<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.

DARK ITEM
Permanent Link: http://ufdc.ufl.edu/UFE0044887/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Scott, Clare H
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Clare H Scott.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Branham, Marc A.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044887:00001

Permanent Link: http://ufdc.ufl.edu/UFE0044887/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Scott, Clare H
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Clare H Scott.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Branham, Marc A.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044887:00001


This item has the following downloads:


Full Text

PAGE 1

1 SYSTEMATICS OF THE LICHEN MOTH TRIBE LITHOSIINI (LEPIDOPTERA: EREBIDAE: ARCTIINAE) INCLUDING A REVIEW OF THE GENUS LYCOMORPHA HARRIS By CLARE HILARY SCOTT A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Clare H. Scott

PAGE 3

3 To my family whose support throughout this long journey has been invaluable

PAGE 4

4 ACKNOWLEDGMENTS This research would not have been possible without the support of numerous people and institutions. I would like to acknowledge the support and advice of my major advisor and committee chair, Dr. Marc Branham, and the other members of my graduate committee, Drs. Rebecca Simmons, Jackie Miller, David Reed, and Christine Miller. I would like to thank Drs. Susan Weller and Jennifer Zaspel for giving me the opportunity to participate in their molecular phylogeny of Arctiinae. Furthermore, I w ish to acknowledge the National Science Foundation Award DEB# 0919185 for the partial financial support of this research. Without the funding Drs. Weller and Zaspel received, the molecular phylogeny of Lithosiini would not have been completed. In addition, the work of Pablo Chialvo, Taylor Wardwell, and Elizabeth Phillippi on this study was invaluable. Pablo helped to amplify the COI and 28S gene fragments and willingly came into the lab on the weekend and holidays to help with this project. Taylor and Elizabeth helped to amplify the CytB and RpS5 gene fragments. In addition, Taylor dealt with submitting all fragments for sequencing. I would like to acknowledge all of the collections listed in Chapters 25 for the material that they provided. Without the use of these specimens, the morphological studies would not have been possible, and the taxon sampling of the molecular study would not have been as broad. Further thanks are offered to the American Museum of Natural History, the Carnegie Museum of Natural History the Cornell University Insect Collection, the Florida Museum of Natural History the Museum of Comparative Zoology (Harvard), the United St ates Museum of Natural Hi story and the Yale Peabody Museum Each of these institutes was kind enough to allow me to visit and examine

PAGE 5

5 their holdings of several families of Lepidoptera, while looking for specimens of Lycomorpha. The tribal phylogenetic analyses were conducted using the University of Florida Phyloinformatics Cluster for High Performance Computing in the Life Sciences and the CIPRES Science Gateway (Miller et al. 2010). Without access to these computer clusters, the time needed to run the tribal phylogenetic analysis would have been prohibitively long This research was funded in part by the Museum of Comparative Zoology Ernst Mayr Travel Grant in Animal Systemati cs, the Systematics, Evolution, and Biodiversity Sections Student Travel Award of the Entomological Society of America, the University of Florida Alumni Fellowship, and the University of Florida SPICE fellowship.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES .......................................................................................................... 10 LIST OF FIGURES ........................................................................................................ 11 ABSTRACT ................................................................................................................... 14 CHAPTER 1 INTRODUCTION .................................................................................................... 16 Literature Review .................................................................................................... 16 Larval Feeding Behavior ................................................................................... 17 Chemical Defense ............................................................................................ 19 Courtship Behavior ........................................................................................... 20 Research Objectives ............................................................................................... 22 Chapter 2 .......................................................................................................... 22 Chapter 3 .......................................................................................................... 23 Chapter 4 .......................................................................................................... 24 Chapter 5 .......................................................................................................... 25 Chapter 6 .......................................................................................................... 26 2 A PRELIMINARY PHYLOG ENY OF THE LICHEN MOTH TRIBE LITHOSIINI (LEPIDOPTERA: EREBIDAE: ARCTIINAE) BASED ON MORPHOLOGICAL CHARACTERS ....................................................................................................... 27 Background Informati on .......................................................................................... 27 Materials and Methods ............................................................................................ 31 Taxon Sampling ............................................................................................... 31 Morphology ....................................................................................................... 32 Characters Examined ....................................................................................... 33 Characters and their Phylogenetic Usefulness ................................................. 33 Head .......................................................................................................... 33 Thorax ........................................................................................................ 34 Wings ......................................................................................................... 35 Abdomen .................................................................................................... 36 Male abdomen and genitalia ...................................................................... 37 Female abdomen and genitalia .................................................................. 42 Phylogenetic Analysis ...................................................................................... 44 Results .................................................................................................................... 45 Discussion .............................................................................................................. 49

PAGE 7

7 3 MOLECULAR PHYLOGENY OF THE TRIBE LITHOSIINI (LEPIDOPTERA: EREBIDAE: ARCTIINAE) ....................................................................................... 83 Background Information .......................................................................................... 83 Materials and Methods ............................................................................................ 87 Taxon Sampling ............................................................................................... 87 DNA Extraction, Amplification, and Sequencing ............................................... 88 Phylogenetic Methods ...................................................................................... 91 Results and Discussion ........................................................................................... 92 4 PHYLOGENY OF THE LICHEN MOTH GENUS LYCOMORPHA HARRIS (LEPIDOPTERA: EREBIDAE: ARCTIINAE) ......................................................... 109 Background Information ........................................................................................ 109 Materials and Methods .......................................................................................... 112 Taxon Sampling ............................................................................................. 112 Collections Consulted ..................................................................................... 113 Morphology ..................................................................................................... 114 Characters Examined ..................................................................................... 115 Phylogenetic Analysis .................................................................................... 115 Results .................................................................................................................. 117 Phylogenetic Analysis and Taxonomic Implications ....................................... 117 Species Checklist of Lycomorpha .................................................................. 122 Checklist of Species Described as Lycomorpha ............................................. 123 Lithosiini ................................................................................................... 123 Arctiini ...................................................................................................... 124 Zygaenidae .............................................................................................. 125 Incertae sedis ........................................................................................... 126 Characters and t heir Phylogenetic Usefulness ............................................... 126 Head ........................................................................................................ 126 Thorax ...................................................................................................... 127 Wings ....................................................................................................... 127 Abdomen .................................................................................................. 128 Male abdomen and genital ia .................................................................... 128 Female abdomen and genitalia ................................................................ 134 Characters examined but excluded from the analysis .............................. 137 5 A REVISION OF THE GENUS LYCOMORPHA HARRIS (LEPIDOPTERA: EREBIDAE: ARCTIINAE: LITHOSIINI) INCLUDING SPECIES FORMERLY PLACED IN THE GENUS PROPYRIA HAMPSON (LEPI DOPTERA: EREBIDAE: ARCTIINAE: LITHOSIINI) ................................................................. 167 Background Information ........................................................................................ 167 Taxonomic History of Lycomorpha and Propyria .................................................. 169 Synonymic Checklist of the Genus Lycomorpha ................................................... 172 Materials and Methods .......................................................................................... 173 Material Examined .......................................................................................... 173

PAGE 8

8 Morphology ..................................................................................................... 174 Species Descriptions ...................................................................................... 175 Systematic Entomology of the Genus Lycomorpha .............................................. 176 Lycomorpha atroxantha (Schaus) .................................................................. 180 Lycomorpha concolor Scott New Species ...................................................... 184 Lycomorpha fulgens (Henry Edwards) ........................................................... 190 Lycomorpha grotei (Packard) ......................................................................... 197 Lycomorpha miniata Packard ......................................................................... 203 Lycomorpha morelosia (Schaus) .................................................................... 209 Ly comorpha neomexicanus Scott New Species ............................................. 214 Lycomorpha normani (Schaus) ...................................................................... 218 Lycomorpha pholus (Drury) ............................................................................ 221 Lycomo rpha ptychoglene (Hampson) ............................................................. 227 Lycomorpha pulchra Dyar .............................................................................. 232 Lycomorpha regulus (Grinnell) ....................................................................... 238 Lycomorpha splendens Barnes and McDunnough ......................................... 244 Lycomorpha texanus Scott New Species ....................................................... 248 6 DISCUSSION AND FUTURE DIRECTIONS ........................................................ 268 Tribal Study ........................................................................................................... 268 Review of Lycomorpha ......................................................................................... 270 Future Directions .................................................................................................. 271 Tribal Systematics .......................................................................................... 271 Chemical Defense .......................................................................................... 272 Courtship Behavior of Lycomorpha ................................................................ 273 APPENDIX A MORPHOLOGICAL DATA MATRIX FOR TRIBAL PHYLOGENY ........................ 274 B CHARACTER DIAGNOSTICS FOR STRICT CONSENSUS TREE ..................... 279 C DATA MATRIX USED TO PRODUCE TREES BASED ON MOLECULAR DATA 281 D LIST OF CHARACTERS AND STATES IN PHYLOGENY OF LYCOMORPHA ... 335 Head ..................................................................................................................... 335 Thorax ................................................................................................................... 335 Wings .................................................................................................................... 335 Abdomen .............................................................................................................. 335 Male Abdomen and Genitalia ................................................................................ 336 Male Abdomen ............................................................................................... 336 Genital Capsule .............................................................................................. 336 Phallus ............................................................................................................ 338 Female Abdomen and Genitalia ........................................................................... 338 E ALL SPECIES DATA MATRIX FOR LYCOMORPHA PHYLOGENY .................... 341

PAGE 9

9 F COLLECTION LOCALITY DATA FROM SPECIMENS USED TO ILLUSTRATE THE ADULT HABITUS OF LYCOMORPHA ......................................................... 342 LIST OF REFERENCES ............................................................................................. 345 BIOGRAPHICAL SKETCH .......................................................................................... 360

PAGE 10

10 LIST OF TABLES Table page 2 1 Comparative table of generic groups of Lithosiini ............................................... 54 2 2 Ingroup taxon sampling ...................................................................................... 55 2 3 Species examined in the phylogenetic analysis .................................................. 56 3 1 List of species used in the analysis .................................................................... 99 3 2 PCR protocol data ............................................................................................ 102 3 3 Optima l partitioning schemes ........................................................................... 103 3 4 Interpretation of the Bayes Factor .................................................................... 104 4 1 Historical family treatment of Lycomorpha ........................................................ 140 4 2 Species included in the phylogenetic analysis .................................................. 141 4 3 Character support for major ingroup clades. .................................................... 143 4 4 Results of Outgroup Jackknife Analysis ........................................................... 145

PAGE 11

11 LIST OF FIGURES Figure page 2 1 Sample of lithosiine species included in the study .............................................. 61 2 2 Lateral view, head .............................................................................................. 62 2 3 Proth oracic leg ................................................................................................... 63 2 4 Male hindwing ..................................................................................................... 64 2 5 A2 sternite .......................................................................................................... 65 2 6 Proximal margin of male eighth sternite, Part A .................................................. 66 2 7 Proximal margin of male eig hth sternite, Part B .................................................. 67 2 8 Tegumen location ............................................................................................... 68 2 9 Tegumen fusion .................................................................................................. 69 2 10 Pleural sclerites .................................................................................................. 70 2 11 Juxta ................................................................................................................... 71 2 12 External view, left valva ...................................................................................... 72 2 13 Internal view, right valva ..................................................................................... 73 2 14 External view, left valva (A,B) and Internal view, right valva (C,D) ..................... 74 2 15 Lateral view, left side, phallus ............................................................................. 75 2 16 Abdominal pelt (A,C) and female genital capsule (B,D), Part A .......................... 76 2 17 Abdominal pelt (A,C) and female genital capsule (B, D), Part B .......................... 77 2 18 Abdominal pelt (A) and female genital capsule (B), Part C ................................. 78 2 19 Ventral female genital capsule ............................................................................ 79 2 20 Bursa copulatrix .................................................................................................. 80 2 21 Strict consensus of the 4408 MP trees ............................................................... 81 2 22 Majority rule consensus tree of the Bayesian analysis ....................................... 82

PAGE 12

12 3 1 Maximum likelihood tree from analysis of AIC, AICc optimal partitioning scheme ............................................................................................................. 105 3 2 Maximum likelihood tree from analysis of BIC optimal partitioning scheme ..... 106 3 3 Majority rule consensus tree of the Bayesian analysis using the AIC, AICc optimal partitioning scheme .............................................................................. 107 3 4 Majority rule consensus tree of the Bayesian analysis using the BIC optimal partitioning scheme .......................................................................................... 108 4 1 Species mistakenly described as members of Lycomorpha ............................. 146 4 2 Lycomorpha species with red forewings and primarily black hindwings ........... 147 4 3 Strict consensus of 3 trees (L=192, CI=0.68, RI=0.71) resulting from t he MP analysis of the MF matrix .................................................................................. 148 4 4 Strict consensus of 3 trees (L=192, CI=0.68, RI=0.73) resulting from the MP analysis of the AS matrix .................................................................................. 149 4 5 Bayesian Inference consensus tree from the analysis of the AS matr ix ........... 150 4 6 Strict consensus of 9 trees (L=191, CI=0.68, RI=0.69) resulting from the exclusion of outgroup taxon Hypoprepia .......................................................... 151 4 7 Strict consensus of 3 trees (L=184, CI=0.70, RI=0.72) resulting from the exclusion of outgroup taxon Ptychoglene ......................................................... 152 4 8 Strict consensus of 6 trees (L=186, CI=0.68, RI=0.70) resulting from the exclusion of outgroup taxon Talara ................................................................... 153 4 9 Strict consensus of 3 trees (L=179, CI=0.70, RI=0.74) resulting from the exclusion of outgroup taxon Lycomorphodes ................................................... 154 4 10 Strict consensus of 6 trees (L=175, CI=0.70, RI=0.75) resulting from the exclusion of outgroup taxon Hypermaepha ...................................................... 155 4 11 Strict consensus of 9 trees (L=190, CI=0.67, RI=0.70) resulting from the exclusion of outgroup taxon Dolichesia ............................................................ 156 4 12 Strict consensus of 24 trees (L=198, CI=0.66, RI=0.71) resulting from constraining the monophyly of Lycomorpha ..................................................... 157 4 13 Strict consensus of 30 trees (L=194, CI=0.67, RI=0.72) resulting from constraining the monophyly of Propyria ............................................................ 158 4 14 Male antennal flagellomeres ............................................................................. 159

PAGE 13

13 4 15 Female antennal flagellomeres ......................................................................... 160 4 16 State of gena .................................................................................................... 161 4 17 Labial palps ...................................................................................................... 162 4 18 Forewing venation ............................................................................................ 163 4 19 Hindwing venation ............................................................................................ 164 4 20 Sec ond abdominal sternite ............................................................................... 165 4 21 A7/A8 androconia ............................................................................................. 166 5 1 Strict consensus of 3 most parsimonious trees (L=192, CI=0.68, RI=0.73) resulting from the maximum parsimony analysis of the all species (AS) dataset .............................................................................................................. 255 5 2 Images of the adult habitus of the genus Lycomorpha, Plate 1 ........................ 256 5 3 I mages of the adult habitus of the genus Lycomorpha, Plate 2 ........................ 257 5 4 Images of the adult habitus of the genus Lycomorpha, Plate 3 ........................ 258 5 5 Images of the adult habitus of the genus Lycomorpha, Plate 4 ........................ 259 5 6 Images of the adult habitus of the genus Lycomorpha, Plate 5 ........................ 260 5 7 Adult habitus of female L. pelopia ..................................................................... 260 5 8 Male flagellomere state .................................................................................... 261 5 9 Female flagellomere state ................................................................................ 262 5 10 Labial palp segment fusion ............................................................................... 263 5 11 Medial veins of the forewing ............................................................................. 264 5 12 Medial and cubital veins of hindwing ................................................................ 265 5 13 Anterolateral process (ALP) form ..................................................................... 266 5 14 Androconia of the A7/A8 intersegmental membrane ....................................... 267

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy SYSTEMATICS OF THE LICHEN MOTH TRIBE LITHOSIINI (LEPIDOPTERA: EREBIDAE: ARCTIINAE) INCLUDING A REVIEW OF THE GENUS LYCOMORPHA HARRIS By Clare Hilary Scott December 2012 Chair: Marc A. Branham Major: Entomology and Nematology The tribe Lithosii ni is composed of an estimated 5 ,000 to 6 ,000 species, which are distributed worldwide. Lithosiini represents the most biodiverse lineage of lichen feeders within Lepidoptera. The tribe is well known for this larval feeding behavior, but no studies have been conducted to examine the evolutionary relationships among the genera of Lithosiini. Only one study has been completed that examined the systematics of a lithosiine genus However, changes continue to be made to the taxonomy of both the tribe and the genera that compose it. In this study, phylogenies of the tribe were constructed based on datasets composed of either morphological or molecular data. These phylogenies were used to examine the evolutionary relationships among the genera of the tribe and to determine whether the subtribes are monophyletic. The datasets were analyzed using maximum parsimony, Bayesian inference, and maximum likelihood methods. The phylogenies obt ained based on the adult morphology are almost entirely unresolved, but Lithosiini is recovered as monophyletic. The topologies recovered in the molecular phylogeny are more resolved. However, there is no nodal support for the deeper nodes, and Lithosiini is not found to be monophyletic. None of

PAGE 15

15 the phylogenies produced by either dataset recovers the subtribes of Lithosiini as monophyletic. In addition to the higher level studies of the tribe, a review of the genus Lycomorpha was completed. A phylogeny was constructed based on adult morphological characters. This phylogeny demonstrates that Lycomorpha is not reciprocally monophyletic with respect to the lithosiine genus Propyria Based on these findings the two genera are synonymized. The name Lycomorpha is given priority based on seniority. Following these changes in the classification of the genus, a revision of the genus Lycomorpha was completed. Descriptions are provided for both the genus and fourteen of the twenty species within Lycomorpha. Three new species are described as part of this study.

PAGE 16

16 CHAPTER 1 INTRODUCTION Literature Review The subfamily Arctiinae Leach is comprised of over 11,000 species, which are cosmopolitan in distribution. This subfamily has been hypothesized to contain at least five tribes, Lithosiini, Arctiini, Ctenuchini, Pericopini, and Thyretini, each of which has formerly been treated as a separate family. In order to assess the monophyly of these five tribes, Jacobson & Weller (2002) constructed a phylogeny of the subfamily using adult and larval morphological characters. The resulting phylogeny recovered Arctiina e as a monophyletic lineage that was supported by two larval and three adult characters The tribe Lithosiini was found to be monophyletic, and eight synapomorphies defined this lineage. Arctiini sensu latu was found to be paraphyletic with respect to Peri copini and Ctenuchini. Jacobson & Weller (2002) redefined the tribe Arctiini to include these lineages. In addition, the phylogeny demonstrated that Ctenuchini was neither monophyletic nor natural. The Syntomiina of Ctenuchini was found to be sister to Thy retini, while the remaining species of Ctenuchini were recovered in Arctiini. The monophyletic Syntomiina+Thyretini clade, Syntomiini, was recovered sister to Lithosiini. Previously, Bendib & Minet (1998) had hypothesized that Syntomiini was sister to Arct iini. Although the phylogenetic analysis of the morphological characters found Lithosiini and Syntomiini to be sister, studies conducted using molecular data (Zahiri et al. 2011, 2012) have recovered Syntomiini sister to Arctiini. In addition, these molecular phylogenies recovered Lithosiini as the basal most clade within Arctiinae. Despite finding different relationships among the tribes, the monophyly of Lithosiini, Arctiini, and Syntomiini has been supported by both morphological and molecular phylogenet ic

PAGE 17

17 studies. However, the relationships among the genera that comprise these tribes remain in flux. This is especially true of the tribe Lithosiini, which is composed of 457 genera. No empirical studies have been conducted that examine the systematics of this tribe. However, authors (Bendib & Minet 1999; Birket Smith 1965; Forbes 1960; Franclemont 1983) all suggested subtribal relationships among the genera of Lithosiini. This lack of resolved phylogenetic relationships among the genera of each tribe make it impossible to study the evolution of chemical defense or courtship behavior within these tribes. Larval Feeding Behavior Within the subfamily Arctiinae, the larvae range from monophagous ( e.g. Utetheisa ornatrix (Linnaeus) feeds on only Crotalaria spp.) t o highly polyphagous ( e.g. Estigmene acrea (Drury) feeds on more than sixty five larval host plants (Hartmann et al. 2005)). Dyer et al. (2007) found that as latitude decreases, there is an increase in the number of monophagous species of Arctiinae. The larvae of the tribe Arctiini have been reported to feed on the tissue of both angiosperms and gymnosperms. Many of the species within this tribe are capable of consuming host plants that are defended with pyrrolizidine alkaloids (PA). In addition, some speci es can feed on plants containing cardiac glycosides (CG). The larvae that consume plants containing either PA or CG sequester these chemicals within their bodies for defense. Weller et al. (1999) hypothesized that the ability to sequester PA from the larval host plant was present in the ancestor of Arctiini. Although the ability to consume plants containing PA occurs throughout the tribe, not all species that sequester PA can successfully r each adulthood feeding only on plants containing these compounds (Bernays et al. 2002). Few reports exist for the larval feeding behavior of the small (~200 species) tribe Syntomiini. The larvae of this tribe have been found to feed on an assortment of pla nt families, dead

PAGE 18

18 plant material, and in some species lichens and mosses (Weller et al. 2009) The tribe Lithosiini, which is estimated to contain 5,000 to 6,000 species, is hypothesized to represent the most biodiverse lineage of lichen feeders within Lepidoptera. Although lichenivory has evolved several times within the ditrysian Lepidoptera (Rawlins 1984), the majority of the lineages that practice this behavior only consist of of approximately two dozen species (Wagner et al. 2008). However, debate exi sts over whether the larvae of Lithosiini are true lichen feeders or graze solely on the algal component of lichens. In their feeding experiments with Eilema complana (Linnaeus), Hesbacher et al. (1995) found that early instar larvae fed exclusively on the cortical and algal layers of the lichen Cladonia pyxidata. By consuming these tissues of the lichen, the larvae avoided feeding on the fungal component of the lichen. In other feeding experiments conducted using Eilema species, the larvae were found to pr efer those lichens that possess fewer polyphenolic compounds (Pykk & Hyvrinen 2003; Pykk et al. 2005). The results of these feeding experiments suggest that lithosiine larvae are algivores. However, Hesbacher et al. (1995) detected the presence of lic hen phenolics that are only produced by the fungal component of the lichen within the adults of eleven lithosiine species representing five genera. Furthermore, Pykk & Hyvrinen (2003) noted that while the larvae fed preferentially on a lichen species wi thout polyphenolic substances, they would forage on other lichens that contained polyphenolics. This behavior suggests that larvae of Lithosiini selectively feed on the fungal components of lichens to obtain defensive chemicals but require other nutritional factors to achieve adulthood.

PAGE 19

19 Chemical Defense The use of chemical defenses against predators and parasitoids is found throughout each of the three tribes of the subfamily Arctiinae. The chemicals used for defense can be sequestered by the larvae from t heir host, produced de novo by either the adult s o r larvae, or obtained by an adult visiting a plant that contains the desired defensive chemical ( e.g. pharmacophagy, as defined by Boppr 1984). Within Arctiinae, the most commonly found defensive chemicals are PA, CG, iridoid glycosides (IG), and biogenic amines (BA) (Weller et al. 1999; Nishida 2002). Hristov & Conner (2005) found that species, which possessed CG, were the most unpalatable to the big brown bat, Eptesicus fuscus followed by species with PA Species of Arctiinae that are chemically defended frequently advertise their distastefulness with bright color patterns. In addition, some of these species also use ultrasonic clicks to warn off auditory predators such as bats. All of the previously mentioned chemicals can be found within different members of the tribe Arctiini. The ability to sequester PA is hypothesized to have been present in the ancestor of the tribe (Weller et al. 1999). PA can be obtained through the larval host plant or by pharmacophagy in the adults. Some species ( e.g. E. acrea) are defended in all life stages by PA (Hartmann et al. 2004). In addition, Hartmann et al. (2004) found that males will transfer their PA load to the female while mating, and the females transfer their PA load to the eggs. CG and IG are obtained from the larval host plant. However, BA are produced de novo and provide the least protection (Weller et al. 1999; Hristov & Conner 2005). Less i s known about the chemical compounds found in the tribe Syntomiini. The species Amata phegea Linnaeus was found to possess BA, and other species of Amata have been found to possess pyrazines (Weller et al. 1999). The

PAGE 20

20 only chemicals that have been found in the tribe Lithosiini are lichen phenolics. Hesbacher et al (1995) examined 103 adults of sixteen species representing eight lithosiine genera using HPLC analysis to test for the presence of lichen polyphenolics. Individuals of eleven species representing five genera possessed known lichen phenolics and other lichenderived compounds. An additional six species were found that possessed only lichenderived compounds. However, this survey (Hesbacher et al. 1995) was not broad enough to determine how frequentl y the sequestration of lichen polyphenolics occurs within Lithosiini. Although the frequency of chemical defenses within Lithosiini has not been broadly documented, the adults of both brightly colored, mimetic lineages ( e.g Hypoprepia Hbner) and drably c olored individuals ( e.g. Agylla Walker) have been found to be unpalatable to bats and birds (Acharya & Fenton 1992; Collins & Watson 1983; Sargent 1995). Furthermore, Hristov & Conner (2005) found that Hypoprepia fucosa Hbner was equally as unpalatable as Arctiini species that possess CG. Courtship Behavior Throughout the subfamily Arctiinae, the males of some species have been found to use scent (pheromones), sound, and/or a combination of both in their courtship rituals. When males use pheromones, these chemicals are released using eversible pheromone glands (coremata) or scent scales (androconia). Androconia occur in numerous forms throughout Arctiinae including hairbrushes on the male forelegs (Schneider et al. 1999), patches of modified wing scales (Jacobson & Weller 2002; Holloway 2002), and subabdominal pouches (Weller et al. 2000). The sounds produced in courtship occur at ultrasonic frequencies and are created by buckling modified cuticular plates present on the metathorax (tymbal organs). These are the same

PAGE 21

21 structures used to create the ultrasonic clicks that advertise the presence of chemical defenses to auditory predators. Both types of courtship are found to occur in the tribe Arctiini. The pheromones used by almost all of the males of this tribe have been found to contain one of two dihydropyrrolizines: hydroxydanaidal or danaidal (Schulz 2009). Both of these compounds are derived from PA. Both monophagous and polyphagous species of Arctiini that consume plants containing PA produce PA derived pheromones. However, the larvae of polyphagous species do not always encounter plants containing PA. When the male larvae of these species ( e.g. Creatonotus gangis Linnaeus, Creatonotus transiens (Walker), E. acrea) do not obtain PA, their coremata do not d evelop fully (Boppr & Schneider 1985; Jordan et al. 2007; Schneider et al. 1982). Males that lack fully developed coremata do not engage in lekking behavior (Jordan et al. 2005; Willis & Birch 1982; Wunderer et al. 1986). In addition, PA can be found in species whose larvae no longer feed on plants containing these compounds ( e.g. Cisseps fulvicullis Hbner). In the species C. fulvicullis pharmacophagous adult males obtain the compounds, which are then transferred to the female as a nuptial gift (Doussourd 1986). Although the use of pheromones derived from PA is the most common courtship strategy found within Arctiini, some species have been found to use pheromones that are not derived from PA ( e.g Cycnia in Conner 1987) or rely solely on ultrasound ( e.g Syntomeida epilai s Walker in Sanderford & Conner 1990, 1995). Although the courtship behaviors of the tribe Arctiini have been well studied, very little is known of the courtship behaviors of the tribes Syntomiini and Lithosiini. Males of Syntomiini pos sess androconial organs (Schneider et al. 1999). However, the chemicals

PAGE 22

22 present in their pheromones are unknown. Within the tribe Lithosiini, the males possess a wide range of scent disseminating structures that include coremata, modified wing scale patches, and androconial pouches on both the abdomen and genital capsule (pers. obs.). As in Syntomiini, the pheromones contained in these structures are unknown. However, the Lithosiini have been found to be able to sequester lichen phenolic compounds for defense. It is possible that, like Arctiini, they have coopted their defensive chemicals for courtship. In addition, adult Lithosiini frequently possess tymbal organs. (1990) demonstrated that the ultrasound produced by species of Setina Schrank was used in their courtship rituals. Until more data is obtained for the tribes Syntomiini and Lithosiini, the evolution of chemical defense and courtship in the subfamily Arctiinae cannot be studied. In addition, a resolved phylogeny of Lithosiini will be needed to study the evolution of these behaviors within this tribe. Research Objectives Chapter 2 The tribe Lithosiini is estimated to contain approximately 5,000 to 6,000 species. These species are placed within 457 genera and are cosmopolitan in distribution. Lithosiini is well known for the feeding behavior of its larvae: lichenivory. In addition, the adults of some species have been found to sequester lichenphenolics (Hesbacher et al. 1995). The tribe Lithosiini is the only lichenfeeding lineage that seques ters these compounds. It is hypothesized that the lichen phenolics are used for defense, and many of the adults are aposematically colored. Although the tribe is well known for its association with lichens, very little is known about the evolutionary relat ionships of the tribe at any level. Phylogenetic studies completed using either morphological or molecular data (Jacobson & Weller 2002; Zahiri et al. 2012) have recovered Lithosiini

PAGE 23

23 as one of three monophyletic tribes within the subfamily Arctiinae. Howev er, the taxon sampling of these studies was not dense enough to make statements about the evolutionary relationships among the genera. Bendib & Minet (1999) proposed the existence of seven subtribes within Lithosiini based on larval, pupal, and adult morph ological characters. However, less than a quarter of the genera of Lithosiini have been placed in a subtribe. The primary objective of this chapter was to construct a phylogeny of the tribe Lithosiini using adult morphological characters. The resulting phy logenies were used to examine the evolutionary relationships among genera belonging to each of the seven subtribes and genera that have not yet been placed in a subtribe. The specific questions addressed in this study were: 1) Is the tribe Lithosiini monop hyletic? 2) Do the subtribes proposed by Bendib & Minet (1999) represent monophyletic clades? 3) Can the unplaced genera included in this analysis be associated with any of the seven subtribes? 4) What type of phylogenetic signal is present within adult morphological characters? Chapter 3 To accurately study the evolution of behaviors and assess the monophyly of the subtribes, a resolved phylogeny of Lithosiini is needed. As noted in Chapter 2, no phylogenetic hypotheses have been proposed for the tribe. A phylogenetic study of Lithosiini was completed using adult morphological characters (Chapter 2; Scott & Branham In Press ). However, the phylogenies recovered through the analysis of these characters were almost entirely unresolved. In other superfamilies, families, and subfamilies of Lepidoptera, phylogenetic analyses conducted using molecular datasets have been able to resolve the higher level relationships that morpholog ical studies could not (Regier et al. 2012; Ugelvig et al. 2011; Wahlberg et al. 2003, 2005; Zahiri et

PAGE 24

24 al. 2011, 2012). The primary objective of this chapter was to construct a phylogenetic hypothesis of Lithosiini using a molecular dataset composed of four gene fragments. These gene fragments included two mitochondrial markers, cytochrome oxidase C subunit I (COI) and cytochrome oxidase B (CytB), and two nuclear markers, ribosomal protein S5 (RpS5) and the nuclear large subunit rRNA 28S D2 loop (28S). Each of these gene fragments has been shown to be phylogenetically informative at the higher level within Lepidoptera (Wahlberg et al. 2009; Mutanen et al. 2010; Zahiri et al. 2011, 2012) The following questions were addressed in this research: 1) Is the phyl ogenetic signal present within the molecular dataset strong enough to resolve the higher level relationships of Lithosiina? 2) Is the tribe Lithosiini monophyletic? 3) Are the subtribes Cisthenina, Lithosiina, Nudariina, and Acsalina monophyletic? 4) What effect does the selection criterion used to partition the dataset and select models of evolution have on the phylogeny that is recovered? Chapter 4 Phylogenetic hypotheses concerning the evolutionary relationships both among and within the genera of Lithos iini are lacking. Similar wing color patterns occur among some genera ( e.g. Lyclene Moore, Barsine Walker, and Adites Moore), which makes determining their generic limits difficult. In addition, other genera are known to represent nonmonophyletic groups ( e.g. Eilema Hbner). To date, only one phylogenetic study has been completed that assessed the systematics of a lithosiine genus (Jacobson 1995). However, authors (Durante 2008, 2009, 2012; Holloway 2002; Knowlton 1967) continue to publish revisionary work s not based on phylogenetic analysis. The issues presented above can be seen in the lithosiine genus Lycomorpha Harris. The adults are aposematically colored and form mimicry complexes with other Lithosiini, Arctiini, and

PAGE 25

25 Zygaenidae as well as lycid beetles. In addition, the adult wing color patterns led to this genus being mistakenly placed in several families. Lycomorpha was transferred to Lithosiini by Forbes (1960) who noted that the loss of an Sc vein was the only character that supported its placement in Euchromiidae. Jacobson & Weller (2002) confirmed this placement within the Lithosiini with their phylogenetic analysis of Arctiinae. Draudt (1917) noted similarities between the color pattern and body shape of Lycomorpha and the lithosiine genera Propyria Hampson and Ptychoglene Felder. In the morphological phylogeny of the tribe, species of Lycomorpha and Propyria were found within a single clade (Chapter 2; Scott & Branham In Press ). No phylogenetic studies have been completed that examine either the evolutionary relationships of the species of Lycomorpha or the generic limits of this genus. The primary objective of this study was to construct a phylogeny of the genus Lycomorpha using adult morphological characters. The phylogeny that was obtained was used to address the following questions: 1) Is Lycomorpha monophyletic? 2) What is the relationship between Lycomorpha and Propyria ? 3) What are the relationships among the species of Lycomorpha? Chapter 5 The phylogeny that was constructed for Lyco morpha using adult morphological characters found the genus to be paraphyletic with respect to Propyria (Chapter 4). Based on these findings, the two genera were synonymized. The older name, Lycomorpha, was given priority. The primary objective of this chapter was to produce a revision of the genus Lycomorpha. The goals of the revision were to produce a description and diagnosis of the genus Lycomorpha, as well as fourteen of the twenty species placed in it. As part of the revision, three new species were d escribed. The

PAGE 26

26 descriptions and diagnoses provide characters that can be used to place species within the genus and separate species with similar wing color patterns. Data on the distribution and biology of each species is provided in each species descripti on. Chapter 6 The objective of this chapter was to discuss the results that were obtained from the studies completed in Chapters 25. This chapter provided justification for the methods used in the phylogenetic analyses of the tribe. In addition, it offered directions that future research could pursue.

PAGE 27

27 CHAPTER 2 A PRELIMINARY PHYLOG ENY OF THE LICHEN MO TH TRIBE LITHOSIINI (LEPIDOPTERA: EREBID AE: ARCTIINAE) BASED ON MORPHOLOGICAL CHARACTERS Background Information Lepidopteran larvae have evolved a wide var iety of feeding habits, which include consuming the fungal symbiont of lichens (lichenivory). This feeding behavior has arisen several times within the ditrysian Lepidoptera (Rawlins 1984). The majority of the licheniverous lineages are composed of less than twodozen species, but the lichen moth tribe Lithosiini (Lepidoptera: Erebidae: Arctiinae) contains approximately 3,150 described species. Furthermore, the Lithosiini are the only lineage known to be capable of sequestering phenolics produced by the fungal symbiont of the lichen (Hesbacher et al. 1995; Wagner et al. 2008). Both the adults and larvae are thought to use the phenolics as def ensive compounds (Weller et al. 1999). The adults of both brightly colored, mimetic lineages ( e.g. Hypoprepia Hbner) and drably colored individuals ( e.g. Agylla Walker) have been found to be unpalatable to bats and birds (Acharya & Fenton 1992; Collins & Watson 1983; Sargent 1995). Although the tribe is well known for its larval feeding behavior, no work has been done to clarify the evolutionary relationships among the genera. Until a phylogeny is reconstructed, it will not be possible to study the evolution of lichenivory and other traits in the life history of these moths. The classification of the tribe Lithosiini has undergone several changes since its original description. Stephens (1829) described the lichen moths as the family Lithosiidae. Hampson (1900) reduced Lithosiidae to a subfamily of Arctiidae, Lithosiinae. However, some authors continued to recognize the family Lithosiidae (Hampson 1920 ; Kiriakoff 1951, 1963 ; Forbes 1960). Although Kiriakoff (1963) applied

PAGE 28

28 the name Lithosiidae, he noted that the tympanic structures of most lithosiine genera do not differ from the structures found in Arctiidae. For bes (1960) stated that Lithosiidae was probably no more than a subfamily of Arctiidae, and his use of Lithosiidae was to maintain consistency with his earlier publications. More recently, during the course of remedying the paraphyly that had been identified within Noctuidae (Jacobson & Weller 2002; Mitchell et al 1997, 2000; Weller et al. 1994), Lafontaine and Fibiger (2006) reduced the Arctiidae, Nolidae, Strepsimanidae, Lymantriidae, and Erebidae ( sensu Fibiger & Lafontaine 2005) to subfamilies of Noctui dae. As a result of this revision, Lithosiinae was reduced to the tribe Lithosiini. In the most recent phylogenetic analyses of the superfamily Noctuoidea (Zahiri et al. 2011, 2012), Erebidae was reassigned family status, and Arctiinae and Lithosiini are now treated as members of Erebidae. Although the classification of the lichen moths has undergone several transitions, very little is known about the evolutionary relationships of the tribe at any taxonomic level. Three separate phylogenetic studies (Jacobson & Weller 2002 ; Wink & von Nikisch Rosenegk 1997; Zahiri et al. 2012) have recovered Lithosiini as a monophyletic clade. Jacobson & Weller (2002) used morphological characters to assess the monophyly of the five tribes of Arctiinae. Lithosiini was recov ered as one of three monophyletic tribes, and eight synapomorphies were identified. All of these synapomorphies ari se from the larval morphology. Wink and von Nikisch Rosenegk (1997) amplified the 16S rRNA gene for taxa from Arctiinae (including 5 species of Lithosiini) and Nymphalidae to examine evolution of pyrrolizidine alkaloid and cardiac glycoside sequestration. Zahiri et al. (2012 ) used 8 genes (1 mitochondrial and 7 nuclear) to examine the evolutionary relationships within the family Erebidae. All of

PAGE 29

29 these analyses found the Lithosiini to be monophyletic; however, the taxon sampling was insufficient (7, 5, and 5 genera, respectively) to infer relationships among the genera. Although Lithosiini has been recovered as one of three monophyletic tribes of Arctiinae, there are two hypotheses about the evolutionary relationships among the tribes. Jacobson & Weller (2002) found that Lithosiini and Syntomiini were sister taxa. This relationship was supported by six synapomorphies (3 adult and 3 larval cha racters). The Lithosiini + Syntomiini clade was sister to Arctiini. However, Bendib & Minet (1998) hypothesized that the Syntomiini were sister to Arctiini based on the morphology of the female dorsal pheromone gland. Most recently, Zahiri et al. (2011, 2012) recovered Lithosiini as the sister taxa to a clade composed of Syntomiini and Arctiini. The only other phylogenetic analysis conducted specifically on Lithosiini examined the monophyly of the genus Agylla (Jacobson 1995). At the time of the study, Agyl la was composed of 138 species making it the fifth, largest genus within Lithosiini. However, the cladistic analysis of morphological characters suggested that the genus was paraphyletic. Although no phylogenetic studies have been completed that examine the evolutionary relationships among the genera of Lithosiini, several authors have proposed the existence of relationships among groups of genera (Table 2 1). Forbes (1939a) referred to generic groups but stated, the classification of the Lithosiinae is too uncertain to make discussion of value (1939a p. 169). Based on his study of the genitalia of lithosiine genera that occur in West Africa, Birket Smith (1965) proposed the existence of either a subtribe and two supergenera, or two subtribes, within Li thosiini. However, he noted that given the amount of variation present in the genitalia these

PAGE 30

30 should be considered interim groupings until the entire tribe Lithosiini had been studied. Franclemont (1983) also recognized Afridina as a subtribe of the Lithos iini. However, Kitchings and Rawlins (1998) have since treated this subtribe as a subfamily of Nolidae. Most recently, Bendib & Minet (1999) proposed the existence of seven subtribes (Figs 2 1 A V) within Lithosiini: Phryganopterygina, Acsalina, Lithosiina, Cisthenina, Nudariina, Endrosina, and Eudesmiina. They provided definitions for all of the subtribes except Lithosiina using larval, pupal, and adult morphological characters. Lithosiina was left to be treated in a later work. They noted that larval characters, such as the presence of a mandibular mola (a structure hypothesized to help the larvae grind the tougher fu ngal tissue of lichens (Gardner 1943)), are the most reliable for accurately placing taxa within Lithosiini. However, no analys e s were conducted to determine whether the morphological characters that were proposed to define the subtribes represent synapomorphies symplesiomorphies or are homoplasious. Holloway (2002) noted that two of the adult characters defined as autapomorphies of the subtr ibe Nudariina have evolved in parallel in other lithosiine subtribes. Also, Holloway (2002) was unable to place all Bornean Lithosiini within subtribes using the descriptions provided by Bendib & Minet (1999). Despite these complications, the classificatio n proposed by Bendib & Minet (1999) has been adopted in more recent publications (Ferguson & Opler 2006; Holloway 2002; Powell & Opler 2009; Schmidt & Opler 2008). Based on the work of Bendib & Minet (1999) and other authors who recognized generic groupings, 112 genera have been placed within subtribes. However, that leaves the majority of the estimated 457 genera of Lithosiini (Jacobson & Weller 2002) unplaced (Figs 2 1W Z)

PAGE 31

31 As noted by Bendib & Minet (1999) and demonstrated in Jacobson & Wellers (2002) phylogeny, larval morphological characters are the most consistent for placing species within the tribe Lithosiini. However, the larvae of many of the species that occur in the tropic s have not been found (Holloway 2002). Adult characters, such as the wing venation and absence of ocelli, have also been used to place species into Lithosiini. However, using the loss of ocelli to place species within Lithosiini led to aocellate phaegopterine genera ( Pygoctenucha Grote and Lerina Walker ) being mistakenly placed within the tribe. Furthermore, the use of wing venation caused the true lithosiine genus Lycomorpha Harris to be mispl aced within Euchromiini (Forbes 1960). In this paper, we report the first phylogenetic analysis of the tribe Lithosiini using morphological characters coded from adult specimens. Species representing each of the seven subtribes, as well as those not currently placed in a subtribe, are examined. The contribution of the adult morphological characters to the resolution of the evolutionary relationships within the tribe is assessed. In addition, the phylogeny is examined to study the evolutionary relationships within Lithosiini, and determine whether support existed for the subtribal relationships proposed by Bendib & Minet (1999). Materials and Methods Taxon Sampling Seventy six species representing each subtribe of Lithosiini, as well as genera that are not currently assigned to a subtribe were sampled (Table 2 2). When available, the type species of a genus was included in the analysis. Malefemale pairs were available for all but five species. Outgroup taxa from the subfamily Aganainae and the tribe Arctiini were included in the analysis. Aganainae has been recovered in the sister

PAGE 32

32 clade to the Arctiinae in several phylogenetic analyses (Kitching 1984; Zahiri et al. 2011, 2012). Furthermore, Zahiri et al. (2011, 2012 ) found the Lithosiini to be the most basal lineage of Arctiinae. Asota heliconia Linnaeus was included as the representative of this subfamily. Pagara simplex Walker the other outgroup taxon, is considered an aocellate phaegopterine (Bendib & Minet 1999) that has previously been treat ed as a lithosiine (Covell 1984; Forbes 1960; Franclemont ; 1983). The larvae of P. simplex lack a mandibular mola (Forbes 1960). The mandibular mola is a synapomorphy of the tribe, and presently it is this character that is used to definitively place species within the tribe. Ferguson and Opler (2006) transferred P. simplex to the tribe Arctiini. See Table 2 3 for the full species list and the locality data for dissected specimens. Morphology Dissections of the genitalia were prepared using standard methods (Winter 2000) after softening the abdomens in warm 10% potassium hydroxide aqueous solution for 30 to 90 minutes. Specimens were viewed in 20% ethanol, and the material was subsequently stored in glycerol. External morphological characters were coded from pinned, dried specimens. All characters were scored using a Nikon SMZ800 light microscope. Pencil drawings were made to illustrate characters and states using a camera lucida. The drawings were scanned and saved as PDFs. These files were imported into Adobe Illus trator CS5 and inked using the pen tool. The terminology for male and female genitalia follows Klots (1970) Kristensen (2003) and Forbes (1939b, 1954). Although Birket Smith (1965) proposed a new nomenclature for the genitalia of Lithosiini, homologous s tructures cannot be identified with confidence in subtribes other than Lithosiina. The terminology for the wing venation follows Kristensen ( 2003).

PAGE 33

33 Characters Examined Eighty two morphological characters (68 binary and 14 multistate; 183 states) were scor ed for all of the species sampled ( Appendix A ) Morphological characters are as follows: head (7 characters, 16 states), thorax (5 characters, 11 states), wings (12 characters, 25 states), abdomen (3 characters, 7 states), male abdomen and genitalia (38 characters, 85 states), and female abdomen and genitalia (17 characters, 39 states). Multistate characters were treated as unordered. When characters were linked, e.g the pre sence of the radial vein and all of the radial sector veins (Character 13) and the branching pattern of R1 and Rs1R s4 (Character 14), resulting inapplicable characters were coded as missing ? (Strong & Lipscomb 1999). Linking the characters allows the presence of the structure to contribute to the analysis and document variation in the structure without overly simplifying characters (Pogue & Mickevich 1990). Characters and their Phylogenetic Usefulness Here we pr esent the list of phylogenetic characters used in this study. We discuss the phylogenetic usefulness of each character. The individual character indices Consensus Index (CI) and Retention Index (RI) are included after each character. Linked characters are indicated by a *. Head 1. Male flagellomere shape. 0: Filiform, 1 : Pectinate. (CI = 0.05, RI = 0.43). 2. Male flagellomeres: sensilla chaeti ca. 0: Present, 1: Absent. (CI = 0.50, RI = 0.80). 3. Location of sensilla chaetica on male flagellomeres. ? : Does not apply, 0: Proximally, before the medial ridge of the flagellomere, 1: Distally, at or beyond the medial ridge of the flagellomere, 2: Apices of the rami. (CI = 0.18, RI = 0.10). 4. Female flagellomere shape. 0 : Filiform, 1 : Pectinate. (CI = 0.06, RI = 0.21).

PAGE 34

34 5. Female flagellomeres: sensilla chaetica. 0 : Present, 1: Absent. (CI = 0.50, RI = 0.80). 6. Location of sensilla chaetica on female flagellomeres. ?: Does not apply, 0: Proximally, before the medial ridge of the flagellomere, 1: Distally, at or beyond the medial ridge of the flagellomere, 2: Apices of the rami. (CI = 0.29, RI = 0). 7. Form of gena (when viewing the head in profile). 0: A continuous band around the base of the eye that joins the frons (Fig. 2 2 A ), 1 : Occurring posteriorly to the eye as a band but not continuous around the base of the eye to the frons (Fig. 2 2B ). (CI = 0.11, RI = 0.11). Summary of Head Characters: Although the indices for the head characters were mostly low, some of the characters were useful for defining small clades, and one character defined the tribe. The flagellomere shape varied between filiform and pectinate in both the males and females. Sensilla chaetica were present in most species of both sexes. Their loss defined the Euthyone + Bruceia clade and Eurylomia Lithosiini was defined by the placement of the sensilla chaetica distally in both males and females. Within the tribe, the occurrence of the chaetica at the tips of the rami arises independently several times. A gena that can be seen as a continuous band around the eye defined the Lycomorpha+ Propyria clade and the Ptychoglene clade. This state also arose independently in several unrelated species. Thorax 8. Tibial spur formula. 0: 0 2 2, 1 : 0 2 3, 2 : 0 2 4. (CI = 0.50, RI = 0.83). 9. Tarsal claw. 0: Simple, 1 : Bifid. (CI = 0.04, RI = 0.40). 10. Epiphysis. 0: Long, twothirds the length of the tibia or nearly the entire length of the tibia, 1: Short, approximately half the length of the tibia or less. (CI = 0.25, RI = 0.25). 11. Prothoracic tibia modified with elongate a pical projection. 0 : Present (Fig. 2 3A ), 1 : Absent (Fig. 2 3B ). (CI = 0.50, RI = 0.50). 12. Tymbal organ. 0 : Present, 1: Absent. (CI = 0.06, RI = 0.25).

PAGE 35

35 Summary of Thoracic Characters: Although thoracic characters have been found to be phylogenetically inform ative in higher level studies of Notodontidae (Miller 1991) and Arctiinae (Jacobson & Weller 2002), they contributed little information about the evolutionary relationships of Lithosiini. The tibial spur formula was useful in defining small clades. Most sp ecies examined had a formula of 02 4. A formula of 02 3 defined the Lycomorpha+ Propyria clade and Rhabdatomis A 0 2 2 formula was unique to the Euthyone+ Bruceia clade. A long epiphysis defined the Apistosia + Gnamptonychia+ Inopsis + Eurylomia clade. It was lost once in Eurylomia The long epiphysis also arose independently in Asura cervicalis and the outgroup taxon Pagara. The presence of an elongate apical projection on the protibia was unique to the Apistosia + Gnamptonychia+ Inopsis + Eurylomia clade. This state was reversed once in Apistosia The form of the tarsal claw and the presence of a tymbal organ were highly variable undergoing several losses and reversions. Wings 13. Forewing: R1 free to costal margin and does not anastomose with Sc. 0: Pr esent, 1 : Absent. (CI = 0.06, RI = 0.29). 14. Forewing: Radial vein and Radial Sector Veins 0 : R1, Rs1R s4 present, 1: R s4 lost. (CI = 0.33, RI = 0). 15. Forewing: radial vein branching pattern when R1, Rs1R s4 present. ?: Does not apply, 0: R1; R s1; (Rs2 (Rs3, R s4)), 1 : R1; R s1; ((R s2, Rs3) Rs4). (CI = 0.07, RI = 0.55). 16. Forewing: M1. 0 : Present, 1 : Absent. (CI = 0.33, RI = 0). 17. Forewing: M2. 0: Present 1: Absent. (CI = 0.50, RI = 0.80). 18. Forewing: M3. 0: Present 1: Absent. (CI = 1.00) 19. Hindwing: Sc+R1. 0: Present, 1: Absent. (CI = 0.17, RI = 0.55). 20. Hindwing: Rs and M1. 0: Separate 1: Stalked beyond distal margin of discal cell. (CI = 0.14, RI = 0.50).

PAGE 36

36 21. Hindwing: M2. 0: Present 1: Absent (CI = 0.06, RI = 0.50). 22. Hindwing: if present, M2 not fused with M3. ?: Does not apply, 0: Present 1: Absent. (CI = 0.11, RI = 0.11). 23. Hindwing: M3 and CuA1. 0: Separate f or entire distance to margin, 1: Stalked 2: Fused. (CI = 0.09, RI = 0.36). 24. Male Hindwing: Anal angle enlarg ed and folded. 0: Present ( Fig. 2 4A ), 1: A bsent ( Fig. 2 4B ) (CI = 0.20, RI = 0.20). Summary of Wing Characters: Although variation was present within the venation of the forewing, the characters coded from this region were only useful in defining small groups or species. The loss of the M2 vein w as unique to the largest clade of Lithosiina taxa, which contains the genera Lithosia Eilema Crambidia and Pelosia Within this clade, the state was reversed once in the species Lithosia quadra The loss of the M3 vein defined Crambidia Similarly, the variation present in the hindwing was only useful for defining species or small clades. The Sc+R1 vein was lost six times within the tribe. These losses corresponded to the species that compose the largest clade of Cisthenina recovered by the Bayesian Inference analysis. However, this relationship was not recovered in the Maximum Parsimony analysis. The M2 vein was lost 17 times in Lithosiini. The occurrence of a CuA1 and M3 vein that were fused and stalk beyond the distal margin of the discal cell aros e 19 times. Abdomen 25. Anterolateral process (ALP) on A2 sternite. 0: Present (Figs 2 5 B D ), 1 : Absent (Fig. 2 5A ) (CI = 0.33, RI = 0). 26. Location of the ALP. ?: Does not apply (Fig. 2 5A ) 0: Firmly fused to the rest of the A2 ( Figs 2 5C,D), 1: Emerging from the proximal end of apodeme ( Fig. 2 5B ) (CI = 0.11, RI = 0.47).

PAGE 37

37 27. Form of ALP i f it is fused to the rest of A2. ?: Does not apply (Figs 2 5A,B ) 0: Flattened, sclerotized lobe ( Fig. 2 5C ), 1: Sclerotized bar ( Fig. 2 5D ), 2: Sclerotized knob that is s horter than the length of the apodeme. (CI = 0.17, RI = 0.38). Summary of Abdominal Characters: Although variation was present in the a nterolateral process (ALP) on the second sternite, this variation was not phylogenetically informative. The ALP was lost in three unrelated genera ( Eilema Hypermaepha, and Hemipsilia ). An ALP that was located at the proximal end of the apodeme arose independently eight times within Lithosiini. Most species examined possessed a flattened, sclerotized lobe ALP. The sclerotized bar form of the ALP arose independently ten times in the tribe. Male a bdomen and g enitalia 28. Proximal margin of A8 sternite. 0: Extending dorsad to the edge of the A8 tergite (Fig. 2 7A ), 1 : Located entirely ventrad, with no portion extending onto the A8 pleurite or tergite. (Fig. 2 6A ), 2 : Extending onto the A8 pleurite but not beyond (Fig. 2 6B ), 3 : Fused with the proximal margin of the A8 tergite forming a continuous ring (Fig. 2 7B ) (CI = 0.10, RI = 0.38). 29. Tegumen occurring entirely dorsad not extendi ng ventrad of the meso dors al costal margins of the valvae. 0: Present (Fig. 2 8A ), 1: Absent ( Fig 2 8B ) (CI = 0.04, RI = 0.33). 30. Fusion/connection between the two halves of the tegumen. 0: Absent ( Fig 2 9A ), 1: Present ( Fig s 2 9B,C ) (CI = 0.25, RI = 0.25). 31. Fusion extends more than half the length of the halves of t he tegumen. ?: Does not apply (Fig. 2 9A ) 0: Present ( Fig 2 9B ), 1: Absent (Fig. 2 9C ). (CI = 0.05, RI = 0.31). 32. Sutures indicating fusion between the halves of tegumen. ?: Does not apply (Fig. 2 9A) 0: Present ( Fig 2 9C ), 1: Absent ( Fig 2 9B ) (CI = 0.10, RI = 0.10). 33. Pleural Sclerites. 0: Present ( Fig s 2 10 B D ), 1: Absent ( Fig 2 10A ) (CI = 0.17, RI = 0.44). 34. Connection between the pleural sclerites and tegumen. ?: Does not apply (Fig. 2 10A ) 0: Membranous tissue ( Fig 2 10B ), 1: Thin, sclerotized bar ( Fig 2 10C ), 2: Fused ( Fig 2 10D ) (CI = 0.07, RI = 0.32).

PAGE 38

38 35. Connection between the pl eural sclerites and the vinculum. ?: Does not apply (Fig. 2 10A ) 0: Membranous tissue ( Fig 2 10D ), 1: Thin, sclerotized bar ( Figs 2 10B,C ) (CI = 0.25, RI = 0.50). 36. Scaphium. 0: Present 1: Absent. (CI = 0.04, RI = 0.32). 37. Scaphium form. ?: Does not apply 0: Sclerotized bar running t he length of the tuba analis 1: Sclerotized triangular plate, 2: Two sclerotized bars forming a v shape, 3: R ectangular sclerotized plate. (CI = 0.75, RI = 0). 38. Subscaphium. 0: Present 1: Absent. (CI = 0.17, RI = 0.38). 39. Juxta occurring as a single, sclerotized plat e undivided by membranous tissue. 0: Present ( Fig 2 11A ), 1: Absent ( Fig 2 11B ) (CI = 0.33, RI = 0.60). 40. Sclerotized portion of juxta extends dorsad toward the tegumen (not occurring as a flat plate). 0: Present 1: Absent. (CI = 0.06, RI = 0.25). 41. Distal end of costal margin occurs as an identifiable structure. 0: Present (Figs 2 12A,C ) 1: Absent (Figs 2 12B,D and 214A ). (CI = 0.07, RI = 0.41). 42. Processus basalis of costa. 0: Present (Fig. 2 12C ) 1: Absent (Figs 2 12A,B,D and 214A,B ). (CI = 0.11, RI = 0.20). 43. Mesad elongations of the costa (Tendon of For bes 1939b). 0: Present (Figs 2 12B,D and 214A ) 1: Absent (Figs 2 1 2 A and 214B ). (CI = 0.05, RI = 0.10). 44. Editum. 0: Present (Figs 2 12C, 213A,C, and 2 14C ) 1: Absent (Figs 2 13B,D ). (CI = 0.04, RI = 0.15). 45. Location of the editum based on the dorsal margin of the valva. ?: Does not apply (Figs 2 13B,D ) 0: Proximally befo re the midpoint of the valva (Figs 2 12C and 213A ) 1: Distally, at or bey ond the midpoint of the valva (Figs 2 13C and 214C ). (CI = 0.08, RI = 0.48). 46. Digitus emerging f rom the distal end of the costa. 0: Present (Figs 2 13 B D ) 1: Absent (Figs 2 13A and 214C,D ). (CI = 0.08, RI = 0.37). 47. Valv ulla occurring as fleshy tissue. 0: Present (Figs 2 12A,B,D, 2 13C, and 214A,B ), 1: Abse nt (Fig. 2 12C ). (CI = 0.06, RI = 0.53). 48. Form of cucullus. 0: Cucullus fused to both the costal and saccular margins of valva, no distinct ends (Fig. 2 12C ) 1: Cucullus fused to costal margin but separated from saccular margin by valvulla (occurring as a separate fleshy lobe) (Fig. 2 14A ) 2: Cucullus and valvulla fused into a contiguous structure (Fig 2 12A,B,D, 2 13C, and 2 14B ). (CI = 0.12, RI = 0.52).

PAGE 39

39 49. Form of fusion between cucullus and valvulla when they for m a single contiguous structure. ?: Doe s not apply (Figs 2 12C and 214A ) 0: Cucullus forming slightly sclerotized dorsal margi n of fleshy lobe of valvulla (Fig. 2 12D ) 1: Sclerotized cucullus present on interior surface of valva while fleshy valvull a forms the external surface (Figs 2 12A and 2 13C ) 2: Cucullus and valvulla form a fleshy lobe with no markings to distinguish either structure (Fig. 2 14B ) 3: Cucullus heavily sclerotized dorsal portion of lobe and valvulla for ms the fleshy ventral margin (Fig. 2 12B ). (CI = 0.30, RI = 0.42). 50. Corona of the cucullus. 0: Present (Figs 2 12A and 213C,D ) 1: Absent (Figs 2 13A,B and 214C,D ). (CI = 0.05, RI = 0.21). 51. Form of corona. ?: Does not apply ( Figs 2 13A,B and 214C,D ) 0: Spines (Figs 2 12A and 213C ) 1: Setae (Fig. 2 13D ). (CI = 0.33, RI = 0.50). 52. Spacing of the spines/setae that form the corona. ?: Does not apply ( Figs 2 13A,B and 214C,D ) 0: Dense, bases of sepa rate spines/setae in contact (Fig. 2 13C ) 1: Not dense, bases of separate spines/setae not in contact (Fig. 2 13D ). (CI = 0.13, RI = 0). 53. Inner face of the valvae: anellifer a extending more than 2/3 the length of the valvae. 0: Present (Figs 2 13A and 214C ), 1: Absent (Figs 2 13 B D and 214D ). (CI = 0.05, RI = 0.46). 54. Inner face of valvae: clasper. 0: Present (Figs 2 13C an d 214C ) 1: Absent (Figs 2 13A,B,D and 214D ). (CI = 0.13, RI = 0.53). 55. Inner face of the valvae: form of clasper. ?: Does not apply (Figs 2 13A,B,D and 2 14D ) 0: Well developed (Fig. 2 13C ) 1: Reduced (Fig. 214C) (CI = 0.25, RI = 0.50). 56. Dorsal margin of the sacculus not extending onto the int ernal face of the valva. 0: Present (Figs 2 13A,B ) 1: Absent (Figs 2 13C,D and 214C,D ). (CI = 0.04, RI = 0.19). 57. Process of the sacculus. 0: Present (Figs 2 12D 2 13B,D, and 214A,B,D ) 1: Absent (Figs 2 12A,C 2 13A, and 214C ). (CI = 0.06, RI = 0.50). 58. Location where the saccular process arises on the ventral margin of the valva. ?: Does not apply (Figs 2 12A,C, 2 13A, and 214C ) 0: Proximal half of the valva (Fig. 2 14D ) 1: At or beyond the midpoint of th e valva (Figs 2 12D 2 13B,D and 2 14A ). (CI = 0.20, RI = 0.33). 59. Saccular process extending to the distal apex of the valva. ?: Does not apply (Figs 2 12A,C, 2 13A, and 214C ) 0: Present (Figs 2 12D and 213B ) 1: Absent (Figs 2 13D and 214 A,B,D ). (CI = 0.13, RI = 0.36).

PAGE 40

40 60. Sac cular process tapering to a point. ?: Does not apply (Figs 2 12A,C, 2 13A, and 214C ) 0: Present (Figs 2 12D 2 13B 2 14A ) 1: Absent (Figs 2 13D and 214B,D ). (CI = 0.08, RI = 0.08). 61. Basiphallus (caecum) form. 0: Well developed, ductus ejaculatorious simplex ( DES ) located entirely dorsad of the caecum (Fig. 2 15A ) 1: Reduced, DES emerging from the anterior dorsal end of caecum (Fig. 2 15B ) 2: Absent, DES emerges from the anterior end of the phallus (Fig. 2 15C ). (CI = 0.10, RI = 0.40). 62. Ruggose patches on vesica. 0: Present 1: Absent. (CI = 0.05, RI = 0.39). 63. Sclerotized bar/pl ate on vesica. 0: Present 1: Absent. (CI = 0.08, RI = 0.29). 64. Ve sica ornamented with cornuti. 0: Present 1: Absent. (CI = 0.05, RI = 0.1 8). 65. Number of cornuti present. ?: Does not apply 0: A single cornutus present 1: Mo re than one cornutus present. (CI = 0.10, RI = 0.44). Summary of Male Characters: The male genitalia accounted for 38 of the 82 characters examined. Although the charact er indices within this suite of characters were generally low, these characters illustrated the variation across genera. The only character coded from the abdomen referenced the form of the proximal margin of the eighth sternite. The tribe was defined by a proximal margin that extended onto the pleurites but not beyond onto the tergite. All of the other states also occur within the tribe. In addition, the character varied within some genera ( e.g. Eilema ). Although none of the species examined possessed cor emata (inflatable androconial structures occurring between the seventh and eighth sternites Ferguson (1985)), pockets of androconial scales were present on the abdominal segments of some males ( e.g. Clemensia ). However, these structures were so varied that homologous states could not be identified. Although these characters were not coded for this analysis, they could be informative in revisions of genera. The male genital capsule of the Lithosiini was highly variable. The valves and tegumen were greatly modified across genera. In addition, the males of many genera

PAGE 41

41 possess pleural sclerites that joined the tegumen and the vinculum. The pleural sclerite was thought to be lost in the subfamily Arctiinae (S. Weller pers. comm.). In some of the species examined, the pleural sclerite was found fused to the posterior margin of the tegumen ( e.g. Lithosia quadra). The two halves of the tegumen were fused for some or all of their length in the majority of the species examined. In the species where fusion was present, the tegumen could occur as a sclerotized plate that is entirely separate from the vinculum ( e.g. Lycomorpha). In addition, some species possessed sutures that could be used to identify the two halves of the tegumen. Although the presence of fusion was the most common state, the two halves of the tegumen were entirely separate in some species of Lithosiini. The valves of Lithosiini varied from having an external face that was completely sclerotized to one that had fleshy lobes present. The genera currently placed in Acsalina, Cisthenina, and Eudesmiina possessed the former state. The latter state was found in the remaining subtribes. In the taxa with a sclerotized external face of the valve, it was not possible to identify the margins of the costa and the sacculus. However, some species possessed a break in the sclerotization on the costal margin that could be used to identify the distal end of the costa. On the inner face of the valve, structures such as an editum, clasper, and corona of the cucullus were present in some species. The phallus of Lithosiini was highly variable. Most species had a well developed caecum on the basiphallus. The vesica was often ornamented with ruggose patches,

PAGE 42

42 sclerotized bars/plates, or cornuti. How ever, ornamentation was completely absent in some species ( e.g. Lycomorpha splendens Barnes & McDunnough). Female a bdomen and g enitalia 66. Segment A7 heavily sclerotized unlike preceding segments. 0: Present (Figs 2 16 A D and 217 A D ) 1 : Absent (Fig. 2 1 8A,B ) (CI = 0.04, RI = 0.12). 67. For m of heavy sclerotization of A7. ?: Does not apply (Fig. 2 18A,B ) 0: Cont inuous around entire segment (Figs 2 16A,B ) 1: Membranous break occurring on sternite (Figs 2 16C,D ) 2: Membranou s break occurring on tergite (F igs 2 17A,B ) 3: Membranous breaks occurring on pleurites (Figs 2 17C,D ). (CI = 0.12, RI = 0.21). 68. A8 tergite does not extend beyond the distal margin of A7 tergite. 0: Present ( 2 17B ) 1: Absent (Figs 2 16B,D, 2 17D, and 218B ). (CI = 0.07, RI = 0.13). 69. L ocation of the ostium bursa. 0: A7 sternite (Fig. 2 19A ) 1: Intersegmental membrane between A7 and A8 (Figs 2 19B,C ) 2: A8 sternite (Fig. 2 19D ). (CI = 0.20, RI = 0.11). 70. Form of the distal margin of the A7 sternite when ostium bursa occurs is located in the A 7 to A8 intersegmental membrane. ?: Does not apply (Figs 2 19A,D ) 0: Nearly h o rizontal with no distinct indentations (Fig. 2 19B ) 1: With a distinct, concave indentation (Fig. 2 19C ). (CI = 0.05, RI = 0.26). 71. Anterior apophyses. 0: Short, less than or eq ual to length of A8 pleurite, 1: Long, greater than length of A8 pleurite. (CI = 0.05, RI = 0.32). 72. P osterior apophyses. 0: Short, less than or equal to t he length of the A8 pleurite, 1: Long, greater than t he length of the A8 pleurite. (CI = 0.04, R I = 0.13). 73. Dorsal pheromone glands within the A8A9 intersegmental membrane. 0: Present 1: Absent. (CI = 1.00, RI = 1.00). 74. Sclerotization of ductus bursa. 0: Present (Figs 2 20A,B ) 1: Absent (Fig. 2 20C ). (CI = 0.05, RI = 0.05). 75. Sclerotization of duc tus bursa loc ated proximally to ostium bursa. ?: Does not apply (Fig. 2 20C ) 0: Present (Fig. 2 20A ), 1: Absent (Fig. 2 20B ). (CI = 0.13, RI = 0.36). 76. Length of ductus bursa. 0: Short, less than or equal to the length of A7 tergite, 1: Long, greater t han t he length of A7 tergite. (CI = 0.06, RI = 0.29). 77. Signa on the corpus bursa. 0: Present 1: Absent. (CI = 0.17, RI = 0.17).

PAGE 43

43 78. Signa number. ?: Does not apply 0: One, 1: Two 2: More than two, 3: Many single signa covering large portions of the interior o f the corpus bursa. (CI = 0.13, RI = 0.38). 79. When more than one signum occur, all have the same form. ?: Does not apply 0: Present 1: Absent. (CI = 0.14, RI = 0.14). 80. Signa extends from the cor pus bursa into the ductus bursa. ?: Does not apply 0: Pres ent 1: Absent. (CI = 0.13, RI = 0.42). 81. Appendix bursa. 0: Present 1: Absent. (CI = 0.05, RI = 0.30). 82. Location of appendix bursa. ?: Does not apply 0: Corpus bursa, 1: Ductus bursa. (CI = 0.10, RI = 0.40). Summary of Female Abd omen and Genitalia Characters: Eighteen characters were coded from the female genitalia. Similar to the male genitalia, these characters helped to illustrate the variation among the genera. The seventh abdominal segment of some species was found to be more heavily scleroti zed than the preceding segments. When the sclerotization was present, it could extend around the segment unbroken or possess membranous regions on the sternite, tergite, or pleurites. The ostium bursa was located in the seventh sternite, the intersegmental membrane between the seventh and eighth sternite, and the eighth sternite. When the ostium bursa occurred in the intersegmental membrane of species with a heavily sclerotized seventh segment, a deep indentation in the posterior margin of the seventh stern ite where the ostium bursa occurred was sometimes found ( e.g. Lycomorpha grotei (Packard)). Sclerotization of the ductus bursa was present in most species. The presence of signa on the corpus bursa defined Lithosiini. Within the tribe, signa were lost in f ive species. The number of signa present varied. It was possible to count the separate signa in some species ( e.g. two signa, L. grotei ). However, some species

PAGE 44

44 possessed many single signa that formed a large patch covered a broad area of the corpus bursa ( e.g. Stigmatophora). This condition was coded as a separate state from the species that possessed three or more separate signa. Phylogenetic Analysis Phylogenetic trees were constructed using both parsimony and Bayesian analyses. The Maximum Parsimony (MP ) analysis was performed in Paup* 4.0b 10 (Swofford 2003). A heuristic search of 1000 random taxa additions using the tree bisection reconnection (TBR) algorithm was performed to identify the most parsimonious cladogram topology Nodal support for the stri ct consensus of the MP trees was evaluated using Bremer support indices (BS: Bremer 1988, 1994). Bremer support indices were calculated in Paup* using a command file produced with TreeRot.v3 (Sorenson & Franzosa 2007) that searched for trees inconsistent w ith the constraint statement given for each node of the strict consensus tree. When discussing our results, we define support values as giving weak (BS 12), moderate (BS 35), good (BS 6 11) support (Wahlberg & Nylin 2003; Wahlberg et a l. 2003, 2005). The Bayesian Inference (BI) analysis was conducted using MrBayes 3.1.2 (Ronquist & model (Lewis 2001) was used to analyze the morphological dataset, which had been input as standard. The parameter was included in the model because Lewis (2001) considers it to be the most appropriate way to allow for rate heterogeneity in morphological character evolution. The Bayesian analyses were performed with four chains, one cold and three hot, using the default temperatur e settings. Five simultaneous, independent runs of 20,000,000 generations were conducted. The Markov chain Monte Carlo (MCMC) chains were started at random trees. Samples were drawn from the cold chain every 1,000 generations. Five

PAGE 45

45 million generations were discarded as burnin. The probabilities of the five runs were summarized, and the potential scale reduction factor (PSRF: Gelman & Rubin 1992) was calculated to confirm that the runs had converged. The PSRF value should approach 1 as the independent runs converge. The trees from the Bayesian analysis were summarized as a majority rule consensus tree. Posterior probability (PP) provided th e clade credibility values for the tree. The consensus trees from both types of analysis were visualized using FigTree v1.3.1 (Rambaut 2010). Results Analyses were based on 82 adult morphological characters sampled for 78 species. The Maximum Parsimony (MP ) analysis resulted in 4408 MP trees with a length (L) of 736, consistency index ( CI ) of 0.10, and a retention index ( RI ) of 0.34. The Bayesian Inference (BI) analysis produced a phylogram with a mean tree length (TL) of 16.36 with a variance of 1.08. Both analyses were rooted on the subfamily Aganainae ( Asota heliconia). Although all of the lithosiine species were found in a single lineage in the optimal cladogram from the parsimony analysis there was no nodal support for this clade. Although the MP analy sis was not able to recover the tribe as monophyleteic, the Bayesian analysi s ) N either of the analyses was able to entirely resolve the evolutionary relationships among the genera of the tribe. The strict consensus of the MP trees produced a cladogram with no resolution of the deeper nodes ( Fig. 2 21). The majority of the clades that were found on this tree received only moderate Bremer support. The low level of resolution in the MP cladogram as well as the low nodal support may be due to high levels of homoplasy present in the morphologic al characters ( Appendix B ). Although 81 of the characters were parsimony informative, most had very low CI and RI values. The BI phylogram ( Fig. 2 22) had a somewhat more resolved

PAGE 46

46 topology than the MP cladogram and several of the nodes received strong posterior probability support values. Despite the low level of resolution present in each cladogram, both analyses recovered identical relationships among certain genera and species. Although the two cladogram s contain similarities, novel evolutionary relationships were also recovered by both phylogenetic methods. Our analyses found genera representing the subtribe Cisthenina present in seven separate clades. Cisthenina is currently composed of 45 genera that are found in both the Old and New World. However, there were several of the species representing the subtribe Cisthenina whose evolutionary relationships are entirely unresolved. The largest of the Cisthenina clades was comprised of the brightly colored, N ew World genera Lycomorpha and Propyria Both genera are apparent mimics of other arctiines, zygaenids, and lycid beetles. the genus Dolichesia Hypermaepha Hampson, Lycomorphodes Hampson, and Talara Walker. Strong support (PP = 1, BS = 3) was found for a clade containing the Neotropic genus Euthyone Watson and the genera Bruceia Neumoegen and Haematomis Schaus. Bruceia was for a sister relationship between Bruceis pulverina Neumoegen and Haematomis mexicana (Druce). Metalobosia Hampson and Odozana Walker were also recovered as monophyly of genera with the exception of Ptychoglene Felder. A sister relationship was found between Pt. erythrophora F elder and Pt. sanguineola (Boisduval) (PP = 1, BS =

PAGE 47

47 4). However, the placement of the remaining species Pt. coccinea (Edwards) was unresolved. In addition, Clemensia Packard was recovered as a monophyletic lineage here was also weak support (BS = 1) for a sister relationship between Clemensia and a clade formed of the only Old World Cisthenina present in the analysis, Aemene Walker, and the unplaced Old World genus Heliosia Hampson (BS = 2). A sister relationship between the Cisthenina genus Rhabdatomis Dyar, which was strongly supported (PP = 1, BS = 3) as monophyletic, and the unplaced genus Epeiromulona The genera representing Lithosiina, a subtribe composed of 38 genera that are both Old and New World in distribution, were found in three clades. The genera Lithosia Fabricius, Eilema Hbner, Crambidia Packard, and Pelosia Hbner formed a clade with ong found for a sister relationship between this clade and the genus Cybosia Hbner. The remaining two Lithosiina clades also contained genera that have not received subtrib al the Lithosiina genera Apistosia Hbner, Gnamptonychia Hampson, and Inopsis Felder and the unplaced genus Eurylomia Felder. The brightly colored, large adults of each of these genera are mostly Neotropical in distribution. Within this clade, Gnamptonychia and Inopsis with Apistosia Finally, the unplaced species Ardonea moria (Walker) was moderately Gardinia Kirby.

PAGE 48

48 There was little resolution of the evolutionary relationships among the genera representing the two subtribes, Endrosina and Nudariina, composed entirely of Old World genera. The relationships tha t were recovered for the genera representing each of these subtribes were almost entirely unique between the two analyses. Endrosina is composed of two genera that are Palearctic and Oriental in distribution. Both analyses recovered the sister relationship between the two species of Setina BS = 3). However, no relationship was found between this clade and the other endrosine genus Stigmatophora Staudinger. The relationships recovered between the genera representing Nudariina (21 genera) were entirely different between our two analyses. The MP cladogram recovered a weakly supported clade (BS = 1) containing Miltochrista Hbner, Hemipsilia Hampson and Asura Walker. Within the clade, Miltochrista was found to be paraphyletic, and Asura was p olyphyletic. The BI phylogram Paidia Hbner and Cyana Walker. The entirely New World subtribe Eudesmiina is presently composed of four genera. With the exception of Euryptidia ira (Druce), the species representing = 1). Within this clade, the genus Eudesmia Hbner was found to be paraphyletic as presently defined. The species of Josioides Felder and Eudesmia were recovered as a The two monogeneric subtribes, Acsalina and Phryganopterygina, were represented in our analyses by a single species each. Their position in both the MP cladogram and BI phylogr am was entirely unresolved. The evolutionary relationships of

PAGE 49

49 the species representing the genera that have not been placed within a subtribe were mostly unresolved. However, some of these genera ( e.g. Eurylomia and Heliosia ) and the species Ardonea moria were found in clades composed of genera representing one of the subtribes. Discussion This is the first phylogenetic study conducted on the tribe Lithosiini using morphological data and broad taxon sampling. Previously, the use of adult morphological char acters to place species within the tribe has proved problematic. The use of these characters has included true genera of Arctiini but resulted in the exclusion of Lithosiini genera. Our analyses indicated that the adult morphological characters did not provide a strong enough phylogenetic sign al to resolve the older, higher level relationships within the tribe. In addition, these characters were only able to recover Lithosiini as monophyletic in the BI analysis It is possible that the inclusion of characters coded from the endoskeleton sensu Snodgrass ( 1993) of the adults may help to resolve the deeper nodes. These endoskeleton characters have been found to be informative at the tribal level within Arctiinae (Jacobson & Weller 2002; DaCosta & Weller 2005). With the low level of deeper node resolution present in our results, it was not possible to assess the monophyly of any of the subtribes proposed by Bendib & Minet (1999). The genera representing each of the subtribes were either found in small clades or t heir placement was unresolved. However, the clades that included individuals from multiple genera contained only genera from a single subtribe or those genera that have not yet been placed in a subtribe.

PAGE 50

50 The results found genera of the largest subtribe Ci sthenina in several clades. Four of these clades contained representatives of multiple genera. The largest clade Dolichesia the Lycomorpha and Propyria clade, and a Lycomorphodes Talara, and H ypermaepha clade. DNA barcoding has also recovered a close relationship among Lycomorpha, Lycomorphodes and Talara (C. Schmidt pers. comm.). Within the Lycomorpha and Propyria clade, our results from the Bayesian analysis suggested that the two genera wer e synonymous. The adults of these two genera share similar color patterns, and Propyria schausi (Dyar) was originally described as a species of Lycomorpha. This was not the only example of paraphyly that the results found within a Cisthenina genus. Bruceia was found to be paraphyletic with respect to Haematomis mexicana The ranges of Bruceia and H. mexicana overlap within the southwestern United States. However, H. mexicana is not the type species of the Haematomis Until the type species of Haematomis can be included in an analysis of these genera, it will be unclear whether they are synonyms or H. mexicana is misplaced. The only Old World Cisthenina included in the analysis, Aemene altaica (Lederer), was found to be sister to the unplaced Old World Helios ia Furthermore, this clade was recovered as sister to the New World Clemensia Forbes (1939a) considered Clemensia to be related to the Old World Nudaria generic group. Forbes later (1960) hypothesized that the genus was closely related to genera, such as Siccia Walker, found within East Asia. Siccia is presently placed within Cisthenina, and Bendib & Minet (1999) considered Aemene to be a synonym of Siccia However, Holloway (2002) has resurrected Aemene as a separate genus.

PAGE 51

51 Genera representing the second largest subtribe, Lithosiina, were found in three clades. The type genus of the subtribe, Lithosia was found in a strongly supported (PP Eilema Crambidia and Pelosia Forbes (1960) noted that the New World genus Crambidia and the New World Eilema bicolor (Grote) were closely related to Lithosia The relationships within this clade were not resolved among the genera or among the species representing each genus. However, as noted by Birket Smith (1965) and Holloway (2002) the genus Eilema as presently defined, does not comprise a natural group. The results recovered entirely different relationships among the genera of Nudariina, the third largest subtribe, depending on the type of analysis that was conducted. Th e results from the MP analysis recovered a weakly supported (BS = 1) clade containing the genera Miltochrista Hemipsilia and Asura Within this clade, Miltochrista was recovered as paraphyletic, and Asura was found to be polyphyletic. Both of these gener a, as currently defined, are very large and possess similar color patterns, which are also found in other Old World lithosiine genera ( e.g. Lyclene Moore, Barsine Walker, and Adites Moore). Bendib & Minet (1999) specifically stated that the genus Asura was not monophyletic. Holloway (2002) noted that the present definition of this genus overlaps with a previous definition of Miltochrista (Hampson). The Bayesian Cyana and Paid ia Bendib & Minet (1999) noted a close relationship between these two genera based on two wing characters (CuA1 and M3 stalked or coincident and a projecting lobe near the base of R2 on the male forewing) and one larval character (fusion of D and SD2 into a single verruca).

PAGE 52

52 Our results recovered very little information on the relationships within the smaller and monogener ic subtribes with the exception of Eudesmiina. All of the species representing Eudesmiina except Euryptidia ira were found within a single clade. Within the clade, the genus Eudesmia was paraphyletic. Furthermore, the relationships between Eudesmia and Josioides suggested that the two genera may be synonymous. This was not unexpected. The adults of the genera that are placed within Eudesmiina are brightly colored with similar patterns. Bendib & Minet (1999) considered an autapomorphy of the subtribe to be t he contrasting black/brown and orange/yellow areas present on the wings of Eudesmiina species. However as noted by Powell & Opler (2009), these color patterns create difficulty in separating species. Within the subtribe Endrosina, the genus Setina was found to be monophyletic. However, no relationship recovered between it and the other endrosine genus Stigmatophora. No relationships were observed for either monogeneric subtribe, Acsalina or Phryganopterygina. We found support for relationships between some of the genera that have not been placed in subtribes and clades of genera from Cisthenina and Lithosiina. In each instance, the unplaced genus was found to be related to a genus or genera that are distributed in the same area of the world. However, the evolutionary relationships of most of the unplaced genera were not recovered. Holloway (2002) noted that he was not able to place all of the genera of Lithosiini that are found in Borneo into the subtribes proposed by Bendib & Minet (1999). Our study found th at the adult external morphology does not provide a phylogenetic signal of sufficient strength to resolve the higher level relationships within

PAGE 53

53 Lithosiini. This result was not unexpected given that all the synapomorphies previously identified for the tribe arise within the larval morphology, and the use of adult morphological characters to assign species to Lithosiini has previously resulted in several misplacements. The use of other external morphological characters and internal characters that can only be examined through whole body dissections may help to clarify the evolutionary relationships. The inclusion of larval characters could also provide informative phylogenetic signals. Unfortunately, the larvae of most tropical lithosiine s have not been found (Holloway 2002). It may also be necessary to use molecular data to resolve the relationships. However, although it was not possible to assess the monophyly of the subtribes proposed by Bendib & Minet (1999), the relationships that were recovered by the analyses do provide support for the subtribes and the evolutionary hypotheses of other authors.

PAGE 54

54 Table 2 1. Compara tive table of generic groups of Lithosiini, including the location of the taxa the author was studying. Brner 1920, 1932 Forbes 1939a Kiriakoff 1951 Germany Panama World ARCTIIDAE Lithosiinae Lithosiini Nudariini ARCTIIDAE Lithosiinae Lithosia group Hypoprepia group LITHOSIIDAE Endrosiinae LITHOSIIDAE Lithosiinae Nudariinae Endrosiinae Birket Smith 1965 Franclemont 1983 Bendib and Minet 1999 West Africa North America World ARCTIIDAE Lithosiinae Lithosiini (spelt Lithosini) Lithosiina (spelt Lithosinia) Eilemina (spelt Eileminia) ARCTIIDAE Lithosiinae Lithosiini Acsalini Afridini ARCTIIDAE Lithosiinae Lithosiini Acsalini Cisthenini Nudariini Eudesmiini Endrosini Phryganopterygini

PAGE 55

5 5 Table 22. Ingroup taxon sampling including the total number of genera placed in each subtribe Subtribe Genera Species Total # # Examined # Examined Acsalina 1 1 1 Cisthenina 45 21 37 Endrosina 2 2 3 Eudesmiina 4 3 7 Lithosiina 38 9 12 Nudariina 21 5 7 Phryganopterygina 1 1 1 Unplaced 345 7 8 457 49 76

PAGE 56

56 Table 23. Species examined in the phylogenetic analysis including subtribe, locality, and collection that provided the material Taxa (Genus species Author) Sex Collection Locality EREBIDAE Arctiinae Lithosiini Acsalina Acsala anomala Benjamin Male Female CUIC CNC Yukon Territory Yukon Territory Cisthenina Aemene altaica (Lederer) Male Female CUIC CUIC Tateshima, Japan Tateshima, Japan Barsinella mirabilis Butler Male CUIC Moengo, Suriname Bruceia hubbardi Dyar Male Female FLMNH FLMNH Cochise Co., AZ, USA Cochise Co., AZ, USA Br. pulverina Neumoegen Male Female CUIC CUIC Coconino Co., AZ, USA Coconino Co., AZ, USA Cisthene plumbea Stretch Male Female FLMNH FLMNH Liberty Co., FL, USA Alachua Co., FL, USA Ci. subjecta Walker Male Female FLMNH FLMNH Alachua Co., FL, USA Ocean City, FL, USA Clemensia albata Packard Male Female FLMNH FLMNH Oldham Co., KY, USA Oldham Co., KY, USA Cl. leopardina Schaus Male Female CUIC CUIC Chapare, Bolivia Chapare, Bolivia Dolichesia falsimonia Schaus Male Female MCZ MCZ Barro Colorado, Panama Barro Colorado, Panama Euthyone simplex (Walker) Male Female CUIC CUIC Barro Colorado, Panama Barro Colorado, Panama Eu. grisescens (Schaus) Male Female MCZ MCZ Barro Colorado, Panama Barro Colorado, Panama Gaudeator paidicus Dyar Male Female CUIC CUIC Barro Colorado, Panama Barro Colorado, Panama Haematomis mexicana (Druce) Male Female CUIC CUIC Santa Cruz Co., AZ, USA Cochise Co., AZ, USA Hypermaepha maroniensis Schaus Male Female CUIC CUIC Moengo, Suriname Moengo, Suriname Hypoprepia cadaverosa Streck Male Female FLMNH FLMNH Torrance Co., NM, USA Jeff Davis Co., TX, USA Hy. fucosa Hbner Male Female UofW FLMNH Collier Co., FL, USA Putnum Co., FL, USA Hy. inculta Edwards Male Female CUIC CUIC Cochise Co., AZ, USA Santa Cruz Co., AZ, USA Lycomorpha fulgens (Edwards) Male Female AMNH AMNH Socorro Co., NM, USA Pima Co., AZ, USA

PAGE 57

57 Table 23. Continued Taxa (Genus species Author) Sex Collection Locality Ly. fulgens nr. Male Female AMNH NHMLAC Catron Co., NM, USA Cochise Co., AZ, USA Ly. grotei (Packard) Male Female NHMLAC NHMLAC Garfield Co., CO, USA Los Angeles Co., CA, USA Ly. pholus (Drury) Male Female USNM CMNH Ottawa Co., Quebec, Canada Pendleton Co., WV, USA Ly. splendens Barnes & McDunnough Male Female USNM NHMLAC Washington Co., UT, USA Yavapai Co., AZ, USA Lycomorphodes correbioides Schaus Male Female CMNH CMNH Zamora, Ecuador Zamora, Ecuador Metalobosia elis (Druce) Male Female CUIC CUIC Nova Teutonia, Brazil Nova Teutonia, Brazil Nodozana jucunda Jones Male Female AMNH AMNH Arima Valley, Trinidad Arima Valley, Trinidad Odozana floccosa Druce Male Female CUIC CUIC Moengo, Suriname Moengo, Suriname Prepiella aurea (Butler) Male Female AMNH AMNH Rodnia, Brazil Rodnia, Brazil Pre. radicans Hampson Male Female CUIC CUIC Moengo, Suriname Moengo, Suriname Propyria morelosia Schaus Male Female USNM AMNH Zacualpan, Mexico Barranca, Mexico Pro. ptychoglene Hampson Male Female USNM USNM Jalapa, Mexico Coatepec, Mexico Ptychoglene coccinea (Edwards) Male Female USNM USNM Cochise Co., AZ, USA Cochise Co., AZ, USA Pt. erythrophora Felder Male Female USNM USNM Morelos, Mexico Cordoba, Mexico Pt. sanguineola (Boisduval) Male Female USNM USNM Jalapa, Mexico Veracruz, Mexico Rhabdatomis coroides (Schaus) Male Female MCZ MCZ Barro Colorado, Panama Barro Colorado, Panama Rh. pueblae (Draudt) Male Female AMNH AMNH Sacatepequez, Guatemala Solola, Guatemala Talara coccinea Butler Male Female CMNH CMNH Hyatanahan, Brazil Oyapok River, French Guiana Ta. megaspila Walker Male AMNH Amazonas, Venezuela

PAGE 58

58 Table 23. Continued Taxa (Genus species Author) Sex Collection Locality Endrosina Setina aurita (Esper) Male AMNH Saint Vran, France Se. irrorella (Linnaeus) Male Female AMNH YPM TL Viella, Spain Co. Clare, Ireland Stigmatophora flava (Bremer and Grey) Male Female AMNH AMNH Guizhou Prov., China Guizhou Prov., China Eudesmiina Eudesmia arida (Skinner) Male Female FLMNH FLMNH Jeff Davis Co., TX, USA Maricopa Co., AZ, USA Eu. praxis (Druce) Male Female AMNH AMNH Durango, Mexico Durango, Mexico Eu. ruficollis (Donovan) Male Female MCZ MCZ So Paulo, Brazil Aguas Blancas, Argentina Euryptidia ira (Druce) Male Female USNM USNM Tiacolula, Mexico Cuernavaca, Mexico Eu. univitta Hampson Male Female AMNH AMNH Pelotas, Brazil Pelotas, Brazil Josioides celena (Walker) Male Female AMNH AMNH Kamkusa, Guyana Shudihar River, Guyana Jo. myrrha (Cramer) Male Female CUIC CUIC Suapure, Venezuela Moengo, Suriname Lithosiina Apistosia judas Hbner Male Female CUIC CUIC Viosa, Brazil Barro Colorado, Panama Crambidia pallida Packard Male Female FLMNH FLMNH Alachua Co., FL, USA Alachua Co., FL, USA Cybosia mesomella (Linnaeus) Male Female YPM YPM Sussex, England Cheshire, England Eilema bicolor (Grote) Male FLMNH Grand Co., CO, USA Ei. bipuncta (Hbner) Male Female CUIC CUIC Harbel, Liberia Harbel, Liberia Ei. heimi de Toulgot Male Female AMNH AMNH Antsiranana, Madagascar Antsiranana, Madagascar Gardinia anoploa Hering Male Female AMNH AMNH Cochise Co., AZ, USA Pima Co., AZ, USA Gnamptonychia flavicollis (Druce) Male Female AMNH AMNH Les Puentes, Mexico Zacualpan, Mexico Inopsis modulata (Edwards) Male Female AMNH AMNH Jalapa, Mexico Jalapa, Mexico Lithosia quadra (Linnaeus) Male Female MCZ MCZ France

PAGE 59

59 Table 23. Continued Taxa (Genus species Author) Sex Collection Locality Li. sororcula (Hfnagel) Male Female AMNH AMNH Tyrol Med Pelosia muscerda (Hfnagel) Male Female MCZ MCZ Germany France Nudariina Asura cervicalis Walker Male Female AMNH AMNH NSW, Australia Victoria, Australia As. strigipennis (Herrich schffer) Male Female CUIC CUIC Kuraru, Taiwan Kuraru, Taiwan Hemipsilia coa vestis (Hampson) Male Female CUIC CUIC Bukai, Taiwan Arisan, Taiwan Cyana interrogationis (Poujade) Male Female CUIC CUIC Ha Giang Prov., Vietnam South China Miltochrista gratiosa (Guerin) Male Female CUIC CUIC Kuraru, Taiwan Kuraru, Taiwan Mi. flexuosa Leech Male Female AMNH AMNH Les, Spain Les, Spain Paidia murina (Hbner) Male AMNH Seva, Spain Phryganopterygina Phryganopteryx convergens de Toulgot Male Female AMNH AMNH Antsiranana, Madagascar Antsiranana, Madagascar Unplaced Ardonea morio Walker Male Female AMNH AMNH Jalapa, Mexico Vera Cruz, Mexico Ar. peculiaris (Druce) Male Female CUIC CUIC Chapare, Bolivia Moengo, Suriname Balbura intervenata Schaus Male Female AMNH AMNH Cocle, Panama Barro Colorado, Panama Epeiromulona icterinus Field Male Female AMNH AMNH Barro Colorado, Panama San Blas, Panama Eurylomia cordula (Boisduval) Male Female AMNH AMNH Jalapa, Mexico Jalapa, Mexico Heliosia jucunda (Walker) Male Female CUIC CUIC N. Qld, Australia N. Qld, Australia Oeonistis entella (Cramer) Male Female CUIC MCZ Papua New Guinea Australia Paramulona nephalistis (Hampson) Male Female AMNH AMNH Santiago, Cuba Santiago, Cuba Arctiini Pagara simplex Walker Male Female CUIC CUIC Manatee Co., FL, USA Manatee Co., FL, USA

PAGE 60

60 Table 23. Continued Taxa (Genus species Author) Sex Collection Locality Aganainae Asota heliconia Linnaeus Male Female UMD UMD Qld, Australia Qld, Australia Collections: AMNH (American Museum of Natural History), CMNH (Carnegie Museum of Natural History), CNC (Canadian National Collection), CUIC (Cornell University Insect Collection), FLMNH (Florida Museum of Natural History), MCZ (Museum of Comparative Zoology, Harvard), NHMLAC (Natural History Museum of LA County), USNM (United States Museum of Natural History), UofW (University of Wisconsin Oshkosh), UMD (University of Maryland, LepATOL Collection), YPM (Yale Peabody Museum)

PAGE 61

61 Figure 21. Sample of lithosiine species included in the study. Subtribe Acsalina: A) Acsala anomala and B) Acsala anomala Subtribe Cisthenina: C) Cisthene plumbea, D) Propyria ptychoglene E) Clemensia albata F) Ptychoglene erythrophora, G) Bruceia pulverina, H ) Gaudeator paidicus and I) Barsinella mirabellis Subtribe Endrosina: J) Setina aurita and K) Setina irrorella Subtribe Eudesmiina: L) Euryptidia univitta M) Eudesmia ruficollis and N) Josiodes myrrha. Subtribe Lithosiina: O) Eilema heimi P) Lithosia quadra Q) Gardinia anoploa, and R) Apistosia judas Subtribe Nudari i na: S) Paidia murina, T) Miltochrista gratiosa, and U) Asura cervicalis. Subtribe Phryganopterygina: V) Phryganopteryx convergens Unplaced Genera: W) Paramulona nephalistis X) Ardonea peculiaris Y) Balbura intervenata, and Z) Eurylomia cordula.

PAGE 62

62 Figure 22. Lateral view, head. A) Lycomorpha pholus ; G gena present as a continuous band that joins F frons. B) Bruceia hubbardi ; Ggena not present as a continuous band that joins F frons. The scale bar is equivalent to 1mm.

PAGE 63

63 Figure 23. Prothoracic leg. A) Eurylomia cordula; AP apical projection. B) Hypoprepia fucosa The scale bar is equivalent to 1mm.

PAGE 64

64 Figure 24. Male hindwing. A) Balbura intervenata ; AA anal angle enlarged and folded. B) Setina irrorella ; AA anal angle unmodified. The scale bar is equivalent to 1mm.

PAGE 65

65 Figure 25. A2 sternite. A) Eilema bipuncta; A apodeme, anterior lateral process (ALP) absent. B) Setina irrorella ; AAA ALP attached to apodeme, A apodeme. C) Ptychoglene erythrophora; ALP fused to A2, FSLflattened sclerotized lobe form of ALP, A apodeme. D) Lycomorpha pholus ; ALP fused to A2, SB sclerotized bar form of ALP, A apodeme. The scale bar is equivalent to 1mm.

PAGE 66

66 Figure 2 6. Proximal margin of male eighth sternite, Part A : A) Acsala anomala; VO8S ventrad only, P pleurite, 6S sixth sternite, 6T sixth tergite, 7S seventh sternite, 7T seventh tergite, 8S eight h sternite, 8T eighth tergite; B) Eudesmia ruficollis ; EP 8S extends onto pleurites, P pleurite, 6S sixth sternite, 6T sixth tergite, 7S seventh sternite, 7T seventh tergite, 8S eighth sternite, 8T eighth tergite. The scale bar is equivalent to 1mm.

PAGE 67

67 Figure 27. Proximal m argin of male eighth sternite, Part B : A) Lycomorpha pholus ; TE 8S up to 8T edge, P pleurite, 6S sixth sternite, 6T sixth tergite, 7S seventh sternite, 7T seventh tergite, 8S eight h sternite, 8T eighth tergite; B) Gardinia anoploa; FT 8S fused to 8T, P pleurite, 6S sixth sternite, 6T sixth tergite 7S seventh sternite, 7T seventh tergite, 8S eighth sternite, 8T eighth tergite. The scale bar is equivalent to 1mm.

PAGE 68

68 Figure 28. Tegumen location. A) Lycomorpha pholus ; TD tegumen dorsad, C costa, PSpleural sclerite, U uncus. B) Acsala anomala; TEV t egumen extending ventrad, C costa, U uncus. The scale bar is equivalent to 1mm.

PAGE 69

69 Figure 29. Tegumen fusion. A) Apistosia judas ; NF no fusion of tegumen halves. B) Clemensia albata; TF tegumen halves fused, FLfusion long, NS no sutures from fusion. C) Gardinia anoploa; TF tegumen halves fused, FS fusion short, S sutures indicating location of fusion. The scale bar is equivalent to 1mm.

PAGE 70

70 Figure 210. Pleural sclerites. A) Acsala anomala; NS no sclerites. B) Lycomorpha pholus ; PS pleural sclerites, MT membranous tissue, SB sclerotized bar. C) Lithosia quadra; PS pleural sclerites, FT fused to tegumen, MT membranous tissue D) Propyria morelosia; PS pleural sclerites, SB sclerotized bar The scale bar is equivalent to 1mm.

PAGE 71

71 Figure 211. Juxta. A) Li thosia quadra; juxta SP solid plate. B) Josiodes celena; juxta DM divided by membrane. The scale bar is equivalent to 1mm.

PAGE 72

72 Figure 212. External view, left valva. A) Inopsis modulata; distal margin of C costa occurring as an identifiable break, S sacculus, CV cucullus and valvulla fused into a contiguous structure, FV fleshy valvulla found on external surface of valva, SC spiny corona. B) Clemensia albata ; C costa and cucullus are a continuous structure, T tendon, S sacculus, CV cucullus and valvulla fused into a contiguous lobe, cucullus forming heavily sclerotized dorsal portion and valvulla forms fleshy ventral margin. C) Lycomorpha fulgens nr.; distal margin of C costa occurring as an identifiable break, PB processus basalis, PEproximal editum, S sacculus, CU cucullus fused to both C costa and S sacculus with no distinct ends. D) Lithosia quadra; C costa and cucullus are a continuous struc ture, T tendon, S sacculus, DSP distal saccular process extends to the distal apex of the valva and tapers to a point, CV cucullus and valvulla fused into a contiguous structure with cucullus forming slightly sclerotized dorsal margin of the fleshy lobe of the valvulla. The scale bar is equivalent to 1mm.

PAGE 73

73 Figure 213. Internal view, right valva. A) Lycomorpha fulgens nr.; LA long anellifer extends more than twothirds the length of valva, PE proximal editum, S sacculus does not extend onto internal face of valva, T tendon. B) Lithosia quadra; D digitus emerges from distal end of costa, SA short anellifer extends two thirds the length of valva or less, S sacculus, DSP distal saccular process extends to distal apex of the valva and tapers to a point, T tendon. C) Inopsis modulata; well developed CLclasper, sclerotized CU cucullus present on internal face of valva, D digitus emerges from distal end of costa, DE distal editum, DM dorsal margin of sacculus extends onto internal face of valva, SA short anellifer, dense SC spined corona. D) Eilema bipuncta ; not dense CS corona of seta, D digitus emerges from distal end of costa, DM dorsal margin of sacculus extends onto internal face of valva, SA short anellifer. The scale bar is equivalent to 1mm.

PAGE 74

74 Figure 21 4. External view, left valva (A,B) and Internal view, right valva (C,D). A) Miltochrista flexuosa; CUcucullus is fused to the C costa, T tendon, V valvulla a fleshy lobe that separates CU cucullus from S sacculus, DSP distal saccular process tapers to a point but does not extend to the distal apex of valva. B) Eilema bipuncta; CV cucullus and valvulla form a fleshy lobe, C costa, DSP distal saccular process does not extend to the distal apex of valva or taper to a point, S sacculus. C) Josiodes celena ; CL clasper reduced, DE distal editum, DM dorsal margin of sacculus extends onto internal face of valva, LA long anellifer, T tendon. D) Clemensia albata; CV cucullus and valvulla, DM dorsal margin of sacculus extends onto internal face of valva, PSPproximal saccular process does not extend to the distal apex of valva or taper to a point, SA short anellifer, T tendon. The scale bar is equivalent to 1mm.

PAGE 75

75 Figure 215. Lateral view, left side, phallus. A) Eilema bipuncta ; DCdeveloped caecum with DES ductus ejaculatorious simplex located dorsad of caecum, V vesica. B) Miltochrista flexuosa; RCreduced caecum with DES ductus ejaculatorious simplex emerging from the anterior dorsal end of caecum, C cornuti, V vesica. C) Lycomorpha fulgens nr.; CA caecum absent, DES ductus ejaculatorious simplex emerges from the anterior end of phallus, C cornuti, V vesica. The scale bar is equivalent to 1mm.

PAGE 76

76 Figure 216. Abdominal pelt (A,C) and female genital capsule (B,D) Part A A) L ycomorpha fulgens nr.; T tergum, S sternum; (B) Lycomorpha fulgens nr.; Seventh abdominal segment HS heavily sclerotized without breaks in the sclerotization, eighth tergite (8T) extends beyond the distal margin of seventh tergite. C) Josiodes celena; T te rgum, S sternum; D) Josiodes celena; Seventh abdominal segment heavily sclerotized with MS membranous sternite, eighth tergite (8T) extends beyond the distal margin of seventh tergite. Stippling indicates differences in degree of sclerotization. The scale bar is equivalent to 1mm.

PAGE 77

77 Figure 217. Abdominal pelt (A,C) and female genital capsule (B,D) Part B A) Lithosia sororcla ; T tergum, S sternum; B) Lithosia sororcula; Seventh abdominal segment heavily sclerotized with MT membranous tergite, eighth terg ite (8T) does not extend beyond the distal margin of seventh tergite. C) Lycomorpha pholus ; T tergum, S sternum; D) Lycomorpha pholus ; Seventh abdominal segment heavily sclerotized with MP membranous pleurites, eighth tergite (8T) extends beyond distal mar gin of seventh tergite. Stippling indicates differences in degree of sclerotization. The scale bar is equivalent to 1mm.

PAGE 78

78 Figure 218. Abdominal pelt (A) and female genital capsule (B) Part C A) Hypoprepia cadaverosa; T tergum, S sternum; B) Hypoprepia cadaverosa; Sclerotization of seventh abdominal segment equivalent to preceding segments, eighth tergite (8T) extends beyond the distal margin of seventh tergite. Stippling indicates differences in degree of sclerotization. The scale bar is equivalent to 1mm.

PAGE 79

79 Figure 219. Ventral female genital capsule. A) Gardinia anoploa ; OB ostium bursa located in the seventh sternite (7S). B) Lycomorpha fulgens ; OB ostium bursa located in the membrane between the seventh and eighth sternite, distal margin of the sev enth sternite (7S) NH nearly horizontal. C) Lycomorpha grotei ; OB ostium bursa located in the membrane between the seventh and eighth sternite, distal margin of the seventh sternite (7S) DI deeply indented. D) Lycomorpha pholus ; OB ostium located in the ei ghth sternite (8S), seventh sternite (7S). The scale bar is equivalent to 1mm.

PAGE 80

80 Figure 220. Bursa copulatrix. A) Propyria morelosia; DB ductus bursa sclerotized, SP sclerotization proximal to the OB ostium bursa, CB corpus bursa. B) Lithosia sororcula; DB ductus bursa sclerotized, sclerotization is not proximal to the OB ostium bursa, CB corpus bursa. C) Lycomorpha fulgens ; DB ductsu bursa not sclerotized, OB ostium bursa, CB corpus bursa. Stippling indicates the presence of sclerotization. The scale b ar is equivalent to 1mm.

PAGE 81

81 Figure 221. Strict consensus of the 4408 MP trees (L=736) L=1053, CI=0.10, RI=0.34 for the parsimony analysis rooted with Asota heliconia. BS values given above branches.

PAGE 82

82 Figure 222. Majority rule consensus tree of the Bayesian analysis rooted with Asota heliconia. Posterior probability support values given above the branches.

PAGE 83

83 CHAPTER 3 MOLECULAR PHYLOGENY OF THE TRIBE LITHOSI INI (LEPIDOPTERA: ER EBIDAE: ARCTIINAE) Background Information The tribe Lithosiini (Lepidoptera: Erebidae: Arctiinae) presently contains approximately 3,150 species. However, it is estimated that the total species number could reach 5,000 to 6,000. These species are placed in 457 genera that are cosmopolitan in dis tribution. Although members of Lithosiini are found worldwide, the biodiversity of the tribe is highest within the tropics (Scoble 1992 ; Holloway 2002). In addition, the highest number of endemic genera occurs within Australia (Common 1990). Within the tri be, Bendib & Minet (1999) have proposed the existence of seven subtribes. However, no phylogenetic analysis has been conducted to determine whether the subtribes constitute natural groups. Furthermore, only 112 genera of Lithosiini have been placed in a subtribe. Adult Lithosiini are commonly known as lichen moths. This name is derived from the hypothesized feeding behavior of the larvae: lichenivory. However, debate exists as to whether the larvae are lichen feeders or algal grazers (Hesbacher et al. 1995 ; Wagner et al. 2008). Although the true larval feeding behavior is uncertain, Pykk and Hyvrinen (2003) observed later instar larvae of Eilema species consuming the fungal thalli. In addition, the Lithosiini are also capable of sequestering phenolics pro duced by the fungal symbiont of the lichen (Hesbacher et al. 1995; Wagner et al. 2008). Although the tribe is known for its association with lichens, it will not be possible to study the evolution of this behavior until the evolutionary relationships among the genera are understood. The tribe Lithosiini has been recovered as monophyletic in three separate studies (Jacobson & Weller 2002; Wink & von Nikisch Rosenegk 1997; Zahiri et al. 2012).

PAGE 84

84 However, the taxon sampling (7, 5, and 5 genera respectively) was not large enough to make inferences about the evolutionary relationships among the genera. Scott & Branham ( In Press ) conducted the first phylogenetic analysis of the tribe using adult morphological characters and dense taxon sampling. Although they recov ered some nodal support for relationships among small species groups, the higher level relationships within the tribe were unresolved. This result was unsurprising since Bendib & Minet (1999), Jacobson & Weller (2002), and Holloway (2002) all noted that the larval morphology was the most reliable for accurately placing taxa within Lithosiini. Although a study of the tribe conducted using both larval and adult morphological characters might provide more resolution to the higher level relationships, the larvae of most lithosiine species that occur in the tropics are unknown (Holloway 2002). Although the adult morphology of the tribe was not able to resolve the higher level relationships within Lithosiini, no studies have been conducted that attempt to resolve these relationships using molecular data. Recently molecular data has been found to be use ful in resolving the higher level relationships within the order Lepidoptera (Regier et al. 2009; Mutanen et al. 2010; Zahiri et al. 2011) and the families that comprise this order (W ahlberg et al. 2003, 2009, 2010; Rota 2011; Zahiri et al. 2012). These st udies frequently combine multiple, independent gene markers selected from both the mitochondrial DNA (mtDNA) and nuclear DNA (nDNA). These two sources of DNA experience different rates of change. The mtDNA is only transmitted through the maternal line, is nonrecombinant, and evolves at a higher rate than the nDNA (Simon et al. 1994). Each of these characteristics of mtDNA allow it to aid in the identification of cryptic species and

PAGE 85

85 resolution of relationships among closely related species and genera (Lafontaine & Schmidt 2010). However, the rapid rate of evolution in the mtDNA sometimes lead to overestimates of species numbers (Schmidt & Sperling 2008). In addition, the use of the full mitochondrial genome of several insect orders was unable to recover robust support for the deeper nodes of Arthropoda (Cameron et al. 2004). Although the mtDNA evolves at a rapid rate, nDNA has a slower mutation rate and undergoes recombination during meiosis. The slower rate of evolution within nDNA has made it useful in recovering the higher level relationships within Lepidoptera (Regier et al. 2009; Mutanen et al. 2010). When a dataset is composed of multiple genes, the difference in the rates of evolution between mtDNA and nDNA provides biological justification for partitioning the dataset (Rota 2011). However, as the number of genes included in an analysis increases, the number of possible partitioning strategies exponentially increases (Lafear et al. 2012). In addition, when a model based method of phylogenetic analysis is used to analyze these datasets, proper partitioning has been shown to increase the accuracy of the phylogeny (Brown & Lemmon 2007). A commonly used way to select among different partitioning strategies is the use of Bayes factors (Brandley et al. 2005; Br own & Lemmon 2007). The Bayes factor is interpreted as the posterior probability of partition scheme 1 over partition scheme 2 in a Bayesian analysis where each scheme has an equal possibility of being true (Kass & Raftery 1995). After a partitioning schem e has been selected, appropriate models of evolution must be selected for each partition of the data. Selecting more complex models of evolution for each partition increases the computational time of an analysis. However, the use of under parameterized models has been found to lead to bias in Bayesian analyses (Huelsenbeck & Rannala 2004 ;

PAGE 86

86 Lemmon & Moriarty 2004). Several different statistical criteria have been developed to aid researchers in selecting appropriate models (Sullivan & Joyce 2005). Two criteri a that are frequently used to select the model of evolution are the Akaike information criterion (AIC; Akaike 1974) and the Bayesian information criterion (BIC; Schwarz 1978). In addition, the AIC criterion has been modified to address small sample sizes: the corrected Akaike information criterion (AICc: Sugiura 1978; Hurvich & Tsai 1989). Each of these criteria is able to compare nested and nonnested models simultaneously. However, the BIC penalizes overparameterization more strongly than then AIC or AICc and the BIC is less likely to increase the number of parameters as the number of sites in the dataset increases. Although some researchers have shown the BIC performs better in data simulations where the true model is known (Luo et al. 2010), this disreg ards the fact that the AIC and AICc do not assume that any of the candidate models are true (Sullivan & Joyce 2005). Therefore, the models selected by the three criteria should be compared using Bayes factors since the model of evolution can only truly be known in simulation studies. The aim of this study is to use four gene fragments to analyze the evolutionary relationships within Lithosiini. The gene fragments examined include two mitochondrial markers, cytochrome oxidase C subunit I (COI) and cytochro me oxidase B (CytB), and two nuclear markers, ribosomal protein S5 (RpS5) and the nuclear large subunit rRNA 28S D2 loop (28S). Each of the fragments is from a proteincoding gene, except for 28S. These genes have been shown to be phylogenetically informat ive at the higher level in Lepidoptera (Wahlberg et al. 2009; Mutanen et al. 2010; Zahiri et al. 2011, 2012). These genes are sequenced for forty six species of Lithosiini representing four

PAGE 87

87 subtribes, as well as species not yet placed in a subtribe. Model based phylogenetic methods, maximum likelihood and Bayesian inference, are used to examine the dataset. The phylogenies obtained are examined to study the deeper relationships within Lithosiini and assess the monophyly of the four subtribes included in the analysis. In addition, the effect of different selection criterion (AIC, AICc, and BIC) for obtaining the optimal model of evolution is studied using Bayes factors (Kass & Raftery 1995). Materials and Methods Taxon Sampling Forty six species of Lithosiini representing twenty six genera were included in the analysis (Table 31). Both Old World and New World species were sampled. Australia, an area with a high number of endemic genera of Lithosiini (Common 1990 ; Edwards 1996), was represented by 15 species that are placed in eight genera. However, the Neotropics, Eastern Europe and Asia were represented by only eight species from seven genera. The species that were sampled are presently placed in four of the lith osiine subtribes proposed by Bendib & Minet (1999). The subtribes that were represented are Acsalina (1 species, 1 genus), Cisthenina (13 species, 7 genera), Lithosiina (17 species, 9 genera), and Nudariina (10 species, 5 genera). In addition, species that have not yet been placed in a subtribe were also included in the analysis (5 species, 5 genera). Of the three subtribes that were not sampled, one subtribe, Phryganopterygina, is monogeneric and restricted to Madagascar. The genera that comprise the other two, unrepresented subtribes are found in the regions for which few specimens suitable for DNA extraction (thirty years old or less) were available: Neotropics (Eudesmiina) and the Palearctic and Oriental region (Endrosina).

PAGE 88

88 To test the monophyly of Lithosiini, outgroup taxa were selected from the subfamily Aganainae and the remaining two tribes of Arctiinae, Arctiini and Syntomiini. Aganainae was represented by three species, which are placed in two genera. Kitching (1984) and Zahiri et al. (2011, 2012) f ound Aganainae to be sister to Arctiinae. Pagara simplex Walker was chosen to represent the tribe Arctiini. Previously, P. simplex has been treated as a me mber of Lithosiini (Covell 1984; Forbes 1960 ; Franclemont 1983). However, Bendib & Minet (1999) consi dered this species to be an aocellate phaegopterine, and Ferguson and Opler (2006) transferred it to Arctiini. In a phylogenetic analysis of Lithosiini based on morphological data (Scott & Branham In Press ), P. simplex was recovered outside of the tribe. T he tribe Syntomiini was represented by Amata aperta (Meyrick). In previous phylogenetic analyses, the position of Syntomiini within Arctiinae has varied based on the data type used in the analysis. Using morphological data, Jacobson & Weller (2002) recover ed Syntomiini sister to Lithosiini. Zahiri et al. (2011, 2012) recovered Syntomiini sister to Arctiini using molecular data. In this study, all analyses were rooted on the aganaine species Asota heliconia (Linnaeus). DNA Extraction, Amplification, and Sequ encing A voucher number was assigned to each specimen used for DNA extraction. This voucher was placed in a vial or on a pin with the remaining moth body. This number was also used to identify the DNA extract from the same specimen. DNA was extracted from three l egs taken from the right side of the thorax of specimens that were frozen or stored in 96% ethanol. If a specimen had been allowed to dry, DNA was extracted from the abdomen of the specimen using the method proposed by Knlke et al. (2005) and Hundsdoerfer and Kitching (2010). The DNA extraction was performed using the

PAGE 89

89 DNeasy blood and tissue kit (Qiagen, Valencia, CA) with modifications noted below. a source of DNA, they were placed in a 1.5ml microcentrifuge tube containing 180l Buffer ATL and 20l proteinase K, and a plastic tissue grinder (Axygen*, Union City, CA) was used to homogenize the tissue in the tube. After homogenization, the tube was incubated for 12 to 14 hours. When an abdomen was used as a source of DNA, the abdomen was removed from the specimen and placed in a 1.5ml microcentrifuge tube in 140incubated for 30 minutes. After the initial incubation period, 7l of proteinase K was pipetted into the basal opening where the abdomen had been attached to the thorax. The tube was incubated for an additional 90 minutes. After the second incubation period, another 7 the basal opening of the abdomen. On female specimens, an incision was made down the pleurites on one side of the abdomen to prevent rupturing before the second aliquot of proteinase K was added. The tube was further incubated for 12 to 14 hours. Following this incubation, the abdomen was placed ATL buffer. Remaining soft tissue was removed from the abdomen using forceps that had been sterilized using a Spectrolinker XL1000 UV crosslinker (Spectronics Corporation) The abdominal pelt and genital capsule were st ored in a vial that contained 20% ethanol to be dissected later. The soft tissue and ATL buffer were returned to the water bath and incubated until all of the soft tissue was digested (30 minutes to several hours). Following the digestion of the tissue, the same extraction procedure was used for both the leg and abdominal tissue. The DNA was bound to a

PAGE 90

90 spin column membrane following the DNeasy blood and tissue kit protocol. After the DNA had been bound to the spin column, it was washed twice with 500l of AW1 buffer. The sample was also washed twice with 500l of AW2 buffer. After the washes were completed, the spin column was transferred to a new 1.5ml tube. To elute the DN A from the spin column, 100l of Buffer AE was added to the center of the spin column membrane. After incubating for one minute at room temperature, the tube was DNA e xtract. The DNA extracts were quantified using a Nanodrop ND 1000 spectrophotometer (ThermoScientific). Polymerase chain reactions (PCR) were used to amplify two mitochondrial gene fragments, cytochrome c oxidase subunit I (COI, 690bp) and cytochrome oxidase b (CytB, 660bp), and two nuclear gene fragments, ribosomal protein S5 (RpS5, 660bp) and the nuclear large subunit rRNA 28S D2 loop (28S, 680bp). PCR was conducted using a high fidelity mastermix, Accuzyme (Bioline, Randolph, MA), to amplify the fragment s from 1.0l of template DNA. The final volume of the reaction was 25.0l. The primers, reagents, and thermocycler profiles used for each gene can be found in Table 3 2. The products obtained from PCR were separated using agarose gel electrophoresis (1% TB E gels). The DNA was stained using GelRed (Phenix, Candler, NC) and visualized with ultraviolet light. The gene fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Valencia, CA). The purified products were sequenced in both the forward and reverse directions at the Biomedical Genomics Center at the University of Minnesota Core Facility. The sequences were edited, aligned

PAGE 91

91 usi ng MUSCLE (Edgar 2004), and concatenated in Geneious v5.6.5 (Drummond et al. 2011). The final concatenated file was 2878bp long. Phylogenetic Methods The concatenated dataset was analyzed using PartitionFinder v1.0.1 (Lanfear et al. 2012) to determine the optimal data partitioning strategy and model of evolution for each partition. The optimal partitioning scheme was determined using the Akaike information criterion (AIC; Akaike 1974), the corrected Akaike information criterion (AICc : Sugiura 1978; Hurvich & Tsai 1989), and the Bayesian information criterion (BIC; Schwarz 1978) (Table 33). Phylogenetic trees were constructed using maximum likelihood (ML) and Bayesian inference (BI) methods. In order to employ both optimal partitioni ng schemes identified with PartitionFinder, the ML and BI analyses were conducted twice. The ML analysis was conducted using RAxML HPC2 v7.3.2 (Stamatikis 2006; Stamatikis et al. 2008) with the default settings. The GTR + G model of evolution was applied for each data partition in the analysis. Nodal support was calculated using 1000 bootstrap (BS) pseudoreplicates (Felsenstein 1985). These values were mapped onto the most likely topology identified by RAxML. The Bayesian Inference (BI) analysis was conducted using MrBayes v3.1.2 (Ronquist & Huelsenbeck 2003). The models of evolution used for each data partition can be found in Table 33. The Bayesian analyses were performed with four chains, one cold and three hot, using the default temperature settings. Two simultaneous, independent runs of 20,000,000 generations were conducted. The Markov chain Monte Carlo (MCMC) chains were started at random trees. Samples were drawn from the cold chain every 1,000 generations. Five million generations were discarded as burn in. The probabilities of the two runs were

PAGE 92

92 summarized, and the potential scale reduction factor (PSRF: Gelman & Rubin 1992) was calculated to confirm that the runs had converged. The PSRF value should approach 1.000 as the independent runs converge. The trees from the Bayesian analysis were summarized as a majority rule consensus tree. Posterior probability (PP) provided the clade credibility values for the tree. Both the ML and BI analysis were conducted using the CIPRES Science Gateway (Miller et al. 2010) The trees from both types of analysis were visualized using FigTree v1.3.1 (Rambaut 2010). Bayes factors (BF; Kass & Raftery 1995) were used to compare the optimal partitioning schemes identified using PartitionFinder. In order to calculate the BF, the harmonic mean (HM) of the likelihood score was obtained from each BI analysis by summing the probabilities of the two runs in the analysis after the burnin had been discarded. In order to calculate BF, the formula 2ln(BF1) = 2[ln(HM1) ln(HM2)] was used (Brandley et al. 2005; Brown & Lemon 2007; Rota 2011). In this formula, HM1 was the harmonic mean of the first partitioning strategy, and HM2 was the harmonic mean of the second partitioning strategy. The significance of the BF that were calculat ed using this formula was determined by the values presented by Kass and Raftery (1995) were a BF > 150 provides strong support against the second partitioning strategy (Table 34). Results and Discussion Analyses were based on 2878bp of sequence obtained from four gene fragments, two mitochondrial and two nuclear, sampled for 46 species of Lithosiini. Each of the analyses was conducted twice in order to compare the optimal partitioning schemes and models of evolution using the AIC, AICc, and BIC selection criteria The Bayes factors (BF) were calculated comparing the harmonic mean from the Bayesian analysis using the BIC scheme (HM1 = 19918.22) to the harmonic mean from the

PAGE 93

93 analysis using the AIC, AICc scheme (HM2 = 19870.87). The BF obtained from this comparison was 1.00238. Based on the values present by Kass and Raftery (1995; Table 34) the difference in the probability of the two schemes was not significant. Although the probability of the partitioning schemes identified by the selection criteria wer e not found to be significantly different, the optimal scheme identified using the BIC contained 24 fewer parameters than the one identified using the AIC and AICc. This is congruent with the AIC and AICc not penalizing additional parameters as strongly as BIC. Both the maximum likelihood (ML) analysis (Figs 31, 3 2) and the Bayesian inference (BI) analysis (Figs 33, 3 4) recovered Arctiinae as a moderately to strongly supported monophyletic clade (BSAIC BIC AIC BIC = 1). However, none of the analyses recovered Lithosiini as a monophyletic group. Instead, Lithosiini was found to be paraphyletic with respect to Syntomiini and Arctiini. In each analysis, Pagara simplex (Arctiini) and Amata aperta (Syntomiini) were reco vered in a weakly supported (PPAIC BIC A sura polyspila Turner and Eilema sp .2. The relationships among these species were unresolved in the BI analysis. However, the relationships within this clade were resolved in the ML analysis, but there was no nodal support. In addition, the clade containing Arctiini and Syntomiini was recovered in Clade D sister to the Miltochrista species included in the analyses. Confusion has existed about the placement of P. simplex A lthough Covell (1984), Forbes (1960), and Franclemont ( 1983) treated it as a member of Lithosiini, Bendib & Minet (1999) considered this species to be an aocellate phaegopterine. However, S. Weller (pers. comm.) notes that the arrangement of the

PAGE 94

94 male valvae of P. simplex is inverted from the typical phaegopterine valvae. The males of P. simplex possess an entirely membranous costa and a sclerotized sacculus. Although these analyses found Lithosiini to be paraphyletic to Arctiini and Syntomiini, both of thos e subtribes were represented by a single species. An analysis that includes several representatives of Arctiini and Syntimiini will help to clarify the relationships among the three tribes. Four of the subtribes proposed by Bendib & Minet (1999) were represented in this analysis. In addition, five genera that have not yet been placed in a subtribe were also included. Three of the subtribes (Cisthenina, Lithosiina, and Nudariina) were represented by multiple species and genera. Both the ML and BI analyses recovered each of these subtribes to be polyphyletic. The majority of the species and genera representing these subtribes were recovered in one of four clades (Clades A D). These clades contained the same species in both partitioning schemes and phylogenet ic analyses. In addition, with the exception of Clade B and Clade D these clades contained species from only one subtribe and unplaced species. The subtribe Acsalina was represented by the single species that defines the subtribe, Acsala anomala Benjamin. A. anomala was recovered sister to Ptychoglene coccinea (Edwards) within the Clade B, which is composed primarily of species placed in Cisthenina. This relationship received moderate support in both ML analyses but was strongly supported in both of the BI analyses (BSAIC BIC AIC PPBIC subtribe.

PAGE 95

95 All but two species of Lithosiinia were recovered in Clade A. This clade was weakly supported in all of the analys es (BSAIC BIC AIC BIC 0.64). Within Clade A, Eilema Hbner was found to be polyphyletic. Birket Smith (1965) and Holloway (2002) noted that the genus Eilema as presently defined, does not comprise a natural group. A moderately to strongly supported relationship was recovered between the type species of the type genus of Lithosiina, Lithosia quadra (Linnaeus), and Eilema sp. 1 (BSAIC BIC AIC BIC addition, this clade was found sis ter to the unplaced species Calamidia hirta (Walker) (BSAIC BIC AIC BIC Hiera gyge Druce, was also recovered within Clade A. However, the placement of H. gyge varied based on both on the type of a nalysis and the partitioning scheme used. Most of the species representing Cisthenina were found in Clade B and Clade C. Clade B received moderate support in both of the BI analyses (PPAIC BIC 0.86). However, this clade was only weakly supported in the ML analysis using the AIC partition strategy (BSAIC Cisthene Walker, except Cisthene subjecta Walker, were found in this clade. Within Clade B, these species were divided between two clades. The species of Cisthene ra nge from North America through the Neotropics. All of the species of Cisthene included in this analysis occur in North America. Although Knowlton (1967) completed a revision of the species that occur north of Mexico, no phylogenetic analysis was done to as sess the generic limits of Cisthene The findings of this study suggest that, as currently defined, Cisthene is polyphyletic. The unplaced species Meterhythosia sangala (Druce) was recovered in Clade B in all analyses. M. sangala was recovered sister to th e well supported Bruceia hubbardi Dyar

PAGE 96

96 + Prepiella aurea nr clade (BSAIC BIC AIC = 1, PPBIC = 1). Although this relationship was recovered in all of the analyses, it received only moderate support in the BI analyses (PPAIC BIC the species of Cisthenina, has no nodal support in either ML analysis but receives moderate to strong support in the BI analyses (PPAIC BIC species of Hypoprepia Hbner were f ound in this clade as well as Bruceia pulverina Neumoegen. A strongly supported (BSAIC BIC AIC = 1, PPBIC sister relationship was recovered between B. pulverina and Hypoprepia cadaverosa Streck. Clade D contained most of the species and three of the five genera representing Nudariina. This clade received moderate support in the BI analyses (PPAIC BIC Miltochrista Hbner was recovered as monophyletic (BSAIC = 100, BSBIC = 100, PPAIC = 1, PPBIC = 1). The Miltochrista clade was recovered sister to the clade containing the representatives of Syntomiini and Arctiini in each analysis (PPAIC BIC Asura Walker was found to be polyphyletic in all of the analyses. Bendib & Minet (1999) stated that Asura was not monophyletic as defined. Lyclene Moore was found to be paraphyletic with respect to Asura cervicalis Walker and the unplaced species Prinasura quadrilineata (Pagenstecher). This relationship was strongly supported (BSAIC BSBIC AIC = 1, PPBIC = 1). This finding was not unexpected since Lyclene and Asura possess similar color patterns. The evolutionary relationships of five of the species of Lithosiini ( Cisthene subjecta, Cyan a meyricki (Rothschild & Jordan), Gardinia anoploa Hering, Heliosia

PAGE 97

97 jucunda (Walker), Schistophleps albida Walker) were unresolved among the analyses. The placement of C subjecta, the type species of the type genus of Cisthenina, and S. albida was dependent upon the type of analysis. In both ML analyses, C. subjecta was found in the basal most clade of the tree sister to the nudariine species S albida However, there was no nodal support for this relationship. In addition, this relationship wa s not recovered in either of the BI analyses. The nudariine species C. meyricki was recovered sister to Clade D in the ML analyses, but its position was unresolved in the BI analyses. G. anoploa and H. jucunda were both found to be related to Clade C in th e ML analysis. Again, these relationships were not recovered in the BI analysis. This study found that molecular data were better able to resolve the evolutionary relationships among the genera of Lithosiini. However, this dataset was still unable to provi de nodal support for the deeper nodes within the tribe. The majority of the species of Lithosiini included in this analysis were missing data from at least one gene. In eleven of the species, only the 28S gene marker was successfully sequenced. These gaps in the data may be contributing to the lack of support for the higher level relationships. In addition, increasing the number of nDNA markers used in the analysis could aid in the resolution of these relationships. Half of the gene markers used in this analysis were obtained from the mtDNA, and the studies that have recovered the higher level relationships of families and tribes with robust nodal support (W ahlberg et al. 2003, 2009, 2010; Zahiri et al. 2011, 2012) included more nDNA fragments than mtDNA fra gments. Also, the study did not recover the tribe Lithosiini as monophyletic with respect to the other two tribes of Arctiinae. This finding may be due to the gaps in the data as well as the used of a single representative for the tribes Arctiini and Syntomiini.

PAGE 98

98 As with the study of the tribe based on morphological data, the subtribes proposed by Bendib & Minet (1999) were not recovered as monophyletic groups. Although three of the subtribes were found to be polyphyletic, four clades composed almost entirel y of species from single subtribes were recovered. This result suggests that with modification, the subtribes of Bendib & Minet could define natural groups. This study also identified several genera that are polyphyletic as presently defined. This finding was not surprising since wing color patterns have been used to place species in both Cisthene and Asura The use of this type of character to place species within a genus resulted in 19 species being mistakenly described as members of Lycomorpha Harris. Al though the use of molecular data provided more resolution of the relationships among the genera of Lithosiini, further analyses will be needed before the evolution of lichen feeding behaviors within the tribe can be studied.

PAGE 99

99 Table 31. List of spec ies used in the analysis including the subtribe, locality, assigned voucher number, collection that provided the material, and the gene fragments that were successfully amplified. Taxa (Genus species) Locality Voucher #, Collection Gene Fragments 28S COI CytB RpS5 EREBIDAE Arctiinae Lithosiini Acsalina Acsala anomala Benjamin Yukon Territory JZCS133, CNC 28S RpS5 Cisthenina Bruceia hubbardi Dyar Arizona, USA PC015, CHS 28S COI B. pulverina Neumoegen Wyoming, USA JZCS132, CNC 28S COI Cisthene juanita Barnes & Benjamin Arizona, USA PC017, CHS 28S COI C. plumbea Stretch Arkansas, USA JZCS139, CNC 28S COI CytB C. subjecta Walker Tennessee, USA PC011, CHS 28S COI C. tenuifascia Harvey Arizona, USA PC014, CHS 28S Hypoprepia cadaverosa Streck Colorado, USA JZCS131, CNC 28S COI CytB H. fucosa Hbner Tennessee, USA PC019, CHS 28S H. fucosa tricolor (Fitch) Minnesota, USA JZCS062, UWO 28S COI CytB RpS5 Lycomorpha pholus (Drury) Connecticut, USA PC022, YPM 28S Lycomorphodes sordida (Butler) Guatemala JZCS140, CNC 28S Prepiella aurea nr. Guatemala JZCS141, CNC 28S Ptychoglene coccinea (Edwards) Arizona, USA PC084, USNM 28S Lithosiina Agylla septentrionalis Barnes & McDunnough Arizona, USA JZCS125, CNC COI Atolmis rubricollis (Linnaeus) Denmark JZCS135, CNC 28S CytB RpS5 Crambidia lithosioides Dyar Tennessee, USA PC018, CHS 28S Cybosia mesomella (Linnaeus) Denmark JZCS137, CNC 28S Eilema bicolor (Grote) Minnesota, USA JZCS060, UWO 28S COI CytB RpS5 E. complana (Linnaeus) Denmark JZCS136, CNC 28S COI RpS5 E. dorsalis (Walker) Australia JZCS040, UMD 28S COI CytB E. griseola (Hbner) France JZCS134, CNC 28S COI CytB RpS5

PAGE 100

100 Table 31. Continued Taxa (Genus species) Locality Voucher #, Collection Gene Fragments E. plana (Boisduval) Australia JZCS028, UMD 28S COI Eilema sp. 1 Australia JZCS082, UMD 28S COI CytB RpS5 Eilema sp. 2 Australia JZCS087, UMD 28S COI RpS5 Eilema sp. 3 Russia/Nepal JZCS107, UWO 28S COI CytB Eilema sp. 4 Russia/Nepal JZCS108, UWO 28S COI Gardinia anoploa Hering Arizona, USA JZCS126, CNC 28S COI RpS5 Gnamptonychia flavicollis (Druce) Arizona, USA JZCS127, CNC 28S COI CytB RpS5 Inopsis modulata (Edwards) Arizona, USA JZCS128, CNC 28S COI Lithosia quadra (Linnaeus) Russia JZCS105, UWO 28S COI Nudariina Asura cervicalis Walker Australia JZCS047, UMD 28S COI A. polyspila Turner Australia JZCS033, UMD 28S COI CytB RpS5 Cyana meyricki (Rothschild & Jordan) Australia JZCS001, UMD 28S COI CytB RpS5 Lyclene pyraula (Meyrick) Australia JZCS020, UMD 28S COI CytB L. reticulata (Felder) Australia JZCS041, UMD COI CytB RpS5 Lyclene sp. 1 Australia JZCS038, UMD 28S COI Lyclene sp. 1 nr. Australia JZCS048, UMD 28S COI RpS5 Miltochrista miniata (Forster) Denmark JZCS138, CNC COI CytB RpS5 Miltochrista sp. 1 Russia/Nepal JZCS109, UWO 28S COI Schistophleps albida (Walker) Australia JZCS056, UMD 28S COI Unplaced Calamidia hirta (Walker) Australia JZCS009, UMD 28S COI RpS5 Heliosia jucunda (Walker) Australia JZCS071, UMD 28S Hiera gyge Druce Costa Rica JZCS130, CNC 28S Meterhythosia sangala (Druce) Guatemala JZCS129, CNC 28S Prinasura quadrilineata (Pagenstecher) Australia JZCS019, UMD 28S COI

PAGE 101

101 Table 31. Continued Taxa (Genus species) Locality Voucher #, Collection Gene Fragments Syntomiini Amata aperta (Meyrick) Australia JZCS081, UMD 28S COI RpS5 Arctiini Pagara simplex Walker Tennessee, USA PC004, CHS 28S Aganainae Asota heliconia (Linnaeus) Australia JZCS029, UMD 28S COI CytB As. orbona (Vollenhoven) Australia JZCS078, UMD 28S COI CytB Neochera dominia (Cramer) Australia JZCS008, UMD 28S COI CytB Collections: CHS (Collection of C. Scott), USNM (United States Museum of Natural History), UWO (University of Wisconsin Oshkosh), UMD (University of Maryland), YPM (Yale Peabody Museum)

PAGE 102

102 Table 32. PCR protocol data including thermocycler profiles, primer sequences for each gene used, and the reagents used. Thermocycler Profiles /3 min min. Primer Name Sequence from 5 to 3 COI DNA Barcode Segment LepF1 5 ATTCAACCAATCATAAAGATATTGG 3 LepR1 5 TAAACTTCTGGATGTCCAAAAAATCA 3 CytB REVCB2H 5 TGAGGACAAATATCATTTTGAGGW 3 REVCBJ 5 ACTGGTCGAGCTCCAATTCATGT 3 28S D2 Loop LEE 28S_D2 F1 5 GAGTACGTGAAACCGTTCAG 3 28S_D2 R1 5 CTGACCAGGCATAGTTCAC 3 RpS5 HybrpS5degF 5 ATGGCNGARGARAAYTGGAAYGA 3 HybrpS5degR 5 CGGTTRGAYTTRGCAACACG 3 Reagents Volume Accuzyme Mix 12.5l Taq Polymerase 0.5l ddH2O 9.0l Forward Primer [20pmol] 1.0l Reverse Primer [20pmol] 1.0l DNA template 1.0l

PAGE 103

103 Table 33. Optimal partitioning schemes selected by PartitionFinder v1.0.1 (Lanfear et al. 2012) using the AIC, AICc, and BIC selection criteria The model of evolution for each partition, the number of subsets, parameters, and the log likelihood for each scheme is included. Selection Criterion Optimal Scheme Model of Evolution Subset # Parameter # lnL AIC, AICc 28S = 1 805 GTR+I+G 10 168 19363.032 COI nt1 = 806 1555 \ 3 GTR+G COI nt2 = 807 1555 \ 3 F81 COI nt3 = 808 1555 \ 3 GTR+G CytB nt1 = 1556 2215 \ 3 GTR+G CytB nt2 = 1557 2215 \ 3 HKY CytB nt3 = 1558 2215 \ 3 GTR+I+G RpS5 nt1 = 2216 2878 \ 3 K80+I RpS5 nt2 = 2217 2878 \ 3 JC+I RpS5 nt3 = 2218 2878 \ 3 GTR+I+G BIC 28S = 1 805 GTR+I+G 7 144 19411.662 COI, CytB nt1 = 806 1555 \ 3, 1556 2215 \ 3 GTR+G COI, CytB nt2 = 807 1555 \ 3, 1557 2215 \ 3 HKY COI, CytB nt3 = 808 1555 \ 3, 1558 2215 \ 3 GTR+G RpS5 nt1 = 2216 2878 \ 3 K80+I RpS5 nt2 = 2217 2878 \ 3 JC+1 RpS5 nt3 = 2218 2878 \ 3 GTR+I+G

PAGE 104

104 Table 34. Interpretation of the Bayes Factor (BF) adapted from Kass and Raftery (1995) BF 1 Evidence for Hypothesis 1 1 3 Not worth mentioning 3 20 Positive 20 150 Strong >150 Very Strong

PAGE 105

105 Figure 31. Maximum likelihood tree from analysis of AIC, AICc optimal partitioning scheme. LnL = 18742.441364 above the branch. A D = Clades A D.

PAGE 106

106 Figure 32. Maximum likelihood tree from analysis of BIC optimal partitioning scheme. LnL = 18792.271033 branch. A D = Clades A D.

PAGE 107

107 Figure 33. Majority rule consensus tree of the Bayesian analysis using the AIC, AICc optimal partitioning scheme. Harmon ic mean likelihood = 19870.87 Posterior probability branch support values given above the branch. A D = Clades A D.

PAGE 108

108 Figure 34 Majority rule consensus tree of the Bayesian analysis using the BIC optimal partitioning scheme. Harmonic mean likelihood = 19918.22. Posterior probability branch support values given above the branch. A D = Clades A D

PAGE 109

109 CHAPTER 4 PHYLOGENY OF THE LIC HEN MOTH GENUS LYCOMORPHA HARRIS (LEPIDOPTERA: EREBID AE: ARCTIINAE) Background Information The lichen moth genus Lycomorpha Harris (Lepidoptera: Erebidae: Arctiinae) is currently composed of seven species of lichen moths that are restricted to North American genus (Forbes 1960; Powell & Opler 2009). It is currently placed within the tribe Lithosiini, and Bendib & Minet (1999) placed Lycomorpha within the subtribe Cisthenina. Although adults of s everal species within Lycomorpha exhibit both diurnal and nocturnal flight activity, L. pholus ( Drury ) is exclusively diurnal (Fullard & Napoleone 2001), and L splendens Barnes and McDunnough is reported to be exclusively nocturnal (Powell & Opler 2009). The adults of the genus are aposematically colored. They are proposed to be Mllerian mimics of lycid beetles, other tiger mot hs (Simmons 2009), and zygaenid moths The wing color patterns of the adults have led to taxonomic confusion in the placement of Lycomorpha within a family as well as the placement of species within the genus. A phylogenetic study of the genus is necessary to elucidate and define the gener ic limits of Lycomorpha. Lycomorpha is currently placed within the tribe Lithosiini. However, Harris (1839) originally described the genus as a member of Zygaenidae. Other authors treated the genus as a member of several other families (Table 41). It was not until Forbes (1960) noted the coloration of the adults and the loss of the Sc vein were the only characters that supported the placement of Lycomorpha within Euchromiidae that the genus was placed within the tribe Lithosiini. Although the wing color patterns caused the genus being misplaced, the lack of synapomorphies from the adult morphology of the lichen moth tribe also contributed to the taxonomic confusion. In a phylogenetic study of the

PAGE 110

110 tribes of Arctiinae, Jacobson & Weller (2002) identified eight synapomorphies for Lithosiini. All of these characters were coded from the larval morphology. In addition, Jacobson & Weller (2002) included L. pholus the type species of Lycomorpha, in their analysis. It was recovered as sister to the genus Hypoprepia Hbner within the Lithosiini clade. Of the eight synapomorphies identified by Jacobson & Weller (2009), the presence of a mandibular mola (a structure that is hypothesized to aid the larvae in grinding the tougher fungal tissue of lichens (Gardner 1943)) i s now used to definitively place taxa within the tribe. When known, the larvae of Lycomorpha possess the mandibular mola (Jacobson & Weller 2002) and are reported to feed on lichens (Comstock & Henne 1967; Dyar 1897; Wagner et al. 2008). Although Jacobson & Weller (2002) confirmed the classification of Lycomorpha as a member of the tribe Lithosiini, confusion remains about the evolutionary relationships among the species within the genus. The adult wing color patterns have been the most commonly used character to place species within Lycomorpha. The use of this character has resulted in an additional nineteen species being described as members of the genus (Fig. 4 1). However, all of these species are now placed within other genera of Arctiini, Lithosiini, and Zygaenidae. In addition, phenotypic variation present within adult Lycomorpha led to the description of subspecies: L. pholus miniata Packard and L. grotei pulchra Dyar for the species, L. pholus and L. grotei (Packard) respectively Within the southw estern United States, four species ( L. fulgens (Henry Edwards), L. grotei L. grotei pulchra, and L. regulus (Grinnell)) that have red forewings and primarily black hindwings occur (Fig 42). Due to the similar coloration and the

PAGE 111

111 sympatric ranges, Comstock & Henne (1967) and Powell & Opler (2009) suggested that these species be studied to determine their taxonomic and systematic relationships. Most recently while conducting a phylogenetic analysis of the tribe Lithosiini, Scott & Branham ( In Press ) recovered all of the included species of Lycomorpha and the genus Propyria Hampson within a single, well supported clade (Bremer Support = 3, Posterior among the species representing the two genera were completely unresolved. However, in the Bayesian Inference analysis Lycomorpha was found to be paraphyletic with respect to Propyria Propyria is a North American genus composed of nine species. Adults from the genus have been coll ected from Mexico and as far south as Costa Rica. The adults are aposematically colored, and one species, P. schausi (Dyar), was originally described as a member of Lycomorpha. Using wing venation, one character separates these genera. In the hindwing of P ropyria, the M3 and CuA1 are fused and stalk beyond the discal cell. These veins are not fused within Lycomorpha. In this study, we used characters coded from the adult morphology to conduct the first phylogenetic analysis of the genera Lycomorpha (7 spec ies) and Propyria (9 species). This phylogenetic analysis is used to assess their generic limits and form a hypothesis of the evolutionary relationships among the species within each genus. Larval specimens were only available for one species, L. pholus Therefore, it was not possible to include larval characters within the analysis even though the larval morphology of Lithosiini has been found to provide the strongest phylogenetic signal (Bendib & Minet 1999; Jacobson & Weller 2002). Sixty five morphologi cal characters were coded for thirteen species representing Lycomorpha and Propyria In addition, the

PAGE 112

112 phylogenetic usefulness of the adult morphological characters in resolving the evolutionary relationships within the genera was assessed Materials and Methods Taxon Sampling Thirteen species representing Lycomorpha (10 species) and Propyria (3 species) were sampled for this study (Table 42). The type species for each genus ( L. pholus and P. ptychoglene Hampson) was included in the analysis. The species representing Lycomorpha included three species that have not yet been described, as well as both of the subspecies. The species status of each subspecies was revived. Each subspecies possesses morphological characters that are unique from the species with which it was synonymized. Malefemale pairs were available for all but two of the species. Both internal and external outgroups were included in the analysis to assess the generic limits of Lycomorpha and Propyria The genera Dolichesia Schaus, Hypermaepha H ampson, Lycomorphodes Hampson, and Talara Walker were included as the internal outgroup. Scott & Branham ( In Press ) found that these four genera formed a strongly Lycomorpha + Propyria clade in the Bayesian Inference analysis. Bendib & Minet (1999) included these genera in the subtribe Cisthenina as well. To root the phylogenetic analysis, an external outgroup composed of Hypoprepia and Ptychoglene Felder was included. Both of these genera are also members of Cistheni na. Forbes (1960) considered Lycomorpha to be a member of the Hypoprepia generic group, and Jacobson & Weller (2002) found Hypoprepia and Lycomorpha as sister taxa. However, in their analysis of Lithosiini, Scott & Branham ( In Press ) found Hypoprepia to be more distantly related to Lycomorpha than the genera of the internal outgroup. The wing pattern colors of Ptychoglene have created confusion

PAGE 113

113 between it and Lycomorpha. Hampson (1914) synonymized the type species of Ptychoglene, P. erythrophora Felde r, with L. drucei Hampson, and the species P. coccinea (Henry Edwards) was originally described within Lycomorpha. Scott & Branham ( In Press ) included both of these species in their analysis of Lithosiini. All species of Ptychoglene were found to be distantly related to the Lycomorpha + Propyria clade. P. erythrophora is included to assess the relationship between it and Lycomorpha and to determine the status of L. drucei Collections Consulted The following is a list of collections consulted for this study. It includes the name of the individual(s) who prepared the loan as well as an acronym for each of the collections. The acronyms used follow Heppner & Lamas (1982): American Museum of Natural History (AMNH) (D. Grimaldi), California Academy of Sciences ( CAS) (N.D. Penny), Carnegie Museum (CMNH) (J. Rawlins), Canadian National Collection, Agriculture Canada (CNC) (C. Schmidt), Cornell University Insect Collection (CUIC) (J. Liebherr, E.R. Hoebeke), Florida Museum of Natural History, University of Florida ( FLMNH) (J. Miller, D.M. Lott, A.D. Warren), Los Angeles County Museum of Natural History (LACM) (W. Xie), Museum of Comparative Zoology, Harvard University (MCZ) (R. Eastwood, P.D. Perkins), Museum of Southwestern Biology (MSB) (D. Lightfoot), National Mus eum of Natural History, Smithsonian Institution (USNM) (D.G. Furth, D. Harvey), Peabody Museum of Natural History, Yale University ( YPM ) (L.F. Gall), San Diego Natural History Museum (SDNH) (M.A. Wall), Texas A&M University Insect Collection (TAMU) (E.G. Riley), Essig Museum of Entomology, University of California, Berkeley (UCB) (J. Powell), University of Minnesota, St. Paul (UMSP) (R. Holzenthal), University of Wisconsin Oshkosh (UWO) (J.M. Zaspel).

PAGE 114

114 Morphology Dissections of the genitalia were prepared after softening the abdomens in a warm 10% potassium hydroxide (KOH, Fisher Scientific, Pittsburg, PA) solution for 30 minutes to 1.5 hours using standard methods (Winter 2000). The scales and viscera were removed from the abdomen in several rinses of 20% ethanol using fine watercolor paintbrushes (# 000 2). Structures were stained with a solution of chlorazole black E stored temporarily in 70% ethanol. Subsequently the abdomin al pelts and genitalia were either stored in vials of glycerol or permanently slide mounted in Euparol (Bioquip, Garden City, CA). The final preparation method used was dependent on the preference of the collection from which the material originated. The external morphological characters were coded from dried pinned specimens. All characters were scored using a Nikon SMZ800 light microscope. Pencil drawings were made using a camera lucida associated with a Leica MZ16 light microscope. These drawings were sc anned and saved as PDFs that were imported into Adobe Illustrator CS5 and then inked using the pen tool. The scale bar included in each figure is equivalent to 1mm. The purpose of stippling in any figure is explained in the figure legend. The terminology f or male and female genitalia follow s Klots (1970) and Forbes (1939 b 1954). The Lithosiini specific terminology for the genitalia proposed by Birket Smith (1965) was not used. This terminology can only be applied with confidence to members of the subtribe Lithosiina, and all species included in this analysis were placed in the subtribe Cisthenina (Bendib & Minet 1999). The terminology for the wing venation follows Kristensen (2003).

PAGE 115

115 Characters Examined Sixtyfive morphological characters (35 binary and 31 m ultistate; 196 states) were scored for all of the species that were sampled (Appendix D). These characters were coded from the adult external morphology as well as the male and female genitalia. Nongenitalic and genitalic characters are as follows: head ( 5 characters, 12 states), thorax (1 characters, 2 states), wings (2 characters, 4 states), abdomen (1 character, 3 states), male abdomen and genitalia (38 characters, 113 states), and female abdomen and genitalia (18 characters and 62 states). Multistate c haracters were treated as unordered and nonadditive. When characters were linked, e.g. the presence of androconia in the A7/A8 intersegmental membrane (Character 10) and the form of the androconia in the A7/A8 intersegmental membrane (Character 11), the r esulting inapplicable characters were coded as missing ? (Strong & Lipscomb 1999). By linking the characters, the presence of a morphological structure can contribute to the analysis, and the variation in the structure can be documented without oversimpl ifying characters (Pogue & Mickevich 1990). Phylogenetic Analysis Phylogenetic trees were constructed using parsimony and Bayesian analyses. Two data matrices were created and analyzed using the same set of morphological characters. One matrix contained all species (AS) from the ingroup including two species represented by a male specimen only (Appendix E). The other matrix contained only the eleven ingroup taxa that were represented by a malefemale pairs. Both matrices were analyzed using a Maximum Pars imony (MP) analysis in Paup* 4.0b 10 (Swofford 2003). A heuristic search of 10,000 random taxa additions was performed to identify all tree islands. The resulting cladograms of the AS matrix and the malefemale

PAGE 116

116 (MF) matrix were compared to determine the ef fect of the missing data in the AS matrix. Bremer support indices (BS: Bremer 1988, 1994) were calculated for the strict consensus of the MP trees obtained from the analysis of each dataset. The program TreeRot.v3 (Sorenson & Franzosa 2007) was run in conj unction with Paup* to obtain the Bremer support indices. In the discussion of our results, we define Bremer support values as giving weak (BS 12), moderate (BS 35), good (BS 611) support (Wahlberg & Nylin 2003; Wahlberg et al. 2003, 2 005). Based on the findings of the comparison between the AS matrix and the MF matrix, only the AS matrix was used to conduct the Bayesian Inference analysis and test the sensitivity of the ingroup topology to the removal of specific outgroup taxa. Additio nal nodal support values were calculated for the AS matrix from character jackknife analysis. Single taxon jackknife analysis (Lanyon 1985) was performed on each of the internal and external outgroup taxa using the AS matrix to determine if the ingroup top ology was sensitive to taxon sampling. 10,000 random taxa additions were performed for each outgroup manipulation. Further nodal support was calculated for the MP cladogram obtained from the analysis of the AS matrix using 1,000 character jackknife replicates (Kitching et al. 1998). Branch support was not calculated using bootstrap analysis (Felsenstein 1985) due to statistical objections that have been raised over its use (Sanderson 1995). The Bayesian Inference (BI) analysis was conducted using MrBayes 3. 1.2 (Ronquist & Huelsenbeck 2003). The data set was input as standard and analyzed using the Mk+ model (Lewis 2001). The BI analysis was performed using four chains (one cold and three hot) using the default temperature settings. Five simultaneous, independent runs of 20,000,000 generations were conducted. The Markov chain Monte Carlo (MCMC)

PAGE 117

117 chains were started at random trees. The cold run was sampled every 1,000 generations. Five million generations were discarded as a burnin. T he potential scale reduction factor (PSRF: Gelman & Rubin 1992) was calculated by summarizing the probabilities of the five runs The PSRF value is expected to approach 1 as the independent runs converge. Posterior probability (PP) provided the clade credi bility values for the BI cladogram The consensus trees from both types of analysis were visualize d using FigTree v1.3.1 (Rambaut 2010). Results Phylogenetic Analysis and Taxonomic Implications The MP analyses of both the all species (AS) and the malefemale (MF) data matrices recovered Lycomorpha as paraphyletic with respect to Propyria The analysis of the AS matrix resulted in three most parsimonious trees (L=192, CI=0.68, RI=0.73) located wit hin a single tree island. Despite the concerns of some authors (Kitching et al. 1998) that missing data within a dataset may confound the analysis, the strict consensus of the MP trees from this analysis was highly resolved (Fig. 44). The only unresolved portion of this tree was the pholus clade. The analysis of the MF matrix also resulted in three most parsimonious trees (L=192, CI=0.68, RI=0.71) within a single tree island. The strict consensus of these trees produced a cladogram (Fig. 43) with a topology identical to that found from the analysis of the AS matrix with the exception of the excluded taxa. However, the nodal support of the MF matrix MP cladogram was lower than that recovered for the AS cladogram. Due to these preliminary findings, the Bayesian Inference (BI) analysis as well as the character and outgroup jackknife analyses were only conducted on the AS matrix. The BI analysis also found Lycomorpha to be paraphyletic with respect to Propyria (Fig.

PAGE 118

118 4 5). However, the topology of the BI cladog ram was less resolved than cladograms recovered through the MP analysis of both matrices. Although the BI analysis was unable to recover the deeper evolutionary relationships of Lycomorpha, the species groups that were recovered were identical to those fou nd in the MP analysis. In addition to the two types of phylogenetic analysis, an outgroup jackknife analysis was completed to determine whether the ingroup topology was sensitive to the exclusion of any outgroup taxon. This analysis revealed that Lycomorpha was recovered as paraphyletic to Propyria regardless of which outgroup taxon was removed (Figs 4 6 to 411). In addition, all of topologies recovered from the outgroup jackknifing were shorter than the MP cladogram obtained from the analysis of the AS m atrix (Table 4 4). Omission of Hypoprepia (Fig. 4 6) or Talara (Fig. 4 8) caused the deeper nodes of the ingroup to collapse. The exclusion of any other outgroup taxon produced no effect on the ingroup topology. However, the removal of Hypoprepia and Hyper maepha (Fig. 4 10) resulted in the loss of resolution among the internal outgroup taxa. In addition, the omission of Dolichesia (Fig. 4 11) resulted in the internal outgroup clade to forming a polytomy with the ingroup. Both types of analysis recover the Lycomorpha + Propyria ingroup sister to the relationship between Lycomorpha and Propyria PP = 1). An examination of the character support (Table 43) for this node reveals that there are twenty synapomorphies that define the ingroup clade. Four of the synapomorphies (L1, IV1, BP1, PG1) are unique and found in all members of the ingroup. The occurrence of a tibial spur formula of 02 3 (L1) is unique within the

PAGE 119

119 subfamily Arctiinae. Scoble (1995) describes Arctiinae as possessing a tibial spur formula of either 02 2 or 02 4. Two of the other unique states that occur in all members of the ingroup arise from the male genitalia. They include the presence of an androconial patch within the intravincular membrane (37:IV1) and the absence of a caecum on the proximal end of the basiphallus (38:BP1). The final uni que state arises from the female genitalia and relates to the form of the dorsal pheromone gland (PG1; Character 64, State 0). The states of another four characters defining the ingroup are unique to this clade (AB1, MA2, MA8, VS1). An anterolateral proces s occurring as a sclerotized bar (9:AB1) and an M shaped vinculum/saccus (36:VS1) are unique character states that are reversed only once within the ingroup. In addition, the form of the androconia present in the A7/A8 intersegmental membrane (11:MA2), whi ch is unique to the ingroup, is further modified to another unique state within the Propyria clade (Clade 4). Within the ingroup clade (Clade 1), two main clades (Clade 2, Clade 3) are present. The pholus osed of three species including the type species of Lycomorpha. The other members of this clade include the former subspecies of L. pholus and a yet to be described species. The undescribed member of the clade represents a form of L. pholus that is only found in Texas. Five characters support this clade. The rectangular sclerotization around the uncus base (23:UB2), which is unique to Clade 2, is present in all species. Although the evolutionary relationships among these three species are unresolved, differ ences are present in the female genitalia. However, they do not provide a strong enough phylogenetic signal to resolve the relationships. The remaining ingroup clade (Clade 3;

PAGE 120

120 Propyria and the remaining species of Lycomorpha with the exception of L. splendens There are ten synapomorphies that support Clade 3. Unique states are present in three of these characters (33:J1, 41:PH2, FA4). However, none of these states are present in all of the species, but each of these states is further modified into another unique state. All of the species representing Propyria are found within Clade 3, but these species do not form a monophyletic clade. The type species of Propyria P. ptychoglene, is found sister to P. normani Schaus 0.64). The Propyria clade is supported by six synapomorphies. The presence of a narrow pocket of sex scales (Character 11, State 2) and a trident shaped processus basalis (Character 29, State 2) in the male genitalia are unique and found in both members of this clade. Unique states are also present in two other characters that were coded from the female abdomen (FA3, FA4). However, a female specimen from P. normani was not available. Therefore, it is not possible to determine whether these states are present in all members of this clade. The other representative species of Propyria P. morelosia Schaus, is recovered within the clade that contains all of the species of Lycomorpha with red forewings and primarily black hindwing s (Clade 5; BS = shaped uncus on the male genital capsule (Character 25, State 0) and continuous heavy sclerotization of the seventh female abdominal segment (Character 49, State 0), are unique to and present throughout Clade 5. The reduction of the A8 sternite to a sclerotized bar that is fused to the A8 tergite and A7 sternite (53:FA6) is also unique to this clade. However, the A8 sternite is lost within the grotei clade (Clade 6).

PAGE 121

121 The grotei 0.99). Three of the species whose wing color patterns led Comstock & Henne (1967) and Powell & Opler (2009) to suggest a phylogenetic study of the taxa was necessary ar e recovered within this clade. Seven synapomorphies define Clade 6. Three of these characters that arise from the female abdomen and genitalia (52:FA5, 57:DB2, 65:PG2) represent unique states that are present in all members of the clade. The findings of o ur analysis demonstrate that Lycomorpha and Propyria are not reciprocally monophyletic. We propose to treat these two genera as congeners. As presently defined, the species of Lycomorpha are found within three clades (C1, C2, C6). Constraining the monophyl y of these species results in a tree that is six steps longer (Fig. 412, L = 198, CI = 0.66, RI = 0.71). The parsimony likelihood test (Kishino & Hawsegawa 1989) does not find the two trees to be significantly different (P < 0.20). However, when this cons traint is enforced, Propyria is found to be paraphyletic with respect to Lycomorpha When the monophyly of Propyria is constrained, a tree that is only two steps longer (Fig. 413; L = 194, CI = 0.67, RI = 0.72; P < 0.53) is found. Constraining the monophy ly of Propyria does not separate it from Lycomorpha. Instead, Lycomorpha remains paraphyletic with respect to Propyria Thus we propose to place Propyria 1898 as a junior synonym of Lycomorpha 1839. A formal revision of Lycomorpha will be provided elsewhere (Scott in prep. ) Below we provide a species checklist of Lycomorpha. The species are listed in alphabetical order. Given the taxonomic confusion surrounding Lycomorpha, we also provide a checklist of the species originally descr ibed in the genus along with their current taxonomic treatment. Several species are removed from Lycomorpha and placed in other genera. L. desertus

PAGE 122

122 is transferred to the lithosiine genus Eudesmia. Hampson (1914) and Jordan (1917) reported that the types of this species had been lost. However, examination of the type collection of the National Museum of Natural History, Smithsonian Institution revealed two unidentified Lithosiini type specimens that match the description of L. desertus (pers. obs.). In addit ion, both specimens are missing abdomens, which is congruent with a malefemale pair taken in copula. A new description of L. desertus will be included in the revision of Lycomorpha. L. nigridorsata Dognin is listed as incert ae sedis In his description of the genus, Dognin compares L. n igridorsata to three species that have been transferred to other genera. Two of these species are now members of Zygaenidae. Dognin (1916) considered Lycomorpha to be a member of Zygaenidae. Without examining the type specim en, it will not be possible to confirm if L. n igridorsata is a lithosiine or zygaenid. Finally, L. drucei is synonymized with P. erythrophora. Species Checklist of Lycomorpha LYCOMORPHA Harris, 1839: 317 Type species: Sphinx pholus Drury, by monotypy Anat olmis Packard, 1864: 45 Prepodes Herrich Schffer, 1855: 100,101 Propyria Hampson, 1898: 521 New Synonym atroxantha (Schaus, 1906 ) (Propyria ) Mexico New Combination criton (Druce, 18811900) ( Cisthene ) Guatemala New Combination coatepeciensis (Strand, 1920) ( Propyria ) Mexico New Combination a. hypoleuca (Draudt, 1917) ( Propyria ) Mexico New Combination orizabae (Strand, 1920) ( Propyria ) Mexico New Combination flora (Schaus, 1911a) ( Propyria ) Costa Rica New Combination

PAGE 123

123 fridolini a (Schaus, 1925) ( Propyria ) Guatemala New Combination fulgens (Henry Edwards, 1881b) ( Anatolmis ) Arizona tenuimargo (Holland, 1903) ( Ptychoglene) Arizona, Mexico tenumargo authors, misspelling grotei (Packard, 1864) ( Anatolmis ) Colorado palmerii Packard, 1872 ( Lycomorpha) Arizona miniata Packard, 1872 ( Lycomorpha) Southern California Species Revised morelosia (Schaus, 1925) ( Propyria ) Mexico New Combination normani (Schaus, 1911b) ( Propyria ) Costa Rica New Combination pelopia (Druce, 18811900) ( Talara) Panama New Combination pholus (Drury, 1773) ( Sphinx ) New England ptychoglene (Hampson, 1898) ( Propyria ) Mexico, Guatemala New Combination aequalis (Walker, 1854a) ( Lithosia) Guatemala New Combination sinuata (Henry Edwards, 1885) ( Lycomorpha) Mexico pulchra Dyar, 1898 ( Lycomorp ha) Texas Species Revised regulus (Grinnell, 1903) ( Anatolmis ) California schausi Dyar, 1898 ( Lycomorpha) New Mexico, Arizona Combination Revis ed splendens Barnes & McDunnough, 1912 ( Lycomorpha) Utah strigifera Gaede, 1926 ( Lycomorpha) Mexico Checklist of Species Described as Lycomorpha Lithosiini EUDESMIA Hbner, 1823: plate 187 Type species: Callimorpha ruficollis Donovan, by monotypy Gerba Walker, 1865: 270

PAGE 124

124 Ruscina Walker, 1854: 563 desert us (Henry Edwards, 1881a) ( Lycomorpha) Arizona deserta Hampson, 1914 misspelling L YCOMORPHODES Hampson, 1900: xvi, 84, 378 Type species: Trichromia strigosa Butler, by original designation. bipartita (Walker, 1866) ( Lycomorpha) Brazil strigosa (Butler, 1877b) ( Trichromia ) Brazil fumata (Mschler, 1890) ( Lycomorpha) Puerto Rico funesta Kirby, 1892, misspelling PTYCHOGLENE Felder, 1874: plate 106 Type species: Ptychoglene erythrophora Felder, by monotypy. coccinea (Henry Edwards, 1886) ( Lycomorpha) Arizona erythrophora Felder, 1874 ( Ptychoglene) Mexico drucei Hampson, 1901 ( Lycomorpha) Mexico New Combination A rctiini CTENUCHA Kirby, In Richardson, 1837: 305 Type species: Ctenucha latreillana Kirby, by monotypy Caralisa Walker, 1856: 1660 Compsoprium Blanchard, In Gay, 1852: 67 Erchia Walker, 1854a: 321 Euctenucha Grote, 1873: 33 Hoplarctia Butler, 1877a: 54 togata (Druce, 1881 1900) ( Acreagris ) Guatemala, Costa Rica, Panama augusta (Henry Edwards, 1887) ( Lycomorpha) Mexico

PAGE 125

125 obscurata Draudt, 1915 ( Ctenucha) Zygaenidae MALTHACA Clemens, 1860: 540 541 Type species: Malthaca perlucidula Clemens, by monotypy Coementa Druce, 1881 1900: 123 Gingla Walker, 1854b: 228 Felderia Kirby, 1892: 163 marginata (Henry Edwards, 1884) ( Lycomorpha) Mexico mexicana (Druce, 1881 1900) ( Lycomorpha) Mexico teos (Schaus, 1889) ( Lycomorpha) Mexico NEOALBERTIA Tarmann, 1984: 64 Type species: Lycomorpha constans Edwards constans (Henry Edwards, 1881) ( Lycomorpha) Arizona sancta (Neumoegen & Dyar, 1894) ( Seryda ) Arizona NEOFELDERIA Tarmann, 1984: 65 Type species: Acreagris correbioides Felder, by monotypy Acreagris Felder, 1874: plate 83 rata (Henry Edwards, 1882) ( Lycomorpha) Arizona PYROMORPHA Herrich Schffer, 1850 1858: 6 Type species: Pyromorpha dimidiata Herrich Schffer, by monotypy Tetraclonia Jordan, 1917: 24 centralis (Walker, 1854a) ( Lycomorpha) notha (Henry Edwards, 1885) ( Lycomorpha) Mexico latercula (Henry Edwards, 1882) ( Lycomorpha) Arizona

PAGE 126

126 flavescens Herig, 1924 ( Tetraclonia) America SERYDA Walker, 1856: 1598 Type species: Seryda cincta Walker, by monotypy anacreon (Druce 1881 1900) ( Lycomorpha) Costa Rica basirei (Druce 1891 1900) ( Lycomorpha) Mexico semifulva ( Druce, 1891 1900) ( Lycomorpha) Mexico I ncertae s edis contermina Henry Edwards, 1884 ( Lycomorpha) Mexico Dyar (1898) does not consider contermina to be a true species of Lycomorpha. No alternative placement is suggested. nigridorsata Dognin, 1916 ( Lycomorpha) Panama regia Schaus, 1889 ( Lycomorpha) Mexico Dyar (1898) considers regia to be closely related to augusta Characters and their Phylogenetic Usefulness Here we present a list of the morphological characters used in this phylogenetic analysis. A discussion of the phylogenetic usefulness of each character is included. The individual character indices Consensus Index (CI) and Retention Index (RI) are included after each character. The indices are rounded up. Linked characters are indicated by a *. Head 1. Male flagellomere state. 0: simple and ciliate (Fig. 4 14A) 1 : serrate (Fig. 4 14B) 2 : bipectinate ( Fig. 4 14C) (CI = 0.67, RI = 0.75). a) Most species possess serrate antennae. Clade 2 + Clade 3 is defined by the presence of state 1. State 0 occurs in all outgroup taxa except Hypoprepia. State 2 is unique to L. splendens

PAGE 127

127 2. Female flagellomere state. 0: simple and ciliate (Fig. 4 15A) 1 : serrate (Fig. 4 15B) (CI = 0.33, RI = 0.50). a) The females of most species possess simple and ciliate antennae. Serrate antennae (state 1) are a synapomorphy of Lycomorpha. They are lost once in Clade 3 but regained in L fulgens 3. Gena state. 0: well developed, can be seen as a continuous band around the eye that joins the frons when viewing the head in profile (Fig. 4 16A) 1 : reduced, cannot be seen as a continuous band around the eye (Fig. 4 16B) (CI = 0.25, RI = 0. 57). a) The presence of a well developed gena (State 0) is a synapomorphy for C lade 2 + C lade 3. Within this clade, i t is reversed twice in New sp. A and L. grotei 4. Proboscis length. 0 : longer than the thorax, 1 : shorter than thorax. (CI = 0.50, RI = 0.00). a) The presence of a proboscis that is shorter than the thorax is autapomorphic for two outgroup taxa: Hypoprepia and Hypermaepha. 5. Labial palp segment fusion. 0 : all segments fused (Fig. 4 17A) 1 : 2nd and 3rd segments fused (Fig. 417B) 2 : fusion absent (Fi g. 4 17C) (CI = 0.67, RI = 0.00). a) Fusion between any of the labial palp segments is uncommon in both Lycomorpha and the outgroup (OG) taxa. The fusion of all three segments is autapomorphic for Hypermaepha. State 1 arises independently in L. splendens and L. fulgens Thorax 6. Tibial spur formula. 0: 0 2 4, 1 : 0 2 3. (CI = 1.00, RI = 1.00). a) A tibial spur formula of 02 3 (state 1) is a synapomorphy of Lycomorpha. It unites all species of Lycomorpha and Propyria This condition is unusual within Arctiinae. Scoble (1995) reported that the tibial spur formula for Arctiinae was either 02 2 or 02 4. Wings 7. Forewing: R free to costal margin, not anasto mosing with Sc. 0 : present (Fig. 4 18A) 1 : a bsent (Fig. 4 18B) (CI = 0.50, RI = 0.50). a) The absence of an R vein that is free to the costal margin (state 2) is a synapomorphy of the internal OG clade. It is reversed just once in Lycomorphodes

PAGE 128

128 8. Hindwing: Sc + R. 0 : present (Fig. 4 19A) 1 : absent (Fig. 4 19B) (CI = 1.00, RI = 1.00). a) The loss of the Sc + R (S tate 1) is a synapomorphy of the internal OG + Lycomorpha clade. Abdomen 9. Form of the Anterolateral Process (ALP) on the A2 apodeme. 0: sclerotized bar (Fig. 4 20A) 1 : flattened sclerotized lobe (Fig. 4 20B) 2 : short nob, less than half the length of the apodeme (Fig. 4 20C) (CI = 0.50, RI = 0.60). a) A synapomorphy of Lycomorpha is the sclerotized bar (state 0) form of the ALP. State 2 occurs only in the internal OG taxa Talara and Hypermaepha All remaining memb ers of the outgroup have the flattened sclerotized lobe (state 1) form of the ALP. Male a bdomen and g enitalia Male Abdomen 10. A7/A8 ventral intersegmental membrane. 0: without androconia (Fig. 4 21A) 1 : with androconia (Figs 4 21 B D) (CI = 0.50, RI = 0.7 5). a) The presence of androconia in the A7/A8 ventral intersegmental membrane (State 1) defines the ingroup clade and arises independently in Hypermaepha 11. Form of androconia in A7/A8 ventral intersegmental membrane. ?: does not apply (Fig. 4 21A) 0 : 2 poc kets with long hair like scales (Fig. 4 21B) 1 : shallow, broad pocket of sex scales onethird or more the width of A7 sternite (Fig. 4 21C) 2 : narrow pocket of sex scales less than onethird the width of A7 sternite (Fig. 4 21D) (CI = 1.00, RI = 1.00). a) The presence of a shallow, broad pocket of sex scales androconia (State 1) is a synapomorphy of the Lycomorpha clade. It transforms into State 2 within the Propyria clade. 12. Cephalic margin of A8 sternite. 0: fused to cephalic margin of A8 tergite, 1: extending to the cephalic margin of A8 tergite, no fusion, 2: extending onto the A8 pleurites. (CI = 0.50, RI = 0.67). a) Fusion of the cephalic margin of A8 sternite to the cephalic margin of A8 tergite (State 0) is diagnostic of the grotei clade. In all other members of the ingroup clade, the cephalic margin of the A8 sternite extends to the cephalic margin of the A8 tergite but no fusion occurs. State 2 is diagnostic of outgroup taxa Hypoprepia and Hypermaepha. 13. Sclerotization of A8 terg ite. 0 : present, 1 : absent. (CI = 1.00, RI = 1.00).

PAGE 129

129 a) The absence of sclerotization on the A8 tergite is a synapomorphy of the internal OG clade. 14. Pattern of sclerotization of A8 tergite. ?: does not apply, 0: T shaped, 1: square, 2: heartshaped, 3: rectan gular. (CI = 1.00, RI = 1.00). a) The ingroup is defined by a rectangular A8 sclerite (State 3). This character transforms to a heartshaped plate (State 2) within New sp. A + grotei clade. 15. A8/A9 dorsal intersegmental membrane. 0: without androconia, 1 : with 3 androconia, 2 pockets with long hair like sex scales bracketing a shallow pocket with hair like scales. (CI = 0.50, RI = 0.50). a) The presence of androconia in the A8/A9 dorsal intersegmental membrane is diagnostic of the internal OG and is reversed once in Hypermaepha. 16. A8/A9 ventral intersegmental membrane. 0: without androconia, 1: with androconia. (CI = 0.50, RI = 0.83). a) Androconia in the A8/A8 ventral intersegmental membrane defines all members of C lade 5 except P. morelosia (the basal most species in the clade). It also arises independently within Dolichesia 17. Form of androconia in the A8/A9 ventral intersegmental membrane. ?: does not apply, 0: 2 shallow pockets of sex scales located on the outer edges of the membrane, 1: a small pocket of sex scales located in the center of the membrane. (CI = 1.00). a) State 1 is a synapomorphy of all species of Lycomorpha within Clade 5. State 0 is unique to Dolichesia Genital Capsule 18. Pleural Sclerites. 0: present, 1: absent. a) The presence of pleural sclerites is constant throughout all taxa included in the study. The character is included because pleural sclerites were thought to be absent throughout Arctiinae. 19. The two halves of the tegumen fused for their entire length. 0: pr esent, 1 : absent. (CI = 1.00, RI = 1.00). a) There is fusion between the two halves of the tegumen in all ingroup and outgroup taxa. However, fusion that extends the entire length of the two halves of the tegumen (state 0) is a synapomorphy of the internal OG + Lycomorpha clade. 20. Sutures indicating the location of the fusion. 0: present, 1 : absent. (CI = 1.00, RI = 1.00).

PAGE 130

130 a) The absence of sutures that can be used to identify the two halves of the tegumen (state 1) is a synapomorphy of the internal OG clade. W hen present the form of the sutures helps to define species groups. 21. Shape of the sutures on the tegumen. ?: does not apply, 0: inverted Y shape, 1 : V shaped, 2: inverted U shape, 3 : Inverted T shape, 4: straight line with an ovoid bulge medially. (CI = 0.80, RI = 0.67). a) Variation in the shape of the sutures is useful for identifying species ( e.g. State 3, L. splendens ; State 2, L. fulgens ). V shaped sutures (State 1) are a synapomorphy of the ingroup. 22. Articulation of tegumen with uncus. 0: not fused, mem branous break separating the tegumen and uncus, 1: fused. (CI = 0.33, RI = 0.33). a) This character had low CI and RI values. Within both the external and internal outgroup taxa fusion between the tegumen and uncus (state 1) arose independently four times. 23. Sclerotization around the uncus base. 0: present, 1: absent. (CI = 0.50, RI = 0.75). a) The presence of sclerotization around the uncus base defines the Clade 2 + Clade 3 relationship. It also arises independently within both external OG taxa. 24. Form of scle rotization around the base of the uncus. ?: does not apply, 0: reduced to narrow, strips occurring laterally on the uncus base, 1: triangular, 2: rectangular, 3 : V shaped, 4: U shaped. (CI = 1.00, RI = 1.00). a) A reduction of the sclerotization to narrow st rips (State 0) is the most common state within the ingroup. However, the form of the sclerotization around the uncus is also useful for diagnosing species ( e.g. State 4 L. grotei ) and small species groups. 25. Curvature of the uncus. 0: S shaped, emerges from the conjuctiva and undergoes two bends, 1: C shaped, 2: knob, 3: straight. (CI = 0.75, RI = 0.86). a) An Sshaped uncus (State 0) is unique to Clade 5 and is present in all species within the clade. All other members of the ingroup clade possess a C shaped uncus (State 1). State 1 also evolves independently within the external OG taxa and Lycomorphodes State 2 is autapomorphic for Hypermaepha. 26. Shape of the apex of the uncus. 0: fingerlike tapering to a point, 1: fingerlike not tapering to a point, 2: laterally compressed ridge, 3: ovoid, teardrop shaped, tapering to a point, 4: spade shaped, tapering to a point. (CI = 0.57, RI = 0.57). a) The variation within this character is diagnostic of small species groups and species. States 0, 1, a nd 3 are found in both the ingroup and the outgroup taxa.

PAGE 131

131 State 4 is an autapomorphy of New sp. A State 2 is an autapomorphy of Lycomorphodes 27. Distal end of costal margin occurring as an identifiable break in the sclerotization. 0 : present, 1: absent. (CI = 0.50, RI = 0.67). a) An identifiable break at the distal end of the costal margin (State 0) defines the ingroup clade. It arises independently within the Lycomorphodes + Hypermaepha clade of the internal OG. 28. Processus basalis of costa. 0: present, 1 : abs ent. (CI = 0.33, RI = 0.60). a) This character (State 0) defines clade 3. It is reversed in the grotei clade and arises independently within the internal OG Lycomorphodes 29. Shape of processus basalis of costa. ? : does not apply, 0: laterally compressed tri angles, 1: elongate spines, tapering to a point, 2 : dorso ventrally compressed trident shaped extensions, tips are blunt, 3 : short dorsoventrally flattened lobe. (CI = 1.00, RI = 1.00). a) The shape of the processus basalis of the costa is useful in diagnosi ng species ( e.g. State 3, New sp. A ) and species pairs ( e.g. State 2, P. morelosia + P. normani ). 30. Transtilla. 0 : present, 1 : absent. (CI = 1.00, RI = 1.00). a) The loss of the transtilla (State 1) defines the internal OG clade). 31. Editum. 0 : present, 1: absent. (CI = 0.33, RI = 0.60). a) Most species in the study possess an editum (State 0). This state is reversed independently within the pholus clade, L. fulgens and the internal OG clade of Lycomorphodes + Hypermaepha. 32. Location of the editum. ?: does not apply, 0: proximally, occurs within the proximal of the costa, 1: processus basalis of the costa, 2: distally, at or beyond the proximal of the of the costa. (CI = 0.67, RI = 0.80). a) The editum is located distally (State 2) in members of both the internal and external OG. State 1 arises twice in the ingroup ( e.g. Propyria clade & New sp. A ). 33. Shape of the juxta. 0: rectangular with length perpendicular to the body, 1: semicircular, 2 : conical projection with lateral extensions, 3: square with el ongate two pronged projection, 4: square with a concave indentation in distal margin, 5: triangular with a conical tip, 6: trapezoidal 7 : rectangular with a triangular indentation in distal margin. (CI = 0.86, RI = 0.83).

PAGE 132

132 a) The shape of the juxta is useful for diagnosing species ( e.g. State 6, L. splendens ) and uniting small species groups ( e.g. State 4, pholus clade). States 5 is diagnostic for a smaller clade within Clade 5 ( L. fulgens ( New sp. A ( L. grotei ( L. regulus ( L. pulchra + New sp. C ))))). All former Propyria species possess State 7. 34. Juxta or namentation, transparent patch. 0 : present, 1: absent. (CI = 0.20, RI = 0.50). a) The presence of transparent patches ornamenting the juxta (State 0) is a synapomorphy of Clade 3. This state is rev ersed twice in L. pulchra and New sp. A 35. Shape of transparent patch. ? : does not apply, 0: triangular, 1: semicircular, 2 : conical 3 : rectangular, 4: circular. (CI = 0.80, RI = 0.50). a) A conical translucent patch in the juxta (State 2) is autapomorphic for P. ptychoglene. State 0 is diagnostic of a smaller clade within Clade 6 ( L. regulus ( L. pulchra + New sp. C)). It is lost once in L. pulchra. This state arises independently in P. morelos ia and P. normani 36. Shape of vinculum/saccus. 0: U shaped, 1: V shaped, 2: M shaped. (CI = 0.67, RI = 0.80). a) An M shaped vinculum/saccus (State 2) is a synapomorphy of the ingroup. It is reversed to state 0 once in L. fulgens 37. Ornamentation of intravincular membrane, single shallow pocket with sex scales. 0 : present, 1 : absent. (CI = 1.00, RI = 1.00). a) This character (State 0) is unique to the ingroup and present in all of the species of this clade Phallus 38. Proximal end of basiphallus (caecum). 0: well developed, ductus ejaculatorious simplex (DES) located entirely dorsad of the caecum, 1: reduced, DES emerging from anterior, dorsal end of caecum, 2 : absent, DES emerges from the anterior end of aedeagus. (CI = 1.00, RI = 1.00). a) The absence of the caecum (State 2) is unique to the ingroup clade. This character unites all Lycomorpha and former Propyria species. A well developed caecum (State 0) is a synapomorphy of the internal OG. State 1 is diagnostic of the external OG taxa. 39. Orientation of basiphallus. 0: straight, 1 : inflected dorsally at distal end (curved away from venter), 2: inflected dorsally at midpoint (curved away from venter), 3 : inflected ventrally at base (curved toward venter). (CI = 0.75, RI = 0.67).

PAGE 133

133 a) Most species possess a straight basiphallus (State 0). State 1 is unique to a smaller clade within Clade 5 ( L. fulgens ( New sp. A ( L. grotei ( L. regulus ( L. pulchra + New sp. C ))))). It is reversed once within the ( L. regulus ( L. pulchra + New sp. C ))) species group of this clade. State 2 is autoapomorphic within Lycomorphodes State 3 occurs in the internal O G taxa Talara and Hypermaepha. 40. Phallic sclerite. 0 : present, 1: absent, highly reduced. (CI = 0.25, RI = 0.50). a) The presence of a phallic sclerite is a synapomorphy of the ingroup. It is lost twice in L. fulgens and P. ptychoglene The sclerite arises independently within the internal OG Talara. 41. Shape of phallic sclerite, left side. ?: does not apply, 0: flattened lobe, extending as a separate structure dorsad of the vesica, 1 : rectangular, 2: narrowed, rounded triangle, 3: narr owed, pointed triangle. (CI = 1.00, RI = 1.00). a) This character (State 2) is unique to clade 3. It is modified to state 3 in the L. pulchra + New sp. C species pair. A rectangular sclerite (State 1) is an autapomorphy of L. splendens State 0 is found in both the ingroup ( e.g. pholus clade) and the internal OG Talara. 42. Vesica bilobed. 0 : absent, 1: present. (CI = 0.50, RI = 0.50). a) A bilobed vesica is found in all external OG tax a and the internal OG taxon Hypermaepha. 43. Membranous projections arising from the primary lobe(s) of vesica. 0: present, 1 : absent. (CI = 1.00, RI = 1.00). a) This character (State 0) is unique to Clade 2 + Clade 3. This clade includes all members of the ingroup except L. splendens 44. Location of membranous projections. ?: does not apply, 0 : apically on the left side, proximal to the distal margin of the aedeagus, 1: distal end of main lobe, upper right apice, 2: apically on the right side, 3: medially on the right side, 4: dorsal surface of the primary lobe. (CI = 1.00, RI = 1.00). a) This character is useful for diagnosing small clades ( e.g State 1, grotei clade) and species ( e.g. State 3, New sp. A ). 45. Ornamentation of the membranous projection located distally on the primary lobe. ?: does not apply, 0: peglike cornuti present the entire length, 1: peglike cornuti present on the distal third, remainder ruggose, 2: ruggose for the entire length. (CI = 1. 00). a) A membranous projection located distally on the primary lobe is unique to the grotei clade. The different forms of ornamentation help to diagnose the species of

PAGE 134

134 this clade ( e.g. State 2, L. grotei ), which includes three of the species with red forewings and primarily black hindwings. 46. Ornamentation of the vesica: heavily sclerotized, spine like cornutus. 0 : present, 1: absent. (CI = 1.00, RI = 1.00). a) The presence of a heavily sclerotized, spine like cornutus (State 0) is unique to the ingroup. It is absent in L. splendens (the most basal species of the ingroup) only. 47. Location of spinelike cornutus ? : does not apply, 0: primary lobe, 1: distal point of the membranous projection off the vesica. (CI = 0.50, RI = 0.67). a) The spine like cornutus is located on the primary lobe of the vesica (State 0) in most species. State 1 is diagnostic of the pholus clade. This state arises independently within L. fulgens Female a bdomen and g enitalia 48. A7 segment more heavily sclerotized than preceding segments. 0: present, 1: absent. (CI = 0.50, RI = 0.00). a) Without Character 49, Character 48 is not phylogenetically informative. The females of most species have an A7 segment that is more heavily sclerotized than the preceding segments (State 0). 49. Form of heavy sclerotization of A7. ?: does not apply, 0: continuous around the segment, 1: membranous breaks in the pleurites, 2 : membranous break occurring on the sternite, 3: membranous break on the tergite, 4: membranous breaks on pleurites and sternite. (CI = 0.80, RI = 0.75). a) A heavily sclerotized A7 segment with membranous breaks in the pleurites (State 1) is unique to the ingroup. This character is reversed in Clade 5 (State 0). States 2, 3, and 4 diagnose taxa within the external and internal outgroups. 50. Shape of A7 sternite. 0 : sternite unsclerotized, no defined shape, 1: goblet shaped, 2: M shaped, 3: shieldshaped, 4: rectangular, length perpendicular to the body, 5: parallelogram, 6: ovoid with x shaped posterior margin. (CI = 0.75, RI = 0.60). a) The shape of the A7 sternit e is useful for diagnosing species ( e.g. State 4, L. pholus ) and small species groups. This character will likely be helpful for future species level revisions. 51. Form of distal margin of the A7 sternite. 0 : deep concave indentation, extends more than a quarter the length of the A7 sternite, 1: margin approximately horizontal, 2: distal margin membranous, not possible to distinguish from A7/A8 intersegmental membrane, 3: crenellated, 4: shallow concave indentation,

PAGE 135

135 extends less than a quarter the length of t he A7 sternite, 5: convex, 6 : A7 distal margin elongated into 2 projections that encircle the ostium bursa. (CI = 0.75, RI = 0.67). a) A deep concave indentation on the distal margin of the A7 sternite (State 0) is unique to Clade 5. Within this clade, State 0 is modified once in L. fulgens (State 1). In addition, the variation in the form of the distal margin can be used to diagnose species ( e.g. State 6, P. ptychoglene ). 52. A8 sternite. 0: present, 1 : absent. (CI = 1.00, RI = 1.00). a) The absence of the A8 ster nite (State 1) is unique to the grotei clade and is not reversed in any of the taxa. 53. Form of A8 sternite. ?: does not apply, 0: heavily sclerotized plate, 1: reduced to a bar fused with A8 tergite, ventral break present, 2: reduced to a continuous scler otized bar, fused with A8 tergite, 3: semicircular lightly, sclerotized plate, anterior margin a sclerotized bar fused with A8 tergite, 4 : sclerotized plate with W shaped anterior margin, 5: sclerotized bar fused to A7 sternite and A8 tergite. (CI = 0.83, RI = 0.80). a) The variation in the form of the A8 sternite can be used to diagnose the smaller species groups ( e.g. State 0, pholus clade) and species ( e.g. State 3, P. ptychoglene). State 5 is unique to the basal taxa within Clade 5. The A8 sternite is completely absent in the grotei clade, which is found in Clade 5. 54. Location of the ostium bursa. 0: intersegmental membrane between A7/A8, 1: A8 sternite, 2: A7 sternite. (CI = 0.50 RI = 0.71). a) The ostium bursa is either found in the intersegmental membrane between A7/A8 (State 0) or the A8 sternite (State 1) within the ingroup. State 1 is found within the pholus clade and P. ptychoglene. Both of these states along with state 2 can be found in the outgroup taxa. 55. Placement of ostium bursa when it occurs in A8 sternite. ?: does not apply, 0: fused with anterior margin of A8 sternite, 1 : broad horizontal opening, centered in A8 sternite, extends over half the width of A8 sternite, 2: circular opening occurring anteriorly in A8 sternite, not fused with margin of A8 sternite, 3: narrow horizontal opening, centered in A8 sternite, extends less half the width of A8 sternite. (CI = 1.00, RI = 1.00). a) The placement of the ostium bursa in the A8 sternite can be used to diagnose species ( e.g. State 2, P. ptychoglene) and species groups ( e.g. State 1, pholus clade). State 0 defines the internal OG taxa Dolichesia and Talara. State 3 is autapomorphic for the internal OG taxon Lycomorphodes 56. Scl erotization of the ductus bursa. 0: present, 1 : absent. (CI = 0.20, RI = 0.43).

PAGE 136

136 a) The presence of sclerotization of the ductus bursa is homoplastic and is not phylogenetically useful without Character 57. 57. Location of the sclerotized portion of the ductus b ursa. ? : does not apply, 0: proximal to the ostium bursa, 1: not proximal to the ostium bursa, membranous break between ostium bursa and sclerotized portion of ductus bursa. (CI = 1.00, RI = 1.00). a) The presence of sclerotization of the ductus bursa that is not proximal to the ostium bursa (State 1) is unique to the grotei clade and is found in all members of the clade. 58. Corpus bursa. 0 : wrinkled, 1: smooth. (CI = 0.33, RI = 0.00). a) This character is no t phylogenetically useful. Most species have a wrinkled corpus bursa (State 0). A smooth corpus bursa (State 0) evolve independently twice in the ingroup ( L. fulgens and L. splendens ) and once in the internal OG ( Talara). 59. Corpus bursa. 0 : single, 1 : two bursae, connate, arising from ductus, 2: two separate bursae with common membranous duct. (CI = 1.00). a) Most species possess a single corpus bursa (State 0). State 1 is an autapomorphy of P. ptychoglene. State 2 is unique to Talara. 60. Signa number. 0: on e, 1 : two, 2 : three or more. (CI = 1.00, RI = 1.00). a) Most of the species examined posses two signa (State 1). L. splendens is diagnosed by the presence of one signum. State 2 is limited to the external OG. 61. Signa form. 0: slightly sclerotized plates with heavily sclerotized bars running perpendicular to the length of the plate, 1: elongate heavily sclerotized strips with internal spines. (CI = 1.00, RI = 1.00). a) This character (State 0) diagnoses the ingroup + internal OG clade. It is present in all members of the clade and undergoes no reversions. 62. Origin of the ductus seminalis. 0: ductus bursa, 1: corpus bursa, 2 : appendix bursa, 3: second corpus bursa. (CI = 0.60, RI = 0.00). a) The ductus seminalis arises from the ductus bursa (State 0) in most species exa mined. Within the ingroup, this state is modified once in P. morelosia (State 1). All four states are present in the outgroup taxa. State 3 is an autapomorphy of Talara. 63. Location of the ductus seminalis on the ductus bursa. ?: does not apply, 0: ventral, 1 : lateral, right side, 2 : lateral, left side, 3 : dorsal. (CI = 0.60, RI = 0.50).

PAGE 137

137 a) The location of the ductus seminalis on the ductus bursa is useful for diagnosing species ( e.g. State 3, L. fulgens ) and small species groups ( e.g State 1, grotei clade). T his character will likely be useful in future species level revisions. 64. Dorsal pheromone gland shape. 0: two triangular projections arising from a single opening, 1: square with elongations from each apical corner. (CI = 1.00, RI = 1.00). a) The presence of a dorsal pheromone gland that is composed of two triangular projections arising from a single opening (State 0) is unique to the ingroup and present in all members. 65. Form of the two triangular projections of the dorsal pheromone gland. ?: does not apply, 0 : broad triangles, width greater or equal to length of the triangle, 1: short, narrow triangles, length of triangle greater than the base but not more than two times greater. (CI = 1.00, RI = 1.00). a) Most members of the ingroup clade are diagnosed by State 0. State 1 is unique to the grotei clade. Characters examined but excluded from the analysis Several morphological characters were examined but were excluded from the final analysis. These characters showed no variation among species, the range of variation could not be coded into discrete states, or the character was variable among individuals within a single brood of a species. The two invariant characters arose from the thorax. They included the tarsal claw form and the length of the epiphysis. T he tarsal claw was simple in all of the taxa. The epiphysis was found to be short (less than twothirds the length of the tibia) in all species examined. These characters have been used in higher level studies of Arctiinae (Jacobson & Weller 2002; DaCosta & Weller 2005). The form of the tarsal claw was also included in a study of arctiine genera (Zaspel & Weller 2006). The form of the tarsal claw and the length of the epiphysis were found to be phylogenetically informative in the higher level studies (Jacobson & Weller 2002; DaCosta & Weller 2005). However, Zaspel & Weller (2006) found this the tarsal claw form to be highly homoplasious within

PAGE 138

138 the genus Virbia These findings along with the absence of variation within the species examined in this study suggest that these characters are informative for higher level phylogenetic studies. Several characters examined on the male & female genitalia were found to have a range of variation that could not be quantified into discrete states. On the male genitalia, the shape of the dorsal tegumen was examined. Within both Lycomorpha and Propyria the fusion between the two halves of the tegumen results in this structure occurring as a contiguous plate. Although the fusion has occurred, the halves of the tegumen can stil l be identified in several species through the presence of sutures that are visible on the dorsal surface of the tegumen. In some species, a raised node is present between the two halves of the tegumen. However, no landmarks could be identified on the male genital capsule to accurately describe the location of this node. Another character that was examined but excluded from the final analysis was the presence of a spine at the distal apex of the valvae. Within Lycomorpha and Propyria the valvae either taper to a sclerotized spine or a sclerotized spine is present at the distal apex. However, the valvae of all the species examined are sclerotized for the entire length. It is difficult to identify the margins of structures such as the sacculus and costa. Ther efore, it was not possible to determine whether the spines represented a homologous structure or several distinct structures. In the female genitalia, the shape of the ductus bursa was examined. Within some species the ductus bursa occurred as a narrow tube. However, in other species the width of the ductus bursa varied along its length. We were not able to quantify this variation within a single character state that was not continuous.

PAGE 139

139 Two characters were excluded because they were found to vary among in dividuals from a single brood. Comstock & Henne (1967) reared broods of the species L. regulus Through examination of this material it was found that within a single brood variation was present in form of the M3 and CuA1 vein in the hindwing and the number of frenular bristles present on the female hindwing. Members of this brood were found to have M3 and CuA1 arising separately from the discal cell or M3 and CuA1 were fused and stalk beyond the discal cell. Propyria has been distinguished from Lycomorpha by the latter form. The presence of both states within a single species of Lycomorpha suggests that this character can no longer be used to separate the two genera. Within this brood it was also found that the frenular bristle number varied between four an d five. In addition, both states were present on some specimens. Although the frenular number has previously been used in higher level studies (DaCosta & Weller 2005; Miller 1991), it would not be an informative character within this study unless a range o f values was coded as a single state.

PAGE 140

140 Table 41 Historical family treatment of Lycomorpha including authors, year, and their placement of the genus. Author(s) Harris 1839 Packard 1864, 1872 Druce 18811900 Edwards 1885, 1887 Schaus 1889 Dognin 1916 Edwards 1886 Neumogen & Dyar 1893 Dyar 1898 Hampson 1898, 1901 Zerny 1912 Draudt 1917 Forbes 1960 Hampson 1914 Comstock & Henne 1967 Family Zygaenidae Ctenuchidae Euchromiidae Syntomiidae Lithosiidae Amatidae

PAGE 141

141 Table 42. Species included in the phylogenetic analysis. CHS = specimen prepared by Clare H. Scott Genus species author Dissection Sex Collection Locality INGROUP Lycomorpha L. fulgens (Henry Edwards) CHS084 Male AMNH New Mexico, USA CHS088 Female AMNH Arizona, USA L. grotei (Packard) CHS079 Male LACM Colorado, USA CHS093 Female LACM California, USA L. miniata Packard CHS071 Male AMNH South Dakota, USA CHS051 Female AMNH Wyoming, USA L. pholus (Drury) CHS136 Male USNM CHS074 Female CMNH West Virginia, USA L. pulchra Dyar CHS076 Male CAS California, USA CHS095 Female SDNH California, USA L. regulus (Grinnell) CHS099 Male AMNH New Mexico, USA CHS102 Female LACM California, USA L. splendens Barnes & McDunnough CHS068 Male USNM Utah, USA CHS061 Female LACM Arizona, USA New sp. A CHS086 Male AMNH New Mexico, USA CHS060 Female LACM Arizona, USA New sp. B CHS128 Male USNM Texas, USA CHS129 Female CAS Texas, USA New sp. C CHS253 Male CMNH New Mexico, USA Propyria P. morelosia Schaus CHS196 Male USNM Mexico CHS247 Female AMNH Mexico P. normani Schaus CHS252 Male USNM Mexico P. ptychoglene Hampson CHS103 Male USNM Mexico CHS104 Female USNM Mexico

PAGE 142

142 Table 42. Continued Genus species author Dissection Sex Collection Locality OUTGROUP TAXA Dolichesia D. falsimonia Schaus CHS158 Male MCZ Panama CHS213 Female MCZ Panama Hypermaepha H. marionensis Schaus CHS163 Male CUIC Surinam CHS218 Female CUIC Surinam Hypoprepia H. fucosa Hbner CHS002 Male UWO Florida, USA CHS004 Female FLMNH Florida, USA Lyc o morphodes L. correbiodes Schaus CHS052 Male CMNH Ecuador CHS053 Female CMNH Ecuador Ptychoglene P. erythrophora Felder CHS121 Male USNM Mexico CHS122 Female USNM Mexico Talara T. coccinea Butler CHS055 Male CMNH Brazil CHS056 Female CMNH French Guiana

PAGE 143

143 Table 43 Character support for major ingroup clades. Abbreviation refers to the name given to the character in Appendix D. CI = consistency index. Clade Character #: Abbreviation State Change Character CI Clade 1. Ingroup 1: A1 0 to 1 0.67 2: A2 0 to 1 0.33 6: L1 0 to 1 1.00 9: AB1 1 to 0 0.50 10: MA1 0 to 1 0.50 11: MA2 0 to 1 1.00 17: MA8 0 to 1 1.00 27: CM1 1 to 0 0.50 29: PB2 0 to 1 1.00 32: ED2 2 to 0 0.67 33: J1 0 to 4 0.88 35: J3 3 to 0 0.80 36: VS1 0 to 2 0.67 37: IV1 1 to 0 1.00 38: BP1 0 to 2 1.00 40: PH1 1 to 0 0.25 49: FA2 0 to 1 0.80 51: FA4 2 to 1 0.75 55: OB2 0 to 1 1.00 64: PG1 1 to 0 1.00 Clade 2. pholus clade 24: UB2 0 to 2 1.00 26: US2 0 to 3 0.57 31: ED1 0 to 1 0.33 47: V6 0 to 1 0.50 50: FA3 2 to 1 0.75 Clade 3. Remaining Ingroup 2: A2 1 to 0 0.33 21: TF3 1 to 4 0.80 28: PB1 1 to 0 0.33 33: J1 4 to 7 0.88 34: J2 1 to 0 0.20 41: PH2 0 to 2 1.00 44: V3 0 to 4 1.00 51: FA4 1 to 0 0.75 53: FA6 0 to 3 0.83 55: OB2 1 to 2 1.00 Clade 4. Propyria 11: MA2 1 to 2 1.00 29: PB2 1 to 2 1.00 32: ED2 0 to 1 0.67 50: FA3 2 to 6 0.75 51: FA4 0 to 6 0.75 63: DS2 0 to 2 0.60

PAGE 144

144 Table 43. Continued Clade Character #: Abbreviation State Change Character CI Clade 5. morelosia + remaining Lycomorpha 25: US1 1 to 0 0.75 26: US2 0 to 1 0.57 49: FA2 1 to 0 0.80 53: FA6 3 to 5 0.83 54: OB1 1 to 0 0.50 56: DB1 1 to 0 0.20 Clade 6. grotei clade 12: MA3 1 to 0 0.50 24: UB2 0 to 3 1.00 28: PB1 0 to 1 0.33 52: FA5 0 to 1 1.00 57: DB2 0 to 1 1.00 63: DS2 0 to 1 0.60 65: PG2 0 to 1 1.00

PAGE 145

145 Table 44. Results of Outgroup Jackknife Analysis. Consistency Index (CI) and Retention Index (RI) rounded Outgroup Excluded Number of Trees Tree Length CI RI None 3 192 0.68 0.73 Dolichesia 9 190 0.67 0.70 Hypermaepha 6 175 0.70 0.75 Hypoprepia 9 191 0.68 0.69 Lycomorphodes 3 179 0.70 0.74 Ptychoglene 3 184 0.70 0.72 Talara 6 186 0.68 0.70

PAGE 146

146 Figure 41. Species mistakenly described as members of Lycomorpha and their current taxonomic placement. A) Ctenucha augusta (Henry Edwards) (Lepidoptera: Erebidae: Arctiinae: Arctiini). B) Neoalbertia constans (Henry Edwards) (Lepidoptera: Zygaenidae). C) Ptychoglene coccinea (Henry Edwards) (Lepidoptera: Erebidae: Arctiinae: Lithosiini).

PAGE 147

147 Figure 42. Lycomorpha species with red forewings and primarily black hindwings. A) L. fulgens B) L. grotei C) L. pulchra. D) L. regulus

PAGE 148

148 Figure 43. Strict consensus of 3 trees (L=192, CI=0.68, RI=0.71) resulting from the MP analysis of the MF matrix. Numbers above the branches are the Bremer support values for the nodes. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 149

149 Figure 4 4. Strict consensus of 3 trees (L=192, CI=0.68, RI=0.73) resulting from the MP analysis of the AS matrix. Numbers below the branc hes are the support values for the nodes: BS/JK. C1 C6 = Clade 1 Clade 6. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 150

150 Figure 45. Bayesian Inference consensus tree from the analy sis of the AS matrix. Numbers listed on the branches are the posterior probability support values. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria, Dotted line = outgroup taxa.

PAGE 151

151 Figure 46. Strict consensus of 9 trees (L=191, CI=0.68, RI=0.69) resulting from the exclusion of outgroup taxon Hypoprepia. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 152

152 Figure 47. Strict consensus of 3 trees (L=184, CI=0.7 0, RI=0.72) resulting from the exclusion of outgroup taxon Ptychoglene. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 153

153 Figure 48. Strict consensus of 6 trees (L=186, CI=0.68, RI=0.70) r esulting from the exclusion of outgroup taxon Talara. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 154

154 Figure 49. Strict consensus of 3 trees (L=179, CI=0.70, RI=0.74) resulting from the exclusion of outgroup taxon Lycomorphodes Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 155

155 Figure 410. Strict consensus of 6 trees (L=175, CI=0.70, RI=0.75) resulting from the exclusion of outgroup taxon Hypermaepha. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 156

156 Figure 411. Strict consensus of 9 trees (L=190, CI=0.67, RI=0.70) resulting from the exclusion of outgroup taxon Dolichesia Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 157

157 Figure 412. Strict conse nsus of 24 trees (L=198, CI=0.66, RI=0.71) resulting from constraining the monophyly of Lycomorpha. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 158

158 Figure 413. Strict consensus of 30 tre es (L=194, CI=0.67, RI=0.72) resulting from constraining the monophyly of Propyria Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 159

159 Figure 414. Male antennal flagellomeres. A) Lycomorphodes correbiodes ; simple, ciliate flagellomeres. B) Lycomorpha fulgens ; serrate flagellomeres. C) Lycomorpha splendens ; bipectinate flagellomeres. The scale bar is equivalent to 1mm.

PAGE 160

160 Figure 415. Female antennal flagellomeres. A) Lycomorpha gr otei ; simple, ciliate flagellomeres. B) Lycomorpha splendens ; serrate flagellomeres. The scale bar is equivalent to 1mm.

PAGE 161

161 Figure 416. State of gena. A) Lycomorpha pholus ; Ggena well developed, can be seen as a continuous band that joins the F frons. B ) Lycomorpha splendens ; Ggena reduced, cannot be seen as a continuous band. The scale bar is equivalent to 1mm.

PAGE 162

162 Figure 417. Labial palps. A) Hypermaepha maroniensis ; a ll segments fused. B) Lycomorpha splendens ; 2nd and 3rd segments fused. C) Lycomorpha pholus ; each segment separate. The scale bar is equivalent to 1mm.

PAGE 163

163 Figure 418. Forewing venation. A) Lycomorpha grotei ; R free to costal margin, does not anastomose with Sc. B) Dolichesia falsimonia ; R anastomoses with Sc. The scale bar is equivalent to 1mm.

PAGE 164

164 Figure 419. Hindwing venation. A) Hypoprepia fucosa; Sc+R vein present. B) Propyria ptychoglene; Sc+R vein absent. The scale bar is equivalent to 1mm.

PAGE 165

165 Figure 420. Second abdominal sternite. A) Lycomorpha pholus ; anterolateral process (ALP) that arises from A apodeme present as a SB sclerotized bar. B) Ptychoglene erythrophora; ALP that arises from A apodeme occurs as FLflattened lobe. C) Hypermaepha maroniensis ; ALP that arises from A apodeme present as SA shor t knob ALP The scale bar is equivalent to 1mm.

PAGE 166

166 Figure 421. A7/A8 androconia. A) Dolichesia falsimonis ; androconia absent from A7/A8 intersegmental membrane. B) Hypermaepha maroniensis ; TP two pockets of long hair like scales in A7/A8 intersegmental m embrane. C) Lycomorpha splendens ; SP shallow pocket of scales that is greater than 1/3rd the width of 7S seventh sternite. D) Propyria normani ; NP narrow pocket of scales less than 1/3rd the width of 7S seventh sternite. The scale bar is equivalent to 1mm.

PAGE 167

167 CHAPTER 5 A REVISION OF THE GENU S LYCOMORPHA HARRIS (LEPIDOPTERA: EREBIDAE: ARCTIINAE : LITHOSIINI) INCLUDING SPECIES FORM ER LY PLACED IN THE GENUS PROPYRIA HAMPSON (LEPIDOPTERA: EREBIDAE: ARCTIINA E: LITHOSIINI) Background Information The brightly colored species of the genus Lycomorpha Harris (Lepidoptera: Erebidae: Arctiinae: Lithosiini), which includes species formerly placed in Propyria Hampson, range from southeastern Canada to Panama. The adults typically possess either orange and black or red forewings. Species possessing either of these color patterns are hypothesized to form Mllerian mimicry complexes with other arctiine genera ( e.g. Ctenucha Kirby, Dycladia Felder, and Correbia Herrich Schffer), zygaenid moths, and lycid beet les (Forbes 1960 ; Simmons 2009). In addition to sharing similar color patterns with these chemically defended, diurnal taxa, adults of several species of Lycomorpha also exhibit diurnal flight activity. Although the species of Lycomorpha are well known for their bright color patterns, these patterns have also led to confusion over both the family placement and species composition of the genus. In order to address the confusion over the species composition of Lycomorpha, a phylogenetic study of the genus was completed (see Chapter 4). This study included representatives of seven species of Lycomorpha and three undescribed species. In order to test the generic limits of Lycomorpha, species placed in the lithosiine genera Propyria and Ptychoglene Felder were al so included. Draudt (1917) noted a similarity of color pattern and body shape among these three genera. Furthermore, species originally described within Lycomorpha have been transferred to both Propyria and Ptychoglene. The phylogeny that was recovered bas ed on adult morphology found that Lycomorpha was not reciprocally monophyletic with respect to the genus Propyria (Fig.

PAGE 168

168 5 1). However, Ptychoglene was found to be more closes related to the genus Hypoprepia Hbner, the species used to root the analysis. As a result of this analysis, Propyria (Hampson 1898) was placed as a junior synonym of Lycomorpha (Harris 1839) (see Chapter 4). Little is known of the biology of the species in the genus Lycomorpha The flight activity Lycomorpha pholus (Drury), the most w idely distributed species, has been studied. Fullard & Napoleone (2001) found that L. pholus was exclusively diurnal. Based on this finding, Muma & Fullard (2004) tested L. pholus to determine whether the tympanum was still functional. Since L. pholus is exclusively diurnal, the species is no longer under selection by bats to maintain functional tympana unless selected for by an alternative use. They found that L. pholus had low sensitivity to ultrasounds of the frequency produced by bats. However, L. pholus adults retained sensitivity to ultrasound frequencies in the range produced by the tymbal organ present on their metathorax. The authors suggest that the tympanum of L. pholus may be used in short range, social communication. This communication coul d occur during the courtship of female L. pholus Males of both Lithosiini and Arctiini have been found to use ultrasonic noises produced by their tymbal organs as part of their courtship ritual ( ern 1990, Conner 1999, Sanderford 2009). In addition, the larvae of L. pholus have been reared on Protococcus viridis algae and Physcia millegrana lichens (Wagner et al. 2008). Lycomorpha regulus (Grinnell) is the only other species in the genus where biological information besides that present on collection labels is available. Comstock & Henne (1967) reared several broods of this species on Parmelia lichens. They observed the adults flying during the day and feeding at flowers of Lepidospartum squamatum and

PAGE 169

169 Senecia douglasii In addition, they found that the fem ales oviposited in the crevices of rocks. Here a revision of the species of Lycomorpha is provided. A generic diagnosis and description of the genus is presented. In addition, a faunal treatment is given for fourteen of the twenty species currently placed in the genus. The inclusion of species was dictated by the availability of pinned material. Four of the species treated are formerly of the genus Propyria Three new species ( L. concolor Scott, L. neomexicanus Scott, and L. texanus Scott) are also treated for the first time. Each faunal treatment includes a diagnosis, description, and illustrations of diagnostic characters. The adult habitus is figured for both sexes ( Figs. 5 2 A H, 5 3 A H, 5 4 A H, 5 5 A H, 5 6A,B, and 5 7 ). A summary of life history info rmation is also provided. This summary is based on the literature and the data available on the collection labels. Taxonomic History of Lycomorpha and Propyria The genus Lycomorpha was originally described as a subgenus of Glaucopis Fabricius within Zygaenidae (Harris 1839). Sphinx pholus Drury was designated as the type species by monotypy. Harris (1839) also treated the arctiine genera Syntomeida Harris, Cosmosoma Hbner, and Ctenucha Kirby as subgenera of Glaucopis However, he noted that these four subgenera did not appear congeneric and might be raised to generic status when more was known of them. After this description, authors (Edwards 1881a, 1881b, 1882, 1884, 1885; Packard 1864, 1872; Druce 18811900) treated Lycomorpha as a genus of Zygaenidae until Edwards (1886) transferred the genus to the family Ctenuchidae, which is now a subtribe of Arctiini. However, the following year Edwards (1887) returned to treating Lycomorpha as a zygaenid genus. Neumogen & Dyar (1893) then transferred Lycomorpha to Euchromiidae, which is now a subtribe of

PAGE 170

170 Arctiini. However, some authors (Dognin 1916) continued to treat the genus as a zygaenid. Later Hampson (1898) transferred Lycomorpha to Syntomiidae. This family was later synonymized with Ctenuchidae. This placement was generally accepted (Zerny 1912; Draudt 1917) until Forbes (1960) transferred the genus to Lithosiini. In his description of Lycomorpha, Forbes noted that the loss of the Sc vein was the only character that supported the placement of Lycomorpha within Euchromiidae. Jacobson & Weller (2002) confirmed the placement of the genus within Lithosiini in their phylogenetic analysis of Arctiinae. Three genera have been synonymized with Lycomorpha: Anatolmis Packard, Prepodes Herrich Schf fer, and Propyria Hampson. In his description, Packard (1864) treated Anatolmis as member of Zygaenidae, and Anatolmis grotei Packard was designated as the type species by monotypy. Packard noted that Anatolmis was morphologically similar to Lycomorpha, wh ich he considered to be the sister taxa to Anatolmis Furthermore, he stated that both genera superficially resemble Lithosiini. Hampson (1898) later synonymized the two genera. However, no explanation was provided for this action. HerrichSchffer (1855) described Prepodes and designated Sphinx pholus as the type species by monotypy. However, this species was already designated as the type of Lycomorpha. The two genera were synonymized, and Lycomorpha was given priority as the older name. Hampson (1898) described Propyria and designated Propyria ptychoglene Hampson as the type species. Propyria was treated as a member of Syntomiidae, and Draudt (1917) noted similarities between Propyria Ptychoglene, a nd Lycomorpha. A phylogenetic analysis of the three genera

PAGE 171

171 found that Lycomorpha and Propyria were not reciprocally monophyletic. Scott (Chapter 4) synonymized the two genera. Throughout the shifts in family placement and the addition of synonyms, new spe cies have continued to be described in Lycomorpha. However, nineteen of the species that were originally described in the genus have been transferred to other genera within Lithosiini, Arctiini, and Zygaenidae. Bryk (1936) transferred ten of these species to three genera of Zygaenidae. An additional three species are considered incertae sedis Dyar (1898) did not consider two of these species, L, contermina Edwards and L. regia Schaus, to be members of Lycomorpha. However, he did not suggest alternative pla cements. In addition, no further mentions can be found of these species in descriptions of the species composition of Lycomorpha. Scott (Chapter 4) transferred the third species, L. nigridorsata Dognin, based on the original species description. In his des cription of L. nigridorsata, Dognin (1916) only compared this species to other species of Lycomorpha that have been transferred into zygaenid genera. The taxonomy of Lycomorpha has been confused by the wing color patterns of the adults. These patterns led to the placement of the genus in several families that are known for being composed of brightly colored individuals. Furthermore, the use of this color system instead morphological characters led to species being mistakenly described as members of Lycomor pha. Below a synonymic checklist is provided that includes all species currently placed within Lycomorpha. A list, which includes the species that have been transferred from the genus, is available in Chapter 4.

PAGE 172

172 Synonymic Checklist of the Genus Lycomorpha In this checklist, the species names are arranged in alphabetical order. Valid species names are in bold and synonyms are in italics. If a species was originally described in a genus other than Lycomorpha, the original generic name follows the authors nam e. The location where the type specimen of a species was collected is provided in parentheses following the original generic name. An asterisk (*) following a name indicates the type specimen of that species was examined. Genus Lycomorpha Harris, 1839 Anatolmis Packard, 1864 Prepodes Herrich Schffer, 1855 Propyria Hampson, 1898 atroxantha (Schaus, 190 6 ) Propyria ( Mexico ) concolor Scott n. sp. (Arizona) criton (Druce, 18811900) Cisthene ( Guatemala) coatepeciensis (Strand, 1920) Propyria ( Mexico ) a hypoleuca (Draudt, 1917) Propyria ( Mexico ) orizabae* (Strand, 1920) Propyria ( Mexico ) flora (Schaus, 1911a) Propyria ( Costa Rica ) fridolini a (Schaus, 1925) Propyria ( Guatemala) fulgens (Henry Edwards, 1881b) Anatolmis ( Arizona) tenuimargo* (Holland, 1903) Ptychoglene ( Arizona, Mexico) tenumargo authors, misspelling grotei (Packard, 1864) Anatolmis ( Colorado) palmerii Packard, 1872 ( Arizona)

PAGE 173

173 miniata Packard, 1872 ( Southern California) morelosia (Schaus, 1925) Propyria ( Mexico ) neomexicanus Scott n. sp. (New Mexico) normani (Schaus, 1911b) Propyria ( Costa Rica ) pelopia (Druce, 18811900) Talara ( Panama ) pholus (Drury, 1773) Sphinx ( New England) ptychoglene (Hampson, 1898) Propyria ( Mexico, Guatemala) aequalis (Walker, 1854a) Lithosia ( Guatemala) sinuata (Henry Edwards, 1885) ( Mexico ) pulchra Dyar, 1898 ( Texas ) regulus (Grinnell, 1903) Anatolmis ( California ) schausi Dyar, 1898 ( New Mexico, Arizon a) splendens Barnes & McDunnough, 1912 ( Utah ) strigifera Gaede, 1926 ( Mexico ) t exanus Scott n. sp. (Texas) Materials and Methods Material Examined This revision was based on the examination of 1,997 pinned specimens. To examine the species limits, 143 dissections of the genitalia of the fourteen species described below were completed. The label data was copied exactly for each specimen that was dissected. Each specimen was assigned a unique dissection voucher number. This voucher number was placed on the pin with the remaining moth body. Another copy of the voucher number was kept with the genitalia being dissected. A voucher number beginning with eit her CHS or CHS PC indicates that Clare H. Scott completed

PAGE 174

174 the dissection. In addition, specimens from the USNM were assigned a unique dissection number, which is associated with the slide prepared for that dissection. This number was also provided in the s pecimens examined section of each species description. The following is a list of institutions that were consulted for this study. The list includes both the name of each collection and an acronym for each. The name of the individual(s) that prepared the loan follows this information. Acronyms follow Heppner & Lamas (1982): American Museum of Natural History (AMNH) (D. Grimaldi), California Academy of Sciences (CAS) (N.D. Penny), Carnegie Museum (CMNH) (J. Rawlins), Canadian National Collection, Agricultur e Canada (CNC) (C. Schmidt), Cornell University Insect Collection (CUIC) (J. Liebherr, E.R. Hoebeke), Florida Museum of Natural History, University of Florida (FLMNH) (J. Miller, D.M. Lott, A.D. Warren), Los Angeles County Museum of Natural History (LACM) (W. Xie), Museum of Comparative Zoology, Harvard University (MCZ) (R. Eastwood, P.D. Perkins), Museum of Southwestern Biology (MSB) (D. Lightfoot), National Museum of Natural History, Smithsonian Institution (USNM) (D.G. Furth, D. Harvey), Peabody Museum o f Natural History, Yale University ( YPM ) (L.F. Gall), San Diego Natural History Museum (SDNH) (M.A. Wall), Texas A&M University Insect Collection (TAMU) (E.G. Riley), Essig Museum of Entomology, University of California, Berkeley (UCB) (J. Powell), Univers ity of Minnesota, St. Paul (UMSP) (R. Holzenthal) Morphology Dissections of the genitalia were prepared after softening the abdomens in a warm 10% potassium hydroxide (KOH, Fisher Scientific, Pittsburg, PA) solution for 30 minutes to 1.5 hours using standard methods (Winter 2000). The scales and viscera

PAGE 175

175 were removed from the abdomen in several rinses of 20% ethanol using fine watercolor paintbrushes (# 000 2). Structures were stained with a solution of chlorazole black E ter. Specimens were viewed in 20% ethanol and stored temporarily in 70% ethanol. Subsequently the abdominal pelts and genitalia were either stored in vials of glycerol or permanently slide mounted in Euparol (Bioquip, Garden City, CA). The final preparatio n method used was dependent on the preference of the collection from which the material originated The wing veins of Lycomorpha species are well developed. Therefore, it was not necessary to remove the wings and clear them using bleach. Instead, the venat ion was viewed by adding one to two drops of 95% ethanol to the wing The external morphology of the dried pinned specimens was examined using a Nikon SMZ800 light microscope. The terminology for male and female genitalia follows Klots (1970) and Forbes ( 1939 b 1954) The terminology for the wing venation follows Kristensen (2003). Illustrations of the external morphology and male and female genitalia were completed using a camera lucida associated with a Leica MZ16 light microscope. The pencil drawings p roduced were scanned and saved as PDFs that were imported into Adobe Illustrator CS5 and then inked using the pen tool. The purpose of stippling in any figure is explained in the figure legend Illustrations are provided for all diagnostic characters In a ddition, when a form of a morphological character was present in more than one species, a single illustration was produced and referenced more than once. Species Descriptions The species placed within Lycomorpha are not sexually dimorphic. There are slight size differences between males and females. Characters from the external morphology, as well as the male and female genitalia were used to diagnose species.

PAGE 176

176 Phenotypically similar species were primarily separated using male and female genitalia characters. However, it was difficult to separate some species using these characters. In addition, variation was present in the wing color pattern of individuals reared from a single brood. However, studies of these brood s made it possible to determine elements of the wing color pattern that were constant throughout a species. When describing elements of the wing color pattern the terminology for the typical noctuid ground plan (Powell & Opler 2009) was used. Although Ferg uson (1985) proposed a wing pattern terminology specific to Arctiinae, homologous pattern elements cannot be identified within Lycomorpha. The colors of the specimens were described using the Naturalists Color Guide (Smith 1975). Images illustrating the adult habitus were taken using an Olympus Camedia C 5500 Zoom digital camera. Systematic Entomology of the Genus Lycomorpha Order LEPIDOPTERA Family EREBIDAE Subfamily ARCTIINAE Tribe LITHOSIINI Genus Lycomorpha Harris Lycomorpha Harris, 1839: p. 317. Type species: Sphinx pholus (Drury, 1773). Anatolmis Packard, 1864: p. 45 Prepodes Herrich Schffer, 1855: pp. 100,101 Propyria Hampson, 1898: p. 521 Diagnosis (Figs. 5 2 A H, 5 3 A H, 5 4 A H, 5 5 A H, 5 6A,B, and 5 7). The adults of this genus are medium sized lithosiines with a forewing length of 11mm to 16.1mm (N = 13) in the males and 11.7mm to 15.5mm (N = 12) in the females. The

PAGE 177

177 male antennal flagellomeres are typically serrate (Fig. 5 8A) The female antennal flagellomeres can be either simple and ciliate or serrate (Figs 5 9A,B) In both sexes, the antennae are dilated in the middle. There are two primary wing color patterns within the genus: 1) a red forewing with a primarily black hindwing and 2) a forewing with an orange or red basal half and a black distal half and a black hindwing with the adbasal region the same color as the basal half of the forewing. Individuals of both wing color patterns form mimicry complexes with other genera of Arctiinae and beetles of the family L ycidae. Four autapomorphies can be used to separate Lycomorpha from other Lithosiini: 1) a tibial spur formula of 02 3, 2) a shallow pocket of sex scales in the intravincular membrane of the male genital capsule, 3) the absence of a caecum on the basiphal lus, and 4) a dorsal pheromone gland shaped like a square with elongations arising from each of the cephalic corners. Description Adult Habitus (Figs. 5 2 A H, 5 3 A H, 5 4 A H, 5 5 A H, 5 6A,B, and 5 7): Head: The color is typically uniform and varies fr om dark gray brown (Fig. 55C) to a dark brown that appears almost black (Fig. 54C). The scales covering the gena of some species are the same color as the patagia and forewing (Fig. 57). Typically, none of the three labial palp segments are fused (Fig. 5 10A) Thorax: The patagia are typically the same color as the red or orange color present on the forewings (Figs. 5 2A,B). The color of the tegulae and dorsal mesothorax is either the same as the head (Fig. 52C) or matches the color present on the patag ia (Fig. 5 2B). The dorsal metathorax is always the same color as the head. Tymbal organs are always present in both the males and females. Forewing: The R and Rs1 4 veins are all present with a branching pattern of R; Rs1; (Rs2 (Rs3, Rs4)). The M1M3 vein s are present. The M2 and

PAGE 178

178 M3 veins arise separately from the discal cell or are fused and stalk beyond the cell (Figs 5 11A,B) Both states are found in some species. Hindwing: The Sc + R vein and the M2 vein are absent throughout the genus. The M3 and CuA1 veins arise separately from the discal cell or are fused and stalk beyond the discal cell (Figs 5 12A,B) The wing color pattern of the fore and hindwings is one of two main types discussed in the diagnosis. Abdomen: The color of the abdomen is a dark br own that is the same as the color of the head and dorsal metathorax (Figs 5 2 A H) The anterolateral process is typically present as a sclerotized bar (Fig 5 13A). A single pouch of androconial scales is present in the A7/A8 intersegmental membrane of males (Figs 5 14A,B) In addition, a pouch of androconial scales is present in the A8/A9 intersegmental membrane of some species. The variation in the sclerotization of the eighth tergite and the form of the cephalic margin of the eighth sternite are specifi c to species groups. Male Genitalia: Phallus: The caecum is always absent from the basiphallus, which is typically straight without inflections. A phallic sclerite is present in most species and variation is present in the shape: rectangular ( L. splendens ) narrow, rounded triangle ( L. grotei ), narrow, pointed triangle ( L. pulchra), and flattened lobe that extends dorsad over the vesica ( L. pholus ). The membrane of the vesica is smooth, and the primary lobe is typically ornamented with at least one membranous projection and a heavily sclerotized, spine like cornutus. The placement of the projection(s) and cornutus are typically species specific. Genital Capsule: The two halves of the tegumen are fused for their entire length. A suture is present on the tegum en indicating the location of the fusion. The shape and location of the suture is species specific. The uncus base is always separated from the tegumen by membranous tissue. The curvature of the uncus is

PAGE 179

179 either C shaped ( L. splendens ) or S shaped ( L. conco lor ). The distal end of the costa is either defined by the presence of a processus basalis of the costa ( L. morelosia) or a membranous break in the dorsal edge of the valve ( L. neomexicanus ). The costa and sacculus are fused into a contiguous structure. The distal end of the valve tapers to a point ( L. grotei ) or a spine ( L. ptychoglene) that is perpendicular to the length of the valve and oriented toward the uncus. The shape of the juxta and its ornamentation with transparent patches is generally species s pecific. The vinculum/saccus are typically M shaped. Female Genitalia: The seventh abdominal segment is heavily sclerotized. The sclerotization is either continuous around the segment ( L. concolor ) or membranous breaks occur on the pleurites ( L. pholus ). T he shape of the seventh sternite is variable: goblet shaped ( L. pholus ), inverted M shaped ( L. concolor ), shield shaped ( L. splendens ), rectangular, perpendicular to the length of the body ( L. miniata), parallelogram shaped ( L. fulgens ), and ovoid with X shaped posterior margin ( L. ptychoglene). The ostium bursa is located in either the A7/A8 intersegmental membrane ( L. grotei ) or the eighth sternite ( L. texanus ). The ductus bursa is typically unsclerotized. The shape of the ductus bursa is species speci fic. Typically only a single corpus bursa is present. The membrane of the corpus bursa is typically wrinkled and ornamented with two signa, which occur on opposite sides of the corpus bursa. The signa are lightly sclerotized, ovoid plates with heavily sclerotized bars occurring perpendicular to the length. Discussion. A wide variation of the color red is present on the fore and hindwing of species that possess the red forewing and primarily black hindwing phenotype (Figs. 5 2 F J and 53A,B). The color can vary from a deep red to a light yellow orange. This

PAGE 180

180 variation appears to be due to the age of the specimen and cannot be associated with the location where the specimen was collected. In addition, a wide range of phenotypic variation is present within individuals from a single brood. The broods reared by Comstock & Henne (1967) help to define the phenotypic variation present within L. regulus In addition, this series was valuable in determining the species boundaries of L. grotei L. pulchra, and L. regulus These three species all possess the same wing color pattern phenotype. Comstock & Henne (1967) and Powell & Opler (2009) suggested these species be studied to determine their systematic and taxonomic relationships. The male and female genitalia are useful for separating species that possess similar wing color patterns. In the male genitalia, the shape of suture on the tegumen and the shape of the valve are typically species specific. Within the female genitalia, the shape of the eighth sclerite and the ductus bursa are helpful in separating species with similar wing color phenotypes. These moths are often found misplaced in uncurated Zygaenidae and Arctiini. Adult Lycomorpha do not possess either ocelli or chaetostomata. Both of these structures are well developed in Zygaenidae, and their absence can be used to separate Lycomorpha from Zygaenidae. The absence of ocelli and tympanal hoods can be used to separate Lycomorpha from Arctiini. In addition, pleural sclerites are present on the male genital caps ule of Lycomorpha. This structure is absent throughout Arctiini. Lycomorpha atroxantha (Schaus) Fig. 5 2A (female). Propyria atroxantha Schaus 1906: 193194 [type locality: Cuesta de Misantla, Vera Cruz, Mexico]

PAGE 181

181 Material examined. Type material: Holotype of L. atroxantha: Propyria atroxantha Schaus, Cuesta de Misantla, Vera Cruz, Mexico, Cat. No. 8516, USNM Specimen preparations. All material from USNM unless otherwise noted: GUATEMALA: Alta Verapaz : Tactic, viii, Schaus and Barnes collection ( 1 female, CHS254, USNM 127,737). Diagnosis Lycomorpha atroxantha can be confused with L. pholus L. pelopia, and L. texanus The geographic distribution of L. atroxantha can be used to separate it from both L. pholus and L. texanus Lycomorpha axtroxantha has been collected from Mexico, Guatemala, and Costa Rica. Both L. pholus and L. texanus are restricted to North America. The tibial spur formula and thoracic color pattern can be used to separate L. atroxantha from each of the previously mentioned species. The tibial spur formula of L. atroxantha is 0 2 2, whereas L. pholus L. pelopia, and L. texanus have a tibial spur formula of 02 3. In addition, a stripe of orange yellow scales extends down the middle of the dorsal thorax in L. atroxantha. However, the dorsal surface of the thorax of L. pholus L. pelopia and L. texanus is composed only of dark brown scales. Description Female habitus (Fig. 5 2A ): Head : Scales on the dorsal portion of the head, clypeus, antennae, and labial palps fuscous (21) colored. The ant ennae are serrate. No fusion occurs among the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile. The scales on the gena and frons are trogon yel low (153) colored. Thorax : The tegulae are covered with a mixture of spectrum orange (17), orange yellow (18), and trogon yellow (153) colored scales. The patagia are raw umber (223) colored with orange yellow scales present around the margin. The dorsal thorax is

PAGE 182

182 covered with raw umber colored scales. A stripe of orange yellow scales is found in the center of the thorax. The stripe extends from the under the patagia to the posterior margin of the mesothorax. The ventral thorax and legs are fuscous (21) colored. The tibial spur formula is 0 2 2 Forewing: Length = 12mm (N = 1); M2 and M3 fused and stalk beyond the discal cell. Dorsal surface: The basal half of the wing is trogon yellow (153) colored. In the basal half of the wing, mars brown (223A) and raw umber (223) colored scales are intermixed with the trogon yellow scales within the discal cell, between the CuA1 and A1 veins, and posterior to the A1 vein. The distal half of the wing is fuscous (21) colored. The internal margin of the distal half of the wing is curved convexly towa rds the wing base and serrate. The margin is indented by trogon yellow scales that line the A1 vein for onethird the width of the fuscous coloring, the CuA2 vein base, and the remainder of the posterior margin of the discal cell to the point where the M2 + M3 and CuA1 veins arise. Dark grayish brown (20) colored scales line the posterior margin of the wing. These scales extend to the wing base. Ventral surface: The wing is warm buff (118) colored. A hair brown (119A) colored band (3 5mm wide) occurs along the outer margin of the wing. The interior margin of this band is curved convexly towards the wing base and smooth Hindwing : CuA1 and M3 fused and stalk beyond the discal cell. Dorsal surface: The wing is orange yellow (18) colored. A raw umber colored marginal band is present. The interior margin of the band is sinuate. The band extends from the apex of the wing to the anal angle. Raw umber colored scales occur intermittently along the posterior margin of the wing. Ventral surface: The pattern is the sa me as the dorsal surface. The wing color is the same as the dorsal surface. The marginal band is hair brown colored. H air brown colored scales do not occur along the

PAGE 183

183 posterior margin of the wing Abdomen: Dorsal and lateral scales raw umber (223) colored. Ventral scales are fuscous (21) colored. Female genitalia: The heavy sclerotization of the seventh abdominal segment is continuous without any membranous breaks. The seventh sternite is shaped like an inverted M. On the distal margin of the seventh sternit e, a deep, concave indentation, which extends more than threequarters the length of the sternite, is present. The eighth sternite is present as an ovoid, heavily sclerotized plate whose surface is wrinkled. The distal margin of the plate extends ventrad o f the papillae anales. The ostium bursa is located in the membrane between eighth sternite and the papillae an a les. The opening is adjacent to the distal margin of the eighth sternite. The ductus bursa is equal to or longer than the length of the seventh t ergite. The ductus bursa is tube shaped and straight. A rounded bulge is present at the midpoint of the ductus bursa on the left side The ductus bursa is not sclerotized. The ductus seminalis arises from the lateral, left side of the ductus bursa The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone glands are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection. Variation Only one female specimen was available from this species. The specimen is congruent with the original holotype. Biology Unknown.

PAGE 184

184 Distribution Based on label data, this species has been collected from Mexico, Guatemala, and Costa Rica. Lycomorpha concolor Scott New Species Figs. 5 2B,C (female); Figs. 5 2D,E (male). Material examined. Type material: Holotype: AZ: Cochise Co., Chiricahua Mountains, East Turkey Creek, 6400, 6.vii.1966, J.G. Franclemont, CUIC. Paratypes: UNITED STATES: Arizona: Cochise Co., Chiricahua Mountains, East Turkey Creek, 6400, 6.vii.1966, J.G. Franclemont, CUIC; Santa Cruz Co., Santa Rita Mts., Madera Canyon, 4880, 11.vii.1960, CUIC (1 female, CHS PC082); Santa Cruz Co., Santa Rita Mts., Madera Canyon, 5800, 8.vii.1960, CUIC (4 females, 1 male); Santa Cruz Co., Santa Rita Mts., Madera Canyon, 4880, 12.vii.1960, CUIC (1 female (CHS PC081), 2 males); Santa Cruz Co., Santa Rita Mts., Madera Canyon, 4880, 10.vii.1960, CUIC (1 female) Specimen preparations. All material from USNM unless otherwise noted: UNITED STA TES : Arizona : Cochise Co., Chiricahua Mts., Pinery Canyon, Upper Camp, 4.vii.1956, LACM (1 male, CHS059); Cochise Co., Chiricahua Mts., Pinery Canyon, Upper Camp, 6.vii.1956, Collected by Lloyd M. Martin, John A. Comstock, and William A. Rees, LACM (1 fe male, CHS060); Cochise Co., Chiricahua Mts., 17.vii (1 female, CHS090, USNM 127,711); Chircahua Mts., July, A. Twomey, Carn. Mus. Acc. 12518, CMNH (1 male, CHS085); Santa Cruz Co., Madera Cyn., 15.vii.1972, Joseph Cicero Coll. (1 female, CHS PC076) New M exico: Catron Co., Bursum Camp, 18 miles E. Alma, 9000ft., 11.vii.1961, F., P. & J. Rindge, AMNH (1 male, CHS086). Etymology The species is named in reference to the similarity between its wing color patterns and those of L. fulgens In museum collection, these two species are generally found in the same drawer, and both will be labeled as L. fulgens

PAGE 185

185 Diagnosis The males and females of L. concolor can be confused with the L. ptychoglene and the darker color forms of L. fulgens and L regulus Lycomorpha concolor can be separated from L. ptychoglene based on size and geographic distribution. The forewing of male L. concolor is five millimeters longer than that of L. ptychoglene. The female forewing of L. concolor is two millimeters lo nger. Furthermore, L. concolor and L. ptychoglene are geographically isolated from each other. Lycomorpha concolor occurs in southeastern Arizona and is a stray into southwestern New Mexico. Lycomorpha ptychoglene occurs from Mexico to Guatemala. The geogr aphic distributions of L. concolor L. fulgens and L. regulus overlap, and the size difference among the three species is not as pronounced. However, the gena of L. concolor is reduced unlike L. fulgens and L. regulus which both possess a well developed gena. In addition, characters from the male and female genitalia can be used to separate the L. concolor from L. fulgens and L. regulus A narrow, rounded triangle shaped phallic sclerite is found in L. concolor In L. fulgens the phallic sclerite is abse nt or highly reduced. The heavily sclerotized, spinelike cornutus occurs at the distal end of the primary lobe of the vesica of L. concolor but the spinelike cornutus of L. fulgens occurs at the distal end of the membranous projection that arises from t he primary lobe of the vesica. The processus basalis of the costa present in L. concolor occurs as a short dorsoventrally flattened lobe, whereas in L. fulgens the processus basalis is present as an elongate spine that tapers to a point. Lycomorpha concolor has a spadeshaped apex of the uncus that tapers to a point. However, the apex of the uncus in L. fulgens is finger like and does not taper to a point. From the female genitalia, a deep, concave indentation occurs in the distal margin of the seventh sternite

PAGE 186

186 of L. concolor whereas the margin of the seventh sternite of L. fulgens is without any noticeable indentations. The basiphallus of L. concolor is inflected dorsally at the distal end curving away from the venter, whereas the basiphallus of L. regulus is straight. On the vesica of L. concolor the membranous projection arises from the right side of the primary lobe, midway down the length. However, in L. regulus the projection is found at the distal end of the primary lobe of the vesica at the r ight apex. A processus basalis of the costa is absent in L. regulus In addition, the apex of the uncus in L. regulus is ovoid (teardrop shaped) not spade shaped as in L. concolor Lycomorpha concolor retains an eighth sternite in the female genitalia. How ever, the eighth sternite is absent in L. regulus Description Male habitus (Fig. 5 2D ): Head : The head, antennal scales, and labial palps are sepia (119) to hair brown (119A) colored. The antennae are serrate. There is no fusion among the labial palp seg ments. The gena is reduced and cannot be seen as a continuous band around the eye when viewing the head in profile. The genal scales are salmon (106) colored Thorax : The tegulae, patagia, and dorsal mesothorax are burnt orange (116) to flesh ocher (132D) colored. The dorsal metathorax, all of the ventral thorax, and the legs are sepia (119) to hair brown (119A) colored. Forewing: L ength = 16.1mm (N = 10); M2 and M3 arise separately from the discal cell. Dorsal surface: The wing is Pratts rufous (140) to f lesh ocher (132D) colored. The fringe of the wing is sepia to hair brown colored. Ventral surface: The wing is Pratts rufous (140) to salmon (106) colored. Below the A1 vein the scales are warm buff (118) colored. The fringe is sepia to hair brown colored. A few sepia to hair brown colored scales are scattered along the distal end of the A1 vein Hindwing : CuA1 and M3 arise separately

PAGE 187

187 from the discal cell. Dorsal surface: The wing is fuscous (21) to hair brown colored. A warm buff (118) colored band costal band is present. The band arises at the wing and extends along the costal margin. This band tapers to a point adjacent to where the Rs vein terminates at the costal marg in. The costal band is broadest in the proximal third of the wing where it stretches from the costal margin to the posterior margin of the discal cell. The posterior margin of the band is smooth except for a single serration that terminates in the proximal third along the posterior margin of the discal cell. Geranium pink (13) colored scales are present along the serration of the band. Ventral surface: The pattern is identical to the dorsal surface. The wing is fuscous to hair brown colored. The costal band is Pratts rufous (140) to salmon (106) colored. Abdomen: Dorsal, lateral, and ventral scales are sepia (119) to hair brown (119A) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is one third or more the width of A7 sternite. The scales in the pocket are drab (27) colored. A small shallow pocket of androconial scales is located in the center of the A8/A9 intersegmental membrane The scales in the pocket are hair brown (119A) colored. The ceph alic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternite and tergite. The pattern of sclerotization on the eighth tergite is heart shaped Female habitus (Fig. 5 2B ): Head : Th e color of the head, antennal scales, labial palps and gena the same as the male. The antennae are simple and ciliate. The fusion of the labial palp segments and the development of the gena are the same as the male. Thorax : The tegulae, patagia, and dorsal mesothorax are flesh ocher (132D) colored. The dorsal metathorax, all of the ventral thorax, and legs are sepia (119) to hair brown (119A) colored.

PAGE 188

188 Forewing: Length = 14.1 (N = 10); venation the same as the male. Dorsal surface: The wings are Pratts rufo us to flesh ocher colored. The fringe is sepia to hair brown colored. The posterior margin is sometimes narrowly lined with sepia to hair brown colored scales. Breaks may be present in these scales, or they may be absent entirely. Ventral surface: The patt ern is the same as the dorsal surface. The wing is Pratts rufous (140) to salmon (106) colored. Below the A1 vein the scales are warm buff (118) colored. The fringe is sepia to hair brown colored. Sepia to hair brown colored scales occur intermittently al ong the posterior margin of the wing. Hindwing: Venation is the same as the male. Dorsal surface: The pattern and colors are the same as the male. Ventral surface: the pattern and colors are the same as the male. Abdomen: Color of the dorsal, lateral, and ventral scales the same as the male. Male genitalia : Phallus : The basiphallus is inflected dorsally at the distal end curving away from the venter. When the phallus is viewed from the left side, the phallic sclerite is present as a narrowed, rounded triang le. The vesica is composed of a single primary lobe with an unornamented, membranous projection arising medially on the right side of the vesica. The distal end of the vesica is ornamented with a single heavily sclerotized, spinelike cornutus Genital cap sule : The tegumen is square with concave indentations on the proximal and distal margin. A V shaped suture that indicates where fusion occurred between the two halves of the tegumen extends from the proximal to distal margin of the tegumen. A triangular shaped knob occurs between the two halves of the tegumen. The knob is contained within the margins of the suture. The apex of the triangle is oriented toward the proximal margin of the tegumen. Narrow, sclerotized strips of tissue occur on the lateral margins of the uncus base. The uncus has an S shaped curve. The

PAGE 189

189 base of the uncus teardrop shaped and narrows adjacent to the apex of the uncus. The apex of the uncus is spade shaped tapering to a point. The distal end of the costa of the valve is defined by a processus basalis of the costa. The processus basalis of the costa occurs as a short dorsoventrally flattened lobe. An editum is found at the cephalic end of the costa but does not extend onto the processus basalis of the costa. The valve is triangular shaped with the ventral margin rounded not pointed. The distal end of the valve tapers to a sclerotized spine that is oriented inward and perpendicular to the length of the valve. The juxta is triangular shaped with a conical tip at the distal end. The juxta is not ornamented with any transparent patches at the proximal margin. Female genitalia: The heavy sclerotization of the seventh abdominal segment is continuous without any membranous breaks. The seventh sternite is shaped like an inverted M. On the distal margin of the seventh sternite, a deep, concave indentation, which extends more than a quarter the length of the sternite, is present. The eighth sternite is present as a sclerotized bar that fuses with the eighth tergite and the seventh sternite. The ost ium bursa is located in the A7/A8 intersegmental membrane below the apex of the concave indention in the seventh sternite. The ductus bursa is shorter than the length of the seventh tergite. It is ribbon shaped proximal to the ostium bursa and the base of the corpus bursa. Between these areas it expends to form a triangular shaped bulb. The ductus bursa is sclerotized proximally to the ostium bursa. The ductus seminalis arises from the ventral side of the ductus bursa. The membrane of the single corpus burs a is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone glands are

PAGE 190

190 square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection. Variation The color patterns on the head and thorax of male and female L. concolor collected in Madera canyon (Figs. 52C,E) differ from the holotype (Fig. 52D). Both sexes have genal scales that are sepia (119) to hair brown (119A) colored. In both sexes, the only portion of the thorax that is redorange colored is the tegulae. In the male, the tegulae are burnt orange (116) to flesh ocher (132) colored. In the female, the tegulae are Pratts rufous (140) to burnt orange (116) colored. The patagia and dorsal thorax of both sexes are sepia to hair brown colored. The coloring of the vent ral thorax and legs is congruent with the holotype. A male L. concolor collected from Redington, Arizona has a sepia colored terminal band with a hair brown colored fringe. The band is 2mm wide at the apex of the wing No variation in size was observed for male or female specimens. Biology All specimens of L. concolor were collected in July. No other information is known about the biology of this species Distribution With the exception of one specimen, this species is only found in Arizona. It has been c ollected from two distinct locations within the state: Chiricahua Mountain Range (Cochise Co.) and Madera Canyon (Santa Cruz Co.) Both locations occur within the Coronado National Forest. However, the two locations are in separate stands of the forest. One specimen was collected in Catron Co., New Mexico. This county is located on the southwest edge of the state adjacent to Arizona. Lycomorpha fulgens (Henry Edwards) Figs 5 2 F H (female ); Figs 5 2I,J and Figs 53A,B (male).

PAGE 191

191 Anatolmis fulgens Henry Edwards 1881b: 116 [type locality: Prescott, Arizona, USA ] Ptychoglene tenuimargo Holland 1903: 110 [type locality: Arizona, USA ] Material examined. Type material: Holotype of L. fulgens : Anatolmis fulgens Henry Edwards, Prescott, Arizona, AMNH. Holotype o f a synonym of L. fulgens : Ptychoglene tenuimargo, Type Holland, 3.ix, Arizona Moth Book, Plate XIII, Fig. 17, CMNH. Specimen preparations. All material from USNM unless otherwise noted : UNITED STATES : Arizona: Redington, 15.ix.1902, M. Chrissman, Holland Collection, CMNH (1 female, CHS044); Graham Mt., 28.viii.1933, Parker Lot, LACM (1 male, CHS083); Pima Co., Tucson, Mt. Lemmon, Elev. 8000, 28.viii.1965, leg. J.H. Hessel, AMNH (1 female, CHS088); Cochis Co., Huachuca Mts., Ramsey Canyon, 5400, 9.vii.1959, LACM (1 female, CHS089). Colorado: Garcia, 12.ix.1898, Holland Collection, CMNH ( 1 male CHS034 ) ; Garcia, 3.ix.1898, Holland, CMNH (1 female, CHS087) New Mexico: Socorro Co., W slope of San Mateo Mts., Wet Red Cyn., 7500ft., uv, 14.ix.1985, R. Holland, AMNH (1 male, CHS084). UNLABELED: 1 male, CHS050, USNM 127,706; 1 female, CHS057, USNM 127,708. Diagnosis Lycomorpha fulgens can be confused with L. concolor L. ptychoglene, and L. regulus As discussed in the diagnosis of L. concolor characters from t he head and male and female genitalia can be used to separate L. fulgens from L. concolor Characters from the genitalia can be used to separate L. fulgens and L. ptychoglene. The basiphallus of L. fulgens is inflected dorsally at the distal end, whereas there is no curvature of the basiphallus in L. ptychoglene Lycomorpha fulgens has a single membranous projection that arises from the right side of the primary lobe of

PAGE 192

192 the vesica. However, L. ptychoglene h as three membranous projections that arise from the dorsal surface of the primary lobe of the vesica. On the male genital capsule, the uncus of L. fulgens has an S shaped curve. The curvature of the uncus of L. ptychoglene is Cshaped. The processus basali s of the costa of L. fulgens is an elongate spine, whereas this structure has a dorsoventrally flattened trident shape in L. ptychoglene. The juxta of L. fulgens is triangular with a conical tip. Lycomorpha ptychoglene has a rectangular juxta with a triangular indentation in the distal margin. In the female genitalia, the heavy sclerotization of the seventh abdominal is continuous around the segment in L. fulgens However, membranous breaks in the sclerotization, which are located on the pleurites, occur i n L. ptychoglene. The distal margin seventh sternite of L. fulgens is approximately horizontal, whereas in L. ptychoglene to elongate extensions arise from the distal margin and encircle the ostium bursa. The ostium bursa of L. fulgens is located in the A7/A8 intersegmental membrane, but is found in the eighth sternite of L. ptychoglene. The wing color patterns of L. fulgens and L. regulus can be very similar in the darker specimens of each species. However, the thoracic coloration can be used to separate t he two species. The only red colored scales that occur on the thorax of L. fulgens are restricted to the tegulae. Lycomorpha regulus always has red colored scales on the tegulae, patagia, and dorsal mesothorax. Description Male habitus (Figs 5 2I,J and 5 3A,B ): Head : Head, antennal scales, labial palps, and gena are Vandyke brown (121) to dark grayish brown (20) colored. The antennae are serrate. No fusion is present among the labial palp segments. The gena is well developed and can be seen as a continuous band around

PAGE 193

193 the eye that joins with the frons when the head is viewed in profile. Thorax : The tegulae are geranium (13), flame scarlet (15), burnt orange (116), or warm buff (118) colored. The anterior margin of the tegulae is Vandyke brown (121) to dark grayish brown (20) colored. The patagia, dorsal and ventral thorax, and legs are Vandyke brown to dark grayish brown colored. Forewing: Length = 13.4mm (N = 10); M2 and M3 arise separately from the discal cell. Dorsal surface: The wing is geranium (12), f lame scarlet (15), burnt orange (116), orange rufous (132D), or warm buff (118) colored. A dusky brown (19) to fuscous (21) colored terminal band is present. The band arises at the distal third to quarter of the costal margin and extends to the anal angle. The posterior margin of the wing is lined with dusky brown to fuscous colored scales. These scales extend from the wing base to the terminal band. Ventral surface: The color and pattern is the same as the dorsal surface Hindwing : CuA1 and M3 arise separately from the discal cell. Dorsal surface: The wing is dusky brown (19) to fuscous (21) colored. A geranium (12), flame scarlet (15), burnt orange (116), orange rufous (132D), or warm buff (118) colored band is present on the costal margin of the wing. The band extends over threequarters the length of the wing arising at the wing base. The band is widest at the wing base where it stretches from the costal margin to the posterior margin of the discal cell. The band then tapers to a point. The p osterior margin of the band is serrate. Ventral surface: The color and pattern is the same as the dorsal surface. Abdomen: Dorsal, lateral, and ventral scales are Vandyke brown (121) to dark grayish brown (20) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is onethird or more the width of A7 sternite The scales in the pocket are raw umber (23) colored. A small shallow pocket of androconial

PAGE 194

194 scales is located in the center of the A8/A9 inters egmental membrane The scales in the pocket are hair brown (119A) colored The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternite and tergite. The pattern of sclerot ization on the eighth tergite is rectangular Female habitus (Figs 5 2 F H ): Head : Head, antennal scales, and labial palps dusky brown (19) colored. The antennae are serrate. The fusion of the labial palp segments and the development of the gena are the s ame as the male. The gena is covered with hair brown (119A) colored scales Thorax : Tegulae geranium (12) to scarlet (14) or chrome orange (16) to ferruginous colored. The anterior margins of the tegulae are dusky brown (19) colored. The patagia, dorsal and ventral thorax, and legs are dusky brown colored. Forewing: Length = 11.9mm (N = 10); venation the same as the male. Dorsal surface: The pattern is the same as the male. The wing is geranium (12) to scarlet (14) or chrome orange (16) to Pratts rufous (1 40) colored. The terminal band is sepia (119) to hair brown (119A) colored. The scales lining the posterior margin of the wing are also sepia to hair brown colored. Ventral surface: The pattern and color are the same as the dorsal surface except that yellow ocher (123C) to chamois (123D) colored scales are intermixed with the red scales posterior to the A1 vein. In addition, the retinaculum is covered in yellow ocher to chamois color ed scales Hindwing : The venation is the same as the male. Dorsal surface: The pattern is the same as the male. The wing is dark grayish brown (20) to fuscous (21) colored. The costal band is geranium pink (13) to burnt orange (116) colored. The band is salmon (106) colored at the wing base. Ventral surface: The wing color is the same as the dorsal surface. The costal band is geranium pink colored for the entire length. The length of the band is the

PAGE 195

195 same as the dorsal surface. The posterior margin of the wi ng is smooth with no serrations Abdomen: Scales on the dorsal, lateral, and ventral abdomen dusky brown (19) colored Male genitalia : Phallus : The basiphallus is inflected dorsally at the distal end curving away from the venter. When the phallus is viewed from the left side, the phallic sclerite is absent or highly reduced. The vesica is composed of a single primary lobe with a membranous projection arising on the left side of the vesica proximal to the distal margin of the phallus The distal end of the me mbranous projection of the vesica is ornamented with a single heavily sclerotized, spine like cornutus. Genital capsule: The tegumen is rectangular with a concave indentation in the distal margin and a rect angular indentation in the proximal margin. An inv erted U shaped suture that indicates where fusion occurred between the two halves of the tegumen extends from the proximal margin of the tegumen adjacent to the distal margin. The apex of the U does not reach the distal margin of the tegumen. A triangular shaped knob occurs between the two halves of the tegumen. The knob is contained within the margins of the suture. The apex of the triangle is oriented toward the distal margin of the tegumen. Narrow, sclerotized strips of tissue occur on the lateral margins of the uncus base. The uncus has an S shaped curve. The apex of the uncus is fingerlike but does not taper to a point. The distal end of the costa of the valve is defined by a processus basalis of the costa. The processus basalis of the costa occurs as a n elongate spine that tapers to a point. No editum is present on the interior surface of the valve. The valve is rectangular shaped wi th a sinuate ventral margin. At the distal end, the valve tapers to a point that is oriented inward and perpendicular to t he length of the valve. The juxta is triangular shaped with a conical tip at the distal end. The juxta is ornamented with a semicircular

PAGE 196

196 transparent patch at the proximal margin. The vinculum/saccus is U shaped. Female genitalia: The heavy sclerotization o f the seventh abdominal segment is continuous without any membranous breaks. The seventh sternite is parallelogram shaped. This sternite is widest at the cephalic end and narrows at the caudal end. The distal margin of the seventh sternite is approximately horizontal without any deep indentations. The eighth sternite is present as a sclerotized bar that fuses with the eighth tergite and the seventh sternite. The ostium bursa is located in the A7/A8 intersegmental membrane. The ductus bursa is as long as the seventh sternite. The ductus bursa forms a ovoid bulb shape proximal to the ostium bursa. It tapers to a ribbon shape adjacent to the base of the corpus bursa. The ribbon shaped portion of the ductus bursa is approximately one third of the length of the d uctus bursa. No sclerotization is present along the length of the ductus bursa. The ductus seminalis arises from the dorsal side of the ductus bursa. The membrane of the single corpus bursa is smooth and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone glands are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection. Variation As noted in the description, a wide range of color variation is present in both males and females. This variation is thought to be due to fading of the specimens. Specimens that were collected more recently are closer to the red color seen in the holotypes. The color of the forewings and tegulae lighten in older specimens. No

PAGE 197

197 correlation was found between the collection location and the color of the specimen. No variation in size was observed for male or female specimens. Biology This species has been collected during the months of May through September. No other information is known about the biology of this species. Distribution Lycomorpha ful gens occurs in the southwestern United States in Arizona and New Mexico. A single individual was collected in the Chihuahua state of Mexico. This Mexican state is adjacent to the southwestern border of New Mexico. Lycomorpha grotei (Packard) Figs. 5 3C,D (female); Figs. 5 3E,F (male). Anatolmis grotei Packard 1864: 47 [type locality: Pikes Peak, Colorado, USA ] Lycomorpha palmerii Packard 1872: 84 [type locality: Arizona, USA ] Material examined. Type material: Holotype of L. grotei not examined. Holotype of a synonym of L. grotei : Lycomorpha palmerii Packard, Arizona, MCZ Specimen preparations. All material from USNM unless otherwise noted: UNITED STATES: Colorado: Denver, 8.viii.1915 (1 female, CHS043, USNM 127,704); Garfield Co., Grizzly Creek, Glenwood Canyon, 11.viii.1970, O. Shields, S. Ellis, LACM (1 male, CHS079). Montana: Stillwater Co., 8 road mi SW of Nye, Woodbine C.G., 5300ft., 28.vii.1982, Julian P. Donahue, LACM (1 male, CHS094). New Mexico: Jemez Mts., 6600 feet, 15.vii.1915, John Woodgate, CMNH (1 male, CHS080). Texas: Engel Colln, C.M. Acc. 2436, CMNH (1 female, CHS092). Utah : Coll. No. 22, G.E. Wallace, Carn. Mus. Acc. 11394, CMNH (1 male, CHS035 ) ; Provo, 7._.1937, H.P. Chandler, Col. No. 4235, CAS (1 female, CHS091). Diagnosis Lycomorpha grotei can be confused with L. pulchra and L. regulus Although there is overlap in the range of these three species, L. grotei does not occur in

PAGE 198

198 California unlike L. pulchra and L. regulus The wing color pattern of each of these species varies, but certain color characters have been found to be constant within each species. Lycomorpha grotei does not have any dark brown scales lining the posterior margin of the forewing. Both L. pulchra an d L. regulus have dark brown scales that extend at least half the length of the posterior margin of the forewing. On the hindwing, the dark brown scales of L. grotei occur intermittently along the posterior margin of the wing, whereas the dark brown scales are continuous to the wing base in L. regulus Characters from the male genitalia can also be used to separate these three species. The basiphallus of L. grotei is inflected dorsally at the distal end. No inflection is present on the basiphallus of either L. pulchra or L. regulus Lycomorpha grotei has no peglike cornuti on the membranous projection arising from the primary lobe of its vesica. Peglike cornuti are present along the entire length of the projection in L. pulchra. These cornuti only occur on the distal third of the projection in L. regulus The uncus base of L. grotei occurs within a U shaped sclerotized plate, whereas the uncus base of both L. pulchra and L. regulus occurs in a V shaped sclerotized plate. Lycomorpha grotei has a juxta that is ornamented with a semicircular transparent patch at the proximal end. The juxta of L. regulus is ornamented with a triangular transparent patch. However, no ornamentation is present on the juxta of L. pulchra. Description Male habitus (Figs 5 3E,F ): H ead : The head and labial palps are cinnamon brown (33) to hair brown (119A) colored. Posterior to the antennae, the head is covered with orange rufous (132C) to salmon (106) to warm buff (118) colored scales. The antennae are serrate. The antennal scales are dark grayish brown (20) colored. No fusion is present between the labial palp segments. The gena is reduced and cannot be

PAGE 199

199 seen as a continuous band around the eye when viewing the head in profile. The gena is covered with the same color of scales that are found posterior to the antennae on the head. Thorax : The tegulae, patagia, and dorsal mesothorax are orange rufous (132C) to salmon (106) to warm buff (118) colored. The color is the same as that found on the head posterior to the antennae. The dorsal metathorax is covered with a mixture of scales that are the same color as those found on the tegulae, patagia, and dorsal mesothorax and cinnamon brown (33) to hair brown (119A) colored scales. The entire ventral thorax and legs are covered with cinnamon brown to hair brown colored scales The color of the brown scales matches those found on the head. Forewing: L ength = 15.2 (N = 10); M2 and M3 arise from the discal separately or are fused and stalk beyond the discal cell. Dorsal surface: The wing is orange rufous to salmon to warm buff colored. The color of the wing is the same as the color of the thorax. Cinnamon brown (33) to russet (34) colored scales are intermixed. A dark grayish brown (20) to fuscous (21) colored terminal band is present. The band ari ses in the distal quarter of the costal margin and extends to the anal angle of the wing. No brown scales extend from the terminal band along the posterior margin of the wing. Ventral surface: The wing is orange rufous to flesh ocher (132D) colored. The costal margin is lined with spectrum orange scales (17). Warm buff (118) colored scales occur posterior to the A1 vein. No cinnamon brown to russet colored scales are present. The color and patt ern of the terminal band are the same as the dorsal surface. Hindwing : CuA1 and M3 arise separately from the discal cell. Dorsal surface: The wing is geranium pink (13) to peach red (94) to salmon (106) colored. Salmon (106) to warm buff (118) colored scal es extend from the costal margin to the anterior margin of the discal cell. A fuscous (21) to

PAGE 200

200 dark drab (119B) colored marginal band is present. The band extends from the apex of the wing to the anal angle. The interior margin of the band is sinuate. Fusco us to dark drab colored scales extend from the band intermittently along the posterior margin of the wing to the wing base. Ventral surface: The wing is geranium pink to peach red to salmon colored. The color and pattern of the marginal band are the same as the dorsal surface Abdomen: Dorsal, lateral, and ventral scales are dark grayish brown (20) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is onethird or more the width of A7 sternite Th e scales in the pocket are drab gray (119D) colored. A small shallow pocket of androconial scales is located in the center of the A8/A9 intersegmental membrane The scales in the pocket are drab gray (119D) colored. The cephalic margin of the eighth stern ite is fused to the cephalic margin of the eighth tergite. The pattern of sclerotization on the eighth tergite is heart shaped Female habitus (Figs 5 3C,D): Head : The colors of the head, labial palps, and gena are the same as the male. The antennae are s imple and ciliate. The antennal scales are natal brown (219A). The fusion of the labial palp segments and the development of the gena are the same as the male. Thorax : The tegulae, patagia, and dorsal mesothorax are orange rufous (132C) to salmon (106) to warm buff (118) colored. The mixture of colors on the dorsal metathorax is the same as the male. The colors of the entire ventral thorax and legs are the same as the male Forewing: Length = 15.5mm (N = 10); Venation is the same as the male. Dorsal surface : The colors and patterns are the same as those on the male. Ventral surface: The colors and patterns are the same as those on the male. Hindwing: CuA1 and M3 arise from the discal separately or are fused and stalk beyond the discal cell. Dorsal

PAGE 201

201 surface: The colors and patterns are the same as those on the male. Ventral surface: The colors and patterns are the same as those on the male. Abdomen: The scales on the dorsal, lateral, and ventral abdomen are natal brown (219) colored. Male genitali a : Phallus : The basiphallus is inflected dorsally at the distal end curving away from the venter. When the phallus is viewed from the left side, a narrow, rounded triangular shaped phallic sclerite is present. The vesica is composed of a single primary lobe with a me mbranous projection present. The membranous projection arises from the distal end of the primary lobe at the upper right apices. The entire length of the membranous projection is ruggose. A heavily sclerotized, spinelike cornutus is present on the distal end of the primary lobe adjacent to the base of the membranous projection. Genital capsule: The tegumen is trapezoidal shaped. It is widest at the distal margin. A rectangular indentation is present in the proximal margin. A V shaped suture that indicates where fusion occurred between the two halves of the tegumen arises from the midpoint of the tegumen and extends to the distal margin. A triangular knob is contained within the margins of the suture. The apex of the triangle is oriented toward the proximal margin of the tegumen. The uncus base occurs within a U shaped sclerotized plate. The uncus has an S shaped curve. The base of the uncus is spade shaped and tapers to a point before the first curve. The apex of the uncus is ovoid (tear drop shaped) tapering to a point. The distal end of the costa of the valve is defined by a membranous break that occurs at the midpoint of the dorsal edge of the valve. The break occurs as a concave indentation in the straight ventral margin of the valve. No processus basalis of the costa is present on the valve. An editum is located on the cephalic end of the costa. The valve has a pentagon shape. The apex of the pentagon occurs on the ventral

PAGE 202

202 margin of the valve and is rounded. Distally, the valve taper s to a sclerotized poi nt that is oriented inward and perpendicular to the length of the valve. The juxta is triangular shaped with a conical tip at the distal end. The juxta is ornamented with a semicircular transparent patch at the proximal margin. Female genitalia: The heavy sclerotization of the seventh abdominal segment is continuous without any membranous breaks. The seventh sternite is shaped like an inverted M. On the distal margin of the seventh sternite, a deep, concave indentation, which extends more than a quarter the length of the sternite, is present. The eighth sternite is absent. The ostium bursa is located in the A7/A8 intersegmental membrane below the apex of the concave indention in the seventh sternite. The ductus bursa is shorter than the length of the seventh sternite. The ductus bursa is tube shaped. The tube undergoes a helical curve before joining the base of the corpus bursa. Sclerotization is present on the ductus bursa but not proximal to the ostium bursa. The sclerotization is separated from the ostium bursa by a membranous break. The ductus seminalis arises from the lateral, right side of the ductus bursa. The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running p erpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone gland is square shaped with two, narrow triangular projections arising from each apical corner. The width of the triangular projectio ns is less than the length of the projections. Variation As noted in the description, a wide range of color variation is present in both males and females. This variation is thought to be due to fading of the specimens. Specimens that were collected more recently are a darker orange red color. The color of

PAGE 203

203 the forewings and the thorax lighten in older specimens. As the wing color lightens the light brown scales that are intermixed on the forewing become more apparent making the wings appear gray. No correl ation was found between the collection location and the color of the specimen No variation in size was observed for male or female specimens. Biology From the label data, this species flies from July through September. Species have been collected from al l of the months within this time period. It is unknown if this represents a single or multiple flights. No other information is known about the biology of L. grotei Distribution This species is found in the western United States. It has been collected from the panhandle of Texas north to Montana. The western edge of its range is Arizona and Utah. The eastern edge of the range is Colorado and New Mexico. The range of this species does not extend into California. Specimens collected in California that hav e been labeled as L. grotei are representatives of either L. pulchra or L. regulus Lycomorpha miniata Packard Fig 5 3G (female); Fig. 5 3H (male). Lycomorpha miniata Packard 1872: 84 [type locality: Southern California, USA ] Material examined. Type mat erial: Holotype of L. miniata: Lycomorpha miniata Packard, Southern California, 933, MCZ. Paratype of L. miniata: Lycomorpha miniata Packard, Southern California, 933, MCZ Specimen preparations. All material from USNM unless otherwise noted : UNITED STATES : Colorado: Jeff. Co., Plainview, 70008000ft., 9 14.vii.1922, Br ooklyn Museum (1 male, CHS069, USNM 127,710); Larimer Co., 10mi. W Loveland, Big Thompson Cyn., 7.viii.1973, J. Powell Collr., UCB (1 female, CHS138). New Mexico: Jemez Springs, Alt. 8500, 15.viii.1928, Marloff Colln, Carn. Mus. Acc. 8992, CMNH (1 male, CHS070); Jemez Springs, 14.vii, Engel

PAGE 204

204 Coll., Carn. Mus. Acc. 13257, CMNH (1 female, CHS137); Colfax Co., Philmont Scout Ranch, Lovers Leap, 18.vii.1973, Joseph Cicero Coll., LACM (1 female, CH S139). South Dakota : Hill City, Black Hills, Joe Dollar Gulch, 3.viii.1964, D.C. Feruson (1 male, CHS038, USNM 127,702) ; Lawrence Co., Custer Peak, 65006794ft., 30.vii.1950, F. and P. Rindge, AMNH (1 male, CHS071) Wyoming: Crook Co., Devils Tower N.M., 4 250ft., 6.vii.1962, F., P., and M. Rindge, AMNH (1 female, CHS051). Diagnosis L. miniata can be confused with L. pholus and L. texanus Although there is overlap of the ranges of L. miniata and L. pholus characters from the wing color patterns and the female genitalia can be used to separate these to species. On the dorsal surface of the forewing of L. miniata, the redorange color of the basal half extends over half the length of the wing. This color ex tends less than half the length of the wing in L. pholus In addition, the dark scales that extend from the distal half of the wing along the posterior margin cannot be seen without a microscope in L. miniata This band of scales can be viewed with the nak ed eye in L. pholus Furthermore, in L. miniata these scales extend only a third of the length of the basal half of the wing. In L. pholus they extend adjacent to the wing base On the ventral surface of the forewing in L. miniata, no dark colored scales extend along the posterior margin of the basal half of the wing unlike L. pholus On the female genitalia, the seventh sternite of L. miniata is rectangular with the length of the rectangle perpendicular to the body, whereas this sternite is goblet shaped in L. pholus In addition, the posterior margin of the seventh sternite has a shallow concave indentation in L. miniata. However, this margin is approximately horizontal in L. pholus

PAGE 205

205 Although both L. miniata and L. texanus are restricted to the western United States, their ranges are isolated. L. texanus occurs in the Edwards Plateau and Rolling Plains regions of Texas. No records are available for L. miniata being found in Texas. The same two characters of the female genitalia used to separate L. miniat a and L. pholus can be used to separate L. miniata from L. texanus The seventh sternite is goblet shaped in L. texanus and the posterior margin of the seventh sternite is crenellated. Description Male habitus (Fig. 5 3H ): Head : Scales on the head and l abial palps are sepia (119) colored. The antennae are serrate. The antennal scales are sepia colored with cobalt (68) iridescence. No fusion is present between the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile. The gena is covered in sepia colored scales. A row of flame scarlet (14) to chrome orange (15) colored scales are present on the posterior margin of the gena. Thorax : The tegulae are fl ame scarlet (14) to chrome orange (15) colored. The patagia and dorsal and ventral thorax are sepia (119) colored. The leg scales are sepia colored with cobalt (68) iridescence. Forewing: L ength = 13.9mm (N = 10); M2 and M3 arise separately from the discal cell. Dorsal surface: The basal half of the wing is flame scarlet (14) to chrome orange (15) colored. The external margin of the basal half of the wing tapers to a point where the CuA1 vein arises from the discal cell. Ant erior and posterior to this point, the external margin is bent convexly toward the wing margin. The distal half of the wing is dusky brown (19) colored. A narrow band of dusky brown colored scales extends from the distal half of the wing along the posterior margin. These scales are difficult to see

PAGE 206

206 without a microscope. The scales extend one third the length of the posterior margin of the basal half of the wing. Ventral surface: The basal half of the wing is flame scarlet (14) to orange rufous (123C) colore d. Chrome orange (16) colored scales line the costal margin of the basal half of the wing. The retinaculum is also covered with chrome orange colored scales. Flesh ocher (132D) colored scales are found posterior to the A1 vein. The external margin of the b asal half of the wing is serrate. The distal half of the wing is dusky brown colored. No dusky brown colored scales extend along the posterior margin of the basal half of the wing Hindwing : CuA1 and M3 arise separately from the discal cell. Dorsal surface: The wing is dusky brown (19) to dark grayish brown (20) to fuscous (21) colored. The adbasal region is geranium pink (13) colored. Within this region, a mixture of burnt orange (116) and warm buff (118) colored scales are found between the costal margin and the anterior margin of the discal cell. The posterior margin of this region is sinuate. Ventral surface: The basal half of the wing is geranium pink colored. The external margin of the basal half of the wing is sinuate. The distal half of the wing is f uscous (21) colored. A narrow band of fuscous colored scales extend from the distal half of the wing along the posterior margin of wing to the wing base. Abdomen: Dorsal, lateral, and ventral scales are sepia (119) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is one third or more the width of A7 sternite. The scales in the pocket are fuscous (21) colored. The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of t he eighth tergite. There is no fusion between the sternite and tergite. The pattern of sclerotization on the eighth tergite is rectangular Female habitus (Fig. 5 3G ): Head : The colors of the head, antennal scales, labial palps, and gena are the

PAGE 207

207 same as th e male. The antennae are serrate. The fusion of the labial palp segments and the development of the gena are the same as the male. Thorax : The tegulae are flame scarlet (15) to chrome orange (16) colored. The colors of the patagia, dorsal and ventral thorax, and legs are the same as the male. Forewing : Length = 13.5mm (N = 10); Venation the same as the male. Dorsal surface: The colors and patterns are the same as those on the male. Ventral surface: The basal half of the wing is geranium pink (13) to orange rufous (132C) colored. The costal margin of the basal half is lined with chrome orange (16) colored scales. Flesh ocher (132D) colored scales occur posterior to the A1 vein in the basal half of the wing. The external margin of the basal half of the wing is the same as the male. The distal half of the wing is dusky brown (19) colored. No dusky brown scales occur on the posterior margin of the basal half of the wing Hindwing : The venation is the sam e as in the male. Dorsal surface: The colors and patterns are the same as those on the male. Ventral surface: The colors and patterns are the same as those on the male Abdomen: The color of the scales on the dorsal, lateral, and ventral abdomen are the sa me as the male Male genitali a : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, the phallic sclerite is present as a flattened lobe, which extends as a separate structure dorsad of the vesica. The ves ica is composed of a single primary lobe with a membranous projection arising on the left side of the vesica proximal to the distal margin of the phallus. The distal end of the membranous projection of the vesica is ornamented with a single heavily sclerot ized, spine like cornutus Genital capsule: The tegumen is rectangular with a concave indentation that extends half the length of the distal margin. The indentation is centered in the margin. The proximal margin of the

PAGE 208

208 tegumen is crenellated. A V shaped su ture that indicates where fusion occurred between the two halves of the tegumen extends for threequarters of the length of the tegumen. The sutures extend from the distal margin anteriorly. A circular knob is contained within the margins of the suture and arises adjacent to the distal margin of the tegumen. The uncus base occurs within a rectangular sclerotized plate. The uncus has a C shaped curve. The apex of the uncus is ovoid ( teardrop shaped) tapering to a point. The distal end of the costa of the val ve is defined by a triangular, membranous break that occurs beyond the midpoint of the dorsal edge of the valve. Beyond the membranous break, the dorsal edge of the valve occurs below the costa. No processus basalis of the costa is present on the valve. No editum is present on the internal face of the valve. The valve is teardrop shaped. The ventral margin of the valve tapers distally and forms a lobe that is perpendicular to the length of the valve. The dorsal margin also tapers to a lobe distally. In addi tion, a sclerotized spine arises from the lobe formed from the dorsal margin of the valve. The spine is oriented inward and perpendicular to the length of the valve. The juxta is a flat square sclerotized plate with a concave indentation in the distal marg in. The juxta is not ornamented with any transparent patches at the proximal margin. Female genitalia: The heavy sclerotization of the seventh abdominal segment is interrupted by narrow membranous breaks that occur on the pleurites. The seventh sternite is rectangular shaped with the length of the rectangle perpendicular to the body. On the distal margin of the seventh sternite, a shallow, concave indentation, which extends less than a quarter the length of the sternite, is present. The eighth sternite is present as a heavily sclerotized plate. The ostium bursa is located in the eighth sternite as a broad, horizontal slit that is centered in the sternite.

PAGE 209

209 The opening extends over half the length of the sternite. The ductus bursa is shorter than the seventh s ternite and ribbon like. The ductus bursa is not curved but a bulge occurs on the right side of the ductus bursa. No sclerotization is present on the ductus bursae. The ductus seminalis arises from the ventral side of the ductus bursa. The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone glan ds are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection. Variation Almost no variation in size and color was observed amon g the male or female specimens examined. Biology This species has been collected in July and August based on the label data. No other information is available on its biology. Distribution This species occurs only in the western United States. It ranges from Montana and South Dakota in the north to New Mexico in the south Although the collection locality on the type specimen of L. miniata is Southern California, no other records are available for this species from California. Lycomorpha morelosia (Schau s) Fig 5 3I (female); Fig. 5 3J (male). Propyria morelosia Schaus 1925: 19 [type locality: Morelos, Mexico] Material examined. Type material: Holotype of L. morelosia: Propyria morelosia Schaus, Morelos, Mexico, USNM Specimen preparations. All material from USNM unless otherwise noted: MEXICO : Nayarit : Zacualpan, ix.1914, Dognin Collection, (1

PAGE 210

210 male CHS196, USNM 127,721). Federal District: Barranca, Mixcoac, 20.viii.1917, C.C. Hoffman, AMNH (1 female, CHS247). Diagnosis This species can be confused with L. neomexicanus and L. normani Lycomorpha morelosia is geographically isolated from L. neomexicanus Lycomorpha morelosia is only known to occur in Mexico, whereas L. neomexicanus has only been found in New Mexico. Although both L. morelosia and L. normani occur in Mexico, the color pattern of the hindwing can be used to separate the two species. The red scales on the hindwing of L. morelosia extend over threequarters the length of the costal margin of the hindwing and arise adjacent to wing base. H owever, the pink scales present on the hindwing of L. normani do not extend more than half the length of the costal margin and arise from the base of the wing. Furthermore, the thorax of L. morelosia is entirely covered with dark brown scales, whereas the tegulae of L. normani are covered in redorange scales. The remainder of the thorax in L. normani is dark brown. Description Male habitus (Fig. 5 3J): Head : Scales on the head, antennae, labial palps, and gena are Vandyke brown (221) colored. The antennae are serrate. No fusion is present between the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile Thorax : Tegulae, patagia, dorsal and ventral thorax, and legs Vandyke brown (221) colored. Forewing : Length = 12mm (N=2); M2 and M3 fused and stalk beyond the discal cell. Dorsal surface: The wing is sepia (119) to Vandyke brown (121) colored. The costal vein is lined with sepia colored scales. A band of geranium (12) and scarlet (14) colored scales is present parallel to the costal margin of the wing.

PAGE 211

211 The band extends over threequarters the length of the wing beginning just beyond the wing base. In the proximal third of the wing, the band extends fr om directly posterior to the costal vein to just above the A1 vein. The band tapers to the width of the discal cell beyond the point where the R1 vein arises from the discal cell. Ventral surface: The pattern is identical to the dorsal surface. The costal vein is lined with sepia (119) colored scales. The anterior half of the wing is fuscous (21) colored. The posterior half of the wing is olive brown colored (28). The band that is parallel to the costal vein is geranium pink (13) colored. The shape of the band is identical to the dorsal surface. Hindwing : CuA1 and M3 fused and stalk beyond the discal cell. Dorsal surface: The hindwing is primarily sepia (219) colored. A band of geranium pink (13) to scarlet (14) colored scales extends from just beyond the wing base to outside of the discal cell. The band extends from the posterior costal vein edge to the posterior edge of the discal cell. Ventral surface: The pattern is identical to the dorsal surface. The ventral surface is primarily fuscous (21) colored. The band parallel to the costal margin is geranium pink (13) colored Abdomen: Dorsal, ventral, and lateral scales Vandyke brown (221) The anterolateral process is present as a flattened sclerotized lobe (Fig. 513B) The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternite and tergit e. The pattern of sclerotization on the eighth tergite is rectangular Female habitus (Fig. 5 3I ): Head : Scales on the head, antennae, labial palps, and gena are dusky brown (19) colored. The antennae are simple and ciliate The fusion of the labial palp s egments and the development of the gena are the same as the male Thorax : Tegulae, patagia, dorsal and ventral thorax, and legs dusky brown (19) colored. Forewing : Length = 12mm

PAGE 212

212 (N=3); venation the same as in the male. Dorsal surface: The dorsal surface of the forewing is sepia (119) colored. A geranium (12) and scarlet (14) to crimson (108) band runs parallel to the costal vein. The band occurs from just beyond the wing base to outside of the discal cell where the Rs5 and Rs4 veins begin to fork. In the basal half of the wing, the band extends from directly below the costal vein to above the A1 vein. In the distal half of the wing, the band narrows to the width of the discal cell. Ventral surface: The ventral surface is primarily geranium pink (13) colored. The costal vein is lined with Vandyke brown (221) colored scales. A hair brown (119A) colored terminal band is present. The hair brown colored scales extend from the terminal band along the posterior margin of the wing to the wing base. The terminal band is 1.5 2mm wide proximal to the apex and expands to 3mm wide proximal to the anal angle. The band does not extend above the A1 vein along the posterior margin of the wing. Geranium pink (13) scales are also found below the proximal half of the A1 vein. The A1 vein is lined with spectrum orange (17) colored scale. A spectrum orange discal spot is present. The Sc vein is lined with chrome orange (16) colored scales Hindwing: Venation is the same as in the male. Dorsal surface: The wing is crimson (108) to g eranium pink (13) colored. A sepia (219) colored marginal band extends from the apex of the wing to the wing base on the posterior margin of the wing. The band is 2mm wide. The internal margin of the band is sinuate. Sepia colored scales are found intermixed with the crimson to geranium pink colored scales on the CuA2 vein and between the internal margin of the marginal band and the posterior margin of the discal cell. Ventral surface : The pattern is the same as the dorsal surface. The wing is geranium pink (13) colored. The marginal band is hair brown (119A) colored. Hair brown colored scales are

PAGE 213

213 found intermixed with geranium pink colored scales between the internal margin of the marginal band and the posterior margin of the discal cell Spectrum orange (17) colored scales line the R1 vein. Abdomen: Dorsal, lateral, and ventral scales dusky brown (20) colored. The anterolateral process is the same as the male Male genitalia : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, a narrowed, rounded triangular shaped phallic sclerite is present. The vesica is composed of a single primary lobe with two membranous projections arising from the dorsal surface of the vesica. A heavily sclerotized, spinelik e cornutus is present on the distal end of the primary lobe Genital capsule: The tegumen has an elongate, rectangular shape. The lateral margins of the tegumen are bent concavely. A triangular indentation is present in the proximal margin. A straight sutur e with an ovoid bulge medially that indicates where fusion occurred between the two halves of the tegumen runs from the cephalic to caudal end of the tegumen. Narrow, sclerotized strips of tissue occur laterally on the uncus base. The uncus has an S shaped curve. The apex of the uncus is fingerlike but does not taper to a point. The distal end of the costa of the valve is defined by a processus basalis of the costa. The processus basalis of the costa occurs as an elongate spine that tapers to a point. An editum is located on the cephalic end of the costa and does not extend onto the processus basalis of the costa. The valve is rectangular shaped and all of the edges are rounded. The dorsal margin of the valve is curved convexly. The juxta occurs as a flat, s clerotized plate that is rectangular with a triangular indentation in the distal margin. The juxta is ornamented with a triangular transparent patch at the proximal margin. Female genitalia: The heavy sclerotization of the seventh abdominal segment is cont inuous without any membranous breaks. The

PAGE 214

214 seventh sternite is shaped like an inverted M. On the distal margin of the seventh sternite, a deep, concave indentation, which extends more than a quarter the length of the sternite, is present. The eighth sternit e is present as a sclerotized bar that fuses with the eighth tergite and the seventh sternite. The ostium bursa is located in the A7/A8 intersegmental membrane below the apex of the concave indention in the seventh sternite. The ductus bursa is longer than the seventh sternite. The ductus bursa is ribbon like, sclerotized for its entire length, and is not curved. The ductus bursa is sclerotized proximally to the ostium bursa. Two corpus bursae that are connate and arise from the ductus bursa are present. Th e membrane of the corpus bursae is smooth. The larger of the two bursae is ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of this bursa. The ductus seminalis arises from the larger corpus bursa. The dorsal pheromone glands are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the l ength of the projection. Variation Almost no variation in size and color was observed among the male or female specimens examined. Biology Unknown. Distribution This species occurs within Mexico. Based on the label data, this species has been collected from the Federal District and the Mexican states of Nayarit and Morelos Lycomorpha neomexicanus Scott New Species Fig 5 4A (male).

PAGE 215

215 Material examined. Type material: Holotype: NM: Union Co., Johnson Mesa, 10mi N Folsom, Sta. 448, 21.vi., leg. H.K. and M.A. Clench, 1977, C.M. Acc. 29258, CMNH, CHS253, male Specimen preparations. This species is represented by one specimen from CMNH. Etymology This species is named for the state where the only representative was collected. Diagnosis Lycomorpha neomexi canus can be confused with L. morelosia and L. normani This species is geographically isolated from L. morelosia as noted in the diagnosis of that species. The locality of L. neomexicanus can also be used to separate it from L. normani Lycomorpha neomexi canus occurs in New Mexico, whereas L. normani is found in Mexico and Costa Rica. The color pattern of the hindwing can also be used to separate L. neomexicanus and L. normani Although the orangered costal band on the hindwing of L. neomexicanus extends three quarters the length of the costal margin, the geranium pink scales in the adbasal region of L. normani extend only half the length of the costal margin. Description Male habitus (Fig. 5 4A ): Head : The head and labial palps are hair brown (119A) colored. The antennae are serrate. The antennal scales are dark grayish brown (20) colored with turquoise green (64) iridescence. There is no fusion among the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile. The gena is covered with light drab (119C) colored scales Thorax : The tegulae are spectrum orange (17) colored. The patagia are hair brown (119A) colored with spectrum orange (17) and orang e yellow (18) colored scales occurring on the outer third of the

PAGE 216

216 patagia. The dorsal mesothorax is sepia (119) colored with hair brown (119A) colored scales around the margins. The dorsal metathorax is sepia colored. The ventral thorax and legs are hair br own (119A) colored. Forewing : L ength = 13mm (N = 1); M2 and M3 are fused and stalk beyond the discal cell. Dorsal surface: The wings are dark grayish brown (20) colored. A warm buff (118) colored band arise at the wing base and extends along the costal mar gin. The band tapers to a point beyond the discal cell where the Rs3+Rs4 fork from Rs2. At the wing base the band stretches from the costal margin to the posterior margin of the wing. It tapers continuously from the wing base. The posterior margin of the band is burnt orange (116) colored and smooth. Burnt orange scales are intermixed with dark grayish brown scales between the A1 vein and the posterior margin of the discal cell. Ventral surface: The wing is orange rufous (123C) colored. The costal vein is lined with spectrum orange (17) colored scales. Posterior to the A1 vein, the wing scales are buff (124) colored. A dark grayish brown (20) terminal band is present. The band is 2mm wide. Hindwing: CuA1 and M2 arise separately from the discal cell. Dorsal surface: The wing is dark grayish brown (20) colored. A costal band extends from the wing base to the distal margin of the discal cell. The anterior half of the band is warm buff (118) colored. The posterior half of the band is orangerufous (123C) colored. The band tapers to a point. The posterior margin of the band is serrate. Ventral surface: The pattern is the same as the dorsal surface. The wing is dark grayish brown colored. The costal band is burnt orange (116) colored. Abdomen: Dorsal, lateral, and ventral scales are sepia (119) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is one third or more the width of A7 sternite. The scales in the pocket are dark drab (119B)

PAGE 217

217 colored. A small sh allow pocket of androconial scales is located in the center of the A8/A9 intersegmental membrane The scales in the pocket are hair brown (119A) colored. The cephalic margin of the eighth sternite is fused to the cephalic margin of the eighth tergite. The pattern of sclerotization on the eighth tergite is heart shaped. Male genitalis: Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, a narrow, pointed triangular shaped phallic sclerite is present. The ve sica is composed of a single primary lobe with a membranous projection present. The membranous projection arises from the distal end of the primary lobe at the upper right apices. The distal third of the projection is ornamented with peglike cornuti. The p roximal two thirds of the projection are ruggose. A heavily sclerotized, spinelike cornutus is present on the distal end of the primary lobe adjacent to the base of the membranous projection. Genital capsule: The tegumen is rectangular shaped. The length of the rectangle is perpendicular to the length of the body. A rectangular indentation is present in the proximal margin. A V shaped suture that indicates where fusion occurred between the two halves of the tegumen arises adjacent to the proximal margin of the tegumen and extends to the distal margin of the valve. A triangular knob is contained within the margins of the suture. The apex of the triangle is oriented toward the proximal margin of the tegumen. The uncus base occurs within a V shaped sclerotized plate. The uncus has an S shaped curve. The base of the uncus is teardrop shaped and tapers to a point proximal to the first curve of the uncus. The apex of the uncus is ovoid (tear drop shaped) tapering to a point. The distal end of the costa of the valve is defined by a membranous break that occurs at the midpoint of the dorsal edge of the valve. No pr ocessus basalis of the costa is present on the valve. An editum is

PAGE 218

218 located on the cephalic end of the costa. The valve is rectangular shaped with a ventral margin that is curved convexly Distally, the valve tapes to a sclerotized point that is oriented inward and perpendicular to the length of the valve. T he juxta is triangular shaped with a conical tip at the distal end. The juxta is ornamented with a triangular transparent patch at the proximal margin. Variation Only one specimen was available for this species. Biology Unknown. Distribution The specimen representing this species was collected in New Mexico in Union County Lycomorpha normani (Schaus) F ig 5 4B (male). Propyria normani Schaus 1911: 613 [type locality: Alajuela, Costa Rica] Material examined. Type material: Holotype of L. normani : Propyria normani Schaus, Alajuela, Costa Rica, USNM Specimen preparations. All material from USNM unless otherwise noted: MEXICO : Morelos : Cuernavaca, vii.1906, Collection Wm. Schaus (1 male, CHS252, USNM 127,736). Diagnosis L. normani can be confused with L. morelosia and L. neomexicanus Lycomorpha normani can be separated from L. morelosia based on color and male genitalia characters as described in the diagnosis of L. morelosia. Characters separating L. normani and L. neomexicanus are provided in the diagnosis of L. neomexicanus Description Male habitus (Fig. 5 4B ): Head : Scales on the head, antennal, labial palp, and gena are fuscous (21) colored. The antennae are serrate. No fusion is present between the labial palp segments. The gena is well developed and can be seen

PAGE 219

219 as a continuous band around the eye that joins with the frons when the head is viewed in profile Thorax : The tegulae are chrome orange (16) colored with flame scarlet (15) colored scales intermixed. The patagia, dorsal and ventral thorax, and legs are fuscous (21) colored Forewing: L ength = 12mm (N = 1); M2 and M3 are fused and stalk beyond the discal cell. Dorsal surface: The wing is fuscous (21) colored. The distal half of the costal vein is lined with sepia (119) colored scales. Chrome orange (16) to flame scarlet (15) colored scales form a band that is parallel to the costal margin. The proximal half of the costal vein is lined with scales from this band. The band extends from the wing base to within 1mm of the wing apex. The band is thickest at the wing base. At the wing base, it stretches from the costal vein towards the posterior margin of the wing. The band is separated from the posterior margin of the wing by a narrow band of fuscous colored scales. Beyond this point the band narrows and tapers to a point. The posterior margin of the band is smooth and angled toward the apex of the wing. Ventral surface: The wing is hair brown (119A) colored. A flame scarlet (15) colored band occurs parallel to the costal margin. The length of this band is the same as the band on the dorsal surface. The width of the band at t he wing base is the same as the dorsal surface. The posterior margin of the band is sinuate and angled toward the M2 + M3. Hair brown scales are intermixed along the posterior margin of the band. Hindwing : CuA1 and M3 fused and stalk beyond the discal cell Dorsal surface: The wing is burnt umber (22) colored. The fringe is fuscous (21) colored. A patch of geranium pink (13) colored scales is present in the adbasal region. The patch extends half the length of the costal margin. At the wing base, the patch s tretches from the costal margin to the posterior margin of the discal cell. The posterior margin of the geranium pink patch curves

PAGE 220

220 convexly. Ventral surface: The pattern is identical to the dorsal surface. The wing is fuscous (21) colored. The adbasal patc h is flame scarlet (15) colored Abdomen: Dorsal, ventral and lateral scales fuscous (21). A narrow pocket of hair like androconial scales is found in the A7/A8 ventral intersegmental membrane. The pocket is less than onethird the width of the A7 sternite. The androconial scales are cinnamon brown (33) colored. The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternite and tergite. The pattern of sclerotization on the ei ghth tergite is rectangular Male genitalis: Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, a narrowed, rounded triangular shaped phallic sclerite is present. The vesica is composed of a single primary lobe with three membranous projections arising from the dorsal surface of the vesica. A heavily sclerotized, spinelike cornutus is present on the distal end of the primary lobe. Genital capsule : The tegumen has an elongate, rectangular shape. The lateral margins of the tegumen are bent concavely. A straight suture with an ovoid bulge medially that indicates where fusion occurred between the two halves of the tegumen runs from the cephalic to caudal end of the tegumen. Narrow, sclerotized strips of tissue occur laterally on the uncus base. The uncus has an C shaped curve. The apex of the uncus is fingerlike and tapers to a point. The distal end of the costa of the valve is defined by a processus bas alis. The processus basalis is dorsoventrally compressed and trident shaped. The tips of the processus basalis are blunt. An editum is located on the base of the processus basalis. The valve is curved at an obtuse angle. Proximally to the genital capsule the valve is rectangular shaped with smooth, uncurved edges. Distal to the curve, the valve is rectangular shaped with

PAGE 221

221 curved edges. The valve tapers to a sclerotized spine that is oriented inward and perpendicular to the valve. In addition, a sclerotized lobe occurs adjacent to the ventral margin of the spine. The juxta occurs as a flat, sclerotized plate that is rectangular with a triangular indentation in the distal margin. The juxta is ornamented with a triangular transparent patch at the proximal margi n. Variation Only one male specimen was available from this species. The specimen is congruent with the original holotype. Biology Unknown. Distribution This species has been collected in Mexico and Costa Rica. Lycomorpha pholus (Drury) Figs. 5 4C,D ( female); Figs. 5 4E,F (male). Sphinx pholus Drury 1773: 49 [type locality: New England, USA ] Material examined. Type material: Holotype not examined. Specimen preparations. All material from USNM unless otherwise noted: CANADA: Ontario: 24mi. SE Kenora, ex flowers Meliotus alba, 5.viii.1967, J.R. Powers Collr., UCB (1 male, CHS134); 20mi. SE Kenora, 30.vii.1967, J.R. Powers Collr., UCB (1 female, CHS125). Quebec: Ottawa Co., Meach Lake, 17.viii (1 male, CHS136, USNM 127,720). UNITED STATES: Missouri: St. Louis Co., 24.ix.1944, Rockwood Res., T.B. Bleulusle Collecter, SDMNH (1 male, CHS064); St. Louis, 20.ix.1931, Meiners, Collection of Grace H. and John L. Sperry, AMNH (1 female, CHS072). New York: Big Indian Vy, Catskill Mts, 10.viii.1907, R.F. Pearsall (1 female, CHS045, USNM 127,705); Oliveria, 18.vi.1927, LACM (1 male, CHS133). Virginia : Page Co., Pinnacle, Shenandoah Nat. Park, 3400, 5.viii.1979, Leg. D.C. Ferguson (1 male CHS036, USNM 127,701). West Virginia:

PAGE 222

222 Pendleton Co., Spruce Knob, Elev. 4890, 5.viii.1960, Milliron and Wallace, CMNH (1 female, CHS074). Diagnosis Lycomorpha pholus may be confused with L. atroxantha, L. miniata, L. pelopia, and L. texanus Color patterns of the thorax, tibial spur formula, and the geographic distribution c an be used to separate L. pholus and L. atroxantha as noted in the diagnosis of the latter species. The geographic distribution and color patterns of the head are useful in separating L. pholus and L. pelopia. Lycomorpha pholus is restricted to North Ameri ca, whereas L. pelopia has been collected from Mexico and Panama. The scales on the head and gena of L. pholus are all sepia colored. However, the genal scales of L. pelopia are orange yellow colored. Characters from the forewing color patterns and the fem ale genitalia help to identify L. pholus and L. miniata Full descriptions of these characters are provided in the diagnosis of L. miniata. Lycomorpha pholus and L. texanus are geographically isolated. Lycomorpha texanus is restricted to the Edwards Plateau and Rolling Plains regions of Texas. The range of L. pholus does not extend into Texas. In addition, a narrow band of dark brown colored scales is present on the posterior margin of L. pholus These scales extend adjacent to the wing base. A narrow band of dark brown scales also occurs in L. texanus However, the band does not extend more than onethird the length of the posterior margin of the basal half of the wing. Description Male habitus (Fig. 5 4E ): Head : Scales on the head, labial palps, and gena are sepia (119) colored. The antennae are serrate. The antennal scales are sepia colored with cobalt (68) iridescence. No fusion is present between the labial palp segments. The gena is well developed and can be seen as a continuous band around

PAGE 223

223 the eye that joins with the frons when the head is viewed in profile. Thorax : The tegulae are spectrum orange (17) to orange yellow (18) colored. The patagia and dorsal and ventral thorax are sepia (119) colored. The leg scales are sepia colored with cobalt (68) iri descence. Forewing : L ength = 13.1mm (N = 10); M2 and M3 arise separately from the discal cell. Dorsal surface: The basal half of the wing is spectrum orange (17) to orange yellow (18) colored. The external margin is sinuate and tapers to a point where the CuA1 vein arises from the discal cell. The distal half of the wing is sepia (119) colored. A narrow band of se pia colored scales extends along the posterior margin of the basal half of the wing. These scales are adjacent to but do not reach the wing base. Ventral surface: The basal half of the wing is orange yellow colored. The external margin tapers to a point where the CuA1 vein arises. Anterior and posterior to the point, the margin is bent convexly toward the wing base. From the costal margin to the CuA2 vein, the distal half of the wing is sepia to dusky brown (19) colored. Posterior to the CuA2 vein the dista l half of the wing is hair brown (119A) colored. Hair brown scales line the posterior margin of the wing and end adjacent to the wing base. Hindwing: The CuA1 and M3 veins arise separate from the discal cell. Dorsal surface: The wing is dusky brown (19) to fuscous (21) colored. The adbasal region is trogon yellow (153) colored. The posterior margin of the adbasal region is orange yellow (18) colored and sinuate. Ventral surface: The pattern is the same as the dorsal surface. The wing is dark grayish brown ( 20) to fuscous (21) colored. The adbasal region is orange yellow colored. Abdomen: Dorsal, lateral, and ventral scales are sepia (119) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is one th ird or more the width of A7 sternite. The scales in the pocket are

PAGE 224

224 cinnamon brown (33) colored. The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternite and tergite. T he pattern of sclerotization on the eighth tergite is rectangular Female habitus (Fig. 5 4C ): Head : Color of head, antennal scales, labial palps, and gena the same as the male. Antennae are serrate. The fusion of the labial palp segments and the development of the gena are the same as the male. Thorax : Color of the tegulae, patagia, dorsal and ventral thorax, and legs same as the males Forewing: Length = 14.2mm (N = 10); M2 and M3 arise separately from the discal cell or M2 and M3 are fused and stalk beyond the discal cell. Dorsal surface: The pattern of the wing is the same as the male. The basal half of the wing is spectrum orange (17) to orange yellow (18) colored. The distal half of the wing and the scales lining the posterior margin of the wing are sepia (119) to dusky brown (19) colored. Ventral surface: The color is the same as in the ventral forewing surface of the male. The external edge of the basal half of the wing is either bent concavely towards the wing base above and below the posterior edge of the discal cell or almost smooth with no distinctive indentations. Hindwing : Venation is the same as the male. Dorsal surface: The pattern is the same as the male. The wing is sepia (119) to fuscous (21) colored. The color of the adbasal region is the same as the male. Ventral surface: The pattern is the same as the male. The wing is either dusky brown (19) or fuscous colored. The color of the adbasal region is the same as the male. Abdomen: The color of the scales on the dorsal, lateral, and ventral abdomen are the same as the male. Male genitalia : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, the phallic sclerite is present as a flattened lobe, which extends as a separate structure dorsad of

PAGE 225

225 the vesica. The vesica is composed of a single primary lobe with a membranous projection arising on the left side of the vesica proximal to the distal margin of the phallus. The distal end of the membranous projection of the vesica is ornamented with a single heavily sclerotized, spine like cornutus Genital capsule : The tegumen is rectangular with a concave indentation that extends a third of the length of the distal margin. The indentation is centered in the margin. The proximal margi n of the tegumen is crenellated. A V shaped suture that indicates where fusion occurred between the two halves of the tegumen extends for the distal twothirds the length of the tegumen. A circular knob is contained within the margins of the suture and ari ses adjacent to the distal margin of the tegumen. The uncus base occurs within a rectangular sclerotized plate. The uncus has a C shaped curve. The apex of the uncus is ovoid (teardrop shaped) tapering to a point. The distal end of the costa of the valve i s defined by a triangular, membranous break that occurs beyond the midpoint of the dorsal edge of the valve. No processus basalis of the costa is present on the valve. No editum is present on the internal face of the valve. The valve is teardrop shaped. Th e ventral margin of the valve tapers distally and forms a lobe that is perpendicular to the length of the valve. The dorsal margin also tapers to a lobe distally. In addition, a sclerotized spine arises from the lobe formed from the dorsal margin of the valve. The spine is oriented inward and perpendicular to the length of the valve. The juxta is a flat square sclerotized plate with a concave indentation in the distal margin. The juxta is not ornamented with any transparent patches at the proximal margin. F emale genitalia: The heavy sclerotization of the seventh abdominal segment is interrupted by narrow membranous breaks that occur on the pleurites. The seventh sternite is goblet shaped. The distal margin of the

PAGE 226

226 seventh sternite is approximately horizontal with no significant indentations or crenellations. The eighth sternite is present as a heavily sclerotized plate. The ostium bursa is located in the eighth sternite as a broad, horizontal slit that is centered in the sternite. The opening extends over half the length of the sternite. The ductus bursa is shorter than the seventh sternite. The ductus bursa is ribbon shaped and undergoes a C shaped curve. No sclerotization is present on the ductus bursae. The ductus seminalis arises from the ventral side of th e ductus bursa. The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the cor pus bursa. The dorsal pheromone glands are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection. Variation Males of L. pholus collected from Oklahoma have burnt orange (116) colored scales between the anterior margin of the discal cell and the A1 vein on the basal half of the ventral surface of the forewing (Fig. 54F) A mixture of geranium pink (13), chrome orange (16), and peach red (94) colored scales are present on the dorsal surface of the adbasal region of the hindwing of some males collected from Oklahoma and Missouri. On the ventral surface of the hindwing of so me males collected from Oklahoma and Missouri, the adbasal region is spectrum orange (17) and geranium pink colored. Some female L. pholus collected from Oklahoma and Missouri have a mixture of peach red (94) and orange yellow (18) colored scales on the posterior margin of the dorsal surface of the adbasal region of the hindwing (Fig. 54D). On the ventral surface

PAGE 227

227 of the hindwing, the adbasal region of these individuals is composed of a mixture of orange yellow and peach red colored scales. No size variation was observed for males or females. Biology The larvae of L. pholus possess a mandibular mola. In addition, they have been raised on the algae Protococcus viridis and the lichen Physcia millegrana (Wagner et al. 2008). The adults of L. pholus are entirel y diurnal (Fullard & Napoleone 2001) The adults have been reported nectar feeding on flowers of Apocynum Ericameria nauseosa, and Solidago (Powell & Opler 2009). Based on label data, the adults fly from from June through September. Distribution Lycomor pha pholus has the broadest distribution of any of the species within Lycomorpha. This species occurs as far north as Ontario and Quebec in Canada. The range of L. pholus extends south along the eastern coast of the United States to North Carolina. Based on the label data a few specimens have been collected from Florida. However, no other information besides the state name was provided. From the east coast, the range of L. pholus extends west to Colorado. Within Western North America, L. pholus occurs from Montana south to New Mexico. Lycomorpha ptychoglene ( Hampson) Fig 5 4G (female); Fig. 5 4H (male). Propyria ptychoglene Hampson 1898: 521 [type locality: Vera Cruz, Mexico] Lithosia aequalis Walker 1854: 511 [type locality: Guatemala] Lycomorpha sinuata Henry Edwards 1885: 128 [type locality: Jalapa, Mexico] Material examined. Type material: Holotype not examined. Specimen preparations. All material from USNM unless otherwise noted: MEXICO: Coatepec:

PAGE 228

228 Collection Wm. Schaus (1 female, CHS104, USNM 127,713). Vera Cruz: Jalapa, Collection Wm. Schaus (1 male, CHS103, USNM 127,712). Diagnosis Lycomorpha ptychoglene may be confused with L. concolor L. fulgens and L. regulus Lycomorpha ptychoglene is geographically isolated from L. concolor as noted i n the diagnosis of that species. Characters from the male and female genitalia that are described in the diagnosis of L. fulgens can be used to separate L. ptychoglene and L. fulgens The geographic distribution of L. ptychoglene and L. regulus are disjunc t. Lycomorpha ptychoglene has been collected in Mexico and Guatemala, whereas L. regulus is found in the southwestern United States from California east to the panhandle of Texas. In addition, the coloration of the thorax can be used to separate these two species. The thorax of L. ptychoglene has red tegulae and the remainder is dark brown. In L. regulus the tegulae, patagia and dorsal mesothorax are all red. The metathorax and entire ventral thorax are dark brown. Description Male habitus (Fig. 5 4H ): He ad : Scales on the head, antennae, labial palps, and gena are fuscous (21) colored. The antennae are serrate. No fusion is present among the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile. Thorax : Scales on the tegulae are spectrum orange (17). The patagia and the remaining dorsal and ventral thoracic scales are fuscous (21). The leg scales are fuscous with a small patch of chrome orange (16) sc ales present on the profemur Forewing: Length = 11mm (N=3); M2 and M3 are fused and stalk beyond the discal cell. Dorsal surface: The wing is chrome orange (16). The proximal half of the costal vein is covered in spectrum orange (17) scales. Fuscous (21) scales line the distal half of the

PAGE 229

229 costal vein. The fuscous scales form a terminal band. A narrow band of fuscous scales extends from the terminal band along the posterior margin of the wing. They do not extend to the wing base. The fringe is fuscous. Ven tral surface: The pattern is identical to the dorsal surface. The scales on the ventral surface are burnt orange (116) at the wing base and transition to salmon (106) colored distally. Salmon colored scales are found along the posterior margin of the wing. The scale colors on the costal vein and marginal band are identical to dorsal surface. Hindwing : CuA1 and M3 are fused and stalk distally beyond the discal cell. Dorsal surface: The hindwing is raw umber (223) colored. A band of salmon (106) colored scales is present along the basal twothirds of the costal margin. The band begins at the wing base. The salmon colored scales line the costal vein. The posterior margin of the band occurs proximal to the R1 vein. No salmon colored scales are found on or posterior to the R1 vein. Ventral surface: The pattern and primary wing color are identical to the dorsal surface. The costal vein is lined with spectrum orange (17) colored scales. On the ventral surface, the band is burnt orange (116) Abdomen: Dorsal, ventral and lateral scales fuscous. A narrow pocket of hair like androconial scales is found in the A7/A8 ventral intersegmental membrane. The pocket is less than onethird the width of the A7 sternite. The androconial scales are hair brown (119A) colored. The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternite and tergite. The pattern of sclerotization on the eighth tergite is rectangular Female habitus (Fig. 5 4G ): Head : Color of head, labial palp, and genal scales the same as in the male. Antennae are simple and ciliate. The antennal scales are dark grayish brown (20) to fuscous (21) colored. The fusion of the labial palp

PAGE 230

230 segments and the development of the gena are the same as the male. Thorax : The tegulae are chrome orange (16). The color of the patagia, dorsal and ventral thorax, and legs is the same as in the male. Forewing : Length = 12mm (N=3); Venation the same as in the male. Dorsal surface: Color and pattern the same as in the male. Ventral surface: Color and pattern the same as in the male. Hindwing: The venation is the same as in the male. Dorsal surface: Color and pattern the same as in the male. Ventral surface: Color and pattern the same as in the male. Abdomen: Color the same as in the male Male genitali a : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, the phallic sclerite is absent or highly reduced. The vesica is composed of a single primary lobe with three membranous projections arising from the dorsal surface of the vesica. A heavily sclerotized, spinelike cornutus is present on the distal end of the primary lobe. Genital capsule: The tegumen has an elongate, rectangular shape. The lateral margins of the tegumen are curved concavely. A triangular indentatio n is present in the proximal margin of the tegumen. A straight suture with an ovoid bulge medially that indicates where fusion occurred between the two halves of the tegumen runs from the cephalic to caudal end of the tegumen. Narrow, sclerotized strips of tissue occur laterally on the uncus base. The uncus has a C shaped curve. The apex of the uncus is fingerlike and tapers to a point. The distal end of the costa of the valve is defined by a processus basalis of the costa. The processus basalis of the cost a is dorso ventrally compressed and trident shaped. The tips of the processus basalis of the costa are blunt. An editum is located on the base of the processus basalis of the costa. The valve is curved at an obtuse angle. Proximally to the genital capsule the valve is rectangular shaped with smooth, uncurved edges.

PAGE 231

2 31 Distal to the curve, the valve is rectangular shaped with curved edges. The valve tapers to a sclerotized spine that is oriented inward and perpendicular to the valve. In addition, a sclerotized lobe occurs adjacent to the ventral margin of the spine. The juxta occurs as a flat, sclerotized plate that is rectangular with a triangular indentation in the distal margin. The juxta is ornamented with a conical transparent patch at the proximal margin. Female genitalia: The heavy sclerotization of the seventh abdominal segment is interrupted by narrow membranous breaks that occur on the pleurites. The seventh sternite is ovoid with an X shaped posterior margin. On the distal margin of the seventh sternit e two elongated projections arise that encircle the ostium bursa and overlap forming an X shape. The eighth sternite is present as a semicircular, lightly sclerotized plate. The anterior margin of the sternite is a sclerotized bar that fuses with the eight h tergite. The ostium bursa is located in the eighth sternite as a circular opening that occurs anteriorly in the plate but is not fused with the anterior margin of the plate. The ductus bursa is equal to or longer than the length of the seventh tergite. T he ductus bursa is ribbon shaped proximal to the ostium bursa and the base of the corpus bursa. Between these two regions the ductus bursa expands to form a circular shaped bulb. The ductus bursa is not sclerotized. The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone glands are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection.

PAGE 232

232 Variation Almost no variation in size and color was observed among the male or female specimens examined. Biology Unknown. Distribution This species is found in the Mexican states of Coatepec and Vera Cruz. The type of a synonym of L. ptychoglene, L. aequalis was collected in Guatemala. Lycomorpha pulchra Dyar Figs. 5 4I,J and 55A (female); Figs. 5 5 B D (male). Lycomorpha pulchra Dyar 1898: 34 [type locality: Belfrage, Texas, USA ] Material examined. Type material: Holotype not examined. Specimen preparations. All material from USNM unless otherwise noted: UNITED STATES: California : Mt. Home Can., 19.ix.1949, A.L. Melander, AMNH (1 male, CHS040); Forest Home, 4.vii.1927, Engel Coll., CMNH (1 female, CHS049); Forest Home, 4.vii.1927, LACM (1 male, CHS077); San Diego Co., Flinn Springs, 18.vi.1981, leg: Faulkner, Brown, SDNH (1 male, CHS075; 1 female, CHS095); Corona, 19.x.1930, CAS (1 male, CHS076); Baja del Norte Mexico, Sierra Juarez Mtns., El Tajo Canyon, 12.ix.1958, F.S. Truxal LACM (1 female, CHS096); Banner, Chariot Canyon, 11.x.1946, R.F. Allen Collector, CAS (1 female, CHS097); Los Angeles Co., S. Fork, Big Rock Cr., 4500, 27.ix.1967, Chris Henne Collection, LACM (1 female, CHS098). Diagnosis Lycomorpha pulchra can be confused with L. grotei and L. regulus Although there is partial overlap of the ranges of L. pulchra and L. grotei only L. pulchra occurs in California. In addition, characters from the forewing color pattern and the male genitalia can be used to separate L. pulchra and L. grotei These characters are fully described in the diagnosis of L. grotei Characters of the wing color pattern and the

PAGE 233

233 male genitalia can be used to separate L. pulchra and L. regulus The dark brown scales on the hindwing of L. pulchra occur intermittently along the posterior margin of the wing. The posterior margin of the hindwing in L. r egulus is continuously lined with dark brown scales. Lycomorpha pulchra possesses a phallic sclerite with a narrow, pointed triangular shape. The phallic sclerite of L. regulus has a narrow, rounded triangular shape. Peglike cornuti are present the entire length of the membranous projection from the primary lobe of the vesica in L. pulchra These cornuti are only found on the distal third of the projection in L. regulus Furthermore, the juxta of L. pulchra is not ornamented with any transparent patches, whereas a triangular shaped transparent patch is present on the proximal edge of the juxta in L. regulus Description Male habitus (Figs 5 5 B D ): Head : The head and labial palps are sepia (119) to hair brown (119A) colored. The antennae are serrate. The antennal scales are sepia colored. There is no fusion among the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile. The genal scales are light dr ab (119C) colored. Thorax : The tegulae, patagia, and dorsal mesothorax Pratts ruby (210), flame scarlet (15), or burnt orange (116) colored. The dorsal metathorax is covered with sepia colored scales. The entire ventral thorax and legs are sepia (119) to hair brown (119A) colored. Forewing : L ength = 12.3mm (N = 10); M2 and M3 arise separately from the discal cell. Dorsal surface: The wing is Pratts ruby, flame scarlet, or burnt orange colored. The color of the wing is the same as the color of the tegulae, patagia, and dorsal mesothorax. A sepia (119) colored terminal band is present. The band arises in the distal third of the cos tal margin and extends to the posterior margin of the wing. The

PAGE 234

234 fringe on the wing is hair brown (119A) colored. The posterior margin of the wing is lined with sepia colored scales. These scales extend over half the length of the posterior margin but do no t reach the wing base. Ventral surface: The pattern is the same as the dorsal surface. The wing is geranium pink (13) to peach red (94) colored. Salmon (106) colored scales are present below the A1 vein. The retinaculum is covered in salmon colored scales. The terminal band is sepia colored. The fringe is hair brown colored. Hindwing : CuA1 and M3 arise separately from the discal cell. Dorsal surface: The wing is geranium (12) to geranium pink (13) or orange rufous (123C) colored. Salmon (106) colored scales stretch from the costal margin to the anterior edge of the discal cell. A narrow dusky brown (19) marginal band is present. The band is less than 1mm wide except at the anal angle of the wing. The interior margin of the band is sinuate. At the anal angle, the band is bent convexly towards the costal margin. The dusky brown scales continue intermittently from the marginal band along the posterior margin of the wing to the wing base. The distal ends of the M1, M3, CuA1, CuA2, and A1 veins are lined with dusk y brown scales. The hair like scales that occur between the A1 and A2 veins may be dusky brown colored. Ventral surface: The wing is geranium (12) to geranium pink (13) or orange rufous (123C) colored. No salmon (106) colored scales are present. The margin al band is dusky brown. The pattern of the marginal band is the same as the dorsal surface. The dusky brown colored scales do not extend along the posterior margin of the wing. The distal end of the M3 vein is lined with dusky brown colored scales. The dus ky brown colored scales form a discal spot Abdomen: Dorsal, lateral, and ventral scales are sepia (119) to hair brown (119A) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The

PAGE 235

235 pocket is one third or more the width of A7 sternite. The scales in the pocket are drab gray (119D) colored. A small, shallow pocket of androconial scales is located in the center of the A8/A9 intersegmental membrane The scales in the pocket are drab (27) colored. The cephalic margin of the eighth sternite is fused to the cephalic margin of the eighth tergite. The pattern of sclerotization on the eighth tergite is heart shaped. Female habitus (Figs. 5 4I,J and 5 5A ): Head : The head is sepia (119) to hair brown (119A) colored. Posterior to the antennae, scarlet (14) to chrome orange (16) or burnt orange (116) colored scales intermixed on the head posterior to the head. The antennae are simple and ciliate. The color of the antennal scales, labial palps, and gena is the same as th e male. The fusion of the labial palp segments and the development of the gena are the same as the male. Thorax : The tegulae, patagia, and dorsal mesothorax are scarlet (14) to chrome orange (16) or burnt orange (116) colored. This color is the same as the scales found posterior to the antennae on the head. The dorsal metathorax, all of the ventral thorax, and the legs are sepia to hair brown colored. Forewing: Length = 13.2mm (N = 10); M2 and M3 arise separately from the discal cell or are fused and stalk beyond the discal cell. Dorsal surface: The wing is the pattern is the same as the male. The wings are scarlet (14) to chrome orange (16) or burnt orange (116) colored. As in the males, the color of the forewing is the same as the color on the thorax. The terminal band is sepia (119) colored with a hair brown (119A) colored fringe. The terminal band extends the same length as the males. Ventral surface: The pattern is the same as the dorsal surface. The wing is geranium pink (13) to peach red (94) colored. Posterior to the A1 vein the scales are salmon (106) colored. The retinaculum is covered in salmon colored scales. The colors of the terminal band and fringe are the same as the dorsal

PAGE 236

236 surface Hindwing: CuA2 and M3 arise separately from the discal cell or are fused and stalk beyond the discal cell. Dorsal surface: The wing is geranium pink (13) to scarlet (14) colored. A band of salmon (106) colored scales extends along the costal margin. The band stretches from the costal margin to the anterior margin of the discal cell. A dusky brown (19) marginal band is present. This band is broader (1mm) than the marginal band found on the male hindwing (<1mm). The interior margin of the band is sinuate. The band is bent convexly toward the costal margin at the anal angle. The dusky brown scales continue intermittently from the marginal band along the posterior margin of the wing to the wing base. The distal end of the M3, CuA1, CuA2, and A1 veins are lined with dusky brown scales. The long hair like scales found between A1 and A2 may be dusky brown colored. Ventral surface: The wing color is the same as the dorsal surface. No salmon colored scales are present along the costal margin. The pattern and color of the marginal band are the same as the dorsal surface. No dusky brown scales extend from the marginal band along the posterior margin of the wing. Dusky brown colored scales line the distal end of the CuA1 vein. A discal spot is formed from the dusky brown colored scales Abdomen: The color of the dorsal, lateral, and ventral scales the same as the male Male genitali a : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, a narrow, pointed triangular shaped phallic sclerite is present. The vesica is composed of a singl e primary lobe with a membranous projection present. The membranous projection arises from the distal end of the primary lobe at the upper right apex. The entire length of the projection is ornamented with peglike cornuti. A heavily sclerotized, spinelike cornutus is present on the distal end of the primary lobe at the upper left apex Genital capsule : The tegumen

PAGE 237

237 is trapezoidal shaped. It is widest at the distal margin. A rectangular indentation is present in the proximal margin. A V shaped suture that indicates where fusion occurred between the two halves of the tegumen extends for the distal twothirds the length of the tegume n. A triangular knob is contained within the margins of the suture. The apex of the triangle is oriented toward the proximal margin of the tegumen. The uncus base occurs within a V shaped sclerotized plate. The uncus has an S shaped curve. The base of the uncus is teardrop shaped and tapers to a point proximal to the first curve of the uncus. The apex of the uncus is ovoid (tear drop shaped) tapering to a point. The distal end of the costa of the valve is defined by a membranous break that occurs beyond the midpoint of the dorsal edge of the valve. No processus basalis of the costa is present on the valve. An editum is located on the cephalic end of the costa. The valve is parallelogram shaped with rounded edges. Distally the valve tapers to a point that is oriented inward and perpendicular to the length of the valve. The juxta is triangular shaped with a conical tip at the distal end. The juxta is not ornamented with any transparent patches at the proximal margin. Female genitalia: The heavy sclerotization o f the seventh abdominal segment is continuous without any membranous breaks. The seventh sternite is shaped like an inverted M. On the distal margin of the seventh sternite, a deep, concave indentation, which extends more than a quarter the length of the s ternite, is present. The eighth sternite is absent. The ostium bursa is located in the A7/A8 intersegmental membrane below the apex of the concave indention in the seventh sternite. The ductus bursa is shorter than the length of the seventh sternite. The ductus bursa is tubed shaped. Sclerotization is present on the ductus bursa but not proximal to the ostium bursa. The sclerotized portion of the ductus bursa forms a C -

PAGE 238

238 shaped curve. The sclerotization is separated from the ostium bursa by a membranous break The ductus seminalis arises from the lateral, right side of the ductus bursa. The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone gland is square shaped with two, narrow triangular projections arising from each apical corner. The width of the triangular projections is less than the length of the projections Variation The wing and thoracic color of male and female L. pulchra can vary significantly (Figs. 5 4I,J and 55 A D). As in L. fulgens this color variation appears associated with the age of the specimen not the collection locality. Older specimens have a lighter, faded coloration No size variation was observed for males or females. Biology Based on the label data, the flight of this species occurs from June to October. Nothing else is known about the biology of L. pulchra. Distribu tion Lycomorpha pulchra is found in the southwestern United States. Its range extends from California to Colorado. This species is found as far south as Baja California. The furthest north L. pulchra has been collected is in Teller County, Colorado. Lyco morpha regulus (Grinnell) Figs. 5 5E,F (female); Figs. 5 5G,H (male). Anatolmis regulus Grinnell 1903: 11 [type locality: Mt. Wilson, California, USA ] Material examined. Type material: Holotype not examined. Specimen preparations. All material from USNM unless otherwise noted: UNITED STATES : Arizona: Cochise Co., Chiricahua Mts., Barfoot Ridge, 8500 ft., 6.viii.1927, CAS (1

PAGE 239

239 male, CHS081). California : Emgd. 4.ii.1968, ova ex. cont. female, Los Angeles Co., San Gabriel Mts., So. Fork Big Rock Cy., 4500, 27.ix.1967, Coll. C. Henne, CAS (1 male, CHS046); Emgd. 3.ii.1968, ova ex. cont. female, Los Angeles Co., San Gabriel Mts., So. Fork Big Rock Cy., 4500, 27.ix.1967, Coll. C. Henne, CAS (1 female, CHS047); Emgd. 17.ii.1968, ova ex. cont. female, Los Angeles Co., San Gabriel Mts., So. Fork Big Rock Cy., 4500, 8.x.1967, Coll. C. Henne, CAS (1 male, CHS101); Emgd. 20.ii.1968, ova ex. cont. female, Los Angeles Co., San Gabriel Mts., So. Fork Big Rock Cy., 4500, 18.x.1967, Coll. C. Henne, CAS (1 female, CHS102); Ventura Co., Sespe Creek, 15.vi.1976, leg. M. Bell and T. Haglund, E.C. Olson Collection, FLMNH (1 male, CHS042); Los Angeles Co., 6.vi.1922, K.R Coolidge, Harold M. Bower, Coll. Accessd LACM 1964, LACM (1 female, CHS093). New Mexico: Catron Co., Bursum Camp, 18 miles E Alma, 9000ft., 14.vii.1961, F., P., and J. Rindge, AMNH (1 male, CHS099); Grant Co., McMillan Camp, 14 miles N Silver City, 7000ft., 13.vii.1964, F., P., and J. Rindge, AMNH (1 female, CHS100). Diagnosis Lycomorpha regulus can be confuse d with L. concolor L. fulgens L. grotei L. ptychoglene, and L. pulchra. Differences in the development of the gena, as well as characters from the male and female genitalia can be used to separate L. regulus from L. concolor These characters are fully described in the diagnosis of the latter species. The color pattern of the thorax can be used to separate L. regulus from L. fulgens The tegulae, patagia, and dorsal mesothorax of L. regulus are covered with red scales, whereas only the tegulae of L. fulg ens have red scales present. The wing color pattern and male genitalia help to separate L. regulus and L. grotei These characters are described in the diagnosis of L. grotei In addition, the gena of L. regulus is well

PAGE 240

240 developed, whereas it is reduced in L. grotei Lycomorpha regulus is geographically isolated from L. ptychoglene In addition, the color pattern of the thorax separates L. regulus and L. ptychoglene. Only the tegulae are red in L. ptychoglene. Wing color patterns and characters of the male genitalia are also used to separate L. regulus from L. pulchra. These characters are discussed in the diagnosis of L. pulchra. Description Male habitus (Figs. 5 5G,H ): Head : The head, labial palps, and gen a are dusky brown (19) colored. The antennae are serrate. The antennal scales are sepia (119) colored. No fusion is present between the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile. Thorax : The tegulae, patagia, and dorsal mesothorax are scarlet (14) to flame scarlet (15) to chrome orange (16) colored. The dorsal metathorax, the entire ventral thorax, and the legs are sepia (119) colored. For ewing : L ength = 13.2mm (N = 10); M2 and M3 arise from the discal separately or are fused and stalk beyond the discal cell. Dorsal surface: The wing is scarlet (14) to flame scarlet (15) to chrome orange (16) colored. The color of the wing matches the color of the tegulae, patagia, and dorsal mesothorax. A sepia (119) colored terminal band is present. The terminal band arises in the distal third of the costal margin of the wing and extends to the anal angle of the wing. The fringe of the wing is dusky brown (19) colored. A narrow band of sepia (119) colored scales extends from the terminal band along the posterior margin of the wing. They extend adjacent to but do not reach the wing base. Ventral surface: The pattern of the wing is the same as the dorsal surf ace. The wing is scarlet to flame scarlet colored. Peach red (94) to salmon (106) colored scales occur posterior to the A1 vein. The retinaculum is covered with salmon colored

PAGE 241

241 scales. The colors of the terminal band, fringe, and scales lining the posterior margin of the wing are the same as the dorsal surface. Hindwing : CuA1 and M3 arise separately from the discal cell or are fused and stalk beyond the discal cell. Dorsal surface: The wing is dark grayish brown (20) colored with a fuscous (21) colored fring e. A poppy red (210) to geranium pink (13) band is present along the costal margin. The band extends threequarters the length of the costal margin and tapers to a point. At the wing base, the band stretches from the costal margin to the A1 vein. Flesh och er (132D) to salmon (106) colored scales occur within the anterior half of the band. The posterior margin of the band is serrate. Ventral surface: The color of the wing is the same as the dorsal surface. The costal band is entirely poppy red to geranium pi nk colored. The costal band is broader stretching from the costal margin to the A2 vein The posterior margin of the band is serrate and bent convexly toward the anal angle of the wing. The band does not taper to a point. Abdomen: Dorsal, lateral, and vent ral scales are sepia (119) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is onethird or more the width of A7 sternite The scales in the pocket are hair brown (119A) colored. A small shallow pocket of androconial scales is located in the center of the A8/A9 intersegmental membrane The scales in the pocket are sayal brown (223C) colored. The cephalic margin of the eighth sternite is fused to the cephalic margin of the eighth tergite. T he pattern of sclerotization on the eighth tergite is heart shaped Female habitus (Figs 5 5E,F ): Head : The colors of the head, antennal scales, labial palps, and gena are the same as the male. The antennae are simple and ciliate. The fusion of the labial palp segments and the development of the gena are the same as the male Thorax : The tegulae, patagia, and

PAGE 242

242 dorsal mesothorax are scarlet (14) to flame scarlet (15) to chrome orange (16) colored. The colors of the dorsal metathorax, the entire ventral thorax, and legs are the same as the male Forewing : Length = 13mm (N = 10); Venation is the same as the male. Dorsal surface: The colors and patterns are the same as those on the male. Ventral surface: The colors and patterns are the same as those on the male Hindwing: The venation is the same as in the male. Dorsal surface: The colors and patterns are the same as those on the male. Ventral surface: The colors and patterns are the same as those on the male. Abdomen: The color of the scales on the dorsal, later al, and ventral abdomen are the same as the male. Male genitali a : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, a narrow, rounded triangular shaped phallic sclerite is present. The vesica is compose d of a single primary lobe with a membranous projection present. The membranous projection arises from the distal end of the primary lobe at the upper right apices. The distal third of the projection is ornamented with peglike cornuti. The proximal twothi rds of the projection are ruggose. A heavily sclerotized, spinelike cornutus is present on the distal end of the primary lobe adjacent to the base of the membranous projection. Genital capsule : The tegumen is trapezoidal shaped. It is widest at the distal margin. A rectangular indentation is present in the proximal margin. A V shaped suture that indicates where fusion occurred between the two halves of the tegumen arises adjacent to the proximal margin of the tegumen and extends to the distal margin of the valve. A triangular knob is contained within the margins of the suture. The apex of the triangle is oriented toward the proximal margin of the tegumen. The uncus base occurs within a V shaped sclerotized plate. The uncus has an S shaped curve. The base of the uncus is teardrop

PAGE 243

243 shaped and tapers to a point proximal to the first curve of the uncus. The apex of the uncus is ovoid (tear drop shaped) tapering to a point. The distal end of the costa of the valve is defined by a membranous break that occurs posterior to the midpoint of the valve. No processus basalis of the costa is present on the valve. An editum is located on the cephalic end of the costa. The valve is rectangular shaped with a sinuate ventral margin The apex of the pentagon occurs on the ventral margin of the valve and is rounded. Distally, the valve taper s to a sclerotized point that is oriented inward and perpendicular to the length of the valve. The juxta is triangular shaped with a conical tip at the distal end. The juxta is ornamented with a triangular transparent patch at the proximal margin. Female genitalia: The heavy sclerotization of the seventh abdominal segment is continuous without any membranous breaks. The seventh sternite is shaped like an inver ted M. On the distal margin of the seventh sternite, a deep, concave indentation, which extends more than a quarter the length of the sternite, is present. The eighth sternite is absent. The ostium bursa is located in the A7/A8 intersegmental membrane below the apex of the concave indention in the seventh sternite. The ductus bursa is equal to or longer than the length of the seventh sternite. The ductus bursa is tube shaped and sinuate. Sclerotization is present on the ductus bursa but not proximal to the ostium bursa. The sclerotization is separated from the ostium bursa by a membranous break. The ductus seminalis arises from the lateral, right side of the ductus bursa. The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly s clerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone gland is square shaped with two, narrow triangular

PAGE 244

244 projections arising from each apical corner. The width of the triangular projections is less than the length of the projections. Variation The wing and thoracic color of male and female L. regulus can vary significantly (Figs. 5 5 E F). This color variation appears associate d with the age of the specimen not the collection locality. Older specimens have a lighter, faded coloration. This is similar to the color variation seen in other species of Lycomorpha with red forewings and primarily black hindwings No size variation was observed for males or females. Biology Based on the label data, there appear to be two flights of L. regulus The first flight occurs from May through July. The second flight begins in late August and continues through October. Comstock & Henne (1967) re ared the larvae of L. regulus on the lichen Parmelia plittii. Their series of L. regulus have proved valuable in determining the phenotypic variation present within the wing color pattern of a single species. This information has aided in the delimitation of the species boundaries of Lycomorpha species with red forewings and primarily black hindwings. Distribution Lycomorpha regulus is another species whose range occurs within the southwestern United States This species is found from California east to the panhandle of Texas. The farthest north L. regulus has been found is Kane County, Utah, which occurs on the border of Utah and Arizona. Lycomorpha splendens Barnes and McDunnough Fig 5 5I (female); Fig. 5 5J (male). Lycomorpha splendens Barnes and McDunnough 1912: 3 [type locality: Eureka, Utah, USA ]

PAGE 245

245 Material examined. Type material: Holotype not examined. Specimen preparations. All material from USNM unless otherwise noted: UNITED ST ATES: Arizona: Yavapai Co., Montezuma Well, 4.x.1955, Lloyd M. Martin, LACM (1 female, CHS061). California: San Bernadino Co., Burns Pinyon Ridge Res., 2.5 air mi. N Yucca Valley, T1N, R5E, NW sec. 27, el. 4100ft, 31.v.1992, Jerry Freilich, LACM (1 male, CHS066). Texas: Jeff Davis Co., Fort Davis, 13.x.1966, A. & M.E. Blanchard (1 male, CHS039 USNM 127,703); Presidio Co., Big Bend Ranch St. Nat. Ar., Sauceda Rnch., 261.x xi.1989, E.G. Riley, TAMU (1 male, CHS067); Armstrong Co., Palo Duro Canyon St. Pk. 25.ix.1968, A. & M.E. Blanchard, AMNH (1 male, CHS065). Utah: St. George, 1 7.vi (1 male, CHS068, USNM 127,709). Diagnosis The coloration of L. splendens is unique within Lycomorpha. It has not been confused with any other members of the genus. Descrip tion Male habitus (Fig. 5 5J): Head : Scales on the head, labial palps, and gena are dusky brown (19) colored. The antennae are bipectinate with comblike rami. The antennal scales are dusky brown with and iridescent cobalt (68) sheen. The second and third segments of the labial palps are fused together. The gena is reduced and cannot be see as a continuous band around the eye when the head is viewed in profile Thorax : The tegulae are geranium pink (13) to scarlet (14) colored. The fringe emerging from the posterior margin of the tegulae is dusky brown (19) colored. The scales on the patagia are dusky brown with cobalt (68) iridescence. The scales on the ventral thorax and remaining dorsal thorax are fuscous (21) colored. The scales on the legs are the same color as those on the patagia. Forewing : L ength = 14.1mm (N = 10); M2 and M3 arise separately from the discal cell. Dorsal surface: The wing is Vandyke

PAGE 246

246 brown (121) colored. The scales lining the costal vein have cobalt (68) iridescence. Ventral surface: The wing is sepia (219) to fuscous (21) colored. No iridescence is present Hindwing : CuA1 and M3 arise separately from the discal cell. Dorsal surface: The wing is geranium pink (13) colored. A narrow hair brown (119A) band extends from the wing base on the costal margin of the wing to the anal angle. No hair brown colored scales occur along the posterior margin of the wing. Along the costal margin of the wing, the band stretches from the costal margin to the center of the discal cell. Ventral surface: Th e pattern and colors are the same as the dorsal surface. Abdomen: Dorsal, lateral, and ventral scales are fuscous (21) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. The pocket is one third or more the width of A7 sternite. The scales in the pocket are raw umber (23) colored. The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternite and tergite. The pattern of sclerot ization on the eighth tergite is rectangular Female habitus (Fig. 5 5I ): Head : Scales on the head, labial palps, and gena are fuscous (21) colored. The antennae are serrate. The antennal scales are fuscous colored with a cobalt (68) iridescence. The fusio n of the labial palp segments and the development of the gena are the same as the male. Thorax : The tegulae are geranium pink (13) to scarlet (14) colored. The fringe emerging from the posterior margin is fuscous (21). Patagia, dorsal and ventral thorax, a nd legs are fuscous colored. Forewing: Length = 11.7mm (N = 3); venation the same as the male. Dorsal surface: The wing is Vandyke brown (121) colored. No iridescence is present Ventral surface: The color is the same as the dorsal surface. Hindwing: The venation is the same as the male. Dorsal surface: The colors of

PAGE 247

247 the wing are the same as the male. The hair brown (119A) band is narrower than in the males. It does not stretch to the center of the discal cell. On the outer margin of the wing, the hair brown colored scales are restricted to the fringe. Ventral surface: The colors and pattern are the same as the dorsal surface. Abdomen: The dorsal scales on the abdomen are fuscous (21) colored. The lateral and ventral scales are sepia (219) colored. Male genitali a : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, a rectangular phallic sclerite is present. The vesica is composed of a single primary lobe. No membranous projections arise from the vesica. A heavily sclerotized, spinelike cornutus is not present. Genital capsule: The tegumen is trapezoidal with a concave indentation on the proximal margin. The lateral margins of the tegumen are curved convexly. The tegumen is widest at the proximal margin. An inverted T shaped suture that indicates where fusion occurred between the two halves of the tegumen extends from cephalic to the caudal margin of the tegumen. No sclerotization extends around the base of the uncus. The uncus has a C shaped curve. The a pex of the uncus is fingerlike tapering to a point. The distal end of the costa of the valve is defined by a triangular, membranous break that occurs at the midpoint of the dorsal edge of the valve. No processus basalis of the costa is present on the valve. An editum is found at the cephalic end of the costa. The valve is ovoid shaped. Distally, the valve taper s to a sclerotized point that is oriented inward and perpendicular to the length of the valve. The juxta is a trapezoidal shaped plate. The juxta is not ornamented with any transparent patches at the proximal margin. Female genitalia: The heavy sclerotization of the seventh abdominal segment is interrupted by narrow membranous breaks that occur on the pleurites. The seventh sternite is shaped like a shield. The

PAGE 248

248 distal margin of the seventh sternite is approximately horizontal without any deep indentations. The eighth sternite is present. However, it is reduced to two bars that are fused to the eighth tergite. The bars are not continuous across the venter. The ostium bursa is located in the A7/A8 intersegmental membrane. The ductus bursa is shorter than the length of the seventh sternite. The ductus bursa is tube shaped and does not curve. No sclerotization is present on the ductus bursa. The ductus semin alis arises from the lateral, left side of the ductus bursa. The membrane of the single corpus bursa is smooth and ornamented with a single slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. The dorsal pheromone glands are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection. Variation Female L. splendens are rare in c ollections. Almost no variation in size and color was observed among the male or female specimens examined. Biology Based on the collection label data, there appear to be two flights of L. splendens The first flight occurs from May to June. The second fl ight lasts from August to October. No specimens have been collected in July. Lycomorpha splendens is reported to be nocturnal and attracted to lights ( Powell & Opler 2009). No other information is known about the biology of this species Distribution This species is found in the Southwestern United States. Its range extends from Texas west to eastern California. L. splendens is found as far north as Colorado and Utah Lycomorpha texanus Scott New Species Fig. 5 6A (female); Fig. 56B (male).

PAGE 249

249 Material examined. Type material: Holotype: Mt. View Acres, Bexar Co., Texas, 11.x.1970, Leg. R.O. & C.A Kendall, USNM (1 male, CHS128, USNM 127,719) Paratypes: UNITED STATES: Texas: Bexar Co., Mt. View Acres, 11.ix.1970, Leg. R.O., USNM (1 male, CHS PC049, USNM 1 27,729); Bexar Co., Mt. View Acres, 11.x.1970, Leg. R.O. & C.A Kendall, USNM (2 males); Tiger Hill USNM (1 female, 1 male). Specimen preparations. All material from TAMU unless otherwise noted: UNITED STATES : Texas : 10 miles south of Kerrville, 8.v.1983, W .F. Chamberlain (2 females, CHS073, CHS PC048; 1 male CHS062); 28 miles N of Del Rio, 10.x.1993, W.F. Chamberlain (1 male, CHS131); Palo Pinto, 24.v.1941, O. Buchholz Collection, AMNH (1 male, CHS063); Palo Pinto, 1.v.1954, W.J. Reinthal, AMNH (1 female, C HS130); Bexar Co., 14mi N.W. San Antonio, 14.x.1970, J.W. Tilden Collector, CAS (1 female, CHS129); Comfort, Lucock, 13.x.1899, Holland Collection, CMNH (1 female, CHS132); Comal Co., New Braunfels, 16.x.1977, leg. E.C. Knudson, 16.x.1977, FLMNH (1 male, C HS PC038); Bexar Co., 12mi N.W. San Antonio, 14.x.1970, J.W. Tilden Collecter, UCB (1 male, CHS PC047) Etymology The name of this species is derived from the only state that it has been collected: Texas Diagnosis Lycomorpha texanus can be confused with L. atroxantha, L. miniata, L. pelopia and L. pholus The geographic distribution of L. texanus can be used to separate it from each of these species. The ranges of L. texanus and L. atroxantha are fully detailed in the diagnosis of L. atroxantha Characters of the female genitalia also help to separate L. texanus and L. miniata. These characters are fully described in the previous diagnosis of L. miniata Lycomorpha texanus is restricted to Texas, whereas L.

PAGE 250

250 pelopia has been collected from Panama and Mexico. The color of the scales on the head and gena are sepia colored in L. texanus However, the scales found on the gena of L. pelopia are orange yellow colored. The color patterns of the forewing noted in the diagnos is of L. pholus as well as the geographic distribution of the species, help to separate this species from L. texanus Description Male habitus (Fig. 5 6B ): Head : Scales on the head, labial palps, and gena are sepia (119) colored. The antennae are serrate. The antennal scales are sepia colored with cobalt (68) iridescence. No fusion is present between the labial palp segments. The gena is well developed and can be seen as a continuous band around the eye that joins with the frons when the head is viewed in profile Thorax : The tegulae are chrome orange (16) to spectrum orange (17) colored. The patagia and dorsal and ventral thorax are sepia (119) colored. The leg scales are sepia colored with cobalt (68) iridescence. Forewing : L ength = 13.4mm (N = 10); M2 a nd M3 arise separately from the discal cell. Dorsal surface: The basal half of the wing is spectrum orange (17) colored. Geranium pink (13) colored scales occur on the basal third of the posterior margin of the basal half. The external margin of the basal half of the wing tapers to a point where the CuA1 vein arises from the discal cell. Anterior and posterior to this point, the external margin is bent convexly toward the wing margin. The distal half of the wing is dusky brown (19) colored with cobalt (68) iridescence. No dusky brown scales extend along the posterior margin of the basal half of the wing. Ventral surface: The basal half of the wing is spectrum orange (17) colored. Burnt orange (116) colored scales are intermixed in the basal half of the wing posterior to the anterior margin of the discal cell. The external margin of the basal half of the wing is serrate. The distal half of the wing is

PAGE 251

251 dusky brown (19) colored. No dusky brown cells extend along the posterior margin of the basal half of the wing Hindwing : CuA1 and M3 arise separately from the discal cell. Dorsal surface: The wing is dusky brown (19) to dark grayish brown (20) to fuscous (21) colored. The adbasal region is chrome orange (16) to spectrum orange (17) colored. Geranium pink (13) col ored scales are intermixed posterior to the middle of the discal cell. The geranium pink colored scales continue to the posterior margin of the adbasal region. The posterior margin of the adbasal region is sinuate. Ventral surface: The basal half of the wi ng is composed of a mixture of chrome orange, spectrum orange, and geranium pink colored scales The external margin of the basal half of the wing is sinuate. The distal half of the wing is fuscous (21) colored. A narrow band of fuscous colored scales extend from the distal half of the wing along the posterior margin of wing to the wing base. Abdomen: Dorsal, lateral, and ventral scales are sepia (119) colored. A shallow, broad pocket of androconial scales present in the A7/A8 intersegmental membrane. T he pocket is one third or more the width of A7 sternite The scales in the pocket are burnt umber (22) colored. The cephalic margin of the eighth sternite extends adjacent to the cephalic margin of the eighth tergite. There is no fusion between the sternit e and tergite. The pattern of sclerotization on the eighth tergite is rectangular Female habitus (Fig. 5 6A ): Head : The colors of the head, antennal scales, labial palps, and gena are the same as the male. The antennae are serrate. The fusion of the labia l palp segments and the development of the gena are the same as the male. Thorax : The tegulae are chrome orange (16) to spectrum orange (17) colored. The colors of the patagia, dorsal and ventral thorax, and legs are the same as the male Forewing: Length = 13mm (N = 10); Venation is the same as the male. Dorsal surface:

PAGE 252

252 The colors and patterns are the same as those on the male. Ventral surface: The colors and patterns are the same as those on the male. Hindwing : The venation is the same as in the male. Dor sal surface: The colors and patterns are the same as those on the male. Ventral surface: The colors and patterns are the same as those on the male. Abdomen: The color of the scales on the dorsal, lateral, and ventral abdomen are the same as the male. Male genitali a : Phallus : The basiphallus is straight with no inflection. When the phallus is viewed from the left side, the phallic sclerite is present as a flattened lobe, which extends as a separate structure dorsad of the vesica. The vesica is composed of a single primary lobe with a membranous projection arising on the left side of the vesica proximal to the distal margin of the phallus. The distal end of the membranous projection of the vesica is ornamented with a single heavily sclerotized, spine like cornutus Genital capsule : The tegumen is rectangular with a concave indentation that extends half the length of the distal margin. The indentation is centered in the margin. Two half crescent shaped sclerotized extensions arise from the corners of the distal margin. The proximal margin of the tegumen is crenellated. A V shaped suture that indicates where fusion occurred between the two halves of the tegumen arises adjacent to the proximal margin of the tegumen and extends to the distal margin of the valve. A circular knob is contained within the margins of the suture and arises adjacent to the distal margin of the tegumen. The uncus base occurs within a rectangular sclerotized plate. The uncus has a C shaped curve. The apex of the uncus is ovoid (teardrop shaped) tapering to a point. The distal end of the costa of the valve is defined by a triangular, membranous break that occurs beyond the midpoint of the dorsal edge of the val ve. Beyond the membranous break, the dorsal edge of the valve

PAGE 253

253 occurs below the costa No processus basalis of the costa is present on the valve. No editum is present on the internal face of the valve. The valve is teardrop shape. The ventral margin of the valve tapers to a point that is perpendicular to the length of the valve distally. The dorsal margin tapers to a lobe distally. In addition, a sclerotized spine arises from the lobe formed from the dorsal margin of the valve. The spine is oriented inward and perpendicular to the length of the valve. The juxta is a flat square sclerotized plate with a concave indentation in the distal margin. The juxta is not ornamented with any transparent patches at the proximal margin. Female genitalia: The heavy scleroti zation of the seventh abdominal segment is interrupted by narrow membranous breaks that occur on the pleurites. The seventh sternite is goblet shaped. The distal margin of the seventh sternite is crenellated. The eighth sternite is present as a heavily scl erotized plate. The ostium bursa is located in the eighth sternite as a broad, horizontal slit that is centered in the sternite. The opening extends over half the length of the sternite. The ductus bursa is shorter than the length of the seventh sternite. The ductus bursa is ribbon like with no curves or bulges. No sclerotization is present on the ductus bursae. The ductus seminalis arises from the ventral side of the ductus bursa. The membrane of the single corpus bursa is wrinkled and ornamented with two, slightly sclerotized ovoid signa with heavily sclerotized bars running perpendicular to the length of the signa. These two signa occur on opposite sides of the corpus bursa. The dorsal pheromone glands are square shaped with two broad triangular projections arising from each apical corner. The width of the triangular projections is greater than or equal to the length of the projection.

PAGE 254

254 Variation In some individuals of L. texanus a narrow band of dusky brown scales extends from the distal half of the fore wing alon g the distal third of the posterior margin of the basal half of the dorsal surface of the forewing. On the ventral surface of the forewing, the pattern of the external margin of the basal half of the wing is the same as the dorsal surface. Almost no variation in size was observed among the male or female specimens examined. Biology There appear to be two flights of L. texanus based on collection label data. The first flight occurs in April and May. The second flight is in September and November. N o other information is known about the biology of this species Distribution L. texanus is restricted to Central Texas. Specimens of L. texanus have been collected in the Edwards Plateau region and the Rolling Plains region. The Rolling Plains region is c ontiguous with the northern edge of the Edwards Plateau.

PAGE 255

255 Figure 51. Strict consensus of 3 most parsimonious trees (L=192, CI=0.68, RI=0.73) resulting from the maximum parsimony analysis of the all species (AS) dataset. Numbers below the branches are the support values for the nodes: Bremer Support (BS)/Jackknife (JK). C1 C6 = Clade 1 Clade 6. Solid line = species placed in Lycomorpha, Dashed line = species placed in Propyria Dotted line = outgroup taxa.

PAGE 256

256 Figure 52. Images of the adult habitus of the genus Lycomorpha P late 1. A) L. atroxantha (Schaus), Female. B) L. concolor Scott, Female. C) L. concolor Scott, Female. D) L. concolor Scott, Male. E) L. concolor Scott, Male. F) L. fulgens (Edwards), Female. G) L. fulgens (Edwards), Female. H) L. fulgens (Edwards), Female. I) L. fulgens (Edwards), Male. J) L. fulgens (Edwards), Male. Collection locality data for each specimen photographed can be found in Appendix F.

PAGE 257

257 Figure 53. Images of the adult habitus of the genus Lycomorpha Plate 2. A) L. fulgens (Edwards), Male. B) L. fulgens (Edwards), Male. C) L. grotei (P ackard), Female. D) L. grotei (Packard), Female. E) L. grotei (Packard), Male. F) L. grotei (Packard), Male. G) L. miniata Packard, Female. H) L. minata Packard, Male. I) L. morelosia (Schaus), Female. J) L. morelosia (Schaus), Male. Collection locality da ta for each specimen photographed can be found in Appendix F.

PAGE 258

258 Figure 54. Images of the adult habitus of the genus Lycomorpha Plate 3. A) L. neomexicanus Scott, Male. B) L. normani (Schaus), Male. C) L. pholus (Drury), Female. D) L. pholus (Drury), Female. E) L. pholus (Drury), Male. F) L. pholus (Drury), Male. G) L. ptychoglene (Hampson), Female. H) L. ptychoglene (Hampson), Male. I) L. pulchra Dyar, Female. J) L. pulchra Dyar, Female. Collection locality data for each specimen photographed can be found in Appendix F.

PAGE 259

259 Figure 55. Images of the adult habitus of the genus Lycomorpha Plate 4. A) L. pulchra Dyar, Female. B) L. pulchra Dyar, Male. C) L. pulchra Dyar, Male. D) L. pulchra Dyar, Male. E) L. regulus (Grinnell), Female. F) L. reg ulus (Grinnell), Female. G) L. regulus (Grinnell), Male. H) L. regulus (Grinnell), Male. I) L. splendens Barnes and McDunnough, Female. J) L. splendens Barnes and McDunnough, Male. Collection locality data for each specimen photographed can be found in App endix F.

PAGE 260

260 Figure 56. Images of the adult habitus of the genus Lycomorpha Plate 5. A) L. texanus Scott, Female. B) L. texanus Scott, Male. Collection locality data for each specimen photographed can be found in Appendix F. Figure 57. Adult habitus of female L. pelopia Collection locality data for the specimen can be found in Appendix F.

PAGE 261

261 Figure 58 Male flagellomere state. A) Lycomorpha fulgens ; serrate flagellomeres. B) Lycomorpha splendens ; bipectinate flagellomeres. The scale bar is equivalent to 1mm.

PAGE 262

262 Figure 59. Female flagellomere state. A) Lycomorpha grotei ; simple, ciliate flagellomeres. B) Lycomorpha splendens ; serrate flagellomeres. The scale bar is equivalent to 1mm.

PAGE 263

263 Figure 510. Labial palp segment fusion. A) Lycomorpha pholus ; No fusion of segments. B) Lycomorpha splendens ; 2nd and 3rd segments fused. The scale bar is equivalent to 1mm.

PAGE 264

264 Figure 511. Medial veins of the forewing. A) Lycomorpha pholus ; M2 and M3 arise separately from the discal cell. B) Lycomorpha grotei ; M2 and M3 are fused and stalk beyond the discal cell. The scale bar is equivalent to 1mm.

PAGE 265

265 Figure 512. Medial and cubital veins of hindwing. A) Lycomorpha grotei ; M3 and CuA1 arise separatel y from the discal cell. B) Lycomorpha ptychoglene; M3 and CuA1 are fused and stalk beyond the discal cell. The scale bar is equivalent to 1mm.

PAGE 266

266 Figure 513. Anterolateral process (ALP) form. A) Lycomorpha pholus ; ALP present as a SBsclerotized bar. B) Lycomorpha morelosia; ALP present as a FL flattened lobe. The scale bar is equivalent to 1mm.

PAGE 267

267 Figure 514. Androconia of the A7/A8 intersegmental membrane. A) Lycomorpha splendens ; SP shallow pocket that is more than 1/3rd the width of 7S seventh sternite. B) Lycomorpha normani ; NP narrow pocket that is less than 1/3rd the width of 7S seventh sternite. The scale bar is equivalent to 1mm.

PAGE 268

268 CHAPTER 6 DISCUSSION AND FUTURE DIRECTIONS Tribal Study Phylogenies have been constructed for the tribe Lithosiini (Lepidoptera: Erebidae: Arctiinae) based on either a morphological or a molecular dataset. The phylogenies were used to assess the monophyly of both the tribe and the subtribes proposed by Bendib & Minet (1999). Although overlap was present in the taxon sampling of the two phylogenetic analyses, the datasets were not combined for a total evidence analysis (De Queiroz 1993; Kluge 1989; Wiens 1998a). O nly seventeen of the species sampled for Lithosiini were present in both datasets. In addition, each of the four gene fragments (two mitochondrial and two nuclear) included in the molecular dataset were not successfully amplified for these seventeen species. Although Whiting et al. (1997) recovered a resolved phylogeny despite the inclusion of taxa that were not represented by all of the data, Wiens & Reeder (1995) and Wilkinson (1995) noted that the inclusion of taxa that were missing portions of the data could detrimentally impact the accuracy of the phylogeny that was obtained. Furthermore, Wiens (1998b) found that as the proportion of missing data increased within a dataset, the acc uracy of the phylogeny decreased. Given the percentage of data that would have been missing by combining the two datasets, a total evidence analysis was not appropriate at this time. For the morphological study, seventy six species of Lithosiini that included representat ives of each of the seven subtribes were sampled for eight y two morphological characters. This dataset was analyzed using maximum parsimony (MP) and Bayesian inference (BI) analysis. The phylogenies that were recovered were almost entirely unresolved. T he BI phylogram recovered the t ribe Lithosiini as monophyleti c;

PAGE 269

269 however none of the subtribes were recovered as monophyletic by either analysis. These findings are not unusual since all synapomorphies that have been identified for the tribe to date, arise from the larval morphology In addition, Bendib & Minet (19 99) noted that the larval morphology was the most accurate for placing taxa within Lithosiini. Although the results of this phylogenetic study do not provide resolution to the evolutionary relationships among the genera, they do provide confirmation that t he phylogenetic signal present within the adult lithosiine morphology is not informative at the tribal level. Phylogenetic analyses of datasets composed of several gene fragments have been used to resolve the higher level relationships within superfamilies families, and subfamilies of Lepidoptera (Regier et al. 2012; Ugelvig et al. 2011; Zahiri et al. 2011, 2012). A molecular dataset composed of four gene fragments (two nuclear and two mitochondrial) was constructed for forty six species of Lithosiini repr esenting four of the lithosiine subtribes. The molecular dataset was analyzed using maximum likelihood (ML) and BI analysis. In addition, the optimal partitioning strategies and models of evolution identified by t wo different selection criteria were compar ed. The same species groups were found with both partitioning strategies and both methods of analysis. The relationships recovered among the species groups varied based on the type of phylogenetic analysis. Both t he type of analysis and the partitioning st rategy affected the nodal support of these groups. Although the phylogenies recovered using the molecular dataset were more resolved than those obtained from the morphological dataset, nodal support was low or absent for the deeper nodes of the molecular p hylogeny. Each of the analyses found t he tribe Lithosiini to be paraphyletic with

PAGE 270

270 respect to the other tribes of Arctiinae, Syntomiini and Arctiini. However, in the most recent phylogenetic an alysis of the subfamily Arctiinae (S. Weller pers. comm.) Lithosiini was recovered as monophyletic. As in the morphological study of the tribe, none of the subtribes included in the analysis were recovered as monophyletic. Although the use of molecular data led to an increase in the resolution of the evolutionary relationships of Lithosiini, further phylogenetic studies are needed to resolve the higher level relationships. Review of Lycomorpha A review of the lithosiine genus Lycomorpha Harris was completed as part of this study. The wing color patterns of the adults of this genus have led to confusion in both the family placement of the genus and the species composition. In their phylogenetic study of the tribes of Arctiinae, Jacobson & Weller (2002) confirmed the placement of Lycomorpha within Lithosiini. However, no study had been completed that examined the relationships of the species within the genus or the generic limits of Lycomorpha. A similarity of wing color pattern and body shape had been noted between Lycomorpha and the lithosiine genera Propyria Hampson and Ptychoglene Felder This study used sixtyfive morphological characters coded for seven species of Lycomorpha, which included three new species. Also included in the analy sis were three species of Propyria and a single species of Ptychoglene. The species sampling included t he type species of each genus. The dataset was analyzed using MP and BI analysis. Both types of analysis, recovered Lycomorpha as paraphyletic with respect to Propyria Twenty synapomorphies were identified that supported this relationship. In addition, Ptychoglene was more closely related to the genus Hypoprepia Hbner than either Lycomorpha or Propyria. Further MP analyses were conducted in which the mon ophyly

PAGE 271

271 of either Lycomorpha or Propyria was constrained. Although the lengths of the two phylogenies recovered from these analyses were not significantly greater the two genera remained paraphyletic. Based on these findings, Lycomorpha and Propyria were synonymized. The older generic name Lycomorpha was given priority. Based on the results of the morphological phylogeny of the genus, a revision of Lycomorpha has been completed. A description and diagnosis have been provided for both the genus and fourteen of the twenty species placed within Lycomorpha. Future Directions Tribal Systematics Studies of the evolution of behaviors within the tribe and assessments of the monophyly of the subtribes of Lithosiini require a resolved phylogeny As part of this study, two phylogenies were constructed for the tribe; h owever, neither phylogeny was able to resolve the higher level relationships within Lithosiini. Of the two datasets that were analyzed, the phylogenies obtained using molecular data were more resolved. Howe ver, only four of the seven subtribes were represented in the taxon sampling of the molecular phylogeny. In addition, the Neotropics, an area of high biodiversity for the tribe Lithosiini, was represented by only four species. Future studies must attempt a denser taxon sampling that includes species from each of the subtribes and provides better representation for areas of high biodiversity. The lack of higher level resolution might be addressed by including more nuclear gene fragments in the data analysis. Nuclear DNA evolves more slowly than mitochondrial DNA, and this property has made it useful in resolving the higher level relationships of the order Lepidoptera (Regier et al. 2009; Mutanen et al. 2010). This process of selecting, amplifying, and sequenc ing gene fragments to construct a dataset for a phylogenetic analysis is reliant on Sanger

PAGE 272

272 sequencing. Although other sequencing methods were available, the cost of these methods has been prohibitive in comparison to Sanger sequencing. However sequencing protocols collectively referred to as Next Generation Sequencing that produce large volumes of data cheaply have become available (Shendure & Ji 2008; Metzker 2010). The greater quantities of information obtained are equivalent to amplifying a large number of loci using Sanger sequencing. In addition, Next Generation sequencing methods allow for genomic data to be obtained for nonmodel organisms. This data can then be used both to construct a phylogeny and to study the evolution of behavior (Nygaard et a l. 2011). Next Generation sequencing methods could also be used to obtain a dataset for future studies to examine the evolutionary relationships of the tribe and obtain resolution at the deeper nodes. Chemical Defense Lichen phenolics are compounds produced by the fungal component of the lichen to defend against herbivores. Hesbacher et al. (1995) examined wildcaught adults of Lithosiini for the presence of these phenolics. They examined 103 adults of sixteen species representing eight lithosiine genera. Twenty four individuals were found to have known lichen phenolic compounds stored in their bodies. In addition, forty seven of the individuals examined possessed lichen phenolic like compounds. They found both inter and intraspecific variation in the presence of these compounds. This is the only the study that has been completed that examined adults of Lithosiini for the presence of lichen based compounds. However, the sampling of the study was too small to provide a clear idea of how common this behavior is within Lithosiini. Future studies could examine a broader sampling of lithosiine taxa from around the world for the presence of lichen phenolics. HPLC analysis could be used to determine which taxa

PAGE 273

273 possess lichen phenolics. This data could then be corr elated with wing color pattern and ultrasonic noise production in order to produce hypotheses as to which species that appear distasteful possess defensive chemicals. Courtship Behavior of Lycomorpha The courtship rituals of some species within the tribe A rctiini involve b oth pheromones released from androconia and ultrasonic clicks produced by tymbal organs (Weller et al 1999; Sanderford 2009). Males of Lycomorpha species possess both of these structures. The males of all species of Lycomorpha possess at least one pocket of androconial scales on their abdomen and a nother pocket of androconial scales within the intravincular membrane of the genital capsule. However, no studies have been completed to examine the courtship behavior of Lycomorpha species. Lycomorpha pholus the most widespread species within the genus, can be used as a model for this research. The tympanum of L pholus has been found to be most sensitive to the ultrasound frequency produced by its tymbal organs. Furthermore, Muma & Fullard (2004) hypothesize that the ability of L. pholus to hear in this range could be selected for by short range, social communications which are the types of cues used in courtship rituals Studies of L. pholus courtship could determine whether the males use either of these systems. If the results of these studies demonstrate that these structures are used in mating, the role of androconia, ultrasound, or both in mating success could also be examined.

PAGE 274

274 APPENDIX A MORPHOLOGICAL DATA M ATRIX FOR TRIBAL PHYLOGENY 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 Acsala anomala 1021010201 1001?00001 0101000111 000211?100 1101?110?1 ??11?11??? 0111?1?12? 0001?000?1 1? Aemene altaica 1010011201 1010100001 000101?100 ??01100101 1101?10211 ??00010111 1110103110 0101?100?1 00 Barsinella mirabilis 001???1201 1110100001 0020000011 1002100101 0101?101?0 1001?11??? 10001????? ?????????? ?? Bruceia hubbardi 11?01?1001 1000000001 0101000211 101??1?001 00101110?1 ??01?11??? 111011?111 00000000?1 1? Bruceia pulverina 11?01?1101 1000000001 0001000011 101??1?001 00101110?1 ??01?11??? 2110102111 00000000?1 00 Cisthene plumbea 0010011201 1000100001 0001001001 000111?101 01000110?1 ??11?01??? 2010002111 1001?00311 00 Cisthene subjecta 0010011201 1000100001 0001001211 000211?101 01000110?1 ??11?01??? 2010002111 1000110301 1? Clemensia albata 0010011211 1100000001 000101?101 0100100101 1100110231 ??11?10011 200001?110 0000110310 00 Clemensia leopardina 0010011211 1100000001 000101?101 0100100101 1100010231 ??11?10011 200001?110 0000110310 1? Dolichesia falsimonia 0010011201 1110100010 1?01000001 0001103101 11100110?1 ??11?01??? 0??0100111 0000010101 1? Euthyone grisescens 01?01?1001 1000000001 0011000211 000101?101 11001110?1 ??01?01??? 1010000010 11000000?1 01 Euthyone simplex 11?11?1001 1000000001 0011000211 0000002100 1111?110?1 ??01?11??? 101001?110 00000000?1 1? Gaudeator paidicus 1010011211 1000000001 0011000201 100111?101 11100110?1 ??01?01??? 0110101111 1100110110 1? Haematomis mexicana 11?01?1101 1000000001 00010??211 101??1?001 00101110?1 ??01?11??? 2110102111 11000000?1 1?

PAGE 275

275 Hypermaepha maroniensis 0010011201 1011?00010 1?111??211 1100100100 1101?110?1 ??00011??? 0110102010 0100000101 00 Hypoprepia cadaverosa 1011011211 1000000001 1?11000201 0001100101 1101?110?0 1001?11??? 201011?110 0000000201 00 Hypoprepia fucosa 1010011211 1000000001 1?11000201 0001100101 1101?110?0 1001?11??? 201011??10 1??0000201 1? Hypoprepia inculta 1011011201 1000000001 1?11000201 0001100101 0101?110?0 1001?11??? 2010101110 0100000201 00 Lycomorpha fulgens 1011010101 1000000010 1?01001001 0000100101 0001?110?1 ??01?11??? 2110000110 1101?10101 1? Lycomorpha fulgens nr. 1010011101 1000000010 1?01001001 0000100101 00000110?1 ??01?01??? 2110000111 1100010101 1? Lycomorpha grotei 1010011101 1000000010 1?01001001 0000100101 11000110?1 ??01?01??? 2100000111 1100010101 1? Lycomorpha pholus 1011010101 1000000010 1?01001001 0000100101 0101?110?1 ??01?01??? 211000312? 1100010101 1? Lycomorpha splendens 1021011101 1000000010 1?01001001 0000100101 01000110?1 ??11?11??? 2111?03111 1101?000?1 1? Lycomorphodes correbioides 0010011201 1000100010 1?11000301 0100100001 0011?110?1 ??01?01??? 1111?1?111 0101?10101 1? Metalobosia elis 0010011211 1010000001 1?20000301 101??1?000 0100110221 ??01?10100 011011?110 0001?10300 01 Nodozana jucunda 0010011?01 1000000001 0000001211 0001100001 1101?110?0 1011?01??? 0001?03111 1101?10310 1? Odozana floccosa 0010011211 1110000001 1?20000001 111??1?001 11100110?1 ??01?01??? 0011?03110 0000010310 00 Prepiella aurea 0010011201 1000100001 0011000201 010011?101 11101110?0 1011?11??? 110001?110 0001?10300 00 Prepiella radicans 1021021211 1100100001 0011000210 ??1??00101 11100101?0 1011?10101 0111?00010 00000100?1 1? Propyria morelosia 1010010101 1000000010 1?11000001 0001100101 00000110?1 ??01?11??? 2010000111 1100010101 01 Propyria 1010010101 1000000010 1?11001001 0000100101 00000110?1 ??01?11??? 2110003111 1101?10101 1?

PAGE 276

276 pytchoglene Pytchoglene coccinea 0010011201 1100000001 1?11000201 000111?101 11000110?0 1011?11??? 111011?010 1001?10211 00 Pytchoglene erythrophora 0010010211 1000000001 1?11000001 0000100101 11000010?0 1001?11??? 100010310? 1100110200 00 Pytchoglene sanguineola 0010010211 1000000001 1?11000001 0000100101 110??010?0 1001?11??? 100010310? 1100110200 00 Rhabdatomis coroides 0010011101 1000000001 0011001301 100211?100 1101?110?1 ??00110100 2011?1?110 0101?000?1 1? Rhabdatomis pueblae 0010011101 1000000001 0011001311 100211?100 11000110?0 0101?10101 0011?00110 0101?100?1 1? Talara coccinea 0010011201 1010100010 1?01001301 0100100101 11100110?1 ??01?01??? 0?11?01010 0101?10101 00 Talara megaspila 001???1201 1010100010 1?01001301 0100100101 11101110?1 ??11?01??? 0011?????? ?????????? ?? Setina aurita 101???0201 1000100001 010101?111 1000100100 1100000221 ??11?10101 11101????? ?????????? ?? Setina irrorella 1010011201 1010100001 010101?111 1000100100 1100000221 ??11?10101 1110103111 0000000301 00 Stigmatophora flava 1010011211 1100100001 010101?111 1000100100 1100000220 1010110100 1000100011 1100000301 00 Eudesmia arida 1011011211 1000100001 0001000201 000011?111 11001110?1 ??00111??? 011011?011 00000100?1 01 Eudesmia praxis 1011011211 1000100001 0001000201 100011?111 11001110?1 ??00111??? 011011?011 10000100?1 01 Eudesmia ruficollis 1010011211 1000100001 0001000201 0000100111 10001110?1 ??00111??? 0101?0112? 0101?000?1 1? Euryptidia ira 0010011201 1100100001 0001001201 000011?101 11001110?1 ??11?11??? 111011?110 00000100?1 01 Euryptidia univitta 1011011211 1000100001 0001000201 0000100101 11001110?1 ??00111??? 1110101111 01000100?1 01 Josioides celena 0010011211 1000100001 0001001211 1000100111 11001110?1 ??00111??? 1101?01111 00000100?1 01 Josioides myrrha 0010011211 1000100001 0001001211 1000100111 11001110?1 ??00111??? 1101?01110 00000100?1 01

PAGE 277

277 Apistosia judas 1021011210 1100100001 1?0101?110 ??0211?100 0101?00210 0010011??? 0110101010 1101?100?1 1? Crambidia pallida 0010011201 1110101101 1?11???011 0002100101 1101?00201 ??11?00001 0?11?1?110 1101?01??? 1? Cybosia mesomella 0010011211 1010000001 010101?211 000111?101 1111?00201 ??11?00100 401011??11 0000010101 00 Eilema bicolor 001???1201 1110101001 1?11???211 0002000101 1110100221 ??01?00100 00101????? ?????????? ?? Eilema bipuncta 0010011211 1110001001 1?111??211 0001100101 1111?00220 1111?00111 001001?111 11001100?1 1? Eilema heimi 0010011211 1110101001 1?11000001 0002000101 1100010201 ??11?10100 0011?02111 0101?100?1 01 Gardinia anoploa 1021021211 1010100001 001101?311 100211?100 01000110?0 1111?11??? 1011?0310? 1101?10101 1? Gnamptonychia flavicollis 1011011210 0100100001 1?11???111 100211?001 0101?00211 ??00011??? 0010103011 00000100?1 1? Inopsis modulata 1021020210 0100100001 010101?111 0002101001 0110100210 0010011??? 0010103011 11000100?1 1? Lithosia quadra 1010011211 1000100001 1?1101?011 000201?101 1101?00201 ??11?00100 011000012? 0000101??? 1? Lithosia sororcula 0010011211 1010101001 1?1101?001 0002000101 1101?00201 ??11?00100 0010102011 1000111??? 01 Pelosia muscerda 0010011211 1110111001 1?1101?201 1002000101 1101?10210 1011?00001 1011?1?02? 0001?000?1 01 Asura cervicalis 1021020210 1010100001 0001001201 100211?100 11000101?1 ??11?00101 1000100011 0100011??? 00 Asura strigipennis 0010011211 1110100001 0001000211 001??1?100 1101?101?1 ??11?00110 0000102111 1100010300 00 Cyana interrogationis 0010011211 1000110001 0011000101 000211?100 1100000221 ??11?10100 101011?011 0101?000?1 00 Hemipsilia coa vestis 0010011211 1000110001 00011??211 101??1?100 11101101?1 ??01?00101 1010101010 0100000300 00 Miltochrista flexuosa 0010011211 1000100001 0001000101 000011?100 11001101?1 ??01?10110 1000101111 1100010300 00 Miltochrista gratiosa 0010011211 1000100001 0101000201 000011?111 11001101?1 ??01?10010 1000103111 11000100?1 00

PAGE 278

278 Paidia murina 101???1211 1001?00001 0011000111 1002101100 1100000220 1111?10110 00001????? ?????????? ?? Phryganopteryx convergens 0010011201 1?00100001 0101???201 010111?101 0101?10210 1110001??? 0001?03111 00000000?1 00 Ardonea moria 1021011211 1010100001 1?01000311 1001100100 1101?110?0 1001?01??? 1111?03111 1100110101 1? Ardonea peculiaris 0010011211 1010100001 1?00000311 001??1?100 10100110?0 1111?01??? 2011?0010? 0001?10101 00 Balbura intervenata 0010011201 1?10100001 0000000311 011??1?101 0101?110?0 1111?11??? 1011?1?110 0001?11??? 00 Epeiromulona icterinus 1010011211 1000000001 1?11000101 100111?101 11101110?0 0001?00111 001011?110 00000100?1 1? Eurylomia cordula 01?01?1201 0000100001 1?0101?110 ??02100100 0100000210 0010011??? 0110100110 11000100?1 1? Heliosia jacunda 0010011201 1000000001 1?0101?110 ??01100100 11101101?0 1111?10111 1011?1?110 00000100?1 01 Oeonistis entella 1020011211 1100100001 010101?311 100011?101 1111?00221 ??10100101 0011?0010? 11000000?1 01 Paramulona nephalistis 1021021201 1?00100001 1?11000101 000211?101 1101?010?1 ??01?10111 101011?110 0100110310 01 Pagara simplex 1021021200 1100100001 0001???111 100211?101 0011?10221 ??11?10000 111001?111 0110101??? 01 Asota heliconia 1001001211 1100100000 0001002111 1101100101 1100?00201 ??11?10011 001001?02? 1110001??? 00

PAGE 279

279 APPENDIX B CHARACTER DIAGNOSTICS FOR STRICT CONSENS US TREE Character Number Best Fit Worst Fit Tree Steps CI RI 0 1 38 22 0.045 0.432 1 1 6 2 0.500 0.800 2 2 12 11 0.182 0.100 3 1 20 16 0.062 0.211 4 1 6 2 0.500 0.800 5 2 7 7 0.286 0.000 6 1 10 9 0.111 0.111 7 2 14 4 0.500 0.833 8 1 39 24 0.042 0.395 9 1 5 4 0.250 0.250 10 1 3 2 0.500 0.500 11 1 21 16 0.62 0.250 12 1 22 16 0.062 0.286 13 1 3 3 0.333 0.000 14 1 30 14 0.071 0.552 15 1 3 3 0.333 0.000 16 1 6 2 0.500 0.800 17 1 1 1 1.000 0/0 18 1 12 6 0.167 0.545 19 1 13 7 0.143 0.500 20 1 35 18 0.056 0.500 21 1 10 9 0.111 0.111 22 2 33 22 0.091 0.355 23 1 6 5 0.200 0.200 24 1 3 3 0.333 0.000 25 1 16 9 0.111 0.467 26 2 18 12 0.167 0.375 27 3 41 38 0.097 0.378 28 1 37 25 0.040 0.333 29 1 5 4 0.250 0.250 30 1 27 19 0.053 0.308 31 1 11 10 0.100 0.100 32 1 10 6 0.167 0.444 33 2 39 27 0.074 0.324 34 1 7 4 0.250 0.500 35 1 35 24 0.042 0.324 36 3 4 4 0.750 0.000 37 1 9 6 0.167 0.375 38 1 6 3 0.333 0.600 39 1 21 16 0.062 0.250 40 1 23 14 0.071 0.409 41 1 11 9 0.111 0.200 42 1 22 20 0.050 0.095

PAGE 280

280 43 1 28 24 0.042 0.148 44 1 22 12 0.083 0.476 45 1 20 13 0.077 0.368 46 1 33 16 0.062 0.531 47 2 33 17 0.118 0.516 48 3 15 10 0.300 0.417 49 1 25 20 0.050 0.208 50 1 5 3 0.333 0.500 51 1 8 8 0.125 0.000 52 1 38 21 0.048 0.459 53 1 16 8 0.125 0.533 54 1 7 4 0.250 0.500 55 1 28 23 0.043 0.185 56 1 31 16 0.062 0.500 57 1 7 5 0.200 0.333 58 1 12 8 0.125 0.364 59 1 14 13 0.077 0.077 60 3 48 30 0.100 0.400 61 1 32 20 0.050 0.387 62 1 18 13 0.077 0.294 63 1 23 19 0.053 0.182 64 1 17 10 0.100 0.438 65 1 26 23 0.043 0.120 66 3 32 26 0.115 0.207 67 1 17 15 0.067 0.125 68 2 11 10 0.200 0.111 69 1 28 21 0.048 0.259 70 1 32 22 0.045 0.323 71 1 31 27 0.037 0.133 72 1 2 1 1.000 1.000 73 1 23 22 0.045 0.045 74 1 12 8 0.125 0.364 75 1 25 18 0.056 0.292 76 1 7 6 0.167 0.167 77 3 35 23 0.130 0.375 78 1 8 7 0.143 0.143 79 1 13 8 0.125 0.417 80 1 31 22 0.045 0.300 81 1 16 10 0.100 0.400

PAGE 281

281 APPENDIX C DATA MATRIX USED TO PRODUCE TREES BASED ON MOLECULAR DATA [28S] Acsala anomala ---------AAAATAGGACCAGGCATAGTTCACGTTTTTTCGGGTCCCAGCAGCGCGGCTCAGAGTG ---CGACTACATT CAC GGAGCAGAAACGAGACGCCTCGGGAGTGCGAGAGATCGACCTAGATCGACGCTCCATCCTCCCTGAGCGCGCGGC AAGCGCACGCCTTCACTTTCGTTGCGCCTTTCAGTTTTATCATCTCAATGACTCGCAT ACATGCTAGACTCCTTGGTC CGTGTTTCAAGACGGG TCCTGCGAGTGCCCGAA ------------ACTGAATCATC GCAGACAGAGA ---CGCGCACAGTCCG A GACTGCACGGCTGCAACAACAGACGCGT CGCACTCACGTCCGCGCCAAGGCGGTACAAAGGATACGACGTTGA ---CTTGCGTCG --GGCCGGACGCGTTATGAACGCGTGCGCGTTTCGTCAGA -----ACTACCGTCCGACGGCCGGTCGGC CACCGTCGCGGTCCCACAGACCCCGT GAAGGATCCGTG--GGGCTCCCGGACGGC ---GCTTAGACCGACATCGAACG GGTCGCGATGTAT -----TTACTAAGAGA----GAAGTGCACGCCGTCCGCGGACGTCGACGGACGCGCGTCGTGCACG CCG ---------------------------------------------------------------------------------------------------------------------------------------------------------------Agylla septentrionalis -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asura cervicalis ----GTACGTGA AACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTCCG CGGCGTACTGGC GCGCGCTTCGATGTCG -------TCGGCCTCGGTCGGC---------------GCGCACGACGCGCGTCTGTC GACGTCCGCG GTGGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCCATCGGACCCC--TCACCGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTG C CGCCAAAGCGCG -----GACGCGAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTC TGT ----------CTGCGATGATTCAGT TTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTA TGCGAGTCATTGAGATTATA --AAACTGAAAGGCG TAACGAAAGTGAAGGCGCGCGCTAGCCGCGCGCTCAGGGAG GATGGAGCGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGCAGGCGC GCTCTGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTATGC ------------Asura polyspila

PAGE 282

282 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGGGTCTTT TGGGACCG CGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTAAGCGCG -----GACGTGAGTGCGGCGCGTCTGT TGTTGCC GC CGTGTCAGTCTCGGACTGTGCGCGTCTCTGT----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTG AAACACGGACCAAGGAGTCTAGCATGTATGCGAGTCATTGAGATAATA--AAACTGAAAGGCG TAACGAAAGTGAAGG CGCGCGCTCGCCGCGCGCTCAGGGAGGATGGAGCGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGT CTCGTTTCCAATCCGTGAATGTAGGCGCGCTCTGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTA TGCCTGGTCAGCTTTA Atolmis rubricollis ----GTACGTGAAACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTCCT CGGCGTACGAACGCGCGCTTCGATGTCG -------TCGGCTTCGGTCGGC ----------------GTGCACGACGCGCGTCCGTCG ACGTCCGAG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---GC CGTTCGGAAGCCCCACTGACCCT -TCACGGGGTC TC TGGGACCGGTATTGCGGTGGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CA ACGTCGTAT CTTGCGTAC C GCCTAAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTCTGT ---------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGC GAGTCATTGAGATAATA--AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGA GGAT GGAGCGTCGATCTCGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGCT CTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGC ------------Bruceia hubbardi ---------TAAAGCTGACCAGGCATAGTTCACCATCTTTCGGGTCCCAGCATTTATGCTCAGAGCG ---CGCCTACAT T CAC GGATTGGAAACGAGACGCCTCGGGAGTGCGAGAGATCGACCTAGATCGACGCTCCATCCTCCCTGAGCGCGCGGC GAGCGCGCGCCTTCACTTTCGTTACGCCTTTCAGTTTTATTATCTCAATGACTCGCAT ACATGCTAGACTCCTTGGTC CGTGTTTCAAGACGGGTCCTGCGAGTGCCCGAA ------------ACTGAATCATC GCAGACAGAGA ---CGCGCACAGTCCG A GACTGCACGGCTGCAACAAC AGACGCGCCGCACCTGCGTCCGCTCTTGGGCGGTACGCAGGATACGACGTTGA ---CTTGCGTCG --GGCCGGACGCGTTGTAAACGCGTGCGCGTTTCGTCAGA -----ACTACCGTCCGACGGCCGGTCGGC CACCGTCGCGGTCCCACAGACCCCGTGAAGGATCCGTG --GGGCTCCCGAACGGC---GCTTAGACCGACATCGAACG GGTCGCGATGTAT -----TTACTAA GAGA ----GAAGTGCACGCCGTCCGCGGACGTCGACGGAAGAGCGTCGTGCACG CCGACCGAGATCGACGACATCGA -----AACGCGCTGCCGTACGCCGCGGAGTGACGATGAATCTC --------TCCGTTCGT TCATTCGAGTTTCG ------CAGGTTTACCCCTGAACG ----------------GTTTCACGTACTCCCCTA --------Bruceia pulverina

PAGE 283

283 -------------------------------------------------------------------ATTCATCGTCATTCCGCGGCGTACGGACGCGCGCTTCGATGTCG ------TCGGCCTCGGTCGGC----------------GTGCACGACGCGCGTACGTCGACGTCCGCG GACGGCGTGCACTTCT ---CT CTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---GC CGTTCGGGAGCCCCAT TGTGCCT --TCACG GGTAT AG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGCGCACGCGT TTAC A ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTCACGTACCGCCTCAGCGCG -----GACGCGGGTGCGGCG CGTCTGCGTATCGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTCTGT ----------CTGCG ATGATTCAGTTTCGGGCAC TCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGCGAGTCATTGAGACAATA --AAACTGAAAGG CG CAACGAAAGTGAAGGCGCGCGCTAGCCGCGCGCTCAGGGAGGATGGAGCGTCGATCTCGGTCGATCTCTCGC ACTCC---------CGAGGCGTCTCGTTTCCAATC----------------------------------------------------------------------------------------Calamidia hirta ----GTACGTGAAACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTCCG CGGCGTACGGAC GCGCGCTTCGATGTCG -------TCGGCCTCGGTCGGC---------------GTGCACGACGCGCGTACGTC GACGTCCGCG GACGGCGTGCAC TTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCCAT TGATCCT -TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCACG ACGCAAG T CAACGTCGTAT CTTGCGTACCGCCTAAGCGCG -----GACGTAAGTGCGGCGCGTCTGTTGTTGCAGCCGTT CAGTCTCGGACTGTGCGCGTCTCTGT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGC GAGTCATTGAGATAATA--AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGAT GGAGCTTCGATCTAGGTCGTACTCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGCT CTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGC ------------Cisthene juanita GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CGCGGCGTACGGAC GCGCGCTTCGATGTAG -------TCGGCCTCGGTCGGC ---------------TTGCACGACGCGCGTCCGT CGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCAT GGATCCT --TCACGGGATC TT TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTAAA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTTCGTAC CGCCTAAGCGCG -----GACGCAAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTTGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGTCAGCTT Cisthene plumbea

PAGE 284

284 ---------TAAAGCTGACCAGGCATAGTTCACCATCTTTCGGGTCCCAGCATTTATGCTCAGAGCG ---CGCCTACATT CAC GGATTGGAAACGAGACGCCTCGGGAGTGCGAGAGATCGACCTAGATCGACGCTCCATCCTCCCTGAGCGCGCGGC AAGCGCGCGCCTTCACTTTCGTTACGCCTTTCAGTTTTATTATCTCAATGACTCGCAT ACATGCTAGACTCCTTGGTC CGTGTTTCAAGACGGGTCCTGCGAGTGCCCGAA ------------ACTGAATCATC GCAGACAGAGA ---CGCGCACAGTCCG A GACTGCACGGCAGCAACAACAGACGCGCCGCACTTACGTCCGCGCTTAGGCGGTACGCAAGATACGACGTTGA ---CTTGCGTCG --GGCCGGACGCGTTATAAACGCGTGCGCGTTTCGTCAGA -----ACTACCGTCCGACGGCCGGTCGGC CACCGTCGCGGTCCCAAAGATCCCGTGAAGGATCCATG --GGGCTCCCGAACGGC---GCTTAGACCGACATCGAACG GGTCGCGATGTAT -----TTACTAAGAGA----GAAGTGCACGCCGTCCGCGGACGTCGACGGACGCGCGTCGTGCGAG CCGACCGAGGCCGACTACATCGA -----AGCGCGCGTCCGTACGCCGCGGAATGACGATGAATCTC --------TCCGTTCGT TCATTCGAGTTTCG ------CAGGTTTACCCCTGAACG ----------------GTTTCACGTACTCCCCTAT -------Cisthene subjecta GGGAGT ACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CGCGGCGTACGGAC GCGCGGCTCGATGCCC------GCCGGTCTCGATCGGC ----------------GGGCACGACGCGCGTCC GTCGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAT -----ACGACAT CGCGACCCGTTCGATGTCGGTCTAAG C ---GCCGCG CGGGAGTCCCGT CGCCCCC--CCTCGGGGTGGTGATTGGACCGCTG---CGGTCGCCGACCGGCGGTC GGACGGTAGCTTCGACGAATCGCGCACGCGT TTACACACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CCAA CGTCTACGCCCGAGTGCG -----GACGTAGGTGCGGCGCGTCTGT CGTCGCAGCCGTG CTGTCTCGGACTGTGCGCG TCTCTGT----------CTGCGATGATTCTGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCA TGTATGCGAGTCATTGAGATGACAACAAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTAGCCGCGCGCTCA GGGAGGATGGAA ATGCGGTCTAGGTCGCACTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGC AGGCGCGCTCTGAG CATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGTCAGCTT Cisthene tenuifascia ---------TTAAGCTGACCAGGCATAGTTCACCATCTTTCGGGTCCCAGCATTTATGCTCAGAGCG ---CGCCTACATT CAC GGATTGGAAACGAGACGCCTCGGGAGTGCGAGAGATCGACCTAGATCGACGCTCCATCCTCCCTGAGCGCGCGGC AAGCGCGCG CCTTCACTTTCGTTACGCCTTTCAGTTTTATTATCTCAATGACTCGCAT ACATGCTAGACTCCTTGGTC CGTGTTTCAAGACGGGTCCTGCGAGTGCCCGAA ------------ACTGAATCATC GCAGACAGAGA ---CGCGCACAGTCCG A GACTGCACGGCAGCAACAACAGACGCGCCGCACTTACGTCCGCGCTTAGGCGGTACGCAAGATACGACGTTGA ---CTTGCGTCG --GGCCGGA CGCGTTATAAACGCGTGCGCGTTTCGTCAGA -----ACTACCGTCCGACGGCCGGTCGGC CACCGTCGCGGTCCCACAGAACCCGTGAAGGATCCATG --GGGCTCCCGAACGGC---GCTTAGACCGACATCGAACG GGTCACG ATGTAT -----TTACTAAGAGA----GAAGTGCACGCCGTCCGCGGACGTCGACGGACGCGCGTCGTGCGAG CCGACCGAGGCCGACTACATCGA -----AGCGCG CGTCCGTACGCCGCGGAATGACGATGAATCTC--------TCCGTTCGT TCATTCGAGTTTCG ------CAGGTTTACCCCTGAACGGTTTCACGTACTCCCCTATAGTGAGTCGTATTAAA --------Crambidia lithosioides

PAGE 285

285 GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCACTC CCCGGCGTACGGAC GCG CGCTTCGATGTCG -------TCGACCTCGGTCGGC---------------GTGCACGACGCGCGTACGT CGACGTCCGGG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCAT GGACCCT -TCACGGGGTA CG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGC ACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTCAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGC G CAACGAAAGTGAAGGCGCGCGCTTGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGTCAGCTT Cyana meyricki ----GTACGTGAAACCGTTCAGGGGTA ------AACCTG CGAAACTC GAATGAACGAACGGAGAGATTCATCGTTATTCCG CGGCGTACTGAC GCGCGATTCGATGTCG-------TCGGCTTAGGTCGGC ----------------GCGCACGACGCGTGTCTGTCG ACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---GC CGTTCGGGAGCCCCAT GGATCCT --TCACGGGGTC T A TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACGG TATTACTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAAAGTCGTAT CTTACGTACCG CCTAAGCGCG -----GACGTGAGTGCGGCTCGTCTGT TGTTGCAGCCGTGCAGTCTCGGACTGTGCGCGTCTCTGT ---------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAA CACGGACCAAGGAGTCTAGCATGTATGCGA GTCATTGAGATTATA --AAACTGAAAGGCG TAACGAAAGTGAAGGCGTGCGCTCGTCGCGCGCTCAGGGAGGATGGA G CGTCGATCTAGGTCGATCTCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATTCGTGAATGTAGGCGCGCTCTG AGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGC ------------Cybosia mesomella ----GTACGTGAAACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTCCA CGGCGTACGGAC GCGCGCTTCGATGTCG -------TCGACCTCGGTCGGC----------------GTGCACGACGCGCGTCCGTCG ACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---GC CGTTCGGGAGCCCCAT GGACCCT --TCGCGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTAAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGC ------------Eilema bicolor

PAGE 286

286 ---AGTACGTGAAACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCACTCCT C GGCGTACGGAC GCGCGGTTCGATGTCG-------TCGACCTCGGTCGGC----------------GTGCACGACGCGCGTACGTCG ACGTCCGAG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---GC CGTTCGGGAGCCCCAT GGACCCT --TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACGG TAG TTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC C GCCTTAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCAGCCGTGCAGTCTCGGACTGTGCGCGTCTCTGT--------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGCG AGTCATTGAGATAAT A --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGATG GAGCGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGCTC TGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTATGCCTGGT-------Eilema complana -----------------------------------------------------GAACGAACGGAGAGATTCATCGTCACTCCTCGGCGTACGGAC GCGCGCTT CGATGTCG -------TCGACCTCGGTCGGC----------------GTGCACGACGCGCGTACGTCGACGTCCGTG GACGGCGTGCA CTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC ---GCCGTTCGGGAGCCCCAT TGACC CT --TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGTGCACG CGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGTGTAC CGCCTCAGCGCG -----GACGTAAGT GCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTGT ----------CTGCGATGATTCAGTTTCG GGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGCGAGTCATTGAGATAATA-AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGATGGAGCGTCGATCTAGGT CGACCTCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGCTCTGAGCATAAATGCTGG GA --------------------------------------------------Eilema dorsalis GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCACTC CTCGGCGTACGGACGCGCGCTTCGATGTCG -------TCGACCTCGGTCGGC---------------GTGCACGACGCGCGTCCGT CGACGTCCGGG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCAT GGACCCT -TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTAAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CA GTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGTCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAA TGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Eilema griseola

PAGE 287

287 GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCACTC CTCGGCGTACGGACGCGCGCTTCGATGTCG -------TCGACCTCGGTCGGC---------------GTGC ACGACGCGCGTCCGT CGACGTCCGAG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCACGGTCCCT --TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGC GTAC CGCCTAAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGA TGGAG CGT CGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Eilema plana ---AGTACGTGAAACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCACTCCT CGGCGTACGGAC GCGCGCTTCGATGTCG -------TCGATCTCGGTCGGC ----------------GTGCACGACGCGCGTCCGTCG ACGTCCTTG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---GC CGTTCGGGAGCCCCACGGACCCT --TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TYATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCCAAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGA TAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Eilema sp.1 GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CTCGGCGTACGGACGCGCGCTTCGATGTCG -------TCGGCCTCGGTCGGC----------------GTGCACGACGCGCGTCCGT CGACGTCCGGG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCAT GGACC CT -TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTAAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCG CAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGT GAACTATGCCTGGT -------Eilema sp.2

PAGE 288

288 GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCACCGTCATTC CGCGGCGTACTGGC GCGCGTATCGATGTCG -------TCGGCTTCGGTCGGC ---------------GTGCACGACGCGCGTCTGA CGATGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT A CAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCATTGGGCCCT --TCACGGGGTCTTT TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGA CGGTAGTTCTGACGAAACGCGCACGCGT TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTA C CGCCTAAGCGCG -----GACGTGAGTGCGGCGCGTCTGT TGTTGCTGCCGTG CAGTCT CGGACTGTGCGCGTCTCT GT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTAT GCGAGTCATTGAGATAATA --AAACTGAAAGGCG TAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGG ATGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC ---------CGAGGCGTCTCGTTTCCAATCCGTGAATGTA GGCGCG CTCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Eilema sp.3 GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCACTC CTCGGCGTACGGACGCGCGCTTCGATGTCG -------TCGACCTCGGTCGGC---------------GTGCACGACGCG CGTCCGT CGACGTCCGAG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCAT GGACCCT -TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CG CCTAAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCTGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTTGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAG GTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Eilema sp.4 -----------------------------------------------------GAACGAACGGAGAGATTCATCGTCACTCCTCGGCGTACGGAC GCGCGCTT CGATGTCG -------TCGATCTCGATCGGC ----------------GTGCACGACGCGCGTCCGTCGACGTCCGAG GACGGCGTGCA CTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC ---GCCGTTCGGGAGCCCCAT GGAC CCT --TCGCGGGGTC TA TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGCGCAC GC GT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTAAGCGCG -----GACGTAAG TGCGTCGCGTCTGTTGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTGT ----------CTGCGATGATTCAGTTTC GGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGCGAGTCATTGAGATAATA --AAACT GAAAGGCG CA ACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGATGGAGCGTCGATCTAGGTCGATC TCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGCTCTGAGCATAAATGCTGGGACCC GAAAG -----------------ATGGTGAACTATGCCTGGT-------Gardinia anoploa

PAGE 289

289 GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CGCGGCGTACGTACGCGCGCTTCGATGTCG -------TCGACCTCGGTCGGC---------------GTGCACGACGCGCGTCCGC CGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCAT GGATCCT --TCGCGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAGCGCGCACGCGT TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTCGCGTA C CGCCTCAGCGCG -----GACGCGAGTGCGGCGCGTCTGC TGTTGCTGCCGTG CAGTCTCGGACTGTGCGCGTCTC TGT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTA TGCGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAG GATGGAGCGTCGATCTCGGTCGATCTCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATCTGTGAATGTAGGCGC GCTCTGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTATGCCTGGT-------Gnamptonychia flavicollis ---------------------------------------------------------GAACGGAGAGATTCACCGTCATTCCTCGGCGTACGGACGCGCGCTTCGA TGTCG -------TCGGCTTAGGTCGGC ----------------GTGCACGACGCGCGTACGTCGACGTCCGAG GACGGCGTGCACTT CT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---GCCGTTCGGGAGCCCCAT GGACCCT TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGCGCACGCG T TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTACCGCCTAAGCGCG -----GACGTAGGTG CGGCGCGTCTGT TGTTGCAGCCGTGCAGTCTCGGA CTGTGCGCGTCTCTGT ----------CTGCGATGATTCAGTTTCGG GCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGCGAGTCATTGAGATAATA AAACTGA AAGGCGCAACGAAAGTGAAGGCGCGCGCTTGCCGCGCGCTCAGGGAGGATGGAGCGTCGATCTAGATCGATCTC TCGCACTCC---------CGAGGCGTCTCGTTTCCAATC----------------------------------------------------------------------------------------Heliosia jucunda GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CGCGGCGTACGGAC GCGCGCTTCGATGTCG -------TCCACCTCGGTGGGC---------------GTGCACGACGCGCGTACGT CGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTCCGGGAGTCCCAT GGTTTTCCTTCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGA CGGTAGTTCTGACGAAGCGCGCACGCGT TCCAA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTAACGT AC CGCCTCAGCGCG -----GACGTTGGTGCGGCGCGTCTGT TGTTGCAGCCGTGCAGTCTCGGACTGTGCGCGTCTC TGT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTA TGCGAGTCATTGAGAATATA --AAACTGAAAGGCG TAACGAAAGTGAAGGTGCGCGCTTGCCGCGCGCTCAGGGAGG ATGGAG CGTCGATCTAGG TCGATCTCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATCTGTGAATGTAGGCGCG CTCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Hiera gyge

PAGE 290

290 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGGGTC TG TGGGACCG CGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGCGCACGCGT TT ATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTAAGCGCG -----GCCGTAAGTGCGGCGCGTCTGT TGTTGCAGC CGTG CAGTCTCGGACTGTGCGCGTCTCTGT----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTG AAACACGGACCAAGGAGTCTAGCATGTGTGCGAGTCATTGAGATAATA--AAACTGAAAGGCG CAACGAAAGTGAAG GCGCGCGCTCGCCGCGCGCTCAGGGAGGATGGAGCGTCGATCTAGGTCGATCTTTCGCACTCC---------CGAGG-------------------------------------------------------------------------------------------------------Hypoprepia cadaverosa ----------------------------------------------------------------------------CATTCCGCGGCGTACGGACGCGCGCTTCGATGTCG -------T CGGCCTCGGTCGGC ----------------GTGCACGACGCGCGTACGTCGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTA GTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC ---GCCGTTCGGGAGCCCCAT TGTGCCT -TCACGGGT AT AG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGCGCACGCGT TTACA AC GCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTCACGTAC CGCCTCAGCGCG -----GACGCGGGTGCGGCGCGT CTGCGTATCGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTCTGT----------CTGCGATGATTCAGTTTCGGGCACTCG CAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGCGAGTCATTGAGACAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTAGCCGCGCGCTCAGGGAGGATGGAGCGTCGATCTCGGTCGATCTCTCGCACT CC---------CGAGGCGTCTCGTTTCCA A ------------------------------------------------------------------------------------------Hypoprepia fucosa GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CTCGGCGTACGTACGCGCGCTTCGATGTCG -------TCGACCTCGGTCGGC---------------GCGCACGACGCGCGTCCGT CTACGTCCGCG GACGGCGTGCACTTCT ---CTCTCAGTAT -----GT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCACGGATCCT -TTACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAATCGCGCACGCGT TTACG ACGCGTCCGGCCCG ACGCAAG TCCAACGTCGTAT CTTTCGTA C CGCCCAAGCGCG -----GACGAGAGTGCGGCGCGCCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTC TGT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTA TGCGAGTCATTGAGACAATT--AAACTGAAAGGCG TAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAG G ATGGAGCGTCGATCTCGGTCGATCTCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATCTGTGAATGTAGGCGC GCTCTGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTATGCCTGGTCAGCTT Hypoprepia fucosa tricolor GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCAT CGTCATTC CTCGGCGTACGTACGCGCGCTTCGATGTCG -------TCGACCTCGGTCGGC---------------GCGCACGACGCGCGTCCGT CTACGTCCGCG GACGGCGTGCACTTCT ---CTCTCAGTAT -----GT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---

PAGE 291

291 GCCGTTCGGGAGCCCCACGGATCCT -TTACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGT CGGAC GGTAGTTCTGACGAATCGCGCACGCGT TTACG ACGCGTCCGGCCCG ACGCAAG TCCAACGTCGTAT CTTTCGTA C CGCCCAAGCGCG -----GACGAGAGTGCGGCGCGCCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTC TGT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTA TGCGAGT CATTGAGACAATT --AAACTGAAAGGCG TAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAG GATGGAGCGTCGATCTCGGTCGATCTCTCGCACTCC---------CGAGGCGTCTCGTTTCCAATCTGTGAATGTAGGCGC GCTCTGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTATGCCTGGT-------Inopsis modulata GGGAGTACGT GAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCACCGTCATTC CTCGGCGTACGGACGCGCGCTTCGATGTCG -------TCTGCTTAGGTCGGC ---------------GTGCACGACGCGCGTCCGT CGACGTCCGAG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGA GCCCCAT GGACCCT -TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTAAGCGCG -----GACGTAGGTGCGGCGCGTCTGT TGTTGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAG TTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGTCAGCTT Lithosia quadra --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCGTCATTCC TCGGCGTACGGACGCGCGCTTCGATGTCG -------TCGGCCTCGGTCGGC----------------GTGCACGACGCGCGTCCGTC GACGTCCGGG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCAACGGACCCT --TCACGGGGTC TG TTGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCTCAGCGCG -----GACGTAAGTGCGGCGCGTCTGT TGTTGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGATAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTC TCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Lyclene pyraula --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCGTCATTCC GCGGCGTACTGGC GTGCGATTCGATG TCG -------TCGGCCTCGGTCGGC----------------GTGCACGACGCACGTCTGTC GACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAT -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G

PAGE 292

292 CCGTCCGGGAGCCCCATTGGACCCC--TCACGGGGTCTGGTGGGACCGAGA ---CGGTGGCCGACCGGCCGTCGGA CGGTAGTTCTGACGAAACGCGCACGCGT TT ACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTACGTA C CGCCTTAGCGCG -----GACGTGAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCT GT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTAT GCGAGTCATTGAGATAATA --AAACTGAAAGGCG TAACGAAAGTGAAGGTGTGCGCTTGCCGCACGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Lyclene reticulata ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lyclen e sp.1 --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCGTCATTCC GCGGCGTACTGGC GTGCGATTCGATGTCG -------TCGGCCTCGGTCGGC----------------GTGCACGACGCACGTCTGTC GACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAT -----AT ACAT CGCGACCCGTTCGATGTCGGTCTA AGC ---G CCGTCCGGGAGCCCCATTGGACCCC--TCACGGGGTCTGGTGGGACCGAGA ---CGGTGGCCGACCGGCCGTCGGA CGGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTACGTA C CGCCTTAGCGCG -----GACGTGAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCT GT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTAT GCGAGTCATTGAGATAATA --AAACTGAAAGGCG TAACGAAAGTGAAGGTGTGCGCTTGCCGCACGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGG ACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Lyclene sp.1 nr. --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCGTCATTCC GCGGCGTACTGGC GTGCGATTCGATGTCG -------TCGGCCTCGGTCGGC----------------GTGCACGACGCACGTCTGTC GACGTCCGCG G ACGGCGTGCACTTCT ---CTCTTAGTAT -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTCCGGGAGCCCCATTGGACCCC--TCACGGGGTCTGGTGGGACCGAGA ---CGGTGGCCGACCGGCCGTCGGA CGGTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTACGTA C CGCCTTAGCGCG -----GACGT GAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCT GT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTAT GCGAGTCATTGAGATAATA --AAACTGAAAGGCG TAACGAAAGTGAAGGTGTGCGCTTGCCGCACGCTCAGGGAGGA

PAGE 293

293 TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCC -----------Lycomorpha pholus GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CGCGGCGTACGGAC GCGCGCTTCGATGTCG -------TCGGCCTCGGTCGGC----------------GTGCACGACGCGTTTCCGT CGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCAT GGATCCT --TCACGGGATC TT TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGT AGTTCTGACGAAACGCGCACGCGT TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCAAAGCGCG -----GACGCAAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGAT GATA --AAACTGAAAGGCG TAACGAAAGTGAAGGCGCGCGCTTGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGTCAGCTT Lycomorphodes sordida -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGGATC TT TGGGACCG CGA ---CGGTGGCCGACCGGCCGTCGGACGGTAGTTCTGACGAAACGCGCACGCGT TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTAC CGCCAAAGCGCG -----GACGCAAGTGCGGCGCGTCTGT TGTTGCAGC CGTG CAGTCTCGGACTGTGCGCGTCTCTGT----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTG AAACACGGACCAAGGAGTCTAGCATGTATGCGAGTCATTGAGATAATA--AAACTGAAAGGCG TAACGAAAGTGAAGG CGCGCGCTTGCCGTGCGCTCAGGGAGGATGGAGCTTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTC TCGTTTCCAATCCGTGAATGTAGGCGCGCTCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTAT GCCTGGTCAGCTTTA Meterhythosia sangala ---------TAAAACGGACCAAGCATAGTTCACCATCTTTCGGGTCCCAGCATTTATGATCAGAGCG ---CGCCTACATT CATG GATTGGAAACGAGACGCCTCGGGAGTGCGAGAGATCGACCTAGATCGACGCTCCATCCTCCCTGAGCGCGCGGCA AGCGCGCGCCTTCACTTTCGTTACGCCTTTCAGTTTTATCATC TCAATGACTCGCAT ACATGCTAGACTCCTTGGTCC GTGTTTCAAGACGGGTCCTGCGAGTGCCCGAA ------------ACTGAATCATC GCAGACAGAKA---MRCGCACAGTCCGA GACTGCACGGCTGCAACAACAGACGCGCCGCACTTGCGTCCGCGCTTTGGCGGTACGCAAGATACGACGTTGA --CTTGCGTCG --GGCCGGACGCGTTGTAAACGCGTGCGCGTTTCGTCAGA -----A CTACCGTCCGACGGCCGGTCGGCC ACCGTCGCGGTCCCAAAGATCCCGNGAAGGATCCATG --GGGCTCCCGAACGGC ---GCTTAGACCGACATCGAACGG GTCGCG ATGTAT -----TTACTAAGAGA-----GAAGTGCACGCCGTCCGCGGACGTCGACGGAAACGCGTCGTGCACGCC

PAGE 294

294 GACCGAGGCCGACGACATCGA -----AGCGCGCGTCCGTACGCCGCGGAATGACGATGAATCTC--------TCCGTTCGTTC ATTCGAGTTTCG ------CAGGTTTACCCCTGAACG -----------------GTTTCACGTACTCCCCTATAGTGA --Miltochrista miniata -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Miltochrista sp.1 --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCGTCATTC C GCGGCGTACTGGC GCGCGTTTCGATGTCG -------TCGGCCTCGGTCGGC----------------GTGCACGGCGCGCGTCTGG AGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC--GCCGTTCGGGAGCCCCATTGGGCCCT --TCACGGGGTCTTT TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGA CGG TAGTTCTGACGAAACGCGCACGCGT TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTGCGTA C CGCCTTAGCGCG -----GACGTGAGTGCGGCGCGTCTGT TGTTGCTGCCGTG CAGTCTCGGACTGTGCGCGTCTCT GT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTAT GCGAGTCATTGAGA TAATA --AAACTGAAAGGCG TAACGAAAGTGAAGGCGTGCGCTTGCCGCGCGCTCAGGGAGG ATGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC ---------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCG CTCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Prepiella aurea nr. ---------TAAAG CTGACCAGGCATAGTTCACCATCTTTCGGGTCCCAGCATTTATGCTCAGAGCG ---CGCCTACATT CAC GGATTGGAAACGAGACGCCTCGGGAGTGCGAGAGATCGACCTAGATCGATGCTCCATCCTCCCTGAGCGCGCGGC GAGCGCGCGCCTTCACTTTCGTTGCGCCTTTCAGTTTTATTATCTCAATGACTCGCAT ACATGCTAGACTCCTTGGTC CGTGTTTCAAGACGGGTCCTGCGAGTGCCCGAA ------------ACTGAATCATC GCAGACAGAGA ---CGCGCACAGTCCG A GACTGCACGGCTGCAACAACAGACGCGCCGCACCTRCGTCCGCRCTKRGGCGGTACGCAAGATACGACGTTGA ---CTTGCGTCG --GGCCGGACGCGTTGTAAACGCGTGCGCGTTTCGTCAGA -----ACTACCGTCCGACGGCCGGTCGGC CACCGTCGCGGTCCCAMAGAYCCCGNGAAGGATCCGTG --GGGCTCCCGAACGGC---GCTTAGACCGACATCGAACG GGTCGCGATGTAT -----TTACTAAGAGA----GAAGTGCACGCCGTCCGCGGACGTCGACGGAAGAGCGTCGTGCACG CCKACCGAGATCGACGACATCGA -----AACGCGCTGCCGTACGCCGCGGAGTGACGATGAATCTC --------TCCGTTCGT TCATTCGAGTT TCG ------CAGGTTTACCCCTGAACG ----------------GTTTCACGTACTCCCCTATAGTGAG Prinasura quadrilineata --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCGTCATTCC GCGGCGTACTGGC GTGCGATTCGATGTCG -------TCGGCCTCGGTCGGC----------------GTGCACGACGCACGTCTGTC

PAGE 295

295 GACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAT -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTCCGGGAGCCCCATTGGACCCC--TCACGGGGTCTGGTGGGACCGAGA ---CGGTGGCCGACCGGCCGTCGGA CGGT AGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CTTACGTA C CGCCTTAGCGCG -----GACGTGAGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCT GT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTAT GCGAGTCATTGAGAT AATA --AAACTGAAAGGCG TAACGAAAGTGAAGGTGTGCGCTTGCCGCACGCTCAGGGAGGA TGGAG CGTCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------Ptychoglene coccinea ---------TAAAGG TGACCCGGCATAGTTCACCATTTTTCGGGTCCCAGCATTTATGGTCAGAGCG ---GGCCTACATT CAC AGATTGGAAACGAGACGCCTCGGGAGTGCGAGAGATCGACCGAGATCGACGCTCCATCCTCCCTGAGCGCGCGAC TAGCGCACGCCTTCACTTTCGTTACGCCTTTCAGTTTTATWATCTCAATGACTCGCAT ACATGCTAGACTCCTTGGTC CGTGTTTCAAGACGGGTCCTGCGAGTGCCCG AA------------ACTGAATCATC GCTGACAGAGA ---CGCGCACAGTCCGA GACTGCACGGCTGCAACAAC AGGCGCGC CGCACTTTGCGTCCGCGCTGAGGGGGTATAAAGGATACGACGTTGA --CTTGCGTCG --GGCCGGACGCGTCGTAAACGCGTGCGCGATTCGTCAGA -----ACTACCGTCCGACGGCCGGTCGGC CACCGTCGCGGTCCCACAGATCCCGTGAAGGATCCRTG --GGGCTCCCGAACGGC---GCTTAGACCGACATCGAACG GGTCGCGATGTAY ----WTACTAAGAGA-----GAAGTGCACGCCGTCCGCGGACGCMGACGGACGCGCGTCGTGCGC GCCGACCGAGGCCGACGACATCGA -----AGCGCGCGTCCGTACGCCGCGGAATGACGATGAATCTC--------TCCGTTC GTTCATTCGAGTTTCG ------CAGGTTTACCCCTGAACG -----------------GTTTCACGTACTCCCCTATAGTGAG -Schistophleps albida --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCGTCATTCC GCGGCGTACGGAC GGGCGGTTCGATGTCG-------TCGGCCTCGGTCGGC----------------GTGCACGACGCTCGTACGTC GACGTCCACG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCCAT GGACCCT --TCACGGGGTC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCACG ACGCAAG T CAACGTCGTAT CTTACGTACC GCCTAAGTGCG ----GACGTGAGTGCCGCGCGTCTGT TGT CGCCGCCGTG CAGTCTCGGACTGTGCGTGTCTCTGT --------CAGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATGCG AGTCATTGAGATAATA --AAACTGAAAGGCG TAACGAAAGTGAAGGTTCGCGCTTGCCGCGTACTCAGGGAGGATGG AG TGTCGATCTAGGTCGACCTCTCGCACTCC ---------CGAGGCGTCTCGTTT CCAATCTGTGAATGTAGGCGCGCTCT GAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT-------Amata aperta ----GTACGTGAAACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTCCG CGGCGTACGGGCTGCGCGGTTCGATGTCG-------TCGACCTCGGTCGTC----------------AGGCACGACGCGCGTCCGTC

PAGE 296

296 GACGTCCGCG GAGGGCGTGCACTTCT ---CTCTTAGTAA -----AT GCAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCCGCGGTCCCT --TCACGGGGTC CG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGATGAAGCGCGCACGCGT TTACA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CCAACGTA C CGCCTCAGCGCG -----GACGTAGGTGCGGCGCGTCTGC TGTTGCCGCCGTG CAGTCTCGGACTGTGCGCGTCTC TGT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTA TGCGAGTCATTGAGACAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGTGCGCGCTAGACGCGCGCTCAGGGAGGA TGGAGCTTCGATCTAGGTCGTACTCTCGCACTCC ---------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGC GCTCTGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTATGC ------------Pagara simplex GGGAGTACGTGAAACCGTTCAGGGGTA -------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCGTCATTC CTCGGCGTACGGGCTGCGCGATTCGATGTCG -------TCGACCTCGGTCGTC----------------AGGCACGACGCGCGTCCG TCGACGTCCGCG GACGGCGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC-GCCGTTCGGGAGCCCCAT AGTCCCCGGTCACGGGGTCTG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGG ACGGT AGTTCTGACGAAACGCGCACGCGT TTTTA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CCAACGT AC CGCCTCAGCGCG -----GACGTAGGTGCGGCGCGTCTGT TGTTGCAGCCGTGCAGTCTCGGACTGTGCGCGTCTC TGT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTA TGCGAGTCATTGAGAT AATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAG GATGGAGCATCGATCTAGGTCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGC GCTCTGAGCATAAATGCTGGGACCCGAAAG-----------------ATGGTGAACTATGCCTGGTCTGCTT-Asota heliconia ----GTACGTGAAACCGTT CAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCTTCATTCCC CGGCGTACGGAC GCGCGGTTCGATGTCG-------TCGGCCTCGGTCGGC---------------CGGCACGACGCGCGCACGTC GACGTCCGTG GAGGTTGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCCGCTCACCCT --TCGCGGGGTGTG TGGGACCGCGA ---CGGTTGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CCAACGTACCGCCTCAGCGCG -----GACGTAGGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCA CTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGACAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTCGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTCGATCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------A TGGTGAACTATGC ------------Asota orbona

PAGE 297

297 ----GTACGTGAAACCGTTCAGGGGTA ------AACCTGCGAAACTC GAATGAACGAACGGAGAGATTCATCTTCATTCCC CGGCGTACGGGC GCGCGGTACGATGTCG -------TCGGCCTCGGTCGGC---------------CGGCACGACGCGCGCACGTC GACGTCCGGG GAGGTTGTGCACTTCT ---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCCGCTTACCCTT --TCACGGGGTA TG TGGGACCGCGA ---CGGTTGCCGACCGGCCGTCGGACG GTAGTTCTGACGAAACGCGCACGCGT TTATA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTAT CCAACGTACCGCCTCAGCGCG -----GACGTAKGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCTG T ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTATG CGAGTCATTGAGACAATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTTGCCGCGCGCTCAGGGAGGA TGGAG CGTCGATCTCGATCGATCTCTCGCACTCC--------CGAGGCGTCTCGTTTCCAATCCGT GAATGTAGGCGCGC TCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGC ------------Neochera dominia --GAGTACGTGAAACCGTTCAGGGGTA-------AACCTGCGAAACTCGAATGAACGAACGGAGAGATTCATCTTCATTCC GCGGCGTACGGAC GCGCGATTCGATGTCG -------TCTACTTCGGTCGGC---------------CGGCACGACGTGCGTACGTC GACGTCCGCG GAGGTAGTGCACTTCT---CTCTTAGTAA -----AT ACAT CGCGACCCGTTCGATGTCGGTCTAAGC---G CCGTTCGGGAGCCCCACGGACCCC--TTACGGGGCC TG TGGGACCGCGA ---CGGTGGCCGACCGGCCGTCGGAC GGTAGTTCTGACGAAACGCGCACGCGT TTTCA ACGCGTCCGGCCCG ACGCAAG T CAACGTCGTATCCTTGCGTA C CGCCTCAGCGCG -----GACGTAGGTGCGGCGCGTCTGT TGTTGCAGCCGTG CAGTCTCGGACTGTGCGCGTCTCT GT ----------CTGCGATGATTCAGTTTCGGGCACTCGCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAGCATGTAT GCGAGTCATTGAGATTATA --AAACTGAAAGGCG CAACGAAAGTGAAGGCGCGCGCTTGCCGCACGCTCAGGGAGG ATGGA G CGTCGATCTAGGTCGATCTCTCGCACTCC ---------CGAGGCGTCTCGTTTCCAATCCGTGAATGTAGGCGCG CTCTGAGCATAAATGCTGGGACCCGAAAG -----------------ATGGTGAACTATGCCTGGT -------[COI] Acsala anomala ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Agylla septentrionalis ------------------------TCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAAC ATCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTG TAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAATTGATTAGTA CCTC

PAGE 298

298 TTATATTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTACTTCCCCCCTCTTTAACTCTT CTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTATCCCCCACTTTCATCAAATATTGCCC ATAGAGGTAGTTCAGTAGACTTAGCTATTTTCTCATTACATCTAGCAGGTATTTCTTCAATTTTAGGAGCTATTAATTTT ATTACCACAATTA TTAACATACGATTAAATAAATTAATATTTGATCAAATACCTTTATTTGTATGAGCAGTTGGTATTACA GCATTTTTACTTCTTCTTTCACTACCAGTTTTAGCTGGAGCAATTACTATATTATTAACTGATCGAAATCTTAATACTTCA TTTTTTGATCCTGCAGGAGGGGGAGATCCCATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTACTT T --------------Asura cerv icalis ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAG GAACCTCTTTAAGTTTACTAATTCGAGCTGAATTAGGAAACCCAGGATCTTTAATTGGGGATGATCAAATTTATAATAC TATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATCGGAGGATTTGGAAATTGGTTGGT ACCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCATTAA CATTGCTAATTTCAAGAAGAGTTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATA TTGCTCATAGTGGAAGATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCGGGTATTTCATCAATTTTAGGAGCAATT AATTTTATTACTACCATT ATTAACATACGATTAAATTCACTATCATTCGATCAAATACCATTATTTGTTTGAGCTGTAGGT ATTACAGCATTTTTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTAACTGATCGAAATTTAAAT ACTTCTTTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTT ----------------------------------Asura pol yspila -----------------------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGG AATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCCGAATTAGGTAATCCAGGTTCTTTAATTGGAGATGATCAAATTT ATAATACTATTGTAACTGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCTTTAATACTTGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTCCTACCTCCT TCTCTAACTTTATTGATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCACCTTTATCAT CTAATATTGCTCATAGAGGTAGTTCCGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGA GCAATTAAT TTTATTACAACTATTATTAATATACGACTTAATAGATTAACCTTTGATCAAATACCTTTATTTGTTTGAGCT GTAGGAATTACAGCATTTCTTCTTCTTCTTTCATTACCTGTTCTAGCAGGAGCTATTACTATATTATTAACTGATCGAAA TTTAAATACTTCATTTTTTGATCCTGCAGGTGGAGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCC AGAAGTTTACTTT ------------------------------------------------------Atolmis rubricollis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 299

299 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Bruceia hubbardi ------------------------------------------------------------------------------------------------TTAAGATTATTAATTCGAGCTGAATTAGGAAA TCCGGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCACACGCTTTTATTATAATTTTTTTTATAGT TATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTCTTATACTAGGTGCTCCTGATATGGCATTCCCACGA ATAAATAACATAAGTTTTTGATTATTACCACCATCTCTTATTCTTTTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGG AACAGGATGAACAGTT TACCCCCCACTTTCATCTAATATTGCTCATAGTGGAAGATCAGTAGATTTAGCTATTTTTTCTT TACACTTAGCTGGAATTTCATCAATCCTAGGAGCTATTAATTTCATTACAACAATTATTAATATACGATTAAATAATTTAT CATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACTGCATTTTTATTATTACTTTCATTACCTGTTCTAGCTG GAGCTATTACTATACTTTTAACAGACCGAA ACTTAAATACTTCATTTTTAAATCCTTTA ------------------------------ATACGAC TCACTATAGGGATCAACCAATCA--------------------Bruceia pulverina ------------------------------------------------------TATTTTATTTTTGGTATCTGAGCGGGAATAGTAGGAACATCTTTAAGTTTATT AATTCGAGCTGAATTAGG AAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTT TTATCATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTCTCATATTAGGTGCCC CTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGATTATTACCACCATCTCTTATTCTTTTAATTTCAAGAAGAA TCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGAGGTAGATCAG TAGATTTAGCTATTTTTTCATTGCATTTAGCCGGAATTTCATCAATCTTAGGTGCTATTAATTTTATTACAACAATTATTA ATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGGATTACTGCATTTTTACTACTAC TCTCATTACCTGTTTTAGCGGGAGCTATCACTATACTTTTAACAGATC GAAAT ----------------------------------------------------------------------------------------------------------Calamidia hirta ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAG GAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGG AAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACTGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTT CCCCTAATATTAGGTGCTCCCGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGATTGCTTCCCCCTTCATTAAC CCTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCAAATATC GCTCATAGTGGTAGTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAAT TTTATTACAACAATTATTAATATACGATTAAATAAATTAATATTTGATCAAATACCTTTATTCGTTTGAGCTGTCGGAATT ACAGCATTTTTACTATTACTCTCCCTACCTGTTTTAGCAGGAGCTATTACCATATTATTAACAGATC GAAATCTTAATAC TTCCTTTTTTGACCCCGCAGGTGGAGGT -----------------------------------------------------------------------Cisthene juanita

PAGE 300

300 ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAG GAACTTCTCTAAGATTATTAATTCGAGCTGAATTAG GTAATCCTGGTTCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTA CCATTAATATTAGGGGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTCTTCCCCCGTCTTTAAC TTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAAC AGTTTATCCCCCACTTTCATCTAATATT GCTCATGGAGGTAGATCAGTTGATCTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAA TTTCATTACCACTATTATTAATATACGATTAAATAGACTATCATTTGATCAAATACCTTTATTCGTTTGAGCTGTAGGAAT TACAGCATTTTTATTATTACTTTCTTTACCAGTTTTAGCCGGAGCTATTACTATATTATTAACAGAT CGAAATTTAAATAC ATCTTTCTTTGACCCTGCGGGAGGAGGAGATCCAATCCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTT TAC -----------------Cisthene plumbea ------------------------TCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAAC TTCCTTAAGACTATTAATTCGAGCTGAATTA GGTAATCCAGGGTCTTTAATTGGTGATGATCAAATTTATAACACAATC GTAACTGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCA TTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTTTACCACCATCTTTAACTTT ATTAATTTCAAGAAGAATTGTAGAAAACGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCT CATGGAGGTAGATCAGTTGATCTCGCTATTTTTTCCCTTCATTTAGCCGGTATTTCATCAATTTTAGGAGCTATTAATTT TATTACTACAATTATCAATATACGATTAAATAAATTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTGGGAATTAC TGCATTTTTATTATTACTTTCCTTACCAGTATTAGCAGGAGCTATTACCATACTTCTAACAGA TCGAAATTTAAATACAT CTTTTTTTGAT --------------------------------------------------------------------------------------Cisthene subjecta ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTCGGTATTTGATCAGGAATAGTAG GAACTTCTCTTAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGGTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTA CCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCACCATCATTAAC TTTACTTATTTCCAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATG AACAGTTTATCCCCCACTTTCATCTAATATT GCTCATGGAGGAAGATCAGTCGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCAATCAA TTTCATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTCTATTTGTTTGAGCTGTTGGTATT ACAGCATTTTTATTATTACTTTCTTTACCAGTATTAGCAGGAGCTATTACTATATTATTAACA GATCGTAACTTAAATACA TCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATCTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTA C -----------------Cisthene tenuifascia

PAGE 301

301 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Crambidia lithosioides ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Cyana meyricki ------------------AGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGG TACTTCTTTAAGATTATTAATTC GAGCAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACTA TTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTAC CTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGATTATTACCCCCTTCATTAACT CTTCTTATTTCAAGAAGAATTGTAGAAAATGGAGCAGG TACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATCG CTCATAGAGGAAGATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAAT TTTATTACCACAATTATTAATATACGACTTAATAACTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGAATT ACTGCATTTTTATTACTTTTATCTTTACCAGTTTTAGCAGGTGCTATTACTATA TTACTAACTGATCGAAATTTAAATACA TCCTTCTTTGATCCTGCAGGAGGAGGAGATCCTATTCTCTACCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTT AC -----------------Cybosia mesomella ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema bicolor ------------------------TCAACCAATCATAAAGATATTGGAACACTATATTTTATTTTTGGAATTTGGGCAGGTATAGTAGGAAC TTCCCTTAGATTATTAATTCGAGCAGAATTGGGTAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTG TAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCC TTATATTAGGAGCCCCTGACATAGCTTTCCCCCGAATAAATAACATAAGTTTTTGACTACTCCCCCCCTCTTTAACATT

PAGE 302

302 ACTCATCTCAAGTAGA ATCGTAGAAAATGGGGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGC TCATAGAGGTAGTTCTGTAGACTTAGCTATTTTTTCTCTACATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTT TATTACAACAATTATTAATATACGATTAAATAAATTAATATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTAC AGCATTTTTATTGCTTCTTTCATTGCCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTTAATACTTC TTTTTTTGACCCTGCAGGAGGGGGAGATCCTATCCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTACT TT --------------Eilema complana ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTCATTTTTGGAATTTGAGCTGGAATAGTA GGAAC TTCACTTAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATAC TATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTGAT CCCCCTTATATTAGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTACTCCCCCCCTCTTTA ACATTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATA TTGCTCATAGAGGTAGTTCTGTAGACTTAGCTATTTTTTCTTTGCATTTAGCAGGTATTTCCTCTATTCTAGGAGCTATT AATTTTATTACAACAATTATTAATATACGATTAAATAAACTAATATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGT ATTACAGCATTCTTATTACTTCTTTCACTACCTGTTT TAGCAGGAGCTATCACCATATTATTAACCGATCGAAATCTTAA CACTTCTTTCTTTGATCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAG TTTACTTT --------------Eilema dorsalis ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAG GAAC ATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTAACTGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTC CCCCTTATATTAGGAGCCCCAGATATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGATTACTTCCCCCCTCATTAA CTCTTTTAATTTCAAGAAGA ATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTATCCCCCACTTTCATCTAATAT TGCTCATAGAGGTAGTTCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATCA ATTTTATCACAACAATTATTAATATACGACTTAATAAATTAATATTTGATCAAATACCTTTATTTGTTTGAGCAGTGGGAA TTACAGCATTTTTATTACTCCTTTCATTACCTGTTTTAGCAGGAGCAATTACTATGTTACTAACAGACCGAAATCTTAAT ACTTCTTTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGT TTACTTT --------------Eilema griseola -----------------------------------------------------------------------------------------------YYAAGATTATTAATTCGAGCTGAATTAGGTAA TCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACTATTGTCACTGCACATGCTTTTATTATAATTTTTTTTATAGT AATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTTGGAGCCCCTGATATAGCTTTCCCCCGA ATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTCTAACATTATTAATTTCAAGAAGA ATTGTAGAAAATGGAGCAGG

PAGE 303

303 AACTGGATGAACAGTTTACCCCCCTTTATCCTCTAATATTGCCCATAGAGGAAGCTCTGTAGATTTAGCTATTTTCTCC CTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGTCTTAATAGTTTA ACTTTCGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTACTTCTTTTATCATTACCTGTTTTAGCT GGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTT-------------------------------------------------------------------------------------------Eilema plana ------------------------TCAACCAATCATAAAGATATTGGAACAATATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAAC TTC TTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTG TAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTC TTATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTACTTCCCCCTTCCCTAACCTTA YTTATTTCAAGTAGAATT GTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATCGCTC ATAGAGGTAGATCTGTAGATCTAGCTATTTTCTCCTTACATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTT ATTACAACAATTATTAATATACGATTAAATAAATTAATATTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACA GCATTTTTATTACTTCTTTCTCTACCAGTTTTAG CGGGAGCTATTACTATATTATTAACTGATCGAAATCTTAATACTTCT TTTTTTGACCCTGCAGGAGGGGGTGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTACTT T --------------Eilema sp.1 TTTTATACGACTCACTATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGG AATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATCCTTAATTGGAGATGATCAAATT TATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAAT TGATTAATTCCTCTAA TATTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGTTTTTGATTACTTCCCCC CTCATTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCA TCAAATATTGCTCATAGAGGTAGATCTGTAGATTTAGCTATTTTTTCATTACATTTAGCGGGTATTTCCTCAATCCTAGG AGCTATTAATTTCATTACCACAATCATTAATAT ACGATTAAATAAATTAATATTTGATCAAATACCATTATTTGTATGAGC TGTAGGAATCACAGCATTTTTATTACTTCTTTCTTTACCTGTTCTAGCGGGAGCTATTACTATATTATTAACTGATCGAA ATCTTAATACTTCTTTTTTTGACCCTGCAGGAGGGGGAGATCCTATCTTATATCAACATTTATTTTGATTTTTTGGACAT CCAGAAGTTTACTTTAGTGAAGGGTAAATA Eilema sp.2 ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATCTTTGGAATTTGAGCTGGAATAGTA GGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGCTCACTAATTGGAGACGACCAAATTTATAATA CTATTGTAACCGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGTGGATTTGGAAATTGATTAG TACCCCTTATACT TGGAGCTCCTGATATAGCTTTCCCTCGGATAAATAATATAAGTTTTTGACTTCTTCCACCTTCTTTA ACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGAGCTGGAACTGGATGAACAGTCTACCCGCCTTTATCATCTAATA

PAGE 304

304 TTGCCCATGGAGGAAGCTCCGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATT AATTTTATTACTACTATTATTAATATACGA TTAAATAGACTATCCTTTGATCAAATACCCCTATTTGTATGAGCAGTCGG AATTACAGCATTTTTACTTCTTCTTTCATTACCTGTATTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAA TACTTCTTTTTTTGATCCTGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAG TTTACTTT --------------Eilema sp.3 ------------------------------------------------------------------------------------------------CTTAGATTATTAATTCGAGCTGAATTAGGAAA TCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGT TATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCCTTATATTAGGA GCCCCAGATATAGCTTTCCCCCGA ATAAATAATATAAGTTTTTGATTACTCCCCCCCTCCTTAACCCTTTTAATTTCAAGAAGAATTGTAGAAAACGGAGCAG GAACAGGATGAACAGTCTATCCCCCACTTTCATCTAATATTGCTCATAGAGGTAGTTCTGTAGATTTAGCTATTTTTTC CTTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTCATTACAACAATTATTAACATACGACTAA ATAAATT AATATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGTATTACAGCATTTTTATTACTTCTCTCATTACCTGTTCTAGC AGGAGCTATTACTATATTATTAACTGATCGAAATCTCAACACTTCTTTT -------------------------------------------------------------------------------------------Eilema sp.4 --------------TATAGGGATTCAACCAATCATAAAGATATTGGTACATTATATTTTATTTTTGGAATTTGGGCAGGTATAGTA GGAACATCATTAAGACTTCTAATTCGAGCTGAATTAGGAAACCCTGGATCTTTAATTGGTGATGATCAAATTTACAATA CCATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAA TCCCTCTTATACTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTCCCCCCTTCCTTA ACCCTTTTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATA TTGCTCATAGAGGTAGATCAGTGGATCTAGCTATTTTTTCACTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATT AACTTTATTACTACAATTATTAATATACGATTAAATAG ATTAATATTTGATCAAATACCATTATTTGTTTGAGCTGTAGGA ATTACAGCATTTTTATTACTTCTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAAT ACATCTTTTTTTGATCCTGCCGGAGGAGGTGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGT TTACTTT --------------Gardinia anoploa ------------------------------------------------------------------------------------------------TTAAGATTATTAATTCGAGCTGAATTAGGTAA TCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGT TATACCCATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCT CCAGATATAGCATTCCCTCGAA TAAATAATATAAGTTTTTGACTTTTACCTCCTTCTTTAATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGA ACAGGATGAACAGTTTATCCTCCACTTTCTTCTAATATAGCTCATAGAGGAAGATCTGTAGATTTAGCTATTTTTTCTTT ACATTTAGCTGGTATTTCATCAATCTTAGGTGCTATTAATTTTATTACTACAATTATTAATATACGTTTAAATA AATTATCA

PAGE 305

305 TTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACTGCTTTTTTACTTCTCCTTTCATTACCAGTATTAGCAGGA GCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTT-------------------------------------------------------------------------------------------Gnamptonychia flavicollis ------------------------------------------------------------------------------------------------TTAAGATTATTAATTCGAGCTGAATTAGGAAA TCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGT TATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTCTTATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGTTTTTGACTTCTTCCCCCCTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGT ACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATGGAGGTAGTTCCGTAGATTTAGCTATTTTTTCATT ACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATG CGATTAAATAGATTAAT ATTTGATCAAATACCTTTATTTGTATGAGCTGTTGGTATTACAGCATTTTTATTACTTCTTTCATTACCAGTTTTAGCTGG AGCAATTACTATATTATTAACAGATCGAAATCTTAATACATCATTT -----------------------------------------------Heliosia jucunda -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hiera gyge ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hypoprepia cadaverosa ------------------------------------------------------------------------------------------------TTAAGTTTATTAATTCGAGCTGAATTAGGTAAT CCTGGATCATTAATTGGTGATGATCAAATTTACAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTA ATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATATTAGGTGCCCCAGATATAGCTTTCCCTCGAAT AAATAACATAAG TTTTTGACTCCTACCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGA ACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGAGGTAGATCAGTAGATTTAGCTATTTTTTCCC TACATTTAGCTGGAATTTCTTCTATTTTAGGGGCTATTAATTTTATTACTACAATTATTAATATACGTCTTAACAAATTAT CATTTGATCAAATACCTTTATTTGTTTGA GCTGTAGGAATTACAGCATTTCTTTTATTACTTTCTCTTCCAGTTTTAGCTG

PAGE 306

306 GAGCTATTACTATATTACTTACTGATCGAAATTTAAATACATCTTTC -------------------------------------------------------------------------------------------Hypoprepia fucosa ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hypoprepia fucosa tricolor ---------------TATAGGGATTCAACCAATCA TAAAGATATTGGAACACTATATTTTATTTTTGGTATCTGAGCCGGAATAGTA GGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGATCATTAATTGGTGATGATCAAATTTATAATAC TATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGT CCCTTTAATATTAGGTGCCCCAGATATAGCTTTTCCTCGAAT AAATAACATAAGTTTTTGACTCCTACCCCCATCATTAA CTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCTCCACTTTCATCCAATAT TGCTCACAGAGGTAGATCAGTAGATTTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTA ATTTTATTACTACAATTATTAATATACGTCTTAACAAATTATCATTTGATCAAATACCT TTATTTGTTTGAGCTGTAGGAA TTACAGCATTTCTTCTATTACTTTCTCTTCCAGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATA CATCTTTCTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTACCAACACTTATTTTGATTTTTTGGACATCCAGAAGTT TACTTT --------------Inopsis modulata -----------------------------AATC ATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTC TTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGATCTTTAATYGGAGACGATCAAATTTATAATACTATTGTAA CTGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTA TATTAGGAGCTCCTGATATAGCATTCCCMCGAA TAAATAATATAAGTTTTTGACTTCTTCCCCCCTCTCTAACTCTTTTA ATTTCAAGAAGAATTGTAGAAAACGGAGCAGGTACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCCCATA GAGGTAGTTCTGTAGATTTAGCTATTTTTTCATTACATTTAGCAGGTATTTCCTCTATTTTAGGAGCTATTAACTTTATTA CTACAATTATCAATATACGATTAAATAGATTAATATTTGATCAAATACC TTTATTTGTATGAGCTGTTGGTATTACAGCAT TTTTATTACTTCTTTCATTACCTGTTCTAGCTGGAGCTATTACTATATTACTAACTGATCGAAATCTTAATACATCATTTT TTGACCCAGCTGGAGGAGGAGATCCTATTCTTTACCAACATTTATTTTGATTTTTTGGACAT -----------------------------Lithosia quadra ------------------------------------------------------------------------------------------------TTAAGATTATTAATTCGAGCAGAATTAGGAAA TCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATGGT TATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTA ATATTAGGAGCTCCTGATATAGCATTCCCTCGAA

PAGE 307

307 TAAATAATATAAGTTTTTGATTATTACCCCCCTCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGA ACAGGATGAACAGTTTATCCCCCACTCTCATCAAATATTGCCCATAGAGGTAGTTCCGTAGATTTAGCCATTTTTTCTT TACATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACCACAATCATTAATA TACGATTAAATAAATTAA TATTTGATCAAATACCTCTATTTGTATGAGCTGTAGGAATTACAGCATTTTTATTACTTTTATCATTACCTGTATTAGCTG GAGCTATTACTATACTTCTAACAGATCGAAACCTCAATACTTCATTT -------------------------------------------------------------------------------------------Lyclene pyraula ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACTCTATATTTTATTTTTGGTATTTGAGCTGGAATAATTG GAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAACCCTGGGTCTTTAATTGGTGATGACCAAATTTATAATACT ATTGTCACTGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTC CCTTTA ATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTCCCCCCTTCTTTAAC TTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCTCCTTTATCTTCTAATATTG CCCATGGTGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAAT TTTATTACAACTATTATTAATA TACGTTTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTA CAGCATTCTTATTACTTCTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CTTTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTAC TTT --------------Lyclene reticulata ------------------------------------------------------TATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACCTCTTTAAGTTTACT AATTCGAGCTGAATTAGGAAACCCAGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTTACTGCACATGCT TTTATTATAATTTTTTTTATAGTAATACCAATTATAATCGGAGGATTTGGAAATTGGTTGGTACCCCTTATATTAGGAGC TCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCATTAACATTGCTAATTTCAAGAA GAGTTGTAGAAAATGGA GCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGTGGAAGAT CAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCGGGTATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACCATTA TTAACATACGATTAAATTCACTATCATTCGATCAAATACCATTATTTGTTTGAGCTGTAGGTATTACAGCATTTTTATTAC TTTTATCTTTACCTGTTTTAGCAGGAGCTATTA CTATATTACTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCAG CTGGAGGAGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTACTTT --------------Lyclene sp.1 ------------------------TCAACCAATCATAAAGATATTGGAACTCTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAAC TTCTTTAAGTTTATTAAT TCGAGCTGAATTAGGTAATCCTGGGTCTCTAATTGGTGATGACCAAATTTATAATACTATTG TTACTGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTT TAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTCCCCCCTTCTTTAACTTTA TTAATTTCAAGAAGAATTGTTGAAAATGGAGCT GGAACAGGATGAACTGTTTATCCTCCTTTATCTTCTAATATTGCTCA

PAGE 308

308 CGGTGGAAGTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTA TTACAACTATTATTAATATACGTTTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAG CATTCTTATTACTTCTTTCTTTACCAGTTTTAGCAGGAGCTATTACTA TATTATTAACTGATCGAAATTTAAATACTTCTT TTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTACTTT -------------Lyclene sp.1 nr. ---AATACGACTCACTATAGGGATTCAACCAATCATAAAGATATTGGAACTCTATATTTTATTTTTGGTATTTGAGCTGGA ATAATTGGAACTTCTTTAAGTTTATTAA TTCGAGCTGAATTAGGTAATCCTGGGTCTCTAATTGGTGATGACCAAATTTA TAATACTATTGTTACTGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTG ATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTCCCCCCTT CTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGC TGGAACAGGATGAACTGTTTATCCTCCTTTATCTTCT AATATTGCTCACGGTGGAAGTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGC AATTAATTTTATTACAACTATTATTAATATACGTTTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTA GGTATTACAGCATTCTTATTACTTCTTTCTTTACCAGTTTTAGCAGGAGCTATTACT ATATTATTAACTGATCGAAATTTA AATACTTCTTTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGA AGTTTACTTTAGTGAGGGGATAATA Lycomorpha pholus -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lycomorphodes sordida -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Meterhythosia sangala ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 309

309 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Miltochrista miniata ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTTG G AACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTCACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTA CCTTTAATACTTGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCTCTAAC ATTATTAATTTCAAGA AGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCTTTATCCTCTAATATT GCCCATAGAGGAAGCTCTGTAGATTTAGCTATTTTCTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTA ATTTTATTACTACTATTATTAATATACGTCTTAATAGTTTAACTTTCGATCAAATACCTTTATTTGTTTGAGCTGTAGGAA TTACAGCATTTTTACTTCTTTTATCATTACCTG TTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATA CTTCTTTTTTTGATCCTGCTGGTGGGGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTT TACTTT --------------Miltochrista sp.1 ---TATACGACTCACTATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATCTGAGCTGGT ATAGT TGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTCATTAATTGGTGATGATCAAATTTA TAATACTATTGTTACTGCACATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGTAATTG ATTAGTACCTTTAATACTTGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTCCCTCCAT CTTTAACATTATTAATTTCA AGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCTTTATCCTC TAATATTGCTCATAGAGGAAGCTCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAG CAATTAATTTTATTACCACTATTATTAATATGCGTCTTAATAGTTTAACTTTTGATCAAATACCTTTATTTGTTTGAGCTGT AGGAATTACCGCATTTTTACTTCTTTTATCTTTAC CTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTT AAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAG AAGTTTACTTTAGTGAGGGGTTAATA Prepiella aurea nr. -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Prinasura quadrilineata TTTTATACGACTCACTATAGGGATTCAACCAATCATAAAGATATTGGAACTCTATATTTTATTTTTGGTATTTGA GCTGG AATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGGTCTCTAATTGGTGATGACCAAATTT

PAGE 310

310 ATAATACTATTGTTACTGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTCCCCCCT TCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCTCCTTTATCTTC TAATATTGCTCACGGTGGAAGTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAG CAATTAATTTTATTACAACTATTATTAATATACGTTTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGT AGGTATTACAGCATTCTTATTACTTCTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTT AAATACTTCTTTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAG AAGTTTACTTTAGTGAAGGAAAAATA Ptychoglene coccinea -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Schistophleps albida ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACTTTATATTTTATTTTTG GAATTTGAGCAGGAATAGTA GGAACCTCACTAAGTTTACTAATTCGAGCTGAATTAGGAAACCCCGGATCTCTAATTGGAGATGATCAAATTTATAATA CTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGGAATTGATTAG TACCTTTAATATTAGGAGCACCTGATATAGCATTTCCTCGAATAAATAACATAAGTTTTTGACTTTTACCACCATCTTTA ACCTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAACA TTGCCCATAGAGGCAGATCCGTTGACTTAGCCATTTTTTCTTTACATCTTGCAGGTATTTCATCAATTTTAGGAGCTATT AATTTTATTACTACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTCGTTTGAGCAGTAGGA ATTACAGCTTT CTTATTATTATTATCATTACCGGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAAT ACCTCTTTTTTTGACCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGT TTACTTT --------------Amata aperta ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTA TTTGAGCAGGAATAGTA GGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAACTCCTGGTTCCATAATTGGAGACGATCAAATCTATAATA CTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGTAACTGATTAG TACCTTTAATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCTTCTT TA ACCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATA TTGCTCATAGAGGAAGTTCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCTTCAATTCTAGGAGCTATT AATTTTATTACAACAATTATTAATATACGATTAAATAATTTATTTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGA

PAGE 311

311 ATTACAGCTTTTTT ATTACTTCTTTCCTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACAGACCGTAATCTCAAT ACATCTTTTTTTGACCCCGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGT TTAC -----------------Pagara simplex ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asota heliconia ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTA GGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCTGGATCTTTAATTGGGGATGATCAAATTTATAACA CTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAG TCCCTCTT ATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCATTA ACACTCTTAATTTCAAGAAGAATTGTTGAAAACGGAGCAGGTACCGGATGAACAGTTTACCCCCCACTTTCATCTAATA TTGCTCATGGAGGAAGATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATT AACTTCATTACCACAATTATTAATA TACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGA ATTACAGCATTTTTATTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACCATACTTCTCACTGATCGAAATTTAAMT ACWTCTTTTTTTGATCCAGSTGGAGGAGGAGATCCAATTTTA -----------------------------------------------------------Asota orbona ---------------TATAGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTA GGAACATCTTTAAGATTGCTAATTCGAGCTGAATTAGGTACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATA CTATTGTTACAGCTCATGCTTTTATTATAATCTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAA TCCCTCTT ATATTAGGAGCCCCCGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCACT AACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGAGCAGGTACCGGATGAACAGTTTACCCCCCACTTTCATCTAAT ATTGCTCACGGAGGAAGATCAGTTGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCAATCTTAGGAGCTAT TAATTTTATTACTACAATTATCAATA TACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGG AATTACAGCATTTTTATTACTCTTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAA CACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAG TTTAC -----------------Neochera dominia ------------------AGGGATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGG AACTTCCCTAAGATTATTAATTCGAGCTGAACTAGGAAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACTA

PAGE 312

312 TTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTAC CTCT AATATTAGGAGCACCTGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACT TTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTG CTCACGGAGGAAGCTCAGTTGATTTAGCTATTTTTTCATTGCATCTAGCAGGTATTTCCTCAATTTTAGGAGCTATTAA TTTTATTACTACAATTATTAAT ATACGATTAAATAGCTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTAT TACTGCATTTCTTTTACTCCTTTCTTTACCAGTTCTAGCAGGAGCTATTACCATACTTTTAACAGACCGAAATTTAAATA CATCTTTCTTTGACCCAGCTGGAGGGGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGT TTAC -----------------[CytB] Acsala anomala -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Agylla septentrionalis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asura cervicalis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asura polyspila --------------------------------------------------TCAATATTAGTTAATTGAATTTGAGGGGGTTTTGCAGTAGATAATGCTACATTAA CACGTTTCTACACATTTCATTTCTTATTACCATTTATTATTTTAATAATAACTATAATTCACTTAMTATTTMTACATCAAAC AGGATCCAATAACCCATTAGGATTAAATAGAAATTATGATAAAATTCCTTTTCACCCATTTTTTACTT TCAAAGATTTAAT TGGAGCTATTATTTTAATATTCCTATTAATTATAATTACTTTAACTAATCCCTATTTATTAGGAGATCCAGATAATTTTATT

PAGE 313

313 CCAGCAAATCCTTTAGTAACTCCAGTTCATATTCAACCTGAATGATATTTTTTATTTGCTTATGCCATTTTACGATCAATT CCAAATAAATTAGGTGGAGTAATTGCTTTAATTATATCTATTTTAATTTTAATTATTTTACCTTTTACATTTAATAAAAA AA TTCAAGGAATTCAATTTTATCCAATTAATCAAATTATATTT ---------------------------------------------------TTAATACGACTCACT ATAGGGATGGCAGAAGAGAATTGGAACGACGAAGCCGTGG Atolmis rubricolis ---------------TTAGGGTGAGGACAAATATCATTTTGAGGAGCTACAGTTATTACAAATCTTTTATCTGCAATCCCTTATTT A GGATCAATATTAGTAAATTGAATTTGAGGAGGATTTGCCGTAGATAATGCTACATTAACACGATTTTATACTTTTCATTT TTTACTACCCTTTATTATTTTAATAATAACTATAATTCATTTATTATTTCTTCATCAAACGGGATCAAATAATCCATTAGGA TTAAATAGAAATTTTGATAAAATTCCTTTCCATCCATTTTTCACTTATAAAGATCTTATTGGAGCTATTATATTATTAACAA TATTAATTATATTAACTCTTACAAATCCCTATTTATTAGGTGATCCTGATAATTTTATTCCTGCTAATCCCTTAGTCACAC CAGTTCATATTCAACCTGAATGATATTTTTTATTTGCATATGCTATTTTACGATCTATCCCTAATAAATTAGGAGGAGTT ATTGCTTTAATTATATCAATTTTAATTTTAATTATTTTACCTTTCACATTTAATAAAAAAATTCAAGGAATTCAATTCTACC CAATCAATCAAGTATTATTT -----------------------------------------------------------------Bruceia hubbardi -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Bruceia pulverina -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Calamidia hirta ---ATACGACTCACATTAGGGTGAGGACAAATATCATTTTGAGGAGCTACAGTAATTACAAATCTTTTATCTGCTATTCCC TATTTAGGATCCATAT TAGTAAATTGAATTTGAGGAGGATTTGCTGTAGATAATGCAACATTAACACGATTCTATACATT TCACTTTTTATTACCTTTTATTATTTTAATAATAACAATAATTCATTTATTATTTCTTCATCAAACAGGATCTAATAATCCA CTAGGACTAAATAGAAATTTAGATAAAATTCCTTTTCATCCATTTTTTACCTTTAAAGATTTAATTGGAGCAATTATATTA ATAATATTTTTAATTATATTAACACTTAC AAATCCTTATTTACTTGGAGATCCAGATAATTTTATCCCAGCCAATCCTTTA GTCACTCCAGTTCATATTCAACCTGAATGATATTTTTTATTTGCTTATGCTATTTTACGATCTATTCCCAATAAATTAGGA

PAGE 314

314 GGTGTAATTGCTTTAATTATATCAATTTTAATTTTAATTATCTTACCTTTTACATTCAATAAAAAAATTCAAGGAATTCAAT TTTACCCAATTAATCAAATTTTATTT -----------------------------------------------------------------Cisthene juanita ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Cisthene plumbea ------------------------GGACAAATATCATTTTGAGGAGCTACTGTTATTACTAACTTATTGTCAGCCATCCCTTATTTAGGAAC TATATTAGTAAATTGAATTTGAGGAGGATTTGCAGTAGATAACGCTACATTAACTCGATTTTACACATTTCATTTTCTAC TACCATTTATTATTGCATTATTAATTATAATTCATTTATTATTTTTACATCAGACAGGGTCAAATAATCCTTTAGGATTAAA T AGAAATTATGATAAAATCCCCTTTCATCCATTTTTTTCTTACAAAGATTTAATTGGAATCATTATTATACTATCAATTCTA ATCTTATTAAATCTCACTAACCCTAACCTACTTGGAGACCCAGATAATTTTATTCCAGCTAACCCATTAGTAACCCCTG TACACATTCAACCTGAATGATATTTTTTATTCGCCTATGCAATTTTACGATCAATTCCTAATAAATTAGGAGGAGTAATT GCTTTAATTATATCCA TTTTAATTCTAATTATTTTACCTTTTACATTTAATAAGAAAATCCAAGGAATTCAATTCTACCCAA TTAAT -----------------------------------------------------------------------------Cisthene subjecta -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Cisthene tenuifascia ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Crambidia lithosioides --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 315

315 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------Cyana meyricki ------------------GGGTGAGGACAAATATCATTTTGAGGAGCTACTGTAATTACTAATTTACTATCAGCAATCCCTTATTTAG GATCCATATTAGTAAATTGAATTTGAGGGGGATTTGCAGTTGAAAATGCTACTTTAACTCGATTTTACACTTTCCATTTT TTATTAC CTTTTATCATTTTAATAATAACTATAATTCATTTATTATTTTTACATCAAACTGGATCTAATAATCCCCTAGGAT TAAATAGTAACTATGATAAAATTCCTTTCCATCCATTTTTTACTTATAAAGATTTAATTGGAGCTATTTTTATATTATTTTT ATTAATTATGTTAACTCTAACTAATCCTTACTTATTAGGAGACCCTGATAATTTTATTCCCGCTAATCCCTTAGTTACTC CCGTTCATATTCAACCTGA ATGATATTTTCTATTCGCTTATGCTATTTTACGATCGATTCCAAATAAATTAGGAGGAGTT ATTGCTCTAATTATATCAATTCTTATTTTAATTATTTTACCATTTACTTTTAATAAAAAAATTCAAGGAATTCAATTTTAT -------------CTCTAT -----------------------------------------------------------------Cybosia mesomella -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema bicolor TTAATACGACTCACATTAGGGTGAGGACAAATATCATTTTGAGGAGCTACAGTTATTACAAATCTTCTATCAGCAATCC CCTATCTTGGATCTATATTAG TAAATTGAATTTGAGGGGGATTTGCTGTAGATAATGCTACATTAACACGATTTTATACA TTTCATTTTTTATTACCTTTTATTGTATTATTACTAGTTATTATTCATCTTTTATTTCTCCATCAAACAGGATCTAATAATC CTTTAGGACTTAATAGAAATCTAGATAAAATTCCATTTCATCCATTTTTTACTTATAAAGATTTAATTGGAGCTATTATTA TAATAATAATCTTAATTATGTTAACTTTTACAAATCCTTATTTATTGGGAGACCCTGATAATTTCATTCCTGCTAACCCAT TAGTTACTCCTGTCCATATCCAACCTGAATGATACTTTTTATTTGCATATGCTATTTTACGATCTATCCCTAATAAATTAG GAGGTGTAATTGCTTTAATTATATCAATTTTAATTTTAATTATTTTACCTTTTACATTTAATAAAAAAATTCAAGGAATTCA A --------------------------------------------------------------------------------------------Eilema complana ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema dorsalis

PAGE 316

316 ---------CTCACATTAGGGTGAGG ACAAATATCATTTTGAGGAGCTACAGTCATTACTAATCTTTTATCGGCAATTCCATAT TTAGGATCCATATTAGTAAATTGAATTTGAGGAGGATTTGCTGTAGATAATGCCACATTAACACGATTTTACACTTTTCA TTTTTTATTACCATTTATTGTATTAATATTAACTATTATTCACTTACTATTTTTACACCAAACAGGATCTAATAATCCCTTA GGTATTAATAGAAATTTTGATAAAATTCCTTTCCA CCCATTCTTTACTTATAAGGATTTAATTGGGGCTATTATTATATTA ACAATTTTAATTATATTAACCTTTACAAATCCTTATTTATTGGGAGATCCTGATAATTTTATTCCCGCTAACCCTTTAGTC ACCCCCGTCCATATTCAACCTGAATGATATTTTTTATTTGCCTATGCTATTTTACGCTCTATTCCTAATAAATTAGGAGG TGTAATTGCTTTAGTTATATCAATTCTAATTTTAATTATTTTACCATTT ACATTTAATAAAAAAATACAAGGAATTCAATTT TATCCCATTAATCAAATTTTATTTTGATTTTTAGTAGTAATAATCATTTTATTAACATGAATTGGAGCTCGACCAGTCTTT -------Eilema griseola ---------------TTAGGGTGAGGACAAATATCATTTTGAGGAGCTACAGTCATTACTAATCTCCTATCAGCAATCCCCTATCTT GGATCTATATTAGTAAATTGAATTTGAG GAGGATTTGCTGTAGATAATGCTACATTAACACGATTTTATACATTTCATTT TTTATTACCATTTGTTGTATTAATATTAACTATTATTCATCTACTATTTCTACATCAAACAGGATCTAATAATCCATTAGG AATTAATAGAAACTTTGATAAAATTCCTTTCCACCCCTTTTTCACGTATAAAGACTTAATTGGAGCTATTATTATATTAAC AATTTTAATTATATTAACTTTTACAAATCCTTATTTATTGGG AGACCCTGATAATTTTATTCCTGCAAATCCCTTAGTTAC TCCTGTACACATTCAACCTGAATGATATTTTCTATTTGCATATGCCATTTTACGATCTATCCCAAATAAATTAGGAGGTG TAATCGCTTTAATTATATCAATTTTAATTTTAATTATTCTACCATTTACATTTAATAAAAAAATCCAAGGAATTCAATTTTA TCCAATTAATCAAATCCTTTTT -----------------------------------------------------------------Eilema plana ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema sp.1 ------------ACATTAGGGTGAGGACAAATATCATTTTGAGGAGCT ACAGTTATTACCAATCTTTTATCTGCTATTCCCTATCT TGGATCTATATTAGTAAATTGAATTTGAGGAGGTTTTGCTGTAGATAATGCAACATTAACACGATTTTACACATTTCATT TTTTACTACCATTTATTATCTTAATAATAGTAATAATTCACTTATTATTTCTCCATCAAACAGGATCTAATAATCCCCTAG GACTAAACAGAAATTTAGATAAAATCCCATTTCACCCATTTTTCACATTTAAAGAT CTAATTGGAGCTATTATATTATTAA TATTATTAACTATACTAACTCTCACAAACCCAAATTTACTTGGGGATCCTGATAATTTTATTCCAGCTAATCCACTGGTT ACACCAGTACACATTCAACCTGAGTGATATTTTTTATTTGCTTACGCTATTTTACGATCTATCCCTAATAAATTAGGAGG TGTAATTGCTTTAATTATATCAATTCTAATTTTAATTATTCTACCTTTTACATTTAATAAAAAAATTCAAG GAATTCAATTT TACCCCATTAATCAAATCTTATTTTGATTTTTAGTAATAATAATTATTTTACTAACATGA -----------------------------

PAGE 317

317 Eilema sp.2 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema sp.3 ------------------GGGTGAGGACAAATATCATTTTGAGGAGCTACAGTTATCACTAATCTCTTATCAGCAATTCCTTACCTTG GATCTATATTAGTTAATTGAATCTGAGGAGGATTTGCTGTTGATAATGCAACTCTAACTCGATTTTACACATTTCATTTT TTATTACCTTTTATTGTATTAATATTAACTATTATTCATTTATTATTTTTACATCAAACAGGATCAAA TAATCCCTTAGGAC TTAATAGAAATTTAGATAAAATTCCCTTTCATCCCTTTTTCACATATAAGGATTTAATTGGAGGTATTATCATATTAATAA TTTTAATTATATTAACTTTTACAAATCCCTATTTATTAGGAGATCCTGATAACTTTATCCCCGCAAATCCCTTAGTTACTC CAGTTCATATTCAACCTGAATGATATTTTTTATTTGCTTATGCTATTTTACGATCAATCCCTAATAAATTAGGAGGTGTA ATTGCTTTAATCATATCAATCTTAATTTTAATTATTTTACCTTTTACATTTAATAAAAAAATTCAAGGAATTCAATTCTATC CCATTAATCAAATTCTATTTTGATTCCTAGTA -----------------------------------------------------Eilema sp.4 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Gardinia anoploa ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Gnamptonychia fl avicollis ---------------------------------------------------------ACATTAGGGTGAGGACAAATATCATTTTGAGGAGCTACTGTCATTACAAAT CTTTTATCAGCTATTCCTTATTTAGGATCAATATTAGTAAATTGAATTTGAGGGGGATTCGCCGTTGATAATGCAACATT AACTCGTTTTTATAGTTTTCACTTTTTATTACCTTTTATTATTTTAATAATAGTTAT AATTCATTTATTATTTCTCCATCAAA CAGGATCTAATAACCCTTTAGGATTAAATAGAAATTATGATAAAATTCCCTTTCATCCATTTTTTACTTATAAAGATTTAA TTGGAAGTATTATATTATTATTTTTATTAATTATATTAACTCTTACTAATCCCTACCTATTAGGAGATCCTGATAATTTTAT

PAGE 318

318 TCCTGCTAATCCTTTAGTTACCCCTGTACATATTCAACCTGAATGATATTTTTTATTTGCTTATGCT ATTTTACGATCAAT TCCTAATAAACTTGGAGGAGTAATTGCTCTTATCATATCAATTTTAATTTTAATTATTTTACCTTTTACATTTAATAAAAAA ATTCAAGGAATTCAATTTTAT -----------------------------------------Heliosia jucunda ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hiera gyge ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hypoprepia cadaverosa ---------------TTAGGGTGAGGACAAATATCATTTTGAGGTGCAACAGTAATTACTAATTTATTATCAGCTATTCCTTATTTA GGAACTATAATAGTAAATTGAATTTGAGGGGGATTCGCAGTAGATAATGCTACTTTAATTCGATTTTATACTTTCCATTT TCTTTTTCCATTTATTATTTTAATAATAACTATAATTCATTTATTATTCTTACATCAAACAGGATCTAATAATCCTTTAGGA TTAAATAGAAATTATGATAAAATTCCATTTCATCCATTTTTTACATACAAAGATTTAATTGGAGCTATCATATTATTATTTA TATTAATTTTATTAACTTTAACTAACCCATATCTATTAGGAGATCCAGATAATTTTATCCCTGCAAATCCATTAGTTACTC CTATTCATATTCAACCAGAATGATATTTTTTATTTGCTTATGCCATTCTTCGATCCATTCCCAATAAATTAGGAGGAGTT ATTGCATTAATTATATCAATTTTAATTTTAATTATCTTACCATTTACTTTTAATAAAAAAATTCAAGGAATTCAATTCTATC CCATTAATCAAATC -----------------------------------------------------------------------Hypoprepia fucosa -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hypoprepia fucosa tricolor ---------------TTAGGGTGAGGACAAATATCATTTTGAGGTGCAACAGTAATTACTAATTTATTATCAGCTATTCCTTATTTA GGAACTATAATAGTAAATTGAATTTGAGGAGGATTCGCAGTAGATAATGCTACTTTAATTCGATTTTATACTTTCCATTT

PAGE 319

319 TCTTTTCCCATTTATTATTTTAATAATAACTATAATTCATTTATTATTTTTACATCAAACAGGATCTAATAATCCTTTAGGA TTAAAT AGAAATTATGATAAAATCCCATTTCATCCATTTTTTACATACAAAGATTTAATTGGAGCTATCATATTATTATTT ATATTAATTTTATTAACTTTAACTAATCCATATCTATTAGGAGATCCAGATAATTTTATCCCTGCAAATCCATTAGTCACT CCTATTCATATTCAACCAGAATGATATTTTTTATTTGCTTATGCCATCCTTCGATCTATCCCCAATAAACTAGGAGGAGT TATTGCATTAATCATATCAA TTTTAATTTTAATTATCTTACCATTTACTTTTAATAAAAAAATTCAAGGAATTCAATTCTAT CCCATTAATCAAATC-----------------------------------------------------------------------Inopsis modulata ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lithosia quadra ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lyclene pyraula ---ATACGACTCACA TTAGGGTGAGGACAAATATCATTTTGAGGAGCAACAGTAATTACTAATTTACTTTCAGCTATTCCT TATTTAGGTTCAATATTAGTTAATTGAATTTGAGGAGGATTTGCCGTAGATAATGCTACATTAACACGATTTTATACCTT TCATTTTTTATTACCTTTTATTATTTTAATAATAACTATAATTCATTTATTATTTTTACATCAAACAGGATCAAATAATCCTT TAGGTTTAAATAGAAACTATGATAAA ATTCCTTTCCATCCATTTTTTACTTATAAAGATTTAATTGGAGCTATTATTATAT TATTTATTTTAATTATACTTACTCTTACTAACCCTTATATATTAGGAGATCCTGATAATTTTATTCCAGCTAACCCTTTAG TTACCCCTGTTCATATTCAACCAGAATGATATTTTTTATTTGCTTATGCAATTTTACGATCAATTCCTAATAAATTAGGAG GTGTTATTGCATTAATTATATCAATTTTAATTTTAATTA TTTTACCTTTTACTTTCAACAAAAAAATTCAAGGAATTCAATT TTATCCTATTAATCAAATTATATTTTGATTT-----------------------------------------------------------Lyclene reticulata ---ATACGACTCACATTAGGGTGAGGACAAATATCATTTTGAGGGGCAACAGTTATTACTAATTTACTTTCAGCAATTCCT TATTTAGGGTCAATATTAGT TAATTGAATCTGAGGGGGGTTTGCTGTAGATAATGCTACATTAACACGATTTTATACTTT CCACTTTCTTTTACCCTTTATCATTTTAATAATAACTATAATTCACTTACTTTTTCTTCACCAAACAGGATCTAATAACCC ATTAGGATTAAATAGAAACTATGATAAAATTCCTTTCCATCCATTCTTTACTTATAAGGATTTAATTGGAGCAATTATTAT AATATTTATTTTAATTATACTCACTCTTACTAAT CCTTACCTATTAGGAGATCCTGATAATTTTATTCCAGCCAATCCTTT

PAGE 320

320 AGTCACCCCTGTTCATATTCAACCAGAATGATACTTTTTATTTGCTTATGCAATTTTACGATCAATTCCTAATAAATTAG GAGGTGTAATTGCATTAATTATATCAATTTTAATTTTAATTATTTTACCTTTTACTTTTAATAAAAAAATTCAAGGAATCCA ATTTTATCCTATTAATCAAATTATATTT ----------------------------------------------------------------Lyclene sp.1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lyclene sp.1 nr. -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lycomorpha pholus ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lycomorphodes sordida ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Meterhythosia sangala -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 321

321 Miltochrista miniata ------CGACTCACATTAGGGTGAGGACAAATATCATTTTGAGGGGCAACAGTCATTACTAATCTACTTTMTGYTATTCCTT ATTTAGGATCTATATTAGTAAATTGAATTTGAGGAGGATTTGCAGTAGATAATGYTACATTAACACGTTTTTATACTTTT CATTTTTTATTACCATTTATTATTATAATAATAACTATAATTCATTTATTATTTTTACATCAAACAGGATCTAATAACCCAT TAGGATTAAATAGAAATTATGACAAAATCCCATTTCATCCATTTTTTACATATAAAGATTTAATTGGAGCTATTATTTTAA TATTTATATTAAT TATTCTTACTCTTACTAATCCTTATTTATTAGGAGACCCTGATAATTTTATTCCCGCTAATCCTTTAGT TACCCCAGTTCACATTCAACCAGAATGATATTTTTTATTTGCTTATGCTATTTTACGATCAATTCCTAATAAATTAGGAG GAGTAATTGCTTTAATCATATCAATTTTAATTTTAATTATTTTACCTTTCACTTTTAATAAAAAAATTCAAGGAATTCAATT TTACCCAATTAACCAAATTATATTT TGATTT-----------------------------------------------------------Miltochrista sp.1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Prepiella aurea nr. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Prinasura quadrilineata -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Ptychoglene coccinea -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 322

322 Schistophleps albida ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Amata aperta ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Pagara simplex ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asota heliconia ------------------GGGTGAGGACAAATATCATTTTGAGGAGCCACTGTTATTACCAATCTTTTATCTGCAATTCCTTATTTAG GATCAATATTAGTAAATTGAATTTGAGGAGGATTTGCAGTTGATAATGCAACCCTAACTCGATTTTATACTTTCCACTTT CTCCTTCCCTTT ATTATTATAATAATAACCATAATTCATCTGCTATTTTTACACCAAACTGGATCTAATAATCCTCTTGGA TTAAATAGTAATTATGATAAAATCCCTTTTCATCCATTTTTTTCTTATAAAGATCTTATTGGAGCAATTATTATAATTTTTA TCTTAATTATATTAACCTTAACTAATCCTTATTTATTAGGAGATCCTGATAATTTTATCCCAGCTAATCCTCTTGTTACAC CAGTTCACATTCAACCAGAATGAT ACTTTTTATTCGCCTATGCAATTTTACGTTCAATTCCCAATAAATTAGGAGGAGTA ATTGCTTTAGTACTTTCAATTTTAATTTTAATTATTTTACCATTTACTTTTAATAAAAAAATCCAAGGAATTCAATTTTATC CTTTAAATCAAATTTTATTTTGATCTTTAGTAACTATA -----------------------------------------------Asota orbona ------------ACATTAGGGTGAGGACAAATATCATTTTGAGGGGCTACTGTTATTACTAATCTTTTATCCGCAATTCCCTATTT AGGATCAATATTAGTAAATTGAATTTGAGGAGGATTTGCAGTTGATAACGCAACATTAACTCGATTTTACACTTTCCATT TTCTTTTACCTTTTATTATTTTAATAATAACTATAATTCATTTATTATTTCTACATCAAACTGGTTCTAATAATCCCCTTGG ATTAAATAGTAACTATGATAAAATC CCCTTTCATCCATTTTTCTCCTATAAAGATCTTATTGGAGCAATTATTTTAATTTT TATCTTAATTATATTAACTTTAACTAATCCTTATCTATTAGGAGATCCTGATAATTTTATCCCGGCTAACCCCCTTGTTAC

PAGE 323

323 ACCAGTTCATATCCAACCAGAATGATATTTTTTATTTGCTTATGCAATTTTACGTTCAATTCCTAATAAATTAGGAGGAG TAATTGCTCTAGTTCTTTCAATTTTAATTTTAATTATTC TACCTTTTACTTTTAATAAAAAAATTCAAGGAATTCAATTCTA TCCATTAAATCAAATTTTATTTTGATCTTTAGTAACAATAATTATTTTATTAACATGAATTGGAGCTCGACCAGTCTTTAG TGAGGGT Neochera dominia ------------ACATTAGGGTGAGGACAAATATCATTTTGAGGGGCAACTGTTATTACTAATCTTTTATCTGCAATCCCTTACTT AGGATCAATATTAGTTAATT GAATTTGAGGGGGATTTGCAGTAGATAACGCTACATTAACTCGATTCTATACCTTTCAT TTTTTATTACCATTTATTATTTTAATAATAACTATAATTCACTTATTATTCCTACATCAAACAGGATCCAATAATCCACTAG GATTAAATAGTAATTATGATAAAATTCCTTTCCATCCTTTTTTTACTTATAAAGACATTGTCGGAGCTATTTTATTAATAT TTTTATTAATTATATTAACCCTAACAAACCCATA TCTATTAGGAGATCCTGATAATTTTATCCCCGCTAATCCCCTTGTA ACTCCAGTCCATATTCAACCAGAATGATATTTTTTATTTGCTTATGCAATTCTACGCTCTATTCCCAATAAACTAGGAGG AGTAATTGCATTAGTTCTTTCAATCCTTATTTTAATTATTTTACCATTTACATTTAATAAAAAAATCCAAGGAATTCAATTC TACCCTATTAATCAAATCTTATTTTGATCTCTAGTTACT--------------------------------------------------[RpS5] Acsala anomala ------CGACTCACTATAGGGATGGCGGAGGAGAATTGGAATGATGATGCCGTAGATGCAGGCA GCATGGCTGTTGACA GCATGCCACTGCCTCAGCCGGCTGATATCCCCGAAATTAAACTGTTCGGAAGATGGAGTTGTTACGACGTTCAAGTG TCTGACATGTCTCTGCA GGATTACATCTCCGTTAAGGAAAAGTACGCCAAGTATTTACCTCACTCGGCTGGCAGGTAT GCCCACAAACGTTTCCGTAAAGCTCAGTGCCCCATCGTCGAGCGTTTGACCAACTCTCTTATGATGCACGGTCGCAA CAATGGCAAAAAACTGATGGCCGTCAGGATCGTGAAGCACGCATTTGAAATTATTCATTTGCTCACTGGTGAGAACCC TCTGCAGGTTCTTGTGACAGCCATCATTAACTCAGGCCCCCGTGAAGACTCCACCAGAATTGGTCGCGCCGGTACGG TGCGGCGGCAGGCTGTTGACGTTTCTCCTCTGCGTCGTGTTAACCAAGCCATCTGGTTATTATGCACAGGTGCACGT GAAGCTGCATTCCGTAACATCAAGACTATTGCTGAGTGTGTAGCTGATGAACTTATTAATGCAGCGAAGGGTTCATCA AACTCTTATGCCATCAAGAAGAAAGATGAGTTGGAGCGTGTT Agylla septentrionali s ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asura cervicalis

PAGE 324

324 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asura polyspila ATGCTGGCAGCATGGCTGTTGAT ---ATGCCTTTGCCCCCGGCAGCCGATATTCCCGAAATAAAACTGTTCGGAAGATG GAGCTGT TTTGATGTGCAGGTTTCTGATATGTCTCTGCAAGATTACATTTCAGTCAAAGAGAAGTACGCCAAATACTTA CCTCACTCGGCTGGCAGGTATGCGCACAAACGTTTCCGTAAAGCTCAGTGCCCCATCGTTGAGCGTTTAGCTAACTC TCTTATGATGCACGGCCGCAATAACGGCAAGAAACTGATGTCCGTTAGAATCGTGAAGCACGCATTCGAAATTATACA TTTGCTCACTGGTGAGAACCCTCTGCAAG TGTTGGTGACAGCTATCATTAACTCTGGGCCCCGGGAAGACTCAACTA GGATTGGTCGTGCTGGTACAGTACGTCGTCAGGCCGTCGACGTTTCCCCTCTTCGCCGTGTAAACCAAGCTATTTGG CTATTGTGCACAGGTGCACGTGAAGCTGCATTCCGTAACATCAAGACTATTGCTGAATGTGTAGCTGATGAACTGATC AATGCAGCAAAGGGATCTTCAAATTCCTATGCCATCAAGAAGAAGGACGAATT AGAACGTGTT Atolmis rubricollis TTAATACGACTCACTATAGGGATGGCGGAGGAGAATTGGAATGACGATGCCGTGGATACAGGCAGCATGGCTGTTGA CAGCATGCCATTGCCACAGGCGGCTGATATCCCCGAAATTAAACTTTTCGGAAGATGGAGTTGCTATGATGTTCAAGT GTCTGACATGTCCCTGCAGGATTACATCTCCGTTAAAGAGAAGTACGCCAAGTATTTACCTCACTCGGCTGGCAGGT ACGCGCACAAACGTTTCCGTAAAGCTCAGTGTCCCATCGTTGAACGTTTGACCAACTCTCTTATGATGCACGGCCGC AACAATGGCAAAAAGCTGATGGCCGTAAGAATCGTGAAGCACGCTTTTGAAATTATTCATTTGCTCACTGGTGAGAAC CCTCTGCAGGTTCTTGTGACAGCTATCATAAACTCCGGTCCCCGTGAAGACTCAACTAGAATTGGTCGCGCTGGTAC AGTGCGCCG GCAGGCTGTTGACGTCTCTCCTCTGCGTCGTGTGAACCAGGCAATCTGGTTACTATGCACAGGTGCA CGTGAGGCTGCATTCCGTAACATCAAGACTATTGCTGAGTGTGTAGCTGATGAACTCATCAACGCAGCAAAGGGTTC ATCAAACTCTTACGCCATTAAGAAGAAGGATGAGTTGGAACGTGTT Bruceia hubbardi ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Bruceia pulverina -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 325

325 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Calamidia hirta ---------------------------------------------------------------------------------------------------------ATCCCCGAAATTAAGTTATTCGGCAGA TGGAGTTGTTATGATGTCCAAGTGTCTGATATGTCCCTGCAGGATTACATCTCTGTTAAAGAGAAGTACGCCAAGTAT TTACCACACTCGGCTGGCAGGTACGCGCACAAACGTTTCCGTAAAGCTCAATGTCCCATCGTTGAGCGTTTGACCAA CTCTCTTATGATGCACGGCCGCAACAATGGCAAGAAACTGATGGCCGTAAGGATCGTGAAGCACGCCTTTGAAATCA TCCATTTGCTCACTGGTGAGAACCCTCTGCAGGTTCTTGTGACTGCTATCATTAACTCTGGCCCCCGTGARGACTCAA CTAGGATCGGTCGCGCTGGTACAGTGCGTCGTCAGGCTGTGGACGTTTCTCCACTCCGT ----------------------------------------------------------------------------------------------------------------------------------------------------------------Cisthene juanita ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Cisthene plumbea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Cisthene subjecta ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Cisthene tenuifascia ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 326

326 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Crambidia lithosioides ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C yana meyricki ------------------------------------------------------------------------------------------------GCGGCTGATATTCCTGAAATCAAACTTTTTGG CAGATGGAGTTGTTATGATGTCCAAGTGTCAGATATGTCTCTACAGGATTACATTTCTGTTAAGGAAAAATACGCTAAG TATTTACCCCACTCTGCTGG CAGGTATGCACACAAACGTTTCCGTAAAGCTCAATGCCCCATCGTTGAGCGTTTGACC AACTCACTTATGATGCACGGCCGCAACAATGGCAAGAAGCTAATGGCTGTCAGGATTGTCAAGCACGCGTTTGAAAT CATTCATTTATTGACTGGTGAAAATCCTTTACAAGTTCTTGTAACGGCTGTCATTAATTCTGGCCCTCGTGAAGATTCA ACTAGAATTGGTCGTGCTGGTACAGTTCGTCGCCAAGCTGTT GATGTCTCTCCTCTGCGTCGTGTGAACCAGGCTAT CTGGCTATTGTGCACTGGTGCTCGGGAAGCAGCATTCCGTAATATCAAGACCATTGCTGAGTGTGTGGCC -------------------------------------------------------------------------Cybosia mesomella ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema bicolor ------CGACTCACTATAGGGATGGCGGAGGAGAATTGGAACGATGATGCCGTGGAGTCAGGCAGCATGGCTGTTGACA ACATGCCATTGCCGCAGGCGGCAGATATCCCCGAAATTAAACTCTTCGGCAGATG GAGTTGTTATGATGTTCAAGTG TCTGACATGTCCCTACAGGATTACATCTCCGTTAAAGAGAAGTACGCCAAGTATTTACCACACTCGGCTGGCAGGTAT GCGCACAAACGTTTCCGTAAAGCTCAGTGTCCCATCGTTGAGCGTTTGACCAACTCTCTTATGATGCACGGCCGCAA CAATGGCAAGAAACTGATGGCCGTAAGGATCGTGAAACACGCATTTGAAATTATTCATTTGCTGACTGGTGAGAACCC T CTGCAGGTTCTTGTAACAGCTATCATAAACTCTGGGCCCCGTGAAGACTCTACTAGAATTGGTCGTGCTGGTACTGT GCGTCGTCAGGCTGTTGACGTTTCACCCCTGCGTCGTGTAAACCAGGCAATCTGGCTATTGTGCACAGGCGCACGT GAGGCTGCATTCCGTAACATCAAGACTATTGCTGAGTGTGTAGCTGATGAACTTATCAACGCAGCTAAGGGTTCATCA AACTCTTATGCCATCAAGAAGAAGG ATGAGTTGGAACGT ---

PAGE 327

327 Eilema complana TTAATACGACTCACTATAGGGATGGCGGAGGAAAATTGGAACGATGAAGCCGTGGAGGCAGGCAGCATGGCTGTTG ACAGCATGCCACTGCCGCAGGCGGCAGATATCCCCGAAATTAAACTCTTCGGCAGATGGAGTTGTTATGATGTTCAG GTGTCTGACATGTCCCTGCAGGATTACATCTCCGTTAAAGAGAAGTACGCCAAGTAT TTACCACACTCGGCTGGCAG GTATGCGCACAAACGTTTCCGTAAAGCTCAGTGCCCCATCGTTGAGCGTTTGACCAACTCTCTTATGATGCACGGCC GCAACAATGGCAAGAAACTGATGGCCGTAAGGATCGTGAAACACGCATTTGAAATTATTCATTTGCTGACTGGTGAGA ACCCTCTGCAGGTTCTTGTGACAGCTATCATTAACTCTGGCCCGCGTGAAGACTCTACTAGAATTGGTCGCGCTGGT ACTG TGCGTCGTCAGGCTGTTGACGTTTCACCCCTACGTCGTGTAAACCAGGCAATCTGGTTATTGTGCACAGGCGC ACGTGAGGCTGCATTCCGTAACATCAAGACTATTGCTGAGTGTGTAGCTGATGAACTTATCAACGCAGCGAAGGGTT CATCAAACTCTTATGCCATCAAGAAGAAGGATGAGTTGGAACGTGTT Eilema_dorsalis ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema griseola ------------------------------------TGGAATGACGATGCCGTGGAGGCAGGCAGCATGGCTGTTGACAGCATGCCA CTGCCGCA GGCGGCAGATATCCCTGAAATTAAACTCTTCGGCAGATGGAGTTGTTATGATGTTCAAGTGTCTGACATGTCCCTGCA GGATTACATCTCCGTAAAAGAGAAGTACGCCAAGTATTTACCACACTCTGCTGGCAGGTATGCGCACAAACGTTTCC GTAAAGCTCAGTGTCCCATCGTTGAGCGTTTGACCAACTCTCTTATGATGCACGGCCGCAACAACGGCAAGAAACTG ATGGCCGTAAGGATC GTGAAACACGCATTTGAAATTATTCATTTGCTTACTGGCGAGAACCCTCTGCAGGTTCTAGTG ACGGCTATCATTAACTCTGGCCCCCGTGAAGACTCTACTAGGATTGGTCGCGCTGGTACCGTGCGTCGTCAGGCTGT TGACGTTTCACCCCTGCGTCGTGTGAACCAGGCTATCTGGTTATTGTGCACAGGAGCACGAGAGGCTGCATTCCGCA ACATCAAGACTATCGCTGAATGTGTAGCTGATGAGCTTA TCAACGCAGCCAAGGGTTCATCAAACTCTTACGCCATCA AGAAGAAGGATGAGTTGGAACGTGTT Eilema plana ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema sp. 1

PAGE 328

328 ------CGACTCACTATAGGGATGGCGGAGGAGAATTGGAACGACGATGCCGCCGATGCAGGCAGCATGGCTGTTGACA ACATGCCACTGCCGCAGGCGGCAGATATCCCCGAAATCAAACTCTTCGGCAGATGGAGTTGTTATGATGTGCAAGTG TCTGACATGTCCCTGCAGGATTACATCTCCGTTAAAGAAAAGTACGCTAAATACTTACCACACTCGGCTGGCAGGTAC GCGCACAAACGTTTCCG TAAGGCTCAGTGTCCCATCGTTGAGCGTTTGACCAACTCTCTTATGATGCACGGCCGCAA CAATGGCAAGAAACTGATGGCCGTGAGAATCGTGAAGCACGCCTTTGAAATCATTCATTTGCTCACTGGTGAGAACC CTCTGCAGGTTCTTGTGACGGCTATCATTAACTCTGGCCCCCGTGAAGACTCAACTAGAATCGGTCGCGCTGGTACA GTGCGTCGTCAGGCTGTTGACGTTTCTCCTCTTCGTCGTGTG AACCAGGCAATCTGGTTATTGTGCACAGGTGCACG TGAGGCTGCATTCCGTAACATCAAGACTATTGCTGAGTGTGTAGCTGATGAACTTATCAACGCAGCCAAGGGTTCTTC AAACTCTTATGCCATCAAGAAGAAGGATGAGTTGGAACGTGTT Eilema sp.2 ------CGACTCACTATAGGGATGGCGGAGGAGAATTGGAACGAAGAATCCGCGGATGCTGGCAGCATGGCTGTTGAC --ATGCC TTTGCCCCCGGCGGCCGATATCCCCGAAATAAAACTGTTCGGAAGATGGAGCTGTTTTGATGTGCAGGTTTC TGATATGTCTCTGCAGGATTACATCTCAGTCAAGGAGAAATACGCTAAGTATTTACCACACTCGGCTGGCAGGTATGC GCATAAACGTTTCCGTAAAGCTCAGTGCCCCATTGTTGAGCGTTTAGCCAACTCTCTTATGATGCACGGCCGCAATAA TGGCAAGAAACTTATGTCCGTAAGAATT GTGAAGCACGCCTTTGAAATCATTCATTTACTCACTGGTGAGAACCCCCT TCAAGTCTTGGTGACAGCTATCATCAACTCTGGGCCCCGTGAAGACTCAACTAGGATTGGTCGTGCTGGTACAGTAC GTCGTCAAGCCGTCGACGTTTCCCCGCTGCGCCGTGTAAACCAAGCTATCTGGCTATTGTGCACAGGTGCACGTGAA GCTGCATTCCGTAACATCAAGACTATTGCTGAATGTGTAGCCGATGAACTGA TTAATGCAGCAAAGGGATCATCAAAT TCCTATGCCATCAAGAAGAAGGACGAATTAGAACGTGTT Eilema sp.3 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Eilema sp.4 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Gardinia anoploa

PAGE 329

329 ------------------------------------------------------------------------------------------------------GATATCCCAGAAATTAAGCTTTTTGGCAG ATGGAGTTGTTATGATGTTCAAGTATCTGACATGTCACTGCAGGATTATATTTCCGTTAAAGAGAAGTACGCCAAGTAT TTACCTCACTCGGCTGGCAGGTATGCTCATAAACGTTTCCGCAAAGCTCAGTGCCCCATCGTTGAGCGTTTGACCAA CTCTCTTATGATGCACGGCCGTAACAATGGCAAAAAGCTGATGGCTGTCA GGATCGTGAAACACGCCTTTGAAATTAT TCACCTGCTCACTGGTGAGAACCCTCTGCAGGTTCTTGTGACCGCTATCATAAACTCTGGACCCCGTGAAGACTCGA CCAGAATTGGCCGTGCTGGTACAGTGCGTCGTCAGGCAGTTGACGTTTCTCCTCTGCGTCGTGTGAACCAGGCTATC TGGTTATTGTGCACAGGTGCACGTGAAGCTGCATTCCGCAACATCAAGACTATTGCTGAATGTGTTGCTGATGA ACTT ATCAATGCAGCAAAGGGTTCATCAAACTCTTATGCCATTAAAAAGAAGGATGAGTTGGAACGT --Gnamptonychia flavicollis ------------------------------------------------ATACGACTCACTATAGGGATGGCGGAGGAGAATTGGAACGATGATGCCGTGGA C ---GGCAGCATGGCTGTCGACAACATGCCACTGCCCCAGGCCGCTGATATCCCCGAAATCAAACTTTTTGGCAGATG GAGTTGTTACGACGTTCAAGTGTCTGATATGTCTCTGCAGGATTACATTTCTGTCAAAGAGAAGTACGCCAAGTATTTA CCTCACTCGGCTGGCAGGTATGCGCATAAACGTTTCCGTAAAGCTCAGTGCCCCATCGTTGAGCGTTTGACCAACTC TCTTATGATGCACGGCCGCAACAATGGCAAAAAGCTGATGGCCGTAAGGATCGTGAAGCACGCTTTTGAAATTATT CA TTTGCTCACCGGTGAGAACCCTCTGCAGGTTCTAGTGACAGCTATCATTAACTCTGGGCCCCGTGAAGATTCAACTAG AATTGGTCGTGCTGGTACAGTGCGCAGACAGGCTGTCGACGTTTCTCCTCTGCGTCGTGTGAACCAGGCAATCTGGT TATTGTGCACAGGTGCACGTGAGGCTGCATTCCGTAACATCAAGACAATTGCTGAGTGTGTAGCTGATGAACTCATCA ATGCAGCAAAGGGTTCATCAA ACTCTTATGCCATTAAGAAGAAGGATGAGTTGGAACGTGTT Heliosia jucunda --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hiera gyge ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hypoprepia cadaverosa -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 330

330 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hypoprepia fucosa --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hypoprepia fucosa tricol or ------------------------------------------------------GATGCAGGCAGCATGGCTGTTGACAGCATGCCACTGCCCCAAGCGGCTGA CATCCCCGAAATTAAACTTTTCGGCAGATGGAGTTGTTATGATGTTCAAGTATCTGACATGTCACTGCAGGATTACATC TCCGTAAAAGAGAAGTACGCCAAGTATTTACCTCACTCGGCTGGCAGGTACGCTCACAAACGTTTCCGTAAAGCTCA GTGCCCCATCGTTGAGCGTTTGACCAACTCTCTTATGATGCACGGCCGCAACAATGGCAAAAARCTGATGGCCGTCA GGATCGTAAAGCACGCGTTTGAAATTATTCACTTGCTCACTGGTGAGAACCCACTGCAGGTTCTTGTAACAGCTATCA TAAACTCTGGACCCCGTGAAGACTCTACGAGAATTGGTCGTGCTGGTACAGTGCGTCGCCAGGCTGTTGACGTCTCT CCTCTGCGCCGTGT TAACCAGGCTATCTGGTTATTGTGCACAGGTGCACGTGAAGTTGCATTCCGTAATATCAAGACC ATTGCTGAATGTGTAGCTGATGAACTTATCAATGCAGCAAAGGGTTCTTCC -----------------------------------------Inopsis modulata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lithosia quadra ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lyclene pyraula -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 331

331 -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lyclene reticulata -----------------------------------------------------------------------------------------CCTCCGGCGGCCGATATCCCAGAAATCAAGCTTT TCGGAAGATGGAGCTGTTTTGATGTGCAGGTGTCGGATATGTCCCTGCAAGATTACATCTCGGTGAAAGAGAAATAT GCCAAGTATTTACCGCACTCCGCTGGCAGGTATGCACACAAACGTTTCCGTAAAGCTCAGTGCCCCATCGTTGAACG TTTGACTAACTCTCTTATGATGCATGGCCGCAACAATGGTAAGAAGCTGATGGCCGTGAGAATCGTCAAACATGCGTT TGAAATAATCCATTTACTCACGGG CGAAAACCCTCTGCAAGTGTTGGTGACAGCTATCATCAATTCGGGACCTCGTGA AGACTCCACTAGGATCGGTCGTGCTGGTACCGTTCGTCGTCAAGCTGTTGACGTCTCTCCTCTGCGCCGTGTGAACC AGGCTGTATGGTTATTGTGCACAGGAGCCCGTGAAGCTGCATTCCGTAATATCAAAACTATCGCCGAGTGTGTAGCT GATGAGCTCATTAATGCAGCCAAAGGATCTTCTAATTCCTATGCAATT AAGAAGAAGGATGAGTTAGAACGTGTT Lyclene sp.1 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lyclene sp.1 nr. ------CGACTCACTAT AGGGATGGCGGAGGAGAATTGGAACGACGATGCAGTGGAGGCTGGCAGCATGGCTGTCGATT CCATGCCCCTTCCTCCGGCGGCCGATATTCCAGAAATTAAGCTTTTCGGAAGATGGAGCTGTTTTGATGTGCAGGTTT CTGATATGTCCCTGCAAGATTACATCTCGGTGAAAGAGAAATACGCCAAGTATTTACCTCACTCCGCTGGCAGGTATG CTCATAAACGTTTCCGTAAAGCTCAGTGCCCTATTGT TGAGCGTTTGACTAACTCCCTTATGATGCATGGCCGCAACA ATGGCAAGAAGCTGATGGCCGTCAGAATCGTCAAACATGCGTTTGAAATAATCCATTTACTCACTGGCGAGAACCCTC TGCAAGTGTTGGTGACAGCTATCATCAATTCGGGACCTCGTGAAGACTCCACTAGGATCGGTCGTGCYGGTACTGTT CGTCGTCAGGCTGTTGACGTTTCTCCTCTGCGCCGTGTGAACCAGGCTATATGGTTATTG TGCACAGGAGCCCGTGA AGCTGCATTCCGTAACATCAAAACTATTGCTGAATGTGTAGCCGATGAGCTCATTAACGCAGCCAAAGGATCTTCTAA TTCCTATGCAATTAAGAAGAAGGATGAGTTAGAACGT --Lycomorpha pholus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 332

332 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Lycomorphodes sordida --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Meterhythosia sangala ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Miltochrista miniata ------GACCTCACTATAGGGATGGCGGAGGAGAATTGGAATGACGATGCCGTGGACGCTGGCGGCATGGCTATTGACA ACATGCCCCTGCCCCTGGCGGCCGATATTCCCGAAATAAAACTTTTCGGAAGGTGGAGCTGTTTTGATGTACAGGTT TCTGATATGTCCCTGCAGGATTATATATCAGTCAAAGAGAAGTACGCTAAATATTTACCTCACTCAGCTGGCAGGTAT GCGCATAAACGTTTCCGTAAAGCACAGTGCCCCATCGTTGAGCGTTTGGCCAACTCTCTTATGATGCATGGCCGCAA CAACGG CAAGAAACTGATGTCCGTGAGAATCGTGAAGCATGCTTTCGAAATCATCCATTTACTCACTGGTGAGAACCC CCTGCAAGTGCTGGTCACTGCTATCATCAACTCTGGGCCCCGTGAAGACTCAACTAGGATTGGCCGTGCTGGTACTG TACGTCGTCAGGCCGTCGACGTTTCCCCTCTGCGCCGTGTGAACCAGGCTATCTGGTTATTGTGCACAGGTGCACGT GAAGCTGCATTCCGTAACATCAAGACTATT GCTGAATGTGTAGCTGATGAACTGATCAACGCAGCAAAGGGATCCTCA AATTCCTATGCCATCAAGAAGAAGGACGAGCTGGAACGTGTT Miltochrista sp.1 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Prepiella aurea nr. -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 333

333 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Prinasura quadrilineata ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Ptychoglene coccinea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Schistophleps albida ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Amata aperta -----------------------------------------------------------------------------------------CCCCCGGCGGCCGATATCCCCGAAATAAAACTGT TCGGAAGATGGAGCTGTTTTGATGTGCAGGTTTCTGATATGTCTCTGCAGGATTACATCTCAGTCAAGGAGAAATACG CTAAGTATTTACCACACTCGGCTGGCAGGTATGCGCATAAACGTTTCCGTAAAGCTCAGTGCCCCATTGTTGAGCGTT TAGCCAACTCTCTTATGATGCACGGCCGCAATAATGGCAAGAAACTTATGTCCGTAAGAATTGTGAAGCACGCCTTTG AAATCATTCATTTACTCACTGG TGAGAACCCCCTTCAAGTCTTGGTGACAGCTATCATCAACTCTGGGCCCCGTGAAG ACTCAACTAGGATTGGTCGTGCTGGTACAGTACGTCGTCAAGCCGTCGACGTTTCCCCGCTGCGCCGTGTAAACCAA GCTATCTGGCTATTGTGCACAGGTGCACGTGAAGCTGCATTCCGTAACATCAAGACTATTGCTGAATGTGTAGCCGAT GAACTGATTAATGCAGCAAAGGGATCATCAAATTCCTATGCCATCAAGAAGAAGGACGAATTAGAACGTGTT Pagara simplex ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 334

334 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asota heliconia --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Asota orbona ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Neochera dominia ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

PAGE 335

335 APPENDIX D LIST OF CHARACTERS A N D STATES IN PHYLOGEN Y OF LYCOMORPHA List of Characters and States used in the Phylogenetic Analysis. Characters that are linked are marked with *. A unique abbreviation is provided to identify each character. Illustrations of the characters and their phyl ogenetic distribution are provided in the Chapter 4. Head 1. A1: Male flagellomere state. 0) simple and ciliate, 1) serrate, 2) bipectinate. 2. A2: Female flagellomere state. 0) simple and ciliate, 1) serrate. 3. E1: Gena state. 0) well developed, can be seen as a continuous band around the eye that joins the frons when viewing the head in profile, 1) reduced, cannot be seen as a continuous band around the eye. 4. P1: Proboscis length. 0) longer than the thorax, 1) shorter than thorax but longer than the head. 5. P2: Labial palp segment fusion. 0) all segments fused, 1) 2nd and 3rd segments fused, 2) fusion absent. Thorax 6. L1: Tibial spur formula. 0) 02 4, 1) 02 3. Wings 7. FW1: Forewing: R free to costal margin, not anastomosing with Sc. 0) Present, 1) Absent. 8. HW1: Hindwing: Sc + R 0) present, 1) absent. Abdomen 9. AB1: Form of the Anterolateral Process (ALP) on the A2 apodeme. 0) sclerotized bar, 1) flattened sclerotized lobe, 2) short nob, less than half the length of the apodeme.

PAGE 336

336 Male Abdomen and Genitalia Male Ab domen 10. MA1: A7/A8 ventral intersegmental membrane. 0) without androconia, 1) with androconia. 11. MA2: Form of androconia in A7/A8 ventral intersegmental membrane. ?) does not apply, 0) 2 pockets with long hair like scales, 1) shallow, broad pocket of sex scales one third or more the width of A7 sternite, 2) narrow pocket of sex scales less than onethird the width of A7 sternite. 12. MA3: Cephalic margin of A8 sternite. 0) fused to cephalic margin of A8 tergite, 1) extending to the cephalic margin of A8 tergi te, no fusion, 2) extending onto the A8 pleurites. 13. MA4: Sclerotization of A8 tergite. 0) present, 1) absent. 14. MA5: Pattern of sclerotization of A8 tergite. ?) does not apply, 0) T shaped, 1) square, 2) heartshaped, 3) rectangular. 15. MA6: A8/A9 dorsal intersegmental membrane. 0) without androconia, 1) with 3 androconia, 2 pockets with long hair like sex scales bracketing a shallow pocket with hair like scales. 16. MA7: A8/A9 ventral intersegmental membrane. 0) without androconia, 1) with androconia. 17. M A8: Form of androconia in the A8/A9 ventral intersegmental membrane. ?) does not apply, 0) 2 shallow pockets of sex scales located on the outer edges of the membrane, 1) a small pocket of sex scales located in the center of the membrane. Genital Capsule 18. P S1: Pleural Sclerites. 0) present, 1) absent. (The presence of pleural sclerites is constant throughout all taxa included in the study.) 19. TF1: The two halves of the tegumen fused for their entire length. 0) present, 1) absent. 20. TF2: Sutures indicating the location of the fusion. 0) present, 1) absent. 21. TF3: Shape of the sutures on the tegumen. ?) does not apply, 0) inverted Y shape, 1) V shaped, 2) inverted U shape, 3) Inverted T shape, 4) straight line with an ovoid bulge medially

PAGE 337

337 22. TU1: Articulation o f tegumen with uncus. 0) not fused, membranous break separating the tegumen and uncus, 1) fused. 23. UB1: Sclerotization around the uncus base. 0) present, 1) absent. 24. UB2: Form of sclerotization around the base of the uncus. ?) does not apply, 0) reduced to narrow, strips occurring laterally on the uncus base, 1) triangular, 2) rectangular, 3) V shaped, 4) U shaped. 25. US1: Curvature of the uncus. 0) S shaped, emerges from the conjuctiva and undergoes two bends, 1) C shaped, 2) knob, 3) straight. 26. US 2: Shape of the apex of the uncus. 0) fingerlike tapering to a point, 1) fingerlike not tapering to a point, 2) laterally compressed ridge, 3) ovoid, teardrop shaped, tapering to a point, 4) spade shaped, tapering to a point. 27. CM1: Distal end of costal mar gin occurring as an identifiable break in the sclerotization. 0) present, 1) absent. 28. PB1: Processus basalis of costa. 0) present, 1) absent. 29. PB2: Shape of processus basalis of costa. ?) does not apply, 0) laterally compressed triangles, 1) elongate spines, tapering to a point, 2) dorsoventrally compressed trident shaped extensions, tips are blunt, 3) short dorso ventrally flattened lobe. 30. TR1: Transtilla. 0) present, 1) absent. 31. ED1: Editum. 0) present, 1) absent. 32. ED2: Location of the editum. ?) does not apply, 0) proximally, occurs within the proximal of the costa, 1) processus basalis of the costa, 2) distally, at or beyond the proximal of the of the costa. 33. J1: Shape of the juxta. 0) rectangular with length perpendicular to the body, 1) semicircular, 2) conical projection with lateral extensions, 3) square with elongate two pronged projection, 4) square with a concave indentation in distal margin, 5) triangular with a conical tip, 6) trapezoidal 7) rectangular wit h a triangular indentation in distal margin. 34. J2: Juxta ornamentation, transpar ent patch. 0) present, 1) absent. 35. J3: Shape of transparent patch. ?) does not apply, 0) triangular, 1) semicircular, 2) conical 3) rectangular, 4) circular. 36. VS1: Shape of vinculum/saccus. 0) U shaped, 1) V shaped, 2) M shaped.

PAGE 338

338 37. IV1: Ornamentation of intravincular membrane, single shallow pocket with sex scales. 0) present, 1) absent. Phallus 38. BP1: Proximal end of basiphallus (caecum). 0) well developed, ductus ejaculatorious simplex (DES) located entirely dorsad of the caecum, 1) reduced, DES emerging from anterior, dorsal end of caecum, 2) absent, DES emerges from the anterior end of aedeagus. 39. BP2: Orientation of basiphallus. 0) straight, 1) inflected dorsally at distal end (curved away from venter), 2) inflected dorsally at midpoint (curved away from venter), 3) inflected ventrally at base (curved toward venter). 40. PH1: Phallic sclerite. 0) present, 1) absent, highly reduced. 41. PH2: Shape of phallic sclerite, left side. ?) does not apply, 0) flattened lobe, extending as a separate structure dorsad of the vesica, 1) rectangular, 2) narrowed, rounded triangle, 3) narrowed, pointed triangle. 42. V1: Vesica bilobed. 0) absent, 1) present. 43. V2: Membranous projections arising from the primary lobe(s) of vesica. 0) present, 1) absent. 44. V3: Location of membranous projections. ?) does not apply, 0) apically on the left side, proximal to the distal margin of the aedeagus, 1) distal end of main lobe, upper right apice, 2) apicall y on the right side, 3) medially on the right side, 4) dorsal surface of the primary lobe. 45. V4: Ornamentation of the membranous projection located distally on the primary lobe. ?) does not apply, 0) peglike cornuti present the entire length, 1) peglike c ornuti present on the distal third, remainder ruggose, 2) ruggose for the entire length. 46. V5: Ornamentation of the vesica: heavily sclerotized, spine like cornutus. 0) present, 1) absent. 47. V6: Location of spine like cornutus. ?) does not apply, 0) pri mary lobe, 1) distal point of the membranous projection off the vesica. Female Abdomen and Genitalia 48. FA1: A7 segment more heavily sclerotized than preceding segments. 0) present, 1) absent. 49. FA2: Form of heavy sclerotization of A7. ?) does not apply, 0) continuous around the segment, 1) membranous breaks in the pleurites, 2) membranous

PAGE 339

339 break occurring on the sternite, 3) membranous break on the tergite, 4) membranous breaks on pleurites and sternite. 50. FA3: Shape of A7 sternite. 0) sternite unsclerotized, no defined shape, 1) goblet shaped, 2) M shaped, 3) shieldshaped, 4) rectangular, length perpendicular to the body, 5) parallelogram, 6) ovoid with x shaped posterior margin. 51. FA4: Form of distal margin of the A7 sternite. 0) deep concave indentation, extends more than a quarter the length of the A7 sternite, 1) margin approximately horizontal, 2) posterior margin membranous, not possible to distinguish from A7/A8 intersegmental membrane, 3) crenellated, 4) shallow concave indentation, extends less tha a quarter the length of the A7 sternite, 5) convex, 6) A7 distal margin elongated into 2 projections that encircle the ostium bursa. 52. FA5: A8 sternite. 0) present, 1) absent. 53. FA6: Form of A8 sternite. ?) does not apply, 0) heavily sclerotized plate, 1) reduced to a bar fused with A8 tergite, ventral break present, 2) reduced to a continuous sclerotized bar, fused with A8 tergite, 3) semicircular lightly, sclerotized plate, anterior margin a sclerotized bar fused with A8 tergite, 4) sclerotized plate wi th W shaped anterior margin, 5) sclerotized bar fused to A7 sternite and A8 tergite. 54. OB1: Location of the ostium bursa. 0) intersegmental membrane between A7/A8, 1) A8 sternite, 2) A7 sternite. 55. OB2: Placement of ostium bursa when it occurs in A8 ster nite. ?) does not apply, 0) fused with anterior margin of A8 sternite, 1) broad horizontal opening, centered in A8 sternite, extends over half the width of A8 sternite, 2) circular opening occurring anteriorly in A8 sternite, not fused with margin of A8 s ternite, 3) narrow horizontal opening, centered in A8 sternite, extends less half the width of A8 sternite. 56. DB1: Sclerotization of the ductus bursa. 0) present, 1) absent. 57. DB2: Location of the sclerotized portion of the ductus bursa. ?) does not apply, 0) proximal to the ostium bursa, 1) not proximal to the ostium bursa, membranous break between ostium bursa and sclerotized portion of ductus bursa. 58. CB1: Corpus bursa. 0) wrinkled, 1) smooth. 59. CB2: Corpus bursa. 0) single, 1) two bursae, connate, arising from ductus, 2) two separate bursae with common membranous duct. 60. CB3: Signa number. 0) one, 1) two, 2) three or more.

PAGE 340

340 61. CB4: Signa form. 0) slightly sclerotized plates with heavily sclerotized bars running perpendicular to the length of the plate, 1) elongate heavily sclerotized strips with internal spines. 62. DS1: Origin of the ductus seminalis. 0) ductus bursa, 1) corpus bursa, 2) appendix bursa, 3) second corpus bursa. 63. DS2: Location of the ductus seminalis on the ductus bursa. ?) does not apply 0) ventral, 1) lateral, right side, 2) lateral, left side, 3) dorsal. 64. PG1: Dorsal pheromone gland shape. 0) two triangular projections arising from a single opening, 1) square with elongations from each apical corner. 65. PG2: Form of the two triangular projections of the dorsal pheromone gland. ?) does not apply, 0) broad triangles, width greater or equal to length of the triangle, 1) short, narrow triangles, length of triangle greater than the base but not more than two times greater.

PAGE 341

341 APPENDIX E ALL SPECIES DATA MAT RIX FOR LYCOMORPHA PHYLOGENY 0 1 0 6 1 1 1 6 2 1 2 6 3 1 3 6 4 1 4 6 5 1 5 6 6 1 Lycomorpha fulgens 11001 10101 11030 11000 20000 10010 1?501 00211 ?002? 01005 1050? 1?101 00300 Lycomorpha grotei 10102 10101 10020 11000 10040 301?0 00501 20210 20012 00002 01?0? 01001 00101 Lycomorpha miniata 11002 10101 11030 0?000 10021 301?0 1?41? 20200 0000? 01014 40011 1?001 00000 Lycomorpha pholus 11002 10101 11030 0?000 10021 301?0 1?41? 20200 0000? 01011 10011 1?001 00000 Lycomorpha pulchra 10002 10101 10020 11000 10030 301?0 0051? 20200 30010 00002 01?0? 01001 00101 Lycomorpha regulus 10002 10101 10020 11000 10030 301?0 00500 20200 20011 00002 01?0? 01001 00101 Lycomorpha splendens 21101 10101 11030 0?000 301?1 001?0 0061? 20200 101?? 1?013 1010? 1?100 00200 New Species A 10102 10101 11020 11000 10000 40030 0151? 20210 2003? 00002 0050? 00001 00000 New Species B 11002 10101 11030 0?000 10021 301?0 1?41? 20200 0000? 01011 30011 1?001 00000 New Species C 1?002 10101 10020 11000 10030 301?0 00500 20200 30011 00??? ????? ????? ????? Propyria morelosia 10002 1011? ?1030 0?000 40000 10010 00700 20200 2004? 00002 0050? 00011 01?00 Propyria normani 1?002 101?1 21030 0?000 40001 00020 01700 20200 2004? 00??? ????? ????? ????? Propyria ptychoglene 10002 10101 21030 0?000 40001 00020 01702 20201 ?004? 00016 60312 1?001 00200 Dolichesia falsimonia 00102 01110 ?11?1 10001 ?11?3 011?1 0231? 01001 ????? 1?002 40210 00001 0011? Hypermaepha maroniensis 00110 01121 021?0 0?001 ?11?2 301?1 1?204 11031 ?11?? 1?035 5020? 00001 02?1? Hypoprepia fucosa 10112 00010 ?2000 0?010 01011 011?0 0211? 01101 ?11?? 1?1?0 2022? 00002 11?1? Lycomorphodes correbiodes 00102 00110 ?01?1 0?001 ?01?1 20001 1?003 11021 ?01?? 1?1?0 20413 1?001 0011? Ptychoglene erythrophora 00002 00010 ?1010 0?010 01011 011?0 02003 01101 ?11?? 1?040 2012? 00002 12?1? Talara coccinea 00102 01120 ?01?1 0?001 ?01?3 111?1 0211? 11030 001?? 1?020 20210 1?121 03?1?

PAGE 342

342 APPENDIX F COLLECTION LOCALITY DATA FROM SPECIMENS USED TO IL LUSTRATE THE ADULT HABITUS OF LYCOMORPHA Figure 5 2 A L. atroxantha (Schaus), Female: Tactic, Guatemala, August, Schaus and Barnes Collection, USNM. B. L. concolor Scott, Female: Cave Ck. Canyon, Portal, Arizona, Cochise Co., 13.vii.1948, C. & P. Vaurie, AMNH. C. L. concolor Scott, Female: Madera Canyon 5800, Santa Rita Mts., Santa Cruz Co., Arizona, 8.vii.1960, J.G. Franclemont, CUIC. D L. concolor Scott, Male: East Turkey Creek 6400, Chiricahua Mountains, Cochise Co., Arizona, 6.vii.1966, J.G. Franclemont, CUIC. E. L. concolor Scott, Male: Madera Canyon 5800, Santa Rita Mts., Santa Cruz Co., Arizona, 8.vii.1960, J.G. Franclemont, CUIC. F. L. fulg ens (Edwards), Female: Palmerlee, Arizona, USNM. G L. fulgens (Edwards), Female: Huachuca Mts., Arizona, USNM. H L. fulgens (Edwards), Female: Wet Canyon, Pinaleo Mts., Arizona, 8.vi.1967, J.H. Hessel, AMNH. I L. fulgens (Edwards), Male: Ramsey Canyon, Huachuca Mts., Cochise Co., Arizona, 28.v.1964, R.F. Sternitzky, Collection of Fred H. Rindge, AMNH. J. L. fulgens (Edwards), Male: Redington, Arizona, USNM. Figure 5 3 A. L. fulgens (Edwards), Male: Redington, Arizona, M. Chrissman, 15.ix.1902, Holland Collection, CMNH. B. L. fulgens (Edwards), Male: Chihuahua Townsend, 16.ix, Holland Collection, CMNH. C. L. grotei (Packard), Female: Black Canon Cimarron, Colorado, 1315.ix.1917, R.C. Shannon, CUIC. D. L. grotei (Packard), Female: So. Utah, Poling, 1.vi i.1910, USMN. E. L. grotei (Packard), Male: Sylvan Lakes, South Dakota, 13.viii.1912, R.A. Leussler, AMNH. F. L. grotei (Packard), Male: Eureka, Utah, 27.viii.1911, Tom Spalding, USNM. G. L. miniata Packard, Female: Joe Dollar Gulch, Hill City, Black Hills South Dakota, 2.viii.1964, D.C. Ferguson, USNM. H. L. miniata Packard, Male: Joe Dollar Gulch, Hill City, Black Hills, South Dakota, 3.viii.1964, D.C. Ferguson, YPM. I. L. morelosia (Schaus), Female: Barranca, Mixcoac, Mexico, 20.viii.1917, C.C. Hoffman, AMNH. J. L. morelosia (Schaus), Male: Zacualpan, Mexico, ix.1914, Dognin Collection, USNM. Figure 5 4 A. L. neomexicanus Scott, Male: New Mexico: Union Co., Johnson Mesa, 10mi N Folsom, 21.vi, Sta. 448, leg. H.K. & M.A. Clench, 1977, C.M. Acc. 29258, CMNH.

PAGE 343

343 B. L. normani (Schaus), Male: Cuernavaca, Mexico, vii.1906, Collection Wm. Schaus, USNM. C. L. pholus (Drury), Female: Big Indian Vy, Catskill Mts, New York, 3.vii.1906, R.F. Pearsall, Accession No. 11291, Collection Brklyn Mus., USNM. D. L. pholus (Drury), Female: Oklahoma: Sequo. Co., Lake Tenkiller, 2mi NW Blackgum, 1114.vi.1981, D. & M. Davis, USNM. E. L. pholus (Drury), Male: USA: VA: Page Co., Pinnacles, Shenandoah Nat. Park 3400, 5.viii.1979, Leg. D.C. F eguson, USNM. F. L. pholus (Drury), Male: Oklahoma: Kiowa Co., 7mi SW Lone Wolf, 3.iv.1979, R.J. McGinley, USNM. G. L. ptychoglene (Hampson), Female: Jalapa, Mexico, Collection Wm. Schaus, USNM. H. L. ptychoglene (Hampson), Male: Mexico, Dognin Collection, USNM. I. L. pulchra Dyar, Female: Cuyamaca State Pk., California, 17.vi.1943, S.S. Nicolay, LACM. J. L. pulchra Dyar, Female: Chariot Canyon, Banner, California, 11.x.1946, R.P. Allen Collector, CAS. Figure 5 5 A. L. pulchra Dyar, Female: Forest Home, California, 7.iv.1927, Engel Coll., Carn. M. Acc. 13257, CMNH. B. L. pulchra Dyar, Male: Mill Cr. Cn., San Bernadino Co., California, 21.ix.1923, E.P. Van Duzce Collector, CAS. C. L. pulchra Dyar, Male: Chariot Canyon, Banner, California, 11.x.1946, R.P. Allen Collector, UCB D. L. pulchra Dyar, Male: Forest Home, California, 7.iv.1927, LACM. E. L. regulus (Grinnell), Female: S. Fork Big Rock Cr., San Gabriel Mts., L.A. Co., California, 23.ix.1971, el. 4500, coll. C Henne, Chris Henne Collection purchased 1978 LACM Foundation, LACM. F. L. regulus (Grinnell), Female: Upper Camp., Pinery Canyon, Chiricahua Mts., Cochise Co., Arizona, 5.vii.1956, Collected by Lloyd M. Martin, John A. Comstock, & William A. Rees, LACM. G. L. regulus (Grinnell), Male: Emgd. 18.ii.1968, ova ex. conf. female, So. Fork Big Rock Cn., L.A. Co., California, 18.x.1967 4500, coll. C. Henne, Chris Henne Collection purchased 1978 LACM Foundation, LACM. H. L. regulus (Grinnell), Male: Diamond Rock, White Mts., Arizona, 30.viii.1947, Collection of Grace H. and John L. Sperry, AMNH. I. L. splendens Barnes and McDunnough, Female: Utah: Kane Co., Fivemile Valley, 5000, (Hwy. 89, 5 road mi. W of Paria R.), 4.ix.1968, leg. J.F. Emmel & A.O. Shields, YPM. J. L. splendens Barnes and McDunnough, Male: Fort Davis, Texas, Jeff Davis Co., 5.x.1969, A. & M.E. Blanchard, USNM. Figure 5 6 A. L. texanus Scott, Female: Texas, USNM. B. L. texanus Scott, Male: Texas, Collection Brklyn Museum, USNM.

PAGE 344

344 Figure 5 7 L. pelopia (Druce), Female: Mexico: Guerrero, 57km NW Taxco, 18501900M, 14.ix.1982, J.A. Powell and J.A. Chemsak Collectors, UCB

PAGE 345

345 LIST OF REFERENCES Acharya, L. & Fenton, M.B. (1992) Echolocation behavior of verpertillionid bats ( Lasiurus cinereus and Lasiurus borealis ) attacking airborne targets including arctiid moths. Canadian Journal of Zoology 70, 1292 1298. Akaike, H. (1974) A new look at the statistical model identification. IEEE Transactions on Automatic Control 19, 716 723. Barnes, W. & McDun nough, J.H. (1912) Fifty new species and varieties. Contributions to the Natural History of the Lepidoptera of North America 1(5) : 1 44. Bendib, A. & Minet, J. (1998) Female pheromone glands in Arctiidae (Lepidoptera). Evolution and phylogenetic significance. Comptes Rendus de lAcadmie des Sciences Series IIISciences de la Vie, 321, 1007 1014. Bendib, A. & Minet, J. (1999) Lithosiine main lineages and their possible interrelationships. I. Definition of new or resurrected tribes (Lepidoptera: Arctiidae). Annales de la Socit Entomologique de France, 35, 241 263. Bernays, E.A., Chapman, R.F. & Hartmann, T. (2002) A highly sensitive taste receptor cell for pyrrolizidine alkaloids in the lateral galeal sensillum of a polyphagous caterpillar, Estigmene acrea. Journal of Comparative Physiology A 188, 715 723. Birket Smith, J. (1965) A revision of the West African Eilemic moth, based on the male genitalia (Lep, Artidae, Lithosinae; incl. gena. Crocosia Eilema Lithosia Pelosia Phryganopsis a. o.). Papers from the Faculty of Science. Haile Sellassie I Univ. Ser. C (Sool.), 1, 1 162. Blanchard, M.E. (1852) In : Gay C. ( ed. ) Historia fisica y politica de Chile : indices alfabeticos de la botanica y de la zoologia. Paris, p p 67 Boppr, M. (1984) Redefining pharmacophagy. Journal of Chemical Ecology 10, 1151 1154. Boppr, M. & Schneider, D. (1985) Pyrrolizidine alkaloids quantitatively regulate both scent organ morphogenesis and pheromone biosynthesis in male Creatonotos moths (Lepidoptera: Arctiidae). Jo urnal of Comparative Physiology A 157, 569 577. Brner, C. (1920) Ord. Lepidptera, Schmetterlinge. In : Brohmer, P. (ed. ) Fauna von Deutschland (ein Bestimmungsbuch unserer heimischen Tierwelt) 2. verbesserte Auflage. Quelle & Meyer, Leipzig pp. 328 355 Brner, C. (1932) Ordn. Lepidptera, Schmetterlinge. In : Brohmer, P. ( ed.) Fauna von Deutschland, 4. verbesserte Auflage. Frankenstein & Wagner, Leipzig pp. 369 404.

PAGE 346

346 Brandley, M.C., Schmitz, A. & Reeder, T.W. (2005) Partitioned Bayesian analysis, partition choice, and the phylogenetic relationships of scincid lizards. Systematic Biology 54, 373 390. Bremer, K. (1988) The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution, 42, 795 803. Bremer, K. (1994) Branch support and tree stability. Cladistics 10, 295 304. Brown, J.M. & Lemmon, A.R. (2007) The importance of data partitioning and the utility of Bayes factors in Bayesian phylogenetics. Systematic Biology 56, 643 655. Bryk, F. (1936) Zygaenidae, II. Lepidopterorum Catalogus 71, 237pp. Berlin. Butler, A.G. (1877a) Illustrations of typical specimens of Lepidoptera Heterocera in the collection of the British Museum, vol. 1. Order of the Trustees, London, 62 pp. 20 plates. Butler, A.G. (1877b) On the Lepidoptera of the family Lithosiidae in the collection of the British Museum. Transactions of the Entomological Society of London, 325 378. Cameron, S.L., Miller, K.B ., DHaese, C.A., Whiting, M.F. & Barker, S.C. (2004) Cladistics 20, 534 557. Untersuchungen zur kophysiologie der Gattung Setina Schrank (Lepi doptera: Arctiidae) Ph.D. dissertation Universitt Innsbruck, Austria. Clemens, B. (1860) Contributions to American lepidopterology, No. 7. Procee dings of the Academy of Natural Sciences of Philadelphia, 12, 522 547. Collins, C.T. & Watson, A. (1983) Field observations of bird predation on neotropical moths. Biotropica 15, 53 60. Common, I.F.B. (1990) Moths of Australia. Melbourne University Press, Carlton, Victoria, 535 pp. Comstock, J.A. & Henne, C. (1967) Early stages of Lycomorpha regulus Grinnell with notes on the imago. (Lepidoptera: Amatidae). Journal of Research on the Lepidoptera, 6(4) 275 280. Conner, W.E. (1987) Ultrasound: its role in t he courtship of the arctiid moth, Cycnia tenera Experientia, 43, 1029 1031. Conner, W.E. (1999) Un chant dappel amoureux: acoustic communication in moths. Journal of Experimental Biology 202, 1711 1723. Covell, C.V., Jr. (1984) A field guide to the moths of Eastern North America. Houghton Mifflin Company, Boston, Massachusetts 496 pp.

PAGE 347

347 DaCosta, M.A. & Weller, S.J. (2005) Phylogeny and classification of Callimorphiini (Lepidoptera: Arctiidae: Arctiinae). Zootaxa, 1025, 1 94. De Queiroz, A. (1993) For c onsensus (sometimes). Systematic Biology 42, 368 372. Dognin, P. (1916) Htrocres nouveaux de l'Amrique du Sud bd. 12. Rennes 34 pp. Draudt, M. (1917) Syntomid a e. Die Gross Schmetterlinge der Erde Bd. 6, 33 230, Stuttgart. Druce, H. (18811900) Biolo gia Centrali Americana: Insecta: LepidopteraHeterocera Volume 1. R.H. Porter, London. Druce, H. (18911900) Biologia Centrali Americana: Insecta: LepidopteraHeterocera Volume 2. R.H. Porter, London. Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Coo per, A., Duran, C., Field, M., Heled, J., Kearse, M., Markowitz, S., Moir, R., Stones Havas, S., Sturrock, S., Thi erer, T. & Wilson, A. (2011) Geneious v5.4, Available from http://www.geneious.com (accessed 1 September 2012) Drury, D. (1773) Illustrations of Natural History, Volume II. B. White, London 90 pp. Durante, A. (2008) Asuroides a new genus of lithosiine moths (Lepidoptera, Arctiidae, Lithosiinae). Zootaxa, 1713, 53 68. Durante, A. (2009) Revision of the Afrotropical species of Asura Walker, 1854 (Lepidoptera: Arctiidae: Lithosiinae), with the description of a new genus. Zootaxa, 2280, 27 52. Durante, A. (2012) The genus Afrasura Durante, 2009 in Gabon, with description of five new species and a new species group (Lepidoptera: Erebidae: Arctiinae: Lithosiini). Zootaxa, 3478, 383 398. Dussourd, D.E. (1986) Adaptations of insect herbivores to plant defenses Ph.D. dissertation, Corn ell University, Ithaca, New York. Dyar, H.G. (1897) The larva of Lycomorpha pholus Psyche 8, 82 83. Dyar, H.G. (1898) New American moths and synonymical notes. Journal of the New York Entomological Society 6, 33 44 Dyer, L.A., Singer, M.S., Lill, J.T., Stireman, J.O., Gentry, G.L., Marquis, R.J., Ricklefs, R.E., Greeney, H.F., Wagner, D.L., Morais, H.C., Diniz, I.R., Kursar, T.A. & Coley, P.D. (2007) Host specificity of Lepidoptera in tropical and temperate forests. Nature 448, 696 699.

PAGE 348

348 Edgar, R. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792 1797. Edwards, E.D. (1996) Arctiidae. In : Nielsen, E.S., Edwards, E.D., & Rangsi, T.V. (Eds.) Monographs on Australian Lepidoptera Volume 4: Checklist of the Lepidoptera of Australia CSIRO Australia, Collingwood, Victoria, pp. 278 286. Edwards, H. (1881a) A new genus and some new forms of North American Zygaenidae. Papilio 1, 80 81. Edwards, H. (1881b) Descriptions of some new species of Heterocera. Papilio 1, 115 122. Edwards, H. (1882) Descriptions of new species of North American Heterocera. Papilio 2, 123 130. Edwards, H. (1884) Notes on Mexican Lepidoptera with descriptions of new species. Papilio 4 11 19. Edwards, H. (1885) Notes on Mexican Lepidoptera, with descriptions of new species. Entomologica Americana, 1, 128 129. Edwards, H. (1886) Notes on North American Zygaenidae and Bombycidae with descriptions of new forms. Entomologica Americana, 2, 8 15. Edwards, H. (1887) Apparently new species of Mexican Heterocera. Entomologica Americana, 3, 89 92. Felder, R. (1874) In: Felder, C., Felder, R. & Rogenhofer, A.F. (Eds.), Reise der sterreichischen Fregatte Novara um die Erde (Zool.) 2 (Abt. 2), plates 75 120 (1874); Erklrung to 75 107 (1875). Vienna. Felsenstein, J.F. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783 791. Ferguson, D.C. & Opler, P.A. (2006) Checklist of the Arctiidae (Lepidoptera: Insecta) of th e continental United States and Canada. Zootaxa, 1299, 1 33. Fibiger, M. & Lafontaine, J.D. (2005) A review of the higher classification of the Noctuoidea (Lepidoptera) with special reference to the Holarctic fauna. Esperiana, 11 7 92. Forbes, W.T.M. (1939a) The Lepidoptera of Barro Colorado island, Panama. Bulletin of the Museum of Comprehensive Zoology Harvard College, 85 97 322. Forbes, W.T.M. (1939b) The muscles of the lepidopterous male genitalia. Annals of the Entomological Society of America, 32, 1 10.

PAGE 349

349 Forbes, W.T.M. (1954) The Lepidoptera of New York and neighboring states, part 3: Noctuidae. Cornell University Agriculture Experiment Station Memoir 329. Cornell University, Ithaca, New York Forbes, W.T.M. (1960) The Lepidoptera of New York and neig hboring states, part 4: Agaristidae through Nymphalidae including butterflies Cornell University Agriculture Experiment Station Memoir 371. Cornell University, Ithaca, New York Franclemont, J.G. (1983) Arctiidae. In : Classey, E.W. ( ed. ) Check List of the Lepidoptera of America North of Mexico T he Wedge Entomological Research Foundation, London, pp. xviii, 114 119. Fullard, J.H. & Napoleone, N. (2001) Diel flight periodicity and the evolution of auditory defences in the Macrolepidoptera. Animal Behavi our 62, 349 368. Gaede, M. (1926) Amatiden des Berliner Zoologischen Museums. (Lep). Deutsche entomologische Zeitschrift 1926, 113 136. Gardner, J.C.M. (1943) Immature stages of Indian Lepidoptera (5). Indian Journal of Entomology 5 89 102. Gelman, A. & Rubin, D.B. (1992) Inference from iterative simulation using multiple sequences. Statistical Sciences 7 457 511. Grinnell, F. (1903) Three undescribed Lepidoptera from Southern California. Entomological News 14 10 11. Grote, A.G. (1873) Catalogue of the Zygaenidae of North America. Bulletin of the Buffalo Society of Natural Sciences 1 29 36. Hampson, G.F. (1898) Catalogue of the Lepidoptera Phalaenae in the British Museum, volume I. Trustees of the British Museum, London, 559 pp. Hampson, G.F. (1900) Arctiadae (Nolinae, Lithosianae). Catalogue of the Lepidoptera Phalaenae in the British Museum, vol II. Trustees of the British Museum, London, 589 pp Hampson, G.F. (1901) New species of Syntomidae and Arctiadae. The Annals and Magazine of Natural Hist ory (7)8 165 186. Hampson, G.F. (1914) Catalogue of the Lepidoptera Phalaenae in the British museum, supplement volume I. Trustees of the British Museum, London, 858 pp. Hampson, G.F. (1920) Lithosiadae (Arctianae) and Phalaenoididae. Catalogue of the Lepidoptera Phalaenae in the British Museum, suppl 2. Trustees of the British Museum, London.

PAGE 350

350 Harris, T.W. (1839) Descriptive catalogue of the North American insects belonging to the Linnaean genus Sphinx in the Cabinet of Thaddeus William Harris, M.D., Librarian of Harvard University. The American Journal of Science, 36 282 320. Hartmann, T., Theuring, C., Beuerle, T. & Bernays, E.A. (2004) Phenological fate of plant acquired pyrrolizidine alkaloids in t he polyphagous arctiid Estigmene acrea. Chemoecology 14, 207 216. Hartmann, T., Theuring, C., Beuerle, T., Klewer, N., Schulz, S., Singer, M.S. & Bernays, E.A. (2005) Specific recognition, detoxification and metabolism of pyrrolizidine alkaloids by the polyphagous arctiid Estigmene acrea Insect Biochemistry and Molecular Biology 35, 391 411. Heppner, J.B. & Lamas, G. (1982) Acronyms for world museum collections of insects, with an emphasis on Neotropical Lepidoptera. Bulletin of the Entomological Society of America, 28 305 315. Herig, M. (1924) Beltrge zur Kenntnis der Zygaeniden (Lep.) II. Neue und wenig bekannte Zygaeniden von Amerika. Deutsche entomologische Zeitschrift 1924, 265 277. Herrich Schffer, G.A.W. (1850 1858) Sammlung neuer oder wenig bekannter aussereuropischer Schmetterlinge, Bd. 1, 84pp. plates 119. Herrich Schffer, G.A.W. (1855) Synopsis familiarum Lepidopterorum. Systematische Bearbeitung der Schmetterlinge von Europa 6 82 132. Hesbacher, S., Giez, I., Embacher, G., Fiedler, K., Max, W., Traw ger, A., Trk, R., Lange, O.T. & Proksch, P. (1995) Sequestration of lichen compounds by lichenfeeding members of the Arctiidae (Lepidoptera). Journal of Chemical Ecology 21, 2079 2089. Holland, W.J. (1903) The Moth Book: A Popular Guide to a Knowledge of the Moths of North America. Dover Publications, New York, 479 pp. Holloway, J.D. (2002) The moths of Borneo: Family Arctiidae, subfamily Lithosiinae. The Malayan Nature Journal 55 279 469. Hristov, N. & Conner, W.E. (2005) Effectiveness of tiger moth (Lepidoptera, Arctiidae) chemical defenses against an insectivorous bat ( Eptesicus fuscus). Chemoecology 15, 105 113. Hbner, J. (1823) Sammlung exotischer Schmetterlinge, Bd 2. Augsburg, 225 plates. Huelsenbeck, J.P. & Rannala, B. (2004) F requentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Systematic Biology 53, 904 913.

PAGE 351

351 Hundsdoerfer, A.K. & Kitching, I.J. (2010) A method for improving DNA yield from century plus old specimens of large Lepidoptera while minimizing damage to external and internal abdominal characters. Arthropod Systematics and Phylogeny 68, 151 155. Hurvich, C.M., & Tsai, C.L. (1989) Regression and time series model selection in small samples. Biometr ika 76, 297 307. Jacobson, N.L. (1995) Cladistic studies of the Arctiidae (Lepidoptera) and the genus Agylla (Arctiidae: Lithosiinae) using characters of adults and larvae Ph.D. dissertation, Cornell University, Ithaca, N ew Y ork Jacobson, N.L. & Weller, S.J. (2002). A cladistic study of the Arctiidae (Lepidoptera) by using characters of immatures and adults. Thomas Say Publications in Entomology, Entomological Society of America, 98pp Jordan, A.T., Jones, T.H. & Conner, W.E. (2005) If youve got it, fla unt it: ingested alkaloids affect corematal display behavior in the salt marsh moth, Estigmene acrea. Journal of Insect Science, 5, 1. Jordan, A.T., Jones, T.H. & Conner, W.E. (2007) Morphogenetic effects of alkaloidal metabolites on the development of the coremata in the salt marsh moth, Estigmene acrea (Dru.) (Lepidoptera: Arctiidae). Archives of Insect Biochemistry and Physiology 66, 183 189. Jordan, K. (1917) Zygaenidae. Die Gross Schmetterlinge der Erde Bd. 6, Stuttgart. Kass, R.E. & Raftery, A.E. (1995) Bayes factors. Journal of the American Statisical Association 90, 773 795. Kirby, W.F. (1837) In : Richardson ( ed .) Fauna Boreali Americana or the zoology of the Northern parts of British America. Josiah Fletcher, Norwich, pp. 1 325. Kirby, W.F. (1892) A synonymic catalogue of Lepidoptera Heterocera (moths): Sphinges and Bombyces, Vol. 1. Gurney & Jackson, London, 951pp. Kiriakoff, S.G. (1951) Recherches sur les organs tympaniques des Lpidoptres en rapport avec la classification. VII Lithosiidae. Biologisch Jaarboek 18, 53 76. Kiriakoff, S.G. (1963) The tympanic structures of the Lepidoptera and the taxonomy of the order. Journal of the Lepidopterists Society 17 1 6. Kishino, H. & Hasegawa, M. (1989) Evaluation of the maximum lik elihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominoidea. Journal of Molecular Evolution 29 170 179.

PAGE 352

352 Kitching, I.J. (1984) An historical review of the higher classification of the Noctuidae (Lepidoptera). Bulletin of the British Museum Natural History (Entomology) 49, 153 234. Kitching, I.J., Forey, P.L., Humphries, C.J. & Williams, D.M. (1998) Cladistics the theory and practice of parsimony analysis Oxford University Press, New York, 228 pp. Kitching, I.J. & Rawlins, J.E. (1998) The Noctuoidea. In : Kristensen, N.P. ( ed.) Lepidoptera, vol. 1. Handbuch der zoologie. de Gruyter, Berlin. Klots, A.B. (1970) Lepidoptera. In : Tuxen, S.L. ( ed.) Taxonomistss glossary of genitalia in insects, second edition. Copenhagen, Munksga ard pp. 115 130. Kluge, A.G. (1989) A concern for evidence and phylogenetic hypothesis of relationships among Epicrates (Boidae, Serpentes). Systematic Zoology 38, 7 25. Knlke, S., Erlacher, S., Haussman, A., Miller, M.A. & S egerer, A.H. (2005) A procedure for combined genitalia dissection and DNA extraction in Lepidoptera. Insect Systematics and Evolution, 35, 401 409. Knowlton, C.B. (1967) A revision of the species of Cisthene known to occur north of the Mexican borders (Le pidoptera: Arcttidae: Lithosiinae). Transactions of the American Entomological Society 93, 41 100, 33 figs. Kristensen, N.P. (2003) Skeleton and muscles: adults. In : Kristensen, N.P. ( ed.), Lepidoptera, Moths and Butterflies, part 3 6. de Gruyter, New York pp. 39 123. Lafontaine, J.D. & Fibiger, M. (2006) Revised higher classification of the Noctuoidea (Lepidoptera). Canadian Entomologist 138, 610 635. Lanyon, S.M. (1985) Detecting internal inconsistencies in distance data. Systematic Zoology 34 397 403. Lafontaine, J.D. & Schmidt, B.C. (2010) Annotated check list of the Noctuoidea (Insecta, Lepidoptera) of North America north of Mexico. ZooKeys 40, 1 239. Lanfear, R., Calcott, B., Ho, S.Y.W. & Guindon, S. (2012). PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution, 29, 1695 1701. Lemmon, A.R. & Moriarty, E.C. (2004) The importance of proper model assumption in Bayesian phylogenetics. Systematic Biology 53, 265 277. Lewis, P. O. (2001) A likelihood approach to estimating phylogeny from discrete morphological character data. Systematic Biology 50, 913 925. Luo, A., Qiao, H., Zhang, Y., Shi, W. Ho, S.Y.W., Xu, W., Zhang, A. & Zhu, C. (2010) Performance of criter ia for selecting evolutionary models in phylogenetics: a

PAGE 353

353 comprehensive study based on simulated datasets. BMC Evolutionary Biology 10, 242. Metzker, M.L. (2010) Sequencing technologies the next generation. Nature Reviews Genetics 11, 31 46. Miller, J.S (1991) Cladistics and classification of the Notodontidae (Lepidoptera: Noctuoidea) based on larval and adult morphology. Bulletin of the American Museum of Natural History 204 230 pp. Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In : Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA pp. 1 8. Mitchell, A., Cho, S., Regier J.C., Mitter, C., Poole, R.W. & Matthews, M. (1997) Phylogenetic utility of elongation factor 1 in Noctuoide the limits of synonymous substitution. Molecular Biology and Evolution, 14, 381 390. Mitchell, A., Mitter, C. & Regier, J.C. (2000) More taxa or more characters revisited: combining data from nuclear proteinencoding genes for phylogenetic analysis of Noctuidae (Insecta: Lepidoptera). Systematic Biology 49, 202 224. Mschler, H.B. (1890) Die LepidopteraFauna der Insel Portorico. Abhandlungen der Senkenb ergischen Naturforschenden Gesellschaft 16 70 360, 1 plate. Muma, K.E. & Fullard, J.H. (2004) Persistence and regression of hearing in the exclusively diurnal moths, Trichodezia albovittata (Geometridae) and Lycomorpha pholus (Arctiidae). Ecological Entomology, 29, 718 726. Mutanen, M., Wahlber g N., & Kaila, L. (2010) Comprehensive gene and taxon coverage elucidates radiation patterns in moths and butterflies. Proceedings of the Royal Society (B) 277, 2839 2848. Neumogen, B. & Dyar, H.G. (1893) A prelim inary revision of the Bombyces of America north of Mexico. Journal of the New York Entomological Society 1 97 118. Neumogen, B. & Dyar, H.G. (1894) A preliminary revision of the Bombyces of America north of Mexico. Journal of the New York Entomological S ociety 2 5 7 76. Nishida, R. (2002) Sequestration of defensive substances from plants by Lepidoptera. Annual Review of Entomology 47, 57 92. Nygaard, S., Zhang, G., Schtt, M., Li, C., Wurm, Y., Hu, H., Zhou, J., Ji, L. Qiu, F., Rasmussen, M., Pan, H., H auser, F., Krogh, A., Grimmelikhuijzen, C.J.P., Wang, J. & Boomsma, J.J. (2011) The genome of the leaf cutting ant Acromyrmex

PAGE 354

354 echinatior suggests key adaptations to advanced social life and fungus farming. Genome Research, 21, 1339 1348. Packard, A.S. (1864) Notes on the family Zygaenidae. Proceedings of the Essex Institute 4 7 48. Packard, A.S. (1872) New American moths: Zygaenidae and Bombycidae. Annual Report of the Trustees of the Peabody Academy of Science, 4 84 91. Pogue, M.G. & M ickevich, M.F. (1990) Character definition and character state delineation: the bte noire of phylogenetic inference. Cladistics 6 319 361. Powell, J.A. & Opler, P.A. (2009) Moths of Western North America. University o f California Press, Berkeley, Califor nia 369pp Pykk, H. & Hyvrinen, M. (2003) Host preference and performance of licheniverous Eilema spp. larvae in relation to lichen secondary metabolites. Journal of Animal Ecology 72, 383 390. ichen secondary metabolites affects food choice and survival of licheniverous moth larvae. Ecology 86, 2623 2632. Rambaut, A. (2010) FigTree v1.3.1. Institute of Evolutionary Biology, University of Edinburgh. Rawlins, J.E. (1984) Mycophagy in Lepidoptera. In : Wheeler, Q. & Blackwell, M. ( E ds.) Fungus insect relationships Columbia University Press, New York pp. 382 423 Rambaut, A. (2010) FigTree v1.3.1. Institute of Evolutionary Biology, University of Edinburgh. Regier, J.C., Mitter, C., Solis, M.A., Hayden, J.E., Landry, B., Nuss, M., Simonsen, T.J., Yen, S.H., Zwick, A. & Cummings, M.P. (2012) A molecular phylogeny for the pyraloid moths (Lepidoptera: Pyraloidea) and its implications for higher level classificat ion. Systematic Entomology 37, 635 656. Regier, J.C., Zwick, A., Cummings, M.P., Kawahara, A.Y., Cho, S., Weller, S., Roe, A., Baixeras, J., Brown, J.W., Parr, C., Davis, D.R., Epstein, M., Hallwachs, W., Hausmann, A., Janzen, D.H., Kitching, I.J., Solis, M.A., Yen, S.H., Bazinet, A.L. & Mitter, C. (2009) Toward reconstructing the evolution of advanced moths and butterflies (Lepidoptera: Ditrysia): an initial molecular study. BMC Evolutionary Biology 9, 280. Ronquist, F. & Huelsenbeck J.P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572 1574.

PAGE 355

355 Rota, J. (2011) Data partitioning in Bayesian analysis: molecular phylogenetics of metalmark moths (Lepidoptera: Choreutidae). Systematic Entomology 36, 317 329. Sanderf ord, K. (2009) Acoustic courtship in the Arctiidae. In : W.E. Conner ( ed .), Tiger Moths and Woolly Bears Behavior, Ecology, and Evolution of the Arctiidae. Oxford University Press, New York, New York. pp. 193 206. Sanderford, M.V. & Conner, W.E. (1990) Cour tship sounds of the polkadot wasp moth, Syntomeida epilais Naturwissenshaften 77, 345 347. Sanderford, M.V. & Conner, W.E. (1995) Acoustic courtship communications in Syntomeida epilais Wlk. (Lepidoptera: Arctiidae Ctenuchini). Journal of Insect Behavior 8, 19 31. Sanderson, M.J. (1995) Objections to bootstrapping phylogenies: a critique. Systematic Biology 44, 299 320. Sargent, T.D. (1995) On the relative acceptabilities of local butterlies and moths to local birds. Journal of the Lepidopterists Soci ety 39 148 162. Schaus, W. (1889) Descriptions of new species of Mexican Heterocera. Entomologica Americana, 5 87 90. Schaus, W. (1906) Descriptions of new South American moths. Proceedings of the United States National Museum 29, 179 345. Schaus, W. (1911a) New species of Heterocera from Costa Rica. Annals and Magazine of Natural Histor y (8) 7 173 193. Schaus, W. (1911b) New species of Heterocera from Costa Rica. Annals and Magazine of Natural History (8) 7 612 634. Schaus, W. (1925) Ne w species of moths in the United States national museum. Proceedings of the United States National Museum 65, 1 74. Schmidt, B.C & Opler, P.A. (2008) Revised checklist of the tiger moths of the Continental United States and Canada. Zootaxa, 1677 1 23. Sc hmidt, B.C. & Sperling, F.A.H. (2008) Widespread decoupling of mtDNA variation and species integrity in Grammia tiger moths (Lepidoptera: Noctuidae). Systematic Entomology 33, 613 634. Schneider, D., Boppr, M, Zweig, J., Horsley, S.B., Bell, T.W., Meinwald, J, Hansen, K. & Diehl, E.W. (1982) Scent organ development in Creatonotus moths: regulation by pyrrolizidine alkaloids. Nature, 215, 1264 1265.

PAGE 356

356 Schneider, D., Legal, L., Dierl, W. & Wink, M. (1999) Androconial hairbrushes of the Syntomis ( Amata ) phegea (L.) group (Lepidoptera, Ctenuchinae): A synapomorphic character supported by sequence data of the mitochondrial 16S rRNA gene. Zeitschrift fr Naturforschung C 54, 1119 1139. Schulz, S. (2009) Alkaloidderived male courtship peromones In : W.E. Conner (ed.), Tiger Moths and Woolly Bears Behavior, Ecology, and Evolution of the Arctiidae. Oxford University P ress, New York, New York. pp. 145 153. Schwarz, G. (1978) Estimating the dimension of a model. The Annals of Statistics 6, 461 464. Sco ble, M.J. (1992) The Lepidoptera Form, Function and Diversity. Oxford University Press New York 404 pp. Scott, C.H. & Branham, M.A. ( In Press ) A preliminary phylogeny of the lichen moth tribe Lithosiini (Lepidoptera: Erebidae: Arctiinae) using morphologi cal characters. Insect Systematics and Evolution. Shendure, J. & Ji, H. (2008) Next Generation DNA sequencing. Nature Biotechnology 26, 1135 1145. Simmons, R. (2009) Adaptive coloration and mimicry. In : W.E. Conner ( ed.), Tiger Moths and Woolly Bears Behavior, Ecology, and Evolution of the Arctiidae. Oxford University Press, New York, New York. pp. 115 126. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene seque nces and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America, 86, 651 701. Sorenson, M.D. & Franzosa, E.A. (2007) TreeRot, version 3. Boston University, Boston, MA. Smith, F.B. (1975) Naturalists co lor guide. The American Museum of Natural History, New York. Color work by Hale Color Consultants, Baltimore. Snodgrass, R.E. (1993) Principles of Insect Morphology Cornell University Press, Ithaca, New York 667 pp. Stamatakis, A. (2006) RAxMLVI HPC: Maximum Likelihood based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688 2690. Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid bootstrap algorithm for the RAxML webserve rs. Systematic Biology 75, 758 771.

PAGE 357

357 Stephens, J.F. (1829) Haustellata. Illustrations of British Entomology, vol 2. Baldwin & Cradock, London. Strand, V.E. (1920) Kritische bemerkungen und berichtigungen zum supplementband I des Hampson schen Catalogue o f the Lepidoptera Phalaenae. Deutsche Entomologische Zeitschrift Iris 34, 217 226. Strong, E.E. & Lipscomb, D. (1999) Character coding and inapplicable data. Cladistics 15, 363 371. Sugiura, N. (1978) Further analysis of the data by Akaikes informati on criterion and the finite correction. Communications in Statistics Theory and Methods 7, 13 26. Sullivan, J. & Joyce, P. (2005) Model selection in phylogenetics. Annual Reviews of Ecology, Evolution, and Systematics 36, 445 466. Swofford, D. L. (2003 ) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Si nauer Associates, Sunderland, Massachusetts Tarmann, G.M. (1984) Generische Revision der amerikanischen Zygaenidae mit Beschreibung neuer Gattungen und Arten (Insecta: Lepidoptera). Entomofauna, Suppl 2, vol 1, 176 pp., vol. 2, 153 pp., 438 figs. Ugelvig, L.V, Vila, R., Pierce, N.E. & Nash D.R. (2011) A phylogenetic revision of the Glaucopsyche section (Lepidoptera: Lycaenidae), with special focus on the Phengaris Maculinea clade. Molecular Phylogenetics and Evolution 61, 237 243. Wagner, D.L., Rota, J. &. McCabe T.L. (2008) Larva of Abablemma (Noctuidae) with notes on algivory and lichenivory in macrolepidoptera. Annals of the Entomological Society of America, 101 40 52. Wahlberg, N. & Nylin, S. (2003) Morphology versus molecules: resolution of the positions of Nymphalis Polygonia, and related genera (Lepidoptera: Nymphalidae). Cladistics 19, 213 223. Wahlberg, N., Weingartner, E. & Nylin, S. (2003) Towards a better understanding of the higher systematics of Nymphalidae (Lepidoptera: Papilionoidea). Molecular Phylogenetics and Evolution, 28, 473 484. Wahlberg, N., Brower, A.V.Z. & Nylin, S. (2005) Phylogenetic relationships and historical biogeography of tribes and genera in the subfamily Nymphalinae (Lepidoptera: Nymphalidae). Biological Journal of the Linnean Society 86 227 251. Wahlberg, N., Leneveu, J., Kodandaramaiah, U., Pea, C., Nylin, S., Freitas, A.V.L. & Brower, A.V.Z. (2009) Nymphalid butterflies diversify following near demise at the

PAGE 358

358 Cretaceous/Tertiary boundary. Proceedings of the Royal Society Biological Sciences 276, 4295 4302. Wahlberg, N., Snll, N., Viidalep p, J., Ruohomki, K. & Tammaru, T. (2010) The evolution of female flightlessness among Ennominae of the Holarctic forest zone (Lepidoptera: Geometridae). Molecular Phylogenetics and Evolution 55, 929 938. Walker, F. (1854a) List of the specimens of Lepidopterous insects in the collection of the British Museum 2 279 581. Walker, F. (1854b) Catalogue of Lepidoptera Heterocera. List of the specimens of Lepidopterous insects in the collection of the British Museum 31, 1 706. Walker, F. (1856) List of the specimens of Lepidopterous insects in the collection of the British Museum 7 1509 1808. Walker, F. (1865) List of the specimens of Lepidopterous insects in the collection of the British Museum 31, 1 321. Walker, F. (1866) List of the specimens of Lepidopterous insec ts in the collection of the British Museum 35, 1535 2040. Watson, A., Fletcher, D.S. & Nye I.W.B. (1980) Noctuoidea (part): Arctiidae, Cocytiidae, Ctenuchidae, Dilobidae, Dioptidae, Lymantriidae, Notodontidae, Strepsimanidae, Thaumetopoeidae, Thyretidae. In : Nye, I.W.B. ( ed.) The generic names of moths of the world, vol. 2 Trustees of the British Museum (Natural History), London, pp. i xiv, 1 228 Weller, S.J., DaCosta, M., Simmons R., Dittmar K. & Whiting M (2009) Evolution and taxonomic confusion in Arctiidae. In : W.E. Conner (ed.), Tiger Moths and Woolly Bears Behavior, Ecology, and Evolution of the Arctiidae. Oxford University Press, New York, New York. pp. 11 30. Weller, S.J., Jacobson, N.L. & Conner, W.E. (1999) The evolution of chemical defences and mating systems in tiger moths (Lepidoptera: Arctiidae). Biological Journal of the Linnean Society 68 557 578. Weller, S. J., Pashley, D.P., Martin, J.A. & Constable, J.L. (1994) Phylogeny of nocutoid moths and the utility of combining independent nuclear and mitochondrial genes. Systematic Biology 43 194 211. Weller, S.J., Simmons, R.B., Boada, R. & Conner, W.E. (2000) Abdominal modifications occurring in wasp mimics of the ctenuchine euchromiine clade (Lepidoptera: Arctiidae). Annals of the Entomological Society of America, 93, 920 928.

PAGE 359

359 Whiting, M.F., Carpenter, J.C., Wheeler, Q.D. & Wheeler, W.C. (1997) The Strepsiptera problem: phylogeny of the Holometa bolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Systematic Biology 46, 1 68. Wiens, J.J. & Reeder, T.W. (1995) Combining datasets with different numbers of taxa for phylogenetic analysis. Systematic Biology 44, 548 558. Wiens, J.J. (1998a) Combining data sets with different phylogenetic histories. Systematic Biology 47, 568 581. Wiens, J.J. (1998b) Does adding characters with missing data increase or decrease phylogenetic accuracy? Systematic Biology 47, 625 640 Wilkinson, M. (1995) Coping with abundant missing entries in phylogenetic inference using parsimony. Systematic Biology 44, 501 514. Willis, M.A. & Birch, M.C. (1982) Male lek formation and female calling in a population of the arctiid moth Estigmene ac rea Science, 218, 168 170. Wink, M., & von Nikisch Rosenegk, E. (1997) Sequence data of mitochondrial 16S rRNA of Arctiidae and Nymphalidae: evidence for a convergent evolution of pyrrolizidine alkaloid and cardiac glycoside sequestration. Journal of Chem ical Ecology 23, 1549 1568. Wunderer, H., Hansen, K, Bell, T.W., Schneider, D & Meinwald, J. (1986) Sex pheromones of two Asian moths ( Creatonotus transiens C. gangis ; Lepidoptera, Arctiidae): behavior, morphology, chemistry and electrophysiology. Journal of Experimental Biology 46, 11 27. Zahiri, R., Kitching I.J., Lafontaine, D., Mutanen L.K., Holloway, J.D. & Wahlberg, N. (2011) A new molecular phylogeny offers hope for a stable family level classification of the Noctuoidea (Lepidoptera). Zoologica Scripta 40, 158 173. Zahiri, R., Holloway, J.D., Kitching, I.J., Lafontaine, D., Mutanen, M. & Wahlberg, N (2012) Molecular phylogenetics of Erebidae (Lepidoptera, Noctuoidea). Systematic Entomology 37, 102 104. Zaspel, J.M. & Weller, S.J. (2006) Review of generic limits of the tiger moth genera Virbia Walker and Holomelina Herrich Schffer (Lepidoptera: Arctiidae: Arctiinae) and their biogeography. Zootaxa, 1159, 68 pp. Zerny, H. (1912) Syntomidae. Lepidopterorum Catalogus 7, 1 179.

PAGE 360

360 BIOGRAPHICAL SKETCH Clare Hilary Scott was born in Columbia, South Carolina. She graduated from D.W. Daniel High School in May 2003. Clare began her undergraduate studies in August 2003 at the University of Georgia. During her time at the university, Clare was able to complete undergraduate research in Dr. John Wares population genetics lab and Dr. Joe McHughs insect systematics lab. In May 2007, she graduated with high honors and received a Bachelor of Science degree in g enetics and a Bachelor of Scienc es in Environmental Sciences degree in e ntomology. In August 2007, Clare enrolled in a Ph.D program in the University of Floridas Department of Entomology and Nematology. Her major advisor was Dr. Marc Branham. While at the University of Florida, Clare had the opportunity to mentor to undergraduate students, Pablo Chialvo and Liset Perez. In addition, she was able to participate in the Science Partners in Inquiry based Collaborative Education (SPICE) GK 12 fellowship program, which allowed her to obtain teaching experience at a Mebane Middle School in Alachua, Florida. Upon completeing her doctoral degree, Clare will begin a postdoctoral position at Purdue.