Epigenetic Mechanisms Regulating Activation of the Tal1 Oncogene in Normal and in Malignant Hematopoiesis

MISSING IMAGE

Material Information

Title:
Epigenetic Mechanisms Regulating Activation of the Tal1 Oncogene in Normal and in Malignant Hematopoiesis
Physical Description:
1 online resource (126 p.)
Language:
english
Creator:
Patel, Bhavita H
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Biochemistry and Molecular Biology (IDP)
Committee Chair:
Huang, Suming
Committee Members:
Lu, Jian Rong
Bungert, Jorg
Kilberg, Michael S
Bloom, David C

Subjects

Subjects / Keywords:
ctcf -- leukemia -- set1 -- tal1
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
CTCFTAL1/SCL is a critical transcription factor required for development of all hematopoietic lineages; yet, aberrant TAL1 transcription which is frequently observed in T-cell acute lymphoblastic leukemia (T-ALL), leads to leukemia manifestation. Therefore to dissect the underlying epigenetic mechanisms regulating TAL1 gene activity in normal and in malignant hematopoiesis this study was undertaken. Here, we report that TAL1 expression is regulated by differential intra- and interchromosomal chromatin loops in normal and leukemia cells, respectively. These loops determine which cell-type specific enhancers interact with the TAL1 promoter. The TAL1 +51 enhancer which is specifically active in erythroid precursors and inactive in leukemic T-cells, interacts with the upstream TAL1 promoter 1 via an activating chromatin loop.  hSET1 mediated H3K4 methylation facilitates this erythroid-specific long-range chromatin interaction, and regulates RNA polII recruitment at the TAL1 locus. SET1 is further required for hematopoietic stem cells (CD34+) capacity to generate burst forming and colony forming units. Furthermore, we find that insulator protein CTCF differentially reorganizes the TAL1 locus chromatin structure keeping the +51 enhancer in a close proximity to the TAL1 promoter in erythroid cells while blocking the same enhancer/promoter interaction in T-ALL. In addition, we identify role of Ldb1 in regulating TAL1 gene activation by regulating TAL1 enhancer/promoter interaction. Altogether, this study sheds light on molecular mechanisms that determine TAL1 gene activity in hematopoiesis and proposes chromatin looping regulated oncogene activation as a novel mechanism utilized by cancer cells.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Bhavita H Patel.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Huang, Suming.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-11-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045268:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 EPIGENETIC MECHANISMS REGULATING ACTIVATION OF THE TAL1 ONCOGENE IN NORMAL AND IN MALIGNANT HEMATOPOIESIS By BHAVITA PATEL A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMEN T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Bhavita Patel

PAGE 3

3 Dedicated to my parents, Harivadan Patel and Jyotsana Patel

PAGE 4

4 ACKNOWLEDGMENTS I owe my grati tude to all those who have made this dissertation possible. My deepest acknowledgments go to my mentor Dr. Suming Huang, who provided me with this opportunity and guided me whole heartedly through out the course of this study. I am very grateful to the memb ers of my committee Dr. Michael Kilberg, Dr. J rg Bungert, Dr. Jianrong Lu and Dr. David Bloom for all their useful comments, suggestions and constructive criticisms. I would like to thank all the members of the Hu a n g lab, especially Dr. Changwang Deng fo r his guidance and assistance with various experimental procedures. I am obliged to my colleague and friend Dr. Betsabeh Khoramnian, who always offered support and shared scientific ideas. I am thankful to T32 training grant in cancer research for providi ng me with financial assistance and to the interdisciplinary program at the University of Florida for providing an excellent platform to pursue my Ph.D. studies. I am truly indebted to all who contributed to this work either by sharing reagents or providin g collaborative or administrative help. Most Importantly, I am grateful to my family for their unconditional love and support, for never doubting my choices and for always being there. I would have not endured these years without my husband, Pritesh, who w as a constant source of encouragement and patience. I am thankful to my parents in law for being very supportive and taking care of my daughter so that I could fulfill my career goals. Lastly, I take this opportunity to acknowledge my parents, whom this di ssertation is dedicated; who made me see beyond the clouds, inspired my academic goals, and provided an excellent example of hard work, strength and perseverance.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 15 T cell Acute Lymphoblastic Leukemia (T ALL) ................................ ....................... 15 Clinical Presentati on ................................ ................................ ......................... 16 Molecular Abnormalities ................................ ................................ ................... 16 Prognosis of T ALL ................................ ................................ ........................... 17 Current T reatment Therapies for T ALL ................................ ........................... 17 TAL1 (T cell Acute Lymbhoblastic Leukemia 1): A Master Regulator of Hematopoiesis ................................ ................................ ................................ ..... 18 TAL1 Role i n Hematopoiesis ................................ ................................ ............ 18 TAL1 Role in T ALL ................................ ................................ .......................... 19 TAL1 Gene Is Regulated By Cis acting Factors in Erythroid Cells ................... 20 TAL1 Gene Is Regulated By Trans acting Factors In Erythroid Cells ............... 21 TAL1 Gene Regulation In T ALL ................................ ................................ ...... 22 2 MATERIALS AND METHODS ................................ ................................ ................ 28 Cell Culture and ShRNA Mediated Knock Down ................................ .................... 28 Primary Human Cord Blood Cell Culture and Erythroid Differentiation ................... 28 Giemsa/May Grunwald Staining Of Erythroid Cells ................................ ................ 29 FACs Analysis of (Cluster of Differentiatio n) CD34+, CD36+ and (Glycophorin A) GPA Surface Markers ................................ ................................ ..................... 29 Native and Cross linked Chromatin Immunoprecipitation Assay ............................ 29 Chromo some Conformation Capture Assay (3C) ................................ ................... 31 Calculation of the Relative Cross linking Frequency Using Image J ....................... 32 Reverse Transcripti on and Quantitative Polymerase Chain Reaction .................... 32 CD34+ Colony Formation Assay ................................ ................................ ............. 33 Luciferase Reporter Assay ................................ ................................ ...................... 33 Soft Agar Colony Formation Assay ................................ ................................ ......... 34 3 SET1 AND CTCF FACILITATE TAL1 PROMOTER/ENHANCER INTERACTION IN ERYTHROID PROGENITORS ................................ ................. 40

PAGE 6

6 Introductory Remarks ................................ ................................ .............................. 40 H3K4 Methyltransferase SET1 (Suvar, Enhancer of Zeste, Trithorax 1) .......... 41 Insulators and CTCF (CCCTC binding factor) ................................ .................. 42 Chromatin Looping and Transcription ................................ .............................. 45 Results ................................ ................................ ................................ .................... 48 Distinct Patterns of Histone Modifications are Associated with TAL1 Enhancer/Promoter Activities ................................ ................................ ........ 48 The Recruitment of hSET1 Correlates with TAL1 Trans criptional Activation during Hematopoiesis ................................ ................................ ................... 49 A Long range Chromatin Loop Mediates Enhancer/Promoter Interaction in the TAL1 Locus in Erythroid Precursors but not in T ALL Cells .................... 49 Recruitment of the hSET1 Complex is Essential for Long range Chromatin Loop and Transcription of the TAL1 Gene ................................ .................... 51 CTCF Mediated Cell type S pecific Chromatin Loops in the TAL1 Locus Regulate Expression of TAL1 Gene in Erythroid and Leukemic Cells ........... 52 Summary ................................ ................................ ................................ ................ 53 4 TAL1 GE NE REGULATION IN T CELL LEUKEMIA ................................ ............... 63 Introductory Remarks ................................ ................................ .............................. 63 Results ................................ ................................ ................................ .................... 65 Histone Modification Profile at the TAL1 Locus in T ALL Cells ......................... 65 Enhancer +51 is Epigenetically and Functionally Silent in T ALL ..................... 66 SET1 Independent TAL1 Gene Regulation in T ALL ................................ ........ 67 CTCF Mediated Cell type Specific Chromatin Loops in the TAL1 Locus Block TAL1 Enhancer/Promoter Interaction in T ALL ................................ .... 67 Summary ................................ ................................ ................................ ................ 69 5 ROLE OF LIM DOMAIN BINDING PROTEIN 1 IN TAL1 GENE REGULATION IN ERYTHROID CELLS ................................ ................................ .......................... 78 Introductory Remarks ................................ ................................ .............................. 78 Results ................................ ................................ ................................ .................... 7 9 Ldb1 Depletion Results in Decreased TAL1 mRNA and Protein Levels ........... 79 SET1 Depletion Alters Ldb1 Levels in Erythroid Cells ................................ ...... 80 Ldb1 Regulation of TAL1 Gene is Independent of H3K4me2&3 ...................... 81 Summary ................................ ................................ ................................ ................ 81 6 SUMMARY, DISCUSSION AND FUTURE DIRECTIONS ................................ ...... 87 Summary and Discussion ................................ ................................ ....................... 87 Putative TAL1 Interacting Regions in T ALL ................................ ..................... 91 Future Directions ................................ ................................ ................................ .... 94 Evaluating the Factors Regulating Cell type Specific Role for CTCF ............... 94 CTCF Depletion Studies in Erythroid and in T ALL Cells ................................ 96 Blocking CTCF Activity by Utilizing Artificial Zinc Finger DNA Binding Domains ................................ ................................ ................................ ........ 96

PAGE 7

7 APPENDIX TAL1 GENE REGULATION IN K562 AND JURKAT CELLS ................................ ................................ ................................ .................... 98 B. EFFECT OF SET1 DEPLETION ON CTCF SITE INTERACTIONS AT THE TAL1 LOCUS IN ERYTHROID CELLS ................................ ................................ ............ 99 C. PRMT1 MEDIATED ASYMMETRIC DIMETHYL H4R3 CROSS TALKS WITH H3 K4 METHYLATIONS AT THE GLOBIN LOCUS. ................................ .......... 100 LIST OF REFERENCES ................................ ................................ ............................. 108 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 125

PAGE 8

8 LIST OF TABLES Table page 2 1 Primer se q u ences ................................ ................................ ............................... 36

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Huma n TAL1 locus and protein isoforms ................................ ............................ 25 1 2 Distribution of genomic rearrangements involving TAL1 in T cell acute lymphoblastic leukemia. ................................ ................................ ..................... 26 1 3 TAL1 is a key regulator of hematopoiesis. Shown is the brief outline of normal hematopoiesis ................................ ................................ ........................ 27 2 1 Ex vivo differentiation of human cord blood CD34+ cell s. ................................ .. 35 3 1 Histone modification associated with TAL1 enhancer and promoter activity in erythroid cells. ................................ ................................ ................................ .... 55 3 2 TAL 1 promoter 1 and +51 enhancer interact in vivo in CD36+ erythroid progenitors. ................................ ................................ ................................ ......... 56 3 3 H3K4 methyltransfearse SET1 is required for the colony formation capacity of K562 and CD34+ HSCs. ................................ ................................ ................. 57 3 4 SET1 is recruited at the TAL1 enhancer/promoter elements and is required for activation of various erythroid genes including TAL1 ................................ ... 58 3 5 Loss of hSET1 disrupts the erythroid specific long range interaction between +51 enhancer and the TAL1 promoter 1 at the TAL1 locus. ............................... 59 3 6 Similar CTC F occupancy is observed across different cellular enviornments.. .. 61 3 7 CTCF organizes TAL1 locus to promote TAL1 promoter/enhancer interaction in erythroid cells.. ................................ ................................ ................................ 62 4 1 Histone modification profile at the TAL1 locus in T ALL REX and HPB ALL cells. ................................ ................................ ................................ ................... 71 4 2 Histone modification profile at the TA L1 locus in T ALL Jurkat cells. ................. 72 4 3 TAL1 +51 enhancer is neither functionally active nor does it interact with TAL1 promoter in T ALL cells. ................................ ................................ ............ 73 4 4 SET1 is neither recruited to the TAL1 locus nor is it required for TAL1 expression in T ALL Jurkat cells. ................................ ................................ ........ 74 4 5 Assessment of TAL1 expression an d chromosomal rearrangements in primary T ALL patient sample. ................................ ................................ ............ 75

PAGE 10

10 4 6 CTCF reorganizes TAL1 locus to block +51 enhancer mediated promoter activation in T cell leukemia. ................................ ................................ .............. 76 4 7 CTCF depletion in T ALL Jurkat cells induces TAL1 transcription. ..................... 77 5 1 Ldb1 is required for high levels of TAL1 in eryth roid cells. ................................ 83 5 2 Ldb1 regulates TAL1 transcription by stabilizing long range TAL1 promoter enhancer interaction in K562 cells. ................................ ................................ ..... 84 5 3 SET1 regulates Ldb1 levels in K562 and in MEL cells. ................................ ...... 85 5 4 Ldb1 depletion does not alter H3K4me2/3 enrichment at the TAL1 enhancer and promoter. ................................ ................................ ................................ ..... 86 6 1 Model: CTCF and epigenetic mediated chromatin looping regulated TAL1 expression in hematopoiesis and leukemogenesis. ................................ ............ 93 A 1 No difference is observed in Cohesin occupancy at the TAL1 locus in K562 and Jurkat cells. ................................ ................................ ................................ .. 98 B 1 No effect of SET1 depletion on CTCF 31 and +53 site chromatin loop in erythroid K 562 cells. ................................ ................................ ........................... 99 C 1 USF1 associated complexes. ................................ ................................ ........... 102 C 2 PRMT1 depletion affects global H3K4me2/3 levels.. ................................ ........ 103 C 3 globin transcription in EPO differentiated mES cells. ................................ ................................ ................................ ................. 104 C 4 PRMT1 is required for active H3K4 di and tri methylations at the mouse globin locus. ................................ ................................ ................................ ...... 105 C 5 Re introduction of PRMT1 rescues H3K4me2/3 levels. ................................ .... 106 C 6 H4R3ame is sufficient to allow SET1 me diated H3K4me2/3 in vitro. A) Experimental strategy for in vitro methylation assay. ................................ ........ 107

PAGE 11

11 LIST OF ABBREVIATIONS B HLHB1 B asic domain, helix loop helix protein, class B, 1 CD34+ Cluster of differentiation 34+ CD36+ Cluster o f differentiation 36+ COMPASS C omplex proteins associated with Set1 CTCF CCCTC binding factor 1 GATA1 Globin transcription factor 1 GPA G lycophorin a HCF C 1 Host cell factor C1 HOX11 Homeobox protein 11 JAK Janus Kinase LDB1 LIM domain binding protein 1 LYL 1 Lymphoblastic leukemia derived sequence 1 MAP17 Membrane associated protein 17 MLL Mixed lineage leukemia MYC Myelocytomatosis viral oncogene NRF Nucleosome remodeling factor OGT O linked N acetylglucosamine (glcnac) transferase PAF RNA polymerase II as sociated factor RUNX1 R unt related transcription factor 1 SCL Stem cell leukemia SET1 Su(var), ehnhancer of zeste, trithorax domain protein 1 SIL Scl interrupting locus TAL1 T cell acute lymphoblastic leukemia protein 1 TAL2 T cell lymphoblastic leukemia p rotein 2

PAGE 12

12 T ALL T cell acute lymphoblastic leukemia T CL5 T cell leukemia 5 TET Ten eleven translocation protein

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Require ments for the Degree of Doctor of Philosophy EPIGENETIC MECHANISMS REGULATING ACTIVATION OF THE TAL1 ONCOGENE IN NORMAL AND IN MALIGNANT HEMATOPOIESIS By Bhavita Patel May 2013 Chair: Suming Huang Major: Medical Sciences TAL1 /SCL is a critical trans cription factor required for development of all hematopoietic lineages; yet, aberrant TAL1 transcription which is frequently observed in T cell acute lymphoblastic leukemia (T ALL), leads to leukemia manifestation. Therefore to dissect the underlying epige netic mechanisms regulating TAL1 gene activity in normal and in malignant hematopoiesis this study was undertaken. Here, we report that TAL1 expression is regulated by differential intra and inter chromosomal chromatin loops in normal and leukemia cells, respectively. These loops determine which cell type specific enhancers interact with the TAL1 promoter. The TAL1 +51 enhancer which is specifically active in erythroid precursors and inactive in leukemic T cells, interacts with the upstream TAL1 promoter 1 via an activating chromatin loop. hSET1 mediated H3K4 methylation facilitates this erythroid specific long range chromatin interaction, and regulates RNA polII recruitment at the TAL1 locus. h SET1 is further required for hematopoietic stem cells (CD34+) capacity to generate burst forming and colony forming units. Furthermore, we find that insulator protein CTCF differentially reorganizes the TAL1 locus chromatin structure keeping the

PAGE 14

14 +51 enhancer in a close proximity to the TAL1 promoter in erythroid cell s while blocking the same enhancer/promoter interaction in T ALL. In addition, we identify the role of LIM domain binding protein 1 ( Ldb1 ) in TAL1 gene activation by regulating TAL1 +51 enhancer and promoter 1 interaction in erythroid cells Altogether, th is study provides a mechanistic insight into the epigenetic mechanisms that function to regulate long range chromatin interactions at the TAL1 locus, to modulate TAL1 gene activity in normal and malignant hematopoiesis.

PAGE 15

15 CHAPTER 1 INTRODUCTION T cell A cu te L ymphoblastic L eukemia (T ALL) leukos haima resembling overabundance of immature WBCs in the diagnosis. These immature leukemic cells accumulate rapidly in the bone marrow and are carried by the bloodstream to other tissues and organs including brain, liver, lymph nodes and testes, where they continue to grow and divide. ed on clinical manifestation and disease progression. Acute lymphoblastic leukemia (ALL) encompasses a group of lymphoid neoplasms that belong to either B or T cell lineage precursor cells. These neoplasms may predominantly present with extensive involveme nt of the bone marrow and peripheral blood, termed as lymphoblastic leukemia; or may be limited to tissue infiltration, being absent or with very limited bone marrow involvement (less than 25%), designated as lymphoblastic lymphoma. ALL can occur at any ag e; however, most incidences occur frequently in people under the age of 15 or over the age of 45. In children, ALLs represent 75% of all acute (which in turn represent 34% of all cancers in this age group), with a peak i ncidence at 2 to 5 years of age [1] A variety of genetic and environmental factors have been related to ALL. Patients with Down syndrome, Bloom syndrome, neurofibromatosis type I, and ataxia telangiectasia, show higher incidence. Furthermore, in utero exposure to ionizing radiati ons, pesticides and organic solvents, has also been linked to increased risk of childhood leukemia [2] T cell acute lymphoblastic leukemia (T ALL), a less frequent subset of ALL, presents as a malignant disease of thymocytes and accounts for about 10 15% cases of

PAGE 16

16 pediatric ALL and 20% of adult ALL. It is classified as high risk leukemia since about 30% of T ALL patients relapse within the first t wo years following diagnosis [ 3 4 ]. Clinical Presentation The clinical onset of T ALL is most often acute. Pa tients with T ALL display mediastinal mass with or without pleural effu sions, leading to respiratory distress. The most common symptoms of ALL include fever, fatigue and lethargy, bone and joint pain and bleeding diathesis. Laboratory analysis indicates a nemia, neutropenia and leucopenia or leukocytosis. In contrast, a build of immature dysfunctional T cells is observed that interfere with normal blood formation. Other common abnormalities include high serum uric acid and lactose d ehydrogenase levels [ 5 ] Molecular Abnormalities One of the most distinguishable characteristic of T ALL is the presence of robust chromosomal rearrangements. The most common chromosomal abnormalities include rearrangements affecting the T cell receptor (TCR) genes, most commonl y TCR ( helix loop helix (bHLH) genes ( MYC, TAL1 TAL2, LYL1, bHLHB1 ), cysteine rich (LIM domain) genes ( LMO1, LMO2 ) or homeodomain genes ( HOX11/TLX1, HOX11L2/TLX3 members of the HO XA cluster) [ 6 9 ]. T ALL may harbor molecular lesion without any detectable cytogenic abnormalities. Upto 50% of T ALL contain activating mutations of TAL1 / Scl gene, correlated to late cortical stage of thymocyte maturation. About 30% of T ALL overexpress Hox11 in absence of genetic abnormalities, related to early cortical thymocyte phenotype. Lyl1 mutations are present in 22% pediatric T ALL, and they correlate with double negative stage of differentiation. About 4 8% of T ALL show MLL mutations, associate d with maturation arrest at early thymocyte stage and have no

PAGE 17

17 impact on prognosis [10 12] Activ at ing Notch mutations are present in 50% of T ALL and inactivating mutation in CDKN2(INK4), a tumor suppressor gene are present in 80% cases on T ALL [ 13 ]. Prog nosis of T ALL The prognosis of ALL has improved dramatically over the past several decades as a result of adapti ve therapy improvements in supportive care, and optimization of the existing chemotherapy drugs. The outcome of pediatric ALL has evolved from an overall survival of less th an 10% in the 1960s to approxi mately 75% to 80% at present [ 14 ]. However, adult patients have a less optimistic outlook. The remission rates have reached 85% to 90%, with overall su rvival rates of only 40% to 50% [15 ] TAL1 p ositive cases appear to have inferior prognosis, while Hox11 positive patients have superior prognosis. MLL positive patie nts have no impact on prognosis [ 11,12 ]. Current T reatment Therapies for T ALL Th e treatment of ALL involves short term intensive che motherapy (with high dose methotrexate, cytarabine, cyclophosphamide, dexamethasone or prednisone, vincristine, L asparaginase, and/or an anthracyclin). [ 14 ,1 6 ]. This is followed by intensification or consolidation therapy to eliminate residual leukemia, pr event or eradicate CNS leukemia, and ensure continuation of remission. Radiation may be used for patients showing evidence of CNS or testicular leukemia, although this approach is controversial at the curre nt time, especially in children [14]. In adult pat ients, the use of growth factors such as granulocyte colony stimulating factor that accelerate hematopoietic recovery has greatly improved the success rate of ALL therapy [17] However, the overall frequency of relapse in ALL still remains a major issue. A pproximately 25% children and 50% adults relapse, a rate that is highly dependent on

PAGE 18

18 the immunophenotypic and genetic subtype of the leukemia [14, 16, and 17] This has stir tremendous research interest in development of better therapies and diagnosis tec hniques. One such area focusses on understanding the molecular mechanisms underlying ectopic activation of various oncogenes. TAL1 (T cell Acute Lymbhoblastic Leukemia 1) : A Master Regulator of H ematopoiesis T cell acute lymphoblastic leukemia 1 ( TAL1 ) (al so known as SCL or TCL5; hereafter referred as TAL1) is a member of the basic helix loop helix (bHLH) family of transcription factors and plays an essential role in the development of all hematopoietic lineages. As described previously, it was cloned from a T ALL patient with chr. (1;14) translocation [66]. It binds to DNA as a heterodimer with the product of ubiquitously expressed bHLH E2A or HEB genes, by recognizing a hexanucleotide sequence CANNTG termed E box [1 8 ]. TAL1 is detected as early as day 8.5 in developing mice embryo and by day E9.5, it is observed in erythroid progenitors, mid brain and endothelium. It is later required for differentiation along erythroid and megakaryocyte lineages but down regulated in B and T cell lineage s TAL1 Role in H em atopoiesis TAL1 is essential for specification of hematopoietic stem cells during embryonic development and in subsequent hematopoietic differentiation, continued TAL1 expression is critical for erythroid maturation as lack of TAL1 leads to block in eryth ropoiesis [ 1 9 20 ]. Deletion of TAL1 in mice leads to embryonic lethality between E9 10.5 due to complete loss of hematopoietic cells [ 2 1 2 2 ]. Moreover TAL1 null embryonic stem (ES) cells are unable to generate both primitive and definitive erythropoietic cells in vitro and do not contribute to hematopoiesis in vivo in chimeric

PAGE 19

19 mouse [ 23, 24 ]. These results demonstrate TAL1 as a master regulator of hematopoiesis, as loss of TAL1 leads to complete absence of erythroid, myeloid, megakaryocyte, mast, and T a nd B lymphoid cells (Figure 1 3) In normal hematopoiesis, where TAL1 well as negatively modulate transcription of target genes by recruiting cofactors (coactivators or corepressors) proteins [ 2 5 27 ]. In this respect it is classified as a bifunctional regulator. The mechanistic detail of how TAL1 performs these tasks is not clearly understood and is an area of active research. An important and current question in hand is what regulates this maste r regulator? As TAL1 is expressed and required for erythroid cell development and oncogenic potential of T cell s [ 28, 29 ], understanding mechanisms underlying the regulation of the TAL1 gene in normal hematopoiesis and leukemogenesis is of particular inter est. TAL1 Role in T ALL Normal expression of TAL1 is restricted to the DN1 DN2 subset of immature CD4 /CD8 thymocytes with ectopic expression resulting in leukemic arre st in late cortical thymocytes [30 ] Two models have been proposed for TAL1 induced leu kemogenesis. In the prevailing model TAL1 acts as a transcriptional repressor by blocking the transcriptional activities of E2A, HEB, and/or E2 2 through its heterodimerization with these E proteins or TAL1 may mediate its inhibitory effect s by interfering with E2A mediated recruitment of chromatin remodeling comple x which activate transcription [31 34 ]. It also been shown to associate with several corepressors including HDAC1, HDAC2, mSin3A, Brg1, LSD1, ETO 2, Mtgr1, and Gfi1 b [35 ] In human T ALL TAL1 tr anscriptional repression may be mediated by TAL1 E2A DNA binding and recruitment of the corepressors LSD1 and/or HP1 [3 6 ]. In the other model

PAGE 20

20 TAL1 induces leukemogenesis through inappropriate gene activation [3 7 ]. At least two genes RALDH2 and NKX3.1 are transcriptionally activated by TAL1 and GATA 3 dependent recruitment of the TAL1 LMO Ldb1 complex [38 3 9 ]. As a transcriptional activator TAL1 has been shown to associate with the coactivators p300 and P/CAF [4 0 41 ]. Both of these complexes contain HAT activities. The prevalence of histone modifying enzymes in TAL1 complexes suggests that one function of TAL1 is to regulate chromatin states of its target genes. Ectopic expression of both TAL1 and LMO1 in mice accelerated the progression to leukemogenesis In this case thymic expression of the TAL1 and LMO1 oncogenes induced expansion of the ETP/DN1 to DN4 population and lead to T ALL in ~120 days. The acquisition of a Notch1 gain of function mutation was proposed to be the rationale behind this increase in leukemia penetrance. In fact, thymic expressi on of all three oncogenes Notch1, TAL1 and LMO1 induced T ALL with high penetrance in 31 days, the time necessary for clonal expansion [ 42 ] These studies suggest that aberrant LMO proteins are key players in abnormal T cell biology. TAL1 G ene I s R egulate d B y C is acting F actors in Erythroid C ells The TAL1 gene, located on chromosome 1p32, is transcribed from two lineage specific promoters, 1a and 1b ( F igure 1 1) Promoter 1a is utilized in erythroid, megakaryocytes and mast cells, while promoter 1b, is use d in primitive myeloid and mast cells [ 4 3, 44 ]. These regulatory regions were initially identified by mapping DNase I hypersensitive sites over the mouse TAL1 locus. Later, transgenic mice studies and in vitro reporter assays validated the function of the hypersensitive sites in regulating TAL1 expression both in vivo as well as in cultured erythroid cells. As illustrated in figure 1 1 A TAL1 has three distinct enhancer elements, which are named based on their distance

PAGE 21

21 from exon 1a; 1) 4 enhancer, which di rects TAL1 expression in embryonic endothelial and hematopoietic cells [ 45 ], 2) +18/19 enhancer, in HSCs, in progenitors in fetal and adult liver and in embryonic endothelium [ 4 6 ], and 3) +51 enhancer, in primitive and definitive erythroid cells [ 47 ]. Besi des these, various other putative regulatory sites have been identified by DNaseI hypersensitive sites mapping, and histone modification patterns [ 48 49 ]. Furthermore, ChIP seq and ChIP chip assays have shown that CTCF (CCCTC binding factor) binds to 31, +40 and +57 sites at the TAL1 locus and may play an important role in the regulation of TAL1 expression in erythroid progenitor K562 cells and CD4+T cells [ 49, 50 ]. The role of CTCF at the TAL1 locus in T ALL cells has not been investigated, and is propos ed in the current study. In addition to its regulation by these cis elements, TAL1 primary transcript is subjected to extensive alternative splicing and translated from seven in frame AUGs. Despite these complexities, there are two major TAL1 protein produ cts observed, one being full length (~47kDa) and a short protein (24 28kDa) which lacks N terminus transactivation domain as a result of alternative splicing [ 51 ]. Both proteins contai n DNA binding and HLH domains (f ig ure 1 1B ) and heterodimerize with E pr oteins. TAL1 protein is also post translationally modified by phosphorylation and acetylation, which modulate its transcriptional activator and repressor activities [ 40, 41, 52, and 53 ]. TAL1 Gene Is Regulated By Trans acting Factors In Erythroid Cells TAL 1 promoter 1a and +51 enhancer elements harbor composite E box and two GATA motifs, which are direct binding sites for TAL1 and GATA proteins, respectively. Therefore, TAL1 may exhibit autoregulation through a positive feedback mechanism [ 54 55 ]. In eryth roid cells, TAL1 is part of a multimeric complex that includes its heter o dimer interacting component E2A, as well as LIM only domain protein LMO2, and

PAGE 22

22 the LIM domain binding protein LDB1. This TAL1 /E2A/LMO2/LDB1 complex interacts 5 6 ], which is shown to be critical for the formation of long globin activation [ 5 7 ]. Presence of composite E box GATA motif and the assembly of the pentameric complex at both TAL1 promoter 1a and +51 enhancer elements strongly suggests role of long range chromatin interaction mechanisms in regulating TAL1 expression [ 49 ]. This idea is further strengthened by the presence of LDB1, a potential mediator of long range chromatin interactions [ 58 ]. Role of histone modifications and chromatin structure in regulating gene expression has been hig hlighted in various studies [ 59 ]. Histone modification patterns dictate transcriptional status of a given gene. Histone acetylation and methylation of H3K4 residues are correlated with transcriptionally active chromatin, whereas methylation of H3K9 and H3K 27 residues has repressive role [ 60 63 ]. Recent studies have shown a correlation between different methylation status of H3K4 residue and regulatory elements including promoters and enhancers. H3K4 mono and dimethyl marks are enriched at enhancers, while H 3K4 trimethyl is present at active gene promoters [ 64 65 ]. This correlation can be exploited to identify regulatory elements which are active in T cell leukemia. Furthermore, the analysis of recruitment of histone modifying enzymes at the TAL1 locus, will aid in understanding the molecular mechanism of TAL1 gene activation. TAL1 Gene Regulation I n T ALL TAL1 was first identified in T ALL patients bearing t(1:14)(p32:q11) translocation (figure 1 2) Additional studies have shown TAL1 to be ectopically expre ssed in about 60% of T ALL cases. This aberrant expression is a result of three major events; 1) 3% cases represent t(1:14)(p32:q11) translocation placing TAL1

PAGE 23

23 oncogene [ 66 ], 2) 30% cases show a submicroscopic 90 kb deletion, wherein the first TAL1 transcription unit [ 67 ], and 3) About 60% of T ALL c ell lines and patient samples show ectopic TAL1 expression with no detectable TAL1 gene rearrangements [ 68 ]. The question remains as to how and what mediates TAL1 ectopic expression in T ALL, especially with patient population that lacks TAL1 gene rearra ngements. A third TAL1 promoter (promoter I V) located upstream of exon 4 (f ig ure 1 1A ), was described to be specifically used in T cell leukemia. It directs TAL1 expression in almost all T ALL blasts with TAL1 gene rearrangement, however in T ALL samples l acking TAL1 genomic rearrangement, transcriptional initiation involves both promoter IV and promoter 1b, with the exception of one case, where promoter 1a was used instead [ 6 9 70 ]. Apart from TAL1 activation due to its translocation to the TCR locus, 25% T ALL patients exhibit SIL TAL1 TAL1 is fused to the SIL gene placing TAL1 under the regulation of SIL promoter/enhancer elements. SIL (also known as STIL), is a cytoplasmic protein proposed to play important rol e in sonic hedgehog signaling and in the regulation of mitotic checkpoint proteins [ 71 72 ]. It is expressed in all hematopoietic cells suggesting that the SIL promoter is in an open chromatin configuration, accessible to the transcriptional machinery in T cells. Although the SIL promoter was suggested to control TAL1 transcription in the subset of T ALL leukemia featuring an intact SIL TAL1 locus chromosome structure, the prediction is largely based on the fact that the SIL promoter has the ability to acti vate TAL1 in the cases of interstitial deletion patients or when artificially linked to the TAL1 coding region [ 73 74 ] The functional link between the SIL promoter and TAL1 coding region, located

PAGE 24

24 90 Kb apart, in leukemia remains unknown. While it is poss ible that an enhancer/promoter could mediate long range activation, it remains puzzling why the SIL promoter region only affects the TAL1 gene in T ALL cells but not in normal erythroid cells. Understanding the mechanism of TAL1 aberrant activation in T AL L will provide not only novel insight into TAL1 induced leukemia but also potentially provide strategies for treating the leukemia.

PAGE 25

25 Figure 1 1. Human TAL1 locus and protein isoforms A) Cis regulatory elements at the human TAL1 locus, and B) Primary st ructure of TAL1 long and short isoforms with various functional domains.

PAGE 26

26 Figure 1 2. Distribution of genomic rearrangements involving TAL1 in T cell acute lymphoblastic leukemia. Based on published data by Bash et al., 1990; Brown et al.,1990; Ferra ndo and Look, 2000; Ferrando et al., 2002

PAGE 27

27 Figure 1 3. TAL1 is a key regulator of hematopoiesis. Shown is the brief outline of normal hematopoiesis. TAL1 is initially required for specification of hematopoietic stem cel ls (HSCs) from hemangioblasts, later for differentiation of hematopoietic progenitor cell (HPC) into common myeloid progenitors (CMP) and subsequently for maturation of erythrocytes, megakaryocytes and macrophages. Various abbreviations used are ; CFU S (co lony forming unit spleen), CFU GEMM (colony forming unit granulocyte erythrocyte megakaryocyte and macrophage), and CFU GM (colony forming unit granulocyte macrophages).

PAGE 28

28 CHAPTER 2 M ATERIALS AND METHODS Cell Culture and Sh RNA Mediated K nock Down K562 cell s were maintained in IMDM supplemented with 10% FBS ( Atlanta Biologics, S11550H) at a cell density of 2 X 10 5 cells/ml. HL 60 were cultured in IMDM supplemented with 20% FBS and T ALL cell lines were maintained in RPMI 1640 (FisherSci, MT 10 040) supplemen ted with 10% FBS. Constructs used for SET1 knockdown were generated by subcloning shRNA oligonucleotides into generation and infections were performed as described pre viously [75] For CTCF knockdown experiments, shCTCF lentiviral constructs were purchased from open biosystems and lentiviral generations and mammalian cell transduction was performed ckdown cells were maintained in media co ntaining 1g/ml puromycin (Calbiochem, 540222 ). Primary Human Cord Blood Cell Culture a nd Erythroid D ifferentiation Human cord blood derived CD34+ cells were purchased from Stem Cell Technologies and were expanded in StemSpan SFEM media (Stem cell technologies, catalog #09650) supplemented with 100ng/ml SCF (Biolegend, 579706) 20ng/ml IL 3 ( Biolegend ), and 20ng/ml IL 6 ( Biolegend, 575706 ) alongwith 1% pen icillin/streptomycin (FisherSci, MT 30 002 ). Before inducing er ythroid differentiation, the cells were sorted for CD34+ using anti CD34+ PE conjugated antibody (BD biosciences, 555822) and about one million cells were subjected to erythroid differentiation to CD36+ cells over a seven day period (refer figure 2 1). On sixth and seventh day, cells were sorted for CD36+ using anti CD36+ FITC conjugated antibody (BD biosciences, 555454) and

PAGE 29

29 used for 3C and ChIP analysis. Further, differentiation was traced by measuring globin and Tal1 transcript levels (figure 2 1B) and Giemsa/May Grunwald staining of the differentiating cells (figure 2 1C). Giemsa/May Grunwald Staining Of E rythroid C ells Differentiation of CD34+ cells was assessed by Giemsa/May Grunwald (Sigma 48900 and 63590 ) staining based on the protocol described by the manufacturer (Sigma). Briefly, 10 5 cells were pelleted on microscopic slides using cytospin, followed by staining with May Grunwald stain for 5 minutes at room temperature ( RT ) The slides were the n washed with 50mMoles/L Tris pH 7.0 and stained with Giemsa (1:20 diluted) for 17 minutes at RT. Finally the slides were washed several times with dH 2 O and observed under microscope and representative pictures were captured. FACs Analysis of ( C luster of D ifferentiation) C D34+, CD36+ and (Glycophorin A) GPA Surface M arkers About >100,000 cells were washed with 0.2% FBS in 1xPBS (FACs) buffer twice. The cells were resuspended i n 2mls of FACs l of anti CD34+ PE and/or anti CD36+ FITC or anti GPA PE conjugated antibody ( BD biosciences ) in dark for 30 minutes with rotation. The cells were then washed twice with FACs buffer, and analyzed fo r either, CD34+, CD36+ or GPA+ on BD LSRII FACs analyzer. Native and Cross linked Ch romatin I mmunoprecipitation A ssay Native ChIP assays for histone modifications were performed in the absence of formaldehyde crosslinking About 1x10 7 cells were washed with 1x PBS containing 10mM sodium butyrate (Sigma, 303410), and Protease inhibitors Pepstatin (Sigma, P5318), Leup eptin (Sigma, L2884), Aprotinin (Sigma, A1153) and 0.2mM PMSF(Sigma, P7626) at 4C. The cells were than lysed in lysis buffer containing 10mM Tris HCL pH

PAGE 30

30 7.5, 10mM NaCl, 3mM MgCl 2 0.4% NP 40, 10mM sodium butyrate, followed by centrifugation at 2500 rpm fo r 5 minutes at 4C. The nuclei pellet was resuspended in lysis buffer containing 1mM CaCl 2 ( micrococcal nuclease cofactor). About 3x10 2 U/ micrococ cal nuclease was added and the chromatin was digested for 10 minutes at 37C, and stopped by the addition of 10mM EDTA The digested chromatin was then subjected to sucrose gradient centrifugation. A linear gradient of 5% to 30% sucrose was p repared in 14ml SW40 tubes (Seton, 7030). 1ml of the digested chromatin was layered on top of the gradient and nucleosomes were separated at 30000 rpm for 15 hrs. at 4C using Beckman U ltracentrifuge. Post centrifugation, collected, an determination Fractions containing mono and di nucleosomes were pooled for ChIP analysis using antibodies specific to various histone modifications: anti H3K9/14Ac (06 599), anti H3K4me1 (ab8895 Abcam), anti H3K4me2 (07 030), anti H3K4me3 (04 745), anti H3K9me2 (07 212) and H3K27me3 (07 449) from Upstate Biotechnology. For transcription factors ChIP assay, chromatin was isolated from 1% formaldehyde ( FisherSci, BP531 ) and EGS ( Sigma E3257 ) cros slinked cells, sonicated using Bioruptor TM UCD 200 (Diagenode) and subjected to IP with anti TAL1 (sc12984, Santa C ruz Biotech), anti GATA1 (N6, Bethyl laboratories), anti SET1 (A300 289A, Bethyl Laboratories), anti ASH2L ( A300 107A, Bethyl Laboratories), anti RNA polII ( ab5408, Abcam), anti CTCF (07 729, Upstate Biotechnology), anti Rad21(ab229, Abcam), anti TAF3 ( A302 359A, Bethyl Laboratory), anti Ldb1 (sc 11198, Santa C ruz Biotechnology) Enrichment of these factors and histone modification was assessed by quantitative PCR analysis using primers (Table 1) designed across the TAL1 locus. Fold

PAGE 31

31 enrichment was calculated relative to Input DNA using the formula; fold enrichment = 2 (Input IP) In case of high IgG background, the value obtained was further norm alized to IgG and plotted as relative fold enrichment. Chromosome C o nformation Capture A ssay (3C) The chromatin conformation capture (3C) assay was per formed with minor modifications [75] In detail 2 x 10 7 cells were cross linked with 2% formaldehyde fo r 10 minutes and stopped by the addition of glycine at a final concentration of 0.125M. Cells were pelleted and washed twice with cold PBS and lysed in lysis buffer (10mM Tris, pH 8.0, 10mM NaCl, 0.2% Nonidet P 40, and Protease inhibitors Pepstatin (Sigma P5318 ), Leupeptin (Sigma L2884 ) Aprotinin (Sigma A1153 ) and 0.2mM PMSF( Sigma P7626 ) at 4C for 90 minutes with gentle rotation. Nuclei were collected and washed with appropriate 1X restriction buffer (for BamHI: NEB buffer 3, NlaIII: NEB buffer 4 Dpn II: NEB DpnII buffer ) and then resuspended in restriction enzyme buffer containing 0.3% SDS at 37C for 1 hour with shaking. TX 100 was then added to a final concentration of 1.8% to sequester SDS at 37C for 1 hour with shaking. Chromatin was than digeste d with 800U of either BamHI or NlaIII or DpnII (NEB) at 37C overnight with shaking. Next day the reaction was stopped by adding SDS to a final concentration of 1.6% at 65C for 30 minutes. The digested chromatin was than diluted in 1 ml of T4 DNA ligation buffer (NEB B0202 ) containing 1% TX 100 (Promega, H5141) and incubated at 37C for 1 hour with shaking. 400 U of T4 DNA ligase (NEB M0202 ) were added and the ligation was carried out at 16C for 5 hours followed by 30 minutes at room temperature. The li gated chromatin was then reverse cros g of Proteinase K (Invitrogen AM2548 ) at g of proteinase K were added and incubated at 42C for 2 hours, followed by phenol chloroform extraction

PAGE 32

32 to purify the 3C DNA. Purified 3C ligated DNA was then PCR amplified using bait and test primers using PicoMaxx ( Stratagene, 600650 ) The PCR products were cloned into pCR TOPOII vector (Invitrogen K4575 ) and sent for sanger sequencing. To control for primer efficienc y, BAC template containing 182041 bp of TAL1 locus was generated and used as a standard. PCR reaction s were performed in parallel for BAC standard and 3C ligated DNA. Furthermore, to control for differences in cell type specific chromatin organization, the interactions at the TAL1 locus were normalized to ERCC3 locus. Relative crosslinking frequencies were calculated and plotted after normalization to loading control and ERCC3 control as described in [77]. Calculation of the Relative C ross lin king Frequenc y Using Image J The relative cross linking frequency between two loci was calculated by the ratio of cross linked sample template versus that obtained from co ntrol templates (BAC) followed by normalization to ERCC3 control locus The following equation wa s used to calculate the relative cross linking frequency: X(Fr1 + Fr2)= [A(Fr1+Fr2)/A(Ctrl1+Ctrl2)]sample/ [A(Fr1+Fr2)/ A(Ctrl1+Ctrl2)]control template, where X: relative cross linking frequency between two given fragments Fr1 and Fr2; A(Fr1+Fr2): cross lin king frequency between Fr1 and Fr2 in the TAL1 locus; A(Ctr1+Ctrl2): cross linking frequency between two control fragments Ctrl1 and Ctrl2 in the ERCC3 locus [75] Reverse Transcription and Quantitative P olymerase C hain R eaction Total RNA was prepared by u sing the RNeasy mini isolation kit (Qiagen, 74106) transcribed by using the Superscript II reverse Transcriptase (Invitrogen 18064 ). cDNA

PAGE 33

33 was analyzed by real time PCR (qR T PCR) using a MyiQ Single Color real time PCR Detection System (Bio Rad). Primer sequences are listed in the Table 1. C D 34+ Colony Formation Assay Human colony formation assay was performed as described by StemCell technology using complete MethocultTM (S tem Cell Technology 04435 ) About 9.5x10 3 CD34 vector control or shSET1 cells were seeded in 4ml SFEM (Stem Cell Technology) media supplemented with 10ng/ml G CSF, 20ng/ml SCF, 10ng/ml IL3, 10ng/ml IL6 and 6U/ml EPO ( a gift from Dr. Constance Noguchi) T hese were than plated in triplicates on methylcellulose cell culture plates and cultured for 18 days, with fresh media supplemented with cytokines added every week. Different hematopoietic colonies; erythroid progenitors (colony forming unit (CFU) erythroi d (CFU E) and burst forming unit erythroid (BFU E)); granulocyte/macrophage progenitors (CFU granulocyte, macrophage (CFU GM); CFU granulocyte (CFU G) and CFU macrophage (CFU M)) and multi potential progenitors (CFU granulocyte, erythroid, macrophage, mega karyocyte (CFU GEMM)), were observed and counted following guidelines as described by Stem Cell Technologies. The experiment was performed with three replicates for each. Luciferase Reporter Assay TAL1 +51 enhancer fragments corresponding to nucleotides 17 618015 to 17619135 (+51 enhancer) or nucleotides 17615818 17620036 (+51 enhancer and +53 CTCF sites) based on GRCh37.p5 build of Genbank NT_032977.9 was subcloned into XhoI and MluI sites of the pGL3 SV40promoter vector. Human +51 enhancer sequence corresp onds to 0.7Kb core sequence of mouse TAL1 +40 enhancer, previously identified [47]. About 110 5 K562, Jurkat, Rex, HL 60, MOLT4 and HPB ALL cells were

PAGE 34

34 transfected with 0.5g of pGL3 SV40p empty, pGL3 SV40p Enh+51 core or pGL3 SV40p Enh+51CTCF+53 along with 50ng of pRL CMV vectors using Lipofactamine 2000 (Invitrogen 11668 ). Luciferase activity was measured 48 hrs post transfection using Dual (Promega E2920 ). Relative luciferase activity was calculated by normalizing pGL3 SV40 Enh+51 and pGL3 SV40 Enh+51CTCF+53 to pGL3 SV40 empty vector control. Soft Agar Colony Formation Assay SETD1A shRNA and control clones of K562 cells were seeded in soft agar for clonogenicity as described [78] Briefly, 2.5 ml of bottom layer consisting of RPMI 1640 medium supplemented with 10% FBS plus 1% P/S and 0.65% agarose was spreaded in a 60 mm tissue culture dish. Then 5 ml of cell layer containing 110 4 cells with 10% FBS plus 1% P/S and 0.35% agarose was overlai d on the top. These 60 mm dishes were then placed in a bigger 10cm dish containing 1X DPBS and incubated at 37C. About two weeks later, the colonies were counted and photographed. (BFU E)); granulocyte/macrophage progenitors (CFU granulocyte, macrophage ( CFU GM); CFU granulocyte (CFU G) and CFU macrophage (CFU M)) and multi potential progenitors (CFU granulocyte, erythroid, macrophage, megakaryocyte (CFU GEMM)), were observed and counted following guidelines as described by Stem Cell Technologies.

PAGE 35

35 Figur e 2 1. Ex vivo differentiation of human cord blood CD34+ cells. Human cord blood CD34+ cells were purchased from Stem Cell Technolog ies and differentiated e x vivo into erythroid precursors. (A) Ex vivo CD34+ differentiation protocol schematic. At every tim e point the cells were subjected to FACs analysis for CD34+, CD36+ and later for GPA+ the representative FACs data for Day 6 is shown B) Assessment of TAL1 and globin mRNA levels during CD34+ differentiation by RT quantitative PCR assay. C) May Grunwald Giemsa staining of the CD34+ cells at Day 3 and 6 of erythroid differentiation.

PAGE 36

36 Table 2 1 Primer se q uences Primer shRNA Hs SET1 1 Target: GGAAAGAGCCATCGGAAAT Hs SET1 2 Target: GACAACAACGAATGAAATA Hs SET1 3 Target: CAACGACTCAAAGTATATA Hs c Maf 1 Target: TGGTTCTCCATGACTGCAAAT Hs c Maf 2 Hs c Maf 3 Target: AACTTCTCGTATTTCTCCTTG Target: ACTTCTCGTATTTCTCCTTGT Hs c Maf 4 Target: TCCAGTAGTAGTCTTCCAGGT Hs c Maf 5 Target: TCATCCAGTAGTAGTCTTCCA RT PCR actin For: GTGGGCCGCTCTAGGCACCA Rev: TGGCCTTAGGGTGCAGGGGG actin For: AGAAAATCTGGCACCACACC Rev: AGAGGCGTACAGGGATAGCA HoxB4 For: TGGATGCGCAAAGTTCACG (both for Hs & Mm) Rev: GGTCTTTTTTCCACTTCATGCG Hs Meis1 For: TCACACTGGCCTTAAAGAGG A Rev: CCGTAATGGGGTAGATCGTC Mm SET1 For: CAGACGGGCTTGTAGATTCC Rev: GAGGCTGTGGTACACTAGG Mm TAL1 For: TAGCCTTAGCCAGCCGCTCG Rev: GCGGAGGATCTCATTCTTGC Hs TAL1 Hs GATA1 Hs Ldb1 Hs p4.2 Hs GPA Hs NKX3.1 Hs c Myb Hs c Myc Hs MAP17 Hs STIL actin For: GGATGCCTTCCCTATGTTCA Rev: AAGATACGCCGCACAACTTT For: GACACTGTGGCGGAGAAAT Rev: CGAGTCTGAATACCATCCTTCC For: GGCATTCCACAGCAACTT Rev: TCCGCATCATGTCGTCAA For: CTGGGCTGTGGATTCCAGTA Rev: ACTGCCTACCCCACACTCAC For: ATTGTCAGCAATTGTGAGCATA Rev: TG ATCACTTGTCTCTGGATTTT For: CCTCCCTGGTCTCCGTGTA Rev: TGTCACCTGAGCTGGCATTAC For: ACCATTTCATAGAGACCAGACTGA Rev: TGGTGTAGGAGTTCTTGGAGAG For: AGCTGCTTAGACGCTGGAT Rev: GAGGTCATAGTTCCTGTTGGTG For: CTGCACACATGATCCTGACC Rev: TCTCATGCTCACTGGACCTG For: GAATGCTTCC CTTGTGATGG Rev: TCAGTTCACAACGGATTGGA For: AGAAAATCTGGCACCACACC Rev: AGAGGCGTACAGGGATAGCA

PAGE 37

37 Table 2 1 Continued Primer Primer Sequence Hs Meis1 globin For: TCACACTGGCCTTAAAGAGGA Rev: CCGTAATGGGGTAGATCGTC For: GGCAACCTGTCCTCTGCCTC Rev: GAAATGGATTGCCAAAACGG ChIP HoxB4 Promoter For: GCCTCTAACTTTGTTCACTTGAC (both for Hs & Mm) Rev: AGCCATTAATTTCTGGGAATTGC Hs HoxB4 For: CCCCGGAAAAAT CTATCTGC Hs TAL1 locus primers STIL Promoter Region 16Kb CTCF site 31Kb Enhancer 4Kb Region 10Kb Upstream1a region CpG island TAL1 Prom1a TAL1 Prom1b TAL1 PromIV Enha ncer +19 CTCF site +40Kb Map17prom Upstream Map17prom Down region Rev: CCAAAGCTGAAAACGAGGAG For: CCGCAGTTCTCCAAGAAGACTT Rev: GGTCGCCGTTACGTATTGGT For: CAGTAGCAAGCCCAAGTGTAGTAACA Rev: GGAAAGATGCACTAACTGGTCCAT For: ACCTGATGTACCTGTGTTCTTTCC Rev: CCCTGTT GGTCCAGTCTGTAAA For: TGGCTGCCTGACTGTCAGAA Rev: CGTTCACCAACCCTCCAATT For: CAAATCAGAAGAAAAGACCTGCAA Rev: TTTCATTTTCCTTCCCTCAATCTC For: AGGGAGACTGCCCATTGAAAT Rev: CCTCCCAGGGCTTCTTTCTT For: CCCTTCTGCGTTTTCTTCGT Rev: CAGAATCAGATCCCTGCTGAGA For: CTAGCGCCGCT CAACCA Rev: TGGGCCAAATGATTCATTTTAAT For: CCGCCTCGGAGACTCTCTT Rev: CACAGCCTCGCGCATTT For: CGTTTTAAACCCAGTGGCTCTAG Rev: CACGCACACTCTCTCTCACAGAA For: TCCAGGAGGGAGTGCCATT Rev: GCCTGCATCCCCCATTG For: TTTTCTCAGGCTAAGCTCTTTGC Rev: GCAAAGTTAGCCAGAGTGTTGTACTC For: GGCGTGGAAGGCACTGAA Rev: GCCCCGCCAAGCTAAACT For: CCCACATCTGCTTGTTCCTCAT Rev: GCTGGCATTCGAGGTCATCT

PAGE 38

38 Table 2 1 Continued Primer Enhancer +51Kb CTCF site +53Kb CTCF site +57Kb Region +70Kb Nkx3.1 promoter Nkx3.1 hHS2 For: GCCTCCTAAGCTTCCTTGATGTC Rev: CAGAAGTGAGACCAATGAGATCGT For: TGGCAGTCCTTCAGTTTCG Rev: CTCTCATCAATCTACGCTTCCTT For: GTGAATGACAGCCATCGTGAT Rev: GGGAGAAGGAGGTGGAGTC For: GTGGCCACAAAGCAAGGAAT Rev: TCTCTGGAATCTCCAAGGCAA For: TTTAGCCAATGGGTTACA Rev: CA GACACATGACATACCA For: TTCTGTAGGTAATCTCTGAGTT Rev: AAGTGATGCCTTCAAGTAAC For: AGTGTTTAGCATCCAGCAGGT Rev: GAAGGGATAGAGGGAGCTGAG 3C A) BamHI Prom1aCE MAP17prom CE Enh+51CE Prom1a bait_L Prom1abait Enh+51 MAP17prom TAL1 proIV Rev: CTGCTCTAGCGGTGGAT TCCTGAGAGG C For:GTTGATCACCTGGTGTCCTTCCTGTTCAT For: ACTCGTGAATCCTGCCCCTCCTTCAGAA Rev: CAGCCAGCCCAGCTTCTCCACTCACTG A For: GTGATGCAGCTTAGTCGCCAACAACCAT C For: GACCTCTGGCTGGTAATC Rev: GAGTGACCTGACTCGAAC For: GCCAAGCAAGGACAGACTTAAGGAGGG TG For: CGTTTTAAACCCAGTGGCT CTAG Rev: CACGCACACTCTCTCTCACAGAA B) NlaIII Enh+51 Prom1a Map17pro TAL1 pro1a TAL1 proIV CTCF 31_3C Rev: GAGTGACCTGACTCGAAC For: CACTCCCTCCGGTGAAATTG Rev: GCCCCGCCAAGCTAAACT For: CTAGCGCCGCTCAACCA Rev: TGGGCCAAATGATTCATT TTAAT For: CGTTTTAAACCCAGTGGCTCTAG Rev: CACGCACACTCTCTCTCACAGAA For: GGCTGTTGAGGAGTAGTAGTGTAA

PAGE 39

39 Table 2 1 Continued Primer C) DpnII CTCF 31_CE CTCF+40_3 C CTCF+53_3 C CTCF+53_C E CTCF+57_3 C CTCF+57_C E Reg 10_3C Rev: CCTTCTCGCAAATGGACAAATCA Rev: TG GAACAGGAAGGAGGAACT Rev: CGGAGGAAGTGCTGAACC For: TGGGAGGAAACAGAGATGACA Rev: AGATTCCTCTCGCAGATGTGA For: TCTCCCTCCAGGTTCTTTCC For: CAAATCAGAAGAAAAGACCTGCAA Luciferase Reporter Assay +51(0.7) +51(4.2) For: ATGCACGCGTCTTTATGTT ATGGCCATTG Rev: ATGCCTCGAGAGAGATCCAGGCTGGTA

PAGE 40

40 CHAPTER 3 SET1 AND CTCF FACILITATE TAL1 PROMOTER /ENHANCER INTERACTION IN ERYTHROID PROGENITORS Introductory Remarks DNA, the basic unit of life, is compacted from a linear 2nm fiber to 1400 nm metaphase chrom osome to be efficiently package into the minute space of the cell nucleus. However, these several meters of our genome must remain functional and accessible to transcriptional and replication machinery. To achieve such dynamic packaging of th e genomic info rmation, DNA is found in complex with an equal mass of histone proteins to form nucleosomes, the basic unit of chromatin Chromatin is an essential platform for all DNA templated mechanisms including replication, repair, recombination and transcription Ea ch nucleosome molecule consists of nucleosome core particle containing 146bp of DNA wrapped around the histone H2A, H2B, H3 and H4 octamer, and the linker histone H1, which interacts with linker DNA between nucleosomes, thus providing further compaction [ 7 9 ]. Histones are lysine and arginine rich proteins synthesized during early S phase of the cell cycle. They are highly conserved from yeast to humans and contain amino terminal tails which are u nstructured, and protrude away from the nuc leosomal core The se tails are unique to each histone molecule and are subjected to various post translational modifications including acetylation methylation phosphorylation ubiquitination sumoylation ADP ribosylation and proline isomerization [ 80 ]. Histone acetylati on neutralizes their positive charge and thereby aids to open the chromatin, however methylation can function to either repress or activate gene transcription. Lysine methylations; H3K4 mono, di and tri methylations are associated with active chromatin, wh ereas H3K9 di and H3K27 tri methylations are associated with repressive chromatin. Several histone lysine methyl

PAGE 41

41 transferases have been identified which selectively modify particular histone residue to implement downstream effect on gene activity. These pr oteins encompass a characteri stic motif of 130 a mino a cids called SET domain, which took its name from Drosophila Su(var) 3 9, Enhancer of zeste and Trithorax [ 81 ] SET domain protein methyltransferases catalyze the transfer of methyl groups from the cofac tor S adenosylmethionine (AdoMet) to specific lysine residues of protein substrates, such as the N terminal tails of histones H3 and H4 So far various SET domain containing proteins have been discovered and have been grouped into eight classes of enzymes, KMT1 8 (where K stands for lysine) [82]. H3K4 Methyltransferase SET1 (Suvar, Enhancer of Zeste, Trithorax 1) The KMT2 class and its first member, Set1, in yeast Saccharomyces cerevisiae were isolated within the Set1/COMPASS functioning as histone H3K4 me thylases and are well conserved in mammals. There are multiple H3K4 methyltransferases, including SET1A (here after referred as hSET1) SET1B, and MLL 1 4 in humans, comprising of the core ASH2L, RbBP5, WDR5 and HCF1 proteins. SET1 complexes contain WDR82 whereas; MLL1/2 and TRR complexes contain Menin as a unique component, respectively [82] There is no data demonstrating the role of SET1 knockout in mammals, however deletion of SET1 in yeast leads to multiple phenotypes, due to complete absence of H3K4 m ono/d i /trimethylation, reinstating the importance of H3K4 methylation in gene regulation [ 83, 84] However, the evidence for direct correlation between SET1, H3K4 me and the phenotype is lacking. SET1 is predominantly associated with the coding regions of highly transcribed RNA pol II genes. In particular SET1 associates with Ser 5 phosphorylated pol II, through Paf1 complex [ 85 ] Moreover, histone H2B ubiquitination by Rad6/Bre1, is required for H3K4 di and tri

PAGE 42

42 methylation, which in turn is regulated by t he Paf1 complex [86]. Thus, much remains to better understand the factors that underlie such robust phenotype observed upon Set1 deletion in yeast model system moreover; the role SET1 in mammals is poorly evaluated Recent studies have identified the role of TET protein s in targeting SET1 to the active chromatin regions in the genome [87] TET2/3 interacts with OGT, which further targets SET1 complex component HCF1 to glyNacylation (addition of GluNAc moiety to the hydroxyl residue of serine or threonine re sidue) a modification that appears to be importa nt for SET1/COMPASS complex inte gr ity. Tet2/3 OGT further promotes binding of the SET1 to the chromatin, specifically to the CpG island promoters of the key hemato poietic genes including JAK1/2 and RUNX1. W ork from our lab has identified USF mediated targeting of SET1 to chicken and mouse beta globin locus. SET1 copurifies with chromatin remodeling protein NRF in a multiprotein complex of ubiquitiously expressed transcription factors USF1 and USF2 in hematop oietic cells. Both SET1 and NRF activities are required for the barrier function of the chicken HS4 and USF1 aids in their recruitment to the chromatin [ 88 ] Furthermore, unpublished data from the lab demonstrates the role of SET1 in regulation of various key hemat opoietic genes including HoxB4 We have also identified SET1 to copurify with TAL1 in er thyroid cells (unpublished). Altogether, th e evidence suggests a critical role for SET1 in hematopoiesis Based on these findings, role of SET1 in TAL1 gene re gulations was assessed. Insulators and CTCF (CCCTC binding factor) Insulators are the guardians of the genome, elements first identified based on their ability to shield genes from outside influences, which might result in inappropriate

PAGE 43

43 activation or repr ession of the gene. Insulators are divided into two classes on the basis of their activities; enhancer blocking insulators prevent distal enhancers from activating a promoter when placed between the enhancer and promote r, and barrier insulator, blocks the spread of heterochromatin and subsequent gene silencing [ 89 ] CCCTC binding factor CTCF, an 11 zinc finger containing transcription factor, was the first identified mammalian enhancer blocking i nsulator CTCF is also well recognized for its role in X chrom osome inactivation, gene imprinting, genome organization and promoter activation or repression. It is very intriguing as to how a single protein can regulate a multitude of cellular functions. The answer probably lays in the context specific interactions o f the CTCF with diverse protein partners. The unique 11 zinc fingers are probably utilized in a combinatorial way to recognize and bind to a variety of DNA sequences as well as interact with a plethora of cellular proteins. Furthermore, CTCF is post transn ationally modified, including poly(ADP)ribosylation, sumoylation and phosphorylation, which further influence its function. Moreover, DNA methylation blocks CTCF DNA binding ability, thus interfering with its gene regulation activities [90] Recently, several genome wide studies utilizing chromosome conformation capture assay (3C) technique have demonstrated an important role for CTCF in advantage. Initial studies demonstrated its binding at the periphery of the nucleolus as well as to the nuclear matrix, which might occur through the nuclear phosphoprotein nucleophosmin [91 ]. Later, CTCF was proposed to be associated with nuclear lamin B in the nucleus. ChIP seq analysis for C TCF occupancy in various cell types identified extensive overlap among CTCF binding sites across different cellular environment [ 92,

PAGE 44

44 93 ] However there is significant difference in the three dimensional interactions between these sites across cell types. F or example, significant differences were observed in CTCF association with H3K27me3 doma in boundaries across cell types. A study at the human beta globin locus, for example, demonstrated that CTCF sites were involved in cell type specific long range intera ction in various human cell lines despite similar occupancy [94 ] Furthermore, c ohesion proteins called cohesins, which play an essential role in keeping sister chromatids together during cell division, have gained tremendous interest as they colocalize wi th CTCF and are thought to give CTCF its cell type specific roles in genome organization. More advanced techniques modified from the original 3C assay like ChIA PET and Hi C, have furth er started to shed light on the city and function. High resolution CTCF associated chromatin interactome map in m ouse ES cells using ChIA PET technique, suggests that CTCF configures the genome into distinct chromatin domains and subnuclear compartments that exhibit different epigenetic states and transcriptional activities. In contrast to its enhancer blocking roles, CTCF appears to promote interaction between promoter and enhancer elements [ 95 ]. Moreover, investigation of the three dimensional genome organization using Hi C technique ha s identified CTCF to be enriched at the boundaries of the so called topological domains (large megabase sized local chromatin interaction domains). These domains coincide with regions that constrain spread of heterochromatin and are conserved across variou s cell types. The boundaries are also enriched for tRNA genes, housekeeping genes, and short interspersed element (SINE) retrotransposons, indicating their role in domain for mation [96 ].

PAGE 45

45 Chromatin Looping and Transcription Control of gene expression can oc cur locally and over large genomic distances. Regulatory elements are frequently positioned far upstream or downstream of the genes they control and can even influence the expression of genes that lie on separate chromosomes. A DNA regulatory element, whic h encompasses binding sites for various transcription factors and can activate promoter driven gene transcription independent of its location, orientation and distance, is termed an Enhancer [ 97 98 ]. Enhancer elements are responsible for allowing spatiote mporal patterns of gene expression during development. from the gene they regulate, sometimes even on separate chromosomes [99 ]. For example, limb bud enhancer for the mouse Sonic hedgehog (Shh ) gene, is more than 1 Mb from the Shh gene promoter [ 100 101 ]; whereas olfactory receptor enhancer H is located on chromosome 14 [1 02 ]. How specific communication among distal regulatory elements is achieved has been the subject of discussion and substan tial recent experimental evidence favors models for long range control of gene expression involving chromatin l ooping [ 103 1 0 4]. Chromatin looping represents an in vivo interaction between two DNA regulatory elements located far apart, which results into the intervening DNA to obtain a loop structure The interaction can be mediated by transcription factors, co activators/co repressors as well as might involve non codi n g RNA, as recently described [1 05 ]. Advances in molecular techniques specifically with t he newer tools like chromosome conformation ca pture (3C) assay, the role of chromatin looping in gen e regulation has become clearer. This approach has now been adapted to produce genome wide map of interactions mediated by a given regulatory element (4C) o r even associations among multiple sequences located throughout the

PAGE 46

46 106, 107, 108 ]. 3C has been utilized to reveal interactions between distal sequences, at multiple gene loci. Within the mammalian globin locus, for example, 3C has been utilized to reveal effect of various transcription factor knockdown on gene transcription and looping interactions [ 109, 110, 75] Similarly, and immunoglobin ]. Evidence supporting enhancer promoter interactions is part of a large and growing body of studies that have suggested nuclear organization as a major determinant of gene expression. First, each chromosome in a nucleus is localized to its own territory, wi th about 20% of nuclear space dedicated to regions of interactions between neighboring chromosomes [ 113, 114 ]. In addition some regions of a beta globin locus, for example found that regions extruded to CT specifically in erythoid cells, and this extrusion occurred prior to activation of high levels of beta globin gene expression and was LCR dependent [ 115 ]. Similarly, the limb bud enhancer is required for extrusion of the S hh gene locus in CT [ 116 ]. Second, nuclear periphery in general appears to exert a repressive influence on genes that localize there. For example, tethering of reporter genes near nuclear periphery or nuclear lamina has shown to result in down regulation o f the reporter and neighboring genes, although this in not true for all genes [ 117, 118, 119 ]. Third, nucleus has various sel f o rganized bodies, including nuclear speckles, PML bodies, nucleoli, cajal bodies and others that might influence the gene express ion. For example, splicing speckles represent concentration of factors, which might serve as a basis for interactions among genes that are otherwise located far apart. This case appears to hold true for erythroid specific genes, that are found

PAGE 47

47 positioned n ear common splicing speckles in erythoid cells [ 120] Finally, genes can colocalize on the basis of shared association with specific factors. This is particularly true for RNA polymerase II. Visualization of RNA polII using antibody specific to RNA polII o r labeling primary transcript have suggested that transcription is localized to RNA 121, 122 ]. In addition to RNA polII, other factors involved in transcription regulation appear to organize into discrete f oci in the nucleus and can either directly or indirectly bring distal gene together. These include, for example, AT rich sequence binding protein, SATB1; which is expressed in thymocytes and many other cell types; functions to bring disparate genomic regio ns together via long range interactions [ 123, 124 ]. In thymocytes SATB1 is observed in a cage like distribution and binds to promoter distal regulatory regions in multiple gene loci and loss of SATB1 results in disruption in normal gene expression patterns and locus wide chromatin structure. Thus, understanding the mechanisms of gene expression at this scale is still an emerging field. Though 3C and its variant s provide important information about enhancer function, these are inherently descriptive assays, and thus do not provide ways to distinguish between correlation and causation. Newer approaches are thus required to establish a direct link between long range interactions and e nhancer function. Given the scope and the indispensable role of chromatin loo ping in gene regulation and genome organization, investigations assessing its role in oncogene activation and cancer manifestation are essential and of current interest. Based on the previous findings, TAL1 GATA1 complex are recruited to the TAL1 promoter 1 and +51 enhancer in K562 cells. Moreover, ChIP chip studies have also demonstrated

PAGE 48

48 enrichment of RNA polII at these regions in K562 cells [49] thus we hypothesized that TAL1 down stream by chromatin looping mechanism. Results Distinct P atterns of H istone Modifications are A ssociated with TAL1 Enhancer/Promoter A ctivities Recent genome wide studies predict a correlation between different type s of histone modifications such as the me thylation statuses of Lys 4 residue on histone H3 tails an d enhancer/promoter activities [ 64, 65 ] Given that TAL1 is tightly controlled by multiple cis regulatory elements in different stages of hematopoiesis, we examined the H3K4me2, H3K4me3, H3K9/14ac, and H3K27me3 patterns across the 166 Kb of the TAL1 locus in K562, and HL 60 cells by ChIP qPCR assay using antibodies specific to these modifications. K562 is human erythroleukemia cell line and HL 60 is derived from an acute myeloid leukemia patient wher e the TAL1 gene is silenced. The pattern of active and repressive histone modifications associated with gene activity in these cell types across the entire STIL1 TAL1 MAP17 locus is shown in Figure 3 1. There are marked enrichments of H3K4me2 and H3K9/14ac in K562 cells at the TAL1 promoter 1, +19, M AP 17 promoter, and the +51 enhancer. H3K4me3 is particularly enriched at the TAL1 promoter 1, but not at other regulatory elements (Figure 3 1 A ). In HL 60 cells where TAL1 is inactive, there are large peaks of H 3K27me3 over the TAL1 promoter IV and promoter 1, marking the silenced TAL1 gene (Figure 3 1B). Moreover, there is no H3K27me3 detected in TAL1 expressing K562 cells. Our results show that previously defined HSC enhancer +19 and erythroid enha ncer +51 are in open chromatin in K562 cells.

PAGE 49

49 The Recruitment of hSET1 C orrelates with TAL1 Transcriptional Activation during H ematopoiesis hSET1 is histone methyltransferase that specifically methylates Lys 4 at histone H3 tails. Given that TAL1 colocalizes with the H3K4 methylatransferase hSET1 complex at the TAL1 target genes during erythroid differentiation [ 125 ] and both +51 enhancer and TAL1 promoter 1 contain composite E box/GATA motifs [ 49 ] we reasoned that recruitment of hSET1 complex by TAL1 may be responsib le for high levels of H3K4 methylations in the TAL1 locus in erythroid cells. To test this possibility, we examined the global interactions between TAL1 and hSET1 at the human genome comparing human primary CD34+ hematopoietic stem cells (HSCs) and CD36+ e rythroid precursors using unbiased ChIP seq technologies. Approximately 50% of intergenic bound hSET1 co localized with TAL1 in CD36+ erythroid precursors ( figure 3 2C ) suggesting that TAL1 recruits the hSET1 complex to regulate its genome wide targets in erythroid cells. As we expected, TAL1 and hSET1 complex bind to both the +51 enhancer and the promoter 1 in the TAL1 locus in primary hematopoietic cells. This binding correlates strongly with H3K4 methylations at these elements ( F ig ure 3 2A &B ). In particu lar, H3K4me3 was enriched around the transcription start site (TSS) of the TAL1 gene upon differentiation to CD36+ cells Thus, our data suggest that recruitment of the hSET1 complex facilitates promoter H3K4 methylations and transcriptional activation of TAL1 expression during normal hematopoiesis A Long range Chromatin Loop Mediates Enhancer/Promoter I nteraction in the TAL1 Locus in Erythroid Precursors but not in T ALL C ells It has been previously reported that +51enhancer is capable of driving reporter gene expression at physiological TAL1 expression sites during hematopoiesis in transgenic mice [47, 126 ] However, it remains unclear how the +51 enhancer activates

PAGE 50

50 the TAL1 gene from 51 Kb downstream in its native chromatin location. An attractive model p roposes formation/presence of a chromosome loop that brings the enhancer and the promoter in close proximity to allow enhancer mediated promoter activation. To test this possibility, we carried out chromosome conformation capture (3C ) assays in CD36+ eryth roid progenitor cells using TAL1 promoter 1 as bait (F igure 3 2 D ) We identify a long range activating chromatin loop between TAL1 promoter 1 and +51 enhancer ( F igure 3 2 E ). This interaction was confirmed by sequencing of the specific PCR product which rev ealed a fusion molecule containing sequences from both promoter 1 and +51 enhancer (Figure 3 2 F ). In contrast, no interactions were detected between TAL1 and M AP 17 promoters Additionally this long range interaction was identified independently using a dif ferent restriction enzyme (data not shown). This data suggests that the +51 enhancer activates the TAL1 promoter 1 via a long range enhancer/promoter chromatin loop. Recent studies have highlighted that long range chromatin interactions provide a topologic al basis for transcriptional regulation [ 127 1 28 ] To test whether the enhancer/promoter loop is specific for erythroid cells or is also present in TAL1 expressing T ALL cells, 3C analysis was performed in K562, Jurkat, and HL 60 cells. For this assay, re striction enzyme NlaIII was used (Figure 3 3 A ) which generated on average 250 500 bp fragments across the genome facilitating detection of specific interactions between the +51 enhancer and the TAL1 promoter 1 Consistent with primary CD36+ cells, the +5 1 enhancer physically interacts with promoter 1 only in K562 cells (figure 3 3B). This interaction was confirmed by sequencing of the specific PCR product ( not shown ). This long range interaction was neither detected between the

PAGE 51

51 M AP 17 promoter and the TAL1 promoter 1 nor in HL 60 cells lacking TAL1 Interestingly, although Jurkat express the TAL1 gene, the chromatin interaction between the +51 enhancer and the TAL1 promoter 1 was not detected in these cells (Figure 3 3B ) supporting the evidence that the +51 enhancer is inactive in TAL1 expressing T ALL cells (Figure 4 3C ). Recruitment of the hSET1 Complex is Essential for Long range Chromatin Loop and T ranscription of the TAL1 G ene Evidence suggests that H3K4me3 is important for establishing chromatin loops [ 50 ] The hSET1 complex has been shown to regulate H3K4me3 methylation. Because the binding of the hSET1 complex correlates with TAL1 activation in erythroid cells (Figure 3 1 and 3 2 ), we further reasoned that recruitment of hSET1 mediate the physical chr omatin interaction between +51 enhancer and promoter 1 at the TAL1 locus. To test this hypothesis, we generated shRNA mediated hSET1 knockdown (KD) in K56 2 cells (Figure 3 3C). SET1 knockdown in K562 affects its colony formation capacity on soft agar assay (Figure 3 3D and E). Furthermore, ablation of hSET1 in CD34+ HSCs resulted in a block in the ability of HSCs to differentiate into CFU E and BFU E colonies but not CFU GEMM and CFU GM colonies (Figure 3 3 F and G) implying an important role for SET1 in er ythroid differentiation. ChIP analysis for SET1 in K562 cells, confirmed its recruitment at the TAL1 locus, similar to the data in CD36+ cells (Figure 3 4A). Next we assessed the effect of SET1 depletion on TAL1 levels. hSET knockdown led to decrease in TA L1 expression in three individual hSET1 KD K562 clones (Figure 3 4 B). In addition to TAL1, SET1 is also required for various other erythroid genes including TAL1 targets, which are repressed as a result of reduced TAL1 expression (Figure 3 4C and D).

PAGE 52

52 Inte restingly, we found d isruption of the long range TAL1 promoter 1a and +51 enhancer chromatin loop upon SET1 knockdown in K562 cells (Figure 3 4 A & B ). A detailed analysis revealed decrease in active histone modifications H3K4me2 and H3K4me3 at the TAL1 pro mo ter and +51 enhancer (Figure 3 5 C ). In addition the recruitment of RNA PolII to both the enhancer and the promoter of TAL1 gene is suppressed (Figure 3 5 C ). Consequently, active histone modifications may be associated with specific chromatin loop formation CTCF Mediated Cell type S pecific Chromatin L oops in the TAL1 Locus Regulate E xpression of TAL1 Gene in E rythroid and Leukemic C ells ChIP chip experiments utilizing genomic tiling microarrays covering 256 kb of the human TAL1 locus identified four disti nct CTCF binding sites in K562 cells, namely 31, +40, +53 and +57 elements [ 49 1 29 ] CTCF site TAL1 locus within the SIL gene body, while +40 is intergenic between TAL1 and MAP17 and +53/+57 are located downstream of +51 enhancer (Figure 3 6 A). Given the global role of CTCF in genome organization [ 89, 1 30 ] it is likely that CTCF may bind differently to CTCF elements in the TAL1 locus in erythroid and leukemic cells, thereby, regulating the +51 enhancer and TAL1 promoter 1 interact ion. To examine this model, we carried out CTCF ChIP analysis in K562 and Jurkat cells. Interestingly, CTCF bound to all of the CTCF elements in both cell lines (Figure 3 6B ) as well as in primary CD4+ T cells (Figure 3 6C), suggesting the binding of CTCF alone is not sufficient to modulate TAL1 gene activity. We next examined whether CTCF differentially regulates genome organization by controlling TAL1 promoter accessibility in erythroid K562 and T ALL Jurkat cells. To address this question, we performed c h romosome conformation capture (3 C) assays in K562 and Jurkat cells using the 31 Kb CTCF element as a bait using

PAGE 53

53 DpnII enzyme (Figure 3 7A) Figure 3 7 B illustrates a specific interaction between CTCF 31 and +53/+57 sites predominantly in erythroid K562 cells but not in T ALL Jukat cells. As a control, there is no CTCF mediated loop formed between 10 Kb and +40 Kb CTCF elements (Figure 3 7 B &C ). The chromatin loop between 31 and +53 CTCF sites might bring the +51 enhancer and promoter 1 of the TAL1 gene into a close proximity thereby facilitating the +51 enhancer medi ated TAL1 promoter 1 activation In contrast to erythroid K562 cells, a smaller chromatin loop between +40 and +53 CTCF sites is detected predominantly in T ALL Jurkat cells (Figure 3 7B and C ). Together, this data suggests a cell type specific chromatin organization by CTCF to regulate TAL1 expression by keeping promoter/enhancer in close proximity in erythroid cells while excluding the +51 enhancer from interacting with the TAL1 promoter 1 in T cell leukemia. Summary To understand the underlying epigenetic mechanisms of TAL1 activation in normal hematopoiesis, we performed ChIP, ChIP seq, and chromatin conformation capture assays to investigate chromatin structure profile which correlates w ith transcriptional activation, at the TAL1 locus comparing erythroid progenitors cell lines and primary CD36+ cells and CD34+ HSCs We observe changes in chromatin dynamics at the TAL1 locus from CD34+ to CD36+ cells co relate with TAL1 promoter enhancer usage. In CD34+ TAL1 promoter 1a, 1a and +19 enhancers are open while in CD36+, +51 erythroid enhancer acquires high enrichment for H3K4me1 mark. Further, w e demonstrate that +51 enhancer interacts with the TAL1 promoter 1a via a long range chromatin loop in vivo. The recruitment of hSET1 HMT complex by TAL1 facilitates this interaction and depletion of hSET1 leads to loss of H3K4 methylation,

PAGE 54

54 enhancer/promoter interaction, RNA PolII loading, and TAL1 transcription. Finally, we investigated the role of insu lator protein CTCF in the regulation of TAL1 expression in normal and in malignant cells. We found that regardless of similar CTCF binding patterns at the TAL1 locus in erythroid progenitors and T ALL cells, CTCF form differential regulatory loops to allow interaction of TAL1 promoter 1 and +51 enhancer in erythroid cells but a repressive loop in T ALL cells. Overall, our study demonstrates, for the first time, an in vivo long range interaction between TAL1 promoter 1a and +51 enhancer, which is regulated a nd organized by hSET1 histone methyltransferase and insulator protein CTCF, which function s to fine tune TAL1 transcription in different hematopoietic compartments.

PAGE 55

55 Figure 3 1. Histone modification associated with TAL1 enhancer and promoter activity i n erythroid cells. Native chromatin immunoprecipitation assay assessing active (A) and repressive (B) histone modification profile at the TAL1 locus in K562 and HL 60 cells. The primers used for the realtime PCR are indicated on the TAL1 locus map. ChIP Fo ld enrichments were determined based on realtime PCR data after normaliz ation to Input DNA The data represents one of the three independent biological repeats.

PAGE 56

56 Figure 3 2 TAL1 promoter 1 and +51 enhancer interact in vivo in C D36+ erythroid progenitors. A & B) ChIP seq analysis for H3K4me3, H3K4me1, TAL1 and Set1 enrichment at the TAL1 locus in C D 34+ and C D 36+ cells. C) Geno me wide target s of SET1 and TAL1, in CD36+ cells. About 45% of SET1 targets are also bound by TAL1. D ) O utline for the 3C assay using BamHI 6 cutter enzyme E ) PCR analysis of the 3C DNA indicating prom1 and +51 interaction in CD36+ cells, F ) S equencing results of TAL1 prom1a and +51 enhancer 3C interaction PCR product. ChIP Seq analysis in CD36+ cells was p erformed at NHLBI, in the laboratory of Dr. Keji Zhao.

PAGE 57

57 Figure 3 3. H3K4 methyltransfearse SET1 is required for the colony formation capacity of K562 and CD34+ HSCs A) NlaIII cut sites at the TAL1 locus and PCR primers used for 3C B) 3C analysis for TAL 1 promoter1 and +51 enhancer interaction in K562, Jurkat, and HL 60 cells C ) Western blot analysis for SET1 knockdown in K562 cells, D & E ) SET1 knockdown affects colony formation capacity of the K562 cells on s oft agar Repres entative pictures are shown in (D ) and quantitation in (E) F ) Western blot for SET1 knockdown in CD34+ cells, and G ) Methylcellulose assay testing colony formation capacity of CD34+ cells, upon SET 1 knockdown. *P value>0.05. The colony formation assay is representative of two biolog ical repeats with three technical replicates in each

PAGE 58

58 Figure 3 4. SET1 is recruited at the TAL1 enhancer/promoter elements and is required for activation of various erythroid genes including TAL1 A) ChIP analysis for SET1 recruitment at the TAL1 locus HOXB4 locus is used as a positive control. Data represented as relative fold enrichment after normalization with IgG (Background). B) RT qPCR analyses of TAL1 (B) and various erythroid genes (C) mRNA levels in the con trol and three KD clones har boring shRN A specific for hSET1. *P value<0.05, **P value<0.01. Data are shown mean SD. The data is cumulative of two biological repeats with three technical replicates.

PAGE 59

59 Figure 3 5. Loss of hSET1 disrupts the erythroid specific long range interaction between +51 enhancer and the TAL1 pr omoter 1 at the TAL1 locus. (A) The 3C analysis for the interaction between +51 enhancer and the TAL1 promoter 1 at the TAL1 locus in the vector control and shSET1 transduced clones B) ChIP analyses of H3K4 me2 and me3 levels as well as RNA PolII recruitment at +51 enhancer and the TAL1 promoter1 upon hSET1 KD. C) Shown is real time qPCR quantitation of the 3C products upon SET1 knockdown 3C data is plotted after quantitation with the primers described on top and is represente d as relative interaction frequency after normalization to BAC template and ERCC3 control region. Data are shown mean SD of three independent experiments. *P value <0.05; **P value <0.01.

PAGE 60

60

PAGE 61

61 Figure 3 6. Similar CTCF occupanc y is observed across different cellular enviornments. A) CTCF sites at the human TAL1 locus, B) ChIP data illustrating no differences in CTCF binding pattern in K562 and Jurkat cells. SILp, prom1a and HS2 are used as negative control regions, and C) UCSC g enome browser representation of CTCF ChIP seq data on TAL1 locus, plotted from raw data from Cuddpah et al., 2007.

PAGE 62

62 Figure 3 7. CTCF organizes TAL1 locus to promote TAL1 promoter/enhancer interaction in erythroid cells A) Human TAL1 locus displaying fou r CTCF binding sites (blue fonts) and DpnII restriction sites (purple dashed lines) used for 3C analysis. B) Semi quantitative PCR analysis of the 3C DNA product to assess interaction among CTCF sites. Specific primer set used are indicated on right along with the specific gel band size +53 CTCF site is used as bait and 10 Kb region was used as a negative control region. C) A total of 3 independent 3C experiments were quantitated by densitometry. Shown are the mean SDM of 3 independent experiments *P v alve< 0.05.

PAGE 63

63 CHAPTER 4 TAL1 GENE REGULATION IN T CELL LEUKEMIA Introductory Remarks TAL1 gene which is normally expressed in erythroid, megakaryocyte and mast cells, is turned off early at double negative stage of normal T cell development. However it is fr equently activated in human T cell leukemia. Unlike erythroid cells, there is scanty literature outlining mechanisms underlying ectopic activation of the TAL1 oncogene in T ALL. As previously discussed, a third TAL1 promoter, promoter IV was described in 1 998 [69 ] TAL1 promoter IV appears to be inactive in SIL TAL1 deletion cells, in normal bone marrow and in erythroid and megakaryocytic cell lines. Further a cell specific factor which functions to repress promoter IV activity in these cells and this repression is released in leukemic T cells [70] The molecular mechanism of this repression and the identity of the trans acting factor currently remain unknown. We are particularly interested in the 60% of T ALL patients which overexpress TAL1 in absence of any TAL1 locus rearrangements. Jurkat and REX cell lines were established from this pool of patients and therefore provide an excellent model system. Earlier studies proposed mon o allelic expression of the TAL1 TAL1 gene app ears to be methylated in one TAL1 allele. On the other allele, t h e authors further identify a DNAse I hypersensitive region about 7Kb upstream of the TAL1 gene as a potential cis regulat ory element in T ALL [ 1 31 ] However no follow up study, dissecting the role of this 7 Kb element in TAL1 gene activation had been described A recen t study by Sanda et al., revealed a new cis regulatory element located about 12Kb upstream of the TAL1 TSS, which is bound by TAL1 GATA3 Lmo1 complex [ 1 32 ] The

PAGE 64

64 role of this element deserves further investigation. Furthermore, since GATA1 is described to be essential for TAL1 gene activation in normal hematopoiesis, previous studies investigating the role of va rious GATA proteins illustrated that, neither GATA2 nor GATA3 could activate TAL1 promoter in T ALL [43]. Moreover, GATA3 ChIP seq analysis in Jurkat cells did not identify TAL1 as a GATA3 target [ 1 33 ]. Distinctively, a study assessing role of HDACi in T c ell leukemia, identified that TAL1 levels are TSA, and SAHA in a dose and time dependent manner [ 1 34 ] This effect of HDACi is independent of apoptosis, protein stability or alternate splicing or mRNA stability. Moreover, RNA polII recruitment is altered upon HDACi treatment at the TAL1 promoter 1 and IV, in cell lines with intact TAL1 gene. These studies provide interesting observations however more in depth analysis about the molecular mechanisms need to be illustrated. Another interesting candidate regulating TAL1 gene in T ALL appears to be long noncoding RNAs. These lncRNAs range from 100nt 9100nts, are spliced, poly adenylated and have no protein coding potential [ 1 35 ] Two lncRNAs termed A3 and A4 were described to be transcribed (A3, sense and A4, antisense to TAL1 ) from the intergenic region between MAP17 and downstream CYP4A11 genes in MCF7 breast cancer cells. Further, knockdown of A3 in MCF7 cells specifically do wn regulated CYP4A11 and TAL1 transcripts. No knockdown studies for A4 were illustrated. These finding s define a novel candidate for TAL1 gene regulation in T ALL. However, despite several attempts we failed to identify these lncRNAs (A3 and A4) in the MCF 7 cells.

PAGE 65

65 Moreover, we found no TAL1 expression in MCF7 cells, thus limiting our analysis to further test the role of these lncRNAs in T ALL. A different perspective to understand TAL1 activation in T ALL is to understand how TAL1 is initially repressed du ring normal T cell development. It is likely that these repressive mechanisms fail during leukemia manifestation, thus leading to aberrant activation of TAL1 oncogene. Unfortunately, there is no literature regarding this aspect. Overall, it is very clear t hat we have very limited knowledge about TAL1 gene regulation in leukemia, and since TAL1 is an essential component for T cell acute l eukemia manifestation, it is critical to dissect the mechanisms underlying its ectopic activation in T ALL. Results Histo ne Modification Pro fil e at the TAL1 Locus in T ALL Cells To assess the role of known TAL1 cis regulatory elements in T cell leukemia, we investigated distribution of various active and repressive histone modifications across the TAL1 neighbourhood in T ALL Native ChIP analysis coupled with real time PCR analysis indicated presence of high levels of H3K4me2 and H3K4me3 at the TAL1 promoter IV in Rex (figure 4 1) and Jurkat cells (figure 4 2) where this promoter is utilized. REX and Jurkat are T ALL cell li ne s where TAL1 is highly activated HPB ALL is a TAL1 non expressing cell line, where the TAL1 promoters and enhancers are enriched for repressive H3K27me3 mark (figure 4 1). In both REX and Jurkat cell lines, TAL1 promoter 1a and 1b appears to be enriched with active histone modifications, however, enhancer +19 and +51 are depleted of both active and repressive histone marks. Interestingly, TAL1 embryonic enhancer 4Kb a p pears to be open in both cell

PAGE 66

66 types. This might be good candidate to look further into SIL promoter is enriched for active modifications as it is expressed in all cell types studied. Enhancer +51 is Epigenetically and Functionally Silent in T ALL Our results in erythroid pre c ursor cells illustrate that +51 enhancer interacts with TAL1 pro moter 1 in vivo via a chromatin loop. Since we did not observe enrichment for active histone modifications at the TAL1 +51 enhancer in T ALL cells, we next assessed whether this TAL1 enhancer/promoter interaction is present in various T ALL cell lines For this we performed similar 3C analysis using NlaIII a four cutter in various T ALL cell lines, including K562 as a positive control. As shown in figure 4 3A, we could not detect interaction between TAL1 promoter 1 and +51 enhancer in T ALL cell lines in co ntrast to K562 cells. HL 60 and HPB ALL are TAL 1 non expressing cell lines and therefore serve as negative controls. The specific interaction product was further sequences to confirm fusion between promoter 1 and +52 enhancer fragments (Figure 4 3B). This data is consistent with figure 3 3B. Next, we tested whether +51 enhancer was active in T ALL cells. Two different sized DNA fragments containing the +51 enhancer element were cloned into a SV40 minimal promoter driven luciferase reporter and introduced into K562 as well as in several T ALL cell lines. Compared to the pGL3 SV40 vector that showed only minimal luciferase activity, the 2 Kb +51 enhancer element specifically activated transcription of the luciferase reporter in K562 cells, but not in the T A LL cell lines, Jurkat, Rex, Molt4, and HPB ALL (Figure 4 3C ). Interestingly, the 4 Kb fragment containing +51 enhancer and downstream +53 Kb CTCF site blocked transactivation activity of the +51 enhancer in K562 cells suggesting that the +53 Kb CTCF site m ay block the +51 enhancer from

PAGE 67

67 activating downstream neighboring genes. Together, the data revealed that the +51 enhancer is neither epigenetically nor transcriptionally active in T ALL cells. SET1 I ndependent TAL1 Gene R egulation in T ALL We observe high levels of H3K4me at the TAL1 promoters in T ALL cell lines. Moreover, SET1 regulates TAL1 ge ne in erythroid cells and unpublished data from the lab has demonstrated interaction between TAL1 and SET1 in Jurkat cells Further, GST studies have identified ASH 2L, a SET1 complex component, to physically interact with TAL1 to mediated SET1 and TAL1 interaction (not shown) Therefore, we hypothesized that SET1 might play a similar role in TAL 1 gene regulation in T ALL To test this, first we assessed SET1 recruitm ent at the TAL1 locus in T ALL Jurkat cells. In contrast to erythroid cells, SET1 was absent at both the TAL1 promoter and enhancer (figure 4 4 C ). NKX3.1 promoter is used as a positive control. Furthermore, unlike K562 cells, w e o bserved no enrichment of T AL1 at its enhancer and promoter in Jurkat cells (figure 4 4 A & B). To confirm the effect of SET1 on TAL1 levels, in T ALL, we stably knocked down SET1 in Jurkat cells. SET1 depletion in Jurkat cells, did not affect TAL1 mRNA and protein levels (figure 4 4 D & E ). These results suggest that both TAL1 and SET1 fail to bind TAL1 locus in T cell leukemia, and therefore does not regulate TAL1 expression in T ALL. CTCF Mediated Cell type Specific Chromatin L oops in the TAL1 Locus B lock TAL1 Enhancer/Promoter I nte raction in T ALL As described in figure 3 7, we identified a unique role for CTCF in TAL1 gene regulation wherein interaction among CTCF sites 31 and +53 in e r yth r oid cells might facilitate TAL1 promoter 1 and +51 enhancer interaction, while interaction between CTCF sites +40 and +53 in T ALL Jurkat cells, might block the +51 enhancer from

PAGE 68

68 activating TAL1 promoter 1 in T cell leukemia. To further validate these finding in T ALL patients, we obtained primary T ALL frozen bone marrow sample from collabrato rs First we assessed whether TAL1 was expressed in this patient by RT qPCR and immu no blot analysis. As shown in figure 4 5A, T ALL sample expresses very high levels of TAL1 when compared to positive control Jurkat cells and negative c ontrol HPB ALL cells. A lthough protein extraction from the T ALL sample was not efficient, we could still significantly observe TAL1 protein expression in T ALL sample (figure 4 5B). Next, we assessed whether the TAL1 locus in this patient was intact. For this we designed prim ers as described by earlier studies evaluating the presence of various TAL1 gene rea r ra n gements in T ALL. As shown in figure 4 5C top panel, there are three distinct SIL TAL1 deletion breakpoints, D1, D2 and D3, where D1 is the most prevalent (>90%). In ad dition to SIL TAL deletions, t(1 ; 14) (p32; q1 1 ) translocation is also observed in 3% of T ALL cases (<3%). We performed semi quantitative PCR analysis to test for the presence of these rearrangements, and we detected neither in the T ALL patient sample. Ho wever, this evaluation is limited by the presence of only one positive control for the SIL TAL1 d1 and therefore, we cannot rule out the possibility that the primers we used (though these primers were previously described and published) did not work effici ently Next, t o confirm our finding of CTCF Jurkat cells, we performed similar 3C analysis in T ALL patient sample About 1x10 7 cells were cross linked with 1% formaldehyde and subjected to digestion with DpnII for 3C analysis. Normal human bone marrow samples were used as control for this study. Semi quantitative PCR analysis of the 3C DNA using primer pairs, 31/+53; +40/+53, and loading control promoter IV, demonstrated specific interaction among CTCF sites +40 and +53

PAGE 69

69 predominantly in T ALL sa mple (figure 4 6B). Whereas, in normal bone marrow we observe d interaction between 31 and +53, consistent with the data in erythroid cells (figure 3 7). The residual interaction between 31 and +53 in T ALL sample could be from the erythroid cells present in the T ALL patient whole bone marrow sample. These interactions were further quantitated using Image J software (figure 4 6C). Summary In summary, unlike erythroid cells (chapter 3), in T cell acute lymphoblastic leukemia cell lines and a primary patie nt sample we demonstrate that previously described TAL1 e tically in active based on the histone modification profile Furthermore, e nhancer +51 fails to drive luciferase reporter in T ALL, and is not involved in long range interaction with the upstream TAL1 promoter 1 More over TAL1 which is recruited to its own promoter and enhancer in CD34+, CD36+ and K562 cells (figure 3 2) does not auto re gulate itself in T ALL. In cont rast to erythroid cells, despite the enrichment for active H3K4me2/3 marks at the TAL1 promoter 1 in T ALL cells, SET1 depletion does not alter TAL1 levels in T ALL cells. This effect is due to absence of SET1 binding at the TAL1 promoter 1 in T ALL, t herefore indicating the role of MLL HMTs in TAL1 gene r egulation in T ALL. Finally, our studies investigating the role of insulator protein CTCF in the TAL1 gene regulation describe that CTCF organizes the TAL1 locus to block TAL1 promoter activation by the downstream +51 enh ancer in T ALL, whereas in erythroi d cells it may function to bring TAL1 enhancer and promoter in close proximity. Confirmation of these findings in primary T ALL patient samples and normal bone marrow indicate s physiological functional significance for the role of CTCF and further supports the data obtained so far in T ALL cell line model systems. Altogether, based on the histone modification profile,

PAGE 70

70 TAL1 and SET1 occupancy, luciferase reporter assay and chromatin looping mediated by CTCF, we report that TAL1 +51 enhancer does not activate TAL1 gene in T ALL, thus reveal ing fine tuning by the cellular mechanisms to allow proper activation of the TAL1 gene in normal, while prevent the same in malignant cells. However, rapidly divi di ng cancer cell, perturb the normal cellular and molecular me cha nisms to their own advantage. An d therefore, to dissect mechanisms unde r lying ectopic activation of the TAL1 onco gene in T ALL, we investigated the role of novel T cell leukemia specific enhancer elements genome wide (refer to Summary and D iscussion, ch apter 6).

PAGE 71

71 Figure 4 1. Histone modification profile at the TAL1 locus in T ALL REX and HPB ALL cells. A) Human TAL1 locus displaying primers designed against various cis regulatory elements used for the ChIP analysis. B) Native ChIP analysis of active (H3 K4me2/3, K9/14Ac) and repressive (H3 K27m3) histone modifications in REX (top) and HPB ALL (bottom) cells. Quantitative PCR analysis was performed to determine Input/Bound ratio. This analysis was performed only once with three technical replicates. Data is represented as mean SD from three technical repeats of single experiment.

PAGE 72

72 Figure 4 2. Histone modification profile at the TAL1 locus in T ALL Jurkat cells A) TAL1 locus map outlining various prime rs used for the ChIP assay, B) Q uantitative PCR an alysis data for fold enrichment of various active and repressive histone modifications at various cic regulatory regions of the TAL1 locus in Jurkat cells. The data is representative of three biological independent repeats.

PAGE 73

73 Figure 4 3. TAL1 +51 enhan cer is neither functionally active nor does it interact with TAL1 promoter in T ALL cells A) 3C analysis for interaction between TAL1 promoter 1 and +51 enhancer in various cell lines. Primers used for the PCR are indicated on right and the NlaIII cut sit es are illustrated on top. B) Sanger sequencing results of the 3C interaction PCR product, and C) Luciferase reporter assay was performed in various cel l lines using the constructs illustrated on left. Relative luciferase activity was calculated after norm alization with renilla luciferase and to empty vector. Error bars represent mean SD from three biological repeats, *P value<0.05.

PAGE 74

74 Figure 4 4. SET1 is neither recruited to the TAL1 locus nor is it required for TAL1 expression in T ALL Jurkat cells Ch IP analysis for TAL1 binding at the TAL1 locus in K562 (A) and in Jurkat ( B ) cells. SIL and reg 16Kb are used as negative controls, C ) SET1 ChIP analysis demonstrating no SET1 binding at TAL1 enhancer/promoter in Jurkat cells. Nkx3.1 promoter is used as a positive control, and D) SET1 knockdown in T ALL Jurkat cells did not affect TAL1 protein (D) and mRNA (E) levels in three independent clones *P value<0.05.

PAGE 75

75 Figure 4 5. Assessment of TAL1 expression and chromosomal rearrangements in primary T ALL pati ent sample A) R T qPCR analysis for TAL1 mRNA levels in T ALL sample, B) Western blot analysis for TAL1 protein expression in T ALL, and C) Semi quantitative PCR analysis testing absence of any TAL1 locus genomic rearrangements in primary T ALL patient sam ple. Various rearrangements involving TAL1 are illustrated on top. Primers were designed against the various breakpoints for semi quantitative PCR analysis. CEM is a positive control for SIL TAL1 D1 rearrangement.

PAGE 76

76 Figure 4 6 CTCF reorganizes TAL1 locus to block +51 enhancer mediated promoter activation in T cell leukemia A) Human TAL1 locus displaying four CTCF binding sites (blue fonts) and DpnII restriction sites (purple dashed lines) used for 3C analysis. B) Semi quantitative PCR analysis of the 3C D NA product to assess interaction among CTCF sites. Specific primer set used are indicated on right along with the specific gel band. 10 Kb region was used as a negative control region. C) A total of 3 independent 3C experiments were quantitated by densito metry. Shown are the mean SDM of 3 independent experiments. *P value < 0.05.

PAGE 77

77 Figure 4 7. CTCF depletion in T ALL Jurkat cells induces TAL1 transcription. A) Western blot analysis demonstrating CTCF k nock d own and upregulation of TAL1 protein in two inde pendent pools of shCTCF knockdown Jurkat cells. This data is representative of two biological repeat, and B) RT qPCR analysis measuring TAL1 mRNA levels after CTCF knockdown in Jurkat cells Error bars represent mean SD from two independent biological re plicates, *P value<0.05, **P value<0.01.

PAGE 78

78 CHAPTER 5 ROLE OF L IM D OMAIN B INDING PROTEIN 1 IN TAL1 GENE REGULATION IN ERYTHROID CELLS Introductory Remarks T ranscriptional regulation of its target genes by TAL1 is manifested in multifactorial complexes On e of most abundant and well studied complex comprises of TAL1, E12/47, GATA1, LMO2 and Ldb1 proteins E12 and E 47 a re spliced variants of E2A gene product They belong to class I bHLH family and can homo or hetero dimerize E12 and E47 proteins are essenti al for normal T cell differentiation TAL1 is mostly present as a heterodimer with either of these or with HEB gene product. Lmo2 is a member of LIM (Lin 11, Isl 1, Mec 3) domain containing proteins. LIM domains are cysteine rich zinc binding domains that are structurally similar to DNA binding GATA finger domains. However, no DNA binding activity has been demonstrated rather they are proposed to provide protein protein interaction interface [136 ] LIM domain binding protein 1 (Ldb1) was originally identif ied due to its ability to bind LIM homeodomain (LIM HD) or LIM only (LMO) domain. It has no enzymatic or DNA binding activity and can homo or hetero dimerize. Deletion of Ldb1 in mice results in embryonic lethality at day E9.5 E10 due to pleiotropic effect s involving defects in heart, hindbrain, and posterior axis development as well as defects in mesoderm derived extra embryonic structure inc luding blood islands of the yolk sac [1 37 ] Induced deletion of Ldb1 in hematopoietic progenitor cells result s in th e rapid depletion of HSCs and downregulation of many genes encoding molecules known to be required for the specification and/or maintenance of HSCs [1 38 ] This study further revealed Ldb1 occupancy at key hematopoietic genes including TAL1, C MYB, LYL1, an d LMO2. Genome wide analysis of the LDB1 complexes containing GATA1 and TAL1

PAGE 79

79 transcription factors in mouse E13.5 fetal liver primary erythroid cells revealed that the complex functions primarily as a transcriptional activat or however, it can function a s a repressor in the presence of high levels of ETO 2 and Mtgr repressor proteins [1 39 ] These studies demonstrate a role for Ldb1 in hematopoiesis and identify its genomic targets. A study in mediating long range chromatin interaction s at the mouse beta globin locus [57] Further work demonstrated requirement for Ldb1 in the migration of the Beta globin locus away from the nuclear periphery, which is necessary to achieve robust transcription globin in nuclear transcription factories [1 40 ] Later, t he LDB1 complex was reported to mediate and activate the long range enhancer/promoter interactions at the Myb loci upo n differentiation [1 41 ] Thus, based on these studies and g iven the presenc e of GATA 9bp E box motifs at the TAL1 +51 enhancer and the promoter 1a previous studies utilizing ChIP chip experiments demonstrated the recruitment of the Ldb1 along with TAL1, GATA, E12 and Lmo2 proteins at the TAL1 locus [49] However the role of Ldb1 on TAL1 gene regulation is currently unknown. Moreover, it remains to be illustrated whether Ldb1 is essential for TAL1 enhancer/promoter interaction, similar to the findings at the beta globin and Myb locus. Results Ldb1 Depletion Results in D ecreased TA L1 mRNA and Protein L evels As Ldb1 is an essential component of TAL1 GATA1 complex, and given that both the promoter and enhancer +51 contain E BOX/GATA motif, we hypothesize that Ldb1 must play an essential role in TAL1 gene regulation. To assess this, we depleted Ldb1 in K562 cells using lentiviral transduction system. Five distinct Ldb1 shRNA contructs were purchased from Open Biosystems to make lentivirus. The cells were than

PAGE 80

80 transduced with a mix of all to obtain maximum knockdown efficiency. Immunoblo t analysis for Ldb1 and TAL1 protein levels reveal ed reduction in TAL1 protein level upon Ldb1 knockdown. Similarly, TAL1 mRNA was reduced significantly upon Ldb1 depletion (figure 5 1B right ). This data is consistent with published data indicating role of Ldb1 in TAL1 gene expression in hematopoietic stem cells [1 38 ] Furthermore, Ldb1 knockdown decreased expression of various other erythroid genes inc luding Myb, p4.2, GPA, globin (not shown). To test whether the decrease in TAL1 levels was subsequent to decrease in long range TAL1 enhancer/promoter interaction, we performed 3C analysis using TAL1 promoter 1 a bait in shLdb1 K562 cells. Semi quantitative PCR analysis of the 3C DNA with TAL1 promoter 1a and +51 enhancer primers revealed decrease in interaction upon Ldb1 kd (figure 5 2B). Realtime PCR analysis was further utilized to quantitate th e se differences. Various other regions in cluding Map17 promoter and +70 r egion s w ere used as negative controls. No interaction between TAL1 promoter 1 and negative control regions was observed (figure 5 2C). The interact ion was also confirmed by sanger sequencing of the PCR product (not shown). SET1 Depl etion Alters Ldb1 Levels in E ry throid Cells Given that SET1 plays an important role in TAL1 gene regulation, we next wanted to test its direct versus indirect roles, for this we first assessed Ldb1 levels upon SET1 in K562 cells. Figure 5 3 illustrates SET1 depletion decreases Ldb1 mRN A and protein levels significantly not only in K562 cells (top) but also in uninduced murine erythrol e ukemia (MEL) cells (bottom). These results raise question about effect of SET1 on TAL1 gene regulation might be through Ldb1. Therefore, to gain insight i nto this, we overexpressed Flag tagged Ldb1 in shSET1 K562 cells using pOZ N FH retroviral vector system. This systems offers a unique advantage to screen Ldb1 overexpressing

PAGE 81

81 cells, since both exogenous gene and IL2R are made as polycistronic mRNA. Mature IL2R receptor is than localized to the cell membrane and the positive cells can then be concentrated using IL 2R a b couple d magnetic beads. Western blot analysis indicates that overexpression of Ldb1 in shSET1 cells could not rescue TAL1 level s, reinstating role of SET1 in looping and disregarding that presence of Ldb1 alone does not suffice (figure 5 4B). However, since the cells are cultured for longer time to screen for Ldb1 ana ly sis can be made from this data. Ldb1 Regulation of TAL1 Gene is Independent of H3K4me2&3 Based on the role of SET1 on TAL1 gene regulation in erythroid cells, we propose role of H3K4me2&3 modifications in mediating long range chromatin interactions. To test this hold true in case of Ldb1 knockdown, i.e. is the decrease in TAL1 promoter and enhancer interaction that we observe upon Ldb1 knockdown is a combination of decrease in Ldb1 as well as in H3K4 methylation levels, we performed ChIP analysis for H3 K4me2 and H3K4me3 enrichment at the TAL1 locus in shLdb1 K562 cells. Surprisingly, we did not observe any reduction in H3K4 me levels at both the TAL1 promoter and enhancer upon Ldb1 depletion (figure 5 4A). Therefore, based on this data, it appears that L db1 acts independent of H3K4me2/3 modification on TAL1 gene, however, overexpressing Ldb1 in shSET1 cells, does not rescue TAL1 levels. Summary Assessment of Ldb1 role in TAL1 gene regulation in erythroid K562 and MEL cells, shows Ldb1 regulates TAL1 tran scription by regulating long range TAL1 promoter and enhancer interaction. Both TAL1 enhancer +51 and promoter 1, which are epigentically active in erythroid cells are bound by Ldb1. This function of Ldb1 appears

PAGE 82

82 to be independent of SET1 me diated H3K4me2/ 3 modifications since H3K4me2/3 modifications remain unchanged upon Ldb1 knockdown, however, since Ldb1 overexpression studies in shSET1 cells did not rescue TAL1 levels, additional experiments are needed to dissect the molecular events. Specifically becau se neither TAL1 to be recruited to the specific E box/Gata motifs at the TAL1 +51 enhancer and promoter 1 In vivo protein protein interaction studies have also identified interaction be tween Ldb1 and SET1 in K562 ce ll nuclear extract (not shown). Similar experiments have detected interaction between Tal1 and SET1 in K562 cells as well (not shown). Further experiments need to be performed to characterize the cross talk between the three p roteins, i.e. TAL1 SET1 and Ldb1. From SET1 depletion studies in K562 and MEL cells its appears that SET1 regulates both TAL1 and Ldb1 expression. Whereas depletion of TAL1 by siTAL1 transient transfections and Ldb1 knockdown in K562 cells does not alter SET1 levels (not shown) However, whether this effect of SET1 on Ldb1 levels is direct or indirect via TAL1 needs to be investigated. Therefore many aspects of Ldb1 mediated TAL1 gene regulation remain unanswered and future studies aiming to address these questions are needed.

PAGE 83

83 Figure 5 1. Ldb1 is required for high levels of TAL1 in erythroid cells A) Ldb1 knockdown efficiency in K562 cells. TAL1 levels are reduced upon Ldb1 knockdown, B) RT qPCR analysis measuring 45% reduction in Ldb1 levels, and C) R T qPCR analysis demonstrating >50% reduction in TAL1 levels upon Ldb1 depletion. *P value<0.05, **P value<0.01.

PAGE 84

84 Figure 5 2. Ldb1 regulates TAL1 transcription by stabilizing long range TAL1 promoter enhancer interaction in K562 cells A) 3C analy sis illustrating decrease in TAL1 promoter/enhancer interaction upon Ldb1 knockdown, and B) Quantitation of the interaction between TAL1 enhancer and promoter upon Ldb1 depletion using realtime PCR analysis. 3C data is plotted after quantitation with the p rimers described on top and is represented as relative interaction frequency after normalization to BAC template and ERCC3 control region. Error bars are represented as mean SD from two biological repeats.

PAGE 85

85 Figure 5 3. SET1 regulate s Ldb1 levels i n K562 and in MEL cells A & B) SET1 knockdown in K562 cells alters Ldb1 protein (A) and mRNA (B) levels in two independent clones, and C & D) SET1 knockdown in undinduced MEL cells, reduces Ldb1, TAL1 and SET1 protein (C) and mRNA (D) levels in three inde pendent clones. The data is representative of two biological repeats.

PAGE 86

86 Figure 5 4. Ldb1 depletion does not alter H3K4me2/3 enrichment at the TAL1 enhancer and promoter A&B) ChIP experiments for enrichment of H3K4me2 (A) and H3K4me3 (B) at the TAL 1 enhancer +51 and promoter 1 upon Ldb1 depletion. Reg +70 is used a negative control, and C) Western blot analysis for TAL1 protein upon overexpression of Ldb1 in shSET1 K562 cells. Overexpression of Flag Ldb1 in shSET1 K562 cells is shown in the western analysis. Ldb1did not rescue TAL1 protein levels.

PAGE 87

87 CHAPTER 6 SUMMARY, DISCUSSION AND FUTURE DIRECTIONS Summary and Discussion Hematopoiesis is a very dynamic cellular process in which mult i potent HSCs give rise to diverse hematopoietic lineages. TAL1 is a critical oncogenic transcription factor required for this process [ 1 4 2 ] Aberrant activation of TAL1 in T lymphocytes leads to leukemic transformation in the majority of childhood T ALL [ 68 ] It is therefore essential to understand the molecular mechanisms that regulate TAL1 transcription activity in normal hematopoiesis and leukemic T cells. We found that TAL1 gene is controlled in normal hematopoietic progenitor cells by a long range intrachromatin loop that brings the +51 enhancer into close p roximity of the TAL1 promoter 1. The loop interaction is specific for erythroid precursor cells and is absent in other hematopoietic cells where TAL1 is silenced or even in T ALL cells where TAL1 is expressed. Thus, an interesting question is what underlie s this differential selection of the +51 enhancer usage in e rythroid precursors and how the tissue specific chromatin loop is established and stabilized. Several lines of evidence support that active histone modifications such as H3 acetylation and methyla tions play an important role in communication between genes and distal cis regulatory elements by chromosomal loops [ 75, 1 43 ] One example globin locus where the LCR can serve as a primary site to recruit transcription factors and chromatin modifying and remodeling factors and stably alter topology of the globin locus during transcriptional activation in erythroid cel ls [ 57, 75, and 1 44 ] Depletion of hSET1 led to reduced H3K4 methylation, disruption of the +51 enhancer/promoter1 chromatin loop, and loss of TAL1 transcription (Figure 3 5 ) suggesting a plausible model that hSET1 mediated H3K4 methylation may be required

PAGE 88

88 for establishing or stabilizing the enhancer/promoter communication through a long range chromatin loop. T he loss of PolII occupancy in the hSET1 depleted cells m akes it possible that hSET1 mediated H3K4 methylations remodel local chromatin and facilitate the accessibility of the basal transcription factors to the TAL1 promoter. T he data provide s a potential mechanism that links H3K4 methylations an d long range enhancer/promoter in erythroid cells. An explanation to the absence of TAL1 promoter/enhancer in teraction in T ALL, might stem from the observation that neither Tal1, GATA3 nor SET1 occupy TAL1 promoter and enhancer regions, moreover SET1 depletion in Jurkat cells does not alter Tal1 levels. Therefore some tissue specific activity inhibits TAL1 compl ex recruitment at these sites in T ALL. Moreover, presence of active H3K4 di and tri methyl marks at the TAL1 promoter 1 in contrast to TAL1 +51 enhancer, indicates possible role for MLL family of H3K4 methyl transferases in TAL1 gene regulation in T ALL. One particularly interesting finding is that CTCF mediate s different chromatin loops at the TAL1 locus in erythroid cells and T ALL cells, thereby providing another layer of regulation to ensure proper TAL1 expression (figure 3 7) CTCF has been implicat ed in diverse regulatory functions, including transcriptional activation and repression, insulation, imprinting, and X chromosome inactivation [ 89, 1 30 ] CTCF molecules are capable of interacting with each other to form a cluster and thereby creating close d looping domains [ 90 ]. It has been proposed that CTCF may play a primary role in the global organization of chromatin architecture and lineage specific gene expression With regards to the TAL1 locus, our data revealed that CTCF differentially organized c hromatin loop domains in erythroid and leukemic cells such that

PAGE 89

89 the +51 enhancer was in a close proximity to the TAL1 promoter1 in erythroid cells and the +51 enhancer was blocked from the TAL1 promoter in T ALL cells. It is likely that the closed chromat in loop between 31 and +53 CTCF sites also prevents the upstream SIL promoter from activating TAL1 gene in erythroid cells. Moreover, KD of hSET1 does not affect the CTCF mediated looping in the TAL1 locus in erythroid cells ( Appendix Figure B). This sugg ests that CTCF is not involved in the enhancer/ promoter interaction directly and further demonstrates a unique role for SET1 in chromatin looping. Absence of CTCF at the TAL1 promoter 1 and at the +51 enhancer supports this idea. However, CTCF mediated chr omatin loops probably facilitate interactions between enhancers and promoters by bring in g them into a close proximity (refer to future directions). The observations for CTCF occupancy and differential looping at the TAL1 locus in erythroid Vs. T ALL cells are similar to that described at the globin locus in K562 and 293T cells [94] At the human globin locus, though the CTCF occupancy remains provided by cohesion proteins Depletion of cohesion protein Rad21 alters CTCF occupancy as well as chromatin looping at the beta globin locus. Furthermore, c o operation between CTCF and cohesion proteins has been rearrangement at the Ig locu s as well as for inter chroma tin interaction between Bcl11b and Arhgap6 loci [ 1 45 1 47 ] To test whether the cell specificity to the CTCF role at the TAL1 locus is provided by cohesins, we investigated the role of cohesin protein s, rad21 and smc3 at the TAL1 locus. ChIP analysis revealed no differences in cohesi n occupancy across the four CTCF sites at the TAL1 locus between K562 and Jurkat cells (appendix A). These data

PAGE 90

90 supports the idea that e ven CTCF interaction with its cofact or cohesin does not seem to differ in different cell types [1 48 ] Next, whether differences in post translationally modified CTCF protein polII, are important for this cell specific role of CT CF will be addressed (refer to future directions). The communication between promoters and cis regulatory enhancers by inter or intra chromosomal interactions has become an important mechanism that governs gene activation over long distances. Many eryth roid expressed gene loci are regulated by a long range chromatin loop that facilitates the distal enhancer accessing promoter in developmental stage specific manner. The question remain s to be answered is how the tissue specific chromatin loop is establish ed and stabilized. It was reported that the LDB1 mediated TAL1 /GATA1 transcription factor complex is required for the loop formation at the globin locus [ 57 ] Recent study using zinc finger mediated tethering of LDB1 to the globin locus in the GATA 1 null cells indicated that recruitment of LDB1 initiated long range enhancer/promoter interaction and globin transcription [ 1 49 ] In the TAL1 locus, there are four TAL1 GATA motifs present at the promoter 1a and the +51 enhancer. TAL1 transcription in hematopoiesis is tightly regulated by multiple cis regulatory elements spreading over the whole TAL1 locus. The +51 enhancer (+40 in mice) is requ ired for TAL1 expression in primitive and definitive erythropoiesis [ 4 7] It has been shown that the TAL1 /GATA 1/LMO2/LDB1 multi protein complex is enriched at the +51 enhancer in K562 cells [ 49 ] Consistent with the importance of the TAL1 /GATA1 complex du ring erythroid differentiation [1 50 ] we found that the TAL1 complex is localized to both +51 enhancer and the TAL1 promoter 1a in CD36+

PAGE 91

91 erythroid precursors (Figure 3 2) and KD of LDB1 disrupts the chromatin loop between the +51 enhancer and the TAL1 prom oter 1a in erythroid cells ( Figure 5 2 ). Thus, our data support that the LDB1 mediated chromatin loop organization may initiate and facilitate TAL1 gene activation in erythroid precursors. Nevertheless, depletion of hSET1 led to reduced H3K4 methylation, d isruption of the +51 enhancer/promoter 1a chromatin loop, and loss of TAL1 transcription suggesting a plausible model that hSET1 mediated H3K4 methylation may be required for stabilizing the enhancer/promoter looping initiated by LDB1 complex. It is intere sted to note that active histone modifications including histone acetylation and asymmetric dimeH4R3 are essential for maintaining active chromatin loop in the globin locus. However, it is possible that hSET1 mediated H3K4 methylation remodel local chromatin may also facilitate the accessibility of the TAL1 /GATA1 transcription factor complex to the DNA motifs. Putative TAL1 Interacting Regions in T ALL In T ALL patients, TAL1 oncogene can be activated by chromosome translocation and interstitial deletion [67, 68, 73] However, chromosomal rearrangements only account for less than 30% of cases of all with aberrant TAL1 overexpression ( F igure 1 2). The question ar ises, how is the TAL1 oncogene aberrantly activated in the majority of T ALL patients that lack chromosome rearrangements in the TAL1 locus and whether dysregulation of enhancer/promoter interactions leads to a disease causing regulatory variant. Although several enhancer elements have been identified in the TAL1 locus [ 1 51 ], epigenetic, chromatin looping, and reporter analysis suggested that none of them is transcriptionally active in T ALL cells (Figure s 4 1, 4 2 and 4 3 ). Thus, c urrently, it remains unkno wn, how TAL1 is activated in the majority of T ALL patients lacking the TAL1 locus rearrangements. To understand the molecular

PAGE 92

92 mechanism underlying regulation of the TAL1 oncogene in leukemic T cells, we employed circularized chromosome conformation captur e (4C) methodology to identify new regulatory elements that activate TAL1 specifically in T ALL leukemia This dissertation will not cover details on the data obtained from 4C analysis in T ALL, however the key findings are discussed. Using TAL1 promoter 1 a as the bait, we discovered that the TAL1 promoter 1a interacts with the TIL16 ( TAL1 interacting locus on chromosome 16) element in T ALL cell line Jurkat, but not in erythroid progenitor K562 cells ( F igure 6 1 B ). TIL16 is located intergenic about ~15 Kb downstream of T cell specific CD2BP2 gene and 5Kb upstream of the non coding RNA gene LOC595101 on chromosome 16 The CD2BP2 protein is a cellular adapter protein that was originally identified as a binding partner of the T cell adhesion protein CD2 in the context of T cell signaling [1 52 ] It is also called as U5 52K (U5 snRNP 52K protein), for it s interaction with U5 15K protein within the splicosomal U5 snRNP [1 53 ] The inter chromosomal interaction between the TIL16 and the TAL1 promoter 1a was further confirmed by 3C assay in three TAL1 over expressing T ALL cell lines, Jurkat, REX and Molt4, but not in K562 cells and by sanger sequencing of the specific interaction band. To further test this interaction in human patients, we performed 3C assay for TAL1 TIL16 interaction in primary T ALL patient bone marrow sample. Consistent with our initial findings, we could detect TAL1 TIL16 interaction in the T ALL patient sample T his patient ectopically expresses TAL1 in absence of its gene rearrangements (not sho wn) These findings identify a novel TAL1 interacting locus TIL16, with a potential enhancer activity to drive TAL1 expression in T cell leukemia. We further identify the role of c maf proto oncoprotein in TAL1 gene regulation by regulating this trans inte rchromosomal

PAGE 93

93 interaction in T ALL (figure 6 1B) Evaluating the role of this novel trans interaction in T ALL will not only aid in answering a long standing mystery about the molecular mechanisms that underlie TAL1 activation in T cell leukemia, but will a lso provide us with newer targets for better therapeutic intervention of T cell leukemia treatment and cure. Figure 6 1. Model: CTCF and epigenetic mediated chromatin looping regulated TAL1 expression in hematopoiesis and leukemogenesis A) In erythoid cells, interaction between CTCF sites 31 and +53 organizes the TAL1 locus to bring TAL1 promoter 1 in close proximity to +51 enhancer, an interaction which is regulated by SET1 and LDB1, a TAL1 complex component, B) In T cell acute leukemia, interaction between CTCF sites +40 and +53 insulates TAL1 promoter activation by +51 enhancer. However, in T ALL cells, a novel cis TAL1 expression, an interaction which is regulated by c maf.

PAGE 94

94 Future Directio ns Evaluating the Factors Regulating Cell type Specific Role for CTCF Our findings reveal that despite no differences in CTCF occupancy at the TAL1 locus in K562, Jurkat and CD4+ T cells, we observe cell type specific chromatin loops involving these CTCF sites. Specifically we observe a small loop between CTCF sites +40 and +53 in T ALL, which blocks +51 enhancer from activating TAL1 promoter 1, whereas in erythroid cells, interaction between 31 and +53 sites might function to keep TAL1 enhancer and promo ter in close proximity. Following from this analysis, we next want to investigate what defines this cell type specific role for CTCF? As discussed in the results and discussion section, we find no differences in cohesion proteins Rad21 and Smc3 occupancy a t the TAL1 locus in K562 and Jurkat cells, similar to our observations for CTCF occupancy (Appendix A). Next, additional cohesion proteins smc1, SA1 and SA2. Recent reports highlight the role for cohesion subunit SA1 as large ly responsible for cohesin accumulation at promoters and at sites bound by the insulator protein CTCF [ 1 54 1 55 ]. specificity attributed to each subunit. We will also investigate the role of additional CTCF interacting proteins, RNA polII, YY1, and nucleophasmin which have been reported to influence CTCF recruitment and chromatin function [ 1 56 ]. For this, ChIP analysis for each of these factors will be first performed to see any differences in binding pattern across K562 and Jurkat ce lls. For the factors with significant differences, which might clue in driving cell studies to dissect the detailed molecular mechanism. s interacting proteins, CTCF undergoes several post translational modifications, including acetylation,

PAGE 95

95 phosphorylation, sumoylation and poly(ADP ribosyl)ation. Parylated forms of CTCF occur both in nucleus and in nucleolus, which is reflected in the chang e in molecular weight from 130 Kd to 180 Kd. Parylation involves addition of poly (ADP ribose) chains (PARs) to proteins catalyzed by Poly (ADP ribose) polymerases [ 1 57 ] Parylation of CTCF is important for its role in genomic imprinting as treatment with PARP inhibitors led to loss of imprinting at 140 CTCF targets genome wide [ 1 58 ]. Parylated CTCF is further illustrated to repress ribosomal gene transcription [ 1 59 ]. Moreover, CTCF directly interacts and activates PARP 1 protein in vivo and in vitro [ 160 ]. Thus, parylation of p hosphorylation of CTCF C terminal four residues (604, 609, 610, and 612) by casein kinase II (CK II) attenuated CTCF mediated repression on c myc gene w ithout affecting its DNA binding [ 1 61 ] The a uthors further demonstrate co expression of CTCF and CK II switches function of CTCF from a repressor to activator [ 1 62 ]. Since phosphorylation and a plausible factor to assess. CTCF protein can be further modified by ubiquitin like small SUMO molecules by SUMO1 and SUMO2 proteins, in vivo and in vitro Sumoylation of CTCF contributes to its repressor function on c myc promoter without affecting i ts DNA binding in vitro [ 1 63 ]. Given, th is effect of various post function, detail analysis for each of these modifications is proposed. First, immunoblot analysis will be utilized to detect whether CTCF is modified in erythroid and in T ALL cells. Next ChIP analysis using modification specific antibodies will be performed to assess differences in site specific bound CTCF protein (given that both phosphorylation er its function). Based on

PAGE 96

96 activity at the TAL1 locus. CTCF Depletion Studies in Erythroid and in T ALL Cells Based on our findings, it is conceivable that CTCF depletion in erythroid and T ALL cells might have distinct effect s on TAL1 expression. Interestingly, CTCF knockdown in T ALL Jurkat cells, increases Tal1 mRNA and protein levels (figure 4 6). Whether this increase is due to TAL1 promoter 1 and +51 enhance r interaction establishment or whether CTCF has a role in TAL1 promoter1 and TIL16 interaction in T ALL will be investigated. Thus, our future work will utilize 3C analysis using NlaIII restriction enzyme to assess the effect of CTCF depletion on T AL 1 locu s chromatin architecture in erythroid K562 and in T ALL Jurkat cells. To assess the role of CTCF on TAL1 gene regulation in using lentiviral system in K562 cells. Blocking CTCF Activity by U t ilizing Artificial Zinc Finger DNA Binding Domains The effect of CTCF knockdown may be non specific and more robust since CTCF plays various cellular functions. Therefore, to evaluate the role of C TCF specifically in TAL1 gene regulation, we plan to utiliz e artificial zinc finger DNA binding do mains (Zn DBDs), as described earlier [ 1 64 1 65 ]. Zinc finger is one of the major structural motifs fo und in DNA protein interaction. Various Zinc finger proteins are key players in transcriptional regulation includin g Sp1, c myc, and CTCF. Cys 2 His 2 zinc finger domain represents the most common DNA binding motif in eukaryotes and about 2% of our genome (700 genes) en codes for zinc finger of this type. Zinc fingers utilize

PAGE 97

97 approximately 30 amino acids to specifically r ecognize 3bps of DNA [ 1 66 ]. Cys2 His2 zinc finger domains are particularly well suited for the construction of synthetic transcription factors as they are commonly arranged as covalent tandem repeats, allowing the recognition of extended asymmetrical seque nce s up to 18bps. This modularity in both structure and function is of great advantage to designing artificial transcription factors [1 67 ] Given these applicability, Zn DBDs have been utilized to expression of mutated huntingtin protein whereas the short wild type gene and subsequent protein product remained unaltered [ 1 68 ]. Similarly, various studies have utilized these artificial zinc finger proteins for specific gene regulation [ 1 65 1 69 and 1 7 0 ]. Thus, Zn DBDs will provide a useful tool to specifically block a given CTCF site and thus aid in investigating the site specific effect of CTCF on TAL1 locus reorganization Z n fingers against 18bp of CTCF sites 31 and +40, since +53 site appears to be non specific. The Zn DBDs cDNAs will be ordered from GenScript INC. These Zn DBDs will have 2x FLAG tag at the c terminal. The flag tagged Zn DBDs will be cloned in pMSCV retroviral vectors and stabl y transduced into K562 and Jurkat cells. The expression, specificity and efficacy of the zinc fingers will be validated in vivo and in vitro [ 1 65 ]. 3C experiments analyzing interaction among previously described CTCF sites as well as between TAL1 promoter 1 / +51 enhancer and TAL1 pro moter 1/TIL16 will be performed to study the effect of CTCF site inhibi tion on TAL1 locus organization and expression.

PAGE 98

98 APPENDIX A A. OLE IN TAL1 G ENE R EGULATION IN K562 AND JURKAT C ELLS As we observe differences in CTCF mediated chromatin loop s in the TAL1 locus in erythroid and T ALL, we investigated role of cohesion proteins Rad21 and Smc1 in providing the cell type specificity the CTCF function. However, we did not observe any significant differences in cohesin occupancy at the TAL1 locus CT CF sites, indicating role of either cell type specific CTCF interacting proteins or post translational modifications of CTCF protein it self. Figure A 1 No difference is observed in Cohesin occupancy at the TAL1 locus in K562 and Jurkat cells. A) TAL 1 locus outlining distinct CTCF binding sites, B&C) ChIP analysis for cohesin subunit Rad21 (B) and Smc1(C) in K562 (top) and Jurkat (bottom) cells. Error bars represent mean SD from two independent repeats.

PAGE 99

99 APPENDIX B B. EFFECT OF SET1 DEPLETION ON CTCF SITE INTERACTIONS AT THE TAL1 LOCUS IN ERYTHROID CELLS Our findings reveal a unique role for SET1 HMT in chromatin looping interaction between TAL1 promoter and +51 enhancer. To further test whether CTCF looping is dependent on SET1, we performed 3C analys is for CTCF site 31 and +5 3 in SET1 knockdown K562 cells (figure B). Semi quantitative PCR analysis of the 3C DNA and control DNA with 31 and +53 site primers revealed no differences in interaction frequency upon SET1 knockdown. This was further confirme d by quantitation of the PCR product using realtime PCR analysis (figure B C). This data i mplies a role for SET1 specifically for TAL1 promoter/enhancer interaction. Figure B 1 No effect of SET1 depletion on CTCF 31 and +53 si te chromatin loop in erythroid K562 cells. A) TAL1 locus Map displaying four CTCF sites and DpnII cut sites (red bars), B) Semi quantitative PCR analysis of the control and 3C DNA using 31/+53 and loading control primers and C) Realtime PCR quantitation of relative interaction frequency plotted after normalization to BAC template.

PAGE 100

100 APPENDIX C C. PRMT1 MEDIATED ASYMMETRIC DIMETHYL H4R3 CROSS TALKS WITH H3K4 METHYLATIONS AT THE GLOBIN LOCUS. Covalent modifications of histones regulate a number of biological processes essential for normal cellular functions, including gene transcription. Whereas, each of these modification s has a specific function, how they are i nterrelated is an interesting and growing area of research. We previously demonstrated that asymmetric dimethylation of H4R3 residues by protein arginine methyltransferase PRMT1 potentiates histone acetylation and is essential both in vitro and in vivo for the establishm ent and maintenance of the active histone acetylation patterns at the chicken g lobin loci [75]. We report here a crosstalk between PRMT1 catalyzed H4R3ame2 and SET1 catalyzed H3K4me2/3 modifications. Previously we purified USF1 associated complexes in HeLa S3 cells stably transduced with a FLAG H A tagged chicken USF1 [ 88] The purified complexes were subjected to LC MS/MS, to identify USF 1 associated polypeptides. Interestingly, both PRMT1 and SET1 associate with USF1 in separate complexes, as determined by immunoblotting experiments of the colum n eluted fractions F6 to F44 (F igure C1). SET1 complex is a part of larger 1.8MDa USF 1 complex, while PRMT1 is a part of 400KDa complex. While assessing the role of PRMT1 on H3 acetylation, we found that PRMT1 is also required for global H3K4me2 and H3K4 m e3 levels in MEL erythroid cells ( F igure C 2 ). This was tested in both mono nucleosomes isolated from control and PRMT1 knockdown MEL cells, as well as crude histones prepared from these cells. We further show that the loss of PRMT1 through RNAi mediated k nock down in murine erythroleukemia (MEL) cells prevents methylation s of H3K4 at PRMT1 target beta globin gene ( F igure C 3) Therefore, we

PAGE 101

101 speculate that the robust effect of PRMT1 knockdown on MEL globin transcription is due to effect on both histone acetylation and H3K4 methylation. Consistent with this, stable PRMT1 knockdown in mES cells, significantly reduces major and globin levels ( F igure C 4). Reintroduction of rat PRMT1 into the PRMT1 knock down cells, rescue s PRMT1 mediated asymmetric dimethylH4R3, and subsequent histone H3K4 methylation patterns ( F igure C 5 ) Rescue with rat PRMT1 also parti ally rescues SET1 recruitment at the major promoter and HS2 regions (F igure C 5 b). Lastly, to dissect whether the effect on H3K4 me2/3 is due to its cross talk with H4R3ame2 or due to PRMT1 dependent SET1 recruitment, we performed in vitro methylation assay utilizing mono nucleosomes isolated from PRMT1 kd and control cells. These nucleosomes were incubated with exogenous PRMT1 and s adenosyl methionine (SAM), to methylate the mono nucleosom es for 90 minutes at 30 degrees, f ollowed by PRMT1 depletion using anti PRMT1 antibody and protein A dynabeads. The modified nucleosomes were than incubated wit h PRMT1 knockdown nuclear extract and SAM Western analysis revealed PRMT1 mediated asymmetric dimethyl H4R3 facilitates histone H3 Lys 4 methylation in vitro ( F igure C 6) Thus, our results suggest an interdependent relationship between arginine and lysi ne methylations and their role in the establishment and maintenance of an active globin domain. Future experiments will focus on identifying whether the H3 acetylation plays a role in this H4R3ame2 and H3K4me2/3 crosstalk and to assess effect of SET1 knock down on global H3 acetylation and H4R3ame2 levels. HDAC and p300 inhibitors will be further utilized to study the effect of H3 acetylation on H3K4 di and tri methylation.

PAGE 102

102 Figure C 1. USF1 associated complexes. Western blot analysis of column eluted USF 1 complexes fraction with PRMT1 and SET1 complex components ; SET1, ASH2L and WDR5. Below is the list of polypeptides that were identified from LC MS/MS data. SET1 and PRMT1 are eluted in different fractions with USF 1.

PAGE 103

103 Figure C 2. PRMT1 depletion affects global H3K4me2/3 levels. A) Immunoblotting for various histone modifications and H3 loading control in mono nucleosomes isolated using sucrose gradient centrifugation from control and PRMT1 knockdown cells, and B) Immunoblot analysis using crude histone isolated using acid extraction from control and PRMT1 knockdown cells.

PAGE 104

104 Figure C 3. PRMT1 is required for globin transcription in EPO differentiated mES cells A) Western analysis of whole cell extracts from control and PRMT1 knockdown in MEL cells showing PRMT1 knockdown does not alter SET1, ASH2L and USF1 levels. B) Quantitative RT globin levels in mES control and PRMT1 knockdown cells after differentiation with EPO. mES PRMT1 cells are original pooled knockdown cells.

PAGE 105

105 Figure C 4 PRMT1 is required for active H3K4 di and tri methylation s at the m ouse globin locus. A) Mouse globin locus displaying globin genes (red bars), hypersentivity sites HS 1 6. B) ChIP analysis for H4R3ame2, H3K4me2 and H3K4me3 enrichment at the major and HS2 in control and sh P RMT1 MEL cells. C) Immunoblot analysis for PRMT1 and various proteins upon PRMT1 depletion in MEL cells, and D) Quantitative RT major mRNA levels in control and shPRMT1 MEL cells upon differentiation with 1.5% DMSO at Day 3 and Day 5.

PAGE 106

106 Figure C 5. R e introduction of PRMT1 rescues H3K4me2/3 levels. A) Western blot displaying successful expression of Flag tagged rat PRMT1 in shPRMT1 cells. B & C) ChIP analysis for various histone modifications and SET1 in control, shPRMT1 and PRMT1 rescue MEL cell s. R e introduction of rat PRMT1 rescues active histone modifications as well as SET1 at t major promoter and HS2 regions. MyoD is used as a negative control region since it is not expressed in MEL cells.

PAGE 107

107 Figure C 6. H4R3ame is sufficient to allow SET1 mediated H3K4me2/3 in vitro. A) Experi mental strategy for in vitro methylation assay. PRMT1 is depleted using anti PRMT1 antibody, B) Western blot analysis for H4R3ame2, H3K4me2/3; showing addition of PRMT1 and SAM catalyzes H4R3ame2, which is sufficient to allow H3K4me2/3 by SET1 enzyme prese nt in PRMT1 knockdown nuclear extract.

PAGE 108

108 LIST OF REFERENCES 1. Gurney JG, Severson RK, Davis S, Robinson LL (1995). Incidence of cancer in children in the United States. Sex race and 1 year age specific rates by histologic type. Cancer 75 2186 95. 2. Spector LG, Ross JA, Robison LL, et al. (2006). Epidemiology and etiology. In: Pui CH, editor. Childhood leukemias. New York: Cambridge University Press 48 66. 3. Pui CH, Relling MV, Downing JR. ( 2004 ) Acute lymphoblastic leukemia. N Engl J Med 350 1535 48. 4. Grotel MV, Meijerink J, Beverloo B, Langerak AW, Buys Gladdines J, Schneider P, Poulsen T, den Boer ML, Horstmann M, Kamps W, Veerman A, van Wering E, van Noesel M, Pieters R. ( 2006 ) The outcome of molecular cytogenetic subgroups in pediatric T cell acute lymphoblastic leukemia: a retrospective study of patients treated according to DCOG or COALL protocols. Haematologica 91 1212 1221. 5. Onciu M. (2009). Acute Lymphoblastic Leukemia. Hematol Oncol Clin N Am. 23 655 674. 6. Cauwelier B, Dastugue N, Cools J, Poppe B, Herens C, De Paepe A, Hagemeijer A, Speleman F. ( 2006 ) Molecular cytogenetic study of 126 unselected T ALL cases reveals high incidence of TCRbeta locus rearrangements and putative new T cell oncogenes. Leukemia 20 1238 44. 7. Mellentin, J.D., S.D. Smith, and M.L. Cleary. ( 1989 ) Lyl 1, a novel gene altered by chromosomal translocation in T cell leukemia, codes for a protein with a helix loop helix DNA binding motif. Cell 14 58 77. 8. Boehm, T., L. Foroni, Y. Kaneko, M. F. Perutz, and T. H. Rabb itts. ( 1991 ) The rhombotin family of cysteine rich LIM domain oncogenes: distinct members are involved in T cell translocations to human chromosomes 11p15 and 11p13. Proc. Natl. Acad. Sci. USA 88 4367 437. 9. Bronwyn M. Owens, Robert G. Hawley. ( 2002 ) HOX and Non HOX Homeobox Genes in Leukemic Hematopoiesis. Stem Cells 20 364 379. 10. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC, Behm FG, Pui CH, Downing JR, Gilliland DG, Lander ES, Golub TR, Look AT (2002). Gene expression signatures d efine novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 1 75 87.

PAGE 109

109 11. Graux C, Cools J, Michaux L, Vandenberghe P, Hagemeijer A (2006). Cytogenetics and molecular genetics of T cell acute lymphoblastic leukemia: from thymocyte to l ymphoblast. Leukemia 20 1496 510. 12. Kees UR, Heerema NA, Kumar R, Watt PM, Baker DL, La MK, Uckun FM, Sather HN. (2003). Expression of HOX11 in childhood T lineage acute lymphoblastic leukaemia can occur in the absence of cytogenetic aberration at 10q24: a Leukemia 17 887 93. 13. Weng AP, Ferrando AA, Lee W, Morris JP 4th, Silverman LB, Sanchez Irizarry C, Blacklow SC, Look AT, Aster JC. (2004). Activating mutations of NOTCH1 in human T cell acute lymphoblastic le ukemia. Science 306 269 71. 14. Pui CH. (2006). Acute lymphoblastic leukemia. In: Pui CH, editor. Childhood leukemias. New York: Cambridge University Press 439 72. 15. Gokbuget N, Hoelzer D. (2009). Treatment of adult acute lymphoblastic leukemia. Semin Hematol 46 64 75. 16. Faderl S, Jeha S, Kantarjian HM. (2003). The biology and therapy of adult acute lymphoblastic leukemia. Cancer 98 1337 54. 17. Kantarjian H, Thomas D, O'Brien S, Cortes J, Giles F, Jeha S, Bueso Ramos CE, Pierce S, Shan J, Koller C, Beran M, Kea ting M, Freireich EJ (2004). Long term follow up results of hyperfractionated cyclophosphamide, vincristine, doxorubicin, and dexamethasone (Hyper CVAD), a dose intensive regimen, in adult acute lymphocytic leukemia. Cancer 101 2788 801. 18. Hsu HL, Wadman I, and Baer R. ( 1994 ) Formation of in vivo complexes between the TALl and E2A polypeptides of leukemic T cells. Proc. Natl. Acad. Sci. 91 3181 3185. 19. Hall MA, Curtis DJ, Metcalf D, Elefanty AG, Sourris K, Robb L, Gothert JR, Jane SM, Begley CG. ( 2003 ) T he critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU S12. Proc. Natl. Acad. Sci. 4 992 7. 20. Mikkola HK, Klintman J, Yang H, Hock H, Schlaeger TM, Fujiwara Y, Orkin SH. ( 2003 ) Haematopoietic stem cells retain long term repopulating activity and multipotency in the absence of stem cell l eukaemia SCL/tal 1 gene. Nature 30 547 51. 21. Porcher C Swat W, Rockwell K, Fujiwara Y, Alt FW, and Orkin SH (1996). The T cell leukemia oncoprotein SCL/tal 1 is essential for development of all hematopoietic lineages. Cell 86 47 57.

PAGE 110

110 22. Robb L Elwood NJ, Elefanty AG, Kontgen F, Li R, Barnett LD, and Begley CG. (1996). The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse. Embo J 15 4123 4129. 23. Robb L, Lyons I Li R, Hartley L, Kontgen F, Harvey RP, Metcalf D, and Begley CG. (1995). Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene. Proc Natl Acad Sci 92 70 75 7079. 24. Shivdasani RA, Mayer EL, and Orkin SH. (1995). Absence of blood formation in mice lacking the T cell leukaemia oncoprotein tal 1/SCL. Nature 373 432 434. 25. Schuh AH, Tipping AJ., Clark AJ., Hamlett I., Guyot B., Iborra FJ., Rodriguez P., Stroubou lis J., Enver T., Vyas P., and Porcher C. ( 2005 ) ETO 2 Associates with SCL in Erythroid Cells and Megakaryocytes and Provides Repressor Functions in Erythropoiesis. Molecular and Cellular Biology 25 10235 10250. 26. Hu X, Li X, Valverde K, Fu X, Noguchi C, Qiu Y, and Huang S. ( 2009 ) LSD1 mediated epigenetic modification is required for TAL1 function and hematopoiesis. Proc. Natl. Acad. Sci. 106 10141 6 27. Hsu HL, Wadman I, Tsan JT, and Baer R. ( 1994 ) Positive and negative transcriptional control by the TAL 1 helix loop helix protein. Proc. Natl. Acad. Sci. 91 5947 5951. 28. Margolin A Neuberg DS, Winter SS, Larson RS, Li W, Liu XS, Young RA, and Look AT. ( 2006 ) Transcriptional regulatory networks downstream of TAL1 /SCL in T cell acute lymphoblastic leukemia. Blood 108 986 992. 29. Palii CG, Perez Iratxeta C, Yao Z, Cao Y, Dai F, Davison J, Atkins H, Allan D, Dilworth FJ, Gentleman R, Tapscott SJ, Brand M. (2011). Differential genomic targeting of the transcription fac tor TAL1 in alternate haematopoietic lineages. Embo J 30 494 509. 30. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC, Behm FG, Pui CH, Downing JR, Gilliland DG et al. ( 2002 ) Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer cell 1 75 87. 31. Hsu HL, Cheng JT, Chen Q, Baer R. ( 1991 ) Enhancer binding activity of the tal 1 oncoprotein in association with the E47/E12 helix loop helix proteins. Molecular and cellular biology 11 3037 3042. 32. Hsu HL, Wadman I, Baer R. ( 1994 ) Formation of in vivo complexes between the TAL1 and E2A polypeptides of leukemic T cells. Proceedings of the National Academy of Sciences of the United States of America 91 3181 3185.

PAGE 111

111 33. Voronova AF, Lee F. ( 1994 ) The E2 A and tal 1 helix loop helix proteins associate in vivo and are modulated by Id proteins during interleukin 6 induced myeloid differentiation. Proceedings of the National Academy of Sciences of the United States of America 91 5952 5956. 34. Park ST, Sun XH. ( 1998 ) The Tal1 oncoprotein inhibits E47 mediated transcription. Mechanism of inhibition. The Journal of biological chemistry 273 7030 7037. 35. Kassouf MT, Hughes JR, Taylor S, McGowan SJ, Soneji S, Green AL, Vyas P, Porcher C. ( 2010 ) Genome wide identifi cation of TAL1's functional targets: insights into its mechanisms of action in primary erythroid cells. Genome research 20 1064 1083. 36. Hu X, Li X, Valverde K, Fu X, Noguchi C, Qiu Y, Huang S. ( 2009 ) LSD1 mediated epigenetic modification is required for T AL1 function and hematopoiesis. Proceedings of the National Academy of Sciences of the United States of America 106 10141 10146. 37. Palomero T, Odom DT, O'Neil J, Ferrando AA, Margolin A, Neuberg DS, Winter SS, Larson RS, Li W, Liu XS, Young RA, Look AT ( 2 006b ) Transcriptional regulatory networks downstream of TAL1/SCL in T cell acute lymphoblastic leukemia. Blood 108 986 992. 38. Ono Y, Fukuhara N, Yoshie O. ( 1998 ) TAL1 and LIM only proteins synergistically induce retinaldehyde dehydrogenase 2 expression i n T cell acute lymphoblastic leukemia by acting as cofactors for GATA3. Molecular and cellular biology 18 6939 6950. 39. Kusy S, Gerby B, Goardon N, Gault N, Ferri F, Grard D, Armstrong F, Ballerini P, Cayuela JM, Baruchel A, Pflumio F, Romo PH ( 2010 ) NK X3.1 is a direct TAL1 target gene that mediates proliferation of TAL1 expressing human T cell acute lymphoblastic leukemia. The Journal of experimental medicine 207 2141 2156. 40. Huang S, Qiu Y, Shi Y, Xu Z, Brandt SJ. ( 2000 ) P/CAF mediated acetylation reg ulates the function of the basic helix loop helix transcription factor TAL1/SCL. The EMBO journal 19 6792 6803. 41. Huang S, Qiu Y, Stein RW, Brandt SJ. ( 1999 ) p300 functions as a transcriptional coactivator for the TAL1/SCL oncoprotein. Oncogene 18 4958 4 967.

PAGE 112

112 42. Tremblay M, Tremblay CS, Herblot S, Aplan PD, Hebert J, Perreault C, Hoang T. ( 2010 ) Modeling T cell acute lymphoblastic leukemia induced by the SCL and LMO1 oncogenes. Genes & development 24 1093 1105. 43. Bockamp EO., McLaughlin F., Murrell AM., Got tgens B., Robb L., Begley CG., and Green AR. ( 1995 ) Lineage Restricted Regulation of the Murine SCL/TAL 1 Promoter. Blood 86 1502 1514. 44. Aplan PD Begley CG, Bertness V, Nussmeier M, Ezquerra A, Coligan J, and Kirsch IR. ( 1990 ) The SCL Gene Is Formed fr om a Transcriptionally Complex Locus. Molecular and Cellular Biology 10 6426 6435. 45. Gttgens B, Broccardo C, Sanchez MJ, Deveaux S, Murphy G, Gthert JR, Kotsopoulou E, Kinston S, Delaney L, Piltz S, Barton LM, Knezevic K, Erber WN, Begley CG, Frampton J, and Green AR. ( 2004 ) The scl +18/19 Stem Cell Hematopoietic Endothelial Enhancer Bound by Fli 1 and Elf 1. Molecular and Cellular Biology 24 1870 1883. 46. Sanchez M Gottgens B, Sinclair AM, Stanley M, Begley CG, Hunter S and Green AR ( 1999 ) with embryonic and adult hematopoietic progenitors. Development 126 3891 3904. 47. Ogilvy S, Ferreira R, Piltz SG, Bowen JM, Gtt gens B, and Green AR. ( 2007 ) The SCL +40 Enhancer Targets the Midbrain Together with Primitive and Definitive Hematopoiesis and Is Regulated by SCL and GATA Proteins. Molecular and Cellular Biology 27 720 6 7219. 48. Follows GA, Dhami P, Gttgens B, Bruce A, Campell P, Dillon S, Smith A, Koch C, Donaldson I, Scott M, Dunham I, Janes M, Vetrie D, and Green A. (2006). Identifying gene regulatory sites by genomic microarray mapping of DNaseI hypersensitive sites. Genome Res. 16 1310 1319. 49. Dhami P, Bruce AW, Ji m JH, Dillon SC, Hall A, Cooper JL, Bonhoure N, Chiang K, Ellis PD, Langford C, Andrews RM, Vetrie D. ( 2010 ) Genomic Approaches Uncover Increasing Complexities in the Regulatory Landscape at the Human SCL (TAL1) Locus. PLoS ONE 5 1 14. 50. Barski A, Cuddapa h S, Cui K, Roh TY, Schones DE, Wang Z, Wei G, Chepelev I, and Zhao K. ( 2007 ) High Resolution Profiling of Histone Methylations in the Human Genome. Cell 129 823 837.

PAGE 113

113 51. Elwood NJ, Green AR, Melder A, Begley CG, Nicola N. ( 1994 ) The SCL protein displays cell specific heterogeneity in size. Leukemia 8 106 14. 52. Wadman IA, Hsu HL, Cobb MH, Baer R. ( 1994 ) The MAP kinase phosphorylation site of TAL1 occurs within a transcriptional activation domain. Oncogene 9 3713 6. 53. Cheng JT, Hsu HL, Hwang LY, Baer R. ( 1993 ) Products of the TAL1 oncogene: basic helix loop helix proteins phosphorylated at serine residues. Oncogene 8 677 83. 54. Kassouf MT Chagraoui H, Vyas P, and Porcher C. ( 2008 ) Differential use of SCL/TAL 1 DNA binding domain in developmental hematopo iesis. Blood 112 1056 1067. 55. Wilson NK, Miranda Saavedra D, Kinston S, Bonadies N, Foster SD, Calero Nieto F, Dawson MA, Donaldson IJ, Dumon S, Frampton J, Janky R, Sun X H, Teichman n SA Bannister AJ, and Gttgens B. ( 2009 ) The transcriptional program c ontrolled by the stem cell leukemia gene Scl /Tal1 during early embryonic hematopoietic development. Blood 113 5456 5466. 56. Wadman IA, Hirotaka O, Grutz CG, Agulnick AD, Westphal H, Forster A, and Rabbitts TH. ( 1997 ) The LIM only protein Lmo2 is abridging molecule assembling an erythroid DNA binding complex which includes the TAL1, E47, GATA 1 and Ldb1/NL1 protein. EMBO J. 16 3145 3157. 57. Song S H, Hou C, Dean A. ( 2007 ) A positive r ole for NLI/Ldb1 in long globin locus control region function. Molecular Cell 28 810 22. 58. Soler E, Andrieu Soler C, Boer ED, Bryne JC, Thongjuea S, Stadhouders R, Palstra R, Stevens M, Knockx C Ijcken W Hou J Steinhoff C Rijkers E, Lenhard B, and Groveld F. ( 2010 ) The genome wide dynamics of the binding of LDB1 complexes during erythrid differentiation. Genes & Dev. 24 277 289. 59. Strahl BD, and Allis CD. ( 2000 ) The language of covalent histone modifications. Nature 403 41 45. 60. Roh TY, Cuddap ah S and Zhao K. ( 2005 ) Active chromatin domains are defined by acetylation islands revealed by genome wide mapping. Genes Development 19 542 552. 61. Boyer LA Plath K, Zeitlinger J, Brambrink T, Medeiros LA, Lee TI, Levine SS, Wernig M, Tajonar A, Ray MK, Bell GW, Otte AP, Vidal M, Gifford DK, Young RA Jaenisch R. ( 2006 ) Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441 349 353.

PAGE 114

114 62. Bannister AJ, Zegerman P, Partridge JF, Miska EA, Thomas JO, Allshire RC, and Ko uzarides T. ( 2001 ) Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410 120 124. 63. Hon G, Wang W, and Ren B ( 2009 ) Discovery and Annotation of Functional Chromatin Signatures in the Human Genome. PloS Computatio nal Biology 5 e1000566. 64. Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins Rd, Barrera LO, Calcar SV, Qu C, Ching KA, Wang W, Weng Z, Green RD, Crawford GE, and Ren B. ( 2007 ) Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nature Genetics 39 311 318. 65. Heintzman ND, Hon GC, Hawkins RD, Kheradpour P, Stark A, Harp LF, Ye Z, Lee LK, Stuart RK, Ching CW, Ching KA, Antosiewicz Bourget JE, Liu H, Zhang X, Green RD, Lobanenkov VV, Stewart R, Tho mson JA, Crawford GE, Kellis M, and Ren B. ( 2009 ) Histone modifications at human enhancers reflect global cell type specific gene expression. Nature 459 108 112. 66. Carroll AJ, Crist WM, Link MP, Amylon MD, Pullen DJ, Ragab AH, Buchanan GR, Wimmer RS, Viet ti TJ. ( 1990 ) The t(1;14)(p34;q11) is non random and restricted to T cell acute lymphoblastic leukemia Blood 15 1220 1224. 67. Brown L, Cheng JT, Chen Q, Siciliano MJ, Crist W, Buchanan G, Baer R. ( 1990 ) Site specific recombination of the tal 1 gene is a common occurrence in human T cell leukemia. EMBO J. 9 3343 51. 68. Bash R, Hall S, Timmons CF, Crist WM, Amylon M, Smith RG, and Baer R. 1995. Does Activation of the TALl Gene Occur in a Majority of Patients w ith T cell Acute Lymphoblastic Leukemia? A Pedia tric Oncology Group Study. Blood 666 676. 69. Bernard O, Azogui O, Lecointe N, Mugneret F, Berger R, Larsen CJ, and Mathieu Mahul D. ( 1992 ) A Third tal 1 Promoter Is Specifically Used in Human T Cell Leukemias. J. Exp. Med. 176 919 925. 70. Courtes C, Lecointe N, Le Cam L, Baudoin F, Sardet C, Mathieu Mahul D. ( 1999 ) Erythroid specific Inhibition of the tal 1 Intragenic Promoter Is due to Binding of a Repressor to a Novel Silencer. The Journal of Biological Chemistry 275 949 958. 71. Kasai K, Inguma S, Yoneyama A, Yoshikawa K, and Ikeda H. ( 2008 ) SCL/TAL1 interrupting locus derepresses GLI1 from the negative control of Suppressor of Fused in Pancreatic cancer cells. Cancer Research 68 7723 7729.

PAGE 115

115 72. Erez A, Perelman M, Hewitt SM Cojacaru G Goldberg I Shahar I Yaron P, Muler I, Campaner S Amariglio N Rechavi G, Kirsch IR, Krupsky M, Kaminski N, and Izraeli S. ( 2004 ) Sil overexpression in lung cancer characterizes tumors with increased mitotic activity. Oncogene 23 5371 5377. 73. Aplan PD, Lombardi DP, Kirsch IR ( 1991 ) Structural characterization of SIL, a gene frequently disrupted in T cell lymphoblastic leukemia. Mol. Cell. Biol. 11 5462 5469. 74. Colaizzo Anas T. and Aplan PD. ( 2003 ). Cloning and characterization of the SIL promoter. Biochimica et Biophysica A cta. 1625 207 213. 75. Li X, Hu X, Patel B, Zhou Z, Liang S Ybarra R, Qiu Y Felsenfeld G, Bungert J, and Huang S. (2010). H4R3 methylation facilitates beta globin transcription by regulating histone acetyltransferase binding and H3 acetylation. Blood 115 2028 2037. 76. Huang S, Litt M, and Felsenfeld G. (2005). Methylation of histone H4 by arginine methyltransferase PRMT1 is essential in vivo for many subsequent histone modifications. Genes Dev 19 1885 1893. 77. Hagege H, Klous P, Braem C, Splinter E, Dekker J, Cathala G, de Laat W, and Forne T. (2007). Quantitative analysis of chromosome conformation capture assays (3C qPCR). Nature protocols 2 1722 1733. 78. Jeha S, Luo XN, Beran M, Kantarjian H, Atweh GF. (1996). Antisense RNA inhibition of phosphoprotein p18 e xpression abrogates the transformed phenotype of leukemic cells. Cancer Res. 56 1445 50. 79. Luger K, Mder AW, Richmond RK, Sargent DF, Richmond TJ (1997). "Crystal structure of the nucleosome core particle at 2.8 A resolution." Nature 389 251 260. 80. Kouza rides T. (2007). Chromatin modifications and their function. Cell. 128 693 705. 81. Jenuwein T, Laible G, Dorn R, Reuter G (1998). "SET domain proteins modulate chromatin domains in eu and heterochromatin." Cellular and molecular life sciences : CMLS 54 8 0 93. 82. Shilatifard A. (2012). The COMPASS Family of Histone H3K4 Methylases: Mechanisms of Regulation in Development and Disease Pathogenesis. Annu. Rev. Biochem. 81 65 95.

PAGE 116

116 83. Boa S, Coert C, Patterton HG. (2003). Saccharomyces cerevisiae Set1p is a methylt ransferase specific for lysine 4 of histone H3 and is required for e fficient gene expression. Yeast 20 827 35. 84. Roguev A, Schaft D, Shevchenko A, Pijnappel WW, Wilm M, Aasland R, Stewart AF. (2001). The Saccharomyces cerevisiae Set1 complex includes an As h2 homologue and methylates histone 3 lysine 4. EMBO J. 20 7137 48. 85. Krogan NJ, Dover J, Wood A, Schneider J, Heidt J, Boateng MA, Dean K, Ryan OW, Golshani A, Johnston M, Greenblatt JF, Shilatifard A. (2003). The Paf1 complex is required for histone H3 m ethylation by COMPASS and Dot1p: linking transcriptional elo ngation to histone methylation. Mo lecular C ell 11 721 729. 86. Wood A, Schneider J, Dover J, Johnston M, Shilatifard A (2003). The Paf1 complex is essential for histone monoubiquitination by the Ra d6 Bre1 complex, which signals for histone methylation by COMPASS and Dot1p. The Journal of biological chemistry 278 34739 34742. 87. Deplus R, Delatte B, Schwinn MK, Defrance M, Mndez J, Murphy N, Dawson MA, Volkmar M, Putmans P, Calonne E, Shih AH, Levine RL, Bernard O, Mercher T, Solary E, Urh M, Daniels DL, Fuks F. (2013). "TET2 and TET3 regulate GlcNAcylation and H3K4 methylation through OGT and S ET1/COMPASS." The EMBO J. 32 645 55. 88. Li X, Wang S, Li Y, Deng C, Steiner LA, Xiao H, Wu C, Bungert J, Gall agher PG, Felsenfeld G, Qiu Y, Huang S (2011). Chromatin boundaries require functional collaboration between the hSET1 and NURF complexes. Blood 118 1386 1394. 89. Wallace JA, and Felsenfeld G. (2007). We gather together: insulators and genome organization. Curr Opin Genet Dev 17 400 407. 90. Dunn KL, Davie JR. (2003). The many roles of transcriptional regulator CTCF. Biochemi. Cell Biol. 81 161 167. 91. Yusufzai T M Tagami H, Nakatani Y, and Felsenfeld G. (2004). CTCF tethers an insulator to subnuclear sites, s uggesting shared insulator mechanisms across species. Mol Cell 13 291 298. 92. Cuddapah S, Jothi R, Schones DE, Roh TY, Cu i K, and Zhao K. (2009). Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of activ e and repressive domains. Genome Res 19 24 32. 93. Kim TH, Abdullaev ZK, Smith AD, Ching KA, Loukinov DI, Green R D, Zhang MQ, Lobanenkov VV, and Ren B. (2007). Analysis of the vertebrate insulator protein CTCF binding sites in the human genome. Cell 128 123 1 1245.

PAGE 117

117 94. Hou C, Dale R, Dean A. (2010). Cell type specificity of chromatin organization mediated by CTCF and cohesion. PNAS 107 3651 3656. 95. Handoko L, Xu H, Li G, Ngan CY, Chew E, Schnapp M, Lee CW, Ye C, Ping JL, Mulawadi F, Wong E, Sheng J, Zhang Y, Poh T, Chan CS, Kunarso G, Shahab A, Bourque G, Cacheux Rataboul V, Sung WK, Ruan Y, Wei CL. (2011). CTCF mediated functional chromatin interactome in pluripotent cells. Nature Genetics 43 630 638. 96. Dixon JR, Selvaraj S, Yue F, Kim A, Li Y, Shen Y, Hu M, Liu JS, Ren B. (2012). Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 485 376 380. 97. Banerji J, Olson L, and Schaffner W. (1983). A lymphocyte specific cellular enhancer is located downstream of the joining r egion in immunoglobulin heavy chain genes. Cell 33 729 740. 98. Gillies SD, Morrison SL, Oi VT, and Tonegawa S. (1983). A tissue specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene. Cell 33 717 728 99. Geyer PK, Green MM and Corces VG. (1990). Tissue specific transcriptional enhancers may act in trans on the gene located in the homologous chromosome: the molecular basis of transvection in Drosophila. EMBO J. 9 2247 2256. 100. Lettice L A Heaney S J, Purdie LA, Li L, de Beer P, Oostra BA, Goode D, Elgar G Hill RE, and de Graaff EA. (2003). A long range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum. Mol. Genet. 12 1725 1735. 101. Sagai T, Hosoya M, Mizushina Y, Tamura M, and Shiroishi T. (2005). Elimination of a long range cis regulatory module causes complete loss of limb specific Shh expression and truncation of the mouse limb. Development 132 797 803. 102. Lomvardas S, Barnea G, Pisapia DJ, Mendelsohn M, Kirkland J, Axel R. (2006). Interchromosomal interactions and olfactory receptor choice. Cell 126 403 413. 103. Bulger M, Groudine M. (2011). Functional and mechanistic diversity of distal transcription enhancers. Cell 144 327 339. 104. Kulaev a OI, Nizovtseva EV, Polikanov YS, Ulianov SV, Studitsky VM. (2012). Distant activation of transcription: mechanisms of enhancer action. Mol Cell Biol. 32 4892 4897.

PAGE 118

118 105. Lai F, Orom UA, Cesaroni M, Beringer M, Taatjes DJ, Blobel GA, Shiekhattar R. (2013). Ac tivating RNAs associate with Mediator to enhance chromatin architecture and transcription. Nature 494 497 501. 106. Zhao Z, Tavoosidana G, Sjlinder M, Gndr A, Mariano P, Wang S, Kanduri C, Lezcano M, Sandhu KS, Singh U, Pant V, Tiwari V, Kurukuti S, Ohlsso n R. ( 2006). Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra and interchromosomal interactions. Nat. Genet. 38 1341 1347. 107. Dostie J, Richmond TA, Arnaout RA, Selzer RR, Lee WL, Honan TA, Rubio E D, Krumm A, Lamb J, Nusbaum C, Green RD, Dekker J. (2006). Chromosome Conformation Capture Carbon Copy (5C): a massively parallel solution for mapping interactions between genomic elements. Genome Res. 16 1299 1309. 108. Lieberman Aiden E, van Berkum NL, Wil liams L, Imakaev M, Ragoczy T, Telling A, Amit I, Lajoie BR, Sabo PJ, Dorschner MO, Sandstrom R, Bernstein B, Bender MA, Groudine M, Gnirke A, Stamatoyannopoulos J, Mirny LA, Lander ES, Dekker J. (2009). Comprehensive mapping of long range interactions rev eals folding principles of the human genome. Science 326 289 293. 109. Drissen R, Palstra RJ, Gillemans N, Splinter E, Grosveld F, Philipsen S, and de Laat W. (2004). The active spatial organization of the beta globin locus requires the transcription factor E KLF. Genes Dev. 18 2485 2490. 110. Vakoc CR, Letting DL, Gheldof N, Sawado T, Bender MA, Groudine M, Weiss M J Dekker J, and Blobel GA. (2005). Proximity among distant regulatory elements at the beta globin locus requires GATA 1 and FOG 1. Mol. Cell 17 453 4 62. 111. Stadhouders R, Thongjuea S, Andrieu Soler C, Palstra RJ, Bryne JC, van den Heuvel A, Stevens M, de Boer E, Kockx C, van der Sloot A, van den Hout M, van Ijcken W, Eick D, Lenhard B, Grosveld F, Soler E. (2011). Dynamic long range chromatin interaction s control Myb proto oncogene transcription during erythroid development. EMBO J. 31 986 999. 112. Verma Gaur J, Torkamani A, Schaffer L, Head SR, Schork NJ, Feeney AJ. (2012). Noncoding transcription within the Igh distal V(H) region at PAIR elements affects the 3D structure of the Igh locus in pro B cells. PNAS 109 17004 17009. 113. Cremer T, and Cremer M. (2010). Chromosome territories. Cold Spring Harb. Perspect. Biol. 2 a003889.

PAGE 119

119 114. Branco M R, and Pombo A. (2007). Chromosome organization: new facts, new models Trends Cell Biol. 17 127 134. 115. Ragoczy T, Telling A, Sawado T, Groudine M, and Kosak ST. (2003). A genetic analysis of chromosome territory looping: diverse roles for distal regulatory elements. Chromosome Res. 11 513 525. 116. Amano T, Sagai T, Tanabe H, Mizushina Y, Nakazawa H, and Shiroishi T (2009). Chromosomal dynamics at the Shh locus: limb bud specific differential regulation of competence and active transcription. Dev. Cell 16 47 57. 117. Andrulis ED, Neiman AM, Zappulla DC, and Sternglanz R. (1998). P erinuclear localization of chromatin facilitates transcriptional silencing. Nature 394 592 595. 118. Finlan L E, Sproul D Thomson I, Boyle S, Kerr E, Perry P, Ylstra B, Chubb JR, and Bickmore WA. (2008). Recruitment to the nuclear periphery can alter expressi on of genes in human cells. PLoS Genet. 4 e1000039. 119. Reddy KL, Zullo JM Bertolino E, and Singh H. (2008). Transcriptional repression mediated by repositioning of genes to the nuclear lamina. Nature 452 243 247. 120. Brown JM, Green J, das Neves RP, Wallace HA, Smith AJ, Hughes J, Gray N, Taylor S, Wood WG, Higgs DR, Iborra FJ, Buckle VJ. (2008). Association between active genes occurs at nuclear speckles and is modulated by chromatin environment. J. Cell Biol. 182 1083 1097. 121. Iborra FJ, Pombo A, Jackson DA, and Cook PR. (1996). Active RNA nuclei. J. Cell Sci. 109 1427 1436. 122. Sutherland H, and Bickmore WA. (2009). Transcription factories: gene expression in unions? Nat. Rev. Genet 10 457 466. 123. Cai S, Han HJ, and Kohwi Shigematsu T. (2003). Tissue specific nuclear architecture and gene expression regulated by SATB1. Nat. Genet. 34 42 51. 124. Cai S, Lee C C, and Kohwi Shigematsu T. (2006). SATB1 packages densely looped, transcriptiona lly active chromatin for coordinated expression of cytokine genes. Nat. Genet. 38 1278 1288. 125. Li Y, Deng C, Hu X, Patel B, Fu X, Qiu Y, Brand M, Zhao K, and Huang S. (2012). Dynamic interaction between TAL1 oncoprotein and LSD1 regulates TAL1 function in hematopoiesis and leukemogenesis. Oncogene 31 5007 5018.

PAGE 120

120 126. Delabesse E, Ogilvy S, Chapman MA, Piltz SG, Gottgens B, and Green AR (2005). Transcriptional regulation of the SCL locus: identification of an enhancer that targets the primitive erythroid lineage in vivo. Mol Cell Biol 25 5215 5225. 127. Li G, Ruan X, Auerbach RK, Sandhu KS, Zheng M, Wang P, Poh HM, Goh Y, Lim J, Zhang J, Si m HS, Peh SQ, Mulawadi FH, Ong CT, Orlov YL, Hong S, Zhang Z, Landt S, Raha D, Euskirchen G, Wei CL, Ge W, Wang H, Davis C, Fisher Aylor KI, Mortazavi A, Gerstein M, Gingeras T, Wold B, Sun Y, Fullwood MJ, Cheung E, Liu E, Sung WK, Snyder M, Ruan Y (2012) Extensive promoter centered chromatin interactions provide a topological basis for transcription regulation. Cell 148 84 98. 128. Sanyal A, Lajoie BR, Jain G, and Dekker J. (2012). The long range interaction landscape of gene promoters. Nature 489 109 113. 129. Follows GA, Ferreira R, Janes ME, Spensberger D, Cambuli F, Chaney AF, Kinston SJ, Landry JR, Green AR, and Gottgens B. (2012). Mapping and functional characterisation of a CTCF dependent insulator element at the 3' border of the murine Scl transcription al domain. PLoS One 7 e31484. 130. Phillips J E, and Corces VG. (2009). CTCF: master weaver of the genome. Cell 137 1194 1211. 131. Leroy Viard K, Vinit MA, Lecointe N, Mathieu Mahul D, Romo PH. (1994). Distinct DNase I hypersensitive sites are associated with T AL 1 transcription in erythroid and T cell lines. Blood 84 3819 3827. 132. Sanda T, Lawton LN, Barrasa MI, Fan ZP, Kohlhammer H, Gutierrez A, Ma W, Tatarek J, Ahn Y, Kelliher MA, Jamieson CH, Staudt LM, Young RA, Look AT. (2012). Core transcriptional regulato ry circuit controlled by the TAL1 complex in human T cell acute lymphoblastic leukemia. Cancer Cell 22 209 221. 133. Okazaki M, Maeda G, Chiba T, Doi T, Imai K. (2009). Identification of GATA3 binding sites in Jurkat cells. Gene 445 17 25. 134. Cardoso BA, de Al meida SF, Laranjeira AB, Carmo Fonseca M, Yunes JA, Coffer PJ, Barata JT. (2011). TAL1/SCL is downregulated upon histone deacetylase inhibition in T cell acute lymphoblastic leukemia cells. Leukemia 25 1578 1586. 135. rom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, Lai F, Zytnicki M, Notredame C, Huang Q, Guigo R, Shiekhattar R. (2010). Long noncoding RNAs with enhancer like function in human cells. Cell 143 46 58.

PAGE 121

121 136. Nam CH, Rabbitts TH. (2006). The role of LMO2 in development and in T cell leukemia after chromosomal translocation or retroviral insertion. Mol Ther. 13 15 25. 137. Mukhopadhyay M, Teufel A, Yamashita T, Agulnick AD, Chen L, Downs KM, Schindler A, Grinberg A, Huang SP, Dorward D, Westphal H. (2003). Functional ablation of the mous e Ldb1 gene results in severe patterning defects during gastrulation. Development 130 495 505. 138. Li L, Jothi R, Cui K, Lee JY, Cohen T, Gorivodsky M, Tzchori I, Zhao Y, Hayes SM, Bresnick EH, Zhao K, Westphal H, Love PE. (2011). Nuclear adaptor Ldb1 regula tes a transcriptional program essential for the maintenance of hematopoietic stem cells. Nat Immunol. 12 129 36. 139. Soler E, Andrieu Soler C, de Boer E, Bryne JC, Thongjuea S, Stadhouders R, Palstra RJ, Stevens M, Kockx C, van Ijcken W, Hou J, Steinhoff C, Rijkers E, Lenhard B, Grosveld F. (2010). The genome wide dynamics of the binding of Ldb1 complexes during erythroid differentiation. Genes Dev. 24 277 89. 140. Song SH, Kim A, Ragoczy T, Bender MA, Groudine M, Dean A. (2010). Multiple functions of Ldb1 requi red for beta globin activation during erythroid differentiation. Blood. 116 2356 64. 141. Stadhouders R, Thongjuea S, Andrieu Soler C, Palstra RJ, Bryne JC, van den Heuvel A, Stevens M, de Boer E, Kockx C, van der Sloot A, van den Hout M, van Ijcken W, Eick D, Lenhard B, Grosveld F, Soler E. (2011). Dynamic long range chromatin interactions control Myb proto oncogene transcription during erythroid development. EMBO J. 31 986 999. 142. Hu, X., Ybarra, R., Qiu, Y., Bungert, J., and Huang, S. (2009). Transcriptiona l regulation by TAL1: a link between epigenetic modifications and erythropoiesis. Epigenetics 4 357 361. 143. Schubeler, D., Francastel, C., Cimbora, D.M., Reik, A., Martin, D.I., and Groudine, M. (2000). Nuclear localization and histone acetylation: a pathwa y for chromatin opening and transcriptional activation of the human beta globin locus. Genes Dev 14 940 950. 144. Vakoc CR, Letting DL, Gheldof N, Sawado T, Bender MA, Groudine M, Weiss, MJ, Dekker J, and Blobel GA. (2005). Proximity among distant regulatory elements at the beta globin locus requires GATA 1 and FOG 1. Mol Cell 17 453 462.

PAGE 122

122 145. Monahan K, Rudnick ND, Kehayova PD, Pauli F, Newberry KM, Myers RM, Maniatis T. (2012). Role of CCCTC binding factor (CTCF) and cohesin in the generation of single cell d iversity of protocadherin 109 9125 9130. 146. Ren L, Shi M, Wang Y, Yang Z, Wang X, Zhao Z. (2012). CTCF and cohesin cooperatively mediate the cell type specific interchromatin interaction between Bcl11b and Arhgap6 loci. Mol Cell Bioc hem. 360 243 251. 147. Feeney AJ, Verma Gaur J. (2011). CTCF cohesin complex: architect of chromatin structure regulates V(D)J rearrangement. Cell Res. 22 280 282. 148. Schmidt D, Schwalie PC, Ross Innes CS, Hurtado A, Brown GD, Carroll JS, Flicek P, Odom DT. (2 010). A CTCF independent role for cohesin in tissue specific transcription. Genome Res. 20 575 588. 149. Deng W, Lee J, Wang H, Miller J, Reik A, Gregory PD, Dean A, Blobel GA. (2012). Controlling long range genomic interactions at a native locus by targeted tethering of a looping factor. Cell 149 1233 44. 150. Hu G Schones DE, Cui K, Ybarra R, Northrup D, Tang Q, Gattinoni L, Restifo NP, Huang S, and Zhao K. (2011). Regulation of nucleosome landscape and transcription factor targeting at tissue specific enhanc ers by BRG1. Genome Res. 21 1650 1658. 151. Gttgens B, Barton LM, Gilbert JG, Bench AJ, Sanchez MJ, Bahn S, Mistry S, Grafham D, McMurray A, Vaudin M, Amaya E, Bentley DR, Green AR, Sinclair AM (2000). Analysis of vertebrate SCL loci identifies conserved en hancers. Nat Biotechnol 18 181 186. 152. Nishizawa K, Freund C, Li J, Wagner G, Reinherz EL. (1998). Identification of a proline binding motif regulating CD2 triggered T lymphocyte activation. PNAS 95 14897 902. 153. Nielsen TK, Liu S, Lhrmann R, Ficner R. (200 7). Structural basis for the bifunctionality of the U5 snRNP 52K protein (CD2BP2). J Mol Biol. 369 902 908. 154. Remeseiro S, Cuadrado A, Gmez Lpez G, Pisano DG, Losada A. (2012). A unique role of cohesin SA1 in gene regulation and development. EMBO J. 31 2090 2102. 155. Cuadrado A, Remeseiro S, Gmez Lpez G, Pisano DG, Losada A. (2012). The specific contributions of cohesin SA1 to cohesion and gene expression: implications for cancer and development. Cell Cycle. 11 2233 2238.

PAGE 123

123 156. Weth O, Renkawitz R. (2011). C TCF function is modulated by neighboring DNA binding factors. Biochem Cell Biol. 89 459 468. 157. D'Amours D, Desnoyers S, D'Silva I, Poirier GG. (1999). Poly(ADP ribosyl)ation reactions in the regulation of nuclear functions. Biochem J. 342 249 268. 158. Yu W, Ginjala V, Pant V, Chernukhin I, Whitehead J, Docquier F, Farrar D, Tavoosidana G, Mukhopadhyay R, Kanduri C, Oshimura M, Feinberg AP, Lobanenkov V, Klenova E, Ohlsson R. ( 2004 ) Poly(ADP ribosyl)ation regulates CTCF dependent chromatin insulation. Nat. Ge net. 36 1105 1110. 159. Torrano V, Navascus J, Docquier F, Zhang R, Burke LJ, Chernukhin I, Farrar D, Len J, Berciano MT, Renkawitz R, Klenova E, Lafarga M, Delgado MD. (2006). Targeting of CTCF to the nucleolus inhibits nucleolar transcription through a po ly(ADP ribosyl)ation dependent mechanism. J Cell Sci. 119 1746 59. 160. Guastafierro T, Cecchinelli B, Zampieri M, Reale A, Riggio G, Sthandier O, Zupi G, Calabrese L, Caiafa P. (2008). CCCTC binding factor activates PARP 1 affecting DNA methylation machiner y. J Biol Chem. 283 21873 80. 161. Klenova EM, Chernukhin IV, El Kady A, Lee RE, Pugacheva EM, Loukinov DI, Goodwin GH, Delgado D, Filippova GN, Len J, Morse HC 3rd, Neiman PE, Lobanenkov VV. (2001). Functional phosphorylation sites in the C terminal region of the multivalent multifunctional transcriptional factor CTCF. Mol Cell Biol. 21 2221 2234. 162. El Kady A, Klenova E. (2005). Regulation of the transcription factor, CTCF, by phosphorylation with protein kinase CK2. FEBS Lett. 579 1424 1434. 163. MacPherson M J, Beatty LG, Zhou W, Du M and Sadowski PD. (2009). The CTCF insulator protein is posttranslationally modified by SUMO. MCB 29 714 725. 164. Greisman HA, Pabo CO. (1997). A general strategy for selecting high affinity zinc finger proteins for diverse DNA targ et sites. Science 275 657 661. 165. globin associated cis regulatory DNA element using an artificial zinc finger DNA binding domain. PNAS 109 17948 17953. 166. Pavletich NP & Pabo CO. (19 91). Zinc finger DNA recognition: crystal structure of a Zif268 DNA complex at 2.1 Science 252 809 817. 167. Beerli RR & Barbas CF, III. (2002). Engineering polydactyl zinc finger transcription factors. Nature Biotechnology 20 135 141.

PAGE 124

124 168. Garriga Canut M, A gustn Pavn C, Herrmann F, Snchez A, Dierssen M, Fillat C, Isalan M. (2012). Synthetic zinc finger repressors reduce mutant huntingtin expression in the brain of R6/2 mice. PNAS 109 E3136 45. 169. Wilber A, Tschulena U, Hargrove PW, Kim YS, Persons DA, Barb as CF 3rd, Nienhuis AW. (2010). A zinc finger transcriptional activator designed to interact with the gamma globin gene promoters enhances fetal hemoglobin production in primary human adult erythroblasts. Blood 115 3033 3041. 170. Sohn JH, Yeh BI, Choi JW, Yo on J, Namkung J, Park KK, Kim HW. (2010). Repression of human telomerase reverse transcriptase using artificial zinc finger transcription factors. Mol Cancer Res. 8 246 253.

PAGE 125

125 BIOGRAPHICAL SKETCH Bhavita Patel was born in the state of Gujarat, India ; fir st daughter of Harivadan Patel and Jyotsna Patel. She pursued her high er s econdary education in M anav K endra G yan M andir S chool, Kandari, Gujarat and obtained senior secondary education diploma i n 1998. She then joined the B iotechnology program at the N at ubhai V allabhai Patel Science College, S ardar P atel U niversity India and obtained Bachelors of Science with b iotech nology m ajor. In 2002, Bhavita enrolled in the m p rogram in Biochemistry, at the Maharaja Sayajirao University, Baroda, India where she gained tremendous exposure to biological research while working with Dr. Jayashree Pohnerkar on polyketide production from Streptomyces and ob tained a degree in Master of Science in b iochemistry in the year of 2004. In 2005, t o pursue higher education Bhavita got enrolled into the graduate degree program at the University of Texas at Dallas (UTD) Richardson, TX, U nited S tates of A merica (U.S.A) In 2006, she got married to a Floridian resident, which led her to graduat e from the University of Texas w ith M aster of S cience in molecular and cellular b Dr. Jeff Dejong on characterizing testis specific non coding RNAs. To fulfill her career goals, Bhavita joined the I nter D isciplinary P rogr am (IDP) at the University of Florida, Gainesville, FL in the year of 2008 and pursued her Doctor of Philosophy ( Ph. D. ) work in the laboratory of Dr. Suming Huang, identifying the role of epigenetic mechanisms in TAL1 gene activation. She has presented he r work at several national and international conferences. During her Ph.D. studies Bhavita was appointed and funded by T32 t raining grant in cancer biology

PAGE 126

126 In 2003, Bhavita was awarded Minaxi and Lalit award for her academic performance in Biochemistry. She has also obtained several awards including travel award from the graduate school, outstanding international student achievement award (2011), from the college of medicine at UFL and achievement award from American Society of Hematology (ASH) in the year of 2012.