<%BANNER%>

Analyzing Beta-Globin Cis-Regulatory Elements By Using Artificial DNA-Binding Domains

Permanent Link: http://ufdc.ufl.edu/UFE0045246/00001

Material Information

Title: Analyzing Beta-Globin Cis-Regulatory Elements By Using Artificial DNA-Binding Domains
Physical Description: 1 online resource (109 p.)
Language: english
Creator: Barrow, Joeva Jade
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: artificial -- beta-globin -- finger -- zinc
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: One of the primary methods to regulate gene expression is through the interaction of trans-factors with cis-regulatory DNA elements. Transcription factors bind in a DNA sequence–specific manner and recruit activities that modulate the association and activity of transcription complexes at specific genes. Often, transcription factors belong to families of related proteins that interact with similar DNA sequences. Furthermore, genes are regulated by multiple, sometimes redundant, cis-regulatory elements. Thus, the analysis of the role of a specific DNA regulatory sequence and the interacting proteins in the context of intact cells is challenging. In this study, we designed and functionally characterized several artificial DNA-binding domains that neutralize the function of a putative cis-regulatory DNA element associated with the adult ß-globin locus. These artificial proteins are comprised of zinc finger DNA-binding domains (ZF-DBD), each composed of six ZFs tailored to interact with desired sequences. I designed a series of artificial DNA-binding domains (DBD) comprised of modular zinc finger DNA binding domains (ZF-DBD)that targeted putative cis-regulatory sites of interests: the -90 and +60 elements relative to the start of the ß-globin promoter. The ZF-DBDs bound to these sites with high affinity and specificity and rendered the target sites inaccessible to endogenous transcription factors.I was able to successfully validate each target cis-element and assessed its requirement for globin gene function. Based on the success of our studies, we conclude that ZF-DBDs are effective tools to identify and characterize putative functional cis-regulatory elements in vivo.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joeva Jade Barrow.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045246:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045246/00001

Material Information

Title: Analyzing Beta-Globin Cis-Regulatory Elements By Using Artificial DNA-Binding Domains
Physical Description: 1 online resource (109 p.)
Language: english
Creator: Barrow, Joeva Jade
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: artificial -- beta-globin -- finger -- zinc
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: One of the primary methods to regulate gene expression is through the interaction of trans-factors with cis-regulatory DNA elements. Transcription factors bind in a DNA sequence–specific manner and recruit activities that modulate the association and activity of transcription complexes at specific genes. Often, transcription factors belong to families of related proteins that interact with similar DNA sequences. Furthermore, genes are regulated by multiple, sometimes redundant, cis-regulatory elements. Thus, the analysis of the role of a specific DNA regulatory sequence and the interacting proteins in the context of intact cells is challenging. In this study, we designed and functionally characterized several artificial DNA-binding domains that neutralize the function of a putative cis-regulatory DNA element associated with the adult ß-globin locus. These artificial proteins are comprised of zinc finger DNA-binding domains (ZF-DBD), each composed of six ZFs tailored to interact with desired sequences. I designed a series of artificial DNA-binding domains (DBD) comprised of modular zinc finger DNA binding domains (ZF-DBD)that targeted putative cis-regulatory sites of interests: the -90 and +60 elements relative to the start of the ß-globin promoter. The ZF-DBDs bound to these sites with high affinity and specificity and rendered the target sites inaccessible to endogenous transcription factors.I was able to successfully validate each target cis-element and assessed its requirement for globin gene function. Based on the success of our studies, we conclude that ZF-DBDs are effective tools to identify and characterize putative functional cis-regulatory elements in vivo.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joeva Jade Barrow.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Bungert, Jorg.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045246:00001


This item has the following downloads:


Full Text

PAGE 1

1 ANALYZING BETA GLOBIN CIS REGULATORY ELEMENTS BY USING ARTIFICIAL DNA BINDING DOMAINS By JOEVA JADE BARROW A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Joeva Jade Barrow

PAGE 3

3 To my wonderful f amily who has always provided a constant source of perspective and inspiration

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my mother. Through her own strength, ambition and independence, she taught me to never back down from a challenge and to always dance. I would also like to express my deep love and gratitude to my husband who ne ver wavered in his support and was always there for me in both the good and heart wrenching challenging times. It is only because of his support and encouragement that I have made it here today. Eternal gratitude to my beautiful son. Motherhood just breaks you open in every way. I never knew I could love so much, be so tired, and cherish absolutely every single tiny experience. N o matter what type of day I would have, his face always made me smile and kept everything in wonderful perspective. I would like to thank my committee members especial ly to Dr. Mitchell Knutso n who has mentored me since my m I know I can and always turn to him for advice. I thank my lab members both past and present ( Drs. Shermi Liang, Zhuo Zhou, I Ju Lin as well as Jared Stees, Pamela Cha males, Stephanie Morton, and our lab technician Blanca Ostmark ) for their assistance, encouragement, and friendship. Finally, the most significant acknowledgement goes to my advisor Dr. Jorg Bungert for his mentorship. Jorg has alway s been eternally optimistic and has encouraged me over the years to always try to the best of my ability to stay positive even when things look bleak. He has taught me to limit my desire to strive for perfection and exquisite control and allow myself to dr the discoveries are often made. I also thank him for his support especially where family matters are concerned. I truly believe that it is only because I had such a strong supportive net work at work as well as at home that I was able to embrace my full

PAGE 5

5 potential. There is no greater mentor alive. I admire his gentle spirit and his positive outlook on everything. I will always be grateful to him.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 Hemoglobin Function and Composition ................................ ................................ .. 13 Globin Gene Locus ................................ ................................ ....................... 13 Hemoglobinopathies ................................ ................................ ............................... 16 Sickle Cell Anemia ................................ ................................ ........................... 16 Thalassemia ................................ ................................ ................................ ..... 17 Therapies for Hemoglobinopathies ................................ ................................ ... 18 Chromatin ................................ ................................ ................................ ............... 21 Gene Transcription ................................ ................................ ................................ 22 Cis Regulatory DNA Elements within the Globin locus ................................ ........... 23 Structural properties of DNA Binding Proteins ................................ ........................ 25 Leucine Zipper ................................ ................................ ................................ .. 26 Helix Loop Helix Domain ................................ ................................ .................. 27 Zinc Finger Domain ................................ ................................ .......................... 27 Trans Acting F actors ................................ ................................ ............................... 28 Krppel Like Factor 1 ................................ ................................ ....................... 28 Upstream Stimulatory Factor ................................ ................................ ............ 30 Globin Gene Regulation. ................................ ................................ ... 31 T cell Acute Lymphocytic Leukemia Protein 1 ................................ .................. 32 Redundancy of cis and trans globin Gene Locus ................................ ................................ ................................ ................... 33 Zinc Finger Artificial DNA Binding Domains ................................ ............................ 33 Challenges with Artificial DNA Binding Domains ................................ .................... 37 Summation ................................ ................................ ................................ .............. 38 2 MATERIAL AND METHODS ................................ ................................ .................. 43 Zinc Finger Design and Construction ................................ ................................ ...... 43 Expression and Purification of the ZF DBD ................................ ............................ 44 Electrophoretic Mobility Shift Assay ................................ ................................ ........ 45 Immunoblot Analysis ................................ ................................ ............................... 45

PAGE 7

7 Cell Culture and Transfections/Transductions ................................ ........................ 46 Immunofluorescence Microscopy ................................ ................................ ........... 46 RN A Isolation and Analysis ................................ ................................ ..................... 47 Chromatin Immunoprecipitation ................................ ................................ .............. 47 Benzidine Staining ................................ ................................ ................................ .. 49 Generation of Transgenic Mice ................................ ................................ ............... 49 3 CHARACTERIZING THE ZF DNA BINDING DOMAIN ................................ 54 Background ................................ ................................ ................................ ............. 54 Results ................................ ................................ ................................ .................... 56 Discussion ................................ ................................ ................................ .............. 61 4 CHARACTERIZING THE +60 EBOX ZF DNA BINDING DOMAIN ......................... 69 Background ................................ ................................ ................................ ............. 69 Results ................................ ................................ ................................ .................... 71 Discussion ................................ ................................ ................................ .............. 75 5 CONCLUSIONS AND FUTURE STUDIES ................................ ............................. 83 Future Studies ................................ ................................ ................................ ........ 85 Therapeutic Delivery of the ZF DBDs ................................ ................................ ..... 86 Challenges and Alternative Strategies ................................ ................................ .... 88 LIST OF REFERENCES ................................ ................................ ............................... 91 BIOGRAPHICAL S KETCH ................................ ................................ .......................... 109

PAGE 8

8 LIST OF TABLES Table page 2 1 Tailored ZF DBD recognition helices. ................................ ................................ 51 2 2 Constant primers and oligonucleotides used in zinc finger construction ............. 52 2 3 Variable oligonucleotides used in zinc zinger construction ................................ 53

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Schematic representation of the structural organization of the human and murine globin loci located on chromosomes 11 and 7 respectively. ................ 40 1 2 A highlight of the cis regulatory elements located within the human globin locus control region HS2 and globin promoter region. ................................ ..... 41 1 3 Schematic of Zinc Finger binding to DNA. ................................ .......................... 42 2 1 Overall design schematic of the ZF DBD ................................ .......................... 50 3 1 In vitro charact erization of the ZF DBD. ................................ ................... 64 3 2 The ZF DBD localizes to the nucleus in induced MEL cells. ..................... 65 3 3 min or globin gene transcription in MEL cells expressing the ZF DBD. ................................ ................................ ............ 66 3 4 aj globin gene promoter by the ZF DBD in MEL cells.. ................................ ..................... 67 3 5 Transient transgenic mouse embryos expressing the ZF DBD exh ibit globin gene... ................................ ................... 68 4 1 Zinc Finger DNA binding domains (ZF DBD) stably localize to the nucleus in MEL cells. ................................ ................................ ................................ ........... 78 4 2 major globin gene transcription in MEL cells expressing the +60 ZF DBD or empty vector.. ................................ ................... 79 4 3 ZF DBDs bind to the intended target sites. ................................ ......................... 80 4 4 USF2 occupancy is reduced at HS2 of the LCR and the major promoter in induced MEL cells harboring the +60 ZF DBD.. ................................ ................. 81 4 5 Pol II occupancy levels accumulate at HS2 of the LCR and dramatic reductions in major promoter occupancy is observed in induced MEL cells harboring the +60 ZF DBD. ................................ ................................ ................ 82

PAGE 10

10 LIST OF ABBREVIATIONS BHLH Basic Helix Loop Helix ChIP Chromatin Immunoprecipitation CPSF Cleavage PolyA Specificity Factor DMSO Dimethylsulfoxide DNaseI Deoxyribonuclease I D .p.c Days post coitum DSIF DRB Sensitivity Inducing Factor HAT Histone Acetyltransferase HS Hypersensitivity Site KLF1 Krppel Like Factor 1 LCR Locus Control Region LZ Leucine Zipper MEL Cells Mo use Erythroleukemia Cells NELF Negative Elongation Factor Pol II RNA Polymerase II PTEFb Positive Transcription Factor b RT PCR Reverse Transcriptase Polymerase Chain Reaction TAL1 T Cell Acute Lymphocytic Leukemia Protein 1 qRT PCR Quantitative (Real Time) Reverse Transcription Polymerase Chain Reaction USF Upstream St imulatory Factor ZF DBD Zinc Finger DNA Binding Domain

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ANALYZING BETA GLOBIN CIS REGULATORY ELEMENTS BY USING ARTIFICIAL DNA BINDING DOMAINS By Joeva Jade Barrow May 2013 Chair: Jrg Bungert Major: Medical Sciences -Biochemistry and Molecular Biology One of the primary methods to regulate g ene expression is through the interaction of trans factors with cis regulatory DNA elements. Transcription factors bind in a DNA sequence specific manner and recruit activities that modulate the association and activity of transcription complexes at specific genes. Often, t ranscription factors belong to families of related proteins that interact with similar DNA sequences. Furthermore, genes are regulated by multiple, sometimes redundant, cis regulatory elements. Thus, the analysis of the role of a specific DNA regulatory se quence and the interacting proteins in the context of intact cells is challenging. In this study, we designed and functionally characterized several artificial DNA binding domain s that neutralize the function of a putative cis regulatory DNA element associ ated with the globin locus. These artificial proteins are comprised of zinc finger DNA binding domains (ZF DBD), each composed of six ZFs tailored to interact with desired sequences. I designed a series of artificial DNA binding domains (DBD) compr ised of modular zinc finger DNA binding domains (ZF DBD) that targeted putative cis regulatory sites of interests: the 90 and +60 elements relative to the start of the globin promoter. The ZF DBDs bound to these sites with high affinity and specificity and rendered the

PAGE 12

12 target sites inaccessible to endogenous transcription factors. I was able to successfully validate each target cis element and assessed its requirement for globin gene function. Based on the success of our studies, we conclude that ZF DBDs are effective tools to identify and characterize putative functional cis regulatory elements in vivo

PAGE 13

13 CHAPTER 1 INTRODUCTION Hemoglobin Function and Composition Hemoglobin is the major protein constituent of red blood cells and functions tog ether to reversibly bind and tran sport oxygen around the body [1] In humans, h emoglobin is comprised of a pair of protein heterodimers derived fr om the alpha and beta globin loci on chromosome 16 and 11, respectively. The alpha and beta globin chains are arranged in a tetrahedral configuration each with a prosthetic ferroprotoporph y rin IX heme moiety e mbedded in a hydrophobic pocket that is covalen tly linke d to a histidine residue [1] The structure is stabilized by non covalent bonds to allow for changes in configuration depending on the oxygen b inding status of the protein [2] Throughout development, different types of proteins expressed from the alpha and beta globin gene loci combine to give rise to different forms of hemoglobin each having a specific set of characteristics and fun ction throughout development [3] Globin Gene Locus The human beta globin gene locus is located on the short arm of chro mosome 11 in humans (11p15.15) that is on ly active in erythroid cells [4] The entire locus sp ans a ~80 arranged in a manner consistent with their expression during development (Figure 1 1) All five genes encode for the varying forms of the globin protein (all about 140 amino acids) which is a critical subunit of the hemoglobin molecule (64 kDa) [3] globin gene is the first to be activated and transcribed [5] globin proteins to form embryonic hemoglobin (HbE

PAGE 14

14 embryonic yolk sac which serves as the primary site for hematopoiesis in the em bryo [6] globin gene is silenced, and the yolk sac to the fetal liver [7] globin pro teins to form fetal hemoglobin (HbF [8] After birth, there is a final switch in the site of hematopoiesis from the fetal liver to the bone marrow concomitant with the silencing of globin gene is then activated to form the functional adul t hemoglobin (HbA globin gene is also activated (HbA2 globin due to a mut ation in the promoter region [3] globin gene locus is located on chromosome 7 and is highly homologous to humans [9] It contains four globin genes loosel y arranged in the order in E11.5 after which there is are co expressed in the fetal liver and subsequently the bone marrow after birth [10,11] Developmental stage type globin genes both in humans and mice requires an upstream element located 6 22 kb away from the embryonic genes known as the locus control region (LCR) [12,13] The LCR is a unique enhancer element that has been shown to also possess chromatin opening properties. It can confer high level expression of linked genes in a position independent manner in transgenic assays [14,15] Insight into the importance of this element was detailed by examining the classic Hi spanic thalassemic patient who developed a de novo deletion

PAGE 15

15 on a mater nally inherited chromosome involving approximately 30 kb of sequences 5' to the epsilon gen e that emcompassed the majority of the LCR. This resulted in the heterochromatization of the globin locus and silencing of all the downstream genes [16] Subsequent work showed that the LCR is a powerful DNA regulatory region characterized by five DNase I hypersensitive sites (HS) (in mice there are six HS) [13,17] Sensitivity to the enzyme DNase I often denotes areas of strong regulatory potential because it indicates that the region of chromatin is open and therefore acc essible to trans acting factors Each HS contains a core region spanning 200 400 bp that is enriched for cis elements such as GATA and MARE motifs that serve as binding sites for regulatory trans acting factors both ubiquitous and erythroid specific, that mediate the sequential activation of the globin genes [1 7] HS 1 4 exhibit erythroid specific hypersensitivity to the enzyme DNase I [18] The current function of HS1 is unknown while HS2 is the only element that functions as a classical enhancer meaning that it can activate heterologous genes in transient expression assays [19,20] HS3 and 4 a lso display enhancer activities; however, they require chromatin integration before this property can be observed [21] HS3 has also been shown to have chromatin op ening activities [22] HS5 has been reported to possess insulator activity in enhancer blocking assays in K562 and murine erythroleukemia (MEL ) cells and has been postulated to have the ability to prevent the spread of heterochromatic marks from the upstream olfactory genes that is maintained in a closed chromatin configuration in erythroid cells [23] The exact mechanism of this process as well as how the activation of the globin genes in a sequential manner is achieved is not comple tely understood and is currently an area of study.

PAGE 16

16 Hemoglobinopathies Regulation of the globin genes is very complex and disruption to the system can lead to hemoglobinopathies. It is estimated that about 7% of the world population are carriers for one of the inherited hemoglobin disorders, making them the most common monogenic diseases in the world [24] Hemoglobinopathies can be div ided into two groups, structural hemoglobin variants such as sickle cell anemia and the thalassaemias, which result from imbalanced and defective synthesis of the globin chains. Sickle Cell Anemia Sickle cell anemia (SCA) was first characterized as a molec ular disorder by Linus Pauling and colleagues in 1949 to occur due to an abnormality in the hemoglobin molecule It is currently classified as the most common inherited genetic disease based on the Newborn Screening Initiative [25,26] The disorder occurs d ue to a genetically T mutation at residue 334 in the beta globin gene that causes a single amino acid globin protein chain [27,28] The result is a substitution the normal polar glutamic acid for a mutant non polar valine. This is a significant problem because upon de oxygenation of hemoglobin to deliv er oxygen to the peripheral tissues, hemoglobin undergoes a conformational change which exposes the substituted hydrophobic valine on the molecular surface resulting in the rapid polymerization of the HbS molecules into long fibers. This causes the red blo od cells to as well as microvascular occlusion leading to tissue ischemia [25] Individuals afflicted with this disease face a life long experience of chronic pain, organ failure due to iron overload, anemia, splenic sequestration, and an increased risk for stroke. In the

PAGE 17

17 heterozygote state in which an individual only inh erits 1 copy of the mutant allele, the patients are asymptomatic and are known as carriers, or to have a sickle cell trait. T he carrier state for SCA is asymptomatic and has been shown t o be protective against malaria and as such SCA is concentrated in tho se countries where malaria has exerted selective evolutionary pressure, such as Africa [25] [29] According to the National Heart Lung and Blood Institute (NHLBI), the current national statistic estimates the probability to be 1 in every 500 African Americans that ha ve the full blown disease and 1 in every 12 African Americans that have the sickle cell trait [ 26] Thalassemia The other major disorder is thalassemia which is an inherited disorder characterized by the absence of or reduction in levels of one or more globin chains. Thalassemia is the most common monogenetic disease worldwide. The disorder can be classified into two major groups, beta and alpha thalassemia depending on the globin chain that is affected [24] Beta thalasse globin protein [24,30] thalassemia is imbalanced globin globin chains on erythroid maturation and surviva l [31] Alpha globin chains are unable to form a functional hemoglobin tetramer and precipitate as inclusion bodies in red cell precursors that accumulate in the bone marrow as well as all other stages of the erythroi d maturation pathway [32] In the most severe forms of the disease (thalassemia major), patients present with failure to thrive, anemia, chronic infection, and bone abnormalities due to the expansion of the bone marrow [33,34,35] In milder cases (thalassemia minor),

PAGE 18

18 patients present with few, if any clinical symptoms. In thalassemia intermedia, the pathogenesis of the patient is variable depending on the individual case and the extent globin disruption [31] Therapies for Hemoglobinopathies Hematopoietic stem cell transplantation represents the only current long term cure for hemoglobino pathies [36] bone marrow by radiation or chemotherapy and then introducing hematopoietic stem then migrate to the bone marrow and repopulate the region. Patients after transplantation require lengthy hospital stays where they are given immunosuppressive drugs to minimize rejec tion of the foreign cells [37] Stem cell transplantation is extremely promising yet still has significant risks including death [38] Case study reports indicate that transplantation with matched donors stil l prove to have too high of a mortality rate to be acceptable. Yet despite these risks, it still remains the only current cure for the disease. Other forms of therapy are aimed at relieving symptoms, preventing complications, and avoiding crisis (in the ca se for sickle cell disease). These therapies such as blood transfusions, and/or the administration of oral medications to increase fetal globin synthesis, require lifelong application for effectiveness. Blood transfusions involve obtaining healthy red blo od cells from a donor and delivering them to the patient intravenously. However, iron is deposited along with the blood and with each successive blood transfusion, iron levels saturate and exhaust the transferrin carrying capacity and lead to chronic iron overload [39,40] Free non bound iron accumulates in the plasma and tissues of the body where it then reacts with oxygen

PAGE 19

19 generating free radicals which causes damage particularly in heart and liver [33,41,42] As there is no effective excretory pathway for iron apart from intestinal shedding and bleedi ng, iron chelation therapy such as the oral medication deferasirox is mandatory for these patients [43] The d aily administration requirement of the drug however is very expensive and is not available to many patients worldwide. Oral medications, the most common of which is hydroxyurea, are targeted towards increasing levels of fetal hemoglobin (HbF) in the blood [44] Although the natural distribution of HbF cells in an adult is approximately 1 2%, studies have shown that thes e cells are able to resist sickling in vitro and inhibit polymerization of sickled hemoglobin [45,46] Furthermore, sickle cell patients that ge netically have higher levels of HbF a phenomenon known as hereditary persistence of fetal hemoglobin (HPFH), often have milder clinical pathogenesis [47] Hydroxyurea is a cytotoxic agent originally used for decades to reduce abnormally high hematocrit and platelet counts for patients with polycyth emia ver a a disorder where the bone marrow synthesizes too many red blood cells [48] until a clinical trial testing the effects of hydr oxyurea in non human primates that it was discovered that hydroxyurea increases fetal hemoglobin [49] Alt h ough the details regarding the mechanism of action remain unclear, data suggest that the cytotoxic nature of the drug targets HbS cells because they are derived from highly prolif erative precursors. These precursors are targeted by the drug and are subsequently destroyed which will boost the relative percentage of HbF cells which stem from precursor s that do not divide as rapidly [50] Clinical trials demonstrated that hydroxyurea could increase HbF levels in patients with sickle cell disease as early as 72 hours of administration

PAGE 20

20 [51,52] Hydroxyurea also stimulates NO production which improves vasodilation and minimizes crisis in sickle cell patients [53] Although this drug has extremely promising outcomes, there are significant complications as well. Hydroxyurea is a myleosuppressive agent and white blood cell levels o ften drop, requiring patients to withdraw from treatment until levels return back to baseline. Low white blood cell counts pose an increa sed risk for infection and long term use of the drug may lead to leukemia as well as other types of cancers [54] Furthermore, hydroxyurea while effective for patients with sickle cell disease is not as effective for patients with thalassemia. Based on the limitations of these treatments, there is a strong need to either improve upon or to develop novel therapies. A proposal that has received much interest as a potential therapeutic cure is to consider re activating the expression globin proteins globin protein in hemoglobin and oxygen carrying potential and red blood cell morphology can be restored [55] Several gene therapy trials have been attempted but delivery met hods are a signi ficant limiting factor and need to be improved. Retroviral vectors which integrate permanently into the host genome have exhibited complications such as vector instability, low titers over time, and variable expression [56,57] Self inactivating lentiviral vectors that can integrate into non dividing cells have also shown some promise. But there remains the risk that the virus can integrate into a region of DNA that can activate some oncogenic potential [58] Therefore, it is cr ucial to design vectors which are lineage and differentiation stage restricted. The incorporation of tissue specific promoters and enhancers in addition to genetic elements with enhancer

PAGE 21

21 blocking properties will aid in reducing the toxicity and increasing the efficiency and stage and tissue globin gene and preliminary studies have demonstrated promise [59] The need therefore to understand the intricacies of globin gene regulation is of the utmost i mportance so that new therapies can be developed Chromatin Chromatin organization mediates the dynamic and structural compaction of genetic information within the nucleus of an eukaryotic cell. The fundamental unit s of known as nucleosomes which consist of a nucleosomal core particle, linker DNA, and the histone linker protein H1 [60] The core particle is composed of two cop ies of histone proteins H2A, H2B, H3, and H4 that are arranged in an oct a meric configuration [61,62,63] Ap proximately 146 bp of DNA interacts with the superhelical ridge structure of the nucleosome that is stabilized by electrostatic interactions [63] Connecting two nucleosomal particles is the linker DNA which varies between different the organism s ranging f rom 10 60 bp. Bound to the linker DNA is histone protein H1 which while not required for the formation of the nucleosome, is essential for higher level structures [64,65] S uccessive compaction of the chromatin fiber initially goes through a 30 nm fiber intermediate whi ch has been proposed to consist of a two start helix solenoid structure followed by condensation into higher order looping chromatin structures [66,67,68,69] Chromatin can be broadly categorized as heterochromatin or euchromatin. In gen eral, heterochromatin is condensed and therefore not accessible for transcription factor interactions typically resulting in the suppression of the genes associated with that

PAGE 22

22 region although transcription of some genes has been reported to occur in the co ntext of heterochromatin [70] Euchromatin represents a more open structure, allowing trans acting factors to b ind to regulate gene expression [71] Relative compaction of the genome can be assessed by various methods of which the most classical is the endonuclease deoxyribonuclease I that makes single strand cuts along the phosphate backbone of DNA [72] Regions of the genome are described based on the interaction with DNAseI and can be insensitive as is the case with heterochromatic regions since the DNA is inaccessible at those sites, or sensitive with a gradient ranging to hypersensitivity [73] Hypersensitive regions are thought to be devoid of nucleosomes and contain many cis regulatory elements th at bind to trans acting factors [74] As the accessibility of chromatin repre sents a critical area of control for gene expression, it is therefore essential that chromatin be dynamic. As such, there are several processes to alter the accessibility of chromatin including ATP dependent chromatin remodelers, and histone modifications [75,76] Gene Transcription Transcription is the process of transcribing DNA to generate a complementary strand of RNA which in general is then used as a template for translation into a funct ional protein. Transcription is mediated through the action of the RNA polymerase as well as a host of accessory proteins. There are three major RNA polymerases in higher order mammals. RNA polymerase I (Pol I) transcribes the ribosomal RNAs involved in ri bosome synthesis and enzymatic activity. RNA polymerase II (Pol II) transcribes the majority of messenger RNAs which typically result in a functional protein while RNA polymerase III (Pol III) transcribes small RNAs and tRNAs used in translation or splicing machin eries [77,78,79,80] Active transcription requires the recruitment of the

PAGE 23

23 polymerase as well as the general transcription factors TFII A, B, D, E and F which through coordinated mechanisms form what i s known as the pre initiation complex (PIC) [81,82] DNA is melted by the helicase acti vity of TFIIH and the C terminal tail (CTD) of the polymerase YSPTSPS and can be phosphorylated at distinct serine residues [83,84,85] Phosphorylation o f the fifth serine by the kinase domain of TFII H promotes transcription initiation [85] After a few short abortive transcripts, DRB sensi tivity inducing f actor (DSIF) and negative elongation factor (NELF) associates with the serine 5 phosphorylated form of Pol II to halt the polymerase until the capping reaction which introduces a 7 methyl guanosine a can ta ke place [86,87,88] Positive transcription elongation factor b (P TEFb) is then recruited to phosphorylate both DSIF, causing the dissociation of NELF, and the serine 2 position of the CTD of Pol II [89] Pol II then becomes processive and engaged in active elongation The RNA is then processed by th e transcription termination factor cleavage polyA specificity factor (CSPF) upon the recognition of the polyadenylation sequence [90] Cis Regulatory DNA Elements within the Globin locus Cis regulatory DNA elements contain binding sites which recruit trans acting factors that modul ate transcription. There are a large number of cis regulatory elements in the beta globin gene locus that can be characterized broadly as promoters, enhancers, insulators, or locus control regions. Promoters are in a position immediately the transcription initiation site, while enhancers, insulators and LCRs are distal regulatory elements [14] An enhancer is defined as having the ability to augment the expression of a gene, exert its function in a position and orientation independent manner, and be able to interact with heterologous promoters. Locus

PAGE 24

24 control regions are similar to enhancers in t hat they augment transcription, but they are typically tissue specific and are able to provide copy number dependent and position independent expression to linked genes [14,9 1] Insulators are sequences that recruit proteins that either block the function of enhancers or provide a boundary between open and closed chromatin. All of the above described cis regulatory elements are present in the beta globin gene locus and as an example of the breath and diversity of cis elements, I will highlight elements surrounding the h uman beta globin gene The cis elements proximal and within the beta globin gene inclu de: two erythroid transcription factor GATA binding sites located at 200 and 120 relative to the transcription start site (TSS) that have been shown to increase transcription [92,93] At position 90 resides a CACCC box that has been shown to interact with Krppel Like Factor 1 ( KLF1 ) [94,95] This region has been well characterized and demonstrated to 88 relative to the TSS which resulted in thalassemia due to the inability to bind KLF1 [95,96] The site in mice however is not characterized and will be one of the objectives of this study. The CCAAT box at 70 also binds to GATA1 and is a positive regulator of globin g ene expression [97] Position 25 holds a non CATAAA to function in a coordinated fashion with the initiator a pyrimidine rich sequence located at +1 of the TSS to recruit the TFIID complex of the PIC [98,99] Downstream there are two conserved EBOX sequences (+20 and +60) that interact with helix loop helix proteins such as TAL1, USF1/2, and TFII I heterodimers that, depending on the cell type, would decrease or increase transcription, respectively [100] Mutagenesis studies in vitro and in vivo indicated that the +60 EBOX is important

PAGE 25

25 for globin expression. A MARE cis element is located at +24 and has be en shown to interact with the transcription factor NF E2 and regulates beta globin transcription in a positive manner [101] Finally, there is a tissue and developmental stage enhancer located approximately 500 bp downstream of the polyadenylation signal of the globin gene. This enhancer contains four binding sites for GATA1 and is important for globin expression [98,102] globin LCR as mentioned previously is an important cis acting regulatory domain that is crucial for high type globin genes during all stages of erythroid development. It is comprised of several erythr oid specific DNase I hypersensitive sites (HS) each spanning approximately 200 400 bp with each HS insulated by 2 4 kb of flanking DNA [103] These HSs contain several putative and confirmed binding sites for various regulators and co regulators. As a representative example, LCR HS2 contains binding sites for the hematopoietic specific proteins GATA 1, KLF1, NF E2, TAL1, as well as the ubiquitously expressed transc ription factor USF (Figure 1 2) [104] These transcripti on factors have been shown to be involved in LCR globin gene transcription and it is hypothesized that these trans acting factors co localize to the LCR to be subsequently transferred to the appropriate gene for transcription initiation. Several mechanisms for this interaction have been postulated, such as tracking and looping models [105,106] Structu ral properties of DNA Binding Proteins There is an abundance of trans acting proteins that interact with the cis elements within the globin locus yet they all contain similar structural motifs that allow these proteins to bind to DNA and dimerize with othe r proteins These motifs include but are not limited to : the zinc finger (ZF) domains the leucine zipper (LZ) and the basic helix

PAGE 26

26 loop helix (bHLH) domain which are primarily structural motifs involved in protein protein interactions but they also contain basic regions to allow for DNA interactions [107] These protein domains are not mutually exclusive; there are many trans acting factors that contain several of these domains. For example, the transcription factors cMyc and USF1/2 contain both LZ and HLH domains. Listed below are the detailed prope rties of each structural domain Leucine Zipper The leucine zipper is a common motif found in dimeric proteins. It was first discovered by McKnight et al. based on protein sequence alignments and secondary st ructure predictions [108] The hallmark of the motif is the heptad a repeat of 7 amino acids designated (abcdefg)n that is arranged in a coiled coiled structure sp anning a 35 amino acid stretch [109] Positions a and d are normally occupied by a leucine residue which provides the major portion of the hydrophobic dimerization domain a nd is critical for the packing of the oligomerization interface [110] The leucines of one helix interdigitate with those of the parallel helix in a non covalent linkage causing the two regions to dimerize. Residues e and g are involved in maintaining this hydrophobic core interface a s well, while the remaining residues: b, c and f are charged polar moieties that ensure the solubility of the protein [111,112] The two most common leucine zipper motifs are the basic leucine zipper (bLZ) and the basic hel ix loop helix leucine zipper (bHLH LZ) which are found in many eukaryotic transcription factors such as the upstream stimulatory factor (USF) [11 3] The basic region interacts with the major groove of DNA through hydrogen bonding allowing leucine zipper containing transcription factors to recognize and bind to specific DNA motifs.

PAGE 27

27 Helix Loop Helix Domain The helix loop helix domain is common in many eukaryotic transcription factors that regulate a large array of cellular processes ranging from differentiation to cellular proliferation. The motif was first identified by Murre et al. in the E12 and E47 murine transcription factors and spans approxi mately 60 amino acids composed of a basic region that mediates DNA binding and two successive amphipathic alpha helices juxtaposed at a 90 degree angle separated by a variable loop [114,115] Proteins that contain the HLH motif are generally dimeric proteins due to the hydrophobic interactions of the alpha helices which align the basic region to bind to palindromic CANNTG sequences, known as the E box, in the major groove of DNA through hydrogen bonding [116,117] Zinc Finger Domain pleated sheets and an alpha helix fold that is structurally stabilized by both hydrophobic interactions and the tetrahedral coordination of a zinc ion by the conserved cysteine an d histidine residues (Figure 1 3 ). In the most common ZF domain two cysteines and two histidines coordinate the Zn atom (Cys2 His2 class) [118] The Cys2 His2 ZF domain was first discovered in the Xen opus l aevis transcription factor TFIIIA that contained nine tandem repeats of the zinc finger motif [119,120] Since then, many other proteins were found to have a similar configuration such as the murine early response protein ZIF268 and human Sp1 [121] To date, the Cys2 His2 zinc finger domain represents the most common binding motif found in DNA binding proteins in eu karyotes. ZF proteins are the second most frequently encoded protein in the human genome [122] Each 30 amino acid zinc finger domain can recognize and bind to 3 bp of B form DNA through

PAGE 28

28 hydrogen bonding [118,123] This, in addition to the fact that these domains can be arranged as covalent tandem repeats allows for the recognition of extended asymmetrical D NA sequences. Crystal studies of the murine transcription factor Zif268 detail that base specific interactions are achieved by hydrogen bonding between the helix reading head and the D NA (Figure 1 3 ) [118,124] helix reading head is inserted in to the major groove of B form DNA and contacts are primarily made with the amino acids located at positions 1, 3 and 6 with respect to helix [125] These contacts are made in an anti parallel fashion so that the amino acids of the helix reading head makes base DNA segment (Figure 1 3 pleated sheets also makes con tacts with the phosphodiester oxygen of the sugar phosphate backbone which further stabilizes the binding through interaction with the first of the conserved histidines (that also coordinate the zinc ion) and a conserved arginine [118,126] Trans Acting Factors Krppel Like Factor 1 Krppel Like Factor 1 (KLF1) is a small 3 zinc fingered transcription factor whose expression is restricted to the erythroid lineage [95] It belongs to a family of transcription factors called the Krppel like factors, which derives its name from the high degree of similarity to the Droso phila transcription factor, Krppel. KLF1 was originally identified by a subtractive erythroid hybridization screen using J774 macrophages as a control with MEL cells as the test sample to determine which genes were erythroid specific [95] CCACACCCT (CAC box) [127] Shortly after its identification, its significance in hema topoiesis was

PAGE 29

29 established from patients harboring mutations in a KLF1 binding site, the 87/88 CAC box upstr eam of the beta globin promoter [128] globin expression and developed thalassemia. Studies in knock out mice subsequently supported the critical role of KLF1. Homozygous null mice for K LF1 are normal during the embryonic stage (10.5 d.p.c) however, when hematopoiesis switches from the yolk sac to the fetal liver, embryonic lethality is observed at 14.5 days post coitum ( d.p.c. ) due to severe anemia resulting from ineffective erythropoies is [129] The fetal livers of major transcripts. This suggests that KLF1 is critical for mechanisms involved in globin switching [130] Functio nally, KLF1 has many defined roles in hematopoiesis. It is the most globin expression [131] It globin transcription in a se quence specific manner and is believed to be involved with globin switching because under expression of KLF1 in heterozygous mice premature switching [132,133] KLF1 is also important for the silencing of the fetal globin expression are elevated 5 fold compared to control mice [130] This occurs as a result of the role of KLF1 in the regulation and activation of the BCL11A gene, which encodes a potent silencer for the embryonic genes. In KLF1 null mice, KLF1 is not present to activate BCL11A and as a result, the fet al globin genes are not efficiently silenced. This mechanism is currently an attractive target for therapy for hemoglobinopathies [134 ] ChIP studies demonstrated that KLF1 binds to LCR elements HS2 and HS3 in addition to the beta globin promoter where it is postulated to assist with chromatin

PAGE 30

30 opening activity [135,136] This hypothesis was formed due to the association of KLF1 with histone acetyltransferases (HATs) p300 and CBP as well as the ATpase of the SWI/SNF chromatin remodeler complex BRG1 [137,138,139] The chromatin opening activity of KLF1 is further supported by the observat ion that disruption of EKLF results in globin promoter and the HS2 and HS3 of the LCR [131] The chromatin opening activity is likely mediated b y KLF1 mediated recruitment of ATP dependent chromatin remodeling complexes [138] Furthermore, KLF1 has also been shown to interact with components of the basal transc ription machinery, including the TBP associated factor 9 (TAF9) [140] Chromatin Capture Conformation (3C) studies also indicates that KLF1 is required for mediating proximity globin gene promoter [141] In cells and mice with disruption of KLF1, the looping association between beta globin and the LCR is not observed. All these studies illustrate that KLF1 binding to the 90 CACCC site is crucial for the recr uitment of transc globin gene promoter. Upstream Stimulatory Factor USF is a ubiquitously expressed transcription factor that was first identified as a cellular activity that binds to an upstream element of the adenovirus ma jor late promoter and stimulated transcription in vitro [142,143] DNaseI footprinting identified the consensus USF DNA binding CANNTG (E box) motifs and its binding has been associated with the transcription of many cellular and viral genes [144] USF belongs to a family of transcription factors characterized by the basic helix loop helix leucine zipper (bHLH LZ) DNA binding domains. The protein was purified to homogeneity and the activity was shown to be contributed by two polypeptides named: USF1 (44 kDa) and USF2 (43 kDa) [145,146] The predominant form of USF is a USF1/USF2 heterodimer,

PAGE 31

31 although homodimers were also found in different cell types [147] Structurally, dimerization and DNA binding activ ity of both proteins is mediated by the highly homologous (>75% sequence identify) C terminal region composed of a USF specific region (USR), a basic region that mediates DNA binding, followed by the HLH LZ region required for dimerization. The N terminal region is divergent between the two proteins and could contribute to the differences in transcription activity of the two proteins [146,148] Indeed, USF1 or USF2 null mice, despite being both viable and fertile, display very dif ferent phenotypes. The USF1 null mouse showed slight developmental abnormalities and had high levels of USF2 possibly a compensatory mechanism. Conversely, the USF2 null mouse had extreme growth defects and had low levels of USF1. The double knock out of U SF1 and USF2 is embryonic lethal [149] Despite the fact that the USF proteins are ubiquitously expressed, they appear to primarily regulate genes that are expressed in a differentiation an d tissue specific manner [150] Most genes activated by USF are expressed at high levels in globin gene. A genome wide mapping study of USF interaction sites in hepatocytes revea led that USF preferentially binds DNA in close proximity to transcription start sites, and that this interaction correlates with increased levels of H3 acetylation suggesting that USF may be involved in the recruitment of transcription complexes [151] Globin Gene R egulation. Previous studies have shown that USF interacts with conserved E box elements l ocated in Hypersensitive Site 2 globin downstream promoter region [152,153] USF interacts with co activators and histone modifiers such as the HAT CBP/p300, as well as with large co regulator complexes

PAGE 32

32 such as the histone methyltransferases PRMT1 and SET1in erythroid cells, suggesting that it functions through chromatin remodeling and RNA Pol II recruitment [154,155] The general transcription factor TFII I has also been shown to interact with USF at INR and E box elements in order t o coordinate gene activation or repression, and can recruit USF to these sites [156] Additionally, USF also is known to function at chromat in maintain an environment of active chromatin [157] T cell Acute Lymphocytic Leukemia Protein 1 T cell acute lymphocytic leukemia protein 1 (TAL1) is also known as stem cell leukemia (SCL). Its name was derived by the observation that TAL1 is highly aberrantly expressed in approximately 30% of patients with T cell acute lymphoblastic leukemia (T ALL) [158,159] TAL1 is a 4 7 kDa helix loop helix protein that heterodimerizes with ubiquitously expressed E proteins (E12/E47) and binds to E box sequences of which the preferred sequence is CAGATG, though additional preferences have been observed as dictated by the associated E pr otein [160] In erythroid cells, it is a part of a large multimeric protein complex comprised of TAL1/E2A/LMO2/GATA1 and LDB1 that binds to composite GATA EBOX sequences [161] Despite its association with leukemia the normal function of TAL1 has not been completely resolved. TAL1 possesses activator as well as repressor capacities depending on cell type and associated proteins [162] Gene knock out studies established that TAL1 is critical during embryonic development. Erythropoiesis in the yolk sac is absent in TAL1 null mice due to the failure to produce hematopoietic progenitor cells. Embryonic lethality is observed at 9.5 d.p.c [163] In the adult, TAL is expressed in hematopoietic stem cells (HSC) and multipotent progenitors o f the

PAGE 33

33 erythroid, myeloid and mast cell lineages [164] Knock outs in these systems result in lack of burst forming units (BFU E) and colony forming cells (CFC Mk) [165] TAL1 has been postulated to in teract in vitro and in vivo with an E box located in the LCR element globin gene promoter and the interaction with NL1/Ldb1 is globin gene into close proximity [166,167] However, further studies are required to detail the complete mechanism of TAL1 mediated regulated beta globin gene expression. Redundancy of cis and trans globin Gene L ocus Given that the majority of hemoglobinopathies result from DNA alterations within globin gene locus, investigators over the years have focused on examining cis elements to identify DNA regions that carry strong regulatory potential and are essential for globin gene function. Employing traditional techniques such as DNaseI hypersensitivity and targeted site disruptions, man y cis regulatory DNA elements were identified such as the LCR and binding sites for several trans acting factors. Although significant progress has been made to identify these elements, numerous studies detailing trans factor binding motifs need to be refi ned in order to identify DNA sequences that truly serve as functional binding sites. This often presents a challenge given the redundant nature of many trans factor binding motifs [168] Furthermore, there remain many potential cis regulatory elements that have yet to be discov ered. Zinc Finger Artificial DNA Binding Domains An alternate approach to evaluate the importance of potential cis regulatory elements in vivo is to engineer and employ artificial DNA binding domains (DBD) composed of zinc finger motifs that will bind with high affinity and specificity to a region

PAGE 34

34 of interest on DNA [169] Once targeted, the DBD will occup y that region and render the cis element inactive by preventing other trans acting factors from binding. This will allow the regulatory potential of the cis element to be evaluated. As mentioned previously, a single zinc finger domain can bind to and reco gnize 3 base pairs of DNA in a sequence specific manner [118] What became immediately attractive was th at zinc finger domains possess a distinct modular organization and it was postulated that it may be possible to mix and match domains to allow the recognition of extended asymmetric DNA sequences [170] The potential of ZF proteins to serve as a backbone for the generation of artificial DNA binding domains has early on been recognize d by Aaron Klug and colleagues [169] This was taken a step further by the Pabo group and others who used phage display technology to express varying forms of the ZIF268 zinc finger protei n on the filamentous phage (fd). The authors mutated the 4 key amino acids of finger 1 of ZIF268 at positions 1, + 2, + 3, and + 6 relative to the amino terminus of the alpha helix that were shown to make base specific co ntacts based on crystal studies. The mu tations replaced those sites with amino acids that were randomly generated. Successful alternate ZIF268 proteins were created that could recognize additional DNA sites with high affinity by simply re arranging the key amino acids [170] The study served as a platform that inspired several groups to attemp t to de rive a one to one amino acid nucleic acid code. The Pabo group improved introduced amino acid substitutions to select fingers but in a context dependent manner [171] Studies were also performed varying the zinc finger backbone and a zinc finger consensus sequence. The resulting protein Sp1C showed the most promise [172]

PAGE 35

35 Sp1C is derived from the DNA binding domain of human Sp1, a zinc finger protein GGGCGG most frequently from a database of 131 zinc finger domain sequences. The rational was that amino acids involved in stabilizing the zinc finger would be present in relatively high frequency. Overall the differences between the two proteins encompass 25 poi nt mutations and 4 residue deletions [173] Studies confirmed that Sp1C was able to adopt 3D structures that are similar to its natural counterpart Sp1 based on NMR and DNA binding studies. Furthermore, Sp1C was noted to bind more tightly to its consensus sequence (lower Kd) compared to Sp1 and bind ing to zinc was also discovered to be stronger. The authors inferred that increased metal ion binding is reflective of more structural stability [172,174] desired sequence with high specificity was created. Sp1C is composed of an N terminal backbone that is composed of strands and assoc iated sequence (amino acid sequence: YKCPECGKSFS) and a C terminal backbone comprised of the C helix (amino acid sequence: HQRTH). It also includes a single fixed conserved N terminus portion (amino acid sequence: LEPGEKP) and C t erminus (amino acid sequence: TGKKTS) to structurally complete the protein. Finally, a linker sequence with amino acid sequence TGEKP fuses the individual zinc finger domains in an array [175,176] The zinc fingers designed in this work are based on the Barbas modules. The Barbas group successfully designed, expressed, and cha racterized ZF proteins with 6

PAGE 36

36 contiguous ZF domains that will bind to 18bp of DNA. This target size is sufficient to generate a unique signature in the genome (3.0x10 9 bp) [175] The method involved synthesizing two 3 zinc finger proteins based on the Sp1C sequence and linking them together using a linker sequence TGEKP (described above) [176] The linker, termed the Krppel type linker peptide, was selected because the pentapeptide sequence represented the consensus sequence that was most commonly found in linking z inc finger domains [177] Furthermore, extensive computer modeling demonstrated that this linker sequence was sufficient to maintain positioning and H bond characteristics that are observed in natural zinc finger proteins. Computer m odeling also determined that the 6 ZF proteins remain bound to the major groove of DNA and follow it for two full helical turns. Electro phoretic mobility shift assays (EMSA) DNA footprinting, and in vivo reporter studies confirmed these results and demons trated that both the ZIF268 and Sp1C based 6 ZF proteins were able to bind to their target sequ ences with enhanced affinity (68 74 fold) compared to their 3 finger counterparts [174,175] Interestingly, the in vivo res ults gave higher affinities (300 fold) than in vitro and the authors attribute this to the unstable nature of the proteins in vitro Naturally occurring three finger proteins, such as Zif268 and SP1, bind their preferred sequences with Kd values between 10 nM and 10 pM [178] Observed DNA affinities tend to improve as the number of fingers increases from one to three, but affinity plateaus beyond three fingers, and only modest improvements in affinity (~70 fold) are seen for six finger proteins over correspo nding three finger proteins [125] Zinc fingers have also been successfully fused to a wide array of functional domains such as transcription activation or repression domains, endonucleases, and integrase etc. Remarkably in each case, the DNA binding

PAGE 37

37 properties of these designed proteins were not altered by adding extra domains on either the N terminus or C terminus of the protein [125] To date, 49 ZF domains have been experimentally characterized and validated in the context of polydactyl proteins and are used for protein design by the Barbas laboratory. The zinc finger proteins recognize all 16 GNN DNA triplets, 15 ANN triplets (ATC not represented), 15 CNN triplets (CTC not represented), and only a few TNN tri plets (TGA, TGG and TAG) giving rise to a large variability in target site selection [179,180] Challenges with Artificial DNA Binding Domain s The artificial DNA binding domains based on zinc finger technology is not without limitations. Although investigators have been able t o design fingers with exquisite specificity, the composition of the target is of extreme importance. Zinc finger proteins possess a stronger affinity and specifi city for GNN triplets T herefore sequences enriched in GNN are desired. As the composition of the target sequence changes to be less GNN rich, the specificity will decrease slightly as well [181] Some ZF domains can also recognize a four base subsite t ermed target site overlap (TSO) [182] This results whe n an aspartate residue is located at position + helix making a contact outside of the targeted triplet. There are now databases that flag potential TSO so that alternate sites can be selected [176] Another common critique of the system is that as additional zinc finger domains are introduced, especially in the case of 6 zinc fingered pr oteins, the specificity towards the target site can be altered. This is particularly problematic when functional domains are fused to zinc finger proteins that could potentially give rise to unwanted activities. The exact mechanism as to how this could occ ur is unclear, however a possible explanation could be that the increased number of

PAGE 38

38 contacts in the 6 finger protein elevates the binding energy to a point where individual residue:base mismatches are insufficient to prevent binding [181] Due to the possible off target effects, validation of specificity and affinity for these proteins becomes of extreme importance. In the current study, no functional domains were used to reduce the possibility of off target activity. It is important to also consider that the binding sites in the genome will be somewhat lower than the theoretical total because many of the sites will be inaccessible due to chromatin structure. Furthermore, given that less than 1% of the human genome is coding, most binding sites will occur in regions that should not affect the transcription of any gene [175] In addition, kinetic studies have determin ed that only proteins that bind their target with an affinity of 10 nM or better are productive regulators [178] Therefore, even if a protein binds a site in a regulatory region that is related but non consensus, it may not have sufficient affinity to eli cit a biological response. Summation thalassemia and sickle cell disease, the most common monogenetic diseases world wide. In order to develop effective treatments that woul d lead towards a cure for globin genes. globin gene locus, identifying novel cis elements that po ssess strong regulatory potential would be beneficial towards the development of novel therapies. The goal of the proposed project is to employ a novel technique to study the cis globin gene locus in order to identify DNA sequ ences that carry strong regulatory potential. I designed artificial DNA binding domains (DBD)

PAGE 39

39 comprised of modular zinc finger DNA binding domains (ZF DBD) that will target a DNA region of interest and bind to this site with high affinity and specificity. B inding of the ZF DBD render s the target site inaccessible to endogenous transcription factors and allow for the validation of the target cis element to assess its requirement for globin gene function. This technique provides an advantage over traditional approaches because it can be rapidly employed while maintaining the specificity and efficacy that parallels that of traditional methods.

PAGE 40

40 Figure 1 1. Schematic representation of the structural organizat ion of the human and murine globin loc i located on chromosomes 11 and 7 respectively.

PAGE 41

41 Figure 1 2. A highlight of the cis regulatory elements located within the human globin locus control region HS2 and globin promoter region. The sequence of the cis element s as well as the target interacting proteins and co regulators are listed below [183]

PAGE 42

42 Figure 1 3. Schematic of Zinc Finger binding to DNA. Base specific contacts are made with amino acids located at positions 1, 3, and 6 relative to the start of the alpha helix. The zinc finger domain binds to DNA in an anti parallel fashion such that the amino acid at position 6 makes base specific contact s with the

PAGE 43

43 CHAPTER 2 MATERIAL AND METHODS Zinc Finger Design and Construction Figure 2 1 provides the overall schematic of the 6 fingered zinc finger DNA binding domains (ZF DBD) derived from the Barbas modules and Zinc Finger Tools database [176] Detailed recognition he lices and oligos are listed in T able s 2 1 to 2 3 The ZF DBD was constructed as described previously with some modifications to incorporate the Flag system (Sigma) and a viral approach was used for eukaryotic studies. Briefly, the 6 fingered ZF DBD was split into two reactions that would eac h encode a 3 fingered ZF domain termed ZF 1 3 and ZF 4 6. A series of oligos coding for either the zinc finger constant backbone or the variable oligos tailored to recognize desired target sequences were hybridized by overlap polymerase chain reaction ( PCR ) and gaps annealed in a phase I modular PCR assembly using a high fidelity Pfu polymerase (Aligent). PCR conditions were performed according to the manufacturer s protocol (Aligent) using the following programs. Assembly PCR: 1) 95 o C for 2 min, 2) 95 o C for 30 s, 3) 60 o C for 30 s, 4) 72 o C for 30 s repeating cycles (2 4) 12X followed by a final extension for 5 min at 72 o C. The program for the subsequent PCR termed amplification is as follows: 1) 95 o C for 2 min, 2) 95 o C for 30 s, 3) 60 o C for 30 s, 4) 72 o C for 30 s repeating cycles (2 4) 25X followed by a final extension for 5 min at 72 o C. The ZF fragments ZF 1 3 and ZF 4 6 were purified using a PCR purification kit (Qiagen) along with a canonical linker which was gel purified (Qiagen). Fragments we re digested with the ap propriate restriction enzymes (T able 2 1 ) and ligated with T4 ligase (NEB) in frame to generate the coding sequence of the complete 6 fingered ZF protein. The complete ZF fragment was then PCR amplified according to manufacture s ins truction

PAGE 44

44 with Pfu polymerase. The product was then isolated by gel extraction and subcloned into the digested, CIP treated (NEB), pT7 Flag2 vector (Sigma) using EcoRI/KpnI (NEB) restriction sites. Sequence was verified by Sanger Sequencing before use in in vitro studies. To construct the eukaryotic viral vector, the coding region for the ZF DBDs were isolated by PCR from pT7 Flag with modified oligos (T able 2 1 ) to incorporate a NLS as well as novel restriction sites and introduced into the pMSCV neo vector (clontech) at the HpaI site. Expression and Purification of the ZF DBD 10 ng of the pT7 Flag2 vector containing the desired ZF DBD of interest was used to t ransform BL21 DE3 cells (Invitrogen). Cells were cultured to log phase (OD 0.5) in Luria broth medium supplemented with 100 g/ mL ampicillin and expression of the ZF DBD was induced upon the addition of 1mM isopropyl D 1 thiogalactopyranoside ( IPTG ) (Sig ma) and 100 M ZnCl 2 (Sigma) following a 4 hour incubation at 37 o C. Cells were then centrifuged at 1900xg at 4 o C for 20 min and pellets were resuspended in s torage buffer as described in Cathomen et al [184] Cells were lysed twice by French press, treated with 2 00g DNase I (Sigma) and centrifuged at 44,000xg for 30 min at 4 o C to remove cell debris. Retained supernatant was passed through a 0.2 M filter ( Corning ) and immunopurified using anti Flag M2 magnetic ol. Flag tagged ZF DBDs were eluted using 3X Flag peptide (Sigma) in 10 mM Tris pH 8.0, 90 mM KCl, 100 M ZnCl 2 5 mM DTT (Sigma) 0.1% Triton X 100 (Sigma) and 30% glycerol (Fisher) and stored at 80 o C until further analysis. Protein concentrations were determined by Bradford method and protein purity was assessed by separating the eluted proteins on a 4 15% SDS PAGE (Bio Rad) and staining with Coomassie Blue (Bio Rad).

PAGE 45

45 Electrophoretic Mobility Shift Assay Electrophoretic Mobility Shift Assay ( EMSA ) was p erformed using the Lightshift prepare DNA, double stranded oligonucleotides representing either the murine 90 CAC GGATCCGAATTCCTGCAGGGTAACACCCTGGCATTGGCCAA mutant GGATCCGAATTCAGTACTTTGCCTGTTTCAATGCCTTAACC annealed in 250 mM Tris HCl, pH 7.7 to their complement antisense sequences by heating to 95 o C and cooling in 0.5 o C increments to 4 o C for several hours. Oligonucleotides were then di gested with BamHI (NEB), passed through a G 25 column (GE Healthcare) to purify the probe, and blunted with Klenow polymerase I (NEB) using biotinlyated nucleotides: bio dATP and bio dCTP (Invitrogen) along with unlabeled nucleotides dTTP and dGTP. For bin ding reactions, 1 g of purified recombinant ZF DBD protein was incubated with 2 ng of either biotinlyated WT or mutant oligos. Binding was challenged with 1 g of excess unlabeled WT and Mut DNA and 1 g of mous e M2 anti Flag antibody (Sigma). Immunoblot Analysis Protein isolation was performed as previously described by Leach et al. with modifications to include a mechanical lysis step with a micro grinder (Radnoti) prior to centrifugation at 20,800 x g for 15 min at 4 o C [100 ] Pr oteins were quantified by Bradford Assay (BioRad) and a range of 10 20 g was loaded on a 4 15% TGX Tris HCl gel (Biorad) and separated by SDS PAGE. Resolved proteins were transfer r ed onto a PVDF membrane using the Trans Blot Turbo (Bio rad). Proteins were blocked i n 5% nonfat dried milk in TBST prior to incubation with the following antibodies: mouse anti Flag ( F 3165, Sigma), rabbit anti ZF sera (gift from Dr. Carlos Barbas, Scripps, CA),

PAGE 46

46 mouse anti BRG1 (gift from Dr. Reissman, University of Florida), an d mouse anti Tubulin ( sc 55529 Santa Cruz ). Anti mouse and anti rabbit secondary antibodies were purchased from Santa Cruz. Proteins were detected by ECL reagent (Millipore) and visualized on X ray film (Kodak). Compartmentalization immunoblot was perform ed using the NE and isolated proteins were analyzed as described above. Cell Culture and Transfections/Transductions Murine erythroleukemia (MEL) and Phoenix A cells were cultured in (FBS) and 1% penicillin/streptomycin (Cellgro). Cells were grown at 37 o C with 5% CO 2 and maintained at a density of 2.0x10 5 cells/ mL Induction of MEL erythroi d differentiation was achieved by the addition of 2% (vol/vol) dimethylsulfoxide (DMSO) to the media following a 72 hour incubation. Retroviral mediated creation of stable MEL cell lines was achieved by transfecting the packaging cell line phoenix A with p MSCV ne o containing the target ZF DBD or empty vector via Lipofectamine 2000 (Invitrogen) replication deficient virus was harvested and centrifug ed at 913 x g for 5 min to re move cellular debris. Retai ned supernatant was treated with 2 g/ mL polybrene and added to MEL cells. Cells were incubated for 48 hours before the addition of 800 g/ mL geneticin for selection for 2 weeks before the concentration was lowered to 100 g/ mL g eneticin for maintenance. Immunofluorescence Microscopy A total of 1.0 10 6 induced MEL cells were plated on poly lysine (Sigma) coated plates and cultured overnig ht at 37 C with 5% CO 2 before being fixed with 4% (wt/vol)

PAGE 47

47 paraformaldehyde (Sigma) for 10 min Cells were rinsed thoroughly with PBS and permeabilized with 0.5%Triton X 100 for 20 min, followed by a blocking step with 3% (wt/vol) BSA (Sigma). Cells were probed with a ZF specific antibody, washed with 4% (vol/vol) Tween (Sigma) and incubated with F ITC conjugated secondary antibody (sc 2777, Santa Cruz). Cells were washed again in 4% (vol/vol) Tween before being placed on slides with mounting media containing DAPI (Vecta Shield). Fluorescence was visualized using a fluorescence microscope (Leica). RN A Isolation and Analysis RNA was isolated from MEL cells and mouse fetal liver by using the RNeasy kit the iScript cDNA synthesis kit (Bio Rad). RNA analysis was perfor med as previously described in Liang et al [185] The following primers were used to amplify cDNA: TACGTTTGCTTCTGATTCT CAGAGGCAGAGGATAGGTC CCGCATGAGGCTTGAGAGG TCTTCTTAAGTTCGTTCCGCTTCC GCTTAAGGAACGCCAGACTCCAG ATTTCTCCTGCTCGTCTTTGT GTGGGCCGCTCTAGGCACCA TGGCCTTAGGGTGCAGGGGG (DS). All RT qP actin expression levels. Chromatin Immunoprecipitation ChIP assays were per formed as described previously with the following modifications [185] A minimum of 2.0 10 7 cells were isolated, crosslin ked, and sonicated to produce 200 400 bp chromatin fragments. Lysates were pre cleared with mouse IgG (sc 2025 Santa Cruz ) for 2 h at 4 C with gentle rotation following a

PAGE 48

48 subsequent pre clearing step with protein A Sepharose beads (GE Healthcare; CL 4B). Ly sates were centrifuged at 1,700xg for 10 min at 4 C to pellet beads and the supernatant was retained and incubated with spe cific antibodies overnight at 4 C with gentle rotation. Sheared chromatin was incubated with 10 ZF antibody. Alternatively, 2 10 mouse RNA Pol II (CTD45H8; Upstate Biotechnology, Inc.) anti mouse RNA Poll II serine 2 ( ab5095; Abcam), anti mouse USF2 ( sc 862X; Santa Cruz), anti mouse TAL1 (gift from the Huang lab, University of Flor ida), anti mouse NF E2 ( sc 291X; Santa Cruz), and anti mouse KLF1 ( ab2483; Abcam and a gift from James Bieker, Mount Sinai Hospital, New York, NY). DNA was purified by phenol/ chloroform/isoamyl alcohol and subsequent chloroform extractions and precipitat ed by adding 2.5X volume of 100% (vol/ vol) e thanol in the presence 10 precipitates were washed in 70% ethanol, resuspended in 10mM Tris H Cl pH 8.5, and analyzed by RT qPCR as previously described (24). The following primer pairs were used: mouse major promoter AAGCCTGATTCCGTAGAGCCACAC CCCACAGGCCAGAGACAGCAGC min or GCCATAGCCACCCTGTGTAG AAT CTTGGT CATGCCCATAGCTT (DS) TGCAGTACCACTGTCCAAGG ATCTGGCCACACACCCTAAG and major region GCTCTTGCCTGTGAACAATG (US TGCTTTTTATTTGTCAGAAGACAG

PAGE 49

49 Benzidine Staining Benzidine (Sigma) stock solution was prepared as follows: 3% Benzidine (w/v) in 90% glacial acetic acid and 10% ddH20 from which fresh working solution was then prepared comprised of a ratio of 1:1 :5 for benzidine stock solution, H 2 0 2 and ddH 2 0 respectively. Induced MEL (1.0x10 6 ) cells were centrifuged at 2000 rpm for 5 min and resuspended in 500 l PBS and 100 l of the benzidine working solution was added to the cell suspension. After a 5 min inc ubation period, cells were centrifuged at 2000 rpm for 5 min and resuspended again in 500 l PBS. Cells were counted under a light microscope (Van g uard, Kirkland, WA) using a hema cytometer (Bright Line, Horsham, PA) and blue cells were calculated as a per centage of total cells. Cells were then imaged using the Scope Image 9.0 software (Life Scientz Bio tech, China). Generation of Transgenic Mice The plasmid pMSCV neo containing the ZF DBD was linearized with Acl I (NEB), gel purified using the Qiagen gel extraction kit, resuspended in injection buffer at a concentration of 2ng/l, and injected into FvB oocy tes as described previously [186] After transfer to pseudopregnant recipients, embryos were taken at day 13.5 dpc and imaged using the Leica microscope (Leica), and Q capture software ( Q Imaging B.C, Canada ). RNA and DNA was extracted and analy zed as described previously The globin gene as described above and primers specific for the ZF DBD cDNA: 5' CTCGAGCCCGGGGAGAAAC 3' (US), 5' TCACTTGTCATCGTCGTCCT 3' (DS). The anim al work was approved by the UF IACUC committee.

PAGE 50

50 Figure 2 1. Overall design schematic of the ZF DBD I n order to maximize the e fficiency of the reaction, the 6 fingered ZF DBD is separated into two domains representing ZF 1 3 and ZF 4 6 These domains are assembled separately using a series of overlapping oligonucleotides coding for either the constant ZF backbone (blue) helix reading heads (black). Domains are annealed and gaps se aled in a phase I PCR assembly step. Th e two domains are then ligated together incorporating a non canonical linker in the process to yield the complete 6 fingered ZF DBD which is then amplified by PCR (Phase II) using flanking forward and reverse primers and cloned into the appr opriate express ion vector

PAGE 51

51 Table 2 1. Tailored ZF DBD recognition h elices. Targ e t triplets with the corresponding a mino acids shown were derived from the ZF Tools website [176] ZF helices are positioned in the antiparallel orient ation relative to the DNA target sequence. Amino acids reflecting positions 1 to +6 relative to the start of the alpha helix r eading head of the ZF protein are shown. All sequences are 90 ZF DBD Target Sequence: CTGCAGGGTAACACCCTG ZF Domains ZF1 ZF2 ZF3 LINKER ZF4 ZF5 ZF6 Target Recognition Triplet CTG ACC AAC GGT CAG CTG ZF Helix RNDALTE DKKDLTR DSGNLRV TGEKP TSGHLVR RADNLTE RNDALTE 2KB NC ZF DBD Target Sequence: CTAGAGACCCATGATTGA ZF Domains ZF1 ZF2 ZF3 LINKER ZF4 ZF5 ZF6 Target Recognition Triplet TGA GAT CAT ACC GAG CTA ZF Helix QAGHLAS TSGNLVR TSGNLTE TGEKP DKKDLTR RSDNLVR QNSTLTE +60 ZF DBD Target Sequence: CACCTGACTGATGCTGAG ZF Domains ZF1 ZF2 ZF3 LINKER ZF4 ZF5 ZF6 Target Recognition Triplet GAG GCT GAT ACT CTG CAC ZF Helix RSDNLVR TSGELVR TSGNLVR TGEKP THLDLIR RNDALTE SKKALTE

PAGE 52

52 Table 2 2. Constant primers and oligonucleotides used in zinc finger c onstruction Oligonucleotides and primers used for the construction of the ZF DBDs. Sequences are Primer Nomenclature C1 (ZF 1 3) CGGGGAGAAACCCTATAAGTGTCCGGAGTGTGGCAAGTCGTTCTC C1 (ZF 4 6) TATAAGTGTCCGGAGTGTGGCAAGTCGTTCTC C2 GCGTACCCACACGGGCGAAAAGCCGTACAAATGCCCAGAATGCGGT AAATCCTTCAGC C3 CGGGGAGAAACCCTATAAGTGTCCGGAGTGTGGCAAGTCGTTCTC General Primers Forward Primer (ZF1 3) CAGGACGAATTCACTCGAGCCCGGGGAGAAACCCTATAAG Forward Primer (ZF4 6) CAGGACGGATCCTATAAGTGTCCGGAGTGTGGCAA Reverse Primer (ZF1 3) CAGGACAAGCTTGTGAGTGCGCTGGTG Reverse Primer (ZF4 6) CAGGACGGTACCGCTGGT TTTTTTGCCGGT GTGAGTGCGCTGGTG Eukaryotic Forward Primer ACGGTTAACATGCCGAAAAAAAAACGC AAAGTGCTCGAGCCCGGGG AGAAAC Eukaryotic Reverse Primer GCAG TTAACTCACTTGTCATCGTCGTCCT

PAGE 53

53 Table 2 3. Variable oligonucleotides used in zinc f inger c onstruction Oligonucleotides encoding the variable regions for ZF1 3 and ZF 4 6 of the ZF DBDs targeted towards the 90, +6 0 and 2KB cis elements are shown. All sequences are Primer Nomenclature Variable Oligos Oligonucleotides for 90 ZF DBD V1 (CTG) (ZF1 3) GCCCGTGTGGGTACGCTGATG TTCGGTCAGCGCATCGTTGCG CGAG AACGACTTGCCACAC V2 (ACC) (ZF1 3) CCTGTATGCGTCCGTTGATG GCGGGTCAGATCTTTTTTATC GCTGAAG GATTTACCGCAT V3 (AAC)(ZF1 3) TTGTGAGTGCGCTGGTG CACGCGCAGGTTGCCGCTATC ACTAAAACT CTTCCCACATTCG V1 (GGT) (ZF4 6) GCCCGTGTGGGTACGCTGATG GCGCACCAGATGGCCGCTGGT CGAG AACGACTTGCCACAC V2 (CAG) (ZF4 6) CCTGTATGCGTCCGTTGATG TTCGGTCAGGTTATCCGCGCG GCTGAA GGATTTACCGCAT V3 (CTG)(ZF4 6) CGGTGTGAGTGCGCTGGTG TTCGGTCAGCGCATCGTTGCG ACTAAAA CTCTTCCCACATTCG Oligonucleotides for +60 ZF DBD V1 (GAG) (ZF1 3) : GCCCGTGTGGGTACGCTGATGGCGCACCAGGTTATCGCTGCGCGAG AACGACTTGCCACAC V2 (GCT) (ZF1 3) : CCTGTATGCGTCCGTTGATGGCGCACCAGTTCGCCGCTGGTGCTGAA GGATTTACCGCAT V3 (GAT)(ZF1 3) : TTGTGAGTGCGCTGGTGGCGCACCAGGTTGCCGCTGGTACTAAAACT CTTCCCACATTCG V1 (ACT) (ZF4 6) : GCCCGTGTGGGTACGCTGATGGCGAATCAGATCCAGATGGGTCGAG AACGACTTGCCACAC V2 (CTG) (ZF4 6) : CCTGTATGCGTCCGTTGATGTTCGGTCAGCGCATCGTTGCGGCTGAA GGATTTACCGCAT V3 (CAC)(ZF4 6) CGGTGTGAGTGCGCTGGTGTTCGGTCAGCGCTTTTTTGCTACTAAAA CTCTTCCCACATTCG Oligonucleotides for NC ZF DBD V1 (GAG) (ZF1 3) : GCCCGTGTGGGTACGCTGATGGCTCGCCAGATGGCCCGCCTGCGAG AACGACTTGCCACAC V2 (GCT) (ZF1 3) : CCTGTATGCGTCCGTTGATGGCGCACCAGGTTGCCGCTGGTGCTGAA GGATTTACCGCAT V3 (GAT)(ZF1 3) : TTGTGAGTGCGCTGGTGTTCGGTCAGGTTGCCGCTGGTACTAAAACT CTTCCCACATTCG V1 (ACT) (ZF4 6) : GCCCGTGTGGGTACGCTGATGGCGGGTCAGATCTTTTTTATCCGAGA ACGACTTGCCACAC V2 (CTG) (ZF4 6) : CCTGTATGCGTCCGTTGATGGCGCACCAGGTTATCGCTGCGGCTGAA GGATTTACCGCAT V3 (CAC)(ZF4 6) : CGGTGTGAGTGCGCTGGTGTTCGGTCAGGGTGCTGTTCTGACTAAAA CTCTTCCCACATTCG

PAGE 54

54 CHAPTER 3 CHARACTERIZING THE ZF DNA BINDING DOMAIN Background Transcription is regulated by proteins that interact in a sequence specific manner with the DNA at promote rs or other regulatory elements. Most transcription factors belong to families of proteins that share characteristic DNA binding or protein/protein interaction domains and often recruit co regulator complexes that modify chomatin structure, recruit transcription complexes, or modulate transcription elongation rates [187,188] Because multi ple members of transcription factor families are usually expressed in any given cell type it is difficult to assess in the context of the cell which protein mediates the effect of a cis regulatory DNA element. Furthermore, transcription factors that regul ate expression of genes often bind to multiple sites in promoter or enhancer regions [168] The analysis of the functional role of cis regulatory elements in the context of intact cells or in vivo therefore is challenging. Transgenic or reporter gene assays are powerful but lim ited by potential position effects. Genetic manipulation of cis regulatory elements is technically challenging and time consuming. The zinc finger domain is the most commonly found DNA binding domain in eukaryotic transcription factors [122] This domain is characterized by a DNA binding alpha helix which is stabilized by an adjacent finger like structure in which h istidine or cysteine residues coordinate a zinc atom [118] The mode of DNA binding by zinc finger proteins is very well understood. This knowledge led to the development of artificial proteins contai ning a defined zinc finger DNA binding domain (ZF DBD) that interacts with a specific sequence of interest [170] Each alpha helix reading head of a ZF DBD recognizes 3 to 4 specific DNA base pairs and such reading heads can be designed to

PAGE 55

55 essentially recognize most triplet s of DNA base pairs [118] Furthermore, these interactions are modular in nature and therefore arranging these zinc finger domains in tandem provides the recognition of asymmetrical DNA sequences [175] Prev ious studies often link these a rtificial ZF DBDs to effector domains that either enhance or repress transcription. Furthermore, ZF DBDs have been quite extensively utilized to target nucleases to specific genomic sites to induce recombination [180,189] Most of the artificial zinc finger proteins studied to date appear to interact with desired target sequences with high specificity, however, off targets have been detected [190] The presence of effec tor domains can lead to additional unwarranted effects. For example, activation or repression domains can interact with proteins to modulate transcription. Thus expression of these effector domains fused to ZF DBDs could sequester proteins and change expre ssion of multiple genes, not just those targeted by the artificial transcription factor [190] In the present study we wished to examine if ZF DBD s without effector domains could be utilized to compete with endogenous transcription factors at specific cis regulator elements thus neutralizing this site. Our purpose is to assess applicability of using ZF DBDs as a screening tool to assess the function of potential cis regulatory elements in vivo To address this question, I designed and expressed a ZF DBD harboring 6 zinc finger domains that specifically interacts with a known critical cis globin gene expressi on the 90 CAC box [191] I ZF DBD The CACCC site, located globin transcription start site, interacts with transcription factor KLF1, a zinc finger protein related to Sp1 [127] KLF1 deficiency leads to

PAGE 56

56 embryonic lethality in mice due to anemia [130] Mutations of the CACCC site in the thalassaemia [96] I designed and expressed a ZF DBD targeti min or globin 90 CACCC site. Statistically, an 18bp sequence occurs only once per mouse and human genome [175] Binding assays indicated that the ZF DBD specifically interacted with DNA min or globin 90 CACCC site. Expression of this ZF DBD min or globin gene but n ot that of other KLF1 regulated genes. Transient transgenic embryos expressing the ZF DBD are phenotypically normal but exhibited redu min or globin gene. The data demonstrate that ZF DBDs without effector domains can be used to neutralize and ther e by assess the function of specific cis regulatory DNA elements in vivo [191] Results To demonstrate the feasibility of using artificial DNA binding domains to neutralize the function of a cis regulatory DNA element, I focused on the 90 CACCC box sequence located u minor globin gene promoter. This ci s element is known to interact with the transcription factor KLF1 an d is critical for high minor globin gene expression in erythroid cells [192] I hypothesized that n eutralization of this site by an artificial DNA binding domain would prevent KLF1 from interacting with its target cis element minor globin gene expression. Thus, I designed a ZF DBD comprised of six z inc finger domains (herein referred to as the ZF DBD) that would bind to 18bp of DNA flanking the target 90 CACCC box (Fig. 3 1A) I designed the ZF DBD using the Zinc Finger Tools website and amino acid nucleic acid recognition sequences were derived from the Barbas modules [176] ZF DBD proteins were then assembled and generated usi ng a

PAGE 57

57 modified protocol from Muller Lerch [184] The ZF DBD was cloned in the pT7 Flag2 vector and ex pressed in and purified from E.c oli (Fig.3 1B and C ). The ZF DBD protein migrated at an expected size of 24 kDa. I next examined the DNA association activ ity of the purified recombinant ZF DBD using electrophoret ic mobility shift assays (EMSAs) shown in Fig.3 1D The ZF DBD specifically interacted with an oligonucleotide containing the 18 bp target WT sequence harboring the 90 CACCC site but not with mutant oligonucleotides. An excess of unlabeled WT oligonucleotides efficiently competed for the binding while mutant oligonucleotides did not perturb binding. The addition of a Flag antibody to the binding reaction eliminated formation of the protei n DNA complex indicating that this interaction was specific. These data demonstrate that the ZF DBD interacts with the target 18bp sequence encompassing the 90 CACC C box in a sequence specific manner. For eukaryotic in vivo studies, the coding sequence for the ZF DBD was cloned into the pMSCV neo plasmid and modified to include a NLS. After packaging, viruses either harboring the vector encoding the ZF DBD or an empty vector were used to transduce mouse erythrole ukemia (MEL) cells. Single cell clones were generated from transd uced MEL population pools and c lonal variability was minimal with respect to expression of the ZF DBD and similar globin gene exp ression profiles were observed. MEL cells are erythroid progenitor cells that express low levels globin genes. Several compounds have been shown to induce differentiation of MEL cells including Dimethylsulfoxide (DMSO). Incubation of MEL cells for 3 days in the presence of 2% DMSO results in a dramatic increase in globin gene expression [193] To examine the cellular localization of the ZF DBD I first

PAGE 58

58 performed immunofluorescence microscopic analysis in induced MEL cells using an antibody against the backbone of the ZF DBD (Fig. 3 2A). The data demonstrate that the ZF DBD localized to the nucleus. I next fractionated the MEL cells into cytosolic and nuclear compartments and performed an immunoblot analysis (Fig. 3 2B). Brg1, a nuclear chromatin regulatory protein and tubulin, a predominantly cytoplasmic protein were used as controls to indicate complete cellular fractionation. The ZF DBD was only present in the nuclear fraction in induced MEL cells confirming immunofluorescence results I analyzed KLF 1 dependent gene expression in single cell clones from MEL cells that stably expressed either the ZF DBD or empty vector. Upon phenotypic analysis MEL cell containing the ZF DBD when pelleted were pale compared to vehicle control cells suggesting that globin synthesis was impaired. (Fig. 3 3A). This wa s confirmed by staining in duced MEL cells with benzidine a stain that reacts with intact hemoglobin for form a blue color indicative of adequate globin synthesis, and found that there was a marked reduction in benzidine positive cells that stably expressed the ZF DBD to levels of approximately 30% compared to control cells (Fig. 3 3B and C). I next extracted RNA and minor globin. Vehicle minor globin expression u pon i nduction as expected Cells expressing the ZF DBD however revealed a minor globin expression in both uninduced and induced MEL cells (Fig. 3 3D). minor globin and to va lidate our hypothesis that the ZF DBD was interfering with KLF1 occupancy at minor globin thus causin g the reduction in expression, I analyzed expression of

PAGE 59

5 9 other KLF1 regulated genes in erythroid cells. Dematin (also known as ba spectrin (Fig. 3 3 E and F) are genes both induced upon erythroid differentiation and positively regulated by KLF1. Importantly, the sequences of the KLF1 binding sites in spectrin and dematin promoter regions are very similar to the 90 CACCC s ite in minor globin gene promoter There were no differences in expression levels spectrin and dematin in induced and uninduced MEL cells expressing the ZF DBD when compared to vehicle control cells demonstrating that expression of the ZF DBD did not affect expression of these genes (Fig. 3 3 E and F) This demonstrates that the ZF DBD specifically reduces e xpression of the globin genes but did not affect expression of other KLF1 target genes in erythroid cells. I next wanted to map the in vivo occupancy of the ZF DBD to chromatin by chromatin immunoprecipitation (ChIP). Our original attempts using an anti flag antibody did not yield conclusive results. I obtained antisera from Dr. Carlos Barbas (Scripps, La J olla, CA), which recognizes the backbone of the ZF DBD. The specificity of the ZF antibody was verified by immuno blot analysis and was consistent with results s een with the anti Flag antibody. I first examined the occupancy of the ZF mi nor globin gene promoter, to the promoter of the dematin gene, and to locus control region element HS2, which all contain KLF1 binding sites (Fig. 3 4A). The data demonstrate that the ZF DB minor globin promoter but not w ith LCR element HS2. Furthermore, expression of the ZF DBD drastically reduced minor globin promoter but not with LCR HS2 (Fig. 3 4B). I also observed transient binding of the ZF DBD to the dematin promoter but it w as not as pronounced minor globin promoter region

PAGE 60

60 Transient binding possibly occurred due to the target sequence similarities in the promoter regions of these genes (Fig. 3 4E ). Y et interestingly, KLF1 binding to this region was not affected (Fig. 4 4A and B) To address the question if binding of the ZF DBD affects the recruitment of tra minor globin gene promoter, I performed ChIP using antibodies specific for RNA polymerase II (Pol II). Pr evious studies have shown that Pol globin gene promoter and that the binding increases upon induction of MEL cell differentiation [194] As shown in Fig 3 4C., Pol II bound efficiently to minor globin promoter and to a lesser extent to LCR element HS2 in induced MEL cells harboring the empty vector. The interaction of Pol II was globin promoter in MEL cells expressing the ZF DBD. Interestingly, the binding of Pol II at LCR HS2 was also somewhat reduced in these cells despite the fact that KLF1 binding was not perturbed at this site which could in globin ZF DBD The data demonstrate that occupancy of the ZF minor promoter prevents KLF1 from binding to the 90 CACCC site t hereby inhibiting the recruitment of transcription complexes (Fig. 3 4D) To test the effect and applicability of introducing an artificial DNA binding domain in a complete in vivo system, I generated and analyzed transient transgenic embryos ubiquitously expressing the ZF DBD There was the possibility that transgenic embryos expressing the ZF DBD would die in utero due to defects in hemoglobin synthesis. Thus, we decided to analyze transient transgenic and wild type embryos at 13.5 dpc. The s witch from the embryonic to the fetal/adult globin expression program

PAGE 61

61 occurs around day 11.5 dpc [3] I analyzed three transgenic and 3 wild type mice. Two out of the three transgenic embryos revealed minor globin gene expression (Fig. 3 5B). Fig. 3 5A illustrates a representative transgenic 90 ZF DBD expressing embryo and as can be seen, these embryos were paler in comparison to non transgenic littermates. Importantly, transgenic embryos did not reveal any obvious developmental phenot ype in dicating that expression of the ZF DBD did not affect development and differentiation. This confirms the possibility that ZF DBD without effector domains to minimize non specific int eractions can be expressed in in vivo system s Discussion The functional role of cis regulatory DNA elements and interacting proteins is difficult to assess in vivo Transgenic studies or stable reporter gene assays are hampered by the fact that sequences are taken out of their natural environment and may be influenc ed by neighboring chromatin at the site of integration Artificial DNA binding domains represent promising tools for studying and modulating gene regulation in vivo As shown in this study, ZF DBDs without effector domains can be used to alter expression o f genes by preventing transcription factors from accessing DNA at specific sites. These synthetic proteins can be used to assess the function of a cis regulatory DNA element and the identity of interacting proteins in vivo Several different strategies hav e been developed to generate artificial binding domains; the majority are based on DNA binding domains found in either ZF or transcription activator like effector (TALE) proteins [178,195] TALE proteins, identified in prokaryotic plant pathogens, are modular in nature and like ZF proteins can be combine d to recognize extended DNA sequences [196] The advantage of ZF proteins over TALE proteins is that they are relatively small,

PAGE 62

62 minimizing effects resulting from potential protein interactions and perhaps in the long term allowing deliv ery by protein transdu ction [197] Much is known about the helix reading head that interact with specific DNA base pair triplets, and this led to the development of al gorithms that have been used to design artificial ZF proteins that bind to sp ecific DNA sequences [198] Klug and colleagues first d escribed the use of a synthetic 3 ZF protein that blocked the activating sequence that arose from a chromosomal translocation [169] In this study, I used the Zinc Finger Tools web site to design a ZF min or globin gene promoter [176] ZF DBD interacted with the min or globin CACCC box and efficiently blocked association of KLF1 with this site. As minor globin gene expression was reduc ed. In previous studies, Bieker and colleagues over expressed the KLF1 DNA binding domain in erythroid cells, maj or globin expression levels [199] However, in contrast to ZF DBD, the KLF1 binding domain interacts with many gene regulatory elements in erythroi ZF DBD did not interact with LCR element HS2, which also contains a KLF1 binding site. I ZF DBD with the dematin promoter in induced MEL cells. However, this binding event did not affect binding o ZF DBD failed to interfere with KLF1 function at this particular site. I also observed a ZF DBD The reason for globin promoters cooperatively regulate each other. This would be consistent with a recent study demonstrating extensive promoter promoter interactions and cross regulation in

PAGE 63

63 mammalian cells [200] Alternatively, the artificial zinc finger protein could bind to both adult globin gene promoters due to close proximity. A recent study by Lam et al. demonstrated that the majority of modular artificial C2H2 ZF proteins bind DNA with high sequence specificity and prefere ntially associate with sites to which they were targeted [201] Although we did not perform a global analysis of the interaction of the ZF DBD in MEL cells, the analysis of selected sites that resemble the targeted site suggests that t ZF min or globin gene promoter. This is further supported by our observation that transient transgenic ZF globin gene expression but did not reveal any other developmental abnormalities. The study presented here demonstrates that ZF DBDs without effector domains can be used to alter expression patterns of genes in vivo. These artificial proteins thus provide a tool for modulating and analyzing cis regulatory DNA elements and may also impact therapeutic approaches aimed at altering expression of specific genes

PAGE 64

64 Figure 3 1 In vitro characterization of the ZF DBD ( A ) Representation of the adult min or globin gene with the ZF DBD (oval) binding to the 90 KLF1 b min or globin gene. The 18 bp sequence targeted by the ZF DBD is shown with the CACCC box highlighted in green ( B) Immunoblot using a flag specific antibody. The 90 ZF DBD migrated with an apparent molecular weight of 24 kDa (C ) SDS PAGE and subsequent Coomassie stain of induced and uninduced E.coli (lanes 1 and 2), respectively. The ZF DBD was immunopurified from crude protein lysates using anti flag magnet ic beads (lane 4 ). (D ) Electrophoretic mobility shift analysis (EMSA) of the purified recombinant ZF DBD using oligonucleotides representing the 90 KLF1 site (WT) or a mutant oligonucleotide (left panel lanes 1 and 3). Binding of the ZF DBD to the labeled WT oligonucleotide was abolished in the presence of 500 molar excess of unlabeled WT competitor but was unaffected by excess of unlabeled mutant oligonucleotides (right panel). The lane labeled WT (*) included a Flag specific antibody during t he binding reaction (left panel).

PAGE 65

65 Figure 3 2 The ZF DBD l ocalizes to the nucleus in induced MEL cells ( A) To visualize the location of the ZF DBD, MEL cells were stably transduced, fixed and stained. DAPI stains chromatin in the nucleus (blue) and the ZF DBD was visualized using antisera against the ZF backbone (green). The bottom panel represents the merge of the two previous panels (B) Induced stable MEL cells were fractionated into cytoplasmic [C] and nuclear fractio ns [N] which were subjected to immunoblot analyses using antibodies specific for tubulin, and anti Flag, as indicated

PAGE 66

66 Figure 3 3 globin gene transcription in MEL cells expressing the ZF DBD. (A) Phenotypic analyses of induced MEL cells that were chemically induced for 72h with 2.5% DMSO. (B ) Benzidine staining of MEL cells expressing the ZF DBD or harboring the empty vector. (C) Percent benzidine positive ME L cells expressing the ZF DBD with number of benzidine positive cells in vehicle control MEL cells set at 100%. D F. Quantitative RT spectrin (E), and dematin (F) transcripts in uninduced (UN) or induced (IN) MEL ce lls expressing either the ZF DBD or harboring the empty vector. Data presented is the average of 3 independent experiments SEM

PAGE 67

67 Figure 1 4 globin gene promoter by the ZF DBD in MEL cells. ChIP analysis of MEL cells expressing the ZF DBD or harboring the empty vector. (A and B) ChIP analysis of the interaction of the ZF DBD (A) or KLF1 (B ) with LCR min or globin gene promoter, and the dematin promoter, as indicated. (C) ChIP analysis of the interaction of RNA polymerase II (Pol II) w min or globin gene promoter. Data represent two independent ChIP experiments with PCRs run in triplicate SEM. (D) Four sequences derived from either the dematin or spectrin promoter harboring potential CAC boxes were aligned with the ZF DBD target site (18bp sequence shown above the line). Sequence homology is indicated by the number in parentheses

PAGE 68

68 Figure 3 5 Transient transgenic mouse embryos expressing the ZF DBD exhibi t globin ge ne. (A) Images of 13.5 dpc wild type (WT) and ZF DBD transgenic embryos. (B) Quan titative RT PCR globin gene expression in WT and ZF DBD transgenic embryos. Expression levels in WT were set at 1. (C) Model illustrating ZF DBD m ediated disruption of KLF1 binding and Pol II recruitment at the adult globin gene promoter.

PAGE 69

69 CHAPTER 4 CHARACTERIZING THE +60 EBOX ZF DNA BINDING DOMAIN Background Cis element redundancy often presents a challenge in molecular biology especially when attempting to interrog ate the functional potential of a cis element in vivo [168] To date, t echniques such as ChIP sequencing can provide a means to address this problem ; however gi ven that ChIP sequencing analyses reflect 100 b p reading frames that often contain numerou s cis elements it remains difficult to identify which element truly harbors the function [202] Artificial DNA binding proteins comprised of zinc finger domains can surmount this challenge. Zin c finger DNA binding domains (ZF DBD) b ind to DNA in a sequence specific manner with high affinity and neutralize a target site. A single zinc finger domain can recognize 3 base pairs of DNA an interaction that can be extended by adding addition al zinc fin ger domains in tandem to allow the recognition of extended asymmetric DNA sequences [118,181] The benefit of em ploying ZF DBDs includes rapid delivery and more importantly, enhanced resolution for cis element detection The enhanced resolution allows target ing of sequences ranging from 6 to 18 base pairs with 18 being optimal as this sequence length confer s a unique signature within the genome [175] We employ the ZF DBD technology to evaluate the putative function of E box elements comprised of the sequence CANNTG within the murine beta globin promoter region. Helix loop helix proteins such as the heterodimer ic transcription factor upstream stimulatory factor (USF) which is composed of the closely related proteins USF1 and USF2, bind s to E box elements and has been shown thr ough ChIP analysis

PAGE 70

70 to occupy the beta globin promoter region where it is involved in mediating high level expression of the adult beta globin gene [147,156] Given that t here are two predominant E box elements located at positions +20 and +60 relative to the murine beta major transcription start site it is difficult by conventional methods to di scern which E box element truly harbors the function in vivo [100] Unders tanding the intricacies of beta globin regulation is warranted to improve therapies for individuals with hemogl obinopathies and detailing which of the two E box elements bind functional USF is critical and could provide insight as to a potential target sit e for therapy. Given that i n vitro mutagenesis studies indicate that the +60 E box elements likely carries the functional relevance, I designed a ZF DBD to target and neutralize 18bp encompassing the +60 E box to determine functional relevance in vivo [194] N eutraliz ing this element will prevent endogenous transcription factors from interacting with the target cis ele ment and beta major expression can be evaluated. In our study, targeting the +60 E box led to a reduction in major globin expression in a dose depende nt manner relative to the amount of ZF DBD protein expressed in the murine erythroleukemia cell line I also observed a dose dependent reduction in RNA polyermase II (Pol II) recruitment to the major promoter region relative to vehicle control cells. This suggests that the +60 E box is critical for high level expression as well as recruitment of Pol II to the beta globin gene. In order to ensure that the introduction of a ZF DBD to the beta globin locus is not the causative factor for altering gene expression, I stably expressed a ZF DBD targeted towards a region 2KB upstream of the beta major promoter th at is predicted to be inert based on global ChIP data from UCSC genome tracks. Neutralizing this site did

PAGE 71

71 not alter bet a globin expression indicating that the effects seen with the +60 ZF DBD is due to specific neutralization of the cis element Results ZF DBDs derived from the Barbas modules were designed t o neutra lize the +60 E box and 2KB cis elements [176] The designed ZF DBD is composed of 6 zinc finger domains to target 18bp regions flanking the desired target sites (Figure 4 1A ). The coding region for the ZF DBD was modified to include a Flag and nuclear localization signal (NLS) tag s and placed into the retroviral pMSCV vector Murine erythroleukemia cells (MEL) were then transduced to generate stable populations for the 2KB ZF DBD (denoted as the negative control (NC) ZF DBD)) through geneticin sulfate selection. S ingle cell clones stably expressing either low levels or medium levels of the +60 E box ZF DBD protein, were selected to evaluate and titrate the concentration of ZF DBD needed to provide optimal neutralization (Figure 4 1C). To confirm nuclear localization, MEL cells har boring the 2KB and the +60 ZF DBDs were fractionated into cytoplasmic and nucle ar fractions (Figure 4 1B and C respectively). The nuclear protein BRG1 and the cytoplasmic p rotein tubulin were used as controls to indicate complete fractionation. The ZF D BDs localize to the nuclear fractions in MEL cells while displaying no stai ning for vehicle treated cells. To determine the effect on adult major expression, RNA was extracted from uninduced and DMSO induced MEL cells Quantitative RT PCR analysis in s table MEL cells harboring the +60 ZF DBD indicated that major globin expression levels were significantly decreased compared to vehicle control cells. Furthermore, this decrease occurred in a dose dependent manner relative to the concentration of ZF DBD protein

PAGE 72

72 present (Figure 4 2B). To confirm the specificity of targeting, additional E box containing erythroid specific genes such as Dematin and Spectrin were evaluated and displayed no change in expression compared to control cells (Figure 4 2B). As ano ther form of control, major globin transcripts from MEL cells harboring the NC ZF DBD targeting a region a few kilobases upstream did not change compared to control MEL cells (Figure 4 2A). This indicates that the effect observed with the +60 ZF DBD cont aining cells was due to the specific targeting and neutralization of the +60 E box cis element by the ZF DBD and not simply due to the introduction of an artificial DNA binding protein to the major globin promoter region. Next to confirm the specificity of the ZF DBDs, I examined target occupancy by chromatin i mmunoprecipitation (ChIP) in induced MEL cells Both the +60 and NC ZF DBDs occupied the designated target regions at the major promoter and 2KB regions respectively (Figure 4 3A and B).To evaluate specificity of targeting, other regions within the beta globin locus were examined. MEL cells harboring low levels of the +60 ZF DBD did not display significant binding to other select regions within the beta globin gene locus hig hlighting the specificity of the ZF DBD MEL cells harboring higher levels of the +60 ZF DBD however did have significant off target binding at the 2KB and major regions This could be due to excessive levels of protein or saturation of the binding t o the target site causing it to bind to other regions. The NC ZF DBD binding to the 2KB site though significant, was weak over non specific controls T his was likely attributed to the fact that ChIP was performed on a population level with heterogeneous e xpression of the NC ZF DBD resulting in increased variability and less evaluative power relative to the homogeneous expression in the single cell clones.

PAGE 73

73 To determine the effect of neutralization the target sites I examined candidate erythroid specific t ranscription factors that are known to bind to E box sequences such as the Upstream Stimulatory Factor heterodimer complex (USF1 and USF2) as well as the T cell acute lymphocytic leukemia protein 1 (TAL1). Both USF and to a lesser extent TAL1 occupied bot h HS2 of the LCR and the major promoter in induced vehicle treated control MEL cells. I nterestingly, USF 2 levels displayed reduced occupancy at the major promoter while TAL1 displayed increased occupancy Though these findings did not cross the threshold of significance, it suggests that the USF1/USF2 complex may be the transcription factor that predominately interacts with the +60 E box cis element The increase d binding of TAL1 could be a compensatory mechanism perhaps through the interaction w ith the +20 E box e lement. Although this hypothesis cannot be verified by ChIP as the two regions are too close in proximity it is an attractive explanation of why I see a trending increase in TAL1 occupancy at the major promoter region Curiously, a si gnificant and dramatic reduction in USF2 occupancy was also observed at the LCR HS2 element. This is an intriguing finding and may suggest co regulation between HS2 and major promoter regions. Indeed, HS2 of the LCR and the major promoter are known to come in to close proximity as determined by 3C analysis and this interaction is critical for the high level expression of the adult globin genes. TAL1 occupancy at HS2 did not display significant differences compared to control MEL cells. Of further note, b oth USF2 and TAL1 displayed altered occupancy major gene in MEL harboring the +60 ZF DBD a phenomenon that warrants further investigation.

PAGE 74

74 Since it is hypothesized that USF is involved in the recruitment of the RNA polymerase II (Pol II) to the LCR for subsequent transfer to the major promoter, the reduction in USF2 occupancy due to the neutralization of the +60 E box element observed may also lead to a reduction in Pol II binding at the LCR and the major promoter. To test this hypothesis, I mapped Pol II occupancy in induced MEL cells harboring the +60 ZF DBD (Figure 4 5 A and B ) Vehicle control cells display the characteristic binding pattern with accumulation of Pol II both at the LCR and the major promoter wit major gene is approached In MEL cells harboring the +60 ZF DBD however, t otal Pol II levels as well as the serine 2 modified representing the initiating form of Pol II displayed a significant and surpr ising increase in occupancy at HS2 of the LCR rather than a decrease as expected This increase occurred in a dose dependent manner with respect to +60 ZF DBD expression and suggests that Pol II is being stalled and therefore accumulating at HS2 Indeed, u pon examination of Pol II occupancy at the major promoter and within the body of the gene, levels were significantly reduced compared to vector control cells. The level of reduction also displayed a dose responsive association. I also observed an increas major gene relative to vehicle control cells that warrants further investigation (Figure 4 5B). Poll II as well as USF2 occupancy in the NC ZF DBD containing induced MEL cells displa yed no change from vector treated cells at the 2KB site as well as the major promoter region s consistent with the prediction that neutralizing the 2KB element should not perturb major globin regulation. I did however observe reduced occupancy of Pol II at HS2 of the LCR as well as an increase in USF2 levels which was attributed

PAGE 75

75 to the variability typically observed when evaluating factor occupancy in a heterogeneous population (Figure 4 5C). Discussion To assess whether the +60 E box cis element located 60 bp downstream of the major globin gene carried functional relevance in vivo I designed an artificial zinc finger DNA binding domain (ZF DBD) to neutralize 18bp encompassing the target site. Successful stable expression and localizatio n of the ZF DBD into murine erythroleukemia cells (MEL) was confirmed by compartmentalization immunoblo t analysis. major globin expression was reduced in MEL cells harboring the +60 ZF DBD in a dose dependent manner while no changes to other selected ery throid specific genes were affected indicating the specificity of targeting. Specificity to the target site was confirmed by ChIP analysis which indicated that the +60 ZF DBD occupied the major promoter region in a specific dose responsive manner. Non sp ecific occupancy was detected at the 2KB major globin gene in a single cell clone that expressed higher levels of the +60 ZF DBD. T his could be due to over saturation of binding to the target site due to the increased l evels of ZF DBD protei n causing transient occupancy at other regions. This indicates that it may be beneficial to select clones with a more moderate physiological like expression pattern to prevent non specific interactions. Neutra lizing the +60 E box e lement le d to a decrease in USF2 occupancy at the major promoter and curiously also at HS2 of the LCR as well as major globin gene. This was an intriguing finding and could be e xplained by the complex 3 dimens ional interaction betw een the LCR and the major gene that has been extensively documented by 3C analysis [105] Regardless, significant reductions in

PAGE 76

76 USF2 recruitment were observed which suggests that this transcription factor may be the likely candidate that interacts with the +60 E box element. Occupancy of TAL1 in comparison was largely unaffected, particularly at the LCR and the major promoter, where dramatic reductions in USF2 occupancy were seen I did note a significant decrease in TAL1 occupancy compared to vehicle treated cells major gene which could indicate a potential role for TAL1 but this warrants further investigation. Clone 15 that harbored higher levels of the ZF DBD protein exhibited major gene. This may be challenging to interpret given the over saturation of the protein producing non physiological effects. The most remarkable finding was the mapping of Pol II. Our hypothesis was that Poll II levels should be reduced at the major promoter as well as the LCR consistent with the reduction in USF2 occupancy since it has been shown that USF is involved in the recruitment of the po lymerase first to the LCR for subsequent delivery to the major globin promoter. Conversely, I observed an increase in both total Poll II levels as well as the serine 2 phosph orylated form a marker for active Pol II ). A possible explanation for this fin ding is that the inhibition of USF binding to the +60 Ebox by the +60 ZFDBD interferes with the transfer of Pol II to the promoter. This is consistent with a previous study from the Bresnick laboratory [203] The authors demonstrated that deficiency of transcription factor NF E2, which can be crossl inked to the LCR and the adult globin gene promoter caused a reduction of Pol II binding at the promoter but not at the LCR. The data thus support a model according to which NF E2 and USF collaborate in the transfer of Pol II from the L CR to the globin gene promoter [204] The observation that USF binding at LCR HS2 decreased in cells expressing the +60 ZF DBD suggests that

PAGE 77

77 the binding of USF at the LCR is indirectly mediated th rough i ts association with the globin gene promoter. In contrast, the NC ZF DBD through its specific binding at the 2KB element a sequence predicted to be inert revealed no change in major globin expression, and no difference in recruitment or occupancy o f USF2 or Pol II at the major promoter I did observe changes in Pol II and USF2 occupancy at HS2 of the LCR and the level of binding of NC ZF DBD was relatively weak which is attributed to heterologous population variation. It will be beneficial to exam ine the effects of the NC ZF DBD on a single cell level since the re sults on the population scale are promising. In our study, I successfully demonstrate that ZF DBDs can be used to effectively target and neutralize cis regulatory elements in vivo. Due to the specificity of binding however as well as the high affinity for the target site over most endogenous factors, it may be only feasible to examine cis regulatory elements outside of gene bodies. The targeting of ZF DBDs to the transcribed region of a ge ne could be problematic due to the possibility that they may interfere with the elongation properties of Pol II. An indication for this is the reduced levels of serine 2 phosphorylated Pol II at the LCR an d the globin gene in cells expressing the + 60 ZF DBD Barring this cautionary statement artificial ZF DBDs still remain extremely effective tools for examining the functional potential of select cis regulatory elements in vivo

PAGE 78

78 Figure 4 1. Zinc Finger DNA binding domains (ZF DBD) stably localize to the nucleus in MEL cells. A) Schematic of the t arget sites for the 2KB and +60 ZF DBDs are shown r elative to the start of the major globin gene. B) Compartmentalization immunoblot where cells were fractionated into cytosolic (C) and nuclear (N) fractions. Brg1 and Tubulin (top and middle panel respectively) represent controls. The 2KB ZF DBD protein in MEL cell population C4 and D2 are shown and indicates nuclear localization (bottom panel). C ) Two single cell clones reflecting l ow and medium protein expressing levels (clones 19 and 15 respectively) both localize the ZF DBD to the nuclear fraction in MEL cells.

PAGE 79

79 Figure 4 2. major globin gene transcriptio n in MEL cells expressing the +60 ZF DBD or empty vector. (A) RT qPCR examining globin transcripts in uninduced and induced MEL cells harboring the NC ZF DBD (B) Quantitative RT major globin spectrin and dematin transcripts in unind uced and induced MEL cells. expressing either the +60 ZF DBD or harboring the empty vector. Da ta presented is the average of 2 independent RNA extractions with qPCR performed in triplicate SEM Statistical analysis were based on student T test p 0.05.

PAGE 80

80 Figure 4 3. ZF DBDs bind to the intended target sites. ChIP analysis of induced MEL cells expressing the +60 ZF DBD, NC ZF DBD, or harboring the empty vector control (A ) ChIP analysis of the occupancy of the +60 ZF DBD to select sites in the globin locus. Two single cell clones with low (clone 19) or high (clone 15) expressing protein levels of the +60 ZF DBD were analyzed. (B ) Mapping of the NC ZF DBD to select sites in the globin gene locus. Data represent two inde pendent ChIP experiments with PCRs run in triplicate SEM. Statistical analysis were based on student T test p 0.05. A B

PAGE 81

81 Figure 4 4 USF2 occupancy is reduced at HS2 of the LCR and the major promoter in induced MEL cells harboring the +60 ZF DBD. ChIP analysis of induced MEL cells expressing the +60 ZF DBD, NC ZF DBD, or harboring the empty vector control. ChIP analysis of the occupancy of the USF2 (A) and TAL1 (B) to select sites in the globin locus. Two single cell cl o nes with low (clone 19) or med (clone 15) expressing protein levels of the +60 ZF DBD were analyzed. (C ) Mapping of the USF2 to select sites in the globin gene locus in induced MEL cells expressing the NC ZF DBD. Data represent two independent ChIP exper iments with PCRs run in triplicate SEM. Statistical analyses were based on student T test p 0.05.

PAGE 82

82 Figure 4 5. Pol II occupancy levels accumulate at HS2 of the LCR and dramatic reductions in major promoter occupancy is observed in induced MEL cells harboring the +60 ZF DBD. ChIP analysis of induced MEL cells expressing the +60 ZF DBD, NC ZF DBD, or harboring the empty vector control. ChIP analysis of the occupancy of the RNA Pol II (A) and the RNA Pol II ser ine 2 phosphorylated form (B) to select sites in the globin locus. Two single cell clones with low (clone 19) or high (clone 15) expressing protein levels of the +60 ZF DBD were analyzed. (C ) Mapping of the Pol II to select sites in the globin gene locus in induced MEL cells expressing the NC ZF DBD. Data represent two independent ChIP experiments with PCRs run in triplicate SEM. Statistical analyses were based on student T test p 0.05.

PAGE 83

83 C HAPTER 5 CONCLUSIONS AND FUTURE STUDIES Cis element redund ancy is a significant challenge in molecular biology [168] The question of how a trans acting factor can direct its functional activity to a subset of 5 mer sequences while displaying no affinity for the other over represented identical sites is still a mystery that remains to be elucidated. Several lines of evidence suggests that the cell and tissue specific expression of these trans factors as well as the 3 dimensional structure of chromatin introducing the interplay of eu and heterochromatin play significant roles in the se gregation and availability of certain sequences over others [187,205,206] Yet techniques such as ChIP sequencing and DNAseI in vivo f ootprinting indicate that there still remains a significant degree of trans factor binding to cis elements to which only a subset truly harbors function [207] The question then is simple : how can investigators assess functional relevance in vivo This phenomenon holds true in the beta globin gene locus. The loc us is en rich ed for a large number of cis regulatory elements that through precise regulation and binding of trans acting factors coordin ate the developmental and stage specific expression of the globin genes [3] Many cis elements have been res o lv ed and functionally defined, yet many more remain to be characterized [183] C lassical approaches to identify the in vivo functional potential of a cis element such as knock out or gene deletion studies are labor intensive, expensive and often times result in alterations of local architecture of the surrounding chromatin which could confound results obtained [208] In our study, we employed the properties of the zinc finger motif to create artific ial DNA binding domains. The zinc finger DNA binding domains (ZF DBD) bind and

PAGE 84

84 neutralize 3 base pairs of DNA in a sequence specific manner [118] I designed ZF DBDs each comprised of 6 zinc finger mo tifs to bind and neutralize 18 base pair DNA arrays. I successfully directed the ZF DBDs to 3 target sites within the murine globin gene locus: the 90 CACC box predicted to interact with KLF1, the +60 E box believed to interact with the USF1/USF2 hetero dimer complex, and the 2KB site as a control region that is predicted to be inert. ChIP studies indicated that all ZF DBDs bound to their target sites and s uccessful neutralization of these sites by the ZF DBDs allowed for in vivo functional characterizat ion of the putative cis elements. Both neutralization of the 90 CACC box as well as the +60 E box resulted in dramatic and significant reductions in globin expression indicating that these sites are critical for high level expression of the adult glob in gene [191] The 2KB site was predicted to be inert and accordingly, a ZF DBD targeting this site did not change globin expression In order to determine the mechanism of action, I mapped the occupancy of trans acting factors predicted to interact with the target cis element. In the 90 CACC box study, KLF1 the transcription factor predicted to interact with that site revealed significant ly reduced occupancy compared to vector treated controls. This also led to a decrease in Pol II levels. USF2, the predicted transcription factor to interact the target cis element also displayed reduced occupan cy towards the neutralized site (the +60 E box) The 2KB study confirmed that factors associated with either the 2KB site or the major promoter we re unchanged. Based on the success of our studies, we conclude that ZF DBDs are effective tools to identify and characterize putative functional cis regu latory elements in vivo

PAGE 85

85 Future Studies In f uture work, we would like to continue to evaluate putative functional cis regulatory elements. Our primary focus will be to evaluate cis elements that could increase the expression of fetal globin genes. This st ems from p atients with hemoglobinopathies of varying levels of disease severity that because of genetic mutations that give rise to high persistence of fetal hemoglobin, exhibit a clinically benign phenotype [47] The fetal form of hemoglobin provides compensation for the impaired adult globin chain synthesis and/or structure. As such, identifying mechanisms that will increase fetal hemoglobin levels is the ideal form of therapy. Neutralizing key cis regulatory elements, par ticular DNA sequences that contribute to the silencing of the fetal globin genes such as those that regulate BCL11A protein expression a key silencer for fetal globin expression, would lead to potential reactivation of the fetal globin genes [209] Indeed this has been observed in a recent study in which BCL11A was conditionally ablated by genetic knock out under the control of the erythro poetin receptor (EPOR) GFP Cre in sickle cell disease mice (SCD) Conditional knockout re activated the fetal globin genes and increase levels to therapeutic effects [210] Given that the regulation of fetal hemoglobin expression is highly complex, there are likely other sequences that are important for re activation of this gene. These sequences will be identified by examining genome wide association studies (GWAS) and neutralized using ZF DBDs. Following this line of study, we would like to continue to evaluate the effects of employin g ZF DBDs in vivo Our in vivo results generated by globally expressing the ZF DBD in a transient manner in transgenic gave promising results and indicated that the ZF DBDs can be used in a live animal model. Indeed, other groups have reported

PAGE 86

86 similar succ essful findings in different disease models [211] To refine our studi es, we are interested in generating stable mouse lines to allow the integration of ZF DBDs into the germ line. We could then examine the eff icacy and specificity of ZF DBD mediated neutralization of target cis element s Inducible promoters such as the tet racycline responsive promoter system will also be beneficial in this case to allow for the control of ZF DBD expression. We could then evaluate the importance of putative cis regulatory elements during different stages of development. Cell type specific expression will also be desired to minimize any potential non specific binding. In previous studies in the Bungert lab, constructs were designed to confer erythroid specific expression [152] These constructs involved the placement of the target gene, in our case the ZF DBD under the control of the human globin prom oter and followed immediately by the trans acting factors in erythroid cells will activate this promoter. Furthermore, sequences for HS2 to HS3 including the intervening linker region will be included to confer high level express ion of the ZF DBD. Finally, the construct contains chicken HS4 sequences that flank the target gene which are insulator elements to prevent position effects. This will be an ideal construct for the cell type specific expression of ZF DBDs. Therapeutic Del ivery of the ZF DBDs The ultimate goal for our study is to treat hemoglobinopathies. Once ZF DBDs are thoroughly characterized in in vivo animal models, the next stage would be to administer the protein to the human population in a safe, specific, and mini mally invasive manner Given the reported challenges surrounding the gold standard AAV mediated viral delivery system which has displayed problems with host immune

PAGE 87

87 responses and the maintenance of robust titers; alternative therapeutic delivery systems hav e been proposed [212] One such system is to employ p rotein based delivery mechanisms of which there are many classes, but one that shows the most promise are the nano particles based delivery syst ems. These are synthetic nano carriers in which the desired protein, in our case, the ZF DBD would be adhered to the surface of the particle for incorporation into the target cell [213] The nano particles range from 20 200nm in size which is optimal for in vivo delivery and they are typically composed of a combination of liposomes, polymers a nd inorganic materials. Mechanisms of nano particle incorporation vary depending on the type and composition of liposomes and polymers used, but it typically employs the endocytotic pathway or receptor mediated incorporation [213] The unique composition of the lipids allows for efficient entry into the cell and release from the lysosomes to yield maximal delivery of the target protein to the cell. Popular lipid compo sitions include the use of trifluoroacetylated lipopolyamines (TFA DODAPL) in combination with dioleoyl phopsophtidylethanolamine (DOPE) [214] In contrast to gene delivery, intracellular protein delivery avoids permanently altering genomic information which could lead to mutagenesis. They display high internalization efficiency, long circulation and minimal internalization by the liver and renal system for clearance [215,216,217] The synthetic nature of these carriers allow for precise design to optimize delivery as a function of desired cell type, immune response and circulization t ime [218] Some optimization techniques include introducing cell penetrating peptides (CPP) such as the TAT sequence derived from HIV, or the use of gold for the nano particles since it is bioinert which will minimize toxicity and improve penetration [219,220] Currently the FDA has approved over 140

PAGE 88

88 nano particle based delivery systems and will be a promising system to deliver ZF DBDs. C hallenges and Alternative Strategies The re are several documented challenges with the zinc finger technology These include only a 49 out of 64 triplet recognition capacity and varying affinity for target triplets with TNN and ANN being weaker than CNN and GNN [221] As mentioned previously, t his preference for GNN could be because the original zinc finger p roteins used as platforms for generating the amino acid nucleic acid interaction algorithm were Sp1 and Zif268 which bind to GC rich r egions If the target region desired is a GNN rich sequence, zinc finger based artificial proteins are ideal [221] O ther sequence variations require extensive validation to ensure the affinity and specificity of the ZF is mai ntained Furthermore, little is known about the context effects on individual fingers in an array which could alter the predicted specificity [222] In our studies, we did not encounter most of these challenges mainly because we had a larg e degree of flexibility in our target sequence However, if neutralization of a fixed sequence is desired, then the limitation associated with ZF DBDs may be a significant concern. A nother alternative approach that has received much interest are the transcription like activator (TAL) effectors proteins [2 23] TAL effector proteins are DNA binding proteins that were first identified from the Xanthomonas class of plant pathogenic bacteria The bacteria inserted these proteins into a plant cell by the bacterial type III secretory system to translocate to t he nucleus and bind to DNA and alter gene expression presumably to create a more favorable condition to the bacteria [224] The TAL effector proteins can be arranged in an array of tandem polymorphic amino acid repeats that recognize DNA in a modular fashion through single contiguous

PAGE 89

89 nucleotide recognition [225] The DNA binding domain is composed of 34 amino acids and can be repeated 13 to 28 times. Each DNA binding domain has select polymorphisms known as repeat variable di residue (RVD) that can occur at position 12 and 13 of the protein domain [195] There are 4 different RVD to recognize each polymorphism NN preferentially recognizes G but has been reported to recognize the adenine nucleotide as well. The number of repeats, as well as the string of RVDs is what determine the sequence recognition length and nucleotide composition [226] To date custom TAL effector arrays are being used to target varying length of DNA sequences. The be nefits over ZF system is the single nucleotide recognition instead of triplet recognition, which again, some triplets are not rec ognized. In addition, TAL effector design and customization are free from context dependent arrays that could lead to changes i n specificity and off target effects that have been seen with zinc fingers [223,227] The d isadvantages to the technique however is that the exact mechanism of DNA binding remains to be elucidated as a crystal structure is not yet available. Furthermore, these proteins a re extremely large which could present problems downstrea m especially in terms of the feasibility of packaging for therapeutics. To address the extent of off target binding for both ZFDBDs and TALE proteins genome wide protein/DNA interaction maps should b e generated. This could be achieved by ChIP sequencing experiments if appropriate antibodies are available. In final concluding remarks, we employed a novel technique to study the cis globin gene locus in order to identify D NA sequences that carry strong regulatory potential. ZF DBDs provide an advantage over traditional

PAGE 90

90 approaches because they can be rapidly employed while maintaining the specificity and efficacy that parallels that of traditional methods. We designed a seri es of artificial DNA binding domains (DBD) comprised of modular zinc finger DNA binding domains (ZF DBD) that targeted putative cis regulatory sites of interests: the 2KB, 90 and +60 elements relative to the start of the globin promoter. The ZF DBDs bo und to these site s with high affinity and specificity and render ed the target site s inaccessible to endogenous transcription factors We were able to successfully validate each target cis element and assess ed its requirement for globin gene function. Based on the success of our studies, we conclude that ZF DBDs are effective tools to identify and characterize putative functional cis regulatory elements in vivo

PAGE 91

91 LIST OF REFERENCES 1. Perutz MF, Rossmann MG, Cullis AF, Muirhead H, Will G, et al. (1960) Structure of haemoglobin: a three dimensional Fourier synthesis at 5.5 A. resolution, obtained by X ray analysis. Nature 185: 416 422. 2. Perutz MF (1978) Hemoglobin structure and respiratory transport. Sci Am 239: 92 125. 3. Stamato yannopoulos G, Nienhuis AW, Majerus P, Varmus H (1994) The Molecular Basis of Blood Diseases; Company WBS, editor. Philadelphia, PA. 4. Bulger M, van Doorninck JH, Saitoh N, Telling A, Farrell C, et al. (1999) Conservation of sequence and structure flankin g the mouse and human beta globin loci: the beta globin genes are embedded within an array of odorant receptor genes. Proc Natl Acad Sci U S A 96: 5129 5134. 5. Hecht F, Motulsky AG, Lemire RJ, Shepard TE (1966) Predominance of hemoglobin Gower 1 in early human embryonic development. Science 152: 91 92. 6. Huehns ER, Dance N, Beaven GH, Keil JV, Hecht F, et al. (1964) Human Embryonic Haemoglobins. Nature 201: 1095 1097. 7. Schroeder WA, Huisman TH, Shelton JR, Shelton JB, Kleihauer EF, et al. (1968) Evidenc e for multiple structural genes for the gamma chain of human fetal hemoglobin. Proc Natl Acad Sci U S A 60: 537 544. 8. Peschle C, Mavilio F, Care A, Migliaccio G, Migliaccio AR, et al. (1985) Haemoglobin switching in human embryos: asynchrony of zeta ---a lpha and epsilon ---gamma globin switches in primitive and definite erythropoietic lineage. Nature 313: 235 238. 9. Hutton JJ, Bishop J, Schweet R, Russell ES (1962) Hemoglobin inheritance in inbred mouse strains. II. Genetic studies. Proc Natl Acad Sci U S A 48: 1718 1724. 10. Farace MG, Brown BA, Raschella G, Alexander J, Gambari R, et al. (1984) The mouse beta h1 gene codes for the z chain of embryonic hemoglobin. J Biol Chem 259: 7123 7128. 11. Jahn CL, Hutchison CA, 3rd, Phillips SJ, Weaver S, Haigwood NL, et al. (1980) DNA sequence organization of the beta globin complex in the BALB/c mouse. Cell 21: 159 168. 12. Tuan D, Solomon W, Li Q, London IM (1985) The "beta like globin" gene domain in human erythroid cells. Proc Natl Acad Sci U S A 82: 6384 6388

PAGE 92

92 13. Forrester WC, Takegawa S, Papayannopoulou T, Stamatoyannopoulos G, Groudine M (1987) Evidence for a locus activation region: the formation of developmentally stable hypersensitive sites in globin expressing hybrids. Nucleic Acids Res 15: 10159 10177 14. Grosveld F, van Assendelft GB, Greaves DR, Kollias G (1987) Position independent, high level expression of the human beta globin gene in transgenic mice. Cell 51: 975 985. 15. Talbot D, Collis P, Antoniou M, Vidal M, Grosveld F, et al. (1989) A dominant control region from the human beta globin locus conferring integration site independent gene expression. Nature 338: 352 355. 16. Driscoll MC, Dobkin CS, Alter BP (1989) Gamma delta beta thalassemia due to a de novo mutation deleting the 5' beta g lobin gene activation region hypersensitive sites. Proc Natl Acad Sci U S A 86: 7470 7474. 17. Lowrey CH, Bodine DM, Nienhuis AW (1992) Mechanism of DNase I hypersensitive site formation within the human globin locus control region. Proc Natl Acad Sci U S A 89: 1143 1147. 18. Dhar V, Nandi A, Schildkraut CL, Skoultchi AI (1990) Erythroid specific nuclease hypersensitive sites flanking the human beta globin domain. Mol Cell Biol 10: 4324 4333. 19. Bungert J, Tanimoto K, Patel S, Liu Q, Fear M, et al. (1999) Hypersensitive site 2 specifies a unique function within the human beta globin locus control region to stimulate globin gene transcription. Mol Cell Biol 19: 3062 3072. 20. Philipsen S, Talbot D, Fraser P, Grosveld F (1990) The beta globin dominant control region: hypersensitive site 2. EMBO J 9: 2159 2167. 21. Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E, et al. (1996) Analysis of mice containing a targeted deletion of beta globin locus control region 5' hypersensitive site 3. Mol Cell Biol 16: 2906 2912. 22. Ellis J, Tan Un KC, Harper A, Michalovich D, Yannoutsos N, et al. (1996) A dominant chromatin opening activity in 5' hypersensitive site 3 of the human beta globin locus control region. EMBO J 15: 562 568. 23. Li Q, Stamatoyannopoulos G (199 4) Hypersensitive site 5 of the human beta locus control region functions as a chromatin insulator. Blood 84: 1399 1401. 24. Weatherall DJ (2001) Phenotype genotype relationships in monogenic disease: lessons from the thalassaemias. Nat Rev Genet 2: 245 25 5. 25. Pauling L, Itano HA, et al. (1949) Sickle cell anemia a molecular disease. Science 110: 543 548.

PAGE 93

93 26. Institute NHLaB (2012) What is Sickle Cell Anemia. 27. Ingram VM (1957) Gene mutations in human haemoglobin: the chemical difference between normal and sickle cell haemoglobin. Nature 180: 326 328. 28. Orkin SH, Little PF, Kazazian HH, Jr., Boehm CD (1982) Improved detection of the sickle mutation by DNA analysis: application to prenatal diagnosis. N Engl J Med 307: 32 36. 29. Allison AC (1954) Protec tion afforded by sickle cell trait against subtertian malareal infection. Br Med J 1: 290 294. 30. Nathan DG, Gunn RB (1966) Thalassemia: the consequences of unbalanced hemoglobin synthesis. Am J Med 41: 815 830. 31. Weatherall DJ (1998) Pathophysiology of thalassaemia. Baillieres Clin Haematol 11: 127 146. 32. Fessas P (1963) Inclusions of hemoglobin erythroblasts and erythrocytes of thalassemia. Blood 21: 21 32. 33. Zurlo MG, De Stefano P, Borgna Pignatti C, Di Palma A, Piga A, et al. (1989) Survival and causes of death in thalassaemia major. Lancet 2: 27 30. 34. Wickramasinghe SN, Bush V (1975) Observations on the ultrastructure of erythropoietic cells and reticulum cells in the bone marrow of patients with homozygous beta thalassaemia. Br J Haematol 30: 395 399. 35. Cooley T, Witwer ER, Lee P (1927) ANEMIA IN CHILDREN WITH SPLENOMEGALY AND PECULIAR CHANGES IN THE BONES REPORT OF CASES. Am J Dis Child 3: 347 363. 36. Urbinati F, Madigan C, Malik P (2006) Pathophysiology and therapy for haemoglobinopathies. Part II: thalassaemias. Expert Rev Mol Med 8: 1 26. 37. Giardini C, Lucarelli G (1999) Bone marrow transplantation for beta thalassemia. Hematol Oncol Clin North Am 13: 1059 1064, viii. 38. Lucarelli G, Clift RA, Galimberti M, Angelucci E, Giardini C, et al. (1999) Bone marrow transplantation in adult thalassemic patients. Blood 93: 1164 1167. 39. Brittenham GM, Cohen AR, McLaren CE, Martin MB, Griffith PM, et al. (1993) Hepatic iron stores and plasma ferritin concentration in patients with sickle cell ane mia and thalassemia major. Am J Hematol 42: 81 85. 40. Gardenghi S, Ramos P, Follenzi A, Rao N, Rachmilewitz EA, et al. (2010) Hepcidin and Hfe in iron overload in beta thalassemia. Ann N Y Acad Sci 1202: 221 225.

PAGE 94

94 41. Rachmilewitz EA, Weizer Stern O, Adams ky K, Amariglio N, Rechavi G, et al. (2005) Role of iron in inducing oxidative stress in thalassemia: Can it be prevented by inhibition of absorption and by antioxidants? Ann N Y Acad Sci 1054: 118 123. 42. Ramos P, Melchiori L, Gardenghi S, Van Roijen N, Grady RW, et al. (2010) Iron metabolism and ineffective erythropoiesis in beta thalassemia mouse models. Ann N Y Acad Sci 1202: 24 30. 43. Wolfe L, Olivieri N, Sallan D, Colan S, Rose V, et al. (1985) Prevention of cardiac disease by subcutaneous deferoxamine in patients with thalassemia major. N Engl J Med 312: 1600 1603. 44. Loukopoulos D, Voskaridou E, Stamoulakatou A, Papassotiriou Y, Kalotychou V, et al. (1998) Hydroxyurea therapy in thalassemia. Ann N Y Acad Sci 850: 120 128. 45. Boyer SH, Be lding TK, Margolet L, Noyes AN (1975) Fetal hemoglobin restriction to a few erythrocytes (F cells) in normal human adults. Science 188: 361 363. 46. Wood WG, Stamatoyannopoulos G, Lim G, Nute PE (1975) F cells in the adult: normal values and levels in indi viduals with hereditary and acquired elevations of Hb F. Blood 46: 671 682. 47. Nagel RL, Fabry ME, Pagnier J, Zohoun I, Wajcman H, et al. (1985) Hematologically and genetically distinct forms of sickle cell anemia in Africa. The Senegal type and the Benin type. N Engl J Med 312: 880 884. 48. Donovan PB, Kaplan ME, Goldberg JD, Tatarsky I, Najean Y, et al. (1984) Treatment of polycythemia vera with hydroxyurea. Am J Hematol 17: 329 334. 49. Letvin NL, Linch DC, Beardsley GP, McIntyre KW, Nathan DG (1984) Au gmentation of fetal hemoglobin production in anemic monkeys by hydroxyurea. N Engl J Med 310: 869 873. 50. Platt OS (2008) Hydroxyurea for the treatment of sickle cell anemia. N Engl J Med 358: 1362 1369. 51. Charache S, Dover GJ, Moore RD, Eckert S, Balla s SK, et al. (1992) Hydroxyurea: effects on hemoglobin F production in patients with sickle cell anemia. Blood 79: 2555 2565. 52. Rodgers GP, Dover GJ, Noguchi CT, Schechter AN, Nienhuis AW (1990) Hematologic responses of patients with sickle cell disease to treatment with hydroxyurea. N Engl J Med 322: 1037 1045. 53. Cokic VP, Smith RD, Beleslin Cokic BB, Njoroge JM, Miller JL, et al. (2003) Hydroxyurea induces fetal hemoglobin by the nitric oxide dependent activation of soluble guanylyl cyclase. J Clin In vest 111: 231 239.

PAGE 95

95 54. Health NIo, Medicine UNLo (2013) Hydroxyurea. 55. Tuan D, Murnane MJ, deRiel JL, Forget BG (1980) Heterogeneity in the molecular basis of hereditary persistence of fetal haemoglobin. Nature 285: 335 337. 56. Baum C, Dullmann J, Li Z, Fehse B, Meyer J, et al. (2003) Side effects of retroviral gene transfer into hematopoietic stem cells. Blood 101: 2099 2114. 57. Sadelain M, Lisowski L, Samakoglu S, Rivella S, May C, et al. (2005) Progress toward the genetic treatment of the beta thalas semias. Ann N Y Acad Sci 1054: 78 91. 58. May C, Rivella S, Callegari J, Heller G, Gaensler KM, et al. (2000) Therapeutic haemoglobin synthesis in beta thalassaemic mice expressing lentivirus encoded human beta globin. Nature 406: 82 86. 59. Emery DW, Yann aki E, Tubb J, Nishino T, Li Q, et al. (2002) Development of virus vectors for gene therapy of beta chain hemoglobinopathies: flanking with a chromatin insulator reduces gamma globin gene silencing in vivo. Blood 100: 2012 2019. 60. Olins AL, Olins DE (197 4) Spheroid chromatin units (v bodies). Science 183: 330 332. 61. Kornberg RD, Thomas JO (1974) Chromatin structure; oligomers of the histones. Science 184: 865 868. 62. Richmond TJ, Finch JT, Rushton B, Rhodes D, Klug A (1984) Structure of the nucleosome core particle at 7 A resolution. Nature 311: 532 537. 63. Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ (1997) Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389: 251 260. 64. Thoma F, Koller T (1977) Influence of h istone H1 on chromatin structure. Cell 12: 101 107. 65. Thoma F, Koller T, Klug A (1979) Involvement of histone H1 in the organization of the nucleosome and of the salt dependent superstructures of chromatin. J Cell Biol 83: 403 427. 66. Bednar J, Horowitz RA, Grigoryev SA, Carruthers LM, Hansen JC, et al. (1998) Nucleosomes, linker DNA, and linker histone form a unique structural motif that directs the higher order folding and compaction of chromatin. Proc Natl Acad Sci U S A 95: 14173 14178. 67. McGhee JD Rau DC, Charney E, Felsenfeld G (1980) Orientation of the nucleosome within the higher order structure of chromatin. Cell 22: 87 96.

PAGE 96

96 68. Dorigo B, Schalch T, Kulangara A, Duda S, Schroeder RR, et al. (2004) Nucleosome arrays reveal the two start organiza tion of the chromatin fiber. Science 306: 1571 1573. 69. Marsden MP, Laemmli UK (1979) Metaphase chromosome structure: evidence for a radial loop model. Cell 17: 849 858. 70. Carrel L, Willard HF (2005) X inactivation profile reveals extensive variability in X linked gene expression in females. Nature 434: 400 404. 71. Horvath JE, Bailey JA, Locke DP, Eichler EE (2001) Lessons from the human genome: transitions between euchromatin and heterochromatin. Hum Mol Genet 10: 2215 2223. 72. Lutter LC (1978) Kinetic analysis of deoxyribonuclease I cleavages in the nucleosome core: evidence for a DNA superhelix. J Mol Biol 124: 391 420. 73. Clark RJ, Felsenfeld G (1971) Structure of chromatin. Nat New Biol 229: 101 106. 74. Stalder J, Larsen A, Engel JD, Dolan M, Groudine M, et al. (1980) Tissue specific DNA cleavages in the globin chromatin domain introduced by DNAase I. Cell 20: 451 460. 75. Kosak ST, Groudine M (2004) Gene order and dynamic domains. Science 306: 644 647. 76. Yodh J (2013) ATP Dependent Chroma tin Remodeling. Adv Exp Med Biol 767: 263 295. 77. Roeder RG, Rutter WJ (1969) Multiple forms of DNA dependent RNA polymerase in eukaryotic organisms. Nature 224: 234 237. 78. Roeder RG, Rutter WJ (1970) Specific nucleolar and nucleoplasmic RNA polymerases Proc Natl Acad Sci U S A 65: 675 682. 79. Weinmann R, Roeder RG (1974) Role of DNA dependent RNA polymerase 3 in the transcription of the tRNA and 5S RNA genes. Proc Natl Acad Sci U S A 71: 1790 1794. 80. Weinmann R, Raskas HJ, Roeder RG (1974) Role of D NA dependent RNA polymerases II and III in transcription of the adenovirus genome late in productive infection. Proc Natl Acad Sci U S A 71: 3426 3439. 81. Buratowski S, Hahn S, Guarente L, Sharp PA (1989) Five intermediate complexes in transcription initi ation by RNA polymerase II. Cell 56: 549 561.

PAGE 97

97 82. Van Dyke MW, Roeder RG, Sawadogo M (1988) Physical analysis of transcription preinitiation complex assembly on a class II gene promoter. Science 241: 1335 1338. 83. Allison LA, Moyle M, Shales M, Ingles CJ (1985) Extensive homology among the largest subunits of eukaryotic and prokaryotic RNA polymerases. Cell 42: 599 610. 84. Corden JL, Cadena DL, Ahearn JM, Jr., Dahmus ME (1985) A unique structure at the carboxyl terminus of the largest subunit of eukaryoti c RNA polymerase II. Proc Natl Acad Sci U S A 82: 7934 7938. 85. Goodrich JA, Tjian R (1994) Transcription factors IIE and IIH and ATP hydrolysis direct promoter clearance by RNA polymerase II. Cell 77: 145 156. 86. Wada T, Takagi T, Yamaguchi Y, Ferdous A Imai T, et al. (1998) DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev 12: 343 356. 87. Yamaguchi Y, Inukai N, Narita T, Wada T, Handa H (2002) Evidence th at negative elongation factor represses transcription elongation through binding to a DRB sensitivity inducing factor/RNA polymerase II complex and RNA. Mol Cell Biol 22: 2918 2927. 88. Shatkin AJ (1976) Capping of eucaryotic mRNAs. Cell 9: 645 653. 89. Wa da T, Orphanides G, Hasegawa J, Kim DK, Shima D, et al. (2000) FACT relieves DSIF/NELF mediated inhibition of transcriptional elongation and reveals functional differences between P TEFb and TFIIH. Mol Cell 5: 1067 1072. 90. Murthy KG, Manley JL (1992) Cha racterization of the multisubunit cleavage polyadenylation specificity factor from calf thymus. J Biol Chem 267: 14804 14811. 91. Li Q, Peterson KR, Fang X, Stamatoyannopoulos G (2002) Locus control regions. Blood 100: 3077 3086. 92. Delvoye NL, Destroisma isons NM, Wall LA (1993) Activation of the beta globin promoter by the locus control region correlates with binding of a novel factor to the CAAT box in murine erythroleukemia cells but not in K562 cells. Mol Cell Biol 13: 6969 6983. 93. Wall L, Destroisma isons N, Delvoye N, Guy LG (1996) CAAT/enhancer binding proteins are involved in beta globin gene expression and are differentially expressed in murine erythroleukemia and K562 cells. J Biol Chem 271: 16477 16484.

PAGE 98

98 94. Hartzog GA, Myers RM (1993) Discrimina tion among potential activators of the beta globin CACCC element by correlation of binding and transcriptional properties. Mol Cell Biol 13: 44 56. 95. Miller IJ, Bieker JJ (1993) A novel, erythroid cell specific murine transcription factor that binds to t he CACCC element and is related to the Kruppel family of nuclear proteins. Mol Cell Biol 13: 2776 2786. 96. Orkin SH, Antonarakis SE, Kazazian HH, Jr. (1984) Base substitution at position 88 in a beta thalassemic globin gene. Further evidence for the role of distal promoter element ACACCC. J Biol Chem 259: 8679 8681. 97. Antoniou M, deBoer E, Habets G, Grosveld F (1988) The human beta globin gene contains multiple regulatory regions: identification of one promoter and two downstream enhancers. EMBO J 7: 37 7 384. 98. deBoer E, Antoniou M, Mignotte V, Wall L, Grosveld F (1988) The human beta globin promoter; nuclear protein factors and erythroid specific induction of transcription. EMBO J 7: 4203 4212. 99. Lewis BA, Kim TK, Orkin SH (2000) A downstream elemen t in the human beta globin promoter: evidence of extended sequence specific transcription factor IID contacts. Proc Natl Acad Sci U S A 97: 7172 7177. 100. Leach KM, Vieira KF, Kang SH, Aslanian A, Teichmann M, et al. (2003) Characterization of the human b eta globin downstream promoter region. Nucleic Acids Res 31: 1292 1301. 101. Kang SH, Vieira K, Bungert J (2002) Combining chromatin immunoprecipitation and DNA footprinting: a novel method to analyze protein DNA interactions in vivo. Nucleic Acids Res 30: e44. 102. Behringer RR, Hammer RE, Brinster RL, Palmiter RD, Townes TM (1987) Two 3' sequences direct adult erythroid specific expression of human beta globin genes in transgenic mice. Proc Natl Acad Sci U S A 84: 7056 7060. 103. Grosveld F, Greaves D, Ph ilipsen S, Talbot D, Pruzina S, et al. (1990) The dominant control region of the human beta globin domain. Ann N Y Acad Sci 612: 152 159. 104. Hardison R, Slightom JL, Gumucio DL, Goodman M, Stojanovic N, et al. (1997) Locus control regions of mammalian be ta globin gene clusters: combining phylogenetic analyses and experimental results to gain functional insights. Gene 205: 73 94. 105. Tolhuis B, Palstra RJ, Splinter E, Grosveld F, de Laat W (2002) Looping and interaction between hypersensitive sites in the active beta globin locus. Mol Cell 10: 1453 1465.

PAGE 99

99 106. Zhu X, Ling J, Zhang L, Pi W, Wu M, et al. (2007) A facilitated tracking and transcription mechanism of long range enhancer function. Nucleic Acids Res 35: 5532 5544. 107. Busch SJ, Sassone Corsi P (1 990) Dimers, leucine zippers and DNA binding domains. Trends Genet 6: 36 40. 108. Landschulz WH, Johnson PF, McKnight SL (1988) The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240: 1759 1764. 109. McLachl an AD, Stewart M (1975) Tropomyosin coiled coil interactions: evidence for an unstaggered structure. J Mol Biol 98: 293 304. 110. Hu JC, O'Shea EK, Kim PS, Sauer RT (1990) Sequence requirements for coiled coils: analysis with lambda repressor GCN4 leucine zipper fusions. Science 250: 1400 1403. 111. Hu JC, Newell NE, Tidor B, Sauer RT (1993) Probing the roles of residues at the e and g positions of the GCN4 leucine zipper by combinatorial mutagenesis. Protein Sci 2: 1072 1084. 112. Spek EJ, Bui AH, Lu M, Ka llenbach NR (1998) Surface salt bridges stabilize the GCN4 leucine zipper. Protein Sci 7: 2431 2437. 113. Hurst HC (1994) Transcription factors. 1: bZIP proteins. Protein Profile 1: 123 168. 114. Henthorn P, Kiledjian M, Kadesch T (1990) Two distinct trans cription factors that bind the immunoglobulin enhancer microE5/kappa 2 motif. Science 247: 467 470. 115. Murre C, McCaw PS, Baltimore D (1989) A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins Cell 56: 777 783. 116. Ellenberger T, Fass D, Arnaud M, Harrison SC (1994) Crystal structure of transcription factor E47: E box recognition by a basic region helix loop helix dimer. Genes Dev 8: 970 980. 117. Ferre D'Amare AR, Prendergast GC, Ziff EB, Bu rley SK (1993) Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain. Nature 363: 38 45. 118. Pavletich NP, Pabo CO (1991) Zinc finger DNA recognition: crystal structure of a Zif268 DNA complex at 2.1 A. Science 252: 809 817. 119. Miller J McLachlan AD, Klug A (1985) Repetitive zinc binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J 4: 1609 1614.

PAGE 100

100 120. Frankel AD, Berg JM, Pabo CO (1987) Metal dependent folding of a single zinc finger from transcription fa ctor IIIA. Proc Natl Acad Sci U S A 84: 4841 4845. 121. Kadonaga JT, Carner KR, Masiarz FR, Tjian R (1987) Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell 51: 1079 1090. 122. Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, et al. (2001) The sequence of the human genome. Science 291: 1304 1351. 123. Lee MS, Gippert GP, Soman KV, Case DA, Wright PE (1989) Three dimensional solution structure of a single zinc finger DNA binding domain. Science 245: 63 5 637. 124. Elrod Erickson M, Rould MA, Nekludova L, Pabo CO (1996) Zif268 protein DNA complex refined at 1.6 A: a model system for understanding zinc finger DNA interactions. Structure 4: 1171 1180. 125. Wolfe SA, Nekludova L, Pabo CO (2000) DNA recogniti on by Cys2His2 zinc finger proteins. Annu Rev Biophys Biomol Struct 29: 183 212. 126. Suzuki M, Gerstein M, Yagi N (1994) Stereochemical basis of DNA recognition by Zn fingers. Nucleic Acids Res 22: 3397 3405. 127. Feng WC, Southwood CM, Bieker JJ (1994) A nalyses of beta thalassemia mutant DNA interactions with erythroid Kruppel like factor (EKLF), an erythroid cell specific transcription factor. J Biol Chem 269: 1493 1500. 128. Orkin SH, Kazazian HH, Jr., Antonarakis SE, Goff SC, Boehm CD, et al. (1982) Li nkage of beta thalassaemia mutations and beta globin gene polymorphisms with DNA polymorphisms in human beta globin gene cluster. Nature 296: 627 631. 129. Nuez B, Michalovich D, Bygrave A, Ploemacher R, Grosveld F (1995) Defective haematopoiesis in fetal liver resulting from inactivation of the EKLF gene. Nature 375: 316 318. 130. Perkins AC, Sharpe AH, Orkin SH (1995) Lethal beta thalassaemia in mice lacking the erythroid CACCC transcription factor EKLF. Nature 375: 318 322. 131. Wijgerde M, Gribnau J, Trimborn T, Nuez B, Philipsen S, et al. (1996) The role of EKLF in human beta globin gene competition. Genes Dev 10: 2894 2902. 132. Perkins AC, Gaensler KM, Orkin SH (1996) Silencing of human fetal globin expression is impaired in the absence of the adult beta globin gene activator protein EKLF. Proc Natl Acad Sci U S A 93: 12267 12271.

PAGE 101

101 133. Tewari R, Gillemans N, Wijgerde M, Nuez B, von Lindern M, et al. (1998) Erythroid Kruppel like factor (EKLF) is active in primitive and definitive erythroid cells and is required for the function of 5'HS3 of the beta globin locus control region. EMBO J 17: 2334 2341. 134. Zhou D, Liu K, Sun CW, Pawlik KM, Townes TM (2010) KLF1 regulates BCL11A expression and gamma to beta globin gene switching. Nat Genet 42: 742 744. 1 35. Lee JS, Ngo H, Kim D, Chung JH (2000) Erythroid Kruppel like factor is recruited to the CACCC box in the beta globin promoter but not to the CACCC box in the gamma globin promoter: the role of the neighboring promoter elements. Proc Natl Acad Sci U S A 97: 2468 2473. 136. Zhou D, Pawlik KM, Ren J, Sun CW, Townes TM (2006) Differential binding of erythroid Krupple like factor to embryonic/fetal globin gene promoters during development. J Biol Chem 281: 16052 16057. 137. Zhang W, Bieker JJ (1998) Acetylat ion and modulation of erythroid Kruppel like factor (EKLF) activity by interaction with histone acetyltransferases. Proc Natl Acad Sci U S A 95: 9855 9860. 138. Armstrong JA, Bieker JJ, Emerson BM (1998) A SWI/SNF related chromatin remodeling complex, E RC 1, is required for tissue specific transcriptional regulation by EKLF in vitro. Cell 95: 93 104. 139. Kadam S, McAlpine GS, Phelan ML, Kingston RE, Jones KA, et al. (2000) Functional selectivity of recombinant mammalian SWI/SNF subunits. Genes Dev 14: 2441 2451. 140. Sengupta T, Cohet N, Morle F, Bieker JJ (2009) Distinct modes of gene regulation by a cell specific transcriptional activator. Proc Natl Acad Sci U S A 106: 4213 4218. 141. Drissen R, Palstra RJ, Gillemans N, Splinter E, Grosveld F, et al. (200 4) The active spatial organization of the beta globin locus requires the transcription factor EKLF. Genes Dev 18: 2485 2490. 142. Carthew RW, Chodosh LA, Sharp PA (1985) An RNA polymerase II transcription factor binds to an upstream element in the adenovir us major late promoter. Cell 43: 439 448. 143. Moncollin V, Miyamoto NG, Zheng XM, Egly JM (1986) Purification of a factor specific for the upstream element of the adenovirus 2 major late promoter. EMBO J 5: 2577 2584. 144. Sawadogo M, Roeder RG (1985) Int eraction of a gene specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43: 165 175.

PAGE 102

102 145. Gregor PD, Sawadogo M, Roeder RG (1990) The adenovirus major late transcription factor USF is a member of the h elix loop helix group of regulatory proteins and binds to DNA as a dimer. Genes Dev 4: 1730 1740. 146. Sirito M, Lin Q, Maity T, Sawadogo M (1994) Ubiquitous expression of the 43 and 44 kDa forms of transcription factor USF in mammalian cells. Nucleic Aci ds Res 22: 427 433. 147. Sirito M, Walker S, Lin Q, Kozlowski MT, Klein WH, et al. (1992) Members of the USF family of helix loop helix proteins bind DNA as homo as well as heterodimers. Gene Expr 2: 231 240. 148. Qyang Y, Luo X, Lu T, Ismail PM, Krylov D et al. (1999) Cell type dependent activity of the ubiquitous transcription factor USF in cellular proliferation and transcriptional activation. Mol Cell Biol 19: 1508 1517. 149. Sirito M, Lin Q, Deng JM, Behringer RR, Sawadogo M (1998) Overlapping roles and asymmetrical cross regulation of the USF proteins in mice. Proc Natl Acad Sci U S A 95: 3758 3763. 150. Corre S, Galibert MD (2005) Upstream stimulating factors: highly versatile stress responsive transcription factors. Pigment Cell Res 18: 337 348. 15 1. Rada Iglesias A, Ameur A, Kapranov P, Enroth S, Komorowski J, et al. (2008) Whole genome maps of USF1 and USF2 binding and histone H3 acetylation reveal new aspects of promoter structure and candidate genes for common human disorders. Genome Res 18: 380 392. 152. Crusselle Davis VJ, Vieira KF, Zhou Z, Anantharaman A, Bungert J (2006) Antagonistic regulation of beta globin gene expression by helix loop helix proteins USF and TFII I. Mol Cell Biol 26: 6832 6843. 153. Bresnick EH, Felsenfeld G (1993) Eviden ce that the transcription factor USF is a component of the human beta globin locus control region heteromeric protein complex. J Biol Chem 268: 18824 18834. 154. Roy AL, Meisterernst M, Pognonec P, Roeder RG (1991) Cooperative interaction of an initiator b inding transcription initiation factor and the helix loop helix activator USF. Nature 354: 245 248. 155. Huang S, Li X, Yusufzai TM, Qiu Y, Felsenfeld G (2007) USF1 recruits histone modification complexes and is critical for maintenance of a chromatin barr ier. Mol Cell Biol 27: 7991 8002. 156. Crusselle Davis VJ, Zhou Z, Anantharaman A, Moghimi B, Dodev T, et al. (2007) Recruitment of coregulator complexes to the beta globin gene locus by TFII I and upstream stimulatory factor. FEBS J 274: 6065 6073.

PAGE 103

103 157. W est AG, Huang S, Gaszner M, Litt MD, Felsenfeld G (2004) Recruitment of histone modifications by USF proteins at a vertebrate barrier element. Mol Cell 16: 453 463. 158. Carroll AJ, Crist WM, Link MP, Amylon MD, Pullen DJ, et al. (1990) The t(1;14)(p34;q11 ) is nonrandom and restricted to T cell acute lymphoblastic leukemia: a Pediatric Oncology Group study. Blood 76: 1220 1224. 159. Aplan PD, Lombardi DP, Ginsberg AM, Cossman J, Bertness VL, et al. (1990) Disruption of the human SCL locus by "illegitimate" V (D) J recombinase activity. Science 250: 1426 1429. 160. Hsu HL, Cheng JT, Chen Q, Baer R (1991) Enhancer binding activity of the tal 1 oncoprotein in association with the E47/E12 helix loop helix proteins. Mol Cell Biol 11: 3037 3042. 161. Wadman IA, Os ada H, Grutz GG, Agulnick AD, Westphal H, et al. (1997) The LIM only protein Lmo2 is a bridging molecule assembling an erythroid, DNA binding complex which includes the TAL1, E47, GATA 1 and Ldb1/NLI proteins. EMBO J 16: 3145 3157. 162. Hsu HL, Wadman I, T san JT, Baer R (1994) Positive and negative transcriptional control by the TAL1 helix loop helix protein. Proc Natl Acad Sci U S A 91: 5947 5951. 163. Shivdasani RA, Mayer EL, Orkin SH (1995) Absence of blood formation in mice lacking the T cell leukaemia oncoprotein tal 1/SCL. Nature 373: 432 434. 164. Visvader JE, Fujiwara Y, Orkin SH (1998) Unsuspected role for the T cell leukemia protein SCL/tal 1 in vascular development. Genes Dev 12: 473 479. 165. Mikkola HK, Klintman J, Yang H, Hock H, Schlaeger TM, et al. (2003) Haematopoietic stem cells retain long term repopulating activity and multipotency in the absence of stem cell leukaemia SCL/tal 1 gene. Nature 421: 547 551. 166. Song SH, Hou C, Dean A (2007) A positive role for NLI/Ldb1 in long range beta gl obin locus control region function. Mol Cell 28: 810 822. 167. Elnitski L, Miller W, Hardison R (1997) Conserved E boxes function as part of the enhancer in hypersensitive site 2 of the beta globin locus control region. Role of basic helix loop helix prote ins. J Biol Chem 272: 369 378. 168. McLean C, Bejerano G (2008) Dispensability of mammalian DNA. Genome Res 18: 1743 1751. 169. Choo Y, Sanchez Garcia I, Klug A (1994) In vivo repression by a site specific DNA binding protein designed against an oncogenic sequence. Nature 372: 642 645.

PAGE 104

104 170. Rebar EJ, Pabo CO (1994) Zinc finger phage: affinity selection of fingers with new DNA binding specificities. Science 263: 671 673. 171. Greisman HA, Pabo CO (1997) A general strategy for selecting high affinity zinc fin ger proteins for diverse DNA target sites. Science 275: 657 661. 172. Krizek BA, Amann B, Kilfoil V, Merkle D, Berg J (1991) A Consensus Zinc Finger Peptide: Design, High Affinity Metal Binding, a pH Dependent Structure, and a His to Cys Sequence Variant. J Am Chem SOC: 4518 4523. 173. Shi Y, Berg JM (1995) A direct comparison of the properties of natural and designed zinc finger proteins. Chem Biol 2: 83 89. 174. Michael SF, Kilfoil VJ, Schmidt MH, Amann BT, Berg JM (1992) Metal binding and folding propert ies of a minimalist Cys2His2 zinc finger peptide. Proc Natl Acad Sci U S A 89: 4796 4800. 175. Liu Q, Segal DJ, Ghiara JB, Barbas CF, 3rd (1997) Design of polydactyl zinc finger proteins for unique addressing within complex genomes. Proc Natl Acad Sci U S A 94: 5525 5530. 176. Mandell JG, Barbas CF, 3rd (2006) Zinc Finger Tools: custom DNA binding domains for transcription factors and nucleases. Nucleic Acids Res 34: W516 523. 177. Ghosh D (1993) Status of the transcription factors database (TFD). Nucleic A cids Res 21: 3117 3118. 178. Segal DJ, Barbas CF, 3rd (2001) Custom DNA binding proteins come of age: polydactyl zinc finger proteins. Curr Opin Biotechnol 12: 632 637. 179. Dreier B, Beerli RR, Segal DJ, Flippin JD, Barbas CF, 3rd (2001) Development of zi nc finger domains for recognition of the 5' ANN 3' family of DNA sequences and their use in the construction of artificial transcription factors. J Biol Chem 276: 29466 29478. 180. Segal DJ, Dreier B, Beerli RR, Barbas CF, 3rd (1999) Toward controlling gen e expression at will: selection and design of zinc finger domains recognizing each of the 5' GNN 3' DNA target sequences. Proc Natl Acad Sci U S A 96: 2758 2763. 181. Beerli RR, Barbas CF, 3rd (2002) Engineering polydactyl zinc finger transcription factors Nat Biotechnol 20: 135 141. 182. Segal DJ, Beerli RR, Blancafort P, Dreier B, Effertz K, et al. (2003) Evaluation of a modular strategy for the construction of novel polydactyl zinc finger DNA binding proteins. Biochemistry 42: 2137 2148.

PAGE 105

105 183. Liang S, M oghimi B, Yang TP, Strouboulis J, Bungert J (2008) Locus control region mediated regulation of adult beta globin gene expression. J Cell Biochem 105: 9 16. 184. Cathomen T, Segal DJ, Brondani V, Muller Lerch F (2008) Generation and functional analysis of z inc finger nucleases. Methods Mol Biol 434: 277 290. 185. Liang SY, Moghimi B, Crusselle Davis VJ, Lin IJ, Rosenberg MH, et al. (2009) Defective erythropoiesis in transgenic mice expressing dominant negative upstream stimulatory factor. Mol Cell Biol 29: 5 900 5910. 186. Bungert J, Dave U, Lim KC, Lieuw KH, Shavit JA, et al. (1995) Synergistic regulation of human beta globin gene switching by locus control region elements HS3 and HS4. Genes Dev 9: 3083 3096. 187. Roeder RG (2005) Transcriptional regulation a nd the role of diverse coactivators in animal cells. FEBS Lett 579: 909 915. 188. Orphanides G, Reinberg D (2002) A unified theory of gene expression. Cell 108: 439 451. 189. Urnov FD, Rebar EJ, Holmes MC, Zhang HS, Gregory PD (2010) Genome editing with engineered zinc finger nucleases. Nat Rev Genet 11: 636 646. 190. Gupta A, Meng X, Zhu LJ, Lawson ND, Wolfe SA (2011) Zinc finger protein dependent and independent contributions to the in vivo off target activity of zinc finger nucleases. Nucleic Acids Re s 39: 381 392. 191. Barrow JJ, Masannat J, Bungert J (2012) Neutralizing the function of a beta globin associated cis regulatory DNA element using an artificial zinc finger DNA binding domain. Proc Natl Acad Sci U S A 109: 17948 17953. 192. Siatecka M, Bie ker JJ (2011) The multifunctional role of EKLF/KLF1 during erythropoiesis. Blood 118: 2044 2054. 193. Antoniou M (1991) Induction of Erythroid Specific Expression in Murine Erythroleukemia (MEL) Cell Lines. Methods Mol Biol 7: 421 434. 194. Vieira KF, Levi ngs PP, Hill MA, Crusselle VJ, Kang SH, et al. (2004) Recruitment of transcription complexes to the beta globin gene locus in vivo and in vitro. J Biol Chem 279: 50350 50357. 195. Zhang F, Cong L, Lodato S, Kosuri S, Church GM, et al. (2011) Efficient cons truction of sequence specific TAL effectors for modulating mammalian transcription. Nat Biotechnol 29: 149 153. 196. Sanjana NE, Cong L, Zhou Y, Cunniff MM, Feng G, et al. (2012) A transcription activator like effector toolbox for genome engineering. Nat P rotoc 7: 171 192.

PAGE 106

106 197. Raagel H, Saalik P, Pooga M (2010) Peptide mediated protein delivery which pathways are penetrable? Biochim Biophys Acta 1798: 2240 2248. 198. Dreier B, Fuller RP, Segal DJ, Lund CV, Blancafort P, et al. (2005) Development of zinc fi nger domains for recognition of the 5' CNN 3' family DNA sequences and their use in the construction of artificial transcription factors. J Biol Chem 280: 35588 35597. 199. Manwani D, Galdass M, Bieker JJ (2007) Altered regulation of beta like globin genes by a redesigned erythroid transcription factor. Exp Hematol 35: 39 47. 200. Li G, Ruan X, Auerbach RK, Sandhu KS, Zheng M, et al. (2012) Extensive promoter centered chromatin interactions provide a topological basis for transcription regulation. Cell 148: 84 98. 201. Lam KN, van Bakel H, Cote AG, van der Ven A, Hughes TR (2011) Sequence specificity is obtained from the majority of modular C2H2 zinc finger arrays. Nucleic Acids Res 39: 4680 4690. 202. Johnson DS, Mortazavi A, Myers RM, Wold B (2007) Genome wide mapping of in vivo protein DNA interactions. Science 316: 1497 1502. 203. Johnson KD, Christensen HM, Zhao B, Bresnick EH (2001) Distinct mechanisms control RNA polymerase II recruitment to a tissue specific locus control region and a downstream promo ter. Mol Cell 8: 465 471. 204. Zhou Z, Li X, Deng C, Ney PA, Huang S, et al. (2010) USF and NF E2 cooperate to regulate the recruitment and activity of RNA polymerase II in the beta globin gene locus. J Biol Chem 285: 15894 15905. 205. Paixao T, Azevedo RB (2010) Redundancy and the evolution of cis regulatory element multiplicity. PLoS Comput Biol 6: e1000848. 206. de Wit E, de Laat W (2012) A decade of 3C technologies: insights into nuclear organization. Genes Dev 26: 11 24. 207. Park PJ (2009) ChIP seq: a dvantages and challenges of a maturing technology. Nat Rev Genet 10: 669 680. 208. Capecchi MR (2005) Gene targeting in mice: functional analysis of the mammalian genome for the twenty first century. Nat Rev Genet 6: 507 512. 209. Sankaran VG, Menne TF, Xu J, Akie TE, Lettre G, et al. (2008) Human fetal hemoglobin expression is regulated by the developmental stage specific repressor BCL11A. Science 322: 1839 1842.

PAGE 107

107 210. Xu J, Peng C, Sankaran VG, Shao Z, Esrick EB, et al. (2011) Correction of sickle cell dis ease in adult mice by interference with fetal hemoglobin silencing. Science 334: 993 996. 211. Sera T (2009) Zinc finger based artificial transcription factors and their applications. Adv Drug Deliv Rev 61: 513 526. 212. Mingozzi F, High KA (2011) Therapeu tic in vivo gene transfer for genetic disease using AAV: progress and challenges. Nat Rev Genet 12: 341 355. 213. Du J, Jin J, Yan M, Lu Y (2012) Synthetic nanocarriers for intracellular protein delivery. Curr Drug Metab 13: 82 92. 214. Zelphati O, Wang Y, Kitada S, Reed JC, Felgner PL, et al. (2001) Intracellular delivery of proteins with a new lipid mediated delivery system. J Biol Chem 276: 35103 35110. 215. Rejman J, Oberle V, Zuhorn IS, Hoekstra D (2004) Size dependent internalization of particles via the pathways of clathrin and caveolae mediated endocytosis. Biochem J 377: 159 169. 216. Jorgensen KE, Moller JV (1979) Use of flexible polymers as probes of glomerular pore size. Am J Physiol 236: F103 111. 217. Desai MP, Labhasetwar V, Walter E, Levy RJ, Amidon GL (1997) The mechanism of uptake of biodegradable microparticles in Caco 2 cells is size dependent. Pharm Res 14: 1568 1573. 218. Connor EE, Mwamuka J, Gole A, Murphy CJ, Wyatt MD (2005) Gold nanoparticles are taken up by human cells but do not cause acute cytotoxicity. Small 1: 325 327. 219. Torchilin VP, Rammohan R, Weissig V, Levchenko TS (2001) TAT peptide on the surface of liposomes affords their efficient intracellular delivery even at low temperature and in the presence of metabolic inhib itors. Proc Natl Acad Sci U S A 98: 8786 8791. 220. Verma A, Uzun O, Hu Y, Han HS, Watson N, et al. (2008) Surface structure regulated cell membrane penetration by monolayer protected nanoparticles. Nat Mater 7: 588 595. 221. Maeder ML, Thibodeau Beganny S Osiak A, Wright DA, Anthony RM, et al. (2008) Rapid "open source" engineering of customized zinc finger nucleases for highly efficient gene modification. Mol Cell 31: 294 301. 222. Ramirez CL, Foley JE, Wright DA, Muller Lerch F, Rahman SH, et al. (2008) Unexpected failure rates for modular assembly of engineered zinc fingers. Nat Methods 5: 374 375.

PAGE 108

108 223. Bogdanove AJ, Voytas DF (2011) TAL effectors: customizable proteins for DNA targeting. Science 333: 1843 1846. 224. Kay S, Hahn S, Marois E, Hause G, Bo nas U (2007) A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science 318: 648 651. 225. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, et al. (2009) Breaking the code of DNA binding specificity of TAL type III effectors. Science 326: 1509 1512. 226. Moscou MJ, Bogdanove AJ (2009) A simple cipher governs DNA recognition by TAL effectors. Science 326: 1501. 227. Wood AJ, Lo TW, Zeitler B, Pickle CS, Ralston EJ, et al. (2011) Targeted genome editing across spec ies using ZFNs and TALENs. Science 333: 307.

PAGE 109

109 BIOGRAPHICAL SKETCH Joeva Barrow was born in Kingston, Jamaica. Jo eva completed her Bachelor of Science in food science and human n utrition at the University of Florida in 2005 with a specialization in d ietetics and a minor in French. Joeva then obtain ed her m aster's degree in food science and human n utrition at the University of Florida in a combined program i n which she also fulfilled the dietetic i nternship requirements (MS DI) and b ecame certifie d as a registered d ietitian in December 2008. Joeva has always had a profound interest in nutrition especially from the research perspective. In 2006, Joeva worked wit h Dr. Gail Kauwell in the Food S cience and Human Nutrition department studying folate met abolism using the microbiologi cal assay. Joeva then is worked with Dr. John Arthington and Dr. Mitchell Knutson evaluating a copper chaper one protein and its application as a copper status indicator in the bovine system Her work resulted in a first author publication and she successfully completed her Master of Science degree With a passion for research, Joeva then pursued her Ph D degree in Biochemistry and Molecular Biology in the College of Medicine at the University of Florida working with Dr. Jrg Bungert studying the effects of globin regulation using artificial DNA binding domains as a predictive tool to identify novel cis regulatory globin gene locus. She graduated in May 2013 with a Ph.D. in m ed ical s ci ences with a specialization in biochemistry and molecular b iology. Given that the field of n e h er post doctoral studies in nutritional b iochemistry with Dr. Pere Puigserver at Harvard University at the Dana Farber Cancer Institute. There, she hopes to unveil the mechanisms that link genetics and epigenetics to nutrition and d isease.