A Gene Cluster Involved in Stress Tolerance, (p)ppGpp Metabolism and Genetic Competence in Streptococcus mutans

MISSING IMAGE

Material Information

Title:
A Gene Cluster Involved in Stress Tolerance, (p)ppGpp Metabolism and Genetic Competence in Streptococcus mutans
Physical Description:
1 online resource (218 p.)
Language:
english
Creator:
Seaton, Kinda Chikere
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Immunology and Microbiology (IDP)
Committee Chair:
Burne, Robert Arthur, Jr
Committee Members:
Brady, Linda J
Gulig, Paul A
Cain, Brian Dale

Subjects

Subjects / Keywords:
alarmones -- caries -- competence -- mutans -- regulator -- streptococcus -- stress
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Dental caries is one of the most commoninfectious diseases, and costs associated with oral care can exceed $70 billionannually.  Streptococcus mutans, the primary etiological agent of dentalcaries, has evolved multiple strategiesto become established as a constituentof pathogenic biofilms and to cause caries. One of the key factors contributing to thevirulence of S. mutans is its ability to tolerate environmental stresses and to thrive at lowpH, when the growth of many other plaque bacteria is inhibited.  The studies provided here identified apreviously uncharacterized gene locus, SMu0835-7,that was renamed rcrRPQ for rel-competence-related. The gene operon was found to beinvolved in stress tolerance, (p)ppGpp metabolism and genetic competence, whichare all important pathways for bacteria and S.mutans to adapt to various environmental stresses. RcrR (SMu0835) encodes a multiple antibiotic resistancefamily transcriptional regulator (MarR), which EMSA and qRT-PCR analysesrevealed is the autogenous dominant regulator of the operon, and rcrPQ (SMu0836-7) encode ATP-dependent efflux pumps.  A mutant where rcrP was deleted and rcrQwas expressed at 1000-fold lower than the wild-type strain had impaired biofilmformation and grew more slowly, especially at low pH and in the presence ofoxidative stresses compared to the wild-type strain.  Optimal expression of relP, which encodes the synthetase that is the primary source of(p)ppGpp during exponential growth, requiredrcrRPQ, and optimal expression of rcrRPQ required relP. The levels of (p)ppGpp accumulated in exponentially growingcells were also affected in rcrRPQmutants. In addition, RcrR was shown to have weak interaction with the promoterof relP, indicating the potential fordirect regulation of the transcription of relPby RcrR.  An important and novel findingwas discovered in the regulation of (p)ppGpp accumulation.  It was found that oxidative stressors causedan increase in (p)ppGpp pools in a RelPRS-dependent manner. Various mutations made in the rcrRPQ operon led to changes in theability of the cells to be transformed with exogenous DNA.  Specifically, replacement of rcrR with a non-polar antibioticresistance cassette resulted in over expression of the rcrPQ exporters and rendered the strain non-transformable withexogenous DNA.  Transcriptional analysisrevealed that the expression of comYA,comX and comS, which are criticalfor competence and DNA uptake, were dramatically altered in these mutants.  EMSAs revealed the possibility of a directinteraction of RcrR with the comX andcomYA promoters.  In addition, mutations in the binding site ofRcrR resulted in attenuated binding of purified RcrR protein to the promoter ofthe rcr operon, as well as altering transformation efficiency and expression ofgenes in the competence cascade.  Globaltranscriptional profiling of the various rcrRmutants also revealed that the genes in the competence pathway were thosethat were most differentially regulated.  Collectively, the data support that the rcrRPQ gene products play a critical rolein physiologic homeostasis and stress tolerance by linking (p)ppGpp metabolism,acid and oxidative stress tolerance, and genetic competence of S. mutans.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Kinda Chikere Seaton.
Thesis:
Thesis (Ph.D.)--University of Florida, 2013.
Local:
Adviser: Burne, Robert Arthur, Jr.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-11-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2013
System ID:
UFE0044889:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 A GENE CLUSTER INVOLVED IN STRESS TOLERANCE, (P)PPGPP METABOLISM AND GENETIC COMPETENCE IN Streptococcus mutans By KINDA CHIKERE SEATON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 201 3 Kinda Chikere Seaton

PAGE 3

3 To my baby Kymani you changed my world Miguel, mom, dad sister and family

PAGE 4

4 ACKNOWLEDGMENTS First ly I would like to thank my mentor Dr. Robert Burne, for all the guidance with my project and providing a great work environment for research. I would also like to thank my committee members Dr. Jeannine Brady Dr. Brian Cain and Dr. Paul Gulig for all thei r input constructive criticisms and suggestions that assisted with my project and helped to develop my critical thinking skills as a scientist. I am also grateful to the entire Burne lab for all the support and exchange of ideas over the years and making work an enjoyable but productive environment. I would especially like to thank Dr. Sang Joon Ahn, for all the time, patience and dedication in g uiding me with this project and teachin g me good scientific techniques. I would like to speciall y thank Ann Sagstetter Decker for all of her help with generating some of the data. To Christopher Browngardt, the lab manager, thanks for keeping everything in order and being a supportive friend. Thank you to Justin Kaspar and Qiang Guo for continuing the work that was started and generating new ideas and results. Special thanks to Matt Watts for all the good discussions and help with all things computer rel ated I would also like to thank Dr. Lin Zeng, Dr. Sara Palmer Zachary Moye and Dr. Jang Na m Kim for all the advice and ideas for trouble shooting and performing experiments. You have all played a part in making the work successful. I would like to acknow ledge the funding sources as well. This work was supported by the NIH Training grant T32 DE07200 in Oral Biology and T32 Training Grant T32AI007110 29 in Infectious Diseases. I would finally like to thank my family and friends, firstly m y parents who hav e been very supportive of my entire educational career and always pushed me to do better and always strive for excellence. Special thanks to m y sister Jamila, who has been

PAGE 5

5 my biggest supporter and confidante when I needed it. To my aunts and uncle s thanks for the endless s upport and love throughout the years To Mig uel, thank you for all the love and support in the past few years.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 11 LIST OF ABBREVIA TIONS ................................ ................................ ........................... 15 ABSTRACT ................................ ................................ ................................ ................... 17 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 19 Streptococcus mutans and Dental Caries ................................ ............................... 19 Virulence Factors of S. mutans ................................ ................................ ............... 21 Adhesion and Biofilm Formation ................................ ................................ ....... 21 Ca rbohydrate Metabolism ................................ ................................ ................ 23 Acidogenicity ................................ ................................ ................................ .... 24 Aciduricity ................................ ................................ ................................ ......... 26 Environmental Stresses in the Oral Cavity and Strategies o f S. mutans to Overcome These Stresses ................................ ................................ .................. 29 Oxidative Stress Tolerance ................................ ................................ .............. 29 Two Component Systems ................................ ................................ ................ 30 Quorum Sensing ................................ ................................ .............................. 31 Genetic Competence ................................ ................................ ........................ 33 Bacteriocins and Immunity Proteins ................................ ................................ 38 Nutrient Limitation and (p)ppGpp Production ................................ ................... 41 Enzymatic Control of (p)ppGpp Metabolism ................................ ..................... 43 Summary ................................ ................................ ................................ ................ 45 Specific Aims ................................ ................................ ................................ .......... 46 2 MATERIALS AND METHODS ................................ ................................ ................ 50 Growth Conditions ................................ ................................ ................................ .. 50 Growth Assays ................................ ................................ ................................ ........ 50 Biofilm Assays ................................ ................................ ................................ ........ 51 DNA Manipulation and Construction of Mutants. ................................ .................... 52 PCR Ligation: Insertion Mutagenesis ................................ ............................... 52 Splice Overlap Extension Mutagenesis ................................ ............................ 52 Complementation ................................ ................................ ............................. 53 Construction of Promoter Fusions ................................ ................................ .... 54

PAGE 7

7 Transformation Assays. ................................ ................................ .......................... 55 Measuremen t of (p)ppGpp Accumulation ................................ ............................... 56 RNA Manipulation ................................ ................................ ................................ ... 57 RNA Extraction ................................ ................................ ................................ 57 qRT PCR ................................ ................................ ................................ .......... 57 Semi quantitative Revers e Transcriptase PCR ................................ ................ 58 RNA Sequencing ................................ ................................ .............................. 58 Short Read Alignments ................................ ................................ .................... 59 Transcript Predictions ................................ ................................ ....................... 59 Prediction of Small RNAs and Targets ................................ ............................. 60 Statistical Analysis f or Differential Expression ................................ .................. 61 Microarray Experiments. ................................ ................................ ................... 61 S. mutan s Microarray Data Analysis ................................ ............................... 62 Biochemical Assays ................................ ................................ ................................ 62 Chloramphenicol Acetyltransferase Assay ................................ ...................... 62 Galactosidase Assay ................................ ................................ ..................... 63 Protein Manipulation ................................ ................................ ............................... 64 Protein Purification ................................ ................................ ........................... 64 Electrophoretic Mobility Shift Assay (EMSA) ................................ .................... 65 Fluorescent Polarization Assay ................................ ................................ ........ 66 3 CHARACTERIZATION OF THE SMU0835 837 OPERON AND ITS ROLE ON GROWTH, BIOFILM FORMATION AND STRESS TOLERANCE IN Streptococcus mutans ................................ ................................ ............................ 76 Introduction ................................ ................................ ................................ ............. 76 Results ................................ ................................ ................................ .................... 78 Transcriptiona l Organization of the SMu0835 837 Operon. ............................. 78 SMu0835 (RcrR) Is the Dominant Regulator of the Operon ........................... 79 Growth Characteristics of the Mutants. ................................ ............................. 80 Discussion ................................ ................................ ................................ .............. 82 4 REGULATION OF relPRS AND THE EFFECTS OF SMU0835 0837 ON relPRS AND ( p)ppGpp LEVELS ................................ ................................ ........................ 103 Introduction ................................ ................................ ................................ ........... 103 Results ................................ ................................ ................................ .................. 104 SMu0835 837 Influence relP Expression and Vice Versa. ............................. 104 Effect of SMu0835 0837 on (p)ppGpp Levels ................................ ................ 105 Effect of Oxidative Stressors on (p)ppGpp Pools ................................ ........... 105 Effect of Oxidative Stressors on relP Promoter Activity ................................ .. 106 Discussion ................................ ................................ ................................ ............ 106 5 THE EFFECT OF SMU0835 0837 ON THE COMPETENCE REGULON ............ 119 Introduction ................................ ................................ ................................ ........... 119 Results ................................ ................................ ................................ .................. 120

PAGE 8

8 Competence Defect in rcrRPQ Mutant s. ................................ ........................ 120 SMu0835 7(rcrRPQ) Affect comX and comY Expression. .............................. 122 Differences in Growth of Mutant Strains in the Presence of CSP ................... 123 Discussion ................................ ................................ ................................ ............ 124 6 REGULATION OF GENE EXPRESSION AND COMPETENCE BY THE SMU0835 ( RcrR) protein ................................ ................................ ...................... 138 Introduction ................................ ................................ ................................ ........... 138 Results ................................ ................................ ................................ .................. 139 Identification of RcrR Binding Sites ................................ ................................ 139 Mutations in the Predicted Binding Sites Affect Binding of the RcrR Protein .. 141 Mutations in the Binding Site of the rcrR Promoter Affect Competence. ........ 142 Effect of the Mutations on P romoter Activity ................................ .................. 142 Mutations in the rcrR Binding Site Affect comX comS and comYA Expression ................................ ................................ ................................ .. 143 Effect of the Mutations in the rcrR Binding Site on rcrR and rcrP Expression 143 Mutations in the Predicted RcrR Binding Site Affects Growth in CSP ............ 144 Global Regulation by the RcrR Regulator ................................ ....................... 145 RcrR Has A Weak Interaction With the comX and relP Promoter Region ...... 145 Discussion ................................ ................................ ................................ ............ 146 7 SUMMARY AND FUTURE DIRECTIONS ................................ ............................ 177 The Role of RcrRPQ in Stress Tolerance ................................ ............................. 177 Novel Factors Affecting (p)ppGpp Metabolism ................................ ..................... 1 80 The Role of RcrRPQ on Genetic Competence and DNA Uptake .......................... 182 Linkage of RcrRPQ to Stress Tolerance, (p)ppGpp and Competence .................. 184 Future Studies ................................ ................................ ................................ ...... 187 Summary ................................ ................................ ................................ .............. 187 APPENDIX: ZONE OF INHIBITION ................................ ................................ ............ 196 LI ST OF REFERENCES ................................ ................................ ............................. 197 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 218

PAGE 9

9 LIST OF TABLES Table page 2 1 List of strains ................................ ................................ ................................ ...... 70 2 2 List of plasmids used ................................ ................................ .......................... 71 2 3 List of primers ................................ ................................ ................................ ..... 72 2 4 List of real time primers ................................ ................................ ...................... 74 2 5 List of primers and oligos for EMSA and FP analysis ................................ ......... 75 3 1 Percentage of labeled PrcrR DNA shifted with unlabeled competitor P rcrR DNA ................................ ................................ ................................ .................... 94 3 2 Table showing growth characteristics of the non polar mutants versus the wild type strain in BHI ................................ ................................ ......................... 95 3 3 Table showing growth characteristics of the polar mutant versus the wild type strain in BHI. ................................ ................................ ................................ ....... 96 3 4 Table showing growth characteristics of the wild type versus the non polar strains at pH 5.5 ................................ ................................ ................................ 97 3 5 Table showing growth characteristics of the polar mutant versus the wild type strain at pH 5.5 ................................ ................................ ................................ ... 98 3 6 Table showing growth characteristics of the mutants versus the wild type strain with aeration ................................ ................................ ............................. 99 3 7 Table showing growth characteristics of the mutants versus the wild type strain with 25 mM paraquat ................................ ................................ .............. 100 4 1 Percent change in GP4 (ppGpp) and GP5 (pppGpp) accumulation of mutant strains compared to the wild type strain. ................................ .......................... 115 5 1 Summary showing mutant strains, SMu0835 837 mRNA expression levels and transformation efficiency compared to the wild type strain. ....................... 127 5 2 Transformation efficiency of the wild type and various mutants strains in the presence or absence of added CSP ................................ ................................ 128 5 3 Table showing growth characteristics of the mutants versus the wild type strain in BHI. ................................ ................................ ................................ ..... 136 5 4 Ta ble showing growth characteristics of the mutants versus the wild type strain in BHI + 2 M CSP. ................................ ................................ .................. 137

PAGE 10

10 6 1 Percentage of DNA shifted wi th different PCR products of the promoter of rcrR ................................ ................................ ................................ ................... 154 6 2 Percentage of DNA shifted with different annealed oligos in the promoter of rcrR ................................ ................................ ................................ ................... 155 6 3 Percentage of labeled P rcrR DNA shifted wi th unlabeled oligo competitors of P rcrR DNA ................................ ................................ ................................ .......... 156 6 4 Percentage of P WT DNA vs. P NBS1 DNA shifted at different protein concentrations ................................ ................................ ................................ .. 157 6 5 Percentage of P WT DNA vs. P BBS DNA shifted at different protein concentrations ................................ ................................ ................................ .. 158 6 6 Transformation efficiency of the wild type and SOE mutants strains in the presence or absence of added CSP ................................ ................................ 160 6 7 Genes differentially regulated in the 835np strain vs. wild type strain via microarray analysis ................................ ................................ ........................... 172 6 8 Genes differentially regulated in the 835np strain vs wild type strain via RNA seq analysis. ................................ ................................ ............................ 173 6 9 Genes differentially regulated in the 835p strain vs wild type strain via RNA seq analysis. ................................ ................................ ................................ ..... 175 7 1 List of organisms with genes encoding RcrRPQ homologues linked to RelPRS homologues and their GeneBank Locus ID ................................ ........ 194 7 2 Summary of mutants with deletions in the rcrQ transformation efficiency compared to the wild type strain ............................... 195

PAGE 11

11 LIST OF FIGURES Figure page 1 1 Comparison of the competence pathways between Streptococcus pneumoniae and Streptococcus mutans ................................ ............................ 47 1 2 Schematic showing the regulation of (p)ppGpp by RelA and SpoT in Gram negative bacteria. ................................ ................................ ............................... 48 1 3 Schematic of the genes encoding the three (p)ppGpp enzymes in S. mutans ... 49 2 1 Schematic showing the process for making insertion:deletion mutants via PCR ligation mutagenesis ................................ ................................ .................. 67 2 2 Schematic showing the process for making point mutations via splice overlap extension PCR ................................ ................................ ................................ .... 68 2 3 Gel image showing size difference in PCR products generated from the SOE mutants vs. WT using MAMA primers. ................................ ............................... 69 3 1 Schematic diagram of the SMu0835 0839 (rcrRPQ) gene cluster and the relPRS operon in S. mutans UA159. ................................ ................................ .. 86 3 2 RT PCR using cDNA generated from the SMu0836 reverse primer.. ................. 87 3 3 RT PCR using cDNA generated from the SMu083 7 reverse primer. .................. 88 3 4 RealTime RT PCR showing rcrQ mRNA levels. ................................ ................ 89 3 5 RealTime RT PCR showing tpx mRNA levels. ................................ ................... 90 3 6 RealTime RT PCR showing SMu0836(rcrP) mRNA levels ................................ 91 3 7 RealTime RT PCR showing NP Kanamycin mRNA levels. ................................ 92 3 8 EMSA showing binding of biotinylated P rcrR DNA with purified RcrR protein.. .... 93 3 9 EMSA showing competitive binding of 5 fmol biotinylated P rcrR DNA and unlabeled P rcrR DNA with 1.25 pmoles of purified RcrR protein.. ........................ 94 3 10 Growth comparison of wild type and non polar mutant strains in BHI ............... 95 3 11 Growth comparison of wild type and polar mutant strains in BHI. ...................... 96 3 12 Growth of the non polar mutants versus the wild type strain at pH 5.5 .............. 97 3 13 Growth of the polar mutant strain versus the wild type strain at pH 5.5. ............. 98

PAGE 12

12 3 14 Growth of the mutants versus the wild type strain with aeration. ........................ 99 3 15 Growth of the mutants versus the wild type strain in 25 mM paraquat. ............ 100 3 16 The differences in biofilm formation of the mutants compared with the wild type strain in glucose. ................................ ................................ ...................... 101 3 17 Schematic of the proposed regulation of the rcrPQ operon by the RcrR protein.. ................................ ................................ ................................ ............ 102 4 1 RealTime RT PCR showing RelP mRNA levels ................................ ............... 109 4 2 RealTime RT PCR showing RelRS mRNA levels ................................ ............ 110 4 3 RealTime RT PCR showing RcrR mRNA levels ................................ ............... 111 4 4 RealTime RT PCR showing SMu0836 mRNA levels.. ................................ .... 112 4 5 CAT activity from the relP promoter. ................................ ................................ 113 4 6 CAT activity from the SMu0835 promoter ................................ ......................... 114 4 7 (p)ppGpp accumulation in mutant versus wild type strains.. ............................ 115 4 8 Accumulation of (p)ppGpp in hydrogen peroxide. ................................ ............. 116 4 9 The effect of hydrogen peroxide on LacZ activity from the relP promoter ........ 117 4 10 Schematic of the potential regulation of the relPRS operon by different environmental cues and potential cross regulation with the rcrRPQ operon.. .. 118 5 1 RealTime RT PCR showing SMu0836 (rcrP) mRNA levels ............................. 129 5 2 RealTime RT PCR showing SMu0835 (rcrR) mRNA levels ............................. 130 5 3 Transformability of the complemented strains compared to the mutant and wild type strains ................................ ................................ ................................ 131 5 4 RealTime RT PCR showing comYA mRNA levels ................................ ........... 132 5 5 RealTime RT PCR showing comYA mRNA levels in complemented strains. 133 5 6 RealTime RT PCR showing comX mRNA levels ................................ .............. 134 5 7 RealTime RT PCR showing comX mRNA levels in complemented strains. ..... 135 5 8 Growth comparison of wild type versus mutant strains in BHI ......................... 136 5 9 Growth comparison of wild type versus mutant strains in 2 M CSP .............. 137

PAGE 13

13 6 1 EMSA showing binding of biotinylated regions of P rcrR DNA with purified RcrR protein. ................................ ................................ ................................ .... 152 6 2 Schematic of the promoter region of the rcrRPQ operon in S. mutans UA159. ................................ ................................ ................................ ......................... 153 6 3 EMSA showing binding of biotinylated PCR products of P rcrR with purified RcrR protein.. ................................ ................................ ................................ ... 154 6 4 EMSA showing binding of biotinylated oligos of P rcrR DNA with purified RcrR protein. ................................ ................................ ................................ ............. 155 6 5 EMSA showing competitive binding of biotinylated regions of P rcrR DNA with unlabeled regions of P rcr DNA and purified RcrR protein. ................................ 156 6 6 EMSA showing binding of biotinylated P NBS1 mutated regions of P rcrR DNA with purified RcrR protein ................................ ................................ ................. 157 6 7 EMSA showing binding of biotinylated P BBS mutated regions of P rcrR DNA with purified RcrR protein ................................ ................................ ................. 158 6 8 EMSA showing binding of biotinylated P NBS2 mutated regions of P rcrR DNA with purified RcrR protein.. ................................ ................................ ............... 159 6 9 galactosidase activity from rcrR promoters that contained various mutations. ................................ ................................ ................................ ....... 161 6 10 RealTime RT PCR showing comYA mRNA levels in strains with mutations in the RcrR binding site. ................................ ................................ ....................... 162 6 11 RealTime RT PCR showing comS mRNA levels in strains with mutations in the RcrR binding site.. ................................ ................................ ...................... 163 6 12 RealTime RT PCR sho wing comX mRNA levels in strains with mutations in the RcrR binding site.. ................................ ................................ ...................... 164 6 13 RealTime RT PCR showing rcrR mRNA levels in strains with mutations in the RcrR binding site ................................ ................................ ........................ 165 6 14 RealTime RT PCR showing rcrP mRNA levels in the strains with mutations in t he RcrR binding site.. ................................ ................................ ...................... 166 6 15 Growth comparison of wild type and mutant strains in BHI. ............................ 167 6 16 Growth comparison of wild type vs. mutant strains in 2 M CSP e. .................. 168 6 17 Growth comparison of wild type vs. SJ354 in 2 M CSP. ................................ 169

PAGE 14

14 6 18 EMSA showing binding of the relP promoter with purified RcrR protein. positive and negative controls for RcrR protein.. ................................ .............. 170 6 19 EMSA showing binding of the comX promoter with purified RcrR protein. .... 171 7 1 Schematic of the working model showing the regulation of relP and comX by RcrRPQ under rcr repressing conditions.. ................................ ........................ 189 7 2 Schematic of the working model showing the regulation of relP and comX by RcrRPQ under rcr derepressing conditions.. ................................ .................... 190 7 3 Schematic of the working model showing the regulation of the competence pathway and the RelPRS dependent production of (p)ppGpp by rcrRPQ ..... 191 7 4 region of SMu0837 (rcrQ). ................................ ................................ ................ 192 7 5 region of SMu0837 (rcrQ). ................................ ................................ ................ 193

PAGE 15

15 LIST OF ABBREVIATION S Km Polar kanamycin resistance gene cassette ABC ATP binding cassette ATP Adenosine triphosphate BCA Bicinchoninic acid BCAA Branch chained amino acids BHI Brain h eart infusion BIP Bacteriocin immunity protein BM Base media BP Base pairs CAT Chloramphenicol acetyl transferase CSP Competence stimulating peptide DTNB Dithionitrobenzoic acid DTT Dithiothreitol dsDNA double stranded DNA EDTA Ethylenediaminetetraacetic a cid EMSA Electrophoretic mobility shift assay GTP Guanosine triphosphate HK Histidine Sensor Kinase IDV Integrated density values kDA kiloDalton MAMA Mismatch amplification mutation assay MarR Multiple antibiotic resistance regulator NPKm Non polar kanamycin resistance cassette O/N Overnight

PAGE 16

16 OD Optical density ONPG ortho Nitrophenyl galactosidase PAGE Polyacrylamide gel elec trophoresis PCR Polymerase chain reaction PEP PTS Phosphoenolpyruvate :sugar phosphotransferase system ppGpp/GP4 Gu anosi ne 3', 5' bispyrophosphate / te t r aphosphate pppGpp/GP5 Guanosine 3' diphosphate, 5 'triphosphate / pentaphosphate qRT PCR Quantitative real time polymerase chain reaction QS Quorum sensing RBS Ribosome binding site RNAP RNA polymerase ROS Reactive oxygen species RR Response regulator RT PCR Reverse transcription polymerase chain reaction SDS Sodium dodecyl sulfate ssDNA Single stranded DNA SOE Splice extension overlap TCA Tricarboxylic acid TCS Two component system TLC Thin layer chromatography XIP ComX inducing p eptide

PAGE 17

17 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy A GENE CLUSTER INVOLVED IN STRESS TOLERANCE, (P)PPGPP METABOLI SM AND GENETIC COMPETENCE IN Streptococcus mutans By Kinda Seaton May 2013 Chair: Robert A. Burne Major: Medical Sciences, Immunology and Microbiology Dental caries is one of the most common infectious diseases and costs associated with oral care c an exceed $ 7 0 billion annually. Streptococcus mutans the primary etio logical agent of dental caries has e volved multiple strategies to become established as a con stituent of pathogenic biofilms and to cause caries. One of the key factors contributing to the virulence of S. mutans is its ability to tolerate environmental stresses and to thrive at low pH, when the growth of many other plaque bacteria is inhibited. The studies provided here identif ied a previously uncharacterized gene locus SMu0835 7 that was renamed rcrRPQ for r el c ompetence r elated that is involved in stress tolerance, (p)ppGpp metabolism and genetic competence. RcrR (SMu0835) encod es a m ultiple a ntibiotic r esistance family transcriptional regulator (MarR) an autogenous dominant regulator of the operon and r crPQ ( SMu0836 7 ) encode ATP dependent efflux pumps Mutations in rcrPQ affected the ability of the organism to grow, especially at low pH and in the presence of oxidative stresses O ptimal expression of r elP, which encodes the synthetase that is the primary source of (p)ppGpp during exponential growth required rcr R PQ and the levels of (p)ppGpp accumulated in exponentially

PAGE 18

18 growing cells w ere also affected in rcrRPQ mutants It was also found that oxidative stres sors caused an increase in (p)ppGpp pools in a RelPRS dependent manner Various mutations made in the rcrRPQ operon led to changes in the ability of the cells to be transformed wi th exogenous DNA. R eplacement of rcrR with a non polar antibiotic resistance cassette resulted in over expression of rcrPQ s and rendered the strain non transformable with exogenous DNA. Transcriptional analysis revealed that the expression of comYA, comX and comS which are critical for competence and DNA uptake were dramatically altere d in these mutants Global t ranscriptional profiling of the various rcrR mutants also revealed that the genes in the competence pathway were those that were most differentially regulated Collectively, the data support that the rcrRPQ gene products play a critical role in physiologic homeostasis and stress tolerance by linking (p)ppGpp metabolism, acid and oxidative stress tolerance and genetic competence of S. mutans

PAGE 19

19 CHAPTER 1 INTRODUCTION Streptococcus m utans and Dental Caries Streptococcus mutans is a G ram positive facultative anaerobe belonging to the virid ans strep hemolytic activity (49) The vir idans streptococci are catalase n egative cocci that form chains and can be further divided into the mutans, mitis, salivarius, anginosus and sanguinus groups. The mutans group cons ist s of Streptococcus mutans Streptococcus sobrinus Streptococcus cricetus Streptococcus rattus Streptococcus downeii Streptococcus ferus Streptococcus macacae and can be differentiated from the other groups by their ability to ferment mannitol and sorbitol S. mutans can be further sub divided into 4 serotypes c, e, f and k based on the cell wall rha mnose glucose polysaccharides (134, 204) The oral m icrobiome is diverse with over 600 taxa present (56) Oral streptococci constitute approximately 23% of cultivable bacteria, and the mutans streptococci comprise 2 5% of the population isolated from healthy ind ividuals (29) Dental caries is considered one of the most common bacterial infections in humans and studies show that 90% of Americans over the age of 20 have dental caries in their permanent teeth (25) In addition to the pain and discomfort associated with dental caries, the disease pose s an economic burden for treatment in the United States, with cost s for oral health care treatment exceeding $ 70 billion annually (134) S mutans is the one of the etiological agent s of dental caries and is implicated in infective endocarditis (80, 92, 104) It was orig inally isolated from carious les ions by Clarke in 1924 (43) In Western

PAGE 20

20 populations and developed countries, t he most common serotype isolated from the oral cavity is serotype c (70 80%), followed by serotype e ( 20%), while f and k account for less than 5% (162) However, serotype f and k are the most common serotype i solated from endocarditi s plaques (161) Abranches et al showed that strains that were serotype e and f were more invasive of coronary endothelial cells than strains that were serotype c (2) S. mutans is able to cause disea se p rimarily based on its metabolism, whereas some other bacteria have typical virulence factors such as toxin s or effectors that cause disease and damage to the host S. mutans has mechanisms to adhere to the tooth surface, accumulate in biofilms, produce acid and tolerate the acid it generates (20) S. mutans is high ly effective at producing acids from the fermentation of a wide range of dietary carbohydrates, causing a decrease in pH of the oral biofilms and demineralization of the tooth It is the accumulation of acids that causes demineralization of the tooth enamel that leads to dental caries and tooth decay (20, 134) In addition, S. mutans is particularly acid tolerant (aciduric) and able to grow and to carry out glycolysis at pH values that are well below that needed to damage the tooth mineral. In fact, the property of aciduricity is considered a major contributor to the role of S. mutans in the initiation and progression of ca rious lesions and a ciduricity is a general property of caries associated bacteria S. mutans utilizes many systems to adapt to the oral environment and outcompete other species in a biofilm to cause disease when the conditions are favorable. The oral ca vity is continuously changing and can become a hostile environment for bacteria to survive, with rapid variations in pH, oxygen tension and nutrient availability. Bacteria must be able to respond to these fluctuat ions in order to survive. Carlsson first

PAGE 21

21 organisms are confronted with extended periods during which saliva is the primary nutrient source, interspersed with comparatively short intervals where nutrients from die tary sources are abundant (38) S. mutans lives on the tooth surface at high cell density in dental plaque, and the structure a nd composition of the plaque are strongly influenced by factors such as pH and nutrient availability. S. mutans aggregates to form a protective biofilm and hence contribute s to the pathogenicity of S. mutans to establish itself as one of the dominant bact eria in cariogenic dental plaque (33, 217) There are four main requirements for S. mutan s to become cariogenic. The bacteria have to be able to adhere to the tooth surface and form biofilms, accumulate in sufficient numbers to produce damage to the host, generate acid by fermentation and tolerate the acidic environment it generates. Virulence Factors of S. mutans Adhesion and Biofilm F ormation Bacteria are able to adhere to the tooth pellicle, which is primar i ly formed from salivary glycoproteins that adhere to the tooth surface and form a thin film S. mutans adheres to the tooth su rface through sucrose dependent and su crose independent interactions. Sucrose independent adhesion is mediated through a surface adhesin P1(SpaP) also known as antigen I/II, which facilitate s binding of S. mutans to the salivary pellicle (51, 115, 139) and mutants deficient in SpaP were not able to adhere to saliva coated surfaces (30) The antigen I/II family of proteins share 7 domains and Bleiweis et al. demonstrated that the alanine rich regi on or A region was able to bind salivary agglutinin (50) The pro line rich domain w as also thought to be responsible for the interaction of P1 (SpaP) with salivary components (20) Other surface associated

PAGE 22

22 proteins such as WapA (Antigen III) and BrpA have been implicated in the formation of biof ilm independ en tly of sucrose. A mutant that lacks the gene encoding the WapA protein had perturbed biofilm architecture (244) and Wen et a l. showed that mutants deficient in brpA had significantly lower biofilm formation when cells were grown in glucose (230) In the presence of sucrose, dental plaque biofilm becomes irreversibly bound by the formation of glucans and fructans (59) S ucrose is the primary substrate for the glucosyltransferases (GTFs) G tfB G tfC and G tfD The G TF enzymes consist of a glucan binding domain (20) and possess sucras e act ivity that split sucrose into glucose and fructose (159, 240) Th e glucose moiety is added to a growing polymer of glucan to synt hesize water soluble and water insoluble glucans (160) The wat er insoluble glucans have a higher degree of branching and a 1,3 linked whereas the water soluble glucans are linked primarily 1,6 glycosidic linkages GtfB and GtfC synthesize the water insoluble glucans while GtfD primarily synth esizes water soluble glucans. Mutants lacking G TF enzymes had diminished cariogenicity in rodents as well (111) Glucans help to facilitate adhesion to the tooth through hydrogen bonding of the glucan polymers to the salivary pellicle (20) S. mutans can become coated with glucans in the presence of sucrose and it is hypothes ized that S. mutans can attach to glucans within the dental plaque (20) Other g lucan binding proteins (GBPs) found on the cell surface are thought to assist in the adherence and biofilm formation process by binding glucans or med iating dextran dependent aggregation (20, 21) The levels of GbpB correlate with biofilm formation (151) and a mutant that had the gbpA gene inactivated had changes to the architecture of sucrose dependent biofilm (21)

PAGE 23

23 Carboh ydrate Metabolism There is a correlation of dental caries development and dietary sugar intake (36) Evidence accumulated in the mid 1800s show ed a link between bacterial sugar metabolism to acid production and tooth decay (140) Therefore, proteins that are involve d in sugar metabolism are considered potential virulence factors of S. mutans These include fructosyltransferase (Ftf), which catalyzes the synthesis of fructans that function as a nutrient reserve (234, 235) a fructanase (FruA), which breaks down fructans fo r energy use (35) and an extracellular dextranase (DexA), which may help contribute to the synth esis and breakdown of glucans (210) During periods of excess sugar intake, S. mutans accumulates intracellula r and extracellular polysaccharides (IPS and EPS). IPS are glycogen like storage polymers and contribute to caries formation and survival during nutrient starvation (34, 208) and EPS are rapidly synthesized when sucrose is present in the diet. The DltA D enzymes, which are orthologous to the D alanine activating enzymes in Bacillus subtilis are involved in the accumulation of intracellular polysaccharides that can be used as an energy reserve (82) At low sugar concentrations, the phosphoenolpyruvate (PEP) sugar: phosphotransferase system (PTS) is the major system for the uptake of sugars in the cell (97, 118, 224) An incoming sugar must be phosphorylated by the PTS. A p hosphate group is transferred to the sugar specific enzyme and finally to the incoming sugar. The PEP PTS internalizes a wide variety of sug ars includ ing glucose, fructose, mannose, sucrose and lactose The PEP PTS consists of two proteins, Enzyme I (E1) and H P r which is a heat stable phosphocarrier protein. There are also sugar specific permeases known as Enzyme II (EII) complex which consist of the EIIA, EIIB and EIIC

PAGE 24

24 domains A phosphate group from a PEP molecule is transferred to EI, which phosphorylates H P r at His 15. The phosphate group is then transf erred to the sugar specific EIIA and B domains, and then transferred to the incoming sugar for transport by EIIC membrane domain (118, 182) The internalized sugar can be metabolized by various enzymes to end products which include glucose and can enter the glycolytic pathway (242) Carbon catabolite repression (CCR) involves networks that activate or silence genes in response to carbohydrate source and availability. CCR is controlled by HPr and CcpA, which is a transcriptional regulator, in low G+C content Gra m positive bacteria. During conditions that can induce CCR such as excess glucose, an HPr kinase that is activated by specific glycolytic intermediates, such as fructose 1,6 bisphosphate (F 1,6 bP) or glucose 6 phosphate, can phosphorylate HPr at serine 4 6 at the expense of ATP HPr (Ser 46 P) forms a complex with CcpA that stimulates CcpA binding to conserved catabolite responsive elements (CRE) in the promoters of a variety of genes to control their activity (3, 120) CcpA can regulate sporulation, antibiotic resistance and expression of virulence attributes. Acidogenicity In 1940 Stephan showed a rapid decline in plaque pH after a sugar rinse that was linked to the production of lactic acid by bact eria (212) S. mutans can produc e lactate, formate, acetate and ethanol as fermentatio n by products from glycolysis. The acidogenicity of S. mutans causes a reduction of plaque pH, and sustained plaque pH values below 5.5 favor the demineralizat ion of enamel and dental caries (120) Lactic acid has a low pKa and is able to demineralize the tooth surface more effectively than other end products such as formate or acetate. The distribution of the fermentation

PAGE 25

25 products changes as growth conditions c hange. When there is an excess of carbohydrate source, lactic acid is the dominant glycolytic end product whereas formate, acetate and ethanol are predominant in glucose limiting conditions (238) S. mutans has the ability to open a lactate gate which protects the bacteria from sugar killing. The opening of the lactate gate enables the rapid movement of carbohydrates through glycolysis and more efficient movement of lactic acid o ut of the cells. The production of lactate is controlled by the NAD dependent lactate dehydrogenase (LDH) (38) When there is an excess of carbohydrate source, NADH levels can build up as a result of glycolysis. LDH is activated by fructose 1,6 bis phosphate a glycolytic intermediate, to catalyze the conversion of pyruv ate to lactate, generating NAD + from NADH. Mutations in ld h appear to be lethal in S. mutans probably because of the accumulation of glycolytic interme diates and an imbalance in NADH /NAD + (42, 88) St rains that have reduced LDH activity have reduced cariogenicity (42, 65, 102) In carbohydrate l imiting conditions S. mutans is able to survive and the major end products shift from lactate to formate, acetate and ethanol and ldh is not induce d. The shift in glycolytic e nd products is controlled by the pyruvate formate lyase enzyme (PFL), which can convert pyruvate and coenzyme A (CoA) into formate and acetyl CoA. However, PFL is not active when oxygen is present and the pyruvate dehydrogenase complex (PDH) is active (39) P yruvate can then be converted to acetyl CoA and CO 2 and NADH is generated (18) Acetyl C oA ca n be converted to acetyl phosph ate (acetyl P). Acetate can then be pro duced from acetyl P yielding one molecule of ATP by the enzyme acetate kinase (39) The inactivation of pdh impairs the survival of the bacteria in limiting sugar (37)

PAGE 26

26 Aciduricity In addition to the generation of acids, S. mutans is able to tolerate low pH, which distinguishes it from many other oral bacteria and gives it a selective advantage to become a dominant colonizer over other oral bacteria that cannot endure acid as well (118) The bacteria are able to retain glycolytic capabilities at pH values as low as 4.4 (27) The pH of saliva is around neutral, which is optimal for the growth of most oral bacteria (143) However after an intake of dietary sugars, the pH rapidly decreases as a result of the metabolism of the dietary sugars. S. mutans has many strategies to cop e and function at this low pH. F ATPase The major mechanism for coping with the low pH is through the ex trusion of protons by the F ATPase (H + translocating ATPase) which maintains the internal pH more alkaline compared to the environment (26) Acid sensitive glycolytic enz ymes are protected through the acid tolerance response processes is maintained. Studies have shown that as the pH falls, the activity of the membrane bound F 1 F 0 ATPase proton pump increases helping to maintain the pH at 0.5 1 relative to the external environment (8 1, 215) The optimal pH for the F ATPase enzyme in S. mutans is 6.0, compa red to less acid tolerant bacteria where the optima l pH for the ATPase enzymes is more neutral (184) Also, it has been shown that the F ATPase can function as an ATP synthase in starved cells at low pH. A sudden drop in pH causes a rapid increase in ATP le vels which was demonstrated to be the result of the F ATPase acting as an ATP synthase (203) Therefore, the F AT Pase may not only be playing role in proton extrusion, but may play a role in generating ATP for growth (203) Shift in membrane profile The fatty acid profile of the membrane shifts from short

PAGE 27

27 chained saturated fatty acids to mono unsaturated fatty acids and longer chains as the pH falls (69) The change in the fatty acid membrane profile leads to decreased permeability to protons which may influence the activity of the F ATPase (188) The fabM gene product is responsible for the generation of mono unsaturated fatty acids (68) and mutants lacking this gene, were more sensitive to low pH and unable to fabM mutants also exhibited reduced virulence in a rat caries model compared to the parental strain (68) Membrane biogenesis is critic al to stress tolerance as well. Strains that had mutations to genes encoding prote ins involved in D alanyl lipoteichoic acid synthesis and phospholipid metabolism were incapable of surviving at low pH (31, 241) A strain with a mutation in the ffh gene, which encodes a homologue of t he eukaryotic signal recognition p article (SRP) was incapable of growing at pH 5 (109) In addition, the membrane localized chaperone YidC, which is involved in the assembly of membrane proteins, had impaired growth in a variety of stress conditions including low pH (84, 120) Alkaline generation Some oral bacteria are able to produce ammonia by urease enzymes or the arginine deiminase system (ADS) in response to a drop in pH (120) These organisms are able to convert urea or arginine to produce CO 2 and ammonia. S. mutans lacks ure ase and the ADS pathway, so it is not able to generate alkali as efficiently, but it does possess an analogous system. The agmatine deiminase system (AgDS), which is able to convert agmatine, a derivative of arginine, to produce putrescine, ammonia and CO 2 The AgDS is expressed at relatively low levels and does not appear to cause a significant rise in the pH of the environment, as is seen with

PAGE 28

28 the ADS system ( 72, 73) The ammonia produced from the AgDS in S. mutans may be important in increasing the cytoplasmic pH and generating ATP to extrude protons, especially when the bacteria are faced with an acid challeng e (73, 74) Induction of genes for DNA repair The glycos idic bonds of deoxyribonucleotides are unstable at low pH, so a buildu p in acid can cause loss of purines and pyrimidines from DNA due to protonation of the base followed by the cleavage of the glycosyl bond that leave abasic sites (AP) (132) There is an induction of the DNA repair AP endonucleases which recognize these AP sites in response to low pH (77) Molecular chaperones which are induced for bacteria to cope with different stresses, prevent aggregation and accumulation of improperly folded proteins that may be toxic for the bacteria. In S. muta ns, the molecular chaperones G roEL and D naK are rapidly induced by acid shock (99) and mutants that had low levels of the genes encoding these chap erones had impaired capacity to grow at low pH, and even hydrogen peroxide. The induction of DnaK is maintai ned throughout acidic conditions, and it is proposed that DnaK has a role in the biogenesis of F ATPase (100, 121) There is also the induction of another stress protein, ClpP pept idase, which may be involved in acid tolera n ce b y preventing the accumulation of denatured proteins and modulating the stability of transcriptional regulators (121) Trigger factor R opA is a ribosome associated peptidyl proly cis trans isomerase molecular chaperone that is conserved in most bacteria. Trigger factor in S. mutans is upregulated in response to a deficiency of luxS which affects acid and oxidative stress tolerance and biofilm formation. The expression of ropA was also increased in cells stimulated by the competence stimulating peptide and in populations grown in biof ilms which suggest that it may have

PAGE 29

29 a role in stress tolerance, competence deve lopment, and biofilm formation. Mutants deficient in ropA also had diminished tolerance to low pH and oxidative stress (232) Environmental Stresses in the Oral Cavity and Strategies o f S mutans t o Overcome These Stresses Oxidative Stress Tolerance Oxygen is a critical environmental factor that affects the composition of oral biofilms. E xposure to oxygen severely impaired biofilm formation in S. mutans and altered cell surface biogenesis which may be due to changes in the exopolysaccharide metabolism or in cell to cell adherence (5) S. mutans is a facultative anaerobe and can metabolize oxygen, but it is catalase negative, lacks a complete TCA cycle and respiratory chain, and has a limited capacity to metabolize reactive oxygen spe cies (ROS) Streptococci do not possess cytochromes and do not carry out oxidative phosphorylation. Most of the respiration is carried out by NADH oxidases, which reduce molecular oxygen to oxidize NADH to NAD + and H 2 O 2 (142) S. mutans is constantly exposed to oxidative stress agents. These stresses include ROS from host defenses, peroxide containing oral hygiene products, Fenton chemistry [(1) Fe 2+ + H 2 O 2 Fe 3+ + OH + OH ; (2) Fe 3+ + H 2 O 2 Fe 2+ + OOH + H + ] and the production of hydrogen peroxide by other oral bacteria (118) ROS are generated inside the cell during respiration from single cell electron reductions of oxygen from the host and other oral bacteria Even though S. mutans lacks a catalase enzyme, it does have a superoxide dismutase, NADH peroxidase, glutathione reductase and alkyl hydroperoxide reductase to help cope with oxygen stress (142) NAD H peroxidase can convert NAD H + H+ H 2 O 2 to NAD + + 2H 2 O (142) Iron ions stimulate the generation of toxic ROS such as hydroxyl radicals and hydrogen peroxide from the Fenton reaction Dpr is a member of the iro n

PAGE 30

30 binding protein family, which allows the con centration of free iron ions to be kept low and hence play s an important role for oxygen tolerance by S. mutans (239) There are other genes found in the S. mutans genome that encode proteins belong to the O xyR, P erR and O hrR families that have been implicated in responding to oxidative stress (118) Two Component Systems Two component systems (TCS) are important for S. mutans to monitor and adapt to changing environmental conditions. TCS allow bacteria to modulate gene expression based on a wide variety of environmental signals, such as osmotic shock, pH variations, host pathogen interaction and other stresses (24) TCS consist of a membrane bound histidine se nsor kinase (HK) that detects environmental signals and undergoes autophosphorylation. The other component in TCS is usually a cytosolic DNA binding response regulator (RR) that binds to the promoter regions of genes to alter their expression. The HK domain detects environmental signals which results in autophosphorylation at a specific histidine residue, creating a high energy phosphoryl group that is transferred to a specific aspartate residue within the N terminal half of the cognate RR. Phosphorylation induces a conformational change in the regulatory domain resulting in activation of the RR. The activated RR then regulate s gene expression by acting as a DNA binding transcriptional regulator to activate or repress genes (214) There are fourteen putat ive TCS found in the S. mutans UA159 genome. C omCDE encodes one of the TCS, which are involved in the development of c ompetence, biofilm formation, bacteriocin production and (p)ppGpp metabolism (9, 205)

PAGE 31

31 Quorum Sensing Bacteria can communicate in a cell cell dependent manner through quorum sensing (QS). Quorum sensing bacteria interact with each other by releasing and responding to the accumulation of chemical signal molecules called autoinducers (228) Bacteria utilize these signals to coordinate their behavior on a population wide basis. The first quorum sensing system was described in the bioluminescent organism, Vibrio fischeri (85) In this bact erium quorum sensing is controlled by LuxR and LuxI, where LuxI is the autoinducer synthase that produces an acyl homoserine lactone (AHL). When the signal reaches a critical threshold extracellularly, it is internalized and bound by LuxR and the comple x activates the transcription of the operon encoding luciferase (228) In Gram negative bacteria QS is controlled by small molec ules called auto inducers (AI), which can be AHLs or other molecules whose production is dependent on S adenosylmethionine (SAM) as a substrate (228) AIs are produced intracelluarly and are able to diffuse across the inner and outer me mbranes freely. When the concentrations of AI reach a critical level, they can bind cytoplasmic receptors. The receptors that have AI bound can then regulate genes in the QS regulon. Some Gram negative bacteria are also able to detect AIs by TCS. In Gra m positive bacteria, QS is controlled by TCS s T here are no known regulatory processes that involve the N acyl homoserine lactone like signal molecule (AHL) or the LuxI LuxR system found in Gram negative bacteria (228) The signaling peptides are referred to as autoinducing peptides (A IP). AIPs are produced intrace l lu l arly, processed and secreted, unlike Gram negative bacteria where the AIs are diffusible across the membrane. When the extracellular concentration s reach a critical level they are detected by the HK domain of TCS s to activate the RR and genes

PAGE 32

32 in the QS regulon The LuxS system, which can mediate communication within and between species, is controlled by the luxS gene encoding the autoinducer AI 2. The luxS gene encodes the AI 2 synthetase and is highly conserved across Gram negative and Gram p ositive bacteria and present in about half of the sequenced bacterial genomes (228) LuxS is involved in the catabolism of S adenosylmethionine and co n verts ribose homocysteine into 4,5 dihydroxy 2,3 pentanedione, which is the precursor for AI 2. The luxS gene in S. mutans appears to have an important regulatory role and impacts virulence. Strains that were defective in luxS had impaired biofilm formation compared to the wild type strain (231) and the production of bacteriocins w as affected (154) Some Gram positive organisms such as Bacillus subtilis have two autoinducing peptides that function in a network that allow the organism to commit to either competence or sporulation which are two mutually exclusive lifestyles (228) The competence pathway, which will be described in more detail below, is activated by a secreted factor ComX, that is detected by a histidine sensor kinase ComP, which autophosphorylates the response regulator ComA (141) Phosphorylated ComA regulates the transcription of genes necessary for the development of competence. ComA has an antagonist protein RapC which when bound to ComA inhibits the development of competence (206) Another autoinducer, competence and sporulation factor (CSF) encoded by phrC is secreted and at low internal concentrations CSF binds to the RapC promoter and disrup ts RapC binding to ComA thus promoting the development of competence (206) At high levels, CSF inhibits the ComP ComA signaling cascade through an unknown mechanism, decreasing the development of

PAGE 33

33 competence and p romoting sporulation. So the same CSF signal can cause the bacteria to commit to either competence or sporulation depending on its internal concentration. In S. mutans the induction of competence is one of the main QS systems and is controlled by the accu mulation and sensing of peptides by the ComCDE TCS system described below Biofilm formation, the acid tolerance response and bacteriocin production are controlled by quorum sensing as well. Genetic Competence Some bacteria encode genetically programmed m achinery to take up DNA from their environment, which is known as genetic competence The phenomenon was first described by Griffith in 1928 where he observed that he could transfer a virulence factor from a virulent strain to an avirulent strain of Strep tococcus pneumonia e The s ubstance extracted f rom S. pneumoniae isolated from diseased mice was able to change the morphology of an avirulent strain (71) Avery et al. noted that the substance was DNA (17) Genetic competence and DNA uptake have been linked to adaptation and survival by providing resources a nd increasing genetic diversity in bacterial species. Competence has been shown to increase the survival of S pneumonia e when challenged with an antibioti c stress and the induction of competence is also regulated by increased frequency of translations e rrors (61, 213) In S. pneum onia e, one of the better studied model organisms for the regulation of competence, the competence regulon is controlled in a quorum sensing like manner, mediated by a 17 aa peptide signaling molecule called competence stimulating peptide (CSP) (87, 144) CSP is derived from C omC which is a 45 aa protein that is processed post translationally. ComC is exported by an ATP binding cassette transporter ComAB,

PAGE 34

34 which cleaves the leader peptide after the Gly Gly motif to the processed 17 aa peptide CSP (94) CSP is sensed by the TCS system consisting of comD which encodes the histidine kinase sensor and come, which encodes the response regulator (176) ComE controls the expression of comX which encodes an alternative sigma factor (114) potentially through a direct interaction at the ComE binding site present within the comX promoter. The C omX alternative sigma factor is able to activate genes that have the comX box consensus sequence i n their promoter region These genes include the late competence genes encoding proteins involved in DNA uptake and internalization such as comYA (136, 138) ComW was identified as another factor that plays a role in regulating competence by controlling the stabilization and activation of ComX. ComW prevents ClpP dependent degradation of ComX, thereby activating competence (144) ComW is also believed to activate the competence pat hway through unknown mechani sms. The genes encoding the proteins involved in DNA uptake are considered late competence genes and include comEA comFA the comYA operon and the genes encoding the proteins involved in the processing of internalized single stranded DNA such as coiA re cA and ssbB (53, 112) In Gram positive bacteria the ComG proteins span the cell wall and form the assembly of a pseudopilus and ATPase. In S. mutans comG is part of a nine gene operon with comYA that make up the genes encoding the proteins for forming the pseudopilus (52) Disassembly of the pseudopilus opens a cell wall channel and enables dsDNA to diffuse from the surface to the DNA binding protein, ComEA, which is found in the cytoplasmic membrane (112) In S. pneumoniae and B. subtilis dsDNA is bound preferentially over ssDNA and has about 200 fold higher

PAGE 35

35 transformation activity in S. pneumo niae for reasons that are not completely understood (45) Once the dsDNA is bound fragmentation of the dsDNA to ssDNA by EndA occurs (52) and ssDNA fragments are transported across th e membrane and the non transported strand is degraded (45) A highly conserved cytoplasmic membrane c hannel ComEC, which is present in all known competent bacteria, enables the transport of ss DNA across the cytoplasmic membrane. The ComFA protein is a DEAD box helicase that is involved in DNA translocation into the cytoplasm in B. subtilis (112) Other proteins such as DprA are involved in protecting the ssDNA from endonucleases and o ne of the putative functions of SsbB is to prevent back diffusion by binding the ssDNA (15) The RecA protein is required for recombination of the ssDNA. The CoiA protein is also a late competence protei n that is implicated in DNA uptake i n S. pneumonia e (54) Plasmid DNA that has no homologous regions to the transform ing bacteria is still transported and processed the same as chromosomal DNA in s treptococci However, it requires recirculization which makes it less efficient to transform compared to chromosomal DNA (52) In S. mutans, competence biofilm formation and stress tolerance have been intimately linked Mutations in the genes of the competence pathway caused attenuated virulence and reduced cariogenicity in rodents (130) and similar mutations in the competence pathway caused reduced biofilm formation (129, 178) The competence pathway in S. mutans has some si milarity to the competence pathway in S. pneumon ia, but the comCDE genes in S. mutans appear to have evolved from a different ancestral gene and appear to be more closely related to genes in S. pneumonia e and related organisms that control the production of bacteriocins (144) I n

PAGE 36

36 fact, the ComCDE system has been shown to regulate the bacteriocins (which are described in more detail below) (110) Additionally there are no ComE binding sites in the promoter region of comX and studies thus far indicate there is no direct binding of ComE to the comX promoter (95) so the precise mechanism of the ComDE dependent regulation of comX and competence is enigmatic. The active form of CSP is considered a 21 mer (128, 130) H owever, a processed 18 aa peptide form that has 3 amino acids cleaved is more active in inducing competence (177) Recently, it has been shown that a membrane associated protease SepM is responsible for the final processing of the 21 mer to the 18 mer form (93) There are also other signals and factors that influence competence d evelopment and DNA uptake in S. mutans many of which are unknown (Figure 1 1 ). In Streptococcus thermophilus a C omR/S system which consists of an Rgg type regulator and autoregulatory peptide ComS, was shown to be the main regulator of comX (66) Morrison et al. identified a similar C omR/S system in S. mutans and Streptococcus pyogenes (149) and it has been shown that ComRS acts as the proximal regulator of comX in these s treptococci. The C omR regulator is required to activate comX and induce competence through an autoregulatory signal, c om X i nducing p eptide (XIP), which is processed from the ComS protein The comS gene is located immediately downstream of comR ComS is a 17 aa precursor that is exported through unknown exporters, but is processed extracellularly to the heptamer XIP XIP is imported through the OPP permease and complexes with ComR to regulate comX and activate competence. ComR activated by XIP c an regulate comS to induce an autoregulatory feedback loop. The Morrison group showed that the promoter activity of

PAGE 37

37 comX required both XIP and comR (149) They could no t detect comX promoter activity in strains that had comS or comR mutated. Khan et al. were able to identify the heptamer XIP in late exponential phase culture supernates of S. mutans that were grow n in defined media further demonstrating that the p rocessed heptamer is generated (105) There is a comX consensus sequence present in the promoter regions of both comR and comX suggesting that there is direct interaction of ComR with the promoter region of comX. A recent publication show s that ComR is able to bind to the promoter of comS and com X in the presence of XIP and other peptides in S. thermophilus (67) A potential ComR binding site was also identified in the promoter region of comX and comS in S. mutans Of note, the m utan s group is the only Streptococcus group t o have both the ComCDE and ComRS system The other competent s treptococci either have the ComCDE system or the ComRS system exclusively (86) In fact, the two systems are acti vated in different conditions in S. mutans T he ComCDE and CSP pathway is able to activate comX and competence in rich medium, w hereas the ComRS pathway and XIP are active in chemically defined media (55, 207) This further demonstrates that the competence pathway in S. mutans is regulated by dive rse signals and environmental conditions. Othe r pathways that control competence in S. mutans include t he serine protease HtrA which has a negative effect on competence, but these effects can be suppressed by the addition of CSP to cultures (6) In S. pneumonia e the negative effects o f HtrA on competence could be attenuated when there is an increased frequency of translational errors and misfolded proteins (213) It was hypothesized that the structure of CSP resembled misfol d ed proteins and thus beco me s a target for HtrA (63) causing a

PAGE 38

38 negative effect on competence The addition of excess CSP was able to over come the negative effects of H trA degr adation. Ahn et al. also showed that the d evelopment of competence and the genes in the competence pathway are influenced by the CiaRH two component system and may be regulating competence through unknown mechanism s (8) Deletions in ciaRH cause d loss of transformability and affected the expression of some of the genes in the competence pathway. The late competence genes in S. mutans such as comYA are also under the influence of the IrvR and IrvA transcriptional regulators, which act independently of comX and are dependent on the cell density of the population. IrvR is a transcriptional regulator that represses the expression of irvA which encodes another transcriptional regulator that directly r epresses the late competence genes (167) So the IrvA and IrvR regulators serve as another mechanism of control of competence in S. mutans Other factors, including the VicRK TCS, HdrMR also influence transformation effici ency and com gene expression in ways that have not been completely elucidated (200) Bacteriocin s and Immunity Proteins Bacteriocins are ribosomally produced antimicrobial peptides produced by some bacteria, to compete against bacteria of similar species for common resources (48) Unlike other antibiotics such as penicillin and tetracycline, bacteriocins have a relatively narrow sp ectrum. Most bacteriocins are very potent and can exhibit antibacterial activity at nM concentrations. In Gram positive bacteria, bacteriocins are pore forming and are generally classified into two classes, lantibiotics (class I) and non lantibiotics (cl ass II) (49) The lantibiotic group usually interacts with lipid II and inhibits cell wall synthesis whereas the non lantibiotic group disrupts membrane potential and causes essential molecules to escape (166) L antibiotics contain post translationally modified

PAGE 39

39 residues and are characterized by dehydrat ed amino acids and intramolecular thioether bonds that create lant h ionine and methyllanthionine residues within the bacteriocin molecule. Lantibiotics are very stable and highly resistant to inactivation under a wide range of environmental stresses (166) The lantibiotics may be further classified based on their tertiary structures such as Type A, which are linear or Type B wh ich are globular. The type A lantibiotics kill susceptible cells primarily through membrane pore formation. Non lantibiotics consist of non modified residues except the presence of disulfide bridges. The non lantibiotics group is further divided; the Cl ass IIa, IIb, IIc and IId bacteriocins. The Class IIa bacteriocins contain an N terminus consensus sequence (YGNGVxCxxxxCxVxWxxA). Class IIb consist s of bacteriocins whose activity is dependent on the action of two different peptides. Class IIc bacterio cins are cyclic bacteriocins with a ring structure formed in a head to tail manner. The Class IId bacteriocins consist of linear non pediocin like one peptide bacteriocins (49) Bacteriocins produced by S. mutans are usually referred to as mutacins (79) an d may help it compete against other oral streptococci in early dental plaque and maintain colonization of the tooth surface (155) The mutacins are from both the lantibiotic and non lantibiotic group but are primarily from the non lantibiotic group (11, 103) The lantibiotic mutacins have a wide spectrum against Gram positive bacteria and the non lantibiotic group is primarily active against closely related species The lantibiotic group of mutacins can be divided into mutacin I, II and II (89, 186) whereas the non lantibiotic group are mutacins IV, V, VI and N (19, 78, 185, 237) and are present in every S. mutans strain analyzed thus far (155) One of the main identifying features is the presence of a conserved peptide leader region with a glycine glycine motif. The non

PAGE 40

40 lantibiotic group is primarily controlled in a quorum sensing like manner and is regulated by the ComCDE pathway, whereas the lantibiotic mutacins are probably regulated by the ScnRK like sensory system. The non lantibiotic bacteriocins and the regulation of compe tence have considerable overlap. Dufour et al. hypothesized that the non lantibiotic bacteriocin CipB functions as a regulator for the transcription of genes in the competence pathway and a cipB mutant was poorly transformable (57) In addition, some of the mutacins were shown to be activated by CSP which included the gene encoding CipB (110, 175, 225) Cvitkovitch et al. show that purified ComE protein is able to interact with the promoter of a number of bacteriocins which inc lude nlmAB and nlmD (95) There are other proteins such as HdRM and BrsRM, which are referred to as LytTR regulatory systems that regulate mutacin production independently of C omCDE (168) The LytTR systems consist of a membrane bound protein inhibitor that antagonizes the activi ty of an associated LytTR family transcriptional regulator (R). T he mutacins are influenced by environmental cues such as nutrient availability and oxygen T ranscriptional analysis shows that the bacteriocins are the most upregulated genes in response to aeration (7) To prevent the bacteria from killing themselves with their own bacteriocins, the organism ha s genes encoding bacter iocin immunity proteins ( BIPS ), often found in the same operon or downstream of the bacteriocin encoding gene In general, BIPS act specifically towards their cognate bacteriocin (166) The mechanisms for conferring immunity are not clear and there appears to be a variety of ways in which immunity proteins can act. For class II bacteriocins, transporter proteins that can extrude the

PAGE 41

41 bacteriocins seem to also be involved in conferring immunity. For example immunity to nisin is confe rred through the sequestering of the bacteriocins and expulsion through ABC exporters (189, 211) Some BIPS bind to the bacteriocin receptor complex to block pore formation by the bacteriocins (169) In S. mutans the BIPS affect antimi cr o bial sensitivity (150) There is also the induction of the gene encoding an immunity protein CipI, in response to high levels of CSP to protect the cells agai nst C ipB, which is also induced in response to high levels of CSP (1 75) Nutrient L imitation and (p)ppGpp P roduction During periods of amino acid starvation, the re is an induction of the stringent response, which involves the accumulation of the nutritional triphosphate (pppGpp or GP5) bispyrophosphate (ppGpp or GP4) collectively known as (p)ppGpp (40) ( P )ppGpp is synthesized by enzymatic phosphorylation of GDP or GTP from ATP [ (197) (Figure 1 2 ] The induction of (p)ppGpp synthesis is important in regulating the physiology and metabolism of bacteria that are sensitive to constantly changing environments (183) In the absence of this functional stringent response there is an increase in translational errors and the limited energy resources are rapidly depleted The accumulation of (p)ppGpp alters the expression of a large number of genes in bacteria by downregulating genes for macromolecular biosynthesis while upregulating genes for protein degradation, amino acid biosynthesis and stress tolerance (22, 23, 190, 218, 223) Therefore, the accumulation of (p)ppGpp is important in maintaining genomic stability by inhibiting DNA replication and serves as a mechanism to limit excessive protein synthesis during nutrient limitations until favorable condition s are restored (218) In E scherichia coli (p)ppGpp helps maintain genomic integrity by resolving conflicts between replication

PAGE 42

42 and transcription, by stalling RNAP in concert with DksA (108) and by inhibiting primase which is essential for the DNA replication machine ry (226) The induction of (p)ppGpp also inhibits translation by repressing transcription of tRNA, rRNA and ribosomal proteins The accumulation of (p)ppGpp causes a reduction in GTP levels and an increase in ATP levels. The reduction in GTP levels occurs through the inhibition of IMP dehydrogenase by (p)ppGpp, which is the first enzyme in GTP biosynthesis. This leads to an incre ase in IMP, a precursor for ATP synthesis resulting in elevated levels of ATP. GTP and ATP are well known gauges for th e energy capacity of the cell and one group demonstrated in B. subtilis that the position of either an adenine (A) or guanine (G) at t he transcriptional start site determined the regulation of a gene by (p)ppGpp accumulation (222) Since the levels of ATP are increased during a (p)ppGpp induced stringent response, the genes where transcription started with an A were positively regulated by (p)ppGpp levels, whereas those that started with G were negatively regulated by (p)ppGpp pools. Interestingly, some of these genes involved in positive regulation by (p)ppGpp accumulation and started with A were those invol ved in branched chain amino acid synthesis, whereas genes involved in energy metabolism were under negative regulation by (p)ppGpp levels (222) CodY is a GTP sensing global nutritional repress or that is highly conserved in F irmicutes. In B. subtilis CodY regulates branched chain amino acid operon expression, and there have been reports that show a connection between CodY and (p)ppGpp levels (96) The reduction of GTP levels during a stringent response is sensed by CodY, and causes its deactivation leading to de repression of genes such as

PAGE 43

43 the BCAA operon (96) However, in S. mutans inactivation of the (p)ppGpp s y n thetase enzymes did not alleviate CodY repression (124) Enzymatic C ontrol of (p)ppGpp M etabolism In G ram negative bacteria, there are two enzymes responsible for controlling (p)ppGpp production : a synthetase enzyme called RelA and a hydrolase enzyme called SpoT with weak synthetase activity (70, 183) (Figure 1 2). RelA synthetase enzy me activity is induced by the binding of uncharged tRNAs to the ribosomal A site during amino acid starvation (83, 147) The cell is able to sense the inability of tRNA aminoacylation to keep up with protein synthesis as is seen in amino acid starvation or inhibi t ors of aminoacyl tRNA synthases SpoT appears to be responsible for basal (p)ppGpp pro duction and (p)ppGpp degradation, but is responsible for (p)ppGpp synthesis in response to other stresses such as fatty acid starvation or carbon source starvation (201) Bacteria need to balance the levels of (p)ppGpp to regulate growth; an overproduction of (p)ppGpp inhibits growth by inducing a stringent response while too little production (p)ppGpp impairs the ability of the cells to respond effectively to nutritional s tresses. B oth the N terminal and C terminal domain s of Rel/SpoT enzymes (RSH) enzymes are responsible for regulation of enzyme activity particularly, the C terminal domain, which is involved in oligomerization and regulation of the RelA protein (75) The catalytic sites of monofunctional RelA enzymes have a conserved acidic triad of residues ExDD (183, 194) In most G ram positive bacteria there is a single bi functional RelA enzyme which has both (p)ppGpp synthetase and (p)ppGpp hydrolase activity (158, 195) T he RelA enzyme is regulated by conformational switching between synthetase on/hy drolase off and synthetase off/ hydrolase on states (91) Unlike t he monofunctional RelA enzyme

PAGE 44

44 found in Gram negative bacteria, the bifunctional RelA enzyme found in Gram positive bacteria ha s a conserved basic RxKD triad in its synthase catalytic site. The N terminal domain of the bifunctional RelA protein has both sy nthase and hydrolase activity (98) The C terminal domain plays a role in regulation through interaction with the N terminal domain so that only one activity remains on w hile the other is switched off and deletions in the C terminus resulted in higher synthase activity (153) It appears that the function of RelA is not dependent on ribosome s and uncharged tRNAs like the Gram negative RelA enzyme but the presence of uncharged tRNAs upregulates the activity of t he enzyme (16, 152) R ecently it has been shown that S. mutans has two additional (p)ppGpp enzymes, RelP and RelQ, which have synthetase domains but no hydrolase domain s (122) (Figure 1 3 ) Subsequent ly homologues of R elQ and R elP were found in B. subtilis (163) and i dentified in ot her s treptococci and other Gram positive bacteria (122) In Enterococcus faecalis the RelQ homologue appears to be linked to vancoymycin resistance, where the relQ mutant was more sensitive to vancomycin than the parental strain (1, 106) In S. mutans t he r elQ operon is cotranscribed with other gene s, ppnK pta and rluE whose products are involved in acetate metabolism in the TCA cycle The p pnK gene encodes an NAD k i nase, rluE encodes a psuedouridine synthetase and pta encod es a phosphotransacetylase. Deletions of the various genes in the relQ operon caused the cells to grow slower than the parental strain in oxidative and acid stresses The accumulation of (p)ppGpp was also d ecreased in the pta mutant, whereas higher levels of (p)ppGpp accumulation wer e seen in the mutant (106) RelP appears to be responsible for the bulk of the (p)ppGpp production under non stringent conditions, whereas RelA is required for a mupiro cin induced stringent

PAGE 45

45 response (123) Of note, relP is part of an operon encoding a TCS, called relRS and a mutant lacking the relRS genes grow s faster than the wild type strain (122) The accumulation of (p)ppGpp by R elPRS plays a significant role in growth control of S. mutans and is regulated by different environmental signals than RelA. It appears that S. mutans has a different mechanism of regulating (p)ppGpp production from other bacteria by combining intracellular and extracellular signals through a TCS and multiple synthetases In order for S. mutans to survive and thrive in the hostile and variable conditions of the oral cavity, one hypothesis suggests that (p)ppGpp modulation through RelPRS is a mechanism for S. mu tans to sense environmental signals to limit growth and balance the production of storage compounds. However, much is still unknown about how these two novel synthetases are regulating (p)ppGpp production in S. mutans Summary Comparisons of the transcri ptional profiles of S. mutans growing with aeration versus anaerobically revealed that many genes are regulated by oxygen or redox potential, including bacteriocin encoding gen e s comX and relP (7) and the SMu0835 SMu0839 gen e cluster (Oralgen database http://www.oralgen.lanl.gov ) (SMU.921 SMU.925 GeneBank Locus tag) located immediately upstream of relP In addition, our lab reported that the uncharacteri zed SMu0835 837 genes were up regulated in response to mupirocin treatment in a (p)ppGpp dependent manner (164) identifying a possible connection of this gene cluster to (p)ppGpp and stress tolerance Given the importance of (p)ppGpp metabolism competence and stress pathways in the regulation of critical homeostatic and virulence pathways in S. mu tans and the potential regulatory overlap of relP and SMu0835 0839 we investigated the role of the

PAGE 46

46 S M u0835 0837 gene cluster in growth, (p)ppGpp metabolism, stress tolerance and genetic competence (199) Specific Aims Assess the role of the SMu0835 0839 gene cluster in growth, biofilm format ion and stress tolerance. Identify the basis for regulation of relPRS and the effect s of SMu0835 0837 on relPRS and (p)ppGpp levels. Determine the role of the SMu0835 0837 on the competence regulon Some of the work presented here has already been published by the author of the dissertation, Kinda Seaton in the Journal of Bacteriology.

PAGE 47

47 A) B) Figure 1 1. Comparison of the competence pathways between Strepto cocc us pneumonia e and Streptococcus mutans A) Competence pathway in Streptococcus pyogenes B) Competence pathway in Streptococccus mutans

PAGE 48

48 Figure 1 2 Schematic showing the regulation of (p)ppGpp by RelA and SpoT in Gram negative bacteria RelA can synthesize the production of (p)ppGp p from GDP or GDP and ATP. SpoT can hydrolyze (p)ppGpp to GDP or GTP.

PAGE 49

49 Figure 1 3 Schematic of the genes encoding the three (p)ppGpp enzymes in S. mutans

PAGE 50

50 CHAPTER 2 MATERIALS AND METHODS Growth C onditions Escherichia coli strains were grown in Luria broth supplemented with 1 ) or ampicillin (100 g ml 1 ), when necessary. E. coli strains were grown at 37 C with continuous shaking at 250 rpm S. mutans UA159 and its derivatives were maintained in brain heart infusion (BHI) medium (Difco Laboratories, Detroit, MI ) supplemented with kanamycin (1 mg ml 1 ), spectinomycin (1 mg ml 1 ) or 1 ) w hen necessary at 37 C in a 5 % CO 2 atmosphere. For biofilm assays, a semi defined biofilm medium (BM) (135) supplemented with 10 mM sucrose or 20 mM glucose was used. For (p)ppGpp accumulation as says, a chemically defined medium FMC (221) supplemented with 0.3 % glucose was used. Growth Assays For growth studies, cultures were gr own overnight in BHI broth at 37C in a 5% CO 2 atmosphere with antibiotics when appropriate then diluted 1:50 into fresh BHI broth and grown to mid exponential phase (OD 600 = 0.5). The cultures were then diluted 1:100 in 350 well plates, overlaid with sterile mineral oil and placed in a Bioscreen C growth monitor (OY Growth Curves AB Ltd., Helsinki, Finland) at 37C. The optical density (OD 600 ) was measured every 30 min for 24 hours with shaking for 1 0 s before each reading. Lo w pH To assess the ability of the mutants to grow at low pH, cells were grown overnight in BHI broth with appropriate antibiotic s when necessary for mutants diluted 1: 5 0 into fresh BHI and grown to mid exponential phase at 37C in a 5% CO 2

PAGE 51

51 atmosphere. The cells were then diluted 1:100 in BHI broth that was acidified to pH 5.5 with HCl, 350 l of each sample was added to multi well plates, with a sterile mineral oil overlay and growth was monitored in a Bioscreen C. Oxidative stress When effects of air on growth were assessed, no miner al oil overlay was utilized. For analysis of oxidative stress tolerance, the cells were grown to OD 600 = 0.5 in BHI b roth at 3 7 C in a 5% CO 2 atmosphere. The cultures were then diluted 1:100 in BHI broth c ontaining 25 mM paraquat (methyl viologen; Sigma Aldrich, St. Louis, MO ) or 0.003 % hydrogen peroxide each well was overlaid with sterile mineral oil and growth was monitored in a Bioscreen C. Growth in CSP To analyze growth in CSP, the procedure describe d above was used. When the cells reached OD 600 = 0.5 in BHI broth, the cultures were diluted 1:100 in BHI broth co (174) (97 % purity) overlaid with sterile mineral oil and growth monitored in the Bioscreen C. Biofilm Assays S. mutans strains were grown to mid exponential phase in BHI broth at 37C in a 5% CO 2 atmosphere. The cells were diluted 1:100 in BM supplemented with eith er 20 mM glucose or 10 mM sucrose and transferred to polystyrene microtiter plates. The cells were incubated in a 5% CO 2 atmosphere at 37C for 24 or 48 h. The medium was decanted emove planktonic and loosely (8:2 ) solution twice. The extracted dye was diluted into 1.6 ml of ethanol:acetone solution. Biofilm formation was quantified by measuring the absorbance of the solution at OD 575 nm.

PAGE 52

52 DNA Manipulation and Construction of Mutants Plasmid DNA was isolated from E. coli using the QIAprep Spin Plasmid Kit (Qiagen Inc., Valencia, CA). Cloning was carried out using established protocols (196) Restriction and DNA modifying enzymes were purchased from Life Technologies Inc. (Rockville, MD) or Ne w England Biolab (Beverley, MA). PCR Ligation: Insertion Mutagenesis A series of mutant strains (Table 2 1) w as derived from S. mutans UA159 using polar (NPKm) kanamycin resistance cassette to replace the genes (8) P rimers were used to amplify the regions flanking the genes of interest (Table 2 3 ). T he PCR products and pALH123 or omega Km (Table 2 2 ) when desired, were digested with Bam HI and ligat ed. The ligated mixture was transformed into competent S. mutans (Figure 2 1). Transformants were selected on BHI agar with 1 mg ml 1 kanamycin. Screening for mutants was done via PCR using A and D primers (Table 2 3 ) to observe for the correct size on 0.8 % agarose gels. Colonies that had the corr ect size were restreaked on fresh BHI agar plates with 1 mg ml 1 kanamycin DNA sequencing using prim ers outside the region of cloning (Table 2 3 ) was done to ensure that the correct mutation had been introduced and that no secondary mutations were created in the genes immediately upstream or downstream of the insert ion site during recombination. Splice Overlap Extension Mutagenesis A series of mutant strains (Table 2 1 ) w as derived from S. mutans UA159 using splice overlap extension (SOE) to make point mutations in different regions (90) Briefly, primers with the desired ba se changes (Table 2 3 ) and primers that matched a sequence located 0.5 kb p upstream and downstream of t he sequence of interest were

PAGE 53

53 used to amplify DNA and generate two P CR products (Figure 2 2 ). Selected pairs of PCR products with 20 bp identity that included the desired mutations were subjected to PCR for 5 cycles in the absence of added primers A second PCR of 30 cycles using the A and D outer primers (Table 2 3 Figure 2 2 ) was performed to generate a 1 kbp product that had the desired muta tions The final PCR product was run on a n agarose gel to ensure correct size then the fragment was excised gel purified (Qiagen) and transformed into competent S. mutans with a suicide plasmid harboring an internal fragment of the lacG gene and an eryth romycin (Em) resistance (Em r ) determinant (242) Transformants were selected on BHI agar with erythromycin. Mismat ch Amplification Mutation Assay (MAMA) PCR was done to screen for isolates that have the desired mutations (41) The MAMA PCR reactio n included 20 n M of a primer th at can only amplify wild type DNA, along with 10 nM of the A primer and 30 nM D primer (Table 2 2 ). If the desired mutation is present, then a longer product (~ 1kb ) will be made, but if the wild type is present a shor ter PCR product (~0.5kb ) is made (Figure 2 3) PCR products were run on an agarose gel and isolates that had the correct size were restreak e d. DNA sequencing was used to ensure that the correct mutation had been introduced and that no mutations were cre ated in the genes immediately upstream or downstream of the insert ion site during recombination. Complementation To complement some of the mutations made in the rcrRPQ operon, the genes that were mutated were am plified from a wild type strain. The amplified DNA was cloned into the pDL278 vector and introduced into the mutant strains. A PCR amplification of the ATG start codon and 50 of the stop

PAGE 54

54 codon of the gene was generated from the wild type strain (Table 2 3 ) of the ATG start codon were included to ensure all the regulatory e lements including the promoter and transcription initiation site were present. The PCR product and the pDL278 plasmid w ere digested with Bam HI and Sac I. The digested PCR product and plasmid were gel purified with a Qiagen DNA purification kit, ligated and transformed into appropriate S. mutans strains. Transformants were selec ted on BHI plates containing 1 mg ml 1 of spectinomycin. The isolates were screened using primers specific to pDL278 and run on an agarose gel to check for the correct size and presence of the insert. Colonies with the correct size were sequenced to ensure that complementation of the gene(s) was correct. For strains that had severely impaired transformation efficiency, the complementation and mutagenesis of the genes were done concurrently and plated with 1mg ml 1 kanamycin to select for the presence of the kanamycin resistance cassette and 1 mg ml 1 spectinomycin to select for the complementation on the plasmid. DNA sequencing was done to verify the integrity of the strains. Construction of Promoter Fusions For construction of the CAT strains, various DNA regions containing 350 bp and 150 bp u pstream of the ATG start site which included t he promoter regions of the SMu0835 and relP genes were amplified via PCR. The PCR products along with the pJL105 plasmid were digested with Sac I and Bam HI and purified using a Qiagen Gel purification kit The digested PCR products were ligated with the digested pJL105 integration vector, which has a staphylococcal chloramphenicol acetyltransferase gene ( cat ) gene that lacks a promoter and ribosome binding site (RBS) (243) The pJL105 vector has sequence homology to the mtlA and phnA genes, which facilitates double

PAGE 55

55 cross over recombination and integration of the inserted DNA in single copy in the S. mutans chromosome. The cat promoter fusions were transformed into wild type and mutant strains of S. mutans and plated on BHI agar plates containing 1 mg ml 1 spectinomycin. T he integrity of the st rains was verified by PCR and DNA sequencing. For construction of the LacZ strains, a similar technique was used as described above f or constructing the CAT strains. H owever the promoter regions were cloned in to the pMZ integration vector which carries a staphylococcal beta galactosidase gene ( lacZ ) gene that lacks a promoter and ribosome binding site (RBS) (243) The vector also has homology to the mtlA and phnA genes which also facilitates double cross over recombination and integrat ion of inserted DNA (133) The lacZ pr omoter fusions were transformed into S. mutans and plated on BHI plates containing 1 mg ml 1 kanamycin. The integrity of the s trains w as verified using PCR and DNA sequencing. Transformation Assays. Overnight cultures were diluted 1:20 in 200 l of BHI broth in polystyrene microtiter plates. The cells were grown to OD 600 = 0.15 in a 5% CO 2 atmosphere. When desired, 100 nM of synthetic competence stimulating peptide (CSP ) (8) was added, cells were incubated for 10 min and 0.5 g of p urified plasmid pDL278, which harbors a spectinomycin resistance (Sp r ) gene, was added to the culture. After 2.5 h incubation at 37C, transformants and total CFU were enumerated by plating appropriate dilutions on BHI agar plates with or without the add ition of 1 mg ml 1 spectinomycin, respectively. CFU were counted after 48 h of incubation and transformation efficiency was expressed as the percentage of transformants among the total viable cells. In some cases, these experiments were repeated with pMSP3535 (E m r ) and JL105 (Sp r ) to

PAGE 56

56 assess the ability to uptake various types of plasmid DNA and to analyze homologous versus non homologous recombination. Measurement of (p)ppGpp A ccumulation The measurement of a ccumulation of (p)ppGpp in S. mutans was done as described elsewhere (122) Briefly, cells from an overnight culture were diluted 1:25 into the chemically defined medium FMC to OD 600 = 0.2. Cells were labeled with 32 P orthophosphate for 1 hour at 37C, harvested, and (p)ppGpp was extracted with formic acid (122) If desired, 0.003% hydrogen peroxide was added to the s amples at the same time as the label. To harvest the labeled cells, the samples were centrifuged at 1400 x g for 2 min and the supernates decanted. The cell pellets were then washed with 32 P orthophosphate To extract t he (p)ppGpp, the each), followed by a series of 3 free thaw cyc les on a dry ice/ethanol and thaw 42 C bath and the cells centrifuged at 1000 x g Following the extraction, supernatant fraction was measured in a scintillation counter and 2.0 x 10 5 CPM of each sample was spotted onto polyethyleneimine (PEI) cellulose plate (Selecto Scientific Suwanee, GA ) for thin layer chromatography (TLC). Solutes were resolved using 1.5 M KH 2 PO 4 buffer that had been acidified to pH 3.4 w ith phosphoric acid. Labeled compounds were detected by exposing the PEI plate with a maximum sensitivity film (Kodak Rochester, NY ) overnight at 80 C (122) The accumulation of GP4 and GP5 was qua ntified using th e AlphaEase FC Fluorochem 8900 (Alpha Innotech, USA) Imaging System Spot Denso Analysis tool. The density of the spots was quantified as integrated density value per area (IDV).

PAGE 57

57 RNA Manipulation RNA Extraction Three colonies from each strain were grown overnight in BHI broth, diluted 1:50 in fresh BHI, grown to OD 600 = 0.5 harvested and immediately treated with RNAprotect reagent from Qiagen (Qiagen Inc., Valencia, CA). Total RNA was extracted using phenol (pH 4.3) (1), DNaseI treated and further purified with the RNeasy mini kit (Q iagen Inc., Valencia, CA ). RNA concentration was measured in tripli cate using a spectrophotometer and run on a gel to assess integrity. qRT PCR Real time PCR was done as detailed by Ahn et al (6) P used to generate cDNA from gene specific primers according to the Superscript III first strand synthesis (Invitrogen Gaithersburg, MD ) reverse transcription protocol. The gene specific primers were designed with Beacon Designer 4.0 software and standard curves for each gene were prepared (Table 2 4) The standard curve was generated using eight 10 fold serial dilutions of the PCR products to determine the starting amount for each cDNA template, based on its threshold cycle. The concentrations of purified PCR products were measu red at OD 260 and the copies/ml for standard curves were calculated according to the formula: copies/ml = (6.023 x 10 23 x C x OD 260 ) / MWt where C = 5 x 10 5 g/ml for DNA and MWt = the molecular weight of the PCR product (base pairs x 6.56 x 10 2 g). The standards were prepared in the concentrations of 10 8 copies/l. Triplicates of each cDNA sample along with cDNA controls for each of the triplicate isolates analyzed were subjected to Real time PCR. Real Time PCR reactions were carried out using an iCycler i Q real time PCR detection system (Bio Rad Hercules, CA ) and iQSYBR green supermix (Bio Rad) according to the protocol

PAGE 58

58 provided by the supplier. The thermocycling program was set for 40 cycles of 95C for 10 s and 60C for 45 s, with an initi al cycle at 95c for 30 s. The accumulation of PCR products was detected after each cycle by monitoring the increase in fluorescence of the reporter dye from dsDNA binding SYBR green. Data w ere collected and analyzed using the software and graphics provi ded by iCycler iQ. Semi quantitative Reverse Transcriptase PCR Reverse Transcriptase PCR (RT PCR) was done using gene specific real time p rimers (Table 2 4 ) on 1 g of RNA that was purified as des cribed above. A PCR reaction of 25 cycles was performed on the cDNAs generated using various combinations of primers (Table 2 4 ) to analyze the different transcripts made in the SMu0835 0839 gene cluster. A positive control using wild type chromosomal DNA and the same primer sets was also used. The PCR reactions were run on a 0.8% agarose gel to analyze size and quantity. RNA Sequencing The RNA sequencing protocol and analysis described bel ow was published by Lin Zeng et al. seq in Streptococcus mutans In Press ) T otal RNA was isolated and purified from the various strains as described above (Qiagen). To remove 16S and 23S rRNAs, 10 g of high quality total RNA was processed using the MICROB Express TM Bacterial mRNA Enrichment Kit (Ambion of Life Technologies, Grand Island, NY), twice, before precipitating with ethanol and resuspending in 25 l of nuclease free water. The fin al quality of enriched mRNA samples was analyzed using an Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA). cDNA libraries were generated from the enriched mRNA samples using the

PAGE 59

59 TruSeq Illumina kit (Illumina, San Diego, CA), following instructi ons from the supplier. Deep sequencing was performed at the Cornell University Life Sciences Core Laboratories Center (Ithaca, NY) Short Read Alignments Approximately 20 million short reads were obtained for each sample. Because the aligner BWA (125) allowed a few gaps for efficient alignment of millions of reads of approximately 100 bp, shorter reads consisting mostly of sequencing adapters would not be mapped. After removing adapter sequences from each short read (146) and ends by quality scores (198) the resulting sequences were mapped onto the reference genome of strain UA159 (GenBank accession no. AE014133) using the short read aligner. Mapped short read alignments were then converted into readable formats using SAMTOOLS (126) Transcript Predictions RNA transcripts were inferred by applying a hidden Markov mode l to site wise expression levels (145) A pileup command of BWA was used to convert the short read alignments into pileup values, which were ta ken as the site wise expression levels along the genome. Site wise expression levels are a list of non negative integers that represent numbers of short reads mapped to a particular genomic position. For the transcript inference program, ParseRNAseq, the c 10 b 25 states for relative expression intensity. Genes that were annotated in close proximity were used as the predicted parts of a transcri pt, while no information regarding the precise transcription initiation or stop sites were pursued in this study. For similar reasons, the orientation of each transcript could not be verified solely based on RNA

PAGE 60

60 seq data; instead we used the information o f annotated genes to determine the strandedness of predicted transcripts. Prediction of S mall RNAs and T argets Although our RNA seq protocol did not specifically enrich non coding small RNAs in the cDNA preparation, small RNAs were retained in the RNA sam ples as only ribosomal RNAs were depleted using specific oligonucleotides. Consequently, it was difficult to discriminate cDNA originated from small non coding RNAs from that of mRNAs, as expression of non coding RNA is often masked by the expression of ne ighboring background mRNAs. Therefore, we utilized RNAz (76) a program that uses homologous sequences and RNA secondary structures to predict putative non coding small RNAs. Because sequence a lignment was a critical step for finding small RNAs via this approach, intergenic regions that also included up and down stream sequences were extracted, BLAST searched against a database of bacterial genomes (12) and the resultant sequence alignments were further refined using a program named MUSCLE (58) Subsequently, RNAz was applied to the alignments for scoring intergenic regions for putative small RNAs (76, 227) Target genes for each candidate small RNA were predicted using RNAplex (219) and RNAplfold (28) and the resultant genes were then used to perform functional category enrichment tests based on their scores by these two programs. In addition, we employed a method of Rho independent terminator (RIT) identification to help identify candidate small RNAs (107) which were subsequently scored using RNAz, and a transcriptional signal based method to identify intergenic sRNA transcription units (TUs) (209)

PAGE 61

61 Statistical Analysis f or Differential Expression The R package DESeq (13) was used to determine differential gene expression on the basis of the negative binomial model (193) Detailed steps for analyzing RNA seq data for differentially expressed genes were utilized as described elsewhere (170) Briefly, short reads aligned to a particular annotated gene in the reference genome were cou nted, generating a table of read counts of all the open reading frames. Statistical software R of the R package DEseq (220) w as then employed to infer differentially expressed genes in various biological conditions. To normalize expression levels among different samples, total sequencing depths for each sample were estimated as the median of the ratios of the geometric mean across all samples, as detailed elsewhere (13, 192) Microarray Experiments. S. mutans UA15 9 microarrays were provided by T he Institute for Genomic Research (TIGR). The microarrays consisted of 1,948 70 mer oligonucleotides representing 1,960 open reading frames printed four times on the surface of each microarray slip. A reference RNA that had been isolated from 100 ml of UA159 cells grown in BHI broth to an OD 600 of 0.5 was used in every experiment. The experimental strains consisted of S. mutans UA159, and mutant derivatives 837np (Table 2 1 ) grown in BHI to OD 600 =0.5 in quadruplicate for each strain. All RNA was purified as described a bove and used to generate cDNA by the proto col provided by TIGR ( http://pfgrc.tigr.org/protocols.shtml ) with minor modifications. The 2:1 dTTP to aminoacyl dUTP was used. Superscript III reverse transcriptase (Invitrogen) was used to increase cD NA yield s. Purified cDNAs from experimental groups were coupled with indocarbocyanine (Cy3) dUTP, while reference cDNA was coupled with

PAGE 62

62 indodicarbocyanine (Cy5) dUTP (Amersham Biosciences, Piscataway, NJ). The amount of in co operated dye was measured fo r each sample using the spectrophotometer. The Cy3 labeled experimental cDNA samples were mixed in equal quantity to the Cy5 labeled reference cDNA samples and the subsequent mixture hybridized to the microarray slides. Hybridization was carried out with a Maui four chamber hybridization system (BioMicro Systems, Salt Lake City, UT) for 16 h at 42C. The slides were then washed by using TIGR protocols and scanned using a GenePix scanner (Axon Instruments Inc, Union City, CA). S. mutans Microarray Data An alysis After the slides were scanned, single channel images were loaded into TIGR Spotfinder software ( http://www.tigr.org/software/ ) and overlaid. A spot grid was created according to TIGR specifications and manually adjusted to fit all spots within the grid, and then the intensity values of each spot were determined. Data were normalized using Microarray Data Analysis Software (MIDAS) ( http://www.tigr.org/software/ ) by used LOWESS and iterative log mean centering with default settings, followed by in slide replicate analysis. Statistical analysis was carried out using BRB Array Tools ( http://linus.nci.nih.go/BRB ArrayTools.html ) with a cutoff P value of 0.001 for class prediction and class comparison. Biochemical Assays Chloramphenicol Acetyltransferase Assay Strains carrying promoter cat gene fu sions were grown from overnight cultures that were inoculated with appropriate antibiotics and diluted 1:30 in 50 ml of fresh BHI broth in a 5% CO 2 atmosphere at 37C to OD 600 = 0.5. Cells were centrifuged and the Protein was extracted by

PAGE 63

63 bead beating in the presence of glass beads (0.1mm diameter) for 20 s twice, with a 2 min interval on ice. The cell lysates were centrifuged at 4000 x g for 10 min and the supernates were used for measuring CAT activity by the method of Shaw (202) Briefly, 10 containing 0.4 mg ml 1 coA (4 mg ml 1 ). C hloramphenicol ( 5 l from a 5 mM stock) was ad ded to the samples immediately before reading and the ra tes were tabulated via the spectrophotometer which measure s the rate of change in OD of the samples per second over a 2 min interval. The concentration of protein was measured using the bicinchonini c acid assay (Thermo Scientific). CAT activity was expressed as nmoles of chloramphenicol acetylated min 1 (mg protein) 1 CAT s pecific activity = (Av era g e Rate/13.6) x (1/Sample volume) x (1/protein concentration) x 10 6 Galactosidase Assay galactosidase activity was measure d according to the protocol of Miller (245) Strains carrying promoter lacZ gene fusions were gr own in 5 ml of BHI broth in a 5% CO 2 atmosphere at 37C to OD 600 = 0.5 in triplicates. Cells (1.5 ml) were centrifuged and the pellets were resuspended in 1.3 ml of Buffer Z (60 mM Na 2 HPO 4 40 mM NaH 2 PO 4 10 mM KCl, 1 mM MgSO 4 with freshly added 50 mM mercaptoethanol). Ce lls (500 l) were permeabilized by high speed vortexing for 1 min with 25 l of toluene:acetone solution (1:9 v/v) 600 The permeabilized cells were transferred to a 37 C water bath a prewarmed ONPG (4 mg ml 1 in 0.1M Na Phosphate buffer pH 7.5) was added to the cells and the time recorded. After a yellow color change was observed the reaction was stopped with 1 M Na 2 CO 3 solution and the time for the color change to occur

PAGE 64

64 recorded. The cells were briefly centrifuged and the OD 550 and OD 420 measured. The specific activity was calculated as Miller units. Miller units = 2000 x (OD 420 1.75 x OD 550 ) /Time (min) / OD 600 To assess the promoter activity of relP in hydrogen peroxide, t he wild type strain carrying the relP lacZ fusion was grown in triplicates in 5 ml of BHI broth in a 5% CO 2 atmosphere at 37C to OD 600 = 0.2. Hydrogen peroxide (0.003%) was added to 2.5 ml of each sample and the other 2.5 ml was l eft untreated. The cells were incubated for 1 h in a 5% CO 2 atmosphere at 37C galactosidase activity was performed as described above. Protein Manipulation Protein Purification An N terminally His 6 tagged RcrR prot ein was obtained by amplifying the entire rcrR structural gene from S. mutans UA159 and cloning it in frame in pQE30 (Qiagen) using DH10B E. coli cells. Clones were sequenced to ensure no errors had been introduced The cells were grown from an overnight culture to an OD 600 of 0. 5 with ampicillin to ensure no loss of the plasmid T he protein was overproduced by induction with 100 mM sterile isopropyl D thiogalactopyranoside (IPTG) for 4 hours and purified as a soluble protein in a Ni 2+ affinity column u sing the protocol recommended by the supplier (Qiagen). Briefly, to obtain the purified protein, the induced E. coli cells were harvested and resuspended in a lysis buffer containing 50 mM NaH 2 PO 4 300 mM NaCl, 10 mM imidazole adjusted to pH 8 with NaOH. The cells were lysed using mechanical force with 500 l of glass beads for 30 s twice. The cells were centrifuged at 14, 000 x g for 10 min at 4 C. The ce ll lysates were incubated with 1 ml of Ni 2+ NTA resin (Qiagen) for ~ 1 h at 4 C then the slurry was loaded on to a column. The column was

PAGE 65

65 then washed 2 times with 4X the volume of the slurry with a wash solution containing 50 mM NaH 2 PO 4 300 mM NaCl and 20 mM imidazole, followed by 2 washes 4X the volume of the slurry with a solution containing 40 mM imidazole to remove nonspecific binding An elution buffer (450 l) containing 500 mM imidazole was added to the column 6 times, for a total of 6 eluate fractions. The protein concentration of the different eluate fractions were then assessed via Bradf ord assay, and the fractions were run on a 12% SDS denaturing polyacrylamide gel to check for purity and size of the protein. The proteins were then dialyzed using a Slide A Lyzer 10 kDA Dialysis Cassette (Thermo Scientific Waltham, MA ) in 2.1 L of Bindi ng Buffer to exclude fragments smaller than 10 kDA. The dialyzed protein was quantified via Bradford assay and 1 g of protein was run on a 12 % denaturing polyacr y l a m i de gel to check for integrity of the protein. Electrophoretic Mobility Shift Assay (EMSA) An electrophoretic mobility shift assay (EMSA) was carried out by using a previously published protocol (3) DNA fragments containing the promoter region of rcrR and other genes we re amplified via PCR using biotinylated primers (Table 2 5). The PCR product was gel purified (Qiagen) and quantified using a spectrophotometer. Five fmol of biotinylated DNA probe was used with different concentrations of purified recombinant His 6 tagged S. mutans RcrR protein in a 10 l reaction mixture containing 10 mM HEPES (pH 7.9), 50 mM KCl, 5 mM MgCl 2 1 mM EDTA, 5 mM dithiothr eitol, 2 g poly (dI dC) and 10 % glycerol. After incubation at room temperature for 40 min, the DNA prote in samples were r esolved in a 4 % [ (30:1) acrylamide:bis acrylamide] non denaturing low ionic strength p olyacrylamide gel at 65 V for about 1 hour. Th e samples were transferred to Genescreen plus hybridization transfer membrane

PAGE 66

66 ( Perkinelmer Life Sciences, Boston, MA ) that was preincubated for 10 min in TBS buffer using a semi dry transfer apparatus. The signals were detected using a chemiluminescent nucleic acid detection kit (Thermo Scientific) and an AlphaEase FC (Fluorochem 890 0) imaging system as recommended by th e supplier. Fluorescent Polarization Assay Forward and reverse complementary oli gos that were 38 bp and 55 bp which included the RcrR binding site were synthesized and labeled with 6 FAM (IDTDNA) at 2 5 ). The forward and reverse oligos were annealed using equal amounts (12.5 pmol es ) of oligos The annealing was done in an annealing buffer ( 10 mM Tris pH 7.5, 1 mM EDTA, 50 mM NaCl ) @ 95 C for 2 min then gradual cooling to room temperature over a 45 min period. Annealed fluoresce ntly labeled probe (10 fmol es) was used with different concentrations of purified recombinant His 6 tagged S. mutans RcrR protein in a 200 l reaction mixture containing 10 mM HEPES (pH 7.9), 50 mM KCl, 5 mM MgCl 2 1 mM EDTA, 5 mM dithiothreitol, 2 g poly (dI dC) and 10% glycerol in a microtiter plate. After incubation at room temperature for 10 min, the samples in the microtiter plate were analyzed in a Synergy 2 plate reader (Biotek Winooski,VT ). The change i n fluorescence polarization of the DNA with the addition of increasing concentrations of RcrR protein was measured. Binding constants were then calculated based on non linear regression analysis tools using the Gene5 program (Biotek) and the Prism statist ical software.

PAGE 67

67 Figure 2 1. Schematic showing the process for making insertion:deletion mutants via PCR ligation mutagenesis

PAGE 68

68 Figure 2 2. Schematic showing the process for making point mutation s via splice overlap extension PCR

PAGE 69

69 Figure 2 3 Gel image showing size difference in PCR products generated from the SOE mutants vs. WT using MAMA primers.

PAGE 70

70 Table 2 1. List of strains Strain Relevant Characteristics Source or reference E. coli strains: DH10B General cloning strain Invitrogen S. mutans strains: UA159 Wild type ATCC 700610 835np SMu0835(rcrR) ::NPKm r This study 835p SMu0835 (rcrR) :: Km r This study 836np SMu0836(rcrP) :: NPKm r This study 836p SMu0836 (rcrP) :: Km r This study (rcrQ )::NP Km r This study SMu0837 (rcrQ) :: Km r This study 835 837np SMu0835, SMu0836 SMu0837 :: NPKm r, This study 836 837np SMu0836, SMu0837 :: NPKm r This study 835 + NPKm r harboring pDL278 SMu0835 This study 835 + r harboring pDL278 SMu0835 This study 835 + 7np (SJ360) 7:: NPKm r harboring pDL278 SMu0835 This study 835 + /wt ( SJ354) UA159 harboring pDL278 SMu0835 This study tpx tpx :: NPKm r This study relA relA :: E m r (122) relP relP :: NPKm r (122) relRS relRS :: NPKm r (122) relAPQ relA, relP, relQ ::E m r NPKm r Tet r (122) NBS1 GAGAACTA TTTTCCCC This study NBS2 AGGAATCA TTTTCCCC This study BBS TCA CCC; CTA CCC This study UA159::P 835 cat Sp r Km r ; This study relP ::P 835 cat Sp r Km r This study UA159::P relP cat Sp r Km r This study 836p ::P relP cat Sp r Km r This study UA159 :: P 835 lacZ Km r This study UA159 ::P NBS1 lacZ Km r This study UA159 ::P NBS2 lacZ Km r This study :: P 835 cat Km r This study :: P NBS1 cat Km r This study :: P NBS2 cat Km r This study

PAGE 71

71 Table 2 2. List of plasmids used Plasmid Phenotype or description Reference or source pJL105 Sp r Km r ; E m r CAT fusion integration vector based on pJL84 (243) This study pDL278 Sp r ; E.coli Streptococ cus shuttle vector (8) pMSP3535 E m r ; E.coli Streptococcus shuttle vector (32) pvT924 Km r plasmid (173) pALH123 Km r ; plasmid encoding the non polar kanamycin gene from Tn1545 (17 3) pMZ Km r E m r LacZ fusion integration vector based on pMC 195 and pMC 340 B (133) pQE30 Amp r E. coli expression vector for 6xHis tagged protein Qiagen

PAGE 72

72 Table 2 3. List of primers Primer Sequence Application SMu0835 A GATGGCTTCTCCCAAACATCC Inactivation of SMu0835 (rcrR) SMu0835 B Bam HI TTAAATTCA GGATCC GGCTCCTTCA Inactivation of SMu0835 (rcrR) SMu0835 C Bam HI GGAAGGTTT GGATCC AAATCAAACA Inactivation of SMu0835 (rcrR) SMu0835 D CACCTGACGCTGTCTTGGA Inactivation of SMu0835 (rcrR) SMu0836 A GCGCCCCTAGGTCTTACCAA Inactivation of SMu0836 (rcrP) SMu0836 B Bam HI CCCATTCTT GGATCC TTAGACGTT Inactivation of SMu0836 (rcrP) SMu0836 C Bam HI ATGACTAAG GGATCC GTAGCCCAAC Inactivation of SMu08356 (rcrP) SMu0836 D GTCGCTGCAAGAGCTCCATT Inactivation of SMu0836 (rcrP) SMu0837 A GTTCCACTGGCTCAGGAAAA Inactivation of SMu0837 (rcrQ) SMu0837 B Bam HI CATCTCT GGATCC CGGTCAG Inactivation of SMu0837 (rcrQ) SMu0837 C Bam HI TGGCTTC GGATCC GATCTCT Inactivation of SMu0837 (rcrQ) SMu0837 D ACGGAGTCAAAAATCCCAAT Inactivation of SMu0837 (rcrQ) SMu0839 A TTGTTATTTTTGGCTGCTTTTT Inactivation of SMu0839 ( cipI ) SMu0839 B Bam HI CATATCTTT GGATCC ACCTAAAATA Inactivation of SMu0839 ( cipI ) SMu0839 C Bam HI TTATTGTCT GGATCC TTTTATTATGG Inactivation of SMu0839 ( cipI ) SMu0839 D Inactivation of SMu0839 ( cipI ) SMu0835 seq FW CCGCTAAAGACGACAAGAGC Sequencing of strains SMu0835 seq RV AGCCCGAACAACACGAACAC 3' Sequencing of strains SMu0836 seq FW CCGCTAAAGACGACAAGAGC Sequencing of 6 strains SMu0836 seq RV AACCAAAGCACCAGCAAAGT Sequencing of 6 strains SMu0837 seq FW TTTACCGCGTGCTTTAGTTTCT Sequencing of strains SMu0837 seq RV ACTTTCTTGTGCATTTGCCTCT Sequencing of strains P 835 FW Sac I GCCAGTCTTA GAGCTC AGTCAGAAG SMU0835 promoter amplification P 835 RV Bam HI CTCCTTCAT GGATCC ACCTCACTTT SMU0835 promoter amplification P RelP FW Sac I GAGCTC TTTGTGGTT relP promoter amplification P RelP RV Bam HI CTTGTGACAT GGATCC TCCTTCTTA relP promoter amplification phnA AS GATTCCATTCATAAGCACAT Sequencing of promoter fusion strains lacZ RV TCAGAAAATTCTGCAAGAGATTCA Sequencing of lacZ promoter fusion strains Cat TCGTTTGTTGGTTCAAATAA Sequencing of cat promoter fusion strains

PAGE 73

73 Table 2 3. Continued Primer Sequence Application SMu0835 FW Bam HI AAGTGAGG GGATCC TATGAAGGAG Amplification of SMu0835 gene to make recombinant protein SMu0835 RV Hind III ATTTTAAAC AAGCTT TACTCCTTCTT Amplification of SMu0835 gene to make recombinant protein BS A ACAAGAGCTGATTGACGTTTCATA Point mutations in P SMu0835 (rcrR) BS D ATGCCCCATTCTTTAGCATTTAGA Point mutations in P SMu0835 (rcrR) NBS1 B TGAGAATATTATAA GGGGAAAAA TGAAAACTAT TA Point mutations in P SMu0835 (rcrR) NBS1 C TAATAGTTTTCA TTTTTCCCC TTATAATATTCTCA Point mutations in P SMu0835 (rcrR) BBS B RV AGAATATTATAA GGG TTCTCATGAAAACTATTAT AATGA GGC CTTAAACTATTG Point mutations in P SMu0835 (rcrR) BBS C FW CAATAGTTTAAG GCC TCATTATAATAGTTTTCAT GAGAA CCC TTATAATATTCT Point mutations in P SMu0835 (rcrR) BS1 MAMA ATCATTATAATAGTTTTCATGAGAACT G Screen for point mutations in P SMu0835 (rcrR) BS2 MAMA TTCTCCTTGACAATAGTTTAAGGAATC G Screen for point mutations in P SMu0835 (rcrR) BS seq FW ATCTCTTATCTTGCGCTGTTTG Sequencing of strains BS seq RV CGACTGCTCCTGTCCATTCAT Sequencing of strains

PAGE 74

74 Table 2 4. List of real time primers Primer Sequence RT 835 Sense TGTTTTAACGCCATTAGGTCAGG RT 835 Anti Sense TCCGAGCAACTGATAAGTCTTCC RT 836 Sense ATCTGTTTGGCTGTCTGGATGG RT 836 Anti Sense ATAATATCTGAGGCGGTCGTTCC RT 837 Sense GACAGATACCATGACCAAAGGG RT 837 Anti Sense AGAAACCAAAGCACCAGCAAAG RT 838 (tpx) Sense GACACTTGCTGGTAAGAAATTGC RT 838 (tpx) Anti Sense ATAGATGGCACAACGCTAATCAC RT 839 Sense TCCTCTGCTTGTTCAGGTTTGC RT 839 Anti Sense TCTTGTGCATTTGCCTCTCTAGC RT NP Kanamycin Sense TGACGGACAGCCGGTATAAAGG RT NP Kanamycin Anti Sense CAGATTGCTCCAGCCATCATGC RT relP Sense AGACACGCCATTTGAGGATTGC RT relP Anti Sense GGTGCTCCAAACTAGCCCAAG RT relA Sense RT relA Anti Sense GCGACTAATCC CCAGCCGATG RT comYA Sense ATTATCTCTGAGGCATCGTCCG RT comYA Anti Sense ACCATTGCCCCTGTAAGACTTG RT comX Sense CGTCAGCAAGAAAGTCAGAAAC RT comX Anti Sense ATACCGCCACTTGACAAACAG RT comS Sense TCAAAAAGAAAGGAGAATAACA RT comS Anti Sense TCATCTGACATAAGGGCTGT

PAGE 75

75 Table 2 5 List of primers and oligos for EMSA and FP analysis Primer Sequence P 835 FW_biotin /5Biosg/GCCAGTCTTAGAAAGTAGTCAGAAG P 835 RV CTCCTTCATAAAAACACCTCACTTTT P relP FW_biotin /5Biosg/AGATAATGCTAGGCTTTTTGTGGTT P relP RV CTTGTGACATAATTCATCCTTCTTA P comX FW_biotin /5Biosig/CATACCCTGCTTTATCTTGAAT P comX RV CTATTACGATGACCTCCTTTTATAAT R S1+13 FW AGCCGTTACGTAGTTTTCATGAGAACTAA R S1 plus RV AATATTATAATAGTTCTCATGAAAACTATTATAATGAT R S 1 plus FW ATCATTATAATAGTTTTCATGAGAACTATTATAATATT R S 1 plus RV AATATTATAATAGTTCTCATGAAAACTATTATAATGAT R S 1 plus RV biotin /5Biosg/AATATTATAATAGTTCTCATGAAAACTATTATAATGAT R S 1 plus RV 6FAM /56FAM/AATATTATAATAGTTCTCATGAAAACTATTATAATGAT R S 2 plus FW TGACAATAGTTTAAGGAATCATTATAATAGTTTTCATGAGAACTATTATAAT ATT R S 2 plus RV AATATTATAATAGTTCTCATGAAAACTATTATAATGATTCCTTAAACTATTG TCA R S 2 plus RV biotin /5Biosg/AATATTATAATAGTTCTCATGAAAACTATTATAATGATTCCTTAAA CTATTGTCA

PAGE 76

76 CHAPTER 3 CHARACTERIZATION OF THE SMU0835 8 37 OPERON AND ITS ROLE ON GROWTH, BIOFILM FORM ATION AND STRESS TOL ERANCE IN Streptococcus mutans Introduction S. mutans is able to survive, persist and compete with other bacteria and eventually cause disease when conditions are favorable. Therefore, it is critical to understand the mechanisms that S. mutans utilizes to adapt to stress. The metabolism of (p)ppGpp is an important stress adaptation pathway. The amount of (p)ppGpp accumulated plays a significant role in controlling the phy siology of the cell and affects certain v irulence attributes in S. mutans (98, 122, 123) The discovery of the additional synthetase enzymes, particularly RelP the dominant producer of (p)ppGpp under non stringent conditions, shows that there are other signals and factor s regulating (p)ppGpp me tabolism than was previously known. The signals regulating RelA dependent (p)ppGpp production are pretty well known, but the signals regulating RelP dependent (p)ppGpp production have not been revealed However, it was found that the expression of the re lPRS operon was upregulated in cells grown with aeration (7) The SMu0835 0839 gene cluster was upregulated in aeration as well and in a mupir ocin induced stringent response (4, 123) The genes in the SMu0835 0839 cluster encode products that are typically involved in stress tolerance as well. The linkage to stress tolerance and response to similar environmental signals provided the basis for potential regulatory overlap of relP and SMu0835 0837 In order to elucidate pa thways that are involved in stress responses and factors influence RelP dependent (p)ppGpp production in S. mutans the SMu0835 0839 gene cluster was closely examined. W e characterized a variety of mutants lacking some or all of these genes. Figure 3 1 sh ows

PAGE 77

77 a schematic of the operon. SMu0835, which we designated rcrR for r el c ompetence r elated (rcrR ) gene is predicted to encode a cytoplasmic transcriptional regulator with a winged helix turn helix DNA binding motif and is identified (Oralgen, Los Alamos) as a member of the m ultiple a ntibiotic r esistance (MarR) family of transcriptional regulators (10) MarR type regulators are widely distributed in bacteria and regulate many functions, including resistance to xenobiotics and oxidative stresso rs, and expression of virulence genes (64) For example, the E. coli MarR protein modulates the expression of multiple genes that impact resistance to a variety of antibiotics and to oxidative stress (14, 181) SMu0836 (rcrP) and SMu0837 (rcrQ) are apparently co transcribed with SMu0835 and are annotated (Oralgen, Los Alamos) as transmembrane ATP Binding Cassette (ABC) transporters that function as multidrug/protein/lipid transport systems T he ATP binding cassette and transmembrane domains of both proteins are located on a single polypeptide and are classified as Type 6 transporters (62) which include homo and hetero meric ABC transporters that typically function as exporters involved in the externalization of toxic compounds or peptides. The highly conserv ed ATP binding Walker A sequence and Walker B magnesium binding sequences, as well as the signature LSGGQ sequence, found in ABC transporters are conserved in both ORFs. Notably, we could identify MarR like regulators that are linked to two similar ABC transpor ters in multiple other streptococcal species and in other Firmicutes (Table 7 1 ). SMu0838 (tpx) encodes a thiol peroxidase that was shown by microarray analysis to be up regulated in response to growth with aeration, compared to anaerobically growing cell s (7) Thiolperoxidases can protect bacteria against oxidative stress by breaking down hydrogen peroxide and organic hydroperoxides. The Tpx protein

PAGE 78

78 contains the 2 cysteine residues that form th e conserved CXXC motif and that are oxidized by hydroperoxides to form a sulfenic acid. Notably, there are other proteins in S. mutans that contain the FX4 CXXC motif that are involved in responses to aeration, including SMu0629, which modulates the activ ity of the AtlA autolysin (7) SMu0839 ( cipI ) was shown by Levesque and co workers (175) to encode a bacteriocin i mmunity protein. Bacteriocin immunity proteins are generally integral membrane proteins that confer protection against certain classes of antimicrobial agents and often enhance stress tolerance (150) In S. mutans CipI plays a protective role against the CipB bacteriocin like protein, which appears to function intracellularly and contributes to cell death following exposure to high levels of competence stimulating pe ptide (CSP) (175) Results Transcriptional Organization of the SMu0835 837 O peron. A collection of mutants was made by allelic exchange using either polar or non polar antibiotic resistance cassettes (Table 2 1 ). Reverse transcriptase PCR (RT PCR) and quantitative RealTime RT PCR were used to determine if genes could be co transcribed and to measure stable transcript levels of the genes in the SMu0835 0839 operon in the and mutants, respectively. RT PCR revealed that SMu08 35 can be co transcribed with SMu0836 and SMu0837 as a polycistronic operon (Figure 3 2, Figure 3 3 ) Consistent with the RT PCR results, expression of SMu0837 (rcrQ) was down regulated nearly 1000 fold in the polar mutant compared to the parental str ain (Fig ure 3 4 ). In contrast, expression of SMu0838 ( tpx) or SMu0839 ( cipI ) was not significantly altered in the mutant c ompared to the wild type strain (Figure 3 5 ) The lack of influence of polar insertions in SMu0836 7 on tpx mRNA levels was

PAGE 79

79 con sistent with our inability to detect a product in RT PCR reactions using primers that would amplify across the SMu0837 tpx intergenic region (data not shown) indicating that these genes are not part of the SMu0835 7 operon. Interestingly, the expression o f SMu0836 (rcrP) and SMu0837 (rcrQ) was significantly up regulated (~100 fold) in the mutant carrying a non polar insertion in the SMu0835 gene ( ) compared to the wild type strain (Fig ure 3 4 Figure 3 6 ), adding further support that these three genes constitute an operon and revealing that the MarR like protein may repress expression of this operon. To further demonstrate that SMu0835 was autogenously regulated, we measured mRNA levels of the non polar kanamycin resistance gene that was used to replace SMu0835 835np strain, lacking the MarR like regulator, and compared it to expression levels in the mutant, which has an intact MarR like regulato r. This non polar kanamycin resistance casset te lacks a promoter (8) so its expression was driven by the SMu083 5 promoter in both the and strains. Consistent with the RealTime PCR results, the expression of the non polar kanamycin marker was about 100 fold higher in the p mutant than in the mutant (Fig ure 3 7 ), adding additional support for the hypothesis that the SMu0835 protein is a negative regulator of the SMu0835 0837 operon. Also of interest is that the magnitude of induction of the operon associated with lo ss of the SMu0835 protein indicates that the genes are significantly repressed during exponential growth in rich medium. Notably, though, the expression of this operon was not differentially expressed as a function of growth phase (data not shown). SMu083 5 (RcrR) Is t he Dominant Regulator of t he Operon Based on the qRT PCR analysis and s RT PCR experiments it appears that RcrR is the d ominant regulator of the operon and therefore EMSAs were done to analyze

PAGE 80

80 whether purified RcrR protein (rRcrR) was able to bind to DNA amplified from the region of rcrR P urified RcrR protein was able to impede the migration of a DNA fragment that included 140 bp in front of the ATG start site of rcrR at low quantities (2 p moles ) (Figure 3 8 ) The shift of the 140 bp DNA fragment was observed as little as 0.65 pmoles of RcrR p rotein. Other DNA fragments that i ncluded regions containing 250 and 200 bp upstream of the rcrR ATG start site were all were impeded by 5 p mol es of purified RcrR prote in (data not shown). Cold competi tion assays were done using biotinylated DNA and unlabeled DNA of the same region in differen t ratios with 1.25 pmol es of rRcR protein. The amount of bi oti nylated DNA that was shifted decreased with increasing concentration s of unlabeled DNA, indicative of competitive binding to the purified protein (Figure 3 9 ). When 50 times more unlabeled DNA was added there was only an a pproximate 30% shift in biotinylated DNA compared to an appro x i mate 88% shift with no co mpetition (Table 3 1). Growth Characteristics of t he Mutants The growth of the various mutants (Table 2 1 ) was monitored in BHI broth. All of the mutants constructed using the non polar cassette displayed a modestly extended lag phase and slightly slow er growth rate than the wild type strain. The wild type strain had a doubling time of about 46 min 1.5 min, whereas the non polar mutants had doubling times of about 51 min 3.5 min (Figure 3 10 ). However, the final optical density attained by the non polar mutants was consistently lower than the parental strain. Notably, the polar mutant, which would not express either ABC transporter, exhibited much slower growth ( 67 min 7 min) and lower final yields than the non polar mu tant s or parental str ain (Figure 3 11 ). Both the polar and non polar tpx

PAGE 81

81 mutants had growth rates s imilar to the non polar mutants, so the effects of the loss of the ABC transporters were independent of the level of expression of tpx or cipI To test if the mutants were sens itive to low pH, the strains were grown in BHI broth that was acidified to pH 5.5 with HCl (Fig ure 3 1 2 ). All of the mutants had a slower growth phenotype than the wild 836p mutant grew very poorly at pH 5.5 and showed very little cell accumula tion even after 26 hours (Figure 3 1 3 ). Exposure to oxygen has been shown to alter growth and biofilm formation by S. mutans (4) and some of the genes in the SMu0835 839 gene cluster were up regulated in response to oxygen (7) The growth phenotype of the mutants was assessed in BHI without an oil ov erlay, thus exposing the cells to air during growth, or in medium containing 25 mM paraquat, a superoxide generating agent, with an oil overlay. Because c ells could not grow in the presence of paraquat without oil overlay was added The polar mutan t again had a slower growth rate than the other strains. In addition, the 836np and 837np mutants displayed a slow growth phenotype when the cells were exposed to air (Fig ure 3 1 4 ) Interestingly, the mutant exhibited significantly faster growth and a shorter lag phase than the wild type strain in medium containing paraquat or in cultures that were gr own with exposure to air (Figure 3 1 5 ). S. mutans has the ability to form biofilms, an essential process in establishment, persistence and pathogenes is. Efflux pumps have been shown to be required for biofilm formation in certain organisms and compounds that can inhibit efflux pumps can affect the ability of bacteria to form biofilms (113) We evaluated if the various mutants had impaired biofilm formation in microtiter plates in BM broth containing sucrose or glucose. Biof ilm formation was quantified at 24 and 48 h to take into account the effects

PAGE 82

82 of the slower growth phenotypes of some of the mutants. T here were no significant differences seen in biofilm formation after 24 or 48 h when the strains were grown in sucrose (data not shown) However, when the strains were grown in glucose, the 836 p mutant, lacking both ABC transporters, formed less biofilm than the other strains at 48 h (Fig ure 3 1 6 ). Collectively, these data highlight the requirement of the ABC transporters for stress tolerance and biofilm formation, but also show that loss of bo th transporters is required to observe changes in the phenotypes of interest. Discussion The ability of S. mutans to survive and persist in the continually varying conditions in the oral cavity is intimately associated with its pathogenicity (33) so understanding how the organism adapts to these often challenging conditions can facilitate the development of novel s trategies to compromise the persistence or virulence of this important human pathogen. The results presented here show that the products of the previously uncharacterized SMu0835 0837 operon, which we now designate as the rcrRPQ operon, for r el c ompetence r elated genes, play a major role in the reg ulation of growth and stress tolerance Although tpx and cipI participate in particular aspects of stress tolerance and the response to CSP, respectively (175) we focused on the rcrRPQ operon because deletion of tpx o r cipI had no significant effects on growth, stress tolerance or gene expression under the conditions we tested. We also found no evidence to support that tpx or cipI were part of the rcr RPQ operon or had an influence on relP expression. The data presented here demonstrate that the RcrP (SMu0836) and RcrQ (SMu0837) exporters are critical for tolerance of the two environmental stresses that

PAGE 83

83 have the greatest influence on the composition (120) biochemical activities and pathogenic poten tial of oral biofilms, oxidative and acid stress. Strains lackin g the RcrPQ transporters grew substantially slower than the parental strain in air or in the presence of the superoxide gene rator paraquat. Likewise, mutants lacking these transporters were more acid sensitive than the parental strain, as evidenced by slower growth at pH 5.5. The RcrPQ transporters were also necessary for proper biofilm formation, another attribute associated with the pathogenicity of S. mutans While it is not yet established if the RcrP and RcrQ pumps are able to function as a heterodimeric complex, as many ABC porters do (62) RcrP and RcrQ clearly have redundancy in function, since deletion of only one of the exporters caused modest phenotypic changes compared to those seen in strains carrying mutations that affected the expression of both gene product s ABC efflux transporters play many roles in bacteria including extrusion of antibiotic s and export in a wide range of compounds, including, metals, peptides and lipids (148) As noted earlier, RcrPQ have a structure typical of ABC export proteins and are annotated as multi drug/protein/lipid transport systems. The simplest explanation for the growth defects of strains lacking both exporters would be that RcrP and RcrQ are each capable of externalizing a substance or class of compounds that accumulates in growing cells, particularly in aerobic condition s or at low pH. Interestingly, the RcrQ protein is predicted to have a fumarate lyase regulatory domain (Oralgen). Growth of S. mutans in air alters metabolism toward heterofermentative growth and impacts the transcriptional profiles of the cells, includ ing enhancing the expression of the genes for pyruvate dehydrogenase and the partial TCA cycle, which in

PAGE 84

84 the case of S. mutans could lead to enhanced fumarate production (7) We tested if mutants lacking the ABC transporters were more sensitive to the presence of fumarate, but this was not the case (data now shown). Notably, aeration also increases the production of peptide antibiotics (mutacins) by S. mutans so the transporters could play a rol e in externalization of peptides with antimicrobial activity which may account for the smaller zone of inhibition with the strain lacking the RcrPQ porters (Appendix A) We are currently testing the hypothesis that RcrQP participate in the transport of s elected peptide based moieties. Notwithstanding, multiple findings presented in this c hapter reveal that the RcrRPQ system in S. mutans has key functions in cellular homeostasis, gene regulation and quorum sensing that extend well beyond simply pumping a deleterious substance from inside the cell. RcrR (SMu0835) is the dominant regulator of the rcrRPQ operon, repressing the production of the genes for the RcrP and RcrQ transporters under all conditions tested here. Overexpression or uncontrolled expression of efflux pumps can affect bacterial homeostasis and physiology by imposing a metabolic burden o n the bacteria or by hyper secretion of signaling molecules (131) so it is critical that genes encoding efflux pumps are properly regulated. Of note, the ( rcrR ) strain had poor biofilm formation in glucose after 48 hours, which may be attributable to the overexpression of the ABC pumps, although we cannot exclude that RcrR is in fluencing the expression of other genes, such as the com genes, to affect biofilm formation. We did not find evidence to support that derepression of the rcrR operon occurs as a function of growth phase (data not shown), so we propose that accumulation of a

PAGE 85

85 specific compound or class of compounds, perhaps those exported by the ABC pumps, could serve as an allosteric regulator of the RcrR transcriptional repressor (Figure 3 1 7 ).

PAGE 86

86 Figure 3 1. Schematic diagram of the SMu0835 0839 (rcrRPQ) gene cluster an d the relPRS operon in S. mutans UA159. SMu0835 (rcrR) encodes for a predicted transcriptional regulator of the MarR family; SMu0836 (rcrP) and SMu0837 ( rcrQ) are annotated as ABC type multidrug/protein/lipid transport; SMu0838 encodes a thiol peroxidase; SMu0839 encodes a predicted bacteriocin immunity protein; SMu0840 (relP) encodes a GTP pyrophosphokinase; SMu0841 (relR) encodes a response regulator and Smu0842 (relS) a sensor histidine kinase of a classic two component system

PAGE 87

87 Figure 3 2 RT PCR using cDNA generated from the SM u0836 reverse primer Reverse t ranscription was performed on 1 g of purified RNA using the SMU0 836 real time reverse primer PCR amplification was performed on the cDNA generated using th e SMu0835 FW and the SMu0836 RV primers. C hromosomal DNA from the wild type strain was also amplified as a positive control. + is the positive control; S is the PCR product from the cDNA generate d; i s a negative control from a reaction with no RT enzyme.

PAGE 88

88 Figure 3 3 RT PCR using cDNA generated from the SMu083 7 reverse primer. Reverse transcription was performed on 1 g of purified RNA using the SMU083 7 real time reverse primer PCR amplification was performed on the cDNA generated using the SMu0836 FW and the SMu0837 RV primers. Chromosomal DNA from the wild type strain was also amplified as a positive control. +, is the positive control; S is the PCR product from the cDNA generated, is a negative control from a reaction with no RT enzyme.

PAGE 89

89 Figure 3 4 RealTime RT PCR showing rcrQ mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data are presented as the log of the copy number of each gene per g of input RNA. *, Differs from the wild type strain at p < 0.0 0 t test). !!, Differs from the 835np strain at p <0.005

PAGE 90

90 Figure 3 5 RealTime RT PCR showing tpx mRNA levels Cells were grown to mi d exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data are presented as the log of the copy number of each gene per g of input RNA.

PAGE 91

91 Figure 3 6 RealTime RT PCR showing SMu0836 (rcrP) mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data are presented as the log of the copy numbe r of each gene per g of input RNA. *, Differs from the wild type strain at p < 0.005 t test). !!, Differs from the 835np strain at p <0.005.

PAGE 92

92 Figure 3 7 RealTime RT PCR showing NP Kanamycin mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data are presented as the log of the copy number of each gene per g of input RNA. *, Differs from the 836np and 836 7np strains at p < 0.0 0 t test).

PAGE 93

93 Figure 3 8 EMSA showing binding of biotinylated P rcrR DNA with purified RcrR protein. Purified RcrR protein of various concentrations (0, 2.5, 5, 10, 20 pmol es) was added to 5 fmol es of biotinylated P rcrR DNA in a bindin g reaction for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n= 7 EMSAs. T here was a similar trend observed in all cases.

PAGE 94

94 Figure 3 9 EMSA showing competiti ve binding of 5 fmol biotinylated P rcrR DNA and unlabeled P rcrR DNA with 1.25 pmol es of purified RcrR protein. Various concentrations of unlabeled DNA containing the same region as the biotinylated region were used The first lane is the no protei n control. The reactions were done for 40 min at room temperature. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n= 3 EMSAs. T here was a similar trend observed in all cases. Table 3 1. Percentage of labeled PrcrR DNA shifted with unlabeled competitor P rcrR DNA 0 x unlabeled DNA 10 x unlabeled DNA 50 x unlabeled DNA 100 x unlabeled DNA 88 % shift 71% shift 30% shift 30% shift % shift calculated as % reduction in the integrated density value (IDV) of the DNA bands compared to the IDV of unshifted DNA band with no protein.

PAGE 95

95 F igure 3 10 Growth comparison of wild type and non polar mutant strains in BHI The strains were grown in triplicate to mid exponential phase in BHI broth, diluted 1:100 and transferred to fresh BHI broth, overlaid with sterile mineral oil and placed in a Bioscreen C at 37C to monitor growth. WT, diamonds; 835np squares; 837np 836np triangles. The results are representative of three independent experiments performed triplicate. T able 3 2. Table showing growth characteristics of the non polar mutant s versus the wild type strain in BHI Strain WT Final OD 0.9 0.017 0.84 0.05 0.80 0.08 0.82 0.03 Doubling Time (min) 46 1.5 47 1 50 0.7 48 3 Lag time (h) 2 3 3 3

PAGE 96

96 Figure 3 11 Growth comparison of wild type and polar mutant strains in BHI Strains were grown as described in Figure 3 10 WT, diamonds; 836p squares. The results are representative of three independent experiments performed triplicate. T able 3 3. Table showing growth characteristics of the polar mutant versus the wild type strain in BHI. Strain WT 836p Final OD 0.9 0.0 2 0. 78 0.03 Doubling Time (min) 46 1.5 5 7 7 Lag time (h) 2 3 Differs from the wild type strain at p < 0.05 t test)

PAGE 97

97 Figure 3 1 2 Growth of the non polar mutants versus the wild type strain at pH 5.5 Cells were grown in triplicate to mid exponential phase in BHI broth, diluted 1:100 in BHI broth acidified to pH 5.5, covered with sterile mineral oil and placed in a Bioscreen C at 37C to monitor growth. WT, diamonds; 835np squares; 837np 836np triangles. The results are representative of three independent experiments performed triplicate T able 3 4. Table showing growth characteristics of the wild type versus the non polar strains at pH 5.5 Strain WT 835np 836np 837np Final OD 0.64 0.03 0.65 0.04 0.62 0.19 0.65 0.05 Doubling Time (min) 98 7 10 9 29 135 13 10 3 24 Differs from the wild type strain at p < 0.05 t test)

PAGE 98

98 Figure 3 1 3 Growth of the polar mutant strain versus the wild type strain at pH 5.5. Strains were grown as in Figure 3 10 WT, diamonds; 836p squares. The results are representative of three independent experiments performed triplicate T able 3 5. Table showing growth characteristics of the polar mutant versus the wild type strain at pH 5.5 Strain WT 836p Final OD 0.64 0.03 0.09 0.01 Doubling Time (min) 98 7 412 117 ** *, Differs from the wild type strain at p < 0.005 t test)

PAGE 99

99 Figure 3 1 4 Growth of the mutants versus the wild type strain with aeration Cells were grown in triplicate to mid exponential phase in BHI bro th then diluted 1:100 in fresh BHI broth and place d in a Bioscreen C at 37 C to monitor growth without the use of mineral oil. WT, 83 5np squares; 836np triangles ; 837np *; 836p Xs The results are representative of three independent experiments performed in at least triplicate. T able 3 6 Table showing growth characteristics of the mutants versus the wild type strain with aeration Strain WT 837np Final OD 0.63 0.03 0.56 0.04 0.39 0 .06 0.36 0.07 0.40 0.07 Doubling Time (min) 38 2 4 2 2 83 3 ** 88 13 ** 95 15 ** *, Differs from the wild type strain at p < 0.005 t test)

PAGE 100

100 Figure 3 1 5 Growth of the mutants versus the wild type strain in 25 mM paraquat Cells were grown to mid exponential phase in BHI broth then diluted 1:100 in 836p squares; relP triangles. The results are representative of three independent experiments performed in at least triplicate. T able 3 7. Table showing growth characteristics of the mutants versus the wild type strain with 25 mM paraquat Strain WT relP 836p Final OD 0.7 0.04 0.82 0.017 0.7 0.18 Doubling Time (min) 100 21 76 1.8 125 40 Lag time (h) 9 8 1 0

PAGE 101

101 Figure 3 1 6 The differences in biofilm formation of the mutants compared with the wild type strain in glucose. Cells were grown to OD 600 =0.5 in BHI broth then diluted 1:100 into BM supplemented with 20 mM glucose in microtiter plates. Biofilm formation was quantified after 48 h as described in the methods section. The results are representative of three independent experiments performed in at least triplicate *, Differs from the wild type at p<0.05.

PAGE 102

102 Figure 3 1 7 Schematic of the proposed regulation of the rcrPQ operon by the RcrR protein. A. The RcrR protein represses the operon under normal conditions. B. Under stress conditions, the accumulation of signals causes the RcrR protein to lose its repressing capabilities leading to derepression of the operon

PAGE 103

103 CHAPTER 4 REGULATION OF r el PRS AND THE EFFECTS OF SMU0835 083 7 ON r elPRS AND ( p)pp G pp LEVELS Introduction The regulation of (p)ppGpp metabolism is critical for maintaining homeostasis in the cell and adapting to changes in nutrient availability. Virulence and other stress pathways have been linked to (p)ppGpp production in a variety of bacterial species (98) In addition deletions of relA affected biofilm formation a virulence property of S. mutans (119) The fact that there are three enzymes governing (p)ppGpp production in S. mutans suggests that (p)ppGpp metabolism is based on diverse signals. It was pre viously thought that nutrient availability was the main signal regulating (p)ppGpp metabolism, but the identification of the additional synth ases RelP and RelQ, suggest s that other environmental signals regulate (p)ppGpp metabolism (122) The accumulation of (p)ppGpp in the absence of relA under non s tringent conditions also indicates that there are other factors influencing (p)ppGpp production in a dom inant way (122) RelP was the ma jor producer of (p)ppGpp under no n stringent conditions and Lemos et al. also showed that overexpressing relP in a strain that lacks the (p)ppGpp hydrola se caused growth arrest of the cells (122) Th ese data demonstrate that production of (p )ppGpp by RelP is of significan t importance in regu lating the physiology of the cell. r elP is co transcribed with relRS which encodes a TCS and (p)ppGpp accumulation was also affected in a relRS mutant under non stringent conditions (122) T he relRS mutant grew faster than the wild type strain, indicating that (p)ppGpp levels were lower in this strain (122) The linkage of the RelRS TCS to RelP and (p)ppGpp production demonstrate s that RelP dependent production of (p)ppGpp is probably controlled by relP transcript levels unlike RelA which is regulated allosterically at the

PAGE 104

104 enzymatic level. S ince RelP d ependent production of (p)ppGpp is lin ked to the RelRS TCS, it also suggests that extracellular sign als control R elPRS dependent (p)ppGpp metabolism. However, these signals have not y et been identified. The upregulation of relPRS in aeration detected via microarray analysis (4) indicates that relPRS is regulate d at the transcriptional level and oxidative stress may be one of the signals to regulate (p)ppGpp metabolism. Interestingly, members of our group showed that SMu0838 (tpx) and SMu0839 (cipI) w ere upregulated in aeration as well (4) The SMu0835 837 operon was up regulated during a mupirocin in duced stringent response in a (p)ppGpp dependent manner (164) i.e., with no induction of these genes in a relA mutant. Therefore, the expression of the relP and SMu083 5 7 operons may be coordinated with one another in response to particular stresses or signals. Results SMu0835 837 I nfluence relP Expression a nd Vice Versa. In order to test if the SMu0835 0837 operon exerted an effect on the expression of relPRS qRT PCR was performed to compare the amount of mRNA expressed from the relPRS operon in the wild type strain with that in various mutant strains. The expression lev el of the relP operon in the and mutants, which either overexpress or do not express the exporters, respectively, was approximately half that measured in the wild type strain, whereas the expression of relP and relRS in the and mut ant was similar to that in wild type strain (F igure 4 1, Figure 4 2 ). Similarly, qRT PCR analysis was done to measure the expression of SMu0835 and SMu0836 in a relP mutant strain and it was noted that the expression these genes was approximately three fo ld lower in the strains lacking relP or relRS, compared to the wild

PAGE 105

105 type strain (Figure 4 3, Figure 4 4 ). In contrast, the expression of SMu0835 and SMu0836 was similar in a mutant and the wild type strain ( data not shown ), an expected finding given the knowledge that RelA does appear to contribute significantly to (p)ppGpp pools under non stringent conditions in exponentially growing cells (122) To verify the qRT PCR results, the promoter for relP was fused to a promoterless chloramphenicol acetyltransferase ( cat ) gene and CAT activity was measured in exponenti ally growing cells. Consistent with the qRT PCR data, relP promoter activity was lower in the mutant than in the wild type background (Figure 4 5 ). Using a cat gene fusion as described above, SMu0835 promoter activity was analyzed in the gene tic background and found to be 1.5 fold lower than in the wild type genetic background (Figure 4 6 ). Thus, the cat fusion data were consistent with the qRT PCR data showing that expression of the SM u0835 7 operon was decreased significantly in the a nd mutants, and vice versa. Effect of SMu0835 0837 on ( p)ppGpp L evels To verify that the changes in relP expression noted in the SMu0835 7 operon mutants were associated with alterations in the levels of (p)ppGpp in cells, alarmone production was monitored in exponentially growing cells in the wild type strain and selected mutants. The results demonstrated that (p)ppGpp production was adver sely affected by loss of constituents encoded by the SMu0835 7 operon, consistent with the changes in relP mRNA levels and relP promoter activity in these same mutants (Fig ure 4 7 Table 4 1 ). Effect of Oxidative S tressors on (p) ppGpp P ools RelP is the principal source of (p)ppGpp in exponentially growing cells and it appears that the RelPRS system functions to slow the growth of the bacteria in

PAGE 106

106 response to signals associated with stress, es pecially oxidative stress (Figure 3 15 ). The strain lacking relP and relRS grew considerably faster than the wild type strain when exposed to paraquat and aeration as noted in Figure 3 1 5 The accumulation of (p)ppGpp in the presence o f hydrogen peroxide was tested. There was a significant increase in bo th ppGpp (GP4) and pppGpp (GP5) levels when 0.003% hydrogen peroxide was present during the labeling of the cell s (Figure 4 8 ). The accumulation of GP4 and GP5, appeared to be dependent on RelPRS There was no accumulation in GP4 or GP5 in mutants lackin g relP or relRS in response to hydrogen peroxide (Figure 4 8 ). However, there were no significant changes in the and mutant, suggesting that this accumulation of (p)ppGpp in response to aeration is predominantly relPRS dependent. Effect of Oxi dative S tressors on relP P romoter A ctivity Since there was an increase in the amount of (p)ppGpp accumulated in response to hydrogen peroxide and the transcription of relP galactosidase experiments examining the effects of hydrogen pe roxide on the relP promoter were done. Consistent with the (p)ppGpp accumulation data there was a significant increase in relP promoter activity when the cells were exposed to hydrogen peroxide compared to the cells that were not (Figure 4 9 ) The activity of the relP promoter was 1 64 9 Miller units when exposed to hydrogen peroxide compared to an activity of 112 5 Miller units when not exposed to stress. Discussion The overlap between control of expression of the r cr operon and the relP operon is of considerable interest. The underlying basis for the retention of multiple (p)ppGpp synthases in S. mutans and in certain other prokaryotes remains largely enigmatic, but

PAGE 107

107 a reasonable explanation for the retention or acquisition of RelP and the RelR S system during evolution has been disclosed in this study. In particular, the evidence supports that the RelRS two component system may sense oxidative stressors or by products of oxidative metabolism as a signal to stimulate (p)ppGpp production by activ ating production of RelP. In previous studies done in our lab, it was shown that the production of (p)ppGpp by RelP plays a significant role in regulating the growth of S. mutans in exponentially growing cells (122) It was also shown that overexpression of relP in a strain lacking (p)ppGpp hydrolase activity could induce growth arrest (122) Of particular interest here was the substantially faster growth rate of the mutant strain in the presence of paraquat (Figure 3 1 5 ) likely arising from a failure of the mutant to accumulate (p)ppGpp through RelP activity. There is also a clear induction of (p)ppGpp in response to hydrogen peroxide stress, and the data show that R el PRS is the major producer of (p)ppGpp under these conditions. We propose that RelP dependent production of (p)ppGpp in cells exposed to oxidative stress functions to slow the growth of the cells. Since S. mutans does not have a complete respiratory chain, has a limited repertoire of enzymes to detoxify reactive oxygen species and displa ys much better growth in conditions of lower oxygen tension, RelPRS may help to protect the cells from exhausting limited resources, from overproducing metabolites that are toxic, and from acquiring deleterious mutations. In E. coli it has been shown th at (p)ppGpp plays a role in resistance to an intrinsic peptide by inducing efflux pumps to extrude the peptide (180) Interestingly, the RcrPQ pumps in S .mutans are al so induced in response to an increase in (p)ppGpp pools during a mupirocin induced stringent response (164) Both the rcrRPQ and relPRS

PAGE 108

108 gene products appear to be modulating growth in response to aeration and, based on our CAT assays and real time PCR analysis, the products of these two operons can exert an effect on the expression of each other. Thus, as part of our working model, we hypothesize that the RcrPQ export apparatus could play a role in externalizing the compound(s) that is detected by RelRS in quorum sensing fashion to control the growth of S. mutans populations in response to elevated redox or reactive oxygen species (Figure 4 10 ). Such a feedback loop could at least partially explain the interdependence of relP and rcr operon expression and the decrease in (p)ppGpp levels in the mutant lacking the RcrPQ porters. This and other potential mechanisms controlling rcr and relP cross regulation are presently under investigation. We propose as part of our working model that the regulation of relP by rcrRPQ may be through the RcrR regulator binding to the relP promoter as well Since rcrRPQ is responsive to high levels of (p)ppGpp, the regulation of the operon may be tied to RelP dependent (p)ppGpp levels.

PAGE 109

109 Figure 4 1. R ealTime RT PCR showing R elP mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers follow ed by qReal Time PCR. The data represent the fold change in copy numbers of the mut ant strains compared to the wild type strain where the wild type value was set to 1.0 *, Differs from the wild type at p t test).

PAGE 110

110 Figure 4 2. RealTime RT PCR showing R elRS mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data represent the fold change in copy numbers of the mutant strains compared to the wild type strain where the wild type value was set to 1.0 *, D iffers from the wild type at p t test).

PAGE 111

111 Figure 4 3. RealTime RT PCR showing RcrR mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data represent the fold change in copy numbers of the mutant strains compared to the wild type strain where the wild type value was set to 1.0 *, Differs from the wild type at p t test).

PAGE 112

112 Figure 4 4. RealTime RT PCR show ing SMu0836 mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data represent the fold change in copy numbers of the mutant strains com pared to the wild type strain where the wild type value was set to 1.0.

PAGE 113

113 Figure 4 5 CAT activity from the relP promoter. The relP promoter was fused to a promoterless cat gene in the pJL105 integration vector. The cat promoter fusion was transformed into the wild type and 836p strains. In all cases cells were grown to mid exponential phase (OD 600 = 0.5) and CAT specific activity was measured as described in the methods section. The results are from three independen t experiments performed in at least triplicate. *, Differs from the wild type, p t Test)

PAGE 114

114 Figure 4 6 CAT activity from the SMu0835 promoter. The SMu0835 promoter was fused to a promoterless cat gene in the pJL105 integration vector. The cat promoter fusion was transformed into the wild type and 836p strains. In all cases cells were grown to mid exponential phase (OD 600 = 0.5) and CAT specific activity was measured as described in the methods section. The results are from three in dependent experiments performed in at least triplicate. *, Differs from the wild type, p t Test )

PAGE 115

115 Figure 4 7. (p)ppGpp accumulation in mu tant versus wild type strains. Cells were grown to OD 600 = 0.2 in FMC and labeled with 32 P orthophosphate. The cells were incubated for 1 h and (p)ppGpp was extracted using 13M formic acid. 2 x 10 5 CPM of each sample was spotted to PEI cellulose plates for TLC in 1.5 M KH 2 PO 4 buffer The data are a representative of n= 4 experiments. There was a similar trend observed in all cases Table 4 1 Percent change in GP4 (ppGpp) and GP5 (pppGpp) accumulation of mutant strains compared to the wild type strain Strain % Change in IDV* of GP4 compared to the wild type strain % Change in IDV* of GP 5 c ompared to the wild type strain 10% Reduction 43% Reduction 26% Reduction 62% Reduction 30% Reduction 45% Reduction IDV= Integrated Density Value of the Spots

PAGE 116

116 Figure 4 8. Accumulation of (p)ppGpp in hydrogen peroxide Cells were grown to OD 600 = 0.2 in FMC and labeled with 32 P orthophosphate. H 2 O 2 (0.003% ) was added where noted during the labeling. The cells were incubated for 1 h and (p)ppGpp was extracted using 13M formic acid. 2 x 10 5 CPM of each sample was spot ted to PEI cellulose plates for TLC in 1.5 M KH 2 PO 4 buffer The data are a representative of n= 7 experiments. There was a similar trend observed in all cases. The spots observed in the relRS deletion strain are an anomaly from the TLC.

PAGE 117

117 Figure 4 9. The effect of hydrogen peroxide on LacZ activity from the relP promoter. The relP promoter was fused to a promoterless lacZ gene in the p MZ integration vector. The lacZ promoter fusion was transformed into the wild type strain In al l cases cells wer e grown to OD 600 = 0.2. H 2 O 2 (0.003%) was added to some of the samples and incubated for 1 hr. LacZ activity was measured as described in the methods section. The results are from three independent experiments performed in at least triplicate. *, Differ s from the wild type, p < 0.0 0 t Test )

PAGE 118

118 Figure 4 10 Schematic of the potential regulation of the re l PRS operon by different environmental cues and potential cross regulation with the rcrRPQ operon. Under stress conditions, the rcr operon i s derepressed to upregulate rcrPQ encoding the exporters causing the extrusion of substances The RelRS TCS may be sensing these substances in addition to oxidative stress to regulate (p)ppGpp production by RelP.

PAGE 119

119 CHAPTER 5 THE EFFECT OF SMU0835 0837 ON THE COMPETENCE RE GULON Introduction S. mutans is naturally competent and elements of the competence regulon have been linked to stress tolerance and biofilm formation (127, 129) The induction of competence is a specifically timed event linked to the accumulation of peptide signals and environmental stresses. Studies done with S. mutans ha ve shown that competence and acid tolerance, one of the key virulence factors of S. mutans are intimately linked. In particular, mutants lacking components of the competence signaling pathway had a diminished ability to grow at low pH (127) The simplest description of the model for development of competence in some streptococci involves quorum sensing of a secreted peptide by a two component system, which triggers a cascade of expression of early and late competence genes involved in DNA uptake and recombination. However, recent studies reveal that the mechanisms underlying the regulation of the competence pathway in S. mutans are more complex, and that much remains to be understood about the signals, signal transduction systems a nd additional regulatory pathways affecting competence (8) It is now known that another peptide signaling pathway ComR S is the proximal regulator of c omX in S. mutans (149) P revious work done in our lab revealed that multiple signa ls are required for efficient activation of competence genes through the CiaRH and Co mDE two component systems. Com D E regulates competence by sensing CSP levels, whereas CiaRH appears to be involved in sensing as yet undefined signals in a CSP independent manner. The expression of comYA and comX are only highly induced when both CSP and horse serum (HS) are present, compared to the addition of CSP or HS alone,

PAGE 120

120 indicating that signals present in HS, possibly additional peptides, regulate competence genes i n conjunction with CSP. (8) There fore, there are multiple parallel systems regulate the competence network in S. mutans In addition to the slow growth phenotype observed in the various strains with rcrRPQ mutations, a loss in the ability to take up DNA was seen in the strain and a hyper transformable phenotype was observed in the strain Therefore, the mutations in the rcrRPQ operon appeared to affect the ability of the cells to uptake DNA. In addition, the C ipI immunity protein which is encoded downstream of the rcrRPQ operon, is upregulated in high levels of CSP. The relPRS operon, which based on our data is linked to rcrRPQ opero, is also affected by high levels of CSP. Based on these data, the linkage of the rcrRPQ operon t o the competence regulon and the ability of the rcrRPQ mutants to take up DNA w ere carefully assessed. Results Competence D efect in rcrRPQ M utants The transformation efficiency of the mutants was strongly dependent on the expression of rcrR and on the ex pression levels of the rcrPQ, which encode the exporters (Table 5 1 ). Specifically, when compared with the wild type strain, the mutant, lacking both ABC exporters, had lower transformation efficiency when CSP was provided (~10 fold decrease), but h igher transformation efficiency than the parental strain in the absence of C SP (~100 fold increase) (Table 5 1 5 2 ). Of particular interest, we were unable to obtain even a single transformant of the strain, which lacks the MarR like regulator and overexpresses the ABC porter genes (Figure 5 1, Figure 5 2) as well as the strain lacking all three genes ( 835 7np ), regardless of whether exogenous CSP was added or not (Table 5 1 5 2 ). We also attempte d to

PAGE 121

121 transform the and 835 7np mutants with plasmid pMSP3535 (32) which like pDL278 is a shuttle vector, b ut it carries an erythromycin marker instead of spectinomycin resistance, as well as with the pJL105 integration vector (Table 2 1 ). In no case were transformants isola t ed (data not shown). r (8) was used to replace the SMu0835 gene ( 835polar ). qRT PCR analysis of the polar mutant revealed that rcrP and rcrQ were expressed at levels similar to the wild type strain (Table 5 1 Fig ure 3 2, Figure 3 3 Figure 5 1 ). We determine d that the expression of the genes downstream of the polar marker did not arise from an internal promoter in rcrR e rcrP gene behind a reporter gene gave no detectable expression in S. mutans (data not shown). Instead, since loss of RcrR caused roughly a 100 fold increase in the transcription of SMu0836 7 (Table 5 1 Fig ure 3 2 Figure 5 1 ), we believe that high level activation of the SMu0835 promoter in the strain lacking th e MarR like regu lator leads to more read through of the terminator in the observed results would be expected. Importantly, the 835polar strain, lacking the MarR regulator but expressing the ex porters at levels that were essentially the same as the wild type strain was hyper transformable (Table 5 1, Table 5 2). In particular, even in the absence of exogenously added sCSP nearly 10 4 fold more transformants were obtained than with the wild type strain (Table 5 1, Table 5 2 ). To determine if the results were due to loss of the MarR like transcriptional repressor, as well as to changes in the transcription of the ABC porter genes, we introduced a wild type copy of the SMu0835 gene expressed from i ts own promoter on

PAGE 122

122 the shuttle plasmid pDL278 into the and 837np mutant strains (Table 1, Fig ure 5 2 ) Complementation of the and mutants, strains 835 + (SJ361) and 835 + (SJ362) restored wild type transformation efficiency and wild type levels of SMu0836 gene expression (Figure 5 1, Figure 5 2 Table 5 2 ). However, introduction of the MarR like regulator into the strain lacking all three genes in strain 835 + 7np (SJ360) whi ch still lacked the SMu0836/7 transporters, did not restore transformation (Figure 5 3, Table 5 1 ). Clearly, then, the absolute expression levels of the ABC transporter genes, as well as the presence of the MarR like regulator, are critical for competence development. Since it is not possible to control the level of expression of complementing genes in S. mutans with any precision, we did not complement the mutant strains with the ABC transport genes in this study Thus, a more reliable picture of the co ntribution of these gene products to stress tolerance and their impact on competence was garnered by contrasting the behaviors of the various polar and non polar mutants, and complemented strains. Once the substrate(s) for the porters is identified, effic iency of translocation of the substrate(s) by particular mutants can be correlated with phenotype. SMu0835 7 (rcrRPQ) Affect comX and comY E xpression To begin to understand the basis for the changes in the transformation efficiency in strains with aberra nt expression of the gene s for the MarR like regulator and ABC transporters, we measured the expression of comD, comX and comYA in the different mutant strains by qRT PCR (8, 156) ComD is the response regulator in the two component system involved in sensing of CSP, comX encodes an alternative sigma factor that is under the control of ComD, and comYA is required for competence development a nd is transcriptionally activated by ComX. The qRT PCR analysis

PAGE 123

123 showed that the expression of comD was not affected in the mutant strains compared to the wild type strain (data not shown). In contrast, the expression of c omYA was down regulated nearly 15 fold in the non transformable and 835 837np mutants, and up regulated by more than 100 fold in the hyper transformable polar strain (Fig ure 5 4, Figure 5 5 ). Interestingly, the expression of comX was up regulated nearly 100 fold in both the 835np and mutant strains (Fig ure 5 6, Figure 5 7) but the effect on comY expression in these strains was markedly different. Therefore, the effects of mutations in, or changes in the expression levels of, Smu 0835 7 may affect competence by interfering with ComX activation of comY Also relevant is that complementation analysis revealed that the 835 + and 835 + strains expressed wild type levels of comX and comYA (Figure 5 5 Figure 5 7 ). Di fferences in Growth of Mutant Strains in the Presence of CSP High levels of CSP (2 M) have been shown to cause growth inhibition of the wild type strain of S. mutans Th e CSP induced growth inhibition has been shown to be linked to comX levels, the induc tion of CipB bacteriocin and its i mmunity protein CipI, which is encoded downstream of the rcrRPQ operon (175) In S. pneumonia e compe tent cells produce lytic factors, such as bacteriocins whic h are targeted against non compe tent cells, as a phenomenon known as (44) However, some of the mechanisms for gro wth inhibition are not known. The growth of the mutants lacking rcrRPQ was tested with and without the addition of 2 M CSP. Interestingly, the 835p strain, which is hypertransformable was more sensitive to CSP induced growth inhibi tion than the wild ty pe strain (Figure 5 8, Figure 5 9 ). The wild type strain had a lag time of 5 hours whereas the 835p strain had a lag time of 15

PAGE 124

124 hours. However, the 835np strain, which is non transformable, and the 836p strain s were more resistant to growth inhibi tio n by CSP than the wild typ e strain (Figure 5 8, Figure 5 9 ). In fact, high levels of CSP impacted the growth of these strains very little. The wild type strain had a final OD of 0.5 whereas the 835np strain had a final OD of 0.7. Discussion Work presented herein adds a novel dimension to the control of genetic competence in S. mutans and likely in other naturally competent streptococci, by demonstrating that the RcrRPQ system plays a dominant role in modulating com gene expression and transf ormation in S. mutans. Notably, even after the addition of HS and CSP, no transformants could be obtained in the 835np mutant strain. The transformation deficiency of the strain was associated with decreased expression of comYA and aberrant regul ation of comX (Fig ure 5 4, Figure 5 6 ). The addition of SMu0835 (rcrR) back into the and strains restored wild type levels of comX and comYA expression and wild type transformation efficiency, whereas complementation of the 837np strain did not restore transformability. One explanation for the lack of transformation in the 835 + 837np strain could be due to the expression levels of rcrR In the 835 + 837np stain, rcrR was not expressed at wild type levels, but was actually overe xpressed when pr esent on plasmid pDL278 (Figure 5 1 ). Interestingly, we also constructed a strain in which we overexpressed rcrR in a wild type genetic background (Table 5 2 Figure 5 2 ). In this case, a reduction in transformation efficiency (data not s hown) and comYA expression (Figure 5 5 ) were noted. Therefore, the complete lack of transformability in the 835 + 837np

PAGE 125

125 complemented strain, versus the behavior of the strain lacking only the ABC porter genes ( 837np ) may be related to overexpression of rcrR Collectively, then, the data support the idea that RcrR has the ability to influence the expression of the com genes and transformation independently of the ABC transporters. We propose that the way in which Rcr R impacts competence is by negatively regulating the expression of a factor that interferes with ComX activation of comY Specifically, it is established that ComX is required for activation of comYA expression in response to CSP. However, parti cular m ut ants lacking RcrR (Figures 5 4 to 5 7 ) display up regulation of comX with concurrent down regulation of comY The simplest explanation for these findings is that RcrR represses the expression of an anti sigma factor, similar to the model in Streptococcus pneumoniae in which ComX activity is negatively controlled by the ComW anti sigma factor, blocking activation of late com gene expression (137, 216) Also, the lytic behavior of the cells in the presence of high concentrations of CSP was previously shown to be dependent on ComX (175) However, in bot h the and strains, comX levels were high but had opposite growth phenotypes in the presence of high CSP (Figure 5 8 Figure 5 9 ). Of note the levels of comYA and transformation efficiency were more indicative of the lytic behavior High l evels of comYA corresponded with higher transformation efficiency and more susceptibility to growth inhibition by CSP The effect of the rcr system on comY and competence appears not only to be affected by RcrR, but also to depend strongly on the level o f expression of the rcrPQ genes. In fact, one of the more intriguing aspects of this study is that defects in transformation are evident both with the loss of, and the overproduction of, the ABC

PAGE 126

126 porters. In particular, the mutant, which has no RcrR but expresses levels of rcrPQ that are similar to the wild type strain, for reasons explained in the results section, has an opposite phenotype to that of the strain, which overexpresses the rcrPQ genes by >100 fold. In this case, the po lar mutant was hypertransformable and displayed up regulation of comY whereas the strain could not be transformed, even when exogenous CSP was provided, and had low comY expression. Furthermore, the polar mutant, which had lost both porters, had reduced transformation efficiency compared to the wild type strain, reinforcing that the appropriate expression of the exporters is necessary for efficient transformation. The complementation data with the rcrR gene provide further evidence that app ropriate levels of the RcrPQ porters and proper regulation of the rcrRPQ operon are necessary for efficient transformation. In addition, overexpression of the genes encoding the porters, displayed a complete loss of transformation, as was seen in the 835 np strain where the ABC porters are also overexpressed (199) Consequently, whatever the RcrPQ exporters are externalizing is necessary for proper regulation and development of competence. Of note, we tested the transformation efficiency of a double kno ckout strain and observed a hypertransformable phenotype, as was seen in the strain carrying only the mutation, so the RcrPQ porters are probably not affecting the production or secretion of ComC. Also, the signal(s) being exported by these transpor ters have the potential to act from inside and/or outside the cell, since rcrPQ expression can neither be too high or too low if efficient transformation of cells is to occur.

PAGE 127

127 Table 5 1 Summary showing mutant strains, SMu0835 837 mRNA expression leve ls and transformation efficiency compared to the wild type strain. Strain SMu0835 Expression SMu0836 Expression SMu0837 Expression Transformation Efficiency +CSP Transformation Efficiency CSP 835np Deleted 100 fold Increase 100 fold Increase None* None 835p Deleted Wild type levels Wild type levels 10 fold Increase 10 4 fold Increase 835 837np Deleted Deleted Deleted None None 836p Wild type levels Deleted 1000 fold Decrease 10 fold Decrease 100 fold Increase 836 837np Wild type levels Deleted Deleted 10 fold Decrease 100 fold Increase 835 + Wild type levels Wild type levels Wild type levels Wild type levels Wild type levels 835 + Wild type levels Wild type levels Wild type levels Wild type levels Wild type levels 835 + 837np 10 fold Increase Deleted Deleted None None None = Zero transformants were detected when 0.04 ml of the transformation mixture was plated directly onto selective mediu m

PAGE 128

128 Table 5 2. Transformation efficiency of the wild type and various mutants strains in the presence or absence of added CSP Strain % Transformants* + CSP % Transformants CSP UA159 1.7 x 10 3 1.44 x 10 6 835np 0 0 835p 4.0 x 10 2 1.0 x 10 2 835 837np 0 0 836p 1.87 x 10 4 2.39 x 10 4 836 837np 1.61 x 10 4 1.24 x 10 4 tpx np 3.25 x 10 3 2.26 x 10 6 % transformants = (number of transformants/total viable bacteria) x 100. +CSP, exogenous CSP added; CSP, no CSP added

PAGE 129

129 Figure 5 1. RealTime RT PCR showing SMu0836 (rcrP) mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data presented as the copy number of each gene per g of input RNA. *, Differs from the wild test). These data were generated by Ann Sagstetter Decker in the summer of 2010, who was a dental student doing research on the rcrRPQ operon and competence

PAGE 130

130 Figure 5 2 RealTime RT PCR showing SMu 0835 (rcrR) mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data presented as the copy number of each gene per g of input RNA. *, Differs from the wild type at p t test ). **, Differs f rom the wild type at p <0.005 The s e data w ere generated by Ann Sagstetter Decker in the summer of 2010 who was a dental student doing research on the rcrRPQ operon and competence

PAGE 131

131 Figure 5 3 Transformability of the complemented strains compared to the mutant and wild type strains. Cultures were grown to OD 600 =0.15 and either 0 or 100 nM CSP was added to the cells for 15 mins. Plasmid pPMSP3535 (500 ng) was plated on BHI agar with erythromycin. This data were g enerated by Sang Joon Ahn, Ph.D

PAGE 132

132 Figure 5 4. RealTime RT PCR showing comYA mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data presented as the copy number of each gene per g of input RNA. *, Differs from the wild type at p t test).

PAGE 133

133 Figure 5 5. Re alTime RT PCR showing com YA mRNA levels in complemented strains. Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data presented as the copy number of each gene per g of input RNA. *, Differs from the wild type at p <0.05. These data were generated by Ann Sagstetter Decker in the summer of 2010, who was a dental student doing research on the rcrRPQ operon and competence

PAGE 134

134 Figure 5 6. RealTime RT PCR showing comX mRNA levels Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data presented as the copy number of each gene per g of input RNA. *, Differs from the wild type at p t test).

PAGE 135

135 Figure 5 7 RealTime RT PCR showing com X mRNA levels in complemented strains. Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done us ing gene specific primers followed by qReal Time PCR. The data presented as the copy number of each gene per g of input RNA *, Differs from the wild type at p t test). This data were generated by Ann Sagstetter Decker in the Summer of 2010, who was a dental student doing research on the rcrRPQ operon and competence

PAGE 136

136 Figure 5 8 Growth comparison of wild type versus mutant strains in BHI. The strains were grown in triplicate to mid exponential phase in BHI broth, diluted 1:100 and transferred to fresh BHI broth, overlaid with sterile mineral oil and placed in a Bioscreen C at 37C to monitor growth. WT, diamonds; 835np squares; 835 p triangles. The results are representative of three independent experiments performed triplicate. T able 5 3. Table showing growth characteristics of the mutant s versus the wild type strain in BHI Strain WT 835np 835p Final OD 0.8 0.02 0.78 0.02 0.68 0.027 Doubling Time (min) 41 1.7 61 8.5 101 19.4 Lag time (h) 3 3 5 OD 600 Time (hrs)

PAGE 137

137 Figure 5 9 Growth comparison of wild type versus mutant strains in 2 M CSP The strains were grown in triplicate to mid exponential phase in BHI broth, diluted 1:100 and transferred to fresh BHI broth containing 2 M CSP overlaid with sterile mineral oil and placed in a Bioscreen C at 37C to monitor growth. WT, diamonds; 835np squares; 835 p triangles. The results are representative of three indepen dent experiments performed triplicate. T able 5 4. Table showing growth characteristics of the mutant s versus the wild type strain in BHI + 2 M CSP. Strain WT 835np 835 p Final OD 0.51 0.06 0.73 0.02 0.54 0.07 Doubling Time (min) 136 9 69 3 ** 143 34 Lag time (h) 3 3.5 15 **, Differs from the wild type strain, at P<0.005.

PAGE 138

138 CHAPTER 6 REGULATION OF GENE EXPRESSION AND COMPETENCE BY THE SMU0835 ( RcrR ) PROTEIN Introduction Our studies thus far have identified an uncharacterized operon which we named rcrRPQ for r el c ompetence r elated, which is involved in stress tolerance, (p)ppGpp metabolism and competence. The rcrRPQ operon encodes a predicted DNA binding protein from the MarR family of transcriptional regulators (RcrR) and two predicted ABC efflux pumps are encoded by rcrP and rcrQ It was found that loss of or chan ges in the expression levels of the rcrRPQ operon elicited profound e ffects on the ability of the bacteria to be transformed w ith chromosomal or plasmid DNA and on the expression of selected early and late competence genes. RcrR was shown to be the dominant regulator of the operon, and a deletion of the rcrR gene with a no n polar kanamycin resistance marker ( ) caused the upregulation of the genes encoding the rcrPQ efflux pumps by ~100 fold Of note, the mutant strain was no longer able to take up DNA and the expression of comYA which is critical for the deve lopment of competence, was greatly reduced compared to the wild type strain ; even though comX mRNA levels were very high. In contrast, a strain carrying a replacement of rcrR with a polar kanamycin resistance cassette ( ) was constitutively hypertrans formable and the comX and comYA genes were both significantly upregulated. Interestingly, expression of the rcrPQ genes encoding the ex porters in the strain was similar to wild type levels for reasons explained in Chapter 5 (199) Therefore, based on the phenotype displayed by the p and strains, the tight regulation of the production of the RcrPQ efflux pumps by RcrR and also RcrR itself appear to play critical roles in the regulation of competence development. Additionally, in a strain

PAGE 139

139 where extra copies of the gene encodin g the rcrR regulator were expressed on the pDL278 pla smid in a wild type background ( SJ354 Table 2 1), no transformants were obtained in the absence of exogenous CSP (Figure 5 3), suggesting that this regulator plays a key role in regulating the rcrRPQ op eron and potentially other genes. However, the mechanisms by which the rcrRPQ operon exerts multiple effects on competence gene expression and how these gene products integrate competence with stress tolerance and (p)ppGpp metabolism have not yet been ide ntified MarR type regulators have been shown to control the expression of many genes, often those encoding efflux pumps, and have been shown to be important in stress tolerance and adaptation to environmental stresses (60) Most MarR regulators prevent gene expression by sterically interfering with RNA polymerase binding to the promoter to block transcription (172) Since the previous findings show that RcrR has such a profound effect on the rcrRPQ operon, DNA uptake and expression of competence genes, it is e ssential to understand the mechanism by which RcrR regulates gene expression and the physiology of the organism. Here, we examine the interactions of the RcrR protein with potential target sequences in S. mutans and show that RcrR has both direct and indir ect roles in controlling competence, growth and stress tolerance. Results Identification o f Rcr R Binding Sites G iven the critical impact of the rcrRPQ genes on key virulence related phenotypes, dissecting the basis for regulation of the rcr operon and comp etence genes by the RcrR protein is an essential step toward understanding alternative mechanisms controlling the development of competence and regulating key aspects of cellular physiology. U sing EMSAs with purified recombinant RcrR (rRcrR) protein it was shown

PAGE 140

140 that a relatively small amount (2 pmoles) of rRcrR was able to impede the migration of a 140 bp PCR product containing the promoter region of rcrRPQ (Figure 6 1 ). To examine more directly the interaction of RcrR with the rcr operon promoter region, we demonstrated that DNA fragments that included as little as 87 bp immediately upstream of the rcrR ATG start codon (data not shown) could be shifted with apparent high affinity by purified rRcrR in EMSA s To further understand the interaction of RcrR with the promoter region of rcrRPQ we utilized RegPrecise ( http://regprecise.lbl.gov/RegPrecise/browse_regulogs.jsp ) to identify a potential psuedopalindromic RcrR target TAGTTT TCATGAGAACTA (Figure 6 2) 51 bp upstream of the start codon of rcrR designated here as RS1. Another 15 bp region (TAGTTTAAGGAATCA) designated RS2, was identified directly upstream of RS1 (Figure 6 2). A biotinylated DNA fragment that included only RS1 was not shifted by rRcrR (Figure 6 3 ), but rRcrR was able to alter the electrophoretic mobility of a PCR product that included RS1 plus 13 random base pairs added to t (Table 2 5, Fi gure 6 3 ). When the RegPrecise predicted binding site RS1 and the potential weaker binding site RS2 were both included in the target DNA, >80% of the DNA shifted when10 pmoles of rRcrR protein were present (Figure 6 3, Table 6 1 ). There was also a shift in DNA when an annealed 38 bp biotinylated oligonucleotide that only included the RegPrecise predicted site RS1, or a 55 bp oligo nucleotide that includ ed both predicted sites (Table 2 5 ), was combined with purified rRcrR protein (Figure 6 4 Table 6 2 ). Th e 55 bp fragment appeared to be bound slightly more efficiently than the 38 bp fragment as >80% of the former shifted with 5 pmoles of RcrR protein compared with approximately 46% of the latter. Unlabeled, annealed 38 bp and

PAGE 141

141 55 bp probes were added in incr easing proportions to 5 fmol of biotinylated 55 bp probe and 1 pmol of purified protein. Both unlabeled probes were able to decrease the amount of biotinylated DNA that was shifted (Figure 6 5 Table 6 3 ). In addition, preliminary results assessing binding via fluorescence polarization using the same 38 and 55 bp annealed probes that had been tagged with 6 indicated that the calculated binding constants for the two fragments exposed to identical concentrations of rRc rR did not differ substantially; the estimated K d for the 55 bp fragment was 0.1 M and the K d for the 38 bp fragment was 0.06 M. Mutations in t he Predicted Binding Sites Affect Binding of the RcrR Protein Based on the results of the EMSAs detailed above, various mutations were rcrRPQ operon in the S. mutans chromosome via splice overlap extension PCR and transformation (Table 2 1), and all mutations were confirmed by PCR and sequencing Subsequently, DNA from the promoter regions of the various mutant strains was obtained by PCR to investigate the effect of the mutations on the ability of rRcrR protein to bind. When the PCR product derived from the NBS1 strain, which had mutations in RS 1, was used, a decrease in the amount of shifting was observed (Figure 6 6 Table 6 4 ). When DNA from the promoter region of the BBS strain, containing mutations in both binding sites was used, there was about a 50% shift with 2.5 p moles of protein and less than 50% shift with 1.5 p moles of protein, compared to 90% of the product derived from the wild type organism (Figure 6 7 Table 6 5 ). However, when the probe was derived from the NBS2 strain, which had mutations only in the secon dary predicted binding site (RS2), there was no difference in the proportion of DNA shifted compared to the wild type DNA (Figure 6 8 ).

PAGE 142

142 Mutations in the B inding S ite of the rcrR P romoter A ffect C ompetence Given the impact that perturbations in expression of any of the rcrRPQ genes has on competence and the relatively inefficient binding observed for rRcrR to the mutated binding sites in vitro the transformation efficiency of the strains harboring the mutated binding sites was assessed with and without ad dition of exogenous synthetic CSP. The NBS1 strain, which has mutations in RS1 only (Table 2 1), displayed a 23 fold increase in transformation efficiency in the absence of added CSP compared to the wild type strain (Table 6 6 ). This hypertransformable phe notype was similar to that observed for the p strain (199) However, there was no difference between the NBS1 mutant and the parental strain in transformation efficiency when 100 nM CSP was added to the cultures (Table 6 6 ). Strain BBS which had mutations in both RS1 and RS2, yielded no transformants in the absence of exogenous CSP (Table 6 6 ), but a similar number of transformants as the wild type strain when CSP was included. Thus, mutation of the predicted binding sites for RcrR in fluenced the transformation phenotypes. We hypothesized that the different effects of the binding site mutations were associated with different expression levels of the operon, because some mutations affect only RcrR binding while others affect RcrR bindin g and promoter activity. Effect of the Mutations o n Promoter Activity To test the hypothesis that the mutations might impact both RcrR binding and promoter activity, lacZ promo ter fusions were made with DNA from the promoter regions of strains WT, NBS1 an d BBS galactosidase assays show ed that there was increased activity with the P BBS promoter from the strain with mutations in both RS1 and RS2 (159 15 Miller units ) compared to the P WT promoter (69 7.3 Miller units ) (Figure 6 9 ), but only a slightly e levated level of expression from the P NBS1 promoter (88 7.4

PAGE 143

143 Miller units ). Therefore, the activity of the rcrRPQ promoter is affected differently in the binding site mutants, and this in turn influences the competence phenotype. We also concluded that th e way that RNA polymerase interacts with the promoters in the BBS and NBS1 strains is different resulting in variations in the promoter activity. Mutations in the rcrR Binding Site Affect comX comS and comYA E xpression To determine if the phenotypes of the binding site mutants could be associated with com gene expression levels, we used qRT PCR to measure the mRNAs for comX, comS and comYA which are critical genes in the development of competence. The NBS1 strain, which was hyper trans formable, had an approximate 30 fold increase in the expression of comYA and about a 20 fold increase in expression of comS compared to the wild type strain (Figure 6 10 Figure 6 11 ). The magnitude of the change in expression of comYA and comS was simil 835 p strain [ (199) Figure 6 10 ] There was also about a 4 fold increase in comX expression in the NBS1 strain compared to the wild type strain (Figure 6 12 ). The levels of comYA were slightly lower in the BBS strain, albeit not statistically different from the wild type strain (Figure 6 10 ), following a trend similar to that observed for the strain (199) Effect of the M utations in the rcrR Binding S ite on rcrR and rcrP E xpression Previously, we showed that the expression of the com genes was dependent on the expression of the rcrRPQ operon (199) Mutations in the RcrR binding site affected the ability of r RcrR to bind efficiently, and galactosidase activity from promoters with mutations in the RcrR binding site was significantly higher than activity from the wild type promoter. Therefore we used qRT PCR to measure the mRNAs for rcrR and rcrP in the NBS1 strains and the BBS strains. There was no significant difference in the

PAGE 144

144 expression of rcrR or rcrP in the NBS1 strain or the BBS strain compared to the wild type expression levels (Figure 6 13, Figure 6 14). Mutation s in the P redicted RcrR Binding S ite Affects Growth in CSP apparent inhibition of growth of S mutans (57, 187, 233) in part due to cell lysis and the induction of the CipB bacteriocin. Of note, the CipI protein co nfers resistance to CipB and is encoded about 1 kbp downstream of rcrRPQ. Our previous findings show that strains with mutations in the rcrRPQ operon grew differently than the wild type strain in ith the transformation phenotypes, the strain was resistant to CSP induced growth inhibition, whereas the strain was hypersensitive to CSP. Interestingly, the NBS1 strain was more sensitive to CSP, as noted by a slight decrease in growth rate with a minimum doubling time of 87 6 min, compared to the wild type strain with a minimum doubling time of 82 10 min (Figure 6 15 Figure 6 16 ). However, the wild type strain attained a final OD 600 = 0.55 0.012, whereas the NBS1 strain reached a final OD 600 of only 0.45 0.07. The BBS strain was more resistant to CSP induced growth inhibition (Figure 6 16 ) when compared to the parental strain, with a final yield of OD 600 = 0.7 0.011 in CS P and minimum doubling time of 56 3 min (p value <0.005 compared to the wild type doubling time). Of note, expression of rcrR from its cognate promoter on a multi copy plasmid in a wild type genetic background also conferred resistant to CSP induced growth inhibition (Figure 6 17 ), with the overexpressing strain achieving a final yield of OD 600 = 0.85, compared to the wild type strain with a final yield of OD 600 = 0.65

PAGE 145

145 Global Regul ation by the RcrR Re gulator Mutations of rcrR and aberrant expression the RcrPQ exporters affect genes in the c ompetence pathway and impacts (p)ppGpp metabolism (199) Here, we utilized RNA seq and microarray analysis to show that numerous genes that are critical for the development of competence are regulated by the rcrRPQ genes (Tables 6 7,6 8,6 9). The most upregulated regulated genes in the hypertransformable strain were c omX, comY, comF, and comEA but in the non transformable n p strain (Table 6 9) comYA was among the most downregulated genes in a microarray s tudy (Table 6 7) Our previous qRT PCR studies also showed that comYA comX and comS are affected by mutations in the rcrRPQ operon (199) and that a strain that overexpresses rcrR also causes a decrease in transformation and diminished sensitivity to growth inhibition by CSP (Figure 6 16 Figu re 6 17 ). RcrR Has A Weak Interaction With the comX and relP Promoter Region Since the deletion of rcrR had dramatic effects on the expression of many of the genes in the competence pathway and other genes, we scanned for genes with RS1/2 sites and conducted EMSAs to determine if the effects on the expression of particular genes could be exerted directly by the binding of RcrR to the promoter regions of these genes. The promoter regions of relP comX and comY had sequences with weak similarity to the RS1 binding site based on the wMATCHER software analysis to find target sequences. Purified rRcrR protein was able to bind to the promoters of comX, and relP albeit with apparently lower affinity than to the promoter of the rcrRPQ operon (Figure 6 18, Figure 6 19 ) as well as comYA (data not shown). Specifically, there was approximately a 10% shift of the comX and relP promoter region s when 20 pmol es of rRcrR was utilized, compared to 100% shift with 10 pmol of rRcrR when the rcrRPQ

PAGE 146

146 promoter was the target. As a negative control, we utilized the promoter of fruA encoding a polysaccharide hydrolase that is not affe cted by mutations in the rcr genes, and observed no shift in mobility even with as much as 100 pmol of purified protein. Discussion The development of competence by S. mutans is a tightly regulated process that is influenced by multiple regulatory factors and inputs, many of which have yet to be characterized. Competence is considered to be a stress response and its induction in bacteria has been linked to translational errors, (p)ppGpp production, antibiotic stress, bacteriocin production and oxidative s tress (61, 175, 199) The rcrRPQ operon is also involved in stress tolerance, particularly oxidative stress, and has a profound effe ct on competence; constituting a regulatory circuit for competence that was previously undiscovered (199) The studies described in this chapter provide novel insights into the mechanisms by which the products of the rcrRPQ operon integrate competence stress tolerance and growth regulation with genetic competence. The simplest model for regulation of the rcrRPQ operon is that the RcrR regulator binds the promoter region of rcr to repress the operon. Based on the EMSA data, the Regprecise predicted binding site (RS1 ) TAGTTTTCATGAGAACTA is the maj or binding site, since oligo nucleotide s containing that region were suffi cient to support rRcrR binding. The sequence of RS1 is similar to typical MarR binding sites, which usually consist of palindromic or psuedopalindromic sequences (236) Further support for the model was gleaned by demonstrating that mutations in RS1 caused attenuated binding of the rRcrR protein in vitro and had effects in vi vo on transformation efficiency, growth and gene expression that were similar to what would be predicted for loss of RcrR. The weaker predicted binding site ( RS2), TAGTTTAAGGAATCA does not appear to be

PAGE 147

147 necessary for binding, at least in vitro since mutati ons made only in that site did not affect rRcrR binding Mutations in RS2 also did not affect the organism in any discernable way However when both predicted binding sites are present, a greater percentage of DNA is shifted, perhaps reflecting that bi nding can be enhanced by the second binding site through cooperative interactions. We also noted that rRcrR binding, like that of many regulators of the MarR family bound more efficiently when additional sequences of 5 to 30 bp were provided adjacent to the binding site (236) Mutations to the binding site in the promoter region of rcrRPQ operon caused the strains to have differences in transformability and aberrant expression of the com genes co mpared to the wild type strain. Based on our previous findings that revealed a dominant role for the RcrR protein on transformation and expression of the rcr operon and com genes (199) we conclude that the inability o f RcrR to bind effectively to its target sequences to control rcrRPQ operon expression levels resulted in the changes in transformability, com gene expression and growth. However, we did not detect any significant changes in the expression of the rcrRPQ o peron in the NBS1 and BBS strains via qRT PCR (Figure 6 13, Figure 6 14 ) even though we detected higher promoter activity in these strains compared to the wild type strain. We posit using gene fusion that the qRT PCR was not sufficiently sensitive to measure biologically significant changes in the expression of the operon, and that even small fluctuations in the expression levels of rcrRPQ may account for observable differences in transformation effic iency and com gene expression. A large increase in the expression of rcrPQ was seen in the strain because the gene encoding RcrR was disrupted which resulted in complete derepression of the operon (199) Notably, the BBS strain which

PAGE 148

148 had the highest promoter activity as a result of de repression had a similar phenotype to the strain In addition, in the SJ354 strain, where there were extra copies of rcrR expressed in a wild type genetic background, there was not a hu ge impact on the expression of rcrPQ but there was a signific ant effect on growth in CSP, transformation efficiency and comYA levels (199) Our previous findings also indicate that any changes to the levels of the gene encoding Rc r R affected transformability and the expression of some of the com genes (199) Collectively, these data show the important role that RcrR and efficient binding of R crR to its cognate DNA sequences have on transformation and expression of the competence genes. Consistent with the phenotype displayed with strains harboring various mutations in rcrR microarray and RNA seq revealed that genes in the competence pathway are the most differentially regulated when there are mutations in rcrR The basis for this change in expression could be due to a weak interaction of RcrR with the promoters of these genes, since weak binding of rRcrR protein in vitro to the comX and com YA promoters was observed. Many MarR type regulators have co factors, such as biochemical intermediates or other small molecules that may be present in vivo that affect binding to DNA to control gene expression (172) Therefore, there may be other factors in vivo that affect binding of RcrR to the com genes that were absent in the EMSA analysis so RcrR could probably play a significant role in regulating com genes. Importantly, the rcrRPQ operon was shown to be involved in stress tolerance and its expression was enhanced in response to environmental insult (123, 199) Consequently, as part of our working model (Figure 7 1 ), the impact of RcrR on com gene expression may be enhanced when rcrRPQ become derepressed.

PAGE 149

149 The difference in growth phenotype of the mutant strains in CSP is more than likely linked to the changes in expression of the competence genes in these strains It has been previously shown that inactivation of certain com genes analyzed in this study cause the cells to become insensitive to CSP induced growth inhibition (175) Also, we have observed that ex pression of the com genes becomes insensitive to added CSP in the rcr R PQ mutants, unlike in the wild type strain where com genes are induced by CSP (data not shown). Of note, comX mRNA levels were high in strains that were both resistant and sensitive to CSP induced growth inhibition which is a surprising finding since it is believed that the induction of comX correlates with lysis and growth inhibition by CSP (117) However, the levels of comY correlate well with the sensitivity to CSP in the strains tested here, as does transformation. The sensitive strains such as and NBS1 were hypertransformable and had high levels of comYA compared with t he resistant strains such as BBS and which had lower levels of comYA and were poorly or non transformable. Our previous findings (199) and the transcriptional profiling with rcrR mutants presented in this study clearly show that the activity of ComX is affected in the CSP resistant strain even though comX expression is high comY levels are low (199) Therefore, it appears that ComX dependent activation of comY and other downstream genes is critical for growth sensitivity to CSP. It is known that fratricide or cell death is necessary for the induction of competen ce in S. pneumoniae biofilms (229) and we also see a correlation with transformability and sensitivity to CSP The induction of bacteriocins was also linked to cell lysis and growth inhibition with high levels of CSP (175, 233) The rcrRPQ operon also appears to be impacting the expression of the bacteriocin genes and bacteriocin production (Ahn et

PAGE 150

150 al. manuscript in preparation) and the RNA seq data show that at least two bacteriocin related genes were upregulated in strain (Table 6 9 ). Ther efore, the effect that the rcrRPQ operon exerts on the bacteriocins and their immunity proteins may be part of the explanation for the differences in growth in CSP. While the data clearly provide evidence of a direct role for RcrR in competence regulation, the expression levels of the genes encoding the rcrPQ pumps, which are under the dominant control of RcrR, must be acknowledged as a major factor controlling late com gene expression and transformation efficiency (199) 836p strain, which lacks rcrP and expresses 1000 fold lower levels of rcrQ ABC pumps than the strain, had higher levels of comYA and higher transformation efficiency than the wild type strain without additional CSP (199) In addition, we have data showing that overexpression of the ABC exporters causes a dramatic reduction in transformation efficiency an d affects the expression of the competence genes (Ahn et al. manuscript in preparation). These data further support our hypothesis that the efflux pumps may be extruding a compound necessary to activate competence. This signal could function in a similar manner to the competence sporulation factor (CSF) in B. subtilis (141, 206) or act as an anti anti sigma factor that interferes with a factor such as ComW, that impairs ComX stability and activation of comYA as seen in S. pneum oniae (137, 216) The inability of RcrR t o bind efficiently to the promoter of the rcr operon and differences in promoter activity could result in slight alterations in the amount of localization of the substrate(s) in the NBS1 and BBS strains. The signal(s) probably need to be balanced carefully where slight fluctuations in their localization can result in differences in the expression of the competence genes and transformation efficiency. Current efforts are

PAGE 151

151 focused on identifying small molecules that RcrPQ are extruding and other factors that i nteract with RcrR. In conclusion, the current findings in this c hapter in addition to our previous findings show that tight control of the rcrRPQ operon by RcrR interacting with its binding site in the promoter region strongly influences the expression of the competence genes and transformation. We also show RcrR is a master regulator and may directly influence com gene expression, as well as relP by interacting with their promoters. The potential for RcrR to interact with the relP promoter may be one of the explanations for the linkage of the rcrRPQ operon to (p)ppGpp metabolism, as previously reported (199) As part of our working model, we propose that competence and RelP dependent (p)ppGpp metabolism are both controlled by RcrR and the rcrRPQ operon to fine tune how the organism responds to different environmental signals (Figure 7 1,7 2 ). It is also reasonable to hypothesize that RcrRPQ and the RcrPQ substrate(s) could play an important role in bi stable behavior associated with CSP and competence, as well as influ encing decisions by the c ell to become competent or lyses Thus, RcrRPQ may provide the potential missing link between the ComRS and CSP signaling pathways, as well as between bacteriocin production and competence development, as proposed by Lemme et al., Levesque and co workers, and the Morrison group (57, 63, 116)

PAGE 152

152 Figure 6 1. EMSA showing binding of biotinylated regions of P rcrR DNA with purified RcrR protein. Purified RcrR protein of various concentrations (0, 2.5, 5, 10, 20 pmol es, Lanes 1 5) was added to 5 fmol es of biotinylated PrcrR DNA in a binding react ion for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence

PAGE 153

153 Figure 6 2 Schematic of the promoter region of the rcrRPQ operon in S. mutans UA159. The ATG start site is highlighted and u nderlined. The 10 region (TATAAT) is located 56 bp upstream of the start site and the 35 region (TTGACA) is located 79 bp upstream. An 18 bp binding site located 51 bp upstream of the start site was identified via RegPrecise (http://regprecise.lbl.gov/ RegPrecise/browse_regulogs.jsp) software prediction tool. The predicted binding site sequence RS1 is TAGTTTTCATGAGAACTA. The secondary predicted site RS2 is TAGTTTAAGGAATCA.

PAGE 154

154 Figure 6 3 EMSA showing binding of biotinylated PCR products of P rcrR with purified RcrR protein. Purified RcrR pro tein (10 pmol) was added to 5 fmol es of biotinylated P rcrR PCR products RS, RS1+ random and RS1+2 in a binding reaction for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal obs erved via chemiluminescence The data are a representative of n= 3 EMSAs. There was a similar trend observed in all cases. T able 6 1 Percentage of DNA shifted with different PCR products of t he promoter of rcrR RS1 RS1 + random RS1 + 2 0 % shift 61 % shift 83 % shift % shift calculated as % reduction in the integrated density value (IDV) of the DNA bands compared to the IDV of unshifted DNA band with no protein.

PAGE 155

155 Figure 6 4 EMSA showing binding of biotinylated oligos of P rcrR DNA with purified RcrR prot ein. Purified RcrR pro tein of various concentrations was added to 5 fmol es of biotinylated P rcrR DNA fragments 38 bp and 55 bp in a binding reaction for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemi luminescence The data are a representative of n=2 EMSAs. There was a similar trend observed in both cases. TABLE 6 2 Percentage of DNA shifted with different annealed oligos in the promoter of rcrR Region 1.5 pmol RcrR 2.5 pmol RcrR 5 pmol RcrR 38 bp 20 % shift 20 % shift 46 % shift 55 bp 43 % shift 74 % shift 83 % shift % shift calculated as % reduction in the integrated density value (IDV) of the DNA bands compared to the IDV of unshifted DNA band with no protein.

PAGE 156

156 Figure 6 5 EMSA showing competitive binding of biotinylated regions of P rcrR DNA with unlabeled regions of P rcr DNA and purified RcrR protein. P urified RcrR protein (1 pmol) was added to 5 fmol es of biotinylated P rcrR DNA fragment 55 bp with increasing concentration of unlabeled P rcr DNA fragments in a binding reaction for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n=2 EMSAs. There was a similar trend observed in both cases. T able 6 3 Percentage of labeled P rc r R DNA shifted with unlabeled oligo competitors of P rcrR DNA Unlabeled region 0 x unlabeled DNA 10 x unlabeled DNA 50 x unlabeled DNA 38 bp 59 % shift 31 % shift 10 % shift 55 bp 59 % shift 27 % shift 14 % shift % shift calculated as % reduction in the integrated density value (IDV) of the DNA bands compared to the IDV of unshifted DNA band with no protein.

PAGE 157

157 Figure 6 6 EMSA showing binding of biotinylated P NBS1 mutated regions of P rcrR DNA with purified RcrR protein. Various concentrations of RcrR pro tein was added to 5 fmol es of biotinylated wild type P rcrR DNA fragment (P WT ) and mutated P rcr DNA fragment (P NBS1 ) in a binding reaction for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n=3 EMSAs. There was a similar trend observed in all cases. T able 6 4 Percentage of P WT DNA vs. P NBS 1 DNA shifted at different protein concentrations Protein concentration % shift of PWT DNA % shift of PN BS DNA 2.5 pmol 54% shift 27% shift 5 pmol 90 % shift 46% shift % shift calculated as % reduction in the integrated density value (IDV) of the DNA bands compared to the IDV of unshifted DNA band with no protein.

PAGE 158

158 Figure 6 7 EMSA showing binding of biotinylated P BBS mutated regions of P rcrR DNA with purified RcrR protein. Various concentrations of RcrR pro tein was added to 5 fmol es of biotinylated wild type P rcrR DNA fragment (P WT ) and mutated P rcr DNA fragment (P BBS ) in a binding reaction for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n=3 EMSAs. There was a similar trend observed in all cases. T able 6 5 Percentage of P WT DNA vs. P BBS DNA shifted at different protein concentrations Protein concentration % shift of PWT DNA % shift of PBBS DNA 1.5 pmol 76 % shift 5 % shift 2.5 pmol 87 % shift 29 % shift 5 pmol 95% shift 92 % shift % shift calculated as % reduction in the integrated density value (IDV) of the DNA bands compared to the IDV of unshifted DNA band with no protein.

PAGE 159

159 Figure 6 8. EMSA showing binding of biotinylated P N BS 2 mutated regions of P rcrR DNA with purified RcrR protein. Various concentrations of RcrR p ro tein was added to 5 fmol es of biotinylated wild type P rcrR DNA fragment (P WT ) and mutated P rcr DNA fragment (P NBS2 ) in a binding reaction for 40 min. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n=2 EMSAs. There was a similar trend observed in both cases.

PAGE 160

160 T able 6 6. Transformation efficiency of the wild type and SOE mutants strains in the presence or absence of added CSP Strain % Transformants + CSP % Transformants CSP UA159 5.29 x 10 3 9.33 x 10 6 NBS1 3.03 x 10 3 2.18 x 10 4 NBS2 2.19 x 10 3 4.76 x 10 6 BBS 1.1 x 10 3 0 % transformants = (number of transformants/total viable bacteria) x 100. +CSP, exogenous CSP

PAGE 161

161 Figure 6 9 galactosidase activity from rcrR promoter s that contained various mutations The rcrR promote rs with the different mutations w ere fused to a promoterless lacZ gene in the p MZ integration vector. The lacZ promoter fusion was transformed into the wild typ e strain. In all cases cells were grown to mid exponential phase (OD 600 = 0.5) and galactosidase activity measured as reported in the methods section The results are from three independent experiments performed in at least triplicate. *, Differs from the wild type at p t Test ) **, Differs from the PWT at p <0.005. !!, Differs from PNBS1 at p <0.005.

PAGE 162

162 Figure 6 10 RealTime RT PCR showing com YA mRNA levels in strains with mutations in the RcrR binding site Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data are presented as log of the copy number of each gene per g of input RNA. *, Differs from the wild type at p < t test). !, Differs from the NB S 1 strain at p t test).

PAGE 163

163 Figure 6 11 RealTime RT PCR showing com S mRNA levels in strains with mutations in the RcrR binding site Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Ti me PCR. The data are presented as log of the copy number of each gene per g of input RNA. *, Differs from the wild type at p < t test). !, D iffers from the NBS1 strain at p <0.05

PAGE 164

164 Figure 6 1 2 RealTime RT PCR showing com X mRNA levels in strains with mutations in the RcrR binding site Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data are presented as the copy number of each gene per g of input RNA. *, Differs from the wild type at p < 0.05 t test). !, Differs fro m the NBS1 strain at p <0.05 t test).

PAGE 165

165 Figure 6 13. RealTime RT PCR showing rcrR mRNA levels in strains with mutations in the RcrR binding site. Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qReal Time PCR. The data are presented as the log of the copy number of each gene per g of input RNA. Differs from the wild type at p < 0.0 0 t test).

PAGE 166

166 Figure 6 14. RealTime RT PCR showing rcrP mRNA levels in the strains with mutations in the RcrR binding site Cells were grown to mid exponential phase (OD 600 =0.5), total RNA was extracted and RT was done using gene specific primers followed by qRea l Time PCR. The data are presented as the log of the copy number of each gene per g of input RNA. Differs from the wild type at p < 0.0 5 t test).

PAGE 167

167 Figure 6 1 5 Growth comparison of wild type and mutant strains in BHI The strains were grown in triplicate to mid exponential phase in BHI broth, diluted 1:100 and transferred to fresh BHI broth, overlaid with sterile mineral oil and placed in a Bioscreen C at 37 C to monitor growth. WT, diamonds; NBS1 squares; BBS triangles 835np and 835p The results are representative of three independent experiments performed triplicate.

PAGE 168

168 Figure 6 1 6 Growth comparison of wild type vs. mutant strains in 2 M CSP The strains were grown in triplicate to mid exponential phase in BHI broth, diluted 1:100 and transferred to fresh BHI broth containing 2 M CSP overlaid with sterile mineral oil and placed in a Bioscreen C at 37 C to monitor growth. WT, diamonds; NBS1 squares; BBS triangles, 835np 835p The results are representative of three independent experiments performed triplicate The statistical analysis on the doubling times and final ODs are detailed in the results section describing the growth phenotype.

PAGE 169

169 Figure 6 17 Growth comparison of wild type vs. SJ 354 in 2 M CSP The strains were grown in triplicate to mid exponential phase in BHI broth, diluted 1:100 and transferred to fresh BHI broth containing 2 M CSP overlaid with sterile mineral oil and placed in a Bioscreen C at 37 C to monitor growth. W T, squares ; SJ354 The results are representative of three independent experiments performed triplicate. These data w ere generated by Ann Sagstetter Decker in the s ummer of 2010, who was a dental student doing research on the rcrRPQ operon and competence. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0:00:16 1:00:17 2:00:17 3:00:17 4:00:17 5:00:17 6:00:17 7:00:17 8:00:17 9:00:17 10:00:17 11:00:17 12:00:17 13:00:17 14:00:17 15:00:17 16:00:17 17:00:17 18:00:17 19:00:17 20:00:17 21:00:17 22:00:17 23:00:17 24:00:17 OD 600 Time (h)

PAGE 170

170 Figure 6 1 8 EMSA showing binding of the relP promoter with purified RcrR protein. Various concentrations of RcrR pro tein was added to 5 fmol es of biotinylated P relP DNA fragment in a binding reaction, P rcrR and P fruA were added as positive and negative controls for RcrR protein. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n=2 EMSAs. There was a similar trend observed in both cases.

PAGE 171

171 Figure 6 1 9 EMSA showing binding of the comX promoter with purified RcrR protein. Various concentrations of RcrR pro tein was added to 5 fmol es of biotinylated P relP DNA fragment in a binding reaction, P r crR and P fruA were added as positive and negative controls for RcrR protein. The reactions were run on a non denaturing polyacrylamide gel and the signal observed via chemiluminescence The data are a representative of n=4 EMSAs. There was a similar trend observed in all ca ses.

PAGE 172

172 Table 6 7 Genes differentially regulated in the 835np strain vs. wild type strain via microarray analysis Parametric p value Fold change Unique id Description Gene symbol 1.00E 07 24.8 SMU.1997 putative ComX1, transcriptional regulator of competence specific genes comX1 < 1e 07 21.5 SMU.922 putative ABC transporter, ATP binding protein 1.47E 05 11.0 SMU.923 putative ABC transporter, ATP binding protein 1.15E 05 6.2 1 SMU.64 Holliday junction DNA helicase RuvB ruvB 1.60E 06 5.31 SMU.65 putative protein tyrosine phosphatase 0.0014 3.14 SMU.1568 putative maltose/maltodextrin ABC transporter, sugar binding protein MalX malX 0.0048 3.11 SMU.574c hypothetical protein 0.0006 3.00 SMU.67 putative acyltransferase 0.0004 2.91 SMU.537 tryptophan synthase subunit beta trpB 0.0004 2.90 SMU.66 hypothetical protein 0.0007 2.61 SMU.1056 hypothetical protein 0.003 2.59 SMU.924 thiol peroxidase tpx 0.002 2.54 SMU.534 anthranilate phosphoribosyltransferase trpD 0.0015 2.52 SMU.1079c putative ABC transporter, ATP binding protein 0.001 2.41 SMU.535 indole 3 glycerol phosphate synthase trpC 0.0039 0.344 SMU.1968c hypothetical protein 0.002 0.336 SMU.493 formate acetyltransferase (pyruvate formate lyase 2) pfl2 0.0028 0.041 SMU.1982c hypothetical protein 7.16E 05 0.013 SMU.1985 ABC transporter ComYB comYB

PAGE 173

173 Table 6 8 Genes differentially regulated in the 835np strain vs wild type strain via RNA seq analysis Gene ID Gene Description Fold Change P value SMU.1997 c competence specific sigma factor 37.1 1.80 e 273 SMU.922 ABC type multidrug / protein/ lipid transport system 16.6 9.31 e 280 SMU.923 ABC type multidrug/protein/lipid transport system 13.6 5.04 e 246 SMU.09 small RNA binding protein 7.91 9.83 e 56 SMU.43 conserved hypothetical protein (possible site specific DNA methyltransferase/restriction modification enzyme) 7.76 3.71 e 31 SMU.1576 c hypothetical protein 7.62 3.26 e 21 SMU.44 conserved hypothetical protein 7.39 1.07e 25 SMU.64 Holliday junction DNA helicase 7.30 2.58e 139 SMU.1644 c conserved hypothetical protein 7.11 1.20e 96 SMU.46 hypothetical protein 5.36 3.01e 07 SMU.65 protein tyrosine phosphatase 4.98 1.51e 77 SMU.10 cell division protein DivIC 4.55 0.0001 SMU.1343 c polyketide synthase 4.02 9.74e 07 SMU.1250 c hypothetical protein 3.90 6.81 22 SMU.66 conserved hypothetical protein; possible phosphatidylinositol 4 phosphate 5 kinase 3.71 2.65e 36 SMU.533 anthranilate synthase 3.62 3.81e 33 SMU.1161 c conserved hypothetical protein 3.49 2.27e 11 SMU.438c (R) 2 hydroxyglutaryl CoA dehydratase activator related protein 3.46 6.53e 27 SMU.68 hypothetical protein 3.43 6.04e 12 SMU.534 phosphoribosyl anthranilate transferase 3.25 2.74e 39 SMU.1643 c conserved hypothetical protein 3.24 1.06e 08 SMU.1340 c bacitracin synthetase 1/ tyrocidin synthetase III 3.22 2.71e 07 SMU.537 tryptophan synthase 3.22 2.24e 43 SMU.532 anthranilate synthase 3.09 3.93e 39 SMU.928 sensor histidine kinase 0.476 1.09e 06 SMU.463 thioredoxin reductase (NADPH) 0.438 6.04e 26 SMU.1692 c pyruvate formate lyase activating enzyme 0.426 4.65e 25 SMU.540 peroxide resistance protein / iron binding protein 0.422 1.16e 36 SMU.924 thiol peroxidase 0.414 2.42e 24 SMU.179 conserved hypothetical protein (possible oxidoreductase) 0.365 4.21e 10 SMU.494 transaldolase family protein 0.361 5.46e 16

PAGE 174

174 Table 6 8. continued Gene ID Gene Description Fold Change P value SMU.491 transcriptional regulator 0.356 2.23e 11 SMU.838 glutathione reductase 0.348 1.10e 41 SMU.148 alcohol acetaldehyde dehydrogenase 0.329 3.05e 10 SMU.1955 c co chaperonin 10kDa 0.322 1.03 27 SMU.495 glycerol dehydrogenase 0.319 2.13e 27 SMU.460 amino acid ABC transporter 0.319 5.13e 22 SMU.629 superoxide dismutase 0.316 7.12e 64 SMU.996 ABC transporter 0.304 7.23e 06 SMU.120 50S ribosomal protein L28 0.302 4.94e 05 SMU.1703 c conserved hypothetical protein 0.299 3.45e 07 SMU.961 macrophage infectivity potentiator related protein 0.297 2.30e 19 SMU.1425 c ATP dependent Clp protease 0.295 4.72e 12 SMU.929c conserved hypothetical protein 0.292 3.35e 40 SMU.82 chaperone protein 0.285 4.56e 14 SMU.493 formate acetyltransferase (pyruvate formate lyase) 0.282 7.74e 43 SMU.962 acyl CoA dehydrogenase 0.239 6.88e 45 SMU.496c cysteine synthetase A 0.237 7.36e 17 SMU.1701 c conserved hypothetical protein 0.236 0.0001 SMU.80 heat inducible transcription repressor 0.229 1.43e 18 SMU.594 hypothetical protein 0.210 3.26e 05 SMU.81 co chaperone protein GrpE 0.209 7.74e 21 SMU.930c transcriptional regulator 0.203 2.52e 09 SMU.457 hypothetical protein 0.146 7.25e 05 SMU.1861 c hypothetical protein 0.140 6.12e 05 SMU.934 amino acid ABC transporter 0.112 4.65e 31 SMU.1185 c mannitol PTS EII 0.110 5.79e 66 SMU.935 amino acid ABC transporter 0.095 4.32e 30 SMU.933 amino acid ABC transporter 0.094 4.63e 39 SMU.936 amino acid ABC transporter 0.094 2.31e 27 SMU.921 transcriptional regulator 0.080 3.40e 39 SMU.932 conserved hypothetical protein 0.080 1.40e 44 SMU.1395 c hypothetical protein 0.038 1.52e 10 The data w ere generated by Sang Joon Ahn and col laborator Sang Chul Choi in the laboratory of Michael Stanhope at the University of Cornell (Ith a ca, NY).

PAGE 175

175 Table 6 9 Genes differentially regulated in the 835p strain vs wild type strain via RNA seq analysis Gene ID Gene Description Fold change P value SMU.1001 DNA processing protein 279 0 SMU.1987 c late competence protein; type II secretion system protein E 247 1.58e 32 SMU.1980 c conserved hypothetical protein 227 5.36e 86 SMU.498 late competence protein F 210 0 SMU.1983 c competence protein ComYD 209 1.99e 145 SMU.1984 c competence protein ComYC 203 4.35e 165 SMU.1981 c competence protein G 203 1.62e 34 SMU.1982 c conserved hypothetical protein 200 2.26e 134 SMU.1985 c competence protein; general (type II) secretory pathway protein 191 3.47e 26 SMU.499 late competence protein required for DNA uptake 170 2.81e 164 SMU.626 competence protein; possible integral membrane protein 143 8.63e 299 SMU.625 competence protein 112 2.48e 172 SMU.1967 c single stranded DNA binding protein 84. 5 7.18e 50 SMU.644 competence protein CoiA 53.0 3.21e 220 SMU.836 hypothetical protein 41.5 5.78e 174 SMU.1979 c conserved hypothetical protein 36.1 4.57e 93 SMU.1912 c hypothetical protein 25.7 7.58e 16 SMU.1910 c hypothetical protein 24.7 3.37e 17 SMU.1997 c competence specific sigma factor 22.8 2.18e 219 SMU.539c prepilin peptidase type IV 21.0 4.04e 07 SMU.1909 c hypothetical protein 20.1 1.51e 13 SMU.837 O xidoreductase 19.1 1.68e 97 SMU.1907 hypothetical protein 18.0 6.48e 13 SMU.1906 c bacteriocin related protein 16.0 4.95e 06 SMU.151 non lantibiotic mutacin IV B 10.0 3.89e 05 SMU.1576 c hypothetical protein 8.66 1.46e 23 SMU.1055 c DNA repair protein RadC 8.65 3.37e 101 SMU.506 type II restriction endonuclease 8.51 2.58e 18

PAGE 176

176 Table 6 9. continued Gene ID Gene Description Fold change P value SMU.769 conserved hypothetical protein 7.70 1.65e 32 SMU.10 cell division protein DivIC 7.30 8.20e 07 SMU.46 hypothetical protein 7.27 2.39e 09 SMU.2086 c competence damage inducible protein A 6.59 2.66e 58 SMU.196c immunogenic secreted protein (transfer protein) 4.10 1.99e 07 SMU.2085 c recombinase A 3.23 7.55e 62 SMU.1915 S. mutans specific competence stimulating peptide 3.23 5.48e 05 SMU.1345 c peptide synthetase similar to mycA 3.25 7.34e 07 SMU.1828 universal stress protein family 0.652 1.46e 08 SMU.132 amino acid amidohydrolase (hippurate amidohydrolase) 0.390 1.46e 20 SMU.1692 c pyruvate formate lyase activating enzyme 0.385 8.13e 32 SMU.540 peroxide resistance protein / iron binding protein 0.385 2.55e 45 SMU.923 ABC type multidrug/protein/lipid transport system 0.368 1.11e 51 SMU.932 conserved hypothetical protein 0.335 6.55e 11 SMU.629 superoxide dismutase 0.301 3.04e 71 SMU.924 thiol peroxidase 0.218 1.35e 68 SMU.1185 c mannitol PTS EII 0.176 2.69e 43 SMU.921 transcriptional regulator 0.086 4.55e 38 The data were generated by Sang Joon Ahn and collaborator Sang Chul Choi in the laboratory of Michael Stanhope at the University of Cornell (Ithaca, NY).

PAGE 177

177 CHAPTER 7 SUMMARY AND FUTURE DIRECTIONS The Role of Rcr R PQ in Stress Tolerance S. mutans is able t o gain a competitive advantage over many commensal organisms because of its ability to thrive under conditions that are favorable for caries development such as low pH (80, 118) However, S. mutans is still able to overcome many environmental c onditions that are less than optimal for it s grow th such as aeration and limited nutrient availability Therefore, it is critical to understand the mechanisms that S. mutans utilizes to respond to stress and eventually cause disease. Transcriptional regulators of the MarR family linked to the expression of genes encoding efflux pumps are one mechanism bacteria use to overcome anti biotic stress and environmental stresses in general (157) MarR proteins linked to efflux have been characterized in other Streptococcus species (191) However, there are limited published studies which characterize MarR regulators linked to efflux pumps in S. mutans and their role in stress tolerance. The previously uncharacterized rcrRPQ operon which encodes a MarR regulator linked to two efflux pumps plays a dominant role in stress tolerance and two o ther stress adaptation pathways: the metabolism of (p)ppGpp and genetic competence. Specifically t he RcrPQ efflux pumps play a significant role in the ability of the cells to grow in a vari ety of stresses. The 836p strain, which has the gene encoding the RcrP (SMu0 8 36) efflux pump deleted and the gene encoding the RcrQ (SMu0837) efflux pump expressed at 1000 fold lower than wild type levels exhibited a poor growth phenotype. The ability f or S. mutans to grow at low pH is a key virulence property (20) and the 836 p mutant had very little cell accumulation even after 24 h at pH 5.5. Efflux

PAGE 178

178 pumps are not only associated with the extrusion of antibiotics but are seen as playing an important role in controlling the physiology of the cell and externalizing a wide range of compounds including, metals, peptides and lipids (148, 179) The re fore, we concluded that the RcrPQ efflux pumps are capable of extruding growth inhibitory compounds t hat accumulate in growing cells t hat may be increased in low pH or aerobic conditions The expression of genes encoding efflux pumps is usually carefully regulated by MarR regulators and uncontrolled expression of genes encoding efflux pumps can eventuall y pose a metabolic burden on the cell (148) The d ata accumulated show that the expression of rcrPQ is under dominant control by the RcrR (SMu0835) regulator whi ch belongs to the MarR family, and t he expression of the genes encoding the pumps had to be carefully regulated V arious strains where rcrPQ were aberrantly expressed had an altered physiology compared to the wild type strain. Strains where rcrPQ were overexpressed were not transformable or had defects in transformation efficiency and many genes in the competence pathway were affected There fore it is critical for RcrR to bind to the promoter of rcrRPQ to control the expression of the operon. The data detailed in Chapter 1 and 6 show that RcrR controls the expression of rcrRPQ by binding to a speci fic pseudopalindromic sequence, TAGTTTTCATGA GAACTA in the promoter region of the rcr operon, which is consistent with the mechanisms of how MarR type regulators bind DNA (236) M utations in the binding site affected the ability of RcrR to bind efficiently and transformation efficiency and the expression of genes in the competence pathway w ere perturbed. MarR type regulators are well known gauges for bacteria to respond to environmental c ues The binding affinity of MarR type regulators to bind promoter DNA can be altered in

PAGE 179

179 response to different signals to control gene expression and cause a physiological response in the cells (172) It is part of ou r working model that under non stress conditions RcrR is able to bind to the promoter of the rcr operon to repress the expression of rcrPQ (Figure 7 1, 7 2, 7 3). However, the rcrRPQ operon is derepressed in response to a stress signal( s ) t hat accumulates inside the cell so the RcrPQ pumps can extrude potentially harmful or growth inhibitory substances. An interesting finding emerged from these studies when we made various deletions in rcrQ (SMu0837) Competence and growth in CSP in these mutants were highly dependent on sequence s in the rcrQ (Table 7 2). We hypothesized that the rcrQ may have some regulatory elements or encode a putative peptide( s ) (Figure 7 4, Figure 7 5) (Ahn et al. manusc ript in preparation). The data thus far indicate that the genes encoding the putative peptides are under the control of RcrR as well, since no promoter activity could be detected in to the ATG start codon of the genes encoding the peptides via lacZ or cat fusions. In addition, a mutant was made where the DNA encoding the putative peptides w as deleted in the background of the 835n p strain (Ahn et al. manuscript in prep aration). The 835n p strain, was not transformable and insensitive to growth inhibition by CSP. However, when the DNA encoding the peptides w as deleted in the 835n p strain, the strain exhibited a phenotype more similar to the 835p strain and was hypert ransformable (Ahn et al. manuscript in preparation). Our hypothes is is that the putative peptide( s ) in rcrQ interferes with either RcrR or may be the signal being exported by the RcrPQ exporters. We have also been able to FLAG tag these peptides and detect them in the cell wall and cytoplasmic fractions using Western blot analysis. However,

PAGE 180

180 their functions ar e still unknown. S tudies are currently being done investigating the role pathways such as (p)ppGpp metabolism These data raise the possibility of other peptide signals involv ed in the regulation of competence. Novel Factors Affecting (p)ppGpp Metabolis m The pro duction of (p)ppGpp is critical for bacteria to overcome environmental stresses, particularly nutrient limitation, and bacteria that cannot mount an efficient stringent response acquire deleterious mutations (183) The levels of (p)ppGpp accumulated need to be carefully regulated since overproduction of (p)ppGpp can also shift the physiology of the cell to gr ow slower, which would negatively affect competitive fitness. Previously, it was thought that RelA was the sole regulator of (p)ppGpp metabo lism in Gram positive bacteria. It is now known however, that there are other synthetases, RelP and RelQ, that pr oduce (p)ppGpp in S. mutans, and their orthologues are fairly widely distributed in other Gram positive bacteria (122) Based on the studies done by Lemos et al. RelP produces the bulk of (p)ppGpp under non stringent conditions and RelP dependent (p)ppGpp accumulati on can influence the growth of S. mutans (122) Notably, the regulation of RelP d ependent (p)ppGpp production was linked to the RelRS TCS, probably by sensing external signals. However, these external signals were not identified. The studies presented here revealed at least one of the signals that influence RelP dependent (p)ppGpp pr oduction in a dominan t way. The R el RS TCS detects oxidative stress to regulate (p)ppGpp production and control the metabolism of the cell. There was a significant increase in the amount of (p)ppGpp accumulated when the cells were exposed to hydrogen pero xide Importantly, the accumulation of (p)ppGpp in hydrogen peroxide was dep endent on both RelP and

PAGE 181

181 RelRS and t he levels of (p)ppGpp accumulated were minimally affected by RelA or RelQ. Furthermore, the promoter activity of relP was increase d when cells wer e exposed to hydrogen peroxide. S. mutans encounters oxidative stress, especially in early biofilm formation in the oral cavity from host defense mechanisms and other oral bacteria, and it has somewhat limited capacity to deal with oxidative stress com pared to other oral streptococci such as S. sanguinus (142, 165) W e posit that the accumulation of (p)p p Gpp under oxidative stress can serve as mechanism to slow the metabolism of th e cell s so they do not use up resources and acquire deleterious mutations Therefore, S. mutans can persist until conditions become more favorable such as in a mature biofilm Notably, preliminary data show that (p)ppGpp accumulation was not affected by low pH and furthermore the expression of relPRS was not changed in response to low pH (data not shown). Therefore, we conclude that aeration and oxidative stress are major environmental signals to regulate RelPRS dependent production of (p)ppGpp An int eresting finding was the effect of the rcrRPQ operon on the expression of relP and (p)ppGpp production T he data detailed in Chapter 4 show that the expression of the rcrRPQ operon affects the amount of (p)ppGpp accumulated where the 835np and 836p mutant s had reductions in levels of (p)ppGpp accumulated in exponentially growing cells Notably the expression of relP was significantly downregulated in the 835np 835p and 836p strains as well. The recombinant RcrR protein was also shown to have weak interaction with the promoter of relP T herefore w e propose t hat RcrR may bind weakly to the relP promoter under specific conditions such as oxidative stress or when the rcr operon is derepressed to positively regulate the expression of

PAGE 182

182 relP and increase (p)ppGpp production to contro l population growth. Based on the reduced levels of (p)ppGpp accumulated in the 836p strain, which has rcrP deleted and rcrQ expressed 1000 fold lower than wild type levels we also propose that the RelR S TCS ca n sense the signals externalized by RcrPQ. We posit that the Rel RS TCS can sense population de n s ity via the substance ( s ) being exported by the RcrPQ exporters when it reaches a critical level to activate RelP dependent (p)ppGpp production (Figure 4 9) in a quorum sensing like manner We have no t investigated t he role of the putative peptide( s ) encoded in the rcrQ hypothesize that if the peptides are being exported by RcrPQ, they may also play a role in the expression o f relPRS and (p)ppGpp production. The Role of RcrRPQ on Genetic Competence and DNA U ptake Genetic competence has nutritional advantages (46) and has been linked to adaptation and survival by increasing genetic diversity in bacterial species Mutations to genes in the competence pathway attenuated virulence and biofilm formation in S. mutans (129, 130) The regulation of competence in S. mutans differs from other naturally compe tent bacteria and S. mutans is the only naturally competent bacteri um studied thus far that utilizes both of the main peptide signaling systems, ComRS and ComCDE to regulate competence (86) It appears that there is cross regulation of the ComCDE and ComRS systems by as yet undefined mechanisms, althoug h they both converge at ComX (63) Despite the fact that the alternative sigma factor ComX is required for activation of late competence genes, other factors influence the development of genetic competence, oft en in a dominant way (8, 63, 167) However, in

PAGE 183

183 most cases the mechanisms by which these other factors affect signaling of competence have not been characterized. These studies reveal components of the competence pathway that were not previously identified The rcrRPQ operon influences the expression of comX and the late competence genes and DNA uptake in a dominant way. Based on the qRT PCR analysis and transcriptional profiling of various mutants of rcrRPQ, RcrR negatively regulates the expression of genes in the competence pathway and may interact with the promoters of genes in the competence pathway directly. The expression of the genes encoding the RcrPQ exporters was also critical in controlling the expression of genes in the competence pathway and DNA uptake. Strains in which the genes encoding the RcrPQ exporters were overexpressed were either non transformable or had reduced transformation capabilities and had lower comYA mRNA levels than in the wild type cell. The 835p strain, which had wild type levels of the genes encoding t he RcrPQ exporters was hypertransformable whereas the 835np strain overexpressed rcrPQ and was not transformable under any of the conditions tested. The strain displayed an interesting gene expression profile where the expression of comX was about 100 fold higher than wild type levels, but the expression of comYA was significantly lower. This was a novel finding since ComX is required to activate comY and other late competence genes. It is therefore our hypothe sis that RcrPQ extrude a si gnal( s ) that is necessary for the activation of ComX (Figure 7 1, Figure 7 2 Figure 7 3 ). We predict t hat the signal( s ) acts as an anti anti sigma factor that impacts ComX protein stability and/or activity Analogous components that impact ComX stabilit y have been described in other naturally competent Gram positive bacteria such as S.

PAGE 184

184 pneumoniae and B. subtilis (228) We hypothesize that the signals being externalized rcrQ Current efforts in the lab are focused on gene rating antibodies to ComX to examine ComX stability in the various rcrRPQ mutants generated and use the His 6 tagged purified ComX to perform pull down assays to identify proteins and components such as the peptides that may interact with it. Linkage of R crRPQ to Stress T olerance, (p)ppGpp and C ompetence S. mutans has evolved and fine tuned multiple systems to integrate and regulate its gene expression to respond to different environmental challenges (121) Stress tolerance, (p)ppGpp metabolism and competence are all important pathways for S. mutans t o survive and establish itself and cause caries when the conditions are favorable. The competence pathway and (p)ppGpp metabolism have been described more extensively in other bacteria but the regulation of both of these systems differ s significantly in S mutans from other Gram positive bacteria An inappropriate induction of these stress response systems can cause the cells to grow inefficiently and cause an unnecessary burden on the cell (101, 183) Consistent with this idea we have some preliminary evidence where a strain that overexpresses comX grows poorly (Sang Joon Ahn, personal communication ). Therefore, it is necessary to tightly regulate the expression of comX The findings presented show the important role that the previously uncharacterized rcrRPQ operon plays in stress adaptation pathways and links (p)ppGpp metabolism and competence We propose that (p)ppGpp metabolism and the development of competence are linked through central control by the RcrR regulator and the substances being localized by the RcrPQ exporters ( Figure 7 1, Figure 7 2, Figure 7 3). S. mutans has master

PAGE 185

185 regulators such as CcpA (3) which can up or down regulate the expression of many genes enabling the bacteria to adapt efficiently to rapid changes in the environment such as those encountered in the oral cavity (120, 205) RcrR appears to serve as another important regul ator by influencing both (p)pp Gpp metabolism and competence. The upregulation of the rcrRPQ operon in the presence of mupirocin (122) indicated that the expression of the operon can be altered in response to stress. An interesting finding from the microarray analysis done by Ahn et al. revealed that the expression of comX was downregulated in aeration, whereas the expression of relPRS was upregulated in response to aeration (7) Therefore oxidative stress, nutrient limitation or other unidentified stress may be some of the signals to integrate RcrR dependent control of (p)ppGpp production and the induction of competence. As part of our working model, we propose that in conditions which cause derepress ion of the rcr operon, R crR can bind more efficiently to the promoters of both relP and comX to positively regulate the expression of relP and (p)ppGpp production and negatively impact the expression of comX and the uptake of DNA (Figure 7 1, 7 2 ) It is known that the C omCDE system can activate comX even though the mechanisms are not clear. However, the expression of comX is lower in aerat ion (7) even though the expression of genes encoding the bacteriocins and ComD were highly upregulated in cells that were aerated (7) Therefore it is reasonable to hypothesize that RcrR can serve as a mechanism to control the expression of comX and DNA uptake even when the expression of the genes encoding the bacteriocins and ComDE are upregulated and may serve as the decision whether ce lls lyse or become competent

PAGE 186

186 The s ubstances that RcrPQ extrude which are also under the dominant control of RcrR, play a significant role in the regulation of both (p)ppGpp metabolism and the development of competence We propose that the substances R crPQ export can act in a quorum sensing like manner to regulate RelPRS depen d ent production of (p)ppGpp to control the growth of the population while internal concentrations impa ct ComX stability and activity (Figure 7 1, 7 2). Therefore, localization of the substances being exported by RcrPQ need to be carefully balanced and slight differences in the localization of the substances can alter the physiology of the cells. The induction of (p)ppGpp production causes the cells to shift their physi ology to con serve energy; we posit that the RcrRPQ system serves to delay the induction of competence so as not to utilize unnecessary resources. However, under other conditions where the rcr operon is repressed, RcrR may not bind as effectively to the relP or comX promoters The amount of the substance externalized by RcrPQ will also be reduced thereby causing lower amounts of (p)ppGpp production by RelP and increasing ComX stability and/or activity (Figure 7 1) Preliminary studies also show a linkage of (p)ppGpp metabolism to ComS/ XIP. A relA mutant is less sensitive to XIP induced growth inhibition compared to the wild type strain and had defects in transformation (Justin Kaspar, personal communication) However, the explanation for these observations is not known and further experiments linking the two pathways are in progress. Data also show that the rcrRPQ operon exerts an effect on the ComRS/ XIP system as well, where comS levels are high in some of the rcrRPQ mutant strains. However, the mechanisms unde rlying the linkage of rcrRPQ to ComRS are currently being investigated.

PAGE 187

187 Future S tudies One of the interesting findings in these studies is the significance of the RcrPQ exporters and the signals being exported to regulate the physiology of the cell. Curr ent efforts are focused on identifying the substrates being extruded by the RcrPQ porters through mass spectrometry on concentrated supernates from the various mutants. We rcrQ Stu dies investigating the localization of these putative peptides through Western blot analysis using antibodies specific to the peptides are currently in progress The RcrR regulator has a dominant role in regulating the rcr operon and other genes through RcrR binding to the promoters of various genes. It is known that MarR regulators can change their binding affinity by the presence of substances such phenols or antibiotics (236) Therefore the identification of substances that can impact the expression of the rcrRPQ operon and influence the binding activity of RcrR to various promoters would provide much needed insi ght into the mechanism of control by the RcrR regulator. Summary The RcrRPQ system has not been identified or characterized in other bacterial species. However, other Streptococcus species have genes that encode orthologues of RcrRPQ linked to RelPRS ( Ta ble 7 1 ). Interestingly, the sp ecies that have orthologues of RcrRPQ linked to R elPRS do not have the ComCDE system, only the ComRS system [ Table 7 1 (86) ] Notably, an orthologue of RcrRPQ w as identified in S. pyogenes (Table 7 1 ), an organism that has not been transformable in laboratory con ditions even though it has all the components of the competence machinery, such as t he genes encoding ComG (ComYA). The orthologues of R crRPQ may have a similar function to control competence in other bacterial species such as S. pyogenes

PAGE 188

188 Current projec ts in the lab are focused on characterizing other clinical isolates of S. mutans and investigating genes that play an important role in stress tolerance. Interestingly, a clinical isolate that does not have the gene encoding the RcrR regulator (4 7) is not transformable under the conditions tested thus far (Lin Zeng, personal communication) suggesting that this operon is not only important in the strain UA159, but may be a critical regulator in other clinical isolates and contribute to fitness of other strains of S. mutans The transformation capabilities o f other strain s of S. mutans differ from the strain UA159 and s ome of the clinical isolates are not readily transformable under the conditions tested thus far (171) Therefore, studies characterizing the rcrRPQ operon in other strains of S. mutans would be interesting to see if they impact the physiology of the organisms and if they function in a similar manner as in the strain UA159. The findings reveal novel factors that influence the development of competence and (p)ppGpp metabolism, which are two important pathways S. mutans utilizes to adapt to various environmen tal stresses to cause disease. The production of (p)ppGpp and the develo pment of competence are regulated by a MarR type regulator and the accumulation of other peptides and signals that were not previously identified The discovery of the peptides encoded in the rcrQ that influence the physiology of the cell may have therapeutic value by impacting the growth of the population or perturbing other physiological pathways Since the expression of rcrRPQ operon affects the physiology of the cells especially growth at low pH, a key virulence attribute of S. mutans RcrRPQ may also be a good target for therap ies to limit the growth of S. mutans and the development of caries.

PAGE 189

1 89 Figure 7 1. Schematic of the working model showing the regulation of relP and comX by Rcr R PQ under rcr repressing conditions. Rc r R can bin d to the promoter of the rcr operon and repress expression of the operon RcrR also has weak interaction with the relP and comX promot ers. The RcrPQ signals can interact with a factor that interferes with ComX stability

PAGE 190

190 Figure 7 2. Schematic of the working model showing the regulation of relP and comX by RcrRPQ under rcr derepressing conditions Derepression of the operon can lead to higher levels of RcrR. High concentrations of RcrR can bind to the relP promoter to activ ate (p)ppGpp production as well as bind to the comX promoter to impair competence. Upregulation of the genes encoding the RcrPQ efflux pumps also results in externaliz ation of the signal/s interacting with the factor that impairs ComX stability causing its activity to be impaired and impacting competence.

PAGE 191

191 Figure 7 3 Schematic of the working model showing the regulation of the competence pathway and the R elPRS dependent production of (p)ppGpp by rcrRPQ

PAGE 192

192 Figure 7 4 region of SMu0837 (rcrQ).

PAGE 193

193 Figure 7 5 region of SMu0837 (rcrQ).

PAGE 194

194 Table 7 1 List of organisms with ge nes encoding R crRPQ homologues linked to R elPRS homologues and their GeneBank Locus ID Organism MarR linked to ABC transporters RelPRS homologues present RelPRS linked to MarR Streptococcus gallolyticus YES GALLO_1282 1286 YES GALLO_1279 1281 YES Streptococcus salivarius YES STRASA001_623 625 YES STRASA001_619 621 YES Streptococcus infantarius YES STRINF_00326 00328 YES STRINF_00329 00332 YES Streptococcus thermophilus YES STU0432 434 NO NO Streptococcus pyogenes YES spyM18_0213 0215 YES spyM18_0934 0936 NO Streptococcus agalactiae YES Gbs1400 1402 YES Gbs1397 1399 YES Streptococcus equisimilis YES Sez_0219 221 NO NO Streptococcus suis YES SsuiDRAFT_2132 2134 NO NO Streptococcus uberis YES SUB1688 1690 NO NO Streptococcus sanguinis YES SSA_0460 0462 YES SSA_1793 1795 NO Streptococcus gordonii YES SGO_1750 1752 YES SGO_0484 0486 NO Streptococcus pneumonia e YES CGSSp11BS70_11141 1146 NO NO Streptococcus mitis YES smi_1834 1836 NO NO

PAGE 195

195 T able 7 2. Summary of mutants with deletions in the rcrQ wild type strain Strain RcrR levels RcrP levels RcrQ levels No. of peptide s present in the rcrQ Growth with CSP Transformation efficie ncy compared to WT 836 7 np V3 Not tested Deleted Deleted 0 Resistant 0 837np V2 Not tested Not tested Deleted 2 Resistant 0 837 p V2 Not tested Not tested Deleted 2 Resistant 0 836 7np V2 Not tested Deleted Deleted 2 Resistant 10 fold increase 836 7p V2 Not tested Deleted Deleted 2 Hypersensitive 1000 fold increase 837np V3 Not tested Not tested Deleted 0 Resistant 100 fold increase 835 7p npV2 Deleted Deleted Deleted 2 Resistant 1000 fold increase 835 7 npV3 Deleted Deleted Deleted 0 Resistant 1000 fold increase

PAGE 196

196 APPENDIX ZONE OF INHIBITION Figure showing the difference in size for the zone of inhibition for the wild type and 836p mutant strains of S. mutans overlaid with Streptococcus sanuginus strain SK150. The diameter for the zone of inhibition of the wild type strain was 21 mm 0.34 mm. The diameter for the zone of inhibition of the 836p strain was 15.5 mm 1.3 mm.

PAGE 197

197 L IST OF REFERENCES 1. Abranches, J., A. R. Martinez, J. K. Kajfasz, V. Chavez, D. A. Garsin, and J. A. Lemos. 2009. The molecular alarmone (p)ppGpp mediates stress responses, vancomycin tolerance, and virulence in Enterococcus faecalis J. Bacteriol. 191: 2248 2256. 2. Abranches, J., J. H. Miller, A. R. Martinez P. J. Simpson Haidaris, R. A. Burne, and J. A. Lemos. 2011. The collagen binding protein Cnm is required for Streptococcus mutans adherence to and intracellular invasion of human coronary artery endothelial cells. Infect. Immun. 79: 2277 2284. 3. Abranche s, J., M. M. Nascimento, L. Zeng, C. M. Browngardt, Z. T. Wen, M. F. Rivera, and R. A. Burne. 2008. CcpA regulates central metabolism and virulence gene expression in Streptococcus mutans J. Bacteriol. 190: 2340 2349. 4. Ahn, S. J., S. J. Ahn, C. M. Browng ardt, and R. A. Burne. 2009. Changes in biochemical and phenotypic properties of Streptococcus mutans during growth with aeration. Appl. Environ. Microbiol. 75: 2517 2527. 5. Ahn, S. J., and R. A. Burne. 2007. Effects of oxygen on biofilm formation and the AtlA autolysin of Streptococcus mutans J. Bacteriol. 189: 6293 6302. 6. Ahn, S. J., J. A. Lemos, and R. A. Burne. 2005. Role of HtrA in growth and competence of Streptococcus mutans UA159. J. Bacteriol. 187: 3028 3038. 7. Ahn, S. J., Z. T. Wen, and R. A. Bu rne. 2007. Effects of oxygen on virulence traits of Streptococcus mutans J. Bacteriol. 189: 8519 8527. 8. Ahn, S. J., Z. T. Wen, and R. A. Burne. 2006. Multilevel control of competence development and stress tolerance in Streptococcus mutans UA159. Infect. Immun. 74: 1631 1642. 9. Ajdic, D., W. M. McShan, R. E. McLaughlin, G. Savic, J. Chang, M. B. Carson, C. Primeaux, R. Tian, S. Kenton, H. Jia, S. Lin, Y. Qian, S. Li, H. Zhu, F. Najar, H. Lai, J. White, B. A. Roe, and J. J. Ferretti. 2002. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc. Natl. Acad. Sci. U S A 99: 14434 14439. 10. Alekshun, M. N., S. B. Levy, T. R. Mealy, B. A. Seaton, and J. F. Head. 2001. The crystal structure of MarR, a regulator of multiple antibiotic re sistance, at 2.3 A resolution. Nat. Struct. Biol. 8: 710 714. 11. Ali, S. B. S., Y. Hurtubise, M. C. Lavoie, and G. LaPointe. 2002. Diversity of Streptococcus mutans bacteriocins as confirmed by DNA analysis using specific molecular probes. Gene 283: 125 131.

PAGE 198

198 12. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403 410. 13. Anders, S., and W. Huber. 2010. Differential expression analysis for sequence count data. Genome Biol. 11: R106. 14. Ariza, R. R., S. P. Cohen, N. Bachhawat, S. B. Levy, and B. Demple. 1994. Repressor mutations in the marRAB operon that activate oxidative stress genes and multiple antibiotic resistance in Escherichia coli J. Bacteriol. 176: 143 148. 15. Atta iech, L., A. Olivier, I. Mortier Barriere, A. L. Soulet, C. Granadel, B. Martin, P. Polard, and J. P. Claverys. 2011. Role of the single stranded DNA binding protein SsbB in pneumococcal transformation: maintenance of a reservoir for genetic plasticity. PL oS Genet. 7: e1002156. 16. Avarbock, D., A. Avarbock, and H. Rubin. 2000. Differential regulation of opposing Rel Mtb activities by the aminoacylation state of a tRNA.ribosome.mRNA.Rel Mtb complex. Biochemistry 39: 11640 11648. 17. Avery, O. T., C. M. Macleod, and M. McCarty. 1944. Studies on the Chemical Nature of the Substance Inducing Transformation of Pneumococcal Types : Induction of Transformation by a Desoxyribonucleic Acid Fraction Isolated from Pneumococcus Type Iii. J. Exp. Med. 79: 137 158. 18. Axelss on, L. 2005. Lactic Acid Bacteria. In S. Salminen, A. von Wright, and A. Ouwehand (ed.), Microbiolgy and Functional Aspects, Third Edition ed. Marcel Dekker, Inc, New York. 19. Balakrishnan, M., R. S. Simmonds, A. Carne, and J. R. Tagg. 2000. Streptococcus mutans strain N produces a novel low molecular mass non lantibiotic bacteriocin. FEMS Microbiol. Lett. 183: 165 169. 20. Banas, J. A. 2004. Virulence properties of Streptococcus mutans Front. Biosci. 9: 1267 1277. 21. Banas, J. A., and M. M. Vickerman. 200 3. Glucan binding proteins of the oral streptococci. Crit. Rev. Oral Bio.l Med. 14: 89 99. 22. Barker, M. M., T. Gaal, and R. L. Gourse. 2001. Mechanism of regulation of transcription initiation by ppGpp. II. Models for positive control based on properties of RNAP mutants and competition for RNAP. Journal of molecular biology 305: 689 702. 23. Barker, M. M., T. Gaal, C. A. Josaitis, and R. L. Gourse. 2001. Mechanism of regulation of transcription initiation by ppGpp. I. Effects of ppGpp on transcription initiation in vivo and i n vitro J. Mol. Biol. 305: 673 688.

PAGE 199

199 24. Beier, D., and R. Gross. 2006. Regulation of bacterial virulence by two comp onent systems. Curr. Opin. Microbiol. 9: 143 152. 25. Beltran Aguilar, E. D., L. K. Barker, M. T. Canto, B. A. Dye, B. F. Gooch, S. O. Griffin, J. Hyman, F. Jaramillo, A. Kingman, R. Nowjack Raymer, R. H. Selwitz, and T. Wu. 2005. Surveillance for dental ca ries, dental sealants, tooth retention, edentulism, and enamel fluorosis -United States, 1988 1994 and 1999 2002. MMWR Surveill Summ 54: 1 43. 26. Bender, G. R., S. V. W. Sutton, and R. E. Marquis. 1986. Acid Tolerance, Proton Permeabilities, and Membrane A tpases of Oral Streptococci. Infection and Immunity 53: 331 338. 27. Bender, G. R., E. A. Thibodeau, and R. E. Marquis. 1985. Reduction of acidurance of streptococcal growth and glycolysis by fluoride and gramicidin. J. Dent. Res. 64: 90 95. 28. Bernhart, S. H., I. L. Hofacker, and P. F. Stadler. 2006. Local RNA base pairing probabilities in large sequences. Bioinformatics (Oxford, England) 22: 614 615. 29. Bowden, G. H., J. M. Hardie, and G. L. Slack. 1975. Microbial variations in approximal dental plaque. Ca ries. Res. 9: 253 277. 30. Bowen, W. H., K. Schilling, E. Giertsen, S. Pearson, S. F. Lee, A. Bleiweis, and D. Beeman. 1991. Role of a cell surface associated protein in adherence and dental caries. Infect. Immun. 59: 4606 4609. 31. Boyd, D. A., D. G. Cvitko vitch, A. S. Bleiweis, M. Y. Kiriukhin, D. V. Debabov, F. C. Neuhaus, and I. R. Hamilton. 2000. Defects in D alanyl lipoteichoic acid synthesis in Streptococcus mutans results in acid sensitivity. J. Bacteriol. 182: 6055 6065. 32. Bryan, E. M., T. Bae, M. K leerebezem, and G. M. Dunny. 2000. Improved vectors for nisin controlled expression in gram positive bacteria. Plasmid 44: 183 190. 33. Burne, R. A. 1998. Oral streptococci... products of their environment. J. Dent. Res. 77: 445 452. 34. Burne, R. A., Y. Y. Chen, D. L. Wexler, H. Kuramitsu, and W. H. Bowen. 1996. Cariogenicity of Streptococcus mutans strains with defects in fructan metabolism assessed in a program fed specific pathogen free rat model. J. Dent. Res. 75: 1572 1577. 35. Burne, R. A., K. Schilling W. H. Bowen, and R. E. Yasbin. 1987. Expression, purification, and characterization of an exo beta D fructosidase of Streptococcus mutans J. Bacteriol. 169: 4507 4517.

PAGE 200

200 36. Burt, B. A., S. A. Eklund, K. J. Morgan, F. E. Larkin, K. E. Guire, L. O. Brown, and J. A. Weintraub. 1988. The effects of sugars intake and frequency of ingestion on dental caries increment in a three year longitudinal study. J Dent Res 67: 1422 1429. 37. Busuioc, M., B. A. Buttaro, and P. J. Piggot. 2010. The pdh operon is expressed i n a subpopulation of stationary phase bacteria and is important for survival of sugar starved Streptococcus mutans J. Bacteriol. 192: 4395 4402. 38. Carlsson, J. 1983. Regulation of sugar metabolism in relation to feast and famine existence of plaque. In C ariology today : 205 211. 39. Carlsson, J., U. Kujala, and M. B. K. Edlund. 1985. Pyruvate Dehydrogenase Activity in Streptococcus mutans Infection and Immunity 49: 674 678. 40. Cashel, M., Gentry, D.R., Hernandez, V.J., and Vinella, D. 1996. The Stringent R esponse. In Escherichia coli and Salmonella, p. 1458 1496. In F. C. Neidhardt (ed.), Cellular and Molecular Biology, vol. 1. ASM Press, Washington, DC. 41. Cha, R. S., H. Zarbl, P. Keohavong, and W. G. Thilly. 1992. Mismatch amplification mutation assay (M AMA): application to the c H ras gene. PCR Methods Appl. 2: 14 20. 42. Chen, A., J. D. Hillman, and M. Duncan. 1994. L (+) lactate dehydrogenase deficiency is lethal in Streptococcus mutans J. Bacteriol. 176: 1542 1545. 43. Clarke, J. K. 1924. On the bacter ial factor in the ae tiology of dental caries. British Journal of Experimental Pathology 5: 141 147. 44. Claverys, J. P., B. Martin, and L. S. Havarstein. 2007. Competence induced fratricide in streptococci. Mo.l Microbiol. 64: 1423 1433. 45. Claverys, J. P. B. Martin, and P. Polard. 2009. The genetic transformation machinery: composition, localization, and mechanism. FEMS Microbiol. Rev. 33: 643 656. 46. Claverys, J. P., M. Prudhomme, and B. Martin. 2006. Induction of competence regulons as a general respons e to stress in gram positive bacteria. Annu. Rev. Microbiol. 60: 451 475. 47. Cornejo, O. E., T. Lefebure, P. D. Pavinski Bitar, P. Lang, V. P. Richards, K. Eilertson, T. Do, D. Beighton, L. Zeng, S. J. Ahn, R. A. Burne, A. Siepel, C. D. Bustamante, and M. J. Stanhope. 2013. Evolutionary and Population Genomics of the Cavity Causing Bacteria Streptococcus mutans Mol. Biol. Evol. 30: 881 893. 48. Cotter, P. D., C. Hill, and R. P. Ross. 2005. Bacteriocins: developing innate immunity for food. Nat. Rev. Microbiol. 3: 777 788.

PAGE 201

201 49. Coykendall, A. L. 1989. Classification and identification of the viridans streptococci. Clin. Microbiol. Rev. 2: 315 328. 50. Crowley, P. J., L. J. Brady, D. A. Pi acentini, and A. S. Bleiweis. 1993. Identification of a salivary agglutinin binding domain within cell surface adhesin P1 of Streptococcus mutans Infect. Immun. 61: 1547 1552. 51. Curtiss, R., 3rd. 1985. Genetic analysis of Streptococcus mutans virulence. Curr. Top. Microbiol. Immunol. 118: 253 277. 52. Cvitkovitch, D. G. 2001. Genetic competence and transformation in oral streptococci. Crit. Rev. Oral. Bio.l Med. 12: 217 243. 53. Desai, B. V., and D. A. Morrison. 2006. An unstable competence induced protein, CoiA, promotes processing of donor DNA after uptake during genetic transformation in Streptococcus pneumoniae J. Bacteriol. 188: 5177 5186. 54. Desai, B. V., and D. A. Morrison. 2006. An unstable competence induced protein, CoiA, promotes processing of do nor DNA after uptake during genetic transformation in Streptococcus pneumoniae. J Bacteriol 188: 5177 5186. 55. Desai, K., L. Mashburn Warren, M. J. Federle, and D. A. Morrison. 2012. Development of competence for genetic transformation of Streptococcus mut ans in a chemically defined medium. J. Bacteriol. 194: 3774 3780. 56. Dewhirst, F. E., T. Chen, J. Izard, B. J. Paster, A. C. Tanner, W. H. Yu, A. Lakshmanan, and W. G. Wade. 2010. The human oral microbiome. J Bacteriol 192: 5002 5017. 57. Dufour, D., M. Cor dova, D. G. Cvitkovitch, and C. M. Levesque. 2011. Regulation of the competence pathway as a novel role associated with a streptococcal bacteriocin. J. Bacteriol. 193: 6552 6559. 58. Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32: 1792 1797. 59. Ellen, R. P., Burne, R.A. (ed.). 1996. Conceptual advances in oral microbial adhesion. In Bacterial adhesion: molecular and ecologic diversity John Wiley and Sons, New York. 60. Ellison, D. W., a nd V. L. Miller. 2006. Regulation of virulence by members of the MarR/SlyA family. Curr. Opin. Microbiol. 9: 153 159. 61. Engelmoer, D. J., and D. E. Rozen. 2011. Competence increases survival during stress in Streptococcus pneumoniae Evolution 65: 3475 3485. 62. Fath, M. J., and R. Kolter. 1993. ABC transporters: bacterial exporters. Microbiol. Rev. 57: 995 1017.

PAGE 202

202 63. Federle, M. J., and D. A. Morrison. 2012. One if by land, two if by sea: signalling to the ranks with CSP and XIP. Mol. Microbiol. 86: 2 41 245. 64. Fiorentino, G., R. Ronca, R. Cannio, M. Rossi, and S. Bartolucci. 2007. MarR like transcriptional regulator involved in detoxification of aromatic compounds in Sulfolobus solfataricus J. Bacteriol. 189: 7351 7360. 65. Fitzgerald, R. J., B. O. A dams, H. J. Sandham, and S. Abhyankar. 1989. Cariogenicity of a lactate dehydrogenase deficient mutant of Streptococcus mutans serotype c in gnotobiotic rats. Infect. Immun. 57: 823 826. 66. Fontaine, L., C. Boutry, M. H. de Frahan, B. Delplace, C. Fremaux, P. Horvath, P. Boyaval, and P. Hols. 2010. A novel pheromone quorum sensing system controls the development of natural competence in Streptococcus thermophilus and Streptococcus salivarius J. Bacteriol. 192: 1444 1454. 67. Fontaine, L., P. Goffin, H. Dubo ut, B. Delplace, A. Baulard, N. Lecat Guillet, E. Chambellon, R. Gardan, and P. Hols. 2013. Mechanism of competence activation by the ComRS signaling system in streptococci. Mol. Microbiol. 68. Fozo, E. M., and R. G. Quivey, Jr. 2004. The fabM gene product of Streptococcus mutans is responsible for the synthesis of monounsaturated fatty acids and is necessary for survival at low pH. J. Bacteriol. 186: 4152 4158. 69. Fozo, E. M., and R. G. Quivey, Jr. 2004. Shifts in the membrane fatty acid profile of Strepto coccus mutans enhance survival in acidic environments. Appl. Environ. Microbiol. 70: 929 936. 70. Gentry, D. R., and M. Cashel. 1996. Mutational analysis of the Escherichia coli spoT gene identifies distinct but overlapping regions involved in ppGpp synthes is and degradation. Mol. Microbiol. 19: 1373 1384. 71. Griffith, F. 1928. The Significance of Pneumococcal Types. Journal of Hygiene 27: 113 159. 72. Griswold, A., Y. Y. Chen, J. A. Snyder, and R. A. Burne. 2004. Characterization of the arginine deiminase op eron of Streptococcus rattus FA 1. Appl. Environ. Microbiol. 70: 1321 1327. 73. Griswold, A. R., Y. Y. Chen, and R. A. Burne. 2004. Analysis of an agmatine deiminase gene cluster in Streptococcus mutans UA159. J. Bacteriol. 186: 1902 1904. 74. Griswold, A. R., M. Jameson Lee, and R. A. Burne. 2006. Regulation and physiologic significance of the agmatine deiminase system of Streptococcus mutans UA159. J. Bacteriol. 188: 834 841.

PAGE 203

203 75. Gropp, M., Y. Strausz, M. Gross, and G. Glaser. 2001. Regulation of Escherichi a coli RelA requires oligomerization of the C terminal domain. J. Bacteriol. 183: 570 579. 76. Gruber, A. R., S. Findeiss, S. Washietl, I. L. Hofacker, and P. F. Stadler. 2010. Rnaz 2.0: Improved noncoding rna detection. Pac. Symp. Biocomput. 15: 69 79. 77. Hahn, K., R. C. Faustoferri, and R. G. Quivey, Jr. 1999. Induction of an AP endonuclease activity in Streptococcus mutans during growth at low pH. Mol. Microbiol. 31: 1489 1498. 78. Hale, J. D., Y. T. Ting, R. W. Jack, J. R. Tagg, and N. C. Heng. 2005. Bact eriocin (mutacin) production by Streptococcus mutans genome sequence reference strain UA159: elucidation of the antimicrobial repertoire by genetic dissection. Appl. Environ. Microbiol. 71: 7613 7617. 79. Hamada, S., and T. Ooshima. 1975. Production and pro perties of bacteriocins (mutacins) from Streptococcus mutans Arch Oral Biol 20: 641 648. 80. Hamada, S., and H. D. Slade. 1980. Biology, immunology, and cariogenicity of Streptococcus mutans Microbiol. Rev. 44: 331 384. 81. Hamilton, I. R., and N. D. Buckl ey. 1991. Adaptation by Streptococcus mutans to acid tolerance. Oral Microbiol. Immunol. 6: 65 71. 82. Harris, G. S., S. M. Michalek, and R. Curtiss, 3rd. 1992. Cloning of a locus involved in Streptococcus mutans intracellular polysaccharide accumulation an d virulence testing of an intracellular polysaccharide deficient mutant. Infect. Immun. 60: 3175 3185. 83. Haseltine, W. A., and R. Block. 1973. Synthesis of guanosine tetra and pentaphosphate requires the presence of a codon specific, uncharged transfer r ibonucleic acid in the acceptor site of ribosomes. Proc Natl Acad Sci U S A 70: 1564 1568. 84. Hasona, A., P. J. Crowley, C. M. Levesque, R. W. Mair, D. G. Cvitkovitch, A. S. Bleiweis, and L. J. Brady. 2005. Streptococcal viability and diminished stress tol erance in mutants lacking the signal recognition particle pathway or YidC2. Proc. Natl. Acad. Sci. U S A 102: 17466 17471. 85. Hastings, J. W., and K. H. Nealson. 1977. Bacterial bioluminescence. Annu. Rev. Microbiol. 31: 549 595. 86. Havarstein, L. S. 2010. Increasing competence in the genus Streptococcus. Mol. Microbiol. 78: 541 544.

PAGE 204

204 87. Havarstein, L. S., G. Coomaraswamy, and D. A. Morrison. 1995. An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus p neumoniae Proc. Natl. Acad. Sci. U S A 92: 11140 11144. 88. Hillman, J. D., A. Chen, and J. L. Snoep. 1996. Genetic and physiological analysis of the lethal effect of L (+) lactate dehydrogenase deficiency in Streptococcus mutans : complementation by alcoho l dehydrogenase from Zymomonas mobilis Infect. Immun. 64: 4319 4323. 89. Hillman, J. D., J. Novak, E. Sagura, J. A. Gutierrez, T. A. Brooks, P. J. Crowley, M. Hess, A. Azizi, K. Leung, D. Cvitkovitch, and A. S. Bleiweis. 1998. Genetic and biochemical analy sis of mutacin 1140, a lantibiotic from Streptococcus mutans Infect. Immun. 66: 2743 2749. 90. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site directed mutagenesis by overlap extension using the polymerase chain reaction. Gen e 77: 51 59. 91. Hogg, T., U. Mechold, H. Malke, M. Cashel, and R. Hilgenfeld. 2004. Conformational antagonism between opposing active sites in a bifunctional RelA/SpoT homolog modulates (p)ppGpp metabolism during the stringent response [corrected]. Cell 11 7: 57 68. 92. Horaud, T., and F. Delbos. 1984. Viridans streptococci in infective endocarditis: species distribution and susceptibility to antibiotics. Eur. Heart J. 5 Suppl C: 39 44. 93. Hossain, M. S., and I. Biswas. 2012. An extracelluar protease, SepM, g enerates functional competence stimulating peptide in Streptococcus mutans UA159. J. Bacteriol. 194: 5886 5896. 94. Hui, F. M., L. Zhou, and D. A. Morrison. 1995. Competence for genetic transformation in Streptococcus pneumoniae : organization of a regulator y locus with homology to two lactococcin A secretion genes. Gene 153: 25 31. 95. Hung, D. C., J. S. Downey, E. A. Ayala, J. Kreth, R. Mair, D. B. Senadheera, F. Qi, D. G. Cvitkovitch, W. Shi, and S. D. Goodman. 2011. Characterization of DNA binding sites of the ComE response regulator from Streptococcus mutans J. Bacteriol. 193: 3642 3652. 96. Inaoka, T., and K. Ochi. 2002. RelA protein is involved in induction of genetic competence in certain Bacillus subtilis strains by moderating the level of intracellular GTP. J. Bacteriol. 184: 3923 3930. 97. Jacobson, G. R., J. Lodge, and F. Poy. 1989. Carbohydrate uptake in the oral pathogen Streptococcus mutans : mechanisms and regulation by protein phosphorylation. Biochi mie 71: 997 1004.

PAGE 205

205 98. Jain, V., M. Kumar, and D. Chatterji. 2006. ppGpp: stringent response and survival. J. Microbiol. 44: 1 10. 99. Jayaraman, G. C., J. E. Penders, and R. A. Burne. 1997. Transcriptional analysis of the Streptococcus mutans hrcA grpE and dnaK genes and regulation of expression in response to heat shock and environmental acidification. Mol. Microbiol. 25: 329 341. 100. Jayaraman, G. C., J. E. Penders, and R. A. Burne. 1997. Transcriptional analysis of the Streptococcus mutans hrcA, grpE and dnaK genes and regulation of expression in response to heat shock and environmental acidification. Molecular microbiology 25: 329 341. 101. Johnsborg, O., V. Eldholm, and L. S. Havarstein. 2007. Natural genetic transformation: prevalence, mechanisms and fun ction. Research in Microbiology 158: 767 778. 102. Johnson, C. P., S. M. Gross, and J. D. Hillman. 1980. Cariogenic potential in vitro in man and in vivo in the rat of lactate dehydrogenase mutants of Streptococcus mutans Arch. Oral Biol. 25: 707 713. 103. Kamiya, R. U., J. F. Hofling, and R. B. Goncalves. 2008. Frequency and expression of mutacin biosynthesis genes in isolates of Streptococcus mutans with different mutacin producing phenotypes. J. Med. Microbiol. 57: 626 635. 104. Keyes, P. H. 1960. The Infe ctious and Transmissible Nature of Experimental Dental Caries Findings and Implications. Archives of Oral Biology 1: 304 &. 105. Khan, R., H. V. Rukke, A. P. Ricomini Filho, G. Fimland, M. O. Arntzen, B. Thiede, and F. C. Petersen. 2012. Extracellular ide ntification of a processed type II ComR/ComS pheromone of Streptococcus mutans J. Bacteriol. 194: 3781 3788. 106. Kim, J. N., S. J. Ahn, K. Seaton, S. Garrett, and R. A. Burne. 2012. Transcriptional organization and physiological contributions of the relQ operon of Streptococcus mutans J. Bacteriol. 194: 1968 1978. 107. Kingsford, C. L., K. Ayanbule, and S. L. Salzberg. 2007. Rapid, accurate, computational discovery of Rho independent transcription terminators illuminates their relationship to DNA uptake. Genome Biol. 8: R22. 108. Kingston, R. E., W. C. Nierman, and M. J. Chamberlin. 1981. A direct effect of guanosine tet raphosphate on pausing of Escherichia coli RNA polymerase during RNA chain elongation. J. Biol. Chem. 256: 2787 2797. 109. Kremer, B. H., M. van der Kraan, P. J. Crowley, I. R. Hamilton, L. J. Brady, and A. S. Bleiweis. 2001. Characterization of the sat ope ron in Streptococcus mutans : evidence for a role of Ffh in acid tolerance. J. Bacteriol. 183: 2543 2552.

PAGE 206

206 110. Kreth, J., D. C. Hung, J. Merritt, J. Perry, L. Zhu, S. D. Goodman, D. G. Cvitkovitch, W. Shi, and F. Qi. 2007. The response regulator ComE in Stre ptococcus mutans functions both as a transcription activator of mutacin production and repressor of CSP biosynthesis. Microbiology 153: 1799 1807. 111. Kreth, J., L. Zhu, J. Merritt, W. Shi, and F. Qi. 2008. Role of sucrose in the fitness of Streptococcus m utans Oral Microbiol. Immunol. 23: 213 219. 112. Kruger, N. J., and K. Stingl. 2011. Two steps away from novelty -principles of bacterial DNA uptake. Mol. Microbiol. 80: 860 867. 113. Kvist, M., V. Hancock, and P. Klemm. 2008. Inactivation of efflux pumps a bolishes bacterial biofilm formation. Appl. Environ. Microbiol. 74: 7376 7382. 114. Lee, M. S., and D. A. Morrison. 1999. Identification of a new regulator in Streptococcus pneumoniae linking quorum sensing to competence for genetic transformation. J. Bacte riol. 181: 5004 5016. 115. Lee, S. F., A. Progulske Fox, G. W. Erdos, D. A. Piacentini, G. Y. Ayakawa, P. J. Crowley, and A. S. Bleiweis. 1989. Construction and characterization of isogenic mutants of Streptococcus mutans deficient in major surface protein antigen P1 (I/II). Infect. Immun. 57: 3306 3313. 116. Lemme, A., L. Grobe, M. Reck, J. Tomasch, and I. Wagner Dobler. 2011. Subpopulation specific transcriptome analysis of competence stimulating peptide induced Streptococcus mutans J. Bacteriol. 193: 1863 1877. 117. Lemme, A., L. Grobe, M. Reck, J. Tomasch, and I. Wagner Dobler. 2011. Subpopulation specific transcriptome analysis of competence stimulating peptide induced Streptococcus mutans. J Bacteriol 193: 1863 1877. 118. Lemos, J. A., J. Abranches, and R A. Burne. 2005. Responses of cariogenic streptococci to environmental stresses. Curr. Issues. Mol. Biol. 7: 95 107. 119. Lemos, J. A., T. A. Brown, Jr., and R. A. Burne. 2004. Effects of RelA on key virulence properties of planktonic and biofilm populations of Streptococcus mutans Infect. Immun. 72: 1431 1440. 120. Lemos, J. A., and R. A. Burne. 2008. A model of efficiency: stress tolerance by Streptococcus mutans Microb iology 154: 3247 3255. 121. Lemos, J. A., and R. A. Burne. 2002. Regulation and Physiological Significance of ClpC and ClpP in Streptococcus mutans J. Bacteriol. 184: 6357 6366. 122. Lemos, J. A., V. K. Lin, M. M. Nascimento, J. Abranches, and R. A. Burne. 2007. Three gene products govern (p)ppGpp production by Streptococcus mutans Mol. Microbiol. 65: 1568 1581.

PAGE 207

207 123. Lemos, J. A., M. M. Nascimento, V. K. Lin, J. Abranches, and R. A. Burne. 2008. Global regulation by (p)ppGpp and CodY in Streptococcus mutans J. Bacteriol. 190: 5291 5299. 124. Lemos, J. A., M. M. Nascimento, V. K. Lin, J. Abranches, and R. A. Burne. 2008. Global regulation by (p)ppGpp and CodY in Streptococcus mutans. J Bacteriol 190: 5291 5299. 125. Li, H., and R. Durbin. 2009. Fast and accurat e short read alignment with Burrows Wheeler transform. Bioinformatics (Oxford, England) 25: 1754 1760. 126. Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis, and R. Durbin. 2009. The sequence alignment/map format and SA Mtools. Bioinformatics (Oxford, England) 25: 2078 2079. 127. Li, Y. H., M. N. Hanna, G. Svensater, R. P. Ellen, and D. G. Cvitkovitch. 2001. Cell density modulates acid adaptation in Streptococcus mutans : implications for survival in biofilms. J. Bacteriol. 183: 6875 6884. 128. Li, Y. H., P. C. Lau, J. H. Lee, R. P. Ellen, and D. G. Cvitkovitch. 2001. Natural genetic transformation of Streptococcus mutans growing in biofilms. J. Bacteriol. 183: 897 908. 129. Li, Y. H., N. Tang, M. B. Aspiras, P. C. Lau, J. H. Lee, R. P. Ellen, and D. G. Cvitkovitch. 2002. A quorum sensing signaling system essential for genetic competence in Streptococcus mutans is involved in biofilm formation. J. Bacteriol. 184: 2699 2708. 130. Li, Y. H., X. L. Tian, G. Layton, C. Norgaard, and G. Sisson. 2008. Additive attenuation of virulence and cariogenic potential of Streptococcus mutans by simultaneous inactivation of the ComCDE quorum sensing system and HK/RR11 two component regulatory system. Microbiology 154: 3256 3265. 131. Linares, J. F., J. A. Lopez, E. Camafeita, J. P. Albar, F. Rojo, and J. L. Martinez. 2005. Overexpression of the multidrug efflux pumps MexCD OprJ and MexEF OprN is associated with a reduction of type III secretion in Pseudomonas aeruginosa J. Bacteriol. 187: 1384 139 1. 132. Lindahl, T., and B. Nyberg. 1972. Rate of depurination of native deoxyribonucleic acid. Biochemistry 11: 3610 3618. 133. Liu, Y., L. Zeng, and R. A. Burne. 2009. AguR is required for induction of the Streptococcus mutans agmatine deiminase system by low pH and agmatine. Appl. Environ. Microbiol. 75: 2629 2637. 134. Loesche, W. J. 1986. Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 50: 353 380.

PAGE 208

208 135. Loo, C. Y., D. A. Corliss, and N. Ganeshkumar. 2000. Streptococcus gordonii biofilm formation: identification of genes that code for biofilm phenotypes. J. Bacteriol. 182: 1374 1382. 136. Luo, P., H. Li, and D. A. Morrison. 2003. ComX is a unique link between multiple quorum sensing outputs and competence in Streptococcus pneumonia e Mol. Microbiol. 50: 623 633. 137. Luo, P., H. Li, and D. A. Morrison. 2004. Identification of ComW as a new component in the regulation of genetic transformation in Streptococcus pneumoniae Mol. Microbiol. 54: 172 183. 138. Luo, P., and D. A. Morrison. 2 003. Transient association of an alternative sigma factor, ComX, with RNA polymerase during the period of competence for genetic transformation in Streptococcus pneumoniae J. Bacteriol. 185: 349 358. 139. Ma, J. K., C. G. Kelly, G. Munro, R. A. Whiley, and T. Lehner. 1991. Conservation of the gene encoding streptococcal antigen I/II in oral streptococci. Infect. Immun. 59: 2686 2694. 140. Magitot, E. 1867. Treatise on dental caries: experimental and therapeutic investigations. 141. Magnuson, R., J. Solomon, and A. D. Grossman. 1994. Biochemical and genetic characterization of a competence pheromone from B. subtilis Cell 77: 207 216. 142. Marquis, R. E. 1995. Oxygen metabolism, oxidative stress and acid base physiology of dental plaque biofilms. J. Ind. Microb iol. 15: 198 207. 143. Marsh, P. D. 2003. Are dental diseases examples of ecological catastrophes? Microbiology 149: 279 294. 144. Martin, B., Y. Quentin, G. Fichant, and J. P. Claverys. 2006. Independent evolution of competence regulatory cascades in streptococci? Trends Microbiol 14: 339 345. 145. Martin, J., W. Zhu, K. D. Passalacqua, N. Bergman, and M. Borodovsky. 2010. Bacillus anthracis genome organization in light of whole transcrip tome sequencing. BMC bioinformatics 11 Suppl 3: S10. 146. Martin, M. 2011. Cutadapt removes adapter sequences from high throughput sequencing reads. EMB net.journal 17: 10 12. 147. Martinez Costa, O. H., M. A. Fernandez Moreno, and F. Malpartida. 1998. The r elA/spoT homologous gene in Streptomyces coelicolor encodes both ribosome dependent (p)ppGpp synthesizing and degrading activities. J. Bacteriol. 180: 4123 4132.

PAGE 209

209 148. Martinez, J. L., M. B. Sanchez, L. Martinez Solano, A. Hernandez, L. Garmendia, A. Fajard o, and C. Alvarez Ortega. 2009. Functional role of bacterial multidrug efflux pumps in microbial natural ecosystems. FEMS Microbiol. Rev. 33: 430 449. 149. Mashburn Warren, L., D. A. Morrison, and M. J. Federle. 2010. A novel double tryptophan peptide phero mone controls competence in Streptococcus spp. via an Rgg regulator. Mol Microbiol 78: 589 606. 150. Matsumoto Nakano, M., and H. K. Kuramitsu. 2006. Role of bacteriocin immunity proteins in the antimicrobial sensitivity of Streptococcus mutans J. Bacterio l. 188: 8095 8102. 151. Mattos Graner, R. O., S. Jin, W. F. King, T. Chen, D. J. Smith, and M. J. Duncan. 2001. Cloning of the Streptococcus mutans gene encoding glucan binding protein B and analysis of genetic diversity and protein production in clinical i solates. Infect. Immun. 69: 6931 6941. 152. Mechold, U., M. Cashel, K. Steiner, D. Gentry, and H. Malke. 1996. Functional analysis of a relA/spoT gene homolog from Streptococcus equisimilis J. Bacteriol. 178: 1401 1411. 153. Mechold, U., H. Murphy, L. Brown and M. Cashel. 2002. Intramolecular regulation of the opposing (p)ppGpp catalytic activities of Rel(Seq), the Rel/Spo enzyme from Streptococcus equisimilis J. Bacteriol. 184: 2878 2888. 154. Merritt, J., J. Kreth, W. Shi, and F. Qi. 2005. LuxS controls b acteriocin production in Streptococcus mutans through a novel regulatory component. Mol. Microbiol. 57: 960 969. 155. Merritt, J., and F. Qi. 2012. The mutacins of Streptococcus mutans : regulation and ecology. Mol. Oral Microbiol. 27: 57 69. 156. Merritt, J., F. Qi, and W. Shi. 2005. A unique nine gene comY operon in Streptococcus mutans Microbiology 151: 157 166. 157. Miller, M. C., S. Parkin, J. D. Fetherston, R. D. Perry, and E. Demoll. 2006. Crystal structure of ferric yersiniabactin, a virulence factor of Yersinia pestis. J Inorg Biochem 100: 1495 1500. 158. Mittenhuber, G. 2001. Comparative genomics and evolution of genes encoding bacterial (p)ppGpp synthetases/hydrolases (the Rel, RelA and SpoT proteins). J. Mol. Microbiol. Biotechnol. 3: 585 600. 159. Monchois, V., R. M. Willemot, and P. Monsan. 1999. Glucansucrases: mechanism of action and structure function relationships. FEMS Microbiol. Rev. 23: 131 151.

PAGE 210

210 160. Munro, C., S. M. Michalek, and F. L. Macrina. 1991. Cariogenicity of Streptococcus mutans V40 3 glucosyltransferase and fructosyltransferase mutants constructed by allelic exchange. Infect. Immun. 59: 2316 2323. 161. Nakano, K., R. Nomura, H. Nemoto, T. Mukai, H. Yoshioka, Y. Shudo, H. Hata, K. Toda, K. Taniguchi, A. Amano, and T. Ooshima. 2007. Det ection of novel serotype k Streptococcus mutans in infective endocarditis patients. J Med Microbiol 56: 1413 1415. 162. Nakano, K., and T. Ooshima. 2009. Serotype classification of Streptococcus mutans and its detection outside the oral cavity. Future Micro biol. 4: 891 902. 163. Nanamiya, H., K. Kasai, A. Nozawa, C. S. Yun, T. Narisawa, K. Murakami, Y. Natori, F. Kawamura, and Y. Tozawa. 2008. Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis Mol. Microbiol. 67: 29 1 304. 164. Nascimento, M. M., J. A. Lemos, J. Abranches, V. K. Lin, and R. A. Burne. 2008. Role of RelA of Streptococcus mutans in global control of gene expression. J. Bacteriol. 190: 28 36. 165. Nguyen, P. T. M., J. Abranches, T. N. Phan, and R. E. Marquis. 2002. Repressed respiration of oral streptococci grown in Biofilms. Curr Microbiol 44: 262 266. 166. Nishie, M., J. Nagao, and K. Sonomoto. 2012. Antibacterial peptides "bacteriocins": an overview of their diverse characteristics and applications. Biocontro.l Sci. 17: 1 16. 167. Niu, G., T. Okinaga, L. Zhu, J. Banas, F. Qi, and J. Merritt. 2008. Characterization of irvR, a novel regulator of the irvA dependent pathway required for genetic competence and dextran dependent aggregation in Streptococcus mutans J. Bacteriol. 190: 7268 7274. 168. Okinaga, T., G. Niu, Z. Xie, F. Qi, and J. Merritt. 2010. The hdrRM Operon of Streptococcus mutans Encodes a Novel Regulatory System for Coordinated Competence Development and Bacteriocin Production. J. Bacteriol. 192: 1844 1852. 169. Oppegard, C., L. Emanuelsen, L. Thorbek, G. Fimland, and J. Nissen Meyer. 2010. The lactococcin G immunity protein recognizes specific regions in both peptides constituting the two peptide bacteriocin lactococcin G. Appl. Environ. Micro biol. 76: 1267 1273. 170. Oshlack, A., M. D. Robinson, and M. D. Young. 2010. From RNA seq reads to differential expression results. Genome Biol. 11: 220.

PAGE 211

211 171. Palmer, S., J. Miller, J. Abranches, L. Zeng, T. Lefebure, V. Richards, J. Lemos, M. Stanhope, and R. A. Burne. 2013. Phenotypic Heterogeneity of Genomically Diverse Isolates of Streptococcus mutans PloS One. 172. Perera, I. C., Y. H. Lee, S. P. Wilkinson, and A. Grove. 2009. Mechanism for attenuation of DNA binding by MarR family transcriptional regu lators by small molecule ligands. J. Mol. Biol. 390: 1019 1029. 173. Perez Casal, J., M. G. Caparon, and J. R. Scott. 1991. Mry, a trans acting positive regulator of the M protein gene of Streptococcus pyogenes with similarity to the receptor proteins of tw o component regulatory systems. J. Bacteriol. 173: 2617 2624. 174. Perry, J. A., D. G. Cvitkovitch, and C. M. Levesque. 2009. Cell death in Streptococcus mutan s biofilms: a link between CSP and extracellular DNA. FEMS Microbiol. Lett. 299: 261 266. 175. Perr y, J. A., M. B. Jones, S. N. Peterson, D. G. Cvitkovitch, and C. M. Levesque. 2009. Peptide alarmone signalling triggers an auto active bacteriocin necessary for genetic competence. Mol. Microbiol. 72: 905 917. 176. Pestova, E. V., L. S. Havarstein, and D. A. Morrison. 1996. Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto induced peptide pheromone and a two component regulatory system. Mol. Microbiol. 21: 853 862. 177. Petersen, F. C., G. Fimland, and A. A. Scheie. 2 006. Purification and functional studies of a potent modified quorum sensing peptide and a two peptide bacteriocin in Streptococcus mutans Mol. Microbiol. 61: 1322 1334. 178. Petersen, F. C., L. Tao, and A. A. Scheie. 2005. DNA binding uptake system: a lin k between cell to cell communication and biofilm formation. J. Bacteriol. 187: 4392 4400. 179. Piddock, L. J. 2006. Multidrug resistance efflux pumps not just for resistance. Nat. Rev. Microbiol. 4: 629 636. 180. Pomares, M. F., P. A. Vincent, R. N. Farias, and R. A. Salomon. 2008. Protective action of ppGpp in microcin J25 sensitive strains. J. Bacteriol. 190: 4328 4334. 181. Pomposiello, P. J., M. H. Bennik, and B. Demple. 2001. Genome wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate. J. Bacteriol. 183: 3890 3902. 182. Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1993. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 57: 543 594.

PAGE 212

212 183. Potrykus, K., a nd M. Cashel. 2008. (p)ppGpp: Still Magical? Annu. Rev. Microbiol. 62: 35 51. 184. Potrykus, K., and M. Cashel. 2008. (p)ppGpp: Still Magical? Annual review of microbiology. 185. Qi, F., P. Chen, and P. W. Caufield. 2001. The group I strain of Streptococcus mutans UA140, produces both the lantibiotic mutacin I and a nonlantibiotic bacteriocin, mutacin IV. Appl. Environ. Microbiol. 67: 15 21. 186. Qi, F., P. Chen, and P. W. Caufield. 2000. Purification and biochemical characterization of mutacin I from the gr oup I strain of Streptococcus mutans CH43, and genetic analysis of mutacin I biosynthesis genes. Appl. Environ. Microbiol. 66: 3221 3229. 187. Qi, F., J. Kreth, C. M. Levesque, O. Kay, R. W. Mair, W. Shi, D. G. Cvitkovitch, and S. D. Goodman. 2005. Peptide pheromone induced cell death of Streptococcus mutans FEMS Microbiol. Lett. 251: 321 326. 188. Quivey, R. G., Jr., R. Faustoferri, K. Monahan, and R. Marquis. 2000. Shifts in membrane fatty acid profiles associated with acid adaptation of Streptococcus mut ans FEMS Microbiol. Lett. 189: 89 92. 189. Ra, R., M. M. Beerthuyzen, W. M. de Vos, P. E. Saris, and O. P. Kuipers. 1999. Effects of gene disruptions in the nisin gene cluster of Lactococcus lactis on nisin production and producer immunity. Microbiology 14 5 ( Pt 5): 1227 1233. 190. Reiness, G., H. L. Yang, G. Zubay, and M. Cashel. 1975. Effects of guanosine tetraphosphate on cell free synthesis of Escherichia coli ribosomal RNA and other gene products. Proc. Natl. Acad. Sci. U S A 72: 2881 2885. 191. Reyes Ca ballero, H., A. J. Guerra, F. E. Jacobsen, K. M. Kazmierczak, D. Cowart, U. M. Koppolu, R. A. Scott, M. E. Winkler, and D. P. Giedroc. 2010. The metalloregulatory zinc site in Streptococcus pneumoniae AdcR, a zinc activated MarR family repressor. J. Mol. B iol. 403: 197 216. 192. Robinson, M. D., and A. Oshlack. 2010. A scaling normalization method for differential expression analysis of RNA seq data. Genome Biol. 11: R25. 193. Robinson, M. D., and G. K. Smyth. 2007. Moderated statistical tests for assessing differences in tag abundance. Bioinformatics (Oxford, England) 23: 2881 2887. 194. Sajish, M., S. Kalayil, S. K. Verma, V. K. Nandicoori, and B. Prakash. 2009. The significance of EXDD and RXKD motif conserva tion in Rel proteins. J. Biol. Chem. 284: 9115 9123.

PAGE 213

213 195. Sajish, M., D. Tiwari, D. Rananaware, V. K. Nandicoori, and B. Prakash. 2007. A charge reversal differentiates (p)ppGpp synthesis by monofunctional and bifunctional Rel proteins. J. Biol. Chem. 282: 3 4977 34983. 196. Sambrook, J., and D. Russel. 2001. Molecular Cloning, 3rd ed, vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 197. Sarubbi, E., K. E. Rudd, and M. Cashel. 1988. Basal ppGpp level adjustment shown by new spoT mutants af fect steady state growth rates and rrnA ribosomal promoter regulation in Escherichia coli Mol. Gen. Genet. 213: 214 222. 198. Schmieder, R., and R. Edwards. 2011. Quality control and preprocessing of metagenomic datasets. Bioinformatics (Oxford, England) 2 7: 863 864. 199. Seaton, K., S. J. Ahn, A. M. Sagstetter, and R. A. Burne. 2011. A transcriptional regulator and ABC transporters link stress tolerance, (p)ppGpp, and genetic competence in Streptococcus mutans J. Bacteriol. 193: 862 874. 200. Senadheera, M. D., B. Guggenheim, G. A. Spatafora, Y. C. Huang, J. Choi, D. C. Hung, J. S. Treglown, S. D. Goodman, R. P. Ellen, and D. G. Cvitkovitch. 2005. A VicRK signal transduction system in Streptococcus mutans affects gtfBCD, gbpB, and ftf expression, biofilm for mation, and genetic competence development. J. Bacteriol. 187: 4064 4076. 201. Seyfzadeh, M., J. Keener, and M. Nomura. 1993. Spot Dependent Accumulation of Guanosine Tetraphosphate in Response to Fatty Acid Starvation in Escherichia coli Proceedings of th e National Academy of Sciences of the United States of America 90: 11004 11008. 202. Shaw, W. V., L. C. Packman, B. D. Burleigh, A. Dell, H. R. Morris, and B. S. Hartley. 1979. Primary structure of a chloramphenicol acetyltransferase specified by R plasmids Nature 282: 870 872. 203. Sheng, J., and R. E. Marquis. 2006. Enhanced acid resistance of oral streptococci at lethal pH values associated with acid tolerant catabolism and with ATP synthase activity. FEMS Microbiol. Lett. 262: 93 98. 204. Shibata, Y., K. Ozaki, M. Seki, T. Kawato, H. Tanaka, Y. Nakano, and Y. Yamashita. 2003. Analysis of loci required for determination of serotype antigenicity in Streptococcus mutans and its clinical utilization. J. Clin. Microbiol. 41: 4107 4112. 205. Smith, E. G., and G. A. Spatafora. 2012. Gene regulation in S. mutans : complex control in a complex environment. J. Dent. Res. 91: 133 141. 206. Solomon, J. M., B. A. Lazazzera, and A. D. Grossman. 1996. Purification and characterization of an extracellular peptide factor that affects two different developmental pathways in Bacillus subtilis Genes Dev 10: 2014 2024.

PAGE 214

214 207. Son, M., S. J. Ahn, Q. Guo, R. A. Burne, and S. J. Hagen. 2012. Microfluidic study of competence regulation in Streptococcus mutans: environmental inputs modula te bimodal and unimodal expression of comX. Mol Microbiol 86: 258 272. 208. Spatafora, G., K. Rohrer, D. Barnard, and S. Michalek. 1995. A Streptococcus mutans mutant that synthesizes elevated levels of intracellular polysaccharide is hypercariogenic in viv o Infect. Immun. 63: 2556 2563. 209. Sridhar, J., N. Sambaturu, R. Sabarinathan, H. Y. Ou, Z. Deng, K. Sekar, Z. A. Rafi, and K. Rajakumar. 2010. sRNAscanner: a computational tool for intergenic small RNA detection in bacterial genomes. PLoS One 5: e11970. 210. Staat, R. H., and C. F. Schachtele. 1974. Evaluation of dextranase production by the cariogenic bacterium Streptococcus mutans Infect. Immun. 9: 467 469. 211. Stein, T., S. Heinzmann, I. Solovieva, and K. D. Entian. 2003. Function of Lactococcus lacti s nisin immunity genes nisI and nisFEG after coordinated expression in the surrogate host Bacillus subtilis J. Biol. Chem. 278: 89 94. 212. Stephan, R. M., and E. S. Hemmens. 1947. Studies of changes in pH produced by pure cultures of oral micro organisms; effects of varying the microbic cell concentration; comparison of different micro organisms and different substrates; some effects of mixing certain micro organisms. J Dent Res 26: 15 41. 213. Stevens, K. E., D. Chang, E. E. Zwack, and M. E. Sebert. 2011. Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors. MBio 2 214. Stock, A. M., V. L. Robinson, and P. N. Goudreau. 2000. Two component signal transduction. Annu. Rev. Biochem. 69: 183 215. 215. Sturr, M. G., and R. E. Marquis. 1992. Comparative acid tolerances and inhibitor sensitivities of isolated F ATPases of oral lactic acid bacteria. Appl. Environ. Microbiol. 58: 2287 2291. 216. Sung, C. K., and D. A. Morrison. 2005. Two distinct functions of ComW in stabilization and activation of the alternative sigma factor ComX in Streptococcus pneumoniae J. Bacteriol. 187: 3052 3061. 217. Svensater, G., U. B. Larsson, E. C. Greif, D. G. Cvitkovitch, and I. R. Hamilton. 1997 Acid tolerance response and survival by oral bacteria. Oral Microbiol. Immunol. 12: 266 273. 218. Svitil, A. L., M. Cashel, and J. W. Zyskind. 1993. Guanosine tetraphosphate inhibits protein synthesis in vivo. A possible protective mechanism for starvatio n stress in Escherichia coli J. Biol. Chem. 268: 2307 2311.

PAGE 215

215 219. Tafer, H., and I. L. Hofacker. 2008. RNAplex: a fast tool for RNA RNA interaction search. Bioinformatics (Oxford, England) 24: 2657 2663. 220. Team, R. D. C. 2011. R: A language and environmen t for statistical computing. R foundation for Statistical Computing, Vienna, Ausrtia. 221. Terleckyj, B., N. P. Willett, and G. D. Shockman. 1975. Growth of several cariogenic strains of oral streptococci in a chemically defined medium. Infect. Immun. 11: 6 49 655. 222. Tojo, S., K. Kumamoto, K. Hirooka, and Y. Fujita. 2010. Heavy involvement of stringent transcription control depending on the adenine or guanine species of the transcription initiation site in glucose and pyruvate metabolism in Bacillus subtilis J. Bacteriol. 192: 1573 1585. 223. Traxler, M. F., S. M. Summers, H. T. Nguyen, V. M. Zacharia, G. A. Hightower, J. T. Smith, and T. Conway. 2008. The global, ppGpp mediated stringent response to amino acid starvation in Escherichia coli Mol. Mic robiol. 68: 1128 1148. 224. Vadeboncoeur, C., and M. Pelletier. 1997. The phosphoenolpyruvate:sugar phosphotransferase system of oral streptococci and its role in the control of sugar metabolism. FEMS Microbiol. Rev. 19: 187 207. 225. van der Ploeg, J. R. 20 05. Regulation of bacteriocin production in Streptococcus mutans by the quorum sensing system required for development of genetic competence. Journal of Bacteriology 187: 3980 3989. 226. Wang, J. D., G. M. Sanders, and A. D. Grossman. 2007. Nutritional cont rol of elongation of DNA replication by (p)ppGpp. Cell 128: 865 875. 227. Washietl, S., I. L. Hofacker, and P. F. Stadler. 2005. Fast and reliable prediction of noncoding RNAs. Proc. Natl. Acad. Sci. USA 102: 2454 2459. 228. Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell to cell communication in bacteria. Annu. Rev. Cell. Dev. Biol. 21: 319 346. 229. Wei, H., and L. S. Havarstein. 2012. Fratricide is essential for efficient gene transfer between pneumococci in biofilms. Appl. Environ. Microbiol. 78: 5897 5905. 230. Wen, Z. T., H. V. Baker, and R. A. Burne. 2006. Influence of BrpA on critical virulence attributes of Streptococcus mutans J. Bacteriol. 188: 2983 2992. 231. Wen, Z. T., and R. A. Burne. 2004. LuxS mediated signaling in Streptococcus mut ans is involved in regulation of acid and oxidative stress tolerance and biofilm formation. J. Bacteriol. 186: 2682 2691.

PAGE 216

216 232. Wen, Z. T., P. Suntharaligham, D. G. Cvitkovitch, and R. A. Burne. 2005. Trigger factor in Streptococcus mutans is involved in str ess tolerance, competence development, and biofilm formation. Infect. Immun. 73: 219 225. 233. Wenderska, I. B., N. Lukenda, M. Cordova, N. Magarvey, D. G. Cvitkovitch, and D. B. Senadheera. 2012. A novel function for the competence inducing peptide, XIP, a s a cell death effector of Streptococcus mutans FEMS Microbiol. Lett. 234. Wexler, D. L., M. C. Hudson, and R. A. Burne. 1993. Streptococcus mutans fructosyltransferase ( ftf ) and glucosyltransferase ( gtfBC ) operon fusion strains in continuous culture. Inf ect. Immun. 61: 1259 1267. 235. Wexler, D. L., J. E. Penders, W. H. Bowen, and R. A. Burne. 1992. Characteristics and cariogenicity of a fructanase defective Streptococcus mutans strain. Infect. Immun. 60: 3673 3681. 236. Wilkinson, S. P., and A. Grove. 2006 Ligand responsive transcriptional regulation by members of the MarR family of winged helix proteins. Curr. Issues. Mol. Biol. 8: 51 62. 237. Xie, Z., T. Okinaga, G. Niu, F. Qi, and J. Merritt. 2010. Identification of a novel bacteriocin regulatory system in Streptococcus mutans Mol. Microbiol. 78: 1431 1147. 238. Yamada, T., and J. Carlsson. 1975. Regulation of lactate dehydrogenase and change of fermentation products in streptococci. J. Bacteriol. 124: 55 61. 239. Yamamoto, Y., K. Fukui, N. Koujin, H. Ohya K. Kimura, and Y. Kamio. 2004. Regulation of the intracellular free iron pool by Dpr provides oxygen tolerance to Streptococcus mutans J. Bacteriol. 186: 5997 6002. 240. Yamashita, Y., W. H. Bowen, R. A. Burne, and H. K. Kuramitsu. 1993. Role of the Streptococcus mutans gtf genes in caries induction in the specific pathogen free rat model. Infect. Immun. 61: 3811 3837. 241. Yamashita, Y., T. Takehara, and H. K. Kuramitsu. 1993. Molecular characterization of a STreptococcus mutans mutant altered in envi ronmental stress responses. J. Bacteriol. 175: 6220 6228. 242. Zeng, L., S. Das, and R. A. Burne. 2010. Utilization of lactose and galactose by Streptococcus mutans : transport, toxicity, and carbon catabolite repression. J. Bacteriol. 192: 2434 2444. 243. Ze ng, L., Z. T. Wen, and R. A. Burne. 2006. A novel signal transduction system and feedback loop regulate fructan hydrolase gene expression in Streptococcus mutans Mol. Microbiol. 62: 187 200.

PAGE 217

217 244. Zhu, L., J. Kreth, S. E. Cross, J. K. Gimzewski, W. Shi, and F. Qi. 2006. Functional characterization of cell wall associated protein WapA in Streptococcus mutans Microbiology 152: 2395 2404. 245. Zubay, G., D. E. Morse, W. J. Schrenk, and J. H. Miller. 1972. Detection and isolation of the repressor protein for the tryptophan operon of Escherichia coli Proc. Natl. Acad. Sci. U S A 69: 1100 1103.

PAGE 218

218 BIOGRAPHICAL SKETCH Kinda Chikere Seaton was born in Georgetown, Guyana South America to Julian M. P. and Yvette P. Seaton. She had her first son, Kyman i 2012. Kinda moved to Manchester, Jamaica in 1996 where she completed her high school education in July 2001. The author attended the Louisiana State University, Baton Rouge from August 2001 to May 2005 as an undergraduate, where she was awarded a non resi dent full tuition scholarship. She graduated from LSU in May 2005 with a Bachelor of Science degree in Biological Scien ces. The author worked as a substitute teacher for the Charlotte Mecklenburg School system from September 2005 June 2006. In August 2006, she began her graduate career at the University of Florida in Biomedical Sciences. From May 2007 to the present, her graduate research in the Immunology and Microbiology advanced concentration was supervised by Robert A. Burne, Ph.D.