The role of Dmt1 in the copper-related compensatory response of the intestinal epithelium during iron-deficiency

The role of Dmt1 in the copper-related compensatory response of the intestinal epithelium during iron-deficiency

MISSING IMAGE

Material Information

Title:
The role of Dmt1 in the copper-related compensatory response of the intestinal epithelium during iron-deficiency
Physical Description:
1 online resource (88 p.)
Language:
english
Creator:
Jiang, Lingli
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Nutritional Sciences
Committee Chair:
Collins, James Forrest
Committee Members:
Knutson, Mitchell D
Sitren, Harry S
Clanton, Thomas Lindsay

Subjects

Subjects / Keywords:
belgrade -- copper -- dmt1 -- iron -- transport
Nutritional Sciences -- Dissertations, Academic -- UF
Genre:
Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Many human and animal studies have shown that serum and liver copper levels increase during iron deficiency. In addition, divalent metal transporter 1 (Dmt1) and the Menkes copper-transporting ATPase (Atp7a) are strongly up-regulated in the duodenum of iron-deficient rats. These findings suggest an important interaction between iron (Fe) and copper (Cu) during iron deficiency. The hypothesis that Dmt1 is necessary for alterations in the expression/activity of copper-related proteins during iron deficiency was tested. Experiments were performed in the Belgrade (b) rat model of genetic iron deficiency. Dmt1 and Atp7a mRNA expression, along with other metal homeostasis- related genes (e.g. Tfr1), was increased in enterocytes from b/b rats (as compared to +/b rats), while hephaestin (Heph) did not change. In the liver, Cp mRNA expression was unaltered. Immunoblots demonstrated that Atp7a protein expression increased in the b/b rats, along with duodenal Heph protein expression (transports copper during low-iron states, when it is strongly induced, and competing iron atoms are low in abundance. First, the Belgrade rat model was utilized to show that mutated Dmt1 cannot increase copper transport in the iron-deficient b/b rats, but the +/b rats did show changes in copper levels during iron deficiency. To further explore the possible copper transport by Dmt1, a doxycycline (DOX) inducible Dmt1 over-expression system in HEK-293 cells was employed. In DOX-treated cells with confirmed Dmt1 over-expression, 64Cu uptake was not different from untreated cells. However, a significant increase in copper uptake was noted (~3 fold) when cells were treated with DOX in the presence of an iron chelator (as compared to DOX only-treated cells). It is therefore concluded that under normal conditions, Dmt1 does not transport copper, but that it may be involved in copper transport under low-iron conditions.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Lingli Jiang.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Collins, James Forrest.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045156:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 THE ROLE OF DMT1 IN THE COPPER RELATED COMPENSATORY RESPONSE OF THE INTESTINAL EPITHELIUM DURING IRON DEFICIENCY By LINGLI JIANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FUL FILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Lingli Jiang

PAGE 3

3 To my parents, Changfu Jiang and Lanying Wei, my husband, Minghui W u, and my son, Natha niel Wu

PAGE 4

4 ACKNOWLEDGMENTS The past four years as a doctoral student are the most memorable days in my life. Here I would like to express my deep sense of gratitude to the people providing me support both physically and mentally during this time. Firs t of all, I would like to thank my advisor, Dr. James Collins, who gave me the opportunity to work in his lab and brought me into the nutritional science field The fruitful guidance from him enables me to master the necessary experimental techniques for m y research, which I believe gives me a strong foundation for my future career. Additionally, I am also hugel y grateful to my committee members: Dr. Harry Sitren I gained a lot from his vast knowledge in nutrition, physiology, biology and so on. Dr. Mitche ll Knutson, with his valuabl e suggestions, guided me to conduct my research in the right direction. Dr. Thomas Clanton was also very kind to support me with constant suggestions and encouragement which were helpful to me for the successful outcome of this research. Secondly, I am also thankful to my labmates, April Kim, Yan Lu, Genie Beasley Liwei Xie, Sukru Gulec and C aglar Doguer for their necessary assistance and suggestions as and when required. In addition, a special thank goes to Ningning Zhao, Wei Z hang and the other graduate students in Food Science and Human Nutrition department who helped me in many other ways. Last but not least, I would like to thank my family, my father, Changfu Jiang, mother, Lanying Wei, and my husband, Minghui Wu who have constantly supported me throughout my life. Without their encouragement and love, I would not have accomplish ed my graduate studies

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 7 LIST OF FIGURES .......................................................................................................... 8 LIST OF ABBREVIATIONS ............................................................................................. 9 ABSTRACT ................................................................................................................... 12 CHAPTER 1 LITERATURE REVIEW .......................................................................................... 14 Introduction to Iron .................................................................................................. 15 Basic P roperties of I ron .................................................................................... 15 Iron Metabolic Pathways .................................................................................. 16 The Physiologic Consequences of Iron Deficiency ........................................... 19 Iron Deficiency Model ....................................................................................... 20 Introduction to Copper ............................................................................................ 22 Basic Properties of Copper ............................................................................... 22 Copper Metabolic Pathways ............................................................................. 23 Copper Containing Proteins ............................................................................. 24 Iron and Copper Interactions .................................................................................. 25 Historical Evidence ........................................................................................... 25 Parallels Between Iron and Copper .................................................................. 27 Links Between Iron and Copper ....................................................................... 28 Specific Aims .......................................................................................................... 30 2 METHODS AND PROCEDURES ........................................................................... 32 Experimental Animals ............................................................................................. 32 Elemental Analyses and Hemoglobin and Hematocrit Measurements ................... 32 Enterocyte Isolation and Subcellular Fractionation ................................................. 33 Quantitative Real Time PCR ................................................................................... 34 Western Blot Analysis ............................................................................................. 34 Immunohistochemical Analys is of Intestinal Tissue ................................................ 35 Enzyme Activity Assay ............................................................................................ 36 Animal Model for Copper Transport Study .............................................................. 38 Animal Genotyping ................................................................................................. 39 Copper and Phenol Red Measurements ................................................................. 39 Everted Gut Sac Assay ........................................................................................... 40 HEK 293 Cell Model ............................................................................................... 40 Total Cell Lysate Isolation ....................................................................................... 41

PAGE 6

6 Iron and Copper Uptake S tudy ............................................................................... 41 3 ALTERATIONS IN THE EXPRESSION/ACTIVITY OF COPPER RELATED PROTEINS ............................................................................................................. 47 Introduction ............................................................................................................. 47 Results .................................................................................................................... 48 Hematological Status as a Function of Diet ...................................................... 48 Serum Copper Levels, and Hepatic Iron an d Copper Levels ............................ 48 Expression of Cu and Fe Homeostasis Related Genes ................................... 49 Western Blot Analysis of Cu and Fe Homeostasis Related P roteins ................ 49 Immunohistochemical Analysis of Atp7a and Dmt1 Protein Expression ........... 50 Cp and Heph Activity Assays ........................................................................... 50 Discussion .............................................................................................................. 50 4 INFLUENCE OF DMT1 ON COPPER HOMEOSTASIS DURING IRON DEFICIENCY .......................................................................................................... 62 Introduction ............................................................................................................. 62 Belgrade Rat Model ................................................................................................ 63 Hematological Status as a Function of Diet ...................................................... 63 Dmt1 mRNA Expression ................................................................................... 63 Dmt1 Protein Expression .................................................................................. 63 Copper Transport Study ................................................................................... 64 HEK 293 Cell Model ............................................................................................... 64 Real time PCR Analysis ................................................................................... 64 Western Blot Analysis ...................................................................................... 64 Iron and Copper Uptake Study ......................................................................... 65 Discussion .............................................................................................................. 65 5 CONCLUSIONS AND FUTURE DIRECTIONS ...................................................... 73 Conclusions ............................................................................................................ 73 Future Directions .................................................................................................... 75 LIST OF REFERENCES ............................................................................................... 78 BIOGRAPHICAL SKETCH ............................................................................................ 88

PAGE 7

7 LIST OF TABLES Table page 2 1 Genotype, sex and age of all rats used in this study .......................................... 43 2 2 qRT PCR primer sequences ............................................................................... 43 2 3 Ingredients of experimental diets ........................................................................ 44 3 1 Comparison between nutritional and genetic iron deficiency .............................. 53

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Iron and copper absorption pathways in intestinal epithelial cells. ...................... 31 2 1 Genotyping of Belgrade rats by PCR. ................................................................. 45 2 2 Standard curve. .................................................................................................. 45 2 3 DOX inducible system. ....................................................................................... 46 3 1 Copper content in SD rat serum and hepatic copper content. ............................ 54 3 2 qRT PCR analysis of intestinal and hepatic gene expression in SD rats. .......... 54 3 3 Hematological status of experimental animals. .................................................. 55 3 4 Copper content in rat serum, and hepatic iron and copper content. ................... 56 3 5 qRT PCR analysis of intestinal and hepatic gene expression. ........................... 57 3 6 Western blot analysis of iron/copper related proteins. ........................................ 59 3 7 Immunohistochemical analysis of Atp7a and Dmt1 protein expression in rat duodenum.. ......................................................................................................... 60 3 8 Spectrophotometric Cp activity assays. .............................................................. 61 4 1 Hematologic al status of experimental rats. ........................................................ 69 4 2 qRT PCR analysis of intestinal Dmt1 expression. .............................................. 69 4 3 Western blot analysis of intestinal Dmt1 protein expression. ............................. 70 4 4 Copper transport study. ...................................................................................... 70 4 5 Real time PCR analysis. ..................................................................................... 71 4 6 Western blot analysis of Dmt1 protei n expression. ............................................. 71 4 7 Iron (A) and copper (B) uptake analysis. ............................................................ 72 5 1 Hypothetical model of copper absorption in intestinal epith elial cells during iron deprivation.. ................................................................................................. 77

PAGE 9

9 LIST OF ABBREVIATIONS 18S 18S ribosomal RNA +/ b D +/ b rats fed the low iron diet AIN A merican Institute of Nutrit ion Atp7a Menkes Copper T ransporting ATPase Atp7b Wilson's Copper T ransporting ATPase b Bel grade BCA Bicinchoninic acid BCS Bathocuproine disulphonate bp Base pair Cd Cadmium Co Cobalt Cp Ceruloplasmin Ct C ycle threshold Ctr1 C opper transporter 1 Ctrl Con trol Cu Copper Dcyt b Duodenal cytochrome B DFO D esferrioxamine DMEM Dulbeccos modified Eagles medium Dmt1 Divalent metal transporter 1 DOX D oxycycline EDTA Ethylenediaminetetraacetic acid F Female Fe Iron

PAGE 10

10 FeD Iron deficiency FBS Fetal Bovine Serum FOX F e rroxidase Fpn1 F erroportin 1 Fzn Ferrozine GC MS Gas chromatography mass spectroscopy HAMP H epcidin Hct Hematocrit h Hour Hb Hemoglobin Heph H ephaestin HEPES 4 (2 hydroxyethyl ) 1 piperazineethanesulfonic acid ICP MS Inductively coupled plasma mass spectrom etry IEC I ntestinal epithelial cell IgG Immunoglobulin G IRP Iron regulatory protein IRE Iron responsive element kDa Kilodalton M Male mk M icrocytic Mn Manganese M in Minute mRNA Messenger RNA Mt1a M etallothionein 1A Ni Nickel

PAGE 11

11 ROS Reactive oxygen species SD Sprague Dawley SDS S odium dodecyl sulfate S la S ex linked anemia TCA T r ichloroacetic acid TM4 T ransmembrane domain 4 T mprss6 Matriptase2 Tf T ransferrin Tfr1 Transferrin receptor 1 TGN Trans Golgi network Tris Tris (hydroxymethyl) aminomethane PBS Phosphatebuffered saline p PD p Phenylenediamine qRT PCR Quantitative reverse transcriptase PCR

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF DMT1 IN THE COPPER RELATED COMPENSATORY RESPONSE OF THE INTESTINAL EPITHELIUM DURING IRONDEFICIENCY By Lingli Jiang May 2013 Chair: James F. Collins Major: Nutritional Sciences Many human and animal studies have s hown that serum and liver copper levels increase during iron deficiency. In addition, divalent metal transporter 1 ( Dmt1 ) and the Menkes copper transporting ATPase ( Atp7a ) are strongly upregulated in the duodenum of iron deficient rats. These findings sug gest an important interaction between iron ( Fe ) and copper ( Cu ) during iron deficiency. The hypothesis that Dmt1 is necessary for alterations in the expression/activity of copper related proteins during iron deficiency was tested. Experiments were performed in the Belgrade ( b ) rat model of genetic iron deficiency. Dmt1 and Atp7a mRNA expression, along with other metal homeostasis related genes (e.g. Tfr1 ) was increased in enterocytes from b / b rats (as compared to +/b rats), while hephaestin ( Heph) did not change. In the liver, Cp mRNA expression was unaltered. Immunoblots demonstrated that Atp7a protein expression increased in the b / b rats, along with duodenal Heph protein expression (< 3 fold). Cp protein expression in the liver did not change nor did serum or enterocyte membrane ferroxidase activity in the mutants. Thus, Dmt1 is at least partially necessary for the copper related compensatory response during iron deficiency. One potential explanati on for t his phenomenon could involve enhanced copper transport by Dmt1 in the small intestine. T he following studies were designed to test the hypothesis that Dmt1

PAGE 13

13 transports copper during low iron states, when it is strongly induced, and competing iron atoms are low in abundance. First the Belgrade rat model w as utilized to show that mutated Dmt1 cannot increase copper transport in the iron deficient b / b rats, but the +/ b rats did show changes in copper levels during iron deficiency. To further explore the possible copper transport by Dmt1, a doxycycline (DOX) inducible Dmt1 over expression system in HEK 293 cells was employed. In DOX treated cells with confirmed Dmt1 over expression, 64Cu uptake was not different from untreated cells. However, a significant increase in c opper uptake was noted (~3 fold) when cel ls were treated with DOX in the presence of an iron chelator (as compared to DOX only treated cells). It is t h erefore concluded that under normal conditions, Dmt1 does not transport copper, but that it may be involved in copper transport under low iron conditions.

PAGE 14

14 CHAPTER 1 L ITERATURE REVIEW The exploration of copper/iron interactions started over 100 years ago [1,2] Copper was thought to affect iron metabolism including intestinal absorption, release from storage and cellular utilization during hemoglobin synthesis [ 3 ] The copper/iron interaction also has a flipside, i.e., iron status can influence copper metabolism [ 4 6 ] Thus, there are copper related feedback mechani sms at the physiologic and cellular levels during low or highiron conditions. In my work, the focus will be on the underlying mechanisms of the copper related compensatory response to low iron conditions. As two key players involved in iron metabolism, ceruloplasmin ( Cp ) and hephaestin ( Heph) are multicopper ferroxidases that are needed for iron absorption from the intestine ( Heph ) and release from various tissues ( Cp ) [7,8]. Without functional multicopper ferroxi dases, Fe2+ cannot be oxidized to Fe3 +, the transferrin binding form and ferrous iron is thus trapped inside enterocytes and hepatic macrophages [9,10] Since Cp and Heph exemplify the relationship between copper and iron metabolism, they have been extensively studied in iron deficient rodents [1,1113] Results from these studies demonstrated increased ferroxidase activities of Cp and Heph in rodents suffering from diet ind uced irondeficiency anemia, which is likely a part of the copper related compensatory response during iron deficiency [ 1418] Recent studies identified other proteins that connect copper and iron metabolism, such as Atp7a (the Menkes Copper Transporting ATPase) and Dmt1 (Divalent metal transporter 1) [19,20] Studies have shown that Atp7a mRNA and protein levels were incr eased during diet induced iron deficiency when Dmt1 expression increases dramatically [ 21] Moreover, other studies have shown that Dmt1 can transport copper

PAGE 15

15 [2,22 26] although the physiological significance of this observation is unknown. Given the uncertainty of the role of Dmt1 in copper homeostasis, the studies described in this dissertation were undertaken to assess the effect of an inactivating mutation in Dmt1 in the Belgrade rat Further studies used HEK 293 cell s Dm t1 over expression, and investigated copper m etabolism during iron deprivation [27] In this work, the overall hypothesis that Dmt1 affects copper homeostasis by interacting with/ transporting copper under low iron conditions will be tested. These studies will help us to understand more about the basic mechanisms of intestinal copper/iron abs orption and copper related compensatory responses during iron deficiency. Introduction to I ron Basic P roperties of I ron Iron is a biologically essential element involved in the metabolism of all living organisms. More than 65% of body iron is found in hem oglobin, up to ~ 10% as myoglobin, 1~5% as part of enzymes, and the remaining body iron is in the blood bound to transferrin or stored in ferritin inside cells. The human body contains ~ 24 g of iron, which is related not only to body mass but is also inf luenced by other physiological conditions including age, gender, pregnancy, and state of growth. Iron has several oxidation states varying from Fe6+ to Fe2 +, depending on the chemical environment. In biological systems iron is found in two principal oxidation states ferrous ( Fe2 +) or ferric (Fe3 +) At the oxygen concentrations found under physiologic conditions, iron is mostly in the more stable oxidized ferric form. Conversely, critical biologic processes, such as intestinal transport, deposition into ferritin, and the synthesis of heme all require that iron be in the reduced ferrous state.

PAGE 16

16 Good sources of iron in American diets include red meat, oysters, clams, beans, dark green leafy vegetables, and dried fruits. In addition to iron found naturally in f oods, refined grain products, such as breads, pasta, cereals and flour are fortified with iron. Dietary iron is found in one of two forms in food: heme and nonheme. Heme iron represents iron that is contained within the porphyrin ring structure, which is d erived mainly from hemoglobin and myoglobin, and thus is found in animal products. Most plant s, as well as dairy and meat products contain nonheme iron. N onheme iron is less easily absorbed by the body. Furthermore, nonheme iron is usually bound to food co mponents which must be hydrolyzed before iron can be absorbed into intestinal epithelial cells. Iron M etabolic P athways Dietary iron is absorbed in the duodenum and the upper part of the jejunum The availability of ingested iron for absorption and the am ount absorbed depend on the chemical nature and quantity of iron in the diet, the presence of other factors in ingested food, the effects of gastrointestinal secretions and the absorptive capacity of the intestinal mucosa. The absorptive capacity is regula ted to a large extent by two internal factors: the amount of iron stores and the rate of erythropoiesis [28] From a typical daily dietary iron intake of 12 18 mg only about 1 to 2 mg is absorbed Compared with non heme iron, heme iron is more readily absorbed. Hence, heme iron may contribute a larger proportion of absorbed iron even though it represents a lesser fraction of ingested iron. Heme iron must be hydrolyzed from hemoglobin or myoglobin prior to absorption. Heme iron enters mucosal cells through the brushborder membrane, possibly by endocytosis, as the intact iron protoporphyrin complex [29] Once within cells, iron is

PAGE 17

17 released by the action of the microsomal enzyme, heme oxygenase [30] Subsequently, heme iron likely enters the same intracellular pool as newly absorbed nonheme iron. Nonheme iron bound to food components must be released in the gastrointestinal tract prior to being absorbed. Once released from food components, most nonheme iron is present as ferric (Fe3 +) iron in the stomach. Ferric iron remains relatively soluble at acidic pH. However, as iron passes from the stomach into the small intestine, ferric iron may complex with oxygen to produce ferric hydroxide (Fe(OH)3), a relatively insoluble compound, which makes the iron less available for absorption. Fe3+ must be reduced by cellsurface ferrireductases such as Dcytb (D uodenal cytochrome B ), to be transported via Dmt1 into enterocytes [31] Iron entering enterocytes can be sequestered into the iron storage protein ferritin, used for metabolic purpose by cells or transported acros s the basolateral membrane. The export of ferrous iron from the enterocyte is accomplished by ferroportin 1 (Fpn1); Fe2+ is then oxidized to Fe3 + for binding to transferrin (Tf) by the copper dependent enzyme H ephaestin (Heph) which is a membrane bound ceruloplasminlike molecule that has ferroxidase activity (Fig 11) [32,33] Essentially all plasma iron exists as ferric iron bound to transferrin, which delivers significant quantities of iron to the bone marrow t o supply erythrocyte precursors with iron for hemoglobin synthesis. Uptake of circulating transferrinbound iron by cells is controlled by the number of transferrin receptors ( TFRs ) expressed on the plasma membrane. The TF R complex exist s as a dimer of two identical transferrin receptors. TF Rs are internalized in response to binding of the diferric transferrin ligand to their extracellular domains. This internalization process involves uptake of the entire TF R -

PAGE 18

18 diferric transferrin complex into an endocytic vesicle. Once formed, the vesicle is acidified by a proton pump in the endosomal membrane, facilitating the release of Fe3+ from transferrin. Ferric iron is subsequently reduced to Fe2+ by endosomal reductases, perhaps by a Steap family protein. Fe2+ is t hen transported out of the endosome by Dmt1. The transferrin cycle is completed whe n the endosome containing the TF R and iron free apotransferrin recycles back to the plasma membrane, where the neutral pH environment facilitates the dissociation of apotr ansferrin from TF Rs. The apotransferrin released into the plasma is then free to be reloaded with ferric iron [34] Liver is the primary site of iron storage in the body, and it likely serves as the central control point of wholebody iron regulation, as it produces hepcidin (HAMP). HAMP, a peptide hormone, is considered as the central iron regulatory molecule that can explain both irondependent and inflammationdependent changes in iron absorption [35] HAMP also regulates iron release from body storage sites, such as the reticuloendothelial system of the liver (Kupper cells) and spleen (macrophages). Efficiency of iron absorption and circulating hepcidin concentrations are inversely correlated In other words, high circulating hepcidin is associated with low iron absorption, and vice versa. The underlying mechanism of hepcidin function involves the iron export protein, ferroportin 1 ( Fpn1 ). Binding of hepcidin to ferroporti n results in the internalization and degradation of Fpn, and thus leads to a decrease in iron export [36] Free iron is toxic, due to its ability to donate and accept electrons and as such it can catalyze the conversion of hydrogen peroxide into oxygen free radicals which is called the Fenton reaction. Free radicals can damage a wide variety of cellular

PAGE 19

19 structures, and ultimately kill cells. To prevent this oxidative damage, the majority of excess free iron in cells is stored within the ferritin molecule [37] There are no ac tive excretory systems for iron, so intesti nal iron transport is tightly regulated. However, i ron is lost from the body by nonspecific processes. About one half of daily endogenous iron losses occur through the intestine, most of which occurs by occult blood loss and the remainder from ferritin ir on lost in sloughed enterocytes and biliary secretions [38] The P hysiologic C onsequences of I ron D eficiency Iron deficiency is defined as a functional tissue deficit of iron resulting from depleted iron stores and is characterized by changes in iron metabolism and ironrelated biochemical indices. The most common consequence of iron deficiency is anemia, which often occurs in pregnant women and women of childbearing age. Deficiency during pregnancy may be caused by several factors, including the need for additional iron for maternal tissue accumulation, dilution of blood volume and the need to transfer considerable quantities of iron to the fetus during the last trimester of gestation. Numerous studies have reported adverse effects of maternal iron deficiency during pregnancy, particularly irondeficiency anemia, and shortened gestation, preterm birth, and lower infant birth weight [39] Maternal anemia during pregnancy increases the risk of low birth weight by about threefold [40] Chlorosis, also called chloremia is a form of chronic anemia It was prom inent from the mid16th century to the beginning of the 20th century, when it was commonly diagnosed in young women in Europe and America, and possibly the Middle and Far East. Chlorosis is characterized by a greenishyellow discoloration of the skin (the "green sickness"), and hypochromic, microcytic erythrocytes and a small reduction in

PAGE 20

20 t he total number of erythrocytes. Those suffering from chlorosis often exhibited behavioral abnormalities including moodiness and lethargy It is usual ly associated with d eficiency of iron and copper containing proteins. Iron deficiency also can exist without anemia; some subtle functional changes may occur in the absence of anemia. However, even mild and moderate forms of iron deficiency anemia are associated with functio nal impairments affecting cognitive abilities [41] immunity, work capacity and the ability to regulate body temperature [42] Iron D eficiency M odel Unlike n utritional iron deficiency, which arises when physiological requirements cannot be met by iron absorption from the diet genetic iron deficiency is caused by defects of iron metabolism related genes, such as mutations in the gene encoding DMT1, transferrin or matriptase2 (T mprss 6) The clinical observation of unexplained forms of iron deficiency anemia has led to the description of a new group of hematological diseases which are genetic forms of irondeficiency anemia [43] Inher ited disorders of iron metabolism lea ding to iron deficiency are uncommon in humans. However, there are a number of reports of inherited refractory anemia which cannot be accounted for by environmental factors or coexisting disease states that likely repr esent defects in iron transport Upon the development of modern molecular techniques, positional cloning of the gene affected in the microcytic ( mk ) anemia mouse was one approach that led to the original identification of Dmt 1 [44] These studies provided strong evidence that Dmt 1 plays a critical role in intestinal iron absorption. Studies published in 2004, described a pa tient carrying a mutation in Dmt 1 who exhibited a severe hypochromic, microcytic an emia. A simi lar phenotype was observed

PAGE 21

21 in the mk mouse, the Belgrade rat, and a mutant Zebra fish strain [45] In each case, this anemia is attributed to a defect in Dmt 1 [46] The gen etic iron deficiency model chosen for my studies was the Belgrade rat ( b / b ), which resulted from irradiation of 8day old female rats, eventually producing a strain with heritable microcytic, hypochromic anemia [47,4 8] The Belgrade rat is characterized morphologically by red cell hypochromia, microcytosis, and reticulocytosis Early studies on this genetic model of iron deficiency demonstrated a defect in iron uptake into reticulocytes and enterocytes. Iron utilizat ion for hemoglobin synthesis is also reduced. In addition, parenteral iron treatment fails to cure the anemia, even though it results in gross iron overload of spleen and liver [47] Molecular genetic approaches led to the discovery that Dmt1 was the mutated gene responsible for the Belgrade rat phenotype and that the mutation is identical to the one in the microcy tic ( mk [49] Dmt1 was also identified almost simultaneously by an expression cloning technique, and it was shown to function as a transporter of div alent metal ions, including iron. [23] Iron absorption was examined in homozygous ( b / b ) and heterozygous ( +/ b ) Belgrade rats, which are phenotypically normal. Long term iron absorption was assayed by whole body counting for 10 days after introducing a dose of radiolabelled ferric iron into the stomach by gavage [50] F or short term experiments, test doses of Fe3+ and Fe2+ were also injected into closed duodenal loops in situ for 30 min [51] In both experiments, the b / b rats had significan tly impaired iron absorption as compared to the +/b rats.

PAGE 22

22 Impaired iron absorption is not the only defect due to Dmt1 mutation in the Belgrade rat as one study done by Edwards et al indicated that although uptake of the transferrin iron receptor complex was unimpaired [52] there was markedly reduced iron accumulation in reticulocy tes in the b / b rats compared with irondeficient phenotypically normal +/ b rats. Th ey thus concluded that the Belgrade rat has an abnormality of iron releas e within the absorptive endosome that is responsible for a state of intracellular iron deficiency, i nvolving the erythron and other body tissues. It is now clear that the Belgrade and mk mutation in Dmt1 decrease iron absorption from the diet and iron uptake into other cells of the body as a result of a defect in the transferrin cycle, demonstrating a cr itical physiological role for Dmt1 in overall body iron homeostasis. Introduction to Copper Basic Properties of Copper Copper is an essential micronutrient involved in a variety of biological processes. Copper can be converted between two major oxidation s tates, cuprous (Cu1 +) and cupric (Cu2 +) and it may shift back and forth during enzyme action. This element is a required co factor for a number of essential enzymes, which include cytochrome c oxidase, lysyl hydroxylase. Although c opper is essential, excess copper is toxic since free copper ions are involved in the Fenton reaction, which generates highly reactive free radicals, such as the hydroxyl radical, that can damage proteins, lipids, and nucleic acids. Thus, under normal conditions, in the cell, free copper is virtually nonexistent. The richest sources of dietary copper contain from 0.3 to more than 2 mg/100 g. These include shellfish, nuts, seeds (including cocoa powder), legumes, bran s and

PAGE 23

23 germ portions of grains, liver and organ meats. Major sources of copper in the US diet are meat, nuts, beans and peas [53] Copper Metabolic Pathways Dietary copper is predominantly absorbed in the duodenum and upper small intestine. At low copper intake levels, absorption is a saturable, active transport process m ediated by copper transporter 1 (Ctr1), a homotrimeric channel like protein that facilitates Cu1+ uptake with high affinity in the brushborder of intestinal epithelial cells ( IECs ) [54,55] Before copper is transported by Ctr1, it has to be reduced from Cu2+ to Cu1+ by unknown copper reductases. However, at high intake levels, passive diffusion plays a role [56] Another potential Cu transporter in the brushborder is Dmt1, already described as a transporter of Fe2+ and Mn2+ [57] Once Cu is absorbed into IECs it binds to chaperone proteins that deliver Cu to specific intracellular sites and enzymes [58] These chaperones function to minimize free Cu ions by releasing them directly to their target proteins. In enterocytes, Cu is bound to the chaperone Atox1, which plays a role in copper homeostasis by binding and transporting cytosolic copper to an ATPase protein, Atp7a, in the trans Golgi network for later incorporation into various cuproenzymes Atp7a may also translocate to the basolateral membrane of enterocytes and pump Cu out of the cell. Some absorbed C u may also bind to cytosolic metallothionein (MT), which functions as an intracellular copper binding protein, analogous to ferritin for iron (Fig 1 1) After absorption, Cu is transported in the portal circulation bound pr edominant ly to albumin and transc uprein 2m acroglobulin). The copper pool in the portal venous system enters the liver where copper is subsequently imported into hepatocytes via Ctr1 [59] Once in the liver, most copper is incorporated into

PAGE 24

24 ceruloplasmin (Cp ) or excreted from the body in bile. Most of copper in the blood is bound to Cp although in the human disease associated with the absence of Cp (Aceruloplasmine mia) Cu is still delivered normally to body tissues. Studies from several laboratories provided convincing evidence that under basal copper conditions Atp7b, which is an analogous P type ATPase to Atp7a in the intestine, is present in the trans Golgi of hepatocytes [60,61] In this cellular compartment A tp7b delivers copper to ceruloplasmin and other cuproenzymes in the secretory pathway. When copper levels are elevated, Atp7b trafficks from the TGN ( trans Golgi n etwork) to the canalicular membrane to export excess copper into the bile. [62] Animal studies suggest that copper is stored in the liver bound to Mt like proteins. Copper Containing Proteins One of the major functions of copper in vivo is to facilitate electron transfer reactions as a cofactor in a host of enzymes, as described below. This section will focus on proteins important for the investigation put forth in this document. Ceruloplasmin, also called ferrox 2glycoprotein with a molecular weight of ~132 kDa [63] It is a bluecolored plasma protein, which binds up to 95% of circulating copper. It undergoes a post translational N l inked glycosylation within the hepatocyte, before being released into the bloodstream. However, glycosylation is not required for copper incorporation during biosynthesis, but changes in the carbohydrate structure may have functional implications with rega rd to protein turnover and enzyme activity. The protein contains 6 tightly bound copper ions, in 3 different types of binding sites. The physiologic functions of ceruloplasmin include copper transport to peripheral tissues, oxidation of organic amines, and iron oxidation for iron release from some tissues, in addition to others. The key function for the studies delineated in this

PAGE 25

25 dissertation relates to the ferroxidase function of Cp as it may relate to iron release from enterocytes [64] Hephaestin ( Heph ) is a transmembrane, copper dependent ferroxidase necessary for effective iron export from intestinal enterocytes and it shares 50% amino acid identity with ceruloplasmin. The theoretical calculated molecular mass of the polypeptide is 127.8 kDa, while the apparent molecular mass of mature hephaesti n on SDS PAGE gels is ~150 160 kDa [65] Hephaestin was identified as a key component of intestinal iron transport by investigation of the sex linked anemia ( sla ) mouse [66] Sla mice develop moderate to severe microcytic, hypochromic anemia due to a block in intestinal iron transport, particularly early in life. Heph represents another key conn ection between iron and copper homeostasis. Iron and Copper Interactions Historical Evidence In 1848, Millon proposed that chlorosis, a common form of anemia, was due to copper deficiency. Furthermore, Pecholier and Saint Pierre [67] concluded that copper was helpful in preventing and overcoming chlorosis upon observing young women work ing in copper factories who were protected from anemia related health issues. In 1862, Italian physician Mendini [68] reported the first direct experimental evidence that supplementation of the diet with copper salts overcame chlorosis in young women. After that, Cervello and his students from Italy confirmed the beneficial effects of copper o n anemia both in patients and animal models. In 1928, Elvehjem et al. [69] discovered the role of copper in forming hemoglobin and in overcoming anemia. Simultaneously, other scientists and physicians attempted to identify causes and cures for chlorosis. In the 1950s to 1960s, Wintrobe et al. [70] began to evaluate how copper affected iron

PAGE 26

26 delivery for hemoglobin synthesis, considering initially intestinal absorption and release f rom storage sites. The copper/iron connection also has a flipside effect, i.e., iron status can influence copper metabolism as first described by Warburg and Krebs in 1927. They measured the amount of iron and copper in the blood from several species and in patients with various diseases [71] and more importantly, they reported that acute bleeding of birds caused a 35 fold increase in the amount of copper in the blood. That is to say, the absence of copper caused chlorosis but according to Wa rburg and Krebs, copper increased during anemia. The observations made by Warburg and Krebs were soon confirmed by similar bleeding experiments in animals and by reports that copper levels increased in human anemia. In 1934, the first experimental confirma tion was by Sarata and Suzuki in Japan. They showed that acute bleeding of rabbits led to a rapid increase in blood copper, reaching a peak after about 2 days and then gradually declining to the normal level [72] Subsequently Sachs [73] in 1938 found that acute bleeding of dogs caused a rapid increase in blood copper The reciprocal relation between iron and copper was also confirmed in multiple observational studies of p atients. Gorter et al. [74] in Holland were first to investigate this relationship in humans. In 1 931 they reported that anemic children had significantly higher blood copper levels than new borne or recovering children Elevated copper was also shown after massive hemorrhage in adults [73,75] Wintrobe et al. [76,77] found that blood copper levels were highly elevated during the anemia of inflammation. After that, Venakteshwara et al. [78] reported that in 1975, the increase in serum copper was shown to reflect elevated serum ceruloplasmin in several conditions of anemia including dietary irondeficiency

PAGE 27

27 anem ia Recently, our lab also reported that serum ceruloplasmin protein expression and activity increases in irondeficient rats [11] In general, iron deficiency results in an increase of copper levels in the liver [79 81] whereas copper deficiency also leads to changes in iron metabolism, causing anemia and liver iron overload [82, 83] Parallel s B etween Iron and Copper Both iron and c opper are essential micronutrients for most organisms, which means the deficiency of either one can cause serious health problems. The nutritional deman d for iron and copper in living organisms is derived from their role in the metabolism of living cells. As iron and copper are transition metals, many of their functions are based on the fact that they exist in two oxidation states allowing them to accept or donate electrons to form the catalytic center of many redox reactions. For instance, the Fenton r ea ction which leads to the formation of reactive oxygen species (ROS), needs iron or copper as princip al reagents. Since both ferric iron and cuprous copper are insoluble in aqueous solution at neutral pH, which would cause precipitation under most physiolog ical conditions, they are associated with carriers or chaperones, in order to m aintain solubility and avoid potential toxicity. Another similarity between iron and copper which was observed is that many doseresponse curves are bell shaped [84] These phenomena reflect regulatory responses to demand in order to protect from toxicity. Without this protective mechanism, iron and copper cannot maintain a harmonic balance in the body: not enough of these minerals can lead to disease states such as anemia, or too much of them can overloaded the free metals in the blood or inside cells, which would initiate toxicity from redox re actions, such as the Fenton reaction mentioned above.

PAGE 28

28 Links B etween Iron and Copper As the rapid development of modern molecular and genetic techniques occurred, novel discoveries have resulted. For instance, studies of two copper containing ferroxidases ceruloplasmin and hephaestin have provided two molecular linkages between copper and iron metabolic pathways. I n 1948, a protein containing ~ 8 copper atoms per molecule was purified, and which retained the p phenylenediamine oxidase activity of the crude fraction [85] Holmberg and Laurell proposed that the n ew protein be named coeruloplasmin Arthur Schade and Leona Caroline [86] reported the discovery of an iron binding protein, named transferrin, in 1944 in egg whites and later in plasma [87] which provided an important clue to the function of ceruloplasmin. In 1961, Curzon [88] mentio ned the earlier work on plasma iron oxidases and the requirement for iron oxidation for loading of transferrin. In addition, a n important clue to understanding coppers role in iron absorption came from studies of mice subjected to mutagenesis by X ray irradiation. In one strain of resulting mices, the defect ive gene was shown t o cause sexlinked and recessive anemia, and the genotype was described as sex linked anemia ( sla ) [89,90] Later, in 1999, Vulpe et al. [66] identified the specific gene mutated in the sla mouse. The hephaestin gene as it was called was highly expressed in the small intestine and colon of mice and rats [33] Moreover the encoded protein had high sequence homology wi th ceruloplasmin, and in particular exhibited conservation of amino acid residues essential for copper binding, and thus for ferroxidase activity. Besides the copper containing ferroxidases o ngoing research has demonstrated that two metal ion transport pr oteins, namely, Atp7a and Dmt1, are also likely to fill gaps in our knowledge of the linkage between iron and copper interactions in health and

PAGE 29

29 disease [91] In 2005, studies done by our lab identified novel genes involved in intestinal iron absorption by inducing iron deficiency in rats during postnatal development from the suckling period through adulthood. Comparative gene chip analyses were performed with cRNA der ived from duodenal mucosa, and r eal time PCR was used to confirm changes in gene expression. Atp7a and Dmt1 were strongly induced at all ages studied, suggesting increased copper absorption by enterocytes during iron deficiency [ 14] Gunshin [23] in 1997, reported that iron and copper elicited similar currents when they expressed the Dmt1 transporter in Xenopus oocytes Subsequently Garrick et al. [24] noted that Cu2+ competes with 59Fe2+ during transient expression of Dmt 1 in HE K 293 cells In 2002, Arredondo et al. [2] showed that an antisense olig o nucleotide designed against Dmt 1 inhibited both iron and copper uptake in Caco 2 cells and that copper competed with iron uptake in these cells In the same year, Linder et al. [25] examined interactions between copper and iron in the same cell culture system. They found that depletion of cellular iron or copper increased apical uptake of both metal ions and that depletion of iron or copper also enhanced tr ansepithelial transport of iron from the apical to the basal chamber Furthermore, a recent study done by Monnot AD [22] found that Dmt 1 contributes to Cu tra nsport at the bloodCSF (cerebrospinal fluid) barrier, and that accumulation of intracellular Cu found in choroidal epithelial Z310 cells during iron deficiency appears to be mediated, at least in p art, via up regulation of Dmt 1 after iron chelation However, other studies found opposite results. For instance, the latest study tested uptake of a variety of metal ions by performing a comprehensive substrateprofile analysis for human DMT1 expressed in RNA injected Xenopus oocytes using radiotracer assays and continuous

PAGE 30

30 measurement of transport by fluorescence with the metal sensitive PhenGreen SK fluorophore. They reported that copper is not a substrate of DMT1 [92] In addition, an in vivo study showed that absorption of copper was not significantly increased in bled rats or rats fed low iron diets [93] However, in this study, copper absorption was measured by counting the radioactivity remai ning in the eviscerated carcass, which was not the direct determination of copper absorption in intestinal cells, and the whole body copper level may be influenced by other factors, such as an excretory pathway. Another study done by Fawzi A. [94] also reported that total body copper did not increase in rats fed low iron diet, but i n iro n deficiency the amount of copper taken up into the duodenal mucosa i s more than two times higher Therefore, the precise role of Dmt1 in copper homeostasis specifically in intestinal epithelial cells, remains to be determined. Specific Aims Based on known fact s of the iron and copper interaction, whereby each metal influences the metabolism of the other, i t is important to discover further key link s between them. The major aim of this study was to investigate how Dmt1, as a potential link between iron and copper af fects the copper related compensatory response during the iron deficiency condition. Specific aim 1 of this dissertation is to test the hypothesis whether DMT1 is necessary or not for alterations in the expression/acti vity of copper related proteins Thes e studies were performed in Belgrade rat model, which is a genetic irondeficient animal model, because of a lack of fully functional Dmt 1. Specific a im 2 is to test the hypothesis that Dmt1 effects the expression and activity of copper related proteins vi a transporting copper. In order to test this an everted gut sac assay in the Belgrade rat and a copper uptake study in the HEK 293 cell model wer e undertaken to evaluate the function of Dmt1 in intestinal copper transport.

PAGE 31

31 Figure 11. Ir on and copper absorption pathway s in intestinal epithelial cell s. Before uptake, ferric iron (Fe3+) is reduced to ferrous form (Fe2+) by duodenal cytochrome b (Dcytb) on the intestinal cell surface along with exogenous dietary reducing agents, such as ascorbic acid. Fe2+ is then transported across the apical membrane via divalent metal transport 1 (Dmt1) into the enterocyte. Intracellular iron ions are delivered to the mitochondria, or to iron storage proteins ( e.g ., ferritin). The newly ac quired Fe2+ is t ransferred across the basolateral membrane via an iron exporter, ferroportin 1 (Fpn1), and then oxidized to Fe3+ by hephaestin (Heph) before it is bound to transferrin (Tf). Liver cells take up transferrinbind iron through transferrin receptor 1 (Tfr1). L ike iron, before entering into the enterocyte via copper transporter 1 (Ctr1) cupric copper (Cu2+) is reduced to cuprous copper (Cu1+) by reductases ( e.g ., Dcytb) on the apical surface of the intestinal cell. Intercellular copper is immediately bound by i ntracellular chaperones and directed to the trans G olgi network and is exported from the cell via the Menkes C opper T ransporting ATPase (Atp7a). Af ter Absorption, copper enters the portal circulation, and then is taken up by liver cells via Ctr1. Most of c opper in the liver incorporates into ceruloplasmin (Cp) and excess copper is excreted through bile via Wilson's C opper T ransporting ATPase ( Atp7b).

PAGE 32

32 CHAPTER 2 METHODS AND PROCEDURES Experimental Animal s All animal studies were approved by the University of Florida IACUC before commencing this investigation. Belgrade rats used in the following studies were adult males and females between the ages of 3.5 and 22 months obtained from a breeding colony at the University at Buffalo maintained by Dr. Laura Garrick. The use of different sexes and ages was necessary because of the expense of maintaining the breeding colony and the small litter sizes [95] The + / b rats, which are phenotypically norm al, were fed a normal chow ( ~198 ppm Fe), whereas the b / b rats were fed a high iron containing chow (~360 ppm Fe), per the usual husbandry routine [95] About two weeks before the experiment, b / b rats were switched to the control diet. In some experiments, control and irondeficient, wild type, Sprague Dawley (SD) [35] rats were also utilized for comparison purposes. These animals were male rats obtained at weaning from Harlan Laboratories, which wer e housed in overhanging cages and fed either a semipurified AIN93G based diet (Dyets) containing 198 ppm (Ctrl) or 3 ppm (FeD) iron for 35 days. This feeding regimen l eads to the development of irondeficiency anemia, with significantly decreased ironrela ted hematological parameters [96] All rats were anesthetized by CO2 exposure and killed by cervical dislocation. The different groups of rats obtained, and a description of how they were utilized in the curr ent st udies are shown in Table 21 Elemental Analyses and Hemoglobin and Hematocrit Measurements Rat liver and serum samples were submitted to the Diagnostic Center for Popul ation and Animal Health at Michigan State University for mineral analysis. Liver

PAGE 33

33 sampl es were dry ashed and digested with nitric acid. The digested tissues/serum samples were then diluted and analyzed by Inductively Coupled PlasmaMass Spectrometry. Hemoglobin ( Hb ) and Hematocrit (Hct) were measured in house using a HemoCue Hb analyzer ( He mocue AB) and a Readacrit Hct system, respectively, following the manufacturers' instructions Enterocyte Isolation and Subcellular Fractionation Animals were s acrifice d and ~ 10 cm the upper small intestine was removed. T he segment was cut into 2 or 3 pieces which were placed into a small Petri dish containing ice cold 1X PBS. The segments were then everted on wooden sticks and submersed in a 15 ml conical tube containing PBS plus EDTA. T he segment remained submerged for ~20 min on ice, with gentle agitation every few minutes which resulted in the release of epithelial cells. The stick containing the intestinal segment was then removed and the cells were centrifuged at 500 g for 5 min at 4 C to pellet the enterocytes, followed by 2 washes. C ells were final ly resuspended in 2 3 ml membrane prep buffer 1 (25 mM Tris HCl, pH 7.4, 25 mM NaCl) with protease inhibitor s, followed by homogenization and centrifuging at 16,000 g for 15 min The supernatant was subsequently ultracentrifuged at 11 0 ,000 g, 5 C for 65 m ins The resulting pellet was dissolved in 500 l buffer 2 (Buffer 1 + 0.25% Tween20). After 20 s sonication, the samples were centrifuged at 16,000 g for 30 min at 4 C. The resulting supernatant was the solubilized particul ate membrane fraction. T he sam ples were then aliquoted and need for immunoblot analysis and enzyme activity assay s.

PAGE 34

34 Quantitative Real Time PCR Total RNA was purified from rat liver with TRIzol reagent (Invitrogen), and qRT PCR was performed as previously described [ 16] Briefly, 1 of RNA was converted to cDNA with the Bio Rad iScript cDNA synthesis kit in a 20 reaction. One l of the cDNA reaction was used with 10 of SYBR Green master mix (BioRad), plus 0.75 (0.25 pM) of each forward and reverse genespeci fic primer (T able 22 ), in a 20 reaction. Primers were designed to span large introns to eliminate the chances of amplification from genomic DNA. Reactions were run in 96well plates on a BioRad iCycler with the following cycling parameters: 95 C for 3 min, and 39 cycles with 95 C for 10 s and 58 C for 30 s. A melt curve was subsequently performed after 39 cycles of amplification; single amplicons were detected in all cases. Preliminary experiments established the validity of each primer pair in that each set was able to linearly amplify each singular transcript across a range of template concentrations. Each RT reaction was analyzed in duplicate for 18S rRNA, Atp7a (Menkes copper ATPase), Dmt1, transferrin receptor 1 ( Tfr 1 ), metallothionein 1A (Mt1a), copper transporter 1 (Ctr1), Wilson's copper ATPase (Atp7b), Heph Cp and hepcidin (Hamp) in each experiment. Next, the average of 18S was subtracted from the experimental gene average to generate the cycle threshold ( Ct ) value. Data were analyzed by routine methods Briefly, b / b vs. +/ b groups. Mean fold induction equates to 2 Western Blot Analysis For Western blot experiments, validated antibodies against Atp7a, Dmt1, Heph and Cp were utilized. The Atp7a a ntiserum (called 5410) has been extensively validated [16,97] The Dmt1 antibody (called anti 1A) was a kind gift from Dr. Michael

PAGE 35

35 Garrick, University at Buffalo. This affinity purified reagent is a polyclonal anti body raised in rabbits against an NH2terminal peptide, which was modeled after a recent publication [ 21] Validation in the Garrick laboratory included studies in HEK293 cells overexpressing Dmt1 (or not), experiments with brainspecific Dmt1 knockout mice, as w ell as studies performed in control and irondeficient rats, and in b / b vs. +/ b rats. All indications are that this reagent specifically recognizes the rat Dmt1 protein. The Dmt1 antibody used in Chapter 4 for B elgrade ra ts was commercial antibody from Alp ha Diagnostic (# 1082627A) The thoroughly characterized Heph antibody (called D4) [ 8 ] was a kind gift from Dr. Chris Vulpe, University of Califo rnia, Berkeley. A well established chicken anti Cp antibody and a peroxidasecoupled secondary antibody were kind gifts from SigmaAldrich. Identical quantities of enterocyte membrane or serum proteins from +/ b and b / b rats were electrophoresed, blotted a nd blocked following published methods [11,15] with the following variations: 1:4,000 dilution of primary antisera (except 1:5,000 for Cp ) and 1:6,000 dilution of horseradish peroxidaseconjugated anti rabbit (secon dary) antibody. Blots were stained with Ponceau S solution to confirm equal sample loading and efficient transfer. The optical density of immunoreactive bands on film and proteins on stained blots was determined using the digitizing software UN SCAN IT (Si lk Scientific), and the average pixel numbers were used for normalization and comparison. The intensity of immunoreactive bands on film was normalized to the intensity of total proteins on stained blots. Immunohistochemical Analysis of Intestinal Tissue Th ese experiments were designed to determine if the Dmt1 mutation of the b / b rat affects the localization of two potential copper/iron transport proteins, namely, Dmt1 and Atp7a, and the enzyme activity of two multi copper ferroxidases Heph and Cp

PAGE 36

36 Immunohi stochemistry analysis was performed to determine the localization of the Atp7a and Dmt1 proteins, as well as to compare protein expression levels in +/ b and b / b rats. Transverse sections of intestinal tissues were harvested from the duodenum of +/ b and b / b rats, and from control and irondeficient SD rats. Tissues were fixed overnight in 10% buffered formalin and then transferred to 70% ethanol. Samples were then embedded in paraffin, and slices were cut and affixed to slides. Tissue sections on slides wer e subsequently deparaffinized with xylene and a series of ethanol washes. Sections were then blocked for 3045 min with immunofluorescence blocking solution ( Bethyl Laboratories) followed by a 10 min wash in PBS. Atp7a and Dmt1 polyclonal antisera were then applied at a 1:1,000 and 1: 6,000 dilutions, respectively, overnight in a humidified chamber, followed by a 10 min wash in PBS. A secondary antibody (Alexa Fluor 647 goat anti rabbit IgG; Invitrogen Molecular Probes) was then applied for 30 min at a 1:1, 000 dilution. After another brief wash in PBS, coverslips were mounted with a fluorescent mounting medium. Slides were visualized in the Confocal and Flow Cytometry Facility in the McKnight Brain Institute at the University of Florida with an Olympus IX81DSU confocal microscope. A 633 nm line from a green HeNe laser was used for sample excitation along with a Cy5 emission filter set. The confocal settings were kept identical across the different samples, so direct comparison of fluorescence intensity was p ossible Enzyme Activity Assay Two enzyme activity assays Ferrozine ( Fzn ) assay and p Phenylenediamine ( p PD ) oxidase activity assay were be used to compare membrane ( Heph) and serum Cp activity between b / b and +/ b rats. Blood was collected by cardiac punct ure with an 18gauge stainless steel needle and transferred into a prechilled Falcon 5 ml

PAGE 37

37 polypropylene tube. After 1 h to allow for clotting, the tubes were centrifuged at 1,500 g for 10 min at 4 C. The supernatants were separated and stored at 4 C for FOX activity assays, which were performed within 48 h. Previous studies demonstrated that the Cp enzyme was stable under these conditions, with no significant decrease in activity noted with storage at 4 C for up to 72 h [ 11 ] For the ingel p PD assay, one milligram of serum protein per lane was electrophoresed through a native 7.5% polyacrylamide gel at a constant 80 V in 1X native running buffer (0.12 M Tris an d 0.04 M glycine) in an icewater bath. The gel was then briefly rinsed in water, incubated in 30 ml 0.1% p PD in 0.1 M Na2CO3CH3COOH buffer, pH 5.0 for 2 3 h in the dark with gentle shaking, rinsed again, and air dried overnight, as previously described i n detail [ 11] For the spectrophotometric p PD assay, the reaction mix contained 500 of serum (15 20 ) or 60 of membrane proteins isolated from duodenal enterocytes with 0.1% p PD in 0.1 M Na2CO3CH3COOH buffer, pH 5.0, which was incubated at 37 C. After consideration of the kinetic properties of the enzyme and based on results of e xtensive pilot experiments, a 1 h reaction time, endpoint assay was chosen [ 11] The reaction was stopped by the addition of NaN3 to a final concentration of 10 mM, the sample was mixed, and absorbance was read at 530 nm in a Beckman DU 640 spectrophotometer. Blank (complete reaction buffer devoid of serum, i.e., enzyme source) readings were subtracted from sample readings. For the spectrophotometric Fzn assay, a ll determinations were initial velocity assays at a 1min time point The reaction conditions were as mentioned above except the reaction was stopped by the addition of Fzn to a final concentration of 3 mM. The sample was then mixed, and absorbance was read at 570 nm in a Beckman DU 640 spectrophotometer. Blank readings were subtracted from

PAGE 38

38 sample readings. In both spectrophotometric methods, supernatants were also assayed in the presence of 10 mM NaN3, a well studied FOX inhibitor, to confirm the identity of the enzyme. (These studies were performed by Dr. Ranganathan) Animal Model for Copper T ransport S tudy The breeding pairs were male b / b and female +/ b which was confirmed by genomic PCR. Females used for breeding were maintained on an ironsupplemented diet (360 ppm ) for at least 4 weeks prior to mating. The b / b male breeders were also maintained on an iron supplemented diet. This decreases neonatal mortality of mutant offspring. Diets used for this study were modified AIN 93 based diet s with various lev el s of iron added in the form of ferrous sulfate. The diets were otherwise identical. (See the diet information in Table 23). After the pups were born, they were weaned at 19~21days o f age. At weaning, DNA was isolated from tail clips for genomic PCR t o determine genotype using the DNeasy Blood & Tissue kit ( Qiagen) Once the genotype was determined, pups were divided into different treatment groups, as described below. The studies described here utilized three experimental groups: +/b rats (phenotypic ally normal) weaned and administered either control (198 ppm Fe) or low (~3 ppm ) iron diets (+/ b D) and b / b rats (which are naturally iron deficient) fed the control diet. After weaning dietary treatments ensued for 34 months, and then all rats were anes thetized by CO2 exposure and killed by cervical dislocation. The u pper part of the small intestinal mucosa and liver tissue w ere then collected for mRNA and protein analysis. In addition, Hemoglobin ( Hb ) and Hematocrit (Hct) were measured as described prev iously.

PAGE 39

39 Animal Genotyping Tail tips were obtained from rats at 19 to 21 days of age. If DNA isolation was not done immediately the tail samples were stored in 20 C A tissue kit (Qiagen) was used to extract DNA following the manufacturers in structions. 3 l DNA solution was taken from each 100 l sample for PCR analysis with the following cycling parameters: 94 C for 5 min, and 30 cycles with 94 C for 20 s, 52 C for 10 s and 72 C for 1 min. The primer set used for this PCR reaction was T M4 ( Nramp2 transmembrane domain 4) F: 5 TATCCCAAGGTCCCACGGAT 3 and TM4 R: 5 GAGGGCCATGATAGTGATGA 3 5 l of each PCR reaction was run on 1% agarose gels and imaged (Fig 2 1). Double and single bands observed on gels indicate heterozygous +/ b and homoz ygous b / b animals respectively. Copper and Phenol Red Measurements The quantitative test that I used for copper measurement was bicinchoninic acid [98] S tandard assay reagents included 0.2 M Hepes buffered BCA (6 mg bicinchoninc acid disodium salt, 3.6 g of NaOH and 15.6 g Hepes in 90 ml double distilled H2O ). A 0.5 ml fluid sample from the everted gut sac was placed into a 1 ml microfuge tube and 0.25 ml of 30% (w/v) trichloroacetic acid (TCA) was added. The tube was capped and vortexed to disperse the TCA and centrifuged at 16,000 g for 5 min, and 0.5 ml of the supernatant was transferred to a clean tube. 0.1 ml 0.0352% (w/v) L dihydroascorbic acid was then added to each tube and the sample was mixed. 0.4 ml of 0.2 M Hepes buffered BCA was then added Finally, a 200 l sample was transferred to a 96well plate, and the absorbance was read at 354 nm [98] T o determine the concentration of experimental samples, a standard curve was prepared by a similar procedure The six standard s for copper were 0, 5, 10, 15, 20 and

PAGE 40

40 25 and for phenol red were 0, 0.5%, 1%, 1.5%, 2% and 2.5%. The same point to point relationship for the two set s of standards were plotted to estimate concentratio n s of samples (Fig 2 2) Everted Gut Sac Assay Everted gut sac assay was performed to test the difference in copper transport across intestinal absorptive cells among the three experimental groups. After 34 months of dietary treatment, all rats were anesthetized by CO2 exposure and killed by cervical dislocation. A 10 cm section from the upper small intestine was collected and washed with icecold PBS. The intestinal sac was gently everted over a glass rod to expose the mucosal surface [99] followed by tying one end of the everted gut with a suture and then filling with 1 ml Krebs Ringer buffer (pH 5.5~6.0) [100] F illed e verted sac was sealed with a suture and then incubated in Krebs Ringer buffer with 600 M CuCl2 which was gassed with 95% O2 at room temperature (24 C) to keep the tissue viable for up to 40 min [101] After each experiment, the gut sacs were washed in PBS to remove excess Cu2 +, and opened to collect the solution inside the gut, followed by measuring Cu concent ration using the colorimetric detection ( described previously ). The perme ability of the intestine w as monitored by adding 0.002% phenol red outside the gut sac, and measuring the absorbance at 562 nm from the solution both inside and outside of the everted gut sac [102] HEK293 Cel l Model Initially, we obtained stably transfected Dmt1 over expressing cell lines that contain the empty pDEST31 vector or the same vector containing the rat IA/+IRE (Iron responsive element) Dmt1 cDNA from Dr. M. Garrick (University at Buffalo). These par ental tetres cell lines contained a DNA construct that encoded a modified tet -

PAGE 41

41 repressor that allowed a tet on response (Fig. 2 3) and were maintained by hygromycin selection. The tetres (tetracycline responsive) cells were maintained at 37 C with 5 % CO2 in Dulbeccos modified Eagles medium with nonessential amino acids and 10% (v/v) FBS containing 200 ml hygromycin, 100 ml streptomycin and 100 units/ml of penicillin. Once the cell lines were exposed to 50 nM doxycycline (DOX) for 24 h, the ind uct ion of Dmt1 expression occured marker, the stably transfected cell lines that contained the pDEST31 vector were maintained. Incubation with 100 M desferr ioxamine (DFO) for 24 h was applied to mimic the lowiron co ndition for this DOX inducible system [24] Total Cell Lysate Isolation After incubation of the cells for 24 hours, cell were gently wash ed with PBS to remove the residual media, followed by adding 500 l of 1X lysi s buffer (Cell Signaling) into each well and incubating on ice for 5 min. Next, cells were scraped off the plate and transferred to a 1.5 ml tube. After 20 s of sonication, the samples were centrifuged at 14,000 g for 10 min at 4 C. The resulting supernat ant was used for subsequent protein work Iron and Copper Uptake Study Iron and c opper uptake studies were performed using Dmt1 stably transfected HEK 293 cell s. Radiolabelled 64Cu was added in the presence of 100 M DFO with or without DOX Uptake of 64Cu was subsequently measured In addition, uptake of 59Fe was used as a positive control to validate the cell model Cells were grown to ~ 60 % confluence in 6 well poly lysine coated plates, and then incubated for 24 h with and without DOX or DFO as follow : DOX/ DFO DOX/+ DFO + DOX / DFO and +DO X / + DFO Cells were gently washed twice in pr e warmed, serum free DMEM

PAGE 42

42 medium and then incubated in BSA containing DMEM medium f or 1 h at 37 C to deplete transferrin. 59Fe2+ and 64Cu1+ was generated from 59FeCl3 and 64CuCl2 respectively, by adding 2 M unlabeled FeCl3 and CuCl2 and 2 mM ascorbic acid to uptake buffer (10 mM Hepes 10 mM Mes (pH 5.5~6.0) 150 mM NaCl and 1 mM CaCl2) t o initiate uptake. After 30 min incubation at 37 C uptake was terminated by removing the uptake buffer and gently replacing it with the prewarmed serum free DMEM medium w ith 2 mM DFO for iron uptake or 2 mM BCS ( Bathocuproine disulphonate) for copper uptake, followed by adding 600 l cell lysis buffer (0.2 N NaOH and 0.2 % SDS) into each well to disrupt the cells. 500 l of solubilized cells were transferred into a gamma counting tube and counted in a PerkinElmer 2480 Automatic Gamma Counter [24] The remaining cell lysates were used to determine the protein concentration.

PAGE 43

43 Table 2 1 Genotype, sex and age of all rats used in this study Genotype Sex Age. Mo Number Procedure +/ b M 22 1 A +/ b M 19 1 A +/ b M 12 2 A,B,C,D +/ b M 9 3 A +/ b M 6 1 A,B,C,D +/ b M 3.5 4 A,B,C,D,G +/ b M 3 3 A,B,C,E,F,G b / b M 9 5 A b / b M 6 2 A,B,C,D b / b M 3.5 2 A,B,C,D,G b / b M 3 1 A,B,C,E,F,G +/ b F 4 3 A,B,C,D +/ b F 3.5 2 A,B,C,D +/ b F 3 3 A,B,C,E,F,G b / b F 4 3 A,B,C,D b / b F 3.5 1 A,B,C,D b / b F 3 3 A, B,C,E,F,G A, hemoglobin and hematocrit, liver q RT PCR; B, enterocyte q RT PCR; C, immunoblots; D, paraPhenylenediamine assay; E, ferrozine assay; F, mineral analysis; G, immunohistochemistry analysis. Table 22 q RT PCR primer sequences Gene Symbol Direction Sequence (5' to 3') 18S FOR TCCAAGGAAGGCAGCAGGC 18S REV TACCTGGTTGATCCTGCCA Atp7a FOR TGAACAGTCATCACCTTCATCGTC Atp7a REV GCGATCAAGCCACACAGTTCA Atp7b FOR TTAGCATCCTGGGCATGACTTG Atp7b REV TTGGTGTGTGAGGAGTCCTCTAGTGT Ctr1 FOR CTACTTTGGCTTTAAGAATGTGGACC Ctr1 REV AACATTGCTAGTAAAAACACTGCCAC Cp FOR ACTTATGCAGATCCTGTGTGCCTATC Cp REV TGCATCTTGTTGGACTCCTGAAAG Hamp FOR GCAAGATGGCACTAAGCACTC Hamp REV GCAACAGAGACCACAGGAGGAAT

PAGE 44

44 Table 2 2. continued Gene Symbol Direction Sequence (5' to 3') Heph FOR ACACTCTACAGCTTCAGGGCATGA Heph REV CTGTCAGGGCAATAATCCCATTCT Mt1a FOR CTTCTTGTCGCTTACACCGTTG Mt1a REV CAGCAGCACTGTTCGTCACTTC Tfr1 FOR ATTGCGGACTGAGGAGGTGC Tfr1 REV CCATCATTCTCAGTTGTACAAGGGAG FOR, forward; REV, reverse; A tp7a, Menkes copper transporting ATPase; Atp7b, Wilsons copper transporting ATPase; Cp ceruloplasmin; Ctr1, copper transporter 1; Hamp, hepcidin; Heph, hephaestin; Mt1a, metallothionein 1A; Tfr1 transferrin receptor 1 Table 23 Ingredients of experimental diets Control Low Iron High Iron 198ppm Fe <3ppm iron 360ppm Fe Ingredient grams/kg grams/kg grams/kg Casein 200 200 200 Sucrose 91.208 91.208 91.208 Soybean Oil 70 70 70 t Butylhydroquinone 0.014 0.014 0.0 14 Cornstarch 397.49 398.47 398.29 Dyetrose 132 132 132 Cellulose (Micro.) 50 50 50 Mineral Mix 35 35 35 Vit am in Mix 10 10 10 Choline Bitartrate 2.5 2.5 2.5 L Cystine 3 3 3 Ferrous Sulfate 0.99 0 1.79 Cu Premix (1mg/g) 7 7 7 Mineral Mix : No. 215518 (without iron and copper) Vit am in Mix : No. 310025

PAGE 45

45 Figure 21. Genotyping of Belgrade rats by PCR Representative PCR genotyping results for +/ b and b / b rats are shown. Double band is +/ b and single band is b / b Figure 22 Standard c urve. Absorbance of serial copper (A) and phenol red (B) concentrations were recorded, respectively. Serial dilutions were performed to ensure an absorbance value for each sample was found within 0 and 0.8. Each dilution was per formed twice.

PAGE 46

46 Figure 23 DOX inducible system. (A) In the absence of the doxycycline (DOX), tetres binds to the tetracyclineresponsive promoter element (TRE), resulting in an inactive Dmt1 expression. (B) In the presence of DOX, tetres are unbound and transgene expression is on.

PAGE 47

47 CHAPTER 3 ALTERATIONS IN THE EXPRESSION/ACTIVITY OF COPPER RELATED PROTEINS Introduction Studies tested the hypothesis that functional Dmt1 is necessary for alterations in the expression/activity o f copper related proteins (Atp7a, Mt, Cp Heph etc.). These studies were performed in the Belgrade rat model, which has an iron deficient phenotype caused by the lack of fully functional Dmt1. As mentioned in the literature review, iron and copper have an inverse relationship: low iron is associated with high copper, and vice versa. Likewise, previous studies done with Sprague Dawley rat s [35] by our lab reflected the same relationship. Increases in serum and liver copper level were noted when rats were deprived of dietary iron for 35 days after weaning (Fig 3 1). Additionally intestinal mRNA level s of Atp7a, Dmt1, Heph Mt1a, and Tfr 1 along with liver Tfr 1 and Mt1a mRNA showed an increase in iron d eficient SD rats (Fig 3 2). Expression of A tp7a and Dmt1 protein in duodenum of iron deficient rats was also significantly higher compared with rats fed a control diet. [23,97] Lastly, studies showed that protein exp ression and activity of intestinal Heph and hepatic Cp went up when rats were fed an irondeficient diet [9,33,103,104] In summary, these studies indicated that a copper related compensatory response was activated in rodents that suffered from irondeficiency anemia. T o further investigate iron and copper interactions, the following experiments took advantage of the Belgrade rat as a model of genetic iron deficiency to determine whether the copper related compensa tory response during iron deficiency still occurred in the absence of fully functional Dmt1.

PAGE 48

48 Results Hematological Status as a Function of Diet Hb (Fig 3 3, A) and Hct (Fig 33, B) values were utilized as markers of hematological status. Because the Belgrade rats used for this study were mixed sex and age, appropriate statistical analysis was performed to avoid bias and to justify combining the data from all rats of each genotype for each parameter studied. Because there was no a priori reason to expect interaction between sex and genotype, the rats were divided into four independent groups (M +/ b M b / b F +/ b and F b / b ; M= male F=female ) and data were analyzed by oneway ANOVA followed by Tukey analysis to test the difference between each group. As e xpected, Hb and Hct levels in the b / b rats were significantly lower than in the +/ b rats (Fig 3 3, A and B). No differences were noted between males and females. Thus, the b / b rats showed a significant irondeficient phenotype, whereas +/ b rats had normal hematological parameters. Next, to test whether age could affect hematological status, correlation analysis was utilized to compare age and Hb /Hct levels (Fig 3 3 C and D). As shown, there was no correlation, demonstrating that neither age nor sex had any effect on hematological parameters. On the basis of these statistical approaches showing no effect of sex or age on hematological status, it was reasonable to group data from all animals of each individual genotype. Serum Copper Levels and Hepatic Iron a nd Copper Levels Genetic iron deficiency attributable to Dmt1 mutation slightly reduced serum copper in b / b rats (Fig 3 4, A), whereas hepatic copper was t he same in both genotypes (Fig 3 4, B). These results showed a different pattern from what has been documented in multiple mammalian species including rats, namely that serum and hepatic copper

PAGE 49

49 levels increase during moderate to severe iron deficiency (23, 28, 43, 53). Moreover, liver iron was reduced by ~70% in the b / b rats compared with the +/ b rats. Ex pression of Cu and Fe HomeostasisRelated Genes q RT PCR analysis of intestinal and hepatic genes related to iron and copper homeostasis was performed in all rats to determine whether the lack of fully functional Dmt1 altered gene expression. Expression of genes quantified in intestine encoded potential copper importers (Dmt1; Ctr1), an intracellular copper binding protein (Mt1a), and a copper exporter (Atp7a). Expression of genes encoding proteins related to iron transport were also quantified, including Dm t1 and Tfr1 as well as a basolateral iron oxidase ( Heph) and the hepatic iron regulatory hormone Hamp. In liver, expression of the copper importer Ctr1 and the copper exporter, Atp7b, were also quantified In enterocytes from the proximal small bowel, Dmt 1 (~11.5fold), Tfr 1 (~3 fold) and Atp7a (~2 fold) were all induced in b / b s compared with +/ b s (Fig 3 5, A). There was no significant change, however, in the expression of Heph Ctr1, and Mt1a mRNAs. In the liver, Hamp was significantly decreased (~40 fol d), whereas Tfr1 was induced (~3 fold) in b / b s compared with +/ b s (Fig 3 5, B). Mt1a and Cp mRNA levels in liver were not different between genotypes. Other hepatic Cu homeostasis related genes, Atp7b and Ctr1 showed a slight reduction in the b / b s. Wester n Blot Analysis of Cu and Fe Homeostasis R elated Proteins Immunoblot analyses of membrane proteins isolated from enterocytes showed increased expression of Atp7a and Dmt1 ( ~2 fold) in b / b rats (Fig 3 6 A and B). Heph protein expression in enterocyte membr ane preps was slightly increased (~2.0 fold) in the b / b rats (Fig 3 6, C) compared with +/ b s. Finally, there was no difference in serum Cp protein levels between genotypes (Fig 36, D).

PAGE 50

50 Immunohistochemical Analysi s of Atp7a and Dmt1 Protein Expression Beca use the subcellular location is also crucial for protein function, immunolocalization studies were performed in fixed intestinal tissue samples from proximal small intestine, utilizing antiAtp7a and Dmt1 antibodies. Control (Ctrl) and iron deficient (FeD ) SD rat samples were used for comparison. Confocal microscopic imaging revealed robust Atp7a protein expression along the basolateral membrane of enterocytes in FeD and b / b rats with little expression observed in Ctrl or +/ b rats (Fig 3 7, A). Dmt1 expres sion was very low in Ctrl and +/ b rats and was much higher in the FeD rats and b / b s. Robust Dmt1 expression was noted along the apical surface of villus enterocytes in irondeficient rats, whereas the protein was detected intracellularly and on the apical surface in the b / b rats (Fig 3 7, B ) Cp and Heph Activity Assays Serum and enterocyte FOX and amine oxidase activity assays were performed to determine whether enzyme function was altered by genetic iron deficiency. No differences in activity between genotypes were noted in serum representing Cp activity (spectrophotometric assays: p PD +/ b n=6, b / b n=4; Fz n +/ b n=13, b / b n=9) (Fig 3 8, C and D) or enterocyte membrane representing Heph activity (spectrophotometric assays: p PD +/ b n= 6, b / b n=4; Fz n +/ b n=9, b / b n=5) (Fig 3 8, A and B) Furthermore, rat serum FOX/amine oxidase activity was almost completely abolished in the presence of 10 mM NaN3, consistent with a recent publication [ 11] whereas inhibition of enterocyte membrane Heph activity by NaN3 was consistently ~75%. Discussion Alterat ions in copper homeostasis during diet induced iron deficiency reflect some aspect of the compensatory response to maximiz e iron absorption from the diet

PAGE 51

51 and release from body stores to support normal erythropoiesis. The possibility that iron deficiency enhances intestinal copper absorption, which contributes to hepatic copper loading, has in fact been previously proposed [105] The present studies were designed to examine the role of Dmt1 in copper homeostasis during iron deficiency by taking advantage of a naturally occurring Dmt1 mutation in the Belgrade rat. Part of the approach was to compare with an extensive body of data obtained in a wildtype rat [35] dietary irondeficiency model The Belgrade rats used in this study were iron deficient as exemplified by significant reductions in blood Hb and Hct. Un expectedly, copper levels were not increased in the liver or serum of the b / b rats, findings that are inconsistent with a host of studies done in many mammalian species with normal functional DMT1 (e.g., humans dogs, rats) documenting increased body copper levels during moderate to severe iron deficiency [5,11,104,106110] Gene expression studies revealed many similar alterations in mRNA expression between the b / b rats and irondeficient SD rats, including induction of Dmt1, Atp7a, and Tfr1 in the duodenum and strong downregulation of Hamp in liver. Conversely a lack of induction of Mt1a in the duodenum and liver was noted that varies from studies in SD rats in which there was a strong upregulation of Mt1a mRNA ex pression in both tissues. Additionally, Atp7and Dmt1 protein expression als o increased significantly in Belgrades as determined by immunoblot and immunohistochemical analyses, but Dmt1 protein was abnormally distributed in the b / b rats. This latter findin g is consistent with a previous publication that showed mislocalization of the mutant Dmt1 protein in the mk mouse (harboring the same point mutation as in the Belgrade rat) [4] Given the role of the multi copper F OXs Cp and

PAGE 52

52 Heph in body iron homeostasis and based on the fact that they are copper dependent enzymes, it was important to consider the expression/activity of these proteins in the present investigation. Consistent with the previous observation [1,2] in the present studies, a moderate increase in enterocyte membrane Heph protein expression was detected on Western blots; however, no change in membrane FOX or amine oxidase activity was noted. As s imilar situation was noted for Cp in which no change in protein expression or serum FOX or amine oxidase activity was observed in Belgrades compared with the phenotypically normal +/ b rats. The most likely explanation for this observation relates to the lack of hepatic coppe r loading in the Belgrades Based on the observations reported by articles cited in the introduction and results from our lab, a side by side comparison of genetic and nutritional iron deficiency is provided (T able 3 3 ) to provide a general overview Overa ll, lack of Mt1a induction in the intestine and liver, lesser induction of duodenal Atp7a, and a lack of hepatic copper loading demonstrated that alterations in copper homeostasis during iron deficiency are less pronounced in the absence of fully functional Dmt1. In this scenario, one would predict that there would be increases in the copper import machinery, with Dmt1 being a potenti al player in this process.

PAGE 53

53 Table 31 Comparison between nutritional and genetic iron deficiency Nutriti onal Genetic mRNA Protein Activity mRNA Protein Activity Atp7a ND ND Cp NC NC NC Heph NC ? NC Mt ND ND NC ND ND Dmt 1 Tfr 1 ND ND Hamp ND ND ND ND NC: No Change, ND: No Determined

PAGE 54

54 Figure 31. Copper content in SD rat serum and hepati c copper content A: liver copper level. B: serum copper content. Means SD are shown. *Statistically significant differences between genotypes (P< 0.05). n=8 Figure 32 qRT PCR analysis of intestinal and hepatic gene expression in SD rats. A.inte stine and B. liver Means SD are shown *P<0.05, **P< 0.01, ***P<0.001. n=8

PAGE 55

55 Figure 33 Hematological status of experimental animals. Hemoglobin ( Hb ) (A) and hematocrit (Hct) (B) levels are shown graphically. M, male; F, female. a, b Statistically diffe rent from one another (P < 0.05). Means SD are shown. Correlation analysis was performed to compare Hb and Hct to age, as seen in C and D, respectively. r Pearson Correlation coefficient. n=24 for +/ b s; n=18 for b / b s

PAGE 56

56 Figure 34 Copper content in rat serum and hepatic iron and copper content A: serum copper level. B: liver copper content. Serum, n= 3 for +/ b and n=4 for b / b ; liver, n=6 for +/ b and n=4 for b / b C: hepatic iron content (n=6 for +/ b and n=4 for b / b ). Means SD a re shown *Statistically significant differences between genotypes (P< 0.05).

PAGE 57

57 Figure 3 5 q RT PCR analysis of intestinal and hepatic gene expression. q RT PCR was performed with RNA samples extracted from isolated enterocytes (A) and liver (B) of +/ b and b / b rats. Experimental repetitions utilizing different groups of +/ b or b / b animals were as follows: +/ b n =19 and b / b n=13 for intestine; +/ b n=24 and b / b n=18 for liver. Y axis shows fold change in b / b s compared with +/ b s. The dashed line cor responding to 1.0fold change (i.e., no change) on the y axis is shown in both panels; bars below 1.0 indicate decreases, and bars above indicate increases in the b / b compared with the +/ b s. *P<0.05, **P<0.01, ***P<0.001; all indicating significant differe nces between genotypes. Means SD are shown.

PAGE 58

58

PAGE 59

59 Figure 3 6 Western blot analysis of iron/ copper related proteins In each panel, a representative Western blot is shown along with quantitative data from all rats studied. Numbers beside the Western blots indicate the placement of the closest molecular weight marker. Band intensities were normalized vs. total protein on the stained blots (shown below each lane of the Western blots). In A, B and C, membrane proteins extract ed from enterocytes were reacted with antibodies against the respective proteins. A : anti ATP7A antibody ( +/ b n=12 and b / b n=7). B: anti DMT1 antibody ( +/ b n=10 and b / b n= 6). The band just above 55 kDa was quantified (See DISCUSSION for explanation). C: anti HEPH antibody ( +/ b n=15 and b / b n=8). D: serum proteins were reacted with anti Cp antibody ( +/ b n=13 and b / b n=7). *P<0.05, **P<0.01, ***P<0.001; all indicating significant differences between genotypes. Means SD are shown.

PAGE 60

60 Figure 37 Imm unohistochemical analysis of Atp7a and Dmt1 protein expression in rat duodenum. Fixed tissue sections were reacted with th e anti Atp7a or Dmt1 specific antiserum followed by a fluorescent tagged secondary antibody and imaged with a confocal microscope. A : Atp7a protein is depicted by the red color. B: autofluorescence is shown (green) along with the specific signal (red color) depicting the Dmt1 protein. The confocal settings remained constant across all images. Images are typical of several experiments. C trl, control Sprague Dawley rat; FeD, irondeficient SD rat

PAGE 61

61 Figure 38 Spectrophotometric Cp activity assays. Panels A and C depict amine oxidase assays with p PD as the substrate, and panels B and D show ferroxidase assays with Fz n as the substrate. (A ) and (B): samples are membrane proteins isolated from purified enterocytes. (C) and (D): samples are serum proteins. No statistical differences were noted in any of these assays between +/ b and b / b rats.

PAGE 62

62 CHAPTER 4 INFLUENCE OF DMT1 ON COPPER HOMEO STASIS DURING IRON DEFICIENCY Introduction The lack of a copper related compensatory response during iron defi ci ency in Belgrade rats [95] led to the idea that Dmt1 may influence copper homeostasis. DMT1 is firmly establish ed as an intestinal iron transporter At least four isoforms of DMT1 have been reported: two are derived from alternative promoters leading to transcripts with two 5 exons (exon 1A and exon 2) and two are from alternative splices at the 3 end ( IRE and + IRE) [111] In the r at, 1A mRNA leads to an N terminal extension of 31 amino acids. At the 3 end, alternative splicing generates transcript s with ( +) or without ( ) IRE (iron response element), which c ould affec t mRNA stability. The isoform of DMT1 that is predominantly expressed in the rat intestine starts transcription at exon 1A and contains the 3 IRE (1A/ +IRE ). In addition to iron, DMT1 has been reported to transport other metals, such as, Cd Co, Mn and Ni [24] However, as mentioned previously it remains controversial whether DMT 1 serves as a transporter of c opper. The studies described here include two different experimental models to test the hypothesis that Dmt1 effects the expression and activity of copper related proteins via its ability to transport copper during iron deficiency. First, copper uptake studies were performed in an established in vitro model of Dmt1 (1A/ +IRE form) overexpression in human embryonic kidney 293 (HEK 293) cells. Second, the everted gut sac assay was utilized as an ex vivo mod el to study intestinal copper transport during iron deficiency anemia in the Belgrade rat.

PAGE 63

63 Belgrade Rat Model Hematological Status as a Function of Diet Hb a nd Hct values were followed as markers of hematological status. Data were analyzed by oneway ANOVA followed by Tukey analysis to evaluate the difference between groups As expected, Hb and Hct levels in the b / b and +/ b rats fed the low iron diet were sig nificantly lower than in the +/ b rats consuming the control diet (Fig 41) Thus, the b / b rats and +/ b rats on the low iron diet suffered from iron deficiency anemia, whereas +/ b rats had normal hematological parameters. Dmt 1 mRNA Expression To confirm the induction of Dmt1 mRNA expression, real time PCR was utilized and data were analyzed by oneway ANOVA followed by Tukey analysis to examine the differences between treatment s. Both b / b rats and +/ b rats on the irondefic ient diet sho wed induction of Dmt1 mRNA compared to +/ b rats consuming the control diet Contrary to expectations, i nduction of Dmt1 mRNA in b / b rats was even higher (2 fold) than in +/ b rats fed the low iron diet (Fig 4 2) Dmt 1 Protein Expression To furt her examine the induction of Dmt1 expression at the protein level, western blot analysis was utilized, and band density was normalized to total protein on stained blots. R elative band density data were analyzed by oneway ANOVA followed by Tukey analysis. Dmt1 protein expression in b / b rats and +/ b rats consuming the low iron diet was significantly higher than in +/ b rats consuming the control diet. However, there was no difference between b / b s and +/ b s on the low iron diet (Fig 4 3)

PAGE 64

64 Copper Transport Study Last, copper transport studies were performed using the everted gut sac assay. Copper transport differences between the three groups were analyzed by oneway ANOVA followed by Tukey analysis. Only +/ b rats consuming the l ow iron diet showed significantly incr easing copper transport in relation to b / b s and +/ b s on the control diet. Even though both Dmt1 mRNA and protein levels were significantly induced in b/b rats there was no difference in copper transport when compared to b / b s and +/ b s fed the control diet (Fig 44) These results indicated that no induction of copper transport occurred when Dmt1 function was abolished, even in the setting of irondeficiency anemia when copper transport was enhanced in +/ b rats. HEK293 Cell Model Real time PCR Analysis To confirm Dmt1 over expression, real time PCR was employed, and data were analyzed by oneway ANOVA followed by a Tukey analysis to assess the difference between each group. Results showed that Dmt1 mRNA expression was si gnificantly higher in cells tre ated with DOX and even higher when DFO was also added (Fig 4 5 A). As expected, TFR 1 mRNA expression increased dramatically when cells were treated with the iron chelator (DFO) in the absence or presence of DOX (Fig 4 5 B) demonstrating that cells were indeed iron deficient. Western Blot Analysis To further confirm the Dmt1 inducible over expression system at the protein level, western blot analysis was employed to quantify Dmt1 protein levels after different treatments Us ing a standard procedure, HEK 293 cell lysates were prepared by extraction with cell lysis buffer. Immunoblot analyses exhibi ted that after adding the

PAGE 65

65 DOX inducer, Dmt1 protein expression w as significantly higher than in u ntreated cells. Furthermore, DOX plus DFO treatment enhanced protein expression even more dramatically while DFO only as a control treatment did not effect protein expression. ( Fig 4 6 ) Iron and Copper Uptake Study Finally, an iron uptake study indicated that adding the DOX inducer au gmented iron uptake. However, this increase was greater in cells treated with DOX plus DFO. DFO alone had no effect on iron uptake (Fig 4 7 A ). These data confirmed that the over expression system worked properly at the functional level. Furthermore, t he copper uptake data showed that copper uptake increased significantly when cells were treated with DOX plus DFO (Fig 4 7 B). All the se data were analyzed by oneway ANOVA followed by Tukey analysis to test the difference between each group. Discussion Prev ious studies reported that Belgrade rat s did not show increases in body copper levels despite significant iron deficiency, leading to speculation that increases in serum and hepatic copper levels are related to Dmt1 mediated copper import during iron defic iency The present studies were designed to test this hypothesis by using complementary ex vivo and in vitro models. Initially, the everted gut sac assay was utilized in tissues extracted from +/ b and b / b rats. Weaned r ats were divided into three treatme nt groups +/ b s on the control diet, b / b s on the control diet as a genetic irondeficient group and +/ b s consuming the lowiron diet as a diet induced irondeficient group. b / b rats and +/ b rats on the iron deficient diets suffered from severe iron deficie ncy as exemplified by significant reductions in blood Hb and Hct. Real time PCR and immunoblot studies revealed strong induction of

PAGE 66

66 Dmt1 expression in the genetic and diet induced, iron deficient groups. However, copper transport increased only in the die t induced irondeficient +/ b s, indicating that functional Dmt1 is necessary for increasing copper import during low iron conditions. To further explore the observation made in the Belgrade rat model, t he doxycycline inducible Dmt1 over expressing HEK 293 c ell line was used in this study designed by Drs. Michael and Laura Garrick (University at Buffalo) to express the 1A/ +IRE form of DMT1 I first validated the model in my hands and confirmed that it was working properly. This validation included three independent studies. Firstly, Dmt 1 mRNA expression was shown to be induced when cells were treated with DOX and DOX plus DFO. Surprisingly, Dmt 1 mRNA expression was dramatically increased when cells were treated with DOX plus DFO. This observation supports th e contention that Dmt1 has a functional 3 IRE which stabilized the transcript when intracellular iron is low. This possibility has been supported by previous studies [112 114] Secondly, Dmt1 protein expression i ncreased after DOX an d DOX plus DFO treatment Thirdly, since DMT1 is an established iro n transporter, iron uptake studies were performed as a final validation of the in vitro model. After independent validation of the HEK 293 cell models, studies were per formed to assess possible copper transport by Dmt1. Results demonstrated that copper transport was similar in uninduced cells and in those treated with DOX. DFO treatment of uninduced cells also had no effect on copper uptake. Surprisingly however, copper transport increased ~ 3fold in cells treated with DOX and DFO. This finding supports our hypothesis that Dmt1 may influence copper uptake when it is strongly induced by iron deprivation and in the absence of competing iron ions. Furthermore, this

PAGE 67

67 observat ion was consistent with previous studies showing that Dmt1 can transport copper [23] Based on the short half life (12 h) and handling safety issues of 64Cu, and the difficulty in obtaining it, we developed a colori metric assay using 2, 2 bicinchoninic acid (BCA) f or the everted gut sac studies. BCA offers the advantage of being highly sensitive and specific for Cu1+. T he reaction rapidly forms an intense purplecolored complex when Cu1+ interacts with BCA. S tandar d curves of Cu1+ concentrations established with various copper concentrations showed a linear correlation. All experimental values fell within the values of the standard curve. T o control for everted gut sac permeability, phenol red was utilized as an ind icator. Results showed that the everted sacs had intact tight junctions as phenol red transport was essentially zero. Although recent studies of Dmt1 transport in Xenopus oocytes did not show transport of copper [92] this result may not nec essarily be applicable to mammalian systems. Data presented here provide further evidence that Dmt1 can mediate copper uptake in the setting of low iron. Although the apparent magnitude of copper transport was lower in the HEK 293 over expression model, the significance of this observation is unclear. As less copper is required and absorbed from the diet as compared to iron, it is possible that Dmt1 could still mediate physiologically relevant copper transport, even if the affinity of copper for Dmt1 was much less than for iron. This could also explain why Dmt1 might only transport copper when luminal iron concentrations are low or when it is strongly induced during iron deficiency. The observations from the HEK 293 cell model are corroborated by studies per formed in the Belgrade rat model. Copper absorption across the intestinal wall in

PAGE 68

68 everted gut sacs was significantly higher in iron deficient +/ b rats, while transport in b / b rats with even more significant iron deficiency was indistinguishable from +/ b ra ts on a control diet. As the only difference between +/ b and b / b rats is one versus two copies of the mutant Dmt1 gene, this finding provides strong evidence of copper transport by Dmt1. This may also explain the paradoxical finding that b / b rats do not show increased body copper levels during iron deficiency, while iron deficient +/ b rats had higher intestinal and hepatic copper levels (which also occurred in WT iron deprived SD rats [11] .) In sum dat a presented herein utilized two independent experimental approaches to show that Dmt1 is necessary for the well described, copper dependent compensatory response to iron deficiency

PAGE 69

69 Figure 41. Hematological status of experimental rats. Hemoglobin (A) and hematocrit (B) levels are shown graphically. a,b,c Statistically different from each other (P< 0.05). n=9 for +/ b s b / b s and +/ b Ds (+/b fed irondeficient diet) Figure 42. q RT PCR analysis of intestinal Dmt1 expression. q RT PCR was performed with RNA samples extracted from intestinal mucosal scrapings. a,b,c Statistically different from each other (P< 0.05). n=4 for +/ b s, b / b s and +/ b Ds

PAGE 70

70 Figure 43. Western blot analysis of intestinal Dmt1 protein expression. Protein samples extracted from intestinal mucosal scrapings were reacted with commercial antibody against Dmt1. A representative blot (A) is shown along with quantitative data (B) from all experimental rats. Band intensities were normalized vs. total protein on the stained blots ( show below each lane of the Western blots). a,b Statistically different from each other (P< 0.05). n=4 for +/ b s, b / b s and +/ b Ds Figure 44. Copper transport study. The bar graph shows the amount of transported copper from mucosal to serosal side in ev erted gut sac of three groups. a,b Statistically different from each other (P< 0.05). n=5 for +/ b s, b / b s and +/ b Ds

PAGE 71

71 Figure 45 Real time PCR analysis. Relative mRNA levels of Rat Dmt1 (rDmt1) (A) and Human TFR 1 ( hTFR 1 ) (B) are shown graphically. DOX/ DFO : without DOX and DF O; DOX/+ DFO without DOX, but with 100 M DFO; +DOX / DFO : with DOX, but without DFO; with DOX and 100 M DFO. a, b Statistically different from one another (p<0.05). Means SD are shown n=4 Figure 46 Western blot analysis of Dmt1 protein expression. A A representative Western blot is shown Numbers beside the Western blots indicate the placement of the closest molecular weight marker. B. Band intensities were normalized vs. total protein on the stained blots (shown below each lane of the Western blots). a, b,c Statistically different from one another (p<0.05). Means SD are shown. n=4

PAGE 72

72 Figure 47 Iron (A) and c opper (B) uptake analysis. a, b,c Statistically different from one another (P<0.05). Means SD are shown. n=4

PAGE 73

73 CHAPTER 5 CONCLUS IONS AND FUTURE DIRECTIONS Conclusions Iron and copper serve as essential micronutrient s which participate in many biochemical reactions in living organisms. I nteractions between these metal ions drive a multitude of cellular processes due to altera t i o ns in wholebody homeostasis, especially during certain disease states. As is known iron and copper share common chemi cal properties including their participation in redox reactions as well as their toxicity primarily via production of reactive oxygen species [115] Furthermore, during iron deficiency, body copper levels increase in many mammalian species suggesti ng that copper influences iron homeostasis These interactions were first noted over a century ago, and two multi copper ferroxidases provide direct link s between iron and copper homeostasis namely, ceruloplasmin and hephaestin [91] However, this is likely not the end of this story as more participants in this interaction are a waiting to be discovered. The initial results presented in Chapter 3 describe alterations in the expression and activity of copper related proteins in Belgrade rats. Surprisingly, lack of the copper dependent compensatory response was noted in these genetic ally iron deficient rats. We have previously shown that both liver and serum copper went up in SD rat s fed low i ron diets compared to contr ol groups (Fig 3 1 ) Additionally Mt1a mRNA expression in the duodenum and liver was strongly upregulated in iron deficient SD rats (Fig 3 2 ) However, of note was th at in Belgrades no increase of Mt1a mRNA expressi on occurred, likely reflecting the lack of copper accumulation in the Dmt mutant animals. Mt1a is in fact strongly induced by copper and is thought to be involved in intestinal [116] and liver [3] copper homeostasis. Furthermore, i mmunoblot and

PAGE 74

74 immunohistochemical analyses exemplified the physiological relevance of increases in transcript expression in that the Atp7a and Dmt1 proteins also increased signifi cantly in the Belgrades but the Dmt1 protein was mislocalized in b / b rats. Lastly as described in Chapter 3, in Belgrades a moderate increase in enterocyte membrane Heph protein was noted, but serum Cp protein expression was unchanged on Western blots Also, no change in membrane ( Heph) or serum ( Cp ) FOX or amine oxidase activity was found Allin all, the lack of fully functional Dmt1 may thus partially blunt th e compensatory response to iron deficiency by decreasing copper levels in enterocytes, which is exemplified by a lack of Mt1a induction, abolishing the frequently described increase in liver and serum copper, and attenuating the documented increase in Cp e xpression and activity [11] To further explore the role of Dmt1 in iron and copper interactions, the everted gut sac technique was utilized in the Belgrade rat model. The induction of copper transport could be det ected only under diet induced irondeficient conditions in +/ b s, but not in genetically irondeficient b / b s with the absence of fully functional Dmt1.To further support of the ex vi vo study, the HEK 293 Dmt1 inducible system was utilized to test the possib le role of Dmt1 in copper uptake. Experiments presented in Chapter 4, utilizing over expressed Dmt1 in the HEK 293 cell line treated with an iron chelator, identified Dmt1 as a potential player in copper uptake during iron deprivation. Moreover, this inve stigation provides novel data supporting the concept that the 3 IRE in the Dmt1 transcript is functional, as Dmt1 induction by DOX was significantly enhanced by iron chelation. This provides additional evidence that Dmt1 may play a role in copper transpor t d uring low iron conditions.

PAGE 75

75 Collectively, these results dem onstrate a new linkage between iron and copper homeostasis, Dmt1. In sum during iron deprivation, copper import is increased through Dmt1, perhaps contributing to documented alterations in whol e body copper metabolism. Future Directions Even though exploration of the metabolic links between iron and c opper has been ongoing since the 1800s many questions still remain unanswered. The present investigation further delved into interactions between iron and copper resulting in novel findings. Collectively however, the findings presented here in also raise some interesting questions of potential physiologic impart. First, as mentioned previously Dmt1 has been proposed to have four different transcr ipt variants, having different 5 and 3 ends. Since the majority of Dmt1 expressed in the duodenum is the (+) IRE form which is described in Chapter 3, the 1A / +IRE Dmt1 variant was over expressed in the HEK 293 cell system to test iron and copper uptake. T o provide additional evidence that the DFO induced significant Dmt1 over expression is due to regulation by the IRE/IRP response system, studies using a Dmt1 variant without the IRE should be tested. Accordingly, we have obtained HEK 293 cells over expressing the 2 /( ) form of Dm t1 and ongoing studies will assess the possible role of the IRE in the Dmt1 transcript. Pilot experiments show that iron chelation has no influence on expression of the 2/( ) isoform of Dmt1. Secondly, even though everted gut sac assay is a classical method to test drug or nutrient transport in the intestine, this assay should be complemented by additional in vivo models of transport Both in situ loop assay s, and gavage studies are standard methods to measure nutrient absorpti on and transport in the intestine; however, these

PAGE 76

76 assays are not easy to undertake using radio labeled copper with only a 12 h half life. On the other hand, the co pper colorimetric assay is less sensitive 65Cu, as a desirable stable tracer, could be introduced into these st udies by taking advantage of modern analytical techniques, such as ICP MS (Inductively coupled plasma mass spectrometry) or GC MS (Gas chromatography mass spectroscopy). Lastly, except for the remaining questions of Dmt1 described abov e, the identification of more molecular components needs to be undertaken at the cellular and biochemical level s, to allow for a deeper understanding of the intersection of copper and iron metabolism. For instance, does copper export from enteroc ytes incre ase during iron deficiency ? If so, is it through Atp7a or other transporters? Are there any undiscovered linkages between iron and copper? What is the molecular mechanism of any potential new interactions? These questions will continue to drive our resear ch in the copper/iron area in the future.

PAGE 77

77 Figure 51. Hypothetical model of copper absorption in intestinal epithelial cells during iron deprivation. Dmt 1 influence s copper transport in intestinal epithelial cells when it i s strongly induced by iron deprivation and in the absence of competing iron.

PAGE 78

78 L IST OF REFERENCES 1. Anderson GJ, Frazer DM, McKie AT, Vulpe CD: The ceruloplasmin homolog hephaestin and the control of intestinal iron absorption. Blood Cells Mol Dis 2002; 29 :367 375. 2. Arredondo M, Munoz P, Mura CV, Nunez MT: DMT1, a physiologically relevant apical Cu1+ transporter of intestinal cells. Am J Physiol Cell Physiol 2003; 284 :C15251530. 3. Bremner I: Involvement of meta llothionein in the hepatic metabolism of copper. J Nutr 1987; 117 :19 29. 4. CanonneHergaux F, Fleming MD, Levy JE, Gauthier S, Ralph T, Picard V, Andrews NC, Gros P: The Nramp2/DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border. Blood 2000; 96 :3964 3970. 5. Cartwright GE, Huguley CM, Jr., et al.: Studies on free erythrocyte protoporphyrin, plasma iron and plasma copper in normal and anemic subjects. Blood 1948; 3 :501 525. 6 Cartwright GE, Lauritsen MA, Humphreys S, Jones PJ, Merrill IM, Wintrobe MM: The Anemia of Infection. Ii. The Experimental Production of Hypoferremia and Anemia in Dogs. J Clin Invest 1946; 25:81 86. 7. Cartwright GE WM : Studies on free erythrocyte protoporphyrin, plasma copper, and plasma iron in normal and in pyridoxinedeficient swine. J Biol Chem 1948:557565. 8. Chen H, Attieh ZK, Dang T, Huang G, van der Hee RM, Vulpe C: Decreased hephaestin expression and activity leads to decreased iron efflux from differentiated Caco2 cells. J Cell Biochem 2009; 107 :803 808. 9. Chen H, Su T, Attieh ZK, Fox TC, McKie AT, Anderson GJ, Vulpe CD: Systemic regulation of Hephaestin and Ireg1 revealed in studies of genetic and nutritional iron deficiency. Blood 2003; 102 :18 93 1899. 10. Collins JF: Gene chip analyses reveal differential genetic responses to iron deficiency in rat duodenum and jejunum. Biol Res 2006; 39 :25 37. 11. Ranganathan PN, Lu Y, Jiang L, Kim C, Collins JF: Serum ceruloplasmin protein expression and activ ity increases in iron deficient rats and is further enhanced by higher dietary copper intake. Blood ; 118 :3146 3153. 12. Petrak J, Vyoral D: Hephaestin --a ferroxidase of cellular iron export. Int J Biochem Cell Biol 2005; 37 :11731178.

PAGE 79

79 13. Chen H, Attieh ZK, Su T, Syed BA, Gao H, Alaeddine RM, Fox TC, Usta J, Naylor CE, Evans RW, McKie AT, Anderson GJ, Vulpe CD: Hephaestin is a ferroxidase that maintains partial activity in sexlinked anemia mice. Blood 2004; 103 :3933 3939. 14. Collins JF, Franck CA, Kowdley KV Ghishan FK: Identification of differentially expressed genes in response to dietary iron deprivation in rat duodenum. Am J Physiol Gastrointest Liver Physiol 2005; 288:G964 971. 15. Collins JF, Hu Z, Ranganathan PN, Feng D, Garrick LM, Garrick MD, Browne RW: Induction of arachidonate 12 lipoxygenase (Alox15) in intestine of irondeficient rats correlates with the production of biologically active lipid mediators. Am J Physiol Gastrointest Liver Physiol 2008; 294 :G948 962. 16. Collins JF, Hua P, Lu Y, Ranganathan PN: Alternative splicing of the Menkes copper Atpase (Atp7a) transcript in the rat intestinal epithelium. Am J Physiol Gastrointest Liver Physiol 2009; 297 :G695707. 17. Dupic F, Fruchon S, Bensaid M, Loreal O, Brissot P, Borot N, Roth MP, Coppin H: D uodenal mRNA expression of iron related genes in response to iron loading and iron deficiency in four strains of mice. Gut 2002; 51:648653. 18. Ece A, Uyanik BS, Iscan A, Ertan P, Yigitoglu MR: Increased serum copper and decreased serum zinc levels in chil dren with iron deficiency anemia. Biol Trace Elem Res 1997; 59:31 39. 19. Edwards JA, Garrick LM, Hoke JE: Defective iron uptake and globin synthesis by erythroid cells in the anemia of the Belgrade laboratory rat. Blood 1978; 51:347357. 20. Fay JCG WM : Stu dies on free erythrocyte protopotphyrin, serum iron, serum iron binding capacity and plasma copper during normal pregnancy. J Clin Invest 1949: 487491. 21. Ferguson CJ, Wareing M, Ward DT, Green R, Smith CP, Riccardi D: Cellular localization of divalent m etal transporter DMT 1 in rat kidney. Am J Physiol Renal Physiol 2001;280:F 803 814. 22. Monnot AD, Zheng G, Zheng W: Mechanism of copper transport at the bloodcerebrospinal fluid barrier: influence of iron deficiency in an in vitro model. Exp Biol Med (Ma ywood) 2012; 237 :327 333. 23. Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA: Cloning and characterization of a mammalian protoncoupled metal ion transporter. Nature 1997; 388:482488. 24. Garrick MD, Dolan KG, Horbinski C, Ghio AJ, Higgins D, Porubcin M, Moore EG, Hainsworth LN, Umbreit JN, Conrad ME, Feng L, Lis A, Roth JA, Singleton S,

PAGE 80

80 Garrick LM: DMT1: a mammalian transporter for multiple metals. Biometals 2003; 16 :41 54. 25. Linder MC, Zerounian NR, Moriya M, Malpe R: Iron and copper homeostasis and intestinal absorption using the Caco2 cell model. Biometals 2003; 16 :145 160. 26. Espinoza A, Le Blanc S, Olivares M, Pizarro F, Ruz M, Arredondo M: Iron, copper, and zinc transport: inhibition of divalent metal transporter 1 (DMT1) and human copper transporter 1 (hCTR1) by shRNA. Biol Trace Elem Res ; 146 :281 286. 27. Tennant J, Stansfield M, Yamaji S, Srai SK, Sharp P: Effects of copper on the expression of metal transporters in human intestinal Caco 2 cell s. FEBS Lett 2002; 527:239 244. 28. Bothwell T, Charlton, RW, Cook, JD & Finch : In Iron Metabolism in Man. Blackwell Scientific Publications 1979: 256 283 29. Parmley RT, Barton JC, Conrad ME, Austin RL, Holland RM: Ultrastructural cytochemistry and radioautography of hemoglobin--iron absorption. Exp Mol Pathol 1981; 34:131 144. 30. Raffin SB, Woo CH, Roost KT, Price DC, Schmid R: Intestinal absorption of hemoglobin ironheme cleavage by mucosal heme oxygenase. J Clin Invest 1974; 54 :13441352. 31. McKie AT, Barrow D, LatundeDada GO, Rolfs A, Sager G, Mudaly E, Mudaly M, Richardson C, Barlow D, Bomford A, Peters TJ, Raja KB, Shirali S, Hediger MA, Farzaneh F, Simpson RJ: An ironregulated ferric reductase associated with the absorption of dietary iron. Science 2001; 291 :17551759. 32. McKie AT, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, Miret S, Bomford A, Peters TJ, Farzaneh F, Hediger MA, Hentze MW, Simpson RJ: A novel duodenal ironregulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 2000; 5 :299309. 33. Frazer DM, Vulpe CD, McKie AT, Wilkins SJ, Trinder D, Cleghorn GJ, Anderson GJ: Cloning and gastrointestinal expression of rat hephaestin: relationship to other iron transport proteins. Am J Physiol Ga strointest Liver Physiol 2001; 281 :G931939. 34. Waheed A, Grubb JH, Zhou XY, Tomatsu S, Fleming RE, Costaldi ME, Britton RS, Bacon BR, Sly WS: Regulation of transferrinmediated iron uptake by HFE, the protein defective in hereditary hemochromatosis. Proc Natl Acad Sci U S A 2002; 99 :3117 3122.

PAGE 81

81 35. Weinstein DA, Wolfsdorf JI: Effect of continuous glucose therapy with uncooked cornstarch on the longterm clinical course of type 1a glycogen storage disease. Eur J Pediatr 2002;161 Suppl 1 :S35 39. 36. Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, Ganz T, Kaplan J: Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science 2004; 306 :20902093. 37. Frazer DM, Anderson GJ: Iron imports. I. Intestinal iron absorption and its regulation. Am J Physiol Gastrointest Liver Physiol 2005; 289 :G631 635. 38. Green R, Charlton R, Seftel H, Bothwell T, Mayet F, Adams B, Finch C, Layrisse M: Body iron excretion in man: a collaborative study. Am J Med 1968; 45 :336 353 39. Singla PN, Tyagi M, Kumar A, Dash D, Shankar R: Fetal growth in maternal anaemia. J Trop Pediatr 1997; 43 :89 92. 40. Rasmussen K: Is There a Causal Relationship between Iron Deficiency or IronDeficiency Anemia and Weight at Birth, Length of Gestation and Perinatal Mortality? J Nutr 2001;131:590S 601S; discussion 601S 603S. 41. Beard JL, Wiesinger JA, Connor JR: Pre and postweaning iron deficiency alters myelination in Sprague Dawley rats. Dev Neurosci 2003; 25:308315. 42. Beard J, Green W, Miller L, Finch C: Effect of iron deficiency anemia on hormone levels and thermoregulation during cold exposure. Am J Physiol 1984; 247 :R114 119. 43. Camaschella C, Poggiali E: Inherited disorders of iron metabolism. Curr Opin Pediatr 2011; 23 :14 20. 44. Fleming MD, T renor CC, 3rd, Su MA, Foernzler D, Beier DR, Dietrich WF, Andrews NC: Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997; 16 :383 386. 45. Donovan A, Brownlie A, Dorschner MO, Zhou Y, Pratt SJ, Paw BH, Philli ps RB, Thisse C, Thisse B, Zon LI: The zebrafish mutant gene chardonnay (cdy) encodes divalent metal transporter 1 (DMT1). Blood 2002; 100 :4655 4659. 46. Anderson GJ, Frazer DM, McKie AT, Vulpe CD, Smith A: Mechanisms of haem and nonhaem iron absorption: l essons from inherited disorders of iron metabolism. Biometals 2005; 18 :339 348. 47. Sladic Simic D, Martinovitch PN, Zivkovic N, Pavic D, Martinovic J, Kahn M, Ranney HM: A thalassemialike disorder in Belgrade laboratory rats. Ann N Y Acad Sci 1969; 165 :93 99.

PAGE 82

82 48. Sladic Simic D, Zivkovic N, Pavic D, Marinkovic D, Martinovic J, Martinovitch PN: Hereditary hypochromic microcytic anemia in the laboratory rat. Genetics 1966; 53 :10791089. 49. Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD, Andrews NC: Nram p2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci U S A 1998; 95:11481153. 50. Farcich EA, Morgan EH: Diminished iron acquisition by cells and tissues of Belgrade laboratory rats. Am J Physiol 1992; 262 :R220 224. 51. Oates PS, Morgan EH: Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am J Physiol 1996; 270 :G826 832. 52. Drakesmith H, Sweetland E, Schimanski L, Edwards J, Cowley D, Ashraf M, Bastin J, Townsend AR: The hemochromatosis protein HFE inhibits iron export from macrophages. Proc Natl Acad Sci U S A 2002; 99 :15602 15607. 53. Pennington JA, Hendricks TC, Douglass JS, Petersen B, Kidwell J: International Interface Standard for Food Databases. Food Addit Contam 1995; 12:809 820. 54. Puig S, Thiele DJ: Molecular mechanisms of copper uptake and distribution. Curr Opin Chem Biol 2002; 6 :171 180. 55. Puig S, Lee J, Lau M, Thiele DJ: Biochemical and genetic analyses of yeast and human high affini ty copper transporters suggest a conserved mechanism for copper uptake. J Biol Chem 2002; 277 :26021 26030. 56. Lee M, del Rosario MC, Harris HH, Blankenship RE, Guss JM, Freeman HC: The crystal structure of auracyanin A at 1.85 A resolution: the structures and functions of auracyanins A and B, two almost identical "blue" copper proteins, in the photosynthetic bacterium Chloroflexus aurantiacus. J Biol Inorg Chem 2009; 14:329 345. 57. Andrews NC: The iron transporter DMT1. Int J Biochem Cell Biol 1999; 31:9919 94. 58. Markossian KA, Kurganov BI: Copper chaperones, intracellular copper trafficking proteins. Function, structure, and mechanism of action. Biochemistry (Mosc) 2003; 68:827837. 59. Li Y, Du J, Zhang P, Ding J: Crystal structure of human copper homeosta sis protein CutC reveals a potential copper binding site. J Struct Biol ; 169 :399 405.

PAGE 83

83 60. Guo Y, Nyasae L, Braiterman LT, Hubbard AL: NH2 terminal signals in ATP7B Cu ATPase mediate its Cu dependent anterograde traffic in polarized hepatic cells. Am J Physi ol Gastrointest Liver Physiol 2005; 289 :G904916. 61. Schaefer M, Hopkins RG, Failla ML, Gitlin JD: Hepatocyte specific localization and copper dependent trafficking of the Wilson's disease protein in the liver. Am J Physiol 1999; 276 :G639 646. 62. Roelofsen H, Wolters H, Van Luyn MJ, Miura N, Kuipers F, Vonk RJ: Copper induced apical trafficking of ATP7B in polarized hepatoma cells provides a mechanism for biliary copper excretion. Gastroenterology 2000; 119 :782 793. 63. Koschinsky ML, Funk WD, van Oost BA, M acGillivray RT: Complete cDNA sequence of human preceruloplasmin. Proc Natl Acad Sci U S A 1986; 83 :50865090. 64. Healy J, Tipton K: Ceruloplasmin and what it might do. J Neural Transm 2007; 114 :777 781. 65. Nittis T, Gitlin JD: Role of copper in the proteosome mediated degradation of the multicopper oxidase hephaestin. J Biol Chem 2004; 279 :25696 25702. 66. Vulpe CD, Kuo YM, Murphy TL, Cowley L, Askwith C, Libina N, Gitschier J, Anderson GJ: Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 1999; 21 :195 199. 67. E. M : De la prsence normale de plusiers mtaux dans le sang de lhomme, et de lanalyse des sels fixes contenus dans ce liquide. Comptes Rend de lAcad des Sci Paris 1848; 26 :41 43. 68. L. M : Di un rimedio per lamenorrea et di altro per la sordita ipostenica. Gazz Med Ital Prov Venete 1862; 5 :36 37. 69. McHargue JS HD, Hill ES. : The relation of copper to the hemoglobin content of rat blood. J Biol Chem 1928; 78 :637 641. 70. Lee GR CG Wintrobe MM. : Heme biosynthesis in copper deficient swine. Proc Soc Exp Biol Med 1968; 127 :977981. 71. Warburg O KH: ber locker gebundenes Kupfer und Eisen im Blutserum Biochem Z 1927; 190 :143 149. 72. Sarata U SA: Studies in the biochemistry of copper V. Effect of rapid loss of blood upon the copper content of blood. Jap J Med Sci II, Biochem 1934; 2 : 341 354

PAGE 84

84 73. A. S : The effect of bleeding ulcers and hemorrhagic anemia upon whole blood copper and iron. Am J Digest Dis Nutr 1938; 4 : 803 804 74. Gorte r E GF, Weyers WA. : De rol van het koper bij de kinderanaemie. Maandschr V Kindergeneesk 1931; 1 : 70 86 75. Pagliardi E GE, Vinti A. : Compartamento del rame plasmatico ed eritrocitario in condizioni morbose. Rass Fisiopatol Clin Terap 1957; 29 : 907 921 76. Fay J CG, Wintrobe MM. : Studies on free erythrocyte protoporphyrin, serum iron, serum ironbinding capacity and plasma copper during normal pregnancy. J Clin Invest 1949; 28 : 487 491 77. Cartwright GE LM, Jones PJ et al. : The anemia of infection. I. Hypofe rremia, hypercupremia, and alterations in porphyrin metabolism in patients. J Clin Invest 1946; 25: 65 80. 78. Venakteshwara Rao M KS, Chande RD et al. : Serum ceruloplasmin in iron deficiency anaemia. J Assoc Physicians India 1975; 23: 571 576 79. Evans JL, Abraham PA: Anemia, iron storage and ceruloplasmin in copper nutrition in the growing rat. J Nutr 1973; 103 :196 201. 80. Owen CA, Jr.: Effects of iron on copper metabolism and copper on iron metabolism in rats. Am J Physiol 1973; 224 :514518. 81. Sourkes TL, Lloyd K, Birnbaum H: Inverse relationship of heptic copper and iron concentrations in rats fed deficient diets. Can J Biochem 1968; 46 :267 271. 82. Lahey ME, Gubler CJ, Chase MS, Cartwright GE, Wintrobe MM: Studies on copper metabolism. II. Hematologic ma nifestations of copper deficiency in swine. Blood 1952; 7 :10531074. 83. Auclair S, Feillet Coudray C, Coudray C, Schneider S, Muckenthaler MU, Mazur A: Mild copper deficiency alters gene expression of proteins involved in iron metabolism. Blood Cells Mol Dis 2006; 36:15 20. 84. Pizarro F, Olivares M, Hertrampf E, Mazariegos DI, Arredondo M, Letelier A, Gidi V: Iron bis glycine chelate competes for the nonheme iron absorption pathway. Am J Clin Nutr 2002; 76:577581. 85. Holmberg CG LC B : Investigations in ser um copper. II. Isolation of the copper containing protein, and a description of some of its properties. Acta Chem Scand 1948; 2 : 550 556.

PAGE 85

85 86. Schade AL CL: Raw hen egg white and the role of iron in growth inhibition of Shigella dysenteriae, Stapylococcus au reus, Escherichia coli and Saccharomyces cerevisiae. Science 1944;100. 87. Schade AL CL: An ironbinding component in human blood plasma. Science 1946; 104 : 340 341 88. G. C : Some properties of coupled ironcaeruloplasmin oxidation systems. Biochem J 1961; 79 : 656 663 89. Falconer DS IJ : The genetics of sexlinked anaemiain the mouse. Genet Res Cambr 1962; 3 : 248 250 90. MS. G : A sexlinked anaemia in the mouse. Genet Res Cambr 1963; 3 : 238 247. 91. Fox PL: The copper iron chronicles: the story of an intima te relationship. Biometals 2003; 16 :9 40. 92. Illing AC, Shawki A, Cunningham CL, Mackenzie B: Substrate profile and metal ion selectivity of human divalent metal ion transporter 1. J Biol Chem 2012; 287 :30485 30496. 93. Pollack S, George JN, Reba RC, Kaufma n RM, Crosby WH: The Absorption of Nonferrous Metals in Iron Deficiency. J Clin Invest 1965; 44:14701473. 94. El Shobaki FA, Rummel W: Binding of copper to mucosal transferrin and inhibition of intestinal iron absorption in rats. Res Exp Med (Berl) 1979; 17 4 :187 195. 95. Jiang L, Ranganathan P, Lu Y, Kim C, Collins JF: Exploration of the copper related compensatory response in the Belgrade rat model of genetic iron deficiency. Am J Physiol Gastrointest Liver Physiol ; 301 :G877 886. 96. Garrick M, Scott D, Walp ole S, Finkelstein E, Whitbred J, Chopra S, Trivikram L, Mayes D, Rhodes D, Cabbagestalk K, Oklu R, Sadiq A, Mascia B, Hoke J, Garrick L: Iron supplementation moderates but does not cure the Belgrade anemia. Biometals 1997; 10 :65 76. 97. Ravia JJ, Stephen R M, Ghishan FK, Collins JF: Menkes Copper ATPase (Atp7a) is a novel metal responsive gene in rat duodenum, and immunoreactive protein is present on brushborder and basolateral membrane domains. J Biol Chem 2005; 280 :3622136227. 98. Brenner AJ, Harris ED: A quantitative test for copper using bicinchoninic acid. Anal Biochem 1995; 226 :80 84.

PAGE 86

86 99. Wiseman THWaG: The use of sacs of everted small intestine for the study of the transference of substances from the mucosal to the serosal surface. J Physiol 1954 January 28; 123 :116125. 100. Alam MA A JF, Al Mohizea AM : Eve rted gut sac model as a tool in pharmaceutical research: limitations and applications. 2012. 101. Handy RD, Musonda MM, Phillips C, Falla SJ: Mechanisms of gastrointestinal copper absorption in the African walking catfish: copper dose effects and a novel aniondependent pathway in the intestine. J Exp Biol 2000; 203:23652377. 102. Cassidy MM, Tidball CS: Cellular mechanism of intestinal permeability alterations produced by chelation depletion. J Cell Biol 1967; 32 :685698. 103. Sakakibara S, Aoyama Y: Dietary iron deficiency upregulates hephaestin mRNA level in small intestine of rats. Life Sci 2002; 70 :3123 3129. 104. Iwanska S, Strusinska D: Copper metabolism in different states of erythropoiesis act ivity. Acta Physiol Pol 1978; 29 :465 474. 105. Sugawara N, Sugawara C: An irondeficient diet stimulates the onset of the hepatitis due to hepatic copper deposition in the LongEvans Cinnamon (LEC) rat. Arch Toxicol 1999; 73 :353 358. 106. Lahey ME, Gubler CJ Cartwright GE, Wintrobe MM: Studies on copper metabolism. VII. Blood copper in pregnancy and various pathologic states. J Clin Invest 1953; 32:329 339. 107. Sherman AR, Tissue NT: Tissue iron, copper and zinc levels in offspring of ironsufficient and iron deficient rats. J Nutr 1981; 111 :266 275. 108. Stangl GI, Kirchgessner M: Effect of different degrees of moderate iron deficiency on the activities of tricarboxylic acid cycle enzymes, and the cytochrome oxidase, and the iron, copper, and zinc concentrati ons in rat tissues. Z Ernahrungswiss 1998; 37:260 268. 109. Venakteshwara Rao M, Khanijo SK, Chande RD, Chouhan SS, Bisarya BN: Serum ceruloplasmin in iron deficiency anaemia. J Assoc Physicians India 1975; 23 :571 576. 110. Yokoi K, Kimura M, Itokawa Y: Effe ct of dietary iron deficiency on mineral levels in tissues of rats. Biol Trace Elem Res 1991; 29 :257 265. 111. Hubert N, Hentze MW: Previously uncharacterized isoforms of divalent metal transporter (DMT)1: implications for regulation and cellular function. Proc Natl Acad Sci U S A 2002; 99 :12345 12350.

PAGE 87

87 112. Rouault T, Klausner R: Regulation of iron metabolism in eukaryotes. Curr Top Cell Regul 1997; 35 :1 19. 113. Haile DJ: Regulation of genes of iron metabolism by the ironresponse proteins. Am J Med Sci 1999; 318 :230 240. 114. Schumann K, Moret R, Kunzle H, Kuhn LC: Iron regulatory protein as an endogenous sensor of iron in rat intestinal mucosa. Possible implications for the regulation of iron absorption. Eur J Biochem 1999; 260 :362 372. 115. Garrick MD NM, Ol ivares M, Harris ED: Parallels and contrasts bet ween iron and copper metabolism Biometals 2003; 16 :1 8. 116. Kelly EJ, Palmiter RD: A murine model of Menkes disease reveals a physiological function of metallothionein. Nat Genet 1996; 13 :219 222.

PAGE 88

88 BIOGRAPHICAL SKETCH Lingli Jiang was born in Wuhan, Hubei province, China. She received a Bachelor of Science degree in 2003 and a Master of Medicine degree in 2005 from Pharmacy School of Tongji Medical University in China. She maj ored in pharmacy and p harmaceutical sciences. She came to the United States in the spring of 2009 to start her PhD study with Dr. James Collins at University of Florida, Fo od Science and Human Nutrition Department.