Cranberry Modifies Innate Immune Cell Function via Priming

MISSING IMAGE

Material Information

Title:
Cranberry Modifies Innate Immune Cell Function via Priming
Physical Description:
1 online resource (104 p.)
Language:
english
Creator:
Creasy, Rebecca A
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Food Science and Human Nutrition
Committee Chair:
Percival, Susan S
Committee Members:
Gu, Liwei
Henken, Robin J
Vincent, Heather K
Roberts Ii, Thomas G

Subjects

Subjects / Keywords:
cranberry -- immunity
Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre:
Food Science and Human Nutrition thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Cranberries contain polyphenols, including proanthocyanidins (PAC). Recent research suggests that PAC may induce a priming effect in innate immune cells, resulting in a more robust response to secondary immune stimuli. The mechanisms underlying priming are not understood. Thus, our objective was to characterize the priming mechanism in THP-1 cells, a model of innate immune cells. In our previous in vitro study, cranberry bioactives containing PAC altered protein levels in the Toll-like receptor 4 (TLR4)signaling pathway. We hypothesized that treatment with cranberry would result in an enhanced response to secondary challenge via a TLR4-dependent mechanism. Priming is postulated to be a subtle cellular response;therefore, a cranberry concentration that did not overtly activate cells was identified. THP-1 monocytes were treated with 5, 25, or 100 µg/mL of cranberry fraction rich in PAC (PAC-r) or a fraction containing moderate PAC levels(PAC-m) for 6 to 48 h. Activation status was determined by four measures:percentage of CD14+, CD49a+ cells; CD49a expression per cell; CD14 expression per cell; and cytokine and chemokine secretion. Three of four measures suggested that optimal experimental conditions were 6 h incubation with 25 µg/mL cranberry fractions.  To investigate the priming mechanism, THP-1 macrophages were treated with 25 µg/mL PAC-r or PAC-m,followed by lipopolysaccharide (LPS) challenge. PAC-r treatment increasedMIP-1a and TNFa secretion upon LPS stimulation. TNFa and  MIP-1a steady-state transcript levels were upregulated by PAC-r in absence of LPS stimulation; however, transcript stability was not altered. HEK-Blue™ hTLR4 cells and THP-1 macrophages with a neutralizing TLR4 antibody were used to delineate the role of TLR4 in mediating transcript increases. Although PAC-r increased TLR4 activation in HEK-Blue™cells, use of the TLR4 neutralizing antibody in THP-1 macrophages treated with PAC-r did not depress  steady-state MIP-1a and TNFa mRNA levels. TLR4 neutralization attenuated LPS-induced MIP-1a and TNFa mRNA increases. Therefore, TLR4 may play a partial but not obligatory role in priming. Collectively, these data suggest that cranberry primes THP-1 cells for enhanced cytokine and chemokine synthesis and secretion upon subsequent stimulation that does not require TLR4 exclusively and may involve other pattern recognition receptors.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Rebecca A Creasy.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Percival, Susan S.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045401:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 CRANBERRY MODIFIES INNATE IMMUNE CELL FUNCTION VIA PRIMING By REBECCA ANNE CREASY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Rebecca Anne Creasy

PAGE 3

3 To my Heavenly Father who makes all things possible

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my advisor, Dr. Susan Percival, for accepting me into her lab, guiding me as a developing scientist and for pushing me beyond my comfort zone. She believed in me, sometimes when I did not even believe in myself, and has been instrumental in allowing me to mature personally and professionally. I am also very grateful to each of my committee members: Dr. Bobb i Langkamp Henken, Dr. Liwei Gu, Dr. Heather Vincent and Dr. Grady Roberts for their mentorship and input related to both my research project and my professional development. I must also acknowledge Mrs. Meri Nantz, Miss Joy Stanilka Mr. CJ Nieves and Dr. Cheryl Rowe for helping me maintain my spiritual, mental and emotional health throughout my graduate research. They kept me laughing, challenged me to think about the world in new ways and were always willing to make time for me and provide a listening ear. My research could not have been completed without training, research in s truments and monetary support. For teaching me everything I know about mammalian cell culture techn iques, I would like to give a special thank you to Dr. Marie Louise Ricketts. I would also like to thank Dr. Mitchell Knutson and Dr. Carlos Romero for their generosity in allowing me to use their instruments. A s incere amount of gratitude goes out to Geo rge and Ruthanna Davis, Florida Section IFT and National IFT for the scholarships they provided during my graduate studies. My friends and fellow graduate students, Marianne Fatica, Amanda Ford, Alyssa Maki, Dr. Stephanie Anne Girard, Cindy Montero, Dr. Yan Lu Ally Radford and Greg Guthrie deserve a great deal of thanks. Their support and thoughtful input on my

PAGE 5

5 dissertation and research helped me excel and made graduate school a more pleasant experience. As family and faith are all that truly matter i n life, I must express my gratitude to my adopted Gainesville family and to my birth family. For accepting me just as I am, my deepest gratitude goes to Dr. Wendy Dahl, Maisie Hayden and Mason Hayden. They opened their home to me, supported me through diff icult times, allowed me to share in their celebrations and helped me rejoice in my own triumphs. They will each forever hold a place in my heart. The Mathews, the second part of my Gainesville family, have also made a huge impact on my life. As a mentor an d friend, Dr. Anne Mathews provided constructive feedback and encouragement with each new endeavor that came along in graduate school. She also helped hold me accountable in my times of struggle and prayed for me in my times of need. Most importantly, she and her husband Dr. Clayton Mathews shared their two precious children, Ben and Add ison with me. It goes without saying that I must thank Ben and Addy. They helped me remember to enjoy the simple things in life and provided immeasurable laughter, joy and happiness during our many play dates. Last but certainly not least, I thank my Daddy, Mama, brother (Jarrod), sister (Lindsey), brother in law (Jay) and nephews (Grady and Gage). They have all loved me unconditionally and have supported me in every endeav or that I have ever undertaken. I praise God every day for blessing me with their love and support I would never have made it through my doctoral experience without them.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 17 I mmune System ................................ ................................ ................................ ...... 17 Monocyte/Macrophage ................................ ................................ ..................... 19 Toll Like Receptors ................................ ................................ .......................... 20 Cytokines and Chemokines ................................ ................................ .............. 21 Cranberry ................................ ................................ ................................ ................ 25 Cranberry Polyphenols ................................ ................................ ..................... 25 Cranberry and Immune Function ................................ ................................ ...... 27 Immune Cell Priming ................................ ................................ ............................... 31 THP 1 Cells ................................ ................................ ................................ ............ 33 2 INTRODUCTION ................................ ................................ ................................ .... 36 Significance and Rationale ................................ ................................ ..................... 36 Hypothesis ................................ ................................ ................................ .............. 37 Specific Aims ................................ ................................ ................................ .......... 37 3 OPTIMAL EXPERIMENTAL CONDITIONS FOR CRANBERRY PRIMING ARE SIX HOURS AND 25 UG/ML CRANBERRY FRACTIONS ................................ ..... 38 Background ................................ ................................ ................................ ............. 38 Materials and Methods ................................ ................................ ............................ 39 Cranberry Fractions ................................ ................................ .......................... 39 THP 1 Monocyte Cell Culture ................................ ................................ ........... 40 Cell Viability ................................ ................................ ................................ ...... 40 Flow Cytometry ................................ ................................ ................................ 41 Multiplex Protein Analysis ................................ ................................ ................. 41 Statistical Analysis ................................ ................................ ............................ 42 Results ................................ ................................ ................................ .................... 42 Cell Viability ................................ ................................ ................................ ...... 42

PAGE 7

7 Flow Cytometry ................................ ................................ ................................ 43 Multiplex Protein Analysis ................................ ................................ ................. 44 Discussion ................................ ................................ ................................ .............. 45 4 CRANBERRY BIOACTIVES INCREASE MIP PROTEIN SECRETION AND TRANSCRIPT ABUNDANCE IN THP 1 MACROPHAGES ...... 57 Background ................................ ................................ ................................ ............. 57 Materials and Methods ................................ ................................ ............................ 58 THP 1 Differentiation ................................ ................................ ........................ 58 THP 1 Macrophage Cell Culture ................................ ................................ ...... 58 Cytokine and chemokine screening experiment ................................ ......... 58 Steady st ate mRNA abundance experiment ................................ .............. 59 Multiplex Analysis ................................ ................................ ............................. 59 RNA Isolation, cDNA Synthesis and qRT PCR ................................ ................ 59 mRNA Stability ................................ ................................ ................................ 61 Statistical Analysis ................................ ................................ ............................ 61 Results ................................ ................................ ................................ .................... 62 Multipl ex Analysis ................................ ................................ ............................. 62 Steady State mRNA Abundance ................................ ................................ ...... 64 mRNA Stability ................................ ................................ ................................ 65 Discussion ................................ ................................ ................................ .............. 65 5 COMPLETE TLR4 ACTIVATION IS NOT REQUIRED FOR CRANBERRY INDUCED INCREASES IN MIP AND mRNA ................................ ........... 78 Background ................................ ................................ ................................ ............. 78 Materials and Methods ................................ ................................ ............................ 79 HEK ................................ ................................ ................ 79 THP 1 Macrophage and hTLR4 Neutralizing Antibody ................................ ..... 80 Statistical Analysis ................................ ................................ ............................ 81 Results ................................ ................................ ................................ .................... 81 HEK ................................ ................................ ................. 81 Neutralization of TLR4 in THP 1 Macrophages ................................ ................ 82 Discussion ................................ ................................ ................................ .............. 82 6 SUMMARY, FUTURE DIRECTIONS AND CONCLUSION ................................ ..... 88 APPENDIX OPTIMIZATION OF ANTI TLR4 ANTIBODY CONCENTRATION ......... 94 LIST OF REFERENCES ................................ ................................ ............................... 97 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 104

PAGE 8

8 LIST OF TABLES Table page 3 1 Composition of cranberry fractions ................................ ................................ ..... 47 4 1 qPCR primer sequences ................................ ................................ .................... 71 4 2 mRNA relative abundance rate of change ................................ ................ 72 4 3 MIP mRNA relative abundance rate of change ................................ ............. 72 A 1 Percentage of change in relative TNF mRNA abundance ................................ 95

PAGE 9

9 LIST OF FIGURES Figure page 1 1 T LR4 pathway. ................................ ................................ ................................ ... 34 1 2 Basic structure of flavan 3 ols and flavonols. ................................ ..................... 35 1 3 Proan thocyanidins found in cranberry ................................ ................................ 35 3 1 Normal phase HPLC chromatograms of procyanidins (PCA) record ed on a fluorescence detector (Ex=231 nm, Em=320 nm). ................................ ............. 48 3 2 HPLC/diode array detector chromatograms of anthocyanins at 520 nm. ........... 49 3 3 THP 1 monocytes maintained viability with cranberry treatment. ....................... 50 3 4 THP 1 monocytes were activated by 48 h treatment r or PAC m. ................................ ................................ ................................ .............. 51 3 5 Representative dot plots showing the effect of time on percentage of THP 1 cells expressing CD14 and CD49a.. ................................ ................................ ... 52 3 6 Representative dot plots showing the effect of concentration on percentage of THP 1 cells expressing CD14 and CD49a. ................................ ..................... 53 3 7 CD14 expression per cell did not differ on THP 1 cells from 6 to 48 h of cranberry treatment. ................................ ................................ ........................... 54 3 8 PAC r. ................................ ................................ ................................ ................. 55 3 9 Chemokine secretion into supernatant was markedly increased by incubation r.. ................................ ................................ ...................... 56 4 1 Cranberry did not activate unstim ulated THP 1 macrophages. .......................... 73 4 2 PAC r enhanced secretion of MIP from stimu lated THP 1 macrophages. ................................ ................................ ................................ ..... 74 4 3 PAC r upregulated expression of and MIP mRNA. ............................. 75 4 4 Cranberry did not stabilize mRNA.. ................................ .......................... 76 4 5 MIP mRNA stability was not altered by cranberry. ................................ ........ 77 5 1 PAC r, but not PAC m, act ivated hTLR4 signaling pathway. .............................. 86

PAGE 10

10 5 2 TLR4 neutralization did not prevent cranberry induced increases in and MIP mRNA. ................................ ................................ ............................ 87 A 1 mRNA abundance following TLR4 neutralization and LPS stimulation. .... 96

PAGE 11

11 L IST OF ABBREVIATIONS Ab Antibody(ies) ANOVA A nalysis of variance APC A ntigen presenting c ell AP 1 A ctivator protein 1 APP A pple peel proanthocyanidins ARE A denylate/uridylate ( AU ) rich element ( s ) ARE BP A denylate/uridylate ( AU ) rich element binding protein C C elsius CAM C ell adhesion molecule CJC C ranberry juice cocktail CO 2 Carbon d ioxide DMEM D DMSO D imethyl sulfoxide EEN Elemental enteral nutrition ELISA Enzyme linked immunosorbent assay FBS Fetal bovine s erum FL OZ Fluid ounce(s) GALT Gut associated lymphoid tissue GFP G reen fluorescent protein GM CS F G ranulocyte macrophage colony stimulating factor H H our (s) HEK H uman embryonic kidney HEPES 4 (2 hydroxyethyl) 1 piperazineethanesulfonic acid H N RNA Heterogeneous nuclear RNA

PAGE 12

12 HPLC High performance liquid chromatography ICR Institute of Cancer Research IFN Interferon IL 1 I nterleukin 1 beta IL 4 I nterleukin 4 IL 5 I nterleukin 5 IL 6 I nterleukin 6 IL 8 I nterleukin 8 IL 10 Interleukin 10 IL 12 ( P 40) I nterleukin 12 (p40) IRF Interferon regulatory f actor LBP L ipid b inding p rotein LPS L ipopolysaccharide MCP 1 Monocyte chemoattractant p rotein 1 MD2 M yeloid differentiation 2 MFI Median fluorescence intensity MHC Major histocompatability c omplex MIN M inute (s) MIP 1 M acrophage i nflammato ry protein 1 alpha MIP 1 M acrophage i nflammato ry protein 1 beta M L Milliliter (s) M RNA Messenger RNA M Y D88 Myel oid differentiation f actor 88 NDM N ondialyzable material NF B Nuclear f actor k appa light chain enhancer of activated B cells

PAGE 13

13 NM Nanometer (s) NTP Nucleoside triphosphate PAC P roanthocyanidin ( s ) PAMP Pathogen associated molecular p attern PBMC Peripheral blood mononuclear c ell (s) PBS Phosphate b uffered s aline PCA Procyanidin ( s ) pIgR Polymeric immunoglobulin receptor R PMA Phorbol 12 myristate 13 acetate PRR Pattern recognition r eceptor RANTES Regulated on a ctivation n ormal T c ell e xpressed and s ecreted RPL37A Ribosomal p rotein L37A R PMI R osw ell Park Memorial I nstitute medium SEAP Secreted embryonic al kaline phosphatase s IgA Secretory immunoglobulin A T H T helper TLR T oll like r eceptor TLR4 Toll like r eceptor 4 TNF Tumor necrosis factor alpha TRIF Toll / interleukin 1 receptor domain containing adaptor protein inducing IFN TTP Tristetraprolin G M icrogram (s) UTI Urinary tract infection UTP triphosphate(s) UTR U ntranslated region

PAGE 14

14 VLA 1 Very late a ntigen 1 VUR V esico ureteric reflux

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CRANBERRY MODIFIES INNATE IMMUNE CELL FUNCTION VIA PRIMING By Rebecca Anne Creasy May 2013 Ch air: Susan S. Percival Major: Food Science and Human Nutrition Cranberries contain polyphenols, including proanthocyanidins (PAC). Recent research suggests that PAC may induce a priming effect in innate immune cells, resulting in a more robust response to secondary immune stimuli. The mechanisms underlying priming are not understood. Thus, our objective was to characterize the priming mechanism in THP 1 cells, a model of innate immune cells. In our previous in vitro study, cranberry bioactives containing P AC altered protein levels in the Toll like receptor 4 (TLR4) signaling pathway. We hypothesized that treatment with cranberry would result in an enhanced response to secondary challenge via a TLR4 dependent mechanism. Priming is postulated to be a subtle c ellular response; therefore, a cranberry concentration that did not overtly activate cells was identified. THP 1 monocytes were r) or a fraction containing moderate PAC levels (PAC m) for 6 to 48 h. Activation status was determined by four measures: percentage of CD14 + CD49a + cells; CD49a expression per cell; CD14 expression per cell; and cytokine and chemokine secretion. Three of four

PAGE 16

16 measures suggested that optimal experimental condi tions were 6 h incubation with 25 To investigate the priming mechanism, THP 1 macrophages were treated with r or PAC m, followed by lipopolysaccharide (LPS) challenge. PAC r treatment increased MIP tion upon LPS stimulation. and MIP steady state transcript levels were upregulated by PAC r in absence of LPS stimulation; however, transcript stability was not altered. HEK 1 macrophages with a neutralizing TLR4 antibo dy were used to delineate the role of TLR4 in mediating transcript increases. Although PAC r increased TLR4 activation in HEK neutralizing antibody in THP 1 macrophages treated with PAC r did not depress steady state MIP and mRNA levels. TLR4 neutralization attenuated LPS induced MIP and mRNA increases. Therefore, TLR4 may play a partial but not obligatory role in priming. Collectively, these data suggest that cranberry primes THP 1 cells for enhanced cytok ine and chemokine synthesis and secretion upon subsequent stimulation that does not require TLR4 exclusively and may involve other pattern recognition receptors.

PAGE 17

17 CHAPTER 1 LITERATURE REVIEW Immune System The immune system has evolved over time to protect the body from invasion and subsequent infection by bacterial, viral and parasitic organisms. A large variety of cells, proteins and other molecules work in unison to discriminate non self from self molecules and to generate an effector response to foreign molecules for their elimination or neutralization. The human immune system is composed of an innate branch and an adaptive branch. defense against invading pathogens. Innate immune components include the epidermal layer, the epithelial lining of the digestive tract, digestive secretions, phagocytes (neutrophils and macrophages), dendritic cells, and natural killer cells. In contrast to the rapid response of innate immune comp onents, T lymphocytes (T cells) and B lymphocytes (B cells) of the adaptive immune system take days to respond to invading pathogens. The adaptive immune system, however, responds with After an initial exposure to an to the antigen in subsequent encounters. Upon penetration of the epithelium, pathogens encounter innate immune cells, such as neutrophils and macrophages. The pathogens are recognized by pattern recognition receptors (PRR) on innate immune cell surfaces. These receptors detect structural motifs from pathogens that are necessary for pathogen survival, known as pathogen associated molecular patterns (PAMP). T he binding of a PAMP to its

PAGE 18

18 respective PRR results in immune cell activation and release of cytokines, chemokines and complement factors. Chemokines attract additional immune cells to the area, while cytokines modify the behavior of target cells recruited to the area. The secreted complement factors can bind to the surface of pathogens and destroy them via cell membrane lysis. Alternatively, complement factors can coat the surface of the pathogen in a process called opsonization, which facilitates phagocyto sis of the immune invader. If the pathogen breaches the innate immune barriers and is taken up by dendritic cells or macrophages, inflammation and subsequent activation of the adaptive immune response may ensue. The adaptive immune response begins when ant igen presenting cells (APC), which have taken up and processed pathogenic components, present an antigen to CD4 + T helper (T H ) cells. The presentation of antigen along with inflammatory cytokines secreted by innate immune cells activates T cells and result s in secretion of cytokines that can further activate B cells, macrophages and other immune cells to swiftly eliminate invaders. B cells contain antigen specific receptors on their cell surface capable of detecting minute differences in antigens. Nave B cells that interact with antigens that match the antibodies attached to their cell surface will differentiate into antibody secreting plasma cells or into memory B cells that possess antigen specific cell surface receptors for subsequent antigen encounters (1) The immune system is very complex; however, it will not be covered in depth here as t he focus of the research project in is on monocytes/macrophages in innate immunity.

PAGE 19

19 Monocyte/Macrophage Monocytes and macrophages are both myeloid lineage cells arising from a common bone marrow derived precursor (2) These mononuclear cells can be identified from other immune cells by the relative abundance of CD14 antigen expressed on their cell surfa ce. Monocytes are primarily found circulating in the peripheral blood and comprise 5 10% of human peripheral blood mononuclear cells (PBMC) (3) Chemoattractants, such as monocyte chemoatt ractant protein 1 (MCP 1), activate the binding of integrins on monocyte cell surfaces to cell adhesion molecules (CAM) on endothelial cell surfaces. Upon binding, monocytes migrate through the epithelial cell tight junctions and into the tissues where dif ferentiation into specific tissue macrophages and dendritic cells occurs (4) The macrophage cells that reside in specific tissues have specialized functions influenced by their microenvironment and are named based on their location. These specialized macrophages inclu de intestinal macrophages of the gut, alveolar macrophages of the lungs, histiocytes in connective tissues, Kupffer cells in the liver, mesangial cells in the kidney, microglial cells in the brain and osteoclasts in bone (1,3 ) Although macrophages may develop into specialized cell types, they possess some of the sam e indispensable anti pathogenic mechanisms as monocytes during inflammatory responses. Both monocytes and macrophages express PRR on their cell surface and endosomal compartments, allowing them to respond to PAMP derived from pathogenic invaders. Recogniti on of PAMP by monocytes and macrophages activates anti pathogen functions including release of inflammatory mediators, production of reactive oxygen and nitrogen species, cytokine secretion and phagocytic ability.

PAGE 20

20 Although monocytes and macrophages possess these devices, macrophages, particularly when activated, exhibit enhanced potential for pathogen destruction (1,5 ) Activated macrophages possess increased phagocytic ability and express higher levels of clas s II major histocompatibility complex (MHC) molecules, which are used to present antigen to CD4 + T H cells. In this respect, macrophages play a key role in bridging innate and adaptive immunity. The presentation of antigen via class II MHC molecules is ess ential to T H cell activation and hence activation of the adaptive immune response. Upon macrophage secretion of inflammatory cytokines and presentation of antigens to T H cells via class II MHC molecules, the T H cells become activated and secrete cytokines, antimicrobial functions of macrophages. Thus, macrophages and T H cells function Toll Like Receptors The Toll like receptor (TLR) family is one class of PRR that is responsible for recognition of a broad array of PAMPs including lipopolysaccharide (LPS), triacyl and diacyl lipopeptides, flagellin, peptidoglycan, single and double stranded viral RNA and bact erial DNA (6 ) Out of the ten known human TLRs, TLR4 was the first human TLR to be discovered (7,8 ) TLR4 is the cognate receptor for LPS, a cell wall component of gram negative bacteria (9 ) The process of LPS recognition by TLR4 begins when LPS in serum, is bou nd by LPS binding protein (LBP). The soluble form of CD14 then delivers the LBP coated LPS to the TLR4 myeloid differentiation 2 (MD2) receptor complex located on the cell surface. Upon activation of the TLR4 MD2 receptor complex (Figure 1 1 ), signal tra nsduction may proceed via either a myeloid differentiation factor 88 (MyD88) dependent or TIR domain containing adaptor protein

PAGE 21

21 dependent adaptor protein pathway (10) Signal transmission via MyD88 culminates in the activation of nuclear factor kappa light chain enhancer of activated B cells (NF and activator protein 1 (AP 1), which translocate into the cell nucleus to induce transcription of early response inflammatory cytokine genes, such as interleukin 6 (IL 6) and tumor nec (10) MyD88 is an essential adaptor molecule in mediating the LPS triggered TLR4 signaling pathway. Mice lacking MyD88 are resistant to septic shock upon LPS challenge, and macrophages isola ted from MyD88 / mice fail to produce proinflammatory cytokines upon LPS exposure (11) The TRIF dependent pathway is also required for effective TLR4 signaling but differs from MyD88 signal transmission in that TLR4 must first be transported to intrace llular endosomes Initiation of the TRIF branch of the TLR4 signaling pathway ends in activation of interferon regulatory factor (IRF) and NF which are responsible for the activation of transcription in type I interferon and infla mmatory cytokine genes respectively (10) A full explanation of the TLR4 pathway will not be covered here as the aim of the research project focuses on the end products of the signaling cascade. A detailed explanation of the TLR4 pathway can be found in t he reviews written by Akira and Takeda (6,10) Cytokines and Chemokines Chemokines form a superfamily of polypeptides 90 to 130 amino acids in length. They ensure a focused response to infection and inflammation via control of leukocyte activation, cellular adhesion and chemotaxis. The chemokines, such as interleukin 8 (IL 8), macrophage inflammatory protein 1 alpha (MIP protein 1 beta (MIP expression of CAM. A dditionally, chemokines stimulate the increased expression of

PAGE 22

22 selectins and integrins on the surface of neutrophils, monocytes, macrophages and other immune cells. The increased expression of both CAMs and selectins helps to initiate the four step extravas ation process. First, immune cells roll on the endothelial surface as selectins on immune cells bind loosely to CAM on the endothelium. Binding of chemokines to their receptors on immune cells activates the cells and induces a conformational change in cell surface integrins. The integrins on the immune cell then tightly adhere to the CAM on the endothelial surface. Following adhesion, immune cells traverse the tight junctions of epithelial cells and move into tissue during the diapedesis process. Once in t he tissue, chemotaxis occurs as recruited immune cells follow the increasing chemokine gradient to the site of inflammation. Successful chemotaxis is essential to initiation and resolution of the immune response. Remarkably, immune cells can detect as litt le as a 1% difference in the chemokine gradient as they migrate (12) This sensitivity ensures rapid movement of immune cells to the site of inflammation for pathogen destruction and subsequent tissue repair. Cytokines, like chemokines, are mediators of the immune response. These low molecular weight glycoproteins, typically less than 30 kDa, are secreted by cells of the immune system as well as other cell types in response to an immune stimulus (1) Cytokines bind to their respective receptors on target cell surfaces. The actions of cytokines are pleitropic and include induction of inflammatio n, control of cell proliferation and differentiation, regulation of hematopoiesis and promotion of wound healing. Interestingly, cytokines may alter the immune environment in an autocrine, paracrine or endocrine manner. Thus, the cell producing cytokines, cells in the nearby

PAGE 23

23 microenvironment or cells in distant parts of the body can be impacted by cytokine activity. T H cells, macrophages and dendritic cells secrete the majority of cytokines during an immune response (1) The cytokines these cells produce are classified into groups based on their functional and structural characteristics. One type of functional grouping is classification based on the type of immune response that the cytokine tends to elicit within the cytokine milieu. Cytokines that are typically associated with inflammatory responses are classified as T H 1 type cytokines while cytokines that exert an anti inflammatory effect in the host are referred to as T H 2 type cytokines. Tight regulation of both T H 1 type and T H 2 type cytokine and chemokine production is necessary as perturbation of the cytokine balance can lead to physiolo gic abnormalities such as sepsis and rheumatoid arthritis. Thus, cytokine and chemokine expression are controlled at both the transcriptional and post transcriptional levels. Transcriptional control is mediated by transcription factors that, when activated bind to promoter regions of cytokine and chemokine DNA to initiate transcription. Transcription factors that play key roles in orchestrating inflammatory cytokine gene transcription in macrophages and other immune cells include NF and AP 1 (13,1 4) Post transcriptional control of cytokine and chemokine gene expression is controlled by the presence of adenylate/uridylate (AU) rich elements (ARE) initially gene and cancer on cogene mRNA (15) As reviewed by Zhang, three classes of AREs exist based on the abundance and distribution of AUUA pentamers or UUAUUUAUU (16) Each of the three ARE classes can confer

PAGE 24

24 instabili ty or stability to the mRNA based on the ARE binding protein (ARE BP) that binds to the mRNA. The ARE BP tristetraprolin (TTP), for example, binds to ARE in TNF transcripts facilitating their degradation, whereas the ARE BP known as HuA stabilizes the TNF transcript (16) Thus, ARE and their respective binding proteins work in concert to control the degradation of gene transcripts for chemokines, cytokines and other proteins. Post transcriptional control of cytokine and chemokine expression via ARE may se rve as an intrinsic coding of the temporal order of cytokine responses during inflammation. Hao and Baltimore examined the temporal gene induction patterns in both period (1 7) Based on mi croarray analysis, the genes were classified into three groups based on the time of peak appearance in mRNA. Group I genes peaked at 0.5 hours, group II genes at 2 hours, and group III genes at 12 hours. Time course measurement of mRNA abundance, showed th at half lives of group I mRNA were shortest and varied from 0.2 hours to 0.9 hours (17) Group II mRNA half lives were longer and varied from 1 hour to 8 hours. Group three half lives could not be measured due to a lack of consistent decrease. Interestingl y, a database search revealed that mRNA of group I a determinant in the induction and kin etics of gene expression. In order to directly genes in group I, group II and group III were utilized in a set of transgenes that expressed green fluorescent protein (GFP) a s the reporter. The GFP was linked to the

PAGE 25

25 GFP mRNA from transgenes linked to the These difference s in mRNA stability occurred regardless of the promoter in the transgene. This research strongly suggests that the induction and kinetics of cytokine and chemokine gene expression is at least partially dependent on mRNA stability as determined by the ARE c ontent (17) Th us, an understanding of the molecular and genetic mechanisms controlling cytokine expression could provide essential information for analyzing and predicting immune response dynamics from initiation to resolution. Cranberry Cranberries ( Vaccinium macrocarpon ) belong to the plant family Ericacea and are one of the few berries of economic significance native to North America (18) Over the centuries, cranberries have been exploited for a variety of purposes. The red berry served as a source of food, meat preservative dye, and wound healing poultice for Native Americans and European settlers. Cranberry Polyphenols Beyond nutrients, such as ascorbic acid, cranberries contain phytochemicals, or secondary plant metabolites. Polyphenols are a type of phytochemical and co ntain multiple phenol rings in their structure. Cranberries have an extensive polyphenol profile with the most abundant classes of polyphenols in cranberry being anthocyanins, flavonols, flavan 3 ols, and proanthocyanidins (PAC) (19) The anthocyanins fou nd in cranberry are polyphenolic pigments also found in other red, purple and blue fruits. These compounds are responsible for the vivid red color of cranberry. The average concentration of anthocyanins in cranberry is 86 mg per

PAGE 26

26 100 g edible portion of rip e fruit (wet weight basis) (20 22) These anthocyanins include cyanidin, delphinidin, malvidin, palargonidin and peonidin (20 22) Variability in environmental factors can influence plant production of anthocyanins; thus, concentrations of anthocyanins have been found to range from 65 mg per 100 g edible portion to 168 mg per 100 g edible portion in cranberries (20 22) Cranberries also contain flavan 3 ols and flavonols. These two polyphenols can be distinguished from one another by the ketone group that is present at carbon 4 on flavonols but is absent at ca rbon 4 on flavan 3 ols (Figure 1 2 ). Flavan 3 ols are also known as catechins. According to Gu et al, cranberry content of flavan 3 ols in whole cranberry is approximately 7 mg per 100 g of fruit (23) Flavonol content of cranberries, however, is much higher and ranges from 7.70 mg to 48.27 mg per 100 g edible, ripe fruit (20) The most abundant flavonols present in cranberry are kaempferol, myricetin and quercetin with more than 70% of these compounds being quercetin glycosides (20) PAC are perhaps the most well known of the c ranberry polyphenols as they have been postulated to prevent urinary tract infections (UTI). PAC are polymers of flavan 3 ols and are thus referred to as condensed tannins. Cranberry PAC include a variety of structural forms distinguished by the li nkages connecting their flavan 3 ol monomers (Figure 1 3 ). Interestingly, the rare Type A PAC (Figure 1 3 p anel C) is present in cranberry and constitutes a large proportion of the total 418.8 mg per 100g PAC content (24) During screening of 88 foods for presence of PAC, the only foods other than cranberry found to contain Type A PAC were curry, cinnamon, peanut, avocado and plum (24)

PAGE 27

27 Cranberry and Immune Function Beyond imparting sensory qualities, cranberry polyphenols are bioactive compounds. Cranberry polyphenols have been studied for their po tential to promote oral health, prevent urinary tract infecti ons, inhibit cancer cell growth and to promote cardiovascular health (19,25) The bulk of research related to cranberry and immune health in recent years has concentrated on the anti adhesive na ture of the berry in relation to E. coli, H. pylori and S. mutans in the urinary tract, stomach and oral cavity, respectively (19,25) Despite the fact that the role of the immune system is to defend the body against pathogenic invaders and altered self mo lecules, very few research studies have been conducted to date that explore the potential of cranberry in modulating immune function. Studies that have shown a potential role of cranberry in altering immune function present evidence that cranberry may act in a variety of ways. Han et al provided evidence of a potential anti inflammatory role of cranberry in a rabbit model of vesico ureteric reflux (VUR), a type of congenital defect of the urinary system (26) Male rabbits receiving VUR surgery were divided into five groups and received the following treatments: 1) sham control; 2) sterile urine instillation; 3) infection with E. coli ; 4) infection with E. coli and dietary supplement of 1 g/kg body weight per day cranberry powder; or 5) infection with E. coli and intraperitoneal injection of melatonin, an antioxidant. Three weeks post surgery, rabbits given cra nberry or melatonin and rabbits instilled with sterile urine showed only mild mononuclear cell infiltration in the absence of fibrosis. The rabbits infected with E. coli and receiving no supplemental treatment, however, had significant mononuclear cell inf iltration and interstitial fibrosis in the infected kidney (26) Moreover, levels of malondialdehyde, an indicator of oxidative damage, was significantly lower in cranberry

PAGE 28

28 fed, melatonin supplemented and sterile urine infused rabbits compared to animals i nfused with E. coli The results of this study provide evidence that cranberry may act via an anti inflammatory mechanism during infections of the urinary system to prevent excessive mononuclear cell infiltration and subsequent tissue death. Pierre et al investigated the ability of cranberry to improve the function of gut associated lymphoid tissue (GALT) in response to elemental enteral nutrition (EEN). GALT serves as a protective barrier against infection by resident and pathogenic microorganisms of the gut. EEN reduces the barrier function of GALT and results in reduced secretory immunoglobulin A (sIgA) levels in the gut lumen and reduced expression of the sIgA transport pr otein, mucosal polymeric immunoglobulin receptor R (pIgR) (27,28) To test the hypothesis that cranberry could attenuate these decrements in GALT function, male Institute of Cancer Research (ICR) mice were randomized to one of three treatment groups: 1) ch ow via gastric catheter; 2) intragastric EEN via gastrostomy; or 3) EEN + cranberry PAC (100 mg/kg body weight) via gastrostomy (29) After receiving the specified treatment for five days, mice were sacrificed. The small intestine was removed from each ani mal for PP lymphocyte enumeration and determination of tissue interleukin 4 ( IL 4 ) phosphorylated signal transducer and activator of transcription 6 (pSTAT 6) and pIgR. Luminal washes were collected from each animal for sIgA measurement. The number of PP lymph ocytes and concentration of ileal tissue IL 4 were significantly increased in mice receiving EEN + PAC compared to EEN only mice, but no difference existed between chow fed and EEN + PAC mice (29) The ileal tissue sIgA and pIgR levels were also significantly elevated in EEN +

PAGE 29

29 PAC mice versus animals receiving EEN feeding. No significant difference in sIgA and pIgR was noted between chow fed and EEN+PAC mice. Analysis of pSTAT 6 by an antibody microarray reve aled that feeding PAC with EEN blunted the reduction in pSTAT 6 induced by EEN alone. As STAT 6 phosphorylation results in downstream activation of pIgR transcription, the authors suggested that increased ileal tissue levels of pIgR and lumen levels of sIg A in PAC+EEN mice were likely due to enhanced STAT 6 phosphorylation and signaling (29) This research study provides promising evidence pathways regardless of PAC absorpti on. The mediators of potential immune modulation induced by cranberry were investigated in a randomized, double blind, placebo controlled intervention involving frequency of asymptomatic bacteriuria in pregnant women (30) Twenty seven females in their fi rst or second trimester of pregnancy received 240 mL of cranberry juice cocktail (CJC) twice daily, CJC once daily and placebo once daily, or placebo twice daily. Each 240 mL bottle of CJC contained 80 mg PAC. After 3 days of beverage consumption, subjects provided 4 hour urine samples. Samples were analyzed for concentrations of anti inflammatory cytokines IL 4, interleukin 10 (IL 10) and interleukin 5 (IL 6. Consumption of CJC twice each day resulted in two fold lower concentrations of urinary IL 6 as compared to urine of subjects receiving placebo beverage twice daily. Urinary concentrations of the other five cytokines tested were not significantly different between the three treatme nt groups. Absence of UTI and asymptomatic bacteriuria in all subjects, including the twice daily placebo group, precluded any evidence of a

PAGE 30

30 uroprotective effect provided by CJC (30) Nonetheless, the reduction in urinary IL 6 concentrations following consumption of 480 m L CJC daily (160 mg PAC) does demonstrate the potential of cranberry to influence mediators of immunity in vivo. Cranberry may also serve a role in boosting humoral immunity, or the aspect of immunity mediated by antibodies. Hochman investigated the impac t of a cranberry nondialyzable material (NDM) with a molecular weight of 12,000 30,000 on lymphoma growth and antilymphoma antibody production in vivo (31) Syngeniec, immune competent Balb/C female mice were inoculated with Rev 2 T 6 murine lymphoma cells Mice received either 4 mg cranberry NDM via intraperitoneal injection one day after inoculation followed by 2 mg cranberry every other day for 14 days or 2 mg cranberry NDM followed by 1 mg cranberry NDM every other day for 14 days. Four of five (80%) co ntrol mice injected with Rev 2 T 6 lymphoma cells developed tumors by three weeks post inoculation, while no mice consuming cranberry NDM developed tumors at study termination 60 days post inoculation. Western blot analysis of Rev 2 T 6 cells probed with s era from inoculated mice showed increased expression of anti lymphoma antibodies in inoculated mice injected with cranberry NDM as compared to the low level of antibody production in tumor bearing control mice and the absence of antibody production in nav e mice (31) The absence of tumors in immune competent Balb/C mice inoculated with lymphoma cells combined with the increased expression of anti lymphoma antibodies against Rev 2 T 6 cells does provide promising evidence of a potential role of cranberry in enhancing the immune response. Jass and Reid investigated the potential of reconstituted cranberry extract to reduce pathogenic microbial adherence in the vaginal environment (32) During a

PAGE 31

31 randomized, crossover study in 12 healthy females consuming reco n stituted cranberry extract for one week, potential pathogens were lost from the vagina in five subjects (42%) consuming reconstituted cranberry drink twice daily (32) There were also no apparent harmful effects on the resident vaginal microbiota. The ben eficial effects observed in the study strengthen the argument for research to fill the paucity of Immune Cell Priming exposure of a c ell or organism to a cytokine or antigen that modifies the ability of the cell or organism to respond to a subsequent immune challenge. However, priming with an antigen or cytokine takes immune cells out of a resting state and into a state of activation. A ctivated immune cells secrete inflammatory mediators that can lead to destruction of body tissues and chronic inflammation when the activation occurs in the absence of an immune challenge. ss both myeloid and lymphoid characteristics, has suggested that priming may also be induced by plant polyphenols in innate immune cells. This antigen independent priming, as termed by ary stimulus being necessary to elicit overt activation and proliferation (33) dietary priming agent to date is PAC produced by certain plants (e.g. apples) (33,34) ells with unripe apple peel PAC resulted in increased expression of cytokine and chemokine transcripts of granulocyte macrophage colony stimulating factor (GM CSF) and IL 8 (35) IL 8 is a chemoattractant that functions to draw immune cells to sites of inflammation in the host, while GM CSF controls the production and differentiation of macrophage and granulocyte cells. Interestingly,

PAGE 32

32 were not induc (35) A possible mechanism behind the increased expression of GM CSF and IL 8 was explored in MOLT (36) Both IL 8 and GM their mRNA (37) These ARE can be bound by ARE BP to alter the stability of the transcript and hence control expression of cytokines and chemokines at a post transcriptional level. Thus, the authors hypothesized that the increase in cytokine and chemokine alterations in the transcript stability (36) Treatment of MOLT 14 cells with APP and subsequent addition of actinomycin D, to inhibit further de novo transcription, resulted in approximately 50% retention of the initial GM CSF transcript level at 30 min utes (min) and 90 min post actinomycin D addition (36) In comparison, GM CSF transcripts from MOLT 20% and 10% of initial levels 30 minutes and 90 minutes after actinomycin D treatment, respectively (36) IL 8 transcript levels also appeared to be stabili zed by APP with greater than 80% of the initial transcript level remaining 90 min after actinomycin D treatment (36) Thus, one possible mechanism responsible for the priming effect seen in lity. Increases in cytokine and chemokine mRNA stability and expression could offer a clear immunonological advantage to immune cells in that upon activation by an immune stimulus, the cells could have transcripts available for translation to protein and t hus initiate a more rapid immune response. However, this hypothesis and the in vivo human relevance remain to be explored.

PAGE 33

33 THP 1 Cells THP 1 cells are a human leukemic cell line cultured from a young male with acute monocytic leukemia (38) These cells ca n be used as an appropriate model of a human innate immune cell in experimental research (39) Similar to primary human monocytes and macrophages, THP 1 cells express TLR4, among many other innate receptors, and express the monocytic cell marker CD14 on th eir surface (40) These cells can be used both as models of human monocytes and macrophages. Treatment of THP 1 cells with phorbol diester induces diffe rentiation from a monocyte to macrophage cell (41) The differentiation process enhances the cells ability to respond to LPS and other mitogens, which is advantageous in experiments where responses of undifferentiated cells may be below detection limits (5)

PAGE 34

34 Figure 1 1. TLR4 pathway.

PAGE 35

35 A B Figure 1 2. Basic structure of flavan 3 ols and flavonols. Subpanels represent: A) flavan 3 ol and B) flavonol. A B C Figure 1 3. Proanthocyanidins found in cranberry. A) proanthocyanidin with a B type B) proanthocyanidin with a B type linkage C) proanthocyanidin with an A type linkage

PAGE 36

36 CHAPTER 2 INTRODUCTION Significance and Rationale Each year more than 62 million cases of the common cold occur in the United States alone and result in approximately $25 billion in lost work productivity (42,43) Additionally, an estimated 37.2 mi llion food borne illnesses occur each year in the United States (44) These and other acute illnesses caused by bacterial and viral pathogens have a significant impact on quality of life and the economy. However, their impact could be lessened by decreasin g the number of days of infection and/or reducing symptom severity. Consumption of dietary bioactives that alter innate immune cell function may facilitate these changes. The long term goal of our lab is to understand how food components modify the immune response to pathogen challenge and subsequent resolution of the inflammatory response. The goal of this research project was to characterize the priming mechanism in THP 1 monocytes/macrophages, a model of an innate immune cell. Priming refers to immune ce ll responses initiated by a compound prior to pathogen encounter. The overall rationale for this research project was two fold. First, the immune modulating potential of cranberry and responsible mechanisms has not been adequately studied. The paucity of research studies that have been conducted to date have focused on bacterial adherence in urinary tract infections and periodontal disease. An understanding of how cranberry modifies immunity may provide knowledge of prevention of these illnesses as well as evidence of how cranberry may enhance immune responsiveness to other infectious agents. Our research directly examined mechanisms by which cranberry bioactives alter innate immune cell function. Second,

PAGE 37

37 having completed the research, we now have a better understanding of how cranberry bioactives interact with TLR4 on the innate immune cell surface to modify cell function, especially monocyte/macrophage function. The monocyte and macrophage function in innate immunity is to phagocytize pathogens and to act ivate other immune cells via antigen presentation and secretion of inflammatory proteins. Thus, these cells are one of the first responders during pathogenic invasion, and are instrumental in initiating a rapid, effective immune response. Swift immune resp onses that eliminate pathogens and restore immune homeostasis provide potential for alleviation of infectious illnesses including the common cold, influenza and cholera. Hypothesis Our central hypothesis was that bioactives in cranberry fractions would enh ance the responsiveness of THP 1 monocyte/macrophage cells to secondary challenge with a bacterial component in a Toll like receptor 4 (TLR4) dependent manner. Specific Aims The primary aims of our research were to: 1. Characterize the activation state of T HP 1 cells in response to increasing concentrations of cranberry to determine optimal experimental conditions. 2. Measure the chemokine and cytokine protein and mRNA levels of cranberry treated THP 1cells using the best determined cranberry concentration from Specific Aim 1. 3. Delineate the role of TLR4 in mediating cranberry induced priming by measuring cytokine and chemokine mRNA levels under conditions in which TLR4 is inactivated.

PAGE 38

38 CHAPTER 3 OPTIMAL EXPERIMENTAL CONDITIONS FOR CRANBERRY PRIMING ARE SIX HOURS AND 25 UG/ML CRANBERRY FRACTIONS Background In order to test the hypothesis that bioactives in cranberry fractions would prime THP 1 cells for an enhanced response to secondary challenge via TLR4, it was first necessary to identify a cranberry concen tration that did not overtly activate the cells. Our proposed definition for innate immune cell priming involves a subtle response in the cell prior to a secondary challenge. An excessive cranberry concentration that activates the cell was postulated to pr ohibit detection of enhanced cytokine secretion upon secondary challenge with LPS, thus precluding our ability to use cytokine and chemokine secretion as a screening tool for which mRNA status to measure in future experiments. Four approaches were used to analyze the activation pattern of THP 1 monocytes: percentage of CD14 + CD49a + cells; CD49a expression per cell; CD14 expression per cell; and cytokine and chemokine secretion. CD14 is a cell surface marker for monocytic cell populations and is involved in cellular response to LPS via the TLR4/MD2 receptor complex (3,45) The marker is constitutively expressed on the cell surface; however, expression is upregulated during polarization of monocytic cells toward an inflammatory phenotype (46,47) CD49a is t chain of the integrin, very late antigen 1 (VLA 1). When CD49a on the extracellular matrix. This integrin is critical for migration of monocytic cells into the tiss ue during an inflammatory response.

PAGE 39

39 As CD49a is expressed on activated T cells and monocytes, changes in CD49a expression per cell was used as the primary cell surface marker to classify the activation status of THP 1 cells (1) Activated monocytic cells secrete cytokines and chemokines. Thus, the activation status of THP 1 monocytes in response to increasing concentrations of cranberry was also characterized by analysis of cytokines and chemokines secreted into culture medium using multiplex technology. Materials and Methods Cranberry Fractions Lyophilized cranberry fractions were obta ined from Ocean Spray Cranberries Inc. (Lakeville, MA). The cranberry fractions, designated PAC m and PAC r, were both derived from the juice portion of the berry. The primary difference between the tw o fractions, as shown in Table 3 1, is that PAC r conta ined 35 40% more PAC than PAC m (dry weight basis). PAC m, however, contained 4.5 times more flavonols, 12 times more anthocyanins and 5 times more phenolic acids than PAC r (dry weight basis). The high performance liquid chromatog raphy (HPLC) chromatograms in Figure 3 1 and Figure 3 2 provide additional infor mation on the composition of procyanidins (PCA), a type of proanthocyanidin, (Figure 3 1, A and B) and anthocyanins (Figure 3 2, A and B) in PAC r and PAC m. The fractions w ere tested for the presence of endotoxin with a PyroGene Recombinant Factor C Endotoxin Detection Kit (Cat # 50 658U, Lonza, Inc., Walkersville, MD) to ensure that cell activation was not due to LPS contamination. Both PAC m and PAC r contained less endot oxin than the minimum detectable limit (0.01 EU/mL) of the assay (data not shown).

PAGE 40

40 In all cell culture experiments, cranberry fractions were dissolved in DMSO vehicle with a final concentration of less than 0.1% DMSO in culture medium. THP 1 Monocy te Cell Culture THP 1 human monocytes (American Type Culture Collection, TIB maintained at 37C, 5% CO 2 in RPMI 1640 complete medium (Cat# 17 105 CV, Corning Cellgro, Manassas, VA) containing 10 % (v/v) FBS, 2 mM L glutamine (25 005 CI, Corning Cellgro, Manassas, VA ), antibiotic antimycotic supplement (100 U/mL 004 CI, Corning Cellgro, Manassas, VA), 25 mM D (+) glucose (Cat# G8769 Sigma Aldrich, St. Louis, MO), 1 mM sod ium pyruvate (Cat# SH30239.01, Thermo Scientific HyClone, Logan, UT), 10 mM HEPES (Cat# 25 060 CI ,Corning Cellgro, 2 mercaptoethanol (M7522, Sigma (30 005 CR, Corning Cellgro, Manassa s, VA). The passage number of the cells was unknown upon receipt from American Type Culture Collection. After arrival, cells were not used beyond passage 50. Cell viability was 95% or greater for all experiments unless otherwise stated. Cells were maintain ed between 2 x 10 5 cells/mL to 8 x 10 5 cells/mL between experiments as recommended by ATCC (48) Cell Viability THP 1 cells were plated at 5 x 10 5 cells per well in a 24 well culture plate ( Cat# 07 200 84, Corning Costar, Manassas, VA). Cells were treated with either 5 25 50 mL of cranberry PAC m or PAC r, media or DMSO vehicle for up to 48 h ours (h) At time points of 0, 24 and 48 h cells were harvested and viability was assessed using the trypan blue exclusion method and a Neubauer hemacytometer.

PAGE 41

41 Flow Cytometry THP 1 monocytes in RPMI complete medium were plated at 5 x 10 5 cells per well in a 24 well culture plate ( Cat# 07 200 84, Corning Costar, Manassas, VA). Cells were incubated with m or PAC r medium or DMSO vehicle for 6 or 48 h. Cells were harvested at aforementioned time points and placed into 5 mL polypropylene culture tubes ( Cat# 14 956, Ther mo Fisher Scientific Inc., Pittsburgh, PA) containing 1 mL of flow wash buffer (0.01% sodium azide in PBS). Cell suspensions Supernatants were discarded and cell buffer (2% FBS in flow wash buffer). 5 x 10 5 cells were stained with fluorophore conjugated antibodies ( Ab ) The antibodies PE conjugated anti human CD14 ( Cat# 12 0149 73, eBioscience, San Diego, CA) and FITC conjugated anti Ca t# sc 23942, Santa Cruz Cells After 30 minutes, cells were washed with 1 min. Supernatants were A BD Company, Franklin Lakes, NJ) was used for data acquisition. Data were analy zed with FlowJo version 7.6.1 software (Tree Star Inc., Ashland, OR). Multiplex Protein Analysis THP 1 cells were plated at 5 x 10 5 cells per well in 24 well culture plates ( Cat# 07 200 84, Corning Costar, Manassas, VA). Cells were treated with either 5, 2 5, or 100 m, PAC r, or DMSO vehicle control for 6, 24 or 48 h. Cell suspensions

PAGE 42

42 were harvested into 1.5 mL polypropylene microcentrifuge tubes and centrifuged for Cell free supernatants were collected into pre labeled 1.5 mL microcentrifuge tubes and stored at 80C until analysis. Cytokine and chemokine production in response to cranberry fractions was quantified with a Milliplex MAP Human Cytokine/Chemokine Bead Panel ( Cat# MPXHCYTO 60K; EMD Millipore; Billerica, MA) protocol. All washing steps were performed on a vacuum manifold apparatus (EMD Millipore; Billerica, MA). Specific cytokines analyzed included MIP 8, IL These proteins, incubation times of 6, 24 a nd 48 h and cranberry fraction concentrations were selected based on unpublished research from the Percival lab examining cytokine and chemokine production from human PBMC following treatment xPONENT 3.1 software (Luminex Corp., Austin, TX) was used for bead analysis. Statistical Analysis For all flow cytometry experiments, statistical analysis was carried out with a 2 way analysis of variance (ANOVA) and Tukey post hoc all pairwise test. All data is presented as mean SD with ( P<0.05) considered significant. Results Cell Viability The percentage of viable cells was greater than 90% for cells treated with PAC m and PAC r at each of the concentrations and time points with the exception of cells r for 48 h (Figure 3 3) Eighty percent of cells were viable with this treatment and time combination.

PAGE 43

43 Flow Cytometry THP 1 monocytes were treated with increasing concentrations (5, 25 or 10 0 m or PAC r, medium or vehicle control for 6 and 48 h. Initially, the percentage of CD14 CD49a cells was examined. Using a two way ANOVA to determine effects of time, treatment and interaction between time and treatment on percentage of CD14 + CD49a + cells, time (P=0.008), treatment (P<0.001) and the interaction (P=0.029) between time and treatment were each found to have a significant effect on percentage of double positive cells (Figure 3 4 ). m r (P<0.001) significantly increased the percentage of CD14 + CD49a + cells from 6 h to 48 h. The shift in the CD14 + CD49a + population with time can be seen in the representative dot plots in Figure 3 5 Post test analysis revealed that within the 6 h period, cells treated with r were activated a s the percentage of CD14 + CD49a + cells was significantly greater (P<0.001) than for cells receiving all other treatments (Figure 3 4 ). r and PAC m treatments at 48 h. tion with PAC r, the percentage of cells positive for both CD14 and CD49a was at least one fold greater (P<0.001) than for all other cell treatments within the same time point. The shift in the CD14 + CD49a + population with increasing concentrations of PAC r is shown in repres entative dot plots in Figure 3 6 The trend for the highest fraction concentration to increase the percentage of CD14 + CD49a + cells continued with PAC m, as the percentage of double positive cells C m treated cells as compared to cells treated

PAGE 44

44 with all other concentrations of PAC r within the same time period (Figure 3 4 ). m or PAC r at 6 h and 48 h had no effect (p>0.05) on the percentag e of double positive cells when comparing treatments within time periods or ti me within treatments (Figure 3 4 ). The median fluorescence intensity (MFI) was used to determine CD14 and CD49a expression per cell. For CD14, time (P=0.007), but not treatment ( P=0.301) or interaction (P=0.997) between time and treatment, had a significant effect on expression of the monocytic cell marker base d on a two way ANOVA (Figure 3 7 ). A Tukey multiple comparison all pairwise post test, however, found no significant diffe rence in CD14 expression with time in any of the treatment groups (p>0.05). When two way ANOVA was used to determine the effects of time, treatment and interaction between time and treatment, CD49a expression per cell was found to be significantly affecte d by treatment (P<0.001), but not time (P=0.417) or interaction (P=0.996) of treatment and time (Figure 3 8 ). r treatment for 48 h resulted in significantly (P<0.05) greater CD49a expression per cell as compared to all other treatment s at the same time point (Figure 3 8 ). Multiplex Protein Analysis Con centrations of MIP 9 panel A), IL 8 (Figure 3 9 panel B), and MIP 9 panel C) chemokines in culture medium from monocytes treated r at 24 and 48 h were markedly higher than other treatments. The r treated cells began at 6 h, and the magnitude relative to other treatments at the same time point increased at 24 and 48 h.

PAGE 45

45 Although secretion of cytokines IL 9 panel D) 3 9 r treatment, the magnitude of the secretion was minimal compared to the secretion of chemokines (Figure 3 9, panels A, B and C). Discussion The activation status of THP 1 monocytes was characterized using four approaches: percentage of CD14 + CD49a + cells; CD49a expression per cell; CD14 expression per cell; and production of chemokines and cytokines. The primary goal of t he experiments was to identify a cranberry concentration that did not overtly activate the cell. Although absence of a response is contrary to what many researchers desire, we were dependent on finding a cranberry concentration that elicited no or minimal changes in activation in order to examine the priming mechanism in later experiments. The cell viability results showed no evidence that cranberry fractions were inducing cell death beyond basal levels. Thus, the 5 was used in flow cytometry and cytokine/chemokine analysis experiments. The concentration and time dependent increase in percentage of CD14 + CD49a + cells suggested that cells were bei ng activated at 6 and 48 h with PAC r. A second measure of activation CD49a expression per cell, confirmed that 100 r was activating cells at 48 h in that each CD14 + cell was expressing more PAC m. In comparison, 6 h treatment with r or PAC m did not elicit cell activation as measured by percentage of CD14 + CD49a + cells and CD49a expression per cell.

PAGE 46

46 The expression per cell of CD14, an identification marker of monocytic cells, was not altered by time or increasing concentrations of PAC m or PAC r. CD14 is a constitutively expressed surface marker on monocytes but can be upregulated during monocyte polarization toward an inflammatory phenotype (47) This polarization occurs in the presence of potent mitogens and mic robial components including peptidoglycan, CpG oligonucleotides, flagellin and LPS (46,47) As cranberry is not a microbial component or potent immune mitogen, it was expected that cranberry would elicit minimal or no changes in CD14 expression per cell. P roduction of MIP PAC r supported the increase in expression of CD49a per cell and percentage of CD14 + CD49a + cells induced with the same concentration of PAC r. Although these chemokines increased in culture medium, it should be noted that the overall magnitude of the increase was lower than levels induced with LPS ( Creasy unpublished observations ). The results of the four activation measures: percentage of CD14 + CD49a + cells; CD14 expression per ce ll; CD49a expression per cell; and chemokine and cytokine for 6 h did not activate THP 1 monocytes. Thus, the 6 h incubation period with cranberry fractions was selec ted for use in all future experiments with THP 1 cells. Between the two fraction concentrations ( ) concentration to use in later experiments as it was an intermediate concentration that was predicted to induce subtle, yet more measurable molecular responses in priming experiments.

PAGE 47

4 7 Table 3 1. Composition of cranberry f ractions Component Fraction PAC m PAC r Sugars 1% none detected Organic Acids 0.5% none detected PACs 60 65% 99% Flavonols 9% 0.5 2% Anthocyanins 6% 0.5 or less% Phenolic Acids 5% 0.1 1% Composition data provided by Ocean Spray, Inc.

PAGE 48

48 A B Figure 3 1. Normal phase HPLC chromatograms of procyanidins (PCA) recorded on a fluorescence detector (Ex=231 nm, Em=320 nm). Sub panels represent: A) PAC r chromatogram and B) PAC m chromatogram. Figure printed with permission (Sandhu et al unpublished).

PAGE 49

49 A B Figure 3 2. HPLC/diode array detector chromatograms of anthocyanins at 520 nm. Sub panels represent: A) PAC r chromatogram and B) PAC m chromatogram. Numbered peaks are: 1 cyanidin glucoside; 2 cyanidin xyloside; 3 peonidin glucoside; 4 peonidin xyloside and 5 peonidin xyloside The numeral 6 and corresponding arrow on subpanel B refer to the retention time for delphinidin glucoside. Figure printed with permission (Sandhu et al unpublished).

PAGE 50

50 Figure 3 3. THP 1 monocytes maintained viability with cranberry treatment. THP 1 monocytes were treated with either 5, 25, m or PAC media or DMSO. Cells were harvested at 0, 24 and 48 h. Viability was assessed using the trypan blue exclusion metho d.

PAGE 51

51 Figure 3 4. THP 1 monocytes were a ctivated by 48 h treatment with 100 g/mL PAC r or PAC m. Cells were incubated with increasing concentrations of PAC m or PAC r, medium or DMSO vehicle. Cells were harvested at 6 and 48 h. Flow cytometry was used t o analyze the percentage of cells expressing CD14 and CD49a. Values represent means SD of two experiments each with duplicate treatme nts. Data were analyzed with a two way ANOVA and Tukey post test (*P<0.05, ***P<0.001).

PAGE 52

52 A B C D Figure 3 5. Representative dot plots showing the effect of time on percentage of THP 1 cells expressing CD14 and CD49 a Subpanels represent cells treated with: A) DMSO for 6 h, B) DMSO for 48 h, C) 100 g/mL PAC r for 6 h and D) 100 g/mL PAC r for 48 h.

PAGE 53

53 A B C D Figure 3 6. Representative dot plots showing the effect of concentration on percentage of THP 1 cells expressing CD14 and CD49a. Subpanels represent cells treated for 48 h with: A) DMSO, B) 5 g/mL PAC r, C) 25 g/mL PAC r and D) 100 g/mL PAC r.

PAGE 54

54 Figure 3 7. CD14 expression per cell d id not differ on THP 1 cells from 6 to 48 h of cranberry treatment. Cel ls were incubated with increasing concentrations of PAC m or PAC r, medium or DMSO vehicle Cells were harvested at 6 and 48 h. Flow cytometry was used to analyze CD14 PE MFI which represents the CD14 expression per cell. Values represent means SD of two experiments each with duplicate treatments. Data were analyzed with a two way ANOVA and Tukey all pairwise post test (P<0.05)

PAGE 55

55 Figure 3 8 CD49a expression per cell was PAC r. Cel ls were incubated with increasing concentrations of PAC m or PAC r, medium or DMSO vehicle Cells were harvested at 6 and 48 h. Flow cytometry was used to analyze CD49a FITC MFI which represents the CD49a expression per cell. Values represent means SD of two experiments each with duplicate treatments. Data were analyzed with a two way ANOVA and Tukey all pairwise post test *Significant versus all other treatments within th e same time point (P<0.05).

PAGE 56

56 A B C D E Figure 3 9 Chemoki ne secretion into supernatant was markedly increased by r. THP 1 monocyte chemokine and cytokine secretion in response to incubation with cranberry for 6, 24 and 48 h. Subpanels represent: A) MIP B) IL 8 concentration in supernatant C) MIP D) IL and super natant.

PAGE 57

57 CHAPTER 4 CRANBERRY BIOACTIVES INCREASE MIP PROTEIN SECRETION AND TRANSCRIPT ABUNDANCE IN THP 1 MACROPHAGES Background and an incubation time of 6 h, the primary hypothesis that cranberry bioactives would enhance THP 1 response to secondary challenge with LPS was tested. The mechanism of enhanced response that was targeted was increased steady state cytokine and chemokine transcript abundance and increased transcript stability. Secretion of chemokines and cytokines during an immune response to pathogen challenge is of paramount importance to ensuring that leukocytes can migrate to the area of pathogen invasion and carry out functions required to swiftly eliminate the immune invader and prevent subsequent infection. Chemokines and cytokines produced by monocytes and macrophages in response to i nvading pathogens and other immune stimuli include GM CSF, MIP IL an d IL 6 (49) Production of these cytokines and chemokines are regulated via multiple mechanisms including gene transcription, mRNA stability and translation of mRNA to protein (50) The increased expression of cytokine and chemokine mRNA mediated by an in crease in stability following treatment of MOLT 14 cells, a proposed possessing innate and adaptive immune cell characteristics, with APP led us to hypothesize that the molecular actions taking place inside THP 1 cells exposed to low levels of cranberry may involve increased mRNA abundance and stability (36) To identify the cytokine and chemokine mRNA whose expression might putatively be increased by cranberry fractions, we used Luminex multiplex technology to analyze cytokine and chemokine proteins in cell supernatant following incu bation with

PAGE 58

58 m and PAC r with and without secondary LPS stimulation Screening protein secretion for mRNA to analyze is supported by the work of Chanput et al in which cytokine and chemokine pro tein kinetics reflected mRNA kinetics (49) Init i ally, THP 1 monocytes were utilized for screening experiments; however, the small magnitude of the cytokine and chemokine secretion in LPS challenged cells precluded our ability to test our hypothesis that cranberry could enhance innate immune cell response to secondary challenge Differentiation of THP 1 monocytes into macrophage like cells result s in enhanced responses to immune stimuli; therefore, THP 1 monocytes were differentiated into macrophage like cells using phorbol 12 myristate 13 acetate PMA for use in all further experiments (5) Materials and Methods THP 1 Differentiation THP 1 monocytes were cultured in 60 mm x 15 mm tissue culture treated plates at 5 x 10 5 cells/mL wi th a total of 3 x 10 6 cells per plate. Cell differentiation was achieved by incubating cells with 100 ng/mL PMA ( Cat# P1585, Sigma Aldrich, St. Louis, MO) for 72 h in a 37C, 5% CO 2 incubator as described by Schwende et al. (51) THP 1 Macrophage Cell Cultu re The cell culture methods for the cytokine and chemokine screening experiment and steady state mRNA abundance experiment are explained separately to avoid confusion with LPS stimulation in the two experiments. Cytokine and chemokine screening experiment Differentiated THP 1 cells were washed with 2 mL of 37C PBS Fresh RPMI 1640 complete m PAC m or PAC r or DMSO was added to culture dishes Cells were returned to a 37C, 5% CO 2 incubator for 6 h. Medium

PAGE 59

59 containing treatments was removed, and cells were washed with 37C PBS THP 1 from Escherichia coli O 55:B5 ( Cat# L4524; Sigma Aldrich St. Louis, MO ) or PBS vehicle control for 6 h in a 37C, 5% CO 2 incubat or. After stimulation, cells were harvested and cell free supernatants were stored at 80C prior to multiplex analysis. Steady state mRNA abundance experiment THP 1 macrophage like cells were washed with 37C PBS to remove residual PMA. Cranberry fractio ns, LPS and DMSO vehicle were diluted in 37C RPMI 1640 complete m edium and added to cells in culture dishes. F inal concentrations of cranberry fractions and LPS in medium were The final percentage of DMSO in culture me dium was less than 0.1%. Culture dishes containing cells were returned to a 37C, 5% CO 2 incubator for 6 h. Multiplex Analysis Cytokine and chemokine production in response to cranberry fractions was quantified with a Milliplex MAP Human Cytokine/Chemokin e Magnetic Bead Panel ( Cat #HCYTOMAG protocol. All washing steps were performed on an AquaMax 4000 (Molecular Devices; Sunnyvale, CA) automatic plate washer. Specific cytokines analyzed incl uded GM CSF, IL 12 ( p 40), IL 6, MCP 1, MIP multiplex system with xPONENT 3.1 software (Luminex Corp., Austin, TX) was used for bead analysis. RNA Isolation, cDNA Synthesis and qRT PCR Culture medium was aspirate d from tissue culture dishes and cells were harvested for RNA isolation without washing. R NA was purified from THP 1

PAGE 60

60 macrophages using RNAzol RT ( M olecular Research Center, Inc., Cincinnati, OH). First stra g RNA using a Hig h Capacity cDNA Reverse Transcriptio n Kit ( Cat# 4368814, Applied Biosystems, Foster City, CA). Reverse transcription was performed on a MJ Research PTC 150 Thermal Cycler. C Quantitative RT Time PCR System using Po wer SYBR Green PCR Master Mix ( 4367659, Applied Foster City, CA) and four 10 fold serial dilutions. Conditions for quantitative RT PCR were 2 min at 50C for stage 1, 10 min at 95C for stage 2 and 15 sec at 95C followed by 1 min at 60C for 40 replicate cycles for stage 3. Primers for MIP RPL37A and Cyclophilin B (Table 4 1) were designed using Primer Express 3.0 soft purchased from Eurofins MWG Operon (Huntsville, AL). Prior to use in experiments, a melting curve analysis was performed on all primers to confirm specificity of ampli fication (data not shown) MIP and TNF values were normalized to the average of RPL37A and Cyclophilin B as the normalized values of MIP using each housekeeping gene independently were positively correlated (r 2 = 0.99). Additionally, the use of RPL37A and Cyclophilin B as reliable reference genes in LPS treated THP 1 cells and PMA differentiated THP 1 cells is supported by the work of Cao et al and Ma e ss et al (52,53)

PAGE 61

61 mRNA Stability Cells were treated 6 h PAC m or PAC r Actinomycin D ( Sigma Aldrich, St. Louis, MO) at a fin al concentration of then spiked directly into culture medium to inhibit de novo transcription, following recommended mRNA decay measurement protocols (54) Cells were harvested for RNA isolation at 1, 30, 90 and 180 min post actinomycin D addit ion. RNA isolation, cDNA synthesis and qRT PCR were carried out as described above with the exception that and MIP were normalized to the single housekeeping gene Cyclophilin B Stati s tical Analysis All statistical analysis procedures were conducted with SigmaPlot version 11.0 or 12.0 (Systat Software Inc., San Jose, CA). Separate statistical tests were performed for each cytokine/chemokine of interest in cells stimulated or not stimulated with LPS. A one way ANOVA was used to test for significant differences among the means of treatment groups with the exceptions of IL 12 (p40) and MCP 1 from stimulated cells. For IL 12 (p40), a one way ANOVA on log 10 transformed data was used due to non normality. Dat a is reported for IL 12 (p40) from stimulated cells as mean SD of untransformed data. Log 10 transformation of MCP 1 values was attempted; however, normality could not be achieved. Thus, MCP 1 values were analyzed with Krus kal Wallis one way ANOVA on rank s. A Tukey multiple comparison procedure was used when necessary to determine what means differed between treatment groups. Data is reported as mean SD. Differences in steady state mRNA abundance for w ere determined with a one way ANOVA (P<0.05) on square root transformed data to correct for unequal

PAGE 62

62 variance. For steady state MIP mRNA abundance, a one way ANOVA (p<0.05) on log 10 transformed data was used to correct non normal data. A Tukey multiple comparison all pairwise test was used to determin e which treatment means differed. Data are shown as mean SD of untransformed data. For and MIP transcript stability, relative mRNA abundance was plotted over time and generation of a trendline was used to derive the slope (relative abundan ce/min) for each experimental duplicate using Microsoft Excel 2007 (Microsoft, Redmond, WA). The slope values from two independent experiments were then used for statistical analysis. For TNF slopes, a one way ANOVA (P< 0.05) was used to test for significant differences among DMSO, PAC m and PAC r treatment group means. Data is shown as mean SD. For MIP slopes, statistical analysis was not conducted as there was little or no reduction of transcript abundance over the 3 h period following actinomycin D addition regardless of treatment. Data is shown as median with the range of values Results Multiplex Analysis In order to prevent confusion, THP 1 macrophages treated with cranberry or vehicle followed by subsequent LPS macrophages treated with cranberry or vehicle followed by incubation with PBS will be throughout the multiplex analysis portion of the results section. The concentration o f eight cytokines/chemokines in culture medium following treatment with cranberry followed by stimulation or no stimulation with LPS was

PAGE 63

63 analyzed with multiplex technology. Detectable levels of all analytes were present in the medium of stimulated and unst imulated cells, except for GM CSF in unstimulated culture medium (Figure 4 1). For unstimulated cells, differences in mean values among PAC r, PAC m and DMSO treatment groups were significant only for the analytes MIP (P<0.001) and IL 6 (P<0.008) (Figure 4 1). A Tukey all pairwise multiple comparison test was used to determine which treatment group means differed. The MIP r and PAC m unstimulated cells was significantly (P<0.001 ) less than the concentration present in the culture medium of vehicle treated cells; however, no significant difference (P<0.787) existed between the mean MIP r treated and PAC m treated cell culture medium. MIP n culture medium from DMSO treated cells was greater than for PAC m (P<0.001) and PAC r (P<0.001) treated cells. PAC r treated cells produced significantly less (P=0.037) MIP m treated cells. The ollowed the same pattern as MIP T of cells treated with PAC m and PAC r being significantly ( P<0.001) less than that in DMSO treated cell culture medium PAC r treated cells also produced significantly (P=0.004) less PAC m treated cells. Stimulated THP 1 macrophages secreted concentrations of cytokines and chemokines that were of greater magnitude than unstimulated cells as noted by the concentration ranges of 0 120 pg/mL for the unstimulated cell graph (Figure 4 1) v ersus 0 5000 pg/mL for the stimulated cell graph (Figure 4 2). Out of the eight cytokines and chemokines analyzed, MIP

PAGE 64

64 concentration in culture medium was significantly (P=0.006 for MIP T Post test analysis showed that treatment with PAC r prior to stimulation resulted in a modest but significant (P=0.005) increase in MIP treatment (Fig ure 4 2). groups was approximately 10 times lower than MIP PAC r induced a (P<0.001) compare d to PAC m. As MIP treated and stimulated cell culture medium as compared to vehicle treated and stimulated cells, these two cytokines/chemokines were selected for analysis of steady state mRNA a nd mRNA stability following cranberry treatment. Steady State mRNA Abundance To determine if cranberry primes THP 1 macrophages via a mechanism involving increased cytokine/chemokine transcript abundance, qRT PCR was used to measure the steady state level s of and MIP mRNA following 6 h treatment with c ranber ry fractions or vehicle control Relative abundances of both MIP and were upregulated with PAC r treatment in comparison to vehicle control and PAC m treatment (Figure 4 3, panels A and B for and MIP respectively). The fold change in relative abundance was 1 and 2.5 for and MIP respectively for PAC r trea ted cells vs. vehicle.

PAGE 65

65 mRNA Stability The possibility that the upregulation of steady state and MIP mRNA by PAC r was due to enhanced mRNA stability was explored using actinomycin D, an inhibitor of de novo transcription, along with qRT PCR. Rela tive abundance of over time following actinomycin D addition declined from 1 to 180 min in all trea tment groups (Figure 4 4 ). However, mean rate of change in transcript abundance did not differ significantly (P=0.057) among THP 1 macrophages trea ted with PAC r, PAC m and DMSO (Table 4 2) R elative abundance of MIP following ac tinomycin D additio n remained stable over time ( Table 4 3 and Figure 4 5 ). Discussion Work in this chapter focused on investigating the ability of cranberry fractions to heighten the THP 1 response to secondary challenge with a bacterial cell wall component via molecular changes in mRNA steady state abundance and mRNA stability. We first used Luminex technology to screen for cytokine and chemokine proteins that were secr eted in greater quantities by cranberry treated and LPS challenged versus vehicle treated and challenged cells to identify potential cytokines and chemokines whose mRNA expression might be altered by cranberry bioactives. This reverse methodology was utili zed because proteins are the active mediators of immune responses. THP 1 macrophages were treated with cranberry or vehicle and were unstimulated or stimulated with LPS to mimic aspects of a pathogen challenge. The unstimulated cells were used as a control to determine if cranberry alone was inducing cytokine and chemokine production, thus activating THP 1 macrophages. 1

PAGE 66

66 monocytes, it was imperative that we test the same concentration in the THP 1 macrophage model. B ased on the absence of increase in cytokine and chemokine protein in unstimulated cells and the ten fold lower concentrations of cytokines and chemokines in culture medium from unstimulated versus stimulated cells, we concluded r or PAC m did not activate THP 1 macrophages. treated and stimulated cells suggests that cranberry does indeed prime THP 1 macro phages. Our findings both agree and disagree with other research involving modulation of cytokine and chemokine production by cranberry in immune cells. Research that is in agreement with our findings that cranberry enhances cytokine and chemokine product ion includes an unpublished in vitro study of cranberry using the HL 60 neutrophil like cell line and an unpublished human dietary intervention study both conducted in our lab. A 24 h incubation of HL 60 neutrophil PAC r and 250 ng secretion into medium that was five fold greater than secretion induced by vehicle control or LPS alone (Muller unpublished). 60 cells were treated with the same PAC r ut ilized in our research, suggesting that cranberry treatments utilized in experiments may have a greater effect on cellular response than differences in innate immune cell type. The physiological relevance of cranberry in boosting immune cell response to se condary challenge was demonstrated in a human dietary intervention previously conducted in our lab. H ealthy subjects consumed 12 fl oz of cranberry beverage or placebo each day for 10 weeks. At baseline and after 10 weeks the concentration s of

PAGE 67

67 cytokines a nd chemokines were measured in culture medium of PBMC stimulated ex vivo with phytohemagglutinin ( PHA ) by 148 pg/mL from baseline to week 10. pg/mL after 10 weeks of beverage consumption. Although five other cytokines were analyzed, including IL 17, IL secretion from baseline to ten weeks between the cranberry and placebo groups was observed (Percival unpubl ished). In contrast to the increases in cytokine and chemokine production seen with LPS challenge in our research, other studies suggest that cranberry attenuates LPS induced cytokine production. Bodet et al investigated the ability of cranberry juice non dialyzable material ( NDM ) with a molecular weight greater than 14,000 to inhibit LPS induced inflammatory cytokine production in the U937 leukemia monoblastic cell line (55) Following a 2 h stimulation with cranberry and subsequent 24 h incubation with L PS derived from five separate sources ( F. nucleatum, P. gingivalis, T. Denticola and T. forsythia ), the concentration s of TNF IL IL 6 and RANTES (regulated upon activation normal T cell expressed and presumably secreted ) in cell supernatants were measured with enzyme linked immunosorbent assay (ELISA). Although reductions in cytokine secretion occurred in cells treated with cranberry and stimulated with LPS, the change was dependent on the type of LPS used as well as the concentration of cranberry NDM. When LPS derived from F. nucleatum was used as the immune cranberry NDM suppressed IL 6 production. The E. coli

PAGE 68

68 O55:B5 LPS. nberry NDM treatment did not prevent LPS induced cytokine production for IL 6 or IL 8 regardless of the LPS source (55) Although the anti inf lammatory e ffect of cranberry on LPS stimulated U937 cells secretion in our research the differences in the results can be explained by a combination of differences in experimental design (55) Primary differences include the removal of medium containing cranberry in our study prior to LPS challenge, utilization of a cranberry concentration one half the concentration used by Bodet e t al, variations in cranberry and LPS treatment times and use of different cell lines. In order to determine the effects initiated by cranberry interaction with the THP 1 cell, we treated cells with cranberry for 6 h, followed by a wash and addition of fre sh medium containing LPS. Bodet et al incubated cells simultaneously with cranberry NDM and LPS (55) Cranberry NDM with a molecular weight >6000 reduces LPS binding to the TLR4/MD2 receptor complex on the surface of HEK293 cells as detected by immunofluor escence (56) Thus, the anti inflammatory effect reported by Bodet et al may be due to an interaction of cranberry with LPS rat her than by a molecular effect induced by cranberry interaction with receptors on the immune cell surface. The composition differences between the cranberry NDM used by Bodet et al and the PAC m and PAC r fractions used in our research could also account for dissimilar cytokine production between the two studies. The NDM used by Bodet et al contained 0 .35% anthocyanins and 65.1% PAC and was void of sugars and organic acids (55) The NDM PAC, sugar and organic acid levels were approximately equivalent to th ose in PAC m; however, the anthocyanin level was closer to the <0.5% found in

PAGE 69

69 PAC r. The fact that cranberry NDM induced different cellular responses than PAC r and PAC dependence of c In order to elucidate the molecular mechanism responsible for t he priming effect seen in PAC r treated cells, we conducted qRT PCR on RNA isolated from THP 1 macrophages treated for 6 h with P AC r, PAC m or vehicle control. PAC r upregulated and MIP mRNA by 1 and 2.5 fold, respectively, compared with vehicle control and PAC m. When actinomycin D was added to cranberry treated THP 1 macrophages, MIP transcripts did not appear to decay over the 3 h time period. In contrast, mRNA decayed with PAC r, PAC m, LPS and DMSO treatment; however, there was no difference in the rate of degradation between vehicle control and PAC r or vehicle control and PAC m treatments. The d ecay rate of is well studied, and the half life in our study of approximately 30 min is within the range of half lives published in the literature (17,57,58) The absence of decay in MIP mRNA in the 3 h post actinomycin D time Using the ARED Organism database which offers a quan titative compilation of AREs in the human, mouse and rat transcriptomes combined with the AREsite database, we found that MIP contains four ATTTA pentamers, while contains nine ATTTA pentamers (59,60) The lower abundance of cis regulatory elements in the MIP that less trans acting regulatory proteins, such as TTP, can bind to the mRNA to promote deadenylation of the poly(A) tail and subsequent mRNA decay (61,62)

PAGE 70

70 The increase in steady state TNF and MIP mRN A abun dance following cranberry treat ment in the absence of alterations in transcript stabilization compared to other treatments could be due to an increase in the rate of transcription MIP and share response elements in their gene promoters for t ranscription factors including NF C/EBP (14) These transcription factors are activated in macrophages and other immune cells by immune stimuli and are capable of initiating the transcriptional activation of and MIP during both early and late phases of an immune cell response (14) In summary, PAC r but not PAC m enhances THP respond to LPS challenge as PAC r treated cells displayed enhanced production of Moreover, this increased cytokine and chemokine production is mediated by a pri ming mechanism involving upregulated steady state mRNA abundance that is independent of and MIP mRNA stability based on the time points used in our experiments.

PAGE 71

71 Table 4 1. qPCR primer s equences Primer Name Primer Sequence MIP Forward CCATGGCTCTCTGCAACCA Reverse GCGGTCGGCGTGTCA Forward GCAGGTCTACTTTGGGATCATTG Reverse GCGTTTGGGAAGGTTGGA RPL37A Forward GGCCTCCCTCCGGAAA Reverse TTGGCGTGCTGGCTGAT Cyclophilin B Forward TGCCATCGCCAAGGAGTAG Reverse CTGCACAGACGGTCACTCAAA

PAGE 72

72 Table 4 2. mRNA r el ative abundance rate of c hange Treatment Relative mRNA / min DMSO 0.0382 0.0093 PAC r 0.0384 0.0047 PAC m 0.0540 0.0117 mRNA levels were normalized to levels of the housekeeping gene Cyclophilin B Rate of change values were ascertained by plotting relative TNF abundance over time, followed by generation of a trendline to derive the slope (relative abundance/min) for each experimental duplicate Values represent mean SD of two independent experiments. Data were analyzed with a one way ANOVA (P<0.05). Table 4 3. MIP mRNA relative abu ndance rate of c hange Treatment Relative MIP mRNA / min DMSO 0.0021 (0.0003 0.0027) PAC r 0.0000 (0.0076 0.0339) PAC m 0.0103 ( 0.0052 0.0023) MIP mRNA levels were normalized to levels of the housekeeping gene Cyclophilin B Rate of change values were ascertained by plotting relative MIP 1 abundance over time, followed by generation of a trendline to derive the slope (relative MIP abundance/min) for each experimental duplicate Values represent median with the range of v alues from two independent experiments.

PAGE 73

73 Figure 4 1 Cranberry did not activate unstimulated THP 1 macrophages. THP 1 r, PAC m, or DMSO for 6 h, followed by 6 h incubation with PBS vehicle control. Cell supernatants were collected and analyzed for cytokines and chemokines using multiplex technology. Values represent mean SD from two independent experiments. *P<0.05, **P<0.01, ***P<0.001

PAGE 74

74 Figure 4 2 PAC r enhance d secretion of MIP from stimulated THP 1 macrophages. THP r, PAC m, or DMSO for 6 h, followed by 6 h incubation with LPS. Cell supernatants were collected and analyzed for cytokines and chemokines using multiplex technology. Value s re present mean SD from two independent experiments. *P<0.05, **P<0.01, ***P<0.001

PAGE 75

75 A B Figure 4 3 Cranberry upregulate d expression of and MIP mRNA. A) mRNA relative abundance. B) MIP mRNA relative abundance. THP 1 m or PAC r or vehicle control. Cellular RNA was isolated and reverse transcribed to cDNA. Quantitative RT PCR was performed on an Applied Biosystem s 7300 RT PCR system. MIP and levels were n ormalized to the average level of two housekeeping genes ( RPL37A and Cyclophilin B ). Data were analyzed with a one way ANOVA and Tukey post hoc analysis. Bars without common letters are significantly different from one another (P<0.05).

PAGE 76

76 Figure 4 4 Cra nberry did not stabilize mRNA. THP 1 macrophages were treated m or PAC r or vehicle control followed by addition Cellular mRNA was isolated at 1, 30, 90 and 180 min post actinomycin D addition and wa s reverse transcribed to cDNA. Quantitative RT PCR was performed on an Applied Biosystem s 7300 RT PCR system. transcript levels are shown relative to housekeeping gene Cyclophilin B Values represent mean SD of two independent experiments.

PAGE 77

77 Fi gure 4 5 MIP mRNA stability was not altered by cranberry. THP 1 macrophages m or PAC Cellular mRNA was isolated at 1, 30, 90 and 180 min post actinomycin D addition and was reverse transcribed to cDNA. Quantitative RT PCR was performed on an Applied Biosystem s 7300 RT PCR system. MIP transcript levels are shown relative to housekeeping gene Cyclophilin B Values represent mean SD of two independent experiments.

PAGE 78

78 CHAPTER 5 COMPLETE TLR4 ACTIVATION IS NOT REQUIRED FOR CRANBERRY INDUCED INCREASES IN MIP AND mRNA Background TLR4 is found on a variety of cell types including mono c y T cells and dendritic cells (8,63) Although TLR4 is the cognate receptor fo r LPS, it is also somewhat promiscuous in comparison to other PRR as it recognizes fibronectin fatty acids and fusion protein from respiratory syncytial virus (9,64,65) Previous research conducted in our lab using the HL 60 human neutrophil like cell line provided evidence that cranberry may also be recognized by TLR4. Treatment of HL 60 cells with cranberry fractions altered levels of the TLR4 signaling protein, IRAK4 (Muller unpublished). As both HL 60 and THP 1 cell lines express TLR4, this PRR was the most logical cell surface receptor for us to investigate. Our primary objective for this set of experiments was to determine if TLR4 mediated the cranberry induced increases in cytokine and chemokine mRNA expression. The activation of TLR4 was first measu red in the HEK line. The ability of cranberry to modulate cytokine and chemokine mRNA levels during priming was then explored with an hTLR4 neutralizing antibody in THP 1 macrophages. HEK to detect human TLR4 activation v ia the transcription factor NF b (66) The HEK 293 cells are co transfected with TLR4 and co receptors CD14/ MD2, along with a secreted embryonic alkaline phosphatase gene. The SEAP gene is fused to the promoter of the pr o inflammatory cytokine gene IL 12 (p40). This promoter contains five binding sites for NF B and AP 1. When TLR4 is activated, the resulting signaling cascade ends in the activation of NF B and AP 1 which then bind to the IL 12 (p40) promoter and indu ce SEAP

PAGE 79

79 production. SEAP production is measured with QUANTI The medium turns blue in the presence of SEAP (66) Materials and Methods HEK HEK htlr4, Invivogen, San Diego, CA) were cu ltured in DMEM (Cat# 10 017 CV, Corning Cellgro, Manassas, VA) supplemented with 50 U/ml penicillin and 50 mg/ml streptomycin (Cat# 1670049, MP Biomedicals, Santa Ana, CA), 1X HEK Blue Selection (Cat# hb sel, Invivogen, San Diego, CA) antibiotics and 10% FBS. The hTLR4 assay was conducted with 70% confluent cells. Cells were detached from the culture flask using PBS warmed to 37C and resuspen d ed at a concentrat ion of 1.4 x 10 5 cells/mL. One suspension was added to a 96 well, flat bottom, tissue culture plate (Cat# 07 200 90 Corning Costar, Manassas, VA). Twenty uL of PAC r, PAC m, LPS from Escherichia coli O 55:B5 ( Cat# L4524; Sigma Aldrich, St. Louis, MO) or DMSO vehicle diluted in medium were added to the 180 uL cell suspens ion. The final concentration of PAC r, PAC The final percentage of DMSO in the culture medium was less than 0.1%. The HEK incubated at 37C for 20 h as described by Invivogen (66) (Cat# rep qb1, Invivogen, San Diego, CA) in a 96 well, flat bottom, tissue culture plate (Cat# 07 200 90 Corning Costar, Manassas, VA). The plate was incubated for 1 h at 37C. Absorbance at 655 nm was read on a SpectraMax 340PC 384 plate reader (Molecular Devices, Sunnyvale, CA).

PAGE 80

80 THP 1 Macrophage and hTLR4 Neutralizing Antibody THP 1 monocytes at 5 x 10 5 cells/mL were plated in 60 mm x 15 mm tissue culture dishes with a total of 3 x 10 6 cells per plate. Cell differentiation was achieved by incubating cells with 100 ng/mL PMA ( Cat# P1585, Sigma Aldrich, St. Louis, MO) for 72 h in a 37C, 5% CO 2 incubator as described by Schwende et al. (51) D ifferentiated cells were washed with 2 mL of 37C PBS. Two mL of RPMI 1640 hTLR4 antibody (Cat# mabg htlr4, Invivogen, San Diego, CA) or an equal volume of sterile water was added in duplicate to cell culture d ishes. Cells were incubated for 1 h in a 37C, 5% CO 2 humidified environment. After the 1 h incubation, 1 mL of RPMI 1640 complete medium containing either PAC r, DMSO vehicle or LPS was added to duplicate cell culture dishes with or without anti hTLR4 a r and 100 ng/mL LPS. The final percentage of DMSO in culture medium was < 0.1%. THP 1 macrophages were incubated with PAC r, DMSO vehicle or LPS treatments for 6 h in a 37C, 5% CO 2 incubator. After incubation, culture medium was aspirated from cells and RNAzol RT (Cat# RN 190, Molecular Research Center, Inc., Cincinnati, OH) was used to isolate RNA. Synthesis of cDNA and qRT PCR were carrie d out as described in Chapter 4. and MIP were normal ized to the single housekeeping gene Cyclophilin B The PAC m cranberry fraction was not used in hTLR4 neutralization experiments as it did not upregulate or MIP steady state mRNA levels in previous experiments. The primary purpose of neutralizing hTLR4 was to determine the role of the receptor in mediating cranberry induced increases in cytokine and chemokine

PAGE 81

81 mRNA. Thus, we focused specifically on PAC r, which displayed the most bioactivity in initial experiments. T he concentration of anti hTLR4 a ntibody and LPS used in the neutralization experiments were determined in a preliminary optimization experiment (see Appendix). Statistical Analysis SigmaPlot versions 11.0 and 12.0 (Systat Software Inc., San Jose, CA) were used for statistical analysis. A bsorbance values from HEK reported as mean SD. Differences between mean absorbance values among treatment groups were tested with a one way ANOVA and a Tukey multiple comparison all pairwise post test. For the hTLR4 neutralization experiments, data were analyzed by comparing the mRNA relative abundance from cells incubated with or without anti hTLR4 antibody in each treatment group (PAC r, DMSO and LPS) using a one way ANOVA and a Tukey post test. Data are reported as mean relative mRNA abundance SD with (P<0.05) considered significant. Results HEK Analysis of absorbance values from HEK way ANOVA revealed that a significant difference (P<0.001) existed between treatment group means (F igure 5 1). The mean absorbance value of supernatants from cells treated with LPS was greater (P<0.001) than for all other treatments based on a Tukey multiple comparison post test, indicating that more SEAP was present in the supernatant of these cells (F igure 5 1). Treatment of cells with PAC r resulted in more

PAGE 82

82 blue color and higher absorbance values of supernatant as compared to medium (P<0.001) and PAC m (P=0.002) treatments. Absorbance values for supernatant from HEK m did not differ (P=0.454) from supernatants from medium treated cells (Figure 5 1). Neutralization of TLR4 in THP 1 Macrophages The involvement of TLR4 in cranberry induced increases in steady state and MIP mRNA abundance s was investigated using an anti hTLR4 neutralizing antibody. For PAC r, neutralization of TLR4 activity with an anti hTLR4 antibody did not attenuate the upregulation of and MIP mRNA (Figure 5 2, panels A and B for and MIP respectively). The ability of the positive control, LPS, to increase and MIP mRNA, however, was significantly reduced (P<0.001 and P<0.05 for and MIP respectively) by hTLR4 neutralization (Figure 5 2, panels A and B for an d MIP respectively). Discussion The objective of our work in this chapte r was to determine if TLR4 plays a role in mediating the upregulated steady state levels of and MIP mRNA induced by cranberry. TLR4 is a pattern recognition receptor that is critical for initiating host responses to LPS, a conserved component of gram negative bacterial cell walls (67,68) When TLR4 is activated, signaling may proceed via either a MyD88 dependent p athway or TRIF dependent pathway (69,70) Signaling via the T RIF pathway ends in translocation of NF 3 into the nucleus, where these proteins induce transcription of type I IFN and proinflammatory cytokine genes (71) Signaling through the MyD88 pathway leads to the translocation of the transcription fact ors NF 1

PAGE 83

83 and IRF 5 into the nucleus with subsequent initiation of transcription of proinflammatory cytokine and chemokine genes, including and MIP (70,72) We used two models, HEK 1 macrophages treated with an anti hTLR4 neutralizing antibody, to determine if cranberry fractions could indeed activate the TLR4 pathway and induce upregulation of steady state and MIP mRNA levels In HEK r treated cells compared to cells treated with PAC m and medium indic ated that PAC r bioactives activated the TLR4 receptor pathway. The degree of activation in the PAC r treated cells, however, was less pronounced than in LPS treated cells. These results support our proposed definition of priming being a subtle response in the cell as compared to an inflammatory state induced by PAMP such as LPS. The absence of a difference in SEAP prod uction in PAC m versus medium treated cells concomitant with greater SEAP production in PAC r treated cells may be due to the approximately 35% lower level of PAC in PAC m compared to PAC r. However, the presence or absence of a single bioactive component or synergy of components in cranberry fractions being responsible for the immune modulating effects in our experiments remains to be investigated. Surprisingly, the use of a TLR4 neutralizing antibody in THP 1 macrophages treated with PAC r did not result in reduced steady state levels of MIP and mRNA In contrast, the ability of LPS to increase MIP and transcript levels was reduced by approximately 34% and 67%, respectively, in the presence of the neutralizing antibody. This magnitude of TN reduction was consistent with preliminary

PAGE 84

84 optimization experiments and demonstrated that the concentration of antibody used was sufficient to reduce TLR4 activation. The seemingly incongruous results from the HEK and TLR4 n eutralization experiment could be due to activation of other PRR pathways that result in increased levels of cytokine and chemokine genes. In addition to TLR4, macrophages and other APC express a host of PRR on their surface, including TLR2, TLR1, TLR6, TL R5 and Dectin 1 (7,70,73) Interestingly, the MyD88 pathway, which is responsible for transcriptional activation of early pro inflammatory cytokine genes including and MIP is shared by all of these receptors (70) PRR work both independently and synergistically via dimerization to modulate immune responses to both microbial components and plant derived substances (74 76) Thus, it is highly probable that cranberry could be activating TLR4 in cells with increases in MIP and mRNA being media ted via activation of an alternate PRR pathway In summary, PAC r did react with the TLR4 receptor in HEK hTLR4 cells However, when TLR4 was neutralized in THP 1 macrophages, MIP and transcript levels should have gone down but did not. Transcript levels did decrease with the LPS p ositive control, so the assay was working properly. PAC r must be interacting with other recept ors on the THP 1 cell surface to induce signaling for chemokin e and cytokine gene transcripti on without specifically needing TLR4 involvement Ou r findings are novel in that to date, no other research has examined the ability of cranberry bioactives to modulate TLR4 receptor signaling and subsequent effects on primin g. Although PAC have been widely studied for their ability to promote an anti inflammatory state or bind pathogen components (56) their potential to modulate

PAGE 85

85 immune cell function prior to pathogen encounter in a manner tha t s abili ty to respond remains a novel field of exploration.

PAGE 86

86 Figure 5 1. PAC r, but not PAC m, activate d hTLR4 signaling pathway. Absorbance values represent SEAP production in HEK Data were analyzed with a one way ANOVA and Tukey post hoc analysis. Values are the mean absorbance SD of two independent experiments. Bars without common letters are significantly different from one another (P<0.05).

PAGE 87

87 A B Figure 5 2. TLR4 neutralization d id not prevent c ranberry induced increases in and MIP mRNA The subpanels represent: abundance and B) MIP THP 1 macrophages were pre hTLR4 neut ralizing antibody, followe d by 6 h incubation with PAC r, vehicle control or LPS. Cellular mRNA was isolated and reverse transcribed to cDNA. Quantitative RT PCR was performed on an Applied Biosystems 7300 RT PCR system. MIP and levels were normalized to the housekeeping gene Cyclophilin B. Data were analyzed with a one way ANOVA and Tukey post hoc analysis. Values represent mean SD of two independent experiments. *P<0.05, ***P<0.001

PAGE 88

88 CHAPTER 6 SUMMARY, FUTURE DIRECTIONS AND CONCLUSION The primary objective of our r esearch was to characterize the priming mechanism in THP 1 cells, a model of innate immune cells. Three specific aims were designed to meet the objective. The Specific Aims were: 1. Characterize the activation state of THP 1 cells in response to increasing co ncentrations of cranberry to determine optimal experimental conditions. 2. Measure the chemokine and cytokine protein and mRNA levels of cranberry treated THP 1cells using the best determined cranberry concentration from Specific Aim 1. 3. Delineate the role of TLR4 in mediating cranberry induced priming by measuring cytokine and chemokine mRNA levels under conditions in which TLR4 is inactivated For the first aim the activation status of THP 1 monocytes in response to 5, 25 r and PAC m was characterized using four measures of activation: percentage of CD14 + CD49a + cells; CD49a expression per cell; CD14 expression per cell; and cytokine and chemokine secretion. Three out of four of the activation experiments suggested that 48 h incubatio r and PAC m were the only time/concentration combinations that did not result in increased cell activation. g/mL concentration was selected as the treatment conditions for all subsequent experiments. For the second specific aim, the molecular changes taking place inside THP 1 cells exposed to cranberry fractions were explored at the mRNA level. The upregulatio n of steady state levels of MIP 1a and TNFa in PAC r treated cells versus vehicle control treated cells, along with the corresponding increase in protein secretion into culture medium, led us to conclude that cranberry primes THP 1 macrophages for a height ened

PAGE 89

89 response to secondary challenge via a mechanism involving increased steady state levels of cytokine and chemokine mRNA. For the third specific aim the final portion of our central hypothesis that cranberry bioactives enhance responsiveness of THP 1 macrophages challenged with LPS via TLR4 was tested. Two models, HEK Blue hTLR4 cells and THP 1 macrophages with a neutralizing anti TLR4 antibody, were used to determine if TLR4 plays a role in priming. Although PAC r increased TLR4 activation in HEK Blu e cells, use of the TLR4 neutralizing antibody in THP 1 macrophages treated with PAC r did not depress steady state levels of MIP and mRNA. Thus, TLR4 is not required for cranberry induced THP 1 cell priming and subsequent increases in MIP 1a and TNFa mRNA. T LR 2, TLR1, TLR6, TLR5 and Dectin 1 are other cell surface receptors that could potentially be responsible for cranberry induced priming. Activation of these PRR can lead to transcriptional activation of MIP 1a TNFa and other pro inflammatory cytokine and chemokine genes (7,70,73) It is of interest to note that in experiments measuring steady state mRNA and SEAP levels, the magnitude of the i ncrease in these parameters were significantly less in PAC r treated cells than in LPS treated cells. The lower level of increase in mRNA and SEAP suggests that cranberry not only primes cells, but that this priming is a subtle response from the cell. Thus our definition of p riming in innate immune cells being a subtle response is consistent with the novel concept of priming proposed by Jutila et al (33,36,77) In synthesizing experimental results from chapters 3 5, it must be noted that PAC r had more eff icacy as a priming agent in THP 1 macrophages than PAC m.

PAGE 90

90 Although the specific component in the cranberry fractions was not investigated, the fact that PAC r contained ~35% more PAC than PAC m suggests that the greater efficacy of PAC r may be due to high er levels of PAC. Other differences between PAC r and PAC m compositions were present. PAC m had 4.5 times more flavonols, 12 times more anthocyanins and 5 times more phenolic acids than PAC r. Although the possibility exists that the difference in bio activity between PAC m and PAC r was due to lower levels of flavonols, anthocyanins and phenolic acids in PAC r, the minimal level of these compounds is not likely to stimulate increases in cytokine and chemokine mRNA and protein. Future resear ch should be targeted primarily toward investigating the cranberry fraction component(s) responsible for the priming of THP 1 macrophages and identifying the mechanism responsible for increased steady state transcript abundance. Delineation of the bioactiv e component(s) in the cranberry fractions could be investigated by treating THP 1 cells with proanthocyanidin, flavonol and anthocyanin standards separately and in combination at levels present in PAC r and PAC m. Cellular RNA could then be harvested, reve rse transcribed to cDNA, and MIP and transcripts analyzed by qRT PCR. Increases in steady state mRNA abundance can be due to either enhanced mRNA stability or an increased rate of transcription. As PAC r and PAC m did not alter TNFa and MIP 1a transcript stability, future experiments could incorporate one of two different methods for measuring the transcription rate. These two methods are nuclear run on assays and qRT PCR utilizing primers specific for heterogeneous nuclear RNA (hnRNA). Nuclear run on assays measure frequency of transcription initiation via a

PAGE 91

91 series of steps including cell nuclei isolation, RNA polymerase pausing and incubation triphosphates (UTP) (7 8) No new transcripts are synthesized during cell nuclei incubation with NTP and radiolabeled UTP. The NTP and radiolabeled UTP, instead, are incorporated into transcripts being synthesized at the time of polymerase pausing. The nascent transcripts contai ning radiolabeled UTP are conjectured to be proportionate to the frequency of transcription initiation (78) Quantitative RT PCR analysis of hnRNA is a surrogate method for nuclear run on assays and is advantageous in that it does not require use of radioa ctive reagents (79) Heterogeneous nuclear RNA is a short lived, transcriptional intermediate that can be further processed to mRNA (80) By using primers that span the intron and extro n regions, analysis of hnRNA with qRT PCR has been used successfully in both cell culture and animal studies as a reliable, sensitive index of transcription rate (79,81) No research study is without limitations. The primary limitation of our research is that it is an in vitro study utilizing a single cell type as a model. Although cell culture studies are valuable in that they allow for greater control over experimental conditions, which facilitate the discovery of mechanisms responsible for results seen in human and animal studies, they do not fully recapitulate and reflect what occurs in higher organisms. We are, however, in the process of completing a human dietary intervention study in which the role of cranberry in modulating subsets of monocytic cell populations and MIP state cytokine and chemokine mRNA abundance and protein secretion from PBMC.

PAGE 92

92 A second limitation of our research is that it utilizes only a single cranberry f raction concentration and time point. Although this time and concentration were carefully selected based on our experimental results, the literature and unpublished research previously conducted in our lab, modification of the cranberry fraction concentrat ion and time may yield different results. Although limitations exist in our research, our study also possesses strengths. Use of the bacterial c ell wall component, LPS, is one strength as LPS more closely mimics a pathogen challenge as compared to plant derived mitogens. Another strength physiologically relevant cranberry fraction concentration. In a dietary intervention study in pregnant women, 240 mL of cranberry beverag e c ontaining 80 mg PAC was consumed twice daily for three days and bioactive effects were noted (30) Moreover, the absorption of PAC following cranberry consumption has been suggested in humans in two different studies utilizing differentiated CaCo 2 cells (82,83) Ou e t al found that procyanidin dimer A2 and A type trimers and tetramers traversed the CaCo 2 cell monolayer with ratios of 0.6%, 0.4%, and 0.2%, respectively (82) In a second study, a small percentage of B type PAC dimers and trimers were also capable of cr ossing the Caco 2 cell monolayer (83) Although the absorption of PAC and other polyphenols may be minimal, there are other routes whereby these compounds may alter immune cell function. Bioactive components in cranberry could be sampled from the luminal milieu via transcytosis in M cells. The M cells deliver antigens to B cells and macrophages and dendritic cells, which are innate immune cells (84)

PAGE 93

93 In summary, PAC r, but not PAC m, primes THP 1 macrophages for an enhanced response to secondary challenge with LPS via a mechanism involving increased steady state levels of MIP 1a and TNFa transcripts This increase in steady state transcripts appears to be independent of transcript stability. The significance of our findings is that we have discovered one mechanism whereby cranberry bioactives can modulate innate immune cell function in preparation for an immune challenge. By having increased levels of cytokine and chemokine transcri pts already present in the cell when a pathogen breaches the immune barrier, innate immune cells would be able to produce a greater abundance of cytokine and chemokine proteins within a set time period to attract and activate other immune cells. Thus, the immune system could react more rapidly than if lower levels of transcripts were present at the time of immune challenge. We have indeed demonstrated the ability of cranberry to boost the THP 1 cell response to a bacterial component. The subsequent effects that cranberry may have on the overall immune system response time and reduction in symptoms and duration of illnesses such as cold, flu and food borne illnesses, remains to be fully elucidated.

PAGE 94

94 APPENDIX OPTIMIZATION OF ANTI TLR4 ANTIBODY CONCEN TRATION To determine what concentration of anti TLR4 neutralizing antibody to use in experiments investigating the role of TLR4 in cranberry induced priming, a preliminary optimization experiment was performed. THP 1 macrophages were treated for 1 h in a 37C, 5% CO2 incubator with 2 mL hTLR4 antibody (Cat# mabg htlr4, Invivogen, San Diego, CA) or an equivalent volume of sterile water. After 1 h, 1 mL of RPMI 1640 complete medium containing either ng/mL LPS or vehicle was added to cells. Culture dishes were returned to a 37C, 5% CO 2 incubator for 6 h. Culture medium was then removed and RNAzol RT (Cat# RN 190, Molecular Research Center, Inc., Cincinnati, OH) was used to i solate RNA from cells. Synthesis of cDNA and qRT PCR were carrie d out as described in Chapter 4. T was normalized to the single housekeeping gene Cyclophilin B stimulated relative abundanc 1 macrophages stimulated with 10 and 100 ng/mL LPS (Table A 1 and Figure A 1) Therefore

PAGE 95

95 Table A 1. Percentage of change in r elative TNF mRNA a bundance LPS (ng/mL) Anti hTLR4 Antibody ( g/mL) % Change in Relative TNF mRNA Abundance 1000 1 31.4 1000 0.5 134.8 1000 0 0.0 100 1 28.4 100 0.5 20 .8 100 0 0.0 10 1 35.6 10 0.5 26.0 10 0 0.0 mRNA levels were normalized to levels of the housekeeping gene Cyclophilin B The percent change in mRNA abundance was calculated relative to the abundance in THP 1 macrophages stimulated with an equivalent concentration of LPS but without TLR4 neutr alization. Values represent mean of treatment duplicates

PAGE 96

96 Figure A 1. mRNA abundance following TLR4 neutralization and LPS stimulation. THP anti hTLR4 antibody or sterile water follow 100 ng/mL or 10 ng/mL LPS or vehicle. Cellular RNA was isolated and r everse transcribed to cDNA. Quantitative RT PCR was performed on an Applied Biosystem s 7300 RT PCR system. transcript levels are shown relative to housekeeping gene Cyclophilin B Values represent mean of treatment duplicates.

PAGE 97

97 LIST OF REFERENCES 1. Kindt TJ, Goldsby RA, Osborne BA. 6th ed. New York: W.H. Freeman and Company; 2007. 2. van FR, Cohn ZA. The origin and kinetics of mononuclear phagocytes. J Exp Med. 1968;128:415 35. 3. Gordon S, Taylor PR. Monocyte and macrophage heter ogeneity. Nat Rev Immunol. 2005 ;5:953 64. 4. Ebert R.H., Florey H.W. The extravascular development of the monocyte observed in vivo. Br J Exp Pathol. 1939:342 56. 5. Takashiba S, Van Dyke TE, Amar S, Murayama Y, Soskolne AW, Shapira L. Differentiation of monocytes to macr ophages primes cells for lipopolysaccharide stimulation via accumulation of cytoplasmic nuclear factor kappaB. Infect Immun. 1999 Nov;67:5573 8. 6. Akira S, Takeda K. Toll like receptor signa lling. Nat Rev Immunol. 2004 ;4:499 511. 7. Kawai T, Akira S. Th e role of pattern recognition receptors in innate immunity: update on Toll like receptors. Nat Immunol. 2010;11:373 84. 8. Medzhitov R, Preston Hurlburt P, Janeway CA, Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive imm unity. Nature. 1997 ; 24;388:394 7. 9. Poltorak A, He X, Smirnova I, Liu MY, Huffel CV, Du X, Birdwell D, Alejos E, Silva M, et al. Defective LPS s ignaling in C3H/HeJ and C57BL/10ScCr m ice: m utations in Tlr4 g ene. Science. 1998;282:2085 8. 10. Kawai T, Aki ra S. Toll like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity. 2011;34:637 50. 11. Kawai T, Adachi O, Ogawa T, Takeda K, Akira S. Unresponsiveness of MyD88 deficient mice to endotoxin. Immunity. 1999;11:115 22. 12. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: The multistep paradigm. Cell. 1994;76:301 14. 13. Kawai T, Akira S. TLR signaling. Cell Death Differ. 2006;13:816 25. 14. Medzhitov R, Horng T. Transcriptional control of the inflammatory response. Nat Rev Immunol. 2009;9:692 703.

PAGE 98

98 15. Caput D, Beutler B, Hartog K, Thayer R, Brown Shimer S, Cerami A. Identification of a common nucleotide sequence in the 3' untranslated region of mRNA molecules specifying inflammatory mediators. Proc Natl Acad Sci U S A. 1986;83:1670 4. 16. Zhang T, Kruys V, Huez G, Gueydan C. AU rich element mediated translational control: complexity and multiple activities of trans activating f actors. Bioche m Soc Trans. 2002; 30:952 8. 17. Hao S, Baltimore D. The stability of mRNA influences the temporal order of the induction of genes encoding inflammatory molecules. Nat Immunol. 2009;10:281 8. 18. U.S.Department of Agriculture NASS. USDA Noncitrus Fruits a nd Nuts 2011 Preliminary Summary. 2012 Mar. 19. Pappas E, Schaich KM. Phytochemicals of cranberries and cranberry products: characterization, potential health effects, and processing stability. Crit Rev Food Sci Nutr. 2009;49:741 81. 20. U.S.Department of Agriculture ARS. USDA Database for the Flavonoid Content o f Selected Foods, Release 3.0. 2011 Sep. 21. Harnly JM, Doherty RF, Beecher GR, Holden JM, Haytowitz DB, Bhagwat S, Gebhardt S. Flavonoid c ontent of U.S. f ruits, v egetables, and n uts. J Agric Food Chem. 2006;54:9966 77. 22. Wu X, Beecher GR, Holden JM, Haytowitz DB, Gebhardt S E, Prior RL. Concentrations of a nthocyanins in c ommon f oods in the United States and e stimation of n ormal c onsumption. J Agric Food Chem. 2006;54:4069 75. 23. G u L, Kelm MA, Hammerstone JF, Beecher G, Holden J, Haytowitz D, Gebhardt S, Prior RL. Concentrations of proanthocyanidins in common foods and estimations of normal consumption. J Nutr. 2004 Mar;134:613 7. 24. Gu L, Kelm MA, Hammerstone JF, Beecher G, Hold en J, Haytowitz D, Prior RL. Screening of f oods c ontaining p roanthocyanidins and t heir s tructural c haracterization u sing LC MS/MS and t hiolytic d egradation. J Agric Food Chem. 2003;51:7513 21. 25. Cote J, Caillet S, Doyon G, Sylvain JF, Lacroix M. Bioacti ve compounds in cranberries and their biological properties. Crit Rev Food Sci Nutr. 2010;50:666 79. 26. Han CH, Kim SH, Kang SH, Shin OR, Lee HK, Kim HJ, Cho YH. Protective effects of cranberries on infection induced oxidative renal damage in a rabbit mo del of vesico ureteric reflux. BJU Int. 2007;100:1172 5.

PAGE 99

99 27. Li J, Kudsk KA, Gocinski B, Dent D, Glezer J, Langkamp Henken B. Effects of parenteral and enteral nutrition on gut associated lymphoid tissue. J Trauma. 1995 ;39(1):44 51. 28. Sano YF, Gomez FE Kang W, Lan J, Maeshima Y, Hermsen JL Ueno C, Kudsk KA. Intestinal polymeric immunoglobulin receptor is affected by type and route of nutrition. J Parenter Enteral Nutr. 2007 ;31(5):351 6. 29. Pierre JF Heneghan AF Feliciano RP, Shanmuganayagam DF, Kr ueger CG Reed JD Kudsk KA. Cranberry proanthocyanidins improve i ntestinal s IgA during elemental e n teral n utrition. J Parenter Enteral Nutr. 2013 Jan 28. [ cited 2013 February 20 ] ; Available from: http://pen.sagepub.com/content/early/2013/01/25/0148607112473654.long 30. Wing DA, Rumney PJ, Leu SY, Zaldivar F. Comparison of urinary cytokines after ingestion of cranberry juice cocktail in pregnant subjects: a pilot study. Am J P erinatol. 2010 ;27:137 42. 31. Hochman N, Houri Haddad Y, Koblinski J, Wahl L, Roniger M, Bar Sinai A, Weiss EI, Hochman J. Cranberry juice constituents impair lymphoma growth and augment the generation of antilymphoma antibodies in syngeneic mice. Nutr Cancer. 2008;60:511 7. 32. Jass J, Reid G. Effect of cranberry drink on bacterial adhesion in vitro and vaginal microbiota in healthy females. Can J Urol. 2009;16:4901 7. 33. Jutila MA, Holderness J, Graff JC, Hedges JF. Antigen independent priming: a transitional response of bovine gammadelta T cells to infection. Anim Health Res Rev. 2008;9:47 57. 34. Holderness J, Jackiw L, Kimmel E, Kerns H, Radke M, Hedges JF, Petrie C, McCurley P, Glee PM, et al. Select plant tannins induce IL 2Ralpha up regulation and augment cell divis ion in gammadelta T cells. J Immunol. 2007;179:6468 78. 35. Graff JC, Jutila MA. Differential regulation of CD11b on gammadelta T cells and monocytes in response to unripe apple polyphenols. J Leukoc Biol. 2007;82:603 7. 36. Daughenbaugh KF, Holderness J Graff JC, Hedges JF, Freedman B, Graff JW, Jutila MA. Contribution of transcript stability to a conserved procyanidin induced cytokine response in gammadelta T cells. Genes Immun. 2011 ;12(5):378 89 37. Khabar KS. The AU rich transcriptome: more than in terferons and cytokines, and its role in disease. J Interferon Cytokine Res. 2005;25:1 10.

PAGE 100

100 38. Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T, Tada K. Establishment and characterization of a human acute monocytic leukemia cell line (THP 1). Int J Cancer. 1980;26:171 6. 39. Auwerx J. The human leukemia cell line, THP 1: a multifacetted model for the study of monocyte macrophage differentiation. Experientia. 1991;47:22 31. 40. ntal Szalmas PF, Strijp JA FAU, Weersink AJ FAU, Verhoef JF, Van Kessel KP. Quantitation of surface CD14 on human monocytes and neutrophils. J Leukoc Biol. 1997;61(6):721 8. 41. Tsuchiya S, Kobayashi Y, Goto Y, Okumura H, Nakae S, Konno T, Tada K. Inducti on of maturation in cultured human monocytic leukemia cells by a phorbol diester. Cancer Res. 1982;42:1530 6. 42. National Institute of Allergy and Infectious Diseases. Common cold. 2011 Jul 7. 43. Bramley TJ, Lerner D, Sames M. Productivity losses rel ated to the common cold. J Occup Environ Med. 2002;44:822 9. 44. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, Jones JL, Griffin PM. Foodborne illness acquired in the United States -major pathogens. Emerg Infect Dis. 2011 ; 17:7 15. 45. Ziegler Heitbrock HW Ulevitch RJ. CD14: cell surface receptor and differentiation marker. Immunol Today. 1993 ;14(3):121 5. 46. Marcos V, Latzin P, Hector A, Sonanini S, Hoffmann F, Lacher MF, Koller B, Bufler P, Nicolai T, Hartl D, et al. Expression, r egulation and clinical significance of soluble and membrane CD14 receptors in pediatric inflammatory lung diseases. Respir Res. 2010 ;11:32. 47. Labeta MO, Durieux JJ, Spagnoli G, Fernandez N, Wijdenes J, Herrmann R. CD14 and tolerance to lipopolysaccharid e: biochemical and functional analysis. Immunology. 1993;80:415 23. 48. American Type Culture Collection. Product Information Sheet for ATCC TIB [cited 2012 May 15]; Available from: http://www.atcc.org/Products/All/TIB 202.aspx 49. Chanput W, M es J, Vreeburg RA, Savelkoul HF, Wichers HJ. Transcription profiles of LPS stimulated THP 1 monocytes and macrophages: a tool to study inflammation modulating effects of food derived compounds. Food Funct. 2010 ;1:254 61.

PAGE 101

101 50. Stumpo DJ, Lai WS, Blackshear PJ. Inflammation: cytokines and RNA based regulation. WIREs RNA. 2010;1:60 80. 51. Schwende H, Fitzke E, Ambs P, Dieter P. Differences in the state of differentiation of THP 1 cells induced by phorbol ester and 1,25 dihydroxyvitamin D3. Jou rnal of Leukocyte Biology. 1996 ;59:555 61. 52. Maess MB, Sendelbach S, Lorkowski S. Selection of reliable reference genes during THP 1 monocyte differentiation into macrophages. BMC Mol Biol. 2010;11:90. 53. Cao XM, Luo XG, Liang JH, Zhang C, Meng XP, Guo DW. Cr itical selection of internal control genes for quantitative real time RT PCR studies in lipopolysaccharide stimulated human THP 1 and K562 cells. B iochem Biophys Res Commun. 2012 ;427:366 72. 54. Rattenbacher BF, Bohjanen PR. Evaluating posttranscriptional regulation of cytokine genes. Methods Mol Biol. 2012;820:71 89. 55. Bodet C, Chandad F Grenier D. Anti inflammatory activity of a h igh molecular weight cranberry fraction on macrophages stimulated by lipopolysaccharides from p eriodontopathogens. Journal of Dental Research. 2006;85:235 9. 56. Delehanty JB, Johnson BJ, Hickey TE, Pons T, Ligler FS. Binding and neutralization of lipopolysaccharides by plant proanth ocyanidins. J Nat Prod. 2007 ;70:1718 24. 57. Deleault KM, Skinner SJ, Brooks SA. Tristetrapr olin regulates TNF TNF alpha mRNA stability via a proteasome dependent mechanism involving the combined action of the ERK and p38 pathways. Mol Immunol. 2008;45:13 24. 58. Mijatovic T, Houzet L, Defrance P, Droogmans L, Huez G, Kruys V. Tumor necrosis fac tor alpha mRNA remains unstable and hypoadenylated upon stimulation of macrophages by lipopolysaccharides. Eur J Biochem. 2000;267(19):6004 12. 59. Halees AS, El Badrawi R, Khabar KS. ARED Organism: expansion of ARED reveals AU rich element cluster variat ions between human and mouse. Nucleic Acids Res. 2008 ;36:D137 40. 60. Gruber AR, Fallmann J, Kratochvill F, Kovarik P, Hofacker IL. AREsite: a database for the comprehensive investigation of AU rich elements. Nucleic Acids Res. 2011 ;39 : D66 9. 61. Palanis amy V, Jakymiw A, Van Tubergen EA, Silva NJ Ki rkwood KL. Control of cytokine mRNA expression by RNA binding proteins and microRNAs. J Dent Res. 2012;91(7):651 8.

PAGE 102

102 62. Kang JG, Amar MJ, Remaley AT, Kwon JF, Blackshear PJ, Wang PY Hwang PM. Zinc finger pro tein tristetraprolin interacts with CCL3 mRNA and regulates tissue inflammation. J Immunol. 2011 ;187(5):2696 701 63. Cui YF, Kang LF, Cui LF, He W. Human gammadelta T cell recognition of lipid A is predominately presented by CD1b or CD1c on dendritic cel ls. Biol Direct. 2009;4:47 64. Shi H, Kokoeva MV Inouye K, Tzameli I, Yin H, Flier JS. TLR4 links innate immunity and fatty acid induced insulin resistance. J Clin Invest. 2006 ;116(11):3015 25 65. Okamura Y, Watari M, Jerud ES, Young DW, Ishizaka ST, Ro se J, Chow JC, Strauss JF, III. The extra domain A of fibronectin activates Toll like receptor 4. J Biol Chem. 2001;276:10229 33. 66. InvivoGen. HEK hTLR4 Cells [cited 2012 November 1st]; Available from: http://www.invivogen.com/hek blue htlr4 67. Chow JC, Young DW, Golenbock DT, Christ WJ, Gusovsky F. Toll like receptor 4 mediates lipopolysaccharide induced signal transduction. J Biol Chem. 1999;274:10689 92. 68. Hoshino K, Takeuchi O, Kawai T, Sanjo H, Ogawa T, Takeda Y, Takeda K, Akira S. C utting edge: Toll like receptor 4 (TLR4) deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps ge ne product. J Immunol. 1999 ;162:3749 52. 69. Guha M, Mackman N. LPS induction of gene expression in human monoc ytes. Cellular Signalling. 2001 ;13:85 94. 70. Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell. 2006;124:783 801. 71. Gonzalez Navajas JM Lee J, David M, Raz E. Immunomodulatory functions of type I interferons. Nat Rev Immunol. 2012;12 (2):125 35. 72. Takaoka A, Yanai H, Kondo S Duncan G, Negishi H, Mizutani T, Kano S, Honda K Ohba Y, Mak TW, et al. Integral role of IRF 5 in the gene induction programme activated by Toll like receptors. Nature. 2005 ;434(7030):243 9. 73. Kumar H, Kawa i T, Akira S. Pathogen recognition in the innate immune resp onse. Biochem J. 2009 ;420:1 16. 74. Ferwerda G, Meyer Wentrup F, Kullberg BJ, Netea MG A dema GJ. Dectin 1 synergizes with TLR2 and TLR4 for cytokine production in human primary monocytes and mac rophages. Cell Microbiol. 2008;10(10):2058 66.

PAGE 103

103 75. Brown GD, Herre J, Williams DL, Willment JA, Marshall AS, Gordon S. Dectin 1 mediates the biological effects of beta glucans. J Exp Med 2003 ;197(9):1119 2. 76. Medzhitov R. Toll like receptors and innat e immunity. N at Rev Immunol. 2001 ;1(2):135 45. 77. Holderness J, Hedges JF, Daughenbaugh K, Kimmel E, Graff J, Freedman B, Jutil a MA. Response of gammadelta T c ells to plant derived tannins. Crit Rev Immunol. 2008;28:377 402. 78. Smale ST. Nuclear run on assay. Cold Spring Harb Protoc. 2009 ;11:1 7. 79. Elferink CJ, Reiners JJ Jr. Quantitative RT PCR on CYP1A1 heterogeneous nuclear RNA: a surrogate for the in vitro transcription run on assay. Biotechniques. 1996 ;20(3):470 7. 80. Lodish H, Berk A, Kaiser CA, Kreiger M, Scott MP, Bretscher A, Ploegh H. Molecular Cell Biology. Sixth ed. New York: W.H. Freeman and Company; 2008. 81. Aydemir F, Jenkitkasemwon g S, Gulec S, Knutson MD. Iron loading increases ferroportin heterogeneous nuclear RNA and mRNA l e vels in murine J774 m acrophages. J N utr. 2009 ;139:434 8. 82. Ou K, Percival SS, Zou T, Khoo C, Gu L. Transport of cranberry A type procyanidin dimers, trimers, and tetramers across monolayers of human intestinal epithelial Caco 2 cells. J Agric Food Chem. 2012 ;60:1390 6. 83. Deprez S, Mila IF, Huneau JF, Tome DF, Scalbert A. Transport of proanthocyanidin dimer, trimer, and polymer across monolayers of human intestinal epithelial Caco 2 cells. Antiox Redox Signal. 2001 ;3(6):957 67. 84. Shanahan F V. Mechanisms of immunologic sensation of intestinal contents. Am J Physiol Gastrointest Liver Physiol 2000; 278:G191 G196.

PAGE 104

104 BIOGRAPHICAL SKETCH Rebecca Anne Creasy was born in 1985 and raised in Denmark, Georgia. She grew up on a small farm and developed a passion for agriculture. Rebecca attended Brooklet Elementary School and Southeast Bulloch High School, both in Brooklet, Georgia. Her love of learning, agriculture, and innate curiosity led her to pursue a Bachelor of Science in Agriculture (B.S.A) degree with a major in Food Science and a minor in Nutrition Science at The University of Georgia beginning in the fall of 2003. Upon receiving her B.S.A. in December 2007, Rebecca spent six months working as a researcher on nutrient stability and sensory properties of foods packaged in a nitrogen atmos phere at The University of Georgia. She also delved into the fitness field working at a fitness center while also earning her personal trainer certification from the National Strength and Conditioning Association. In July of 2008, Rebecca began her pursui t of a Ph.D. in Food Science and Human Nutrition at the University of Florida so that she could further her understanding of the intimate relationship between food and nutrition sciences. After her first year of graduate studies, Rebecca was accepted into the lab of Dr. Susan S. Percival. Her research project focused on the role of cranberry in boosting human immune function. Rebecca graduated with her Doctor of Philosophy in Food Science and Human Nutrition and a minor in Agricultural Education and Commun ication from the College of Agricultural and Life Sciences in the spring of 2013. Her future plans are to utilize the gifts and knowledge God has given her to improve the lives of others.