<%BANNER%>

Molecular mechanisms of repression of meiosis-specific genes during early embryonic development of the mouse

Permanent Link: http://ufdc.ufl.edu/UFE0045256/00001

Material Information

Title: Molecular mechanisms of repression of meiosis-specific genes during early embryonic development of the mouse
Physical Description: 1 online resource (85 p.)
Language: english
Creator: Leseva, Milena N
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: development -- e2f6 -- epigenetics -- germline -- silencing
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The E2f6 transcriptional repressor is an E2F-family member essential for the silencing of a group of meiosis-specific genes in somatic tissues. Although E2f6 has been shown to associate with both polycomb repressive complexes (PRC) and the DNA methyltransferase Dnmt3b, the cross-talk between these repressive machineries during E2f6-mediated gene silencing has not been clearly demonstrated yet. In particular, it remains largely undetermined when and how E2f6 establishes repression of meiotic genes during embryonic development. We demonstrate here that the inactivation of a group of E2f6 targeted genes first occurs at the transition from mouse embryonic stem cells (ESCs) to epiblast stem cells (EpiSCs), which represent pre- and post-implantation stages, respectively. This process was accompanied by de novo methylation of their promoters. Of interest, despite a clear difference in DNA methylation status, E2f6 was similarly bound to the proximal promoter regions both in ESCs and EpiSCs. Neither E2f6, nor Dnmt3b overexpression in ESCs decreased meiotic gene expression or increased DNA methylation, indicating that additional factors are required for E2f6-mediated repression during the transition. When the SET domain of Ezh2, a core subunit of the PRC2 complex was deleted however, repression of Stag3 and Smc1ß during embryoid body differentiation was largely impaired, indicating that the event required the enzymatic activity of Ezh2. In addition, repression of Stag3 and Smc1ß occurred in the absence of Dnmt3b. The data presented here suggest a primary role of PRC2 in E2f6-mediated gene silencing of the meiotic genes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Milena N Leseva.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Terada, Naohiro.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045256:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045256/00001

Material Information

Title: Molecular mechanisms of repression of meiosis-specific genes during early embryonic development of the mouse
Physical Description: 1 online resource (85 p.)
Language: english
Creator: Leseva, Milena N
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: development -- e2f6 -- epigenetics -- germline -- silencing
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The E2f6 transcriptional repressor is an E2F-family member essential for the silencing of a group of meiosis-specific genes in somatic tissues. Although E2f6 has been shown to associate with both polycomb repressive complexes (PRC) and the DNA methyltransferase Dnmt3b, the cross-talk between these repressive machineries during E2f6-mediated gene silencing has not been clearly demonstrated yet. In particular, it remains largely undetermined when and how E2f6 establishes repression of meiotic genes during embryonic development. We demonstrate here that the inactivation of a group of E2f6 targeted genes first occurs at the transition from mouse embryonic stem cells (ESCs) to epiblast stem cells (EpiSCs), which represent pre- and post-implantation stages, respectively. This process was accompanied by de novo methylation of their promoters. Of interest, despite a clear difference in DNA methylation status, E2f6 was similarly bound to the proximal promoter regions both in ESCs and EpiSCs. Neither E2f6, nor Dnmt3b overexpression in ESCs decreased meiotic gene expression or increased DNA methylation, indicating that additional factors are required for E2f6-mediated repression during the transition. When the SET domain of Ezh2, a core subunit of the PRC2 complex was deleted however, repression of Stag3 and Smc1ß during embryoid body differentiation was largely impaired, indicating that the event required the enzymatic activity of Ezh2. In addition, repression of Stag3 and Smc1ß occurred in the absence of Dnmt3b. The data presented here suggest a primary role of PRC2 in E2f6-mediated gene silencing of the meiotic genes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Milena N Leseva.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Terada, Naohiro.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045256:00001


This item has the following downloads:


Full Text

PAGE 1

1 MOLECULAR MECHANISMS OF REPRESSION OF MEIOSIS SPECIFIC GENES DURING EARLY EMBRYONIC DEVELOPMENT OF THE MOUSE By MILENA NIKOLAEVA LESEVA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Milena Nikolaeva Leseva

PAGE 3

3 To my husband for his love and support

PAGE 4

4 ACKNOWLEDGMENTS I thank Dr. Naohiro Terada for welcoming me into his laboratory and introducing me to the exciting world of developmental biology and embryonic stem cells. I am grateful to him for opening m y eyes to the potential within th e stem cell biology field and its i ntersection with the wonders of epigenetic phenomena. I thank him for his kindness, warm heart, understanding and extreme patience. I would also like to acknowledge my committee members: Dr. Paul Oh, Dr. Thomas Yan g, Dr. James Resnick, and Dr. J rg Bungert for their valuable advice, encouragement, and point of views. I thank the current and previous members of our labo ratory for the professional, friendly environment and their readiness to always help I would specifically like to thank Dr. Katherine Sant ostefano for teaching me cell culture, molecular biology techniques, and iPS cell reprogramming I thank Chae Ho for his encouragement, Dr. Aline Bonilla for her positive attitude and support, and Joon for making me laugh I also thank Alice, Serena, and N at for their much needed friendship, t hrough good times and bad. Last, but not least, I thank the Fulbright Commission and the U.S. Department for Educational and Cultural Affairs for creating and administering the unique International Fulbright Science an d Technology award, which allowed me to come to the University of Florida and partake in t his life altering Ph. D. experience

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURE S ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 Embryo nic Development ................................ ................................ ......................... 13 Peri implantation Development of the Mouse ................................ ................... 13 First cell lineage choice ................................ ................................ .............. 14 Second cell lineage choice ................................ ................................ ......... 14 Mo lecular Foundations of the First Cell Lineage Choices ................................ 16 Genetic regulation of the TE vs. ICM choice ................................ .............. 17 Genetic regulation of the EPI vs. PE choice ................................ ............... 18 Mouse Embryonic Stem Cells ................................ ................................ ................. 20 Ep iblast Stem Cells ................................ ................................ ................................ 23 Epigenetic Mechanisms of Gene Regulation ................................ .......................... 25 Nucleosomal Organization of the Genome ................................ ....................... 26 DNA Methylation ................................ ................................ .............................. 29 Polycomb Repressive Complexes ................................ ................................ .... 34 The E2f6 Transcription Factor ................................ ................................ ................ 36 Significance ................................ ................................ ................................ ............ 38 2 MATERIALS AND METHODS ................................ ................................ ................ 39 Cell Lines and Cell Culture Conditions ................................ ................................ ... 39 / ESCs .................. 40 Microarray ................................ ................................ ................................ ............... 41 Real Time Quantitative RT PCR ................................ ................................ ............. 41 Bisulfite DNA Sequencing ................................ ................................ ....................... 42 Chro matin Immunoprecipitation QPCR ................................ ................................ ... 43 3 RESULTS ................................ ................................ ................................ ............... 47 Tuba3 and Slc25a31 genes ................................ ................................ ................. 47

PAGE 6

6 E2f6 Target Genes are First Silenced in EpiSCs, a Model for the Post implantation Epiblast ................................ ................................ ........................... 48 De n ovo DNA Methylation Patterns of E2f6 Target Gene Promoters are First Set in EpiSCs ................................ ................................ ................................ ...... 49 Over expression of E2f6 or Dnmt3b in ESCs do es not Induce Premature Silencing of E2f6 Target Genes ................................ ................................ ........... 50 3b may be Dispensable ................................ ................................ ............................ 51 4 DISCUSSION ................................ ................................ ................................ ......... 72 LIST OF REFERENCES ................................ ................................ ............................... 77 BIOGRAPHIC AL SKETCH ................................ ................................ ............................ 85

PAGE 7

7 LIST OF TABLES Table page 2 1 Genotyping RT PCR and PCR primers ................................ .............................. 45 2 2 Quantitative real time PCR primers ................................ ................................ .... 45 2 3 Forward and reverse primers used for bisulfite sequencing ............................... 45 2 4 Chromatin immunoprecipitation real time PCR primers ................................ ...... 46 3 1 CGI cl assification ................................ ................................ ................................ 55 3 2 Gene microarray ................................ ................................ ................................ 55

PAGE 8

8 LIST OF FIGURES Figure page 3 1 Embryonic tissues and their in vitro derivatives. ................................ ................. 56 3 2 Deletion of E2f6 disrupts somatic cell CGI methylation at E2f6 dependent ermline specific gene promoters ................................ ........ 57 3 3 Deletion of E2f6 disrupts somatic cell CGI methylation at E2f6 dependent Tuba3 and Slc25a31 g ermline specific gene promoters ................................ ..... 58 3 4 Germline specific genes regulated by E2f6 are first silenced in primed pluripotent stem cells.. ................................ ................................ ........................ 59 3 5 Differential DNA met EpiSCs and MEFs. ................................ ................................ ............................ 60 3 6 DNA demethylation of the Stag3 promoter during in vitro and in vivo reprogramming ................................ ................................ ................................ .. 61 3 7 DNA methylation of the Tuba3 and Slc25a31 promoters in ESCs, EpiSCs and MEFs. ................................ ................................ ................................ .......... 62 3 8 The effects of E2f6 over expression on RNA expression and DNA methy lation of meiotic genes in ESCs ................................ ............................... 63 3 9 The effects of Dnmt3b over expression on RNA expression and DNA methylation of meiotic genes in ESCs. ................................ ............................... 64 3 10 Preparation of embryoid bodies using t he classic hanging drop method or AggreWell plate ................................ ................................ ................................ .. 65 3 11 Germline specific gene expression levels during embryoid body differentiation of wild type, Ezh2 deficient and Dnmt3b deficient pluripotent stem cells. ................................ ................................ ................................ ........... 66 3 12 type and Ezh2 deficient pluripotent stem cells. ................................ ................... 67 3 13 DNA methylation of Stag3 gene during embryoid body differentiation of wild type, Ezh2 deficient pluripotent stem cells. ................................ ........................ 68 3 14 CHIP qPCR for enrichment of H3K27me3 at the TSS of select genes ............... 69 3 15 Dnmt3b deficient pluripotent stem cells.. ................................ ............................ 70 3 16 Model for E2f6 mediated repression of Stag3 and Smc1 genes.. .................... 71

PAGE 9

9 LIST OF ABBREVIATIONS 2i Cell culture conditions containing MEK1/2 and GSK3 inhibitors 5meC 5 methyl Cytosine 5hmeC 5 hydroxymethyl Cytosine BER Base excision repair bp Basepair cDNA Complementary DNA CGI CpG island Ch IP Chromatin immunoprecipitation DIA Differentiation inhibitory activity E2.5 Embryonic day 2.5 EB Embryoid body ECM Extracellular matrix EPI Epiblast EpiSCs Epiblast stem cells ESCs Embryonic stem cells FCS Fetal calf serum H3K4me3 Trimethylation of histone H3 at the fourth lysine position H3K27me3 Trimethylation of histone H3 at the twenty seventh lysine position ICM Inner cell mass iPSCs Induced pluripotent stem cells KSR Knockout serum replacement LIF Leukemia inhibitory factor MEFs Mouse embryonic fibroblasts mES C Mouse embryonic stem cell

PAGE 10

10 mg Milligram g Microgram mL Milliliter L Microliter mM Millimolar ng Nanogram nM Nanomolar Obs/Exp Ratio of observed over expected PcG Polycomb group protein PCR Polymerase chain reaction PE Primitive endoderm PRC Polycomb repressor complex qPCR Quantitative polymerase chain reaction RT PCR Reverse transcription polymerase chain reaction TE Trophectoderm TFs Transcription factors TSS Transcription start site U Units ZP Zona pellucida

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR MECHANISMS OF REPRESSION OF MEIOSIS SPECIFIC GENES DURING EARLY EMBRYONIC DEVELOPMENT OF THE MOUSE By Milena Nikolaeva Leseva May 2013 Chair: Naohiro Terada Major: Medical Sciences Molecular Cell Biology The E2f6 transcriptional repressor is an E2F family member essential for the silencing of a group of meiosis specific genes in somatic tissues. Although E2f6 has been shown to associate with both polycomb repressive complexes (PRC) and the DNA methyltransf erase Dnmt3b, the cross talk between these repressive machineries during E2f6 mediated gene silencing has not been clearly demonstrated yet. In particular, it remains largely undetermined when and how E2f6 establishes repression of meiotic genes during emb ryonic development. We demonstrate here that the inactivation of a group of E2f6 targeted ge nes first occurs at the transition from mouse embryonic stem cells (ESCs) to epiblast stem cells (EpiSCs), which represent pre and post implantation stages, respec tively. This process was accompanied by de novo methylation of their promoters. Of interest, despite a clear difference in DNA methylation status, E2f6 was similarly bound to the proximal promoter regions both in ESCs and EpiSCs. Neither E2f6, nor Dnmt3b o verexpression in ESCs decreased meiotic gene expression or increased DNA methylation, indicating that additional factors are required for E2f6 mediated repression during the transition. When the SET domain of Ezh2, a core subunit of the PRC2 complex was de

PAGE 12

12 during embryoid body differentiation was largely impaired, indicating that the event occurred in the absence of Dnmt3b. The dat a presented here suggest a primary role of PRC2 in E2f6 mediated gene silencing of the meiotic genes.

PAGE 13

13 CHAPTER 1 INTRODUCTION Embryonic D evelopment In female mammals the process of oogenesis leads to the generation of germinal vesicle oocytes arrested in metaphase II of the second meiotic division. Following fertilization the oocyte is pr ompted to complete it forming the haploid maternal pr onucleus and the second polar body. The fertilized oocyte (now cal led a zygote) undergoes a serie s of cleavage divisions thus traversing through a 2 4 and 8 cell stage consecutively. The cleavage divisions increase the number of cells by partitioning 1 The mammalian embryo undergoes rotational cleavage in which the first division is meridional. During the following division one of the blastomeres divide s meridio naly while the other equa torially. 2 The individual cells of the embryo, also called blastomeres, are considered to be equipotent. In other words, they are capable of contributing to all extraembryonic and embryonic tissues alike with no cell lineage commitment bias. Mater nally derived transcripts and proteins are present in the zygote during these early stages, but mammalian embryonic development is considered to be regulative, not mosaic. This ensures that the inter cellular differences emerging later on will depend on th e interactions between cells and their position within the embryo rather than on the inheritance of specific morphogenetic determinants by a particular blastomere. Peri implantation Development of the Mouse Mouse pre implantation development occurs from f ertilization up to E4.5 and involves a series of morphogenetic changes required to prepare the embryo for

PAGE 14

14 implantation into the uterine wall. Two cell fate specification events occur during this time. First cell lineage choice Up to the 8 cell stage (E2.5) the blastomeres are loosely arranged within the embryo, which is surrounded by a protective gly c oprotein layer, the zona pellucida Around the 8 cell stage the embryo undergoes compaction, i.e an incr ease in intercellular contacts through tight junctions mediated by E cadherin, thus forming the morula Polarization of the cells within it follows, w ith distinctive apical and baso lateral domains being observed. 3 As the blastomeres continue t o divide the plane of division will determine their future positions within the embryo. Depending on whether the mitotic plane is perpendicular or parallel to the apical domain the cell will undergo symmetrical or asymmetrical division, respectively. Symmetrical cell divisions will generate two polar outer cells. Asymmetrical divisions will generate one polar outer cell and one apolar cell with a mor e inner position. The outer cells are the precursors of the future trophectoderm (TE) which will differentiate into trophoblast cells and the supportive giant cells contributin g to the embryonic placenta The inner cells will go on to form the inner cell m ass (ICM). Two waves of internalization will secure the number of ICM cells (approximately 13) needed to continue development. In summar y, the first cell fate choice results from the combination of compaction, polarization, asymmetrical cell divisions and differential cell positioning. 4 Second cell lineage choice The embryo at the 32 cell stage (E3.5) undergoes cavitation to form a fluid filled blas t o coel within the early blastocyst. It is at this stage that the firs t axis of polarity is set which will correspond to the proximal d istal axis at the egg cylinder stage. The

PAGE 15

15 embryonic side of the blastocyst is where the ICM is positioned, overlaid by polar TE. The abembryonic is on the opposite (non ICM) side, surrounded by mural TE. As the blastocyst matures the segregation of the epiblast (EPI) and primitive endoderm (PE) within the ICM begins. The mechanisms of cell commitment to each of these lineages are still under dispute due to conflicting experimental observation s. According to one hypothesis the two waves of cell internalization generate bi potent cells that can contribute to both the EP I and PE without any preference. According to another the longer a cell is exposed to the outer environment the less likely it is to contribute to the EPI. 5 This suggests that cells, which are internalized during the first wave, will contribute more of te n than not to the EPI, while cells internalized during the second wave will be biased towards the PE. The resulting mature blastocyst now contains a mixture of randomly distributed EPI and PE cells. Signals from the mural TE will trigger cell movements leading to the sorting out of a single epi thelial layer of PE overlaying the cells of the EPI on the surface facing the blastocoel Any PE cells which have not assumed their correct position will undergo apoptosis The PE cells will give rise to the future parietal and visceral endoderm tissue of the yolk sac, while the pluripotential cells of the EPI will differentiate int o all three germ layers of the embryo proper These events are taking place while the embryo is moving along the oviduct to its final de stination, the uterus. Throughout this time the zona pellucida (ZP) prevents its attachment to the oviduct wall F ailure to do so would result in an ectopic pregnancy. When the embryo reaches the uterus it hatch es from the zona and the blastoc yst implants into the wall of the endometrium. This process is facilitated by the trophoblast

PAGE 16

16 cells which secrete proteases required for lysis of the ZP and the endometrial extracellular matrix (ECM), and also synthesize the additional ECM proteins needed for successful implantation. The cells of the post implantation mouse epiblast continue to proliferate to form a cup shaped structure called the egg cylinder. The next major developmental milestone is the gastrulation stage, which results in formatio n of the three embryonic germ layers : ectoderm, endoderm, and mesoderm. Molecular Foundations of the First Cell Lineage C hoices For decades developmental biologists have been unveiling the events occurring during mammalian embryonic development using, primarily the mouse as a model organism. Much of the understanding that has been gained over the years has been applied to the study of developmental disorders, the practice of assisted reproduction and, more recently, has contributed to the explosion in embryonic stem cell research. Starting transcription factors (TFs) essential for the maintenance of the undifferentiated state were identified, including Pou5f (Oct4), Sox2 and Nanog. These factors are absolutely required for normal embryonic development. 6, 7 Oct4 belongs to class V of the POU ( P it 1 O ct 1 U nc86 ) family of transcription factors, which bind the consensus octamer sequence ATGCAAAT. 8 Oct4 / embryos develop up to E3.5, but die aroun d the time of implantation forming implantation sites with no embryonic structures. 9 Sox2 belongs to the Sry related HMG box family of transcription factors and binds to the consensus A/T A/ TCAAAG sequence. 10 Sox2 / embryos die shortly af ter implantation and lack Oct4 positive epiblast cells. 11 While most TFs contact the DNA through the major groove, Sox2 interacts with the minor groove and induces a sharp kink in the DNA molecu le. Sox2 and Oct4 function cooperatively

PAGE 17

17 and bind to composite target sites as Sox2/Oct4 heterodimers with their DNA binding domains positioned adjacent to one another. 12 The third major pluripotency factor, N anog, takes its name after the c eltic land of the ever young (Tir nan Og) and was identified in 2003. 7, 13 It is a homeodomain transcription factor with ~50% aa identity to the NK2 family o f homeodomain proteins. Nanog / embryos fail to form epiblasts and die around the time of implantation. Curiously, Nanog null embryos also lack PE, but this phenotype could be r escued if knockout cells are injected into wild type blastocysts, which go on to develop normally 14, 15 This discovery suggested for the first time that Nanog expressing cells can also control spec ific ation of the PE through secretion of a factor 16 ,which e xperimental evi dence suggests is fibroblast growth factor 4 ( Fgf4 ) 17 19 The Sox2/Oct4 heterodimer regulates expression from the Nanog promoter by binding to a site approximately 250bp upstream of the transcription start site ( TSS ) Genetic r egulation of the TE vs. IC M c hoice On the molecular level the outer and inner cells of the early blastocyst can be distinguished from each other by their mutually exclusive expression of two major transcription factors: Cdx2 and Oct4. Cdx2 is stochastically expressed until the 8 cel l stage, but is gradually restricted to the outer cells of the morula. 20 Oct4 is initially translated from maternally derived tran scripts and is later ubiquitously expressed, but is effectively down regulated in all Cdx2 positive cells. These TF s interact through reciprocal negative feedback loops and positively auto regulate their own expression. Cdx2 null embryos lack sustained TE specification, and this phenotype is accompanied by an aberrant activation of ICM specific gene s. Cdx2 lies downstre am of the TF Tead4 In Tead4 null embry os the TE phenotype is even more s evere and includes the complete loss of Cdx2 expression. Tead4 mediated activation of Cdx2 requires the

PAGE 18

18 transcriptional co ac tivator Yap1. Yap1 is a downstream target of the Hippo signaling pathway, which is activated only in the inner cells of the morula Phosphorylation of Yap1 by the Lats1/2 kinase activity sequesters it in the cytoplasm, thus preventing expression of Cdx2. This allows for accumulation of Oct4, which further down regulates Cdx2. In contrast, in the outer cells, Yap1 can translocate into the nucleus where, together with Tead4, it positively regulates expression from the Cdx2 promoter. Cdx2 can then activate transcription from its own promoter through an auto regulatory loop, and can also inhibit Oct4 expression. 3, 21, 22 Genetic regulation of the EPI vs. PE c hoice The separation of the epiblast from the PE is the result of t he activation of the Fgf/Erk pro differentiation pathway. 23 The transcription factors Oct4 and Sox2 directly control the expression of Fgf4, which is the dominant fibroblast growth factor ligand in the early embryo. It is, initially, ubiquitously expressed in cells of the 8 and 16 cell stage morula The main Fgf receptor expressed at this time is Fgfr2. How the first subtle differences among the cells of the ICM are initially introduced is currently not clear, but by the early blastocyst stage Fgf4 expression is restricted to the EPI and Fgfr2 is confined to the extraembryonic lineages (TE and PE). Activation of the Fgf receptor upon ligand bin ding leads to activation of Mapk /Erk signaling mediated by Grb2, which results in down regulation of the pluripotency marker Nanog and an increase of the PE marker Gata6. G rb2 nul l embryos can still form an ICM however these cells express only markers characteristic of the EPI, like Nanog. Nanog and Gata6 reciprocally repress exp ression This ensures that the ICM will stabilize two different cell populations: Na nog+ and Gata6+ The Gata6 positive cells will then eventually relocate to the surface of the ICM where they will form the PE. 24

PAGE 19

19 Most of the regulators of lineage commitment were uncovered using genetic approaches and different combinations of lineage traci ng, knockout mouse models and knockout or over expression experiments in vitro However, these appr oaches cannot detect the gene expression fluctuations that exist between individual cell s of the early embryo. The advent of single cell transcriptome analysis and next generation sequencing has made it easier to address precisely those types of questions. 25, 26 In a recent publication single cell gene expression profiling was u sed to monitor 48 transcrip tion factors in 500 cells from the singl e cell zygote to the 64 cell blastocyst stage. 27 As expected, there were no appreciable differences in the expres sion profiles between cells of the 2 4 and 8 cell stage s However, by the 64 cell stage 60% of the cells highly expressed TE markers like Cdx2 and Krt8, 25% were enriched for the PE markers Gata4 and Pdgfra, and 11% were enriched for EPI markers like N anog and So x2. Importantly, when the authors projected the expression patterns in cells from the 8 through the 32 up to the 64 cell stage they were able to monitor the transition of individual transcriptomes towards one of the three early embryonic lineages (TE, PE, or EPI). One interesti ng observation that they made is that many transcription factors, which will later become cell type restricted ar e actually co expressed in 16 cell blastomeres at levels comparable to those seen in lineage committed cells of the 64 cell stage. Thus they concluded that in most cases, it is not the up regulation of a TF contrary, it is the down regulation of the TF in certain cells t hat will exclude them from a particular lineage. Whether this is a stochastic process or not r emains unclear. D uring the transition from 16 to 32 cell stage, the two TFs exhibiting the strongest induction

PAGE 20

20 are Id2 (in cells of the TE) and Sox2 (in cells of the ICM). Furthermor e, there are distinct Id2 HIGH /Sox2 LOW and Id2 LOW / Sox2 HIGH cell subpopulations present even at th e 16 cell stage, with the Id2 LOW /Sox2 HIGH representing the future cells of the ICM. Finally, the strongest inverse correlation between th e expression levels of two genes at the 32 cell stage is that of Fgf4 and Fgfr2. Thus, it is the increase of Fgf4 (from a low initial expression level at the 16 cell stage) and a decrease in Fgfr2 (from a high express ion level at the 16 cell stage) that r estricts cells to the EPI. T reatment of embryos with an Fgfr inhibitor led to a down regulation of PE specific Gata4 and Sox17, because of the role Fgf signaling plays in PE specification. This coincides with an up regulation of the EPI specific Nanog and Esrrb. Remarkably, Gata6 was unaffected suggesting that expression of Gata6 might actually be independen t of Fgf signaling. Mouse Embryonic Stem Cells Embryonic stem cell culture has allowed for tremendous strides to be made towards the understanding of early embryonic development, but these cells have also served as a tool for dissecting of individual gene function through advances made in recombinant DNA technologies. Mammalian embryonic stem cells (ES C ) are characterized by their capability to prolifer ate virtually indefinitely in vitro In addition, they can differentiate into any embryonic cell lineage, given the appropriate differentiation signal. The term een assigned to this property 28 In this regard they differ from adult stem cells, or progenitor cells, which possess a restricted developmental potential. This is why embryonic stem cells are considered to be the in vitro counterpart of the ICM. However, it is important to keep in mind that the pluripotent state of the pre implantation

PAGE 21

21 epiblast tissue exists only trans iently in the embryo, and that ESC are essentially an in vitro adaptation that permit this state to be stabilized and studied ex vivo The isolati on of pluripotent cells directly from the mouse embryo was demonstrated for the first time in 1981 29, 30 Once ICM outgrowths were formed in vitro they were dissociated into a single cell suspension and re plated on a feeder layer of mitotically inactivated mouse embryonic fibroblasts (MEF s ) until round, dome shaped ES C colonies were observe d. Because, historically, much of the research that led to the isolation of mouse ESC s was done on embryonal carcinoma cell lines the optimal cell culture conditions were derived empirical ly without in depth understanding of the molecular mechanisms that sustain pluripotency and self renewal in vitro It took many years of investigation for the stem cell biology field to achieve chemically defined conditions of cell culture. During this time it was discovered that MEFs secrete a differentiation inhibitory activity (DIA) which was identifi ed as the IL 6 family cytokine l eu kemia inhibitory factor (Lif) For the mouse L if is essential to sustain embryo nic viability during diapause. Diapause is a rodent specific phenomenon observed in pregnant females that have not yet weaned off their previous litter. This is an adaptation that preserves the blastocyst for an extended period of time until hormonal conditions optimal for implantation are reached. Diapause can also be induced experimentally by ovari ectomy around 2d.p.c. and can facilitate m ouse ES C isolation. 31 As knowledge o f ESC biology gradually increased feeder free culture conditions were developed and chemically defined media supplemente d with Lif and Bmp4 was used to maintain the undifferentiated state. 32 However, today it is well known the ES C s require no supplementation wi th extrinsic factors given that any pro differentiation pathways like

PAGE 22

22 Fgf/Erk ar e inhibited. This has led to the discovery that a combination of small chemical inhibi inhibition alone (2i) without serum can sustain pluripotency and self renewal in vitro 33 To achieve the best quality of ES C s a 2i+Lif composition is routinely being used today. These conditions have also allowed f or the derivation of ESCs from previously unpermissive mouse strains 34 A s mentioned above, derivation of ESC s requires an adaptation from a normally transient state in vivo to a state that is sustainable in vitro and at the same time entails the acquisition of self renewal capacity. A recent study utilized RNA sequenc ing to observe the transition from the ICM t o the ESC transcriptome at the single cell level. 35 The authors investigated 385 pluripotency and early differentiation related genes and followed their expression in single cells of the ICM, the 3 and 5 day ICM outgrowths, and ESC s Interestingly, c Myc was expressed heterogeneously in ICM cells, but its expression had small to no variability as cells progress ed from 3 to 5 day outgrowths, and finally to established ES C s This suggests that genes like c Myc are selected for during the derivation proce ss. The same is true for the bone morphogenetic protein re ceptor Bmpr1a, which is highly expressed in ES C s This might e xplain why ESC s historically, were maintained in media supplemented initially with serum, and later with Bmp4. The general conclusion from this study is that during the transition from ICM to ES C s genes involved in cell growth, amino acid and lipid metab olism, and transcription become activated in ES C s In 2008 Chen et al. used chromatin immunoprecipitation coupled with high throughput sequencing ( CHIP seq ) to map the genomic locations of 13 transcription

PAGE 23

23 factors including Oct4, Sox2, Nanog, Stat3, Smad1, c Myc n Myc, Klf4, and Esrrb in ESC s 36 From this and other genome wide studies a picture emerges of two renewal. O ne is centered on the pluripotency factor axis Oct4 Sox2 Nanog, with Oct4 assuming the highest position in the hierarchy The other is centered on the Myc TF s These circuitries are characterized by feedback loops, auto regulation, cooperativity and co occ upancy of multiple TF s at numerous genomic target loci Epiblast Stem Cells In 2007 an additional pluripotent cell type was isolated from the post implantation egg cylinder stage epiblast of E5.5 embryos. 37, 38 These epiblast stem cells (EpiSC s ) diff er morphologically from ESC s and form flattened epithelial colonies on MEF feeders. They do not require t he Lif / Stat3 pathway to maintain pluripotency, but rather Activin/b FGF signaling. In addition, EpiSC s differ from ES C s in their transcriptomes and e pigenomes so that EpiSC s undergo de novo DNA methylation, and female lines have one inactive X chromosome It has been suggested that EpiSC s are in fact more developmentally advanced than ES C s Today it is widely accepted that two different pluripotency states exist: a nave (ground) state, and a poised (primed) state exemplified by ES C s and EpiSC s respectively. 28 Interestingly, EpiSC s are thought to resemble more closely h uman ES C s at least in terms of morphology and cell culture techniques, active cell signaling pathways, and developmental potential. 39 In fact, both hES C s and EpiSC s are not clonogenic and do not survive as single cells, in contrast to mES C s Moreover, different established cell lines exhibit differential differentiation abilities in culture. 40 This has led to the important conclusion that the hES C s lines isolated so far may not represent the true nave pluripotency state of the human pre

PAGE 24

24 implantation emb ryo. This might be explained by inhere nt differences between rodents and higher primate s, which make it challenging to isolate equivalent cell populations. Another, not mutually exclusive alternative might be that the explanted human ICM actually progresses developmentally during the hES C derivation process due to the absence of diapause in primates. It was originally postulated that EpiSC s can only be established from post implantation epiblast tissu e. However, EpiSC s have more recently been derived even from the pre implantation ICM when it is cultured in EpiSC conditions. This underscores the fact that the ICM likely contains a heterogeneous population of cells. 41 In fact, heterogeneity within ES C and EpiSC cultu res has been observed frequently due to fluctuating levels of major transcription factors, which leads to the establishment of transient and inter convertible in vitro cell subpopulations. 42 44 These subpopulations might represent an unstable specification towards a mo re differentiated state which correspond s to different development stages in vivo In this way, for example, the Oct4 positive population of early passage EpiSC s c an be considered equivalent to the early post implantation epiblast, while the predominantly Oct4 negative population of la te passage EpiSC s are equivalent to late post implantation epiblast. However, i t should be noted that t he significance of the observed heterogeneity has recently been called into question. Derivation of new mES C s lines in conditi ons thought to promote the ground state of pluripotency (2i ) has revealed the presence of far less morphological and molecular het erogeneity than previously thought to exist. 45 Blastocyst injection, or morula aggregation, of mouse and rat ESC s ge nerate chimeras efficiently. 46, 47 Rodent ESC s contribute readily to all embryonic tissues,

PAGE 25

25 including the germline and this ability is considered the most stringent functional assay to determine differentiation potential Because t his property is sha red by both rodent ESC s and the ICM from which they are derived ESC s can serve as an in vitro model system for rodent pre implantation embryonic development. However, due to the b iology of EpiSC s and their inability to survive well when introduced into blastocysts, their full in vivo differentiation potential had not been experimentally demonstrated This left open the question of whe ther or not EpiSC s can be considered equivalent to the post im plantation epiblast. A recent study demonstrated that when grafted into E7.0 E7.5 day embryos cultured in vitro for up to 48hrs, 10 16 EpiSC s were able to disperse from the graft site, proliferate, and commit to the cell fate of adjacent cells 48 Dispersed EpiSC s, and their descendants were capable of up regulating markers of the surface ectoderm, neuroectoderm, mesoderm and endoderm, depending on their location. Importantly, alkaline phosphatase p ositive and Stella positive graft derived cells were also observed suggesting contribution to primordial germ cells, the precursors of the germline. In contrast, ESC s either did not incorporate effi ciently into E7.5 embryos, or w ere unable to differentiate appropriately in this developmentally advanced environment. Epigenetic Mechanisms of Gene Regulation According to the central dogma of molecular biology genetic information is passed from the DNA molecule on to RNA, and from RNA on to proteins, in the pr ocesses of transcription and translation. Today we accept that this is an oversimplified view, which cannot explain many phenomena observed during decades of research. The definition of epigenetics has evolved greatly since it was first introduced by Waddi n between genes and their products that bring the

PAGE 26

26 epigenetic are mechanisms that influence gene expression without changes in the DNA sequence, t h at are meiotically or mitotically heritable and are maintained even after the stimulus that caused them has been removed. Epigenetic mechanisms of regulation operate through chromatin folding in 3D space nucleosome positioning and remodeling, covalent modifications of histone proteins and histone variants, and methylation of DNA. DNA template driven processes like replication, transcription and repair all occur on chromatin rather than naked, linear DNA, which influences their regulation. The l arge mammalian genome (3400 Mb in humans) is compacted 1 2x10 4 fold so that a 2m long linear DNA molecule is reduced to 10m that c on a the 30nm two start zigzag helix 49 and on to higher order structures. Nucleosomal Organization of the Genome The nucleosome is t he basic repeating unit of chromatin. 50 It consists of 147bp of B form DNA wrapped around a histone octamer in 1.65 turns as a left handed superhelix. The histone octamer contains two m olecules each of the core histones H2A, H2B, H3, and H4. The core histones are small, conserved, and highly basic proteins with central globular domains and unstructured histone tails protruding from the nucleosome particle. The presence of positively char ged amino acid side chains on the h istone molecules facilitates tight electrostatic interaction s with the negatively charged pentose phosphate backbone of the DNA molecule Within the nucleosome t h e histone molecules are organized as two H2A/ H2B dimers an d a single H3/H4 tetramer. Between each nucleosome a region of linke r DNA with variable length ( mean of

PAGE 27

27 approximately 35bp) is observed bound by the linker histone H1 which is essential to promote compaction In addition to the canonical core histones, hi stone variants can also be incorporated into chromatin in a developmental stage or cell type specific manner. Histone var iants can contribute to the organization of particular chromosome structure s like CENP A, which is only observed at centromeric regions. They can also be present within regulatory regions where they modulate chromatin accessibility, like H2A.Z and H3.3, which are enriched at active gene promoters and macroH2A which is associated with transcriptional repression 51 The histone tails are subject to extensive post translational covalent modifications including acetylation, methylation, phosphorylation, ADP ribosylation, ubiquitylation, and sumoylat ion The first three modifications are studied the best and they are targeted to lysine (K) arginine (R) and serine (S) residues mostly located on the amino terminal histone tails. Some modifications can act in cis by altering the interaction between DNA and the core particle through introduction of a net charge change. A cetylation, for example, can neutralize positive charges thereby creating a more open chromati n region accessible for binding of regulatory proteins or components of the basic transcripti onal machinery Other modifications, like methylation, can act in trans and appropriate domains 52, 53 It is important to note that histone modifications do not occur i n isolation, but in combination 54, 5 5 T oday we recognize that t his combinatorial histone code is present both within the same nucleosome (on sister and non sister histone tails) and among adjac ent nucleosomes. This c ode implies multivalent reader chromatin interactions and is the reason why a specific modification can have more than one

PAGE 28

28 functional outcome. This code ultimately serves to structurally define the chromatin environment and determin e its functionality. During embryonic development the mammalian genom e undergoes vast reorganization, which leads to the establishment of euchromatin and heterochromatin domains. Euchromatin is considered the gene ric h, transcriptionally active, centrally located portion of the genome. Heterchromatin refers to the generally gene poor, facultatively or constitutively silenced, peripherally located and compacted region of the genome. A recent study demonstrated the dynamics of global chromatin organization and remodeling from the single cell zygote up to the post implantation epiblast stage of development using electron spectroscopic imaging 56 At the single cell stage the chromatin is gener ally dispersed, with little compaction primarily located around the nucleolar precursor bod y This stage is prior to the major zygotic genome activation that occurs around the 2 cell stage and coincides w ith low levels of transcription Between the 2 and 4 cell stage there is a transient period of chromatin compaction and structu ral compartmentalization with a gradual increase in the size of heterochromatin blocks By the 8 cell stage and in the E3.5 blastocyst the chromatin is remodeled and assumes a more dispersed organization once again with high levels of nucleoplasmic ribonu cleop r otein structures This closely resembles what is observed in ESC s 57 indicating that the open hyper dynamic and permissive chromatin state is characteristic of undifferentiated pluripotentia l cells in vivo and not merely an adaptation that accompanies the ESC derivation process In the early post implantation embryo at E5.5 there are many small and some larger blocks of compacted chromatin,

PAGE 29

29 peripherally located heterochromatin along the nuclear envelope, and few regions of dispersed chromatin. DNA Methylation Most of the dynamics of DNA methylation during mammalian embryogenesis occur during the transition from germ cell to zygote specific methylation patterns shortly after fertilization, and later between the pre implantation ICM and E6.5 post implantation epiblast. 58 Genome wide DNA methylation patterns in the mammalian embryo are established de novo mainly during the transition from the pre to postimplantation stage. Notably, most of the initial targets for de novo methylation are genes commonly expressed in the germline that have meiosis specific functions, li ke Dazl, Spo11, Tex 12 and Sycp3,which are essential for synaptonemal complex formation 59 DNA methylation is associated with gene repression and provides an epi genetic barrier that distinguish es embryonic from extraembryonic lineages. Total 5meC levels in the E7.5 trophoblast are roughly half of what is observed in the epiblast. This increase in overall DNA methylation in the epiblast tissue and its in vitro derivatives is explained by higher methylation levels at satellite repeats, LINE1 and IAP elements, which is required for maintenance of genomic stability. In contrast, t he extraembryonic tissue s exhibit hypermethylation at CGIs of genes with transcripti on factor activities that function in embryoni c patterning and morphogenesis. 60 I n mamma ls methylation is a covalent modification to the fifth carbon atom (C5) position in the pyrimidine ring of a cytosine in a CpG dinucleotide context. The methyl group is positioned in the major groove where it does not interfere with base pairing between the two complementary DNA strands. The transfer of a methyl group is carried

PAGE 30

30 out by a family of DNA methyltransferase s ( Dnmt s ), which utilize S adenosyl L methionine (SAM) as a methyl group donor. Th e enzymatic reaction involves nucleophilic attack by the enzyme on C6 of the cytosine to be modified. This attack is carried out by the thiol group of the cysteine residue withi n the conserved PCQ motif (motif IV) in the enz the formation of a covalent substrate enzyme intermediate stabil ized by the ENV motif, motif VI Formation of the covalent intermediate activates C5 for electrophilic attack and leads to the transfer of the CH 3 group from SAM to the target cytosine. All DNA methyltransferases carry out their function via a base flipping mechanism pai ring interactions are disrupted; the base is then flipped out of the double helix and buried 61 The founding member of the DNA methylt ransferase family of enzymes, Dnmt1, has a preference for hemimethylated DNA substrates, co localizes with PCNA at the replication fork, and is considered to be mainly involved in maintenance of established methylation patterns. Dnmt2 has low enzymatic activity and an unknown function, but is possibly involved in methylation o f tRNA Asp Dnmt3a and 3b comprise the de novo class of DNA methyltransferases essential for the establishment of new promoter, inter and intragenic methylation patterns during embryonic development and for the silencing of repetitive DNA elements. The im portance of DNA methylation for normal embryonic development is emphasized by the fact that Dnmt1 and Dnmt3b knockout mutations are embryonic lethal, while Dnmt3a knockout mice die shortly after birth. 62 Methylated cytosines can be spontaneously deaminated, which leads to a C G to T A transition mutation. This is why the CG dinucleotide has been subjected to negative

PAGE 31

31 selection and is largely depleted from the mammalian genome. However, there are stretches of DNA (arou nd 500bp long) with high C+G content (>55%) and an observed to expected CpG ratio >0.65, which are termed CpG islands (CGI s ). 63 There are over 23000 CGIs in the haploid mouse genome (>25000 per haploid human genome ) and ~50% of them are associated with annotated transcription start sites (TSS) of protein coding genes CGI promoters are usually maintained hypomethylated and generally lack core promoter elements like a TATA box, TFIIB recognition element (BRE) and d ownstream core promoter element (DPE). 64 It is notable that unmethylated CGIs are generally nucleosome deficient an d enriched for trimethylated l ysine 4 on histone H3 (H 3K4me3), a modification asso ciated with actively transcribed genes. However, e nrichment of this histo ne mark at CGIs can be observed irrespective of whether the asso ciated gene is being actively transcribed or not. This observation is now explained by the binding of the CXXC finger protein Cfp1, a subunit of the Setd1 H3K4 methyltransferase complex, to unmethyla ted CGIs. 65 Additional CXXC domain proteins like Kdm2a, which functions as an H3K36me2 demethy lase, have also been described. 66 Collectively, these proteins are likely creating a specialized chromatin environment at CGIs that distinguishes it from the bulk of the genome The first major epigenetic reprogramming event during embryonic development involves the global erasure of DNA m ethylation patterns from the parental pronuclei following fertilization During this round of demethylation only imprinted gen es and the intracist ernal A particles (IAP s ) will retain their methylation patterns. In contrast, specific long interspersed elem ent 1 (LINE 1 ) families and LTR retroelements demonstrate a dramatic loss of methylation especially when the methylation levels b etween sperm and

PAGE 32

32 the zy gote are compared 58 The global DNA methylation patterns will also be reset later in a small group of approximately 40 cells which are specified from the proximal epiblast at E6.5 and will go one to form the future germline. According to a recent study on genome wide epigenetic reprogramming during primordial ge r m cell (PGC) maturation all DNA methylation is gradually lost while PGCs migrate through the hindgut endoderm at E9.5, reach the gonadal anlagen at E11.5, and undergo sex ual determination at E13.5. In fact, DNA methylation is lost from a variety of genomic loci, including CGI and non CGI promoters, exons, introns and intergenic regions, LINE1 elements and differentially methylated regions (DMRs) a t imprinted genes. Curiously, the only genomic feature s that retain high le vels of methylation during PGC maturation are the IAPs which are continuously hypermethylated in E6.5 epiblast cells up to E16.5 male and female PGCs. 67 DNA demethylation of the male pronucleus is considered to be an active process that occurs rapidly in a DNA replication independent manner In contrast, demethylation of the female genome occurs slowly during consecutive rounds of cell division, hence is a pass ive process that depends on replication. The mechanism of passive demethylation involves th e sequestration of the o ocyte specific isoform of the maintenance methyltransferase ( Dnmt1 o ) in the cytoplasm and the gradual dilution of the DNA methylation mark. The mechanisms of active de methylation are not immediately obvious and many years were spent in search of a DNA dem ethylase activity. Today we recognize that active DNA demethylation can be achieved, at least in part, by the participation of the base excision repair (BER) pathway components. 68

PAGE 33

33 Additional modifications derived from 5meC have been discovered like 5hmeC. This modifi cation is det ectable in ESC s and is set by the Tet enzymes. Tet1/2/3 are a family of deoxygenases that hydroxylate 5meC in a n oxalglutarate and Fe(II) dependent manner. 69 Tet1/2 are highly expressed in ESC s and Tet1 in parti cular has been shown to be present in the embryo from the 2 cell stage to the early blastocyst at which point its expression is restricted to the ICM. It has been demonstrated through chromatin immunoprecipitation and siRNA knockdown experiments that Tet1 maintains the hyp omethylated state of the Nanog promoter in vitro and is required for its continuous expression If Tet1 is knocked down in one blastomere of a 2 cell stage embryo the descendants of that blastomere will preferentially contribute to the TE lineage. 70 Although the importance of 5hmeC is undisputed, it is currently not clear whether this mark is a cause or consequence of DNA demethylati on. The study of this modifi cation by traditional bisulfite sequencing methods has been challenging. T reatment of DNA with sodium bisulfite lead s to deamination of all unmethylated cytosines, while methylated cytosines are refractory to this reaction. In t his way, bis ulfite conversion of DNA template s followed by PCR amplification a nd Sanger sequencing of a locus of interest allow s for unmethylated cytosines to be easily distinguished from methylated ones. A drawback of this method is that 5meC and 5hmeC ca nnot be distinguished from each other because both do not undergo a C to T transition Moreover, bisulfite treated templates with dense 5hmeC sites are not efficiently amplified during the PCR step, which lea ds to underrepresentation of 5hmeC marked region s. 71 A new method called Tet assisted bisulfite sequencing (TAB seq) was recently suggested to provide single base resolution detection of 5hmeC that is suitable for both genome wide and locus

PAGE 34

34 specific studi es. 72 Some interesting observations were made when TAB seq was applied to mouse and human ESCs including 5hmeC strand asymmetry and sequence bias towards guanine rich regions. Interestingly, this mark is enriched at low Cp G (LCP) and intermedia te CpG (ICP), and depleted at high CpG (HCP) promoters. E nrichment of 5hmeC was observed near TF binding sites, but was most prominent at distal p300 enriched regulatory ele ments, predicted enhancers, and DNaseI hypersensitive sites. 73 Polycomb Repres sive Complexes The identification of the polycomb group of proteins (PcG) began with the discovery of two Drosophila male mutants that carry sex combs on all legs, instead of only on the legs of the first thoracic seg ment In all metazoans body patterning during embryogenesis is controlled by segment specific expres si on of the Hox homeodomain transcription factors along the ant erior posterior axis Deregulation of Hox gene expression leads to common phenotypes collectively referred to as homeotic transformations or transformation of one body part into an adjacent on e. The initially discovered mutations in Pc (polycomb) and Esc (extra sex combs ), were heterozygous. Homozygous mutant animals die d during embryonic development, which underscores the importance of both proper expression of Hox gene s and their tight regula tion. The search for orthologs of PcG proteins revealed high functional and structural conservation in the animal and plant kingdoms. Additional PcG proteins we re discovered and their roles were found to extend beyond Hox gene regulation to include cell c ycle control, stem cell maintenance, cell differentiation, X chrom o some inactivation, and repression of developmentally regulated genes PcG proteins form multisubunit complexes with specific core and variable accessory proteins. Polycomb repressive comple xes (PRC) change their subunit composition in a

PAGE 35

35 developmental stage and cell type specific manner and even within the same cell. The importance of these pro t e ins has sparked much investigation into the means by which they are targeted to specific gene loci, the mechanisms by which they establish gene repression and the heritability of the established repressed state across successive cell divisions. Two main ma mmalian PRC co mplexes have been characterized to date: PRC1 and PRC2. PRC1 contains the core subunits Ring1, B mi 1, Cbx, and Ph and their isoforms like Ring1a/1b, Cbx4/6/7/8 and Ph1/2/3. There are also a dditional subunits like Rybp, and Kdm2. PRC1 is assoc iated with H2AK119ub and modification independent chromatin compaction. Ubiquitination of H2AK119 is mediated by Ring1 and has been demonstrated to be important for accumulation of the Ser5 phosphorylated form of RNA P ol II (poised RNAP) at bivalent promot ers in ESCs and inhibition of Pol II elongation 74, 75 PRC2 contains the core subunits Ezh1/2, Suz12, Eed, and RbAp 46/48 and is associated with the modification H3K27me3 mediated by Ezh2. The methyltransferase activity of Ezh2 depends on its catalytic SET domain and is efficient only in the presence of Suz12 and Eed within a single trimeric complex. According to the current paradigm, PRC2 is recruited to its target locations where it sets the H3K27me3 mark. This mark can be recognized by the Eed subunit to facilitate PRC2 propagation. 76 The recruitment and activity o f PRC2 can be modulated by the local nucleosomal density 77 and local pre existing histone modifications like H3K4me3 and H3K36me3. Many developmentally regulated gene promoters have been observed to be enriched for both the active H3K4me3 and the repressive H3K27me3 in ESCs. This bivalent state facilitates quick activation or stable repression of the

PAGE 36

36 associated gene once differentiation begin s along a specific path. However, d ue to technical difficulties it remained unclear whether these two modifications exist within the same n ucleosome, or are simply enriched at overlapping genomic location s Furthermore, it was not known if a single modification exists on one or both sister histone tails within the same core particle, i.e. whether the two histone subunits of the nucleosome are interchangeable and identical. A re cent study demonstrated that a single histone mark can exist in both symmetric and asymmetric configurations, modifying both sister histone tails or only one respectively. In addition, bivalent modifications do exist within the same nucleosome. However, t hey are always asymmetric with H3K4me3 occurring on one sister histone tail, and H3K27me3 modifying the other. 78 This study also revealed that PRC2 activity is inhibited on nucleosomes symmetrically modified by H3K4me3/H3K36me3. In Drosophila targeting of PRC complexes to genetic loci is mediated through the DNA binding protein PHO to polycomb response elements (PREs). There appear to be no mammalian orthologs of PRE bindi ng proteins, except YY1. T wo mammalian PRE like elements have been described more recently. 79, 80 In any case, mammalian PRC1/2 are generally targeted through more complex mechanisms, which include non coding RNAs 81, 82 unmethylated CpG islands 83 and sequence specific DNA binding proteins, like transcription factors. T he E2f6 Transcription Factor The E2F family of transcription factors are very well studied and recognized for t heir role in cell cycle regulation, a function they exert through binding to the retinoblastoma (Rb) tumor suppressor and the related pocket proteins. E2f6 was discovered over a decade ago as an addition to the E2F family, but investigators quickly

PAGE 37

37 realize d that it differs from other E2Fs. 84 86 Although E2f6 forms a heterodimer with DP1/2 capable of bin ding to DNA, it does so with a preference for the TCCCGC consensus sequence, which deviates from the canonical E2F site. 87 Furthermore, E2f6 lacks a Rb tumor suppressor binding domain and was therefore classified as a pocket protein independent transcriptional repressor. In addition, E2f6 is ubiquitously expressed throughout all phases of the cell cycle and can regulate some unusual E2F target genes. 87, 88 Interestingly, those are commonly expressed in germ cells. E2f6 null mouse embryonic fibroblasts (MEF) have no prolife ration defect, but aberrantly reactivate a number of genes, which include the subunits of the meiotic cohesin complex 88 the testis specific tubulin isoforms Tuba3 and Tuba7 87 and the gonadal ADP/ATP translocator located on the inner mitochondrial membrane, Slc25a31 ( Ant4) 89 Even more intriguing is the fact that E2f6 knockout mice, although grossly normal, exhibit mild hom eotic transformations of the axial skeleton, a hallmark phenot ype for PcG deficiencies. 90, 91 Indeed, E2F6 has been shown to interact with RYBP in the context of a BMI1 containing repressive complex and with EPC1 which itself associates with EZH2. 92, 93 In addition, an E2F6 complex has been described that 0 ) cells. 94 More recently, a PRC1 like 4 (PRC1L4) complex was also des cribed containing RING1, RING2, and L3MBTL2, in addition to E2F6. 95, 96 Adding to the complexity of E2f6 mediated gene regulation is the fact that this transcription factor is suggested to associate with Dnmt3b. 97 De novo methylation is particularly important during early embryonic development following waves of demethylation of the parental genomes in the zygote, and also during primordial germ

PAGE 38

38 cell (PGC) maturation where it is essential for the re establishment of proper imprinting patterns. 62, 98 Significance Cells of developing mammalian embryos gradually become restricted in their potency as they transition from a pluripotent to a terminally differentiated state. This occurs during cell lineage commitment following cell fate choices, which can be prompted by a variety of cues. 3 The molecular mecha nisms underlying cell fate determination are diverse, but they ultimately lead to the establishment of cell type specific gene expression programs. This ensures that gene products essential for a particular cell function will be expressed in the appropriat e lineages only, and silenced in all others. The same is also true for germline specific genes, which must be permanently repressed in somatic tissues. Failure to faithfully carry out this process and the aberrant activation of these genes can have severe consequences for the cell. 99 Although many observations have been made thus far regarding the role of E2f6 in repression of some germline genes, we still lack a detailed understanding of the mechanisms involved. Up to this point, the precise timing of repression establishment of this group of genes during development has also remained an open question. In addition, a clear demonstration of a murine PcG containing E2f6 complex that can target germ cell specific gene prom oters in the soma has also been lacking. We propose here that E2f6 might function together with enzymatically active Ezh2, in addition to a de novo DNA methyltransferase, to establish stable gene inactivation of Stag3 and Smc1

PAGE 39

39 CHAPTER 2 MATERIALS AND METHODS Cell Lines and Cell Culture Conditions R1 and J1 ESCs were maintained on dishes coated with 0.1% gelatin (EMD Millipore, ES 006 B) in KO DMEM (Life Technologies, 10829 018), containing 10% knock out serum replacement (KSR) (Life Technologies, 1 0828 028), 1% FCS (Atlanta Biologicals, S11550H), 25 mM HEPES (Corn ing Cellgro, 25 060 Cl), 100U/mL penicillin, 100g/mL streptomycin, 0.3 mg/mL L glutamine (Corning Cellgro, 30 009 Cl), monothioglycerol (Sig ma Aldrich, M6145), and 1000U/mL LIF (EMD Millipore, ESG1107). J1 ESCs constitutively overexpressing Dnmt3b were gene rated as described previously. 100 R1 ESCs constitutively overexpressing E2f6 were gen erated as described previously. 89 Dnmt3b / J1 ESCs are a gift from Dr. En Li as we described previously. 101 ESCs aggregation was promoted by hanging drop culture Approximately 2000 cells/ 25L drops were seeded on the lid of petri dishes. Embryoid body differentiation was carried out in IMDM media (Corning Cellgro, 10 016 CV) with 20% F CS, 100U/mL penicillin, 100g/mL streptomycin, and monothioglycerol. Two days after embryoid body f ormation the cell aggregates were collected and transferred to non adherent petri dishes. At Day 4 the aggregates were allowed to attach to gelatin coated culture dishes and grown until Day 10. MEFs were maintained in DMEM me dia, containing 15% FCS, 100U/ mL penicillin, and 100g/mL streptomycin. For the purpose of EpiSC culture MEF feeder cells were prepared by treating sub con fluent MEF cultures with 10g/mL Mitomycin C (Roche Diagnost ics, 107409) for 3 hours at 37 o C EpiSC cell clumps were transferred on to MEF feeders plated at 5x104 cell s /cm 2 and maintained in KO DMEM with 20%

PAGE 40

40 KSR, 5ng/mL mercaptoethanol (Life Technologies, 21985 023), 2mM L glutamine (Life Technologies, 25030 081) and non essential amino acids (Life Technologies, 11140 050). Colonies were passaged every 3 days using g entle dissociation with 1.5mg/mL Collagenase IV (Life Technologies, 17104 019). Ezh2 fl/fl induced pluripotent stem cells (iPSCs) 102 were generated by reprogramming of ROSA26:CreER MEF cells carrying a loxP flanked SET domain of Ezh2, and generously provided to us by Dr. Manuel Serrano. They were maintained in the ESC culture conditions described above. To obtain Ezh2 treated with 1M final concentration of 4 hydroxytamoxifen (Sigma Aldrich, H 7904) for 4 days. Three Ezh2 Genotypi ng PCR for Ezh2 fl/fl, Ezh2 PSCs, and Dnmt3b / ESCs Deletion of the SET domain of Ezh2 was confirmed by genotyping PCR. Genotyping PCR was carried out with 1.5U of Taq polymerase (5 PRIME, 2200010), with 320M dNTPs (Life Technologies, 10297 018) and 500nM oligonucleotides (Integrated DNA Technolog ies, Coralville, IA) using 200ng gDNA template. The following conditions were used: 15 min initial denaturation at 95 o C followe d by 40 cycles of 45 sec at 95 o C denaturation, annealing for 30 sec (Ta=58.7 o C for the wild type allele; Ta=62.6 o C for the mutan t allele ), extension for 1.5 min at 72 o C and final extension for 10 min. Deletion of the SET domain at the mRNA level was confirmed by RT PCR with 15ng cDNA and the following conditions: 1 min initial denaturation at 94 o C followe d by 30 cycles for 5 sec at 94 o C, annealing for 5 sec at Ta=55 o C and final extension for 10 min at 72 o C The oligonucleotides used for genotyping h ave been described previously. 103 For pri mer sequences see Table 2 1.

PAGE 41

41 Deletion of Dnmt3b at the mRNA level in Dnmt3b / J1 ESC was confirmed by RT PCR using primers that amplify exons 17 through 21, which code for the C terminal catalytic domain. The RT PCR was carried out with 1.5U of Taq polymerase, 500M dNTPs and 400nM oligonucleotides on 25ng cDNA template. The RT PCR conditions were as described above except for th e anneali ng temperature which was Ta=60 o C For primer seq uences see Table 2 1 Microarray Total RNA was extracted from ESCs, EpiSCs, and MEFs using RiboPure RNA Isolation Kit (Life Technologies, AM1924). Gene expression profiling was performed by Genus Biosystems, Northbrook, IL. Total RNA samples were quantified by UV spectrophotometry (OD260/ 280). The q uality and quantity of total RNA was assessed using an Agilent Bioanalyzer (Agilent Technologies, Palo Alto, CA). First and second strand cDNA was prepa red from the total RNA samples. cDNA was fragmented to uniform size and hybridized with Agilent Whole Genome 4x44K arrays. Slides were washed and scanned on an Agilent G2565 Microarray Scanner. Data was analyzed with Agilent Feature Extraction and GeneSpri ng GX v7.3.1 software packages. Intensity values were normalized to the median value of the array. The values given in Table 3 2 represent the normalized mRNA expression levels of select genes in ESCs, EpiSCs, and MEFs. Real T ime Quantitative RT PCR Total mRNA for gene expression analysis was extracted using the RNAqueous Kit (Life Technologies, AM1912). First strand cDNA was synthesized using High Capacity cDNA Reverse Transcription Kit (Life Technologies, 4368814) and the supplied random primers. The qPCR was carried out in 20L reactions/well on a 96 well

PAGE 42

42 plate (Bio Rad, MLL9601) using 2M of each respective primer pair (Integrated DNA Technologies), 2.5ng cDNA and 2x Power SYBR Green PCR Master mix (Life Technologies, 4367659). We used a DNA Engine Optic on 2 Thermo cycler (MJ Research Inc., Waltham, MA) and the data was analyzed with MJ Opticon Monitor analysis software 3.1 (Bio Actin. Relative quantification was performed fol lowing the C t Liva k method. Primer sequen ces are listed in Table 2 2 Bisulf i te DNA Sequencing Genomic DNA used for bisulfite conversion was extracted using the Wizard protocol. All DNA sequence s for primer design were obtained from the UCSC genome browser ( http:// genome.ucsc.edu ) Primer design (see Table 2 3 ) and CpG island (CGI) prediction were carried out using the MethPrimer software 104 ( http://www.urogene.org/cgi bin/methprimer/methprimer.cgi ). This software scores a DNA sequence as a CGI when it fulfills the following criteria: at least a 200bp sequence, with a G+C content >50% and an Obs/Exp CpG ratio >0. 6. Bisulfi te conversion was performed using the EZ DNA Methylation Gold Kit (Zymo Research, D5005). Up to 2g of genomic DNA was converted using the C1000 Thermal Cycler (Bio Rad) at 98 o C for 10 min, followed by 64 o C for 2.5 hrs. PCR products from bisulfite converted t emplates were gel purified with QIAquick Gel Extraction Kit (Qiagen, 28704), and cloned in the pCR2.1 vector using the TOPO TA Cloning Kit (Life Technologies, K4520 For blue white screening 10 20 whi te colonies were chosen for expansion in Luria Broth (Research Products International Corp., L24041 1000) liquid cultu re overnight

PAGE 43

43 containing 100g/mL ampicillin (Fi sher Scientific, BP1760) at 37 o C and 250rpm. Plasmid DNA was isolated using Qiaprep Spin Mi niprep Kit (Qiagen, 27106). Clones containing the insert of interest were subjected to automated DNA sequencing (DNA Sequencing facilities, Center for mammalian genetics, University of Florida) using M13 primers supplied with the TOPO TA Cloning Kit. Chrom atin Immunoprecipitation QPCR Approximately 5x10 6 cells were used per ChIP assay. Cells were cross linked using 1% formaldehyde (Sigma Aldrich, F8775) for 10 minutes at room temperature. The formaldehyde was quenched using 250mM glycine (Fisher Scientific, BP381 1) for 5 min. The cells were washed with 1X ice cold PBS, containing 137mM NaCl (Fisher Scientific, BP3581), 2.7mM KCl ( Sigma Aldrich, P 9333), 10mM Na 2 HPO4 (Si gma Aldrich, S 7907) and 2mM KH 2 PO4 (Sigma Aldrich, P 9791) and collected by scraping in 1mL ice cold PBS with protease inhibitor cocktail (PIC) (Sigma Aldrich, P 8340) followed by centrifugation. The cell pellets were resuspended in lysis buffer containing: 5mM PIPES pH8.0 (Sigma Aldrich, P 6757), 85mM KCl and 0.5% NP 40 (USB Corporation, 196 28) and incubated on ice for 10 min. The cell nuclei were pell eted at 5000rpm for 5 min at 4 o C and resuspended in nuclei lysis buffer containing: 50mM Tris HCl pH8.1 (Fisher scientific, BP152 1), 10mM EDTA (Fisher Scientific, BP120) and 1% SDS (Sigma Aldr ich, L4509). The chromatin was sheared using a Sonic Dismembrator 100 (Fisher scientific) at power setting 4. Each burst was 10 sec, followed by a one min ute rest on ice. The number of bursts required to generate average chromatin fragments between 200 700 bp was optimized for each cell type. The chromatin was diluted in buffer containing: 167mM NaCl, 16.7mM Tris HCl pH8.2, 1.2mM EDTA, 1.1% Triton X 100 (Sigma Aldrich, T 9284), 0.01% SDS. The diluted chromatin was then pre

PAGE 44

44 cleared with blocked recombinant Pr otein G Sepharose 4B conjugate beads (Life Technolo gies, 10 1241) for 20 min at 4 o C Some of this chromatin was set aside and used later as Input. The chro matin equivalent of around 5x10 6 cells was then incubated overnight with 2g of each antibody (except for the H3K27me3 CHIP where 4g of both H3K27me3 antibodies were used) The antibodies used in this study E2f6 polyclonal rabbit antibody (a generous gift from Dr. Stefan Gaubatz); H3 (Abcam, ab1791) H3K4me3 (EMD Millipore, 07 4 73), and H3K27me3 (EMD Millipore, 17 622) On the next day antigen antibody complexes were pulled down with Protein G Sepharose beads for 1 hr at 4 o C The beads were collected and washed 7 times with wash buffer containing: 250mM LiCl (Sigma Aldrich, L 4 408), 10mM Tris HCl pH8.0, 1mM EDTA, 0.5% DOC (Fisher Scientific, BP349), and 0.5 % NP 40. The chromatin was eluted from the beads using elution buffer containing: 50mM Tris HCl pH8.0, 10mM EDTA, 1% SDS. The covalent cross linking was reversed by incubating the chromatin w ith 200mM NaCl overnight at 65 o C The DNA was then extracted using phenol/chloroform/isoamylalcohol (Sigma Aldrich, P 2069) and purified using QIAquick PCR Purification Kit (Qiagen, 28106). This DNA was then subjected to qPCR. For qPCR the Input DNA was diluted 1:50 and the IP DNA samples 1:5, which was accounted for during quantification. Six primer pairs (Integrated DNA Technologies) spanning 5kb of the Stag3 gene (from 2.5kb to +3kb around the transcription start site) were designed using Primer3 primer design software ( http://frodo.wi.mit.edu/ ; also see Table 2 4 ). Primers for ChIP Actin can also be found in Table 2 4.

PAGE 45

45 Table 2 1. Genotyping RT PCR and PCR primers Gene of int erest Primer sequence Dnmt3b (RT PCR) F: CTGTTTGATGGAATTGCAACGG R: TGAGCAGCAGACACCTTGATG Ezh2 SET (RT PCR ) Ezh2 delete 5 2: AACACCAAACAGTGTCCATGCTAC Ezh2 delete 3 2: CTAAGGCAGCTGTTTCAGAGAGAA Ezh2 SET (PCR ) : CTGCTCTGAATGGCAACTCC Ezh2 left 5 LoxP: ACGAAACAGCTCCAGATTCAGGG Table 2 2 Quantitative real time PCR primers Gene of interest Primer sequence Stag3 F: AGAGTCTGACGGCCAAAGAA R: GAGAACTTGGCAAGGAGCTG Smc1 F: CATGGTGAAGCAAGAGCAAA R: CAAAACCTTCTTGCGTTCCT Slc25a31 F: ATGATGCAGAGTGGGGAATC R: ACGGAAGAAGGCAGGAACTC Tuba3 F: GCTTCCTCATCTTCCACAGA R: CTCCAGCTTGGACTTCTTGC E2f6 F: CAGGATATTCACGGCATTCA R: TTCTCTGGGAGCTGGAACAT Dnmt3b F: CGCCACCATGTGCAGGAGTAC R: GACGCTCTTAGGTGTCACTTCTTCC Table 2 3 Forward and re verse primers used for bisulfi te sequencing Gene of interest Primer sequence Stag3 F: TAGGATTGTATAGTTATATGTTTGG R: TCAAAAATCCTTTCAAATCTCAATAA Smc1 US F: TAAAAGTTTGAGAGTAAGTTT R: ACAACTCAAAATACCCCATAACTAC Smc1 DS F: AGTTATGGGGTATTTTGAGTTGTTG R: AAAAACCCTTAATCTAACATAAAACCC Slc25a31 F: TTGTTGTGTATTGATTGAGT ATG R: AAAAAAAACTAAAAAAC Tuba3 F: TGTGTAGGGTTGTTAGGGTATTTTT R: TTAAACTCCACATCCCACTAATAATTAA

PAGE 46

46 Table 2 4 Chr omatin immunoprecipitation real time PCR primers Gene of interest Primer sequence Stag3 TSS F: GCTTATCCCGTGCCTTCC R: CAGTGGACATCCCACCTC Stag3 2.5kb F: CCAAGTCAGAGAAGGCCAAG R: CAACCTCCGACCCTTAGTGA Stag3 1.5kb F: AAGAGCCACTGTCCTCTACCAG R: AGGTGAGCACCTTCAAGTCTGT Stag3 +1kb F: CACTAAGTTGCTCAGGCTACAGG R: ACCTGAAACTAGGAGTGATGCTG Stag3 +2kb F: ACTCTTTATGTGGCAGGAATGG R: CAGACTCACTGGAACAGCTTTG Stag3 +3kb Smc1 TSS Slc25a31 TSS Gata6 TSS Hoxa11 TSS b Actin TSS F: CCACAGTATCAGGCTTAGAATGG R: CAGACTAGCTGAAAGACCACAGG F: GCTCGTGGAGAATTTCAAGTCG R: GATTTCTGGGGCGCTGGTTAC F: CTGTTCTCCCAGCATCCTCAG R: CGTTCGACATGTTGGACAGAG F: ATTGTAGGGACTCCGAGGTT R: AGAAGTTTCTCTGCCCACTGG F: ATGTTAAGCTCGGCTACTGC R: GACCCGAGACGTAGTAAGTACA F: CCGAAAGTTGCCTTTTATGG R: AAGGAGCTGCAAAGAAGCTG

PAGE 47

47 CHAPTER 3 RESULTS E2f6 D is ruption R esults in the L oss of DNA methylation at the Tuba3 and Slc25a31 genes Previous studies demonstrate that E2f6 is required for gene silencing of four meiotic genes ( ) in somatic tissues. In order to investigate whether this is accompanied by DNA methylation we performed bisulfite sequencing analysis of their promoter regions comparing wild type MEFs with MEFs isolated from E2f6 knockout mice. As summarized in Table 3 1, the Stag3 Smc1 and Slc25a31 genes have prom oters with high CpG content and strong CGIs. However, the Tuba3 promoter although GC rich, has a lower CpG count, and consequently, a weak CGI. When we examined methylation of CpGs surrounding the E2f6 bindi ng site in wild type MEFs, hypermethylation was found mostly downstream of it in In contrast, DNA methylation was present at all CpG sites investigated in Tuba3 and Slc25a31 The Stag3 and promoters were alm ost completely devoid of m ethylation in E2f6 null MEFs (Fig.3 2A and 2C ) However, deletion of E2f6 only partially affected methylation at the Tuba3 and Slc25a31 promoters (Fig.3 3A, 3C) The overall methylation level of the Tuba3 p romoter decreased from 99% in wild type MEFs to 42 % in E2f6 / MEFs. The change in methylation of the Slc25a31 p romoter was even less dramatic, decreasing from 96.2% to 76.8%. This indicates that, although E2f6 plays a role in establishing DNA methylation, the levels of its requirement among these genes a re different.

PAGE 48

48 E2f6 Target Genes are F irst Silenced in EpiSCs, a Model for the Post implantation E piblast To shed light on E2f6 mediated germ cell specific gene repression during development we investigated gene expression patterns in two mouse pluripotent stem cell types, ESCs and EpiSCs, and in the terminally differentiated MEFs. We chose to look at ESCs and EpiSCs as representing the two different stages in development from which these stem cells are derived, the pre implantation and post implantation ep iblast, respectively. MEFs represent somatic tissues (see Figure 3 1) To validate the quality and differentiation stages of the cells used in this study, we initially performed a microarray analysis. Markers for the nave pluripotency state like Zfp42 (Re x1) were highly expressed in ESCs, as was Klf4, which then becomes down regulated in EpiSCs. Pluripotency markers like Pou5f1 (Oct4) and Nanog were highly expressed both in ESCs and EpiSCs, and downregulated in MEFs. Fgf5, a marker for the poised pluripote ncy state, was upregulated in EpiSCs, similarly to Dnmt3b, which is a known marker for the post implantation epiblast. As expected, MEFs upregulate Col11a, which appreciable express ion in ESCs; whereas Slc25a31 is at nearly background levels (see microarray data in Table 3 2). To confirm the expression patterns of E2f6 and the germline genes we used quantitative RT PCR. As we expected based on the microarray data, all four genes are expressed albeit to a differ en t extent in nave ESCs (Fig. 3 4 A). However, all four are completely silenced in the primed EpiSCs, coinciding with a 2.5 fold increase of E2f6 mRNA. Using Stag3 as a model for a gene regulated by E2f6 we observed that the Sta g3 transcription start site (TSS) in ESCs was enriched for H3K4me3, a histone mark

PAGE 49

49 associated w it h active transcription (Fig. 3 4 B). This activation mark was lost in EpiSCs and MEFs. We also found that E2f6 was associated with the Stag3 promoter i n all three cell types (Fig. 3 4 C). Notably, E2f6 was recruited even in ESCs, while this gene is still being actively transcribed. This suggests that E2f6 occupancy at the Stag3 promoter is not sufficient to silence the gene. De novo DNA Methylation Patterns of E2f6 Target Gene Promoters are F irst S et in EpiSCs We next demonstrate establishment of DNA methylation during development again using the Stag3 promoter as an example. In agreement with our gene expression data we observed that the Stag3 promoter region (from 138bp to +73bp relative to the TSS) is nearly completely unmethylated in ESCs (with 1.7% overall methylation), and increasingly methylated in EpiSCs and MEFs, at 19.5% and 34%, respectively (Fig. 3 5 A and 5 B ). This observation was also confirmed for methylation at the upstream promoter region ( 179bp/+14bp) and 5.9% at the downstream exonic region (+44bp/+332bp) in ESCs. Methylation of both regions increased in EpiSCs to 62.2% and 92.4%, respectively. In MEFs overall methylat ion of these regions decreases to 19.7% and 53.5%, respectively, independent of t ra nscriptional silencing (Fig. 3 5C and 5 D ). In addition, we also observe that the Stag3 promoter is unmethylated in E13.5 PGC and iPSCs (Fig. 3 6 ). Thus, this promoter underg oes DNA demethylation during both in vivo and in vitro reprogramming. Taken together these data indicate that E2f6 mediated DNA methylation and gene repression likely occur during the transition from ground to primed state of pluripotency, in a reprogramma ble manner

PAGE 50

50 Interestingly, the Tuba3 and Slc25a31 genes have a different pattern of DNA methyla tion with their promoters hypermethylated even in ESCs. The promoter region of Tuba3 under investigation in ESCs exhibits 50% meth ylation in (Figure 3 7A and 7 B) while Slc25a31 is nearly completely methylat ed 88.7% methylation (Figure 3 7C and 7 D). Taken together these results again point to differential mechanisms of regulation that exist between the Stag3 Tuba3 and Slc25a31 genes Over expres sion of E2 f6 or Dnmt3b in ESCs does n ot Induce Premature Silencing of E2f6 Target G enes Since we observed an increase in E2f6 expression in EpiSCs, the upregulation of this transcription factor protein might underlay silencing of the target genes. To test this hypo thesis, we over expressed E2f6 in ESCs to the level seen in EpiSCs (approximately 2.5 fold increase). However, stable over expression of E2f6 did not repress any o f the genes investigated (Fig. 3 8 A). Moreover, we did not observe an increase in DNA methylation at t he Stag3 gene promoter (Fig. 3 8 B). To ensure that ectopically over expressed E2f6 can be recruited to DNA we also confirmed that it was enriched at the Stag3 promoter by ChIP (Figure 3 8 C). These data indicate that E2f6 over expression alo ne cannot induce premature silencing of E2f6 target genes in ground state ESCs. Previously, Dnmt3b has been shown to be essential for re pression of E2f6 target genes. 97 From our microarray we observed that expression of Dnmt3b is increased 2 fold in EpiSCs relative to ESCs. We used the same rationale as above and utilize d a Dnmt3b over expressing J1 ESC line described previously with an approximately 4.5 fold increase in Dnmt3b expression. 100 Again, we did not observe gene inactivation in

PAGE 51

51 comparison to the control J1 ESCs (Fig. 3 9 A ). We note that there was a small increase in Stag3 promoter DNA methylation from 2.3% to 9.7%, but this was not suffici e nt to si lence the gene (Fig. 3 9 B ). Taken together we conclude that: 1) over expression of E2f6 or Dnmt3b alone cannot establish gene repression in ground state ESCs; 2) additional co regulator(s) are likely required for initiation and establishment of gene silenc ing. Ezh2 is Required for the genes While Dnmt3b may be D ispensable To investigate the requirement of Ezh2 and Dnmt3b for the silencing of Stag3 established and routinely employed approach for plurip otent cell differentiation, namely embryoid bodies. Embryoid bodies are complex structures, which faithfully recapitulate the early stages of mammalian embryonic development (Fig.3 10A and 10B). Silencing of developmentally regulated genes by polycomb repressive complexes is often initiated by PRC2, which then modifies the chromatin and provides a binding platform for PRC1. Enhancer of Zeste homolog 2 (Ezh2) is a core subunit of the PRC2 complex, and it is the enzymatic activity of this protein that is responsible for trimethylation of histone H3 at lysine 27 (H3K27me3). In order to investigate whether PRC2 is r eq uired for the silencing of the E2f6 target genes under investigation here we used ground state induced pluripotent stem cells 102 in which we can conditionally delete exons of the SET domain of Ezh2 (Fig. 3 11 A). 103 We designated them Ezh2 fl/fl iPSCs. These Ezh2 fl/fl iPSCs and the Ezh2 OHT treatment were subjected t o embryoid body differentiation. All four genes are expected to be down regulated during this transition from pluripotent iPSCs to the heterogeneous

PAGE 52

52 culture containing a variety of somatic cell types that is the embryoid body. Indeed, the enes were efficiently silenced after 10 days of differentiatio n of the Ezh2 fl/fl iPSCs (Fig. 3 11 transcriptionally active, suggesting that these genes require Ezh2 for their repression. In contrast, Tub a3 and Slc25a31 show no dependency on Ezh2 for their silencing (Fig.3 11D). it was hypomethylated in both the wild type and mutant iPSCs at the onset of differentiation (Day 0), which correlates with transcriptional activity from this promoter. Following ten days of differentiation it acquires the 5meC mark in the Ezh2 but decreased when compared to the Ezh2 fl/fl iPSCs (Fig. 3 1 2A and 12 C) The overall methylation of the do during differentiation from 5.5% to 61.3% in Ezh2 fl/fl, and from 2.6% to 29.7% i n Ezh2 We also performed bisulfite sequencing for the Stag3 promoter and observed simil ar results (Fig. 3 13 ) To confirm tha t H3K27me3 is indeed required for transcriptional silencing of E2f6 target genes we performed ChIP qPCR on Day 0 and Day 10 embryoid bodies prepared from Ezh2 fl/fl and Ezh2 and Slc25a31. We used Gata6 and Hoxa11 as Actin as a fl/fl show Actin. Furthermore, the enrichment is comparable to what is obse rved at the Gata6 TSS (Fig. 3 14A). In contrast, H3K27me3 is lost and Sl c25a31 TSS in

PAGE 53

53 Ezh2 g. 3 14 B). Howev er, some residual H3K27me3 is still observed at the Gata6 and Hoxa11 loci. Further experimentation will be required to overcome any technical difficulties and unequivocally confirm the enrichment of this histone modification at E2f6 target gene promoters. In addition, it will be especially interesting to observe the dynamics of H3K4me3 and H3K27me3 at these promoters during embryoid body differentiation of Ezh2 fl/fl iPSCs. A previous report demonstrated that a hypomorphic mutation of Dnmt3b led to de repression of meiotic genes in somatic tissues, some of which overlap with the target genes of E2f6. 97 To further shed light on the role of Dnmt3b in E2f6 mediated gene repression, here we investigated gene repression and DNA methylation during in vitro differentiation of Dnmt3b knockout J1 ESCs (Fig. 3 11 B). I f Dnmt3b mediated DNA / ESCs would be deficient in silencing of these genes upon cell differentiation. Surprisingly, both genes were down regulated following embryoid body diff erentiation (Fig. 3 11 C). Importantly, this was accompanied by a partial increase in overall methylation at the downstream 32bp) from 13% to 35.5% (Fig. 3 15 ). This suggests that Dnmt3b is not indispensable for establishing gene repress ion and DNA methylation of these meiotic genes. Interestingly, Tuba3 and Slc25a31 are also down regulated during EB differentiation of Dnmt3b knockout ESCs (Fig.3 11D). Taken together the data presented above serve to establish the following model for E2f6 promoter of these genes is not sufficient to trigger their silencing. However, through direct or indirect mechanisms of interaction E2f6 can facilitate the recruitment of a

PAGE 54

54 PRC2 or PRC2 like repressive complex with an Ezh2 subunit. The binding of PRC2 to the promoters and the H3K27me3 mark associated with it will lead to down regulation of de novo DNA methylation mediated by Dnmt3b or Dnmt3a Deletion of the SET domain from Ezh2 abolishes its function at these promoters and removes the block to transcription. Consequently, these genes are aberrantly re expressed in differentiated cells (see Figure 3 16).

PAGE 55

55 Tabl e 3 1. CGI classification according to the more stringent Takai and Jones criteria 63 Gene Regi on G+C% No. CpGs Obs./Exp. CGI class Stag3 389/+111 61.6 44 0.94 strong Smc1 204/+416 62.3 48 0.81 strong Tuba3 356/+249 64.5 33 0.53 weak Slc25a31 128/+372 61.4 41 0.87 strong Table 3 2. Gene microarray G ene ESCs EpiSCs MEFs Description Stag3 2.72 0.07 0.12 Stromal antigen 3 1.37 0.05 0.02 Structural maintenance of chromosomes 1B Tuba3 9.68 0.06 0.01 Tubulin alpha, 3A Slc25a31 0.33 0.01 0.01 Solute carrier family 25, member 31 E2f6 1.92 5.03 5.00 E2F transcription factor 6 Dp1 12.21 11.82 7.67 Transcription factor Dp1 Dp2 1.45 1.01 0.61 Transcription factor Dp2 Ezh1 0.27 0.15 0.19 Enhancer of Zeste homolog 1 Ezh2 3.77 3.79 0.97 Enhancer of Zeste homolog 2 Suz12 10.64 4.53 1.89 Suppressor of Zeste 12 homolog Eed 4.29 3.13 1.52 Embryonic ectoderm development Dnmt1 7.78 8.03 3.95 DNA methyltransferase 1 Dnmt3a 3.15 5.87 0.13 DNA methyltransferase 3A Dnmt3b 7.25 14.83 0.15 DNA methyltransferase 3B Dnmt3L 45.07 5.48 0.04 DNA methyltransferase 3 like Pou5f1 26.38 59.76 0.01 POU domain class 5, transcription factor 1 Nanog 9.47 6.62 0.03 Nanog homeobox Sox2 6.52 4.11 0.04 SRY box containing gene 2 Klf4 32.37 2.21 13.68 Kruppel like factor 4 Zfp42 50.81 0.89 0.01 Zinc finger protein 42 Fgf5 0.04 3.33 0.04 Fibroblast growth factor 5 Col11a 0.09 0.07 0.32 Pro collagen, type XI, alpha

PAGE 56

56 Figure 3 1. Embryonic tissues and their in vitro derivatives. The ICM cells of the pre implantation blastocyst (E3.5) serve as the source of ESCs. The epiblast cells of the post implantation egg cylinder (E5.5) serve as the source of EpiSCs. The E14 embryo is the source of MEFs. Black: trophectoderm layer of outer cells; white: epiblast cells of the ICM or early egg cylinder, gray: primitive endoderm c ells of the ICM or ex t r a embryonic endoderm of the egg cylinder

PAGE 57

57 Figure 3 2 Deletion of E2f6 disrupts somatic cell CGI methylation at E2f6 dependent Stag3 and germline specific gene promoters. A,C Bisulfite DNA sequencing analysis for CGI methylation of the Stag3 promoters, respectively in wild type and E2f6 / MEFs. Percent methylation for the region amplified by the primers is given in parenthesis. B, D Quantification of bisulfite sequencing data demonstrating the dynamics of methylation at each indivi dual CpG dinucleotide in respectively. A value of one corresponds to 100% methylation. designates the position of E2f6 binding; +1 designates the TSS.

PAGE 58

58 Figure 3 3 Deletion of E2f6 disrupts somatic cell CGI me thylation at E2f6 dependent Tuba3 and Slc25a31 germline specific gene promoters. A C Bisulfite DNA sequencing analysis for CGI methylation of the Tuba3 and Slc25a31 promoters, respectively in wild type and E2f6 / MEFs. Percent methylation for the region amplified by the primers is given in parenthesis. B, D Quantification of bisulfite sequencing data demonstrating the dynamics of methylation at each individual CpG dinucleotide in Tuba3 and Slc25a31 promoters, respectively. A value of one corresponds to 100% methylation. designates the position of E2f6 binding; +1 designates the TSS.

PAGE 59

59 Figure 3 4 Germline specific genes regulated by E2f6 are first silenced in primed pluripotent stem cells. A. RNA expression levels of Slc25a31 in ESCs, EpiSCs, and MEFs shown by qPCR. The expression of each gene in embryonic stem cells was set to a value of one. B. ChIP qPCR analysis for H3K4me3 enrichment spanning 2.5kb downstream and 3kb upstream (relative to the TSS) of the Stag3 promoter in ESCs, EpiSCs and MEFs. Enrichment is shown normalized to the total H3 content at each specific primer pair position. C. ChIP qPCR analysis for enrichment of E2f6 at the Stag3 promoter in ESCs, EpiSCs and MEFs. Enrichment is shown as the percent of Input DN A.

PAGE 60

60 Figure 3 5 Differential DNA methylation of the promoters in ESCs, EpiSCs and MEFs. A, B. CGI methylation of the Stag3 promoter in ESCs, EpiSCs and MEFs. C, D. CGI methylation of the promoter in ESCs, EpiSCs and MEFs. designates the position of E2f6 binding site; +1 designates the TSS.

PAGE 61

61 Figure 3 6 DNA demethylation of the Stag3 promoter during in vitro and in vivo reprogramming. Bisulfite DNA sequencing analysis of CGI methylation of the Stag3 promoter in E13.5 p rimor dial germ cells (PGC ) and induced pluripotent stem cells (iPS)

PAGE 62

62 Figure 3 7 DNA methylation of the Tuba3 and Slc25a31 promoters in ESCs, EpiSCs and MEFs A, B. CGI methylation of the Tuba3 promoter in ESCs, EpiSCs and MEFs. C, D. CGI methylation of the Slc25a31 promoter in ESCs, EpiSCs and MEFs. designates the position of E2f6 binding site; +1 designates the TSS

PAGE 63

63 Figure 3 8 The effects of E2f6 over expression on RNA expression and DNA methylation of meiotic genes in ESCs. A. qPCR analysis of and E2f6 RNA expression in ESCs with or without stable over expression of E2f6. B. Bisulfite DNA sequencing analysis of the Stag3 promoter in ESCs with or without stable over expression of E2f6. C. ChIP qPCR analysis for E2f6 occ upancy at the Stag3 promoter in ESCs ectopically over expressing FLAG tagged E2f6.

PAGE 64

64 Figure 3 9 The effects of Dnmt3b over expression on RNA expression and DNA methylation of meiotic genes in ESCs. A. RNA expression levels of Stag3, E2f6 and Dnmt3b in ESCs with or without stable over expression of Dnmt3b. B. Bisulfite DNA sequencing analysis for methylation of the Stag3 promoter in ESCs with or without stable over expression of Dnmt3b.

PAGE 65

65 Figure 3 1 0 Preparation of embryoid bodies using the classic hanging drop method ( A ), or AggreWell 400 plate (STEMCELL Technologies, 27845) for increased EB yield ( B ).

PAGE 66

66 Figure 3 11 Germline specific gene expression levels durin g embryoid body differentiation of wild type, Ezh2 deficien t and Dnmt3b deficient pluripotent stem cells. A. Confirmation of Ezh2 fl/fl and Ezh2 / g enotype using PCR and RT PCR, upper and lower panel respectively. The amplicons for the flox and (for cDNA PCR), respectively. B. Confirmation of the Dnmt3b / genotype. The amplicon for the wild type allele for cDNA PCR is 452bp. C. q PCR analysis of RNA expres sion during EB differentiation of Ezh2 fl/fl iPSCs, Ezh2 / iPSCs and Dnmt3b / ESCs at Day 0 and Day 10. The expression of each gene at Day0 was set to a value of 1 D. q PCR analysis of Tuba3 and Slc25a31 RNA expression during EB differentiation of Ezh2 fl/ fl iPSCs, Ezh2 / iPSCs and Dnmt3b / ESCs at Day 0 and Day 10. The expression of each gene at Day 0 was set to a value of 1

PAGE 67

67 Figure 3 12 DNA methylation of gene during embryoid bo dy differentiation of wild type and Ezh2 deficient pluripotent stem cells CGI methylation of the downstream region of the promoter was measured using bisulfite sequencing from the sample of Day 0 and Day 10 following EB differentiation of Ezh2 fl/fl ( A ,B ), Ezh2 / iPSCs ( C,D ).

PAGE 68

68 Figure 3 13 DNA methylation of Stag3 gene during embryoid body differentiation of wild type, Ezh2 deficient pluripotent stem cells CGI methylation of the downstream region of the Stag3 promoter was measured using bisulfite sequencing from the sample of Day 0 and Day 10 following EB differentiation of Ezh2 fl/fl ( A ,B ), Ezh2 / iPSCs ( C,D ).

PAGE 69

69 Figure 3 14. CHIP qPCR for enrichment of H3K27m e3 at the TSS of select genes during Day 0 and Day 10 following EB differentiation of Ezh2 fl/fl iPSCs ( A ), and Ezh2 / iPSCs ( B ). Enrichment of H3K27me3 is normalized by the H3 content at the TSS site.

PAGE 70

70 Figure 3 15 DNA methylation of gene during embryoid body differentiation of Dnmt3b deficient pluripotent stem cells. CGI methylation o f the downstream region of was measured using bisulfite sequencing from the sample of Day 0 and Day 10 following EB differentiation of Dnmt3b / ESCs

PAGE 71

71 Figure 3 16 Model for E2f6 mediated repression of Stag3 and Smc1 genes. Binding of the E2f6/Dp1 heterodimer at its consensus binding site within the promoter of Stag3 or Smc1 recruits a PRC2 complex with an enzymatically active Ezh2 core subunit. This results in transcriptional down regulation and coincides with the setting of the H3K27me3 mark (green popsicle s ). Dnmt3b is rec ruited in conjunction, or independently, with PRC2 and stabilizes the repressed state by de novo DNA methylation (black popsicles). Deletion of the SET domain of Ezh2 destabilizes the PRC2 complex and, most likely, the Ezh2 protein itself (dashed lines). T his relieves the block to transcription and leads to a partial loss of DNA methylation at the promoter CGI (white popsicles).

PAGE 72

72 CHAPTER 4 DISCUSSION Epigenetic mechanisms of gene regulation are fundamental for the establishment and maintenance of the cell type specific gene expression programs that are first set up during the early stages of mammalian embryonic development. The phenotypic outcomes of chromatin modifications and their inheritance through consecutive cell divisions depend on the concert Through their action functional domains like euchromatin and heterochromatin can be established. One potential route for targeting of chromatin modifiers to gene regulatory regions is recruitment th rough sequence specific DNA binding molecules, such as transcription factors. The E2f6 transcription factor binds to the proximal promoters of a the germline and inevitabl y get shut down in somatic tissues during development. We demonstrate here that E2f6 dependent germline gene promoters are first silenced and targeted for de novo methylation in EpiSCs (i.e the post implantation epiblast). Temporally, this corresponds to the transition from ground to primed state pluripotency. During this transition the open, transcriptionally permissive chromatin of early epiblast cells is progressively compacted. Gene silencing and heterochromatinization can be achieved through the loss of activation associated histone marks (e.g H3K4me3), and gradual accumulation of DNA methylation, as we dense CGIs is often incompatible with transcription from the associated promoters. Our findings here are in agreement with a recent study, which demonstrated that de novo

PAGE 73

73 methylation of the E6.5 epiblast tissue is mainly targeted to genes expressed in th e germline. 59 Importantly, methylation of the Stag3 promoter is reversible during reprogramming in vivo to PGCs and in vitro to iPSCs. That deletion of E2f6 results in aberrant reactivation of a group of germline genes has been demonstrated previously. Here, we can correlate this transcriptional reactivation with a loss of DNA methylation. Indeed, in the absence of E2f6 the Stag3, de novo methylatio n. This observation is in agreement with a recent report that binding of Dnmt3b to the proximal promoters of Maelstrom, Syce1, and Tex11, in addition to Slc25a31 was lost upon deletion of E2f6 in MEF cells. 97 Thus, it is plausible that E2f6 occupancy at germline gene promoters is essential for Dnmt3b mediated DNA methyla tion. However, according to our data stable overexpression of Dnmt3b in ESCs is not sufficient to completely silence these genes, irrespective of an increase in Stag3 promoter methylation. Moreover, overexpression of E2f6 and its binding to the Stag3 promo ter is not sufficient to induce gene silencing or promoter methylation in ESCs. Importantly, the aforementioned study did not report bisulfite DNA sequencing for Slc25a31 in E2f6 / MEFs. According to our data, this promoter retains its hypermethylated sta te in E2f6 / MEFs, albeit with partial loss of the 5meC mark. Consequently, although a physical association between E2f6 and Dnmt3b was proposed, 97 we suggest that E2f6 is unlikely to be the sole requirement for establishment of DNA methylation. In addition, our data underscore the importance of clarifying whether these genes are methylated only by Dnmt3b, or if Dnmt3a can also participate. One hint that Dnmt3b might not be the only methyltransferase involved

PAGE 74

74 came from our embryoid body differentiation of Dnmt3b / ESCs. Expression of Stag3 differentiation, despite the absence of Dnmt3b mediated methyltransferase activity. Our data suggest that additional regulators may play a role in the silencing of ct with the PRC2 complex through associations with EZH2, EED, and perhaps SUZ12. 105 The interactions between DNMT and EZH2 are characterized the best and involve the N terminal portion of EZH2. Binding of EZH2 to its target promoters and the as sociated H3K27me3 modification occur upstream of DNA methylation because DNMTs dissociate from EZH2 depleted promoters. So, we would expect PRC2 activity to be essential for initiation of repression, while DNA methylation stabilizes the repressed state. In addition, the presence of non functional PRC2 complexes (e. g. with mutated Ezh2 subunits) should result in a defect in repression initiation. Accordingly, we observe here the sustained transcriptional activity iPSCs can efficiently silence these genes. This suggests that H3K27me3 is essential for initiation of repression at these promoters. A recent study looking at the interaction between the PRC and DNA methylation re pressive machineries found that targeting of a Gal4DBD EZH2 fusion protein to a Gal4 binding site array in MEL cells can lead to the recruitment of Bmi1 and Suz12, a nd an increase in H3K27me3. 106 However, it only resulted in the recruitment of Dnmt3a, which importantly, was not accompanied by de novo deposition of the 5meC m ark. Unfortunately, no definitive results could be obtained for Dnmt3b. Of note, a similar system using GAL4 EZH2 targeted to a GAL4TK Luciferase construct was capable of silencing the reporter independently of the

PAGE 75

75 SET enzymatic activity wh was employed. 107 The fact that Stag3 and that H3K27me3 is indeed required for initiation of repression of these genes. We have attempted to describe here, in further detail, the molecular mechanisms of E2f6 mediated germline gene regulation. Surprisingly, we observe that differe ntial mechanisms govern silencing of these genes in the soma. We point out that the methylation changes we observe upon deletion of E2f6 vary depending on gene decrease ( Slc25a31). It is possible that additional mechanisms exist to safeguard Slc25a31 promoter methylation. Accordingly, it was recently described that silencing of this gene is mainly DNA methylation dependent. This was observed in a study aimed at identifying genes that are permanently upregulated after a prolonged recovery period following 5aza dC treatment of somatic cells. 108 In addition, Ezh2 activity is dispensable SCs The discovery that deletion of E2f6 in somatic cells can deregulate genes with functions in the germline, and that a conserve d E2f6 binding element exists in the proximal promoters o f murine meiosis specific genes 89 put forth the idea that E2f6 might serve as r, E2f6 mediated regulation of these genes appears to be more nuanced than we initially anticipated. It seems likely that within the larger group of testis specific, germline genes additional subgroups exist and that the mechanisms of E2f6 mediated repress ion are complex and dependent upon the gene context. It is probable that genes with similar

PAGE 76

76 complex, are regulated through mechanisms that are more closely related than functional ly distant genes.

PAGE 77

77 LIST OF REFERENCES 1. Albert M, Peters AH. Genetic and epigenetic control of early mouse development. Curr Opin Genet Dev 2009;19:113 121. 2. Gilbert S. Developmental biology Sunderland, MA: Sinauer Associates, Inc.; 2000. 3. Stephenson RO, Rossant J, Tam PP. Intercellular interactions, position, and polarity in establishing blastocyst cell lineages and embryonic axes. Cold Spring Harb Perspect Biol 2012;4. 4. Cockburn K, Rossant J. Making the blastocyst: lesso ns from the mouse. J Clin Invest 2010;120:995 1003. 5. Bruce AW, Zernicka Goetz M. Developmental control of the early mammalian embryo: competition among heterogeneous cells that biases cell fate. Curr Opin Genet Dev 2010;20:485 491. 6. Pesce M, Anastassiadis K, Schler HR. Oct 4: lessons of totipotency from embryonic stem cells. Cells Tissues Organs 1999;165:144 152. 7. Chambers I, Colby D, Robertson M, et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643 655. 8. Schler HR, Hatzopoulos AK, Balling R, et al. A family of octamer specific proteins present during mouse embryogenesis: evidence for germline specific expression of an Oct factor. EMBO J 1989;8:2543 2550. 9. Nichols J, Zevnik B, Anastassiadis K, et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998;95:379 391. 10. Gubbay J, Collignon J, Koopman P, et al. A gene mapping to the sex determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 1990;346:245 250. 11. Chambers I, Tomlinson SR. The transcriptional foundation of pluripotency. Development 2009;136:2311 2322. 12. Remnyi A, Lins K, Nissen LJ, et al. Crystal structure of a POU/HMG/DNA ternary complex suggests differential assembly of Oct4 and Sox2 on two enhancers. Genes Dev 2003;17:2048 2059. 13. Mitsui K, Tokuzawa Y, Itoh H, et al. The homeoprotein Nanog is required for maintenance of pl uripotency in mouse epiblast and ES cells. Cell 2003;113:631 642.

PAGE 78

78 14. Messerschmidt DM, Kemler R. Nanog is required for primitive endoderm formation through a non cell autonomous mechanism. Dev Biol 2010;344:129 137. 15. Silva J, Nichols J, Theunissen TW et al. Nanog is the gateway to the pluripotent ground state. Cell 2009;138:722 737. 16. Frankenberg S, Gerbe F, Bessonnard S, et al. Primitive endoderm differentiates via a three step mechanism involving Nanog and RTK signaling. Dev Cell 2011;21:1005 1 013. 17. Feldman B, Poueymirou W, Papaioannou VE, et al. Requirement of FGF 4 for postimplantation mouse development. Science 1995;267:246 249. 18. Goldin SN, Papaioannou VE. Paracrine action of FGF4 during periimplantation development maintains trophecto derm and primitive endoderm. Genesis 2003;36:40 47. 19. Arman E, Haffner Krausz R, Chen Y, et al. Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad S ci U S A 1998;95:5082 5087. 20. Ralston A, Rossant J. Cdx2 acts downstream of cell polarization to cell autonomously promote trophectoderm fate in the early mouse embryo. Dev Biol 2008;313:614 629. 21. Rossant J, Tam PP. Blastocyst lineage formation, ear ly embryonic asymmetries and axis patterning in the mouse. Development 2009;136:701 713. 22. Rossant J, Nutter LM, Gertsenstein M. Engineering the embryo. Proc Natl Acad Sci U S A 2011;108:7659 7660. 23. Kunath T, Saba El Leil MK, Almousailleakh M, et al FGF stimulation of the Erk1/2 signalling cascade triggers transition of pluripotent embryonic stem cells from self renewal to lineage commitment. Development 2007;134:2895 2902. 24. Lanner F, Rossant J. The role of FGF/Erk signaling in pluripotent cells Development 2010;137:3351 3360. 25. Tang F, Lao K, Surani MA. Development and applications of single cell transcriptome analysis. Nat Methods 2011;8:S6 11. 26. Tischler J, Surani MA. Investigating transcriptional states at single cell resolution. Curr Opin Biotechnol 2013;24:69 78.

PAGE 79

79 27. Guo G, Huss M, Tong GQ, et al. Resolution of cell fate decisions revealed by single cell gene expression analysis from zygote to blastocyst. Dev Cell 2010;18:675 685. 28. Nichols J, Smith A. Pluripotency in the embryo a nd in culture. Cold Spring Harb Perspect Biol 2012;4:a008128. 29. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:154 156. 30. Evans M. Discovering pluripotency: 30 years of mouse embryonic stem cells. Nat Rev Mol Cell Biol 2011;12:680 686. 31. Nichols J, Smith A. The origin and identity of embryonic stem cells. Development 2011;138:3 8. 32. Ying QL, Nichols J, Chambers I, et al. BMP induction of Id proteins suppresses differentiation and sustai ns embryonic stem cell self renewal in collaboration with STAT3. Cell 2003;115:281 292. 33. Ying QL, Wray J, Nichols J, et al. The ground state of embryonic stem cell self renewal. Nature 2008;453:519 523. 34. Blair K, Wray J, Smith A. The liberation of embryonic stem cells. PLoS Genet 2011;7:e1002019. 35. Tang F, Barbacioru C, Bao S, et al. Tracing the derivation of embryonic stem cells from the inner cell mass by single cell RNA Seq analysis. Cell Stem Cell 2010;6:468 478. 36. Chen X, Xu H, Yuan P, et al. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell 2008;133:1106 1117. 37. Brons IG, Smithers LE, Trotter MW, et al. Derivation of pluripotent epiblast stem cells from mammalian embryos. Nat ure 2007;448:191 195. 38. Tesar PJ, Chenoweth JG, Brook FA, et al. New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 2007;448:196 199. 39. Vallier L, Alexander M, Pedersen RA. Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J Cell Sci 2005;118:4495 4509. 40. Osafune K, Caron L, Borowiak M, et al. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat Biotechnol 20 08;26:313 315.

PAGE 80

80 41. Najm FJ, Chenoweth JG, Anderson PD, et al. Isolation of epiblast stem cells from preimplantation mouse embryos. Cell Stem Cell 2011;8:318 325. 42. Chambers I, Silva J, Colby D, et al. Nanog safeguards pluripotency and mediates germline development. Nature 2007;450:1230 1234. 43. Han DW, Tapia N, Joo JY, et al. Epiblast stem cell subpopulations represent mouse embryos of distinct pregastrulation stages. Cell 2010;143:617 627. 44. Toyooka Y, Shimosato D, Murakami K, et al. Identification and characterization of subpopulations in undifferentiated ES cell culture. Development 2008;135:909 918. 45. Marks H, Kalkan T, Menafra R, et al. The transcriptional and epigenomic foundations of ground state pluripotency. Cell 2012;149:590 604. 46. Li P, Tong C, Mehrian Shai R, et al. Germline competent embryonic stem cells derived from rat blastocysts. Cell 2008;135:1299 1310. 47. Buehr M, Meek S, Blair K, et al. Capture of authentic embryonic stem cells from rat blastocysts. Cell 2008;135:1287 1298 48. Huang Y, Osorno R, Tsakiridis A, et al. In Vivo differentiation potential of epiblast stem cells revealed by chimeric embryo formation. Cell Rep 2012;2:1571 1578. 49. Schalch T, Duda S, Sargent DF, et al. X ray structure of a tetranucleosome and its implications for the chromatin fibre. Nature 2005;436:138 141. 50. Luger K, Dechassa ML, Tremethick DJ. New insights into nucleosome and chromatin structure: an ordered state or a disordered affair? Nat Rev Mol Cell Biol 2012;13:436 447. 51. Banaszynski LA, Allis CD, Lewis PW. Histone variants in metazoan development. Dev Cell 2010;19:662 674. 52. Taverna SD, Li H, Ruthenburg AJ, et al. How chromatin binding modules interpret histone modifications: lessons from professional pocket pickers. Nat Struct Mo l Biol 2007;14:1025 1040. 53. Musselman CA, Lalonde ME, Ct J, et al. Perceiving the epigenetic landscape through histone readers. Nat Struct Mol Biol 2012;19:1218 1227. 54. Jenuwein T, Allis CD. Translating the histone code. Science 2001;293:1074 1080 55. Strahl BD, Allis CD. The language of covalent histone modifications. Nature 2000;403:41 45.

PAGE 81

81 56. Ahmed K, Dehghani H, Rugg Gunn P, et al. Global chromatin architecture reflects pluripotency and lineage commitment in the early mouse embryo. PLoS One 2010;5:e10531. 57. Meshorer E, Yellajoshula D, George E, et al. Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells. Dev Cell 2006;10:105 116. 58. Smith ZD, Chan MM, Mikkelsen TS, et al. A unique regulatory phase of DNA methy lation in the early mammalian embryo. Nature 2012;484:339 344. 59. Borgel J, Guibert S, Li Y, et al. Targets and dynamics of promoter DNA methylation during early mouse development. Nat Genet 2010;42:1093 1100. 60. Senner CE, Krueger F, Oxley D, et al. D NA methylation profiles define stem cell identity and reveal a tight embryonic extraembryonic lineage boundary. Stem Cells 2012;30:2732 2745. 61. Hermann A, Gowher H, Jeltsch A. Biochemistry and biology of mammalian DNA methyltransferases. Cell Mol Life S ci 2004;61:2571 2587. 62. Okano M, Bell DW, Haber DA, et al. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999;99:247 257. 63. Takai D, Jones PA. Comprehensive analysis of CpG islands in h uman chromosomes 21 and 22. Proc Natl Acad Sci U S A 2002;99:3740 3745. 64. Deaton AM, Bird A. CpG islands and the regulation of transcription. Genes Dev 2011;25:1010 1022. 65. Clouaire T, Webb S, Skene P, et al. Cfp1 integrates both CpG content and gene activity for accurate H3K4me3 deposition in embryonic stem cells. Genes Dev 2012;26:1714 1728. 66. Blackledge NP, Zhou JC, Tolstorukov MY, et al. CpG islands recruit a histone H3 lysine 36 demethylase. Mol Cell 2010;38:179 190. 67. Seisenberger S, Andre ws S, Krueger F, et al. The dynamics of genome wide DNA methylation reprogramming in mouse primordial germ cells. Mol Cell 2012;48:849 862. 68. Hajkova P, Jeffries SJ, Lee C, et al. Genome wide reprogramming in the mouse germ line entails the base excision repair pathway. Science 2010;329:78 82. 69. Cimmino L, Abdel Wahab O, Levine RL, et al. TET family proteins and their role in stem cell differentiation and transformation. Cell Stem Cell 2011;9:193 204.

PAGE 82

82 70. Ito S, D'Alessio AC, Taranova OV, et a l. Role of Tet proteins in 5mC to 5hmC conversion, ES cell self renewal and inner cell mass specification. Nature 2010;466:1129 1133. 71. Huang Y, Pastor WA, Shen Y, et al. The behaviour of 5 hydroxymethylcytosine in bisulfite sequencing. PLoS One 2010;5 :e8888. 72. Yu M, Hon GC, Szulwach KE, et al. Tet assisted bisulfite sequencing of 5 hydroxymethylcytosine. Nat Protoc 2012;7:2159 2170. 73. Yu M, Hon GC, Szulwach KE, et al. Base resolution analysis of 5 hydroxymethylcytosine in the mammalian genome. Cell 2012;149:1368 1380. 74. Stock JK, Giadrossi S, Casanova M, et al. Ring1 mediated ubiquitination of H2A restrains poised RNA polymerase II at bivalent genes in mouse ES cells. Nat Cell Biol 2007;9:1428 1435. 75. Zhou W, Zhu P, Wang J, et al. Histone H2A monoubiquitination represses transcription by inhibiting RNA polymerase II transcriptional elongation. Mol Cell 2008;29:69 80. 76. Margueron R, Justin N, Ohno K, et al. Role of the polycomb protein EED in the propagation of repressive histone marks. N ature 2009;461:762 767. 77. Yuan W, Wu T, Fu H, et al. Dense chromatin activates Polycomb repressive complex 2 to regulate H3 lysine 27 methylation. Science 2012;337:971 975. 78. Voigt P, LeRoy G, Drury WJ, et al. Asymmetrically modified nucleosomes. Cel l 2012;151:181 193. 79. Woo CJ, Kharchenko PV, Daheron L, et al. A region of the human HOXD cluster that confers polycomb group responsiveness. Cell 2010;140:99 110. 80. Sing A, Pannell D, Karaiskakis A, et al. A vertebrate Polycomb response element gove rns segmentation of the posterior hindbrain. Cell 2009;138:885 897. 81. Zhao J, Sun BK, Erwin JA, et al. Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science 2008;322:750 756. 82. Zhao J, Ohsumi TK, Kung JT, et al. Genome w ide identification of polycomb associated RNAs by RIP seq. Mol Cell 2010;40:939 953. 83. Ku M, Koche RP, Rheinbay E, et al. Genomewide analysis of PRC1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 2008;4:e1000242.

PAGE 83

83 84. Cartwri ght P, Mller H, Wagener C, et al. E2F 6: a novel member of the E2F family is an inhibitor of E2F dependent transcription. Oncogene 1998;17:611 623. 85. Kherrouche Z, Begue A, Stehelin D, et al. Molecular cloning and characterization of the mouse E2F6 gen e. Biochem Biophys Res Commun 2001;288:22 33. 86. Trimarchi JM, Fairchild B, Verona R, et al. E2F 6, a member of the E2F family that can behave as a transcriptional repressor. Proc Natl Acad Sci U S A 1998;95:2850 2855. 87. Pohlers M, Truss M, Frede U, e t al. A role for E2F6 in the restriction of male germ cell specific gene expression. Curr Biol 2005;15:1051 1057. 88. Storre J, Schfer A, Reichert N, et al. Silencing of the meiotic genes SMC1beta and STAG3 in somatic cells by E2F6. J Biol Chem 2005;280 :41380 41386. 89. Kehoe SM, Oka M, Hankowski KE, et al. A conserved E2F6 binding element in murine meiosis specific gene promoters. Biol Reprod 2008;79:921 930. 90. Storre J, Elssser HP, Fuchs M, et al. Homeotic transformations of the axial skeleton that accompany a targeted deletion of E2f6. EMBO Rep 2002;3:695 700. 91. Courel M, Friesenhahn L, Lees JA. E2f6 and Bmi1 cooperate in axial skeletal development. Dev Dyn 2008;237:1232 1242. 92. Trimarchi JM, Fairchild B, Wen J, et al. The E2F6 transcription factor is a component of the mammalian Bmi1 containing polycomb complex. Proc Natl Acad Sci U S A 2001;98:1519 1524. 93. Attwooll C, Oddi S, Cartwright P, et al. A novel repressive E2F6 complex containing the polycomb group protein, EPC1, that interacts w ith EZH2 in a proliferation specific manner. J Biol Chem 2005;280:1199 1208. 94. Ogawa H, Ishiguro K, Gaubatz S, et al. A complex with chromatin modifiers that occupies E2F and Myc responsive genes in G0 cells. Science 2002;296:1132 1136. 95. Trojer P, Cao AR, Gao Z, et al. L3MBTL2 protein acts in concert with PcG protein mediated monoubiquitination of H2A to establish a repressive chromatin structure. Mol Cell 2011;42:438 450. 96. Qin J, Whyte WA, Anderssen E, et al. The polycomb group protein L3mbtl2 assembles an atypical PRC1 family complex that is essential in pluripotent stem cells and early development. Cell Stem Cell 2012;11:319 332.

PAGE 84

84 97. Velasco G, Hub F, Rollin J, et al. Dnmt3b recruitment through E2F6 transcriptional repressor mediates germ line gene silencing in murine somatic tissues. Proc Natl Acad Sci U S A 2010;107:9281 9286. 98. Saitou M, Kagiwada S, Kurimoto K. Epigenetic reprogramming in mouse pre implantation development and primordial germ cells. Development 2012;139:15 31. 9 9. Simpson AJ, Caballero OL, Jungbluth A, et al. Cancer/testis antigens, gametogenesis and cancer. Nat Rev Cancer 2005;5:615 625. 100. in vivo. J Biol Chem 2006;281:9901 9908. 101. Oka M, Meacham AM, Hamazaki T, et al. De novo DNA methyltransferases Dnmt3a and Dnmt3b primarily mediate the cytotoxic effect of 5 aza 2' deoxycytidine. Oncogene 2005;24:3091 3099. 102. Villasante A, Piazzolla D, Li H, et al. Epigenetic regulation o f Nanog expression by Ezh2 in pluripotent stem cells. Cell Cycle 2011;10:1488 1498. 103. Su IH, Basavaraj A, Krutchinsky AN, et al. Ezh2 controls B cell development through histone H3 methylation and Igh rearrangement. Nat Immunol 2003;4:124 131. 104. Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002;18:1427 1431. 105. Vir E, Brenner C, Deplus R, et al. The Polycomb group protein EZH2 directly controls DNA methylation. Nature 2006;439:871 874. 106. Rush M, Appanah R, Lee S, et al. Targeting of EZH2 to a defined genomic site is sufficient for recruitment of Dnmt3a but not de novo DNA methylation. Epigenetics 2009;4:404 414. 107. Hansen KH, Bracken AP, Pasini D, et al. A model for transmission of the H3K27me3 epigen etic mark. Nat Cell Biol 2008;10:1291 1300. 108. Hackett JA, Reddington JP, Nestor CE, et al. Promoter DNA methylation couples genome defence mechanisms to epigenetic reprogramming in the mouse germline. Development 2012;139:3623 3632.

PAGE 85

85 BIOGRAPHICAL SKETCH Milena Ni kolaeva Leseva was born in Bulgaria, to parents Nikolay and Diana. iotec hnology in 2004, and a M.S. in c ell biology in 2006. In August, 2008 she joined the I nterd isciplinary Program in B iomedical s ciences at the Uni versity of Florida, College of M edicine. In the spring of the following year she entered the molecular cell biology concentration and began work in the laboratory of Dr. Naohiro Terada. She received her Ph.D. from the University of Florida in the spring of 2013.