<%BANNER%>

Generation of Human Induced Pluripotent Stem Cells as Isogenic Cellular Model for Myotonic Dystrophy Type 1

Permanent Link: http://ufdc.ufl.edu/UFE0045082/00001

Material Information

Title: Generation of Human Induced Pluripotent Stem Cells as Isogenic Cellular Model for Myotonic Dystrophy Type 1
Physical Description: 1 online resource (43 p.)
Language: english
Creator: Xia, Guangbin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: cell -- cellular -- dystrophy -- model -- muscle -- pluripotent -- stem
Clinical Investigation (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Dystrophia Myotonica type 1(DM1) is an autosomal dominant multisystem disorder. There is currently no effective therapy. Disease-specific induced pluripotent stem (iPS) cell lines would provide a translational platform for DM1 studies The study was approved by the University of Florida Institutional  Review  Board.  Dermal fibroblast (passage 3) derived from skin punch biopsies obtained from 2 DM1 patients with different CTG repeats and a 51-year-old healthy male were used for reprogramming. Traditional Yamanaka factors (hOct4, hSox2, hKlf4, hc-Myc) were transduced by retroviral infection.  The iPS cell lines were characterized by morphology, RT-PCR and immunofluorescence assay of stem cell markers. Pluripotency was assessed by in vitro embryoid body-mediated  differentiation.  Generation of neural stem cells (NSC) and in vitro neural differentiation were  assessed using morphological analyses and immunofluorescence stains of a specific NSC marker (Nestin), neuronal markers (neurofilament H, beta-tubulin III) and an astrocytic marker (GFAP).  Intranuclear foci was detected by RNA fluorescence in situ hybridization (FISH). We have generated two DM1 iPS cell lines and a normal control iPS cell line. DM 1 iPS and control iPS cell clones showed typical stem cell growth patterns in culture with high nuclear/cytoplasm ratio with normal karyotype. The iPS colonies maintained the same growth pattern through subsequent passages. All iPS cell lines expressed stem cell markers(Oct4, Nanog, Sox2, SSEA4) by RT-PCR and immunocytofluorescence  and differentiated into three embryonic layer cells in vitro through embryoid body formation. Upon in vitro neural differentiation, control iPS cells underwent normal differentiation from neurospheres, neural rosettes, and neural stem cells to neural cells.  The pathognomonic feature of intranuclear foci were detected in iPS cells, neural stem cell and terminally differentiated all three embryonic layer cells. In conclusion, we have established disease-specific human DM 1 iPS cell lines. These mutant iPS cells have hESC features and  the potential to in vitro differentiation. Pathognomonic intranuclear foci were detected in iPS cells, neural stem cell and terminally differentiated all three embryonic layer cells. The DM1 disease-specific iPS cells can provide unlimited cell resource for mechanistic studies and function as a translational platform for therapeutic drug development  and cell replacement therapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Guangbin Xia.
Thesis: Thesis (M.S.)--University of Florida, 2012.
Local: Adviser: Limacher, Marian C.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0045082:00001

Permanent Link: http://ufdc.ufl.edu/UFE0045082/00001

Material Information

Title: Generation of Human Induced Pluripotent Stem Cells as Isogenic Cellular Model for Myotonic Dystrophy Type 1
Physical Description: 1 online resource (43 p.)
Language: english
Creator: Xia, Guangbin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: cell -- cellular -- dystrophy -- model -- muscle -- pluripotent -- stem
Clinical Investigation (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Dystrophia Myotonica type 1(DM1) is an autosomal dominant multisystem disorder. There is currently no effective therapy. Disease-specific induced pluripotent stem (iPS) cell lines would provide a translational platform for DM1 studies The study was approved by the University of Florida Institutional  Review  Board.  Dermal fibroblast (passage 3) derived from skin punch biopsies obtained from 2 DM1 patients with different CTG repeats and a 51-year-old healthy male were used for reprogramming. Traditional Yamanaka factors (hOct4, hSox2, hKlf4, hc-Myc) were transduced by retroviral infection.  The iPS cell lines were characterized by morphology, RT-PCR and immunofluorescence assay of stem cell markers. Pluripotency was assessed by in vitro embryoid body-mediated  differentiation.  Generation of neural stem cells (NSC) and in vitro neural differentiation were  assessed using morphological analyses and immunofluorescence stains of a specific NSC marker (Nestin), neuronal markers (neurofilament H, beta-tubulin III) and an astrocytic marker (GFAP).  Intranuclear foci was detected by RNA fluorescence in situ hybridization (FISH). We have generated two DM1 iPS cell lines and a normal control iPS cell line. DM 1 iPS and control iPS cell clones showed typical stem cell growth patterns in culture with high nuclear/cytoplasm ratio with normal karyotype. The iPS colonies maintained the same growth pattern through subsequent passages. All iPS cell lines expressed stem cell markers(Oct4, Nanog, Sox2, SSEA4) by RT-PCR and immunocytofluorescence  and differentiated into three embryonic layer cells in vitro through embryoid body formation. Upon in vitro neural differentiation, control iPS cells underwent normal differentiation from neurospheres, neural rosettes, and neural stem cells to neural cells.  The pathognomonic feature of intranuclear foci were detected in iPS cells, neural stem cell and terminally differentiated all three embryonic layer cells. In conclusion, we have established disease-specific human DM 1 iPS cell lines. These mutant iPS cells have hESC features and  the potential to in vitro differentiation. Pathognomonic intranuclear foci were detected in iPS cells, neural stem cell and terminally differentiated all three embryonic layer cells. The DM1 disease-specific iPS cells can provide unlimited cell resource for mechanistic studies and function as a translational platform for therapeutic drug development  and cell replacement therapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Guangbin Xia.
Thesis: Thesis (M.S.)--University of Florida, 2012.
Local: Adviser: Limacher, Marian C.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0045082:00001


This item has the following downloads:


Full Text

PAGE 1

1 GENERATION OF HUMAN INDUCED PLURIPOTENT STEM CELLS AS ISOGENIC CELLULAR MODEL FOR MYOTONIC DYSTROPHY T YPE 1 By GUANGBIN XIA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Guangbin Xia

PAGE 3

3 To my father Enz h en Xia who has taught me not to be just a passenger in this wonderful world but to leave something valuable behind

PAGE 4

4 ACKNOWLEDGMENTS I thank my mentor Dr. Tets uo Ashizawa for his continuous support and providing great opportunities for me to pursue my s c i e nce interest. I thank Dr. Naohiro Terada and Dr. Katherine E Santostefano for their assistance and guidance in establishing the iPS cell lines. This work supported in part by the NIH/NCATS Clinical and Translational Science Award to the University of Florida UL1 TR000064.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 INTRODUCT ION ................................ ................................ ................................ .... 11 2 METHODS ................................ ................................ ................................ .............. 15 Reagents and Cells ................................ ................................ ................................ 15 Clinical Information of Study Subjects ................................ ................................ ..... 15 Skin Biopsy and Culture of Human Dermal Fibroblasts ................................ .......... 16 Southern Blot ................................ ................................ ................................ .......... 16 Generation of iPS C ell L ines ................................ ................................ ................... 17 Characterization of iPS C ells Lines ................................ ................................ ......... 18 Embryoid Body For mation ................................ ................................ ...................... 19 Neural Differentiation ................................ ................................ .............................. 19 RNA FISH ................................ ................................ ................................ ............... 20 Immunocytofluorescence Staining and RNA FISH Plus Immunocytofluroscence ... 21 3 RESULTS ................................ ................................ ................................ ............... 23 Confirmation of Expansion and in vitro Instability of CTG Repeats in DM1 Fibroblast Cells ................................ ................................ ................................ .... 23 Outcomes ................................ ................................ ................................ ............... 23 Reprogramming Efficiency is Similar for DM1 and Control iPS Cell Generation ................................ ................................ ................................ .... 23 DM1 and Control iPS Cells Have Stem Cell Featur es ................................ ...... 23 DM1 iPS Cells are Pluripotent and Intranuclear RNA Foci are Present Within Stem Cells and Terminally Differentiated Cells ................................ .. 24 DM1 and Control iPS Cells Undergo Normal Process in vitro Lineage directed Neural Differentiation ................................ ................................ ....... 24 Intranuclear RNA Foci are Formed in Neural Stem Cell and Terminally Differentiated Neurons and Astrocytes ................................ .......................... 25 4 DISCUSSION ................................ ................................ ................................ ......... 33 LIST OF REFEREN CES ................................ ................................ ............................... 37

PAGE 6

6 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 43

PAGE 7

7 LIST OF TABLES Table page 2 1 Summary of subjects ................................ ................................ .......................... 22

PAGE 8

8 LIST OF FIGURES Figure page 3 1 Southern blot of genomic DNA isolated from cultured fibroblast cells. ............... 25 3 2 Retroviral infection ................................ ................................ .............................. 26 3 3 T ypical DM1 and control iPS colonies growing on MEF ................................ ..... 27 3 4 RT PCR products of stem cell markers ................................ .............................. 27 3 5 iPS stained colonies ................................ ................................ ........................... 28 3 6 DM1 03 EBs ................................ ................................ ................................ ....... 29 3 7 Endodermal and mesodermal cell differentiation ................................ ................ 30 3 8 Intranuclear foci presence ................................ ................................ .................. 31 3 9 DM1 iPS and normal control iPS cells ................................ ................................ 31 3 10 RNA FISH plus immunocytofluorescence staining of neural markers ................. 32

PAGE 9

9 Abstract of Thesis Pr esented to the Graduate School of the University of Florida in Partial Fulfill ment of the Requirements for the Degree of Master of Science GENERATION OF HUMAN INDUCED PLURIPOTENT STEM CELLS AS ISOGENIC CELLULAR MODEL FOR MYOTONIC DYSTROPHY T YPE 1 By Guangbin Xia December 2012 Chair: Marian C Limacher Major: Medical Science s Clinical and Translational Science Dystrophia Myotonica type 1 (DM1) is an autosomal dominant multisystem disorder with no currently effective therapy. We h ypothesized that d isease specific induced pluripotent stem (iPS) cell lines would provide a translational platform for DM1 stud ies The study was approved by the University of Florida Institutional Review Board. Dermal fibroblast s (passage 3) derived from skin punch biopsies obtained from 2 DM1 patients with different CTG repeats and a 51 year old healthy male were used for reprogramming. Traditional Yamanaka factors (hOct4, hSox2, hKlf4, hc Myc) were transduced by retroviral infection. The iPS cell lines were characterized by morphology, reverse transcriptase PCR ( RT PCR ) and immunofluorescence assay of stem cell markers. Pluripotency was assessed by in vitro embryoid body mediated differentiation. Generation of neural stem cells (NSC) and in vitro neural differentiation were assessed using morphological analyses and immunofluorescence stains of a specific NSC marker (Nestin), neur onal markers (neurofilament H, beta tubulin III) and an astrocytic marker

PAGE 10

10 (GFAP). Intranuclear foci w ere detected by RNA f luorescence in situ hybridization ( FISH) We generated two DM1 iPS cell lines and a normal control iPS cell line. DM1 iPS and control iPS cell clones showed typical stem cell growth patterns in culture with high nuclear/cytoplasm ratio with normal karyotype. The iPS colonies maintained the same growth pattern through subsequent passages. All iPS cell lines expressed stem cell markers (Oct4, Nanog, Sox2, SSEA4) by RT PCR and immunocytofluorescence and differentiated into three embryonic layer cells in vitro through em bryoid body formation. Upon in vitro neural differentiation, control iPS cells underwent normal differentiation from neurospheres, neural rosettes, and neur al stem cells to neural cells. The pathognomonic feature s of intranuclear foci were detected in DM1 iPS cells and neural stem cell s, and terminally differentiated all three embryonic layer cells. In conclusion, w e have established disease specific human DM1 iPS cell lines. These mutant iP S cells have hESC features and the potential for in vitro different iation. Pathognomonic intranuclear foci were detected in iPS cells, neural stem cell and termi nally differentiated all three embryonic layer cells. The DM1 disease specific iPS cells can provide unlimited cel l resource s for mechanistic stud ies and can func tion as a translational platform for future therape utic drug development and cell replacement therapy.

PAGE 11

11 CHAPTER 1 INTRODUCTION Dystrophia Myotonica type 1 ( DM 1) is a dominantly inherited genetic disorder that is the most common cause of muscular dystrophy in adults affecting one in 8500 individuals worldwide 1 Theoretically, the incidence should decrease with the prevalence of genetic testing and genetic counseling. However, the general pool of the population who carry the pre mutated allele won't change. Thus, we do not expe ct a significant change in DM1 incidence as the desc e ndents of this population will be eventually affected due to the common phenomenon of anticipation meaning the expansion will further expand and cause early onset and severe type. In fact, most DM1 are identified without a family history. Simply providing genetic counseling for the affected families won't eliminate the mutant gene. The disease is caused by an unstable CTG nucleotide repeat expansion within the dystrophia myotonica protein kinase(DMPK) 3 untranslated region on chromosome 19q13.3 2 DM1 is a multis ystemic disorder. In classic form, the major features include impaired muscle relaxation (myotonia), muscle wasting, cardiac conduction defects, cardiomyopathy, insulin resistance, frontal balding and early onset cataracts. Much has been known about these features through tran s genic, knockout mice and in vitro fibroblast cell and myoblast cells cultures (summarized in recent reviews) 3 7 One other feature of DM1 is central nervous system ( CNS ) involvement. The CNS involvement in DM1 is presented by low intellectual and cognitive abilities manifested by memory impairment, poor executive function, and psychiatric disorders including personality abnormalities in the adult and mental retardation, a utism spectrum disorder, attention deficit hyperactivity disorder ( ADHD ) in the congenital form 8 15 The impairment is

PAGE 12

12 generally correlated to CTG expansion size 8 14 However, the further study of this disorder is limited by d ifficulty in getting viable CNS cells. DM1 is considered a disease of splicenopathy. Two a ntagonistic splicing factor families muscleblind like 1 ( MBNL) and CUG binding protein 1( CUGBP1)/ Elav like family member (CELF1) proteins, are particularly affected 16 25 In normal embryonic stage, MBNL1 nuclear levels are low and CUGBP1 levels are high. During development, MBNL1 nuclear levels increase w hile CUGBP1 levels decrease, inducing an embryonic to adult transition of downstream splice targets. In DM1, MBNL1 is sequestered by CUG repeats in intranuclear foci, resulting in a decrease of functional MBNL1, while CELF1 function is upregulated due to h yperphosphorylation and protein stabilization via activation of PKC (as review ed elsewhere) 18 26 28 This simulates the embryonic condition and enhances expression of embryonic splicing profiles of MBNL and CELF 1 targeted transcripts in adults 29 32 The aberrant splicing of insulin receptor ( exclusion of exon 11), chloride channel 1 (inclusion of exons containing stop codons) and cardiac troponin (exclusion of exon 5) have been correlated to clinical manifestations of insulin resistance, myo tonia and cardiac conduction block/cardiomyopathy 33 35 The underlying molecular mecha nism for CNS involvement might also be related to aberrant splicing MAPT aberrant splicing ha s been found in DM1 brain s. Different from other neurodegenerative disorders, pathological tau is mainly the shortest isoform with reduction of exon 2 inclusion 36 39 Exon 3, 6 and 10 inclusion are also reduced but not as consistently detected as exon 2 18 38 41 Interestingly, the inclusion or exclusion of the exons is not induced by a one specific splicing factor. For example, the inclusion of

PAGE 13

13 exons 2/3 is repressed by ETR 3 39 while the inclusion of exon 10 is repressed by CELF2 36 MBNL1 seems to be less important in the brain than it is in the muscle tissues 38 42 Other aberrantly spliced genes in human brai n include APP, and SORBS1, DCLK1, CAMK2D, CACNA1D, NMDAR which were also identified in MBNL 1 and MBNL 2 knockout mice 42 43 However, the above findings are only isolated reports and were mainly restricted to animal studies or autopsy tissues which are from patients with advanced stage disease and m u ltiple confounding factors from age an d comorbidities prior to death. The therapeutic modalities for DM1 are limited to symptomatic and supportive care Multi d isciplin ary care has greatly increased the patient quality of life. In particular, prophylactic pacemaker placement has dramatically reduced sudden cardiac death. However, no treatment has been able to prevent the progre ssion of this daunting disease. Recent ly t herapeutic development targeting neutralization or eliminatio n of expanded RNA foci ha s provide d hope Multiple approaches, including ribozymes antisense o ligonucleotides (ASO) and chemicals (pentamidine and small molecules) have been developed and show promising results 44 50 ASO 49 p entamidine 47 and small molecules 50 are the most promising approaches. However, the se studies have been limit ed to animal models. H uman induced pluripotent ( h iPS) cells are generated by direct reprogram m ing of human somatic cells. These hiPS cells possess many of the properties of human embryonic stem cells ( hESC ) and have the potential to differentiate into most tissue types in the human embryo including cardiomyocytes and neural cells 51 56 The major advantage of human iPS cells over hESC is that they overcome most of the limitations

PAGE 14

14 of hESC The patient specific iPS cel l lines eliminate the ethical and immune rejection concerns. The most anticipated clinical application of iPS cell technology is for personalized cell therapy. Other potential application s of iPS cells are mechanistic studies and therapeutic drug developme nt. Disease specific iPS cells will preserve the genetic mutation carried by the patient on the functional human genomic background, which cannot be accomplished in animal models. In this study, we proposed to establish two DM1 hiPS cell lines and o ne normal hiPS cell line. The human iPS cells and differentiated progenies will contain the pathognom on ic features of DM1 cells These cells will be ideal for mechanistic studies therapeutic drug development and studies for future cell replacement therapy

PAGE 15

15 CHAPTER 2 METHODS Reagents and Cells Culture medium: Media for iPS cells culture (DMEM/F12, 20% KSR, Glutamax, 2 Mercaptoethanol, Sodium Pyruvate, MEM NEAA, penicillin/streptomycin), recombinant human fibroblast growth factor basic (FGFb)(#PHG00 21), recombinant human epidermal growth factor (Hu EGF) (#PHG0311L), and SuperScript III Reverse Transcriptase (#18080) were purchased from Invitrogen (Eugene, OR). Defined Cryopreservation Medium for hESC and hiPSCs (#05854), ACCUTASETM (#07920), Anti O ct 3/4 (#01550), Anti SSEA 4 (#01554), FITC conjugate d goat anti mouse IgG (#10210), Heparin (#07980), Y 27632 ROCK inhibitor (#071 71), AggreWellTM 800 (#27865), STEMdiffTM Neural Induction Medium (#05831), STEMdiffTM Neural Rosette Selection Reagent (#058 32), NeuroCultTM NS A proliferation kit (#05751) and NeuroCultTM NS A Differentiation kit (#05752) were purchased from STEMCELL Technologies (Vancouver, BC, Canada). Poly L Ornithine (#P4957), Laminin (#L2020), and Mitomycin (M4287) were purchased from Sig ma Aldrich (St. Louis, MO). The following antibodies were purchased from the companies in dicated : Nestin and alpha fetoprotein (AFP) R&D, Minneapolis, MN ; Neurofilament H (#2836), Cell Signaling Boston, MA ; GFAP (#NB300 41A), Novus Biologicals, Littleton, CO ; beta Tubulin III (#CBL 412 X), Millipore Billerica, MA ; and Desmin Lab Vision Kalamazoo, MI Slides were purchased from ibidi GmbH Martinsried, Germany Clinical I nformation of Study Subjects This study was approved by the Un iversity of Florida Institutional Review Board. All subjects provided written c onsent. Nine subjects were recruited ( T able 2 1).

PAGE 16

16 Fibroblasts were collected as described below for all of them. Two DM1 and one normal control were selected for reprogramming. DM1 03 is a 46 year old Caucasian male with symptoms onset at the age of 25. At the time of biopsy, he had severe myotonia, cataracts (removal surgery at the age of 30) dysphagia ( p ercutaneous endoscopic gastrostomy (PEG) placed at age 43), conduction blo ck ( pacemaker placed at age of 45), hypersomnia and cognitive impairment, but still functioned independently with his activities of daily living. DM1 05 is a 45 year old Caucasian female with symptom onset at the age of 26. She suffered from myotonia, mild dysphagia, no conduction block, no cataracts, and no diabetes, some cognitive impairment, but functioned well bot h socially and occupationally. The n ormal control subject was a 5 1 year old Caucasian male with no medical problems Skin Biopsy and Culture of Human Dermal Fibroblasts Skin biopsies were performed under local anesthesia by once time punch biopsy (6mm in diameter) in the lateral thigh at the middle level between gluteal fold and popliteal fossa. Biopsy specimens were processed into 0.5mm cubes with scissors and scaples in culture dish es and placed into duplicate 25cm2 flask s and cultured in primary culture medium (DMEM with 20% FBS). When fibroblast cells from adjacent explants started merging (after a mean 2 weeks) the flasks were treated with 0.05% Trypsin/EDTA and passed to a 75cm 2 flask and further expand when cells get 90% confluent. Cells at passage 3 were used for reprogramming. Southern Blot High molecular weight DNA was extracted from DM1 fibroblasts cells using conventional metho ds. Five microgram s of DNA was digested by NcoI and separated by 0.5% agarose gel before transferring to a Nitran supercharged membrane, which was

PAGE 17

17 hybridized overnight at 74 C with a DM1 probe. This probe is 777 b ase pair long PCR product amplified from a region of the DMPK gene located upstream of the CTG repeat (Forward primer 5' TGCCTCAGACCTGCTGCCCA 3', reverse primer 5' AACCCAATGCAGCCCAGGGC 3'). Generation of iPS C ell L ines Reprogramming was performed with the four traditional Yamanaka factors using r etroviral vectors 53 Retroviruses, one for each of the four reprogramming factors (i.e. Oct4, Sox2, Klf4, and c Myc) and enhanced green fluorescent protein (EGFP), w ere individually packaged using a 293FT human embryonic kidney cell line (Invitrogen). After 72 hours of virus production, cell supernatant was filtered through a 0.45M pore size filter, and the virus was concentrated by centrifugation for 16 hours at 8,000 xg at 4 C. Oct4, Sox2, Klf4, and c Myc viruses were combined an d used for transduction. One day prior to transduction, fibroblasts were plated at a density of 1x10 5 cells per 9.5cm 2 cell culture dish in DMEM containing 15% FBS. Transduction efficiency was monitored using additional fibroblasts retrovirally transduced with EGFP virus alone. On D ay 5 after transduction, each 9.5cm 2 plate was passaged to a 56cm 2 dish with feeders (6.7x10 5 mitomycin C mitotically inactivated mous e embryonic fibroblasts (MEFs). On Day 6, the medium was changed from DMEM con taining 15% FBS t o iPS medium. Half of the media was removed and replaced with fresh iPS medium every other day (Day s 8, 10, 12, etc ) until colonies were ready to be pick ed up. mFreSR freezing medium (STEMCELL Technologies) was used to prepare iPS cells frozen stocks.

PAGE 18

18 Cha racterization of iPS C ells L ines Morphology. iPS cells were cultured with MEF feeders. The morphology of iPS cell clones was examined and compared to that of human embryonic stem cells (hESCs) by growing pattern, nuclear/ cytoplasm ratio. RT PCR of stem cell markers Total RNA was extracted from fibroblasts (passage 4) and iPS cells (passage 13 of DM1 03 and DM1 05, passage 15 of normal control) using RNaeasy Micro Kit (Qiagen, Valencia, CA). cDNA was synthesized using SuperScript III Reverse Transcriptas e (Invitrogen) from 1g total RNA in a final volume of 20l. 1 L was used for subsequent PCR. Stem cell marker RT PCR was performed using primers targeting endogenous human OCT4, SOX2, NANOG and MYC. Electrophoresis of the PCR products was carried out on a 1.6% agarose gel. Alkaline phosphatase activity assay and i mmunocytofluorescence staining of stem cell markers Slides. Three to five iPS clumps (around 100 cells) were seeded into chambers with feeders and cult ured for 2 3 days to allow the colonies to expand. For the alkaline phosphatase activity assay, the chamber was incubated with a Liquid Fast Red Substrate System (Thermo Scientific, #TA 060 AC) overnight at 4 C. Nuclear transcription factor Oct4 and cell surface marker SSEA4 were examined by immunocytofluorescence staining. The slides were washed with phosph ate buffer ed saline ( PBS ) and fixed in 4% paraformaldhyde for 5 minutes, permeabilized with 0.3% Triton X 100 for 15 minutes, blocked with 10% normal goat serum (Vector Laboratories) for 30 minutes and incubated with Oct4 or SSEA4 (1:100) overnight at 4 C. The slides were washed and incubated with goat anti mouse FITC conjugated secondary antibody (1:500) (StemCell Technologies) for 30 minutes. Slides were washed and mounted with VECTASHIELD mounting medium with DAPI

PAGE 19

19 (Vector Laboratories). Pictures were taken using an Olympus IX81 DSU Spinning Disk confocal microscope. Prolonged self renewal iPS cells were passaged at a 1:4 ratio approximately ever y 4 5 days and were maintained to passage 20 for DM1 03 and DM1 05 and passage 21 for normal control iPS cells Over this time, iPS cell growth pattern an d morphology did not change. Embryoid Body Formation Undifferentiated colonies ( passage 17 of DM1 03, passage 16 of DM1 05 and passage 17 of normal control iPS) were collected and resuspended in 3 mL accutase and incubated for 25 min at 37 C to make a single cell suspension. Cells were then centrifuged at 300 xg for 5 minutes. The cell pell et was resuspended in embryoid body ( EB ) medium to generate 2.5X10 5 cells/ml and 2 mL was added to each well of an AggreWell 400 plate (STEMCELL Technologies). The plate was centrifuged at 100 xg for 3 minutes to capture the cells in the microwells. This generated roughly 500 cells per EB. Twenty four hours later, EBs were detached by flushing the microwells with induction medium and transferred to a low attachment 6 well plate for further culture of five Sli des (coated with Poly Orthnine Laminin) for further differentiation. Neural Differentiation Neural differentiation using the AggreWell 800 (Stemcell Technologies) was performed following manufacture r 's protocol. Briefly, a single cell suspension was prepar ed, and 1.2 to 2.5 X10 6 cells were seeded to each well of the AggreWell 800. The cells were captured in the microwells by centrifugation and cultured for five days. Over this time, the iPS cells collected at the bottom of the well aggregated to form

PAGE 20

20 neuro spheres. The spheres were flushed from the microwells using neural induction medium and were transferred to a Poly Ornithine Laminin coated 6 well plate. On D ay 7, neural rosettes were detached using STEMdiff Neural Rosette Selection Reagent (Stemcell Tec hnologies) and transferred to a 6 well plate coated with Poly Ornithine Laminin. Neural stem cells (NSC) started growing out of neural rosettes after 12 hours. Cells were cultured for seven days. NSCs were detached with accutase to make a single cells su spension and 4 X 10 4 cells were seeded Slides and cultured in Neural Induction medium (Stemcell Technologies) for observation and staining of neural markers. For further propagation and differentiation, NSC were detached using accutase an d grown either in suspension or as attached cells using NeuroCult NS A proliferation medium (Stemcell Technologies). RNA FISH Intranuclear foci containing (CUG)exp RNA were detected in DM1 fibroblasts, iPS cells, NSC, and neurons via RNA FISH using a Cy3 labeled (CAG) 10 DNA probe. slides were washed twice in sterile PBS (pH 7.4), fixed in 10% buffered formalin phosphate (Fisher Scientific) for 10 min at room temperature, washed three times in sterile PBS (pH 7.4), and dehydrated in pre chilled 70% ethanol for 3 hr at 4C. The cells were washed in 40% formamide (EMD Chemicals) in 2X SCC buffer (300 mM sodium chloride, 30 mM sodium citrate, pH 7.0) for 10 min at room temperature, then blocked in hybridization buffer (40% formamide, 2X SCC buffer, 200 u g/mL BSA, 100 mg/mL dextran sulfate, 2 mM vanadyl sulfate, 1 mg/mL yeast tRNA (Invitrogen ) for 15 min at 37C. The Cy3 labeled (CAG) 10 DNA probe was denatured for 10 min at 100C, chilled on ice for 10 min, then added to pre chilled hybridization buffer for a final co ncentration of 500 pg/ u L probe. Hybridization buffer containing the probe

PAGE 21

21 was added to the cells and hybridization was performed in a humidified chamber for 2 hr at 37 C. As a negative control, RNA FISH for (CUG) exp RNA was performed on control patient cells. As an additional negative control, the experiment was performed in parallel on all cells using hybridization buffer lacking the (CAG) 10 DNA probe. After hybridi zation, cells were washed three times in pre warmed 40% formamide/2X SCC buffer for 30 min at 37C and once in sterile PBS (pH 7.4), followed by counterstaining with Vectashield containing DAPI (Vector Laboratories). Immunocytofluorescence Staining and RNA FISH P lus Immunocytofluroscence a density of 1 X 10 6 Slides and cultured in Neural Induction medium for observation and staining of neural m arkers. Cells were cultured for 3 5 days to allow for spontaneous differentiation. The slides were then fixed in 4% paraformaldhyde and processed for immu nocytofluorescence staining. Primary antibody was incubated over night at 4C with AFP (1:100), D esmin (1:100), Nestin (1:100), Neurofilament H (1:50), beta tubulin III (1:250), or GFAP (1:500). The following day, slides were washed three times with PBS, incubated with appropriate secondary antibody conjugated with either Alexa Fluor 555 or Alexa Fluor 488 (Invitrogen) (1:500) for 30 minutes, washed with PBS and mounted with VECTAS HILD Mounting Medium with DAPI. Pictures were taken using Olympus IX81 DSU Spinning Disk confocal microscope. We combin ed the two studies in one slide to better illustrate the relations hip. Briefly, the slides were first processed for intranuclear foci as described above then were incubated with primary antibody (Oct4, both AFP and desmin simultaneously, or neural markers) and staining was completed as described above.

PAGE 22

22 Table 2 1 Summary of subjects Subject ID Age Gender DM type Family history Fibroblast iPS cells MD iPS 01 63 F 1 Brother Yes MD iPS 02 46 F 1 Brother Yes MD iPS 03 47 M 1 Sister Yes Yes MD iPS 04 51 M Control None Yes Yes MD iPS 05 40 F 1 None Yes Y es MD iPS 06 50 F 2 Unknown Yes MD iPS 07 57 M 1 Daughter, granddaughter Yes MD iPS 08 33 F 1 Father, daughter Yes MD iPS 09 56 F Control None Yes MD iPS 10 65 M 2 Unknown Yes

PAGE 23

23 CHAPTER 3 RESULTS Confirmation of E xpansion and i n v itro I nstability of CTG R epeats in DM1 F ibroblast C ells Southern blot of genomic DNA isolated from cultured fibroblast cells showed the CTG repeat expansion size ( Figure 3 1). In DM1 fibroblasts, the expanded alleles were shown as a smear representing a range in size of 976 to 1245 repeats for DM1 03 and 644 to 1051 repeats for DM1 05, suggesting repeat instability. In the normal control, the two normal alleles were detected as a single band by Southern blot. The CTG repeat size in DM1 03 tended to incre ase with passage while the DM1 05 CTG repeat size is relatively stable Outcomes Reprogramming E fficiency is S imilar for DM1 and C ontrol iPS C ell G eneration The traditional retroviral method had similar transduction efficiency between DM1 and control cells as demonstrated by GFP fluorescence (Figure 3 2). Colonies with typical hESC morphology were ready to isolate around day 30 for both DM1 and control iPS cells. These cells were allowed to expand in culture, and 4 10 individual clones were further propagat ed. Clone number 7 of DM1 03, clone number 2 of DM1 05, and clone number 10 of control iPS cells were used for studies below. DM1 and C ontrol iPS C ells H ave S tem C ell F eatures Morphology DM1 and control iPS cells grew as flat, well circumscribed colonies with cells having high nuclear/cytoplasm ratio (Figure 3 3). There was no change in their morphology or growth through subsequent passages ( at least through passage 20). Stem cell markers DM1 and control i PS cells but not the original fibroblasts expressed stem cell markers (Oct4, Nanog and Sox2) by RT PCR (Figure 3 4).

PAGE 24

24 Immunocytofluorescence analysis revealed positive staining of stem cell markers for alkaline phosphatase, Oct4, and SSEA4 in DM1 and control iPS (Figure 3 5). DM1 iPS C ells are P luripotent and I ntranuclear RNA F oci are P resent W ithin S tem C ells and T erminally D ifferentiated C ells To examine the pluripotency of established iPS cell lines, embryoid bodies (EBs) were generated. All EBs showed a normal pattern of differentiation in culture chambers and differentiated into cells with various types of morphology. Small EBs have the tendency to differentiate more towards neural lineages (Figure 3 6). Endodermal and mesodermal cell differentiation was confirmed by immunohistochemical staining of AFP and desmin (Figure 3 7 A C), respectively. Not surprisingly, we found intranuclear foc i formed in both germ layer cells. No foci were found in the normal control cells at any stage (enlarged areas in Figure 3 7 A C). Ectodermal differentiation was demonstrated by neural differentiation as described below. The specificity of the intranuclea r foci assay was confirmed in the primary culture of fibroblasts. No signal was detected in normal fibroblasts in contrast to DM1 fibroblasts (Figure 3 7 D F). I ntranuclear foci were also found in DM1 iPS cells (Figure 3 8). DM1 and C ontrol iPS C ells U nder go N ormal P rocess in vitro L ineage directed N eural D ifferentiation Neural differentiation of DM1 iPS cells was compared to control iPS cells. Both DM1 and control iPS cells underwent normal neural differentiation. iPS cells aggregated and formed neurospheres in the microwells (Figure 3 9 A). Neural rosettes started forming three days following attachment of neurospheres (Figure 3 9 B). Following re plating of neural rosettes, NSCs began egressing from the edges and had the tendency to form loosel y arranged rosettes (Figure 3 9 C) from which spontaneous differentiation

PAGE 25

25 occurred (Figure 3 9 D). Eventually, the entire plate was dominated by NSCs. The NSCs have been passed up to passage 7 without losing neural differentiation potential Intranuclear R NA F oci are F ormed in N eural S tem C ell and T erminally D ifferentiated N eurons and A strocytes DM1 and control NSCs express Nestin and can further differentiate into neurons and astrocytes (confirmed by neuron and astrocyte markers). Intranuclear foci, a path ognomonic finding in DM1, are present in NSCs as well as terminally differentiated neurons and astrocytes (Figure 3 10). No intranuclear foci were observed in control cells (data not shown). Fig ure 3 1. Southern blot of genomic DNA isolated from cultured fibroblast cells Five microgram s of DNA from fibroblast cells was digested by NcoI for Southern blot and run in 0.5% agarose gel. Both DM1 03 and D M1 05 contain expanded allele. The c ontrol cell ( DM1 04) has only one band showing overlapping of two alleles. The CTG repeat size in DM1 03 tends to increase with passage while the DM1 05 CTG repeat size is relatively stable.

PAGE 26

26 Fig ure 3 2. Retroviral infection Retroviral infection was conducted on 6 well plate. EGFP was used as control to monito r infection efficiency. The infection efficiency is higher than 80%. No difference was seen between the two DM1 subjects and the normal control.

PAGE 27

27 Fig ure 3 3. Typical DM1 and control iPS colonies growing on MEF Typical DM1 and control iPS colonies growing on MEF are shown to be flat, well circumscribed (A, B, C). High magnification shows tightly compacted cells with high nuclear/cytoplasm (D, E, F). Figure 3 4. RT PCR products of stem cell markers RT PCR products of stem cell markers show that DM1 and normal control iPS cells express stem cell markers (Oct4, Nanog and Sox2) which are not expressed in the original fibroblast cells (FB) In contrast c Myc is ubiquitously expressed in somatic and stem cells. Control ( ): no RNA control. actin: loading control.

PAGE 28

28 Fig ure 3 5 iPS stained colonies. All iPS colonies stained positive for alkaline phosphatase (A, B, C); intranuclear stem cell marker Oct4 (D, E, F and G, H, I merged with DAPI) and cell surface stem cell marker SSEA 4 (J, K, L and M, N, O merged with DAPI). The surrounding feeder cells are negative for stem cell markers

PAGE 29

29 Fig ure 3 6 DM1 03 EBs Microscopy of DM1 03 EBs demonstrate differentiation in cultured chamber into ce lls with different morphology. Spontaneous neural differentiation (with axons) can be seen in small EBs (insets).

PAGE 30

30 Fig ure 3 7. Endodermal and mesodermal cell differentiation RNA FISH and double staining of en dodermal (AFP) and mesodermal ( D esmin) markers on EB were performed in the same Ibid iTreat u Slide. The endodermal and mesodermal cell differentiation was confirmed by pos itive AFP (green) and positive D esmin (red) cells. Cells that are negative for these markers are most likely ectoderm cells. Intranuclear foci were found in DM1 cells of three embryonic germ layers (A, B) but not in control cells (C). The corresponding primary culture of fibroblast cells show intranuclear foci in DM1 fibroblasts (D, E) but not normal control (F). Insets indicate areas of the image that are enlarged fo r greater detail.

PAGE 31

31 Fig ure 3 8 Intranuclear foci presence. Intranuclear foci were present in DM1iPS cell (only DM1 03 iPS is shown here). Stem cell marker (Oct4, green) and RNA FISH (red) were performed on the same IbidiTreat u Slide. Feeder cells are negative for Oct4 and foci (arrows), which confirmed the specificity of both immunocytofluorescence and RNA FISH. A) DAPI (blue) and RNA foci (red). B) Oct4 (green) and RNA foci (red). C) DAPI (blue), RNA foci (red) and Oct4 (gre en) merge. Fig ure 3 9 DM1 iPS and normal control iPS cells aggregate and form neurospheres normally in the microwells (only DM1 03 was shown here) (A). Neural rosettes start forming 3 days after neurosphere attachment (B). NSCs egress re plated neural rosettes and re form into small loosely arranged rosettes(C) from which spontaneous differentiation occurs (D ).

PAGE 32

32 Fig ure 3 10. RNA FISH plus immunocytofluorescence staining of neural markers. DM1 03 NSC express Nestin (A, green) and can further differe ntiate into astrocytes positive for GFAP (F, green) and neurons positive for Neurofilament H (B, green) and beta tubulin III (C, D, E, green). Intranuclear foci (red) are formed in NSCs, neurons and astrocytes ( o bvious in the enlarged boxes). DAPI is blue

PAGE 33

33 CHAPTER 4 DISCUSSION Since the first description of DM1 by Steiner in 1909 and identification of the gene mutation i n 1992 57 60 much knowledge has been gained into the pathogenesis of DM1 using mouse models Ho wever, these animal models only display certain aspects of the disease and n one of them can fully recapitulate the clinical phenomen a The pathogenesis of CNS involvement is particularly poorly understood. We recently generated MBNL2 knock out mice and f ound MBNL 2 plays an important role in cognitive impairment in DM1 61 However, there are some hurdles that mouse model s cannot overcome. The biggest hurdle is that pathogenic mimicking is generated on a different genomic background. Thus, to overcome these limitations, we propose d DM1 patient derived iPS cells as a cellular model system for DM1 disease studies. To achieve this end, we generated a DM1 cellular model through reprogramming human skin fibroblasts isolated from DM1 patients. On ce established, DM1 and control iPS cells grow in a similar pattern to hESCs with high nuclear/cytoplasm ratio, express stem cell markers and have stem cell features of self renewal and pluripotency. These cells harbor the naturally mutated gene in the hu man genomic background, making this a n ideal isogenic cellular model for DM1 studies For mechani sti c studies, p revious alternative splicing studies are restricted to autopsy brain tissues which may have masked some differences due to non selective inclusion of different type cells and premortem confounding factors. In the current study, w e have shown that iPS cells derived from reprogrammed DM1 fibroblasts can be differentiated into viable neural cells cells that are otherwise difficult to obtain unlike the easily isolated myoblast or fibroblast cells by muscle or skin biopsy. Through lineage

PAGE 34

34 specific differentiation and cell sorting, future experiments can analyze the expression of DMPK, MBNL, CELF and alternative splicing of their target genes in a cell type specific manner, which may further shed light on the pathogenesis of CNS involvement. Furthermore, these iPS cells represent an unlimited resource of cells for repeated studies and c omparisons. Intranuclear CUG RNA foci are pathognomonic findings in DM1. These RNA foci can be found in cultured human fibroblasts myoblasts, biopsy tissues 57 neuronal cells in the post mortem brain 18 and t ransgenic mouse models 21 23 29 62 63 The foci contain mutant DM1 mRNA and sequestered splicing and transcription factors, among them M BNL 1, 2 and 3 are main factors that have been well studied in DM1 pathogenesis which is elegantly described in several reviews 3 5 6 64 66 In this study, we found these foci not only in terminally differentiated cells but also in pluripoten t and multipotent cell stages. To our knowledge, ours is the first report to track the foci formation during the developmental course from stem cell to t erminally differentiated neuron. The presence of intranuclear foci in iPS cells creates a discrepancy between the findings of RNA foci and clinical presentation in these two patients. Both patients had no symptoms prior to early adulthood. Why the patie nts were protected in young age or why they became symptomatic as adults if the RNA foci exist throughout the course of embryonic development, childhood and adolescence is unknown. In addition, it is not known whether the components in the foci are differe nt in different stages and whether any aberrant splicing occurs prior to onset of symptoms. It is also unknown whether DM1 is a developmental disorder or degenerative disorder, and whether these findings are only restricted to in vitro culture condition. It is reasonable to predict that the foci

PAGE 35

35 exist in live body tissues from the time embryo forms even in adult onset cases. The foci are always there, ready for trapping emerging proteins that are important for cell viability or anti aging. I ntranuclear R NA foci are considered pathogenic and can be used as outcome measures for therapeutic intervention. Multiple approaches, including antisense oligonucleotides, ribozymes and chemicals, have been developed for the treatment of DM1 44 48 67 68 However, all are based on animal models and restricted human cell cultures (myoblasts). Treatment outcomes from these studies can be further validated in these human disease specific DM1 iPS cells and al most all cell types from lineage directed differentiation by assessing changes in intranuclear foci. The in vivo efficacy assay can be analyzed in teratoma tissues derived from this iPS cells in nude mice. These cell lines represent an additional, more app licable model to further translate results from basic studies into clinical applications. However, the fundamental cure for DM1 will be correction of the mutation. Recent technological developments involving genomic editing with either zinc finger nuclease s (ZFNs) or t ranscription activator like effector nucleases ( TALENs) are very promising in this area. We think these disease specific human iPS cell are ideal for testing these technologies and pave the way for future cell based therapy. In conclusion, we have established disease specific human DM1 iPS cell lines. These mutant iPS cells harbor mutations in the native genomic background as DM1 patient and have the potential to d ifferentiat e into cells of the three embryonic germ layers. Neural cells differe ntiated form these iPS cells contain pathognomonic intranuclear RNA foci. These cell lines represent an invaluable tool for the study of DM1

PAGE 36

36 CNS neuropathogenesis and can readily be exploited as a translational platform for therapeutic drug development.

PAGE 37

37 LIST OF REFERENCES 1. Harper P. Myotonic Dystrophy, 3rd ed. London: WB Saunders; 2001. 2. Fu YH, Pizzuti A, Fenwick RG, Jr., et al. An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science. 1992;255(5049):1256 1258. 3. Ashizawa T, Sarkar PS. Myotonic dystrophy types 1 and 2. Handb Clin Neurol. 2011;101:193 237. 4. Ro meo V. Myotonic Dystrophy Type 1 or Steinert's disease. Adv Exp Med Biol. 2012;724:239 257. 5. Ranum LP, Cooper TA. RNA mediated neuromuscular disorders. Annu Rev Neurosci. 2006;29:259 277. 6. Lee JE, Cooper TA. Pathogenic mechanisms of myotonic dystrophy. Biochem Soc Trans. 2009;37(Pt 6):1281 1286. 7. Gomes Pereira M, Cooper TA, Gourdon G. Myotonic dystrophy mouse models: towards rational therapy development. Trends Mol Med. 2011;17(9):506 517. 8. Sistiaga A, Urreta I, Jodar M, et al. Cognitive/personality pattern and triplet expansion size in adult myotonic dystrophy type 1 (DM1): CTG repeats, cognition and personality in DM1. Psychol Med. 2010;40(3):487 495. 9. Bird TD, Follett C, Griep E. Cognitive and personality function in myotonic muscular dystrophy. J Neurol Neurosurg Psychiatry. 1983;46(11):971 980. 10. Portwood MM, Wicks JJ, Lieberman JS, Duveneck MJ. Intellectual and cognitive function in adults with myotonic muscular dystrophy. Arch Phys Med Rehabil. 1986;67(5):299 303. 11. Roig M, Balliu PR, Navarro C, Brugera R, Losada M. Presentation, clinical course, and outcome of the congenital form of myotonic dystrophy. Pediatr Neurol. 1994;11(3):208 213. 12. Rubinsztein JS, Rubinsztein DC, McKenna PJ, Goodburn S, Holland AJ. Mild myo tonic dystrophy is associated with memory impairment in the context of normal general intelligence. J Med Genet. 1997;34(3):229 233. 13. Steyaert J, Umans S, Willekens D, et al. A study of the cognitive and psychological profile in 16 children with congeni tal or juvenile myotonic dystrophy. Clin Genet. 1997;52(3):135 141.

PAGE 38

38 14. Ekstrom AB, Hakenas Plate L, Samuelsson L, Tulinius M, Wentz E. Autism spectrum conditions in myotonic dystrophy type 1: a study on 57 individuals with congenital and childhood forms. Am J Med Genet B Neuropsychiatr Genet. 2008;147B(6):918 926. 15. Douniol M, Jacquette A, Guile JM, et al. Psychiatric and cognitive phenotype in children and adolescents with myotonic dystrophy. Eur Child Adolesc Psychiatry. 2009;18(12):705 715. 16. Thornt on CA, Wymer JP, Simmons Z, McClain C, Moxley RT, 3rd. Expansion of the myotonic dystrophy CTG repeat reduces expression of the flanking DMAHP gene. Nat Genet. 1997;16(4):407 409. 17. Fu YH, Friedman DL, Richards S, et al. Decreased expression of myotonin protein kinase messenger RNA and protein in adult form of myotonic dystrophy. Science. 1993;260(5105):235 238. 18. Jiang H, Mankodi A, Swanson MS, Moxley RT, Thornton CA. Myotonic dystrophy type 1 is associated with nuclear foci of mutant RNA, sequestration of muscleblind proteins and deregulated alternative splicing in neurons. Hum Mol Genet. 2004;13(24):3079 3088. 19 Kanadia RN, Johnstone KA, Mankodi A, et al. A muscleblind knockout model for myotonic dystrophy. Science. 2003;302(5652):1978 1980. 20. Kanadia RN, Shin J, Yuan Y, et al. Reversal of RNA missplicing and myotonia after muscleblind overexpression in a mous e poly(CUG) model for myotonic dystrophy. Proc Natl Acad Sci U S A. 2006;103(31):11748 11753. 21. Wang GS, Kearney DL, De Biasi M, Taffet G, Cooper TA. Elevation of RNA binding protein CUGBP1 is an early event in an inducible heart specific mouse model of myotonic dystrophy. J Clin Invest. 2007;117(10):2802 2811. 22. Orengo JP, Chambon P, Metzger D, Mosier DR, Snipes GJ, Cooper TA. Expanded CTG repeats within the DMPK 3' UTR causes severe skeletal muscle wasting in an inducible mouse model for myotonic dyst rophy. Proc Natl Acad Sci U S A. 2008;105(7):2646 2651. 23. Mahadevan MS, Yadava RS, Yu Q, et al. Reversible model of RNA toxicity and cardiac conduction defects in myotonic dystrophy. Nat Genet. 2006;38(9):1066 1070. 24. de Haro M, Al Ramahi I, De Gouyon B, et al. MBNL1 and CUGBP1 modify expanded CUG induced toxicity in a Drosophila model of myotonic dystrophy type 1. Hum Mol Genet. 2006;15(13):2138 2145.

PAGE 39

39 25. Timchenko NA, Cai ZJ, Welm AL, Reddy S, Ashizawa T, Timchenko LT. RNA CUG repeats sequester CUGBP1 and alter protein levels and activity of CUGBP1. J Biol Chem. 2001;276(11):7820 7826. 26. Kuyumcu Martinez NM, Wang GS, Cooper TA. Increased steady state levels of CUGBP1 in myotonic dystrophy 1 are due to PKC mediated hyperphosphorylation. Mol Cell. 2007 ;28(1):68 78. 27. Miller JW, Urbinati CR, Teng Umnuay P, et al. Recruitment of human muscleblind proteins to (CUG)(n) expansions associated with myotonic dystrophy. EMBO J. 2000;19(17):4439 4448. 28. Fardaei M, Rogers MT, Thorpe HM, et al. Three proteins, MBNL, MBLL and MBXL, co localize in vivo with nuclear foci of expanded repeat transcripts in DM1 and DM2 cells. Hum Mol Genet. 2002;11(7):805 814. 29. Lin X, Miller JW, Mankodi A, et al. Failure of MBNL1 dependent post natal splicing transitions in myotoni c dystrophy. Hum Mol Genet. 2006;15(13):2087 2097. 30. Leeb C, Jurga M, McGuckin C, Moriggl R, Kenner L. Promising New Sources for Pluripotent Stem Cells. Stem Cell Rev. 2009. 31. Ward AJ, Rimer M, Killian JM, Dowling JJ, Cooper TA. CUGBP1 overexpression i n mouse skeletal muscle reproduces features of myotonic dystrophy type 1. Hum Mol Genet. 2010;19(18):3614 3622. 32. Koshelev M, Sarma S, Price RE, Wehrens XH, Cooper TA. Heart specific overexpression of CUGBP1 reproduces functional and molecular abnormalit ies of myotonic dystrophy type 1. Hum Mol Genet. 2010;19(6):1066 1075. 33. Savkur RS, Philips AV, Cooper TA. Aberrant regulation of insulin receptor alternative splicing is associated with insulin resistance in myotonic dystrophy. Nat Genet. 2001;29(1):40 47. 34. Mankodi A, Takahashi MP, Jiang H, et al. Expanded CUG repeats trigger aberrant splicing of ClC 1 chloride channel pre mRNA and hyperexcitability of skeletal muscle in myotonic dystrophy. Mol Cell. 2002;10(1):35 44. 35. Charlet BN, Savkur RS, Singh G, Philips AV, Grice EA, Cooper TA. Loss of the muscle specific chloride channel in type 1 myotonic dystrophy due to misregulated alternative splicing. Mol Cell. 2002;10(1):45 53. 36. Sergeant N, Sablonniere B, Schraen Maschke S, et al. Dysregulation of human brain microtubule associated tau mRNA maturation in myotonic dystrophy type 1. Hum Mol Genet. 2001;10(19):2143 2155.

PAGE 40

40 37. Vermersch P, Sergeant N, Ruchoux MM, et al. Specific tau variants in the brains of patients with myoto nic dystrophy. Neurology. 1996;47(3):711 717. 38. Dhaenens CM, Tran H, Frandemiche ML, et al. Mis splicing of Tau exon 10 in myotonic dystrophy type 1 is reproduced by overexpression of CELF2 but not by MBNL1 silencing. Biochim Biophys Acta. 2011;1812(7):732 742. 39. Leroy O, Dhaenens CM, Schraen Maschke S, et al. ETR 3 represses Tau exons 2/3 inclusion, a splicing event abnormally enhanced in myotonic dystrophy type I. J Neurosci Res. 2006;84(4):852 859. 40. Leroy O, Wang J, Maurage CA, et a l. Brain specific change in alternative splicing of Tau exon 6 in myotonic dystrophy type 1. Biochim Biophys Acta. 2006;1762(4):460 467. 41. Dhaenens CM, Schraen Maschke S, Tran H, et al. Overexpression of MBNL1 fetal isoforms and modified splicing of Tau in the DM1 brain: two individual consequences of CUG trinucleotide repeats. Exp Neurol. 2008;210(2):467 478. 42. Suenaga K, Lee KY, Nakamori M, et al. Muscleblind like 1 knockout mice reveal novel splicing defects in the myotonic dystrophy brain. PLoS One. 2012;7(3):e33218. 43. Charizanis K, Lee, K. Y., Batra, R., Goodwin, M., Zhang, C., Yuan, Y., Shiue, L., Cline, M., Scotti, M.M., Xia, G., Kumar, A., Ashizawa, T., Clark, H.B., Kimura, T., Takahashi, M.P., Fujimura, H., Jinnai, K., Yoshikawa, H., Gomes Per eira, M., Gourdon, G., Sakai, N., Nishino, S., Foster, T.C., Ares Jr, M., Darnell, R.B., and M.S. Swanson. Muscleblind Like 2 mediated alternative splicing in the developing brain and dysregulation in myotonic dystrophy. Neuron. 2012 ; 75:1 14. 44. Wheeler T M, Sobczak K, Lueck JD, et al. Reversal of RNA dominance by displacement of protein sequestered on triplet repeat RNA. Science. 2009;325(5938):336 339. 45. Lee JE, Bennett CF, Cooper TA. RNase H mediated degradation of toxic RNA in myotonic dystrophy type 1. Proc Natl Acad Sci U S A. 2012;109(11):4221 4226. 46. Langlois MA, Lee NS, Rossi JJ, Puymirat J. Hammerhead ribozyme mediated destruction of nuclear foci in myotonic dystrophy myoblasts. Mol Ther. 2003;7(5 Pt 1):670 680. 47. Warf MB, Nakamori M, Matthys CM, Thornton CA, Berglund JA. Pentamidine reverses the splicing defects associated with myotonic dystrophy. Proc Natl Acad Sci U S A. 2009;106(44):18551 18556.

PAGE 41

41 48. Mulders SA, van den Broek WJ, Wheeler TM, et al. Triplet repeat oligonucleotide mediated re versal of RNA toxicity in myotonic dystrophy. Proc Natl Acad Sci U S A. 2009;106(33):13915 13920. 49. Wheeler TM, Leger AJ, Pandey SK, et al. Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Nature. 2012;488(7409):111 115. 50. Parkesh R, Childs Disney JL, Nakamori M, et al. Design of a bioactive small molecule that targets the myotonic dystrophy type 1 RNA via an RNA motif ligand database and chemical similarity searching. J Am Chem Soc. 2012;134(10):4731 4742. 51. Kastenberg ZJ Odorico JS. Alternative sources of pluripotency: science, ethics, and stem cells. Transplant Rev (Orlando). 2008;22(3):215 222. 52. Yu J, Vodyanik MA, Smuga Otto K, et al. Induced pluripotent stem cell lines derived from human somatic cells. Science. 200 7;318(5858):1917 1920. 53. Takahashi K, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 2007;131(5):861 872. 54. Zwi L, Caspi O, Arbel G, et al. Cardiomyocyte differentiation of human in duced pluripotent stem cells. Circulation. 2009;120(15):1513 1523. 55. Dimos JT, Rodolfa KT, Niakan KK, et al. Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science. 2008;321(5893):1218 1221. 56. Lie KH, Chung HC, Sidhu KS. Derivation, propagation, and characterization of neuroprogenitors from pluripotent stem cells (hESCs and hiPSCs). Methods Mol Biol. 2012;873:237 246. 57. Aslanidis C, Jansen G, Amemiya C, et al. Cloning of the essential myotonic dystrophy region and mapping of the putative defect. Nature. 1992;355(6360):548 551. 58. Buxton J, Shelbourne P, Davies J, et al. Detection of an unstable fragment of DNA specific to individuals with myotonic dystrophy. Nature. 1992;355(6360):547 548. 59. Harley HG, Brook JD, Rundle SA, et al. Expansion of an unstable DNA region and phenotypic variation in myotonic dystrophy. Nature. 1992;355(6360):545 546.

PAGE 42

42 60. Brook JD, McCurrach ME, Harley HG, et al. Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell. 1992;68(4):799 808. 61. Charizanis K, Lee, K. Y., Batra, R., Goodwin, M., Zhang, C., Yuan, Y., Shiue, L., Cline, M., Scotti, M.M., Xia, G., Kumar, A., A shizawa, T., Clark, H.B., Kimura, T., Takahashi, M.P., Fujimura, H., Jinnai, K., Yoshikawa, H., Gomes Pereira, M., Gourdon, G., Sakai, N., Nishino, S., Foster, T.C., Ares Jr, M., Darnell, R.B., and M.S. Swanson. Muscleblind Like 2 mediated alternative spli cing in the developing brain and dysregulation in myotonic dystrophy. Neuron. 2012;75:1 14. 62. Mankodi A, Logigian E, Callahan L, et al. Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat. Science. 2000;289(5485):1769 1773. 63. Seznec H, Agbulut O, Sergeant N, et al. Mice transgenic for the human myotonic dystrophy region with expanded CTG repeats display muscular and brain abnormalities. Hum Mol Genet. 2001;10(23):2717 2726. 64. Schara U, Schoser BG. Myotonic dystrophies type 1 and 2: a summary on current aspects. Semin Pediatr Neurol. 2006;13(2):71 79. 65. de Leon MB, Cisneros B. Myotonic dystrophy 1 in the nervous system: from the clinic to molecular mechanisms. J Neurosci Res. 2008;86(1):18 26. 66. Llamusi B, Artero R. Molecular Effects of the CTG Repeats in Mutant Dystrophia Myotonica Protein Kinase Gene. Curr Genomics. 2008;9(8):509 516. 67. Furling D, Doucet G, Langlois MA, et al. Viral vector producing antisense RNA restores myotonic dystrophy my oblast functions. Gene Ther. 2003;10(9):795 802. 68. Larsen J, Pettersson OJ, Jakobsen M, et al. Myoblasts generated by lentiviral mediated MyoD transduction of myotonic dystrophy type 1 (DM1) fibroblasts can be used for assays of therapeutic molecules. BM C Res Notes. 2011;4:490.

PAGE 43

43 BIOGRAPHICAL SKETCH G u angbin Xia graduated from the Second Military Medical University, Shanghai, China with a medical degree in 1990. He received his PhD in 2002 from Tokyo Medical and Dental University, Tokyo, Japan. He did his internship training in U niversity of Virginia and completed his neurolog y residency in University of Florida in 2010 He then completed a year of fellowship training in Neuromuscular Medicine at the University of Florida in 2011 He also completed training in the Clinical Research Consortium for Spinocerebellar Ataxias /NIH. In 2012 he completed a Master of Science with a concentration in clinical and translational science while a s cholar in the Adv anced Postgraduate Program in Clinical Investigation. D r. Xia is board certified by the American Board of Psychiatry and Neurology (ABPN), the Ne uromuscular Medicine Board and the American Board of Electrodiagnostic Medicine (ABEM). He is a member of the American Academy of Neurology and International Society for Stem Cell Research (ISSCR). Dr. Xia's research interest is disease specific induced pluripotent stem (iPS) cell s in the application of neurodegenerative disorders. Myotonic d ystrophy and s pinocerebellar ataxias (SCAs) a re his current research focus. He has successfully established disease specific iPS cell lines for DM1, SCA2 and SCA 3 These disease specific iPS cell lines are ideal isogenic cellular models for mechanistic studies and function as translational platform for drug development and for the study of cell replacement therap y.