<%BANNER%>

Human Parvovirus B19 Expression in Thyroid Disease Correlates with Increased Inflammation

Permanent Link: http://ufdc.ufl.edu/UFE0045213/00001

Material Information

Title: Human Parvovirus B19 Expression in Thyroid Disease Correlates with Increased Inflammation
Physical Description: 1 online resource (163 p.)
Language: english
Creator: Adamson, Laura A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: b19 -- cancer -- il-6 -- parvovirus -- thyroid
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Parvovirus B19 is a small, ubiquitous virus that persists in many human tissues. B19 has been detected in thyroid tissues in general and thyroid tumors in particular, but little is known about its effects on the thyroid microenvironment. The goal of this study was to better characterize B19 persistence in thyroid, and determine what effects this persistence has on thyroid diseases such as cancer. The hypothesis was that B19infects and expresses more efficiently in thyroid cancer tissues and cells and alters thyroid cellular inflammatory cytokine production. The specific aims were 1) to determine the B19 infection status of a large cohort of PTC, ATC, and other thyroid cancers and tissues, 2)to determine the ability of B19 to infect, express, and alter cytokine expression in vitro, and 3) to determine the effect of B19 infection and expression on thyroid disease and inflammation in vivo. Standard molecular and cellular methods were employed including but not limited to nested PCR, RT-PCR, qPCR, qRT-PCR, IHC, Southern and Western blotting, plasmid transfection, flow cytometry, and ELISA.   Results from archived FFPE thyroid tissues demonstrated no differences in the overall detection rate ofB19 DNA and protein among normal and cancer tissues though there were clear differential intensities and patterns of staining that distinguished normal vs.cancer tissues. B19 co-receptors were more frequently detected in benign and tumor-adjacent tissues and on the surface of a cell line derived from normal thyroid tissue; tumor tissues and cell lines derived from them tended to express fewer of these co-receptors. A normal thyroid-derived cell line supported low-level B19 infection and expression of B19 NS1. NS1 expression in thyroid-derived cells resulted in an increase in IL-6 only in the cell line K1 derived from a PTC. A prospective study of tissues and sera derived from 15 subjects with thyroid masses revealed that B19 genome quantification did not differ among thyroid pathologies. Significantly higher levels of NS1 RNA and VP proteins were seen in adenomas and tumors compared to other benign non-adenomatous and autoimmune tissues. B19 capsid protein levels correlated with a significant increase in both circulating and intrathyroidal IL-6 in these disease tissues.  Together, these data support the conclusions that: 1)B19 commonly persists in a wide variety of human thyroid tissues across the spectrum from normal to benign to cancer, 2) normal thyroid cells are likely the initial target of infection leading to persistence with the transition to thyroid adenomas and tumors providing a more supportive cellular milieu for B19 gene expression, and 3)  B19 gene expression leads to up-regulation of local and systemic IL-6 levels in thyroid adenomas and tumors. These studies suggest that B19 infection and gene expression may play a role in thyroid cancer progression via an inflammatory mechanism.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Laura A Adamson.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Hobbs, Jacqueline A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045213:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045213/00001

Material Information

Title: Human Parvovirus B19 Expression in Thyroid Disease Correlates with Increased Inflammation
Physical Description: 1 online resource (163 p.)
Language: english
Creator: Adamson, Laura A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2013

Subjects

Subjects / Keywords: b19 -- cancer -- il-6 -- parvovirus -- thyroid
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Parvovirus B19 is a small, ubiquitous virus that persists in many human tissues. B19 has been detected in thyroid tissues in general and thyroid tumors in particular, but little is known about its effects on the thyroid microenvironment. The goal of this study was to better characterize B19 persistence in thyroid, and determine what effects this persistence has on thyroid diseases such as cancer. The hypothesis was that B19infects and expresses more efficiently in thyroid cancer tissues and cells and alters thyroid cellular inflammatory cytokine production. The specific aims were 1) to determine the B19 infection status of a large cohort of PTC, ATC, and other thyroid cancers and tissues, 2)to determine the ability of B19 to infect, express, and alter cytokine expression in vitro, and 3) to determine the effect of B19 infection and expression on thyroid disease and inflammation in vivo. Standard molecular and cellular methods were employed including but not limited to nested PCR, RT-PCR, qPCR, qRT-PCR, IHC, Southern and Western blotting, plasmid transfection, flow cytometry, and ELISA.   Results from archived FFPE thyroid tissues demonstrated no differences in the overall detection rate ofB19 DNA and protein among normal and cancer tissues though there were clear differential intensities and patterns of staining that distinguished normal vs.cancer tissues. B19 co-receptors were more frequently detected in benign and tumor-adjacent tissues and on the surface of a cell line derived from normal thyroid tissue; tumor tissues and cell lines derived from them tended to express fewer of these co-receptors. A normal thyroid-derived cell line supported low-level B19 infection and expression of B19 NS1. NS1 expression in thyroid-derived cells resulted in an increase in IL-6 only in the cell line K1 derived from a PTC. A prospective study of tissues and sera derived from 15 subjects with thyroid masses revealed that B19 genome quantification did not differ among thyroid pathologies. Significantly higher levels of NS1 RNA and VP proteins were seen in adenomas and tumors compared to other benign non-adenomatous and autoimmune tissues. B19 capsid protein levels correlated with a significant increase in both circulating and intrathyroidal IL-6 in these disease tissues.  Together, these data support the conclusions that: 1)B19 commonly persists in a wide variety of human thyroid tissues across the spectrum from normal to benign to cancer, 2) normal thyroid cells are likely the initial target of infection leading to persistence with the transition to thyroid adenomas and tumors providing a more supportive cellular milieu for B19 gene expression, and 3)  B19 gene expression leads to up-regulation of local and systemic IL-6 levels in thyroid adenomas and tumors. These studies suggest that B19 infection and gene expression may play a role in thyroid cancer progression via an inflammatory mechanism.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Laura A Adamson.
Thesis: Thesis (Ph.D.)--University of Florida, 2013.
Local: Adviser: Hobbs, Jacqueline A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2013
System ID: UFE0045213:00001


This item has the following downloads:


Full Text

PAGE 1

1 HUMAN PARVOVIRUS B19 GENE EXPRESSION IN THYROID DISEASE CORRELATES WITH INCREASED INFLAMMATION By LAURA A. ADAMSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 201 3 Laura A. Adamson

PAGE 3

3 I dedicate this work to my parents, Christine and Lanny Adamson, who have supported me throughout bot h my struggles and accomplishments, and always encouraged me to keep working towards my dreams.

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my mentor, Dr. Jacqueline Hobbs, for her constant support and guidance during my graduate career and for allowing m e the opportunity to be creative and grow as a scientist. I would also like to thank my committee members Dr. Michael Clare Salzler, Dr. Maureen Goodenow, Dr. Michael Kilberg, and Dr. Arun Srivastava for their insightful comments and suggestions. A second thanks to Dr. Arun Srivastava for providing the p6 promoter plasmid for all luciferase experiments. I would also like to thank the laboratories of Dr. Peter Sayeski for the use of their luminometer and Dr. Harry Nick for the use of their Real Time machine, and Sarah Barilovits for helping me run all my real time experiments. A special thanks also goes to Monica Polcz for being as excited about B19 research as I am, and for helping with anything and everything in the laboratory. I also thank Marda Jorgenson in the Cell and Tissue Analysis Core for assisting me in troubleshooting protocols, letting me stay late to finish experiments, and helping to keep me positive when I hit bumps in the road, and Neal Benson for his assistance in running flow cytometry exper iments. I am especially grateful for Meghan Soustek, machine or protocols that I wa nted to try. I would like to thank Jason Small for listening and being supportive through this journey Last, I would like to thank my parents, Lanny

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTERS 1 INTRODUCTION ................................ ................................ ................................ .... 16 Parvovirus B19 ................................ ................................ ................................ ....... 16 The Parvoviridae Family ................................ ................................ ................... 16 Viral Genome ................................ ................................ ................................ ... 16 Tissue Tropism ................................ ................................ ................................ 18 Parvoviruses and Tumor Cells ................................ ................................ ......... 19 Viral Immune Response ................................ ................................ ................... 19 Parvovirus B19 Associated Disease ................................ ................................ 20 Thyroid Cancer and Disease ................................ ................................ .................. 21 Thyroid Disease ................................ ................................ ............................... 21 Benign disorders and adenomas ................................ ............................... 22 Thyroiditis and thyroid autoimmune disease ................................ .............. 23 Thyroid Carcinomas ................................ ................................ ......................... 24 Cytok ine Expression in Thyroid Disease ................................ .......................... 26 Thyroid Disorders and Parvovirus Infection ................................ ............................ 26 Parvovirus Infection of the Thyroid ................................ ................................ ... 26 B19 and Thyroid Disorders ................................ ................................ ............... 27 2 HYPOTHESES AND SPECIFIC AIMS ................................ ................................ .... 29 3 MATER IALS AND METHODS ................................ ................................ ................ 30 Materials ................................ ................................ ................................ ................. 30 Cell Lines ................................ ................................ ................................ .......... 30 Archived Tissue ................................ ................................ ................................ 30 Matched Tissue and Blood ................................ ................................ ............... 31 Methods ................................ ................................ ................................ .................. 31 Nucleic Acid Extraction in FFPE Tissues ................................ .......................... 31 Nucleic Acid Extraction in Fine Needle Aspirates and Flash Frozen Tissue .... 32 Nested PCR ................................ ................................ ................................ ..... 32 Reverse Transcriptase PCR (RT PCR) ................................ ............................ 33

PAGE 6

6 Real Time Quantification ................................ ................................ .................. 33 Southern Blottin g ................................ ................................ .............................. 34 Flow Cytometry ................................ ................................ ................................ 36 B19 Infection of N Thy Ori 3.1 ................................ ................................ .......... 36 Immunof luorescent Staining of Virally Infected Cells ................................ ........ 37 Immunohistochemical (IHC) Detection ................................ ............................. 37 Positive Pixel Quantification ................................ ................................ ............. 38 B19 IgG/ IgM EIA and Western Blot ................................ ................................ 39 Cytokine Quantification in Cell Lines ................................ ................................ 40 Cytokine and Hormone Detection in Patient Serum ................................ ......... 41 Cloning of p6 and CMV Luciferase Plasmids ................................ ................... 41 Luciferase Promoter Activ ity ................................ ................................ ............. 42 Statistical analyses ................................ ................................ ........................... 43 4 PARVOVIRUS B19 INFECTION IN A WIDE RANGE OF THYROID DISEASES ... 46 B19 DNA and RNA Detection in Flash Frozen Tissue Samples and Matched Serum ................................ ................................ ................................ .................. 46 Viral DNA and RNA Detection in a Variety of Thyroid Tissue ................................ 47 Protein Detection and Localization in Both Normal and Tumor Tissue ................... 48 B19 Co Receptors are Detected in Normal Thyroid Tissue ................................ .... 49 Conclusions ................................ ................................ ................................ ............ 49 5 EXPRESSION OF PARVOVIRUS B19 IN THYROID CELLS CORRELATES WITH INCREASED IL 6 EXPRESSION AND SECRETION IN VITRO ................... 57 Expression of B19 Co Receptors on Thyroid Cells In Vitro ................................ ..... 57 B19 Infection of Normal Thyroid Follicular Cells ................................ ..................... 58 Incre ase in IL 6 and TNF Transfection ................................ ................................ ................................ ......... 59 B19 p6 Promoter Activity in Thyroid Derived Cells ................................ ................. 59 Conclusions ................................ ................................ ................................ ............ 60 6 PERSISTENCE OF PARVOVIRUS B19 IN THYROID DISEASE CORRELATES WITH INCREASED IL 6 EXPRESSION AND CIRCULATION IN VIVO .................. 66 Circulating B19 Specific Antibodies Do Not Correlate With Thyroid Disease ......... 66 Similar Amounts of B19 DNA are Detected in Thyroid Tissue and Blood ............... 68 Increased B19 Gene Expression in Thyroid Tumors and Adenomas ..................... 69 B19 Expression in the Thyroid Correlates to Increased IL 6 Expression ................ 70 Conclusions ................................ ................................ ................................ ............ 72 7 DISCUSSION ................................ ................................ ................................ ......... 85 B19 Infection and Persistence in the Thyroid ................................ .......................... 85 Parvovirus Persistence ................................ ................................ ........................... 86 Parvovirus B19 Activity in Tumors ................................ ................................ .......... 87 Role of B19 in Thyroid Disease ................................ ................................ .............. 89

PAGE 7

7 Models of Parvovirus B19 Infection ................................ ................................ ........ 89 Parvovirus B19 in vitro ................................ ................................ ...................... 90 Parvovirus B19 in vivo ................................ ................................ ...................... 90 Limitations and Difficulties with B19 Related Methods ................................ ........... 91 Nested PCR Detection o f Viral DNA ................................ ................................ 91 Detection of B19 Antibodies in Serum ................................ .............................. 92 Specificity of B19 Antibodies Used in Research ................................ ............... 93 Conclusions ................................ ................................ ................................ ............ 94 8 FUTURE STUDIES ................................ ................................ ................................ 96 Effects of NS1 in Thyroid Autoimmune Disease ................................ ..................... 96 B19 Correlation with Thyroid Signaling Pathways ................................ .................. 97 Co Infection with Activating or Inhibitory Viruses ................................ .................... 98 Conclusions ................................ ................................ ................................ ............ 99 APPENDIX A NS1 EFFECT IN THYROID CELL IN VITRO ................................ ........................ 100 Introduction ................................ ................................ ................................ ........... 100 Methods ................................ ................................ ................................ ................ 100 NS1 Transfection of Cell Lines ................................ ................................ ....... 100 Analysis of Cell Death ................................ ................................ .................... 101 Quantification of Cytokine Secretion ................................ .............................. 101 Results ................................ ................................ ................................ .................. 101 NS1 Does Not Strongly Induce Apoptosis in Thyroid Derived Cells ............... 101 The Effects of NS1 are Strongest in PTC Derived K1 ................................ .... 102 Conclusions ................................ ................................ ................................ .......... 103 B DILUTION CLONING OF THYROID CELL LINES ................................ ............... 108 Introduction ................................ ................................ ................................ ........... 108 Methods ................................ ................................ ................................ ................ 108 Generation of Dilution Clones ................................ ................................ ......... 108 Calculating Doubling Times ................................ ................................ ............ 109 nPCR for B19 DNA ................................ ................................ ......................... 109 Storage ................................ ................................ ................................ ........... 110 Results ................................ ................................ ................................ .................. 110 Discus sion ................................ ................................ ................................ ............ 111 C DETECTION OF PARVOVIRUS B19 CAPSID PROTEINS IN TESTICULAR TISSUE ................................ ................................ ................................ ................. 115 Peer reviewed Publication ................................ ................................ .................... 115 Introduction ................................ ................................ ................................ ........... 115 Materials and Methods ................................ ................................ .......................... 117 Samples ................................ ................................ ................................ ......... 117

PAGE 8

8 Immunohistochemistry (IHC) ................................ ................................ .......... 118 Polymerase Chain Reaction (PCR) ................................ ................................ 119 Results ................................ ................................ ................................ .................. 120 Detection of B19 capsid proteins in testis tissues ................................ ........... 120 Detection of B19 DNA ................................ ................................ .................... 121 Discussion ................................ ................................ ................................ ............ 122 D INCREASED IL 6 DETECTION IN DULT AND PEDIATRIC LYMHPOID TISSUES HARBORING PARVOVIRUS B19 ................................ ........................ 132 Peer reviewed Publication ................................ ................................ .................... 132 Introduction ................................ ................................ ................................ ........... 132 Materials and Methods ................................ ................................ .......................... 134 Sampl es ................................ ................................ ................................ ......... 134 Immunohistochemistry (IHC) ................................ ................................ .......... 134 Results ................................ ................................ ................................ .................. 135 Detection of B 19V VP1/VP2 in lymphomas ................................ .................... 135 Detection of IL 6 ................................ ................................ ............................. 136 Detection of cellular receptor (P antigen) and co r B19V ................................ ................................ ................................ ........... 137 Discussion ................................ ................................ ................................ ............ 138 LIST OF REFERENCES ................................ ................................ ............................. 149 BIOGRAPHICAL SK ETCH ................................ ................................ .......................... 163

PAGE 9

9 LIST OF TABLES Table page 3 1 Primers used for nucleic acid amplification ................................ ......................... 44 4 1 Results of tissue and serum analysis for B19 in five PTC subjects .................... 51 4 2 B19 nucleic acid and protein detection in FFPE tumors. ................................ .... 52 6 1 Subject information and B19 IgG and IgM detection in serum by ELISA and Western blot. ................................ ................................ ................................ ...... 73 6 2 Summary of cytokines, TSH, and B19 antibodies in serum and B19 DNA and protein detect ion in subjects with thyroid disease. ................................ .............. 74 C 1 Given ages and pathologies of Biochain tissue sections and corresponding IHC data. ................................ ................................ ................................ .......... 127 D 1 Subject information and IHC results. ................................ ................................ 142

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Map of Parvovirus B19 genome, promoter, and proteins. ................................ .. 17 3 1 Quantitative Real Time PCR for B19 ................................ ................................ 45 4 1 B19V nucleic acid detection in five PTC tumors and serum. .............................. 53 4 2 Viral nucleic acid d etection in FFPE tissues ................................ ....................... 54 4 3 Capsid protein localization varies between tissues. ................................ ............ 55 4 4 Antigen detection in normal thyroid tissue s ................................ .... 56 5 1 P Antigen, in vitro ................................ ..................... 61 5 2 B19V entry and expression in normal thyroid cells. ................................ ............ 62 5 3 Quantification of increase in TNF 6 secretion following NS1 transfection. ................................ ................................ ................................ ........ 63 5 4 Comparison of TNF 6 in thyroid cells. ................................ .................. 64 5 5 Relative p6 luciferase expressi on values normalized to CMV at 48 hours post transfection. ................................ ................................ ................................ 65 6 1 Western strips detecting B19 IgG (A) and IgM (B) antibodies in subject serum. ................................ ................................ ................................ ................ 75 6 2 B19 DNA detection and quantification in thyroid tissue. ................................ ..... 76 6 3 B19 genome copy numbers were quantified serum samples from each subject as shown by markers in each group. ................................ ...................... 77 6 4 B19 DNA detection and quantification in normal and tumor thyroid fine needle aspirates. ................................ ................................ ................................ 78 6 5 Increase in NS1 RNA in thyroid adenoma and tumor tissue ............................... 79 6 6 B19 protein detection and quantification in thyroid tissue. ................................ .. 80 6 7 Correlation of B19V capsid protein and IL 6 staining within thyroid tissue ........ 81 6 8 Representation of p ositive pixel analysis for B19 and IL 6 detection in thyroid tissues ................................ ................................ ................................ ............... 82 6 9 Serum cytokine levels in subjects with B19 protein expression in the thyroid as measured by IHC ................................ ................................ ........................... 84

PAGE 11

11 7 1 Model of B19V interaction in thyroid disease. ................................ ..................... 95 A 1 Decreased cell numbers in Daoy bu t not K1 following NS1 Transfection ......... 104 A 2 Lack of apoptosis in PTC derived K1 ................................ ................................ 105 A 3 Expression of NS1 in thyroid derived cel ls ................................ ....................... 106 A 4 Alterations in cytokine secretion 24 hours following NS1 transfection in thyroid cells ................................ ................................ ................................ ....... 107 B 1 TT dilution clone char acteristics ................................ ................................ ....... 112 B 2 Doubling time of 3 K1 dilution clones. ................................ ............................... 113 B 3 B19V nucleic acid detection in SW579 dilution clones. ................................ .... 114 C 1 Variation in IHC staining of B19 capsid protein ................................ ................. 128 C 2 Positive B19 staining of immune cells in testis tissues ................................ ..... 130 C 3 PCR Detection of B19 DNA ................................ ................................ .............. 131 D 1 Patterns of B19V staining and IL 6 production. ................................ ................ 146 D 2 Differential 5 1 integrin and P antigen membrane staining ........................... 147 D 3 Overall Correlation of B19V versus IL 6 Staining ................................ ............. 148

PAGE 12

12 LIST OF ABBREVIATIONS AAV Adeno associated Virus AN Adenomatoid nodule ATC Anaplastic thyroid carcinoma ELISA Enzyme linked immunosorbent assay B19 Parvovirus B19 FBS Fetal Bovine Serum FNA Fine needle aspiration FFPE Formalin fixed, paraffin embedded FTC Follicular thyroid carcinoma FVP Follicular varia nt of papillary carcinoma HCA H rthle cell adenoma HCC H rthle cell carcinoma HT HYP Hyperplastic nodule Interferon gamma IHC Immunohistochemistry IL 6 Interleukin 6 MTC Medullary thyroid carcinoma MVM Minute virus of mouse NS1 Nonstructural protein PCR Polymerase Chain Reaction PTC Papillary thyroid carcinoma qPCR Quantitative PCR

PAGE 13

13 qRT PCR Quantitative r eal time reverse transcriptase PCR SSC S aline sodium citrate SDS Sodium dodecyl sulfate T3 Triiodothyronine T4 Thyroxine Tg Thyroglobulin THR Thyroid hormone receptor TNF Tumor necrosis factor alpha TPO T hyroid peroxidase TSH Thyroid stimulating hormone VP Viral protein ( B19 capsid)

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy HUMAN PARVOVIRUS B19 GENE EXPRESSI ON IN THYROID DISEASE CORRELATES WITH INCREASED INFLAMMATION By Laura A. Adamson May 2013 Chair: Jacqueline A. Hobbs Major: Medical Sciences Immunology and Microbiology Parvovirus B19 is a small, ubiquitous virus that persists in many human tissues. B 19 has been detected in thyroid tissues in general and thyroid tumors in particular but little is known about its effects on the thyroid microenvironment The goal of this study was to better characterize B19 persistence in thyroid and determine what eff ects this persistence has on thyroid disease s such as cancer The hypothesis was that B19 infects and express es more efficiently in thyroid cancer tissues and cells and alters thyroid cellular inflammatory cytokine production The specific aims were 1) t o determine the B19 infection status of a large cohort of PTC, ATC, and other thyroid cancers and tissues 2) t o determine the ability of B19 to infect, express, and alter cytokine expression in vitro and 3) t o determine the effect of B19 infection and expr ession on thyroid disease and inflammation in vivo Standard molecular and cellul ar methods were employed including but not limited to nested PCR, RT PCR, qPCR, qRT PCR, IHC, Southern and W estern blotting, plasmid transfection, flow cytometry, and ELISA.

PAGE 15

15 Results from archived FFPE thyroid tissues demonstrated no differences in the overall detection rate of B19 DNA and protein among normal and cancer tissues though there were clear differential intensities and patterns of staining that distinguished normal v s cancer tissues. B19 co receptors were more frequently detected in benign and tumor adjacent tissues and on the surface of a cell line derived from normal thyroid tissue; tumor tissues and cell lines derived from them tended to express f ewer of these co receptors. A normal thyroid derived cell line supported low level B19 infection and expression of B19 NS1. NS1 expression in thyroid derived cells resulted in an increase in IL 6 only in the cell line K1 derived from a PTC. A prospective study of tissues and sera derived from 15 subjects with thyroid masses revealed that B19 genome quantitation did not differ among thyroid pathologies. Significantly higher levels of NS1 RNA and VP proteins were seen in adenomas and tumors compared to other benign non aden omatous and autoimmune tissues. B19 capsid protein levels correlated with a significant increase in both circulating and intrathyroidal IL 6 in these disease tissues Together, these data support the conclusions that : 1) B19 commonly persists in a wide va riety of human thyroid tissues across the spectrum from normal to benign to cancer 2) normal thyroid cells are likely the initial target of infection leading to persistence with the transition to thyroid adenomas and tumors providing a more supportive cel lular milieu for B19 gene expression, and 3) B19 gene expression leads to up regulat ion of local and systemic IL 6 levels in thyroid adenomas and tumors. Th ese studies suggest that B19 infection and gene expression may play a role in thyroid cancer progre ssion via an inflammatory mechanism.

PAGE 16

16 CHAPTER 1 INTRODUCTION Parvovirus B19 The Parvoviridae Family The Parvoviridae family is a group of small (18 26nm), nonenveloped, single stranded DNA viruses that infect a wide variety of hosts either asymptomaticall y or in associat ion with an expanding range of pathologies (Tattersall, 2006). Viral entry into cells is achieved by receptor mediated endocytosis, but trafficking varies between virus families, and uncoating is poorly understood. Replication of this famil y of viruses requires infected cells to be undergoing S phase, with viral replication occurring in the nucleus ( Tijssen et al., 2012) Members of the Parvoviridae family that infect humans include Bocavirus (HBoV), Parvovirus 4 (Parv4), Adeno associated vi rus (AAV), and Parvovirus B19 ( B19 ), of which, to date, B19 is associated with the widest range of parvovirus related illnesses. Viral Genome The viral genome of B19 is 5,596 nucleotides in length and encodes for a large non structural protein (NS1), as w ell as two capsid proteins (VP1 and VP2), of which VP1 contains a unique region referred to as VPU. B19 is also known to encode two smaller proteins: an 11 kDa and 7.5 kDa protein of which the functions are not entirely known (Heegaard and Brown, 2002). G ene expression is control led by a single promoter, p6, located at map unit 6 of the viral genome (Brown, 2006). There are 3 different genome variants with little variability between strains seen in the capsid seque nce (Erdman et al., 1996). Of genomes 1, 2 and 3, genotype 1 is the pre dominant strain (Young and Brown, 2004).

PAGE 17

17 Figure 1 1 Map of Parvovirus B19 genome, promoter, and proteins. In permissive cells, the right side of the genome encoding the capsid mRNA is expresse d in greater amounts to allow for packaging (Astell et al., 1997). In comparison, nonpermissive cells predominately express the left side of the genome, overexpressing NS1 mRNA (Liu et al., 1992). There are a variety of functions associated with NS1 expres sion. During replication, NS1 has been shown to act as a nickase and helicase, and is essential for trans activation of the p6 promoter and essential for gene production (Astell et al., 1997). In nonpermissive cells, NS1 expression has been shown to activa te multiple pathways including both NF B and STAT3 (Duechting et al., 2008). Following expression, multiple effects have been seen in B19 NS1 transfected cells in vitro These cells have been shown to undergo apoptosis through a caspase 3 dependent pathwa y (Moffatt et al., 1998), upregulate both IL 6 and TNF (Fu et al., 2002; Moffatt et al., 1996), and halt cell cycle progression at G1 (Morita et al., 2003). NS1 has also been shown to transactivate other viral promoters besides p6, including the HIV LTR (Sol et al., 1993). Cellular factors can also be bound by NS1, including the Sp1/Sp3 transcription factors (Raab et al., 2002). Little is known about the other nonstructural proteins, 11 kDa and 7.5 kDa, but reports

PAGE 18

18 have implicated them in replication ca psid protein production and apoptosis (Zhi et al., 2006). Tissue Tropism B19 has three known co receptors : P antigen also called globoside 5 1 integrin and Ku80 ( Brown et al., 1993; Weigel Kelley et al., 2003; Munakata et al., 2005 ). B19 DNA has been detected in a wide variety of tissues, but permissive infection is believed to be restricted to erythroid precursor cells (e.g. burst forming units and colony forming units) and possibly an as yet undis covered erythroid specific factor (Munshi et al., 1993) While autonomous replication is, to date, restricted to these cell types, other factors have been shown to assist full replication in nonpermissive cell s Adenovirus, the DNA virus responsible for as sisting with the Parvoviridae family member adeno associated virus (AAV) replication, has been shown to also assist with full replication in vitro in cell lines reported to be nonpermissive for B19 replication (Guan et al., 2009). Furthermore, B19 gene exp ression, independent of replication, can occur in nonpermissive cells. B19 DNA has been detected in a wide range of tissues besides bone marrow derived cells, including brain, heart, skin, synovial fluid, tonsils, testis, colon, liver, and thyroid (Hammon d and Hobbs, 2007; Li et al., 2007; Mori et al., 2007; Norja et al., 2006; Pankuweit et al., 2003; Gray et al., 1998 ). Yet protein expression has been restricted to a subset of these tissues. Persistent capsid protein detection has been seen in the colon, thyroid, skin, and testis (Polcz et al., 2011; Adamson et al., 2011; Wang et al., 2008; Li et al., 2007; Aractingi et al., 1996). Most of these studies focus on detection and localization of the viruses, with little data on the role of B19 in persistent i nfection.

PAGE 19

19 Parvoviruses and Tumor Cells Although little data are available on B19 expression in tumor cells, other parvoviruses have shown increased expression in a tumor environment. Studies have shown that Rat Parvovirus H 1 has minimal effects on viabili ty of nontransformed cells, yet is able to achieve lytic infection in all immortalized neuroblastoma lines examined (Lacroix et al., 2010). MVM cytotoxicity is shown to be enhanced in the presence of c Myc, c Src, and SV40 large T antigen and suppressed in cells immortalized by bovine papillomavirus type 1, indicating that cell susceptibility to parvoviruses may be oncogene specific (Salome et al., 1990). Oncogenes have also been shown to be involved in parvovirus assembly. Raf 1 was responsible for MVM c apsid protein phosphorylation and import into the nucleus. Cells lacking Raf 1 were unable to produce mature progeny vir ions (Riolobos et al., 2010). Viral Immune Response During the course of viral infection, IgM and IgG antibodies can be produced agains t VP1, VP2, and NS1. In a typical course of infection, viremia is detected in the blood by approximately day 6, with titers between 10 10 and 10 13 VP2 specific IgM is produced after about 3 weeks, followed by prolonged VP2 and VP1 specific IgG antibodies ( Modrow and Dorsch, 2002). These IgG antibodies are neutralizing and have been shown to prevent reinfection (Saikawa et al., 1993). While B19 specific antibodies in the serum are usually a marker of acute or previous infection, false negativity of both IgM and IgG serum antibodies has been seen in immunocompromised and high ly viremic patients (Bredl et al., 2011; Eid et al., 2006; Kurtzman et al., 1989). Prevalence of parvovirus B19 IgG seropositivity increases with age, with 30 60% of the

PAGE 20

20 adult population and greater than 85% of the geriatri c population possessing B19 specific IgG (Heegaard and Brown, 2002). Besides humoral immunity, virus specific T cells have been reported following B19 infection. B19 specific CD8+ T cells have been detected with increasi ng frequency for months following acute infection, even following resolution of symptoms (Isa et al., 2005). In viral infection, CD8+ T cells are usually limited to the duration of acute infection (Lauer et al., 2002). The extended detection of CD8+ T cell s in B19 infected individuals is indicative of persistent, low level production of virus or viral proteins (Norbeck et al., 2005). Parvovirus B19 Associated Disease B19 has been shown to be a cause of several, wide ranging human illnesses (Young and Brown, 2004) including aplastic crisis, erythema infectiosum (fifth disease), arthritis, thrombocytopenia, hydrops fetalis, and myocarditis. B19 has also been highly associated with neurological disorders ( Douvoyiannis et al., 2009; Hammond and Hobbs, 2007 ) and autoimmune disorders with symptoms similar to rheumatoid arthritis and lupus erythematosus (Lunardi et al., 2008 ). A link between B19 and other immune disorders such as chronic fatigue syndrome has also been proposed (Jacobson et al., 2007). The role of B19 in autoimmune thyroid dis eases including Graves disease 2010; Lehmann et al., 2008; Mori et al., 2007) has also gained attention more recent ly as B19 antibodies and detection in tissues has been associated with thyroid autoimmune disease diagnosis.

PAGE 21

21 Thyroid Cancer and Disease Thyroid Dis ease Recently, thyroid disease has been reported in approximately 5% of the United States population, with an increased frequency in w oman compared to men. Reports show incidence rates for autoimmune thyroiditis at 5.13%, thyroid nodules at 2.3%, benign goiters at 0.84%, and thyroid carcinomas being detected in 8.7 out of 100,000 people (Golden et al., 2009). Thyroid disease is common i n iodine deficient regions, often resulting in a high prevalence of goiter due to decreased thyroid hormones levels. In areas of sufficient dietary iodine, thyroid autoimmune disorders are more frequently diagnosed (Vanderpump, 2011). Thyroid disease is de tected and diagnosed based on clinical characteristics, age, sex, medical background, and thyroid blood tests (Shaha, 2000). Blood tests measuring TSH, T4, T3, and Free T4 are the most commonly used. Anti thyroid antibodies, including anti TSH, anti TPO, and anti Tg can be an indication of thyroid autoimmune disease (ATA, 2012). Fine needle aspirates (FNA) are also often used in conjunction with blood tests to analyze cell morphology and genetic mutations (Nikiforov et al., 2009). Treatment varies dependi ng on diagnosis, and can include thyroxine therapy, radioiodine therapy, anti thyroid drugs, and/or partial or full thyroidectomy (Hermus and Huysmans, 1998). In benign disorders, total thyroidectomy surgery has increased from 17.6% to 39.6% over the last 10 years, but recurrent hypothyroidism or disease is associated with both partial and full thyroidectomy (Ho et al., 2011). Although the outcome for thyroid disease is usually considered excellent, some patients can develop post treatment hypothyroidism an d in rare cases, permanent recurrent laryngeal nerve

PAGE 22

22 palsy (Efremidou et al., 2009). Because of this, understanding the root of thyroid disease and markers associated with particular diagnoses is essential. Benign d isorders and a denomas Clinically detecta ble thyroid nodules occur in approximately 4 5% of the United States population, with only 10 30% of these nodules being diagnosed as malignant depending on histological determination (Shaha, 2000). Benign thyroid disorders can result from hyperplastic cel ls and often arise as a result of environmental conditions or hormonal changes that lead to altered thyroid function (Perez Montiel and Suster, 2008). T hyroid nodules are often detected incidentally or based on size, and typically do not result in hyper o r hypothyroidism. In approximately 1% of the cases, the nodules can contribute to hyperthyroidism or thyrotoxicosis (Welker and Orlov, 2003) Patients with benign thyroid disorders including goiters and other nodules have an increased risk of developing th yroid cancer, even when symptoms do not persist following treatment of the benign disorder (From et al., 2000). Many of these thyroid disorders can be observed in conjunction with each other, and are primarily diagnosed by histological features, although c hromosomal abnormalities have been linked to adenoma development (Belge et al., 1998). Thyroid adenomas, in comparison to benign nodules, usually result from genetic abnormalities. Although debated, s ome adenomas, such as Follicular and Hrthle cell adeno mas, appear to have the ability to become carcinomas in certain patients (Vasko et al., 2004). In the case of follicular adenoma, molecular testing has shown in one cohort that these adenomas are independent tumors rather than a stage in the development to wards carcinomas (Krause et al., 2011). Recently, genetic testing has

PAGE 23

23 been used to differentiate normal thyroid tissue, adenomas, and carcinomas, showing distinct mRNA profiles within each group (Fontaine et al., 2009). With all this controversy and confli cting data, well validated molecular markers combined with understanding distinct histological features are essential in determining proper diagnoses and treatments, and for predicting progression and recurrence. Thyroiditis and t hyroid a utoimmune d isease Thyroiditis is a broad classification for local inflammation found in the thyroid. These disorders can be chronic or acute, include lymphocytic infiltration, can have a s (HT; Slatosky, et al., 2000). As with other research concerning thyroid disease, thyroiditis as a precursor for thyroid cancer is controversial One study has shown that the RET/PTC rearrangement is linked to PTC cases with previous thyroiditis, while BR AF V600E is not (Muzza, et al., 2010). HT has also been proposed as a possible risk factor or precursor to thyroid cancer, especially PTC (Larson et al., 2007; Antonelli et al., 2007). serum antibodies against the thyroid hormone receptor and excessive production of thyroid thyroid carcinomas and involves anti thyroid drugs, radioactive iodine, or partial or full thyroidectomy ( Weetman, 2000). Unlike many thyroid cancers, there is no single gene mutation associated with 2008). Infection has also been suggested as a predisposing factor for G development (Cooper, 2003).

PAGE 24

24 While there is still no definitive link between thyroiditis or autoimmune disease and development of thyroid cancer, it has been shown that as much as 20% of cancers can be contributed to previous chronic inflamm ation (Mantovani et al., 2008). Understanding the underlying cause of these conditions can better elucidate the link between these thyroid disorders. Thyroid Carcinomas Thyroid cancer accounts for approximately 48,0 2 0 new cancer cases and 1, 74 0 cancer rel at ed deaths annually (Howlader et al., 2012) Nearly 40% of thyroid cancers are not diagnosed until they have spread locally/regionally or metastasized. If diagnosed while locally or regionally spread, the 5 year survival rate is nearly 100%, but that rat e drops to about 60% if metastasized. Though the overall rate of thyroid cancer is low in the general population, it occurs at all ages from childhood to old age. Currently, thyroid cancer accounts for 7.8% of all cancers in those age d 15 19 (Machens et a l., 2010). Women are three times more likely than men to be afflicted. From 1975 2005, the incidence of thyroid cancer, particularly PTC, has increased 2 3 times for reasons that are not completely understood. Increased detection has no doubt contributed (Davies and Gilbert Welch, 2006) Exposure to ionizing radiation, iodine prophylaxis, external beam irradiation, and 131 I have also been put forth as possible reasons, but whether there are other causes, such as viruses, has not been determined. These c ancers can develop from thyroid epithelial cells into papillary carcinomas (PTC), the most prevalent thyroid cancer, follicular carcinomas (FTC), Hrthle cell carcinomas, and the very aggressive anaplastic carcinomas (ATC) and undifferentiated tumors. Some tumors are diagnosed as a combination of these features, such as

PAGE 25

25 follicular variants of papillary cancers (FVP), undifferentiated cancers that arise in PTC tumors, and adenomas with pathological features resembling carcinomas (Wiseman et al., 2003). Tumor s that develop from parafollicular cells are less common and are diagnosed a s medullary carcinomas (MTC). While there is a smaller amount of research available on pediatric thyroid cancers due partly to how rare they are, most tumors appear to follow a si milar course to adult thyroid cancers. One study show ed that children with thyroid cancer who present with metastases tend to be younger than those without (Hamilton et al., 2010). Most thyroid cancers are associated with specific genetic mutations. PTC tu mors are the most common thyroid carcinoma, and have the most well studied genetic profile. These tumors typically have mutation in the RET/RAS/BRAF/MAPK pathway, with specific mutations noted at the BRAF V600E mutation and RET/PTC rearrangement (Giordano et al., 2005). FTC tumors show PAX8 mutations, along with many of the same mutations seen in PTC tumors (Xing, 2005). A recent study has shown that about 10% of recurrent PTCs have double mutations in common PTC related oncogenes whereas primary PTCs usually only have 1 of these m utations (Henderson et al., 2009). Tumors with single oncogene mutations express distinct pathological profiles (Nikiforova et al., 2003). PTCs are typically unencapsulated, express wild type p53, and infiltrate the thyroid gland ( Kikuchi et al., 1997 ) Some PTC variants have distinct histological features and particularly unfavorable prognoses: oxyphilic (Hrthle cell), tall cell, and columnar cell PTCs. Though not all ATC tumors are derived from other follicular tumors, there is a correlation between BR AF mutations in some PTC tumors and subsequent progression to the less differentiated anaplastic tumors (Nikiforova et al., 2003). What drives this

PAGE 26

26 progression to a more aggressive phenotype is currently not known, but mutations of p53 have been found in ATC tumors with BRAF mutations and small areas of tissues with pathological features similar to PTC tumors (Quiros et al., 2005). MTC tumors, in contrast, tend to be hereditary, but also are associated with sporadic gene mutations similar to other thyroid tumors (Fink et al., 1996). Understanding how B19 contribute s to tumor formation or progression will greatly enhance our knowledge of thyroid tumorgenesis. Cytokine Expression in Thyroid Disease In both thyroid cancers and autoimmune disorders, alteration s in cytokine production by thyroid epithelial cells and infiltrating immune cells are associated with specific phenotypes including increased local inflammation, pro or antitumor responses, or increasing cell destruction (Lumachi, et al., 2010). Although the link is still debated, there is some evidence showing an increased risk of thyroid cancer in patients previously diagnosed with autoimmune thyroid disease (Weetman, 2004). IL 6 and IL 8 have both been shown to be increased in both thyroid follicular c ells and lymphocytes in patients with autoimmune thyroid disease (Heuer et al., 1996; Watson et al., 1994). While gene alteration and lymphocytic infiltration are the primary factors involved in cytokine alteration, pathogenic infection has also been sugge sted (Tomer and Davies, 1993). Thyroid Disorders and Parvovirus Infection Parvovirus Infection of the Thyroid T he link between parvoviruses and thyroid disorders has not been firmly established, but data from non human parvoviruses has shown a link betwe en viral infection and thyroid pathways or disease. In a case study involving a porcine

PAGE 27

27 parvovirus, the virus was isolated from pig feces and shown to replicate efficiently in primary porcine thyroid cells, developing cytotoxic features (Yasuhara et al., 1 989). In another study, symptoms resembling parvovirus infection in humans including necrotizing colitis and an enlarged thyroid gland were found in a beaver with thyroid follicular carcinoma and pulmonary metastases (Anderson et al., 1989). Little in vi tro data are available on B19 thyroid interactions, but the related virus, MVM has been more extensively studied. MVM NS1 protein has been shown to increase thyroid ho rmone receptor (THR) expression, and MVM mediated cytotoxicity has been shown to be enha nced in the presence of T3 exclusively in c Ha Ras transformed rat cells (Vanacker et al., 1996; Vanacker et al., 1993) THR is a known oncogene and possible factor in thyroid tumor progression (Fagin, 2005; Puzianowska Kuznicka et al., 2002; Suzuki et al. 2002). The Ras oncogene is not uncommonly mutated in PTC (Nikiforov, 2008), and there is significant literature linking non B19 parvovirus replication with Ras mutations. B19 and Thyroid Disorders Initially several case studies noted a link between t hyroid disease development and B19 infection. The first case of acute B19 infection coinciding with the onset of subacute thyroiditis in a 32 year old woman was reported in 1994 (Vejlgaard and Nielsen, 1994). Munakata et al. ( 2005 ) also showed an associati on of acute B19 infection and thyroid disease. Acute B19 infection was confirmed by serum anti B19 IgM and B19 DNA. Two weeks later the patient disease with symptoms that fluctuated directly with B19 replication. A th ird case study showed B19 persisting in the thyroid of a 37 year old female who had an acute B19

PAGE 28

28 2007). Larger studies have begun to link B19 detection with autoimmu ne thyroid disease. An association of acute B19 infection was reported in a relatively large group age matched control group (N=73; Lehmann et al., 2008). More recently, i n a study of archived tissues from a Chinese cohort B19 infection was found to highly correlate with A strong correlation with B19 detection and PTC has been reported (Wang et al., 2008). Significantly, B19 pro teins w ere not found in other thyroid cancers specifically FTC and MTC B19 infection was assessed in multiple ways, not just by nested PCR, but also by in situ hybridization for DNA and immunohistochemistry for capsid proteins. To date, this is the only group that has published such results strongly associating PTC with B19 infection. We have extended this data in another small cohort (N=29) of PTC and in addition, a small cohort of ATC/undifferentiated tumors (N=3). In particular, we found an even stron ger B19 gene expression signal in ATC compared to PTC (Adamson et al., 2011). These studies suggest that B19 can infect the thyroid, but the sites of persistence and what role B19 plays in thyroid disease has yet to be determined.

PAGE 29

29 CHAPTER 2 HYPOTHESES AND SPECIFIC AIMS Hypotheses: Parvovirus B19 infects and express es more efficiently in thyroid cancer tissues and cells and alters thyroid cellular inflammatory cytokine production Specific Aim # 1 : To determine the B19 infection status of a large cohort o f PTC, ATC, and other thyroid cancers and tissues. Our working hypothesis is that B19 nucleic acids and protein will be detected more frequently in more sever e thyroid cancers in comparison to other benign t hyroid disorders Specific Aim # 2 : To determine t he ability of B19 to infect, express, and alter cytokine expression in vitro Our working hypothesis is that B19 has the capability to infect thyroid cells, and B19 gene expression in these cells will result in increased inflammation. Specific Aim # 3 : To determine the effect of B19 infection and expression on thyroid disease and inflammation in vivo Our working hypothesis is that quantification of B19 detection and gene expression will correlate with an increase in progression from benign disorders to tu mors, and that this increase in vir al gene products will correlate with a change in systemic and local inflammatory cytokines or thyroid hormones.

PAGE 30

30 CHAPTER 3 MATERIALS AND METHODS Materials Cell L ines Six thyroid derived cell lines 8305C from an ATC K1 from a PTC, FTC 133 from a PTC, TT from a MTC, SW579 from a squamous cell carcinoma, and N Thy Ori 3.1 from normal thyroid epithelial cells, and K562 from erythroleukemic cells, were used in this study. 8305C, FTC 133, K1, and N Thy Ori 3.1 were obtai ned from European Collections of Cell Culture (ECACC, Salisbury, UK). TT, SW579, and K562 and were obtained from American Type Culture Collection (ATCC, Manassas, VA). 8305C was grown in Eagles Minimal Essential media supplemented with 2mM glutamine and 1 % nonessential amino acids, K1 in a 2:1:1 mixture of DMEM:Ham's F12:MCDB 105 supplemented with 2mM glutamine, FTC133 in a 1:1 mixture of DMEM:Ham's F12 supplemented with 2mM glutamine, TT in F 12K media, SW579 in Leibovitz's L 15 media N Thy Ori 3.1 in RP MI media supplemented with 2mM glutamine, and K562 in Iscove's Modified Dulbecco's Medium All cell line medias were supplemented with 10% FBS and grown at 37 0 C/5% CO 2 Archived Tissue All tissue was collected following Institutional Review Board (IRB) a pproval, Project #36 2010. Tissues were previously collected with informed consent between 1997 and 2007. 2 20 tissue blocks previously fixed in formalin and embedded in paraffin (FFPE tissues) were selected to represent a wide range of ages and thyroid dia gnoses from the University of Florida Shands Hospital Tissue Repository following pathology confirmation by pathologist Dr. Larry J. Fowler.

PAGE 31

31 Matched Tissue and Blood All tissue was collected following Institutional Review Board (IRB) approval, Project #499 2011 from January 2013 to July 2013 Informed consent was obtained from each subject and blood, serum, and tissue was collected after resection and diagnoses by pathology. Two milliliters of blood was collected in an EDTA tube, DNA was immediately extrac ted using a Qiagen Generation Capture kit and remaining samples were stored at 80 0 C. Six milliliters of blood was collected in a serum separator tube, centrifuged for 10 minutes at 1,200rpm, and serum was removed and stored at 80 0 C. Fine needle aspirate s (FNA) samples were taken by making 5 passes of a 20 gauge needle in both the tumor and normal adjacent tissue and expelled into 500l serum free complete media. FNA samples were smeared on a slide and hematoxylin and eosin stained to confirm cell type. U p to two centimeters of thyroid tissue were sectioned into three pieces: one was stored at 80 0 C and the remaining two were stored in liquid nitrogen. Methods Nucleic Acid Extraction in FFPE Tissues Four 5 m sections were cut from each block and placed in a DNA and RNAase free tube. Tissue was deparaffinized in 1ml xylene followed by 1ml 100% ethanol. DNA was extracted using a Qiagen FFPE DNA or RNA extraction kit according to the (Qiagen, Valencia, CA) For DNA, tissues were dep araffinized in xylene and 100% ethanol. Tissue sections were lysed in Qiagen Buffer ATL with proteinase K at 56 0 C for 1 hour, followed by 90 0 C for 2 hours. Samples were then centrifuged for 15 minutes at 13,200 RPM. Supernatants were transferred to a

PAGE 32

32 DNeas y column, where DNA was captured, washed, and eluted in 100l TE. For RNA, tissues were deparaffinized as above, lysed in buffer PKD, and bound and washed as with DNA using buffers and solutions from the RNeasy kit. All RNA samples were eluted in 20l RNas e free water. Nucleic Acid Extraction in Fine Needle Aspirates and Flash Frozen T issue For FNA cells, tube containing cells in serum free media were centrifuged for 5 minutes at 1,200 rpm. Cells were resuspended in 200l media and DNA was extracted using a Qi agen Generation Capture Column according to the instructions (Qiagen, Valencia, CA). DNA was eluted in 100l elution buffer and stored at 20 0 C. For flash frozen tissues, 25mg (DNA) or 5mg (RNA) of tissue was cut on dry ice and placed in a sterile microcentrifuge tube. DNA was extracted using the Qiagen elution buffer. For RNA, tissue was ground on dry ice using a pestle, resuspended in lysis buffer, and homo genized using a Qiashredder. RNA was then extracted using a in 20l sterile water and treated with DNase for 30 minutes at 37 0 C. Purified DNA was stored at 20 0 C, and RNA was stored at 80 0 C Nested PCR One microgram of DNA was amplified in a 2X Taq Mastermix, 1M forward and reverse primers, and water up to 25l (New England Biolabs, Ipswich, MA). PCR was carried out for 30 rounds with a denaturation temperature of 95 0 C an annealing temperature of 55 0 C and an extension temperature of 68 0 C For the nested round,

PAGE 33

33 internal primers were used with the above method, with 5l of the first reaction being amplified in the second round. Samples were amplified alongside a GAPDH contr ol. All a mplified samples were analyzed on a 3% agarose gel containing ethidium bromide and visualized in a ChemiDoc XRS Universal Hood II under UV light (Bio Rad Hercules, CA ). PCR products were extracted from the agarose gel using a GeneJET Gel Extracti on Kit (Fermentas, Glen Burnie, Maryland ) instructions. Samples were sent to the University of Florida Interdisciplinary Center for Biotechnology Research DNA Sequencing Core facility for direct sequencing. S equences were co mpared to known B19 sequences using the National Center for Biotechnology Information Basic Local Alignment Search Tool (BLAST). Reverse Transcriptase PCR (RT PCR) 1g of RNA was synthesized into cDNA and amplified using a one step RT PCR Mastermix involvi ng an initial reverse transcriptase step for 30 minutes at 42 0 C, followed by PCR amplification as described for DNA All RNA was treated with DNAse [Ambion (Invitrogen), Grand Island, NY] prior to amplification and a no RT control was run alongside each sa mple. Each sample was amplified alongside a GAPDH control. RT PCR products were analyzed on an agarose gel as described above. Real Time Quantification Real time PCR was performed using an iQ5 Real Time iCycler (Bio Rad, Hercules, CA) according the manufac in a 25l final volume consisting of 12.5l 2X SsoFast EvaGreen SYBR mix (Bio Rad), 7.5 l water, and 1.5 l 0.5 m VP 97 forward and reverse primers, and 100ng DNA. For RNA amplification, cDNA was creat ed using 1g of RNA in a 20l final volume

PAGE 34

34 Verso cDNA synthesis kit (Thermo Scientific, Waltham, MA) and 2l of this product was amplified as described above using both VP and NS1 AMP O and AMP K primers Primer seq uences are listed in Table 3 1 Amplification was carried out with an initial denaturation step at 95 0 C for 5 minutes, followed by 40 cycles of denaturation at 95 0 C, annealing at 55 0 C, and extension at 72 0 C. To confirm specificity of amplification, PCR pro ducts were subjected to a melting curve shown in Figure 3 1 To quantitate the amount of viral DNA, a nearly full length plasmid containing the B19 genome (PYT103c) was serial diluted to 1:10 to create a standard curve. All samples were amplified alongside GAPDH primers, B19 DNA isolated from positively infected serum ( B19 control), a thyroid genomic DNA with a known concentration (GAPDH control), and corresponding negatives. All samples were normalized to GAPDH, and RNA samples were normalized for primer e fficiency. All primers used for nucleic acid amplification are shown in Table 3 1. Southern Blotting Ten micrograms of DNA of B19 or Mock infected DNA from N thy O ri 3.1 cells (Hirt protocol as described above) was separated overnight on a 1.2% agarose g el. The following day, the gel was soaked in TAE containing ethidium bromide for 20 minutes and visualized next to a ruler under UV light. Following 3 washes in distilled water, the gel was soaked for 30 minutes in a denaturation solution made of 60g sodiu m hydroxide and 175.2g sodium chloride in 3 liters distilled water. Following 2 brief washes in water, the gel was neutralized in a solution made of 363.3g tris base and 262.9g sodium chloride in 3 liters of water. Following another rinse in water, the gel was set up in an

PAGE 35

35 overnight downward transfer in 20X saline sodium citrate (SSC) buffer to cellulose nitrate paper. The next morning, the membrane was baked for 30 minutes at 60 0 C and UV cross linked. The membrane was then pre hybridized for 30 minutes at 65 0 C in a (SDS), and 100g/ml single stranded DNA. The probe was made using the Invitrogen RadPrime DNA labeling system (Carlsbad, CA). A 714 base pair long sequence of the B1 9 genome that overlapped the NS1 VP region was removed from a nearly full length B19 plasmid by digestion with HindIII and PstI. The digest was run on a 1.2% agarose gel and isolated using a gel isolation kit. The probe was denatured by boiling for 5 minut es and placed on ice prior to labeling. Five microliters of 32 P dCTP was mixed with 10l denatured probe containing 80ng of DNA and 1l each of 500M dATP, dGTP, and dTTP, along with 20l 2.5X Random Primer solution and 1l Klenow enzyme and incubated for 10 minutes at 37 0 C. Five microliters of stop buffer was added and the mixture purified in a MicroSpin G 50 column (GE Healthcare, Buckinghamshire, UK). The labeled probe was then boiled for 5 minutes, placed on ice for 5 minutes, added the hybridization mi xture, and incubated overnight at 65 0 C. The following day, the membrane was washed for 15 minutes each in a wash buffer containing descending amounts of SSC (2X, 1X, 0.5X, and 0.1X) with 0.1% SDS at 55 0 C. The membrane was air dried, placed in a plastic cov er, incubated for 1 week with film at 80 0 C, and developed.

PAGE 36

36 Flow Cytometry Six thyroid cells lines and an erythroleukemia cell line commonly used in B19 studies were examined by flow cytometry for the three B19 co receptors P antigen, 5 1 integrin, and K u80. Cell lines included normal thyroid cell line, N Thy Ori 3.1, 8305C, K1, FTC133, TT, SW579, and K562. All cell lines were grown as described above. Adherent cells were briefly incubated with 50 mM EDTA; EDTA was inactivated using PBS containing 1% feta l bovine serum (FC buffer). N Thy Ori did not remove easily with EDTA and had to be detached using 0.25% trypsin/0.5mM EDTA mixture briefly. One million cells were collected by centrifugation at 1,200 rpm for 5 minutes. Cells were incubated for 30 minutes in primary antibody diluted in FC buffer at 40C (P Antigen, 1:50; 5 1, 1:100, Millipore; Mantreya; Ku80, 1:40, EMD Biosciences, San Diego, CA) followed by 3 washes in FC buffer, and incubated for an additional 30 minutes in secondary antibody at 40C (Anti Mouse FITC, Anti Rabbit PE; Sigma). 4% paraformaldehyde was used to fix the samples. 10,000 cells were sorted on a FACS Calibur (BD Biosciences, San Jose, CA) and analyzed using Cellquest Version 3.3. Non specific binding was detected by IgG isotype cont rol for 5 1 integrin and secondary only controls for both antibodies were included. B19 Infection of N Thy Ori 3.1 Wild type B19 virus containing 10 8 particles per microliter in serum was generously provided by Kent Dupuis, Cerus, Concord, CA N Thy Ori 3.1 cells were plated at 70% confluency with one million cells/60cm 2 dish and incubated overnight at 37 0 C in 5% CO 2 Virus was added to cells at 10,000 particles per cell in 1 ml serum free media. Attachment and entry were achieved by incubating virus with N Thy Ori 3.1 cells

PAGE 37

37 for 1 hour at 4 0 C with gentle rocking followed by 1 hour at 37 0 C. Before collection, cells were washed thoroughly with PBS and trypsinized to remove unincorporated virus. The cells were harvested using the Hirt extraction protocol as p reviously described (Hirt, 1967). Briefly, DNA was precipitated from the sample using 5M sodium chloride, phenol:chloroform extraction, and 100% ethanol precipitation. Following two washes with 70% ethanol, the pellet was air dried and resuspended in 40l TE buffer. Immunofluorescent Staining of Virally Infected Cells N Thy Ori 3.1 cells were infected as above. Following the one hour incubation at 37 0 C, cells were trypsin i zed and plated onto glass coverslips. At 16, 24, 48, and 72 hours post infection, cell s were washed three times with PBS, then fixed using 1:1 acetone:methanol for five minutes at 20 0 C. Following three PBS washes, cells were blocked for 45 minutes in 3% goat serum/0.4% BSA and incubated overnight in anti VP2 antibody (MAB8283) in blocking solution at 4 0 C. Cells were washed in PBS and incubated one hour with goat anti mouse secondary labeled with Texas Red. After six further PBS was h es, coverslips were mounted to slides using VectaShield mounting media with DAPI (Vector Laboratories, Inc). S lides were imaged and captured using an DSU Spinning Disk Confocal Scanner mounted on an Olympus IX81 inverted fluorescent microscope and Hamamatsu C4742 80 12AG Monochrome CCD Camera Z stack confocal images were merged into a projection image using Ado b e Photoshop Immunohistochemical (IHC) Detection Each tissue block was cut in 5 m thick sections and allowed to dry overnight on Superfrost Plus microscope slides Slides were baked for 30 minutes at 60 0 C prior to rehydration. Each sample was deparaffini zed by two 5 minute incubations in xylene

PAGE 38

38 followed by a descending alcohol series. Endogenous peroxidase activity was blocked by a 10 minute incubation in 0.3% hydrogen peroxide in methanol. Heat induced antigen retrieval was performed using a 10mM Citra B uffer for 25 minutes followed by a 30 minute block in 2.5% horse serum/avidin blocker (Vector Labs Burlingame, CA). Tissues were incubated overnight in m ouse anti B19 (MAB 8293 ; 1:50 ; Millipore ), m ouse anti 5 1 integrin ( 1:100, Millipore), rabbit anti IL 6 (1:500; AbCam, Cambridge, MA) or r abbit anti P antigen ( 1:50, Matreya LLC, Pleasant Gap, PA ) with a biotin blocker. All B19 slides were stained alongside a B19 positiv e acutely infected fetal liver. Antibodies were detected using a mouse HRP ( B19 and 5 1), rabbit HRP (IL 6) or rabbit AP (P antigen) ABC kit (Vector Labs). Secondary antibodies were incubated on the slides for 30 minutes, followed by a 30 minute avidin/biotin incubation. Slides were developed using ImmPACT DAB for B19 and IL 6, ImmPACT VIP for 5 1 integrin, and Vector Red Alkaline Phosphatase for P antigen (Vector Labs). B19 slides were counterstained for nuclei using hematoxylin. Slides were permanently mounted and imaged using a Leica DM 2500 upright microscope at the indicated magnifica tion (Leica Microsystems, Buffalo Grove, IL). Positive Pixel Quantification Slides were digitally scanned by the Aperio ScanScope and positive pixel counting was performed using the positive pixel count algorithm of Aperio ImageScope software (Aperio, Vis ta, CA). The algorithim was set with a hue value of 0.1, a hue width of 0.6, and a color saturation threshold of 0.08. For B19 these values counted visible positive pixels, with most localization to the nucleus and excluded background. For IL 6, both nucl ear and cytoplasmic staining was detected. Where visible background was

PAGE 39

39 greater than the color saturation threshold, exclusion marking was used to exclude background in the positive pixel count. Staining in each slide was calculated as a whole section for B19 and for both B19 and IL 6 by matching four 20x B19 areas in each section with corresponding matching sections on IL 6 slides. Numerical values were assigned to positive staining by multiplying the average intensity (lavg) by the total positivity, gene rating an overal positive score. All scores less than five were considered negative for that protein. B19 IgG/ IgM EIA and Western Blot Serum samples were obtained as previously stated. Using the Biotrin Parvovirus B19 antibody kits, samples were diluted 1:100 in sample buffer and analyzed for B19 International Ltd., Dublin, Ireland. TMB substrate was added to detect antibody complexes, followed by addition of the provided s top solution after 10 minutes. An ELISA reading was taken immediately following at 450 nm. For western blot detection of B19 specific antibodies, 20 l of patient serum was diluted 1:100 and probed against various forms of B19 antigens using the Mikrogen Di agnostik recomLine Parvovirus B19 IgG and IgM (Floriansbogen, Germany). Western strips were scanned using GS 800 Calibrated Densitometer and band intensity was calculated using Quantity One Image Software (Bio Rad, Hercules, CA). Positive scoring was calcu lated by measuring the positive band(s) and background on each strip, and dividing this value by the cut off control. Values ranging from 0 0.1 were negative ( ), 0.11 0.8 scored equivocal (+/ ), and greater than 0.81 were considered positive, with positiv e assignments of 0.81 1.6 (+), 1.7 2.5 (++), and greater than 2.51

PAGE 40

40 (+++). Bands that were visible by eye but did not scan were also considered equivocal (+/ ). Cytokine Quantification in Cell Lines Following transfection, cellular supernatants were colle cted at 24 and 48 hours post transfection and total protein was collected at 0, 24, 48, and 72 hours post transfection. A protease inhibitor was added to each supernatant sample, samples were centrifuged for 5 minutes at 1200 rpm to remove cell debris, and aliquoted before storage at 20 0 C. Cells were lysed in RIPA buffer containing a protease inhibitor cocktail on ice. Following a 5 minute incubation at 4 0 C, cells were centrifuged for 5 minutes at 13,200 rpm to remove cell debris, and protein supernatant w as transferred to a new tube before storage at 20 0 C. Protein production was confirmed by western blot in K1 cells. K1 transfected with NS1 or an empty plasmid, and total proteins were collected at 0, 24, 48, and 72 hours post transfection and analyzed by western blot. 40g of each sample was separated on a 12% SDS PAGE and transferred to a PVDF membrane. Following blocking for 1 hour in 5% milk in TBST at room temperature, samples were incubated overnight in primary antibody recognizing IL 6 diluted 1:1000 (AbCam), TNF shaking at 4 C. After 3 washes in TBST, membranes were incubated for 1 hour at room temperature in anti Rabbit (TNF 6) diluted 1:15,000 or Goat an ti Mouse HRP (GAPDH) diluted 1:10,000 in 5% milk/ TBST. After 3 additional washes, membranes were incubated in ECl solution for 5 minutes. Films were exposed for 2 minutes prior to developing. Duplicate experiments were analyzed and averaged.

PAGE 41

41 Cytokine and Hormone Detection in Patient Serum TNF nzyme linked immunosorbent assay s (TNF 6, BD Bioscience, San Jose, CA; TSH, GenWay Biotech, Inc., San Diego, CA). Cloning of p6 and CMV Luciferase P lasmids The firefly luciferase gene was ordered from Addgene in a pcDNA 3 .1+ plasmid (Plasmid 18964, Addgene, Cambridge, MA). To assure both the p6 and CMV plasmid had identical backbones, the 1689 base pair luciferase gen e was removed from the Addgene plasmid using the clon in g sites HindIII and XbaI. The pcDNA 3.1 plasmid was cut using HindIII and XbaI for 1 hour at 37 0 C ( Invitrogen, Grand Island, NY). Digestion products were run on a 1.2% agarose gel, the DNA was extracte d, and plasmid and insert were ligated overnight with T4 DNA ligase at a 1:3 ratio. All ligated plasmids were transformed into E. coli cells by incubating 2l of the ligation mixture with 100l of E. Coli cells on ice for 30 minutes. Following a 40 second heat shock at 42 0 C, 950l SOC outgrowth media was added to each tube and placed at 37 0 C for 1.5 hours with shaking. 100l of this mixture was plated onto a LB plate containing ampicillin and IPTG/x gal and incubated overnight at 37 0 C. White colonies were p icked and grown overnight in 5ml LB broth containing 5l ampicillin. 2ml of this culture was collected, and plasmid DNA extracted using the GeneJet Plasmid Miniprep kit (Thermo Scientific, Waltham, MA). For the p6 plasmid, the CMV promoter was removed by cutting with BglII and BamHI for 1 hour at 37 0 C. The cut ends were blunted and annealed together with T4

PAGE 42

42 DNA ligase overnight at 4 0 C. The plasmid was transformed as above and this pcDNA plasmid with CMV removed as labeled pcDNA null with the multiple cloni ng site still containing SalII, EcoRI, PstI, EcoRV, XhoI, and Xba ? sites. The plasmid map for pB19p6 is shown in Figure 3 2D. The p6 promoter was removed from the pB19p6 plasmid by cutting with EcoRI and HindIII for 1 hour at 37 0 C to produce at 424 base pa ir fragment. The pcDNA null plasmid was opened by digestion with EcoRI and XbaI for 1 hour at 37 0 C. Following analysis on a 1.2% agarose gel and DNA extraction, the open plasmid was combined with the 1689 base pair luciferase gene cut as above in a 1:3:3 r atio and annealed together with T4 DNA ligase overnight at 4 0 C. The plasmid was transformed as above. Both CMV and p6 luciferase were grown in 500ml cultures, and plasmids isolated using the HiSpeed Plasmid Maxiprep kit (Qiagen, Valencia, CA ). Final produc ts were sequenced again to confirm intact promoters and luciferase gene. Luciferase Promoter A ctivity 8305C, K1, FTC133, TT, and N T hy O ri 3.1 were plated at 90% confluency into 2 wells of a 6 well dish. The transfection mixture was made using 2g of eithe r p6 or CMV luciferase plasmid mixed with 3l (FTC133, TT, and N T hy O ri 3.1) or 4l (K1 and 8305c) of FuGene in 100l serum free media (Promega, Madison, WI). Transfection mixtures were vortex, incubated at room temperature for 15 minutes, then applied to cells. Cells were grown for 48H, then collected by one freeze thaw cycle and scrapping in 400l 1X Reporter lysis buffer (Promega). 100l of Luciferase Reagent was added to each tube. After addition of 20l cell lysate, tubes were mixed three times and pl aced in the luminometer. Luciferase levels in CMV and p6 transfected cells were measured with a 2 second measurement delay followed by a 10 second measurement reading using a

PAGE 43

43 Lumat LB 9507 luminometer. Duplicate values from each experiment were averaged, a nd combined with values from triplicate experiments from each cell line to measure average promoter activity. All values were normalized to CMV. Statistical analyses All comparisons were performed using group FFPE comparisons, Wilcoxon rank sum test (for any 2 group comparison), Kruskal Wallis test (for 3 group comparison), and ANOVA (analysis of variance; greater than 3 group association between B19 and IL 6 staining in thyroid tissue. All analyses were performed in SAS version 9.2.

PAGE 44

44 Table 3 1 Primers used for nucleic acid amplification Primer Oligonucleotide sequence (5' 3') Gene Produ ct Size Experimen t 4A AACGCCTCAGAAAAATACCC VP 324 nPCR 4B TAAGTGCTGAAACTCTAAAGG 4C CAAAAGCATGTGGAGTGAGG VP 104 nPCR and RT PCR 4D ACCTTATAATGGTGCTCTGGG B19 Au F1 TATGCTTACTTAACAGTAGG VP 852 nPCR B19 Au R1 AATTGGCCCACTTTGTGG B19 Au F2 GCCTTAGCACAGGTACCTCT VP 397 nPCR B19 Au R2 CATCCTCCTAAGGCTGCAAAC P1 GTACGCCCATCCCCGGGACCAGTTCAGG NS1 309 RT PCR P5 CCCACATGGCAGCTACATCGCACCAAAT VP 97 F CCACTTTTAGTGCTAACTCTGTAAC VP 97 qPCR VP 97 R GCTGCGGGAGAAAACACCTTA AMP O CTGGAGTACCTGTGGTTA NS1 323 qRT PCR AMP KO CACCACTGCTGCTGATAC

PAGE 45

45 Figure 3 1 Quantitative Real Time PCR for B19 (A) The fluoresc ence emitted by SYBR Green I for B19 plasmid DNA corresponding to 5 X 10 10 to 5 X 10 2 genome copies. (B) Reference curve generated from cycle numbers of amplification correlated to Log B19 DNA copies. (C) Melting curve of VP 97 primers amplifying DNA from thyroid tissue.

PAGE 46

46 CHAPTER 4 PARVOVIRUS B19 INFECTION IN A WIDE RANGE OF THYROID DISEASES Specific Aim #1: To determine the B19 infection status of a large cohort of PTC, ATC, and other thyroid cancers/tissues. Our working hypothesis is that B19 nucleic acid s and protein will be detected more frequently in more sever e thyroid cancers in comparison to other benign t hyroid disorders To evaluate the immune response to B19, as well as detection and expression of the virus, a small cohort of five flash frozen PT C samples matched to serum were analyzed for B19 IgG and IgM in the serum and B19 DNA and RNA in the thyroid. To expand the types of thyroid tissues capable of being infected by B19 and allowing for persistence and expression, a large cohort of FFPE tissue s were examined for B19 nucleic acids, capsid proteins, and viral co receptors. B19 DNA and RNA Detection in Flash Frozen Tissue Samples and Matched Serum B19 has previously been reported to express in increased amounts in PTC tissues (Wang et al., 2008). To begin to determine the characteristics of B19 infection of thyroid, a small cohort (N=5 females) of matched PTC tumors and sera were examined for the presence of B19 DNA, RNA, and virus specific immunoglobulin s Table 4 1 summarizes the age, tumor clas sification, B19 detection results, and code assigned to each subject Viral DNA was detected in the serum from 1 of the 5 cases (Case 5 ; Figure 4 1A ), and sequencing data confirmed B19 identity (data not shown) Matched serum from each subject was also ex amined for the presence of B19 specific IgG or IgM. Four of the 5 (80%) subjects had positive B19 IgG in their serum by ELISA, while no subjects had detectable B19 IgM (Table 4 1 ). When the serum was tested for multiple anti B19

PAGE 47

47 antibody types by western b lot, all cases, including the ELISA negative sample, had detectable anti B19 antibodies, although the ELISA negative case (case 4) showed a weaker band than the other 4 cases (Fig ure 4 1B). This confirmed that the detected virus in tissue is persisting fro m a previous infection. Each tumor showed detectable amounts of B19 DNA by nPCR amplification in at least one of two separate isolates, with two cases being positive in both (Fig ure 4 1C). All positive bands were directly sequenced and were 99 100% identic al to B19 sequences, and were 99% identical to each other, confirming B19 detection (data not shown) Both isolates of RNA from Case 002 were positive for VP RNA (Fig ure 4 1D). Together, these data suggest that B19 can persist and express in the thyroid. V iral DNA and RNA Detection in a Variety of Thyroid Tissue To investigate the types of thyroid dis ease tissues B19 can persist in, 219 FFPE samples from different subjects were analyzed for the presence of B19 nucleic acids and proteins Table 4 2 lists the frequency of B19 DNA RNA, and protein detection by nPCR, RT PCR, and IHC, respectively, in each type of FFPE thyroid tissue examined. nPCR was performed twice from interrupted serial sections, and the table denotes positivity seen in either section. Ther e was no difference in DNA detection in cancer versus non While RNA quality was poor in a large number of the FFPE blocks, samples were extracted from a small cohort of tissues and analyzed to confirm VP expression in corresponding blocks. B19 capsid DNA and RNA were detected in a large amount of thyroid samples analyzed. The top column s in Table 4 2 represent carcinomas, while the bottom column s represent benign (non malignant) dis eases B19 capsid nucleic acids were

PAGE 48

48 detected by nPCR in 87% of tissues examined including approximately 84 % of thyroid cancer metastases (Table 4 2). Figure 4 2 shows a representative nPCR (A) and RT PCR (B) gel denoting both positive and negative amplification in FFPE tissue samples. RNA was isolated from an acutely infected fetal tissue and was used as a positive control to confirm the presence of viral RNA (Fig ure 4 2B). Protein Detection and Localization in Both Normal and Tumor Tissue Immunohistochemistry was performed twice from interrupted serial sections, and Table 4 2 denotes positivity seen in either section. Greater than 50% of all types of tissues including normal controls, adenomas, and tumors, were positive for capsid proteins by IHC, but staining int ensity and localization throughout sections varied among tissue types. There was no difference in IHC detection in cancer versus non 0.6592). All tissues were stained alongside an acutely infected fetal liver used as a positive control (Fig ure 4 3A). Tissue staining was strongest in thyroid tumors, especially PTC and ATC tissue, as represented by a PTC tissue seen alongside its corresponding IgG control which lacks staining (Fig ure 4 3B C). Similar to our earlier study [Adamson et al., 2011], capsid staining could be detected in normal tissue and tissue adjacent to tumors, although with weaker, nuclear localization, and a smaller amount of positive cells (Fig ure 4 3D). Adenomas and other benign disor ders typically showed mild to moderate nuclear staining (Fig ure 4 3E). In some tissues, darker, more concentrated capsid staining could (Fig ure 4 3F). In thyroid metastases, B19 staining was localized to thyroid tumor tissue, and was not seen in adjacent lymph node or other surrounding tissues (Fig ure 4 3G H,

PAGE 49

49 respectively). Some tissues had positive nuclear staining in normal adjacent tissue but not in tumor tissue and therefore w ere counted as negative. All pediatric cases showed detection patterns and staining comparable to adult cases with similar diagnoses. B19 Co R eceptors are Detected in Normal Thyroid Tissue To begin to elucidate the mechanism of B19 thyroid infection, 40 t hyroid tissue sections representing each pathological category were analyzed by IHC for the presence of the B19 co receptors P antigen and 5 1 integrin Ku80 was not tested because of its low expression level on the surface of cells as shown by previous FACS data and Figure 4 5. Figure 4 4 demonstrates positive detection of the co receptors in thyroid tissue (shown by black staining ) The darker, more concentrated staining depicts typical detection of the receptor s at the surface of tissues. In positive samples, both co receptors were frequently located in sporadic clusters in normal tissue or the normal tissue adjacent to the tumors (Fig ures 4 4 A B arrows ). Most tumor areas were negative for both receptors, but in some tumors there was weak nuclear (but not surface) staining in the tumor region as depicted by weaker grey staining in the nucle ar area (Figure 4 4C arrow). No staining was detected in IgG controls (Fig ure 4 4D). While some tumors also had a few areas where the co receptors were detected on th e surface (data not shown), both thyroid tissues denoted as normal and normal tissue adjacent to tumors by pathological examination w ere the most consistently positive Conclusions These data indicate that normal thyroid tissues have the receptors necessa ry to allow B19 infection, and together with IHC data, suggest that normal thyroid epithelial cells, not tumors, may be the initial target of B19 during infection of the thyroid. While

PAGE 50

50 B19 is commonly harbored and can express to a limited degree in most th yroid tissues, amount of B19 positive cells and intensity of B19 staining by IHC varies greatly among tissue types.

PAGE 51

51 Table 4 1 Results of tissue and serum analysis for B19 in five PTC subjects Code Age TNM Tissue Serum n PCR* RT PCR ELISA Western IgG n PCR IgG IgM 1 52 T2N0M0 +/+ n/a + + 2 53 T2N0M0 /+ + + + 3 51 T2N0M0 /+ n/a + + 4 48 T2N0M0 +/ n/a + 5 79 T3N0M0 +/+ n/a + + + Patient information and B19 detection results by nPCR and RT PCR in ti ssue, and ELISA, Western blot, and nPCR of serum samples are summarized. TNM denotes tumor (T), lymph nodes involved (N), and distant metastasis (M). (*) Denotes results of two separate isolates amplified by nPCR ; n/a denotes samples not analyzed.

PAGE 52

52 Ta ble 4 2 B19 nucleic acid and protein detection in FFPE tumors nPCR RT PCR IHC ATC 9/10 5/5 8/10 57/65 4/7 49/69 PTC < 1cm 33/37 4/6 19/37 FVP 16/17 2/3 9/17 FTC 5/5 2/2 4/5 HCC 7/9 4/6 7/9 MTC 10/11 4/4 6/11 Metastases* 31/37 7/9 28/37 FA 4/5 2/3 4/5 HCA 2/2 2/2 1/2 Aden. Nodule 2/3 3/3 2/3 Hyperplasia 6/7 4/4 5/7 Autoimm une 6/7 2/2 5/7 Normal/ Benign 2/3 2/2 2/3 Frequency of detection of B19 DNA by nested PCR (nPCR), RNA by RT PCR, and capsid proteins by IHC in different types of thyroid tissues are shown. Abbreviations: ATC anaplastic thyroid carcinoma, PTC papil lary thyroid carcinoma, FVP follicular variant of papillary, HCC Hrthle cell carcinoma, MTC medullary thyroid carcinoma, SCC squamous cell carcinoma, FA follicular adenoma, HCA Hrthle cell immu ne related diseases and Graves disease. *Metastases include lymph node, epiglottis, neck, spine, and chest wall.

PAGE 53

53 Figure 4 1 B19 nucleic acid detection in five PTC tumors and serum. (A) n PCR amplification of serum DNA for B19 sequences. (+) denotes p YT103c positive control, (MW), the 100 base pair molecular weight marker, cases 1 5 are marked in order above each lane, and ( ) denotes the negative control. (B) B19 antibody detection as shown by Mikrogen WesternLine in cases 1 5, with reaction controls shown to left. Top line denotes positive reaction control, second IgG or IgM specificity, third cut off control for positive detection, and remaining denote different B19 antigens. (C) B19 DNA was isolated from two separate regions of each tumor and ampli fied by nPCR. Top and bottom images represent each different isolate. All lanes are labeled as in (A). (D) RT PCR was performed on two different samples isolated from Case 2 for B19 VP RNA, labeled 2.1 and 2.2. (+) denotes p YT103c positive control, (MW), t he 100 base pair molecular weight marker, the two isolates of Case 2 RNA are individually marked, and ( ) denotes the negative control PCR (no RT) amplification of RNA is shown in middle to exclude DNA contamination of the sample, and GAPDH positive contr ol is shown at bottom. All PCR and RT PCR VP products are 104 base pairs and directly sequenced to verify B19 identity All lanes not marked are blank.

PAGE 54

54 Figure 4 2 Viral nucleic acid detection in FFPE tissues. (A) DNA was isolated from each FFPE block a nd amplified for B19 DNA by nPCR or GAPDH by standard PCR. (+) denotes p YT103c positive control, MW denotes 100 base pair molecular weight marker, numbers 1 4 show 4 different FFPE RNA samples, and ( ) denotes negative PCR control. All other lanes are bla nk. (B) RT PCR was performed on the fetal liver positive control and 4 thyroid cases for B19 VP and GAPDH RNA. The top gel is samples amplified by RT PCR, the middle samples were the RT step was omitted to confirm lack of DNA contamination, and the third t he GAPDH positive control. (+) denotes p YT103c positive control, (MW) denotes molecular weight marker, (FL) denotes the fetal liver RNA positive control, numbers 1 4 show 4 different RNA samples, and ( ) denotes negative PCR or RT PCR control. All other la nes are blank. Positive controls and PCR product sizes are the same as in Fig. 4 1.

PAGE 55

55 Figure 4 3 Capsid protein localization varies between tissues. IHC staining for B19 capsid shows strong detection in a fetal liver positive control (A brown coloring). Similar dark staining was seen in multiple thyroid tissues, including the PTC shown in B. Lack of staining was seen in IgG controls stained alongside B19 tissues (C). B19 localization and intensity varied between tissues. Normal tissues tended to show fewe r positive cells with weak to negligible nuclear staining (D arrows). Weaker nuclear staining could be seen in some tissues, as demonstrated by the adenoma in E (arrows positive and negative cells). Darker, more punctuated staining was seen in select tissu arrow), or both dark nuclear and cytoplasmic staining in a PTC metastasis (G). Staining detected in thyroid cancer metastasis (G) was localized to the distant tumor and not the lymph nodes (H). All scale bars repr esent 25m.

PAGE 56

56 Figure 4 4 and P Antigen detection in normal thyroid tissue s. IHC staining was used to detect B19 co receptors in thyroid tissues as shown by black punctate staining. Both receptors Antigen were most commonly localized to the normal thyroid tissue adj acent to the tumors (A B ; arrows ). T umor tissue showed weak to no co receptor staining, as shown by positi ve Specificity of detection was confirmed by the lack of staining in IgG control (D). Scale bars represent 10m.

PAGE 57

57 CHAPT ER 5 EXPRESSION OF PARVOVIRUS B19 IN THYROID CELLS CORRELATES WITH INCREASED IL 6 EXPRESSION AND SECRETION IN VITRO Specific Aim # 2 : To determine the ability of B19 to infect, express, and alter cytokine expression in vitro Our working hypothesis is that has the capability to infect thyroid cells, and expression in these cells will result in increased inflammation. To evaluate B19 infection in the thyroid, cell lines derived from both normal thyroid cells and thyroid carcinomas were used to assess B19 co receptor expression, wild type B19 infection and expression, and effects of B19 gene expression on inflammation. Expression of B19 Co Receptors on Thyroid Cells In Vitro To determine which thyroid cells have the co receptors necessary for B19 infection, six thyroid cell lines, including N Thy Ori 3.1, a normal thyroid epithelial cell line, 4 thyroid cancer cell lines, and one B19 semi permissive erythroleukemic cell line (K562; non thyroid) were examined for surface expression of the co receptors P Antige n, 5 1 integrin, and Ku80. There was particular interested in the normal epithelial derived cell line N Thy Ori 3.1 due to localization of B19 co receptors in normal thyroid cells in vivo N Thy Ori 3.1 cells were 44.8% positive for P Antigen and 16.8% for Ku80 showing normal thyroid derived cells also express all three co receptors (Fig. 5 1A) 5 1 integrin was expressed at high levels in every cell line except TT, which is derived from a parafollicular C cell tumor (an MTC). P Antigen w as expressed at a significantly higher level as determined by analysis of variance (ANOVA) in the normal thyroid cell line when compared to all other cell lines examined except the FTC derived cell line FTC133 and the ATC cell line 8305C

PAGE 58

58 ( p<0.05; Fig ure 5 1B ). It was interesting that both receptors were expressed at such a high level in the FTC cell line. This cell line may have been derived from tumor cell s that did strongly express both receptors, or the conditions created in cell culture may have upregul ated these receptors. This strong expression of the co receptors suggests that FTC133 may be a good model for studying B19 interaction s in thyroid cancers. Ku80 was also expressed in the normal thyroid cell line, but in general, most cell lines had low sur face expression of this receptor. B19 Infection of Normal Thyroid Follicular Cells To confirm B19 can infect normal thyroid cells we used wild type virus to infect the normal thyroid cell line N Thy Ori 3.1 Two hours following infection, viral DNA was d etected in low molecular weight DNA extracted from B19 infected cells (Fig ure 5 2A ). Capsid proteins could also be detected in cells up to 24 hours post infection by i mmunofluorescent staining Figure 5 2 B shows B19 capsid staining localized in the cytopla sm in two normal thyroid cells. By direct cell counting of VP positive cells, approximately 10 15% of cells showed positive capsid staining at 16 and 24 hours post infection. Up to 48 hours post infection, viral NS1 RNA was detected in the normal thyroid cell line but no VP RNA was seen (Fig ure 5 2 C ). In two separate infections, NS1 RNA was seen at 48 hours or at 24 and 48 hours, but levels were undetectable by 72 hours. Normal thyroid epithelial cells do not appear to support full replication of the vir us in cell culture, but t his does show that B19 can both infect and express at least to a limited degree, in normal thyroid.

PAGE 59

59 Increase in IL 6 and TNF Following NS1 Transfection NS1 transfection has been shown to upregulated IL 6 and TNF in multiple cell types. To determine if NS1 has the same effect in thyroid cells, two thyroid tumors cell lines (K1 and FTC133) and one normal thyroid cell line (N T hy O ri 3.1) were transfected with a NS1 expressing or empty plasmid (mock) and cellular supernatants were collected at 24 and 48 hours post transfection. Total values were quantitated compared to a cytokin e specific standard curve for TNF and IL 6 (Figure 5 3 ). When change in cytokine secretion was shown as a relative value (Total NS1 minus total mock), K1 showed an increase in TNF transfection, but a decrease in total IL 6 secretion (Figure 5 4) K1 showed the largest increase in expression of both cytokines although both FTC133 and N T hy O ri 3.1 showed a smaller increase in IL 6 from mock transfected to NS1 transfected cells (Figure 5 4A B). Total proteins were analy zed in K1 transfected cells at 0, 24, 48, and 72 hours and compared to 72 hour mock transfected proteins by western blot for cellular TNF IL 6 (Figure 5 4 C). A significant increase was also seen in cellular IL 6 as shown by relative intensity measurement s compared to GAPDH at 72 hours post transfection ( Wilcoxon Rank Sum Test p<0.05; Figure 5 4 D). While there was a slight increase over the time course in TNF B19 p6 Promoter Activity in Thyroid Derived Cells To determine if the B19 promoter p6 expresses equally well in all thyroid cell types, 4 thyroid tumor cell lines (8305C, K1, FTC133, and TT) and 1 normal thyroid cell line (N T hy O ri 3.1) were analyzed for promoter efficiency using a luciferase assa y. All thyroid cell lines except TT were derived from thyroid epithelial cells, except TT, which

PAGE 60

60 was derived from the C cells of a MTC tumor. Cells were transfected and total lysates were collected a t 48 hours post transfection Total p6 luciferase values were normalized to CMV values, as shown in Figure 5 5 No significant difference was seen in p6 expression levels between cell lines as measured using analysis of variance indicating that B19 expression is not controlled at the promoter level in thyroid cells. Conclusions These data demonstrate that B19 has the ability to infect and express in normal thyroid cells in vitro Expression of NS1 in thyroid cells correlates with increased inflammation as measured by TNF 6 production and secretion. This effect appears to be strongest in the thyroid cancer cells analyzed, and regulated at a level beyond the viral promoter.

PAGE 61

61 Figure 5 1 P Antigen, in vitro Flow cytometry was used to detect surface expression of B19 co receptors in thyroid and erythroleukemic cells. The tissue type each cell line was derived from is shown in parathens es. Positive d etection of receptors in N thy O ri 3.1 cells is shown ( A ). The shift in the light grey li ght depicts intensity of PE P antigen or FITC Ku 80 positive cells, compared to secondary only (darker grey), or unstained cells (black). Percent of c o receptor positive cells in 6 thyroid derived cell lines and one erythroleukemic cell line commonly used i n B19 research as determined by flow cytometry analysis ( B ). N Thy O ri 3.1, a normal thyroid epithelial cell line, expressed all three co receptors on the surface of the cells, with 44.8% positive for P Antigen and 16.8% for Ku80 signifies cell lines with expression levels significantly different than the normal thyroid cell line. Samples with ND denotes those only analyzed once where statistical analyses were not done All samples unless otherwise noted were ananlyzed in tripli cate. *p<0.05

PAGE 62

62 Figure 5 2 B19 entry and expression in normal thyroid cells (A) Southern blot analysis of 1g and 5g of low molecular weight DNA from mock ( ) and B19 (+) infected cells (Lanes 5 and 7, and 9 and 11, respectively). Arrow shows detection of B19 DNA from virally infected cells. Lane 1 shows a 1kb molecular weight marker. 50 and 10pg of PYT103c positive control is shown in lanes 2 and 3. All other lanes are blank. (B) B19 VP capsids can be detected in the cytoplasm of normal thyroid cells at 16 (shown) and 24 hours post infection by immunocytochemical staining as demonstrated by Red VP staining (C) RT PCR detection B19 NS1 and VP RNA in viral or mock infected cells. B19 NS1, but not VP, RNA could be detected in virus infected cells, with no Pos denotes negative, and 0, 24, 48, and 72 time points in hours post infection (HPI).

PAGE 63

63 Figure 5 3 Quantification of increase in T N F and IL 6 secretion following NS1 transfection. Total TNF 6 ( B ) in cellular supernatants were compared in 4 thyroid cell lines transfected with either a n empty plasmid (light) or NS1 (dark) expressing plasmid at 24 and 48 hours post transfec tion All values are shown in pg/ml. *p<0.05.

PAGE 64

64 Figure 5 4 Comparison of TNF 6 in thyroid cells. Relative change s in cytokine secretion as assessed by total supernatant concentrations of TNF IL 6 (B) in supernatants as calculated by su btracting mock transfected values from NS1 transfected values Four thyroid cell lines were compared at 24 and 48 hours. All values are shown in pg/ml. (C) Total proteins from K1 NS1 or Mock transfected cells analyzed by western blot from 0 72 hours post t ransfection for TNF 6. (D) Quantification of western values by densitometry compared to GAPDH for multiple experiments *p<0.05

PAGE 65

65 Figure 5 5 Relative p6 luciferase expression values normalized to CMV at 48 hours post transfecti on.

PAGE 66

66 CHAPTER 6 PERSISTENCE OF PARVOVIRUS B19 IN THYROID DIS EASE CORRELATES WITH INCREASE D IL 6 EXPRESSION AND CIRCULATION IN VIVO Specific Aim # 3 : To determine markers of thyroid disease associated with B19 infection in vivo Our working hypothesis is that quantification of B19 detection and expression will correlate with an increase in progression from benign disorders to tumors, and that this increase in virus will correlate with a change in systemic and local inflammatory cytokines or thyroid hormones. To evaluate both viral detection and expression in different thyroid disorders, 15 thyroid tissues matched to serum representing benign, adenomatous, and carcinoma pathologies were prospectively collected. Serum samples were analyzed for viral immune resp onse (both IgM and IgG) antibodies to confirm acute or prior infection. Tissue samples were used to detect and quantify viral DNA, RNA, and protein, and correlate expression to a local and circulating inflammatory response. Circulating B19 Specific Antibo dies Do N ot Correlate W ith Thyroid D isease Fifteen thyroid tissue samples matched to serum representing 5 each of non adenomatous and autoimmune benign disorders ( ), adenomas, and tumors were prospectively examined for B19 immu ne response, persistence, and expression in the thyroid. To confirm previous (either past or acute) infection with B19 serum samples were analyzed for the presence of B19 specific IgG and IgM by two methods: 1) the Biotrin ELISA, and 2) Mikrogen western s trips containing 6 different B19 proteins of different sizes separated on a membrane. The patient number assignments, relavent disease information, category assignment, and total B19 antibodies detected are summarized in Table 6 1 Results for the west ern strips are shown in Figure 6 1A (IgG) and 6 1B(IgM). Eight of the 15 (53.3%) subjects

PAGE 67

67 were IgG positive by ELISA, yet 10 of 14 (71.4%) had detectable antibodies by the Mikrogen western strips, with two additional showing only 1 weak band with an intensity below the cut off control (patients 7 and 12) that were counted as negative. One subject developed too high of a background to adequ a tly detect positive IgG bands (patient 15). All serum samples that were positive by Biotrin ELISA had at least equivilant i f not higher band intensities for the conformational epitope used in both assays, confirming comparable results with both methods. Interestingly, antibody detection based on band intensity for minor capsid protein VP1 and the N terminus of the capsid was h igher in both benign and tumor subjects compared to those with adenomas, although the difference was not significant ( Figure 6 1C; Kruskall Wallis Test; p=0. 057 ) Only strips that had at least two bands weakly visible or one band greater than or equal to t he cut off control were considered positive. No patients were positive for IgM by the ELISA, but 5 of the 15 (33%) were weakly positive by the western strips, with two additional subjects (10 and 13) showing bands with intensities below the cut off control This was notable in patients 1 and 15, where no IgG antibodies were detected by either ELISA or western strip, and reactivity was only seen for IgM against the N terminal half of the structur al protein VP1/VP2. Also of note is the NS1 IgM reactivity seen disease subjects. Figure 6 1 depicts the developed bands for both the IgG and IgM strips. These data both confirm previous or current infection in subjects with thyroid disease, and illustrate the need for sensitive testing methods when determining the presence of B19 antibodies for research in a laboratory setting.

PAGE 68

68 ELISA was used to analyze the amount of thyroid stimulating hormone (TSH) and B19 associated cytokines IL 6, TNF and IFN in each subject Total cy tokine levels and B19 antibody detection status are shown in Table 6 2 Unlike previous reports in subjects with chronic fatigue syndrome and past B19 infection (Kerr et al., 2001) there was no significant difference in IFN B19 antibody positive and negative serum samples from patients with thyroid disease (Wilcoxon Rank Sum Test; p=0.5309) Additionally, there was no significant difference in TNF 6, and TSH level s when compared to both disease state (benign, adenoma, or tumor) and to the presence of B19 antibodies (Wilcoxon Rank Sum Test; p=0.14, 0.12, and 0.24, respectively ) This indicates that previous infection with B19 as evidenced by anti B19 antibodies, is not a sufficient predictive factor of thyroid disease. Similar A mounts of B19 DNA are Detected in T hyroid T issue and B lood Nested PCR and IHC were performed to determine B19 persistence in the thyroid. Results are summarized in Table 6 2 DNA from each t umor was analyzed by nPCR for the presence of B19 DNA as shown in Figure 6 2A Thirteen of the 15 cases (86.7%) were positive for viral DNA. This is similar to previous reports of approximately 90% of archived thyroid tissues being positive for B19 DNA by nPCR (Wang et al., 2008). To quantify the amount of virus present in each tissue section, two different samples from each case, and from each lobe where they were collected separately as denoted by (**), were examined for viral genome copy numbers by qPCR. Although there was a slight decrease in genome copies per microgram from benign to adenoma to tumor tissue, no significant difference was found in the amount of viral DNA detected between each group or between separate lobes in the same patient, as shown in Figure

PAGE 69

69 6 2B (Kruskall Wallis Test; p=0.243) q PCR was also used to examine circulating viral genomes. All samples showed low levels (less than or equal to 10 4 genome equiv a lants per ml), and no signficant difference was seen between groups ( Figure 6 3; Kruskall Wallis Test; p=0. 432 ). To determine if viral loads varied between tumor tissue and normal tissue adjacent to the tumor, DNA from fine needle aspirates (FNAs) of each section were examined by qPCR for genome copy numbers. As each sample was taken cells were smeared on a slide and stained with hematoxylin and eosin to confirm normal or tumor cell morphology (Figure 6 4A B). When values were obtained from separate sections of the tissue, no significant difference was seen between genome copy number s in the normal adjacent tissue and in the tumor (Figure 6 4C). This indicates that replication, if occuring, is equally efficient in normal and tumor cells or occuring at a low, in distinguishable level. Increased B19 Gene Expression in Thyroid T umors and A denomas Because there is no commercially available antibody against B19 NS1, standard and qRT PCR were used to detect and compare NS1 RNA in thyroid tissue. Using high sensitivity NS1 primers, B19 RNA was weakly detected in 4 of the 15 (26.7%) cases ( Figu re 6 5A ). To confirm and quantify expression, two separate RNA samples from each subject were examined by qRT PCR for NS1. Two benign, 2 adenoma, and 3 tumor samples had detectable, although very low, levels of NS1. Expression of NS1 showed an increase, th ough not statistically significant, in adenoma and tumor samples compared to benign ( Figure 6 5B; Kruskall Wallis Test; p=.02 12 ).

PAGE 70

70 IHC was performed to detect and determine localization of B19 capsid proteins in each tissue section. Unequal distribution of IHC staining within tissues was often seen as demonstrated by two different areas shown from case 7 in Figure 6 6 A B with some areas staining more intensely than others, and the IgG negative lacking staining ( Figure 6 6C ). Because staining distribution a nd intensity were not equiv a lant between tissue sections, a positive pixel count program was used to calculate the total positivity of each section to better distinguish the differences in capsid expression. Each case was assigned a positive score ( to ++ ) based on the value by mulitiplying the average intensity of each positive area by the total positivity of the whole tissue section. Cases with scores less than five were considered negative ( ), with those from 5.1 20 ranking (+), and greater than 20.1 r anking (++). Representative images of different ranking of stainings are shown with an adenoma in 6 6 D which was ranked (++), 5 6 E which was ranked (+), and 6 6 F which was negative. When overall positivity scores were compared between groups, only tumor ti ssue had significantly increased VP capsid staining compared to benign tissue ( Figure 5 6G ; Kruskall Wallis Test; p<0.01 ). Four subjects ( 26.7 %) were completely negative for B19 protein in the thyroid. Together, these data suggest that while viral DNA can be detected at similar rates in different types of thyroid diseases, NS1 expression and capsid protein detection is increased in adenoma and tumor tissue. B19 Expression in the Thyroid Correlates to Increased IL 6 E xpression To determine if B19 infection o f the thyroid is associated with increased IL 6 production by thyroid epithelial cells, thyroid tissue sections were analyzed by IHC for IL 6 and B19 capsid protein. All subject tissue sections were stained for both B19 and

PAGE 71

71 IL 6, and four 20x areas represe nting both positive and negative areas of B19 staining seen in each tissue were randomly selected and matched to corresponding IL 6 slide areas. Correlative values for all cases are shown in Figure 6 7A. There is a moderate positive trend in all cases betw een IL 6 and B19 coefficient =0.453 and CI = (0.224, 0.634). Total IL 6 positivity in corresponding B19 positive compared to B19 negative tissue sections showed a significant increase in IL 6 staining in B19 positive t issues (6 7B; Wilcoxon Rank Sum Test; p<0.01). Color maps showing localization of staining of both proteins in DAB and as assigned after pixel counting are represented in Figure 6 8, with positivity scores shown in the upper right corner. These data show t hat subjects with increased amounts of B19 proteins within the thyroid have increased levels of circulating IL 6, and that IL 6 production is increased in thyroid cells/tissues where B19 capsid protein is detected. While the detection of B19 specific IgG o r IgM did not correlate with a change in TSH or any of the cytokines measured in Table 6 2 these molecules were compared in patients where B19 capsid proteins were not detected in the thyroid versus those who had low or high amounts. As shown in Figure 6 8 and Table 6 2 each tissue section was stained for B19 capsid protein by IHC, total staining was analyzed using a positive pixel count algorithim, and ranked based on pixel intensity and distribution. When patient serum cytokine and TSH levels were separ ated into groups based on staining quantification, TNF detection in correlation to B19 protein detection, although an increasing trend was seen in TNF Figure 6 9 ; Kruskall Wallis Test; p=0.317, 0.523, and 0.298, respectively ). Interestingly, serum TSH levels were signficantly

PAGE 72

72 decreased in patients with low (+) detectable amou nt s of B19 capsid protein and IL 6 levels were signficantly increased in subjects with high (++) capsid protein Because of the extreme severity of the thyroid cancer, patient 11 was excluded from serum analysis for cytokine and TSH levels. Conclusions Our results show that B19 infection in the thyroid results in increased capsid protein detect ion in adenoma and tumor tissue. This increased detection of B19 capsids within the thyroid correlates with both increased IL 6 expression locally and circulating in the serum, contributing to increased inflammation in thyroid disease.

PAGE 73

73 Tab le 6 1. Subject information and B19 IgG and IgM detection in serum by ELISA and W estern blot. Sub # Age/ Sex Cat. Diagnoses ELISA Western Blot B19 IgG Western Blot B19 IgM B19 IgG B19 IgM VP 2p 1# VP N 2 VP 1S 3 VP 2r 4 VP C 5 NS1 VP 2p 1* VP N 2 VP 1S 3 VP 2r 4 VP C 5 N S1 1 34/F B Grave's disease +/ +/ + + 2 32/F B Grave's disease + +++ +++ +++ + +/ + + + 3 56/F B Multinodular hyperplasia 4 56/F B Multinodular goiter + + +++ +++ 5 58/ F B Chronic thyroiditis + ++ +/ +/ +/ +/ + + 6 24/F A Adenomatous hyperplasia + ++ +/ +/ +/ 7 71/F A H rthle cell adenoma +/ 8 54/F A Adenomatous hyperplasia +/ +/ +/ 9 65/F A Adenomatous hyperplasia + + 10 48/M A Follicular adenoma + +++ +/ +/ +/ 11 52/M T PTC, tall cell + + +++ ++ 12 47/M T Micropapillary +/ 13 66/F T H rthle cell carcinoma + ++ +++ +++ +/ +/ 14 55/M T PTC w/ thyroiditis and hyperplasia + +++ +++ +++ + +/ +/ 15 46/F T PTC N/A N/A N/A N/A N/A N/A + *B= Benign (non normal and autoimmune), A= Adenoma, T= Tumor; # Recognizes same antigen as Biotrin IgG ELISA ; 1 Main capsid antigen (confirmation epitope) ; 2 N terminal half of the structure protein VP 1 and VP 2 ; 3 Specific segment (differentiation to VP 2) ; 4 Main capsid antigen (linear epitope) ; 5 C t erminal half of the structure proteins VP 1 and VP 2 ; N/A not available due to high background Plus marks in Western Blot lanes denote positivity compared to cut positive or approximately equal to the cut positive or greater than 2 times the intensity of positive control.

PAGE 74

74 Table 6 2 Summary of cytokines, TSH, and B19 antibodies in serum and B19 DNA and protein detection in subjects with thyroid disease. Sub. # Serum Thyroid TNF (pg/ml) IL 6 (pg/ml) IFNy (pg/ml) TSH (mlU/l) B19 IgG/IgM ^ B19 DNA (nPCR) B19 Capsid Protein (IHC) 1 0.00 0.00 8.28 4.29 /+ + 2 0.04 14.52 15.08 0.07 +/+ + + 3 0.00 0.00 9.84 0.64 / 4 0.00 7.38 14.77 0.85 +/ + 5 0.00 3.99 4.69 1.51 + /+ + 6 0.00 7.75 0.00 7.97 +/ + ++ 7 0.00 14.42 5.39 4.06 */ + ++ 8 0.00 0.00 14.14 0.99 +/ 9 0.00 0.00 4.38 0.25 +/ + + 10 0.00 4.63 7.19 0.41 +/ + + 11 2.39 57.02 9.30 7.01 +/ + + 12 0.00 14.31 9.84 0.26 */ + ++ 13 0.00 9.04 7.42 0 .41 +/ + + 14 0.23 10.66 4.92 0.59 +/+ + ++ 15 0.00 13.02 11.48 0.17 NA/+ + ++ ^As detected by either ELISA or Western strip; *Marked as negative only 1 weak band below the cut off control by western count quantification.

PAGE 75

75 Figure 6 2 Western strips detecting B19 IgG (A) and IgM (B) antibodies in subject serum. Each strip is numbered abo ve with the subject number corresponding to each strip. Top line denotes positive reaction control, second IgG or IgM specificity, third cut off control for positive detection, and remaining denote different B19 antigens. (C) Quantification of B19 IgG anti body detection seen in (A) as determined by densitometry Thick line at 1 denotes the cut off control point. C

PAGE 76

76 Figure 6 2 B19 DNA detection and quantification in thyroid tissue. (A) n PCR was performed on thyroid DNA. The top gel is B19 detection and the bottom gel is the GAPDH loading control. The case number, (+) PYT103c positive control or ( ) negative control, and (*) 100 base pair molecular weight marker are labeled above each lane. PCR product size is 397 base pairs. (B) B19 g enome copy number s were quantified in two different DNA samples from each thyroid tissue as shown by markers in each group Genome copy numbers per g are shown with median and standard error bars for each group.

PAGE 77

77 Figure 6 3 B19 genome copy numbers were quantified serum sample s from each subject as shown by markers in each group. Genome copy numbers per ml are shown with median and standard error bars for each group.

PAGE 78

78 Figure 6 4 B19 DNA detection and quantification in normal and tumor thyroid fine needle aspirates H ematox ylin and eosin staining of normal (A) and tumor (B) FNA cells from a micropapillary carcinoma are shown. (C) Genome copy numbers per g in FNA samples from normal adjacen t and tumor cells from subject 6 (adenoma ) and subject 11 ( tumor ) tissues. Scale bar r epresents 10m.

PAGE 79

79 Figure 6 5 Increase in NS1 RNA in thyroid adenoma and tumor tissue (A) RT PCR detection of B19 NS1. The top gel is B19 detection and the bottom gel is the GAPDH loading control. The case number, (+) PYT103c positive control or ( ) nega tive control, and (*) 100 base pair molecular weight marker are labeled above each lane. RT PCR product size is 397 base pairs. (B) q RT PCR amplification of B19 NS1. Two different RNA samples were amplified from each subject, and total values were pooled f or each group. Adenoma and tumor values are shown relative to benign tissue levels. No significant difference was seen in B19 DNA or RNA between groups.

PAGE 80

80 Figure 6 6 B19 protein detection and quantification in thyroid tissue (A B) Differences in B19 ca psid IHC staining in the same tissue section are shown in brown (C) Corresponding IgG control to A and B showing lack of non specific staining Positive pixel count quantification was used to enumerate positive staining in sections from each subject. Tiss ue sections representing strong (++; D), weak (+; E) and negative ( ; F) IHC staining for B19 capsid protein s are shown (G) Total staining quantification in pooled adenoma and tumor tissues shows a significant increase compared to benign tissues (** = p<0 .01).

PAGE 81

81 Figure 6 7 Correlation of B19 capsid protein and IL 6 staining within thyroid tissue. (A) Linear c orrelation between benign (square), adenoma (diamond), and tumor (triangle) tissues for IL 6 and B19 staining are shown F our different matched se ctions from each thyroid case are represented The correlation between B19 detection and IL 6 expression is shown with the black line (B) Pooled IL 6 staining values in thyroid sections that are B19 positive or negative as determined by positive pixel qua ntification (** = p<0.01).

PAGE 82

82 Figure 6 8 Representation of p ositive pixel analysis for B19 and IL 6 detection in thyroid tissues B19 and IL 6 IHC staining as depicted by brown coloring is shown in (A) and (E), (B) and (F), respectively. Corresponding colo r maps of positive pixel calculations are shown in (C) and (G), (D) and (H), respectively, with color coding shown below. Numbers in the upper right corner of color maps denote the numerical pixel count based on total positivity of each section multiplied by average intensity of pixels.

PAGE 83

83

PAGE 84

84 Figure 6 9 Serum cytokine levels in subjects with B19 protein expression in the thyroid as measured by IHC Protein levels were assigned as ( ) negative, (+) low, or (++) high amounts of B19 protein in the whole tissue section by positive pixel count algorithm Serum cytokine and hormone levels were grouped by IHC ranking N=5 for ( ) and (++), n=4 for (+). = p<0.05

PAGE 85

85 CHAPTER 7 DISCUSSION B19 Infection and Persistence in the Thyroid B19 co antigen were more frequently detected in cellular binding to fibronectin and also acts as a cellular co receptor for B19 In the absence o f fibronectin binding of this integrin has been shown to downregulate cellular proliferation in some carcinoma cells (Varner et al., 1995). Downregulation of this integrin is associated with loss of cellular attachment, and may be occurring independent of virus infection (Dalton et al., 1992). Yet, strong localization of both co antigen) in normal adjacent tissue, decreased surface expression in tumors, and increased surface expression in the normal thyroid cell line compared to most tumor cell lines indicates that independent of the mechanism of receptor expression, normal thyroid cells are most likely the initial target of B19 in the thyroid. In nonpermissive cells, the nonstructural gene product (NS1) is predominately produced over the structural genes, resulting in a lack of replication (Liu et al., 1992). What mechanism limits full replication to only erythroid progenitor cells, to date, is still assoc iation with binding to the ribosome in nonpermissive cells, allowing for production of both RNAs but lacking assembly of full virions (Pallier et al., 1997). Still, what factor causes this restriction has yet to be determined. Just as with AAV, co infectio n with adenovirus can overcome this block and allow full replication and production of infectious B19 virions in cells deemed nonpermissive (Guan et al., 2009). In thyroid

PAGE 86

86 cancers and autoimmune diseases, infection with other viruses ha s been reported, and this, or another unknown factor, could contribute to the increase in capsid proteins seen in adenoma and tumor tissues. B19 DNA is known to persist in a wide variety of tissues but how B19 persists in human cells has yet to be determined. P rotein detecti on to our knowledge, that is not directly associated with acute infection, has been restricted to a small subset of those tissues including thyroid (Adamson et al., 2011) testis (Polcz et al., 2011) colon (Li et al., 2007), and synovial tissue and bone marrow (Norja et al., 2006; Takahashim et al., 1997) The mechanism for viral persistence is unknown, but other parvoviruses such as AAV are known to integrate into the human genome (Laughlin et al., 1986) making this one possible mechanism for continued B19 persistence. Minute virus of mouse (MVM) has been shown to have the ability to persist as an episome (Corsini et al., 1997). In adeno associated virus (AAV) gene therapy trials, persistence of AAV capsids in dogs and primates have been reported up to 6 years following gene transfer, suggesting intact capsids may persist for an extended amount of time by some unknown mechanism (Stieger et al., 2009). In this study, the question of whether the capsid proteins seen are persisting, intact virions, newly tra nslated, unincorporated capsid proteins, or recently assembled, infectious virus is unknown and an area of further investigation. Parvovirus Persistence While little is known about how Parvovirus B19 persists in human tissues, studies conducted on other parvovirus es have suggested multiple methods for persistence. Parvovirus genomes have been reported in a wide range of eukaryotic genomes,

PAGE 87

87 demonstrating the ability of this family of viruses to persist in host DNA (Liu et al., 2011) I n certain circumstan ces, parvoviruses can integrate in a site specific manner. Adeno associated virus (AAV) has the ability to integrate into a specific locus on the human chromosome 19 (Kotin et al., 1991). Recombinant AAV (rAAV) vectors have also been shown to integrate non specifically into the human genome ( Rivadeneira et al., 1998). Site specific integration has also been shown for M VM, which can integrate its genome in sequences corresponding to its origin of replication sequence (Corsini et al., 1997). This may be one me chanism for the persistence of B19 in thyroid tissues. Persistent parvovirus virions, not merely genomes, have been detected following acute infection. Karetnyi et al. detected B19 capsid as measured by immune adherence PCR in IgG positive patients with a cute liver failure, suggesting that B19 capsid may persist in tissues following acute infection (Karetnyi et al., 1999). Stieger at al. reported i ntact rAAV vectors were visible in canine and primate retinas 6 years following transduction by electron micro scopy (Stieger et al., 2009). B19 has also been detected in the cytoplasm of skin lesions by electron microscopy (Takahashi et al., 1995). In this study, the low quantity of B19 DNA and RNA compared to abundance of B19 capsid proteins detected by IHC sug gest that intact B19 virions could persist in thyroid tissues. Viral integration cannot be ruled out, and may also account for some of the DNA detected in these tissues. Further studies involving target electron microscopy to IHC positive cells could inves tigate this possibility. Parvovirus B19 Activity in Tumors Other members of the Parvovirus family have been shown to be anti tumorigenic (Rommelaere and Cornelis, 1991). B19 NS1 has been shown to induce apoptosis, but

PAGE 88

88 the data is restricted to erythroid de rived primate COS 7, kidney, and liver cells (Moffatt et al., 1998; Sol et al., 1999; Hsu et al., 2004 ; Poole et al., 2006 ). Moffatt et al. showed that expression of Bcl 2, a proto oncogene, protected NS1 transfected cells from apoptosis, suggesting the c ellular environment can influence the effects of NS1. Hsu et al. saw a similar induction in apoptosis in primary erythroid cells. NS1 expression in liver derived cells showed induction of apoptosis only in 35% of the transfected cells. This again points to a role for the cellular microenvironment in a n NS1 mediated phenotype. In COS 7 cells, NS1 expression resulted in both upregulation of p53 and induction of apoptosis (Hsu et al., 2004). Because p53 is commonly mutated in thyroid cancers, the thyroid cance r microenvironment may protect cells from NS1 induced apoptosis. In other parvoviruses, induction of apoptosis is oncogene specific Normal rat fibroblasts stabl y expressing MVM nonstructural genes were shown to undergo apoptosis upon transformation with c Ha ras (Moussett et al., 1994). The effect of oncogene transformation on apoptosis was correlated to amount of oncogene expressed. Transformation of the same cell line with v myc or v src increased the ability of MVM to induce apoptosis, but not with bo vine papilloma virus strain 1 (BPV 1) oncogene (Salome et al., 1990). Faisset et al. showed that H 1 apoptosis induction was stronges t in virally transformed cells While initial data in the thyroid demonstrates that NS1 does not induce apoptosis in PTC de rived cell line K1, examination of other thyroid cancer cell lines or normal thyroid cells may demonstrate a specific cellular phenotype in relation to NS1 expression.

PAGE 89

89 Role of B19 in Thyroid Disease Because IL 6 expression was correlated with neither disea se state nor B19 IgG alone, this suggests that persistent B19 expression may play a role in inducing inflammation. IL 6 is a potent inflammatory signaling cytokine that is upregulated in a wide range of disease including, but not limited to, cardiovascular disease, autoimmune disease, diabetes, and some cancers (Heikkila et al., 2008). While these data do not suggest that B19 is a cause of thyroid cancer, expression of B19 capsid proteins may create an inflammatory state that could influence an underlying d isease. When the effects of treatment for chronic hepatitis C on thyroid function were analyzed, an already elevated level of IL 6 prior to treatment was determined to be a predictive factor for subsequent thyroid dysfunction (Huang et al., 2012). In parv ovirus infection of canines, increased circulation of IL 6 and other inflammatory cytokines resulting from viral infection of the intestinal epithelium has been shown to affect the pituitary thyroidal axis. In this same study, decreases seen in TSH and fre e T4 following parvovirus infection were associated with decreased survival in infected canines (Schoeman and Herrtage, 2008). These studies further support that a B19 induced increase in IL 6 may be a contributing factor to disease progression. In our st udy, the cohort was small (n=15), but a larger study examining a wider range of cases may elucidate a broader impact for B19 in thyroid disease. Mode ls of Parvovirus B19 I nfection Because B19 is species specific to humans, modeling of infection in a labora tory is difficult. The lack of fully understanding the B19 life cycle and tropism has limited these types of experiments. In vitro and animal model studies are ideal for proving a

PAGE 90

90 viral role in pathogenesis, but because of both the limited supply of the vi rus and extreme tropism for humans, the models are wrought with many difficulties. Parvovirus B19 in vitro In vitro full replication is restricted to a subset of specialized cells of the erythroid lineage (Srivastava and Lu, 1988; Ozawa et al., 1987). Ev en when full replication is reported, titers are low and inadequate for large scale experiments (Miyagawa et al., 1999). While we have shown that B19 can infect thyroid cells in vitro (Figure 4 6), limited availability of virus and variability between samp les makes these experiments difficult to perform and repeat with reliability. Plasmid transfection or recombinant virus transduction is often employed to demonstrate the effects of a single B19 gene on a cell type of interest. Many of the associations of B 19 with transcription factors (NF B, STAT3) and cytokine expression (IL 6, TNF in vitro (Duechting et al., 2008; Fu et al., 2002; Moffatt et al., 1996). Therefore, in vitro models of B19 related disease may be the best method for directly understanding the impact of B19 gen e expression in a particular cell type, but does not adequately represent the complex cell architecture of many organs or the impact of the immune system. Parvovirus B19 in vivo Transgenic mouse models have been created to express B19 proteins to a limite d degree. In these models, the nonstructural gene NS1 is typically expressed by an organ specific promoter or under the control of a Cre loxP system in an organ of interest. To date, these models have adequately represented B19 NS1 involvement in non immu ne hydrops fetalis (Chisaka et al., 2002) and polyarthritis (Takasawa et al., 2004). When NS1 was transgenically expressed in the thyroid of C57BL/6 mice,

PAGE 91

91 development of autoimmune thyroid disease following thyroglobulin injection did not correlate with NS 1 expression (Mori et al., 2011). This indicates that NS1 alone may not be responsible for B19 alterations in thyroid disease. Many other parvoviruses share characteristics with B19 and may, in a limited sense, be employed to understand B19 infection in v ivo A simian parvovirus capable of infecting cynomolgus monkeys is 65% homologous to B19 and results in severe anemia in immunocompromised hosts. Histological examination of bone marrow from these animals showed features very similar to B19 associated an Yet, these models are good starting points to understand what role B19 may play in persistent disease. Animal models examining the impact of downstream effectors altered by B19 in humans, such as IL 6, may also be employed to expand upon the role of B19 i n thyroid disease. Limitations and Difficulties with B19 Related Methods The most common methods used to detect and confirm previous B19 infection is detection of viral DNA by nPCR and confirmation of B19 IgG and/o r IgM antibodies by ELISA. In combination, positive nPCR and ELISA results are commonly accepted as the gold standard of confirming B19 infection. Still, there are limitations and difficulties associated with both techniques that require stringent controls to confirm results. Nested PCR Detection of Viral DNA Nested PCR is an extremely sensitive technique for specifically detecting low level amounts of DNA (Cassinotti et al., 1993). Yet because of its sensitivity, contamination and false positivity are fre quent. To asses for these problems, multiple controls are necessary for each experiment. When DNA is extracted, a tube containing

PAGE 92

92 only water instead of a sample should be taken through the extraction process and amplified to detect any contamination presen t during the extraction process. When each experiment is run, a PCR negative that is also amplified by a 2 round reaction should be included. If possible, multiple primer sets and confirmation with a second method such a Southern blotting or dot blot hybri dization should also be used (Patou et al., 1993). In this study, multiple sets of primers were used to detect B19 DNA, and qPCR was used to quantify the amount of DNA. B19 DNA detected in this study was confirmed by differences, although slight, in genome values by qPCR and by the consisent lack of contamination in all negative samples examined. Detection of B19 Antibodies in Serum Previously published reports have shown B19 IgG seropositivity increases with age, with 30 60% of the adult population and g reater than 85% of the geriatric population possessing B19 specific IgG (Heegaard and Brown, 2002). Analysis of B19 antibodies by ELISA is widely accepted, and the kit provided by Biotrin which detects the conformational epitope of VP2 is frequently used c linically and for research purposes. In this study, both the Biotrin ELISA and a western strip containing 6 B19 antigens were used to detect B19 antibodies. In both of our cohorts, 55% (11/20) were IgG positive by Biotrin ELISA, yet 79% (15/19) were posit ive using western blot. These ELISA results are within previously reported positivity rates, but weakly detectable bands by western blot for various B19 antigens were also seen. This may show a low level antibody production or antibodies against other B19 antigens not detectable by the Biotrin system. Some bands seen using the Mikrogen strips were below the cut off control or very faint, indicating low or waning immunity to B19 This could explain results

PAGE 93

93 as seen in Chapter 6 with Patient 7 from the second cohort, who had high levels of B19 protein detected within the thyroid, but was negative by ELISA and had very low levels of B19 IgG detectable by western blot. Bredl et al. (2011), showed that in 16% of patients with mid range levels of circulating virus (10 5 10 7 geq/mL) no B19 antibodies (IgG or IgM) could be detected, indicating that multiple methods of detection (not merely ELISA) may be necessary in assessing B19 infection, particularly in a research setting. Weak IgM bands were also seen in 33% (5/15 ) of the total patients. These findings may suggest reactivation of presistant virus or more recent infection that was within weeks or months prior to surgery (or a weaker immune response in general). Klepfish et al. (2006) saw that in a patient treated wi th rituximab, B19 reactivation was observed. Conditions created by thyroid disease or its treatment may have triggered low level reactivation of persistent B19 Specificity of B19 Antibodies Used in Research Some studies have shown some B19 antibodies can bind human antigens and may be linked to autoimmune like symptoms (Lehmann et al., 2003). Lunardi et al. (1998), showed B19 IgG could also bind keratin, collagen II, cardiolipin and ssDNA. Binding of B19 IgG to thyroglobulin was analyzed in this study, an d their data indicated this protein was not a target of B19 antibodies. While this may be on e mechanism of B19 related disease, and is a concern for B19 antibodies used in protein detection, MAB8293 is a commonly used antibody in B19 detection studies both in vitro and in vivo (Wang et al., 2008; Zhi et al., 2006; Zakrezewska et al., 2001). Furthermore, the peptide used to confirm auto antigen binding recognized amino acids 57 80 in VP2, while

PAGE 94

94 MAB8293 (also called R92F6 ) recognizes amino acids 328 344 in VP 2. When pixel count parameters were applied to B19 staining, only 10 of 15 (66.7%) subjects were positive for B19 capsids, and staining within sections was not uniform, suggeting the antibody is not binding a common cellular protein While nonspecific bind ing of this VP antibody cannot be entirely ruled out, this strongly suggests that the antibody used in our study is truly recognizing B19 proteins in these patients. Conclusions Although the role of B19 in thyroid disease is still not clear, the data prese nted here can begin to elucidate a place for B19 in thyroid cancers. A summation of our theory of B19 / thyroid interaction is shown in Figure 7 1. Infection and detection in normal thyroid cells and tissue suggests that B19 infects the thyroid before disea se occurs, and capsid proteins persist at a low level (Figure 7 1: A B red lines ). Over an indefinite amount of time, environmental exposures (such as radiation), genetic mutation (BRAF, RAS, RET), or infection with another virus (HHV 6, HCV, EBV, SV40) may cause the thyroid to develop a specific disease (C). Upon this transition, an increase in B19 capsid proteins and NS1 expression is seen in tissues with persistent virus (D blue lines ). This increase in capsid protein detection then correlates with a c hange in the thyroid milieu specifically to IL 6 as shown here (E) but the interaction or impact on other molecules has yet to be investigated. All together, these data suggest that B19 may act as an aggravating factor to underlying thyroid disease, and when expressed in increased amounts, may contribute to altering the course of thyroid disease.

PAGE 95

95 Figure 7 1 Model of B19 interaction in thyroid disease.

PAGE 96

96 CHAPTER 8 FUTURE STUDIES Effects of NS1 in Thyroid Autoimmune D isease In our small cohort of matc hed serum and thyroid tissue samples (n=2), both patients with Graves disease had IgM antibodies specific to NS1. Infection with B19 has been shown to correlate with an increase in autoantibody production, including those against cardiolipin, rheumatoid f actor, anti nuclear antibodies and anti double stranded DNA antibodies (Hansen et al., 1998). While little data is available on NS1 IgM, p revious reports have shown that IgG antibodies against NS1 are associated with chronic B19 infection and more sever e a ssociated disease (Hemauer et al., 2000). Further studies encompassing a larger cohort of patients with thyroid autoimmune disease where viral (not only B19 ) circulating antibodies may begin to elucidate what role antibodies against B19 or other viruses, may play in thyroid autoimmunity. Expression of NS1 has been shown to induce apoptosis in a wide range of cell s in vitro ( Hsu et al., 2004; Poole et al., 2004; Moffatt et al., 1998). Induction of apoptosis has been shown to be a contributing factor to thy roid autoimmune disease, particularly Other studies have shown that autophagy can be activated in B19 infected cells, and activation of autophagy may aid in cellular survival not apop tosis (Nakashima et al., 2006). The mechanism of NS1 mediated cell death, or lack thereof, seems to be cell type dependent. What effect B19 has on cellular survival in thyroid cells particularly in its impact on thyroid autoimmune disease versus thyroid c ancers, has yet to b e determined. Understanding the impact of B19 expression, particularly NS1, on thyroid cells may be the first key in determining the role of B19 in thyroid disorders.

PAGE 97

97 B19 Correlation with T hyroid Signaling P athways While data on the r ole of B19 in thyroid signaling pathways is limited, studies have shown a connection between other parvovirus gene products and regulation of thyroid related signaling pathways. Vanacker et al. ( 1993 ) showed that the minute virus of mouse (MVM) nonstructur al gene product can activate the thyroid hormone receptor In this same study, the also concluded that T3 binding to cells could sensitize the cells to parvovirus infection /cytotoxicity Interestingly, data from our laboratory has shown that B19 infection may actually downregulate THR expression in som e cell types (data unpublished). How this a ffects normal and cancerous thyroid cells has yet to be determined. In vitro data has shown that B19 NS1 upregulate s phosphorylation of STAT3 in endothelial cells (Duechting et al., 2008). In medullary thyroid ca ncer, STAT3 activation by the mutated RET pathway has been shown to be essential for c fos activity that leads to cellular proliferation and transformation (Plaza Menacho et al., 2007). STAT3 phosphorylation has also been linked to hepatocyte growth factor and c met expression in PTC tumors and some adenomas, and this was suggested as a possible factor responsible for adenoma to carcinoma progression (Trovato et al., 2003). An increase in genes induced by hypoxic conditions has been observed in thyroid car cinomas; in particular, those with a BRAF V600E mutation (Zerilli et al., 2010). In this study, hyp oxia inducible factor 1 BRAF mutation. In vivo and vitro activation of the hypoxia pathway was associated with a more aggressive disease phenotype and therapeutic resistance (Burrows et al., 2009). B19 gene expression has been shown to be enhanced in primary erythroid cells

PAGE 98

98 under hypoxic conditions (Pillet et al., 2004). Whether this could be a factor contributing to enhanced B19 expression in thyroid tumors is an area to be further investigated. Underst anding the environments outside of the bone marrow where B19 can express efficiently will increase the knowledge of cellular requirements of the virus for both replication and persistence in non permissive cells Together, these data suggest that B19 may both contribute to thyroid disease progression by regulating thyroid signaling pathways and transcription factors, and be affected by the microenvironment created during thyroid disease. By examining the relationship between B19 and thyroid disorders, a be tter understanding of B19 biology and thyroid disease progression may be achieved. Co I nfection with Activating or Inhibitory V iruses Recent data from our laboratory has shown that Human Herpesvirus 6 (HHV 6) can co infect the same tissues as B19. Unique to HHV 6 is the latency protein U94, which is a homolog of the AAV2 replication protein, Rep 68/78 This protein has single stranded DNA binding properties (Dhepakson et al., 2002). In the thyroid cohorts studied in our laboratory, nuclear U94 was mostly l ocalized to normal tissue adjacent to tumors, and total amounts of U94 expression in tissues usually, but not always, correlated with increased B19 VP staining (data not published) This indicates that U94 nuclear expression may act as an initiating factor for increased B19 expression. Other viruses have also been associated with thyroid disease. A strong association between Hepatitis C Virus (HCV) infection and thyroid disorders, particularly cancers, has been reported (Antonelli et al., 2006). Shimakage et al. showed the expression of Epstein Barr virus (EBV) proteins, particularly EBNA2 and LMP1, known

PAGE 99

99 oncogene products of EBV, correlated with tumor progression in their cohort. T hey especially saw an increase in expression of these proteins in undifferen tiated (more aggressive) carcinomas compared to papillary carcinomas (Shimakage et al., 2003). In an examination of normal and tumor tissue, Vivaldi et al. showed the Simian virus 40 (SV40) was detected in 66 100% of PTC and ATC tumors, but also detected i n a decreased frequency in tissues adjacent to the tumors. In contrast, only 10% normal tissues and goiters were positive for the virus, suggesting that SV40 infects tumors and is able to spread to normal adjacent tissue (Vivaldi et al., 2003). Adenoviru s has been shown to act as a helper virus, allowing B19 replication in non permissive cells, yet few studies have been performed determining the effects of co infecting viruses on B19 expression, especially in the thyroid (Guan et al., 2009; Ponnazhagan et al., 1995). Together, this data suggests a wide range of viruses that infect and may influence the development and environment of thyroid tumors. Understand ing the relationship these viruses have with thyroid cells, and each other, is essential in underst anding the role of viruses in thyroid disease. Conclusions The role of viruses in thyroid disease, while not a new field, is lacking in convincing data of viral involvement in transformation and tumor progression. Most studies have been limited to detectio n and associations. Targeted approache s examining the effects of the viral immune response on the thyroid, the role of viral gene products in thyroid signaling, and the impact multiple viruses contribute is necessary to determine the role of B19 and other viruses, in thyroid cancer and disease.

PAGE 100

100 APPENDIX A NS1 EFFECT IN THYROID CELL IN VITRO Introduction NS1, the main non structural gene of B19 has been associated with a wide variety of effects including apoptosis ( Hsu et al., 2004; Moffatt et al., 1998 ) cytokine regulation ( Hsu et al., 2006; Fu et al., 2002 ), and transactivation of its own, other viruses, and cellular promoters ( Duechting et al., 2008; Mitchell, 2002 ). While the effects of NS1 in epithelial cells have been studied in numerous papers, l ittle data is available on its role in thyroid cells. Although at low levels, NS1 RNA was detected in vivo from RNA extracted from human thyroid tissues (Figure 5 5 ) t he goal of this study was to determine what effects related to apoptosis and cytokine in duction results from NS1 expression in thyroid cells. Methods NS1 T ransfection of Cell L ines A pcDNA 3.1 plasmid containing the NS1 gene driven by the p6 promoter was used to express NS1 in thyroid and non thyroid derived cells. All samples were transfecte d using FuGene transfection reagent (Promega) and grown according to their published instructions. The amount of transfection reagent was optimized prior to NS1 transfection to minimize transfection related cytotoxicity. All transfections were performed al ongside a mock transfected control w h ere the p6NS1 plasmid was substituted for an empty vector. To confirm expression of NS1, RNA was collected at 48 hours post transfection from each cell line using Tri Reagent according to the (Molecular Research Center, Molecular Research Center, Inc., Cincinnati, OH). All RNA was treated with DNase prior to amplification (Invitrogen).

PAGE 101

101 RNA was amplified using a one step RT NS1 primers. Analysis of C ell D eath Cell death was measured following NS1 transfection by two methods: 1) total cell counts and 2) cell fragmentation. Follo wing NS1 and mock transfection, the amount of viable cells was counted using trypan blue exclusion dye at 0, 6, 12, 24, 36, 4 8, and 72 hour post transfection. T otal cell lysates from thyroid PTC cell line K1 and medulloblastoma cell line Daoy, were collected at the same time points listed above 100l of cell lysate was analyzed using the Cellular DNA fragmentation ELISA accordi ng to the instructions (Roche, Indianapolis, IN). Quantification of Cytokine Secretion Supernatants from NS1 and mock tra nsfected K1, FTC133, TT, and N T hy O ri 3.1 were compared using a Signosis Inflammatory ELISA s trip that measured TNF IFNr, G CSF, GM CSF, IL 1 IL 8, IP 10, and RANTES (Signosis, Sunnyvale, CA ) Results NS1 D oes N ot S trongly Induce Apoptosis in Thyroid Derived C ells To determine if NS1 induces cell death in thyroid derived cells, K1, a PTC derived cell line, and Da oy, a medul l oblastoma derived cell line, were transfected with a plasmid containing NS1 driven by the p6 promoter, or with an empty (Mock o r p6R a vector with the NS1 gene inserted in the reverse orientation ) vector. Total cell counts were taken at 0, 6, 12, 24, 48, and 72 hours post transfection (Figure A 1) In Daoy cells, NS1 transfection decreased cell numbers at 48 and 72 hours post transfection.

PAGE 102

102 Interestingly, K1 showed an NS1 induced decrease at 24 hours post transfection, but similar values were se en at 48 and 72 hours. To confirm that the changes in cell numbers were because of cell death, lysates from each time point were analyzed by ELISA for histone release demonstrating cell fragmentation (Figure A 2 ). NS1 transfected Daoy cells showed an incr ease in cell death compared to mock transfected controls, while K1 NS1 and mock transfected cells showed similar, low levels of cell death. Together, these data show that our NS1 plasmid is capable of inducing cell death, and that cell death is reduced in PTC derived K1 cells. The Effects of NS1 are Strongest in PTC D erived K1 The effects of NS1 on cytokine production in thyroid derived cells was measured in PTC derived K1, FTC derived FTC133, MTC derived TT, and normal thyroid cell derived N T hy O ri 3.1 Cells were transfected using the same p6 NS1 plasmid or a mock plasmid, and total cell lysates were collected 48 hours post transfection Expression of NS1 was confirmed in each cell line by RT PCR on total RNA for the NS1 gene. K1, FTC133, and N T hy O ri 3 .1 expressed NS1 at approximately equal levels, while TT showed decreased expression. No NS1 expression was seen in mock transfected cells (Figure A 3). To determine if NS1 expression altered secretion of other inflammatory cytokines NS1 and mock transfe cted cell ular supernatants were collected at 24 hours post transfection and analyzed using an inflammation ELISA array that measured TNF CSF), granulocyte macrophage colony stimulating factor (GM CSF) IL 8, Interferon gamma induced

PAGE 103

103 protein 10 (IP 10, also known as CXCL10), and Rantes (also known as CCL5). Total changes in values for NS1 minus m ock transfected supernatants are shown in Figure A 4A (p<0.10). Significant changes were seen in all c ell lines for at least one cytokine, with the largest changes seen in K1 (Figure A 4B). Conclusions Together, these data show that NS1 expression in the thyroid does not induce cell death to a detectable extent, and can induce a change in cytokine express ion. Limited data was obtained examining NS1 induction of Caspase 3, and although the data was not conclusive, it suggested NS1 does not activate Caspase 3 in thyroid cells (data not shown). Other studies have reported that cell survival can be seen in B19 infect ion where autophagy is activated (Nakashima et al., 2006). Further analysis is needed to examine the role of B19 on apoptotic, autophagocytic, and necrotic pathways in thyroid cells. While the cytokine data presented here is limited further studi es looking at NS1 effects on other cytokines and related pathways may reveal a stronger role for B19 in thyroid disease. Furthermore Li et al. ( 2007 ) showed that expression of VP1u, not NS1, was sufficient to upregulate expression of cyclo oxygenase 2 pro teins (COX2), indicating that other B19 gene products may be involved in B19 related phenotypes. Further studies that more adequately examine the role of all B19 gene products and effects on multiple pathways may better elucidate a more clear relationship between B19 and thyroid disease.

PAGE 104

104 Figure A 1 Decrease d cell numbers in Daoy but not K1 following NS1 Transfection Total viable cells were counted using trypan blue dye at each time point listed above in Daoy (A) or K1 (B) cells. Each point shows the average of two experiments.

PAGE 105

105 Figure A 2 Lack of apoptosis in PTC derived K1 Cell fragmentation in NS1 and Mock (P6R) transfected medulloblastoma cell line Daoy and PTC cell line K1 were compared at 0, 6, 12, 24, 48, and 72 hours post transfection Abs orbance values denote detection of fragmented DNA by ELISA measuring quantity of free histones

PAGE 106

106 Figure A 3 Expression of NS1 in thyroid derived cells C ells were collected 48 hours post transfection and RNA was analyzed by RT PCR. The top line represen ts the samples that underwent reverse transcriptase, the middle those only amplified by PCR to exclude DNA contamination, and the bottom the GAPDH control. P represent s the plasmid positive control, (+) denotes NS1 transfection ( ) denotes m ock transfecte d, and N denotes negative PCR control.

PAGE 107

107 Figure A 4 Alterations in cytokine secretion 24 hours following NS1 transfection in thyroid cells Total changes in cytokine production (NS1 Mock values) 24 hours post transfection are shown in (A) for duplicate e xperiments measuring 8 inflammatory cytokines in 4 thyroid derived cell lines. Values that were measured to be significant (p<0.10) are shown in (B).

PAGE 108

108 APPENDIX B DILUTION CLONING OF THYROID CELL LINES Introduction Serial dilution cloning is a fast and ea sy method to isolate single cell colonies from heterogeneous cell lines. In vivo data has shown that, when detected, B19 is not found in every cell within the thyroid (Adamson et al., 2011). Furthermore, other members of the Parvoviridae family have been s hown to replicate better in the presence of specific oncogenes. Studies have shown that Rat Parvovirus H 1 has minimal effects on viability of nontransformed cells, yet is able to achieve lytic infection in all immortalized neuroblastoma lines examined (La croix et al., 2010) In minute virus of mouse (MVM) infection, Raf 1 was responsible for capsid protein phosphorylation and import into the nucleus. Cells lacking Raf 1 were unable to produce mature progeny virus (Riolobos et al., 2010). By generating cel l lines derived from dilution cloning, a better understanding of B19 infection and expression in the thyroid may be able to be achieved. The goal of this study was to generate single cell colonies from several thyroid cell lines, and characterize these cel ls for B19 related studies. Methods Generation of D ilution C lones Thyroid cell lines K1, SW579, and TT were dilution cloned to create 8 single cell cultures. All cells were grown in their previously published medias at 37 C/ 5% CO 2 except SW579, which was grown in the absence of CO 2 15,000 cells were placed in one well of a 96 well plate and grown overnight. The next day, the cells were serial diluted 1:2 for 9 additional wells. 200l of the final well was added to 10ml media, and mixed thoroughly 100l of this cell mixture was then aliquoted onto the remainder of the

PAGE 109

109 96 well plate. The plate was tilted at a 45 0 angle for 20 minutes to promote adherence to the outside of the well. Media was replaced daily until sufficient wells were confluent with cells. Calculating Doubling T imes Once cells reached confluency in a 10cm 2 dish, 300,000 cells were counted and plated in a 6 well culture container. Cells were collected and counted using Trypan blue exclusion at 0, 6, 12, 24, and 48 hours following plating. Exp onential growth curves were used to calculate doubling time. n PCR for B19 DNA To determine if B19 DNA persists in only a subset of thyroid cells, nPCR for B19 was performed on DNA from each dilution clone. Approximately 1 million cells were suspended in 1m l of a whole cell lysis buffer consisting of 50 mM Tris Cl (pH 8). 10 mM EDTA. 0.8 % sodium dodecyl sulfat e. Nine microliters of proteinase K was added to each tube and incubated for 1 hour at 56 0 C with mixing every 20 minutes. Five hundred microliters sod ium chloride was added to each tube and shaken vigorously. After the tubes were centrifuged for 10 minutes at 3,200 rpm, the supernatant was transferred to a new tube. Three milliliters 100% ethanol was added, mixed by inverting, and centrifuged again as a bove. The supernatant was then removed, the pellet air dried and resuspended in 100 l nuclease free water. The NS1 gene was detected in each sample by nPCR using the outer primer pair F1 GGGCCGCCAAGTACAGGA AGGTGTGTAGAAGGCTTCTT and ne sted F2 AATGAAAACTTTCCATTTAATGA TCCTGAACTGGTCCCGGGGATGGG of DNA was amplified in

PAGE 110

110 12.5l 2X Taq mastermix, and 0.5mM forward and reverse primers. Water was added up to 25 l. Amplification was carried out following an init ial denaturation for 5 minutes at 9 5 C, followed by 30 cycles of 9 5 C for 30 seconds, 55 C for 30 seconds, and 68 C for 30 seconds. A final extension time of 68 C for 5 minutes was performed. Five microliters of the first round reaction was amplified as ab ove with nested primers. A plasmid containing the B19 genome and water were used as positive and negative controls, respectively. Products were run on a 3% agarose gel containing ethidium bromide and visualized using a Bio Rad UV gel dock. Storage One mi llion cells were collected by centrifuging at 1,200rpm for 5 minutes. Pellets were suspended in growth media supplemented with 5% DMSO, frozen overnight at 80 C, and store permanently in liquid nitrogen. Results For each cell line, at least 3 morphologic ally different cell lines were generated by dilution cloning. Eight of the 10 TT clones can be seen in Figure B 1. Clones 3, 12, and 15 had a faster growth time, and gre w in more distinct, connect ed clusters. Clone 5 showed axon appearing extensions, and g rew very slowly. Clones 6 and 16 had an parent TT cell cultures. Doubling times were calculated for each dilution clone, and times varied greatly between cultures. Three clones from parent cell line K1 labeled K1 2, K1 4, and K1 45 had doubling times that varied between 18 and 30 hours as shown in Figure B 2. Similar results were seen in dilution clones created from all three parent cell lines.

PAGE 111

111 To determine if B19 persis tence was restricted to a subset of cells in thyroid cell lines, 8 DNA samples from SW579 dilution clones were analyzed by nPCR for B19 Two of the 8 samples showed positive bands for B19 (Figure B 3). Similarly, 2/8 samples were positive in TT, and 4/8 we re positive in K1 dilution clones. Detection of B19 in dilution clones appeared to be independent of doubling times. Further investigations of gene expression in these cells may elucidate a better relationship between B19 and the thyroid. Discussion By di lution cloning, 8 morphologically unique cell lines were created from each parent cell line that varied in growth time and B19 persistence. While no distinct phenotype has yet been linked to previous B19 infection, these cell lines, once fully validated, c ould have a multitude of use s By understanding the genetic background and characteristics of each clone, their ability to support viral infection and expression may reveal genetic factors important in the B19 lifecycle. Furthermore, these cell lines, inde pendent of B19 infection, may prove to be great representations for different stages of thyroid disease and could be used for both in vitro and in vivo modeling.

PAGE 112

112 Figure B 1 TT dilution clone characteristics. Morphology of 8 different TT dilution clone s is shown at 20X.

PAGE 113

113 Figure B 2 Doubling time of 3 K1 dilution clones. Doubling time of 3 different K1 dilution clones are shown in parenthesis next to the clone name. Cell counts were taken in triplicate at each of the 5 time points shown. Exponential growth curves were generated from 5 different cell count time points over 50 hours.

PAGE 114

114 Figure B 3 B19 nucleic acid detection in SW579 dilution clones. DNA from 8 different SW579 dilution clones w as analyzed for B19 DNA. Two of the 8 showed evidence of persistent B19 DNA. p YT103c, a plasmid containing the nearly full length B19 genome, was used as a positive control 100 base pair molecular weight marker is shown The PCR reaction mixture without a template was used as PCR product size is 491 base pairs.

PAGE 115

115 APPENDIX C DETECTION OF PARVOVIRUS B19 CAPSID PROTEINS IN TESTICULAR TISSUE Peer reviewed Publication Polcz ME, Adamson LA Datar RS, Fowler LJ, Hobbs JA. 2011. Detection of parvovirus B19 capsid proteins in testicular tissues. Urology 79(3):744.e9 15 PMID#: 22137539 Introduction We previously reported B19 persistence in normal brain and thyroid cancers, and an immunohistochemical (IHC) stain on an FDA standard tissue array for B19 capsid prot ein has also detected its presence in testis tissue. Current literature on the incidence of B19 DNA in the testis remains inconclusive, and no positive IHC results had been obtained previously. In the U.S. it was estimated that 8,480 men would be diagnos ed with, and 350 men would die of, testicular cancer in 2010 (Jemal et al., 2010) T esticular tumors represent the most prevalent type of cancer in males 20 34 years of age (Altekruse et al., 2007) Testicular tumors are often classified as either seminoma or nonseminomatous germ cell tumors, the latter consisting of embryonal carcinomas, teratomas, endodermal sinus tumors, and choriocarcinomas. Testicular tumors are often diagnosed by their histopathology, though up to 60% contain a mixture of histological patterns (Cotran et al., 1994) Typically the nonseminomas demonstrate mixed histologies, but in approximately 10% of cases, seminoma and nonseminoma components can be associated within the same tumor, and seminomas can even switch to a nonseminomatous ph enotype (van de Geijn et al., 2009) While the average 5 year survival rate is over 95% if diagnosed early before distant spread, the incidence of these cancers has been steadily rising with an average increase of 1.5 2.3% from 1976 2005 (Altekruse et al ., 2007) The reason(s) for this

PAGE 116

116 increase is unknown. The etiology of these tumors is poorly understood because of a considerable geographic and racial variation in incidence. Commonly accepted predisposing factors include cryptorchidism, genetics, and tes ticular dysgenesis. A viral role has also been suggested due to the young age of the affected population, the steadily increasing incidence of these tumors, and overexpression of w ild t ype p53 in many cases (Newell et al., 1984) Parvovirus B19 (B19) is a small, non enveloped, single stranded DNA virus (Cossart et al., 1975) B19 encodes its major nonstructural protein (NS1) on the left side of its genome and two capsid proteins (VP1 and VP2) on the right. VP1 and VP2 are identical except for a 226 amino acid sequence at the N terminus of VP1, designated VP u B19 is a common human pathogen known to cause erythema infectiosum (fifth disease) in children and polyarthropathy in adults. B19 also causes acute aplastic crisis in individuals with shortened red bl ood cell survival chronic anemia in immunocompromised hosts and non immune hydrops fetalis, fetal or congenital anemia, abortion, and stillbirth during pregnancy (Young and Brown, 2004) In addition, B19 is a cause of thrombocytopenia and myocarditis (Bo ck et al., 2010) B19 has also been highly associated with various types of thyroid cancer (Wang et al., 2008; Adamson et al., 2011) Viral persistence has been described not only in immunocompromised individuals, but also in symptomatic and non symptomati c immunocompetent individuals (Kurtzman et al., 1987; Lefrere et al., 2005) B19 is only known to replicate in erythroid progenitor cells, yet B19 DNA has been detected in various tissues, including the skin, tonsils, liver, synovia, thyroid, brain, and s erum (Hobbs JA, 2004; Norja et al., 2006; Adamson et al., 2011) This long term persistence

PAGE 117

117 of B19 in such a diverse set of tissues requires more research into the molecular mechanisms by which B19 can enter these cells, as well as possible etiological rol es in chronic disease. Current literature on the persistence of B19 in the testis remains inconclusive. One study reported by Gray et al. has detected B19 sequences by PCR in 85% of the testicular germ cell tumors tested (N=39), but not in any normal con trols (Gray et al., 1998) Diss et al. subsequently found B19 DNA at a lower rate in tumor samples, but also in normal tissues, and microdissection suggested the virus to be widespread (Diss et al., 1999) Tolfvenstam et al. tested serum collected before t he onset of cancer and could not find any association between previous infection with the virus and subsequent development of disease (Tolfvenstam et al., 2002) They did, however, confirm an increased frequency of B19 DNA in testicular tumors. This observ ation has been further verified by Ergunay and colleagues, who employed a real time PCR assay (Ergunay et al., 2008) Two of the previous studies also assessed for B19 capsid proteins in testis tissues by IHC and were reported as negative, so to date, no e v idence beyond DNA detection has been determined for test i s (Diss et al., 1999; Tolfvenstam et al., 2002) In this report, we demonstrate for the first time the presence of B19 capsid protein in various normal and tumor testis samples by IHC. Materials an d Methods Samples A testis tissue array (Catalog #Z7020096), a separate testis tumor tissue slide (Catalog #T2235260 3), and an FDA standard tissue array (Catalog #T8234700 1) were obtained from BioChain, Inc. All contained formalin fixed, paraffin embedd ed tissues All

PAGE 118

118 ages and pathologies are listed in Table C 1. Testis genomic DNA (gDNA) from a 24 year old normal subject was purchased from BioChain (Catalog # D1234260). Immunohistochemistry (IHC) IHC was performed on each above slide along with an acut ely B19 infected fetal liver positive contro l and a n IgG negative. The slides were baked for 30 minutes at 62 o C, then rehydrated two xylene washes followed by a descending alcohol series. Endogenous perox idase activity was blocked by a 10 minute incubation in 0.3% hydrogen peroxide in methanol Heat induced a ntigen retrieval was performed in 10mM Citra ( pH=6.0). Sections were blocked in avidin block solution with 1% horse serum in Tris buffered saline (TBS) for 25 minutes at room temperature. A biotin block and 1% horse serum solution included a 1:50 dilution of a primary antibody that recognizes an epitope common to the VP1 and VP2 structural proteins of B19 (Millipore, Catalog # MAB8293), and was used to incubate the samples overnight at 4 o C in a humid cha mber. The samples were then incubated at room temperature for 30 minutes in solution containing anti mouse immunoglobulin G (IgG) (Vectastain ABC Kit Mouse IgG: Catalog # PK 4002) and 1% horse ser um in TBS. The antibody complex was detected using a n avidi n biotin detection solution in TBS for 30 minutes at room temperature. Positive staining was detected after incubation for 5 20 minutes at room temperature with diaminobenzidine liquid (ImmPact DAB kit Catalog # SK 4105). The avidin biotin blocking kit was purchased from Vector Labs (Catalog # SP 2001) The slides were counterstained with hematoxylin (Electron Microscopy Sciences, Hatfield, PA) to identify the nuclei, and dehydrated in an ascending series of alcohol. Images were taken on a Lecia DM 2500 up right microscope.

PAGE 119

119 Polymerase Chain Reaction (PCR) Four primer sets were used to det ect B19 DNA in a normal g DNA sample in triplicate. One primer set, referred to as P1 ( GTACGCCCATCCCCGGGACCAGTTCAGG position 2060 2087) and P5 ( CCCACATGGCAGCTACAT CGCACCAAAT position 2369 2342), targets the NS1 region of B19 (Nikkari et al., 1995) Three nested ( nPCR) primer sets were also used. The first set consisted of VPu1 ( GCAAATGGTGGGAAAGTGAT position 2460 2480), VPu2 ( AACTTCCGGCAAACTTCCTT po sition 3092 3072), VPuN1 ( CCCATGCCTTATCATCCAGT position 2715 2735), and VPuN2 ( TGAATCCTTGCAGCACTGTC position 2902 2882). The second set consisted of 4A ( AACGCCTCAGAAAAATACCC position 3101 3120), 4B ( TAAGTGCTGAAACTCTAAAGG positio n 3445 3425), 4C ( CAAAAGCATGTGGAGTGAGG position 3187 3206), and 4D ( ACCTTATAATGGTGCTCTGGG position 3290 3271). The third set consisted of NS1 ( GGGGCAGCATGTGTTAAAGT position 1353 1373), NS2 ( TCCCAGCTTTGTGCATTACA position 1854 183 4), NSN1 ( CTGCAAAAGCCATTTTAGGC position 1583 1603), and NSN2 ( CATGTCAGGGCTGCATCTTA position 1792 1772). These nested primer sets target the VPu, VP1, and NS1 regions of B19, respectively. To ensure quality of the DNA, the sample was also test ed for actin. 2.5 pg of pYT103c plasmid, a nearly full length clone of the B19 genome, was used as the positive control, and a negative control reaction was included. 1g of the testis gDNA was added to a PCR master mix and amplified according to the manufactur (New England BioLabs,

PAGE 120

120 Catalog # M0270L). Products were analyzed on a 3% agarose gel containing ethidium bromide and visualized in a ChemiDoc XRS Universal Hood II under UV light (Bio Rad). PCR products were extracted from the agarose gel using a GeneJET Gel Extraction Kit were sent to the University of Florida Interdisciplinary Center for Biotechnology Research DNA Sequencing Core facility S equences were com pared to known B19 sequences using the National Center for Biotechnology Information Basic Loc al Alignment Search Tool (BLAST; Altschul et al., 1990) Results Detection of B19 capsid proteins in testis tissues There was detection of B19 capsid protein by IHC in most of the normal adult ( 6/7 = 85.7 %) samples, and the majority of testis tumor (1 7 /2 3 = 73.9 %) samples The malignant fibrohist i ocytosis sample and 9 /1 4 ( 64.3 %) of seminoma s also showed positive detection. A normal fetal testis sample displayed a wea kly equivocal signal within the nuclei. There was good reproducibility between the duplicate sections and duplicate slides A summary of the results is shown in Table C 1 Figure C 1 demonstrates some of the variation in signal localization in the various types of pathological diagnoses. While most of the samples tested exhibited positive staining, there was variation in the pattern between different types of tumors, including within the same tumor type. The normal samples showed strongest positivity of nu clear and cytoplasmic staining in the most basally oriented germ cells with a loss of signal as they mature. The interstitial Leydig cells showed weak staining. In the granuloma, the most intense staining was

PAGE 121

121 found in the reactive epithelial cells. The int erstitial cells displayed weaker signal, and the spermatozoa in the lumen displayed no signal. The tuberculosis sections consisted mainly of invading plasma cells and lymphocytes, the former displaying weak positive signal and the latter negative. Histiocy tes within the section were also positive for B19 (Figure C 2). One tuberculosis section contained remnants of tubules with strong epithelial staining. While the adenoma section was noted by Biochain to be of the epididymis, it seems to instead be taken fr om the rete testis There was positive staining of the squamous epithelial cells, while the connective tissue (mediastinum testis ) was largely negative. The seminomas displayed a range of staining patterns. Five were negative for B19. In the remaining s eminomas, the tumor cells displayed positive staining, while the lymphocytes generally did not. The fibrohist i ocytosis was alike in that the tumor cells displayed a positive B19 signal, but the invading lymphocytes were negative. The endodermal sinus tu mor displayed widespread staining in the malignant cells. The embryonal carcinoma displayed a pattern of weak staining in the tumor cells that had arranged themselves into a characteristic glandular pattern. The most intense B19 staining of the array was f ound in the Non of lymphocytes invading the interstitium were positive along with the germ cells. Detection of B19 DNA B19 DNA was detect ed in the normal testis g DNA with all four primer sets used (Figure C 3). Pos itive results were verified by aligning the amplified product to a known B19 Au sequence (Altschul et al., 1990) The positive and negative co ntrols displayed actin PCR confirmed the presence of quality gDNA.

PAGE 122

122 Discussion B19 capsid proteins have now been detected in both testis and thyroid tumors, although proteins are also detectable in normal testis tissue. We performed IHC using the above protocol on an FDA array containing 30 types of normal tissue and 41 different tumor tissues (data not shown) and have only been able to definitively detect B19 capsid proteins in testis skin, immune cells, and thyroid tissu e. A few other tissues on the array had equivocal staining. To date, we are the first group to detect B19 in testis tissue by IHC. Two other groups have unsuccessfully attempted to find viral protein by IHC (Diss et al., 1999; Tolfvenstam et al., 2002) We believe the conditions we have defined in our study are optimized to detect B19 capsid protein in tissues. When IHC was attempted in thyroid tissue using other methods of antigen retrieval such as DAKO, or more dilute antibody (1:200 or greater), we were unable to detect viral capsid protein. Yet using the conditions described above, virus was detected in the same tissues previously staining negative (unpublished data). This shows that IHC optimization for each tissue type is necessary for accurate detecti on of B19. Another possible explanation is that an insufficient number of tissue samples were tested previously as we too found an occasional negative testis tissue. Th rough both one round and n PCR, we were able to verify that the normal testis DNA sampl e had observable amounts of B19 DNA. This agrees with previous studies that detected B19 DNA in benign testis tissue and our IHC results that have detected B19 capsid protein in 6/6 normal samples (Diss et al., 1999) While n PCR is prone to contamination, this was likely not the case. All controls excluding any template DNA were negative, and B19 could also be detected in one round PCR. Moreover, the

PAGE 123

123 sequences amplified from the gDNA were not identical to that of the positive control ( 95 99% versus 99 100% identity to B19 Au reference, respectively). The status of infection (acute versus chronic) was not known for this patient. It also remains unknown whether persistent B19 infection involves integration of t he B19 genome into the cellular DNA or if it resi des in the cell episomally. Two of the co receptors for B19, integrin 5 1 and P antigen are reported ly expressed in testicular tissue, although 5 1 has o nly been reported in rat testis (Olie et al., 1996; Giebel et al., 1997) P antigen has been shown to be upregulated in both adult tissues compared to children and of testicular tumors compared to normal testis. Therefore it is not implausible that B19 can infect testis Full replication is not necessary for B19 to affect testis tumors. In non permissi ve cells, B19 NS1 can be expressed at levels that can lead to cytotoxicity (Hsu et al., 2004) NS1 has multiple functions, and can transactivate cellular promoters such as those for IL 6 and TNF (Moffatt et al., 1996; Fu et al., 2002) Whether these or o ther genes are altered in testicular tumors remains an area of future investigation. It has been reported that there are increased levels of w t p53 in testicular seminomas and papillary thyroid carcinomas, two tumor types highly associated with B19 infecti on (Guillou et al., 1996; Horie et al., 2001) What common features make both of these tissues contain a large amount of B19 capsid proteins has yet to be determined. Recent studies have found that the mean time from onset of testicular tumor development until diagnosis is 12.5 17.4 weeks, with a weak correlation between a larger gap and metastasis (Connolly et al., 2011) If B19 capsids are present in both normal and tumor tissue, it is worth investigating if B19 may act as an early marker of

PAGE 124

124 tumor i gene sis and may be a factor capable of decreasing this time from development to detection. The presence of B19 in normal tissue may indicate a cellular shift not seen on the histological level. Many autonomous parvoviruses are known to preferentially replicate in tumors, although many of these viruses are oncolytic (Rommelaere et al., 2010) Even though the direct role for B19 in testicular carcinomas cannot be determined from these studies, it may shed some light into the cellular milieu of these tumors. Test icular tumors, as previously noted, are mainly divided into two types: seminoma and nonseminomatous. In at least one of the seminoma cases analyzed, the B19 staining seemed to localize to cells surrounding the fibrous septa in the tumor. This indicates the re may be a particular subset of cells that the virus prefers. In contrast, the seminomas negative for capsid proteins may be uniform seminomas, or the patients may not have had B19 exposure. While seminomas are the most common type of testicular cancer, m any tumors have a mixed pathology (van de Geijn et al., 2009) Tumors with a varied distribution of B19 staining may be explained by a mixed tumor ty pe. This was evident in a tuberculosis testis sample, where the granulomatous testis tissue was negative wh ile the strongest staining was localized to epithelial cells lining the tubules in a small portion of the tumor. Interestingly, the tuberculosis section also contained positive B19 staining of immune cells, including histiocytes (Figure C 2). Because eryth roid progenitor cells, the only known permissive cell s for B19, and immune cells are ultimately derived from the same hematopoietic stem cell, the potential for these other blood cells to be carriers of the virus remains an area of future study. In compari ng the various tissue sections, the lymphocytes, another type of blood

PAGE 125

125 cell, also displayed an intriguing pattern of B19 staining. Only the cancerous lymphocytes of the non healthy lymphocytes in the other sections did not. One study has found evidence of B19 infection in 5/10 patients with non with a variety of hematological disorders (Us et al., 2007) We have found that in commercially supplied tissue arrays, sometimes the supplied diagnos e s are debatable or the tissue section is too small to provide a full view of the tissue. More studies with larger tissue sections as well as clinical pathology reports may give a clearer picture of the localization of B19 proteins in testis tissues. warranting fu r ther investigation. B19 DNA has been detected by several studies in testis tumors, but to our knowledge, this is the first time viral proteins have been detected by IHC. Whether this is from acute viral infection or reactivation of previously present vi rus is an area of current investigation. It is of interest that we found capsid proteins in both normal and tumor tissue. While all but one of the normal adult testis samples were positive, the normal fetal testis sample displayed a comparatively weak signal. B19 is known to be capable of vertical transmission from mother to fetus. It is estimated that the incidence of B19 vertical tr ansmission to a fetus is 0.24% 1.65%. Fetal B19 infection can lead to stillbirth, abortion, or a self limiting asymptomatic episode (Heegard et al., 2002) Since the cause of death of the fetal sample is unknown, it is a possibility that acute B19 infe ction in the mother was transmitted to the fetus. It should also be noted that the sample was taken from a fetus at 29 weeks of gestation. It has been found that the greatest chance of a fetus having adverse effects after infection occurs

PAGE 126

126 between 11 and 23 weeks of gestation (Heegard et al., 2002). Weak presence of B19 capsid proteins in the testis may be an indication of more intense infection elsewhere in the fetus. A tissue section of a 1.5 year old child with an endodermal sinus tumor stained positive for B19. The signal for this sample was quite strong, as compared to the normal fetal sample, indicating that B19 capsid protein presence in the testis may be higher when infection occurs after birth. tissue by h istology may not be normal, and the presence of B19 protein may be a signal of molecular and cellular changes heralding tumorgenesis The presence of viral proteins in this wide array of testis tissues leads us to believe B19 may play a role, even if indir ectly, in testicular tumors.

PAGE 127

127 Table C 1. Given ages and pathologies of Biochain tissue sections and corresponding IHC data. Pathology Anatomic Site Age B19 IHC Results Normal Testis 73 + Normal Testis 70 + Normal Testis 69 + Normal Testis 24 + Normal Testis 20 + Normal Normal Normal Testis Testes Testes 36 23 Fetus + /+ Seminoma Testis 47 + Seminoma Testis 63 + Seminoma Testis 29 Seminoma Testis 29 + Seminoma Testis 44 + Seminoma Testis 70 + Seminoma Testis 36 Seminoma Testis 25 Semi noma Testis 30 Seminoma Testis 28 Seminoma Seminoma Testis Testis 34 54 + + Seminoma Testis 32 + Seminoma Testis 56 + Tuberculosis Testis 47 + Tuberculosis Testis 30 + Fibrohistocytosis Testis 51 + Malignant fibrohistocytosis Testis 52 Endod ermal sinus tumor Testis 1.5 + Embryonal carcinoma Testis 40 + Non Hodgkin lymphoma Testis 72 + Granuloma Epididymis 36 + Adenoma Epididymis 58 +

PAGE 128

128 Figure C 1. Variation in IHC staining of B19 capsid protein. All pictures were taken at 20X. Brown col oration indicates positive staining, and nuclear hematoxylin staining appears blue. Figure A shows positive nuclear staining of the positive control, an acutely infected fetal liver section. Figure B shows strong localized epithelial staining in a section identified by Biochain as a granuloma. Figure C is a normal tissue section, showing increased signal in the less differentiated germ cells. Figure D displays a normal tissue section that shows a negative signal for B19. Figure E is an endodermal sinus t umor of a 1.5 year old patient that shows a strong positive staining in the tumor area. A weakly positive signal is shown in Figure F, a normal fetal testis sample.

PAGE 129

129

PAGE 130

130 Figure C 2 Positive B19 staining of immune cells in testis tissues. All pictures wer e taken at 20X. Brown coloration indicates positive staining, and nuclear hematoxylin staining appears blue. Figure A shows a seminoma with positive B19 staining in the tumor cells and negative signal in the invading lymphocytes (arrow). Figure B is a non lymphoma section where both germ cells (arrow) and lymphocytes (small arrow) display strong B19 staining. Figure C is a tuberculosis section, and while the epithelial cells in the bottom right corner display the strongest B19 staining, there is a lso positive signal in the invading histiocytes (arrow). Figures D F are the respective IgG controls.

PAGE 131

131 Figure C 3 PCR Detection of B19 DNA. Lanes 1, 7, and 9 contain a DNA ladder. Lanes 4, 5, 8, 12, 13, 17, 18, 22, and 23 contain 1 g of normal test is gDNA. Lanes 2, 10, 15, and 20 contain 2.5 pg of pYT103c. Lanes 3, 11, 16, and 21 are PCR negatives without any template DNA. Lanes 6, 14, and 19 are empty. Primer sets: P1/P5 Lanes 2 actin Lane 8; 4C/4D Lanes 10 13; VPUN1/VPUN2 Lanes 15 18; NSN1/NSN2 Lanes

PAGE 132

132 APPENDIX D INCREASED IL 6 DETECTION IN DULT AND PEDIATRIC LYMHPOID TISSUES HARBORING PARVOVIRUS B19 Peer reviewed Publication Polcz ME, Adamson LA Lu X, Chang MH, Fowler LJ, Hobbs JA. 2013. Increased IL 6 detection in adult and pediatri c lymphoid tissue harboring Parvovirus B19. Journal of Clinical Virology. Accepted in press Introduction Parvovirus B19 ( B19V ) is a common human pathogenic virus. Its single stranded DNA genome encodes three major nonstructural proteins and two capsid pr oteins VP1 and VP2. W ell documented diseases caused by B19V include erythema infectiosum (fifth disease) in children, arthropathy in adults, transient aplastic crisis in individuals with shortened red blood cell survival, and chronic anemia in immunocompr omised hosts (Young and KE, 2004) T he spectrum of B19V induced diseases has been broadening with numerous studies implicating B19V as a causative agent for thrombocytopenia, myocarditis, hepatitis a range of autoimmune diseases and various neurological disorders (Saint Martin et al., 1990; Heegaard et al., 1999; Heegaard et al., 2002; Broliden et al., 2006; Mogensen et al., 2010) Viral persistence has been described not only in immunocompromised individuals, but also in symptomatic and non symptomatic immunocompetent individuals (Kurtzman et al., 1987; Lefree et al., 2005) B19V is only known to replicate in erythroid progenitor cells that contain the main cellular receptor for B19V infection, blood group P antigen as well as two identified co receptors integrin and Ku80 (Brown et al., 1993; Weigel Kelley at el., 2003; Munakata et al., 2005) Yet after apparent clearance of infection, B19V DNA has been detected in serum samples and may persist in various tissues including skin, myocardial endothelium tonsils, liver, thyroid, testis, brain,

PAGE 133

133 synovia (Norja et al., 2006; Bultmann et al., 2003; Hobbs 2006; Adamson et al., 2011; Polcz et al., 2012) Lymphomas are tumors composed of neoplastic lymphocytes or very rarely histiocytes They are broadly clas sified into the former distinguished from the latter by the presence of the neoplastic Reed Sternberg giant cell. The me di an age at diagnosis for Hodgkin lymphoma is 38 years, compared to NHL at 66 years (Howlader et al., 2012) Greater than 85% of NHLs are derived from B cells, ~12% from T cells, and a very small number from histiocytes (Cotran et al., 1994) In a previous study, evidence of B19V infection was detected in 5/10 (50%) subject s with NHL and 3/8 (37 .5%) subject LISA and PCR on serum specimens (Us et al., 2007) In some cases, t he oncogenic functions of lymphomas may depend on the expression of viral genes, as is the case with EBV induced lymphomas where the viral genes expressed differ among tumor types (Vereide et al., 2010) Full replication would not be necessary for B19V to influence lymphoma development. B19V NS1 is known to alter the expression of cellular factors including interleukin 6 (IL 6), which is known to increase the risk for and worsen the prognosis of lymphomas (Mitchell et al., 2002) In this report, we demonstrate B19V infection of the immune cells of adult and pediatric lymphoma s as well as in benign lymph node sections and show a correlation betw een levels of B19V and IL 6 positivity To determine the susceptibility of cells in different disease states to infection with B19V all samples were also tested for the presence of P antigen and

PAGE 134

134 Materials and Methods Samples Seventy five duplicated sections of 0.5 m thi c k formalin fixed, paraffin embedded (FFPE) tissues of various types of lymphoma and benign lymphoid tissues were examined (Biochain, Z7020070). Subject ages ranged from 7 to 84 years old, with a mean age of 50.3 years and standard de viation of 18.8 years. Cases were identified by Biochain as being either B cell NHL (n=45), diffuse large B cell NHL lymphoma (n=11), extranodal NK/T cell lymphoma (n=3), anaplastic large cell lymphoma (n=4), mantle cell lymphoma (n=1) or benign lymph nodes (n=5) This study followed the World Medical Associ ation's Declaration of Helsinki. Immunohistochemistry (IHC) IHC for B19V VP1/VP2 capsid protein was performed on two slides of the lymphoma array as previously described (Polcz et al., 2012) IHC was also performed as above on one of the lymphoma arrays using a mouse monoclonal antibody to integrin (1:150; Millipore, MAB1969), a polyclonal antibody to P antigen (1:100; Matreya, Pleasant Gap, PA), or a rabbit polyclonal antibody to IL 6 (1:500; Abcam, ab6672). I mages were taken on a Leica DM 2500 microscope. Slides stained for B19V or IL 6 were analyzed using the positive pixel count algorithm of Aperio ImageScope antigen slides were analyzed using the membrane quantification algorithm. Correlation was determined using Spearman rank correlation coefficient analysis with p<0.0001.

PAGE 135

135 Results Detection of B19V VP1/VP2 in lymphomas Positive pixel counting was used to quantify B19V staining in each section, with scores ranging from 0 5 denoted as negative ( ), 5.1 30 as weakly positive (+), 30.1 60 as positive (++), and those greater than 60 as strongly positive (+++). Eleven of the 75 cases were negative (14.7%), 28 (37.3%) were weakly positive, 21 were positive (28%), and 15 (20%) were strongly positive. There was no significant difference between pathology and B19V po sitivity. Of the outputs for the positive pixel count algorithm, the average intensity was multiplied by the positivity (total number of positive pixels divided by total number of pixels) for each analyzed section. These calculated values were averaged f or the duplicate sections within each slide and also with their counterparts on the second slide. These values are noted in Table D 1. Due to poor quality of the image, two tissue sections for subjects 1 5 and one section each for subjects 6 and 7 could no t be analyzed using this algorithm on one of the slides stained for B19V. Positive B19V capsid protein staining was for the most part localized to the relatively larger, neoplastic lymphocytes. Positive staining was mainly nuclear with some cytoplasmic. Cytoplasmic staining was predominant, however, in 8 of the sections classified as NHL, B cell type. Positive staining of epithelial cells was also found in an NHL taken from the abdominal skin, an NHL taken from the testis, and a diffuse large B cell NHL f rom the thyroid. Where present, endothelial cells and macrophages also tended to stain positively, even where the lymphocytes did not, as year

PAGE 136

136 old male. Positive staining was n ot always widespread, as two of the NHL tissue sections showed strong positive staining, but only in the lymphocytes in a small portion of the section. The various histologic patterns of staining can be seen in Figure D 1. Detection of IL 6 Positive IL 6 staining was analyzed using the positive pixel count algorithm in a similar manner to B19V. The average intensity for each section was multiplied by the positivity. The calculated value for each section was averaged with the duplicate section within the s ame slide, and these values are also listed in Table D 1. The relationship between the average [I avg *positivity] values for B19V versus IL 6 for each subject was plotted and displayed in Figure D 2. The Spearman rank correlation coefficient analysis was performed to determine the relationship between B19V and IL 6 staining, yielding an overall correlation coefficient of 0.679 between the average of the two slides stained for B19V and the slide stained for IL 6 (p value < 0.0001, n=75). T here was no signi ficant difference between adult and pediatric sections, with the correlation coefficient for adult and pediatric B19V and IL 6 being 0.636 and 0.607, respectively. Pediatric cases were defined as those patients under 18 years old and are represented in bol d font in Table D 1. The Spearman correlation coefficient between B19V slide #1 and the IL 6 slide was 0.742 (p value < 0.0001, n=75), and 0.531 between B19V slide #2 and the IL 6 slide (p value < 0.0001, n=75). The correlation between B19V slide #1 and B 19V slide #2, stained on different days, was 0.793. Statistical analysis for each slide of the array is listed in Table D 1. Subjects 43 and 68 had relatively high [I avg *positivity] values for B19V with lower than expected values for IL 6. They are shown in Figure D

PAGE 137

137 sections, Subject 43, an 81 year old female with pharyngeal NHL, B cell type displayed mainly cytoplasmic staining for B19V (Figure D 1 D F), and subject 68, a 52 year old male with an NHL, B cell type from the col on displayed both strong nuclear and strong cytoplasmic staining for B19V VP1/VP2. Detection of cellular receptor (P antigen) and co Analysis with the membrane quantification algorithm of the Aperio ImageScope software yielded an output of total cells with membrane protein expression and assigned scorin g to each section 0 3+, with a 3+ signifying a strong intensity, based on the percentage of cells scoring at each intensity. The section was assigned a score of 0 if less than 10% of the cells stained at the 1+ or higher levels, a 1+ if more than 10% of th e cells stained at the 1+ and higher level, a 2+ if more than 10% of the cells stained at the 2+ and higher levels, and a 3+ if more than 10% of the cells stained at the 3+ level. Figure D 3 C D depicts the frequency of cells with any positively staining membrane for each subtype, with disregard to the intensity of the staining. The slide score for each section was averaged with the duplicate section within the same slide, and these values are listed in Supplemental Table 1. These overall scores are furth er broken down into the percentage of cells scoring at each intensity level, grouped by pathological subtype (Figure D 3E F). While most sections displayed similar f antigen positive cells, variation between tissue types is seen in the intensity of staining. Overall intensity scores were decreased in all groups for P even if the amount of positive cells are similar, the distribution of P antigen compared to There does not seem to be a correlation between

PAGE 138

138 the intensity of receptor staining and the strength of B19 V positivity. While the sample size was low, it is interes ting to note that when averaging the overall intensity scores for lymphoma cases, both with an average intensity of 2.5. P antigen intensity was notably high in NK/T cell ly mphoma with a value of 2.67. Discussion B19V capsid proteins have now been detected in both benign and malignant lymphoid tissues. IHC has been shown to be highly sensitive and specific in the detection of B19V, and also has the advantage of preserving t he histology of the specimens (Quemelo et al., 2007) PCR is more sensitive and specific, but is not ideal in the FFPE tissues used in this study due to the potential for DNA damage and contamination. Furthermore, samples that are DNA positive may simply r epresent a latent infection. IHC provides added clues to the viral life cycle. Serum samples were not tested in this study due to unavailability, and immunocompromised patients, such as those suffering from hematological malignancies, may be chronically in fected without the ability to mount a proper immune response. Therefore, levels of IgM or IgG may not be detectable, making such tests unreliable in the diagnosis of B19V infection (Kurtzman et al., 1989) P antigen expression has been shown on lymphocyt es, and as a co receptor for B19V, renders our results unsurprising (Fellous et al., 1974) Our results corroborate this finding as well as demonstrate the presence of the B19V co was no significant association between the intensity of receptor staining and the strength of B19V positivity for either receptor, indicating either that the quantity of

PAGE 139

139 receptor may not have an effect on the efficiency of B19V infection, or that infection took place at an earlier stage and our results represe nt reactivation or increased replication in a persistent infection. The latter would be supported by the observation that the by the NK/T cell lymphoma. While a similar tre nd was not apparent in the normal samples stained for P antigen, it has been reported that increased levels of P antigen do not correlate with B19V infection (Weigel Kelley et al., 2001) No similar studies have V infection but are warranted Though our chance of B19V attachment and subsequent entry and infection. It is not improbable that B19V may play some role in lymphoma develo pment. Our data reveal a positive correlation between the levels of positive staining for B19V VP1/VP2 and the inflammatory cytokine IL 6. Our results were significant, with a p value < 0.0001. In general, with the Spearman rank correlation coefficient an alysis, a correlation coefficient exceeding 0.80 or 0.90 indicates a close correlation, so our coefficient of 0.679 is classified as moderate. Increased levels of IL 6 have been linked to the pathogenesis of and a worse ( Kurzrock et al., 1993; Gaiolla et al., 2011) IL 6 has been shown to function as an autocrine growth factor in B cell NHL cell lines (Yee et al., 1989) Previous IHC analyses have found IL 6 expression in the tumor cells and macrophages of 89% (48/54) of N HL tumor samples, and a high correlation between serum and tumor supernatant IL 6 levels as well as detection in the tumors by IHC suggest that the tumor cells are the major contributor of IL 6 in the serum of these

PAGE 140

140 subjects (Voorzanger et al., 1996) Our results show a tendency for colocalization of B19V VP1/VP2 and IL 6 staining in the neoplastic lymphocytes (Figure D 1). B19V NS1 is known to alter the expression of cellular factors including tumor necrosis factor (TNF 6, both associated with an increased risk of NHL (Fu et al., 2002; Mitchell et al., 2002; Purdue et al., 2011) B19V NS1 acts as a transactivator of the IL 6 gene promoter, upregulating its production in hematopoietic cell lines (Moffatt et al., 1996) W hile we did not measure NS1 due to the lack of a commercially available antibody, we would hypothesize that there is either a low level of NS1 produced that could lead to IL 6 activation, or that the presence of B19V capsid protein may activate this pathway though further experiment s are required to determine this. Considering that many other factors may activate the signal transduction pathways involving IL 6, including other cytokines, serum factors, and pathogens including a list of viruses other than B19V, the level of correlatio n between the levels of B19V VP1/VP2 and IL 6 in this sample is actually higher than may be initially expected. A few outliers were seen where IL 6 and B19V detection did not correlate, perhaps representing differentially activated signaling pathways or c ofactors by B19V or by the cancer. Our data suggests that B19V infection may induce a pathway involving the inflammatory cytokine IL 6 that could contribute to pathogenesis of or alter the prognosis of lymphomas. This report examined the relationship of B 19V with IL 6, but its relationship with other cytokines should be studied further. B19V interaction with lymphomas may extend further than upregulation of pro inflammatory cytokines. B19V has been linked to many autoimmune diseases that confer a signifi cantly increased risk for lymphoma development including rheumatoid

PAGE 141

141 arthritis systemic lupus erythematosus (Takahashi et al., 1998; Lehmann et al., 2003; Lehmann et al., 2008; Wang et al., 2010) A nti viral antibodies produce d during chronic B19V infection have the potential fo r autoantigen binding, and chronic antigen stimulation triggered by autoimmunity and/or infection is a risk factor for lymphoma development (Lunardi et al., 1998) In certain cells, B19V may also have th e potential to induce an invasive cellular phenotype (Ray et al., 2011) B19V has already been suspected to play a role in other hematological malignancies, such as acute lymphoblastic and myeloblastic leukemia, through erythroid suppressio n and immune c ell proliferation (Kerr et al., 2003) Clinically B19V infection leads to a higher number of complications including cytopenia in children with acute lymphoblastic leukemia, a greater number of blood transfusions and longer interruptions in chemotherapy c ompared to B19V negative patients, further highlighting the significance of B19V infection in patients with hematological disorders (Lindblom et al., 2008)

PAGE 142

142 Table D 1. Subject information and IHC results. Age, gender, diagnosis, and IHC data for each s tain are listed. Positivity for B19V and IL 6 was taken as the average of the [I avg *positivity] values for each subject, and 3) for each subject, using the positive pixel count algorithm and the membrane quantification algorithm of the Aperio ImageScope software, respecti vely. Simple statistics for each slide, and the average of both B19V slides are also listed.

PAGE 143

143 Subject # 1 Age Gender Histology Average B19 B19 Positivity 2 Average IL 6 Integrin P Antigen 1 24 M Normal 3.27 5.67 2 1 2 29 M Normal 71 +++ 81.86 2 1 3 36 M Normal 9.85 + 28.51 2.5 2 4 68 F Normal 31.93 ++ 69.84 3 2 5 68 F Normal 53.93 ++ 45.69 3 1 6 72 F Mantle cell lymphoma 42.58 ++ 46.6 2 2 7 22 F Anaplastic large cell lymphoma 68.46 +++ 84.74 3 1 8 41 M Anaplastic large cell lymphoma 90.84 +++ 67.67 2 1 9 64 M Anaplastic large cell lymphoma 1.08 20.1 2 2 10 69 M Anaplastic large cell lymphoma 27.77 + 46.5 2 2 11 47 M Extranodal NK/T cell lymphoma 3.73 55.31 3 3 12 53 F Extranodal NK/T cell lymphoma 21.5 + 80.97 2 3 13 74 M Extranodal N K/T cell lymphoma 45.43 ++ 94.89 2.5 2 14 17 F 30.77 ++ 37.82 2 1 15 7 M 25.17 + 53.1 2 1 16 21 M 70.28 +++ 89.13 2 1 17 27 M 74.08 +++ 72.83 3 1.5 18 28 M 29.25 + 83.17 2 2 19 31 F 51.76 ++ 82.83 2 1 20 34 M 99.69 +++ 82.12 2 1 21 60 M 14.78 + 42.59 2 1.5 22 63 F 7.63 + 23.61 1.5 1 23 69 F 25.55 + 15.83 1.5 2 24 72 F 58.32 ++ 93.31 2 2 25 39 F Non cell 38.27 ++ 75.12 2.5 1 26 42 F Non cell 11.94 + 19.92 2 3 27 47 M Non cell 39.16 ++ 45.99 2 1 28 54 M Non cell 25.7 + 26.07 2 2.5 29 54 F Non cell 24.27 + 48.35 2 2.5 30 84 F Non cell 23.45 + 73.03 2 1 31 7 M Non homa, B cell 32.35 ++ 19.88 2 2

PAGE 144

144 32 10 M Non cell 10.02 + 12.75 2 1 33 13 F Non cell 5.85 + 10.8 2 3 34 29 M Non cell 14.75 + 32.84 2 2 35 34 M Non cell 16.71 + 43.9 1 2 2 36 36 M Non cell 32.52 ++ 60.36 2 3 37 37 F Non cell 5.88 + 4.82 2 2.5 38 37 M Non cell 7.9 + 11.96 2 1.5 39 39 M Non cell 24.7 + 21.06 1.5 1.5 40 43 F Non H cell 22.06 + 61.67 2 1 41 43 M Non cell 60.77 +++ 75.35 2 1 42 44 M Non cell 31.06 ++ 29.66 2 1.5 43 44 M Non cell 7.66 + 4.06 2 1.5 44 44 M Non B cell 50.79 ++ 79.48 2 1 45 45 M Non cell 1.63 10.65 2.5 1.5 46 46 M Non cell 0.65 2.58 2 2 47 47 F Non cell 51.89 ++ 64.72 2 3 48 47 F Non cell 71.34 +++ 46.1 6 2 2 49 49 F Non cell 12.33 + 10.62 1.5 2 50 51 M Non cell 63.12 +++ 45.05 2 2 51 51 F Non cell 6.67 + 33.65 2 1 52 52 M Non cell 73.92 +++ 26.56 2 2.5 53 53 M No n cell 1.04 17.77 2 1 54 53 M Non cell 90.01 +++ 64.4 2 1.5 55 55 M Non cell 54.17 ++ 39.22 1.5 1 56 55 F Non cell 3.21 5.47 2 1 57 56 M Non B cell 80.02 +++ 47.56 2.5 2 58 58 F Non cell 46.74 ++ 41.34 1.5 2 59 59 M Non cell 14.48 + 17.51 2.5 1.5 60 59 M Non cell 0.6 16.77 2 1 61 61 M Non cell 25.82 + 30.06 2 2 62 62 M Non cell 42.84 ++ 51.92 3 1.5 63 65 M Non cell 0.61 25.49 2 2 64 65 M Non cell 95.84 +++ 70.25 2.5 1.5

PAGE 145

145 65 65 M Non cell 9.13 + 2.53 2 2 66 67 M Non cell 18.09 + 40.53 2.5 1.5 67 68 F Non cell 44.3 ++ 79.52 2.5 1 68 72 M Non cell 0.54 5.16 2 1.5 69 72 M Non cell 51.97 ++ 33.6 2 1 70 74 F Non mphoma, B cell 34.54 ++ 48.09 2 2 71 75 M Non cell 1.38 27.67 2 2.5 72 75 F Non cell 40.37 ++ 64.54 2 3 73 79 M Non cell 68.24 +++ 55.07 2.5 3 74 81 F Non cell 66 .37 +++ 11.5 2 2 75 81 M Non cell 17.65 + 35.9 2 2 1 Bolded cases denote pediatric subjects 2 0 5 ( ), 5.1 30 (+), 30.1 60 (++), >60 (+++)

PAGE 146

146 Figure D 1. Patterns of B19V staining and IL 6 production. Row 1 (A C) is an a naplastic large cell lymphoma section taken from the right inguinal lymph node of a 69 year old man. Row 2 (D F) is a NHL, B cell type taken from the pharyngeal region of an 81 year old female. Row 3 (G I) is a NHL, B cell type taken from the stomach of a 51 year old male. Column 1 (A G) represents the stain for B19V capsid protein and column 2 (B H) the stain for IL 6. (A) Mostly positive nuclear staining for B19V VP1/VP2 in the lymphocytes, but also in the endothelial cells; there is very strong correspo nding IL 6 production (B). (C) IgG control for tissues seen in A. (D) B19V staining is much more cytoplasmic, and localized to the larger neoplastic lymphocytes with the smaller lymphocytes staining negatively, but the corresponding IL 6 staining (E) is r elatively low, with IL 6 being produced mostly by the non neoplastic infiltrating cells, most likely plasma cells (F). Figure G shows strong nuclear B19V staining of the neoplastic lymphocytes, macrophages, and also endothelial cells (enlarged in I), with strong corresponding production of IL 6 (H). Scale bars represent 25m.

PAGE 147

147 Figure D 2 Differential 5 1 integrin and P antigen membrane staining (A) 5 1 staining in a NHL, B cell type taken from the greater gastric curvature of a 68 year old female. (B) P antigen staining in a NHL, B cell type taken from the pharynx of an 81 year old female. Overall membrane detection and intensity of staining seen for 5 1 (C and E) and P antigen (D and F) in all sections based on membrane staining quantification. Scale bars represent 10m.

PAGE 148

148 Figure D 3. Overall Correlation of B19V versus IL 6 Staining This plot sh ows a moderate positive correlation between the level of overall positive B19V staining with positive IL 6 staining. Intensity and positivity values were obtained by the positive pixel count algorithm of the Aperio ImageScope software, multiplied together, and averaged between the tissue sections for each subject. denotes pediatric samples. # denotes outlier cases 43 and 68. [I avg *positivity] corresponds to the average pixel intensity for each section multiplied by the positive distribution.

PAGE 149

149 LIST OF REFERENCES Adamson LA, Fowler LJ, Clare Salzler MJ, Hobbs JA. 2011. Parvovirus B19 infection in Hashimoto's thyroiditis, papillary thyroid carcinoma, and anaplastic thyroid carcinoma. Thyroid. 21(4): 411 7. Altekruse SF, Kosary CL, Krapcho M, et al. 2007 SEER Cancer Statistics Review, 1975 2007. Altschul SF, Gish W, Miller W, et al 1990. Basic local alignment search tool. J Mol Biol 215: 403 410 American Thyroid Associated (ATA). 2012. Thyroid Function Tests. Falls Church, Virginia < http://www.thyr oid.org/blood test for thyroid/ > Anderson WI, Schlafer DH, Vesely KR. 1989. Thyroid follicular carcinoma with pulmonary metastases in a beaver (Castor canadensis) J Wildlife Dis. 25(4): 599 600. Antonelli A, Ferri C, Fallahi P, Ferrari SM, Ghinoi A, Roton di M, Ferrannini E. 2006. Thyroid disorders in chronic Hepatitis C Virus infection. Thyroid. 16(6): 563 572. Astell CR, Luo W, Brunstein J, St. Amand J. 1997. B19 parvovirus: biochemical and molecular features. In: Anderson LJ, Young NS, editors. Human par vovirus B19. Vol. 20. Basel: Karger. p 16 41. Belge G, Roque L, Soares J, Bruckmann S, Thode B, Fonseca E, Clode A, Bartnitzke S, Castedo S, Bullerdiek J. 1998. Cytogenetic Investigations of 340 Thyroid Hyperplasias and Adenomas Revealing Correlations b etween Cytogenetic Findings and Histology. Cancer Genet Cytogenct. 101: 42 48. Bock C, Klingel K, Kandolf R 2010. Human Parvovirus B19 Associated Myocarditis. N Engl J Med 362: 1248 1249. Bredl S, Plentz A, Wenzel JJ, Pfister H, Most J, Modrow S. 2011. False negative serology in patients with acute parvovirus B19 infection J Clin Virol. 51(2): 115 120. Breen EC, van der MM, Cumberland W, Kishimoto T, Detels R, Martinez Maza O. 1999. The development of AIDS phoma is preceded by elevated serum levels of interleukin 6. Clin Immunol. 92:293 299. 2605. Broliden K, Tolfvenstam T, Norbeck O. 2006. Clinical aspects of parvovirus B19 infection. J Intern Med 2 60 : 285 304.

PAGE 150

150 Brown KE. 2006. The genus Erythrovirus, p 25 41. In Kerr JR, Cotmore SF, Bloom ME, Linden RM, Parrish CR. (ed), Parvoviruses, Edward Arnold Ltd, London. Brown KE, Anderson SM, Young NS. 1993. Erythrocyte P Antigen: Cellular Receptor for B19 P arvovirus. Science. 262: 114 117. Bultmann BD, Klingel K, Sotlar K, Bock CT, Kandolf R. 2003. Parvovirus B19: a pathogen responsible for more than hematologic disorders. Virchows Arch 442 : 8 17. Burrows N, Resch J, Cowen RL, von Wasielewski R, Hoang Vu C, West CM, Williams KJ, Brabant G. 2009. Expression of hypoxia inducble factor 1 in thyroid carcinomas. Endocr Relat Cancer. 17: 61 72. Cassinotti P, Weitz M, Siegl G. 1993. Human parvovirus B19 infections: Routine diagnosis by a nested polymerase chain rea ctino assay. J Med Virol. 40(3): 228 234. Chisaka H, Morita E, Murata K, Ishii N, Yaegashi N, Okamura K, Sugamura K. 2002. A transgenic mouse model for non immune hydrops fetalis induced by the NS1 gene of human parvovirus B19. J Gen Virol. 83(2): 273 281. Connolly SS, Daly PJ, Floyd MS,Jr, et al: Terminology and Details of the Diagnostic Process for Testis Cancer. J Urol, 2011. Cooper DS. Hyperthyroidism. The Lancet. 362(9382): 459 468. Corsini J, Tal J, Winocour E. 1997. Directed integration of minute v irus of mice DNA into episomes. J Virol. 71(12): 9008 9015. Cossart YE, Cant B, Field AM, et al 1975. Parvovirus like particles in human sera. The Lancet 305: 72 73. Cotran RS, Kumar V, and Robbins SL 1994. Robbins pathologic basis of disease 5th ed. Philadelphia WB Saunders 1015 1022 Dalton SL, Marcantoni EE, Assoian RK. 1992. Cell attachment controls fibronectin and alpha 5 beta 1 integrin levels in fibroblasts. Implications for anchorage dependent and independent growt h. J Biol Chem. 267: 8186 81 91. Davies L, Welch HG. 2006. Increasing incidence of thyroid cancer in the United States, 1973 2002. JAMA. 295(18): 2164 7. Diss TC, Pan LX, Du MQ, et al. 1999. Parvovirus B19 is associated with benign testis as well as testicular germ cell tumours. Molec ular Pathology 52: 349 352. Douvoyiannis, M, Litman, N, and Goldman, DL. 2009. Neurologic manifestations associated with Parvovirus B19 infection. Clin Infect Dis. 48(12): 1713 23.

PAGE 151

151 Duechting A, Tschope C, Kaiser H, Lamkemeyer T, Tanaka N, Aberle S, Lang F, Torresi J, kandolf R, Bock CT. 2008. Human Parvovirus B19 NS1 Protein Modulates Inflammatory Signaling by Activation of STAT3/ PIAS3 in Human Endothelial Cells. J Virol. 82(16); 7942 7952. Efremidou EI, Papageorgio MS, Liratzopoulos N, Manolas KJ. 2009. The efficacy and safety of total thyroidectomy in the management of benign thyroid disease: a review of 932 cases Can J Surg. 52(1): 39 44. Eid AJ, Brown RA, Patel R, Razonable RR. 2006. Parvovirus B19 infection after transplantation: a review of 98 cas es. Clin Infect Dis. 43(1): 40 8. Ergunay K, Tezel GG, Dogan AI, et al 2008. Testicular persistence of Parvovirus B19: Evidence for preferential infection of germ cell tumors. Pathology Research and Practice 204: 649 653. Fellous M, Gerbal A, Tessier C, Frezal J, Dausset J, Salmon C. 1974. Studies on the Biosynthetic Pathway of Human P Erythrocyte Antigens Using Somatic Cells in Culture. Vox Sang 26 : 518 36. Fontaine J F, Mirebeau Prunier D, Raharijaona M, Franc B, Triau S, et al. 2009 Increasing the Number of Thyroid Lesions Classes in Microarray Analysis Improves the Relevance of Diagnostic Markers. PLoS ONE 4(10): 7632 7636. From G, Mellemgaard A, Knudsen N, Jorgensen T, Perrild H. 2000. Review of thyroid cancer cases among patients with previous b enign thyroid disorders. Thyroid. 10(8): 697 700. Fink M, Weinhausel A, Niederle B, Haas OA. 1996. Distinction between sporadic and hereditary medullary thyroid carcinoma (MTC) by mutation analysis of the RET proto oncogene. 69(4): 312 316. Fu Y, Ishii KK Munakata Y, Saitoh T, Kaku M, Sasaki T. 2002. Regulation of Tumor Necrosis Factor Alpha Promoter by Human Parvovirus B19 NS1 through Activation of AP 1 and AP 2 J Virol. 76(11): 5395 5403. Gaiolla RD, Domingues MA, Niero Melo L, de Oliveira DE. 2011. Se rum levels of interleukins 6, 10, and 13 before and after treatment of classic Hodgkin lymphoma. Arch Pathol Lab Med 135 : 483 9. Giebel J, Loster K, Rune GM 1997. Localization of integrin 1, 1, 5 and 9 subunits in the rat testis. Int J Androl 20: 3 9 Giordano TJ, Kuick R, Thomas DG, Misek DE, Vinco M, Sanders D, Zhu Z, Ciampi R, Roh M, Shedden K, Gauger P, Doherty G, Thompson NW, Hanash S, Koenig RJ, Nikiforob YE. 2005. Molecular classification of papillary thyroid carcinoma: distinct BRAF, RAS, and RE T/PTC mutation specific gene expression profiles discovered by DNA microarray analysis Oncogene. 24:6646 6656.

PAGE 152

152 Golden SH, Robinson KA, Saldanha I, Anton B, Ladenson PW. 2009. Prevalence and incidence of Endocrine and Metabolic Disorders in the United Sta tes: A Comprehensive Review. Journal of Clinical Endocrinology & Metabolism. 94(6): 1853 78. Gray A, Guillou L, Zufferey J, et al 1998. Persistence of parvovirus B19 DNA in testis of patients with testicular germ cell tumours. J Gen Virol 79: 573 579. Guan W, Wong S, Zhi N, Qui J. The genome of human parvovirus B19 can replicate in nonpermissive cells with the help of adenovirus genes and produce infectious virus. J Virol. 83(18): 9541 9553. Guillou L, Estreicher A, Chaubert P, et al 1996. Germ cell t umors of the testis overexpress wild type p53. Am J Pathol 149: 1221 1228. Hamilton J, Rachmiel M, Gupta A, Ngan BY, Daneman D. 2010. Thyroid cancer in childhood: a retrospective review of childhood course. 20(4): 375 380. Hammond, CJ, Hobbs, JA. 2007. P arvovirus B19 Infection of brain: Possible role of gender in determing mental illness and autoimmune thyroid disorders. Medical Hypotheses. 69(1): 113 116. Hansen KE, Arnason J, Bridges AJ. 1998. Autoantibodies and common viral illnesses. Semin Arthritis R heum. 27: 263 271. Heegaard ED Brown KE. 2002. Human Parvovirus B19. Clinical Microbiology Reviews. 15(3): 485 505. Heegaard ED, Rosthoj S, Petersen BL, Nielsen S, Karup Pedersen F, Hornsleth A. 1999. Role of parvovirus B19 infection in childhood idiopath ic thrombocytopenic purpura. Acta Paediatr 88 : 614 7. Heikkila K, Ebrahim S, Lawlor DA. 2008. Systematic review of the association between circulating interleukin 6 (IL 6) and cancer. Eur J Cancer. 44: 937 945. Hemauer A, Gigler A, Searle K, Beckenlehner K, Raab U, Broliden K, Wolf H, Enders G, Modrow S. 2000. Seroprevalence of Parvovirus B19 NS1 Specific IgG in B19 Infected and Uninfected Individuals and in Infected Pregnant Women. J Med Virol. 60: 48 55. Hermus AR and Huysmans DA. 1998. Treatment of Beni gn Nodular Thyroid Disease. Drug Therapy. 338: 1438 1447. Heuer M, Aust G, Ode Hakin S, Scherbaum WA. Different Cytokine mRNA Profiles in Graves' Disease, Hashimoto's Thyroiditis, and Nonautoimmune Thyroid Disorders Determined by Quantitative Reverse Tran scriptase Polymerase Chain Reaction (RT PCR) Thyroid. 6(2): 97 106.

PAGE 153

153 Hirt B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26: 5707 5717. Ho TWT, Shaheen AA, Dixon, E, Harvey A. 2011. Utilization of thyroidecto my for benign disease in the United States: a 15 year population based study. American Journal of Surgery. 201(5): 570 574. Hobbs JA 2006. Detection of adeno associated virus 2 and parvovirus B19 in the human dorsolateral prefrontal cortex. J Neurovirol 12: 190 199. Horie S, Maeta H, Endo K, et al 2001. Overexpression of p53 protein and MDM2 in papillary carcinomas of the thyroid: Correlations with clinicopathologic features. Pathol Int 51: 11 15. Howlader N, Noone AM, Krapcho M, Neyman N, Aminou R, Altekruse SF, Kosary CL, Ruhl J, Tatalovich Z, Cho H, Mariotto A, Eisner MP, Lewis DR, Chen HS, Feuer EJ, Cronin KA (eds). SEER Cancer Statistics Review, 1975 2009 (Vintage 2009 Populations), National Cancer Institute. Bethesda, MD, http://seer.cancer.gov/ csr/1975_2009_pops09/, based on November 2011 SEER data submission, posted to the SEER web site, 2012. Hsu TC, Tzang BS, Huang CN, Lee YJ, Liu GY, Chen MC, Tsay GGJ. 2006. Increased expression and secretion of interleukin 6 in human parvovirus B19 non stru ctural protein (NS1) transfected COS 7 epithelial cells. Clin Exp Immuno. 144(1): 152 157. Hsu TC, Wu WJ, Chen MC, Tsay GJ. 2004. Human parvovirus B19 non structural protein (NS1) induces apoptosis through mitochondria cell death pathway in COS 7 cells. Sc and J Infect Dis. 36(8): 570 7. Huang YX, Chen XY, Ma LN, Yin JM, Ren S, Guo DD, Zheng YH. 2012. [Analysis of thyroid dysfunction and influencing factors in chronic hepatitis C patients treated with peg IFNa 2a and ribavirin]. Zhonghua Gan Zang Bing Za Zhi 20(3): 216 20. Jacobson, SK, Daly, JS, Thorne, GM, and McIntosh, K. 1997. Chronic Parvovirus B19 Infection Resulting in Chronic Fatigue Syndrome: Case History and Review. Clinical Infectious Diseases. 24(6): 1048 1051. Jemal A, Siegel R, Xu J, et al: 201 0. Cancer statistics, 2010. CA Cancer J Clin 60: 277 300. Karetnyi YV, Beck PR, Markin RS, Langnas AN, Naides SJ. 1999. Human parvovirus B19 infection in acute fulminant liver failure. Arch Virol. 144: 1713 1724. Kerr JR, Barah F, Cunniffe VS, Smith J, Val lely PJ, Will AM, et al. 2003. Association of acute parvovirus B19 infection with new onset of acute lymphoblastic and myeloblastic leukaemia. J Clin Pathol 56 : 873 5.

PAGE 154

154 Klepfish A, Rachmilevitch E, Schattner A. 2006. Parvovirus B19 reactivation presenting as neutropenia after rituximab treatment. Eur J Intern Med. 17: 505 507. Kotin RM, Menninger JC, Ward DC, Berns KI. 1991. Mapping and direct visualization of a region specific viral DNA integration site on chromosome 19q13 qter. Genomics. 10(3): 831 4. Kra use K, Prawitt S, Eszlinger M, Ihling C, Sinz A, Schierle K, Gimm O, Dralle H, Steinert F, Sheu S Y, Schmid KW, Fuhrer D. 2011. Dissecting molecular events in thyroid neoplasia provides evidence for distinct evolution of follicular thyroid adenoma and carc inoma. Am J Path. 179(6): 3066 3074. Khl U, Pauschinger M, Seeberg B, Lassner D, Moutsias M, Poller W, et al. 2005. Viral persistence in the myocardium is associated with progressive cardiac dysfunction. 112: 1965 1970. Kurtzman GJ, Ozawa K, Cohen B, et a l 1997. Chronic Bone Marrow Failure Due to Persistent B19 Parvovirus Infection. N Engl J Med 317: 287 294. Kurzrock R, Redman J, Cabanillas F, Jones D, Rothberg J, Talpaz M. 1993. Serum interleukin 6 levels are elevated in lymphoma patients and correlat e with survival in advanced Hodgkin's disease and with B symptoms. Cancer Res 53 : 2118 22. Lacroix J, Leuchs B, Li J, Hristov G, Deubzer HE, Kulozik AE, Rommelaere J, Schlehofer JR, Witt O. 2010. Parvovirus H1 selectively induces cytotoxic effects on huma n neuroblastoma cells. Int J Cancer. 127 : 1230 1239. Lauer GM, Ouchi K, Chung RT, Nguyen TN, Day CL, Purkis DR, Reiser M, Kim AY, Lucas M, Klenerman P, Walker BD. 2002. Comprehensive analysis of CD8+ T cell responses against hepatitis C virus reveals multi ple unpredicted specificities. J. Virol. 76:6104 6113 Laughlin CA, Cardellichio CB, Hoon HC. 1986. Latent infection of KB cells with adeno associated virus type 2. J. Virol. 60: 515 524. Lefrere J, Servant Delmas A, Candotti D, et al 2005. Persistent B1 9 infection in immunocompetent individuals: implications for transfusion safety. Blood 106: 2890 2895. Lehmann, HW, Lutterbuse, N, Plentz, A, Akkurt, I, Albers, N, Hauffa, BP, Hiort, O, Schoenau, E, and Modrow, S. 2008. Association of Parvovirus B19 infe ction and 383. Lehmann HW, von Landenberg P, Modrow S. 2003. Parvovirus B19 infection and autoimmune disease. Autoimmunity Reviews. 2: 218 223.

PAGE 155

155 Li Y, Wang J, Zhu G, Zhang X, Zhai H, Zhang W, et al 2007. Detection of Parvovirus B19 Nucleic Acids and Expression of Viral VP1/VP2 Antigen in Human Colon Carcinoma. Am J Gastroenterol. 102: 1489 1498. Liu H, Fu Y, Xie J, Cheng J, Ghabrial SA, Li G, Peng Y, Yi X, Jiang D. 2011. Widespread endogeni zation of Densoviruses and Parvoviruses in Animal and Human Genomes. 85(19): 9863 9876. Lindblom A, Heyman M, Gustafsson I, Norbeck O, Kaldensjo T, Vernby A, et al. 2008. Parvovirus B19 infection in children with acute lymphoblastic leukemia is associated with cytopenia resulting in prolonged interruptions of chemotherapy. Clin Infect Dis 46 : 528 3 Liu JM, Green SW, Shimada T, Young NS. 1992. A block in full length transcript maturation in cells nonpermissive for B19 parvovirus. J Virol. 66:4686 4692. L umachi F, Basso SMM, Orlando R. 2010. Cytokines, thyroid diseases and cancer. Cytokine. 50(3): 229 233. Lunardi C, Tinazzi E, Bason C, Dolcino M, Corrocher R, Puccetti A. 2008. Human parvovirus B19 infection and autoimmunity. Autoimmun Rev 8:116 120 Luna rdi C, Tiso M, Borgato L, Nanni L, Milo R, De Sandre G, Severi AB, Puccetti A. 1998. Chronic parvovirus B19 infection induces the production of anti virus antibodies with autoantigen binding properties. Eur J Immunol. 28: 936 948. Machens A, Lorenz K, Ngu yen TP, Brauckhoff M, Dralle H. 2010. Papillary thyroid cancer in children and adolescents does not differ in growth pattern and metastatic behavior. J Pediatr. 157(4): 648 52. Mantovani A, Allavena P, Sica A, et al. 2008. Cancer related inflammation. Nat ure. 54: 436 444. Mitchell LA. Parvovirus B19 nonstructural (NS1) protein as a transactivator of interleukin 6 synthesis: Common pathway in inflammatory sequelae of human parvovirus infections? J Med Virol. 67(2): 267 274. Miyagawa E, Yoshida T Takahashi H Yamaguchi K Nagano T Kiriyama Y Okochi K Sato H 1999. Infection of the erythroid cell line, KU812Ep6, with human parvovirus B19 and its application to titration of B19 infectivity. J. Virol. Methods 83:45 54. Moffatt S, Yaegashi N, Tada K, Tanaka N, Sugamura K. 1998. Human Parvovirus B19 Nonstructural (NS1) Protein Induces Apoptosis in Erythroid Lineage Cells J Virol. 72(4): 3018 3028. Moffatt S, Tanaka N, Tada K, Nose M, Nakamura M, Muraoka O, Hirano T, Sugamura K. 1996. A cytotoxic nonstructural protein, NS1, of human parvovirus B19 induces activation of interleukin 6 gene expression. J Virol. 70(12): 8485 8491.

PAGE 156

156 Mogensen TH, Jensen JM, Hamilton Dutoit S, Larsen CS. 2010. Chronic hepatitis caused by persistent parvovirus B19 infection. BMC Infect Dis 10 : 246. Mori K, Yoshida K, Ishii K, Morohosi K, Nakagawa Y, Saeko H, Ozaki H, Takahashi Y, Ito S. 2011. Experimental autoimmune thyroiditis in parvovirus B19 transgenic mice. 44(6): 483 489. Mori, K, Munakata, Y, Saito, T, Tani, J, Nakagawa, Y, Hosh ikawa, S, Ozaki, H, Ito, S, and Yoshida, K. 2007. Intrathyroidal persistence of human parvovirus B19 DNA in a 31. Munakata, Y, Kodera, T, Saito, T, and Sasaki, T. 2005. Rheumatoid arthritis, type 1 366(9487):780. Munakata Y, Saito Ito T, Kumura Ishii K, Huang J, Kodera T, Ishii T, Hirabayashi Y, Koyanagi Y, Sasaki T. 2005. Ku80 autoantigen as a cellular coreceptor for human parvovirus B19 infection. Blood. 106(10): 3449 3456. Munshi NC, Zhou S, Woody MJ, Morgan DA, Srivastava A. 1993. Successful replication of parvovirus B19 in the human megakaryocytic leukemia cell line MB 02. J. Virol. 67(1):562 566. D, Colombo C, Perrino M, Ravasi E, Rossi S, Cirello V, Beck Peccoz P, Borrello MG, Fugazzola. 2010. The tight relationship between papillary thyroid cancer, autoimmunity and inflammation: clinical and molecular studies Clinical Endocrinology. 72(5): 702 708. Nakashima A, Tanaka N, Tamai K, Kyumma M, Ishikawa Y, Sato H, Yoshimori T, Saito S, Sugamura K. 2006. Survival of parvovirus B19 infected cells by cellular autophagy. Virology. 349(2): 254 263. Newell GR, Mills PK, Johnson DE 1984. Epidemiologic com parison of cancer of the testis and Hodgkin's disease among young males. Cancer 54: 1117 1123. Nikiforov YE, Steward DL, Robinson Smith TM, Haugen BR, Klopper JP, Zhu Z, Fagin JA, Falciglia M, Weber K, Mikiforova MN. 2009. Molecular testing for mutation s in improving the fine needle aspiration diagnosis of thyroid nodules. J Clin Endo Metab. 94(6): 2092 2098. Nikkari S, Roivainen A, Hannonen P, et al. 1995. Persistence of parvovirus B19 in synovial fluid and bone marrow. Ann Rheum Dis 54: 597 600. Nor ja P, Hokynar K, Aaltonen LM, Chen R, Ranki A, Partio EK, Kiviluoto O, Davidkin I, Leivo T, Eis Hbinger AM, Schneider B, Fischer HP, Tolba R, Vapalahti O, Vaheri A, Sderlund Venermo M, Hedman K. 2006. Bioportfolio: lifelong persistence of variant and pro totypic erythrovirus DNA genomes in human tissue. Proc Natl Acad Sci. 103(19): 7450 3.

PAGE 157

157 Brown KE. 1994. Identification of a novel simian parvovirus in cynomolgus monkeys with se vere anemia. A paradigm of human B19 parvovirus infection. J Clin Invest. 93(4): 1571 1576. Olie RA, Fenderson B, Daley K, et al. 1996. Glycolipids of human primary testicular germ cell tumours. Br J Cancer 74: 133 140. Ozawa K, Kurtzman G Young N 198 7. Productive infection by B19 parvovirus of human erythroid bone marrow cells in vitro. Blood 70:384 391. Pallier C, Greco A, Le Junter J, Saib A, Vassias I, Morinet F. 1997. The 3' untranslated region of the B19 parvovirus capsid protein mRNAs inhibits i ts own mRNA translation in nonpermissive cells. J Virol. 71(12): 9482 9489. Pankuweit S, Moll R, Baandrup U, Portig I, Hufnagel G, Maisch B. 2003. Prevalence of the parvovirus B19 genome in endomyocardial biopsy specimens. Human Pathology. 34(5): 497 503. Patou G, Pillay D, Myint S, Pattison J. 1993. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19. J Clin Microbiol. 31(3): 540 546. Perez Montiel MD, Suster S. 2008. The spectrum of histologic changes in thyroidhy perplasia: a clinicopathologic study of 300 cases Human Pathology. 39(7): 1080 1087. Pillet S, Le Guyader N, Hofer T, NguyenKhac F, Koken M, Aubin J T, Fichelson S, Gassmann M, Morinet F. 2004. Hypoxia enhances human B19 erythrovirus gene expression in p rimary erythroid cells Virology. 327(1): 1 7. Plaza Menacho I, van der Sluis T, Hollema H, Gimm O, Buys CHCM, Magee AI, Isacke CM, Hofstra RMW, Eggen BJL. 2007. Ras/ERK1/2 mediated STAT3 Ser727 Phosphorylation by Familial Medullary Thyroid Carcinoma assoc iated RET Mutants Induces Full Activation of STAT3 and Is Required for c fos Promoter Activation, Cell Mitogenicity, and Transformation J Bio Chem. 282: 6415 6424. Polcz ME, Adamson LA, Datar RS, Fowler LJ, Hobbs JA. 2012. Detection of parvovirus B19 caps id proteins in testicular tissues. Urology. 79 : 744.e9,744.15. Ponnazhagan S, Woody MJ, Wang XS, Zhou SZ, Srivastava A. 1995. Transcriptional transactivation of parvovirus B19 promoters in nonpermissive human cells by adenovirus type 2. J Virol. 69(12): 80 96 8101. Poole PD, Karetnyi YV, Naides SJ. 2004. Parvovirus B19 induced apoptosis of hepatocytes. J Virol. 78(14): 7775 7783.

PAGE 158

158 Purdue MP, Lan Q, Bagni R, Hocking WG, Baris D, Reding DJ, et al. 2011. Pre diagnostic serum levels of cytokines and other immune markers and risk of n on Hodgkin lymphoma. Cancer Res Quemelo PR, Lima DM, da Fonseca BA, Peres LC. 2007. Detection of parvovirus B19 infection in formalin fixed and paraffin embedded placenta and fetal tissu es. Rev Inst Med Trop Sao Paulo. 49 : 103 7. Ray NB, Nieva DR, Seftor EA, Khalkhali Ellis Z, Naides SJ. 2001. Induction of an invasive phenotype by human parvovirus B19 in normal human synovi al fibroblasts. Arthritis Rheum. 44 : 1582 6. Riolobos, L, Valle, N, Hernando, E, Maroto, B, Kann, M, Almendral, JM. 2010. Viral Oncolysis That Targets Raf 1 Signaling Control of Nuclear Transport. J Virol. 84: 2090 2099 Rivadeneira ED, Popescu NC, Zimonjic DBB, Cheng GS, Nelson PJ, Ross MD, DiPaolo JA, Klotman ME. 1998. Sites of recombinant adeno associated virus integ ration. Int J Oncol. 12(4): 805 10. Rommelaere J, Cornelis JJ. 1991. Antineoplasic activity of parvoviruses. J Virol Method. 33(3): 233 251. Rommelaere J, Geletneky K, Angelova AL, et al 2010. Oncolytic parvoviruses as cancer therapeutics. Cytokine Growth Factor Rev 21: 185 195. Saikawa T, Anderson S, Momoeda M, Kajigaya S, Young NS. 1993. Neutralizing linear epitopes of B19 parvovirus cluster in the VP1 unique and VP1 VP2 junction regions. J Virol. 67(6): 3004 9. Saint Martin J, Choulot JJ, Bonnaud E, Morinet F. 1990. Myocarditis cause d by parvovirus. J Pediatr. 116: 1007 8. Salom N, van Hille B, Duponchel N, Meneguzzi G, Cuzin F, Rommelaere J, Cornelis JJ. 1990. Sensitization of transformed rat cells to parvovirus MVMp is restricted to specific oncoge nes. Oncogene. 5: 123 130. Schoeman JP, Herrtage ME. 2008. Serum thyrotropin, thyroxine and free thyroxine concentrations as predictors of mortality in critically ill puppies with parvovirus infection : a model for human paediatric critical illness? Resear ch Articles University of Pretoria. < http://hdl.handle.net/2263/8592 > Shaha AR. 2000. Controversies in the management of thyroid nodule. The Laryngoscope. 110(2): 183 189. Shimakage M, Kawahara K, Sasagawa T, Inoue H, Yutsudo M, Yoshida A, Yanoma S. 2003 Expression of Epstein Barr Virus in thyroid carcinoma correlates with tumor progression. Human Pathology. 34(11): 1170 1177.

PAGE 159

159 Slatosky J, Shipton B, Wahba H. 2000. Thyroiditis: Differential diagnosis and management. Am Fam Physician. 61(4): 1047 1052. So l N, Junter JL, Vassias I, Freyssinier JM, Thomas A, Prigent AF, Rudkin BB, Fichelson S, Morinet F. 1999. Possible Interactions between the NS 1 Protein and Tumor Necrosis Factor Alpha Pathways in Erythroid Cell Apoptosis Induced by Human Parvovirus B19 J Virol. 73(10): 8762 8770. Srivastava A, Lu L 1988. Replication of B19 parvovirus in highly enriched hematopoietic progenitor cells from normal human bone marrow. J. Virol. 62:3059 3063. Stieger K, Schroeder J, Provost N, Mendes Madeira A, Belbellaa B, Le Meur G, Weber M, Deschamps J Y, Lorenz B, Moullier P, Rolling F. 2009. Detection of intact rAAV particles up to 6 years after successful gene transfer in the retina of dogs and primates. Molecular Therapy. 17(3): 516 523. Takahashi Y, Murai C, Shibata S, Munakata Y, Ishii T, Ishii K, et al. 1997. Human parvovirus B19 as a causative agent for rheumatoid arthritis. PNAS. 95(14): 8227 8232. Takasawa N, Munakata Y, Ishii KK, Takahashi Y, Takahashi M, Fu Y, Ishii T, Fujii H, Saito T, Takano H, Noda T, Suzuki M Nose M, Zolla Patzner S, Sasaki T. 2004. Human Parvovirus B19 transgenic mice become susceptible to polyarthritis. J Immuno. 173(7): 4675 4683. Tattersall P. 2006. The evolution of parvovirus taxonomy, p 5 14. In Kerr JR, Cotmore SF, Bloom ME, Linden RM, Parrish CR. (ed), Parvoviruses, Edward Arnold Ltd, London. Tijssen P, Agbandje McKenna M, Almendral JM, Bergoin M, Flegel TW, Hedman K, Kleinschmidt J, Li Y, Pintel DJ, Tattersall P 2012. The genus Erythrovirus, p 25 41. In King AMQ, Adams MJ, Carsten EB Lefkowitx(ed), Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Inc, San Diego, CA. Tolfvenstam T, Papad ogiannakis N, Andersen A, et al. 2002. No association between human parvovirus B19 and testicular germ c ell cancer. J Gen Virol 83: 2321 2324. Tomer Y, Davies TF. 1993. Infection, Thyroid Disease, and Autoimmunity. Endocrine Reviews. 14(1): 107 120. Trovato M, Grosso M, Vitarelli E, Ruggeri RM, Alesci S, Trimarchi F, Barresi G, Benevenga S. 2003. Distinct ive expression of STAT3 in papillary thyroid carcinomas and a subset of follicular adenomas. Histology and histopathology. 18(2): 1 9.

PAGE 160

160 Us T, Ozune L, Kasifoglu N, et al 2007. The investigation of parvovirus B19 infection in patients with haematological di sorders by using PCR and ELISA techniques. Braz J Infect Dis 11: 327 330. van de Geijn GM, Hersmus R, Looijenga LHJ 2009. Recent developments in testicular germ cell tumor research. Birth Defects Research Part C: Embryo Today: Reviews 87: 96 113. Vanac ker J M, Corbau R, Adelmant G, Perros M, Laudet V, Rommelaere J. 1996. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone responsive element. J Virol 70:2369 2377. Vanacker J M, Laude t V, Adelmant G, Stehelin D, Rommelaere J. 1993. Interconnection between thyroid hormone signaling pathways and parvovirus cytotoxic functions. J Virol 67:7668 7672. Vanderpump MPJ. 2011. The epidemiology of thyroid disease. British Medical Bulletin. 99(1) : 39 51. Varner JA, Emerson DA, Juliano RL. 1995. Integrin alpha 5 beta 1 expression negatively regulates cell growth: reversal by attachment to fibronectin. Mol Biol Cell. 6: 725 740. Vasko VV, Gaudart J, Allasia C, Savchenko V, Di Cristofaro J, Saji M, Ringel MD, De Micco C. 2004. Thyroid follicular adenomas may display features of follicular carcinoma and follicular variant of papillary carcinoma. Eur J Endocrinol. 151: 779 786. Vejilgaard TB, Nielsen OB. 1994. Subacute thyroiditis in Parvovirus B19 inf ection. Ugeskr Laeger. 156(41): 6039 40. Vereide D, Sugden B. 2010. Insights into the evolution of lymphomas induced by Epstein Barr virus. Adv Cancer Res 1 08 : 1 19. Vivaldi A, Pacini F, Martini F, Iaccheri L, Pezzetti F, Elisei R, Pinchera A, Faviana P, Basolo F, Tognon M. 2003. Simian Virus 40 Like Sequences from Early and Late Regions in Human Thyroid Tumors of Different Histotypes J Clin Endo Metab. 88(2): 892 899. Voorzanger N, Touitou R, Garcia E, Delecluse HJ, Rousset F, Joab I, et al. 1996. Inter leukin (IL) 10 and IL 6 are produced in vivo by non Hodgkin's lymphoma cells and act as cooperative growth factors. Cancer Res 56 : 5499 505. Wang, J, Zhang, W, Liu, H, Wang, D, Wang, W, Li, Y, Wang, Z, Wang, L, Zhang, W, Huang G. 2010. Parvovirus B19 infe ction associated with Hashimoto's thyroiditis in adults. J Infect. 60(5): 360 70.

PAGE 161

161 Wang JH, Zhang WP, Liu HX, Wang D, Li YF, Wang WQ, Wang L, He FR, Wang Z, Yan QG, Chen LW, Huang GS. 2008. Detection of human parvovirus B19 in papillary thyroid. Br J Cance r. 98(3): 611 8. Wang SH, Baker JR. 2007. The role of apoptosis in thyroid autoimmunity. Thyroid. 17(10): 975 9. Watson PF, Pickerill AP, Davies R, Weetman AP. 1994. Analysis of cytokine gene ndo Metab. 79(2): 355 360. Weetman AP. 2004. Cellular immune responses in autoimmune thyroid disease. Clin endocrinol. 61:405 413. 1248. Weigel Kelley KA, Yoder MC, Srivastava A. 2003. 5 1 integ rin as a cellular coreceptor for human parvovirus B19: requirment of functional activation of 1 integrin for viral entry. Blood. 102(12): 3927 3933. Welker MJ, Orlov D. 2003. Thyroid Nodules. Am Fam Physician. 67(3): 559 567. Wiseman SM, Loree TR, Rigual MR, Hicks Jr. WL, Douglas WG, Anderson GR, Stoler DL. 2003. Anaplastic transformation of thyroid cancer: Review of clinical, pathologic, and molecular evidence provides new insights into disease biology and future therapy. Head & Neck. 25(8): 662 670. Xin g M. 2005. BRAF mutation in thyroid cancer. Endocr Relat Cancer. 12:245 262. Yasuhara H, Matsui O, Hirahara T, Ohgitani T, Tanaka M, Kodama K, Nakai M, Sasaki N. 1989. Characterization of a parvovirus isolated from the diarrheic feces of a pig. Nihon Juig aku Zasshi. 51(2): 337 44. Yee C, Biondi A, Wang XH, Iscove NN, de Sousa J, Aarden LA, et al. 1989. A possible autocrine role for interleukin 6 in two lymphoma cell lines. Blood 74 : 798 804. Young NS, Brown KE. 2004. Parvovirus B19. New England Journal of Medicine. 350:586 597. Zakrzewska K, Azzi A, De Biasi E, Radossi P, De Santis R. Davoli PG, Tagariello G. 2001. Persistence of parvovirus B19 DNA in synovium of patients with haemophilic arthritis. J Med Virol. 65: 402 407. Zerilli M, Zito G, Martorana A, Pitrone M, Cabibi D, Cappello F, Giorgano C, Rodolico V. 2010. BRAFV600E mutation influences hypoxia inducible factor levels in papillary thyroid cancer Modern Pathology. 23: 1052 1060.

PAGE 162

162 Zhi N, Mills IP, Lu J, Wong S, Filippone C, Brown KE 2006. Molecular and Functional Analyses of a Human Parvovirus B19 Infectious Clone Demonstrates Essential Roles for NS1, VP1, and the 11 Kilodalton Protein in Virus Replication and Infectivity. J Virol. 80: 5941 5950.

PAGE 163

163 BIOGRAPHICAL SKETCH Laura Adamson graduated in 200 8 from Iowa State University with a B.S. in g enetics and a minor in m icrobiology. While there, she completed her undergraduate research working on two projects. Her first project focused on using a transgeneic corn model for oral immunizati ons of cholera toxin. Her second project involved using genetically modified mesenchymal stem cells for treatment of retinal disease. This Brain derived neurotrophic factor released from engineered mesenchymal stem cells attenuates glutamate and hydrogen peroxide mediated death of staurosporine differentiated RGC 5 cells Experiment Eye Research. In 2008, Laura entered the Interdisciplinary Program for Biomedical Research at the University of Fl orida. In 2009, she joined the laboratory of Dr. Jacqueline Hobbs in the Immunology/Microbiology Concentration. Her work is focused on the role of Parvovirus B19 in thyroid cancers and disorders. While conducting this research, she has published one first author and one second author paper to date on B19 in thyroid disorders and testicular tissue. She has also received the Howard Hughes Medical Institute Award for Graduate Research for her publication with her undergraduate trainee Monica Polcz. She has al so been actively involved in teaching, being a course leader for two summers for the Student Science Teaching Program and tutoring for the University of Florida Athletic Association