<%BANNER%>

Diversity within Xanthomonas Axonopodis Poinsettiicola and Its Role as Causal Agent of Bacterial Blight in Commercial Gr...

Permanent Link: http://ufdc.ufl.edu/UFE0045087/00001

Material Information

Title: Diversity within Xanthomonas Axonopodis Poinsettiicola and Its Role as Causal Agent of Bacterial Blight in Commercial Greenhouse Ornamental Crops
Physical Description: 1 online resource (51 p.)
Language: english
Creator: Rockey, William David
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: greenhouse -- mlsa -- ornamentals -- poinsettia -- xanthomonas
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: High value ornamental crops such as poinsettia (Poinsettia), croton (Codiaeum), crown of thorns (Euphorbia), geranium (Pelargonium), and zebra plant (Aphelandra squarrosa) are often grown in close proximity in commercial glasshouse facilities throughout the world. Because of its virulence and ability to infect many genera, bacterial blight, Xanthomonas axonopodis pv. poinsettiicola (XAP), is considered to be the most serious bacterial disease causing extensive crop losses. Multiple XAP strains have exhibited the ability not only to cause leaf spots on poinsettia, but also may cause disease on other ornamentals such as croton, crown of thorns, zebra plant, and geranium. In this study, sixty-seven XAP strains were characterized via pathogenicity tests, hypersensitive response, and sequence analysis. Multilocus Sequence Analysis (MLSA) of six conserved housekeeping genes were used to sequence the Xanthomonas strains’ DNA. The genes used were gltA, gapA, fusA, gyrB, lacF, and lepA. Phylogenetic analysis resulted in multiple clusters with two main clusters suggesting two predominant species of XAP. These findings, along with the pathogenicity data for each strain, can assist epidemiologists in identifying disease sources and tracking pandemics of pathogenic XAP strains.High value ornamental crops such as poinsettia (Poinsettia), croton (Codiaeum), crown of thorns (Euphorbia), geranium (Pelargonium), and zebra plant (Aphelandra squarrosa) are often grown in close proximity in commercial glasshouse facilities throughout the world. Because of its virulence and ability to infect many genera, bacterial blight, Xanthomonas axonopodis pv. poinsettiicola (XAP), is considered to be the most serious bacterial disease causing extensive crop losses. Multiple XAP strains have exhibited the ability not only to cause leaf spots on poinsettia, but also may cause disease on other ornamentals such as croton, crown of thorns, zebra plant, and geranium. In this study, sixty-seven XAP strains were characterized via pathogenicity tests, hypersensitive response, and sequence analysis. Multilocus Sequence Analysis (MLSA) of six conserved housekeeping genes were used to sequence the Xanthomonas strains’ DNA. The genes used were gltA, gapA, fusA, gyrB, lacF, and lepA. Phylogenetic analysis resulted in multiple clusters with two main clusters suggesting two predominant species of XAP. These findings, along with the pathogenicity data for each strain, can assist epidemiologists in identifying disease sources and tracking pandemics of pathogenic XAP strains.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by William David Rockey.
Thesis: Thesis (M.S.)--University of Florida, 2012.
Local: Adviser: Norman, David J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0045087:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045087/00001

Material Information

Title: Diversity within Xanthomonas Axonopodis Poinsettiicola and Its Role as Causal Agent of Bacterial Blight in Commercial Greenhouse Ornamental Crops
Physical Description: 1 online resource (51 p.)
Language: english
Creator: Rockey, William David
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: greenhouse -- mlsa -- ornamentals -- poinsettia -- xanthomonas
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: High value ornamental crops such as poinsettia (Poinsettia), croton (Codiaeum), crown of thorns (Euphorbia), geranium (Pelargonium), and zebra plant (Aphelandra squarrosa) are often grown in close proximity in commercial glasshouse facilities throughout the world. Because of its virulence and ability to infect many genera, bacterial blight, Xanthomonas axonopodis pv. poinsettiicola (XAP), is considered to be the most serious bacterial disease causing extensive crop losses. Multiple XAP strains have exhibited the ability not only to cause leaf spots on poinsettia, but also may cause disease on other ornamentals such as croton, crown of thorns, zebra plant, and geranium. In this study, sixty-seven XAP strains were characterized via pathogenicity tests, hypersensitive response, and sequence analysis. Multilocus Sequence Analysis (MLSA) of six conserved housekeeping genes were used to sequence the Xanthomonas strains’ DNA. The genes used were gltA, gapA, fusA, gyrB, lacF, and lepA. Phylogenetic analysis resulted in multiple clusters with two main clusters suggesting two predominant species of XAP. These findings, along with the pathogenicity data for each strain, can assist epidemiologists in identifying disease sources and tracking pandemics of pathogenic XAP strains.High value ornamental crops such as poinsettia (Poinsettia), croton (Codiaeum), crown of thorns (Euphorbia), geranium (Pelargonium), and zebra plant (Aphelandra squarrosa) are often grown in close proximity in commercial glasshouse facilities throughout the world. Because of its virulence and ability to infect many genera, bacterial blight, Xanthomonas axonopodis pv. poinsettiicola (XAP), is considered to be the most serious bacterial disease causing extensive crop losses. Multiple XAP strains have exhibited the ability not only to cause leaf spots on poinsettia, but also may cause disease on other ornamentals such as croton, crown of thorns, zebra plant, and geranium. In this study, sixty-seven XAP strains were characterized via pathogenicity tests, hypersensitive response, and sequence analysis. Multilocus Sequence Analysis (MLSA) of six conserved housekeeping genes were used to sequence the Xanthomonas strains’ DNA. The genes used were gltA, gapA, fusA, gyrB, lacF, and lepA. Phylogenetic analysis resulted in multiple clusters with two main clusters suggesting two predominant species of XAP. These findings, along with the pathogenicity data for each strain, can assist epidemiologists in identifying disease sources and tracking pandemics of pathogenic XAP strains.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by William David Rockey.
Thesis: Thesis (M.S.)--University of Florida, 2012.
Local: Adviser: Norman, David J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0045087:00001


This item has the following downloads:


Full Text

PAGE 1

1 DIVERSITY WITHIN XANTHOMONAS AXONOPODIS POINSETTIICOLA AND ITS ROLE AS CAUSAL AGENT OF BACTERIAL BLIGHT IN COMMERCIAL GREENHOUSE ORNAMENTAL CROPS By WILLIAM ROCKEY A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS IN SCIENCE UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 William Rockey

PAGE 3

3 To my family, for their never ending love and continual support of my current and future en deavors

PAGE 4

4 ACKNOWLEDGMENTS I thank my committee members Drs. David J. Norman and Jeffrey B. Jones for research project. I would like to thank Drs. Neha Potnis and Ana Maria Bocsanczy for all of their help in the laboratory and having an answer for every last question I could come up with. I also thank Jeanne Yuen for all of her help in the greenhouse. My thanks to Dr. William Zettler as well for sparking my inte rest in plant pathology and steering me in the right direction toward the end of my undergraduate studies. I thank my parents for their advice, guidance, and most of all their love. I am grateful for all of your support throughout my undergraduate and grad uate studies.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGM ENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 6 LIST OF FIGURES ................................ ................................ ................................ .......... 7 ABSTRACT ................................ ................................ ................................ ..................... 8 CHAPTER 1 ORNAMENTAL CROPS ................................ ................................ ......................... 1 0 Production Values ................................ ................................ ................................ ... 10 Poinsettia ................................ ................................ ................................ ................ 11 2 XANTHOMONAS AXONOPODIS PV. POINSETTIICOLA ................................ ..... 15 Xanthomonads ................................ ................................ ................................ ........ 15 Taxonomy an d Classification Methods ................................ ................................ ... 16 3 MULTILOCUS SEQUENCE ANALYSIS OF XAP AND THE EVALUATION OF ITS DISEASE CAUSED ON COMMERCIALLY PRODUCED GREENHOUSE ORNAMENTAL PLANTS ................................ ................................ ........................ 19 Materials and Methods ................................ ................................ ............................ 21 Bacterial Strains ................................ ................................ ............................... 21 In vitro Procedures ................................ ................................ ........................... 21 Genomic DNA extraction ................................ ................................ ............ 21 PCR protocols and sequencing ................................ ................................ ........ 21 Phylogenetic analysis ................................ ................................ ................ 22 In vivo Procedures ................................ ................................ ............................ 23 Hypersensitive response assay (HR) ................................ ......................... 23 Inoculat ion assay ................................ ................................ .............................. 23 Disease assessment ................................ ................................ .................. 24 Results and Discussion ................................ ................................ ........................... 24 Phy logenetic Analysis ................................ ................................ ...................... 24 Pathogenicity and Host Range ................................ ................................ ......... 26 LIST OF REFERENCES ................................ ................................ ............................... 48 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 51

PAGE 6

6 LIST OF TABLES Table page 3 1 List of the 67 Xanthomonas strains utilized in this study including original host, date of isolation, and source ................................ ................................ ...... 29 3 2 Primers for six Xanthomonas housekeeping genes. ................................ ........... 33 3 3 Host range on 4 hosts of the 67 Xan thomonas strains utilized in this study ....... 34

PAGE 7

7 LIST OF FIGURES Figure page 3 1 Leaf spots on poinsettia caused by Xanthomonas axonopodis pv. Poinsetti icola ................................ ................................ ................................ ...... 37 3 2 Disease caused by Xanthomonas axonopodis pv. poinsettiicola ........................ 38 3 3 SYBR green gel staining of three different XAP g enes on 1% agarose .............. 39 3 4 Grouping of plants for inoculation in the greenhouse ................................ ......... 39 3 5 Necrotic zones on infected aphelandra ................................ .............................. 40 3 6 Phylogeny of the 67 Xanthomonas strains in this study ................................ .... 41 3 7 Phylogeny of the fusA gene ................................ ................................ ................ 42 3 8 Phylogeny of the gapA gene ................................ ................................ ............... 43 3 9 Phylogeny of the gltA gene ................................ ................................ ................. 44 3 10 Phylogeny of the gyrB ge ne ................................ ................................ ................ 45 3 11 Phylogeny of the lacF gene ................................ ................................ ................ 46 3 12 Phylogeny of the lepA gene ................................ ................................ ................ 47

PAGE 8

8 Abstract of Disser tation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science DIVERSITY WITHIN XANTHOMONAS AXONOPODIS POINSETTIICOLA AND ITS ROLE AS CAUSAL AGENT OF BACTE RIAL BLIGHT IN COMMERCIAL GREENHOUSE ORNAMENTAL CROPS By William Rockey December 2012 Chair: David J. Norman Major: Plant Pathology H igh value ornamental crops such as p oinsettia ( Poinsettia ), c roton ( Codiaeum ), c rown of t horns ( Euphorbia ), g eranium ( P elargonium ) and zebra plant ( Aphelandra squarrosa ) are often grown in close proximity in commercial glasshouse facilities throughout the world. Because of its virulence and ability to infect many genera, b acterial blight Xanthomonas axonopodis pv. poinse ttiicola (XAP), is considered to be the most serious bacterial disease causing extensive crop losses. Multiple XAP strains have exhibited the ability not only to cause leaf spot s on poinsettia, but also may cause disease on other ornamentals such as croton crown of thorns, zebra plant, and geranium. In this study, sixty seven XAP strains were characterized via pathogenicity tests, hypersensitive response, and sequence analysis. Multilocus sequence a nalysis (MLSA) of six c onserved housekeeping genes was use d to sequence the Xanthomonas strains The genes used were gltA gapA fusA gyrB lacF and lepA P hylogenetic analysis resulted in multiple clusters with two main clusters suggesting two predominant species of XAP. These findings, along with the pat hogenicity data for each

PAGE 9

9 strain, can assist epidemiologists in identifying disease sources and tracking pandemic s of pathogenic XAP strains.

PAGE 10

1 0 CHAPTER 1 ORNAMENTAL CROPS Ornamental plants belong to a category of plants generally grown for aesthetics, and o ften have secondary qualities, including privacy and wind protection (Davidson & Miller, 1990). Aesthetic plant species often contain desirable bark, leaves, flowers or po rtion of the plant industry. Ornamentals are grown worldwide; they are often associated with and celebrated in different cultures, such as the bonsai tree in Japan and tulips in Holland. Floriculture is a popular subgroup of ornamentals, and refers to plan ts with desirable flowers. Production Values In the United States, there are hundreds of different floriculture crops grown, imported, and distributed throughout the country. In 2011, the total crop value at wholesale over fifteen states for growers with $10,000 or more in sales was valued at $4.08 billion (USDA, 2011). California and Florida account for 45% of floriculture plant cultivation in the United State at a combined production valued of $1.94 billion, with $1.01 billion and $835 million, respectiv ely. Michigan, Texas and North Carolina complete the top five state producers, collectively accounting for $790 million in crop value. These top five states account for $2.73 billion and 67% of the fifteen state total production value (USDA, 2011). However 2011 marked a 2% drop in wholesale value from $4.15 billion to $4.08 billion. This drop was also accompanied by a reduction in total producers in the fifteen states. While 2010 had a total of 6,164 growers, 2011 recorded a 7% drop to 5,763 growers. With a reduction in the number of growers, the total area for floriculture crop

PAGE 11

11 production was also reduced. In 2011 there was a total covered area of 712 million square feet, compared to the 730 million squared feet just one year before in 2010, amounting to a 2% decrease (USDA, 2011). Large floriculture operations, with $100,000 or more in sales, also experienced a small decrease in total wholesale value for 2011. Down 1% from 2010, these operations account for 96% of the total $4.08 billion in floriculture cr ops, and totaled $3.94 billion in 2011. Large operations of ornamental crops comprise of 44% of all producers. Within the large operations industry, California accounts for 25% of total wholesale value, with Florida, Michigan, Texas, and North Carolina acc ounting for 21, 9, 6 and 6% respectively (USDA, 2011). Poinsettia The genus Euphorbia contains over one thousand species, and belongs to the Euphorbiaceae family. Within this genus is Euphorcia pulcherrima Willd. ex Klotzsch, commonly known as poinsettia. This species is native to Mexico, and was often used by Aztec Indians to make reddish purple dye, as well as to concoct medicine to treat fevers. The growth of poinsettia was limited to the present day Taxco region of Mexico, and was introduced into the Un ited States in 1825 by Joel Roberts Poinsett. Poinsett was a botanist, and while serving as the first United States Ambassador to Mexico, he had these plants sent to his home in South Carolina. After successfully cultivating them in his greenhouse, he sent them to friends around the country in the horticulture business. The plant was first sold as Euphorcia pulcherrima but the name poinsettia remains as the accepted and common name in English speaking countries ( Benson et al., 2002 ).

PAGE 12

12 The poinsettia market developed in the early 1920s. The first cultivar to gain popularity was the Oak Leaf poinsettia. From the 1920s until the 1960s, all commercial poinsettias were selections or sports from the Oak Leaf seedlings. During this period, Southern California becam e the production center for field grown poinsettias to be cut and sold as flowers. The cultivars used during this time were the Early Red and True Red varieties. In the 1950s poinsettia breeding programs started at institutions nationwide, including severa l universities, as well as the United States Department of Agriculture. Cultivation of poinsettias also reached Europe, where the Zieger Brothers of Hamburg, Germany and Thormod Hegg & Son of Reistad, Norway also began commercial poinsettia breeding progra ms ( Benson et al., 2002 ). Researchers began selecting genetic traits desired by consumers, such as stiff stems, larger bracts, color variety, and post harvest qualities. Work was led by Dr. Robert N. Stewart of the Agricultural Research Service of Beltsvil le, Maryland. With the become popular with consumers worldwide. Although there are currently over one hundred cultivars of poinsettia commercially grown, the Eckespoint F reedom cultivar accounts for over 50% of the red poinsettia market worldwide ( Benson et al., 2002 ). The poinsettia market value is determined using a program compiling data from the fifteen top producing states (USDA, 2011). The states included are Califo rnia, Florida, Hawaii, Illinois, Maryland, Michigan, New Jersey, New York, North Carolina, Ohio, Oregon, Pennsylvania, South Carolina, Texas, and Washington. The number of producers with operations totaling $100,000 or more in sales is used to quantify the amount of commercially grown poinsettias sold. From 2010 to 2011, there was a 9.5%

PAGE 13

13 decrease in the total number of poinsettia producers in the fifteen state program, declining from 677 to 613 producers. However, a slight increase in total poinsettias sold was observed from 2010 to 2011, increasing from 34.65 million to 34.72 million (USDA, 2011). In the fifteen state poinsettia production program, the top three states with the most poinsettia producers in 2011 were Pennsylvania with eighty eight growers, Ohio with seventy three, and New York with sixty two. However, the top three states with most poinsettias grown were California with 7.27 million, North Carolina with 4.41 million, and Ohio with 3.56 million. Almost all poinsettias grown are sold at wholes ale. There was a slight increase from 96% to 97% of commercially grown poinsettias sold wholesale for 2010 to 2011. The wholesale market for poinsettias can be broken down to potted plants that are less than five inches or five inches and greater. From 201 0 to 2011, both categories experienced a decrease in average price per pot. From 2010 to 2011, poinsettias in less than five inch pots dropped 8.9% from an average wholesale market value of $2.02 per plant to $1.84. For pots of five inches or more, the ave rage wholesale market price dropped from $4.65 in 2010 to $4.60 in 2011. Although the market observed an increase in the total amount of growers in the fifteen states, the total value of all sales at wholesale decreased from 2010 to 2011. In 2010, the fift een states accounted for a total wholesale value of all sales of $140.8 million, as opposed to the 1% decrease to $139.2 million in 2011 (USDA, 2011). These decreases are most likely due to the economic recession in the United States. With consumers spendi ng less and directing their available personal funds to more essential goods, smaller

PAGE 14

14 floricultural productions likely have trouble staying afloat in the market and are either bought out or are ultimately forced to close down. Poinsettia is mainly propaga ted through rooted cuttings. Although strict sanitation methods and a variety of bactericides containing copper, manganese, and/or copper may be used to control Xanthomonas outbreaks, they are often ineffective once pathogen become established in a product ion facility ( Benson et al., 2002 ). Coupled with popular usage of overhead irrigation methods, XAP infections are easily spread throughout production facilities. When growers diversify production by growing multiple genera and species of crops, as they oft en do, xanthomonads are easily spread plant to plant. In this case, damage can be extensive as the bacteria spreads to infect multiple genera.

PAGE 15

15 CHAPTER 2 XANTHOMONAS AXONOPOD IS PV. POINSE T TIICOL A Xanthomonads Xanthomonas is a genus of gram negative bacteri a encompassing over twenty five different species ( Hayward et al ., 1993). The bacteria are rod shaped, have polar flagellum, are aerobic chemoorganotrophs, and usually produce yellow xanthomonadin pigment ( Leyns et al., 1984). They are capable of causing d isease on at least 124 monocot plant species and 268 dicot plant species ( Hayward et al ., 1993). Many Xanthomonas species cause diseases of ornamental plants and agriculturally important crops. Symptoms of disease include cankers, spots, blights and necros is. Leaves, stems, and fruits may be affected. With a number of economically important ornamental plants susceptible to infection by different Xanthomonas species, up to date information about Xanthomonas is of great concern to commercial growers. Although research has led to practical control of some Xanthomonas infections, the unpredictable nature of bacterial diseases makes them a constant threat. Xanthomonas can be a seed borne pathogen, as well as a water borne pathogen. As with many bacterial pathogen s, it easily spread by splashing water. This in turn creates a huge risk for growers using over head irrigation. Therefore, the spread of infection can be reduced using ebb and flow irrigation, as well as chlorine dioxide dosed irrigation water. Commercial ly available products containing bactericidal chemicals such as copper hydroxide and benzoic acid may also help control Xanthomonas, however, they have been proven to provide much less significant control than that of ebb and flow irrigation and chlorine d ioxide dosed irrigation water (Krauthausen et al., 2011).

PAGE 16

16 Taxonomy and Classification Methods There is extensive diversity between xanthomonads. The high degree of phytopathogenic diversity in contrast to uniformity in the disease symptoms they cause pres ents an obstacle for obtaining a stable classification method for the genus. There have been multiple methods used to characterize xanthomonads, both phenotypically and genotypically ( Vauterin et al ., 2000). Initially, xanthomonads were classified using a approach in which variants exhibiting new host range or different disease symptoms were classified as separate species. In turn, the genus quickly became very complex, with over 100 Xanthomonas species named. To differentiate the rapidly growing amount of species, several phenotypic studies were performed, but the results only further illustrated the uniformity of disease in relation to phytopathogenic diversity ( Vautrin & Swings 1997). This led researchers to merge almost all Xan thomonas species into a single species, Xanthomonas campestris. Years later, this method was reevaluated and in turn, species distinguishable by a unique host range or disease were reclassified into pathovars. Along with the phenotypic characteristics, gen otypic similarities should also be conserved. This polyphasic approach is currently used for Xanthomonas classification ( Vautrin & S w ings 1997). There are several phenotypic methods for classifying xanthomonads. Some of the more common approaches include BioLog and fatty acid methyl ester (FAME) fingerprinting. These approaches develop unique microbial reports based on the utilization of different carbon sources (BioLog) or the fatty acid profile (FAME) of individual xanthomonads. However, these methods a lone are not suitable for

PAGE 17

17 distinguishing between species, as many xanthomonads may produce the same profiles. Genotypic methods are more commonly used and include DNA DNA hybridization, repetitive sequence based polymerase chain reaction (Rep PCR), 16s rRN A, amplified fragment length polymorphism (AFLP), restriction fragment length polymorphism (RFLP), and multilocus sequence analysis (MLSA). Methods like Rep PCR, AFLP, and RFLP were the standard for Xanthomonas species determination up until the late 1990s Rep PCR generates a genomic fingerprint based on primers targeting the repetitive extragenic palindrome sequences within a genome (Rademaker et al., 2000). AFLP constructs random markers throughout an entire genome and tests for their presence in compari son to related species (Ngoc et al ., 2010). RFLP analyzes the homology between sequences created using restriction enzymes within related species (Simoes et al ., 2007). Although these methods are occasionally still used in addition with other techniques, t hey have mostly been replaced by newer, more selective methods like DNA DNA hybridization and 16s rRNA gene sequencing ( Martens et al ., 2008). DNA DNA hybridization is a comparison of the overall sequence similarity between the entire genomes of two separ ate strains. Currently, for strains to be considered the same species, they must obtain 70% or higher DNA hybridization ( Martens et al ., 2008). Although DNA DNA hybridization provides an accurate comparison, its labor intensiveness, technicality, and non u niformity between methods in different laboratories, decrease its suitability as a popular technique ( Martens et al ., 2008).

PAGE 18

18 Similar to DNA DNA hybridization, 16s rRNA gene sequencing also provides a high degree of differentiation between Xanthomonas spec ies. In contrast, a measure of 70% DNA DNA hybridization relatedness correlates with 97% 16s rRNA gene similarity. However, 16s rRNA gene sequence analysis has reported identical 16s rRNA sequences between different species, and therefore presents the obst acle of setting a delineation value for different species ( Martens et al ., 2008). MLSA is a newer approach than those previously mentioned. In MLSA, housekeeping genes conserved within a genus can be sequenced and used to analyze taxonomic relationships. W hen using MLSA to compare species within the same genus, it is suggested to use at least five highly conserved genes that are universally distributed, and are present in single copies at distinct locations within their respective chromosomes. Housekeeping genes present a higher degree of sequence variance than that of 16s rRNA. Coupled with the possibility of conserved 16s rRNA gene sequences between different species, the MLSA method is considered to be superior to Rep PCR, AFLP, and RFLP for species ident ification ( Martens et al ., 2008).

PAGE 19

19 CHAPTER 3 MULTILOCUS SEQUENCE ANALYSIS OF XAP AND THE EVALUATION OF IT S DISEASE CAUSED ON CO MMERCIALLY PRODUCED GREENHOUSE ORNAMENTAL PLANTS Bacterial leaf spot of poinsettia is a major bacterial disease causing extensiv e damage and economic loss to growers. The disease begins with small pinpoint lesions, and in some cultivars, the lesions gradually grow larger, coalescing to form angular leaf spots. In most cases, the infected leaves eventually drop off (Figure 3 1). Poi nsettias are the most valuable potted ornamental plant variety grown in the United States, but are also produced in several countries worldwide. With the ubiquitous distribution of Xanthomonas. axonopodis pv. poinsettiicola (XAP) in countries with commerc ial poinsettia production, this disease presents a serious threat. Xanthomonas leaf spot was first described in 1951 in India (Patel et al., 1951). In the United States the first description of this disease was in 1960 in outdoor production of poinsettia ( McFadden & Mowry, 1962). It has since been described in every country where poinsettias are cultivated. Poinsettia is mainly propagated through rooted cuttings. Although strict sanitation methods and a variety of bactericides containing copper, manganese, and/or copper may be used to control Xanthomonas outbreaks, they are often ineffective once the pathogen becomes established in a production facility ( Benson et al., 2002 ). Coupled with popular usage of overhead irrigation methods, XAP infections are easi ly spread throughout production facilities. When growers diversify production by growing multiple genera and species of crops, as they often do, xanthomonads are easily spread plant to plant. In this case, damage can be extensive as the bacteria spreads to infect multiple genera (Figure 3 2). In this study we compare XAP strains from poinsettia

PAGE 20

20 ( Euphorbia pulcherrima ), croton ( Codiaeum variegatum (L.) A.Juss), crown of thorns ( Euphorbia milii Des Moul), and newly describe strains from zonal geranium ( Pelarg onium x h ortorum L.H.Bailey), and zebra plants ( Aphelandra squarrosa Nees.). In our MLSA analysis, we utilized six housekeeping genes fusA, gapA, gltA, gyrB, lacF, and lepA to separate closely related species. These six genes are highly conserved between xanthomonads. fusA encodes an elongation factor protein that promotes the GTP dependent translocation of the nascent protein chain from the A site to the P site in the ribosome (STRING 9.0, 2011). gapA encodes the enzyme glyceraldehyde 3 phosphate dehydrog enase ( Marcelletti et al ., 2010). gltA encodes the enzyme citrate synthase (STRING 9.0, 2011). gyrB encodes the enzyme DNA gyrase ( Marcelletti et al ., 2010). lacF encodes the enzyme ABC transporter sugar permease (STRING 9.0, 2011). lepA encodes a GTP bind ing protein (STRING 9.0, 2011). Observations of recent outbreaks of Xanthomonas in poinsettia and geranium production suggest that there may be an overlapping host range between the described species XAP and X hortorum pv pelargonii ( X HP) a nd that new, mo re virulent Xanthomonas strains may have emerged. Changes within host range between these described species may be the result of the intense multicrop production system used by growers or that original species descriptions were inaccurate. To test our hypo theses regarding host range overlap we not only did MLSA analysis but also mist inoculated poinsettia, croton, crown of thorns, zonal geranium, and zebra plants. Determining which Xanthomonas populations have potential to cause damage in these important o rnamental crops is important to growers, government regulators, and diagnosticians.

PAGE 21

21 Materials and Methods Bacterial Strains Xanthomonas strain sources and original hosts of strains used in this study are listed in Table 3 1. These 67 strains were recovere d over a 62 year period primarily from poinsettia and other crops of interest. Stra ins were routinely cultured on nutrient agar or in b roth and were stored in 15% glycerol at 80 C. In vitro Procedures Genomic DNA extraction Bacterial strains were revived from 80C storage by streaking onto NA plates and incubating at 28C. Individual colonies were then restreaked twice to limit possible contamination. After 24 hr of growth, genomic DNA was extracted using illustra bacteria genomicPrep Mini Spin kit (GE, Pittsburgh, PA). Purified DNA was stored in elution buffer at 20C. PCR protocols and sequencing Primers for the six gene loci ( fusA, gapA, gltA, gyrB, lacF, lepA ) were designed and provided by Neha Potnis (Table 3 2), University of Florida. Each PCR amp lification contained 25 L GoTaq Green Master Mix upstream and downstream primer at 10 M, and 100 ng of DNA (Hong et al ., 2012). DNA sequences was c onducted in a thermocycler (Bio Rad, Hercules, CA). A hot start of 95C for 5 min; followed by 30 cycles of 95C for 15 s, 54C for 30 s, and 72C for 60 s; and a 10 min extension at 72C in the last cycle was used (Hong et al ., 2012). The annealing temper ature was adjusted according to which gene was being amplified. The

PAGE 22

22 PCR products were electrophoresed through 1.0% agarose gel and visualized with UV light via SYBR Green Gel stain (Figure 3 3). Sanger sequencing was performed (Interdisciplinary Center for Biotechnology Research, ICBR, University of Florida, Gainesville, FL) to determine the six gene sequences for each of the 67 strains. Phylogenetic analysis To determine the phylogenetic relationships of the strains, the sequences of each of the 6 genes we re analyzed separately, as well as combined Initially, raw sequence data were assigned Phred quality scores, trimmed, and assembled using CodonCode Aligner ver. 4.0.3. for a final phylogeny tree. Sequences were aligned using CLUSTALW implemented in MEGA 5 .05 ( Tamura et al 2011; Thompson et al. 1994 ) Maximum likelihood searches were conducted using MEGA5 u tilizing the model and parameter suggested for the data matrix by Modeltest ( Posada & Crandall, 1998 ) Using the same matrix as in MEGA and the model suggested by MODELTEST, Bayesian Markov chain Monte Carlo (MCMC) phylogenetic analysis was conducted with MrBayes 3 ( Huelsenbeck et al. 2001; Ronquest & Huelsenbeck, 3003 ) Each Markov chain in the Bayesian search was started from a random tree and run 2.0 X 10 6 cycles, sampling every 100 th cycle from the chain. Four chains were run simultaneously, thre e hot and one cold. Each simulation was run twice and the default settings for the priors on the rate matrix (0 100), branch lengths (0 10), and proportion of invariant sites (0 1) were used. Stationarity of the sum of the natural log of the likelihoods of the trees in each of the four chains weighted according to the temperatures of the chains was evaluated by monitoring likelihood values graphically. The initial 100 trees in each run were discarded as burn in. The remaining trees were used to construct ma jority rule consensus trees.

PAGE 23

23 Bayesian posterior probabilities for each clade were derived from trees remaining after discarding the burn in samples. For ease of visual comparison to bootstrap values, we present these probabilities as whole numbers 0 100. P osterior probabilities greater than ( Wilcox et al. 2002 ) Four distinct clades were assigned to XAP isolates based on this analysis In vivo Procedures Hypersensitive response assay (HR) HR assays were performed in a greenhouse on tobacco ( Nicotiana tabacum cv. 'Hicks') Bacterial strains were grown for 24 hr at 28 C and bacterial cells were suspended in sterile tap water. Each suspension was adjusted to an absorbance of 0.3 at a wavelength of 600 nm, correlating to 3 5 X 10 8 CFU/mL. This concentration was used to infiltrate a 4 5 cm area of the intercostal leaf tis sue via hypodermic needle and syringe (Hibbard et al ., 1987). Infiltrated areas were checked at 24 hr post inoculation, and again after 48 hr. All infiltrations were carried out in two replicates. Inoculation assay A limited host range was conducted using all 67 strains listed in Table 3.1 Inoculations were done on three plants of the following: poinsettia (' Eckespoint Prestige Red' ), crown of thorns (' Red Splendens ), zebra plant (' Dania ), and two croton cultivars ( Gold Dust and 'Gold Star' ). Three plants of each variety were arra nged in a single block (Figure 3 4 ). Bacterial strains were incubated on NA plates at 28C for 48 hr. A suspension of each strain was spectrophotometrically adjusted (A 600 ) in saline (8 .5g/L NaCl) to 1 10 8 cfu/mL

PAGE 24

24 Approximately 150mL of this bacterial suspension was sprayed over the entire group of plants, being sure to apply an even soak to the upper and lower leaves of each plant. Immediately after applying the suspension, the plan ts in a group were bagged and allowed 24 hr to initiate infection at 100% humidity. After 24 hr, the bags were removed. The plants were checked for symptoms on a daily basis for 30 days. Inoculation assay w as repeated once as described above. Disease asses sment At the onset of symptoms, the plants were reported as showing spots. Each day the spots were checked and recorded for disease progression. Counts were recorded between 1 100 leaf spots, with plants exhibiting greater than 100 leaf spots simply marked as >100. Average leaf spot counts were tabulated from all six plants in both experiments (Table 3 2). Some geraniums inoculated with HXP strains rapidly developed wilt symptoms and were recorded as such. Large necrotic zones developed on the zebra plants (Figure 3 5) with no distinct spots; thus a rating scale was utilized as follows; (0) no symptoms, (1) 1 5 leaf spots 5 to 20 mm in size, (2) large necrotic zones developed on leaves followed by defoliation. Severity of plant symptoms were statistically compared between strains in the distinct MLSA clades using ANOVA and LSD procedures. Results and Discussion Phylogenetic Analysis MLSA analysis of the 67 strains in this study revealed at least four distinct Xanthomonas populations found infecting poinset tia (Figure 3 6). The first three clades are separated by Xanthomonas campestris pv. campestris type strain and Xanthomonas hortorum pv. pelargonii strains The first clade contains strains originally

PAGE 25

25 isolated from poinsettia, croton, geranium, zebra plant and aglaonema. Clade l contains the Xanthomonas codiaei type strain (LMG8678) described by Vauterin et al. 2000. Xanthomonas codiaei has never been described as a pathogen of geranium or aglaonema. The two X. codiaei strains isolated from geranium (X17 21, X1730) segregated into clade 1 were isolated from a greenhouse production facility that also cultivated poinsettia. Strain X1720 was isolated at the same time as X1721 from poinsettia within the same facility. The strain X661 isolated from aglaonema in 1988 is in clade I and was used this study due to a unique FAME analysis that identified it as X. a xonopodis pv. poinsettiicola rather than X. a xonopodis pv. dieffenbachia Zebra plant is a new host of Xanthomonas codiaei as it was first observed in ze bra plant production in Florida in 2011. Clade II only contains two X anthomonas strains, X870 and X874 both isolated in Florida in 1989. At the time of collection, these strains were identified as X. a xonopodis pv. poinsettiicola and were stored. These st rains are clearly separated in this MLSA study from other clades, however; no other information regarding genus and species of the host or pathogenicity expression exists regarding these strains. Clade III contains 8 strains closely related by MLSA to X. h ortorum pv pelargonii Seven of the eight were isolated from poinsettia. Four X. h ortorum pv pelargonii strains including the pathovar reference strain (LMG7314) are located in a separate clade above clade III. Clade IV contains the largest percentage of strains in this study including the pathovar reference strain for X. axonopodis pv. poinsetticola (LMG849). Strains within this cluster contain isolates taken from poinsettia, crown of thorns, and nandina

PAGE 26

26 ( Nandina domestica Thunberg). Nandina is frequ ently seen in Florida infected with an non described Xanthomonas species. FAME analysis identified isolate X1676 as an X. axonopodis pv. poinsetticola The MLSA analysis places strain X 1676 within clade IV, but it has no close counterpart. Also of intere st is that this strain produced no symptoms on any plant tested in this study. Similar clade separations were observed with individual genes in this study: fusA (Figure 3 7) gapA (Figure 3 8), gltA (Figure 3 9), gyrB (Figure 3 10), lacF (Figure 3 11), an d lepA (Figure 3 12). Our clade separations with the combined 6 genes is similar to genes that clearly separated X. codiaei from X. campestris pv. campestris X. hortorum pv pelargonii, and X. axonopodis pv begoniae However, Young did not have any XAP strains in his study. Pathogenicity and Host Range When strains of Xanthomonas are isolated from ornamental plants they are usually assigned a pathovar status based solely on host of origin without further host range testing or genetic characterization (Bull et al ., 2008; Young et al ., 1978, 2008). Thus, host range overlap between distinct pathovars or species are not noted. Also new species or strains infecting a new host a re not described simply because symptoms resemble well described species. Poinsettias were the most susceptible of all the plants tested in this study (Table 3 3). Symptoms varied from a few spots to > 100 spots per plant. Leaves with greater than 75 spot s quickly turned chlorotic and abscised X661 isolated from aglaonema was highly virulent on poinsettia but produced little to no symptoms on other host plants

PAGE 27

27 tested (Table 3 3). There were no significant differences in virulence on poinsettia between str ains in each of the clusters. Two cultivars of croton were utilized in this study Gold Dust 'Gold Star'). In this study only three strains, X1903, X1904 and the X codiaei type strain (LMG8678) produced symptoms on these cultivars. These cultivars we re reported as being very with an average of no greater than 11 spots per plant. Interestingly, other strains in clade I originally isolated from croton did not produce any symptoms on croton. To understand why this could occur one must know the history of croton production in the own plants. As economic conditions changed in the US, prop agation of cuttings shifted to Central American countries. During this same time period, selections were being made for resistance to Xanthomonas and subsequently the current crotons are more resistant than the earlier versions. Geraniums have never been c onsidered to be a host of XAP. However, strains within clades I, III, and IV produced leaf spot on zonal geranium. The highest concentration of leaf spots was observed with the X codiaei strains in clade I. As many as eleven spots were observed on indivi dual plants. However, there were no significant differences between the number of spots observed on geranium between clades I and IV. Only strains from clades III and IV produced leaf spots on crown of thorns with no symptoms being observed with strains from clades I and II. Strains from all clades produced symptoms on zebra plants. However strains from clade I were significantly ( P

PAGE 28

28 = 0.05) more severe than strains in other clades. Many of the strains in clade I were highly virulent on zebra plant formi ng large coalescing necrotic leaf spots that eventually resulted in leaf abscission. In summary, ornamental growers suffer significant crop and economic loss each year from various foliar diseases including bacterial blight caused by Xanthomonas axonopodi s pv. poinsettiicola (XAP) In particular, XAP remains a constant threat due to its continuing diversification, giving rise to new strains within the species. Newer strains appear to rapidly adapt to greenhouse conditions, crossing over to other ornamental s grown in close proximity. In addition, the optimal greenhouse conditions for various ornamentals also provide an optimal environment for several Xanthomonas species other than XAP. With this in mind, growers must stay on constant lookout for new infectio ns and remain up to date on recent outbreaks.

PAGE 29

29 Table 3 1. List of the 67 Xanthomonas strains utilized in this study including original host, date of isolation, and source Lab ID Original ID Org. Host Date of isolation Source u X54 DPI 083 6248 Poinsett ia ( Euphorbia pulcherrima ) 1983 JWM X87 PDD 225 84 Croton ( Codiaeum variegatum ) 1984 DDB X202 GWS 2705B 85 Poinsettia ( Euphorbia pulcherrima ) 1985 GWS X340 DPI P87 4567 Poinsettia ( Euphorbia pulcherrima ) 1987 JWM X349 066 2894 Poinsettia ( Euphorbia pul cherrima ) 1966 RS X350 070 4220 Crown of thorns ( Euphorbia milli ) 1970 RS X351 C. po 2 JBJ X352 071 425 Crown of thorns ( Euphorbia milli ) 1971 RS X353 066 2936 1966 RS X356 071 424 Crown of thorns ( Euphorbia milli ) 1971 RS X357 071 559 Crown of thorns ( Euphorbia milli ) 1971 RS X358 071 604 Crown of thorns ( Euphorbia milli ) 1971 RS X386 NZTCC 3278 Poinsettia ( Euphorbia pulcherrima ) 1972 NZTCC X387 NZTCC 3279 Poinsettia ( Euphorbia pulcherrima ) 1972 NZTCC X394 NZTCC 5730 Euphorbia acalyphoide s 1965 NZTCC X395 NZTCC 5779 Poinsettia ( Euphorbia pulcherrima ) 1950 NZTCC X419 Poinsettia ( Euphorbia pulcherrima ) 1988 MREC X506 A2726 Poinsettia ( Euphorbia pulcherrima ) AMA X507 A2727 Poinsettia ( Euphorbia pulcherrima ) AMA X516 A2737 Poinsettia ( Euphorbia pulcherrima ) AMA X517 A2738 Poinsettia ( Euphorbia pulcherrima ) AMA X525 A2746 Poinsettia ( Euphorbia pulcherrima ) AMA

PAGE 30

30 Table 3 1. Continued Lab ID Original ID Org. Host Date of isolation Source u X541 A2762 Poinsettia ( Euphorbia pulc herrima ) AMA X616 DPI 071 604 Crown of thorns ( Euphorbia milli ) 1971 JWM X644 DPI 066 2936 Poinsettia ( Euphorbia pulcherrima ) 1966 JWM X661 PDD 1772 88 Aglaonema Maria 1988 DDB X699 DPI P88 4093 4 Poinsettia ( Euphorbia pulcherrima ) 1988 JWM X700 DP I P88 4093 2 Poinsettia ( Euphorbia pulcherrima ) 1988 JWM X701 DPI P85 2020 Poinsettia ( Euphorbia pulcherrima ) 1985 JWM X749 PDD 539 89 Poinsettia ( Euphorbia pulcherrima ) 1989 DDB X773 DPI 88 5463 4 Croton ( Codiaeum variegatum ) 1988 JWM X808 GWS 2365B2 88 Poinsettia ( Euphorbia pulcherrima ) 1988 GWS X822 DPI 89 3258 1 Crown of thorns ( Euphorbia milli ) 1989 JWM X835 PDD 3199 89 1989 DDB X842 Crown of thorns ( Euphorbia milli ) 1989 X852 PDD 3349 89 Poinsettia ( Euphorbia pulcherrima ) 1989 DDB X870 D PI P89 4476 3 1989 JWM X874 DPI P89 4476 2 1989 JWM X879 DPI P89 5239 2 Poinsettia ( Euphorbia pulcherrima ) 1989 JWM X979 LMG568 (ATCC 33913) V Cabbage ( Brassica oleracea ) ATCC X1144 XP137 A DCH X1302 Croton ( Codiaeum variegatum ) 1991 MREC X 1505 Croton ( Codiaeum variegatum ) 1993 MREC X1634 Poinsettia ( Euphorbia pulcherrima ) 1997 MREC X1676 Nandina ( Nandina domestica ) 1998 MREC X1720 Poinsettia ( Euphorbia pulcherrima ) 2000 MREC

PAGE 31

31 Table 3 1. Continued Lab ID Original ID Org. Host Date o f isolation Source u X1721 Geranium ( Pelargonium sp.) 2000 MREC X1730 Geranium ( Pelargonium sp.) 2001 MREC X1763 Poinsettia ( Euphorbia pulcherrima ) 2002 MREC X1807 Crown of thorns ( Euphorbia milli ) 2004 MREC X1848 Poinsettia ( Euphorbia pulcherrim a ) 2010 MREC X1877 LMG849 (ATCC11643) w Poinsettia ( Euphorbia pulcherrima ) 1964? BCCM/LM G X1878 LMG7228 (ATCC8721) Geranium ( Pelargonium sp.) 1986? BCCM/LM G X1879 LMG7303 x Begonia ( Begonia sp.) BCCM/LM G X1880 LMG7314 y Geranium ( Pelargonium sp.) BCCM/LM G X1881 MEX 1 Geranium ( Pelargonium sp.) 2011 DLT X1890 MEX 11 Geranium ( Pelargonium sp.) 2011 DLT X1891 613 Poinsettia ( Euphorbia pulcherrima ) 2009 SK X1892 614 Poinsettia ( Euphorbia pulcherrima ) 2009 SK X1893 616 Poinsettia ( Euphorbia pulche rrima ) 2010 SK X1894 617 Begonia ( Begonia sp.) SK X1898 612 Poinsettia ( Euphorbia pulcherrima ) 2007 SK X1899 615 Poinsettia ( Euphorbia pulcherrima ) 2009 SK X1901 Zebra plant ( Aphelandra squarrosa) 2011 MREC X1903 Zebra plant ( Aphelandra squarros a) 2011 MREC X1904 Zebra plant ( Aphelandra squarrosa) 2011 MREC

PAGE 32

32 Table 3 1. Continued Lab ID Original ID Org. Host Date of isolation Source u X1906 LMG8678 (ATCC700187) Z Croton ( Codiaeum variegatum ) 1987 BCCM/LM G u Strains were obtained from th e following laboratories: (AMA) Anne M. Alvarez, Department of Plant Pathology, University of Hawaii at Manoa, Honolulu, HI, 96822; (ATCC) American Type Culture Collection, Manassas, VA 20108; (BCCM/LMG) Belgian Coordinated Collections of Micro organisms, Brussel, Belgium; (DAC); (DCH) Donald C. Hildebrand, Department of Plant Pathology, University of California, Berkeley, CA 94704; (DDB) D. D. Brunk, Plant Disease Diagnostics, Inc., Apopka, FL 32703; (DLT) Darryl L. Thomas, Syngenta Flowers PO Box 1349. G ilroy CA 95021; (GWS) Gary W. Simone, Department of Plant Pathology, University of Florida, Gainesville, FL 32611; (JWM) J. W. Miller, Division of Plant Industry, Florida Department of Agriculture and Consumer Services, Gainesville, FL 32602; (JBJ) Jeffrey B. Jones Department of Plant Pathology, University of Florida, Gainesville, FL 32611; (MREC) Mid Florida Research and Education Center, University of Florida, Apopka, FL 32703; (NZTCC) New Zealand Type Culture Collection; (SK) Sven Keil, IDENTXX GmbH, Ma ybachstrasse 50, 70469 Stuttgart, Germany; and (RS) Robert Stall, Department of Plant Pathology, University of Florida, Gainesville, FL 32611. v Pathovar reference strain X. campestris pv. campestris w Pathovar reference strain for X. axonopodis pv. poinsettiicola x Pathovar reference strain for X. axonopodis pv. begoniae y Pathovar reference strain for Xanthomonas hortorum pv. pelargonii z Type Stain Xanthomonas codiaei Vauterin, Hoste, Kersters and Swings 199 5

PAGE 33

33 Table 3 2 Primers for six Xanthomonas housekeeping genes. Gene Sequence Forward Reverse fusA T CTG GCS CAR GAR GAY CC T CTG GCS CAR GAR GAY CC gapA GGCAATCAAGGTTGGYATCAACG ATCTCCAGGCACTTGTTSGARTAG gltA ATCTTGATCAGGTCACGCTCAAC AGCATCTTCAGCACGGCT TCGTT gyrB AAGTTCGACGACAACAGCTACAA GAMAGCACYGCGATCATGCCTTC lacF GCTSTTCTGGAAGTCSCTST SAGRTTCCACCACTTGAAGC lepA AAGCSCAGGTGCTCGACTCCAAC CGTTCCTGCACGATTTCCATGTG

PAGE 34

34 Table 3 3 Host range on 4 hosts of the 67 Xanthomonas strains utilized in this study. Hy persensitive response on tobacco and MLSA cluster designation listed for each strain Lab ID Poinsettia ( Euphorbia pulcherrima ) leaf spot count Geranium ( Pelargon ium sp.) leaf spot count Crown of thorns ( Euphorbi a milli ) leaf spot count Zebra plant ( Aphelan dr a squarrosa) necrotic zone severity 0 2 HR MLSA cluster X54 57 3 0 0.83 IV X87 75 0 0 1 + I X202 69 0 0 1.7 + I X340 74 3 0 0.5 IV X349 42 3 0 0 IV X350 70 5 5 0 IV X351 >100 0 10 0.3 III X352 62 0 0 0.6 + IV X353 0 0 0 0.17 + IV X356 71 0 0 0 + IV X357 96 3 5 0 IV X358 76 0 0 0 + IV X386 92 0 0 0 III X387 92 0 0 0.3 III X394 >100 0 0 0 + IV X395 >100 0 0 0.3 + IV X419 96 0 0 1 + I X506 >100 2 0 1 + I X507 80 0 0 0 + IV X516 88 0 0 0.67 IV X517 >100 0 0 0.17 + IV X5 25 >100 0 0 0.3 + IV X541 >100 0 0 0 + IV X616 28 0 0 0.3 + IV X644 62 1 0 0 IV X661 73 0 0 0.17 + I X699 89 0 0 2 + I X700 85 4 0 2 + I X701 91 0 0 0.3 III X749 63 0 0 1 III X773 88 0 0 2 + I X808 55 5 0 0.17 + III X822 >100 0 9 0 IV X 835 90 0 0 0 + IV X842 58 3 13 0.5 IV X852 76 0 0 2 I

PAGE 35

35 Table 3 3 Continued Lab ID Poinsettia ( Euphorbia pulcherrima ) leaf spot count Geranium ( Pelargon ium sp.) leaf spot count Crown of thorns ( Euphorbi a milli ) leaf spot count Zebra plant ( Aphelandr a squarrosa) necrotic zone severity 0 2 HR MLSA cluster X870 63 0 0 0.17 + II X874 56 0 0 0 II X879 71 0 0 2 I LMG568 V 30 0 0 0 + pv. campestris X1144 >100 2 0 0 + IV X1302 91 0 0 2 + I X1505 >100 3 0 1.7 + I X1634 32 0 0 0 III X1676 0 0 0 0 IV X1720 83 2 0 2 I X1721 67 0 0 2 + I X1730 49 11 0 2 + I X1763 >100 1 0 2 + I X1807 25 0 0 0.17 + IV X1848 20 0 0 0.17 III LMG849 w >100 0 0 0.17 IV LMG7228 0 Wilt 0 0 pv. pelargonii LMG7303 x 0 0 0 1 pv. begoniae LMG7314 y 0 Wi lt 0 0.33 pv. pelargonii X1881 18 Wilt 0 0 + pv. pelargonii X1890 0 Wilt 2 0 + pv. pelargonii X1891 >100 0 9 0.5 + IV X1892 >100 0 0 0.17 + IV X1893 >100 0 0 0 + IV X1894 0 0 0 0.17 pv. begoniae X1898 >100 0 1 0 IV X1899 >100 0 0 0 IV X190 1 75 0 0 2 I X1903 0 0 0 1.7 I X1904 0.33 0 0 1.8 I LMG8678 Z 24 0 0 1.7 I

PAGE 36

36 Table 3 3 Continued Lab ID Poinsettia ( Euphorbia pulcherrima ) leaf spot count Geranium ( Pelargon ium sp.) leaf spot count Crown of thorns ( Euphorbi a milli ) leaf spot cou nt Zebra plant ( Aphelandr a squarrosa) necrotic zone severity 0 2 H R MLSA cluster v Pathovar reference strain X. campestris pv. campestris w Pathovar reference strain for X. axonopodis pv. poinsettiicola x Pathovar reference strain for X. axonopodis pv. begoniae y Pathovar reference strain for Xanthomonas hortorum pv. pelargonii z Type Stain Xanthomonas codiaei Vauterin, Hoste, Kersters and Swings 1995

PAGE 37

37 Figure 3 1. Leaf spots on poinsettia caused by Xanthomonas axonopodis pv. Po inset t iicola ( Photograph by William Rockey)

PAGE 38

38 a. Croton leaf spot b. Crown of Thorns leaf spots c. Aphelandra necrotic zones d. Geranium leaf spots Figure 3 2. Disease caused by Xanthomonas axonopodis pv. poinse t ti icola C roton (a), crown of thorns (b), geranium (c), and aphelandra (d) (Photophraphs by William Rockey)

PAGE 39

39 Figure 3 3. SYBR green gel staining of three different XAP genes on 1% agarose ( Photograph by William Rockey) Figure 3 4. Grouping of pl ants for inoculation in the greenhouse ( Photograph by William Rockey)

PAGE 40

40 Figure 3 5. Necrotic zones on infected aphelandra ( Photograph by William Rockey)

PAGE 41

41 Figure 3 6. Phylogeny of the 67 Xanthomonas strains in this study. Phylogeny based on the con catenated data set of fragments of the genes fusA gap A gltA gyrB lacF and lepA

PAGE 42

42 Figure 3 7. Phylogeny of the fusA gene

PAGE 43

43 Figure 3 8. Phylogeny of the gapA gene

PAGE 44

44 Figure 3 9. Phylogeny of the gltA gene

PAGE 45

45 Figure 3 10. Phylogeny of the gyrB gene

PAGE 46

46 Figure 3 11. Phylogeny of the lacF gene

PAGE 47

47 Figure 3 12. Phylogeny of the lepA gene

PAGE 48

48 LIST OF REFERENCES 1. Davidson, J.A. and Miller, D.R. 1990. 3.9.8 Ornamental Plants. World Crop Pests. Vol. 4B. Elsevier, Amsterdam, the Netherlands. pp603 632. 2. Benson, D.M., J.L. Hall, G.W. Moorman, M.L. Daughtrey, A.R. Chase, and K.H. Lamour. 2002. The history and diseases of poinsettia, the Christmas flower. Plant Health Progress doi:10.1094/PHP 202 0212 01 RV. 3. Bull, C.T., De Boer, S.H., Denny, T.P., Firrao, G., Fisch er Le Saux, M., Saddler, G. S.,Scortichini, M., Stead, D.E., and Takikawa, Y. 2008. Demystifying the namencluture of bacterial plant pathogens. J Plant Pathol. 90:403 417. 4. Chase, A.R. 1985. Bacterial leaf spot of Codiaeum variegatum cultivars caused by X anthomonas campestris pv. poinsettiicola Plant Pathology 34: 446 448. 5. USDA (United States Department of Agricutlure). 2011. Floriculture Crops 2011 Summary. Washington, DC. 6. Hayward, AC (1993). The host of Xanthomonas In: Xanthomonas ; pp. 51 54. J.G. S wings and E.L. Civerolo (eds.); Chapman & Hall, London, United Kingdom 7. Hibberd, A.M., Stall, R.E., and Bassett, M.J. 1987. Different phenotypes associated with incompatible races and resistance genes in bacterial spot disease of pepper. Plant Disease 71: 1075 1078 8. Hong, J.C., Norman, D.J., Reed, D.L., Momol, M.T., and Jones, J.B. 2012. Diversity Among Ralstonia solanacearum Strains Isolated from the Southeastern United States. Phytopathology 102:924 936. 9. Huelsenbeck, J. P., F. Ronquist, R. Nielsen, and J. P. Bollback. 2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294:2310 2314. 10. Krauthausen, HJ., Norbert, L., and Wohanka, W. 2011. Methods to reduce the spread of black rot pathogen, Xanthomonas campestris pv. canpe stris in brassica transplants. Journal of Plant Diseases and Protection 118:7 16. 11. Leyns, F., De Cleene, M., Swings, J., and De Ley, J. 1984. The Host Range of Genus Xanthomonas The Botanical Review 50:308 356. 12. Marcelletti, S., Ferrante, P., and Scorti chini, M. 2010. Multilocus Sequence Typing Reveals Relevant Genetic Variation and Different Evolutionary Dynamics among Strains of Xanthomonas arboricola pv. juglandis. Diversity 2:1205 1222.

PAGE 49

49 13. Martens, M., Dawyndt, P., Coopman, R., Gillis, M., De Vos, P., and Willems, A. 2008. Advantages of multilocus sequence analysis for taxonomic studies: a case using 10 housekeeping genes in the genus Ensifer (including former Sinorhizobium ). International Journal of Systematic and Evolutionary Microbiology 58:200 214 14. McFadden, L. A., and Mowry, H. R. 1962. Bacterial leaf spot disease of poinsettia in Florida. Plant Dis. Rep. 46:551 554. 15. Ngoc, L., Verniere, C., Jouen, E., Ah You, N., Lefeuvre, P., Chiroleu, F., Gagnevin, L., Pruvost., O. Amplified fragment length pol ymorphism and multilocus sequence analysis based genotypic relatedness among pathogenic variants of Xanthomonas citri pv. citri and Xanthomonas campestris pv. bilvae International Journal of Systematic and Evolutionary Microbiology 60:515 525. 16. Patel, M. K., Bhatt, V. V., and Kulkarni, Y. S. 1951. Three new bacterial diseases of plants from Bombay. Indian Phytopathol. 4:144.151. 17. Posada, D., and K. A. Crandall. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14:817 818. 18. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731 2739. 19. Rademake r, J., Hoste, B., Louws, F., Kersters, K., Swings, J., Vauterin, L., Vauterin, P., de Bruijn, F. 2000. Comparison of AFLP and rep PCR genomic fingerprinting with DNA DNA homology studies: Xanthomonas as a model system. International Journal of Systematic a nd Evolutionary Microbiology 50:665 677. 20. Ronquist, F., and J. P. Huelsenbeck. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572 1574. 21. Simoes, T., Goncalves, E., Rosato., Y., and Mehta, A. 2007. Differentiation of Xanthomonas species by PCR RFLP of rpf B and atp D genes. FEMS Microbiol. Lett 271:33 39. 22. STRING 9.0 Search Tool for the Retrieval of Interacting Genes/Proteins. Faculty of Health Sciences, Novo Nordisk Foundation Centre for Protein Research, University of Copenhagen, Denmark. 2011. 23. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol.

PAGE 50

50 24. Th ompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignments through sequence weighting, position specific gap penalties and weight matrix choice. Nucl. Acids Res. 22:4673 4680. 25. Wil cox, T. P., D. J. Zwickl, T. A. Heath, and D. M. Hillis. 2002. Phylogenetic relationships of the dwarf boas and a comparison of Bayesian and bootstrap measures of phylogenetic support. Molecular Phylogenetics and Evolution 25(2):361 371. 26. Vautrin, L., and Swings, J. 1997. Are classification and phytopathological diversity compatible in Xanthomonas ? Journal of Industrial Microbiology & Biotechnology 19:77 82. 27. Vauterin, L., Rademaker, J., and Swings, J. 2000. Synopsis on the taxonomy of the genus Xanthomonas Phytopathology 90:677 682. 28. Young, J. M., D. W. Dye, J. F. Bradbury, C. G. Panagopoulos, and C. F. Robbs. 1978. A proposed nomenclature and classification for plant pathogenic bacteria. New. Zeal. J. Agr. 21:153 177. 29. Young, J.M., Park, D.C., Shearman, H .M., and E. Fargier. 2008. A multilocus sequence analysis of the genus Xanthomonas Systemic and a pplied Microbiology 31: 366 377.

PAGE 51

51 BIOGRAPHICAL SKETCH William Rockey was born in Flagler Beach, FL, USA. He graduated from Palm Coast Flagler High School in 2005 and attended the University of Central Florida from 2005 2007. He transferred to the University of Florida in 2008 to pursue a Bachelor of Science degree in Biology. He graduated in May 2010 and started his Master of Plant Pathology degr ee studies in August 2010 at the University of Florida. Before graduating in December 2012, he conducted research on Xanthomonas axonopodis pv. poinsettiicola and its role as the causal agent of bacterial blight on several ornamental plant varieties.