Development of a Thermochemical Process for Hydrolysis of Polylactic Acid Polymers to L-Lactic Acid and Its Purification...

MISSING IMAGE

Material Information

Title:
Development of a Thermochemical Process for Hydrolysis of Polylactic Acid Polymers to L-Lactic Acid and Its Purification Using an Engineered Microbe
Physical Description:
1 online resource (124 p.)
Language:
english
Creator:
Chauliac, Diane Sylvie
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
Pullammanappallil, P C
Committee Members:
Shanmugam, Keelnatham T
Nicholson, Wayne L
Gonzalez, Claudio F
Dunn, Ben M

Subjects

Subjects / Keywords:
d-lactate -- escherichia-coli -- l-lactate -- l-ldh -- lactic-acid -- lactide -- naoh -- pla -- purification -- racemization -- recycling -- thermohydrolysis
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Polylactic acid polymer (PLA), produced from renewable resources is an alternative to petroleum-derived plastics. Thermochemical hydrolysis of the PLA-based plastics is an effective method of recycling them at the end of use to generate the constituent monomer, lactic acid (LA) that can be reused to produce PLA. Temperature-dependent release of LA from PLA beads in water follows apparent first order decay kinetics after a short lag. In the presence of limiting amount of NaOH, a concentration-dependent immediate release of LA, apparently from the amorphous regions of the beads, was detected. The rate of hydrolysis of PLA was higher in the presence of NaOH compared to water alone and this was dependent on particle size. Racemization of released LA was not detected during hydrolysis in water or with limiting amount of NaOH. D-LA removal from the resulting syrup was achieved using an Escherichia coli lacking all three L-lactate dehydrogenases identified. This bacterial biocatalyst was able to metabolically remove all the D-LA present in 1.5 M PLA-derived syrup in about 25 h, at 37°C. This represents an average productivity of 0.173 gD-LA/(gDW.h). These results show that PLA-based plastics can be rapidly converted to optically pure L-LA for reuse using a combination of thermochemical and bio-based processes.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Diane Sylvie Chauliac.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Pullammanappallil, P C.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045364:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 DEVELOPMENT OF A THERMOCHEMICAL PROCESS FOR HYDROLYSIS OF POLYLACTIC ACID POLYMERS TO L LACTIC ACID AND ITS PURIFICATION USING AN ENGINEERED MICROBE By DIANE SYLVIE CHAULIAC A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Diane S. Chauliac

PAGE 3

3 To my aunt who taught me how pr and happier.

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my deep appreciation and gratitude to my advisors, Dr. P.C. Pullammanappallil and Dr. K.T Shanmugam, for the patient guidance and mentorship they provide d to me, all the way from when I was first applying to the PhD program in the Microbiology and Cell Science department, through to completion of this degree. Dr. Shanmugam intellectual heft is matched only by his genuinely good nature and down to earth hum ility, and I am truly fortunate to have had the opportunity to work with him. I would also like to thank my committee members, Drs. B. Dunn C. Gonzalez, and W, Nicholson for the ir friendly guidance, thought provoking suggestions, and the general collegial ity that each of them of Drs. Michel Chartrain to have strongly pushed me in applying for a PhD and gave me the confidence necessary to be successful at it. ss if I did not acknowledge the support and encouragements of my loved ones. I thank Donald in s upporting me in any way he could throughout this journey, I salute his acceptance of sometimes long working hours and thank him for his everyday moral support; my parents who raised me to be responsible and independent, seed ing for a bright future; my sister, Fleur who was always able to find words of hope and courage when I needed it; I thank my best friend, Melanie for us growing so close to one another bein g so far apart.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ........................... 8 LI ST OF FIGURES ................................ ................................ ................................ ......................... 9 LIST OF ABBREVIATIONS ................................ ................................ ................................ ........ 11 ABSTRACT ................................ ................................ ................................ ................................ ... 16 CHAPTER 1 REVIEW OF THE SYNTHESIS AND DE GRADATION OF POLY LA CTIC ACID POLYMERS ................................ ................................ ................................ ........................... 17 Biodegradable Polymers ................................ ................................ ................................ ......... 17 Drivers and Rationale for the Use of Biodegrad able Polymers ................................ ...... 17 Biodegradable Polymers Market ................................ ................................ ..................... 18 PLA Polymers and Lactic Acid Market ................................ ................................ .......... 19 PLA Production ................................ ................................ ................................ ...................... 20 Synthesis ................................ ................................ ................................ .......................... 20 Lactic acid production ................................ ................................ .............................. 21 Production of lactide molecules ................................ ................................ ............... 22 Ring opening polymerization (ROP) ................................ ................................ ....... 23 Chemistry of PLA Polymers ................................ ................................ ........................... 25 Properties of PLLA and PDLLA ................................ ................................ .............. 26 Properties of sc PLA ................................ ................................ ................................ 28 PLA Degradation ................................ ................................ ................................ .................... 29 Recycling and Composting ................................ ................................ .............................. 29 Enzymatic Degradation ................................ ................................ ................................ ... 30 Thermohydrolysis ................................ ................................ ................................ ............ 32 2 ESCHERICHIA COLI AS A BIOCATALYST FOR TH E D LA REMOVAL OF THE HYDROLYZED PLA MATER IAL ................................ ................................ ....................... 37 Cradle to Cradle Life Cycle of PLA ................................ ................................ ...................... 37 Escherichia coli : a biocatalyst of choice ................................ ................................ ................ 37 Lactic Acid Metabolism of Escherichia coli ................................ ................................ .......... 38 Known LDHs in Wild Type E. coli ................................ ................................ ................. 38 Fermentative LDH ................................ ................................ ................................ .... 38 Respiratory LDH ................................ ................................ ................................ ...... 38 Evidence of Other L LDHs ................................ ................................ ............................. 40 3 OBJECTIVES AND CHOSEN STRATEGIE S ................................ ................................ ..... 42

PAGE 6

6 4 MATERIAL AND METHODS ................................ ................................ .............................. 43 PLA Hydrolysis ................................ ................................ ................................ ...................... 43 Materials ................................ ................................ ................................ .......................... 43 Thermohydrolysis Conditions ................................ ................................ ......................... 43 Analysis ................................ ................................ ................................ ........................... 44 Kinetics Parameters Measurements ................................ ................................ ................. 44 ................................ ............. 44 Activation energy E a ................................ ................................ ................................ 45 Calculations ................................ ................................ ................................ ..................... 45 Optical Purity Study ................................ ................................ ................................ ........ 46 Engineering E. coli for the D LA Removal from Hydrolyzed PLA Material ........................ 46 Bacterial Strains, Plasmids and Growth Conditions ................................ ........................ 46 Toxicity Induced by PLA Syrup on the Growth of Wild Type E. coli ........................... 47 Mutagenesis ................................ ................................ ................................ ..................... 47 Mutations constructed by transduction ................................ ................................ .... 47 Deletion of ykgEFG operon ................................ ................................ ..................... 48 Tn5 random insertion into the genome of DC82551 ................................ ................ 48 UV mutagenesis of strain DC82551 ................................ ................................ ......... 49 Adaptive evolution of E. coli strain DC8261 and DC bglX ................................ ...... 50 Removal of D LA from Hydrolyzed PLA M aterial ................................ ............................... 51 D LA Consumption Rate as a Function of DC bglX Cell Density ................................ ... 51 D LA Removal Using Hydrolyzed PLA Material ................................ ........................... 52 Inoculum preparation ................................ ................................ ............................... 52 PLA syrup preparation ................................ ................................ ............................. 52 Analyses and calculations ................................ ................................ ........................ 53 D LA removal with air sparging ................................ ................................ .............. 53 Insight into the L LA Metabolism of Escherichia coli ................................ .......................... 54 Biochemistry of L LDHs ................................ ................................ ................................ 54 Cell free extract preparation ................................ ................................ ..................... 54 Enzyme assays ................................ ................................ ................................ .......... 54 Pyruvate accumulation ................................ ................................ ............................. 55 Localization of L LDHs in E. coli ................................ ................................ ........... 55 Construction of Genomic Libraries and recA Mutants ................................ .................... 55 ................................ ................................ ................................ ........ 57 Conjugation of DC8261 with Various Hfr Strains ................................ .......................... 57 L LDH Act ivity Observed on Native Gel ................................ ................................ ....... 57 Sample preparation ................................ ................................ ................................ ... 57 Native gel electrophoresis: PAGE ................................ ................................ ............ 58 5 RESULTS AND DISCUSSION ................................ ................................ ............................. 62 PLA Hydrolysis to LA ................................ ................................ ................................ ............ 62 PLA Hydrolysis in Water ................................ ................................ ................................ 62 PLA Hydrolysis in an Alkaline Solution ................................ ................................ ......... 64 Activation Energy of PLA Hydrolysis to LA ................................ ................................ .. 67 Effect of Particle Size of PLA on Hydrolysis ................................ ................................ 67

PAGE 7

7 Racemization of Lactic Acid during Hydrolysis ................................ ............................. 68 Engineering E. coli for Removal of D LA from Hydrolyzed PLA ................................ ........ 70 Toxicity Induced by LA and PLA Syrup on the Growth of Wild Type E. coli .............. 70 Isolation of E. coli Mutant Lacking L LDH Activity ................................ ...................... 71 Purification of PLA Syrup by DC8212, DC8248 and DC8261 ................................ ...... 73 Adaptive Evolution of E. coli Strain DC8261 in D LA MM and Optimization ............. 74 D LA Consumption Rate as a Function of Cell Density ................................ ................. 75 Purification of PLA Syrup by DC826170 and DCbglX30 ................................ .............. 76 Insight into the L LA Metabolism of Escherichia coli ................................ .......................... 78 Phenotype of DC8255 on L LA MM ................................ ................................ .............. 78 Ykg as an LD H ................................ ................................ ................................ ................ 79 Third L LDH in E. coli ................................ ................................ ................................ .... 80 Biochemical Properties of L LDHs in E. coli ................................ ................................ 80 Cellular localization of L LDHs and identification of electron acceptor for activity ................................ ................................ ................................ ..................... 80 Kinetic properties of the three L LDHs ................................ ................................ ... 81 Attempts to Map the Third L LDH ................................ ................................ ................. 83 Complementation of L LA minus phenotype using plasmid libraries ..................... 83 ion of DC8261 with Hfr E. coli strains .............. 85 Attempts to identify the third L LDH by LC/MS ................................ .................... 86 6 CONCLUSION ................................ ................................ ................................ ..................... 106 LIST OF REFERENCES ................................ ................................ ................................ ............. 108 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 124

PAGE 8

8 LIST OF TABLES Table page 1 1 PLA degrading organisms and detection method (148) ................................ .................... 33 1 2 Characteristics of purified PLA degrading enzyme from various strains (148) ................ 34 2 1 Plasmids and strains used in this study ................................ ................................ .............. 59 2 2 Primers used in this study ................................ ................................ ................................ .. 60 3 1 D LA content of syrup o btained after hydrolysis of PLA at various temperatures ........... 89 3 2 Effect of base on racemization of LA ................................ ................................ ................ 89 3 3 Growth rates of relevant E. coli strains in minimal medium containing various lactic acid isomers ................................ ................................ ................................ ....................... 90 3 4 L LDH activities of E. coli mutants defective in various L LDH activities ...................... 90 3 5 Affinity of different L LDH to L LA in E. coli ................................ ................................ 91 3 6 Potential L LDH gene candidates located between 55 min and 65 min on the E. coli chromosome ................................ ................................ ................................ ....................... 91 3 7 ............................. 92 3 8 List of potential L LDHs identified from LC/MS analysis ................................ ............... 92

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Possible routes towards the industrial production of PLA ................................ ................. 34 1 2 Molecular mech anism describing the production of Lactide ................................ ............. 35 1 3 Molecular mechanism of cationic ROP ................................ ................................ ............. 35 1 4 Molecular mechanism of anionic ROP ................................ ................................ .............. 36 1 5 Hydrolysis of PLA in the presence of water ................................ ................................ ...... 36 2 1 Culture apparatus used for D LA removal from PLA syrup with sparged air ................... 61 2 2 Pictures of spheroplasts of DC8255 cells ................................ ................................ .......... 61 3 1 LA recovery profiles of various PLA materials in water at 160C. ................................ .. 93 3 2 Hydrolysis profiles of PLA at different temperatures ................................ ........................ 93 3 3 Hydrolysis profiles of PLA in water or 1 M NaOH at 160C ................................ ........... 94 3 4 Relationship between the amount of LA recovered during the first phase of PLA hydrolysis and the initial concentration of NaOH at different temperatures. .................... 95 3 5 A aqueous solution. ................................ ................................ ................................ ................ 96 3 6 Effect of PLA particle size and NaOH concentration on LA recovery ............................. 96 3 7 Optical purity of LA released during the hydrolysis of PLA beads (grade 3052D) at 160C ................................ ................................ ................................ ................................ 97 3 8 Growth rate of E. coli strain W3110 in increasing con centration of either Na L LA or hydrolyzed PLA syrup ................................ ................................ ................................ .. 97 3 9 Roadmap of the different strains constructed throughout the present study ...................... 98 3 10 Screening steps following UV exposure of E. coli strain DC82551. OD 420 was determined at 24 h. ................................ ................................ ................................ ............. 99 3 11 Growth of strains DC8261, DC lldR and DC ykgD on 3 g/L L LA MM kan after 48 h of incu bation at 37C. ................................ ................................ ................................ ........ 99 3 12 D l actic acid consumption rates and doubling time of E. coli strain DC bglX as a function of initial cell density ................................ ................................ .......................... 100

PAGE 10

10 3 13 D LA removal from PLA syrup by E. coli strain DC bglX 30 ................................ .......... 100 3 14 L LDH activity of various fractions during membrane preparation from E. coli strain DC8255 ................................ ................................ ................................ ............................ 101 3 15 pH profiles of the three different L LDH activities in E. coli ................................ ......... 102 3 16 L LDH activity pH profiles of membranes with multiple L LDH activities ................... 103 3 17 Enzyme activity as a function of substrate concentration using membranes from E. coli ................................ ................................ ................................ ................................ .... 104 3 18 Genetic map of E. coli K 12 showing appr oximate chromosomal regions carried by different F prime elements. ................................ ................................ .............................. 105 3 19 Native PAGE gels stai ned with DCPIP, without L LA, and with L LA ........................ 105

PAGE 11

1 1 LIST OF ABBREV IATIONS (NH 4 ) 2 SO 4 Ammonium sulfate [D LA] D Lactic acid concentration [L LA] L Lactic acid concentration [LA] Lactic acid concentration [Lac] Lactic acid mass fraction at time t [Lac] max Maximum lactic acid concentration [Na L LA] Sodium L lactic acid conc entration [NaOH] Sodium hydroxide concentration C Celsius d egree BCA B icinc honinic acid a ssay BL (R) B utyrolactone CAGR Compound annual growth r ate CAPSO N Cyclohexyl 2 hydroxyl 3 aminopropanes ulfonic acid cm C entimeter Compatibilizer Also referred to as coupling agents, are additives, that when added to a blend of immiscible mate rials during extrusion, modify their interfacial properties and stabilize the melt blend C u SO 4 Cupric sulfate D LA D Lactic acid D LDH D Lactate dehydrogenase DCPIP 2,6 Dichlor ophenolindop henol DNA Deoxyribonucleic a cid DNase Desoxyribonuclease DXO 1,5 D ioxepan 2 one E. coli Escherichia coli

PAGE 12

12 e.g. E xempli gratia E a Activation energy EDTA Ethylenediaminetetraa cetic acid etc E t cetera FAD Flavin adenine d inucleotide FDA Food and d rug a dministration FeSO 4 Ferr ous sulfate Flexural modulus Pressure used as a gauge to compare relative bending stiffness of various plastics. Measure obtained through a 3 points bending test Flexural strength P ressure (load per surface area) to apply to br eak the material during a 3 points bending test FMN Flavin monon ucleotide FRT FLP Recombination Target g G ram g/L G ram per liter GA Glycolic a cid g D LA Gram of D LA g DW G ram cell dry weight gras Generally regarded as s afe h H our H 2 0 W ater H 2 SO 4 Sulfuric ac id HEPES 4 (2 HydroxyEthyl) 1 piperazineethanes ulfonic acid HPLC High performance liquid chromatography i.e, Id est (That is) K Kelvin

PAGE 13

13 k Apparent maximum hydrolysis rate kan K anamycin resistance gene kDa K ilo d altons KH 2 PO 4 Monopotassiun phosphate K m Mich aelis constant ktpa kilo tons per annum L Liter L LA L Lactic acid L LDH L Lactate dehydrogenase LA Lactic acid LB Luria Bertani broth LDH Lactate dehydrogenase M Molar MES 2 ( N Morpholino)ethanes ulfonic acid mg Milligram MgCl 2 Magnesium c hloride MgSO 4 .7 H 2 0 Magnesium sulfate min Minute mL Milliliter MM Minimal m edium mM millimolar mm millimeter Modulus M easurement of the stiffness of an elastic material. It is the flexural modulus obtained in the initial linear stress to strain curve MS Microsoft MTT Dimethyl thiazolyl diphenyl t etrazolium salt

PAGE 14

14 MW Molecular weight N. meningitidis Neisseiria meningitidis Na Sodium Na 2 HPO 4 Sodium phosphate dibasic NaCl Sodium chloride NaMoO 4 Sodium m olybdate NaOH Sodium h ydroxyde nm N anometer nt Nucleotide O 2 O xygen OD 420 Optical density (420 nm) PAGE P olyacrylamide gel electrophoresis PCL Polycaprol actone PCR Polymerase chain reaction PDLA PLA made of D Lactide PDLLA PLA made of D and L lactide PEG P oly(ethylene glycol) PEO P oly(ethylene oxide) PET Polyeth ylene t erephtalate PHB Polyhydroxyb utyrate PLA Polylactic a cid PLLA PLA made of L Lactides R U niversal gas constant RNase Ribonuclease ROP Ring Opening Polymerization

PAGE 15

15 rpm Rotation per minute RT Room temperature s S econd Sb PLA Stereoblock PLA Sc PLA Stereo complex PLA SOC Super Optimal Broth SSP Solid State Polycondensation Strain (Mecanics) Normalized measure of deformation, dimensionless t T ime T Absolute temperature in Kelvin t 0 T ime at the start of the experiment Td Doubling time (h) Tensile strength Als o called ultimate strength, is the maxim um stress that a material can wi t hst and while being stretched or pulled before necking Tg G lass transition temperature Tm Melting temperature TMC T rimethylene carbonate UV Ultraviolet Vm Maximum specific activity w/v Weight / V olume Lag phase duration M icrogram M icroliter M icrometer M icromole

PAGE 16

16 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENT OF A THERMOCHEMICAL PROCESS FOR HYDROLYSIS OF POLYLACTIC ACID POLYMER S TO L LACTIC ACID AND ITS PURIFICATION USING AN ENGINEERED MICROBE By Diane Sylvie Chauliac May 2013 Chair: Pratap Pullammanappallil Major: Microb iology and Cell Science Polylactic acid polymer (PLA), produced from renewable resources is an alternative to petroleum derived plastics. Thermochemical hydrolysis of the PLA based plastics is an effective method of recycling them at the end of use to gen erate the constituent monomer, lactic acid (LA) that can be reused to produce PLA. Temperature dependent release of LA from PLA beads in water follows apparent first order decay kinetics after a short lag. In the presence of limiting amount of NaOH, a conc entration dependent immediate release of LA, apparently from the amorphous regions of the beads, was detected. The rate of hydrolysis of PLA was higher in the presence of NaOH compared to water alone and this was dependent on particle size. Ra cemization of released LA was not detected during hydrolysis in water or with limiting amount of NaOH. D LA removal from the resulting syrup was achieved using an Escherichia coli lacking all th r e e L lactate dehydrogenases identified This bacterial biocatalyst was abl e to metabolically remove all the D LA present in 1.5 M PLA derived syrup in about 25 h, at 37C. This represents a n average productivity of 0.173 g D LA /(g DW .h). These results show that PLA based plastics can be rapidly converted to optically pure L LA for reuse using a combination of thermochemical and bio based processes.

PAGE 17

17 CHAPTER 1 REVIEW OF THE SYNTHE SIS AND DEGRADATION OF POLY LACTIC ACID POLYMERS Biodegradable P olymers Drivers and Rationale for t he Use of Biodegradable P olymers In 2011, 280 million to nnes of petroleum derived plastics were produced world wide and current average per capita plastics consumption of about 26 kg is estimated to increase by about 4% every year through 2016 ( 124 ) Manufacture of these non renewable plastics utilizes toxic non renewable chemicals. In addition, these non biodegradable polymers accumulate in the environment creating environmental hazard both in the l and rivers and ocean ( 1 59 154 155 ) Accumulating information point s to potential health hazards and diseases that can be directly related to the use of certain p lastics in consumer products ( 132 155 ) Food stored in some plastic containers is being recognized as carr ying toxic leachates from the containers making it unfit for human consumption ( 94 95 ) Owing to concerns ove r the effects of such leachates, government agencies in Australia, Canada, the European Union, and the United States have restricted or prohibited the use of phthalates in consumer products ( 189 ) These concerns led researchers to creat e new forms of plastics, which are renewable, biodegradable and biocompatible ( 26 106 144 174 ) Bio based polymers also called biopolymers when the polymer naturally exists in nature reduce oil consumption and alleviate some of the environmental burden petroleum based plastics cause. Various biodegradable polyme rs are available on the market and classified as follows: Agro polymers from agricultural such as the agro polymers from agro resources e.g., starch, cellulose Bio polymers produced by microbial activity e.g., the Polyhydroxyalkan oates

PAGE 18

18 Bio based polymers convent ionally and chemically synthesized and whose monomers are obtained from agricultural resources e.g., polylactic acid (PLA) P olymers whose monomers and polymers are obtained conven tionally by chemical synthesis, e.g., poly caprolactones. Natural polymers and synthetic polymers based on renewable resources are the basis for a sustainable production of eco efficient plastics that are expected to gradually replace the oil based family of plastic ( 110 ) Compared to various biodegradable polyesters, PLA has one of the highest potential as a replacement for petroleum based plastics due to its av ailability on the market and its low price ( 98 141 173 ) Ri sing prices of oil make PLA a cost competitive alternative to petroleum derived plastics. PLA polymers are aliphatic polyesters produced from lactic acid. PLA products are approved by the FDA for their use in therapy, and can be used for food contact packa ging since they are generally regarded as safe (GRAS) ( 16 ) Biodegradable Polymers M arket The global biodegradable plastics market has been witnessing the fastest growth among all plastic and polymer markets in recent times. This high growth is driven by several fa ctors such as increasing awareness and the push for sustainable solutions. In 2005, the global biode gradable plastics market was 94. 8 ktpa (kilo tons per annum) compared with 28 ktpa in 2000. Forecast made in 2005 predicted a bio degradable plastic product ion of 214. 4 ktpa in 2010 (17% CAGR) ( 125 ) while the actual amount turne d out to be almost double this f igure with 422 ktpa of biodegradable plastics consumed in 2011 ( 6 ) This latter report also pred icted a 22.5% annual growth rate leading to a forecast of 1 200 ktpa of biodegradable plastic by 2016. Despite the rapid increase of the biodegradable plastics market, these values do not compare with the 31,000 ktpa of plastic waste generated in 2010 in t he United States alone ( 30 ) Western Europe is

PAGE 19

19 the lead ing consumer of biodegradable plastics and repre sents 60% of the global market. North America and Asia Pacific regions represent 22% and 18% of the market of biodegradable plastic s, respectively. In terms of end use markets, packaging (including rigid and flexible packaging, paper coating and foodservic e and loose fill packaging) is the largest sector in 2005 with 63 % of total market volume ( 125 ) The packaging segment accounted for 70% of total volume in 2010 and is expected to slightly decrease to a bout 65% by 2016 as other uses increase. This sector was worth 297 ktp a in 2011 and should increase at a 20.5% compound annual growth rate (CAGR) to reach nearly 770,1 ktpa by 2016. The fibers/fabrics segment is expected to show substantial growth over the forecast period, especially in the hygiene market. The use of biodegr adable p olymers in fibers and fabrics was valued at an estimated 61 ktpa in 2011 and is expected to reach 197 ktpa in 2016, reflecting a 26.6% compound annual growth rate (CAGR) ( 6 ) PL A Polymers and Lactic Acid Market Since Ethicon companies int roduced a high strength polymer in 1972, PLA has been widely utilized as sutures, dental implants, bone screws and pins because of its biocompatibility with the human bod y. The PLA market was the n primarily related to medical applications due to production of lactic acid allowed the PLA technology to be accessible for applications other than medical ( 98 ) Polylactic acid has emerged as a key product in the biodegradable plastic group It is not only a biodegradable polymer, but also a complete bio based polymer. The physical and mechanical properties of PLA make it a good c and idate fo r replacement of petroleum based plastic s in several application areas ( 102 ) In 2005, PLA market share represented 38% of t he biodegradable plastics market volume, starch polymers and other synthetic polymers constituting 47% and 15% respectively. The PLA market was expected to grow faster than other

PAGE 20

20 biodegradable polymer markets, raising the PLA market share to 43% of the sal es of biodegradable plastic in 2011, overpowering the market for starch polymers (i.e., 41%) ( 125 ) The global dem and for PLA was 248.8 kilo tons in 2010 and is expected to reach 870.8 kilo tons in 2016, growing at a CAGR of 20.8% from 2011 to 2016. In terms of revenue, the dem and was estimated to be worth $1 .2 b illion in 2010 and is expected to reach $3 .8 b illion in 2016, growing at a CAGR of 18.7% from 2011 to 2016 ( 102 ) Europ ean Union is the largest consumer of PLA, mainly owing to stringent packaging regulations Dem and for PLA in Europe is expected to reach $1 .4 b illion in 2016, growing at a CAGR of 18.3% from 2011 to 2016. Cargill Dow was the first company to produce PLA on a large scale in 2002. Given the strong market dem and and expected PLA market growth, many companies have embarked on polylactic acid production with increased production cap acities and building new plants; PURAC bio materials (The Netherl and s), Futtero (Joint Venture between Total petrochemicals and Galactic, Belgium), Mitsui (Japan), LG Chem (Korea) and Hycail (Finl and ) are other companies worldwide focusing on industrial production of PLA plastics PLA P roduction Sy nthesis D ifferent routes of PLA production are summarized in F igure 1 1. There are three possible processes for the production of PLA. The cheapest method is the condensation of lactate into a prepolymer of low molecular weight (top part of F igure 1 1 ). Th is prepolymer is brittle and glassy, which for the most part, is un suitable for any application unless some external coupling agent is added to the mixture, for increas ing the polymer molecular weight. However, t he added adjuvant s and solvent s necessary to achieve a high molecular weight polymer increase the cost and complexity of this method ( 8 11 64 139 145 ) An alternate method uses a solvent base process in which a high molecular weight polymer is produc ed by direct condensation of

PAGE 21

21 lactic acid molecules (middle section of the diagram F igure 1 1 ). Release of water molecules accompanies the condensation of each monomer of lactate to the polymer. Because water molecules can affect and hydrolyze the polymer a s it is being produced, this process requires the use of solvents and continuous azeotropic distillation to remove water and is currently used by Mitsui Toatsu company in Japan ( 29 ) An other route for PLA production is a solvent free process in which a low molecular weight prepolymer is first produced by condensation of lactic acid (bottom part of F igure 1 1). This is followed by a controlled depolymerization t o produce lactide, a cyclic dimer of lactic acid. Lactide s are maintained in solution and purified by distillation. Catalytic ring opening of the purified lactide intermediates results in production of the desired molecular weight polymer in a continuous m anner, without any additional purification step to remove the residual lactide molecules ( 55 ) The following sections will detail the molecular mechanism of this process ; production of lactide followed by ring opening polymerization (ROP) to produce PLA in the USA. Lactic acid production Production of high molecular weight PLA at high yield relies on the availability of high quality lactic acid ( 41 60 ) The attractive cost of lactic acid and its availability on the market are the reasons why PLA was the first bio based polymer produced i n mass. Currently, almost all the lactic acid (2 hydroxy propionic acid) available on the market is produced by fermentation of corn or potato starch. B riefly, homolactic Lactobacilli ferment carbohydrates to produce optically pure L lactic acid as sole fe rmentation product. In these fermentations over 1.8 moles of L LA per mole of hexose is produced, representing 90% of the theoretical yield of 2 mol/mol ( 21 ) During the fermentation process lasting three to six days, calcium hydroxide ( or calcium carbonate ) is added to the m edium to neutralize lactic acid in the medium as calcium lactate. M edium is then filtered to remove cells and insoluble fractions, dried and acidifi ed with sulfuric

PAGE 22

22 acid to yield crude lactic acid that still contains residual carbohydrates and proteins. F urther purification could utilize distillation of the lactic acid as methyl or ethyl ester, followed by hydrolysis of the purified ester to the acid form. D lactic acid is also produced by fermentation ( 48 130 176 ) In 1990, the worldwide production volume of lactic acid was approximately 40 ktpa with two primary manufacturers, CCA Biochem in The Netherlands and Sterling Chemi cals in Texas City, TX, USA ( 21 ) he global dem and for lactic acid incr eased ten times to 482.7 kilo tons in 2010 and is expected to reach 1,077 kilo tons in 2016, growing at a CAGR of 14.2% from 2011 to 2016 ( 102 ) Production of lactide molecules Production of lactide, a cyclic dimer of lactic acid, was first described by Pelouze in 1845. He studied self esterification of lactic acid under heat and reported the formation of a prepolymer no longer miscible with water ( 121 ) There are three main steps in the current production process of lactide: prepolymerization (dehydration), lactide synthesis from the prepolymer usually in the presence of a catalyst such as tin octoate (thermal cracking), and purification of lactide. The p repolymerization step is typically conducted in a 6 h batch process, where a vacuum of 70 250 mbar and temperature up to 190C are applied to dehydrate the lactic acid, causing it to self esterify into a prepolymer of 8 to 25 residues long linear chain ( 116 ) The prepolymer is then fed into a cracking zone operated at a temperature no higher than 240 C and pressure sufficient to cause vaporization of lactide after its formation. Dur ing this step, t he hydroxyl group located at one end of the polymer attacks the carbonyl carbon of the following lactate unit and cyclicyze into a molecule whose formula is C 6 H 8 O 4 (Figure 1 2) This mechanism is referred to ( 8 64 145 ) Presence of a catalyst enhances lactide formation by facilitating the backbiting mechanism. Tin octoate (stannous 2 ethylhexanoate) is

PAGE 23

23 the best among the catalysts tested and exhibited the lowest level of racemization ( 114 ) Besides, this catalyst is widely available at food grade. In this process, lactide formation is in equilibrium with lactic acid and therefore, lactide must be removed as it is produced to ensure completion of the reaction ( 114 142 ) This is achieved by vaporization of neo formed lactide to quickly remove it from the reaction chamber. After condensation and subsequent purification to remove any residual water, lactic acid and oligomers, concentrated pure lactide is maintained as a liquid ( 116 ) or turned into a powder. Purification involves distillation and crystallization steps to remove impurities but also to remove most of the meso lactide produced as the rate of h y drolysis of meso lactide (back into lactic acid) is much higher than that of D or L lactide. D ifferent percentages of the lactide isomers formed depend on the purity of the lactic acid feedstock, temperature of the reaction and the catalyst used ( 60 ) D lactide contains only D LA L lactide contains only L LA and optically inactive meso lactide contains one molecule of each of the isomers (F igure 1 2) Lactides used for PLA production must be at least 99% optically pure, must not contain more than 0.2% of meso lactide because meso lactides are highly hygroscopic and undergo rapid hydrolysis in water ( 182 ) B ecause racemization can be controlled throughout lactide production it is possible to project th e optical purity of the resulting product based on the starting material ( 54 ) Therefore, lactic acid used as a raw material must have an optical purity of highe r than 99% ( 184 ) Ring opening polymerization (ROP) The ring opening polymerization of lactide (ROP) was first demonstrated by Carothers in 1932 ( 13 ) This process of ROP has been shown to be an equilib rium reaction between the cyclic dimer and polymer form ( 13 ) The ROP can be cationic or anionic ( 41 ) depending on the type of initiator used to break the cyclic lactide and introduce it into the polymer. T he molecular

PAGE 24

24 mechanism of cationic ring o pening and anionic r ing opening is presented in Figures 1 3 and 1 4, respectively P olymerization starts with t he opening of positively charged lactide at the alkyl oxygen bond by an S N 2 nucleophile attack by the triflate anions, one to activate the first lactide, and a second anion to break down the dimer of lactate. Then, the carbonyl of another lactide attack s t he carbon that was activated by the triflate anion. This reaction leads to binding of the lactide molecule to polymer and the release of one molecule of catalyst triflate anion. The cycle can then start over with the nucleophile attack from trifle to the b ackbone of the newly linked lactide ( F igure 1 3), opening of the ring and subsequent attack from a new lactide molecule. Many different chemical s have been tested for their ability to initiate polymerization of PLA, but potassium or calcium ions are the c hemical of choice in the production of polymers that are considered biocompatible ( 60 ) Among other initiators tes ted, t in (II) and zinc ha ve been shown to yield the purest PLA polymers ( 19 ) C oupling agents are also added to the mixture to allow ramification of the polymer, which greatly increase the final molecular weight of the polymer. These chemicals react the same way as catalyst, but attack pr eferentially the hydroxyl or carboxyl groups present in the polymer. Some examples of coupling agents are isocyanates, acid chlorides, anhydrides, epoxides, thiirane and oxazoline ( 60 ) By controlling the residence time, temperature and the type of catalyst employed, it is possible to control the ratio and sequenc e of D and L LA unit s in the final polymer. This mixtu re dictates the mechanical properties of the polymer such as tensile strength, the el ongation at break, the modulus and the melting point among others. The architecture of the backbone define s the degree of crystallinity and the process ing temperature of the polymers. It should be noted that racemization could occur at any step in the polymer production ( 50 86 )

PAGE 25

25 Chemistry of PLA P olymers There are three types of polylactide polymers that can be produced; homopolymers, copolymers, and stereocomplexes. Homopolymers are typically made of 100% L lactide and called PLLA. PDLA, made out of D lactides exclusively, has t he same characteristics as PLLA but is more expensive due to the higher price of the D LA monomer ( 77 ) The common commercial co polymer of PLA is PDLLA (Poly (D L ) Lactic Acid), composed of predominantly L lactide, with small amount s of D and meso lactide. Properties of PLA are highly related to the ratio bet ween the two isoforms D and L. Stereocomplex PLA (sc PLA) consists of both PLLA and PDLA fibers. PLLA and PDLA chains are packed side by side to form a super structure with impr oved thermal and mechanical properties over PLLA. Their properties will be briefly detailed here as the present study principally focuses on PDLLA copolymers and not on sc PLA. Aside of the polymers mentioned above, numerous molecules have been copolymeri zed with PLLA. Glycolic acid (GA), poly(ethylene glycol) (PEG) or poly(ethylene oxide) (PEO), (R) butyrolactone (BL), 1,5 dioxepan 2 one (DXO) and trimethylene carbonate (TMC) are examples among many other possible comonomers. Plasticizing PLA with other molecules can help tailor the properties of the created polymer to fit the needs of a specific application. For instance, PLA PEO polymers are more hydrophilic, flexible and biodegradable than PLA homopolymer ( 146 ) which makes them a more suitable candida te for controlled drug delivery systems. Starch has also been investigated as a blend with PLLA to reduce its cost while maintaining its biodegradability ( 69 79 80 ) Blending PLLA with starch requires the addition of compatibilizers that act as glue between the hydrophobic PLLA and the hydrophilic starch ( 63 81 177 186 187 ) PLLA has also been blended with non biodegradable polymers such as polyefins, vinyl polymers, elastomers, and rubbers and with other biodegradable polymers s uch caprolactone) and polyhydroxyalkanoates. There is

PAGE 26

26 a plethora of copolymers that have been engineered and commercialized but for the most part, these degradable materials are of interest for the pharmaceutic al industry and are not further discussed here. Properties of PL LA and PDLLA PLA homopolymers available on the market are typically made of a 100% L lactide (PLLA) with high crystallinity and good mechanical properties ( 122 ) Research and development allowed researchers to understand that t he chiral purity of the polymer controls the ability of the polymer to crystallize ( 33 56 ) These polymers are transparent and their properties approach some of the petroleum derived pla stics ( 111 ) PLA presents a medium water and oxygen permeability level ( 180 ) comparable to polystyrene ( 90 ) For instance, noteworthy PLA properties include a flexu ral modulus higher than that of polystyrene, a resistance to fatty foods and dairy products equivalent to PET, an excellent flavor and aroma barrier, and good heat stability ( 98 ) Other advantages of controlled polymer crystall inity relate to the storage, transfer and processing of polylactic acid resins into fibers, non woven fabrics, films, and other end products ( 33 ) PLLA is a semicrystalline material with a modulus of 2.7 GPa, a tensile strength of 50 to 70 MPa, an elongation at b reak of 4%, a flexural modulus of 5 GPa, and a flexural strength of 100 MPa ( 28 34 49 70 ) Its melting point is about 180C and the glass transition Tg is around 60 to 65C ( 4 ) which when annealed properly, has a crystallinity of 35% to 70%. From these values, PLLA can be characterized as being brittle with a rather low elongation at break, which limits its applications. To broaden the applications of PLA polymers, chemists developed copolymers with tailored valuable properties. The common commercial co polymer of PLA is PDLLA (Poly (D L )Lactic Acid), composed of predominantly L lactide, with smal l amount of D and meso lactide. Typically, the feed of D LA ranges from 1 to 8% of the total LA used during production of the polymer. PLA resins containing more than 93% of L lactic acid

PAGE 27

27 are semicrystalline whereas PLA composed of 50 to 93% L lactic acid are fully amorphous ( 3 ) For identical L isomer contents, copolymers of L and D lactides have higher crystallinities than those made with L and meso lactides, and therefore exhibit lower melting temperatures ( 100 ) These different properties associated with PDLLA favo r its actual development in different packaging applications (trays, cups, bottle s films etc.) ( 141 146 ) Amorphous and biaxial films made of PDLLA exhibit clarity and gloss that exceeds PET Besides, PDLLA is easily printed on, which means that stickers and label s are not necessary ( 98 ) Kolstad investigated the crystal lization behavior of copolymers of L lactides and meso lactide ( 86 ) He observed a loss of 3C in the melting tempera ture with every 1% of meso lactide (or D isomer) added to the feed. 3% meso lactide was enough to double the crystallization time of the polymer over the PLLA crystallization kinetics, 6% meso lactide incorporated into PLA slowed the crystallization kineti cs of the corresponding polymer by an order of magnitude ( 86 ) Lower crystalline melting points achieved by introduci ng meso lactide into the polymerisation also allow lower melt processing temperatures of the final polymer ( 98 ) PDLLA has a melting temperature ranging from 130 to 180C, again directly related to the amount of D LA added to t he feed ( 51 57 60 86 ) The glass transition of PDLLA varies from 60C for PLLA to 34C when PLA is prepared with 50% of each isomer of lactic acid ( 118 ) Overall, copolymerizing PLLA with small amount o f D isomer offers materials with lower brittleness and better film properties ( 4 ) Annealing improves the thermo mechanical properties of PLA by letting the polymer crystalize. Therefore, extrusion or injection molding processes must be optimized. Proper crystallization of PLLA and PDLLA will improve the behavior of the plastic when applications require temperatures higher than 50C. Biaxial orientation of PLA film is an important method to increase tensile strength

PAGE 28

28 and elongation at break. Thus, PLA is a versatile polymer that can be converted into several materials having useful properties for m any different applications. Properties of sc PLA While PLLA and PDLA are relatively heat sensitive, stereocomplexes made from both polymers exhibit a melting point increase of 51C as compared to their respective pure polymers ( 65 164 ) On the other hand, blending PLLA with PDLA lowers its biodegradability as it increases its stability ( 23 ) Sc PLA can act as high performance polymers because their melting temperature, i.e. 230C, is 50C higher than that of enantiomeric PLLA or PDLA ( 65 ) The glass transition of sc PLA is 65 to 72C, which is slightly higher than that of PLLA ( 71 ) probably due to the limited mobility of PLA fibers in the amorphous regions surrounded by crystalline states. Sc GPa, and a elongation at break of 30%, which are values considerably higher than the ones reported for PLLA ( 4 ) To promote sc crystallization of PLA, stereoblocks type PLA have been created (sb PLA), which are b lock copolymers of enantiomeric PLLA and PDLA. Sb PLA can be synthesized by solid state polycondensation (SSP) of a mixture of PLLA and PDLA having medium molecular weight or by stepwise ROP of D and L lactides. It is believed that van der Waals interacti ons of the enantiomeric polymer chains are responsible for the stereocomplex formation ( 4 ) PLA remains a challenge and several research efforts are currently ongoing towards a process that is fast enough and yields high molecular weight sc PLA ( 138 165 166 168 ) Even though an optimum process for the production of sc PLA is n ot in place yet, stepwise ROP seems to be a promising way ( 68 87 ) In this method, a primary polymer is syn thesized using L or D lactide as a feed. When the molecular weight of 50 kDa is reached, the polymer is precipitated to remove the residual monomer T he second lactide monomer and a catalyzer such as the commonly used tin octanoate is then added to the ne wly

PAGE 29

29 formed polymer to start the ROP using the counterpart lactic unit exclusively This way sb PLA of 200 kDa can be obtained, with various PLLA/PDLA block ratio for producing fibers with high thermal stability for various electric appliances and automobil e parts since sc PLA is incombustible by nature ( 92 169 ) PLA D egradation Recycling and C omposting The world's annu al consumption of plastic materials has increased from around 5 million tons per year in the 1950 ( 179 ) The widespread use of plastics dem and s proper end of life manage ment. In 2011, plastics made up about 12 pe rcent of the municipal solid waste a dramatic increase from 1960, when plastics were less than one percent of the waste stream ( 30 ) The general assumption is that biopolymers quickly degrade via microbial activity However, PLA should be composted at industrial facilities since the appropriate conditions required for degradation of biopolymers are not met in the typical "backyard" compost pile or in landfills ( 53 175 ) PLA and other organic matter, when composted, can be used as fertilizers and soil amendment. Biodegradation of PLA containers although eco friendly, is effective only under appropriate conditions, i.e., 60C and 80% relative humidity ( 9 ) B iodegradation of PLA polymer occurs in two steps: the first phase consists of fragmentation of the polymer due to absorption of water. Fragmentation of PLA is faster at higher temperatures compared to room temperature ( 98 ) In an industrial com posting facility operating at a temperature of about 70C, fragmentation starts in less than 2 days and biodegradation starts at about day 4. When the average molecular weight of the released polymer reaches around 10, 000, microorganisms present in the so il begin to digest these short polymers releasing carbon dioxide and water which constitutes the second step of the biodegradation process Several A ctinomycetes and thermophilic bacteria have been reported to possess low

PAGE 30

30 molecular weight PLA degrading ab ility and these include Brevibacillus, Bacillus smithii, Geobacillus spp. and Bacillus licheniformis ( 2 83 134 158 160 ) Despite the compostability of PLA, l and fill is currently the dominant waste management method in the United States ( 24 52 137 ) When disposed in lan dfills, PLA products do not biodegrade and may even contribute to the release of greenhouse gases into the atmosphere, cancelling the beneficial effects of utilizing such plastics over petroleum derived polymers ( 174 ) I n 2005, NatureWorks implemented a large volume "buy back" program in North America for post consumer Ingeo bottles sorted from mixed plastic recycling streams. ( 112 ) Galactic (Belgium), another major PLA producer, recently developed a process to recycle 1 ktpa of PLA as a start towards an effort to recycle the plastic. One of their methods is mechanical recycling that moulds the PLLA polymer back into PLA beads. Their chemical process involves melting the plastic and separating the two isomers chemically i n order to reintroduce pure lactic acids into the polymer production stream. An optical purity of over 99% is required for both D Lactic acid and L Lactic acid entering the PLA production process ( 62 ) Chemic al separation of the two enantiomers is expensive, usually using liquid or solid enantioselective membranes ( 58 ) or High P erforman ce Liquid Chromatography (HPLC). Enzymatic D egradation Microbial and enzymatic degradation of PLA are sustainable ways of recycling the polymer. At present, available information on PLA degrading enzymes is less than that available for other biodegradable plastics such as PCL or PHB ( 148 ) Studies on enzymatic degradation of PLA mainly focus on the changes occurring on the polymeric material itself by following the weight loss or the surface morphology changes, among other criteria. Enzymatic degradation of low molecular weig ht PLA films by enzymes such as Rhizopus delemer lipase, hog pancreatic

PAGE 31

31 lipase and carboxylic esterase have been studied ( 37 ) A recent study evaluated the use of two commercial enzyme preparations from Nov ozyme (Japan); i.e., lipase CA (produced by C and ida antarctica ) immobilized on acrylic resin and lipase RM (produced from Rhizomucor miehei ) immobilized on a macroporous anion exchange resin to break down PLA into cyclic oligomers of low molecular weight t hat can be purified and redirected into the production of the plastic. Lipase RM was reported to degrade PDLLA at 60C and lipase CA degraded PLLA at 100C ( 151 ) Besides the higher temperature, the enzymatic reaction was conducted in a mixture of chloroform and hexane or o xylene. In 2006, Jarrerat et al. demonstrated biological recycling of PLA at 40C without the use of organic solvents ( 75 ) The ext racellular PLA degrading enzyme produced by an A ctinomycete Amycolatopsis orientalis showed high activity ; 2.0 g/L of PL L A powder was completely degraded within 8 h at 40C by 20 mg/ L of purified enzyme (12.5 mg PLA hydrolyzed per mg of enzyme per hour) A n optically active L LA was obtained as degradation product without undesirable racemization. However, the enzyme produced was stereospecific and did not cleave D isomer based PLA ( 73 ) At present, there are abou t 30 microbes that have been isolated for their PLA degrading ability and are listed in Table 1 1 ( 148 ) So far, only a few PLA depolymerases have been isolated and purified from these organisms. Their biochemical characteristics are presented in Table 1 2 ( 148 ) For enzyme based recycling of PLA to become a reality, large scale cost effective production of PLA depolymerases need t o be achieved. Since the PLA polymer s sold on the market are PDLLA containing L lactide with small amount of D lactide or meso lactide, enzymes that can degrade both types of ester bonds that are present in the polymer, i.e., L L, D D, L D and D L are requ ired for effective depolymerization of PDLLA. As of today, only one organism, Bacillus stearothermophilus was isolated for its ability to degrade PDLA ( 161 ) The enzyme degradin g

PAGE 32

32 PDLA has not been characterize d yet, and it is not known if such enzyme may be able to cut L D and D L ester bonds This gap in knowledge needs to be addressed before efficient enzyme based recy cling of PLA becomes a reality. Thermohydrolysis An alternat ive to biodegradation of PLA is hydrolysis of the polymer at high temperature also called chemical recycling ( 163 ) Optical purity of the starting material is also a critical factor for PLA synthesis from hydrolysis derived LA ( 172 ) The mechanism of hydrolysis of PLA is covered in numerous reports ( 3 4 22 171 183 ) (Figure 1 5) While extensive literature is available on degradation characteristics of PLA polymers used in the medical fiel d, information on chemical recycling of PLA to monomer is minimal ( 10 163 170 183 ) Tsuji et al. reported on thermohydrolysis of pellet shaped PLA in water in the temperature range of 120C to 350C while Yagihashi and Funazukuri (2009) evaluated depolymerizat ion of polymer in an alkaline solution. Use of large excess of NaOH in comp arison to the amount of polymer in this study did not permit critical evaluation of the effect of NaOH on the hydrolysis of the polymer, including potential ra cemization of the rele ased monomer ( 96 ) The present study compares the kinetics of PLA hydrolysis in water and NaOH towards underst and ing the role of NaOH in this process. Hydrolysis kinetics were evalua ted using a modified version of the Gompertz equation ( 47 190 ) to describe the thermochemical hydrolysis of PLA via a single equation relating the LA concentration as a function of time, rate of hydrolysis and lag pha se duration.

PAGE 33

33 Table 1 1. PLA degrading organisms and detection method ( 148 ) Strain Detection method of PLA degradation (Ref.) Amycolatopsis sp. HT 32 Film weight loss; monomer production ( 127 ) Amycolatopsis sp. 3118 Film weight los s; monomer production ( 66 ) Amycolatopsis sp. KT s 9 Clear zone method ( 157 ) Amycolatopsis sp. 41 Film weight loss; monomer production ( 128 ) Amycolatopsis sp. K104 1 Clear zone method ( 109 ) Lentzea waywayand ensis Film weight loss; monomer production ( 74 ) Kibdelosporangium aridum Film weight loss; monomer production ( 74 ) Tritirachium album ATCC 22563 Film weight loss; monomer production ( 72 ) Brevibac illus Change in molecular production and viscosity ( 159 ) Bacillus stearothermophilus Change in molecular production and viscosity ( 161 ) Bacillus smithii PL 21 Change in molecular production and viscosity ( 160 ) Bacillus licheniformis PLLA 2 Biodegradation test ( 83 ) Paenibacillus amylolyticus TB 13 Molecul ar technique ( 140 ) Bacillus clausii strain pLA M4 Molecular technique ( 105 ) Bacillus cereus pLA M7 Molecular technique ( 105 ) Treponema denticola pLA M9 Molecular technique ( 105 ) Paecilomyces Molecular technique ( 136 ) Thermomonospora Molecular technique ( 136 ) Thermopoly spora Molecular technique ( 136 ) Actinomadura keratinilytica T16 1 Cle ar zone and turbidity method ( 149 ) Micromonospora echinospora B12 1 Clear zone and turbidity method ( 149 ) Micromonospora viridifaciens B7 3 Clear zone and turbidity method ( 149 ) Nonomuraea terrinata L44 1 Clear zone and turb idity method ( 149 ) Nonomuraea fastidiosa T9 1 Clear zone and turbidity method ( 149 ) Bacillus licheniformis T6 1 Clear zone and turbidity method ( 149 ) Laceyella Sacchari T11 7 Clear zone and turbidity method ( 149 ) Thermoactinomyces vulgalis T7 1 Clear zone and turbidity method ( 149 ) Repro duced with permission from Interchopen

PAGE 34

34 Table 1 2 Characteristics of purified PLA degrading enzyme from various strains ( 148 ) Strain MW (kDa) Opt. pH Opt. temp (C) Enzyme type (Ref.) Amycolatopsis sp. 41 40 6 34 45 Protease ( 128 ) Amycolatopsis sp. K104 1 24 9.5 55 60 Serine protease ( 109 ) B. smithii 63 5.5 60 Acyltransferase ( 133 ) Cryptococcus sp. S 2 21 Lipase ( 103 ) Amycolatopsis orientalis ssp. orientalis 24 19 18 9.5 10.5 9.5 50 60 Serine protease ( 91 ) Actinomadura keratinilytica T16 1 30 10 70 Serine protease ( 149 ) Adapted from ( 148 ) with permission from Interchopen Figure 1 1 Possible route s towards the industrial production of PLA ( 98 ) Reproduced with permission from Elsevier.

PAGE 35

35 Figure 1 2 Molecular m echanism describing the production of Lactide ( 98 ) Reproduced with permission from Elsevier. Figure 1 3. Molecular mechanism of cationic ROP ( 41 ) Reproduced with permission from Elsevier.

PAGE 36

36 Figure 1 4. Molecular mechanism of anionic ROP ( 41 ) Reproduced with permission from Elsevier. Figure 1 5. Hydrolysis of PLA in the presence of water ( 98 ) Reproduced with permission f rom Elsevier.

PAGE 37

37 CHAPTER 2 ESCHERICHIA COLI AS A BIOCATALYST FOR TH E D LA REMOVAL OF THE HYDROLYZED PLA MATER IAL Cradle to Cradle Life Cycle of PLA Recovering the lactic acid contained in the polymer for reuse seems the logical application to develop. Visc ous PLA syrup obtained a fte r hydrolysis is composed of a mixture of D and L lactic acid. An optical purity of over 99% is required for both D Lactic acid and L Lactic acid entering the PLA production process ( 62 ) Chemic al separ ation of the two enantiomers is expensive, usually using liquid or solid enantioselective membranes ( 58 ) or High P erforman ce Liquid Chromatography (HPLC). A bio based enantiomer separation is expected to be cost effective compared to several other abiological processes. Therefore, a cost effective biological system nee ds to be developed that purifies the L lactic acid from the contaminating D lactic acid. Using a microbe to offer new ways of separating two isomers has never been described before. However, this concept might be of interest only when the presence of one s ubstance contaminates and decrease the purity of its isomer, present at a much larger scale. The present study proposes to fill this gap of knowledge by engineering a bacterium such as Escherichia coli to selectively metabolize D LA contained in PLA syrup to result a pure L LA su bstance. This way, pure L LA could be redirected into the PLA production stream. Escherichia coli : a biocatalyst of choice Many bacteria have the ability to utilize D and L lactic acid for growth. However, no commonly used strain i n laboratory or industrial setting has t he ability to use D lactic acid isomer exclusively Among the commonly used laboratory strains, Escherichia coli seems of choice due to the vast amount of information available on its genetics and physiological chara cteristics E. coli has minimal growth

PAGE 38

38 requirements; a high specif ic growth rate and a high cell yield on various substrates Additionally, countless molecular biology tools are readily accessible to investigators and multiple genome sequences are published Information is available for E. coli in terms of aerobic lactic acid metabolism. Wild type E. coli possesses two distinct pathways, each enabling use of L and D lactic acid as a carbon source under aerobic cond ition, respectively and reviewed in the next paragraph Lactic Acid Metabolism of Escherichia coli Known LDHs in Wild T ype E. coli E. coli grows well on L or D lactic acid as sole source of carbon ae robically and also produces D LA during anaerobic growt h and fermentation of sugars. As of today, three lactic acid dehydrogenases have been identified in E. coli Fermentative LDH E. coli gene ldhA codes for the fermentative lactic acid dehydrogenase and is responsible for D lactic acid formation from pyruvat e ( 104 ) This enzyme is a cytoplasmic tetramer that is NADH dependent and is produced only under oxygen limited conditions ( 152 153 ) Under physiological conditions, the fermentative LdhA protein is not known to oxidize L or D lactic acid and therefore does not contribute to the aerobic lactic acid catabolism. Respiratory LDH Several lactate oxidizing enzymes have been characterized in bacteria and these are membrane ass ociated flavoproteins that are components of the electron transport system coupling to O 2 or to other electron acceptors such as nitrate, fumarate or trimethylamine N oxide ( 42 43 ) These LDHs oxidize lactate to pyruvate and the electrons are transferred to ubiquinone. Quinones deliver the elec trons to terminal oxidoreductases and ultimately to O 2 ( 43 ) Under anaerobic conditions and in the presence of nitrate or fumarate, lactate oxidation is coupled to

PAGE 39

39 reduction of these alternate electron acceptors utilizing appropriate enzyme complexes. Pyruvate is used as the source of cellular carbon for biosynthesis. Both D LA and L LA induce th eir cognate LDH activities in the cell as long as the terminal acceptor is also present in the medium ( 85 113 119 ) The dld gene located at 47 min on the E. coli chromosome encodes a protein with FAD as a cofactor (E.C.1.1.2.5) that is responsible for the oxidation of D LA into pyruvate ( 129 131 ) D lactate oxidation is coupled to reduction of ubiquinone in E. coli ( 45 61 ) D LDH activity is detectable in membrane vesicles prepared from cells grown in glucose, lactate, glycerol and succinate, but virtually no activity was observed unde r anaerobic condition ( 40 113 ) The enzyme consists of a single subunit of 64 kDa ( 131 ) D LDH remains firmly attached to the membrane and requires detergents or strong chaotropic agents to release the enzyme from the cytoplasmic membrane ( 162 ) D LDH from E. coli ML308 225 was purified 400 fold and the pure product showed that D LDH was able to oxidize L LA at a relative rate of 14% of the D LA oxidation rate ( 38 ) The measu red K m for L LA was about 30 times higher than the K m for D LA, i.e., 18 mM and 0.6 mM, respectively for this purified enzyme ( 38 ) Also in N. meningitis Vm and K m measured with L LA as a substrate using purified D LDH wer reduced /(min.mg protein) and 32.2 mM respectively; Dld activity towards L LA is 3 times lower than the activity recorded for D LA as a substrate, and the K m of D LDH towards L LA is 55 times higher than the K m measured for D LA ( 32 ) The E. coli lldD gene (80 min) is part of an o peron that codes for a lactate permease, a DNA binding regulatory protein and the L LDH ( lldP RD ) ( 25 ) The L LDH encoded by lldD contains FMN as cofactor (E.C.1.1.2.3 ) and is anchored in the inner surface of the cytoplasmic membrane ( 25 40 120 ) Originally designated as lct the L LA utilization locus has been

PAGE 40

40 renamed lld ( 43 ) The purified L LDH appears to be a protein with a single subunit of 43 kDa ( 40 ) with a K m for L LA of ( 40 ) Production of L LDH in the cell is dependent on the presence of either L LA or D LA and oxygen, but no D LA dependent reduction of the electron acceptor could be measured with the L LDH ( 40 85 113 119 ) The activity measured on cells grown in LA was 20 times higher than in cells grown in other carbon sources ( 40 ) ArcA protein has been shown to repress transcription of lldD under anaerobic condition ( 25 99 ) Interestingly, a mutation in the lldD did not abolish L LA dependent reduction of DCPIP at 600 nm, suggesting that one or more genes encod ing proteins with L LDH activity exists in the cell ( 120 ) Evidence of O ther L LDHs As with E. coli Neisseria meningitides and Neisseria gonorrhoeae seem to possess at least two distinct membrane bound L LDHs based on gro wth of an lldA deletion mutant (homolog of lldD in E. coli ) on L LA as sole carbon source ( 31 ) In Bacillus subtilis deletion of the lut ABC operon, shown to code fo r an L LDH in the cell, did not completely abolish growth of the mutant on L LA ( 14 ) another evidence that bacteria may possess more than one L LDH in the ce ll. Interestingly, the proteins encoded by the B. subtilis lut ABC operon are not h omologs of the proteins expressed from the lldP RD operon of E. coli but they e xhibit 54%, 57% and 38% sequence identities with an uncharacterized ykgEFG operon ( 14 ) The proteins encoded by the lut ABC of B. subtilis and ykgEFG in E. coli are also homologs of the proteins encoded by lld EFG (SO_1520 to SO_1518) of Shewanella oneiden sis MR 1 The YkgEFG proteins of E. coli exhibit 30%, 38% and 32% identity and 49%, 57% and 48% similarities with Shewanella SO_1520, SO_1519, and SO_1518 respectively In S oneidensis mutating any of the genes of the operon led to a mutant that did not grow on L LA ( 123 ) Growth on L LA was restored in Shewanella mutant by transforming with E. coli ykgEFG genes ( 123 ) Bioinformatics studies have predicted a dehydrogenase type activity for the YkgE orthologs o f several bacteria; YkgE is

PAGE 41

41 predicted to be a putative dehydrogenase subunit in Shigella sonnei SS046 (99% identity and similarity with the E. coli gene sequence) ( 76 ) and HN41 as a putative L lactate dehydrogenase Fe S oxidoreductase subunit in Shewanella sp. (31% identity and 49% similarities) ( 82 ) The database ( 117 ) also reports that numerous bacteri al genomes include these two sets of genes ( lld and ykg ) underlying that various organisms may possess tw o distinctive L LDHs Among them are the Neisseria strains reported to have multiple L LDHs as well as E. coli K 12 ( 31 ) Only two published studies describe a mutant of E. coli unable to grow on L LA aerobically Both of these studies used r and om mutagenesis to isolate a mutant unable to grow on L LA aerobically ( 25 120 ) Interestingly in one of these studies this mutation appear s to also disrupt the permease activity (gen e upstream of the dehydrogenase), and a plasmid harboring only the dehydrogenase gene failed to complement the mutation ( 25 ) Considering there are at least two disti nct L LDH activities encoded by the lldD and ykgE in E. coli the genotype of the L LA defective mutant described by Dong et al. is unclear. In the other study a mutation in the lldD did not abolish L LA dependent reduction of DCPIP at 600 nm, i n agreemen t wit h the presence of other L LDHs in the cell ( 120 ) The present study proposes a novel process for the post consumer use of PLA polymers. In this process, PLA based plastics are hydrolyzed followed by purification of the lactic acid syrup using a bacterial biocatalyst to optically pure L lactic acid that can reenter the PLA production. This study also presents kinetics of PLA hydrolysis in water and in the presence of NaOH towards a better underst and ing of the potential o f NaOH as a catalyst for rapid hydrolysis of the polymer. The genetics and physiology of the engineered Escherichia coli biocatalyst developed for purification of the L LA syrup ( D LA removal ) is presented.

PAGE 42

42 CHAPT ER 3 OBJECTIVES AND CHOSEN STRATEGIE S The s pecific objectives of the research are: 1) C onstruct a kinetic mo del for breaking down of PLA polymer s into its simplest components: L and D lactic acid. Thermohydrolysis will be performed with w ater and catalyst such as NaOH towards a better underst and i ng of the potential of NaOH as a catalyst for rapid hydrolysis of PLA Racemization that may occur throughout hydrolysis will be evaluated 2) Most of the PLA plastics present on the marke t as packaging material contain a small amount of D LA. Therefore, s mall amount of D LA is present in the hydrolyzed material. Isomer separation is possible, though expensive. To overcome this, E. coli will be engineered and evolved to specifically and efficiently metabolize PLA derived D LA, leaving the remaining and abun dant L LA in the medium to be further purified and reused. Ultimately, the recombinant strain will be used to perform D LA removal experiments in which cells, in presence of hydrolyzed PLA material, will actively oxidize the pool of D LA contained in the s yrup. Following D LA removal, L LA remaining in the culture broth can be purified following the process already in place and following production of L LA by fermentation 3) Explore and supplement the knowledge on the aerobic L lactic acid metabolism of Es cherichia coli Attempts will be made to uncover and identify the genes encoding L LDHs in the cell besides lldD Overall, the present study proposes a novel process for the post consumer use of PLA polymers. In this process, thermohydrolysis is the first step, followed by the D LA removal from the hydrolyzed material to yield pure L LA that could be redirected into the pr oduction of the polymer itself.

PAGE 43

43 CHAPTER 4 MATERIAL AND METHODS PLA H ydrolysis Materials PLA beads (~ 2 mm in diameter) obtained from Natu reWorks LLC (grade 3052D and grade 4032D) and were utilized without further treatment unless otherwise noted These two polymer grades represent a large portion of the PLA used in food packaging in USA. PLA grade 3052D is designed for injection mo u lding a pplications whereas grade 4032D is typically converted into biaxially oriented films. Properties of PLA pellet grade 4032D that contains an average of 1.2% D LA are as follows: Mw 155,000, number average molecular weight Mn 93,200, Tm, 160C and Tg, 61C ( 150 ) On the other h and PLA pellet grade 3052D contains 4.15% (0.45) D LA (NatureWorks LLC). Pure Na L LA and D LA were purchased from Sigma Aldrich (St. Lo uis, MO, USA) and were of the highest purity available Thermohydrolysis C onditions Fifteen g of PLA beads were mixed with 15 g of liquid in a 200 mL sealed canister (Werner Mathis AG, Switzerl and ). In the experiments unless specified otherwise, the total weight of solid and liquid was set at 30 g. A total of 24 canisters were prepared identically and heated to the desired temperature in a Mathis oven (Werner Mathis AG, Switzerl and ). At different time periods, canisters were removed from the oven and cool ed in water at room temperature to stop further hydrolysis. The Mathis oven harbors a temperature probe that measures the internal temperature within a canister in line. Canisters are locked onto a circular device rotating alternatively for 30 s at 60 rpm clockwise and counterclockwise, allowing mixing. The oven was set to increase the temperature of the canisters by 6C per minute. The

PAGE 44

44 oven was preheated to the desired temperature and the contents of the canisters r eached 160C in about 18 min When noted in the text, PLA beads were ground using a laboratory mill (Thomas Wiley Company model 4, Swedesboro, NJ, USA). The powder was then passed through a bouillon strainer (WINCO model CCB 8R, China) and used in hydrolysis experiments. Analy sis After heating a nd cooling to room temperature, canisters were opened and liquid and solid fractions were separated and weigh ed and a mass balance was performed. Once the liquid fraction was removed, canisters were rinsed with distilled water and dried at 160C. Water bou nd to the solids was included as part of the solid fraction The pH of the liquid fraction was measured using an Orion 420A pH meter (Thermo Scientific). Density of the liquid fraction was measured by weigh ing 1 mL of PLA syrup. LA concentration in the syr up was determined by HPLC using an HP 1090 chromatograph (Agilent Technologies, Santa Clara CA) equipped with a Bio Rad Aminex HPX 87H ion exclusion column (45C; 4 mM H 2 SO 4 ; flow rate, 0.4 mL/ min) and dual detectors (UV detector at 210 nm and refractive index monitor, in series). Optical isomers, D and L lactic acid, were determined by chiral HPLC (Chirex 3126(D) penicillamine column; 150 4.6 mm; Phenomenex) using 2 mM CuSO 4 as mobile phase (flow rate, 0.6 mL/min) with a diode array detector set at 21 0 nm. Kinetics Parameters M easurements Apparent rate of and lag phase duration For each condition tested, lactic acid concentration as a function of time of incubation was generated and an equation ( 2 1) derived from the Gompertz model was us ed to fit the data set. The equation used was as follows: (E quation 2 1)

PAGE 45

45 where [Lac] is the mass fraction of lactic acid at time t [Lac] max is the maximum theoreti cal mass fraction of of hydrolysis of PLA into LA (1/h ), t is the heating time (h), and [Lac] max and were determined using the non linear regression approach with the aid of the solver function available from the MS Excel ToolPak. Solver converges the sum of square error between the experimental data and the estimation to a minimum value. This way, hydrolysis rate and lag phase duration could be compared throughout the study. This equation, established in 1825 by Gompertz was modified later to describe bacterial growth ( 47 190 191 ) Since, the modified version of the equation has been reused in many other areas of research to predict yield of biogas, growth patterns of cancerous cells, etc. ( 12 89 ) it is also used here to predict the rate of hydrolysis of PLA to lactic acid. Activation energy E a The natural logarithm form of the Arrhenius equation was used to evaluate the activation energy for the hydro lysis of PLA into LA (eq. 2 2) ( 190 ) (equation 2 2 ) where E a is the activation energy (kcal/ of hydrolysis (1/h), T is the absolute temperature in Kelvin (K), R is the universal gas constant (1.9858*10 3 kcal/mol). Calculation s LA M w is 90.06 g/mol and PLA repeat unit M w is 72 g/mol Consequently, 15 g of PLA represents a maximum theoretical amount of 18.7 g of LA or 0.2076 mole after complete hydrolysis. Density of the PLA beads was established as 1.26.

PAGE 46

46 Optical Purity S tudy To evaluate the effect of heat and alkaline condition on the racemization of LA, 7 g of water or 7 g of 1 M NaOH was mixed with 7 g of PLA syrup obtained from a previous experiment in a sealed canister and subjected to heat treatment at 160C for 2 h. The PL A syrup used in this experiment (ra n in triplicate ) was obtained by mixing equal amounts of syrup obtained at 160C after 150 min with water or 1M NaOH. In another set of canisters, 7 g of 1 M L LA solution was mixed with either 7 g of 1 M NaOH or 7 g of w ater and subjected to the same heat treatment. After heat treatment and cooling to RT, a sample from each of the canister was subjected to chiral HPLC to assess the D LA content after treatment and compared with the D LA content of the starting sample En gineering E. coli for t he D LA Removal f rom Hydrolyzed PLA M aterial Bacterial Strains, Plasmids and Growth C onditions The E. coli K 12 strains and plasmids used in this study are listed in Table 2 1. E. coli Top10 or E. coli EPI300 was used for plasmid lib rary construction. During strain construction, cultures were grown at either 37C in Luria Bertani (LB) broth (per liter: 10 g of Difco tryptone, 5 g of Difco yeast extract, and 5 g of sodium chloride) or on this medium solidified with agar (1.5%). Antibio tics were added to the medium as needed at the following concentrations: 1 1 ), Chloramphenicol 1 ) and ampicillin (100 1 ). Engineered strains were cultured in minimal medium (per liter: 6.25 g N a 2 HPO 4 0.75 g KH 2 PO 4 2 g NaCl, 27.3 mg NaMoO 4 .2H 2 O, 27.3 mg FeSO 4 .7H2O, 2.7 g (NH 4 ) 2 SO 4 0.55 g MgSO 4 .7H 2 O ). In some experiments, an additional 100 mM sodium p hosphate buffer, pH 7.0 was also added to the medium to provide higher buffering capacity. C ult ures were maintained in minimal medium containing 2% lactic acid purchased from Fisher scientific (Fairlawn, NJ, USA). When used, glucose concentration was 1% unless otherwise specified L

PAGE 47

47 LA concentration was 0.5% and D LA concentration was 0.3% SOC medi um was used as a recovery medium after transformation: 20 g/L Bacto Tryptone, 5 g/L yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl 2 10 mM MgSO 4 and 20 mM glucose T o xicity I n duced by PLA Syrup on t he Growth of Wild T ype E. coli E. coli K 12 strain W311 0 was used in this study as the wild type ( Table 2 1 ) Preculture was grown in mineral salts minimal medium containing 10 g/L of lactic acid (Fisher) and used to inoculate 20 mL of minimal medium (125 mL flask) containing either Na L LA (Sigma) or hydrolyz ed PLA syrup at an initial OD 420 of 0.05. 1 mM betaine was also added to each culture to help the strain resist high osmotic pressures induced by high [LA]. The syrup used in this experiment was obtained by hydrolyzing soft drink PLA cups (obtained from Ka ng station) at 160 C for 135 min. These cups, harboring the company logo directly printed on the plastic, were hydrolyzed after cutting them into pieces of about 2 cm 2 to fit the canister diameter. Before adding PLA syrup to the culture medium, pH w as adjusted to 7 by direct addition of NaOH pellets. After inoculation, flasks were incubated at 37 C and agitated at 200 rpm. A 500 OD 420 was measured using a spectrophotometer (Beck m an spectrophotometer model DU 640) in order to determine the specific growth rate of the cultures. [Na L LA] tested were: 4, 8, 16, 26, 31, 37, 41, 56, and 79 g/L. Concentrations of LA derived from hydrolyzed PLA used in this study were: 4, 10, 25, 32, 37, 42, 49, 54, 65 and 111 g/L, as determined by HPLC. Mutagenesis Mutations constructed by transduction Strains DC825, DC8255, DC82551, DC8261X, DC826170X, DC lldR DC ykgD and DC bglX were created using the same protocol. Bacteriophage P1 cm clr100 was used in transduction experiments ( 107 ) P1 phage was prepared using appropriate E. coli Keio mutant

PAGE 48

48 ( 5 ) as the donor and transduced into the appropriate recipient strain After transduction, colonies w ere picked and streaked onto LB kanamycin agar medium and incubated at 42C overni ght to eliminate the lysogens. Isolated colonies were picked, resuspended in sterile water, and the suspension was used as a DNA template to perform a set of PCR reactions using specific primers (Table 2 2), to ensure that the correct mutation is present in the transductant. A thermo sensitive plasmid pCP20 expressi ng FRT recombinase, allowed curing the kan gene from the cassette ( 15 ) Strains with of their names denote that their kanamycin cassettes were cured. Deletion of ykgEFG operon Deletion of yk gEFG operon was performed using methods reported elsewhere ( 20 ) Primers F ykgG kan and R ykgE kan ( T able 2 2) were used to amplify the kanamycin gene using pKD4 as the DNA templ ate. PCR amplified DNA of the correct size was gel purified using Illustra GFX PCR DNA and Gel B and Purification Kit (GE Healthcare, Pittsburgh, PA, USA) and electroporated into electrocompetent DC8255c [pKD46] cells. Following recovery at 30C in 2 mL of SOC medium, cells were centrifuged and spread onto LB agar medium with kanamycin and incubated at 30C for 24 to 48 h. Colonies were then streaked onto fresh LB agar with kanamycin and incubated at 37C to confirm kanamycin resistance as well as to cure th e thermo sensitive plasmid pKD46 from the transformants. Colony PCR reactions were performed to ensure that the double cross over deleted ykgEFG in the cell. The strain generated was named DC8255 ykgEFG Tn5 random insertion into the genome of DC82551 Tn5 r lldD ykgE ::kan ) was performed using EZ Tn5 insertion kit (Epicentre, Madison, WI ). Cells were made competent by washing cells harvested at mid exponential phase of growth four times with 10% glycerol sterile so lution.

PAGE 49

49 420 above 100). A total of 500 tetracycline resistant transpositions were obtained. An alternative protocol consisted in the construction of a Tn5 P1 phage library prepared as followed The random insertions were generated by (NEB, Ipswich, MA ) using EZ Tn5 insertion kit (Epicentre, Madison, WI ) A large number of tetracycline resistant transpositions (>10,000) were obtained and P1 phage was grown on the pool of tetracycline resistant mutants. This phage preparation was used to transduce DC82551 (L LA + ) and transductants were selecte d on LB tetracycline agar medium. The t etracycline resistant colonies were transferred to minimal medium with L LA as the carbon source and tetracycline and LB tetracycline by replica plating technique and incubated at 37C. The colonies that did not grow on lactate minimal medium but grew on LB tetracycline medium were selected and re were used to inoculate 4 culture tubes containing each 1.5 mL of minimal medium with different carbo n sources; 5 g/L L LA, 3 g/L D LA, 5 g/L glucose, or 5 g/L succinate. Culture tubes were incubated at 37C on a rotator operating at 75 rpm for aeration. Mutants that failed to grow on L LA as sole source of carbon in liquid medium also were selected and t heir genomic DNA was sequenced using Tn5 F primer to map the transposon location. UV mutagenesis of strain DC82551 Strain DC82551 was grown in 10 mL of Luria Bertani broth (LB) to an OD 420 of about 1.0. C ells were collected by centrifugation, washed twice with 5 mL of minimal medium salts ( free of carbon source ) and resuspended in 1 mL of the same medium One mL of the suspension was subjected to UV l ight (254 nm) for different time periods; from a few seconds to 1 min. Subsequently, 2 mL of SOC medium were added to the culture tube and incubated at 37C with

PAGE 50

50 agitation for two hours before plating serial dilutions of the culture on LB agar to assess the cell survival rate Cells from time of exposure that yielded about 1% survival were plated to yield approx imately 100 200 colonies per plate Replica plating of these colonies to glucose MM and LB p lates were performed to determine the p roportion of auxotrophs. The UV treated sample that exhibited about 1% of auxotrophs was retained for further screening. Su bsequently, colonies were once again replicated from Glucose MM agar medium onto L LA MM glucose MM and LB agar and the plates were incubated at 37C C olonies identified to grow on LB and glucose MM bu t not on L LA MM were selected and retested on L LA MM medium to confirm their inability to grow on L LA as the carbon source. Upon confirmation, selected isolates were inoculated into 2 mL each of the following minimal medi um with different carbon sources in 13 x 100 mm glass tubes : 1% L LA MM, 1% D LA MM 1% succinate MM, 1% glucose MM and incubated in a rotator at 37 C The desired phenotype was Glucose + Succinate + D LA + and L LA Testing for growth on succinate MM ensured that the mutant possesses the machinery to grow on a non fermentative carbon so urce whereas aer obic growth on D LA MM suggested that th e transport of lactate was not altered. Mutant strains that exhibited the required phenotype were stored at 80C for future use. All the L LA negative mutants were grown in D LA MM for 24 h in a shak er. Three cultures that showed the highest OD 420 were retained as DC8212, DC8248 and DC8261. Adaptive evolution of E. coli strain DC8261 and DC bglX DC8261 was serially transferred every day into 5 mL of fresh D LA (0.4%, w/v) kanamycin MM in a 125 mL Erlen meyer flask using 1% inoculum. Due to the high cost of analytical grade sodium D LA salt, after 27 days, the medium volume was changed to 1 mL in 13 x 100 mm test tubes and the cultures were incubated at 37C on a rotator at approximately 70 rotations per minute After incubation for 12 h to 24 h, the culture was transferred to fresh

PAGE 51

51 medium at a starting OD 420 of 0.08 and this was continued for several serial transfers. A stock of the culture was made after every ten transfers or every time a significant im provement on cell yield at 24 h could be observed. After 70 passages, the culture was streaked on 0.5% D LA MM agar and a colony that developed earl ier than others was picked, cultured and named DC826170. Another strain, DC bglX was transferred 30 times in 2% LD LA MM and an adapted strain named DC bglX 30 was isolated Even though DC bglX was transferred in MM containing both D LA and L LA, DC bglX 30 still retained the L LA negative phenotype Removal of D LA f rom H ydrolyzed PLA M aterial D LA Consumption Rate as a Function of DC bglX Cell D ensity To assess of the relationship between the D LA consumption rate and the initial cell density of the microbial biocatalyst engineered to remove D LA from PLA syrup, the following experiment was performed using DC bglX E. coli strain DC bglX inoculum was generated by culturing the st rain aerobically in 1 L (2.8 L Fernbach flask) of 20 g/L LD LA MM (37 C 250 rpm). Cells were harvested at mid exponential phase of growth centrifuged for 15 min at 5,000 g at room temperature and resuspended in 30 mL of 20 g/L LD LA MM. Cells were then used to ino culate 35 mL of 20 g/L LD LA MM ( 25 0 mL flask) at an OD 420 of 0.5, 1.0, 2.0, 3.0, 4.0, 5.0 and 6.0. After inoculation, flasks were incubated at 37C in a rotary shaker operating at 25 0 rpm. At different time period s 1 mL of culture was sampled to measure the OD 420 as well as to measure the total [LA] and [D LA] by HPLC and chiral HPLC respectively. D LA consumption rates were calculated as the slope of the plot of [D LA] over time. Ex periments were conducted in triplicates.

PAGE 52

52 D LA Removal Using H ydrolyzed PLA M aterial I n oculum preparation E. coli strains DC8212, DC8148, DC8261, DC826170 and DC bglX 30 were each used in separate D LA purification experiments. DC8261 inoculum was generated b y culturing the st rain in 50 mL of 10 g/L glycerol MM. Inocula for DC826170 and DC bglX 30 were cultured aerobically in 1 L of 20 g/L LD LA MM. Cultures were incubated at 37C in a rotary shaker operating at 250 rpm. Cells were harvested at mid exponential p hase of growth by centrifug ation for 15 min at 5,000 g at room temperature washed once in half their volume of MM lacking carbon source, and resuspended in 5 to 30 mL of MM without C source. These washed cells were used to inoculate 20 mL of MM containing PLA syrup at an initial LA concentration (total LA) of 20 g/L at an OD 420 of about 8.0.The culture in a 250 mL Erlenmeyer flask was incubated aerobically at 37C in a shaker ( 250 rpm) An initial cell density of OD 420 of 6.0 was used in experiments conduc ted with strains DC826170 and DC bglX 30. In these experiment s, 35 mL of medium containing increasing amount of LA ( 250 mL flask ) were ino culated, and incubated at 37C in a rotary shaker operating at 250 rpm. DC826170 culture was used to perform D LA remova l experiments of syrups at concentration s of 27, 34, 41, 58, 81, 99 and 105 g/L LA. A concentration of 126 g/L LA MM was used when the strain tested was DC bglX 30. Also, 1 mM or 2 mM betaine was added to the cultures to alleviate potential osmotic effect th at high [LA] may cause. Experiments conducted with DC bglX 30 were triplicate d PLA syrup preparation PLA s yrup used in D LA removal experiment s by strains DC8212, DC8248 and DC8261 was obtained by melting Kangaroo Express soft drink cups at 160C for 135 min. It contained about 5% D LA and 95% L LA as determined by HPLC analysis PLA syrup used for the

PAGE 53

53 purification of D LA by strains DC826170 and DC bglX 30 originated from PLA bead grades 4032D and 3052D respectively. The syrups from these two PLA grades co ntained a D LA fraction of about 5 % and 7.5% of the total LA respectively. Prior to use, pH of the PLA syrup was adjusted to 7.0 by direct addition of NaOH pellets. Analyses and calculations During the D LA removal experiments approximately 1 mL was samp led at different time periods. Cell density as OD 420 w as measured using a spectrophotometer (Bec km an model DU640, USA). T otal LA was measured by HPLC and D LA fractions were evaluated by HPLC equipped with a chiral chromatographic column As needed viabil ity was assessed by plate count of the E. coli strain on LB agar medium. D LA removal with air sparg ing The apparatu s used in these experiments is depicted i n F igure 2 1. Briefly, an aquarium pump (Aqua culture, model no. 0079285405133, China) was connecte d to a 1 L filtering flask containing 600 mL of sterile water. The filtering flask was connected to manifold that can support aeration of up to 8 cultures simultaneously through a glass sparger immersed into the culture T he entire apparat us (except the pu mp) was autoclaved prior to use and a sterile filter and the filtering flask ensured that the air pumped into the system was free of contaminants. The pump was used at a capacity of 1.2 L/min. Screw clamps ins talled on the flexible tubing connecting each sparger allowed regulation of air flow to be visually equal in each culture tube (about 0.2 L/min) Culture tubes (25 x 200 mm) containing 25 mL of medium with 135 g/L of total LA were inoculated with strain DC bglX 30 at an initial OD 420 of 6.0.

PAGE 54

54 Insight in to t he L LA Metabolism of Escherichia coli Biochemistry of L LDHs Cell free extract preparation Regardless of the strain used, cell extract for LDH assay w as prepared a s follows. O ne liter of minimal medium containing sodium 10 g/L DL LA was inocul ated at 1% with an overnight culture grown in the same medium. Cells were grown in 2.8 L Fernbach flasks and agitated at 250 rpm at 37C. Cells were harvested at an OD 420 of about 2 (mid e xponential phase of growth) by centrifugation at 4,200 xg for 15 min, washed once with MM lacking carbon source and resuspended in about 30 mL of 50 mM HEPES buffer at pH 8 .0 The cells were incubated with l ysozyme (0.3 mg/mL) and EDTA (10 mM) for 30 min at 37C with mild agitation. Spheroplasts formation was verified by microscopy was used to ensure cell wall removal. As seen on F igure 2 2 A, the majority of the cells are round shaped cells and about 30% of the cells appeared intact after lysozyme treatmen t. RNase, DNase (0.1 mg/mL each ) and MgCl 2 (10 mM) were then added to the mixture and returned to 37C for another 30 min. The preparation was sonicated for a total of 3 minutes on ice with intermittent cooling After a subsequent low speed centrifugation (120 xg, 5 min, 4C) to remove cell debris and unbroken cells, the supernatant was retained as the crude extract. Sonication treatment allowed an efficient break down of the spheroplasts into vesicles of smaller diameter (F ig. 2.1B). Small membrane vesicle s obtained after sonication is expected to be inside out to accommodate the large ATP synthase protruding from the inner membrane into the cytoplasm of the cells ( 39 ) Total protein was assayed by the BCA method with bovine serum albumin as st and ard ( 147 ) Enzyme assays L LDH was assayed at room temperature by the addition of 40 mM L LA into a 1.5 mL cuvette contain of and 50 mM buffer in a

PAGE 55

55 1.0 mL reaction volume ( 119 ) L LDH s activity in cell extracts prepared from strains J7 and DC lldR was determined using 50 mM MES Tricine buffer at pH 6.5 L LDH activity in the crude extract s from DC8255, DC82551 and DC ykgD were determined using HEPES CAPSO buffer at pH 9.5, 10.0 and 9.5 respectively L LA oxidation was monitored at 600 nm as reduction of DCPIP and concentration of oxidized DCPIP was calculated using the extinction coefficie nt for DCPIP of 19.1 mM 1 .cm 1 at this wavelength ( 126 ) Pyruvate accumulation In order to determine that the product of the L LDH reaction was indeed pyruvate, a reaction mixture was set up as described above and incubated at room temperature. Every 5 min or when the reaction mixture turned white due to of DCPIP was added to the mixture. Occasionally, more crude extract was added, as needed. This way, around 3 mM of DCPIP was reduced. To stop the reaction and precipitate the proteins, a few drops of concentrat ed H 2 SO 4 were added to the cuvette and the mixture was centrifuged for 5 min at 16,000 xg. The supernatant was subjected to HPLC and the product of the reaction was determined. Localization of L LDHs in E. coli To localize the LDHs in the cell, crude extra cts were centrifuged at 100,000 g for 2 h Supernatant was retained as the soluble fraction and the pellet resuspended in 3 mL of 50 mM of HEPES buffer pH 8 .0 constituted the membrane fraction of the cells. Each fraction was assayed for L LDH activity as d escribed above, using 50 mM HEPES buffer at pH 8.0. Construction of Genomic L ibraries and recA M utants Three plasmid libraries were used throughout this study. Standard genetic methods were used for the isolation of DNA and plasmids, dige stion with restric tion enzymes and ligation ( 135 ) Enzymes were purchased from New England BioLabs (Ipswich, MA) and used as directed

PAGE 56

56 by the vendo r. Strain DC8261 r ecA 53 mutant was constructed (DC8261 RecA ) by conjugation as described elsewhere ( 18 ) Plasmid pUC18 based plasmid library was generously provided by L.O. Ingram (University of Florida) ( 188 ) Average chromosomal DNA insert size in this library is between 2 and 4 kb. Plasmid pACYC184 based library made from the genomic DNA of E. coli strain W3110 wild type was constructed by Frank Healy using plasmid vector pACYC184. Average length of the inserts in this library is about 6 kb. Plasmid pCC1 BAC based genomic library w as constructed using DNA purified from E. coli lldD ykgE ) Genomic DNA was partially dige sted with endonuclease Sau3AI Fragments of 1.5 to 5 kb in length were purified from agarose gels and ligated into alkaline phosphatase treated BamHI sites of plasmid pCC1 BAC (Epicentre Madison, WI ) Ligation products were transformed into electrop oration competent E. coli strain EPI3000 ( Epicentre, Madison, WI ). Blue white identification indicated that about 85% of the clones contained an insert (white colonies). M ore than 15 ,000 colon ies were pooled and used to prepare a master library of plasmid DNA used to transform DC8261c and DC8261 recA About 120 to 240 ng of plasmid DNA from each library was electroporated into strain DC8261 and/or DC8261 r ecA and plated on LB chloramphenicol med ium (pACYC and PCC1 BAC based libraries) or LB amp icillin (pUC18 based library). C MM with L LA containing the appropriate antibiotic and incubated at 37C for 48 to 72 h. When pCC1 BAC lib rary was used, colonies from Lerechlo ramphenicol medium were also LA + clones were streaked onto L LA MM and LB agar medium with appropriate antibiotic to confirm growth of the clone. Upon

PAGE 57

57 verification of the desired phenotype, an isolated colony was p icked from the rich medium, using primers annealing upstream and downstream of the insertion site on the plasmid ( Table 2 2 ). Plasmid DNA was sequenced to identify the gen omic content of the insert DNA. omplementation Complementation analysis with E. coli out as described previously ( 97 ) using E. coli Genetic Stock Center Crosses in liquid medium were performed with log phase donor and recipient (DC8261) cells grown aerobically in LB medi um to an OD 420 of about 1. Donor and recipient cells were mixed in a culture tube at a ratio 10:1 respectively, and incubated at 37 C for 30 min with gentle rotation (about 50 rpm on a rotator) to allow gene transfer. A total of 10 8 recipient cells were co njugated with 10 9 Cells were then plated on 0.3% L LA MM supplemented with kanamycin and in cubated at 37C for 48 to 72 h. Conjugation of DC8261 with Various Hfr S trains Three Hfr strains were used to transfer DNA into strain DC8261c ( 178 ) (Table 2 1). Conjugations were performed as follows. Donors and recipient cells were grown in LB until mid exponential phase of growth. Then, 10 9 CFU o f DC8261c were mixed with 10 8 donor cells. Matting step was performed at 37 C under mild agitation (50 rpm) for 30 minutes. Culture tubes were vortexed for at least 30 sec to break the pairs and dilutions were plated on L LA tetracycline agar medium. L LDH Activity Observed on Native G el Sample preparation Ten mL of cell free extract prepared as describe d above was centrifuged at 100,000 x g for 2 h. The top 8 mL of the supernatant and the bottom 2 mL, which looked darker in color,

PAGE 58

58 were collected separately The sample containing the bottom 2 mL was then centrifuged at 150,000 g for another 3 h T he bottom part of the supernatant that was slightly above the pellet (diffuse material) with L LDH activity was used in native gel electrophoresis without further t reatment. Native gel electrophoresis : PAGE Non denaturing gels contained 7.5% w/v polyacrylamide (acrylamide 30%, bisacrylamide 0.8%), and 2% triton X 100. Samples were subjected to electrophoresis in 25 mM Tris and 192 mM glycine buffer (pre chilled). App roximately 35 of sample was loaded in each well. Immediately following electrophoresis at 4C overnight, the gel was bathed in 50 mM HEPES CAPSO buffer pH 9.0 containing 1.5 mM DCPIP. Once the gel turned dark blue and checked for no apparent lactate independent red uction of DCPIP, the solution was diluted ten times in 50 mM HE PES CAPSO buffer at pH 9.0 and 50 mM L LA was added. The gel with the assay mixture was gently rocked until white discoloration due to L LA dependent reduction of DCPIP could be observed on the gel. The white band on the gel was precisely cut and the proteins in the gel slice were identified after trypsin digestion and LC MS/MS by the Interdisciplinary Center for Biotechnology Research at the University of Florida

PAGE 59

59 Table 2 1 Plasmids and stra ins used in this study Plasmid or strain Relevant characteristics Source or reference Plasmids pCP20 FLP + ci857 + p R Rep ts Ap R ,Cm R ( 15 ) pKD46 bla P BAD gam bet exo pSC101 ori TS ( 20 ) pKD4 bla FRT kan FRT ( 20 ) pCA24N:: lldD pCA24N carrying lld D from E. coli K 12 AG1 ( 84 ) F143 relA1 ( 97 ) F104 KL723 ( 97 ) F128 E5014 ( 97 ) F254 KL719 ( 97 ) Strains W3110 F rph 1 INV( rrn D rrn E ) ATCC 27325 Top10 F mcrA mrr hsdRMS mcrBC lacZ lac X74 nupG recA1 ara ara leu )7697 gal E15 gal K16 rpsL (Str R ) end A1 Invitrogen MG1655 F ilv G rfb 50 rph 1 ATCC 700926 KL711 F + thi his ura trp ( 97 ) KL723 F + thi arg his ( 97 ) E5014 F + thi ( 97 ) KL719 F + thi met tr p leu ( 97 ) BW6166 Hfr glgP721::Tn 10 thi ( 178 ) NK6051 Hfr purK79::Tn 10 thi ( 178 ) BW6163 Hfr zed 977::Tn 10 thi ( 178 ) J7 JM107 ldhA tcdE pflB (Lab collection) DC825 J7 dld :: kan This study DC8255 J7 lldD :: kan This study DC82551 DC8255 ykgE :: k an This study DC82552 ykgF : :kan This study DC82553 ykgG ::kan This study DC8212 DC82551 UV treated (L LA ) This study DC8248 DC82551 UV treated (L LA ) This study DC8261 DC82551 UV treated (L LA ) This study DC8261 RecA DC8261 RecA This study DC826170 DC8261 transferred 70X in MM D LA This study DC lldR DC8261 lldR ::kan ( lldD + ) This study DC bglX DC826170 BglX ::kan This study DC ykgD DC8261 ykgD ::kan ( ykgE + ) This study DC bglX 30 DC826170X transferred 30X in MM LD LA This study DC825 ykgEFG DC825 ykgEFG ::kan This stud y

PAGE 60

60 Table 2 2. Primers used in this study Primer name F dld out ggatggttgccgaataaa R dld out cctgcgtacctggattgaa F dld in cacgctctattcgctgga R dld in gctcataccactcggtgtcgtta F lldD out gcaatcctcagtgaagcata R lldD out cggtgtcgttt cagagtga F lldD in gccgttcctgttccactat R lldD in gcaatcatacgcacgacat F ykgE out cggtggtttgggcttt R ykgE out gcgggtagcgtcttctt F ykgE in cgtaagctgggagtgaagga R ykgE in ggctcatcaacacttcagca F ykgF out cgatgtaggtgccagttt R ykgF out cctccagcctcgtgtca F ykgF in cgaacgtctgggctatga R ykgF in gcaggcgtagggtaaatctt k1 cagtcatagccgaatagcct k2 F ykgG kan c ggtgccctgaatgaactgc atgcggcaagctggtttatcaatggcggcaaaacaccgtgtaggctggagctgcttcg R ykgE kan ggctcatcaacacttcagcaatatgcatcactttcatatgaatatcctcctta F ykgE k an ggcacgagactccgtgctgctactggaaaaactcggcgtgtaggctggagctgcttcg F ykgD out gcacgcacaaaatctgtgtg F lldR out tctgatctgttgctggttgc F bglX out ccagtgacagcaactgatcc F lldD kan gcattcgagggagaaaaacgcatgattgtttccgcagtgtaggctggagctgcttcg R LldD kan tgccgcattccct ttcgccatgggagccatcatatgaatatcctcctta F lldP kan ctgcaagccaccgcagcagaagaaattggcgtctcgtgtaggctggagctgcttcg F pACYC Bam ctatcgactacgcgatcatg R pACYC Bam cggtgatgtcggcgatatag F M13 gtaaaacgacggccagt R M13 aacagctatgaccatg Tn5 F gggtgcgcatgatcctctagagt

PAGE 61

61 Figure 2 1 Culture apparatus used for D LA removal from PLA syrup with sparged air Fig ure 2 2 Pictures of spheroplasts of DC8255 cells (A) and vesicles after 3 minutes of sonication (B). Magnification: 1000 X. A B

PAGE 62

62 CHAP TER 4 R ESULTS AND DISCUSSION PLA Hydrolysis to LA PLA Hydrolysis in W ater Hydrolysis of two different PLA beads (grades 3052D and 4032D) and a consumer product (PLA based cups) w ere performed at 160C with water and the L LA released was determined by HPLC. S ince the hydrolysis profiles of all three PLA were similar (F igure 3 1) subsequent experi ments were conducted using beads grade 4032D, as the crystallinity of this polymer is slightly higher than the other bead s The consumer grade plastic cup was not use d due to t he need for further processing ( size reduction ) The PLA beads w ere treated in water at 140C, 150C and 160C and the amount of LA released was determined (Figure 3 2 ). L actic acid was detected in the medium after a short lag a t all three temper atures, and the duration of this lag time was dependent on the temperature of incubation (1.33 h, 2 h and 3.15 h at 160C, 150C and 140C, respectively) (Fig ure 3 2 A). During the lag period, the beads started to s of ten due to heat followed by swelling of the beads indicating water intake. Apparently, water molecules diffuse d into the amorphous regions of the beads as suggested by Tsuji et al. ( 170 ) as seen by a slight increase (less than 10% by weight) in the solid fraction weight that reached its maximum by the end of the lag phase. Following the lag, LA release was exponential and the rate of LA production increased with increasing temperature (0.382 /h at 140C, 0.664 /h at 150C and 0.989 /h at 160C). The rate of LA release under the experimental condition f ollowed a first order kinetics and all the acquired data fit a modified G ompertz model (equation 3 1) (Figure 3 2B ). The model curve fitted the data set with a sum of the square errors R 2 equal to 0.0034 f or the 150C treatment and the model also allowed f or the determination of the lag phase duration and maximum rate of hydrolysis.

PAGE 63

63 By mid exponential phase of LA accumulation, the beads have completely melted and the remaining solid material was opaque and white. At the end of hydrolysis of the PLA beads, n o solid material was present and the syrup was clear with a slight yellow color with a density ranging from 1.162 at 140C to 1.191 at 160C. The amount of time required for almost complete hydrolysis of PLA was also dependent on the temperatur e and the fi nal lactic acid titer was 191 (10.6), 197 (1.91) and 182.5 (2.99) mmoles of LA from the 16 0C, 150C and 140C treatment respectively. These titers represent a yield of 92% (160C), 95% (150C) and 88% (140C) of LA from PLA beads. The lower yield at 1 40C could be due to incomplete hydrolysis of LA oligomers at this temperature at the time the experiment was terminated. Similar hydrolysis pr of iles of PLA pellets were also reported by Tsuji et al. in the temperature range of 180C to 350C ( 163 ) In a 15 min hydrolysis time used in their study, the LA yield w as 65% (220C), 75% (260C), 80% (300C) and 90% (350C ). The results presented in Figure 3 2 shows that 95% of LA yield can be achieved at a significantly lower temperature of 160 C although the time required was longer than the 15 min incubation used by Tsuji, et al. ( 148 ). Siparsky and co workers suggested that continued accumulation of LA during hydrolysis could support an autocatalytic increase in the rate of PLA hydrolysis ( 143 ) To test this possibility, a hydrolysis pr of ile was obtained at 160 C in the presence of equal amounts of PLA beads an d LA syrup obtained from a previous experiment (pH 2.0; [LA], 460 mM) and compared to the one in which PLA beads were hydrolyzed in water. The hydrolysis pr of iles of both samples were similar (data not presented). Additionally, a PLA hydrolysis pr of ile in sulfuric acid (160 mM) also did not exhibit any detectable difference in lag phase duration or the rate of lactic acid release. Siparsky et al. hydrolyzed PLA in the melt using an acetonitrile/water mixture

PAGE 64

64 and this could account for the reported autocatal ytic PLA hydrolysis pr of ile ( 143 ) that was no t observed in a water based hydrolysis of PLA beads presented here (Fig ure 3 2). Also, the good fit of the Gompertz model to the hydrolysis pr of ile did not suggest an autocatalytic increase in PLA hydrolysis rate. The PLA pellets used in the hydrolysis exp eriments represent the raw material used by manufacturers to produce commodity plastic items distributed on the market. PLA bead grade 3052D represents the PLA typically sold to the food industries for producing packaging material for their food products. PLA grade 4032D is also used by the food industry, but mainly as films. It is possible that the hydrolysis behavior of plastic items made from these PLA beads may differ from the raw PLA used in this study. To test this possibility, soft drink cups obtaine d from 2 and subjected to hydrolysis with water at 160C. The hydrolysis profiles obtained for the s oft drink cups were comparable to the profiles obtained for the two grades of PLA beads, as seen in Figure 3 1. PLA Hydrolysis in a n Alkaline S olution PLA is hydrolyzed to LA in water at a rate that incr eases with temperature (Fig ure 3 2A ). As presented above, PLA hydrolysis is not influenced significantly by the presence of either lactic acid or sulfur ic acid. However, base has been reported to enhance PLA hydrolysis ( 183 ) although the effect of base on hydr olysis is yet to be described. In order to evaluate the effect of NaOH on hydrolysis of PLA beads, thermochemical hydrolysis pr of ile of PLA w as det ermined at 160C (Fig ure 3 3 ). In the presence of NaOH, hydrolysis pr of ile s of PLA beads were biph asic (Fig ure 3 3A ). There was an immediate release of LA that reached the maximum of about 17 mmoles in the p resence of 15 mmoles of NaOH after 15 min at 160 C and this amount represents about 8% of the theoretical maximum (Fig ure 3 3B) This was followed by complete hydrolysis of PLA

PAGE 65

65 (Figure 3 3A). In this experiment, the ratio of added [NaOH] to the PLA concentration was 0.07 mol/mol A similar alkali depend ent initial burst of LA was also observed at 60C (Fig ure 3 3 B) but not at room temperature At both 60C and 160C, this initial phase of LA release was within 15 min after the canisters were inserted in the pre heated oven (Fig ure 3 3 B) and the solid PL A still present in the canister retained its beads shape When PLA was hydrolyzed with water at temperatures as high as 160C, this initial phase of LA production seen in presence of NaOH was not detected (Fig ure 3 1, 3 2 and 3 3 ). These results suggest th at added alkali directly interacts with the amorphous regions of the polymer, especially at the surface of the bead, and this requires heating of the beads to expose these regions to solvent. This is in agreement with the observation that the solid beads o f slightly smaller diameter can be retrieved from the canisters after 15 min of heat treatment and also with previously rep orted surface erosion of PLA under alkaline conditions ( 167 ) Increasing the [NaOH] in the react ion increased the amount of LA produced during this p hase of PLA hydrolysis (Fig ure 3 4A ). Higher concentration of NaOH also reduced the lag duration before the second phase of hydrolysis started (Fig ure 3 4B ). Apparently, one molecule of OH reacts with o ne stereocenter of the polyester to release one mo lecule of LA. In this experiment, the correlation between LA release and [NaOH] was about 0.9. Since at 160C, higher [NaOH] led to an overlap of the two ph ases of PLA hydrolysis (Fig ure 3 3 B and 3 4A ), the actual LA concentration released during the first phase could not be accurately determined. To overcome this limitation, 60C was used to evaluate the first phase of alkali dependent PLA hydrolysis since at this temperature, no significant additional LA r elease was observed over a 4 day s period besides the initial release of LA by the base. At 60C as well as at 160C a direct correlation between the initial [NaOH] in the reaction and the amount of LA released from the

PAGE 66

66 PLA during the first phase can be ob served (Fig ure 3 4 A). On a molar basis, the correlation between [NaOH] and the amount of LA released in to the solution was 0.72 at 60C. The difference in the molar ratio between the two temperatures i.e., 0.72 mol/mol at 60C and 0.9 mol/mol at 160 C co uld be related to temperature dependent m elting of the beads that exposed additional amorphous regions of the bead to base attack. Since 60C is not high enough to completely melt the PLA beads within the four hour period of this experiment NaOH access is restricted to the amorphous layer on the bead surface that is not stoichiometrically equal to the base concentration especially at higher [NaOH]. After this initial base catalyzed release of LA, a short lag in LA release was observed at 160C. This lag d uration varied depending on the concentration of NaOH added to the reaction (Fig ure 3 4B) and also to the tem perature of incubation (Fig ure 3 4 C). However, it should be noted that base addition only shortened the lag phase before the remaining PLA hydrolys is started and it did not significantly alter the biphasic pr of ile of the PLA hydrolysis This is in agreement with a previous report on PLA hydrolysis conducted at temperatures over 160C that also showed a shorten ing of the lag phase by NaOH ( 183 ) Imme diately following this lag, the remaining PLA beads were hydrolyzed to LA in an exponential manner until the total LA yield reached about 90% of the theoretical value, as seen previously with water based hydrolysis (Fig ure 3 2A and 3 3A ). The rate of hydro lysis in the second phase of the reaction with added NaOH was slightly higher (1.23 /h ) compared to water based hydrolysis (0.99 /h ). This slightly higher rate of hydrolysis could be a consequence of surface erosion of the beads during the base attack that reduced the size of the remaining beads suggesting that the bead diameter may be a component in determining the hydrolysis rate ( 167 )

PAGE 67

67 Activation Energy of PLA Hydrolysis to LA Addition of base to the hydrolysis react ion did not significantly change the activation energy of hydrolysis (19.6 kcal/mol with NaOH and 17.2 kcal /mol with water alone) (Fig ure 3 5 ). One possible explanation for the slightly higher activation energy obtained in the presence of NaOH is that the base initially helps hydrolyze the amorphous regions of the beads leading to an increase in activation energy for hydrolysis of the remaining more organized crystalline parts of the beads. This would be in agreement with the previously reported higher ener gy to achieve hydrolysis of crystalline PLA ( 167 ) T hese values for activation energy of hydrolysis of PLA beads are close to the 19.9 kcal/mol obtained for hydrolysis of PDLLA microcapsules and 20.0 kcal/mol for PLLA m icrocapsules in the range of 21C to 45C ( 101 ) However values obtained in this study differ from the 12.2 kcal/mol reported for temperatures ranging from 180C to 250C; this lower value probably represents the activation energy required to break down the polymers into oligomers of smaller Mw as opposed to activation energy necessary for release of LA ( 171 ) Effect of Particle Size of PLA on H ydrolysis The resu lts presented above suggest the reactivity of NaOH with the PLA beads (2 mm diameter) may be limited by the surface area of the beads. It is possible that increasing the surface area accessible to the hydroxyl ions would increase the amount of LA released per mole of NaOH added. To test this possibility, the 2 mm diameter PLA beads were ground, sifted through a bouillon strainer a nd subsequently reacted with NaOH at 60C (Fig ure 3 6 ). In this set of experiments, 5 g of ground PLA (70 mmoles) were added to 25 g of aqueous solution containing 90 mmoles of NaOH (Fig ure 3 6 A). At this ratio of NaOH to PLA, the hydrolysis of PLA was mo nophasic and reached a maximum yield of about 90% within four hours. At [NaOH] below this value, the quantity of base added was limiting and the amount of

PAGE 68

68 total LA recovered was proportional to the initial amount of base added (Fig ure 3 6 B). When ground PL A was hydrolyzed 0.97 (0.028) mole of LA per mole of NaOH was obtained as opposed to a ratio of 0.82 (0.0034) obtained for the 2 mm diameter PLA beads. This increase in the molar ratio shows that the total surface area of the polymer accessible to hydro xyl ions limits the amount of LA that can be released under such conditions. It is also possible that grinding the beads to a powder led to partial decrystallization of the polymer accounting for the monophasic hydrolysis profile at 60C and the higher mol ar ratio. It is interesting to note that with the 2 mm PLA beads, the LA released to base ratio at 60C increased to 0.82 in this experiment compared to 0.72 seen before (Fig ure 3 4 A). This is apparently due to the PLA to base ratio at the beginning of the experiment and the time of sampling: 17% PLA (w/w) in this experiment (Fig ure 3 6 ) compared to 50% PLA (w/w) in the previous experiment (Fig ure 3 4 A ) and a time of sampling from 4 hours to 24 hours Racemization of Lactic Acid d uring H ydrolysis In the re covery of LA for reuse in the polymer industry, it is important that the LA produced by hydrolysis of PLA remains true to the original optical purity of the PLA. To investigate the isomeric stability of LA, PLA grade 3052D that contains a reported 4% of D isomer w as used in this experiment. During hydrolysis with water, trace amount of LA was released during the first hour before the expo nential increase in LA (Fig ure 3 7 ). During this period, the LA released was enriched in D LA reaching as high as 20% of the total released LA As the total LA concentration started to increase, the D LA fraction of the total declined to a final ratio of about 7.8% (Figure 3 7) Similar results were also obtained during PLA hydrolysis at temperatures lower than 160C (Table 3 1) or by addition of limi ting amounts of NaOH (Figure 3 7B) This higher than anticipated D LA content (about 5 8%) in the syrup was

PAGE 69

69 unexpected since it has been reported by others that racemization was not observed during heat treatment of PLA beads be low 200C ( 163 171 183 ) The increase in the D/L ratio could arise from limited racemization of LA during production of the beads ( 4 ) or during hyd rolysis. To distinguish between the two alternatives, LA syrup obtained after PLA hydrolysis in water at 160C was mixed with equal amount (w/w) of e ither water or 1 M NaOH and heated to 160C for 2 h. Also pure L LA in water or in 1 M NaOH was treated th e same way. Results of these experiments show that the D/L ratio of either syrup or pure L LA did not change significantly upon treatment in presence of water or NaOH at 160C (Table 3 2). Based on these results, it can be concluded that the observed highe r t han expected D/L ratio (Fig ure 3 7 ; Table 3 1) is apparently introduced during the preparation of the PLA beads and not during thermohydrolysis in water or in limiting NaOH. However, racemization of LA during hydrolysis of PLA could not be ruled out alt hough free LA was not significantly altered in this experiment.. Racemization of free L LA did occur when the NaOH is present at stoichiometrically higher concentration compared to the PLA and heated to 160C (Table 3 2). Similar increase in racemization o f LA in the presence of excess KOH and heat has been reported by Lockwood et al. ( 96 ) Even though NaOH in limiting or stoichiometrically equal amounts did not appear to affect race mization during hydrolysis (Table 3 1 and Figure 3 7), base must be used with caution as excess NaOH remaining after hydrolysis could lead to racemization of the product. Ideally, the process chosen to hydrolyze PLA polymer should not increase the D LA con tent of the product above that of the starting polymer to minimize the need for separation of the two enantiomers before L LA can be reused ( 172 ) This can be achieved by judici al application of alkali, time and temperature in the thermochemical hydrolysis of PLA for reuse.

PAGE 70

70 Engineering E. coli for Removal of D LA from Hydrolyzed PLA T o xicity I n duced by LA and PLA Syrup on the Growth of Wild Type E. coli Since almost all PLA mate rial found on the market include small amount of D LA or other co polymers, purification of the b ulk L LA is a critical factor in the overall process before the recovered L LA can be reused for production of PLA. This can be achieved either by expensive pu rification processes ( 58 ) or biologically using microbes that ca n selec tively remove the minor component o f the PLA syrup, such as D LA. Although all PLA polymers are made almost exclusively from lactic acid or other biodegradable compounds, during their production, the polymers could acquire some toxic compounds that may prevent successful bio based purification of the PLA syrup. Before genetically engineering an E. coli strain to selectively remove D LA from the PLA syrup, assessment of the toxicity of the PLA syrup is necessary. Escherichia coli is known to use both L and D LA as sole carbon sources for aerobic growth. To assess the p otential toxicity of PLA syrup, growth of E. coli strain W3110 in minimal medium conta ining PLA syrup was evaluated (F igure 3 8). E. coli strain W3110 was grown in mineral salts minimal medium containing increasing amounts of PLA syrup corresponding to a LA concentration ranging from 4 to 110 g/L. As a control, the same experiment was conducted using pure Na L LA as a sole carbon source. The highest specific growth rate was recorded for the lowest [LA] used, i.e., 4 g/L, regardless of the source of the lactic acid (Fig ure 3 8). However, the specific growth rate of 0.5 /h observed for Na L LA was higher than the growth rate of 0.4 /h when LA originated from PLA syrup. For [LA] lower than 35 g/L, growth rates observed with Na L LA were consistently 15% higher on average than the growth rates measured for cultures using melted PLA. This result suggests that additional compound(s) present in the syrup have a negative effect on the metabolism of the cell affecting its growth rate. Even though the growth rates recorded using PLA syrup were lower

PAGE 71

71 than that of the cultures containing Na L LA, the cells reached the same final OD 420 for both carbon sources (data not shown). Regardless of the LA source a sharp decrease in the specific growth rate was observed with LA concentrations higher than 27 g/L. The decrease reported was probably due to the high solute concentrations and osmotic effect ( 17 ) At [LA] higher than 42 g/L and 56 g/L in cultures containing PLA syrup and Na L LA, respectively, growth of the organism was not observed during the cours e of the experiment that lasted 27 h. Overall, wild type E. coli was able to grow using PLA syrup as a sole carbon source. In spite of the slight decrease in the growth rate observed when PLA is used, E. coli is a satisfactory candidate for metabolic eng in eering in order to selectively remove D LA from hydrolyzed PLA material Isolation of E. coli M utant Lacking L LDH Activity The first step in engineering E. coli to selectively remove D LA from hydrolyzed PLA material is the construction of a strain that i s unable to utilize L LA as a carbon source. The two genes encoding known L lactate dehydrogenases in E. coli ( lldD and ykgE ) we re deleted with the expectation that the double mutant will be defective in oxidation of L LA without any change in its D LA met abolism (Figure 3 9) Unexpectedly, the double mutant, strain DC82551, still grew in mineral salts medium with L LA as sole carbon source. These results indicate that there is at least one or possibly more additional protein(s) with L L DH activity produced by E. coli In order to obtain an E. coli mutant that is unable to grow on L LA as sole source of carbon, random insertions of Tn5 transposon s into the genome of DC82551 using a EZ Tn5 kit was constructed (Epicentre). Using the double mutant as the recipi ent of the mutated DNA, only 500 mutants were obtained due to low transformation eff iciency of DC82551 None of the mutants had a L lactate minus phenotype (Figure 3 9) To increase the total number of transposon mutants, mutated DNA was electroporated int o E. coli strain NEB Turbo electrocompetent cells The obtained transposon mutants were pooled (>10 ,000) and phage P1 was grown on this pool of

PAGE 72

72 mutants. The P1 library was used to transduce the tetracycline resistance gene into the lldD, ykgE double mutant strain DC82551. About 1200 transductants were tested for growth on L LA in MM. Three tranductants did not to grow on L LA. The genomic DNA from these three mutants was extracted and sequenced using the Tn5 F primer, provided by Epicentre. In all three mu tants, the transposon was inserted in the same gene, i.e., gltB gene, encoding the large subunit of glutamate synthase the enzyme that converts L glutamine and alpha ketoglutarate into two molecules of L glutamate ( 108 ) To evaluate the putative role of gltB in L LA metabolism, the gltB 32 transductants tested were found to be L LA positive suggesting that the gltB gene has no detectable role in L LA metabolism. It is unclear why the transposon induced gltB mutation negatively affected L LA metabolism in the E. coli double mutant. A possibility is that the transposon insertion followed by transduction into the double mutant caused additional genetic alteration in the chromosome leading to the L LA minus phenotype. These strains were not further studied. Chemical mutagenesis using ethylmethane sulfonic acid also failed to yield a L LA minus mutant. UV light has long been used as a mutagen of bacterial and eukaryo tic genomes and the mechanism of this process is well studied ( 36 46 88 ) Strain DC82551 was mutated using UV and among an approximately 4 ,000 colonies screened, 20 mutants were found to be defective in L LA utilization ( L LA Glu + D LA + Succ + ) (Figure 3 9 and Figure 3 10 ) These 20 mutants were tested in liq uid medium with L LA as sole C source and their growth rate and cell y ield with D LA were determined. T hree mutants that yielded the highest cell density after 24 h of growth i n minimal medium with D LA as a sole carbon source were retained and named

PAGE 73

73 DC821 2, DC8248 and DC8261 (Figure 3 10 ) The kanamycin gene cassette in ykgE gene in the Material and Methods section, to generate DC8212c, DC8248c and DC8261c. Lac tic acid is transported in E. coli by two known gene products encoded by lldP and glcA ( 115 ) Only a mutant lacking both transporters failed to accumulate LA in the cell. When ykgE + was transduced into the UV induced L LA minu s DC8261 mutant the resulting transductants ( ykgE + expression no other L LDH ) grew on lactate at about the same rate as an lldD mutant (DC8255, Table 3 3), suggesting that lactate transport is unaffected in strains DC8212, DC8248 and DC8261 (Figure 3 9) This was further confirmed by transducing lld D + into the DC8261 strain Growth of one such transductant; carrying a deletion in lldR with kanamycin resistance gene insertion DC lldR ) is presented in Figure 3 11 When cultured in liquid L LA MM, the maximum growth rate of strain DC lldR was comparable to the growth rate observed for DC8255 and DC82551 parent strains (Table 3 3). Transformation of strain DC8261, with plasmid pCA24N that contains the coding sequence of lldD gene (pCA24N:: lldD Table 2 1 ) under the control of an IPTG inducible promoter ( 84 ) restored growth on L LA. These results are in agreement that the third mutation that eliminated growth of E. coli on L LA is not in any of th e gene(s) contributing to L LA transport. Purification of PLA Syrup by DC8212, DC8248 and DC8261 Purification of the PLA syrup requires a strain that is L LA minus but has high rate of D LA metabolism. To determine which strain could remove D LA from a cul ture broth most e fficiently strains DC8212, DC8248 and DC8261 were grown in glycerol MM, harvested at mid exponential phase of growth and washed as described in the Material and Method section. Growing the cells using glycerol as a carbon source should no t influence the level of D LDH

PAGE 74

74 activity, as suggested in two previous studies ( 40 113 ) A minimal medium cont aining 20 g/L PLA syrup with a composition of 10 mM of D LA and 210 mM of L LA was inoculated at an OD 420 of 8.0. Strains DC8212 and DC8261 were a ble to metabolize all the D LA in the medium. Strain DC8248 only consumed about 50% o f the D LA added to the m edium in about 4 days and the [D LA] remained constant thereafter (data not shown). Consequently, D C8248 was not studied further. I t took five days for DC8212 and DC8261 to completely remove the 0.9 g/L D lactate added to the medium. T he large molar excess of L LA present might have hampered with the ability of the E. coli strains to rapidly metabolize D lactate in the medium As expected, both strains did not metabolize L LA. Specific D LA removal rate recorded for DC8261 was slightly higher than for DC821 2, i.e., 0.004 and 0.003 g D LA /(g DW .h). Consequently, DC8261 was r etained for further experiments. Adaptive Evolution of E. coli Strain DC8261 in D LA MM and Optimization S erial transfers of DC8261 in D LA MM were performed to improve the growth rate of th e bacterium in 3 g/L D LA MM The growth rate after transferring the strain 70 times (DC826170) had a specific growth rate of 0.29 /h, which is about 50% higher than for the starting strain (DC8261) that had a specific growth rate of 0.20 /h (Table 3 3 and Figure 3 9 ). In order to improve further the growth of strain DC826170 on D LA as a sole carbon source, dld structural gene was introduced into the genome. The dld gene codes for a D LDH in E. coli and is responsible for the oxidation of D LA into pyruvat e under aerobic condition ( 129 ) This gene was previously deleted as it was shown that D LDH in E. coli exhibits a minor L LA dependent reduction of MTT ( 38 ) (Figure 3 9) Transduction of bglX :: kan a neighboring gene to dld into strain DC826170 allowed rest oration of the native copy of the dld gene coding for a D LDH in E. coli resulting in creating strain DC bglX D glucosidase that is not predicted to influence the aerobic D LA metabolism in E. coli ( 185 ) Surprisingly,

PAGE 75

75 restoring the expression of this second D LDH in strain DC826170 did not increase the growth rate of the resulting strain on D LA MM (data not shown). DC bglX was then transferred every day in LD LA MM and an adapted strain named DC bglX 30 exhibited a maximum growth rate of 0. 36 /h (Td of 1.92 h) in D LA MM (Table 3 3 and Figure 3 9) This represents an improv ement of about 25% over the growth rate of DC826170, and 80% improvement over the growth rate of the parent strain DC8261. Even though dld gene encodes a LDH that was shown to possess the ability to oxidize L LA in vitro ( 38 ) DC bgl X and DC bgl X30 still lacked the ability to grow on L LA as a sole carbon source (Table 3 3). D LA Consumption Rate as a Function of Cell Density The PLA syrup purification experiments described above were conducted at high cell density (OD 420 of 8 .0) and high concentration of PLA syrup It is possible that the D LA removal rate of similar or higher value could be obtained in a culture started at a lower cell density to increase O 2 availability per cell To assess the relationship between the D LA r emoval rate a nd the starting culture density the following experiment was performed. Strain DC bglX was cultured in 20 g/L LD MM and harvested at mid exponential phase of growth, centrifuged and used to inoculate 20 g/L LD LA MM at various OD 420 ; 0.5, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0 (Fig ure 3 12 ). At starting cell densities up to 4.0 (OD 420 ), D LA removal rate increased with increasing cell density, suggesting that the amount of cells was a limiting factor during this phase At initial cell densities of above 4.0 (OD 420 ), D LA removal rate remained constant and at about 0.55 g D LA /(L.h) suggesting that the cell density was in excess. The increase in D LA removal rates as a function of cell density exhibited two linear curves of different sl opes; a rapid increas e up to a cell density of 1.0, and a relatively lower increase in the D LA removal rate between 1.0 and 4.0 (Fig ure 3 12 ). At lower initial cell densities, the cultures grew at a higher growth rate compared to the high cell density cultures.

PAGE 76

76 This is in agr eement with the fact that growing cells do metabolize the C source in the medium at a higher rate than non growing or slow growing cells. As inoculation density increased, D LA and/or oxygen became limiting, limiting growth but supporting only maintenance at the expense of D LA. These results show that a balance between metabolic activity and cell density is essential to achieve the highest rate of D LA removal from the PLA syrup. Under the current experimental condition, this appears to be about 4 OD 420 un its. Purification of PLA Syrup by DC826170 and DCbglX30 Strain DC826170 was selected after transferring DC8261 into D LA MM for about 700 generations, which increased the growth rate of the evolved strain by about 50% over the growth rate of the starting strain DC8261 in the same medium. The ability of strain DC826170 to remove D LA in PLA syrup was tested in shake flasks containing 35 mL of minimal medium containing 28, 33, 48, 65, 80 and 8 5 g/L of total LA. These media were inoculated at an initial cell density of 6.0 (OD 420 ) to ensure that the cells were in excess under the conditions of this experiment. Strain DC826170 completely removed all the D LA in cultures star ted with 28, 33, and 48 g/L of PLA derived LA in about 66, 67 and 71 h, respectively (da ta not shown). The specific rates of removal of D LA from these culture s were 0.014, 0.021 and 0.025 g D LA /(g DW .h), respectively. The specific rate of D LA removal by the evolv ed strain DC826170 was about 6.5 fold higher than the starting strain of the met abolic evolution, D8261 ( 0.004 g D LA /(g DW .h)) These r esults suggest that the [D LA] has a positive effect on the rate of D LA removal from the PLA syrup reaching a maximum at 50 g/L of total LA from PLA syrup. As the concentration of PLA syrup increased a bove 50 g/L of LA, the rate of removal of D LA declined, probably a s a consequence of inhibitory compounds presen t in the PLA syrup (Fig ure 3 8). During the experimental period of 110 h only about 12, 13 and 20% of the D

PAGE 77

77 LA present in the medium was remov ed from cultures that started with 65, 80 and 85 g/L of PLA syrup respectively. Continued metabolic adaptation of strain DC826170 for growth in the presence of 20 g/L of DL LA combined with restoration of dld + genotype led to strain DCbglX30 (Figure 3 9) Growth rate of this strain on D LA was about 3 0% higher than strain DC826170 (Table 3 3). Interestingly, strain DCbglX30 was able to efficiently metabolize all the D LA in PLA syrup at a total LA concentration as high as 126 g/L in about 40 h (Fig ure 3 13 ). Apparently, adaptive evolution in the presence of 20 g/L DL LA accumulated enough beneficial mutations to count eract part of the inhibitory effect s of high [LA]. At 126 g/L of LA from PLA syrup, the specific rate of D LA removal by strain DCbglX30 was 0 .114 g D LA /(g DW .h) with a volumetric rate of D LA removal of 0. 25 g D LA /(L.h). This represents a significant improvement over strain DC826170 that was limited to a maximum of 50 g/L LA from PLA syrup. When the total LA concentratio n was increased to 200 g /L, even strain DCbglX30 could only remove about 50% of the D LA present in the syrup in about 24 h, and remained constant afterwards. The D LA removal experiments detailed above were all conducted in shake flasks agitated at 250 rpm for optimum aeration o f the culture. Because D LA oxidation is oxygen dependent, it is possible that oxygen is a limiting factor in the shake flasks with high cell density. To test this possibility, air was sparged into the cultures actively removing D LA from PLA syrup In thi s experiment, concentration of LA used was 135 g/L and the cultures were started at an OD 420 of 6.0. Under such condition, strain DC bglX 30 metabolized the entire pool of D LA present in the culture broth in about 24 h, which is 10 h earlier than in shake f lask agitated at 250 rpm (Figure 3 13 ). D LA removal rate was about 50% higher when air was sparged than in shake flask, i.e., 0.363 and 0.250 g D LA /(L.h), respectively.

PAGE 78

78 Overall, this study shows that it is possible to engineer Escherichia coli to selective ly remove the D LA present in PLA syrup. Adaptive evolution, genetic manipulation as well as process modification to supply higher rate of oxygen supply are ways to increase tolerance to high lactic acid concentration in the PLA syrup and D LA removal rate Further adaptive evolution in the presence of PLA syrup with high [LA] is expected to further enhance the ability of strain DC bglX 30 and its derivatives to purify PLA syrup. The use of a microbial biocatalyst to purify a steric mixture of LA has not been described before. Such a bioprocess alleviates the requirement for expensive equipment necessary to perform this task by abiological means. Insight in to t he L LA Metabolism of Escherichia coli Phenotype of DC8255 on L LA MM Strain DC8255 lacks the three lactate dehydrogenases known to date, i.e., proteins coded by lldD dld and ldhA ( 40 104 129 ) (Figure 3 9) In mi nimal medium containing L LA as sole carbon source, strain DC8255 grew aerobically and with limiting oxygen Specific growth rate of strain DC8255 in MM with L LA was 0.27 /h under oxygen limitation con dition whereas the growth rate of the parent strain (J7) was 0.38 /h representing a 39% decrease due to the lldD mutation (Table 3 3) However, strain DC8255 reached the same cell yield as strain J7 (data not shown). The L lactic acid specific consumption rate calculated during the exponential phase of growth was 33% lower in DC8255 than in the wild type E. coli i.e, 12 g L LA /(g DW h ), compared to 18 g L LA /(g DW h ) respectively. This indicat es that while the L LDH encoded by the lldD is important for L LA u tilization, E. coli is also producing additional L LDHs that are contributing to L LA metabolism. In order to confirm the presence of multiple L LDHs in E. coli the lldD deletion was also transduced into other E. coli wild type strains, W3110 and MG1655. As seen with strain DC8255, these lldD mutants also grew in minimal medium with L LA as a sole carbon source confirming the presence of additional L LDHs in E. coli

PAGE 79

79 Ykg as an LDH Pinchuck et al. ( 123 ) reported that E. coli ykg EFG operon when introduced into a lactate minus mutant of Shewanella oneidensis MR 1 restored growth on L LA suggesting that this operon encodes an L LDH activity. To further evaluate this ykg encoded L LDH activity, ykgE was deleted in strain DC8255, giving strain DC82551 (Figure 3 9) Since ykg operon contains three genes, ykgF and ykgG were also deleted individually yielding strai ns DC82552 and DC82553, respectively (Table 2 1) All three double mutants ( lld and ykg ) still grew in L LA minimal medium although at a lower growth rate compared to the lld mutant, and the cell yield of the three double mutants on L LA was also reduced b y about 237.5% in compari son to the parent strain DC8255 (data not shown) An lld mutant that also lacks all three genes of the ykg operon (DC825 ykgEFG ) still grew in L LA minimal medium Based on comparative genome analysis ( 27 ) it was determined that the ykgE encoded product likely possess es the d ehydrogenase activity, and therefore, strain DC82551 was u sed in all further experiments (Figure 3 9) After UV treatment of DC82551 DC8261 was isolated upon its L LA minus phenotype (Figure 3 9) This strain possesses multiple mutations including lldD a nd ykgE As observed previously the reintroduction of a native copy of lldD structural gene into the genome of DC8261 restored the ability of the strain to grow on L LA as a sole carbon source (Figure 3 9 and Figure 3 10) Similarly, ykgE gene sequence wa s reintroduced into the genome of DC8261 c by cotransduction of a kanamycin marker adjacent to ykgE gene, creating DC ykgD strain (Figure 3 9) After selection on LB kanamycin agar medium transductants were streaked onto L LA kanamycin agar medium Interest ingly, all the transductants screened grew well on L LA medium by 48h incubation at 37C (Fig ure 3 11 ) This result strongly suggest s that YkgE is an L LDH allowing growth of the organism on L LA MM. When cultured in L LA liquid MM, the

PAGE 80

80 maximum growth rat e of DC ykgD strain was comparable to the growth rates of DC8255 and DC82551, i.e., 0.28 /h as opposed to 0.27 /h and 0.30 /h respectively (Table 3 3). T hird L LDH in E. coli The results presented in the previous section suggest that E. coli has at least thr ee proteins with L LDH activity. The LldD was the first L LDH described in E. coli ( 25 119 ) Based on heterologous complementation and comparative genomic analysis, YkgEFG constitutes a second enzyme complex oxidizing L LA in the cell. Growth of an E. coli strain lacking both lldD gene and ykgEFG operon (Table 3 3; strain DC82551) in L LA minimal medium and the inabili ty of mutant strain DC8261 to grow on L LA suggests the presence of, yet to be identified, one or more additional gene(s)/operon(s) encoding L LDH activity. This third L LDH activity is referred to as X, encoded by the gene x Biochemical Properties of L L DHs in E. coli Cellular localization of L LDHs and identification of electron acceptor for activity LldD has been described to be a membrane bound protein and its activity can be measured by coupling the oxidation of L LA to the reduction of MTT or DCPIP ( 40 120 ) Therefore, crude extracts of strain DC8255 (LldD YkgE + and X + ) was used to localize the remaining L LDH activities in the cell and also to identify an electron acceptor able to couple lactate oxidation. Among the various electron acceptors tested; NAD + NADP + ferricyanide MTT and 2, 6 dichlorophenol indophenol (DCPIP), only MTT and DCPIP were reduced by the cell extract in the presence of L LA. DCPIP was selected over MTT since MTT requires phenazine methosulfate (PMS) as an intermediate electron carrier. Irrespective of the bacterial strain tested (strain J7, DC lldR DC ykgD or DC82551), pyruvate was id entified by HPLC to be the product of the L LDH reaction in the presence of DCPIP as electron acceptor.

PAGE 81

81 Spheroplasts of strain DC8255 ( lldD ) had 0.03 unit of L LDH activity and this activity increased by almost two fold upon sonication that reduced the ves ure 2 2 Material and Methods ) ( 39 ) Using the membrane vesicles collec ted after centrifugation at 100,000 x g, 92% of the remaining L LDH activity was detec ted in the vesicles (Figure 3 14 ). These results suggest that the two remaining L LDH activities (Ykg and X) in the lldD mutant also appear to be membrane associated. Kin etic properties of the three L LDHs In order to determine the kinetic characteristics of the three L LDHs, E. coli strains that produced only one of the three enzymes were submitted to enzyme activity assays ( Figure 3 9; DC lldR DC ykgD and DC82551). Also, c rude extracts of J7, DC8255 and DC8261 were prepared and L LDH activity assays were performed. Activities measured in crude extracts prepared from strains J7 and DC lldR were the highest. These two strains produce LldD protein in the cell, suggesting that L ldD is the most active L LDH in the cell (Table 3 4). Specific activity of YkgE measured in membranes from cells that produced only the Ykg derived L LDH was about half of the LldD activity and the activity recorded for X alone represented about 23 % of th e LldD activity. Silencing Ykg and X from being expressed did not diminish the Lld activity indicating that the Lld LDH is the primary enzyme in the wild type cell. Removing the Lld LDH by deletion of the gene could have elevated the level of the other tw o enzymes and in the wild type cell the activity of these two alternate L LDHs could be significantly lower. Since the all three mutants producing only one of the three enzymes grew at about the same specific growth rate (Table 3 3), apparently loss of one or more of the L LDHs is compensated by the other although the level of enzyme activity of these mutants may vary significantly (Table 3 4). Activity profiles at different pH values for the three L LDHs are presented in Fig ure 3 15 The Lld had a pH optim um for activity of about 6.5 using DCPIP as electron acceptor (Fig ure 3 15 A). This

PAGE 82

82 optimum pH value differs from the pH value of 8.5 reported by Futai and Kimura ( 40 ) One explanation may rely on the different electron a cceptor they used in their study; another explanation may be that, in the present study, the activity was measured on vesicles and not on isolated protein. This observation has been made for other proteins such as N. meningitis D LDH, also a membrane assoc iated oxidoreductase, which exhibited an optimum pH of 7.0 in vesicles and an optimum pH of 8.0 when the assay was performed using purified protein ( 32 ) As seen in Figure 3 15B and 3 15 C the optimum pH recorded for YkgE and X were more basic, i.e., 9.4 and 10.0 respectively. A better comparis on of their pH pr ofile is depicted in Figure 3 16 DC8255 e x presses both Y kgE and X whereas DC ykgD and DC82551 express solely Y kgE or X respectively (Figure 3 9) DC8255 pH profile exhibits a peak at 9.5 as well as a shoulder at pH around 10, which may rep resent YkgE activity, and X activity respectively (Figure 3 16) The initial velocities and double reciprocal plots obtained for L LDH activity measured in DC82551 (X + ) with increasing concentrations of L LA and DCPIP are presented in Fig ure 3 17 Velocit y curve obtained when varying L LA provided a profile characteristic of a Michaelis Menten curve ( 78 ) and corresponding double reciprocal plot allowed to d etermine a K m for L LDH activity of E. coli (Figure 3 17 A and Table 3 5 ) ( 93 ) Apparent K m of the LldD enzyme for L ( 40 ) Apparent K m for L LA for Ykg of 640 M was the highest of the three L LDH activities in E. coli (Table 3 5). Apparent K m for DCPIP det ermined for LldD YkgE and X were 44, 70 and 500 respectively. These results show that the some of the enzyme activities were not determined at saturating concentration of one of the substrates, DCPIP, especially the activity of X when the

PAGE 83

83 DCPIP concent ration was set at 100 M due to its intense color in the oxidized form. The lower activity of the X LDH reported in Table 3 4 could arise from the difficulty in assaying the enzyme usi ng DCPIP as electron acceptor. Based on physiological, biochemical and g enetic analysis; E. coli appears to possess three L LDHs activities with distinct characteristics. All three L lactate oxidoreductases are membrane associated and catalyze the oxidation of L LA to pyruvate that supports growth of the organism under aerobic conditions. Attempts to Map the Third L LDH Complementation of L LA minus phenotype using plasmid libraries In the first set of experiments to map the gene encoding the X LDH activity, strain DC8261c was transformed with a cloned E. coli DNA library (Fi gure 3 9) None of the plasmid containing transformants grew on L LA MM. Since the X L LDH being a membrane associated enzyme, it is possible that a potential complementing plasmid due to its high copy number (plasmid pUC18 was used as a vector) was toxic to the cell. To overcome this possibility, a lower copy number plasmid library was used, i.e., pACYC184 based library. This plasmid allows about 20 to 40 copies to be maintained in E. coli cells as opposed to an average of 500 copies with pUC based plasmids About 10,000 transformants were tested for growth on L LA. Few small colonies that appeared on L LA MM with chloramphenicol were selected and tested further. However, none of these transformants grow in liquid culture in the same medium. Plasmids extract ed from these putative clones upon transformation back into strain DC8261 also failed to support growth on L LA. Insert DNA in these plasmids, analyzed by agarose gel electrophoresis or by colony PCR using pACYC primers (Table 2 2) was never larger than ab out 200 nt long suggesting significant rearrangement of the insert DNA in these plasmids. The small insert found in these plasmids was sequenced. The chromosomal region surrounding these insert

PAGE 84

84 DNAs insert sequence ( 3 kb) in the genome did not lend to id entification of a plausible L LDH candidate based on the presence of an oxidoreductase and/or flavin binding motif. Considering the putative rearrangements that occurred, it was possible that the initial poor growth on L lactate is due to zygotic induction of the gene upon plasmid entry ( 7 35 67 181 ) The pACYC based plasmid enters the cell, and expression of the plasmid borne genes starts, allowing the production of L LDH. Because of the number of plasmid in the cell and the fact that L LDH is a membrane associ ated protein, the production of too high levels of such protein disrupts the organization of the membrane, cell growth ceases. However, the initial production of the enzyme led to L LA oxidation and allowed the strain to divide few times. As the cells divi ded, a dilution effect of the L LDH present in the membrane have occurred, which allowed the daughter cells to divide as well, even though these cells did not produce any new L LDH. This way, a colony appeared on L LA chloramphenicol agar medium, but the c ells do not carry, in fact, a gene coding for an L LDH. LA MM replica plate, but could not be subcultured in the same medium. Nonetheless, the toxicity induced by high le vel of L LDH triggered recombinases to excise the piece of DNA that caused the toxicity in the cell. Therefore, a recA derivative of DC8261 was constructed ( 18 ) (DC8261 recA ) to minimize recombination L LA + transformants obtained in this new genetic background (DC8261 RecA ) could be subcultured on the same medium. DNA insert in plasmids isolated from seven transformants were sequenced. The insert D NA in all 7 plasmids contained the lldD gene As a result, a plasmid library was created using DC82551 genomic DNA lacking ykgE and lldD genes. Additionally and to avoid potential toxicity induced by the copy number of the plasmid, a single copy plasmid wa s used. A total of over 10,000 chloramphenicol resistant

PAGE 85

85 transformants were screened for growth on L LA as a sole carbon source. No L LA + clones (Figure 3 9) The results presented above suggest s the possibility that more than one gene is involved in the third L LDH activity observed in E. coli Therefore, a different genetic approach was adopted, consisting of conjugating DC8261 (L LA E. coli strains. and conjugation of DC8261 with Hfr E. coli strains The L LA minus a region of the E. coli K 12 chromosome that would complement the L LA minus phenotype of the mutant (Figure 3 9) Th e exconjugants containing the following plasmids grew on L LA MM agar medium: F143, F104, F128 and F254 (Figure 3 18 ). F104, F128 and F254 harbor the ykgE gene. Interestingly, F143 complemented the L LA phenotype of DC8261, though at a significantly lower frequency than that of the other plasmids. F143 plasmid is not known to include any identified L LDH, and the results presented here suggest that this region contains a gene(s) involved in the aerobic L LA metabolism of E. coli sted did not lead to any obvious L LA + phenotype. To confirm these results, three selected Hfr strains were used in conjugation experiments (Table 2 1). Hfr strain BW6166 point of origin is located at 91.46 min on the E. coli chromosome and a Tn10 transpos on is inserted about 13 min upstream of the point of insertion ( 76.78 min). Therefore, BW6166 can insert the lldD gene in the early stages of conjugation, and select for a tetracycline marker. NK6051 and BW6163 points of origin are located at 96.80 and 65. 00 min respectively, and harbor a Tn10 insertion at 11.87 and 43 minutes respectively. Therefore, the regions transferred by Hfr strains NK6051 and BW6163 contain ykgE and the e conjugations allowed some level of growth on L LA MM. Out of the three, BW6163 x DC8261 gave the best

PAGE 86

86 frequency of recombination with more than 10 6 L LA + CFU obtained (1% frequency). NK5061 x DC8261c gave about 250 colonies (0.00025%) and BW6166 x DC8261 gave about 6000 colonies on L LA MM plate (0.006%). In summary, F143 seems to harbor gene(s) that can complement L LA phenotype of DC8261 corresponding to the third L LDH. This result was also confirmed by the conjugation of Hfr BW6163 with DC8261c. Con sequently, corresponding portion of the E. coli K 12 chromosome was screened for potential dehydrogenases that were individually tested in a series of transductions (Table 3 6) Among the potential genes, three putative flavoproteins were identified ( ygcU, ygcQ, yqcA ). Deletions of all these genes listed in Table 3 6 in DC82551c did not yield any L LA minus phenotype indicating that these oxidoreductases did not contribute to L LDH activity (figure 3 9) As an alternative approach, genes about 30 kb apart i n the entire region corresponding to the deletion mutants (Table 3 7) These P1 phages were used to transduce DC8261c (L LA ). Table 3 7 gives the number of kanamycin r esistant transductants obtained for each transduction performed. None of the transductants grew on L LA kanamycin medium, suggesting that more than one gene in this region may be required to obtain a L LA + phenotype. This experiment further suggests that t hese genes are not cotransducible by P1 phage. It is possible that the genes needed for growth on L LA as sole carbon source involve a dehydrogenase as well as accessory proteins and a regulatory protein. The L LA + phenotype of DC82551 appears more complex than expected. Nonetheless, this strain is able to oxidize L LA for aerobic growth on L LA as a sole carbon source. Attempts to identify the third L LDH by LC/MS Since the genetic approach failed to identify the gene encoding the X LDH, a biochemical app roach was attempted (Figure 3 9) This involved identification of the X in native

PAGE 87

87 polyacrylamide gels b y activity staining (Figure 3 19 ) followed by identification of the component proteins by LC/MS after trypsin digestion. Membrane fraction was solubilize d with Triton X 100 in the gel during electrophoresis. A L LA dependent white band characteristic of the reduction of DCPIP appeared in the gel when soaked in reaction buffer after electrophoresis. The white band representing the third L LDH activity as we ll as other proteins with similar electrophoretic migration was removed and processed for LC/MS analysis. The results obtained after trypsin digestion, LC/MS MS separation and peptide identification were compared with E. coli proteome to identify the vario us proteins at the location in the gel. These results revealed a multitude of proteins present in the excised gel. Some of the identified proteins with unknown function could potentially serve as a oxidoreductase catalyzing L LA oxidation This was based o n the following criteria: peptides exhibited a flavin motif, or a dehydrogenase putative function or the peptide belonged to an inner surface protein of unknown function (Tab le 3 8 ). Among the genes encoding the identified proteins, ygbJ and yphG are loca ted in the chromosomal reg ion that complemented the L LA minus phenotype of DC8261. Two other candidates for the third L LDH are ygaF and visC Transducing the null mutation of each into the double mutant ( lldD, ykgE ) did not yield an L LA minus phenotype except for visC When a visC deletion mutation was transduced into visC :: kan did not grow on L LA. If the VisC is encoding the third L LDH, deletion of this gene is expected to yield 100% of L LA minus mutants. This transduction result suggests that at least two separate genes are contributing to the third L LDH activity and deletion of both these genes are needed for abolishing the third L LDH activity in E. coli Apparently, these two genes are unlinked in the chromosome. Id e ntification of these two or more genes contributing to the third L LDH activity as well as

PAGE 88

88 unraveling the anticipated complex interaction among these two gene products is part of a continuing future study. Although the proteomic study faile d to clearly pin point the protein(s) responsible for the third L LDH, similar experiment using membranes that contained the Ykg L LDH did lead to identification of the protein in the tryptic peptide pool (Figure 3 9) Purification of the third L LDH from a large amount of detergent solubilized membranes using conventional protein purification methods followed by trypsin digestion and LC/MS MS separation of the peptides is expected to identify the nature of the protein complex responsible for L LDH activity along with the gene(s) encoding it. This will be the starting part of a future study towards establishing the L lactic acid metabolism in E. coli and by extension in other bacteria.

PAGE 89

89 Table 3 1. D LA content of syrup obtained after hydrolysis of PLA at v arious temperatures W ater 1 M NaOH Temperature ( C) Time* (h) (D/total) LA (%) LA yield (%) Time* (h) (D/total) LA (%) LA yield (%) 160 2.1 6.4 92.0 1.9 4.7 98.1 155 2.8 6.3 92.4 2.0 6.3 96.1 150 3.7 6.8 95.0 2.5 6.0 95.9 140 5.5 8.3 88.0 4 .1 5.4 96.5 130 15.6 6.4 94.7 17.0 6.4 97.5 120 50.7 5.6 94.7 40.7 6.0 94.2 This experiment was conducted with PLA beads grade 4032D Time of sampling Table 3 2 Effect of base on racemization of LA (D/total) LA (%) Treatment 0 time (stdev) 2 h (stdev) PLA syrup + water 6.26 (0.80) 6.46 (0.90) L LA + water UD UD PLA syrup +1M NaOH 6.58 (0.69) 14.64 (0.48) L LA + 1M NaOH UD 9.02 (1.25) UD, undetectable amount of D LA PLA syrup from bead grade 4032D or pure L LA solution was treated at 160 C Values in parenthesis represent st and ard deviations.

PAGE 90

90 Table 3 3 Growth rates of relevant E. coli strains in minimal medium containing various lactic acid isomers Specific growth rate (1/h) Strain Relevant characteristics Phenotype on L LA D LA (4 g/L) LD LA (8 g/L) L LA (4 g/L) J7 lldD + ykgEFG + x + + 0.25 0.41 0.38 DC8255 ykgEFG + x + + 0.17 0.27 0.27 DC82551c x + + 0.14 0.27 0.30 DC lldR lldD + lldR + 0.20 0.26 0.27 DC ykgD ykgEFG + ykgD + 0.19 0.29 0.28 DC8261c no L LDH 0.20 0.25 NG D C826170c no L LDH 0.29 0.34 NG DC bglX 30 no L LDH 0.36 0.36 NG NG: No detectable growth Growth rates are in 1/h. Cultures were grown at 37 C in a shaker (250 rpm) in mineral salts medium with indicated carbon source. x represents the third, yet to be identified, L LDH activity Table 3 4 L LDH a ctivities of E. coli mutants defective in various L LDH activities Strain Relevant mutation Active L LDH Activity (U/mg protein ) % total J7 none LldD, Ykg, X 0.13 (0.016) 100 DC lldR ykgE x LldD 0.14 (0.016) 108 DC8255 lldD Ykg, X 0.06 (0.010) 49 DC ykgD lldD x Ykg 0.05 (0.008) 38 DC82551 lldD ykgE X 0.03 (0.0013) 23 DC8261 lldD ykgE x N one U D 0 UD, undetectable; <0.01 unit U, of reduced DCPIP per minute X rep resents the third, yet to be identifi ed, L LDH activity Values in parenthesis represent standard deviations

PAGE 91

91 Table 3 5 Affinity of different L LDH to L LA in E. coli Strain Relevant mutation Active L LDH L LA K m (m M) J7 none LldD, Ykg, X 0.0 96 (0.012 ) DC lldR ykgE x LldD 0.0 88 (0.036) DC8255 lldD Ykg, X 0. 753 (0.074) DC ykgD lldD x Ykg 0. 640 (0.113) DC82551 lldD ykgE X 0. 316 (0.04) X represents the third, yet to be identified, L LDH activity Values in parenthesis represent standard deviations Table 3 6 Potential L LDH gene candidates located between 55 min and 65 min on the E. coli chromosome Gene Locus (min) Annotation in E. coli W3110 ygbJ 61.63 P redicted dehydrogenase, Rossmann fold domain ygcO 62.33 P redicted 4Fe 4S cluster containing protein fucO 63.18 L actaldehyde reductase ygcN 62.30 H ypothetical protein ygcR 62.39 P utative electron transfer flavoprotein ygcU 62.45 P utative FAD containing dehydrogenase yqcA 62.96 F lavoprotein ygcQ 62.37 H ypothetical protein

PAGE 92

92 Table 3 7 Tran Number of transductants Marker Transduced Strand Distance (kb) LBK LLAK iscS::kan (58 min) 0 76 0 yfhK::kan 28 199 0 yfiQ::kan + 29 75 0 yfjD::kan + 26 47 0 ypjF::kan + 27 59 0 proW: :kan 29 175 0 ascB::kan + 34 240 0 iap::kan + 34 319 0 ygcF::kan 27 235 0 sdaC::kan + 24 200 0 ptrA::kan 26 180 0 yqeH::kan + 29 250 0 ssnA::kan + 31 175 0 gcvP::kan 26 228 0 yggP::kan 27 316 0 pppA::kan + 35 200 0 yghS::kan (68 min) 24 250 0 Transductants were selected at 30 C on LB kanamycin agar medium and replicated to L LA kanamycin agar medium, and incubated at 37 C for a total of 4 5 days. Table 3 8 List of potential L LDHs identified from LC/MS analysis G ene Molecular w e ight (kDa) O peron Locus ( min ) A nnotation ygbJ 139 ygbJK 62.99 D ehydrogenase yphG 7 no 59.09 H ypothetical protein yajO 36 no 0.08 O xidoreductase, aldo/keto visC 26 no 67.07 FAD oxidoreductase ybiC 39 no 18.98 L actate malate dehydrogenase qor 35 no 93. 06 Q uinone oxidoreductase ydbC 31 ydbCD 33.35 O xidoreductase ygaF 46 ygaTF 61.43 FAD oxidoreductase

PAGE 93

93 Figure 3 1. LA recovery pr of iles of various PLA material s in water at 160C LA released in the surrounding liquid obtained for PLA beads grade 3052D grade 4032D and 2 cm 2 pieces of s of t drink cups Figure 3 2 Hydrolysis pr of iles of PLA at different temperatures (A) LA recovery at 140C, 150C and 160C. PLA and water were 15 g each. (B) LA recovery pr of ile at 150C. Dashed line was derived from Gompertz model pr edicted LA production pr of ile (E q. 1). In (A) and (B), t he dotted line s located at the top represent the theoretical maximum LA c oncentration (207.63 mmoles) that can be obtained from 15 g of PLA. 0 1 2 3 4 5 6 7 8 0.0 1.0 2.0 [Lactic acid] (M) Time (h)

PAGE 94

94 Figure 3 3 Hydrolysis pr of iles of PLA in water or 1 M NaOH at 160C The NaOH solution used in t his experiment corresponds to 15 mmoles of OH in the reaction (A) The dotted line at the top corresponds to the theoreti cal yield of LA ( 207.63 mmoles ) that can be obtained from 15 g of PLA (B) Initial r elease of LA at 60 C and 160 C under alkaline conditions. NaOH H 2 O 160C 60C A B

PAGE 95

95 Figure 3 4 Relationship between the amount of LA recovered during the first phase of PLA hydrolysis and the i nitial concentration of NaOH at different temperatures (A) LA recovered after 15 min at 160C (R 2 = 0.99877) and 4 h at 60C (R 2 = 0.99680) as a function of initial NaOH concentration (B) Natural logarithm of the lag duration (h) as c alculated using E quation 1 as a function of initial NaOH concentration (R 2 = 0.99575). (C) Natural logarithm o f the lag du ration (h) as calculated using E quation 1 as a function of temperature (R 2 were above 0.99)

PAGE 96

96 Figure 3 5 er or 1 M NaOH aqueous solution Figure 3 6 Effect of PLA particle si ze and NaOH concentration on LA recovery In both Figures the dotted line at the top re prese nts the theoretical yield of LA (69.4 mmoles) (A) LA obtained at 60C for ground PLA (17% (w/w)) wit h 90 mmoles of NaOH (B) Coarse PLA powder and 2 mm polished beads were heated at 60C for 24 h and the total LA released is presented as a function of the initial NaOH concentration (17% PLA (w/w)). (R 2 values on the linear portion of the curves were abo ve 0.995 for both treatments ). See Methods section for other details. 2 mm beads powder B A NaOH H 2 O

PAGE 97

97 Figure 3 7 Optical purity of LA released during the hydrolysis of PLA beads ( grade 3052D ) at 160C (A) Hydrolysis of PLA beads with water. (B) Hydrolysis of PLA beads with 1 M Na OH. Figure 3 8. Growth rate of E. coli strain W3110 in increasing concentration of either Na L LA ( ) or hydrolyzed PLA syrup ( ) E xperiment was conducted in minimal medium with lactic acid as sole carbon source (35 mL in 250 mL flask). Flasks were ag itated at 250 rpm on a shaker at 37C.

PAGE 98

98 Figure 3 9 Roadmap of the different strains constructed throughout the present study. Red arrows represent genetic manipulation s performed by transduction.

PAGE 99

99 Fig ure 3 10 Screening steps following UV exp osure of E. coli strain DC82551 OD 420 was determined at 24 h. Fig ure 3 11 Growth of strains DC8261, DC lldR and DC ykgD on 3 g/L L LA MM kan after 48 h of incubation at 37C

PAGE 100

100 Figure 3 12 D lact ic acid consumption rates ( ) and doubling time ( ) of E. coli strain DC bglX as a function of initial cell density. The experiment was conducted in 35 mL of minimal medium (250 mL flask) and 20 g/L of synthetic lactic acid syrup (1:1 of L LA and D LA) Fla sks were agitated at 250 rpm on a shaker at 37C. Figure 3 13 D LA removal from PLA syrup by E. coli strain DC bglX 30 D LA removal from PLA syrup with 125 g/L total LA at 37C in shake flasks (35 mL in 250 mL flask) agitated at 250 rpm (filled markers) or with air spa rged through the culture (em p ty mar kers). B

PAGE 101

101 Figure 3 14 L LDH activity of various fraction s during membrane preparation from E. coli strain DC8255 Enzyme activity was me asured in 50 mM HEPES buffer pH 8 .0 U represents one unit of L LDH activity ( of DCPIP reduced per min ) Specific activity is listed next to each fraction ; underlined values represent total activities and values in the dotted box represent proportion of total activity retrieved in the solu ble and membr ane fractions

PAGE 102

102 Figure 3 15 p H pr of iles of the three different L LDH activities in E. coli Enzyme activity was measured in isolated membranes using 50 mM MES Tricine buffer (A), or HEPES CAPSO buffer (B) and (C).

PAGE 103

103 Figure 3 16 L LDH ac tivity pH pr of iles of membranes with multiple L LDH activities pH pr of iles for E. coli strains DC8255 ; DC ykgD ; and DC82551, Strain DC8255 contains both YkgE and the third enzyme whereas DC ykgD and DC82551 contain only YkgE or the third enzyme, re spectively 0.00 0.01 0.02 0.03 0.04 0.05 0.06 0.07 0.08 6.0 8.0 10.0 12.0 Activity ( /( min.mg )) pH

PAGE 104

104 Figure 3 17 Enzyme activity as a function of substrate concentration using membrane s from E. coli strain DC82551 that contains only the third L LDH activity.

PAGE 105

105 Figure 3 18 Genetic map of E. coli K 12 showing approximate chromosomal reg i ons carried by different F prime elements is represented by an arc which has a narrow head drawn to show the point of origin of the ancestral Hfr strain(see inner circle). The dashed black lines, which extend radially from the genetic markers on t he outer circle, indicate the known termini of the F prime elements Known deletions are indicated by narrow rectangles. lldD and ykgE gene loci are represented and the bold dashed lines LA minus phenotype i n DC8261. Figure 3 19 Native PAGE gels stained with DCPIP, witho ut L LA (A), and with L LA (B). 2% triton 100 was added to the gel and migration was performed at 4 C to conserve activity.

PAGE 106

106 CHAPTER 5 CONCLUSION Polylactic acid polymer (PLA), although b iodegradable, persists in nature upon disposal due to various constraints. Thermochemical hydrolysis of the PLA based plastics is an effective method of recycling them at the end of life to generate the constituent monomer, lactic acid (LA) that can be reu sed to produce PLA. Hydrolysis of PLA beads in water occurs in two stages; swelling and melting of the polymer followed by release of LA from the molten plastics Temperature dependent release of LA from PLA beads in water follows apparent first order deca y kinetics after a short lag and a modified Gompertz equation can explain the overall process. In the presence of limiting amount of NaOH, a base concentration dependent immediate release of LA, apparently from the amorphous regions of the beads was detect ed. Bulk of the l actic acid production follow ed after a short lag until a maximum of about 95% of the theoretical yield of LA wa s reached. The rate of hydrolysis of PLA was higher in the presence of NaOH compared to water alone and is dependent on particle size. Racemization of released LA was not detected during hydrolysis in water or with limiting amount of NaOH. However, molar excess of NaOH during PLA hydrolysis led to racemization of LA. Overall, the results presented in this dissertation show that the rmochemical hydrolysis of PLA based plastics in the presence of limiting amount of base is an effective and rapid method of recovering LA for reuse as chemical feedstock. A novel bio based process was develop ed for purification of the PLA syrup obtained a fter hydrolysis. The D LA removal is achieved at 37C under aerobic conditions using an engineered E. coli that lacks L LDH activity No D LA was detectable after this process step, suggesting that the L LA obtained after downstream purification can be red irected into the PLA production process. The use of a biological system for the purification of diastereoisomers has

PAGE 107

107 never been described and constitutes a promising economical way of obtaining technical grade L LA from post consumer PLA items. Finally, th is study led to uncovering new features of the aerobic L LA metabolism in E. coli. E. coli ykgEFG operon encode s a second L LDH in addition to the previously reported lldD encoded L LDH The Ykg LDH is also localized in the membrane and the activity of th is complex in crude extract was about 2 fold lower than the activity of LldD Additionally, a third L LDH activity was also detected in a mutant lacking both lldD and ykgE and the gene ( s ) encoding this third LDH activity is yet to be identified. This third L LDH activity in the cell even though lower than for the other two LDH activities, is sufficient to support growth of E. coli on L LA.

PAGE 108

108 LIST OF REFERENCES 1. Allsopp, M., Walters, A., Santillo, D., and Johnston, P. 2007, posting dat e. Plastic http://www.unep.org/regionalseas/marinelitter/publications/docs/plastic_ocean_report.pdf 2. Arena, M., C. Abbate, K. Fukushima, and M. Gennari. 2011. Degradation of poly (lactic acid) and nanocomposites by Bacillus licheniformis. Environ Sci Pollut Res 18: 865 870. 3. Auras, R., B. Harte, and S. Selke. 2004. An overview of polylactides as packaging materials. Macromol Biosci 4: 835 864. 4. Auras, R. A., L. T. Lim, S. E. M. Selke, and H. Tsuji. 2010. Poly(lactic acid ): synthesis, structures, properties, processing, and applications John Wiley & Sons, Hoboken, N.J. 5. Baba, T., T. Ara, M. Hasegawa, Y. Takai, Y. Okumura, M. Baba, K. A. Datsenko, M. Tomita, B. L. Wanner, and H. Mori. 2006. Construction of Escherichia co li K 12 in frame, single gene knockout mutants: the Keio collection. Mol Syst Biol 2: 1 11. 6. BCC Research 2011, posting date. Biodegradable polymers, Report code PLS025D. 7. Bloom, F. R., and B. Tyler. 1979. Introduction of bacteriophage lambda into ce lls of Klebsiella aerogenes. J Bacteriol 139: 680 682. 8. Bonsignore, P. V. 1995. Production of high molecular weight polylactic acid. United States. 9. Bosiers, L., and S. Engelmann. 2003. Compostable Material: Thermoformed Packaging Made of PLA p. 21 23 Kunststoffe international, vol. 12. 10. Brake, L. D., and N. S. Subramanian. 1993. Rapid depolymerization of polyhydroxy acids. United States. 11. Buchholz, B. 1994. Process for preparing polyesters based on hydroxycarboxylic acids. United States. 12. Budiyono, B., I. W. Nyoman, S. Sunarso, and S. Johari. 2010. The kinetics of biogas production rate from cattle manure in batch mode International Journal of Chemical and Biological Engineering 3: 39 44. 13. Carothers, W. H., G. L. Dorough, and F. J. van Natta. 1932. Studies of polymerization and ring formation. X. The reversible polymerization of six membered cyclic esters. Journal of the American Chemical Society 54: 761 772.

PAGE 109

109 14. Chai, Y. R., R. Kolter, and R. Losick. 2009. A Widely Conserved Gene Cluste r Required for Lactate Utilization in Bacillus subtilis and Its Involvement in Biofilm Formation. Journal of Bacteriology 191: 2423 2430. 15. Cherepanov, P. P., and W. Wackernagel. 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the o ption of Flp catalyzed excision of the antibiotic resistance determinant. Gene 158: 9 14. 16. Conn, R. E., J. J. Kolstad, J. F. Borzelleca, D. S. Dixler, L. J. Filer, Jr., B. N. LaDu, Jr., and M. W. Pariza. 1995. Safety assessment of polylactide (PLA) for use as a food contact polymer. Food Chem Toxicol 33: 273 283. 17. Csonka, L. N. 1989. Physiological and genetic responses of bacteria to osmotic stress. Microbiological Reviews 53: 121 147. 18. Csonka, L. N., and A. J. Clark. 1980. Construction of an Hfr s train useful for transferring recA mutations between Escherichia coli strains. J Bacteriol 143: 529 530. 19. Dahlmann, J., G. Rafler, K. Fechner, and B. Mehlis. 1990. Synthesis and properties of biodegradable aliphatic polyesters. British Polymer Journal 2 3: 235 240. 20. Datsenko, K. A., and B. L. Wanner. 2000. One step inactivation of chromosomal genes in Escherichia coli K 12 using PCR products. Proc Natl Acad Sci U S A 97: 6640 6645. 21. Datta, R., S. P. Tsai, P. Bonsignore, S. H. Moon, and J. R. Frank. 1995. Technological and economic potential of poly(lactic acid) and lactic acid derivatives. FEMS Microbiology Reviews 16: 221 231. 22. David, H., G. Patrick, L. Jim, and R. Jed. 2005. Polylactic Acid Technology, Natural Fibers, Biopolymers, and Biocomposi tes. CRC Press. 23. de Jong, S. J., B. van Eerdenbrugh, C. F. van Nostrum, J. J. Kettenes van den Bosch, and W. E. Hennink. 2001. Physically crosslinked dextran hydrogels by stereocomplex formation of lactic acid oligomers: degradation and protein release behavior. Journal of Controlled Release 71: 261 275. 24. Denison, R. A. 1996. Environmental life cycle comparisons of recycling, landfilling, and incineration: A review of recent studies. Annu Rev Energ Env 21: 191 237. 25. Dong, J. M., J. S. Taylor, D. J Latour, S. Iuchi, and E. C. Lin. 1993. Three overlapping lct genes involved in L lactate utilization by Escherichia coli. J Bacteriol 175: 6671 6678. 26. Drumright, R. E., P. R. Gruber, and D. E. Henton. 2000. Polylactic Acid Technology. Advanced Materia ls 12: 1841 1846.

PAGE 110

110 27. Durfee, T., R. Nelson, S. Baldwin, G. Plunkett, V. Burland, B. Mau, J. F. Petrosino, X. Qin, D. M. Muzny, M. Ayele, R. A. Gibbs, B. Csrg G. Psfai, G. M. Weinstock, and F. R. Blattner. 2008. The Complete Genome Sequence of Escheric hia coli DH10B: Insights into the Biology of a Laboratory Workhorse. Journal of Bacteriology 190: 2597 2606. 28. Engelberg, I., and J. Kohn. 1991. Physicomechanical Properties of Degradable Polymers Used in Medical Applications a Comparative Study. Bioma terials 12: 292 304. 29. Enomoto, K., A. M., and A. Yamaguchi. 1994. Polyhydroxycarboxylic acid and preparation process thereof. United States. 30. Environmental protection agency 2012, posting date. Plastics. http://www.epa.gov/osw/conserve/materials/pla stics.htm l 31. Erwin, A. L., and E. C. Gotschlich. 1996. Cloning of a Neisseria meningitidis gene for L lactate dehydrogenase (L LDH): evidence for a second meningococcal L LDH with different regulation. J Bacteriol 178: 4807 4813. 32. Erwin, A. L., and E C. Gotschlich. 1993. Oxidation of D lactate and L lactate by Neisseria meningitidis: purification and cloning of meningococcal D lactate dehydrogenase. J Bacteriol 175: 6382 6391. 33. Eyal, A. M., J. N. Starr, R. Fisher, B. Hazan, R. Canari, D. R. Witzke P. R. Gruber, and J. J. Kolstad. 2001. Lactic acid processing methods arrangements and products. United States. 34. Fambri, L., A. Pegoretti, R. Fenner, S. D. Incardona, and C. Migliaresi. 1997. Biodegradable fibres of poly(L lactic acid) produced by me lt spinning. Polymer 38: 79 85. 35. Feinstein, S. I., and K. B. Low. 1982. Zygotic induction of the rac locus can cause cell death in E. coli. Mol Gen Genet 187: 231 235. 36. Franklin, W. A., P. W. Doetsch, and W. A. Haseltine. 1985. Structural determinatl on of the ultraviolet light induced thymine cytosine pyrimidine pyrimidone (6 4) photoproduct. Nucleic Acids Research 13: 5317 5325. 37. Fukuzaki, H., M. Yoshida, M. Asano, and M. Kumakura. 1989. Synthesis of Copoly(D,L Lactic Acid) with Relatively Low Mol ecular Weight and Invitro Degradation. European Polymer Journal 25: 1019 1026. 38. Futai, M. 1973. Membrane D lactate dehydrogenase from Escherichia coli. Purification and properties. Biochemistry 12: 2468 2474.

PAGE 111

111 39. Futai, M. 1974. Orientation of membrane vesicles from Escherichia coli prepared by different procedures. J Membr Biol 15: 15 28. 40. Futai, M., and H. Kimura. 1977. Inducible membrane bound L lactate dehydrogenase from Escherichia coli. Purification and properties. J Biol Chem 252: 5820 5827. 41 Garlotta, D. 2001. A Literature Review of Poly(Lactic Acid). Journal of Polymers and the Environment 9: 63 84. 42. Garvie, E. I. 1980. Bacterial lactate dehydrogenases. Microbiological Reviews 44: 106 139. 43. Gennis, R. B., and V. Stewart. 1996. Respir ation, p. 217 261. In H. E. Umbarger (ed.), Neidhardt, F. C. Curtiss, R. III Ingraham, J. L. Lin, E. C. C. Low, K. B. Magasanik, W. S. Reznikoff, W. S. Riley, M. Schachter, M. Escherichia coli and Salmonella : cellular and molecular biology. ASM Press, W ashington, D.C. 44. Giongo, A., D. B. Crabb, A. G. Davis Richardson, D. Chauliac, J. M. Mobberley, K. A. Gano, N. Mukherjee, G. Casella, L. F. W. Roesch, B. Walts, A. Riva, G. King, and E. W. Triplett. 2010. PANGEA: pipeline for analysis of next generatio n amplicons. Isme J 4: 852 861. 45. Giordano, G., L. Grillet, J. Pommier, C. Terriere, B. A. Haddock, and E. Azoulay. 1980. Precursor forms of the subunits of nitrate reductase in chlA and chlB mutants of Escherichia coli K12. Eur J Biochem 105: 297 306. 4 6. Glickman, B. W., R. M. Schaaper, W. A. Haseltine, R. L. Dunn, and D. E. Brash. 1986. The C C (6 4) UV photoproduct is mutagenic in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 83: 6945 6949. 47. Gompe rtz, B. 1825. On the Nature of the Function Expressive of the Law of Human Mortality, and on a New Mode of Determining the Value of Life Contingencies. Philosophical Transactions of the Royal Society of London 115: 513 583. 48. Grabar, T. B., S. Zhou, K. T Shanmugam, L. P. Yomano, and L. O. Ingram. 2006. Methylglyoxal bypass identified as source of chiral contamination in l(+) and d( ) lactate fermentations by recombinant Escherichia coli. Biotechnol Lett 28: 1527 1535. 49. Grijpma, D. W., A. J. Nijenhuis, P. G. T. Wijk, and A. J. Pennings. 1992. High impact strength as polymerized PLLA. Polymer Bulletin 29: 571 578. 50. Grijpma, D. W., J. P. Penning, and A. J. Pennings. 1994. Chain entanglement, mechanical properties and drawability of poly(lactide). Collo id Polym Sci 272: 1068 1081.

PAGE 112

112 51. Grijpma, D. W., and A. J. Pennings. 1994. (Co)Polymers of L Lactide .2. Mechanical Properties. Macromolecular Chemistry and Physics 195: 1649 1663. 52. Gross, R. A., and B. Kalra. 2002. Biodegradable polymers for the enviro nment. Science 297: 803 807. 53. Gruber, P., and M. O'Brien. Online. Wiley VCH Verlag GmbH & Co. KGaA. 54. Gruber, P. R., E. S. Hall, J. J. Kolstad, M. L. Iwen, R. D. Benson, and R. L. Borchardt. 1999. Co ntinuous process for manufacture of lactide polymers with controlled optical purity. United States. 55. Gruber, P. R., E. S. Hall, J. J. Kolstad, M. L. Iwen, R. D. Benson, and R. L. Borchardt. 1992. Continuous process for manufacture of lactide polymers w ith controlled optical purity. United States. 56. Gruber, P. R., J. J. Kolstad, and C. M. Ryan. 1996. Melt stable semi crystalline lactide polymer film and process for manufacture thereof. United States. 57. Gupta, A. P., and V. Kumar. 2007. New emerging trends in synthetic biodegradable polymers Polylactide: A critique. European Polymer Journal 43: 4053 4074. 58. Hadik, P., L. P. Szabu, and E. Nagy. 2002. D,L lactic acid and D,L alanine enantioseparation by membrane process. Desalination 148: 193 198. 59. Hammer, J., M. H. Kraak, and J. R. Parsons. 2012. Plastics in the marine environment: the dark side of a modern gift. Reviews of environmental contamination and toxicology 220: 1 44. 60. Hartmann, M. H. 1998. High molecular weight polylactic acid polym ers, p. 367 411. In D. L. Kaplan (ed.), Biopolymers from Renewable Resources. Springer. 61. Ho, C., E. A. Pratt, and G. S. Rule. 1989. Membrane bound D lactate dehydrogenase of Escherichia coli: a model for protein interactions in membranes. Biochim Bioph ys Acta 988: 173 184. 62. http://www.loopla.org. 63. Huneault, M. A., and H. B. Li. 2007. Morphology and properties of compatibilized polylactide/thermoplastic starch blends. Polymer 48: 270 280. 64. Ibay, A. C., and L. P. Tenney. 1993. Polymers from hydr oxy acids and polycarboxylic acids. United States.

PAGE 113

113 65. Ikada, Y., K. Jamshidi, H. Tsuji, and S. H. Hyon. 1987. Stereocomplex formation between enantiomeric poly(lactides). Macromolecules 20: 904 906. 66. Ikura, Y., and T. Kudo. 1999. Isolation of a microo rganism capable of degrading poly (L lactide). The Journal of general and applied microbiology 45: 247 251. 67. Jacob, F., and E. L. Wollman. 1956. [Processes of conjugation and recombination in Escherichia coli. I. Induction by conjugation or zygotic indu ction]. Annales de l'Institut Pasteur 91: 486 510. 68. Jacobsen, S., P. H. Degee, H. G. Fritz, P. H. Dubois, and R. Jerome. 1999. Polylactide (PLA) A new way of production. Polym Eng Sci 39: 1311 1319. 69. Jacobsen, S., and H. G. Fritz. 1996. Filling of poly(lactic acid) with native starch. Polym Eng Sci 36: 2799 2804. 70. Jacobsen, S., and H. G. Fritz. 1999. Plasticizing polylactide The effect of different plasticizers on the mechanical properties. Polym Eng Sci 39: 1303 1310. 71. Jamshidi, K., S. H. H yon, and Y. Ikada. 1988. Thermal Characterization of Polylactides. Polymer 29: 2229 2234. 72. Jarerat, A., and Y. Tokiwa. 2001. Degradation of Poly(L lactide) by a Fungus. Macromolecular Bioscience 1: 136 140. 73. Jarerat, A., Y. Tokiwa, and H. Tanaka. 200 4. Microbial poly(L lactide) degrading enzyme induced by amino acids, peptides, and poly(L amino acids). Journal of Polymers and the Environment 12: 139 146. 74. Jarerat, A., Y. Tokiwa, and H. Tanaka. 2003. Poly(L lactide) degradation by Kibdelosporangium aridum. Biotechnol Lett 25: 2035 2038. 75. Jarerat, A., Y. Tokiwa, and H. Tanaka. 2006. Production of poly(l lactide) degrading enzyme by Amycolatopsis orientalis for biological recycling of poly(l lactide). Applied Microbiology and Biotechnology 72: 726 73 1. 76. Jiang, Y., F. Yang, X. Zhang, J. Yang, L. Chen, Y. Yan, H. Nie, Z. Xiong, J. Wang, J. Dong, Y. Xue, X. Xu, Y. Zhu, S. Chen, and Q. Jin. 2005. The complete sequence and analysis of the large virulence plasmid pSS of Shigella sonnei. Plasmid 54: 149 1 59. 77. John, R. P., S. A. G, K. M. Nampoothiri, and A. Pandey. 2009. Direct lactic acid fermentation: focus on simultaneous saccharification and lactic acid production. Biotechnol Adv 27: 145 152. 78. Johnson, K. A., and R. S. Goody. 2011. The Original M ichaelis Constant: Translation of the 1913 Michaelis Menten Paper. Biochemistry 50: 8264 8269.

PAGE 114

114 79. Ke, T., and X. Sun. 2001. Thermal and mechanical properties of poly(lactic acid) and starch blends with various plasticizers. T Asae 44: 945 953. 80. Ke, T. Y., and X. Z. Sun. 2001. Effects of moisture content and heat treatment on the physical properties of starch and poly(lactic acid) blends. Journal of Applied Polymer Science 81: 3069 3082. 81. Ke, T. Y., and X. Z. S. Sun. 2003. Starch, poly(lactic acid), a nd poly(vinyl alcohol) blends. Journal of Polymers and the Environment 11: 7 14. 82. Kim, D. H., S. Jiang, J. H. Lee, Y. J. Cho, J. Chun, S. H. Choi, H. S. Park, and H. G. Hur. 2011. Draft Genome Sequence of Shewanella sp. Strain HN 41, Which Produces Arse nic Sulfide Nanotubes. Journal of Bacteriology 193: 5039 5040. 83. Kim, M. N., W. G. Kim, H. Y. Weon, and S. H. Lee. 2008. Poly(L lactide) degrading activity of a newly isolated bacterium. Journal of Applied Polymer Science 109: 234 239. 84. Kitagawa, M., T. Ara, M. Arifuzzaman, T. Ioka Nakamichi, E. Inamoto, H. Toyonaga, and H. Mori. 2006. Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K 12 ORF Archive): Unique Resources for Biological Research. DNA Research 12: 291 2 99. 85. Kline, E. S., and H. R. Mahler. 1965. The lactic dehydrogenases of E. coli. Ann N Y Acad Sci 119: 905 919. 86. Kolstad, J. J. 1996. Crystallization kinetics of poly(L lactide co meso lactide). Journal of Applied Polymer Science 62: 1079 1091. 87. Komazawa, Y., and Z. Tang. 2008. Method for producing polylactic acid block copolymer. 88. Kunz, B. A., and B. W. Glickman. 1984. The role of pyrimidine dimers as premutagenic lesions: a study of targeted vs. untargeted mutagenesis in the lacI gene of Esc herichia coli. Genetics 106: 347 364. 89. Lay, J. J., Y. Y. Li, and T. Noike. 1998. Mathematical Model for Methane Production from Landfill Bioreactor. Journal of Environmental Engineering 124: 730 736. 90. Lehermeier, H. J., J. R. Dorgan, and J. D. Way. 2 001. Gas permeation properties of poly(lactic acid). Journal of Membrane Science 190: 243 251. 91. Li, F., S. Wang, W. Liu, and G. Chen. 2008. Purification and characterization of poly(L lactic acid) degrading enzymes from Amycolatopsis orientalis ssp. ori entalis. FEMS Microbiol Lett 282: 52 58.

PAGE 115

115 92. Li, S. M., A. El Ghzaoui, and E. Dewinck. 2005. Rheology and drug release properties of bioresorbable hydrogels prepared from polylactide/poly(ethylene glycol) block copolymers. Macromol Symp 222: 23 35. 93. Li neweaver, H., and D. Burk. 1934. The Determination of Enzyme Dissociation Constants. Journal of the American Chemical Society 56: 658 666. 94. Lithner, D., J. Damberg, G. Dave, and K. Larsson. 2009. Leachates from plastic consumer products -screening for t oxicity with Daphnia magna. Chemosphere 74: 1195 1200. 95. Lithner, D., I. Nordensvan, and G. Dave. 2012. Comparative acute toxicity of leachates from plastic products made of polypropylene, polyethylene, PVC, acrylonitrile butadiene styrene, and epoxy to Daphnia magna. Environmental science and pollution research international 19: 1763 1772. 96. Lockwood, L. B., D. E. Yoder, and M. Zienty. 1965. Lactic acid. Annals of the New York Academy of Sciences 119: 854 867. 97. Low, K. B. 1972. Escherichia coli K 12 F prime factors, old and new. Bacteriol Rev 36: 587 607. 98. Lunt, J. 1998. Large scale production, properties and commercial applications of polylactic acid polymers. Polymer Degradation and Stability 59: 145 152. 99. Lynch, A. S., and E. C. Lin. 1996. T ranscriptional control mediated by the ArcA two component response regulator protein of Escherichia coli: characterization of DNA binding at target promoters. J Bacteriol 178: 6238 6249. 100. MacDonald, R. T., S. P. McCarthy, and R. A. Gross. 1996. Enzymat ic degradability of poly(lactide): Effects of chain stereochemistry and material crystallinity. Macromolecules 29: 7356 7361. 101. Makino, K., M. Arakawa, and T. Kondo. 1985. Preparation and Invitro Degradation Properties of Polylactide Microcapsules. Chem Pharm Bull 33: 1195 1201. 102. Markets and Markets.com 2011, posting date. Global Lactic Acid & Poly Lactic Acid (PLA) Market by Raw Materials, Types, Applications and Potential Opportunities (Forecast to 2016). http://www.marketsandmarkets.com/Market Rep orts/polylacticacid 387.html. 103. Masaki, K., N. R. Kamini, H. Ikeda, and H. Iefuji. 2005. Cutinase like enzyme from the yeast Cryptococcus sp. strain S 2 hydrolyzes polylactic acid and other biodegradable plastics. Appl Environ Microbiol 71: 7548 7550.

PAGE 116

116 104. Mat Jan, F., K. Y. Alam, and D. P. Clark. 1989. Mutants of Escherichia coli deficient in the fermentative lactate dehydrogenase. J Bacteriol 171: 342 348. 105. Mayumi, D., Y. Akutsu Shigeno, H. Uchiyama, N. Nomura, and T. Nakajima Kambe. 2008. Identif ication and characterization of novel poly(DL lactic acid) depolymerases from metagenome. Appl Microbiol Biotechnol 79: 743 750. 106. Mehta, R., V. Kumar, H. Bhunia, and S. N. Upadhyay. 2005. Synthesis of Poly(Lactic Acid): A Review. 45: 325 349. 107. M iller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory. 108. Miller, R. E., and E. R. Stadtman. 1972. Glutamate synthase from Escherichia coli. An iron sulfide flavoprotein. J Biol Chem 247: 7407 7419. 109. Nakamura, K., T. Tom ita, N. Abe, and Y. Kamio. 2001. Purification and characterization of an extracellular poly(L lactic acid) depolymerase from a soil isolate, Amycolatopsis sp. strain K104 1. Appl Environ Microbiol 67: 345 353. 110. Narayan, R. 2006. Biobased and Biodegrada ble Polymer Materials: Rationale, Drivers, and Technology Exemplars, p. 282 306, Degradable Polymers and Materials, vol. 939. American Chemical Society. 111. Narayanan, N., P. K. Roychoudhury, and A. Srivastava. 2004. L (+) lactic acid fermentation and it s product polymerization. Electronic Journal of Biotechnology 7: 167 178. 112. NatureWorks LLC 2005, posting date. Buy back Program, http://www.natureworksllc.com/the ingeo journey/end of life options/feedstock recycling/buy%20back%20program. 113. Nishimu ra, Y., I. K. P. Tan, Y. Ohgami, K. Kohgami, and T. Kamihara. 1983. Induction of membrane bound L lactate dehydrogenase in Escherichia coli under conditions of nitrate respiration, fumarate reduction and trimethylamine N oxide reduction. Fems Microbiology Letters 17: 283 286. 114. Noda, M., and H. Okuyama. 1999. Thermal Catalytic Depolymerization of Poly(L Lactic Acid) Oligomer into LL Lactide: Effects of Al, Ti, Zn and Zr Compounds as Catalysts. Chem. Pharm. Bull. 47: 467 471. 115. Nunez, M. F., O. Kwon, T H. Wilson, J. Aguilar, L. Baldoma, and E. C. Lin. 2002. Transport of L Lactate, D Lactate, and glycolate by the LldP and GlcA membrane carriers of Escherichia coli. Biochem Biophys Res Commun 290: 824 829. 116. O' Brien, W. G., L. A. Cariello, and T. F. Wells. 1996. Integrated process for the manufacture of lactide. USA.

PAGE 117

117 117. Overbeek, R., T. Begley, R. M. Butler, J. V. Choudhuri, H. Y. Chuang, M. Cohoon, V. de Crcy Lagard, N. Diaz, T. Disz, R. Edwards, M. Fonstein, E. D. Frank, S. Gerdes, E. M. Glass, A. Goesmann, A. Hanson, D. Iwata Reuyl, R. Jensen, N. Jamshidi, L. Krause, M. Kubal, N. Larsen, B. Linke, A. C. McHardy, F. Meyer, H. Neuweger, G. Olsen, R. Olson A. Osterman, V. Portnoy, G. D. Pusch, D. A. Rodionov, C. Rckert, J. Steiner, R. Stevens, I. Thiele, O. Vassieva, Y. Ye, O. Zagnitko, and V. Vonstein. 2005. The Subsystems Approach to Genome Annotation and its Use in the Project to Annotate 1000 Genomes. Nucleic Acids Research 33: 5691 5702. 118. Ovitt, T. M., and G. W. Coates. 1999. Stereoselective ring opening polymerization of meso lactide: Synthesis of syndiotactic poly(lactic acid). Journal of the American Chemical Society 121: 4072 4073. 119. Pascal M. C., and F. Pichinoty. 1965. Regulation of the biosynthesis and function of D and L lactate dehydrogenases in Aerobacter aerogenes. Biochim Biophys Acta 105: 54 69. 120. Pascal, M. C., J. Puig, and M. Lepelletier. 1969. Genetic study of a mutation aff ecting lactate dehydrogenase activity in Escherichia coli K 12. C R Acad Sci Hebd Seances Acad Sci D 268: 737 739. 121. Pelouze, J. 1845. Synthesis of low molecular weight polylactic. J. Chem. Pharm. 53: 112 124. 122. Perego, G., G. D. Cella, and C. Bastio li. 1996. Effect of molecular weight and crystallinity on poly(lactic acid) mechanical properties. Journal of Applied Polymer Science 59: 37 43. 123. Pinchuk, G. E., D. A. Rodionov, C. Yang, X. Li, A. L. Osterman, E. Dervyn, O. V. Geydebrekht, S. B. Reed, M. F. Romine, F. R. Collart, J. H. Scott, J. K. Fredrickson, and A. S. Beliaev. 2009. Genomic reconstruction of Shewanella oneidensis MR 1 metabolism reveals a previously uncharacterized machinery for lactate utilization. Proc Natl Acad Sci U S A 106: 2874 2879. 124. Plasticseurope 2010, posting date. http://www.plasticseurope.org/information centre/press room 1351/press releases 2012/first estimates suggest around 4 increase in plastics global production from 2010.aspx. 125. Platt, D. K., and R. T. Limit ed. 2006. Biodegradable Polymers: Market Report. Rapra Technology. 126. Pon, L. A., and E. A. Schon. 2007. Methods in Cell Biology: Mitochondria. 127. Pranamuda, H., Y. Tokiwa, and H. Tanaka. 1997. Polylactide Degradation by an Amycolatopsis sp. Applied and Environmental Microbiology 63: 1637 1640.

PAGE 118

118 128. Pranamuda, H., A. Tsuchii, and Y. Tokiwa. 2001. Poly (L lactide) degrading enzyme produced by Amycolatopsis sp, vol. 1. Wiley VCH, Weinheim, ALLEMAGNE. 129. Pratt, E. A., L. W. Fung, J. A. Flowers, and C. Ho. 1979. Membrane bound D lactate dehydrogenase from Escherichia coli: purification and properties. Biochemistry 18: 312 316. 130. Rajgarhia, V., C. A. Dundon, S. Olson, P. Suominen, and B. Hause. 2003. Methods and Materials for the production of D Lactic acid in yeast. United States. 131. Rule, G. S., E. A. Pratt, C. C. Chin, F. Wold, and C. Ho. 1985. Overproduction and nucleotide sequence of the respiratory D lactate dehydrogenase of Escherichia coli. J Bacteriol 161: 1059 1068. 132. Rustagi, N., S. K. Pradhan, and R. Singh. 2011. Public health impact of plastics: An overview. Indian journal of occupational and environmental medicine 15: 100 103. 133. Sakai, K., H. Kawano, A. Iwami, M. Nakamura, and M. Moriguchi. 2001. Isolation of a thermophilic poly L lactide degrading bacterium from compost and its enzymatic characterization. J Biosci Bioeng 92: 298 300. 134. Sakai, K., H. Kawano, A. Iwami, M. Nakamura, and M. Moriguchi. 2001. Isolation of a thermophilic poly l lactide degrading bacterium from compost and its enzymatic characterization. Journal of Bioscience and Bioengineering 92: 298 300. 135. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning. A laboratory manual second edition vols 1, 2 and 3. Sambrook, J., E. F. Fritsch and T. M aniatis. Molecular Cloning: a Laboratory Manual, Second Edition, Vols. 1, 2 and 3. Xxxix+Pagination Varies(Vol. 1); Xxxiii+Pagination Varies(Vol. 2): Xxxii+Pagination Varies(Vol. 3) Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, USA. Il lus. Paper. 136. Sangwan, P., and D. Y. Wu. 2008. New insights into polylactide biodegradation from molecular ecological techniques. Macromol Biosci 8: 304 315. 137. Sartorius, I. 2005. Biodegradable Plastics in the Social and Political Environment, Biopo lymers Online. Wiley VCH Verlag GmbH & Co. 138. Sawai, D., Y. Tsugane, M. Tamada, T. Kanamoto, M. Sungil, and S. H. Hyon. 2007. Crystal density and heat of fusion for a stereo complex of poly(L lactic acid) and poly(D lactic acid). J Polym Sci Pol Phys 45 : 2632 2639. 139. Seppala, J., J. F. Selin, and S. Tao. 1995. Method for producing lactic acid based polyurethane. United States.

PAGE 119

119 140. Shigeno, Y., T. Teeraphatpornchai, K. Teamtisong, N. Nomura, H. Uchiyama, T. Nakahara, and T. Kambe. 2003. Cloning and s equencing of a poly(DL lactic acid) depolymerase gene from Paenibacillus amylolyticus strain TB 13 and its functional expression in Escherichia coli. Appl Environ Microbiol 69: 2498 2504. 141. Sinclair, R. G. 1996. The Case for Polylactic Acid as a Commodi ty Packaging Plastic. Journal of Macromolecular Science, Part A 33: 585 597. 142. Sinclair, R. G., R. A. Markle, and R. K. Smith. 1992. Chemistry and production of lactic acid lactide and poly lactic. U.S.A. 143. Siparsky, G. L., K. J. Voorhees, and F. Mi ao. 1998. Hydrolysis of Polylactic Acid (PLA) and Polycaprolactone (PCL) in Aqueous Acetonitrile Solutions: Autocatalysis. Journal of Polymers and the Environment 6: 31 41. 144. Sodergard, A., and M. Stolt. 2002. Properties of lactic acid based polymers an d their correlation with composition. Progress in Polymer Science 27: 1123 1163. 145. Spinu, M. 1993. L D polylactide copolymers with controlled morphology. United States. 146. Steinbchel, A., Y. Doi, and M. Hofrichter. 2002. Biopolymers, vol. 4. Wiley V CH. 147. Stoscheck, C. M. 1990. Quantitation of protein, p. 50 68. In P. D. Murray (ed.), Methods in Enzymology, vol. Volume 182. Academic Press. 148. Sukkhum, S., and V. Kitpreechavanich. 2011. New Insight into Biodegradation of Poly (L Lactide), Enzyme Production and Characterization, Progress in Molecular and Environmental Bioengineering From Analysis and Modeling to Technology Applications. 149. Sukkhum, S., S. Tokuyama, T. Tamura, and V. Kitpreechavanich. 2009. A novel poly (L lactide) degrading a ctinomycetes isolated from Thai forest soil, phylogenic relationship and the enzyme characterization. The Journal of general and applied microbiology 55: 459 467. 150. Sungsanit, K., N. Kao, S. N. Bhattacharya, and S. Pivsaart. 2010. Physical and rheologic al properties of plasticized linear and branched PLA. Korea Aust Rheol J 22: 187 195. 151. Takahashi, Y., S. Okajima, K. Toshima, and S. Matsumura. 2004. Lipase Catalyzed Transformation of Poly(lactic acid) into Cyclic Oligomers. Macromolecular Bioscience 4: 346 353. 152. Tarmy, E. M., and N. O. Kaplan. 1968. Chemical characterization of D lactate dehydrogenase from Escherichia coli B. J Biol Chem 243: 2579 2586.

PAGE 120

120 153. Tarmy, E. M., and N. O. Kaplan. 1968. Kinetics of Escherichia coli B D lactate dehydrogena se and evidence for pyruvate controlled change in conformation. J Biol Chem 243: 2587 2596. 154. Teuten, E. L., J. M. Saquing, D. R. Knappe, M. A. Barlaz, S. Jonsson, A. Bjorn, S. J. Rowland, R. C. Thompson, T. S. Galloway, R. Yamashita, D. Ochi, Y. Watanu ki, C. Moore, P. H. Viet, T. S. Tana, M. Prudente, R. Boonyatumanond, M. P. Zakaria, K. Akkhavong, Y. Ogata, H. Hirai, S. Iwasa, K. Mizukawa, Y. Hagino, A. Imamura, M. Saha, and H. Takada. 2009. Transport and release of chemicals from plastics to the envir onment and to wildlife. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 364: 2027 2045. 155. Thompson, R. C., C. J. Moore, F. S. vom Saal, and S. H. Swan. 2009. Plastics, the environment and human health: current co nsensus and future trends. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 364: 2153 2166. 156. Tian, Z., D. Chauliac, and P. Pullammanappallil. 2013. Comparison of non agitated and agitated batch, thermophilic anae robic digestion of sugarbeet tailings. Bioresource Technology 129: 411 420. 157. Tokiwa, Y., M. Konno, and H. Nishida. 1999. Isolation of Silk Degrading Microorganisms and Its Poly(L lactide) Degradability. Chem Lett 4: 355 356. 158. Tomita, K., Y. Kuroki, and K. Nagai. 1999. Isolation of thermophiles degrading poly(l lactic acid). Journal of Bioscience and Bioengineering 87: 752 755. 159. Tomita, K., Y. Kuroki, and K. Nagai. 1999. Isolation of thermophiles degrading poly(L lactic acid). J Biosci Bioeng 87: 752 755. 160. Tomita, K., T. Nakajima, Y. Kikuchi, and N. Miwa. 2004. Degradation of poly(l lactic acid) by a newly isolated thermophile. Polymer Degradation and Stability 84: 433 438. 161. Tomita, K., H. Tsuji, T. Nakajima, Y. Kikuchi, K. Ikarashi, and N Ikeda. 2003. Degradation of poly(d lactic acid) by a thermophile. Polymer Degradation and Stability 81: 167 171. 162. Truong, H. T., E. A. Pratt, and C. Ho. 1991. Interaction of the membrane bound D lactate dehydrogenase of Escherichia coli with phosphol ipid vesicles and reconstitution of activity using a spin labeled fatty acid as an electron acceptor: a magnetic resonance and biochemical study. Biochemistry 30: 3893 3898. 163. Tsuji, H., H. Daimon, and K. Fujie. 2003. A New Strategy for Recycling and Pr eparation of Poly(l lactic acid): Hydrolysis in the Melt. Biomacromolecules 4: 835 840.

PAGE 121

121 164. Tsuji, H., and I. Fukui. 2003. Enhanced thermal stability of poly(lactide)s in the melt by enantiomeric polymer blending. Polymer 44: 2891 2896. 165. Tsuji, H., S. H. Hyon, and Y. Ikada. 1992. St ereocomplex Formation between Enantiomeric Poly(Lactic Acid) .5. Calorimetric and Morphological Studies on the Stereocomplex Formed in Acetonitrile Solution. Macromolecules 25: 2940 2946. 166. Tsuji, H., S. H. Hyon, and Y. Ikada. 1991. Stereocomplex Format ion between Enantiomeric Poly(Lactic Acid)S .3. Calorimetric Studies on Blend Films Cast from Dilute Solution. Macromolecules 24: 5651 5656. 167. Tsuji, H., and Y. Ikada. 1998. Properties and morphology of poly(L lactide). II. Hydrolysis in alkaline soluti on. J Polym Sci Pol Chem 36: 59 66. 168. Tsuji, H., and Y. Ikada. 1993. Stereocomplex Formation between Enantiomeric Poly(Lactic Acid)S .9. Stereocomplexation from the Melt. Macromolecules 26: 6918 6926. 169. Tsuji, H., Y. Ikada, S. H. Hyon, Y. Kimura, and T. Kitao. 1994. Stereocomplex Formation between Enantiomeric Poly(Lactic Acid) .8. Complex Fibers Spun from Mixed Solution of Poly(D Lactic Acid) and Poly(L Lactic Acid). Journal of Applied Polymer Science 51: 337 344. 170. Tsuji, H., K. Nakahara, and K. Ikarashi. 2001. Poly(L lactide), 8 High temperature hydrolysis of poly(L lactide) films with different crystallinities and crystalline thicknesses in phosphate buffered solution. Macromol Mater Eng 286: 398 406. 171. Tsuji, H., T. Saeki, T. Tsukegi, H. D aimon, and K. Fujie. 2008. Comparative study on hydrolytic degradation and monomer recovery of poly(l lactic acid) in the solid and in the melt. Polymer Degradation and Stability 93: 1956 1963. 172. Tsukegi, T., T. Motoyama, Y. Shirai, H. Nishida, and T. E ndo. 2007. Racemization behavior of l,l lactide during heating. Polymer Degradation and Stability 92: 552 559. 173. Vert, M., G. Schwarch, and J. Coudane. 1995. Present and Future of PLA Polymers. Journal of Macromolecular Science, Part A 32: 787 796. 174. Vink, E. T. H., K. R. Rabago, D. A. Glassner, and P. R. Gruber. 2003. Applications of life cycle assessment to NatureWorks (TM) polylactide (PLA) production. Polymer Degradation and Stability 80: 403 419. 175. Vink, E. T. H., K. R. Rabago, D. A. Glassner, B. Springs, R. P. O'Connor, J. Kolstad, and P. R. Gruber. 2004. The sustainability of NatureWorks (TM) polylactide polymers and Ingeo (TM) polylactide fibers: an update of the future. Macromolecular Bioscience 4: 551 564.

PAGE 122

122 176. Wada, M., T. Oikawa, D. Moch izuki, J. Tokuda, M. Kawashima, T. Araki, R. Abe, H. Miyake, H. Takahashi, H. Sawai, T. Mimizuka, T. Morishige, and Y. Higashi. 2005. Biocatalysr for producing D Lactic acid. Japan. 177. Wang, N., J. G. Yu, and X. F. Ma. 2007. Preparation and characteriza tion of thermoplastic starch/PLA blends by one step reactive extrusion. Polym Int 56: 1440 1447. 178. Wanner, B. L. 1986. Novel regulatory mutants of the phosphate regulon in Escherichia coli K 12. J Mol Biol 191: 39 58. 179. Waste online 2011, posting dat e. Plastics recycling information sheet. http://dl.dropbox.com/u/21130258/resources/InformationSheets/Plastics.htm. 180. Weber, C. J. 2000. Biobased packaging materials for the food industry: status and perspectives : a european concerted action. KVL Depa rtment of Dairy and Food Science. 181. Wollman, E. L., and F. Jacob. 1957. [Processes of conjugation and recombination in Escherichia coli. II. Chromosomal location of phage lambda and genetic results of zygotic induction]. Annales de l'Institut Pasteur 9 3: 323 339. 182. www.futerro.com. 183. Yagihashi, M., and T. Funazukuri. 2009. Recovery of l Lactic Acid from Poly(l lactic acid) under Hydrothermal Conditions of Dilute Aqueous Sodium Hydroxide Solution. Ind Eng Chem Res 49: 1247 1251. 184. Yamaguchi, Y. and T. Arimura. 1996. Method for purification of lactide. United States. 185. Yang, M., S. M. Luoh, A. Goddard, D. Reilly, W. Henzel, and S. Bass. 1996. The bgIX gene located at 47.8 min on the Escherichia coll chromosome encodes a periplasmic glucosi dase. Microbiology 142: 1659 1665. 186. Zhang, J. F., and X. Z. Sun. 2004. Mechanical and thermal properties of poly(lactic acid)/starch blends with dioctyl maleate. Journal of Applied Polymer Science 94: 1697 1704. 187. Zhang, J. F., and X. Z. Sun. 2004. Physical characterization of coupled poly(lactic acid)/starch/maleic anhydride blends plasticized by acetyl triethyl citrate. Macromolecular Bioscience 4: 1053 1060. 188. Zheng, H., X. Wang, L. P. Yomano, K. T. Shanmugam, and L. O. Ingram. 2012. Increase i n furfural tolerance in ethanologenic Escherichia coli LY180 by plasmid based expression of thyA. Appl Environ Microbiol 78: 4346 4352.

PAGE 123

123 189. Zimmer, K. E., A. C. Gutleb, S. Ravnum, M. Krayer von Krauss, A. J. Murk, E. Ropstad, J. U. Skaare, G. S. Eriksen, J. L. Lyche, J. G. Koppe, B. L. Magnanti, A. Yang, A. Bartonova, and H. Keune. 2012. Policy relevant results from an expert elicitation on the health risks of phthalates. Environmental health : a global access science source 11 (Suppl. 1): S6. 190. Zwieter ing, M. H., I. Jongenburger, F. M. Rombouts, and K. van 't Riet. 1990. Modeling of the bacterial growth curve. Appl Environ Microbiol 56: 1875 1881. 191. Zwietering, M. H., F. M. Rombouts, and K. van 't Riet. 1992. Comparison of definitions of the lag phas e and the exponential phase in bacterial growth. J Appl Bacteriol 72: 139 145.

PAGE 124

124 BIOGRAPHICAL SKETCH Diane C hauliac earned her b achel or G r and es E gree in b iotechnology in 2007 from the University of Luminy at Marseilles, France. After working as a visitor scientist for Merck & Co (New Jersey, USA), Diane joined the doctoral program of the M icrobiolo gy and Cell Science D epartment at the U niversity of Florida in 2009 D. Chauliac has been the recipient of a scholarship since the start of her PhD While pursuing her degree, D. Chauliac worked as a teaching assistant for the department of microbiology and Cell Science during her first scholar year. Addit ionally, Diane helped three undergraduate students and three graduate students in t heir own researches, leading to publications independent of her PhD project ( 44 156 ) and an additional manuscript is under in the writing During her PhD, Diane was abl e to publish her work relating to the hydrolysis of PLA and Thermohydrolysis kinetics of PLA beads in aqueous solution