<%BANNER%>

Aldosterone-Dependent Mirna Regulation of Endothelin-1

Permanent Link: http://ufdc.ufl.edu/UFE0045229/00001

Material Information

Title: Aldosterone-Dependent Mirna Regulation of Endothelin-1
Physical Description: 1 online resource (170 p.)
Language: english
Creator: Jacobs, Mollie E
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: aldosterone -- kidney -- mirna
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: MicroRNAs (miRNAs)are a family of small noncoding RNAs that have been shown to regulate gene expression by inhibiting translation or targeting specific mRNAs for degradation. miRNAs play important roles in the regulation of metabolism in the healthy cell and  in the pathogenesis of many diseases including diabetic nephropathy and hypertension-related renal disease.  Aldosterone is the major known hormone responsible for sodium retention in the kidney collecting duct. Our working hypothesis is that aldosterone action alters the miRNA contentin the inner medullary collecting duct resulting in increased translation and stabilization of mRNAs involved in sodium reabsorption. Here we report the miRNA landscape in mIMCD-3 cells using Toray 3D-GeneTM miRNA microarray analysis to evaluate 1080 miRNAs. Microarray analysis identified 35 highly expressed miRNAs, as well as several miRNAs whose levels appear to be affected by the presence of aldosterone. Two aldosterone responsive miRNAs affected levels of serum/glucocorticoid regulated kinase 1and sodium/potassium-transporting ATPase subunit beta-1mRNA.  Argonaute pull-down experiments also demonstrated that endothelin-1 mRNA is a target of the RNA-induced silencing complex indicating miRNA action on this transcript.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mollie E Jacobs.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Cain, Brian Dale.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045229:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045229/00001

Material Information

Title: Aldosterone-Dependent Mirna Regulation of Endothelin-1
Physical Description: 1 online resource (170 p.)
Language: english
Creator: Jacobs, Mollie E
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: aldosterone -- kidney -- mirna
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: MicroRNAs (miRNAs)are a family of small noncoding RNAs that have been shown to regulate gene expression by inhibiting translation or targeting specific mRNAs for degradation. miRNAs play important roles in the regulation of metabolism in the healthy cell and  in the pathogenesis of many diseases including diabetic nephropathy and hypertension-related renal disease.  Aldosterone is the major known hormone responsible for sodium retention in the kidney collecting duct. Our working hypothesis is that aldosterone action alters the miRNA contentin the inner medullary collecting duct resulting in increased translation and stabilization of mRNAs involved in sodium reabsorption. Here we report the miRNA landscape in mIMCD-3 cells using Toray 3D-GeneTM miRNA microarray analysis to evaluate 1080 miRNAs. Microarray analysis identified 35 highly expressed miRNAs, as well as several miRNAs whose levels appear to be affected by the presence of aldosterone. Two aldosterone responsive miRNAs affected levels of serum/glucocorticoid regulated kinase 1and sodium/potassium-transporting ATPase subunit beta-1mRNA.  Argonaute pull-down experiments also demonstrated that endothelin-1 mRNA is a target of the RNA-induced silencing complex indicating miRNA action on this transcript.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mollie E Jacobs.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Cain, Brian Dale.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045229:00001


This item has the following downloads:


Full Text

PAGE 1

1 ALDOSTERONE DEPENDENT MIRNA REGULATION OF ENDOTHELIN 1 By MOLLIE ELIZABETH JACOBS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF D OCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Mollie Elizabeth Jacobs

PAGE 3

3 To Endothelin and to Sean, thank you for all of your love and support

PAGE 4

4 ACKNOWLEDGMENTS There are so many people whose support and encouragement I would like to acknowledge. First I would like to thank my mentor, Dr. Brian D. Cain for the many years of support and encouragement. I started in the Cain laboratory thanks to one of Dr. Donald All in BCH4024. The transparency was advertising a position for a dishwasher in the Cain laboratory After I started what I thought would be a part time job, I found myself spending more and more time in the laboratory, and began begging the other lab members, particularly Megan Mitzelfelt and Cathy Hass, to let me help them with their experiments. After the laboratory technician left, Megan encouraged me to ask Brian for her position. I will always be grateful that Brian recogniz ed my enthusiasm and dedication to research, and offered me not only a position in the laboratory as a technician, but encouraged me to apply to graduate school as well. Without his mentorship, I would not be where I am today. I would also like to thank my committee members, Dr. J e an n ine Brady, Dr. Michael Kilberg, Dr. Philip Laipis, and Dr. Alfred Lewin O ur meetings have always brought up interesting new ideas and perspectives Their input and suggestions have been invaluable and I appreciate the time they have spent helping me develop my project. Additionally, I woul d like to thank our collaborators Dr. Charles Wingo and Dr. Michelle Gumz Dr. Wingo has patiently answered the many, many questions I have had about the physiology of the k idney, and has been so supportive and enthusiastic about the progress I have made o n this project. Dr. Gumz has taught me everything I know about RNA isolation and qRT PCR. I am so grateful for all the time she has spent helping me troubleshoot any problems that arose when I first started working on the Endothelin 1 project

PAGE 5

5 I would a lso like to thank my husband, Sean, for being wonderful. His love and constant encouragement have made this dissertation possible. I would also like to thank my amazing parents, Chris topher and Pat ricia for all their love and support, without which I woul d not be the person I am today. I would also like to thank my wonderful in laws, Ray and Chris tine Ely, for taking Sean and I out for many, much needed nights on the town. There are also so many friends I would like to thank. Without the help of Lauren Je ffers, it is quite possible that I would still be doing qRT PCR I would like to thank her for all her assistance, and wish her the best of luck as she starts an M.D./Ph.D program at Emory University next year Kristin Gonzalez my best friend of over twen ty years, has always made time to keep in touch and has given me constant support regardless of how great the time difference between us was I would also like to thank Lori Prugh, whose friendship is has sustained me during the many years of hard work, la dies' nights and failed/successful experiments

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ .................... 12 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 G ENERAL INTRODUCTION ................................ ................................ .................. 17 The Kidney ................................ ................................ ................................ .............. 17 Kidney Development ................................ ................................ ........................ 17 Gross Anatomy of the Kidney ................................ ................................ ........... 19 Ultrastructure of the Nephron ................................ ................................ ........... 19 Renal Transport Mechanisms: Na + Cl and H 2 O Reabs orption Along the Nephron ................................ ................................ ................................ ............... 21 The Proximal Tubule ................................ ................................ ........................ 21 The Loop of Henle ................................ ................................ ............................ 22 Distal Tubule and Collecting Duct ................................ ................................ .... 22 Regulation of NaCl and H 2 O Reabsorption ................................ ...................... 22 The Renin Angiotensin Aldosterone Syste m ................................ .................... 23 Aldosterone Stimulation of ET 1 ................................ ................................ ....... 25 The Endothelin Family ................................ ................................ ............................ 26 Endothelin 1 ................................ ................................ ................................ ..... 26 The Endothelin 1 Gene ................................ ................................ .................... 27 Endothelin Processing ................................ ................................ ...................... 27 Endothelin Converting Enzymes ................................ ................................ ...... 28 Endothelin Receptors ................................ ................................ ....................... 29 Endothelin Receptors in the Kidney Collecting Duct ................................ ........ 31 Endothelin Physiology ................................ ................................ ...................... 34 Endothelin and the Vasculature ................................ ................................ ........ 34 Endothelin 1 and th e Nervous System ................................ ............................. 36 Endothelin 1 and the Heart ................................ ................................ ............... 37 Endothelin 1 and the Kidney ................................ ................................ ............ 38 Endothelin and the Tubular System ................................ ................................ 39 Endothelin 1 and Disease ................................ ................................ ................ 41 Endothelin 1 and Hypertension and Vascular Dis ease ................................ .... 41 Endothelin 1 and Pulmonary Hypertension and Heart Failure .......................... 42 Endothelin 1 and Renal Disease ................................ ................................ ...... 44 Transcriptional Regulation of the Edn1 Gene ................................ ................... 45

PAGE 7

7 Post Transcriptional Regulation of EDN1 mRNA ................................ ............. 45 microRNA ................................ ................................ ................................ ............... 46 miRNA Annotation ................................ ................................ ............................ 47 miRNA Biogenesis ................................ ................................ ........................... 47 Transc ription of miRNA Genes ................................ ................................ ......... 48 Nuclear Processing by Drosha ................................ ................................ ......... 50 Nuclear Export by Exportin 5 ................................ ................................ ............ 51 Cytoplasmic Processing by Dicer ................................ ................................ ..... 52 miRNAs in Renal Physiology ................................ ................................ ............ 53 miRNAs in Renal Disease ................................ ................................ ................ 55 Edn1 miRNA Interaction ................................ ................................ ................... 59 ET 1 Impact on miRNA Levels ................................ ................................ ......... 62 Summary and Goals ................................ ................................ ............................... 63 2 DELETION ANALYSIS OF THE EDN1 ................................ ....................... 73 Introduction ................................ ................................ ................................ ............. 73 Ma terials and Methods ................................ ................................ ............................ 75 Generation of Luciferase Reporter Constructs ................................ ................. 75 TaqMan miRNA Quantitative Real Time PCR ................................ ............... 78 Luciferase Assays ................................ ................................ ............................ 79 Results ................................ ................................ ................................ .................... 79 Construction of the Luciferase Edn1 porter Construct ..................... 79 Detection of miRNAs in mIMCD 3 Cells ................................ ........................... 80 Mutation of Selected miRNA Target Sites in the Edn1 ......................... 81 Large Scale Deletion Analysis of the Edn1 ................................ .......... 82 Systematic Deletion Analysis of the Edn1 ................................ ............ 83 Discussion ................................ ................................ ................................ .............. 84 3 DEFINING THE MIRNA LANDSCAPE OF THE MIMCD 3 CELL LINE ................ 102 Introduction ................................ ................................ ................................ ........... 102 Materials and Methods ................................ ................................ .......................... 103 Hormone Treatments and RNA Isolation ................................ ........................ 103 R NA Integrity Analysis ................................ ................................ .................... 104 Toray 3D GeneTM Analysis ................................ ................................ ........... 104 TaqMan miRNA quantitative Real Time PCR ................................ .............. 105 The presence of miRNAs upregulated by aldosterone was confirmed using a TaqMan miRNA Assay (Chapter 2). ................................ ...................... 105 Results ................................ ................................ ................................ .................. 105 RNA Integrity Analysis ................................ ................................ .................... 105 Toray 3D Gene TM MicroRNA Microarray Analysis ................................ .......... 107 Aldosterone and Dexamet hasone Dose Responsive miRNAs ....................... 109 Discussion ................................ ................................ ................................ ............ 110

PAGE 8

8 4 INTERACTION BETWEEN RISC AND TARGET MRNA ................................ ..... 127 Introduction ................................ ................................ ................................ ........... 127 Materials and Methods ................................ ................................ .......................... 129 mIMCD 3 Cell Culture ................................ ................................ .................... 129 Anti miR Transfection ................................ ................................ ..................... 129 Selection of Antibodies for Use With mIMCD 3 Cells ................................ ..... 130 Detection of Proteins in mIMCD 3 Cells ................................ ......................... 131 RNA Isolation and qRT PCR ................................ ................................ .......... 132 MagnaRIP RNA Binding Protein Pulldown Assay ................................ .......... 133 Results ................................ ................................ ................................ .................. 135 Anti miR Inhibitor Impact on RNA Levels ................................ ....................... 135 Antibody Selection for R ISC pulldown Assay ................................ ................. 136 RISC Pulldown Time Course ................................ ................................ .......... 137 Blocking RISC Interaction with Target mRNA ................................ ................ 138 Discussion ................................ ................................ ................................ ............ 139 CONCLUSIONS AND PERSPECTIVES ................................ ................................ ..... 147 Summary of Results ................................ ................................ .............................. 147 Perspectives and Future Directions ................................ ................................ ...... 150 LIST OF REFERENCES ................................ ................................ ............................. 154 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 170

PAGE 9

9 LIST OF TABLES Table page 1 1 NaCl transport along the nephron. ................................ ................................ ...... 65 1 2 H 2 O transpor t along the nephron. ................................ ................................ ....... 66 1 3 Hormones that regulate NaCl and H 2 O reabsorption in the kidney. .................... 67 1 4 Main characteristics of the e ndothelin receptors. ................................ ................ 68 2 1 Oligonucleotide primers used to generate Edn1 ...... 86 2 2 Sequences of miRNAs Studied ................................ ................................ .......... 87 2 3 Plasmids generated to study the Edn1 ................................ .................. 88 2 4 Detection of miRNA in mIMCD 3 cells ................................ ................................ 89 3 1 Comparison of RNA integrity numbers for samples submitted for miRNA microarray analysis. ................................ ................................ .......................... 112 3 2 miRNAs not detected in mIMCD 3 cells. ................................ .......................... 113 3 3 miRNAs detected in only one RNA sample ................................ ..................... 114 3 4 Highly abundant miRNAs in mIMCD 3 cells ................................ ..................... 115 3 5 Highly expressed miRNAs possibly targeting the murine Edn1 ........... 115 3 6 Moderately expressed miRNAs possibly targeting the murine Edn1 .... 116 3 7 Lowly expressed miRNAs possibly targeting the murine Edn1 ............. 117 3 8 Aldosterone responsive miRNA possibly targeting the murine Edn1 3 ..... 118 3 9 miRNAs upregulated by aldosterone. ................................ ............................... 119 3 10 TaqMan miRNA assay of miRNAs potentially regulated by aldosterone in Toray samples. ................................ ................................ ................................ 119 4 1 Sequences of miRNAs studied. ................................ ................................ ........ 142 4 3 Affect of anti miR inhibitors on RI SC Edn1 mRNA co immunoprecipitation. .... 142 4 4 of the potential miR 709 binding sites in the Edn1 ............................... 143

PAGE 10

10 LIST OF FIGURES Figure page 1 1 A bisected view of a human kidney and renal tubule ................................ .......... 69 1 2 Ov erview of ET 1 synthesis.. ................................ ................................ .............. 70 1 3 Primary sequences of endothelin isoforms.. ................................ ....................... 71 1 4 Processing of endothelin family members and endothelin receptor specificities. ................................ ................................ ................................ ........ 71 1 5 Processing of ET 1 and miRNAs and overview of miRNA mediated translational repression. ................................ ................................ ..................... 72 2 1 PCR amplification of the Edn1 ................................ ............................... 90 2 2 Insertion of a novel EcoRI site in pmirGLO ................................ ......................... 91 2 3 Generation of the Edn1 lu ciferase reporter construct. ................................ ........ 92 2 4 Mutation of the let 7/miR 98 binding site. ................................ ........................... 93 2 5 Mutation of the miR 199 binding site in th e Edn1 ................................ ... 94 2 6 Luciferase reporter activity of Edn1 reporter constructs with mutated miRNA binding sites. ................................ ................................ ................................ ....... 95 2 7 Removal o f bases 958 1345 from pMJ3. ................................ ............................ 96 2 8 Luciferase Activity for Edn1 ................................ ..... 97 2 9 Map of the Edn1 ................................ ................................ .................... 98 2 10 Generation of Edn1 ................................ .................. 99 2 1 1 Luciferase activity for Edn1 ................................ ... 100 2 12 Luciferase activity of Edn1 ................................ ..... 101 3 1 Alignment of the Homo sapiens and Mus musculus Edn1 ................... 120 3 2 Predicted miRNA binding sites in the human EDN1 ............................. 121 3 3 Predicted miRNA binding sites in the murine Edn1 .............................. 122 3 4 Examples of Agilent 2100 Bioanalyzer electropherograms .............................. 123 3 5 Confirmation of RNA integrity. ................................ ................................ .......... 124

PAGE 11

11 3 6 miRNA levels in response to aldosterone. ................................ ........................ 125 3 7 miRNA levels in response to dexamethasone ................................ .................. 126 4 1 Transfection of anti miR inhibitors stabilizes mRNA transcripts ........................ 144 4 2 Argonaute antibodies detected Ago proteins in mIMCD 3 c ell lysate ............... 145 4 3 RISC Edn1 mRNA co immunoprecipitation. ................................ ..................... 145 4 4 Minimum free energy hybridization of miRNAs and target mRNAs .................. 146 5 1 Proposed mod el for miRNA Edn1 mRNA interaction. ................................ ...... 153

PAGE 12

12 LIST OF ABBREVIATIONS ACE Angiotensin converting enzyme AGO A rgonaute ANG I Angiotensin I ANG II Angiotensin II ARE AU rich Element ATP1A1 ATP1B1 C H IP Chromatin Immunoprecipitation CKD Chronic kidney disease DE1 Destabilizing element 1 DE2 Destabilizing element 2 DGCR8 DiGeorge syndrome critical region 8 DHB Dopamine hyd roxylase DMEM DSRNA Double stranded RNA ECE Endothelin converting enzyme E DN 1 Endothelin 1 gene EDNRA Endothelin receptor type A gene EDNRB Endothelin receptor type B gene EEmiRC Early embryonic miRNA cluster EGFP Enhanced green fluorescent protein EMT Epithelial mesenchymal transition E NOS Endothelial nitric oxide synthase ET 1 Endothelin 1, mature peptide

PAGE 13

13 ET 2 Endothelin 2, mature peptide ET 3 Endothelin 3, mature peptide ET A R Endothelin receptor type A ET B R Endothelin rec eptor type B FBS Fetal bovine serum GR Glucocorticoid receptor HEK293 Human embryonic kidney 293 cell line HUVEC Human umbilical vein endothelial cells LBG Luria Bertani broth supplemented with glucose LO2 Human liver cell ine MIMCD 3 Murine inner medullar y collectind duct cell line, clone 3 MIP Macrophage inflammatory protein MI RNA microRNA MR Mineralocorticoid receptor NO Nitric oxide OREBP Osmotic response element binding protein OX LDL Oxidized low density lipoprotein PCR Polymerase chain reaction POL I RNA polymerase I POL II RNA polymerase II PRE MIRNA Precursor miRNA PRI MIRNA Primary miRNA transcript Q RT PCR Quantitative real time polymerase chain reaction RIP RNA immunoprecipitation

PAGE 14

14 RISC RNA induced silencing complex RL SEC Rat liver sinusoidal endothelial cells SCNN1A SGK1 Serum/glucocorticoid regulated kinase 1 SL Spotting lethal THP 1 Human acute monocytic leukemia cell line TRBP Transactivating response RNA binding protein UTR Untr anslated region

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ALDOSTERONE DEPENDENT MIRNA REGULATION OF ENDOTHELI N 1 By Mollie Elizabeth Jacobs May 2013 Chair: Brian D. Cain Major: Medical Sciences Biochemistry and Molecular Biology The kidney is the organ principally responsible for maintaining acid base homeostasis and ion balance in the blood stream. Aldosteron e is the major known hormone involved in regulation of sodium retention in the kidney collecting duct. The hormone has non genomic effects in renal cells, but its primary mode of action is regulation of transcription of many genes. Some of those genes enco de proteins that function in sodium retention. The endothelin 1 ( Edn1 ) gene is among those induced by aldosterone in the renal collecting duct. Endothelin favors sodium secretion in the urine, so aldosterone and endothelin 1 participate in a feedback loo p that adjusts sodium levels in the body. MicroRNAs (miRNAs) are a family of small noncoding RNAs that have been shown to regulate gene expression by inhibiting translation or targeting specific mRNAs for degradation. miRNAs play important roles in the re gulation of met abolism in the healthy cell and in the pathogenesis of many diseases including diabetic nephropathy and hypertension related renal disease. My working hypothesis is that aldosterone action alters the miRNA content in the inner medullary col lecting duct resulting in

PAGE 16

16 increased translation and stabilization of mRNAs involved in sodium reabsorption. The primary focus is on miRNA action on Edn1 mRNA. In this dissertation, a reporter gene strategy was employed to conduct a systematic functional a nalysis of the Edn1 confirmed that the mRNA contains many elements important for its stability and landscape in cells derived from the mu rine renal inner medullary collecting duct (mIMCD 3) was determined using Toray 3D Gene TM miRNA microarray analysis to evaluate 1080 miRNAs. Microarray analysis identified 34 highly expressed miRNAs. Other miRNAs were present in lesser amounts, and many were not found in mIMCD 3 cells. The levels of a number of miRNAs appeared to be affected by the presence of aldosterone. Aldosterone responsive miRNAs affected levels of serum/glucocorticoid regulated kinase 1 mRNA, sodium/potassium transporting ATPase s ubunit beta 1 mRNA, and endothelin 1 mRNA. Finally, argonaute immunoprecipitation experiments demonstrated that endothelin 1 (Edn1) mRNA is a direct target of the RNA induced silencing complex indicating miRNA action on this transcript. The RISC Edn1 mRNA interaction was specifically inhibited by anti miR 709 implicating this particular miRNA in the regulation of Edn1 expres s ion in the renal collecting duct.

PAGE 17

17 CHAPTER 1 GENERAL INTRODUCTION The Kidney Proper renal function is essential for many processes in cluding fluid and electrolyte homeostasis, acid base balance, and excretion of metabolic waste. The kidneys are a pair of highly specialized organs that filter the blood and produce urine; they possess transport mechanisms for various mineral ions, organic ions, amino acids and metabolites (Brenner and Rector, 2008). Renal transport mechanisms also play a fundamental role in the maintenance of water (H 2 O) and sodium (Na + ) homeostasis. The work presented in this dissertation will focus on the effect of aldos terone on the microRNA (miRNA) landscape in a murine inner medullary cell line, and how aldosterone induced changes in miRNA content impact transcripts involved in Na + reabsorption. Kidney D evelopment The vertebrate kidney derives from the intermediate m esoderm of the urogenital ridge. It develops in three successive stages: the pronephros, the mesonephros, and the metanephros. The pronephros consists of pronephric tubules and the precursor to the Wolffian duct. The pronephros develops from the rostral mo st ridge at 22 days of gestation in humans and 8 days post coitum in mice. The pronephros is nonfunctional in mammals, but is functional in the larval stages of fish and amphibians. The mesonephros develops in the midsection of the urogenital ridge. It is thought to have a filtering role in mammalian embryos, but degenerates before birth. Both the pronephros and the mesonephros develop in a rostral to caudal direction, and the tubules are aligned adjacent to the Wolffian duct. The third and final develop mental stage of the

PAGE 18

18 kidney is the metanephros. The metanephros gives rise to the definitive adult kidney of higher vertebrates. It arises from an outgrowth of the distal end of the Wolffian duct known as the ureteric bud epithelium and a cluster of cells known as the metanephric mesenchyme. A subset of the metanephric mesenchyme aggregates adjacent to the tips of the branching ureteric bud, and these aggregations of cells undergo mesenchymal to epithelial conversion to become the renal vesicle (Saxn and Sariola, 1987). The glomerulus develops from the most proximal end of the renal vesicle furthest from the ureteric bud tip. Parietal epithelial cells differentiate and flatten to become ceral epithelial cells produce the glomerular basement membrane. Podocytes, which first appear as columnar shaped epithelial cells connected by tight intercellular junctions, flatten, spread out, and develop foot processes. During development, the intercel lular junctions are replaced by the slit diaphragm (Reeves et al., 1978). The tubular portion of the nephron becomes segmented in a proximal distal order into the proximal convoluted tubule, the descending and ascending loops of Henle, and the distal conv oluted tubule. The collecting ducts are derived by branching off from the ureteric bud, unlike the nephron, which arises from a distinct pretubular aggregate. Extensive remodeling is required to form collecting ducts from the branches of the ureteric bud Osathanodh and Potter, 1963). All segments of the nephron are present at birth, however, maturation of the tubule continues in the post natal period. The postnatal maturation events include

PAGE 19

19 increased number of transporters, permeability, and biophysical p roperties of tubular membranes (Baum et al., 2003). Gross Anatomy of the Kidney The kidneys are paired organs located on the posterior part of the abdomen, behind the peritoneum on either side of the vertebral column in the superior lumbar region. The ren al artery, renal vein, nerves, and the renal pelvis pass into the sinus of the kidney via the hillus, a slit on the concave medial surface of the kidney. The kidneys are surrounded by a renal fascia, which functions to anchor the kidney and the adrenal gla nd to surrounding structures. These include a peritoneal fat pad, which cushions the kidney, and a tough, fibrous capsule, which serves as a protective barrier. Ultrastructure of the Nephron Three distinct regions are observed on the cut surface of the b isected kidney: the outer cortex, the inner medulla, and the renal pelvis (Figure 1 1, left panel). The cortex and the medulla are composed of nephrons, blood vessels, lymphatics, and nerves. In the human kidney the medulla is divided into 8 18 conical mas ses known as the renal pyramids. Unlike the human kidney, the murine kidney has a single renal pyramid. Nephrons are the functional unit of the kidney; there are two types of nephrons 85% are located entirely in the cortex (cortical nephrons) and 15% are l ocated near the cortex medulla junction (juxtamedullary nephrons). Each nephron consists of a renal the renal tubule. Filtrate first passes through the glomerular filtration membrane, which lies between the blood and the interior of the glomerular capsule formed by the podocytes, then enters the renal tubule The renal tubule is the portion of the nephron containing the tubular fluid which was filtered through the glomerulus After passing

PAGE 20

20 through the renal tubule, the filtrate continues to the collecting duct system (Figure 1 1 right panel). The collecting ducts collect filtrate from many nephrons and empty into a minor calyx. Major and minor calyces collect urine and empty i t into the renal pelvis. The collecting duct can be divided into three regions; the cortical collecting duct, the outer medullary collecting duct, and the inner medullary collecting duct. Two types of cells have been described in the mammalian collecting d uct: principal cells, which represent the major cell type, and intercalated cells (Madsen et al., 1988). Intercalated cells have a low cellular profile in the tubule lumen and are thought to mediate transport involved in acid base balance (Clapp et al., 19 87), whereas principal cells are tall with relatively few organelles and function in Na + and H 2 O reabsorption. A major function of the cortical collecting duct is the secretion of potassium (K + ). The primary function of the outer medullary collecting is u rine acidification. As it descends through the inner medulla the diameter of the collecting duct narrows. The experiments described in this dissertation make use of a cell line derived from the terminal inner medullary collecting duct from an SV40 transge nic mouse (Rauchman et al., 1993). These cells retain many important characteristics from the nephron segment they were derived from. The cells display high transepithelial resistance and well developed junctional complexes, especially tight junctions. Api cal to basolateral Na + flux was inhibited by amiloride and atrial natriuretic peptide. Additionally, cells adapted to being cultured in hypertonic medium supplemented with NaCl and urea. These conditions mimic the environment of the renal medulla in vivo, and are lethal for most other cells.

PAGE 21

21 Renal Transport Mechanisms: Na + Cl and H 2 O Reabsorption A long the Nephron Formation of urine involves three basic processes: filtration of plasma by the glomerulus, reabsorption of H 2 O and solutes from the filtrate and secretion of solutes into the tubular fluid. The volume and composition of the urine is modulated by reabsorption and secretion by the renal tubules. In the kidney cells solute transport occurs by both passive and active transport mechanisms, while H 2 O reabsorption occurs via a passive mechanism only (Table 1 1 and Table 1 2). Tubular reabsorption enables the kidneys to retain important solutes, such as Na + and the secretion of substances into the tubular fluid enables the excretion of pollutants fr om the body. The Proximal Tubule The proximal tubule is responsible for reabsorbing the majority of filtered H 2 O and solutes. Approximately 67% of the filtered H 2 O, Na + Cl K + and other solutes are reabsorbed across the apical membrane in the proxima l tubule by several different mechanisms (Table 1 1). Na + is reabsorbed in both the early and the late segment of the proximal tubule. In the early segment Na + is primarily reabsorbed with HCO 3 whereas in the late segment Na + is primarily reabsorbed with Cl These differences are attributed to both the differences in composition of tubular fluid, as well as the differences of Na + transport at these segments. In the early segment of the proximal tubule Na + uptake is coupled to specific symporter and antip orter proteins. In the late segments reabsorption of Na + and Cl occurs by passive diffusion, creating a driving force for passive reabsorption of H 2 O by osmosis. The Na + K + ATPase, the key element for reabsorption in the proximal tubule, is located exclus ively on the basolateral membrane. Accumulation of Na + in the cell and is then stimulated to increase its rate of Na + transport into the blood stream and K + into the cell via the Na + K + ATPase.

PAGE 22

22 The Loop of Henle Reabsorption of filtered Na + ,Cl K + Ca 2+ and HCO 3 in the loop of Henle occurs almost exclusively in the thick ascending limb. Roughly 25% of the filtered Na + Cl and K + are reabsorbed in the loop of Henle. The reabsorption of H 2 O occurs exclusively in the thin descending limb of Henle, because the thick ascending limb is impermeable to H 2 O. The increased NaCl transport in the thick ascending limb increases the positive voltage in the lumen, which in turn becomes a driving force for the reabsorption of other cations. Distal Tubule and Collectin g Duct The distal tubule and the collecting duct reabsorb ~7% of the filtered Na + and Cl as well as between 8% 17% H 2 O. In the distal tubule and the collecting duct the principal cells reabsorb Na + and H2O and secrete K + while the intercalated cells se crete either H + or HCO 3 which regulates acid base balance ,and reabsorb K + Although only a small amount of Na + is reabsorbed in the collecting duct, the collecting duct is responsible for fine tuning Na + reabsorption and is the last site for Na + reabsor ption before it exits the body. Regulation of NaCl and H 2 O Reabsorption Reabsorption of Na + Cl and H 2 O in the kidney is regulated to maintain a normal extracellular fluid volume. Extracellular fluid volume is important for maintaining vascular volume cardiac output, and blood pressure. Several hormones and factors regulate Na + and Cl reabsorption in the kidney. These hormones and their site of action in the nephron are summarized in Table 1 3.

PAGE 23

23 The Renin Angiotensin Aldosterone System The primary f unction of the renin angiotensin aldosterone system is to regulate vascular tone and renal salt excretion in response to changes in extracellular fluid volume or blood pressure. Three factors play an important part in stimulating the release of renin. Re nin secretion is stimulated by a decrease in perfusion pressure, activation of the sympathetic nerve fibers innervating the afferent arteriole, or a decrease in NaCl delivery to the macula densa. Renin is both produced and stored in the granular juxtaglome rular cells. Renin is synthesized as an inactive precursor molecule, preprorenin, cleavage of the signal peptide from the carboxyl terminus of preprorenin results in prorenin, which is also a biologically inactive molecule. The active proteolytic enzyme is produced after glycosylation and proteolytic cleavage of prorenin. Circulating renin is derived almost entirely from the kidney. Renin alone does not have a physiologic function; it functions solely as a proteolytic enzyme, cleaving its substrate angiote nsinogen. The source of angiotensin I (AngI) in all animal species is plasma angiotensinogen. The liver is the primary site of angiotensinogen mRNA and protein synthesis in the body. However, in the kidney, the cortex was also determined to have a relati vely high level of angiotensinogen gene expression in reverse transcription polymerase chain reaction (RT PCR) experiment (Terada et al., 1993). Agiotensinogen is cleaved by renin at a leucine valine peptide bond to yield a 10 amino acid peptide, AngI. The angiotensin c onverting enzyme (ACE) is responsible for cleaving the histidine leucine from the carboxyl end of AngI to form the 8 amino acid peptide

PAGE 24

24 angiotensin II (AngII). ACE has a high capacity to convert AngI to AngII. Within the kidney ACE is loca lized in the glomerular endothelial cells and the proximal tubule brush border (Brenner and Rector, 2008). AngII has a very short biological half life and is known to interact with at least two AngII receptor subtypes AT 1 and AT 2 AngII has several import ant physiological functions such as arteriolar vasoconstriction, stimulation of antidiuretic hormone and thirst, enhancement of Na + and Cl reabsorption by the proximal tubule, and stimulation of aldosterone secretion from the adrenal cortex. These biologi cal functions are mediated by the AT 1 receptor. The functional role of the AT 2 receptor is poorly understood (Miura et al., 2012). Aldosterone has multiple effects in the kidney. Aldosterone reduces Na + and Cl secretion by stimulating its reabsorption by the thick ascending limb of the loop of Henle, the distal tubule, and the collecting duct. The primary affect of aldosterone mediated Na + and Cl reabsorption in the kidney is via the stimulation of Na + reabsorption in the distal tubule and the collecting duct. Aldosterone enters the principal cells and binds to the mineralocorticoid receptor (MR). Ligand binding leads to a conformational change in MR and the release of chaperone heat shock proteins. This conformational shift reveals nuclear localization si gnals and causes the receptor to undergo nuclear translocation and bind to the deoxyribonucleic acid (DNA) sequence of target genes to stimulate or repress transcription. Classical aldosterone induced genes include the alpha subunit of the epithelial sodiu m channel ( Scnn1a ), (Sayegh et al., 1999), the alpha1 subunit of Na + K + Atp1a1 ) (Kolla et al., 1999), and the serum and glucocorticoid regulated kinase 1 gene ( Sgk1 ) (Loffing et al., 2001).

PAGE 25

25 Aldosterone Stimulation of ET 1 Endothelins are pot ent vasoconstrictor peptides derived from the endothelium. Endothelin 1 (ET 1) was first identified as an aldosterone responsive gene in the Cain laboratory (Gumz et al., 2003). An increase in Edn1 mRNA was observed after 1 hour of treatment with 10 6 M al dosterone. Inhibiting either the MR or the glucocorticoid receptor (GR) with spironolactone or mifepristone, respectively, decreased Edn1 expression levels. These results indicated that both receptors contribute to aldosterone mediated increases in Edn1 g ene expression (Gumz et al., 2003). Additional work by others examined kidneys isolated from adrenalectomized Sprague Dawley rats treated with 50 g/110g body weight aldosterone for one hour (Wong et al., 2007). A 2 fold increase in Edn1 mRNA was observed. Co treatment with potassium canrenoate (20 mg/animal) ,an aldosterone receptor antagonist, blocked induction of Edn1 mRNA. The Wingo laboratory focused on aldosterone stimulation of Edn1 mRNA in acutely isolated inner medullary collecting duct cells from male Sprague Dawley rats treated with either 1 mg/100g body weight aldosterone or vehicle (2% ethanol in saline) for 2 hours (Stow et al., 2009). An aldosterone dose dependent nuclear translocation and binding of both MR and GR to hormone response elemen ts in the Edn1 promoter was observed in a murine inner medullary collecting duct cell line (mIMCD 3) (Stow et al., 2009). After 1 h, aldosterone led to a two fold i ncrease in Edn1 mRNA expression in the inner medulla. Chromatin immunoprecipitation and DNA affinity purification assays demonstrated direct binding of both receptors to a hormone response element localized in the region of the Edn1 gene (Stow et al., 2009, Stow et al., 2012).

PAGE 26

26 The Endothelin Family There are three structurally and pharmacol ogically distinct isoforms of endothelin, endothelin 1 (ET 1), endothelin 2 (ET 2), and endothelin 3 in mammalian species (ET 3) (Inoue, 1989b). The human genes of ET 1, ET 2 and ET 3 are located on chromosomes 6, 1, and 20, respectively. The murine genes of ET 1 ET 2, and ET 3 are located on chromosomes 13, 4, and 2, respectively. All three isoforms of endothelin are 21 amino acids, are highly homologous, and share a common structure, with two intrachain disulfide linkages (Figure 1 2 ). The disulfide bri dges confer resistance to enzymatic degradation in the plasma and tissues. ET 1 is the only endothelin family member released from the endothelium, and is produced by a wide variety of cell types ET 2 is expressed in the heart, lung, renal medulla and co rtex, vasculature, reproductive organs, and the colon. ET 3 is expressed in the brain, eye, intestine, lung, and kidney (Bagnato et al., 2011). Endothelin 1 ET 1 is an intercellular signaling molecule expressed in many different organ systems and tissues. Although ET 1 is best known as a potent vasoconstrictor, ET 1 plays important roles in the vasculature, kidney, humoral systems, nervous system, and in the heart (Kohan et al., 2011). ET 1 was first isolated in 1988 by Yanisagawa et al. from the supernata nt of cultured porcine aortic endothelial cells. Purified ET 1 was shown to cause contraction of smooth muscle cells in many different species. Since its initial discovery, studies have shown that ET 1 has a more biologically diverse role in mammalian phys iology.

PAGE 27

27 The Endothelin 1 Gene The human preproendothelin 1 gene was first cloned in 1989 by Inoue and colleagues. The gene for human EDN1 1 is encoded within five exons distributed over 6836 base pairs (Figure 1 2). The gene is located on chromosome 6p23 p24 in humans (Arinami et al., 1991). The mRNA was determined to be 2026 nucleotides long, excluding the poly(A) tail and has a half life of approximately 15 minutes (Inoue et al., 1989). The mature endothelin 1 (amino acids 53 73) is encoded entirely with in exon 2, and the entire untranslated region (UTR) is encoded in exon 5. The half life of the mature ET 1 in the healthy circulation is about one minute (Gasic et al., 1992). The murine Edn1 gene is organized in the same manner and is located on chromo some 13 at position 20.82 cM 1. By convention the human endothelin 1 gene is written EDN1 while the rat and murine endothelin 1 gene are written Edn1 Endothelin Processing Preproendothelins are formed following transcription and translation. Processing o f the three endothelin isoforms is depicted in Figure 1 4. Human ET 1 encodes the 212 amino acid preproET 1. Removal of the short signal sequence by a signal peptidase yields proET 1. Next, proET 1 is cleaved by a furin like protease which belongs to the c alcium dependent serine endoproteases on the C terminal side of the sequence Arg Ser Lys into the circulation. Big ET 1 has about two orders of magnitude less vasoconstrictor potency than the mature ET Juste et al., 2003). Big ET 1 is processed into ET 1 by endothelin converting enzymes (Figure 1 4).

PAGE 28

28 Endothelin Converting Enzymes The conversion of Big ET 1 to ET 1 occurs primarily through the action of the high ly specific Endothelin Converting Enzyme 1 (ECE 1). ECE 1 cleaves Big ET 1 between Trp21 and Val22 to produce the mature peptide ET 1 (Xu et al., 1994). ECE 1, a type II membrane bound metalloprotease, is present as a dimer on the cell surface (Xu et al., 1994). A single gene, with different promoters, encodes four different isoforms of ECE 1 (ECE 1a, 1b, 1c, and 1d), which arise from alternative splicing of the ECE 1 mRNA (Kuruppu and Smith, 2012). There are subtle differences in the cytoplasmic N termina l of the different isoforms that are important for subcellular trafficking (Jafri and Ergul, 2003, Schweizer et al., 1997), suggesting that the mature form of ET 1 can be converted from Big ET 1 both intracellularly and extracellularly. These isoforms of E CE 1 show similar specificity converting Big ET 1 to ET 1 but big ET 2 and big ET 3 are converted much less efficiently, suggesting that other ECE isoforms may be involved in processing Big ET 2 and Big ET 3. Interestingly, a negative feedback loop to regu late ECE 1 production in the presence of ET 1 has been detected. Treatment of cells with ET 1 resulted in a decrease in both ECE 1 mRNA and protein expression over 6 hours (Naomi et al., 1998). Two other ECE isoforms, ECE 2 and ECE 3, have been identified ECE 2, which has 59% identity to ECE 1, was found to convert Big ET 1 to mature ET 1 both in vitro and in transfected Chinese hamster ovary (CHO) cells. ECE 2 converts Big ET 1 more efficiently than either Big ET 2 or Big ET 3. ECE 2 also has a more aci dic optimal pH than ECE 1, pH 5.5 versus a neutral optimal pH, respectively. This suggests that ECE 2 acts as an intracellular enzyme at the trans Golgi network, where the vesicular fluid is acidified (Emoto and Yanagisawa, 1995). ECE 3 was first purified from bovine iris

PAGE 29

29 microsomes (Hasegawa et al., 1998), where concentrations of ET 3 are higher than ET 1. ECE 3 was found to convert Big ET 3 to ET 3 but proved unable to convert Big ET 1 to ET 1. ECE 3 was found to be somewhat larger, 140 kilodaltons (kDa) than either ECE 1 or ECE 2, both of which are 130 kDa. Endothelin Receptors Early studies demonstrated that all three endothelins had strong vasoconstrictor and pressor effects (Inoue et al., 1989a). Synthetic peptides were used to examine their biologi cal activities. The contractile responses were assayed on porcine coronary artery strips in vitro. All three peptides exhibited strong and long lasting vasoconstrictor activity at nanomolar concentrations. The vasoconstrictor activity was greatest for ET 1 and lowest for ET 3. The pressor responses were examined in vivo on anesthetized chemically denervated rats; all three isoforms produced a strong pressor response. The peak pressor effect was essentially identical for ET 1 and ET 1, but smaller for ET 3. The time required for blood pressure to return to baseline values was longest for ET 2 and shortest for ET 3. Interestingly, the initial depressor effect was more profound in ET 3 than ET 1. The pharmacological profiles of the three isoforms were conside rably different, suggesting the existence of subtypes of endothelin receptors (Inoue et al., 1989). The two subtypes of endothelin receptors, ET A R (Arai et al., 1990) and ET B R (Sakurai et al., 1990), are G protein coupled receptors. The receptors are memb ers of the seven transmembrane domain family of receptors (Sakurai et al., 1990). The distribution of the receptor subtypes differs: the ET A R is predominantly found in smooth muscle cells and cardiac muscles, whereas the ET B R is predominantly found in

PAGE 30

30 endo thelial cells (Huggins et al., 1993). All three endothelin family members bind ET B R at physiological concentrations with similar affinity, but ET 3 binds with lower selectivity, and does not activate ET A R. ET 1 and ET 2 bind ET B R and ET A R with equal potenc y. There are two agonists for the ET B R, sarafotoxin 6c and IRL1620 (Watts, 2010), but to date, there are no reported agonists for the ET A R. The two receptors can have opposing or synergistic effects, depending on the cell type, tissue, or physiological sti muli. For example, the ET A R mediates vasoconstrictive and proliferative responses to ET 1 (Wagner et al., 1992), while the ET B R has more broad effects including endothelial cell survival, signaling to endothelial nitric oxide synthase (eNOS) and NO product ion, prostacyclin synthesis and ECE 1 inhibition (Sakurai et al., 1990). The ET B R also clears circulating ET 1, which occurs mainly in the lungs and the kidney (Johnstrom et al., 2005). After the ET B R is activated it is internalized, and then targeted to t he lysosome for turnover (Bremnes et al., 2000). The human kidney, unlike most other organs, has a higher content of ET B R. However, in renal disease, many of the pathophysiological effects of ET 1 seem to be mediated via the ET A R (Davenport and Maguire, 20 12, Kohan et al., 2011). The complexity of responses observed may be due to the ability of the endothelin receptors to form both homodimers and heterodimers. The different types of dimers display different binding density (Evans and Walker, 2008). Interest ingly, the functional response is different depending on dimer formation: binding of ET 1 to homodimers induces a transient elevation of Ca 2+ concentration, when ET 1 binds to heterodimers the response lasts several minutes (Evans and Walker, 2008). Furthe rmore, alternative splicing of EDNRA or EDNRB transcripts can occur, leading to alterations in receptor

PAGE 31

31 functional characteristics (Evans and Walker, 2008). However, alternative splicing in the renal receptors has not been observed (Hatae et al., 2007, Shy amala et al., 1994). Endothelin Receptors in the Kidney Collecting Duct The collecting duct represents the final nephron segment able to control urinary electrolyte and H2O content. The collecting duct, in particular the inner medullary collecting duct, p roduces more ET 1 than any other cell type in the kidney or indeed the entire body (Kohan, 1997). The collecting duct is also the site of the highest endothelin receptor expression in the kidney. While ET A R expression remains undefined in the kidney, both animal models and humans have been shown to express ET B in relatively high amounts (Kohan, 1997, Ge et al., 2006). To examine the role of ET 1 in the collecting duct the activation of either ET A or ET B was examined. Patch clamp methods were used to invest igate the effects of basolateral ET 1 on the amiloride sensitive Na + channel in A6 distal nephron cells. Binding of picomolar ET 1 to ET B R inhibits, whereas the binding of nanomolar ET 1 to a different ET receptor (likely ET A R ) stimulates, sodium reabsorpt ion (Gallego and Ling, 1996). Patch clamp electrophysiology was also used to investigate regulation of the epithelial Na + channel (ENaC) by ET 1 in isolated, split open rat collecting ducts (Bugaj et al., 2008). ET 1 significantly decreased ENaC open pro bability by about three fold within 5 min utes Inhibiting ET A R 123 modestly decreas ed ENaC open probability In the presence of inhibited ET A R ET 1 retained its ability to markedly and rapidly decrease ENaC activity. These results suggest that ET A Rs do not play a significant role in acute regulation of ENaC by nanomolar concentrations of ET 1 in the freshly isolated rat collecting duct To define possible involvement of ET B R a similar

PAGE 32

32 strategy was used. ET B receptors were inhibited with BQ 788 which had only a modest effect on ENaC activity. However, i n contrast to inhibiting ET A R inhibiting ET B R completely abolished ET 1 action on ENaC These were the first studies directly demonstrating that ET 1 negatively regulates ENaC in the mammalian collecting duct (Bugaj et al., 2008). To examine the role of renal medullary ET B R in renal excretory function, an ET B R antagonist, A192621 (0.5 mg/kg/hr), was infused into the renal medulla of volume expanded Sprague Dawley rats (Guo and Yang, 2006). This infusion induced an immediate and significant reduction of u rine flow. Following intramedullary infusion of A192621, urinary Na + excretion remained unchanged during the first 20 minutes but started to decline, with a maximal effect observed at 60 min utes Changes in urinary excretion of both K + and Cl followed the same pattern as urinary Na + Over a 60 minute period of intramedullary infusion of A192621, several hemodynamic parameters such as mean arterial pressure, renal blood flow, or medullary blood flow were examined. Inteterstingly, none of the hemodynamic parameters examined were affected by infusion of A192621 These data suggest that intramedullary blockade of ET B R produces antidiuresis and antinatriuresis independently of hemodynamic changes, and that the immediate response to intramedullary blockade of ET B R is the reduction of H2O excretion followed by the reduction of Na + excretion (Guo and Yang, 2006). Whole animal studies were conducted to further examine the role of the ET B R Spotting lethal (sl) rats carry a naturally occurring deletion in the ET B gene that completely abrogates functional receptor expression (Gariepy et al., 1998). Rats homozygous for this mutation die shortly after birth due to congenital distal intestinal

PAGE 33

33 aganglionosis. Genetic rescue of ET B R sl/sl rats from this developmental def ect using a dopamine hydroxylase (DBH) ET B R transgene result ed in ET B R deficient adult rats. The DBH ET B R/ ET B R sl/sl rats express ed ET B R only under the transcriptional control a 5.8 kb fragment of the human DBH promoter. The rats express ed ET B R in adre nergic tissues but lack ed ET B R in most other tissues where ET B R is normally expressed. The authors demonstrated that the transgene is expressed in a limited, tissue specific manner during development (Gariepy et al., 1998). DBH ET B R/ ET B R sl/sl rats exhibi t ed normal renal and cardiovascular development, and the DBH ET B R transgene d id not affect blood pressure (Gariepy et al., 2000). On a Na + deficient diet, DBH ET B R/ ET B R sl/s l and wild type DBH ET B R/ ET B R +/+ rats both exhibit ed a normal arterial blood p ressure. However, DBH ET B R/ ET B R sl/sl rats were hypertensive on a normal Na + diet, and this hypertension was salt sensitive. On a high Na + diet, the DBH ET B R/ ET B R sl/sl rats were severely hypertensive. No difference in plasma renin activity or plasma al dosterone concentration was found between salt fed wild type, DBH ET B R/ ET B R +/+ or DBH ET B R/ ET B R sl/s l rats. Irrespective of diet, DBH ET B R/ ET B R sl/sl rats displayed increased circulating ET 1, and, on a high Na + diet, they show ed increased but incomple te hypotensive responses to acute treatment with ET A R antagonist FR13931 7 (10 mg/kg, intra arterially). Normal pressure wa s restored in salt fed DBH ET B R/ ET B R sl/sl rats when ENaC wa s blocked with amiloride (Gariepy et al., 2000) These results suggest tha t DBH ET B R/ ET B R sl/sl rats we re hypertensive because they lack ed the normal tonic inhibition of the renal ENaC. The role of the collecting duct ET A R in mediating ET 1 actions on the collecting duct was also evaluated. The ET A R gene was selectively disrup ted in the collecting duct

PAGE 34

34 (CD ET A R K O) (Ge et al, 2005) CD ET A R K O mice had no differences in systemic blood pressure, Na + or K + excretion, and plasma aldosterone or renin activity in response to a normal Na + or a high Na + diet compared with controls. During normal H2O intake, urinary osmolality, plasma Na + concentration, and plasma osmolality were not affected. Therefore, the collecting duct ET A R does not appear to be involved in modulation of systemic blood pressure or renal Na + excretion under physi ological conditions (Ge et al, 2005). Endothelin Physiology The presence of ET 1 was first proposed when conditioned media from primary endothelial cell cultures produce d constriction of isolated rings of the porcine left anterior descending coronary arte ry (Hickey et al., 1985) Increasing concentrations of endothelial cell conditioned culture media resulted in a dose dependent in isometric tension in porcine, bovine, and canine coronary arteries. Interestingly, the response did not require an intact endo thelium, suggesting the presence of a peptide vasoconstrictor derived from the endothelium (Hickey et al., 1985). Later this peptide was isolated and described in 1989 by Yanisagawa and colleagues W hile it is best known as a potent vasoconstrictor, ET 1 h as been shown to have many roles in many different cell and tissue types. Endothelin and the Vasculature Endothelin is well known as a regulator of vascular tone. To examine diffusion of ET 1 human umbilical vein endothelial cells (HUVECs) were cultured on acellular amniotic membranes, dividing the tissue culture wells into an apical (luminal) and a basolateral (abluminal) compartment. 125 I ET 1 added was added on the apical or the basolateral side at a final concentration of 0.1 nM. Analyzing ET 1 secr etion, roughly

PAGE 35

35 80% of the total amount of synthesized ET 1 was found in the basolateral compartment. In the presence of dexamethasone, a decrease in the level of ET 1 was found in the apical compartmen t, whereas the total amount of ET 1 produced was no t affected (Wagner et al., 1992). These results provided early evidence that ET 1 is a local paracrine regulator of vasotone. The synthesis of ET 1 is difficult to study because it is very efficiently cleared from the circulation. Additionally discrimin ation between Big ET 1, ET 1, and the other endothelins is technically difficult so many commercially available detection methods have either wide ranges of specificity or are lack sufficient sensitivity to detect the level of circulating ET 1 in the plas ma. Plasma ET 1 levels have been determined to be in the low picomolar range (0.1 0.4 pM), using ELISA, which is well below the EC 50 of many of the biological actions of ET 1 (Treiber et al., 2000). The reported cross reactivity of the antibody was <0.02% for all big ETs, 7.8% for ET 3, and 27.4% for ET 2 (Treiber et al., 2000). ET 1 action in the vasculature is mediated by both ET A and ET B receptors located on vascular smooth muscle. Currently, the precise signaling events responsible for endothelin ind uced vasoconstriction in different vascular beds remain unclear, but it is commonly accepted that phospholipase C activation, inositol triphosphate generation and calcium mobilization from intra and extra cellular sources are involved (Schneider et al., 2 007). To examine the effect of ET B receptor blockade, the hemodynamic effects of systemic doses of the ET B selective antagonist BQ 788 were investigated in healthy male volunteers (Strachan, et al., 1999). After a 15 minute infusion of BQ 788 (3, 30, or

PAGE 36

36 300 nmol/min) or placebo, plasma ET 1 and big ET 1, blood pressure, heart rate, cardiac index, and stroke index were measured. Plasma ET 1 was shown to increase, but there was no significant change in plasma big ET 1. Although BQ 788 had no effect on mean arterial pressure, r eduction s in heart rate, cardiac index, and stroke index were observed and an increase in total peripheral vascular resistance was seen The selective ET B R antagonist BQ 788 caused peripheral vasoconstriction in healthy volunteers, sug gesting that the overall balance of effects of endogenous ET 1 at the vascular ET B R favors vasodilatation (Strachan, et al., 1999). The effects of ET A selective, ET B selective, and nonselective rec eptor antagonists on the plasma immunoreactive ET 1 level s in the rat were examined, as well as blockade of the ET A R in humans (Opgenorth et al., 2000). The plasma ET 1 level was increased by five and ten fold after rats were treated with A 192621, an ET B selective antagonist, for 3 days at 30 and 100 mg/kg/day v ia food. The plasma ET 1 level was increased by 1.8 and 2.4 fold when rats were treated with A 216546, an ET A selective antagonist, at 10 and 50 mg/kg/day via food for 7 days. As a comparison, the plasma ET 1 level was increased by > 24 fold when rats were treated with A 1820 86, a nonselective antagonist for ET A and ET B at 100 mg/kg/day via food for 9 days. In humans, blockade of ET A R by ABT 627 did not result in an elevation in ET 1 until after 7 days of treatment (Opgenorth et al., 2000). The results, ta king into consideration previous observations, suggest that the ET B receptor is the clearance receptor for ET 1 within the vasculature. Endothelin 1 and the Nervous System It has been suggested that ET 1 has a role in the central nervous system, based on its histological identification in both the central and peripheral nervous system in a

PAGE 37

37 number of species, including humans. Ea rly work demonstrated positive immunostaining for ET 1 in neurons of the human spinal cord (Giaid et al. 1989). Additional studies demonstrated that EDN1 mRNA, ET 1, ECE 1, ET A and ET B receptors localized within multiple regions of the human brain (Naidoo, 2004). ECE 1 and ET B receptors were detected in over 20 regions of the brain, and ET A receptors were detected in nine regions. ED N1 mRNA, ET 1, ECE 1 and ET B receptors were observed in cortical pyramidal cells, neurons, cells in the anterior pituitary gland; nerve cell processes in the pars nervosa; pinealocytes and choroidal epithelial cells. Only EDN1 mRNA, ET 1, ECE 1, and ET B re ceptors were detected in cerebral capillary endothelial cells (Naidoo, 2004). A neurotransmitter role for ET 1 has also been proposed. In the peripheral nervous system a topical application of ET 1 was shown to alter nerve conduction (Zochodne et al. 199 2). Additionally, EDN1 mRNA and ET 1 like immunoreactivity have been described in human spinal cord and dorsal root ganglia (Giaid et al. 1991). Taken together, these data suggest that ET 1 plays a part in neural transmission/modulation in addition to its vascular actions. Endothelin 1 and the Heart Early studies in neonatal cardiomyocytes isolated from rat detected the expression of both E dn 1 mRNA (Ito et al., 1993) and mature ET 1 (Suzuki et al., 1993). However, EDN1 mRNA was not detected cells isolated from adult guinea pig hearts (Preissig Mueller et al., 1999) or cardiomyocytes isolated from adult rats (Merkus et al., 2005). These results suggest that, unlike neonates, it is possible that the healthy adult cardiomyocytes do not produce ET 1. Cardiomyoc ytes express ET A Rs (Farah et al., 1996), and activation of the ET A R in humans resulted in increased contractility

PAGE 38

38 (MacCarthy et al., 2000). L type Ca 2+ channels produce the main depolarizing current in response to ET 1 after activation of the ET A Rs (Komuka i et al., 2010). Because ET 1 is known to have systemic effects on the vasculature, the local effect of ET 1 was examined independently in healthy humans using an intracoronary injection of an ET A R antagonist BQ 123 (MacCarthy et al., 2000). ET 1 was foun d to have a modest positive ionotrophic response. Interestingly, in patients with heart failure, blocking endogenous ET 1 by inhibiting the ET A receptor was shown to increase contractility (MacCarthy et al., 2000). Endothelin 1 and the Kidney The kidney is both a functional target and a source of ET 1 ET 1 is present in relatively high amounts, and while it is particularly abundant in the inner medulla (Kitamura et al., 1989), it has been shown that apparently every cell type in the kidney synthesizes ET 1and expresses endothelin receptors (Kohan et al., 2011). In the kidney, the endothelin system serves to modulate glomerular filtration rate, Na + and urinary H 2 O excretion, acid/base balance, cellular proliferation, and inflammation. The cellular localiz ation of both ET receptor subtypes in the vascular and tubular system of the rat kidney was determined by immunofluorescence microscopy (Wendel et al., 2006). In the renal vasculature, as in the rest of the vasculature, ET A Rs are present on both smooth mus cle cells and endothelial cells, while ET B Rs are expressed only in the endothelial cells (Wendel et al., 2006). In the vascular system both ET A Rs and ET B Rs were observed in the media of interlobular arteries and afferent and efferent arterioles. In interlo bar and arcuate arteries, only ET A Rs were present on vascular smooth muscle cells. ET B R immunoreactivity was low on endothelial cells of renal arteries, whereas there was strong immuno labeling of peritubular and glomerular

PAGE 39

39 capillaries as well as vasa recta endothelium. ET A Rs were evident on glomerular mesangial cells and pericytes of descending vasa recta bundles. In the renal tubular system, ET B Rs were located in epithelial cells of proximal tubules and inner medullary collecting ducts, whereas ET A Rs were found in distal tubules and cortical collecting ducts. Both ET receptor subtypes cooperate in mediating renal cortical vasoconstriction but exert differential and partially antagonistic effects on renal medullary function (Wendel et al., 2006). Endothelin and the Tubular System Endothelin has been shown to control channel activity and inhibit Na + reabsorption, and collecting duct derived ET 1 and the endothelin receptors play an important role in the regulation of Na + H 2 O, and acid excretion. The proxima l tubule synthesizes ET 1, but in relatively low amounts (Kohan, 1991). In cultured human renal proximal tubular cells, RNAase protection assays demonstrated the ex pression of EDN1 and EDN2 mRNAs (Ong et al., 1995) Analysis of total cellular RNA by RT PCR demonstrated expression of mRNAs for both ET A and ET B receptor subtypes. Combined blockade of ET A and ET B receptors (by PD 145065) but not that of ET A Rs alone (by BQ 123) blocked the mitogenic effect of exogenous or endogenous ET 1 and also profoundly sup pressed endogenous ET 1 synthesis. In contrast, incubation with the ET B R agonist, BQ 3020, stimulated endogenous ET 1 synthesis (Ong et al., 1995). Additional studies demonstrated that t he ET B R inhibited Na + K + ATPase activity in rat renal proximal tubule (RPT) cells (Liu et al., 2009). In RPT cells from Wistar Kyoto rats, stimulation of ET B Rs by the ET B R agonist, BQ3020, decreased Na + K + ATPase activity. The ET B R mediated inhibition of Na + K + ATPase activity was dependent on an increase in intracellular c alcium, because this effect was

PAGE 40

40 abrogated by a chelator of intracellular free calcium (BAPTA AM), a Ca 2+ channel blocker (nicardipine) and a phosphatidylinositol 3 kinase inhibitor (wortmannin). An inositol 1,4,5 trisphosphate receptor blocker (2 aminoethy l diphenyl borate) also blocked the inhibitory effect of the ET B R on Na + K + ATPase activity. These results suggest that i n rat RPT cells, activation of the ET B R inhibits Na + K + ATPase activity by facilitating extracellular Ca 2+ entry and Ca 2+ release from endoplasmic reticulum (Liu et al., 2009). While the role of ET 1 in the thin loop of Henle is poorly understood, it is known to be expressed at relatively low levels (Moridaira et al., 2003). ET A R induced Ca 2+ signaling has been observed in the rat thin descending limb (Bailey et al., 2003), but the expression of ET A Rs and ET B Rs is disputed depending on the species. In the thick ascending limb ET 1 expression is thought to be greater than ET 1 production in the proximal tubule, but lower than in the colle cting duct (Kohan et al., 2011). The ET B receptor activation has been shown to elevate Ca 2+ concentration and nitric oxide production in the rat cortical thick ascending limb, and this plays a role in the inhibition of chloride reabsorption (Plato et al., 2000). The collecting duct shows the highest level of ET 1 of any cell type in the kidney, and quite possibly the highest level of ET 1 expression in any cell or tissue type in the entire body (Moridaira et al., 2003). The collecting duct consists of po larized epithelium, and it has been established that there is polarity of ET 1 secretion in the collecting duct. ET 1 is predominantly released from the basolateral side of rat inner medullary collecting duct cells (Kohan and Padilla, 1992), murine cortica l collecting duct cell line (Todd Turla et al., 1994), and in Madin Darby Canine Kidney Epithelial Cells (Shramek

PAGE 41

41 et al., 1993).The ET B R has been shown to be highly expressed in the inner medullary collecting duct in both mice and humans (Kohan, 1997, Ge e t al., 2006), the majority of these receptors are located in the basolateral side, which enables ET 1 to function in an autocrine manner. ET 1 has been shown to both inhibit the Na+,K+ ATPase in the rabbit inner medullary collecting duct (Zeidel et al., 19 89), and in isolated, split open rat cortical collecting ducts ET 1 decreased ENaC open channel probability (Bugaj et al, 2008). Both effects would favor Na+ secretion in the urine. Endothelin 1 and Disease While ET 1 has been shown to be involved in p hysiological functions, the dysregulation of ET 1 has been shown to result in pathological alterations in many different diseases. Specific blockade of either receptor would attenuate the effects of ET 1, however, the broad localization of the two receptor s, combined with the fact that the two receptors activate opposing signaling pathways, make it difficult to characterize ET 1 and its receptors in disease states. The overall action of ET 1 is to increase blood pressure and vascular tone. Therefore, endoth elin antagonists may play important role s in the treatment of cardiac, vascular and renal diseases associated with vasoconstriction and cell proliferation These include essential hypertension, pulmonary hypertension, chronic heart failure and renal diseas e Endothelin 1 and Hypertension and Vascular Disease Due to its vasoconstrictive properties, and the fact that it is released from vascular endothelial cells, it is not surprising that ET 1 is involved in the pathogenesis of hypertension and vascular dis ease. Endothelin expression has been shown to be elevated in the atherosclerotic plaque of human coronary arteries (Lerman et al., 1991),

PAGE 42

42 and inhibition of the ET A receptor has been shown to inhibit the formation of atherosclerotic plaques in rabbit arter ies (Tepe et al., 2002). Exposure of mice with coronary atherosclerosis to mental stress or hypoxia led to acute ischemia and other symptoms which were indicative of acute myocardial infarction. Apoptotic death of cardiomyocytes was followed by inflammati on and fibrosis in the heart. These pathological changes were prevented by a blockade of the ET A receptor with LU135252 (1 mg/kg of body weight). Treatment with LU135252 dramatically attenuated the electrocardiogram signs of myocardial ischemia and also re duced the extent of subsequent myocardial infarction. These results suggest that stress elicits myocardial infarction through endothelin receptor signaling in coronary atherosclerosis (Caliguiri et al., 1 999). In patients with essential hypertension treatme nt with bosentan, a nonselective endothelin receptor antagonist, or darusentan, an ETA receptor antagonist, was shown to substantially reduce arterial blood pressure (Krum et al., 1998, Nakov et al., 2002). Darusentan has also been shown to be effective f or treating resistant hypertension (Black et al., 2007). African American and obese patients are both at increased risk for cardiovascular and renal disease and often have resistant hypertension. These patients also have elevated plasma ET 1 levels, and tr eatment with darusentan, or other endothelin receptor antagonists may be potential therapeutic options for these patients. Endothelin 1 and Pulmonary Hypertension and Heart Failure The lungs and the heart are both targets as well as sources for ET 1. Pat ients with pulmonary hypertension have higher pulmonary arterial levels of ET 1 than venous plasma levels of ET 1 compared to patients with normal pulmonary pressure. This could be due to either increased pulmonary ET 1 production, or decreased clearance o f ET 1

PAGE 43

43 in the lung (Kedzierski and Yanagisawa, 2001). Selective ET A R antagonists and nonselective endothelin receptor antagonist bosentan have been shown to reduce pulmonary artery pressure and remodeling of pulmonary arteries (Dupuis, 2001). Dogs with p ulmonary hypertension were treated with ET B R antagonists, resulting in increased both pulmonary pressure and vascular resistance. The evidence suggests that ET A R antagonists, not ET B R antagonists, would be best for treatment of patients with pulmonary hype rtension (Kedzeirski and Yanagisawa, 2001). ET 1 and ET A R are the predominant signaling components of the endothelin signaling system in the heart. In the healthy heart, the endothelin system contributes to ionotrophy, arrhythmogenesis, and the contracti le function of cardiomyocytes. Impaired cardiac function has been shown to result in increased levels of Big ET 1 or increased levels of circulating ET 1 (Miyauchi et al., 1989). Plasma endothelin concentrations are increased in the acute phase of myocardi al infarction and in chronic heart failure. Plasma endothelin concentrations were shown to be strongly related to an unfavorable prognosis after myocardial infarction (Omland et al., 1994). Additional studies showed that plasma big endothelin 1 concentrati ons were significantly higher in patients with moderate and severe heart failure than in those with mild heart failure. In advanced heart fa ilure, plasma big endothelin 1 was strongly related to survival and appeared to predict 1 year mortality better than hemodynamic variables and levels of atrial natriuretic peptide (Pacher et al., 1996). The latter are established prognostic marker s in chronic heart failure Furthermore, these elevated levels of ET 1 seen in heart failure are thought to be derived from p ulmonary congestion, which in turn impairs the clearance function of the lung (Staniloae et al., 2004).

PAGE 44

44 Endothelin 1 and Renal Disease Endothelin plays an important pathophysiological role in the kidney. The kidney is important in the long term regulatio n of blood pressure and Na + balance, and ET 1 is a major contributor to renal physiology. The endothelin system appears to be involved in the pathogenesis of chronic kidney disease (CKD) and fibrosis. ET 1 is involved in the progression CKD largely due to its stimulatory effect on renal cell proliferation and extracellular matrix production. Protein overload of the renal tubular cells leads to an increase in the synthesis and release of ET 1 (Begnini et al, 1998). This peptide accumulates in the interstitiu m and activates a series of events that leads to inflammation, and ultimately renal scarring. A correlation has been found between increased levels of urinary ET 1 excretion and renal damage. In patients with remission of proteinuria, urinary ET 1 levels d ecreased, whereas in patients with persistent proteinuria urinary ET 1 levels remained elevated (Vlachojannis et al. 2002). Diabetic nephropathy is a major complication of diabetes mellitus, and is the leading cause of end stage renal disease (Groop et a l., 2009). Renal involvement is seen in both type 1 and type 2 diabetes mellitus, and about 15 20% of type 1 diabetes patients and 30 40% of diabetes type 2 patients will eventually develop end stage renal disease (Benz and Amann, 2011). In patients with d iabetes, hyperglycemia stimulated ET 1 production, and higher urinary and circulating ET 1 levels were observed ( Zanatta et al., 2008)). Insulin was also found to increase renal ET 1 production, providing a link between diabetic nephropathy and a pathophy siological role for ET 1. Endothelin receptor blockers have been shown to be nephroprotective in animal models of type 1 and type 2 diabetes mellitus (Kahn et al., 1999, Gross et al., 2003), in patients ET A R

PAGE 45

45 blockade was shown to lower blood pressure and increase renal blood flow (Honing et al., 2000). Transcriptional Regulation of the Edn1 Gene The regulation of Edn1 gene transcription is achieved through the actions of many different hormones, stimuli, and cell signals that converge on cis acting eleme nts in the Edn1 promoter (Stow et al., 2011) Although some response elements such as the AP 1 and HIF 1 sites function in many cells types, many factors governing Edn1 apparently vary significantly among different cells. A systematic survey of the Edn1 ge ne for tissue and condition specific activation of enhancer elements is needed. Finally, the emerging fields of epigenetic regulation (Welch et al., 2013) and mRNA stability (Jacobs et al., 2013) will undoubtedly shed more light on the regulation of Edn1 expression Post T ranscriptional Regulation of EDN1 mRNA Regulation of EDN1 expression occurs primarily at the level of transcription (Stow et al., 2011) ; however, it is becoming clear that EDN1 mRNA is regulated at the post transcriptional level. This re gulation is reflected in the relative instability of the EDN1 mRNA, with a measured half life of approximately 1 5 minutes (Inoue et al., 1989). The mechanisms providing this apparent lability appear to be focused on the untranslated region (UTR) of the EDN1 UTR represents over 50% of the total mRNA length and contains long tracts of highly conserved sequence. Alignment of 19 species of class Mammalia yielded greater than 80% sequence identity between EDN1 and this conservation extends more broadly among vertebrate species (Chapter 4) The level of conservation by itself

PAGE 46

46 suggests that there are elements in the UTR that are critical for tight regulation of EDN1 mRNA availability. Mammalian EDN1 UTRs typically contain 3 7 AU rich elements (AREs) depending on the species. Early work by Mawji et al. (2004) identified one human ARE (position 978 987) that facilitated mRNA turnover via the AUF1 proteosome pathway. However, the AREs were not sufficient to f ully destabilize the EDN1 message. The importance of apparent ARE action was supported by additional studies implicating the same region in EDN1 lability (952 991) (Reimunde et al., 2004). While these studies demonstrated that AREs play a role in EDN1 mRNA turnover, they also suggested that the instability of the EDN1 mRNA was not entirely dependent on the AREs. microRNA microRNAs (miRNAs) are a family of small (18 26 nucleotide), single stranded, endogenously produced, noncoding RNA. RNA interferenc e had been demonstrated to manipulate gene expression in Caenorhabditis elegans The presence of miRNA was discovered when a novel observation was made: transfecting double stranded RNA (dsRNA) had a much more profound effect on gene silencing than transfe cting single stranded RNA (Fire et al., 199 8 ). T ransfecting dsRNA predicted to target promoter or intron sequences, resulted in no interference. In contrast, t he transfection of dsRNA markedly decrease d or eliminate d endogenous mRNA transcript levels (Fire et al., 199 8 ). Early work in Drosophila melanogaster focused on the expression patterns of miRNA (Lagos Quintana et al., 2001). It was noted that certain miRNAs were expressed only in embryogenesis, while others were observed at consistent levels at all d evelopmental stages. These observations suggested that while some miRNAs may

PAGE 47

47 play a role during certain stages of development, others appear to be involved in normal cellular maintenance (Lagos Quintana et al., 2001). miRNA Annotation Currently, measures a re being taken to unify the miRNA nomenclature. The name of a miRNA contains specific information. For example, consider the miRNA mmu miR it is from the miR 200 family. Many miRNA s are classified in families, and these family members can be encoded on different chromosomes The important point is that t hey share a common seed sequence The seed sequence is typically defined as position 2 particular miRNA is related to at least two other miRNA s. In this e xample there are known miR 200a and miR 200b miRNAs and miR 200c shared a seed sequen ce with both capitalized, it can refer to the miRNA precursor, the genomic locus, the primary transcript, or even the extended hairpin that includes the precursor. However mi R mature products, mmu miR 200c and mmu miR 200c*. In this case miR 200c arises 200c hairpin, and miR (Lee and Ambros, 2001) However, the the miR/miR* nomenclature is being retired in favor of the 5p/ 3p nomenclature. miRNA Biogenesis Early work studying the biogenesis of miRNAs first detected a precursor miRNA (pre miRNA) of about ~70 nt using Northern blot analysis, however, analysis of mammalian cDNA databases suggested that the mature form of an miRNA was processed from a much long er primary transcript (pri miRNAs) (Lagos Quintana et al.,

PAGE 48

48 2001). Using a bioinformatics and cDNA cloning approach, it was determined that many miRNA genes are located in intergenic regions that contain no other known or predicted transcript (Lee and Ambro s, 2001, Lau et al., 2001). Transcription of miRNA G enes Characterizing miRNAs genes has been difficult because they differ from protein coding genes, and appear to lack common promoter elements. Originally, RNA Polymerase III (Pol III) was thought to m ediate miRNA transcription, because it transcribes most small RNAs, such as tRNAs and U6 snRNAs. However, several studies provided evidence that Pol III may not be mediating miRNA transcription. For example, pri miRNAs can be up to several kilobases in len gth, and often contain stretches of more than four uricils, which would signal transcription termination for Pol III (Lee et al., 2002). Additionally, expressed sequence tag analysis identified many transcripts containing miRNA sequences. Many of these seq uences contain poly (A) tails and some are spliced. These observations were consistent with transcription by RNA Polymerase II (Pol II) (Smalheiser, 2003). The first direct evidence that miRNA genes are transcribed by Pol II was reported by Lee et al. (2 003). RNAs with a 7 methyl guanosine cap were selectively enriched from total RNA using affinity purification with eIF4E, the high affinity cap binding protein. The fraction of RNA bound to eIF4E demonstrated that multiple miRNA transcripts (e.g. pri m iR 23a~27a~24 2, pri let 7a 1, pri let 7a 3, pri miR 30a, and pri miR 21) contained a cap. The fraction of RNA bound to eIF4E did not contain the mature or pre miRNA, suggesting that only the pri miRNA has a cap. The cap is removed during processing of pri miRNA to pre miRNA. To verify the presence of a poly (A) tail, oligo d (T) cellulose beads were used to selectively enrich the total RNA for

PAGE 49

49 transcripts containing a poly(A) tail (Lee et al., 2004). All pri miRNAs examined contained poly(A) tails, howeve r, some signals may have been due to long internal stretches of As that could lead to internal priming. To determine the polymerase amatin was used to selectively inhibit Pol II. Treatment amatin for 5 9 hours resulted in a reduction in levels of pri miRNA, indicating that Pol II is responsible for miRNA transcription. While the authors were able to determine Pol II was transcribing the miRNA cluster, they were unable to define any common promoter element s, such as the TATA box, the initiator element, the downstream promoter element, or the TFIIB recognition element in the promoter region (Lee et al., 2003). Genomic analysis of miRNA genes revealed that many miRNA clusters had Alu elements upstream of th e promoter regions (Borchert et al., 2006). Alu transcription occurs through recruitment of Pol III, and many of the upstream Alu elements had Pol III promoter elements. Chromatin immunoprecipitation (ChIP) was performed using antibodies specific for Pol I II, Pol II, TFIIIB, and TFIIIC. ChIP analysis of sequences ~300 bases upstream of miRNAs with Alu upstream elements showed enrichment for Pol III, TFIIIB, and THIIIC, demonstrating specific occupancy of these loci with transcriptional machinery for Pol III (Borchert et al., 2006). In summary, it appears that individual miRNA genes are transcribed by either Pol II or Pol III. Additional studies used computational analysis to identify and define conservation in miRNA genes (Berezikov et al., 2005). Sequenc ing was performed on the 700 base pairs surrounding 122 known miRNAs in ten different primate species, such as gorilla, chimpanzee, macaque, tamarin, spider monkey, wool l y monkey, and

PAGE 50

50 lemur. The sequences revealed a strong conservation in the stem of miRNA hairpins and a higher degree of variation in loop sequences. The resulting profile was used to predict miRNAs in human and mouse using cross species comparison. This technique identified 976 novel miRNA candidates (Berezikov et al, 2005). While this metho d presented a novel way to identify miRNA genes, it failed to discover any regulatory elements that would provide insight into the transcription of miRNA genes. Houbaviy and colleagues (2011) provided the first evidence of a TATA box in a miRNA gene prom oter. While examining the sequence upstream of an early embryonic miRNA cluster (EEmiRC) a putative TATA box was discovered. A sequence alignment of the Bos taurus Homo sapien Mus musculus and Can i s familiarus EEmiRC revealed a conserved TATATAAGA motif This motif contained a canonical TATA box located at position 35 in all four species. To test if this TATA box was involved in RNA Pol II dependent transcription a genomic fragment ( 2003 +4898) containing the putative murine promoter sites was cloned u pstream of a fragment encoding enhanced green fluorescent protein (EGFP). This reporter construct was transfected into embryonic stem cells. Reproducible expression of EGFP was measured by fluorescence activated cell sorting Deleting the region containin g the TATA box resulted in a significant decrease in EGFP expression, but EGFP expression was not completely eliminated. Similar results were observed by transfection of the EGFP reporter vector into human embryonic kidney cells (HEK293) (Houbaviy et al., 2005). Nuclear Processing by Drosha The pri miRNA transcripts are generally several kilobases long and contain one or more local stem loop structures. The first step of miRNA maturation is cleavage at the stem of

PAGE 51

51 the hairpin structure, which releases a sm all hairpin that is termed a precursor miRNA (pre miRNA). This reaction takes place in the nucleus by the nuclear RNAse III type protein Drosha (Lee et al., 2003). In vertebrates, Drosha requires the DiGeorge syndrome critical region 8 protein (DGCR8) as a cofactor. Mouse ES cells that are deficient in DGCR8 fail to produce miRNAs and have defects in proliferation and dif ferentiation (Wang et al.,2007) In C. elegans and D. melanogaster the cofactor for Drosha is Pasha. Human Drosha fractionates at approxim ately 650 kDa, indicating that Drosha functions as a large complex known as a microprocessor The Drosha / DGCR8 complex contains two double stranded RNA (dsRNA) binding domains (Han et al, 2004). A typical pri miRNA consists of a ~33 base pair stem, a termi nal loop, and flanking single stranded RNA segments. DGCR8 interacts with the pri miRNA through the single stranded RNA segments and the stem, and provides a structural support for Drosha to cleave the substrate pri miRNA about 11 base pairs away from the single strand double strand RNA junction (Han et al., 2006, Zeng and Cullen, 2005). Drosha and DGCR8 regulate each other post transcriptionally. The Drosha DGCR8 complex cleaves the hairpin structures embedded in the DGCR8 mRNA, and destabilizes it. DGCR8 stabilizes Drosha protein through protein protein interaction, so the decrease in DGCR8 mRNA would consequently effect of destabilization of Drosha (Han et al., 2009). This cross regulation may have a role in maintaining homeostasis in miRNA biogenesis. Nu clear Export by Exportin 5 Following processing by the Drosha/DGCR8 microprocessor complex, pre miRNAs are exported to the cytoplasm in a process mediated by Exportin 5 (EXP5).

PAGE 52

52 Originally thought to be a minor export mechanism for tRNAs (Bohnsack et al., 2002), the major cargo of EXP5 is pre miRNA (Yi et al., 2005, Bohnsack et al., 2004). EXP5 recognizes the ~14 base pair double stranded stem and the short (~1 8 nt) overhang of the pre miRNA (Zeng and Cullen, 2004). EXP5 can bind pre miRNAs specifically in a process that requires the presence of a Ran GTP co factor (Yi et al., 2005). Exportins contain a RanGTP binding site and transfer cargo between the nucleus and cytosol. Exportins bind their cargo in the nucleus with high Ran GTP levels, then transloc ate as a trimeric complex (RanGTP EXP cargo) into the cytoplasm, where the hydrolysis of GTP releases the cargo and Ran. The exportin returns to the nucleus to continue to faci litate transport (Kutay et al., 1997). Cytoplasmic Processing by Dicer In the cytosol, pre miRNAs are further processed by Dicer. Dicer cleaves the pre miRNA near the terminal stem loop, releasing the mature miRNA duplex (Hutvanger et al., 2001, Knight and Bass, 2001). Dicer is highly conserved and found in almost all eukaryotic org anisms. Dicer interacts with double stranded RNA binding proteins I n mammals Dicer interacts with TRBP (trans activating response (TAR) RNA binding protein) and the protein activator of the interferon induced protein kinase (PACT). Both proteins are comp onents of the RNA induced Silencing Complex (RISC). Following Dicer cleavage, the mature miRNA is loaded onto an argo na ute (Ago) protein within RISC. One strand serves as a guide strand, while the other strand is degraded. The RNA duplex is is asymmetric and the relative thermodynamic stability of first 1 4 bases at each end determine s which s trand is incorporated into RISC (Schwartz et al., 2003, Khvorova et al., 2003). The strand whose 5 end is less stable serves as the guide strand Because the miRNA is incorporated as a duplex, it is

PAGE 53

53 thought that strand selection is determined by the polarity of the duplex prior to or upon loading of the miRNA duplex. The Ago family of proteins are the core components of RISC. There are two conserved domains which structurally define the Ago proteins: the PAZ domain, which binds to the 2 nt overhang at the end of small RNAs, and the PIWI domain, which can mediate endonucleolytic cleavage (Kim et al., 2009). Ago1 and Ago2 have been demonstrated to posses s strand d issociating activity of miRNA duplexes, but Ago 3 and Ago 4 apparently do not. Ago1 and Ago2 function as RNA chaperones and perform multiple rounds of strand dissociation (Wang et al., 2009). miRNA duplexes with central mismatches are preferentially sorted into Ago1, which incorporate miRNA duplexes only when assembling translational repression competent complexes. siRNA duplexes with perfect matches are preferentially sorted into Ago2, which has target RNA cleavage activity (Wang, et al., 2009). It has be en shown that the phosphate of the guide miRNA is essential for loading into Ago, as is the nucleotide of the guide strand (Kawamata et al., 2011). Changing the nucleotide alters the thermodynamic asymmetry of the duplex, but the identity of the n ucleotide itself is not critical for RISC loading (Kawamata et al., 2011). The miRNA targeted mRNA is engulfed into P bodies, where it can be either stored or degraded (Valencia Sanchez et al., 2006) miRNAs in Renal Physiology In the kidney, it is clear that miRNAs are required for both development and homeostasis and are also involved in the regulation of blood pressure and homeostasis. Additionally, miRNAs are emerging as important players in renal pathophysiology.

PAGE 54

54 In kidney development, miRNAs are i nvolved at the earliest stages. To address the potential action of Dicer dependent miRNAs in mammalian kidney development, Nagalakshmi and colleagues (2011) conditionally ablated Dicer function within cells of nephron lineage and the ureteric bud derived c ollecting duct system. Six2 Cre mediated removal of Dicer activity from the progenitor cells of the nephron epithelium led to elevated apoptosis and premature termination of nephrogenesis. Thus, Dicer action is important for the development of a normal nep hron complement. HoxB7 Cre mediated removal of Dicer function from the ureteric bud epithelium led to the development of renal cysts. Cyst formation was preceded by excessive cell proliferation and apoptosis, and accompanied by disrupted ciliogenesis withi n the ureteric bud epithelium. Dicer removal also disrupted branching morphogenesis. Thus miRNA activity has distinct regulatory roles within different components of the developing mouse kidney (Nagalakshmi et al., 2011) Additional studies examined t he lo ss of miRNAs in nephron progenitor cells, which result ed in a premature depletion of this population during kidney development (Ho et al., 2011) Increased apoptosis and expression of the pro apoptotic protein Bim accompanied this depletion. Profiling of m iRNA expression during nephrogenesis identified several highly expressed miRNAs (miR 10a, miR 106b, miR 17 5p) in nephron progenitors that are either known or predicted to target Bim (Ho et al, 2011) In Dicer knockout mice, podocyte specific knockout of D icer caused proteinuria by the second week after birth, followed by rapid progression of glomerular and tubular injury by the third week, and ultimately resulting in death by the fourth week due to renal failure (Harvey et al., 2008).

PAGE 55

55 In mammalian kidneys a transcription factor, osmotic response element binding protein (OREBP), has been shown to regulate cellular osmoregulation. In murine renal cells and kidneys, OREBP mRNA and protein expression were shown to be regulated by miR 200 and miR 717 (Huang et al., 2011). Inhibiting either miRNA increased expression of OREBP. Exposure of kidney cells to hypertonic medium significantly downregulated the expression of both miR 200b and miR 717 (Huang et al., 2011). miRNAs have also been shown to be involved in r egulating components of RAAS in the kidney. Juxtaglomerular cells synthesize and release renin. To examine if miRNAs play a role in juxtaglomerular cells, mice with a conditional deletion of Dicer were generated (Sequeira Lopez and Gomez 2010). Deletion o f Dicer severely reduced the number of juxtaglomerular cells, decreased expression of the renin genes (Ren1 and Ren2), lowered plasma renin concentration, and decreased blood pressure. As a consequence of the disappearance of renin producing cells, the kid neys developed striking vascular abnormalities and prominent striped fibrosis. The authors concluded that miRNAs maintain the renin producing juxtaglomerular cells and the morphologic integrity and function of the kidney (Sequeira Lopez et al, 2010). Furth ermore, d eletion of Dicer from the ureteric bud and its descendents resulted in severe unilateral or bilateral hydronephrosis by three months (Pastorelli et al., 2009). miRNAs in Renal Disease Recent studies have focused on analyzing the expression of miR NAs in renal disease. Understanding the role of miRNAs in renal disease could lead to novel therapies.

PAGE 56

56 Polycy s tic kidney disease (PKD) is a disorder in which clusters of cysts containing aqueous like fluid develop in the renal epithelial cells. The disea se arises from mutations or dysregulated expression of the genes which encode polycystin 1 (PKD1), polycystin 2 (PKD 2), or the gene for fibrocystin/polyductin (PKDH1). The mutations can be either autosomal dominant or autosomal recessive. One of the twelv e types of mutations found in the autosomal dominant form of PKD is a silent mutation in the UTR. The involvement of miRNAs in PKD was first demonstrated in a rat model. Differential expression of miRNAs was observed in the kidneys of a PKD rat model, w here the dysregulated miRNAs targeted many signaling pathways involved in PKD (Pandey et al., 2008). Additionally, miR 17 was shown to directly regulate PKD2 and Bicc1, a post transcriptional regulator of PKD2 interferes with the binding of miR 17 to the 3 UTR of PKD2 mRNA (Tran et al., 2010). miRNAs may also have a role in diabetic nephropathy, which is the leading cause of end stage renal disease. In glomeruli isolated from streptozotocin injected diabetic mice and diabetic db/db mice, miR 192 levels we re elevated (Kato et al, 2007). miR 192 was shown to regulate E box repressors that are responsible for controlling the expression of collagen 1 (Kato et al, 2007). These proteins are responsible for the glomerular and tubular hypertrophic growth typically seen in diabetic nephropathy. The loss of miR 192 correlates with tubulointerstitial fibrosis and reduction in glomerular filtration rates in biopsies from patients with established diabetic nephropathy (Krupa et al., 2010). In end stage renal disease, renal transplantation is preferred over dialysis because of better survival rate and better quality of life. However, acute allograft

PAGE 57

57 rejection and chronic allograft nephropathy are major challenges to utilizing this therapy. Differential miRNA expression patterns were found in acute rejection of kidney allografts. Comparing acute rejection biopsies with normal allograft biopsies revealed a subset of 17 miRNAs that were differentially expressed (Anglicheau et al., 2009). Furthe rmore, this profile was used to accurately predict acute rejection by examining the intragraft levels of either miR 142 5p or miR 155 (Anglicheau et al., 2009). Similar work generated a panel of 20 miRNAs, 12 downregulated and 8 upregulated, in acute rejec tion when compared to normal allograft biopsies (Sui et al., 2008). These data could provide useful biomarkers for predicting allograft rejection in patients. In fibrotic kidney disease, fibrosis results from an imbalance in the turnover of extracellular matrix molecules, and is a common response to CKD. Epithelial mesenchymal transition (EMT) describes a reversible series of events during which epithelial cells undergo morphological changes and acquire mesenchymal characteristics. EMT has been suggested as a contributing factor for kidney fibrosis. Recent studies have demonstrated that EMT is regulated by miRNAs, specifically the miR 200 family and miR 205 (Gregory et al., 2008, Korpal et al., 2008). Additionally, the downregulation of miR 15a is thought to contribute to in vitro cystogenesis by targeting the cell cycle regulator Cdc25A (Lee et al., 2008). Chronic hypertension can result in kidney damage leading to hypertensive kidney disease or hypertensive nephrosclerosis. However, the exact molecular m echanism that leads to hypertensive nephrosclerosis remains unknown. Work by Wang and colleagues (2010) examined 34 patients with hypertensive neprhosclerosis, and controls from normal renal tissue. The authors found that the levels of intrarenal miR

PAGE 58

58 200a miR 200b, miR 141, miR 429, miR 205, and miR 192 were significantly higher in biopsies from patients with nephrosclerosis as compared to controls. Proteinuria correlated with intrarenal expression of miR 200a, miR 200b, miR 192, miR 141, miR 429, and miR 205. The degree of upregulation of this panel of miRNAs was found to correlate with disease severity (Wang et al., 2010). miR 29b has also been found to be upregulated in renal medullary tissues, with a negative regulatory effect on collagen and extracell ular matrix accumulation in hypertensive renal injury (Liu et al., 2010). miRNAs are also involved in kidney cancer. Although the functions of most of the identified miRNAs have yet to be determined, their use as potential biomarkers has been considered in several human diseases and cancers. In order to understand their role in renal tumorigenesis, the expression levels of miRNAs were studied in four sub types of human renal neoplasms; clear cell, papillary, and chromophobe renal cell carcinomas (RCC), and b enign renal oncocytomas (Petillo et al., 2009) Kidney tumor tissues from 20 patients were examined, four cases from each of the following histological subtypes: oncocytoma, chromophobe, papillary, poor prognosis clear cell, and good prognosis clear cell. The prognostic classification of the clear cell samples was based on cancer specific post nephrectomy survival of less than 5 years (poor prognosis) or 5 years or more (good prognosis). Total RNA was extracted from these samples and from their correspondin g matched normal kidney tissues. The authors found a unique miRNA signature for each subtype of renal tumor. Furthermo re, they were able to identify unique patterns of miRNA expression distinguishing clear cell RCC cases with favorable versus unfavorable o utcome. Work by Juan et al. (2010) identified

PAGE 59

59 a panel of 35 miRNAs that distinguish ed clear cell type renal cell carcinoma samples from patient matched normal kidney tissue with high confidence. Edn1 miRNA Interaction The primary mechanism thought to contr ol ET 1 bioavailability is the rate of transcription from the ET 1 gene ( EDN1 ), but recent research suggests that EDN1 expression is attenuated by miRNA mediated regulation. The action of specific miRNAs on EDN1 mRNA appears to vary greatly in a tissue spe cific manner. An excellent example of tissue specific miRNA action on EDN1 expression can be seen in endothelial biology. Yeligar et al. (2009) studied liver sinusoidal endothelial cells (rLSEC) derived from ethanol fed rats. These cells displayed large i ncreases of Edn1 mRNA in comparison to non ethanol controls. Two miRNAs, miR 155 and miR 199, showed decreased expression in response to ethanol treatment. A binding site miR 199 (position 166) was found in the human and rat UTR of the Edn1 mRNA Overexp ression of either miRNA completely inhibited ethanol induced Edn1 mRNA expression. Similar results were obtained with human microvascular endothelial cells (HMEC 1). Inhibiting miR 199 levels led to an increase in ET 1 protein levels in the presence of eth anol. The data provided convincing evidence that miR 199 regulates ethanol induced ET 1 levels in both rLSEC and HMEC 1. Another study examined two miRNAs, miR 125a and miR 125b, that are endogenously expressed in abundance in human vascular epithelial ce lls (Li et al., 2010). Both miRNAs are predicted to target the EDN1 UTR at an e lement located at position 373. 293A cells containing Luciferase EDN1 transfected with either miR 125a or miR 125b overexpression plasmids. As expected for

PAGE 60

60 miRNAs targeting EDN1 expression, both miRNA over expression plasmids suppressed luciferase expression in a dose dependent manner. Interestingly, in vascular epithelium the action of these miRNAs are regulated by oxidized low density lipoprot ein (oxLDL), which was shown to increase pre pro endothelin 1 production. miR 125a expression was enhanced by oxLDL treatment and miR 125b expression simultaneously decreased. The authors suggested that this could be an example of coordinate miRNA mediated E DN1 mRNA regulation. Recently, Li et al. (2012) proposed a novel role for miRNA regulation of EDN1 Levels of miR 1 increase during cardiac and skeletal muscle development, while ET 1 protein levels significantly decrease during differentiation of DMSO induced P19 teratoma cells to cardiomyocytes (Monge et al., 1995). Several murine and human tissues and cell lines were examined for levels of both miR 1 and EDN1 mRNA. In tissues where miR 1 levels were high, such as cardiac and skeletal muscle, EDN1 mRNA levels were low. In contrast, tissues that had high levels of EDN1 mRNA expression, including the lung and kidney, had low levels of miR 1 expression. The concept of a negative correlation between miR 1 and EDN1 mRNA, gained additional support from a seri es of luciferase reporter assays showing overexpression of miR 1 action on the EDN1 UTR in 293T cells. miR 1 may also be regulating EDN1 mRNA levels in some hepatocarcinomas. miR 1 is a known to act as a tumor suppressor in several types of cancer (Hudso n et al.,2011, Rao et al., 2010). Additionally, silencing the miR 1 gene was shown to induce proliferation of hepatoma cells (Datta et al., 2008). Li et al. (2012) demonstrated that miR 1 is down regulated in two different hepatocarcinoma cell lines, Hep2G and Hep3B, relative to an immortalized human liver

PAGE 61

61 cell line (LO2). Interestingly, miR 1 overexpression inhibited proliferation in HepG2 and Hep3B cells, and addition of exogenous ET 1after transfection increased cell viability. In many malignant cells u pregulation of ET 1 has been shown to promote cell proliferation (Bagnato et al., 2011), so it seems reasonable that the decrease in miR 1 levels in hepatocarcinoma cells is a contributing factor in increased cell proliferation. In diabetes, glucose has been shown increase the levels of several vasoactive factors, including ET 1 (Feng and Chakrabarti, 2012). It has been suggested that the resulting elevation of these factors contributes to the tissue damage seen in organs affected by diabetic complication s. An elegant study focused on the role of miR 320 in diabetes (Feng and Chakrabarti, 2012). To determine if miR 320 was regulated by glucose, streptozotocin diabetic (STZ) rats were fed either a control or high glucose diet. One month after the onset of d iabetes there was a significant decrease in miR 320 expression in STZ diabetic rat cortical tissue. HUVECs were treated with high levels of glucose and as expected EDN1 mRNA levels increased. HUVECs were then transfected with a miR 320 mimic to specifical ly block miR 320 binding to target mRNAs. A mimic is a small double stranded chemically modified synthetic RNA designed to bind to a target mRNA resulting in RISC based decrease in target mRNA expression. The level of EDN1 mRNA and ET 1 was significantly d ecreased when HUVECs treated with glucose were also transfected with a miR 320 mimic. This suggests that miR 320 plays a role in posttranscriptional regulation of ET 1 and other vasoactive factors. Thus in diabetes, the downregulation of miR 320 may lead t o the upregulation of those factors contributing to the pathogenic state.

PAGE 62

62 ET 1 I mpact on miRNA L evels I t is also becoming clear that ET 1 itself may be causing changes that influence the miRNA content in cells. For example, ET 1 has been shown to activate monocytes, leading to an increase in the expression of the chemokine macrophage inflammatory protein exhibit increased levels of circulating proinflammatory cytochemokines. Work b y Gonsalves and Kalra (2010) examined the effect of ET 1 on miRNA expression in a human acute monocytic leukemia cell line (THP 1). In this study, miRNAs with putative binding sites within the MIP UTR that were known to be upregulated in cancer or und er hypoxic conditions were selected for investigation. In THP 1 cells treated with ET 1, 60 80% reductions were seen in several miRNAs, including miR 20, miR 194, and miR 195a, relative to untreated cells. miR 195a was chosen for further examination becaus e of a highly conserved binding site in the MIP UTR Either treatment of THP 1 cells with a miR anti miR or transfection with a miR195a overexpression plasmid resulted in a dramatic increase in MIP only a m odest increase was seen when anti miR 195a was transfected prior to ET 1 treatment, and this increase was attenuated by a miR 195a overexpression plasmid. This change in mRNA corresponded with a change in ET 1 induced MIP levels inTHP 1 cells. T hese findings suggested that miR 195a is a negative regulator of ET 1 induced MIP A nother example of how ET 1 stimulus can affect miRNA levels can be seen in a cardiac specific miR 23a transgenic mouse (Wang et al., 201 1 ). T hese mice developed normally to adulthood and did not exhibit any substantial defects in cardiac function or morphology. However, an exaggerated hypertrophic response developed when animals

PAGE 63

63 were treated with phenylephrine. They also displayed an increase i n heart/body weight ratio, increased cardiomyocytes size, and elevated levels of hypertrophic specific markers. The levels of miR 23a were shown to significantly increase in response to ET 1 treatment, and knockdown of miR 23a attenuated the hypertrophic r esponses induced by ET 1. Additionally, miR 23a targets the transcription factor Foxo3a. Foxo3a inhibits cardiac hypertrophy, and ET 1 was shown to induce a decrease in Foxo3a levels. Looking at a downstream target of Foxo3a, magnesium superoxide dismutase (MnSOD), ET 1 induced reduction of MnSOD was attenuated by transfection of a miR 23a anti miR. These results led to the suggestion that ET 1 initiates hypertrophy through a miR 23a Foxo3a pathway. A unique relationship between ET 1 signaling and primary miRNA (pri miRNA) regulation has been observed by von Brandenstein et al. (2011). Under control miR 15a and prevent the release of miR 15a in the Caki 1 RCC cell line. However, ET 1 st imulation miR 15a was exported from the nucleus and processed into the mature form of miR 15a. Blocking either endothelin ature miR 15a. miR 1 inducible cell lines derived from malignant tumors, namely a melanoma cell line (SKmel 28) and a breast carcinoma cell line (MCF 7). Therefore depression of miR 15a may represent an i mportant mechanism of action for ET 1 signaling in tumor biology. Summary and Goals Hypertension is a leading risk factor for cardiovascular disease, the leading cause of death. However, the molecular mechanisms underlying hypertension are

PAGE 64

64 poorly characte rized as the cause of more than 95% of hypertensive patients is unknown However, it is known is that Na + reabsorption by the distal nephron and collecting duct plays a critical role in determining extracellular fluid volume and blood pressure T his proce ss is stimulated by aldosterone. ET 1 levels have been shown to be upregulated by aldosterone (Gumz et al., 2003), but ET 1 exerts an opposing action on Na + reabsorption in the collecting duct. We hypothesize that aldosterone dependent induction of Edn1 ex pression in the collecting duct mediates a negative feedback mechanism to prevent excessive Na + retention resulting from aldosterone stimulation Understanding the post transcriptional mechanisms controlling ET 1 bioavailability represents an important ne w target for therapeutic development. The studies described here lay the ground work demonstrating that miRNAs act on EDN1 mRNA in many different cells, such as principal cells of the renal collecting duct. Since ET 1 can function by an autocrine mechanis m, ET 1 has the potential to indirectly affect its own expression via miRNA ( Figure 1 5). The goal of this dissertation is to define both the miRNA landscape in mIMCD 3s, and the changes in miRNA expression in response to aldosterone. Furthermore, underst anding how transcripts involved in Na + reabsorption, such as Edn1 the serum glucocorticoid kinase 1 ( Sgk1 ) and the beta 1 subunit of the Na + ,K + ATPase ( Atp1B1 ), are regulated by miRNAs represents a novel regulatory mechanism for aldosterone stimulated Na + reabsorption.

PAGE 65

65 Table 1 1. NaCl t ransport a long the n ephron. Table a dapte d from Koeppen and Stanton, 2001 Segment Percentage of filtered NaCl reabsorbed Mechanism of Na+ entry across the apical membrane Major Regulatory Hormones Proximal tubule 67 Na+/H+ exchange Cotransport with amino acids and organic solutes Na+/H+/Cl /anion exchange Angiotensin II Norepinephrine Epinephrine Dopamine 25 Na+ K+ 2Cl symport Aldosterone Distal tubule ~4 Na+ Cl symport Aldosterone Late distal tubule and collecting duct ~3 Na+ channels Aldosterone Atrial natriuretic peptide Urodilatin

PAGE 66

66 Table 1 2. H 2 O transport along the nephron. Table adapted from Keoppen and Stanton, 2001. Segement Percentage of load reabsorbed Mechanism of H 2 O re absorption Proximal tubue 67 Passive (Descending thin limb only) 15 Passive Distal tubule 0 No water reabsorption Late distal tubule and Collecting duct ~8 17 Passive

PAGE 67

67 Table 1 3 Hormones that regulate NaCl and H 2 O reabs orption in the kidney Adapted from Koeppen and Stanton, 2001. Hormone Major Stimulus Nephron Site of Action Effect on Transport Angiotensin II Proximal tubule reabsorption Aldosterone concentration Thick ascending l imb Distal tubule Collecting duct reabsorption

PAGE 68

68 Table 1 4. Main c haracteristics of the e ndothelin r eceptors. Adapted from Davenport and Maguire, 2011. ET A ET B Gene Name EDNRA EDNRB Ligand Affinity ET 1 = ET 2> ET 3 ET 1 = ET 2 = ET 3 Desensitization Slow Fast Trafficking Endosom es for recycling Lysosomes for degredation Peptide agonists None Sarafotoxin S6C BQ320 IRL1620 Peptide antagonists BQ123 FR139317 BQ788 Renal Function Vasculature Cortical vasoconstriction Conduit vessel v asoconstriction Afferent arteriolar constriction Efferent arteriolar constriction Medullary vasodilation Conduit vessel vasodilation Afferent arteriolar dilation Efferent arteriolar dilation Glomerulus Mesangial cell contraction Mesangial cell proliferation Podocyte injury None Inner Medullary Collecting Duct Extracellular matrix accumulation Interstitial fibrosis Natriuresis

PAGE 69

69 Figure 1 1 A bisected view of a human kidney and renal tubule. B MD macula densa, PT proximal tubule, JM juxta medullary nephron, DTL descending thin limb, ATL ascending thin limb, TAL thick ascending limb, DT distal tubule, CCD cortical collecting duct, OMCD outer medullary collecting duct, IMCD inner medullary collecting duct. Figure adapted from Koeppen and Stanton, 2001.

PAGE 70

70 Figure 1 2. Overview of ET 1 synthesis. Intron exon structure and RNA processing pathway are indicated for the E dn1 gene. Translation yields preproET 1 that is p rocessed in sequential proteolytic steps to generate ET 1. St ructure of ET 1 contains 2 disulfide bridges and was rendered from the RCSB Protein Data Bank (PDB 1T7H) using PyMOL (Stow et al., 2009)

PAGE 71

71 Figure 1 3. Primary sequences of endothelin isoforms. Amino acids that differ from the ET 1 sequence in ET 2 and ET 3 are shown in yellow and red, respectively. Figure 1 4 Processing of endothelin family members and endothelin receptor specificities

PAGE 72

72 Figure 1 5. Processing of ET 1 and miRNAs and overview of miRNA mediated translational repressi on.

PAGE 73

73 CHAPTER 2 DELETION ANALYSIS OF THE EDN1 UTR Introduction Reg ul ation of the ET 1 gene ( Edn1 ) occurs primarily at the level of transcription in many tissues (Stow et al, 2011), but it is also clear that Edn1 mRNA is reg ul ated at both the post transcri ptional and translational level s The untranslated region (UTR) of the Edn1 mRNA represents over 50% of the total transcript length and contains long tracts of sequences conserved in vertebrates from humans to birds to amphibians. The high level of cons ervation suggests that there are elements in the UTR that are critical for tight reg ul ation of Edn1 mRNA availability. Several mechanisms are known to affect Edn1 mRNA stability, such as the presence of AU rich elements (AREs) and miRNA reg ul ation. Ear ly work based on a crude deletion analysis showed that the human Edn1 UTR has two distinct conserved domains important for R Edn1 These two domains function together to promote Edn1 mRNA destabilization. DE1 contains 3 7 AREs depending on species one conserved ARE (located in human EDN1 mRNA at position 978 987) was shown to facilitate mRNA turnover via the AUF1 proteosome pathway However, DE1 alone could not reconstitute the destabilizing activity seen in the full length Edn1 UTR. The elements responsible for promoting destabilization activity in DE2 were not examined (Mawji et al., 2004). Additional studies by a different group implicated a similar region as important in destabilizing the E DN 1 mRNA (952 991) (Reimunde et al., 2005). Of the six AREs in this region, three (ARE 3 ARE 4 and ARE 5 ) were shown to contribute to E DN 1 UTR instability. The authors noted that

PAGE 74

74 these resul ts differed slightly from p revious ly reported studies and suggested several factors that could reconcile the differences: the two groups investigated slightly different fragments of the 3 ` UTR, and the Reimunde et al study included a short poly(A) tract. Some AU rich binding proteins have been shown to interact with the poly(A) tail and/or the poly(A) binding proteins, and the presence of this poly(A) tract may have contributed to the difference in the results. The authors did not address DE2 (Reimunde et al., 2005). More recent work has demonstrated that miRNAs play a role in reg ul ating ethanol mediated expression of ET 1 in LSECs and HMEC 1 s (Yeligar et al 2009 ) This work d emonstrated miR 199 control of ethanol induced ET 1 expression in LSECs,and tha t both miR 199 and miR 155 regulate ethanol induced ET 1 expression in HMEC 1 cells. Over the past three years, several other miRNAs have been linked to ET 1 regulation (Chapter 1). In this chapter the generation of a luciferase Edn1 UTR reporter gene vector is described. The full length murine Edn1 UTR was inserted into a luciferase reporter, and then a systematic series of UTR deletions were constructed. Following transfection into mIMCD 3 cells, luciferase activity was determined as a measure of luciferase Edn1 UTR mRNA stability and translation efficiency. The results confirm and extend some of the earlier deletion analysis observations. More importantly, the data clearly show that the ARE elements are not alone responsible for the labili ty of Edn1 mRNA.

PAGE 75

75 Materials and Methods Generation of L uciferase R eporter C onstructs In order to construct a luciferase Edn1 reporter vector, it was first necessary to generate Edn1 RNA isolated from mIMCD 3 cells grown in DMEM supplemented wi th charcoal stripped FBS and treated with 1 M aldosterone for one hour was used to generate c DNA. A 5X reverse transcription (RT) buffer (250 mM Tris, pH 8.3, 375 mM KCl, and 15 mM MgCl2) was prepared according to specifications on the Invitrogen website ( I nvitrogen.com ) To make cDNA using the oligo d(T) primer a reaction was set up containing 4 L 5X RT buffer, 1 L 10 mM dNTPs, 2 L 0.1M DTT, 2 L d(T) primer, and 2 L of the RT enzyme mix. First, 3 5 g of total RNA was diluted with H2O to a final vo lume of 8 L Next, 3 L of oligo d(T) primer and 1 L of dNTP mixture were added to the sample, mixed vigorously and briefly centrifuged Then the sample was incubated at 70 C for 10 minutes, and quick chilled on ice. Finally, 4 L of RT buffer, 2 L DT T and 2 L of enzyme mix ture were added to the sample. The sample was mixed vigorously and briefly centrifuged The sample was incubated at 42 C for 60 minutes, and at 70 C for 15 minutes. The sample was diluted with 180 L H 2 O To amplify the 1.3 kilo base fragment of the UTR, a PCR reaction was prepared consisting of 5 L Platinum Taq 10x buffer ( 600 mM Tris SO 4 (pH 8.9), 180 mM Ammonium Sulfate ) (Invitrogen), 1.5 L 50mM MgCl2, 2.5 L cDNA (from reaction described above), 1 L primer MM5 (Table 2 1 ) 1 L primer MM6, 0.5 L Platinum Taq (Invitrogen), 1.5 L dNTP mix, and 37.5 L H 2 O. The PCR cycles used were: 94 C for 10 minutes, then 30 cycles of 94 C for 30 seconds, 58 C for 30 seconds, 72 C for 1 minute, and 72 C for 10 minutes. MM5 was des igned to introduce a novel EcoRI site in

PAGE 76

76 the coding sequence of the Edn1 mRNA 247 bases upstream of the UTR. MM6 introduced a novel XhoI site after the native Edn1 polyadenlyation signal. These restriction sites were chosen to facilitate cloning of the Edn1 UTR into the pmirGLO vector (Pro mega) (Figure 2 1, Panel A) The PCR product was ligated into the pCR2.1 TOPO vector (Invitrogen) and transformed into One Shot chemically competent Escherichia coli cells (Invitrogen). This strain overexpresses th e Lac repressor ( lac Iq gene). For blue/white screening IPTG was added to the plates to obtain expression from the lac promoter. Several white colonies were selected, plasmid DNA was prepared using the Qiagen Miniprep kit (Qiagen) insert DNA was screened u sing an EcoRI (New England Biolabs) digest (Figure 2 1, Panel B) In order to insert the Edn1 to be added to the pmirGLO multiple cloning site. After QuikChange TM mutagenesis using primers M11 and MM1 2 to introduce an EcoRI site the res ul ting plasmid DNA was screened for the presence of an EcoRI site (Figure 2 2 ). The resulting plasmid named pMJ2 had the required EcoRI site. B oth pMJ1 and pMJ2 were digested with EcoRI and XhoI, run on a 0.8% agarose g el to isolate the fragments respectively. A gel extract ion kit ( Qiagen) was used to recover the DNA fragments and a ligation performed Ligations were set up using 20 femtomoles of EcoRI/XhoI digested pmirGLO, and either 60 fmoles or 200 fmoles of the Edn1 and an overnight ligation performed. 1 L of the ligation reactions were transformed into 25 L competent E. coli and the cells were plated on LBG ampicillin plates. To verify

PAGE 77

77 that the ligation of the Edn1 3 UTR cDNA into pMJ2, plasmid DNA was isolated and screened using an EcoRI/XhoI digest (Figure 2 3) QuikChange TM mutagenesis, so mutagenesis experiments to mutate selected put ative miRNA binding sites were conducted using the full length Edn1 pMJ1 as a template for the mutagenesis. T he QuikChange TM mutagenesis products generated using primers MM9 and MM13 (Table 2 1) on pMJ1 were transformed into chemical ly competent E. coli cells. A successful mutagenesis introduced the SNaBI site and mutated the binding site. Plasmid DNA was isolated and then screened for the presence of a SnaBI site (Figure 2 vector, an EcoRI/XhoI digest was performed to isolate the fragment containing the mutated binding site from the TOPO vector. The reporter plasmid pMJ2 was also digested with EcoRI/XhoI to generate compatible ends for the ligation step. The insert and vector were gel purified, an overnight ligation was set up, and the ligation products were transformed into chemically competent E. coli cells. To verify the insert was present, plasmid DNA was screened for the presence of the 1.3 kb insert using an EcoRI/XhoI digest and a new SnaBI site (Figure 2 4, Panel B) Once the correct size insert was verified, the plasmid was sequenced using primers R24 and F20 to ensure that only the SnaBI site had been mutated and n o other bases had been affected. T he PCR reaction s to generate systematic deletions in the Edn1 UTR cDNA w ere set up using 100 ng of pMJ3 as template, 5 L 10X Taq buffer ( 500 mM KCl, 100 mM Tris HCl (pH 9.0 at 25C), 15 mM MgCl 2 and 1% Triton X 100 ) 1.5 L 50mM MgCl 2 2 L forward primer (Table 2 1) 2 L reverse p rimer (MJ20), 1 L 10mM dNTPs,

PAGE 78

78 0.3 L Taq, and 36.2 L H 2 O PCR cycles used were: 95 C 1 minute, then 28 cycles of 95 C for 30 seconds, 54 C for 1 minute, 72 C for 1 minute The PCR reactions were recharged with 0.3 L Taq, and 1 L dNTPs, and the PCR cycles were repeated. A 100 L SacI/XhoI digest of the PCR products and pMJ3 was performed the reactions were h eat inactivated at 65 C for 20 minutes. Ligation reactions were set up, the ligation products were transformed into competent E. coli and pla ted on selective media as described above TaqMan miRNA Q uantitative Real Time PCR RNA was isolated from mIMCD 3 cells using Trizol (Invitrogen). The reverse transcription reaction was set up containing 0.15 L 100 nM dNTPs, 1 L MultiScribe reverse tran scriptase (50U/L), 1.5 L 10X RT buffer, 0.19 L RNase inhibitor (20U/L), 4.16 L nuclease free H2O 3L 5X RT primer (Table 2 2), 5 L RNA( 1ng/L). The reaction was mixed gently, and briefly centrifuged. Cycling parameters for the RT reaction were 30 m inutes at 16C, followed by 30 minutes at 42C, then 5 minutes at 85C. For qPCR analysis the reaction was set up containing 1 L TaqMan miRNA probe, 1.33 L cDNA product from RT reaction, 10 L TaqMan Universal Master Mix II (Invitrogen) and 7.67 L nu clease free H 2 O Cycling parameters were set up for 2 minutes at 50C, 10 minutes at 95C, then 40 cycles of 95C for 15 seconds followed by 60C for 1 minute. The first step was to set up cDNA synthesis using a primer to anneal to the mature form of the m iRNA. The cDNA synthesis reaction was set up using 0.15 L dNTP mix, 1 L M ul tiScribe TM Enzyme Reverse Transcriptase (Applied Biosystems), 1.5 L 10X buffer, 0.19 L RNase inhibitor, 4.2 L H 2 O and 5 L (1ng/ L ) RNA, and 3 L miRNA primer. The cyclin g par ameters for cDNA synthesis: 16 C for 30 minutes, 42

PAGE 79

79 C for 30 minutes, 85 C for 5 minutes. After cDNA synthesis, real time PCR reactions were set up: 10 L TaqMan Universal Master Mix II (Invitrogen) 1 L 20X probe, 7 L H2O and 1.3 L cDNA. Real tim e cycling parameters were a 50 C hold for 2 minutes, 95 C hold for 10 minutes to activate the enzyme, then 40 cycles of 95 C for 15 seconds, and 60 C for 1 minute. Luciferase Assays mIMCD 3 cells were counted, diluted in antibiotic free DMEM F12, an d approximately 40,000 cells/well were plated in 24 well tissue c ul ture dishes (Costar 3524) in DMEM F12. Cells were grown for 48 hours after plating. 250 pMol of the reporter construct was mixed with non specific DNA (to 1 ug) and with 0.2 g of pRL cont rol plasmid DNA. Transfections were carried out using DharmaFECT4 (Thermoscientific). Optimal transfection time was 48 hours. Cell lysis and the reporter gene assays were conducted according to the Dual Luciferase Reporter Gene protocol (Promega). Lucifera se data was normalized to the Renilla transfection control and the activity of the empty reporter, pmirGLO, was set to 100%. Res ul ts Construction of the Luciferase Edn1 UTR Reporter Construct In order to study the stability of the Edn1 UTR, the full length UTR was inserted into a luciferase reporter. To determine if the PCR reaction designed to amplify the Edn1 UTR was successf ul t he PCR product was analyzed on an agarose gel (Figure 2 1 A ) the appearance of a 1.3 kb band indicated that the PCR was su c cessf ul Next, the PCR fragment was ligated into a TOPO vector. To verify that the fragment was inserted into the TOPO vector, an EcoRI digest was performed. Proper insertion of the 1.3kb PCR product into the TOPO vector res ul t ed in a 3.9 kb fragm ent

PAGE 80

80 and a 1.3 fragment after an EcoRI digest. A plasmid displaying the correct restriction pattern was identified and the nucleotide sequence determine d using a forward primer (R24) and a reverse primer (F20) (Table 2 1, Table 2 3) Sequencing res ul ts conf irmed amplification of the Edn1 P lasmid pMJ3, contain ed the f ul l length, wild type luci f erase Edn1 UTR reporter gene (Figure 2 3 ). Transfection of pMJ3 into mIMCD 3 cells yielded about 20% of the luciferase activity compared to empty control vector pmirGLO (Figure 2 6) This is consistent with previous reports that the Edn1 mRNA wa s very unstable Detection of miRNAs in mIMCD 3 C ells The UTR of the Edn1 mRNA was analyzed for likely miRNA binding sites with two separate algorithms (Targetsc an.org, microRNA.org). Even under high stringency search parameters, numerous strong miRNA binding sites were predicted in t he murine Edn1 UTR In silica analysis predicted that both miR 98 and the miRNAs of the let 7 family wo ul d bind to position 574 581 in the Edn1 UTR. In order to examine if the let 7 family or miR 98 were involved in regulating Edn1 bioavailability, the presence of these miRNAs in mIMCD 3 cells was determined. First, an in silica analysis (microRNA.org) suggested that of the let 7 family, only let 7c and let 7f were likely to be highly abundant in the murine collecting duct. The presence of these miRNAs in mIMCD 3cells was empirically confirmed using a TaqMan MicroRNA Assay (Applied Biosystems). For this assay total RNA was extra cted from mIMCD 3 cells. Pre formulated primer and probe sets were used to detect the mature form of the miRNAs (Table 2 2). Applied Biosy s tems recommended snoRNA 202 as a positive control for murine samples Sno 202 has been shown to vary little amongst a wide variety of murine cell types and tissue samples. For this assay, C T values less than or equal to 29

PAGE 81

81 indicate d a strong, positive reaction where there wa s abundant miRNA in the sample. C T values ranging from 30 37 indicate d positive reactions with mod erate amounts of target miRNA in the sample. C T values below 40 indicate that the miRNA wa s detectable in the sample, but at very low amounts (Table 2 4). The positive control, snoRNA 202, had an average C T value of 22.6. Both let 7c and let 7f had C T valu es of 25.7 indicat ing that both of these miRNAs we re present in abundant amounts. The C T value s for miR 98 showed that this miRNA is present in moderate amounts for miR 199 t he C T value indicated a very low abundance Mutation of Selected miRNA Target Sites in the Edn1 UTR Once it had been established that the miRNAs of interest were present in the mIMCD 3 cells, the putative binding site for let 7/miR 98 in the Edn1 UTR w as mutated as a test of whether these miRNAs targeted the Edn1 mRNA. To exam ine the importance of the highly conserved putative let 7/miR 98 binding site in the Edn1 UTR was destroyed. A decision was made to eliminate the binding site by mutating it and changing 5 of the 8 nucleotides in the putative binding site to a SnaBI res triction site. In order to verify that a novel miRNA binding site was not created by this mutagenesis, the seed sequences of the top 500 miRNAs predicted to be present in the murine collecting duct were examined in silico To examine the effect of deleti ng the miR 199 site identified in by Yeligar et al (2009) a similar QuikChange TM mutagene s is (Agilent Technologies) was used to eliminate the miR 199 binding site. This mutagenesis introduced a novel XmaI site replacing the miR 199 site (Figure 2 5 A ). The UTR was then excised using via an EcoRI/XhoI digest followed by gel purification and ligated into the luciferase reporter vector (Figure 2 5 B).

PAGE 82

82 Transfection of the mutation plasmids into mIMCD 3 cells revealed that destroying the let 7/miR 98 binding s ite (pMJ5) did not appear to have an y impact on luciferase activity (Figure 2 6). Indeed luciferase activity was very similar to that observed with the parent lucierase Edn1 in the mIMCD 3 cells, the highly co nserved let 7/miR 98 binding site does not play a role in regulating the Edn1 UTR reporter activity (Figure 2 6). Furthermore, deletion of the miR 199 binding site did not affect luciferase activity either. Apparently t he miR 199 regulation of Edn1 obser ved by Yeligar et al (20 09 ) in liver sinusoidal cells is an example of a tissue specific miR 199 regulation. Large Scale D eletion Analysis of the Edn1 UTR In order to define a region of the Edn1 UTR that is important for stability, a series of delet ion constructs spanning the length of the UTR were generated. The UTR was scanned for unique restriction sites that co ul d be used for this deletion analysis. The first deletion construct removed bases 514 1096 by utilizing two existing XbaI sites in p MJ3 which generate d plasmid pMJ6. Ligation mediated mutagenesis was used to generate several deletion constructs. To remove bases 958 1345 from pMJ3, primers MJ3 and MJ4 (Table 2 1) were designed to have ends compatible with a NheI sticky end and a XhoI overhang, as well as a SacI site. Plasmid DNA was isolated from transformants and screened using a Sac I digestion S uccessf ul ligation resulted in the appearance of a 500bp fragment not seen in pMJ3 and the resulting plasmid was named pMJ7 (Figure 2 7). The next deletion construct was designed to remove bases 221 958 from pMJ3. Primers MJ7 and MJ8 (Table 2 1) were designed to have a SacI end and a NheI

PAGE 83

83 sticky end and an additional PvuII site. P lasmid DNA was isolated and screened for insertion of the linker using a PvuII digestion (data not shown) Deleting various regions of the UTR restore d about 15% luciferase activity of the reporter constructs pMJ6 and pMJ7, but neither deletion construct completely restore d luciferase activity to the lev el seen in the empty vector pmirGLO (Figure 2 8 ). The most interesting res ul t was obtained from pMJ9 (Figure 2 8). Plasmid pMJ9 yielded luciferase activity comparable to pmirGLO This deletion eliminated many possible miRNA binding sites but also retaine d all three AU rich elements This result suggests that the AU elements are probably not be the major reg ul ator of Edn1 m RNA stability. Systematic D eletion Analysis of the Edn1 UTR In addition to deleting large segments of the Edn1 UTR, a series of systematic deletions were also made using a PCR based approach. These deletions were designed to remove segments of the UTR from the region of the UTR in ~100 bp increments (Figure 2 9). Forward PCR primers were designed to remove bases from the end of the UTR by annealing downstream of the UTR start site and to introduce a SacI site. T he same reverse primer was used for this set of deletion constructs and contains an XhoI site To determine if the PCR amplif ication of segments of the Edn1 U TR w ere successf ul, 10 L of each reaction was run on an 0.8% agarose gel (Figure 2 1 0, Panel A). T he PCR products were ligated into pMJ2, and PCR primers MM5 and MM6 were used to verify the ligation (Figure 2 1 0, Panel B). Successf ul deletions were generate d using primers MJ12 and MJ20 to generate a deletion of 109 bases of the UTR. Primer set MJ13 and MJ20 generated a deletion of 200 bases. Primer set MJ15 and MJ20 were used to generate a deletion of the first 422 bases of

PAGE 84

84 the Edn1 UTR. Primer set MJ16 and MJ20 were used to successf ul ly delete 820 bases of the Edn1 UTR, yielding pMJ23. Primer set MJ19 and MJ20 were used to delete 1019 bases of the UTR. The systematic deletions g enerally had low luciferase activity in mIM CD 3 cells (Figure 2 1 1 ). Th ese results were not surprising, because these reporter constructs still retained many conserved miRNA binding sites associated with DE1 and DE2. One reporter construct, pMJ26, displayed high luciferase activity. The stability of pMJ26 reporter construct i s most likely due to the fact that it only contains the terminal 77 bases of the Edn1 UTR Discussion The deletion constructs presented in this chapter demonstrate that the Edn1 UTR is sufficient to greatly reduce expression of luciferase. Whether t his was a result of RNA instability or perhaps translational control was not addressed. Both large and small deletions in the Edn1 UTR failed to restore luciferase expression (Figure 2 14). Previous work has demonstrated that Edn1 mRNA is regulated by mi R 199 in rLSEC and HMEC 1 cells. However, mutating this site in the Edn1 UTR reporter construct did not affect luciferase levels. This suggests tissue specific miRNA regulation of Edn1 mRNA. An important observation was that one construct, pMJ9, yielded high luciferase levels despite containing all three murine AREs. This result indicates that the AREs alone are not wholly responsible for the instability observed in endogenous Edn1 mRNA. One interpretation of the sum of the experiments described in this chapter is that the Edn1 mRNA is regulated by many elements distributed along the entire length

PAGE 85

85 The TaqMan miRNA assay confirmed the presence of several miRNAs, let 7c, let 7f, and m iR 98. Analysis of the Edn1 UTR revealed a highly conserved miRNA binding site for the let 7 family and miR 98, but elimination of this putative binding site did not restore luciferase activity to the Edn1 luciferase reporter construct. Apparently in the mIMCD 3 cells, this site in the Edn1 UTR does not play a role in destabilizing the Edn1 mRNA. Similarly destroying the miR 199 binding site that had previously been shown to regulate Edn1 mRNA levels under hyp oxic conditions had no apparent effect on the luciferase expression. The lack of miR 199 mediated action provides evidence that this regulatory mechanism is not functional in the mIMCD 3 cells. However, multiple predicted miRNA binding sites are predicted in the Edn1 UTR, and it is likely that more than one miRNA may be acting on the Edn1 UTR. The deletion analysis failed to provide a definitive region of the UTR that is important for stability. At this point in the project it was clear that this candidate approach to looking for miRNA a ction on Edn1 mRNA was insufficient and a more comprehensive method was needed (Chapter 3).

PAGE 86

86 Table 2 1. Oligonucleotide primers used to generate Edn1 UTR deletion constructs. Primer Name Primer Sequence > MM5 GACAAGAAGTGCTGGAATTCCTGCCAAGCAG G MM6 ACAGTAGGGCTCGAGATTTATTTTCTAAAATCATTACCTTGACAGGCAAAACAAAGCATGTTCTC MM10 MM11 GTGTATGACAGAGCAGAAAGGGTACGTACTCTCATATTCATGAAATACATCCCAATGTAC AGAGAGGAATTCAGTACGCC MM12 TCGAGGCGTACTGAATTCCTCTCTAGCT MM13 GTACATTGGGATGTATTTCATGAATATGAGTGTACGTA CCCTTTCT GCTCTGTCATACAC MJ3 CTAGCCGC GAGCTC GAGAG MJ4 TCGACTCTCGAGCTCGCGG MJ7 GGTCCTGCT CGATCG CTTCGC MJ8 CTAGGCGAAGCGATCGAGCAGGACCAGCT GC7 CTCAAAGCAACTCTTCCCGGGCCACATTGGGATGTATTTCATGAATATGAGTCTACCTCACC GC8 GGTGAGGTAGACTCATATTCATGAAATACATCCCAATGTGGCCCGGGAACAGTTGC TTTGAG MJ9 CCCGGGCCACATTGGGATGTATTTCATGAATATGAGTGTACGTAACCTTTCTGCACTG MJ10 CAGTGCAGAAAGGTTACGTACACTCATATTCATGAAATACATCCCAATGTGGCCCGGG MJ12 GCGAGCTCGGCTTCTACAGTTTCTTGTTCAG MJ13 GCGAGCTCGCGTCCGCTGGGA MJ15 GCGAGCTCAAATTTTTCTGAGGA MJ16 GCGAGCTCGTACATGTTG AAAACCTGGTCT MJ19 GCGAGCTCTAAAAATATATTTCTGAATGAAATTGAGAACATGCTTTG MJ20 R24 F20 GGATCAGCTTGCATGTCTAGACTCGAGATTTA GTA AAA CGA CGG CCA GTG CAG GAA ACA GCT ATG AC

PAGE 87

87 Table 2 2 Sequences of miRNAs Studied 1 miRNA Mature Sequence Stem loop Sequence > miR 98 5p UGAGGUAGUAAGUUGUA UUGUU CUGCACAUGCUGGGGUGAGGUAGUAAGUU GUAUUGUUGUGGGGUAGGGAUUUUAGGCC CCAGUAAGAAGAUAACUAUACAACUUACUA CUUUCCUUGGUGUGUGGCAU miR 199 3p ACAGUAGUCUGCACAUU GGUUA GCCAUCCCAGUGUUCAGACUACCUGUUCA GGAGGCUGGGACAUGUACAGUAGUCUGCA CAUUGGUUAGG C let 7c 1 UGAGGUAGUAGGUUGU AUGGUU UGUGUGCAUCCGGGUUGAGGUAGUAGGUU GUAUGGUUUAGAGUUACACCCUGGGAGUU AACUGUACAACCUUCUAGCUUUCCUUGGA GCACACU let 7f 1 UGAGGUAGUAGAUUGUA UAGUU AUCAGAGUGAGGUAGUAGAUUGUAUAGUU GUGGGGUAGUGAUUUUACCCUGUUUAGGA GAUAACUAUACAAUCUAUUGCCUUCCCUGA G 1 The TaqMan MicroRNA Assay (Invitrogen by Life Technologies) RT primers and qPCR primer sequences are proprietary, and the exact sequence is unknown.

PAGE 88

88 Table 2 3 Plasmids generated to study the Edn1 UTR. Plasmid Name Description of Plasmid P rimers Used to Generate Plasmid pMJ1 Edn1 UTR in TOPO vector pcR2.1 MM5,MM6 pMJ2 QuikChange TM used to introduce an EcoRI site into the pmirGLO MCS MM11, MM12 pMJ3 Edn1 UTR ligated in to pMJ2 N/A, ligation pMJ4 Novel SnaBI site to destroy let 7/miR 9 8 site in pMJ1 MM 10 MM13 pMJ5 Edn1 UTR from pMJ4 ligated into pMJ2 N/A, ligation pMJ6 XbaI digestion of pMJ3, removal of bases 513 1345 N/A, ligation pMJ7 Linker oligonucleotides to remove bases 958 1345 from pMJ3, novel SacI introduced MJ3, MJ4 pM J9 Linker oligonucleotides used to remove bases 221 958 from pMJ3, PvuII site introduced MJ7,MJ8 pMJ10 QuikChange TM used to introduce XmaI site in pMJ1 to destroy miR 199 binding site in Edn1 UTR GC7, GC8 pMJ11 XbaI digest and rel i gation of pMJ5, same res L ting plasmid as pMJ6 N/A, ligation pMJ12 Edn1 UTR from pMJ10 inserted into pMJ2 N/A, ligation pMJ13 QuikChange TM on pMJ10 to delete the let 7/miR 98 binding site MJ9,MJ10 pMJ14 Edn1 UTR from pMJ13 inserted into pMJ2` N/A, ligation pMJ15 SacI digest of pMJ7, removes all but the first 221 bases of the Edn1 UTR N/A, ligation pMJ16 pMJ3, SalI and XhoI digest, Klenow filled, religated. Removes XbaI in MCS. N/A, ligation pMJ17 Deletion of bases 1 109 of Edn1 UTR MJ12,MJ20 pMJ18 Deletion of bases 1 200 of Edn1 UTR MJ13,MJ20 pMJ20 Deletion of bases 1 422 of Edn1 UTR MJ15, MJ20 pMJ23 Deletion of bases 1 820 of Edn1 UTR MJ16, MJ20 pMJ26 Deletion of bases 1 1019 of Edn1 UTR

PAGE 89

89 Ta ble 2 4 Detection of miRNA in mIMCD 3 cells miRNA Average C T SE snoRNA 202 22.6 0.5 let 7c 25.7 0.1 let 7f 25.7 0.1 miR 98 31.8 0.1

PAGE 90

90 Figure 2 1. PCR amplification of the Edn1 UTR. A) A 1 kilobase ladder (Invitrogen) was used t o determine the size of the PCR product (Lane 1). Primers MJ5 and MJ6 were used to amplify a 1.3 kb fragment of the Edn1 UTR from RNA isolated f rom either aldosterone treated mIMCD 3 cells (Lane 2) or vehicle treated mIMCD 3 c ells (Lane 3). B) Screening for insertion of the Edn1 UTR in pCR2.1 TOPO v ector. Insertion of the Edn1 PCR product into the TOPO vector was screened using an EcoRI digest, proper insertion wo ul d res ul t in a restriction pattern of a 3.9 kb vectir fragment and a 1.3 kb insert fr agment. Lane 1 1 kb ladder (Invitrogen), lane 2 uncut plasmid, lane 3 plasmid digested with EcoRI, displaying the correct restriction pattern. This plasmid was named pMJ1. B A

PAGE 91

91 Figure 2 2. Insertion of a novel EcoRI site in p mirGLO For cloning purposes an EcoRI site needed to be added to the MCS of pmirGLO. QuikChange TM mutagenesis using primers MM11 and MM12 introduced a novel EcoRI site. A SacI digest was also performed on candidate plasmids to determin e if the SacI restriction site co ul d be used if the EcoRI mutagenesis proved to be unsuccessf ul Lane 1 1kb ladder (Invitrogen), Lane 2 uncut plasmid, Lane 2 plasmid/SacI digestion, Lane 3 plasmid/EcoRI digestion, Lane 4 plasmid SacI/EcoRI digest. The res u l ting plasmid was named pMJ2.

PAGE 92

92 Figure 2 3. Generation of the Edn1 luciferase reporter construct. To screen for the insertion of the Edn1 UTR an EcoRI/XhoI digest was used to screen colonies from the ligation reactions. If the Edn1 UTR was inserted in pmiRGLO, the EcoRI/XhoI digest wo ul d yield a 1.3kb fragment. M ul tiple colonies were screened for the insertion. Lane 1 1 kb ladder (Invitrogen), Lane 2 pmiRGLO, uncut, Lane 3 pmirGLO EcoRI/X hoI, Lane 4 plasmid uncut, L ane 5 plasmid, EcoRI/X hoI, lane 6 plasmid uncut, Lane 7 plasmid, EcoRI/XhoI, Lane 8 plasmid, uncut Lane 9 plasmid, EcoRI/XhoI, Lane 10 plasmid, unc ut, Lane 11 plasmid, EcoRI/XhoI, Lane 12 plasmid, uncut, Lane 13 plasmid, EcoRI/XhoI. The plasmid c ontaining the Edn1 UTR was chosen for sequencing, and named pMJ3.

PAGE 93

93 Figure 2 4. Mutation of the let 7/miR 98 binding site A) To examine the importance of the let 7/miR 98 binding site, primers MM9 and MM13 were used for QuikChange TM mutagen esis T hese primers mutated the putative binding site by introducing a novel SnaBI site. Lane 1 1kb ladder (Invitrogen), Lane 2 plasmid, uncut, Lane 3 plasmid/SnaBI, Lane 4 pMJ1, uncut, Lane 5, pMJ1/SnaBI. The QuikChange TM mutagenesis was successf ul a nd the res ul ting plasmid was named pMJ4. B) To screen for insertion of the UTR in pMJ2 an EcoRI/XhoI digest was performed. A successf ul insertion wo ul d yield a 1.3 kb fragment after an EcoRI/XhoI digest. Lane 1 1 kb ladder (Invitrogen), Lane 2, plasmid, uncut, Lane 3, plasmid, EcoRI/XhoI. The candidate plasmid was sequenced, the presence of the SnaBI site was confirmed, and the res ul ting plasmid was named pMJ5. B A

PAGE 94

94 Figure 2 5. Mutation of the miR 199 binding site in the Edn1 UTR. A) Primers GC1 and GC2 were designed to mutate the miR 199 binding site in pMJ1 by introducing a novel XmaI site by QuikChange TM mutagenesis. Lane 1 1 kb ladder (NEB), Lane 2 pMJ1, uncut, Lane 3 pMJ1/XmaI, Lane 4 candidate plasmid, uncut, Lane 5 candidate plasmid/X maI. The presence of the XmaI site indicated a successf ul mutagenesis and the res ul ting plasmid was named pMJ10. B) Insertion of Edn1 UTR with the mutated miR 199 binding site into pMJ2. The Edn1 UTR was excised from pMJ10 using an EcoRI/XhoI digest a nd ligated into pMJ2, successf ul ligation wo ul d be indicated by the presence of a XmaI site. Lane 1 1 kb ladder (NEB), Lane 2 pMJ2, uncut, Lane 3 pMJ2/XmaI, Lane 4 plasmid, uncut, Lane 5 plasmid/XmaI. The res ul ting plasmid containing the novel XmaI si te was named pMJ12 A B

PAGE 95

95 Figure 2 6 Luciferase reporter activity of Edn1 reporter constructs with mutated miRNA binding sites. A) Cartoon of sites mutated. B) Luciferase reporter activity. For this assay activity of the empty pmir GLO vector is set to 100%. Deletion of either the let 7/miR 98 binding site (pMJ5) or the miR 199 binding site (pMJ12) did not result in stabilization of the Edn1 UTR. A B

PAGE 96

96 Figure 2 7 Removal of bases 958 13 45 from pMJ3. Ligation mediated mutagenesis was used to remove bases 958 1345 from pMJ3 and introduce a SacI site for screening. The presence of a 500 bp after SacI digestion indicates a successf ul mutagenesis. Lane 1 1 kb ladder (NEB), Lane 2 pMJ3, uncu t plasmid Lane 3 pMJ3/SacI, Lane 4 uncut plasmid Lane 5 plasmid /SacI, Lane 6 uncut plasmid Lane 7 plasmid /SacI, Lane 8 uncut plasmid Lane 9 plasmid /SacI, Lane 10 uncut plasmid Lane 11 plasmid/ SacI, Lane 12, uncut plasmid Lane 13 plasmid/ SacI The plasmid with the correct insert was named pMJ7

PAGE 97

97 Figure 2 8 Luciferase Activity for Edn1 UTR Deletion Constructs. A) Cartoon of deletions. B) Luciferase reporter activity. For this assay the empty pmiRGLO vector is set to 100% acti vity. Reporter constructs pMJ6, pMJ7, and pMJ9 were significantly more active than pMJ3. p < 0.05, **p<0.005. A B

PAGE 98

98 Figure 2 9. Map of the Edn1 UTR. DE1 is depicted in pink, DE2 in blue. Locations of the pri mers chosen for PCR are underlined. Each forward primer was designed to have a SacI site (Table 2 1)

PAGE 99

99 Figure 2 10 Generation of Edn1 UTR deletion constructs. A) Forward primers were designed to introduce a SacI site. The same reverse primer which contains an XhoI site, was used for all deletion constructs PCR products were run on an agarose gel. Lane1 1 kb ladder, Lane 2 (empty), Lane 3 PCR product I I, of 109 bp, Lane 4 PCR product II, of 200 bp, Lane 5 PCR product III, of 302 bp, Lane 6 PCR product IV, of 422 bp, Lane 7 PCR product V, of 822 bp, Lane 8 PCR product VI, of 902 bp, Lane 9 PCR product VII, of 982 bp, Lane 10. PCR product VIII, of 1019 bp. B) Once the PCR products were inserted into pMJ3, primers MM5 a nd MM6 were used to amplify the UTR to verify the success of the insertion. Lane 1 kb ladder (NEB), Lane 2 pMJ3, Lane 3 pMJ17, Lane 4 pMJ19, Lane 5 pMJ20, Lane 6 pMJ23, Lane 7 pMJ26 A B

PAGE 100

100 Figure 2 11. Luciferase a ctivity for Edn1 UTR d e letion c onstructs. A) Cartoon of deletions made in the Edn1 For this assay activity of the empty vector, pmiRGLO is set to 100%. p<0.004 A B

PAGE 101

101 Figure 2 1 2 Luciferase ac tivity of Edn1 UTR d eletion c onstructs The Edn1 UTR deletions are shown to scale. Depicted in red bars are the three murine AU rich elements, in yellow bars the let 7/miR 98 binding site. For determining luciferase activity, the empty pmirGLO vector is set to 100%

PAGE 102

102 C HAPTER 3 DEFINING THE MIRNA L ANDSCAPE OF THE MIMC D 3 CELL LINE Introduction A major goal of the Cain Laboratory is understand the molecular regulation of the endothelin signaling pathway in the kidney. The luciferase reporter studies, along with the destabilizing element identified by Mawji et al (2004) suggested that the Edn1 UTR is not regulated by AREs alone. In fact, a growing body of evidence suggests that miRNAs are involved in regulating Edn1 mRNA bioavailability (Jacobs et. a l., 2013). In mRNA length and contains long tracts of highly conserved sequence. Alignment of 19 species of class Mammalia yielded greater than 80% sequence identity between any two E dn1 For e xample, the human and murine Edn1 UTRs have 96% sequence identity (Figure 2 1) and this conservation extends more broadly among vertebrate species. The level of conservation by itself suggests that there are elements in the UTR that are critical for tight regulation of EDN1 mRNA availability. The emergence of miRNAs as a major gene regulatory mechanism provided a likely candidate for E dn 1 mRNA control (Jacobs et. al, 2013, Chapter 1) miRNAs are a family of small (18 24 nt), single stranded, endoge nously produced, noncoding RNAs. The action of a miRNA is dependent on its incorporation into the RNA induced silencing complex (RISC). A miRNA RISC indentif ies target mRNAs by imperfect base pairing As a result, miRNAs specifically regulate gene expression by blocking protein translation and/or inducing degradation of targeted miRNAs. Clearly, miRNAs play important roles in the regulation of metabolism in the healthy cell, and dysregulation of miRNA levels is associated with

PAGE 103

103 the pathogenesis of many diseases (Fish, 2012, Ho and Kreidburg, 2012, Feng and Feng, 2011, Abdellatif, 2012). Examination of the Edn1 UTR revealed many predicted miRNA binding sites within conserved sequence segments of both t he human EDN1 and murine Edn1 suggesting that multiple miRNAs are likely to be targeting the EDN1 mRNA ( Jacobs et. al., 2013, Figure 2 2 and Figure 2 3) Given that ET 1 is expressed in many different tissues, it seems likely that miRNAs may be inv olved regulating basal E dn 1 mRNA expression in a tissue specific manner. The working hypothesi s is that aldosterone action alters the miRNA content in the IMCD resulting in increased translation and stabilization of Edn1 mRNA. Due to the presence of many predicted miRNA binding sites, the practical approach to test the hypothesis w as to study the miRNA content in control cells by microarray analysis. The aim of this section was to determine the miRNA landscape of an inner medullary collecting duct cell li ne (mIMCD 3) using Toray 3D Gene TM miRNA microarray analysis. The experiment was designed to generate several key pieces of information. First, the miRNA microarray determine d the miRNA landscape in a target tissue for ET 1 action, the mIMCD 3 cells. Secon d, the aldosterone responsive miRNAs were identified. Third, it provide d a list of candidate miRNAs that may act directly upon Edn1 mRNA in re na l collecting duct cells Materials and Methods Hormone Treatments and RNA Isolation Approximately 70,000 mIMCD 3 cells were counted diluted into DMEM F12 media, and plated in Corning CoStar transwell dishes to induce polarity. Cells were grown to confluence, and then the medium was replaced by hormone free media for 24 hours. The cells were treated with either v ehicle (ethanol) or 100nM aldosterone. After 24

PAGE 104

104 hours of aldosterone treatment cells were washed twice with 1mL PBS, then 1 mL of TRIzol was added to each well. The cells were incubated with the TRIzol at room temperature for 5 minutes. A pipet tip was u sed to gently scrape the surface of the transwell membrane to remove the cells, cell lysate s were gently resuspended by pipetting up and down. The cells were incubated in a 1.5mL test tube for an additional 3 minutes to obtain complete lysis. Next 200 L o f chloroform was added to the tube, and the tube was mixed by shaking for 15 seconds. The samples were centrifuged at 12,000 rpm at 4C for 20 minutes. The aqueous phase was collected and 800 L of isopropanol was added to each sample. Samples were incubat ed at 80C overnight. Next, samples were thawed on ice, and centrifuged at 12,000 rpm at 4C for 30 minutes. The RNA pellet was then washed with 70% ethanol, and centrifuged again at 12,000 rpm at 4C for 10 minutes. The pellets were air dried for 10 minu tes. To obtain the amount of RNA required for the miRNA microarray, it was necessary to concentrate the samples Six transwells for each passage were pooled into one 150 L total RNA sample RNA Integrity Analysis To ensure the high quality necessary for microarray analysis, the RNA samples were analyzed using an Agilent 2100 Bioanalyzer (UF ICBR) The RNA samples were diluted to a concentration between 50 500 ng/L. Total RNA was analyzed using a Small RNA Bioanalyzer Chip (Agilent) Samples were then s hipped to Toray Industries, Inc., and the RNA was reanalyzed to ensure RNA integrity was not affected by shipping. Toray 3D GeneTM Analysis These steps were performed by the technical staff of Toray Industries. phosphates were removed from the micr oRNA termini using Calf Intestinal Alkaline Phosphatase (CIP), to prevent circularization of miRNA. 500 ng RNA was labeled using

PAGE 105

105 the miRCURY LNA microRNA Hy5 Power labeling kit (208030 A, Exiqon). Hy5 is a fluorescent label that is enzymatically attached t end of the miRNAs in the total RNA sample. Fluorescent labeling was followed by hybridization of labeled RNA to a mouse miRNA oligo microarray chip, 3D Gene TM 16 hrs, 32 250 rpm. The chips were then washed three times with three different wash buffers and scanned using the Toray 3D Gene TM Scanner. TIFF images of all DNA chips we re quantified using Extraction TM (Toray). Calculated background intensit ies were determined by focusing on small regions surrounding the spot mask, the median of pixel values in this region were then subtracted from the spot intensity, and the data was normalized using a quantile normalization method. TaqMan miRNA quantitative Real Time PCR The presence of miRNAs upregulated by aldosterone was confirmed using a TaqMan miRNA Assay (Chapter 2). Results RNA Integrity Analysis To verify the quality of the RNA isolated from the mIMCD 3 cells, the RNA was analyzed using an Agilent 2100 Bioanalyz er. Th is electrophoretic assay was based on traditional gel electrophoresis principles that have been transferred to a chip format ( Agilent 2100 Bioanalyzer 2100 Expert User's Guide ) Micro channels we re fabricated in glass to create interconnected network s among the wells (Agilent Technologies) During chip preparation, the micro channels we re filled with a sieving polymer and fluorescence dye. Once the wells and channels we re filled, the chip bec ame an integrated electrical circuit. The 16 pin electrodes of the cartridge we re arranged so that they fit into the wells of the chip. Each electrode wa s connected to an independent power supply

PAGE 106

106 ( Agilent 2100 Bioanalyzer 2100 Expert User's Guide ) Charged biomolecules like the RNA samples we re electrophoretically driven by a voltage gradient similar to slab gel electrophoresis. Because of a constant mass to charge ratio and the presence of a sieving polymer matrix, the molecules we re separated by size ( Agilent 2100 Bioanalyzer 2100 Expert User's Guide ) Dye molecu les intercalate d into the RNA strands. These complexes we re detected by laser induced fluorescence. Data wa s translated into gel like images (bands) and electropherograms (peaks). With the help of a ladder (Figure 3 4 Panel A ) that contain ed fragments of known sizes and concentrations, a standard curve of migration time versus fragments size wa s plotted. From the migration times measured for each fragment in the sample, the size wa s calculated. One marker fragment for RNA wa s run with each of the samples b racketing the overall sizing range. we re internal standards used to align the ladder data with data from the sample wells. This wa s necessary to compensate for drift effects that may occur during the course of a chip run. F or total RNA assays, the ribosomal ratio wa s determined, giving an indication on the integrity of the RNA sample. The 2100 expert software plot ted fluorescence intensity versus migration time and produce d an electropherogram for each sample (Figure 3 3, Pa nel B ). The data was also displayed as a densitometry plot, creating a gel like image ( http://www.genomics.agilent.com ) (Figure s 3 4 Panel B ). Sample integrity was also independently examined after shipping to ensure that the samples did not degrade during transit (Figure 3 5 ). The data were expressed as a RNA Integrity Number (RIN). An RIN value of 1.0 represented fully degraded RNA, whereas an RIN

PAGE 107

10 7 value of 10 represented a high quality RNA preparation. All sa mples sent to Toray had RIN values of 9.6 or greater (Table 3 1). Toray 3D Gene TM MicroRNA Microarray Analysis To define the miRNA landscape of the mIMCD 3 cell line a Toray 3D Gene TM microRNA microarray analysis was conducted. Microarray slides containi ng probes for 1080 miRNA were scanned three times, then merged into one data set. The merged data was analyzed using Genepix Pro TM 4.0 software (Molecular Devices). Spots that might be associated with artifacts were eliminated using software and visual gu ided flags. A small number of miRNAs were not detected in any of the RNA samples. The 55 miRNAs not detected in any RNA sample in the Toray 3D Gene TM miRNA microarray are listed in Table 3 2. Interestingly, miR 1 is often used as a positive control for ot her types of miRNA analysis and known to regulate ET 1 in skeletal muscle (Li, 2012). T his miRNA was not detected in any RNA sample from mIMCD 3 cells. Another 100 miRNAs were detected in only one out of ten samples (Table 3 3). Detection of these signals was regarded as a spurious result, and it is ver y likely that these represented false positives. The miRNAs were most probably not present in mIMCD 3 cells. The most highly abundant miRNAs defined as scoring greater than 7.0 on the quantile normalization scale are listed in Table 3 4. Interestingly, most of the miRNAs in this table did not change significantly in response to aldosterone. This suggested that their abundance reflects a role in cellular processes independent of aldosterone. To independently verify high abundance, the TaqMan qRT PCR assay was performed on let 7c and let 7f. Both were found at very high levels in mIMCD 3 RNA ( Table 2 4 ). It is 2145, is no longer

PAGE 108

108 considered to be a m iRNA and is not included in Table 3 4. It has been shown that the small RNA formerly known as miR 2145 is in fact a splicing fragment derived from 5S rRNA transcripts (Chiang et al., 2010). In order to determine the mIMCD 3 miRNAs that might target the mu rine Edn1 UTR, results from the miRNA microarray data were examined using two different context+ score for a specific site This score wa s the sum of the contribution of six features: site type contribution 3' pairing c ontribution local AU contribution position contribution target site abundance contribution, and seed pairing stability contribution ( Garcia et al., 2011 ). For each predicted target of each miRNA, the sum of the context+ scores for the sites to that miRNA was calculated as the total context+ score. Predicted targets of each miRNA family we re sorted by total context+ score. The representative miRNA wa s the miRNA in its family with the most favorable (lowest) total context+ score. Although only one miRNA wa s chosen as the representative miRNA, all the other miRNAs of the miRNA family we re also predicted to target the same target gene at the same target site(s). Since overlapping sites cannot be occupied at the same time, some miRNAs we re removed fr om this table to create a set of non overlapping sites while maximizing the total context score. These non overlapping sites we re used to calculate the total context score. The target sites predicted by miRanda (microRNA.org) we re scored for likelihood of mRNA downregulation using mirSVR, a regression model that wa s trained on sequence and contextual features of the predicted miRNA::mRNA duplex. Expression

PAGE 109

109 profiles we re derived from a comprehensive sequencing project of a large set of mammalian tissues and cell lines of normal and disease origin (Betel et al., 2010) Using the same set of parameters, lists of highly expressed (Table 3 5), moderately expressed (Table 3 6), and lowly expressed (Table 3 7) miRNAs that had the potential to target the murine Ed n1 UTR were generated. This analysis also identified seven miRNAs that were aldosterone responsive and predicted to target the Edn1 UTR, All of these miRNAs were expressed at low levels (Table 3 8). The Toray microarray data also identified five m iRNAs that were upregulated 2 fold or more by aldosterone (Table 3 9). In an attempt t o independently verify the microarray results, TaqMan miRNA assays for these candidate miRNAs were performed on the same RNA samples that were used for the microarray (T able 3 10) C T values were normalized using a small nucleolar RNA, snoRNA 202 as an endogenous control. Unfortunately, the TaqMan miRNA experiments did not confirm the microarray results. This was most likely due to the large variance that was seen i n sno RNA 202 C T values between samples (data not shown). Aldosterone and Dexamethasone Dose R esponsive miRNAs To examine if the response to hormone treatment was MR or GR specific, both aldosterone and dexamethasone dose response experiments were conducted to determine the e ffect on expressio n levels of the target miRNAs. The results of the dose response experiments are shown in Figure 3 6 All of the miRNAs predicted to be aldosterone responsive by the miRNA microarray were also responsive to increasing concen trations of dexamethasone (Figure 3 7 ).

PAGE 110

110 Discussion Defining the miRNA landscape will provide a resource for identifying miRNAs that may be acting on Edn1 mRNA or other transcripts involved in sodium reabsorption in the renal colletcing duct. The data only miRNA data set for a collecting duct cell line. Additionally, the aldosterone and dexamethasone dose response experiments demonstrated changes in several miRNAs in response to increasing aldosteron e or dexamethasone concentrations suggesting a novel mechanism for regulation of sodium transport in the collecting duct. The RNA integrity analysis represents a quick and effective way to examine RNA integrity. The Agilent Bioanalyzer allowed a far mor e accurate calculation of RNA concentration and quality than the SmartSpec Spectrophotometer used in the Cain laboratory. More importantly, this analysis allowed exclusion of several RNA samples that were partially degraded, and ensured that we used only t he highest quality RNA samples for the miRNA microarray. Interestingly, when the samples were analyzed in the Toray laboratories after shipment, the ir RIN values were actually higher than our RIN values (Table 3 1). This differe nce is almost certainly due to differences in the chips used for analysis and/or differing software. The miRNA microarray data set defines the miRNA landscape of a murine inner medullary collecting duct cell line. We were able to determine the expression patterns of over 1,000 diff erent miRNAs. The few highly expressed miRNAs did not change in response to aldosterone, so it seems likely that these miRNAs may be playing a role in collecting duct cell homeostasis. A practical use of the microarray data in combination with two separat e algorithms (targetscan.org, microRNA.org) was to consider the miRNAs in the mIMCD 3 c ells that have the potential to target Edn1 mRNA. We were

PAGE 111

111 also able to determine several aldosterone responsive miRNAs that might target Edn1 mRNA. These miRNAs will be candidates for future studies of miRNA mediated hormonal action on Edn1 mRNA. Toray analysis and dose re sp onse experiments determined that several miRNAs were significantly upregulated in response to aldosterone. The coordinates of the miRNA genes were o btained from the miRBase.org website, and the ~700 bp of the promoter regions of these miRNA genes were examined for nuclear hormone response elements using the Transcription Element Search System ( http://www.cbi l.upenn.edu/tess ). All miRNAs examined had multiple predicted hormone response elements. Both aldosterone and dexamethasone treatment resulted in an increase in the levels of these miRNAs (Figures 3 10 and 3 11) It would be interesting to determine whic h hormone response elements are important for hormone dependent transcription of these miRNAs. After the RNA samples had been submitted for the microarray analysis, a paper was published that stated the authors saw a loss of miRNAs during RNA preparation using TRIzol (Kim et al, 2012). When comparing miR 144 levels isolated using TRIzol versus the mirVana miRNA isolation kit (Invitrogen), the authors noted the isolation methods gave different results. The authors postulated that small miRNAs with low GC content are not isolated as efficiently with TRIzol when compared to other isolation methods. Reviewing the miRNA microarray results, we noted that several of the highly expressed miRNAs in our cell line have low GC content H owever it is possible that so me of the moderately or lowly expressed miRNAs may have been affected by this isolation process.

PAGE 112

112 Table 3 1 Comparison of RNA integrity numbers for samples submitted for miRNA microarray analysis. Sample ICBR RIN Toray RIN 120P20ALDO 10 10 120P20VEH 1 0 10 1117P20ALDO 10 10 1117P20VEH 10 10 107P19ALDO 10 10 107P19VEH 9.7 10 231ALDO 9.5 10 231VEH 9.6 6 232ALDO 9.7 9.8 232VEH 9.9 10

PAGE 113

113 Table 3 2 miRNAs n ot d etected in mIMCD 3 c ells miRNAs Not Detected in mIMCD 3 Cells mmu miR 1 mmu miR 201 mmu miR 34b 5p mmu miR 383 mmu miR 376b* mmu miR 488 mmu miR 681 mmu miR 688 mmu miR 759 mmu miR 465a 3p mmu miR 465b 3p mmu miR 465c 3p mmu miR 127* mmu miR 190b mmu miR 467d mmu miR 875 5p mcmv miR M44 1 mcmv miR m107 1 5p mcmv miR m108 2 5p.2 mmu mi R 1 2 as 5p mmu miR 1969 mmu miR 1298* mmu miR 3106 mmu miR 3086 5p mmu miR 466p 5p mmu miR 466n 3p mmu miR 203* mmu miR 384 5p mmu miR 3088* mmu miR 3088 mmu miR 3092* mmu miR 344b* mmu miR 3112 mmu miR 3470a mmu miR 144* mmu miR 152* mmu miR 153* mmu miR 190* mmu miR 205* mmu miR 411 mmu miR 463 mmu miR 883a 5p mmu miR 19b 2* mmu miR 192* mmu miR 101b* mmu miR 539 3p mmu miR 541* mmu miR 802* mmu miR 421* mmu miR 511 3p mmu miR 544 5p mmu miR 1198 3p mmu miR 743b 3p mmu miR 879 mmu miR 879* same pro be was used for these miRNAs in the Toray micro array

PAGE 114

114 Table 3 3 miRNAs d etected in o nly o ne RNA s ample miRNAs Detected in Only One Sample Detected in Aldosterone treated Sample Detected in Vehicle Treated Sample mmu miR 124 mmu miR 127 mmu miR 135a mmu miR 153 mmu miR 219 5p mmu miR 376b mmu miR 376a* mmu miR 488* mmu miR 495 mmu miR 695 mmu miR 707 mmu miR 450b 5p mghv miR M1 7 5p mmu miR 463* mmu miR 541 mmu miR 883a 3p mmu miR 147 mmu miR 376a mmu miR 380 3p mmu miR 758 mmu miR 802 mm u miR 592 mmu miR 465c 5p mmu miR 466b 5p mmu miR 590 3p mmu miR 466o 5p mmu miR 504 mmu miR 742* mmu miR 743b 5p mcmv miR m01 3* mmu miR 669h 5p mmu miR 1191 mmu miR 1933 5p mmu miR 1953 mmu miR 1954 mmu miR 1970 mmu miR 1264 5p mmu miR 1298 mmu miR 3069 5p mmu miR 3071 mmu miR 3078 mmu miR 3079 5p mmu miR 3079 3p mmu miR 3087 mmu miR 3098 5p mmu miR 3101 mmu miR 374c* mmu miR 99a* mmu miR 146a* mmu miR 202 3p mmu miR 291a 3p mmu miR 34b 5p mmu miR 208a 3p mmu miR 410 mmu miR 682 mmu miR 409 5p mmu miR 871 5p mmu miR 448 3p mmu miR 882 mmu miR 490 3p mmu miR 367 mmu miR 323 3p mmu miR 590 5p mmu miR 302b mmu miR 302c mmu miR 677 mmu miR 654 3p mmu miR 878 5p mmu miR 873 mmu miR 875 3p mmu miR 337 3p mmu miR 145* mmu miR 196a 2* mmu miR 216b mmu miR 653 mmu miR 582 3p mmu miR 218 2* mcmv miR m01 4* mcmv miR M44 1 mmu miR 669i mmu miR 669g mmu miR 669j mmu miR 599 mmu miR 1251 mmu miR 3065 mmu miR 3075* mmu miR 3081 mmu miR 3089 3p mmu miR 344g 5p mmu miR 1912 mmu miR 137* mmu miR 429* mmu miR 543* mmu miR 367 mmu miR 302d* mmu miR 216b* mmu miR 497* mmu miR 1955 3p

PAGE 115

115 Table 3 4 Highly a bundant miRNAs in mIMCD 3 c ells Table 3 5 Highly expressed miRNAs possibly targeting the murine Edn1 UTR miRNA Microarray a Highly expresse d Aldosterone Vehicle Total Context Score b miRANDA c Sites d miR 709 10 .26 .14 10.52 .60 0.31 0.52 212^,610,668 let 7a 9.50 .38 9.32 .54 0.34 0.99 563 let 7c 8.95 .13 8.97 .52 0.34 0.99 563 let 7d 8.83 .26 8.83 .38 0. 34 1.01 563 let 7f 8.67 .38 8.20 1.11 0.34 0.99 563 let 7b 8.95 .17 8.27 .35 0.34 0.99 563 miR 31 7.65 .22 7.42 .20 0.20 1 .01 220,665^ a Toray 3 D Gene data is expressed as the mean of at least four trials and standard dev iation. b Total context score as computed by Targetscan.org The total context score represents the sum of the contribution of six features: site type contribution 3' pairing c ontribution local AU contribution position contribution target site abundanc e contribution, and seed pairing stability contribution c mirSRV score as computed by microRNA.org. d seed sequence(s) contributing to the mirSRV score. Highly Abundant miRNAs miR 690 miR 1937b miR1937a miR 21 miR 709 let 7a let 7c miR 30c miR 29a let 7d miR 23a let 7f let 7b miR23b miR 15 b miR 10a miR 93 miR 24 miR 31 miR 106b miR 103 miR 29b miR 22 miR 19b miR 26a let 7i miR 106a miR 27a miR 200b miR 182 miR 10b let 7g

PAGE 116

116 Ta ble 3 6. Moderately expressed miRNAs possibly targeting the murine Edn1 UTR miRNA Microarray a Target scan Moderately expressed Aldosterone Vehicle Total Context Score b miRANDA c Sites d let 7i 7.15 .30 6.69 .71 0.34 0.99 560 miR200a 6.68 .55 5.95 .88 0.09 0.75 1^,345 let 7e 6.66 .33 6.27 .85 0.34 1.01 563 let 7g 6.12 .37 5.43 1.32 0.34 0.99 561 miR 425 4.13 .26 3.91 .56 0.08 0.88 578,802^ miR 185 4.40 .40 3.76 .79 0.27 0.59 54,618^ a Toray 3 D Gene data is expressed as the mean of at least four trials and standard deviation. b Total context score as computed by Targetscan.org. The total context score represents the sum of the contribution of six features: site type contribution 3' pairing c ont ribution local AU contribution position contribution target site abundance contribution, and seed pairing stability contribution c mirSRV score as computed by microRNA.org. d he major seed sequence(s) contributing to the mirSRV score.

PAGE 117

117 Table 3 7 Lowly expressed miRNAs possibly targeti ng the murine Edn1 UTR miRNA Microarray a Target scan Lowly expressed Aldosterone Vehicle Total Context Score b miRANDA c Sites d miR 98 3.98 .52 3.34 1.20 0.34 0.99 563 miR 152 3.77 .42 3.27 .82 0.17 0.59 577 miR 101b 3.57 .69 3.38 .68 0.19 0.46 528,1091^ miR148b 3.48 .38 2.93 .66 0.17 0.62 575 miR149 3.29 .19 3.06 .33 0.16 0.24 290 miR194 2.93 .28 2.53 .55 0.22 1.03 519 miR 370 2.82 .36 2.37 .29 0.17 0.13 311 miR 206 2.71 .40 2.53 .79 0.38 0.90 145 miR 501 5p 2.25 .25 1.94 .61 0.20 0.66 739 miR 466a 3p 2.24 .28 1.94 .64 0.51 2.66 543^,921^,938, 951 miR 466b 3p 2.21 .21 2.35 .30 0.51 1.31 538,857,994^ miR 467g 1.98 .31 1.76 .34 0.5 1 1.31 540,859,997^ miR 187 1.88 .28 1.89 .34 0.27 0.39 261 miR 105 1.56 .25 1.13 .48 0.16 0.16 455 miR 148a 1.24 .39 1.19 .04 0.17 0.62 575 miR 129 5p 1.21 .27 1.14 .38 0.26 1.03 408 a Toray 3 D Gene data are expressed as the mean of at least four trials and standard deviation. b Total context score as computed by Targetscan.org. The total context score represents the sum of the contribution of six features: site type contribution 3' pairing c ontribution local AU contribution position contribution target site abundance contribution, and seed pairing stability contribution c mirSRV score as computed by microRNA.org. d seed sequence(s) contributing to the mirSRV score.

PAGE 118

118 Table 3 8 Aldosterone r esponsive miRNA possibly t argeting the m urine Edn1 miRNA Microarray a Aldosterone Vehicle miRANDA b Sit es c miR297a* 1.54 .52 0.84 .17 d 1.3200 539,856,994^ miR101a e 0.77 .14 NA 1.1198 526,807,1091^ miR 1839 5p 1.16 .44 NA 0.3679 560 miR467e 1.05 .05 NA 0.1595 455 miR 467b* 1.34 .43 NA 0.1148 996 miR135a 2* 1.23 .15 0.84 .14 f 1.1823 650^,945,1087 miR 1898 NA 1.15 .60 0.1800 771 a Toray 3 D Gene data is expressed as the mean of at least four trials and standard deviation. NA indicates no significant signal above background. b mirSRV score as computed by microRNA.org. c Position of the first base of a s seed sequence(s) contributing to the mirSRV score. d miR 297a* was detected in only 3 samples. e miR 101a had a total context score of 0.19 in T ar getscan .org. f miR 135a 2* was detected in only 3 sample s.

PAGE 119

119 Table 3 9 miRNAs upregulated by a ldosterone miRNA Average fold Change SD miR 200c 2.68 0.58 miR 467b* 2.68 0.44 miR 297a* 2.02 0.87 miR 327 2.10 0.46 miR 1966 2.02 0.66 Table 3 10 TaqMan miRNA a ssay of miRNAs p otent ial l y r egulated by a ldosterone in Toray samples Probe Sample Fold Change Standard Error miR 297 Vehicle 1 .26 0.37 Aldosterone 1.62 0.50 miR 327 Vehicle 1.87 1.00 Aldosterone 1.14 0.42 miR 467 Vehicle 1.04 0.14 Aldosterone 1.21 0.14 miR 1966 Vehicle 1.51 0.54 Aldosterone 0.96 0.19 miR 200c Vehicle 1.39 0.44 Aldosterone 2.58 0.98

PAGE 120

120 H. sapiens 1 CAGACCTTCGGGGCCTGTCTGAAGCCATAGCCTCCACGGAGAGCCCTGTGGCCGACTCTG 60 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| M. musculus 1 CAGACCTTCGGGGCCTGTCTGAAGCCATAGCCTCCACGGAGAGCCCTGTGGCCGACTCTG 60 H. sapiens 61 CACTCTCCACCCTGGCTGGGATCAGAGCAGGAGCAT C CTCTGCTGGTTCCTGACTGGC 118 |||||||||||||||||| |||||||||||||||||| | ||||||| ||||||||||||| M. musculus 61 CACTCTCCACCCTGGCTGGGATCAGAGCAGGAGCATCCTCTCTGCTTGTTCCTGACTGGC 120 H. sapiens 119 AAAGGACCAGCGTCCTCGTTCAAAACATTCCAAGAAAGGTTAAGGAGTTCCCCC AACCA 177 |||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||| M. Musculus 121 AAAGGACCAGCGTCCTTGTTCAAAACATTCCAAGAAAGGTTAAGGAGTTCCCCCAAACTG 180 H. sapiens 178 TCTTCACTGGCTTCCATCAGTGGTAACTGCTTTGGTCTCTTCTTTCATCTGGGGATGACA 237 |||||| |||||| |||| |||||||||| ||||||||||||||||||||||||||||||| M. musculus 81 TCTTCATTGGCTTGCATCGGTGGTAACTGCTTTGGTCTCTTCTTTCATCTGGGGATGACA 240 H. sapiens 238 ATGGACCTCTC ---AGCAGAAACACACAGTCACATTCGAATTCGGGTGGCATCCTCCG g 293 ||||||||||| |||||||| |||||| || |||||||||||||||||||||||| M. musculus 241 ATGGACCTCTCAGAAAGCAGAAATGCACAGTGACATTCGAATTCGGGTGGCATCCTCC -298 H. sapiens 294 agagagagagag GAAGGAGATTCCACACAGGGGTGGAGTTTCTGACGAAGGTCCTAAGGG 353 ||| | |||||||||||||||||||| ||||||||| ||||||||||||||||||||| M. musculus 299 -AGA A AGAGGAAGGAGATTCCACACCAGGGTGGAGTTTCTGACGAAGGTCCTAAGGG 354 H. sapiens 354 AGTGTTTGTGTCTGACTCAGGCGCCTGGCACATTTCAGGGAGAAACTCCAAAGTCCACAC 413 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | M. musculus 355 AGTGTTTGTGTCTGACTCAGGCGCCTGGCACATTTCAGGGAGAAACTCCAAAGTCCACGC 414 H. sapiens 414 AAAGATTTTCTAAGGAATGCACAAATTGAAAACACACTCAAAAGACAAACATGCAAGTAA 473 |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| M. musculus 415 AAAGATTTTCTAAGGAATGCACAAATTGAAAACATACTCAAAAGACAAACATGCAAGTAA 474 H. sapiens 474 AG aaaaaaaaaa GAAAGACTTTTGTTTAAATTTGTAAAATGCAAAACTGAATGAAACTGT 533 | || ||||||| |||||||||||||||||||||||||| |||||||||||| ||||||| M. musculus 475 A AAGAAAAAAA AAAGACTTTTGTTTAAATTTGTAAAACACAAAACTGAATGAAACTGT 532 H. sapiens 534 TACTACCATAAATCAGGATATGTTTCATGAATATGAGTCTACCTCACCTATATTGCACTC 593 |||| || ||||||||||||||||||| |||||||||||||||||||||||||||||||| M musculus 533 TACTGCCGTAAATCAGGATATGTTTCAAGAATATGAGTCTACCTCACCTATATTGCACTC 592 H. sapiens 594 TGGCAGAAGTATTTCCCACATTTAATTATTGCCTCCCCAAACTCTTCCCACCCCTGCTGC 653 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | M. mus culus 593 TGGCAGAAGTA TTCCCACATTTAATTATTGCCTCCCCAAACTCTTCCCACCCCTGCTTC 651 H. sapiens 654 CCCTTCCTCCATCCCCCATACTAAATCCTAGCCTCGTAGAAGTCTGGTCTAATGTGTCAG 713 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| M. musculus 652 CCCTTTCTCCATCCCCCATACTAAATCCTAGCCTCGTAGAAGTCTGGTCTAATGTGTCAG 711 H. sapiens 714 CAGTAGATATAATATTTTCATGGTAATCTACTAGCTCTGATCC --AG aaaaaaaa GAT 769 ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| M. musculus 712 CAGTAGATATAATATTTTCATGGTAATCTACTAGCTCTGATCCATAAGAAAAAAAAAGAT 771 H. sapiens 770 CATTAAATCAGGAGATTCCCTGTCCTTGATTTTTGGAGACACAATGGTATAGGGTTGTTT 829 ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||| M. musculus 772 CAT TAAATCAGGAGATTCCCTATCCTTGATTTTTGGAGACACAATGGCATAGGGTGGTTT 831 H. sapiens 830 ATGAAATATATTGAAAAGTAAGTGTTTGTTACGCTTTAAAGCAGTAAAATTATTTTCCTT 889 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| M. musculus 832 ATGAAATA TATTGAAAAGTAAGTGTTTGTTATGCTTTAAAGCAGTAAAATTATTTTCCTT 891 H. sapiens 890 TATATAACCGGCTAATGAAAGAGGTTGGATTGAATTTTGATGTACTTA ttttttt ATAGA 949 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| M. musculus 892 TATATAACCGGCT AATGAAAGAGGTTGGATTGAATTTTGACGTACTTATTTTTTTATAGA 951 H. sapiens 950 TATTTATATTCAAACAATTTATTCCTTATATTTACCATGTTAAATATCTGTTTGGGCAGG 1009 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| M. musculus 952 TATTTATATTCAAACAA TTTATTCC TATATTTACCATGTTAAATATCTGTTTGGGCAGG 1010 H. sapiens 1010 CCATATTGGTCTATGTATTTTTAAAATATGTATTTCTAAATGAAATTGAGAACATGCTTT 1069 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| M. musculus 1011 CCATATTGGTCTATGTATTT TTAAAATATGTATTTCTAAATGAAATTGAGAACATGCTTT 1070 H. sapiens 1070 GTTTTGCCTGTCAAGGTAATGACTTTAGAAAATAAATA ttttttt CCTTACTGTA 1124 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| M. musculus 1071 GTTTTGCCTGTCAAGGTAATGACTTTAGAAA ATAAATATTTTTTTTCCTTACTGTA 1126 Figure 3 1 Alignment of the Homo sapiens and Mus musculus Edn1 UTR. The two sequences have 96% identity.

PAGE 121

121 Figure 3 2 Predicted miRNA binding sites in the human EDN1 UTR. Predicted miRNA target sites within the hu man EDN1 using microRNA.org (Betel et al., 2008). Depicted are target sites of conserved miRNAs with high probability mirSVR scores (blue arrows), and target sites for miRNAs empirically shown to interact with EDN1 mRNA (r ed arrows).

PAGE 122

122 Figure 3 3 Predicted miRNA binding sites in the murine E dn 1 UTR. Predicted miRNA target sites within the murine Edn 1 NM_010104 ) were determined using microRNA.org (Betel et al., 2008). Depicted are target sites of conserved miRNAs with high probability mirSVR scores (blue arrows), and target sites for miR 709, which will be examined in more detail in Chapter 4 (red arrows).

PAGE 123

123 Figure 3 4 Example s of Agilent 2100 Bioanalyzer e lectropherogram s A) The ladder contains fragments of known sizes and concentrations Based on the electropherogram peaks of the ladder a standard curve of migration time versus fragments size is plotted B) RNA isolated from aldosterone treated mIMCD 3 cells A B

PAGE 124

124 Figure 3 5 Confirm ation of RNA i ntegrity. After the RNA samples arrived in Japan, the RNA integrity analysis was repeated by the Toray technical staff to verify samples did not become degraded or contaminated during shipment. All samples passed the quality control and were deemed suitable for miRNA microarray analysis.

PAGE 125

125 Figure 3 6 miRNA l evels in r esponse to a ldoster one The candidate miRNAs identified by the Toray microarray were examined by qRT PCR for response to aldosterone

PAGE 126

126 Figure 3 7 miRNA l evels i n r esponse to d examethasone. The candidate miRNAs identified by the Toray microarray were examined by qRT PCR for response to dexamethasone. p <0.05

PAGE 127

127 CHAPTER 4 INTERACTION BETWEEN RISC AND TARGET MRNA Introduction The miRNA microarray defined the miRNA landscape in the mIMCD 3 cell line (Chapter 3). The next step was to identify miRNAs likely to be targeting transcripts of interest. While there are many different methods to determine interaction between miRNAs and their target mRNAs, each method has cert ain limitations that make it difficult to determine if the observed effect is due to direct interaction or secondary effect s In order to validate that a miRNA targets an mRNA, several different criteria have been proposed (Kuhn et al., 2008). First, pred ictive algorithms must confirm that a potential bin d ing site for the miRNA of interest must be seen in the UTR of a target mRNA. While several algorithms exist, for example TargetScan ( www.targetscan.org ), miRTarg et2 ( www.miRDB.org ) and miRanda miSVR ( www.microRNA.org ), the limitations of each algorithm must be understood or else it is possible to obtain incorrect predictions. For example, the miRanda miSVR algorithm predicted that of the let 7 family, only let 7c and let 7f were expressed in the murine kidney collecting duct. The data presented in Chapter 3 demonstrated that not only were other let 7 family members present in the mIMCD 3 cells many were found to be present in high abundance. The second proposed criterion is that both miRNA and its predicted target are coexpressed in the cell or tissue type of interest. This is easily accomplished using the miRNA qRT PCR method described in Cha pter 3 coupled to qRT PCR to detect expression of the proposed target mRNA. Third, if a miRNA is interacting with a target mRNA, manipulating levels of the miRNA should produce a change in both the target

PAGE 128

128 mRNA and protein levels. However, manipulation of m iRNA levels make it difficult to tell if an observed effect is the result of a direct interaction or a downstream effect. Finally, it must be established that this targeting equates to a change in biological function. The data presented in this chapter wi ll examine the changes in mRNA and protein levels that result from inhibiting specific miRNAs, as well as the use of a RISC immunoprecipitation to detect direct RISC target mRNA interaction. The Argonaute (Ago) family of proteins provide the core protein components of the RISC complex. Ago proteins are roughly 95 kDa in size and contain two c haracteristic domains, the PAZ domain and the PIWI domain (Carmell et al., 2002). The PAZ domain interacts with the end of the miRNA, and the PIWI domain interacts with the phosphate and the proximal region of the miRNA that guides target mRNA recognition (Hammond, 2005). Mammals have four different Ago proteins, the genes coding for Ago1, Ago3, and Ago4 reside in tandem on a single chromosome in both humans a nd mice. Ago2 is encoded at a discrete site within the genome on a different chromosome (Sasaki et al., 2003). All four share considerable primary sequence homology. As a result commercial antibodies are available for each individual Ago protein and some Despite a growing body of evidence suggesting interaction between miRNA RISCs and Edn1 mRNA, a direct RISC Edn1 mRNA interaction has not yet been reported (Jacobs et al., 2013). The observations presente d in all earlier studies of miRNA action on Edn1 could be the products of indirect events resulting from the effects of miRNA manipulations, rather than direct demonstrations of RISC binding to Edn1 mRNA. Because the Ago protein is an integral component of RISC and

PAGE 129

129 participates in a direct interaction with miRNA, Ago proteins represent an attractive target for immunoprecipitation experiments designed to identify specific mRNAs bound by RISC. This chapter reports the use of anti miR inhibitors, a newly dev eloped RNA binding protein pulldown assay (MagnaRIP, Millipore) and an Ago specific antibody to detect direct interaction between RISC and Edn1 mRNA. Materials and Methods mIMCD 3 Cell Culture For anti miR miRNA inhibitor experiments approximately 70,000 cells were plated per well in 6 well cell culture plates. Cells were grown in DMEM supplemented with 10% FBS and 50ug/ml gentamicin. Cells were grown to 80% confluence. A high number of cells were required for the MagnaRIP assay. Typically one RNA immunop recipitation reaction (i.e. one immunoprecipitation using one antibody) 7 cells. The mIMCD 3 cells were grown in DMEM in 15 cm dishes. After the initial seeding the media was replaced every 48 hours. Cells wer e washed twice with 5 mL PBS before fresh medium was added. Plates were grown to 80% confluence. Freshly isolated cells were used for all MagnaRIP assays. Anti miR Transfection Anti miR miRNA inhibitors (Ambion) were resuspended in 50 l nuclease free H2O to generate a 100 M stock solution (Table 4 1). A working stock solution ( 10 M) was generated to avoid repeated freeze thawing of the stock solution. The final concentration of anti miR inhibitors used was 10 nM. Transfections for the 15 cm dish were set u p using 15 l DharmaFECT4 diluted into hormone free media, then mixed with the anti miR inhibitors, and incubated for 30 minutes at room temperature. While

PAGE 130

130 the mixture was incubating, the 15 cm dishes were washed twice with PBS and the media was replaced w ith hormone free media. The mixture of DharmaFECT4 and anti miR inhibitors w ere added to the 15 cm dishes. Transfections for the 6 well plates were set up similarly, using 6 l DharmaFECT 4. Cells were incubated with the anti miR inhibitors for 48 hours. Selection of Antibodies for Use With mIMCD 3 Cells The antibodies used to detect changes after the anti miR inhibitor transfection experiments were directed against preproEndothelin (Sigma Aldrich, E0771 ), sgk1 (Sigma Aldrich, SAB2104902 ), ATP1B1 (Sigma Al drich, SAB2501588 ), and actin (Santa Cruz, sc 130300 ). Cellular protein was isolated and used to optimize Western blotting conditions for these antibodies. For experiments to identify antibodies suitable for a RISC pulldown, mIMCD 3 cells were grown to confluence, then media w as replaced with hormone free media for 24 hours. Cells were then treated with 100nM aldosterone or vehicle for 48 hours. For experiments to identify changes in target mRNAs, mIMCD 3 cells were grown to 80% confluence and transfected with anti miR miRNA in hibitors (as described above). Cells were then rinsed twice with PBS and lysed with Passive Lysis Buffer (Promega). A bicinchoninic acid assay (BCA assay) was performed to determine protein concentration. Cellular protein (50 g) was used for Western Blo tting. The antibodies used were Ago1 (Cell Signaling Technology,D84G10), Ago2 (Cell Signaling Technology, C34C6), pan Ago (Millipore, MABE56). A goat anti mouse IgG secondary antibody was used with the preproendothelin 1 antibody (Santa Cruz Biotechnology sc2005), a goat anti rabbit IgG secondary antibody was used with the sgk1 antibody

PAGE 131

131 (Santa Cruz Biotechnology, sc2004), and a rabbit anti goat IgG secondary antibody (Sigma Aldrich, A5420) was used with the actin and ATP1B1 antibodies. Detection of Prote ins in mIMCD 3 C ells Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) was performed using a mini PROTEAN TGX gel (Bio Rad). A mini PROTEAN tank (B io Rad) was filled with 500 mL Running Buffer (25mM Tris, 192 mM g lycine, 0.1%SDS), the ge l was placed into a cassette, then the tank with buffer. The comb was removed, and the wells were rinsed with Running Buffer. Kaleidoscope Precision Plus ladder (Bio Rad) was used as a molecular weight marker. SDS sample buffer (62.5 mM Tris HCL (pH 6.8), 2% w/v SDS, 10% glycerol, 50 mM DTT, 0.01% w/v bromophenol blue)was added to cellular protein Samples were sonicated for 10 15 seconds. Samples were heated at 95 C for five minutes and cooled on ice. Samples were spun briefly in a centrifuge and loaded o nto the gel. The gel was run at 175 V for 30 minutes. For the electrotransfer to a membrane, nitrocellulose membrane was cut to size. Sponges and filter paper were soaked in pre chilled Transfer Buffer (25 mM Tris, 192mM g lycine, 20% m ethanol). The PROTEA N tank was filled with 500 mL Transfer Buffer. Transfer cassette was assembled and placed into the PROTEAN tank with a stir bar. The tank was placed on the stir plate at 4C to circulate the buffer. The proteins were transferred to the membrane at 100 V fo r one hour at 4 C. The membrane was incubated in 25 mL blocking buffer (T ris B uffered S aline (TBS) 0.1% Tween 20, 5% w/v nonfat dry milk) with shaking for one hour at room temperature. The membrane was then washed three times for five minutes with 15 m L TBS/T ((TBS, 0.1% Tween 20). The membrane was then incubated with the primary antibody (1:1000 dilution for all primary antibodies) in primary antibody dilution buffer

PAGE 132

132 (TBS, 0.1% Tween 20, 5% BSA) with gentle agitation over night at 4 C. The membrane wa s washed three times for five minutes with 15 mL TBS/T. The membrane was incubated with secondary antibody (1:2000 dilution for all secondary antibodies) in blocking buffer for one hour at room temperature with gentle agitation. The membrane was then washe d three times for five minutes with 15 mL TBS/T. The chemiluminescent detection system used was LumiGLO reagent (Cell Signaling Technologies). The membrane was incubated with 10 mL 1X LumiGLO (9 ml H 2 O, 500 l LumiGLO, 500l peroxide) with gentle agitation for 1 minute at room temperature and exposed to Blue Devil autoradiography film (Genesee Scientific). Densitometry analysis was performed using ImageJ software ( http://rsb.info.nih.gov/ij/ ). RNA Isolation and qRT PCR RNA isolation was performed as desc ribed in Chapter 3. To prepare cDNA for the qRT PCR the RNA samples were DNase treated using the DNA freeTM kit (Ambion by Life Technologies, AM1906). Briefly, samples were diluted to 10 g, 0.1 volume of 10X DNase I Buffer and 1 L rDNase I were added to the RNA, and mixed gently. Samples were incubated at 37 C for 30 minutes. Next, resuspended DNase inactivation reagent (0.1 volume) was added to the samples and mixed gently. Samples were incubated at room temperature for two minutes with occasional mixing DNase inactivation buffer was removed by spinning samples at 10,000 g for 90 seconds. The RNA was transferred to a fresh nuclease free tube. The cDNA was prepared using the High Capacity cDNA Reverse Transcription (RT) kit (Applied Biosystems, 4368813 ). To set up the reaction 2 l of 10X RT buffer, 0.8 l 25X dNTP mix (100mM), 2.0 l 10X RT random primers, 1.0 l MultiScribe TM Reverse Transcriptase, 1.0 l RNase inhibitor, and 3.2 l nuclease free H 2 O was added

PAGE 133

133 to 2 g of the DNase treated RNA. The the rmal cycling conditions used were: 25 C for 10 minutes, 50 C for 50 minutes, 85 C for 5 minutes. To set up the qRT PCR 17 l of mastermix ( 1 l primer probe (Table 4 2).5 l TaqMan MasterMix (Invitrogen), and 3.5 l H 2 O) was added to 8 l cDNA (4ng/l) Samples were set up in triplicate. The qRT PCR cycling parameters were: two minutes at 50C, 10 minutes at 40C, followed by 15 seconds at 95C and one minute at 60C for 40 cycles in a Bi Rad MJ Opticon 2. MagnaRIP RNA Binding Protein Pulldown Assay Precautions were taken to minimize RNase contamination: RNaseZAP TM (Invitrogen) was used to clean the work area, gloves and pipetmen, all pipets, filter tips, microcentrifuge tubes, and cell scrapers were certified nuclease free. All solutions used that we re not included in the MagnaRIP kit were certified DNase free and RNase free whenever possible. For cell lysate preparation, the plates were washed twice with 10 mL ice cold PBS, then 10 mL of PBS was added to each plate, cells were scraped from the plat e and finally transferred to a 15 mL conical tube. Cells were collected by centrifugation (1500 rpm, 5 minutes) and the supernatant was discarded. The cell pellet was resuspended by gentle pipetting in an equal volume of RIP lysis buffer: 100 l RIP lysis buffer, 0.5 l Protease Inhibitor Cocktail, 0.25 l RNase Inhibitor. Lysate was incubated on ice for 5 minutes, the supernatant was then collected by centrifugation at 14,000 rpm for 10 minutes at 4 C. To prepare the magnetic beads for immunoprecipitation, 50 l of magnetic beads suspension was added to each tube. Then 500 l of RIP wash buffer was added to each tube, and mixed gently with a vortex mixer. Tubes were placed on a magnetic separator and the supernatant was discarded. This step was repeated, then

PAGE 134

134 the beads were resuspended in 100 l RIP wash buffer. Next, 5 g of the pan Ago antibody (MABE56) was added and tubes were incubated with rotation for 30 minutes. Tubes were placed on a magnetic separator and the supernatant was discarded. Magnetic b ead antibody complexes were washed twice with 500 l RIP wash buffer. To immunoprecipitate the Ago RNA complexes 100 l of the cell lysate supernatant and 900 l RIP Immunoprecipitation buffer ( 860 l RIP wash buffer, 35 l 0.5 M EDTA, 5 l RNase Inhibit or) were added to the magnetic bead antibody complexes. At this point, 10 l of the supernatant was reserved as input. All tubes were incubated with rotation at 4 C overnight. Tubes were spun briefly in a centrifuge, then placed on a magnetic separator. The supernatant was discarded, and beads were washed six times with 500 l RIP wash buffer. To purify the RNA 150 l Proteinase K Buffer (117 l RIP wash buffer, 15 l 10% SDS, 18 l Proteinase K) was added to the magnetic bead complexes. Tubes were incub ated at 55 C with shaking for 30 minutes. After the incubation, tubes were spun briefly in a centrifuge and placed on a magnetic separator. The supernatant was transferred to a new tube and 300 l of RIP wash buffer was added. Then 400 l of a phenol:chlo roform:isoamyl alcohol mixture (125:24:1) was added to each tube. Tubes were mixed with a vortex for 15 seconds, and spun in a centrifuge at 14,000 rpm at room temperature for 10 minutes. The aqueous phase was carefully removed and placed in a new tube wit h 400 l chloroform. Tubes were mixed with a vortex for 15 seconds and then spun in a centrifuge at 14,000 rpm at room temperature for 10 minutes. The aqueous phase was removed and placed in a new tube. Next 15 l of Salt Solution I, 15 l Salt Solution II 5 l Precipitate Enhancer, and 850 l absolute ethanol

PAGE 135

135 were added to each tube. Tubes were gently mixed and incubated at 80 C overnight to precipitate the RNA. Then tubes were spun in a centrifuge at 14,000 rpm at 4 C for 30 minutes, The supernatant was carefully discarded and the pellet was washed with 80% ethanol, then spun in the centrifuge at 14,000 rpm at 4 C for 15 minutes. The supernatant was carefully removed and the pellet was air dried for 10 minutes. The pellets were resuspended in 20 l RNase free H 2 O To analyze immunoprecipitated RNA, a reverse transcription reaction was set up (9 l RNA, 10 l 2X RT Buffer, 20X Enzyme Mix), the RT reaction cycle was 37 C for 60 minutes, 95 C for 5 minutes. For real time qPCR 2 l of the cDNA sample was ad ded to 23 l qPCR reagent mix (9.5 l ddH 2 O 12.5 TaqMan Master Mix, and 1 l primer mix), each reaction was set up in triplicate. The qPCR parameters were 95 C for 10 minutes, followed by 40 cycles of 95 C for 15 seconds and 60 C for one minute. Results Anti miR Inhibitor Impact on RNA Levels Putative targets for miRNAs which showed decreased expression in response to aldosterone were examined using miRDB.org, with particular focus on transcripts that could be involved in ion transport. Transcripts ident ified by this analysis included Scn2a1 the 1 alpha subunit of a nonvoltage gated sodium channel, Kv2.1 a voltage dependent K + + /K + ATPase, as well as transcripts known to be upregulated by aldosterone, including Sgk1 the serum/ glucocorticoid kinase 1, and Edn1 Several of the predicted transcripts likely to be targeted by miRNAs ha d not been previously studied in the mIMCD 3 cell line. To confirm the presence of these mRNAs in

PAGE 136

136 the mIMCD 3 cell line qRT PCR was performed. With the exception of Kv2.1, all of the target mRNAs of interest were present in the mIMCD 3 cell line. To exam ine if these miRNAs affected the predicted targets, anti miR inhibitors were used. Use of anti miR inhibitors allowed examination of the effect of miRNA inhibition at both the mRNA and protein levels. Understanding which miRNAs were involved in directing R ISC to the target mRNAs also narrowed down which miRNAs to inhibit for a novel RNA binding protein pull down assay. The transfection of different anti miR inhibitors did not result in an increase in Scn2a1 levels (data not shown) The transfection of ant i miR 135a 3p resulted in an approximate 30% increase in Sgk1 levels (Figure 4 1, Panel A). Transfection of anti miR 1898 resulted in roughly a 40% increase in Atp1B1 levels (Figure 4 1, Panel B). Transfection of anti 709 resulted in about a 60% increase i n Edn1 mRNA levels (Figure 4 1, Panel C). These data suggest that these mRNAs are being targeted for turnover, and that inhibiting the association of these miRNAs with RISC through the use of anti miR inhibitors prevents this miRNA mediated mRNA turnover. Antibody Selection for RISC pulldown Assay In order to detect RISC Edn1 interaction, it was necessary to indentify a suitable antibody for an RNA binding protein that is part of the RISC complex. The Ago proteins represented a good target for this type o f experiment because they interact directly with the miRNA guide strand to direct RISC to a target mRNA. Additionally, a large number of Ago antibodies were available. T hree different Ago antibodies were examined : Ago1, Ago2, and a pan Ago antibody that re cognizes all four isoforms of Ago proteins found in mammals. For the mIMCD 3 cell line, the pan Ago antibody detected the Ago proteins

PAGE 137

137 more robustly than the Ago1 antibody (Figure 4 2), while bands were not seen in the Western blot using the Ago2 antibody (data not shown). The Ago2 antibody was not studied further. The pan Ago antibody was chosen for the immunoprecipitation reactions because Ago proteins were readily detectable in both vehicle and aldosterone treated samples. The Millipore research and de velopment team confirmed that this antibody would be compatible for use with the MagnaRIP kit (personal communication). The epitop e for the pan Ago antibody has not been published, so amino acids 47 879 of the Ago2 protein were examined using NCBI Conserve d Domain Search. The best apparent match was in the C terminal portion of Ago proteins, downstream of the RNA guide strand anchoring site in the PIWI subdomain Indeed, two months after Millipore was his antibody was available for purchase. RISC Pulldown Time Course The use of anti miR inhibitors and miRNA overexpression plasmids has suggested an interaction between several different miRNAs and Edn1 mRNA (Jacobs et al., 2013). Despite these suggestion s that miRNAs play a role in regulating Edn1 mRNA levels, a direct interaction between RISC and Edn1 mRNA has not been demonstrated. To determine if there was a direct interaction between RISC and Edn1 mRNA a RISC immunoprecipitation time course was conduc ted in the presence of aldosterone or vehicle. The mIMCD 3 cells were grown in the presence of either 100nM aldosterone or vehicle for 1 hour, 6 hours, or 12 hours. The whole cell lysate was then used for a RISC immunoprecipitation. The RNA isolated from this assay was then analyzed by qRT

PAGE 138

138 PCR. After one hour of aldosterone treatment, over five fold more Edn1 mRNA was targeted by RISC. There was a dramatic decrease in the amount of Edn1 mRNA interacting with RISC after 12 hours of aldosterone treatment. Th ese results suggest that the increased rate of Edn1 gene transcription coupled to decreased miRNA action on Edn1 mRNA may account for the build up of ET 1 seen in the inner medulla in response to aldosterone. Interestingly, not only was Edn1 mRNA detected in the RISC immunoprecipitations, the amount of Edn1 mRNA interacting with RISC was significantly affected by the addition of 100nM aldosterone (Figure 4 3). The amount of RISC Edn1 mRNA co immunoprecipitation increased in the hour following aldosterone tr eatment, reflecting a rapid accumulation of mRNA due to induction of transcription. More importantly, there was a significant drop in Edn1 mRNA pull down from mIMCD 3 cells expo sed to aldosterone for 12 hours. This suggests that RISC is targeting less Edn1 mRNA after prolonged exposure to aldosterone. Blocking RISC Interaction with Target mRNA Examining the Edn1 UTR revealed multiple putative binding sites for aldosterone responsive miR 297a 3p, miR 709, and miR 135a 3p, as well as a site for miR 1898. The latter was only detected in vehicle treated samples in the miRNA microarray (Chapter 3). If any of these miRNAs were guiding RISC to Edn1 mRNA, transfecting anti miRNA inhibitors would be expected to block the RISC Edn1 interaction. Anti miR oligo nucleotides were transfected for 48 hours, whole cell lysate was isolated and used for a RISC immunoprecipitation. The only anti miRNA inhibitor that blocked RISC Edn1 mRNA interaction was miR 709. Interestingly, blocking the other candidate miRNAs led to an increase in Edn1 mRNA targeted by RISC. Coupling

PAGE 139

139 the anti miR transfection with the RISC immunoprecipitation demonstrated that anti miR 709 impaired the RISC Edn1 mRNA interaction. In contrast, other anti miRs resulted in an increased amount of Edn1 m RNA co immunoprecipitating with RISC (Table 5 1). Discussion The data presented in this chapter demonstrated that inhibiting specific miRNAs led to a significant increase in several transcripts that play a role in sodium reabsorption. Importantly, a dir ect interaction between RISC and Edn1 mRNA has been demonstrated for the first time. This interaction is strongly affected by treatment of the mIMCD 3 cells with aldosterone. Additionally, the anti miR 709 miRNA inhibitor blocked RISC interaction with Edn1 mRNA. Because an miRNA can target ma n y different mRNAs, blocking a specific miRNA can often have off target effects. Initially, this was a concern with inhibiting miR 135a 3p and seeing an effect on Sgk1 mRNA, and inhibiting miR 1898 and seeing an ef fect on Atp1B1 mRNA. When these studies were first conducted, microRNA.org predicted that miR 1898 had a putative binding site in the Atp1B1 UTR, but it was a poorly conserved site with a poor miSVR score, and there was not a putative binding site for m iR 135a 3p in the Sgk1 UTR. To determine if these miRNAs could be directly affecting the mRNAs in question, an alignment of the miRNAs and target mRNAs was performed using BiBiserv RNAhybrid which aligns a miRNA sequence to a long RNA sequence and pred icts the minimum free energy that would occur upon hybridization. Both were predicted to form a highly stable interaction w ith the miRNA (Figure 4 4). I t is likely that our evidence is the first to link these miRNAs to these mRNAs, which explains

PAGE 140

140 why an in teraction wa s not predicted by the available algorithms. Unfortunately at the present time there are no studies that have examined the role of these miRNAs in the kidney or any other tissue or cell type. It will be interesting to see what function of these candidate miRNA have in the cell and how that may be affecting other targets that appear to have an affect Edn1 levels. The data presented in this chapter demonstrate that miR 709 has met the criterion established for determining an miRNA/mRNA interacti on. In silico examination of the Edn1 UTR reveals three p utative miR 709 binding sites ( position 212, 610, and 668) (microRNA.org). Using mFold ( http://mfold.rna.albany.edu ) to examine the free energy of the 70 nucleotides flanking the putative miRNA binding sites in the Edn1 UTR, the sites at position 610 and 668 have a minimum free energy that is higher than randomly expected ( G = 13.4 kcal/mol) (Martin et al., 2007), suggesting that these sites are accessible to miRNAs (Table 4 4). The use of anti miRNA inhibitors demonstrated that miR 709 is significantly affecting Edn1 mRNA levels. Most importantly, the RISC immunoprecipit ations demonstrate, for the first time, a direct interaction between Edn1 mRNA and RISC. All methods for detecting interaction have drawbacks: overexpression may generate false positive reports, luciferase reporters can be sensitive to various transfection methods, anti miR inhibitors may have downstream effects (Thomson et al., 2011). Immunoprecipitations of RISC components relies on a stable interaction between the miRNA mRNA target and the Ago proteins. The data presented in this chapter not only demonst rate that a stable interaction between Edn1 mRNA and RISC occurs, but that the interaction is sensitive to aldosterone.

PAGE 141

141 Th ese data also suggest a biological role of miRNA/ Edn1 mRNA interaction. The working hypothesis of the Cain laboratory is that ET 1 is an inhibitor of aldosterone induced Na + reabsorption. Edn1 expression has been demonstrated to increase in response to a ldosterone (Gumz et al., 2003) T he Ago pull down experiments suggest that while Edn1 expression is indeed increased, the RISC complex targets more Edn1 mRNA in the presence of aldosterone than vehicle after one hour. This RISC targeting decrease d significantly after 12 hours of aldosterone exposure, which would suggest that Edn1 mRNA is no longer being turned over and is able to be post translationally modified into the mature peptide. Furthermore, this interaction is blocked when miR 709 is inhibited with an anti miR inhibitor The data presented in Chapter 3 demonstrated that miR 709 decreased in response to physiological levels of aldo sterone. This would suggest that under conditions when aldosterone is not present, miR 709 targets Edn1 mRNA for turnover In contrast, in the presence of aldosterone miR 709 levels decrease and Edn1 mRNA is subsequently no longer targeted by RISC, enabli ng an increase in both Edn1 mRNA and mature ET 1 protein.

PAGE 142

142 Table 4 1 Sequences of miRNAs s tudied 1 miRNA Mature Sequence Stem loop Sequence > miR 297a 3p UAUACAUACACACAUAC CCAUA CUGUGUGUAUAUGUAUGUGUGCAUGUGCA UGUGUGUAUAUGAAUAUACAUAUACAUACA CA CAUACCCAUACAAACAUGCACACAAACA CACAGAAAAUUGA miR 1898 AGGUCAAGGUUCACAGG GGAUC GUAUGAACAUAGGUCAAGGUUCACAGGGG AUCAAGAAAUAUUAUUCUUGUAUAAUCUGU UUACUUUGACCUAAAUACUAGCUU miR 135a 1 UAUGGCUUUUUAUUCCU AUGUGA AGGCCUCACUGUUCUCUAUGGCUUUUUAU UCCUAUGUGAUUCUAUUGCUCGCUCAUAU A GGGAUUGGAGCCGUGGCGUACGGUGAGG AUA miR 709 GGAGGCAGAGGCAGGA GGA UGUCCCGUUUCUCUGCUUCUACUCAGAAG UGCUCUGAGCAUAGAACUGUCCUGUUUGA GCAGCACUGGGGAGGCAGAGGCAGGAGGA U miR 200c CGUCUUACCCAGCAGUG UUUGG CCCUCGUCUUACCCAGCAGUGUUUGGGUG CUGGUUGGGAGUCUCUAAUACUGCCGGGU AAUGAUGGAGG 1 Both the TaqMan MicroRNA Assay primers (Invitrogen by Life Technologies) and anti miR TM miRNA Inhibitors (Ambion by Life Technologies) primer sequences are proprietary, and the exact sequence is unknown. Table 4 2 TaqMan probes used for qRT PCR Probe Sequence actin, beta ACTGAGCTGCGTTTTACACCCTTTC Edn1 TCCAGAAACAGCTGTCTTGGGAGCC Sgk1 CTCTACGGCCTGCCCCCGTTTTATA Scn2a1 GATCTTTCCGACTGCTTAGAGTCTT Atp1b1 GCCCCGCCAGGATTGACACAGATTC Table 4 3. Affect of anti miR inhibitors on RISC Edn1 mRNA co immunoprecipitation. Anti miR oligonucleotide Edn1 mRNA Fold Change Standard Error anti miR 297a 3p 1.2 0 0.07 anti mir 1898 2.79 0.94 anti miR 135 1 3p 1.2 0 0.25 anti miR 709

PAGE 143

143 4 4 G ( kcal/mol) of the 70 nucleotides fl anking the and regions of the potential miR 709 binding sites in the Edn1 UTR Predicted miR 709 Binding Site Position in the Edn1 UTR 70 bp 70 bp 212 21.30 22.30 610 9.40 10.70 668 6.10 11.40

PAGE 144

144 Figure 4 1. Transfection of anti miR inhibitors stabilizes mRNA transcripts. A) Transfection of anti miR 135a 3p resulted in a 30% increase in Sgk1 mRNA levels compared to vehicle treated cells. B) Transfection of anti miR 1898 resulted in a 40% increase in Atp 1B1 mRNA levels. C) Transfection of anti miR 709 resulted in a 60% increase in Edn1 mRNA levels. p<0.01, **p<0.08. A B C

PAGE 145

145 Figure 4 2 Argonaute antibodies detect ed Ago proteins in mIMCD 3 cell lysate. Cells were lysed and Ago proteins examined by wester n blot analysis. Panels: A) Ago1 antibody, 95 kDa B) pan Ago antibody, 95 kDa. A aldosterone, V vehicle. Figure 4 3. RISC Edn1 mRNA co immunoprecipitation. Whole cell lysate was collected from cells that had been treated with either vehicle ( orange bars) or 100nM aldosterone for 1 hour, 6 hours, or 12 hours (blue bars) Levels of Edn1 mRNA in immunoprecipitates were determined by qRT PCR. *p < 0.006, **p <0.01, n = 3. A B

PAGE 146

146 Figure 4 4 M inimum f ree e nergy h ybridi zation of miRNAs and target mR NAs. A) Predicted h ybridization between miR 135a 3p (green) and Sgk1 mRNA (red). B) Predicted h ybridization between miR 1898 (green) and Atp1B1 mRNA (green). Both analyses predict a stable interaction between the miRNA and target mRNA. A B

PAGE 147

147 CHAPTER 5 C ONCLUSIONS AND PERSP ECTIVES Summary of Results The Edn1 mRNA is known to be highly labile (Inoue et al, 1989) F or many years it has been assumed that this instability is due to the presence of the AREs in the UTR (Mawji et al, 2004, Reimunde, 2005). How ever, deletion analysis of the Edn1 UTR (Chapter 2) demonstrated that deletion of no one region restored stability. A particularly important observation suggested that the AREs alone do not govern Edn1 mRNA stability. Experiments with a luciferase Edn1 mRNA reporter gene construct that contained all three murine AREs yielded a highly stable mRNA (Chapter 2). This observation, coupled with the identification of miRNAs as regulators of Edn1 mRNA (Jacobs et al, 2013), suggested that that miRNAs could be i nvolved in controlling the bioavailabilty of Edn1 mRNA. To examine the miRNA landscape in IMCD cells, a miRNA microarray was conducted. To the best of our knowledge, the data presented in Chapter 3 represents the miRNA content of a renal collecting duct cell line. The miRNA microarray defined expression leve ls for 1080 murine miRNAs. The microarray quantitatively sorted miRNAs from highly abundant to not expressed. Interestingly, expression of the vast major ity of the miRNAs did not change in response to aldosterone, suggesting that they play a role in the normal functions of a healthy cell. Howev er, the levels of a select few miRNAs present in moderate to low abundance, did change in response to aldosterone Additionally, one highly expressed miRNA, miR 709, was determined to be down regulated in the presence of aldosterone. The changes in expression were small, but since a miRNA can target many different

PAGE 148

148 mRNAs even a small change in miRNA expression can hav e a significant impact on target mRNA levels. The miRNA microarrays also demonstrated which miRNAs were not present in the mIMCD 3 cells. These results will be useful for choosing negative controls and to rule out specific miRNA regulation as the field dev elops. The miRNAs identified in Chapter 3 provided a list of candidate miRNAs to examine for a role in regulating transcripts involved in sodium reabsorption. The hypothesis was that aldosterone dependent changes in miRNA alter Na + transport in the collec ting duct. To determine if there were miRNAs acting on Na + transport mechanisms miRNA/mRNA interaction s were specifically blocked using anti miR inhibitors. The anti miR inhibitors prevent the mature miRNA from being incorporated into RISC. Therefore, if a miRNA is targeting an mRNA, blocking its incorporation into RISC would result in an increase in the target mRNA. In silico examination sensitive miRNAs. Transfection of anti miR 135a 3p resulted in a 20% increase in Sgk1 mRNA, transfection of anti miR 1898 resulted in a 40% increase in Atp1B1 mRNA, and transfection of miR 709 resulted in a 60% increase in Edn1 mRNA when compared to vehicle treated samples (Chapter 4). The results indicat ed that these mRNAs are targets of miRNA regulation and represent entirely novel regulatory mechanisms for these transcripts. To further examine the role of RISC Edn1 mRNA interaction RISC immunoprecipitation experiments were performed. Not only did these experiments demonstrate a direct interaction between RISC and Edn1 mRNA, they showed that the interaction is affected by aldosterone. T he amount of Edn1 mRNA interacting with RISC

PAGE 149

149 was significantly affected by the addition of 100nM aldosterone ( Chapter 4 ) The amount of RISC Edn1 mRNA co immunoprecipitation increased in the hour immediately following aldosterone treatment, reflecting a rapid accumulation of Edn1 mRNA due to induction of transcription. More importantly, there was a significant drop in Edn1 mRNA pull down from mIMCD 3 cells exposed to aldosterone for 12 hours. This suggests that RISC is targeting less Edn1 mRNA likely reflecting turnover of the message after prolonged exposure to aldosterone. These results suggest that the increased rate of Edn1 gene transcription coupled with the decreased miRNA action on Edn1 mRNA may account for the build up of ET 1 seen in the inner medulla in the early aldosterone response Furthermore, the transfection of anti miR 709 inhibitors prior to the RISC immun oprecipitation blocked RISC Edn1 mRNA interaction. This suggests that miR 709 directs RISC to Edn1 mRNA for turnover or translational inhibition. This is the first direct evidence of a miRNA binding to Edn1 mRNA. Taken together, these results allowed us to develop a model for miRNA interaction with Edn1 mRNA ( Figure 5 1). T his model is the first to describe miRNA regulation of Edn1 mRNA in the kidney collecting duct. Understanding how Edn1 mRNA is regulated could lead to important new therapeutic develop ments for blood pressure control. We have also demonstrated that miR 709 targets Edn1 mRNA in the absence of aldosterone. Since ET 1 functions to inhibit aldosterone induced Na + reabsorption, blocking miR 709 to increase ET 1 levels represents an attractiv e target for anti hypertensive therapy.

PAGE 150

150 Perspectives and Future Directions The data presented in this dissertation provides important data to define the miRNA landscape in a murine inner medullary collecting duct cell line, and elucidates a novel regulat ory pathway in which Edn1 mRNA expression is modulated in the presence of aldosterone. While the experiments detailed in this dissertation answer many questions about how miRNAs are involved in regulating transcripts that are involved in Na + reabsorption, the data raises many more questions about both the role of miRNAs in the inner medullary collecting duct,how aldosterone concentration affects the miRNA landscape, and how all of this alters Na + handling by the kidney. Aldosterone is known to induce the expression of many different genes (Gumz et al., 2003) A novel role for aldosterone induced gene expression could involve miRNA mediated regulation of transcription factors. Indeed, a new algorithm, TransmiR ( http://202.38.126.151/hmdd/mirna/tf/ ), has been developed to help link miRNA regulation to transcription factors, but it is currently in its infancy based on a very limited data set (Published January 30 th 2013) Exploring the potential for miRNAs t o modulate the availability of transcription factors will enhance our understanding of the regulation of gene expression and has the potential to provide a fresh perspective on how gene expression can be regulated in the collecting duct. The observation t hat the expression of several miRNAs was increased expression in the presence of aldosterone identifies candidates to study miRNA gene expression. Our current understanding of miRNA gene organization is limited (Chapter 1) T he Cain laboratory has extensiv e experience in examining the hormone response elements located in the promoter regions of aldosterone responsive genes. The

PAGE 151

151 promoter regions of the miRNAs upregulated by aldosterone have been examined using the Transcription Element Search System ( www.cbil.upenn.edu/ tess ). All have multiple predicted hormone response elements with in the first 700 bp upstream of the transcriptional start site. Demonstrating that the hormone response elements are functional for the induction of expression of these miRNAs would not only represent a novel aspect in our understanding of miRNA promoter elements in the inner medullary collecting duct. Whether observations of this type could be expanded to other aldosterone sensitive epithelia remains an open question. While the anti miR inhibitor studies described in Chapter 4 provide a starting point for understanding the role of miRNAs in regulating these transcripts, expanding these studies would provide additional information ab out how these miRNAs are involved in regulating target mRNA levels. For example, deletion analysis of the putative miRNA binding sites in Sgk1 or Atp1B1 UTR reporter constructs could be used as additional support for miRNA mediated regulation of these m RNAs. Alternatively, miRNA overexpression plasmids could be constructed to determine if overexpression correlate s with a decrease in target mRNA levels. Furthermore, RISC immunoprecipitation studies might be conducted to determine if the RISC targeting pat tern observed for Edn1 mRNA are seen for Sgk1 and Atp1B1 mRNA. It also would be interesting to look at an aldosterone time course for the expression for these miRNAs to determine if there is an inverse correlation between their expression and that of their target mRNAs While the data presented for the mir 709 interaction with Edn1 mRNA surpasses the criteria for establishing a miRNA/mRNA interaction, the approach of RISC

PAGE 152

152 immunoprecipitation combined with anti miR inhibitors establishes an additional metho d to study miRNA action on Edn1 mRNA (Chapter 4). Blocking miR 709 and conducting aldosterone time course experiment s like those described in Chapter 4 could determine if miR 709 is the sole miRNA regulating Edn1 mRNA in the mIMCD 3 cells, or identify coo rdinate regulation involving additional miRNAs to regulate Edn1 mRNA levels. The experiments described above address questions that can be examined using currently available techniques, however, there are still many important long term questions that cann ot be addressed until miRNA expression and targeting are better characterized. For example, the true physiological changes in miRNA expression levels in response to aldosterone remain unknown. M icroarray data presented in Chapter 3 defines a change in the miRNA landscape in response to 24 hours of exposure to 100 nM aldosterone in a murine derived inner medullary collecting duct cell. While these observations pave the way for a more thorough examination of miRNA reg ulation in the kidney, they do not yet exa min e the acute inital changes in the miRNA landscape in response to aldosterone. It is reasonable to expect that the waxing and waning of aldosterone concentration that reflect s the physiological response to blood pressure would be accompanied by a similar shift in the miRNA composition of a cell. Understanding how these changes impact Na + reabsorption could provide new therapeutic targets for the treatment of hypertension

PAGE 153

153 Figure 5 1. Proposed model for miRNA Edn1 mRNA interaction.

PAGE 154

154 LIST OF REFEREN CES Abdellatif, M. (2012). Differential expression of microRNAs in different disease states. Circ Res 110, 638 650. Anglicheau D Sharma V K Ding R Hummel A Snopkowski C Dadhania D Seshan S V and Suthanthiran M. (2009). MicroRNA express ion profiles predictive of human renal allograft status. Proc Natl Acad Sci U S A 106 5330 533 5 Arai, H., Hori, S., Aramori, I., Ohkubu, H., and Nakanishi, S. (1990). Cloning and expression of a cDNA encoding an endothelin receptor. Nature 348, 730 732. A rinami, T., Ishikawa, M., Inoue, A., Yanagisawa, M., Masaki, T.,Yoshida, M.C., and Hamaguchi, H. (1991). Chromosomal assignments of the human endothelin family genes: the endothelin 1 gene( EDN1 ) to 6p23 p24, the endothelin 2 gene(EDN2) to Ip34, and the end othelin 3 gene(EDN3) to 0q13.2 q13.3. Am J Hum Genet 48, 990 996. Bailey M Haton C Orea V Sassard J Bailly C Unwin R and Imbert Teboul M. (2003). ETA receptor mediated Ca2 + signaling in thin loop: impariment in genetic hypertension. Kidney Int 63 1276 1284. Bagnato, A., Loizidou, M., Pflug, B.R., Curwen, J., and Growcott, J. (2011). Role of the endothelin axis and its antagonists in the treatment of cancer. Br J Pharmacol 163, 220 233. Baum, M., Quigly, R., and Satlin, L. (2003). Maturational changes in renal tubular transport. Curr Opin Nephrol Hypertens 12, 521 526. Benigni A Colosio V Brena C Bruzzi I Bertani T and Remuzzi G. (1998). Unselective inhibition of endothelin receptors reduces re nal dysfunction in experimental diabetes. Diabetes 47, 450 456. Betel D Koppal A Agius P Sander C and Leslie C. (2010). Comprehensive modeling of microRNA targets predicts functional non conserved and non canonical sites. Genome Biol 11:R90 B enz, K., and Amann, K. (2011). Endothelin in Diabetic Renal Disease. Contrib Nephrol 172, 149 148. Berezikov E Guryev V van de Belt J Wienholds E Plasterk R H and Cuppen E. (2005). Phylogenetic shadowing and computational identification of human microRNA genes. Cell 120, 21 24.

PAGE 155

155 Black, H.R., Bakris, G.L., Weber, M.A., Weiss, R., Shahaway, M.E., Marple, R Tannoury G Linas S Wiens B L Linseman J V Roden R and Gerber M J. (2007). Efficacy and safety of darusentan in patients w ith resistant hypertension: results from a randomized, double blind, placebo controlled dose ranging study. J Clin Hypertens 9 760 76 9. Bohnsack M T Czaplinski K and Grlich D. (2004). Exportin 5 is a RanGTP dependent dsRNA binding protein that med iates nuclear export of pre miRNAs. RNA 10 185 1 91 Bohnsack M T Regener K Schwappach B Saffrich R Paraskeva E Hartmann E and Grlich D. (2002). Exp5 exports eEF1A via tRNA from nuclei and synergizes with other transport pathways to con fine translation to the cytoplasm. EMBO J 21 6205 62 15. Borchert, G., M., Lanier, W., and Davidson, B.L. (2006). RNA polymerase III transcribes human microRNAs Nature Struct and Mol Biol 13, 1097 1101. Bremnes, T., Paasche, J.D., Mehlum, A., Sandberg, C. Bremnes, B., and Attramadal, H. (2000). Regulation and intracellular trafficking pathways of the endothelin receptors. J Biol Chem 275, 17595 17604. Brenner, B.M., and Rector, F.C. (2008). Brenner & Rector's the kidney, 8th edn (Philadelphia, Saunders Els evier). Bugaj, V., Pochynyuk, O., Mironova, E., Vandewalle, A., Medina, J.L., and Stockand, J.D. (2008). Regulation of the epithelial Na+ channel by endothelin 1 in rat collecting duct. Am J Physiol Renal Physiol 295, F1063 1070. Bugaj, V., Mironova, E., K ohan, D.E., and Stockand, J.D. (2012). Collecting duct specific endothelin B receptor knockout increases ENaC activity. Am J Physiol Cell Physiol 302, 188 194. Carmell, M.A., Xuan, Z., Zang, M.Q., and Hannon, G.J. (2002). The Argonaute family: Tentacles th at reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes & Dev 16, 2733 2742. Clapp, W.L., Madsen, K.M., Verlander, J.W., and Tisher, C.C. (1987). Intercalated cells of the rat inner medullary collecting duct. Kidney Inte rnational 31 1080 1087. Dai, Y., Sui, W., Lan, H., Yan, Q., Huang, H., and Huang, Y. (2008). Microarray analysis of micro ribonucleic acid expression in primary immunoglobulin A nephropathy. Saudi Med J 29, 1388 1393.

PAGE 156

156 Dai, Y., Sui, W., Lan, H., Yan, Q., Huang, H., and Huang, Y. (2008). Comprehensive analysis of microRNA expression patterns in renal biopsies of lupus nephritis patients. Rheumatol Int 29, 749 754. Datta, J., Kutay, H., Nasser, M.W., Nuovo, G.J., Wang, B., Majumder, S., Liu, C.G., Volinia, S ., Croce, C.M., Schmittgen, T.D., Ghoshal, K., and Jacob, S.T. (2008). Methylation mediated silencing of MicroRNA 1 gene and its role in hepatocellular carcinogenesis. Cancer Res 68, 5049 4058. Davenport, A.P. and Maguire, J.J. (2012). Pharmacology of rena l endothelin receptors. Contrib Nephrol 172, 1 17. Denault, J.B., Claing, A., D'Orlans Juste, P., Sawamura, T., Kido, T., Masaki, T., and Leduc, R. (1995). Processing of proendothelin 1 by human furin convertase. FEBS lett 362, 276 280. Juste, P., Plante, M., Honore, J.C., Carrier, E., and Labonte, J. (2003) Synthesis and degradation of endothelin 1. Can J Physiol Pharmacol 81,503 510. Dupuis, J., 2001. Endothelin receptor antagonists in pulmonary hypertension. Lancet 358, 1113 1114. Emoto, N., and Yanisagawa, M. (1995). Endothelin converting enzyme 2 is a membrane bound, phosphoramidon sensitive metalloprotease with acidic pH optimum. J Biol Chem 270, 15262 15268. Evans, N.J., and Walker, J.W. (2008). Endothelin receptor dimers evaluated by FRE T, ligand binding, and calcium mobilization. Biophys J 95, 483 492. Fareh J Touyz R M Schiffrin E L and Thibault G. ( 1996 ). Endothelin 1 and angiotensin II receptors in cells from rat hypertrophied heart. Receptor regulation and intracellular Ca2 + modulation. Circ Res 78 302 3 11. Feng, B. and Chakrabarti, S. ( 2012). miR 320 regulates glucose induced gene expression in diabetes. ISRN Endocrinol ,549875. Feng,W., and Feng, Y. (2011). microRNAs in neural cell development and brain diseases. Sci Ch ina Life Sci 54, 1103 1112. Fire A Xu S Montgomery M K Kostas S A Driver S E and Mello C C. (1998). Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature 391 806 8 11. Fish, J.E. (2012). A primer on the role of microRNAs in endothelial biology and vascular disease. Semin Nephrol 32, 167 175.

PAGE 157

157 Gallego, M.S., and Ling, B.N. (1996). Regulation of amiloride sensitive sodium channels by endothelin 1 in distal nephron cells. Am J Physiol 271, F451 F460. Garcia D M Baek D Shin C ., Bell, G.W., Grimson, A., and Bartel, D.P.(2011). Weak seed pairing stability and high target site abundance decrease the proficiency of lsy 6 and other microRNAs. Nat Struct Mol Biol 18 1139 11 46. Gariepy, C. E Williams, S. C. Richardson, J. A Hammer, R. E and Yanagisawa, M. ( 1998 ) Transgenic expression of the endothelin B receptor prevents congenital intestinal aganglionosis in a rat model of Hirschsprung disease. J. Clin. Invest 102 1092 1101 Gariepy, C.E, Ohuchi, T. Williams, S.C., Richardson, J. A and Yanagisawa, M. (2000). Salt sensitive hypertension in endothelin B receptor deficient rats. J Clin Invest 105, 925 933. Gasic, S., Wagner, O.F., Vierhapper, H., Nowotny, P., and Waldhausl, W. (1992). Regional haemo dynamics effects and clearance of endothelin 1 in humans: renal and peripheral tissues may contribute to overall disposal of the peptide. J Cardiovasc Pharmacol 19, 176 180. Giaid, A., Gibson, S.J., Herrero, M.T., Gentleman, S., Legon, S., Yanagisawa, M., Masaki, T., Ibrahim, N.B.N., Roberts, G.W., Rossi, M..L, and Polak J.M. ( 1991). Topographical localization of endothelin mRNA and peptide immunoreactivity in neurones of the human brain. Histochemistry 95(,303 314. Ge Y Stricklett P K Hughes A K Yanagisawa M and Kohan D E. (2005). Collecting duct specific knockout of the endothelin A receptor alters renal vasopressin responsiveness, but not sodium excretion or blood pressure. Am J Physiol Renal Physiol 289 F692 69 8 Ge, Y., Bagnall, A., Strick lett, P.K., Strait K Webb D J Kotelevtsev Y and Kohan D E. (2006) Collecting duct specific knockout of the endothelin B receptor causes hypertension and sodium retention. Am J Physiol Renal Physiol 291, F1274 F1280. Gonsalves,C., and Kalra, V.K. (2010). Endothelin 1 induced macrophage imflammatory protein AP 1 and is negatively regulated by microRNA 195. J Immunol 185, 6253 6264. Gregory P A Bracken C P Bert A G and Goodall G J. (2008). MicroRNAs as regulators of epithelial mesenchymal transition. Cell Cycle 7 3112 8.

PAGE 158

158 Groop, P.H., Thomas, M.C., Moran, J.L., Waden, J., Thorn, L.M., Makinen, V.P., Rosengard Barlund, M., Hietala, K., Heikkila, O., and Forsblom, C. The presence and severity of chronic kidney disease predicts all cause mortality in type 1 diabetes. Diabetes 58, 1651 1658. Gross, M.L., El Shakmak, A., Szabo, A., Koch, A., Kuhlmann, A., Munter, K., Ritz, E., and Amann, K. (2003). ACE inhibitors but not en dothelin receptor blockers prevent podocytes loss in early diabetic nephropathy. Diabetelogia 46, 856 858. Gumz, M.L., Popp, M.P., Wingo, C.S., and Cain, B.D. (2003). Early transcriptional effects of aldosterone in a mouse inner medullary collecting duct cell line. Am J Physiol 285 F664 673. Guo, X., and Yang, T. (2006). Endothelin B receptor antagonism in the rat renal medulla reduces urine flow rate and sodium excretion. Exp Biol Med (Maywood) 231, 1001 1005. Hammond, S.M. (2005). Dicing and slicing: T he core machinery of the RNA interference pathway. FEBS Lett 579, 5822 5829. Han J Pedersen J S Kwon S C Belair C D Kim Y K Yeom K H Yang W Y Haussler D Blelloch R and Kim V N. (2009). Posttranscriptional crossregulation between Drosha and DGCR8. Cell 136 75 84 Han J Lee Y Yeom K H Nam J W Heo I Rhee J K Sohn S Y Cho Y Zhang B T and Kim V N. (2006). Molecular basis for the recognition of primary microRNAs by the Drosha DGCR8 complex. Cell 125 887 901. Han, J., Lee, Y., Yeom, K.H., Kim, Y.K., Jin, H., Kim, V.N. (2004)The Drosha DGCR8 complex in primary microRNA processing. Genes Dev 18 3016 30 27 Harvey, S.J., Jarad, G., Cunningham, J., Goldberg, S., Schermer, B., Harfe, B.D., McManus, M.T., Benzing, T. and Miner, J.H. (2008). Podocyte specific deletion of dicer alters cytoskeletal dynamics and causes glomerular disease. J Am Soc Nephrol 19, 2150 2158. Hasegawa, H., Hiki, K., Sawamura, T., Aoyama, T., Okamoto, Y, Miwa, S., Shimohama,S., Kimura, J., and Masaki, T. (1998). Purification of a novel endothelin converting enzyme specific for big endothelin 3. FEBS Lett 428, 304 308. Hatae, N., Aksentijevitch, N., and Zemekova, H.W. (2007). Cloning and functional identification of novel endothelin receptor typ e A isoforms in pituitary. Mol Endocrinol 21, 1192 1204.

PAGE 159

159 Hickey K A Rubanyi G Paul R J and Highsmith R F. (1985). Characterization of a coronary vasoconstrictor produced by cultured endothelial cells. Am J Physiol 248 C550 C55 6. Ho, J., and Kre idburg, J.A. (2012). The long and short of microRNAs in the kidney. J Am Soc Nephrol 23, 400 404. H o J Pandey P Schatton T Sims Lucas S Khalid M Frank M H Hartwig S and Kreidberg J A. (2011). The pro apoptotic protein Bim is a microR NA target in kidney progenitors. J Am Soc Nephrol 22 1053 10 63 Honing, M.L., Hijimering, M.L, Ballard, D.E., Yang, Y.P., Padley, R.J., Morrison, P.J., and Rabelink, T.J. (2000). Selective ET(A) receptor antagonism with ABT 627 attenuates all renal effects of endothelin in humans. J Am Soc Nephrol 11, 1498 1504. Huang W Liu H Wang T Zhang T Kuang J Luo Y Chung S S Yuan L and Yang J Y. (2011). Tonicity responsive microRNAs contribute to the maximal induction of osmoregulatory transcr iption factor OREBP in response to high NaCl hypertonicity. Nucleic Acids Res 39 475 85 Houbaviy H B, Dennis L Jaenisch R and Sharp P A. (2005). Characterization of a highly variable eutherian microRNA gene. RNA 11, 1245 1257. Hudson, R.S., Yi, M. Esposito, D., Watkins, S.K., Hurwitz, A.A., Yfantis, H.G., Lee, D.H., Borin, J.F., Naslund, M.J., Alexander, R.B., Dorsey, T.H., Stephens, R.M., Croce, C.M., and Ambs, S. (2011) MicroRNA 1 is a candidate tumor suppressor and prognostic marker in human pr ostate cancer. Nucleic Acids Research 40, 3689 3703. Huggins, J.P, Pelton, J.T., and Miller, R.C. (1993). The structure and specificity of endothelin receptors: their importance in physiology and medicine. Pharmacol Ther 59,55 123. Hutvgner G McLachlan J Pasquinelli A E Blint E Tuschl T and Zamore P D. (2001). A cellular function for the RNA interference enzyme Dicer in the maturation of the let 7 small temporal RNA. Science 293 834 83 8 Inoue, A., Yanagisawa, M., Takuwa, Y., Mitsui, Y., K obayashi, M., and Masaki, T. (1989 a ). The human preproendothelin 1 gene. Complete nucleotide sequence and regulation of expression. J Biol Chem 264, 14954 9. Inoue,A., Yanisagawa, M., Kimura, S., Kasuya, Y., Miyauchi, T., Goto, K., and Masaki, T. (1989 b ). The human endothelin family: three structurally and pharmacologically distinct isopeptides predicted by three separate genes. Proc Natl Acad Sci 86, 2863 2867.

PAGE 160

160 Ito H Hirata Y Adachi S Tanaka M Tsujino M Koike A Nogami A Murumo F and Hiroe M. (1993). Endothelin 1 is an autocrine / paracrine factor in the mechanism of angiotensin II induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest 92 398 403 Jafri, F, and Ergul, A. (2003). Nuclear localization of endothelin convert ing enzyme 1: subisoform specificity. Arterioscler Thromb Vasc Biol 23, 2192 2196. Johnstrom, P., Fryer, T.D., Richards, H.K., Harris, N.G., Barret, O., Clark, J.C., Pickard, J.D., and Davenport, A.P. (2005). Positron emission tomography using 18F labelled endothelin 1 reveals prevention of binding to cardiac receptors owing to tissue specific clearance by ET B receptors in vivo. Br J Pharmacol 144, 115 122. Juan, D., Alexe, G., Antes, T., Liu, H., Madabhushi, A., Delisi, C., Ganesan, S., Bhanot, G., and Li ou, L.S. (2012). Identification of a microRNA panel for clear cell kidney cancer. Urology 75, 835 841. Kato M Zhang J Wang M Lanting L Yuan H Rossi J J and Natarajan R. (2007). MicroRNA 192 in diabetic kidney glomeruli and its function i n TGF beta induced collagen expression via inhibition of E box repressors. Proc Natl Acad Sci 104 3432 343 7 Karet, F.E., and Davenport, A.P. (1996). Localization of endothelin peptides in human kidney. Kidney Int 49, 382 387. Kawamata T Yoda M and Tomari Y. (2011). Multilayer checkpoints for microRNA authenticity during RISC assembly. EMBO Rep 12, 944 94 9 Kedzeirski, R.M., and Yanagisawa, M. (2001). Endothelin system: the double edged sword in health and disease. Annu Rev Pharmacol Toxicol 41, 696 699. Khan M A Dashwood M R Mumtaz F H Thompson C S Mikhailidis D P and Morgan R J. (1999). Upregulation of endothelin A receptor sites in the rabbit diabetic kidney: potential relevance to the early pathogenesis of diabetic nephropathy. Neph ron 83 261 267 Khvorova A Reynolds A and Jayasena S D (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell 115, 209 216. Kim V N Han J and Siomi M C. (2009). Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol 10 126 1 39 K itamura K Tanaka T Kato J Eto T and Tanaka K. (1989). Regional distribution of immunoreactive endothelin in porcine tissue: abundance in inner medulla of kidney. Biochem Biophys Res Commun 161 348 352.

PAGE 161

161 Koeppen, B.M., and Stanton, B.A. (2001) Renal Physiology, 3 rd edn (Missouri, Mosby, Inc) Kohan, D.E. (1991). Endothelin s ynthesis by rabbit renal tubule cells. Am J Physiol Renal Fluid Electrolyte Physiol 261, F221 F226. Kohan D E and Padilla E. (1992). Endothelin 1 is an autocrine facto r in rat inner medullary collecting ducts. Am J Physiol Renal Fluid Electrolyte Physio l 263 F607 F 612. Kohan, D.E. (1997). Endothelins in the normal and diseased kidney. Am J Kid Dis 29, 2 26. Kohan, D.E., Rossi, N.F., Inscho, E.W., and Pollock, D.M. (20 11). Regulation of blood pressure and salt homeostasis by endothelin. Physiol Rev 91, 1 77. Komukai K O Uchi J Morimoto S Kawai M Hongo K Yoshimura M and Kurihara S. (2010). Role of Ca(2+)/calmodulin dependent protein kinase II in the re gulation of the cardiac L type Ca(2+) current during endothelin 1 stimulation. Am J Physiol Heart Circ Physiol 298 H1902 H190 7 Kolla, V., Robertson, N.M., and Litwack, G. (1999). Identification of a mineralocorticoid/glucocorticoid response element in th e human Na/K ATPase alpha1 gene promoter. Biochem Biophys Res Commun 266, 5 14. Korpal, M., Lee, E.S., Hu, G., and Kang, Y. (2008). The miR 200 family inhibits epithelial mesenchymal transition and cancer cell migration by direct targeting of E cadherin tr anscriptional repressors ZEB1 and ZEB2. J Biol Chem 283,14910 14914. Knight S W and Bass B L. (2001). A role for the RNase III enzyme DCR 1 in RNA interference and germ line development in Caenorhabditis elegans. Science 293, 2269 22 71. Kuhn, D.E., M artin, M.M., Feldman, D.S., Terry, A.V., Nuovo, G.J., and Elton, T.S. (2008). Experimental validation of miRNA targets. Methods 44, 47 54. Kutay U Bischoff F R Kostka S Kraft R and Grlich D. (1997). Export of importin alpha from the nucleus i s mediated by a specific nuclear transport factor. Cell 90 1061 10 71. Krum, H., Viskoper, R.J., Lacourciere, Y., Buded, M., and Charlon, V. (1998). The effect of an endothelin receptor antagonist, bosentan, on blood pressure in patients with essential hype rtension.

PAGE 162

162 Krupa A Jenkins R Luo D D Lewis A Phillips A and Fraser D. (2010). Loss of MicroRNA 192 promotes fibrogenesis in diabetic nephropathy. J Am Soc Nephrol 21 438 4 47 Lagos Quintana, M Rauhut R Lendeckel W and Tuschl T. (2 001). Identification of novel genes coding for small expressed RNAs. Science 294 853 85 8 Lanford R.E., Hildebrandt Eriksen E.S., Petri A., Persson R., Lindow M., Munk M.E., Kauppinen S., and rum H. (2010). Therapeutic silencing of microRNA 122 in primate s with chronic hepatitis C virus infection. Science 327, 198 201 Lau N C Lim L P Weinstein E G Bartel D P. (2001). An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294, 858 862. Lee S O Masyuk T Splinter P Banales J M Masyuk A Stroope A and Larusso N. (2008). MicroRNA15a modulates expression of the cell cycle regulator Cdc25A and affects hepatic cystogenesis in a rat model of polycystic kidney disease. J Clin Invest 118 3714 24 Lee Y Kim M Ha J Yeom K H Lee S Baek S H and Kim V N. (2004). MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 23 4051 40 60. Lee Y Ahn C Han J Choi H Kim J Yim J Lee J Provost P Rdmark O Kim S a nd Kim V N. (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415 419 Lee Y Jeon K Lee J T Kim S and Kim V N. (2001). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J 21 4663 46 70. Le e,R.C., and Ambros, V. 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862 864. Lehrman, A., Edwards, B.S., Hallett, J.W., Heublein, D.M., Sandberg, S.M., and Burnett, J.C., Jr. (1991). Circulating and tissue immunoreactivit y in advanced atherosclerosis. N Engl J Med 325, 997 1001. Loffing, J., Pietri, L., Aregger, F., Bloch Faure, M., Ziegler, U., Meneton, P., Rossier, B.C., and Kaissling, B. (2000). Differential subcellular localization of ENaC subunits in mouse kidney in response to high and low Na diets. Am J Physiol 279 F252 258. Li, D., He, B., Zhang, H., Shan, S.F., Liang, Q., Yuan, W.J., and Ren, A.J. (2012). The inhibitory effect of miRNA 1 on ET 1 gene expression. FEBS Lett 586, 1014 21.

PAGE 163

163 Li, D., Yang, P., Li, H., Cheng, P., Zhang, L., Wei, D., Su, X., Peng, J., Gao, H., Tan, Y., Zhao, Z., Li, Y., Qi, Z., Rui, Y., and Zhang, T. (2012). MicroRNA 1 inhibits proliferation of hepatocarcinoma cells by targeting endothelin 1. Life Sci 91, 440 447. Li D., Yang, P., Xiong, Q., Song, X., Yang, X., Liu, L., Yuan, W., and Rui, Y.C. (2010) microRNA 125a/b 5p inhibits endothelin 1 expression in vascular endothelial cells. J Hypertens 28, 1646 1654. Liu Y Taylor N E Lu L Usa K Cowley A W Jr, Ferreri N R Yeo N C and Liang M. (2010). Renal medullary microRNAs in Dahl salt sensitive rats: miR 29b regulates several collagens and related genes. Hypertension 55 974 9 82. Ling, L., Maguire, J.J., and Davenport, A.P. (2013). Endothelin 2, the forgotten isoform: emergin g role in the cardiovascular system, ovarian development, immunology and cancer. Br J Pharmacol 148, 283 295. MacCarthy PA, Grocott Mason R, Prendergast BD, Shah AM. (2000). Contrasting inotropic effects of endogenous endothelin in the normal and failing h uman heart: studies with an intracoronary ET(A) receptor antagonist. Circulation 101 142 14 7. Madsen, K.M., Verlander, J.W., and Tisher, C.C. (1988). Relationship between structure and function in distal tubule and collecting duct. J Electron Microsc Tech 9, 187 208. Martin M M Buckenberger J A Jiang J Malana G E Nuovo G J Chotani M Feldman D S Schmittgen T D Elton T S. (2007). The human angiotensin II type 1 receptor +1166 A/C polymorphism attenuates microrna 155 binding. J Biol Ch em 282, 24262 24269. Mawji, I.A., Robb, G.B., Tai, S.C., and Marsden, P.A. (2004). Role of the 3' untranslated region of human endothelin 1 in vascular endothelial cells. Contribution to transcript lability and the cellular heat shock response. J Biol Chem 279, 8655 8667. Miura S I Imaizumi S and Saku K. (2012). Recent progress in molecular mechanisms of angiotensin II type 1 and 2 receptors. Curr Pharm Des [Epub ahead of print]. Merkus D Brzezinska A K Zhang C Saito S and Chilian W M. (20 05). Cardiac myocytes control release of endothelin 1 in coronary vasculature. Am J Physiol Heart Circ Physiol 288 H2O 88 H2O 92 Miyauchi, T., Yanisagawa, M., Tomizawa, T., Sugishita, Y., Suzuki, N., Fujino, M., Ajisaka R Goto K and Masaki T. (1989) Increased plasma concentrations of endothelin 1 and big endothelin 1 in acute myocardial infarction. Lancet 2, 53 54.

PAGE 164

164 Moridaira K Nodera M Sato G and Yanagisawa H. (2003). Detection of prepro ET 1 mRNA in normal rat kidney by in situ RT PCR. N ephron Exp Nephrol 95 e55 61. Monge, J.C., Stewart, D.J., and Cernacek, P. (1995). Differentiation of embryonal carcinoma cells to a neural or cardiomyocyte lineage is associated with selective expression of endothelin receptors. J Biol Chem 270, 15385 15 390. Naidoo, V., S Naidoo, S., R., and Raidoo, D.M. (2004). Cellular distribution of the endothelin system in the human brain. J Chem Neuroanat 27, 87 98 Nakov, R., Pfarr, E., and Eberle, S. (2002). Darusentan: an effective endothelinA receptor antagoni st for treatment of hypertension. Am J Hypertens 15, 583 589. Naomi, S., Iwaoka, T., Disashi, T., Inoue, J., Kanesaka, Y., Tokunaga, H., and Tomita, K. (1998). Endothelin 1 inhibits endothelin converting enzyme 1 expression in cultured rat pulmonary endoth elial cells. Circulation 97, 234 236. Nagalakshmi V K Ren Q Pugh M M Valerius M T McMahon A P and Yu J. (2011). Dicer regulates the development of nephrogenic and ureteric compartments in the mammalian kidney. Kidney Int 79, 317 3 30 Ohler, U., Yekta, S., Lim, L.P., Bartel, D.P., and Burge, C.B. (2004). Patterns flanking sequence conservation and a characteristic upstream motif for microRNA gene identification. RNA 10, 1309 1322. Omland, T., Lie, R.T., Aakvaag, A., Aarsland, T., and Dickstei n, K. (1994). Plasma endothlien determination as a prognostic indicator of a 1 year mortality after acute myocardial infarction. Circulation 89, 1573 1579. Ong A C M Jowett T P Firth J D Burton S Karet F E and Fine L G. (1995). An endotheli n 1 mediated autocrine growth loop involved in human renal tubular regeneration. Kidney Int 48 390 401. Osathanodh, V., and Potter, E.L. (1963). Development of human kidney as shown by microdissection. iii formation and interrelationship of collecting tub ules and nephrons. Arch Pathol 76, 290 302. Pacher, R., Stanek, B., Hulsmann, M., Koller Strametz, J., Berger, R., Schuller, M., Hartter E Ogris E Frey B Heinz G and Maurer G. (1996). Prognostic impact of big endothelin 1 plasma concentrations compared with invasive hemodynamic evaluation of severe heart failure. J Am. Coll. Cardiol 27, 633 641. Pandey P Brors B Srivastava P K Bott A Boehn S N Groene H J and Gretz N. (2008). Microarray based approach identifies microRNAs and their target functional patterns in polycystic kidney disease. BMC Genomics 23 624.

PAGE 165

165 Pastorelli, L.M., Wells, S., Fray, M., Smith, A., Hough, T., Harfe, B.D., McManus, M.T., Smith, L., Woolf, A.S., Cheeseman, M., and Greenfield, A. (2009). Genetic analyse s reveal a requirement for Dicer1 in the mouse urogenital tract. Mamm Genome 20, 140 151. Petillo D Kort E J Anema J Furge K A Yang X J and The, B T (2009). MicroRNA profiling of human kidney cancer subtypes. Int J Oncol 35 109 1 14 Plato C Pollock D and Garvin J. (2000). Endothelin inhibits thick ascending limb chloride flux via ETB receptor mediated NO release. Am J Physiol Renal Physiol 279 F326 F333. Preisig Muller R Mederos y Schnitzler, M Derst C and Daut J. (1999). Se paration of cardiomyocytes and coronary endothelial cells for cell specific RT PCR. Am J Physiol Heart Circ Physi ol 277 H413 H416 Rao, P.K., Missiaglia, E., Shields, L., Hyde, G., Yuan, B., Shepherd, C.J., Shipley, J., and Lodish H.F. (2010). Distinct ro les for miR 1 and miR 133a in the proliferation and differentiation of rhabdomyosarcoma cells. FASEB J 24, 3427 3437. Reeves, W., Caulfield, J.P., and Farquhar M.G. (1978). Differentiation of epithelial foot processes and filtration slits: sequential appe arance of occluding junctions, epithelial polyanion, and slit membranes in developing glomeruli. Lab Invest 39, 90 100. Reimunde, F.M., Castaares, C., Redondo Horcajo, M., Lamas, S., and Rodrguez Pascual, F. (2005). Endothelin 1 expression is strongly re pressed by AU rich elements in the 3' untranslated region of the gene Biochem J 387, 763 772. Sakurai, T., Yanagisawa, M., Takuwa, Y., Miyazaki, H., Kimura, S., Goto, K., and Masaki, T. (1990). Cloning of a cDNA encoding a non isopeptide selective subtype of the endothelin receptor. Nature 348, 732 735. Sayegh, R., Auerbach, S.D., Li, X., Loftus, R.W., Husted, R.F., Stokes, J.B., and Thomas, C.P. (1999). Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans activation of a hormone response element in the 5' flanking region of the human epithelial sodium channel alpha subunit gene. J Biol Chem 274,12431 12437. Saxn, L., and Sariola, H. (1987). Early organogenesis of the kidney. Pediatr Nephrol 1, 385 3 92. Schneider, M.P., Boesen, E.I., and Pollock, D.M. (2007). Contrasting a ctions of e ndothelin ETA and ETB r eceptors in c ardiovascular d isease Annu Rev Pharmacol Toxicol 47, 731 759.

PAGE 166

166 Schramek H Gstraunthaler G Willinger C C and Pfaller W. (1993). Hyperosmolality regulates endothelin release by Madin Darby canine kidney cells. J Am Soc Nephrol 4 206 213 Schwarz D S Hutvgner G Du T Xu Z Aronin N and Zamore P D. (2003). Asymmetry in the assembly of the RNAi enzyme complex. C ell 115, 199 208. Sequeira Lopez M L and Gomez R A. (2010). Novel mechanisms for the control of renin synthesis and release. Curr Hypertens Rep 12 26 32 Shyamala, V. Moulthrop, T.H.M., and Stratton Thomas, J. (1994). Two distinct human endothelin B re ceptors generated by alterative splicing from a single gene. Cell Mol Biol Res 40, 285 296. Smalheiser, N.R. (2003). EST analyses predict the existence of a population of chimeric microRNA precursor mRNA transcripts expressed in normal human and mouse tiss ues. Genome Biol 4 403 Staniloae, C., Dupuis, J., White, M., Gosselin, G., Dyrda, I., Bois, M., Crpeau J Bonan R Caron A and Lavoie J. (2004). Reduced pulmonary clearance of endothelin in congestive heart failure: a marker of secondary pulmonar y hypertension. J Card Fail 10, 427 432. Stow, L.R., Gumz, M.L., Lynch, I.J., Greenlee, M.M., Rudin, A., Cain, B.D., and Wingo, C.S. (2009). Aldosterone modulates steroid receptor binding to the endothelin 1 gene (edn1). J Biol Chem 284, 30087 30096. Stow L.R., Voren, G.E., Gumz, M.L., Wingo, C.S., and Cain, B.D. (2012). Dexamethasone stimulates endothelin 1 gene expression in renal collecting duct cells. Steroids 77, 360 366. Stow, L.R., Jacobs, M.E., Wingo, C.S., and Cain, B.D. (2011). Endothelin 1 gene regulation. FASEB J 25, 16 28. Strachan F E Spratt J C Wilkinson I B Johnston N R Gray G A and Webb D J. (1999). Systemic blockade of the endothelin B receptor increases peripheral vascular resistance in healthy men. Hypertension 33 581 5 8 5. Strait K.A., Stricklett, P.K., Kohan, R.M., and Kohan, D.E. (2010). Identification of two nuclear factor of activated T cells (NFAT) response elements in the 5' upstream regulatory region of the ET 1 promoter. J Biol Chem 285, 28520 28528. Sui W Zou H Zou G Yan Q Chen H Che W and Xie, S. (2008).Clinical study of the risk factors of insulin resistance and metabolic syndrome after kidney transplantation. Transpl Immunol 20, 95 9 8.

PAGE 167

167 Suzuki T Kumazaki T and Mitsui Y. (1993). Endothel in 1 is produced and secreted by neonatal rat cardiac myocytes in vitro. Biochem Biophys Res Commun 191 823 830. Sweizer, A., Valdenaire, O., Nelbock, P., Deuschle, U., Dumas Milne Edwards, J.B., Stumpf, J.G., and Loffler, B.M. (1997). Human endothelin c onverting enzyme 1 (ECE 1): three isoforms with distinct subcellular localizations. Biochem J 328, 871 877. Terada, Y., Tomita, K., Nonoguchi, H., and Marumo, F. (1993). PCR localization of angiotensin II receptor and angiotensinogen mRNAs in the kidney. Kidney Int 43, 1251 1259. Tepe, G., Brehme, U., Seeger, H., Raschack, M., Claussen, C.D., and Duda, S.H. (2002). Endothelin A receptor antagonist LU 13525 inhibits hypercholesteremia induced, but not deendothelialization induced, atherosclerosis in rabbit arteries. Invest Radiol 37, 349 355. Todd Turla K M Chen M Kretzler M Rose D Smart A Yu T Zhu X Fehes Toth G Briggs J P and Schnermann J. (1994). Synthesis and polarized secretion of endothelin in a cortical collecting duct cell line (M1). Hypertension 24 408. Tran U Zakin L Schweickert A Agrawal R Dger R Blum M De Robertis E M and Wessely O. (2010). The RNA binding protein bicaudal C regulates polycystin 2 in the kidney by antagonizing miR 17 activity. De velopment 137 1107 11 16 Treiber F A Jackson R W Davis H Pollock J S Kapuku G ,Mensah G A and Pollock D M. (2000). Racial differences in endothelin 1 at rest and in response to acute stress in adolescent males. Hypertension 35 722 725. Turner AJ, Murphy LJ. (1996). Molecular pharmacology of endothelin converting enzymes. Biochem Pharm 51: 91 102. Vassileva, I., Mountain, C., and Pollock, D.M. (2003). Functional role of ETB receptors in the renal medulla. Hypertension 41, 1359 1363. Val encia Sanchez M A Liu J Hannon G J and Parker R. (2006). Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev 20 515 5 24.

PAGE 168

168 Vlachojannis J G Tsakas S Petropoulou C Goumenos D S and Alexandri S. (2002). Endothel in 1 in the kidney and urine of patients with glomerular disease and proteinuria.Clin Nephrol 58: 337 343 von Brandenstein, M., Depping, R., Schfer, E., Dienes, H.P., and Fries, J.W. (2011). microRNA 15a release as part of endothelin signaling. Biochim Biophys Acta 1813, 1793 1802. Wagner O F Christ G Wojta J Vierhapper H Parzer S Nowotny P J Schneider B Waldhusl W and Binder B R. (1992). Polar secretion of endothelin 1 by cultured endothelial cells. J Biol Chem 267 16066 1606 8 Wang B Li S Qi H H Chowdhury D Shi Y and Novina C D. (2009). Distinct passenger strand and mRNA cleavage activities of human Argonaute proteins. Nat Struct Mol Biol 16 1259 12 66 Wang G Kwan B C Lai F M Choi P C Chow K M Li P K and Szeto C C. (2010). Intrarenal expression of miRNAs in p atients with hypertensive nephrosclerosis. Am J Hypertens 23 78 84 Wang, K., Lin, Z.Q., Long, B., Li, J.H., Zhou, J., and Li, P.F. (2011). Cardiac hypertrophy is positively regulated by microRNA miR 23a. J Biol Chem 287, 589 599. Wang, Y., Medvid, R., Mel ton, C., Jaenisch, R, and Blelloch, R. (2007). DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self renewal. Nature Genet 39, 380 385. Am J P hysiol Regul Integr Comp Physiol 298, 254 260. Welch, A.K., Jacobs, M.E., Wingo, C.S., and Cain, B.D. (2013). Early progress in epigenetic regulation of endothelin pathway genes. Br J Pharmacol 168, 327 334. Wendel M Knels L Kummer W Koch T. (20 06). Distribution of endothelin receptor subtypes ETA and ETB in the rat kidney J Histochem Cytochem 54 1193 1 203 Wong, S., Brennan, F.E., Young, M.J., Fuller, P.J., and Cole, T.J. (2007). A Direct Effect of Aldosterone on Endothelin 1 Gene Expression i n Vivo. Endocrinol 148, 1511 1517. Xu, D., Emoto, N., Giaid, A., Slaughter, C., Kaw, S., deWit, D., and Yanagisawa, M. (1994). ECE 1: a membrane bound metalloprotease that catalyzes the proteolytic activation of big endothelin 1. Cell 78, 473 485.

PAGE 169

169 Yeliga r, S., Tsukamoto, H., Kalra, V.K. (2009). Ethanol induced expression of ET 1 and ET BR in liver sinusoidal endothelial cells and human endothelial cells involves hypoxia inducible factor 1alpha and microRNA 199. J Immunol 183, 5232 5243. Yi R Doehle B P Qin Y Macara I G and Cullen B R. (2005). Overexpression of exportin 5 enhances RNA interference mediated by short hairpin RNAs and microRNAs. RNA 11 220 22 6 Zeidel M L Brady H R Kone B C Gullans S R and Brenner B M. (1989). Endothel in, a peptide inhibitor of Na + K + ATPase in intact tubular epithelial cells. Am J Physiol Cell Physiol 257 C1101 C1107. Zeng Y and Cullen B R. (2005). Efficient processing of primary microRNA hairpins by Drosha requires flanking nonstructured RNA seque nces. J Biol Chem 280 27595 27 603 Zochodne D W Ho L T and Gross P M. (1992). Acute endoneurial ischemia induced by epineurial endothelin in the rat sciatic nerve. Am J Physiol 263 H1806 H 1810

PAGE 170

170 BIOGRAPHICAL SKETCH Mollie Jacobs was born in May field Height s Ohio in 1982. She grew up in Orlando, FL where she attended the Center for International Studies magnet program at Dr. Phillips High School, where she specialized in both German and Japanese language and culture. After graduating, Mollie wa s selected to participate as a Congress Bundestag Youth Exchange Scholar, and spent a year living in Iserlohn, Germany After returning from Germany, Mollie attended Valencia College from 2001 2003 and, due to a love of b iology and a decided dislike of b usi ness a ccounting, she decided to change the focus of her undergraduate studies from i nternational b usiness m anagement to m icrobiology. Following this decision, she transferred to the University of Florida in 2003 While an undergraduate at the University of Florida Mollie had the opportunity to start working in the Cain laboratory. Mollie graduated from the University of Florida in 2006 with a Bachelor of Science d egree in m icrobiology and c ell s cience. In 2007 Mollie started the Interdisciplinary Program an d returned to the l aboratory of Dr. Brian D. Cain where her doctoral dissertation research focused on the post transcriptional regulation of Edn1 mRNA.