<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.

DARK ITEM
Permanent Link: http://ufdc.ufl.edu/UFE0044961/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Wang, Rui
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: Medicinal Chemistry -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Rui Wang.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Luesch, Hendrik.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044961:00001

Permanent Link: http://ufdc.ufl.edu/UFE0044961/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Wang, Rui
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: Medicinal Chemistry -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Rui Wang.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Luesch, Hendrik.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044961:00001


This item has the following downloads:


Full Text

PAGE 1

1 DISCOVERY AND CHARAC TERIZATION OF SMALL MOLECULE ACTIVATORS OF THE ANTIOXIDANT RESP ONSE ELEMENT By RUI WANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMEN TS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Rui Wang

PAGE 3

3 To my parents and grandparents

PAGE 4

4 ACKNOWLEDGMENTS I owe this degree to my mother, Mrs Zhengxin Fan, for all her ever u nconditional love and belief in me. I could not have been here without the ever rising expectations from my father, Dr. Fengyang Wang. I must also extend my gratitude to my grandparents, Mrs Guifang Cai and Mr Shushen Wang for giving me a memorable chil dhood and shaping me into being the person that I am today. This work would not have been completed without my advisor, Professor Hendrik Luesch. I sincerely appreciate Dr. Luesch for giving me the opportunity to work on these wonderful research projects, for allowing me the freedom to prove my own ideas, right or wrong, and for being there to provide guidance when needed I would also like to express my appreciation to my committee members, Professor Margaret O. James, Professor Kenneth B. Sloan, and Profe ssor Alfred S. Lewin, for their time and advice throughout the process. I am thankful of our research collaborators on specific projects : Professor Theodore L. Goodfriend for his knowledge of lin oleic acids and related fatty acids o n the EKODE project ; Pr ofessor Valerie Paul for collecting samples and her specialty in taxonomy of marine algae and Professor Keith P. Choe for his expertise in Caenorhabditis elegans related field o n the AI 3 project Working with these experts was a great learning experience Additionally, the ARE luciferase reporter plasmid used extensively in the projects was a gift from Professor Jeffrey A. Johnson; the other expression vectors were gifts from Professor Donna D. Zhang and Professor Nathanael S. Gray The pcDNA3 mRFP was sh ared by Professor Roger Tsien through Addgene Without t heir generosity, my work would not have pro ce e ded so smoothly.

PAGE 5

5 Many people lent their h ands on individual experiments. Dr. Jonathan T. Kern helped with two assays in EKODE characterization; Sarath Gun asekera extracted and fractionated the re collection of Ulva lactuca ; Drs. Haoyu Mao and Yanxia Liu spent their time on mice treatment and tissue harvesting. My thanks also go to the other members in the Luesch lab, both past and present ( Dr. Qiyin Chen, D r. Susan Matthew, Dr. Ranjala Ratnayake, Dr. Wei Zhang, Dr. Jason Kwan, Kanchan Taori, Lilibeth Salvador, Rana Montaser, Kamolrat Metavarayuth, and Michelle Bousquet ); and the administrative staff in Med Chem office (Gladys (Jan) Kallman, Dave Jenkins, and Brian Karcinski ) for their kindness and timely support on various aspects of my research and life at the University of Florida.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 18 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 20 The Keap1 Nrf2 ARE Signaling Pathway ................................ ............................... 20 Small Molecule Activators Targeting the Nrf2 ARE Pathway ................................ .. 22 2 ACTIVATION OF THE ANTIOXIDANT RESPONSE ELEMENT BY SPECIFIC OXIDATION PRODUCTS OF LINOLEIC ACID ................................ ...................... 26 Rationale ................................ ................................ ................................ ................. 26 Profiling of Fatty Acids and Related Metabolites for ARE Activation in IMR 32 Cells ................................ ................................ ................................ .................... 27 ARE Activation by EKODE in the Presence of Antioxidant and Validation in Primary Cortical Neurons ................................ ................................ ..................... 28 EKODE Mediated Activation of Endogenous ARE Regulated Genes and Glutathione Levels in IMR 32 Cells ................................ ................................ ..... 28 Mechanism of ARE Activation by EKODE ................................ .............................. 30 Summary ................................ ................................ ................................ ................ 30 Experimental ................................ ................................ ................................ ........... 33 Chemicals, Reagents and Plasmids ................................ ................................ 33 ARE Activity Profiling of Fatty Acid Derivatives in IMR 32 Cells ....................... 34 A RE Activity in IMR 32 Cells in the Presence of Antioxidant (Catalase) .......... 35 Mouse Primary Cortical Cultures ................................ ................................ ...... 35 RNA Extraction, Quan titative RT PCR and Validation ................................ ...... 36 Immunoblot Analysis ................................ ................................ ........................ 37 Glutathione Assays ................................ ................................ .......................... 37 RNA Interference Experiments ................................ ................................ ......... 38 Inhibitor Studies ................................ ................................ ................................ 39 3 SEAWEEDS AND UNSATURATED FATTY ACID CONSTITUENTS FROM THE GREEN ALGA ULVA LACTUCA AS ACTIVATORS OF THE CYTOPROTECTIVE NRF2 ARE PATHWAY ................................ ......................... 46

PAGE 7

7 Rationale ................................ ................................ ................................ ................. 46 ARE activity Profiling of Various S eaweeds and the Identification of Ulva Lactuca as a Rich Source of Antioxidants ................................ ........................... 47 Bioassay Guided Fractionation, Isolation and Structure Determination of Three ARE Activators ................................ ................................ ................................ .... 48 Biological Activity of the Purified Compounds ................................ ......................... 50 Compound 1 Induces Cytoprotective Genes and Glutathione (GSH) Synthesis in IMR 32 Cells ................................ ................................ ................................ .... 51 NRF2 and PI3K are Required for ARE Activation by Compound 1 in IMR 32 Cells ................................ ................................ ................................ .................... 52 Compound 1 Enriched Extract of Ulva Lactuca Induce s Cytoprotective Genes In Vitro and In Vivo ................................ ................................ ................................ .. 53 Summary ................................ ................................ ................................ ................ 55 Experimental ................................ ................................ ................................ ........... 57 Chemicals and Reagents ................................ ................................ ................. 57 General Instrumentation ................................ ................................ ................... 57 Eukaryotic Algae Library Preparation ................................ ............................... 58 Fractionation and Isolation from Ulva Lactuca ................................ .................. 58 Cell Culture ................................ ................................ ................................ ....... 60 ARE luc Reporter Gene As say ................................ ................................ ......... 60 Immunoblot Analysis ................................ ................................ ........................ 61 RNA Extraction, cDNA Synthesis, and Quantitative PCR (qPCR) Analysis ..... 61 RNA Interference Experiments ................................ ................................ ......... 62 Glutathione Assays ................................ ................................ .......................... 63 Mouse Studies ................................ ................................ ................................ .. 63 hPAP Assay ................................ ................................ ................................ ..... 64 4 IN VITRO AND IN VIVO CHARACTERIZATION OF A TUNABLE DUAL REACTIVITY PROBE OF THE NRF2 ARE ANTIOXIDANT DEFENSE PATHWAY ................................ ................................ ................................ .............. 77 Rationale ................................ ................................ ................................ ................. 77 Identification of a Potent ARE Activator, AI 3 ................................ .......................... 77 In Vivo Bioa ctivity of AI 3 in Mice ................................ ................................ ............ 79 Chemistry ................................ ................................ ................................ ................ 80 AI 3 Induces Cytoprotective Genes in IMR 32 Cells ................................ ............... 82 AI 3 Requires the Presence of NRF2 and PI3K for Its Bioactivities in IMR 32 Cells ................................ ................................ ................................ .................... 83 AI 3 Recruits Different Sets of Cysteine Codes to Dictate Its Biological Activ ities .. 85 AI 3 Protects Mouse Macrophages Against LPS Induced Inflammation ................. 87 Summary ................................ ................................ ................................ ................ 88 Experimental ................................ ................................ ................................ ........... 89 Chemicals and Reagents ................................ ................................ ................. 89 Plasmid Constructs ................................ ................................ .......................... 89 Cell Cultures ................................ ................................ ................................ ..... 90 ARE luc Reporter Gene Assay ................................ ................................ ......... 90 Immunoblot Analysis ................................ ................................ ........................ 90

PAGE 8

8 Pgst4 ::GFP Reporter Gene Assay in C. Elegans ................................ ............. 91 Mice Experiment ................................ ................................ ............................... 91 RNA Extraction, cDNA Synthesis and Quantitative PCR (qPCR) .................... 92 RNA Interference Assay ................................ ................................ ................... 92 Glutathione Assays ................................ ................................ .......................... 93 Preparation of Cytosolic and Nuclear Extracts ................................ ................. 93 Chitin Pull Down ................................ ................................ ............................... 94 In Vitro Ubiquitination Assay ................................ ................................ ............. 95 Immunoprecipitation ................................ ................................ ......................... 95 Determination of NO Accumulation ................................ ................................ .. 96 Sample Prepara tion and LC MS Parameters for Stability Studies .................... 96 Plasma Stability Studies ................................ ................................ ................... 97 Cellular Stability Studies ................................ ................................ ................... 98 In vitro Reactions with Small Molecule Thiols and LC MS Analysis ................. 98 5 CONCLUSIONS ................................ ................................ ................................ ... 116 APPENDIX : NMR SPECTRA ................................ ................................ ...................... 119 LIST OF REFERENCES ................................ ................................ ............................. 135 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 147

PAGE 9

9 LIST OF TABLES Ta ble page 2 1 Fatty acids and their acronyms, controls and respective solvents used in this study. ................................ ................................ ................................ .................. 40 3 1 Marine eukary otic algae library collection sites and dates. ................................ 65 3 2 NMR data for 7( E ) 9 keto octadec 7 enoic acid ( 1 ) and 7( E ) 9 keto octadec 7 enamide ( 3 ) in CDCl 3 ................................ ................................ ...................... 67 3 3 NMR data for 7( E ) 9 keto hexadec 7 enoic acid ( 2 ) in CDCl 3 at 600 MHz. ........ 68 4 1 The bioactivities (ARE luc) of the structural analogs of AI 3. ............................ 100

PAGE 10

10 LIST OF FIGURES Figure page 1 1 The current working model of the Keap1 Nrf2 ARE antioxidant defense signaling pathway and the mechanism of Michael reaction ................................ 24 1 2 Chemical structures of ARE inducers mentioned in the text ............................... 25 2 1 Chemical structures of the compounds tested ................................ .................... 41 2 2 ARE activation by EKODE and other linoleic acid derivatives in IMR 32 cells at 10 M using an ARE luciferase reporter gene assay ................................ ..... 42 2 3 Reporter gene assays in IMR 32 cell s and primary cortical cultures .................. 43 2 4 EKODE induces endogenous ARE regulated genes and aff ects GSH levels in IMR 32 cells ................................ ................................ ................................ .... 44 2 5 Mechanism of ARE activation in IMR 32 cells ................................ .................... 45 3 1 ARE luciferase activity profiling of the eukaryotic algae collection and distribution of activities in each phylum in IMR 32 cells ................................ ...... 69 3 2 Structural information of the three comp ounds isolated from Ulva lactuca ......... 71 3 3 1 ................................ ..... 72 3 4 Compound 1 induces cytopr otective genes in IMR 32 cells ............................... 73 3 5 Compound 1 requires NRF2 and PI3K for the induction of ARE regulated genes in IMR 32 cells ................................ ................................ ......................... 74 3 6 In vitro antioxidant bioactivity confirmation of a compound 1 containing Ulva lactuca fraction (fraction 3*, see Materia ls and Methods) in IMR 32 cells .......... 75 3 7 Fraction 3* induced endog enous cytoprotective genes in vivo ........................... 76 4 1 Comparison of the bioactivities of six commercially available Nrf2 ARE inducers in vitro and in vivo ................................ ................................ ............. 109 4 2 Stability and rodent in vivo activity of AI 3 ................................ ........................ 110 4 3 The structure activ ity relationships (SAR) of AI 3 ................................ ............. 111 4 4 AI 3 induces cytoprotective gene expression in IMR 32 cells ........................... 112 4 5 Cytoprotective gene activation by AI 3 is dependent on Nrf2 and PI3K sig naling pathways in IMR 32 cells ................................ ................................ ... 113

PAGE 11

11 4 6 AI interacti ons with its molecular partners ................................ ............................. 114 4 7 AI 3 prote cts against LPS induced inflammation in mou se macrophages (RAW264.7 cells) ................................ ................................ .............................. 115

PAGE 12

12 LIST OF ABBREVIATION S ARE the antioxidant response element ATCC American type culture collection br s Broad singlet 13 C Carbon 13 NMR o C Degree Celsius cDNA Complementary DNA CEMEM CH 2 Cl 2 Methylene chloride CH 3 CN Acetonitrile CMV Cytomegalovirus CO 2 Carbon dioxide C terminus Carboxyl terminus CUL3 ubiquitin E3 ligase scaffold protein Cullin 3 Cys Cysteine 1D One dimensional 2D Two dimensional Chemical shift (in ppm) d Doublet dt Doublet of triplets DEM Diethyl maleate DMEM DMSO Dimethyl sulfoxide DNA Deoxyribose nucleic acid DP Declustering potential

PAGE 13

13 DPBS hate buffered saline DTNB dithiobis(2 nitrobenzoic acid) EC 50 Half maximal effective concentration EKODE 12,13 epoxy 9 keto 10( trans ) octadecenoic acid EP Entrance potential EtOAc Ethyl acetate EtOH Ethanol FBS Fetal bovine serum g Gram g Gravity GAP DH Glyceraldehyde 3 phosphate Dehydrogenase GFP Green fluorescence protein GSH Glutathione (reduced) GSSG Glutathione (oxidized) GST Glutathione S transferase GST 4 glutathione S transferase 4 h Hour (s) 1 H Hydrogen 1 NMR HBSS HCOOH Formic acid HMBC Heteronuclear multiple bond correlation spectroscopy H 2 O W ater hPAP Human placental alkaline phosphatase HPLC High performance liquid chromatography HSQC Heteronuclear multiple quantum correlation spectroscopy

PAGE 14

14 HRESIMS High resolutio n electroscopy ionization mass spectroscopy Hz Hertz IC 50 Half maximal inhibitory concentration IMR 32 IMR 32 neuroblastoma cells i PrOH Isopropanol KEAP1 Kelch like ECH associated protein 1 lacZ bacterial gene for beta galactosidase LC MS Liquid chromatog raphy mass spectrometry LDL low density lipoprotein LH 20 Sephadex LH 20, a bead formed dextran medium luc Luciferase reporter gene max Wavelength at which the maximum absorbance (UV) occurs m M ultiplet M Molar (concentration) MAPK mitogen activated prot ein kinase Me Methyl MeOH Methanol MEK1 Mitogen activated protein kinase kinase mM Millimolar (concentration) L Microliter g Microgram M Micromolar (concentration) mg Milligram MHz Megahertz min Minutes

PAGE 15

15 mL Milliliter mol Mole mRFP Monomer Red Fluorescen t Protein MRM Multiple reaction monitoring mRNA messenger RNA MS Mass spectrometry MS MS Tandem mass spectrometry m/z Mass/charge ratio MUFA Monounsaturated fatty acid (s) n BuOH n butanol NAC N acetyl cysteine NADPH Nicotinamide adenine dinucleotide phosphate (reduced) NF B Nuclear factor Kappa light chain enhancer of the activated B cells NMR Nuclear magnetic resonance NOESY Nuclear overhauser effect spectroscopy NQO1 NAD(P)H:quinone oxidoreductase 1 NRF2 nuclear f actor E2 related factor 2 N terminus Amino terminus P Probability PBS Phosphate buffered saline PCR Polymerase chain reaction pcDNA3 Mammalian cell expression vector pH log[H + ] PI3K phosphoinositide 3 kinase ppm Parts per million

PAGE 16

16 PUFA Polyunsaturated fatt y acid (s) PVDF Polyvinylidene difluoride q Q uartet qC Quaternary carbon qPCR Quantitative PCR RNA Ribonucleic acid RNase Ribonuclease r.t. Room temperature ROS Reactive oxygen species s Second (s) SDS PAGE Sodium dodecyl sulfate polyacrylamide ge l electrophoresis Ser Serine siRNA small interfering RNA sp. Species (singular) spp. Species (plural) SPE Solid phase extraction SSA Sulfosalicyclic acid t Triplet td Triplet of doublets t R Retention time tBHQ T ert butylhydroquinone TNB 5 thio 2 nitrobenz oic acid TOCSY Total correlation spectroscopy Tris HCl Tris(hydroxymethyl)aminomethane hydrochloride buffer UV Ultraviolet light

PAGE 17

17 v/v Volume per volume w/v Weight per volume (1g/100 mL ) fold, fold concentrated, times

PAGE 18

18 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DISCOVERY AND CHARAC TERIZATION OF SMALL MOLECULE ACTIVATORS OF THE ANTIOXIDANT RESP ONSE ELEMENT By Rui W ang December 2012 Chair: Hendrik Luesch Major: Pharmaceutica l Sciences The antioxidant response element (ARE) is a cis acting enhancer sequence that regulates the expression of most phase II cytoprotective enzymes. Activation of the ARE, thereby increas ing the expression of these enzymes, e.g. NAD( P)H: quinone oxidored uctase 1 (NQO1) and glutathione S transferases (GSTs), can alleviate the damage from cellular oxidative stress which in turn, may ameliorate the progress of many age related diseases, such a s neurodegenerative disease, stroke and aging itself. The ARE is regulated through the Keap1 Nrf2 signaling pathway. Nrf2, the transcription factor that binds to the ARE, can be activated by alkylation of i ts cytoplasmic repressor, Keap1, and through phos phorylation by certa in kinases Th is research presents the discovery of four Michael acceptor type small molecule activators of the ARE from various resources and the subsequent biological mechanisms of action studies of two of them (EKODE and compound 1 ) in addition to the chemical and biological characterization of a previously reported inducer (AI 3) identified through a high throughput screening campaign First, EKODE, an endogenous oxidative metabolite of linoleic acid identified from a library of 19 essential fatty acids and derivatives was found to be a potent ARE activator Later on, three

PAGE 19

19 structure analogs (compounds 1 3 ) of EKODE were isolated through bio assay guided fractionation from a n edible marine eukaryotic alga, Ulva lactuca that was pri oritized from a collection of 30 species of field collected eukaryotic algae Among the three natural compounds, compound 1 not only resembled EKODE chemically it also proved to be a promising ARE inducer biologically. In a third project we found that AI 3, a known ARE inducer in cell culture also possessed potent ARE activating power in vivo in two whole animal models AI 3 is structurally unique in that it has two thiol sensitive sites that could undergo nucleophilic addition elimination reactions. It was concluded that AI 3 activated the Nrf2 ARE pathway by primarily alkylating a reactive cysteine residue (C ys151) on the Nrf2 repressor Keap1. Collectively, the small molecule ARE inducers discovered and characterized here may prove to be valuable biolo gical tool s and/or even provide potential therapeutic interventions with oxidative stress related diseases.

PAGE 20

20 CHAPTER 1 INTRODUCTION The Keap1 Nrf2 ARE Signaling P athway The antioxidant response element ( ARE ) gained much attention for oxidative stress rel ated research since it was found to govern the transcriptional activation of cytoprotective enzymes in 1990 1 The identification of the two cytoplasmic regulators of the ARE, the transcriptional activator Nrf2 (1997) 2 3 and its repressor Kea p1 (1999) 4 delineated the antioxidant signaling pathway that provided a promising target for antioxidant drug discovery 5 6 Over the past decades, the activation of the nuclear factor E2 related factor 2 (Nrf2) antioxidant response element (ARE) antioxidant defense signa ling pathway was extensively studied to tackle oxidative stress related health problems 7 10 Oxidative stress is the situation when the cell is unable to control the r eactive oxygen species (ROS) generated from exposure to environmental stresses and harmful chemicals 11 12 Left unattended, excess ROS may cause inflammation, cancer, and many age related diseases, such as diabetes, cardiovascular damage and neurodegeneration 13 14 The Nrf2 protein is an inducible cap 'n' collar type transcription factor that is responsible for activating the expression of a variety of antioxidant proteins and cyt oprotective enzymes. Under normal conditions, its repressor Keap1 serves as an adaptor for Cul3 based E3 ubiquitin ligase complex to target Nrf2 for proteasomal degradation. However, when the cell is exposed to stressors, changes in Keap1 lead to the disso ciation of the Cul3 complex, resulting in discontinuation of Nrf2 ubiquitination. This in turn promotes the accumulation of Nrf2, its nuclear translocation, and the subsequent binding to the antioxidant response element (ARE) that regulates the

PAGE 21

21 expression of many cytoprotective genes (Figure 1 1) such as NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S transferase (GST) 15 There are six function al domains (Nrf2 ECH homology 1 6, or Neh1 6) in Nrf2. The C terminal Neh1, Neh4 and Neh5 domains are important for ARE binding and transactivation, whereas the N terminal Neh2 domain are responsible for binding with Keap1 through its DLG and ETGE motifs 16 Keap1 possesses three functional domains, the N terminal Broad complex, Tramtrack, and Bric a Brac (BTB) domain, the intervening region (IVR), and the C termi nal DC domain that encompasses the double glycine repeat or Kelch repeat (DGR) and the C terminal region (CTR). In a healthy cell, the N terminal BTB domains of two molecules of Keap1 form a homodimer with the two C each of the DLG (lower affinity) and ETGE (high affinity) motifs in the Neh2 domain of Nrf2. This specific positioning allows the Cul3 E3 ubiquitin ligase that also binds at the BTB region to ubiquitinate the seven lysine residues between the DLG and ETGE motifs 17 Keap1 senses oxidative stressors through its cysteine residues, or the so called 18 Distinct cysteine residue (s) are recognized by specific sets of chemicals to each elicit their unique patterns of downstream molecular effects. Out of the twenty seven cysteines on Keap1, nine of them neighbor with basic amino acids and are therefore thought to possess highly reactive nucleophilic sulfhydryl groups that can covalently bind to electrophilic pro oxidants 19 [though, e.g., Michael reaction (Figure 1 1)] three of which (Cys151, Cys273, and Cys288) were conceded to be the sole or collaborative player(s) in Keap1 Nrf2 signaling in various cell types 20 Cys151 is located in the BTB domain. Modifications at this particular site have been shown to result in the

PAGE 22

22 dissociation of the Cul3 ubiquitin ligase complex 21 possibly perturbed by the molecular volume increases at Cys151 22 which also agrees with the earlier findings that mutations of the cysteine to a less electrophile sensitive serine renders the Keap1 C151S an inactive oxidative stress sensor 23 In contrast, manipulations of the two IVR cysteines Cys273 and Cys288 were found to retain Keap1 Cul3 interaction 24 but instead lead to the dissociation of the low affinity Nrf2 DLG domain fro m Keap1 25 so that it may no longer be able to hold Nrf2 in the correct conformation for ubiquitination 26 in accordance with the constitutive activities of Nrf2 found in the presence of Keap1 C273S or Keap1 C288S 23 Small Molecu le A ctivators Targeting the Nrf2 ARE P athway Given the demonstrated therapeutic promises in activating the Nrf2 ARE antioxidant defense signaling pathway, extensive e fforts have been made to discover and subsequently characterize ARE activators from both n atural and synthetic resources. Many naturally occurring small molecule inducers have been isolated and explored as chemopreventive or therapeutic agents (Figure 1 2) For example, curcumin 27 the active ingredient in traditional herbal remedy and dietary spice turmeric ( Curcuma longa ) is currently in clinical trials for multiple conditions, including several 28 The skin of red grapes ( Vitis vinifera ) is rich in r esveratrol 29 30 which was found to be responsible for an inverse relationship between grape consumption and breast cancer occurrence in an epidemiologic study 31 In a clinical setting, resveratrol was observed to induce the re expression of tumor suppressor genes in a group of women who are at increased risk of breast cancer 32 The detoxification enzyme inducer, sulforaphane 33 was found in many cruciferous

PAGE 23

23 vegetables. It has been shown that daily regimen of hot water infused with 3 day old broccoli sprouts has promising results in cancer chemoprevention in healthy individuals 34 Broccoli sprouts ( Brassica oleracea italica ) contain high levels of its precursor, glucoraphanin 35 which can be enzymatically converted to sulforaphane in the gastrointestinal tract after ingestion 36 S ynthetic libraries were also successfully utilized t o generate some potent A RE activators (Figure 1 2) For example, medicinal chemistry analysis of sulforaphane identified ten commercially available synthetic analogs 37 one of which, 3 morpholinopropyl isothiocyanate (3MP ITC) was found to induce cytoprotective gene expression in mice 38 AI 1, a potent ARE inducer in IMR 32 ce lls and primary cortical neurons was discovered from a synthetic library of 1.2 million individually array ed small molecules in a high throughput screening (HTS) campaign 39 A second HTS of a library of 9,400 compounds yielded LAS0811 that was found to activate the ARE re gulated cytoprotective genes in HepG2 cells 40 and recombinant HepG2 (VL 17 A) cells 41 The aims of the present research were to discover more potent small molecule activators of the Nrf2 ARE pathway from both natural and synthetic resources, including libraries of marine natural products and synthetic compounds ; and to elucidate the chemical and biological mechanism of actions of any of the activators identified.

PAGE 24

24 Figure 1 1. The current working model of the Keap1 Nrf2 ARE antioxidant de fense signaling pathway and the mechanism of Michael reaction.

PAGE 25

25 Figure 1 2. Chemical structures of ARE inducers mentioned in the text

PAGE 26

26 CHAPTER 2 ACTIVATION OF THE AN TIOXIDANT RESPONSE E LEMENT BY SPECIFIC OXIDATION PRODUCTS O F LINOLEIC ACID Rationa le Linoleic acid (C18:2 n 6), the most abundant polyunsaturated fatty acid (PUFA) in human low density lipoprotein (LDL), is an essential nutrient, but has also been implicated in the pathogenesis of atherosclerosis, hypertension, diabetes, and other disea ses 42 45 The paradox of an essential fatty acid participating in both beneficial and pathological processes may be explained by its conversion to biologically a ctive metabolites 46 47 As an example of a pathological effect, it has been s hown that one oxidation product of linoleic acid, 12,13 epoxy 9 keto 10(trans) octadecenoic acid (EKODE), stimulates aldosterone secretion by rat adrenal cells, providing a potential link between linoleic acid oxidation and hypertension 48 Effects of polyunsaturated fatty acids differ from cell to cell. For example, in cultured endothelial cells, l inoleic acid elicits production of superoxide and nitric oxide, and increases intracellular calcium levels 49 By contrast, in an insulin secreting cell line and in primary normal human fibroblasts, linoleic acid protects against oxidativ e stress 50 51 The protective effect of linoleic acid described by Beeharry et al. 51 is dependent on PI3 kinase (PI3K) activity. PI3K activity is also necessary for another protective effect of a variety of compounds activati on of the antioxidant response element (ARE) 52 Because of this common involvement of PI3K, we postulated that the protective effect of linoleic acid derives from its activati on of the ARE an effect of Reproduced with permission from Wang, R.; Kern, J. T.; Goodfriend, T. L.; Ball, D. L.; Luesch, H., Activation of the antioxidant response element by specif ic oxidized metabolites of linoleic acid. Prostaglandins, leukotrienes, and essential fatty acids 2009, 81 (1), 53 9. Copyright (2009) Elsevier Ltd.

PAGE 27

27 linoleic acid itself or of one of its oxidation products. The experiments described here tested the effects of linoleic acid, other fatty acids, and several oxidation products on ARE activation in two cell types. Profili ng of F att y A cids and Related Metabolites for ARE Activation in IMR 32 C ells We screened linoleic acid and 18 related fatty acids and oxidation products (for structures, see Figure 2 1 ) for ARE activation at 10 M in IM R 32 human neuroblastoma cells a va lidated cellular model of oxidative stress 52 54 using an ARE luciferase based reporter gene assay 53 These fatty acids included four other nonconjugated unsaturated fatty acids without additional functional group s, five al lylic unsaturated carbonyl systems, four epoxides and two prostaglandins, including prostaglandin J2 (PGJ2), an arachidonic acid metabolite that is known to induce the expression of ARE regulated genes 55 Linoleic acid itself did not induce the ARE in IMR 32 cells; however, the epoxy keto linoleic acid EKODE exhibited activity (23.1 fold) comparable to the model activator tert butylhydroqui none (tBHQ) at 10 M (34.9 fold), while only four other compounds (15 oxo ETE, 13 oxo ODE, 9 oxo ODE, PGJ2) activated the ARE more than 2 fold (4.7 3.9 2.3 and 4.4 fold, respectively). All of the active c ompounds are Michael acceptors unsaturated carbonyl groups (enones) which can act as electrophiles (Figure 2 2 ). The activity of PGJ2 was accompanied by apparent response analysis sugge sted that fold) without toxicity. Based on the remarkable activity of EKODE, with out apparent toxicity at 10 we focused on this compound in subsequent experiments.

PAGE 28

28 ARE Activation by EKODE in the P rese nce of Antioxidant and V alidation in Primary Cortical N eurons Many Michael acceptors are known for their ability to activate the ARE and react with sulfhydryl groups, including glutathione, thereby mimicking an oxidative insult 56 Consequent ly, their ARE activities may be reduced in the presence of scavenging was added to the culture medium (Figure 2 3 A). The same effect was observed with diethyl maleate (DE M, 20 M), a classical electrophile that reacts via conjugate addition, while the activity of tBHQ was largely unaffected as previously described (Figure 2 3 A) 54 Dose response analysis indicated that an EKODE concentration of 10 M was re quired for potent ARE activity (here: 41.5 fold; Figure 2 3 B). Depending on the experimental conditions and status of the IMR 32 cells, we observed ARE activation by EKODE at 10 M from 20 to 45 fold. At 32 M, EKODE activated the ARE even more (110 fol d; Figure 2 3 B), but also demonstrated toxicity, while EKODE did not introduce significant cyto toxicity at 10 M (by observation under a microscope cells were all rounded up floating, or lysed ) To test whether EKODE can also activate the ARE in a more differentiated cell type, we measured ARE activity in primary, dissociated murine neuronal cortical cultures derived from ARE hPAP transgenic mice (Figure 2 3 C). As observed in IMR 32 cells, EKODE activated the ARE in primary cells as well, although at hal f the efficacy of tBHQ, (9.6 vs 18.6 fold). E KODE Mediated Activation of Endogenous ARE Regulated Genes and Glutathione Levels in IMR 32 C ells reporter gene assay, we ev aluated its effects on level s of endogenous gene products.

PAGE 29

29 NAD(P)H:quinone oxidoreductase 1 (NQO1), which prevents reduction of quinones that lead to radical species formation, is known to be strongly induced by ARE activators 57 We first assessed NQO1 transcript levels by quantitative PCR (qPCR) after revers e transcription (RT) upon treatment of IMR 32 cells with EKODE for 8 h. At 10 M, EKODE induced NQO1 by 15.1 fold ( Figure 2 4 A) as compared with 8.7 fold for tBHQ (data not shown). A lower EKODE concentration (1 M) was significantly less effective in incr easing NQO1 mRNA levels. In contrast, mRNA levels of transcription factor NRF2 were virtually unchanged. Next, we used immunoblot analysis to measure NQO1 protein levels upon 24 h of EKODE treatment. NQO1 levels were increased in IMR 32 cells treated with 10 M but not 1 M EKODE ( Figure 2 4 B). Analysis of NQO1 transcript and NQO1 protein levels in IMR 32 cells upon EKODE treatment paralleled the result from the ARE luciferase reporter assay. As pointed out above, Michael acceptors at toxic concentrations can alkylate glutathione and deplete glutathione levels 58 However, since glutathione biosynthetic genes are regulated by the ARE, activat ion of the ARE should have an opposing effect, contributing to an enhanc ed cellular antioxidant status. We assessed the effect of EKODE on levels of glutathione in a time dependent manner at the nontoxic concentration at which EKODE activates the ARE (10 M). While glutathione levels were reduced by about 22% relative to vehicle control after 2 h of exposure, longer incubation times (8 h, 16 h, 24 h) led to a steady increase of glutathione concentrations with a peak at 16 h (+61%) ( Figure 2 4 C ). This trend has been observed with Michael acceptors at nontoxic concentrations, an effect originally attributed to enhanced cystine uptake 58 but bett er explained by enhanced glutathione synthesis.

PAGE 30

30 Mechanism of ARE A ctivation by EKODE The major transcription factor i nvolved in ARE activation is Nrf 2 59 60 To test if EKODE requires NRF2 to exert its ARE activating effect, we carried out two sets of experiments. First, we depleted IMR 32 cells of NRF2 using small interfering RNAs (siRNAs) specifically targeting the NRF2 transcript and cotra nsfected the ARE luciferase reporter along with control constructs for normalization (actin lacZ ) and to monitor DNA transfection efficiency (CMV GFP ). We used siRNAs at 50 nM which reduced NRF2 levels by >80% as we previously validated by dose response an alysis 59 After 48 h, the transfected cells were treated with EKODE for another 24 h and ARE activity was measured by luminescence detection. EKODE was unable to acti vate the ARE reporter in NRF2 depleted cells ( Figure 2 5 A). The activity of tBHQ was also completely ab olished in this system (Figure 2 5 A). In a second experiment, we cotransfected a dominant negative Nrf2 with the reporter plasmids; again EKODE as well a s tBHQ lacked ARE activity in those cells (data not shown). Kinase mediated signaling has been implicated in ARE activation; particularly the PI3K and MAPK pathways 52 61 To determine the signaling pathways that mediate ARE target genes, we tested the effects of the PI3K inhibitor LY294002 and the MEK1 inhibitor PD98059 at concentrations that were previously shown to be effective in IMR 32 cells. EKODE did not fully activate the ARE reporter in cells that were pre treated with LY294002, while PD98059 had no effect (Figure 2 5 B). Summary The ARE is a cis acting enhancer element in the promoter of many phase II detoxification and antioxidant genes. The transcription factor that governs the

PAGE 31

31 expression of ARE regulated genes is Nrf2, which is usually kept in the cytoplasm by the repressor protein Keap1 60 Keap1 contains highly reactive sulfhydryl groups and acts a cellular sensor that recognizes electrophilic inducers 62 In respon se to oxidative stress, glutathione depletion, or mediators such as tert butylhydroquinone (tBHQ), second messenger systems including PI3K promote the translocation of the transcription factor Nrf 2 to the nucleus, where it binds to the ARE and coordinates transcription of a collection of cytoprotective and detoxification genes including heme oxygenase 1 63 glutathione S transferases (GSTs) 64 and NAD(P)H:quinone oxidoreducta se 1 65 Induction of these enzymes by the ARE contributes to protection from a variety of toxins in a multitude of cell types 66 70 We showed that EKODE, an endogenous product of linoleic acid oxidation, can activate this protective mechanism. Our results suggest that EKODE is a stronger ARE activator than many other conjugated eno ne type Michael acceptors that result from fatty acid oxidation. This activity was not cell type specific as we could clearly show activity in human neuroblastoma cells (IMR 32) as well as in primary cortical cells. e reporter assay system; EKODE also induced transcription of endogenous ARE regulated genes: NQO1 mRNA levels were increased upon EKODE treatment concomitant with an increase of NQO1 protein levels in IMR 32 cells. The observed increase in glutathione l evels can be explained by enhanced synthesis as a result of inducing ARE regulated genes that encode enzymes involved in glutathione biosynthesis. Partial blockade of its effects by catalase suggests that EKODE acts by a mechanism analogous to that of diet hyl maleate, a pro oxidant that

PAGE 32

32 depletes cellular glutathione at toxic concentrations and also increases glutathione levels at nontoxic concentration 58 Either a small initial depletion of GSH triggers the ARE activation or, more likely, EKODE alkylates KEAP1 sulfhydryl grou ps(s), leading to release of Nrf 2, and the subsequent transcription factor translocation and ARE activation. Our experi ments using NRF2 specific siRNAs and a pharmacological inhibitor of PI3K activity demonstrated that NRF2 and PI3K mediate EKODE activity. These results are consistent with the hypothesis that the reported PI3K requirement for the protective effects of lino leic acid 51 could result from ARE activation by this metabolite of linoleic acid. Both NRF2 and PI3K were recently shown to be required for ARE activation by cDN As coding for sequestosome 1 and dipeptidylpeptidase 3, which exert protective effects upon overexpression 59 EKODE is not the only fatty acid derivative known to act ivate the ARE pathway; the J2 series of prostaglandins potently induces Nrf2 nuclear translocation and the subsequent up regulation of detoxification genes such as GST 55 Activity of these eicosanoids is also attributed to their enone functionality which provides an electrophilic carbon for attack by nucleophiles 71 Prostag landin J2 (PGJ2) based cyclopentenone derivatives of arachidonic acid have shown neuroprotective effects in various models 72 73 PGJ2 also showed ARE activation in our reporter assay system using IMR 32 cells, but to a lesser degree than EKODE at the same concentration. At the concentration where EKODE activated the ARE without inducing toxicity, PGJ2 was toxic; however, PG

PAGE 33

33 prostaglandins, EKODE is found in human plasma at concentrations between 10 9 and 5 10 7 mol/L 74 so the relevance of linoleic acid derivatives in intact animals m ay exceed that of eicosanoids. EKODE stimulates aldosterone production by rat a drenal cells 48 and aldosterone can be pathogenic, in part by contributing to oxidative stress. Stimulation of antioxidant enzyme synthesis by EKODE might lessen the damaging effects of aldosterone and wise detrimental insults. Omega 6 fatty acids are generally portrayed as contributing to pathology, but the ARE inducing properties of the oxidized derivative of linoleic acid may partially redeem their bad reputation. Oxidation products of common fatty a cids, like the parent acids themselves, display both helpful and harmful properties. Only when synthesis of these products can be safely inhibited in vivo will we learn the different roles of the derivatives and their precursors. Meanwhile, our data show t hat research into the biological properties of PUFAs must include consideration of their oxidation products. Experimental Chemicals, Reagents and P lasmids EKODE was synthesized by an adaptation of the process described by Gardner and Crawford 75 and purified by high pressure liquid chromatography 48 EKODE employed in this study was an isomeric mixture consisting of primarily one of the isomers, termed trans EKODE ( E ) 1b, according to the nomenclature proposed by Lin et al. 76 Additional fatty acid derivatives were purchased from Cayman Biochemicals (Ann Arbor, MI) and INDOFINE Chemical Company, Inc. (Hillsborough, NJ). Tert butylhydroquinone (tBHQ) was purchased from Acros Organics (St. Louis, MO).

PAGE 34

34 LY294002 and PD9805 9 were purchased from Calbiochem (San Diego, CA). Media reagents were purchased from Invitrogen (Carlsbad, CA) unless specified otherwise. Fetal bovine serum (FBS) was obtained from Atlanta Biologicals (Norcross, GA) and from Hyclone (Logan, UT). FuGENE6 a nd FuGENE HD transfection reagents were from Roche Diagnostics (Indianapolis, IN) and siLentFect from Bio Rad Laboratories (Hercules, CA) Detection reagent, BriteLite, for ARE reporter assays was purchased from PerkinElmer Life And Analytical Sciences, I nc. (Waltham, MA). Compounds were dissolved or obtained from the supplier in the solvents indicated in Table 2 1. All other chemicals were purchased from Fisher Scientific, Inc. (Hampton, NH). The luciferase reporter construct for human NQO1 ARE (ARE luc) contains the sequence CTCAGCCTTCCAAATCGCAGTCACAGTGACTCAGCAGAATC 53 Small interfering RNAs (siRNAs) against human NRF2 were obtained from Dh armacon, I nc. (Lafayette, CO) ARE Activity Profiling of Fatty Acid Derivatives in IMR 32 C ells ARE luciferase reporter plasmid (100 ng/well), CMV GFP (10 ng/well, for monitoring transfection efficiency) and actin lacZ (20 ng/well, for normalization) were cotransfec ted into IMR 3 2 human neuroblastoma cells (3 3 ,000 cells/well) using FuGENE HD transfection reagent following the The transfected cells were dispensed in 96 Essential Medium (ATCC, Man assas, VA) supplemented with 10% FBS at 37 C in a humidified 5% CO 2 atmosphere. After 24 h, cells were treated with individual compounds and incubated at the same condition for another 24 h. ARE activities were detected by using BriteLite detection reagen t for luminescence. Each compound was tested in quadruplicate. Normalized values are given.

PAGE 35

35 ARE Activity in IMR 32 Cells in the Presence of Antioxidant (C atalase) IMR 32 human neuroblastoma cells were plated at a density of 1 0,000 cells/well in a 96 well supplemented with 10% FBS at 37 C in a humidified 10% CO 2 atmosphere. Following the incubation, cells were cotransfected with the ARE luciferase reporter plasmid (80 ng/well) and CMV lacZ (20 ng/well) using FuGENE6 transfection reagent following the immediately followed by compound addition. An additional 24 h later, luciferase and galactosidase activities were measured 53 and compared with compound treatment alone. The data are presented as the ratio of luciferase activity in relative light units to galactosidase a ctivity to account for any differences in transfection efficiencies between experiments. This experiment was performed by Dr. J Kern. Mouse Primary Cortical C ultures Primary cerebral cortical cultures were prepared from an ARE driven, heat stable human al kaline phosphatase (ARE hPAP) transgenic reporter mouse line 77 On embryonic day 16 (E16), the cortices from mouse pups were dissected and transferred to Hank's b alanced salt solution (HBSS). The tissue was dissociated with 0.05% trypsin in HBSS for 10 min at 37 C, and then filtered through a 70 m cell strainer. Cells were plated on poly D lysine c oated plates at approximately 3 2 0,000 cells/ ( cm squared ) in Comple Media with 10% fetal bovine serum, 10% horse serum, 2 mM L glutamine, and 1% penicillin/streptomycin) and allowed to adhere to the plate for 45 min in a 37 C humidified incubator (5% CO 2 and 5% O 2 ) prior to a media exchange to remove non

PAGE 36

36 adherent cells. The plated cells were incubated in CEMEM for 48 h prior to a media change to Neurobasal media with a B27 supplement containing antioxidants to specifically enhance neuronal growth. On the following day, the experimental treatments were performed. For analysis of human placental alkaline phosphatase (hPAP) activity, the mouse primary cortical cultures were lysed and the whole cell extracts incubated at 65 C for 25 min to inactivate endogeno us phosphatase activity. Analysis of the hPAP activity was performed using the phospho light chemiluminescent substrate per the This experiment was performed by Dr. J Kern. RNA Extraction, Q uantitative RT P CR and V alidation IMR 32 cells (6 00,000 cells/well) were plated in a 6 well plate 24 h prior to treatment. Cells were treated with vehicle (0.5% DMSO), tBHQ (10 M) and EKODE (1 and 10 M). After 8 h of incubation, total RNA was extracted with RNeasy Mini Kit (Qiagen, Valencia, CA). cDNA was synthesized from 2 g of total RNA by using SuperScript II Reverse Transcriptase (Invitrogen) and Oligo (dT)12 18 Primer (Invitrogen). The cDNA served as a template for quantitative PCR (qPCR) using TaqMan probes (Appli ed Biosystems, Foster City, CA). qPCR was performed by using 12.5 L of TaqMan 2 universal master mix, 1.25 L of 20 TaqMan gene expression assay mix, 2 L of cDNA and 9.25 L of RNase free sterile water, in a total volume of 25 L per well reaction in a 96 well plate (Applied Biosystems) by using the ABI 7300 sequence detection systems (Applied Biosystems). The thermocycler program consisted of 2 min at 50 C, 10 min at 95 C, and 40 cycles of 95 C for 15 s and 60 C for 1 min. Each assay was carried ou t in triplicate. GAPDH expression was used as internal control for normalization.

PAGE 37

37 Immunoblot A nalysis IMR 32 cells (6 00,000 cells/well) were plated into each well of 6 well plates 24 h prior to treatment. Cells were treated with vehicle (0.5% DMSO) and EKO DE at 1 and 10 M. After 24 h of incubation, whole cell lysates were prepared by using PhosphoSafe lysis buffer (Novagen, Gibbstown, NJ). The protein concentrations of the cell lysates were measured by using the BCA assay (Pierce, Rockford, IL). Samples co ntaining equal amount of protein were separated by SDS PAGE, transferred to PVDF membrane, probed with antibodies and detected with Supersignal Femto Western Blotting Kit (Pierce). Anti NQO1 antibody was purchased from Abcam (Cambridge, MA) and the seconda ry anti goat antibody from Santa Cruz Biotechnology (Santa Cruz, CA). Anti actin and the secondary anti rabbit antibodies were obtained from Cell Signaling (Boston, MA). Glutathione A ssays IMR 32 cells were seeded at 3 ,000,000 per plate (10 cm dish) or 8 00,000 per well (6 well plate). When the desired confluency was reached, the cells were treated with EKODE (10 M) or vehicle (DMSO, 0.5%) for 2, 8, 16 or 24 h. Treated cells were then washed twice with PBS and harvested in 1 mL (10 cm dish) or 200 L (6 well plate) of PBS. The collected cells were centrifuged at 600 g for 10 min at 4 C. After removal of the supernatant, the volume of the cell pellet was measured and resuspended in 3 volumes of 5% sulfosalicylic acid (SSA) solution. The cell suspensions were frozen (in liquid nitrogen) and thawed (in 37 C water bath) twice, incubated for 5 min at 4 C, and centrifuged at 10,000 g for 10 min at 4 C. The supernatant was transferred to a separated microcentrifuge tube and used immediately as glutathione stock. The concentrations of total (reduced and oxidized) glutathione

PAGE 38

38 (GSH + GSSG) were assessed using Glutathione Assay Kit (Sigma, St. Louis, MO), based on a kinetic reaction in which catalytic amounts (nmoles) of GSH cause a dithiobis(2 nitrobenzoic acid) (DTNB) to 5 thio 2 nitrobenzoic acid (TNB) and the GSSG formed is recycled by glutathione reductase and NADPH, which also gives a positi ve value in this reaction. The yellow product, TNB is measured spectrophotometrically at 412 nm. The total glutathione levels were determined from a standard curve of reduced glutathione. Each of the four time points was measured in duplicate. Fresh 10 fol d dilutions of GSH stocks were used. Values given are normalized to glutathione content in vehicle treated cells. RNA Interference E xperiments 24 h prior to transfection, IMR 32 cells (1 00,000 cells/well) were plated in a 24 well plate. The nontargeting co ntrol siRNA and siGENOME SMARTpool siRNA reagents targeting NRF2 were obtained from Dharmacon. Using siLentFect as a transfection reagent, siNRF2 (50 nM, 330 ng/well) was cotransfected with ARE luc (250 ng/well), CMV GFP (50 ng/well, for monitoring transfe ction efficiency) and actin lacZ (100 ng/well, for normalization). After 48 h, the cells were treated with vehicle (0.5% DMSO), tBHQ (10 M) and EKODE (10 M) and incubated for an additional 24 h before luciferase and galactosidase activities were measur ed 53 59 Each experiment was carried out in quadruplicate. The data are presented as the ratio of luciferase activity in relative light units to galactosidase activity to account for effects on viability and any differences in transfection efficiencies between experiments.

PAGE 39

39 Inhibitor S tudies IMR 32 cells (1 00,000 cells/we ll) were transfected with ARE luc (594 ng/well), CMV GFP (59.4 ng/well, for monitoring transfection efficiency) and actin lacZ (118 ng/well, for normalization) in 24 well plates. After 24 h, the cells were pre treated with vehicle (0.5% DMSO), LY294002 (25 M, PI3K inhibitor) and PD98059 (50 M, MEK1 inhibitor) for 30 min prior to treatment with vehicle or EKODE (10 M). galactosidase activities were detected another 24 h later. Each experiment was carried out in quadruplicate. The data are presented as the ratio of luciferase activity in relative light units to galactosidase activity to account for any differences in transfection efficiencies between experiments and for potential effects of inhibitors on cell viability.

PAGE 40

40 Table 2 1 Fatty acids and their acronyms, controls and respective solvents used in this study. Acronym IUPAC name Solvent EKODE 12,13 Epoxy 9 keto (10) trans octadecenoic acid DMSO (+) Vernolic acid (12 S ,13 R ) Epoxy 9(Z) octadecenoic acid Eth anol ( ) Vernolic acid (12 R ,13 S ) Epoxy 9(Z) octadecenoic acid Ethanol (+) Coronaric acid (9 R ,10 S ) Epoxy 12 Z octadecenoic acid Ethanol 15 Oxo ETE 15 Oxo 5 Z ,8 Z ,11 Z ,13 E eicosatetraenoic acid Ethanol 13 Oxo ODE 13 Oxo 9 Z ,11 E octadecadienoic acid Ethanol 9 Oxo ODE 9 Oxo 10 E ,12 Z octadecadienoic acid Ethanol () 9 HETE () 9 Hydroxy 5 Z ,7 E ,11 Z ,14 Z eicosatetraenoic acid Ethanol () 12 HETE () 12 Hydroxy 5 E ,8 Z ,10 Z ,14 Z eicosatetraenoic acid Ethanol () 15 HETE () 15 Hydroxy 5 E ,8 Z ,11 Z ,13 Z eicosatetraenoi c acid Ethanol (9 S ) HODE (9 S ) Hydroxy 10 E ,12 Z octadecadienoic acid Ethanol (13 S ) HODE (13 S ) Hydroxy 9 Z ,11 E octadecadienoic acid Ethanol Linoleic acid 9 Z ,12 Z Octadecadienoic acid Ethanol a Arachidonic acid 5 Z ,8 Z ,11 Z ,14 Z Eicosatetraenoic acid Ethanol a Linolenic acid 9 Z ,12 Z ,15 Z Octadecatrienoic acid Ethanol Linolenic acid 6 Z ,9 Z ,12 Z Octadecatrienoic acid Ethanol Oleic acid 9 Z Octadecenoic acid Ethanol Prostaglandin E2 (PGE2) 9 Oxo (15 S ) dihydroxy prosta 5 Z ,13 E dien 1 oic acid DMSO Prostagl andin J2 (PGJ2) 11 Oxo (15 S ) hydroxy prosta 5 Z ,9,13 E trien 1 oic acid Methyl acetate tBHQ Tert butylhydroquinone DMSO DEM Diethyl maleate DMSO a T he compound was dissolved in a solvent containing 0.1% 2,6 di tert butyl 4 hydroxytoluene (BHT) to preven t autoxidation to peroxides.

PAGE 41

41 Figure 2 1. Chemical structures of the compounds tested.

PAGE 42

42 Figu re 2 2 ARE activation by EKODE and other linoleic acid derivatives in IMR 32 cells at 10 M using an ARE luciferase reporter gene assay. Like tBHQ, EKODE is a strong activator of the ARE. Four other Michael acceptors (15 oxo ETE, 13 oxo ODE, 9 oxo ODE, and PGJ2) exhibited weak ARE activation. ARE activation for each compound was normalized to the respective solvent (Table 2 1). Cotransfection of actin lacZ served to account for differences in cell number due to effects on viability. Structures of active compounds are given. Results are the means standard deviation ( n = 4).

PAGE 43

43 Figure 2 3. R eporter gene assays in IMR 32 cells and primary cortical cultures. (A) ARE activation in IMR 32 cells by diethyl maleate (DEM), tBHQ, and EKODE in the pr esence and absence of catalase. (B) Dose response analysis of ARE activation by EKODE in IMR 32 cells. Concentrations 32 M resulted in toxicity. (C) ARE activation in primary cortical cultures derived from ARE hPAP transgenic mice. EKODE, but not linoleic acid, activates the ARE compared with control. Results are the means standard deviation ( n = 4). D ata presented in Figures 2 3A and 2 3C : courtesy of Dr J. Kern.

PAGE 44

44 Figure 2 4. EKODE induces endogenous ARE regulated genes and affects GSH levels in IMR 32 cells. (A) Effect of EKODE on NQO1 transcript levels as analyzed by quan titative real time PCR (qPCR). IMR 32 cells were treated for 8 h, total RNA was isolated, reverse transcribed to cDNA and subjected to TaqMan analysis. Results are the relative expression means standard deviation ( n = 3). GAPDH was used as internal control for normalization. EKODE induced NQO1 expression at 1 and 10 M. For comparison, NRF2 transcript levels remained unchanged. (B) Effect of EKODE on NQO1 protein levels as analyzed by immunoblot analysis. IMR 32 cells were treated with EKODE for 24 h, proteins were extracted, resolved by SDS PAGE and subjected to immunoblot analysis for NQO1 ( actin = control). EKODE greatly increased NQO1 protein levels at 10 M. (C) Time dependent changes of GSH levels in IMR 32 cells upon exposure with EKODE vs. vehicle (0.5% DMSO). Cells were treated with EKODE for the indicated times, harvested and resusp ended in 5% SSA solution. Upon two freeze thaw (liquid N 2 /37 C) cycles and centrifugation, the supernatant served as a s ource of cellular glutathione. Total glutathione (GSH, GSSG) was assessed using the Glutathione Assay Kit (Sigma). Results are the mea ns standard deviation ( n = 2).

PAGE 45

45 Figure 2 5. Mechanism of ARE activation in IMR 32 cells. (A) Effect of siRNAs targeting NRF2 on ARE activation by EKODE and tBHQ (10 M each) in IMR 32 cells. The ARE luciferase reporter was cotransfected with siRNAs targeting NRF2 or control siRNAs (50 nM), along with actin lacZ (for normalization) and CMV GFP (to monitor DNA transfection efficiency). After 48 h, luciferase and galactosidase activities were measured ( n = 4). EKODE was unable to activate the ARE in I MR 32 cells depleted of NRF2. (B) Effect of PI3K and MAPK inhibitors on ARE activation by EKODE and tBHQ in IMR 32 cells. IMR 32 cells were transfected with ARE luciferase and actin lacZ reporters and 24 h later pre treated with PI3K inhibitor LY294002 (25 M) and MEK1 inhibitor PD98059 (50 M) before EKODE addition. Inhibitor concentrations used were previously shown to be effective in this cell type. Luminescence was recorded 24 h later and normalized ARE activities are displayed. As shown, EKODE requires PI3K activity for full ARE activity, however, acts independent of the MAPK pathway. Results are the means standard deviation ( n = 4).

PAGE 46

46 CHAPTER 3 SEAWEEDS AND UNSATUR ATED FATTY ACID CONS TITUENTS FROM THE GREEN ALGA ULVA LACTUCA AS ACTIVATORS OF THE CYTO PROTECTIVE NRF2 ARE PATHWAY Rationale As mentioned above, dietary phytochemicals, e.g., curcumin (turmeric) 27 28 r esveratrol (red grapes) 29 32 and sulforaphane 33 36 have been demonstrated to possess promising chemopreventive or therapeutic properties In addition to terrestrial organisms, the marine environment has proven to be a rich source of potent compounds with diverse therapeutic properties 78 79 Our group has focused on the discovery and development of drug leads from marine cyanobacteria, which resulted in several molecules with anticancer activities 80 82 In an effort to expand our research area to disease (including cancer) prevention, we started investigating marine eukaryotic algae, or seaweeds, b ecause the consumption of edible seaweeds has been postulated to account for a longer life span and low cancer occurrence 83 84 We hypothesized that like their terrestrial counterparts, could also activate the ARE and protect the cell from potential oxidative damage 85 In fact, individual compounds with antioxidant activities have been identified from marine algae. For example, the free radical scavenger fucoxanthin, a carotenoid from a common edible seaweed, Hijikia fusiformis 86 was found to activate the antioxidant defense system (Nrf2 ARE) in mouse liver cells during the course of our project 87 In the present s tudy, we aimed to discover other small molecule antioxidants from seaweeds. We screened a collection of Floridian marine eukaryotic algae for their Reproduced in part with permission from Free Radic Biol Med under revision for publication. Unpublished work. Copyright (2012 ) Elsevier Ltd.

PAGE 47

47 ability to activate the Nrf2 ARE pathway by using an ARE luciferase reporter gene assay that is amenable to high throughput screening 39 59 88 An edible green alga, Ulva lac tuca was highly potent in activating the ARE luc reporter. Three rare keto fatty acid based compounds were subsequently isolated from the lipophilic extract through bioassay and NMR guided fractionation. Their chemical structures were elucidated and the biological mechanism of actions of the most active compound and fraction characterized. ARE activity Profiling of Various Seaweeds and the I dentification of Ulva L actuca as a Rich Source of A ntioxidants Using an ARE luciferase reporter assay 53 we tested the bioactivities of thirty marine algae. The seaweeds were collected in Florida waters, frozen immediately on site, then lyophilized and extracted consecutive ly with non polar (50% EtOAc in MeOH, v/v) and polar (50% EtOH in H 2 O, v/v) solvent mixtures. Afterwards, a 20 mg sample of each crude extract was fractionated over normal and reversed phase (C18) SPE cartridges to generate 6 7 fractions. All of the extrac ts and fractions were screened for ARE luc activity in a high throughput format in IMR 32 neuroblastoma cells, a standard cell type for oxidative stress related studies 39 59 88 Each sample was tested at two concentrations, 10 g/ mL and 100 g/ mL An arbitrary prioritization system was employed. An extract was considere d sufficiently active if one of its SPE fractions had more than 10 fold activity at any of the two concentrations. For comparison, a standard ARE activator, tert butylhydroquinone (tBHQ), normally activates the ARE luc to 15 30 fold at 10 M in the reporter assay in IMR 32 cells 88 53 While 58% of the green and 45% of the red algae species activated the reporter, fewer species (25%) of the brown algae appeared to be

PAGE 48

48 active at th e concentrations tested (Table 3 1 and Fig ure 3 1A). One particular species, Ulva lactuc a (Chlorophyta), stood out to yield highly active po lar and non polar extracts (Figure 3 1A). Subsequently, the remainder of the more active lipophilic extract was further fractionated by large scale silica gel chromatography and the resulting fractions re tested in the ARE luc reporter assay (Figure 3 1B). Bioassay Guided Fractionation, Isolation and S tructure D etermination of Three ARE A ctivators To identify the chemical components responsible for the ARE activity, we further separated the active silica g el fraction that had the pred ominant weight (fraction 4, Figure 3 1B) by reversed phase HPLC, which indicated that this fraction was still a very complex mixture of many minor constituents. The bioactivities of each of the HPLC fractions were tested again at two concentrations (10 g/ mL and 100 g/ mL ) using the reporter gene assay. The fractions that had greater than 10 fold activity at 10 g/ mL and major weight (>1 mg) were purified to afford three fatty acid type compounds, 1 3 (Figure 3 2A). For compoun d 1 7( E ) 9 keto octadec 7 enoic acid, the HRESIMS spectrum showed a pseudomolecular ion [M + Na] + of 319.2247, suggesting a molecular formula of C 18 H 32 O 3 with three degrees of unsaturation. The chemical structure was elucidated by 1D ( 1 H and 13 C) and 2D (COSY, TOCSY, HSQC, a nd HMBC) NMR techniques (Table 3 2 ). The 1 H NMR spectrum was indicative of a fatty acid type molecule, with signals for a methylene en H 1.30, 12H, C12 C17) and a poorly defined triplet due to a terminal CH 3 H 0.88, H 3 18) with virtual coupling (Figure 3 2B). The two H 6 H 6.83, H H 6.08, H 8) appeared to have HMBC correlations to a ket C

PAGE 49

49 unsaturated carbonyl system. The trans conformation of the double bond was deduced based on the large coupling constant (15.8 Hz) between the olefinic protons (H 7 and H 8). The third degree of uns aturation was accounted for by a carboxylic acid carbonyl C 177.20 (C1). Compound 2 7( E ) 9 keto hexadec 7 enoic acid, possessed a 1 H NMR spectrum very similar to that of 1 indicating that it is also a fatty type molecule (Figure 3 2B). HRESIMS analysis showed a pseudomolecular ion [M + Na] + of 291.1942, with a 28 amu (2 CH 2 ) difference from compound 1 The molecular formula was calculated as C 16 H 28 O 3 The structur e was determined by NMR (Table 3 3 ). It was shown that compound 2 has the same e xact functionalities as compound 1 including a terminal carboxylic acid group (C1) and an unsaturated carbonyl system (C7 C9), but with a truncated fatty chain (C10 C16). This acid had previously been isolated from a laboratory cultured marine diatom, Skeletonema marinoi 89 Compound 3 7( E ) 9 keto octadec 7 enamide, showed a pseudomolecular ion [M + Na] + of 318.2417 by HRESIMS, with only 1 amu difference from acid 1 Its molecular formula was calculated as C 18 H 33 NO 2 also with three degrees of unsa turation. The structure was determined again by NMR (Table 3 2 ). While the same unsaturated carbonyl system (C7 C9) and the fatty chain (C10 C18) were observed in the 1 H NMR spectrum, there was an additional pair of broad, low H 5.39 and H 5.24. These two protons were suggestive of a primary amide moiety at the C1 position in place of the carboxylic acid group present in the other two compounds (Figure 3 2B).

PAGE 50

50 Biological Activity of the Purified C ompounds The ARE activities of the three compounds in IMR 32 cells were compared by dose response analysis usi ng t he reporter gene assay (Figure 3 3A). At 10 g/ mL the C18 fatty acid ( 1 ) showed remarkable ARE activation (17.6 fold), which was six times higher than the C16 acid ( 2 2.8 fold), four times higher than the fatty acid amide ( 3 4.5 fold), and even slig htly higher than the positive control (tBHQ, 14.9 fold). At the higher concentration tested, 32 g/ mL the C18 acid ( 1 ) showed signs of cytotoxicity when the cells were observed under the microscope (almost all cells were rounded up floating, or lysed ) w hile the other two strongly activated the reporter. At 32 g/ mL the C16 acid ( 2 ) was two times more efficacious than the fatty acid amide ( 3 ) (30.3 fold vs. 13.2 fold, respectively). We compared the bioactivities and chemical structures of the three comp ounds with our previous studies of other fatty acids and predicted that the electrophilic Michael acceptor motif is essential for the potent ARE activities of the three compounds; related fatty acids that do not have this exact motif showed lesser or no AR E luc activation 88 The carboxylic acid functional group appeared to contribute to the activity because the amide derivative ( 3 ) was less efficacious than acid ( 1 ) ( 4.5 fold vs. 17.6 fold, respectively, at 10 g/ mL ) and acid ( 2 ) (13.2 fold vs. 30.3 fold, respectively, at 32 g/ mL ). And also the length of the fatty tail seemed to play a role because with identical acid and enone groups, the short chain acid ( 2 C16) w as less potent than the long chain acid ( 1 C18) (EC 50 : 6.0 g/ mL vs. 17.7 g/ mL respectively) ( Figure 3 3B). Because fatty acid 1 proved to be the most active in the series, we focused on this compound for further biological studies.

PAGE 51

51 Compound 1 Induces Cytoprotective G enes and Glutathione (GSH) Synthesis in IMR 32 C ells We assessed the levels of an endogenous ARE regulated cytoprotective gene, NQO1 in IMR 32 cells upon exposure to the C18 fatty acid ( 1 ). Similar to its parent fraction (fraction 4), the induction of NQO1 was found to be dose dependent both at the transcript and protein levels. Higher than basal levels of NQO1 mRNA were detected starting from 1 g/ mL (1.5 fold), and were much more pronounced at the higher non toxic concentrations ( Figure 3 4A). Similarly, by immunoblot analysis, NQO1 protein expression was detectable starting at 1 g/ mL and was the highest at 10 g/ mL ( Figure 3 5A). Glutathione (GSH), a thiol containing tripeptide, is the major intracellular antioxidant. The sulfhydryl grou p serves as an electron donor and reacts with ROS and unwanted electrophilic xenobiotics, maintaining a reducing cellular environment. Certain small molecules, e.g., diethyl maleate (DEM), activate the ARE by temporarily depleting the endogenous pool of fr ee thiols, primarily GSH 54 90 leading to a disrupted redox status of the cellular environment. This event is the n sensed by Keap1, which releases Nrf2 to activate the ARE, inducing a set of ARE regulated glutathione biosynthetic genes. Alternatively, or additionally, electrophilic compounds may alkylate Keap1 specifically to promote Nrf2 nuclear translocation and tr anscriptional activation of target genes, including those involved in GSH biosynthesis and recycling 5 To test if our molecule is thiol reactive rather nonspecifically, we first compared the ARE activities of compound 1 in a model system, i.e., the presence and absence of an exogenously supplied, cell permeable small molecule antioxidant, N acetyl cysteine (NAC) 54 In the presence of 1 mM of NAC, the ARE luc activity of the fatty acid was

PAGE 52

52 reduced by 70% ( Figure 3 4B), suggesting that it may indeed react with small molecule thiols and po ssibly also intracellular glutathione. Next, the levels of endogenous glutathione over time were examined after the cells were treated with compound 1 The result was similar to our previous observation for another ARE activating keto monounsaturated fatt y acid ( MUFA ) 12,13 epoxy 9 keto 10( trans ) octadecenoic acid (EKODE) 88 While a transient decrease was observed until 8 h (<30%), confirming reactivity towards GSH, the level of glutathione was restored by more than 50% of the basal level at 16 h and stayed above baseline at least up to 24 h ( Figure 3 4C), which is consistent with increased GSH biosynthesis via induced biosynthetic gene transcription. NRF2 and PI3K are R equired for ARE Activation by Compound 1 in IMR 32 C ells ARE activation is tightly regulated by Nrf2 and Keap1. In a healthy cell, Nrf2, the transcriptional activator of the ARE, is targeted by its cytoplasmic repressor, Keap1, for proteasomal degrada tion. When Keap1 senses environmental stress or harmful chemicals, it releases Nrf2, which translocates to the nucleus, where it binds to the ARE and activates expression of downstream cytoprotective genes. As shown in Figure 3 4A, the levels of NRF2 mRNA remained unchanged at the effective doses (1 10 g/ mL ) of compound 1 indicating that the induction of ARE regulated genes was not due to an elevated NRF2 transcript level. To confirm the involvement of NRF2 in fatty acid 1 induced ARE activation, we used small interfering RNAs (siRNAs) to knock down endogenous NRF2 transcripts in IMR 32 cells 88 The NRF2 depleted cells were then treated with 1 and analyzed for the ex pression of the ARE regulated NQO1 ( Figure 3 5A). NQO1 was virtually undetectable by immunoblot

PAGE 53

53 analysis, suggesting that NRF2 is essential for fatty acid 1 induced cytoprotective gene expression. Further dissection of the Nrf2 ARE mechanism had previousl y revealed that certain protein kinases may be involved in the activation of Nrf2 by phosphorylation and facilitate its stabilization and nuclear translocation 52 91 92 Two kinase signaling cascades in particular, the phosph oinositide 3 kinase (PI3K) and mitogen activated protein kinase (MAPK) pathways, have been extensively investigated 91 93 Their requirement for ARE activity seems to be cell type dependent. For example, the model ARE activator, tBHQ, requires the presence of PI3K, but not MAPK, to activate the ARE in IMR 32 cells 52 whereas the opposite was found in HepG2 cells 94 We performed loss of function experiments to investigate the kinase requirem ents for fatty acid 1 induced ARE activation. IMR 32 cells were pre treated with pharmacological inhibitors of either the PI3K or the MAPK pathway for 30 min, before being exposed to fatty acid 1 at its active concentration (10 g/ mL ). After 24 h, the cell s were lysed and analyzed by Western blot. Expression of NQO1 was reduced by half in the presence of a MAPK (MEK1) inhibitor, and completely diminished in the presence of a PI3K inhibitor ( Figure 3 5B). These data indicated that MAPK signaling pathway may be partially required while PI3K pathway is fully required for the induction of ARE regulated genes by compound 1 in IMR 32 cells. Compound 1 Enriched E xtract of Ulva L actuca Induces Cytoprotective G enes I n V itro and I n V ivo To determine if the in vitro cell culture results translate into in vivo activities, we wanted to test the activity of a compound 1 containing Ulva fraction in mice. However, materials from a re collection of Ulva lactuca (2009) had to be used due to the

PAGE 54

54 exhaustion of the original col lection (2006). The fractionation scheme was also updated in order to potentially better concentrate the fatty acid contents in the lipophilic fractions (see Materials and Methods). Fraction 3* (25% hexane in EtOAc, v/v) was found to be the only one that c ontained compound 1 To ensure that the bioactivity of fraction 3* was comparable to that of compound 1 the endogenous expression of the ARE regulated gene, NQO1 was assessed at the transcript and protein levels in IMR 32 cells. It was shown that fracti o n 3* induced high levels of Nqo 1 in a dose dependent manner. Higher than baseline levels of NQO1 mRNA were detected starting from 3.2 g/ mL (1.4 fold) and continued to increase until 32 g/ mL (23.0 fold) ( Figure 3 6A); a similar trend was observed at the l evel of protein expression ( Figure 3 6B). Having confirmed its in vitro ARE activities, we administered a single dose (50 mg/kg) of the compound 1 containing fraction 3* by oral gavaging to mice carrying a transgene that has the ARE containing promoter reg ion of rat Nqo1 gene coupled with the human placental alkaline phosphatase (hPAP) reporter 77 95 After 12 h, t he mice were euthanized and various tissues harvested. Each tissue was uniformly divided into two parts and analyzed for the increase in the endogenous Nqo1 mRNA levels and the enzymatic activities of the transgene encoded hPAP protein. While changes in hP AP activities were not statistically significant ( P > 0.05, Figure 3 7 C ), significant induction ( P Nqo1 was detected in more than half of the seven tissues tested ( Figure 3 7A B ). Other than expectedly the stomach, the heart tissues showed the highest significant induction (30.3 fold) of Nqo1 mRNA (Figure 3 7A) together with mult iple other ARE Nrf2 regulated antioxidant genes (Figure 3 7B) Significantly elevated levels of Nqo1 were also found in lung (4.8 fold) and the brain (1.3 fold); the

PAGE 55

55 activation in the liver was of borderline significance (9.3 fold, P = 0.06). Even though n ot statistically significant ( P > 0.05) with our sample size, Nqo1 induction in the other tissues (kidney and small intestine) appeared to follow the same trend. Summary Consistent with our hypothesis, extracts of various marine algae were identified to ac tivate the Nrf2 ARE pathway. In particular, we found potent in vitro and in vivo ARE activitor s from the lipophilic silica gel fractions of an edible green alga, Ulva lactuca which had previously been reported to have anti inflammatory 96 antiviral 97 anti peroxidative and anti hyperlipidemic 98 properties. Three active compounds from Ulva lactuca were isolated, including a new monounsaturated keto fatty acid ( 1 C18:1(n 11)), and two structural analogs, a second keto fatty acid ( 2 C16:1(n 9)) and a fatty acid amide ( 3 ). These fatty compounds share a common structural feature, the conjugate unsaturated enone motif, which is capable of alkylating reactive thiol groups in cysteine residues. As mentioned before in the results section, the Michael acceptor motif is a common denominator among many ARE activators 19 56 and must be responsible for the ARE activities by comparison to previously published data for related fatty acids 88 unsaturated enone system, it seems quite puzzling that substantial differences in the biological activities exist among the three compounds. The variation in bioactivities may be attributed to the other functional groups on the molecules First, fatty acid amides are known to have poor aqueous solubility 99 leading to their poor bioavailability, which could potentially explain why fatty acid amide 3 is less potent and efficacious than the two acids. Second, the shortening of the chain by two carbons had two effects on the bioactivity. It shifted the EC 50 from 6.0 g/ mL ( 1 ) to 17.7 g/ mL ( 2 ), and the maximum efficacy from 17.6 fold ( 1 10 g/ mL ) to 30.3 fold ( 2 32

PAGE 56

56 g/ mL ). Both phenomena may again be explained by bioavailability. But thi s time, the possible causes were thought to be the less efficient movement across the phospho lipid bilayer forming the cell membrane by the shorter chain (C16) acid 100 Fatty acid 1 may exert a dual biological mechanism of action that culminated in ARE activation. It transiently lowers the level of the intracellular guard (GSH) via direct chemical reaction to the sulfhydryl group, generating a feedback to activa te the glutathione biosynthetic machinery 90 which is governed by the Nrf2 ARE signaling pathway 101 conjugated enone may directly alkylate reactive cysteine resides on Keap1 102 leading to Nrf2 release and then to ARE activation, which induces a broad spectrum of cytoprotective genes including NQO1, GST, GSH reductase, GSH peroxidase and glucose 6 phosphate dehydrogenase 101 The latter four are known to be key players in glutathione dependent detoxification of harmful agents (GST and GSH reductase) and cellular glutathione recycling (GSH peroxidase and glucose 6 p hosphate dehydrogenase) 90 Expectedly, NRF2 is essential for the cytoprotective gene induction by compound 1 in cultured h uman cells. The mRNA levels of NRF2 remained unchanged, suggesting that the stabilization of transcription factor NRF2 protein and not the upregulation of its own transcription led to the downstream cytoprotective gene induction. Furthermore, fatty acid 1 is probably a monofunctional inducer of phase II enzymes since NRF 2 mRNA levels are induced via the aryl hydrocarbon receptor pathway that controls phase I enzyme induction 103 104 Despite the variable activation of transgene expression in vivo in the reporter mice, the ind uction of the endogenous Nqo1 gene was borderline significant ( P = 0.06)

PAGE 57

57 in the liver, significant ( P < 0.05) in the brain and lung, and most prominent in heart tissues ( P = 0.004). A more than 30 fold increase in Nqo1 mRNA in the heart was found 12 h afte r oral gavaging, suggesting sufficient bioavailability of the active ingredient(s) and great cytoprotective potential. This is also consistent with literature reports that a MUFA containing diet reduces the risk for cardiovascular diseases 105 106 Nevertheless, we cannot rule out the possibility that other factors may have contributed to the induction of the cytoprotective gene expression in vivo For example, based on HPLC a nd NMR analysis, there were many other compounds in the particular fraction that was used, some of them also activate the ARE and/or cooperate with the identified active compounds. Unfortunately, sufficient quantities could not be isolated for further stud ies. Experimental Chemicals and R eagents Unless otherwise indicated, solvents for extraction and chromatography were purchased from Fisher Scientific, and all other chemicals were from Sigma. General I nstrumentation HPLC was carried out on a Shimadzu Pro minence Series. 1 H and 2D NMR data in CDCl 3 were recorded on a Bruker Avance II 600 MHz NMR spectrometer using a 5 mm TXI cryogenic probe. The 13 C NMR data was recorded at 125 MHz on a Bruker 500 MHz NMR spectrometer. All spectra were referenced to residua H C 77.16 ppm). UV absorbance was measured in a sub micro (50 L ) quartz cuvette (Starna cells) using a SpectraMax M5 (Molecular Devices) spectrophotometer. Accurate mass (HRESIMS) data was obtained on an Agilent 6210

PAGE 58

58 T OF LC TOF mass spectrometer equipped with an APCI/ESI multimode ion source detector. Eukaryotic A lgae Library P reparation The algae species were hand collected in the period of 2006 2009 in Florida waters (see Table 3 1). They were immediately frozen on d ry ice, then stored at 20 o C until lyophilized. The dried samples were first extracted with agitation in 200 (w/v) of a non polar solvent mixture (50% EtOAc in MeOH, v/v) twice for tw o consecutive 24 h, then in 200 (w/v) of a polar solvent mixture (50% EtOH in H 2 O, v/v) for another two consecutive 24 h periods. At the end of each extraction, the solvents were removed by a Rotavapor (BCHI Labortechnik AG), and the resulting extracts stored at 4 o C until analyzed. Approximately 20 mg of each non polar ex tract was dissolved in CH 2 Cl 2 loaded onto a silica SPE column (1000 mg/8 mL Alltech Extract Clean TM ), and eluted with increasing percentage of i PrOH (0%, 2%, 5%, 10%, 20%) in CH 2 Cl 2 followed by 100% MeOH. Approximately 20 mg of each polar extract was d issolved in 50% EtOH/H 2 O (v/v), loaded onto a C18 SPE column (1000 mg/8 mL Alltech Extract Clean TM ), and eluted with increasing percentage of MeOH (0%, 20%, 40%, 60%, and 80%) in H 2 O followed by 100% MeOH. All fractions were dried under N 2 gas and stored at 4 o C (< 48 h) until tested. Fractionation and I solation from Ulva L actuca Ulva lactuca was collected from Shark Island (N 27 o 28.024, W 80 o 19.163) near Fort Pierce, FL, on July 25 th 2006 and June 3 rd 2009 by Dr. V. Paul and coworkers The initial ( 2006) non polar extract of Ulva lactuca (4 .1 g) was separated on a silica gel column into seven fractions by eluting with increasing percentage of i PrOH (0%, 2%, 5%, 8%, 10%, and 20%) in CH 2 Cl 2 followed by 100% MeOH. Each fraction was

PAGE 59

59 concentrated to dryn ess and stored at 20 o C. The 8% i PrOH fraction (fraction 4, 81.0 mg) was chromatographed on a semi preparative HPLC column (Phenomenex, Synergi Hydro RP, 250 10 mm, 4 m; flow rate, 2.0 mL /min) by HPLC. The HPLC method consisted of increasing percentag e of CH 3 CN in H 2 O (10% 100% in 0 40 min, 100% in 41 60 min). HPLC fraction 19 ( t R 41.2 min, 1.9 mg) was subjected to analytical HPLC (Restek, Allure C18, 250 4.6 mm, 5 m; flow rate, 1.0 mL /min) using a gradient of increasing percentage of CH 3 CN in H 2 O with 0.1% HCOOH as a modifier (10% 100% in 0 20 min, 100% in 20 25 min) to afford compound 1 ( t R 21.9 min). Compound 2 ( t R 19.7 min) was isolated from an adjacent HPLC fraction (14, t R 37.0 min); compound 3 ( t R 20.4 min) from an adjacent silica gel fr action (fraction 5, HPLC fraction 11, t R 42.8 min). All three compounds were later identified in one or multiple other silica gel fractions (3 6) and isolated using the same procedure. The total amount reported for each compound is the combined weight fro m all isolations and purifications. 7( E ) 9 keto octadec 7 enoic acid ( 1 ): 0.5 mg, colorl ess, amorphous solid; UV max (log ) 210 (2.46); 1 H NMR, 13 C NMR, and 2D NMR data, see Table 3 2 ; HRESIMS m/z 319.2247 for [M+Na] + (calculated for C 18 H 32 O 3 319.2244). 7( E ) 9 keto hexadec 7 enoic acid ( 2 ): 0.2 mg, colorless, amorphous solid; UV (Et max (log ) 212 (2.41); 1 H NMR, 13 C NMR, and 2D NMR data, see Table 3 3 ; HRESIMS m/z 291.1942 for [M+Na] + (calculated for C 16 H 28 O 3 291.1931). 7( E ) 9 keto octadec 7 enamide ( 3 ): 0.1 mg, colorless, amorphous solid; UV max (log ) 209 (2.46); 1 H NMR, 13 C NMR, and 2D NMR data, see Table 3 2 ; HRESIMS m/z 318.2417 for [M + Na] + (calculated for C 18 H 33 NO 2 318.2404).

PAGE 60

60 For the in vivo studies, a compound 1 containing fraction (fraction 3*) from a re collection of Ulva lactuca (2009) was used due to the exhaustion of the originally collected material. The recollected sample was handled in a slightly different fashion in an attempt to concentrate the amount of fatty compounds. After lipophilic extraction as described above, the non polar extract was partit ioned with EtOAc and H 2 O. The EtOAc portion was dried down and separated by silica gel chromatography to yield 6 fractions. Fraction 3* (25% hex in EtOAc, v/v) was found to be the only fraction containing compound 1 by HPLC (see above) trial injections. Th e identity of compound 1 in this fraction was confirmed by HPLC co injection, NMR and mass spectrometry. Cell C ulture IMR Essential Medium (EMEM, ATCC) supplemented with 10% (v/v) feta l bovine serum (FBS, HyClone) and 1% (v/v) antibiotic antimycotic (Invitrogen). The cells were maintained at 37 o C in a humidified 5% carbon dioxide (CO 2 ) atmosphere. ARE luc R eporter Gene A ssay IMR 32 cell s (33 ,000 cells/well) were transiently transfecte d with ARE luc plasmid (100 ng/well) using FuGENE HD (Roche Diagnostics) as a transfection reagent (1:3, w/v). The cells were dispensed into each well of a 96 well plate and incubated for 24 h. They were then treated with solvent control (DMSO or EtOH, 1% v/v) or individual extracts/fractions/compounds for 24 h before ARE activities were detected by using BriteLite detection reagent (PerkinElmer). Relative fold activation for the treated samples over solvent control was reported. The ARE luciferase (ARE l uc) reporter contains the ARE sequence of human NQO1 : CTCAGCCTTCCAAATCGCAGTCACAGTGACTCAGCAGAATC 53

PAGE 61

61 For assays in the presence of an antioxidant, the ce lls were pretreated with excess NAC (1 mM, pH 7.50) for 2 h before they were treated with solvent cont rol or the compounds Immunoblot A nalysis IMR 32 cells (800,000 cells/well) were seeded into each well of 6 well plates. 24 h later, cells were treated wi th solvent control (EtOH, 0.5%, v/v) or fractions/compounds. After another 24 h, whole cell lysates were collected in PhosphoSafe buffer (Novagen) 80 o C until analyzed. For each sample, the protein conce ntration was measured using a BCA assay kit (Pierce). Samples containing equal amount of total protein were separated by SDS PAGE (NuPAGE Novex 4 12% Bis Tris Mini gels, Invitrogen), transferred onto a PVDF membrane, and incubated overnight with the indi cated primary antibodies at 4 o C on an orbital shaker. The membranes were then incubated with the corresponding secondary antibodies (HRP linked) for 1 h at room temperature and detected with Supersignal Femto Western Blotting kit (Pierce). Anti NQO1 (mou se) antibody was from Abcam; anti actin (rabbit), anti mouse HRP, and anti rabbit HRP antibodies were from Cell Signaling Technology. For kinase inhibitor assays, the cells were pre treated with the previously established active concentrations of the cor responding inhibitors, LY294000 (25 M) or PD98059 (50 M) 88 for 30 min before being treated with the solvent control or compounds RNA Extraction, cDNA Synthesis, and Quantitative PCR (qPCR) A nalysis Cultured cells were treated in the same way as described for the immunoblot experiments. After 12 h, total RNA was extracted using a commercial kit (RNeasy Mini

PAGE 62

62 Kit, Qiagen). For mice tissues, total RNA was extracted us ing TRIzol reagent cDNA synthesis and qPCR experiments for both cultured cells and mice tissues were performed following the same procedure. 2 g of each RNA sample was reverse transcribed int o cDNA, which served as a template for TaqMan gene expression assays (Applied Biosystems). For each qPCR run, a total reaction volume of 25 L was prepared consisting of 12.5 L of TaqMan 2 universal master mix, 1.25 L of a 20 TaqMan g ene expression as say probe, 1 L of cDNA and 10.25 L of RNase free sterile water. The reactions were dispensed into 96 well optical reaction plates (Applied Biosystems) and detected in an Applied Biosystems 7300 Real Time PCR System. The thermocycler program consisted of 2 min at 50 C, 10 min at 95 C, and 40 cycles of 95 C for 15 s and 60 C for 1 min. For normalization, GAPDH expression was used as an internal control for human cells (IMR actin for mice tissue samples. RNA I nterference E xperiments IMR 32 cells (600,000 cells/well) were seeded in 6 well plates and incubated at 37 o C for 24 h. The medium was then care fully aspirated and replaced with a transfection mixture containing siRNAs (50 nM) and siLentFect TM lipid transfection reagent (Bio Rad Laboratories) in fresh medium (2 mL /well). 48 h after transfection, the cells were treated with solvent control (EtOH, 0 .5%, v/v) or compound 1 for 24 h. The treated cells were then lysed in PhosphoSafe buffer and whole cell lysates analyzed by immunoblot (see above). The siRNAs, siGENOME Non Targeting siRNA Pools and siGENOME SMARTpool (human NFE2L2), were purchased from D harmacon.

PAGE 63

63 Glutathione A ssays (Sigma). Briefly, IMR 32 cells (800,000 cells/well) were seeded into 6 well plates and incubated at 37 o C. The cells were then treated with solvent contr ol (EtOH, 0.5%, v/v) or compound 1 for the indicated period of time. At the end of each treatment, the cells 200 L of DPBS, and pelleted at 600 g for 10 min at 4 o C. After removal of DPBS, the cell pellet was deproteinized and re suspended in 3 volumes of 5% sulfosalicylic acid solution (v/v). The suspension was frozen (liquid N 2 ) and thawed (37 o C water bath) twice and then incubated at 4 o C for 5 min. The cell debris was s pun down at 10,000 g for 10 min at 4 o C. The supernatant was transferred to fresh tubes and used as glutathione stock. The concentration of the total glutathione (GSH + GSSG) was measured and compared with a standard curve of reduced glutathione (GSH). Mous e S tudies All animal experiments conducted were approved by the Institutional Animal Care & Use Committee at the University of Florida. The transgenic mice (B6C3 ARE Tg) were obtained from Professor J. Johnson 77 bred by the Animal care services at UF and free environment and inspected daily. Three male mice (3 4 months old) were used in each treatment group. Fraction 3* was prepared in a vehicle consisting of 10% DMSO (v/v), 10% Cremophor EL (v/v) in PBS as a 10 mg/ mL suspension. A single dose of 200 L (50 mg/kg) was administered by oral gavaging (Courtesy of Dr Y. Liu) No apparent toxicity was observed for any animal. After 12 h, the mice were euthanized in 100%

PAGE 64

64 CO 2 The tissues were harvested immediately (Courtesy of Dr Y. Liu) frozen on dry ice, and kept at 80 o C until analyzed. hPAP A ssay The frozen tissues were thawed on ice and lysed in TMNC buffer (0.05 M Tris HCl, 0.005 M MgCl 2 0.1 M NaCl, 1% CHAPS (w/v), pH 7.0 ) 107 The homogenized samples were centrifuged at 16,100 g for 2 mi n at 4 o C. The supernatants were transferred to fresh tubes and used as hPAP stock. hPAP activity in each sample was determined by using a commercial kit (Phospha Light TM system). Briefly, the protein concentration in each sample was meas ured using the BCA assay. 100 L of protein (300 g) was diluted with equal volume of 1X assay buffer and incubated at 65 o C for 30 min to inactivate any endogenous alkaline phosphatase activity. The heated samples were then cooled on ice to room tempera ture and dispensed i nto 96 well plates (50 L/well). 50 L of assay buffer (room temperate) was added to each well and incubated for 5 min before addition of reaction buffer (50 L /well, room temperature). The reaction was incubated for another 20 min and det ected for lumines cence (0.25 s /well). The average hPAP activities of a set of mice ( n = 3) that did not carry the transgene was used as an internal control for normalization and subtracted from each value obtained for transgenic mice. T he P values for the in vivo data we re calculated by two tail paired t test comparing to the corresponding controls.

PAGE 65

65 Table 3 1. Marine eukaryotic algae library collection sites and dates. Species Sites Dates Notes Caulerpa cupressoides (Chlorophyta) Marquesas Keys 042407 Caulerpa rac emosa (Chlorophyta) Bush Key, west side 042307 DRTO 0000021 Ulva sp. 1 (Chlorophyta) Marquesas Keys 042407 Halimeda opuntia (Chlorophyta) Marquesas Keys 042407 Halimeda sp. (Chlorophyta) Western Dry Rocks 042107 Ulva lactuca (Chlorophyta) Sout h side of Fort Pierce inlet 072506 Ulva lactuca (Chlorophyta) South side of Fort Pierce inlet 060309 Ulva sp. 2 (Chlorophyta) Bush Key, west side 042307 DRTO 0000016 Ulva sp. 3 (Chlorophyta) Fort Jefferson and Garden Key 042207 DRTO 0000011 Ulva sp 4 (Chlorophyta) Fort Jefferson and Garden Key 042207 DRTO 0000012 Ulva sp. 5 (Chlorophyta) Fort Jefferson and Garden Key 042207 DRTO 0000013 Ulva sp. 6 (Chlorophyta) Fort Jefferson and Garden Key 042207 DRTO 0000015 Ulva sp. 7 (Chlorophyta) Marquesa s Keys 042407 Agardhiella subulata collection 1 (Rhodophyta) Marquesas Keys 042407 Agardhiella subulata collection 2 (Rhodophyta) Marquesas Keys 042407 Laurencia microcladia (Rhodophyta) Fort Jefferson and Garden Key 042207 DRTO 0000008 Laurenci a papillosa (Rhodophyta) Marquesas Keys 042407 Laurencia sp. 1 (Rhodophyta) Marquesas Keys 042407 Laurencia sp. 2 (Rhodophyta) Marquesas Keys 042407 Liagora sp. 1 (Rhodophyta) Fort Jefferson and Garden Key 042207 DRTO 0000006 Liagora sp. 2 (Rho dophyta) Fort Jefferson and Garden Key 042207 DRTO 0000005 Liagora sp. 3 (Rhodophyta) Fort Jefferson and Garden Key 042207 DRTO 0000007 Asparagopsis taxiformis (Rhodophyta) Fort Jefferson and Garden Key 042207 DRTO 0000004 Colpomenia sinuosa ( Ochrophy ta ) Bush Key, west side 042307 DRTO 0000022 Dictyota caribaea ( Ochrophyta ) Fort Jefferson and Garden Key 042207 DRTO 0000014 Dictyota cervicornis ( Ochrophyta ) Western Dry Rocks 042107 Hydroclathrus clathratus ( Ochrophyta ) Bush Key, west side 042307 DRTO 0000017

PAGE 66

6 6 Table 3 1. Continued Padina gymnospora ( Ochrophyta ) Fort Jefferson and Garden Key 042207 DRTO 0000009 Padina sp. ( Ochrophyta ) Bush Key, west side 042307 DRTO 0000018 Rosenvingea intricata ( Ochrophyta ) Fort Jefferson and Garden Key 042207 DRTO 0000010 Stypopodium Zonale ( Ochrophyta ) Western Dry Rocks 042107 South side of Fort Pierce inlet: N 27 o 28.024, W 80 o 19.163; Western Dry Rocks: N 24 o 26.696, W 081 o 55.707; Fort Jefferson and Garden Key: Dry Tortugas National Park; Bush Ke y, west side: N 24 o 37.582, W 082 o 52.099; Marquesas Keys: N 24 o 33.398, W 082 o 06.663

PAGE 67

67 Table 3 2 NMR data for 7( E ) 9 keto octadec 7 enoic acid ( 1 ) and 7( E ) 9 keto octadec 7 enamide ( 3 ) in CDCl 3 a 13 C NMR data was recorded at 125 MHz. b 1 H NMR data was recorded at 600 MHz. c Long range heteronuclear correlations between the indicated carbon and the protons at 600 MH z. d 13 C data was deduced from HMBC and HSQC. C/H No. 7( E ) 9 keto octadec 7 enoic acid 7( E ) 9 keto oct adec 7 enamide C a H ( J, Hz) b HMBC c C d H ( J, Hz) b HMBC c NH 5.39 br s NH 5.24 br s 1 177.20 qC 175.36 qC 2 33.78 CH 2 2.34 t (7.1) 3, 1 35.22 CH 2 2.21 t (6.5) 3, 1 3 24.72 CH 2 1.63 m 1, 2 24.68 CH 2 1.63 m 1, 2 4 31.71 CH 2 1.31 m 3 28.44 CH 2 1.33 m 3 5 27.92 CH 2 1.46 m 4, 6 27.48 CH 2 1.46 m 4, 6 6 32.49 CH 2 2.21 dt (6.9, 7.0) 5, 7, 8 31.92 CH 2 2.19 dt (6.9, 7.3) 5, 7, 8 7 146.46 CH 6.83 dt ( 15.8, 6.9 ) 5, 6, 9 147.58 CH 6.81 dt (15.9, 6.9) 5, 6, 9 8 130.87 CH 6.08 d (15.8) 6, 9 130.26 CH 6.07 d (15.9) 6, 9 9 201.24 qC 200.80 qC 10 40.24 CH 2 2.52 td (7.4, 1.4) 11, 9, 12 39.43 CH 2 2.50 td (7.4, 1.6) 11, 9, 12 11 24.34 CH 2 1.60 m 10, 9, 12 23.56 CH 2 1.60 m 10, 9, 12 12 17 29.1 9 CH 2 1.30 m 28.71 CH 2 1.31 m 18 14.11 CH 3 0.88 m 17 13.50 CH 3 0.88 m 17

PAGE 68

68 Table 3 3. NMR data for 7( E ) 9 keto hexadec 7 enoic acid ( 2 ) in CDCl 3 at 600 MHz. C/H No C a H ( J ) HMBC b 1 176.17 qC 2 32.92 CH 2 2.35 t (7.2) 3, 1 3 24.25 CH 2 1.64 m 1, 2 4 29.28 CH 2 1.30 m 3 5 27.48 CH 2 1.47 m 4, 6 6 32.06 CH 2 2.21 dt (7.0, 7.1) 5, 7, 8 7 146.90 CH 6.82 dt (15.9, 7.0) 5, 6, 9 8 129.96 CH 6.09 d (15.9) 6, 9 9 201.45 qC 10 39.27 CH 2 2.52 t (7.4) 11, 9, 12 11 23.90 CH 2 1.60 m 10, 9, 12 12 15 28.52 CH 2 1.32 m 16 13.62 CH 3 0.89 m 15 a 13 C NMR data was deduced from HMBC and HSQC. b Long range heteronuclear correlations between the indicated carbon and th e protons.

PAGE 69

69 Fig ure 3 1. ARE luciferase activity profiling of the eukaryotic algae collection and distribution of activities in e ach phylum in IMR 32 cells. (A) The algae extracts

PAGE 70

70 were fractionated on small scale (~20 mg) by normal or reversed phase (C1 8) silica gel based SPE columns to generate 372 fractions. The ARE luc activity of each fraction was tested in duplicate at two concentrations, 10 g/ mL and 100 g/ mL Each dot represents the average fold activation of one fraction at one concentration. Th e enlarged dots represent the active fractions from Ulva lactuca (Fort Pierce, FL, 2006). (B) ARE luc activities of the large scale silica gel chromatography fractions from 2006 Ulva lactuca ( n = 2) in IMR 32 cells. The fractions were eluted with CH 2 Cl 2 (f raction 1, 7.2 mg), 2% i PrOH in CH 2 Cl 2 (fraction 2, 6.9 mg), 5% i PrOH in CH 2 Cl 2 (fraction 3, 10 .9 mg), 8% i PrOH in CH 2 Cl 2 (fraction 4, 81 .0 mg), 10% i PrOH in CH 2 Cl 2 (fraction 5, 21 .1 mg), 20% i PrOH in CH 2 Cl 2 (fraction 6, 14 .0 mg), and 100% MeOH (fract ion 7, 1726 .5 mg). Fractions 5 and 6 also show significant ARE activities, but they were not chromatographed initially due to relatively lower amounts. The ARE luc results for the large scale fraction s are shown as fold activation + the standard error of t he mean (SEM). Asterisk (*) designates observed toxicity.

PAGE 71

71 Figure 3 2. Structural information of the three compounds isolated from Ulva lactuca (A) Proposed chemical structures. (B) 1 H NMR characteristic signals for com pound 1 3 in CDCl 3 recorded at 600 MHz.

PAGE 72

72 Figure 3 3. tionship analysis for compound 1 (A) Dose dependent ARE luc activities of the three compounds in IMR 32 cells ( n = 3). 1 The results for the ARE luc assay are shown as fold activation + SEM. Asterisk (*) designates observed toxicity.

PAGE 73

73 Figure 3 4. Compound 1 induces cytoprotective genes in IMR 32 cells. (A) Treatment with compound 1 led to dose dependent increase in NQO1 but not NRF2 mRNA levels after 12 h ( n = 3). (B) At the active concentration (10 g/ mL ), compound 1 luc activity was reduced in the presence of an antioxidant, N acetyl cysteine ( n = 3). After transfection, IMR 32 cells were incubated for 24 h, then pre treated with 1 mM of NAC for 2 h before th ey were exposed to 10 g/ mL of compound 1 (C) Compound 1 induced a net increase in glutathione levels at its active concentration ( n = 3). Following a decrease (~30%) until 8h, GSH levels started to increase and peaked at 16 h, then dropped back but staye d above the basal level up to at least 24 h. The results for the ARE luc assa y are shown as fold activation + SEM; the qPCR and G SH results are fold activation + standard deviation (SD).

PAGE 74

74 Figure 3 5. Compound 1 requires NRF2 and PI3K for the induction of ARE regulated genes in IMR 32 cells. (A) NRF2 is essential for compound 1 induced NQO1 expression. The cells were incubated for 48 h after siRNA transfection, then treated with compound 1 for 24 h before whole cell lysates were collected. (B) PI3K acti vity is required for induction of NQO1 expression by compound 1 50 M of PD098059 ( MEK1 inh ibitor) or 25 M of LY294002 ( PI3K inhibitor) was used to pre treat the cells for 30 min before they were exposed to 10 g/ mL of compound 1 After another 24 h of i ncubation, whole cell lysates were prepared and assessed for NQO1 expression by immunoblot analysis.

PAGE 75

75 Figure 3 6. In vitro antioxidant bioactivity confirmation of a compound 1 containing Ulva lactuca fraction (fraction 3*, see Materials and Methods) i n IMR 32 cells. (A) Fraction 3* increased endogenous NQO1 mRNA levels after 12 h of treatment ( n = 3). (B) Fraction 3* dose dependently induced expression of NQO1 at the protein level after 24 h of treatment. The results for cellular q PCR assays are fold a ctivation + SD

PAGE 76

76 Figure 3 7. Fraction 3* induced endogenous cytoprotective genes in vivo (A) Fraction 3* induced endogenous Nqo1 expression in multiple tissues in mice. (B) Fraction 3* induced other ARE Nrf2 regulated genes in the heart tissues. (C) The effect of fraction 3* on the hPAP activity in tissues derived from Nqo1 hPAP transgenic mice. A strain of transgenic mice (B6C3 ARE Tg) was used in this study. The mice ( n = 3) were fed by oral gavaging and the tissues were collected after 12 h. Each tissue was divided into two identical portions One set of the tissues was analyzed for Nqo1 mRNA levels (for small intestine vehicle mice, n = 2) and the other set was analyzed for hPAP activity. 0.05. **: P = 0.06. No significant hPAP activity ( P > 0.05) was detected in any of the tissues analyzed. Result s are shown as fold activation + SEM. Mice oral gavaging and tissue ha rvesting were performed by Dr. Y Liu. T he P values for the in vivo data were calculated by two tail paired t test comparing to the corresponding controls.

PAGE 77

77 CHAPTER 4 IN VITRO AND IN VIVO CHARACTERIZATION OF A TUNABLE DUAL REACTIVITY PROBE OF THE NRF2 ARE ANTIOXIDANT DEFE NSE PATHWAY Rationale In addition to natural products 108 synthetic libraries have been successfully utilized to yield small molecules that recognize cysteine code s and initiate the Nrf2 ARE regulated cytoprotective gene activation (Figure 4 1A) For example, multiple electrophilic activators of the ARE were identified from a synthetic library of 1.2 million small molecules using an ARE luciferase reporter assay in high throughput screening (HTS) format. The primary hits were then filtered through additional sets of cell culture based bioassays to yield s even prioritized inducers. One particular compound, AI 1 ( A RE I nducer 1 ), was investigated in detail due to its bioactivity in primary cortical culture and low toxicity 39 The aims o f this project were to examine the suitability of any of these compounds as in vivo probes; and to subsequently elucidate the chemical and biological mechanisms of actions of the prioritized activator (s). Identification of a Potent ARE A ctivator, AI 3 Of the seven originally prioritized HTS hits, six were commercially available (Figure 4 1 B ) and validated by using the same ARE luciferase (ARE luc) reporter assay in a dose response manner in IMR 32 cells 39 (Figure 4 1 C ). While, as expected, AI 1 was not toxic up to 32 M, the other molecules showed signs of cytotoxicity when observed under the microscope (almost all cells were rounded up, floating, or lysed) beyond 10 M in the reporte r assay. However, at this concentration (10 M), the ARE Reproduced in part with permission from ACS Chem Bio l under preparation for publication, Unpublished work. Copyright (2012 ) American Chemical Society

PAGE 78

78 luc activity of AI 1 (31.4 fold) was at least 40% lower than most of the others (52.2 to 96.1 fold). To ensure that these activities from the ectopic reporter system translated into endogenous gene activation and that they were not due to oxidative stress, the group of small molecules was tested by Western blot analysis for their ability to induce the ARE driven gene, NQO1, in the presence of a cell permeable antioxidant (NAC) 88 (Figure 4 1 D ). The endogenous gene activation results were consistent with the ARE luc data. All compounds induced NQO1 in a dose dependent manner. At the maximum non toxic concentratio n (10 M), the levels of NQO1 were similar both in the presence and the absence of the NAC, suggesting that the groups of small molecules did not activate the ARE by exerting oxidative stress to the cell at this particular concentration ; and also not nonsp ecifically reacted with NAC or, by extrapolation, with other thiol containing biomolecules including glutathione. We then examined the abilities of these small molecules to induce cytoprotective genes in a whole animal model. Caenorhabditis elegans are tr ansparent and free living nematodes that are about 1 mm in length. The relatively small size and short life span (2 3 weeks) allow the worms to be cultured in microtiter plates and widely used as biosensors in agricultural 109 and pharmaceutical industries 110 111 Similar to vertebrates, they have a cytoprotective pa thway (Figure 4 1 A ) that is also inducible 112 The detoxification of oxidative insults is controlled through a cytoplasmic transcription factor, SKN 1, a homologu e of Nrf2. Under basal conditions, SKN 1 constantly translocates into the nucleus and is ta rgeted for Cul4 dependent protea somal degradation by the repressor, WDR 23, a functional equivalent of Keap1 113 114 When the cell experiences

PAGE 79

79 oxidative stress, SKN 1 bypasses WDR 23 and activates the expression of cytoprotective genes, such as glutathione S transferase 4 ( gst 4 ) 112 By utilizing a reporter strain of C. elelgans the in vivo bioactivities of the compounds were assessed in a dose response manner (Figure 4 1 E ). Surprisingly, given the similar activities in cell cultures, compound 9 stood out to be a rema rkably potent gst 4 activator (22.5 fold) in C. elegans up to 1 mM (the highest non toxic concentration), while dose dependent activation was also detected for other compounds ( 4 6 and AI 1), but to a much lesser extent (2.4 to 5.6 fold). Compound 9 was given the name AI 3 ( A RE I nducer 3 ) since it originated from the same screen as AI 1 The promising in vivo data in C. elegans motivated us to test AI 3 in a higher organism. In V ivo B ioactivity of AI 3 in M ice Metabolic stability is a desired property in discovering potential drug leads 115 Before subjecting AI 3 to a rodent model, we assessed its in vitro stabilities in mouse plasma over a period of 24 h ( Figure 4 2A B), using its bromine analog (AI 3 4, 10 ) as an internal standard (I.S.). AI 3 showed remarkable plasma stability (78%) up until 24 h, suggesting great potential of extended bioavailability (Figure 4 2A) On the o ther hand, when incubated with a normal cell lysate (HEK293), the levels of AI 3 decreased in a time dependent manner, with 12 h being the mid point (50%), indicating that AI 3 can be metabolized by cellular components ( Figure 4 2A ). Having established its metabolic stability profile, AI 3 was administered to 4 week old mice via intraperitoneal single dose injection (50 mg/kg). Upon 12 h treatment, the mRNA levels of the ARE regulated gene Nqo1 were assessed in liver and kidney tissues by quantitative PCR ( qPCR) after reverse transcription (RT) (Figure 4 2 C ).

PAGE 80

80 Elevated Nqo1 transcript levels were detected in both organs with higher induction in the liver (5.5 fold). These initial validation results suggested that AI 3 shows bioactivity in mammalian cell cul tures with in vivo activity in C. elegans and in mice. Therefore, we decided to investigate the chemical and biological modes of actions of AI 3. Chemistry A common structural feature shared by many ARE activators is the electrophilic Michael acceptor moti f. This chemical signal can be recognized by the nucleophilic sulfhydryl groups, i.e., cysteine residues on Keap1, to trigger the activation of downstream pathways 56 AI 3 is comprised of two potential Michael acceptor systems. First, it has a unique, enone motif in that it is an acylated electron deficient heteroaromatic (thiophene) system substituted in position to the carbonyl group with a methyl sulfonyl substituent that could act as a leaving group in a nucleophilic aromatic substitution (addition elimination) reaction. Second, the conjugated methyl sulfonyl group can also act as an acceptor of ele ctrons in a Michael type fashion 116 (Figure 4 3 A ) and in corresponding position there is a second electrophilic, chloro substituted carbon at the C1 position where an addition elimination (nucleophilic aromatic substitution) reaction can occur. We speculated that both substituents may contribute to the reactivity of AI 3 to wards sulfhydryl groups through addition elimination reactions at two sites. To test this hypothesis, an in vitro alkylation experiment was conducted in which AI 3 was incubated with either 2 fold or 50 fold excess of each of two biologically relevant smal l molecule thiols (NAC and glutathione (GSH)) for 2 h at room temperature (r.t.) (Figure 4 3 B ). The reaction products were then analyzed by LC MS. Substitution

PAGE 81

81 products at the methyl sulfonyl and chlorine position were detected for both nucleophiles. Hav ing identified the sulfhydryl sensitive sites on AI 3, we next examined how alterations of the chemical scaffold and electronics of the aromatic ring would affect its bioactivity. Using the ARE luc reporter assay, we tested thirty two synthetic analogs of AI 3 in a dose response manner ( Table 4 1). We found that monosubstitutions at either thiol reactive position led to changes in bioactivity profiles. First, a methyl sulfonyl group or related electron acceptor proved to be critical for AI replaced with a methyl sulfide group (AI 3 1, 10 ) which can neither act as an electron acceptor nor a good leaving group, both potency and efficacy were reduced. AI 3 1 (EC 50 11 .2 M) was 2.5 times less potent than AI 3 (EC 50 4.4 M), and its maximum efficacy dropped to 19% (5.7 fold at 32 M) as compared with the parent compound (30.4 fold at 10 M). Substitution with a methyl sulfoxide group (AI 3 2, 11 ) that is a better leavi ng group as the methyl sulfonyl group yet can act as electron acceptor enhanced the biological profile by shifting the EC 50 from 4.4 M (AI 3) to 1.0 M (AI 3 2 was toxic at 10 M), while sustaining the maximum potency (31.1 fold at 3.2 M vs. 30.4 fold). Secondly, manipulations at the chloro position show ed that this functional group is important but not the primary determinant of bioactivity. The corresponding unsubstituted analog (AI 3 3, 12 ) retained 63% of the efficacy (19.2 fold vs. 30.4 fold, both at 10 M) while the potency increased by 1.5 times (E C 50 : 2.9 M vs. 4.4 M). The analog bearing the less electronegative bromine substituent (AI 3 4, 13 ) had roughly the same ARE luc activity at 10 M while its potency increased by 1.7 times (EC 50 : 2.6 M vs. 4.4 M), indicating that the better leaving grou p potential was able to offset

PAGE 82

82 electronic effects on the ring that would otherwise decrease reactivity. These results indicated that the role of the chlorine may either be to affect the electronics of the thiophene ring therefore the electrophilicity of t he second reactive carbon C3, or to serve as a leaving group to facilitate the nucleophilic attack at C1, suggesting the tunability of the system by modulating these two parameters. Regardless of the leaving group potential of the C1 substituents, the ana logs rendered inactive as long as the methyl sulfide group or equivalent was in C3 position ( 16 19 23 28 30 3 5 ), indicating that electron withdrawing substituents (through conjugation) are needed at C3 in order to increase (th iol)nucleophiles. With a methyl sulfoxide group at C3, the maximum efficacy is modulated depending on the nature of the electron withdrawing group (EWG) at the C1 position ( 20 22 ). And, the carbonyl group at C 4 is essential for bioactivity; a lterations at this site were not tolerated ( 32 ). The observed correlations between the functional groups and the bioactivity confirmed that AI 3 requires a EWG at the position (C3) of the Michael system for its bioactivity. The EWG can either act as a leaving group to undergo a formal Michael type addition elimination reaction at C3 (nucleophilic aromatic substitution), or as an auxiliary group to facilitate a nucleop hilic attack at C1 by increasing its electrophilicity. Other factors, such as the spatial requirements of the compound and noncovalent interactions with the local environment of the target may also play a role in the overall bioactivity. AI 3 Induces C ytop rotective Genes in IMR 32 C ells The ability of AI 3 to induce the ARE regulated cytoprotective gene, NQO1 was tested both at the transcript and protein levels (Figure 4 4 A B ), which appeared to be dose dependent. At 12 h of treatment, NQO1 mRNA levels inc reased starting from 0.03

PAGE 83

83 M (1.8 fold) and reached a plateau at 10 M (27.7 fold). Based on immunoblot analysis, after 24 h of treatment, NQO1 protein levels started to heighten at 0.3 M and also plateaued at 10 M. Furthermore, as shown in Figure 4 1 D at lower concentrations (0.3 M 3.2 M), AI inducing activity was reduced in the presence of NAC, an antioxidant that can also act as a thiol nucleophile (Figure 4 3 B ), thereby leading to reduced bioavailability of AI 3. Nonspecific reactivity w ith thiols would suggest potential for off target toxicity, causing oxidative stress in the cell, which may be balanced out by NAC at lower concentrations, as observed for the oxidative stressor diethyl maleate (DEM) (Figure 4 1 D ) 90 To rule out the latter possibility, the levels of NQO1 were tested in the presence of a secon d antioxidant, catalase 54 (Figure 4 4 B ). AI 3 induced NQO1 to similar levels at all concentrations tested, indicating that the previous observation may be solely due to the thiol reactive nature of the compound. The most abundant free thio l in the cell is the small molecule antioxidant glutathione 117 With in vitro evidence that AI 3 may be GSH reactive (Figure 4 3 B ), the influence of AI 3 on intracellular levels of GSH was examined in IMR 32 cells (Figure 4 4C ). The endogenous glutathione levels were indeed reduced by 30% after 2 h, consistent with the observed sulfhydryl reactivity of AI 3 in vitro (Figure 4 3 B ). Yet, the loss of GSH was compensated for by 8 h and the levels continued to increase until 24 h (160%). One potential explanation is that the temporary partial depletion of GSH by AI 3 may induce a feedback signal to activate the Nrf2 ARE system that controls the GSH synth etic and recycling genes 101 AI 3 Requires the P re sence of NRF2 and PI3K for Its Bioactivities in IMR 32 C ells While certain small molecules induce both Nrf 2 mRNA production through the activation of the upstream aryl hydrocarbon receptor (AhR) xenobiotic response

PAGE 84

84 element (XRE) signaling pathway and Nrf2 regulated gene activation 104 others are mono functional inducers that only modulate phase II enzyme expression 88 T reatment with AI 3 did not have any effect on NRF2 mRNA level s (Figure 4 4A) suggesting that it is a specific inducer of the phase II response. To confirm the involvement of NRF2 in the activation of cytoprotective genes, we employed small interfering RNAs (siRNA) to knock down endogenous NRF2 transcripts, and 48h later, treated with AI 3 for 24 h (Figure 4 5 A ). The expression of NQO1 was undetectable in NRF2 depleted cells, indicating that NRF2 is essential in AI 3 induced NQO1 gene induction. We next examined the effect of AI 3 on the stabilization and nuclear tra nslocation of NRF2 54 over a period of 18 h (Figure 4 5 B ). After 1 h, NRF2 was detectable in the nucleus, and its level remained steadily increased after 3 h. Moreover, the Nrf2 ARE regulated expression of NQO1 was observed starting from 12 h and continued to increase until 18 h, further testifying that Nrf2 nuclear translocation precedes and is needed for ARE regulated gene activation and expression. In addition to Keap1 alkylation initiated Nrf2 activation, phosphorylation of Nrf2 through Keap1. Two particular pathways, phosphoinositide 3 kinase (PI3K) and mitogen activated protein kinase (MAPK) signaling were extensively studied and their involvements in ARE re gulated gene activation appear to be cell type specific. For example, functional phosphoinositide 3 kina se (PI3K) was required for AI 1 or tBHQ induced ARE activation in IMR 32 cells 39 52 whereas mitogen activated protein kinase cells 94 To identify which one of these is needed for AI 32 cells,

PAGE 85

85 specific pharmacological inhibitors of either kinases were used to co treat the cells with AI 3 (Figure 4 5 C ). AI 3 did not induce the expression of NQO1 in the presence of PI3K inhibitor (LY294002), whereas NQO1 levels were unaffected were co treated with MAPK (MEK1) inhibitor (PD98059). This result indicated that PI3K kinase signaling is crucial for the ac tivation of ARE regulated genes by AI 3 in IMR 32 cells. AI 3 Recruits Different Sets of Cysteine Codes to Dictate Its Biological A ctivities At the molecular level, the reactive cysteine residues on Keap1 seem to be recognized by chemical inducers with dis tinct structural features. While long chain fatty acid type of Michael acceptors (e.g., 15d PGJ 2 18 and 9 nitro octadec 9 enoic acid 24 ) were found to have a preference for Cys273 and/or Cys288, enone compounds without a long fatty chain (e.g., tBHQ 18 and AI 1 39 ) tend to favor Cys151. To test if AI biological activities were also Cys151 dependent, we examined its effect on interactions between Keap1 and its molecular partners in the antioxidant defense system. First, we investigated AI for the Cul3 ubiquitin ligase complex. Mammalian expression vectors encoding human Cul3 (hemagglutin(HA) tagg ed, HA Cul3) and either wild type human Keap1 (Chitin binding domain (CBD) tagged, or w ild t ype Keap1) or Keap1 C151S (Cys151 mutated to Ser151, also CBD tagged) 118 were co transfected into HEK293 cells, which had been demonstrated to be suitable for overexpression experiments 39 and have low levels of endogenous Keap1 (Figure 4 6 A C ). The cel ls were treated with serial dilutions of AI 3 for 5 h and Keap1 proteins subsequently purified by pull down with chitin magnetic beads (Figure 4 6 A ). The amounts of w ild t ype Keap1 associated Cul3 significantly reduced in the presence of AI 3; whereas the compound was unable to influence the

PAGE 86

86 levels of Cul3 associated with Keap1 C151S. This data suggested that AI mechanism of action may involve Cys151. Additionally, the association of Keap1 with Nrf2 in the presence of AI 3 was assessed. Plasmids carry ing human Nrf2 (HA tagged, HA Nrf2) 118 and either w ild t ype Keap1 or Keap1 C151S were co transfected into HEK293 cells that were then treated with increasing dose s of AI 3 for 5 h before Keap1 protein was purified (Figure 4 6 B ). Clearly, treatment of cells overexpressing w ild t ype Keap1 with AI 3 did not disrupt Nrf2 Keap1 interactions, but led to the stabilization of Nrf2 starting from 3.2 M. In the mutant (Keap 1 C151S) transfected cells, no significant levels of Nrf2 were found to associate with Keap1 at lower concentrations (3.2 M and 10 M), consistent with the previous observation that Keap1 C151S was a constitutive repressor of Nrf2. Perhaps surprisingly, w e noticed that at higher concentrations (32 M and 100 M), treatment of AI 3 seemed to be able to reverse the repressive effect of Keap1 C151S and stabilize Nrf2, which was in contrast to the previous results that Keap1 Cul3 interactions were still intact at these concentrations (Figure 4 6 A ). To further demonstrate that the AI 3 induced stabilization of Nrf2 was due to the dissociation of Cul3 from Keap1, i.e., due to the inhibition of Keap1 mediated ubiquitination of Nrf2, HEK293 cells were co transfecte d with Neh2 (Gal4 tagged Keap1 binding domain on Nrf2, Gal4 Neh2), ubiquitin (HA tagged, HA Ub) 118 and either wt Keap1 or Keap1 C151S expression vectors. The cell s were treated with the same concentrations of AI 3 for 5 h and Neh2 proteins then purified by immunoprecipitation (Figure 4 6 C ). The results corresponded to the last observation. Starting from 3.2 M, AI 3 inhibited ubiquitination of Neh2 in the presence of wt Keap1. Again, Keap1 C151S

PAGE 87

87 was resistant to the inhibition at lower concentrations of the compound (3.2 M and 10 M and 100 M) when lesser degrees of Neh2 ubiquitination were observed. This result confirmed our suspicion that AI 3 may employ more than one cysteine residue (Cys151) for its biological out come in a dose dependent manner. Obviously, at l ower concentrations, AI 3 was able to stabilize Nrf2 because the compound was able to alkylate the serine residue at the critical Cys 151 position so that Cul3 was dis sociated from Keap1 and no longer capable of targeting Nrf2 for proteasomal degradation. At higher concentrations, AI 3 may cause Nrf2 stabilization through a distinct Cys151 independe nt mechanism by potentially recruiting other cysteines, e.g., Cys273 and Cys288, in the IVR region in Keap1. As mentioned earlier, alkylation of the cysteines in the IVR may lead to the release of the low affinity Nrf2/DLG 25 Thus, Nrf2 may not be correctly positioned for ubiquitination even though the interaction between Cul3 and Keap1 C151S was still intact. AI 3 Protects Mouse M ac rophages Against LPS Induced I nflammation Studies have shown that some Nrf2 ARE inducers also exhibit anti inflammatory properties 119 120 To test if AI 3 could inhibit the inflammatory response, we tested its influence on the levels of a pro inflammatory signaling molecule, nitric oxide (NO), in lipopolysaccharide (LPS) sti mulated RAW264.7 mouse macrophages (Figure 4 7 A ). AI 3 showed inhibition of NO production in a dose dependent manner with an IC 50 of 1.2 M, indicating that the compound may indeed be anti inflammatory. During inflammation, the signaling molecule NO is gen erated by the inducible form of the NO synthase (iNOS). To test if the reduction in NO levels was due to the inhibition of iNOS

PAGE 88

88 activation, LPS stimulated mouse macrophages were treated by serial dilutions of AI 3 for 12 h, then assessed for their endogeno us levels of iNos transcript by qPCR analysis (Figure 4 7 B ). AI 3 consistently inhibited iNos gene transcription with roughly the same IC 50 (1.3 M vs. 1.2 M). To determine if this activity may indeed be ARE related, we measured Nqo1 mRNA levels from the same samples (Figure 4 7 C ). AI 3 upregulated Nqo1 transcript levels in RAW264.7 cells in a dose response manner starting from 0.1 M (1.2 fold), which inversely correlated with iNos mRNA levels, providing circumstantial evidence of the functional dependen ce of AI inflammatory effect on ARE activation. AI 3 dependent iNos inhibition may depend on two Nrf2 ARE regulated molecular events that control the activation of the iNos transcription factor NF the Nrf2 ARE signaling pathway has been proposed to contribute to NF repression 121 by preventing its release from the repressor, I some ARE activators such as sulforaphane 122 Second, the presence of AI 3 potentially guaranteed a cellular environment free of NF B stim uli (mostly reactive oxygen species) 123 as shown by its ability to promote Nrf2 ARE regulated GSH production and detoxification enzyme activation (Figure 4 4 C ). Summary The work presented here detailed the complex chemical and biological mechanisms of actions of AI 3, a potent inducer of the Nrf2 ARE antioxidant defense system in two cultured cell lines and in two whole animal models. AI 3 is chemically tunable at two electrophilic carbons on the thiophene ring to direct the extent of true nucleophilic aromatic substitutions by at least one reactive cysteine residue on Keap1 It is able to overrule the repressor function of a Keap1 mutant in a concentration

PAGE 89

89 depe ndent manner. We discovered that AI 3 also possesses anti inflammatory properties, which may be linked to the activation of Nrf2 ARE signaling as well. Experimental Chemicals and R eagents Unless otherwise indicated, HPLC grade solvents were from Fisher Sci entific and all other chemicals were purchased from. The six small molecule ARE activators and structural analogs of AI 3 were from Maybridge (Thermo Fisher Scientific). Anti NQO1 (mouse) and anti Nrf2 (rabbit) antibodies were from Abcam, anti Oct 1 (C 21) anti Gal4 (DBD), and anti Keap1 (E 20) from Santa Cruz Biotechnology, anti HA (mouse) from Covance, anti actin (rabbit), anti tubulin (rabbit), anti mouse HRP, and anti rabbit HRP from Cell Signaling Technology, and anti goat HRP from Chemicon (Millipore). Protein A/G agarose beads were purchased from Santa Cruz Biotechnology and chitin magnetic beads fro m New England Biolabs. Plasmid C onstructs The ARE luciferase reporter construct (ARE luc) contains the core sequence of human NQO1 ARE 53 The mock plasmid (pc DNA3 mRFP) was purchased from Addgene (plasmid 13032). The following plasmids were reported by Zhang et al. 23 118 The Keap1 CBD plasmid carries the entire open reading frame (ORF) of human Keap1 fused to the chitin binding domain (CBD) of the Bacillus circulans chitinase A1 gene upstream of the Keap1 stop codon. The Keap1 C 151S CBD plasmid had the Cys at 151 position in Keap1 CBD mutated to Ser by oligonucleotide directed mutagenesis. The HA Cul3 plasmid was constructed by fusing an N terminal hemagglutinin (HA) tag with a cDNA sequence coding for amino acids 1 380 of human Cul3 gene. The Gal4 Neh2

PAGE 90

90 expression vector contains the codons for the first 97 amino acids (Neh2 domain) of human Nrf2 fused to the ORF of the Gal4 DNA binding domain. Cell C ultures All cells were purchased from American Type Culture Collection (ATCC) IM R 32 ATCC) supplemented with 10% fetal bovine serum (FBS, HyClone) and 1% antibiotic antimycotic (Invitrogen) at 37 o C with 5% CO 2 HEK293 human embryonic kidney cells and RAW2 64.7 mouse macrophages cells were grown in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen) with 10% FBS and 1% antibiotic antimycotic at 37 o C with 5% CO 2 ARE luc Reporter Gene A ssay Using Fugene HD (Roche Diagnostics) as a transfection reagent, IMR 32 cells (3 3 ,000 cells/well) were transiently transfected with ARE luc plasmid (100 ng/well) and seeded in 96 well plates for 24 h. The cells were then treated with a solvent control (DMSO, 1%, v/v) or serial dilutions of individual compounds for 24 h befo re ARE activities were detected by using BriteLite detection reagent (PerkinElmer). Each condition was tested in triplicates. Immunoblot A nalysis IMR 32 cells (8 00,000 cells/well) were seeded into each well of 6 well plates and incubated for 24 h. The cell s were then treated with a solvent control (DMSO, 0.5%, v/v) or individual compounds. Unless otherwise noted, they were treated for 24 h, lysed in 75 L of PhosphoSafe buffer (Novagen), then stored at 80 o C until analyzed. For each sample, the protein con centration was measured by using a BCA assay kit (Pierce). Samples containing equal amount of total protein were separated by SDS PAGE

PAGE 91

91 (NuPAGE Novex 4 12% Bis Tris Mini gels, Invitrogen), transferred onto a PVDF membrane, and incubated overnight with the indicated primary antibodies at 4 o C. The membranes were then incubated with the corresponding secondary antibodies (HRP linked) for 1 h at room temperature and detected with Supersignal Femto Western Blotting kit (Pierce). For assays in the presence of a n antioxidant ( N acetylcysteine or catalase), the cells were pretreated with the indicated antioxidant (NAC at 1 mM, catalase at 100 U/mL) for 2 h before they were treated with the solvent control or individual compounds. For kinase inhibitor assays, the i ndicated concentrations of the corresponding pharmacological inhibitors were co treated with the individual compounds. Pgst4 ::GFP Reporter Gene A ssay in C. E legans A strain of C. elegans (VP596, dvIs19[pAF15( gst 4::GFP::NLS )];vsIs33[ dop 3::RFP ]) carrying t he reporter transgenes Pgst 4 ::GFP and Pdop 3 ::RFP were used 124 The worms were fed with E. coli strain OP50 on nematode growth medium (NGM) agar plates at 20 o C. Synchronized worms (L4 to young adults, 75 worms/well ) we re dispensed into 96 well plates that contain either NGM buffer alone, or a solvent control (DMSO, 1 2%, v/v) or individual compounds diluted in NGM. The plates were incubated at 20 o C for 24 h. The level of Pgst 4 induction by each treatment was measured in a microplate reader ( BioTek Synergy HT ) and calculated as GFP (485/20ex 528/20em)/ RFP ( 540/25ex 590/35em ). Mice E xperiment The experiments conducted here were under protocol 2001104818, as approved by the Institutional Animal Care & Use Committee at the University of Florida. A group of three wild type male mice (C57BL/6J ) was used for each treatment. The mice were

PAGE 92

92 maintai ned under standard conditions. AI 3 was dissolved in 100% DMSO and administered by int raperitoneal injection (i.p. courtesy of Dr H Mao ). No apparent toxicity was observed for the animals. The mouse were euthanized in 100% CO 2 after indicated periods of time, the tissues were harvested immediately (Courtesy of Dr H. Mao) frozen on dry ice, and kept at 80 o C until analyzed. RNA E xtra c tion, cDNA Synthesis, and Q uantitative PCR (qPCR) The cells were seeded (see immunoblot) and treated for 12 h. Total RNAs from cultured cells was then extracted by using a commercial kit (RNeasy Mini Kit, Qiagen). For mice tissues, TRIzol reagent (Invitro gen) was used to extract total RNAs. The subsequent cDNA synthesis and qPCR procedures for both followed the same procedure 2 g of each total RNAs were reverse transcribed intro cDNAs, which served as a template for TaqMan gene expression assay (Applied Biosystems) detected in an Applied Biosystems 7300 Real Time PCR System. Each qPCR sample was prepared as a 25 L total reaction volume, combining 12.5 L of Taqman 2 universal master above cDNA, free sterile water. The qPCR method was designed as following: 50 C for 2 min, 95 C for 10 min, and 40 cycles of 95 C for 15 s and 60 C for 1 min. GAPDH was used as endogenous control to normalize for IMR 32 cells, an d actin for RAW264.7 cells and mice tissues. RNA Interference A ssay IMR 32 cells (5 00,000 cells/well) were seeded into 6 well plates and incubated at 37 o C for 24 h. The media were then carefully aspirated and replaced with a transfection mixture compose d of siRNAs (50 nM) and siLentFect TM lipid transfection reagent (Bio Rad Laboratories) in fresh medium. After another 48 h of incubation, the cells were

PAGE 93

93 treated with a solvent control (DMSO, 0.5%, v/v) or serial dilutions of AI 3 for 24 h. Whole cell lysat es were prepared in PhosphoSafe and analyzed by immunoblot (see above). The siRNAs, siGENOME Non Targeting siRNA Pools and siGENOME SMARTpool (human NFE2L2), were purchased from Dharmacon. Glutathione A ssays Glutathione assays were performed following the protocol (Sigma). Briefly, IMR 32 cells (8 00,000 cells/well) were seeded into 6 well plates and incubated at 37 o C. The cells were then treated with a solvent control (DMSO, 0.5%, v/v) or AI 3 for the indicated period of time. At th e end of each treatment, harvested in 200 L of DPBS, and pelleted at 600 g for 10 min at 4 o C. The supernatant was removed and the cell pellet was deproteinized and re suspend ed in 3 volumes of 5% sulfosalicylic acid solution (v/v). The cell suspension was frozen (liquid N 2 ) and thawed (37 o C water bath) twice and incubated at 4 o C for 5 min. The cell debris was pelleted at 10,000 g for 10 min at 4 o C. The supernatant was use d as glutathione stock. The concentration of the total cellular glutathione (GSH + GSSG) was measured and compared with a standard curve of reduced glutathione (GSH). Preparation of Cytosolic and Nuclear E xtracts IMR 32 cells (2 ,000,000 cells/dish ) were se eded into 6 cm dishes and treated with a solvent control (DMSO, 0.5%, v/v) or individual compounds for the indicated periods of time. The cytosolic and nuclear extracts of the treated cells were prepared by using a commercial kit, NE PER Nuclear and Cytopl asmic Extraction Reagents (Pierce). Briefly, cells were washed once with DPBS, collected in 1 mL of DPBS in a microcentrifuge tube, and pelleted at 500 g for 30 min at 4 o C The pellet was then re

PAGE 94

94 suspended in ice cold buffer CER I supplemented with 1% c O mplete, EDTA free Protease Inhibitor Cocktail (v/v, Roche Diagnostics) by vigorous vortexing. Following addition of ice cold buffer CER II, the sample were vortexed vigorously for 5 s and incubated on ice for 1 min. The vortexing step was repeated before the sample was pellet down at 16,100 g for 5 min at 4 o C. The supernatant was transferred to a fresh tube and used as cytosolic stock. The remainder insoluble portion was washed and centrifuged twice with ice cold DPBS before being re suspended in ice co ld buffer NER supplemented with 1% c O mplete, EDTA free Protease Inhibitor Cocktail (v/v). The suspension was vortexed vigorously for 15 s and incubated on ice for 10 min. This step was repeated for four times. Afterwards, the sample was centrifuged and the supernatant was used as nuclear extract stocks. Subsequently, the cellular and nuclear extracts were an alyzed by immunoblot Chitin Pull D own HEK293 cells (1 6 00,000 cells/dish) were transiently co transfected with a total amount of 1.8 g/dish of one of the two sets of plasmids using Fugene HD and seeded into 6 cm dishes. For Figure 4 6 A HA Cul3 (0.9 g/dish) and Keap1 CBD (0.9 g/dish) or C151 CBD (0.9 g/dish) were used. For Figure 4 6B HA Nrf2 (1.2 g/dish) and Keap1 CBD (0.6 g/dish) or C151 CBD (0. 6 g/dish) were used. After 43 h of incubation, cells were treated with a solvent control (DMSO, 0.5%, v/v) or series dilutions of individual compounds for 5 h. The whole cell lysates were then prepared in 200 L of PhosphoSafe, the protein concentration m easured by BCA assay. Equal amount of whole cell lysates were incubated with 50 L of chitin magnetic beads for 1 h at 4 o C. The beads were then washed three times with CBD column binding buffer (500 mM NaCl, 20 mM Tris HCl, 1 mM EDTA, 0.1% Tween 20 (v/v) pH 8.0). The CBD

PAGE 95

95 tagged proteins were then eluted with 60 L of 4 NuPAGE LDS sample buffer (Invitrogen) at 95 o C for 10 min and analyzed by immunoblot (see above). In V itro Ubiquitination A ssay HEK293 cells (1, 6 00,000 cells/dish) were transiently co tra nsfected with the Gal4 Neh2 (0.7 g/dish), HA Ub (0.6 g/dish), and Keap1 CBD (0.7 g/dish) or C151 CBD (0.7 g/dish) us ing Fugene HD and seeded into 6 cm dishes. After 43 h of incubation, cells were treated with a solvent control (DMSO, 0.5%, v/v) or seri al dilutions of AI 3 for 5 h. Following treatment, the cells were washed twice in ice cold DPBS and lysed in 2% SDS (v/v) in TBS (10 mM Tris HCl [pH8.0] and 150 mM NaCl). The lysates were boiled at 95 o C for 10 min to inactivate endogenous ubiquitin hydrol ase. This rapid lysing process also disrupted any non covalent interactions including Keap1 Neh2. The boiled samples were then sonicated for 20 s in an ice bath, and diluted with eight volumes of 1% Triton X 100 (v/v) in TBS. The protein of interest was th en purified by immunoprecipitation followed by immunoblot analysis Immunoprecipitation Equal amount of whole cell lysates (measured by BCA assay) were precleared by incubating with 20 L of protein A/G agarose beads (Santa Cruz Biotechnology) for 30 min a t 4 o C. The beads were pelleted at 800 g for 30 s at 4 o C. The supernatants were transferred to fresh tubes and incubated with an anti Gal4 antibody (2 g/sample) for 1 h at 4 o C. Then, 20 L of protein A/G agarose beads were added to each sample which w ere then incubated at 4 o C for overnight. Afterwards, the beads were pelleted at 800 g for 30 s at 4 o C and washed with ice cold 0.5 M LiCl in TBS once. Following two additional washes with ice cold TBS, the immunoprecipitated protein was eluted with 2

PAGE 96

96 electrophoresis sample buffer (Santz Cruz Biotechnology) at 95 o C for 2.5 min, and analyzed by immunoblot (see above). Determination of NO A ccumulation RAW264.7 cells (12,000 cells/well) were seeded in 96 well plates for 24 h. They were then treated with a lipopolysaccharide (LPS) solvent control (H 2 O, 1%, v/v), or stimulated with LPS (500 ng/mL) right after treatment with the solvent control (ethanol, 1%, v/v) or individual compounds. After another 24 h of incubation, the levels of nitrite in the medium we re determined by using Griess Reagent System (Promega) following standard protocol. Briefly, 50 L of medium was careful aspirated and incubated with 50 L of the sulfanilamide solution for 6 min at room temperature in the dark. The reaction mixture was th en incubated with 50 L of NED solution (0.1% N 1 napthylethylenediamine dihydrochloride in water, v/v) for another 6 min in the dark. The amount of the magenta product was determined spectrometrically at 540 nm, and compared with a nitrite standard curve to determine the level of nitrite accumulated in each treatment. Sample Preparation and LC MS Parameters for Stability S tudies Master stock solutions of AI 1 and the internal standard (I.S.) AI 3 4 ( 10 ) were prepared in ethanol as 2 mg/mL solutions. An ali quot of the 2 mg/mL of AI 1 was then diluted to 20 g/ml in methanol, which were used to prepare the testing concentration (2 g/mL) and serial dilutions of the standards (2, 1, 0.5, 0.25, 0.125, 0.0625, 0.0313, 0.0156 g/mL). An aliquot of the 2 mg/ml of AI 3 4 (I.S.) was diluted to 20 g/mL in ethanol, which were then used to prepare a 20 ng/ml working internal standard solution in ethyl acetate (EtOAc). All dilutions were freshly prepared before each reaction. Identification of AI 3 and the I.S. were per formed using a HPLC MS method through a

PAGE 97

97 reversed phase column (Phenomenex, Onyx Monolithic C18 column, 3.0 100 mm ). The LC mobile phase consisted of MilliQ water (solvent A) and methanol (solvent B) with 0.1 % formic acid at 0.5 mL/min. The LC run starte d with increasing percentage of solvent B (80 100%) over 3 min, then kept at 100% solvent B for 2 min. The MS detection was achieved by electrospray ionization in positive mode with multiple reaction monitoring (MRM) scan. The MRM pairs monitored for AI 3 and I.S. were 293 196 and 339 The MS ionization parameters were: curtain gas 40.0, ion spray voltage 5,500, temperature 700 o C, ion source gas 1 40.0, ion source gas 2 30.0. Compound dependent MS parameters were: AI 3, declustering potential ( DP) 46.0 entrance potential (EP) 9.0, collision energy (CE) 31.0, collision cell entrance potential (CEP) 14.0, and collision cell exit potential (CXP) 6.0; I.S., DP 71.0, EP 8.5, CE 35.0, CEP 16.0, and CXP 6.0. Data analysis was performed in quantitate mode usin g Analyst 1.4.2 (Applied Biosystems). The concentrations of AI 3 in the testing samples in the plasma and whole cell lysates were determined by comparing to a standard curve of AI 3 that were generated by least square linear regression analysis of the anal yte peak area/I.S. peak area (Y axis) against nominal concentration of the standard solutions (X axis). All samples were analyzed sequentially in the same day and all data points were normalized to the I.S.. Plasma Stability S tudies 10 L of AI 3 (2 g/mL) was added to 100 L of mouse serum, vortexed vigorously for 15 s, then incubated at 37 o C for the indicated periods of time. At the end of each incubation, 400 L of EtOAc was added to each sample to quench the reaction, followed by addition of 200 L of I.S. (20 ng/mL). To ensure complete extraction of AI 3, the samples were transferred to an orbital shaker (700 rpm) and kept at 23 o C for 5 min,

PAGE 98

98 followed by centrifugation ( 16,100 g ) at 4 o C for 10 min. 450 L of the top organic layer (containing AI 3) w as transferred to glass vials and immediately dried under N 2 The dried samples were reconstituted in 45 L of methanol and 10 L of which were analyzed by HPLC MS (see above). Cellular S tability S tudies HEK293 cells were grown in normal conditions, lysed in PhosphoSafe, and determined for their protein concentration as described under Immunoblot section. The cell lysates were then diluted to 1 mg/mL with 25 mM Tris HCl buffer (pH 8.0). 100 L of the diluted HEK293 cell lysates (1 mg/mL) was incubated with 10 L of AI 3 (2 g/mL) for the indicated time points, then handled and analyzed in the same manner as described for plasma stability studies. In vitro Reactions with Small M olecule Thiols and LC MS A nalysis The small molecule thiols were dissolved in ster ile MilliQ water and incubated with 2 fold or 50 fold excess of AI 3 (DMSO) for 2 h at room temperature. The reactions were then dried down immediately under N 2 and reconstituted in 50% MeOH (v/v). 10 L of each sample was analyzed by LC MS in the positive mode. The LC MS module was a Shimadzu UFLC System coupled to a 3200 QTRAP (Applied Biosystems). The samples were automatically injected onto an analytical HPLC column (Restek, Allure PFP Propyl, 250 4.6 mm, 5 m) and separated in a gradient run, and ionized by turbo spray. The LC mobile phases consisted of MilliQ water (solvent A) and acetonitrile (solvent B). The gradient method started with increasing percentage of solvent B (10 100%) over 20 min, followed by 100% of solvent B for 5 min. The flow rate was 1 mL/min. The MS ionization parameters were: curtain gas 40.0, ion spray voltage 4,500,

PAGE 99

99 temperature 700 o C, ion source gas 1 40.0, ion source gas 2 50.0, DP 65.0, and EP 10.0.

PAGE 100

100 Table 4 1. The bioactivities ( ARE luc) of the structural analogs of AI 3. AI 3 SAR of methyl sulfonyl group position methyl sulfonyl group is critical

PAGE 101

101 Table 4 1. Continued SAR of halide position substitutio n of the chloro group is tolerable

PAGE 102

102 Table 4 1. Continued SAR of (6,6 dimethyl) group position substitution of the two methyl groups reduces activity

PAGE 103

103 Tabl e 4 1. Continued SAR of two positions (methyl sulfonyl and halide) sulfone to sulfoxides increases the activity, sulfides are inactive

PAGE 104

104 Table 4 1. Continued SAR of two positions (chlorine and carbonyl) carbonyl group is important for activity

PAGE 105

105 Table 4 1. Continued SAR of two positions (dimethyl and halide) substitution of the chloro group is tolerable

PAGE 106

106 Table 4 1. Continued SAR of two positions ( dimethyl and methyl sulfonyl) sulfone to sulfoxides increases the activity, sulfides are inactive

PAGE 107

107 Table 4 1. Continued SAR of three positions carbonyl group and sulfonyl group are both important for activity

PAGE 108

108

PAGE 109

109 Figure 4 1. Comparison of the bioactivities of six commercially available Nrf2 ARE inducers in vitro and in vivo (A ) The working models of the antioxidant defense pathways in mammals and Caenorhabditis elegans ( C. elegans SBE, SKN 1 binding element 125 ). S/A: stressors or activators. (B ) Chemical structures of the six inducers previously reported 39 (C ) Dose dependent activation of an ARE luciferase (ARE luc) reporter in IMR 32 cells ( n = 3) with 24 h of treatment. (D ) 24 h after treatment, all compounds dose dependently induced the expression of NQO1 in IMR 32 cells. At the highest active and non toxic concentration (10 M), the levels of induction was not reduced in the presence of an antioxidant, N acetylcysteine (NAC, 1 mM), by the treatment with the same compound. ( E ) 24 h after treatment, AI 3 ( 9 ) a ctivated a Pgst 4 reporter transgene to much greater extent than the other five compounds in C. elegans ( n = 3). Results from ( C ) and ( E ) are shown as fold activation + the standard error of the mean (SEM). Asterisk (*) designates observed toxicity. Figure 4 1E was performed in part by Dr KP Choe.

PAGE 110

110 Figure 4 2. Stability and r odent in vivo activity of AI 3. (A) Plasma and cellular stabilities of AI 3 ( n = 2). (B) A representative LC MS (MRM scan) profile of AI 3 (MRM 293 196) and the I.S. AI 3 4 (MR M 339 242). m/z : the parent ion [M+H] + daughter ion [M+H SO 2 CH 3 H 2 O] + for both AI 3 and the I.S.. (C) AI 3 significantly upregulated the levels of Nrf2 mRNAs in liver and kidney tissues in mice ( n = 3) after 12 h of a single dose i.p. treatment. Result s for (A) and (C) are shown as fold activation + SEM. Mice i.p. injection and tissue harvesting were performed by Dr H. Mao.

PAGE 111

111 Figure 4 3. The structure activity relationships (SAR) of AI 3. (A ) Summary of SAR analysis. ( B ) Both methyl sulfonyl and the chloro bearing carbons are reactive towards thiols in vitro

PAGE 112

112 Figure 4 4. AI 3 induces cytoprotective gene expression in IMR 32 cells (A ) 12 h after treatment, AI 3 induces the NQO1 at the transcript levels ( n = 2). (B ) 24 h after treatment, AI 3 in duced NQO1 protein expression starting from 0.3 M. The presence of an antioxidant (catalase, 50 g/ mL ) did not have a significant effect on AI (C ) Following a transient reduction in cellular glutathio ne (GSH), AI 3 induced GSH synthesis starting from 4 h up to 24 h ( n = 3). Results from ( A) and (C ) are shown as fold activation + SEM. Asterisk (*) designates observed toxicity.

PAGE 113

113 Figure 4 5. Cytoprotective gene activation by AI 3 is dependent on Nrf2 and PI3K signaling pathways in IMR 32 cells. (A ) 24 h of treatment with AI 3 was unable to induce NQO1 expression when endogenous NRF2 is knocked down by small interfering RNAs (si NRF2 ) (B ) AI 3 promotes the stabilization and/or nuclear translocation of NRF2 starting from 1 h (C ) Co treatment with LY294002 (25 M, PI3K inhibitor), but not PD98059 (50 M, MEK1 inhibitor), prevented AI 3 induced NQO1 expression after 24 h of treatment.

PAGE 114

114 Figure 4 6. AI 3 requires primarily one cysteine code (Cys151) t interactions with its molecular partners. (A ) 5 h of treatment with AI 3 disrupted the interactions between wt Keap1, but not Keap1 C151S, and Cul3. (B ) 5 h of treatment with AI 3 induces the stabilization of Nrf2 in the presence of its repressor, wt Keap1. AI 3 can reverse the repression effect of Keap1 C151S starting from 32 M. ( C ) wt Keap1 facilitated Neh2 (the Keap1 binding domain of Nrf2) ubiquitination was inhibited by AI 3 after 5 h of treatment. Keap1 C151S targeted Neh2 degrada tion was also inhibited by AI 3 at higher doses (32 M and 100 M).

PAGE 115

115 Figure 4 7. AI 3 protects against LPS induced inflammation in mouse macrophages (RAW264.7 cells) (A ) AI 3 reduces the production of nitric oxide (NO), a signaling molecule during i nflammation, in a dose dependent manner ( n = 4) after 24 h of treatment. ( B ) 12 h of treatment with AI 3 inhibited the activation of inducible NO synthase (iNOS) at the transcript level starting from 0.3 M ( n = 2) (C ) 12 h of treatment with AI 3 induces Nqo1 mRNA production in a dose dependent manner ( n = 2). Results are shown as fold activation + SEM.

PAGE 116

116 CHAPTER 5 CONCLUSIONS Our goal s in this w ork were to discover potent Nrf2 ARE activators from both n atural and synthetic sources and to subsequently c haracterize their ch emical and biological mechanism of actions. A synthetic library of nineteen linoleic acid related unsaturated fatty acids was compiled to explore a link between the previously observed cytoprotective effects of linoleic acid 30 51 and the activation of the Nrf2 ARE antioxidant defense pathway. We identified an epoxy keto deri vative of linol eic acid that strongly activates the antioxidant response element (ARE) in IMR 32 neuroblastoma cells a nd cerebro cortical neurons. This active compound, EKODE induces the expression of ARE regulated cytoprotective genes such as NQO1 at the transcript and protein levels. EKODE requires transcription factor NRF2 an d PI3K for ARE activity. Moreover, treatment with EKODE only led to NRF2 activation, but not the increase in production of NRF2 mRNA. The results suggest that specific oxidation products of linole ic acid may initiate responses that lessen damage caused by oxidative stress. N ature has produce d novel compounds with Nrf2 ARE activating potential 27 30 33 In the pursuit of other natural chemopreventive agents, we built, fractionated, and screened a library of thirty field collected eukaryotic algae from F lorida. An edible green alga, Ulva lactuca yielded multiple active fractions by ARE luciferase reporter assay. T hree MUFA derivatives were isolated as active components, including a new keto type C18 fatty acid ( 1 ), the corresponding shorter chain C16 aci d ( 2 ), and an amide derivative of the C18 acid ( 3 ). Their chemical structures were elucidated by NMR and mass spectrometry. Similar to EKODE, a ll three contain the conjugated enone motif

PAGE 117

117 between C7 C9, which is thought to be responsible for the ARE activit y. Subsequent biological studies focused on compound 1 the most active and abundant ARE activator isolated. Its biological activity profiles also resemble that of EKODE in that the C18 fatty acid ( 1 ) induced the expression of NQO1 in IMR 32 cells; it s cel lular activity requires the pres ence of NRF2 and PI3K function; t reatment with 1 did not results in change in NRF2 mRNA levels. When a single dose of an U. lactuca extract that was enriched with fatty acid 1 was given orally to mice, significant increases in Nqo1 transcript levels were observed in heart, brain, lung, and stomach tissues Taken together this study provide d a new insight as to why consumption of dietary seaweed may have health benefits, and the identified compounds add to the list of chemopr eventive dietary unsaturated fatty acids. In a third attempt to explore more potent and bioavailable activators, we validated and prioritized a collection of six commercially available ARE activators previously discovered from a high throughput screening c ampaign by testing them in cell culture a nd a reporter strain of a whole animal model, Caenorhabditis elegans These studies allowed us to identify AI 3 as an ARE activator that induces cytoprotective genes in human cells and in worms, which also translate d into in vivo activity in mice. AI 3 is an electrophilic ARE activator with two thiol sensitive sites towards nucleophilic addition elimination reaction, and SAR studies indicate d the tunability of the system. Biochemical studies suggested that AI activity is mediated by alkylation of Cys151 on Keap1. This was confirmed by t andem LC MS analysis that low concentrations of AI 3 alkylate primarily at Cys151 (data not shown) The immediate effects of such alkylation were elucidated to be the disruption of Keap1 Cul3 (low [AI 3]) and/or Keap1 Nrf2 (high

PAGE 118

118 [AI 3]) interactions that both led to the stabilization of Nrf2. This further translated into the downstream Nrf2 ARE regulated cytoprotective gene activation and inflammatory gene repression. Our data si gnifies that AI 3 may be become a tunable biological tool owing to its dual reactivity towards thiol nucleophiles and with proper chemical tuning, it may even provide therapeutic benefits in cancer chemoprevention. Collectively, o ur hyp otheses were succes sfully proven in that linoleic acid owes its cytoprotective effect to activating the Nrf2 ARE signaling antioxidant defense pathway, not by itself, but by one of its endogenous oxidized metabolites EKODE ; other than the land, the sea also produces potent Nrf2 ARE inducers that are active both in vitro and in vivo ; moreover, some reported ARE activators discovered in cell culture based assays may also be active in whole animal models. All compounds discovered and characterized here may have the potential to be utilized as tool compounds or even therapeutic agents with medicinal chemistry manipulations

PAGE 119

119 APPENDIX NMR SPECTRA Figure A 1. 1 H NMR spectrum of 7( E ) 9 keto octadec 7 enoic acid ( 1 ) in CDCl 3 (600 MHz).

PAGE 120

120 Figure A 2. 13 C NMR spectrum of 7( E ) 9 keto octadec 7 enoic acid ( 1 ) in CDCl 3 (125 MHz).

PAGE 121

121 Figure A 3. HSQC spectrum of 7( E ) 9 keto octadec 7 enoic acid ( 1 ) in CDCl 3 (600 MHz).

PAGE 122

122 Figure A 4. COSY spectrum of 7( E ) 9 keto octadec 7 enoic acid ( 1 ) in CDCl 3 (600 MHz).

PAGE 123

123 Figure A 5. TOCSY spectrum of 7( E ) 9 keto octadec 7 enoic acid ( 1 ) in CDCl 3 (600 MHz).

PAGE 124

124 Figure A 6. HMBC spectrum of 7( E ) 9 keto octadec 7 enoic acid ( 1 ) in CDCl 3 (600 MHz).

PAGE 125

125 Figure A 7. 1 H NMR spectrum of 7( E ) 9 keto hexadec 7 enoic acid ( 2 ) in CDCl 3 (600 MHz).

PAGE 126

126 Figure A 8. HSQC spectrum of 7( E ) 9 keto hexadec 7 enoic acid ( 2 ) in CDCl 3 (600 MHz).

PAGE 127

127 Figure A 9. COSY spectrum of 7( E ) 9 keto hexadec 7 enoic acid ( 2 ) in CDCl 3 (600 MHz).

PAGE 128

128 Figure A 10. TOCSY spectrum of 7( E ) 9 keto hexadec 7 enoic acid ( 2 ) in CDCl 3 (600 MHz).

PAGE 129

129 Figure A 11. HMBC spectrum of 7( E ) 9 keto hexadec 7 enoic acid ( 2 ) in CDCl 3 (600 MHz).

PAGE 130

130 Figur e A 12. 1 H NMR spectrum of 7( E ) 9 keto octadec 7 enamide ( 3 ) in CDCl 3 (600 MHz). H H 3.72.

PAGE 131

131 Figure A 13. HSQC spectrum of 7( E ) 9 keto octadec 7 enamide ( 3 ) in CDCl 3 (600 MHz). S C H C H 3.72.

PAGE 132

132 Figure A 14. COSY spectrum of 7( E ) 9 keto octadec 7 enamide ( 3 ) in CDCl 3 (600 MHz). H H 3.72.

PAGE 133

133 Figure A 15. TOCSY spectrum of 7( E ) 9 keto octadec 7 enamide ( 3 ) in CDCl 3 (600 MHz). H H 3.72.

PAGE 134

134 Figure A 16. HMBC spectrum of 7( E ) 9 keto octadec 7 enamide ( 3 ) in CDCl 3 (600 MHz). C H H 3.72.

PAGE 135

135 LIST OF REFERENCES (1) Rushmore, T. H., and Pickett, C. B. (1990) Transcriptional regulation of the rat glutathione S transferase Ya subunit gene. Characterization of a xenobiotic responsive element controlling inducible expression by phenolic antioxidants. J Biol Chem 265 14648 53. (2) Itoh, K., Chiba, T., Takahashi, S., Ishii, T., Igarashi, K., Katoh, Y., Oyake, T., Hayashi, N., Satoh, K., Hatayama, I., Yamamoto, M., a nd Nabeshima, Y. (1997) An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun 236 313 22. (3) Moi, P., Chan, K., Asunis, I., Cao, A., and Kan, Y. W. (199 4) Isolation of NF E2 related factor 2 (Nrf2), a NF E2 like basic leucine zipper transcriptional activator that binds to the tandem NF E2/AP1 repeat of the beta globin locus control region. Proc Natl Acad Sci U S A 91 9926 30. (4) Itoh, K., Wakabayashi, N ., Katoh, Y., Ishii, T., Igarashi, K., Engel, J. D., and Yamamoto, M. (1999) Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino terminal Neh2 domain. Genes & Development 13 76 86. (5) Jung, K. A., an d Kwak, M. K. (2010) The Nrf2 system as a potential target for the development of indirect antioxidants. Molecules 15 7266 91. (6) Jeong, W. S., Jun, M., and Kong, A. N. (2006) Nrf2: a potential molecular target for cancer chemoprevention by natural compo unds. Antioxid Redox Signal 8 99 106. (7) Kwak, M. K., and Kensler, T. W. (2010) Targeting NRF2 signaling for cancer chemoprevention. Toxicol Appl Pharmacol 244 66 76. (8) Copple, I. M., Goldring, C. E., Kitteringham, N. R., and Park, B. K. (2010) The ke ap1 nrf2 cellular defense pathway: mechanisms of regulation and role in protection against drug induced toxicity. Handb Exp Pharmacol 233 66. (9) Joshi, G., and Johnson, J. A. (2012) The Nrf2 ARE Pathway: A Valuable Therapeutic Target for the Treatment of Neurodegenerative Diseases. Recent Pat CNS Drug Discov (10) Li, J., Ichikawa, T., Janicki, J. S., and Cui, T. (2009) Targeting the Nrf2 pathway against cardiovascular disease. Expert Opin Ther Targets 13 785 94. (11) Halliwell, B. (2007) Biochemistry of oxidative stress. Biochem Soc Trans 35 1147 50.

PAGE 136

136 (12) Galli, F., Piroddi, M., Annetti, C., Aisa, C., Floridi, E., and Floridi, A. (2005) Oxidative stress and reactive oxygen species. Contrib Nephrol 149 240 60. (13) Reuter, S., Gupta, S. C., Chaturvedi, M. M., and Aggarwal, B. B. (2010) Oxidative stress, inflammation, and cancer: how are they linked? Free Radic Biol Med 49 1603 16. (14) Khansari, N., Shakiba, Y., and Mahmoudi, M. (2009) Chronic inflammation and oxidative stress as a major cause of age re lated diseases and cancer. Recent Pat Inflamm Allergy Drug Discov 3 73 80. (15) Dinkova Kostova, A. T., Holtzclaw, W. D., and Kensler, T. W. (2005) The role of Keap1 in cellular protective responses. Chem Res Toxicol 18 1779 91. (16) Zhang, D. D. (2006) Mechanistic studies of the Nrf2 Keap1 signaling pathway. Drug Metab Rev 38 769 89. (17) McMahon, M., Thomas, N., Itoh, K., Yamamoto, M., and Hayes, J. D. (2006) Dimerization of substrate adaptors can facilitate cullin mediated ubiquitylation of proteins b y a "tethering" mechanism: a two site interaction model for the Nrf2 Keap1 complex. J Biol Chem 281 24756 68. (18) Kobayashi, M., Li, L., Iwamoto, N., Nakajima Takagi, Y., Kaneko, H., Nakayama, Y., Eguchi, M., Wada, Y., Kumagai, Y., and Yamamoto, M. (2009 ) The antioxidant defense system Keap1 Nrf2 comprises a multiple sensing mechanism for responding to a wide range of chemical compounds. Mol Cell Biol 29 493 502. (19) Dinkova Kostova, A. T., Massiah, M. A., Bozak, R. E., Hicks, R. J., and Talalay, P. (20 01) Potency of Michael reaction acceptors as inducers of enzymes that protect against carcinogenesis depends on their reactivity with sulfhydryl groups. Proc Natl Acad Sci U S A 98 3404 9. (20) Yamamoto, T., Suzuki, T., Kobayashi, A., Wakabayashi, J., Mah er, J., Motohashi, H., and Yamamoto, M. (2008) Physiological significance of reactive cysteine residues of Keap1 in determining Nrf2 activity. Mol Cell Biol 28 2758 70. (21) Rachakonda, G., Xiong, Y., Sekhar, K. R., Stamer, S. L., Liebler, D. C., and Free man, M. L. (2008) Covalent modification at Cys151 dissociates the electrophile sensor Keap1 from the ubiquitin ligase CUL3. Chem Res Toxicol 21 705 10. (22) Eggler, A. L., Small, E., Hannink, M., and Mesecar, A. D. (2009) Cul3 mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1. Biochem J 422 171 80.

PAGE 137

137 (23) Zhang, D. D., and Hannink, M. (2003) Distinct cysteine residues in Keap1 are required for Keap1 dependent ubi quitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol Cell Biol 23 8137 51. (24) Kansanen, E., Bonacci, G., Schopfer, F. J., Kuosmanen, S. M., Tong, K. I., Leinonen, H., Woodcock, S. R., Yamamoto, M., Carlbe rg, C., Yla Herttuala, S., Freeman, B. A., and Levonen, A. L. (2011) Electrophilic nitro fatty acids activate NRF2 by a KEAP1 cysteine 151 independent mechanism. J Biol Chem 286 14019 27. (25) Taguchi, K., Motohashi, H., and Yamamoto, M. (2011) Molecular mechanisms of the Keap1 Nrf2 pathway in stress response and cancer evolution. Genes Cells 16 123 40. (26) Kobayashi, A., Kang, M. I., Watai, Y., Tong, K. I., Shibata, T., Uchida, K., and Yamamoto, M. (2006) Oxidative and electrophilic stresses activate Nr f2 through inhibition of ubiquitination activity of Keap1. Mol Cell Biol 26 221 9. (27) Balogun, E., Hoque, M., Gong, P., Killeen, E., Green, C. J., Foresti, R., Alam, J., and Motterlini, R. (2003) Curcumin activates the haem oxygenase 1 gene via regulati on of Nrf2 and the antioxidant responsive element. Biochem J 371 887 95. (28) Hatcher, H., Planalp, R., Cho, J., Torti, F. M., and Torti, S. V. (2008) Curcumin: from ancient medicine to current clinical trials. Cell Mol Life Sci 65 1631 52. (29) Langcake P., and Pryce, R. J. (1976) Production of Resveratrol by Vitis Vinifera and Other Members of Vitaceae as a Response to Infection or Injury. Physiological Plant Pathology 9 77 86. (30) Rubiolo, J. A., Mithieux, G., and Vega, F. V. (2008) Resveratrol prot ects primary rat hepatocytes against oxidative stress damage: activation of the Nrf2 transcription factor and augmented activities of antioxidant enzymes. Eur J Pharmacol 591 66 72. (31) Levi, F., Pasche, C., Lucchini, F., Ghidoni, R., Ferraroni, M., and La Vecchia, C. (2005) Resveratrol and breast cancer risk. Eur J Cancer Prev 14 139 42. (32) Zhu, W., Qin, W., Zhang, K., Rottinghaus, G. E., Chen, Y. C., Kliethermes, B., and Sauter, E. R. (2012) Trans resveratrol alters mammary promoter hypermethylation in women at increased risk for breast cancer. Nutr Cancer 64 393 400. (33) Kensler, T. W., Egner, P. A., Agyeman, A. S., Visvanathan, K., Groopman, J. D., Chen, J. G., Chen, T. Y., Fahey, J. W., and Talalay, P. (2012) Keap1 Nrf2 Signaling: A Target for Ca ncer Prevention by Sulforaphane. Top Curr Chem

PAGE 138

138 (34) Kensler, T. W., Chen, J. G., Egner, P. A., Fahey, J. W., Jacobson, L. P., Stephenson, K. K., Ye, L., Coady, J. L., Wang, J. B., Wu, Y., Sun, Y., Zhang, Q. N., Zhang, B. C., Zhu, Y. R., Qian, G. S., Carme lla, S. G., Hecht, S. S., Benning, L., Gange, S. J., Groopman, J. D., and Talalay, P. (2005) Effects of glucosinolate rich broccoli sprouts on urinary levels of aflatoxin DNA adducts and phenanthrene tetraols in a randomized clinical trial in He Zuo townsh ip, Qidong, People's Republic of China. Cancer Epidemiol Biomarkers Prev 14 2605 13. (35) Farnham, M. W., Stephenson, K. K., and Fahey, J. W. (2005) Glucoraphanin level in broccoli seed is largely determined by genotype. Hortscience 40 50 53. (36) Zhang, Y., Talalay, P., Cho, C. G., and Posner, G. H. (1992) A major inducer of anticarcinogenic protective enzymes from broccoli: isolation and elucidation of structure. Proc Natl Acad Sci U S A 89 2399 403. (37) Prawan, A., Keum, Y. S., Khor, T. O., Yu, S., N air, S., Li, W., Hu, L., and Kong, A. N. (2008) Structural influence of isothiocyanates on the antioxidant response element (ARE) mediated heme oxygenase 1 (HO 1) expression. Pharm Res 25 836 44. (38) Keum, Y. S., Chang, P. P., Kwon, K. H., Yuan, X., Li, W., Hu, L., and Kong, A. N. (2008) 3 Morpholinopropyl isothiocyanate is a novel synthetic isothiocyanate that strongly induces the antioxidant response element dependent Nrf2 mediated detoxifying/antioxidant enzymes in vitro and in vivo. Carcinogenesis 29 594 9. (39) Hur, W., Sun, Z., Jiang, T., Mason, D. E., Peters, E. C., Zhang, D. D., Luesch, H., Schultz, P. G., and Gray, N. S. (2010) A small molecule inducer of the antioxidant response element. Chem Biol 17 537 47. (40) Zhu, M., Baek, H., Liu, R., Son g, A., Lam, K., and Lau, D. (2009) LAS0811: from combinatorial chemistry to activation of antioxidant response element. J Biomed Biotechnol 2009 420194. (41) Kim, T. H., Venugopal, S. K., Zhu, M., Wang, S. S., Lau, D., Lam, K. S., Clemens, D. L., and Zern M. A. (2009) A novel small molecule, LAS 0811, inhibits alcohol induced apoptosis in VL 17A cells. Biochem Biophys Res Commun 379 876 81. (42) Horrobin, D. F., Omega 6 essential fatty acids : pathophysiology and roles in clinical medicine Wiley Liss: N ew York, NY, 1990; p xvi, 595 p. (43) Hennig, B., Meerarani, P., Ramadass, P., Watkins, B. A., and Toborek, M. (2000) Fatty acid mediated activation of vascular endothelial cells. Metabolism 49 1006 13. (44) Fagot Campagna, A., Balkau, B., Simon, D., Warn et, J. M., Claude, J. R., Ducimetire, P., and Eschwge, E. (1998) High free fatty acid concentration: an independent risk factor for hypertension in the Paris Prospective Study. Int J Epidemiol 27 808 13.

PAGE 139

139 (45) Turpeinen, A. M., Basu, S., and Mutanen, M. (1999) A high linoleic acid diet increases oxidative stress in vivo and affects nitric oxide metabolism in humans. Lipids 34 Suppl S291 2. (46) Greene, J. F., and Hammock, B. D. (1999) Toxicity of linoleic acid metabolites. Adv Exp Med Biol 469 471 7. (4 7) Buchanan, M. R. (2000) Linoleic acid metabolites in health and disease. Adv Exp Med Biol 469 463 9. (48) Goodfriend, T. L., Ball, D. L., Raff, H., Bruder, E. D., Gardner, H. W., and Spiteller, G. (2002) Oxidized products of linoleic acid stimulate adre nal steroidogenesis. Endocr Res 28 325 30. (49) Saraswathi, V., Wu, G., Toborek, M., and Hennig, B. (2004) Linoleic acid induced endothelial activation: role of calcium and peroxynitrite signaling. J Lipid Res 45 794 804. (50) Beeharry, N., Lowe, J. E., Hernandez, A. R., Chambers, J. A., Fucassi, F., Cragg, P. J., Green, M. H., and Green, I. C. (2003) Linoleic acid and antioxidants protect against DNA damage and apoptosis induced by palmitic acid. Mutat Res 530 27 33. (51) Beeharry, N., Chambers, J. A., and Green, I. C. (2004) Fatty acid protection from palmitic acid induced apoptosis is lost following PI3 kinase inhibition. Apoptosis 9 599 607. (52) Lee, J. M., Hanson, J. M., Chu, W. A., and Johnson, J. A. (2001) Phosphatidylinositol 3 kinase, not extra cellular signal regulated kinase, regulates activation of the antioxidant responsive element in IMR 32 human neuroblastoma cells. J Biol Chem 276 20011 6. (53) Moehlenkamp, J. D., and Johnson, J. A. (1999) Activation of antioxidant/electrophile responsive elements in IMR 32 human neuroblastoma cells. Arch Biochem Biophys 363 98 106. (54) Lee, J. M., Moehlenkamp, J. D., Hanson, J. M., and Johnson, J. A. (2001) Nrf2 dependent activation of the antioxidant responsive element by tert butylhydroquinone is inde pendent of oxidative stress in IMR 32 human neuroblastoma cells. Biochem Biophys Res Commun 280 286 92. (55) Kawamoto, Y., Nakamura, Y., Naito, Y., Torii, Y., Kumagai, T., Osawa, T., Ohigashi, H., Satoh, K., Imagawa, M., and Uchida, K. (2000) Cyclopenteno ne prostaglandins as potential inducers of phase II detoxification enzymes. 15 deoxy delta(12,14) prostaglandin j2 induced expression of glutathione S transferases. J Biol Chem 275 11291 9.

PAGE 140

140 (56) Talalay, P., De Long, M. J., and Prochaska, H. J. (1988) Ide ntification of a common chemical signal regulating the induction of enzymes that protect against chemical carcinogenesis. Proc Natl Acad Sci U S A 85 8261 5. (57) Dinkova Kostova, A. T., Fahey, J. W., and Talalay, P. (2004) Chemical structures of inducers of nicotinamide quinone oxidoreductase 1 (NQO1). Methods Enzymol 382 423 48. (58) Bannai, S. (1984) Induction of cystine and glutamate transport activity in human fibroblasts by diethyl maleate and other electrophilic agents. J Biol Chem 259 2435 40. (5 9) Liu, Y., Kern, J. T., Walker, J. R., Johnson, J. A., Schultz, P. G., and Luesch, H. (2007) A genomic screen for activators of the antioxidant response element. Proc Natl Acad Sci U S A 104 5205 10. (60) Nguyen, T., Sherratt, P. J., and Pickett, C. B. ( 2003) Regulatory mechanisms controlling gene expression mediated by the antioxidant response element. Annu Rev Pharmacol Toxicol 43 233 60. (61) Yu, R., Lei, W., Mandlekar, S., Weber, M. J., Der, C. J., Wu, J., and Kong, A. N. (1999) Role of a mitogen act ivated protein kinase pathway in the induction of phase II detoxifying enzymes by chemicals. J Biol Chem 274 27545 52. (62) Wakabayashi, N., Dinkova Kostova, A. T., Holtzclaw, W. D., Kang, M. I., Kobayashi, A., Yamamoto, M., Kensler, T. W., and Talalay, P (2004) Protection against electrophile and oxidant stress by induction of the phase 2 response: fate of cysteines of the Keap1 sensor modified by inducers. Proc Natl Acad Sci U S A 101 2040 5. (63) Prestera, T., Talalay, P., Alam, J., Ahn, Y. I., Lee, P J., and Choi, A. M. (1995) Parallel induction of heme oxygenase 1 and chemoprotective phase 2 enzymes by electrophiles and antioxidants: regulation by upstream antioxidant responsive elements (ARE). Mol Med 1 827 37. (64) Prestera, T., and Talalay, P. ( 1995) Electrophile and antioxidant regulation of enzymes that detoxify carcinogens. Proc Natl Acad Sci U S A 92 8965 9. (65) Li, Y., and Jaiswal, A. K. (1992) Regulation of human NAD(P)H:quinone oxidoreductase gene. Role of AP1 binding site contained with in human antioxidant response element. J Biol Chem 267 15097 104. (66) Li, J., Lee, J. M., and Johnson, J. A. (2001) Microarray analysis reveals an antioxidant responsive element driven gene set involved in conferring protection from an oxidative stress i nduced apoptosis in IMR 32 cells. J Biol Chem 277 388 94.

PAGE 141

141 (67) Kelly, V. P., Ellis, E. M., Manson, M. M., Chanas, S. A., Moffat, G. J., McLeod, R., Judah, D. J., Neal, G. E., and Hayes, J. D. (2000) Chemoprevention of aflatoxin B1 hepatocarcinogenesis by coumarin, a natural benzopyrone that is a potent inducer of aflatoxin B1 aldehyde reductase, the glutathione S transferase A5 and P1 subunits, and NAD(P)H:quinone oxidoreductase in rat liver. Cancer Res 60 957 69. (68) Shih, A. Y., Johnson, D. A., Wong, G ., Kraft, A. D., Jiang, L., Erb, H., Johnson, J. A., and Murphy, T. H. (2003) Coordinate regulation of glutathione biosynthesis and release by Nrf2 expressing glia potently protects neurons from oxidative stress. J Neurosci 23 3394 406. (69) Konwinski, R. R., Haddad, R., Chun, J. A., Klenow, S., Larson, S. C., Haab, B. B., and Furge, L. L. (2004) Oltipraz, 3H 1,2 dithiole 3 thione, and sulforaphane induce overlapping and protective antioxidant responses in murine microglial cells. Toxicol Lett 153 343 55. (70) Kensler, T. W., Wakabayashi, N., and Biswal, S. (2007) Cell survival responses to environmental stresses via the Keap1 Nrf2 ARE pathway. Annu Rev Pharmacol Toxicol 47 89 116. (71) Satoh, T., Furuta, K., Tomokiyo, K., Namura, S., Nakatsuka, D., Sugie Y., Ishikawa, Y., Hatanaka, H., Suzuki, M., and Watanabe, Y. (2001) Neurotrophic actions of novel compounds designed from cyclopentenone prostaglandins. J Neurochem 77 50 62. (72) Satoh, T., Baba, M., Nakatsuka, D., Ishikawa, Y., Aburatani, H., Furuta, K., Ishikawa, T., Hatanaka, H., Suzuki, M., and Watanabe, Y. (2003) Role of heme oxygenase 1 protein in the neuroprotective effects of cyclopentenone prostaglandin derivatives under oxidative stress. Eur J Neurosci 17 2249 55. (73) Satoh, T., Okamoto, S. I., Cui, J., Watanabe, Y., Furuta, K., Suzuki, M., Tohyama, K., and Lipton, S. A. (2006) Activation of the Keap1/Nrf2 pathway for neuroprotection by electrophilic [correction of electrophillic] phase II inducers. Proc Natl Acad Sci U S A 103 768 73. (74) Goodfriend, T. L., Ball, D. L., Egan, B. M., Campbell, W. B., and Nithipatikom, K. (2004) Epoxy keto derivative of linoleic acid stimulates aldosterone secretion. Hypertension 43 358 63. (75) Gardner, H. W., and Crawford, C. G. (1981) Degradation of linol eic acid hydroperoxides by a cysteine FeCl3 catalyst as a model for similar biochemical reactions. III. A novel product, trans 12,13 epoxy 11 oxo trans 9 octadecenoic acid, from 13 L (S) hydroperoxy cis 9,trans 11 octadecadienoic acid. Biochim Biophys Ac ta 665 126 33.

PAGE 142

142 (76) Lin, D., Zhang, J., and Sayre, L. M. (2007) Synthesis of six epoxyketooctadecenoic acid (EKODE) isomers, their generation from nonenzymatic oxidation of linoleic acid, and their reactivity with imidazole nucleophiles. J Org Chem 72 94 71 80. (77) Johnson, D. A., Andrews, G. K., Xu, W., and Johnson, J. A. (2002) Activation of the antioxidant response element in primary cortical neuronal cultures derived from transgenic reporter mice. J Neurochem 81 1233 41. (78) Newman, D. J., and Cragg G. M. (2004) Marine natural products and related compounds in clinical and advanced preclinical trials. J Nat Prod 67 1216 38. (79) Montaser, R., and Luesch, H. (2011) Marine natural products: a new wave of drugs? Future Med Chem 3 1475 89. (80) Taori, K., Paul, V. J., and Luesch, H. (2008) Structure and activity of largazole, a potent antiproliferative agent from the Floridian marine cyanobacterium Symploca sp. J Am Chem Soc 130 1806 7. (81) Hong, J., and Luesch, H. (2012) Largazole: from discovery to broad spectrum therapy. Nat Prod Rep 29 449 56. (82) Chen, Q. Y., Liu, Y., an d Luesch, H. (2011) Systematic chemical mutagenesis identifies a potent novel apratoxin A/E hybrid with improved in vivo antitumor a ctivity. ACS Med Chem Lett 2 861 865. (83) H oshiyama, Y., Sekine, T., and Sasaba, T. (1993) A case control study of colorectal cancer and its relation to diet, cigarettes, and alcohol consumption in Saitama Prefecture, Japan. Tohoku J Exp Med 171 153 65. (84) Hoshiyama, Y., and Sasaba, T. (1992) A case control study of single and multiple stomach cancers in Saitama Prefecture, Japan. Jpn J Cancer Res 83 937 43. (85) Surh, Y. J. (2003) Cancer chemoprevention with dietary phytochemicals. Nat Rev Cancer 3 768 80. (86) Yan, X., Chuda, Y., Suzuki, M., and Nagata, T. (1999) Fucoxanthin as the major antioxidant in Hijikia fusiformis, a common edible seaweed. Biosci Biotechnol Biochem 63 605 7. (87) Liu, C. L., Chiu, Y. T., and Hu, M. L. (2011) Fucoxanthin enhances HO 1 and NQO1 expression in murine hepat ic BNL CL.2 cells through activation of the Nrf2/ARE system partially by its pro oxidant activity. J Agric Food Chem 59 11344 51. (88) Wang, R., Kern, J. T., Goodfriend, T. L., Ball, D. L., and Luesch, H. (2009) Activation of the antioxidant response elem ent by specific oxidized metabolites of linoleic acid. Prostaglandins Leukot Essent Fatty Acids 81 53 9.

PAGE 143

143 (89) Fontana, A., d'Ippolito, G., Cutignano, A., Romano, G., Lamari, N., Massa Gallucci, A., Cimino, G., Miralto, A., and Ianora, A. (2007) LOX induce d lipid peroxidation mechanism responsible for the detrimental effect of marine diatoms on zooplankton grazers. Chembiochem 8 1810 8. (90) Deneke, S. M., and Fanburg, B. L. (1989) Regulation of cellular glutathione. Am J Physiol 257 L163 73. (91) Feng, J ., Zhang, P., Chen, X., and He, G. (2011) PI3K and ERK/Nrf2 pathways are involved in oleanolic acid induced heme oxygenase 1 expression in rat vascular smooth muscle cells. J Cell Biochem 112 1524 31. (92) Surh, Y. J., Kundu, J. K., and Na, H. K. (2008) N rf2 as a master redox switch in turning on the cellular signaling involved in the induction of cytoprotective genes by some chemopreventive phytochemicals. Planta Med 74 1526 39. (93) Na, H. K., Kim, E. H., Jung, J. H., Lee, H. H., Hyun, J. W., and Surh, Y. J. (2008) ( ) Epigallocatechin gallate induces Nrf2 mediated antioxidant enzyme expression via activation of PI3K and ERK in human mammary epithelial cells. Arch Biochem Biophys 476 171 7. (94) Zipper, L. M., and Mulcahy, R. T. (2003) Erk activation is required for Nrf2 nuclear localization during pyrrolidine dithiocarbamate induction of glutamate cysteine ligase modulatory gene expression in HepG2 cells. Toxicol Sci 73 124 34. (95) Yates, M. S., Tauchi, M., Katsuoka, F., Flanders, K. C., Liby, K. T., Honda, T., Gribble, G. W., Johnson, D. A., Johnson, J. A., Burton, N. C., Guilarte, T. R., Yamamoto, M., Sporn, M. B., and Kensler, T. W. (2007) Pharmacodynamic characterization of chemopreventive triterpenoids as exceptionally potent inducers of Nrf2 regu lated genes. Mol Cancer Ther 6 154 62. (96) Margret, R. J., Kumaresan, S., and Ravikumar, S. (2009) A preliminary study on the anti inflammatory activity of methanol extract of Ulva lactuca in rat. J Environ Biol 30 899 902. (97) Chiu, Y. H., Chan, Y. L. Li, T. L., and Wu, C. J. (2012) Inhibition of Japanese encephalitis virus infection by the sulfated polysaccharide extracts from Ulva lactuca. Mar Biotechnol (NY) 14 468 78. (98) Sathivel, A., Raghavendran, H. R., Srinivasan, P., and Devaki, T. (2008) A nti peroxidative and anti hyperlipidemic nature of Ulva lactuca crude polysaccharide on D galactosamine induced hepatitis in rats. Food Chem Toxicol 46 3262 7. (99) Craig, C. (2006) Kirk Othmer Encyclopedia of Chemical Technology and Ullmann's Encyclopedi a of Industrial Chemistry. Issues in Science & Technology Librarianship 6 6.

PAGE 144

144 (100) Calder, P. C., Bond, J. A., Harvey, D. J., Gordon, S., and Newsholme, E. A. (1990) Uptake and incorporation of saturated and unsaturated fatty acids into macrophage lipids and their effect upon macrophage adhesion and phagocytosis. Biochem J 269 807 14. (101) Thimmulappa, R. K., Mai, K. H., Srisuma, S., Kensler, T. W., Yamamoto, M., and Biswal, S. (2002) Identification of Nrf2 regulated genes induced by the chemopreventive agent sulforaphane by oligonucleotide microarray. Cancer Res 62 5196 203. (102) Kansanen, E., Jyrkkanen, H. K., and Levonen, A. L. (2012) Activation of stress signaling pathways by electrophilic oxidized and nitrated lipids. Free Radic Biol Med 52 973 82 (103) Kohle, C., and Bock, K. W. (2007) Coordinate regulation of Phase I and II xenobiotic metabolisms by the Ah receptor and Nrf2. Biochem Pharmacol 73 1853 62. (104) Miao, W., Hu, L., Scrivens, P. J., and Batist, G. (2005) Transcriptional regulation o f NF E2 p45 related factor (NRF2) expression by the aryl hydrocarbon receptor xenobiotic response element signaling pathway: direct cross talk between phase I and II drug metabolizing enzymes. J Biol Chem 280 20340 8. (105) Gillingham, L. G., Harris Janz, S., and Jones, P. J. (2011) Dietary monounsaturated fatty acids are protective against metabolic syndrome and cardiovascular disease risk factors. Lipids 46 209 28. (106) Abeywardena, M. Y., and Patten, G. S. (2011) Role of omega3 long chain polyunsatura ted fatty acids in reducing cardio metabolic risk factors. Endocr Metab Immune Disord Drug Targets 11 232 46. (107) Kraft, A. D., Johnson, D. A., and Johnson, J. A. (2004) Nuclear factor E2 related factor 2 dependent antioxidant response element activatio n by tert butylhydroquinone and sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative insult. J Neurosci 24 1101 12. (108) Magesh, S., Chen, Y., and Hu, L. (2012) Small molecule modulators of Keap1 Nrf2 ARE pathway as po tential preventive and therapeutic agents. Med Res Rev 32 687 726. (109) Fitzgerald, V., Mensack, M., Wolfe, P., and Thompson, H. (2009) A transfer less, multi well liquid culture feeding system for screening small molecules that affect the longevity of C aenorhabditis elegans. Biotechniques 47 ix xv. (110) Moy, T., Conery, A., Larkins Ford, J., Wu, G., Mazitschek, R., Casadei, G., Lewis, K., Carpenter, A., and Ausubel, F. (2009) High Throughput Screen for Novel Antimicrobials using a Whole Animal Infectio n Model. Acs Chemical Biology 4 527 533.

PAGE 145

145 (111) Dengg, M., and van Meel, J. C. (2004) Caenorhabditis elegans as model system for rapid toxicity assessment of pharmaceutical compounds. J Pharmacol Toxicol Methods 50 209 14. (112) Choe, K. P., Przybysz, A. J., and Strange, K. (2009) The WD40 repeat protein WDR 23 functions with the CUL4/DDB1 ubiquitin ligase to regulate nuclear abundance and activity of SKN 1 in Caenorhabditis elegans. Mol Cell Biol 29 2704 15. (113) Hasegawa, K., and Miwa, J. (2010) Geneti c and Cellular Characterization of Caenorhabditis elegans Mutants Abnormal in the Regulation of Many Phase II Enzymes. Plos One 5 (114) Choe, K. P., Leung, C. K., and Miyamoto, M. M. (2012) Unique structure and regulation of the nematode detoxification ge ne regulator, SKN 1: implications to understanding and controlling drug resistance. Drug Metab Rev 44 209 23. (115) Nassar, A. E. F., Kamel, A. M., and Clarimont, C. (2004) Improving the decision making process in the structural modification of drug candi dates: enhancing metabolic stability. Drug Discovery Today 9 1020 1028. (116) Morales Sanfrutos, J., Lopez Jaramillo, F. J., Hernandez Mateo, F., and Santoyo Gonzalez, F. (2010) Vinyl sulfone bifunctional tag reagents for single point modification of prot eins. J Org Chem 75 4039 47. (117) Townsend, D. M., Tew, K. D., and Tapiero, H. (2003) The importance of glutathione in human disease. Biomed Pharmacother 57 145 55. (118) Zhang, D. D., Lo, S. C., Cross, J. V., Templeton, D. J., and Hannink, M. (2004) Ke ap1 is a redox regulated substrate adaptor protein for a Cul3 dependent ubiquitin ligase complex. Mol Cell Biol 24 10941 53. (119) Liu, H., Dinkova Kostova, A. T., and Talalay, P. (2008) Coordinate regulation of enzyme markers for inflammation and for pro tection against oxidants and electrophiles. Proc Natl Acad Sci U S A 105 15926 31. (120) Ma, Q., Kinneer, K., Ye, J., and Chen, B. J. (2003) Inhibition of nuclear factor kappaB by phenolic antioxidants: interplay between antioxidant signaling and inflamma tory cytokine expression. Mol Pharmacol 64 211 9. (121) Li, W., Khor, T. O., Xu, C., Shen, G., Jeong, W. S., Yu, S., and Kong, A. N. (2008) Activation of Nrf2 antioxidant signaling attenuates NFkappaB inflammatory response and elicits apoptosis. Biochem P harmacol 76 1485 9. (122) Xu, C., Shen, G., Chen, C., Gelinas, C., and Kong, A. N. (2005) Suppression of NF kappaB and NF kappaB regulated gene expression by sulforaphane and PEITC through IkappaBalpha, IKK pathway in human prostate cancer PC 3 cells. Onc ogene 24 4486 95.

PAGE 146

146 (123) Schmidt, K. N., Amstad, P., Cerutti, P., and Baeuerle, P. A. (1995) The roles of hydrogen peroxide and superoxide as messengers in the activation of transcription factor NF kappa B. Chem Biol 2 13 22. (124) Leung, C. K., Deonarine A., Strange, K., and Choe, K. P. (2011) High throughput screening and biosensing with fluorescent C. elegans strains. J Vis Exp (125) Blackwell, T. K., Bowerman, B., Priess, J. R., and Weintraub, H. (1994) Formation of a monomeric DNA binding domain by Skn 1 bZIP and homeodomain elements. Science 266 621 8.

PAGE 147

147 BIOGRAPHICAL SKETCH Rui Wang was born in Chifeng, Inner Mongolia, M ainland China in 1981. She went to Inner Mongolia Agricultura l University and obtained her b b iotechnology in 20 02 After spending a year in New Oriental English School to improve her English skills, she attended the University of Nottingham in England in 2 004. She was awarded a Master of Science degree in applied b i o molecular t echnology in 2005. Rui then worked as Laboratories where she developed an interest in pharmaceu tical sciences. In 2007, she was admitted to the College of Pharmacy at the University of Florid a to continue her education and receive d her Doctor of Philosophy degree in pharmaceutical sciences medicinal c hemistry at UF in 2012.