<%BANNER%>

ROS Scavengers Affect Plant Reproduction

Permanent Link: http://ufdc.ufl.edu/UFE0045376/00001

Material Information

Title: ROS Scavengers Affect Plant Reproduction
Physical Description: 1 online resource (113 p.)
Language: english
Creator: Wang, Yaying
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: arabidopsis -- peroxidases -- soybean -- stress
Biology -- Dissertations, Academic -- UF
Genre: Botany thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Reactive oxygen species (ROS) can act as redox signaling molecules or destructive reagents. While many environmental stresses promote ROS synthesis, ROS scavengers neutralize those toxic molecules and protect plants from cellular damage and programmed cell death that are caused by high ROS accumulation. In this study, a group of ROS scavengers, whose expression in pistils significantly changed following salt stress, was investigated to understand their roles in reproduction. Loss-of-function mutants for these three ROS-scavenging genes were characterized. The results indicated three cytosolic class III peroxidases (PER17, 28, and 29) that were primarily expressed in pistils all modulate ROS metabolism and ovule abortion. In contrast, ASCORBATE PEROXIDASE4 (APX4), a class I peroxidase, did not affect fertility in Arabidopsis. Instead, this locus regulated seedling growth and seed vigor. To investigate whether enhanced ROS-scavenging capacity can counteract physiological changes under environmental stress, PER17, 28, and 29 transgenes were transformed into and expressed in Arabidopsis and soybean plants. The phenotypes of these transgenic plants were evaluated. This study demonstrated these ROS scavengers regulate ROS metabolism and play important roles in plant reproduction.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yaying Wang.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Hauser, Bernard A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045376:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045376/00001

Material Information

Title: ROS Scavengers Affect Plant Reproduction
Physical Description: 1 online resource (113 p.)
Language: english
Creator: Wang, Yaying
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: arabidopsis -- peroxidases -- soybean -- stress
Biology -- Dissertations, Academic -- UF
Genre: Botany thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Reactive oxygen species (ROS) can act as redox signaling molecules or destructive reagents. While many environmental stresses promote ROS synthesis, ROS scavengers neutralize those toxic molecules and protect plants from cellular damage and programmed cell death that are caused by high ROS accumulation. In this study, a group of ROS scavengers, whose expression in pistils significantly changed following salt stress, was investigated to understand their roles in reproduction. Loss-of-function mutants for these three ROS-scavenging genes were characterized. The results indicated three cytosolic class III peroxidases (PER17, 28, and 29) that were primarily expressed in pistils all modulate ROS metabolism and ovule abortion. In contrast, ASCORBATE PEROXIDASE4 (APX4), a class I peroxidase, did not affect fertility in Arabidopsis. Instead, this locus regulated seedling growth and seed vigor. To investigate whether enhanced ROS-scavenging capacity can counteract physiological changes under environmental stress, PER17, 28, and 29 transgenes were transformed into and expressed in Arabidopsis and soybean plants. The phenotypes of these transgenic plants were evaluated. This study demonstrated these ROS scavengers regulate ROS metabolism and play important roles in plant reproduction.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yaying Wang.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Hauser, Bernard A.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045376:00001


This item has the following downloads:


Full Text

PAGE 1

1 ROS SCAVENGERS AFFECT PLANT REPRODUCTION By YA YING WANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Y a Ying Wang

PAGE 3

3 T o my dearest parents and people who helped to make this work possible

PAGE 4

4 ACKNOWLEDGMENTS I enthusiastically thank my supervisor, Dr. Bernard Hauser, for his support and guidance throughout the course of my research and dissertation He is not only a wonderful mentor but also a caring friend to me while I am at UF. I sincerely thank my committee members, Dr s. Al ice Harmon, Kenneth Boote, Charles Guy, and Mark Settles, f or their enthusiasm and insightful ideas in enzymatic analyses, reproductive physiology, gene regulation and genetic analyses I also thank current and former members of the Hauser lab (Yuan Zhou, Logan Peoples, Amanda Hecker, Fariann Amin, Alexi Runnels, Kristina Swansons, and Sondra Ionescu) for assistance with assays, camaraderie and collaboration on joint projects. The researchers in Agricultural Research Service at the USDA (Dr. Hartwell Allen, Dr. Lingxiao Zhang, John Truett, Maritza Romero, and Barth Gervelis) designed and monitored our state of the art growth facilities and helped with the large scale soybean harvests In addition, I would like to thank the late Dr. George Casella UF Dep ar t ment of Statistics for his advice on statistical analyses Dr. Ning Hui Cheng of Baylor College of Medi cine generously donated the DsRed con struct. I thank Dr s Marta Wayne Keith Choe and David Julian for the use of their lab equipment. Dr. Zhengui Zheng shared his expertise and insights with in situ hybridization. Without the help of all of these individuals, t his work would not have been possible. I would not have been able to complete my studies without balance between my academic endeavors and persona l life Therefore, I acknowledge my friends in Taiwan and in Gainesville for all the ir support and encouragement; needless to say, special thanks should be given to friends in Gainesville for their company and help. Last, but not least, I thank my parents and family members for their endless support, understanding and love

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURE S ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 GENERAL INTRODUCTION ................................ ................................ .................. 12 Stress Affects Seed Development ................................ ................................ .......... 12 The Role and Generation of ROS in Plants ................................ ............................ 15 ROS Scavenging Mechanism ................................ ................................ ................. 17 Stress and ROS Signaling ................................ ................................ ...................... 19 Enhance ROS Scavenging Capacity by Over expressing ROS Scavengers .......... 20 Objectives and Organization of This Dissertation ................................ ................... 21 2 peroxidase 17 28 AND 29 LOST OF FUNCTION INCREASE OVULE ABORTION IN ARABIDOPSIS ................................ ................................ ............... 24 Background ................................ ................................ ................................ ............. 24 Material and Methods ................................ ................................ ............................. 27 Plant Material ................................ ................................ ................................ ... 27 Statistics ................................ ................................ ................................ ........... 28 RNA Expression ................................ ................................ ............................... 28 ROS Accumulati on ................................ ................................ ........................... 29 H 2 O 2 Detection ................................ ................................ ................................ 29 Localization of GFP Translational Fusion Proteins ................................ ........... 30 Results ................................ ................................ ................................ .................... 31 Increased Ovule Abortion Rate in Peroxidase Mutants ................................ .... 31 ROS Buildup Correlates to Ovule Abortion Rate ................................ .............. 32 Generation of H 2 O 2 Contributes to ROS Accumulation ................................ .... 32 Expression and Sub cellular Localization of Peroxidases ................................ 33 Discussion ................................ ................................ ................................ .............. 33 Superoxide Dismutase (FSD2) ................................ ................................ ......... 34 Ascorbate Peroxidase (APX4) ................................ ................................ .......... 35 Cytosolic Class III Peroxidases ................................ ................................ ........ 35 Summary ................................ ................................ ................................ ................ 37 3 HETEROLOGOUS EXPRESSION OF PER17 28 AND 29 IN ARABIDOPSIS AND SOYBEAN ................................ ................................ ................................ ...... 47

PAGE 6

6 Background ................................ ................................ ................................ ............. 47 Materials and Methods ................................ ................................ ............................ 48 Constr ucts ................................ ................................ ................................ ........ 48 Plant Materials ................................ ................................ ................................ .. 48 Reverse Transcription PCR (RT PCR) ................................ ............................. 49 Immunobloting ................................ ................................ ................................ .. 50 Results and Discussion ................................ ................................ ........................... 51 Ectopic Expression of PER17 in Arabidopsis ................................ ................... 51 Ectopic Expression of PER28 in Arabidopsis ................................ ................... 52 Ectopic Expression of PER29 in Arabidopsis ................................ ................... 54 Responses of Wild type Soybean Plants to Heat Stress ................................ .. 55 Heterologous Expression of PER17 in Soybean ................................ .............. 56 Heterologous Expression of PER28 in Soybean ................................ .............. 57 Heterologous Expression of PER29 in Soybean ................................ .............. 58 Summary ................................ ................................ ................................ ................ 59 4 THE APX4 LOCUS REGULATES SEED VIGOR AND SEEDLING GROWTH IN ARABIDOPSIS ................................ ................................ ................................ ....... 70 Background ................................ ................................ ................................ ............. 70 Materials and Meth ods ................................ ................................ ............................ 73 Plant Material ................................ ................................ ................................ ... 73 Germination Test ................................ ................................ .............................. 73 Seed Viabili ty and Seedling Growth ................................ ................................ 73 Pigment Extraction ................................ ................................ ........................... 74 Reverse Transcription PCR (RT PCR) ................................ ............................. 74 In Situ Hybridization ................................ ................................ ......................... 75 GUS Staining ................................ ................................ ................................ .... 75 Localizati on of GFP Translational Fusion Proteins ................................ ........... 75 APX Activity Assay ................................ ................................ ........................... 76 H 2 O 2 Detection ................................ ................................ ................................ 77 Results ................................ ................................ ................................ .................... 77 Chlorotic apx4 Cotyledons ................................ ................................ ................ 77 Photosynthetic Pigment Levels and Seedling Growth were Reduced in apx4 Mutants ................................ ................................ ................................ ......... 78 Decreased Germination of apx4 Seeds in an Unfavorable Environment .......... 7 9 Expression and Sub cellular Localization of APX4 ................................ ........... 80 Two apx4 Mutant Alleles are Knockout Mutants ................................ ............... 80 Increased H 2 O 2 Levels and Reduced Total APX Activity in apx4 Mutants ....... 81 Discussion ................................ ................................ ................................ .............. 81 Analysis of the apx4 Mutant Lesion ................................ ................................ .. 81 APX4 May Transit to Multiple Organelles ................................ ......................... 82 APX4 is Important during Development of Seedling Photosystems ................. 82 APX4 May Regulate the Activity or the Stability of O ther APXs ....................... 84 APX4 Regulates Seed Coat Formation and Affects Seed Vigor ....................... 85 5 GENERAL CONCLUSIONS ................................ ................................ ................... 94

PAGE 7

7 APPENDIX A COMPLEMENTATION OF per17 28 and 29 MUTANTS WITH THE COMPLEMENTING TRANSGENES ................................ ................................ ....... 98 B ENZYME ACTIVITY OF MYC PER17, 28 AND 29 ................................ ............... 101 C PROMOTER ACTIVITY OF PER28 AND PER29 ................................ ................. 102 LIST OF REFERENCES ................................ ................................ ............................. 103 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 113

PAGE 8

8 LIST OF TABLES Table page 2 1 Mutation of ROS scavenging genes significantly reduced fertility ...................... 39 2 2 Primers used in this study. ................................ ................................ ................. 40 3 1 The fertility of Arabidopsis PER17OE and controls were evaluated ................... 61 3 2 The fertility of Arabidopsis PER28OE and controls were evaluated ................... 62 3 3 The fertility of Arabidopsis PER29OE and controls were evaluated. .................. 63 3 4 Soybean yield was modulated by temperature and genotype ............................ 64 3 5 Soybean fertility and harves t index was affected by temperature and genotype ................................ ................................ ................................ ............. 65 3 6 Soybean vegetative growth was affected by temperature and genotype ............ 66 A 1 The fertility of per17, 29 and 29 mutants transformed with 35S::myc PER17 35S::myc PER28 or 35S::myc PER29 was measured ................................ ...... 98

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Ovules develop into seeds ................................ ................................ ................. 22 1 2 ROS metabolism ................................ ................................ ................................ 23 2 1 RT PCR analysis revealed the per17 per28 per29 and apx4 homozygous mutant alleles contain no detectable full length transcripts. ............................... 41 2 2 Fertility was measured in (A) healthy stage 12 pistils and (B) pistils after watering once with 75 mM NaCl ................................ ................................ ......... 42 2 3 Following salt stress, peroxidase mutants accumulated ROS in ovules ............. 43 2 4 Hydrogen peroxide accumulation in peroxidase mutants ................................ ... 44 2 5 Quantitative PCR of PER17 (A), PER28 (B) and PER29 (C) transcript levels .... 45 2 6 Three PER GFP proteins localize in the cytosol of Arabidopsis root cells .......... 46 3 1 RNA expression and protein expression in over expressing transgenic Arabidopsis plants were evaluated ................................ ................................ ..... 67 3 2 Soybean plants grown at supra optimal temperatures experience a reduction in fertility. ................................ ................................ ................................ ............ 68 3 3 Reproductive growth of Maverick was delayed at 38/30C ................................ 69 4 1 Two apx4 mutant alleles had chlorotic cotyledons and this phenotype reverted when transformed with the APX4 gene ................................ ................ 87 4 2 Chlorophyll a, chlorophyll b and lutein levels were significantly lower in apx4 mutants. ................................ ................................ ................................ .............. 88 4 3 Seedling growth of apx4 mutants was significantly reduced ............................... 89 4 4 The germination of apx4 seeds was lower than wild type se eds due to an altered seed coat ................................ ................................ ................................ 90 4 5 APX4 transcripts were found in shoot tissues ................................ ..................... 91 4 6 The APX4 GFP translational fusion protein localized to mesoph yll and guard cell chloroplasts ................................ ................................ ................................ .. 92 4 7 Mutation of apx4 leads to H 2 O 2 a ccumulation and reduction of total APX activity in seedlings ................................ ................................ ............................. 93

PAGE 10

10 A 1 In total protein extracts from transgenic plants, myc PER17 and myc PER28 were detected by immunoblotting using an anti myc antibody ........................... 99 A 2 Detection of transcripts deriving from the myc P ER17 and myc PER29 transgenes ................................ ................................ ................................ ........ 100 B 1 Peroxidase activity from myc PER17 (A), myc PER28 (B) and myc PER29 (C) transformants was measured ................................ ................................ ..... 101 C 1 GUS histochemical staining of PER28::GUS ................................ .................... 102

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROS SCAVENGERS AFFECT PLANT REPRODUCTION By Ya Ying Wang May 2013 Chair: Bernard A. Hauser Major: Botany Reactive oxygen species (ROS) can act as redox signaling molecules or destructive reagents. While many environmental stresses promote ROS synthesis ROS scavengers neutralize those toxic molecules and protect plants from cellular damage and programmed cell death that are caused by high ROS accumulation In this study, a group of ROS scavengers whose expression in pistils significantly changed following salt stress was i nvestigated to understand their roles in reproduction. Loss of function mutants for the se three ROS scavenging genes were characterized. The results indicated t hree cytosolic class III peroxidases (PER17, 28, and 29) that were primarily expressed in pistils a ll modulate ROS metabolism and ovule abortion In contrast, ASCORBATE PEROXIDASE 4 ( A PX4 ) a class I peroxidase, did not affect fertility in Arabidopsis. Instead, this locus regulated seedling growth and seed vigor To investigate whether enhanced ROS scavenging capacity can counteract physiological changes under environmental stress PER1 7 28 and 29 transgenes were transformed into and expressed in Arabidopsis and soybean plants The phenotypes of these transgenic plants were evaluated. This study demonstrated these ROS scavengers regulate ROS metabolism and play important roles in plant reproduction.

PAGE 12

12 CHAPTER 1 GENERAL INTRODUCTION Reactive oxygen species (ROS) are a group of highly active small molecules that can be naturally produced during cellular metabolism or be massively induced under environmental stresses. In cells, ROS play a du al role: as signaling molecules in hormone signaling, defense response, stomatal closure, and development; and as destructive molecules that cause protein degradation, DNA mutation, lipid oxidation, and programmed cell death (PCD) (Apel and Hirt, 2004; Mit tler et al., 2004). When plants encounter stress, vegetative and reproductive growth can be limited as photoassimilates compensate for the stress adaptation. The outcome leads to yield decrease and impacts agriculture since the loss can be up to 78% of the yield (Boyer, 1982). In seed crops, environmental stress affects seed development and influences the seed set, seed quality and seed vigor (Bailly, 2004). In this study, the mechanism of how reproduction, especially fertility and seed de velopment, is affected by ROS scavengers responsive to salt stress in Arabidopsis is examined By revealing how ROS scavengers are involve d in reproduction, strategies may be found to counter the stress induced physiological changes, maintain fecundity of seed crops and benefit agriculture. Stress Affect s Seed Development Under optimal growth conditions, a flowering plant can perform its best, yielding seeds at its optimal or genetic potential. In reality, there are many environmental factors, including th e quality or intensity of light, temperature, water availability, nutrient availability, pathogen attack, and air pollution (e.g. ozone) that may affect plant growth and the assimilation process. For instance, elevated temperatures influence thylakoid

PAGE 13

13 mem brane integrity and decrease photosynthetic rates (Havaux, 1992). Salt stress decreases water potential in soil and affects nutrient uptake (Hasegawa et al., 2000). Environmental stress impacts agriculture by causing up to 20 fold reductions in yield (Boot e et al., 2005; Boyer, 1982; Prasad et al., 2002). In addition, the unfavorable environment can stress plants from a few minutes to up to days depending on the type of stress Salt accumulation in the soil gives rise to one type of abiotic stress, which i s a major threat to worldwide agriculture. Ions accumulate in soil from irrigation and, after reaching a certain level, begin to affect plant growth. Most major crops are sensitive to salt especially at germination and seedling stage. Although some plants are salt tolerant, most plants reduce their rate of growth and carbon accumulation, as measured by dry weight (Greenway and Munns, 1980). Salt stress affects plants by altering their water potential and causing an osmotic effect or ion toxicity. Plants ex periencing salt stress usually undergo a disruption of cell membrane integrity, ROS production, and cell death (Hasegawa et al., 2000). Studies suggest that salt stress affects photosynthesis and therefore, reduces plant growth and yield ( Havaux, 1992; Sudhir and Murthy, 2004). For seed crops reduction of yield often indicates a decrease in seed fecundity and this impacts the agricultural economy. Seeds develop from fertilized ovules. Under normal condition s fertilized ovules act as a strong sink and r eceive metabolites from other source tissues. However, ovules will degenerate after exposure to such stress es as elevated temperatures and salt, therefore reducing the formation of seeds (Beppu et al., 1997; Prasad et al., 2002; Sun et al., 2004). Seed pro duction is not only important to

PAGE 14

14 seed crops (e.g. soybeans and peas) but also important to other crops for reproducti ve purposes. T o understand what physiological and biochemical processes occur during seed development when exposed to salt stress, Arabid opsis thaliana was chosen for the basic mechanism study. Arabidopsis is sensitive to moderate levels of salt, and the fertility of Arabidopsis is reduced by salt stress and the presence of ROS in ovules (Sun et al., 2004 2005). Since the development of Ar abidopsis ovules has been well characterized, it can serve as a genetic model of dicotyledonous plants. The ovule development and embryogenesis of Arabidopsis is typical of most dicotyledonous plants. An Arabidopsis ovule is comprised of a nucellus; outer and inner integuments, which envelop the nucellus; and the funiculus, a stalk that attaches the ovule to the placenta. Within the nucellus, the sporogenous cell (megaspore mother cell) undergoes meiosis and forms four megaspores. Three of these degenerate but the fourth divides mitotically three times forming seven cells with total of eight nuclei in the e mbryo sac : one egg, two synergids, and three antipodals which are haploid while the seventh, the central cell is binucleate (Fig. 1 1A; Schneitz et al., 1995). Seeds arise from fertilized ovules. When the ovule is fertilized, both the egg and the centra l cell fuse with sperm nuclei and develop into embryo and endosperm, respectively. During endosperm development, nuclei repeat mitosis without cytokinesis or cell wall formation, producing coenocytic endosperm. Cellularization of the coenocyte is then init iated and finally completed at the heart shape embryo stage (Schneitz et al., 1995). While the endosperm develops, the embryo grows slowly, but the embryo grows rapidly after endosperm development is complete. During embryo development, the cell

PAGE 15

15 divides as ymmetricall y through sequential stages: one cell, four cell, octant (eight cell), 16 cell dermatogen, gl obular, heart, torpedo, walking sti ck and mature embryos (Fig. 1 1B ; Goldberg et al., 1994). The two integuments undergo structural and biochemical spec ializations as the ovules become seeds. During ovule development, programmed cell death (PCD) occurs when all megaspores but one degenerate. Cell death also occurs during the rupture of synergids after fertilization and the degeneration of nucellar cells while the embryo sac expands. ROS is involved in the fertiliz ation process, including pollen stigma interaction and pollen tube growth (McInnis et al., 2006 a ; Potocky et al., 2007; Wilkins et al., 2011). However, excessive ROS commonly leads to PCD (Bethke and Jones, 2001; Dat et al., 2003; Hauser et al., 2006). I n Arabidopsis ROS accumulation was observed in salt stressed ovules and resulted in high ovule abortion rates rates (Sun et al., 2004, 2005). It is hypothesized that ROS plays an important role in regulating ovule development The Role and Generation of ROS in Plants Reactive oxygen species, such as singlet oxygen ( 1 O 2 ), superoxide (O 2 ), hydroxyl radical s ( OH), and hydrogen peroxide (H 2 O 2 ), are a group of highly active small molecules that can be naturally produced during cellular metabolism. In plants, ROS are mainly produced in chloroplasts, mitochondria, and peroxisomes during photosynthesis, respiration, or other metabolic processes (Macpherson et al., 1993; Mittler et al., 2004). While ground state oxygen (O 2 ) is essential to all aerobic organisms, it can be converted to ROS during energy transfer and electron transfer reactions. In plants, singlet oxygen is formed during excessive excitation of chlorophyll and causes photoinhibition while su peroxide, hydroxyl radical s and hydrogen peroxide are produced from electron transfer (Hideg et al., 1994; Apel and Hirt, 2004). The

PAGE 16

16 superoxide can be a starting molecule for triggering the production of other reactive species. For example, superoxide is usually rapidly and enzymatically converted to hydrogen peroxide. Hydroxyl radicals can be generated when hydrogen peroxide meets divalent ions, such as Fe 2+ and Cu 2+ (Allan and Fluhr, 1997). Hydrogen peroxide is also a product of photorespiration. Hydroge n peroxide is relative ly stable and can cross the plasma membrane or move apoplastically into neighboring cells. ROS can be induced by abiotic and biotic stress. Abiotic stress, such as drought stress, salt stress, cold stress, heat shock, light stress, an d such biotic stress es as wounding and pathogen attack, can lead to ROS production (Prasad et al., 1994; Tsugane et al., 1999; Apel and Hirt, 2004). Some oxidases and peroxidases contribute to ROS generation. NADPH oxidase (NOX) a membrane bound enzyme co mplex that catalyzes the production of superoxide, is an enzymatic source of ROS generation in mammals. Respiratory burst oxidase homologues (RBOH), homologues of mammalian NADPH oxidase subunits, are found in plants and are associated with ROS production (Torres et al., 1998; Sagi and Fluhr, 2001; Foreman et al., 2003). While peroxidases usually remove ROS, some cell wall peroxidases have also been described that are able to generate various ROS for defense or deve lopmental purposes ROS generation via cel l wall peroxidases is strongly pH dependent (Bolwell and Wojtaszek, 1997; Blee et al., 2001; Liszkay et al 2003; Mei et al., 2009) In cells, moderate amounts of ROS play a role as signaling mole cules in regulating many biological processes, e.g. develo pment and defense responses (Foreman et al., 2003; Liu e t al., 2010). However, the over accumulation of ROS is toxic. Excessive ROS, e.g. an oxidative burst, can change the redox homeostasis,

PAGE 17

17 damage proteins, break down fatty acid s mutate D NA and induce PCD (Prasad et al 199 4; Pennell and Lamb, 1997; Jabs, 1999; Dat et al 2003). Therefore, plants have evolved a sophisticated ROS scavenging network ROS Scavenging Me ch a nism ROS can be scavenged via non enzymatic and enzymatic pathways (Fig. 1 2A) The n on enzymatic ROS scavenging mechanism relies on the oxidation of antioxidants, such as glutathione (GSH), ascorbate, flavonoids, alkaloids, carotenoids, and the like There are also enzymes present in different compartments of plant cells that scavenge ROS, including superoxide dismutases (SOD s ), catalases (CAT s ), and several types of peroxidases. SODs catalyze the dismutation of superoxide s to hydrogen peroxides and oxygen. Three groups of superoxide dismutases are found and named by their met al cofactors: Cu/Zn SOD, Mn SOD and Fe SOD. In Arabidopsis, Cu/Zn SOD isozymes are found in cytosol, peroxisomes and chloroplasts. While Mn SOD is found in mitochondria, Fe SOD has cytosolic and plastidic isoforms (Kliebenstein et al., 1998; Myouga et al 2008). Several enzymes found in plant cells can diminish peroxides. CATs found in peroxisomes can decompose hydrogen peroxide produced in photorespiration into water and oxygen. Glutathione peroxidases (GPX s ) reduce peroxides by oxidizing glutathione a nd are prevalent ROS sacavenging enzymes in mammalian cells. Seven GPX homologous are found in Arabidopsis and are suggested to be localized in several sub cellular compartments (Rodriguez Milla et al., 2003). However, plant GPXs showed higher thioredoxin peroxidase activity than glutathione peroxidase activity (Herbette et al., 2002; Jung et al., 2002) Peroxiredoxins (PRX) are peroxidases that can reduce

PAGE 18

18 different thio containing molecules to detoxify hydrogen peroxides. For example, the PRX using thiored oxin as the reducing agent is called thioredoxin peroxidase (TPX). Ten PRXs are found in Arabidopsis and in various isoforms, are present in chloroplasts, mitochondria and cytosol (Dietz et al., 2006). There is a superfamily of heme containing peroxida ses and these peroxidases are divided into three classes. Class I peroxidases are of bacterial origin, including cyanobacterium CPX, yeast cytochrome c peroxidase (CCP), and ascorbate peroxidases (APX). Class II peroxidases consist of fungal peroxidases th at are not found in plants. Class III peroxidase s are unique to plants and result from a large gene family (Welinder, 1992). APXs reduce hydrogen peroxides by oxidizing ascorbate via the a sc o r bate glutathione cycle ( Fig. 2 2B ). In the asc o r bate glutathion e cycle, a sc o r bate and glutathione are first oxidized and then are regenerated by an other three enzymes: mon odehydroascorbate reductase (MD AR/MD H AR), glutathione dependent dehydroascorbate reductase (DHAR), and glutathione reductase (GR) This a sc o r bate glutathione cycle has been found in chloroplasts, mitochondria, cytosol, and peroxisomes (Noctor and Foyer, 1998) Accordingly, eight Arabidopsis APXs and enzymes required in a sc o r bate glutathione cycle are found in those cellular compartments (Jimene z et al., 1997; Asada, 1999; Chew et al., 2003). Class III peroxidases can reduce hydrogen peroxide by using various donor molecules including lignin precursors, auxin, or secondary metabolites (Hiraga et al., 2001; Cosio and Dunand, 2009). In Arabidopsis there are 73 class III peroxidases (PER s ) annotated (Tognolli et al 2002). Many class III peroxidases are predicted to

PAGE 19

19 target the cell wall or vacuole and may be involved in lignification, defense responses, hormone metabolism, salt tolerance and plan t development (Hiraga et al., 2001; Cosio and Dunand, 2009; Welinder et al., 2002). A well known class III peroxidase is horseradish peroxidase (HRP) which function s in H 2 O 2 removal. A c ross linking reaction for pathogen defense will be triggered by the r adical products generated after this catalytic process (Veitch, 2004). The functions of most of these class III peroxidases, however, remain unknown. In every cell compartment, usually more than one ROS scavenging enzyme can be found. From reverse genetic studies, many single knockout mutants appear to be no differen t from wild types. These observations imply that the ROS scavenging pathway is dynamic and redundant (Apel and Hirt, 2004). Plants also use cellular antioxidants to scavenge ROS for managing the redox state of the cell. When the redox state is upset (e.g. oxidative stress), ROS signaling will be activated Stress and ROS Signaling It is hypothesized that t he cell can sense ROS via three different methods: unknown ROS receptors, redox sensitive t ranscription factors (TF), and inhibition of phospha tases by ROS (Mittler et al 2004; Glasauer and Chandel, 2013). Evidence indicates that downstream signaling events are associated with increased concentrations of cellular calcium [Ca 2+ ] and calcium binding proteins (Foreman et al., 2003; Potocky et al., 2007). ROS can also activate G proteins (Baxter Burrell et al., 2002), phospholipid signaling (Anthonay et al., 2004), and mitogen activated protein kinase (MAPK) signaling pathways (Pitzschke and Hir t, 2006). The MAPK signaling pathway regulates the expression of many transcription factors, such as HSF, WRKY and Myb, which will activate different defense mechanisms in response to stress.

PAGE 20

20 Interestingly, abiotic and biotic stresses both induce ROS gene ration but lead to different results possibly due to different signaling mechanisms While abiotic stress induces ROS production, ROS scavenging enzymes are usually induced to decrease ROS levels in plants (Apel and Hirt, 2004). On the other hand, when pl ants are attacked by pathogens, ROS accumulation activates PCD consequently restrict ing the spread of the biotic threat. This will not be achieved without the suppression of the ROS scavenging capacity. Therefore, a high degree of coordination between the production of ROS and ROS scavenging mechanisms is expected Enhance ROS Scavenging Capacity by Over expressing ROS Scavengers Since many ROS scavenging genes show increased expression under stress (Kliebenstein et al., 1998 ; Shigeoka et al., 2002 ; Rodrig uez et al., 2003 ), it leads us to hypothesize that these ROS scavengers are important for preventing or alleviating the damage caused by oxidative bursts after stress. Using the gene transfer technique, over expressing extra copies of the ROS scavenging ge ne in plant s can be created. This may provide an alternative strategy for plants to counter the stress induced physiological changes and maintain productivity. Many transgenic plants that over express the ROS scavenging gene have shown better tolerance to stress. Transgenic tobacco plants that express a chloroplastic Cu/Zn SOD gene from pea maintain higher photosynthetic capacity under stress than the non transgenic controls (Sen Gupta et al 1993). Over expressing chloroplastic tAPX in Arabidopsis increa ses its resistance to herbicide induced photo oxidative stress (Murgia et al., 2004). Tobacco plants that contain the transgene from Arabidopsis peroxisomal APX3 are resist ant to the oxidative stress from peroxisomes but not from chloroplasts (Wang et al. 1999). These examples illustrate that it is possible to spatial ly and

PAGE 21

21 temporal ly manipulate ROS scavenging capacity with the consequent result of enhanced tolerance to environmental stresses Objectives and Organization of T his Dissertation The goal of t his s tudy is to elucidate the role that ROS scavengers PER17, PER28, PER29 and APX4 play in Arabidopsis reproduction. While ROS accumulation was observed in gametophyte s after salt stress and led to ovule abortion in Arabidopsis, these ROS scavenging genes showed differential expression (Sun et al., 2005). What is the relationship among ROS levels, ROS scavengers and ovule abortion? What is the function of these ROS scav engers in reproduction? Does increased ROS scavenger expression lead to enhanced ROS scavenging capacity under stress consequently maintain ing fecundity? The roles of three class III peroxidases and APX4 are investigated and discussed in C hapter 2 and 4, respectively Transgenic Arabidopsis and soybeans that over express three class III peroxidases are evaluated for their reproductive phenotypes. The results are organized in Chapter 3 The conclusion s for all these results are given in C hapter 5.

PAGE 22

22 A B Figure 1 1 Ovules develop into seeds. Ovule (A) and embryogenesis stages (B) in Arabidopsis Abbreviations: cc, central cell; ec, egg cell; ii, inner integument; oi, outer integument; mp, micropyle; syn, synergids; vas, vasculature; et, endothelium; vac, vacuole; ap, antipodals; ch, chalaza; fu, funiculus; sc, seed coat; en, endosperm; sm, shoot meristem; rm, root meristem.

PAGE 23

23 A B Figure 1 2 ROS metabolism. (A) Overview of ROS generati on and removal in plant cell. (B) Asc o r bate glutathione cycle is present in many cellular compartments to remove hydrogen peroxide. Enzymes involved are depicted in rectangular gray boxes. Abbreviations: NOX/RBOH, NADPH oxidase; SOD, superoxide dismutase; CAT, catalase; APX, ascorbate peroxidase; GPX, glutathione peroxidase; PRX, peroxiredoxin; PER, class III peroxidase; GSH, glutathione; GSSG, oxidized glutathione; MDHA, monodehydroascorbate ; DHA, dehydroascorbate ; GR, glutathione reductase; MDAR/MDHAR, mo nodehydroascorbate reductase ; DHAR, dehydroascorbate reductase

PAGE 24

24 CHAPTER 2 peroxidase 17 28 AND 29 LOST OF FUNCTION INCREASE OVULE ABORTION IN ARABIDOPSIS Reactive oxygen species (ROS) act as redox signaling molecules or destructive reagents. While many environmental stresses promote ROS generation, ROS scavengers neutralize those toxic molecules and protect plants from cellular damage and programmed cell death. In this study, we found three cytosolic class III peroxidases (PER) in Arabidopsis thaliana that a ffect ROS metabolism and ovule abortion. PER17, PER28, and PER29 are putative heme containing peroxidases that scavenge peroxides. Quantitative RT PCR analyses reveal these three per oxidase genes were primarily expressed in pistils. The peroxidase GFP translational fusion proteins of PER17, 28, and 29 were found in the cytoplasm. In all peroxidase single, double, and triple mutants, the ovule abortion rates significantly increased und er normal growth conditions. In each of these single mutants total H 2 O 2 levels rose, but only in the peroxidase triple mutant was there a statistically significant increase. These increased H 2 O 2 levels correlated with significantly higher seed failure rate s When the roots were transiently salt stressed, PER17 gene expression markedly increased, while the expression of PER28 and PER29 decreased in Arabidopsis pistils. Analyses of fertility data indicate that the presence of PER28 and PER29 reduces s eed fail ure in unstressed plants. Since the PER17 gene is expressed at higher levels in pistils mutation of this locus caused significant increases of ovule abortion in bo th healthy and stressed fruits. Background Reactive oxygen species (ROS), such as superoxide (O 2 ), hydroxyl radicals ( OH), and hydrogen peroxide (H 2 O 2 ), are a group of highly active small molecules that

PAGE 25

25 can be naturally produced during cellular metabolism. In plants, ROS are mainly produced in chloroplasts, mitochondria, and peroxisomes during photosynthesis, respiration, or other metabolic processes (Macpherson et al., 1993; Mittler et al., 2004; Moller, 2001 ). Low to moderate amounts of ROS signal different res ponses and regulate many biological processes, e.g., development and defense responses (Foreman et al., 2003; Liu et al., 2010). Excessive ROS, however, changes redox homeostasis and leads to oxidative stress (Apel and Hirt, 2004; Dat et al., 2003; Prasad et al., 1994). Among various ROS in plants, H 2 O 2 is generally considered to be the main molecule that serves as a long range signaling molecule because it is relatively stable and can diffuse relatively rapidly crossing membranes. ROS can damage proteins, break down fatty acids, mutate DNA, and induce programmed cell death (PCD) (Dat et. al, 2003; Jabs, 1999; Pennell and Lamb, 1997). Understanding how plants regulate ROS levels can permit hypotheses of mechanisms to prevent excessive ROS production. In plant cells, there are several ROS scav enging enzymes to maintain redox homeostasis. Superoxide dismutases (SOD s ) convert superoxide to H 2 O 2 and oxygen (Bowler et al., 1992). Catalases (CAT s ) break down H 2 O 2 into water and oxygen ( Vandenabeele et al., 2004 ). Glutathione peroxidases (GPX s ) reduc e H 2 O 2 by oxidizing glutathione (GSH), and glutathione reductases (GR s ) regenerate GSH utilizing NAD(P)H (Foyer et al., 1995). Ascorbate peroxidases (APX s ), which are members of class I peroxidases, reduce H 2 O 2 by oxidizing ascorbate via the ascorbate glut athione cycle ( Noctor and Foyer, 1998 ). Each of these ROS scavengers is found in many cell compartments, and can be either cytosolic or membrane bound (Apel and Hirt, 2004;

PAGE 26

26 Mittler et al., 2004; Narendra et al., 2006). The class III heme containing peroxid ases (PER or PRX) are unique to plants and result from a large gene family. In Arabidopsis, there are 73 of these annotated peroxidases ( Hiraga et al., 2001; Tognolli et al, 2002 ). Many of these peroxidases are predicted to target the cell wall or vacuole and are hypothesized to be involved in lignification, defense responses, hormone metabolism, salt tolerance, and development (Cosio and Dunand, 2009; Welinder et al., 2002). Horseradish peroxidase (HRP) is the best known class III peroxidase. The radical p roducts generated after this catalytic process trigger pathogen defense responses (Veitch, 2004). The functions of most of these class III peroxidases, however, remain unknown. Many environmental stresses such as heat shock, chilling, salt, high light, and pathogen attack, cause ROS accumulation ( Bolwell and Wojtaszek, 1997; Hasegawa et al., 2000; Prasad et al., 1994; Sun et al., 2010; Vandenabeele et al., 2004; Zhang et al., 2007 ). When Arabidopsis roots were salt stressed, water potential in the infloresc ence significantly decreased and fertility was significantly reduced ( Sun et al., 2004). ROS accumulation was observed in salt stressed ovules and was hypothesized to cause high ovule abortion rates in Arabidopsis; consequently, fertility is reduced becaus e seeds arise from ovules ( Sun et al., 2005). The expression of a group of ROS scavenging genes, including one APX ( APX4 / At4G09010 ), three putative PER ( PER17/At2G22420, PER28/At3G03670, PER29/At3G17070 ), and one SOD ( FSD2/At5G51100 ), was significantly altered in Arabidopsis ovules following salt stress (Sun et al., 2005). Together with the evidence of ROS accumulation in stressed ovules, we hypothesize that these ROS scavenging genes may regulate the ROS levels during ovule abortion

PAGE 27

27 In this study, we characterized the role of three PER genes in regulating ROS level in Arabidopsis ovules. By revealing the mechanism of ovule abortion under stress, strategies may be found to counter the stress induced physiological changes and maintain plant fecundity. Material and Methods Plant M aterial Arabidopsis thaliana wild type (Col 0) and ROS scavenger T DNA inserted mutants (SALK_003180 for per17 SALK_076194 for per28 SALK_133065 for per29 SAIL_519_E04 for apx4 and SALK_ 080457 for fsd2 ) were identified from ABRC stocks (Ohio State University). After backcrossing these mutant alleles with wild type Arabidopsis (Col 0), homozygous mutants were identified by polymerase chain reaction (PCR). Two gene specific primers from upstream and downs tream coding sequences were used to verify the presence of wild type alleles. One gene specific primer and one primer from T DNA border sequence were used to confirm the presence of mutant allele (Table 2 2). All mutants used have no fu ll length transcript s (Fig. 2 1 ; Myouga et al., 2008.) Plants were grown in 2 x 2 pots in a Percival plant growth chamber (Perry, IA) at 24C, 50% relative humidity, and continuous fluorescent light (100 mol photon m 2 s 1 ). To stress plants, the pots were soaked in irrigate d water containing 75 mM NaCl for 6 hours, drained, then not irrigated with plain water for an additional 42 hours. Hydroponic Arabidopsis were grown using Rockwool supports, as described by Gibeaut et al. (1997). Hydroponic medium contained 5 mM KNO 3 2. 5 mM KH 2 PO 4 2 mM MgSO 4 50 M Fe EDTA, 2 M Ca(NO 3 ) 2 70 M H 3 BO 3 14 M MnCl 2 0.5 M CuSO 4 1.0 M ZnSO 4 0.2 M NaMoO 4 10 M NaCl, and 0.01 M CoCl 2 The solution

PAGE 28

28 was replaced weekly to minimize changes to these concentrations due to transpiration. To stress plants, 75 mM NaCl was added to this hydroponic solution at the 5th week after germination. Statistics Healthy seeds and aborted ovules in each s ilique (developed from pistil) were recorded. From these data, ovule abortion rates and fertility with standard errors were calculated. Before performing ANOVA analysis using JMP8 software (Cary, NC), ovule abortion rates were root arcsine transformed to g enerate a normal distribution. RNA E xpression Total RNA was isolated from 10 day old seedling and tissues from 30 day old hydroponic plants using RNeasy mini kit (Qiagen, Valencia, CA). Complementary DNA (cDNA) was synthesized using SuperScript III reverse transcriptase (Invitrogen, Grand Island, NY) from 1 g of total RNA as suggested by manufacturer. Quantitative PCR (qPCR) was performed in optical 96 well plates using an ABI StepOnePlus machine (Applied Biosystems, Grand Island, NY). Each 10 L reaction consisted of GoTaq qPCR Master Mix (Promega, Madison, WI), 2 L of 1:50 diluted cDNA, and 0.2 M each of gene specific primer pairs (see Table 2 2). The following thermal profile was used for qPCR: 95C for 2 min; 30 cycles of 95C for 15 s and 60C for 1 min; and a melt curve analysis at 95C for 15 s, 60C for 15 s, and 95C for 15 s. C T and standard curve were extracted using ABI StepOne v2.2 software (Grand Island, NY). The fold change of gene expression and standard deviations were calculated according to the guide from ABI (http://www.appliedbiosystems.com/absite/us/en/home/support/tutorials.html). Melt curve analyses were used to verify that a single product was produced from each qPCR.

PAGE 29

29 ROS A ccumulation Pistils were dissected lengthwise and incubated in 10 M 5 (and 6 ) carboxy dichlorodihydrofluorescein diacetate (CH 2 DCFDA, Molecular Probes, Grand Island, NY) for 30 min, then samples were washed twice in 10 mM of phosphate buffer pH 7.0. In the presence of ROS, CH 2 DCFDA was oxidized to form car boxy dichloro fluorescein (CDCF), which is highly fluorescent (Cathcart et al., 1983). The CDCF was visualized by excitation between 490 and 510 nm and the fluorescent emissions detected using a 520 nm long pass filter. This filter set detects both CDCF em ission (green) and plant cell auto fluorescence (red). The result of triple mutant in Figure 2 3 is after normalization based on wild type controls in two experiments. H 2 O 2 Detection Pistils were frozen in liquid nitrogen and pistil length was measured under a dissecting microscope (Leica, Buffalo Grove, IL). After pistils were ground to powder, 0.1 mL of 0.2 M HClO 4 was added to sto p catal ase activity, then incubated on ice for 5 min. Samples were centrifuged at 14,000 rpm for 10 min at 4C. The superna tant was neutralized with 110 L of 0.2 M NH 4 OH and was centrifuged again at 3,000 g The supernatant was passed through a column of AG resin (Bio Rad, Hercules, CA), and then was eluted with 0.1 mL deionized water (modified from Xiong et al., 2007). Ampl ex Red Hydrogen Peroxide Peroxidase Assay kit (Invitrogen, A22188) was used to quantify H 2 O 2 levels in the extracts, as recommended by the manufacturer. Fluorescence was measured using Synergy HT fluorescence plate reader (Bio Tek, Highland Park, IL) with excitation/emission at 540/590 nm. The concentration of H 2 O 2 in the samples was calculated using a standard curve.

PAGE 30

30 Loca lization of GFP Translational Fusion P roteins The pEW201ML binary plasmid was created to contain the PER17 coding sequence (upstream) tha t is translationally fused to the GFP coding sequence (downstream) and is driven by the CAMV 35S promoter. Similarly, the pEW202ML and pEW203ML binary plasmids were created to contain PER28 and PER29 with translationally fused GFP, respectively. The plasmi d was moved into Agrobacterium tumefaciens strain ASE by electroporation. Plants were transformed with this A. tumefaciens containing the plasmid according to Clough and Bent (1998 ). Transformants were selected by spraying 1000 fold diluted BASTA (Finale, AgrEvo, Pikeville, NC). Seven day old seedlings were submerged in fixative solution containing 4% paraldehyde, 0.5% glutaraldehyde, 1% DMSO, 3 mM DTT, 10 mM HEPES (pH 6.4), 2 mM ED TA, 5.6 mM KCl, and 10 mM MgCl 2 Samples were vacuum infiltrated with a weak vacuum and washed with 10 mM HEPES (pH 6.4), 2 mM EDTA, 5.6 mM KCl, and 10 mM MgCl 2 for 10 minutes three times. Cell walls were counter stained using 0.1 mM calcoflour for 10 min. After washing with phosphate buffer, samples were mounted with 10% glycerol in 20 mM Tris HCl (pH 9). GFP and cell wall fluorescence were detected using an Olympus (Center Valley, PA) IX81 DSU spinning disk confocal microscope and images were processed by SlideBook software. The filter set used for capturing GFP fluorescence was excited at 472 nm and emitted at 540 nm; the DAPI filter set used has excitation and emission at 387 nm and 440 nm

PAGE 31

31 Results Increased Ovule Abortion Rate in Peroxidase M utants Fitn ess was evaluated for five ROS scavenging genes ( per17, 28, 29, apx4 and fsd2 ). RT PCR showed that full length transcripts were not detected in the RNA population s of leaves and flowers (Fig. 2 1 and data not shown). Since the mutation lesion in each of these mutant lines occurs within or upstream of the peroxidase or SOD domain, these are all loss of function mutants. Previous research showed that stage 12 flowers (Smyth et al., 1990) are especi ally susceptible to environmental stress (Sun et al., 2004). Therefore, stage 12 flowers (Smyth et al., 1990) were marked, and the fertility was measured after plants were either salt stressed treated with 75 mM NaCl for 48 hours or kept under healthy grow th conditions. Under normal growth conditions, three class III peroxidase mutants ( per17 per28 per29 ) and a superoxide dismutase mutant ( fsd2 ) exhibited significant increases in the ovule abo rtion rates (Table 2 1 ). The apx4 mutant did not exhibit this p henotype. The double and triple mutants of PER genes were created and the ovule abortion rates of these mutants also rose significantly. Ovule abortion rates were also scored for Arabidopsis under 75 mM NaCl salt stress for 48 hours. The ovule abortion rat es increased significantly in per17 mutant, per17per28 and per17per29 double mutants, and per17per28per29 triple muta nts (Table 2 1 ). In order to compare the fertility and abortion rates in different experimental replicates, the fertility of each mutant w as normalized with wild type controls that were grown in the same trays as the experimental plants (Fig. 2 2). For the wild type controls, 95% of the ovules successfully set seed under healthy growth conditions; for the salt stressed controls, 55% of the o vules set seed (Table 2 1 ) Normalization sent these reproductive rates to 100%. When compared to reproduction rates in the respective

PAGE 32

32 single mutants, relative fertility decreased even more in salt stressed per17 per17per28 and per17per29 double mutants, and the per17per28per29 triple mutant (Fig. 2 2A and 2 2B). Notably, the ovule abortion rates of these mutants significantly varied from those of wild type fruits following salt stress (Table 2 1 ), indicating the ir mutants responded more sensitivel y to sal t stress. These results are consistent with the differential expression data reported by Sun et al. (2005): mutation of genes that were induced by environmental stress led to larger fertility effects when plants were exposed to salt stress. Conversely, the fitness of mutants in genes that were most abundant in unstressed plants showed greater effects in healthy plants. ROS Buildup Correlates to Ovule Abortion R ate After salt stressing, Sun et al. (2005) reported that ROS initially accumulated in the gametophyte and then spread throughout the ovule. To determine whether or not salt stress induces the formation of ROS in ovules, samples from stressed plants were stained with CH 2 DCFDA, a ROS sensitive dye. In each per mutant genotype, ROS accumulation wa s evaluated in ovules 48 hours after salt stress (Fig. 2 3). We observed significantly higher levels of ROS accumulation in the ovules of per17, 28 and 29 single mutants than in wild type controls ( p < 0.0001). Similarly, even greater ROS levels were dete cted in the double and triple mutants Generation of H 2 O 2 Contributes to ROS A ccumulation Peroxidases convert H 2 O 2 into water and oxygen. Measuring the level of H 2 O 2 in per mutants will help determine whether or not the accumulation of ROS in ovul es is a r esult of the accumulation of H 2 O 2 due to a reduction in peroxidase activity. A coupled enzyme assay using Amplex Red, a fluorescent indicator, was used to detect H 2 O 2 levels in pistils. Results show H 2 O 2 accumulation in the pistils of peroxidase triple

PAGE 33

33 mutants was higher than in wild type controls in both unstressed and salt stressed conditions (Fig. 2 4). While H 2 O 2 levels in per single and double mutants increased, they were not significantly higher tha n controls. Plant tissues contain many peroxidase isoforms, so the removal of one is likely to have an incremental effect, as described above. Expression and Sub cellular L ocalization of P eroxidases While PER17 PER28 and PER29 mRNA were detected in many plant tissues, quantitative PCR results revealed that they were most abundant in pistils (Fig. 2 5). The fact that these three PER mRNA levels are low in leaves may explain why there was no apparent mutant phenotype in vegetative tissues. Many peroxidases are active in peroxisomes, so the PTS1 predictor ( Neuberger et al., 2003 ) was used to evaluate the putative PER17 PER28 and PER29 protein sequences. This bioinformatics analysis revealed a low probability that these proteins target peroxisomes. Construct s containing GFP translational fusion protein were created to infer the sub cellular localization of each peroxidase. Transgenic plants containing peroxidase GFP proteins were examined by confocal microscopy. Results showed that three peroxidase proteins w ere present in the cytoplasm (Fig. 2 6 ) Discussion The genes in this study were chosen for analysis because they exhibited significant changes in expression at initiation of ovule abortion. Previous investigation correlated ROS accumulation in ovules with the rate of ovule abortion (Hauser et al., 2006). Results show that mature gametophytes or developing ovu les tolerate up to 8 hours of 200 mM salt stress with minimal disruption to reproduction, but longer treatment causes more than 90% of the ovules to a bort (Sun et al., 2004). From a global

PAGE 34

34 microarray study (Sun et al., 2005), five ROS scavengers that exhibited significant changes in gene expression at the critical developmental stage were selected for further analysis. These ROS scavenging genes were P ER17 PER28 PER29 APX4 and FSD2 While PER17 expression increased, the levels for the other four genes were significantly lower following salt stress (Fig. 2 2C; Sun et al., 2005). Initially we were unable to discriminate between PER29 mRNA and expressi on of transcripts from another putative peroxidase gene, AT3G42570. These two genes exhibit extensive nucleotide identity and the probe pairs generated by the whole genome Affymetrix microarray cannot discriminate between the transcripts from these genes. Consequently, multiple gene specific primers for this gene were generated ( data not shown ) to measure the levels of transcripts from both genes. These primers could amplify PCR product from the genomic DNA template, but, despite repeated efforts using a variety of primers, we failed to amplify AT3G42570 mRNA product from the cDNA template (data not shown). In addition, neither large scale cDNA nor ESTs projects identified any AT3G42570 transcripts (Welinder et al., 2002). From these data, we conclude that AT3G42570 is not biologically active in the tissues investigated here and the previously mea sured Affymetrix transcript levels derived solely from PER29 mRNA. Superoxide Dismutase (FSD2) Myouga et al. (2008) reported that FSD2 is active in chloroplasts. When plants were grown at 5 fold higher fluence rates than those described here, fsd2 leaves w ere chlorotic. At lower fluence rates, the other two Arabidopsis SOD loci were sufficient to protect chloroplasts from photo oxidation. Reproductive analyses of fsd2 mutants

PAGE 35

35 revealed significant reduction in fertility for actively photosynthesizing plants, but had minimal effect on stressed plants (Table 2 1). The fsd2 mutant was more sensitive to oxidative stress under high light, rather than salt stress, because the FSD2 is located in chloroplasts. This implies that, although many abiotic stresses lead to ROS production, different metabolic pathways are i nvolved in ROS detoxification. Ascorbate Peroxidase (APX4) While APX4 transcripts are abundant in leaves and developing embryos (Winter et al., 2007), mutation of the APX4 locus had no effect on ovule deve lopment or plant fertility (Table 2 1 and data not shown). The absence of an ovule or seed phenotype in apx4 mutants may be due to genetic redundancy with another ROS scavenger. ROS scavengers that are expressed in developing seeds can limit oxidative stre ss during seed desiccation and germination, thereby reducing seed deterioration (Bailly, 2004). Alternatively, this locus may affect other seed traits or seedling establishment, which have not yet bee n measured. Cytosolic Class III Peroxidases In this stud y, we measured how three class III peroxidase loci affected ROS metabolism and ovule abortion. The nomenclature of class III peroxidases in Arabidopsis varies (Cosio and Dunand, 2009; Tognolli et al, 2002; Welinder et al., 2002 ), where both PER or PRX have been used. In earlier studies, PER17 was reported to modulate lignification and pod shatter (Cosio and Dunand, 2009) and PER28 was hypothesized to affect pollen pistil interactions (Tung et al., 2005). We found that PER17, PER28, and PER29 affected H 2 O 2 p roduction in ovules, but mutation of individual loci showed modest increases in hydrogen peroxide accumulation (Fig. 2 4). The robust increase in ROS shown in Figure 2 3 indicates not only hydrogen peroxide

PAGE 36

36 increases in stressed ovules, but increases other active oxygen species following stress conditions. The level of PER17 mRNA increased after 24 hours of stress, while the expression of PER28 and PER29 was repressed under these conditions (Fig. 2 2C). Following salt stress, per17 per17per28 per17per28 and per17per28per29 mutants exhibited lower fertility (Fig. 2 2B) than unstressed counterparts (Fig. 2 2A). One simple explanation for this is that increased PER17 activity after salt stress limits ovule failure. Conversely, per28, per29 and per28per29 mutants showed significant ovule abortion rates in healthy plants, but not after environmental stress (Table 2 1), indicating that PER28 and PER29 scavenge peroxides in healthy plants, but have negligible activity in those that are salt stressed. These da ta suggest that under normal conditions all three PER genes scavenge ROS in ovules or nearby areas to which this molecule can diffuse, thereby protecting ovules from abortion (Fig. 2 5). When encountering salt stress, PER17 remains an influential peroxide scavenger that removes ROS. We observed ROS accumulation after salt stress in ovules of three peroxidase mutants (Fig. 2 3), which indicated that either the rate of ROS removal decreased or its synthesis accelerated. ROS accumulation further increased in p er double and triple mutants (Fig. 2 3). However, the ovule abortion rates in some of the peroxidase mutants were not affected. We cannot distinguish which types of ROS accumulated in these tissues because CH 2 DCFDA stains many ROS. One or more types of ROS may reach a critical threshold, signaling the described physiological changes. Data reported here show that the induction of ROS accumulation by the mutation of peroxidases was sufficient to increase the rate of seed abortion.

PAGE 37

37 It is believed that H 2 O 2 ma y be a better signaling molecule than other types of ROS because it can cross the plasma membrane and move into neighboring cells. In plants, class III peroxidases can reduce peroxides by using various donor molecules, such as auxin or secondary metabolite s (e.g., lignin precursors and phenolic compounds) (Cosio and Dunand, 2009; Hiraga et al., 2001 ). Some cell wall peroxidases modulate ROS levels, which affect plant defense or development, but this reaction is strongly pH dependent (Blee et al., 2001; Bolw ell and Wojtaszek, 1997; Liszkay et al., 2003; Mei et al., 2009). Therefore, we quantified H 2 O 2 levels in our peroxidase mutants. The H 2 O 2 levels in peroxidase single and double mutants were higher than the wild type controls, but were not significantly hi gher as result of the high variance. For given genotypes, this variance can be explained by variability in the activity in the family of 70+ peroxidases present in Arabidopsis, which might or might not be due to differences in ovule abortion rates among pi stils. Purification of H 2 O 2 is labor intensive and samples cannot be stored frozen, so the sample size for each genotype was limited. The hydrogen peroxide levels were significantly higher in triple mutants under both unstressed ( p < 0.05) and salt stresse d ( p < 0.01) conditions (Fig. 2 4). These data correlated with low fertility (Table 2 1 and Fig. 2 2), indicating H 2 O 2 may be the molecule that causes ovule abortion Summary H 2 O 2 is a signal transducing molecule that serves as a barometer and regulator of the redox state of cells (Noctor et al., 2000). Consequently, cells tightly regulate the level of this metabolic pool with a variety of scavenging molecules that neutralize H 2 O 2 The effects of mutating three cytosolic peroxidase genes, which previously w ere found to markedly change in transcript abundance at a critical stage in ovule development,

PAGE 38

38 caused significant reductions in fertility. The three loss of function class III peroxidase mutants ( per17 per28 and per29 ) were found to accumulate more ROS and H 2 O 2 in ovules. Meanwhile, the ovule abortion rates increased in these mutants. Since peroxidases function in H 2 O 2 removal, it is expected that peroxidase mutants generate higher H 2 O 2 After salt stress, mitochondrial membrane potential changed first a nd ROS accumulation was then observed in ovules (Hauser et al., 2006.). These processes are often seen in PCD and may be the causes of ovule abortion. We found that the three class III peroxidases in this study are localized in cytoplasm (Fig. 2 6) and det oxify excess ROS, specifically H 2 O 2 in order to protect ovules from aborting. In the future, the peroxidase activity of these three class III peroxidase proteins will be examined in vitro In addition, over expression of these peroxidase genes will be eva luated to determine whether increased ROS scavenging activity reduces ovule abortion rates under stress

PAGE 39

39 Table 2 1 Mutation of ROS scavenging genes significantly reduced fertility. Prior to stress, stage 12 flowers were marke d and the subsequent ovule abortion rates for these fruit were determined. Stressed plants were treated with 75 mM NaCl for 48 hours. For each genotype, 30 pistils were scored. After arcsine transformation, ANOVA tests compared fertility between mutant gen otypes and wild type controls: significant difference of less than 0.05, a 0.01, b 0.001, c and 0.0001. e Abortion rate (%) Genotype Healthy* Stressed* Wild type 12.9 2.0 26.9 4.6 per17 29.6 5.8 b 44.6 6.0 a per28 23.2 3.3 b 34.6 4.4 fsd2 35.2 6.8 c 29.0 4.2 apx4 21.4 4.2 23.2 4.0 Wild type 18.0 1.7 33.4 3.3 per29 50.8 3.5 e 41.6 4.8 Wild type 14.9 1.3 33.1 2.7 per17 per28 39.7 6.3 c 64.0 6.6 e Wild type 23.9 3.1 49.5 4.5 per17 per29 35.6 6.0 67.7 6.9 b Wild type 21.6 1.5 39.5 3.6 per28 per29 33.7 4.0 b 40.0 2.9 Wild type 5.4 0.7 25.4 4.6 per17 per28 per29 31.5 5.2 e 66.3 5.6 e The o vule abortion rate is the average one standard error.

PAGE 40

40 Table 2 2 Primers used in this study. Primer ID Purpose ACT2_qF4 ATTCCAGCAGATGTGGATCTC qPCR and RT PCR, internal control ACT2_qR4 AGCCTTTGATCTTGAGAGCTTAG qPCR and RT PCR, internal control PER17_qF3 TTCCAACATCGATTCACTAAGATC qPCR PER17_qR3 CCAATCTGGTCCTCCTGTAAG qPCR PER28_qF1 TGGGATCGCGTCTTGTGGTA qPCR PER28_qR1 TTAGCCTGCCAGCCAAAGTG qPCR PER29_qF1 GCAAACACGTGGCAGACTCT qPCR PER29_qR1 TATCGTATGTGCACCCATGATG qPCR PER17_F TGTCTCTTCTTCCCCATCTC RT PCR and genotyping PER17_3UTR TCTTCTCTTTACTAATGATAATTC RT PCR PER28_F CGTTTTCTGTTCTACTCTTGC RT PCR and genotyping PER28_3UTR ATCATCAGAAGCGGAAATTAAG RT PCR PER29_F AGAATCTACAGCTGCATCATG RT PCR and genotyping PER29_3UTR ACATTTGATAATTATAAATATACATC RT PCR APX4_2F CTGTTCCTTCCTTCACCAAC RT PCR and genotyping APX4_2R AGTTTGCTCAGATTGATCCGT RT PCR and genotyping PER17_ EcoF GAATTCAAGTATGTCTCTTCTTCC pEW201ML construct PER17_ EcoR GAATTCTAGATACAAGCAATACATC pEW201ML construct PER28_ StuF AGGCCTAACAAGATGAAGATTGCAAC pEW202ML construct PER28_ EcoR GAATTCCGTTGAATGCTCTACAATTCG pEW202ML construct PER29_ StuF AGGCCTATGAAACCAAAGAGCAAAG pEW203ML construct PER29_ EcoR GAATTCCATCAACCTTGTCACACAC pEW203ML construct PER17_ R AGATACAAGCAATACATCAATAG Genotyping PER28_ R ATTCGTCCTGATCTCACCAG Genotyping PER29_ R CTTCTAATTACTCCTTCATTCC Genotyping LBb1 ATTTCGGAACCACCATCAAAC Genotyping Sail_LB CATAACCAATCTCGATACACC Genotyping

PAGE 41

41 Figure 2 1 RT PCR analysis revealed the per17 per28 per29 and apx4 homozygous mutant alleles contain no detectable full length transcripts. per17 per28 per29 and apx4 are null alleles. ACTIN2 ( ACT2 ) was as positive control.

PAGE 42

42 A B C Figure 2 2 Fertility was measured in (A) healthy stage 12 pistils and (B) pistils after watering once with 75 mM NaCl. Bars showed standard errors. (C) Expression of three peroxidase genes before and after salt stress (data extracted from Sun et al., 2005)

PAGE 43

43 Figure 2 3 Following salt stress, peroxidase mutants accumulated ROS in ovules. Prior to stress, stage 12 flowers were marked. CH 2 DCFDA fluorescence intensity in ovules was evaluated: level 0 had no detectable ROS; level 2 had slight ROS accumulation; and level 3 had copious ROS. For each genotype, three biological repeats, ea ch with 10 ovules, were analyzed. An ANOVA analysis was used to compare ROS levels in mutant genotypes to wild type controls. All genotypes significantly differed from controls ( p < 0.0001). Error bars indicate standard errors.

PAGE 44

44 A B Figure 2 4. Hydr ogen peroxide accumulation in peroxidase mutants. Prior to stress, stage 12 Arabidopsis flowers were marked. Plants were treated with either water (A) or 75 mM NaCl (B). After 48 hours, hydrogen peroxide was measured in five or more pistils from each genot ype. Bars indicate standard errors. Asterisks indicated significant differences between the mutant genotypes and the wild type (WT) (* p < 0.05 and ** p < 0.01).

PAGE 45

45 A B C Figure 2 5. Quantitative PCR of PER17 (A), PER28 (B) and PER29 (C) transcript levels in 30 day old rosette leaves (RL), cauline leaves (CL), roots, stage 12 flowers, stage 12 pistils, and 10 day old seedlings. The error bars result from three technical replicates.

PAGE 46

46 A B C D Figure 2 6. Three PER GFP proteins localize in the cytosol of Arabidopsis root cells. Merged confocal images show GFP (green) and cell wall (blue) fluorescence in (A) wild type (B) PER17 GFP (C) PER28 GFP and (D) PER29 GFP cells.

PAGE 47

47 CHAPTER 3 HETEROLOGOUS EXPRESS ION OF PER17 28 AND 29 IN ARABIDOPSIS AND SOYBEAN Background Environmental s tress impact s agriculture by causing up to 20 fold reductions in yield (Boote et al., 2005; Boyer, 1982 ; Prasad et al., 2002). Many stresses, including salt and heat stress, lead to ROS accumulation ( Apel and Hirt, 2004; Mittler et al., 2004 ) which is toxic to cells Plants, therefore, have evolved a sophisticated network to scavenge ROS in order to minimize damage and manage the redox state of the cell. In Chapter 2, three scavenging genes ( PER17 28 and 29 ) that modulate ROS metabolism during plant development were evaluated. Mutants of these three Class III peroxidases caused ROS accumulation and subsequent high rates of ovule abortion/seed failure. These peroxidases were ectopically expressed in A rabidopsis and their effects on reproduction were evaluated in this chapter. In addition, these peroxidases were heterologously expressed in soybean plants ( Glycine max ). Like many seed producing species, the grain yield of soybean plants decreases when t hey experience heat stress (Boote et al., 2005). Supra optimal temperature affects flower set, pollination, fruit set, seed formation, and grain yield (Prasad et al., 2000, 2001, 2002). To investigate how modifying ROS scavenging capacity in soybean plant influences the reproductive physiology of healthy and stressed plants, PER17 28 and 29 from Arabidopsis were transformed into soybean plants and the transgenic soybean plants were characterized.

PAGE 48

48 Materials and Methods Constructs The pEW401M L plasmid contains the PER17 coding sequence and an upstream in frame myc tag (MEQ KLISEEDL) T he pEW402ML and pEW403ML plasmids contain respectively PER28 and PER29 each with a myc tag. The C a MV 35S promoter drives expression of the myc PER genes For complementa tion test s, each construct wa s introduced into the respective Arabidopsis mutant To generate over expressing Arabidopsis plants the same constructs were introduced into Col 0 wild type plants. In addition, a transgenic line containing a blank vector and a myc tag was created as a control. For soybean transformation, myc PER fragment s were insert ed into the pZY101 vector and were transformed into soybean plants as described in Zeng et al. (2004) by the Plant Transformation Core Facili ty at the University o f Missouri. Plant M aterials For fertility assays Arabidopsis thaliana (Col 0 or transgenic) plants were grown in 2 x 2 pots in a Percival plant growth chamber (Perry, IA) at 22C, 50% relative humidity, and continuous fluorescent lighting (5 0 mol m 2 s 1 ). To s tress plants, the pots were irrigated once with 75 mM NaCl Transgenic plants used in the fertility assay were from T3 homozyous seeds. For the peroxidase activity assay, plants were grown in a Percival at 22C with continuous 2 s 1 irr adiance. Seeds were sterilized in 0.6% hypochlorite with 0.01% Tween 20 for 15 minutes and washed five times with sterile water. After incubating in the dark at 4C for 3 days, seeds were spread on medium containing half strength MS salt s 1X B5 vitamins, 1% sucrose, pH 5.8, and 0.5% phytoagar. Transgen ic plants that over expressed PER protein s were used for the peroxidase activity assay.

PAGE 49

49 Wild type soybean [ Glycine max (L.) Merr. cv. Maverick ] and transgenic soybean plants were pot grown (9 inch, 2.5 gallo n pot) in the gree nhouses starting in August, 2012. Seeds were germinated at 30 C under natural lighting in Gain es ville, Florida. Prior to potting, 12 liters of perlite and 18 tablespoons of Osmocote (19 6 12) were mixed with 2.8 cubic feet of SunGro Sunsh ine MVP (Agawam, MA) potting soil The environment wa s maintain ed at 50 % humidity and 700 ppm CO 2 to minimize photorespiration. Ten days after sowing, temperature tr eatments began : 30/22, 34/26, 38/30 and 42/34C (day/night temperature transition at 9 am/pm). Soybean plants were harvested when at least 60% of soybean pods reached R8 stage ( Pedersen, 2009 ) which was 101 130 days after sowing Leaf areas were measured and dry weights were collected after drying at 65C for 3 days. Pods were air dri ed and seed weights were measured Seed abortion rate was measur ed from the population of successfully seeded pods at the final harvest. The h arvest index was calculated as the ratio of seed weight to the total aboveground dry weight. Shelling percentage w as calculated by total seed weight over total pod weight X 100%. Reverse Transcription PCR (RT PCR) Total RNA from Arabidopsis inflorescences was isolated using RNeasy mini kit (Qiagen Valenc ia, CA) minating genomic DNA was removed by treating with DNase I (Promega, Madison, WI) as suggested by the manufacturer Complementary DNA (cDNA) was synthesized using SuperScript II reverse transcriptase (Invitrogen, Grand Island, NY) from 1 g of total RNA th at was primed with 0.5 g Oligo(dT) 12 18 T ranscripts of myc PER were amplified using 1 st strand cDNA template and the following primers: myc

PAGE 50

50 AAGCTTATCAGTGAGGAAGAC AGATACAAGCAATACATCAATAG myc PER17 ; CTTCTAATTACTCCTTCATTCC myc PER29 ). Primers used for endogenous PER17 transcripts amplification were as listed in Chapter 2 (Table 2 2). UBQ10 transcripts were amplified and served as internal controls using the same 1 st strand cDNA template and U BQ10 GAAAACAATTGGAGGATGGTC GAGACGAGATTTAGAAACCAC Immunobloting Soluble proteins from Arabidopsis inflorescence were extracted in buffer containing 100 mM Tris pH7.5, 5 mM EDTA pH8.0, 0.1% SDS, 20 mM mercaptoethan o l and 1 m M PMSF. Protein concentration was determined with a Bradford assay ( Bradford, 1976 ). Twenty micrograms of proteins were loaded and separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE). Proteins were transferred t o a PVDF membrane (Millipore, Billerica, MA ) at 4C and constant 2 5 0 mA The membrane was blocked with 5% non fat milk solution and then incubated with 1:2000 diluted mouse anti myc antibody (Millipore) overnight at 4C. After six 10 min washes with PBST ( 3.2 mM Na 2 HPO 4 0.5 mM KH 2 PO 4 1.3 mM KCl, 135 mM NaCl, 0.05% T ween 20, pH 7.4), the membrane was incubated in 5% non fat milk solution with 1:10, 000 diluted rabbit anti mouse IgG HRP antibody ( Jackson ImmunoResearch, West Grove, PA ) at room temperature fo r 1 hour. After developing with SuperSignal West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL ), fluorescence was captured using BioMax Light Film (Kodak, Rochester, NY ).

PAGE 51

51 Results and Discussion Ectopic Expression of PER17 in Arabidopsis The 35S::myc PER17 construct contains a 35S promoter that expresses the PER17 cDNA with an upstream myc tag attached. Transformation of this construct into Arabidopsis per17 mutants complemented the fertility of this genotype (Table A 1), indicating that the t ransgene was biologically active. The same construct was, therefore, transformed into Arabidopsis (Col 0); creating genetic lines over expressing PER17 (designated PER17OE). Four independent PER17OE transformants, 6916, 6824, 6987, and 6932, were evaluated When the fertility of these PER17OE genetic lines was examined, no significant difference in terms of ovule abortion rates was observed in 6916, 6824, or 6932 when compared to the wild type or the vector controls (Arabidopsis transformed with 35S::myc ) u nder normal growth conditions (Table 3 1). After plants were salt stressed, 6932 showed higher fertility ( p < 0.05) than the wild type and the vector controls. The 6916 and 6824 genetic lines showed reduced fertility. The 6987 genetic line consistently sho wed high ovule abortion rates no matter whether they were under normal or salt stressed conditions. To interpret why the fertility varied in each PER17OE genetic line, the expression level of myc PER17 transcripts and proteins was examined. Immunoblotting results showed n o detectable myc PER17 protein express ion in any of the PER17OE genetic lines (data not shown). RT PCR revealed myc PER17 transcripts in 6916, 6824, and 6932 were abundant (Fig. 3 1A). Similar results were shown in the per17 mutant transfo rmed with 35S::myc PER17 (designated per17 Compl). One out of three per17 Compl genetic lines showed myc PER17 protein expression while the other two genetic lines only had detectable myc PER17 transcripts (Fig. A 1). Despite the

PAGE 52

52 absence of detectable myc PER17 protein, all three of these genetic lines complemented per17 mutants. These results suggest that the e xpression of myc PER17 protein was strictly regulated. It is puzzling that the 6916, 6824, and 6932 genetic l ines had high levels of myc PER17 mRNA expression, but their fertility results varied. In Chapter 2, we proposed PER17 is important for protecting ovules from abortion under salt stress. However, only one genetic line (6932) showed higher tolerance to salt stress. Alternatively, overexpression of myc PER17 may alter the endogenous PER17 transcriptional expression or translational regulation and result in a decrease of PER17 levels and/or activity. Quantitatively examination of endogenous PER17 transcripts o r protein levels in PER17OE genetic lines may help to answer this question. The effects of the 6987 transgenic line, however, could result from rearrangement of the T DNA during insertion, transgene mediated co suppression, or RNA interference. Ectopic Ex pression of PER 28 in Arabidopsis Transformation of the 35S::myc PER28 construct into per28 mutants and complementation of the mutant phenotype indicate the transgene is functional (Table A 1). The same construct was used to create transgenic Arabidopsis pl ants that over express myc PER28 (designated PER28OE). In the 6754, 6792, 6797, 6784, and 6685 genetic lines evaluated two out of five PER28OE genetic lines exhibited significantly low er fertility (Table 3 2) Consequently, the myc PER28 protein levels were examined in PER28OE genetic lines (Fig. 3 1 B ) Three bands were present in the immunoblots. The top band was equivalent to the predicted size of myc PER28 protein ( 36.3 k Da ) The molecular weights of the o th er two bands were 1 and 2 kDa smaller than this. These truncated proteins probably were no t a result of degradation because the

PAGE 53

53 recombinant protein expressed in E. coli did not show any similar degradation pattern (data not shown) Alternatively, there may be cryptic splice sites in the myc PER28 construct or the PER28 protein has a signal peptide at its C terminus and was clipped during organelle targeting. PTS1 and PTS2 targeting sequences were missing from this protein, indicating this protein probably d oes not transit to peroxisomes. The PER28 GFP was localized in the cytoplasm (Chapter 2). This construct has additional C terminal amino acids that might interfere with protein targeting. An N terminal GFP fusion to PER28 could be used to determine if this was a problem. The more myc PER28 proteins were expressed, the less fertile the PER28OE genetic line was. According to PER28::GUS staining, the gene was first expressed in the transmitting track of stage 12 flowers and then was expressed in the stigma at higher levels (Fig. C 3A). In stage 13 flowers, when the stigma is most receptive to pollination (Smyth, 1990), PER28 displayed maximal expression (Fig. C 3B). Based on its expression pattern, PER28 may belong to one of the stigma specific peroxidases (cla ss III peroxidases). Stigma specific peroxidases are active when the stigma becomes receptive (McInnis et al., 2006b). In addition, stigma specific peroxidases exhibited lower activity when compared to horseradish peroxidase, and so did myc PER28 (Fig. B 1 B). The expression of these genes is consistent with a role in pollen stigma interaction or pollen tube growth/tracking. A pollen tube travels along transmitting tissue before it fertilizes an ovule. The composition of transmitting tissue includes highly s ecretory cells with nutrients and signals that may be involved in pollen tube guidance (Wilhelmi and Preuss, 1997). The tip growth of pollen tubes required ROS buildup and the presence of antioxidant that alters pollen growth in vitro (Potoky et al., 2007)

PAGE 54

54 However, the pollination and pollen tube growth appeared normal in the PER28 OE transgenic lines (data not shown). Alternatively, ectopic expression of myc PER28 may affect the growth of pistils or stamen filaments, interfering with the timing of pollinat ion and consequently reducing fertility. Previous experiments showed that when the timing of pollination did not occur when the stigma was most receptive, decreased seed sets resulted (Herrero, 2003). Ectopic Expression of PER 29 in Arabidopsis The 35S::myc PER29 construct was able to restore a normal phenotype to per 29 mutants (Table A 1), indicating that myc PER29 was biologically active. Five PER29OE genetic lines, 6682, 6722, 6725, 6764, and 6775, were created by introducing the 35S::myc PER29 co nstruct into Arabidopsis Although the fertility results showed no significant difference between PER29OE and controls under healthy and salt stressed conditions (Table 3 3), the average ovule abortion rate of salt stressed PER29OE was lower than controls. When comparing the ovule abortion rate between healthy and salt stressed plants, the vector control showed significantly reduced fertility after salt stress ( p < 0.01). In contrast, the fertility of PER29OE plants was not significantly altered before or a fter salt stress. These results indicated that PER29OE promoted salt tolerance. Immunoblotting revealed a strong band the same size as the predicted myc PER29 protein (38.4 kDa; Fig. 3 1B). In the evaluated genetic lines, moderate expression of the myc PER 29 protein showed the greatest salt tolerance (Table 3 3 and Fig. 3 1B). According to PER29::GUS staining, this gene is active in ovules, especially around the gametophyte (Fig. C 1C and D). In addition, it was expressed in guard cells (Fig. C 1E). In the siliques, PER29::GUS staining wa s only present in aborted ovule s,

PAGE 55

55 but not de veloping seeds (data not shown), indicating that PER29 was expressed during gametophyte development, but not during embryogenesis. Sun et al. (2005) reported that a fter salt stress ing ROS initially accumulated in the gametophyte and then spread throughout the ovule Thus, PER29 may be responsible for regulating ROS in the gametophyte prior to fertilization. Aggarwal (2009) proposed that ROS accumulation in the filiform apparatus ca uses pollen tube rupture and release of the male gametes in the female gametophyte. The expression of PER29 is consistent with a regulatory role in the release of male gametes from the pollen tube into the female gametophyte. In addition, mutants that comp romise this process might exhibit fertility or fertilization problems. PER29 was also expressed in the guard cells (Fig. C 1E and data not shown), where it is known that H 2 O 2 act s as a secondary messenger in ABA mediated stomata l clos ure (Kwak et al., 2003; Pei et al., 2000). Perhaps PER29 is involved in this regulatory pathway in guard cells. Responses of Wild type S oybean Plants to Heat S tress Soybean plants were grown in four different temperature regimes: 30/22, 34/26, 38/30, and 42/34C (day/night), as described in materials and methods. The wild type Maverick plants at 30/22C had the highest total pod and seed masses (Table 3 4) and the lowest pod and seed abortion rates (Table 3 5). Although the average pods and seeds produced per plant in the 34/26C treatment was greater than in the 30/22C treatment, seeds produced in the 30/22C had higher quality based on the average seed mass and the number of seeds each pod carried (Table 3 4). The harvest index is the ratio of the yield (dry mass of interest) to the total aboveground dry mass. Results revealed that pod and seed harvest indexes for soybean plants grown in the 30/22 and 34/26C treatments were not significantly different (Table 3 5). Overall, the results

PAGE 56

56 indicate that 30/22 C was the optimal growing temperature for soybean plants (Gibson and Mullen, 1996). Soybean plants grown at higher temperatures experienced stress responses, including increased pod and seed abortion rates, reduced pod and seed harvest indexes, lower tot al and average seed masses, and decreased shelling percentage (Table 3 4 and 3 5). Shelling percentage is the ratio of the seed mass to pod mass. Under moderate heat stress (34/26C), pod abortion rate, seed abortion rate, seeds per pod, and average seed m ass differed significantly ( p < 0.01), while pod and seed harvest indexes and total seed mass did not. Under high heat stress (38/30C), all yield parameters were significantly lower ( p < 0.001). Soybean plants grown in severe heat stress (42/34C) produce d sterile flowers that lacked pollen grains ( Fig. 3 2 ). In addition, severe heat stress delayed the initiation of reproductive development (Fig. 3 3). Under moderate heat stress (34/26C), the number of nodes on the longest branch significantly increased ( p < 0.001), indicating assimilate partitioning moved into branches. Nonetheless, the number of branches remained unchanged (Table 3 6). Under severe heat stress (38/30 and 42/34C), the biomass increased significantly ( p < 0.05 and p < 0.001, respectively) at the expense of reproductive growth (Table 3 6). Heterologous E xpression of PER17 in S oybean The 35S::myc PER17 construct was used to create transgenic soybean plants that heterologously expressed myc PER17 (designated 501). Transformants were resistant to the herbicide BASTA. PCR genotyping for the presence of the transgene revealed that the transgene was in plants, but there was rearrangement near the ends of the transgene (data not shown). In 30/22C, the 501 transgenic lines had significantly lower seed abortion rate than the controls (Table 3 5). According to the harvest indexes,

PAGE 57

57 the 501 transgenic lines performed better in 30/22C than at higher temperatures (Table 3 5). The 501 transgenic lines had hig her pod and seed harvest indexes than the controls, while the shelling percentage remained similar to the controls in 30/22C (Table 3 5). Total seed mass and total pod mass increased (Table 3 4). In addition, the 501 transgenic lines had significantly mor e nodes on the longest branch (Table 3 6). Total branch pod and seed masses were higher than in the controls (data not shown). These results indicate that the 501 transgenic lines had higher harvest indexes, which may be a result of increased branch growth Heterologous E xpression of PER28 in S oybean The 35S::myc PER28 construct was used to create transgenic soybean plants that heterologously expressed myc PER28 (designated 502). Transformants were resistant to the herbicide BASTA. PCR genotyping for the pr esence of the transgene revealed that the transgene was in plants, but there was DNA rearrangement near the ends of the transgene (data not shown). In the 30/22C treatment, the growth of 502 transgenic lines did not significantly differ from the Maverick controls. Under moderate heat stress (34/26C), the 502 transgenic lines showed significantly higher shelling percentage, more seeds per pod, and fewer branches (Table 3 5 and 3 6). The shelling percentage of control soybean plants decreased under heat str ess (Table 3 5). The higher shelling percentage indicated that the 502 transgenic lines were more tolerant to moderate heat stress (34/26C). In addition, the seed abortion rates of the 502 transgenic lines were consistently lower in all temperature regim es when compared to the controls (Table 3 5). Increasing the sample size may result in statistical differences When the same construct was over expressed in Arabidopsis plants, the transgenic lines with high protein expression

PAGE 58

58 exhibited high abortion rate s. In transgenic soybeans, the expression of myc PER28 proteins was undetectable (data not shown). This reveals that the control points and the mechanisms controlling ROS levels and regulations likely differ between these two species. Alternatively, the re gulatory processes are ineffective with the heterologous protein. Evaluation of many other transgenic constructs reveals that transgenes often cause different effects in heterologous systems. Heterologous Expression of PER29 in S oybean The 35S::myc PER29 construct was used to create transgenic soybean plants that heterologously expressed myc PER29 (designated 503). Transformants exhibited BASTA resistance and the PER29 coding sequence was amplified from transgenic plants (data not shown). In the 30/22C tr eatment, the growth parameters measured in the 503 transgenic lines did not differ significantly from the Maverick controls. However, the 503 transgenic lines resulted in increased average seed mass. This phenotype was present in 30/22C and became statist ically significant under moderate heat stress 34/26C (Table 3 4). In 503 seeds, more photoassimilate was transferred into developing embryos, resulting in higher carbohydrate and storage protein levels. Composition of seed contents and seed vigor will be examined in the future. In addition, the 503 transgenic lines also showed significantly fewer pod s lower pod abortion rates in 34/26C and much more biomass in 34/26 and 38/30C (Table 3 4, 3 5, and 3 6). While the 503 transgenic lines had lower pod abort ion, seed abortion rate may be a better index to evaluate plant fertility because the number of small pods (< 20 mm) that fall prior to harvest could vary between genotypes. Remarkably, the majority of the vegetative tissues from the 503 transgenic lines r emained green through the R8 stage, while those of the controls mostly turned yellow and/or abscised (data not

PAGE 59

59 shown). Thus, the decreased harvest index of the 503 transgenic lines under heat stress was a result of increased total biomass, rather than decr eased pod and seed masses (Table 3 4 and 3 5). Summary The goal of this study was to investigate whether increased ROS scavenging capacity in Arabidopsis and soybean plants would counteract the physiological changes under environmental stresses and promote fecundity. Three Arabidopsis cytosolic peroxidases ( PER17 28 and 29 ) that modulate ROS metabolism during plant development wer e continuously over expressed in Arabidopsis using 35S promoter. One of the PER17OE transgenic lines showed better tolerance to salt stress and had significantly increased fertility compared to the controls, while the other PER17OE transgenic lines did not Based on the discrepancy between transcript and protein expression levels (Fig. 3 1 and data not shown), it is likely that the PER17 protein levels of those PER17OE transgenic lines were regulated post transcriptionally, i.e ., the steady state level of P ER17 protein was not determined by the rate of transcription, but at down stream control points for gene expression. Unexpectedly, PER28OE transgenic lines with high levels of myc PER28 proteins showed lower fertility in unstressed plants. Over expression of PER28 may affect pistil or stamen filament growth and result in low fertility. The fertility results from PER29OE transgenic lines indicated that PER29OE promoted salt tolerance. Transgenic soybean plants that contained these transgenes were evaluated u nder heat stress. The 501 transgenic lines had higher harvest index when grown at 30/22C, but did not show increased tolerance to heat stress. The 502 transgenic lines were more tolerant to moderate heat stress (34/26C) than the controls and showed lower seed abortion rates. The 503 transgenic lines produced bigger seeds

PAGE 60

60 than the controls and their leaves stayed green under moderate heat stress (34/26C). However, none of these transgenic soybean plants showed greater tolerance to heat extremes (38/30C) As expected, over expression of PER28 and PER29 under heat stress resulted in decreased seed abortion rates but the effects were not statistically significant. Increasing the sample size may result in statistical differences Under high heat stress, howe ver, decreased seed abortion rates were not sufficie nt to maintain total reproductive mass

PAGE 61

61 Table 3 1. The fertility of Arabidopsis PER17OE and controls were evaluated. S tressed plants were water ed once with 75 mM NaCl For e ach genotype, 36 pistils were scored. Abortion rates were arcsine transformed and compared. Statistical difference s between transformants and controls are marked: less than 0.05, a 0.01, b and 0.0001. c Abortion rate* (%) Genotype Healthy Stressed Wild type 7.2 1.6 12.1 3.0 6916 9.6 2.1 27.5 4.6 b 6824 9.0 1.8 18.9 3.6 6987 23.9 2.8 c 24.9 3.7 a 6932 7.2 1.6 4.3 0.8 b Vector control 8.5 1.9 11.4 3.1 The o vule abortion rate is the average one standard error.

PAGE 62

62 Table 3 2. The fertility of Arabidopsis PER28 OE and controls were evaluated. For e ach genotype, 12 pistils were scored. Abortion rates were arcsine transformed and compared. Statistical difference s between transformants and controls are shown below: less than 0.05, a 0.01, b and 0.0001. c Genotype Abortion rate* (%) Wild type 4.4 1.0 6 754 6.0 0.9 6792 14.3 4.0 a 6797 5.2 1.1 67 84 49.5 9.4 c 6685 12.0 6.6 The o vule abortion rate is the average one standard error.

PAGE 63

63 Table 3 3. The fertility of Arabidopsis PER29 OE and controls were evaluated. Stressed plants were water ed once with 75 mM NaCl For e ach genotype, 20 healthy pistils and 30 salt stressed pistils were scored. Abortion rates were arcsine transformed and compared by one way ANOVA. The fertility of each tested genotype and the wild type control did not differ significantly. Abortion rate* (%) Genotype Healthy Stressed Wild type 6.6 1.1 11.7 3.4 668 2 5.9 1.1 6.5 1.1 6722 5.7 1.0 8.3 1.7 67 25 4.6 0.8 9.1 1.9 6764 7.6 2.1 9.9 3.8 6 775 3.5 0.8 10.6 3.8 Vector control 4.3 0.6 8.6 1.6 The o vule abortion rate is the average one standard error.

PAGE 64

64 Table 3 4. Soybean yield was modulat ed by temperature and genotype. ANOVA tests evaluat ed yield parameters between transgenic soybean plants and the Maverick control plants : significant difference s of less than 0.05, a 0.01, b and 0.001 c are marked. Temperature treatment (C) 30/22 34/26 38/30 Pod set (number per plant) Maverick control 131.2 210.2 153.0 501 ( Myc PER17 ) 162.3 170.4 109.0 502 ( Myc PER28 ) 140.5 168.2 104.3 503 ( Myc PER29 ) 124.2 147.8 a 89.8 b Seed set (number per plant) Maverick control 299.2 402.2 250.8 501 ( Myc PER17 ) 374.0 354.8 177.3 502 ( Myc PER28 ) 323.8 353.2 168.0 503 ( Myc PER29 ) 281.0 303.8 138.3 a Seeds per pod Maverick control 2.3 1.9 1.6 501 ( Myc PER17 ) 2.3 2.0 1.6 502 ( Myc PER28 ) 2.3 2.1 b 1.6 503 ( Myc PER29 ) 2.3 2.1 1.5 Total pod mass (g/plant) Maverick control 84.48 86.81 49.97 501 ( Myc PER17 ) 102.94 77.51 33.80 502 ( Myc PER28 ) 91.43 80.06 32.50 503 ( Myc PER29 ) 83.17 76.61 30.00 b Total seed mass (g/plant) Maverick control 61.88 59.46 29.94 501 ( Myc PER17 ) 75.26 54.05 20.06 502 ( Myc PER28 ) 67.99 56.17 18.91 503 ( Myc PER29 ) 61.73 53.31 17.59 b Average seed mass (g/seed) Maverick control 0.208 0.149 0.120 501 ( Myc PER17 ) 0.202 0.152 0.109 502 ( Myc PER28 ) 0.210 0.158 0.101 503 ( Myc PER29 ) 0.221 0.176 a 0.127

PAGE 65

65 Table 3 5. Soybe an fertility and harvest index w as affected by temperature and genotype. ANOVA tests compared parameters between transgenic soybean plants and the Maverick control plants : significant difference s of less than 0.05, a 0.01, b and 0.001 c are marked. Temperature treatment (C) 30/22 34/26 38/30 Pod abortion rate (%) Maverick control 0.2 3.4 4.7 501 ( Myc PER17 ) 0.5 1.6 6.8 502 ( Myc PER28 ) 0.4 3.1 9.0 503 ( Myc PER29 ) 0.3 1.1 a 5.8 Seed abortion rate (%) Maverick control 9.9 24.5 39.7 501 ( Myc PER17 ) 2.8 c 24.5 35.8 502 ( Myc PER28 ) 8.7 21.9 35.2 503 ( Myc PER29 ) 9.7 22.9 39.0 Pod Harvest Index (%) Maverick control 69.4 75.0 42.2 501 ( Myc PER17 ) 75.8 70.0 26.4 a 502 ( Myc PER28 ) 70.4 69.3 27.4 503 ( Myc PER29 ) 70.0 62.6 a 20.8 b Seed Harvest Index (%) Maverick control 50.8 51.2 25.4 501 ( Myc PER17 ) 55.5 49.0 15.6 a 502 ( Myc PER28 ) 52.4 48.8 15.8 503 ( Myc PER29 ) 51.9 43.6 a 12.2 a Shelling percentage (%) Maverick control 73.1 68.4 59.8 501 ( Myc PER17 ) 73.3 69.4 58.8 502 ( Myc PER28 ) 74.4 70.4 a 56.5 503 ( Myc PER29 ) 74.2 69.7 58.3

PAGE 66

66 Table 3 6. Soybean vegetative growth w as affected by temperature and genotype. ANOVA tests compared growth parameters between transgenic soybean plants and the Maverick control plants : significant difference s of less than 0.05, a 0.01, b and 0.001 c are marked. Temperature treatment (C) 30/22 34/26 38/30 42/34 Total Biomass (g/plant) Maverick control 37.84 29.61 71.00 89.88 501 ( Myc PER17 ) 33.23 32.16 89.34 59.32 a 502 ( Myc PER28 ) 38.37 35.98 76.52 56.50 503 ( Myc PER29 ) 35.28 44.71 a 113.98 b 46.34 a Stem mass (g/plant) Maverick control 24.40 21.56 45.52 33.92 501 ( Myc PER17 ) 24.48 21.20 52.79 20.00 a 502 ( Myc PER28 ) 22.77 22.65 46.80 20.69 503 ( Myc PER29 ) 21.62 24.54 59.28 15.30 b Branch number Maverick control 9.0 10.8 9.2 7.2 501 ( Myc PER17 ) 9.8 8.0 a 10.5 6.3 502 ( Myc PER28 ) 6.8 6.6 b 8.7 6.3 503 ( Myc PER29 ) 5.0 a 4.5 b 8.5 5.0 Node # on branch* Maverick control 7.0 10.8 20.8 24.2 501 ( Myc PER17 ) 9.3 a 12.2 18.8 27.0 502 ( Myc PER28 ) 8.5 10.2 19.7 26.8 503 ( Myc PER29 ) 7.8 10.8 18.3 21.6

PAGE 67

67 A B Fig ure 3 1. RNA expression and protein expression in over expressing transgenic Arabidopsis plants were evaluated (A) First strand cDNA was synthesized from PER17OE transformants (6916, 6824, 6987 and 6932). Transcripts were amplified by RT PCR. The endogenous PER17 transcripts wer e amplified using primers derived from the UTRs. The myc PER17 transcripts from the transgene were amplified using the forward primer derived from the myc tag. UBQ10 transcripts were amplified and served as internal control. (B) Protein expressio n of myc P ER28 and myc PER29 was detectable using an anti myc antibody to probe immunoblots The 6754, 6792, 6797, 6784 and 6685 are PER28OE transgenic lines. The 6682, 6722, 6725, 6764 and 6775 are PER29OE transgen ic lines.

PAGE 68

68 A B Figure 3 2. Soybean plants grown at supra optimal temperatures experience a reduct ion in fertility ze any pollen (A, right), but pollen was synthesized t). Flowers open when plants were ed closed (B, bottom).

PAGE 69

69 Figure 3 3. Reproductive growth of Maverick was delayed at 38/30C. Reproductive developmental stages were determined as described in Pedersen (2009).

PAGE 70

70 CHAPTER 4 THE APX4 LOCUS REGULATES SEED VIGOR AND SEEDLING GROWTH IN ARABIDOPSIS The amino acid sequence and crystal structure of APX4 are similar to other ascorbate peroxidases (APXs), a group of proteins that protect plants from oxidative damage by transferring electrons from asc orbate to detoxify hydrogen peroxides In this study, we characterized two apx4 mutant alleles. Translational fusions with GFP indicated APX4 localizes to chloroplasts. Both apx4 mutant alleles formed chlorotic cotyledons with significantly reduced chlorophyll a chlorophyll b and lutein levels, indicating APX4 is an important component for seedling establishment. The growth of apx4 seedlings was stunted early in seedling development. In addition, APX4 altered seed quality by affecting seed coat formation. While apx4 seed development appeared normal, the seed coat was more permeable than in wild type. In addition, accelerated aging tests showed that apx4 seeds were more sensitive to environmental stress than wild type seeds. APX4 transcripts were abundant in shoot tissues. As revealed by in situ hybridization and GUS staining, APX4 is present in the mesophyll and phloem. In addition, the expression of APX4 was wound induced. Mutation of APX4 resulted in increased H 2 O 2 accumulation and significantly reduced total APX activity in apx4 2 seedlings This result leads us to hypothesize that APX4 is involved in the ROS scavenging process, possibly by affecting the activity or stability of other APXs Background Ascorbate peroxidases (APXs) are heme containing proteins that convert hydrogen peroxides (H 2 O 2 ) into water using ascorbate one of the major ant ioxidants in plant cells, as the reducing substrate. When superoxides are generated as by products of photosynthesis or the product of NADPH oxidases, superoxide dismutases (SODs)

PAGE 71

71 rapidly convert superoxides into a neutral and relative stable molecule, H 2 O 2 APXs scavenge H 2 O 2 and neutralize it through the ascorbate glutathione cycle. In this cycle, another three enzymes, monodehydroascorbate reductase (MDAR/MDHAR), glutathione dependent dehydroascorbate reductase (DHAR), and glutathione reductase (GR), are involved in regenerating ascorbate back into the cellular antioxidant pool. This ROS scavenging cycle is active in chloroplasts, mitochondria, the cytosol, and peroxisomes (Asada, 1999; Noctor and Foyer, 1998). Based on amino acid sequence similarity to bacterial enzymes, APXs are classified as class I peroxidases, along with yeast cytochrome c peroxidase (CCP) and cyanobacterium CPX (Welinder, 1992). The crystal structure of typical APXs resembles CCP, which has 10 helixes. Important APX signatures are the catalytic domain, the heme binding domain, and the ascorbate binding domain. Amino acid residues in each domain are conserved within APX isoforms. In Arabidopsis APX1, Arg38 and His42 in the catalytic domain, His163 and His169 in the hem e binding domain and Lys30, and Arg172 in the ascorbate binding domain are highly conserved residues, which are proposed to be the key residues (Henrissat et al., 1990; Schuller et al., 1996; Sharp et al., 2003). Substitution of these residues reduces cata lytic ability or ascorbate utilization of APX (Bursey and Poulos, 2000; Celik et al., 2001). In Arabidopsis, APXs are found in several cellular compartments. APX1 (AT1G07890) and APX2 (AT3G09640) are both cytosolic and protect cells from oxidative stress. Reports show that APX1 is constantly expressed, but is up regulated by high light, heat, and wounding, while APX2 is only expressed under extreme light stress (Davletova et al., 2005; Karpinski et al., 1997; Maruta et al., 2012). APX3

PAGE 72

72 (AT4G35000) is found in peroxisomes. Increased APX3 activity provided resistance to the oxidative stress present in peroxisomes (Wang et al., 1999). The phenotype of apx3 mutant indicates that there is a redundant ROS scavenging mechanism that compensates for the loss of apx3 function (Narendra et al., 2006). Thylakoid APX (tAPX, AT1G77490) is in chloroplast membranes with its catalytic domain oriented toward stroma. The tapx mutant does not show an obvious mutant phenotype, even under oxidative stress (Giacomelli et al., 2007; Jespersen et al., 1997; Kangasjarvi et al., 2008; Kitajima, 2008). Stromal APX (sAPX, AT4G08390) has been found in both chloroplasts and mitochondria. During early seedling development, the lost of function sapx mutant exhibits the chloroplast bleached ph enotype under photo oxidative stress (Chew et al., 2003; Jespersen et al., 1997; Kangasjarvi et al., 2008). According to sequence similarity, APX4 (AT4G09010), APX5 (AT4G35970), and APX6 (AT4G32320) are Arabidopsis APXs. APX5 and APX6 are predicted to be microsomal targeted and cytosolic respectively, but no experimental evidence has been reported (Panchuck et al., 2002). Sequence similarity and crystal structure of APX4 reveals this protein resembles other ascorbate peroxidases, but APX4 is missing conse rvative residues in the catalytic and heme binding domains and reportedly lacks APX activity (Granlund et al., 2009; Kieselbach et al., 2000; Lunderg et al., 2011; Teixerira et al., 2004). In addition, the ascorbate binding portion of APX4 is missing and t he protein lacks ascorbate binding ability (Granlund et al., 2009). In this study, two mutant alleles, apx4 1 and apx4 2 were characterized. We conclude that APX4 plays an important role in regulating seedling growth, seed quality, and APX activity, despi te the fact that APX4 lacks catalytic ability.

PAGE 73

73 Materials and Methods Plant M aterial Plants were grown in square 2.5 inch pots with continuous fluorescent light (100 mol m 2 s 1 ). Arabidopsis thaliana wild type (Col 0) and apx4 T DNA inserted mutants (SAIL_519_E04 as apx4 1 and SALK_119726 as apx4 2 ) were characterized from ABRC stocks (Alonso et al., 2003). Homozygous mutants were isolated by polymerase chain reaction (PCR). Two gene CTGTTCCTTCCTTCACCA AC AGTTTGCTCAGATTGATCCGT wild type allele. One gene specific primer and one primer from the T DNA border sequence were used to confirm the presence of mutant alleles. Germination T est Seeds were steri lized in either 0.6% or 3% hypochlorite with 0.01% Tween 20 for 15 minutes and washed several times with sterile water. Seeds were stored in the dark at 4C for 3 days before they were spread on the GM plates (half strength MS salt, 1X B5 vitamins, 0.5% ph ytoagar, pH 5.8). Sterilized seeds were incubated in a Percival 2 s 1 irradiance. Germination was recorded daily for 7 days. Germination was defined as 1 mm radical emergence. For accelera ted aging tests, seeds were incubated in a chamber at 41.5C with 100% relative humidity for 3 days and air dried for another 3 days. Aged seeds were sterilized and sown on GM plates, as described above. Seed Viability and Seedling G rowth Intact and perfor ated seeds were imbibed in 1% 2,3,5 triphenyl tetrazolium chloride solution (Sigma, St. Louis, MO) according to Boisson et al. (2001) to determine seed viability. For seedling growth comparison, wild type (Col 0) and two apx4 mutant

PAGE 74

74 seeds were grown on GM plates (phytoagar was replaced with 1.5% agar) for seven days. Plates were set vertically so roots grew along the surface of the plates and were measured with a ruler. Images of individual plants were captured and the leaf area was estimated using these im ages. Results were analyzed by one way ANOVA. Pigment E xtraction Fresh weights of seven day old plants were measured. Individual plants were ground in liquid nitrogen and pigments were dissolved in 1 mL of 100% acetone in the dark for 10 minutes with perio dic vortex. The absorbance of chlorophyll a chlorophyll b and lutein pigment were spectrophotometrically measured at 662 nm, 645 nm, and 474 nm, respectively. Pigment content was calculated according to the Beer Lambert law by using extinction coefficien t of 82.7 L g 1 cm 1 for chlorophyll a 50.7 L g 1 cm 1 for chlorophyll b and 197.3 L g 1 cm 1 for lutein (Bulda et al., 2008). Reverse Transcription PCR (RT PCR) Total RNA was isolated from various tissues using RNeasy mini kit (Qiagen, Valencia, CA). Co mplementary DNA (cDNA) was synthesized using SuperScript II suggested by manufacturer. APX4 transcripts were amplified using 1st strand cDNA and gene specific primers: to ampli fy full length APX4 transcripts F2 and R2 primers were used; to amplify APX4a AGATACGGTTTCACGGCTTC APX4b CTGCATATGAAATAGGACCTC UBQ10 transcripts were amplified as internal controls using the same 1st strand cDNA template and UBQ10 GAAAACAATTGGAGGATGGTC GAGACGAGATTTAGAAACCAC

PAGE 75

75 In S itu H ybridization In situ hybridization was performed according to Park et al. (2004). Seven day old Arabidopsis seedlings were grown on GM plates with 1% sucrose, then embedded in paraffin and 10 m sections mounted on slides. For sense probe synthesis, forward TAATACGA CTCACTATAGGGCCTTCACAAAACCAAAACACAC CTTTTGCATCACCCACATTG sense probe TAATACGACTCACTATAGGGCTTTTGCATCACCCACATTG CCTTCACAAAACCAAAACACAC GUS S taining To construct APX4::GUS 1.1 kbp of APX4 upstream sequence was PCR amplified and transcriptionally fused to the upstream of the uidA gene start codon (Jefferson et al., 1987). This plasmid was moved into Agrobacterium tumefaciens strain ASE by electroporation. Plasmids were transformed with into A. tumefaciens as described by Clough and Bent (1998). Transformants were selected by spraying 1000 fold diluted BASTA (Finale, AgrEvo, Pikeville, NC). For GUS assays, plant tissues were v acuum infiltrated with substrate solution (1 mM 5 bromo 4 chloro 3 indoyl glucuronide, 50 mM sodium phosphate pH 7.0, 1% Triton X 100, 1% DMSO, 10 mM EDTA) and incubated at 37C. Seedlings and influorescences were incubated in substrate for 2 hours and 2 d ays, respectively. Plant pigments were removed by incubating in 70% ethanol before microscopic examination and image capture. Localization of GFP T ranslational Fusion P roteins A binary plasmid was created that contained the APX4 coding sequence (upstream) translationally fused to the GFP coding sequence (downstream). Expression

PAGE 76

76 of this construct was driven by the cauliflower mosaic virus 35S promoter. Following the transformation method describe earlier, this 35S::APX4 GFP construct and the 35S::DsRed KSRM construct (Cheng et al., 2006) were co transformed into Col 0 Arabidopsis plants. Transformants containing both transgenes were fixed and examined by confocal microscopy. Plant tissues were submerged in fixative solution containing 4% paraldehyde, 0.5% glu taraldehyde, 1% DMSO, 3 mM DTT, 10 mM HEPES (pH 6.4), 2 mM EDTA, 5.6 mM KCl, and 10 mM MgCl 2 Samples were vacuum infiltrated with a weak vacuum, washed with 10 mM HEPES (pH 6.4), 2 mM EDTA, 5.6 mM KCl, and 10 mM MgCl 2 for 10 minutes three times, and mount ed with 10% glycerol in 20 mM Tris HCl (pH 9). GFP and DsRed fluorescence was detected using an Olympus IX81 DSU spinning disk confocal microscope (Center Valley, PA) and images were processed by SlideBook software. The filter set used for capturing GFP fl uorescence was excited at 472/30 nm and emitted at 520/35 nm. The Texas Red filter set was used for capturing DsRed fluorescence and has excitation and emission at 562/40 nm and 624/40 nm, respectively. Chlorophyll auto fluorescence was detected using a Cy 5 filter (excitation 650/13 nm and emission 684/24 nm). Identical exposure times were used to capture images from transgenic and wild type plants. Using these images, autofluorescence can be differentiated from GFP and DsRed signals. No detectable GFP and DsRed fluorescence was observed in wild types (data not shown) APX Activity A ssay Zymographs were used to visualize active APX complexes on 10% native polyacrylamide gel according to Mittler and Zilinska (1993). Total protein was extracted from the 11 d old seedlings grown on GM plates with 1% sucrose. Kinetics assay for total APX activity was done by following the procedure modified from Nakano and

PAGE 77

77 Asada (1981). Fifty micrograms of total protein extract was mixed in the assay buffer for a total volume of 1 mL containing 50 mM potassium phosphate (pH 7), 0.5 mM ascorbate, 1 mM hydrogen peroxide, and 0.1 mM EDTA. APX activity was defined as the consumption of ascorbate per microgram total protein per minute, assuming an absorption coefficient of 2.8 mM 1 cm 1 at 290 nm. H 2 O 2 Detection Amplex Red (Invitrogen, A22188) readily penetrates cells and interacts with H 2 O 2 (Ashtamker et al., 2007). Seedlings were immersed in the Amplex Red solution (as suggested by the manufacturer) for 10 minutes in darkness followi ng by a 10 second rinse with sterile water. Fluorescence images were captured using a Leica MZFL dissecting microscope (Leica, Buffalo Grove, IL) equipped with a 546/10 nm narrow band excitation filter and 590 nm long pass emission filter. Results Chloroti c apx4 C otyledons Chlorotic cotyledons were found in two different apx4 mutant alleles, designated as apx4 1 and apx4 2 (Fig. 4 1E and F). The apx4 1 mutant has a T DNA insertion in the 6th intron and the apx4 2 mutant has a T DNA insertion in the last exon (Fig. 4 1M). In both apx4 alleles, the chlorotic cotyledon phenotype was in completely penetrant or had variable expressivity (Fig. 4 1B and C). This phenotype was observed in 66% and 80% of the apx4 1 and apx4 2 seedlings, respectively. Seedlings with severely chlorotic cotyledons often died when sown in soil, but they survived when grown on GM plates containing sucrose. This indicates that many apx4 seedlings acquired nutrients from the media that they were un able to synthesize in sufficient amounts in soil.

PAGE 78

78 Two findings show that the chlorosis phenotype was caused by the mutation of the APX4 locus. First, the heteroallelic apx4 1 / apx4 2 plants displayed a chlorotic cotyledon phenotype, which was indistinguisha ble from the parental phenotype (Fig. 4 1G). This eliminates the possibility of a second site mutation causing the observed phenotype. Second, introducing an intact APX4 gene into the apx4 1 mutant background complemented the chlorotic cotyledon phenotype (Fig. 4 1H). This indicates that the genomic fragment containing APX4 was sufficient to compensate for the mutated APX locus and eliminate the cotyledon phenotype. Photosynthetic Pigment Levels and S eedl ing Growth were Reduced in apx4 M utants Seedlings o f apx4 mutants were separated into two groups, green cotyledons (GC) and chlorotic cotyledons (CC), and their pigments were extracted. Data revealed that chlorophyll a chlorophyll b and lutein contents in both apx4 mutant alleles with chlorotic cotyledons were significantly reduced (Fig. 4 2). Surprisingly, apx4 1 seedlings without apparent chlorotic cotyledons have significantly less chlorophyll and lutein than wild type, and apx4 2 seedlings with green cotyledons had lower, but not significantly lower, levels. The data revealed that cotyledon chlorosis occurred in both groups of seedlings, which shows that the apx4 mutants exhibited variable expressivity, not poor penetrance. Seedli ng growth was evaluated by measuring leaf area (including the cotyledons) and root length because the biomass of a single Arabidopsis seedling is difficult to measure accurately (Paul Victor et al., 2010). Seedlings were grown on GM plates that were orient d old

PAGE 79

79 seedlings, the root lengths and leaf areas of both apx4 alleles were significantly lower than wild type controls (Fig. 4 3). Decreased Germination of apx4 Seeds in an Unfavorable Environment Although the fertility of the apx4 1 mutant did not seem to be affected (Chapter 2), the seed color of apx4 mutants was darker than wild type seeds (Fig. 4 1I). Becau se changes in seed coat color are associated with other seed property modifica tions (Debeaujon et al., 2001; Koornneef, 1981), seed quality and seed vigor were evaluated for apx4 alleles. Only 20% of the apx4 1 seeds germinated after sterilization in 3% hypochlorite, but this germination behavior was maternally controlled (Fig. 4 4A ), indicating this phenotype was determined by seed coat properties. When 0.6% hypochlorite was used for sterilization, freshly harvested wild type seeds completely germinated in 2 d, whereas apx4 seeds did this in 4 d (Fig. 4 4B). Germination rates of apx 4 significantly decreased after accelerated aging (Fig. 4 4B) as well as natural aging (Fig. 4 4C). These results indicate apx4 seeds were less tolerant of harsh environmental conditions, probably due to changes in the apx4 seed coat. In order to determine whether apx4 mutant seeds were viable, wild type and mutant seeds were evaluated to determine if they could oxidize tetrazolium chloride. Once tetrazolium penetrates the seed coat, a metabolically active embryo oxidizes this colorless dye, forming a red p igment. Normally tetrazolium cannot penetrate the seed coat, so seeds need to be perforated to carry out this test. Results showed that apx4 seeds are metabolically active, but the seed coat of apx4 mutant alleles was more permeable than wild type since te trazolium penetrated the seed without perforation (Fig. 4 1J L).

PAGE 80

80 Expression and Sub cellular L ocalization of APX4 As revealed by in situ hybridization, APX4 transcripts were found in leaf mesophyll and phloem (Fig. 4 5B). Glucuronidase (GUS) staining indicated that the APX4 promoter is more active in cotyledons than in developing true leaves (Fig. 4 5C). In reproductive organs, APX4 was expressed in sepals (especially in vasculature) and the abscission area at the base of sepals (Fig. 4 5D and E). Examination of the dissected edge of the carpel wall revealed intense APX4::GUS staining (Fig. 4 5F), indicating that the expression of this gene was induced by wounding. According to RT PCR results, APX4 is expressed in many tis s ues throughout the above ground plant, but not in roots (Fig. 4 5G). APX4 GFP translational fusion protein localized to the chloroplasts (Fig. 4 6). Interestingly, chloroplasts in guard cells have a stronger GFP signal than chloroplasts in mesophyll cells. Although APX4 was predicted to be present in microsomes, specifically in peroxisomes, our APX4 GFP translational fusion proteins did not co localize with the DsRed KSRM marker protein, which is targeted to peroxisomes. Two apx4 M utant Allele s are K nock out M utants According to the RT PCR results, no full length APX4 transcripts were found in either apx4 mutant alleles (Fig. 4 5H). Two other reverse primers, R4 and R5, amplified partial APX4 transcripts. APX4a transcripts amplified with F2 and R4 primers (Fig 4 1M) were present in wild type Arabidopsis, but not in the two apx4 mutants. Truncated APX4b transcripts, amplified with F2 and R5, were found in both apx4 alleles, but the amount was greatly reduced in apx4 2 seedlings (Fig. 4 5I). If APX4b can be stab ly translated, the truncated protein would only contain a third of the amino acid sequence of a mature APX4 protein. While the apx4 2 allele is predicted to encode nearly the

PAGE 81

81 entire coding sequencing of this gene (Fig. 4 1M), the T DNA insert disrupted sta ble transcript accumulation for this allele (Fig. 4 5I). Therefore, it appears that both apx4 1 and apx4 2 are null alleles. Increased H 2 O 2 Levels and Reduced Total APX A ctivity in apx4 M utants To investigate whether APX4 is involved in the ROS scavenging metabolism, H 2 O 2 levels and total APX activity in wild type plants and apx4 mutants were measured. We observed large H 2 O 2 accumulation in 5 d old apx4 seedlings, which were higher than the baseline levels in wild type plants (Fig. 4 7A). Zymographs were u sed to visualize active APX complexes on native polyacrylamide gels. Results showed that apx4 2 produced lower total APX activity (Fig. 4 7C). The kinetic assay measured APX activity by the consumption of ascorbate in an APX dependent fashion, confirming t hat the decrease of total APX activity in apx4 2 was significant (Fig. 4 7D). Discussion Analysis of the apx4 Mutant L esion The chlorotic cotyledon phenotype was distinctive in apx4 mutants, although it did not appear homogenous in apx4 seedlings. Analysis of pigment accumulation in apx4 alleles showed a range of phenotypes. This variation was either due to the differences in the environment causing fluctuations in H 2 O 2 generation or varied expressivity of the apx4 phenotype. The offspring from the crossing of apx4 mutants with wild type plants appeared phenotypically normal, indicating apx4 is a recessive mutant (data not shown). In order to eliminate the possibility that the mutant phenotype is caused by another T DNA insertion at a different locus, heteroallelic apx4 1/apx4 2 seedlings were evaluated by crossing apx4 1 with apx4 2 mutants. The progeny from this cross exhibited a chlorotic cotyledon phenotype, similar to the parents (Fig. 4 1G).

PAGE 82

82 This result shows t hat the cotyledon phenotype was caused by mutation in APX4 locus and not a second site mutation at a different locus. APX4 M ay T ransit to Multiple O rganelles APX4 GFP fusion protein localized to chloroplasts (Fig 4 6), which agrees with previously publishe d biochemical evidence (Granlund et al., 2009; Kieselbach et al., 2000). APX4 transcripts were most abundant in plant tissues with chloroplasts, including cells of cotyledons, leaves, sepals, and mesophyll. APX4 transcripts also were present in phloem. Mit ochondria, on the other hand, are predominant organelles in phloem cells, supplying energy required in metabolite transportation. We observed that APX4 GFP fluorescence is not only present in chloroplasts (3 4 m), but also present in some smaller organell es (1 2 m; data not shown). Originally we thought these fluorescent organelles were peroxisomes because a SLK motif is present in the C terminus of APX4 (Panchuck et al., 2002). However, our APX4 GFP does not co localize with the peroxisomal marker protei n (Fig. 4 6). Therefore, we hypothesize that APX4 may be a multiple targeting protein that is also present in mitochondria. A similar dual targeting pattern has been identified in sAPX, as well as an APX homolog in rice (Chew et al., 2003; Lazzarott et al. 2011). An experiment for examining the co localization of a mitochondrial marker and APX4 GFP is required to confirm this hypothesis. Although APX4 GFP is not found in peroxisomes, an N terminal fused GFP APX4 construct will be needed to test this hypoth esis. If APX4 is present in peroxisomes, a C terminal tag (such as GFP) may disrupt its targeting pathway and result in a false negative result. APX4 is I mportant during Development of Seedling P hotosystems In seedlings, apx4 alleles displayed lower growth rates (Fig. 4 3). This reduction in growth probably was caused by reduced pigment levels in apx4 mutants (Fig. 4 2),

PAGE 83

83 which likely reduced photosynthetic rates. In 7 d old apx4 seedlings, the total leaf area was 25% lower and root length was 20% shorter th an in wild type (Fig. 4 3). Although APX4 was not expressed in roots, the root growth is decreased in apx4 mutants, probably due to less available photosynthate for their overall growth. These mutant phenotypes were only observed in apx4 seedlings. The dif ferences in growth between apx4 mutants and wild type plants become less apparent as plants age. At the vegetative to reproductive transition, apx4 plants were indistinguishable from wild type (Granlund et al., 2009). Since APX4 is continuously expressed in growing shoots ( Panchuk et al., 2005 ), there may be redundant gene(s) expressed later in development and complement for the lost function of apx4 Chlorophyll a b and lutein are photosynthetic pigments found in light harvest ing complex II ( Peter and Thornber, 1991 ). The reduction in photosynthetic pigment levels could be a result of lower pigment synthesis or higher degradation rates. Mutants associated with chlorophyll biosynthesis not only show different degrees of yellowin g or chlorosis, but also affect chloroplast development (Lepisto et al, 2009; Wu et al., 2007). In addition, lutein is a xanthophyll, which is derived from oxygenated carotenes (Kim and DellaPenna, 2006). Increased degradation is more likely to be regulate d by APX4 since in apx4 mutants there were similar reductions in lutein and chlorophyll levels on a percent basis. sAPX scavenges hydrogen peroxides and protects chloroplasts from photo oxidative stress. Lost of function sapx mutants exhibited seedling ble aching phenotypes under photo oxidative stress (Chew et al., 2003). Similarly, APX4 may be involved in protecting the photo systems since biochemical data showed that the APX4 protein is associated with light harvesting complex II (Granlund et al., 2009).

PAGE 84

84 APX4 May Regulate the A ctivity or the Stability of O ther APX s APX4 previously was hypothesized to be a non functioning ascorbate peroxidase because this protein lacks critical residues in the catalytic, heme binding, and ascorbate binding domains shown tha t were non variant in functional ascorbate peroxidases (Granlund et al., 2009; Kieselbach et al., 2000; Teixerira et al., 2004). In apx4 seedlings we observed increased H 2 O 2 accumulation and reduced total APX activity (Fig. 4 7). We, therefore, propose th at APX4 is involved in ROS scavenging through an alternative mechanism. Some APXs dimerize noncovalently (Mittler and Zilinskas, 1991). An APX homolog found in rice can interact with chloroplastic and mitochondrial APXs. The associated knockdown mutant sho wed changes in total APX activity (Lazzarott et al., 2011). APX4 might regulate the activity or stability of other APX proteins via physical interaction. In order to support this hypothesis, a protein protein interaction test will be required, especially f or the APXs that may be co localized with APX4. Although our yeast two hybrid analysis failed to identify an interaction between APX4 and other APXs (data not shown), it does not exclude this possibility. It remains possible that APX4 did not fold correctl y or the transit peptide interferes with these interactions. Alternatively, APX4 may have indirect interactions with other APXs. The reduction of total APX activity was significant in apx4 2 seedlings and small in apx4 1 While the decrease was small for b oth alleles, this APX activity included enzyme activity from the cytoplasm, mitochondria, and other organelles. APX4 is a chloroplast protein and may only regulate other APXs that co localize to chloroplasts. Consequently, this small overall decrease in th e total APX activity corresponded to a physiologically significant reduction in chloroplast peroxide scavenger activity, as shown by the phenotype in cotyledons (Fig. 4 1). When we examined total APX activity from a

PAGE 85

85 mixture of cellular compartments, the ef fect of reduced APX activity caused by the mutation in the APX4 locus was masked by other APXs, such as cytosolic APX1. Thus, the decrease in chloroplast APX activity is likely more than that shown in Figure 4 7D. APX4 Regulates Seed Coat Formation and Affects Seed V igor The seed coat protects the embryo from the surrounding environment. Before encountering favorable conditions for germination, the seed coat maintains seed longevity by forming a selective permeable barrier to oxygen, water, and pathogens (Mohamed Yaseen et al., 1994). The seed coat of apx4 mutants appears to be more permeable than wild type based on the tetrazolium tests and sensitivity to hypochlorite (Fig. 4 1J, K, and Fig. 4 4B). This change in apx4 seed coat properties not only affect ed seed permeability, but also influenced seed protection, quality, and longevity. After natural aging for two years, the germination of apx4 seeds was reduced significantly, possibly due to gradually oxidation of the embryo caused by changes in the permea bility of the seed coat (Fig. 4 4C). Similarly, apx4 seeds are less viable under harsh environmental conditions, such as high humidity and temperature (Fig. 4 4 B). In Arabidopsis, the seed coat consists of an outer integument with two cell layers and an inner integument with three cell layers Integuments are maternal tissue and are undifferentiated until fertilization (Schneitz et al., 1995). This explains why the germination of apx4 heterozygous seeds showed maternal effects (Fig. 4 4 A). During early e mbryo development, integuments convey nutrients from maternal tissues to the embryo and transmit regulatory signals (Weber et al., 1995). At seed maturity, lignification of the phenolic compounds in the integuments contributes to the color of the seed coat and selectively permeable barrier to water and other metabolites (Debeaujon et al., 2000; Moise et al., 2005). In Arabidopsis seeds, colorless proanthocyanidins are

PAGE 86

86 synthesized in inner integument. The color of the seed coat develops after oxidative enzym es, such as peroxidases and laccases, alter phenolic compounds and start the free radical polymerization of lignins (Debeaujon et al., 2003; Liang et al, 2006). Mutants that affect seed coat pigmentation have been proven to affect seed vigor due to the cha nge in permeability of the seed coat (Debeaujon et al., 2000). The seed coat of apx4 mutants not only increased seed permeability, but also displayed darker pigmentation (Fig. 4 1I). These results indicate that APX4 regulates seed coat formation. APX4 also may be regulating phenolic biosynthesis or oxidation, although no APX4 expression was detected in the seed coat (data not shown). This could be because the promoter used in the APX4::GUS construct was a partial one or this assay was below the level of det ection. Further examination is required to resolve this puzzle

PAGE 87

87 A B C D E F G H I J K L M Figure 4 1 Two apx4 mutant alleles had chlorotic cotyledons and this phenotype reverted when transformed with the APX4 gene. Eleven day old wild type (A and D), apx4 1 (B and E), and apx4 2 (C and F) seedlings were grown on GM plates with 1% sucrose Heteroallelic apx4 1 / apx4 2 seedlings exhibited chlorotic cotyledons, indicating that these mutants are allelic (G). The 4. 2 kb Eco RI to Xba I APX4 fragment shown in (M), complemented the apx4 1 mutant (H). The color of wild type (left), apx4 1 (center), and apx4 2 (right) seeds are shown (I). Intact (J and K) and perforated (L) seeds were incubated in 1% tetrazolium solution f or 1 day (J) or 2 days (K and L) The structure of APX4 including the T DNA insertion sites and primer locations are shown in (M). Red boxes indicate the putative peroxidase domain. Blue arrows show primer locations used for RT PCR. Solid boxes= exons; op en boxes= UTRs; regions. Size bars = 2.5 mm (D H) and 1 mm (I L ).

PAGE 88

88 Figure 4 2. Chlorophyll a, chlorophyll b and lutein levels were significantly lower in apx4 mutants. Pigments were extracted from seedlings with chlorotic cotyledons (CC) and green cotyledons (GC). Pigment levels were measured from individual plants and compared to the wild type controls (WT).

PAGE 89

89 A B Figure 4 3 Seedling growth of apx4 mut ants was significantly reduced. Leaf area (A) and root length (B) were measured from 7 day old seedlings grown across the surface of GM plates with 1% sucrose.

PAGE 90

9 0 A B C Figure 4 4. The germination of apx4 seeds was lower than wild type seeds due to an altered seed coat. (A) Seeds of wild type (WT), apx4 1 mutants, and apx4 1 /+ heterozygotes from reciprocal crosses were sterilized in 3% hypochlorite and germination rates were evaluated. (B) Control (N.A.) a nd accelerated aged (A.A.) seeds were sterilized in 0.6% hypochlorite and the germination was measured. (C) The germination of wild type and apx4 2 seeds stored at room temperature for various time periods were tested. Seeds were sterilized in 0.6% hypochl orite.

PAGE 91

91 A B C D E F G H I Figure 4 5. APX4 transcripts were found in shoot tissues. Sense (A) and anti sense (B) RNA probes were used to detect APX4 expression in 7 day old seedlings (bar = 1 mm). APX4 promoter activity was inferred by GUS staining in 13 day old seedlings (C, bar = 5 mm), inflorescences (D, bar = 1 mm), and siliques (E and F, bar = 1 mm) of APX4 ::GUS. RT PCR results (G) revealed that APX4 was present in 30 day old rosette leaves (RL), c auline leaves (CL), stage 12 flowers (FL) and pistils (P), but not in roots (R). No full length APX4 transcripts were detected in 11 day old apx4 mutants (H). Truncated transcripts were observed in 11 day old seedlings (I). UBQ10 was used as internal contr ol. Abbreviations: lp, leaf primodium; ct, cotyledon; ep, epidermis; c, cortex; x, xylem; p, phloem.

PAGE 92

92 A B C D Figure 4 6. The APX4 GFP translational fusion protein localized to mesophyll and guard cell chloroplasts. In 5 week old APX4 GFP plants the GFP (green, A), chloroplast (red, B), and DsRed (blue, C; peroxisomal marker) fluorescence were visualized by confocal microscopy using cauline leaves. A merged image is shown in D. Bars = 10 m

PAGE 93

93 A B C D Figure 4 7. Mutation of apx4 leads to H 2 O 2 accumulation and reduction of total APX activity in seedlings. H 2 O 2 mediated fluorescence (A) and bright field (B) view of 5 day old wild type (left), apx4 1 (right) and apx4 2 (bottom) plants (bar = 2 mm). In apx4 mutants, seedlings had inc reased H 2 O 2 accumulation. APX in gel (C) and kinetics (D) assays showed significantly lower APX activity in 11 day old apx4 2 seedlings ( p < 0.001)

PAGE 94

94 CHAPTER 5 GENERAL CONCLUSION S The research in this dissertation investi gated the role s of ROS scavenging genes during plant reproduction. ROS accumulation in ovule gametophytes was observed prior to ovule abortion. From a global microarray study, the expression of a group of ROS scavenging genes significantly changed in Arabido psis pistils followin g salt stress (Sun et al., 2005). To investigate how these ROS scavengers were involved in Arabidopsis ovule abortion, l oss o f function mutants for each of these ROS scavenging genes were evaluat ed. The mutation in three class III peroxidase genes ( PER17 28 and 29 ) resulted in significantly increased ovule abortion rates with no apparent change in vege tative growth T h is mutant phenotype wa s restored by addition of a wild type copy of the respective transgene, indicating the ovule abortion was caused by the mutation for each locus The ovule abortion rates significantly increased in all peroxidase single, double and triple mutants. In addition, t otal ROS levels rose in the ovules of peroxidase triple mutants, which correlate with their high ovule aborti on rate. P eroxidase GFP translational fusion proteins were present in the cytosol. While many class III peroxidases are predicted to be localized to cell wall and involve d in defense, these three cytosolic peroxidases were mor e likely to modulate ROS metab olism and affect ovule abortion. A ccording to the quantitative RT PCR results t hese three peroxidase genes were primarily expressed in pistils. After salt stress, PER17 gene expression increased markedly while PER28 and PER29 decreased The fertility results suggest that these three peroxidases may scavenge ROS and prevent ovule abortion under normal growth

PAGE 95

95 conditions. When encountering salt stress, the expression of PER17 gene was up regulated and its product served as a n important ROS scav enger t hat prevent s ovule abortion. According to PER28::GUS images, PER28 was expressed in the transmitting track and stigma when those tissues are receptive to pollen germination. It is known that Arabidopsis flowers are susceptible to environmental stres s around this stage (Sun et al., 2004) and ROS is also involved in the fertilization process, including pollen stigma interaction and pollen tube growth (McInnis et al., 2006a; Potocky et al., 2007; Wilkins et al., 2011). PER28 may modulate ROS metabolism during this process. The PER29 ::GUS data indicated that PER2 9 was expressed in ovules, especially in the gametophyte. Sun et al. (2005) reported that ROS initially accumulated in the gametophyte and then spread throughout the ovule a fter salt stress Thus, PER29 may be responsible for removing excessive ROS in the gametophyte. Transgenic plants that heterologously expressed these class III peroxidases were created. The objective was to investigate whether increased ROS scavenging capacity would counteract t he physiological changes under environmental stresses, thus maintaining plant fecundity. One Arabidopsis PER17OE genetic line showed increased fertility under salt stress, but the rest did not. In the PER17OE transgenic lines, myc PER17 mRNA expression was present, but the myc PER17 proteins were not detected. This indicates that the expression of myc PER17 protein was strictly regulated In the PER28OE genetic lines, the highly expressed myc PER28 proteins were associated with decreased fertility, which conflicts with the original hypothesis of this work. It may be because the ectopic expression of PER28 disturbed ROS levels during stigma reception or stamen filament elongation, consequently resulting in

PAGE 96

96 fertilization failure and increas ed seed failure The abortion rates of PER29OE genetic lines were lower than the control after salt stress, but the decrease was not statistically significant. The same trans genes were transformed into soybean p lants and the effects of these transgenes we re evaluated under heat stress When compared to the Maverick controls, the 501 transgenic lines had a higher harvest index in unstressed plants, but they did not show increased tolerance to heat stress. The 502 transgenic lines were more tolerant of moder ate heat stress (34/26C) and showed decreased seed failure rates but the decrease was not statistically significant This could be due to a small sample population. Increasing the sample size may result in statistical differences. The 503 transgenic line s produced bigger seeds than the controls and their leaves stayed green under moderate heat stress (34/26C). However, none of these transgenic soybean plants showed increased tolerance to high heat stress (38/30C) Vegetative growth continued longer at t he expense of reproductive growth in wild type controls and transgenic soybean plants under heat stress. Under moderate heat stress, over expression of these peroxidases may maintain soybean yield by reducing pod/seed abortion rates or sustaining seed deve lopment. However, assimilates remained in vegetative tissues rather than moving into reproductive growth under high heat stress. Ascorbate peroxidase 4 ( APX4 ) a class I peroxidase ( Panchuk et al., 2002 ; Welinder, 1992 ) showed decreased expre ssion after sa lt stress (Sun et al., 2005). While the apx4 mutant did not affect fertility s eeds of apx4 mutants were more sensitive to environmental stress due to the permeability change in the seed coat, indicating APX4 affects seed coat formation. Darker pigmentation of the apx4 seed coat indicates that

PAGE 97

97 APX4 may regulate phenolic biosynthesis or oxidation In addition, apx4 seedlings had chlorotic cotyledons, significantly reduced photosynthetic pigment levels and slower seedling growth The APX4 G FP translation al fusion proteins were present in chloroplasts. Although t he RT PCR revealed APX4 was abundant in shoot tissues the apx4 mutant only exhibited chlorotic cotyledons and reduced growth rate in seedling s. These data indicate APX4 is important during development of seedling photosystems but another locus functions redundantly in other tissues The mutation in the APX4 locus also resulted in increased H 2 O 2 accumulation and reduced total APX activity in apx4 2 seedlings, indicating APX4 is inv olved in the ROS scavenging process. This study demonstrate d how these ROS scavengers affect ROS metabolism and plant reproduction in Arabidops is. Mutants of ROS scavenging genes exhibited mutant phenotypes where ROS accumulated; however, heterologous expr ession of PER genetic lines either show ed insignificant tolerance to the environmental stress or decreased fertility, as the mutant did The results indicate the ROS level s during reproduction are critical and need to be precisely regulated. Future analyse s will be necessary to reveal how these genes are regulated on the cellular level

PAGE 98

98 APPENDIX A COMPLEMENTATION OF per17 28 and 29 MUTANTS WITH THE COMPLEMENTING TRANSGENES Table A 1 The fertility of per17, 29 and 29 mutants transformed with 35S::myc PER17 35S::myc PER28 or 35S::myc PER29 was measured Stressed flowers were marked at stage 12, plants were water ed once with 75 mM NaCl, and fertility measured a week later For each genotype, 36 pistils were scored. Ab ortion rates were arcsine transformed and compared by ANOVA. The fertility of tested genotype s and the wild type control s did not differ significantly. Abortion rate* (%) Genotype Healthy Stressed Wild type 5.3 0.9 12.3 3.5 Per17 + 35S::myc PER 17 6.5 1.0 8.2 1.3 Wild type 5.0 0.8 per28 + 35S::myc PER28 4.7 0.9 per29 + 35S::myc PER29 6.8 0.9

PAGE 99

99 Figure A 1 In total protein extracts from transgenic plants, myc PER17 and myc PER28 w ere detect ed by immunoblotting using an anti myc antibody. The 7179 genetic line wa s a per17 mutant with a 35S::myc PER17 transgene. The 7057, 7059 and 7061 genetic lines we re per28 mutants with 35S::myc PER28 transgenes.

PAGE 100

100 Figure A 2. Detection of transcripts deriving from the myc PER17 and myc PER29 transgenes. First strand cDNA was synthesized from 35S::myc PER17 transformants (7178 and 7180) and 35S::myc PER29 transformants (7014, 7017 and 7018). Transcripts were amplified by RT PCR. Only transcripts from the transgene were amplified because the forward primer derived from the myc tag. UBQ10 transcripts were amplified and served as internal control.

PAGE 101

101 APPENDIX B E NZYME ACTIVITY OF MYC PER17, 28 AND 29 A B C Figure B 1. Peroxidase activity from myc PER17 (A), myc PER28 (B) and myc PER29 (C) transformants w as measured E ach well of an ELISA plate was coated with 0.5 g myc tag antibody so that myc tagged proteins could be fished from total protein extract s. Total soluble proteins were extracted from 12 day old seedlings (7179 for myc PER17, 7059 for myc PER28, and 6722 for myc PER29) in extraction buffer. Amplex Red was applied to deter mine the activity of myc peroxidases. Fluorescence was measured with excitation/emission at 540/590 nm. The relative fluorescence of each myc peroxidase was normalized with wild type controls in each experimental replicate

PAGE 102

102 APPENDIX C PROMOTER ACTIVITY OF PER28 AND PER29 A B C D E Figure C 1. GUS histochemical staining of PER28::GUS (A and B bars = 100 m ) and PER29::GUS (C to E) in reproductive tissues. PER28 was first expressed in the transmitting tract of stage 1 2 pistil s (A), and moved on to the stigma in stage 13 pistil s (B). PER29 promoter was active in ovules (C bar = 100 m ) and guard cells of sepals (E bar = 25 m ) A higher magnification of ovules, revealed that most of the GUS staining derived from the ga metophyte (D, bar = 10 m).

PAGE 103

103 LIST OF REFERENCES Aggarwal M (2009) Functional analysis of receptor like kinases in pollen pistil interactions in Arabidopsis thaliana. Masters Theses. Allan AC, Fluhr R (1997) Two distinct sources of elicited reactive oxygen species in tobacco epidermal cells. Plant Cell 9: 1559 1572 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Kames M, Mulholland C, Ndubaku R, Schmidt I, Guzman P, Aguilar Henonin L, Schmid M, Weigel D, Carter DE, Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, B erry CC, Ecker JR (2003) Genome wide insertional mutagenesis of Arabidopsis thaliana Science 301: 653 657 Anthony RG, Henriques R, Helfer A, Meszaros T, Rios G, Testerink C, Munnik T, Deak M, Koncz C, Bogre L (2004) A protein kinase target of a PDK1 signaling pathway is involved in root hair growth in Arabidopsis. EMBO J. 23: 572 581 Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55: 373 399 Asada K (1999) The water water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50: 601 639 Ashtamker C, Kiss V, Sagi M, Davydov O, Fluhr R (2007) Diverse subcellular locations of cryptogein induced ROS production in tobacco BY 2 cells. Plant Physiol. 143: 1817 1826 Bailly C (2004) Active oxygen species and antioxidants in seed biology. Seed Sci. Res. 14: 93 107 Baxter Burrell A, Yang Z, Springer PS, Bailey Serres J (2 002) RopGAP4 dependent Rop GTPase rheostat control of Arabidopsis oxygen deprivation tolerance. Science 296: 2026 2028 Beppu K, Okamoto S, Sugiyama A, Kataoka I (1997) Effects of temperature on flower development and fruit set of "Satohnishiki" sweet cherr y [ Prunus avium ]. J. Japan. Soc. Hort. Sci. 65: 707 712 Bethke PC, Jones RL (2001) Cell death of barley aleurone protoplasts is mediated by reactive oxygen species. Plant J. 25: 19 29 Blee KA, Jupe SC, Richard G, Zimmerlin A, Davies DR, Bolwell GP (2001) M olecular identification and expression of the peroxidase responsible for the oxidative burst in French bean ( Phaseolus vulgaris L.) and related members of the gene family. Plant Mol. Biol. 47: 607 620 Boisson M, Gomord V, Audran C, Berger N, Dubreucq B, Gr anier F, Lerouge P, Faye L, Caboche M, Lepiniec L (2001) Arabidopsis glucosidase I mutants reveal a critical role of N glycan trimming in seed development. EMBO J. 20: 1010 1019

PAGE 104

104 Bolwell GP, Wojtaszek P (1997) Mechanisms for the generation of reactive oxygen species in plant defence broad perspective. Physiol. Mol. Plant Pathol. 51 : 347 366 Boote KJ, Allen LH, Prasad PVV, Baker JT, Gesch RW, Snyder AM, Pan D, Thomas JMG (2005) Elevated temperature and CO 2 impacts on pollination, reproductive growth, a nd yield of several globally important crops. J. Agric. Meteorol. 60: 469 474 Bowler C, van Montagu M, Inze D (1992) Superoxide dismutase and stress tolerance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43: 83 116 Boyer JS (1982) Plant productivity and the environment. Science 218: 443 448 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72: 248 254 Bulda OV, R assadina VV, Alekseichuk HN, La man NA (2008) Spectrophotometric measurement of carotenes, xanthophylls, and chlorophylls in extracts from plant seeds. Russ. J. Plant Physiol. 55: 544 551 Bursey EH, Poulos TL (2000) Two substrate binding sites in ascorbate peroxidase: the role of arginin e 172. Biochemistry 39: 7374 7379 Cathcart R, Schwiers E, Ames BN (1983) Detection of picomole levels of hydroperoxides using a fluorescent dichlorofluorescein assay. Anal. Biochem. 134: 111 116 Celik A, Cullis PM, Sutcliffe MJ, Sangar R, Raven EL (2001) E ngineering the active site of ascorbate peroxidase. Eur. J. Biochem. 268: 78 85 Cheng N H, Liu JZ, Brock A, Nelson RS, Hirschi KD (2006) AtGRXcp, an Arabidopsis chloroplastic glutaredoxin, is critical for protection against protein oxidative damage. J. Bio l. Chem. 281: 26280 26288 Chew O, Whelan J, Millar AH (2003) Molecular definition of the ascorbate glutathione cycle in Arabidopsis mitochondria reveals dual targeting of antioxidant defenses in plants. J. Biol. Chem. 278: 46869 46877 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana Plant J. 16: 735 743 Cosio C, Dunand C (2009) Specific functions of individual class III peroxidase genes. J. Exp. Bot. 60: 391 408 Dat JF, Pellinen R, Beeckman T, Van De Cotte B, Langebartels C, Kangasjarvi J, Inze D, Breusegem F (2003) Changes in hydrogen peroxide homeostasis trigger an active cell death process in tobacco. Plant J. 33: 621 632 Davletova S, Rizhsky L, Liang H, Shengqiang Z, Oliver DJ Coutu J, Shulaev V, Schlauch K, Mittler R (2005) Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis. Plant Cell 17: 268 281

PAGE 105

105 Debeaujon I, Leon Kloosterziel KM, Koornneef M (2000) Influence of the tes ta on seed dormancy, germination, and longevity in Arabidopsis. Plant Physiol. 122: 403 413 Debeaujon I, Nesi N, Perez P, Devic M, Grandjean O, Caboche M, Lepiniec L (2003) Proanthocyanidin accumulating cells in Arabidopsis testa: regulation of differentiation and role in seed development. Plant Cell 15: 2514 2531 Debeaujon I, Peeters AJM, Leon Kloosterziel KM, Koornneef M (2001) The TRANSPARENT TESTA12 gene of Arabid opsis encodes a multidrug secondary transporter like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell 13: 853 871 Dietz K J, Jacob S, Oelze M L, Laxa M, Tognetti V, de Miranda SMN, Baier M, Finkemeier I (200 6) The function of peroxiredoxins in plant organelle redox metabolism J. Exp. Bot. 57: 1697 1709 Foreman J, Demidchik V, Bothwell JHF, Mylona P, Miedema H, Torres MA, Linstead P, Costa S, Brown lee C, Jones JDG, Davies JM, Dolan L (2003) Reactive oxygen spe cies produced by NADPH oxidase regulate plant cell growth. Nature 422: 442 446 Foyer CH, Souriau N, Perret S, Lelandais M, Kunert KJ, Pruvost C, Jouanin L (1995) Overexpression of glutathione reductase but not glutathione synthetase leads to increases in a ntioxidant capacity and resistance to photoinhibition in poplar trees. Plant Physiol. 109: 1047 1057 Giacomelli L, Masi A, Ripoll DR (2007) Arabidopsis thaliana deficient in two chloroplast ascorbate peroxidases shows accelerated light induced necrosis whe n levels of cellular ascorbate are low. Plant Mol. Biol. 65: 627 644 Gibeaut DM, Hulett J, Cramer GR, Seemann JR (1997) Maximal biomass of Arabidopsis thaliana using a simple, low maintenance hydroponic method and favorable environmental conditions. Plant Physiol. 115: 317 319 Gibson LR, Mullen RE (1996) Influence of day and night temperature on soybean seed yield. Crop Sci. 36: 98 104 Glasauer A, Chandel NS (20 13) ROS. Curr. Biol. 23: R100 Goldberg RB, de Paiva G, Yadegari R (1994) Plant embryogenesis: zygote to seed. Science 266: 605 614 Granlund I, Storm P, Schubert M, Garcia Cerdan JG, Funk C, Schroder WP (2009) The TL29 protein is lumen located, associated w ith PSII and not an ascorbate peroxidase. Plant Cell Physiol. 50: 1898 1910 Greenway H, Munns R (1980) Mechanisms of salt tolerance in non halophytes. Annu. Rev. Plant Physiol. 31: 149 190 Hasegawa PM, Bressan RA, Zhu J K, Bohnert HJ (2000) Plant cellular and molecular responses to high salinity. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51: 463 499

PAGE 106

106 Hauser BA, Sun K, Oppenheimer DG, Sage T (2006) Changes in mitochondrial membrane potential and accumulation of reactive oxygen species precede ultrastructural changes during ovule abortion. Planta 223: 292 299 Havaux M (1992) Stress tolerance of photosystem II in vivo : antagonistic effects of water, heat, and photoinhibition stresses. Plant Physiol. 100: 424 432 Henrissat B, Saloheimo M, Lavaitte S, Knowles JKC (1990) Structural homology among the peroxidase enzyme family revealed by hydrophobic cluster analysis. Proteins 8: 251 257 Herbette P, Lenne C, Leblanc N, Julien JL, JoeDrevet R, Roeckel Drevet P (2002) Two GPX like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities. Eur. J. Biochem. 269: 2414 2420 Herrero M (2003) Male and female synchrony and the regulation of mating in flowerin g plants. Philos. Trans. R. Soc. Lond. B Biol. 358: 1019 1024 Hideg E, Spetea C, Vass I (1994) Singlet oxygen production in thylakoid membranes during photoinhibition as detected by EPR spectroscopy. Photosynth. Res. 39: 191 199 Hiraga S, Sasaki K, Ito H Ohashi Y, Matsui H (2001) A large family of class III plant peroxidases. Plant Cell Physiol. 42: 462 468 Jabs T (1999) Reactive oxygen intermediates as mediators of programmed cell death in plants and animals. Biochem. Pharm. 57: 231 245 Jefferson RA, Ka vanagh TA, Bevan MW (1987) GUS fusions: glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 3901 3907 Jespersen HM, Kjaersgard IVH, Ostergaard L, Welinder KG (1997) From sequence analysis of three novel ascorbate pe roxidases from Arabidopsis thaliana to structure, function and evolution of seven types of ascorbate peroxidase. Biochem. J. 326: 305 310 Jung BG, Lee KO, Lee SS, Chi YH, Jang HH, Kang SS, Lee K, Lim D, Yoon SC, Yun D J, Inoue Y, Cho MJ, Lee SY (2002) A Chinese cabbage cDNA with high sequence identity to phospholipid hydroperoxide glutathione peroxidases encodes a novel isoform of thioredoxin dependent peroxidase. J. Biol. Chem. 277: 12572 12578 Kangasjarvi S, Lepisto A, Hannikainen K, Piippo M, Luomala E M, Aro E M, Rintamaki E (2008) Diverse roles for chloroplast stromal and thylakoid bound ascorbate peroxidases in plant stress responses. Biochem. J. 412: 275 285 Karpinski S, Escobar C, Karpinska B, Creissen G, Mullineaux PM (1997) Photosynthet ic electron transport regulates the expression of cytosolic ascorbate peroxidase genes in Arabidopsis during excess light stress. Plant Cell 9: 627 640 Kieselbach T, Bystedt M, Hynds P, Robinson C, Schroder WP (2000) A peroxidase homologue and novel plastocyanin located by proteomics to the Arabidopsis chloroplast thylakoid lumen. FEBS Lett. 480: 271 276

PAGE 107

107 Kim J, DellaPenna D (2006) Defining the primary route for lutein synthesis in plants: the role of Arabidopsis carotenoid beta ring hydroxylase CYP97A3. Proc. Natl. Acad. Sci. USA 103: 3474 3479 Kitajima S (2008) Hydrogen peroxide mediated inactivation of two chloroplastic peroxidases, ascorbate peroxidase and 2 Cys peroxiredoxin. J. Photochem. Photobiol. 84: 1404 1409 Kliebenstein DJ, Monde RA, Last RL (1998) Superoxide dismutase in Arabidopsis: an eclectic enzyme family with disparate regulation and protein localization. Plant Physiol. 118: 637 650 Koornneef M (1981) The complex syndrome of ttg mutants. Arabid. I nf. Serv. 18: 45 51 Kwak JM, Mori IC, Pei Z M, Leonhardt N, Torres MA, Dangl JL, Bloom RE, Bodde S Jones JDG, Schroeder JI (2003) NADPH oxidase AtrbohD and AtrbohF genes function in ROS dependent ABA signalling in Arabidopsis. EMBO J 22: 2623 2633 Lazzaro tt F, Teixeira FK, Rosa SB, Dunand C, Fernandes CL, Fontenele AdeV, Silvera JAG, Verli H, Margis R, Margis Pinheiro M (2011) Ascorbate peroxidase related (APx R) is a new hemecontaining protein functionally associated with ascorbate peroxidase but evolutio narily divergent. New Phytol. 191: 234 250 Lepisto A, Kangasjarvi S, Luomala E M, Brader G, Sipari N, Keranen M, Keinanen M, Rintamaki E (2009) Chloroplast NADPH thioredoxin reductase interacts with photoperiodic development in Arabidopsis. Plant Physiol. 149: 1261 1276 Liang M, Davis E, Gardner D, Gai X, Wu Y (2006) Involvement of AtLAC15 in lignin synthesis in seeds and in root elongation of Arabidopsis. Planta 224: 1185 1196 Liszkay A, Kenk B, Schopfer P (2003) Evidence for the involvement of cell wall peroxidase in the generation of hydroxyl radicals mediating extension growth. Planta 217: 658 667 Liu X, Williams CE, Nemacheck JA, Wang H, Subramanyam S, Zheng C, Chen M S (2010) Reactive oxygen species ar e involved in plant defense against a gall midge. Plant Physiol. 152: 985 999 Lunderg E, Storm P, Schroder WP, Funk C (2011) Crystal structure of the TL29 protein from Arabidopsis thaliana : an APX homolog without peroxidase activity. J. Struct. Biol. 176: 24 31 Macpherson AN, Telfer A, Barber J, Truscott TG (1993) Direct detection of singlet oxygen from isolated photosystem II reaction centres. Biochim. Biophys. Acta 1143: 301 309 Maruta T Inoue T Noshi M Tamoi M Yabuta Y Yoshimura K Ishikawa T Shige oka S (2012) Cytosolic ascorbate peroxidase 1 protects organelles against oxidative stress by wounding and jasmonate induced H 2 O 2 in Arabidopsis plants. Biochim. Biophys. Acta. 12: 1901 1907

PAGE 108

108 McInnis SM, Desikan R, Hancock JT, Hiscock SJ (2006a) Production of reactive oxygen species and reactive nitrogen species by angiosperm stigmas and pollen: potential signalling crosstalk? New Phytol. 172: 221 228 McInnis SM, Emery DC, Porter R, Desikan R, Hancock JT, Hiscock SJ (2006b) The role of stigma peroxidases in flowering plants: insights from further characterization of a stigma specific peroxidase (SSP) from Senecio squalidus (Asteraceae). J. Exp. Bot. 57: 1835 1846 Mei W, Qin Y, Song W, Li J, Zhu Y (2009) Cotton GhPOX1 encoding plant class III peroxidase may be responsible for the high level of reactive oxygen species production that is related to cotton fiber elongation. J. Genet. Genomics 36: 141 150 Mittler R, Vanderauwera S, Gollery M, Breusegem F (2004) Reactive oxygen gene network of plants. Trends Plant Sci. 9: 490 498 Mittler R, Zilinskas BA (1991) Purification and characterization of pea cytosolic ascorbate peroxidase. Plant Physiol. 97: 962 968 Mittler R, Zilinskas BA (1993) Detction of asc orbate peroxidase activity in native gels by inhibition of the ascorbate dependent reduction of nitroblue tetrazolium. Analy. Biochem. 212: 540 546 Mohamed Yasseen Y, Barringer SA, Splittstoesser WE, Costanza S (1994) The role of seed coats in seed viabili ty. Bot. Rev. 60: 426 439 Moise JA, Han S, Gudynaite Savitch L, Johnson DA, Miki BLA (2005) Seed coats: structure, development, composition, and biotechnology. In Vitro Cell Dev. Biol. 41: 620 644 Moller IM (2001) Plant mitochondria and oxidative stress: e lectron transport, NADPH turnover, and metabolism of reactive oxygen species Annu. Rev. Plant Physiol. Plant Mol. Biol. 52: 561 591 Murgia I, Tarantino D, Vannini C, B racale M, Carravieri S, Soave C (2004) Arabidopsis thaliana plants overexpressing thylak oidal ascorbate peroxidase show increased resistance to paraquat induced photooxidative stress and to nitric oxide induced cell death. Plant J. 38: 940 953 Myouga F, Hosoda C, Umezawa T, Iizumi H, Kuromori T, Motohashi R, Shono Y, Nagata N, Ikeuchi M, Shin ozaki K (2008) A heterocomplex of iron superoxide dismutases defends chloroplast nucleoids against oxidative stress and is essential for chloroplast development in Arabidopsis. Plant Cell 20 : 3148 3162 Nakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 22: 867 880 Narendra D, Venkataramani S, Shen G, Wang J, Pasapula V, Lin Y, Kornyeyev D, Holaday AS, Zhang H (2006) The Arabidopsis ascorba te peroxidase 3 is a peroxisomal membrane bound antioxidant enzyme and is dispensable for Arabidopsis growth and development. J Exp. Bot. 57: 3033 3042

PAGE 109

109 Neuberger G, Maurer Stroh S, Eisenhaber B, Hartig A, Eisenhaber F (2003) Prediction of peroxisomal targe ting signal 1 containing proteins from amino acid sequence. J. Mol. Biol. 328: 581 592 Noctor G, Foyer CH (1998) Ascorbate and glutathione : keeping active oxygen under control, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49 : 249 279 Noctor G, Veljovic Jovanovic S, Foyer CH (2000) Peroxide processing in photosynthesis: antioxidant coupling and redox signalling. Philos. Trans. R. Soc. Lond. B Biol. Sci. 355: 1464 1475 Panchuk II, Volkov RA, Schoffl F (2002) Heat stress and heat shock transcripti on factor dependent expression and activity of ascorbate peroxidase in Arabidopsis. Plant Physiol. 129: 838 853 Panchuk II, Zentgraf U, Volkov RA (2005) Expression of the Apx gene family during leaf senescence of Arabidopsis thaliana Planta 222: 926 932 Park SO, Zheng Z, Oppenheimer DG, Hauser BA (2004) The PRETTY FEW SEEDS2 gene encodes an Arabidopsis homeodomain protein that regulates ovule development. Development 132: 841 849 Paul Victor C, Zust T, Rees M, Kliebenstein DJ, Turnbull LA (2010). A new me thod for measuring relative growth rate can uncover the cost of defensive compounds in Arabidopsis thaliana. New Phytol. 187: 1102 1111 Pedersen P (2009) Soybean Growth and Development. Soybean Extension and Research Program, Dept. Agronomy, Iowa State Uni v. Pei ZM Murata Y Bening G Thomine S Klusener B Allen GJ Grill E, Schroeder JI (2000) Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells. Nature 406: 731 734 Pennell RI, Lamb C (1997) Programmed cel l death in plants. Plant Cell 9: 1157 1168 Peter GF, Thornber JP (1991) Biochemical composition and organization of higher plant photosystem II light harvesting pigment proteins. J. Biol. Chem. 266: 16745 16754 Pitzschke A, Hirt H (2006) Mitogen activated protein kinases and reactive oxygen species signaling in plants. Plant Physiol. 141: 351 356 Potocky M, Jones MA, Bezvoda R, Smirnoff N, Zarsky V (2007) Reactive oxygen species produced by NADPH oxidase are involved in pollen tube growth. New Phytol. 174: 742 751 Prasad PVV, Boote KJ, Allen LH, Thomas JMG (2002) Effects of elevated temperature and carbon dioxide on seed set and yield of kidney bean ( Phaseolus vulgaris L.) Global Change Biol. 8: 710 712 Prasad PVV, Craufurd PQC, Kakani VG, Wheeler TR, Boote KJ (2001) Influence of high temperature during pre and post anthesis stages of floral development on fruit set and pollen germination in peanut. Aust. J. Plant Physiol. 28: 233 240

PAGE 110

110 Prasad PV V, Craufurd PQC, Summerfield RJ (2000) Effects of short epi sodes of heat stress on flower production and fruit set of groundnut ( Arachis hypogaea L.) J. Exp. Bot. 51: 777 784 Prasad TK, Anderson MD, Martin BA, Stewart CR (1994) Evidence for chilling induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide. Plant Cell 6: 65 74 Rodriguez Milla MA, Maurer A, Huete AR, Gustafson JP (2003) Glutathione peroxidase genes in Arabidopsis are ubiquitous and regulated by abiotic stresses through diverse signaling pathways. Plant J. 36: 602 615 Sa gi M, Fluhr R (2001) Superoxide production by plant homologues of the gp91(phox) NADPH oxidase: modulation of activity by calcium and by tobacco mosaic virus infection. Plant Physiol. 126: 1281 1290 Schneitz K, Hulskamp M, Pruitt RE (1995) Wild type ovule development in Arabidopsis thaliana : a light microscope study of cleared whole mount tissue. Plant J. 7: 731 749 Schuller DJ, Ban N, van Huystee RB, McPherson A, Poulos TL (1996) The crystal structure of peanut peroxidase. Structure 4: 311 321 Sen Gupta A, Webb RP, Holaday AS, Allen RD (1993) Overexpression of superoxide dismutase protects plants from oxidative stress. Plant Physiol. 103: 1067 1073 Sharp KH, Mewies M, Moody PCE, Raven EL (2003) Crystal structure of the ascorbate peroxidase ascorbate complex. Nat. Struct. Mol. Bio. 10: 303 307 Shigeoka S, Ishikawa T, Tamoi M, Miyagawa Y, Takeda T, Yabuta Y, Yoshimura K (2002) Regulation and function of ascorbate peroxidase isoenzymes. J. E xp. Bot. 53: 1305 1319 Smyth DR, Bowman JL, Meyerowitz EM (1990) Early flower development in Arabdopsis. Plant Cell 2: 755 767 Sudhir P, Murthy SDS (2004) Effects of salt stress on basic processes of photosynthesis. Photosynthetica 42: 481 486 Sun J, Wang M J, Ding M Q, Deng S R, Liu M Q, Lu C F,Zhou X Y, Shen X, Zheng X J, Zhang Z K, Song J, Hu Z M, Xu Y, Chen S L (2010) H 2 O 2 and cytosolic Ca 2+ signals triggered by the PM H + coupled transport system mediate K + /Na + homeostasis in NaCl stressed Populus euph ratica cells. Plant Cell Environ. 33: 943 958 Sun K, Cui Y, Hauser BA (2005) Environmental stress alters gene expression and induces ovule abortion: reactive oxygen species appear as ovules commit to abort. Planta 222: 632 642 Sun K, Hunt K, Hauser BA (200 4) Ovule abortion in Arabidopsis triggered by stress. Plant Physiol. 135: 2358 2367

PAGE 111

111 Teixeira FK, Menezes Benavente L, Margis R, Margis Pinheiro M (2004) Analysis of the molecular evolutionary history of the ascorbate peroxidase gene family: inferences from the rice genome. J. Mol. Evol. 59: 761 770 Tognolli M, Penel C, Greppin H, Simon P (2002) Analysis and expression of the class III peroxidase la rge gene family in Arabidopsis thaliana Gene 288: 129 138 Torres MA, Onouchi H, Hamada S, Machida C, Hammond Kosack KE, Jones JDG (1998) Six Arabidopsis thaliana homologues of the human respiratory burst oxidase (gp91phox). Plant J. 14: 365 370 Tsugane K, Kobayashi K, Niwa Y, Ohba Y, Wada K, Kobayashi H (1999) A recessive Arabidopsis mutant that grows photoautotrophically under salt stress shows enhanced active oxygen detoxification. Plant Cell 11: 1195 1206 Tung CW, Dwyer KG, Nasrallah ME, Nasrallah JB (2 005) Genome wide identification of genes expressed in Arabidopsis pistils specifically along the path of pollen tube growth. Plant Physiol. 138: 977 989 Vandenabeele S, Vanderauwera S, Vuylsteke M, Tombauts S, Langebartels C, Seidlitz HK, Zabeau M, Van Mon tagu M, Inze D, Van Breusegem F (2004) Catalase deficiency drastically affects high light induced gene expression in Arabidopsis thaliana Plant J. 39: 45 58 Veitch NC (2004) Horseradish peroxidase: a modern view of a classic enzyme. Phytochemistry 65: 249 259 Wang J, Zhang H, Allen RD (1999) Overexpression of an Arabidopsis peroxisomal ascorbate peroxidase gene in tobacco increases protection against oxidative stress. Plant Cell Physiol. 40: 725 732 Weber H, Bo risjuk L, Heim U, Buchner P, Wobus U (1995) Se ed coat associated invertases of fava bean control both unloading and storage functions: Cloning of cDNAs and cell type specific expression. Plant Cell 7: 1835 1846 Welinder KG (1992) Superfamily of plant, fungal and bacterial peroxidases. Curr. Opin. Stru ct. Biol. 2: 388 393 Welinder KG, Justesen AF, Kjaersgard IVH, Jensen RB, Rasmussen SK, Jespersen HM, Duroux L (2002) Structural diversity and transcription of class III peroxidases from Arabidopsis thaliana. Eur. J. Biochem. 269: 6063 6081 Wilhelmi LK, Pr euss D (1997) Blazing new trails: pollen tube guidance in flowering plants. Plant Physiol 113: 307 312 Wilkins KA, Bancroft J, Bosch M, Ings J, Smirnoff N, Franklin Tong VE (2011) Reactive oxygen species and nitric oxide mediate actin reorganization and programmed cell death in self incompatibility response of Papaver. Plant Physiol. 156: 404 416 Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007) An scale biological data sets. PLoS One 2: e718

PAGE 112

112 Wu Z, Zhang X, He B, Diao L, Sheng S, Wang J, Guo X, Su N, Wang L, Jiang L, Wang C, Zhai H, Wan J (2007) A chlorophyll deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol. 145: 29 40 Zeng P, Vadnais DA, Zhang Z, Polacco JC (2004) Agrobacterium mediated transformation of Soybean [ Glycine max (L.) Merrill]. Plant Cell Rep. 22: 478 482 Zhang F, Wang Y, Yang YL, Wu H, Wang D, Liu JQ (2007) Involvement of hydrogen peroxide and nitric oxide in salt resistance in the calluses from Populus euphratica Plant Cell Environ. 30: 775 785

PAGE 113

113 BIOGRAPHICAL SKETCH In 1978, Ya Y ing (Emily) Wang was b orn in Sanchong, a suburb of Taipei, Taiwan. She prefers Emily, a name given to her by her first En glish teacher Emily grew up in a family with her grandparents, uncles, aunts, parents, sister, brothers and cousins. She often helped her grandmother with gardening and became fond of horticulture. As she grew older, she learned that she loved gifting plants that she propagated. As was her wish, she enrolled as an undergraduate student at National Taiwan University in Taipei, where she majored in Horticultur al Sciences. In her senior year, she worked on a mentored research project in the Plant Molecular Biology Lab. After a year of hard work, she had accumulated enough data and results to present at t he Chinese Hort icultural Society Annual Meeting in Taiwan. During this year, Emily decided to pursue her Masters degree in the same laboratory. After graduation in 2003, she worked as an associate researcher in a biotech company, Green Health Biotechnology Co., to develop anti cancer drugs from traditional herbs. Following this, she worked as a technician in the Institute of Plant and Microbial Biology in Academia Sinica, Taiwan, to refine her knowledge of plant science. Inspired and encouraged by her employers in Academia Sinica, Emily decided to study abroad. In the spring of 2013, Emily received her doctoral degree in Botany from the University of Florida.