to HS2 of the LCR in K562 cells ................................ ................................ ................................ .......... 33 4 1 Immunoblot analysis of protein extracts from K562 cells ................................ .... 37 4 2 Immunoblot an alysis of co immunoprecipitation on whole cell protein extracts from K562 cells ................................ ................................ ................................ ... 37 5 1 BLAST alignment of the sequenced bacterial plasmids with the corresponding 110 base pair shRNA sequence ................................ ................. 41 5 2 RT qPCR expression analysis results for populations of shRNA transfected K562 cells ................................ ................................ ................................ ........... 42 5 3 RT qPCR analysis of expression levels of gamma globin, GATA1, and GATA2 in GATA2 version 2 shRNA transfected cells after recovery from thawing ................................ ................................ ................................ ............... 43 6 1 RT qPCR analysis of K562 cells 48 hours after transfection with siRNA against lamin a/c ................................ ................................ ................................ 46 6 2 RT qPCR analysis of K562 cells 72 hours aft er transfection with non targeting ( negative control) or GATA2 siRN A ................................ ..................... 47

PAGE 10

10 LIST OF ABBREVIATIONS 3C Chromosome Conformation Capture ATP Adenosine 5' triphosphate A USF Dominant negative USF BLAST Basic Local Alignment Search Tool BRG1 Brahma Related Gene 1 ChIP Chromatin Immunoprecipitation cDNA Complementary DNA DNA Deoxyribonucleic Acid DNase Deoxyribonuclease d pc Days post coitum EGS E thylene glycol bis[succinimidylsuccinate ] FBS Fetal Bovine Serum GAPDH Glyceraldehyde 3 phosphate dehydrogenase HS Hypersensiti ve Site IgG Immunoglobulin G K562 cells Human Erythroleukemia Cells LCR Locus Control Region mRNA Messenger RNA qPCR Quantitative Polymerase Chain Reaction RFP Red Fluorescent Protein RNA Ribonucleic Acid RNA pol II RNA Polymerase II RT q PCR Quantitative Reverse Transcription Polymerase Chain Reaction shRNA Small hairpin RNA

PAGE 11

11 siRNA Small interfering RNA SWI/SNF SWItch/Sucrose NonFermentable TFIID Transcription factor II D TG Transgenic USF Upstream Stimulatory Factor WT Wild Type

PAGE 12

12 Abstract of Thesis Pre sented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science INVESTIGATION OF THE ROLE OF GATA2 IN THE ACTIVATION OF THE BETA GLOBIN LOCUS CONTROL REGION DURING EARLY ERYTHROPOIESIS By Stephanie Noel Morton May 2013 Chair: J rg Bungert Major: Biochemistry and Molecular Biology The beta globin locus control region (LCR) is a powerful enhancer region located 50 kilobasepairs upstream of the human beta globin genes that has been shown to be necessary for the high level expression of these genes Many events in the activation of the beta globin gene locus have been shown to first occur at the LCR and subsequently occur at the genes themselves. Thus, understandin g the activation of the LCR is crucial to understanding the activ ation of the beta globin genes. BRG1, the central catalytic subunit of the SWI/SNF chromatin remodeling complex, is thought to be the protein responsible for opening the chromatin of the LCR early in erythropoiesis. It is unknown which factor is responsible for the specific targeting and recruitment of BRG1 to the LCR in early erythropoiesis. The experiments presented in this thesis address the hypothesis that GATA2, a transcription factor wit h a zinc finger DNA binding domain, is the initial factor that binds to hypersensitive site 2 (HS2) of the LCR and recruits BRG1 to open the LCR. Chromatin immunoprecipitation experiments were performed to confirm the co occupancy of GATA2 and BRG1 at HS2 in early erythropoiesis. Co immunoprecipitation experiments were attempted to detect an interaction between GATA2 and BRG1, but

PAGE 13

13 results from these experiments were inconclusive. Finally, small interfering RNA techniques were utilized to knock down GATA2 to see any indirect effects on the occupancy of BRG1 at HS2 of the LCR. Further work will need to be done to elucidate the potential role of GATA2 in the recruitment of BRG1.

PAGE 14

14 CHAPTER 1 INTRODUCTION Chromatin Structure and Remodeling The DNA in the nucleus is organized into chromatin, a complex of DNA and the proteins that help to organize it ( 1 ). The building blocks of chromatin are nucleosomes, which consist of DNA wrapped around a complex of highly conserved nucleoproteins called histones ( 2 ). In the nucleosome core, two copies of each of the histone proteins H2A, H2B, H3, and H4 assemble to form a disk shaped octameric structure ( 3 ). DNA segments of 145 147 base pairs wrap around these disk shaped structures in a left handed superhelix, stabilized primarily by electrostatic interactions and hydrogen bonding between the histone proteins and phosphodiester backbone of the DNA ( 2 ). Together, the ~146 base pair DNA segment and the histone octamer form the nucleosome core ( 3 ). DNA segments of varying lengths, known as linker DNA, connect one nucleosome core particle to the next in chromatin ( 3 ). Histone Modifications The amino terminus of each of the core histone proteins is an unstructured segmen t of basic amino acid residues that protrudes from the nucleosome core ( 4 ). Known as histone tails these domains do not contribute to the structure or stability of individual nucleosomes ( 5 ). Instead, histone tails are essential to the higher order folding of chromatin ( 4 ). The basic histone tails contribute to chromatin condensation t hrough inter nucleosomal histone histone interactions, which help the nucleosomes to stack on one another in order to pack DNA ( 3 ). Histone tails are so essential to this role that in vitro their selective proteolytic removal prohibits chromatin from packing beyond the 10nm fiber ( 6 ).

PAGE 15

15 The histone tails can be post translationally modified in a number of ways by a range of enzymes ( 4 ) Lysine and arginine residu es, which make up around one third of each histone tail sequence, can be methylated or acetylated and methylation can occur multiple times on a single residue ( 4,6 ). Phosphorylation of serines and threonines also occurs, as d o ubiquitylation, sumoylation, and ribosylation of other residues ( 4 ). Each of these covalent modifications will vary the molecular presentation of a histone tail, allowing it to make different binding contacts to DNA, neighboring histones, and other proteins ( 7 ). The ultimate result of the altered molecular presentation of the histone tail via post translational modification is altered packing of chromatin ( 4 ). Some modifications, such as acetylation, are known to be activating modifications which mark open region of chromatin while others, such as trimethylation of H3K9, correlate with chromatin condensation and transcriptional repression ( 3,4 ) Important regulatory regions in DNA, such as promoters, enhancers, and insulators, are often marked by a characteristic pattern of histone modi fications that help to define them ( 4 ). Exactly how specific histone modifications a lter the chromatin landscape is unknown. It was long believed that alteration in the charge of a histone tail resulting from a modification accounted for the effects of the modification on chromatin packing, as the charge neutralization would affect the electrostatic interactions that help condense chromatin ( 6 ). However, further research discouraged this hypothesis, suggesting that the small e xtent of charge neutralization even on a highly modified histone tail would not be enough to cause the major changes in chromatin structure that result from histone modifications ( 6 ) Rather than directly causing changes in chromatin structure, histone modifications are now believed to alter the packing of DNA through a

PAGE 16

16 variety of indirect effects ( 4 ) For example, many prote ins that bind histones contain small histone binding modules, such as chromodomains to bind methylated lysines or bromodomains to bind acetylated lysines, that enable them to bind to the chromatin fiber via recognition of a specific histone modification ( 4 ). Chromatin Remodeling Complexes The presence of nucleosomes is generally inhibitory to DNA binding ( 3 ) Proteins that regulate gene express ion must deal with the repressive nature of nucleosomes in order to bind DNA ( 3 ) One mechanism of doing so is to mobilize the nucleosomes thus relieving repression due to interactions of the core parti cle with the DNA ( 3 ) A number of protein complexe s known as chromatin remodeling complexes exist to carry out this function ( 3 ). These complexes us e energy from the hydrolysis of ATP to destabilize nucleosomes by disrupting DNA histone contacts ( 3 ). One such chromatin remodeling complex is SWI/SNF, a complex first identified in yeast that is highly conserved in eukaryotes ( 8,9 ). Recruitment of the SWI/SNF complex ultimately leads to removal of nucleosomes from the enhancer and promoter regions to which it is recruited. The resulting nucleosome free regions a re sensitive to digestion of DNa se I, and can be referred to as DNa se I hypersensitive sites ( 3 ). In mammals, the 2 MDa SWI/SNF complex contains 10 12 subunits, many of which are encoded by multiple genes ( 9 ). The complex contains one of two central catalytic ATPase subunits, brahma related gene 1 (BR G1) or brahma that share significant sequence homology and have similar activities ( 10 ). BRG1 and brahma both contain a DExx catalytic domain that is important in ATP binding and hydrolysis, a HE LICc domain that functions in DNA translocation, and a bromodomain that recognizes specific acetylated residues in histone tails ( 11,12 ). These features allow the

PAGE 17

17 SWI/SNF complex to disrupt the nuclear architecture at the target site ( 11 ). Of the two, BRG1 has been sh own to be crucial to many aspects of beta globin gene regulation, including chromatin remodeling, transcriptional activation, epigenetic modifications, and the looping of the locus ( 13 15 ). The SWI/SNF complex binds with high affinity to DNA and nucleosomes in an ATP independent manner ( 8 ). In addition to the intrinsic DNA binding abilities of some subunits of the SWI/SNF complex an initial gene or cell type specific factor is thought to be required to recruit the chromatin remodeling complex to a promoter or enhan cer region ( 9 ). For example, interactions between multiple different nuclear receptors and several SWI/SNF components, including BRG1, have been shown to be involved in the recruitment of SWI/SNF to hormone responsive promoters ( 12 ). Binding of this initial factor is key to the mobilization of nucleosomes that allows initiation of activation of the regulatory DNA region. Promoter and Enhancer Regions Several cis regulatory DNA elements act in the regulation of ge ne expression by RNA polymerase II (RNA pol II) ( 1 ) Two such elements are enhancers and promoters. These two DNA elements share several characteristics, but key differences differentiate them as distinct types of functional regions ( 16 ) Promoter Regions Promoter regions are a type of cis regulatory DNA element located proximal to the target gene ( 16 ) The basal promoter contains basal promoter elements, including the TATA box, initiator, and downstream promoter elements, which recruit RNA pol II and general transcription factors particularly TFIID ( 16 ). This region provides a platform for assembly of transcription complexes that are subsequently primed to initiate

PAGE 18

18 transcription of the target gene ( 16,17 ). The complete promoter region includes the basal promoter as well as upstream regulatory elements within 1000 base pairs of the transcription start site ( 16 ) The upstream regulatory elements provide binding site s for gene specific transcription factors, which contribute to transcriptional regulation of the target gene ( 16 ) Tissue specific promoters Two distinct types of promoters exist. Tissue specific promoters, which mediate transc riptional initiation on focused, single or several base pair long regions, comprise the promoters for only about 30% of genes ( 17 ). These p romoters are commonly marked with high H3K4 tr imethylation and H3K79 trimethylation ( 16,18 ). Tissue specific promoters contain the previously mentioned basal promoter elements and typically control expression of regulated genes ( 16 17 ). Despite making up a minority of the promoters in vertebrates, tissue specific promoters are heavily studied because of their involvement with significant regulated genes ( 17 ). Housekeeping promoters The remaining 70% of genes are controlled by housekeeping or dispersed promoters ( 16,17 ). Typically conveying expression at lower levels than tissue specific promoters, these contain no basal promoter elements ( 1,16 ). Instead, housekeeping promoters are found in CpG islands, granting them a GC rich nucleotide composition ( 17 ). Transcription under the control of a housekeeping promoter initiates at one of many weak start sites scattered over a region of about 50 100 nucleotides ( 17 ). Housekeeping promoters are also distinguishable from tissue specific promoters by their histone modifications ( 16 ). Rather than the H3K4 and H3K79 trimethylation seen in

PAGE 19

19 tissue specific promoters, housekeeping promoters are marked by H3K27 acetylation and H3K20 monomethylation ( 16 ). Enhancer Regions Enhancers are similar to promoters in their 50 200 base pair length DNase I hypersensitivity, and inclusion of factor binding elements of 6 10 base pairs ( 1 ). However, unlike proximal promoter elements, e nhancer regions are located distal from the target gene, often 50 kilobases or more from the target gene and commonly within introns ( 1,19 ). transcription from within a plasmid construct that has been transfected into cells, regardless of the enhancer location or orientation to the promoter of the target gene ( 19 ). The histone modifications that characterize enhancer regions provide an added dissimilarity to promoter r egions, as enhancers are marked by high H3K27 acetylation and H3K4 monomethylation and an absence of the significant H3K4 trimethylation found in promoters ( 16,19 ). The high H3K27 acetylation could result from the greater ex tent of histone acetyltransferase p300 binding at enhancers as compared to promoters ( 19 ) Enhancers often act to convey tissue or developmental stage specific expression at the transcriptional level ( 16 ). Enhancers can me diate gene expression by opening the chromatin at promoter regions, positioning genes physically close to transc riptionally active regions of t he nucleus, directly recruiting transcription complexes, and recruiting elongation factors to affect transcriptio nal elongation ( 16 ). Although some enhancers can directly recruit RNA pol II transcription complexes, enhancers do not contain the basal promoter elements found in promoters ( 16 ). Instead, e nhancers contain transcription factor binding sites to recruit a variety of ubiquitous or

PAGE 20

20 tissue specific proteins ( 16 ). Many of these proteins also bind promoter regions either directly or through interactions wi th other factors, creating a complex interplay between enhancer and promoter bound proteins ( 16 ) Within the past few decades, chromosome conformation capture (3C) experiments have revealed extensive colocalization interactions between enhancers and the promoters of the genes they regulate ( 19 between the enhancer and promoter, with the intervening DNA looped out of the way, are necessary for gene acti vation by the enhancer ( 19 ). These direct interactions could facilitate the transfer of chromatin modifying proteins, elongation factors, or entire transcription complexes f rom the enhancer to the promoter to activate expression of the target gene ( 16 ). Organization and Regulation of the Beta Globin Gene Locus The beta globin protein makes up one of two subunits of the protein hemoglobin, the main oxygen carrier in the bloodstream ( 20 ) The human beta globin gene locus is found on chromosome 11 ( 20 ) It contains the genes of the beta globin family, which include epsilon gamma delta and beta globin ( 20 ) These genes are organized and exp ressed in a developmental stage specific manner with epsilon globin expressed i n the embryonic yolk sac, gamma globin expressed in the fetal liver, and delta globin an d, to a greater extent, beta globin expressed in the adult bone marrow ( 20 ) The Locus Control Region (LCR) Upstream of the be ta globin gene locus is a powerful 15 kb enhancer region termed the locus control region (LCR) ( 20 ) The LCR contains five DNase I hypersensitive (HS) sites which contain known binding site s for transcription factors important in the activation of the beta globin gene locus ( 20 ) The LCR has been shown

PAGE 21

21 to be critical for beta globin gene expression as absence of an LCR leads to severely reduced beta globin gene expression ( 21 ) Activation of the Beta Globin Gene Locus Erythroid cells differentiate from hematopoietic stem cells through a process known as erythropoiesis, in which they pass through many intermediate stages ( 20,22 ) Expression of the developmental stage appropriate beta globin gene is not high until late in the process of erythropoiesis ( 20,23 ) Activation of the beta globin gene locus is thought to begin with the opening of the LCR early in erythropoiesi s ( 24 ) Many events involved in the activation of the beta globin gene locus have been shown to first occur at the LCR and subsequently occur at the beta globin promoter regions ( 24 ) Understanding how the LCR is activated is critical for understanding activation of the beta globin genes as a whole. Upstream Stimulatory Factor ( USF ) Several transcription factors have proven crucial in the activation of the LCR. One of these is a prote in known as Upstream Stimulatory Factor (USF) ( 25 ) USF is a ubiquitously expressed transcription factor that has a basic helix loop helix leucine zipper DNA binding domain specific for a central E box motif ( 26 ) It has two forms, USF1 and USF1, which share a large amount of sequence homology, and is typically active in the form of the USF1/USF2 heterodimer ( 26,27 ) USF enhances the expression of erythropoietic transcription factors and mediates the recruitment of transcription complexes to the beta globin gene locus ( 28,29 ) A transgenic mouse model has been made which expresses a form of USF in which the basic DNA binding domain is replaced by acidic residues ( 25 ) This protein, known as A USF, has been shown to inhibit normal activity of both USF1 and USF2 in a

PAGE 22

22 dominant negative manner ( 25 ) Erythroid cell specific expression of A USF in transgenic mice has been shown to lead to reduced expression of all beta type globin genes and reduced association of RNA p ol II with HS2 and the beta major globin gene promoter ( 25 ) A USF embryos show an anemic phenotype at 10.5 dpc and the mutation is embryonic lethal by 12.5 dpc ( 25 ) Co r egulator BRG1 Another cr itical transcription factor is b ra h ma related gene 1 (BRG1). As discussed previously in this chapter, BRG1 is the central cat alytic ATPase subunit of the SWI/SNF chromatin remodeling complex ( 12 ) It uses energy derived from ATP hydrolysis to disrupt the chromatin architecture at target DNA regions ( 12 ) BRG1 is required for beta globin regulation and erythropoiesis in vivo ( 13 15 ) The hypomorphic mutant BRG1 ENU1/ which has a mutation in its ATPase domain that uncouples ATPase activity from chromatin remodeling, is recruited to the beta globin locus, but epigenetic marks, chromatin remodeling, and transcription are all negatively affected ( 13 ) BRG1 ENU1/ embryos show an anemic phenotype at 12.5 dpc that is similar to the phenotype of A USF embryos ( 13,25 ) Co immunoprecipitation experiments show that USF2 and BRG1 appear to be associated in a common protein complex, although the exact nature of their interaction has not yet been determined ( 30 ) The pattern of occupancy of BRG1 at HS2 and the beta major promoter is similar to that of USF ( 30 ) Through chromatin immunoprecipitation (ChIP) experiments, BRG1 appears to be associated with the locus early on during differentiation and later dissociates ( 30 ) ChIP experiments in 10.5 dpc male embryonic yolk sac cells reveal that BRG1 binding at HS2 appears to be higher in A USF transgenic cells than in non transgenic cells ( 30 ) Contrastingly, BRG1 binding at

PAGE 23

23 the beta major promot er appears to be higher in non transgenic cell than in transgenic cells ( 30 ) GATA 2 The SWI/SNF complex, with catalytic subunit BRG1 seems a likely candidate to open the LCR. It remodels nucleosomes, appears to interact with USF2, and is pres ent early in erythropoiesis, later dissociating. As SWI/SNF has no mechanism to direct it specifically to the LCR another molecule must recruit the complex to the LCR in order f or it to play its critical role ( 9 ) A likely candidate for this role is GATA2 a t ranscription factor with a zinc finger DNA binding domain ( 32 ) Other zinc finger proteins have been shown to associate with BRG1 and selectively recruit it to regulatory regions ( 12 ). GATA2 is expressed in hematopoietic pro genitor cells and its expression declines through th e course of erythropoiesis ( 32,33 ) GATA2 has been shown to be essential for the function of hematopoietic progenitor cells ( 34 ). GATA 2 / mice exhibit sever e defects in hematopoiesis exhibiting an anemic phenotype t hat leads to death by 10 11 dpc ( 35 ). Summation The experiments in this thesis will address the hypothesis that GATA2 is the initial transcription factor that binds to HS2 of the beta globin LCR and recruits chromatin remodeling proteins, such as BRG1, to open the LCR.

PAGE 24

24 CHAPTER 2 MATERIALS AND METHODS Design and Construction of shRNA Expressing Vectors Small hairpin RNA ( shRNA ) oligomers were desi gned using the Dharmacon siRNA Design C enter ( http://www.dharmacon.com/designcenter/designcenterpage. aspx ). Transcript sequences were obtained using the Ensembl Genome Browser ( http://useast.ensembl.org ) Human t ranscripts used were as follows: Gata2 001, CCDS3049; Gata1 001, CCDS14305; SMARCA4 001 (BRG1), CCDS12253. Two sequences per transcript were chosen from the results of the Dharmacon siRNA Design Center and aligned to the human genome using the Basic Local Alignment Search Tool (BLAST) to check for off target effects. The selected sequences were then inserted into the RNA Codex Tool ( http://cancan.cshl.edu/cgi bin/Codex/Tools.cgi ), with AC added before the 19mer sequence and A added after to create a 22mer sequence prior to shRNA optimization. The resulting sense and anti sense s equences were inserted into an shRNA hairpin sequence, obtained courtesy of the lab of Dr. Suming Huang at the University of Florida. The rever se complement to each sequence was also generated to allow for annealing of the shRNA oligomers and ligation into a double stranded vector. The IDT DNA Analyzer ( http://www.idtdna. com/analyzer/Applications/OligoAnalyzer/ ) was used to analyze the full hairpin sequences to confirm their ability to form hairpins. Complete shRNA sequences are listed in Table 2 1. Desalted shRNA o ligomers were obtained from Sigma, then resuspended and annealed into double stranded oligomers. The TRIPZ vector (Thermo Scientific) was digested with EcoRI HF and XhoI ( New England Biolabs), and the digested vector was

PAGE 25

25 gel purified using the QIAGEN Gel Extraction Kit Double stranded shRNA oligomers were ligated into the TRIPZ vector The construct was then transformed into Stbl2 competent cells ( Invitrogen ). Plasmid DNA was extracted from transformed cells and sequenced to check for mutations in the shRNA sequences. Cell Culture and Transfections Human erythroleukemia (K562) cells were maintained in R PMI 1640 supplemented with 10% fetal bovine s erum (FBS) and 1% penicillin/streptomycin. Cells were grown at 37 C in an incubator containing 5% CO 2 shRNA Transfections K562 cells at a concentration of 5x10 5 cells per milliliter of media were transfected using 10 microliters Lipofectamine 2000 Reagent (Invitrog en) per milliliter of for transfections was 2.5 micrograms per milliliter of media. Puromycin (Sigma Aldrich) at a concentration of 5 micrograms per milliliter of media wa s added as a selection drug 48 hours post transfection The concentration of puromycin was lowered to 2 micrograms per milliliter of media 10 days after transfection to maintain selection. Expression of shRNA was induced by adding 1 microgram of doxycyclin e ( Sigma ) per milliliter of media. RNA was extracted 72 96 hours after induction with doxycycline. siRNA Transfections siGENOME SMARTpool reagents for human GATA2 (M 009024 00) Lamin A/C control (D 001050 01), siGLO Lamin A/C control (D 001620 02), and no n targeting small interfering RNA ( siRNA ) control (D 001210 02) were obtained from Dharmacon and resuspended in 1x siRNA buffer (60mM KCl, 6mM HEPES pH 7.5, 0.2mM MgCl 2 ) DharmaFECT 1 Transfection Reagent (T

PAGE 26

26 200 1, Dharmacon) was used to transfect K562 cells at a concentration of 2x10 6 cells The volume of DharmaFECT 1 Transfection Reagent used per milliliter of media was 2 microliters. The contr ol siRNAs were transfected at 25 micromolar concentrations and the GATA2 siRNA was transfected at a 50 micromolar concentration. Cells were incubated for 48 72 hours after transfection. RNA Extraction and Complementary DNA (cDNA) Creation RNA was extracted from 1 x 10 6 cells using the RNeasy Mini Kit from QIAGEN. concentration of the RNA was determined using the Implen P300 NanoPhotometer. Complementary DNA (cDNA) was crea ted from 1 microgram of total RNA using the iScript cDNA synthesis kit (Bio analyzed via quantitative polymerase chain reaction (qPCR). Chromatin Immunoprecipitation (ChIP) Chromatin immunoprecipitati on (ChIP) experiments were performed as described previously ( 36 ) T he following antibodies were used for ChIP assays: RNA polymerase II ( RNA p ol II ) (CTD4H8; Upstate Biotechnology), rabbit anti BRG1 (sc 10768, Santa Cruz), rabbit anti GATA2 (sc 9008x, Santa Cruz), and rat anti GATA1 (sc 265, Santa Cruz ). Normal rabbit IgG ( P120 101, Bethyl Labs ) was used as a negative control. Quantitative Polymerase Chain Reaction (qPCR) Reactions were set up using the SsoAdvanced SYBR Green Supermix (Bio Rad) and run in the Bio Rad CFX Connect Real Time System. Primers used for qPCR experiments are listed in Table 2 2. Reverse transcriptase quantitative polymerase c hain reaction ( RT q PCR ) reactions for RNA analysis were carried out under the

PAGE 27

27 following conditions: 95C for 5 min, 40 cycles of 94C for 30 s, 59C for 30 s, and 72C for 1 min (the plate was read after each extension step), 95C for 10 s, and a melting c urve from 60C to 95C with a 0.5C step size. qPCR reactions for ChIP experiments used the following conditions: 95C for 5 min, 40 cycles of 94C for 10 s, 59C for 20 s, and 72C for 30 s (the plate was read after each extension step), 95C for 30 s, an d a melting curve from 60C to 95C with a 0.5C step size. Analysis was performed using the relative standard curve method, with standard curves generated by 10 fold serial d ilutions of wild type cDNA for RT q PCR and input DNA of the appropriate cell type for ChIP qPCR. For RT q PCR, r esults were reported as expression levels normalized to the messenger RNA (mRNA) of reference gene GAPDH ChIP qPCR results were normalized as the fraction of input DNA from the appropriate cell type Protein Extraction and We stern Blotting At least 1x10 7 cells were used per lane in western blot experiments. Proteins were extracted by resuspending cells in RIPA buffer (50 mM Tris HCl [pH 7.4], 100 mM NaCl, 10 mM EDTA, 0.25% NaDesoxycholate, 1% NP 40, 0.1% SDS) contain ing protea se inhibitors (Roche). Cells were then placed on a rotating wheel at 4C for 30 minutes. Between 10 micrograms and 60 micrograms of protein extracts were incubated in Laemmli buffer at 95C for 10 minutes. Denatured proteins were separated by electrophores is on 4 15% Mini PROTEAN TGX precast gels (Bio Rad). The Bio Rad Mini Trans Blot apparatus was used for electrotransfer onto a polyvin ylidene difluoride with a solution of 5% milk in a TBS solution containing 0.1% Tween 20 (TBST). Antibodies used for probing and detection were incubated with the membrane in a 5% milk solution in TBST. Proteins were detected using the Immobilon Western

PAGE 28

28 Chemiluminescent HRP Substrate (Millipor e) and x ray film (Kodak) according to the Primary antibodies were the same as those used for ChIP. Mouse anti tubulin (sc 55529, Santa Cruz) was used as an equal loading control for whole cell extracts. Secondary antibodies were goat anti mouse IgG HRP (sc 2005, Santa Cruz), goat anti rabbit IgG HRP (sc 2301, Santa Cruz), and goat anti rat IgG HRP (sc 2006, Santa Cruz). Co Immunoprecipitation Between 1 2x10 7 cells per antibody were used for co immunoprecipitation experimen ts. Cel ls were washed with PBS and resuspended in lysis buffer (20mM Tris pH 7.5, 100mM NaCl, 0.5% NP 40, 0.5mM EDTA, 0.5mM PMSF) for extraction of protein complexes. After centrifugation of samples and isolation of supernatants, antibodies were added to the extr acts and incubated overnight on a rotator at 4 C Antibodies used in co immunoprecipitation experiments were the same as those used for ChIP. Next, protein A sepharose beads (GE Healthcare) were added to the immunoprecipitates, which were then incubated on a rotator at 4 C for another 2 hours After washing the immunoprecipitates three times with lysis buffer, immunoblotting was performed according to the western blot procedure outlined previously.

PAGE 29

29 Table 2 1 List of human shRNA oligomer sequences Gene Seq uence GATA2 version 1 Top tcgagaaggtatattgctgttgacagtgagcgCCCAAAGTGCATGCAGGAGAAAtagtgaa gccacagatgtaTTTCTCCTGCATGCACTTTGGTtgcctactgcctcgg 3' Bottom aattccgaggcagtaggcaCCCAAAGTGCATGCAGGAGAAAtacatctgtggcttcactaT TTCTCCTGCATGCACTTTGGTcgctcactgtcaacagcaatataccttc 3' GATA2 version 2 Top tcgagaaggtatattgctgttgacagtgagcgCCGAGAGCATGAAGATGGAAAAtagtgaa gccacagatgtaTTTTCCATCTTCATGCTCTCGTtgcctactgcctcgg 3' Bottom aattccgaggcagtaggcaCCGAGAGCATGAAGATGGAAAAtacatctgtggcttcactaT TTTCCATCTTCATGCTCTCGTcgctcactgtcaacagcaatataccttc 3' GATA1 version 1 Top tcgagaaggtatattgctgttgacagtgagcgCCTGGAAGATCTGGATGGAAAAtagtgaa gccacagatgtaTTTTCCATCCAGATCTTCCAGTtgcctactg cctcgg 3' Bottom aattccgaggcagtaggcaCCTGGAAGATCTGGATGGAAAAtacatctgtggcttcactaT TTTCCATCCAGATCTTCCAGTcgctcactgtcaacagcaatataccttc 3' GATA1 version 2 Top tcgagaaggtatattgctgttgacagtgagcgCCCCGCAAGGCATCTGGAAAAAtagtgaa gccacagatgtaTTTTTCCAGATGCCTTGCGGGTtgcctactgcctcgg 3' Bottom aattccgaggcagtaggcaCCCCGCAAGGCATCTGGAAAAAtacatctgtggcttcactaT TTTTCCAGATGCCTTGCGGGTcgctcactgtcaacagcaatataccttc 3' BRG1 version 1 Top tcgagaaggtatattgctgttgacagtgagcgCCGCTCAGAAGAAGAGGAAGAAtagtga agccacagatgtaTTCTTCCTCTTCTTCTGAGCGTtgcctactgcctcgg 3' Bottom aattccgaggcagtaggcaCCGCTCAGAAGAAGAGGAAGAAtacatctgtggcttcacta TTCTTCCTCTTCTTCTGAGCGTcgctcactgtcaacagcaatataccttc 3' BRG1 version 2 Top tcgagaaggtatattgctgttgacagtgagcgCCCCAAGGATTTCAAGGAATAAtagtgaa gccacagatgtaTTATTCCTTGAAATCCTTGGGTtgcctactgcctcgg Bottom aattccgaggcagtaggcaCCCCAAGGATTTCAAGGAATAAtacatctgtggcttcactaT TATTCCTTGAAATCCTTGGGTcgctcactgtcaacagcaatataccttc 3 In the above sequences, lowercase letters indicate the sequence of the standard shRNA hairpin used. Capital letters signify the specific sense and antisense shRNA sequences. Each version has two strands (top and bottom ) that were annealed together to al low ligation into a double stranded vector

PAGE 30

30 Table 2 2 List of human primers used for qPCR experiments Primers Usage Sequence HS2 ChIP qPCR GAGTCATGCTGAGGCTTAGGG 3' GTCACATTCTGTCTCAGGCA 3' GATA1 RT q PCR CCACTACCTATGCAACGCCT 3' ACCTGCCCGTTTACTGACAA 3' GATA2 RT q PCR CTACAGCAGCGGACTCTTCC 3' CCCACAGTTGACACACTCCC 3' globin RT q PCR TGAATGTGGAAGATGCTGGA 3' CATGATGGCAGAGGCAGAG 3' GAPDH RT q PCR GAAGGTGAAGGTCGGAGTCA 3' GAGGTCAATGAAGGGGTCAT 3' Lamin A/C RT q PCR AGGACCAGGTGGAGCAGTAT CACCAGGTTGCTGTTCCTCT

PAGE 31

31 CHAPTER 3 CO OCCUPANCY OF GATA2 AND BRG1 AT THE LOCUS CONTROL REGION IN EARLY ERYTHROPOIESIS Introduction The experiments presented in this thesis aim to evaluate the role of GATA2 in recruiting BRG1, the catalytic subunit of the SWI/SNF chromatin remodeling complex, to hypersensitive site 2 (HS2) of the locus control region (LCR) of the beta globin gene locus. This recruitment is hypothesized to be necessary to ope n the LCR in early erythropoiesis, an event important for activation of the beta globin genes. In order to investigate the possibility of this interaction it was necessary to first ensure that BRG1 and GATA2 colocalize at HS2 in K562 cells These cells ar e a line of human erythroleukemia cells that exist permanently in an early stage of erythropoiesis ( 37 ) Previous genome wide studies have shown that GATA2 and BRG1 can be commonly found to bind to the same region s of DNA ( 18 ) Here, chromatin immunoprecipitation (ChIP) experiments were used to investigate the existence of their co occupancy at HS2 in K562 cells. Results ChIP experiments were performed in K562 cells to investigate GATA2 and BRG1 binding at HS2 of the beta globin LCR. RNA polymerase II ( RNA pol II ) was used as a positive control, as it is known to bind to HS2 in K562 cells. Rabbit IgG was used as a negative con trol. The results of the experiments displayed in Figure 3 1, show BRG1, GATA2, and RNA pol II binding at HS2 in K562 cel ls. Discussion The presence of colocalization of BRG1 and GATA2 at HS2 was encouraging, as this is the minimum requirement for the hyp othesis presented in this thesis to be

PAGE 32

32 plausible. RNA pol II levels were high, as expected at this region in this cell type. BRG1 binding levels were relatively low, possibly because it binds indirectly to DNA. For future experiments, use of an additional crosslinker such as e thylene glycol bis[succinimidylsuccinate] (EGS) could help to capture more of the BRG1 bound.

PAGE 33

33 Figure 3 1. ChI P analysis of BRG1, GATA2, and RNA p ol II binding to HS2 of the LCR in K562 cells. Antibodies against rabbit IgG were us ed as a negative control. DNA was analyzed by qPCR using primers specific for HS2. Data were normalized to IgG and are shown as means standard errors of the means of three independent ChIP experiments. qPCRs were performed in triplicate.

PAGE 34

34 CHA PTER 4 THE ASSOCIATION OF GATA2 AND BRG1 Introduction In order for GATA2 to recruit BRG1 protein protein interactions must exist between the two factors. If they exist, these interactions should be detectable by co immunoprecipitation experiments Previous co immunoprecipitation studies have shown an interaction between BRG1 and GATA1 a transcription factor in the same family as GATA2 that shares many redundant functions ( 30 38 ) A ttempts were made to determine the existen ce of an interaction between GATA2 and BRG1 Results Prior to beginning co immunoprecipitation experiments, antibodies used for immunoblotting were tested by western blot. Figure 4 1 shows the results of a western blot performed using K562 whole cell prote in extracts and optimized antibody dilutions. Bands for BRG1 and GATA2 can be clearly seen at 205 kDa and 50 kDa, respectively. This shows that the blotting technique and antibodies used in these experiments were effective. The results of the co immunoprec ipitation experiments showed severely overexposed pull down lanes, with the highest concentration of overexposure being centered around 50 kDa. The input lanes were generally unaffected by the overexposure, and continued to demonstrate the presence of the target protein in the protein extracts through successful immunoblotting. However, the amount of overexposure in the lanes with the immunoprecipitated protein complexes prohibited visualization of any possible interaction between GATA2 and BRG1.

PAGE 35

35 Discussion Co immunoprecipitation experiments presented several problems. As seen in Figure 4 2, severe overexposure was present in all lanes containing antibody pull downs. This overexposure was absent from the input lane indicating that the likely caus e of the overexposure was something found only in the lanes containing immunoprecipitated protein extracts. The most probable cause of the overexposure was the presence of antibodies used for pull down in the gel. These antibodies, even when denatured, wou ld be bound by the secondary antibodies used to probe the membrane. Heavy chain immunoglobulins have a molecular weight of 50 kDa, which would explain the centering of the overexposure at this weight. Unfortunately, the protein GATA2 has a molecular weight of 50 kDa, placing it at the center of the overexposure. This prevents the visualization of even a positive control immunoprecipitation using GATA2, where a GATA2 antibody would be used for both the pull down and probing. BRG1, with a molecular weig ht of 205 kDa, could theoretically still be detected. However, the level of overexposure was so high that it would often obscure past this molecular weight. In Figure 4 2, BRG1 can be detected in the positive control lane, where the BRG1 pull down is probe d using an anti BRG1 antibody. Unfortunately, BRG1 can also be detected in the negative control IgG pull down, which calls into question the significance of the positive control. BRG1 is notably absent from the GATA2 pull down lane. With the lack of a nega tive control or any confirmation that the GATA2 pull down was effective, this absence contributes nothing to the body of knowledge surrounding a possible interaction between BRG1 and GATA2. Several methods can be used to overcome the problems caused by the presence of pull down antibodies in the gel. Use of cross species antibodies for pull down and

PAGE 36

36 probing was attempted, but cross species antibodies were still recognized, leading to the same issue with overexposure. As an alternative to secondary antibody usage, the Clean Blot IP Detection Reagent (Thermo Scientific) was utilized in several attempts. However, the blots resulting from these experiments were extremely questionable, and detection of proteins even in a non immunoprecipitated western blot was no t effective. Binding the pu ll down antibodies to protein A sepharose beads was also unsuccessfully attempted.

PAGE 37

37 Figure 4 1 Immunoblot analysis of protein extracts from K562 cells. 15 micrograms of protein extracts were loaded per lane. Figure 4 2. Im munoblot analysis of co immunoprecipitation on whole cell protein extracts from K562 cells. Antibodies against rabbit BRG1, rabbit GATA2, and rabbit IgG were used to pull down protein complexes. Membrane was probed using antibodies against either rabbit BR G1 or rabbit GATA2.

PAGE 38

38 CHAPTER 5 STABLE KNOCKDOWN OF GATA2 USING SMALL HAIRPIN RNA Introduction If the hypothesis that GATA2 recruits BRG1 to hypersensitive site 2 ( HS2 ) during early erythropoiesis is correct, it should follow that knocking down GATA2 in K5 62 cells would reduce BRG1 occupancy at HS2. Thus, small hairpin RNA (shRNA) was used to knock down GATA2 in K562 cells in order to elucidate any direct effect on BRG1 occupancy at HS2. This particular method can be used to create a stable line of cells in which expression of an shRNA from a vector could be induced to knock down a gene The TRIPZ vector (Thermo Scientific) was chosen for its many features, including a Tet On system to allow for expression of the shRNA only in the presence of doxycycline, puromycin and ampicillin resistance genes, and the coexpression of red fluorescent protein ( TurboRFP ) in conjunction with the shRNA so that successfully transfected cells could be visualized using fluorescence microscopy. Results Six shRNAs were acquired, two versions each for BRG1, GATA2, and GATA1. Version one of both BRG1 and GATA2 failed to anneal, despite many attempts, leaving experiments to be carried out with only one version of the shRNAs for these two genes. The other four remaining shRNAs that di d successfully anneal were ligated into the TRIPZ vector, transformed into bacteria, and then sequenced to ensure that the 110 base pair shRNA sequence s contained no mutations. Figure 5 1 shows the outcome of a Basic Local Alignment Search Tool ( BLAST ) ali gnment of the 110 base pair shRNA sequence s with the ir corresponding sequencing results

PAGE 39

39 Plasmid DNA of each of the four mutation free shRNA constructs was extracted from bacteria. Independent populations of cells were transfected with one of these four co nstructs After a month of selection with puromycin BRG1 version 2 shRNA transfected cells were frozen down to maintain them for future experiments. Following a three day induction with doxycycline to induce shRNA expression analysis was performed on the three remaining transfected cell populations to analyze the expression levels of the genes targeted for knockdown The results of these experiments are shown in Figur e 5 2. A t test revealed that GATA1 version 1 and GATA2 version 2 shRNAs produc ed significant results successfully knocking down their target genes upon induction of expression of the shRNA with doxycycline. After this check for successful knockdown on the population level, single cell clones were generated from the three shRNA tran sfected populations Surviving clones were induced with doxycycline and checked with an inverted fluorescence microscope for RFP expression which would indicate expression of the shRNA RNA extractions were performed on those clones that expressed RFP E xpression levels of target genes were analyzed using RT qPCR (data not shown) Knockdown levels varied with each clone, and were inconsistent between two sep arate extractions and analyses. Before further analysis, including chromatin immunoprecipitation (C hIP) experiments, could be performed, all clones died from contamination. Frozen cell populations were thawed and expression analysis was performed to check for knockdown of target genes upon induction with doxycycline. Results are shown in Figure 5 3. No difference in the levels of GATA2, the shRNA target gene, was seen

PAGE 40

40 between untreated shRNA transfected control cells and doxycycline induced shRNA transfected cells. Discussion Use of shRNA to knock down genes seemed moderately effective on the population level, as successful knockdowns of GATA2 and GATA1 were achieved. However, single cell clones originating from these populations did not fare well. Knockdown levels varied significa ntly and were inconsistent between two extractions. Additionally, many of the clones failed to grow. One possible explanation for this phenomenon is leaky expression of the shRNA from the vector, potentially through trace amounts of doxycycline contained i n the fetal bovine serum (FBS) used in the media. GATA2 and GATA1 are important proteins involved in many different cellular processes. Altering the levels of these two proteins on a long term basis could negatively affect their growth and survival An att empt to surmount this problem by using tetracycline free FBS ( Clontech ) ultimately led to the demise of all of the cells, as the laboratory stock of this reagent was contaminated with bacteria. The decision to create single cell clones was made in an attem pt to see higher knockdown levels than those observed in the transfected populations. However, knockdown levels in single cell clones, if present, were equal to or less than the levels seen in the populations and were inconsistent Future attempts at knock ing down GATA1 and GATA2 with this specific shRNA expression system should focus experimentation first on the population level, since minimal problems were encountered at this stage. If desired, generation of single cell clones concurrent with experimentat ion on the population level would be an efficient strategy, as generation of single cell clones takes an extensive amount of time.

PAGE 41

41 Figure 5 1. BLAST alignment of the sequenced bacterial plasmids with the corresponding 110 base pair shRNA sequence. 100% identity was found betwe en the correct sequence and the observed sequence for each. A) GATA1 version 1 shRNA. B) GATA1 version 2 shRNA. C) GATA2 version 2 shRNA. D) BRG1 version 2 shRNA A B C D

PAGE 42

42 Figure 5 2. RT qPCR expression analysis results for populations of shRNA transfected K562 cells. Results are depicted as means standard deviations for one experiment and are normalized to GAPDH levels The black bars represent expression levels in transf ected cells untreated with doxycycline, which should not express the shRNA. The gray bars indicate expression levels in transfected cells induced to express the shRNA through treatment with 1 microgram doxycycline for three days. Significance was analyzed using a two t test. A) GATA1 version 1 shRNA (*p<0.001) B) GATA1 version 2 shRNA. C) GATA2 version 2 shRNA (**p<0.0001) A B C **

PAGE 43

43 Figure 5 3. RT qPCR analysis of expression levels of gamma globin, GATA1, and GATA2 in GATA2 version 2 shRNA trans fected cells after recovery from thawing. Shown here are the means standard deviations of one experiment. Results were normalized to the levels of GAPDH. The black bars represent expression levels in transfected cells untreated with doxycycline, which should not express the shRNA. The gray bars indicate expression levels in transfected cells induced to express the shRNA through treatment with 1 microgram doxycycline for three days.

PAGE 44

44 CHAPTER 6 TRANSIENT KNOCKDOWN OF GATA2 THROUGH SMALL INTERFERING RNA In troduction In order to circumvent the problems encountered with stable transfections of small hairpin RNA ( shRNA ) expressing vectors, transfections were performed using small interfering RNA (siRNA). This technique would allow analysis of knockdown levels as soon as 24 hours after transfections, minimizing the potential adverse, unintentional effects of knocking down important transcription factors. The goal of these experiments was to determine the effect of reducing the levels of GATA2 on the occupancy of BRG1 at hypersensitive site 2 ( HS2 ) of the locus control region ( LCR ) If GATA2 does recruit BRG1 to this region, knocking down GATA2 through siRNA should reduce the levels of BRG1 binding at HS2. Results Transfections were performed using siRNAs acquired from Dharmacon. An siRNA against lamin A/C was used as a positive control to evaluate the effectiveness of the transfection technique. A non targeting siRNA was used as a negative control to discern any effects on gene expression caused solely by the tran sfection procedure. A pool of GATA2 siRNAs was used as the experimental condition. First, transfection conditions were optimized using the positive control siRNA. RT qPCR analysis was performed 48 hours after transfection with lamin siRNA at a 25 micromola r concentration. The conditions evaluated included two concentrations of cells (2x10 5 and 4x10 5 cells per milliliter of media) and three concentrations of DharmaFECT 1 reagent (1, 2, or 3 microliters of DharmaFECT per milliliter of media). Figure 6 1 shows that optimal conditions for transfection were found at a cell density of 2x10 5 cells

PAGE 45

45 per milliliter of media and a DharmaFECT concentration of 2 microliters DharmaFECT per milliliter of media. Once transfection conditions were optimized, GATA2 siRNA was u sed to transfect K562 cells. RNA was extracted 72 hours after transfection and GATA2 expression levels were analyzed using RT qPCR. Results are displayed in Figure 6 2. The results of three independent experiments indicated a statistically significant knoc kdown in the GATA2 siRNA transfected cells when GATA2 expression levels were compared to those in non targeting siRNA transfected cells or to untreated cells. Discussion Use of siRNA to knock down GATA2 appears promising. Preliminary optimization experimen ts to knock down lamin using a positive control siRNA were successful, and lamin knockdown levels appeared consistent between experiments. Encouragingly, small scale transfections of GATA2 siRNA into K562 cells resulted in a statistically significant reduc tion of GATA2 messenger RNA ( mRNA ) levels. It has yet to be determined if the ~40% reduction in the levels of GATA2 mRNA in these siRNA transfected cells will translate to any changes in GATA2 or BRG1 binding at HS2 in chromatin immunoprecipitation ( ChIP ) experiments. More work remains to be done before GATA2 can be knocked down on the scale required for ChIP experiments.

PAGE 46

46 Figure 6 1. RT qPCR analysis of K562 cells 48 hours after transfection with siRNA against lamin a/c. Expression levels shown are the means standard deviations of one experiment, with the qPCR performed in triplicate. Expression levels were normalized against levels of GAPDH. In the figure legend, the first number refers to the concentration of cells used. The number 2 in dicates a concentration of 2x10 5 cells per milliliter of media, while the number 4 indicates a concentration of 4x10 5 cells per milliliter of media. The second number, located after the forward slash, shows the amount of DharmaFECT 1 reagent used in each t ransfection. The number 1 indicates that 1 microliter of DharmaFECT was used per milliliter of media Similarly, the number 2 indicates that 2 microliters DharmaFECT was used, and the number 3 indicates that 3 microliters DharmaFECT was used. The optimal c onditions were found when the concentration of cells was 2x10 5 cells per milliliter of media and the concentration of DharmaFECT 1 reagent was 2 microliters DharmaFECT per milliliter of media.

PAGE 47

47 Figure 6 2 RT qPCR analysis of K562 cells 72 hours after transfection with non targeting (negative control) or GATA2 siRNA. Results are shown as means standard errors of the means of three indep endent experiments and are normalized to the levels of GAPDH. The asterisk indicates a statistically significant difference between the expression levels of GATA2 in GATA2 siRNA transfected cells (black) and GATA2 expression levels in both negative control siRNA transfected cells (gray) and untreated cells (white) (p<0.0001).

PAGE 48

48 CHAPTER 7 CONCLUSIONS AND FUTURE DIRECTIONS The overall hypothesis presented in this thesis is that the transcription factor GATA2 recruits BRG1, the catalytic subunit of the SWI/SNF c hromatin remodeling complex, to hypersensitive site 2 ( HS2 ) of the beta globin locus control region ( LCR ) during early erythropoiesis. Preliminary chromatin immunoprecipitation ( ChIP ) experiments in K562 cells reveal that BRG1 and GATA2 can be found to co occupy HS2, although BRG1 levels were relatively low. However, low levels of BRG1 binding should be expected due to the indirect nature of its binding interactions with HS2. Future ChIP experiments should include the use of a supplemental crosslinker, such as EGS, to pull down a greater proportion of the BRG1 bound to HS2. Additionally, the use of a negative control DNA region, such as the linker DNA between HS2 and HS3 in the LCR, would be advisable. This type of negative control would provide additional e vidence of the validity of t he binding of BRG1, GATA2, and RNA polymerase II ( RNA p ol II ) observed at HS2. Still, these ChIP experiments provide the minimum support necessary to merit further exploration of the hypothesis. Co immunoprecipitation experiments have been inconclusive so far. The detection of pull down antibodies in the blot has proven to be a truly challenging problem to circumvent. Many different approaches to fix the problem, including crosslinking the antibod ies to protein A sepharose beads, using special detection reagents, or pulling down protein complexes with a cross species antibody, failed to yield successful results. Recently, attempts at co immunoprecipitation experiments using a protocol obtained from the lab of Dr. John Strouboulis have showed promising

PAGE 49

49 results. Future efforts on co immunoprecipitation experiments will involve optimization of this protocol to attempt to detect an interaction between GATA2 and BRG1, if present. Knockdown of GATA2 throu gh expression of small hairpin RNA ( shRNA ) in K562 cells after transfection of an shRNA expressing vector produced encouraging results at the population level. However, the reproducibility of these results is questionable, since all cells were used in the process of generating single cell clones before replicate experiments were performed. The extreme variations in knockdown levels after doxycycline induction in the single cells clones suggests that the reproducibility on the population level may also have been q uestionable. Still, future researchers would be wise to at least attempt to perform experiments on the population level, as cells appeared to be much more stable and healthy at this point and knockdown levels were still around 50%. It is possible tha t the variegated expression between cells on the population level would diminish the possibility of viewing a significant difference in factor binding at HS2 through ChIP. This effect might even be large enough to obscure any differences in binding when co nsidering GATA2, which should have its binding directly affected by its own knockdown. Only experimentation will be able to put these questions to rest. Given the lack of success seen in experiments performed on the single cell clone level and the tremendo us amount of time required to get to this stage it would certainly be worth the time of a future r esearcher to attempt the ChIP experiment at the population level. Regardless of what stage the transfected cells are in, care should be taken to use only med ia containing tetracycline free fetal bovine serum ( FBS ) Leaky expression of the shRNA through trace amounts of doxycycline contained in the media, although

PAGE 50

50 not confirmed, can only diminish the results of any experiments performed and damage the life of t he transfected cells. Experiments should also be done as quickly as possible once cells are through the selection phase. Delaying experiments prolongs the amount of time cells must be maintained in culture and increases the risk of cell death due to contam ination or old age. Transient transfections using small interfering RNA ( siRNA ) were far faster and simpler than stable transfections using shRNA Preliminary experiments knocking down lamin using a positive control siRNA were extre mely successful and cons istent, as were t ransfection s of a GATA2 siRNA to kn ock down GATA2 in small scale experiments Future experiments will include analysis of the expression of gamma globin (the beta globin famil y gene expressed in K562 cells) and GATA1 in GATA2 knockdown cel ls Transfected cells will also be used for ChIP experiments to examine binding of GATA2 and BRG1 to HS2. The results of these experiments, in conjunction with the potential results from co immunoprecipitation experiments, should finally put to rest the qu estion posed in the hypothesis of this thesis.

PAGE 51

51 APPENDIX A PROTOCOL FOR SHRNA DESIGN AND TRANSFECTIONS shRNA Design Purpose : Design shR NAs against Gata2, Brg1, and Gata1. 1. Using ensembl.org, I searched Hu man for Gata2, Brg1, and Gata1 2. I then clicked Transcript> Human followed by the first transcript result that popped up. 3. number to view all transcripts. a. Gata2 : six transcripts; I chose CCDS3049, Gata2 001 (1443 nt) b. Gata1 : three transcripts; I chose CCDS14305, Gata1 001 (1242 nt) c. Brg1 (SMARCA4): nine transcripts; I chose CCDS12253, SMARCA4 001 (4944 nt) 4. I copied these transcripts into a word document for storage. I then inserted each sequence into the Dharmacon siRNA desig n center ( http://www.dharmacon.com/designcenter/designcenterpage.aspx ). I entered the sequences in FASTA format. In all cases, I chose the first and second results generated so tha t I would have two shRNAs to work with. 5. To generate a 22mer sequence, I used the RNA codex tool ( http://cancan.cshl.edu/cgi bin/Codex/Tools.cgi ). I inserted AC before the 19mer sequence and A a fter to create the 22mer sequence. After pressing submit, I grabbed the two 22mer sequences highlighted in red. These should be optimized for shRNA. I inserted both into the hairpin sequences from Jared/the Huang lab. In both the forward and reverse cases, I inserted the sense sequence first and the antisense second. Since they are reverse complements, this allows them to pair with each other. 6. After generating the full hairpin sequences, I used the IDT DNA analyzer ( http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ ) to check their ability to form hairpins. 7. I also blasted each sequence to its respective genome to make sure that the only perfect match was in the target gene.

PAGE 52

52 Anneal oligos Purpose: My oligos are all single stranded, so I have to anneal each to its complement in order to ligate them into a double stranded vector. 1. I received the technical datasheet from my oligos. It gives a column that reads free water necessary to resuspend them at 200uM. 2. Use a 30uL reaction to anneal the oligos. Most reagents are found in the enzyme box. 8uL Nuclease free H 2 O 7.5uL Oligo (use both top and bo ttom oligo, so 15uL total, each at 50uM) 3uL 10x PNK Buffer 2uL 10mM ATP 2uL T4 Polynucleotide Kinase 3. Incubate at for 1.5 hours 4. Add 4uL of 0.5M NaCl and incubate the solution at for 5 minutes in a water bath. 5. Turn the water bath off and let t he solution cool slowly to room temperature, or until a minimum of 30C. 6. Store at 20C. Check integrity of double stranded oligos 1. Prepare a 500nM solution of each single stranded oligo for a control. a. This is a 1:400 dilution from the 200mM stock. 2. Prepa re a 500nM solution of each double stranded oligo from the annealing reaction. a. This is a 1:100 dilution from the annealing reaction 3. Add 2uL 6x dye and 5uL of each prepared solution. Run these samples on a 4% agarose gel. a. The double stranded oligo should run slower than the single stranded oligo. There should also be no contamination of single stranded oligo in the double stranded oligo lane.

PAGE 53

53 Digest vector Purpose: Perform a double digestion of the TripZ vector to prepare it for shRNA ligation. 1. Set u p a 40uL reaction: a. 2uL TripZ vector (concentration=1.7ug/uL, so 3.4ug total) b. 2uL EcoRI c. 2uL XhoI d. 4uL Buffer 4 e. 4uL 10x BSA f. 26uL Nuclease free water 2. Incubate at for 2 hours g. EcoRI has star activity, meaning that it can cleave the 4bp core of its 6bp cle enzyme. 3. Add 1uL calf intestine phosphatase, or CIP. Incubate for 30 minutes at h. CIP removes phosphate groups from the ends of your vector so that it cannot self ligate. 4. Heat inactivate CIP by incubating at for 30 minutes. 5. Run digest on a gel. Excise the correct band and purify with the Qiagen gel extraction kit to remove the small digested fragment. Ligate oligos to vector Purpose: Ligate double stranded shRNA into vector. 1. Make ligation mastermix: Total Single Item 81uL 5.5uL Nuclease free water 13.5uL 1.5uL Ligase buffer 9uL 1uL T4 Ligase 18uL 2uL Digested vector (want 50 100ng vector) 2. Aliquot 10uL of master mix into 8 tubes Label tubes appropriately. 3. Add 5uL of each double stranded oligo into the appropriate tube. 4. Incubate the ligation reaction overnight at

PAGE 54

54 Transform bacteria 1. Thaw competent cells for 5 10 minutes on ice. Use a 50uL aliquot for each tube. 2. Take ligation mixture out of incubator, flash spin down, then pipet up and down to mix. 3. Add 2uL of vector (from the ligation reaction) to each tube of 50uL competent cells. Pipet just on the surface, then flick carefully a few times. a. Positive control: add 1uL of standard TripZ vector 4. Incubate on ice for 30 minutes 5. Heat shock cells at for 30 seconds 6. Incubate on ice for 3 5 minutes to allow bacteria to relax. 7. Add 450uL SOC or LB (use flame) and incubate for 90 minutes at while shaking at 225r pm. 8. Pellet cells at 13,200rpm for 1min. Remove most of the supernatant, leaving 30 40uL of media. Resuspend with pipet. 9. Plate all 50uL of cells on LP AMP plates. a. If colonies grow, then that means transformation was successful. Miniprep Protocol 1. Grow b acteria: Pick colonies. Incubate overnight at while shaking in 3ml LB with ampicillin (100mg/ml stock, use 1ul amp/ml LB). 2. Pellet bacteria: Pour culture into two microcentrifuge tubes (1.5ml into each tube). Pellet bacteria by centrifuging for 2 minutes at 8000rcf. 3. Lyse bacteria: Remove supernatant. Using your pipet, resuspend pellet in 100ul cold GTE buffer with lysozyme (0.25mg in 5ml). Incubate on ice 5 minutes 4. Denature proteins and chromosomal DNA: Add 200ul buffer P2 (make fresh). Mix by i nversion five times. Incubate on ice for 5 minutes a. For steps 4 and 5, try not to extend incubation time past 5 minutes! To make 1ml Buffer P2: 930ul H 2 O 20ul 10M NaOH 50ul 20% SDS

PAGE 55

55 5. Precipitate proteins and chromosomal DNA: Add 150ul 5M potassium acetate. Invert and tap to mix. Incubate on ice for 5 minutes. 6. Pellet proteins and chromosomal DNA: Centrifuge 5 minutes at max speed. 7. Precipitate plasmid DNA and RNA: Transfer 400ul of supernatant to a new tube. Add 1000ul 100% ethanol (or 2.5x volume). Incubat e at RT for 5 minutes or in freezer overnight a. A longer incubation will allow for increased precipitation of your plasmid DNA. b. If any of the white stuff gets taken in while pipetting, do a phenol chloroform isoamyl alcohol precipitation to improve purity. 8. Pellet plasmid DNA and RNA: Centrifuge for 15 minutes at max speed at 9. Wash: Remove supernatant and wash with 300ul 70% ethanol. Do not resuspend. Centrifuge for 10 minutes at max speed at 10. Eliminate remaining ethanol: Remove supernatant by tilting tube sideways and aspirating ethanol as it flows down. Try to dry out as much ethanol as possible without aspirating your pellet. Let stand around 10 minutes 11. Degrade RNA: Resuspend in 30ul TE pH 8.0 plus 0.5ul RNAse per sample. Incubate at for 30 minutes 12. Quantitate, and store at

PAGE 56

56 LIST OF REFERENCES 1. Molecular cell biology (W.H. Freeman and Co, 2013). 2. Luger, K., Mder, A. W., Richmond, R. K., Sargent, D. F. & Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Na ture 389 251 260 (1997). 3. Kornberg, R. D. & Lorch, Y. Twenty five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 98 285 294 (1999). 4. Peterson, C. L. & Laniel, M. A. Histones and histone modifications. Current Biology 14 R546 R551 (2004). 5. Ausio, J., Dong, F. & Van Holde, K. E. Use of selectively trypsinized nucleosome nucleosome. J. Mol. Biol. 206 451 463 (1989). 6. Hansen, J. C. Conformational Dynamics of the Chromatin Fiber in Solution: Determinants, Mechanisms, and Functions. Annual Review of Biophysics and Biomolecular Structure 31 361 392 (2002). 7. Jenuwein, T. & Allis, C. D. Translating the histone code. Science 293 1074 1 080 (2001). 8. Peterson, C. L. & Workman, J. L. Promoter targeting and chromatin remodeling by the SWI/SNF complex. Curr. Opin. Genet. Dev. 10 187 192 (2000). 9. Euskirchen, G., Auerbach, R. K. & Snyder, M. SWI/SNF chromatin remodeling factors: multiscale analyses and diverse functions. J. Biol. Chem. 287 30897 30905 (2012). 10. Tang, L., Nogales, E. & Ciferri, C. Structure and function of SWI/SNF chromatin remodeling complexes and mechanistic im plications for transcription. Prog. Biophys. Mol. Biol. 102 122 128 (2010). 11. Liu, N., Balliano, A. & Hayes, J. J. Mechanism(s) of SWI/SNF induced nucleosome mobilization. Chembiochem 12 196 204 (2011). 12. Trotter, K. W. & Archer, T. K. The BRG1 trans criptional coregulator. Nucl Recept Signal 6 e004 (2008). 13. Bultman, S. J., Gebuhr, T. C. & Magnuson, T. A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF related complexes in beta globin expr ession and erythroid development. Genes Dev. 19 2849 2861 (2005).

PAGE 57

5 7 14. Griffin, C. T., Brennan, J. & Magnuson, T. The chromatin remodeling enzyme BRG1 plays an essential role in primitive erythropoiesis and vascular development. Development 135 493 500 (2 008). 15. Kim, S. I., Bultman, S. J., Kiefer, C. M., Dean, A. & Bresnick, E. H. BRG1 requirement for long range interaction of a locus control region with a downstream promoter. Proc. Natl. Acad. Sci. U.S.A. 106 2259 2264 (2009). 16. Stees, J., Varn, F., Huang, S., Strouboulis, J. & Bungert, J. Recruitment of Transcription Complexes to Enhancers and the Role of Enhancer Transcription. Biology 1 778 793 (2012). 17. Juven Gershon, T. & Kadonaga, J. T. Regulation of gene expression via the core promoter and the basal transcriptional machinery. Developmental Biology 339 225 229 (2010). 18. Dunham, I. et al. An integrated encyclopedia of DNA elements in the human genome. Nature 489 57 74 (2012). 19. Bulger, M. & Groudine, M. Functional and Mechanistic Diversity of Distal Transcription Enhancers. Cell 144 327 339 (2011). 20. The Molecular basis of blood diseases (W.B. Saunders, 1994). 21. Higgs, D. R. Do LCRs open chromatin domains? Cell 95 299 302 (1998). 22. Vernimmen, D., De Gobbi, M., Sloane Stanley, J. A., Wood, W. G. & Higgs, D. R. Long range chromosomal interactions regulate the timing of the transition between poised and active gene expression. EMBO J. 26 2041 2051 (2007). 23. Tsiftsoglou, A. S., Vizir ianakis, I. S. & Strouboulis, J. Erythropoiesis: Model systems, molecular regulators, and developmental programs. IUBMB Life 61 800 830 (2009). 24. Levings, P. P. & Bungert, J. The human beta globin locus control region. Eur. J. Biochem. 269 1589 1599 (2 002). 25. Liang, S. Y. et al. Defective erythropoiesis in transgenic mice expressing dominant negative upstream stimulatory factor. Mol. Cell. Biol. 29 5900 5910 (2009). 26. Corre, S. & Galibert, M. D. Upstream stimulating factors: highly versatile stress responsive transcription factors. Pigment Cell Res. 18 337 348 (2005). 27. Sirito, M. et al. Members of the USF family of helix loop helix proteins bind DNA as homo as well as heterodimers. Gene Expr. 2 231 240 (1992).

PAGE 58

58 28. Crusselle Davis, V. J. et al. Recruitment of coregulator complexes to the beta globin gene locus by TFII I and upstream stimulatory factor. FEBS J. 274 6065 6073 (2007). 29. Crusselle Davis, V. J., Vieira, K. F., Zhou, Z., Anantharaman, A. & Bungert, J. Antagonistic regulation of bet a globin gene expression by helix loop helix proteins USF and TFII I. Mol. Cell. Biol. 26 6832 6843 (2006). 30. Liang, S. Y. An investigation into the role of USF in beta globin regulation. (2010).at < http://search.proquest.com/docview/822234848/abstract/13C7D79D5CAF26699 2/1?accountid=10920> 32. Bresnick, E. H., Katsumura, K. R., Lee, H. Y., Johnson, K. D. & Perkins, A. S. Master regulatory GATA transcription factors: mechanistic principles and emerging links to hematologic malignancies. Nucleic Acids Res. 40 5819 5831 (2012). 33. Merryweather Clarke, A. T. et al. Global gene expression analysis of human erythroid progenitors. Blood 117 e96 108 (2011). 34. Tsai, F. Y. & Orkin, S. H. Transcription facto r GATA 2 is required for proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation. Blood 89 3636 3643 (1997). 35. Tsai, F. Y. et al. An early haematopoietic defect in mice lack ing the transcription factor GATA 2. Nature 371 221 226 (1994). 36. Leach, K. M. et al. Characterization of the human beta globin downstream promoter region. Nucleic Acids Res. 31 1292 1301 (2003). 37. Yoo, J., Herman, L. E., Li, C., Krantz, S. B. & Tuan D. Dynamic changes in the locus control region of erythroid progenitor cells demonstrated by polymerase chain reaction. Blood 87 2558 2567 (1996). 38. Grass, J. A. et al. Distinct Functions of Dispersed GATA Factor Complexes at an Endogenous Gene Locus. Molecular and Cellular Biology 26 7056 7067 (2006).

PAGE 59

59 BIOGRAPHICAL SKETCH Stephanie Noel Morton began her studies at the United States Military Academy (USMA) majoring in life science with the intent to become a physician. After completing her second year, Stephanie transferred to the University of Florida (UF), where she major ed in biology. In the summer of 2011, she started a supplemental instruction (SI) tutoring program for the undergraduate biochemistry course coordinated by Dr. Philli p Laipis. The success of the SI program prompted Dr. Laipis to request that Stephanie Biology to grow and stabilize the new program. In August 2011, Stephanie graduated cum laude from a multifaceted tutoring program that includes group study sessions, private tutoring, walk in tu t oring, and supplemental videos In the six semesters during which she ran the program, over 1,300 students utilized the group study sessions alone. S he oversaw the development of 48 group leaders and 57 other tutors. Upon graduating, Stephanie will enter m edical school at the Geisel School of Medicine at Dartmouth. She would like to pursue a career in academia, splitting her time between clinical practice and medical education.