Endogenous Expression of Brain Interleukin-2 and the Link to Alterations in Choline Acetyltransferase Expression in Inte...

MISSING IMAGE

Material Information

Title:
Endogenous Expression of Brain Interleukin-2 and the Link to Alterations in Choline Acetyltransferase Expression in Interleukin-2 Knockout Mice
Physical Description:
1 online resource (67 p.)
Language:
english
Creator:
Meola, Danielle M
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Neuroscience (IDP)
Committee Chair:
Petitto, John M
Committee Members:
Streit, Wolfgang J
Lewis, Mark H
King, Michael A
Atkinson, Mark A

Subjects

Subjects / Keywords:
brain -- cholinergic -- gfp -- interleukin2 -- knockout -- medial -- mice -- microglia -- phenotype -- septum
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
In the peripheral immune system, Interleukin-2 (IL-2) is essential for immune homeostasis, normal T regulatory cell function, and self-tolerance.  IL-2 knockout (IL-2KO) mice develop spontaneous autoimmunity characterized by increased T cell trafficking to multiple organs.  IL-2 is also expressed in the brain.  We previously described the apparent loss of cholinergic cell bodies in the medial septum of IL-2KO mice.  Here we investigated if loss of brain-derived IL-2, or autoimmunity stemming from loss of peripheral IL-2, is responsible for the alteration in choline acetyltransferase (ChAT) expression in the medial septum of IL-2KO mice.  To accomplish this objective, we compared ChAT-positive neurons between IL-2 wild-type (IL-2WT) mice, IL-2KO, and congenic IL-2/recombinase activating gene-2 KO (IL-2KO/RAG-2KO) mice that lack IL-2 but fail to develop autoimmunity.  IL-2KO and IL-2KO/RAG-2KO mice had significantly lower numbers of ChAT-positive neurons than IL-2WT mice.  This did not coincide with an overall loss of cells in the medial septum suggesting that loss of brain IL-2 results in a change in cholinergic phenotype unrelated to cell death.  No differences were noted in the endogenous expression of cytokines and chemokines tested in the medial septum.  Evaluation of brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) levels between IL-2WT and IL-2KO mice in medial septal homogenates revealed that IL-2KO mice have markedly higher levels of NGF in the medial septum compared to IL-2WT mice.  Our findings suggest that brain-derived IL-2 plays an essential role in the maintenance of septohippocampal projection neurons in vivo.  In the second part of this dissertation project, to determine the origin of brain-derived IL-2, we used a novel transgenic mouse model that expresses green fluorescent protein (GFP) in cells that normally express IL-2.  We found that a number of discrete brain regions express GFP and the expression is selective for neurons.  There are several reports that IL-2 is expressed by rat microglia, however, we found microglia activated in vivo by peripheral nerve injury or challenged by intraperitoneal injection of lipopolysaccharide, do not express GFP in our model.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Danielle M Meola.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Petitto, John M.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-12-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0045029:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 ENDOGENOUS EXPRESSION OF BRAIN INTERLEUKIN 2 AND THE LINK TO ALTERATIONS IN CHOLINE ACETYLTRANSFERASE EXPRESSION IN INTERLEUKIN 2 KNOCKOUT MICE By D ANIELLE MARIE MEOLA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 D anielle Marie Meola

PAGE 3

3 To my dog Prime whose lifelong battle with ill iteracy inspires me to strive for greatness despite the odds

PAGE 4

4 ACKNOWLEDGMENTS First and foremost a special thanks must be extended to my mentor Dr. John Petitto whose modest personality, sense of humor, and empathetic nature have made him a pleasure to work for. His style of mentoring has provided me with a true assessment of what it takes to generate your own ideas, and the hard part, see them through. It is only the large stick by the door he intermittently threatens me with that would clue you into his well understood frustration I would also like to express my gratitude to ward the members of my supervisory committee. In addition to the time they have volunteered to oversee my progress, each member has imparted wisdom and attitudes that undoubtedl y have influenced my own. Dr. Mark Lewis, who also mentored me during my undergraduate years, has a kindness and generosity with his time th at has always made me feel welcome and encouraged. One of the best decisions I made early on in my studies was joi ning Dr. be skeptical in As for Dr. Michael King, i n addition to the many hours I spent working in his lab I truly appreciate the work. I am also indebted to hi m for expanding my taste in music than an ice cube. While I have not had the opportunity to get to know Dr. Mark Atkinson well I am no less appreciative of his willingness to serve on my committee, and have benefited from his insi ghtful questions during our meetings. Besides my committee I must thank some folks who have helped me in a great number of ways. Dr. Huang Zhi, a n important contributor to my work and delightful person to have around the lab, has

PAGE 5

5 been paramount to my suc cess. Also, my dear friend Dr. Amber Muehlmann, who has provided me with guidance, a shoulder to lean on, and comic relief only a friend that has like to thank Bonnie McLauri n for teaching me about animal procedures, how to navigate the IACUC and for being that warm presence when I just needed a hug. Lastly, I must thank my family for their patience, encouragement, love, and monetary contributions that have made a higher education possible for me. Most of all, I thank my f ianc Alan for believing in me 8 years ago when he selflessly Tennessee fan and Gator hater. I love you sweetheart.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 BACKGROUND AND SIGNIFICANCE ................................ ................................ ... 12 Cytokine Brain Interactions ................................ ................................ ..................... 12 Interleukin 2: a Pleiotropic Cytokine ................................ ................................ ....... 13 Evidence of IL in the CNS ................................ ................................ .... 14 Detection of IL 2 in the Brain ................................ ................................ .................. 16 Alteration of Septohippocampal System in IL 2 Knock Out Mice ............................ 16 Morphology and Behavior ................................ ................................ ................. 16 Cytokine Profile ................................ ................................ ................................ 17 Neurotrophic Environment ................................ ................................ ................ 18 T Lymphocyte Trafficking to Brains of IL 2KO Mice ................................ ................ 18 Objectives of This Dissertation Research ................................ ............................... 19 2 P HENOTYPIC LOSS OF SEPTOHIPPOCAMPAL CHOLINERGIC NEURONS: RELATION TO BRAIN VERSUS PERIPHERAL IL 2 DEFICIENCY ....................... 22 Introduction ................................ ................................ ................................ ............. 22 Materials and Methods ................................ ................................ ............................ 24 Animals ................................ ................................ ................................ ............. 24 Immunohistochemistry ................................ ................................ ...................... 25 Cytokine Analysis ................................ ................................ ............................. 26 Neurotrophin Analysis ................................ ................................ ...................... 27 Cell Quantification ................................ ................................ ............................ 28 Results ................................ ................................ ................................ .................... 29 Discussion ................................ ................................ ................................ .............. 30 3 EXPRESSION OF GFP IN B6.CG TG (IL2 EGFP) 17EXR TRANSGENIC MICE: EVIDENCE FOR THE NEURONA L EXPRESSION OF INTERLEUKIN 2 IN DISCRETE REGIONS OF MURINE BRAIN ................................ ....................... 35 Introduction ................................ ................................ ................................ ............. 35 Materials and Methods ................................ ................................ ............................ 37 Animals ................................ ................................ ................................ ............. 37 Breeding and Genotyping ................................ ................................ ................. 37

PAGE 7

7 Tissue Preparation ................................ ................................ ........................... 37 Immunohistochemistry ................................ ................................ ...................... 38 Results ................................ ................................ ................................ .................... 38 Discussion ................................ ................................ ................................ .............. 39 4 EXPRESSION OF IL 2 IN RESPONSE TO SYSTEMIC LPS CHALLENGE AND FACIAL NERVE AXOTOMY IN B6.CG TG (IL2 EGFP) 17EVR TRANSGENIC MICE ................................ ................................ ................................ ....................... 47 Introduction ................................ ................................ ................................ ............. 47 Materials and Methods ................................ ................................ ............................ 48 Animals ................................ ................................ ................................ ............. 48 Facial Nerve Axotomy ................................ ................................ ...................... 48 Lipopolysaccharide ................................ ................................ ........................... 48 Tissue Preparation ................................ ................................ ........................... 48 Immunohistochemistry ................................ ................................ ...................... 49 Results ................................ ................................ ................................ .................... 50 Discussion ................................ ................................ ................................ .............. 50 5 CONCLUSION ................................ ................................ ................................ ........ 52 Summary of the Overall Findings ................................ ................................ ............ 52 Implications ................................ ................................ ................................ ............. 54 Caveats and Future Directions ................................ ................................ ............... 56 Concluding Remarks ................................ ................................ ............................... 57 REFERENCES ................................ ................................ ................................ .............. 58 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 67

PAGE 8

8 LIST OF FIGURE S Figure page 2 1 Quantification of ChAT+ cells in the mouse medial septum of subject groups at 8 weeks of age. Bars represent the mean S.E.M. for IL 2WT(C57), IL 2KO/RAG 2KO(KO/KO ), and IL 2KO mice. N=5 mice/group. *p< .05. ............... 34 2 2 Comparison of NGF (left) and BDNF (right) protein levels in the medial septum of IL 2KO mice (n=7) vs. IL 2WT littermates (n=6). Bars repres ent mean S.E.M. ................................ ................................ ................................ .... 34 3 1 GFP positive cells in the lateral septum (top) and in the spleen (bottom). Bottom panel illustrates specificity of GFP antibody. Reactivity of primary antibody was que nched with 10 l free recombinant GFP protein prior to use in staining protocol. ................................ ................................ ............................. 43 3 2 Representative micropictographs showing expression of GFP in the medial septum (top) and red nucleus (bott om). Arrows annotate cellular GFP expression co localized with pan neuronal cell marker NeuN. ........................... 44 3 3 GFP positive cells in the lateral septum (left) and fastigial nucleus and interposed nucleu s of the cerebellum (right). Shown here at 10X. ..................... 45 4 1 No evidence of IL 2 expression in injured facial motor nucleus (area indicated by rectangular border). Representative section stained wit h anti GFP primary antibody 7 days after periphery nerve axotomy. Note contrast with positively stained cells in reticular nucleus above. ................................ .............. 51

PAGE 9

9 LIST OF TABLES Table page 3 1 List of nuclei positive for IL 2 transgene through rostral caudal extent of brain and brainst em. (+) symbol designates relative intensity of GFP staining as visualized by fluorescence immunohistochemistry ................................ ............. 46

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ENDOGENOUS EXPRESSIO N OF BRAIN INTERLEUK IN 2 AND THE LINK TO ALTERATIONS IN CHOLI NE ACETYLTRANSFERASE EXPRESSION IN INTERLEUKIN 2 KNOCKOUT MICE By Danielle Marie Meola December 2012 Chair: John Michael Petitto Major: Medical Sciences In the peripheral immune system, Interleukin 2 ( IL 2 ) is essential for immu ne homeostasis, normal T regulatory cell function, and self tolerance. IL 2 knockout (IL 2KO) mice develop spontaneous autoimmunity characterized by increased T cell trafficking to multiple organs. IL 2 is also expressed in the brain. We previously desc ribed the apparent loss of cholinergic cell bodies in the medial septum of IL 2KO mice. Here we investigated if loss of brain derived IL 2, or autoimmunity stemming from loss of peripheral IL 2, is responsible for the alteration in choline acetyltransfera se (ChAT) expression in the medial septum of IL 2KO mice. To accomplish this objective, we compared ChAT positive neurons between IL 2 wild type (IL 2 WT ) mice, IL 2KO, and congenic IL 2/recombinase activating gene 2 KO ( IL 2KO/RAG 2KO ) mice that lack IL 2 but fail to develop autoimmunity IL 2KO and IL 2KO/RAG 2KO mice had significantly lower numbers of ChAT positive neurons than IL 2WT mice. This did not coincide with an overall loss of cells in the medial septum suggesting that loss of brain IL 2 resul ts in a change in cholinergic phenotype unrelated to cell death. No differences were noted in the endogenous expression of cytokines and chemokines tested in the

PAGE 11

11 medial septum. Evaluation of brain derived neurotrophic factor ( BDNF ) and nerve growth facto r ( NGF ) levels between IL 2WT and IL 2KO mice in medial septal homogenates revealed that IL 2KO mice have markedly higher levels of NGF in the medial septum compared to IL 2WT mice. Our findings suggest that brain derived IL 2 plays an essential role in t he maint e nance of septohippocampal projection neurons in vivo. In the second par t of this dissertation project, t o determine the origin of brain derived IL 2, we used a novel transgenic mouse model that expresses green fl uorescent protein (GFP) in cells that normally express IL 2 We found that a number of discrete brain regions express GFP and the expression is s elective for neurons. T here are several reports that IL 2 is expressed by rat microglia, however, we found microglia activated in vivo by peri pheral nerve injury or challenged by intraperitoneal injection of lipopolysaccharide, do not express GFP in our model.

PAGE 12

12 CHAPTER 1 BACKGROUND AND SIGNI FICANCE Cytokine Brain Interactions The central nervous system (CNS) and peripheral immune system were onc e vulnerability to inflammatory processes and m respond to immune challenge and reject transplants ( Barker and Widner, 2004 ). It is now under stood that the two systems work in concert to achieve many homeostatic mechanisms both related to immune protection and normal physiological activities i ncluding neuroinflammation and autoimmunity, viral infection hypothalamic pituitary axis (HPA) regulat ion, induction of fever, sleep, analgesia, feeding behavior, and cognition (Ader et al., 2001; Dunn, 2002; Wilson et al., 2002) The cytokin es produced by immune cells, and involved in the intercommunication of the two systems a re ushered through the blo od brain barrier (BBB) to initiate their effects on the CNS b y way of various transporters (Banks et al., 2002), circumventricular organs (CVO) and as is the case with IL 2, non saturable mechanisms that have yet to be determined (Waguespack et al., 1994) P eripheral leukocytes, in particul ar activated T cells that enter the brain during certain conditions (e.g., EAE, facial nerve axotomy IL 2 deficiency) can also release cytokines in the CNS (Hickey et al., 1991) In addition to peripheral cytokines finding their way to central targets, immune competent cells in the brain such as microglia and perivascular macrophages that respond to immune challenge in the brain, produce and secrete many of the same cytokines and may play an important role in both the innate and adaptive arm s of the immune response ( Petitto et al., 200 1 ).

PAGE 13

13 While much attention has been given to immune cytokines expresse d by immune type cells, neurons have also been shown to express cytokines and cytokine receptors typically associated with immune functions (Sorkin et al., 1997). The role of im mune cytokines expressed by neurons and the functional significance of cytokine receptors on select populations of ne urons is a relatively new area of study and a promising avenue for discovery regarding the influence of brain derived cytokines on normal brain function and immune derived cytokines in injury and disease, via converging signaling pathways T he focus of this dissertation is on Interleukin 2 (IL 2) which can be produced in the periphery and in the CNS. Interleukin 2 : a Pleiotropic Cytokin e IL 2 as its name suggests, is best known for its action s in the peripheral immune system w h ere it is common ly secreted by leukocytes to signal activation and differentiation to a number of cell types most notably, T cells, B cells, and macrophages (Wald mann, 2002 ). IL 2 belongs to the four helix bundle family of cytokines and signals via a common gamma ( c ) subunit shared by multiple cytokines including IL 4, IL 7, IL 9, and IL 15 (Sugamura et al., 1996) ; a subuni t only shared with IL 15 (Giri et al., 1995) ; and, in one conformation, an subunit, which confers high a ffinity binding (Leonard et al., 1984) T he creation of a transgenic knockout mouse model has provided further information on the inherent function of I L 2 in the immune system and its role in self tolerance (Schmitt et al., 1994) IL 2 knockout (KO) mice develop autoimmune symptoms in cluding ulcerative colitis, although the manifestation of the phenotype (e.g. advanced hemolytic anemia ) is dependent on the genetic background of the knockout

PAGE 14

14 mice (Horak, 1995, 1996) The autoimmune phenotype that develops when the IL 2 gene is deleted is T cell dep endent and marked by infiltration of auto reactive T cells to several tissues and organ systems (Ma et al., 1 995) Further investigation of these knockout mice has revealed that the apparent mechanism of autoimmunity is driven by the limited development and ability of regulatory T cells (CD4 + CD25 + T reg cells) to promote self tolerance and suppress T cell respo nses in vivo (Nelson, 2004) Though extensive research h as characterized IL 2 in the peripheral immune system, increasing evidence indicates that IL 2 may play a role in normal brain functioning and may potentially be involved in the pathogenesis of a number of neuropsychiatric and neurodegenerative diseases w here alterations in IL 2 function and IL 2 gene polymorphisms have been reported ( e.g., multiple sclerosi s, schizophrenia and Tourette syndrome ) ( Mahendran et al., 2004 ; Beloosesky et al., 2002; Morer et al., 2010; Cavanilla et al., 2010) Evi dence of IL 2 Action in the CNS The effect of IL 2 on cognition and mood in humans were among the earliest findings that suggested that this cytokine might have neurobiological actions. In early clinical studies of the cognitive side effects of IL 2 t herapy, 50% (i.e., 22 patients out of 44) of the subjects monitored developed cognitive changes, with 15 of them necessitating acute intervention (Denicoff et al., 1987) In other studies IL 2 therapy was found to impair spatial memory and performance in planning tasks (Capuron et al., 2001a) and induce depressive symptoms as early as two days into therapy (Capuron et al., 2000) In general, the most notable side effects occurred with higher doses and/or longer treatment intervals. In addition to cognitive and emotional ch anges other neurological side effects may include drowsiness, aphasia, blurred or double vision, and

PAGE 15

15 loss of taste ( published in the Proleukin package insert Cetus Oncology US, Rev 5/92 ). The impact of IL 2 on learning and memory has been investigated in hippocampal slice culture and was found to modulat e aspects of both short term (STP) and long term potentiation ( LTP) (Tancredi et al., 1990) and ha s been shown to interact with NMDA receptors and influence peak amplitudes in a concentration dependent manner ( Bender et al., 1996). IL 2 can also modulate the release of some neurotransmitters such as dopamine (Alonso et al., 1993; Petitto et al., 1997) and acetylcholine (Hanisch et al., 1993; Seto et al., 1997) The most potent effect s have been on a cetylcholine (Ach) release from septohippocampal cholinergic neurons in culture (Ha nisch et al., 1993; Seto et al., 1997) Exogenous IL 2 has also been shown to have trophic effects on fetal septal and hippocampal cells marked by increased viability and dendritic sprouting (Sarder et al., 1993; Sarder et al., 1996) Our lab has previou sly detected IL 2 receptors in the habenula, medial septum, hippocampal formation and associated limbic regions in mouse, and suspect that these effects are a result of d irect signaling through IL 2 receptors expressed by these neurons (Petitto and Huang, 2001). Exogenously administered IL 2 also has multiple effects on the hypothalamic pituitary axis (HPA). Effects on pituitary cells include stimulation of cortisol production and adrenal cortico tropin releasing hormone (Hanisch et al., 1994) and increas ed pituitary cell responsiveness to corticotropin releasing hormone (Witzke et al., 2003) IL 2 has also been shown to regulate the production and secretion of peptides from hypothalamu s (Karanth et al., 1993; Lapchak and Araujo, 1993; Pardy et al., 1993)

PAGE 16

16 Detection of IL 2 in the Brain Detection of IL 2 expression in the CNS has been challenging due to the instability of its mRNA and short half life of the protein ( Chappell et al., 19 98 ). There has been some success in detecting IL 2 mRNA in homogenized samples of murine hippocampus, amygdala, and pre frontal cortex by reverse transcriptase PCR ( Banks et al., 1991) IL 2 protein has also been detected in the hip pocampus, amygdala, pre frontal cortex, cerebral cortex, striatum and pituitary gland by enzyme linked immunoabsorbent assays ( Lee et al., 200 8 ). T hese studies make evident the normal expression of IL 2 in the brain, however they do not provide a ny infor mation about cellular origin. In situ IL 2 immunoreactivity has been mapped to di screte areas of perfused rat forebrain including the septohippocampal system, hippocampus, and related limbic regions (Lapchak et al.1991 ; Villemain, 1991; Lapchak, 1993 ), ho wever, the techniques used in these studies (e.g. antiserum directed against recombinant human IL 2) resulted in poor resolution and IL 2 reactivity appea red scattered and nonspecific. Overall, studies aiming to describe the origin of IL 2 in the brain ha ve been inconclusive and have yielded conflicting results that range from widespread expression that appears non specific to expression that is very limited or undetectable. Alteration of Septohippocampal System in IL 2 Knock Out M ice Morphology and Beha vior To assess the importance of brain derived IL 2 on neuronal function in vivo, our lab has investigated the morphological status of IL 2 related structures in a n IL 2KO mouse model on the C57BL/6 background IL 2KO mice ha d a 26% reduction in medial s eptal cholinergic neurons as assessed by choline acetyltransferase (ChAT) staining. Loss of IL 2 selectively affect ed medial septal cholinergic neurons as there were no

PAGE 17

17 differences in GABAergic cells originating from the medial septum and no changes in t he cholinergic neurons in the striatum (Beck et al., 200 2 ) In the hippocampus, IL 2KO mice ha d fewer granule cells (Beck et al., 200 5a ) and reduced infrapyramidal (IP) mossy fiber length (Petitto et al., 1999) ; a measure that has been positively correlat e d with spatial learning ability (Schopke et al., 1991; Schwegler and Crusio, 1995; Schwegler et al., 1988 ). W e previously observed that IL 2KO mice had markedly impaired spatial learning and memory in the Morris water maze. Examination of other domains of behavioral performance showed that IL 2 KO mice did not differ from WT controls in measures of fearfulness or locomotor activity in the elevated plus maze, or in reflexive startle responses to auditory stimuli although sensory motor gating assessed b y pre pulse inhibition of acoustic startle (PPI) was increased significantly (Petitto et al., 1999) Cytokine Profile IL 2 gene deletion alters the neuroimmunological status of the mouse hippocampus. Our lab previously measured cytokines in the hippocampu s and serum of IL 2KO mice by multiplex microsphere cytokine analysis (Beck et al., 200 5 b ). Compared to IL 2WT mice in the hippocampus of IL 2KO mice we detected an increase in known T cell chemoattractants interleukin 15 (IL 15), monocyte chemotactic pr otein 1 ( MCP 1 ) and Interferon gamma induced protein 10 ( IP 10 ) (Beck et al., 2005 b ). T he unique c ytokine profile s detected in the serum versus hippocampal tissue indicat e d th at IL 2 deficiency alter s the neuroimmunological status of the hippocampus by in fluencing the endogenous production of immune cytokines, rather than by peripheral cytokines tr aversing the BBB

PAGE 18

18 Neurotrophic Environment Compared to wild type mice, IL 2KO mice have drastically reduced concentrations of brain derived neurotrophic factor ( BDNF) and a reciprocal increase of nerve growth factor (NGF) in the hippocampus (Beck et al., 200 5 a ) This significant (~50%) alteration in neurotrophin levels may explain some of the neuropathologies we have observed in the septohippocampal system of our model. T L ymphocyte T rafficking to Brains of IL 2KO Mice Although not presented in its entirety here, prior to the studies that make up the later chapters of this dissertation, we investigated the trafficking of IL 2WT and IL 2KO T cells to the septum, hippocampus, and cerebellum of transgenic mice In this study, w e used an experimental approach that used a combin ation of inter breeding IL 2KO IL 2WT, and RAG 2K O mice to produce immunodeficient mice that either have functional brain IL 2 ( IL 2 WT /RAG 2KO ) or lack brain IL 2 ( IL 2KO/RAG2KO ) These animals were then reconstituted with either (normal) IL 2WT or (autoimmune) IL 2KO splenocytes to evaluate whether IL 2 deficiency in the brain, or rather autoimmun ity found in IL 2KO mice is responsible for the upregulation of T cell trafficking in the brain s of IL 2KO mice (Huang., 2009) In IL 2KO/RAG2KO mice that were reconstituted with a wild type immune system, the number of T cells found in all regions quantified (hippocampus, septum, and cerebellum) wa s doubled compared to IL 2 WT /RAG2KO mice reconstituted with a wild type immune system. In IL 2 WT /RAG2KO mice that did not lack brain IL 2 and reconstituted with autoreactive T cells from IL 2 KO mice, there was a comparable increase of T cell s in the hippo campus and septum (Huang et al., 2011) These findings demonstrate that brain IL 2 deficiency and possibly subsequent changes in the CNS (e.g. cytokines, chemokines, and

PAGE 19

19 neurotrophic factors), may lead to the development of T cell mediated inflammatory p rocesses in the brain Conversely, as previously shown in our lab using the facial nerve axotomy model of peripheral nerve injury, T cells that enter the CNS may play a role in maintaining the viability of neurons. In these studies we demonstrated that i n WT mice, re injury of the axotomized facial motor nerve results in the reversal of neuronal atrophy and loss of cholinergic phenotype typically observed after initial in jury RAG2KO mice that lack a functional immune system, do not exhi bi t these effect s (Ha et al., 2007 ). Therefore, given the known pathology of the medial septum and hippocampus of IL 2KO mice, wild type T cells trafficking to the CNS of IL 2KO/RAG2KO mice may indicate an underlying supportive function of T cells in response to the neur opathology caused by loss of endogenous IL 2 signaling in the brain Objectives of This Dissertation Research In the following chapter, we sought to disentangle the contributions of IL 2 deficiency in the brain versus in the peripheral immune system to alt erations in cholinergic expression in the medial septum While IL 2KO mice of the C57BL/6 strain are relatively autoimmune resistant, they do develop pathology in the bowel and exhibit sp l enomegaly that coincides with an increase of T cells in the CNS (H ua ng et al., 2009; Huang et al., 2011). In the IL 2KO model, we cannot be ce rtain whether the changes in in the brain, or rather a dy s regulation of the cholinergic septum due to loss of endogenous IL 2 T o make this distinction, we again bred IL 2KO/RAG2KO mice and compared the number of ChAT positive cells in the medial septum with those of IL 2KO and IL 2WT mice. This strategy allowed us to remove the confounding e ffects of autoreactive T cells as well as draw

PAGE 20

20 conclusions about the efficacy of T cells (if playing a supportive role) to rescue medial septal neurons from effects of IL 2 deficiency. In addition to answering this important question about the nature of our model, we evaluated the expression p rofile of multiple cytokines and chemokines in IL 2KO mice t o reveal any inflammatory signaling in the medial septum and to better understand the mechanism by which T cells are drawn to the C NS in response to loss of IL 2. Lastly, we tested whether the ch anges in neurotrophins we previously detected in the hippocampus was consistent with levels in the medial septum Despite interest for many years about IL 2 as a possible neurotrophic factor or neuromodulator in the septohippocampal system, reliable tools have been lacking to study the cell types and circuitry involved in IL expression profile of an IL2 GFP transgene reporter mouse (IL 2p8 GFP) that could provide a powerful tool to advance this field. Unlike the autoradiography studies done in rats, because GFP has a significantly longer half life than IL 2 and is not secreted from its cell of origin, we can provide a clear account of IL 2 expression without the problems of cross reactivity to other cytokines or ba ckground staining of secreted IL 2 that may explain the unspecific binding and wide range of detection abilities characteristic of existing methodologies. Here we use fluorescent immunohistochemistry co labeling techniques to determine which cell types (i .e. neurons or glia) and which select nuclei throughout the brain and brainstem express the IL2 GFP transgene In the final chapter, we investigated whether activation of microglia in vivo would activate the expression of the IL2 GFP transgene in our mod el. While the expression of IL 2 from microglia has been reported in rat (G ira r d et al., 2008) to our knowledge there

PAGE 21

21 is no evidence of IL 2 expression from murine microglia. Mirroring work done in rats shown to activate microglia in vivo we administer ed intraperitoneal injections of lipopolysaccharide to IL 2p8 GFP mice to evaluate the expression of IL 2 in the brain under these conditions. In a second experiment, we tested the expression of IL 2 from activated microglia in the facial nerve axotomy mo del. Axotomy of the peripheral nerve causes a localized proliferation and activation of microglia in the facial motor nucleus. This paradigm allowed us to investigate the microglial expression of IL 2 under alternative immune activating conditions and at the same time evaluate whether injury induces neuronal expression of IL 2 in the facial nucleus.

PAGE 22

22 CHAPTER 2 PHENOTYPIC LOSS OF S EPTOHIPPOCAMPAL CHOL INERGIC NEURONS: RELATION TO BRAIN VE RSUS PERIPHERAL IL 2 DEFICIENCY Introduction Interleukin 2 (IL 2) has been implicated in the pathogenesis of several major disease and schizophrenia (Hanisch & Quirion, 1995; Merrill, 1990) The in dispensable role of IL 2 for normal immune system functioning was discovered when IL 2 knockout (IL 2KO) mice demonstrated that IL 2 deficiency results in increased T cell trafficking and autoimmunity to multiple organ systems (Horak, 1995; Kundig et al., 1993; Schorle, Holtschke, Hunig, Schimpl, & Horak, 1991) and by research showing that IL 2 is essential for immune homeostasis, normal T regulatory cell function, and self tolerance (Nelson, 2004; Turka & Walsh, 2008) IL 2 is also expressed by brain cells. IL 2 receptors are enriched in the septohippocampal system where the cytokine has been shown to have trophic effects on fetal septal and hippocampal neurons, and have p otent effects on acetylcholine release from septohippocampal cholinergic neurons (Awatsuji, Furukawa, Nakajima, Furukawa, & Hayashi, 1993; Hanisch, Seto, & Quirion, 1993; Petitto & Huang, 2001; Sarder, Saito, & Abe, 1993; Seto, Kar, & Quirion, 1997) In addition to IL that loss of brain IL endogenous neuroimmunological milieu (e.g., alterat ions in the normal balance of cytokines and chemokines), and that such effects may be involved in initiating processes that lead to central nervous system (CNS) autoimmunity (Beck et al., 2005 b ; Huang et al. 2009; Huang et al. 2011 )

PAGE 23

23 We found previously that compared to wild type (WT) littermates, adult IL 2 deficient mice had a marked reduction of choline acetyltransferase (ChAT) positive medial septum/diagonal band of Broca (MS/vDB) cell bodies (Beck, King, Huang, & Petitto, 2002) This loss of ChAT positive neurons was selective for medial septum, as the cholinergic phenotype of WT and IL 2KO mice did not differ in the number of ChAT positive neurons in the striatum, and GABAergic neurons in the MS/vDB did not differ between IL 2WT and IL 2KO mice (Beck et al., 2002 ) Central versus peripheral immunological contributions on brain development and neuropathology a re not well understood. Neuroimmunology studies revealed that T lymphocytes can have important effects on CNS neurons, and normal peripheral T cell function has been found to be essential for the preservation of the phenotype of injured motoneurons (Ha, Huang, & Petitto, 2007; Jones, Serpe, Byram, Deboy, & Sanders, 2005; Schwartz & Moalem, 2001) We previously found in IL 2KO mice that there is a marked infiltration of T cells to the brain that mirrors, in relative magnitude, the progression of autoimmunity in the periphery (Huang et al., 2009) In the present study, we sought to test the hypothesis that the loss of quantifiable medial septal cholinergic neurons in IL 2KO mi ce is due to the loss of cholinergic phenotype rather than neuronal cell loss, and that the loss of phenotype is due to loss of brain derived IL 2 rather than changes in neuroimmune stat us or T cell infiltration. In E xperiment 1, we sought to determine if the loss ChAT positive neurons in the medial septum was due to loss of central (brain derived) IL 2, peripheral IL 2 (autoimmunity), or a combination of both factors. To accomplish this objective, in E xperiment 1 we compared ChAT positive neurons between IL 2WT mice, IL 2KO and congenic IL 2KO/RAG 2KO mice bred in our lab. These double knockout

PAGE 24

24 IL 2KO/RAG 2KO mice have peripheral immunodeficiency resulting from the absence of mature T and B cells associated with the loss of both RAG 2 gene alleles, and als o have both IL 2 gene alleles deleted. In E xperiment 2, we determined if the loss of the IL 2 gene resulted in changes in the endogenous expression of cytokines and chemokines in the me dial septum. In E xperiment 3, we quantified total neurons in the media l septum to test our working hypothesis that the marked reduction of ChAT positive neurons in the medial septum of IL 2KO mice is due to the loss of the cholinergic phenotype, rather than neuronal cell loss. Exploring a potential mechanism for downregulat ion of cholinergic phenotype (Lazo et al., 2010; V an der Zee & Hagg, 2002; Ward & Hagg, 2000) in E xperiment 3 we also quantified BDNF and NGF in the medial septum to assess how levels of these neurotrophic factors correlate with changes in ChAT positive neurons in the medial septum of IL 2KO mice. Materials and Methods Animals Mice used in these experiments were cared for in accordance with the NIH Guide for the Care and Use of Laboratory Animals and housed under s pecific pathogen free conditions. All animals used in these experiments were 8 12 weeks of age, and were matched for age and balanced for sex. IL 2KO mice were bred in our colony using IL 2 heterozygote by IL 2 heterozygote crosses as described previously (Huang et al., 2009) The IL 2KO mice, obtained originally from the NIH repository at Jackson Laboratories, were derived from ten generations of backcrossing onto the C57BL/6 background. IL 2KO/RAG 2KO mice were br ed in our colony using r ecombinase a ctivating g ene 2 knockout (RAG 2KO) mice that were originally obtained from Taconic farms. The RAG 2 protein is necessary for the recombination of T cell receptors and

PAGE 25

25 immunoglobulins, therefore, RAG 2KO mice fail to dev elop a mature and functional T and B cells. The breeding of these congenic mice was performed as described previously by our lab, where IL 2KO mice where bred with RAG 2KO mice, producing mice with both IL 2 and RAG 2 alleles deleted referred to here as IL 2KO/RAG 2KO (Huang et al. 2011 ) All mice used in study were on C57BL/6 background. G enotypes of mice were determined by PCR as described previously (Huang et al. 2009 ) Stat istical analyses for these studies were performed using analysis of variance (ANOVA), and post hoc analysis. Immunohistochemistry Mice were anesthetized by a 0.5mg/mL ketamine cocktail in a 3:3:1 ratio (ke tamine/xylazine/acepromazine) and were perfused with 4% buffered formaldehyde. Brains were dissected, post fixed 2 hr s and cryoprotected in 30% sucrose overnight. 15m sections were collected on Superfrost/Plus slides (Fisher could be performed. 40m sections were collected in 0.1 M phosphate buffered saline (PBS) and immediately used in staining protocol. Tissue sections were incubated in normal goat serum (Vector; 1:30 in PBS) f or 1 hour at room temperature followed by overnight incubation at 4C with the primary antibodies rabbit anti ChAT (Chemicon; 1:2000 in PBS with 0.3% Triton X 100 and 1% normal goat serum (NGS)), or rabbit anti beta III tubulin (Chemicon; 1:1000 in PBS wit h 0.3% Triton X 100 and 1% NGS, /well). Sections were washed and incubated overnight in the secondary antibody, biotinylated goat anti rabbit IgG (Sigma B 7389; 1:1000 dilution in PBS with 0.3% Triton X 100 and 1% NGS). The sections were then washed and in cubated in

PAGE 26

26 ExtrAvidin (Sigma E 2886; 1:1000 in PBS) for 2 h. The sections were developed in 0.5 diaminobenzidine (DAB), 0.2 mg/ml urea H 2 O 2 for approximately 5 min and were placed on slides, dehydrated in graded ethanol washes, cleared in two ch anges of xylenes, and coverslipped. Cytokine Analysis Septal homogenates were analyzed from IL 2KO and WT mice to compare cytokine levels in the septum as described previously (Beck et al., 2005 b ) Briefly, mice w ere anesthetized with an injection cocktail of 3:3:1 ketamin e (100 mg/m L )/xylazine (20 mg/mL )/acepromazine (10 mg/mL) at a dose of 0.015 mL injection cocktail/g body weight. The animals were then saline perfused. The brains were removed, snap frozen, and t microgram sca of homogenizing solution (500 mM NaH 2 PO 4 /Na 2 HPO 4 buffer and 0.2% TX 100 in H 2 O with anti protease complete TM cocktail (Boehringer) per mg of wet weight tissue). The tissue was sonicated in the homogenizing solution for 30 s on ice and centrifuged at 16,000 g for 15 min at 4 C. microsphere cytokine analysis was performed to measure a number of cytokines in the septum of IL 2KO and WT mic e using Lincoplex mouse cytokine (Linco, Research, Inc) and Luminex 100 LabMAP system (Upstate Biotechnology) kits. Assays were performed according to the manufacturer's instructions, and cytokine concentrations were calculated using the Softmax program an d the linear range on the standard curve

PAGE 27

27 (3.2 10,000 pg/mL ). Altogether, we attempted to detect a total of 22 different cytokines and chemokines. Neurotrophin Analysis Enzyme linked immunosorbent assay (ELISA) measurement of NGF and BDNF was performed as described previously (Beck et al., 2005 a ) Levels of NGF and BDNF were analyzed in the homogenates from medial septum using a commercially available E max immunoassay system according to the manufacturer's instruct ions (Promega). Briefly, the 96 well plates were coated with 1:6250 anti NGF polyclonal antibodies in carbonate coating buffer (0.025 M sodium bicarbonate, 0.025 M sodium carbonate, pH 9.7) and incubated overnight at 4 C. The plates were washed with TBST wash buffer (20 mM Tris HCL pH 7.6, 150 mM NaCl, 0.05% (v/v) Tween 20) and blocked with 1 Block and Sample buffer (provided with kit) for 1 h. The plates were washed again with TBST, and a set of standard curves were generated in duplicate by performing 1 : 2 dilutions of a known 500 pg/mL standard in a range from 500 to 7.6 pg/mL follo wed by a All added samples and standards were allowed to incubate at 25 C for 6 h. The plates were washed thoroughly with TBST, and a 1:4000 anti NGF monoclonal antibody was added and incubated overnight at 4 C. The plates were again washed with TBST, and a 1:100 anti rat IgG polyclonal antibody conjugated to HRP was added for 2.5 h at room temperature. The plates were washed, and TMB One Solution was added for color development for 10 min. The reaction was stopped with the addition of equal volume of 1 N HCl, and the absorbance was read at 450 nm within 30 min of the color development reaction. The data were reported as pg of protein per mg wet weight tissue.

PAGE 28

28 Cell Quantification For quantification of stained neuronal somata of the medial septum cells were counted using the software MCID 5.1 and the three dimensional counting box (optical dissector) method described by Williams and Rakic (Williams & Rakic, 1988) as described previously by our lab ( Beck et al., 2002) All stereology was performed using a CCD High Resolution Sony camera and a Zeiss Axioplan 2 microscope with a motorized x y stage made by Imaging Research, Inc. The latter is capable of making movements as fine Every third section through the anterior posterior extent of the septal region was sampled. The regions to be counted were outlined at 10x magnification and the size of the counting boxes were generated to be approximately 5% of the most rost ral, and therefore, smallest, area of the medial septum (defined by the section where the corpus collosum first joins in the midline). The size of the outlined count regions, but not the counting box, varied depending on where the individual section was t aken from the rostral to caudal extent of the medial septum. The defined counting box was approximately 2 2.5% of the outlined count area of the largest single section of the medial septum. Quantification of ChAT positive neurons was performed on 20 m s other brain regions for other ongoing studies in our lab, and the neuronal assessments were done as described previously in our lab for comparing relative difference between groups (Ha et al., 2006) Planimetric counting methods were used due to section thickness. A total 30 sections throughout the entire medial septum per animal were collected. Eight sections per animal (approximately 1/4 of the entire medial septum), were used to quantify the number of cholinergic neurons. Sections were chosen throughout the medial septum at a fixed interval with every fourth section selected for

PAGE 29

29 quantification. Ch AT immunostained histological sections we re processed for cell number quantification with in the region of interest encompassing the individual left and right medial septal nuclei defined by a triangular shape that extended, dorso ventrally, from the apex of the medial septum to an imaginary line connecting the lower limits of the anterior commissures on each hemisphere and, medio laterally, from the midline to the outer limits of the medial septal area (Lopez Coviella et al., 2011 ) Briefly, color images w ere taken with a SPOT digital camera at 10X magnification. ImageJ (National Institutes of Health) was used to view the images and perform the planimetric cell counting. Results In E xperiment 1, we compared ChAT positive medial septal neurons between I L 2WT, IL 2KO and congenic IL 2KO/RAG 2KO mice. As seen in Figure 1, there was a significant main effect of subject group [F(2,10 )=38.9, p< .05]. Post hoc anal y se s co nfirmed that IL 2KO and IL 2KO/RAG 2KO mice did not differ from one another, however, bot h of these subject groups had significantly lower ChAT positive neuron numbers than IL 2WT mice (p<.05). In E xperiment 2, to determine if the loss of IL 2 resulted in changes in the endogenous expression of cytokines and chemokines in the medial septum, we compared levels of 22 different cytokines and chemokines between IL 2WT (n=8) and IL 2KO (n=7) mice. In medial septal homogenates, there were detectable levels of IL 6, IL 1, IL 17, IL 7, IL 9, IL 12, IL 15, interferon gamma inducible protein of 10 kD (IP 10), and monocyte chemoattractant protein 1 (MCP 1). Thus, only those cytokines and chemokines detected were subjected to statistical analyses. The remainder of the cytokines and chemokines tested could not be detected, these were: IFN

PAGE 30

30 IL 2, IL 4, IL 5, IL 10, IL 13, kerotinocyte derived chemokines (KC), granulocyte stimulating factor (G CSF), macrophage inflammatory protein 1 alpha (MIP 1), and RANTES. Among the cytokines and chemokines that were measurable, there were no differ ences between IL 2WT and IL 2KO mice. In E xperiment 3, we quantified total neurons in the medial septum by counting cells positive for the pan neuronal marker beta III tubulin between IL 2WT (n=5) and IL 2KO (n=5) mice, to test the hypothesis that the mark ed reduction of ChAT positive neurons in the medial septum of IL 2KO mice is due to the loss of the cholinergic phenotype. We found that there were no differences in beta III tubulin stained neurons between the IL 2WT and IL 2KO mice (data not shown). We also compared BDNF and NGF levels between IL 2WT and IL 2KO mice in medial septal homogenates. Figure 2 shows the results of the comparison of these neurotrophins between the groups. As seen in Figure 2, IL 2KO mice had markedly higher levels of NGF in the medial septum compared to IL 2WT mice [F(1,11)=13.3, p<.005]. For BDNF, however, there were no differences between these subject groups. Discussion Consistent with our hypothesis, the results of these quantitative experiments show that the reduction in stained neurons in the medial septum is not due to cell loss, but to a change in cholinergic phenotype. Since IL 2KO mice do not produce brain IL 2, but have peripheral T cell dysregulation and autoimmunity from the loss of IL 2 in the peripheral immune system, we needed to determine if the reduction in medial septal ChAT positive neurons was the result of the peripheral immune alterations associated with the loss of peripheral IL 2. Using IL 2KO/RAG 2KO mice that lack a functional immune system, we esta blished that the loss of ChAT positive cells in the medial

PAGE 31

31 septum is due to loss of brain derived IL 2 rather than the peripheral immune dysregulation present in IL 2KO mice (Huang et al., 2009) Quantitative comp arisons of total cells in the medial septum of IL 2KO and IL 2WT mice revealed that the reduction in ChAT positive cells in the medial septum is indicative of a change in cholinergic phenotype rather than cell death. Loss of the cholinergic phenotype by m edial septal neurons has been recognized since the seminal study by Hagg and colleagues (Hagg, Manthorpe, Vahlsing, & Varon, 1988) who demonstrated that loss of medial sep tal cholinergic phenotype occurs following axotomy, and is reversible with intracerebroventricular infusion of NGF Surprisingly although there were no differences in detectable cytokines and chemokines in the medial septum, we found previously that IL 2 KO mice had alterations in the hippocampus (Beck et al., 2005 a ) Thus, it appears that loss of IL 2 modifies the neuroimmunological enviro n ment differently in different regions of the brain. The neurotrophic facto r that is specifically responsible for maintaining cholinergic phenotype, NGF, was elevated while BDNF levels were not abnormal in the absence of IL 2. IL 2 has been found to modify the expression of neurotrophin receptors in lymphocytes (Besser & Wank, 1999) however, the effects of IL 2 on NGF in the brain is unknown. Septal cholinergic neurons account for most of the cholinergic innervation of the hippocampus and play a key role in the regulation of hippocampal synaptic activity (Lazo et al. 2010 ) Since neuronal expression of neurotrophins is controlled by some neurotransmitters and there is a to pographical correlation between neurotrophin expression and cholinergic terminal distribution from the cholinergic basal forebrain (Yu, Pizzo, Hutton, & Perez Polo, 1995) it has been investigated whether cholinerg ic

PAGE 32

32 afferents regulate neurotrophin gene expression in the hippocampus. When cholinergic neurons were selectively and completely destroyed by intraventricular injection of 192 IgG saporin, resulting in a cholinergic deafferentation of the hippocampus, there were no significant changes in NGF or BDNF mRNA levels from 1 week to 5 months after the lesion (Yu et al., 1995) Similarly, in a developmental study using hippocampal slice culture, changes in neurotrophin expr ession in the excised hippocampus over time reflected the changes that occur in vivo (Forster, Otten, & Frotscher, 1993) These results suggest that cholinergic afferents may not play a significant role in maintai ning basal levels of neurotrophin gene expression in the hippocampus, and that perhaps loss of IL 2, rather than the consequence of changes in cholinergic functionality, may be responsible for changes in neurotrophic environment. This dysregulation of hipp ocampal and medial septal neurotrophins may be, in part, responsible for the failure of cholinergic neuronal maintenance seen in the Ms/vDB of IL 2KO mice. Further studies are needed to determine the purported point of convergence of the IL 2 and neurotro phin signaling pathways. In summary, the reduction of cholinergic cells in the medial septum of IL 2KO mice is due to loss of brain derived IL 2 rather than neuroimmunological processes initiated by the peripheral T cell dysregulation and autoimmun it y that develops in these mice. The loss of ChAT staining in the medial septum of IL 2KO mice did not coincide with loss of total neurons, suggesting that the failure to visualize these cells by ChAT immunohistochemistry is due to a down regulation of the protei n and a consequent change in cholinergic phenotype. Lastly, we detected an increase in NGF in the medial septum that mirrored the increase we previously reported in the hippocampus (Beck e t

PAGE 33

33 al., 2005 a ) This dysr egulation of the neurotrophin environment in the septohippocampal pathway, in response to loss of brain derived IL 2, is a likely candidate in the etiology of the observed changes in phenotype, or conversely, may play some compensatory function in providin g cholinergic support. If the latter is true, and IL 2 deficiency has direct consequences on cholinergic function, we are compelled to hypothesize that endogenously produced brain IL 2 has a biologically significant role in maintaining cholinergic circuit ry in the septohippocampal system.

PAGE 34

34 Figure 2 1. Quantification of ChAT+ cells in the mouse medial septum of subject groups at 8 weeks of age. Bars represent the mean S.E.M. for IL 2WT(C57), IL 2KO/RAG 2KO(KO/KO), and IL 2KO mice. N=5 mice/group. *p< .05 Figure 2 2 Comparison of BDNF (left) and NGF (right) protein levels in the medial septum of IL 2KO mice (n=7) vs. IL 2WT littermates (n=6). Bars represent mean S.E.M.

PAGE 35

35 CHAPTER 3 EXPRESSION OF GFP IN B6.CG TG (IL2 EGFP) 17EXR TRANSGEN IC MIC E: EVIDENCE FOR THE NEU RONAL EXPRESSION OF INTERLEUKIN 2 IN DISCRETE REGIONS OF MURINE BR AIN Introduction Interleukin 2 (IL 2) is widely regarded as a pro inflammatory cytokine responsible for regulating homeostasis, activation, and clonal expansion of T c ells in the peripheral immune system. There are several lines of evidence that suggest IL 2 may also function as a neuromodulator Most of our understanding about the role IL 2 may play in the brain comes from studies that demonstrate how exogenously admi nistered IL 2 to neurons in culture has dynamic effects on several key functions such as long term and short term potentiation in the hippocampus ( Tancredi et al., 1990; Bender et al., 1996 ), neurotransmitter release from cholinergic and dopaminergic neuro ns ( Alonso et al., 1993; Petitto et al., 1997 ; Hanisch et al., 1993; Seto et al., 1997 ), and has been shown to have neurotrophic effects on septal and hippocampal primary cell cultures ( Sarder et al., 1993; Sarder et al., 1996 ) Despite interest for many years about IL 2 as a possible neurotrophic factor or neuromodulator, reliable tools have been lacking to study the cell types and circuit ry involved in IL situ IL 2 immunoreactivity has been mapped to di screte areas of perfused rat forebr ain including the septohippocampal system, hippocampus, and related limbic regions (Lapchak et al.1991 ; Villemain, 1991; Lapchak, 1993 ), however, the techniques used in these studies (e.g. antiserum directed against recombinant human IL 2) resulted in poor resolution and IL 2 reactivity appea red scattered and nonspecific. Overall, studies aiming to describe the origin of IL 2 in the brain have been inconclusive and have yielded conflicting results that range

PAGE 36

36 from widespread expression that appears non spec ific to expression that is very limited or undetectable. B6.Cg Tg(Il2 EGFP)17Evr ( IL2p8 GFP) transgenic mice, generated by targeting a new upstream regulatory region of the IL 2 gene, reliably express green fluorescent protein (GFP) in immune cells known to produce IL 2 (Eizenberg et al., 1995). The expression of GFP in the brains of these animals has not been documented. Here we report on the expression of GFP from the brains of I L2 p8 GFP m ice, a novel approach that could provide a powerful tool to adva nce this field. Unlike the autoradiography studies done in rats, because GFP has a significantly longer half life than IL 2 and is not secreted from its cell of origin, we can provide a clear account of IL 2 expression without the problems of cross react ivity to other cytokines or background staining of secreted IL 2 that may e xplain the no nspecific binding and wide range of detection abilities characteristic of existing methodologies. Here we use fluorescent immunohistochemistry co labeling techniques t o determine which cell types (i.e. neurons or glia) and which select nuclei throughout the rostral caudal extent of the brain and brainstem express the IL2 GFP transgene We observed GFP expression in the immune cells of the spleen and thymus, and in neu ronal populations of the septal nuclei, thalamus, hypothalamus, striatum, cortex, and brainstem. Our findings suggest that IL 2 is produced by neurons in discrete regions of the mouse brain and supports the hypothesis that IL 2 is used in normal brain sig naling. IL 2 has been implicated in a number of psychiatric and neurodegenerative disorders where aberrant levels of central and peripheral IL 2 have been reported ( Mahendran et al., 2004 ; Beloosesky et al., 2002; Cavanilla et al., 2010 ). The mounting

PAGE 37

37 evi dence supporting a role of IL 2 in normal brain functioning should lead to a new perspective in evaluating IL 2 levels in assessing and studying neurological disease. Materials and Methods Animals All mice in this study were cared for in compliance with the NIH Guide for the Care and Use of Laboratory Animals. Mice were housed in microisolater cages under specific pathogen free conditions. Breeding and Genotyping Female B6.Cg Tg (Il2 EGFP ) 17Evr (IL2p8 GFP) mice were obtained from the Mutant Mouse Regiona l Resource Center and bred with C57BL/6 mice obtained from Jackson Laboratories. Transgene positive offspring were identified by PCR analysis of tail DNA. PCR primers in the IL 2 proximal promoter (IL2 CATCCTTAGATGCAACCCTTCC sequence (GFP GCTGAACTTGTGGCCGTTTAC bp product in transgene positive mice. PCR conditions were as follows: 94C, 5 min, then 35 cycles of 93C, 30 s; 62C, 15 s; 72C, 45 s, followed by a final 5 min at 72C, using an i cycler (BioRad). Tissue Preparation Mice were anesthetized by a 0.5mg/mL ketamine cocktail in a 3:3:1 ratio (ketamine/xylazine/acepromazine) and were perfused with 4% paraformaldehyde (PF). Brains were dissected, post fixed in 4% PF, and dehydrated in 3 0% sucrose overnight.

PAGE 38

38 until staining could be performed. Immunohistochemistry Tissue sections were air dried and were incubated in normal goat serum (Vector; 1:30 in PBS) for 1 hour at room temperature followed by overnight incubation at 4C with the primary antibodies mouse an ti NeuN (MAB377; 1:250; Millipore), and rabbit anti GFP ( A 11122 ; 1:5000; Life Technologies). Phosphate buffer saline (1X) was used for all wash steps performed between incubation steps (Fisher Scientific). Visualization of the primary antibody was perform ed by incubating sections in goat anti mouse Texas Red secondary antibody (1:300; Life Technologies), and g oat anti rabbit Alexa Fluor 488 secondary antibody ( 1:300; Life Technologies) for 2 hours at room temperature. Sections were coverslipped with Vecta shield mounting medium (Vector Laboratories). Specificity of antibodies were tested by systematic omission of either primary or secondary antibody and specificity of anti GFP was further challenged by pre incubating the primary antibody with recombinant G FP protein prior to use in staining the protocol (figure 3 1). All qualitative assessments of GFP staining in mice positive for the reporter were made in comparison to GFP negative littermates. Results In this study we used fluorescent immunohistochemist ry co localization techniques to determine the cellular origin of IL 2 in IL2p8 GFP transgenic mice that co express GFP reporter in cells that express IL 2. To test the s pecificity of the GFP antibody, we pre incubat ed the primary antibody with recombinan t GFP prior to use in our staining protocol to quench its ability to bind the antigen in tissue. Spleen tissue, that reliably exhibits transgene expression from T cells, was used as a positive control

PAGE 39

39 for each staining procedure ( F igure 3 1). GFP express ion was found throughout the brain in discrete nuclei with apparent differences in relative staining intensity (T able 3 1). In most cells expressing GFP, the reporter was co localized with NeuN a pan neuronal cell marker we used to confirm the neuronal p henotype o f GFP positive cells (F igure 3 2 ). The few c ells stained positive for GFP but not NeuN were morphologically and geographically identical to those expressing both markers Discussion The IL2p8 GFP strain has proven to be a successful model for evaluating the endogenous expression of IL 2 in the peripheral immune system in vivo IL 2 is implicated in a number of neurobiological processes and numerous studies have attempted to determine the origin of brain derived IL 2, however, the elusive prope rties of IL 2 mRNA and protein have thwarted attempts using co nventional methodologies. Here we discuss our findings in the context of our previous work in the septohippocampal system of IL 2KO mice and speculate on the significance of IL 2 expression in l ess familiar regions based on our histological data and known anatomical and functional properties of regions positive for the reporter. Multiple studies have shown that exogenously administered IL 2 to septohippocampal neurons has potent effects on the r elease of acetylcholine from septal neurons and trophic effects on both cell types in culture ( Sarder et al., 1993; Sarder et al., 1996 ). T he known circuitry of the septohippocampal system, and distribution of IL 2 receptors in the limbic system ( Lapchak et al., 1991; Petitto et al., 1995) corresponds well with the expression pattern of GFP we found in IL2p8 GFP mice. The lateral septum where robust expression of GFP was detected projects mainly to t he medial septum and hippocampus and is therefore wel l positioned to

PAGE 40

40 provide modulatory input to the septohippocampal system ( F igure 3 3) We also detected conservative expression of GFP from a subset of cells in the subiculum, the main output structure of the hippocampus that projects back to the septal n uclei (in addition to other GFP positive regions i. e., prefrontal cortex, hypothala mus, mammillary nuclei, entorhinal cortex and amygdala ) We previously described the effects of brain derived IL 2 deficiency on cholinergic phenotype and neurotrophin expr ession in the septohippocampal system of IL 2KO mice (Beck et al., 2005 a ; Meola et al., under review). IL 2KO mice exhibit a significant loss of ChAT expression in the medial septum and neurotrophin levels in both the medial septum and hippocampus are alte red. Because we did not detect GFP in the hippocampus, we suspect that these effects may be due to lack of IL 2 signaling upstream in the septal nuclei that may interfere with the impact of NGF arrival from the hippocampal projection field that can regula te the expression of ChAT ( Hagg et al., 1988 ). Because IL 2 receptors are expressed both in the sept um and hippocampus (Petitto et al., 1995), and neurotrophins in the hippocampus are expressed independently of cholinergic innervation (Forster, Otten, & F rotscher, 1993 ; Yu et al., 1995 ), further studies designed to identify a point of convergence of the NGF and IL 2 signaling pathways are needed to determine how loss of IL 2 signaling from the septal nuclei could result in these deleterious effects. In add ition to the neuropathology in the septum and hippocampus, we ha ve detected changes in several measures of behavior. IL 2KO mice exhibit markedly impaired spatial learning and memory in the Morris water maze and while no differences were found in reflexiv e startle responses to auditory stimuli, pre pulse inhibition of acoustic startle (PPI), a measure of sensor i motor gating, was increased significantly

PAGE 41

41 (Petitto et al., 1999). The entorhinal cortex is well established as the seat of spatial memory and navi gation, whereas t he dorsal endopiriform nucleus, lateral septum, amygdala, and cingulate are known to be involved in sensor i motor gating and were found to express GFP in ILp8 GFP reporter mice. Further evidence of a pleiotropic role for IL 2 in the immun e and nervous systems has been demonstrated by systemic administration of IL 2. In studies evaluating the neuropsychiatric symptoms of patients receiving IL 2 therapy, ~50% developed cognitive and emotional symptomology as early as 2 days into therapy ( De nicoff et al., 1987; Capuron et al., 2000). Neurobiological side effects published by the manufacturer of the IL 2 drug Proleukin include depression, hallucinations, memory deficits, dizziness, fever, blurred vision and loss of taste. In this study, we fo und GFP to be expressed in the septal nuclei, amygdala, median raphe nucleus, entorhinal cortex, vestibular nuclei, solitary nucleus, olfactory bulb, and lateral geniculate nucleus of the thalamus, which may help explain why those receiving IL 2 therapy re port these disturbances. Exogenously administered IL 2 also has multiple effects on the hypothalamic pituitary axis (HPA). Effects on pituitary cells include stimulation of cortisol production and adrenal cortico tropin releasing hormone (Hanisch et al., 1994) and increas ed pituitary cell responsiveness to corticotropin releasing hormone (Witzke et al., 2003) IL 2 has also been shown to regulate the production and secretion of peptides from the hypothalamus (Karanth et al., 1 993; Lapchak and Araujo, 1993; Pardy et al., 1993) In IL2p8 GFP mice, GFP was expressed from the paraventricular hypothalamic nuclei that have direct projections to the pituitary gland, and t he anterior /posterior hypothalamic nuclei involved in thermoregulation.

PAGE 42

42 Briefly, it is notable that many nuclei that were found to express GFP are interconnected and have similar f unctional roles or modalities (T able 3 1) For example, the motor cortex, anterior and lateral aspects of the striatum, interposed nuclei, red nuclei, inferior olivary nuclei, and the gigantoce llular reticular nucleus are all involved in motor control; whereas the somatosensory cortex, fastigial nucleus of the cerebellum, vestib ular nuclei, and the mesencephalic nucleus of the trigeminal nerve are important to proprioception. Lastly, many positive nuclei are involved in nociception and analgesia: periaqueductal gray, central gray of the pons, and the r aphe magnus nucleus Overa ll, the anatomical expression profile of GFP in this reporter model syncs well with the existing literature and appears to be restricted to specific modalities. Our data should help fill the gaps in our current knowledge of the origin of IL 2 in the brain as well as inspire novel inquiries as to its function in the nervous system. In this study we evaluated the expression of GFP in the brains of ILp8 GFP mice under normal physiological conditions. We did not detect GFP in any cell types other than neuro ns. A few studies have reported on the expression of IL 2 from microglia in response to lipopolysaccharide, a potent inducer of inflammation, and insults such as hypoxic ischemia ( Kowalski et al., 2004; Girard et al., 200 8 ) In the future, it will be int eresting to test methods of microglia activation in the IL2p8 GFP transgenic reporter model.

PAGE 43

43 Figure 3 1. GFP positive cells in the lateral septum (top) and in the spleen (bottom). Bottom panel illustrates specificity of GFP antibody. Reactivity of p rimary antibody was quenched with 10 l free recombinant GFP protein prior to use in staining protocol.

PAGE 44

44 Figure 3 2. Representative micropictographs showing expression of GFP in the medial septum (top) and red nucleus (bottom). Arrows annotate cells pos itive for GFP (left), pan neuronal cell marker NeuN (center), co localization of both markers (right)

PAGE 45

45 Figure 3 3. GFP positive cells in the lateral septum (left) ; fastigial nucleus and interposed nucleus of the cerebellum (right). Shown here at 10 X magnification Fastigial nucleus cerebellum Posterior interposed nucleus

PAGE 46

46 Table 3 1. List of nuclei positive for the IL 2 transgene through out the rostral caudal extent of the brain and brainstem. (+) sy mbol designates relative intensity of GFP staining as visualized by fluorescen ce immunohistochemistry Nucleus Modality Relative staining intensity Mitral cell layer olfactory bulb Olfactory ++ Granular cell layer olfactory bulb Olfactory +++ External piriform layer olfactory bulb Olfactory ++ Anterior olfactory nucleus (ventral and medial) Olfactory ++ Ventral and lateral orbital cortices Limbic ++ Cingulate Limbic ++++ Motor 1 Motor ++ Motor 2 Motor ++ Dorsal endopiriform nucleus Sensory motor g ating (SMG) ++++ Striatum Motor, SMG + Lateral septum Limbic, SMG ++++ Medial septum Limbic ++ Horizontal limb diagonal band of Broca Limbic ++ Subiculum Limbic + Paraventricular hypothalamic nucleus Limbic, Autonomic +++ Basal lateral amygdaloid nucleus Limbic + Anterior and posterior hypothalam us Autonomic ++ V entrolateral geniculate nucleus, parvocellular Vision +++ Nucleus of the solitary tract Chemosensation ++++ Periaqueductal gray Analgesia ++ Median raphe nucleus Analgesia ++ Magnocellular reticular formation/ Gigantocellular reticular formation Mixed ++++ Red nucleus Motor ++++ Entorhinal cortex (medial/lateral ) Spatial memory ++++ Mammillary bodies Memory ++++ Mesencephalic nucleus of 5 Proprioception, Mot or ++ Pontine gray Relay ++ Lateral v estibular nucleus Proprioception, Motor +++ Fastigial nucleus cerebellum Proprioception, Motor ++++ Posterior interposed nucleus Proprioception, Motor ++++ Inferior olivary nucleus Proprioception, Motor +++

PAGE 47

47 CHAPTER 4 EXPRESSION OF IL 2 IN RESPONSE TO SYSTE MIC LPS CHALLENGE AN D FACIAL NERVE AXOTOMY IN B6.CG TG (IL2 EGFP) 17EVR TRANSGEN IC MICE Introduction Interleukin 2 (IL 2) a well characterized immune system cytokine, has been increasingly recognized as an endogenous brain derived cytokine that may play a role in the normal function of multiple CNS pathways W e have recently reported on the neuronal expression of green fluorescent protein (GFP) in B6.Cg Tg (Il2 EGFP ) 17Evr ( IL2p8 GFP) transgenic mice, that reliably express the reporter in cells known to produce IL 2 (Eizenberg et al., 1995 ; Meola et al., under review ) As noted in the previous study (Chapter 3), evaluation of GFP expression in IL2p8 GFP transgenic mice indicate that resting microglia do not express IL 2 under normal physiological conditions Studies that report immunoreactive localization of IL 2 in rat microglia have use d measures of immune activation to induce microglia activation such as intraperitoneal injection (i.p.) of lipopol ysaccharide (LPS), a potent antigen from gram n egative bacteria, and physical manipulations such as hypoxic ischemia ( Girar d et al., 2008 ). In this study we used two methods of microglia activation in ILp8 GFP mice to assess the expression of IL 2 from a ctivated microglia in vivo Facial nerve axotomy, a model of peripheral nerve injury we routinely use in our lab to evaluate neuro inflammatory processes results in the activation and proliferation of microglia in the facial motor nucleus. Second, we use d the standard procedure of i.p. injection of LPS to induce systemic inflammation and activation of microglia in the brain.

PAGE 48

48 Materials and Methods Animals Three B6.Cg Tg (Il2 EGFP) 1 7Evr transgen ic mice and two wild type littermates negative for the GFP rep orter were used in all groups for each experiment (total of 30 mice) Transgene positive offspring were identified by PCR analysis of tail DNA. PCR primers in the IL 2 proximal promoter (IL2 CATCCTTAGATGCAACCCTTCC and the GFP coding sequence (G FP GCTGAACTTGTGGCCGTTTAC used, amplifying a 830 bp product in transgene positive mice. PCR conditions were as follows: 94C, 5 min, then 35 cycles of 93C, 30 s; 62C, 15 s; 72C, 45 s, followed by a final 5 min at 72C, using an i cycler ( BioRad). Facial Nerve Axotomy Animals were anesthetized with 4 % isoflurane. The right facial nerve was exposed, and a portion of the main branch resected to prevent nerve reconnection as described previously (Ha et al., 2007). The whisker response was as sessed after surgery to ensure complete whisker paralysis. Mice in each group were then sacrificed at 7 and 14 days after resection injury to assess CD11b + and MHC II + microglia in the injured FMN. Lipopolysaccharide Animals received 1mg/kg LPS (Sigma) dis solved in 500u L of 1X PBS via i.p. injection. Control animals received 1 volume of vehicle. Animals were sacrificed at 3, 6, and 26 hours after injection ( Jeong et al., 2010; Terrando et al., 2010 ) Tissue Preparation Mice were anesthetized by a 0.5mg/ ml ketamine cocktail in a 3:3:1 ratio (ketamine/xylazine/acepromazine) and were perfused with 4% paraformaldehyde (PF).

PAGE 49

49 Brains were dissected, post fixed in 4% PF, and dehydrated in 30% sucrose overnight. Tissue was snap frozen in isopentane and stored at 80C. Coronal sections were cut performed. Immunohistochemistry Tissue sections w ere air dried and were incubated in normal goat serum (Vector; 1:30 in PBS) for 1 hour at room temperature followed by overnight incubation at 4C with the primary antibodies rat anti cd11b (MAB11372; Millipore), rat anti MHC II (M5/114.15.2; PharMingen) o r rabbit anti GFP ( A 11122 ; 1:5000; Life Technologies). Phosphate buffer saline (1X) was used for all wash steps performed between incubation steps (Fisher Scientific). Visualization of the primary antibod ies for microglia markers cd11b and MHC II, was per formed by incubating sections in goat anti rat secondary antibody (1:2000, Vector Labs) for 2 h at room temperature followed by incubation in avidin peroxidase conjugates (1:500, Sigma) for 1 h. No signal was obtained with each of the primary or secondary antibodies alon e. The chromagen reaction was revealed by diaminobenzidine (DAB) H 2 O 2 solution (Sigma; 0.07% DAB/0.004% H 2 O 2 ). Sections were dehydrated in ascending alcohol washes, cleared in xylenes, and coverslipped. (1:300; Life Technologies). Visua lization of the primary antibody for GFP was performed by incubating sections in g oat anti rabbit Alexa Fluor 488 secondary antibody ( 1:300 ; Life Technologies) overnight at 4C, washed, and coverslipped with Vectashield mounting medium (Vector Laboratories ). Spleens of transgene positive animals were stained for GFP as positive controls

PAGE 50

50 Results Groups that received facial nerve axotomy, assessed at either 7 or 14 days post surgery, exhibited robust activation of microglia as visualized by cd11b staining an d assessed by phenotypic changes in morphology, i.e. am o eboid vs. ramified phenotype and formation of phagocytic clusters around dying neurons (Ha et al., 2007). No GFP staining was detected in activate d microglia from either group (F igure 4 1). A nimals that received LPS showed a conservative increase in activation of microglia at 26 hours after injection compared to those assess ed at 3 and 6 hours (data not shown) Sections stained for GFP did not reveal any expression in all animals tested regardless o f activation state Spleens of transgene positive animals were stained for GFP as positive controls Discussion P revious studies that have reported the expression of IL 2 in microglia both in vivo and in vitro have been conducted in rats (Girard et al., 2008; Kowalski et al 2004). Differences may exist between the two species in the expression of IL 2 or possibly in the methods necessary to induce the expression of IL 2 in activated microglia. In agreement with our findings, one study that incubated p rimary cultures of rat microglia in a range of LPS concentrations found upregulation of a number of inflammatory cytokines but failed to detect IL 2 during the 72 hour incubation period (Du and Li 1998). We previous characterized the expression of GFP in the brains of naive IL 2p8 GFP mice and found that all IL 2 expressing cells were neuronal with no indication of expression from glial type cells. Pioneer ing studies done by the group that generated the IL 2p8 GFP strain report that GFP is reliably expr essed by immune type cells in the periphery that normally express IL 2. In this study, we used the spleens of transgenic

PAGE 51

51 animals as positive controls due to the robust expression of IL 2 from T cells in the white pulp of these tissues. Therefore, it does not appear that the GFP transgene expressed in this model is restricted to neuronal subtypes or lacks the ability to be expressed properly in cells of haematopoietic lineage. Together, t hese observations and the data presented in Chapter 3 indicate that microglia in the mouse brain do not express IL 2 in this model under any of the conditions tested. Figure 4 1. IL 2 expression in injured facial motor nucleus (area indicated by rectangular border). Representative section stained with anti GFP primary antibody 7 days after periphery nerve axotomy. Note lack of IL 2 staining in area of interest in contrast to positive staining in the reticular nucleus above

PAGE 52

52 CHAPTER 5 CONCLUSION Summary of the Overall Findings The overall purpose of this dissertation r esearch was to investigate the expression profile of IL 2 in the brain and relate those findings to our understanding of how loss of IL 2 impacts the septohippocampal system. In Chapter 2, we aimed to expand on our previous research and challenge the orig inal postulation by our lab that the observed loss of cholinergic somata in the medial septum of IL 2KO mice was due to inflammatory processes. In these experiments, we tested the hypothesis that loss of cholinergic staining in the medial septum was due t o loss of brain derived IL 2. To accomplish this, we used congenic IL 2 KO /RAG 2KO mice bred in our lab that l ack the T cell dependent autoimmune phenotype present in IL 2KO mice. We compared the relative loss of ChAT positive cells in IL 2KO, IL 2 KO /RAG 2KO, and IL 2WT animals and found that both KO strains had a similar loss of cholinergic staining in the medial septum compared to WT animals. We also evaluated the relative expression of c ytokines and chemokines in the medial septum of IL 2KO and IL 2WT mice. We found no differences between groups. These data support the hypothesis that loss of ChAT staining in the medial septum of IL 2 KO mice is due to loss of brain derived IL 2 rather than changes in cytokines associated with autoimmunity. To gain f urther insight into the effect IL 2 deficiency has on septohippocampal cholinergic neurons, we compared numbers of beta III tubulin positive cells in medial septum of IL 2KO and IL 2WT mice. There was no significant difference in the number of total neuro ns in the medial septum of either group. This suggests that the loss of ChAT staining in the medial septum of IL 2KO mice is due to a down regulation of ChAT and thus, a change in cholinergic

PAGE 53

53 phenotype unrelated to cell death. This observation is in agre e ment with our previous inability to detect any glial activation, indicative of cellular clearance of dead neurons in these mice. Nerve growth factor (NGF) is well characterized as the trophic factor responsible for maintaining cholinergic phenotype in a n umber of pathways. Here we measured the relative expression of the neurotrophic factors NGF and BDNF in the medial septum to compare to our previous data in the hippocampus. We found there to be, similar to the hip pocampus, a substantial dysregulation of NGF in the medial septum. Further studies are necessary to determine how brain derived IL 2 influences the expression of neurotrophic factors in the septohippocampal system and how that can affect the cholinergic phenotype of cells in the septal nucle i. In Chapter 3, we described the expression of GFP in brains of IL 2p8 GFP transgenic mice that express GFP in cells that normally express IL 2. This model offers a clear interpretation of the cellular source of IL 2, more so than any method that was pr eviously available. Using fluorescent co labeling techniques, we determined that IL 2 is selectively expressed by neurons in discrete nuclei throughout the brain and brainstem. The expression profile of IL 2 in the mouse brain syncs well with the existin g literature and provides us the impetus and direction to investigate whether similar pathologies exist in the multiple brain regions that express IL 2, similar to those we have characterized in the septohippocampal system. Understanding how loss of IL 2 can impact multiple systems can provide greater insight into the functional nature of IL 2 as an apparent neuromodulator. Finally, in Chapter 4 we investigated whether IL 2p8 GFP microglia activated in vivo expressed GFP. Several studies in rats have conc luded that microglia can be

PAGE 54

54 activated to express IL 2 upon immune challenge both in vivo and in vitro (Kowalski et al., 2004; Girard et al., 2008) We found, however, using two different methods of microglia activation, that microglia d id not express IL 2 at any of the time points evaluated. These findings are at odds with the current literature and may be due to differences in rat versus mouse physiology or differences between experimental conditions. In addition to activation and proliferation of micro glia, in the facial nerve axotomy injury model, there is an infiltration of T cells to the injured facial motor nucleus (FMN) Not only did we fail to observe IL 2 expression in activated microglia in this paradigm, most of the T cells present in the FMN did not appear to express IL 2 although we observed a strong baseli ne expression of IL 2 (GFP) in the spleens of these mice. Although outside the scope of this study, it is interesting to entertain the possibility of a mechanism that would restrict the ex pression of IL 2 in immune cells to the peripheral compartment, considering the cross talk possible between infiltrating immune cells and brain circuits that rely on IL 2 signaling in normal brain physiology. Implications This series of studies is the fir st to demonstrate that endogenous levels of brain derived IL 2 may be an important factor in maintaining the cholinergic projections between the septal nuclei and hippocampus. The impact on this pathway involves the expression of neurotrophic factors prov en necessary for the normal functionality of the septohippocampal system. We postulate that this change in trophic factors contributes to the observed alteration in cholinergic phenotype and that IL 2 exerts its modulatory actions on converging pathways d ownstream of IL 2 and neurotrophin signaling. Clinically, exogenously administered IL 2 is used to treat a number of disorders, including cancer (Atkins et al., 1999; Davi s and Gillies, 2003; Fyfe et al., 1995; Guirguis

PAGE 55

55 et al., 2002; Parkinson et al., 1990; Rosenberg et al., 1985; Rosenberg et al., 1994) and HIV infection (Armstrong and Kazanjian, 2001; Mitsuyasu, 2001; Smith, 2001) IL 2 treatments are not, however, without side effects. As noted earlier, a number of studies have investigated the diverse neuropsyc hiatric and cognitive changes in patients receiving IL 2 therapy (Denicoff et al., 1987 ; Capuron et al., 2000; Capuron et al., 2001; Walker et al., 1997). While these clinical investigations identified cognitive dysfunction associated with IL 2 therapy, they d id not offer any insight to the physiological mechanism underlying th em. One hypothesis that fits well with our data is that chronic IL 2 tre atment may alter the function of brain pathways that use IL 2 in normal signaling IL 2 readily crosses the BBB and gross alterations in the level of circulating IL 2, especially w he n w ell above that occurring naturally, can be expected to alter brain systems that express the IL 2 receptor. In addition to those receiving IL 2 therapy, alterations in IL 2 levels and polymorphi s ms in the IL 2 gene have been reported in a number of patien ts with neuropsychiatric and neurodegenerative diseases. The majority of studies interpret these alterations as indicative of inflammatory processes related to the disease. As we have shown here, in our work with IL 2KO mice and the IL 2p8 GFP reporter m odel, altered levels of IL 2 detected in the cerebrospinal fluid and in post mortem brain may have a neuronal basis. The expression profile of IL 2 we reported in Chapter 3 strongly suggests that alterations in IL 2 could have a number of multifaceted del eterious effects on multiple pathways in the CNS. Future studies aimed at evaluating IL 2 as a brain derived cytokine integral to neuronal signaling, may find IL 2 to be an important player in the pathogen e sis and in the treatment of disease s involving th ese pathways

PAGE 56

56 Caveats and Future Directions In Chapter 2, we examined the effects of IL 2 deficiency on the cholinergic phenotype of septohippocampal neurons. We briefly described the alterations of neurotrophic factors in the medial septum and hippocamp us that may be associated with the changes in cholinergic phenotype we observed. Further studies are needed to determine how the alterations we measured are interrelated. Our new working hypothesis is that IL 2 exerts it s neurotrophic effects, and influe nce on acetylcholine release, through indirect manipulation of classic neurotrophin signaling the in the CNS. A quantitative comparison of RNA or proteins expressed in these two pathways in vivo accompanied by in vitro assays that would allow for the man ipulation of these pathways directly, would be useful in investigating this potential mechanism of action. Though the majority of cholinergic neurons in the medial septum project to the hippocampus (Schwegler et al., 1996) a small percentage also project to other areas, including the mediodorsal nucleus of the thalamus (Gritti et al., 1998) parietal cingulate (Gritti et al., 1997) and entorhinal cortices (Alonso and Kohler, 1984) Thus, to acc urately claim that the change in cholinergic phenotype in the medial septum of the IL 2KO mouse corresponds to changes in neurotrophin expression, we would need to expand our study to include other areas in evaluating changes in the molecular milieu of pro jection fields in addition to the hippocampus. Likewise, in Chapter 3, we identified a number of IL 2 positive neuronal populations that most likely are not involved in septohippocampal signaling. Parallel studies should be conducted in these areas, espe cially those that project to cholinergic regions, to test the generalization of future claims.

PAGE 57

57 Concluding Remarks The complex array of various cytokines in the peripheral immune system and CNS appear to play a major role in the intercommunication of th ese two systems. The daunting nature of the questi ons unanswered in the field of neuroimmunology necessitates the small strides made in studies such as those described in this dissertation. As previously discussed, IL 2 has pleiotropic roles in the perip heral immune system and in the CNS. Here w e have identified the cellular source of IL 2 in the brain. The systems that we found to express IL 2 and the modalities they serve fit well with what we already know about the disruption s that alter ation of IL 2 can have on experimental measures in the lab and the neurobiological deficits exhibited by humans receiving IL 2 in the clinic. Examination of the exact mechanisms underlying the functional role of IL 2 in specific neuronal circuitry could prove to be a fruitful approach in future research and may have important clinical utility. By understanding the role IL 2 play s in multiple systems, we can begin to explain how inflammation and /or alteration s of the cytokine environment can a ffect multiple pathways and contribute to the symptomology and deleterious effects associated with the progression of disease

PAGE 58

58 REFERENCES Ader, R., Felten, D., & Cohen, N. (Eds.). (2001). Psychoneuroimmunology third edition San Diego, CA: Academic Press. Alonso, A., & Kohler C. (1984). A study of the reciprocal connections between the septum and the entorhinal area using anterograde and retrograde axonal transport methods in the rat brain. [Research Support, Non U.S. Gov't]. The Journal of comparative neurology, 225 (3), 327 343. doi: 10.1002/cne.902250303 Alonso, R., Chaudieu, I., Diorio, J., Krishnamurthy, A., Quirion, R., & Boksa, P. (1993). Interleukin 2 modulates evoked release of [3h]dopamine in rat cultured mesencephalic cells. [Research Support, Non U.S. Gov't]. Journ al of neurochemistry, 61 (4), 1284 1290. Araujo, D. M., Lapchak, P. A., Collier, B., & Quirion, R. (1989). Localization of interleukin 2 immunoreactivity and interleukin 2 receptors in the rat brain: Interaction with the cholinergic system. [Research Supp ort, Non U.S. Gov't]. Brain research, 498 (2), 257 266. Armstrong, W. S., & Kazanjian, P. (2001). Use of cytokines in human immunodeficiency virus infected patients: Colony stimulating factors, erythropoietin, and interleukin 2. [Review]. Clinical infecti ous diseases : an official publication of the Infectious Diseases Society of America, 32 (5), 766 773. doi: 10.1086/319227 Atkins, M. B., Lotze, M. T., Dutcher, J. P., Fisher, R. I., Weiss, G., Margolin, K., Rosenberg, S. A. (1999). High dose recombi nant interleukin 2 therapy for patients with metastatic melanoma: Analysis of 270 patients treated between 1985 and 1993. [Research Support, Non U.S. Gov't Research Support, U.S. Gov't, P.H.S. Review]. Journal of clinical oncology : official journal of the American Society of Clinical Oncology, 17 (7), 2105 2116. Banks, W. A., Farr, S. A., & Morley, J. E. (2002). Entry of blood borne cytokines into the central nervous system: Effects on cognitive processes. [Research Support, U.S. Gov't, Non P.H.S. Researc h Support, U.S. Gov't, P.H.S. Review]. Neuroimmunomodulation, 10 (6), 319 327. doi: 71472 Beck, R. D., Jr., King, M. A., Huang, Z., & Petitto, J. M. (2002). Alterations in septohippocampal cholinergic neurons resulting from interleukin 2 gene knockout. [Co mparative Study Research Support, U.S. Gov't, P.H.S.]. Brain research, 955 (1 2), 16 23. Beck R D ., Jr King M A Ha G K Cushman J D Huang Z Petitto J M. (2005) IL 2 deficiency results in altered septal and hippocampal cytoarchitecture: rela tion to development and neurotrophins. J Neuroimmunol 160 (1 2) 146 53.

PAGE 59

59 Beck R D ., Jr Wasserfall C Ha G K Cushman J D Huang Z Atkinson M A Petitto J M. (2005) Changes in hippocampal IL 15, related cytokines, and neurogenesis in IL 2 de ficient mice. Brain Res 1041 (2) 223 30. Beloosesky, Y., Salman, H., Bergman, M., Bessler, H., Djaldetti, M. (2002) Cytokine levels and phagocytic activity in patients with Alzheimer's disease. Gerontology 48 (3), 128 32. Capuron, L., Ravaud, A., & Dant zer, R. (2000). Early depressive symptoms in cancer patients receiving interleukin 2 and/or interferon alfa 2b therapy. [Research Support, Non U.S. Gov't]. Journal of clinical oncology : official journal of the American Society of Clinical Oncology, 18 (10) 2143 2151. Capuron, L., Ravaud, A., & Dantzer, R. (2001a). Timing and specificity of the cognitive changes induced by interleukin 2 and interferon alpha treatments in cancer patients. [Research Support, Non U.S. Gov't]. Psychosomatic medicine, 63 (3), 3 76 386. Capuron, L., Ravaud, A., Gualde, N., Bosmans, E., Dantzer, R., Maes, M., & Neveu, P. J. (2001b). Association between immune activation and early depressive symptoms in cancer patients treated with interleukin 2 based therapy. [Clinical Trial Rand omized Controlled Trial Research Support, Non U.S. Gov't]. Psychoneuroendocrinology, 26 (8), 797 808. Cavanillas M L Alcina A Nez C ., de las Heras, V Fernndez Arquero M Bartolom M de la Concha E G Fernndez O Arroyo R Matesanz F Urcelay E. (2010) Polymorphisms in the IL2, IL2RA and IL2RB genes in multiple sclerosis risk. Eur J Hum Genet. 18 (7) 794 9. Davis, C. B., & Gillies, S. D. (2003). Immunocytokines: Amplification of anti cancer immunity. [Review]. Cancer immunology, i mmunotherapy : CII, 52 (5), 297 308. doi: 10.1007/s00262 002 0349 4 Denicoff, K. D., Rubinow, D. R., Papa, M. Z., Simpson, C., Seipp, C. A., Lotze, M. T., Rosenberg, S. A. (1987). The neuropsychiatric effects of treatment with interleukin 2 and lymph okine activated killer cells. Annals of internal medicine, 107 (3), 293 300. Du Z Y Li X Y. (1998) Cytokine and nitric oxide production by rat microglia stimulated with lipopolysaccharides in vitro. Zhongguo Yao Li Xue Bao. 19 (3) 257 60. Dunn, A. J. (2002). Mechanisms by which cytokines signal the brain. [Review]. International review of neurobiology, 52 43 65.

PAGE 60

60 Eizenberg, O., Faber Elman, A., Lotan, M., & Schwartz, M. (1995). Interleukin 2 transcripts in human and rodent brains: Possible expressio n by astrocytes. J Neurochem, 64 (5), 1928 1936. Forster, E., Otten, U., Frotscher, M. (1993). Developmental neurotrophin expression in slice cultures of rat hippocampus. Neurosci Lett 155 216 219. Fyfe, G., Fisher, R. I., Rosenberg, S. A., Sznol, M., Parkinson, D. R., & Louie, A. C. (1995). Results of treatment of 255 patients with metastatic renal cell carcinoma who received high dose recombinant interleukin 2 therapy. [Clinical Trial Clinical Trial, Phase II Multicenter Study Research Support, Non U .S. Gov't Research Support, U.S. Gov't, P.H.S.]. Journal of clinical oncology : official journal of the American Society of Clinical Oncology, 13 (3), 688 696. Girard S Larouche A Kadhim H Rola Pleszczynski M Gobeil F Sbire G. (2008) Lipo polysaccharide and hypoxia/ischemia induced IL 2 expression by microglia in neonatal brain. Neuroreport 19 (10) 997 1002. Giri, J. G., Anderson, D. M., Kumaki, S., Park, L. S., Grabstein, K. H., & Cosman, D. (1995). Il 15, a novel t cell growth factor th at shares activities and receptor components with il 2. [Review]. Journal of leukocyte biology, 57 (5), 763 766. Gritti, I., Mainville, L., Mancia, M., & Jones, B. E. (1997). Gabaergic and other noncholinergic basal forebrain neurons, together with cholin ergic neurons, project to the mesocortex and isocortex in the rat. [Research Support, Non U.S. Gov't]. The Journal of comparative neurology, 383 (2), 163 177. Gritti, I., Mariotti, M., & Mancia, M. (1998). Gabaergic and cholinergic basal forebrain and pre optic anterior hypothalamic projections to the mediodorsal nucleus of the thalamus in the cat. Neuroscience, 85 (1), 149 178. Guirguis, L. M., Yang, J. C., White, D. E., Steinberg, S. M., Liewehr, D. J., Rosenberg, S. A., & Schwartzentruber, D. J. (2002). Safety and efficacy of high dose interleukin 2 therapy in patients with brain metastases. Journal of immunotherapy, 25 (1), 82 87. Hagg, T., Vahlsing, H. L., Manthorpe, M., & Varon, S. (1990). Nerve growth factor infusion into the denervated adult rat hi ppocampal formation promotes its cholinergic reinnervation. [Research Support, U.S. Gov't, Non P.H.S. Research Support, U.S. Gov't, P.H.S.]. The Journal of neuroscience : the official journal of the Society for Neuroscience, 10 (9), 3087 3092. Hanisch, U. K., & Quirion, R. (1995). Interleukin 2 as a neuroregulatory cytokine. [Research Support, Non U.S. Gov't Review]. Brain research. Brain research reviews, 21 (3), 246 284.

PAGE 61

61 Hanisch, U. K., Rowe, W., Sharma, S., Meaney, M. J., & Quirion, R. (1994). Hypothal amic pituitary adrenal activity during chronic central administration of interleukin 2. [Research Support, Non U.S. Gov't]. Endocrinology, 135 (6), 2465 2472. Hanisch, U. K., Seto, D., & Quirion, R. (1993). Modulation of hippocampal acetylcholine release: A potent central action of interleukin 2. [Research Support, Non U.S. Gov't]. The Journal of neuroscience : the official journal of the Society for Neuroscience, 13 (8), 3368 3374. Hickey, W. F., Hsu, B. L., & Kimura, H. (1991). T lymphocyte entry into t he central nervous system. [Research Support, Non U.S. Gov't Research Support, U.S. Gov't, P.H.S.]. Journal of neuroscience research, 28 (2), 254 260. doi: 10.1002/jnr.490280213 Horak, I. (1995). Immunodeficiency in il 2 knockout mice. [Research Support, N on U.S. Gov't Review]. Clinical immunology and immunopathology, 76 (3 Pt 2), S172 173. Horak, I. (1996). Interleukin 2 knockout mice: A new model to study autoimmunity and self tolerance. [Research Support, Non U.S. Gov't]. Sbornik lekarsky, 97 (1), 25 28. Huang Z Meola D Petitto J M. (2012). Dissecting the effects of endogenous brain IL 2 and normal versus autoreactive T lymphocytes on microglial responsiveness and T cell trafficking in response to axonal injury. Neurosci Lett 526 (2) 138 43. Hu ang Z Meola D Petitto J M. (2011). Loss of CNS IL 2 gene expression modifies brain T lymphocyte trafficking: response of normal versus autoreactive Treg deficient T cells. Neurosci Lett 499 (3), 213 8. Huang Z Dauer D J Ha G K Lewis M H Petitto J M. (2009) Interleukin 2 deficiency induced T cell autoimmunity in the mouse brain. Neurosci Lett 463 (1) 44 8. Jeong H K Jou I Joe E H. (2010) Systemic LPS administration induces brain inflammation but not dopaminergic neuronal death i n the substantia nigra. Exp Mol Med 42 (12) 823 32. Karanth, S., Lyson, K., & McCann, S. M. (1993). Role of nitric oxide in interleukin 2 induced corticotropin releasing factor release from incubated hypothalami. [In Vitro Research Support, U.S. Gov't, P .H.S.]. Proceedings of the National Academy of Sciences of the United States of America, 90 (8), 3383 3387. Kowalski J Labuzek K., Herman Z S. (2004) Flupentixol and trifluperidol reduce interleukin 1 beta and interleukin 2 release by rat mixed glial and microglial cell cultures. Pol J Pharmacol. 56 (5) 563 70.

PAGE 62

62 Lapchak, P. A., & Araujo, D. M. (1993). Interleukin 2 regulates monoamine and opioid peptide release from the hypothalamus. [In Vitro Research Support, Non U.S. Gov't]. Neuroreport, 4 (3), 303 306. Lapchak, P. A., Araujo, D. M., Quirion, R., & Beaudet, A. (1991). Immunoautoradiographic localization of interleukin 2 like immunoreactivity and interleukin 2 receptors (tac antigen like immunoreactivity) in the rat brain. [Comparative Study Research Support, Non U.S. Gov't]. Neuroscience, 44 (1), 173 184. Lazo, O. M., Mauna, J. C., Pissani, C. A., Inestrosa, N. C., & Bronfman, F. C. (2010) Axotomy induced neurotrophic withdrawal causes the loss of phenotypic differentiation and downregulation of NGF signaling but not death of septal cholinergic neurons. Mol Neurodegener, 5 5. Lee, H.J., Hammond, D.N., Large, T.H., Roback, J.D., Sim, J.A., Brown, D.A., Otten, U.H., Wainer, B.H. (1990). Neuronal properties and trophic activities of immortalized hip pocampal cells from embryonic and young adult mice. J Neurosci. 10 (6),1779 87. Leonard, W. J., Depper, J. M., Crabtree, G. R., Rudikoff, S., Pumphrey, J., Robb, R. J., et al. (1984). Molecular cloning and expression of cdnas for the human interleu kin 2 receptor. Nature, 311 (5987), 626 631. Lopez Coviella, I., Mellott, T.J., Schnitzler A C Blusztajn, J.K.(2011). BMP9 protects septal neurons from axotomy evoked loss of cholinergic phenotype PloS One 6 (6), e21166 Ma, A., Datta, M., Margosian, E., Chen, J., & Horak, I. (1995). T cells, but not b cells, are required for bowel inflammation in interleukin 2 deficient mice. [Comparative Study Research Support, Non U.S. Gov't Research Support, U.S. Gov't, P.H.S.]. The Journal of experimental medicine 182 (5), 1567 1572. Mahendran R Mahendran R Chan Y H. (2004) Interleukin 2 levels in chronic schizophrenia patients. Ann Acad Med Singapore 33 (3) 320 3. Mitsuyasu, R. T. (2001). The potential role of interleukin 2 in hiv. [Research Support, No n U.S. Gov't Research Support, U.S. Gov't, P.H.S. Review]. AIDS, 15 Suppl 2 S22 27. Nelson, B. H. (2004). Il 2, regulatory t cells, and tolerance. [Review]. Journal of immunology, 172 (7), 3983 3988.

PAGE 63

63 Pardy, K., Murphy, D., Carter, D., & Hui, K. M. (1 993). The influence of interleukin 2 on vasopressin and oxytocin gene expression in the rodent hypothalamus. [Research Support, Non U.S. Gov't]. Journal of neuroimmunology, 42 (2), 131 138. Parkinson, D. R., Abrams, J. S., Wiernik, P. H., Rayner, A. A., M argolin, K. A., Van Echo, D. A., et al. (1990). Interleukin 2 therapy in patients with metastatic malignant melanoma: A phase ii study. [Clinical Trial Multicenter Study Research Support, U.S. Gov't, P.H.S.]. Journal of clinical oncology : official j ournal of the American Society of Clinical Oncology, 8 (10), 1650 1656. Petitto, J. M., & Huang, Z. (2001a). Cloning the full length il 2/15 receptor beta cdna sequence from mouse brain: Evidence of enrichment in hippocampal formation neurons. [Research S upport, U.S. Gov't, P.H.S.]. Regulatory peptides, 98 (1 2), 77 87. Petitto, J. M., McCarthy, D. B., Rinker, C. M., Huang, Z., & Getty, T. (1997). Modulation of behavioral and neurochemical measures of forebrain dopamine function in mice by species specifi c interleukin 2. [Research Support, Non U.S. Gov't Research Support, U.S. Gov't, P.H.S.]. Journal of neuroimmunology, 73 (1 2), 183 190. Petitto, J. M., McNamara, R. K., Gendreau, P. L., Huang, Z., & Jackson, A. J. (1999). Impaired learning and memory and altered hippocampal neurodevelopment resulting from interleukin 2 gene deletion. [Research Support, U.S. Gov't, P.H.S.]. Journal of neuroscience research, 56 (4), 441 446. Rosenberg, S. A., Mule, J. J., Spiess, P. J., Reichert, C. M., & Schwarz, S. L. (1 985). Regression of established pulmonary metastases and subcutaneous tumor mediated by the systemic administration of high dose recombinant interleukin 2. The Journal of experimental medicine, 161 (5), 1169 1188. Rosenberg, S. A., Yang, J. C., Topalian, S. L., Schwartzentruber, D. J., Weber, J. S., Parkinson, D. R., White, D. E. (1994). Treatment of 283 consecutive patients with metastatic melanoma or renal cell cancer using high dose bolus interleukin 2. JAMA : the journal of the American Medical A ssociation, 271 (12), 907 913. Sarder, M., Abe, K., Saito, H., & Nishiyama, N. (1996). Comparative effect of il 2 and il 6 on morphology of cultured hippocampal neurons from fetal rat brain. [Comparative Study]. Brain research, 715 (1 2), 9 16. doi: 10.101 6/0006 8993(95)01291 5 Sarder, M., Saito, H., & Abe, K. (1993). Interleukin 2 promotes survival and neurite extension of cultured neurons from fetal rat brain. Brain research, 625 (2), 347 350.

PAGE 64

64 Schmitt, E., Germann, T., Goedert, S., Hoehn, P., Huels, C., Koelsch, S., Rude, E. (1994). Il 9 production of naive cd4+ t cells depends on il 2, is synergistically enhanced by a combination of tgf beta and il 4, and is inhibited by ifn gamma. [Research Support, Non U.S. Gov't]. Journal of immunology, 153 (9), 3989 3996. Schopke, R., Wolfer, D. P., Lipp, H. P., & Leisinger Trigona, M. C. (1991). Swimming navigation and structural variations of the infrapyramidal mossy fibers in the hippocampus of the mouse. [Research Support, Non U.S. Gov't]. Hippocampus, 1 (3), 315 328. Schwegler, H., Boldyreva, M., Pyrlik Gohlmann, M., Linke, R., Wu, J., & Zilles, K. (1996b). Genetic variation in the morphology of the septo hippocampal cholinergic and gabaergic system in mice. I. Cholinergic and gabaergic markers. [Compar ative Study Research Support, Non U.S. Gov't]. Hippocampus, 6 (2), 136 148. Schwegler, H., & Crusio, W. E. (1995). Correlations between radial maze learning and structural variations of septum and hippocampus in rodents. [Research Support, Non U.S. Gov't Review]. Behavioural brain research, 67 (1), 29 41. Schwegler, H., Crusio, W. E., Lipp, H. P., & Heimrich, B. (1988). Water maze learning in the mouse correlates with variation in hippocampal morphology. [Research Support, Non U.S. Gov't]. Behavior geneti cs, 18 (2), 153 165. Seto, D., Kar, S., & Quirion, R. (1997). Evidence for direct and indirect mechanisms in the potent modulatory action of interleukin 2 on the release of acetylcholine in rat hippocampal slices. [Comparative Study In Vitro Research Suppo rt, Non U.S. Gov't]. British journal of pharmacology, 120 (6), 1151 1157. Smith, K. A. (2001). Low dose daily interleukin 2 immunotherapy: Accelerating immune restoration and expanding hiv specific t cell immunity without toxicity. [Review]. AIDS, 15 Supp l 2 S28 35. Sorkin, L. S., Xiao, W. H., Wagner, R., & Myers, R. R. (1997). Tumour necrosis factor alpha induces ectopic activity in nociceptive primary afferent fibres. [Research Support, U.S. Gov't, Non P.H.S. Research Support, U.S. Gov't, P.H.S.]. Neu roscience, 81 (1), 255 262. Sugamura, K., Asao, H., Kondo, M., Tanaka, N., Ishii, N., Ohbo, K., Takeshita, T. (1996). The interleukin 2 receptor gamma chain: Its role in the multiple cytokine receptor complexes and t cell development in xscid. [Revi ew]. Annual review of immunology, 14 179 205. doi: 10.1146/annurev.immunol.14.1.179

PAGE 65

65 Tancredi, V., Zona, C., Velotti, F., Eusebi, F., & Santoni, A. (1990). Interleukin 2 suppresses established long term potentiation and inhibits its induction in the rat hippocampus. [In Vitro Research Support, Non U.S. Gov't]. Brain research, 525 (1), 149 151. Terrando N Rei Fidalgo A Vizcaychipi M Cibelli M Ma D Monaco C Feldmann M Maze M. (2010) The impact of IL 1 modulation on the development of lipopolysaccharide induced cognitive dysfunction. Crit Care 14 (3) R88. Thune, J. J., & Pakkenberg, B. (2000). Stereological studies of the schizophrenic brain. [Research Support, Non U.S. Gov't Review]. Brain research. Brain research reviews, 31 (2 3), 200 204. Turka, L.A., Walsh, P.T. (2008) IL 2 signaling and CD4+ CD25+ Foxp3+ regulatory T cells. Front Biosci 1 (13), 1440 6. v an der Zee, C. E., & Hagg, T. (2002). Delayed NGF infusion fails to reverse axotomy induced degeneration of basal forebrain c holinergic neurons in adult p75(LNTR) deficient mice. Neuroscience, 110 (4), 641 651. Villemain, F., Owens, T., Renno, T., & Beaudet, A. (1991). Localization of mrna for interleukin 2 (il 2) in mouse brain by in situ hybridization. Society of Neuroscience Abstracts, 17 1199. Waguespack, P. J., Banks, W. A., & Kastin, A. J. (1994). Interleukin 2 does not cross the blood brain barrier by a saturable transport system. [Research Support, U.S. Gov't, Non P.H.S.]. Brain research bulletin, 34 (2), 103 109. Wal ker, L. G., Walker, M. B., Heys, S. D., Lolley, J., Wesnes, K., & Eremin, O. (1997). The psychological and psychiatric effects of ril 2 therapy: A controlled clinical trial. [Clinical Trial Randomized Controlled Trial Research Support, Non U.S. Gov't]. Psy cho oncology, 6 (4), 290 301. doi: 10.1002/(SICI)1099 1611(199712)6:4<290::AID PON283>3.0.CO;2 G Williams, R. W., & Rakic, P. (1988). Three dimensional counting: An accurate and direct method to estimate numbers of cells in sectioned material. J Comp Neuro l, 278 (3), 344 352. Wilson, C. J., Finch, C. E., & Cohen, H. J. (2002). Cytokines and cognition -the case for a head to toe inflammatory paradigm. [Review]. Journal of the American Geriatrics Society, 50 (12), 2041 2056.

PAGE 66

66 Witzke, O., Winterhagen, T., K ribben, A., Philipp, T., Mann, K., & Reinhardt, W. (2003). Interleukin 2 given to asymptomatic hiv infected individuals leads to an exaggerated response of the pituitary gland to the action of crh. Clinical endocrinology, 59 (1), 104 109. Yu J Pizzo D P Hutton L A Perez Polo J R. (1995) Role of the cholinergic system in the regulation of neurotrophin synthesis. Brain Res. 24 ( 705 ), 247 52.

PAGE 67

67 BIOGRAPHICAL SKETCH Danielle Marie Meola was born in Langhorne PA, to Judith and Michael Meola She lived in cahoots with her older sister and younger brother in Atco, NJ until the perfect blend of divorce led to escape from a life time of tacky Italian American customs to life on the road in a Type C Thomas Built school bus they called home. The seemingly endless summer of traveling, camping, and bathing in public park sprinklers came to an end in the Old P ueblo, Tucson, AZ. spotty grasp of the S panish language and tolerance of spicy food s that may border on talent. Danielle was always an enthusiastic student and although adventurous and willing, a mediocre athlete. A creative bookworm by nature, she began writing stories and poetry at a young age and was once awarded first place in a school district poetry contest. The theme of her award winning masterpiece was nature and the change of seasons, a source of beauty that continues to inspire nature enthusiasts, and lov in the great outdoors and participated in paintball wars, motor sports, hiking, and snow skiing. brief confronta tion with a particularly stubborn Aspen and resulted in the paralysis of and a decade later she began her s tudy of Neuroscience at the University of Florida. Today, Danielle lives in McIntosh, FL with her beloved dog Prime and fianc Gustave Alan Kloes. They enjoy hiking, biking, and kayaking the many waterways