<%BANNER%>

Characterization of Insect Acetylcholinesterase Enzyme

PRIVATE ITEM Digitization of this item is currently in progress.
MISSING IMAGE

Material Information

Title:
Characterization of Insect Acetylcholinesterase Enzyme DMSO-Mediated Allosteric Effects, Inhibitor Pharmacological Profile, and Role in the Neurotoxicity of Insect Repellents
Physical Description:
1 online resource (171 p.)
Language:
english
Creator:
Swale, Daniel R
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Entomology and Nematology
Committee Chair:
Bloomquist, Jeffrey R
Committee Members:
Linser, Paul J
Bernier, Ulrich R
Smartt, Chelsea T
Long, Maureen T

Subjects

Subjects / Keywords:
acetylcholinesterase -- anopheles-gambiae -- boophilus-microplus -- carbamates -- deet -- phlebotomus-papatasi -- vector-control
Entomology and Nematology -- Dissertations, Academic -- UF
Genre:
Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Vector borne diseases are of great importance, and there hasbeen significant interest in the design of novel mechanisms for the control of insectvectored diseases.  Utilization ofprimarily one chemical class of insecticides for disease vector control hasincreased insecticide resistance, limiting the effectiveness of currentlyutilized control methods within malaria endemic regions.  I first report on the enzyme kinetic effectsof a unique allosteric solvent interaction that occurs betweenmosquito-selective carbamates, dimethyl sulfoxide, and Anopheles gambiae acetylcholinesterase.  These results have implications for the highthroughput screening of insecticides, as continued use of current methods usingDMSO likely facilitates the overlooking of lead compounds.  Secondly, I present a characterization of theinhibitor profile of acetylcholinesterase from Boophilus microplus (Bm) and Plebotomuspapatasi (Pp) compared to human and bovine acetylcholinesterase, in order toidentify divergent pharmacology that could lead to selective inhibitors.  Results indicate a unique structure of Bm acetylcholinesterase that could leadto the design of novel inhibitors to replace the currently utilized class ofinsecticides.  Additionally, Bm and Pp display low nanomolar sensitivity to a variety of newly designedcarbamate insecticides that could provide an excellent lead compound for vectorcontrol.  Thirdly, I report an analysisof the mode of action of the toxicity to the insect repellent N,N-Diethyl-meta-toluamide (DEET).  Recent reports suggest DEET is anacetylcholinesterase inhibitor, potentially causing a toxicity risk in exposedhuman individuals.  Results indicate thatDEET is a poor acetylcholinesterase inhibitor, but instead mimicks the action ofoctopamine on the insect central nervous system.  Futher analysis found a blocking action onmammalian neuronal sodium and potassium channels similar to local anesthetics,such as lidocaine.  Such an action wouldexplain the numbness caused by DEET when applied to human skin.  Overall, I conclude that toxicity of DEET throughanticholinesterase properties is unlikely and would be of little relevance tohuman safety.  Lastly, the evaluation ofmosquito-selective carbamates to mosquito vectors and agricultural pests werereported.  Results indicate that ournovel carbamates possess unusual insect selectivity that has implications formitigation of mosquito insecticide resistance due to agricultural uses,particularly in malaria endemic regions.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Daniel R Swale.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Bloomquist, Jeffrey R.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044993:00001

MISSING IMAGE

Material Information

Title:
Characterization of Insect Acetylcholinesterase Enzyme DMSO-Mediated Allosteric Effects, Inhibitor Pharmacological Profile, and Role in the Neurotoxicity of Insect Repellents
Physical Description:
1 online resource (171 p.)
Language:
english
Creator:
Swale, Daniel R
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Entomology and Nematology
Committee Chair:
Bloomquist, Jeffrey R
Committee Members:
Linser, Paul J
Bernier, Ulrich R
Smartt, Chelsea T
Long, Maureen T

Subjects

Subjects / Keywords:
acetylcholinesterase -- anopheles-gambiae -- boophilus-microplus -- carbamates -- deet -- phlebotomus-papatasi -- vector-control
Entomology and Nematology -- Dissertations, Academic -- UF
Genre:
Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Vector borne diseases are of great importance, and there hasbeen significant interest in the design of novel mechanisms for the control of insectvectored diseases.  Utilization ofprimarily one chemical class of insecticides for disease vector control hasincreased insecticide resistance, limiting the effectiveness of currentlyutilized control methods within malaria endemic regions.  I first report on the enzyme kinetic effectsof a unique allosteric solvent interaction that occurs betweenmosquito-selective carbamates, dimethyl sulfoxide, and Anopheles gambiae acetylcholinesterase.  These results have implications for the highthroughput screening of insecticides, as continued use of current methods usingDMSO likely facilitates the overlooking of lead compounds.  Secondly, I present a characterization of theinhibitor profile of acetylcholinesterase from Boophilus microplus (Bm) and Plebotomuspapatasi (Pp) compared to human and bovine acetylcholinesterase, in order toidentify divergent pharmacology that could lead to selective inhibitors.  Results indicate a unique structure of Bm acetylcholinesterase that could leadto the design of novel inhibitors to replace the currently utilized class ofinsecticides.  Additionally, Bm and Pp display low nanomolar sensitivity to a variety of newly designedcarbamate insecticides that could provide an excellent lead compound for vectorcontrol.  Thirdly, I report an analysisof the mode of action of the toxicity to the insect repellent N,N-Diethyl-meta-toluamide (DEET).  Recent reports suggest DEET is anacetylcholinesterase inhibitor, potentially causing a toxicity risk in exposedhuman individuals.  Results indicate thatDEET is a poor acetylcholinesterase inhibitor, but instead mimicks the action ofoctopamine on the insect central nervous system.  Futher analysis found a blocking action onmammalian neuronal sodium and potassium channels similar to local anesthetics,such as lidocaine.  Such an action wouldexplain the numbness caused by DEET when applied to human skin.  Overall, I conclude that toxicity of DEET throughanticholinesterase properties is unlikely and would be of little relevance tohuman safety.  Lastly, the evaluation ofmosquito-selective carbamates to mosquito vectors and agricultural pests werereported.  Results indicate that ournovel carbamates possess unusual insect selectivity that has implications formitigation of mosquito insecticide resistance due to agricultural uses,particularly in malaria endemic regions.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Daniel R Swale.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Bloomquist, Jeffrey R.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044993:00001


This item has the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF INSECT ACETYLCHOLINESTERASE ENZYME : DMSO MEDIATED ALLOSTERIC EFFECTS, INHIBITOR PHARMACOLOGICAL PROFILE, AND ROLE IN THE NEUROTOXICITY OF INSECT REPELLENTS By DANIEL ROBERT SWALE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Daniel Robert Swale

PAGE 3

3 To my family (Mom, Dad, Adam, Emily, and Katelyn), for their encouragement and steadfast support throughout my journey at the University of Florida. I would also like to thank my advisor Dr. Jeff Bloomquist for all of his support and friendship he has provided me duri ng my time at UF. To my committee members, Drs. Uli Bernier, Chelsea Smartt, Paul Lindser, and Maureen Long, thank you for your helpful guidance throughout my academic career. To my wonderful and beautiful fianc e thank you for helping me through the man y trials and tribulations throughout my Ph.D. You made this journey fun and kept it exciting. To the AMAZING Bloomquist lab (Lacey Jenson, James Mutunga, Fan Tong, Nick Larson, Boonan Su, Rafique Islam, and honorary member Chris Holderman), thank you for your help within the lab, but more

PAGE 4

4 ACKNOWLEDGMENTS My dissertation project was funded by a grant from th e National Institute of Allergy and Infectious Disease ( R01 AI082581 ). Collaborations have been an extensive part of my project and include the USDA CMAVE (Gainesville, FL), USDA ARS (Kerrville, TX), Molsoft (LaJolla, CA), and Virginia Tech Chemistry Dep artment (Laboratory of Paul Carlier).

PAGE 5

5 TABLE OF CONTENTS Page ACKNOWLEDGMENTS ................................ ................................ ................................ ........... 4 LIST OF TABLES ................................ ................................ ................................ ...................... 8 LIST OF FIGURES ................................ ................................ ................................ .................... 9 ABSTRACT ................................ ................................ ................................ ........................ 11 CHAPTER 1 LITERATURE REVIEW ................................ ................................ ................................ ... 13 1.1 Mosquito Borne Vectors ................................ ................................ ............................ 13 1.2 Mosquito Borne Diseases ................................ ................................ .......................... 15 1.3 Other Invertebrate Disease Vectors and Their Respective Vectored Diseases ............ 19 1.4 Vector Borne Disease Control Methods ................................ ................................ ..... 20 1.5 Mode of Action of Insecticides Used for Vector Control ................................ ........... 24 1.6 Insecticide Target Sites and Str uctural Biology of Acetylcholinesterase .................... 27 1.7 Insecticide Resistance Mechanisms ................................ ................................ ........... 29 1.8 Insecticide Resistance Patterns Observed in Arthropod Disease Vectors .................... 32 1.9 Historical and Current Uses of Repellents for Insect Vector Control .......................... 34 1.10 Development of New Anticholinesterase Inhibitors ................................ ................... 36 1.11 High Throughput Screening of Insecticides ................................ ............................... 37 1.12 Objectives of This Study ................................ ................................ ........................... 38 2 REDUCED POTENCY OF INSECT SELECTIVE CARBAMATES MEDIATED BY ALLOSTERIC DMSO STABILIZATION OF ANOPHELES GAMBIAE ACETYLCHOLINESTERASE: IMPLICATIONS FO R HIGH THROUGHPUT SCREENING OF INSECTICIDES ................................ ................................ .................... 44 2.1 Introduction ................................ ................................ ................................ .................. 45 2.2 Materials an d Methods ................................ ................................ ................................ 47 2.2.1 Inhibitors, Solvents, and Assay Reagents ................................ ......................... 47 2.2.2 Enzymes ................................ ................................ ................................ .......... 48 2.2.3 Inhibitor Preparation Protocols ................................ ................................ ........ 48 2.2.4 Enzyme Inhibition Assays ................................ ................................ ............... 49 2.2.4.1 k i determinations ................................ ................................ ................ 50 2.2.4.2 V max and K m determinations ................................ ............................... 50 2.2.4.3 IC 50 determinations ................................ ................................ ............ 50 2.2.5 Statistical Analyses ................................ ................................ .......................... 52 2.2.6 Molecular Homology Models ................................ ................................ .......... 52 2.3 Results ................................ ................................ ................................ ........................ 53 2.3.1 DMSO Dependent Antagonism of Carbamate Inhibition in AgAChE and hAChE ................................ ................................ ................................ ............. 53

PAGE 6

6 2.3.2 Time Course of Inhibition Comparison ................................ ............................ 55 2.3.3 Concentration Dependence of DMSO effects ................................ ................... 55 2.4 Discussion ................................ ................................ ................................ .................... 56 3 INHIBITOR PROFILE OF RHIPICEPHALUS (BOOPHILUS) MICROPLUS AND PHLEBOTOMUS PAPATASI ACETYLCHOLINESTERASE AND THE IDENTIFICATION OF POTENT N METHYLCARBAMATES FOR THE CONTROL OF THEIR RESPECTIVE VECTORED DISEASES ................................ ......................... 70 3.1 Introduction ................................ ................................ ................................ .................. 70 3.2 Methods ................................ ................................ ................................ ....................... 73 3.2.1 Inhibitors, Solvents, and Assay Reagents ................................ ......................... 73 3.2.2 Molecular Homology Modeling ................................ ................................ ....... 74 3.2.3 Enzyme Preparations ................................ ................................ ....................... 74 3.2.4 Enzyme Inhibition Assays ................................ ................................ ............... 75 3.2.5 Statistical Analyses ................................ ................................ .......................... 76 3.3 Results ................................ ................................ ................................ ........................ 76 3.3.1 Potency of AChE Inhibitors in Arthropods ................................ ....................... 76 3.3.2 Potency of AChE Inhibitors in Mammals ................................ ......................... 78 3.3.3 Inhibitor Selectivity Across Mammals and Arthropods ................................ .... 79 3.3.4 Homology Modeling and Site Directed Mutagenesis (W384F) of rBmAChE1 ................................ ................................ ................................ ...... 80 3.4 Discussion ................................ ................................ ................................ .................... 81 4 THE TOXICITY AND MODE OF ACTION OF N,N DIETHYL META TOLUAMIDE (DEET) ON THE NERVOUS SYSTEM ................................ .................... 92 4.1 Introduction ................................ ................................ ................................ .................. 92 4.2 Materials and Methods ................................ ................................ ................................ 94 4.2.1 Inhibitors, Solvents, and Assay Reagents ................................ ......................... 94 4.2.2 Enzyme Sources, Insects, and Neuronal Cells ................................ .................. 94 4.2.3 Enzyme Inhibition Assays ................................ ................................ ............... 96 4.2.4 Toxicity Assays ................................ ................................ ............................... 96 4.2.5 Electrophysiological Studies ................................ ................................ ............ 98 4.2.5.1 Saline ................................ ................................ ................................ 98 4.2.5.2 Musca CNS recordings ................................ ................................ ...... 98 4.2.5.3 Musca sensory recordings ................................ ................................ 100 4.2.5.4 Neuromuscular junction recordings ................................ .................. 100 4.2.5.5 Patch c lamp recordings ................................ ................................ .... 101 4.3 Results ................................ ................................ ................................ ...................... 102 4.3.1 Lethality of DEET ................................ ................................ ......................... 102 4.3.2 Signs of Intoxication by DEET ................................ ................................ ...... 102 4.3.3 Anticholinesterase Actions of DEET and Local Anesthetics .......................... 103 4.3.4 Whole Brain Recordings from Musca domestica larvae ................................ 104 4.3.5 Sensory Nerve Recordings from Musca domestica ................................ ......... 105 4.3.6 Neuromuscular Junction Recordings from Musca domestica .......................... 106 4.3.7 Patch Clamp Recordings ................................ ................................ ................ 106

PAGE 7

7 4.4 Discussion ................................ ................................ ................................ .................. 107 5 ACTIVITY OF NEWLY DESIGNED ANOPHELES GAMBIAE SELECTIVE CARBAMATES AGAINST MOSQUITO VECTORS, AGRICULTURAL PESTS, AND MODEL ORGANISMS ................................ ................................ .......................... 125 5.1 Introduction ................................ ................................ ................................ ................ 125 5.2 Mate rials and Methods ................................ ................................ ............................... 127 5.2.1 Inhibitors, Solvents, and Assay Reagents ................................ ....................... 127 5.2.2 Insects and Enzyme sources ................................ ................................ ........... 128 5.2.3 Enzyme Inhibition Assays ................................ ................................ ............. 129 5.2.4 Topical Toxicity Assays ................................ ................................ ................ 130 5.2.5 Mouse Oral Toxicity ................................ ................................ ...................... 130 5.2.6 Statistical Analyses ................................ ................................ ........................ 131 5.3 Results ................................ ................................ ................................ ...................... 1 31 5.3.1 Pharmacodynamic Studies ................................ ................................ ............. 131 5.3.1.1 Mosquito v ectors ................................ ................................ ............. 131 5.3.1.2 Agricultural p ests ................................ ................................ ............. 132 5.3.1.3 Model o rganisms ................................ ................................ ............. 133 5.3.2 Hu man Selectivity and Mammalian Toxicity of Experimental Carbamates .... 134 5.3.3 Selectivity of Experimental Carbamates Over Agricultural Insects ................. 134 5.3.4 Toxicity of Methylcarbamates ................................ ................................ ........ 135 5.4 Discussion ................................ ................................ ................................ .................. 136 6 CONCLUSIONS ................................ ................................ ................................ .............. 147 LIST OF REFERENCES ................................ ................................ ................................ ........ 153 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ... 172

PAGE 8

8 LIST OF TABLES Table Page 1 1 Effects of N methylcarbamate insecticides on An. gambiae and human AChE activity (Anderson et al., 2008). ................................ ................................ ................................ 43 2 1 IC 50 values for An. gambiae homogenate, CBL, and human AChE enzymes exposed to DMSO. ................................ ................................ ................................ ...................... 61 2 2 Representation of reduced mosquito selectivity due to increased IC 50 within Ag AChE under the presence of constant 0.1% DMSO ................................ ................................ .. 64 2 3 Average bimolecular rate constant determinations for PRC 331 and bendiocarb on Ag AChE and h AChE. ................................ ................................ ................................ .... 65 2 4 Average IC 50 values of two commercial and two experimental carbamates over a 60 minute incubation time period with Anopheles gambiae homogenate. ............................ 66 3 1 IC 50 values of AChE inhibitors with enzymes utilized in this study. ............................... 88 3 2 Tacrine and tacrine dimer inhibition of tick and sandfly AChE. ................................ ..... 89 3 3 IC 50 values of AChE inhibitors with the mutated r Bm AChE1 (W384F) enzyme compared to r Bm AChE1 wildtype. ................................ ................................ ................. 90 4 1 Toxicity values of DEET to three mosquito strains and the house fly. .......................... 114 4 2 Enzyme inhibition data expressed as mean (n=3) IC 50 values. ................................ ...... 115 5 1 Mean inhibition potencies of c ommercial and experimental methylcarbamates to five mosquito species in the genera Anopheles and Aedes ................................ .................. 142 5 2 Mean inhibition pote ncies of commercial and experimental methylcarbamates to agriculturally relevant insects. ................................ ................................ ..................... 143 5 3 Mean inhibition potencies of commercial and experimental methylcarbamates to AChE of model organisms. ................................ ................................ .......................... 144 5 4 Selectiviy ratios obtained from in vitro inhibit ion potencies. ................................ ...... 145 5 5 Topical toxicity of methylcarbamates to three mosquito species and the European Corn Borer, Ostrinia nubilal is ................................ ................................ ..................... 146

PAGE 9

9 LIST OF FIGURES Figures Page 1 1 Two commonly used carbamates and organophosphates for controlling disease carrying mosquito vectors and other insect pests ................................ ............................ 40 1 2 Displays structures of two synthet ic pyrethroids and the structure of DDT .................... 40 1 3 Diagram of AgAChE gorge showing some of the relevant amino acid residues at the peripheral anionic site and catalytic acyl s ites ................................ ............................. 41 1 4 Highly selective and species sensitive carbamate molecules designed for use on Anopheles gambiae and referred to in this study. ................................ .......................... 42 1 5 Non selective experimental carbamate, PRC 521. ................................ .......................... 43 2 1 Structure name and chemical name of standard and experimental carbamate insecticides utilized in this study. ................................ ................................ ................... 60 2 2 Influence of DMSO on AChE catalytic and inhibitor activity. ................................ ........ 67 2 3 Comparison of dose response curves for protocols A C with PRC 331 and Propoxur with CBL enzy me ................................ ................................ ................................ .......... 68 2 4 Homology models of h AChE and Ag AChE ................................ ................................ ... 69 3 1 Structures of experimental methylcarbamate inhibitors us ed in this study. ..................... 87 3 2 Su perposition views of tacrine and E2020 complexes onto the model of Bm AChE1. F330 is shown to exist in two orientations ................................ ................................ ...... 91 4 1 St ructures of inhibitors used in C hapter 4. ................................ ................................ .... 112 4 2 Diagram of the Musca domestica dissection, recording arrangement, and nerve activity fo r the central nervous system an d the sensory nervous system dissectio ns. ..... 113 4 3 Nerve discharges of the CNS from M. domestica third instar larvae. ............................ 116 4 4 Potency of DEET, toluene, and lidocaine on CNS nerve discharge of the house fly ..... 117 4 5 Effect of phentolamine on the activity of DEET, octopamine, and propoxur to CNS nerve discharge rates of the housefly. ................................ ................................ .......... 118 4 6 Sensory nervous system firing frequency recordings from M. domestica third instar larvae. ................................ ................................ ................................ .......................... 119 4 7 Concentration response relationship for the blocking action of DEET at the neuromuscular junction of Musca domestica ................................ ................................ 120

PAGE 10

10 4 8 Recordings of evoked EPSP of the neuromuscular junction in M. domestica larvae after exposure to DEET, lidocaine, chlordimeform, and octopamine ............................ 121 4 9 Voltage dependent block of rat neuronal sodium channels ................................ ........... 122 4 10 Voltage dependent block of rat neuronal potassium channels.. ................................ ..... 123 4 11 Three dimensional structural overlay of the carbon backbone of DEET and chlordimeform ................................ ................................ ................................ ............ 124 5 1 Chemical structures of methylcarbamates tested for activity to mosquito vectors and agriculturally relevant insects. ................................ ................................ ..................... 141

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF INSECT ACETYLCHOLINESTERASE ENZYME : DMSO MEDIATED ALLOSTERIC EFFECTS, INHIBITOR PHARMACOLOGICAL PROFILE, AND ROLE IN THE NEUROTOXICITY OF INSECT REPELLENTS By Daniel Robert Swale December 2012 Chair: Jeffrey R. Bloomquist Major: Entomology and Nematology Vector borne diseases are of great importance and there has been significant interest in the design of novel mechanisms for the control of insect vectored diseases. Utilization of primarily one chemical class of insecticides for disease vector control has increased insecticide resis tance, limiting the effectiveness of currently utilized control methods within malaria endemic regions I first report on the enzyme kinetic effect s of a unique allosteric solvent interaction that occurs between mosquito selective carbamates, dimethyl sul foxide, and Anopheles gambiae acetylcholinesterase. These results have implications for the high throughput screening of insecticides as continued use of current methods using DMSO likely facilitates the overlooking of lead compounds. Secondly I presen t a characterization of the inhibitor profile of acetylcholinesterase from Boophilus microplus ( Bm ) and Plebotomus papatasi ( Pp ) compared to human and bovine acetylcholinesterase, in order to identify divergent pharmacology that could lead to selective inh ibitors. Results indicate a unique structur e of Bm acetylcholinesterase that could lead to the design of novel inhibitors to replace the currently utilized class of insecticides. Additionally, Bm and Pp display low nanomolar sensitivity to a variety of newly designed carbamate insecticides that could provide an excellent lead compound

PAGE 12

12 for vector control. Thirdly I report an analysis of the mode of action of the toxicity to the insect repellent N,N Dieth yl meta toluamide (DEET) Recent reports suggest DEET is an acetylcholinesterase inhibitor, potentially causing a toxicity risk in exposed human individuals. Results indicate that DEET is a poor acetylcholinesterase inhibitor but instead mimicks the act ion of octopamine on the insect central nervous system. F uther analysis found a b l ocking action on mammalian neuronal sodium and potassium channels similar to local anesthetics, such as lidocaine. Such an action would explain the numbness caused by DEET when applied to human skin. Overall, I conclude that toxicity of DEET through anticholinesterase properties is unlikely and would be of little relevance to human safety. Lastly, the evaluation of mosquito selective carbamates to mosquito vectors and agri cultural pests were reported Results indicate that our novel carbamates possess unusual insect selectivity that has implications for mitigation of mosquito insecticide resistance due to agricultural uses, particularly in malaria endemic regions.

PAGE 13

13 CHAPTER 1 LITE RATURE REVIEW 1.1 Mosquito Borne Vectors Vector borne diseases are either emerging or resurging due to a variety of different factors including, but not limited to, consequenc es of public health policy, insecticide resistance, and the change from eradication o f vectors to emergency response (Gubler, 1998a). This change from prevention to emergency response allows diseases to thrive and continuously infect humans m osquito was capable of transmitting disease from human to human, making the design of control programs to manage the arthropod vector of critical importance (Gubler, 1998a). By the urban yellow fever and dengue fever were controlled in Central and South America and were eliminated in North America through destruc tion of breeding sites and controlled insecticide usage (Gubler, 1998a). Similarly, m alaria was greatly reduced in the Americas, Asia, and the Pacific Islands through control programs combining insecticide spraying and elimination of breeding sites (Gubler, 1998a). With the exception of Antarctica, mosquitoes are capable of thriving in many biotic communities such as tropical forests, salt marshes, and the tun dra (Mullen and Durden, 2002). Due to their ubiquitous presence, high potential for domestication, inhabitance of many ecosystems and ability to acclimate to a change in environment and in some cases to shift host preference mosquitoes are the most impo rtant arthropod affecting human health. Among these is the Anopheles gambiae (Giles ; An. gambiae ) mosquito. This species is regarded as the 3 million deaths annually (WHO, 2003). Despite rigorous control efforts, over 100 countries are at risk for malaria, making it the major cause of mortality in third world countries (WHO, 2003).

PAGE 14

14 Anophe les s p p. mosquitoes are found in many countries throughout the world allowing for the widespread presence of the malaria parasite. An gambiae is considered to be the primary malaria vector in Sub Saharan Africa (Coluzzi, 1984), An darlingi is the primary vector in Latin America (Conn et al., 2006), and An dirus is considered to be the primary vector in Southeast Asia (Manh et al., 2010). Although the aforementioned species are considered to be primary malaria vectors, secondary vectors have been documented to cause substantial malaria transmission. Secondary vectors include: A n arabiensis, An funestus, An nili, and An moucheti. Ae aegypti (Linn.) and Ae albopictus (Skuse) are also major vectors of several important diseases in humans Dengue fever and dengue dengue hemorrhagic fever (DHF) are considered to be the most im portant tropical infectious diseases, after malaria (Gubler, 1998b). Ae. aegypti is considered to be the most efficient dengue vector due to its preference for human hosts and resides in densely populated locations. However, Ae albopictus is considered to be the primary vector in some locations of the world in which Ae aegypti populations are low. Ae aegypti is mainly found in the sub tropical zone of the Americas and is a great threat to humans due to domestication and their diurnal habits. Additionally, Ae species have been found to transmit various other diseases such as West Nile LaCrosse encephalitis, and Yellow Fever ( Watts et al., 1973 ; WHO, 1997; Nash et al., 2001 ) viruses Other mosquito genera, such as Culex ( Cx. ) are also known to act as vectors for numerous other diseases that affect thousands of people worldwide. Cx quinquefasciatus (Say) is debatably the primary African vector within the genus and has been observed in staggering densities. In Rangoon, Myanmar, this particular species has been estimated to have densities of 15 million per square kilometer resulting in 80,000 bites per year/per person (Mullen and Durden, 2002). Cx quinquefasci atus are inhabitants of many locations throughout the world

PAGE 15

15 including sub Saharan Africa, a nearly identical range to An gambiae. Over a billion people in as many as 80 countries are at risk for lymphatic f ilariasis (LF), which is vectored by C x quinque fasciatus (WHO, 2000) Cx quinquefasciatus is a nocturnal mosquito and feeds opportunistically on mammals, which can be an important consideration for control mechanisms (Mullen and Durden, 2002). Due to the high number of infections from multiple vect ors and omnipresence of mosquitoes, control programs are vital for reduction of disease. 1.2 Mosquito Borne Diseases Malaria is considered to be the most important insect transmitted disease ; it affects 300 500 million individuals with approximately 1.5 3 mill ion fatalities annually (Giles and Warell, 1993; WHO, 2003). The malaria parasite, Plasmodium falciparum is vectored by An gambiae (Giles), and has increased morbidity/mortality towards individuals with compromised immune systems, including children and pregnant women (Greenwood et al., 1987). In the United States, endemic malaria has been eradicated, even though the Anopheles spp. vector s are still present. This eradication was achieved through the use of synthetic pesticides, and through improved socio economic conditions such as window screens and air conditioners (Williams, 1963; Zucker, 1996). Malaria control programs have bee n implemented worldwide and have been successful in eradicating malaria within developed countries. However, developing or underdeveloped countries have not been able to eradicate the disease for multiple reasons including, but not limited to financial bu rdens, poor compliance of control programs, and insecticide resistance. Control programs are varied throughout the world and have a large influence on the impact of malaria within a particular region. Dengue fever and DHF have increased substantially ov er the past 40 years and in 1996 Organization (WHO, 1997). Within the past 10 years there have been an estimated 100 million

PAGE 16

16 cases of dengue fever, 500,000 cases of d engue hemorrhagic fever, and approximately 25,000 deaths annually (Gubler, 1998b). Although dengue fever has been an important tropical disease worldwide for many years, it is now becoming an eminent threat within the United States. Dengue is often consi dered a disease found within tropical and subtropical locations, but it is capable of being transmitted in temperate climates as well. For approximately four decades (1940 1980), there were no reported cases of acquired dengue fever within the continent al United States. However, environmental factors, competent mosquito vectors, increased outdoor activities, and reduced control measures within the United States provided conditions adequate to facilitate a dengue outbreak within the United States. Confi rmation of this possibility is shown by locally acquired cases of dengue in 1980 along the Texas Mexico border. These cases are thought to have coincided with large outbreaks in neighboring Mexican cities. Furthermore, since 2009, there have been 61 conf irmed cases of locally acquired dengue fever in Key West Florida alone (CDC, 2010) and according to the Miami Dade Health Department, two locally acquired dengue case s in Miami Dade county. This northward spread of the disease toward larger cities in Flo rida has increased the concern that dengue could reemerge as an endemic dis ease in the U.S. (Vaidyanathan 2010). There are a number of factors that have been identified as reasons for the reintroduction of dengue in the U.S. First, dengue was added to the list of Nationally Notifiable Infectious Conditions within the past year (2010) (Franco et al., 2010). Due to t his, awareness within the medical community is low and can potentially lead to delayed identification of dengue outbreaks. Secondly, increased world travel allow for dengue outbreaks to more likely due to movement of the virus and the vectors. Thirdly, t he overall range of the two vectors, A e aegypti and A e albopictus are continuing to expand and will potentially lead to dengue outbreaks within the

PAGE 17

17 United States. Currently, A e albopictus has been found to inhabit locations from the eastern seaboard t o New England and the Mississippi River up to Chicago. Lastly, governmental agencies have had severe budget cuts, which prevent adequate vector surveillance and control programs to be established thus minimiz ing ol future outbreaks (Franco et al., 2010). Currently, the Florida Keys utilize a variety of the aforementioned control techniques to minimize the transmission rates of dengue fever. The Mosquito Control Association within the Florida Keys actively practic es source reduction via door to door campaigns to isolate and eliminate mosquito breeding sites. Larval control is accomplish ed through the application of larvicides such as spinosad or Bacillus thuringiensis israelensis W hen applied properly t hese larvicides have no effect on non target organisms and are considered to be the optimal method for controlling mosquito populations in the Florida Keys. However, when populations ar e too large for larval control the spraying of ault icides on adult popuat ions has become the principal method for controlling the disease vectors. According to the Florida Keys Mosquito Control Association, vehicles or airplanes spray a fine mist of insecticides to locations with adult mosquito populations through an Ultra Low Volume (ULV) method. The ULV method deploys less than an ounce of insecticide per acre. When performing ground adulticide treatments, it is common for the county to utilize permethrin as the control agent whereas organophosphates are used in the aerial treatments. Although these insecticides are administered in extremely low amounts, public outcries often limit the use of these effective control measures. Control of mosquitoes through the use of insecticides is complicated due to the large abundance an d diversity of environmentally sensitive ecosystems found within the Florida Keys. There are a large number of marine sanctuaries, refuges, and national parks that convolute the

PAGE 18

18 problem of controlling mosquito vectors. One organism of concern is Cyclargu s thomasi bethunebakeri or the Miami Blue Butterfly (MBB). The MBB is a coastal butterfly that inhabits sunny areas at the edge of tropical hardwood forests (Zhong, 2007). This insect has a total developmental time of approximately 30 days, which yield s them more susceptible to a number of insecticidal sprays in the field. This species of insect is considered to be one of the rarest in North America and was declared to be critically endangered by the state of Florida in 2002. Currently, Bahia Honda Ke y State Park has the only isolated population of MBB that still flourishing in the wild (Center of Biodiversity, 2005) and there is significant controvers y over utilizing insecticides for mosquito control near potential MBB habitats. Studies have found residues of naled and fenthion (organophosphates) within the hammock ecosystems of wildlife refuges in the state of Florida due to unintentional insecticide drift from aerial applications. Recently, resear ch has been performed to determine the effects of organophosphates toward MBB larvae when using ULV for mosquito control. Data suggests that the overall survival rate of MBB larvae is 73.9% when exposed to ULV (1000 g/m 2 ) organophosphates in the spray zo ne. This survival rate is significantly lower than for MBB exposed in them drift zone (90.6%) or control zones (100%), indicating that mortality to the MBB larvae occurs within the mosquito targeted spray area. However, these data also suggest that morta lity of MBB is minimal outside of the targeted spray area (Zhong, 2007). The results of the previous study indicates the dire need for the development of a novel insecticide that can be used for dengue control in the state of Florida, and similar locatio ns worldwide, with minimal to no mortality to non target species, including the Miami Blue Butterfly. Development of such an insecticide could be essential for a successful mosquito control program while allowing population s of the endangered species to s urvive

PAGE 19

19 1.3 Other Invertebrate Disease Vectors and Their Respective Vectored Diseases There are a number of other medically important disease vector ing arthropod s that impact human and animal health through the transmission of disease and the economic burde n the diseases produce. One example is Phlebotomine sandflies, which are nematoceran insects that have the capability of transmitting a number of human and animal related diseases. Sandflies are most commonl y known to transmit leishmaniasi s, a potentiall y disfiguring disease that affects people in more than 80 countries worldwide (Desjeux, 1996). Leishmaniasis is considered to be an emerging and uncontrolled disaease as it is endemic in nearly 100 countries with nearly 350 million people at risk (WHO, 20 07, 2010). Phlebotomus papatasi is the primary species of the old world that is known to vector Leishmania major the causative pathogen for zoonotic cutaneous leishmaniasis (Jaffe et al., 2004; Kravchenko et al., 2004). Phlebotomus papatasi populations are widespread with endemicity in central Asia, India, North and Central Africa, and the Middle East (WHO, 2007). This high geographic prevalence combined with the biology of the sandfly make this insect exceptionally difficult to control. B urrowing rodents are reservoir hosts for L major and sand flies utilize rodent burrows for various insect lifestages, making the control of these insects through direct insecticidal application difficult (Schlein and Muller, 2010; Wasserberg et al., 2011; Mascari et al., 2012). Ticks are also well known arthropods of medical and veterinary importance as they are disease vectors to both, humans and animals. Approximately ten percent of the 867 tick species are known vectors of numerous pathogens that infec t humans and animals. These tick v ectored diseases result in significant economic losses and mortality directly due to their feeding behavior (Jongejan and Uilenberg, 2004) of livestock Ticks transmit a greater diversity of pathogenic organisms, protozo a, and viruses than any other arthropod (Jongejan and Uilenberg, 2004). The global importance of ticks is primarily through the diseases transmitted to livestock as they are a

PAGE 20

20 major constraint of livestock production and therefore, economic growth. The major tick borne diseases that affect livestock include babesiosis, anaplasmosis, theileriosis and heartwater. Beyond the transmission of diseases, ticks are capable of negatively affecting livestock and the ir economic value through extensive blood loss, reduced value of skins/hides, and reduced milk production (Jongejan and Uilenberg, 2004). An agriculturally important tick that affects the U.S. population is the cattle tick, Rhipicephalus ( Boophilus) microplus (Canestrini; Bm ). This species of tick is a potentially deadly pest of cattle as they are primary vectors for Babesia, a protozoan parasite that causes the deadly hemolytic disease known as babesiosis. Due to the high value of livestock and the increasing difficulty to control tick vectors, the re is a need for the development of insecticides with novel modes of action that can augment the currently utilized control methods to continue reducing disease vector populations. 1.4 Vector Borne Disease Control Methods Control methods vary substantially in cost, sustainability, applicability, and effectiveness; however, the principle remains the same: reduction of morbidity and mortality of vector borne diseases through reduction of transmission levels, which in turn can potentially reduce the severity of in fection (Bay, 1967). Prior to the use of dichloro diphenyl triphenylethane (DDT), the majority of vector control was targeted toward the larval stages, which requires extensive knowledge of insect behavior and ecology (Brogdon and McAllister, 1998). L arv icides are still commonly used however a combination of control methods are now used In 1940, the development of DDT revolutionized vector control by allowing effective control measures to be introduced into mosquito laden areas through indoor residual spraying (IRS). The use of DDT in malaria endemic regions assisted in eliminating the disease in the United States and Europe, and reduced transmission by up to 99% in Sri Lanka, India (Attaran and Maharaj, 2000). D espite its positive results on vector c ontrol, DDT was banned due to environmental harm, high persistence

PAGE 21

21 in vegetation and mammals, and potential carcinogenic/teratogenic properties towards humans ( Roberts, 1997 ; Turusov et al., 2002 ). This ban has resulted in researchers attempting to develo p mosquitocides that are less persistent, more selective, have minimal side effects, and are cheap er to produce (Carlier et al., 2008; Berg, 2009). The World Health Organization ( WHO ) has focused on malaria reduction in sub Saharan Africa by controlling the disease vecto rs with the use of two primary methods. Indoor residual spraing ( IRS ) has been utilized by spraying a persistent insecticide in the house interior and eaves of houses. Although utilization of IRS has had great success in decreasing the concentration of malarial vectors, there has been a decline in the use of IRS due to lack of funding from local governments, concerns of environmental harm, and potential human intoxicat ion (WHO, 2006). The second form of controlling malarial vectors is by administering long lasting insecticide treated bed nets (ITNs), usually treated with a pyrethroid (WHO, 2006). There have been several studies that report reduced malaria infection du e to reduction of insect vectors through the use of ITNs (Choi et al., 1995; Curtis et al., 1998). Lymphatic Filariasis is vectored by Cx quinquefasciatus and more effective means of control are needed for this vector Currently, minimization of cases f or this disease is based around reduction of mosquito numbers, but also incorporates treatment of the microfilaria through medicinal compounds such as a lbendazole (Ottesen et al., 1999). Adult C x. quinquefasciatus control programs are very similar to thos e of Ae. aegypti and A e. albopictus but there is a greater utilization of biopesticides like Bacillus sphaericus (Barbazan et al., 1997) A major problem with chemical control o f Cx quinquefasciatus is the increased prevalence of resistance. Continued widespread use of malathion, an organophosphate, has resulted in a broad spectrum of insecticide resistant C x quinquefasciatus whereas Ae. aegypti with an identical

PAGE 22

22 range and exposure rate showed no resistance (Magdalena et al., 2000). This greater resi stance potential suggests the need for reduced broad application of insecticides to a more narrow use, such as control through ITNs. An. gambiae and Cx. quinquefasciatus possess common nocturnal feeding habits, making it feasible to jointly control malaria and filariasis through ITNs. This method is currently succeful and has products such as permethrin incorporated Olyset Net bed nets In a recent study of these nets, they resulted in increased exophily of Cx. quinquefasciatus that factored into feeding success rates of 14%, to 15% compared with 35% when untreated nets were used (Guessan et al., 2008). As with other mosquito vectored diseases, there is a need for new, selective mosquitocides for continued reduction of lymphatic filariasis. Dengue fever, transmitted by Ae. aegypti and Ae. albopictus has no vaccine, and therefore the only way to reduce disease transmission is to control the primary vectors (Gubler, 1989) These mosquito species are domesticated and have evolved to breed in water laden containers of relatively small volume, such as used car tires, old plastic cartons, and flower vases at cemeteries (Christophers, 1960 ) Plastic containers are the primary breeding site s for Aedes spp., which impacts control measure strategie s ( Vezzani and Schweigmann, 2002). Control of dengue fever through the reduction of Ae. aegypti and Ae. albopictus begins with the adequate covering of plastic containers (ie: cemetery vases, used car tires, etc.) to prevent access to egg laying females (Vezzani and Schweigmann, 2002). Secondly, biological control, although not commonly utilized, has been used to control the two dengue fever vectors (Turley et al., 2009). In lieu of b iological control, many countries have begun control with natural and chemical larvicides and have had success in reducing the number of vector mosquitoes (Garcez et al., 2009). There are a number of proven larvicides such as deltamethrin, temephos, DDT, methoprene, and Bacillus thuringiensis subsp. Israelensis as well as other botanical larvicides

PAGE 23

23 (Kumar et al., 2009; Borovsky, 2003). H owever, prolonged use of several aforementioned synthetic larvicides has led to resistance and therefore decreased control (Mulla et al., 2004 ; Kroeger et al., 2006 ). C ontrol of adult mosquitoes includes broad applications of insecticides via aircraft, vehicles, and by hand (WHO, 2008). These techniques result in satisfactory levels of adult mosquito control that oft en persist through the peak dengue transmission period (Gratz, 1991). Although these methods are effective for controlling mosquito vectors, the broad application of insecticides could have deleterious effects of non target organisms and will likely incre ase the presence of insecticide resistance. Due to these factors, there is a need for the design of new, selective mosquitocides for the control of disease vectors worldwide. N on mosquito disease vectors are also of critical importance as these arthropods may also be competent in vectoring deadly human and animal diseases. Control of phlebotomine sandflies is very similar to the control methods used for An. gambiae The use of ITNs are used primarily for malaria control, but their effectiveness on phlebo tomine sandfly populations has been evaluated in numerous different countrie s and shown some promise for control (Maroli and Lane, 1989; Mutinga et al., 1992; Basimike and Mutinga, 1995). However, the effectiveness of ITNs may be limited because the highe st sandfly biting activity is during the twilight hours, usually before people are outdoors Due to this crepuscular activity, control has shift ed to utilizing IRS methods and insecticide impregnated curtains hung across potential sites of entry (ie: wind ows and doors) (Alexander and Maroli, 2003). Studies have shown that curtains impregnated with permethrin significantly reduced the human biting rate and resting density of P. papatasi indicating a potential control method for reduction of vectored disae ase from phlebotomine sandflies (Elnaiem et al., 1999). Recently, research has been performed to determine the effectiveness of targeting sandflies through rodents, their primary host for

PAGE 24

24 bloodfeedings (Mascari et al., 2012). Current sandfly control meth ods could be substantially augmented through the development of a feed through insecticide that possesses high sandfly toxicity, yet low mammalian toxicity. Control of tick vectored diseases is different than control of dipteran vectors due to the diffe rent hosts and the different developmental habitats. Control programs for the cattle fever tick also utilize insecticides, but application of these chemicals is usually applied directly to the host animal through sprays and dips versus aerial sprays or st atic control methods. Although Boophilus microplus ( Bm ) has been eradicated within the United States, Mexican cattle still suffer infestations of Bm that harbor Babesia sp p and pose a threat to cattle populations within the United States through reintrod uction (Graham and Ho urrigan, 1977; Bram et al., 2002 ). Reintroduction of infected Bm from Mexico into the United States is of extreme concern due to the large number of imported cattle and also due to the likelihood of infected ungulate wildlife crossing the Rio Grande River and entering southern Texas (George, 1990). To prevent the return of Bm to the United States, the United States Department of Agriculture (USDA) implemented the Cattle Fever Tick Eradication Program (CFTEP) which mandates a quarantine zone, dipping of all imported cattle into 0.3% 0.25% coumaphos, and a 7 14 day quarantine period (Graham and Hourrigan, 1977; Miller et al., 2005). Although CFTEP has been effective in reducing Boophilus populations, control has become increasingly dif ficult due to escalating organophosphate (OP) and pyrethroid resistance of Bm within Mexican cattle (Miller et al., 2005; Li et al., 2003; Rosario Cruz et al., 2005; Baxter and Barker, 1998). 1.5 Mode of Action of Insecticides Used for V ector C ontrol Insecticides continue to be a mainstay for mosquito control programs utilizing the integrated vector management approach for the control of vector borne diseases (Hemingway

PAGE 25

25 and Ranson, 2000). Insecticides have been developed with a variety of mechanisms a nd target sites. A cetylcholinesterase (AChE, EC 3.1.1.7) inhibitors block the hydrolytic action of AChE and carbamate (CB) and organophosphate (OP) compounds are two classes of insecticides commonly known to inhibit th is enzyme (Bloomquist, 1999) Figu re 1 1 depicts common CB s (Bendiocarb and Propoxur) and OP s (Malathion and Fonofos) used for vector control. The OPs are a group of insecticides that are chemicall y diverse and are classified based on the elements attached to the central phosphorous atom. Due to the majority of OPs being phosphorothionates, cytochrome P450 monoxygenase s within the insect must bioactivat e them through a reaction known as oxidative desulfuration (Bloomquist, 1999). Carbamates are a similar group of insecticides when compar ed to as they are both anticholinesterases and induce similar signs of intoxication. Carbamates are all esters of carbamic acid that often posses an aryl group as the leaving group. The insecticidal effect of CB s and OPs is similar due to their inhe rent ability to inhibit acetylcholinesterase ( AChE ) AChE is a serine hydrolase needed for regulating the synaptic action of the neurotransmitter aceytlcholine ( Ach ) The AChE directed insecticides react with a serine residue that is located at the catal ytic site found within the AChE gorge (Fukuto, 1990). The carbamoylated or phosporylated enzyme is no longer able to hydrolyze ACh, resulting in the buildup of ACh in the nerve synapse (Cohen and Oosterbaan, 1963). This effect causes excessive excitation of the nerves, producing uncoordinated movements, tremors, and paralysis (Yu, 2008). Although these two classes of insecticides are very similar in their mode of action, they do possess notable differences. The phosphorylation of AChE is considered to b e irreversible and can inactivate the enzyme for hours to days whereas carbamoylation of

PAGE 26

26 AChE is less stable and will hydrolyze with a half life of approximately 40 min (Bloomquist, 1999). A second commonly used class of insecticides for vector control is the pyrethroids Pyrethroids are synthetic compounds dvelopmed from pyrethrins found in flowers of Chrysanthemum cinerariaefolium The compounds within this class are typically esters of chyrsanthemic acid (Bloomquist, 1999). Th e compounds within th is insecticidal class target the voltage gated sodium channels of insects (discussed in further detail in a separate section) and possess greater selective toxicity for insects when compared to the The high efficacy and selectivity of pyrethroids ha s resulted in their wide utiliz ation as pest control agents (Bloomquist, 1999) Pyrethroids are classified into two types, type 1 or 2 based on their alcohol substituent. More specifically, type 2 pyrethroids are commonly classified by the presence of a n alpha cyano group, whereas type 1 pyrethroids do not possess this functional group and are therefore approximately 10 fold less toxic to insects (Bloomquist, 1999). T he two classes of pyrethroids act on the target site slightly differently. Type 1 com pounds prolong the sodium current for milliseconds whereas the type 2 compounds increase the duration of the current for minutes or longer. Therefore, type 1 compounds produce multiple action potentials within the peripheral nerves and interneruons in the central nervous system and type 2 compounds simply reduce electri cal excitability through a long term depolarization of the axon. Due to this variability in the mode of action, the two types of pyrethroids exhibit different signs of intoxication within i nsects. Type 1 compounds produce hyperexcitability and convulsions within the insect after intoxication and, due to their quick action, a greater knockdown ability when compared to type 2 compounds. Conversely, type 2 compounds produce lethargic actions and ataxia (Bloomquist, 1999). Structure activity experiments have suggested that the more polar molecules are capable

PAGE 27

27 of capable of penetrating the cuticle more efficiently resulting in rapid knockdown, but quick dissociation from the active site, reduc ing toxicity (Salgado et al., 1983). It is interesting to note that both DDT and type I pyrethroids display a negative temperature coefficient of toxicity, meaning they are more toxic at low temperatures, whereas type 2 pyrethroids display a positive temp erature coefficient (Yu, 2008). Figure 1 2 depicts commonly used pyrethroids for vector control. One of the oldest groups of commercial insecticides are chloride channel antagonists such as dieldrin, lindane and fipronil (Bloomquist, 1998). Although the majority of these compounds have now been banned from commercial use, lindane and endosulfan are s till used in a variety of circumstances due to their inherently higher biodegradability. These inhibitors possess an antagonistic effect on the inhibitory neurotransmitter found within the CNS, gamma aminobutyric acid (GABA). This antagonism results in h yperexcitability and convulsions due to the prevention of synaptic inhibition through blocking GABA mediated Cl channel activation. Many of these compounds possess high mammalian toxicity, which has led to subsequent banning of many insecticides within this class. However, recent chemical synthesis has produced a novel GABA antagonist, fipronil, which has high sel ectivity toward insects over mammals and is often used in veterinary medicine (Bloomquist, 1999). 1.6 Insecticide Target Sites and Structural Biology of Acetylcholinesterase Acetylcholinesterase is a well validated and highly useful target for insecticides. As previously mentioned, AChE is critical for sustaining life within insects and mammals due to its principal role in nerve signal propagation. It serves to hydrolyze ACh within cholinergic synapses and inhibition of this process will lead to repeated ner ve stimulation, tremors, and eventual death of the insect. A lthough many anticholinesterases have high insect toxicities, their mode of action typically allows for minimal selectivity among commercially vailable

PAGE 28

28 compounds Both mammalian and insect AChE possess es a serine residue at the catalytic site within the A ChE gorge which results in poor selectivity and thereby limit s the use of many AChE inhibitors (Pang, 2009). Thus development of anticholinesterases with a novel mode of action is of critical i mportance for control of mosquito borne disesases The development of a t hree dimensional (3 D) structural model of AChE from the electric eel, Torpedo californica ( Tc AChE), has provided an understanding of the structure function relationships between inhi bitors and AChE (Sussman et al., 1991). Moreover we are now capable of utilizing crystal sructures of numerous AChE proteins to perform in silico ligand docking of chemical libraries. The An. gambiae acetylcholinesterase gorge is approximately 20 deep section halfway down the gorge, and a catalytic acyl site at the bottom of the gorge ( Sussman et al., 1991 ) Functionally important residues are shown in figure 1 3 The catalytic acyl site is composed of the catalytic triad (His 441, Glu 325, and Ser 200 ( Ag numbering). The orbitals of tryptophan 84 facilitate binding of the trimethylammonium group of acetylcholine and serine 200 ( Ag numbering) functions to quickly bind the acetyl group of the substrate during catalytic hydrolysis (Szegletes et al., 1999) During the carbamylation reaction between the substrate and the CAS, the oxyanion hole is thought to stab i lize the tetrahedral intermediate of the reaction (Szegletes et al., 1999) The anionic site is thought to bind ACh at the quaternary ammonium group through cation or interactions. The peripheral site of the acetylcholinesterase gorge includes cysteine 286 (absent in humans), a s par tate 72 and tryptophan 279 ( Szegletes et al., 1999; Ferrari et al., 2001 ; Pang, 2006 ) and has a unique action during substrate catalysis. It has been suggested that the peripheral site contributes to catalytic efficiency by the transient binding of ACh a s it migrates toward the catalytic acyl site. Results discussed in Ferrari et al (2001)

PAGE 29

29 provided a potential explanation of the role for the ligand binding to the peripheral site. It was proposed that the binding of the ligand to the peripheral site init iated a conformational change within the AChE protein structure, which is then allosterically transmitted to the acyl site to facilitate catalysis (Ferrari et al., 2001). 1.7 Insecticide Resistance Mechanisms Insecticide resistance has become a major problem for effective mosquito control due to a continuous selection for resistance to nearly all deployed insecticides (Pasteur and Raymond, 1996). DDT was first utilized for mosquito control in 1946 and resistance to the insecticide was reported in Ae. triatae niorhynchus and Ae. solicitans in 1947 (Brown, 1986). In 1992, there were more than 100 mosquito species that were considered to be resistant to one or more insecticide classes (WHO, 1992). The biochemistry of insecticide resistance is important to unde rstand when attempting to mitigate resistance through the manipulation of compound chemistries or when performing surveys to understand resistance patterns within an area. There are two primary methods for the production of insecticide resistance: increas ed concentrations of metabolic enzymes and/or target site insensitivities. Glutathione S transferases (GST), esterases, and monooxygenases are three major enzyme groups within insects that are believed to be responsible for metabolically based resistance to organochlorines, organophosphates, carbamates, and pyrethroids (Hemingway and Ranson, 2000). Also, non silent point mutations yield target site insensitivities and are therefore the primary method for producing target site resistance. Esterases (synony mous with carboxylesterases ) are a group of enzymes that hydrolyze carboxylic esters (Walker, 1993; Hemingway and Karunaratne, 1998) The carboxylesterase based mechanism for resistance has been found within numerous medically important species and is con sidered the principal mechanism for OP resistance and the secondary mechanism for

PAGE 30

30 CB resistance within mosquitoes, including An. gambiae (Hemingway and Karunaratne, 1998; McCarroll et al., 2000). There are two classes of esterases, A and B. S ome A esterases can hydrolyze OP insecticides through the use of an acylated cysteine in the active site and are therefore commonly termed phosphoric triester hydrolases (EC: 3.1.8) (Aldridge, 1953; Reiner et al, 1993; Walker, 1993). B esterases have a serine r esidue within its active site and are classified as serine hydrolase enzymes. The mechanism for insecticide resistance is thought to be due to sequestration rather than metabolizing the xenobioti c which is seen in various other metabolic based resistance s (Kadous et al., 1983). When AChE inhibiting xenobiotics are substrates for these enzymes the acylated enzyme is formed quickly but the deacylation step is slow and becomes the rate limiting step. Therefore, the increased presence of carboxylesterases produces resistance due to rapid sequestration before the insecticides reach the target enzyme. GSTs are commonly found in aerobic organisms and are dimeric multifunctional enzymes that metabolize a large range of xenobiotics to confer insecticide resista nce to a variety of insecticide classes (Ranson et al., 2001; Prapanthara et al., 1996). Resistance due to elevated levels of GST activity was initially identified in OP resistance and it is now considered to be a mechanism of metabolic resistance within many insect species, including An. gambiae (Hayes and Wolf, 1988). Detoxification of OP insecticides occurs via an O dealkylation (glutathione conjugation with the alkyl group of the insecticide) or an O dearylation (glutathione conjugation with the leavi ng group) reaction (Oppenorth et al., 1979; Chiang and Sun, 1993). Cytochrome P450 m onooxygenases are a group of enzymes found in the majority of animals including insects. Similar to GSTs, these enzymes are involved in the metabolism of xenobiotics and are associated with pyrethroid resistance in numerous mosquito vectors The P450 monooxygenases metabolize a large majority of insecticides usually for detoxification

PAGE 31

31 purposes but are occasionally involved in bioactivation reactions, as seen with OPs The catalytic action of P450 enzymes is through the donation of an oxygen molecule into the substrate via uptake of electrons from NADPH ( Hemingway et al., 1985 ; Vulule et al., 1994 ; Br ogdon et al., 1997 ). Target site resistance is the second most common method of insecticide resistance and is produced through point mutations (Hemingway and Ranson, 2000). For resistance to occur, the amino acid change must yield a reduction in affinity or efficacy for the insecticide without reducing the functionality of the target site too extensively Although the point mutations confer resistance towards insecticides, there is a negative fitness cost to the individual in the absence of the insecticide and therefore, the fitness cost has large implications toward the p ersistence of the resistance within the field (Hemingway and Ranson, 2000). Prior to discussion of AChE point mutations that confer resistance, it is important to understand the genes that correspond to AChE. Two primary genes have been discovered which encode AChE, ace 1 and ace 2 (Weill et al., 2004). P ublished studies have reported that AChE1 is the primary site for OP and CB binding, implying that the ace 1 gene encodes the primary AChE in many insect species (Chen et al., 2009). Therefore, the insect ace 1 gene is likely more important in comparison to the ace 2 gene; however, Drosophila melanogaster and Musca domestica are two insect species that utilize o nly the ace 2 gene for encoding the primary AChE enzyme. Both ace genes, ace 1 and ace 2 were found to be present within Ag A ChE, however it is well established that ace 1 is the primary gene for encoding the AChE enzyme within Ag AChE (Weill et al., 2002) The function of ace 2 when both ace genes are present is unknown (Weill et al., 2002; Weill et al., 2004). A major difference between AChE1 and AChE2 (encoded by ace 1 and ace 2 respectively) is a 31 amino acid insertion within the AChE2

PAGE 32

32 sequence. Thi s insertion is absent in vertebrate AChEs and is potentially a characteristic of the ace 2 gene in diptera (Weill et al., 2002). Insensitive AChE is a common resistance mechanism to anticholinesterase insecticides in insects. However, the point mutatio ns have been found to display a range of insensitivities due to variability in the mutation and variability within the genes encoding AChE (Weill et al., 2004). Mutations corresponding to AChE ins ensitivity towards insects that utilize the ace 2 gene (ie: Drosophila melanogaster, Musca domestica, and Bactrocera oleae ) have been well describe d but the different behavior of the ace 1 gene has hindered the process for insects that do not utilize ace 2 (Malcom et al., 1998) High levels of AChE insensitiviti es have been documented for mosquito vectors including: An. gambiae (Weill et al, 2003) An. albimanus (Ayad and Georghiou, 1975), and Cx. pipiens (Bourguet et al., 1996) H igh levels of AChE resistance within Cx. pipiens and An. gambiae corresponds with the same glycine to serine substitution (known as G119S through Torpedo nomenclature), and results from a single point mutation of GGC to AGC in the ace 1 gene (Weill et al., 2003). MACE ( M odified A cetyl C holin E sterase) is used to describe insensitive ACh E enzyme due to a point mutation that yields high resistance ratios toward dimethylcarbamates, such as pirimicarb (Foster et al., 2003). 1.8 Insecticide Resistance Patterns Observed in Arthropod Disease Vectors The emergence of widespread insecticide resista nce is threatening disease control efforts by allowing a reemergence of insect vector populations. In An. gambiae populations, resistance to OP s emerged 14 years after their initial deployment and five years after the first uses of carbamates (Hirshorn, 1 993). The majority of insecticide resistance within populations of An. gambiae is to pyrethroids by means of an increased frequency of kdr (altered sodium channel) and increased levels of elevated P450 monooxygenases ( Vulule et al., 1999; Ranson et al., 2 000b; Stump e t al., 2004 ). Anticholinesterase resistance is not yet widespread in A n. Gambiae

PAGE 33

33 mosquitoes from Kenya as the majority of exposure to carbamates and organophosphates is likely through agricultural uses. However, AChE resistance has been found in Southern Benin within the AKRON strain of A n. gambiae The AKRON strain possess es upregulation of and CYP325D2: 5.1 fold) and to elevate d GST levels (GSTD1 6: 2.7 fold, GSTD11: 2.1 fold) (Djouaka et al., 2008). In conjunction with increased metabolic activity, PCR analysis has shown the AKRON strain to possess a kdr mutation ( L1014F ) and an insensitive ace 1 mut ation that confer resistan ce to pyrethroids/DDT and carbamates, respectively (McAllister and Adams, 2010; Yadouleton et al., 2009). Resistance ratios towards carbamates ( eg. propoxur) have been shown to be greater than 5,000 fold when compared to the susceptible G3 strain (McAllis ter and Adams, 2010). Other arthropods are also capable of exhibit ing high levels of insecticide resistance that reduce the effectiveness of control programs. The cattle tick, Bm is a prime example of this as resistant ticks continuously cross the Mexi can border and enter the United States, a country that has eradicated Bm populations. O P and pyrethroid resistance has been attributed to both metabolic and target site insensitivities with the later being the primary mechanism for OP resistance (Li et a l., 2003; Schuntner et al., 1968; Bull and Ahrens, 1988; Morgan et al., 2009). However, isolating the mutated sequence of insensitive Bm AChE has proven to be difficult and the situation is convoluted due to the presence of multiple genes encoding Bm AChE ( Temeyer et al., 2010). Temeyer et al. (2010) expressed three acetylcholinesterases from OP resistant and suseptable strains of Bm and showed different alleles existed between the two strains. Although future research is needed to determine the roles of e ach gene in vivo it appears that OP insensitivity is multigenic (Baxter and Barker, 1998; Temeyer et al., 2010) or occurs from post

PAGE 34

34 translational modification of Bm AChE1, as shown in Drosophila melanogaster (Mutero and Fournier, 1992) Insecticide resi stance in phlebotomine sandfly populations is also a major issue that must be considered when determining control methods or designing novel inhibitors. There have been recent reports of insecticide resistance in sandfly populations (Alexander and Maroli, 2003) and evidence for AChE resistance through target site insensitivities (Surendran et al., 2005). The reports documenting the occurrence of MACE within sandflies were from the countries of Sri Lanka and Sudan, two countries participating in anti malar ial campaigns. It is reasonable to suggest the anticholinesterase resistance is due to widespread use of organophosphates during this time. Insecticide resistance must be understood and combated to continue controlling arthropod disease vectors. An und erstanding of the resistance patterns can assist researchers in the development of novel inhibitors and allow the use of additional control measures, such as augmenting the chemical control program with insect repellents for personal protection. 1.9 Historical and Current Uses of Repellents for Insect Vector Control The use of insect repellents likely began thousands of years ago with the use of natural products from plants and insects, primarily utilizing the benzoquinones present in the se tissue s (Baker, 1996 ). Historical documentation provides insight into the use of natural repellents, such as castor oil, by the Egyptians, Romans, and Native Americans for the control of flying insects ( Romi et al., 2001 ; Charlwood, 2003 ). Although natural repellents do provide a small degree of personal protection from insects, synthetic insect repellents have become a highly effective method of personal protection from biting insects and have functioned to enhance the effectiveness of vector control programs that utiliz

PAGE 35

35 extensive research to design a repellent adequate enough to protect troops on deployment. The first wave of military repellents contained essential oils derived from pla nts, such as citronella and campho r ( Covell, 1943). However, use of these repellents was short lived as the repellent properties were minimal and the duration of action of the repellent was short. During this time, U.S. troops were suffering enormous bou ts of malaria in the various theaters of war during the Along with malaria, chigger borne scrub typhus became a large issue with the advent of jungle warfare i n the Pacific War. Due to the rise of disease amongst our wartime troops, the United States Department of Agriculture (USDA) was requested in 1942 by the Department of Defense to search for new insecticide s and repellent s to control mosquitoes and chigger s (Whayne, 1955). In 195 2 a breakthrough in the science of repellents occurred with the discovery of N,N diethyl 3 methylbenz amide or DEET, by the United States Army (McCabe et al., 1954). D EET has been on the market for over 50 years and remains the m ost effective insect repellent in use today. D EET is a broad spectrum repellent that is highly effective against all mosquitoes (Gupta and Rutledge, 1991; Tron gtokit et al., 2 004; Curtis et al., 1987), sand flies (Alexander et al., 1995 a ), black flies (Ro bert et al., 1992), chiggers (Frances, 1994), ticks (Solberg et al., 1995), bedbugs (Kumar et al, 1995), and fleas (Mehr et al., 1984). An estimated 200 million people around the worl d use DEET containing products each year (U.S. EPA, 1980). Due to the high frequency of use, there have been extensive debates on the safety of DEET after a variety of reports indicate a potential linkage of DEET to seizures and encephalopathy (Roland et al., 1985; Osimitz and Murphy, 1997; Briassoulis et al., 2001). There has also been recent documentation that DEET is neurotoxic and is synergized by neurotoxic insecticides (Osimitz and Grouthaus, 1995; Abou Doina et al., 1996). Furthermore, mode of

PAGE 36

36 action studies suggests DEET is an acetylcholinesterase inhibitor (Corbel et al., 2009). While a significant amount of literature exist s on the effects of DEET to human toxicity within a laboratory setting, there have been minimal clinical reports of adverse effects directly li nked to the use of DEET, even though billions of doses are applied annually. It is also interesting to note that the frequency of observed seizures occurring after use of DEET containing products, when analyzed in the context of the number of human applic ations, any linkage is voided based on the increased probability of an association by chance (Koren et al., 2003). Th ough many years of research has been performed on numerous aspects of DEET action it is surprising that a debate remains as to the repelle ncy mode of action and molecular targets of DEET. One argument suggests DEET is a blocker of olfactory sensory neurons to attractants, such as carbon dioxide and 1 octen 3 ol (Ditzen et al., 2008; Dogan et al., 1999; Davis and Sok olove, 1976). Other res earch has suggested that insects detect DEET through olfactory mechanisms that elicit avoidance behavior (Syed and Leal, 2008; Carroll et al. 2005). The experimental evidence for both mechanisms potentially indicates that DEET does not affect one specifi c mol ecular target, and can therefore provide repellency through multiple modes of action. An understanding of the molecular mode of action for both, repellency and toxicity is essential for the development of novel compounds and for continued control of vector borne diseases. 1.10 Development of New Anticholinesterase Inhibitors The current problems associated with insecticide use, such as increased insecticide resistance, have resulted in a need for exploring new chemicals with alternate target sites to sustain the vital role of insecticides in vector borne disease control. However, newer tools in insecticide design can assist us in modifying the existing insecticide compounds for known target sites, of which AChE is one. The three dimensional structure of AChE from Torpedo californica

PAGE 37

37 ( Tc AChE) is available and provides insights for studying structure function relationships of many inhibitors (Sussman et al., 1991). Crystal structures of other AChE proteins are available, which assisted mo lecular modeli ng efforts and the synthesis of a ppropriate libraries of anticholinesterase compounds ( Bartolucci et al., 2001 ; Bourne et al., 2004 ). The AChE enzyme of Drosophila melanogaster has been crystallized and provides structural insights for other insect AChEs. It has shown that the insect AChE gorge is narrower than the previously crystallized structure of Torpedo californica and smaller in gorge volume (Harel et al., 2000). This c rystal structure can be utilized to determine the structure and function of other insect AChE gorges through comparative molecular modeling, bearing in mind that there are two ace genes in insects and the Drosophila crystal structure belongs to ace 2. Mole cular models suggest that the peripheral and active sites of Ag AChE and human AChE ( h AChE) consist of differing and unique amino acids, which can assist in the design of a selective carbamate ( Pang, 2006; Carlier et al ., 2008). Effects of ligand binding t o the catalytic triad due to the interactions between three of the peripheral site residues and the formation of the insect gorge has been studied through site directed mutagenesis (Mutunga, 2011 ) Through utilization of these models, design of selective compounds that are capable of interacting with ke y amino acids is possible. Figure 1 4 shows experimental compounds that demonstrated high potency and selectivity to Ag AChE (Carlier et al ., 2008) and will be used in this study. Figure 1 5 displays PRC 521, a non selective experimental carbamate. Table 1 1 displays the potency and mosquito selectivity of our novel inhibitors toward Ag AChE and human AChE. 1.11 High Throughput Screening of Insecticides Researchers have attempted to standard ize the HTS process (ie: solvents for inhibitors) in order to increase production and decrease variability. Dimethyl sulfoxide (DMSO) has favorable

PAGE 38

38 characteristics (good dissolving ability, low chemical reactivity, etc.) and therefore has been chosen for the standard vehicle during HTS (Tjernberg et al., 2006). Because DMSO has become the standard solvent for drug discovery, there has been a large amount of research on the storage of compounds within DMSO stock solutions. Many of these articles discuss h ow prolonged storage can potentially cause compound instability, decreased potency through freeze/thaw cycles, and the effect of water absorption toward compounds (Cheng et al. 2003; Kozikowski et al., 2003). While this knowledge is important, there has b een little documentation on the critical aspect of the effects of DMSO on protein function during in vitro HTS Research has shown DMSO can act as a stabilizer (Rajendran et al., 1995), denaturant ( Jacobson and Turner, 1980 ; Fujita et al., 1982 ; Bhattacharjya and Balaram, 1997; Kovrigin and Potekhin 1997), inhibitor (Perlman and Wolff, 1968; Johannesson et al., 1997 ; Klei field et al., 2000 ), or an activator in various systems (Rammler, 1967). However, these experiments were performed at DMSO con centrations (10% 70%) that exceed the 0.1% ( v/v ) to 5% ( v/v ) typically used for in vitro applications, such as HTS (Tjernberg et al., 2006). It is vital to understand the interaction between solvent and enzymes when attempting to develop a selective ins ecticide. Without this knowledge, advantageous potency, efficacy, or selectivity can be overlooked due to solvent dependent effects during in vitro assays. 1.12 Objectives of T his S tudy The dissertation describes three research objectives: Objective 1: The first objective was to perform experiments to investigate the biochemical mechanism of a solvent dependent antagonism of AChE inhibition by mosquito selective carbamates within Ag AChE. An understanding of solvent enzyme interactions during in vitro assays is critical for the proper screening of compounds against AChE. Details of this study are presented in C hapter 2.

PAGE 39

39 Objective 2: The second objective of this dissertation work was to characterize the inhibitor profile of recombinant acetylcholinesterase s from two arhtorpods, the cattle tick ( Boophilus microplus ) and the sandfly ( Phlebotomus papatasi ), and was compared to human and bovine AChE, in order to identify divergent pharmacology that might lead to selec tive inhibitors. Specifically, known AChE inhibitors, experimental carbamate inhibitors, and a tacrine dimer series were used as structural probes to determine AChE protein biology. Details of the AChE inhibitor profile and the potential leads for future insec ticide design are present ed in C hapter 3. Objective 3: The third objective of my dissertation research investigated the mode of action of biting insect repellents, such as DEET, upon ion channels and enzymatic systems. A thorough understanding of DEET neurotoxicity is vital for its continued use as a repellent and can provide information on the design of future insect repellents. Complete details of DEET neurotoxicity through toxicokinetic assays, biochemical assays, and electrophysiologic al recordings are presented in C hapter 4. Objective 4: The fourth objective of my dissertation was to determine the activity of our novel carbamate inhibitors to nuisance biting mosquito vectors and agricultural pests. Accounting for mosquito resistance toward insecticides is vital when devel oping mosquitocides for disease control. The onset of insecticide resitance can be dramatically delayed through the development of chemcals with low toxicity to agricultural pests due to limited selection pressure within breeding sites. The undocumented insect selectivity of our no vel carbamates is presented in C hapter 5.

PAGE 40

40 Fig ure 1 1. Two commonly used carbamates (A, B) and organophosphates (C, D) for controlling disease carrying mosquito vectors and other insect pests. Coumaphos oxon is shown as it i s the active form of the chemical. Figure 1 2. Displays structures of two synthetic pyrethroids (A, type 1 and B, type 2) and the structure of DDT (C).

PAGE 41

41 Figure 1 3. Diagram of AgAChE gorge showing some of the relevant amino acid residues ( Tc AChE numbering) at the peripheral ( W279 C286, W431), anionic site (W84), and catalytic acyl sites (S 200 )

PAGE 42

42 Figure 1 4 Highly selective and species sensitive carbamate molecules designed for use on Anopheles gambiae and referred to in this study. IUPAC names of the experimental compounds are: 3 ( t butyl)phenyl methylcarbamate (Terbam, Knockbal, TBPMC, PRC 331), 3 (ethyldimethylsilyl)phenyl methylcarbamate (PRC 337), 3 (trimethylsilyl) phenyl methylcarbamate (PRC 387), 3 (ethyldimethylsilyl)phenyl methylcarbamate (PRC 388), 2 (2methylbutylthio)phen yl methylcarbamate (PRC 407), 2 (2ethylbutylthio)phenyl methylcarbamate (PRC 408), and 2 (2 ethylbutoxy)phenyl methylcarbamate (PRC 421). In C hapter 3 of the dissertation, these compoiunds are numbered with bold Arabic numerals instead of PRC designation s.

PAGE 43

43 Figure 1 5 Non selective experimental carbamate, PRC 521. IUPAC name: 3 ( sec butyl )phenyl methylcarbamate. Table 1 1. Effects of N methylcarbamate insecticides on An. gambiae and human AChE activity (Anderson et al., 2008). An. gambiae AChE Human AChE Inhibitor IC 50 nM; (95% CI) Hill slope r 2 IC 50 nM; (95% CI) Hill slope r 2 MS* Propoxur 371 (320 421) 0.94 0.99 1710 (1420 2060) 1.31 0.99 5 PRC 331 3 (2 4) 0.50 0.99 265 (240 293) 0.98 0.99 88 PRC 337 124 (117 132) 0.84 0.99 9551 (7695 11850) 0.97 0.98 77 PRC 387 6 (3 9) 0.71 0.96 532 (375 756) 0.81 0.97 89 PRC 407 30 (25 36) 0.77 0.99 3543 (3152 3904) 0.95 0.99 118 PRC 408 3 (2 4) 0.86 0.98 3627 (3182 4134) 1.06 0.99 1204 PRC 421 276 (245 302) 0.96 0.99 98820 (89110 109600) 1.52 0.98 358 PRC 521 9 (7 12) 0.59 0.99 12 (8 16) 0.77 0.99 1.3 *Mosquito Selectivity = IC 50 of Human AChE / IC 50 of mosquito AChE

PAGE 44

44 CHAPTER 2 REDUCED POTENCY OF INSECT SELECTIVE CARBAMATES MEDIATED BY ALLOSTERIC DMSO STABILIZATION OF ANOPHELES GAMBIAE ACETYLCHOLINESTERASE: IMPLICATIONS FOR HIGH THROUGHPUT SCREENING OF INSECTICIDES Abstract : The increasing prevalence of pyrethroid resistant mosquitoes within malaria endemic regions has amplified the need for development of effective and selective mosquitocides for use in disease control programs Towards this end we have explored the selectivity of a series of substituted phenyl methylcarbamates for inhibition of An gambiae ( Ag) acetylcholinesterase ( Ag AChE) over human AChE ( h AChE). Initially, inhibition of these compounds was studied using a fixed ratio of solvent to inhibitor concentration, whereby the final DMSO concentration varied from 0.1% to 0.00000001%. Interestingly, s creening of several carbamates in the presence of const ant 0.1% DMSO ( v/v ) indicated reduced inhibition of Ag AChE compared to the variable % DMSO method, but no reduction of inhibition was observed with h AChE. For several compounds, this phenomenon resulted in a reduction of the observed h AChE/ Ag AChE selectivity ratio by at least 10 fold. Commercial car bamates propoxur and bendiocarb displayed no solvent dependent antagonism of inhibition toward Ag AChE or h AChE. The selectivity of novel carbamates and the antagonistic effects observed are potentially explained through amino acid variability within the insect and human AChE proteins, producing var ying degrees of flexibility. Molecular modeling suggest s the DMSO molecule is capable of reducing the flexibility of the Ag protein and limiting access of th e carbamates to the catalytic acyl site of Ag AChE. Therefore, it is vital to account for interactions between the solvent and protein/ligand during the development of high throughput screening methods especially for these insecticides Disclaimer: This study was a continuation of my thesis project (Swale, 2009) performed at Virginia Tech. The thesis was published with single IC 50 values whereas this document contains mean (n=3) IC 50 values in T able 2 1 along with different analysis of inhibition values

PAGE 45

45 and H ill slope values. At the University of Florida enzyme kinetic (eg. ki K m and V max ) and time course inhibition studies were performed to expound on the previous findings publish ed in Swale (2009). Figures 2 2 and 2 4 were first shown in the th esis and are also included here for completeness. 2.1 Introduction The need for novel insecticides for disease control is increasing rapidly due to the development of insecticide resistance within mosquito species and the banning of longstanding commercial com pounds (Zaim and Guillet, 2002). However, it is becoming increasingly difficult to commercialize new insecticides due to cost of production, strict environmental regulations, and increasing regulatory procedures within the development process. To increas e the possibility of discovering novel compounds, there has been an ongoing transition from whole organism testing towards in vitro and/or in silico high throughput screens (HTS) for insecticide discovery (Tietjen et al., 2005). The success of HTS is cont ingent on a number of factors including, but not limited to, quality of the chemical library, the type of assay used, and the solvent effect on proteins during the assay (Tjernberg et al., 2006). Standardization of the HTS process, including the solvents used, has expedited screening and decreased response variability of chemical libraries (Ridley et al., 1998). Dimethyl sulfoxide (DMSO) is a simple amphipathic molecule and is the primary solvent used for solubilization of chemical libraries for HTS due to its good dissolving ability, low chemical reactivity, and low vapor pressure (Tjernberg et al., 2006). Since DMSO has become the accepted solvent for the screening of chemical libraries, research has been performed on the stability and decreased potenc y of inhibitors dissolved in DMSO during freeze/thaw cycles, prolonged storage, or due to water absorption (Cheng et al., 2003; Kozikowski et al., 2003). Previous studies have also analyzed the effect DMSO has toward enzyme systems and has been shown to a ct as a stabilizer

PAGE 46

46 (Rajendran et al., 1995), denaturant ( Kovrigin and Potekhin, 1968 ; Jacobson and Turner, 1980 ; Bhattacharjya and Balaram, 1997 ), inhibitor (Perlman and Wolff, 1968; Johannesson et al., 1997 ; Kleifield et al., 2000;), or an activator (Ramm ler, 1967). However, experiments studying the effect of DMSO on proteins have been predominantly performed at DMSO concentrations of 10% 70% (Tjernberg et al., 2006), greatly exceeding the commonly used concentrations of 0.1% 5% DMSO during HTS (Tjernbe rg et al., 2006). Acetylcholinesterase (AChE: EC 3.1.1.7) is a serine hydrolase necessary for breakdown of the neurotransmitter acetylcholine (Ach) in both human and insect central nervous systems ( ; Radic and Taylor, 2008 ). Inhibition of t his enzyme prevents termination of nerve signalling, producing hyperexci tation, convulsions, and death ( O A plethora of commercial insecticides target AChE, but these inhibitors modify a ubiquitous catalytic serine residue, limiting the sele ctivity of currently available compounds ( Gibney et al ., 1990 ; Radic and Taylor, 2008 ). This poor selectivity against human AChE reduces the utility of anticholinesterases for use in close proximity to humans, and raises concern for their domiciliary use in disease control programs targeting the malaria mosquito, An gambiae Although sequence identity between the catalytic triad of human and Ag ace 1 (the gene responsible for encoding Ag AChE) is high, residue variability within the acyl pocket and peripheral site potentially allow for the development of selective anticholinesterases (Carlier et al., 2008). Work in our laboratory has identified several substituted phenyl methylcarbamates that possess high selectivity (>100 fold) for the malaria vector Ag AChE over h AChE (Carlier et al., 2008). Experimental carbamates were originally screened with one protocol, and selection of solvent was based upon the chemical evidence of high compound solubility typically in ethanol or methanol. However, the selectivity ratios observed previously (Carlier et al., 2008) became

PAGE 47

47 un replicable when our experimental procedures were standardized to have a constant percentage (0.1%, v/v ) of dimethyl sulfoxid e (DMSO) throughout the experimental concentrations of the inhibitor. This discrepancy in results led to numerous experiments to characterize the mechanisms involved and a potential explanation for the apparent solvent dependent antagonism of inhibition s een with Ag AChE. The objective of this investigation was to determine the effects of DMSO on carbamate inhibition and whether these solvent effects can mask selectivity of novel insecticides through solvent dependent antagonism of inhibition during in vi tro assays. Implications of these studies for the high throughput screening of insecticides are discussed within. 2.2 Materials and Methods 2.2.1 Inhibitors, S olvents, and A ssay R eagents Standard and commercial carbamates, along with t heir IUPAC names, are given in F igure 2 1. Propoxur (99% purity) and bendiocarb (99% purity) were purchased from Sigma Aldrich (St. Louis, MO, USA), and experime ntal carbamates (Figure 2 1) were prepared as described in Carlier et al., 2008 (Carlier et al., 2008). All experimental co mpounds were purified by column chromatography and/or re crystallization and are >95% pure by 1 H NMR analysis. Ellman assay (Ellman et al., 1961) reagents are composed of a cetylthiocholine iodide (ATCh)( 99% purity), dithiobis (2 nitro)benzoic acid (DTNB)(99% purity), and sodium phosphate buffer, all of which were purchased from Sigma Aldrich (St. Louis, MO, USA). Molecular sieve OP type 3 were purchased from Sigma (St. Louis, MO, USA) and were used to prevent water absorption within the DMSO stoc k. Fifty beads were added into a 100 mL stock solution. These sieves

PAGE 48

48 2.2.2 Enzymes Three enzymes were used in this study: adult An gambiae homogenate (wild type G3 strain, c ultured in the Department of Entomology and Nematology Emerging Pathogens Institute, Gainesville, FL, USA), CBL ( Ag AChE recombinant enzyme from Creative BioLabs, Shirley, NY, USA ), and recombinant h AChE (lyophilized powder, Sigma C1682, St. Louis, MO, USA). Homogenate enzymes were prepared from groups of ten non blood fed adult female mosquitoes homogenized in 1 mL of ice cold sodium phosphate buffer (0.1 M sodium phosphate, pH 7.8,) with an electri c motor driven glass tissue homogenizer. The homogenate was centrifuged at 5000 x g using a Sorvall Fresco refrigerated centrifuge at 4 C for 5 minutes. The supernatant was used as the enzyme source for the assay, and all enzyme preparations contained 0 .3 % ( v/v ) Triton X 100 and 1 mg/ml BSA. The CBL enzyme (recombinant Ag AChE / ace 1) consisted of the catalytic domain sequence D1 P540. It was designed and expressed in soluble form using the baculoviral insect cell expression system by Creative Bio Labs (CBL, division of Creative Dynamics Inc., Port Jefferson Station, NY, USA). The expression vector pFASTBac and Sf9 insect cells were used. The full length precursor protein is Swiss Prot code ACES_ANOGA with the corresponding numbering is D162 D701. From infection of 1 liter of insect cell culture, soluble rAg AChE (ace 1) was expressed and purified up to 90% (0.25 mg yield), first with an anion exchange Q column, followed by a Ni 2+ NTA gravity column. Prior to use in assay, CBL was diluted 300 fold with phosphate buffered Triton x 100 and h AChE was diluted 500 fold with phosphate buffered Triton x 100 2.2.3 Inhibitor Preparation Protocols Three protocols were utilized to determine the inherent effects of solvent on IC 50 and Hill slopes for AChE inhibit ion. Protocol A was 100 fold dilution of a 0.1 M stock solution (DMSO) of inhibitor, suspended into phosphate buffer at pH 7.8. Serial dilutions in 10 fold steps were

PAGE 49

49 then performed in buffer providing a constant ratio of inhibitor to solvent. Final inh ibitor concentration range was 10 4 M to 10 11 M, with the DMSO content being 0.1% ( v/v ) at the highest inhibitor concentration used, and declining in 10 fold steps. Protocol B was identical to protocol A with the only exception being the starting stock c oncentration is 10 mM versus 0.1 M. Protocol C entailed dilution of 0.1 M stock solution of inhibitor dissolved with DMSO. Ten fold serial dilutions of the stock inhibitor w as then performed in solvent to give a range of DMSO stock solutions that were th en further diluted into 0.1 M sodium phosphate buffer. A constant final 0.1% ( v/v ) DMSO was therefore present throughout the experiment, so that the inhibitor concentration was the only variable in the experiment. 2.2.4 Enzyme Inhibition Assays The Ellman assay (Ellman et al., 1961) was used with slight modifications from Carlier et al. (2008) to determine the bimolecular rate constant ( k i ). Enzyme solution (10 L) was added to each well of the 96 well micro assay plate along with 20 L of dissolved compou nd and 150 L of ice cold phosphate buffer. The plate was incubated at 25C for six minutes at one minute intervals. Ellman assay reagents ATCh (0.4 mM, final concentration) and DTNB ( 0.3 mM, final concentration) were prepared fresh and 20 L was added t o the enzyme to initiate the reaction. Changes in absorbance were recorded by a DYNEX Triad spectrophotometer (DYNEX Technologies, Chantilly, VA, USA) at 405 nm. Samples were analyzed at concentrations bracketing the IC 50 using a three minute time point to ensure linearity, and contained 0.1% DMSO ( v/v ) or 10 5 % DMSO ( v/v ). Experiments were performed at 10 5 % DMSO ( v/v ) due to previously determined experimental evidence of insignificant influence of the DMSO molecule on the Ag AChE protein. Bendiocarb was used in place of propoxur due to higher potency against Ag AChE.

PAGE 50

50 2.2.4.1 k i determinations The k i results were analyzed via the two step method (Bar On et al., 2002; Copeland, 2005) with the use of GraphPad Prism TM 4.0c (GraphPad Software, San Diego, CA, USA). A linear regression was first performed (x axis: incubation time; y axis: V/V o where V = velocity after incubation time, T and V o = initial enzyme reaction velocity) on five pre determined concentrations, based upon the IC 50 value of the inhibitor. The natural log of the previously determined V/V o ratio was then plotted against incubation time to determine k (obs) values. The k (obs) values were then plotted against the inhibitor concentration, and analyzed by an additional linear regression. The slope of this regression line corresponds to the k i of the carbamoylation reaction (Bar On et al., 2002; Copeland, 2005). 2.2.4.2 V max and K m determinations Methods for V max and K m determinations were nearly identical as previously explained in section 2.4a. However, seven separate ATCh concentrations were used versus the fixed concentration described above. Experiments were performed with 0.1% DMSO ( v/v ) and no DMSO in the same 9 6 well microassay plate to allow for simultaneous reading and reduced variability. Buffer was used in place of DMSO in the experiments when no DMSO was used. Change in absorbance was analyzed with identical instrumentation as previously described. Sampl es were analyzed using the 3.67 min time point to ensure linearity using Prism TM (GraphPad Software, San Diego, CA, USA) with the use of the Michelis Menten equation to determine K m and V max : V o = V max [S] / K m + [S]; whereby, V o and V max are the initial a nd final enzyme velocity, respectively, and [S] designates the substrate concentration. 2.2.4.3 IC 50 determinations Inhibition of AChE by solvent or carbamates was determined using the Ellman assay (Ellman et al., 1961) and was based on the method outlined in Ca rlier et al., 2008. Identical

PAGE 51

51 instrumentation was used as described in section 2.4a and 2.4b. Enzyme concentrations used were within the linear range, therefore eliminating the need for protein quantification. Solutions were prepared with DMSO diluted i nto sodium phosphate buffer (pH = 7.8) to create final concentrations ranging from 10% to 10 7 % DMSO. The percent activity remaining for each concentration was determined by the formula: (average optical density per concentration / control optical density ) x 100. IC 50 values for each species were calculated by nonlinear regression from eight inhibitor concentrations using Prism TM (GraphPad Software, San Diego, CA, USA). The nonlinear regression equation used was as follows: Y = bottom + (Top Bottom) / (1 + 10 ^((LogEC 50 x)*Hillslope)); where x = the logarithm of the concentration and Y = the response. Y starts at the top (normalized 100%) and approaches the bottom (0%) with a sigmoid shape. The time course experiments were also performed with the use of the Ellman assay (1961). The enzyme was incubated with the inhibitor for a total of 60 minutes with readings taken at ten minute intervals, allowing for six data points per assay versus one ten minute incubation. The results were analyzed identi cally to those explained above. The midpoint for the DMSO dependent antagonism of inhibition of Ag AChE was determined with the method for Protocol C. DMSO concentrations were held constant at concentrations ranging from 0.00001% to 1%. CBL enzyme was uti lized for this experiment due to consistency of results, when compared to Ag homogenate enzyme. Mean IC 50 values were calculated from three replicate IC 50 values determined at each DMSO concentration, as described above.

PAGE 52

52 2.2.5 Statistical A nalyses The IC 50 an d Hill slope values for carbamates run under each protocol were averaged (n=3) and compared by a one GraphPad InStat TM (GraphPad Software, San Diego, CA, USA). The DMSO effect on catalytic param eters of the substrate, ATCh, was determined by calculating the percent residual activity using the formula: (concentration OD value / control OD value)*100. The mean (n = 3) percent residual activity was compared with a one comparison test (Figure 2 2). The average (n=3) bimolecular rate constants were statistically analyzed using unpaired t tests with significance being represented by P < 0.05. The average (n=5) V max and K m data were statistically analyzed through the use of a paired t test (df = 4) with significance represented by P < 0.05. Statistical analyses were performed using InStat TM (GraphPad Software, San Diego, CA, USA). 2.2.6 Molecular Homology Models The homology models of DMSO and AChE were previously published in the M. S. thesis of Daniel Swale (Swale, 2009), but are also shown in this dissertation for completeness. Homology models were generated by Dr. Dawn Wong (Virginia Tech Entomology) and through our collaborations with Drs. Max Totrov and Polo Lam at Molso ft ICM. A computationally refined homology model of Ag AChE was generated using Molsoft ICM (Abagyan et al., 1994). The X ray structure of mouse AChE (mAChE, PDB 1D 1N5R) was used as a template for the Ag AChE catalytic subunit (D1 P540). The flexible per ipheral site loop of Dm AChE was used as a template for initial modeling of the corresponding loop region of Ag AChE. Loop templates were extracted from the PDB and allowed us to further model the loop of Ag AChE, followed by Monte Carlo sampling of the side chains, and energy minimization of the backbone. The RMSD

PAGE 53

53 value of the backbone carbon atoms between the refined Ag AChE model and the m AChE template is 0.40 angstroms for 495 matches (Carlier et al., 2008 ). 2.3 Results 2.3.1 DMSO Dependent Antagonism of Carbamate Inhibition in AgAChE and hAChE Protocols A and B resulted in similar IC 50 values for Ag homogenate and Ag AChE recombinant enzyme (CBL), as shown in Table 2 1. The largest difference between Protocols A and B for Ag homogenate was a 4 fold increase in IC 50 (PRC 388), and there was a 6 fold increase in IC 50 (PRC 331) on CBL. Table 2 1 also shows that in the presence of constant 0.1% DMSO (Protocol C) resulte d in a substantial decrease in inhibition potency of mosquito enzymes for the experimental carbamates (PRC 331, PRC 337, PRC 387, PRC 388, PRC 408, and PRC 421). The increased IC 50 values ranged from a 5 fold increase (PRC 421) to a 43 fold increase (PRC 388) with Ag homogenate. Similarly, less potent IC 50 values were observed for CBL, and ranged from a 3 fold increase (PRC 337) to a 28 fold increase (PRC 331). However, the commercial carbamates propoxur and bendiocarb displayed little difference betwee n the three protocols. From Protocols A to C, Ag homogenate displayed a mere 1.2 fold increase in IC 50 value for propoxur, and a 1.4 fold increase in IC 50 value for bendiocarb. CBL displayed no significant statistical difference between IC 50 values for p ropoxur, and bendiocarb displayed only a 1.4 fold increase in IC 50 (Table 2 1). Similarly, a non selective experimental carbamate (PRC 521) displayed a 1.7 fold increase in IC 50 value from Protocol A to Protocol C on Ag homogenate (Table 2 1), a small i ncrease relative to selective carbamates. CBL was found to be the most sensitive of the two Ag AChE enzymes studied to standard and experimental carbamates, regardless of protocol. Propoxur and bendiocarb were 3.7 fold and 3 fold more potent, respectivel y, in all protocols to CBL when compared to Ag AChE homogenate. In general, experimental carbamates were found to be 2 4 fold more potent to CBL

PAGE 54

54 when compared to Ag AChE homogenate. The largest difference in potency between the two Ag AChE enzymes was 10 fo ld and was observed with protocol A and PRC 331. A plot of the decreased potency observed with PRC 331 across treatment protocols A C versus little change in potency with propoxur against the C BL enzyme is shown in Figure 2 3. Contrary to Ag AChE patte rns of inhibition, h AChE yielded at most a 1.3 fold increase in IC 50 value with experimental carbamates (PRC 337) in the presence o f constant 0.1 % DMSO (Table 2 1). The decreased potency of experimental carbamates toward Ag AChE with Pr otocol C, and the l ack of effect on h AChE produced drastically low er selectivity ratios (Table 2 2). Hill slope values of the concentration response curves were also shown to vary according to solvent concentration, selectivity properties of the inhibitor, and AChE enzyme (Figure 2 2). For An. gambiae homogenate, the commercial insecticides displayed little to no statistical increase in Hill slope values across protocols A C. Bendiocarb displayed a 20% increase in Hill slope from protocol A to protocol C and a 10% increa se was observed for PRC 521 (Table 2 1). However, statistically significant increases in Hill slope values were observed with experimental carbamates, as PRC 331 displayed a 30% fold increase and PRC 388 displayed a 80% increase from proto col A to protoco l C (Table 2 1). The CBL enzyme displayed results similar to those of the Ag homogenate data, with the Hill slopes of bendiocarb and propoxur slightly increasing (1.1 fold), whereas Hill slopes for the selective carbamates increased up to 80% (PRC 331) b e tween protocol A to C (Table 2 1). Similar to the inhibition potency data, no statistically significant increase in Hill slope values among the three protocols was observed with any class of carb amates for human AChE (Table 2 1). We observed a highly statistically significant (P<0.0001) 3 fold increase in the bimolecular rate constant ( k i ) for PRC 331 inhibiting Ag AChE when exposed to constant 0.1%

PAGE 55

55 DMSO, compared to constant 10 5 % DMSO. However, this effect was not observed with the commercial carbam ate, bendiocarb (10% increase, P = 0.31). Similarly, h AChE displayed no significant increase in k i for PRC 331 and bendiocarb. This pattern of results is nearly identical to those found with the IC 50 results displayed in section 3.1 (Table 2 3). 2.3.2 Time Cou rse of Inhibition Comparison Increasing the incubation time of Ag AChE and inhibitor decreased the IC 50 value for all inhibitors stud i ed over all protocols (T able 2 4). The least and greatest difference between ten and sixty minute incubations was with PRC 331 using protocol A (128 fold) and PRC 408 using protocol B (1.7 fold), respectively. Commercial inhibitors had little difference in fold change between ten and sixty minutes as all protocols ranged from 2.7 fold to 4.9 fold, a difference of 1.8 fold. F or commercial carbamates, maximum inhibition was reached with an incubation time of 40 minutes for all three protocls. However, PRC 331 displayed a steady increase in potency with increasing incubation time for protocols A and C. With protocol C, we obse rved nearly a two fold increase in inhi bi tion with 60 minutes over 30 minutes. Enzyme inhibition with PRC inhibition until 50 minutes with protocol C. This finding likely in dicates a slower delivery of experimental carbamates to the catalytic site with protocol C when compared to protocol A. However, this is not the case for commercial carbamates as the increase in potency was uniform throughout the three protocols. 2.3.3 Concentr ation D ependence of DMSO effects When the Ag AChE enzyme kinetics without DMSO is compared to 0.1% DMSO, the V max had a small, but statistically significant (P = 0.001) 17% increase in V max of 0.058 moles min 1 to 0.068 moles min 1 The K m value also dis played a statistically significant increase (P = 0.01) of 87.4 M to 133.2 M when Ag AChE was exposed to 0.1% DMSO, a 52% increase. As

PAGE 56

56 shown in Figure 2 2A, Ag homogenate showed inhibition at 10% DMSO, an increase in activity at 1% DMSO, and essentially n o change in activity at 0.1% DMSO. CBL enzyme activity followed a similar pattern of DMSO dependent effects (Figure 2 2A). h AChE displayed strong inhibition at 10% DMSO, about half inhibition at 1% DMSO, and a smaller decreas e in activity at 0.1% DMSO (F igure 2 2A). This data wa s shown in Swale (2009). PRC 331 and the Ag recombinant enzyme (CBL) w as used to determine the midpoint of DMSO dependent antagonis m of inhibition by PRC 331 (Figure 2 2B). The midpoint for DMSO antagonism of IC 50 v alue was determined to be 35.2 M (95% CI: 19.5 M to 63.8 M; Hill slope = 1.7; r 2 = 0.96), or 0.00025% DMSO. DMSO had substantial antagonistic effects on inhibition at 0. 128 M (1% DMSO) to 128 M (10 3 % DMSO), and assays performed at 0.1% DMSO ( v/v ) co ntain 1 2. 8 mM DMSO (Figure 2 2B), where the effect was maximal. This data wa s shown in Swale (2009). 2.4 Discussion Within HTS screens, DMSO concentrations usually range from 0.1% ( v/v ) to 5% ( v/v ), depending on the solubility, required inhibitor concentrati on range, assay type, and sensitivity of the enzyme to DMSO (Tjernberg et al., 2006). Many researchers perform in vitro assays or HTS screens at solvent concentrations that do not affect the enzyme through denaturation or inhibition (Tjernberg et al., 200 6). However, these amounts of DMSO may be problematic for some effects, as we demonstrated a solvent dependent antagonism of Ag AChE inhibition at levels (0.1% DMSO), reflected in higher values for both IC 50 and k i However, we observed little to no statistically significant decrease of inhibition for h AChE. The increase in Ag AChE IC 50 s and lack of effect on h AChE IC 50 s reduced the previously determined selectivity ratios of the experimental carbamates (Carlier et al., 2008). This apparent reduction of selectivity due to

PAGE 57

57 solvent interactions has implications for high throughput screening of chemical libraries, as it alludes to the possibility of excluding from further development, compounds that are affected by so lvent interactions. Two standard carbamates (propoxur and bendiocarb) were tested on both Ag AChE enzymes and resulted in little or no statistical difference for inhibition among the three protocols. Thus, the presence of DMSO has no effect on enzyme inhib ition when these two carbamates are used. The structural conformations of these carbamates allow them to react with the catalytic acyl site despite the presence of DMSO. A non selective experimental carbamate (PRC 521, 3 sec butyl) also resulted in littl e (1.7 fold increase from Protocols A to C) statistical difference between the three protocols, indicating that the structural specificity for selective inhibition and its DMSO sensitivity are quite precise, when compared to its tert butyl analog PRC331 (T able 2 1). Therefore, it is reasonable to suggest that the mechanism mediating selectivity is also involved in the observed effects of DMSO. While high concentrations of DMSO affected substrate kinetics, DMSO at 0.1% had little to no direct effect on th e catalytic act ivity of the enzymes (Figure 2 2A). Although Km is affected at 0.1% DMSO, inhibition assays are run at 0.5 mM substrate, where the reaction is zero order. These data suggest that the experimental concentration of 0.1% DMSO, which affected carbamate induced inhibition, has minimal influence on the catalytic activity of the substrate ATCh by enzyme, whether Ag AChE or h AChE. Thus, pre screening the enzyme for DMSO effects under the usual conditions of the Ellman assay would reveal nothing unu sual in the behavior of DMSO under typical assay conditions Variability in Hill slope values among protocols presents an interesting aspect of DMSO dependent effects within the catalytic gorge of Ag AChE Hill slope values approach unity for

PAGE 58

58 potent, monov alent inh ib itors (Shoichet, 2006; Table 2 1), but increased DMSO concentration increased IC 50 values and Hill slopes for experimental carbamates progressing from protocol A C. Variability of Hill slopes between protocols is difficult to rationalize based on an inhibitor solubility mechanism. Incomplete solubility will decrease the concentration of active ingredient rendering it less potent, yet reduced levels of DMSO gave the most potent IC 50 values. The low Hill slopes observed with protocol A in both A g AChE enzymes ga ve the appearance of a two site binding model, indicating that Ag AChE possesses multiple enzyme conformers, likely due to enzyme flexibility. The near unity Hill slopes for Protocol C suggest DMSO mediated allosteric stabilization of the A ChE enzyme increases the time spent within a single, lower affinity conformation. Obviously there is no DMSO present in commercial formulations of anticholinesterase insecticides, so a multiple site/conformational state interaction, in vivo may actually occur, at least in the case of Ag AchE. Comparison of h AChE and Ag AChE sequences show several differences, primarily within the acyl pocket and the peripheral site, suggesting the potential for development of selective anticholinesterases (Carlier et al., 2008). Molecular homology model s have been generated (Figure 2 4) and suggest alternate conformations of W84 and W431 ( Ag numbering) within the hydrophobic subpocket of Ag AChE, giving the Ag enzyme a high degree of flexibility (Figure 2 4). Presumably, this flexibility would be able to accommodate appropriately branched, ortho or meta substituted alkanes, via rotation of W84. Alternate conformations of the corresponding residues in h AChE are not easily obtained due to the presence of Y449 ( h ) versus D441 in Ag AChE. Homology models of h AChE reveal the presence of hydrogen bonds between Y449 and the indole nitrogens of W86 and W439 (human numbering), and are shown in Figure 2 4. This interaction prevents flexibility within the hydrophobic sub pocket of h AChE, rendering

PAGE 59

59 the gorge less accommodating to branched alkane carbamates. Sequence comparisons reveal D441 of Ag AChE is analogous to Y449 of the human. Due to the smaller size of D441 when compared to Y449, it is probable to suggest D441 is too distal to produce hydrogen bonds with W84 and W431, as seen in h AChE. The inability to form hydrogen bonds between D441 and W84 and W431 would pr ovid e flexibility within the hydrophobic subpocket of Ag AChE, potentially producing the high selectivity r atios of Ag AChE over h AChE. To conclude, t he unexpected antagonism of inhibition by DMSO described in this research is potentially explained through the flexibility of W84 and W431 ( Ag numbering). The size and molecular orientation of DMSO allows for an interaction between a DMSO molecule and the indole nitrogens of W84 and W431 that produces hydrogen bonds with D441 within Ag AChE (Figure 2 4). Hydrogen bonding of these substituents produces an Ag AChE enzyme structure similar to that of h AChE and result s in a loss of flexibility of the Ag AChE hydrophobic subpocket, producing a less accommodating enzyme for the selective carbamates. Thus, the stabilization of the Ag AChE enzyme through the presence of 0.1% DMSO ( v/v ) is potentially responsible for the sol vent dependent antagonism of inhibition seen with our Ag AChE selective carbamates and the Hill slope data suggest that the inhibition of antagonism is due to allosteric stabilization and not to direct competition with the insecticide for its binding site.

PAGE 60

60 Structure Name Chemical Name Structure Name Chemical Name Propoxur 2 isopropoxyphenyl methylcarbamate PRC 388 3 (ethyldimethylsilyl)phenyl methylcarbamate Bendiocarb 2,2 dimethylbenzo (1,3) dioxol 4 yl methylcarbamate PRC 408 2 ((2 ethylbutyl)thio)phenyl methylcarbamate PRC 331 3 (tert butyl)phenyl methylcarbamate PRC 421 2 (2 ethylbutoxy)phenyl methylcarbamate PRC 337 2 ((2 methylallyl)thio)phenyl methylcarbamate PRC 521 3 sec butylphenyl methylcarbamate Figure 2 1. Structure name and chemical name of standard and experimental carbamate insecticides utilized in this study.

PAGE 61

61 Ta ble 2 1 IC 50 values for An. gambiae homogenate, CBL, and human AChE enzymes exposed to DMSO. Numbers represent mean (n=3) IC 50 values followed by 95% confidence limits in parentheses. Lowercase letters after 95% CI values represent statistical significance for IC 50 values among protocols A C. Uppercase letters after the SEM represent statistical significance for Hill slope values among protocols A C. Values for each inhibitor not labeled by the same letter represent statistical significance across treatment protocols A C at P < 0.05. Ag AChE (Homogenate) Protocol A Protocol B Protocol C Inhibitor IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 Ratio (C/A) Propoxur 450 (423 479)a 0.7 (0.02)A 367 (320 422)b 0.71 (0.04)A 445 (267 623)a 0.92 (0.01)B 0.98 Bendiocarb 156 (138 176)a 0.75 (0.03)A 150 (139 161)a 0.74 (0.01)A 172 (80 264)a 0.9 (0.02)B 1.1 PRC 331 10 (8 13)a 0.36 (0.02)A 33 (29 37)b 0.81 (0.02)B 104 (80 128)c 0.91 (0.02)C 10.4 PRC 337 156 (121 184)a 0.45 (0.03)A 166 (122 206)a 0.83 (0.02)B 476 (356 596))c 1.0 (0.05)C 3.1 PRC 388 4 (2 7)a 0.41 (0.05)A 15 (9 21)b 0.8 (0.02)B 221 (116 325)c 0.87 (0.03)B 55.2 PRC 408 12 (8 16)a 0.43 (0.01)A 22 (16 27)a 0.8 (0.05)B 106 (85 128)a 1.1 (0.07)C 8.8 PRC 421 79 (51 112)a 0.41 (0.02)A 129 (98 149)a 0.74 (0.02)B 431 (254 607)b 0.91 (0.08)B 5.4 PRC 521 9 (7 11)a 0.52 (0.05)A 13 (10 16)a 0.84 (0.02)B 16 (15 19)b 0.91 (0.02)B 1.8

PAGE 62

62 Ta ble 2 1. Continued Ag AChE (CBL; recombinant) Protocol A Protocol B Protocol C Inhibitor IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 Ratio (C/A) Propoxur 121 (104 140)a 1.1 (0.07)A 99 (91 109)a 1.1 (0.06)A 132 (123 142)a 1.3 (0.03)A 1.1 Bendiocarb 50 (47 53)a 1.2 (0.06)A 48 (45 51)a 1.1 (0.09)A 63 (61 65)b 1.3 (0.03)A 1.3 PRC 331 1 (0.7 1.5)a 0.4 (0.02)A 8 (5 11)b 0.82 (0.02)B 28 (25 31)c 1.1 (0.07)B 28 PRC 337 68 (60 77)a 0.85 (0.03)A 108 (96 118)b 1.0 (0.1)B 169 (148 170)c 1.2 (0.03)B 2.5 PRC 388 12 (10 14)a 0.53 (0.02)A 16 (13 21)a 0.76 (0.03)A 47 (44 49)b 1.2 (0.12)B 4 PRC 408 6 (4 9)a 0.5 (0.03)A 19 (16 23)b 0.78 (0.03)B 62 (59 65)c 1.1 (0.07)C 10.3 PRC 421 31 (26 37)a 0.51 (0.01)A 59 (49 71)b 0.76 (0.03)A 188 (178 199)c 1.2 (0.1)B 6

PAGE 63

63 Ta ble 2 1. Continued Human AChE Protocol A Protocol B Protocol C Inhibitor IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 nM; (95% CI) Hill Slope (SEM) IC 50 Ratio (C/A) Propoxur 1524 (1250 1850)a 1.0 (0.04)A 1320 (1200 1560)a 1.1 (0.1)A 1442 (2430 3131)a 1.02 (0.09)A 0.93 PRC 331 250 (208 301)a 1.1 (0.07)A 147 (128 170)a 1.0 (0.08)A 233 (154 311)a 0.94 (0.03)A 0.59 PRC 337 6126 (5437 6902)a 1.0 (0.04)A 8075 (7501 8692)b 1.0 (0.04)A 8035 (7743 8327)b 1.1 (0.06)A 1.2 PRC 388 427 (389 468)a 0.88 (0.02)A 447 (392 509)a 0.82 (0.05)A 451 (431 470)a 1.0 (0.09)A 1.1 PRC 408 5064 (4649 5518)a 1.1 (0.08)A 5148 (4374 6059)a 1.1 (0.07)A 5127 (4871 5383)a 0.97 (0.05)A 1.03 PRC 421 107,000 (96,540 118,600)a 0.84 (0.02)A 130,800 (32,460 326,000)a 0.77 (0.03)A 112,600 (72,489 152,711)a 1.1 (0.07)B 1.05

PAGE 64

64 Table 2 2. Representation of reduced mosquito selectivity due to increased IC 50 within Ag AChE under the presence of constant 0.1% DMSO ( v/v ), Protocol C. IC 50 values are expressed as mean (n=3). Ag AChE a Human AChE a Ag AChE b Human AChE b Inhibitor IC 50 nM; (95% CI) IC 50 nM; (95% CI) MS* IC 50 nM; (95% CI) IC 50 nM; (95% CI) MS* Propoxur 450 (423 479) 1524 (1250 1850) 3.4 445 (267 623) 1442 (2430 3131) 3.2 PRC 331 10 (8 13) 250 (208 301) 25 104 (80 128) 233 (154 311) 2.2 PRC 337 156 (121 184) 6126 (5437 6902) 39 476 (356 596) 8035 (7743 8327 16 PRC 388 4 (2 7) 427 (389 468) 106 221 (116 325) 451(431 470) 2 PRC 408 12 (8 16) 5064 (4649 5518) 422 106 (85 128) 5127 (4871 5383) 48 PRC 421 79 (51 112) 107000 (96540 118600) 1354 431 (24 607) 112600 (72489 152711) 261 *Mosquito Selectivity (MS) = IC 50 of Human AChE / IC 50 of mosquito AChE a Data set 1 was performed by preparing inhibitors following Protocol A b Data set 2 was performed using Protocol C with constant 0.1% DMSO as a solvent.

PAGE 65

65 Table 2 3. Average (n=3) bimolecular rate constant determinations for PRC 331 and bendiocarb on Ag AChE and h AChE. Values are k i (95% CI) Denotes statistical significance at P < 0.05. k i units = mM 1 /min 1 Ag AChE homogenate h AChE 0.1% DMSO 10 5 % DMSO P Value 0.1% DMSO 10 5 % DMSO P Value Bendiocarb 975 (559 1389) 1116 (796 1436) 0.31 114 (52 175) 130 (73 186) 0.47 PRC331 1600 (1074 2176) 4587 (4260 4912) < 0.0001* 541 (330 750) 703 (501 904) 0.75

PAGE 66

66 Table 2 4. Average (n=3) IC 50 values of two commercial and two experimental carbamates over a 60 minute incubation time period with Anopheles gambiae homogenate Protocol A Protocol B Protocol C Propoxur IC 50 (nM; 95% CI) IC 50 (nM; 95% CI) IC 50 (nM; 95% CI) 10 min 257 (215 307) 289 (246 328) 312 (278 342) 20 min 134 (107 177) 172 (143 307) 226 (171 245) 30 min 92 (82 100) 121 (99 148) 148 (121 162) 40 min 61 (54 79) 98 (77 112) 104 (88 116) 50 min 55 (948 64) 93 (72 103) 96 (81 109) 60 min 51 (46 57) 101 (91 112) 99 (84 108) Bendiocarb 10 min 108 (101 114) 146 (117 168) 152 (118 195) 20 min 64 (56 74) 82 (66 109) 90 (78 103) 30 min 52 (47 58) 68 (58 76) 74 (67 83) 40 min 38 (35 -42) 56 (44 68) 63 (55 72) 50 min 38 (33 44) 58 (48 69) 58 (52 67) 60 min 37 (33 42) 53 (47 58) 56 (50 64) PRC 331 10 min 10 (7 13) 43 (34 56) 101 (94 109) 20 min 2 (1 4) 33 (26 43) 83 (76 90) 30 min 0.5 (0.2 0.7) 37 (29 46) 64 (59 69) 40 min 0.2 (0.1 0.4) 29 (23 35) 46 (43 48) 50 min 0.13 (0.06 0.2) 17 (14 20 44 (38 51) 60 min 0.08 (0.04 0.1) 26 (17 39) 32 (28 37) PRC 408 10 min 37 (22 51) 59 (43 80) 238 (198 272) 20 min 24 (11 31) 68 (50 92) 89 (75 105) 30 min 18 (7 26) 47 (34 64) 91 (74 112) 40 min 9 (2 17) 51 (43 61) 65 (57 73) 50 min 11 (4 21) 51 (42 62) 49 (43 56) 60 min 6 (4 15) 35 (29 42) 49 (43 55)

PAGE 67

67 Figure 2 2. Influence of DMSO on AChE catalytic (A) and inhibitor (B) activity. In A, bars represent average (n = 3) percent activity remaining with error bars representing S.E.M. Bars not labeled by the same letter within each enzyme species represents statistical significance at P < 0.05. For B, EC 50 of DMSO effect on PRC331 dependent inhibition of recombinant Ag AChE (CBL) is shown. Symbols represent mean IC 50 (n = 3) with S.E.M. bars (Swale, 2009). A B

PAGE 68

68 Figure 2 3. Comparison of dose response curves for protocols A C with PRC 331 and Propoxur with CBL enzyme. Error bars are not shown to prevent cluttering of curves but were found to be less than 5% residual AChE activity.

PAGE 69

69 Figure 2 4. Homology models of h AChE (green ribbons) and Ag AChE (red and blue ribbons) and orient from N to C terminus. A) Monte Carlo refined Ag AChE homology model that displays selected residues found within Ag AChE hydrophobic subpocket and are shown as CPK colored ball and stick model, with white carbon atoms. Alternate conformation of W431 ( Ag) is caused by the binding of a selective ligand an d is displayed as black lines. Blue to red ribbon represents N to C terminus. B) Overlay of h AChE and Ag AChE. Grey dashes represent hydrogen bonding between Y449 ( h) and W86/W439 ( h ). C) Top view of Ag AChE with DMSO molecule bound hydrophobic subpocket. Bridged hydrogen bonding is shown between the DMSO oxygen and W84 ( Ag )/W431 ( Ag) with interatomic distances in . Bound DMSO molecule, rendered as ball and stick model with pale yellow carbon atoms, is closely flanked by two methi onines, M83( Ag ) and M438( Ag ), and several other side chains (Swale, 2009). A C 441 ( Ag ) 3.4 3.6 B

PAGE 70

70 CHAPTER 3 INHIBITOR PROFILE OF RHIPICEPHALUS (BOOPHILUS) MICROPLUS AND PHLEBOTOMUS PAPATASI ACETYLCHOLINESTERASE AND THE IDENTIFICATION OF POTENT N METHYLCARBAMATES FOR THE CONTROL OF THEIR RESPECTIVE VECTORED DISEASES Abstract : The cattle tick, Rhipicephalus (Boophilus) microplus ( Bm ), and the sand fly, Phlebotomus papatasi (Pp), are disease vectors to cattle and humans, respectively. The purpose of this study was to characterize the inhib itor profile of acetylcholinesterases from Bm ( Bm AChE1) and Pp ( Pp AchE) compared to human and bovine AChE, in order to identify divergent pharmacology that might lead to selective inhibitors. Results indicate that Bm AChE has low sensitivity (IC 50 = 200 M ) toward tacrine, a monovalent CS inhibitor with mid nanomolar blocking potency in all previous species tested. Similarly, a series of bis (n) tacrine dimer s, bivalent inhibitors and peripheral site AChE inhibitors possess poor potency toward Bm AChE. Molecular homology models suggest the r Bm AChE enzyme possesses a W384F paralogous substitution near the catalytic site, where the larger tryptophan side chain obstructs the access of larger ligands to the active site. This finding suggests a unique AChE g orge structure in Bm AChE, a phenomenon that can further support the possibility for design of selective inhibitors. In addition, Bm AChE1 and Pp AChE have low nanomolar sensitivity to a variety of experimental carbamate anticholinesterases that we originall y designed for control of the malaria mosquito, An gambiae One experimental compound, 2 ((2 ethylbutyl)thio)phenyl methylcarbamate, possesses >300 fold selectivity for Bm AChE1 and Pp AChE over human AChE, and a mouse oral LD 50 of >1500 mg/kg, thus provid ing an excellent new lead for vector control. 3.1 Introduction Utilization of insecticides for disease vector control remains the most effective component of the integrated vector management approach for the control of vector borne

PAGE 71

71 diseases (Hemingway and Rans on, 2000). The cattle tick, Rhipicephalus ( Boophilus) microplus (Canestrini; Bm ), is a potentially deadly pest of cattle since it is a prima ry vector for babesiosis and anaplasmosis (Graham and Hourrigan, 1977 ) Economic losses are furthered substantiall y as normal feeding behavior of tick infestations lead to reduction in milk production and weight gain, as well as overall declines in cattle health (Jonsson et al., 1998). Similarly, the sandfly, Pp is a primary vector of numerous zoonotic diseases sign ificant to human health, including leishmaniases and bartonellosis (Desjeux, 2001). Control programs of these two disease vectors rely largely on the use of insecticides. For control of the cattle tick, the USDA implemented the Cattle Fever Tick Eradicat ion Program ( CFTEP ) which mandates a quarantine zone, dipping of all imported cattle into organophosphate (eg. coumaphos) solutions, and a 7 14 day quarantine period (Graham and Hourrigan, 1977; Miller et al., 2005 ; Maroli and Lane, 1991). Similarly, san dfly control is largely based on insecticides through the use of indoor residual spraying with pyrethroids and organophospha tes (Morsy et al., 1993), and the use of insecticide treated bednets is a successful and sustainable method for malaria control and has been evaluated for control of Phlebotomine sandflies (Maroli and Lane, 1991; Falcao et al., 1991 ; Mutinga et al., 1992; Morsy et al., 1993 ; Alexander et al., 1995 ). Although these control methods have been effective in reducing Boophilus and Phlebotomus populations, control has become increasingly difficult due to escalating insecticide resistance among wild populations ( Roulston et al., 1968 ; Jamroz et al., 2000 ; Miller et al ., 2005; Surendran et al., 2005 ). O rganophosphate insecticides, suc h as coumaphos, are inhibitors of AChE (EC 3.1.1.7), a serine hydrolase responsible for terminating nerve signals at the synapses of cholinergic systems within the central nervous system of invertebrat es, leading to death 1967 ). Organophosphate and pyrethroid resistance has been attributed to both

PAGE 72

72 metabolic and target site mechanisms, with the later being the prim ary reason for organophosphate resistance ( Schuntner et al., 1968 ; Li et a., 2003; Rosario Cruz et al., 2004; Surendran er al., 2005; M organ et al., 2009). Organophosphate insensitive AChE might provide cross resistance to insecticides with similar mode of action, such as carbamates. Modification of current compounds can provide increased invertebrate/vertebrate selectivity ratios along side the potential for development of res istance mitigating compounds. The three dimensional crystal structures of AChE from Tc Dm and mouse (among others) are av ailable, and provide insights to structure function relationships for numerous inhibitors (S ussman et al., 1991; Taylor et al., 1991; Bourne et al., 1999; Harel et al., 2000). Pharmacological and structural analyses of AChE have revealed that AChE contains two binding sites for inhibitors: one at the catalytic site ( CS ) and one near the entrance to the catalytic gorge, the PS. The CS is located about 4 from the base of the gorge and consists of S 200, H 440, E 327, and W 84 ( Tc numbering), the later serving to bind the trimethylammonium group of acetylcholine (Harel et al., 1993). In turn, th e PS is located toward the mouth of the gorge and consists of W279, Y70, D72, H287 ( Tc numbering) (Harel et al., 1993; Szegletes et al., 1999; Radic et al., 2006; Mallender et al., 2000). The PS has been shown to briefly bind substrates en route to the CS thereby increasing catalytic efficiency (Szegletes et al., 1999). Using differences in CS geometry between Ag AChE and human AChE ( h AChE), we have developed highly selective anticholinesterase mosquitocides (ie: carbamates) having mosquito selectivity of up to 500 fold (Carlier et al., 2008). Simultaneous occupancy of these two sites through the design of bivalent inhibitors should facilitate the mitigation of AChE target site resistance, since resistance to this type of compound would require the develo pment of multiple mutations in the protein while retaining sufficient functionality.

PAGE 73

73 The objective of the present investigation was two fold. First, we characterized the inhibitor profile of aceylcholinesterases from r Bm AChE1 and Pp AChE compared to human and bovine AChE, in order to identify divergent pharmacology that might lead to selective inhibitors. Secondly, we show evidence of highly potent and selective experimental carbamate inhibitors that can assist in the control of Bm and Pp populations. 3.2 M ethods 3.2.1 Inhibitors, Solvents, and Assay Reagents Aldrich (St. Louis, MO, USA) Experimental carbama tes (Figure 3 1) were prepared as described in Carlier et al. (2008). All experimental compounds were purified by column chromatography and/or re crystallization and are >95% pure by 1 H NMR analysis. All experimental inhibitors used in th is study are shown in F igure 3 1 and the structures of all other inhibitors are found in the literature Bis (n) tacrine dimers (n = 2, 3, 4, 5, 6, 7, 8, 9, 10, and 12 methylenes) were synthesized and purified to > 95% using established procedures (Carlier et al., 1999 ) and provided by the Carlier laboratory, Department of Chemistry, Virgina Tech, for this work all purchased from Sigma Aldrich (St. L ouis, MO, USA). Ellman assay (Ellman et al., 1961) reagents are composed of ATCh ( 99% purity), DTNB (99% purity), and sodium phosphate buffer, all of which were purchased from Sigma Aldrich (St. Louis, MO, USA). Molecular sieve OP type 3 beads were pu rchased from Sigma (St. Louis, MO, USA) and were used to prevent water absorption within the DMSO stock.

PAGE 74

74 3.2.2 Molecular Homology Modeling Molecular homology models were constructed through collaborations with Drs. Maxim Totrov and Polo Lam at Molsoft L.L.C. ( LaJolla, CA). Homology model s of the Bm AChE1 were constructed in ICM (ICM Manual Molsoft 2011). X ray structure from the Protein Databank (PDB ID 1ACJ the complex of Torpedo Californica AChE with tacrine) was used as a template. Side chain refinement was performed in ICM using Biased Probability Monte Carlo (BPMC) global optimization procedure (Abagyan and Totrov 1994). 3.2.3 Enzyme Preparations Recombinant enzymes were provided by Drs. Kevin Temeyer and Beto Perez de Leon at the USDA ARS in Kerrville, TX. Recombinant constructs of R. (B.) microplus Bm AChE1 were produced as p reviously described (Temeyer et al., 2010) except that baculovirus supernatants containing rBmAChE1 were produced in sf21 insect cell culture grown in Gibco Sf SFM (serum fre e medium, Life Technologies, Carlsbad, CA). Site directed mutagenesis was utilized to convert the codon for Trp384 to Phe384 (W384F) in cDNA of BmAChE1 (Deutch #5, wt) previously cloned into the baculoviral transfer plasmid pBlueBac4.5/B5 His TOPO (Life Technologies) as previously described (Temeyer et al., submitted) phosphorylated PCR primers Bm AChE1 1203U29X (C TTCTTCTTGCAATACTTCTT CGGATTTC ) and Bm AChE1 1181L22 (GAACCTTCGTTTGCGTTAGAAC) were utilized (25 cycles, 66 C annealing temp, 4 min extension at 72 C) with the Phusion Site Directed Mutagenesis Kit (Thermo Fisher Scientific, Pittsburg, PA) to perform targeted mutagenesis following the instructions of the manufacturer. The mutagenized plasmid was transformed into E. coli TOP10 ch emically competent cells, sequence verified, and cotransfected with Bac N Blue DNA into Sf21 insect cells as previously described. Baculovirus cultures were produced in sf21 cells

PAGE 75

75 grown in Gibco Sf d from all expression cultures to verify construction and expression of the intended coding sequences. Six enzymes were utilized in this study: r Bm AChE1, mutated r Bm AChE1 (W384F), r Pp AChE, h AChE, bovine brain homogenate, and Ag AChE homogenate. Ag AChE and bovine brain homogenate enzyme was prepared from groups of ten whole non blood fed adult female mosquitoes or 5 mg (wet weight) of excised bovine brain tissue. Bovine tissue collection was via a local slaughterhouse, and approved by the University of Flo rida IACUC. Each tissue was homogenized in 1 mL of ice cold sodium phosphate buffer (0.1 M, pH 7.8) containing 0.3% Triton x 100, with an electric motor driven glass tissue homogenizer. The homogenate was centrifuged at 5000 x g using a Sorvall Fresco re frigerated centrifuge, at 4 C for 5 minutes. The supernatant was used as the enzyme source for the assay. Prior to use in assay, r Bm AChE1 and Pp AChE were diluted 10x and h AChE was diluted 100x with the aforementioned buffer + Triton mixture. 3.2.4 Enzyme Inh ibition Assays IC 50 values were determined using slight modifications from Ell man et al. (1961) as outlined in Hartsel et al. (2012 ). Briefly, ten L of enzyme solution was added to each well of a 96 well micro assay plate, along with 20 L of dissolved compound and 150 L of ice cold phosphate buffer. The assay plate was incubated at 25C for ten minutes. Ellman assay reagents, ATCh (0.4 mM, final conc.) and DTNB (0.3 mM, final conc.), were prepared fresh and 20 L was added to the enzyme to initiate t he reaction. Changes in absorbance were recorded by a DYNEX Triad spectrophotometer (DYNEX Technologies, Chantilly, VA, USA) at 405 nm. Six inhibitor concentrations were used in triplicate to construct concentration response curves. Inhibitors were prep ared using DMSO and contained a final concentration of 0.1% DMSO ( v/v )

PAGE 76

76 throughout each inhibitor concentration. Enzyme concentrations used were within the linear range of activity, therefore eliminating the need for protein quantification. 3.2.5 Statistical A nalyses Individual IC 50 values were calculated using nonlinear regression with GraphPad Prism TM (GraphPad Software, San Diego, CA, USA). All experiments yielded acceptable Hill slope (>0.8) and r 2 50 values are expressed as mean of n=3 values. Mean IC 50 values and 95% confidence limits were determined with GraphPad InStat TM (GraphPad Software, San Diego, CA, USA). The mean IC 50 values were statistically analyzed using an unpaired t test (two tail) a nd Tukeys post test with significance being represented by P < 0.05. Statistical analyses were performed using InStat TM (GraphPad Software, San Diego, CA, USA). Selectivity ratios of enzymes were determined by the equation: vertebrate IC 50 / invertebrate IC 50 3.3 Results 3.3.1 Potency of AChE I nhibitors in A rthropods The majority of compounds used for enzyme characterization act at the CS of AChE. Coumaphos oxon is a potent anticholinesterase against r Bm AChE (Table 3 1), but is 43 fold less effective against r Pp AChE (Table 3 1). Commercial carbamate insecticides (propoxur, bendiocarb, carbaryl, and bendiocarb) are highly potent inhibitors of both r Bm AChE1 and r Pp AChE (Table 3 1). For both r Bm AChE and r Pp AChE, the most active carbamate was carbofuran, whereas in the tick propoxur was the least active and for the sandfly it was carbaryl. Although commercial carbamates yielded fairly similar inhibition potencies for r Pp AChE and r Bm AChE, experimental carbamates possessed varying potencies ag ainst the two enzymes (Table 3 1). For r Bm AChE1, experimental carbamates possess a range of approximately 25 fold, with 6 and 3 being the most and least potent inhibitor, respectfully. Compound 1 is the most potent experimental carbamate with a meta positioned side chain by approximately 5 to

PAGE 77

77 10 fold, compared to 2 and 3 respectively. Compound 6 displayed the greatest potency for experimental inhibitors studied with an ortho positioned side chain. For r Pp AChE, experimental inhibitors displayed a r ange of 18 fold with 1 and 7 being the most and least potent inhibitors, respect ively The meta substituted compounds were of similar high potency, with compound 6 the only ortho carbamate of similar activity. This compound was also equipotent to both r B m AChE1 and r Pp AChE (Table 3 1). r Bm AChE1 was found to have low sensitivity (IC 50 = 220 M) toward tacrine, a monovalent CS inhibitor with mid nanomolar blocking potency in all previous species tested, including r Pp AChE. Eserine, a natural product CS chol inesterase inhibitor, was the most potent compound tested in this study, and possessed potencies toward r Bm AChE1 and r Pp AChE differi ng by a factor of six (Table 3 1). The high potency of this carbamate may be attributable to its basic nitrogen functionali ty; protonation at assay pH confers a positive charge and greater attraction to the choline binding site. Edrophonium, a reversible CS inhibitor, was considerably less potent than the carbamates (low micromolar range), and displayed similar mean IC 50 values in the low micromolar range against r Bm AChE1 r Pp AChE. The two peripheral site inhibitors studied (tubocurarine and ethidium) displayed poor inhibition of r Bm AChE1, but typical levels of inhibitory activity to r Pp AChE. Tubocurarine inhibited no mor e than 15% of enzyme activity at 10 3 M with r Bm AChE1, and was over 25 fold more active against r Pp AChE (Table 3 1). Ethidium was more active than tubocurarine in both species, and showed 5 fold greater potency for r Pp AChE than r Bm AChE. Bivalent AChE inhi bitors spanning both the CS and PS binding domains possessed reduced inhibition potency toward r Bm AChE1 and high potency toward r Pp AChE (Table 3 1). BW284c51 was active at the low micromolar level on r Bm AChE1, and was found to have 424 fold greater activi ty against r Pp AChE (Table 3 1) E2020 (donepezil) displayed approximately three percent inhibition at 100 M, and was therefore considered to be inactive on r Bm AChE1.

PAGE 78

78 However, E2020 was a potent inhibitor of r Pp AChE, as it was found to have an IC 50 value of ca. 100 nM (Table 3 1). To further understand the inhibitor profile of r Bm AChE1 and r Pp AChE, the enzymes were also studied using bis (n) tacrine dimer series as structural probes to measure the distance between the CS and PS (Table 3 2). r Pp AChE was f ound to be more sensitive to the entire tacrine dimer series when compared to r Bm AChE1. Comparing IC 50 values across r Bm AChE1 and r Pp AChE, the differences in potency ranged from 297 fold for bis (8) tacrine to 1493 fold for bis (10) tacrine (Table 3 2) For r Bm AChE1, the most potent tacrine dimer was found to be bis (8 ) tacrine and the least potent was found to be bis (2) tacrine However, a different pattern of inhibition for r Pp AChE produced less than a 2.5 fold difference between bis (7) tacrine through bis (12) tacrine with the IC 50 values ranging from 2 5 nanomolar (Table 3 2). 3.3.2 Potency of AChE I nhibitors in M ammals The two mammalian AChE enzymes studied, human and bovine, displayed similar inhibition potencies to CS directed compounds, with the large st potency difference being ca. 10 f old to coumaphos oxon (Table 3 1). Commercial carbamate inhibitors also displayed little difference in potency values to the mammalian AChE enzymes with the largest difference being 1.9 fold (carbofuran). The most and least potent commercial CS inhibitors were found to be carbofuran and carbaryl, respectively, for both mammalian enzymes. Similarly, the experimental carbamates displayed little difference in IC 50 values. The largest difference was 3 fold ( 3 ) and potency ratios of most inhibitors neared unity. The most potent experimental carbamate for both enzymes was 1 ( meta substituted ) A 2.7 fold difference was observed in potency with eserine, the second most potent CS inhibitor, with h AChE more sensitive than bov ine AChE. Edrophonium was found to be a low micromolar inhibitor to both mammalian enzymes and h AChE was 1.6 fold more sensitive whe n compared to bovine (Table 3 1 ).

PAGE 79

79 Mammalian enzymes were also found to possess similar sensitivities to both peripheral s i te inhibitors studied (Table 3 1). The potency differences between the two species was 1.05 fold and 1.4 fold for tubocurarine and ethidium, respectfully. Ethidium was found to be more potent than tubocurarine to both enzymes by approximately 2 fold. Bivalent inhibitors, E2020 and BW284c51, were shown to be the most potent blockers of both mammalian enzymes, with IC 50 values in th e low nanomolar range (Table 3 1). E2020 was the most active inhibitor to both mammalian enzymes with nearly equipotent IC 50 values against h AChE and bovine AChE. Although 2 to 4 fold less potent than E2020, BW284c51 was still the second most potent bivalent inhibitor to the mammalian enzymes, with inhibition values differing by 2.1 fold across mammal species. 3.3.3 Inhibitor S electivity A cross M ammals and A rthropods SR values are used to express in vitro selectivity differences between mammalian and arthropo d enzymes, as shown in Table 3 1. For r Bm AChE1, the most selective standard carbamate was carbaryl for both human and bov ine enzymes. Otherwise, commercial carbamates were shown to have a large range of enzyme selectivity, varying from 8 to 174 fold for h AChE and 12 to 163 fold for bovine AChE. Edrophonium was found to be negatively selective for both the human and bovin e AChE enzymes, as they were more active on the mammalian enzymes when compared to r Bm AChE1. Eserine was found to be highly selective for r Bm AChE1 over bovine AChE (123 fold) and moderately selective over h AChE (46 fold). The SR of experimental carbamates for r Bm AChE1 were shown to be highly variable and ranged from 1 fold to 360 fold for h AChE and 4 fold to 338 fold for bovine AChE (Table 3 1) The most potent experimental inhibitor, 6 presented the largest SR (338 fold) for bovine AChE and was also fou nd to be very selective against h AChE with an SR of 342. The lowest SR observed of experimental carbamates for r Bm AChE1 and bovine and h AChE was 3 with SR values of 4

PAGE 80

80 fold and 1 fold, respectively. Coumaphos oxon was found to have SR of 104 fold and 11 fold for bovine and h AChE, respectively. The SR values for 6 are a 3.3 fold (bovine AChE) and 31 fold ( h AChE) increase over that of the currently us ed acaricide, coumaphos oxon. PS and bivalent inhibitors were both found to be negatively selective as they inhibited the mammalian enzyme with greater efficacy compared to r Bm AChE1. The h AChE selectivity (Table 3 1) of the experimental carbamates wit h Pp AChE was found to range from 23 fold ( 1 ) to 611 fold ( 7 ). Propoxur was found to be most selective commercial carbamate with an SR of 21 fold whereas 6 was found to have an SR of 366 fold, a 17 fold increase over propoxur. Edrophonium was found to be negatively selective for Pp AChE, whereas eserine was 7.6 fold selective, 3 fold less than the least selective experimental carbamate. PS inhibitors were both found to be poorly selective with SR values near unity. A ten fold difference in SR was observe d between the bivalent inhibitors with E2020 being negatively selective for Pp AChE and BW284c51 being non selective (SR = 1.1). 3.3.4 Homology M odeling and S ite D irected M utagenesis (W384F) of rBmAChE1 Homology models were constructred by Dr. Max Totrov. Hom ology model of the Bm AChE1 was constructed, and the percentage identity of the template and target sequence was 42%. The alignment contained 8 insertions/deletions. All but one of the indels were remote from the CS/PS, with a loop three residues shorter being on the outer rim of the PS (N336 V340). Overall backbone RMSD to the template was 1.35A. The catalytic and peripheral sites as well as the gorge were inspected and compared to X ray structures of the complexes of tacrine (PDB ID 1ACJ) and E2020 (PD B ID 1EVE). The model revealed the organization of the CS, gorge and PS that was overall similar to other species, but several distinctive features were observed. Firstly, AChE from other species typically has a phenylalanine or tyrosine residue in the p osition corresponding to W384. Review of the inhibitor complex structures revealed that

PAGE 81

81 the phenylalanine side chain is able to adopt alternative orientations, either enlarging the catalytic site so that tricyclic ligands such as tacrine can be accommodat ed, or expanding the gorge when bulkier moieties are present there, as is the case with E2020. On the other hand, larger W384 side chain in Bm AChE1 fills most of the space occupied by either of the phenylalanine conformers. Another significant difference observed is that generally highly conserved tryptophan residue in the PS (W286 in human enzyme) is substituted by T335. Inhibition potencies of AChE inhibitors to the r Bm AChE1 (W384F) mutant enzyme and a comparison to r Bm AChE1 are shown in T able 3 3. The mutated r Bm AChE1 (W384F) enzyme displayed a statistically significant increase in inhibition when compared to r Bm AChE1 wildtype with the inhibitors tacrine, BW284c51, and E2020. Tacrine and BW284c51 was found to be 6.4 fold and 8 fold more potent to the mutated enzyme (W384F) when compared to r Bm AChE1 wildtype. E2020 displayed a > 40 fold increase in potency to the mutated enzyme, but an exact value was not able to be determined due only 3% of the r Bm AChE1 wildtype enzyme being inhibited at 100 M. Prop oxur was the only standard or experimental AChE inhibitor to show a statistically significant increase (1.4 fold) in IC 50 value between the wildtype and mutant enzymes. The near unity ratios of commercial and experimental inhibitors indicate the mutation had no effect on the catalytic activity of the mutated enzyme when compared to the wildtype. 3.4 Discussion Rhipicephalus ( Boophilus) microplus and Phlebotomus papatasi are both of great concern due to their ability to vector diseases. Pp present significan t issues in numerous countries as it is the primary vector for zoonotic cutaneous leishmaniasis transmission to humans and has been the major cause of disease morbidity among United States military personnel (Desjeux, 2001; Pehoushek et al., 2004; Willard et al., 2005). Bm populations are of veterinary concern as they are a potentially deadly pest of cattle and induce large economic burdens on

PAGE 82

82 cattle farmers in southwestern United States and Mexico (Jonsson et al., 1998). Chemical insecticide s have been t he primary mechanism for control of both disease vectors throughout recent history. However, recent reports of insecticide resistance have amplified the need for the design of novel chemicals to control these vector populations (Rosario Cruz, 2005; Morgan et al, 2009; Hassan et al., 2012). To further the design of novel chemicals, an understanding of the target site protein is vital to determine protein structure and to the develo pment of inhibitor specificity. CS inhibitors were highly potent with IC 50 values extend ing into the low nanomolar range, indicating the W384/Y337 substitution has little bearing on the activity of smaller, monovalent molecules. The experimental methylcarbamates possessed side chains in the meta or ortho position s Compound 1 was found to be the most potent inhibitor with a meta substituted side chain. Inhibition potencies decreased 5 fold and 10 fold for 2 and 3 respectively, when compared to 1 This suggests the r Bm AChE1 enzyme is not capable of accommodating the larger tr imethylsilyl group, indicating the meta substituted side chains must be small er in size to effectively inhibit the enzyme. Ortho substituted phenyl methylcarbamates 4 7 were found to be highly potent to the r Bm AChE1 enzyme and were most potent with thiol substituted side chains. Compound 7 possesses a 2 ethylbutoxy substituted side chain and was less potent than all three thiol alkyl substituted side chains, indicating that its lipophilicity or polarizability may alter int eractions of the inhibitor at the r Bm AChE1 acyl site. A different inhibition pattern was observed with Pp AChE as it is more sensitive to meta substituted phenyl methylcarbamates 1 3 versus meta substituted phenyl methyl carbamates 4 5 and 7 One excepti on was found to be 6 as it was the second most potent experimental carbamate and was 6 fold more active than any other ortho substituted carbamate studied. The high potency of 6 to r Bm AChE1 and r Pp AChE is exceptional, as it is 7 fold more potent when

PAGE 83

83 compared to Ag AChE (IC 50 : 10 4 nM), the enzyme species it was designed to target (Jiang et al., submitted) The activated form of coumaphos, an anticholinesterase insecticide currently used in Bm control programs, possesses 100 fold selectivity for Bm AChE1 over bovine AChE and a mere 10 fold selectivity over h AChE. Although these selectivity values are higher than other anticholinesterases, 6 was shown to be equipotent (14 nM) to coumaphos oxon and posse ss 338 fold and 342 fold selectivity over bovine AChE and h AChE, respectively. Selectivity of experimental carbamates that possess ortho substituents was also excellent for r Bm AChE1 compared to the mammalian AChE enzymes This selectivity was abolished t o less than ten fold with meta substituted side chains due to a lower potency to r Bm AChE1, suggesting the design of future N methylcarbamates for Bm control should utilize ortho substitutions. Compound 6 was also found to be highly selective for Pp AChE ov er h AChE with a SR of 366 while standard carbamates were found to have SR of less than 20 fold for Pp AChE over h AChE This finding indicat es that the experimental carbamates are a viable control method for Pp populations in locations of close proximity t o humans, such as insecticide treated nets or indoor residual spraying. r Bm AChE1 was found to be over 1000 fold less sensitive to tacrine when compared to all other species studied, indicating a unique catalytic site in Bm AChE. Molecular homology model s indicate that there are two significant paralogous substitutions that inhibit ligand binding in Bm AChE1, W384/Y337 and T335/W286 ( Bm /human numbering) (Fig ure 3 2 ). Typically, phenylalanine or tyrosine is analogous to the W384 residue in Bm AChE1. In Tc F330 is analogous to W384 in the tick and is thought to possess two orientations to accommodate various ligands. These two orie ntations are shown in Figure 3 2. However, t he W384 residue in Bm AChE1 possesses a larger side chain than Y337 in h AChE (F330 in Tc AChE). The model

PAGE 84

84 suggests that steric clashes of the tryptophan side chain with bulky ligands in the CS (tacrine) or gorge (E2020) would be resolved by the re orientation of the tyrosine side chain in AChE of other species, but cannot be completely a voided with the W384 of Bm AChE1. This structural clash contributes to the significantly reduced affinity of these inhibitors, although the difference in potency for tacrine can be only partially accounted for by mutation W384F (Table 3 3). Presumably, the T335/W286 substitution also had a large contribution to the reduced potency of the tacrine dimer series. The monomeric tacrine was among the least active inhibitor in the series, with bis (8) tacrine being the most potent at an IC 50 value o f about 1 uM. The pattern of inhibition for r Bm AChE was similar to h AChE (Anderson et al., 2009), as the IC 50 decreased with increasing tether length to bis (8) tacrine, and then increased again as tether length neared 12 methylenes. The chicken enzyme is known to be missing Y70, Y121, and W270, three principal PS residues, and is therefore considered to be devoid of a PS (Eichler et al., 1994). Interestingly, r Bm AChE1 was found to be 16 fold (A9A) to 341 fold (A4A) less sensitive to the tacrine dimer ser ies when compared to chicken AChE (Mutunga, 2011), suggesting the T335/W286 substitution ( Bm /human numbering) potentially provides a blockade effect or steric hindrance that serves to prevent adequate binding of bivalent ligands to the CS and PS sites. Ho wever, it is unlikely that the peripheral site is absent in r Bm AChE1, as ethidium bromide inhibited the enzyme with nearly the same potency values seen in numerous other species. Additionally, the pattern of inhibition (increased potency with increasing t ether length to bis (8) tacrine, then decreasing potency) indicates the presence of dual binding. The r Pp AChE enzyme yielded a different response when compared to r Bm AChE1, Ag AChE and h AChE. The monomeric tacrine was found to be among the least potent of t he tacrine dimer series but was similar in potency to every species studied ( IC 50 ca. 200 nM), excluding Bm AChE. However, the pattern of inhibition was different than r Bm AChE1 as the

PAGE 85

85 IC 50 decreased with increasing tether length but did not increase again as the tether link neared 12 methylenes. Drosophila melanogaster AChE, an ace 2 encoding insect, has also been shown to have this pattern of inhibition to the tacrine dimer series (Mutunga, 2011). Insects utilizing the ace 2 g ene to encode the functional AChE unit may likely possess a different protein structure than ace 1 insects that is capable of accommodating larger tether lengths over shorter tethers. In an effort to validate the homology models, site directed mutagenesis was performed to study the effect the W384/Y337 substitution has on the inhibitor potency to the r Bm AChE1 enzyme. The mutation performed was a W384F mutation due to phenylalanine possessing a smaller structural size when compared to tryptophan, allowing a closer resemblance to tyrosine, which is found in the majority of other enzymes, including h AChE. Statistically significant increases in potency were observed with tacrine and the two bivalent inhibitors, BW284c51 and E2020. Although the increase in pot ency to the mutated enzyme with tacrine and bivalent inhibitors validates the model of W384 preventing access of larger ligands to the acyl site, it does not fully account for the decreased r Bm AChE1 sensitivity, as the W384F mutation did not decrease the I C 50 values to that observed in other species. One would expect an additional 172 fold increase in potency for tacrine if the mutation accounted for all of the decreased inhibitor potency. Therefore, it is plausible to suggest other paralogous substituti ons are present in conjunction with W384/Y337 ( Bm /human numbering), allowing for a unique Bm AChE1 gorge geometry and therefore, a constricted entry to the acyl site. For instance, molecular homology models suggest the T335/W286 ( Bm /human numbering) substi tution in the Bm peripheral site could account for a reduced sensitivity to peripheral site and bivalent inhibitors. The T335/W286 substitution in r Bm AChE1 could potentially disrupt the transient binding mechanism

PAGE 86

86 of the PS (Szegletes et al., 1999) and ef fectively reduce the potency of acyl site inhibitors through allosteric effects at the CS. To conclude, the findings of the current study have significant implications for the future design of selective and resistance mitigating inhibitors for the control of vectored diseases. The non selective inhibitor, tacrine, yielded a 1000 fold difference in the inhibition profile for Bm AChE1 over Pp AChE. This indicates a unique AChE gorge geometry drastically different than that of Pp AChE and all other enzyme speci es studied. Interestingly, despite the structural differences of Bm AChE1, the highly selective experimental carbamate 6 is nearly equipotent toward Bm AChE1 and Pp AChE and is more potent toward these two enzyme species than Ag AChE, the species it was designed to target. The high potency toward Bm AChE1 and Pp AChE in conjunction with the low mammalian activity provides an attractive alternative and superior insecticide for Bm and Pp control.

PAGE 87

87 Fi gure 3 1. Structures of expe rimental methylcarbamate inhibitors used in this study.

PAGE 88

88 Table 3 1. IC 50 values of AChE inhibitors with enzymes utilized in this study. IC 50 values are expressed in nM and are shown as means (n = 3). Selectivity ratios (SR) are expressed as follows: SR 1 = Bovine AChE IC 50 / r Bm AChE1 IC 50 ; SR 2 = h AChE IC 50 / r Bm AChE1 IC 50 ; SR 3 = h AChE IC 50 / r Pp AChE1 IC 50 r Bm AChE1 r Pp AChE h AChE Bovine AChE IC 50 nM (95% CI) IC 50 nM (95% CI) IC 50 nM (95% CI) IC 50 nM (95% CI) SR 1 SR 2 SR 3 Coumaphos oxon 10 (2 17) 430 (349 511) 111 (103 121) 1,038 (875 1201) 104 11 0.26 Propoxur 33 (20 46) 89 (50 126 1,442 (2430 3131) 1,835 (1289 2381) 55 43 21 Carbofuran 5 (3 8) 8 (2 14) 38 (30 45) 73 (48 98) 15 8 5 Carbaryl 16 (5 27) 167 (126 208) 2,780 (2430 3131) 2,605 (2343 2868) 163 174 17 Bendiocarb 16 (7 24) 15 (14 16) 182 (113 250) 195 (173 216) 12 11 12 Eserine 1.5 (0.5 2.5) 9 (4 14) 69 (54 84) 185 (145 224) 123 46 7.6 Edrophonium 2,425 (1941 2910) 1,178 (584 1771) 1,081 (7774 1387) 1,799 (1506 2091) 0.74 0.45 0.92 BW284C51 12,723 (12,423 13,024) 30 (20 39) 33 (18 46) 16 (11 21) 0.001 0.003 1.1 Tacrine 220,766 (171,378 270,155) 205 (168 240) 213 (122 304) 187 (143 229) 0.001 0.001 1.04 E2020 3 % inhibition at 10 4 M 92 (69 114) 7 (3 10) 9 (4 13) <0.001 <0.001 0.08 Tubocurarine 15 % inhibition at 10 3 M 38,890 (31034 46746) 57,606 (48625 66588) 54,396 (49236 59558) <0.05 <0.06 1.5 Ethidium Bromide 77,710 (68,349 87,071) 14,136 (9391 18882) 22,886 (14600 31174) 323,43 (26316 38371) 0.42 0.3 1.6 1 37 (18 62) 10 (4 16) 233 (154 311) 259 (242 277) 7 6 23 2 190 (150 230) 22 (13 30) 539 (484 593) 1,053 (896 12210) 5 3 25 3 364 (256 337) 16 (8 24) 451 (431 470) 1,357 (1284 1430) 4 1 28 4 25 (10 39) 150 (90 209) 8,035 (7743 8327) 6,366 (6027 6704) 255 321 54 5 77 (56 96) 100 (73 126) 10,906 (10451 11362) 8,955 (6055 12810) 116 142 109 6 15 (3 26) 14 (11 15) 5,127 (4871 5383) 5,073 (4772 5373) 338 342 366 7 312 (256 366 184 (137 229) 112,600 (72,489 152,711) 92,016 (85,035 98,998) 295 360 611

PAGE 89

89 Table 3 2. Tacrine and tacrine dimer inhibition of tick and sandfly AChE. Compound r Bm AChE1 Pp AChE IC 50 (nM; 95% CI) IC 50 (nM; 95% CI) Tacrine 220,766 (171,378 270,155) 205 (168 240) bis (2) tacrine 190,095 (162,000 217,828) 151 (132 166) bis (3) tacrine 131,917 (119840 156,091) 139 (100 161) bis (4) tacrine 45,740 (33,582 56,442) 103 (87 128) bis (5) tacrine 11,748 (9,061 15,910) 25 (15 36) bis (6) tacrine 9,421 (6209 13017) 9 (5 15) bis (7) tacrine 2919 (2198 3675) 5 (2 8) bis (8) tacrine 892 (510 1109) 3 (0.5 6) bis (9) tacrine 2046 (1495 2583) 3 (0.5 5) bis (10) tacrine 2986 (2687 3384) 2 (0.3 5) bis (12) tacrine 4126 (3368 4892) 3 (0.6 6)

PAGE 90

90 Table 3 3. IC 50 values of AChE inhibitors with the mutated r Bm AChE1 (W384F) enzyme compared to r Bm AChE1 wildtype. IC 50 values are expressed in nanomolar units and are shown as means (n = 3 ). Asterisks represent statistical significance at P < 0.05 when compared to the wild type enzyme values (Table 3 1). r Bm W384F AChE1 r Bm AChE1 IC 50 / W384F IC 50 Inhibitor IC 50 (nM; 95% CI) Ratio Coumaphos oxon 9 (3 15) 1.1 Propoxur 47 (36 57)* 0.7 Carbofuran 6 (3 10) 0.8 Bendiocarb 18 (10 25) 0.9 BW284C51 1570 (1481 1658)* 8.1 Tacrine 34,470 (28175 40765)* 6.4 E2020 2298 (1385 3211)* 43.5 1 53 (36 69) 0.7 6 23 (15 31) 0.7 7 256 (244 266) 1.2

PAGE 91

91 Figure 3 2. Superposition views of tacrine (A) and E2020 (B) complexes onto the model of Bm AChE1. F330 is shown to exist in two orientations: 1) conformation adopted in complex with tacrine is shown in magenta and 2) the conformation adopted in complex with E2020 is shown in green. Conserved W84 is shown at the bottom of the active site for orientation.

PAGE 92

92 CHAPTER 4 THE TOXICITY AND MODE OF ACTION OF N,N DIETHYL META TOLUAMIDE (DEET) ON THE NERVOUS SYSTEM Abstract : Recent studies have raised the possibility that N,N d iethyl 3 methylbenzamide ( DEET ) is an acetylcholinesterase (AChE) inhibitor and that this action may contribute to its effects in insects, and cause risk of toxicity in exposed human s. DEET causes disru pted posture and hyperexcitation that is distinct from the anticholinesterase propoxur, as well as lethal ity in mosquitoes at topical doses in the microgram range (2 4 g), but DEET is an extremely poor AChE inhibitor in mosquitoes (<10% inhibition), even at a concentration of 10 mM. Neurophysiological recordings were performed to determine the effect of DEET on the insect nervous system and compared to toluene and lidocaine, structurally related compouds with anesthetic actions DEET was found to have neuroexcitatory effects on the CNS in the micro molar range (EC 50 : 1 2 0 M), over 1000 fold less potent than p ropoxur. Phentolamine was found to completely block the CNS neuroexcitation of DEET and octopamine, but was not found to be an effective blocker o f propoxur. DEET and lidocaine blocked neuromuscular transmission in housefly larvae, as well as Na + and K + channels in rat cortical neurons. T aken together, the s e finding s suggest DEET is like ly targeting octopaminergic synap ses and not acetylcholinesterase to induce neuroexcitation and presumably toxicity. The ion channel blocking ation of DEET would be consistent with the numbness experienced after inadvertent application to the lips or mouth. 4.1 Introduction The insect repe llent DEET ( N,N diethyl 3 methylbenzamide) is used more often than any other mosquito repellent, with greater than 200 million people users worldwide (Moore and Debboun, 2007). T here is still much debate as to the mode of repellent action and molecular

PAGE 93

93 ta rgets of DEET. One argument suggests DEET blocks olfactory sensory neurons that detect attractants, such as carbon dioxide and 1 octen 3 ol ( Davis and Sokolove, 1976 ; Ditzen e t al., 2008; Dogan et al., 1999 ). O ther research has found that insects detect DEET through olfactory mechanisms that elicit avoidance behavior ( Carroll et al., 2005 ; Syed and Leal, 2008 ). There is experimental evidence for both mechanisms potentially indicating that DEET does not affect one specific molecular target but can provide repellency through multiple modes of action. An understanding of the molecular mode of action for both repellency and toxicity is essentia l for the development of novel repellents and for continued control of vector borne diseases. Althou gh the molecular mode of action of repellency by DEET remains elusive there has been interest in the toxicological profile of DEET sinc e it has been shown to have insecticidal properties (Moss, 1996; Licciardi et al., 2006). Moss (1996) also speculated, based on comparisons of synergism effects of DEET, amitraz and chlordimeform, that DEET may have some toxic actions similar to those of formamidine pesticides. Large oral doses of DEET (blood concentration of 1 mmol/litre) have been shown to lead to nause a, vomiting, bradychardia, and seizures in humans (Ellenhorn, 1997). Documentation also exists of DEET being potentially toxic to humans when combined with pesticides ( Lipscomb et al., 1992 ; Clem et al., 1993) and recent literature suggests the toxic act ion is due to anticholinesterase properties (Corbel et al., 2009). The majority of human exposure to DEET is through contact exposure, therefore limiting the applic ability of toxicity data via oral exposure. Contact exposure of DEET also has the potenti al for negative effects to humans as exposure can lead to numbness and redness of the affected area ( Reuveni and Yagupsky 1982). The numbing sensation is similar to those observed with local anesthetics, such as lidocaine, raising the question if DEET i s acting on

PAGE 94

94 specific ion channels to yield an anesthetic like effect versus possessing anticholinesterase properties. The objective of this study was to determine the mode of action of DEET neurotoxicity and compare its action to known anticholinesterases local anesthetics and octopaminergic chemicals with the goal of providing insights into the specific targets of DEET with respect to the acute toxicity. 4.2 Materials and Methods 4.2.1 Inhibitors, S olvents, and A ssay R eagents The inhibitors DEET ( N,N diethyl 3 methylbenzamide ), lidocaine, toluene, cesium, and propoxur were all purchased from Sigma Structures of these i n hibitors are shown in F igure 4 1. The solvent, dimethyl sulfoxide (DMSO) was also p urchased from Sigma Aldrich (St. Louis, MO, USA). Molecular sieve OP type 3 w as purchased from Sigma (St. Louis, MO, USA) and were used to prevent water absorption within the DMSO stock. Fifty beads were added into a 100 mL stock solution. These sieves Ellman assay (Ellman et al., 1961) reagents are composed of acetylthiocholine iodide (ATCh)( dithiobis (2 nitro)benzoic acid (DTNB)(99% purity), and sodium phosphate buffer, all of which were purchased from Sigma Aldrich (St. Louis, MO, USA). Molecular sieve OP type 3 w as purchased from Sigma (St. Louis, MO, USA) and were used to prevent water absorption within the DMSO stock. Fifty beads were added into a 100 mL stock solution. These 4.2.2 Enzyme Sources, Insects, and Neuronal Cells In vitro biochemical assays utilized five acetylcholinesterase enzymes: A n. gambi ae homogenate ( Ag AChE; wild type G3 strain, cultured in the Emerging Pathogens Institute, University of

PAGE 95

95 Florida, Gainesville, FL, USA from egg s provided by the Center for Disease Control, Atlanta, GA, USA ) Ae aegypti ( Aa AChE; cultured in the CMAVE, USDA ARS, Gainesville, FL, USA) Musca domestica ( Md AChE; cultured in Department of Entomology and Nematology Medical Entomology Laboratory, University of Florida, Gainesville, FL, USA) and Drosophila melanogaster ( Dm AChE; Oregon R strain, cultu red in the Eme rging Pathogens Institute, University of Florida, Gainesville, FL, USA) and recombinant human ( h AChE; lyophilized powder, Sigma C1682, St. Louis, MO, USA). Homogenate enzymes were prepared from groups of ten non blood fed adult female mosquitoes (or five whole bodied Drosophila three Musca heads) homogenized in 1 mL of ice cold sodium phosphate buffer (0 .1 M sodium phosphate, pH 7.8,) with an electric motor driven glass tissue homogenizer. The homogenate was centrifuged at 5000 x g using a Sorvall Fresco refrigerated centrifuge at 4 C for 5 minutes. The supernatant was used as the enzyme source for the assay, and all enzyme preparations contained 0.3 % ( v/v ) triton X 100 and 1 mg/ml BSA. Prior to use in assay, the recombinant human enzyme was diluted 500 fold into sodium phosphate buffer containing triton X 100 and 1 mg/ml BSA. Insects used for in vivo toxicity assays were obtained from sources listed above. In addition, An. gambiae (AKRON strain) was cultured at the University of F lorida Emerging Pathogens Institute, Gainesville, FL, USA from eggs supplied from stocks maintained at the Center for Dis ease Control (Atlanta, GA, USA). Rat neuronal cortex cells w ere purchased from Invitrogen (Grand Island, NY, USA), plated on 35 mm glass cover slips, and maintained in primary neuron basal medium (PNBM) without L glutamine at 38 C until used for patch cla m p studies

PAGE 96

96 4.2.3 Enzyme Inhibition Assays Inhibition of AChE was determined using the Ellman assay (Ellman et al., 1961) and was based on the method outlined in Carlier et al., 2008. Enzyme solution (10 L) was added to each well of the 96 well micro assay p late along with 20 L of inhibitor, dissolved in DMSO, and 150 L of sodium phosphate buffer. The plate was incubated at 25C for ten minutes. Ellman assay reagents, ATCh (0.4 mM, final concentration) and DTNB (0.3 mM, final concentration), were prepared fresh and 20 L was added to the enzyme to initiate the reaction. Changes in absorbance were recorded by a DYNEX Triad spectrophotometer (DYNEX Technologies, Chantilly, VA, USA) at 405 nm. Enzyme concentrations used were within the linear range, therefo re eliminating the need for protein quantification. IC 50 values for each species were calculated by nonlinear regression from eight inhibitor concentrations using GraphPad Prism TM (GraphPad Software, San Diego, CA, USA). The nonlinear regression equation used was as follows: Y = bottom + (Top Bottom) / (1 + 10 ^((LogEC 50 x)*Hillslope)); where x = the logarithm of the concentration and Y = the response. Y starts at the top (normalized 100%) and approaches the bottom (0%) with a sigmoid shape. 4.2.4 Toxicity Assays Topical toxicity bioassays were performed based on the method of Pridgeon et al (2008). Briefly, insects were chilled on ice for 3 min, during which the appropriate volume (200 nL for mosquitoes, 1 L for Musca ) of chemical (dissolved in 95 % Ethanol) was applied onto the abdomen of insect using a handheld Hamilton microapplicator. For each inhibitor, five doses w ere applied on ten insects each and repeated three times. An ethanol only treatment was

PAGE 97

97 included in each experiment as a negativ e control. Insects were transferred into paper cups covered with netting and supplied with free access to sugar water for the duration of the experiment. Mortality was recorded at the 24 hour time point. Mortality data was pooled and analyzed by log pro bit using Poloplus to determine 24 hr LD 50 values. Three LD 50 values were obtained and the mean LD 50 value was calculated and used for statistical analysis. Diet toxicity assays were performed on Drosophila melanogaster Flies were fasted for 8 hours p rior to initializing the experiment. Flies were transferred into a container that contained a cotton ball infused with a sugar/inhibitor solution. For each inhibitor, one dose (1 mg/ml) was applied on twenty five flies and was replicated five times. Mor tality was recorded at the 24 hour time point. Contact toxicity bioassays were performed on both strains of An gambiae G3 (susceptible) and AKRON (pyrethroid and anticholinesterase resistance) with the use of the WHO protocol (WHO, 1981). Adult female mosquitoes were 2 5 days of age and were non blood fed at the time of experimentation. Five concentrations of inhibitor dissolved in ethanol were prepared and treated by applying 2 mL of each concentration on a 180 cm 2 (12 cm x 15 cm) paper. Paper s were le f t to dry for 24 hours prior to use. Mosquitoes were chilled for three minutes on ice, after which 25 females were placed in the WHO kit holding chamber to recover for one hour. Mosquitoes were then moved to the t reatment chamber, which contain the treated paper, and exposed for one hour. After the one hour exposure, the mosquitoes were transferred back to the holding chamber and maintained on 10 % sugar solution for 24 hrs. Each concentration was repeated in triplicate. Mortality was recorde d 24 hours post treatment and an LD 50 was calculated using Poloplus (LeOra Sofware Company, Petaluma, CA, USA) Three LD 50 values were obtained and the mean LD 50 value was used for statistical analysis.

PAGE 98

98 For all toxicity assays, control mortality was cor rected for using Abbots formula (Abbot, 1925) : Corrected percent mortality = (% alive in control % alive in treated) % alive in control 4.2.5 Electrophysiological Studies 4.2.5.1 Saline Suction electrode recordings were performed on the central and peripheral nervo us systems of larval Musca domestica. The central nervous system recordings used saline containing : 157 mM NaCl, 3 mM KCl, 2 mM CaCl 2 and 4 mM HEPES. The peripheral nervous system and neuromuscular junction recordings were performed with saline containi ng : 140 mM NaCl, 0.75 mM CaCl 2 5 mM KCl, 4 mM MgCl 2 5 mM NaHCO 3 and 5 mM HEPES. Both saline solutions were held at a pH of 7.25. P atch clamp experiments were performed on rat neuronal cortex cells and used a variety of different saline solutions based upon the ion channel of interest. Extracellular solution was the same regardless of the target ion channel and contained: 140 mM NaCl, 5 mM KCl, 2 mM MgCl 2 2 mM CaCl 2 10 mM glucose, and 10 mM HEPES (pH = 7.4). Intracellular patch solution for potassium channel recordings consisted of: 140 mM KF, 10 mM NaCl, 2 mM MgCl 2 and 10 mM HEPES (pH = 7.2). Intracellular patch solution for sodium recordings consis ted of: 140 mM CsCH 3 SO 3 10 mM NaCl, 2 mM MgCl 2 10 mM HEPES (pH = 7.2). 4.2.5.2 Musca CNS r ecordings Neurophysiological recordings were performed on third instar Musca domestica larvae and were based on methods described in Bloomquist et al. (1991). Electrode s/pipettes were pulled from borosilicate glass capillaries with filament (outer diameter 1.0 mm, inner diameter 0. 8 mm (Sutter Instrument, Novato CA, USA) on a P 1000 Flaming/Brown micropipette puller

PAGE 99

99 (Sutter Instrument). The settings on the pipette pulle r are as follows: Heat = 565, pull = 0, velocity = 35, time = 200, pressure = 500, RAMP = 561. The CNS w as first excised from the larvae and placed in a separate dish containing the appropriate physiological saline (200 uL), described in section 4.2.5.1. A drawing of the CNS dissection and recording arrangement is shown in F igure 4 2a. The CNS was manually transected posterior to the cerebral lobes to disrupt the blood brain barrier and enhance chemical penetration into the CNS (Bloomqust et al., 1991) After dissection was complete, peripheral nerve trunks were pulled into a recording suction electrode. This allowed amplification and digitization of the electrical activity originating from the CNS. The signal was fed into an amplifier that quantifie d individual spikes and converted them into a rate, expressed in Hz (MacLab ADInstruments, Colorado Springs CO, USA ). Activity was monitored using LabChart 7 for a ten minute time period to establish a constant baseline firing rate as the spike frequen cy typica lly increased from 0 to 10 minutes before stabilization. After a constant baseline was established, the CNS preparation was directly exposed to t est compound by adding 200 uL of the chemical to the bath containing 200 uL of saline. The fin al c oncentration of solvent in the bath was 0.1% DMSO. Each concentration was recorded for three to five minutes prior to the addition of the next inhibitor concentration. Mean spike frequencies for each concentration were used to construct dose response c urves. Dose response curves were used to determine the EC 50 values and were calculated by nonlinear regression (variable slope) using GraphPad Prism TM (GraphPad Software, San Diego, CA, USA) in a manner similar to that for AChE inhibition Each inhibitor concentration was replicated 3 5 times.

PAGE 100

100 4.2.5.3 Musca s ensory r ecordings As with the CNS recordings, the sensory recordings were also performed on third instar Musca domestica larvae with the same suction electrodes. The fat body, digestive system, and central nervous system were removed from the body to ensure non synaptic activity was recorded. After dissection was complete, a peripheral nerve trunk containing sensory nerve axons was drawn into a record ing suction electrode. A drawing of the sensory record i ng system is shown in F igure 4 2b. Activity was monitored for a 5 minute time period to establish a constant baseline of spike activity. The inhibitors were applied directly to the larval body cavit y and the final concentration of solvent ( usual ly DMSO) never exceeded 0.1%. Each concentration was recorded for three minutes or until the spike frequency bec a me constant. Mean spike frequencies for each concentration were analyzed identically to thos e of the CNS recordings. 4.2.5.4 Neuromuscular j unction r ecordings Third instar larvae were prepared in the manner as described in the Musca sensory recordings (section 4.2.5.3). In short, the maggot was immobilized with pins and the nervous and musculature s ystems were exposed. Saline was identical to that used in the sensory recordings and is described in section 4.2.5.1. The lateral nerves were severed from the base of th e CNS. A lateral nerve trunk was drawn into a suction electrode (which was filled wi th saline). Stimuli were applied at 1 volt with a repetitive frequency of 0.2 milliseconds to elicit a contraction from the longitudinal muscle. The stimulated muscle was then impaled with a recording glass capillary microelectrode filled with 1 M KCl to record the effect on the evoked EPSP and membrane potential. The resting membrane potential of all muscles prior to recording ranged between 30 mV to 70 mV. The recording electrode was inserted into the center of the contracting muscle to limit the ef fect of muscle movement on the recording. Signals from all

PAGE 101

101 recordings were amplified and digitized with the use of the MacLa b Chemicals were applied to the preparation directly by hand pipetting 150 uL of chemical to the bath solution of 150 uL. The ac tion of DEET on the house fly neuromuscular junction was found to be an all or none blockage of the evoked EPSP Therefore, data was calculated as the percentage of the preparations yielding a blocking response and was determined from at least five preparations per concentration. 4.2.5.5 Patch c lamp r ecordings Assistance in patch clamping and associated data analysis was provided by Dr. Baonan Sun. C ells were cultured on cover slip s and were immersed in 35 mm Petri d ishes filled with room temperature extracellular saline. The recipe for the extracellular patch solution is given in section 4.2.5.1. Patch pipettes were pulled from borosilicate glass capillaries with filament (outer diameter 1.5 mm, inner diameter 0.86 mm (BF150 86 10, Sutter Instrument, Novato CA, USA) on a P 1000 Flaming/Brown micropipette puller (Sutter Instrument). Patch electrodes were filled with solutions containing either intracellular patch solutions described in section. Cesium (CsCH 3 SO 3 ) was used to eliminate potassium currents during sodium channel analysis. The patch electrodes had resistances of 5 7 MOhms. Patch clamp recordings were performed with a 40x/0.80W water immersion objective (working distance 3.5 mm) using a forced air cooled Photometrics Evolve 512 with a CCD97 camera system. The neurons were then approached with a patch pipette pressurized to prevent contamination of the tip. After approaching the cell surface, the pressure was released and negative pressure was applied to facilitate seal formation. Following gigaseal formation, the membrane was ruptured through a brief, manual suction of the e lectrode. If cell rupture could not be obtained after gigaseal formation, a 2 msec long zap pulse was applied.

PAGE 102

102 Currents were ampl ified with the use of a patch clamp amplifier (Axopatch 200B, Molecular De vices LLC, Sunnyvale, CA, USA) and were connected via A/D converter (Digidata 1440A, Molecular Dev ices LLC) Recordings underwent low pass filtering at 1 kHz and were sampled at 10 kHz or 100 kHz for potassium and sodium currents respectively. For recording and analyzing data, pClamp 10.0 software (Molecular Devices LLC) was used. Membrane resistance and capacitance were read from membrane test protocols of pCLAMP 10.0. 4.3 Results 4.3.1 Lethality of DEET Topical bioassays showed DEET to be toxic via surface contact and topical application (Table 4 1) No statistical ly significan t differences w ere seen between the mosqui to species or strains, indicating no cross resistance and little spe cies variability. For comparison, the LD 50 of propoxur to Ae. aegypti is 1 ng/mg, a 1102 fold difference when compared to the LD 50 of DEET. Synergism with a co treatment of 200 ng PBO had little to no statistical influence on the topical toxicity of DEET (Table 4 1) The synergism ratio was found to be 1.2 fold for both strains of An. gambiae, 1.02 fold for Ae. aegypti, and 1.3 fold for Musca domestica. DEET was also found to be toxic through contact (eg. tarsal) exposure. LC 50 values were found to be much greater than that of p ropoxur ; for Ae. aegypti there was a 900 fold difference when compared to the LC 50 of DEET (Table 4 1) DEET was found to be non toxic to Drosophila melanogaster with a sugar feeding assay at 1 mg/ml. Higher concentrations wer e not studied in this assay. 4.3.2 Signs of Intoxication by DEET The signs of intoxication of Ae aegypti after exposure to 1750 ng of DEET were found to possess both hyperexcitatory and lethargic tendencies. Five minutes post exposure, the mosquitoes were le thargic with the majority standing with splayed posture or laying ventral side upward. The mosquitoes were not capable of rest ing on the vertical sides of the container and

PAGE 103

103 would rest on the flat bottom instead After agitation, the mosquitoes became hyperexcited through increased wing beat frequency, spinning on their backs, and erratic movements. Flight did not occur even after manual stimulation. After approximately 10 seconds of hyperexcitation, the mosquitoes resumed lethargic tendencies. The co ntrol mosquitoes were found to have normal posture (legs not splayed outward of the midline), would rest on the sides of the cup versus the bottom, and displayed no signs of excitation (twitching, spinning, increased frequency of wing beats, etc). Upon ag itation, the mosquitoes would immediately fly from their resting posture to a different location on the container. Mosquitoes intoxicated with p ropoxur exhibit extreme hyperexcitation with no lethargic tendencies. Five minutes post exposure to 1 ng/inse ct, the mosquitoes were in the supine position and were rapidly beating their wings. This high wing beat frequency caused the mosquitoes to spin on their dorsal side. If the mosquitoes stopped beating their wings, they rapidly twitch ed and contract ed the ir legs. The mosquitoes continued this behavior until death. Manual agitation of the mosquito caused no change in the behavior of the mosquitoes. Houseflies presented very similar signs of intoxication in that the flies were lethargic with occasional bouts of excitation. However, unlike Ae. aegypti the flies did not present a change in behavior after agitation as they remained standing and did not begin convulsing. Although the flies presented tendencies of excitation by twitching and uncoordinated movements, it was not to the same level of intensity as observed with mosquitoes. The flies were less hyperexcited and more lethargic while intoxicated when compared to the mosquitoes. 4.3.3 Anticholinesterase Actions of DEET and Local Anesthetics DEET was fou nd to be a poor anticholinesterase inhibitor of Dm AChE, hAChE, and Md AChE with mean IC 50 values of 10 mM, 12 mM, and 6 mM, respectively (Table 4 2) The

PAGE 104

104 mosquito enzymes, Ag AChE and Ae AChE, were found to be completely insensitive to DEET at concentrations up to 10 mM, but were highly sensitive to propoxur with an IC 50 value of 447 nM to Ag AChE. The mean IC 50 for propoxur to Md AChE was found to be 130 nM, a 40,769 fold difference when compared to the IC 50 value of DEET to Md AChE. Lidocaine was found to have an IC 50 value of 4.9 mM to Md AChE, a 1.1 fold diffence when com pared to DEET. T oluene was found to be inactive at concentrations up to 10 mM on all enzyme preparations. Chlordimeform was found to be 50 fold more potent (IC 50 : 0.12 mM) to M d AChE when compared to DEET whereas octopamine had an IC 50 greater than 10 mM. All IC 50 values are show in in T able 4 2 4.3.4 Whole Brain Recordings from Musca domestica larvae House fly CNS recordings were performed in an effort to further characterize DEET toxicity and to elaborate upon the in vitro data. The effects of DEET, lidocaine, and t oluene on nerve discharge from larval Musca domesica CNS are shown in Figure 4 3 to di splay the varying modes of action of the three compounds. DEET was found to be neuroexcitatory to either transected or intact CNS, having EC 50 values of 0.12 (0.05 0.28) mM and 0.21 (0.08 0.56) mM, respectively. No statistical significance (P > 0.05) was observed between the sensitivity of transected and intact preparations. Toluene was also found to have excitatory properties, but at concentrations ten fold higher than that of DEET (Figure 4 3) The EC 50 of toluene was found to be 1.1 mM on t he transected CNS. Lidocaine, a known sodium channel blocker, was found to have an inhibitory effect on the CNS with an EC 50 of 2.4 mM. Propoxur was used as a positive control for AChE inhibitors and was found to have an EC 50 of 344 nM, 3 50 fold more po tent than DEET. Dose response curves of the three compounds to transected Musca CNS are shown in Figure 4 4

PAGE 105

105 DEET mediated neuroexcitation w as compared to octopamine to assist in the i dentification of its mode of action (Figure 4 5) Octopamine was f ound to have an excitatory EC 50 of 0.11 mM, nearly identical to the EC 50 found for DEET (EC 50 : 0.12 mM) Interestingly, chlordimeform, a formami dine insecticide that requires oxidative N dealky lation to its active principle (Costa and Murphy, 1987 ) had no effect up o n CNS spike discharge frequency. Experiments were then performed with phentolamine, an established octoaminergic antagonist (Yokel and Wise, 1976 ) to determine its ability to block the neuroexcitation of DEET and test whether neuroexcitation mght be mediated via central octopamine receptor s DEET (up to 500 uM) mediated neuroexcitation was completely blocked by 100 M phentolamine and it completely block ed octopamine mediated neuroexcitation at octopa mine concentrations up to 3 mM. The neu roexcitation of propoxur was not substantially decreased by phentolamine, as a mere 1.6 fold difference in EC 50 values were observed with and without phentolamine (Figure 4 5) 4.3.5 Sensory Nerve Recordings from Musca domestica DEET was found to have no inh ibitory or excitatory influence on the peripheral nervous system of Musca domestica. The only change in sensory discharge frequency was gradual rund own in the preparation (Fig. 4 6 ). Lidocaine was found to inhibit spike frequency at 5 mM, a su rprisingly high concentration. Toluene was found to have excitant properti es at 5 mM, nearly 10 fold higher than the EC 50 found in the CNS recordings. The pyrethroid f enfluthrin was used as a positive control and was found to have neuroexcitant propertie s with an EC 50 of 25 nM indicating the assay itself is not the cause of the surprisingly low sensitivity of the sensory system to the three studied compounds. Traces of the nerve recordings are shown i n F igure 4 6

PAGE 106

106 4.3.6 Neuromuscular Junction Recordings from Musca domestica Studies o f neuromuscular junctions with DEET yielded a complete nerve block of the evoked EPSP in the body wall musculature of third instar Musca domestica The block was found to be an essentially all or none response with an EC 50 of 7. 2 mM (Figure 4 7 ). Complete nerve block was obtained approximately 120 seconds after 10 mM DEET was added to the bath, and little graded decline in EPSP amplitude w as observed prior to complete block (Figure 4 8) Little to no change was observed on the membrane resting potential after the addition of DEET at any concentration. Lidocaine was also found to be a blocker at the neuromuscular junction and the blocking pattern was consistent with inhibition of pre syn aptic action potentials, as it was a n all or none response very similar to DEET (Figure 4 8) Toluene was found again to be excitatory at 5 mM (data not shown) and t he excitatory effect was capable of being washed out after a 14x dilution. Octopamine, a biogenic amine, was found to induce rhythmic discharges at concentrations of 1 mM or greater, but did not induce block of evoked EPSPs (Figure 4 8). C hlordimeform was found t o have a graded block of the evoked EPSP a t low milliomolar concentrations, indi cating an effect on the post synaptic muscle membrane Propoxur was used as a negative control and was found to have no effect on the NMJ of M. domesica larvae (data not shown). 4.3.7 Patch Clamp Recordings Patch clamp recordings of rat cortical neurons suggested DEET is a block er of both sodium and p otassium channels of rat neuronal cortex cells. DEET was found to block the sodium current s with nearly identical potency when compared to toluene but was 33 fold less active when c ompared to lidocaine (Figu re 4 9 a). The DEET medi a ted sodium channel block was capable of being washed out to restore approxim ately 50% of sodium currents (Figure 4 9 b)

PAGE 107

107 Potassium channels were more sensitive to DEET as they were blocked at concentrations 8 fold lower than sodium channels (Figure 4 10 ) 4.4 Discussion D EET toxicity has been of great interest due to the large number of annual applications to humans Recent literature suggests that DEET is a n acetyl cholinesterase inhibitor (Corbel et al., 2009) and suggest s that the safety of humans could be at risk through cholinesterase poisoning. Studies were performed to determine the mode of neurotoxic action of DEET and to determine if DEET inhibits acetylcholinesterase at concentrations that imply a reason for concern about i ts safety Previous s tudies ( Reuveni and Yagupsky 1982 ) have als o shown that dermal exposure to DEET can cause redness and numbness of the treated area, similar to an action of local anesthetics. Accordingly comparisons were made between DEET lidocaine and toluene, two documented sodium channel inhibitors to determine the anesthetic properties of DEET ( Jaffe and Rowe, 1996; Scior et al., 2009 ). DEET was found to be toxic at microgram dose s to the mosquitoes, Ae. aegypti and An. gambiae and to the housefly, Musca domestica Toxicity assays were performed on the G3 (susceptible) an AKRON (resistant) strains of An. gambiae to determine if the G119S point mutation in Ag AChE, known as MACE or the upregulated P450 enzyme levels would reduce DEET t oxicity. The LD 50 of the two strains w ere not statistically significant, indicating that the AChE target site mutation has no relevance to the toxicity of DEET. The addition of pipronyl butoxide had no s ignificant impact on the toxicity of DEET demonstr primary mechanism of detoxication. To further analyze the potential that DEET is an anticholinesterase, we studied the in vitro AChE inhibition of DEET to mosquitoes, houseflies, and human enzymes. Interestingly, we found no i nhibition of mosquito AChE and poor inhibition of housefly Dm AChE, and human AChE (Figure 4 4) The fact that DEET is toxic to

PAGE 108

108 the mosquito without inhibition of AChE in vitro suggests that DEET imposes its neurotoxic effect in a manner other than acetyl cholinesterase inhibition A variety of electrophysiological recordings were utilized to further analyze the mode of action of DEET toxicity The excitation of the CNS after exposure to DEET appeared superficially to be consistent with AChE inhibition but was different than the response pattern of toluene or lidocaine. Lidocaine was found to be a blocker in all preparations studied (eg. CNS, PNS, NMJ) with EC 50 values similar to those found in the literature (Jaffe and Rowe, 1996), likely indicating a dif ferent action to nerve preparations when compared to DEET, regardless of the similar Md AChE inhibition potencies seen in Table 4 2 Although DEET and lidocaine were nearly equipotent against Md AChE, the local anesthetic action of lidocaine on presynaptic sodium channels likely negates the anticholinesterase action. Toluene was uniformily excitatory in all preparations with no anesthetic action on the insect nervous system. This suggests the i nsect local anesthetic binding site (LABS) of the sodium channel is different when compared to rat LABS (Scior et al., 2009). The insect neuromuscular junction serves as a negative control for effects of suspected cholinergic inhibitors, as i nsects do not have cholinergic synapses in their peripheral nervous system ( Calhoun, 1963; Booth and Lee, 1971 ). Within this preparation, DEET was shown to exhibit presynaptic block of the evoked EPSP an effect consistent with an anesthetic like action. L idocaine di splayed a blocking pattern similar to DEET, indicating an effect on the presynaptic nerve terminal. This similar mode of action on the neuromuscular junction is likely due to the similar chemical structures these two compounds possess. As expected, propo xur was found to be inactive on the M. domestica neuromuscular junction and served as a negative control. Because DEET has effects inconsistent with cholinesterase inhibition and an action different than

PAGE 109

109 lidocaine based on the CNS studies, experiments wer e performed to compare DEET to compounds acting on the octopmaninergic system. Octoapaminergic compounds, such as chlordimeform (CDM) and octopamine, are toxic through an activation of octopamine receptors, leading to an increased cAMP concentration and ov erstimulation of the octopaminergic synapse. In addition, chlordimeform is documented to possess both anesthetic and excitatory effects as the chemical blocks nerve transmission at high concentrations, but can have an excitatory effect at lower concentrat ions (Pfister et al., 1978; Hollingsworth and Lund, 1982). Further comparison between DEET and octopaminergic compounds found that phentolamine completely blocked the CNS neuroexcitation of DEET and octopamine, but was not found to be an effective blocker of propoxur. These data suggest DEET is likely targeting octopaminergic synspases and not acetylcholinesterase to induce toxicity. The structure of DEET superficially resembles the chemical structure of lidocaine and chlordimeform (Fig. 4 1), a character istic that should not be overlooked when studying the potential for a similar mode of action. The largest stuctural difference between DEET and lidocaine is the basicity of the lidocaine nitrogen, and for DEET and chlordimeform would be the presence of a chlorine atom substituted at the 4 position on the phenyl ring. Both chemicals possess a substituted side chain with DEET having a carbonyl amide and one diethylamine group while chlordimeform possesses the formamidine dimethyl groups and no carbonyl oxyg en Three dimensional structural overlays (Figure 4 11) of the two chemicals suggest the rings overlap well, and the diethylamine group of DEET can occupy space similar to the dimethylamine of CDM. These similar structural bases could provide similaritie s in their action on ion channels and enzymatic systems.

PAGE 110

110 Patch clamp studies were performed with rat neuronal cortex cells to determine the mode of action of DEET on specific ion channels within mammalian cells. Results indicate DEET is capable of blocki ng sodium and potassium channels at low to mid micromolar concentrations similar to lidocaine and other local anesthetics. Th ese results can be use ful for describing the numbing sensation observed when DEET contacts mam malian skin ( Reuveni and Yagupsky 1982 ) With regards to insect toxicity, it is unlikely sodium or potassium channel blockage is the primary mechanism of toxicity. L idocaine and CDM ha ve been documented to have anesthetic like effect s through noncompetitive inhibition of acetylcholine an d inhibition of potassium induced contractions (Wang et al., 1975). Although DEET is capapble of blocking sodium channels at similar concentrations to known anesthetics (lidocaine and toluene), it is unlikely DEET is cap able of decreasing the synaptic sen sitivity to acetylcho line lead s to insect toxicity. We believe this is unlikely based on the data showing that DEET is a neuroexcitant of the CNS whereas a block of spike frequency was observed with lidocaine. Mosquitoes show a splayed posture and hyper excitation after toxic doses of DEET, perhaps because of a combination of central octopaminergic hyperexcitation complexed with incomplete suppression of peripheral neurotransmission. To conclude, it is unlikely that DEET exerts its toxicity through antich olinesterase properties due to it s low potency for enzyme inhibition and the block of neuroexcitation with phentolamine Thus it is plausible to suggest toxicity to houseflies and likely mosquitoes, is through a mimicking action of the neurotransmitter octopamine in the octopaminergic system as was portrayed with the CNS recordings performed with phentolamine perhaps in combination with peri pheral neurosuppressive effects Numbn ess of mammalian mucous membranes is potentially explained through an anesthetic e ffect of nerve conduction block

PAGE 111

111

PAGE 112

112 Figure 4 1. St ructures of inhibitors used in C hapter 4.

PAGE 113

113 Figure 4 2. Diagram of the Musca domestica dissection, recording arrangement, and nerve activity for the central nervous system (A) and the sensory nervous system (B) dissections.

PAGE 114

114 Table 4 1 Toxicity values of DEET to three mosquito strains and the house fly. Letters after 95% CI values represent statistical significance for IC 50 va lues among species within a given toxicity measurement column (first letter) and between synergi zed and unsynergized LD 50 for each strain (second letter). Values not labeled by the same letter represent statistical significance at P < 0.05. LC 50 LD 50 LD 50 ( + 200 ng PBO ) Species (mg/ml; 95% CI) (ng/mg; 95% CI) (ng/mg; 95% CI) SR Ag (G3) 1.9 (0.9 2.9)a 1175 (988 1361)a,a 1021 (829 1231)a 1.2 Ag (AKRON) 2.7 (1.0 4.5)a 1472 (1136 1806)b,a 1247 (872 1526)a 1.2 Ae. aegypti 2.3 (1.1 3.6)a 1102 (836 1367)a,a 1082 (841 1310)a 1 M. domestica 8104 (7026 9000) ,a 6219 (4405 8563)a 1.3

PAGE 115

115 Table 4 2 Enzyme inhibition data expressed as mean (n=3) IC 50 values. IC 50 (mM; 95% CI) Propoxur DEET Lidocaine Toluene An. gambiae (G3) 4.5e 4 (4.2e 4 4.8e 4) > 10 > 10 > 10 An. gambiae (AKRON) > 1 >10 > 10 > 10 Ae. aegypti 3.7 e 4 (3.2e 4 4.1e 4) > 10 > 10 > 10 M. domestica 1.3e 4 (1.1e 4 1.6e 4) 6 (3 8)a 4.9 (3 7) > 10 Drosophila melanogaster 8.4e 5 (6.9e 5 1.1e 4) 10 (6 13)b 9.6 (5 14) > 10 Human 1.4e 3 (1.2e 3 1.6e 3) 12 (7 17)b > 10

PAGE 116

116 Figure 4 3 Nerve discharges of the CNS from M. domestica third instar larvae.

PAGE 117

117 Figure 4 4 Potency of DEET, toluene, and lidocaine on CNS nerve discharge of the house fly

PAGE 118

118 Figure 4 5. Effect of phentolamine on the activity of DEET, octopamine, and propoxur to CNS nerve discharge rates of the house fly

PAGE 119

119 Figure 4 6 Sensory nervous system firing frequency recording s from M. domestica third instar larvae.

PAGE 120

120 Figure 4 7 Concentration response relationship for the blocking action of DEET at the neuromuscular junction of Musca domestica. Numbers next to data points represent the number of preparations studied at each concentration.

PAGE 121

121 Figure 4 8. Re cordings of evoked EPS P of the n euromuscular junction in M. domestica larvae after exposure to DEET, lidocaine, chlordimeform (CDM), and octopamine. In the DEET trace, the remaining transients after block of the EPSP are stimulus artifacts. Expansion of the octopamine trace ( arrow) shows the rhythmic activity induced by high concentrations of octopamine.

PAGE 122

122 Figure 4 9 Voltage dependent block of rat neuronal sodium channels. A) Dose response curves of three inhibitors to rat neuronal sodium channels obtained through patch cla mp recordings. B) DEET mediated voltage dependence block of the sodium currents in rat neuronal cortex neurons

PAGE 123

123 Figure 4 10 Voltage dependent block of rat neuronal potassium channels. A) Dose response curves of DEET mediated inhibition of rat neur onal potassium channels obtained through patch clamp recordings. B) DEET mediated voltage dependence block of the potassium currents in rat neuronal cortex expressed as current voltage plots

PAGE 124

124 Figure 4 11 Three dimensional structural overlay of the carbon backbone of DEET ( g reen) and chlordimeform (magenta). Other atoms are carbonyl oxygen (red), nitrogen (blue) and hydrogen (white). Model was created by Dr. Dawn Wong using 3DpyMol.

PAGE 125

125 CHAPTER 5 ACTIVITY OF NEWLY DESIGNED ANOPHELES GAMBIAE SELECTIVE CAR BAMATES AGAINST MOSQUITO VECTORS, AGRICULTURAL PESTS AND MODEL ORGANISMS Abstract: N ew and highly selective anticholinesterase mosquitocides (ie: carbamates) are under development in our laboratory The experimental carbamates have shown up to 1000 fold selectivity of An. gambiae enzyme over human AChE and an LD 50 of 4 ng/insect. A similar degree of selectivity and toxicity was observed for other mosquito species studied For example, the compound, 3 tert butylphenyl N methylcarbamate yielded: An. gambiae IC 50 104 nM and an LD 50 of 4 ng/mosquito ; A e aegypti IC 50 79 nM and LD 50 ~ 7 ng /mosquito ; C x quinquefasciatus IC 50 120 nM and LD 50 ~14 ng /mosquito Surprisingly the experimental carbamates displayed generally poor enzyme inhibition in the honey bee ( Apis mellifera ) and lepidopteran agricultural pests ( IC 50 > 10 6 ), indicating unusual insect selectivity The unique selectivity pattern of our experimental carbamates has implications for mitigation of mosquito insecticide resistance due to agricultural uses It has been suggested that irrigated agriculture and crop spraying has subjected mosquito vectors to selection in the larval stages, especially with pyrethroids. Development of insec ticides that have little to no toxicity on agricultural pests, such as our novel carbamates, can alleviate this mode of insecticide resistance selection by eliminating agricultural use. 5.1 Introduction The use of synthetic chemicals remains the principal mech anism of integrated vector management for the control of malaria and other vector borne diseases (Hemingway and Ranson, 2000). Residents of malaria endemic countries sleep under insecticide treated nets (ITNs) to reduce malarial transmission. Pyrethroids remain the only class of insecticides approved for use in insecticide treated nets (ITNs), the first line of malaria vector control, and have been effective

PAGE 126

126 in controlling the malaria vector for a number of years. However, the increased prevalence of pyr ethroid resistant mosquitoes, primarily through a sodium channel mutation ( kdr) is forcing researchers to develop new mosquitocides with a novel mode of action to control the malaria mosquito, An. gambiae Bes ides malaria, diseases such as dengue fever/d engue hemorrhagic f ever (vector: Ae. aegypti ), lymphatic f ilariasis (vector: Cx. quinquefasciatus ), and West Nile Virus (vector: Ae. albopictus ) are also highly prevalent and often deadly. By 1999, the WHO s population to be at risk for dengue f ever and over a billion individuals, in as many as eighty countries were at r isk for lymphatic f ilariasis (WHO, 2007). It is apparent that the design of novel mosquitocides is vital for the reduction of vector borne disease transmi ssion and minimizing mosquito borne deaths. Acetylcholinesterase (AChE) is a well validated insecticide target site that has been utilized for many years with organophosphates and carbamates. AChE is a serine hydrolase that is necessary for regulation of the neurotransmitter acetylcholine in both, humans and insect central nervous systems. Anticholinesterases react with a serine residue located at the catalytic site near the bottom of the AChE gorge to inactivate the enzyme. The inactivated enzyme is no longer capable of hydrolyzing acetylcholine, resulting in the buildup of Ach in the nerve synapse, leading to death ( ). Des ign of novel mosquitocides that possess high levels of mosquito selectivity could have large implications f or vector disease control programs Insecticide resistance of mosquitoes due to agricultural uses has been documented and specifically affects insecticide design for disease control. W idespread agricultural use of pyrethroids has been implicated in exacerbating development of resistance to insecticides with the same mode of action, thus reducing the effectiveness of ITNs ( Yadouleton et al., 2009 ).

PAGE 127

127 Development of a highly selective insecticide with poor toxicity to agricultural pests can mitigate res istance due to less ancillary uses and therefore, limited selection pressure within breeding sites. Our novel carbamates possess a high degree of selectivity through utilization of unique differences between human and An. gambiae AChE active sites. The objective of this research was to determine the in vitro and in vivo activity of experimental insecticides to other nuisance biting mosquitoes, model organisms, and agricultural pests in an effort to gain a broader perspective on the potential toxicity of these compoinds to other insects 5.2 Materials and Methods 5.2.1 I nhibitors, Solvents, and Assay Reagents Propoxur (99% purity), bendiocarb (99% purity), and carbofuran (99% purity) were purchased from Sigma Aldrich (St. Louis, MO, USA). Experimental carbamates were prepared as descri bed in Carlier et al., 2008 All experimental compounds were purified by column chromatography and/or re crystallization and are >95% pure by 1 H NMR analysis. Structures of experimental carbamates and propoxur are shown in Figure 5 1. Ellman assay (Ellman et al., 1961) reagents are composed of acetylthiocholine iodide (ATCh)( dithiobis (2 nitro)benzoic acid (DTNB)(99% purity), and sodium phosphate buffer, all of which were purchased from Sigma Aldrich (St. Louis, MO, USA). Molecular sieve OP type 3 were purchased from Sigma (St. Louis, MO, USA) and were use d to prevent water absorption within the DMSO stock. Fifty beads were added into a 100 mL stock solution. These sieves have a diameter of ~ 2 mm, a pore size of 3 and a water absorbing The solvents, dimethyl sulfoxide and absolute et hanol were purchased from Sigma Aldrich (St. Louis, MO, USA).

PAGE 128

128 5.2.2 Insects and Enzyme sources Wildtype An. gambiae ( Ag AChE) (Diptera: Culicidae) mosquitoes were provided by the Center for Disease Control (Atlanta, GA) and were reared from the egg lifestage a t the University of Florida (Department of Entomology and Nematology, Emerging Pathogens Institute, Gainesville, FL, USA). An. albimanus ( Aa AChE) (Diptera: Culicidae) An. quadrimaculatus ( Aq AChE) (Diptera: Culicidae), and Ae. aegypti ( Ae AChE) (Diptera: C ulicidae) were cultured and reared at the United States Department of Agriculture Agricultural Research Service (Gainesville, FL, USA). Ae. albopictus ( Ab AChE) (Diptera: Culicidae) is a non resistant lab strain that was provided by Dr. Phil Kaufman at t he University of Florida (Department of Entomology, Medical and Veterinary Laboratory, Gainesville, FL, USA). Cx. quinequefasciatus ( Cq AChE) was supplied by Dr. Bill Walton at the University of California Riverside and is a 40 year, susceptible lab strai n and was used for toxicity assays The housefly, Musca domestica (FS strain) (Diptera: Muscidae), was provided by Dr. Phil Kaufman at the University of Florida (Department of Entomology, Medical and Veterinary Laboratory, Gainesville, FL, USA) and has been in culture for 40 years. Drosophila melanogaster (Orgeon R strain) (Dipter a: Drosophilidae) was cultured at the University of Florida (Department of Entomology and Nematology, Emerging Pathogens Institute, Gainesville, FL, USA). Asian Citrus Psyllids, Diaphoria citri (Hemiptera: Psyllidae) were provided by the Department of Ent omology and Nematology, Lake Alfred CREC station, at the University of Florida (Gainesville, FL, USA). The honeybee, Apis mellifera ( Am AChE) (Hymenoptera: Apidae) was provided by Dr. James Ellis at University of Florida (Department of Entomo logy, Bee Uni t, Gainesville, FL, USA). Ostrinia nubilalis (Lepidoptera: Crambidae) were ordered from French Agricultural Research ( Lamberton, MN ). Plutella xylostella (Lepidoptera: Plutellidae) was provided by Dr. Tony Shelton at Cornell University (Ithaca, NY, USA). Neither

PAGE 129

129 lepidopteran species are known to possess resistance to any insecticides. Human AChE enzyme was purchased from Sigma Aldrich (lyophilized powder, Sigma C1682, St. Louis, MO, USA) Acetylcholinesterase enzyme sources were prepared from groups o f ten whole non blood fed adult female mosquitoes, three fly/bee heads, six whole bodied fruit flies, tweny whole bodied psyllids, or twenty L3 lepidopteran heads. Each enzyme preparation was from tissue homogenized in 1 mL of ice cold sodium phosphate bu ffer (0.1 M, pH 7.8) containing 0.3% Triton x 100, with an electric motor driven glass tissue homogenizer. The homogenate was centrifuged at 5000 x g at 4 C for 5 minutes. The supernatant was used as the enzyme source for the assay. Prior to use in ass ay, h AChE was diluted 100x with the aforementioned buffer + Triton mixture. 5.2.3 Enzyme Inhibition Assays IC 50 values (concentration needed to inhibit 50% of the enzyme) were determined using slight modifications from Ellman et al. (1961) and is outlined in Car lier et al. (2008). Briefly, 10 L of enzyme solution was added to each well of the 96 well micro assay plate along with 20 L of dissolved compound and 150 L of ice cold phosphate buffer. The assay plate was incubated at 25C for ten minutes. Ellman assay reagents, ATCh (0.4 mM, final conc.) and DTNB (0.3 mM, final conc.), were prepared new for each experiment and 20 L was added to the enzyme to initiate the reaction. Changes in absorbance were recorded by a DYNEX Triad spectrophotometer (DYNEX Technologies, Chantilly, VA, USA) at 40 5 nm. Six inhibitor concentrations were used in triplicate to construct dose response curves using Graphpad Prism 4 (GraphPad Software, San Diego, CA, USA). Inhibitors were prepared using DMSO and contained a final concentration of 0.1% DMSO ( v/v ) throug hout each inhibitor concentration. Enzyme concentrations used were within the linear range, therefore eliminating the need for

PAGE 130

130 protein quantification. IC 50 values for each species were calculated by nonlinear regression from eight inhibitor concentration s using Prism TM (GraphPad Software, San Diego, CA, USA). The nonlinear regression equation used was as follows: Y = bottom + (Top Bottom) / (1 + 10 ^((LogEC 50 x)*Hillslope)); where x = the logarithm of the concentration and Y = the response. Y start at the top (normalized 100%) and approaches the bottom (0%) with a sigmoid shape. 5.2.4 Topical Toxicity Assays Topical toxicity bioassays were performed based on t he method of Pridgeon et al (2008). Briefly, insects were chilled on ice for 3 min, during which the appropriate volume (200 nL for mosquitoes, 1 L for lepidopteran larvae ) of chemical (dissolved in 95% e thanol) was applied onto the abdomen of the insect using a handheld Hamilton microapp licator. For each inhibitor, five doses were applied to ten insects each, and repeated three times. An ethanol only treatment was included in each experiment as a negative control. Insects were transferred into paper cups covered with netting and suppli ed with free access to sugar water for the duration of the experiment. Mortality was recorded at the 24 hour time point. Mortality data was pooled and analyzed by log probit using Poloplus to determine 24 hr LD 50 values. Three LD 50 values were obtained and the mean LD 50 value was used for statistical analysis. 5.2.5 Mouse Oral Toxicity Mammalian toxicity studies provid e valuable insights toward structure activity relationships and safety determinations of novel inhibitors. We performed a screen of three expe rimental insecticides using the OECD/OCDE approved method, known a and in oral dosing of male Mus

PAGE 131

131 musculus (ICR strain). All procedures for these experiments were approved by the Univer sity of Florida IACUC. Inhibitors were dissolved in a 10% DMSO olive oil mixture and the final concentration of DMSO was 0.1% for each inhibitor concentration. Drugs were administered through the use of an oral gavage needle at volumes of no more than 400 uL. A maximum of eight mice total were used for each inhibitor and were monitored every 4 hours for 24 hours after the administration of the insecticide Toxicity was recorded at 24 hours post exposure. The mice were sacrificed at any s ign of suffering and counted as dead 5.2.6 Statistical A nalyses The IC 50 and Hill slope values for carbamates run under each protocol were averaged (n=3) and compared by a one GraphPad InStat TM (G raphPad Software, San Diego, CA, USA). Mortality was recorded 24 hours post treatment and an LD 50 was calculated using Poloplus. Three LD 50 values were obtained and the mean LD 50 value was used for statistical analysis. For all toxicity assays, control mortality was corrected for using Abbots formula (Abbot, 1925). Abbotts Formula: Corrected percent mortality = (% alive in control % alive in treated) % alive in control 5.3 Results 5.3.1 Pharmacodynamic Studies 5.3.1.1 Mosquito v ectors Standard and experimental m ethylcarbamates were screened on five mosquito species prior to screening on agricultural pests and model organisms. All data were fit to a sigmoid curve with r 2 0.98 within all experiments and Hill slope values 0.8. The IC 50 results of

PAGE 132

132 mosquito enzy m es, presented in Table 5 1, show that carbofuran displayed more potent inhibition across all mosquito species than all other methylcarbamates. Carbofuran was found to be approximately 10 fold more potent than the least potent commercial carbamate, propox ur. In addition, the rank order of potency of commercial carbamates insecticides was always carbo furan > bendiocarb > propoxur (Table 5 1) No statistical significance of the IC 50 s was observed between mosquito species for each separate commercial carbam ate. The potencies of e xperimental carbamates were widely variable among the mosquito speci es tested (Table 5 1) PRC 331 and PRC 388 were the two experimental inhibitors studie d that contain a meta substituted side chain. Of these two, PRC 331 was found to be the more potent by approximately two fold. PRC 408 was found to be the most potent experimental inhibitor containing an ortho substituted side chain in all mosquito species studied. Differenc es ranged from 1.3 fold ( Ae AChE; PRC 408 and PRC 337) to 6.1 fold ( Aq AChE; PRC 408 and PRC 421) for ortho subsitututed experimen tal carbamates on mosquito species Of the Anopheles s p p. studied, PRC 331 and PRC 408 displayed nearly identical inhibition po tencies (ca. 100 nM), however, PRC 408 was approximately two fold less potent when compared to PRC 331 in both Ae mosquito species (Table 5 1) 5.3.1.2 Agricultural p ests All IC 50 values of agriculturally relevant insects are shown in Table 5 2. Three agricult ural pests and one economically important pollinator were studied to determine the activity of experimental inhibitors to agriculturally relevant insects Lepidopteran insects, Plutella xylostella and Ostrinia nubilalis were significantly less sensitive to the experimental carbamates when compared to An gambiae When compared to Ag AChE, O. nubilalis displayed up to a 194 fold increase (PRC 408) in IC 50 value whereas the commercial carbamate bendiocarb displayed a 1.9 fold increase The pattern of decreased inhibition potencies was also

PAGE 133

133 observed with Plutella xyostella AChE as experimental inhibitors displayed up to a 492 fold de crease (PRC 408) in inhibition whereas bendiocarb increased 1.2 fold, a statistically ins ignificant increase between Ag AChE and Px AChE. In h ibition potencies also varied widely with D. citri as there was a ten fold difference between the two commercial carbamates, propoxur and bendiocarb. For the experimental insecticides, PRC 331 was the mos t potent inhibitor (128 nM) and was two fold more potent than PRC 388, the other meta substituted experimental methylcarbamate The experimental carbamates possessing an ortho substituted side chain were 8 to 48 fold less active to D. citri when compared to PRC 331 (Table 5 2) The economically important pollinator Apis mellifera displayed a wide range of inhibition potencies that appear to be based upon the position of the substituted side chain. Similar to D. citri all ortho substituted inhibitors were substantially less potent when compared to meta substituted inhibitors. A 19 fold difference in inhibion was observed between propoxur and bendiocarb whereas a 170 fold difference in inhibition was observed betwe en PRC 331 and PRC 421, the most and least potent experimental inhibitors Of the experimental carbamate s, a 2.4 fold difference was observed between meta substituted compounds and up to a 14 fold difference was observed between the ortho substituted compounds (Table 5 2) 5.3.1.3 Model o rganisms The flies, Drosophila melanogaster and Musca domestica were shown to possess similar inhibition potencies to both standard and experimental carbamates (Table 5 3) The most potent commercial inhibitor was bendiocarb which was 2.6 fold ( Md AChE) to 3.8 fo ld ( Dm AChE) more potent when compared to propoxur. The experimental inhibitor PRC 408 was the most potent inhibitor for both fly s pecies with inhibition values 23 to 1 3 fold more active than PRC 421 for Dm AChE and Md AChE, respectively (Table 5 3 ) Huma n AChE was found to be much less sensitive to the experimental carbamates when compared to both fly and mosquito species.

PAGE 134

134 PRC 331 and PRC 421 were found to be the most and least potent inhibitors, respectively, for human AChE. Torpedo californica AChE in hibition values were obtained from Jiang et al. (submitted 2012 ) and are included in this dissertation as a model fish species Tc AChE inhibition values suggest the enzyme is much more sensitive to meta substituted inhibitors as the IC 50 values of these compounds range from 167 nM to 221 nM, a 1.3 fold difference. However, PRC 421, an ortho substituted carbamate, is 44 fold less potent when compared to PRC 331 (Table 5 3) 5.3.2 Human Selectivity and Mammalian Toxicity of Experimental Carbam ates Data show th at that the experi emental carbamates possess selectivity values ( human IC 50 / Ag AChE IC 50 ) of up to 261, an 87 fold increase in selectivity when compared to propoxur (Table 5 3 ) The experimental carbamates, PRC 331 and PRC 388 had the lo west SR values no more than 2 fold. The ortho substituted experimental carbamates were found to be substantially more selective with SR values ranging from 16 to 261 fold over human AChE (Table 5 3 ). These selectivity ratios were also reported in Jian g et al., (submitted, 2012). Mouse toxicity data support the in vitro results as the experimental inhibitors were at least 10 fold less toxic when compared to propoxur. The least toxic inhibitors to the mouse was PRC 408 and PRC 421 with LD 50 mg/kg and >2000 mg/kg, respectively. 5.3.3 Selectivity of Experimental Carbamates Over Agricultural Insects S electivity ratios are used to express in vitro selectivity differences between An gambiae AChE the enzyme for which the experimental carbamates were designed, and various agricultural insect AChE s as shown in Table 5 4 Selectivity ratios (SR) were compared to An gambiae IC 50 values since the experimental carbamates were designed to control this particular species of mosquito. Selectivity rati os of commercial carbamates were found to be 1 to 2 fold for D. citri and A. mellifera yet ranged from 2 to 15 fold selective for O. nubilalis. Propoxur

PAGE 135

135 was found to be the most selective commercial carbamate (15 fold) for O. nubilalis but was 13 fold less selective than PRC 408, the most selective experimental carbamate (Table 5 4) PRC 408 was found to be 97 fold more selective than bendiocarb. Commercial carbamates were found to be poorly selective over the Ag AChE enzyme for D. citri and s electivi ty of experimental carbamates were found to range from 0.9 fold (PRC 388) to 30 fold (PRC 408). PRC 408 was found to be 15 fold more selective than either commercial carbamate studied (Table 5 4) Commercial carbamates bendiocarb and propoxur were found to be 1 to 2 fold selective over Ag AChE for Am AChE Experimental carbamates displayed SR values over Ag AChE ranging from 0.3 fold (PRC 331) to 12 fold (PRC421), and PRC 331, 337 and 388 were negatively selective for Am A ChE. However, PRC 408 and PRC 421 were up to 11 and 12 fold more selective than the commercial carbamate bendiocarb, respectively (Table 5 4) 5.3.4 Toxic ity of Methylcarbamates Toxicity of carbamates was assessed through topical bioassays to determine the LD 5 0 values ( Table 5.5 ) Experimental carbamates were found to range in LD 50 20 fold, with PRC 331 and PRC 421 being the most and least toxic to An gambiae respectively. These data support the in vitro data as they were the most and least potent inhibitors as well (Table 5 5 ). The two commercial carbamates were found to have an LD 50 of 3 ng/insect (propoxur) and 2 ng/insect (bendiocarb) to An. gambiae adults. The experimental inhibitor, PRC 331, was found to be nearly equitoxic when compared to the two c ommercial carbamates. Excluding PRC 421, all other experimental carbamates were considered to be highly toxic to An gambiae with LD 50 values Ae. a egypti w hen compared to An. gambiae as LD 50 v alues ranged from a 1.4 to 18 fold difference when compared to propoxur (LD 50 : 5 ng/insect ). PRC 331 was found to be nearly equitoxic to Ae.

PAGE 136

136 aegypti when compared to propoxur and was 3 fold less toxic when compared to bendicoarb. As with Ag excluding PRC 421, LD 50 values were found to be 23 ng/ insect and were deemed to be highly toxic to Ae aegypti. Toxicity of methylcarbamates to Cu. quinquefasciatus was found to be substantially less with commercial and experimental carbamates b y 3 to 11 fold when compared to An. gambiae However, the least toxic carbamate, PRC 421 was found to be nearly equitoxic fold difference) to all three mosquito species Interestingly, the experimental carbamates possessed low toxicity to Ostrin ia nubilalis Bendiocarb was found to have an LD 50 of 10 1 ng/insect 23 fold more toxic than the most toxic experimental carbamate (PRC 331). Experimental carbamates and propoxur were all toxic at low micro gram doses to Ostrinia These data correlate wi th the poor potency activity that was observed during the in vitro analysis. 5.4 Discussion The curren tly registered carbamates (eg. p ropoxur, bendiocarb, carbofuran, etc) could be improved upon due to the minimal selectivity the compounds possess. To compound the issue, the increasing prevelance of pyrethroid resistant mosquitoes has increased the need for the design of chemicals with a novel mode of action to augment current control methods. Similarly, mosquito control in South Florida relies on ultra low volume spraying of organophosphates to control A e. aegypti and the spread of dengue fever. Insecticide resistance and the incidental toxicity to endangered insects has li mited the uses of c urrently utilized insecticides, amplifying the need for the development of novel chemicals. All mosquito species studied were highly sensitive to the experimental carbamates (Table 5 1) and most novel carbamates were found to be toxic at levels equal or n ear that of propoxur (Table 5 5 ) Literature suggests that alkyl substituents at the meta position of the phenyl ring are more potent inhibitors than substitutions at the ortho position ( Metcalf, 1971; Kuhr and

PAGE 137

137 Dourou gh, 1976 ). Although this was true f or the agriculturally relevant insects, this trend was not observed for the potency of mosquitoes as PRC 331 and PRC 408 were nearly equipotent in all five mosquito species studied. Among the ortho substituted carbamates, propoxur and PRC 421 both possess an alkoxy link age to the phenyl ring while PRC 337 and PRC 408 are thioethers (Fig. 5 1) The structural similarities between PRC 421 and propoxur likely explain the similar inhibition potencies observed across all mosquito species. However, it is interesting to note that although both are thioethers substituted in the ortho posi tion, PRC 408 is approximately four fold more potent than PRC 337 across all mosquit o species. This reduction of activity s uggests the double bond in PRC 337 prevents flexibility, making the enzyme less accommodating to the rigid structure. The high activity obs erved with PRC 408 was reduced four t o five fold by replacing the sulfu r wi th an oxygen (PRC 421). Similarly meta substitution of a silicon group in the side chain of PRC 388 causes a reduction in potency when compared to the t butyl group of PRC 331 suggesting the larger silicon group reduces the acces to the catalytic site in all mosquito species. Selectivity against human AChE is of critical importance for development of insecticides with the intended use being ITN deployment. Mouse toxicity data for p ropoxur, a WHO approved carbamate for mosquito control, has a mammalian LD 50 of 2 4 mg/kg (Black et al., 1973) and is ten fold more t oxic when compared to PRC 331 (2 54 mg/kg) to mice Branching schemes containing a sulfer or oxygen atom off the ortho position, as seen in PRC 408 and PRC 421, decreases the mammalian toxicity by up to 75 fold when compared to Propoxur. These data suggest the novel carbamates are substantially safer than the currently utilized methylcarba ma tes for malaria control. Previous studies (Hartsel et al., 2012) have shown models suggesting Ag AChE has a larger ligand pocket when compared to h AChE This larger binding pocket of

PAGE 138

138 Ag AChE likely accepts inhibitors with an increased steric bulk approximately two bonds away from the phenyl core with a greater affininty when compared to h AChE, yieldin g selectivity. Therefore, the larger 2 substituted side chains (PRC 388) have a reduced mammalian selectivity when compared to the smaller 2 subs t ituted side chain in PRC 331. Similarly, the longer and more rigid ortho subs t ituted side chains have reduce d SR values when compare d to the more flexible, and somewhat shorter, ortho substituted side chains (Hartsel et al., 2012; Jiang et al., submitted). Although the novel carbamates were found to possess high activity a gainst mosquito species and low activi ty against mammalian models it is also critical to understand the activity of the chemicals to agricultural pests and non target organisms. Broad spectrum insecticides were once favored for commercialization due to the ability to ta r get numerou s pests wi th the same chemical. However, i nsecticide resistance of mosquitoes due to agricultural uses has been documented and specifically a ffects insecticide design for disease contro l. W idespread agricultural use of pyrethroids has been implicated in exacerbating development of resistance to insecticides with the same mode of action when used in ITNs ( Yadouleton et al., 2009) Currently, lepidopteran insect pests are considered to be the most important insect pest of maize in Africa and are the cause of substantial food loss throughout the continent 2006). Specifically, Chilo partellus (Swinhoe) (Lepidoptera: Crambidae) is a lepidopteran stem o et al., 200 6). The European corn b orer, Ostrinia nubilalis (Lepidoptera: Crambidae), was studied due to its relatedness to Chilo partellus in an effort to determine the activity of novel carbamates to lepidopteran pests. Results s how high selectivity for Ag AChE ove r lepidopteran AChE enzyme

PAGE 139

139 with all novel carbamates (Table 5 4 ) suggesting advantageous properties for mitigation of insecticide resistance through reducing the ancillary uses of the chemicals in crop pest control The novel carbamates with meta positioned side chains were inversely selective against D. citri and A. mellifera whereas the ortho substituted carbamates were up to 30 fold selective. Additionally, propoxur, a commercialized ortho substituted carbamate, and the ortho substituted expe rimental inhibitors were found to be poor inhibitors of D. citri and A. mellifera which likely indicates the se proteins are less accommodating to alkane substituted side chains in the ortho position versus the meta position. These data suggest ortho subs tituted, branched carbamates comprise a promising approach to more selective carbamates against An. gambiae based upon the high mosquito activity and poor agricultural insect activity. Control of A e. aegypti in the state of Florida is becomine increasing ly difficult due to insecticide resistance and the large abundance and diversity of environmentally sensitive lands fo und within the Florida complicate the problem of controlling mosquito vectors (Zhong et al., 2010; Zhong, 2007). One organism of interest is Cyclargus thomasi bethunebakeri or the Miami B lue Butterfly (MBB). The MBB is a coastal butterfly that inhabits sunny areas at the edge of tropical hardwood forests (Zhong, 2007). This species of insect is considered to be o ne of the rarest insects in North America and was declared to be endangered by the state of Florida in 2002. Currently, Bahia Honda Key State Park is the only isolated population of MBB that remains flourishing in the wild (Center of Biodiversity, 2005). Due to this being the only wild population remaining, there are large controversies over utilizing insecticides for dengue control near potential MBB habitats. It is plausible to suggest utilization of the novel carbamates discussed in this study could be implemented for successful dengue control while allowing the population of the endangered butterfly species to grow in the presence of the insecticides.

PAGE 140

140 In conclusion, the potent AChE inhibition of mosquito AChE and previously undocumented levels of h igh mouse oral toxicity coupled with the low activity to agricultural insects suggest these are likely candidate insecticides to be employed into any mosquito control program The general lack of activity against agricultural pests suggests avoidance of c ross resistance development in non target species from incidental insecticide exposure from agricultural uses.

PAGE 141

141 Figure 5 1. Chemical structures of methylcarbamates tested for activity to mosquito vectors and agricu lturally relevant insects Bendiocarb and car bofuran are not shown due to their presence in the literature and unrelated charac teristics when compared to the experimental carbamates

PAGE 142

142 Table 5 1. Mean (n=3) inhibition potencies of commercial and experimental methylcarbamates to five mosquito species in the genera Anopheles and Aedes Abbreviations are as follows: Ag AChE ( Anopheles gambiae ), Aa AChE (Anopheles albimanus ), Aq AChE ( Anopheles quadr imaculatus ), Ae AChE ( Aedes aegypti ), Ab AChE ( Aedes albopictus ). Mean IC 50 (nM; 95% CI) Ag AChE Aa AChE Aq AChE Ae AChE Ab AChE Propoxur 445 (267 623) 481 (319 643) 428 (335 521) 369 (304 433) 352 (257 447) Carbofuran 47 (25 68) 55 (43 68) 43 (29 57) 41 (27 54) 46 (10 81) Bendiocarb 172 (80 264) 182 (96 268) 137 (83 190) 127 (81 173) 137 (96 177) PRC 331 104 (80 128) 100 (80 119) 93 (73 111) 79 (39 118) 87 (73 100) PRC 337 476 (356 596) 379 (283 474) 390 (342 439) 275 (213 337) 332 (280 384) PRC 388 221 (116 325) 217 (153 282) 281 (223 338) 341 (253 429) 288 (223 353) PRC 408 106 (85 128) 93 (75 110) 92 (66 117) 208 (146 270) 177 (110 245) PRC 421 431 (254 607) 546 (392 700) 565 (383 746) 756 (708 803) 574 (452 695)

PAGE 143

14 3 Table 5 2. Mean (n=3) inhibition potencies of commercial and experimental methylcarbamates to agriculturally relevant insects. Mean IC 50 (nM; 95% CI) P. xylostella AChE O. nubilalis AChE D. citri AChE A. mellifera AChE Propoxur 3322 (2524 4121) 6710 (4774 8646) 942 (689 1194) 941 (853 1030) Bendiocarb 217 (143 291) 336 (229 442) 92 (62 121) 49 (34 64) PRC 331 675 (370 980) 2933 (2541 3325) 128 (100 156) 32 (17 47) PRC 337 1681 (1396 1965) 10847 (8148 13546) 1067 (812 1345) 379 (307 451) PRC 388 3411 (3162 3660 7794 (7073 8516) 210 (147 273) 77 (29 125) PRC 408 52166 (42756 61578) 20640 (14831 26449) 3193 (2833 3552) 1242 (883 1601) PRC 421 > 100 uM 81940 (71788 92092) 6189 (5786 6591) 5440 (3990 6890)

PAGE 144

144 Table 5 3. Mean (n=3) inhibition potencies of commercial and experimental methylcarbamates to AChE of model organisms. Tc AChE inhibition values were previously reported in Jiang et al. (submitted in 2012). Mean IC 50 (nM; 95% CI) D. melanogaster AChE M. domestica AChE Human AChE T. californica AChE Propoxur 104 (48 159) 152 (106 199) 1442 (1255 1629) 1563 + 145 Bendiocarb 27 (9 44) 58 (36 79) 182 (113 250) 126 + 16 PRC 331 97 (66 129) 181 (142 220) 233 (154 -311) 167 + 27 PRC 337 131 (78 183) 156 (129 182) 8035 (7743 8327) 1300 + 83 PRC 388 279 (315 343) 488 (434 541) 451 (431 470) 221 + 40 PRC 408 23 (8 38) 51 (14 87) 5127 (4871 5383) 585 + 83 PRC 421 482 (334 630) 654 (493 815) 112600 (72489 152711) 7430 + 699

PAGE 145

145 Table 5 4 Selectiviy ratios (SR) obtained from in vitro inhibition potencies. SR values are expressed as follows: SR 1 = O. nubilalis AChE IC 50 / Ag AChE IC 50 ; SR 2 = D. citri AChE IC 50 / Ag AChE IC 50 ; SR 3 = A. mellifera AChE IC 50 / Ag AChE IC 50 ; SR 3 = h AChE IC 50 / Ag AChE IC 50 Inhibitor SR 1 SR 2 SR 3 SR 4 Propoxur 15 2 2 3 Bendiocarb 2 2 1 1 PRC 331 28 1.2 0.3 2 PRC 337 23 2.2 0.8 16 PRC 388 35 0.95 0.3 2 PRC 408 194 30 11 48 PRC 421 190 14 12 261

PAGE 146

146 Table 5 5. Topical toxicity of methylcarbamates to three mosquito species and the European Corn Borer, Ostrinia nubilalis An. gambiae Ae. aegypti Cu. Quinquefasciatus O. nubilalis Inhibitor LD 50 (ng/bug; 95% CI) LD 50 (ng/bug; 95% CI) LD 50 (ng/bug; 95% CI) LD 50 (ng/bug; 95% CI) Propoxur 3 (2 4) 5 (4 6) 20 (16 23) 1045 (931 1119) Bendiocarb 2 (1 4) 2 (1 4) 6 (3 8) 101 (91 111) PRC 331 4 (3 6) 7 (2 11) 14 (11 17) 2379 (2226 3134) PRC 337 12 (8 17) 19 (10 25) 85 (74 96) 3310 (2905 3691) PRC 388 8 (6 10) 12 (9 15) 92(82 106) 3189 (2745 3609) PRC 408 10 (5 17) 23 (19 28) 50 (45 56) 2842 (2503 3119) PRC 421 81 (63 100) 92 (77 111) 83 (77 90) 3826 (3493 4580)

PAGE 147

147 CHAPTER 6 C ONCLUSIONS The first objective of this dissertation research aimed to address potential interactions between solvent and target proteins during the high throughput screening process of insecticides. I performed enzyme kinetic studies to support the previous results of DMSO mediated antagonism of mosquito AChE inhibition (Swale, 200 9). The bimolecular rate constant (ki) was utilized to determine the effect of 0.1 % DMSO on the carbamoylation reaction of Ag AChE and supported the IC 50 data collected in Swale (2009). Both in vitro experimental systems showed a decreased inhibition of mosquito selective carbamates when in the presence of 0.1 % DMSO, but no inhibition differences were observed with non selective carbamates or human AChE. Molecular models suggest the selectivity of our novel carbamates and antagonist effects of inhibiti on is likely due to flexibility of W84 and W431 ( Ag numbering) within the hydrophobic subpocket of Ag AChE. The corresponding residues within h AChE are hydrogen bonded with Y449 ( h), producing a rigid enzyme structure within the hydrophobic subpocket. Mole cular models also suggest that DMSO is capable of hydrogen bonding with the indole nitrogens of W84/W431 ( Ag numbering ) and D441 within Ag AChE, forming a DMSO stabilized Ag AChE to have a more rigid st ructure approaching that of h AChE, thereby inhibiting highly branched (selective) experimental carbamates from binding to the target site. These findings have large implications for high throughput screening processes of insecticides, usually performed b y industrial chemical companies, as companies using one protocol to screen for selective mosquitocides, and specifically AChE, are likely discarding prospective lead compounds.

PAGE 148

148 Future studies would be to continue to isolate the mechanism of antagonism to ward inhibition through site directed mutagenesis. Substitution of Y449 of h AChE to an aspartate would allow for similar experiments to determine if the paralogous substitution is responsible for both, selectivity and antagonism of inhibition. Studies wi th bivalent inhibitors and/or tacrine dimers would also be useful to determine if the DMSO mediated stabalization would alte r the enzyme stucture to affect dual site binding of inhibitors. The second objective of this dissertation research was two fold. First, we characterized the inhibitor profile of aceylcholinesterases from Boophilus microplus ( Bm AChE1 ) and Plebotomus papatasi ( Pp AChE ) compared to human and bovine AChE, in order to identify divergent pharmacology that might lead to selective inhibitors. Secondly, we performed a screen of highly potent and selective experimental carbamate inhibitors that can assist in the control of Bm and Pp populations. Results indicate that Bm AChE1 has uniquely low sensitivity (IC 50 = 220 M) toward tacrine, an inhibitor with nanomolar blocking potency in all previous species tested, including Phlebotomus papatasi (IC 50 = 205 nM) Molecular homolog y models indicate that the paralogous substitution W384/Y337 inhibit s ligand binding in Bm AChE1 In addition, Bm AChE1 and Pp AChE display low nanomolar sensitivity to a variety of carbamate insecticides. Compound 6 2 ((2 ethylbutyl)thio)phenyl methylcarb amate (IC 50 = ca. 15 nM in both species) possesses greater than 350 fold selectivity for Bm AChE1 and Pp AChE over mammalian AChE and a mouse oral LD 50 of greater than 1500 mg/kg. These findings have significant implications for the future design of selective and resistance mitigating inhibitors for the control of vectored diseases by Bm and Pp The non selective inhibitor, tacrine, yielded a 1000 fold difference in the inhibition profile for Bm AChE1

PAGE 149

149 over Pp AChE indicating a unique AChE gorge geomet ry. The high potency of carbamates 6 toward Bm AChE1 and Pp AChE in conjunction with the low mammalian activity provides an attractive alternative and superior insecticide for Bm and Pp control. Future work would be to isolate the remaining paralogous subs titutions, other than W384, within the r Bm AChE1 protein that reduces the binding activity of tacrine and bivalent inhibitors. Due to W384F only partially restoring the activity of tacrine, it is plausible to suggest other substitutions remain that could b e utilized to gain a better understanding of the Bm AChE protein. A better understanding of the protein structure could then be used to create further selective and resistance mitigating inhibitors. After a clearer picture of the Bm AChE protein is determi ned, it would also be possible to design bivalent ligands that could take advantage of the unique paralogous substitutions within Bm AChE1. Also, due to the substantially increased selectivity and equipote n cy observed with carbamate 6 when compared to coum aphos oxon, it would be reasonable to analyze further analogs of ortho substituted carbamates thiol linkers. The third objective of this dissertation research was to characterize the toxicity and the mode of action of DEET neurotoxicity and compare its action to known anticholinesterases local anesthetics and oc topaminergic chemical. Here the goal was to provide insights into the specific targ ets of DEET with respect to acute toxicity. Recent studies have also raised the possibility that DEET is an AChE inhibitor and that this action may contribute to its effects in insects, and cause risk of toxicity in exposed individuals. A n understanding of DEET neurotoxicity is vital for its contin ued use as a repellent. Results indicate that DEET is lethal to mosquitoes at topical doses in the microgram range (2 4 g), but DEET is an extremely poor AChE inhibitor in mosquitoes (<10% inhibition), even at a concentration of 10 mM. AChE enzymes from human, Drosophila melanogaster and

PAGE 150

150 Musca domestica are slightly more sensitive with IC 50 values ranging between 5 and 10 mM. Phentolamine was found to completely block the CNS neuroexcitation of DEET and octopamine, but was not found to be an effective b locker of propoxur. This finding suggests DEET is likely targeting octopaminergic synspases and not acetylcholinesterase to induce toxicity. To conclude, it is unlikely that DEET exerts its toxicity through anticholinesterase properties due to its low po tency for enzyme inhibition and the block of CNS neuroexcitation with phentolamine Thus it is plausible to suggest that toxicity to houseflies and likely mosquitoes, is through a mimicking action of the neurotransmitter octopamine in the octopaminergi c system as was portrayed with the CNS recordings per formed with phentolamine. Numbn ess of mammalian mucous membranes is potentially explained through an anesthetic effect of nerve conduction block. Future studies would be to determine the action of DEE T within inta ct mosquitoes through in situ record ings of the flight motor reflex pathway s using brain stimulation and recording dorsolongitudinal muscle activation Such a stud y would provide evidence for the action of DEET is within the mosquito and coul d be compared to formamidine, carbamates, and anesthetic compounds. Also, to continue to isolate the potential DEET is acting on the octopaminergic system, studies could be performed using the firefly light organ as in this tissue the primary neurotransmi tter is octopamine. Application of DEET would determine if it is capable of activating the lanterns In vitro biochemical analyses could also be performed through binding studies of DEET to the octopamine receptor within the firefly lantern and measuring cAMP production

PAGE 151

151 The final objective of this dissertation research was to determine the in vitro and in vivo activity of experimental insecticides to other nuisance biting mosquitoes, model organisms, and agricultural pests. These findings wi ll provide us with a broader perspective on the potential toxicity of these compoinds to other insects and could show advantageous properties for resistance management. Accounting for mosquito resistance toward insecticides is vital when developing mosq uitocides for disease control. Insecticide resistance of mosquitoes due to agricultural uses has been documented and specifically effects insecticide design for disease control. W idespread agricultural use of pyrethroids has been implicated in exacerbat ing development of resistance to insecticides with the same mode of action when used in ITNs. Development of highly selective insecticides with poor toxicity to agricultural pests, and therefore less ancillary uses, can mitigate resistance through reduced selection pressure within breeding sites. Results indicate unique insect selectivity among the novel carbamates as they were found to be selective for mosquitoes over agricultural pests (190 fold) and human (260 fold) enzymes. Mouse oral toxicity showe d promising results as the experimental inhibitors were at least 10 fold less toxic when compared to propoxur (24 mg/kg). The least toxic inhibitors to the mouse were found to be PRC 408 and PRC 421 with LD 50 respectively. In conclusion, the potent AChE inhibition of mosquito AChE and previously undocumented levels of low mouse oral toxicity coupled with the low activity to agricultural insects suggest these are likely candidate insecticides to be employed into any mosqu ito control program. The general lack of activity against agricultural pests suggests avoidance of cross

PAGE 152

152 resistance development in non target species from incidental insecticide exposure from agricultural uses. Future studies on the design of future mos qutocides would be to further analyze the ortho substituted, branched carbamates as they comprise a promising approach to more selective carbamates against An. gambiae Studies to determine the effectiveness and degree of resistance management through a combination of novel carbamates and pyrethroids would be of use to enhance the currently utilized control methods within Africa while retaining the low non target toxicity shown in this study.

PAGE 153

153 LIST OF REFERENCES Abbot WS. ( 1925 ) A method of computing the effectiveness of an insecticide. Journal of Economic Entomology. 18: 265 267. Abou Doina M, Wilmarth K, Jensen K, Oehme F, Kurt T. (1996). Increased neurotoxicity following concurrent exposure to pyridostigmine broke, DEET, and chlorpyrifos. Fu ndamental and Applied Toicology 34:201 Aldridge W. ( 1953 ) Serum esterases: Two types of esterase (A and B) hydrolyzing p nitrophenyl acetate, propionate, and butyrate, and a method for their determination. Journal of Biochemistry 53:110 120 Alexa nder B and Maroli M. (2003). Control of Phlebotomine Sandflies. Medical and Veterinary Entomology 17:1 18. Alexander B, Cadena H, Usma M, Rojas C. (1995 a ). Laboratory and field evaluations of a repellent soap containing diethyl toluamide and permethrin against phlebotomine sand flies in Valle del Cauca, Columbia. American Journal of Tropical Medicine and Hygiene. 52:169 Alexander B, Usma M, Cadena H, Quesada B, Solarte Y, Roa W, Travi B. (1995). Evaluation of deltamethrin impregnated bednets and curtains against phlebotomine sandflies in Valle del Cauca, Columbia. Journal of Medical and Veterinary Entomology 9:279 283 Anderson T, Hartsel J, Ma M, Mutunga J, Wong D, Wysinski A, Jackson B, Paulson S, Carlier P, and Bloomquist J. (2008). ACS 236 th National Meeting Philadelphia, PA. AGRO poster no. 79. Anderson T, Paulson S, Wong D, Carlier P, Bloomquist J. (2009). Pharmacological mapping of the acetylcholinesterase catalytic gorge in mosquitoes with Bis (n) tacrines, in Advances in Human Vector Control, eds. J. Clark. ACS Symposium Series; American Chemical Society: Washington, DC. ASTM, (1987), E 1163 87, Standard Test Method for Estimating Acute Oral Toxicity in Rats, Amer. Soc. Test. Mat., Philadelphia PA, USA Attaran A and Maharaj R. (2000). Doctoring malaria, badly: the global campaign to ban DDT. British Medical Journal. 321:1403 1405. Ayad H and Georghiou G. ( 1975 ) Resistance to organophosphates and carbamates in Anopheles albimaus based on reduced sensitivity of acetylcholinesterase Journal of Economic Entomology. 68: 295 297. Baker M. (1996). Fur rubbing: Use of medicinal plants by capuchin monkeys. Ameri can Journal of Primatology 38:263

PAGE 154

154 Bar On P, Millard C, Harel M, Dvir H, Enz A, Sussman J, Silman I. (2002). Kinetic and structural studies on the interaction of cholinesterases with the anti Alzheimer drug rivastigmine, Biochemistry. 41:3555 3564. Barbazan P, Baldet T, Dariet F, Escaffre H, Haman Djoda D, and Hougard JM. (1997). Control of Culex quinquefasciatus (Diptera: Culicidae) with Bacillus sphaericus in Maroua, Cameroon. Journal of American Mosquito Control Association. 13(3):263 269. Ba rtolucci C, Perola E, Pilger C, Fels G, Lamba D. (2001). Three dimensional structure of a complex galanthamine with acetylcholinesterase from Torpedo Californica: Implications for the design of new anti Alzheimer drugs. Proteins. 42(2): 182 189. Basimi ke M. and Mutinga, M. (1995). Effects of permethrin treated screens on phlebotomine sandflies, with reference to Phleboto mus martini (Diptera: Psychodidae). Journal of Medical Entomology. 32:428 432. Baxter G and Barker S. (1998). Acetylcholineste rase cDNA of the cattle tick, Boophilus microplus : characterization and role in organophosphate resistance. Insect Biochemistry and Molecular Biology. 28:581 589 Bay E. (1967). Mosquito control by fish: A present day appraisal. WHO Chronicles. 21:415 423. Berg H. (2009). Global status of DDT and its alternatives for use in vector control to prevent disease. Environmental Health Prospective. 117(11): 1656 1663 Bhattacharjya S and Balaram P. (1997). Effects of organic solvents on protein structur es: observations of a structured helical core in hen egg white lysozyme in aqueous DMSO. Protein: Structure, Function and Genetics. 29:492 507. Black A, Chiu Y, Fahmy M, and Fukuto T. (1973). Selective Toxicity of N sulfenylated derivatives of insect icidal methylcarbamate esters. Jouranl of Agricultural and Food Chemistry. 21:747 751 Bloomquist J, ffrench Constant R, Roush R. (1991). Excitation of central neurons by dieldrin and picrotoxinin in susceptible and cyclodiene resistant strains of Dros ophila melanogaster (Mei gen). Pesticide Sci ence. 32:463 469 Bloomquist J. (1999). Insecticides: Chemistries and Characteristics. Textbook. University of Minnesota, St. Paul, MN. Bloomquist J. ( 1998 ) Chemistry and Toxicology of the chlorinated cyclodienes and lindane. In: Reviews in Toxicology. Vol 2, no 5 6, ppp. 333 355. Booth G and Lee A. (1971). Distribution of cholinesterease in insects. WHO Bulletin. 44:91 98

PAGE 155

155 Borovsky D. (2003). Trypsin modulating oostatic factor: a potential new larvicide for mosquito control. Journal of Experimental Biology. 206: 3869 3875. Bourne Y, Kolb H, Radic Z, Sharpless K, Taylor P, and Marchot P. (2004). Freeze frame inhibitor captures acetylcholinesterase in a unique conformation. Proceedings of the National Academy of Sciences. 101: 1449 1454. Bourne Y, Taylor P, Bougis P, Marchot P. (1999). Crystal structure of mouse acetylcholinesterase: A peripheral site occluding lo op in tetrameric assembly. Journal of Biological Chemistry 5:2963 2970 Bram R, George J, Reichrd R, Tabachnick J. (2002). Threat of foreign arthropod borne pathogens to livestock in the United States. Journal of Medical Entomology. 39:405 416. Bria ssoulis G, Narlioglou M, Hatzis. (2001). Toxic encephalopathy associated with the use of DEET insect repellents: a case analysis of its toxicity to children. Human and Experimental Toxicology 20:8 Brogdon W, McAllister J, and Vulule J. ( 1997 ) Heme peroxidase activity measured in single mosquitoes identifies individuals expressing the elevated oxidase mechanism for insecticide resistance. Journal of American Mosquito Control Association. 13:233 237 Brogdon and McAllister. (1998). Insecticide re sistance and Vector control. Emerging Infectious Diseases. 4:4 10 Brown AW. ( 1986 ) Insecticide resistance in mosquitoes: a progmatic view. Journal of American Mosquito Control Association. 2:123 140. Bruce R. (1985) An Up and Down Proce dure for Acute Toxicity Testing. Fundamental Applications of Toxicology. 5: 51 157. Bull D and Ahrens E. (1988). Metabolism of coumaphos in susceptible and resistant strains of Boophilus microplus (Acari: Ixodidae), Journal of Medical Entomology. 25: 94 98. Bu nn R, Knoght K, Lacasse W. (1955). The role of entomology in the preventive medicine program of the armed forces. Military Medicine. 116:119 Calhoun E. (1963). The physiological significance of acetylcholine in insects and observations upon other ph armacologically active substances. Advances in Insect Physiology 3:480 482 Carlier P, Han Y, Chow E, Li C, Wang H, Lieu T, Wong H, Pang Y. (1999). Evaluation of short tether Bis THA AChE inhibitors: A further test of the dual binding site hypothesis. Bioorganic Medicinal Chemistry 7: 351 357

PAGE 156

156 Carlier P, Anderson T, Wong D, Hsu D, Hartsel J, Ma M, Wong E, Choudhury R, Lam P, Totrov M, Bloomquist J. ( 2008). Towards a Species Selective Acetylcholinesterase Inhibitor to Control the Mosquito Vector of Malaria, Anopheles gambiae. Chemico Biological Interactions. 175: 368 75. Carroll J, Klun J, Debboun M. (2005). Repellency of DEET and SS220 applied to skin in volves olfactory sensing by two species of ticks. Journal of Medical Entomology. 19:101 106 CDC, MMWR (Morbidity and mortality Weekly Report). ( 2010 ) Locally Acquired Dengue Key West, Florida, 2009 and 2010. 59(19):577 581 Charlwood D. (2003). Did Herodotus describe the first airborne use of mosquito repellents. Trends in Parisitology. 19:555 Chen H, Liao Z, Hui X, Li G, Li F, and Han Z. (2009). Ace2 rather than ace1 is the major acetylcholinesterase in the silkworm, Bombyx mori. Insect Science. 16:297 303. Cheng X, Hochlowski J, Tang H, Hepp D, Beckner C, Kantor S. (2003). Studies on repository compound stability in DMSO under various conditions. Journal of Bimolecular Screening 8:292 304 Cheng X, Hochlowski J, Teutsch S, Liu S, Hightower A, and Sexton J. (2003). Studies on repository compound stability in DMSO under various conditions. Journal of Bimolecular Screening 8: 292 304 Chiang F and Sun C. (1993). Glutathione transferase isozymes of diamondback moth larvae and their role in the degradation of some organophosphorus insecticides. Pesticide Biochemistry and Physiology. 45:1 7 Choi H, Breman J, Teutsch S, Liu S, Hightower A, and Sexton J. (1995). The effectiveness of insecticide impregnated bed nets in reducing the gases of malaria infection: a meta analysis of published results. American Journal of Tropical Medicine and Hygiene 52:377 382. Christophers R. (1960). Aedes aegypti (L.), the Yellow Fever Mosquito Cambridge Univ Press, Cambridge, pp 739. Clem J, Havemann D Raebel M. (1993). Insect repellent (N,N Diethyl m toluamide) cardiovascular toxicity in an adult. Ann pharacother 27: 289 293 ClustalW and ClustalX. Current protocols in bioinformatics. Aug;Chapter Cohen J and Oosterbaan R. (1963). The active site for acetylcholinesterase and related esterases and its reactivity toward substrates and inhibitors. Handbuch der Exper imentellen Pharmakologie. 15: 300 373.

PAGE 157

157 Collins F, Mendez M, Rasmussen M, Mehaffe y P, Besansky N, and Finnerty V. (1987). A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. American Journal of Tropical Medicine and Hygiene. 37:37 44. Coluzzi M. (1984). Heterogeneities of the malaria vectorial system in tropical Africa an their significance in malaria epidemiology and control. Bulletin of the World Health Organization. 62:107 113 Conn J, Vineis J, Bollback J, Onyabe D, Wilkerson R, Povoa M. (2006). Population structure of the malaria vector Anopheles darlingi in a malaria endemic region of Eastern Amazonian Brazil. American Journal of Tropical Medicine and Hygeine. 74(5): 798 8 06 Copeland, R. (2005). Evaluation of enzyme inhibitors in drug discovery: A guide for medicinal chemists and pharmacologists. John Wiley and Sons, Inc., Eds. Hoboken, NJ, USA. Corbel V, Stankiewicz M, Pennetier C, Fournier D, Stojan J, Girard E, Di mitrov M, Molgo J, Hougard J, Lapied B. (2009). Evidence for inhibition of cholinesterases in insect and mammalian nervous systems by the insect repellent DEET. BMC Biology 7:47 Costa L and Murphy S. (1987 ). Interaction of the pesticide chlordimefo rm with adrenergic receptors in mouse brain: an in vitro study. Archives of Toxicology. 59: 323 357 Covell G. (1943). Anti mosquito measures with special reference to India. Health Bulletin. 11:1 60 Curtis C, Lines J, Ijumba J, Callaghan A, Hill N, Karimzad M. (1987). The relative efficacy of repellents against mosquito vectors of disease. Medical and Veterinary Entomology. 1:109 Curtis C, Maxwell C, Finch R, and Njunwa K. (1998). A comparison of use of a pyrethroid either for house spraying or for bednet treatment against malaria vectors. American Journal of Tropical Medicine and Hygiene 3:619 631. Davis E and Sokolove P. (1976). Lactic acid sensitive receptors on the antennae of the mosquito, Aedes aegypti. Journal of Comparative Physiology. 105:43 54 Desjeux P. (2001). The increase in risk factors of leishmaniasis worldwide. (2001). Tropical Royal Society of Tropical Medicine and Hygeine. 95:239 245 Ditzen M, Pellegrino M, Vosshall L. (2008). Insec t odorant receptors are molecular targets of the insect repellent DEET. Science. 319:1838 1842 Dixon W and Mood A. (1948). A method for obtaining an Analyzing sensitivity Data, Journal of American Statistics Association. 43: 109 126.

PAGE 158

158 Djouaka R, Bakar e A, Coulibay O, Akogbeto M, Ranson H, Hemingway J, and Strode C. elevated in multiple pyrethroid resistant populations of Anopheles gambiae s.s from Southern Benin and Nige ria. BMC Genomics. 9:538 Dogan E, Ayres J, Rossignol P. (1999). Behavioural mode of action of DEET: Inhibition of lactic acid attraction. Medical and Veterinary Entomology. 13:97 100 Eichler J, Anselmet A, Sussman J, Massoulie J, Silman I. (1994). Differential effect of Molecular Pharmacology 45:395 398 Ellenhorn M. (1997). poisoning. 2 nd edition. Baltimore: William and Wilkins. Ellman G, Courtney K, Andres V, and Featherstone R. (1961). A new rapid colorimetric determination of acetylcholinesterase activity. Biochemical Pharmacology. 7:88 95. Elnaiem D, Aboud M, El Mubarek S, Hassan H, and Ward R. (1999). Impact of permethrin impregnated curtains on Phlebotomus papatasi sandflies indoors at Khartoum, Sudan. Medical and Veterinary Entomology 13:191 197 Falcao A, Pinto C, Gontijo C, Flaqueto A. (1991). Effect of deltametrin spraying on the sandfly populations in a focus of American cutaneous leismaniasis. Memrias do Instituto Oswaldo Cruz 4:399 404 Ferrari GV, Mallender W, Inestrosa N, and Rosenberry. (2001). Thioflavin T is a fluoresc ent probe of acetylcholinesterase peripheral site that reveals conformational interactions between the peripheral and acylation sites. Journal of Biological Chemistry. 276(26):23282 23287 Foster S, Kift N, Baverstock J, Sime S, Reynolds K, Jones J, Thomp son R, and Tatchell M. (2003). Association of MACE based insecticide resistance in Mysus persicae with reproductive rate response to alarm pheromone and vulnerability to attack by Aphidius colemani. Pest Management Science. 59: 1169 1178. Frances S. (1994). Response of a chigger to repellent and toxicant compounds in the laboratory. Journal of Medical Entomology. 24:165 Franco C, Hynes N, Bouri N, and Henderson D (2010). The Dengue Threat to the United States. Biosecurity and Bioterrorism: B iodefense Strategy, practice, and Science. 8(3) Fujita Y, Izumiguchi S, Noda Y. (1982). Effect of dimethyl sulfoxide and its homologues on the thermal denaturation of lysozyme as measured by differential scanning calorimetry. International Journal of Peptide and Protein Research. 19: 25 31. Fukuto T. (1990). Mechanism of Action of Organophosphorus and Carbamate Insecticides. Environmental Health Perspectives 87: 245 254

PAGE 159

159 Garcez W, Garces F, Silva L, Da G, and Haerski L. (2009). Larvicidal activity against Aedes aegypti of some plants native to the West Central region of Brazil. Bioresource Technology. 100(24): 6647 6650. George J, Pound J, Davey R. (2004). Chemic al control of ticks on cattle and the resistance of these parasites to acaricides. Parasitology 129:S353 S366 George J. Wildlife as a constraint to the eradication of Boophilus spp. (Acari: Ixodidae). (1990). Journal of Agricultural Entomology. 7:119 125. Gibney G, Camp S, Dionne M, MacPee Quigley K, Taylor P. (1990). Mutagenesis of essential functional residues in acetylcholinesterase. Proceedings of National Academy of Sciences 87: 7546 7550. Giles H and Warrell D. ( 1993 ) Bruce Essential Malariology 3 rd edition, Edward Arnold, London Graham O and Hourrigan J. (1977). Eradication programs for the arthropod parasites of livestock. Journal of Medical Entomology. 6: 629 658. Gratz N. (1991). Emergency control of Aedes aegypti as a disease vector in urban areas. Journal of the American Mosquito Control Association. 7(3):353 65. Greenwood B, Bradley A, Greenwood A, Byass P, Jammeh K, Marsh K, Tulloch S, Oldfield S, and Hayes R. (1987). Mortality and morbidity from lar aia among children in a rural area of The Gambia, West Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene. 81:478 486. Gubler D. (1998 b). Dengue and Dengue Hemorrhagic Fever. Clinical Microbiology Review. 11(3): 480 496. Gubler, D. (1989). Aedes aegypti and Aedes aegypt i borne Disease Control in the 1990s: Top Down or Bottom Up. 49th Franklin Craig Lecture delivered before the American Society of Tropical Medicine & Hygiene, Washington, DC. Gubler, D. (1998 a). Resu rgent Vector Borne Diseases as a Global Health Problem. Journal of Emerging Infectious Disease. 4(3): 442 450. Guessan R, Darriet F, Doannio J, Chandre F, and Carnevale P. (2008) Olyset Net efficacy against pyrethroid resistant Anopheles gambiae and Culex quinquefasciatus after 3 years' field use in Cte d'Ivoire. Journal of Medical Entomology. 15(1): 97 104 Gupta R and Rutledge L. (1991). Controlled release repellent formulations on human volunteers under three climatic regimens. Journal of American Mosquito Control Association. 7:490

PAGE 160

160 Harel M, Kryger G, Rosenberry T, Mallender W, Lewis T, Fletcher R, Cuss J, Silman I, Sussman J. (2000). Three dimensional structures of Drosophila melanogaster acetylcholinesterase and of its complexes w ith two potent inhibitors. Protein Science. 9:1063 1072 Harel M, Schalk I, Ehret sabatier L, Bouet F, Geldner M, Hirth C, Axelsen P, Silman I, Sussman J. (1993). Quaternary ligand binding to aromatic residues in the active site of acetylcholinesterase National Academy of Science Proceedings 90:9031 9035 Hartsel J Wong D Mutunga J Ma M Anderson T Wysinski A Islam R Wong E Paulson S L i J Lam P Totrov M Bloomquist J, Carlier P. (2012). Re engineering aryl methylcarbamates to confer high selectivity for inhibition of Anopheles gambiae vs human acetylcholinesterase. Bioorganic Medicinal Chemistry Letters. 22 : 4593 4598 Hassan M, Widaa S, Osman O, Numiary M, Ibrahim M, Abushama H. (201 2). Insecticide resistance in the sandfly, Phlebotomus papatasi from Khartoum State, Sudan. Parasitology Vectors 5 Hayes J and Wolf C. (1988). Role of glutathione transferase in drug resistnace. In: Sies H and Ketterer B (eds), Glutathione conjuga tion. Academic Press, pp. 315. Hemingway J and Ranson H. (2000). Insecticide resistance in insect vectors of human disease. Annual Review of Entomology 45:369 389 Hemingway J, Malcolm C, Kissoon K, Boddington R, Curtis C, and Hill N. (1985). The biochemistry of insecticide resistance in Anopheles sacharovi : Comparitive studies with a range of insecticide susceptible and resistnant Anopheles and Culex species. Pesticide Biochemistry and Physiology. 24(1): 68 76 Hemingway J, Miyamoto J, and Herath P. (1991). A possible novel link between organophosphorus and DDT insecticide resistance genes in Anopheles : supporting evidence from fenitrothion metabolism studies. Pesticide Biochemistry and Phsysiology. 39:49 56 Hemin g way J and Karunaratne S. (1998). Mosquito carboxylesterases: a review of the molecular biology and biochemistry of a major insecticide resistance mechanism. Medical and Veterinary Entomology 12:1 12 Hirshhorn N. (1993). Study of the occupation al health of Indonesian farmers who spray pesticides. The Indonesian National IPM Program, FAO, Jakarta. 23: 12 16. Holling s worth R and Lund A. (1982). Ed. Coats J. Insecticide Mode of Action. Chapter 7, pages 189 227. Academic Press.

PAGE 161

161 Jacobson L and Turner C. (1980). Specific solvent effects on the thermal denaturation of ribonuclease: effect of DMSO and p dioxane on thermodynatmics of denaturation. Biochemistry. 19: 4534 4538. Jaffe R and Rowe M. (1996). Differential nerve block; direct meas urements on individual myelinated and unmyelinated dorsal root axons. Aneshesiology 84:1455 1464 Jaffe C, Baneth G, Abdeen G, Schlein Y, and Warburg A. (2004). Leishmaniasis in Israel and the Palestinian Authority. Trednds in Parasitology 20: 328 332. Jamroz R, Guerrero F, Pruett J, Oehler D, Miller R. (2000). Molecular and biochemical survey of acaricide resistance mechanisms in larvae from Mexican strains of the southern cattle tick, Boophilus microplus Journal of Insect Physiology 46: 685 695 Jiang Y, Swale D, Carlier P, Hartsel J, Ma M, Ekstrm F and Bloomquist J. (Submitted). Evaluation of novel carbamate insecticides for neurotoxicity to non target s pecies Journal of Pesticide Biochemistry and Physiology Johannesson H, Denisov V, Halle B. (1997). Dimethyl sulfoxide binding to globular proteins: a nuclear magnetic relaxation dispersion study. Protein Science. 6: 1756 1763 Jongejan F and Uilenberg G. (2004). The global importance of ticks. Parasitology 129: 3 14 Jonsso n N, Mayer D, Matschoss A, Green P, Ansell J. (1998). Production effects of cattle tick ( Boophilus microplus ) infestation of high yielding dairy cows, Veterinary Parasitology 78: 65 77. Kadous A, Ghiasuddin S, Matsumura F, Scott J, and Tanaka K. (1983 ). Difference in the picrotoxinin receptor between the cyclodiene resistant and susceptible strains of the German cockroach. Pesticide Biochemistry and Physiology. 19: 157 166. Kleifield O, Frenkel A, Bogin O, Eisenstein M, Brumfeld V, Burstein Y et al. (2000). Spectroscopic studies of inhibited alcohol dehydrogenates from Thermoanaerobacter brockii: proposed structure for the catalytic intermediate state. Biochemistry. 39: 7 702 7711 Koren G, Matsui D, Bailey B. (2003). DEET based insect repellents: safety implications for children and pregnant and lactating women. Canadian Medical Association. 169: 209 212. Kovrigin E and Potekhin S. (1968). Preferential solvation cha nges upon lysozyme heat denaturation in mixed solvents. Biochemistry. 36: 9195 9199. Kozikowski B, Burt T, Tirey D, Williams L, Kuzmak B, Stanton D, Morand K, Nelson S. (2003). The effect of freeze/thaw cycles on the stability of compounds in DMSO. Journal of Biomolecular Screening. 8 (2):210 215.

PAGE 162

162 Kravchenko V, Wasserberg G, and Warburg A. (2004). Bionomics of phlebotomine sandflies in the Galilee focus of cutaneous leishmaniasis in northern Israel. Journal of Medical Entomology. 18: 418 428. Kroeger A, Lenhart A, Ochoa M, Villegas E, Levy M, Alexander N, and McCall P. (2006). Effective control of dengue vectors with curtains and water container covers treated with insecticide in Mexico and Venezuela: cluster randomized trials. British Medica l Journal. 332:1247 1252. Kuhr R and Dorough H. (1976). Carbamate Insecticide: Chemistry, Biochemistry, and Toxicolog y., CRC Press, Cleveland, Ohio. pp. 189 220. Kumar S, Prakash S, Rao K. (1995). Comparative activity of three repellents against bedbugs. Indian Journal of Medical Research 102:20 Kumar S, Thomas A, Samuel T, Sahgal A, Verma A, and Phillai M. (2009). Diminished reproductive fitness associated with the deltamethrin resistance in an Indian strain of dengue vector mosquito, Aedes aegypti L. Tropical Biomedicine. 26(2): 144 164. Li A, Davey R, Miller R, George J. (2003). Resistance to Coumaphos and Diazinon in Boophilus microplus (Acari: Ixod idae) and evidence for the involvement of an oxidative detoxification mechanism. Journal of Medical Entomology. 40:482 490. Licciardi S, Herve Jm Darriet F, Hougard J, Corbel V. (2006). Lethal and behavioral effects of three synthetic repellents (DEET IR3535, and KBR3023) on Aedes aegypti mosquitoes in laboratory assays. Journal of Medical and Veterinary Entomology. 20:288 293. Lipscomb J, Kramer Jm eikin J. (1992). Seizure following brief exposure to the insect repellent N,N Diethyl m toluamid e. Annals of Emerging Medicine, 21:315 317 Magdalena M, Coto R, Lazcano J, Soca A, and Fernandez D. (2000). Malathion resistance in Aedes aegypti and Culex quinquefasciatus after its use in Aedes aegypti control programs. Journal of American Mosquito Control Association. 16(4):324 330. Malcom C, Bourguet D, Ascolillo A, Rooker S, Garvey C, Hall L, Pasteur N, and Raymond M. (1998). A sex linked Ace gene, not linked to insensitive acetylcholinesterase mediated insecticide resistance in Culex pipien s Insect Molecular Biology. 7:107 120. Mallender W, Szegletes T, Rosenberry T. (2000). Acetylthiocholine binds to Asp74 at the peripheral site of human acetylcholinesterase as the first step in the catalytic pathway. Biochemistry 39:7753 7763 Manh C, Beebe N, Van V, Quang T, Lein C, Nguyen D, Xuan T, Ngoc A, and Cooper, R. (2010). Vectors and malaria transmission in the deforested, rural communities in north central Vietnam. Malaria Journal. 9:259

PAGE 163

163 Maroli M and Lane R. (1989). The effect of pe rmethrin impregnated nets on Phlebotomus (Diptera: Psychodidae) in central Italy. Leishmaniasis the Current Status and New Strategies for Control, pp. 217223. Plenum Press, New York. Maroli M and Lane R. (1991). The effect of permethrin impregnated curtains against phlebotomine sandflies: laboratory and field studies. Parasitology 33:399 404 Martinez Torres D, Chandre F, Williamson M, Darriet F, Berge J, Devonshire A, Guillet P, Pasteur N, and Pauron D. (1998). Molecular characterization of pyrethroid knockdown resistance ( kdr ) in the major malaria vector, Anopheles gambiae. Insect Molecular Biology. 7:179 184 Mascari T, Stout R, and Foil L. (2012). Laboratory evaluation of rubidium as a long lasting marker for bloodfeeding sand flies (Diptera: Psychodidae). Journal of Medical Entomology. 49:227 30. McAlllister J and Adams M. (2010). Mode of action for natural products isolated from essential oils of two trees is differ ent from available mosquito adulticides. Journal of Medical Entomology 47: 1123 1126 McCabe E, Barthel W, Gertler S, and Hall S. (1954). Insect Repellents, III, N,N diethylamides, Journal of Organic Chemistry. 19:493 McCarroll L, Paton M, Karunatat ene S, Jayasuryia H, Kalpage K, and Hemingway J. (2000). Insecticides and mosquito borne disease. Nature. 407: 961 962. doi:10.1038/35039671 Mehr Z, Rutledge L, Inase J. (1984). Evaluation of commercial and experimental repellents against Xenopsyl la cheopis (siphonaptera: Pulicidae). Journal of Medical Entomology. 21:665 Metcalf R. (1971). Structure activity relationships for carbamates. Bull etin of World Health Organ ization. 4: 43 78. Miller R, Davey R, George J. (2005). First report of Organophosphate resistant Boophilus microplus (Acari: Ixodidae) within the United States. Journal of Medical Entomology 42:912 917. Moore S and Debboun M. (2007) in Insect repellents: Principles, m ethods, and uses. Eds Debboun M, Frances S, Strickman D. (CRC, Boca Raton, FL). pp 3 30 Morgan J, Corley S, Jackson L, Lew Tabor A, Moolhuijzen A, Jonsson N. (2009). Identification of a mutation in the para sodium channel gene of the cattle tick Rhic ephalus (Boophilus) microplus associated with resistance to synthetic pyrethroid acaricides. International Journal of Parasitology 39:775 779

PAGE 164

164 Morsy T, Aboul Ela R, El Gozamy B, Salama M, Ragheb D. (1993). Residual effect of four insecticides applied for indoor control of Phlebotomus papatasi (Scopoli). Journal of Egyption Society of Parasitology. 23:485 492 Moss J. (1996) Synergism of toxicity of N,N Diethyl m toluamide to German Cockroaches by Hydrolytic Enzyme Inhibitors. Journal of Economical Entomology 89:1151 1155. Mowry F. (1963). Statistics of malaria, in Internal Medicine in World War II, Volume II: Infectious Diseases. Ed. Heaton L, Coates J, Havens W. Washington D.C., Medical Department, United States Army. Pp. 449 463 Mulla M, Thayara U, Tawatsin A, Chompoosri J. (2004). Procedures for the evaluation of field efficacy of slow release formulations of larvicides against Aedes aegypti in water storage containers. Journal of American Mosquito Control Association 20(1):64 73. Mullen and Durden. (2002). Medical and Veterinary Entomology. Academic Press. pp: 203 248. Mutero A and Fournier D. (1992). Post translational modifications of Drosophila Acetylcholinesterase: in vitro utagenesis and expression in xenopus oocytes Journal of Biological Chemistry. 267: 1695 1700 Mutinga M, Basimike M, Mutero C, and Ngindu A. (1992). The use of permethrin impregnated wall cloth (MBU cloth) for control of vectors of malaria and leishmaniases in Kenya. Effect on phlebotomine sandfly populations. Insect Science Applications. 13:163. Mutunga J. (2011). Molecular, Biochemical, and Toxicological Evaluation of Anticholinesterases or control of the Malaria Mosquito, Anopheles gambiae Ph.D. Dissertation, Virginia Tech, April 28, pg. 13 7 Greenberg A, Sherman M, Wong S, Campbell G, Roehrig J, Gubler D, Shieh W, Zaki S, Smith P, and Layton M. (2001). The outbreak of West Nile Virus infection in the New Yo rk City area. New England Journal of Medicine 344(24):1807 1814. ) Distribution, pest status and agro climatic preferences of lepidopteran stem borers of maize in Kenya Annual Entomological Society of France. 42:171 177 Oppen orth F, Van der Pas L, and Houx N. (1979). Glutathione S transferases and hydrolytic activity in a tetrachlorovinphos resistant strain of housefly and their influence on resistance. Pesticide Biochemistry and Physiology. 11:176 188

PAGE 165

165 Osimitz T and Grothaus R. (1995). The present safety assessment of DEET. The Journal of American Mosquito Control Association 11:274 Osimitz T and Murphy J. (1997). Neurological effects associated with the use of the insect repellent DEET. Journal of Toxicology: Clinical Toxicology. 35:435 Ottesen E, Ismail M, and Horton J. (1999). The Role of Albendazole in Programs to Eliminate Lymphatic Filariasis. Parasitology Today 15(9):382 386 Pang Y. (2006). Novel acetylcholinesterase target site for malaria mosquito control. PLoS ONE 1(1) e58. Doi10.1371/journal.pone.000058 Pang Y, Singh S, Gao Y, Lassiter T, Mishra R, Zhu K, Brimijoin S. (2009). Selective and irreversible inhibitors of aphid acetylcholinesterase: Steps toward human safe insecticides. PLoS ONE. 4(2): e4349. Pasteur N and Raymond M. (1996). Insecticide Resistance Genes in Mosqui to es: Their Mutations, Migration, and Selection in Field Populations. Journal of Heredity 87(6): 444 449. Pehoushek J, Quinn D, Crum W. (2004). Cutaneous leishmaniasis in soldiers returning from deployment to Ira q. Journal of American Dermatology 51 Perlman R and Wolff J. (1968). Dimethyl Sulfoxide: An inhibitor of liver alcohol dehydrogenase. Science. 160: 317 319. Pfister W, Chinn C, Noland V, and Yim G. (1978). Similar pharmacological actions of c hlordimeform and local anesthetics. Journal of Biochemstry and Physiology 9:148 156. Pridgeon J, Pereira R, Becnel J, Allan S, Clark G, Linthicum K. (2008). Susceptibility of Aedes aegypti, Culex quinquefasciatus, and Anopheles quadrimaculatus to 19 pesticides with different modes of action. Journal of Medical Entomology. 45:82 87 Radic Z and Taylor P. (2006). Structure and Function of Cholinesterases Toxicology of Organophosphate and Carbamate Compounds, Elsevier Inc., Academic Press. ISBN 13: 978 0 12 088523 7 Rajendran S, Tadha C, Prakash V. (1995). Mechanism of solvent induced thermal stabilization of alpha amylase from Bacillus amyloliquefaciens. International Journal of Peptide and Protein Residue. 45:122 128. Rammler, D. (1967). The effect of DMSO on several enzyme systems. In: Annals of New York Academy of Sciences. Braaten, D, Ed. John Wiley & Sons, Inc., Eds. 141: 291 299.

PAGE 166

166 Ranson H, Jensen B, Vulule J, Wang X, Hemingway J, and Collins F. (2000). Identification of a point mutation in the voltage gated sodium channel gene of Kenyan Anopheles gambiae associated with resistance to DDT and pyrethroids. Insect Molecular Biology. 9:491 497 Ranson H, Jensen B, Wang X, Prapanthadara L, Hemingway J and F.H. Collins. (2000 b). Genetic mapping of two loci affecting DDT resistance in the malaria vector Anopheles gambiae Insect Molecular Biology 9: 499 507. Ranson H, Rossiter L, Ortelli F, Je nsen B, Wang X, Roth C, Collins F, and Hemingway J. (2001). Identification of a novel class of insect glutathione S Transferases involved in resistance to DDT in the malaria vector Anopheles gambiae. Journal of Biochemistry. 359 (pt.2):295 304. Reiner E ., Pavkovic E, Radic Z, and Simeon V. (1993). Differentiation of esterases reacting with organophosphorus compounds. Chemico Biological Interactions. 87:77 83 Reuveni H and Yagupsky P. (1982). Diethyltoluamide containing insect repellent: adverse ef fects in worldwide use. Archives of Dermatology 18:582 583 Ridley S, Elliott A, Yeung M, and Youle D. (1998). High throughput screening as a tool for agrochemical discovery: Automated synthesis, compound input, assay design, and process management. Pestic ide Sci ence 54, 327 337. Robert L, Coleman R, Lapointe D, Martine P, Kelly R, Edman J. (1992). Laboratory and field evaluation of five repellents against the black flies. Journal of Medical Entomology 29:267. Roberts D, Laughlin L, Hsheih P, Legters L. (1997). DDT, global strategies, and a malaria control. Emerging Infectious Diseases. 3(3): 295 302 Roland E, Jan J, Rigg J. (1985). Toxic encephalopathy in a child after brief exposure to insect repellents Canadian Medical Association Journal 132:155 Romi R, Sabatinelli G, Majori G. (2001). Could malaria reappear in Italy. Emerging Infectious Diseases. 7:915 Rosario Cruz R, Guerroro F, Miller R, Rodriguez Vivas R, Dominguez Garcia D, Cornel A, Hernandez Ortiz R, George J. (2005). Roles played by esterase activity and by a sodium channel mutation involed in pyrethroid resistance in populations of Boophilus mi croplus (Acari: Ixodidae) collected from Yucatan, Mexico. Journal of Medical Entomology. 42:1020 1025. Roulston W, Schnitzerling H, Schuntner C. (1968). Acetylcholinesterase insensitivity in the Biarra strain of the cattle tick Boophilus microplus as a cause of resistance to

PAGE 167

167 organophosphorous and carbamate acaricides. Australian Journal of Biological Sciences 21:759 767 Schlein Y, and Mller G. (2010). Experimental control of Phlebotomus papatasi by spraying attractive toxic sugar bait (ATSB) on vegetation. Trans Royal Society of Tropical Medicine and Hygiene.. 104: 766 771. Schuntner C, Roulston W, Schnitzerling H. (1968). A mechanism of resistance to organophosphorous acaricides in a strain of the cattle tick, Boophilus microplus Australian Journal of Biological Sciences 21: 97 109. Scior T, Martinez Morales E, Cruz S, Salinas Stefanon E. (2009). In silico modeling of toluene binding site in the pore of the voltage gated sodium channel. Journal of Receptor Ligand and Channel Research 2:1 9 Shoichet B. (2006). Interpreting steep dose response curves in early inhibitor discovery. Journal of Medicinal Chem istry 49: 7274 7277. Solberg V, Klein T, McPherson K, Bradford B, Burge J, Wirtz R. (1995). Field evaluation of DEET and a piperidine repellent against Amblyomma americanum Journal of Medical Entomology 32:870 Stump A, Atieli F, Vulule J and Besansky N. (2004). Dynami cs of the pyrethroid knockdown resistance allele in western Kenyan populations of Anopheles gambiae in response to insecticide treated bed net trials. American Journal of Tropical Medicine and Hygiene. 70: 591 596. Surendran S, Karunaratne S, Adams Z, H emingway J, Hawkes N. (2005). Molecular and biochemical characterization of a sand fly population from Sri Lanka; Evidence for insecticide resistance due to altered esterases and insensitive acetylcholinesterase. Bulletin for Entomological Research. 95 :371 380 Sussman J, Harel M, Frolow F, Oefner C, Goldman A, Toker L, Silman I. (1991). Atomic Structure of acetylcholinesterase from Torpedo californica: a prototypicacetylcholine binding protein. Science. 253: 872 879. Swale D. (2009). Determinti on of Allosteric solvent effects between acetylcholinesterase and mosquito selective carbamates: Implications for high throughput screening of insecticides Master of Science Thesis. Virginia Tech. Accessed: 9/11/12 Syed Z and Leal W. (2008). Mosquitoes smell and avoid the insect repellent DEET. PNAS. 105:13598 13603 Szegletes T, Mallender W, Thomas P, Rosenberry T. (1999). Substrate binding to the peripheral site of acetylcholinesterase initiates enzymatic catalysis: Substrate inhibition arises as a secondary effect. Biochemistry 38:122 133

PAGE 168

168 Taylor D, Sack J, Maune J, Beckingham K, Quiocho F. (1991). Structure of a recombinant calmodulin from Drosophila melanogaster refined at 2.2 A resolution. Journal of Biologica l Chemistry. 266: 21375 21380 Temeyer K, Pruett J, Olafson P. (2010). Baculovirus expression, biochemical characterizatioin and organophosphate sensitivity of rBmAChE1, rBmAChE2, and rBmAChE3 of Rhipicephalus (Boophilus) microplus Veterinary Parasitolo gy. 172: 114 121 Temeyer K, Brake D Tuckow A Li A Perez de Leon A. (submitted). Acetylcholinesterase of the sand fly, Phlebotomus papatasi (Scopoli): cDNA sequence, baculovirus expression, and biochemical prop erties. Journal of Parasites and Vector s. Tietjen K, Drewes M, Stenzel K. (2005). High Throughput Screening in Agrochemical Research. Comb. Chem. High Throughput Screen. 8: 589 594. Tjernberg A, Markova N, Griffiths W, and Hallen D. (2006). DMSO Related Effects in Protein Characterization. Journal of Biomolecular Screening 11:131 137. Trongtokit Y, Rongsriyam Y, Komalamisra. (2004). Labatory and field trial of developing medi cinal local Thai plant products against four species of mosquito vectors. Southeast Asian Journal of Tropical Medicine and Public Health. 35:325 Wolbachia infection reduces blood feeding success in the dengue fever mosquito, Aedes aegypti PLoS Neglected Tropical Diseases. 3(9): e516 Turusov V, Rakitsky V, and Tomatis L. (2002). Dichlorodiphenyltrichloroethane (DDT): Ubiquity, Persistence, and Risks. Environmental Health Perspectives 110(2):1 25 128 U.S. EPA. (1980). Pesticide Registration Standard for N,N diethyl meta toluamide. Washington D.C: Office of Pesticides and Toxic substances special pesticides review division. United States Environmental Protection Agency. Vaidyanathan G. Dengue re emerges in U.S., spurring race for vaccine. New York Times June 28, 2010. Accessed December 27, 2010. Vezzani D and Schweigmann. (2002). Suitability of Containers from Different Sources as Breeding Sites of Aedes aegypti (L.) in a Cemetery of Buenos Aires City, Argentina. Memrias do Instituto Oswaldo Cruz 97(6): 789 792. Vulule J, Beach R, Atieli F, McAllister J, Brogdon W, Roberts J, Mwangi W and Hawley W. (1999). Elevated oxidase and esterase levels associated wi th permethrin tolerance in Anopheles gambiae from Kenyan villages using permethrin impregnated nets. Medical and Veterinary Entomology. 13: 239 244.

PAGE 169

169 Vulule J, Beach R, Atieli F, Roberts J, Mount D, Mwangi R. (1994). Reduced susceptibility of Anopheles gambiae to permethrin associated with the use of permethrin impregnated bed nets and curtains in Kenya. Medical and Veterinary Entomology. 8:71 75 Walker C. (1993). The classification of esterases which hydrolyse organophosphates: Recent Developments Chemico Biological Interactions. 87(1): 17 24 Wang C, Narahashi T, Fukami J. (1975). Mechanism of neuromuscular block by chlordimeform. Journal of Pesticide Biochemistry and Physiology 5: 119 125 Wasserberg G, Poche R, Miller D, Chenault M, Zol lner G, and Rowton E. (2011). Imidacloprid as a potential agent for the systemic control of sand flies. Journal for Vector Ecology. 36 (Suppl. 1): S148 S156. Watts D Pantuwanana S, Defoliart G, Yuill T, and Thompson W. (1973). Transovarial Transmission of LaCrosse Virus (California EncephalitisGroup) in the Mosquito, Aedes triseriatus Science 182(4117):1140 1141. Weill M, Fort P, Bertomieu A, Dubois M, Pasteu r N, and Raymond M. (2002). A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is non homologous to the ace gene in Drosophila Proceedings of the Royal Biological Society 269(1504): 2007 2016. Weill M, Lutfalla G, Mogensen K, Chandre F, Berthomieu A, Berticat C, Pasteur N, Phillips A, Fort P, and Raymond M. (2003). Insecticide resistance in mosquito vectors. Nature. 423:136 137 Weill M., Malcolm C, Chandre F, Mogensen K, Berthomieu A, Marquine M, and Raymond M. (2004). The unique mutation in ace 1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Molecular Biology. 13:1 7. Whayne T. (1955). Clothing, in personal Health Measures and Immunization. Eds. Coates Jm hoff E, Hof f P. Office of the Surgeon General Department of the Army, Whashington D.C. pp. 31 83 White N. (1996). The treatment of Malaria. New England Journal of Medicine. 335(11):800 806. W.H.O (1981). Document WHO/VBC/81.805 World Health Organization, Geneva. W.H.O. (2006). Section 2.2. Indoor Residual Spraying: Use of indoor residual spraying for scaling up Global Malaria protection and elimination. W.H.O. (2007) Cutaneous leishmaniasis: Why are you neglecting me? http://whqlibdoc.who.int/hq/2007/WHO_CDS_NTD_IDM_2007.3_eng.pdf [Accessed: 9/7/12]

PAGE 170

170 W.H.O. (2003). The World Health Report 2003: shaping the future. World Health Organization Geneva. W.H.O. (2010) Control of the leishmaniasis. Report of a meeting of the WHO expert committee on the control of leishmaniases, Geneva, 22 26 March 2010. WHO Technical Report Series; no. 949. W.HO. 1992. Vector resistance to pesticides. Fifteenth report of the expert committee on vector biology and control. WHO Technic al Report Series. 818: 1 55 WHO. (1997). Dengue hemorrhagic fever: diagnosis, treatment, prevention and control. 2 nd edition. Geneva: World Health Organization WHO. (2000). Lymphatic Filariasis Fact Sheet. WHO. 2009. Dengue and dengue haemorr hagic fever. Fact Sheet. http://www.who.int/me diacentre/factsheets/fs117/en/ Accessed: Jan 2011 Willard R, Jeffcoat A, Benson P, Walsh D. (2005). Cutaneous leishmaniasis in soldiers from Fort Campbell, Kentucky returning from Operation Iraqi Freedom. Journal of American Academy of Dermatology 52 Williams LL. (1963). Malaria Eradication in the United States. American Journal of Public Health. 53(1): 17 21. Yadouleton A, Asidi A, Diouaka R, Braima J, Agossou C, Akogbeto M. (2009). Development of vegetable farming: a cause of the emergence of insecticide resistance in populations of Anopheles gambiae in urban areas of Benin. Malaria Journal. 8(103). Yokel R and Wise R. (1976). Attenuation of intravenous amphetamine reinforcement by central dopamine blockade in rats. Psychopharmacology 48: 311 318 Yu S (2008). The Toxicology and Biochemistry of Insecticides. CRC Press. Zaim M and Guillet P. (2002). Alternative insecticides: an urgent need. Trends in Parasitol ogy 18(4):161 163. Zhong H. (2007). Impact of Mosquito aerial ULV spray on Miami Blue Butterfly. FDACS Contract NO. 010978. Final report to James Clauson. Zhong H, Hribar L, Daniels Jm Feken M, Brock C, and Trager M. (2010). Aerial Ultra low volume application of naled: Impact on nontarget imperiled burrerfly larvae ( Cyclargus thomasi Bethunekbakeri ) and Efficacy against adult mosquitoes. Environmental Entomology 39: 1961 1972.

PAGE 171

171 Zucker J. (1996). Changing Patterns of Autochthonous Malaria Transmission in the United States: A Review of Recent Outbreaks. Emerging Infectious Diseases 2(1): 37 43.

PAGE 172

172 BIOGRAPHICAL SKETCH Daniel Swale was raised in a military household and lived in eight different states throughout his childhood and into his high school years. Today, he claims Virginia as his home and currently has family located in Yorktown, Virginia. Daniel graduated from Grafton High School in 2004 and attended Chri stopher Newport University where he majored in Biology and Chemistry with a pre medical track. He participated in the NCAA varsity cross country and track teams all four years of his undergraduate education. Upon graduation, Daniel accepted a Master of S cience graduate research assistantship at Virginia Tech in the laboratory of Professor Jeff Bloomquist to study insect toxicology and medical entomology. He graduated from Virginia Tech in December 2009 and followed Professor Bloomquist to the University of Florida. There he has continued his fascination with insects, biochemistry, organic chemistry, and toxicology through a pursuit of a Ph.D. in insect toxicology. His career goals are to obtain a tenure track professorship position in academia to study the control of vector borne diseases through the use of biochemical and toxicological methods.