Transcriptional and Post-Transcriptional Regulation of Menkes Copper Atpase (Atp7a) Gene Expression during Iron Deficiency

MISSING IMAGE

Material Information

Title:
Transcriptional and Post-Transcriptional Regulation of Menkes Copper Atpase (Atp7a) Gene Expression during Iron Deficiency
Physical Description:
1 online resource (115 p.)
Language:
english
Creator:
Xie, Liwei
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Nutritional Sciences
Committee Chair:
Collins, James Forrest
Committee Members:
Knutson, Mitchell D
Cousins, Robert J
Lu, Jian Rong

Subjects

Subjects / Keywords:
atp7a -- copper -- hif -- hypoxia -- sp1
Nutritional Sciences -- Dissertations, Academic -- UF
Genre:
Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Menkes copper ATPase (Atp7a) is a copper exporter inintestinal enterocytes of rodents. It is necessary to export copper from enterocytes and deliver Cu toblood circulation. In a well-characterized intestinal epithelial (IEC-6) cell model, Atp7a maintains intracellular copper homeostasis.In a previous study, Atp7a was shownto be strongly upregulated at themRNA (~5-fold) and protein (~8-fold) levelsin duodenal enterocytes, concomitantwith copper loading and accumulation in intestine and liver. It wasobserved that Atp7a expression levelalso paralleled that of iron transport-relatedgenes, such as divalent metal transporter 1 (Dmt1), duodenal cytochrome B (Dcytb), and ferriportin 1 (Fpn1). Studies from different labs haveproven that HIF2a robustly increasesthe expression of iron transported-related genes and iron absorption in smallintestine during iron deficiency. A microarray study showed that Atp7a together with iron transport-related genes have GC-rich sequences (potential Sp1-like factor binding sites) on the promoters of these genes. The major gaps thisstudy aims to fill are to elucidatethe molecular mechanisms of Atp7a regulationduring iron deficiency. Thesestudies tested the hypothesisthat Atp7a expression is regulated byHIF2a, Sp1, and copper attranscriptional or post-transcriptional levels. Atp7a promoter was cloned into a luciferase reporter vectorand characterized. Mutagenesis analysis showed thatthere are three evolutionarilyconserved, functional HypoxiaResponse Elements (HREs) and four functionalSp1-binding sites in theAtp7a promoter. Chromatin immunoprecipitation(ChIP) analysis proved thatHIF2a and Sp1 directly bind to theAtp7a promoter. Furtherinvestigation looked into the copper-mediated stabilization of the Atp7a protein. The copper-Atp7a interactionincreased Atp7a proteinstability, which was investigated in the IEC-6 cells. These data indicated thatAtp7a mRNA expression regulatedby HIF2a and Sp1, in parallelwith the iron transport-related genes, and that copperstabilized the Atp7a protein by a post-transcriptional mechanism. The majorfinding of this study is that Atp7a is coordinately regulated with irontransport-related gene by HIF2a,and that the Atp7a protein is stabilized by copper loading in the mammalianintestine during iron deprivation.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Liwei Xie.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Collins, James Forrest.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0045150:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 TRANSCRIPTIONAL AND POST TRANSCRIPTION AL REGULATION OF MENKES COPPER ATPASE (ATP7A) GENE EXPRESSION DURING IRON DEFICIENCY By LIWEI XIE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Liwei Xie

PAGE 3

3 To my family who gave love and support over the past 6 years

PAGE 4

4 ACKNOWLEDGMENTS The past three years and half were the most excit ing and memorable time in my life, which was filled with not only the effor t and hard work, but also the most accomplishment Each of these point s derive s back to five and half year s ago when I started my dream at SUNY at Buffalo. First, I would like to give my deepest appreciation to my parents, my grandparents, an d my wife. It was their support in m ost aspects of my life, which allowed me to utilize the avail able resources and limited time to study and conduct research work. Second ly I offer my acknowledgement to my academic advisor, Dr. James F Collins. You offered me space and resource to partici pate in research where I learned basic biological techniques when I was still an undergraduate student with no background knowledge in biology. I learned the most basic things from where I started, and it turned out to be a precious experience when I moved forward to the advanced level s of my studies During my Doctor of Philosophy work you offered a comfortable working space and flexible working time, which allowed me to design and schedule my work based on my schedule. You also gave me a lot freedom to come up idea s design the experiments, develop new techniques, and work independently, all of which led to my accomplishment s and success and will be helpful for future work in my life. Third ly I want to thank my committee members, Dr s Cousins, Knutson and Lu for the significant and generous contribution toward my research work. Fourth ly I would like to give appreciation to those people from other institutions for the useful research resources shared, the proofreading of a fellowship application

PAGE 5

5 an d p apers reviewed. I also want to acknowledge financial support from NIH, UF graduate school, and a generous donation from UF International Center. Last, I would like to thank all the graduate students in the lab, Dr. Yan Lu, Ms. Lingli Jiang, Mr. Sukru Gule c, Ms. A pril Kim, and Dr. Genie and other students and facult y in the department, as well for their support toward my work. Without help from these people and organization mentioned above, I would not have been able to make these great achievement s over the last three and half year s All of you are important components of my life, which have accelerate d my success.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 15 Iron ................................ ................................ ................................ .......................... 15 Chemistry and Biochemical Properties ................................ ................................ ... 15 Systemic Iron Homeostasis ................................ ................................ .................... 15 Molecular Mechanisms of Iron Absorption ................................ .............................. 17 Regulation of Iron Absorption ................................ ................................ ................. 20 Co pper ................................ ................................ ................................ .................... 22 Chemistry and Biochemical Properties ................................ ................................ ... 22 Systemic Copper Homeostasis ................................ ................................ ............... 22 Molecular Mechanisms of Copper Absorption ................................ ........................ 23 Regulation of Copper Absorption ................................ ................................ ............ 24 Iron Copper Interactions ................................ ................................ ......................... 25 2 TRANSCRIPTIONAL REGULATION OF THE MENKES COPPER ATPASE EPITHELIAL CELLS ................................ ................................ ............................... 29 Summary ................................ ................................ ................................ ................ 29 Background ................................ ................................ ................................ ............. 30 Materials and Methods ................................ ................................ ............................ 32 Results ................................ ................................ ................................ .................... 35 Discussion ................................ ................................ ................................ .............. 39 3 E TRANSCRIPTIONAL INDUCTION OF ATP7A DURING HYPOXIA ................................ ................................ ................................ 53 Summary ................................ ................................ ................................ ................ 53 Background ................................ ................................ ................................ ............. 54 Methods ................................ ................................ ................................ .................. 57 Results ................................ ................................ ................................ .................... 62 Discussion ................................ ................................ ................................ .............. 68

PAGE 7

7 4 COPP ER STABILIZES THE MENKES COPPER TRANSPORTING ATPASE (ATP7A) PROTEIN EXPRESSED IN RAT INTESTINAL EPITHELIAL (IEC 6) CELLS ................................ ................................ ................................ .................... 84 Summary ................................ ................................ ................................ ................ 84 Background ................................ ................................ ................................ ............. 85 Materials & Methods ................................ ................................ ............................... 86 Results ................................ ................................ ................................ .................... 88 Discussion ................................ ................................ ................................ .............. 90 5 CONCLUSIONS AND FUTURE DIRECTIONS ................................ ...................... 99 Conclusions ................................ ................................ ................................ ............ 99 Future Directions ................................ ................................ ................................ .. 100 LIST OF REFERENCES ................................ ................................ ............................. 102 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 114

PAGE 8

8 LIST OF TABLES Table page 2 1 Primer List ................................ ................................ ................................ ............... 45 3 1 Primer List ................................ ................................ ................................ ............... 74 4 1 Sequences of primers used for qRT PCR Experiments ................................ .......... 94

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Real time quantitative RT PCR (qRT PCR) analysis of Atp7a mRNA expression in rat intestinal epithelial (IEC 6) cells.. ................................ ............ 46 2 2 Analysis of rat Atp7a promoter transcriptional activity. ................................ ..... 47 2 3 response elements (HREs). ................................ ................................ .............. 48 2 4 inducible f actor (HIF) expression vectors. ................................ ......................... 49 2 5 Deletion analysis of the putative HREs.. ................................ ............................. 50 2 6 Chromatin immunoprecipitation HREs in the rat Atp7apromoter. ................................ ................................ .......... 51 2 7 and B) and Atp7a (C and D) protein expression in hypoxia and CoCl 2 treated IEC 6 cells ................................ ......... 52 3 1 Effect of mithramycin on mRNA expression in rat intestinal epithelial (IEC 6) cells. ................................ ................................ ................................ ................... 76 3 2 Effect of mithramycin on CoCl 2 mediated transcriptional induction in IEC 6 cells. ................................ ................................ ................................ ................... 77 3 3 Effect of Sp1 over expression on endogenous Atp7a expression and Atp7a, Dmt1, and Dcytb promoter activity in IEC 6 cells.. ................................ .............. 78 3 4 Mutation analysis of putative Sp1 binding sites ................................ ................ 79 3 5 Chromatin immunoprecipitation (ChIP) an alysis of Sp1 binding to rat Atp7a promoter ................................ ................................ ................................ ............ 80 3 6 Co construct s (WT or mutated). ................................ ................................ ............... 81 3 7 intestine.. ................................ ................................ ................................ ............ 82 3 8 Immunoblot analysis of phosphorylated Sp1 (p Sp1) protein expression in IEC 6 cell with CoCl2 mimetic hypoxia or 1% O2 expo sure.. ............................. 83 4 1 Effect of Iron Deprivation and Copper Loading on Atp7a mRNA and Protein Expression in IEC 6 cells. ................................ ................................ .................. 95

PAGE 10

10 4 2 Effect of Copper Loading on Mt and Atp7a mRNA Expression. .......................... 96 4 3 Effect of Copper Loading on Expression of Copper Related Genes .................. 97 4 4 Immunoblot Analysis of Atp7a Protein Expression in Cycloheximide (CHX) Treated IEC 6 cells. ................................ ................................ ............................ 98

PAGE 11

11 LIST OF ABBREVIATIONS Atp7a Menkes Copper ATPase Ankrd37 Ankyrin Repeat Domain Protein 37 COX1 Cytochrome c Oxidase 1 Cp Ceruloplasmin Ctrl Control Ctr1 Copper Transport Protein 1 Cu Co pper Cu 1+ Cuprous Copper Cu 2+ Cupric Copper Dcytb Duodenal Cytochrome b Dmt1 Divalent Metal Transporter 1 Fe Iron FOX Ferroxidase Fpn 1 Ferro portin 1 FeD Iron Deficiency Heph Hephaestin Hypoxia Hypoxia Inducible Fa ctor 2 HRE Hypoxia Response Element IEC 6 Rat Intestinal Epithelial Cells IRE Iron Response Element IRP Iron Response Protein Mt Metallothionein SOD 1 Cu/Zn Superoxide Dismutase 1

PAGE 12

12 Sp1 Specificity Protein 1 Sp6 Specificity Protein 6 TfR 1 Transferrin Factor Receptor 1 VEGF Vascular Epitheli al Growth Factor UTR Untranslated Region

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TRAN SCRIPTIONAL AND POST TRANSCRIPTIONAL REGULATION OF MENKES COPPER ATPASE (ATP7A) GENE EXPRESSION DURING IRON DEFICIENCY By Liwei Xie May 2013 Chair: James F. Collins Major: Nutritional Sciences Menkes c opper ATPase (Atp7a) is a copper exporter in intestinal enterocytes of rodents. It is necessary to export copper from enterocyte s and deliver Cu to blood circulation. In a well characterized intestinal epithelial (IEC 6) cell model Atp7a maintain s intracellular copper homeost asis. In a previous study, Atp7a was shown to be strongly upregulated at the mRNA (~5 fold) and protein (~8 fold) levels in duodenal enterocytes, concomitant with copper loading and accumulation in intestine and live r It was observed that Atp7a expression level also paralleled that of iron transport related genes, such as divalent metal transporter 1 ( Dmt1 ), and duodenal cytochrome B ( Dcytb ) Studies from different labs have prove n creases the expression of iron transported related genes and iron absorption in small intestine during iron deficiency A microarray study showed that Atp7a together with iron transport related genes have GC rich sequence s ( potential Sp1 like factor binding site s ) on the promoter s of these genes The major gaps this study aims to fill are to elucidate the molecular mechanisms of Atp7a regulation during iron deficiency. The se studies test ed the hypothesis that Atp7a at

PAGE 14

14 transcription al or post transcr iption al levels Atp7a promoter was cloned into a luciferase reporter vector and characterized M utagenesis analysis showed that there are three evolutiona rily conserved functional Hypoxia Response Elements (HREs) and four functional Sp1 binding sites in the Atp7a promoter. Chromatin i mmunoprecipitation (ChIP) a bind to the Atp7a promoter Further investigation looked into the copper mediated stabilization of the Atp7a protein. The copper Atp7a interaction increase d Atp7a protein stability, which was investigated in the IEC 6 cells. These data indicated that Atp7a mRNA expression Sp1, in parallel with the iron transport related genes and that copper stabilized the Atp7a protein by a post tran scriptional mechanism. The major finding of this study is that Atp7a is coordinately regulated with iron transport related gene by and that the Atp7a protein is stabilized by copper loading in the mammalian intestine during iron deprivation.

PAGE 15

15 CHA PTER 1 INTRODUCTION Iron Chemistry and Biochemical Properties Iron is essential for life as it plays important roles in biological processes such as electron transport, enzyme activity, oxygen transport and gene regulation [ 1 ] In nature, iron exists in various oxidation states. Ferrous (Fe 2+ ) and f erric (Fe 3+ ) iron are the most common states in biological systems [ 2 ] Iron in the diet is fou nd in two distinct forms: heme and non heme (or inorganic) iron [ 3 ] Heme iron, which is bound within the porphyrin ring structure of hemoglobin and myoglobin, is found predominantly in meat products [ 4 ] Due to the protection of the ring structure, the absorption of heme iron is less influenced by dietary factors leading to higher bioavailability [ 4 ] In contrast, non heme iron that in nature exists mostly as ferric (Fe 3+ ) iron can be found in various dietary sources including meats and plants. Ferric iron is insoluble at physiological pH. However, in the small intestine, when ferric iron is released from digested food products, dietary and luminal factors, including ascorbic acid and gastric acid, help reduce the ferric iron to a soluble and more absorbable form, ferrous iron (Fe 2+ ) [ 5 6 ] Furthermore, some plant derived dietary factors, such as phytate, fibers, polyphenol and tannic acid, tightly bind to ferric iron in the intestine, decreasing bioavailability and negatively affecting iron absorption [ 7 ] Systemic Iron Homeostasis require adequate amounts of iron to maintain systemic homeostasis. However, organisms hav e to avoid absorbing too much iron as it will accumulate in organs and

PAGE 16

16 cause toxic effects. Importantly, there is no known excretory pathway to eliminate excess iron. Iron is absorbed from digested food into enterocytes, and is then exported into blood. I ron exported across the basolateral surface of enterocytes rapidly binds to transferrin (TF), which circulates iron to the major sites of utilization including the largest consumer of iron, the erythroid bone marrow [ 8 9 ] Absorbed iron goes first to the liver, where excess iron may be store d in ferritin inside the hepatocytes [ 10 ] In tissues, no free iron exists as it is highly reactive and can produce oxygen free radicals [ 11 ] Hepatocyte iron can be mobilized when needed. The rest of the absorbed iron is distributed to other tissues. When plasma iron is in excess, transferrin will be saturated, and massive amounts of iron accumulate in the liver [ 12 ] As mentioned, the erythroid bone marrow is the largest iron consumer where iron is incorporated into hemoglobin in erythroid precursors. In muscle cells, the formation of myoglobin also requires a large amount of iron, however, the mechanism of iron acquisition by muscle cells is less clear [ 13 ] Except for a small amount of absorbed iron in the small intestine (1 2 mg/d), the majority of body iron supply is derived from the recycling of iron already within the system (20 25 mg/d) [ 14 ] The recovery and recycling of iron from senescent erythroid cells contributes most to this iron pool Old o r damaged erythrocytes are phagocytosed by tissue macrophages, particula rly in spleen, and by K upffer cells in the liver. Some iron remains in macrophages, and some is exported to plasma TF for use. TF bound iron either circulates to hepatocytes for deposi tion or to the organ of iron utilization [ 14 ]

PAGE 17

17 Massive iron overload and accumulation in liver results in hepatotoxici ty, leading to liver fibrosis and cirrhosis, which eventually may cause liver cancer [ 15 ] Iron accumulation is also a common feature of neurodegenerative diseases, including nd the much rarer disorders aceruloplasminemia, Hallervorden Spatz disease, and neuroferritinopathy [ 16 18 ] Iron has been implicated in pathogenic diseas es for its capacity to produce free radicals and increase oxidative stress. To avoid excessive iron absorption and accumulation leading to iron toxicity related diseases, intestinal iron absorption, internal iron recycling from macrophages, and mobilizati on from hepatocytes have to be meticulously regulated. Thus, mammals have developed precise and sophisticated regulatory mechanisms that control intestinal iron absorption. Molecular Mechanisms of Iron Absorption Iron moves from dietary sources across the enterocyte to the portal circulation generally by three steps: 1) Iron flows from dietary sources across the apical surface of enterocytes; 2) Iron translocates from the apical to basolateral surfaces for delivery to portal blood circulation or it can be stored or utilized in enterocytes; 3) Iron is exported across the basolateral surface of enterocytes into the circulation, where it binds to apo transferrin. The majority of dietary non heme iron is in the form of ferric iron (Fe 3+ ) which is insoluble at physiological pH. Ferric iron thus has to be reduced to a soluble form, ferrous iron, which is accomplished by an iron reductase on the brush border surface of duodenal enterocytes [ 19 20 ] Duodenal cytochrome b (Dcytb), a multi spanning membrane protein was shown to have ferric iron reductase activity [ 21 23 ] However,

PAGE 18

18 mice with Dcytb deletion can still absorb iron, which suggests that Dcytb is not e ssential for iron absorption in mouse small intestine [ 22 ] There may be some other iron reductase or iron reduction mechanism existing in mice, such as ascorbic acid. However, the relevance of this observation to iron homeostasis in humans is not clear. Once reduced, f errous iron is transported across the apical membrane by divalent metal transporter 1 (Dmt1) [ 24 25 ] In addition to the enterocyte of small intestine, Dmt1 expression is also detected in most body cells where it plays important roles in the uptake of TF bound iron [ 26 ] Studies indicated that either small intesti ne specific deletion of Dmt1 or a mutated Dmt1 in small intestine will lead to a defect in iron absorption and severe anemia is observed [ 27 28 ] This suggests that Dmt1 is an essential pathway for iron absor ption in the mammalian small intestine. Once inside enterocytes, iron can be utilized by enterocytes, stored inside the iron storage protein ferritin, or transferred across the basolateral membrane to portal blood circulation [ 14 ] First, the enterocyte may utilize newly absorbed iron for its metabolic purposes such as in mitochondria, where iron may be used for heme synt hesis or iron sulfur cluster protein synthesis, including cytochromes in the mitochondrial electron transport chain [ 29 ] Newly absorbed iron may also participate in the regulation of genes encoding proteins involving in iron metabolism. Second, in addition to metabolic use and basolateral transport of excess iron in enterocytes, iron can be incorporated to f erritin. Last, if body has a high demand of iron, newly absorbed iron will be transferred across the basolateral membrane quickly for use by various tissues and organs.

PAGE 19

19 Ferrous iron is pumped out of enterocyte s into the portal blood circulation by a multi spanning membrane protein, ferro portin 1 [ 30 31 ] On the basolateral membrane, before being bound to TF, effluxed ferrous iron needs to be oxidized to ferric iron. In small inte stine, hephaestin (Heph) is strongly expressed in mature enterocytes and is known to be the major iron oxidase [ 32 ] However, Heph is not essential as sla (Heph mutant) mice and Heph knockout mice do not strongly influence iron status [ 33 ] There thus must be some other unidentified ferroxidase s expressed in enterocytes that may work cooperatively with Fpn1 for iron export across the basolateral membrane of duodenal enterocytes [ 34 35 ] Ferrous iron in the basolateral iron transport complex is oxidized to ferric iron, followed by picking up by apo transferrin [ 36 ] However, transferrin is not essential for iron transport, as mice lacking TF (called hypotransferrinemia mice) do not die [ 37 ] These animals have massive iron overload in liver and nonhematopoietic tissues, and they develop severe iron deficiency anemia, which suggests that TF is important for erythropoiesis to uptake sufficient iron for erythrocyte development to meet high leve ls of iron demand for hemoglobin synthesis [ 37 ] Another plasma protein, ceruloplasmin (Cp) that has homology to Heph also has the ability to oxidize ferric iron to ferrous iron. Cp is synthesized in hepatocytes and secreted into blood [ 38 ] It facilitates iron release from various tissues. However, Cp knockout in mice did not show a clear defect in iron absorption (unpublished observation). Since mice with double deletion of Heph and Cp are still viable, there must be some unidentified and uncharacterized ferroxidase that exists [ 35 ] Recently, another ferroxidase has been identified wi th similar function to Heph and Cp [ 35 ] Further studies are however necessary to understand the functional and physiological

PAGE 20

20 importance of these novel ferroxidases. Both Heph and Cp are copper dependent iron ferroxidases as copper is incorporated biosynthetically into both proteins Thus, animals with copper deficiency will develop iron deficien c y anemia, as copper is required for Heph and Cp enzyme activity [ 39 ] Regulation of Iron Absorption Iron absorption in duodenal enterocytes is tightly regulated, as no active excretory pathway exists. Thus, the amount of body iron must be determined via regulation of intestinal iron absorption. Iron absorption increases at the times of high body demand, and decreases when iron stores are replete. Research has identified several regulatory mechanisms that regulate iron absorption. The duodenum is the major site for intestinal iron absorption. Studies suggested a post transcriptional regulatory mechanism is involved in expression of iron transport related genes [ 40 ] The iron response element s (IRE s ) are found in the untranslated region (UTR) of the mRNAs [ 41 ] Iron regulatory proteins (IRPs) bind to IREs when intracellular iron is low. The binding of IRPs to IREs can either increase mRNA stability (e.g. Dmt1 [ 42 ] UTR) or block translation (e.g. Fpn1 [ 30 ] and ferritin [ 43 ] with IREs in the UTR). It was initially thought that IRPs sense the intracellular iron levels and regulate mRNA translation via direct interaction with mRNA. However, during iron deficiency, th e system has a high iron demand. In this case, intestinal iron uptake and iron transport the across basolateral membrane are induced, while this conflicts with the IRPs mediated mechanism of Fpn1 regulation. Furthermore, other iron transport related genes such as Dcytb do not have IREs. It was thus hypothesized that other regulatory mechanisms must exist, especially during iron deprivation.

PAGE 21

21 It was noted that during iron deficiency, iron is depleted in hepatocytes (the major iron deposition site) and in ery throcytes (the major iron utilization site) [ 44 ] This causes a defect in hemoglobin synthesis in erythrocytes and eventually affects oxygen transport to different organs, leading to systemic hypoxia. Several studies have identified that iron deficiency mediated hypox ia in small intestine stabilizes hypoxia inducible factor (HIF) in enterocytes [ 45 ] related gene expression in enterocytes through direct binding to hypoxia response elements (HREs) on promoters of these genes [ 46 ] At least two HREs were found on proximal region of the promoters, including Dmt1, Dcytb, and Fpn1 [ 45 47 ] During iron deficienc plays a major role in regulating iron transport related gene expression in duodenal enterocytes to increase systemic iron level. Thus, another splice variant of the Fpn1 iency [ 47 ] Mice with intestine [ 45 47 ] even during iron deficiency Only a slight induction on Dmt1 is observed in mice with [ 45 ] Fpn1 is the only known iron transporter to carry iron across the basolateral membrane to the portal blood circulation, and this action is the rate limiting step that is crucial for maintenance of systemic iron levels [ 30 ] Hepcidin was originally identified in urine a s a small antimicrobial peptide, and subsequently linked to iron homeostasis [ 48 ] It is mainly produced by and secreted from hepatocytes [ 48 ] Expression of hepcidin in liver is inversely related to intestinal iron uptake and this suggests that hepcidin is a suppressor of iron absorption [ 30 31 49 ] Hepcidin exerts its function by interacting

PAGE 22

22 with Fpn1, subsequently leading to the internalization and degradation of the whole complex to reduce iron export from enterocytes [ 30 ] Copper Chemistry and Biochemical Properties Copper (Cu) is one of the essential trace minerals for most organisms, especially for rodents and humans. Cu ion exists in two oxidation states in biological systems, Cu 1+ (cuprous) and Cu 2+ (cupric). It plays important roles in biological systems and serves as a cofactor for enzymes and proteins involved in energy generation and release, iron oxidation (Cp and Heph), signal transduction (cytochrome c oxidase in mitochondria), formation and r egulation of hormones, collagen formation (lysyl oxidase), red blood cell formation and cellular metabolism [ 50 ] Systemic Copper Homeostasis There is an average of ~1.3 mg/d of copper flowing from dietary sources into duodenal enterocytes [ 51 ] The absorbed copper passes through enterocytes and is exported into the portal blood circulation. The exported copper is picked up by albumin, which circulates and delivers copper to the liver for the cuproenzym e synthesis, such as Cp. Excessive copper is exported via hepatic Atp7b into bile and excreted through feces. Body copper homeostasis is coordinately regulated via intestinal copper absorption, copper storage in tissues (e.g. liver), and copper excretion b y the liver [ 50 ]

PAGE 23

23 Molecular Mechanisms of Copper Absorption Copper absorption is regulated via coordinate interaction between membrane bound transporters that pump copper in and out of cells and intracellular chaperones that deliver copper to their targets. Copper uptake occurs from the lumen of s mall intestine via a copper transporter protein (Ctr1), which is structurally and functionally conserved from yeast to humans [ 52 ] Accumulating evidence indicates that a metal loreductase is required to reduce Cu 2+ to Cu 1+ which likely traverses the apical membrane of duodenal enterocytes via Ctr1. Recent studies suggested some possible candidates as the required metalloreductase. A Steap protein, which localizes to the plasma and intracellular membrane may work synergistically with Ctr1 to mediate Cu 1+ uptake [ 53 ] Alternatively, Dcytb located at the apical membrane of enterocytes, which mediates iron reduction, may also work with Ctr1 to mediate Cu 1+ uptake [ 54 ] Inside enterocytes, copper is delivered via specific copper chaperones to distinct target enzymes through direct protein p rotein interactions. The copper chaperone, CCS is responsible to deliver copper to Cu/Zn superoxide dismutase (SOD1), while COX17 delivers copper to cytochrome c oxidase (COX1) in mitochondria [ 55 56 ] A thi rd copper chaperone in enterocytes is the Atox1 protein, which delivers copper to a copper transporter (Atp7a), which is located inside the Golgi complex and traffics between Golgi complex and the basolateral membrane of enterocytes [ 57 59 ] Following export across the basolateral membrane to the portal blood circulation by Atp7a, copper is bound to albumin, tr anscuprein, or low molecular weight ligands. Newly absorbed copper is taken up by hepatocytes, where copper is incorporated into newly synthesized ceruloplasmin, which is afterward released from hepatocytes into the blood and is

PAGE 24

24 delivered to cells as a fun ctional ferroxidase. In hepatocytes, excess copper is stored in metallothionein to avoid the generation of free radicals from the free Cu [ 60 ] Regulation of C opper A bsorption Copper as a cofactor plays important roles in biological processes including growth and development. However, excessive copper especially free copper, will be toxic in terms of the redox property of copper contributing to the generation of free radicals such as the hydroxyl radical [ 61 ] Thus, excessive copper in duodenal enterocytes will be quickly exported across the basolateral surface into the portal blood circulation followed by binding to transport proteins such as albumin or transcuprein to circulate to hepatocytes for storage [ 50 ] The concentr ation of copper in duodenal enterocytes is tightly regulated by the copper transporter located on the basolateral side of enterocytes, the Menkes Copper Transporting ATPase (Atp7a). This protein is a unique copper transporting P type ATPase, which plays an essential role in maintaining copper homeostasis. M utation on Atp7a gene may cause Menkes disease, which is an X linked recessive disorder, identified and isolated in the 1960s by John Han Menkes and will lead to copper accumulation in enterocytes and sys temic copper deficiency [ 62 ] In 1993 Atp7a was isolated as a candidate gene for Menkes disease by positioning cloning and the supporting evidence s indicated that this gene encodes a copper transporting ATPase [ 63 65 ] It was documented that genes involved in copper trafficking and transport are regulated at the transcription al level in multiple systems [ 66 68 ] However, in some organisms, copper does not affect the mRNA level and may be associated with protein degradation and maintenance of steady state protein levels. Studies have demonstrated

PAGE 25

25 that copper stimulates endoc ytosis of the membrane bound copper transporter, Ctr1, followed by degradation via a post translational mechanism in HEK293 cells [ 69 ] Additionally the copper chaperone for SOD1 (CCS) protein levels change inversely with copper concentration and CCS half life via copper levels is regulated [ 70 71 ] This is achieved through the binding of copper to the cysteine residues (also known as CXC domain) at th e N terminus [ 72 ] This domain is commonly found in several copper transporter s and chaperones, including, Atp7a, Atp7b, CCS, and Atox1 [ 73 74 ] The Atp7a protein in duodenal enterocytes mainly was found in two subcellular locations, in the trans Golgi network (TGN) and plasma membrane (PM) [ 75 ] At normal copper concentration s most Atp7a protein is localized to the TGN where it supplies copper to copper dependent enzymes in the secretory pathway [ 59 ] H owever, in the presence of increased copper concentration in duodenal enterocytes, the Atp7a protein trafficks to the PM to export excessive copper in vitro [ 59 ] This phenomenon has been observed in both duodenal enterocytes and in intestinal epithelial cell models [ 76 ] Studies investigated in various cell types showed that elevated intracellular copper concentration induces trafficking of Atp7a protein to PM and coppe r seems to maintain high level of Atp7a protein in the PM [ 77 ] Iron Copper Interactions Copper is closely associated with iron absorption and transport. As ferrous iron traverses the basolateral membrane of enterocytes, it needs to be oxidized to ferric iron before being bound by apo transferrin. This oxidation process is mediated via two kno wn ferroxidases, hephaestin (Heph) that is synthesized by duodenal enterocytes [ 33 ] and ceruloplasmin (Cp) synthesized by hepatocytes [ 78 ] These two ferroxidases (FOXs) are copper dependent enzymes. When the copper level is low, copper

PAGE 26

26 dependent FOX activity and abundance are low, leading to a defect in intestinal iron absorption and the development of iron deficiency anemia. In contrast, high copper uptake will be correspondingly associated with higher activity and abunda nce of FOX s Increased copper levels in hepatocytes also robustly increase Cp activity and abundance in blood. Several in vitro studies have shown the link between copper and Cp levels and it was been demonstrated in HepG2 cells that induction of copper im port via direct binding to HREs on Cp promoter [ 79 80 ] Coppe r mediated induction of Cp expression and activity has also been observed in rodent models [ 81 ] However, the mediated regulatory mechanism of Cp expression could not be recapitulated in t he in vivo animal models during iron deficiency. In humans and rodents, low copper level is associated with reduced ferroxidase activity, leading to iron deficiency anemia. A similar phenomenon is also observed in mice with deletion of hephaestin or cerulo plasmin [ 35 ] These observations demonstrated that copper is essential to maintain systemic iron homeostasis. Dmt1 as an iron transporter on the apical membrane of duodenal enterocytes and it may also be involved in copper uptake [ 24 ] Several studies have shown that Dmt1 can transport copper, although the physiological mechanism is not clear [ 82 83 ] Recent investigation in Belgrade rats (bearing a point mutation in Dmt1: b/b) have demonstrated that mutant Dmt1 abolishes the uptake of copper as a compensatory mechanism to increase iron absorption during iron deficiency [ 84 ] This is supported by several key observations: 1) Dmt1 mutation abolishes the increase of liver and serum copper levels in Belgrade rats on low iron diets; 2) The documented induction of Cp

PAGE 27

27 expression and activity was attenuated; 3) A decrease of copper levels in enterocytes was observed as exemplified by abolishing Mt expression and a lesser induction of Atp7a [ 84 ] In duodenum of iron deprived rats, a robust induction of iron transport genes was obse rved, including Dmt1 and Dcytb [ 85 ] The basola teral surface copper transporter, Atp7a is also strongly upregulated, perhaps responding to the influx of copper into enterocytes, eventually leading to increase on copper levels in liver and serum [ 85 86 ] The increased copper absorption is considered as a compensatory mechanism to activate the copper mediated mechanism via increasing copper based ferroxidase activity (Cp and He ph) to increase iron release from duodenal enterocytes. However, the regulatory mechanism s to mediate Atp7a induction during iron deficiency are still unknown. The major aim of this study was to delve into the mechanistic aspects of induction of Atp7a during iron deficiency. First, preliminary studies demonstrated that endogenous Atp7a expression in rat intestinal epithelial (IEC 6) cells was indu ced by CoCl 2 treatment, a hypoxia mimetic and 1% oxygen exposure. A combination of A ctinomycin D and CoCl 2 treatment suggested that the hypoxia mediated induction is at the transcriptional level. We also identified three phy logenetically conserved hypoxia ACGTG across species in the Atp7a promoter. Thus, we hypothesized that Atp7a is 6 cells. Second, previous GeneChip studies found both iron transport re lated genes and the Atp7a gene have GC rich promoter sequences [ 87 ] These GC rich sequences are known to be bound by specificity protein (Sp like factor) and furthermore, these GC rich

PAGE 28

28 sequences are located in the flanking region of HREs. Thus, we predicted that Atp7a is transcriptionally regulated by Sp1, which might be also involved mediated transcriptional regulation. Third, preliminary data demonstrated that Atp7a protein increases in IEC 6 cells with additional copper, however the mRNA level is unaffected. It was also noted that the induction of Atp7a protein level is stro nger than that of mRNA [ 86 ] Moreover, in duodenal enterocytes, studies have shown that copper is associated with Ctr1 and CCS protein stability and ste ady state protein levels [ 69 71 72 ] Thus, we generated the hypothesis that copper stabilizes Atp7a protein in IEC 6 cells. From these studies, three regulatory mechanisms are identified to be involved in mediated signaling mediated transcriptional regulation; 3) Copper mediated induct ion of Atp7a is at the level of transcription. Copper dependent mechanism to increase Atp7a protein level s is at the level of post transcriptional level, which is independent of HIF2 and Sp1 mediated induction of the Atp7a transcript. These investigations have thus identified novel regulatory mechanisms related to Atp7a expression in the mammalian intestine during iron deficiency

PAGE 29

29 CHAPTER 2 TRANSCRIPTIONAL REGULATION OF THE MENKES COPPER ATPASE (ATP7A) L EPITHELIAL CELLS Summary Iron homeostasis related genes (e.g. Dmt1 and Dcytb ) are upregulated by HIF2 during iron deficiency in the mammalian intestine. Menkes C opper ATPase ( Atp7a ) gene expression is also strongly induced in the duodenum of iron defic ient rats. The current study was thus designed to test the hypothesis that Atp7a Rat intestinal epithelial (IEC 6) cells were utilized to model the intestinal epithelium, and CoCl 2 and 1% O 2 were applied to mimic hypoxia in vitro Bo th treatments significantly increased endogenous Atp7a mRNA levels; mRNA induction with CoCl 2 treatment was blunted by a transcriptional inhibitor. The rat Atp7a promoter was thus cloned and studied. Various sized promoter constructs were inserted into a luciferase reporter vector and transfected into cells. A 224/+88 bp construct had full activity and was induced by CoCl 2 ; this promoter fragment was thus utiliz ed for subsequent analyses. Interestingly, this region contains three phylogenetically conserved, putative hypoxia NCGTGN expression caused a significant upregulation of promoter activity expression had little effect. To determine if Atp7a is a direct HIF target, three putative HREs were mutated individually or in combination; all were shown to be essential for transcriptional induction. Chromatin immunoprecipitation studi es also demonstrated that This work has been published : Am J Physiol Cell Physiol, 2011. June: 300 (6): C1298 305. P ermission to reprint is no t required.

PAGE 30

30 HIF2 binds to the Atp7a shown to be increased by both treatments. In conclusion, the Atp7a gene is upregulated e regulation with genes related to intestinal iron homeostasis. Background Intestinal iron absorption is the result of the coordinated action of iron import and export proteins, located on the brush border and basolateral membranes of enterocytes, mediated by divalent metal transporter 1 (Dmt1) [ 24 27 ] and ferroportin 1 (Fpn1) [ 30 31 49 88 ] respectively. Also required are a coupled reduction of dietary ferric iron by duodenal cytochrome B (Dcytb; or other proteins) [ 21 89 ] to the import process and an oxidation event mediated by hephaestin (Heph) [ 33 ] coupled to the export pro cess. Absorption of iron is a regulated process, responding in the positive direction during states of iron deficiency. This enhancement of absorption is mediated partially via induction of genes related to enterocyte iron homeostasis; each of the genes me ntioned above is modulated by physiological signals that increase expression during iron deprivation. Previous studies have also shown induction of copper transport related genes in the gut of iron deficient rats [ 85 90 ] suggesting that alterations in copper homeostasis may be part of the compensatory mechanism to increase iron absorption. This is consistent with previous observations documenting increased copper in the intestinal epithelium liver [ 91 ] and serum [ 92 ] of mammals during iron deficiency. The induction of iron and copper related genes in the intestine during iron deprivation suggests a possible common regulatory mechanism.

PAGE 31

31 During iron deficiency, when levels of the liver derived iron homeostasis regulating hormone hepcidin [ 93 ] drop precipitously, other regulatory mechanisms likely come in to play. In some cases, genes are induced via interaction of intracellular iron sensing proteins (iron regulatory proteins) with stem loop str uctures (called iron iron homeostasis related genes ( Dmt1 Fpn1 ) [ 30 42 ] But interestingly, not all genes induced during iron deprivation have IREs and some genes respond in opposite directions than predicted by the location of the IRE, suggesting that other mechanisms are involved. I ndeed, recent studies have shown that Dmt1 and Dcytb (and possibly Fpn1 ) are upregulated during iron deficiency at the level of gene transcription via specific interaction with a hypoxia responsive trans [ 45 80 ] These investigations and another recent study [ 94 ] suggested that during iron deficiency, when many tissues become hypoxic, the intestinal epithelium responds by preferential gene expression intended to overcome the iron de ficient phenotype. The current study was thus undertaken to test the hypothesis that the Menkes Copper ATPase ( Atp7a This supposition derives from the fact that Atp7a mRNA induction para llels that of Dmt1 and Dcytb as noted in previous publications [ 85 ] Atp7a encodes an intestinal copper transporter, and its induction is particularly intriguing given the aforementioned potential link between iron and copper during conditions of low iron in the intestine. The induction of Atp7a was modeled in intestinal epitheli al (IEC 6) cells in culture and hypoxia was applied (or mimicked). Data suggested transcriptional induction of Atp7a expression

PAGE 32

32 during condition s that mimic hypoxia so the promoter was cloned and studied. Extensive mechanistic studies identified specific HIF binding sites in the Atp7a promoter, which are shown to drive induction during hypoxia. Moreover, a critical role coordinate regulation of iron and copper homeostatic genes in enterocytes during iron deficiency. Materials and Methods Cell Culture Rat intestinal epithelial (IEC 6) cells were obtained from American Type Culture Collection (ATCC, Manassas VA) and cultured as previously described [ 76 ] recommendations. In some experiments, cells were grown in a hypoxia chamber (BioSpherix, Lacona, NY) with 5% CO 2 and 1% O 2 balanced with 94% N 2 oxygen conditions. Plasmid Construction The rat A tp7a promoter was amplified by PCR with a proof reading polymerase (Invitrogen, Carlsbad, CA), utilizing a rat BAC genomic clone as a template (clone # CH230 Institute, Oakland, CA). The forward primer was ~ 3000 bp upstream of the transcriptional start site (which was previously identified) [ 76 ] and the reverse primer with overhanging KpnI (forward) and EcoRV (reverse) restriction enzyme cutting sites. Promo ter fragments were cloned into pGL4.18 basic luciferase vector (Promega, Madison, WI). Further deletion constructs were created by PCR amplification using the 3 kb promoter fragment as a template, using the same reverse primer and different forward primers with overhanging KpnI restriction enzyme digestion site s PCR products

PAGE 33

33 and vector were double digested with restriction enzymes KpnI and EcoRV (Fermentas, Glen Burnie, MD) and ligat ions were performed with LigaFast Rapid DNA Ligation System (Promega, Mad ison, WI). Deletion of putative hypoxia response elements ACGTG using primers flanking the putative HRE and going in opposite directions, thus deleting the HREs For double and triple HRE deletions, plasmids having previously deleted HREs were used as templates in the same fashion. Linearized PCR products were subsequently circularized with the Quick Li gation TM Kit (New England BioLab, Ipswich, MA). All the promoter constructs were sequenced by the DNA Sequencing Core in ICBR at the University of Florida. Sequences of each primer are shown in Table 2 1. Transient Transfection and Luciferase Assay IEC 6 cells were transfected in 24 Atp7a promoter construct and 150 ng pRL CMV vector ( containing the Renilla luciferase reporter gene as internal control ) using TurboFect in vitro Transfection Reagent (Fermenta s, Glen Burnie, MD) expression Atp7a 150 ng pRL CMV vector were co transfected into ~80% confluent IEC 6 cells in 24 well plates. Empty pcDNA3.1 vector was used as negative control (for the HIFs). Luciferase activity was measured using the Dual Luciferase Assay Kit (Promega, Madison, WI) bating with 100 1X Passive Cell Lysis Buffer for 20 minutes with gentle shaking. Cell lysates

PAGE 34

34 were collected and 20 was used to measure Firefly and Renilla luciferase activity in a tube luminometer (CAN/CAS STD C22.2; Berthold Technologies, Oak Ridge TN) Total RNA Isolation and Real Time qRT PCR Total cellular RNA was isolated by Trizol transcri bed with iScript cDNA Synthesis kit (BioRad, Hercules, CA) in a 20 reaction. After reverse transcription, the 20 reaction was diluted to 40 1 was used for qRT PCR reaction with SYBR Green qRT PCR master mix (BioRad), as previously described [ 76 ] Sequences of each primer used for qRT PCR are listed in Table 3 1. Cytosol and Nuclear Protein Preparation and Immunoblotting Cytosol and nuclear proteins were purified with the Nuclear Extract Kit (Active Motif, CA) according determined by BCA Protein Assay Kit (Thermo Scientific, Rockford, IL). Cytosol or nuclear protein were resolved by 7% SDS PAGE followed by electroblotting to a PVDF membrane which was then blocked in 5% non fat milk. Membranes were reacted with a commerc ial available 132H; Novus Biologicals, Littleton, CO) and one previously developed and characterized against Atp7a (called 54 10) [ 91 ] The protein on the membrane was visualized by ECL and autoradiography film. Chromatin Immunoprecipitation Pre confluent IEC 6 cells with or without CoCl 2 treatment in 10 cm cell culture dishes were crosslinked with 1X PBS containing 1% formaldehyde for 10 minutes and quenched with 2M glycine at a final concentration of 0.2M for 5 minutes at room temperature. Nuclei were isolated by usi ng the Active Motif Kit (Active Motif, Carlsbad, CA) and lysed with SDS lysis buffer (1% SDS, 10 mM

PAGE 35

35 EDTA, 50 mM Tris HCL pH 8.1 and protease inhibitor cocktail). Chromatin was sheered by a Bioruptor instrument (Diagenode, Sparta, NJ) following the manufac instructions, using 45 cycles of one minute sonication followed by 30 seconds at 4 o C. The size of resulting fragments was determined by agarose gel electrophoresis. Nuclear samples were cleared by centrifug ation at 16 000 x g for 30 minutes at 4 o C. The 122, Novus Biologicals, Littleton, CO) at 4 C Protein and chromatin were reverse crosslinked with 1 M NaCl for 6 hours at 65 C following 1 hour incubation with RNase A (Ferm entas) and overnight incubation with Proteinase K (Fermentas) at 37 C. Chromatin was extracted and purified with phenol/chloroform/isoamyl alcohol follow ed by precipitation with 100% isopropanol and glycogen. 1 sample was used for qRT PCR as described above, with primers specific for Atp7a (covering a region containing the HREs and another upstream region with no HREs), Dmt1 and ankyrin repeat domain protein 37 ( Ankrd37 ) Phylogenetic footprinting and sequence alignments were utilized to identify regions in the rat Dmt1 and Ankrd37 genes that were homologous to the experimentally identified HRE containing regions in the mouse Dmt1 [ 45 ] and human Ankrd37 [ 95 ] genes. Amplification was also performed with the same primer sets using input DNA (i.e. before IP with the antibody). All primers are listed in Table 3 1. Results Regulation of Endogenous Atp7a Gene Expression by Hypoxia In an attempt to recapitulate the induction of Atp7a seen in the intestinal epithelium of iron deficient rats, IEC 6 cells (which express Atp7a ) [ 76 ] were treated with CoCl 2 (to mimic hypoxia) or subjected to hypoxia (1% O 2 ). qRT PCR results demonstrated that endogenous Atp7a mRNA levels increased 1.8 and 1.6 fold following exposure to CoCl 2

PAGE 36

36 or 1% O 2 respectively (Figure 2 1). The induction of Atp7a by CoCl 2 was abolished wh en cells were exposed to actinomycin D, a transcriptional inhibitor (ActD; 1g/mg in H 2 O), 1 hour prior to and during 16 hours CoCl 2 exposure (Figure 2 1 ). Investigation of Atp7a Transcriptional Activity The previously mentioned data suggested that the m echanism of Atp7a induction by hypoxia was transcriptional; regulation of the Atp7a promoter was thus investigated. The following promoter constructs were generated as described in the Materials and Methods section: bps 2995/ +88, 976/+88, 754/+88, 47 6/+88, 224/+88, 194/+88, 144/+88 and 15/+88 (all relative to the transcriptional start site). Forward primers utilized to amplify these fragments were designed from DNA regions that did not have predicted cis elements. Reporter gene assays demonstrated that the activity of the longest construct ( 2995/+88) had similar activity to the 224/+88 construct (Fig ure 2 2 ). The 976/+88 and 754/+88 constructs showed similar activity levels. Interestingly, the 476/+88 construct had significantly diminished act ivity suggesting that an inhibitory element exists in the region between bps 476 and 224; this element must be inactive or otherwise silenced by upstream elements as the 754/+88 construct retained full promoter activity. Promoter constructs with further 15/+88 construct having the same background activity as the empty plasmid. As the 224/+88 construct had full activity, it was utilized for further studies. Further data showed that the 2995/+88 (data not shown) and the 224/+88 constructs were significantly induced by CoCl 2 exposure (Figure 2 3 ; sequence 2 3 panel B). It was also noted that the 224/+88 construct contained 3 phylogenetically con served, putative

PAGE 37

37 hypoxia response elements (HREs; between bps 224 and were thus generated to assess the potential role of the HREs in this induction. Promoter 224 to 160 all showed ind uction by CoCl 2 exposure while constructs ending from bp 113 to 57 were not responsive. These observations suggested that the HREs in the Atp7a gene may play a mechanistic role in induction by CoCl 2 Expression and Atp7a Transcriptional Activity Since CoCl 2 has been described in many cell types [ 80 96 ] and both isoforms bind to highly similar DNA sequences, it was important to determine experimentally which HIF was responsible for induci ng the Atp7a gene. Additional experiments were thus performed in IEC 6 cells co transfected with the 2995/+88 and 224/+88 Atp7a promoter/luciferase human cDNA while the HI F plasmid contained the mouse cDNA [ 45 ] ; cDNA expression was driven by the CMV promoter in the pcDNA3.1 plasmid (Invitrogen). s were signif icantly increased in co transfected cells, as determined by qRT PCR (data not shown). Results showed that over expression had only a minor effect on promoter activity of both construct s (Figure 2 4; 1.7 and 1.8 fold, respectively). over expression however resulted in a dramatic induction of promoter activity of both constructs, 5.2 fold for the 2995/+88 construct (Figure 2 4, panel A) and 4.7 fold for the 224/+88 construct (Figure 2 4, panel B; No Treatment). Further studies were p expression with CoCl 2 treatment or hypoxia (1% O 2 ) on Atp7a promoter activity. This was important as

PAGE 38

38 even though there was a significant induction of and mRNA levels in transfected cells, it is lik ely that protein expression levels were not as significantly Studies described above were thus repeated using the 224/+88 promoter construct and CoCl 2 or 1% O 2 Basal promoter activity was increased 1.7 to 2.0 fold with these treatments (Figure 2 4, panel B; CoCl 2 expression had no additional effect on Atp7a expression resulted in a significant increa se (although it was not greater than activity expression under normoxic conditions) Elements in the Promoter Since Atp7a promoter activity was induced by CoCl 2 treatment, hypoxia an d H if expression, the next logical step was to consider the role of the 3 putative HREs in the responsive promoter fragment. These sequences were thus deleted individually or in combination in the 224/+88 promoter construct and transfection experim ents were done in IEC 6 cells. The wild type construct responded positively to expression (~5 fold increase over empty vector transfected cells; Figure 2 5). Deletions of the HREs however resulted in a significant decrease in the level of induct ion (~2 fold), although there was no noticeable difference between individual deletions of an HRE, double deletions or deletions regulation of the Atp7a promoter, chromatin immunoprecipitation (ChIP) assays were performe d with cross linked, soluble chromatin isolated from CoCl 2 treated and non treated IEC 6 cells. DNA fragments were found to be ~500 bp in length after the sonication protocol. qRT PCR was subsequently performed on DNA samples pulled

PAGE 39

39 down by c antibody (Fig ure 2 6). As compared to input DNA (before pull down), there was a significant increase in the amount of DNA amplified from the CoCl 2 treated samples representing the region of the Atp7a promoter containing the HREs (Figure 2 6; Atp7a (+) H RE ), while there was no amplification using primers targeting a region of the promoter upstream of the HRE region (Figure 2 6; Atp7a ( ) HRE). Increased amplification was also noted from the CoCl 2 treated samples for two positive controls, Dmt1 and Ankrd37 (Figure 2 regulation of Dmt1 in the mammalian intestine [ 45 46 ] and Ankrd37 was also noted to be a HIF target (but regulated by HI [ 95 ] Discussion The hypothesis that common regulatory mechanisms are activated during iron deficiency stems from observations showing very similar patterns of gene expression in the intestine of iron deficient rats [ 85 ] Several iron homeostasis related genes (e.g. Dmt1 Dcytb TfR1 etc.) were induced across several postnatal developmental sta ges and in models of diet induced and genetic iron deficiency [ 97 ] Genes related to copper homeostasis showed a parallel expression pattern. One particularly interesting gene, the Menkes Copper ATPase encoding an intestinal copper transporter, was induced in a strikingly similar pattern to the gene encoding the predominant iron transporter, Dmt1 [ 85 ] Furthermore, recent published works have demonstrated that Dmt1 and other iron deficiency [ 45 46 ] This interesting observation leads to speculation that during iron deficiency, hepcidin independent mechanisms are invoked to increase iron absorption, and that identifying additional genes r egulated by this mechanism is likely to reveal novel participants in the compensatory response of the intestinal epithelium to iron

PAGE 40

40 deprivation. Some of these participants may also play important, hitherto unrecognized roles in iron homeostasis as a part o f normal physiology. The current study was thus undertaken to test the hypothesis that Atp7a which if true, would provide a mechanistic explanation for its strong induction during iron deficiency. Atp7a is strongly expressed in IEC 6 cells [ 76 ] so this cell line was utilized as a model of the mammalian intestinal epithelium. Cells were exposed to 1% oxygen to recapitulate hypoxia which occurs in many tissues, including the intestine, during iron deficiency when hemoglobin levels are significantly re duced. Cells were also treated with CoCl 2 which mimics hypoxia by binding to the oxygen dependent degradation region of the H if subunits, which prevents oxygen from signaling their degradation [ 98 ] Initial observations demonstrated that expression of the endogenous Atp7a gene was increased in response to both treatments; this induction was abrogated by a transcriptional blocker, indicating regulation at the level of transcription. The rat Atp7a gene promoter was thus cloned and characterized. The transcriptional start site (TSS) [ 76 ] ide ntified suggesting alternative start sites, all within a ~30 bp region in exon 1 of the s (but not containing the putative start codon, which is in exon 2). Promoter constructs were transfected into IEC 6 cells, a well studied model of the intestinal epithelium. The longest promoter construct ( 2995/+88) and a shorter construct ( 224/+88) bot h had similar reporter gene activity levels in transient transfection assays, so the

PAGE 41

41 latter construct was selected for further analyses. This construct was significantly induced by CoCl 2 sequence to bp 160 also responded but even shorter constructs were unresponsive. These data suggested the presence of the hypoxia responsive cis elements (HREs) between bp 160 and 113. Interestingly, these putative HREs were conserved across three mammalian sp ecies (rat, mouse and human), when 1000 bp promoter sequences were used as input to run the FootPrinter web server (http://genome.cs.mcgill.ca/cgi bin/FootPrinter3.0/FootPrinterInput2.pl ). Further studies were designed to consider the role of these sequen ces in the induction of Atp7a gene expression by hypoxia. Two H IF IF IF rize with a binding partner (HIF This only occurs under conditions when cells are exposed to certain hypoxia mimics such as CoCl 2 or deferroxamine [ 46 94 ] induction of the Atp7a gene, experiments were performed to assess the effect of H if over expression on promoter activity. Data demonstrated that both the 2995/+88 and 224/+88 bp constructs were significantly induced by over expression of H IF H IF expression only had a marginal effect on the activity of both constructs. Interestingly, identical studies carried out after cells were exposed to 1% oxygen or CoCl 2 demonstrated that there was no additional synergistic effect on promoter activity. This observation suggested that when H IF expressed, even under conditions where it would normally be degraded (i.e. normoxia), protein levels must be suffi ciently increased so as to overwhelm the degradative machinery. Both H if

PAGE 42

42 are degraded via interaction with an accessory protein, von Hippel Lindau (VHL), that targets them for destruction in the lysosome [ 99 100 ] It is further speculated that hypoxia and CoCl 2 exposure had no additional influence on Atp7a promoter activity due to the fact that the H IF mediated induction of Atp7a promoter activity was already at a predetermined maximum. It would seem logical that Atp7a induction would have an upper limit so as to avoid inducing copper deficiency in cells, as one important role of the Atp7a protein is in copper e fflux. Additional studies considered the function role of the HREs in the Atp7a promoter. The H IF expression system was thus utilized in co transfection experiments using the wild type 224/+88 bp promoter construct and additional constructs with sp ecific deletions of the putative HREs. Results showed that deletion of individual HREs or combinatorial deletions in two or three of the HREs all had the effect of minimizing the induction of promoter activity to around 2 fold (as compared to a >5 fold ind uction of the wild type construct). Surprisingly, none of the deletions including deletions in all three sites in combination resulted in complete loss of induction by HIF trans acting factor(s) is important in t he response of the Atp7a gene to hypoxia. We previously speculated that Sp1 or a related G/C rich binding trans acting factor could play a role in the genetic response of the intestinal epithelium to iron deprivation [ 94 101 ] Interestingly, the Atp7a promoter contains a phylogenetically conserved Sp1 binding site and it was noted that mutation of this site in the 224/+88 bp promoter construct led to a >80% decrease in promoter activity (data not shown). The role of this cis element in controlling Atp7a gene transcription will be the subject of further investigations.

PAGE 43

43 Although the HRE deletion studies described above strongly suggested that the Atp7a gene was a direct HIF target, further studies were necessary to independently confirm this observation. ChIP assays were thus performed utilizing a well characterized H IF cross linked DNA/protein isolated from control and CoCl 2 treated cells. Results showed a substantial increase in Atp7a promoter sequences containing the HREs with CoCl 2 exposure, while an upstream promoter region that did not contain the HREs was not dete cted in either condition. Dmt1 and Ankrd37 two known hypoxia responsive genes, were utilized as positive controls. These data demonstrate that Atp7a is indeed a direct H IF The last set of experiments was designed to address the issue of the potential physiological significance of the results reported in this manuscript. If the induction of Atp7a gene expression by H IF that 1) increased Atp7a mRNA expression would translate into increased protein levels, and 2) that the H IF 6 cells during hypoxia also resulting in increased protein levels. Well established Atp7a [ 76 86 ] an tibodies were thus utilized to perform immunoblots of proteins isolated from control, CoCl 2 treated and hypoxia exposed cells. In both cases (hypoxia and CoCl 2 ), Atp7a and protein levels increased 4 6 fold as compared to untreated cells grown under n ormoxic conditions (Figure 3 7). These observations suggest that the induction of these genes during hypoxia is indeed of physiological relevance. It is intriguing to note coordinate regulation of Dmt1 Dcytb Fpn1 and Atp7a gene transcription by H IF intestinal epithelial cells, representing iron and copper homeostasis related genes. It has been previously suggested that alterations in copper

PAGE 44

44 levels during iron deficiency may be part of the compensatory physiological response to iron deprivation [ 91 ] Induction of Atp7a under these conditions, by a con served regulatory mechanism of proven significance provides impetus for further consideration of this potential role for copper. As copper increases in the intestinal epithelium during iron deficiency and metallothionien is induced [ 68 ] it is tempting to speculate Atp7a induction could play a role in cellular physiology of enterocytes. There is a documented increase in the production of reactive oxygen species (ROS) in mitochondr ia with CoCl 2 exposure and hypoxia [ 102 103 ] and copper may contribute to the production of ROS [ 104 ] It is thus possible that Atp7a may play an essential role to protect cells from the enhancement in membrane lipid peroxidation, DNA damage and protein oxidation by ROS in the setting of iron deprivation when copper levels increase. This would be mediated by the copper efflux role for Atp7a in intestinal epitheli al cells, which could partially mitigate ROS generation.

PAGE 45

45 Table 2 1 Primer List Construct Primer Sequence 2995/+88 Fwd 5' AATAGGTACCCTGGCTGTCC TGAAACTC 3' 976/+88 Fwd 5' AGCAGGTACCAGGGATGGAGTTCAGGTC 3' 754/+88 Fwd 5' AGAGCGGTACCACGAGTAGGTAGTGCC TTG 3' 476/+88 Fwd 5' ACCAGGTACCGCAACAAACCACGATGT 3' 224/+88 Fwd 5' TATAGGTACCCACCTTGGCCGAGGATG C 3' 194/+88 Fwd 5' AAAAGGTACCAGGGGGCGCACGGAG 3' 182/+88 Fwd 5' AAAAGGTACCGGAGCTTTGGGCG 160/+88 Fwd 5' AACGGGTACCTTTCACGTGACGTGG 3' 144/+88 Fwd 5' AAAGGTACCATTTCCCTAGTCGGCCCAG 3' 113/+88 Fwd 5' AGTAGGTACCCTGGCATCACCCGGAG 3' 88/+88 Fwd 5' ATTAGGTACCTCAGAGGCGGGCGGGGCGAA 3' 57/+88 Fwd 5' ATTAGGTACCTGGGGAGGTTGGGGCT 3' 15/+88 Fwd 5' AAAAGGTACCTCCGCCTGCGCCTAGACTC 3' Rev 5' ATTAGATATCCAGGGCTGGGGTTCGAGC 3' CACCAGGGGGCGCACG CATGCATCCTCGGCCAAGG ACGTGGACCATTTCCCTAGTCGG TGAAAGGGAGCGCGCG GACCATTTCCCTAGTCGGCCC TCACGTGAAAGGGAGCGCG Primer Name qRT PCR 18S Fwd TCCAAGGAAGGCAGCAGGC 18S Rev TACCTGGTTGATCCTGCCA Atp7a Comm Fwd TGAACAGTCATCACCTTCATCGTC Atp7a Comm Rev TGCATCTTGTTGGACTCCTGAAAG Primer Name ChIP Assay Atp7a Fwd TGCTAGGGCCTAACCCACCTTG Atp7a Rev AAGCTGGGCCGACTAGGGAAAT Ankrd37 Fwd CTTGCAGACAGAAGCCCCAGTACA Ankrd37 Rev GGTTGATATCCTGGCCTTTGAGCT Dmt1 Fwd CTCTGCTTTGAAGTCTCCTAGTCC Dmt1 Rev TGAGATTTCATTTATGTGCCATTC Negative Control Fwd AGCCTGGCTTTGATGGATGATTTT Negative Control Rev TTTAGTCACCTCCCAACTCCAGGAAT

PAGE 46

46 Figure 2 1 Real time quantitative RT PCR (qRT PCR) analysis of Atp7a mRNA expression in rat intestinal epithelial (IEC 6) cells Total RNA was extracted from IEC 6 cells that were treated with CoCl 2 (A) or cultured in 1% O 2 (B). Atp7aexpression was normalized to 18S. Similar experiments were mL ) pretreatment 1 h before and duri ng CoCl 2 treatment (A). Each bar represents the mean value SD. *P < 0.05, #P < 0.05, as compared with control, unpaired Student's t test; n = 5.

PAGE 47

47 Figure 2 2 Analysis of rat Atp7a promoter transcriptional activity. Firefly luciferase (Luc) reporter vec tors with various length Atp7a promoter fragments were constructed as described in MATERIALS AND METHODS. Each construct was transiently transfected into IEC 6 cells that were preseeded into 24 well plates at was used as a control. Twenty four hours after transfection, firefly and Renilla luciferase activity was measured by a Dual Luciferase Assay System; firefly luciferase activity was normalized by Renilla luciferase activity. Each bar represents the mean val ue SD. Different letters next to bars indicate statistical significance (P < 0.05), between constructs, unpaired Student's t test; n = 3.

PAGE 48

48 Figure 2 3 response elements (HREs ). construct were made as described in MATERIALS AND METHODS. All of the constructs were transfected into preconfluent IEC 6 cells, followed by CoCl2 SD. *P < 0.05, +CoCl 2 2 for each construct, unpaired Student's t test; n = 3. B: sequence of the Atp7a endmost base of the different deletion constructs is shown.

PAGE 49

49 Figure 2 4 inducible factor (HIF) expression vectors luciferase activity was deter mined. four hours after transfection, cells were treated with CoCl 2 O 2 Each bar represents the mean value SD. In A and B, dif ferent letters above bars indicate statistical significance (P < 0.05), between transfection or treatment conditions, unpaired Student's t test; n = 3.

PAGE 50

50 Figure 2 5 Deletion analysis of the putative HREs. construct were indi vidually deleted or deleted in combination. Wild type (WT) or deleted expression plasmid (or empty vector) into IEC 6 cells. Constructs are shown schematically in A, while luciferase assay results are shown in B. Each bar represents the mean value SD. Different letters above bars indicate statistical significance (P < 0.05), unpaired Student's t test; n = 3.

PAGE 51

51 Figure 2 6 HREs in the rat Atp7apromoter DNA fragments containing cross linked 6 cell nuclear extracts prepared from control (untreated) or CoCl 2 treated cells. Primers were used to amplify the region of Atp7a containing the HREs [Atp7a (+) HRE] transporter 1 (Dmt1) and ankyrin repeat domain protein 37 (Ankrd37) were utilized as positive controls. Input indicates amplification from DNA bef ore pull down with the antibody using Atp7a primers covering the putative HREs. Input samples were also run for all other primer sets, and identical results were obtained (data not shown). Data from two independent experiments are shown.

PAGE 52

52 Figure 2 7 and B) and Atp7a (C and D) protein expression in hypoxia and CoCl 2 treated IEC 6 cells Eighty percent preconfluent IEC 6 cells were treated with CoCl 2 2 or cultured in normoxia (21% O 2 ; control). (including membrane for Atp7a) proteins were extracted and resolved by 7% SDS PAGE, and blots were reacted with specific antibodies against these proteins. Images shown are from one representative experiment. Quantitative data from three independent experiments are shown below each representative blot. ***P < 0.05.

PAGE 53

53 CHAPTER 3 MEDIATE TRANSCRIPTIONAL INDUCTION OF ATP7A DURING HYPOXIA Summary Genes with GC rich promoters were preferentially induced in the rat duodenal epithelium during iron deficiency, including those encoding iron (e.g. Dmt1 and Dcytb ) and copper (e.g. Atp7a and Mt1 ) homeostasis related genes We previously demonstrated that Atp7a was co regulated with iron transport In this study, we sought to test the role of Sp1 in transcriptional regulation of Atp7a as phylogenetic footprinting revealed conserved GC transcriptional start site. In itial studies in IEC 6 cells showed that an Sp1 inhibitor (mithramycin) reduced expression of endogenous Atp7a and iron transport related genes, and also blocked their induction by the CoCl 2 mimetic hypoxia. Moreover, overexpression of Sp1 increased endoge nous Atp7a mRNA and protein expression, and also Atp7a, Dmt1, and Dcytb promoter activity. Site directed mutagenesis of a basal Atp7a promoter construct revealed several functional Sp1 binding sites, which mediated induction of pro moter activity. Furthermore, chromatin immunoprecipitation (ChIP) assays confirmed that Sp1 specifically interacts with the Atp7a promoter and this interaction was blocked by mithramycin treatment. Furthermore, to determine the physiologic relevance of the se observations, studies were performed in a rat model of iron deficiency. ChIP experiments confirmed that the Atp7a investigation has thus revealed a novel aspect of hypoxia relate d gene expression in the mammalian intestine in which Sp1 is necessary for the HIF mediated induction of

PAGE 54

54 gene expression during iron deficiency. This regulatory mechanism may have broader implications for understanding the genetic response to intestinal hy poxia. Background Iron is essential for life, as it plays important roles in biological systems ; it is involved in such processes as electron transport, enzyme activity, oxygen transport, and gene regulation [ 1 ] Systemic iron level s are maintained by intestinal absorption, which is precisely controlled, as there is no regulated excretory mechanism in mammals Thus, precise and soph isticated regulatory mechanisms have evolved to control iron absorption in duodenal enterocytes to maintain appropriate cellular iron level s and to avoid iron overload [ 14 ] The absorption process is regulated coordinately via signals derived from different organs involved in iron transport, utilization, and storage. Intestinal iron absorption is mediated first via redu ction of dietary ferric iron by duodenal cytochrome c reductase (Dcytb) [ 21 23 105 ] and transport of ferrous iron by divalent metal transporter (Dmt1) [ 24 27 42 ] located on the apical surface of enterocytes. Newly absorbed iron is exported by ferr o portin 1 (Fpn1) [ 30 31 49 ] on the basolateral side of enterocytes, followed by oxidizatio n by hephaestin (Heph) [ 33 ] expressed in enterocytes and /or ceruloplasmin (Cp) [ 106 107 ] synthesized and released from hepatocytes in to blo od. I ron absorption is induced during iron deprivation reflected by the increased expression of iron transport related genes including Dmt1, Dcytb, and Fpn1 in duodenal enterocytes [ 85 ] Studies found that the copper transporter (Menkes copper ATPase; Atp7a) located on the basolateral surface of enterocytes was also upregulated during iron deficiency, and increased copper concentration s were noted in enterocytes, liver, and serum of iron deficient rats [ 85 86 ] In enterocyt es, Atp7a expression paralleled

PAGE 55

55 that of iron transport related genes, suggesting that a copper dependent mechanism was activated in response to low iron levels to increase iron absorption via increased activity of copper dependent enzymes (Heph and Cp) [ 81 ] Low body iron stor es activate intestinal iron absorption via physiological signals to increase iron uptake from dietary sources. In response to low tissue iron levels some iron transport related genes are regulated via a post transcriptional mechanism. Iron response elements (IREs), which are short conserved stem loop s are found in either ( TfR1 [ 108 ] Fpn1 [ 31 ] (Dmt1 [ 42 ] ferritin [ 109 ] ) of untranslated region s (UTR s ) o f these mRNA molecules. IREs are bound by the iron re gulatory proteins (IRPs) in the cytosol of cells IRP binding to IREs increase s mRNA stability or block s translation of target genes [ 41 43 ] I UTR, IRP binding increase s transcript stability, leading to accumulation of Dmt1 protein on the apical side of enterocytes t o increase iron uptake during iron deficiency. Other genes including Fpn1 and TfR 1, have IREs in the UTR where IRP binding block s translation. Although some key iron related genes are regulated by the IRP/IRE mediated regulatory mechanism, other genes related to iron homeostasis d o not have IREs (e.g. Dcytb hephaestin) Moreover, the downregulation of Fpn1 via the IRP/IRE mediated post transcriptional mechanism conflicts with the overall concept to increase systemic iron levels through duodenal enteroc ytes during iron deficiency Thus, there must be some additional regulatory mechanisms involved in maintaining systemic iron homeostasis. Resent studies have demonstrated that low body iron store s (and hemoglobin in red blood cells) result in systemic hypoxia, leading to stabilization of hypoxia inducible

PAGE 56

5 6 trans acting HIF subunits translocate to the nucleus and dimerize with a subunit to form the functional HIF complex, which binds to HREs on gene p romoter s with additional recruitment of co [ 110 112 ] Intestinal related genes iron levels [ 45 47 ] In previous work, we reported that Atp7a is also upregulated by 6 cells via CoCl 2 mimetic hypoxia [ 113 ] It was speculated that the HIF mediated upregulation of Atp7a in enterocytes during iron deficiency to increase body copper concentration to induce the copper dependent ferroxidase activity as a secondary mechanism to increase iron absorption during low body iron storage. In additio n to HREs found on the promoter of iron transport genes (e.g. Dmt1 Dcyt B and Fpn1 ) for a mediated regulatory mechanism, it was noted that these genes that were highly induced in rat intestinal epithelium during iron deficiency also contain evolutio nary conserved GC rich sequences [ 87 ] The Atp7a gene was strongly induced during iron deficiency and also co regulated with ir on transport related genes Atp7a gene has GC rich sequences promoter, especially in the proximal region to the transcriptional initiation sites, where HREs were found. Thus, in the current study, we sought to tes t the role of Sp1 involved mediated induction of Atp7a. This hypothesis is derived from the observation that gene promoter s enrich of GC rich sequences. Atp7a encodes a copper tran sporter protein, which is located on basolateral surface of enterocytes. Its induction during iron deficiency

PAGE 57

57 provides a potential interface between iron and copper. An i nitial observation made in IEC 6 cells showed that an Sp1 inhibitor (mithramycin) redu ced expression of endogenous Atp7a and iron transport related genes, and also blocked their induction by the CoCl 2 mimetic hypoxia Moreover, Sp1 overexpression robustly increased Atp7a mRNA and protein expression, and also Atp7a, Dmt1, and Dcytb promoter activity in IEC 6 cells. Phylogenetic foodprinting indicated that several evolutional ly conserved putative Sp1 binding sites were found on Atp7a promoter in rats and mice, and Chromosome Immunoprecipitation (ChIP) assay suggested that the induction of Atp7 a was mediated via a direct binding of Sp1 on the promoter and mithramycin decreased the Sp1 binding to promoter. Furthermore, to determine the physiological relevance of these observations, the in vivo rat model on iron deficient diet was used. ChIP exper iment confirmed both mediated induction of gene expression to increase iron absorption during iron deficiency. Method s Cell Culture : Rat intestinal epithelial (IEC 6) cells were obtained from the American Type Culture Collection (ATCC ; Manassas, VA) and cultured according to the manufacture r and as described previously [ 113 114 ] For hypoxia exp eriment s 85% pre confluent IEC 6 cells were cultured in a hypoxia chamber with 1% O 2 and 5% CO 2 (with the balance being nitrogen) To mimic hypoxia, 2 was used to treat I EC 6 cells at 85% confluence for 60 hours. To interrupt Sp1 binding, IEC 6 cells were treated with mithramycin (a specific Sp1 inhibitor) at various concentration s at 7 days post confluence for 24 hours.

PAGE 58

58 Animals and Diets : Wean l ing Sprague Dawley rats (male) were purchased from Harlan, raised in overhanging, wire mesh bottomed cages under 12 hour light/dark cycle and sacrificed at 10 am. A t otal of 12 rats were used for this study. Rats were split into two diets group and fed A IN 93G based diets (Dyets, Bethlehem, PA), including a control diet (Ctrl) containing 198 ppm iron and an iron deficien t diet (FeD) containing 3 ppm iron for five weeks. The diets were otherwise identical. A nimal body weight s was measured week ly At the end of the feeding regime, each rat was anesthetized by CO 2 exposure and killed by cervical dislocation. Blood was collected by cardiac puncture and transferred to a 1 mL tube. Hemoglobin and hematocrit were measured by routine methods The d uodenum was excise d a nd inverted on a wooden stick followed with isolating enterocytes using well established, previously published methods [ 81 84 ] Duodenal enterocytes were used for mRNA isolation, western blot analysis and chromatin immunoprecipitation experiments as described in Methods All animal studies were approved by Institutional Animal Care and Use Committee (IACUC) at the University of Florida. RNA Isolation and Real Time Quan titative RT PCR : Total RNA was isolated from IEC 6 cells or duodenal enterocytes by TRIzol (Life Technologies, Grand Island, NY), according to the manufacture r and as described before [ 113 ] RNA concentration was measured by spectrophotometer y reverse transcribed using the iScript cDNA Synthesis Kit (Bio Rad, Hercules, CA) in a 20 reaction. After reverse transcription, the 20 reaction was diluted to 120 with nuclease free water, and 3 was utilized for qRT PCR reaction s with SYBR Gr een PCR Master Mix (Bio Rad). Primers were designed to span large introns to avoid

PAGE 59

59 amplification from genomic DNA. Furthermore, standard curve reactions were run in pilot experiments to validate each primer pair; linear amplification was documented over a range of template concentrations for each primer set prior to experiments being performed. Expression of e xperimental gene s was normalized to the expression of 18S rRNA Primer s equence s are listed in the S upplementary T able. Plasmid Construction : The r at Sp1 open reading frame (ORF) was cloned by PCR from cDNA derived from IEC 6 cells using Phusion High Fidelity DNA Polymerase (Fermentas, Waltham, MA). The forward primer contained the translational start codon and the reverse primer he translation stop codon P rimers were designed with overhanging Kpn I (Forward) and EcoR V (Reverse) restriction enzyme cutting sites. PCR amplified Sp1 ORF and pcDNA 3.1 vector were double digested with Kpn I and EcoR V, followed by column purification. Sp1 ORF was sub cloned into double digested pcDNA 3.1 with LigaFast Rapid DNA Ligation System (Promega). An HA tag was inserted o nto the end of Sp1 ORF by PCR amplifying the entire pcDNA Sp1 plasmid with primers containing the HA sequence. P rimers wer e designed with the forward primer at the end of Sp1 ORF without a stop codon, and reverse primer at the EcoR V site on the pcDNA 3.1 vector. Each primer contained half of the HA tag sequence end of each primer was phosphorylated. Atp7a promoter constructs with mutation s in putative Sp1 binding site s were prepared by PCR amplifying the entire wild type ( WT ) 224/+88 bp promoter construct with QuickChange Lightning Site Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) usin g primers with mutation s in putative Sp1 binding site s, going in opposite direction s PCR products w ere digested with Dpn I restriction enzyme (Agilent

PAGE 60

60 Technologies) to remove the template DNA. All DNa constructs were sequenced by the DNA Sequencing Core i n ICBR at the University of Florida to confirm that amplicons did not contain mutations Primer s equence s are listed in Supplementary Table 3 1 Transfection and Luciferase Assay : Atp7a WT or mutated promoter construct s ( ) were transient ly transfecte d to IEC 6 cells at ~60% confluence and cultured in 24 well plate s s construct ( WT or mutated) was co overexpression vector. pRL CMV plasmid ex pressing Renil la luciferase was used to normalize expression of firefly luciferase driven by experimental promoter s 36 hours after transfection, luciferase activity was measured with the Dual Luciferase Reporter Assay System (Promega, Madison, WI) according to the manufacture r Stable Sp1 Overexpression : IEC 6 cells in 6 well plate s were transfected with pcDNA 3.1 (empty vector ) or pcDNA Sp1 HA vector with TurboFect in vitro Transfection Kit (Fermentas). 60 hours after transfection, IEC 6 cells were treated with G418 ( at a predetermined concentration ) to kill n on transfected cells allowing transfected cells expressing the Neomycin gene in pcDNA 3.1 or pcDNA Sp1 HA vector s to survive. The selected IEC 6 cells with stable expression of Sp1 were used to analyze Atp7a and Sp1 mRNA expression using qRT PCR and protein expression by western blot ting Protein Isolation and Western Blot Analysis : Total cytosolic and nuclear protein was isolated f rom IEC 6 cells cultured in 10 cm cell culture dish es as described previously [ 114 ] Briefly cells were washed 3 times with ice cold PBS (pH 7.4) and harvested with a cell scraper. Cells were lysed using a hypotonic buffer (Active Motif ;

PAGE 61

61 Carlsbad, CA) and a tissue homogenizer and membrane bound protein s w ere solubilized with NP 50 (0.0 5 %), followed by centrifuging at 16000 rpm for 1 minute. The nuclear pellet was resuspended with nuclear lysis buffer (Piercenet, Rockland, IL), and incuba ted on ice for 30 minutes, followed by 30 seconds of vortexing e very ten minutes. Nuclear lysate was collected by centrifugation at 16000 rpm in a microcentrifuge for 15 minutes, and the supernatant was collected. Cytosolic and n uclear protein concentratio n s were determined with BCA Protein Assay (Piercenet Rockford, IL ). 30 cytosolic and s were resolved on 7.5% SDS PAGE gels followed with transfer to PVDF membrane s The membrane was blo cked with 5% non fat milk and then incubated with anti Atp7a (54 10 as characterized before), anti Sp1 ( Millipore, Temecula, CA ) or and anti phophorylated Sp1 (Abcam, Cambridge, MA) primary antibod ies followed by an anti rabbit secondary antibody. Antibody binding was visualized using home made ECL r eagent as described before [ 81 ] followed by exposure to X ray film. For some experiments, protein expression was normalized to the total protein s on stained blots Protein expression was normalized to total Sp1 for the phosphorylation of Sp1. Chromatin Immunoprecipitation (ChIP) Assay : Chromatin Immunoprecipitation (ChIP) assay was performed as described and published before [ 113 ] Briefly, IEC 6 cells or rat duodenal enterocy tes were cross linked with 1.1% chloroform f or 10 minutes, followed with quenching with 0.3 M glycine IEC 6 cells or enterocytes were lysed wit h hypotonic buffer (Active Motif) and homogenize d Nucle i w ere collected and resuspended in nuclear lysis buffer followed by sonication with a BioRuptor for 30 cycles with 30 seconds on and 30 seconds off. The target DNA with

PAGE 62

62 bound protein was pulled down with Sp1 or were analyzed by PCR with primer set s list ed in Su pplementary T able. Statistical Analysis : ANOVA ( Tukey: compared all pairs of columns) and paired student t test (Graphpad La Jolla, CA ) w ere used to statistically compare data across groups. p<0.05 was considered statistically significant. Results Mithramycin Selectively In hibits Sp1 Mediated Transcriptional Regulation : E ndogenous Atp7a expression in 7 da y s post confluent IEC 6 cells was analyzed by qRT PCR with mithramycin for 24 hours treatment at various concentration s C oncentration s of mithramycin from 100 1000 nM did n ot cause significant cellular stress as determined by microscop ic observation. Mithramycin at 100 nM started to reduce Atp7a mRNA expression ~50% in IEC 6 cells. Higher concentration s led to further reduction o f Atp7a expression ( e.g. 500 nM caused > 70% r eduction). C oncentration s between 700 and 1000 nM did not cause further reduction s i n Atp7a mRNA level (Figure 3 1A). The iron transport related genes including Dmt1, Dcytb, and Fpn1 also have GC rich promoter sequences as shown by previous microarray studies [ 87 ] The mRNA level s of these genes also decreased a s m ithramycin concen tration increased (Figure 3 1B, C and D). Ankyrin repeat domain 37 (Ankrd37) which also has a GC rich promoter expression and is a known HIF target [ 95 ] also showed a decreasing expression patte rn with m ithramycin treatment (Figure 3 Sp1 were selected as positive control gene s as it was reported that Sp1 regulate s both at the mRNA level via direct DNA binding (Figure 3 1F and G). Sp6 and TfR were selected as negative control (Figure 3 1H and I).

PAGE 63

63 Selective Inhibition of Sp1 Blocked Hypoxia Mediated Induction : Iron transport related genes including Dmt1 Dcytb and Fpn1 duodenal enterocytes during iron de ficiency. In a previous study, we proved that Atp7a was upregulated by the hypoxia mimic CoCl 2 promoter [ 113 ] In IEC 6 cells, the combination of CoCl 2 and mithramycin was utilized to mediated induction o f endogenous Atp7a expression. 7 day s post confluent IEC 6 cells were treated with CoCl 2 for 60 hours as described in a previous study [ 113 ] 36 hours after CoCl 2 treatment, 500 nM mithramycin was added to cells with and without CoCl 2 treatment. 24 hours later, mRNA expression level s w ere analy zed by qRT PCR. CoCl 2 robustly increased Atp7a, Dmt1, Dcyt b and Fpn1 mRNA expression levels, and mithramycin treatment led to a reduction i n transcript level s consistent with observation s shown in Figure 3 1 For the combination of CoCl 2 and mithramycin mediated induction of Atp7a and iron transport genes was blocked by mithramycin treatment possibly via the interruption of Sp1 binding to the promoter. Additional experiments were performed in the expression of Ankrd37, and VEGF for combi n ed of CoCl 2 and mithramycin treatment Several previous studies indicated that Ankrd37 and VEGF are regulated by HIF1 and [ 47 95 115 116 ] Here, we shown that even though mithramycin treatment inhibited Sp1 binding blocking mediated effect, the expression was still induced with th e hypoxia mimic CoCl 2 (Figure 3 2) This induction may thus be exerted by a HIF1 mediated mechanism Regulation of Atp7a Expression by Sp1 : We have shown that inhibition of Sp1 DNA binding block s target gene expression. Sp1 binding was necessary and required for mediated induction of Atp7a expression T o recapitulate the Sp1 mediated

PAGE 64

64 regulatory mechanism on induction of Atp7a in response to iron deficiency, IEC 6 cells were transfected with HA tagged Sp1 expression vector. qRT PCR and western blot confirmed the overexpression of Sp1 in IEC 6 cells (Figure 3 3 A and C) and also demonstrated that both Atp7a mRNA and protein were induced in IEC 6 cells by Sp1 overexpression (Figure 3 3 B, D, and E ). Since endogenous Atp7a expression was induced in IEC 6 cells by Sp1 overexpression the effect of Sp1 overexpression on promoter activity was tested Sp1 overexpression resulted in an induction o f Atp7a promoter activity (~2.5 fold; Figure 3 3F ). P revio us microarray analysis show ed that iron transport related genes contained GC rich sequences on the promoter and that sequence s were highly conserved between mouse and rat [ 113 ] Therefore, mouse Dmt1 and Dcytb promoter constructs l ab at the University of Michigan, Ann Arbor MI ) were co transfected with Sp1 expression vector. Dmt1 (~5 fold; Figure 3 3G ) and Dcytb (~4 fold; Figure 3 3H ) promoter activity w as induced in IEC 6 cells with Sp1 overexpression Sp1 Regulated Atp7a Expression Via Direct Binding to the Promo ter : It has been shown that in IEC 6 cells, Sp1 robustly increased endogenous Atp7a expression and promoter activity, and that of iron transport related gene s Therefore, to delve into mechanistic aspect s of Sp1 mediated induction, the 224/+88 bp Atp7a promoter bearing basal transcriptional activity as described before [ 113 ] was analyzed. P hylogenetic footprinting analysis across species (human, rat, mouse) has shown multiple GC rich sequences in this promoter region (data not shown). TFSEARCH ( http://www.cbrc.jp/research/db/TFSEARCH.html ) was thus utilized to predict putative Sp1 binding site s Four evolutionarily conserved putative Sp1 binding sites across species

PAGE 65

65 were identified in the region of 224/+88 bp (Figure 3 4A) Promoter constructs with mutation of the putative Sp1 binding site s were generated. Constructs with multiple mutations were generated by introducing subsequent mutations Either WT or mutated promoter constructs were transient ly transfected in to IEC 6 cells, and promoter activity was analyzed. Single site mutation s of sites 2 and 3 led to ~50% reduction o f promoter activity. Mutation s of site s 1 or 4 led to ~60% and ~75% decreases in promoter activity, respectively (Figure 3 4B). Double mutation s o f sit e s 2 and 3 reduced promoter activity to 70% of WT It is surpris ing to note that mutation s of both site 1 and 4 brought promoter activity down to the background level (Figure 3 4C). However, triple mutation (site s 1 & 2 & 3 and site s 2 & 3 & 4) and quadrup le mutation s on all four putative Sp1 binding sites led to only 70% reduction o f Atp7a promoter activity. Sp1 Regulated Atp7a Expression ByDirect Binding to Promoter Cis Elements: F our evolutionarily conserved putative Sp1 binding sites across species wer e identified on the Atp7a promoter, and the site specific mutation s affected Atp7a basal promoter activity. Thus, to prove Sp1 mediated regulation via d irect binding to the p romoter, the chromatin immunoprecipitation (ChIP) assays were performed with cross linked, soluble chromatin isolated from IEC 6 cells. With an established sonication protocol, ~200 bp DNA fragment s were generated ( Figure 3 5 C ) Target fragments were pulled down by ChIP grade Sp1 specific antibody. PCR was subsequently performed on DNA samples with three separate primer sets, target ing the putative Sp1 binding site s, with 100 bp flanking region s between forward and reverse primer (Figure 3 5A). The predicted putative Sp1 binding site s were all successfully PCR amplified (Figure 3 5 D ), while there was no noticeable amplification using primers targeting upstream or

PAGE 66

66 downstream region s with no predicted Sp1 binding site s (Figure 3 5B and D ). To confirm the effect of mithramycin treatment to inhibit Sp1 binding, WT Atp7a promoter transfec ted IEC 6 cells were treated with increas ing concentration s of mithramycin. As the concentration of mithramycin increased, promoter activity decreased progressively (Figure 3 5 E ). Additional ChIP assay experiments were performed with s amples from mithramyc in treated IEC 6 cells. Primers targeting the region containing four Sp1 binding sites were used. PCR amplification suggested that mithramycin treatment of IEC 6 cells resulted in a significant reduction i n DNA amplifi cation from the mithramycin treated sa mples as compared to i nput DNA (Figure 3 5 F ). This demonstrated the effect of mithramycin to be able to inhibit Sp1 binding to the Atp7a promoter. Mediated Upregulation of Atp7a Expression : Previously, we reported that the Atp7a IEC 6 cells with CoCl 2 treatment which recapitulate s the iron deficiency induced hypoxia seen in rat small intestine. Thus, we used this cell line to further elucidate the cis mediated upregulation of Atp7a expression. The co transfection experiment with Atp7a promoter (w ith or w ithout mutati on o f the Sp1 C o transfection resulted in an induction of WT Atp7a promoter activity with fold induction; Figure 3 6A) or Sp1 (~3 fold induction; Figure 3 6A). Next the promoter bearing individual, or combination s of two, three or four mutations was co f Sp1 binding site s resulted in decrease d or Sp1.

PAGE 67

67 Compared to WT promote r activity, single mutation only led to a slight decrease o f promoter activity with Sp1 overexpression ( ~25% reduction). ~50% reduction o f Atp7a 3 6B, C, D, and E). Double mutation s either o f site s 1 mediated induction o f Atp7a promoter activity completely, while only mutation o f site s 2 & 3 blocked Sp1 mediated induction (Figure 6F & G). Triple mutation s o f the Atp7a promoter caused further decrease s of HIF2 and Sp1 (~50%) mediated induction (Figure 6H & I). Mutation on all four Sp1 binding sites blocked the induction of promoter activity 3 6J). HIF Regulated Gene Expression Via Direct Binding to the Promoter In Vivo : To recapitulate the in vitro observation s in an in vivo setting SD rats were placed on specialized diets (Control: Ctrl or Iron deficient: FeD) for 5 weeks. Body weight was measured each week for each of the five weeks when they consumed the s pecial diets. The growth rate of iron deficient rats started to decrease at the third week (Figure 3 7A). At the end of the fifth week, all rats were sacrificed, and hemoglobin and hematocrit levels were measured. H emoglobin and hematocrit level s decreased ~75% for FeD diet fed rats (Figure 3 7B & C). In response to iron deficiency, Dmt1, Dcytb, and Atp7a expression w as induced in duodenal enterocytes (Figure 3 7D, E, F, & H). Ceruloplasmin (Cp) is a ferroxidase protein synthesized and released from liver to bloo d to oxidize ferrous iron for release from various organs. Cp protein level in blood i ncreased ~1.5 fold in iron deficient rats (Figure 3 7G) consistent with our previous study [ 81 ] In duodenal enterocytes of iron (Figure 3

PAGE 68

68 via direct binding to the Atp7a promoter as shown in ChIP results (Figure 3 7J). ChIP assays a lso confirmed the direct binding of Sp1 to the Atp7a promoter in vivo Figure 3 7K). Discussion The perturbation of iron and copper level s in the intestinal epithelium was associated with the upregulation of the Atp7a gene [ 85 86 ] Atp7a expression in enterocytes parallels that of iron transport related genes. However, the regulatory mechanism of Atp7a gene regulation was unclear. To determine the molecular mechanisms of this induction, an established cell culture model of mammalian intestinal epithelium was utilized. A recent investigation noted that Atp7a is co regulated with iron transport ciency [ 113 ] Furthermore, we f ound that genes with GC rich sequences promoter were strongly induced in rat duodenal enterocytes during iron deficiency [ 87 ] This included a copper transporter ( Atp7a ) and iron transport related genes (e.g. Dmt1 and Dcytb ) [ 87 ] This seemed more plausible, given that the GC rich sequence binding protein s ( e.g. Sp1 like factors) may be invol ved in regulation of gene expression in duodenal enterocytes. In the current study we sought to test the role of Sp1 in transcriptional regulation of Atp7a in the intestinal epithelium during hypoxia Accordingly, we used a well characterized anti tumor drug (mithramycin), which selectively inhibits Sp1 binding to DNA to block Sp1 mediated transcriptional regulation [ 117 119 ] C oncentration s of mithramycin ranging from 100 to 1000 nM progressively decreased Atp7a, Dmt1, Dcytb, Fpn1, Ankrd37, Sp1 and HIF2 mRNA expression C oncentration s of mithramycin >5 00 nM had no additional effect on mRNA expression.

PAGE 69

69 This may be due to cel lular tolerance or some protective mechanisms activated at higher concentrations for non tumor cells. Studies have demonstrated that in various tissues both the Sp1 and gene s have functional Sp1 binding site s and that mutation of putative Sp1 binding site s blocked mRNA expression [ 120 121 ] Furthermore, we sought to understand whether Sp1 binding was necessary for HIF2 mediated induction, as phylogenetic footprinting showed that conserved HREs and GC rich seque nces were located in the proximal region of 224 bp upstream of the transcriptional initiation site IEC 6 cells were treated with CoCl 2 and/or mithramycin. CoCl 2 mim ics hypoxia and can thus stabilize the HIF1 and HIF2 protein s; h owever, in the intestinal epithelium, it was demonstrated that HIF2 ( not HIF1 ) upregulate s gene expression (e.g. Atp7a Dmt1 Dcytb and Fpn1 ) during iron deficiency [ 45 47 113 ] Here, our results suggested that inhibition of Sp1 binding by 500 nM mithramycin blocked the bin ding did not affect VEGF and Ankrd37 induction by CoCl 2 because an upregulate their expression [ 47 95 115 116 ] These observations suggested that Sp1 may be involved in the regulation of expression of target genes with GC rich sequences promoter induced during iron deficiency/hypoxia and Sp1 involvement may be necessary for mediated induction. Additio nal experiments were thus designed to delve into the mechanistic aspects of Sp1 mediated induction. To recapitulate Sp1 mediated upregulation, a n Sp1 overexpression system was established to access the role of Sp1 in endogenous Atp7a expression and promote r activity. Stable expression of Sp1 in IEC 6 cells induced both Atp7a mRNA and protein expression. Sp1 overexpression also induced the promoter activity of Atp7a, Dmt1, and

PAGE 70

70 Dcytb. Further investigation looking into t he putative binding sites was performed by introducing mutation s in to the predicted Sp1 binding sites. To understand whether the predicted binding site s were essential for Atp7a basal promoter activity and Sp1 mediated induction, mutated promoter constructs were generated. Mutation analysis exp eriment s suggested that these sites were essential for basal promoter act ivity. However, why double mutation o f site 1 & 4 brought expression down to background level s while mutation s of all four sites only led to ~60% reduction o f promoter activity is un clear To prove that Sp1 regulate s Atp7a expression through a direct interaction with predicted GC rich sequences on the promoter, ChIP assays were performed utilizing a ChIP grade Sp1 specific antibody to pull down the DNA/Sp1 complex isolated from non treated IEC 6 cells. To do this, three sets of primers were designed to amplify the DNA sequence from p ull down samples with 100 bp flanking region s between forward and reverse prime r s A well established sonication protocol from previous studies generated ~200 bp DNA fragments [ 113 ] Results proved that all of these sites were important for Sp1 binding to upregulate Atp7a expression. Further experiments to explore the effect of mithramyci n interruption of Sp1 bind ing to the GC rich sequence s were performed. Atp7a promoter activity and Sp1 binding to the promoter in IEC 6 cells with mithramycin treatment were a ss essed. Atp7a promoter activity decreased progressively with increas ing concentration s of mithramycin, and ChIP results showed that mithramycin treatment in IEC 6 cells decreased Sp1 binding to the Atp7a promoter. These data demonstrated that Atp7a is a direct target of Sp1 in the intestinal epithelium.

PAGE 71

71 In a previous study, deletion of all HREs did not result in complete loss of induction by HIF2 which led to the speculation that other trans acting factors may be important for the Atp7a genomic response to hypoxia [ 113 ] In the current study, we noted multiple GC rich sequences on the Atp7a promoter and d emonstrated these Sp1 bindin g sites were functional ly mediated induction in response to iron deficiency/hypoxia. Additional experiments considered the functional roles of GC rich sequences in the Atp7a promoter in terms of Sp1 mediated transcriptional regu mediated induction. A as utilized to a ss ess the role of Sp1 binding sites by using the WT and mutated 224/+88 bp Atp7a promoter construct s Sp1 overexpression led to ~5 and ~2.5 fold induction o f Atp7a promoter activity, re spectively. Mutation o f individual Sp1 binding site s led to only a slight reduction o f promoter activity. However, double mutation o f site 2 & 3 blocked Sp1 mediated induction completely. This was reasonable because Atp7a has a TATA box less promoter ; we thus predicted that Sp1 has function in a similar role as TATA box binding protein to recruit the transcriptional initiation complex [ 122 123 ] The triple mutation progressively decreas ed the induction of promoter activity by Sp1 and mutation on all four Sp1 binding site s blocked the induction. These data suggested that all sites were functional Sp1 binding site s In terms of the effect of mediated induction, single mutation, or combination s of two, three or f our mutations on Sp1 binding site s effectively attenuated mediated induction (as compared to the induction of the WT mutation s of s ite s mediated induction.

PAGE 72

72 However, there was still a 1.5 s bearing triple mutation s (either site s 1 & 2 & 3 or 2 & 3 &4). Mutation o f four Sp1 binding mediated induction. This suggested some synergi stic mediated induction. To determine the physiologic relevance of these observations, ChIP experiments were performed in duodenal enterocytes isolated from rats fed Ctrl or FeD diets for 5 weeks after weaning At the end of fifth week, animals were sacrificed for enterocyte isolation. The iron deficient rat s showed a similar p henotype as observed in previous studies, such as slow growth rate, lower hemoglobin and hematocrit level s (ab out 25% of rat s on Ctrl diet), induction of iron transport protein e ncoding genes ( e.g. Dmt1 Dcytb Fpn ) and copper homeostasis protein encoding gene s ( e.g. Atp7a : both mRNA and protein) [ 85 ] and induction o f serum ferroxidase activity ( e.g Cp) [ 81 ] In duodenal ente but deficiency / hypoxia. Importantly, ChIP experiment s showed that Atp7a is indeed a direct deficient rats. Sp1 binding to promoter s may be enhanced by post translational modification s such as phosphorylation or acetylation. Studies indicated that phosphorylation of Sp1 could increase protein/DNA binding affinity [ 124 ] Here we report that hypoxia (1% O 2 or CoCl 2 ) increased phosphorylation of the Sp1 protein in relation to total Sp1 protein levels (Figure 3 8). Additional investigation s also suggested Sp1 may interact with for example in in ovarian clear cell carcinoma [ 125 ] and th is in tumor progression [ 126 ]

PAGE 73

73 This investigation has successfully identified the trans acting factor inv olved in in vitro model. This is what may occur to upregulate Atp7a and iron transport related genes in the rat intestinal epithelium during iron deficiency, when enterocytes iron levels are low and hypoxia occurs. It is i ntriguing that iron perturbation affected both iron homeostasis related gene expression (e.g. Dmt1, Dcytb, and Fpn1) and copper transport related gene expression (Atp7a) during iron deficiency. As GC rich promoters were preferentially induced in the intest inal epithelium during iron deficiency, it was not able that genes with such promoter sequences included the se same iron and copper homeostasis protein encoding genes. The Sp1 mediated regulatory mechanism was integral to HIF2 mediated induction most like ly functioning to i ncrease iron homeostasis related gene expression during iron deficiency and copper transport related genes as a compensatory mechanism to increase iron absorption. Therefore, this study provide s novel insight into iron deficiency/hypoxia respons ive genes in the mammalian small intestine, where Sp1 is necessary and required for the hypoxi c response. This regulatory mechanism may have broader implications for the understanding of the intestinal iron and copper homeostasis.

PAGE 74

74 Table 3 1 Primer List Primer Name qRT PCR 18s Forward 5' TCCAAGGAAGGCAGCAGGC 3' 18s Reverse 5' TACCTGGTTGATCCTGCCA 3' Atp7a Forward 5' TGAACAGTCATCACCTTCATCGTC 3' Atp7a Reverse 5' TGCATCTTGTTGGACTCCTGAAAG 3' Dmt1 Forward 5' GTGTTGGATCCTGAAGAAAAGATTCC 3' Dmt1 Reverse 5' GGGATTTTCTCATCAAAGTAGGTGGT 3' Dcytb Forward 5' AGTGCAGCAAGTTCTTGATGAAAT 3' Dcytb Reverse 5' CGTGGCAATCACTGTTCCAA 3' Fpn1 Forward 5' TCGTAGCAGGAGAAAACAGGAGC 3' Fpn1 Reverse 5' GGAACCGAATGTCATAATCTGGC 3' Ankrd37 Forward 5' TGCTGGAGACAGGAGCATCAGT 3' Ankrd37 Reverse 5' CCACCAGGAGGCTAAGGCAC 5' GCGACAATGACAGCTGACAAGG 3' 5' CCTCCAAGGCTTTCAGGTACAAGT 3' Sp1 Forward 5' CCAGACCATTAACCTCAGTGCATTG 3' Sp1 Reverse 5' CCCTCACTGTCTTTACAATAGGGGC 3' Sp6 Forward 5' TGTGCTACCAAGACAACCTT 3' Sp6 Reverse 5' AAGTGGGTTCACAGCAGTT 3' TfR Forward 5' ATTGCGGACTGAGGAGGTGC 3' TfR Reverse 5' CCATCATTCTCAGTTGTACAAGGGAG 3' VEGF Forward 5' ACTGCTGTACCTCCACCATGCC 3' VEGF Reverse 5' CTTTCTGCTCCCCTTCTGTCGT 3' Primer Name Promoter construct with mutation on Sp1 binding site Site 1 Forward TGCGTGCACCAGGGGAAAACACGGAGCTTTGGGC 3' Site 1 Reverse 5' GCCCAAAGCTCCGTGTTTTCCCCTGGTGCACGCA 3' Site 2 Forward 5' GGGGGGCCTCAGAGATAGGCGGGGCGAACGC 3' Site 2 Reverse 5' GCGTTCGCCCCGCCTATCTCTGAGGCCCCCC 3' Site 3 Forward 5' GGGCCTCAGAGGCGGATAGGGCGAACGCTGTGG 3' Site 3 Reverse CCACAGCGTTCGCCCTATCCGCCTCTGAGGCCC Site 4 Forward 5' GCTGGTTGATCGCTGCTATCCTACGGAGCTCCG AG 3' Site 4 Reverse CTCGGAGCTCCGTAGGATAGCAGCGATCAACCAGC Site 2 & 3 Forawrd 5' GTGGGGGGCCTCAGAGTACGTACGGGCGAACGCTGTG GGC 3' Site 2 & 3 Reverse 5' GCCCACAGCGTTCGCCCGTACGTACTCTGAGGCCCCC CAC 3'

PAGE 75

75 Table 3 1. Continued Primer Name ChIP Assay HRE Forward 5' TGCTAGGGCCTAACCCACCTTG 3' HRE Reverse 5' AAGCTGGGCCGACTAGGGAAAT 3' Negative Control Forward 5' AGCCTGGCTTTGATGGATGATTTT 3' Negative Control Reverse 5' TTTAGTCACCTCCCAACTCCAGGAAT 3' Sp1 Forward 1 CCCACCTTGGCCGAGGA 3' Sp1 Reverse 1 GGGCCGACTAGGGAAATGGT 3' Sp1 Forward 2 5' GGGCCCTGGCATCACCC 3' Sp1 Reverse 2 5' GCTCCTCCCTCGACGGCTT 3' Sp1 Forward 3 5' GAGCTGCCTCCGCCTGC 3' Sp1 Reverse 3 5' GGTTCGAGCTCGGAGCTCC 3' Negative Control Forward 1 GCCAGGGTAGAGAAACCCTGTCT Negative Control Reverse 1 5' GCCCTGGCAGTAAATGCCC 3' Negative Control Forward 2 5' TGAAACGGGTGGGAGGAGG 3' Negative Control Reverse 2 5' CCCAAGTTCAGTTCCCAGTGATAA 3' Negative Control Forward 3 5' ATGGGGTGATGTCAAATTAAGACAG 3' Negative Control Reverse 3 5' AGTTAGTGAGGTTGGCAGAACCAC 3'

PAGE 76

76 Figure 3 1 Effect of mithramycin on mRNA expression in rat intestinal epithelial (IEC 6) cells. IEC 6 cells at 7 days post confluence were treated with mithramycin at different concentration s ranging from 100 nM to 1000 nM for 24 hours. Relative mRNA expression levels were determined. A: Atp7a. B: Dmt1. C: Dcytb. D: Fpn1. E: Ankrd37. F: te st, n=3.

PAGE 77

77 Figure 3 2 Effect of mithramycin on CoCl 2 mediated transcriptional induction in IEC 6 cells IEC 6 cells at 7 days post confluence were treated with CoCl 2 for 36 hours, followed by adding mithramycin (500 nM) with/without CoCl 2 to cell culture s for another 24 hours. Gene expression levels were determined by qRT PCR. A: Atp7a. B: Dmt1. C: Fpn1. D: Ankrd37. E: VEGF. Each bar represents mean SD. Different letter s ab ove each bar (a, b, c) indicate significant difference s (P<0.05, ANOVA).

PAGE 78

78 Figure 3 3 Effect of Sp1 over expression on endogenous Atp7a expression and Atp7a, Dmt1, and Dcytb promoter activity in IEC 6 cells. IEC 6 cells were transfected with HA tag ged Sp1 expression vector. Sp1 and Atp7a mRNA and protein expression wer e determined. A: relative Sp1 mRNA expression levels. B: relative Atp7a mRNA expression levels. C: HA tag ged Sp1 protein level. D & E: Atp7a protein level. Atp7a, Dmt1, and Dcytb promoter constructs were co transfected with Sp1 expression vector. F: Atp7a promoter activity. G: Dmt1 promoter activity. H: Dcytb promoter activity. Each bar represents the mean test, n=3.

PAGE 79

79 Figure 3 4 Mutation analysis of putative Sp1 binding sites A: w ild type ( WT) and mutated Atp7a promoter sequences from 224 bp to +88 bp are shown. Putative Sp1 binding sites and mutated sequenc es were annotated. Putative Sp1 binding site was mutated individual ly or in combination. Either WT or mutated promoter construct s were transfected in to IEC 6 cells. B : promoter activity of construct bearing single. C : promoter activity of construct with double mutation s D : promoter activity of construct s with three or four mutation s Each bar represents mean value SD. ***P<0.005 unpaired test n=3.

PAGE 80

80 Figure 3 5 Chromatin immunoprecipitation (ChIP) analysis of Sp1 binding to rat Atp7a promoter A: location of primer s used to amplif y the Atp7a promoter region containing Sp1 binding site(s). B: location of primer s us ed to amplify Atp7a promoter region s not containing Sp1 binding site. C ross linked chromos omal DN A was pulled down by ChIP grade Sp1 antibody from IEC 6 nuclear extracts prepared from control (untreated) or mithramycin treated cells. Input was amplified fr om DNA before pull down with primer s containing the putative Sp1 binding site. C: the size of DNA fragment after sonication. D : each putative Sp1 binding site was PCR amplified with primers (Atp7a) covering region with putative Sp1 binding site E : w.t Atp7a promoter was transfected in to IEC 6 cells. 12 hours after transfection, IEC 6 cells were treated with mithramycin (from 100 nM to 1000 nM). F : primers containing four Sp1 binding site s were used to determine the effect of mithramycin on Sp1 binding. test.

PAGE 81

81 Figure 3 6 Co or Sp1 expression vector with Atp7a promoter constructs (WT or mutated). WT or mutated (individual mutation or mutation s in combinati on) Atp7a promoter construct was co Sp1 expression vector (or empty vector as control) into IEC 6 cells. A: WT Atp7a promoter construct. B: mutation on site 1. C: mutation on site 2. D: mutation on site 3. E: mutation on site 4. F : mutation s on site s 1 & 4. G : mutation on site s 2 & 3. H: mutation s on site s 1 & 2 &3. I: mutation s on site s 2 & 3 & 4. J: mutation s on site s 1 & 2 & 3 & 4. Each bar represents mean value test, n=3.

PAGE 82

82 Figure 3 7 ChIP analyses rat intestine. 12 rats divided into two group s were placed on control (Ctrl) or iron deficient (FeD) diets for five weeks. At the end of fifth week, rats were sacrificed and duodenal enterocytes were isolated. A: rat body weight was measured each week and growth rate is shown graphically. Hematological status of rats on different diets. B. hemoglobin levels. C: hematocrit levels. Dmt1 (D), Dcytb (E), and Atp7a (F) mRNA express ion levels were determined using duodenal enterocytes. G: ceruloplasmin protein level was determined using serum from each group. Each bar represents mean value SD. *P<0.05, **P<0.01, ***P<0.005, unpaired Student t test, n=6. Cytosolic and nuclear protei n s were isolated from duodenal enterocytes of each group. H: PCR amplified with primers containing HREs. K: Atp7a promoter was PCR amplified with primers containing each Sp1 bind ing site.

PAGE 83

83 Figure 3 8 Immunoblot analysis of phosphorylated Sp1 (p Sp1) protein expression in IEC 6 cell with CoCl2 mimetic hypoxia or 1% O2 exposure. IEC 6 cells at chamber (1% O2) for 60 hours. P Sp1 protein level is normalized to total Sp1 protein level. P Sp1 bands are ~120 kDa and Sp1 bands are ~108 kDa. Blot shown was the representative of three independent experiments.

PAGE 84

84 CHAPT ER 4 COPPER STABILIZES THE MENKES COPPER TRANSPORTING ATPASE (ATP7A) PROTEIN EXPRESSED IN RAT INTESTINAL EPITHELIAL (IEC 6) CELLS Summary Iron deficiency decreases oxygen tension in the intestinal mucosa, leading to stabilization of hypoxia t upregulation of genes involved in iron transport (e.g. Dmt1, Fpn1). Iron deprivation also alters copper homeostasis, reflected by copper accumulation in the intestinal epithelium and induction of an intracellular copper binding protein (Mt) and a copper exporter Atp7a protein expression was induced more strongly than mRNA in the duodenum of iron deprived rats, suggesting additional regulatory mechanisms. The current s tudy was thus designed to decipher mechanistic aspects of Atp7a regulation during iron deprivation using an established in vitro model of the mammalian intestine, rat IEC 6 cells. Cells were treated with an iron chelator and/or copper loaded to mimic the i n vivo situation. IEC 6 cells exposed to copper showed a dose dependent increase in Mt expression, confirming intracellular copper accumulation. Iron chelation with copper loading increased Atp7a mRNA and protein levels while unexpectedly, copper alone inc reased only protein levels. This suggested that copper increased Atp7a protein levels by a post transcriptional regulatory mechanism. Therefore, to determine if Atp7a protein stability was affected, the translation inhibitor cycloheximide (CHX) was utilize d. Experiments in IEC 6 cells revealed that the half life of the Atp7a protein was ~48 hours and furthermore that intracellular copper accumulation increased steady state Atp7a This work has been published : Am J Physiol Cell Physiol2013 Feb; 304(3): C257 62 P ermission to reprint is not required.

PAGE 85

85 protein levels. This investigation thus reveals a novel mechanism of Atp7a regu lation in mediated transcriptional induction during iron deficiency. Background Body iron levels are controlled by intestinal absorption, as no active excretory mechanism exists for this ess ential trace mineral. As such, intestinal iron transport is tightly regulated by local and systemic factors. Previous studies dating back many decades have implicated copper as being important for control of body iron homeostasis [ 1 9 89 ] Rele vant observations include hepatic copper loading during iron deficiency [ 9 81 127 ] and concomitant increased production of a liver derived, circulating multi copper ferroxidase, ceruloplasmin (Cp) [ 81 ] It has been noted that serum copper levels increase during iron deficiency in a number of mammalian species [ 128 129 ] likely reflecting higher levels of the holo Cp (i.e. copper containing) enzyme [ 10 35 130 ] Cp is necessary for iron release from body stores [ 107 114 ] and may influence intestinal iron absorption [ 131 ] At the lev el of the intestine, another multi copper ferroxidase, hephaestin, is important for iron efflux from enterocytes [ 33 132 ] ; its expression however is not strongly regulated by iron levels [ 133 135 ] Additional published studies described perturbations in intestinal copper metabolism during iron deprivation, as exemplified by copper accumulation in the int estinal mucosa [ 86 ] and increased expression of a cytoplasmic copper binding protein (metallothionein [Mt]) and a copper exporter (Menkes copper ATPa se [Atp7a]) [ 85 86 ] Whether copper directly influences intestinal iron absorption or if the metal is simply traversing entero cytes en route to the liver, where copper increases during iron deprivation, is currently not known. In either

PAGE 86

86 case though, it is logical to predict that copper positively influences intestinal iron homeostasis. The rate limiting step in acquisition of di etary copper is the copper transporting ATPase, Atp7a, which is necessary for assimilation of absorbed copper. This is reflected by the phenotype of patients with Menkes Disease, in which mutated Atp7a leads to copper accumulation in enterocytes and severe systemic copper deficiency [ 136 137 ] Interesti ngly, Atp7a is strongly induced in the duodenum of iron deficient rats [ 85 127 ] in the setting of perturbations in body copper levels. A recent investigation revealed that Atp7a was coordinately regulated in intestinal epithelial cells along with genes encoding proteins involved in intestinal i ron absorption (e.g. Dmt1, Cybrd1, Fpn1), by a transcriptional mechanism mediated by a hypoxia inducible trans acting [ 45 138 140 ] It was however noted that Atp7a protein levels were more strongly induced than mRNA levels [ 86 ] suggesting that additional regulatory mechanisms exist. The current study was thus undertaken to assess this possibility in an established model of the rodent in testinal epithelium, rat IEC 6 cells, which express proteins involved in intestinal iron and copper absorption, including Dmt1 [ 141 142 ] and Atp7a [ 143 144 ] Iron depriv ation and copper loading studies in IEC 6 cells revealed that copper had a direct influence on Atp7a protein expression independent of changes in mRNA levels. Materials & Methods Cell Culture Rat intestinal epithelial (IEC 6) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA), and cultured as previously described [ 113 ] Atp7a protein half life, 7 days post confluent IEC 6 cells were treated with various

PAGE 87

87 concentrations of a protein translati mL ) and for different time periods (24, 48, or 60 hours). For Atp7a protein stability experiments, IEC 6 cells were cultured for 7 days post confluence, followed by CHX, deferoxamine (DFO; an iron chelator) 2 hours. Total RNA Isolation and Real Time Quantitative RT PCR IEC 6 cells at ~85% confluence were washed with the ice cold PBS (pH 7.4) three times. Total RNA was subsequently isolated from cells using TRIzol reagent (Life Technologies; Grand Island, cDNA Synthesis Kit (BioRad; Hercules, CA) i n a 20 reaction. After reverse transcription, cDNA was diluted to 120 with nuclease free water, and 3 was used for the quantitative, real time PCR (qRT PCR) with SYBR Green qRT PCR master mix (Bio Rad), as described previously [ 113 ] Expression of experimental genes was normali minimally between samples. The sequences of primers used for the qRT PCR experiments are listed in Table 4 1. Each primer pair was first validated by performing standard curve reactions whereby linear amplification was observed across a range of template concentrations. Melt curves were also routinely run with each PCR reaction to ensure that single amplicons were produced. Protein Isolation and Western Blot Total cellular protein was purified with the Nuclear Extraction Kit (Active Motif; Carlsbad, CA) as described previously with minor modifications [ 113 ] IEC 6 cells at ~85% confluence were washed with the ice cold PBS

PAGE 88

88 (pH 7.4) and then harvested using a cell scraper, followed by suspension in 1x hypotonic buffer bestatin, and 2 mM AEBSF HCl). Cells were lysed using a tissue homogenizer and membrane bound proteins were solubilized with NP 40 (0.05%). A total cell lysate, minus nuclear protein, wa s obtained by centrifuging at 16,000 rpm in a microfuge for 15 minutes at 4 C. Protein concentration in the resulting supernatant was determined resolved by 7.5% SDS PAG E, followed by transfer to a PVDF membrane, which was subsequently blocked in 5% non fat milk. The membrane was then reacted with a rabbit polyclonal antibody against the rat Atp7a protein (called 54 10), which has been extensively validated [ 76 113 143 ] actin (600 403 886; Rockland; Gilbertsville, PA) and tubulin (ab 6160; Abcam; Cambridge, MA) were also utilized to detect constitutively ins for normalization. For some experiments, Atp7a protein expression was normalized to total proteins on stained blots, as previously described [ 84 145 ] Immunoreactive proteins on membranes were visualized using in house made ECL reagent [ 81 ] and x ray film. Stati stical Analysis ANOVA (GraphPad, La Jolla, CA) was utilized to statistically compare experimental data across groups; p <0.05 was considered significant. Results Atp7a Expression is Upregulated by Iron Chelation and Copper Loading To model the in vivo situation during iron deficiency and to decipher mechanistic aspects of Atp7a regulation during iron deficiency, IEC 6 cells were treated with an iron chelator (DFO) and/or extra copper was added to the culture media. Iron chelation increased

PAGE 89

89 Atp7a mRNA e xpression (~1.6 fold), but had little effect on protein levels (Figure 4 1). Iron chelation (200 M DFO) plus copper loading (CuCl 2 ; 200 M) had a more dramatic effect on Atp7a expression, leading to significant induction of mRNA (~2.6 fold) and protein le vels (~2 fold). Additionally, copper loading (200 M for 16 hours) in the absence of iron chelation had no effect on Atp7a mRNA expression, but led to a significant increase of p rotein levels (~1.8 fold) (Figure 4 1). Based upon microscopic observation of cells, none of the treatments led to significant cell death (data not shown). Effect of Copper Loading on Atp7a Expression To further investigate the effect of copper loading on Atp7a protein expression, IEC 6 cells were treated with increasing concentrat ions of copper in the cell culture medium for 16 hours, followed by quantifying Atp7a mRNA and protein expression levels. Increased intracellular copper was confirmed by dose dependent increases in metallothionein (Mt1a/2a) mRNA expression (Figure 4 2). Mt has been shown to be a sensitive marker of intracellular copper accumulation in a number of mammalian species [ 68 77 ] Copper treatments from 100 400 M did not lead to significant cell stress as determined by microscopic observation, but higher levels (e.g. 500 and 600 M) resulted in notable cell d eath, as exemplified by detached, floating cells (data not shown). Atp7a mRNA expression was not affected by copper treatment at any concentration; however, Atp7a protein levels increased at all copper concentrations, with the maximal response (~2 fold) be ing seen with 200 M copper. Higher copper levels (300 and 400 M) did not lead to further increase of Atp7a protein levels. Furthermore, mRNA levels of additional copper related genes were also not affected by copper loading, including copper transporter 1 (the

PAGE 90

90 apical copper importer), superoxide dismutase 1 (SOD1; an intracellular, copper containing antioxidant protein) and antioxidant protein 1 (Atox1; a co pper chaperone for Atp7a) (Figure 4 3). Effect of Copper Loading on Atp7a Protein Stability Since Atp7a physically interacts with copper as part of its transport function, we next considered the possibility that increased intracellular copper could increase Atp7a protein stability. To do so, a global translation inhibitor, cycloheximide (CHX), was uti lized in the IEC 6 cell model. As rapidly dividing IEC 6 cells are very sensitive to CHX treatment (data not shown), these experiments were done in fully confluent cell monolayers (7 days post confluent). First, IEC 6 cells were treated with increasing CHX concentrations to assess the effec t on Atp7a protein levels (Figure 4 4A). A maximal reduction in protein levels (~80%) was observed with 10 g/ mL CHX for 48 hours. Then, to estimate Atp7a protein half life, cells were treated with 10 g/ mL CHX for time periods ra nging from 24 to 60 hours (Figure 4 4B). These experiments revealed that the Atp7a protein half life was ~48 hours, as at this time point, protein levels had decreased ~50%. Next, to determine if copper loading altered Atp7a protein stability, cells were treated with CHX in the pres ence and absence of copper (Figure 4 4C). In this study, CHX decreased Atp7a protein levels, while CHX in the presence of copper abolished the decrease. As expected, DFO plus copper also led to an increase of Atp7a protein levels. Discussion Consistent with alterations in body copper levels during iron deficiency, intestinal Atp7a mRNA and protein are induced in the setting of increased mucosal copper in iron deprived rats [ 85 86 ] To determine the molecular mechanism of this induction, we utilized an established model of the mammalian intestinal epithelium, rat IEC 6 cells.

PAGE 91

91 Cells were treated with CoCl 2 or cultured in 1% oxygen to simulate the hypoxic response that typifies iron deprivation [ 113 ] These studies revealed that the Atp7a gene was a direct target of a hypoxia inducible, trans mediates increases in Atp7a mRNA expre ssion during iron deprivation [ 113 ] This places Atp7a among a group of iron related genes (e.g. Cybrd1, Dmt1, Fpn1) that are [ 45 46 146 ] Furthermore, in iron deficient rats, we consistently noted that Atp7a protein levels increased more dramatically than mRNA levels, perhaps hinting at an additional regulatory mechanism. This seemed even more plausible given that Atp7a protein levels increased more dramatically in the IEC 6 cell model when cells were treated with an iron chelator in the presence of added copper. The cu rrent studies were thus undertaken to consider the possibility that copper has a direct role in stabilizing the Atp7a protein. In the current and past studies [ 76 ] Atp7a mRNA levels increased with DFO treatment in IEC 6 cells, possibly by a HIF mediated mechanism, as iron chelation is know n to stabilize the HIF proteins (similar to low oxygen or CoCl 2 exposure) [ 94 147 148 ] Induction of mRNA expression was more pronounced in the presence of added copper ( Figure 4 1), which presumably increased intracellular copper levels as indicated by induction of Mt1a/2a expression. How intracellular copper accumulation c ould enhance the effect of DFO on Atp7a gene expression is not known. Furthermore, although iron chelation alone did not affect Atp7a protein levels, DFO plus added copper led to an increase. Unexpectedly, copper loading in the absence of DFO also increase d Atp7a protein levels, while having no influence on mRNA expression. These observations suggested that two independent regulatory mechanisms were involved in

PAGE 92

92 Atp7a induction in IEC 6 cells: 1) a possible HIF related transcriptional mechanism that increas ed mRNA levels, and 2) a post transcriptional mechanism acting directly on the Atp7a protein. Additional experiments were thus designed to delve into the effect of copper loading on Atp7a protein levels. Cycloheximide (CHX) is commonly used to globally inh ibit protein translation, whereby one can assess the rate of protein decay in the absence of synthesis. In the IEC 6 cell model, we thus utilized CHX to determine: 1) the relative stability of the Atp7a protein and 2) whether it was altered by copper loadi ng of cells. Once a suitable concentration of CHX was identified, which significantly attenuated Atp7a protein expression and was not toxic to the cells (10 g/ mL ), a time course was performed to assess Atp7a protein decay rate. Results revealed an approxi mate 41 hour half life for the Atp7a protein. Importantly, further experiments showed that Atp7a protein decay was significantly inhibited by loading cells with copper in the presence of CHX, most likely indicating that copper interacted with and stabilize d the protein. Copper has been shown to stabilize proteins in which it plays a catalytic role. For example, apo ceruloplasmin (devoid of copper) is much less stable than the copper containing form (the holo enzyme) [ 149 ] Copper also stabilizes the cytosolic metal storage protein metallothionein [ 150 ] In the current investigation however, copper interaction with the protein is more transient in nature, as Atp7a is a trans membrane copper transporter. Atp7 a has 6 cytosolic, N terminal copper binding domains [ 151 ] although all 6 are not required for copper transport function or trafficking from trans Golgi t o plasma membrane in cells [ 152 ] As such, we postulate that increased intracellular copper allows for specific binding to one or more of the intracellular copper

PAGE 93

93 binding domains, leading to stabilization of the protein. How or if this might influence transport activity or protein trafficking is not known. This investigation has thus successfully modeled in vitro what may be occurring to Atp7a gene and protein expression in vivo during iron deprivation, when enterocyte iron levels are low & hypoxia occurs, and mucosal copper levels increase. Iron chelation with DFO, which presumably decreases intracellular iron and stabilizes the HIFs, increased Atp7a mRNA expression, while copper loading had an additional, synergistic effect. Use o f a translation inhibitor revealed a direct influence of copper on Atp7a protein stability. A novel paradigm is thus revealed in which Atp7a protein expression increases due to two diverse signals: 1) HIF signaling and 2) via alterations in intracellular c opper content. The existence of two independent regulatory mechanisms for copper homeostasis in enterocytes specifically during perturbations in iron levels strengthens the hypothesis that copper has a positive influence on intestinal iron absorption. Whet her other copper or iron homeostasis related proteins may be similarly regulated by interaction with intracellular copper in enterocytes is currently unknown. Interestingly however, the predominant intestinal iron importer, divalent metal transporter 1 (Dm t1) can bind to and transport copper [ 83 ] but the physiological significance of such an interaction is not clear.

PAGE 94

94 Table 4 1. Sequences of primers used for qRT PCR Experiments Gene Name Primer Sequence 18S Forward TCCAAGGAAGGCAGCAGGC 18S Reverse TACCTGGTTGATCCTGCCA Atp7a Forward TGAACAGTCATCACCTTCATCGTC Atp7a Reverse TGCATCTTGTTGGACTCCTGAAAG Mt 1a Forward CTTCTTGTCGCTTACACCGTTG Mt 1a Reverse CAGCAGCACTGTTCGTCACTTC Mt 2a Forward ACTGCCGCCTCCATTCGG Mt 2a Reverse TCTTGCAGGAGGTGCATTTGC Ctr1 Forward CTACTTTGGCTTTAAGAATGTGGACC Ctr1 Reverse AACATTGCTAGTAAAAACACTGCCAC S od1 Forward AGCGGTGAACCAGTTGTGGTG S od1 Reverse TGGACCGCCATGTTTCTTAGAG Atox1 Forward GTTCTCTGTGGACATGACCTGTGG Atox1 Reverse CAAGGTAGGAGACCGCTTTTCCT

PAGE 95

95 Figure 4 1. Effect of Iron Deprivation and Copper Loading on Atp7a mRNA and Protein Expression in IEC 6 cells IEC 6 cells at 85% confluence were treated with DFO, CuCl 2 or DFO+CuCl 2 (all used at 200 M) for 16 hours. ( A ) Relative Atp7a mRNA expression levels are depicted with the different treatments. Shown are means SD; n = 3. ( B ) A representative Atp7a immunoblot is shown, with tubulin used as a constitutively expressed housekeeping protein for normalization. The Atp7a bands are ~180 kDa, while tubulin bands are ~55 kDa. Quantitative data from 3 independent experiments are presen ted below in panel C where means SD are shown. In panels A and C, letters atop bars indicate significance. Bars sharing the same letter are not statistically different from one another. Bars with different letters are statistically different from one an other (ANOVA; p<0.05).

PAGE 96

96 Figure 4 2 Effect of Copper Loading on Mt and Atp7a mRNA Expression IEC 6 cells at 85% confluence were incubated with CuCl 2 at different concentrations (100 400 M) for 16 hours. Mt1a ( A ), Mt2a ( B ), and Atp7a ( C ) mRNA expression was determined by qRT PCR. Shown are means SD; n=3. ( D ) Atp7a protein levels were determined by immunoblotting with a validated anti Atp7a actin as a constitutively expressed housekeeping protein for normalization. The A tp7a bands are ~180 kDa, actin bands are ~50 kDa. A representative blot is shown (D) with quantitative data from 3 independent experiments depicted in panel E (where means SD are presented). In panels A, B and E, letters atop bars indicate signif icance. Bars sharing the same letter are not statistically different from one another. Bars with different letters are statistically different from one another (ANOVA; p<0.05).

PAGE 97

97 Figure 4 3 Effect of Copper Loading on Expression of Copper Related Genes IEC 6 cells at 85% confluence were treated with CuCl 2 (100 400 M) for 16 hours. Expression of Ctr1 (A), Sod1 (B), and Atox1 was subsequently determined by qRT PCR. Each bar represents mean SD; n=3.

PAGE 98

98 Figure 4 4 Immunoblot Analysis of Atp7a Protein Exp ression in Cycloheximide (CHX) Treated IEC 6 cells. IEC 6 cells at 7 days post confluence were initially treated with CHX for 48 hours at varying concentrations and Atp7a protein expression was quantified ( A ). Shown above is a representative immunoblot with stained protein from the blot shown underneath (which was used to normalize Atp7a protein levels). The Atp7a bands are ~180 kDa. Quantitative data from 3 independent experiments are shown below (mean SD; n=3). Subsequently, a time course was performed using 10 g/ mL CHX ( B ). A representative blot and stained proteins are shown above and quantitative data below (mean SD; n=3). Cells were then treated with CHX with and without copper loading, and Atp7a pr otein expression was quantified ( C ). DFO + copper was utilized as a positive control. Again, a representative blot and stained proteins are shown above and quantitative data below (mean SD; n=3). In all lower panels, letters atop bars indicate significa nce. Bars sharing the same letter are not statistically different from one another. Bars with different letters are statistically different from one another(ANOVA; p<0.05).

PAGE 99

99 CHAPTER 5 CONCLUSION S AND FUTURE DIRECTIONS Conclusions These studies were designed to delve into the molecular mechanisms of induction of the Atp7a gene, which was observed in rat duodenal enterocytes during iron deficiency [ 85 86 ] The aim of these studies was to identify the specific regulatory mechanisms leading to induction of Atp7a gene in rat small intestine. This induction was thus recapitulated in in vitro cell culture model, IEC 6 cells. By the completion of these studies, three regulatory mechanisms have been identified: 1) In rat duodenal enterocytes, it was observed that during iron deficiency, Atp7a gene expression is strongly induced and its expressio n parallels that of iron transport related genes (e.g. Dmt1 and Dcytb ) [ 85 ] duodenal enterocytes in response to the low iron levels and Atp7a expression is mediated signaling pathway. 2) Genes that respond to iron deficiency contain GC rich sequence s in the promoter [ 87 ] and these GC rich sequences are located in close proximity to the region where three evolutionarily conserved HREs are found Thus, studies were performed to determine if Atp7a is transcriptionally regulated by Sp1 via direct binding to the promoter. Sp1 was shown to mediated induction of Atp 7a expression; 3) During iron deficiency, in the presence of elevated copper levels in duodenal enterocytes, Atp7a protein levels are more robustly induced th an its transcript levels [ 86 ] T his phenomenon was recapitulated in IEC 6 cells and it was found that copper loading in I E C 6 cells does not affect Atp7a mRNA level s but increases Atp7a protein level s F urther investigation showed that copper in IEC 6 cells increases Atp7a pro tein stability.

PAGE 100

100 Future Directions I t was proposed since the identification of induction of Atp7a expression in duodenal enterocytes during iron deficiency that induction of Atp7a expression and increased copper absorption in small intestine are conside red to be a compensatory mechanism to increase systemic iron level s C opper is cofactor of two important iron ferroxidases, which may be associated with iron release from enterocyte s to portal blood circulation. During iron deficiency, increased copper abs orption via small intestine may lead to the accumulation of copper in hepatocytes. T his has been observed in in vivo animal model s, and increased Cp expression and activity are noted in hepatocytes [ 81 ] However, mechanisms of induced Cp expression are still unknown. Further studies can be initiated to reveal the mechanisms by which copper regulates Cp expression in liver. C opper also is cofactor of Hp. D uring iron deficiency, increased Hp activity is essential to iron release from enterocytes to further increase systemic iron levels. However, whether copper affect s Hp expression and how copper is incorporated into Hp are not clear. S tudies look ing into the functional role of copper in Hp ex pression in enterocytes and the subcellular Hp synthesis and copper incorporation into Hp can be further investigated. Genes that respond to low iron have GC rich sequences in their promoters. Sp like factors (e.g. Sp1, Sp3, Sp4, and Sp6) may bind to GC ri ch sequence s In this study, we characterized one of the Sp like factors (Sp1) and found that Sp1 transcriptionally regulates Atp7a expression and is involved in the HIF2 mediated induction of Atp7a expression. However, whether other Sp like factors could bind to these GC rich sequences to regulate Atp7a expression is still unknown. Thus, studies to understand whether other Sp like factors are involved and whether the interaction between Sp1 and

PAGE 101

101 other Sp like factors exists in response to hypoxia/iron defi ciency can be further pursued. Overall, these studies successfully modeled the observation made in in vivo animal models, and several molecular mechanisms have been identified that regulate Atp7a expression during iron deficiency.

PAGE 102

102 LIST OF REFERENCES 1. Aisen, P., C. Enns, and M. Wessling Resnick, Chemistry and biology of eukaryotic iron metabolism. Int J Biochem Cell Biol, 2001. 33 (10): p. 940 59. 2. Nam, W., High valent iron(IV) oxo complexes of heme and non heme ligands in oxygenat ion reactions. Acc Chem Res, 2007. 40 (7): p. 522 31. 3. Hurrell, R.F., Improvement of trace element status through food fortification: technological, biological and health aspects. Bibl Nutr Dieta, 1998(54): p. 40 57. 4. Uzel, C. and M.E. Conrad, Absorptio n of heme iron. Semin Hematol, 1998. 35 (1): p. 27 34. 5. Lynch, S.R., Interaction of iron with other nutrients. Nutr Rev, 1997. 55 (4): p. 102 10. 6. Lombard, M., E. Chua, and P. O'Toole, Regulation of intestinal non haem iron absorption. Gut, 1997. 40 (4): p. 435 9. 7. Zijp, I.M., O. Korver, and L.B. Tijburg, Effect of tea and other dietary factors on iron absorption. Crit Rev Food Sci Nutr, 2000. 40 (5): p. 371 98. 8. Richardson, D.R. and P. Ponka, The molecular mechanisms of the metabolism and transport of iron in normal and neoplastic cells. Biochim Biophys Acta, 1997. 1331 (1): p. 1 40. 9. Prus, E. and E. Fibach, Uptake of non transferrin iron by erythroid cells. Anemia, 2011. 2011 : p. 945289. 10. Torti, F.M. and S.V. Torti, Regulation of ferritin genes and protein. Blood, 2002. 99 (10): p. 3505 16. 11. McCord, J.M., Iron, free radicals, and oxidative injury. J Nutr, 2004. 134 (11): p. 3171S 3172S. 12. Datz, C., et al., Iron homeostasis in the Metabolic Syndrome. Eur J Clin Invest, 2013. 43 (2): p. 215 224. 13. Wilson, M.T. and B.J. Reeder, Oxygen binding haem proteins. Exp Physiol, 2008. 93 (1): p. 128 32. 14. Andrews, N.C., Forging a field: the golden age of iron biology. Blood, 2008. 112 (2): p. 219 30.

PAGE 103

103 15. Batts, K.P., Iron overload syndromes and the liver. Mo d Pathol, 2007. 20 Suppl 1 : p. S31 9. 16. Zecca, L., et al., Iron, brain ageing and neurodegenerative disorders. Nat Rev Neurosci, 2004. 5 (11): p. 863 73. 17. Zecca, L., et al., The role of iron and copper molecules in the neuronal vulnerability of locus c oeruleus and substantia nigra during aging. Proc Natl Acad Sci U S A, 2004. 101 (26): p. 9843 8. 18. Kaur, D., et al., Genetic or pharmacological iron chelation prevents MPTP induced neurotoxicity in vivo: a novel therapy for Parkinson's disease. Neuron, 20 03. 37 (6): p. 899 909. 19. Wollenberg, P. and W. Rummel, Dependence of intestinal iron absorption on the valency state of iron. Naunyn Schmiedebergs Arch Pharmacol, 1987. 336 (5): p. 578 82. 20. Raja, K.B., R.J. Simpson, and T.J. Peters, Investigation of a role for reduction in ferric iron uptake by mouse duodenum. Biochim Biophys Acta, 1992. 1135 (2): p. 141 6. 21. McKie, A.T., et al., An iron regulated ferric reductase associated with the absorption of dietary iron. Science, 2001. 291 (5509): p. 1755 9. 22. Gunshin, H., et al., Cybrd1 (duodenal cytochrome b) is not necessary for dietary iron absorption in mice. Blood, 2005. 106 (8): p. 2879 83. 23. Latunde Dada, G.O., et al., Molecular and functional roles of duodenal cytochrome B (Dcytb) in iron metabolism. B lood Cells Mol Dis, 2002. 29 (3): p. 356 60. 24. Gunshin, H., et al., Cloning and characterization of a mammalian proton coupled metal ion transporter. Nature, 1997. 388 (6641): p. 482 8. 25. Fleming, M.D., et al., The iron transporter Nramp2 is mutated in t he anemic belgrade (b) rat. Blood, 1997. 90 (10): p. 2675 2675. 26. Mackenzie, B. and M.D. Garrick, Iron Imports. II. Iron uptake at the apical membrane in the intestine. Am J Physiol Gastrointest Liver Physiol, 2005. 289 (6): p. G981 6. 27. Fleming, M.D., e t al., Nramp2 is mutated in the anemic Belgrade (b) rat: Evidence of a role for Nramp2 in endosomal iron transport. Proceedings of the National Academy of Sciences of the United States of America, 1998. 95 (3): p. 1148 1153.

PAGE 104

104 28. Fleming, M.D., et al., Micro cytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nature Genetics, 1997. 16 (4): p. 383 386. 29. Han, O., Molecular mechanism of intestinal iron absorption. Metallomics, 2011. 3 (2): p. 103 9. 30. Abboud, S. and D.J. Haile, A n ovel mammalian iron regulated protein involved in intracellular iron metabolism. J Biol Chem, 2000. 275 (26): p. 19906 12. 31. McKie, A.T., et al., A novel duodenal iron regulated transporter, IREG1, implicated in the basolateral transfer of iron to the cir culation. Mol Cell, 2000. 5 (2): p. 299 309. 32. Frazer, D.M., et al., Cloning and gastrointestinal expression of rat hephaestin: relationship to other iron transport proteins. Am J Physiol Gastrointest Liver Physiol, 2001. 281 (4): p. G931 9. 33. Vulpe, C.D., et al., Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet, 1999. 21 (2): p. 195 9. 34. Ranganathan, P.N., et al., Immunoreactive hephaestin and ferroxidase activity are prese nt in the cytosolic fraction of rat enterocytes. Biometals, 2012. 25 (4): p. 687 95. 35. Ranganathan, P.N., et al., Discovery of a cytosolic/soluble ferroxidase in rodent enterocytes. Proc Natl Acad Sci U S A, 2012. 109 (9): p. 3564 9. 36. Morgan, E.H., The role of plasma transferrin in iron absorption in the rat. Q J Exp Physiol Cogn Med Sci, 1980. 65 (3): p. 239 52. 37. Trenor, C.C., et al., The molecular defect in hypotransferrinemic mice. Blood, 2000. 96 (3): p. 1113 1118. 38. Holmberg, C.G. and C.B. Laurel l, Histaminolytic activity of a copper protein in serum. Nature, 1948. 161 (4085): p. 236. 39. Prohaska, J.R., Impact of Copper Limitation on Expression and Function of Multicopper Oxidases (Ferroxidases). Advances in Nutrition: An International Review Jour nal, 2011. 2 (2): p. 89 95. 40. Muckenthaler, M.U., B. Galy, and M.W. Hentze, Systemic iron homeostasis and the iron responsive element/iron regulatory protein (IRE/IRP) regulatory network. Annu Rev Nutr, 2008. 28 : p. 197 213.

PAGE 105

105 41. Casey, J.L., et al., Iron responsive elements: regulatory RNA sequences that control mRNA levels and translation. Science, 1988. 240 (4854): p. 924 8. 42. Lee, P.L., et al., The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and poly morphisms. Blood Cells Mol Dis, 1998. 24 (2): p. 199 215. 43. Caughman, S.W., et al., The iron responsive element is the single element responsible for iron dependent translational regulation of ferritin biosynthesis. Evidence for function as the binding si te for a translational repressor. J Biol Chem, 1988. 263 (35): p. 19048 52. 44. Anderson, C., I. Aronson, and P. Jacobs, Erythropoiesis: Erythrocyte Deformability is Reduced and Fragility increased by Iron Deficiency. Hematology, 2000. 4 (5): p. 457 460. 45. Shah, Y.M., et al., Intestinal hypoxia inducible transcription factors are essential for iron absorption following iron deficiency. Cell Metab, 2009. 9 (2): p. 152 64. 46. Mastrogiannaki, M., et al., HIF 2alpha, but not HIF 1alpha, promotes iron absorption in mice. J Clin Invest, 2009. 119 (5): p. 1159 66. 47. Taylor, M., et al., Hypoxia Inducible Factor of Intestinal Ferroportin During Iron Deficiency in Mice. Gastroenterology, 2011. 140 (7): p. 2044 2055. 48. Park, C.H., et al., Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J Biol Chem, 2001. 276 (11): p. 7806 10. 49. Donovan, A., et al., Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature, 2 000. 403 (6771): p. 776 81. 50. Kim, B.E., T. Nevitt, and D.J. Thiele, Mechanisms for copper acquisition, distribution and regulation. Nat Chem Biol, 2008. 4 (3): p. 176 85. 51. Collins, J.F. and L.M. Klevay, Copper. Adv Nutr, 2011. 2 (6): p. 520 2. 52. Nose, Y., B.E. Kim, and D.J. Thiele, Ctr1 drives intestinal copper absorption and is essential for growth, iron metabolism, and neonatal cardiac function. Cell Metabolism, 2006. 4 (3): p. 235 244. 53. Ohgami, R.S., et al., The Steap proteins are metalloreductase s. Blood, 2006. 108 (4): p. 1388 94. 54. Wyman, S., et al., Dcytb (Cybrd1) functions as both a ferric and a cupric reductase in vitro. FEBS Lett, 2008. 582 (13): p. 1901 6.

PAGE 106

106 55. Amaravadi, R., D.M. Glerum, and A. Tzagoloff, Isolation of a cDNA encoding the hu man homolog of COX17, a yeast gene essential for mitochondrial copper recruitment. Hum Genet, 1997. 99 (3): p. 329 33. 56. Casareno, R.L., D. Waggoner, and J.D. Gitlin, The copper chaperone CCS directly interacts with copper/zinc superoxide dismutase. J Bio l Chem, 1998. 273 (37): p. 23625 8. 57. Larin, D., et al., Characterization of the interaction between the Wilson and Menkes disease proteins and the cytoplasmic copper chaperone, HAH1p. J Biol Chem, 1999. 274 (40): p. 28497 504. 58. Yamaguchi, Y., et al., B iochemical characterization and intracellular localization of the Menkes disease protein. Proc Natl Acad Sci U S A, 1996. 93 (24): p. 14030 5. 59. Petris, M.J., et al., Ligand regulated transport of the Menkes copper P type ATPase efflux pump from the Golgi apparatus to the plasma membrane: a novel mechanism of regulated trafficking. EMBO J, 1996. 15 (22): p. 6084 95. 60. Linder, M.C. and M. Hazegh Azam, Copper biochemistry and molecular biology. Am J Clin Nutr, 1996. 63 (5): p. 797S 811S. 61. Kubow, S., T.M. Bray, and W.J. Bettger, Effects of dietary zinc and copper on free radical production in rat lung and liver. Can J Physiol Pharmacol, 1986. 64 (10): p. 1281 5. 62. Menkes, J.H., Maple syrup disease; isolation and identification of organic ac ids in the urine. Pediatrics, 1959. 23 (2): p. 348 53. 63. Vulpe, C., et al., Isolation of a candidate gene for Menkes disease and evidence that it encodes a copper transporting ATPase. Nat Genet, 1993. 3 (1): p. 7 13. 64. Mercer, J.F., et al., Isolation of a partial candidate gene for Menkes disease by positional cloning. Nat Genet, 1993. 3 (1): p. 20 5. 65. Chelly, J., et al., Isolation of a candidate gene for Menkes disease that encodes a potential heavy metal binding protein. Nat Genet, 1993. 3 (1): p. 14 9 66. Blalock, T.L., M.A. Dunn, and R.J. Cousins, Metallothionein gene expression in rats: tissue specific regulation by dietary copper and zinc. J Nutr, 1988. 118 (2): p. 222 8. 67. Minghetti, M., et al., Copper induces Cu ATPase ATP7A mRNA in a fish cell line, SAF1. Comp Biochem Physiol C Toxicol Pharmacol, 2011. 154 (2): p. 93 9.

PAGE 107

107 68. Suzuki, K.T., et al., Roles of metallothionein in copper homeostasis: responses to Cu deficient diets in mice. J Inorg Biochem, 2002. 88 (2): p. 173 82. 69. Petris, M.J., et al ., Copper stimulated endocytosis and degradation of the human copper transporter, hCtr1. J Biol Chem, 2003. 278 (11): p. 9639 46. 70. West, E.C. and J.R. Prohaska, Cu,Zn superoxide dismutase is lower and copper chaperone CCS is higher in erythrocytes of cop per deficient rats and mice. Exp Biol Med (Maywood), 2004. 229 (8): p. 756 64. 71. Bertinato, J. and M.R. L'Abbe, Copper modulates the degradation of copper chaperone for Cu,Zn superoxide dismutase by the 26 S proteosome. J Biol Chem, 2003. 278 (37): p. 3507 1 8. 72. Caruano Yzermans, A.L., T.B. Bartnikas, and J.D. Gitlin, Mechanisms of the Copper dependent Turnover of the Copper Chaperone for Superoxide Dismutase. Journal of Biological Chemistry, 2006. 281 (19): p. 13581 13587. 73. Lutsenko, S., et al., Functi on and Regulation of Human Copper Transporting ATPases. Physiological Reviews, 2007. 87 (3): p. 1011 1046. 74. Robinson, N.J. and D.R. Winge, Copper Metallochaperones. Annual Review of Biochemistry, 2010. 79 (1): p. 537 562. 75. Linz, R. and S. Lutsenko, Copper transporting ATPases ATP7A and ATP7B: cousins, not twins. J Bioenerg Biomembr, 2007. 39 (5 6): p. 403 7. 76. Collins, J.F., et al., Alternative Splicing of the Menkes Copper Atpase (Atp7a) Transcript in the Rat Intestinal Epithelium. Am J Physiol Gas trointest Liver Physiol, 2009. 77. Pase, L., et al., Copper stimulates trafficking of a distinct pool of the Menkes copper ATPase (ATP7A) to the plasma membrane and diverts it into a rapid recycling pool. Biochem. J., 2004. 378 (3): p. 1031 1037. 78. Takaha shi, N., T.L. Ortel, and F.W. Putnam, Single chain structure of human ceruloplasmin: the complete amino acid sequence of the whole molecule. Proc Natl Acad Sci U S A, 1984. 81 (2): p. 390 4. 79. Martin, F., et al., Copper dependent activation of hypoxia ind ucible factor (HIF) 1: implications for ceruloplasmin regulation. Blood, 2005. 105 (12): p. 4613 9. 80. Mukhopadhyay, C.K., B. Mazumder, and P.L. Fox, Role of hypoxia inducible factor 1 in transcriptional activation of ceruloplasmin by iron deficiency. J Bi ol Chem, 2000. 275 (28): p. 21048 54.

PAGE 108

108 81. Ranganathan, P.N., et al., Serum ceruloplasmin protein expression and activity increases in iron deficient rats and is further enhanced by higher dietary copper intake. Blood, 2011. 118 (11): p. 3146 53. 82. Tennant, J., et al., Effects of copper on the expression of metal transporters in human intestinal Caco 2 cells. FEBS Lett, 2002. 527 (1 3): p. 239 44. 83. Arredondo, M., et al., DMT1, a physiologically relevant apical Cu1+ transporter of intestinal cells. Am J Phy siol Cell Physiol, 2003. 284 (6): p. C1525 30. 84. Jiang, L., et al., Exploration of the Copper Related Compensatory Response in the Belgrade Rat Model of Genetic Iron Deficiency. American journal of physiology. Gastrointestinal and liver physiology, 2011. 85. Collins, J.F., et al., Identification of differentially expressed genes in response to dietary iron deprivation in rat duodenum. Am J Physiol Gastrointest Liver Physiol, 2005. 288 (5): p. G964 71. 86. Ravia, J.J., et al., Menkes Copper ATPase (Atp7a) is a novel metal responsive gene in rat duodenum, and immunoreactive protein is present on brush border and basolateral membrane domains. J Biol Chem, 2005. 280 (43): p. 36221 36227. 87. Collins, J.F. and Z. Hu, Promoter analysis of intestinal genes induced d uring iron deprivation reveals enrichment of conserved SP1 like binding sites. BMC Genomics, 2007. 8 : p. 420. 88. Zoller, H., et al., Expression of the duodenal iron transporters divalent metal transporter 1 and ferroportin 1 in iron deficiency and iron overload. Gastroenterology, 2001. 120 (6): p. 1412 9. 89. Collins, J.F., J.R. Prohaska, and M.D. Knutson, Metabolic crossroads of iron and copper. Nutr Rev, 2010. 68 (3): p. 133 47. 90. Collins, J.F., Gene chip analyses reveal differential genetic responses to iron deficiency in rat duodenum and jejunum. Biol Res, 2006. 39 (1): p. 25 37. 91. Ravia, J.J., et al., Menkes copper ATPase (Atp7a) is a novel metal responsive gene in rat duodenum, and immunoreactive protein is present on brush border and basolateral m embrane domains. Journal of Biological Chemistry, 2005. 280 (43): p. 36221 36227. 92. Ece, A., et al., Increased serum copper and decreased serum zinc levels in children with iron deficiency anemia. Biol Trace Elem Res, 1997. 59 (1 3): p. 31 9.

PAGE 109

109 93. Collins, J.F., M. Wessling Resnick, and M.D. Knutson, Hepcidin regulation of iron transport. J Nutr, 2008. 138 (11): p. 2284 8. 94. Hu, Z., S. Gulec, and J.F. Collins, Cross species comparison of genomewide gene expression profiles reveals induction of hypoxia induc ible factor responsive genes in iron deprived intestinal epithelial cells. Am J Physiol Cell Physiol, 2010. 299 (5): p. C930 8. 95. Benita, Y., et al., An integrative genomics approach identifies Hypoxia Inducible Factor 1 (HIF 1) target genes that form the core response to hypoxia. Nucleic Acids Res, 2009. 37 (14): p. 4587 602. 96. Piret, J.P., et al., CoCl2, a chemical inducer of hypoxia inducible factor 1, and hypoxia reduce apoptotic cell death in hepatoma cell line HepG2. Ann N Y Acad Sci, 2002. 973 : p. 443 7. 97. Collins, J.F., et al., Induction of arachidonate 12 lipoxygenase (Alox15) in intestine of iron deficient rats correlates with the production of biologically active lipid mediators. Am J Physiol Gastrointest Liver Physiol, 2008. 294 (4): p. G948 6 2. 98. Yuan, Y., et al., Cobalt inhibits the interaction between hypoxia inducible factor alpha and von Hippel Lindau protein by direct binding to hypoxia inducible factor alpha. J Biol Chem, 2003. 278 (18): p. 15911 6. 99. Maxwell, P.H., et al., The tumour suppressor protein VHL targets hypoxia inducible factors for oxygen dependent proteolysis. Nature, 1999. 399 (6733): p. 271 5. 100. Cockman, M.E., et al., Hypoxia inducible factor alpha binding and ubiquitylation by the von Hippel Lindau tumor suppressor p rotein. J Biol Chem, 2000. 275 (33): p. 25733 41. 101. Hu, Z., B. Hu, and J.F. Collins, Prediction of synergistic transcription factors by function conservation. Genome Biol, 2007. 8 (12): p. R257. 102. Chandel, N.S., et al., Mitochondrial reactive oxygen species trigger hypoxia induced transcription. Proc Natl Acad Sci U S A, 1998. 95 (20): p. 11715 20. 103. Giordano, F.J., Oxygen, oxidative stress, hypoxia, and heart failure. The Journal of Clinical Investigation, 2005. 115 (3): p. 500 508. 104. Videla, L.A ., et al., Oxidative stress mediated hepatotoxicity of iron and copper: Role of Kupffer cells. Biometals, 2003. 16 (1): p. 103 111.

PAGE 110

110 105. Gunshin, H., et al., Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta a nd liver. J Clin Invest, 2005. 115 (5): p. 1258 66. 106. Harris, Z.L., et al., Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux. Proc Natl Acad Sci U S A, 1999. 96 (19): p. 10812 7. 107. Hellman, N.E., et al., Hepa tic iron overload in aceruloplasminaemia. Gut, 2000. 47 (6): p. 858 60. 108. Takami, T. and I. Sakaida, Iron regulation by hepatocytes and free radicals. J Clin Biochem Nutr, 2011. 48 (2): p. 103 6. 109. Walden, W.E., et al., Structure of dual function iron regulatory protein 1 complexed with ferritin IRE RNA. Science, 2006. 314 (5807): p. 1903 8. 110. Wang, G.L. and G.L. Semenza, General involvement of hypoxia inducible factor 1 in transcriptional response to hypoxia. Proc Natl Acad Sci U S A, 1993. 90 (9): p. 4304 8. 111. Wang, G.L., et al., HYPOXIA INDUCIBLE FACTOR 1 IS A BASIC HELIX LOOP HELIX PAS HETERODIMER REGULATED BY CELLULAR O 2 TENSION. Proceedings of the National Academy of Sciences of the United States of America, 1995. 92 (12): p. 5510 5514. 112. Ji ang, B.H., et al., Dimerization, DNA binding, and transactivation properties of hypoxia inducible factor 1. J Biol Chem, 1996. 271 (30): p. 17771 8. 113. Xie, L. and J.F. Collins, Transcriptional regulation of the Menkes copper ATPase (Atp7a) gene by hypoxi a inducible factor (HIF2{alpha}) in intestinal epithelial cells. Am J Physiol Cell Physiol, 2011. 300 (6): p. C1298 305. 114. Xie, L. and J.F. Collins, Copper stabilizes the Menkes copper transporting ATPase (Atp7a) protein expressed in rat intestinal epith elial cells. Am J Physiol Cell Physiol, 2013. 304 (3): p. C257 62. 115. Mizukami, Y., et al., Hypoxia inducible factor 1 independent regulation of vascular endothelial growth factor by hypoxia in colon cancer. Cancer Res, 2004. 64 (5): p. 1765 72. 116. Carroll, V.A. and M. Ashcroft, Role of Hypoxia Inducible Factor (HIF) HIF Like Growth Factor I, or Loss of von Hippel Lindau Function: Implications for Targeting the HIF Pat hway. Cancer Research, 2006. 66 (12): p. 6264 6270.

PAGE 111

111 117. Sleiman, S.F., et al., Mithramycin Is a Gene Selective Sp1 Inhibitor That Identifies a Biological Intersection between Cancer and Neurodegeneration. The Journal of Neuroscience, 2011. 31 (18): p. 6858 6870. 118. F., et al., DNA Binding Characteristics of Mithramycin and Chromomycin Analogues Obtained by Combinatorial Biosynthesis. Biochemistry, 2010. 49 (49): p. 10543 10552. 119. Miller, D.M., et al., Mithramycin selectively inhibits trans cription of G C containing DNA. Am J Med Sci, 1987. 294 (5): p. 388 94. 120. Liang, Z.D., et al., Specificity protein 1 (sp1) oscillation is involved in copper homeostasis maintenance by regulating human high affinity copper transporter 1 expression. Mol Ph armacol, 2012. 81 (3): p. 455 64. 121. Wada, T., S. Shimba, and M. Tezuka, Transcriptional regulation of the hypoxia inducible factor 2alpha (HIF 2alpha) gene during adipose differentiation in 3T3 L1 cells. Biol Pharm Bull, 2006. 29 (1): p. 49 54. 122. Emili A., J. Greenblatt, and C.J. Ingles, Species specific interaction of the glutamine rich activation domains of Sp1 with the TATA box binding protein. Mol. Cell. Biol., 1994. 14 (3): p. 1582 1593. 123. Taylor, I.C. and R.E. Kingston, Factor substitution in a human HSP70 gene promoter: TATA dependent and TATA independent interactions. Mol Cell Biol, 1990. 10 (1): p. 165 75. 124. Tan, N.Y. and L.M. Khachigian, Sp1 phosphorylation and its regulation of gene transcription. Mol Cell Biol, 2009. 29 (10): p. 2483 8. 1 25. Koizume, S., et al., Sp1 interaction mediates a deacetylation dependent FVII gene activation under hypoxic conditions in ovarian cancer cells. Nucleic Acids Research, 2012. 126. Ke, X., et al., Hypoxia upregulates CD147 through a combined effect of HIF 1alpha and Sp1 to promote glycolysis and tumor progression in epithelial solid tumors. Carcinogenesis, 2012. 33 (8): p. 1598 607. 127. Hurrell, R.F., et al., Iron absorption in humans as influenced by bovine milk proteins. Am J Clin Nutr, 1989. 49 (3) : p. 546 52. 128. Andrews, N.C., M.D. Fleming, and J.E. Levy, Molecular insights into mechanisms of iron transport. Curr Opin Hematol, 1999. 6 (2): p. 61 4. 129. Kundu, S., et al., On the reactivity of mononuclear iron(V)oxo complexes. J Am Chem Soc, 2011. 133 (46): p. 18546 9.

PAGE 112

112 130. Heeney, M.M. and N.C. Andrews, Iron homeostasis and inherited iron overload disorders: an overview. Hematol Oncol Clin North Am, 2004. 18 (6): p. 1379 403, ix. 131. Cherukuri, S., et al., Unexpected role of ceruloplasmin in intesti nal iron absorption. Cell Metab, 2005. 2 (5): p. 309 19. 132. Anderson, G.J., et al., The ceruloplasmin homolog hephaestin and the control of intestinal iron absorption. Blood Cells Mol Dis, 2002. 29 (3): p. 367 75. 133. Lewin, J.S., et al., Interactive MRI guided radiofrequency interstitial thermal ablation of abdominal tumors: clinical trial for evaluation of safety and feasibility. J Magn Reson Imaging, 1998. 8 (1): p. 40 7. 134. Linderman, R.J. and J.M. Siedlecki, Selective Copper Catalyzed Coupling Reacti ons of (alpha Acetoxyhexyl)tricyclohexyltin. J Org Chem, 1996. 61 (19): p. 6492 6493. 135. Wang, F., et al., A novel murine protein with no effect on iron homoeostasis is homologous with transferrin and is the putative inhibitor of carbonic anhydrase. Bioch em J, 2007. 406 (1): p. 85 95. 136. Williams, D.M. and C.L. Atkin, Tissue copper concentrations of patients with Menke's kinky hair disease. Am J Dis Child, 1981. 135 (4): p. 375 6. 137. Danks, D.M., et al., Menkes kinky hair syndrome. An inherited defect in the intestinal absorption of copper with widespread effects. Birth Defects Orig Artic Ser, 1974. 10 (10): p. 132 7. 138. Taylor, M., et al., Hypoxia inducible factor 2alpha mediates the adaptive increase of intestinal ferroportin during iron deficiency in mice. Gastroenterology, 2011. 140 (7): p. 2044 55. 139. Boaz, T.L., et al., MR monitoring of MR guided radiofrequency thermal ablation of normal liver in an animal model. J Magn Reson Imaging, 1998. 8 (1): p. 64 9. 140. Hider, R.C., D. Bittel, and G.K. Andre ws, Competition between iron(III) selective chelators and zinc finger domains for zinc(II). Biochem Pharmacol, 1999. 57 (9): p. 1031 5. 141. Thomas, C. and P.S. Oates, Differences in the uptake of iron from Fe(II) ascorbate and Fe(III) citrate by IEC 6 cell s and the involvement of ferroportin/IREG 1/MTP 1/SLC40A1. Pflugers Arch, 2004. 448 (4): p. 431 7. 142. Thomas, C. and P.S. Oates, IEC 6 cells are an appropriate model of intestinal iron absorption in rats. J Nutr, 2002. 132 (4): p. 680 7.

PAGE 113

113 143. Lu, Y., C. Ki m, and J.F. Collins, Multiple Menkes copper ATPase (Atp7a) transcript and protein variants are induced by iron deficiency in rat duodenal enterocytes. J Trace Elem Med Biol, 2012. 26 (2 3): p. 109 14. 144. Collins, J.F., et al., Alternative splicing of the Menkes copper Atpase (Atp7a) transcript in the rat intestinal epithelium. Am J Physiol Gastrointest Liver Physiol, 2009. 297 (4): p. G695 707. 145. Lynch, S.R., et al., The effect of dietary proteins on iron bioavailability in man. Adv Exp Med Biol, 1989. 2 49 : p. 117 32. 146. Lewin, J.S., et al., Interactive MR imaging guided biopsy and aspiration with a modified clinical C arm system. AJR Am J Roentgenol, 1998. 170 (6): p. 1593 601. 147. Bunn, H.F. and R.O. Poyton, Oxygen sensing and molecular adaptation to hypoxia. Physiol Rev, 1996. 76 (3): p. 839 85. 148. Semenza, G.L., Hypoxia inducible factor 1 and the molecular physiology of oxygen homeostasis. J Lab Clin Med, 1998. 131 (3): p. 207 14. 149. Hellman, N.E. and J.D. Gitlin, Ceruloplasmin metabolism and funct ion. Annu Rev Nutr, 2002. 22 : p. 439 58. 150. Cols, N., et al., In vivo copper and cadmium binding ability of mammalian metallothionein beta domain. Protein Eng, 1999. 12 (3): p. 265 9. 151. Lutsenko, S., et al., N terminal domains of human copper transpor ting adenosine triphosphatases (the Wilson's and Menkes disease proteins) bind copper selectively in vivo and in vitro with stoichiometry of one copper per metal binding repeat. J Biol Chem, 1997. 272 (30): p. 18939 44. 152. Goodyer, I.D., et al., Character ization of the Menkes protein copper binding domains and their role in copper induced protein relocalization. Hum Mol Genet, 1999. 8 (8): p. 1473 8.

PAGE 114

114 BIOGRAPHICAL SKETCH Liwei Xie China an old city with more than 2000 years of history and raised by his grandparents and father who helped him to grow to be a strong, silent and independent man He believes this was the most precious gift that he received from his family. Before college He spent most of his time with his grandfather who sparked his passion for science. The two most valued things he learned from his grandfather were hard work and creative thinking. His high school biology teacher was also extremely influential in his life Her help changed his perspectives of biological s ciences and molded his understanding of it by demonstrating to him the importance and necessity of biomedical research in disease therapies, such as AIDS, cancer, and diabetes. She ignited his passion, and inspired his dream of becoming a scientist, and i t was her influence later on in his life that led him to switch from electrical engineering to biological sciences. As a result, he began pursuing his true passion at the State University of New York at Buffalo, where he obtained his second ee in biological s ciences While there, he gained research Sciences as an undergraduate volunteer. After the summer of 2008, he split his time between two new labs, which e xposed him to several other interesting studies such as inflammatory response and function of protein methylation. These experiences provided him with different perspectives for areas of his graduate studies, and he decided nutritional sciences would be hi s major focus. In 2009, he moved to the University of Florida to pursue his Doctor of Philosophy in nutritional science. He felt so excited to be part of an energetic and productive team. Besides working on the excellent research projects, he also had the opportunity to learn

PAGE 115

115 about nutrition from professors who are prominent experts in the area of vitamins and minerals. His Doctor of Philosophy training focused on understanding the molecular mechanisms of mineral absorption, and more broadly, it provided hi m with a fundamental and precise understanding of nutrition. His future plan is to bridge his training in nutrition to human diseases. Epidemiological studies have shown that dietary changes can have a critical effect on a vast number of diseases beyond ob esity and metabolic syndromes, such as cancer. He plans to shift his focus to studying the molecular mechanisms of carcinogenesis, and further exploring the strategy for cancer prevention and treatment Arbor has rich experience and excellent resources to study the progression of colon cancer. The post doctoral training he receives will allow him to connect his understanding of metal homeostasis with colon carcinogenesis.