<%BANNER%>

Effects of Increased Maternal Cortisol on Maternal Metabolism and Fetal Development

Permanent Link: http://ufdc.ufl.edu/UFE0045317/00001

Material Information

Title: Effects of Increased Maternal Cortisol on Maternal Metabolism and Fetal Development
Physical Description: 1 online resource (138 p.)
Language: english
Creator: Feng, Xiaodi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: conduction -- cortisol -- development -- heart -- metabolism -- pregnancy
Pharmacodynamics -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Elevated maternal stress in late gestation can cause programming of fetal development. This programing can result from direct effects of cortisol on the fetus, or it can result from changes in maternal metabolism, which indirectly affects fetal growth. In my dissertation, experiments were designed to: 1) test direct effects of maternal cortisol on fetal heart development, especially the effects on cell apoptosis and the differential role of MR (mineralocorticoid receptor) and GR (glucocorticoid receptor); 2) investigate the effects of long-term infusion of cortisol in late gestation on maternal metabolic changes; and 3) investigate the effects of long-term infusion of cortisol on fetal growth. I found that infusion of cortisol from 120 to 130 days of gestation significantly increased cell apoptosis within the cardiac conductive system. This increase was likely mediated by GR. Apoptosis of cardiac conductive cells suggests possible re-programming of cardiac contraction. C-kit positive stem cells also underwent apoptosis with the infusion of cortisol, which might be associated with apoptosis of the cardiac conduction system.   Prolonged infusion of cortisol from 120 to ~142 days of gestation significantly increased maternal blood glucose concentrations, which were accompanied by impaired glucose tolerance. More than half of the cortisol infused ewes had stillborn fetuses, with significantly lower maternal uterine blood flow and significantly higher baseline insulin concentrations, suggesting that long-term cortisol infusion increases fetal mortality. Measurements of the fetus at the end of the study showed that infusion of cortisol significantly increased the ratio of the thickness of fetal septum relative to  tibial length, and increased the ratio of kidney weight to body weight. Also a gender difference in the heart size in offspring was noticed. Male offspring had a significantly higher ratio of the heart weight to body weight compared to that of female offspring in the control group.  In summary, in-vivo studies using an ovine model showed that infusion of cortisol from 120 to 130 days of  gestation increased cell apoptosis in the fetal cardiac conduction system and stem cells. Prolonged cortisol infusion increased the fetal death rate, which might be caused by the malfunction of the cardiac conduction system, or may be related to maternal insulin resistance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Xiaodi Feng.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Keller Wood, Maureen.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045317:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045317/00001

Material Information

Title: Effects of Increased Maternal Cortisol on Maternal Metabolism and Fetal Development
Physical Description: 1 online resource (138 p.)
Language: english
Creator: Feng, Xiaodi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: conduction -- cortisol -- development -- heart -- metabolism -- pregnancy
Pharmacodynamics -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Elevated maternal stress in late gestation can cause programming of fetal development. This programing can result from direct effects of cortisol on the fetus, or it can result from changes in maternal metabolism, which indirectly affects fetal growth. In my dissertation, experiments were designed to: 1) test direct effects of maternal cortisol on fetal heart development, especially the effects on cell apoptosis and the differential role of MR (mineralocorticoid receptor) and GR (glucocorticoid receptor); 2) investigate the effects of long-term infusion of cortisol in late gestation on maternal metabolic changes; and 3) investigate the effects of long-term infusion of cortisol on fetal growth. I found that infusion of cortisol from 120 to 130 days of gestation significantly increased cell apoptosis within the cardiac conductive system. This increase was likely mediated by GR. Apoptosis of cardiac conductive cells suggests possible re-programming of cardiac contraction. C-kit positive stem cells also underwent apoptosis with the infusion of cortisol, which might be associated with apoptosis of the cardiac conduction system.   Prolonged infusion of cortisol from 120 to ~142 days of gestation significantly increased maternal blood glucose concentrations, which were accompanied by impaired glucose tolerance. More than half of the cortisol infused ewes had stillborn fetuses, with significantly lower maternal uterine blood flow and significantly higher baseline insulin concentrations, suggesting that long-term cortisol infusion increases fetal mortality. Measurements of the fetus at the end of the study showed that infusion of cortisol significantly increased the ratio of the thickness of fetal septum relative to  tibial length, and increased the ratio of kidney weight to body weight. Also a gender difference in the heart size in offspring was noticed. Male offspring had a significantly higher ratio of the heart weight to body weight compared to that of female offspring in the control group.  In summary, in-vivo studies using an ovine model showed that infusion of cortisol from 120 to 130 days of  gestation increased cell apoptosis in the fetal cardiac conduction system and stem cells. Prolonged cortisol infusion increased the fetal death rate, which might be caused by the malfunction of the cardiac conduction system, or may be related to maternal insulin resistance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Xiaodi Feng.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Keller Wood, Maureen.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045317:00001


This item has the following downloads:


Full Text

PAGE 1

1 EF FECTS OF INCREASED MATERNAL CORTISOL ON MATERNAL METABOLISM AND FETAL DEVELOPMENT By XIAODI FENG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Xiaodi Feng

PAGE 3

3 To my dearest Mom and Dad for their unconditional love and support ; also to my lovely husband who have accompanied me through good and bad tim e s been very patient and constantly cheered me up.

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my committee chair, Maureen Keller Wood, for giving me the opportunity to learn under her guid ance. She has been a great mentor, with tremendous enthusiasm and insight into her field of research. Her success in both work and life is an inspiration for me. I would also like to thank Dr. Charles Wood, whose surgical expertise made the experimental de signs in this dissertation possible. His enthusiasm in his work is also an inspiration for me. Thanks a lot to my other committee mem bers, Dr. Katovich, Dr. Millard and Dr. Neu, for your great suggestion and support along my study. Thanks a lot to all the personnel in Keller Wood lab, present and past. Elaine Sumners deserves special mention for her advice, both research related and non research related.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAP TER 1 INTRODUCTION ................................ ................................ ................................ .... 15 Background ................................ ................................ ................................ ............. 15 Hydroxysteroid Dehydrogenase ................................ ................................ ................................ ... 16 Normal Maternal Fetal Interaction in Late Gestation ................................ .............. 18 Maternal Metabolism ................................ ................................ ........................ 19 Fetal Development ................................ ................................ ........................... 19 Glucocorticoid Exposure and Fetal Programming ................................ ................... 22 Glucocortic oid Exposure and Fetal Heart Development ................................ ......... 25 Novelty and Significance ................................ ................................ ......................... 28 2 METHODS ................................ ................................ ................................ .............. 30 Animal Use ................................ ................................ ................................ ............. 30 Surgical Procedures ................................ ................................ ............................... 30 Surgical Procedure 1 ................................ ................................ ........................ 30 Surgical Procedure 2 ................................ ................................ ........................ 31 Blood Sampling ................................ ................................ ................................ ....... 32 Uterine Blood Flow Measurement ................................ ................................ ........... 32 Plasma Volume Measurement ................................ ................................ ................ 32 Intravenous Glucose Tolerance Test (IVGTT) ................................ ........................ 34 Immunohistochemistry ................................ ................................ ............................ 34 Activated Caspase 3 Staining and Quantification ................................ ............. 34 Activated Caspase 3 and C kit Double Staining ................................ ............... 36 Neurofilaments Medium and Microtubule associated Protein 2 Staining .......... 36 Activated Caspase 3 and Periodic Acid Schiff Double Staining ....................... 37 Collagen Staining ................................ ................................ ............................. 37 Picture Analysis with ImageJ ................................ ................................ .................. 38 3 CORTISOL INCREASES CELL APOPT OSIS IN CARDIAC CONDUCTION SYSTEM IN LATE GESTATION ................................ ................................ ............. 40

PAGE 6

6 Introduction ................................ ................................ ................................ ............. 40 Materials and Methods ................................ ................................ ............................ 41 Experimental Design ................................ ................................ ........................ 41 Immunohistochemistry ................................ ................................ ...................... 42 Caspase 3 staining ................................ ................................ .................... 42 Double staining of caspase 3 and Neurofilament Medium or Microtubule associated protein 2 ................................ ............................ 43 Double staining of caspase 3 and periodic acid schiff ............................... 43 Double staining of caspase 3 and c kit ................................ ...................... 44 Results ................................ ................................ ................................ .................... 44 Cortisol Treatme nt Increases Apoptosis in the Fetal Sheep Heart ................... 45 Cortisol Induces Apoptosis in Purkinje Fibers ................................ .................. 46 Cortisol Induces Apoptosis i n Stem cell like Cells ................................ ............ 47 Discussion ................................ ................................ ................................ .............. 47 Role of Mineralocorticoid Receptor and Glucocortidoid Receptor in Glucocorticoid Program ming ................................ ................................ ......... 48 Apoptosis of Cardiac Stem Cells ................................ ................................ ...... 50 Apoptosis of Cardiac Conductive Cells ................................ ............................ 52 Clinical Perspective ................................ ................................ .......................... 53 4 CORTISOL REGULATES MATERNAL METABOLISM IN LATE GESTATION ...... 62 Introduction ................................ ................................ ................................ ............. 62 Materials and Methods ................................ ................................ ............................ 63 Experimental Design ................................ ................................ ........................ 63 Body Condition Scoring System ................................ ................................ ....... 64 Glucose Tolerance Test ................................ ................................ ................... 64 Results ................................ ................................ ................................ .................... 64 Cortisol Effects on Maternal Glucose Metabolism and Body Condition Scoring ................................ ................................ ................................ .......... 64 Cortisol Effects on Maternal Electrolytic Balance and Hemodynamics ............. 65 Intravenous Glucose Tolerance Test ................................ ................................ 65 Live Fetuses versus Stillborn Fetuses in the Cortisol Group ............................ 67 Discussion ................................ ................................ ................................ .............. 68 Cortisol Affects Maternal Metabolism and Causes Glucose Intolerance .......... 68 Cortisol and Electrolytes and Hemodynamics ................................ .................. 71 Stillborn versus Live Fetuses ................................ ................................ ............ 73 5 CORTISOL REGULATES FETAL GROWTH IN LATE GESTATION ..................... 94 Introduction ................................ ................................ ................................ ............. 94 Materials and Methods ................................ ................................ ............................ 95 Results ................................ ................................ ................................ .................... 96 Stillbir th Rate ................................ ................................ ................................ .... 96 Organ Weights ................................ ................................ ................................ 97 Body Length ................................ ................................ ................................ ..... 97 Heart Measurements ................................ ................................ ........................ 97

PAGE 7

7 Fibrosis in Fetal Hearts ................................ ................................ ..................... 98 mRNA Expression of Atrial natriuretic peptide (ANP), B type natriuretic peptide(BNP) and C type nat riuretic peptide (CNP) ................................ ...... 98 Discussion ................................ ................................ ................................ .............. 98 Fetal Stillbirth and Cardiac Measurements ................................ ....................... 99 Normal Fetal Heart Growth and Maturation ................................ .................... 101 Cortisol Effects on Fetal Heart in Late Gestation ................................ ............ 102 Gender C haracteristics of Cardiovascular Outcomes ................................ ..... 104 6 SUMMARY ................................ ................................ ................................ ........... 113 LIST OF REFERENCES ................................ ................................ ............................. 1 19 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 138

PAGE 8

8 LIST OF TABLES Table page 5 1a Number of ewes with live or stillborn lambs in the first part of the study ........... 107 5 1b Number of ewes with live or stillborn fetuses in the second part of the study ... 107 5 1c Total number of ewes with live or stillborn fetuses i n the study ........................ 107 5 2 Fetal somatic measurements (cm) ................................ ................................ ... 109 5 3 Number of male and female fetuses in both groups in current study ................ 111 5 4 Sequences of primer sets for ANP, BNP and CNP ................................ ........... 112

PAGE 9

9 LIST OF FIGURES Figure page 3 1 The nine diff erent layers of the fetal heart ................................ .......................... 56 3 2 Overall caspase 3 staining in fetal hearts ................................ ........................... 57 3 3 Caspase 3 staining in fetal hea rts showed a distribution pattern depending on the location ................................ ................................ ................................ .... 58 3 4 Identification of Purkinje fibers in the fetal heart ................................ ................. 59 3 5 Caspse 3 staining in Purkinje fibers ................................ ................................ ... 60 3 6 Detection of apoptosis in stem cells ................................ ................................ ... 61 4 1 Maternal plasma cortisol concentration over the experimental period ................ 76 4 2 Maternal plasma glucose concentration over the experimental period ............... 77 4 3 Maternal plasma insulin concentration over the experimental period ................. 78 4 4 Maternal plasma progesterone concentration over the experimental period ...... 79 4 5 Maternal plasma NEFA concentration over the experimental period .................. 80 4 6 Maternal plasma lactate concentration over the experimental period ................. 81 4 7 Maternal BCS scores over the experimental period ................................ ........... 82 4 8 Maternal PCV value over the experimental period ................................ ............. 83 4 9 Maternal plasma protein content over the experimental period .......................... 84 4 10 Maternal plasma volume at 120 days and 140 days of gestation in t he control and cortisol group s ................................ ................................ ................ 85 4 11 Maternal uterine blood flow over the experimental period ................................ .. 86 4 12 Maternal plasma glucose concentration during the IVGTT test in the control and cortisol groups ................................ ................................ ............................. 87 4 13 AUC of maternal plasma glucose during IVGTT between the control and cortisol groups ................................ ................................ ................................ .... 88 4 14 d value of glucose decay curve fitting during IVGTT between the control and cortisol groups ................................ ................................ ................................ .... 89

PAGE 10

10 4 15 Plasma insulin concentrations during GTT ................................ ......................... 90 4 16 Maternal plasma insulin during the experimental period ................................ ..... 91 4 17 Maternal plasma insulin concentration duringthe IVGTT test ............................. 92 4 18 Maternal uterine blood flow during the experimental period ............................... 93 5 1 Fetal organ weight per body weight ratio ................................ .......................... 108 5 2 Fetal heart thickness in left ventricle, septum and right ventricle ...................... 109 5 3 Wall thickness in fetal heart normalized by length of thetibia ........................... 110 5 4 Fetal heart weight to body weight ratio between male and female fe tuses of control ewes ................................ ................................ ................................ ..... 110 5 5 Fetal heart weight to body weight ratio of female fetuses of control and cortisol treated ewes ................................ ................................ ......................... 111 5 6 Fold change of mRNA expression of CNP relative to control group ................. 112

PAGE 11

11 LIST OF ABBREVIAT IONS HSD Hydroxysteroid dehydrogenase ACTH Adrenocorticotropic hormone AGA Appropriate for gestational age ANOVA Analysis of variance ANP Atrial natriuretic peptide AUC Area under the curve BCS Body condition scoring BID Bis In Die (twice a day) BNP B t ype natriuretic peptide BSA Bovine serum albumin CHF Chronic heart failure CRH Corticotropin releasing hormone CNP C type natriuretic peptide CRL Crown rump length DAB Diaminobenzidine EB Evans blue EMT Mesenchymal transition EPDC Epicardially derive d cells GLUT Glucose transporter GR Glucocorticoid receptor GTT Glucose tolerance test HPA AXIS Hypothalamic pituitary adrenal axis I.M. Intramuscular IDDM Insulin d ependent d iabetes m ellitus

PAGE 12

12 IGF Insulin like growth factor IGT Impaired glucose tolerance IUGR Intrauterine growth restriction IVGTT Intra venous glucose tolerance test LV Left ventricle MAP2 Microtubule associated protein 2 MMT Minimal model technique MR Mineralocorticoid receptor NBT/BCIP Nitro blue tetrazolium chloride/ 5 bromo 4 chloro 3' indolyphosphate p toluidine salt NEFA Non esterified fatty acid NFM Neurofilament m edium PAS Periodic Acid Schiff PBS Phosphate buffered saline PCV Packed cell volume PP Plasma protein RV Right ventricle SL Septum left SR Septum right UCP Unc oupling protein UPS Ubiquitin proteasome system

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECTS OF INCREASED MATERNAL CORTISOL ON MATERNAL METABOLISM AND FETAL DEVELOPMENT By Xiaodi Feng May 2013 Chair: Maureen Keller Wood Major: Pharmaceutical Sciences Pharmacodynamics Elevated maternal stress in late gestation can cause programming of fetal development. This programing can result from direct effects of cortisol on the fetus or it can result from changes in maternal metabolism, which indirectly affect s fetal growth. In my dissertation experiments were designed to : 1) test direct effects of maternal cortisol on fetal heart development, especially the effect s on cell apoptosis and t he different ial role of MR (mineralocorticoid receptor) and GR (glucocorticoid receptor) ; 2) investigate the effects of long term infusion of cortisol in late gestation on maternal metabolic changes; and 3) investigate the effects of long term infusion of cortisol on fetal growth. I found that infusion of cortisol from 120 to 130 days of gestation significantly increased cell a poptosis with in the cardiac conductive system. This increase was likely mediated by GR. Apoptosis of cardiac conductive cells suggests possible re programming of cardiac contraction. C kit positive stem cell s also underwent apoptosis with the infusion of c ortisol which might be associated with apoptosis of the cardiac conduction system. Prolonged infusion of cortisol from 120 to ~142 days of gestation significantly increased maternal blood glucose concentration s which were accompanied by impaired

PAGE 14

14 gluco se tolerance. More than half of the cortisol infused ewes had stillborn fetuses, with significantly lower maternal uterine blood flow and significantly higher baseline insulin concentration s suggesting that long term cortisol infusion increases fetal mort ality Measurements of the fetus at the end of the study showed that infusion of cortisol significantly increased the ratio of the thickness of fetal septum relative to tibia l length, and increased the ratio of kidney weight to body weight. Also a gender difference in the hear t size in offspring was noticed. M ale offspring had a significantly higher ratio of the heart weight to body weight compared to that of female offspring in the control group. In summary, in vivo studies using an ovine mo del showed that infusion of cortisol from 120 to 130 days of gestation increased cell apoptosis in the fetal cardiac conduction system and stem cells Prolonged cortisol infusion increased the fetal death rate, which might be caused by the malfunction of the cardiac conduction system or may be related to maternal insulin resistance.

PAGE 15

15 CHAPTER 1 INTRODUCTION Background Cortisol is a glucocorticoi d which is usually produced by the adrenal cortex in response to stress. Stimulating signals activate the hypothalamus to produce corticotropin releasing hormone (CRH), which travels to the pituitary to stimulate the production of a drenocorticotrop ic hormone ( ACTH ) ACTH e nters the circulation, and reaches the adrenal cortex, where it stimulates the production of cortisol. When the plasma cortisol concentration is above the normal range, the high level of cortisol send s signals to the hypothala mus and the pituitary to inhibit the secretion of cortisol, which is usually considered a cortisol negative feedback. Cohen (1958) observed a marked rise in plasma free cortisol levels in a normal woman throughout pregnancy, which was confirmed by later st udies (Burke and Roulet 1970; Cohen and others 1958; Goldberg and others 1966) Further investigation show ed that the plasma cortisol concentration in pregnant women increase s significantly from 12 weeks of gestat ion, to values approximately 3 5 times above non pregnant values (Beitins and others 1970; Lindner 1964; Wintour and others 1978) A two fold increase in cortisol concentration is observed in pregnant e wes (Barcikow ski Wood and others 1998; Lindner 1959) The normal increase of maternal plasma cortisol concentration before term raises the question: what does the cortisol increase do for normal pregnancy? Osler (1962) r maternal cortisol, resulted in intrauterine fetal growth retardation (Osler and Pedersen

PAGE 16

16 1962) This was later supported by O'Shaughnessy and other groups (Fux Otta and others 2008; O'Shaughnessy and Hackett 1984) On the other hand studies of ith excess cortisol production, revealed that abnormally high maternal cortisol concentration also retarded fetal growth and maturation (Buescher and others 1992) Additionally, an investigation among 477 singleton infants found that a repeated co urse of glucocorticoids in pregnant women before term le d to reduced birth weight and head circumference, providing further evidence that excessive glucocorticoid exposure in late gestation is associated with adverse effects on fetal size at birth (French and others 1999) It can be reasonably concluded that during pregnancy in humans, normal maternal cortisol concentrations have important implications for fetal growth. Similar conclusions were made in a ewe model of pregnancy (Keller Wood 1996; Newnham and others 1999; Sloboda and others 2000) Glucocorticoi d Receptor Mineralocorticoid Receptor and Hydroxysteroid D ehydrogenase Cortisol ha s two receptors, the glucocorticoid receptor ( GR) and the mineralocorticoid receptor ( MR). It is believed that GR is a more widely expressed receptor than MR, while the affinity of MR to major endogen ous glucocorticoids is higher than that of GR. As a result, the total binding to MR was saturated at a low corticosterone or cortisol concentration. This suggests that in physiological conditions when the hormone concentration is low, MR is the ma jor function ing receptor to mediate corticosteroid effects while in situations with high corticosteroid concentration, for example when the person is administered exogenous glucocorticoids or under

PAGE 17

17 stress, GR is more involved in the effects of glucocortic oids (Bradbury and others 1994; Reul and others 1987) Besides binding to endogenous glucocorticoids both MR and GR also bind endogenous mineralocorticoids including aldosterone. For GR, the affinity of binding to cortisol is much higher than that of aldosterone, so when both endogenous glucocorticoids and mineralocorticoids are present in the tissue GR is primarily occupied by the glucocorticoids The affinity of MR to cortisol and aldosterone is similar and the synthetic mineralocorticoids are selective for MR ; as a result, they compete to bind to MR In this situation, whether cortisol or corticosterone bind to MR is regulated by two enzymes, h ydroxysteroid dehydrogenase 1 ( HSD 1) and h ydroxysteroid dehydrogenase 2 ( HSD 2) Synthetic gluco corticoids and HSD s. HSD 1 is an enzyme that converts inactive cortisone into cortisol while HSD 2 has the opposite function and conv ert active cortisol in to inactive cortison e. The concentration of HSD 2 varies in different tissues. When the HSD 2 level is high, cortisol is mostly converted into cortisone, and MR is left to be occupied by mineralocorticoids This regulation happe ns typically in the kidney and other epithelia In the kidney activity of HSD 2 is very high, and most of the cortisol is converted to inactive cortisone. As a result, MR is occupied by aldosterone which maintains fluid volume balance (Stewart and Mason 1995) HSD2 is defective as in syndromes of apparent mineralocorticoid excess, cortisol binds to mineralocorticoid receptors and leads to hypertension (White and others 1997) A similar effect also occurs in the placenta The high concentration of HSD 2 in the placenta converts

PAGE 18

18 maternal cortisol into inactive cortiso ne which significantly reduces the amount of cortisol across placenta, and protect s the fetus from exposure to maternal glucocorticoids (Murphy and others 1974) Low concentrations of cortisol in the fetus are good for fetal HPA axis maturation as high level s of fetal cortisol could negatively inhibit the activity of the fetal hypothalamus and pituitary, which further reduces the stimulation of ACTH on fetal adrenal to promote its maturation. It was reporte d that offspring of mother s with syndrome have an increased risk of adrenal insufficiency, probably due to the high fetal cortisol exposure from the mother (Gop al and others 2012) However in the hippocampus of the brain, the concentration of HSD 2 is relative ly low, which leaves MR available to both cortisol and aldosterone. Since the concentration of cortisol is much higher than that of aldos terone (1 10nM versus 0.1M ) in hippocampus, MR is mostly occupied by cortisol (Richards and others 2003) Normal Maternal Fetal Interaction in Late Gestation Late gestation is a critical period for fetal growth and development. During the third trimester, the f etal lung matures structurally and functionally, with the production of surfactant to enable the first breath after delivery. Fetal liver enzymes are induced by glucocorticoids to initiate glucose accumulation and gluconeogenesis, preparing the liver to provide energy to the neonate Maturat ion in the f etal heart, kidney, gut, adrenal and adipose tissue mature also help newborn s cop e with the intra uterine to extra uterine transition (Fowden 1995; Fowden and others 1998a; Liggins 1994; Silve r 1990) These changes are considered to be an outcome of hormone interactions of which glucocorticoids play an important role

PAGE 19

19 Maternal Metabolism I n late gestation the normal increase of maternal cortisol production inhi bits the insulin pathway, partly by in activation of insulin receptor s and inhibition of Glut4 transport to the cell surface, which prevents up take of glucose by peripheral tissues Cortisol also increases the breakdown of muscle glycogen, and promotes liver gluconeogenesis As a result the plasma glucose concentration in the maternal blood is increased Cortisol also promotes the degradation of protein and triglyceride, and increases the blood concentration s of amino acid s and fatty acid s The maternal plasma glucose, amino acid s and f atty acid s are transported across the placenta and be used as fuel for fetal metabolism and tissue synthesis It was reported that in the ovine fetus, when the mother is maintained in an optimal nutritional situation, about 50% of fetal en ergy is from glucose, 25% is f rom amino acid, and 25% from other sources including lactate and acetate (Milley and Simmons 1979) Normal maternal cortisol concentrations also maintain the normal increase in plasma volume and uterine blood flow in late gestation (Jensen and others 2005) which are necessary to allow delivery of nutrient s from the mother to the fetus across the placenta (Hall and others 2001) Studies in pregnant women found that reduced plasma volume is associated with IUGR (Salas and others 1993) Fetal Development The fetus depends on maternal nutrients to maintain essential fetal growth In late gestation, fetal tissues undergo both accretion and differentiation, which is regulated by hor mones. Fetal hormones can be secreted by fetal endocrine glands, produced by the utero placenta unit, or derived from the mother. The key regulating

PAGE 20

20 hormones include insulin, insulin like growth hormones (IGFs) and cortisol (Fowden and Forhead 2004) Fetal insulin is produced by the fetal pancreas. Its concentration rises in early and middle gestati on and then becomes stable unti l term (Fowden and Hill 2001) Insulin is an anabolic hormone, which stimulates glucose uptake and protein synthesis, and promotes fetal growth. Insulin deprivation of the sheep fetus resulted in reduced daily increment of crown rump length (CRL) in late gestation, and reduced body weight, limb l ength and CRL at birth (Fowden and others 1989) indicating that insulin is an important fetal growth hormone. Studies s how that in both hypoinsulinemic and hyperinsulinemic fetuses, tissue differentiation appears to be normal in late gestation, sugges ting that insulin is more involved in tissue accretion than differentiation (Fowden and Forhead 2009a; Fowden and others 1998a) Like insulin, IGFs have anabolic effects and can stimulate fetal growth (Dunger and others 2007) Defects of IGF1 genes or IGF1 receptors are associated with low birth weight and head size (Abuzzahab and others 2003; Woods and others 1996) and treatment of IGF1 in growth restricted fetus es increased body weight (Fowden 2003) Meanwhile, over expression of IGFII in the Beckwith Wiedemann syndrome is associated with overgrowth of the fetus (Morison and others 1996) Deletion of the IGF1 receptor, which binds to both IGFI and IGFII, causes a great degree of growth retardation (Efstratiadis 1998) Besides their effects on accretion both IGFs are involved in cell differentiation as well, especially in late gestation when the fetal tissues including mus cle, bone, brain and adrenal mature to adapt to the extra uterine transition (Fowden and Forhead 2009a; 2009b)

PAGE 21

21 Cortisol is one of the few endogenous hormones that can cross the placenta Before the fetal adrenal is able to secret e cortisol, fetal cortisol comes from the mother down a maternal fetal concentration gradient, which is regulated by the placenta HSD 2. In fetal sheep, HSD 2 activity is around 2 pmol/min per mg protein in late gestation, and about 90% of the fetal cortisol is of maternal origin (Clarke and others 2002; Seckl 2001) Once the fetal adre nal is activated near term, the fetal adrenal cortex starts to produce cortisol and becomes the primary source of cortisol in fetal circulation (Fowden and others 1998b) It was believed that near term feta l cortisol surge is respons ible for the natural decrease in growth before delivery, as in late gestation fetal adrenalectomy significantly increased fetal birth weight and crown rump length ( CRL ) while exogenous cortisol infusion significantly decreased t he CRL increment (Fowden and others 1996) This is probably caused by the catab olic effects of glucocorticoids, which enhances breakdown of protein and adipose tissue, and activate endogenous glucose production. Besides restricting fetal accretion, cortisol also stimulates cell differentiation in various t issues in preparation for delivery. In the fetal lung cortisol matures the alveoli structure, promotes lung liquid re absorption and surfactant production, which prepares the fetus for breath after delivery. In the fetal liver, cortisol induces the expres sion of gluconeogenic enzymes, increases glycogen deposition and stimulates expression of s everal hormone receptors binding proteins and growth factors which help with the transition from fetal metabolism to adult metabolism. In the adrenal, cortisol in duces expression of ACTH receptors and matures the fetal HPA axis (Fowden and oth ers 1998a)

PAGE 22

22 Cortisol can interact with both insulin and IGFs in the fetus during late gestation. It inhibits pancreatic beta cell development and insulin content in cultured cells. It also blocks the insulin signaling pathway. Cortisol can regulate e xpression of IGFI and IGFII in various fetal organs, including liver, muscle and adrenal, and achieves tissue specific effects. Generally, cortisol initiate s a switch from a fetal growth pattern to an adult growth pattern by decreasing expression of IGFII, and increasing expression of IGFI and growth hormone (GH) receptor in the fetal liver (Fowden and Forhead 2009a) Glucocorticoid Exposure and Fetal Programming The positive effects of cortisol on normal fetal development in late gestation were applied to medical practice It was reported the maternal cortisol in late gestation promotes surfactant production in the fetal lung (DeLemos and others 1970) as a result, glucocorticoids were given to the mother to promote fetal lung maturation for pre term delivery. Since Liggins started t he clinical tr ial in 1970s, peri natal glucocorticoids have now became a standard treatment to prevent respiratory distress syndromes (1995 1995; Jobe and Soll 2004; Liggins and Howie 1972) It was reported that repeated dose s of glucocorticoids reduces the occurrence and s everity of neonatal lung distress and increases survival ability in the first few weeks of life (Crowther and Harding 2007) Besides the beneficial roles of cortisol in pregnancy, abnormally high maternal cortisol levels have adverse effects on fetal growth, as observed in mother s with (Buescher and others 1992; Howlett and others 1985) Maternal stress is another cause for higher than normal cortisol level s It w as reported that pregnant women exposed to extreme heat stress especially in the second and third trimester had low birth weight babies (Deschenes 2009; O 2009) A Perceived Stress

PAGE 23

23 Scale measurement of 865 pregnant women showed that maternal distress is directly associated with intrauterine growth retardation ( IUGR) and gestational age at delivery (Rond and others 2003) Although the intrauterine growth retardation could usually be mitigat ed by postnatal catch up growth, studies show that the low birth weight is associated with subsequent risk of hypertension, insulin resistance, altered HP A axis function, behavior and cardiac metabolic disorders in adult lives of offspring (Barker 1998; Barker and others 1993a; Davis and others 2011a; Fujioka and others 2006; Gluckman and others 2005; Kapoor and Matth ews 2008; O'Regan and others 2004; Ravelli and others 1998; Talge and others 2007) Th e correlation between intrauterine fetal growth and adult onset diseases has been referred to as It is believed that during the period of rapid fetal growth, organs mature in a critical period, and failure of maturation due to an adverse intrauterine environment might cause irreversible alterations in tissue structure and functions. These fetal adaptions might be beneficial at the ti me of insult but may amplify and permanently alter metabolism through adult life (Barker and Fall 1993; Waterland and Garza 1999) Besides mental stress, administration of stress hormone s influences intrauterine fet al growth. Reinisch found that p rednisone treatment for infertility in women caused significantly lower birth weight of full term babies, and a parallel mice experiment showed that this decrease is associated with glucocort icoid exposure (Reinisch and others 1978) Animal experiments revealed that repeated glucocorticoids treatment, either dexamethas one or betamethasone, resulted in reduced birth weight (Bloom and others 2001) and predisposition of hypertension, glucose intolerance, insulin resistance, renin angiotensin system disorder and HPA axis malfunction (Fowden an d others 1995;

PAGE 24

24 Ortiz and others 2003) These studies raised concerns regarding the perinatal treatment with glucocorticoids, especially those widely used to promote fetal lung maturation for pre term delivery A 14 year follow up of offspring with per inatal single course betamethasone treatment (24mg, divided by 2 days) showed that adults with betamethasone treatment and low birth weight had increased systolic and diastolic blood pressure in their postnatal lives compared to those with no perinatal glu cocorticoids treatment (Doyle and others 2000) Another study revealed that the same dose of betamethas one treatment (two doses of 12mg /dose, 24 hours apart) caused increased plasma cortisol response to he e l stick blood draw in the offspring implying that their HPA axis function is programmed by the glucocorticoid treatment (Davis and others 2011b) However one 30 y ear follow up study by Dalziel demonstrated that a single course of betamethasone treatment to pregnant women resulted in no differences in cognitive function, memory, and life quality in the offspring compared to no treatment control He also demonstrated that there were no differences in blood pressure, blood cortisol levels, lipid levels, diabetes or cardiac disease history in the offspring with betamethasone treatment compared to no treatment control The different results of those studies might be caus ed by different selection of patients. In Dalziel etamethasone treatment varies from one dose of 6mg to two dose s of 12mg, while in the other two stud ies, betamethasone treatment s were constantly two doses of 12mg. The inclusion of low dose treat ments might result in the difference s between treated and non treated groups not detectable However, Dalziel did report that the oral glucose tolerance test (GTT) was altered in the glucocorticoid treated offspring suggesting that pren atal glucocorticoids exposure might

PAGE 25

25 cause glucose intolerance and insulin resistant in adult life (Dalziel and others 2005a; Dalziel and others 2005b) Another two year follow up of a randomized, controlled trial sh owed that despite some reduced measurements of body weight and growth at birth no significant differences were found in body size, blood pressure, respiratory morbidity, or behavior scores at two year s of age between the control children and children expo sed to prenatal betamethasone although children exposed to repeat doses of corticosteroids were more likely to have attention problem s (Crowther and others 2007; Crowther and Harding 2007) The latest Cochrane revi ew on the use of repeat doses of prenatal corticosteroid supported its immediate benefits including a 17% reduction of respiratory distress and a 16% reduction in morbidity in the first week of neonates, with no significant ha rm in early childhood (McKinlay and others 2012) However, trials included in this review ha d a follow up at only 2 to 3 years of age, and some cardiovascular or metabolic dysfunction caused by glucocorticoids treatment might need a longer time to appear Glucocorticoid Exposure and Fetal Heart Development Previous studies reported that in a n ovine model of continuous exogenous cortisol infusion fetal heart g rowth was significantly increased, without an increase of the fetal blood pressure (Jensen and others 2005) This implies that cortisol may directly modulate growth of the fetal heart instead of indir ectly working through changes in hemodynamics. Direct infusion of cortisol into the fetal circumflex coronary artery also increased heart weight and heart weight to body weight ratio, without changes of hemodyna mic effects, further proving that glucocorticoids have direct effects on fetal heart development (Giraud and others 2006) In an ovine model used in this laboratory in which maternal cortisol concentration is increased to a concentration comparable to

PAGE 26

26 that caused by mild stress, overall fetal growth was slow ed but fetal heart weight, wall thickness and heart weight to body weight ratio were significantly increas ed, without changes in fetal blood pressure. This cortisol induced heart enlargement can be completely blocked by infusion into the intra pericardial space of a mineralocorticoid receptor (MR) antagonist, and was partially blocked by the intrapericardial infusion of a glucocor ticoid receptor (GR) antagonist. This further confirms that corticosteroids directly affect fetal heart growth, which c an be reg ulated by the two corticosteroid receptors, MR and GR (Reini and others 2008) Further investigation found that in cortisol treated fetal hearts, Ki67 expression is significantly increased, suggesting that heart enlargement is caused by increased cell proliferation (dat a not published) The correlation between intra uterine environment and fetal heart development was noticed a long time ago (Rueda Clausen and others 2011b) Early in 1980s, i t was reported the people with low birth weight small head circumference and low ponderal index (weight/length 3 ) had higher blood pressure and a higher risk of coronary disease death (Barker and others 1989; Barker and others 1993b) Animal experiments showed that this correlation could be due to the increased fetal exposure to maternal glucocorticoids, as d examethasone treatment in pregnant ra ts caused decreased birth weight and increased blood pressure in the offs pring (Benediktsson and others 1993) Similarly in a study using pregnant rats, i nhibition of HSD 2 caused a significant increase of blood pressure in the offspring (Lindsay and others 1996) As a in late gestation promotes fetal tissue maturation to prepare for extra uterine life (Fowden 1995) Exposure to high concentration s of cortisol interrupts the timing of fetal cardiac maturation, which might

PAGE 27

27 cause the programming of adult cardiovascular diseases. In a ewe model of fetal circumflex coronary artery infusion, cortisol treatment significantl y increased fetal heart weight and heart weight to body weight ratio, with no changes of c ardiomyocyte dimensions and binucleation percentage. However, expression of Ki67 is significantly increased in the ventricle walls when compared to the control group, indicating that more cardiomyocytes entered the cell cycle (Giraud and others 2006) Another study in a rat model showed that maternal infusion of dexamethasone significantly decreased fetal cardiac noradrenergic innervation as measured by noradrenergic level and turnover. Th is adverse effect of prenatal glucocorticoids was dose dependent, and persisted in young adulthood (Bian and others 1993) Similarly, another study in fetal sheep found that cortisol infusion significantly decreased glucos e transporter Glut 1 mRNA expression in the left ventricle, and significantly increased the expression of angiotensinogen mRNA in both ventricles (Lumbers and others 2005) In cultured rat embryonic cardiomyocyte cells, dexamethasone treatm ent significantly increased cell size and hypertrophic markers, which is blocked by a GR antagonist or a short hairpin mediated GR depletion (Ren and others 2012) The effects of prenatal glucocorticoids on cardiac development are considered dose dependent. For example, the fetal cardiac myosin heavy chain expression normally undergoes a beta MHC to alpha MHC transition from late gestatio n to early postnatal age. Bian found that a low dose of dexamethasone infusion (0.05 mg/kg) significantly promoted alpha MHC expression without inhibiting body or heart growth, while the higher doses (0.2 mg/kg or 0.8 mg/kg) f ailed to increase alpha MHC

PAGE 28

28 expression or caused biphasic changes, with s igns of growth inhibition (Bian and others 1992) Novelty and Significance My study used an ovine model to study the effects of the maternal stress hormone, cortisol, on fetal develop ment. The e we is a good animal model for human pregnancy, because they have single or twin fetuses, a long gestation period (approximately 145 days) and the fetal growth in late pregnancy has a similar pattern as in human In both ewe s and human s cardiomyocyte maturation begins in late gestation of pregnancy, which makes it a good model for human cardiac development (Botting and others 2012) S ince ewes are big animals, they also allow more complicated procedures and experiments compared to small animals. In most animal experiments and human retrospective studies the glucocorticoids use d are synthetic steroids mostly betamethasone or dexamethasone. In contrast, in my study, we used cortisol. Cortisol is the endo geno us glucocorticoid which mimics the natural stress response better than synthetic glucocorticoids. It was proposed that the endogenous glucocorticoid and synthetic glucocorticoids might have different effects on the fetus, because endogenous glucocorticoi d s like co rtisol can bind to both MR and GR, while synthetic glucocorticoids preferably target GR. In some tissues with abundant amount of both MR and GR, for example the fetal heart, cortisol and synthetic glucocorticoids might have very different effects In addition the ability to cross the placenta barrier, the CBG binding percentage and clearance are different between the endogenous and synthetic glucocorticoids, making cortisol a better analogue for maternal stress (Singh and others 2012)

PAGE 29

29 Most importantly, in my study, we investigated t he effects of cortisol on the fetal cardiac cell apoptosis. There have been many experiments studying the proliferative effects of glucocorticoids on fetal hearts, but very few of them studied cell apoptosis. Glucocorticoids promote cell differentiation an d tissue maturation in late gestation, in which cell apo ptosis plays an important role. In my study, I focused on the apoptotic effects of cortisol on the cardiac conduction system and stem cells, which are two types of cells that have not been previously studied in the context of corticosteroid action on the fetal heart.

PAGE 30

30 CHAPTER 2 METHODS Animal Use Ewes with singleton or twin pregnancies were studied. All animal use was approved by the University of Florida Institutional Animal Care and Use Committee and conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Surgical Procedures Surgical Procedure 1 Pregnant sheep at 118 123d of gestation age were randomly assigned to one of four groups. The first group consisted o f control ewes infused with saline (control group); the second group consisted of ewes continuously infused with cortisol (hydrocortisone hemisuccinate ; Sigma, ; cortisol group); the third group consisted of ewes with infusion of cortiso l and infusion of the MR antagon ist potassium canrenoate (Sigma, e fetus (cortisol+ MRa group); the fourth group consisted of ewes with infusion of cortisol and infusion of the GR antagonist mifepriston directly into the pericardial space of the fetus ( cortisol+GRa group ) Surgeries were performed at 118 123 days of gestation as described. Pregnant sheep were anesthetized with 1.5% 2.5% halothane. Catheters were placed in the matern al femoral veins and arteries. The f etal femoral tibial artery and amniotic space were also catheterized as described before (Wood et al 1983, Jensen et al 2002a). Fetal pericardial catheters were placed for delivery of the drugs as described before (Reini and others 2008; Wood 2002) All sheep were treated with flunixa

PAGE 31

31 i.m. ; Fort Dodge Animal Health, Fort Dodge, IA) at the end of surgery and in the morning of the next day. Webster Veterinary) was administered for 3 days after surger y. The infusion of cortisol (1 mg/kg per day c ortisol as cortisol hemisuccinate in normal saline; Sigma) or infusion of saline started after sheep were returned to the cages. Another dose of flunixamine was given on the morning after surgery, and ministered for 3 days after surgery. Sheep were studied for 10 days before eutha nization. During this period, sheep have access to water, food, and salt blocks ad libitum Surgical Procedure 2 Pregnant sheep at 115 day s of gestation age were randomly assi gned to control group (n=1 5 ) or cortisol group (hydrocortisone hemisucc inate; Sigma; 1mg/kg per day iv ; cortisol group; n= 15). Surgeries were performed at ~115 days of gestation to place fetal and maternal arterial and venous catheters and maternal ut erin e blood flow probe All sheep were treated with flunixiamine at the end of surgery and in the morning of the next day. Polyflex (500 mg i.m. bid ) was administered for 5 days after surgery. The infusion of cortisol started immediately after surge ry and ewes were studied until delivery In the first 3 ewes in the cortisol group, all of them had stillborn fetuses, while 5 ewes in control group had liveborn lambs (Table 5 1a) The e nd points of the study were changed after this observation. Ewes from both groups wer e euthanized at ~140 144 days of gestation before delivery, with an overdose of euthanasia solution containing pentobarbital During t he period of study, sheep have access to water, food, and salt blocks ad libitum

PAGE 32

32 Blood Sampling Maternal blood samples (8 9 ml each ) were taken immediately after walking into the room in the morning. Blood was drawn fr om femoral arterial catheters i nto a heparinized syringe for measurement of plasma electrolytes (AVL 9180 analyzer, Roche Instruments ), glucose (YSI 2300 glucose analyzer, Yellow Sp r ings, OH), plasma protein by refractometry and packed cell volume (PCV, measured with a capillary tube ). T he re maining plasma was stored at 20 C for analysis for plasma cortisol concentration (Coat a Count radioimmunossay, Siemens, Inc ). Six milliliters of the blood was collected into tubes containing EDTA (Vacutainer, Becton Dickinson); the plasma was aliquoted, and stored in 80 C for analysis of maternal insulin, progesterone, lactate and nonesterified free fatty acid concentrations Uterine Blood Flow Measurement A Doppler blood flow probe was placed around the main uterine artery of the pregnant horn of th e uterus and sutured in place. The probe cable was passed through the abdominal wall and under the skin to exit at the right flank. Uterine blood flow was measured using software from Transonic Instruments (Physiogear; Ithaca NY) using blue tooth techn ology. Uterine blood flow was measured for 30 min utes when the ewes were in a calm, non excited state every 5 days from 120 days till term or the end of the study. Plasma Volume Measurement Maternal plasma volume was measured using the dye dilution methods using Evans b lue ( EB, Sigma Aldrich, St Louis, MO). Evens blue is an azo dye which has very high affinity to serum albumin and stays in plasma. As a result it has been used to measure plasma volume since 1930s. Briefly, after a bolus injection of Evans blue, the

PAGE 33

33 utes to assess the Evans blue concentration at 0 min, which reflects the plasma volume. For each ewe, e ight milliliters of maternal blood was taken as a baseline sample. After that, a bolus injection of Eve ns Blue (5 mg/ml) was injected into maternal femoral vein. At 10, 15, 20, 25, 30, 35, 4 0 minutes after the injection. B lood samples (1.5 ml) were collected into tubes containing EDTA (50 l /ml blood of 0.4 M EDTA) to prevent coagulation. Concentrations of dye in each sample were determined by spectrometry absorbance at 610nm (blue color) and 4 20nm (red color) recorded by a plate reader (Jensen and others 2002a) In order to calculate plasma volume, for each animal, a standard curve was constructed using the Evans blue d ye and the maternal plasma from the baseline sample. Corrections for other colors in the ewe plasma were made using the 420 absorbance. The relationship between the 420 and 610 absorbance was fit to a line (Sigmplot, IBM, Armonk, NY) and best fit lines f or all animals were p ooled together to form equation 1. Baseline plasma from all animals without any Evans blue were used to determine the relationship between 420 and 610 absorbance in the absence of exogenous blue dye, in order to determine the sp illover of the yellow into the blue absorbance. The best fit line is equation 2. The 610nm absorbance value of the 10 40min plasma and standard diluted baseline plasma was corrected for the yellow color at 420 nm using the two equations. For each animal, w e assume that blue dye concentration decay in the plasma is a straight line since the plasma volume of the ewe is stable during the experiment. Using the standard curve of baseline plasma and regression of the EB concentration decay from 10 to 40 min utes w ill allow us to estimate the EB concentration at time 0, which is the time when ejected EB was evenly

PAGE 34

34 distributed in the maternal circulation but not degraded. The injected EB amount (g) divided EB concentration at 0 (min /ml) is the estimated maternal pl asma volume (ml). Intravenous Glucose Tolerance Test ( IV GTT) A n IVGTT was performed in the ewes at 131 133 days of gestation All tests were performed in the morning before feeding. Ew es were not fasted ; in ruminants it is not possible to fully empty the rumen with even 24h of fasting. A bolus injection of glucose (0.4 g glucose per kg body weight) was injected into the maternal femoral vein. Maternal blood (2.5 ml per sample) was collected at 5, 0, 2, 5, 10, 15, 20 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, and 180 min utes relative to the injection of glucose Maternal plasma glucose concentration was analyzed immediately after sampling, and the remaining plasma was s tored at 20 C to measure insulin concentr ation (ALPCO ovine insulin ELISA ). Immunohistochemistry At the time of necropsy a cross section of the fetal heart including left ventricle, right ventricle and septum was taken from each fetus or lamb and fixed in 4% buffered paraformaldehyde overnight. Heart section s were dehydrated in increasing concentrations of reagent alcohol, cleared in xylene, and embedded in paraffin wax Activated Caspase 3 Staining and Quantification Activated caspase 3 is a marker for cell apoptosis. 5 m thick sections were cut using a Zeiss rotary microtome and placed on poly L lysine coated slides Heart sections were warmed up in a slide warmer deparaffinized in xylene and rehydrated in decreasing concentrations of reagent alcohol from 100% to 0% using a standard protocol. Slides were then quenched in 0.3% hydrogen peroxide in methanol for 10 min utes to remove endogenous peroxidase activity. Antigen retrieval was performed

PAGE 35

35 with 0.1M sodium citrate buffer in water bath in microwave for 5 min utes S e ctions were then blocked with 5% goat serum in phosphate buffered saline ( PBS ) for 1 hour, incubated with activated caspase 3 antibody (1:500 dil ution in blocking buffer) for 2 hours at 4C, washed twice in PBS for 2 min utes and incubated with seco ndary antibody (1:500 dilution in 1% goat serum) for 1 hour After being washed twice with PBS sections were incubated with streptavidin conjugated horseradish peroxidase (1:200 dilution in 1% goat serum) for 10 min utes and t diaminobenzidine tetrahydrochloride (co DAB) for 10min. Sections were washed twice in deionized water for 2 min utes counterstained with methyl green for 20 min utes dehydrated in ETOH for 30 second s twice, cleared in xylene, and mounted with a cover slip. For the purpose of quantification, each heart section is divided into three different parts: left ventricle, septum, and right ventricle. Each part is further divided into 3 layers from epicardial to endocardial surf ace in the case of the left and right ventricular free walls As a result, each heart slide contains nine layers, from left ventricle to right ventricle, including lef t ventricle epicardial layer (L epi), myocar dial layer (L mid ) and endocardial layer (L e ndo), septum endocardial layer( L sep), myocardial layer (M sep )and endocardial layer( R sep ), right ventricle endocardial layer( R endo), myocardial layer (R mid )and epicardial layer(R epi), as shown in Figure 3 1 Five images at 100X were taken within each of the 9 heart layer s and analyzed using imageJ (Schneider and others 2012) On each imag e the area of activated caspase 3 positive nuclei and the area of heart tissue were measured, and the percentage of activa ted caspase 3 positive area per tissue area was calculated.

PAGE 36

36 Activated Caspase 3 and C kit Double Staining C kit is a marker for stem cells. Heart sections were first stained with activated caspase 3 as mentioned above, except that instead of DAB, heart section s were incubated with nitro blue tetrazolium chloride / 5 bromo 4 chloro 3' indolyphosphate p toluidine salt ( NBT/BCIP ) for 2.5 ho urs After that, slides were washed in deionized water for 2 min utes twice, blocked with 10% b ovine s erum a lbumin ( BSA) for 1 hour, incubated with c kit antibody (H300; 1:100 dilution in blocking buffer; Santa Cruz Biotechnology Inc Santa Cruz, Californ ia ) for 2 hours, biotinylated goat anti rabbit secondary antibody (1:200 dilution in 10% BSA; Jackson ImmunoResearch Laboratories, INC. West grove, PA) for 1 hour, and streptavidin conjugated horseradish peroxidase (1:200 dilution in 10% BSA; Thermo scie ntific, Rockford, IL) for 30 minutes. Slides were stained with Metal Enhanced DAB substrate Kit (Thermo scientific, Rockford, IL ) for 40 min utes washed twice in deionized water for 2min and counterstained with methyl green as mentioned above. Neuro f ilaments Medium and Microtubule associated Protein 2 Staining Neuro filaments medium (NFM) are intermediate filaments found in neurons. M icrotubule associated protein 2 (MAP2) is a neuro specific cytoskeletal protein. Before the staining, hea rt sections were bleached under the microscope light for 20 min utes using the 2 x objectives in order to eliminate tissue autoflu o rescence. Heart slides were then deparaffinized and rehydrated as mentioned above. Antigen retrieval was performed with 0.1M s odium citrate buffer in the microwave at high power for 5 min utes Slides were blocked with 5% goat serum for 1 hour, incubated with NFM or MAP2 (1:500 dilution in blocking buffer) for 1 hour, washed in PBS twice, incubated with AMCA conjugated goat anti c hicken IgG (1:500 dilution in 1% goat serum) for 1 hour,

PAGE 37

37 washed in PBS again, and blocked in sudan black (0.1% in 70% reagent alcohol) for 2 min utes After that, slides were washed in PBS, and covered with fluoromount Activated Caspase 3 and Periodic Acid Schiff Double Staining PAS (Periodic acid Schiff s reagent: Santa Cruz Biotechnol ogy Inc., Santa Cruz, California ) stains glycogen with a bright pink color, and in our study it is used to demark Purkinje fibers (Airey and others 2004) For the double staining, slides were first stained with activated caspase 3 following the protocol mentioned above, and then incubated with periodic acid for 5 min utes washed in deionized water 3 times, incu bated with utes and rinsed in tap water for at least 3 times until all the washing solution is not pink any more. Slides were then dehydrated gradually from 20% reagent alcohol to 100% reagent alcohol for 1 min at each concentra tion, cleared in xylene and cover slipped with permount. For quantification, photographs were taken at 100x magnification along the subendocardial area of left ventricle (LV), right ventricle (RV) and both edges of the septum (SL, SR) Purkinje fibers wit h positive PAS staining were selected. The area of Purkinje fibers was measured, and the number of activated caspase 3 positive staining nuclei inside the fibers was counted. The percentage of positive stained nuclei per fiber area was used to evaluate Pur kinje fiber apoptosis. Collagen Staining Heart sections were deparaffinized and rehydrated following normal procedure. Sections were then incubated in picrosirius red for 30 min utes followed by washing in 0.01 M hydrochloric acid twice and 75% reagent alc ohol for 2 min utes Slides were dehydrated and permounted with a coverslip.

PAGE 38

38 Picture Analysis with ImageJ All image s were taken at 100x with an Olympus microscope. Microscope was set according to the company protocol. White balance was applied without slid es, and a white background picture was taken. Then a dark background picture was taken with the light path blocked. To correct the background of the image s, a correction factor was created using the white background to subtract the dark background. For each of the pictures, the dark background was subtracted from it first. The resulting image was divided by the correction factor using Image Calculator, and the value multiplied by 255 The final picture should be a cor rected picture with the empty space s, containing no tissue close to pure white ( 255,255,255) To quantify positive caspase 3 staining with a methyl green counterstain, a n I mageJ plug in call (created by G.Landi ni based on the method of Ruifrok (Ruifrok et al,2001)) Image s were split into DAB and methyl green color panels based on the color spectra for DAB and methyl green and the DAB panel was used. T he t hreshold was picked for each DAB panel, and the median o f all values was used for eventual analysis of all pictures. DAB staining above the threshold was measured as DAB area. In order to measure tissue area, a fluorescent image was taken along each light field image to capture autofluorescence of the tissue T he fluorescent image was set as binary, and the tissue area was thus measured. To quantify caspase 3 positive nuclei in Purkinje fibers, images were split into DAB and PAS color panels from which I created color codes based on the color spectra of The DAB panel was used to pick up positive caspase 3 staining using same the method as mentioned above, which is named panel 1. Since some

PAGE 39

39 heavy PAS staining was falsely picked up as DAB staining in panel 1, a second panel excluding all PAS s taining was used to rule out the PAS staining in the DAB panel. In order to do that, the original images were inverted and all the PAS staining showed a green color wh ereas the DAB stained nuclei showed a blue color, and empty space s appeared black. The c o lor threshold plug in was used to filter out the green PAS staining, which creates panel 2. Panel 1 and panel 2 were overlapped, and the overlapping areas are supposed to be the positive caspase 3 nuclei, which was named panel 3. Panel 3 was compared to o riginal pictures to make sure the caspase 3 positive nuclei were chosen correctly To quantify the collagen area, pictures were split into CIE LAB color space L panel was selected to calculate tissue area. T hen a color threshold plug in was used to pick u p the collagen staining using HSU (Hue, Saturation, Value) color split

PAGE 40

40 CHAPTER 3 CORTISOL INCREASES CELL APOPTOSIS IN CARDIAC CONDUCTION SYSTEM IN LATE GESTATION Introduction Maternal stress has been associated with changes in metabolism and stress res ponsiveness in the offspring (reviewed in (Cottrell and Seckl 2009; Davis and others 2011a; Entringer and others 2012) ). In animal models, glucocorticoid exposure in the antenatal period has been demonstrated to red uce birth weight, and increase the risk of metabolic, neurologic and cognitive, and cardiovascular disorders ( reviewed in (Harris and Seckl 2011) ) Several studies have suggested that glucocorticoids also impact fetal heart development, producing cardiac enlargement (Fayol and others 2004; Giraud and others 2006; Lumbers and others 2005) C a rdiac enlargement is also observed with high dose steroid treatment in infants with congenital adrenal hyperplasia (Al J arallah 2004; Scir and others 2007) Previous studies in our lab have used an ovine model of chronic maternal stress using exogenous cortisol infusion to increase maternal cortisol concentrations. We have found that chronic elevation of maternal cortiso l concentrations to those comparable to that caused by mild stress caused a slowing of overall fetal growth, but an increase in fetal heart weight, wall thickness and heart weight to body weight ratio without an increase in fetal blood pressure (Jensen and others 2005; Reini and others 2008) These increases in maternal cortisol produce a similar ly modest increase in fetal cortisol relative to the concentrations that are achieved near term. This enlargement of the fetal heart was blocked by intra pericardial infusion of a mineralocorticoid receptor (MR) antagonist, but only partially attenuated by a glucocorticoid receptor (GR) antagonist (Reini and others 2008) Further investigation found that the heart

PAGE 41

41 enlargement was correlated with increased cell proliferation marked by ki67 The results suggest ed that this cell proliferation was mediated by MR (data not published Reini and Keller Wood ). The current studies further investigate the effects of cortisol on fetal hearts in late gestation at a time of terminal differentiation (Jonker and others 2007) spe cifically characterizing the roles of MR and GR in cardiac apoptosis Materials and Methods Experimental Design Ewes with singleton pregnancies were studied. Briefly, pregnant sheep at 118 123 day of gestation age were randomly assigned to one of four grou ps: ewes infused with saline(control group, n=6); ewes continuously infused with cortisol (hydrocortisone hemisuccinate; Sigma; 1mg/kg per day iv ; cortisol group; n=5 ); ewes continuously infused with cortisol and an infusion of the MR antagonist pota ssium ; n=6) directly into the pericardial space of the fetus; ewes continuousl y infused with cortisol and an infusion of n=4 infu sed directly into the pericardial space of the fetus. All pericardial infusions were delivered using an Alzet minipump (model 2ML2; 5uL/h; Durect Corporation, Cupertino, CA, USA) delivering at 0.12 mL/day without appreciable increase in pericardial fluid volume. Surgery was performed at 118 123 days of gestation. The procedures were described as After surgery, treatments lasted for 10 days and ewes were euthanized with an overdose of euthanasia solution containing pent obarbital.

PAGE 42

42 Immunohistochemistry A cross section of fetal heart was collected at necropsy fixed in 4% paraformaldehyde, and embedded in paraffin wax. Sections were cut at 5 um using a Zeiss rotary microtome (Model HM325) and placed on poly L lysine coated slides. All incubations were performed at room temperature unless otherwise stated. Caspase 3 s taining In order to detect cell apoptosis in the fetal hearts, an antibody against activated caspase 3 was used. Sections were deparaffinized a nd rehydrated, and stained with activated caspase 3 as mentioned above. Briefly, quenching ( 0.3 % hydrogen peroxide in methanol) and a ntigen retrieval (0.1M sodium citrate buffer in a microwave at 1350watt ) was performed. Sections were then blocked with 5% goat serum for 1 hour, incubated with active caspase 3 antibody (1:500 dilution in blocking buffer; R&D System Inc Minneapolis, MN ) for 2 hours at 4 C incubated with biotinylated goat anti rabbit secondary antibody (1:500 dilution in 1% goat serum; Jac kson ImmunoResearch Laboratories, INC. West G rove, PA) for one hour, incubated with streptavidin conjugated horseradish peroxidase (1:200 dilution in 1% goat serum; Thermo scientific, Rockford, IL ) for 10 min utes and then stained with Metal Enhanced DAB substrate Kit (Thermo scientific, Rockford, IL ) for 10 min utes Sections were counterstained with methyl green ( Sigma Aldrich, St. Louis, MO ) Preliminary analysis showed that the pattern of caspase 3 positive cells varied significantly across areas of t h e hearts. In order to quantify cell apoptosis, heart sections were divided into 9 different layers as mentione d before, including L epi, L mid L endo, L sep m sep R sep R endo, R m id and R epi ( Figure 3 1 ) Pictures were taken at 100X with Olympus elec trical microscope and analyzed with Image J (ImageJ

PAGE 43

43 1.43m; Colour Deconvolution plug in is used). On each image, the percentage of the area of active caspase 3 positive nuclei relative to the the total area of heart tissue was measured The data were analyzed by two way analysis of variance corrected for repeated measures using SPSS Double staining of c aspase 3 and Neurofilament Medium or Microtubule associated protein 2 Based on the morphology and the location of the active caspase 3 pos itive cells, neuronal markers were used to identify whether conductive cells were undergoing apoptosis Purkinje fibers are part of the electrical conduction system of the he art, as a result, they express some neuron specific molecules. Neurofilament mediu m (NF M) is expressed in the cardiac conductive system (Atkinson and others 2011) MAP 2 is a neuron specific cytoskeletal protein (Caceres and others 1983) Heart sections were first stained with activ e caspase 3 antibody followed by Alexa Fluor 594 goat anti rab bit IgG secondary antibody (1:500 dilution; Invitrogen, Eugene, Oregon), and then stained with NF M or MAP 2 antibodies (1:500 dilution; EnCor Biotechnology Inc. Gainesville, FL) followed by Alexa Fluor 488 goat anti chicken IgG secondary antibody (1:500 d ilution; Molecular Probes, Eugene, Oregon). Staining protocols were described in Chapter 2. Heart s lides were visualized with fluorescence filters. To further identify Purkinje fibers, Periodic acid Schiff (PAS) staining was used. As conductive cells, Pu rkinje fiber cells contain more glycogen than cardiomyocytes, which can be detected with PAS (Cruz Biotechnology Inc., Santa Cruz, California ). Double staining of c aspase 3 and p eriodic acid schiff To specifically quantify the apoptosis in Purkinj e fibe rs, double staining of caspase 3 and PAS was performed as mentioned above Heart slides were first stained

PAGE 44

44 with activated caspase 3, and then stained with PAS. PAS stains glycogen. Purkinje fibers contain more glycogen than ordinary cardiomyocytes in late gestation, which makes glycogen a marker for Purkinje fibers (Airey and others 2004; Forsgren and Thornell 1981) The h eart slide was divided into 4 different areas along the subendocardial spaces of ventricles and septum s: LV, SL, SR, RV. Photographs were taken at 10 0 x using an Olympus electric microscope and analyzed with ImagJ (ImageJ 1.43m; revised Colour Deconvolution plug in is used) Purkinje fibers were identified by PAS staining. The number of pos itive ly stained nuclei per fiber area was used to evaluate Purkinje fiber apoptosis (control: n=5; cortisol: n=5; cort+MRa, n=7; cort+GRa, n=4). This data was analyzed by two way analysis of variance (hea rt section/layer treatment) corrected for repeated measures. P<0.05 was used as the criteria for significance using a one tailed compariso n. Double staining of c aspase 3 and c kit In order to detect whether the apoptotic cells included stem cells, sections were double stained for activated caspase 3 and c kit. Heart sections were first stained for active caspase 3 then stained with c kit as described in chapter 2. Sections were counterstained with methyl green. Results Data on the heart weight and the hormone concentrations has been previously pub lished (Reini and others 2008) The maternal infusion of cortisol increased fetal cortisol concentrations from 4.1 1.7 nM in the control group to an average of 9.4 1.7 nM in the fetuses of cortisol infused ewes. Heart weight to body weight ratio, left free wall, right free wa ll and septal wall thicknesses were significantly increased by the maternal infusion of cortisol, and the MR antagonist blocked the effect of cortisol.

PAGE 45

45 Further investigation showed that t he percentage of nuclei positively stained for Ki67 in the left ventr icle was increased in the cortisol group and the cortisol infused group treated with a GR antagonist compared to other groups. In the right ventricle, the cortisol infused group had significantly more Ki67 stained nuclei than the control and cortisol infus ed group treated with the MR antagonist (data by Reini and Keller Wood, not published). Cortisol Treatment Increases Apoptosis in the Fetal Sheep Heart Caspase3 is a key player in the process of cell apoptosis; as a result, active caspase3 staining was use d to detect apoptotic cells (Fig ure 3 2 ). The hearts of the fetuses whose mothers were infused with cortisol tend to have a higher percentage of active ca spase 3 positive staining compared to control sheep or fetal hearts from cortisol infused ewes that we re treated with the GR antagonist However, there were no overall differences among the treatment groups in the staining for caspase 3. Although the group treated with the MR antagonist tended to have the greatest staining for activated caspase 3 this dif ference was not statistically significant as a result of the high variability in staining in this group. There were overall sign ificant differences in active caspase 3 staining among the walls of the cardiac chambers (Fig ure 3 3) which were visually eviden t. When these differences were analyzed, there was a significant effect of cardiac location on activated caspase 3 staining. The septum had significantly more activated caspase 3 stain ing than the right ventricle. Within the layers of the heart, the su bendocardial and subepicardial layers had greater staining than did the middle portion of each wall of the heart which is primarily myocytes. There were no overall differences among groups in this pattern.

PAGE 46

46 Cortisol Induces Apoptosis in Purkinje Fibers In cortisol treated fetal hearts, cell apoptosis was evident primarily in areas closest to the cardiac chamber, the subendocardial layers of left ventricle and right ventricle, and the subendocardial layers of septum. This pa ttern of distribution could be ca used by apoptosis of cell types that predominate in th e subendocardial region. Purkinje fiber cells are prominent cell types located in the subendocardial space of the ovine heart. As seen in Fig 3 4a, some of the caspase 3 positive cells in fetal hearts of cortisol treated ewes are primarily located between the endocardium and myocardium with morphology consistent with that of Purkinje fibers: large cells with large, round nuclei or double nuclei, and projection of the fibers into the ventricle walls. Dou ble staining of activated caspase3 and NF M or MAP 2 demonstrates that these fibers are Purkinje fiber cells (Fig ure 3 4b, Fig ure 3 4c). Double staining of activated caspase 3 and PAS further demonstrates that those apoptotic cells are Purkinje fiber cells (Fig ure 3 4d). Cortisol treatment increased Purkinje fiber apoptosis in fetal sheep heart (Fig ure 3 5a). Intra paracardial space administration with the MR antagonist did not attenuate the increase in apoptosis resulting from maternal cortisol infusion; however treatment with GR antagonist completely attenuated the increase in activated caspase 3 staining in PAS positive cells. The apoptosis caused by cortisol was greater in the subendocardial spaces of septum(S L, S R) and left ventricle (LV) r than in the right ventricular free wall (RV), although the apoptosis in the septum on the side adjoining the LV chamber was greater than that in the LV free wall adjoining the same chamber (Fig ure 3 5b).

PAGE 47

47 Cortisol Induces Apoptosis in Stem cell like Cells To determ ine whether stem cells underwent apoptosis in cortisol treated hearts, tissue sections were stained with antibodies against c kit. C kit is a marker for cells with proliferat ion and differentiation ability, for example stem cells and their progeny. Double staining of active caspase 3 and c kit showed that a large proportion of apoptotic cells are c kit positive cells, indicating that cortisol treatment induces apoptosis of stem cells or their derivatives (Fig ure 3 6). Discussion Combined with data of heart measurements and Ki67, our study has demonstrated a striking remodeling effect of cortisol in the fetal heart. Maternal cortisol infusion increased fetal heart size, cell proliferation and apoptosis in the late gestation fetal heart. Thus the increased wall thickness and heart weight caused by the chronic elevation of maternal cortisol appears to involve an increase in myocyte proliferation, whereas the apoptotic effect involved conductive cells and stem cells. Whereas previous studies have suggested a proliferative effect of fetal stress, i nduced by placental restriction or very high levels of cortisol (Giraud and others 2006) these studies suggest even relatively small increases in fetal cortisol can induce increased proliferation when those increases occur chronically during the period of terminal dif ferentiation in the heart. The proliferative and apoptotic effects of cortisol also appear to be mediated by different receptors: blocka g e of MR attenuated the proliferation induced by cortisol mos tly in myocytes, whereas blockag e of GR attenuated the ap optosis in Purkinje fibers.

PAGE 48

48 Role of Mineralocorticoid Receptor and Glucocortidoid Receptor in Glucocorticoid Programming MR and GR are the high and low affinity receptors, respectively, for cortisol. In many epithelial tissues, MR s are protected from binding by cortisol because of (Murphy and others 1974; Rashid and Lewis 2005) However we have previously found (Reini and others 2006) that the fetal heart expresses both MR and GR, and has relatively low expressi and relati vely high expression of the complementary enzyme ; in comparison the fetal kidney at 130d of gestation had 13 fold lower expression of MR and 750 fold higher expression of (Reini and others 2006) Therefore it would be expected that cortisol action in the fetal heart could be mediat ed by both MR and GR. In this sense the fetal heart is similar to the adult hippocampus, a tissue in which cortisol binds to both MR and GR (De Kloet and others 1998; Rashid and Lewis 2005) It has been reported t hat in the rat hippocampus MR expression is increased in response to neuron injury and is associated with neuronal survival (Crochemore and others 2005; Lai and others 2007; Rogalska and others 2009) whereas overex pression of GR can enhance the toxic effects of exogenous insults, and cause cell apoptosis (Airey and others 2004; Almeida and others 2000; Woolley and others 1991) These studies demonstrate that cortisol induced enlargement of the fetal heart by increasing cell proliferation through activation of the MR. In contrast, cortisol induced cell apoptosis in Purkinje fibers can be blocked by a GR antagonist, but not a MR antagonist, indicating that GR mediates cell apop tosis in the cardiac conduction system. The high leve ls of apoptosis after MR blockag e suggest that MR normally limit apoptosis in the fetal conduction system, consistent with

PAGE 49

49 our expectation that the occupancy and activation of the high affinity MR is hi gh even at the achieved total fetal cortisol concentrations of approximately 9 nM (which we predict produce free levels of 2 3 nM). Indeed, the cells of the cardiac conduction system share some similarities with neurons, and the differential roles of MR an d GR we found in Purkinje fibers are consistent with the hippocampal findings The apparent effect of MR on cardiomyocyte proliferation in the fetal sheep heart is contrary to a study in ne onatal rats showing that blockag e of MR with spironolactone decreas e d both proliferation and apoptosis of myocytes (Sohn and others 2010) However, whereas the neonatal rat heart and the fetal sheep heart are both in the final stages of proliferative growth, the sheep in our study were in utero and had MR blockag e solely in the heart, and the rats were newborn with total body spironolactone treatment. Most importantly though, the expression of MR in the heart is low at 18.5 days of gestation and increases postnatally MR expression is higher both before and after the perinatal period (Martinerie and others 2013) thus it may be th e level of MR expression that affects the outcome of MR activation in these two studies. In study, the cell apoptosis was measured in myocytes, while in our study, cell apoptosis was found predominantly in non myocyte cells. These in v ivo effects of MR and GR on the developing fetal heart differ in some aspects from the effects of glucocorticoids seen in cardiomyocyte cultures. In cultures derived from embryonic heart (H9C2 cells) or primary cultures of neonatal cardio myocytes (Ren and others 2012) synthetic glucocorticoids caused hypertrophy in the presence of serum, but inhibited cardiomyo cyte apoptosis in response t serum deprivation; both effects were mediated by GR. These results do not controvert

PAGE 50

50 our findings, because of the difference in both steroid dose between the two studies and the differences between the environment of the in vivo heart and the cul tured cells. The anti apoptotic effect of glucocorticoid receptor activation observed by Ren and coworkers occurred in cardiomyocytes, while the pro apoptotic effect we observed was in Purkinje fibers and c kit positive stem cells. Further, the developme ntal age of the hearts may play a role as endothelin has been shown to induce cardiomyocytes to develop into Purkinje fibers at earlier stages of chick heart development, but causes cardiomyocyte hypertrophy at later stages (Mikawa and others 2003) Thus different cell types and different developmenta l ages might determine the effects of glucocorticoids Apoptosis of Cardiac Stem Cells Whereas the Ki67 expression, indicative of cell proliferation, appears to occur in cardiomyoc yt es, we found little activated casapse 3 in cardiomyocytes. We identifie d several other cell types in the developing fetal hearts that underwent apoptosis with cortisol infusion. One type of apoptotic cell was the c kit positive cells, a source of cardiogenesis in the developing heart ( Ferreira Martins and others 2012) The c kit positive cells expressing activated caspase 3 fall into at least two categories depending on their morphology: one cell type features big, round nuclei, scattered among cardiomyocytes, and the second categor y of cells features long thin nuclei with little cytoplasm, located between muscle bundl es and inside connective tissue Although both kinds of cells were c kit positive, their morphological difference indicated that they may have different lineages or s tages of differenti ati on. The first phenotype is consistent with previous studies examining patterns of apoptosis in the developing heart that showed scattered apoptotic cells throughout the myocardium, although these reports did not conclusively identify the dying cells

PAGE 51

51 Recent studies suggest that c kit labels a heterogeneous population of cells in the heart arising from different precursors and consisting of cardiac stem cel ls, mast cells, hematopoeitic cells, cells derived by epithelial to mesenchymal transition, and possibly others. Several of these populations are progenitor cells in the developing heart (Hou and others 2012; Wu and others 2008) A s tem cells population derived from the epicardium ( epicardially derived cells EPDC ) are c kit positive (Di Meglio and others 2010) The EPDC originate in the proepicardial organ and undergo an ep ithelial to mesenchymal transition ; the EPDC can (Winter and Gittenberger de Groot 2007) differentiate into fibroblasts, coronary arteries and possibly myocytes and may participate in the development of Purkinje fibers ( Also (Dettman and others 1998; Winter and Gittenberger de Groot 2007; Zhou and others 2008) ) The apoptotic c kit positive cells we observed in cortisol infused fetal hearts are scattered among cardiomyocytes, between muscle bundles, aro und Purkinje fibers or blood vessels, suggesting that they might derive from EPDCs. For example, the apoptotic stem cells in Figure 3 6B with spindle shape is likely to be a fibroblast It is also possible that some of the c kit positive cells originate in bone marrow (Rota and others 2007) Myocardial infarction increases the number of bone marrow derived c kit positive cells in the heart (Fazel and others 2006) In some of the heart sections apoptotic cells were observed lining the endothelium of the heart chamber (data not shown), suggesting that there might be cell migration from the circulation to cardiac tissue. C kit positive mast cells have also been demonstrated in t he heart, although the cells we observed did not exhibit the characteristic morphology of mast cells, corticosteroids can alter mast cells number and activation, so we cannot rule out this possibility.

PAGE 52

52 Apoptosis of Cardiac Conductive Cells The primary type of apoptotic cells we identified is Purkinje fibers. Purkinje fibers are part of cardiac conductive system; so increased apoptosis in Purkinje fibers suggests that cortisol could impair electrical conduction and heart contraction. This brings up a qu estion: Why did cortisol target Purkinje fibers? One possible explanation is that like neurons, Purkinje fibers may be susceptible to cellular stress. Studies in rat embryos showed that maternal hyperthermia caused malformations in both the central nervous system and cardiac conduction system (Aoyama and others 2002) One possible explanation is that 120 130 day s of gestation in sheep is a key phase for fetal Purkinje fiber expansion as suggested by Airey (Airey and others 2004) and a poptosis of c kit positive cells induced by cortisol makes Purkinje fiber formation slow and inadequate, as a result, more apoptotic Purkinje fibers were detected in cortisol treated fetal hearts. Another possible explanation is that in an active remodeling fetal heart apoptosis, resulting in increased apoptosis in overall fibers. The origin of Purkinje fibers has been controversial, but recently more evidence suggests that co nductive cells and cardiomyocytes are derived from a common origin (reviewed in (Pennisi and others 2002) ), and EPDCs play an important role in Purkinje fiber formation and differentiation (Gittenberger de Groot and others 1998) Studies in an avian model show that inhibition of epicardial outgrowth resulted in aberrant differentiation of Purkinje fibers, so that the Purkinje fibers are abnormal and not aligned (Eralp and others 2006) Th is correlation between epicardial outgrowth and Purkinje fiber formation can be explained in two ways: 1) Cardiac e pithelial cells contribute to mesenchymal stem cell formation via mesenchymal transition (EMT) and mesenchymal cells differentiate into Purk inje fibers.

PAGE 53

53 This is supported by the results of a study in which human mesenchymal stem cells were injected into fetal sheep ; these stem cells formed more than 50% of the sheep Purkinje fibers (Airey and others 2004) ; 2) EPDCs differentiate into coronary vasculature, perivascular fibroblasts, and interstitial fibroblasts (Dettman and others 1998) which form a supportive environment for Purkinje fiber differentiation. It was reported that with stimulation of ectopic fibroblast growth factor, Purkinje fibers differentiate adjacent to the newly induced coronary arteries (Hyer and others 1999) suggesting the directive role of vasculature for the conductive wir ing of the heart. Also differentiated Purkinje fibers are surrounded by collagen which were considered as insulator and mechanical support (Morita and others 1991; Ono and others 2009) This collagen sheath is part of fibrous skeleton formed by EPDC derived interstitial fibroblasts (Poelmann and others 2002; Winter an d Gittenberger de Groot 2007) Although Purkinje fiber development has not been thoroughly studied in the ovine fetus, the time of our treatment corresponds to the development of a fibrous sheath around the septal Purkinje fiber (Canale and others 1987) Our study showed observation of apoptotic c kit positive cells in cortisol treated hearts. The spindle shaped apoptotic c kit pos itive cells mostly exist between muscle bundles, insi de connective tissue, along fibrous skeleton close to blood vessels or Purkinje fibers. The morphology and localization of these cells suggest EPDCs, and they may be related with the increased apoptosis in Purkinje fibers of cortisol treated hearts. Clini cal Perspective In this study, we have observed the adverse effects of the maternal stress hormone cortisol on cells within the fetal cardiac conduction system. We also demonstrated differential roles of MR and GR on cell proliferation and apoptosis in lat e

PAGE 54

54 gestation. Prior to late gestation, fetal cortisol concentrations are in the range for activation of MR with only partial activation of GR. The normal late gestation increase in cortisol dramatically increases the activation of GR. These GR mediated effe cts play an important role in fetal development and organ maturation in late gestation, especially in terms of surfactant production in the fetal lung (DeLemos and others 1970) These effects of cortisol in the immediate peripartal period occur at a time at which the Purkinje fibers should normally be mature, and terminal differentiation of the myocytes is nearly complete (Jonker and others 2007) Since Liggins and Howie started clinical trials in the 1970s (Liggins and Howie 1972) sho rt term prenatal gluc ocorticoid treatment has become a standard treatment for promoting fetal lung maturation in the event of preterm delivery Despite the immediate benef icial effects of glucocorticoid treatment, concerns have also been raised considering the resulting low body weight at birth (Bloom and others 2001; Davis and others 2009; Reinisch and others 1978) and altered metabolism (Nyirenda and others 1998; Seckl 2004; Sloboda and others 2002) cardiovascular function (Dalziel and others 2005b; Doyle and others 2000) and HPA regulation (Davis and others 2011b; Matthews 2000; Waffarn and Davis 2012; Welberg a nd others 2001) in later life; our data also raised concerns about apopto tic effects in the fetal heart. A n examination of the use of prenatal glucocorticoids suggested that there is no risk for cardiac enlargement at birth after repeated co urses for threatened prematurity (Dalziel and others 2005b) suggesting that this treatment paradigm does not produce l ong term changes in the heart. Our study timing is relatively later in the maturational process, occurring during the time at whic h terminal differentiation begins in the myocardium (Jonker and others 2007) and mat uration of the conduction system

PAGE 55

55 (Canale and others 1987) suggesting the late gestation fetal heart may be vulnerable to the effects of chronic stress or steroid administration duri ng this period. Thus our results suggest a potential postnatal consequence of maternal stress, but also indicate dangers to chronic therapeutic steroid administration during this period of gestation.

PAGE 56

56 Figure 3 1. The n ine different layers of the fetal heart. From left to right, they are L epi, L mid L endo, L sep, M sep, R sep R endo, R mid R epi. The layers marked black are epicardial layers of ventricles, the layers marked blue are middle layers of ventricles and septum, and the layers marked pink are endocardial layers of ventricles and septum. LV: left ventricle; RV: right ventricle.

PAGE 57

57 Figure 3 2 Overall caspase 3 staining in fetal hearts. The c ortisol group tended to have a higher percentage of active caspase 3 positi ve staining compared to control group or cort+GRa group, and cort+MRa group tended to have the greatest staining for activated caspase 3 However these difference s were not statistically significant due to the high v ariance inside the groups Control: n=5; cortisol: n=5; Cort+MR: n=7; Cort+GR: n=4.

PAGE 58

58 Figure 3 3 C aspase 3 staining in fetal hearts showed a distribution pattern depending on the location The endocardial layers of ventricles and septum (marked as pink in Figure 3 1) had significa ntly higher apoptosis than that of middle layer (marked as blue in Figure 3 1)) and septum overall had more caspase 3 staining than the ventricles. Control: n=5; cortisol: n=5; Cort+MR a : n=7; Cort+GR a : n=4.

PAGE 59

59 Figure 3 4 Identification of Purkinje fiber s in the fetal heart. A: Caspase 3 positive cells (brown nuclei) project into the ventricle wall. B: Co staining of PAS (pink) and caspase 3 (brown nuclei). C: Co staining of NF M (green) and caspase 3 (red). D: Co staining of MAP2 (green) and caspase 3 (r ed). Arrows show Purkinje fibers, and arrow heads show caspase 3 positive nuclei.

PAGE 60

60 Figure 3 5 Caspse 3 staining in Purkinje fibers. A: C ortisol treatment significantly increased apoptosis in Purkinje fibers in fetal sheep he art. Treatment with GR antagonist completely attenuated the increase, while treatment of MR antagonist B: Purkinje fiber apoptosis in different areas of the heart. indicates that cell apoptosis in Purkinje fibers is lowest in subendocardial spac e of right ventricle. Straight line indicates that the apoptosis in the septum on the side adjoining the LV chamber was greater than that in the LV free wall adjoining the same chamber. Control: n=5; cortisol: n=5; Cort+MR: n=7; Cort+GR: n=4. _____ A

PAGE 61

61 Figure 3 6 Detection of apoptosis in stem cells. c kit (brown cytoplasm) staining and caspase 3(blue nuclei) staining co localized in cells among cardiomyocytes (A), between cardiac muscle bundles (B), around Purkinje fibers or blood vessels (C). A B C

PAGE 62

6 2 CH APTER 4 CORTISOL REGULATES MATERNAL METABOLISM IN LATE GESTATION Introduction Nutrient availability is a major determinant of the development of fetal and placental growth retardation (Charlton and Johengen 1987) With adequate nutrition and oxygen supply fetal growth accelerates in late gestation to prepare for extra u terine transition Evi dence show s that maternal malnutrition results in growth retardation and inferior adaptation after birth (Armitage and others 2004; Petrik and others 1999) Glucose the major fuel source for t he fetus mostly comes from maternal blood Besides glucose, amino acids especially those that the fetus ca nnot synthesize and fatty acids also depend on maternal supply (Hay and others 1984b; Paolini and others 20 01; Ronzoni and others 1999) In normal gestation, maternal cortisol increases especially in late gestation. As a catabolic hormone, cortisol increase s maternal glucose, amino acid and fatty acid concentration s by inhibiting tissue accretion and promotin g tissue degradation. Normally in human s the mean diurnal plasma glucose concentration in early pregnancy is 107 10 mg/dl and in late pregnancy is 114 8 mg/dl (Skyler and others 1980) This value in sheep is much lower, with the normal plasma glucose concentration in late gestation of approximate ly 50 60 mg/dl (Comline and Silver 1970) ; this value is also increased relative to the nonpregnant ewe Maternal uterine blood flow is also increased compared to the non pregnant uteru s by 3.5 fold which greatly increases nutrient and substrate delivery through the uterine artery from the mother to the placenta (Thaler and others 1990) The normal increase of uterine blood flow is m aintained by maternal cortisol concentration as well (Jensen and others 2005)

PAGE 63

63 This study was set out to investigate changes in maternal metabolism under stress in late gestation. Cortisol was infused into pregnant ewes at a rate whi ch is comparable to that of pregnant women under stress. Changes of maternal metabolic, electrolytic and hemodynamic parameters were measured, and their possible effects on fetal development were discussed. Materials and Methods Experimental Design Sh eep with singleton pregnancies were studied. Briefly, pregnant ewes at 115 day of gestation age were randomly assigned to the control group (n=14) or cortisol group (hydrocortisone hemisuccinate; Sigma; 1mg/kg per day IV; cortisol treated group; n= 15). Sur gery was performed at ~115 days of gestation. The procedures were at 115 days of pregnancy. Beginning at 120 days of gestation, m aternal blood samples and uterine blood flow measurements were collected every 5 days. Maternal body condition was assessed every 3 days using body condition scoring of sheep (BCS (Khan 1992) ). Maternal plasma volume was measured at 120 days and 140 days of gestation using Evans blue dye. An intravenous glucose tolerance test (IVGTT) was done at 131 133 days of gestation to evaluate maternal glucose metabolism. Maternal blood samples were used to measure electrolytes including sodium, potassium, and calcium concentration packed cell volume (PCV), plasma protein (PP) concentration and plasma concentrations of hormones including cortisol, progesterone, insulin, and substrates including glucose, nonesterified fatty acids ( NEFA) and lactate.

PAGE 64

64 Body Condition Scoring System The maternal body condition scor ing ( BCS ) estimates the condition of muscl e and fat of sheep, by assessing the depth of muscl e and fat deposition over and around the thoracic and lumbar vertebrae It has 3 criteria : sharpness of spinal processes, sharpness of transverse processes, and fullness of loin muscle and fat Each evaluation is assigned a score on a scale from 1 to 5 with 1 reflecting an undernourished ewe and 5 reflecting obesity The average score of the 3 evaluations is used to assess each body condition. Glucose Tolerance Test IVGTT is a glucose to lerance test. It challenges the body with glycaemia, in order to test pancreas B cell function insulin response and resultant glucose uptake by tissues The first phase insulin response reflects pancreatic cell secretion of stored insulin, and is widely used as an index of risk of progression to Insulin Dependent Diabetes Mellitus ( IDDM ) (Bingley and others 1992) In this study, a bolus injection of glucose was given to ewes and maternal blood was taken from 5 min utes until 180 min utes after injection Both glucose and insulin concentrations in the blood samples were measured. Results Cortisol Effects on Maternal Glucose Metabolism and Body Condition Scoring The m aternal cortisol concentration in the cortisol treated group is significantly higher than that of c ontrol group during the period of treatment (Figure 4 1). The plasma glucose and insulin concentration s are also significantly increased in the cortisol group compared to that of the control group (Figure 4 2 Figure 4 3 ). Maternal progesterone concentrati on l is not significantly di fferent overall between the two groups (Figure 4 4)

PAGE 65

65 The m aternal NEFA and lactate concentration s are also not different between the two groups (Figure 4 5 Figure 4 6). BCS scores are also not different between groups and a cross gestational days (Figure 4 7). Cortisol Effects on Maternal Electrolytic Balance and Hemodynamics The m aternal blood sodium, potassium and calcium co ncentration are not different between the control and cortisol group s PCV value overall is not significant between the two groups (Figure 4 8). When comparing PCV value at different gestational days in both groups, the PCV value s at 130 day s and 135 day s of gestation are significantly lower than that of 120 days of gestation. In the control group, there is a gradual drop of PCV value from 120 days of gestation to 140 days of gestation, which is not present in the cortisol group. The plasma protein co ncentration overall is not significant between the two groups. However, the plasma pr otein concentration at 140 days of gestation is significantly higher than that of the concentration at 120 and 125 days of gestation (Figure 4 9 a ). This increase is more o bvious in the cortisol group than in the control group. Overall plasma volume and plasma volume per body weight at 140 days of gestation is significantly higher than that of 120 days of gestation (Figure 4 10). Although there is no overall significant b etween the two treatment groups, plasma volume per body weight in control group increased by 8% from 120 days of gestation to 140 days of gestation, while in the cortisol group the increase wa s 33%. The uterine blood flow was not different between the con trol and cortisol groups (Figure 4 11). Intra venous Glucose Tolerance Test The g lucose concentration before the GTT is higher in the cortisol group compared to the control group. After the injection of glucose, a rapid increase in

PAGE 66

66 maternal gl ucose concentration was ob served in both groups at 2 min utes The p lasma glucose concentrations then gradually decreased, and returned to baseline level s by180 min utes (Figure 4 12). Two way repeated measurement was used to analyze the maternal gluco se concentration during the GTT test. Statistics show that although the overall glucose concentration in the cortisol gr oup is not significantly higher than that of the control group (p=0.067 ) the interaction of GTT time and glucose concentration is signi ficant (p= 0.0 08 ), which indicates that the change of glucose concentration over time is different between the two groups. At the time points of 60, 70, 8 0, 90, 100, 120, 160 and 180 minutes maternal glucose level s are significantly higher in the cortisol treated ewes compared to the control ewes (Figure 4 12). The area under the curve (AUC) of glucose is significantly higher in the cortisol group than that of the control group (Figure 4 13). The IVGTT test has two phases of glucose decay; a rapid d ecay due to rapid tissue uptake of glucose, and a second slower decay in plasma glucose concentrations ( reviewed by Leahy 2005 Prando et al, 1978 ) Th e time points with significant differences in plasma glucose concentration between the gr oups are distributed at the second half of the GTT test, indicating different second phase glucose clearance In order to quantify that, the glucose disappearance curve for each ewe was fit to a 5 parameter exponential decay curve using the equation f=y0+a*exp ( b*x) +c*exp ( d*x) d value is significantly lower in the cortisol group compared to the control group, indicating that the rate of decay of glucose concentrations wa s slower in cortisol treated animals (Figure 4 14). There was no overall difference between insulin concentration between the two groups during the GTT test, and there was no difference in overall insulin ar ea under

PAGE 67

67 the curve ( Figure 4 15 ) The insulin response curve also has two components: the first phase is caused by immediate insulin release from pancreatic beta cell vesicles, and the second phase is caused by new insulin secretion in response to glu cose stimulation (Cobelli and others 2007; Curry and others 1968) Live Fetuses versus Stillborn Fetuses in the Cortisol Group At the end of the study, 8 out of 15 ewes in the cortisol group had stillborn fetuses. Two of these stillborn lambs were delivered at 146 days of gestation five died in utero or wer e stillborn at 135 140 d ays of gestation and one ewe was sacrificed during abortion at 141 d ay s of gestation The other 7 ewes were sacrifice d at 139 143 days of gestation as soon as early signs of labor (including changes in uterine contractions) were noted Considering that the stillborn fetuses might result from different maternal metabolism, we divided the cortisol group into a group with l ive fetuses at delivery or time of necropsy ( cort live group; n=7) and a group with stillborn lambs or dead lamb at the time of necropsy (cort stillborn group; n=8), and re analyzed the data. We found that the cort stillborn group has significantly higher insulin concentration s than that of control group ov er gestational ages (Figure 4 16 ). In the GTT test, the first phase insulin response tended to be lower in the cort live group compared to the control group while the first pha s e insulin response in the cort still born group s tended to be higher than the control group (Figure 4 17 ). Analysis of maternal data among the control, cort live and cort still born groups revealed that maternal progesterone concentration was significantly higher in the cort live g roup compared to the control group (Figure 4 4b). Plasma protein value at 140 days of gestation was significantly increased in the cort still born group, but not in the

PAGE 68

68 control and cort live groups (Figure 4 9b). The control and cort still born group s also h ad significantly lower uterine blood flow than the cort live group (Figure 4 18 ). Discussion In this study we looked at the maternal metabolic changes with cortisol treatment in late gestation. In chapter 3 we found that cortisol can directly work on the f etal heart and regulate its development, which is mediated differently by MR or GR. Besides the direct effects, maternal cortisol could also regulate maternal metabolism, including hormones and blood nutrients, which may directly affect fetal growth. Corti sol Affects Maternal Metabolism and Causes Glucose Intolerance As we mentioned earlier, cortisol has catabolic effects and promotes breakdown of muscle glycogen into glucose and stimulate hepatic gluconeogenesis It also inhibits the insulin pathway and de crease s uptake of glucose by peripheral tissues (Andrews and Walker 1999) As a result, maternal and fetal hyperglycemia is expected with cortisol infusion. In this study, the cortisol group has significantly higher maternal plasma glucose concentr ation compared to the control group, which is consistent with what we expected. High glucose level stimulates production of insulin, so the plasma insulin concentration would be expected to increase. In this study, the mean value of plasma insulin concentr ation in the cortisol group was slightly, but not significantly higher than that of control group. In normal pregnancy, NEFA concentration gradually increases, in co njunction with an ncrease in cortisol and decrease of insulin. Our study showed a significantly higher NEFA concentration at 142 145 days of pregnancy compared to that of 120 and 125 days of gestation, which is consistent with that data Progesterone is an important hormone that helps reduce uterine contraction and maintain pre gnancy. A sudden drop of progesterone near term is a sign of labor. We

PAGE 69

69 groups unti gestation lengt h. Glucose, amino acid s and lactate are three major oxidizable substrates in the sheep fetus. Glucose is the main source of fetal energy, and it crosses the placenta through simplified transport. Glucose can also be synthesized into lactate in the placent a and transported to the fetus. Amino acids are precursors of fetal proteins, and they cross the plac enta through active transport. The p lacenta can breakdown the amino acids from the mother and re synthesize them into new amino acids needed by the fetus (Battaglia 2007) The placenta also uptake s free fatty acids via fatty acid transporters (FATP s ) from the maternal circ ulation and provides fatty acids for both placental metabolism and fetal growth (Zhu and others 2010) In this study cortisol infusion significantly increased maternal glucose concentration, and maternal insulin con centration tended to increase as well. The higher glucose concentration and higher glucose AUC in IVGTT test also suggest that ewes in the cortisol group have reduced glucose uptake by tissues These maternal metabolic changes in cortisol treated ewes are very similar to that of diabetic pregnancy. M aternal infusion of cortisol significantly increased fetal heart weight and wall thickness (Jensen and others 2005; Jen sen and others 2002b; Reini and others 2008) F etal and neonatal cardiac hypertrophy is a common outcome of diabetic pregnancy. It was reported that fetuses from diabetic mother s have significantly larger heart size comp ared to normally grown fetuses, secondary to hypertrophy of the ventricular free walls, septal hypertrophy and right vent ricle dilation (Veille and others 1993) Septal hypertrophy is

PAGE 70

70 the most significant characteristic of fetuses born to diabetic mother s and is also called asymmetrical septa l hypertrophy. It was originally believed that fetal car diomegaly resulted from hyperglycemia of the diabetic mother, however, recent studies revealed that well controlled diabetes with normal plasma glucose during pregnancy still resulted in increased fat mass and cardiac septum thickness in newborn fetuses (Aman and others 2011; Vela Huerta and others 2000) Also high maternal insulin concentration did not alter placental glucose uptake and transfer in ewes in late gestation (Hay and others 1984a) further confirms that fetal cardiac hypertrophy of diabetic mother is not directly regulated by maternal nutrition, but may be related to hormonal or epigenetic regulation. When comparing infants of diab etic mother s to macrosomic infants of nondiabetic mothers although both of them have significantly higher interventricular septum/posterior wall thickness ratios than appropriate for gestational age (AGA) infants only infants of diabetic mother s ha ve si gnificantly increased shortening fraction s and ejection fraction s than AGA infants (Demiroren and others 2005) further confirming that nutrition overload is not the cause of cardiac dysfunction in fetus es of diabetic pregnancy. Diabetic pregnancy has a high rate of stillborn fetuses. It was reported that stillborn fetuses from diabetic mother s had heavier hearts and thicker ventricular free walls compared with appropriately grown stillborn infants from non diabetic mother s and this cardiomegaly might contrib ute to fetal death in those pregnancies (Russell and others 2008) In this study, more than 50% of ewes with cortisol infusion had stillborn fetuses. Combined with the findings in Chapter 3 that cortisol infusion significantly

PAGE 71

71 increased fetal heart weight and wall thickness, it is possible that those stillborn fetuses in the cortisol group might have die d from cardiomegaly with abnormal cardiac function. Cortisol and Electrolytes and Hemodynamics PCV is the volume percentage of red blood cells in blood. It decreases during normal pregnancy, partly due to the iron deficienc y and increased maternal plasma volume in pregnant women (Milman and others 2000) In this study, we observed a significant decrease in the PCV value from 120 days to 140 days of gestation in the control group, but n ot in the cortisol group. This is consistent with studies showing that stress increases cortisol and the PCV value, which in our study resulted in an attenuation of the normal decrease of PCV in the cortisol group (Medica and others 2010; S.J.H 1998) Plasma proteins include various kinds of proteins, most importantly albumin and globulins. We used a refractometer to measure total plasma protein. Normally the total plasma protein gradually decre ases during pregnancy due to an increase in plasma volume (Fisayo 2007) however, in this study, we saw a gradual increase of plasma protein level from 120 to 145 days of gestation This might be a compensatory mechanism in correspondence to the surgical procedure (Macarthur 1948; Pedersen and others 1989) However, cortisol promote s the production of albumin (Chou 1983) In this study, maternal plasma protein concentration in the cortisol group tended to increase, but was not signifi cant ly different from the control group. From 120 days of gestation to 140 days of gestation, there was a significant increase in plasma volume, which is consistent with other studies (Jensen and others 2002a) see a significant increase of plasma volume in the cortisol group compared to the

PAGE 72

72 control group, the pe rcentage increase in the cortisol group is 33%, much higher than that of the control group ( 8%) Previous studies in model in which ewes were adr enalectom ized and replaced with nonpregnant concentrations of corti s ol and aldosterone in late gestation maternal plasma volume failed to increase, indicating that cortisol helps maintain the normal increase of maternal plasma volume in la te gesta tion (Jensen and others 2002a) Another study showed that uterine blood flow was signi ficantly increased at 130 days of gestation with the same dose of cortisol infusion used in the current study, and control ewes had significantly increased uterine blood flow from 120 to 130 days of gestation (Jensen and others 2005) However, in the current study, no significant increase was observed in maternal plasma volume in cortisol treated ewes. This could be explained by the difference in treatment len gth. Plasma volume changes with body size; as a study, the treatment only lasted for 10 days, so mater nal body weight may not have large enough changes at the end of stud y compared to the body weight at the beginn ing of the study. However, in the current study, the treatment lasted for more than 25 days. During this time, maternal body weight is more likely to increase or decrease. However, we used the body weight at 115 d ays of gestation to correct plasma volume at both 120 and 140 days of gestation, so as not to include the changes in fetal weight, or under development over this time in our correction to maternal body weight. However, this might introduce some error if cortisol actually increased maternal muscle and adipose breakdown resulting in lower effective maternal lean body mass at 140 days in this group.

PAGE 73

73 Stillborn versus Live Fetuses Segregating the cortisol group into cort live and cort still born group s resulte d in some interesting data. During the experimental period from 120 to 140 days of gestation, both the cort live and the cort still born group have significantly higher glucose level compared to the control group, but there was no difference between the cor t live and cort still born group s However, although insulin concentration s during the experiment were not different between the cort live group and control group s the cort still born group has significantly higher insulin concentrations than that of the co ntrol group. As reviewed by Leahy, type II diabetes has two stages: the first stage is insulin resistance, and the second stage is impaired b eta cell function (Leahy 2005) The first stage features high insulin concentration in order to maintain normal glucos e level s. As a result the insulin concentration is high and glucose concentration is normal. In our study, both the cort live and cort still born group s have higher glucose concentrations than that of the control group, which could be explained by the effe cts of cortisol infusion. On top of that, when we compare data within the cortisol group, the cort still born group has a higher baseline insulin concentration than the cort live group. This suggests that the cort still born group needs more insul in in order to keep glucose concentration similar to that of the cort live group, and cort still born group has a compensatory production of extra insulin This implies that ewes in the cort still born group might have developed insulin resistance and have a high risk of developing type II diabetes (Cavaghan and others 2000; Leahy 2005) Pregnancy has a diabetogenic effect on the mother. Insulin sensitivity in normal pregnancy is reduced to about one third of non pregnant level s in order to maintain maternal glucose homeostasis (Buchanan and others 1990) G enetically predisposed

PAGE 74

74 pregnant women have a risk of developing gest ational diab etes W omen with gestational diabetes have a significantly reduced first phase insulin response during the IVGTT, with a higher insulin concentration during the second phage compared to normal pregnant women (Muck and Hom mel 1977) However, th mean insulin sensitivity measured by minimal model technique (MMT) (Bergman 1989) in gestational diabetics is similar to that of normal pregnancy (Buchanan and others 1990) In the current study, the cort live group had a similar baseline insulin concentration compared to control group, with decreased first phase insulin secretion suggesting that ewes in this group might have developed gestational diabetes On the other hand, the attenuated insulin secretion in the first phase of GTT is a physiological definition of impaired glucose tolerance (IGT), and it result s in hyperglycemia in the second phase of GTT, which is consistent with our study since we observed a higher glucose concentration in the second phase of glucose decay in the cortisol treated ewes Gestational diabetes could progress to type II dia betes, associated with marked deterioration of insulin sensitivity (Tura and others 2012) In IVGTT, insulin resis tance is compensated by a great enhancement of first and second phase insulin secretion in response to glucose challenge (Buchanan and others 1990) In the current study, the cort still born group tended to have an increased insulin response compared to the cort live group, further suggesting that ewes in the cort still born group might have developed insulin resistance and may progress from gestational diabetes to Type II diabetes In conclusion, the results of the GTT test and basal insulin concentration suggest that ewes in the cort live group have impaired glucose tolerance and gestational diabetes which might be caused by cortisol treat ment, whereas ewes in the cort

PAGE 75

75 still born group have already developed insulin resistance, suggesting the possible onset of type II diabetes.

PAGE 76

76 Figure 4 1 M aternal plasma cortisol concentration over the e xperimental period. indicates that the overall l cortisol concentration wa s significantly higher in cortisol group compared to control group. Control n=1 3 ; cortisol n=15 at 129 135 days of gestation, n=9 at 140 days of gestation

PAGE 77

77 Figure 4 2 M aternal plasma glucose concentration over the experimental period. indicates that the overall plasma glucose concentration was significantly higher in cortisol group compared to control group. Co ntrol n=13; cortisol n=15 at 129 135 days of gestation, n=9 at 140 days of gestation.

PAGE 78

78 Figure 4 3 M aternal plasma insulin concentration over the experimental period. indicates that insulin concentrat ions of the cortisol group wa s significantly higher than that of the control group. Control n=13; cortisol n=15 at 129 135 days of gestation, n=9 at 140 days of gestation.

PAGE 79

79 F igure 4 4 M aternal plasma progesterone concent ration over the experimental period Figure4 a: At129 135 days of gestation: control n=13, cortisol n=15; at 140 days of gestation, control n=12, cortisol n=9 Figure 4 4b: indicates that overal l plasma progesterone wa s significantly higher in cortisol live group compared to the cort stillborn group. At 129 135 days of gestation: control n=13, cort live n=7, cort still born n=8; at 140 days of gestation, control n=12, cort live n=5, cort stil l born n=4. Figure 4 4a Figure 4 4b

PAGE 80

80 Figure 4 5 M aternal plasma NEFA concentration over the experimental period. There were n o overall differences between the two groups. Control n=13; cortisol n=15 at 129 135 days of gestati on, n=9 at 140 days of gestation. NEFA: non esterified fatty acid.

PAGE 81

81 Figure 4 6 M aternal plasma lactate concentration over the experimental period. There wa s no overall difference between the two groups. Control n=13; cortisol n=15 at 129 135 days of gestation, n=10 at 140 days of gestation.

PAGE 82

82 Figure 4 7 M aternal BCS scores over the experimental period. There wa s no overall difference betwe en the two groups. Control n=13; cortisol n=15 at 129 135 days of gestation, n= 7 at 140 days of gestation BCS: body condition scoring

PAGE 83

83 Figure 4 8 M aternal PCV value over the experimental period. There wa s no overall difference between the two groups. Control n=13; cortisol n=15 at 129 135 days of gestation, n=9 at 140 days of gestation PCV: packed cell volume.

PAGE 84

84 Fig ure 4 9 Maternal plasma protein content over the experimental period. Figure 4 9a: indicates that PP value at 140 days of gestation was significantly higher than that of 120 and 125 days of gestation. Control n=13; cortisol n=15 at 129 135 days of gest ation, n=9 at 140 days of gestation. Figure 4 9b: indicates that the high PP value at 140 days of gestation existed only in the cort stillborn group, but not in the control and cort live groups. Control n=13; cort live n=7, cort stillborn n=8 at 129 135 days of gestation, cort live n=6, cort stillborn n=3 at 140 days of gestation. PP: plasma protein. Figure 4 9a Figure 4 9b

PAGE 85

85 Figure 4 10 M aternal plasma volume at 120 days and 140 days of gestation in the control and cortisol groups. The p lasma volume at 140 days of gestation wa s significantly higher than that of 120 days of gestation. Plasma volume in control group increased by 8% from 120 to 140 days of gestation, and in cortisol group the increase is 33 %. Control: n= 11; cortisol : n=5.

PAGE 86

86 Figure 4 1 1 M aternal uterine blo od flow over the experimental period. There wa s no significant difference between control and cortisol groups Control: n=12; cortisol: n=12.

PAGE 87

87 Fig ure 4 1 2 M aternal plasma glucose concentration during the IVGTT test in the control and cortisol groups. indicates that at that time point, glucose concentration in cortisol group wa s significantly higher than that of control group. Control: n=12 ; cortisol: n=15. IVGTT: intra venous glucose tolerance test. * *

PAGE 88

88 Figure 4 13 AUC of maternal plasma glucose during IVGTT between the control and cortisol groups. indicates that glucose AUC wa s significantly higher in the cortisol group compared to the control group. Control: n=1 2 ; cortisol: n=15. AUC: area under the curve.

PAGE 89

89 Figure 4 14 d value of glucose decay curve fitting during IVGTT between the control and cortisol group s indicates that the cortisol group has significantly lower d value compared to control group suggesting tha t glucose clearance rate during he second phase of IVGTT wa s slower during cortisol infusion. Control: n=1 0; cortisol: n=11

PAGE 90

90 Figure 4 15 Plasma insulin conce ntrations during GTT. Figure 4 15 a: Plasma insulin concentrations during the GTT test. Figure 4 15 b: Insulin AUC during the GTT test. Control: n=1 2 ; corti sol: n=15 Figure 4 15a Figure 4 15b

PAGE 91

91 Figure 4 16 M aternal plasma insulin during the experime ntal period There were significant differences among the control, cort live and cort stillborn groups. indicates that plasma insulin level in the cort isol stillborn group wa s significantly higher than that of the control group. Con trol: n=1 3 ; cort live: n=7; cort still born : n=8.

PAGE 92

92 Figure 4 17 Matern al plasma insulin concentration during the IV GTT test. indicate that at 10 and 3 0 minutes the insulin concentrations of ewe s in the cort still born group were significantly higher than that of the control and cort live group s Control: n=12; cort live: n=7; cort still born : n=8.

PAGE 93

93 Figure 4 18 M aternal uterine blood flow durin g the experimental period There were significant differences among the control, cort live and cort stillborn groups. indicates that the over all uterine blood flow wa s significantly higher in cort live group compared to that of cort stillb orn group. Control: n=12; cort live: n=7; cort stillborn: n=5.

PAGE 94

94 CHAPTER 5 CORTISOL REGULATES FETAL GROWTH IN LATE GESTATION Introduction There is a pronounced increase in fetal growth and mat uration in fetal organs in late gestation of pregnancy Cortisol is believed to be one of the hormones that drive s the transition from tissue accretion to tissue differentiation, and promote s maturation of structure and function of fetal organs to adapt to extra uterine life. When a suboptimal intrauterine environment exists, growth of many fetal organs is restrained, while other organs are spared; t his is called asymmetrical fetal growth. Excessive glucocorticoid exposure is one of the causes of asymmetrical fetal growth. It was reported that prenatal glucocorticoid tr eatment resulted in smaller fetuses at term with decreased body length, weight and head circumference (Abbasi and others 2000; Davis and others 2009; French and others 1999) Maternal cortisol infusion also decrease d general fetal growth, with decreased weight of spleen and placenta and increased weight of fetal heart (Jensen and others 2002b) The adoptive changes of fetal growth are believed to remain after birth and may become origins of adult diseases (Barker and Fall 1993) Modest elevation of maternal corti sol concentration in the ovine model from 120 to 130 days of gestation had been proven to decrease overall fetal growth and increase fetal heart to body weight ratio (Reini and others 2006) In C hapter 3 we discussed corresponding changes in cardiac cell a poptosis in response to 10 day s of cortisol infusion, and in C hapter 4 we investigated the maternal metabolic and hemodynamic changes of a longer cortisol infusion ( from 115 to 144 days of gestation). In this chapter we will test whether this long er period of cortisol infusion alters final fetal development before birth We also will verify whether the cardiac cell modulation we observed with

PAGE 95

95 the 10 day infusion persists with a longer period of cortisol infusion, and whether this cell modulatio n results in abnormality of fetal hearts. Materials and Methods Fetuses of pregnant ewes from the study in Chapter 4 were used. At 142 14 4 days of gestation, ewes and their fetuses were euthanized with an overdose of euthanasia sol ution containing pentobarbital. Fetuses were immediately removed from the uterus and fetal orga ns were dissected and weighed. The f etal heart was weighed, and the cardiac wall thickness including th ose of the left ventricul ar and right ventric ular free walls, and septum, were measured at two different locations and the average value was clacualted Fetal crown to rump length crown diameter sternal girth, tibia l length and hock to hoof a nd whole leg lengths were measured. Fetal measurements were corrected for body weight and tibia length, as fetal tibia length is a good estimate of fetal skeleton growth (MB 1928; Rueda Clausen and others 2011a; S cheuer and others 1980) After excluding stillborn fetuses, 16 fetuses were studied (Table 5 1 b ) which were divided into two groups: fetuses of the control group of ewe (n=9) and fetuses of the cortisol group of ewe ( ewes with infusion of hydrocortisone hemisuccinate; Sigma; 1mg/kg per day iv; n= 9 ). In the control group, there were both male and female fetuses, and gender effects on fetal growth were tested. Fibrosis was examined in fetal hearts by quantification of collagen. Picrosirius red was used to stain collagen using the staining protocol described in Chapter 2. Pictures were taken using an Olympus microscope, and analyzed with ImageJ. RNA was extracted from the cardi a c septums taken at necropsy from live fetuses in the cortisol group and the contr ol group at 140 143 days of gestation (n=9 in the control group, n=7 in the cortisol group) Quantitative real time PCR was used to

PAGE 96

96 analyze the genes atrial natriuretic peptide (ANP), B type natriuretic peptide (BNP), and C type natriuretic peptide (CNP) Sequence s of primer set s for the genes are in Table 5 4 Fold changes of gene expression were calculated using the housekeeping gene 18s, Expression of 18s is notdifferent between the control and cortisol groups, indicat ing that it is a good housekeeping gene for this study. The fold change of mRNA expression was calculated as 2 Chi square test was used to compare the stillbirth rate and male/female ratio between control group and cortisol group. When over 20% of the expected values in the contingency table is less than 5, a Fisher exact test was performed instead. The and girth measurements. Heart wall thickness measures wer e corrected using tibial length Over all wall thickness was analyzed using repeated two way analysis of variance (ANOVA), and measurement of each wall was analyzed using student t test. The length of the fetal tibia, the hock to hoof, and the whole leg was measured for each leg, and an alyzed using repeated two way ANOVA. Cardiac f ibrosis was analyzed using repeated two way ANOVA. Results Stillbirth Rate There were 15 ewes in the control group, 13 of which had live fetuses at necropsy or delivered lambs, and 2 of which had stillb orn lam bs There were 15 ewes in the cortisol group as well, 7 of which had live fetuses at necropsy, and 8 of which had stillb orn lambs or lambs which died in utero Chi square test showed no significant

PAGE 97

97 differences in stillbirth rate of fetuses between the control and cortisol groups ( p=0.053. Table 5 1 c ). Organ W eights There were no differences in the body weights of fetuses between the control group and cortisol group. The b rain, pituitary, adrenal, peri renal adipose tissue, pancreas, and lung weight to body weight ratio was not different between the two groups l. The average kidney weight corrected to body weight was significantly higher in the cortisol group than in the control group (Figure 5 1). Body Length No difference s were found in c rown to rump, crown, sternal girth, tibia l and hock to hoof or whole leg lengths between the contro l and the cortisol groups (Table 5 2 ). Heart Measurements There were no differences in fetal heart weight or heart weight/body weight ratio between the tw o groups. There was also no difference between the two groups when heart weight was correct ed to tibia length (Rueda Clausen and others 2011a) There was no overall difference in fetal heart wall thickness between t he two groups. However, as ex pected at this age, the septum wa s significantly thicker than the left ventricle, and the left ventricle wa s significantly thicker than the right ventricle (Figure 5 2). When the thickness of the heart wall s was corrected for f etal size using tibia length cortisol infusion significantly increased the thickness of septum and overall fetal heart wall thickness (Figure 5 3). In the control group, male fetuses had significantly higher heart weight/body weight ratio s compared to fem ale fetuses (Figure 5 4); this effect of gender was not tested in cortisol group due to lack of live male fetuses in this group

PAGE 98

98 Since the re were only female fetuses in the cortisol group a gender effect might be a factor in fluencing the overall comparison of fetal heart growth. The Fisher exact test showed that male/female ratio is different between control and cortisol groups (Table 5 3). As a result, we re analyzed the fetal heart weight data with only female fetuses inclu ded. The heart weight/tibia length ratio is significantly higher in female fetuses in the cortisol group than th e female fetuses of the control group, and heart weight/body weight ratio was higher in the cortisol group as w ell (Figure 5 5). Fibrosis in Fetal Hearts No differences of the area of collagen staining were found between the fetal hearts in the control and cortisol treated groups suggesting that cortisol infusion di d not inc rease cardiac fibrosis. mRNA Expression of A trial natriuretic peptide (ANP) B type natriuretic peptide (BNP) and C type natriuretic peptide (CNP) The e xpression of CNP mRNA in the septum of the heart was higher in the cortisol group co mpared to the control group (p=0. 028 in a one tail student t test ) Data in Figure 5 6 are expressed as g roup means of fold change relative to expression in the control group There was no difference in the expression of ANP and BNP mRNAs Discussion Maternal stress has been reported to decrease fetal growth and impair organ development Psychological distress in early, mid and late gestation is associated with low birth weight and prematurity (Rond and others 2003) Prenatal glu cocorticoid treatment also significantly decreases birth weight (Bloom and others 2001; Davis and others 2009; French and others 1999) When comparing dexamethasone treated infants and h istorical cohort of infants and after adjusting for gestational age, maternal race,

PAGE 99

99 parity, and infant gender dexamethasone treated infants were smaller by 12g at 24 26 weeks, 63g at 27 29 weeks, 161g at 33 34 weeks of gestation (Bloom and others 2001) These con clusions were made based on hundred s or thousands of subjects In the current and cortisol group, probably due to the limited sample size. Fetal Stillbirth and Cardiac Measurem ents Early in the 1980s, evidence was found to link the intrauterine environment to adult diseases in future life (Barker 1998) It is believed that an adverse uterine envi ronment constrain s the grow th of certain organs while sparing some other important organs. P revious studies of ewes showed that cortisol infusion from 120 to 130 days of gestation significantly decreased the rate of fetal somatic growth measured as fetal t horacic girth from spine to sternum (Jensen and others 2005) The f etal heart weight to body weight and heart wall thickness was increased, with elevated exp ression of Ki67 (Reini a nd others 2008) and increased cell apoptosis in conductive cells and stem cells. In this study, originally we planned to give the same dose of cortisol infusion from 115 days of gestation until natural deliver y in order to examine whether the fetal hear t modification that we observed at 130 days of gestation (Chapter 3) resulted in any neonatal cardiac abnormality or malfunction. The first part of the study included 3 ewes in the cortisol group and 6 ewes in the control group (Table 5 1 a ) It turned out that all three ewes in cortisol group ha d stillborn fetuses. One of the ewes aborted at 140 days of gestation, and the other two delivered stillborn fetuses on 146 days of gestation. While in control group, 5 out of 6 ewes gave birth to live lambs at term, except one ewe that aborted before 140 days of gestation due to low food intake. Fisher exact t test of the first part of study (Table 5 1a) showed that stillbirth rate is significantly higher in the

PAGE 100

100 cortisol group compared to the control group (p=0.048) suggest ing that the long period of infusion of cortisol resulted in fatal changes in fetuses. Uterine blood flow data shows that ewes in the cortisol group had high uterine blood flow before labor, indicating that those fetuses were a live before labor sta rted. It was assumed that the long period of infusion of cortisol caused the fetus to be unable to survive the process of labor, and that they most likely died during delivery. Examination of the stillborn f etuses showed that they seem to have abnormally developed hearts Combined with the findings of cardiac cell modification in Chapter 3, and the evidence of insulin resistance in the ewes of stillbirth, we hypothesized that the more pro long ed period of cort isol infusion might have triggered more severe fetal heart remodeling, and associated with cardiac dys function. We further hypothesized that the possible defects of conduction, or of contractility and ejection efficiency in the fetal heart might be one of the reasons that c aused stillbirth Since ewes in the cortisol group were unlikely to deliver live lambs, we move d the end point of the experiment early in order to get live fetuses. So in the second part of the study, we tried to sacrifice ewes from bo th the control and cortisol groups between 139 144 days of gestation, before labor started. Uterine blood flow and maternal behavior were used to monitor the signs of labor, and ewes were euthanized as soon as the risk of delivery increased. At the end of the second part of study, there were 12 ewes in the cortisol group, among which 7 had live fetuses at the time of euthanization and 5 delivered stillborn fetuses. In the control group there were 8 ewes that had live fetuses (including a twin), and 1 had a stillborn fetus due to prolonged labor (T ab le 5 1b ). Altogether, we had 15 ewes in control group, and 15 ewes in cortisol

PAGE 101

101 group (Table 5 1c). Data in this chapter is from the live fetuses with 7 live fetuses from cortisol group and 9 live fetuses from con trol group. In this study with an increased period of cortisol treatment, we saw a significant difference in fetal heart weight/b o dy weight ratio after correction for the gender factor. T he septum thickness and overall wall thickness of the fetal heart was also significantly increased when corrected with ength of the tibia The c hange in f heart structure might cause change s of cardiac function. CNP is a marker of cardiac function and expressed by various cell types in the heart. P lasma CNP concentrations are closely related to left ventricle function and dp/dt ( Rate of Rise of Left Ventricular Pressure) in patients with chronic heart failure (CHF), and dp/dt is a good index of left ventric ular contractility. CNP expres sion is elevated in failing heart s as part of beneficial compensatory response (reviewed in (Del Ry 2012) ) In this study we saw increase d CNP mRNA expression in fetal septum with infusion of cortisol to the ewe suggesting that these fetuses might have cardiac malfunction related with ventricle contractility. This data is consistent with our observation of apoptotic Purkinje fibers in Chapt er 3. Normal Fetal Heart Growth and Maturation Fetal cardiomycytes have two forms in ewe and human : mononucleated my o cytes and binucleated myocytes. Binucleated myocytes are bigger than mononucleated myocytes, and considered to be the final differentiated myocytes as a result of karyokinesis without cytokinesis (Oparil and others 1984) In early gestation, most of myocytes are uninucleated, and heart growth is a r esult of cell hyperplasia T he percentage of binucleated myocytes gradually increase s from 2% at 77 days of gestation to 50% at 135 days gestation and 90% at 4 6 weeks after birth in the ovine model (Jonker and others 2007) It appears that before 110 days of gestation in fetal

PAGE 102

102 sheep, cardiac growth is due to mononucleated myocyte hyperp lasia, while after 110 days of gestation, the size of both mononucleated and binucleated myocytes increases. This increase is associated with cell proliferation and increased transition from mononucleated myocytes to binucleated myocytes, all of which cont ribute to cardiac enlargement and maturation before birth (Burrell and others 2003; Jonker and others 2007) It was proposed that exogenous insults have different effects on heart growth depending on the time the st ress is imposed. In early gestation, increased cardiac workload due to systolic hypertension or increased metabolic demands leads to cardiac enlargement, by stimulating myocyte hyperplasia and delay ing binucleation and maturation. I n older hearts, increase d cardiac workload causes heart hypertrophy due to an increase in cell size and hyperplasia of non cardiomy o cyte components (Oparil and others 1984) Cortisol Ef fects on Fetal Heart in Late Gestation Prenatal glucocorticoid exposure has been reported to program fetal heart growth and adult cardiovascular diseases As reported previously in the fetal heart there is an abundant expression of both MR and GR, and at the same time the activity of HSD 2 is relatively low, which suggests local effects of glucocorticoids through both MR and GR (Lumbers and others 2005; Reini and others 2006) Studies show that cortisol infusion into the left coronary artery of the fetal lamb significantly decreased DNA concentration in the left ventricle, indicating that cortisol may promote heart maturation by shifting from cell proliferation to cell hypertrophy (Rudolph and others 1999) Similarly, anothe r study showed that a very high rate of infusion of cortisol for 2 3 days at 130 days of gestation significantly increased cell size of uninucleated and binucleated myocytes in the left ventricle, causing heart hypertrophy (Lumbers and

PAGE 103

103 other s 2005) In the rat model, it was found that cortisol infusion to the mother promoted fetal heart maturation by stimulating the transition of c ardiac myosin heavy chain from the beta isoform to the alpha isoform (Bi an and others 1992) However, results of some other studies are controversial. Giraud reported that cortisol infusion into the fetal circumflex coronary artery had no effects on changes in cardiomyocyte size or the percentage of binucleation, but increase d the expression of Ki67, a cell proliferation marker (Giraud and others 2006) Maternal cortisol infusion significantly increased fetal heart weight to body weight ratio (Reini and others 2008) with an increase in Ki67 expression (data not published) The reason that these two studies showed cell hyperplasia instead of hypertrop hy might be due to the low cortisol dose used as compared to the higher doses used in other studies, based on the observation that the effect of cortisol is dose dependent (Bian and others 1992; Lumbers and others 20 05) For example, i n study, the dose of cortisol we use d wa s relatively low (1mg/kg/d ay ). At this rate of infusion, fetal cortisol concentration of treated ewes was about 2.7 ng/ml, and the free cortisol concentration would be 1. 9 nM based on the expected free fraction of cortisol in the fetus Since MR has higher affinity to cortisol compared to GR, 1.9 nM free cortisol concentration would result in 85% occupancy of MR and 60% occupancy of GR (Reini and others 2008) MR appears to prevent cell loss and promote survival after injury (Crochemore and others 2005; Fraccarollo and others 2004; Lai and others 2007) while GR has been reported to stimulate cell apoptosis and terminal differentiation (Almeida and others 2000; Fowden 1995) The higher occupancy of MR (85%) probably explains why cortisol infusion increased cell proliferation instead of cell hypertrophy which further resulted in heart enlargement

PAGE 104

104 Similarly in the current study, the same dose of cortisol (1mg/kg/d ay ) was used, and we saw a significant increase of cardiac wall thickness /tibia length in the fetuses of treated ewes. Gender Characteristics of Cardiovascular Outcomes In this study, we saw a gender effect on fetal cardiac development in the control group. This is not surprising because it has been long accepted that cardiovascular diseases affect men and women differently, and studies show that women are less likely to have adverse cardiovascular outcomes compared to men (Daugherty and others 2013; Grigore and others 2008) Among patients with isolated systolic hypertension, women had concentric hypertrophy featuring increased left ventricle wall thickness, increased left ventricle ma ss and no ventricle chamber enlargement, while men had acentric hypertrophy with enlarged left ventricle chamber, increased left ventricle mass and no changes of left ventricle wall thickness (Krumholz and othe rs 1993) Women also are more likely to have preserved systolic function in heart failure and aortic stenosis (Aurigemma and Gaasch 1995; Carroll and others 1992; Gerdts and others 2001; Masoudi and others 2003) Even under normal conditions the left ventricle mass in men is greater than that in women after normalization to body surface area (Gardin and others 1995; Levy and others 1987) As a result, the myocardial mass th at exists in normal adult men appears as a state of relative hypertrophy (de Simone and others 1995) This gender difference of cardiovascular outcomes might be caused by expression of different proteins between women and men. Protein pattern comparison revealed 7 and 22 protein spots with sex related expression profiles which might contribute to gender effects of ca rdiovascular diseases (Diedrich and others 2007) Gender differences in metabolic syndromes may also contribute to ge nder differences in

PAGE 105

105 cardiovascular diseases. I mpaired glucose tolerance and impaired fasting glucose appeared more frequently in men, whereas impaired glucose tolerance was observed more often in women. Lipid accumulation patterns also differ between men a nd women: p remenopausal women more frequently develop peripheral obesity, whereas men and postmenopausal women are more prone to central obesity which is associated with increased cardiovascular mortality (Regitz Zagrosek and others 2006) Besides, t he differential effects of sex hormones on the cardiomyocytes may account for the gender effec ts. Androgen and estrogen receptors have been detected in cardiac tissue of both women and men (Weinberg and others 1999) and androgen and estrogen have completely different effects on left ventricle mass, fibrosis and vascular contraction (Lund and Mancini 2004; Ozaki and others 2001) In a st udy of adaptive hypertrophy in rat model, male hearts demonstrated impaired contractility, with decrease of s arcoplasmic reticulum Ca 2+ ATPase mRNA levels and increase of beta myosin heavy chain and ANF mRNA compared to female hearts, and estrogen pathway was proposed to mediate the gender differences in gene expression (Weinberg and oth ers 1999) Specifically, t he sex of the fetus affects glucocorticoid programming of fetal growth Studies in mice showed that dexamethasone treatment of 60 hours beginning at E12.5 significantly increased HSD 2 mRNA expression at E14.5 and protein level at E17.5 in the placentas of female only (Cuffe and others 20 11) Another study using the same protocol but with natural glucocorticoid, corticosteroid, showed that corticosteroid significantly increased placental size, thickness and IGF2 expression of male fetuses only (Cuffe and others 2012) Activity of HSD 2 determines the amount of glucocorticoids that pass through placenta, and the placental size and growth factor

PAGE 106

106 mRNA level s are associated with fetal growth. These studies suggest a sex specific alteration to the placenta with glucocorticoid treatme nts. A sex difference also exists in the cord blood concentrations of growth hormone, IGFs, leptin and fetal insulin production (Yajnik and others 2007) and those hormones interact with the function of glucocorticoids in the fetus. Prenatal glucocorticoid indu ced hypertension is also gender specific. In a study using rats, only male offspring that received prenatal dexametha sone treatments on days 13 14, 15 16, 17 18 of gestation had elevated blood pressure at 6 months of age (Ortiz and others 2003) Similarly, dexamethasone exposure in late gestation in rats significantly increased the systolic blood pressure of male offspring at 24 weeks old age. The protein exp ression of bot h uncoupling protein 2 and 3 ( UCP 2 and UCP 3 ) in the hearts of the male offspring was also significantly decreased, and UCP expression may be linked with changes in cardiac metabolic fuel selection ( Langdown and others 2001)

PAGE 107

107 Table 5 1a Number o f ewes with live or stillborn lambs in the first part of the study L ive lamb stillborn Control 5 1 Cortisol 0 3 (Fisher exact test: p=0.048) Table 5 1b Number of ewes with live or stillborn fetuse s in the second part of the study L ive fetus stillborn Control 8 1 Cortisol 7 5 ( Fisher exa ct test: p= 0.178 ) Table 5 1 c Total n umber of ewes with live or stillborn fetuses in the study live stillborn Control fetus lamb 2 8 5 Cor tisol fetus 8 7 (* one ewe had twins Chi square test of stillbirth rate between two groups: p=0.053.)

PAGE 108

108 Figure 5 1 Fetal organ weight per body weight ratio. indicates that fetal kidney weight/body weight ratio is significantly higher in cor tisol group compared to that of control group. Control: n=9; cortisol: n=7 PRAD: peri renal adipose tissue. R: right, L: left.

PAGE 109

109 Table 5 2 Fetal somatic measurements (cm) Measurements Cortisol group Control group Crown to rump 61.211.55 59.581.53 Cro wn 30.470.54 32.191.58 Bonnet 26.30.55 25.960.62 Girth 40.343.14 37.71.14 Tibia 12.70.2 13.080.32 Hock to hoof RR 21.710.34 22.010.65 LR 21.930.28 22.090.63 RF 28.360.42 29.290.77 LF 28.430.37 29.030.76 Whole leg RR 39.940.76 41.011.04 LR 40.140.64 41.11.06 RF 33.670.57 34.310.81 LF 33.50.51 34.210.85 Control: n=9; cortisol: n=7 Figure 5 2 Fetal heart thickness in left ventricle, septum and right ventricle. Straight lines indicate that wall thickness (m m) of septum is significantly higher than that of left ventricle and right ventricle. Control: n=9; cortisol: n=7. l v: left ventricle, rv: right ventricle.

PAGE 110

110 Figure 5 3 Wall thickness in fetal heart normalized by length of the tibia indicat es that septum thickness/tibia l length is r significantly greater in cortisol group compared to control group. Control: n=9; cortisol: n=7. l v: left ventricle, rv: right ventricle. Figure 5 4 Fetal heart weight to body weight ratio between male and female fetuses of contro l ewes indicates that male fetuses had significantly heavier hearts compared to female fetuses. Control: n=9; cortisol: n=7.

PAGE 111

111 Table 5 3 Number of male and female fetuses in both groups in current study male female Control 6 3 Cortisol 0 7 (Fisher exact test, P=0.011) Figure 5 5 Fetal heart weight to body weight ratio of female fetuses of control and cortisol treated ewes indicates that cortisol treatment significantly increased fetal heart weight ratio compared to control group. Control: n=9; cortisol: n=7.

PAGE 112

112 Table 5 4 Sequences of primer sets for ANP, BNP and CNP Gene Forward Primer Reverse Primer Ovine ANP CTCCTCTTTGTGGCGTTTCAG CAGAGCCATACACGGGATTTG Ov ine BNP CAAGGTGCGGGTTTCTGAA GGTCCAACAGCTCCTGCAAT Ovine CNP CGCGCGCAAATACAAAGG CAGCTTGAGGCCGAAGCA Figure 5 6 Fold change of mRNA expression of CNP relative to control group The fetuses in the c ortisol treated group had incr eased mRNA expression of CNP One tail t test: p =0.0 28 Control: n=9; cortisol: n=7.

PAGE 113

113 CHAPTER 6 SUMMARY Intrauterine programming of adult diseases has been supported by multiple studies. Prenatal glucocorticoid exposure to the fetus decreases birth weight and causes fetal organ adaptation, which remains in adult life and leads to increased risk of cardiovascular, metabolic, and neurologic disorders. In this dissertation, we found that a mild increase of maternal cortisol concentratio n, which is comparable to that of pregnant women under stress, increased cell apoptosis in fetal cardiac conductive cells at 130 days of gestation. This apoptosis is attenuated by GR antagonist, not MR antagonist, suggesting a pathway of GR mediated cell d eath. GR mediated pathway may not be the only cause of Purkinje fiber apoptosis. As mentioned in Chapter 4, infusion of cortisol significantly increased maternal glucose concentration Maternal glucose is readily transported across the pl acenta to the fetus and similar studies have show n that maternal cortisol infusion increased fetal glucose concentration s (Jensen and others 2005; Jensen and others 2002b) As a result, it is reas onable to assume that fetal glucose concentration increased correspondingly with cortisol infusion in the studies of Chapter 4 Studies have shown that hyperglycemia directly induces apoptotic cell death in the myocardium in vivo in a rat model, pos sibly through the mitochondria l cytochrome c mediated caspase 3 pathway (Cai and others 2002) V entricular myocardial biopsies fro m diabetic patients also demonstrated increased cell apoptosis in myocytes, endothelial cells and fibroblasts. Co localization of nitrotyrosine expression and cell apoptosis suggested a possible link between oxidative stress and cell death (Frustaci and others 2000) The h exosamine biosynthetic pathway and a dysfunctional ubiquitin proteasome system (UPS) are potential mediato rs of this

PAGE 114

114 process (Marfella and others 2009; Rajamani and Essop 2010) However, in those studies Purkinje fibers were n ot studied As part of cardiac conduction system, Purkinje fibers have a large content of glycogen to maintain high metabolism in late gestation (Forsgren and Thornell 1981) which make them a target for oxidative stress (Ceriello 2000) Clinical studies proved that the magnitude of hypergly cemia correlated with the site and extent of the myocardial infarct, and the magnitude of ST segment elevation (Gokhroo a nd Mittal 1989) and experiments in rats and cultured cells showed that oleanolic acid, an antioxidant, blunted hyperglycemia induced contractile dysfunction (Mapanga and others 2012) These data suggest possible d amage of cardiac conduction system from hyperglycemia. Cells with stem cell markers became apoptotic with infusion of cortisol as well, suggesting decreased cell renew or turn over in those fetal hearts. These observations provide another possible explana tion for Purkinje fiber apoptosis. Cardiac stem cells may directly differentiate into Purkinje fibers, may express proteins or cytokines to mediate Purkinje fiber differentiation, or may form some other kinds of cells including vasculature cells and fibrob lasts that support the development of cardiac conductive system. The c kit positive stem cells we observed in cortisol exposed fetal hearts scatter among cardiomyocytes, around blood vessels and Purkinje fibers, or between muscle bundles. The distribution of those stem cells suggests that they might be EPDCs, and t heir localization reflects their function. When the same dose of cortisol was given to the ewes from 115 days until 140 143 days of gestation, more than half of ewes had stillborn fetuses. This c ould be correlated with increased cardiac cell apoptosis in Purkinje fibers and c kit positive cells

PAGE 115

115 as observed in Chapter 3 In ewes with stillborn fetuses, insulin resistance was developed with decreased uterine blood flow. M aternal insulin resistance and the development of type II diabetes could be a nother cause of still birth, probably by changes of related regulatory hormones and epigenetic modulation, instead of by changes of maternal metabolites. Decreased uterine blood flow might be a consequence of the hormonal and genetic changes. in somatic growth, or in organ weight except for the heart and kidney C ardiac fibrosis was comparable to the control fetuses. This probabl y explains why they survived because yet stillborn fetuses to control fetuses because the fetuses died at various gestational ages. Also since they were dead at the time of necro psy their organ weight is not accurate and their tissues started degrading, which makes it difficult to analyze. If the stillborn fetuses from the cortisol treated group could be added to the analysis, more significant differences in fetal development bet ween the two groups would be expected. Fetal growth is mostly regulated by fetal insulin and IGFs while fetal tissue differentiation is mostly regulated by fetal cortisol (Fowden and Forhead 2009a) In this dissertation infusion of cortis ol started at 115 days of gestation. Since maternal cortisol can pass across the placenta, this infusion caused an early increase of fetal cortisol concentration in late gestation. Cortisol inhibits tissue growth and stimulate s cell differentiation of a wide range of fetal tissues including the liver, lungs, gut, skeletal muscle and adipose tissue (Fowden and others 1998a) Cortisol also stimulates the expression of growth hormone receptors in the fetal liver, which promotes the

PAGE 116

116 production of IGF I As a result, the ratio of plasma IGFI over IGFII is increased in the fetus, gett ing close to the ratio in the adults. In other tissues like skeletal muscles, studies show that cortisol infusion at 127 130 days of gestation in an ovine model decreases the mRNA expression of both IGFI and IGFII. These data are consistent with the effect s of cortisol on promoting tissue differentiation and maturation. When comparing live fetuses from the control and cortisol groups, we observed a significant enlargement of fetal hearts and kidneys with cortisol infusion. Although we od pressure in those fetuses, the change of the kidney weight implies a risk of cardiac diseases, possibly hypertension, if those fetuses lived to adulthood. It has been predicted that h ypertension in adults is strongly related to a low birth weight and a large placenta caused by glucocorticoid exposure (Barker and others 1993b) In a rat model maternal protein restriction significantly increa sed systolic blood pressure in offspring, and investigation of the placenta in these pregnancies revealed attenuated activity of HSD 2 (Langley Evans and others 1996a) indicating th at fetal cortisol exposure was involved in the programming of hypertension Another study showed that prenatal dexamethasone treatment significantly decreased birth weight, placenta weight, and adult blo od pressure compared to that of offspring of control rats (Benediktsson and others 1993) This glucocorticoid induction of adult onset hypertension could b e explained in different ways. Some studies suggest that prenatal glucocorticoids cause a cluster of metabolic abnormalities, including insulin resistance in fetuses and their postnatal lives, with associated hypertension (Sugden and others 2001) Other studies suggest that glucocorticoids auto regulate the expression of GR, and possibly MR, in the fetal brain, alters the fetal HPA axis and other related brain

PAGE 117

117 function, resulting in cardiovascular problems (Langley Evans and others 1996a; Langley Evans and others 1996b; Meyer and Rothuizen 1994) Kidney is another site for glucocorticoid programming of hypertension. It was reported that injection of dexamethasone (0.2mg/kg) twi ce on 15 and 16 days of gestation in a rat model significantly decreased glomeruli number and increased systolic blood pressure in offspring (Ortiz and others 2001) and further investigation found that more glomeruli had glomerulosclerosis in the dexamethasone treated group (Ortiz an d others 2003) Another study in the ovine model found that dexamethasone treatment in early gestation (26 28 days of gestation) significantly increased kidney weight at 127 days of gestation. Meanwhile, when stimulated with angiotensin II, dexamethasone treated fetuses had a reduced increase of urine flow and glomerular filtration rate compared to control fetuses, implying altered kidney function. Further investigation found that at 130 days of gestation, mRNA expression of angiotensinogen, AT1 and AT2 re ceptors were increased in the kidney of dexamethasone treated fetuses (Moritz and others 2002) This programming of fetal kidney happens when glucocorticoids were administered at a time of active nephrogenesis (Baum 2010) and might affect renal function and consequently blood pressure. In the current study, we saw an increase of fetal kidney measur e fetal blood pressure, it would be interesting to look at the changes of ultra structure in those kidneys in future studies. In this dissertation, a mild increase of cortisol concentration in ewes comparable to maternal stress induced both cell proliferat ion and cell apoptosis in the fetal heart at 130 days of gestation. Cell proliferation existed mostly in cardiomyocytes, mediated by

PAGE 118

118 MR, while cell apoptosis existed mostly in conductive cells, stem cells and fibroblasts, mediated by GR. This change of fet al hearts may cause cardiac remodeling and dysfunction, and may further cause increased fetal death when the infusion of cortisol is prolonged, as observed in Chapter 5. The mild increase of maternal cortisol could also cause maternal glucose intolerance, and further insulin resistance, which may also contribute to the increased stillbirth rate. These results raised concerns to outcomes of pregnancy under stressed or with prenatal glucocorticoid exposure, as glucocorticoids treatments have been a standard p rotocol to promote fetal lung maturation. The different roles of MR and GR may provide potential targets to block adverse cortisol effects.

PAGE 119

119 LIST OF REFERENCE S 1995 N IH 1995. Effect of corticosteroids for fetal maturation on perinatal outcomes. NIH Consensus Development panel on the effectof corticosteroids for fetal maturation on perinatal outcomes. JAMA. p. 413 418. Abbasi S, Hirsch D, Davis J, Tolosa J, Stouffer N, Debbs R, Gerdes JS. 2000. Effect of single versus multiple courses o f antenatal corticosteroids on maternal and neonatal outcome. Am J Obstet Gynecol 182(5):1243 9. Abuzzahab MJ, Schneider A, Goddard A, Grigorescu F, Lautier C, Keller E, Kiess W, Klammt J, Kratzsch J, Osgood D et al. 2003. IGF I receptor mutations resul ting in intrauterine and postnatal growth retardation. N Engl J Med 349(23):2211 22. Airey JA, Almeida Porada G, Colletti EJ, Porada CD, Chamberlain J, Movsesian M, Sutko JL, Zanjani ED. 2004. Human mesenchymal stem cells form Purkinje fibers in fetal she ep heart. Circulation 109(11):1401 7. Al Jarallah AS. 2004. Reversible cardiomyopathy caused by an uncommon form of congenital adrenal hyperplasia. Pediatr Cardiol 25(6):675 6. Almeida OF, Cond GL, Crochemore C, Demeneix BA, Fischer D, Hassan AH, Meyer M, Holsboer F, Michaelidis TM. 2000. Subtle shifts in the ratio between pro and antiapoptotic molecules after activation of corticosteroid receptors decide neuronal fate. FASEB J 14(5):779 90. Aman J, Hansson U, Ostlund I, Wall K, Persson B. 2011. Increa sed fat mass and cardiac septal hypertrophy in newborn infants of mothers with well controlled diabetes during pregnancy. Neonatology 100(2):147 54. Andrews RC, Walker BR. 1999. Glucocorticoids and insulin resistance: old hormones, new targets. Clin Sci ( Lond) 96(5):513 23. Aoyama N, Yamashina S, Poelmann RE, Gittenberger De Groot AC, Izumi T, Soma K, Ohwada T. 2002. Conduction system abnormalities in rat embryos induced by maternal hyperthermia. Anat Rec 267(3):213 9. Armitage JA, Khan IY, Taylor PD, Na thanielsz PW, Poston L. 2004. Developmental programming of the metabolic syndrome by maternal nutritional imbalance: how strong is the evidence from experimental models in mammals? J Physiol 561(Pt 2):355 77. Atkinson A, Inada S, Li J, Tellez JO, Yanni J, Sleiman R, Allah EA, Anderson RH, Zhang H, Boyett MR et al. 2011. Anatomical and molecular mapping of the left and right ventricular His Purkinje conduction networks. J Mol Cell Cardiol 51(5):689 701.

PAGE 120

120 Aurigemma GP, Gaasch WH. 1995. Gender differences i n older patients with pressure overload hypertrophy of the left ventricle. Cardiology 86(4):310 7. hydroxycorticosteroids by the adrenal gland in sheep during last days of pregnancy and 1st days of l actation]. Acta Physiol Pol 20(4):537 46. Barker DJ. 1998. In utero programming of chronic disease. Clin Sci (Lond) 95(2):115 28. Barker DJ, Fall CH. 1993. Fetal and infant origins of cardiovascular disease. Arch Dis Child 68(6):797 9. Barker DJ, Gluckm an PD, Godfrey KM, Harding JE, Owens JA, Robinson JS. 1993a. Fetal nutrition and cardiovascular disease in adult life. Lancet 341(8850):938 41. Barker DJ, Osmond C, Golding J, Kuh D, Wadsworth ME. 1989. Growth in utero, blood pressure in childhood and adul t life, and mortality from cardiovascular disease. BMJ 298(6673):564 7. Barker DJ, Osmond C, Simmonds SJ, Wield GA. 1993b. The relation of small head circumference and thinness at birth to death from cardiovascular disease in adult life. BMJ 306(6875):422 6. Battaglia FC. 2007. Placental transport: a function of permeability and perfusion. Am J Clin Nutr 85(2):591S 597S. Baum M. 2010. Role of the kidney in the prenatal and early postnatal programming of hypertension. Am J Physiol Renal Physiol 298(2):F23 5 47. Beitins IZ, Kowarski A, Shermeta DW, De Lemos RA, Migeon CJ. 1970. Fetal and maternal secretion rate of cortisol in sheep: diffusion resistance of the placenta. Pediatr Res 4(2):129 34. Bell ME, Wood CE, Keller Wood M. 1991. Influence of reproducti ve state on pituitary adrenal activity in the ewe. Domest Anim Endocrinol 8(2):245 54. Benediktsson R, Lindsay RS, Noble J, Seckl JR, Edwards CR. 1993. Glucocorticoid exposure in utero: new model for adult hypertension. Lancet 341(8841):339 41. Bergman R N. 1989. Lilly lecture 1989. Toward physiological understanding of glucose tolerance. Minimal model approach. Diabetes 38(12):1512 27. Bian X, Briggs MM, Schachat FH, Seidler FJ, Slotkin TA. 1992. Glucocorticoids accelerate the ontogenetic transition of c ardiac ventricular myosin heavy chain isoform expression in the rat: promotion by prenatal exposure to a low dose of dexamethasone. J Dev Physiol 18(1):35 42.

PAGE 121

121 Bian X, Seidler FJ, Slotkin TA. 1993. Fetal dexamethasone exposure interferes with establishment of cardiac noradrenergic innervation and sympathetic activity. Teratology 47(2):109 17. Bingley PJ, Colman P, Eisenbarth GS, Jackson RA, McCulloch DK, Riley WJ, Gale EA. 1992. Standardization of IVGTT to predict IDDM. Diabetes Care 15(10):1313 6. Bloom S L, Sheffield JS, McIntire DD, Leveno KJ. 2001. Antenatal dexamethasone and decreased birth weight. Obstet Gynecol 97(4):485 90. Botting KJ, Wang KC, Padhee M, McMillen IC, Summers Pearce B, Rattanatray L, Cutri N, Posterino GS, Brooks DA, Morrison JL. 201 2. Early origins of heart disease: low birth weight and determinants of cardiomyocyte endowment. Clin Exp Pharmacol Physiol 39(9):814 23. Bradbury MJ, Akana SF, Dallman MF. 1994. Roles of type I and II corticosteroid receptors in regulation of basal activ ity in the hypothalamo pituitary adrenal axis during the diurnal trough and the peak: evidence for a nonadditive effect of combined receptor occupation. Endocrinology 134(3):1286 96. Buchanan TA, Metzger BE, Freinkel N, Bergman RN. 1990. Insulin sensitivi ty and B cell responsiveness to glucose during late pregnancy in lean and moderately obese women with normal glucose tolerance or mild gestational diabetes. Am J Obstet Gynecol 162(4):1008 14. Buescher MA, McClamrock HD, Adashi EY. 1992. Cushing syndrome in pregnancy. Obstet Gynecol 79(1):130 7. Burke CW, Roulet F. 1970. Increased exposure of tissues to cortisol in late pregnancy. Br Med J 1(5697):657 9. Burrell JH, Boyn AM, Kumarasamy V, Hsieh A, Head SI, Lumbers ER. 2003. Growth and maturation of cardi ac myocytes in fetal sheep in the second half of gestation. Anat Rec A Discov Mol Cell Evol Biol 274(2):952 61. Caceres A, Payne MR, Binder LI, Steward O. 1983. Immunocytochemical localization of actin and microtubule associated protein MAP2 in dendritic spines. Proc Natl Acad Sci U S A 80(6):1738 42. Cai L, Li W, Wang G, Guo L, Jiang Y, Kang YJ. 2002. Hyperglycemia induced apoptosis in mouse myocardium: mitochondrial cytochrome C mediated caspase 3 activation pathway. Diabetes 51(6):1938 48. Canale E, S molich JJ, Campbell GR. 1987. Differentiation and innervation of the atrioventricular bundle and ventricular Purkinje system in sheep heart. Development 100(4):641 51.

PAGE 122

122 Carroll JD, Carroll EP, Feldman T, Ward DM, Lang RM, McGaughey D, Karp RB. 1992. Sex as sociated differences in left ventricular function in aortic stenosis of the elderly. Circulation 86(4):1099 107. Cavaghan MK, Ehrmann DA, Polonsky KS. 2000. Interactions between insulin resistance and insulin secretion in the development of glucose intole rance. J Clin Invest 106(3):329 33. Ceriello A. 2000. Oxidative stress and glycemic regulation. Metabolism 49(2 Suppl 1):27 9. Charlton V, Johengen M. 1987. Fetal intravenous nutritional supplementation ameliorates the development of embolization induced growth retardation in sheep. Pediatr Res 22(1):55 61. Chou JY. 1983. Temperature sensitive adult liver cell line dependent on glucocorticoid for differentiation. Mol Cell Biol 3(6):1013 20. Clarke KA, Ward JW, Forhead AJ, Giussani DA, Fowden AL. 2002. R egulation of 11 beta hydroxysteroid dehydrogenase type 2 activity in ovine placenta by fetal cortisol. J Endocrinol 172(3):527 34. Cobelli C, Toffolo GM, Dalla Man C, Campioni M, Denti P, Caumo A, Butler P, Rizza R. 2007. Assessment of beta cell function in humans, simultaneously with insulin sensitivity and hepatic extraction, from intravenous and oral glucose tests. Am J Physiol Endocrinol Metab 293(1):E1 E15. Cohen M, Stiefel M, Reddy WJ, Laidlaw JC. 1958. The secretion and disposition of cortisol duri ng pregnancy. J Clin Endocrinol Metab 18(10):1076 92. Comline RS, Silver M. 1970. Daily changes in foetal and maternal blood of conscious pregnant ewes, with catheters in umbilical and uterine vessels. J Physiol 209(3):567 86. Cottrell EC, Seckl JR. 2009 Prenatal stress, glucocorticoids and the programming of adult disease. Front Behav Neurosci 3:19. Crochemore C, Lu J, Wu Y, Liposits Z, Sousa N, Holsboer F, Almeida OF. 2005. Direct targeting of hippocampal neurons for apoptosis by glucocorticoids is re versible by mineralocorticoid receptor activation. Mol Psychiatry 10(8):790 8. Crowther CA, Doyle LW, Haslam RR, Hiller JE, Harding JE, Robinson JS, Group AS. 2007. Outcomes at 2 years of age after repeat doses of antenatal corticosteroids. N Engl J Med 3 57(12):1179 89.

PAGE 123

123 Crowther CA, Harding JE. 2007. Repeat doses of prenatal corticosteroids for women at risk of preterm birth for preventing neonatal respiratory disease. Cochrane Database Syst Rev(3):CD003935. Cuffe JS, Dickinson H, Simmons DG, Moritz KM. 2011. Sex specific changes in placental growth and MAPK following short term maternal dexamethasone exposure in the mouse. Placenta 32(12):981 9. Cuffe JS, O'Sullivan L, Simmons DG, Anderson ST, Moritz KM. 2012. Maternal corticosterone exposure in the mou se has sex specific effects on placental growth and mRNA expression. Endocrinology 153(11):5500 11. Curry DL, Bennett LL, Grodsky GM. 1968. Dynamics of insulin secretion by the perfused rat pancreas. Endocrinology 83(3):572 84. Dalziel SR, Lim VK, Lamber t A, McCarthy D, Parag V, Rodgers A, Harding JE. 2005a. Antenatal exposure to betamethasone: psychological functioning and health related quality of life 31 years after inclusion in randomised controlled trial. BMJ 331(7518):665. Dalziel SR, Walker NK, Pa rag V, Mantell C, Rea HH, Rodgers A, Harding JE. 2005b. Cardiovascular risk factors after antenatal exposure to betamethasone: 30 year follow up of a randomised controlled trial. Lancet 365(9474):1856 62. Daugherty SL, Masoudi FA, Zeng C, Ho PM, Margolis KL, O'Connor PJ, Go AS, Magid DJ. 2013. Sex differences in cardiovascular outcomes in patients with incident hypertension. J Hypertens 31(2):271 277. Davis EP, Glynn LM, Waffarn F, Sandman CA. 2011a. Prenatal maternal stress programs infant stress regulat ion. J Child Psychol Psychiatry 52(2):119 29. Davis EP, Waffarn F, Sandman CA. 2011b. Prenatal treatment with glucocorticoids sensitizes the hpa axis response to stress among full term infants. Dev Psychobiol 53(2):175 83. Davis EP, Waffarn F, Uy C, Hobel CJ, Glynn LM, Sandman CA. 2009. Effect of prenatal glucocorticoid treatment on size at birth among infants born at term gestation. J Perinatol 29(11):731 7. De Kloet ER, Vreugdenhil E, Oitzl MS, Jols M. 1998. Brain corticosteroid receptor balance in hea lth and disease. Endocr Rev 19(3):269 301. de Simone G, Devereux RB, Daniels SR, Meyer RA. 1995. Gender differences in left ventricular growth. Hypertension 26(6 Pt 1):979 83. Del Ry S. 2012. C type natriuretic peptide: A new cardiac mediator. Peptides 4 0C:93 98.

PAGE 124

124 DeLemos RA, Shermeta DW, Knelson JH, Kotas R, Avery ME. 1970. Acceleration of appearance of pulmonary surfactant in the fetal lamb by administration of corticosteroids. Am Rev Respir Dis 102(3):459 61. Echocardiographic measurements in infants of diabetic mothers and macrosomic infants of nondiabetic mothers. J Perinat Med 33(3):232 5. Deschenes. 2009. Climate Change and Birth W eight. In: M G, editor. American Economic Review. p. 211 217. Dettman RW, Denetclaw W, Ordahl CP, Bristow J. 1998. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. D ev Biol 193(2):169 81. Di Meglio F, Castaldo C, Nurzynska D, Romano V, Miraglia R, Bancone C, Langella G, Vosa C, Montagnani S. 2010. Epithelial mesenchymal transition of epicardial mesothelium is a source of cardiac CD117 positive stem cells in adult hum an heart. J Mol Cell Cardiol 49(5):719 27. Diedrich M, Tadic J, Mao L, Wacker MA, Nebrich G, Hetzer R, Regitz Zagrosek V, Klose J. 2007. Heart protein expression related to age and sex in mice and humans. Int J Mol Med 20(6):865 74. Doyle LW, Ford GW, Da vis NM, Callanan C. 2000. Antenatal corticosteroid therapy and blood pressure at 14 years of age in preterm children. Clin Sci (Lond) 98(2):137 42. Dunger DB, Petry CJ, Ong KK. 2007. Genetics of size at birth. Diabetes Care 30 Suppl 2:S150 5. Efstratiadi s A. 1998. Genetics of mouse growth. Int J Dev Biol 42(7):955 76. Entringer S, Buss C, Swanson JM, Cooper DM, Wing DA, Waffarn F, Wadhwa PD. 2012. Fetal programming of body composition, obesity, and metabolic function: the role of intrauterine stress and stress biology. J Nutr Metab 2012:632548. Eralp I, Lie Venema H, Bax NA, Wijffels MC, Van Der Laarse A, Deruiter MC, Bogers AJ, Van Den Akker NM, Gourdie RG, Schalij MJ et al. 2006. Epicardium derived cells are important for correct development of the P urkinje fibers in the avian heart. Anat Rec A Discov Mol Cell Evol Biol 288(12):1272 80. Fayol L, Masson P, Millet V, Simeoni U. 2004. Cushing's syndrome in pregnancy and neonatal hypertrophic obstructive cardiomyopathy. Acta Paediatr 93(10):1400 2.

PAGE 125

125 Faze l S, Cimini M, Chen L, Li S, Angoulvant D, Fedak P, Verma S, Weisel RD, Keating A, Li RK. 2006. Cardioprotective c kit+ cells are from the bone marrow and regulate the myocardial balance of angiogenic cytokines. J Clin Invest 116(7):1865 77. Ferreira Mart ins J, Ogrek B, Cappetta D, Matsuda A, Signore S, D'Amario D, Kostyla J, Steadman E, Ide Iwata N, Sanada F et al. 2012. Cardiomyogenesis in the developing heart is regulated by c kit positive cardiac stem cells. Circ Res 110(5):701 15. Fisayo AM. 2007. Plasma proteins and proteinuria in gestational malaria. Indian J Clin Biochem 22(2):93 5. Forsgren S, Thornell LE. 1981. The development of Purkinje fibres and ordinary myocytes in the bovine fetal heart. An ultrastructural study. Anat Embryol (Berl) 162 (2):127 36. Fowden AL. 1995. Endocrine regulation of fetal growth. Reprod Fertil Dev 7(3):351 63. Fowden AL. 2003. The insulin like growth factors and feto placental growth. Placenta 24(8 9):803 12. Fowden AL, Apatu RS, Silver M. 1995. The glucogenic cap acity of the fetal pig: developmental regulation by cortisol. Exp Physiol 80(3):457 67. Fowden AL, Forhead AJ. 2004. Endocrine mechanisms of intrauterine programming. Reproduction 127(5):515 26. Fowden AL, Forhead AJ. 2009a. Endocrine regulation of feto placental growth. Horm Res 72(5):257 65. Fowden AL, Forhead AJ. 2009b. Hormones as epigenetic signals in developmental programming. Exp Physiol 94(6):607 25. Fowden AL, Hill DJ. 2001. Intra uterine programming of the endocrine pancreas. Br Med Bull 60:12 3 42. Fowden AL, Hughes P, Comline RS. 1989. The effects of insulin on the growth rate of the sheep fetus during late gestation. Q J Exp Physiol 74(5):703 14. Fowden AL, Li J, Forhead AJ. 1998a. Glucocorticoids and the preparation for life after birth: a re there long term consequences of the life insurance? Proc Nutr Soc 57(1):113 22. Fowden AL, Mundy L, Silver M. 1998b. Developmental regulation of glucogenesis in the sheep fetus during late gestation. J Physiol 508 ( Pt 3):937 47.

PAGE 126

126 Fowden AL, Szemere J, Hughes P, Gilmour RS, Forhead AJ. 1996. The effects of cortisol on the growth rate of the sheep fetus during late gestation. J Endocrinol 151(1):97 105. Fraccarollo D, Galuppo P, Bauersachs J. 2004. Mineralocorticoid receptor antagonism and cardiac remod eling in ischemic heart failure. Curr Med Chem Cardiovasc Hematol Agents 2(4):287 94. French NP, Hagan R, Evans SF, Godfrey M, Newnham JP. 1999. Repeated antenatal corticosteroids: size at birth and subsequent development. Am J Obstet Gynecol 180(1 Pt 1): 114 21. Frustaci A, Kajstura J, Chimenti C, Jakoniuk I, Leri A, Maseri A, Nadal Ginard B, Anversa P. 2000. Myocardial cell death in human diabetes. Circ Res 87(12):1123 32. Fujioka A, Fujioka T, Ishida Y, Maekawa T, Nakamura S. 2006. Differential effects of prenatal stress on the morphological maturation of hippocampal neurons. Neuroscience 141(2):907 15. Fux Otta C, Szafryk de Mereshian P, Iraci GS, Ojeda de Pruneda MR. 2008. Pregnancies associated with primary adrenal insufficiency. Fertil Steril 90(4) :1199.e17 20. Gardin JM, Wagenknecht LE, Anton Culver H, Flack J, Gidding S, Kurosaki T, Wong ND, Manolio TA. 1995. Relationship of cardiovascular risk factors to echocardiographic left ventricular mass in healthy young black and white adult men and women The CARDIA study. Coronary Artery Risk Development in Young Adults. Circulation 92(3):380 7. Gerdts E, Zabalgoitia M, Bjrnstad H, Svendsen TL, Devereux RB. 2001. Gender differences in systolic left ventricular function in hypertensive patients with ele ctrocardiographic left ventricular hypertrophy (the LIFE study). Am J Cardiol 87(8):980 3; A4. Giraud GD, Louey S, Jonker S, Schultz J, Thornburg KL. 2006. Cortisol stimulates cell cycle activity in the cardiomyocyte of the sheep fetus. Endocrinology 147( 8):3643 9. Gittenberger de Groot AC, Vrancken Peeters MP, Mentink MM, Gourdie RG, Poelmann RE. 1998. Epicardium derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res 82(10):1043 52. Gluckman PD, Ha nson MA, Pinal C. 2005. The developmental origins of adult disease. Matern Child Nutr 1(3):130 41.

PAGE 127

127 Gokhroo R, Mittal SR. 1989. Electrocardiographic correlates of hyperglycemia in acute myocardial infarction. Int J Cardiol 22(2):267 9. Goldberg S, Lewenth al H, Gottfried I, Ben Aderet N. 1966. Free 11 hydroxycorticosteroids in plasma in normal pregnancies and in cases of fetal death and missed abortion. Am J Obstet Gynecol 95(7):892 6. Gopal RA, Acharya SV, Bandgar TR, Menon PS, Shah NS. 2012. Cushing dise ase with pregnancy. Gynecol Endocrinol 28(7):533 5. Grigore D, Ojeda NB, Alexander BT. 2008. Sex differences in the fetal programming of hypertension. Gend Med 5 Suppl A:S121 32. Hall JM, Couse JF, Korach KS. 2001. The multifaceted mechanisms of estradio l and estrogen receptor signaling. J Biol Chem 276(40):36869 72. Harris A, Seckl J. 2011. Glucocorticoids, prenatal stress and the programming of disease. Horm Behav 59(3):279 89. Hay WW, Sparks JW, Gilbert M, Battaglia FC, Meschia G. 1984a. Effect of in sulin on glucose uptake by the maternal hindlimb and uterus, and by the fetus in conscious pregnant sheep. J Endocrinol 100(1):119 24. Hay WW, Sparks JW, Wilkening RB, Battaglia FC, Meschia G. 1984b. Fetal glucose uptake and utilization as functions of ma ternal glucose concentration. Am J Physiol 246(3 Pt 1):E237 42. Hou J, Wang L, Jiang J, Zhou C, Guo T, Zheng S, Wang T. 2012. Cardiac Stem Cells and their Roles in Myocardial Infarction. Stem Cell Rev. Howlett TA, Rees LH, Besser GM. 1985. Cushing's synd rome. Clin Endocrinol Metab 14(4):911 45. Hyer J, Johansen M, Prasad A, Wessels A, Kirby ML, Gourdie RG, Mikawa T. 1999. Induction of Purkinje fiber differentiation by coronary arterialization. Proc Natl Acad Sci U S A 96(23):13214 8. Jensen E, Wood C, K eller Wood M. 2002a. The normal increase in adrenal secretion during pregnancy contributes to maternal volume expansion and fetal homeostasis. J Soc Gynecol Investig 9(6):362 71. Jensen E, Wood CE, Keller Wood M. 2005. Chronic alterations in ovine materna l corticosteroid levels influence uterine blood flow and placental and fetal growth. Am J Physiol Regul Integr Comp Physiol 288(1):R54 61.

PAGE 128

128 Jensen EC, Gallaher BW, Breier BH, Harding JE. 2002b. The effect of a chronic maternal cortisol infusion on the late gestation fetal sheep. J Endocrinol 174(1):27 36. in epithelial tissues. Cell Tissue Res 343(3):537 43. Jobe AH, Soll RF. 2004. Choice and dose of corticosteroid for ant enatal treatments. Am J Obstet Gynecol 190(4):878 81. Jonker SS, Zhang L, Louey S, Giraud GD, Thornburg KL, Faber JJ. 2007. Myocyte enlargement, differentiation, and proliferation kinetics in the fetal sheep heart. J Appl Physiol 102(3):1130 42. Kapoor A Matthews SG. 2008. Prenatal stress modifies behavior and hypothalamic pituitary adrenal function in female guinea pig offspring: effects of timing of prenatal stress and stage of reproductive cycle. Endocrinology 149(12):6406 15. Keller Wood M. 1996. In hibition of stimulated and basal ACTH by cortisol during ovine pregnancy. Am J Physiol 271(1 Pt 2):R130 6. Keller Wood M, Cudd TA, Norman W, Caldwell SM, Wood CE. 1998. Sheep model for study of maternal adrenal gland function during pregnancy. Lab Anim Sc i 48(5):507 12. Khan K. 1992. Effect of prelambing supplementation and ewe body condition score on lamb survival and total weight of lamb weaned. In: Meyer HH, editor. Proceedings WesternSection American society of Animal Science. p. 175. Krumholz HM, La rson M, Levy D. 1993. Sex differences in cardiac adaptation to isolated systolic hypertension. Am J Cardiol 72(3):310 3. Lai M, Horsburgh K, Bae SE, Carter RN, Stenvers DJ, Fowler JH, Yau JL, Gomez Sanchez CE, Holmes MC, Kenyon CJ et al. 2007. Forebrain mineralocorticoid receptor overexpression enhances memory, reduces anxiety and attenuates neuronal loss in cerebral ischaemia. Eur J Neurosci 25(6):1832 42. Langdown ML, Smith ND, Sugden MC, Holness MJ. 2001. Excessive glucocorticoid exposure during late intrauterine development modulates the expression of cardiac uncoupling proteins in adult hypertensive male offspring. Pflugers Arch 442(2):248 55. Langley Evans SC, Gardner DS, Jackson AA. 1996a. Maternal protein restriction influences the programming o f the rat hypothalamic pituitary adrenal axis. J Nutr 126(6):1578 85.

PAGE 129

129 Langley Evans SC, Phillips GJ, Benediktsson R, Gardner DS, Edwards CR, Jackson AA, Seckl JR. 1996b. Protein intake in pregnancy, placental glucocorticoid metabolism and the programming of hypertension in the rat. Placenta 17(2 3):169 72. Leahy JL. 2005. Pathogenesis of type 2 diabetes mellitus. Arch Med Res 36(3):197 209. Levy D, Savage DD, Garrison RJ, Anderson KM, Kannel WB, Castelli WP. 1987. Echocardiographic criteria for left vent ricular hypertrophy: the Framingham Heart Study. Am J Cardiol 59(9):956 60. Liggins GC. 1994. The role of cortisol in preparing the fetus for birth. Reprod Fertil Dev 6(2):141 50. Liggins GC, Howie RN. 1972. A controlled trial of antepartum glucocorticoi d treatment for prevention of the respiratory distress syndrome in premature infants. Pediatrics 50(4):515 25. Lindner HR. 1959. Blood cortisol in the sheep: normal concentration and changes in ketosis of pregnancy. Nature 184(Suppl 21):1645 6. Lindner H R. 1964. Comparative aspects of cortisol transport: lack of firm binding to plasma proteins in domestic ruminants. J Endocrinol 28:301 20. Lindsay RS, Lindsay RM, Edwards CR, Seckl JR. 1996. Inhibition of 11 beta hydroxysteroid dehydrogenase in pregnant r ats and the programming of blood pressure in the offspring. Hypertension 27(6):1200 4. Lumbers ER, Boyce AC, Joulianos G, Kumarasamy V, Barner E, Segar JL, Burrell JH. 2005. Effects of cortisol on cardiac myocytes and on expression of cardiac genes in fet al sheep. Am J Physiol Regul Integr Comp Physiol 288(3):R567 74. Lund LH, Mancini D. 2004. Heart failure in women. Med Clin North Am 88(5):1321 45, xii. Macarthur JL. 1948. Plasma proteins in pregnancy. Can Med Assoc J 59(3):275. Manasek FJ. 1969. Myocar dial cell death in the embryonic chick ventricle. J Embryol Exp Morphol 21(2):271 84. Mapanga RF, Rajamani U, Dlamini N, Zungu Edmondson M, Kelly Laubscher R, Shafiullah M, Wahab A, Hasan MY, Fahim MA, Rondeau P et al. 2012. Oleanolic acid: a novel card ioprotective agent that blunts hyperglycemia induced contractile dysfunction. PLoS One 7(10):e47322.

PAGE 130

130 Marfella R, Di Filippo C, Portoghese M, Siniscalchi M, Martis S, Ferraraccio F, Guastafierro S, Nicoletti G, Barbieri M, Coppola A et al. 2009. The ubiq uitin proteasome system contributes to the inflammatory injury in ischemic diabetic myocardium: the role of glycemic control. Cardiovasc Pathol 18(6):332 45. Martinerie L, Munier M, Le Menuet D, Meduri G, Viengchareun S, Lombs M. 2013. The mineralocortic oid signaling pathway throughout development: Expression, regulation and pathophysiological implications. Biochimie 95(2):148 57. Masoudi FA, Havranek EP, Smith G, Fish RH, Steiner JF, Ordin DL, Krumholz HM. 2003. Gender, age, and heart failure with prese rved left ventricular systolic function. J Am Coll Cardiol 41(2):217 23. Matthews SG. 2000. Antenatal glucocorticoids and programming of the developing CNS. Pediatr Res 47(3):291 300. MB H. 1928. Growth of long bones of human fetus as illustrated by the tibia In: RE S, editor. Proc Soc Exp Biol Med: Society for Experimental Biology and Medicine. p. 638 641. McKinlay CJ, Crowther CA, Middleton P, Harding JE. 2012. Repeat antenatal glucocorticoids for women at risk of preterm birth: a Cochrane Systematic R eview. Am J Obstet Gynecol 206(3):187 94. Medica P, Giacoppo E, Fazio E, Aveni F, Pellizzotto R, Ferlazzo A. 2010. Cortisol and haematochemical variables of horses during a two day trekking event: effects of preliminary transport. Equine Vet J Suppl(38):1 67 70. Meyer HP, Rothuizen J. 1994. Increased free cortisol in plasma of dogs with portosystemic encephalopathy (PSE). Domest Anim Endocrinol 11(4):317 22. Mikawa T, Gourdie RG, Takebayashi Suzuki K, Kanzawa N, Hyer J, Pennisi DJ, Poma CP, Shulimovich M, Diaz KG, Layliev J et al. 2003. Induction and patterning of the Purkinje fibre network. Novartis Found Symp 250:142 53; discussion 153 6, 276 9. Milley JR, Simmons MA. 1979. Metabolic requirements for fetal growth. Clin Perinatol 6(2):365 76. Milman N Byg KE, Agger AO. 2000. Hemoglobin and erythrocyte indices during normal pregnancy and postpartum in 206 women with and without iron supplementation. Acta Obstet Gynecol Scand 79(2):89 98. Morison IM, Becroft DM, Taniguchi T, Woods CG, Reeve AE. 1996. S omatic overgrowth associated with overexpression of insulin like growth factor II. Nat Med 2(3):311 6.

PAGE 131

131 Morita T, Shimada T, Kitamura H, Nakamura M. 1991. Demonstration of connective tissue sheaths surrounding working myocardial cells and Purkinje cells of the sheep moderator band. Arch Histol Cytol 54(5):539 50. Moritz KM, Johnson K, Douglas Denton R, Wintour EM, Dodic M. 2002. Maternal glucocorticoid treatment programs alterations in the renin angiotensin system of the ovine fetal kidney. Endocrinology 1 43(11):4455 63. Muck BR, Hommel G. 1977. Plasma insulin response following intravenous glucose in gestational diabetics. Arch Gynakol 223(4):259 68. Murphy BE, Clark SJ, Donald IR, Pinsky M, Vedady D. 1974. Conversion of maternal cortisol to cortisone du ring placental transfer to the human fetus. Am J Obstet Gynecol 118(4):538 41. Newnham JP, Evans SF, Godfrey M, Huang W, Ikegami M, Jobe A. 1999. Maternal, but not fetal, administration of corticosteroids restricts fetal growth. J Matern Fetal Med 8(3):81 7. Nyirenda MJ, Lindsay RS, Kenyon CJ, Burchell A, Seckl JR. 1998. Glucocorticoid exposure in late gestation permanently programs rat hepatic phosphoenolpyruvate carboxykinase and glucocorticoid receptor expression and causes glucose intolerance in adult offspring. J Clin Invest 101(10):2174 81. O D. 2009. Climate Change and Birth Weight. In: M G, editor. American Economic Review. p. 211 217. O'Regan D, Kenyon CJ, Seckl JR, Holmes MC. 2004. Glucocorticoid exposure in late gestation in the rat permanentl y programs gender specific differences in adult cardiovascular and metabolic physiology. Am J Physiol Endocrinol Metab 287(5):E863 70. O'Shaughnessy RW, Hackett KJ. 1984. Maternal Addison's disease and fetal growth retardation. A case report. J Reprod Med 29(10):752 6. Ono N, Yamaguchi T, Ishikawa H, Arakawa M, Takahashi N, Saikawa T, Shimada T. 2009. Morphological varieties of the Purkinje fiber network in mammalian hearts, as revealed by light and electron microscopy. Arch Histol Cytol 72(3):139 49. Op aril S, Bishop SP, Clubb FJ. 1984. Myocardial cell hypertrophy or hyperplasia. Hypertension 6(6 Pt 2):III38 43. Ortiz LA, Quan A, Weinberg A, Baum M. 2001. Effect of prenatal dexamethasone on rat renal development. Kidney Int 59(5):1663 9.

PAGE 132

132 Ortiz LA, Quan A, Zarzar F, Weinberg A, Baum M. 2003. Prenatal dexamethasone programs hypertension and renal injury in the rat. Hypertension 41(2):328 34. Osler M, Pedersen J. 1962. Pregnancy in a patient with Addison's disease and diabetes mellitus. Acta Endocrinol (Copenh) 41:79 87. Ozaki T, Nishina H, Hanson MA, Poston L. 2001. Dietary restriction in pregnant rats causes gender related hypertension and vascular dysfunction in offspring. J Physiol 530(Pt 1):141 52. Paolini CL, Meschia G, Fennessey PV, Pike AW, Teng C, Battaglia FC, Wilkening RB. 2001. An in vivo study of ovine placental transport of essential amino acids. Am J Physiol Endocrinol Metab 280(1):E31 9. Pedersen P, Hasselgren PO, Angers U, Hall Angers M, Warner BW, LaFrance R, Li S, Fisch er JE. 1989. Protein synthesis in liver following infusion of the catabolic hormones corticosterone, epinephrine, and glucagon in rats. Metabolism 38(10):927 32. Pennisi DJ, Rentschler S, Gourdie RG, Fishman GI, Mikawa T. 2002. Induction and patterning of the cardiac conduction system. Int J Dev Biol 46(6):765 75. Petrik J, Reusens B, Arany E, Remacle C, Coelho C, Hoet JJ, Hill DJ. 1999. A low protein diet alters the balance of islet cell replication and apoptosis in the fetal and neonatal rat and is asso ciated with a reduced pancreatic expression of insulin like growth factor II. Endocrinology 140(10):4861 73. Poelmann RE, Lie Venema H, Gittenberger de Groot AC. 2002. The role of the epicardium and neural crest as extracardiac contributors to coronary va scular development. Tex Heart Inst J 29(4):255 61. Rajamani U, Essop MF. 2010. Hyperglycemia mediated activation of the hexosamine biosynthetic pathway results in myocardial apoptosis. Am J Physiol Cell Physiol 299(1):C139 47. Rashid S, Lewis GF. 2005. T he mechanisms of differential glucocorticoid and mineralocorticoid action in the brain and peripheral tissues. Clin Biochem 38(5):401 9. Ravelli AC, van der Meulen JH, Michels RP, Osmond C, Barker DJ, Hales CN, Bleker OP. 1998. Glucose tolerance in adults after prenatal exposure to famine. Lancet 351(9097):173 7. Regitz Zagrosek V, Lehmkuhl E, Weickert MO. 2006. Gender differences in the metabolic syndrome and their role for cardiovascular disease. Clin Res Cardiol 95(3):136 47.

PAGE 133

133 Reini SA, Dutta G, Wood C E, Keller Wood M. 2008. Cardiac corticosteroid receptors mediate the enlargement of the ovine fetal heart induced by chronic increases in maternal cortisol. J Endocrinol 198(2):419 27. Reini SA, Wood CE, Jensen E, Keller Wood M. 2006. Increased maternal c ortisol in late gestation ewes decreases fetal cardiac expression of 11beta HSD2 mRNA and the ratio of AT1 to AT2 receptor mRNA. Am J Physiol Regul Integr Comp Physiol 291(6):R1708 16. Reinisch JM, Simon NG, Karow WG, Gandelman R. 1978. Prenatal exposure to prednisone in humans and animals retards intrauterine growth. Science 202(4366):436 8. Ren R, Oakley RH, Cruz Topete D, Cidlowski JA. 2012. Dual role for glucocorticoids in cardiomyocyte hypertrophy and apoptosis. Endocrinology 153(11):5346 60. Reul J M, van den Bosch FR, de Kloet ER. 1987. Relative occupation of type I and type II corticosteroid receptors in rat brain following stress and dexamethasone treatment: functional implications. J Endocrinol 115(3):459 67. Richards EM, Hua Y, Keller Wood M. 2 003. Pharmacology and physiology of ovine corticosteroid receptors. Neuroendocrinology 77(1):2 14. Rogalska J, Kang P, Wotherspoon W, Macleod MR, Lai M. 2009. Effect of hyperthermia and anoxia on glucocorticoid and mineralocorticoid receptor expression in neonatal rat hippocampus. Neurosci Lett 450(2):196 200. Rond PH, Ferreira RF, Nogueira F, Ribeiro MC, Lobert H, Artes R. 2003. Maternal psychological stress and distress as predictors of low birth weight, prematurity and intrauterine growth retardation. Eur J Clin Nutr 57(2):266 72. Ronzoni S, Marconi AM, Cetin I, Paolini CL, Teng C, Pardi G, Battaglia FC. 1999. Umbilical amino acid uptake at increasing maternal amino acid concentrations: effect of a maternal amino acid infusate. Am J Obstet Gynecol 181 (2):477 83. Rota M, Kajstura J, Hosoda T, Bearzi C, Vitale S, Esposito G, Iaffaldano G, Padin Iruegas ME, Gonzalez A, Rizzi R et al. 2007. Bone marrow cells adopt the cardiomyogenic fate in vivo. Proc Natl Acad Sci U S A 104(45):17783 8. Rudolph AM, Ro man C, Gournay V. 1999. Perinatal myocardial DNA and protein changes in the lamb: effect of cortisol in the fetus. Pediatr Res 46(2):141 6. Rueda Clausen CF, Dolinsky VW, Morton JS, Proctor SD, Dyck JR, Davidge ST. 2011a. Hypoxia induced intrauterine grow th restriction increases the

PAGE 134

134 susceptibility of rats to high fat diet induced metabolic syndrome. Diabetes 60(2):507 16. Rueda Clausen CF, Morton JS, Davidge ST. 2011b. The early origins of cardiovascular health and disease: who, when, and how. Semin Repro d Med 29(3):197 210. Russell NE, Holloway P, Quinn S, Foley M, Kelehan P, McAuliffe FM. 2008. Cardiomyopathy and cardiomegaly in stillborn infants of diabetic mothers. Pediatr Dev Pathol 11(1):10 4. S.J.H H. 1998. Effect of transportation on plasma corti sol and packed cell volume in different genotypes of sheep. In: D.M. B, editor. Small Ruminant Research. p. 233 237. Salas SP, Rosso P, Espinoza R, Robert JA, Valds G, Donoso E. 1993. Maternal plasma volume expansion and hormonal changes in women with id iopathic fetal growth retardation. Obstet Gynecol 81(6):1029 33. Scheuer JL, Musgrave JH, Evans SP. 1980. The estimation of late fetal and perinatal age from limb bone length by linear and logarithmic regression. Ann Hum Biol 7(3):257 65. Schneider CA, R asband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9(7):671 5. Scir G, D'Anella G, Cristofori L, Mazzuca V, Cianfarani S. 2007. Marked left ventricular hypertrophy mimicking hypertrophic cardiomyopathy associated w ith steroid therapy for congenital adrenal hyperplasia. J Cardiovasc Med (Hagerstown) 8(6):465 7. Seckl JR. 2001. Glucocorticoid programming of the fetus; adult phenotypes and molecular mechanisms. Mol Cell Endocrinol 185(1 2):61 71. Seckl JR. 2004. Pren atal glucocorticoids and long term programming. Eur J Endocrinol 151 Suppl 3:U49 62. Silver M. 1990. Prenatal maturation, the timing of birth and how it may be regulated in domestic animals. Exp Physiol 75(3):285 307. Singh RR, Cuffe JS, Moritz KM. 2012. Short and long term effects of exposure to natural and synthetic glucocorticoids during development. Clin Exp Pharmacol Physiol 39(11):979 89. Skyler JS, O'Sullivan MJ, Robertson EG, Skyler DL, Holsinger KK, Lasky IA, McLeod AG, Burkett G, Mintz DH. 198 0. Blood glucose control during pregnancy. Diabetes Care 3(1):69 76.

PAGE 135

135 Sloboda DM, Newnham JP, Challis JR. 2000. Effects of repeated maternal betamethasone administration on growth and hypothalamic pituitary adrenal function of the ovine fetus at term. J En docrinol 165(1):79 91. Sloboda DM, Newnham JP, Challis JR. 2002. Repeated maternal glucocorticoid administration and the developing liver in fetal sheep. J Endocrinol 175(2):535 43. Sohn HJ, Yoo KH, Jang GY, Lee JH, Choi BM, Bae IS, Yim HE, Son CS, Lee J W. 2010. Aldosterone modulates cell proliferation and apoptosis in the neonatal rat heart. J Korean Med Sci 25(9):1296 304. Stewart PM, Mason JI. 1995. Cortisol to cortisone: glucocorticoid to mineralocorticoid. Steroids 60(1):143 6. Sugden MC, Langdown ML, Munns MJ, Holness MJ. 2001. Maternal glucocorticoid treatment modulates placental leptin and leptin receptor expression and materno fetal leptin physiology during late pregnancy, and elicits hypertension associated with hyperleptinaemia in the early gr owth retarded adult offspring. Eur J Endocrinol 145(4):529 39. Talge NM, Neal C, Glover V, Early Stress TaRaPSNFaNEoCaAMH. 2007. Antenatal maternal stress and long term effects on child neurodevelopment: how and why? J Child Psychol Psychiatry 48(3 4):245 61. Thaler I, Manor D, Itskovitz J, Rottem S, Levit N, Timor Tritsch I, Brandes JM. 1990. Changes in uterine blood flow during human pregnancy. Am J Obstet Gynecol 162(1):121 5. Tura A, Grassi A, Winhofer Y, Guolo A, Pacini G, Mari A, Kautzky Willer A. 2012. Progression to type 2 diabetes in women with former gestational diabetes: time trajectories of metabolic parameters. PLoS One 7(11):e50419. Veille JC, Hanson R, Sivakoff M, Hoen H, Ben Ami M. 1993. Fetal cardiac size in normal, intrauterine growth r etarded, and diabetic pregnancies. Am J Perinatol 10(4):275 9. Vela Huerta MM, Vargas Origel A, Olvera Lpez A. 2000. Asymmetrical septal hypertrophy in newborn infants of diabetic mothers. Am J Perinatol 17(2):89 94. Waffarn F, Davis EP. 2012. Effects o f antenatal corticosteroids on the hypothalamic pituitary adrenocortical axis of the fetus and newborn: experimental findings and clinical considerations. Am J Obstet Gynecol 207(6):446 54.

PAGE 136

136 Waterland RA, Garza C. 1999. Potential mechanisms of metabolic im printing that lead to chronic disease. Am J Clin Nutr 69(2):179 97. Weinberg EO, Thienelt CD, Katz SE, Bartunek J, Tajima M, Rohrbach S, Douglas PS, Lorell BH. 1999. Gender differences in molecular remodeling in pressure overload hypertrophy. J Am Coll Ca rdiol 34(1):264 73. Welberg LA, Seckl JR, Holmes MC. 2001. Prenatal glucocorticoid programming of brain corticosteroid receptors and corticotrophin releasing hormone: possible implications for behaviour. Neuroscience 104(1):71 9. White PC, Mune T, Rogers on FM, Kayes KM, Agarwal AK. 1997. 11 beta Hydroxysteroid dehydrogenase and its role in the syndrome of apparent mineralocorticoid excess. Pediatr Res 41(1):25 9. Winter EM, Gittenberger de Groot AC. 2007. Epicardium derived cells in cardiogenesis and car diac regeneration. Cell Mol Life Sci 64(6):692 703. Wintour EM, Coghlan JP, Oddie CJ, Scoggins BA, Walters WA. 1978. A sequential study of adrenocorticosteroid level in human pregnancy. Clin Exp Pharmacol Physiol 5(4):399 403. Wood CE. 2002. The ovine fe tal endocrine reflex responses to haemorrhage are not mediated by cardiac nerves. J Physiol 541(Pt 2):613 22. Woods KA, Camacho Hbner C, Savage MO, Clark AJ. 1996. Intrauterine growth retardation and postnatal growth failure associated with deletion of t he insulin like growth factor I gene. N Engl J Med 335(18):1363 7. Woolley CS, Gould E, Sakai RR, Spencer RL, McEwen BS. 1991. Effects of aldosterone or RU28362 treatment on adrenalectomy induced cell death in the dentate gyrus of the adult rat. Brain Res 554(1 2):312 5. Wu SM, Chien KR, Mummery C. 2008. Origins and fates of cardiovascular progenitor cells. Cell 132(4):537 43. Yajnik CS, Godbole K, Otiv SR, Lubree HG. 2007. Fetal programming of type 2 diabetes: is sex important? Diabetes Care 30(10):2754 5. Zhou B, Ma Q, Rajagopal S, Wu SM, Domian I, Rivera Feliciano J, Jiang D, von Gise A, Ikeda S, Chien KR et al. 2008. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature 454(7200):109 13. Zhu MJ, Ma Y, Long NM, Du M, Ford SP. 2010. Maternal obesity markedly increases placental fatty acid transporter expression and fetal blood triglycerides at

PAGE 137

137 midgestation in the ewe. Am J Physiol Regul Integr Comp Physiol 299(5):R1224 31.

PAGE 138

138 BIOGRAPHICAL SKETCH Xiaodi Feng was born in 1982. She grew up in a small town in China, where she had a lot of happy memories. Xiaodi started her journey of education at the age of 6 and was one of the top students from elementary school to high school. In 1999 Xiaodi was admitted to s even year MD/MS program in Shandong Medical University, a prestigious medical university which is now part of Shandong University through school mergence. In 2006 Xiaodi graduated from Shandong University with a MD and a master degree After graduation, ought the opportunity to study abroad. In 2007 Xiaodi started her PhD education wi th a teaching assistantship at C ollege of Pharmacy, University of Florida.