<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.

DARK ITEM
Permanent Link: http://ufdc.ufl.edu/UFE0044879/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Xiao, Carl
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: Genetics and Genomics -- Dissertations, Academic -- UF
Genre: Genetics and Genomics thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Carl Xiao.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Brantly, Mark L.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044879:00001

Permanent Link: http://ufdc.ufl.edu/UFE0044879/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Xiao, Carl
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: Genetics and Genomics -- Dissertations, Academic -- UF
Genre: Genetics and Genomics thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Carl Xiao.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Brantly, Mark L.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044879:00001


This item has the following downloads:


Full Text

PAGE 1

1 DEVELOPMENT OF NOVEL THERAPIES FOR LIVER DISEASE ASSOCIATED WITH MISFOLDED Z ALPHA1 ANTITRYPSIN ACCUMULATION AND DISPOSAL By K AI XIAO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 K ai X iao

PAGE 3

3 To my parents, my lovely wife and all the individuals who helped me to achieve what I have today

PAGE 4

4 ACKNOWLEDGMENTS I would li ke to give my greatest appreciation to my mentor, Dr. Mark Brantly, for all his great advices on my journey of pursuing the Ph.D. degree. Although Dr. Brantly is very busy as a division chief, but he is always there and open to discuss new ideas with me. A lso I would like to thank Dr. S ihong Song. As one of my committee members he provides me with great support not only to my researches but also a lot of great advices for my career life I also want to thank Dr. William Dunn Jr. and Dr. Chen Liu for their great advices in the committee meeting s. I would also like to thank Dr. Yona Levites for her great support to the scFv project. In addition, I want to thank Dr. Regean Wang and Dr. Karina K rotova who helped me with problem solving and detailed experiment d esign ing Also, I want to thank the lab manager Farshid Rouhani, our technicians Emily McAndrew and Regina Oshins and all other fellow students and personnel in my program Without them, my experiment wont run so smoothly. I would like to give special thanks to our program assistant, Ho pe Parmeter, who did administrative work for me and make s my life easier. In addition, I want to thank my parents for their unconditional support for my career. Finally, I want to give the special thanks to my lovely wife. I t is her love and care that assist me to achieve what I am today.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 LIST OF ABBREVIATIONS ........................................................................................... 10 CHAPTER 1 LITERATURE REVIEW .......................................................................................... 13 Introduction to Alpha1 Antitrypsin and Deficiency .................................................. 13 AAT Deficiency Pathogenesis ................................................................................. 14 Cellular Mechanisms Related To AAT Deficiency ................................................... 15 Unfolded Protein Response .............................................................................. 15 Autophagy ........................................................................................................ 16 ER Overloading Response ............................................................................... 17 Current Therapy for AAT Deficiency ....................................................................... 18 AAV Based M AAT Gene Delivery ................................................................... 18 SiRNA Gene Knockout ..................................................................................... 19 Stem Cells ........................................................................................................ 20 Small Molecules ............................................................................................... 20 Gene Correction by ZFN and TALEN ............................................................... 20 Single Chain Variable Fragment (scFv) Antibody and Its Application ..................... 23 Basic Structure of Immunoglobulins ................................................................. 23 Introduction to ScFv ......................................................................................... 24 Cloning of ScFv and Its Therapeuti c Application .............................................. 24 2 ESTABLISHMENT OF ALPHA1 ANTITRYPSIN DEFICIENCY DISEASE MODEL ................................................................................................................... 27 Introduction ............................................................................................................. 27 Materials and Methods ............................................................................................ 27 Establishing of AT01 (PI ZZ) and Hu339 (PI MM) Hepatocyte Lines ................ 27 Establishment of CHO mRFP Z AAT Stable Expression Cell Line .................. 28 Primers and Antibodies .................................................................................... 28 RNA Interference .............................................................................................. 29 Western Blot Analysis ...................................................................................... 29 Quantitative RT PCR Assay ............................................................................. 30 Fluorescent Immunostaining ............................................................................ 30 Detection of Secretion of Alpha Fetal Protein (AFP) and Albumin .................... 30 Animal and Human Subjects ............................................................................ 31 Statistical Analyses .......................................................................................... 31

PAGE 6

6 Results .................................................................................................................... 32 Validation of Established Cell Lines ................................................................. 32 AT01 Hepatocytes Have Higher Levels of UPR than Hu339 Hepatocytes ....... 33 UPR And Cytokine Gene Expressions Decreased After AAT Knockdown In AT01 Hepatoc ytes But Not In Hu339 Hepatocytes. ...................................... 34 Overexpression of Z AAT Induced UPR in A CargoAmount Dependent Manner .......................................................................................................... 35 Overexpression of BiP Increased the Soluble Part of Z AAT In AT01 Cells. .... 35 UPR Related Genes Have Higher Expression Levels In a PI ZZ Mouse and Human Than Normal PI MM Tissues. ........................................................... 36 NF ............................... 36 Discussion .............................................................................................................. 37 3 SINGLE CHAIN ANTIBODY VARIABLE FRAGMENT THERAPY FOR ALPHA ONE ANTITRYPSIN DEFICIENCY ......................................................................... 50 Introduction ............................................................................................................. 50 Materials and Methods ............................................................................................ 51 Cell Lines and Transfections ............................................................................ 51 Cloning of Anti AAT ScFv ................................................................................. 51 Construction of ScFv Fusion Protein Vectors ................................................... 52 ScFv Anti AAT Binding Activity Assay .............................................................. 53 AAT Activity Assay ........................................................................................... 53 NF Assay ........................................................................................ 54 Immunoblotting for Nondenaturing Gels .......................................................... 54 Immunofluorescent Microscopy ........................................................................ 54 Immunoprecipitation ......................................................................................... 55 Cell Proliferation Estimated by MTT Assay ...................................................... 55 Statistical analyses ........................................................................................... 56 Results .................................................................................................................... 56 Cloning and Characterization of Anti AAT ScFv ............................................... 56 Purified Anti AAT Scf v Inhibits Z AAT Polymer Formation in vitro .................... 57 ScfvFKBP12 Increases Degradation of Z AAT in Cell Culture ........................ 57 ScFv FKBP12 Reduces Z AAT Polymerization through Proteasome Degradation Pathway .................................................................................... 59 ScfvFKBP12 Reduces ER Stress Caused by Z AAT Accumulation ................ 60 Sc fv FKBP12 does Not Interfere the Secretion and the Activity of M AAT ....... 61 Discussion .............................................................................................................. 61 4 AAV DELIVERED WILD TYPE ALPHA1 ANTITRYP SIN REDUCES POLYMERIZATION OF ITS MUTANT (Z AAT) BY ENHANCING Z AAT SECRETION IN HEPATOCYTES: A NEW APPROACH FOR AAT DEFICIENCY TREATMENT. .................................................................................. 79 Introduction ............................................................................................................. 79 Materials and Methods ............................................................................................ 80 Cell Lines Establishment, Culture and Genotyping .......................................... 80

PAGE 7

7 Western Blot ..................................................................................................... 80 Polymer Z AAT ELISA ...................................................................................... 80 Florescent Double Immunostaining and Polymer HRP Immunostaining .......... 81 Colocalization measured by Proximity Ligation Assay (PLA) ........................... 81 Pull down experiment ....................................................................................... 82 In vitro Polymerizatio n Inhibition Experiment .................................................... 82 Liver Function Assays ...................................................................................... 82 Mice Experiment ............................................................................................... 82 Results .................................................................................................................... 84 Intracellular Z AAT Accumulation Level Decreased after Treated with rAAV1 M AAT ............................................................................................... 84 In vivo Assessment of AAVM AAT Gene Delivery in PI*Z Mouse ................... 85 Z AAT secretion level increased after treated with rAAV1M AAT in vivo ........ 86 Improved Liver Function after rAAV8 M AAT Treatment .................................. 86 M AAT Reduces Z AAT Polymerization by ProteinProtein Interaction. ........... 87 Discussion .............................................................................................................. 87 5 FINAL DISCUSSION AND FUTURE DIRECTIONS ............................................... 98 APPENDIX PLASMID CONSTRUCTS ........................................................................ 101 LIST OF REFERENCES ............................................................................................. 102 BIOGRAPHICAL SKETCH .......................................................................................... 118

PAGE 8

8 LIST OF TABLES Table page 2 1 UPR and cytokinerelated gene expression levels after AAT are knocked down in AT01 cells.. ........................................................................................... 40 3 1 Hybridoma screening results for positive affinity antibody to AAT.. .................... 65 3 2 Primers used to clone scFv and subsequent constructs. .................................... 66

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Validation of AT01 and Hu339 cells.. .................................................................. 41 2 2 M or Z AAT fusion proteins express properly within CHO cells .......................... 42 2 3 A T01 hepatocytes have increased levels of UPR related genes compared to Hu339 hepatocytes. ............................................................................................ 43 2 4 UPR and cytokine levels decreased after AAT knock down in AT01 cells, but not in Hu339 cells. .............................................................................................. 44 2 5 UPR gene response to Z AAT transfection in AT01 cells ................................... 45 2 6 Soluble portion of AAT increased when BiP was overexpressed in A T01 cells. ................................................................................................................... 46 2 7 UPR gene expression levels in Z AAT mouse and human are higher than in normal controls .................................................................................................. 47 2 8 Volcano plot of t he NF 49 3 1 Expression and binding properties of anti AAT scFv. ......................................... 67 3 2 Anti AA T scFv inhibits the polymerization of Z AAT in vitro ................................ 70 3 3 ScFv FKBP12 increase degradation of Z AAT .. ................................... 71 3 4 ScFv FKBP12 do uble mutant does not increase the degradation efficiency.. .... 73 3 5 ScFv FKBP12 directs Z AAT into proteasome degradation. .............................. 75 3 6 Sc Fv FKBP12 reduces ER stress caused by Z AAT accumulation .................... 76 3 7 ScFv FKBP12 does not interrupt the secretion and activity of M AAT. ............... 78 4 1 Intracellular Z AAT decreased after treatment with rAAV1M AAT ..................... 91 4 2 The beneficial effects of M AAT gene therapy in Z AAT transgenic mice. .......... 93 4 3 Serum AAT concentration after treated with rAAV8M AAT.. ............................. 94 4 4 Improved liver function after rAAV8 M AAT treatment ........................................ 95 4 5 M AAT interacts with Z AAT ............................................................................... 96 4 6 A schematic model showing M AAT enhances Z AAT secretion. ....................... 97

PAGE 10

10 LIST OF ABBREVIATION S AAT Alpha1 Antitryps in AATD Alpha1 Antitrypsin Deficiency UPR Unfolded protein response ER Endoplasmic reticulum ERAD ER associated degradation ERO ER overloading NF rAAV Recombinant adenoassociated virus AAT Alpha1 Antitrypsin ScFv Single Chain Variable Fragment MetLuc Metridia luciferase CHO cells Chinese Hamster Ovary cells PI ZZ Protease Inhibitor homozygous for Z type mutation PI MM Protease Inhibitor homozygous for normal wild type mRFP monomer red fluorescent protein CMA chaperone mediated autophagy

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENT OF NOVEL THERAPIES FOR LIVER DISEASE ASSOC IATED WITH MISFOLDED Z ALPHA1 ANTITRYPSIN ACCUMULATION AND DISPOSAL By Kai Xiao December 2012 Chair: Mark L. Brantly Major: Genetics and Genomics Alpha1 antitrypsin (AAT) deficiency is caused by a single nucleotide substitution, which may cause chroni c obstructive pulmonary disease (COPD), emphysema, liver fibrosis, or cirrhosis. The central event in AAT deficiency associated liver disease is beta sheet polymerization, which disrupts the global protein synthesis dynamic within the ER. To counter the ag gregated proteins toxic effects, cells induce several responses, such as the ER overloading response (ERO), unfolded protein response (UPR), and autophagy. Several therapeutic methods have been proposed to remove the toxic aggregation, such as small molec ule polymerization inhibition, autophagy upregulation, RNA interference, and genomic correction. To validate the active cellular response to AAT deficiency in hepatocytes, we focused on mutant Z AAT expressing cell line models established from PI ZZ patie nts or Chinese hamster ovary (CHO) cells. We confirmed that UPR and ERO pathways are activated in these models. To restore the protein synthesis dynamics within the ER, we implemented two approaches to eliminate polymerized Z AAT. We first designed a novel gene therapy strategy using a single chain variable fragment (scFv) derived from a monoclonal antibody to inhibit AAT polymerization; we can further improve the scFv -

PAGE 12

12 ZAAT complex degradation by adding a FKBP12 tag recognized by proteasome machinery. We confirmed that reduction of Z AAT polymerization leads to decreased cell stress levels. Although the scFv can recognize both M and Z AAT, the expression of scFv FKBP12 does not interfere with the secretion or activity of wild type M AAT in the cells. The se cond approach is to deliver wildtype M AAT to the liver through portal vein injection. We found that this treatment can significantly reduce intracellular Z AAT accumulation. We further proved that intracellular Z AAT was interact and secreted together wi th overexpressed M AAT. These two gene therapies present novel approaches for the treatment of human conformational diseases, in this case AAT deficiency. Our future studies will focus on the detailed mechanisms of the proteinprotein interaction and how c ells respond to these two therapies.

PAGE 13

13 CHAPTER 1 LITERATURE REVIEW Introduction to Alpha 1 Antitrypsin and Deficiency Alpha1 antitrypsin (AAT) is an acute phase glycoprotein synthesized and secreted by the liver. It is the second most abundant circulating protein in the plasma and its serum half life is 4 5 days ( 1 ) Its major function is to protect the lungs against proteolytic damage from neutrophil elastase (NE) by irreversibly docking its inhibition site to NEs proteolytic active site ( 2 ) AAT is a 12.2 kb gene located on chromosome 14q32.1 and designated by protease inhibitor locus. It has four coding exons II, III, IV, and V, and three noncoding exons at the 5 region only translated in macrophages ( 3 ) The length of AAT mRNA produced depends on the synthesis locat ion. In hepatocytes, AAT is transcribed into a 1.6 kb mRNA which encodes a 394 amino acid peptide. Downstream the peptide is glycosylated and folded into a 52 kDa glycoprotein with three asparaginelinked carbohydrate side chains ( 4 5 ) More than 100 variants have been described in various populations. Some variants are named for their migration speed under isoelectri c focusing conditions as fast (F), medium (M), slow (S), and very slow (Z). Clinically, variants are divided into three major groups. Protease inhibitor (PI)*M represents the most common allele in all populations described; individuals who are homozygous c arriers have a mean value of 1.3 g/L circulating AAT. The second group are patients with PI*S or PI*Z alleles who have below normal AAT serum concentration levels that are associated with lung or liver disease. The last group, null alleles produce no serum AAT and these patients have shown increased risk of lung disease ( 6 7 ) and HIV infection ( 8 )

PAGE 14

14 AAT D eficiency Pathogenesis AAT deficiency (AATD) was first discovered by Laurell and Eriksson in 1963. In reviewing 1500 serum protein electrophoreses (SPEP) over six months, Laurell found three of five individuals missing the AAT protein band had emphysema at young ages and one had a family history of emphysema. After that, the cardinal clinical features of 1 region of the SPEP, early onset emphysem a, and a genetic predisposition ( 9 10 ) The most common variant that causes deficiency is the Z mutation. This co dominant mutation is a G to A substitution in E xon V, which causes a single amino acid substitution of a positively charged lysine for negatively charged glutamic acid at position 342 ( 11) This mutation causes abnormal folding of AAT, which leads to polymerization and accumulation within the ER. Although polymerization was observed is still under debate ( 12) likely mechanism in vivo ( 13, 14) AAT deficiency is more prevalent in Caucasians, but it has been detected in virtually every population, culture, and ethnic g roup. The direct approach which is based on screening studies showed that the frequency of PI ZZ in United States is 1/4455, which is approximately 70,000 individuals ( 15 17) sheet of the Z mutation leads to two major clinical manifestations, including loss of function lung disease and gainof toxic function liver disease ( 18, 19) Due to lack of AAT, an important protease inhibitor, the lungs are exposed to proteolytic attack by neutrophil elastase (NE), creating a consequent risk of early onset of emphysema. Also, AATD as a very important genetic factor was found in

PAGE 15

15 1 2% of individuals affected with chronic obstructive pulmonary disease (COPD) ( 20) Cigarette smoking will significantly increase the risk of AATD associated lung disease. Median life expectancy for smokers with AATD is between 40 49 y ears, 1015 years shorter than nonsmokers ( 21) The mechanisms of AATD associated liver disease are not as well understood as those of lung disease. Clinical studies show only 1015% of PI ZZ individuals will develop liver disease ( 22) Indications are that there must be a second hit, such as environmental or genetic f actors that lead to liver disease ( 23, 24) It has been shown sheet insertion based polymerization caus es Z AAT to accumulate within the endoplasmic reticulum (ER), inducing ER stress, but the exact mechanism(s) by which the accumulated protein leads to cellular injury is unknown ( 25) ER associated degradation (ERAD) is a very efficient sys tem for disposal of misfolded AAT and 90% of newly synthesized Z AAT is degraded by this pathway ( 26) Cellular Mechanisms Related To AAT Deficiency Unfolded Protei n Response Proteins depend on chaperonemediated assistance to fold into their correct native conformation. Misfolded proteins are retained in the ER either to be refolded or degraded. Normally homeostasis can be maintained and the ER has an elaborate feed back and regulation system to prevent retained proteins from exceeding its folding capacity. If accumulation of unfolded proteins in the ER exerts stress on the organelle, a signal cascade, referred to as the unfolded protein response (UPR), will be activated to maintain the ERs folding capacity. UPR is composed of three major pathways. The first is the protein kinase RNA like endoplasmic reticulum kinase (PERK) pathway. When this pathway is activated, PERK will phosphorylate the eukaryotic translation ini tiation

PAGE 16

16 factor 2 second is the activating transcription factor 6 (ATF6) pathway. Here, the signal will primarily activate a series of chaperones to help protein folding. The t hird is the inositol requiring protein1 (IRE1) pathway, wherein the activated IRE1 will splice a target mRNA called X box binding protein 1 (XBP1). Only the spliced form of XBP1 will induce the expression of protein degradation genes and some heat shock proteins ( 27 28) Studies show that under the ERs sophisticated proteinfolding environment, newly synthesized Z AAT undergoes one of two checkpoint branches. One is the initiation of protein chaperone facilitated AAT conformation maturation and the other processes through selective ER associated degradation (ERA D) in 26S cytosolic proteasomes ( 29 ) However, ERAD is easily saturated and it will lead to accumulation of unfolded proteins within the ER, activating UPR ( 27) As a branch of UPR, ERAD is boosted and the degradation rate is coordinated by the IRE1XBP 1 pathway ( 30) Autophagy Other than ERAD, cells have another bulk degradation mechanism called macro autophagy or autophagy to degrade unfolded proteins such as Z AAT. Autophagy is a highly conserved cellular pr ocess by which cells recycle cytoplasm and dispose of excess or defective organelles. Cytosolic double membrane vesicles, also called autophagosomes, are formed to surround those materials for lysosomal or vacuolar disposal ( 31 ) A series of autophagy related genes (Atg) are responsible for several continuous steps, like induction, cargo recognition and packaging, vesi cle formation, and break down. Atg 8 also called microtubuleassociated protein 1 light chain 3 (LC3) is the most commonly used marker to monitor the autophagy process in mammalian cells ( 32) In contrast to macroautophagy, another degradation pathway is named

PAGE 17

17 chaperon mediated autophagy (CMA). In CMA, a highly specific subset of cytosolic proteins with the motif (VKKDQ) are recognized by the heat shock cognitive protein 70 (Hsc 70) chaperone and degraded in lysosome. Studies sugges t accumulation of Z AAT polymers will stimulate autophagy turnover ( 33) and the defect in the autophagy pathway could be the reason of the cells vulnerable to toxic Z AAT aggregation within the ER ( 34) Further studies have shown that autophagy appears to be a nonselective degradation mechanism for accumulated Z AAT as opposed to selectiveERAD ( 35) However, this evidence shows good support for the functionality that autophagy plays in the toxic gainof function conditio n and it also sheds light on the secondhit theory, wherein another malfunction is needed to cause liver disease in the AAT deficient individual. ER Overloading Response Another major ER stress pathway activated by misfolded proteins is the ER overloading response (EOR). It was first described as a cellular response to viral protein accumulation in the ER ( 36) Its central signaling molecule, transcriptional factor nuclear ER stress ( 36) However, the question of whether NF s a cancer prone or apoptotic prone signal has been debated for a decade. Supporters of the cancer prone theory have shown that after overexpression of Z AAT, elevation of IL6 and IL8 is correlated with increased NF ( 37) Also in a clinical study, IL8 was shown to promote angiogenesis in tumors ( 38) However, apoptotic prone theorists have more convincing evidence showing that Z AAT accumulation is associated with an intense apoptotic response ( 39, 40) Studies show that upregulation of caspase4 is specifically induced by ER stress ( 41) Also there is

PAGE 18

18 evidence that the mitochondria apoptosis pathway is involved in Z AAT induced ER stress by up regulation of proapoptotic Bcl 2 family members Bax and Bak ( 39) Current Therapy for AAT Deficiency Current therapy for lung disease in AATD is the well established augmentation therapy, which is weekly or bimonthly administered normal AAT purified from pooled human plasma. This treatment can achieve a total protein level above the protective threshold of 0.5g/L ( 42 ) but there are several limitations for augmentation therapy. First, it is associated with several side effects, such as headaches, fever, urticaria, and fatigue, but serious side effects like anaphylaxis and precipitation of heart failure are uncommon ( 43, 44) Second, production of AAT is very limited because of its source. Alternative production has been studied using bacteria ( 45) yeast ( 46) or milk from sheep ( 47) as a factory, but results are disappointing because glycosylation of synthesized AAT is different from the purified human form, which may cause safety issues, such as immune response or severe allergy. The last and most important limitation of augmentation therapy is that it cant prevent AATD related liver disease. Currently, the only treatment for AATD liver disease is liver transplantation. However, the major drawbacks of transplantation are obvious, including lack of donors, immunosuppression issues, and a significantly higher mortality rate. Therefore, alternative therapies have been under research in the past two decades. All novel treatments can be filed into the following four categories. AAV Based M AAT Gene Delivery As an extension of augmentation therapy, this strategy is based on the idea of replacing the defective Z AAT gene and producing normal protein that can be functional in circulation. Gene therapy in animal models has used several different methods,

PAGE 19

19 including retroviral, adenoviral, adenoassociated viral, and liposomal vectors ( 48) Recombinant adenoassociated viral (rAAV) vectors have proven to be the most effective delivery system, capable of achieving therapeutic levels of AAT ( 49) and less likely to induce an inflammatory response than adenoviral vectors. Site specific integration on chromosome 19q13.3 has proven safe in tissue culture experiments ( 48 ) which prov ides a great advantage over the interruption of genes caused by other vectors. Various ectopic sites of AAV infection are able to secrete biologically active AAT into serum ( 50 ) A recent phase II clinical trial using intramuscular injection of rAAV serotype 1 AAT vector in nine AATD individuals at doses of 6.01011, 1.91012, and 6.01012 vector genomes/kg (n=3 subjects/dose) showed that resulting M AAT serum lev els were dose dependent, peaked at 30 days, and persisted for at least 90 days. No vector related side effects were observed and none of the subjects developed antibodies to AAT ( 51) Although safet y and feasibly were not an issue, the peak level of transgene product was around 40 to 100 fold less than the therapeutic level ( 51) SiRNA Gene Knockout Since mutated Z AAT is translated from the mRNA of the gene, interruption of Z AAT mRNA is another strategy to ameliorate hepatocellular damage. Currently there are two approaches to interrupt the transcription of mutant Z AAT mRNA. The first was developed by the Strayer group. They designed hammerhead ribozymes to cleave AAT mRNA at a specific site ( 52) The other approach is to use RN A interference (RNAi) to reduce the level of Z AAT mRNA transcription ( 53) The earlier study showed that short hairpin RNA (shRNA) longer than 19 base pairs had l iver associated toxicity ( 54) The most recent study from the Flotte group has demonstrated a safer and more effective RNAi approach by utilizing micro RNA (miRNA ) ( 55)

PAGE 20

20 Stem Cells The development of stem cells has also shown some potential for treatment of AATD. Studies from the Song group have demonstrated that rAAV vector mediated BM cellbased liver gene therapy is feasible for the treatment of AAT deficiency ( 56) Hepatocyte transplantation studies have shown that 20% 98% of mutant hepatocytes could be replaced by wildtype donor cells ( 57 ) Human induced pluripotent stem cells (hIPSCs) present a great opportunity in cell based therapy for human disease. Dermal fibroblasts have been isolated from patients with AATD and used to generate patient specific hIPSC lines. Hepatocytes derived from these hIPSCs showed the key pathological features of AATD ( 58) Based on these studies, the next step would be to collect hIPSCs from the patient and replace the mutant cells to cure the disease. Small Molecules This strategy is based on the mechanisms of Z A AT polymerization and accumulation. One treatment approach is to stimulate autophagy, which is shown to be associated with Z AAT clearance. Such treatments include rapamycin ( 59) and carbamazepine ( 60 ) Another approach is attenuating or blocking Z AAT polymer formation. Molecules from previous generations, such as 4p henylbutyrate and glycerol, have shown to be effective in vitro but not in animal models ( 12, 61) The new version of such molecules were designed in silico and can target the cavity of the Z AAT protein mutation site ( 62 ) ; it has been shown to be effective in term inating polymerization in vitro and in ex vivo ( 62 ) Gene Correction by ZFN and TALEN The ability to manipulate genotype has been pursued by geneticists even be fore the discovery of DNA structure. The traditional way of making genespecific

PAGE 21

21 manipulations are targeted gene knock outs or knock ins. Theoretically, it is simple enough, but the actual practice is very challenging. The native homologous recombination f requency in the targeting organism can be as low as 1 X 107; such a rare event needs large amount of selection help even with the assistance of an antibiotic marker. Although the availability of using embryonic stem (ES) cells to produce transgenic mice has accelerated the process of genome mutation in animal models, the process itself still carries very high uncert ainty and long development time ( 63, 64 ) With developments in nucleus biology, studies show that double strand break (DSB) will dramatically increase the recombination frequency ( 65) Further studies show that D SB is lethal to the cells ( 66) Two natural DSB repair mechanisms have been discovered: homologous repair (HR) and nonhomologous end joining (NHEJ) ( 67) The first attempt to use DSB repair as a tool to modify a genomic target used a homing endonuclease, I Sce I, which recognizes and cuts 18 bp ( 68) However, its applications were limited because the reorganization sequence needs to be inserted before it can conduct highefficiency recombination ( 64 ) In recent years, development of zinc finger nuclease (ZFN) has allowed us to effectively modify a target sequence within the genome. The development of ZFN was inspired by the natural type II endonucleases, which have separate binding and cleavage domains ( 69 ) ZFN was engineered to mimic this characteristic by adopting zinc finger as the DNA binding domain and truncated Fok I endonuclease as the cleavage domain. Each zinc finger can bind approximately 3 bp of DNA ( 70) and the Fok I cleavage domain needs dimerization to be functional ( 71 ) These two properties

PAGE 22

22 ensure the wide application of ZFN because with the zinc finger library, recognition sites wont be limite d and the dimerization of Fok I needs two different ZFNs to be functional, thus extending the specificity of the target site ( 64) Successful ZFN induced gene t argeting has been reported in the fruit fly ( 72) zebra fish ( 73) rat ( 74) mouse ( 7577) A. thaliana ( 78) and various different human cell lines ( 7982 ) The frequency varies among different target organisms, but an average of 10% yield without antibiotic selection is very common ( 64 ) Due to the rapid development of ZFN, two clinical trials have been conducted, including treatment for glioblastoma ( 83) and HIV ( 82, 84) In the first case, ZFN was used to knock out the glucocorticoid receptor gene as part of the T cell based immunotherapy. In the HI V study, ZFN was used to interrupt the CCR5 gene, which is an important receptor for HIV infection. In the mouse model, when T cells have a knock out of this receptor, there is more than a sevenfold reduction in viral load and fivefold increase in CD4 co unts ( 84 85) Although the ZFN has a great impact in the field of genome modification, safety concerns have been raised regarding clinical studies, especially the risks of off target effects. Basic studies found that ZFN binding to triplets are not specific and the combination of different modules may induce preference of each ZFN ( 64) To ameliorate this situation, several methods have been tested: a separate twofinger module with a short linker which increased specificity ( 86) ; and a bioinformatics approach using ultradeep next generation sequencing to identify off target sites ( 82) Another DNA binding module, transcription activationlike (TAL) domain, was recently identified in Xanthomonas plant pathogens ( 87) The TAL effector is composed

PAGE 23

23 of repeated modules for DNA recognition. Each repeated module consists of 3335 amino acids, which can specifically recognize one nucleotide base. Similar to ZFNs, TAL endonuclease (TALEN) is composed of a TAL recognition site and a Fok I cleavage site. The advantage of TALEN over ZFN is the DNA binding mechanisms are more straightforward and it can bind to a larger sequence (18bp instead of 9bp) on each site. These characteristics give TALEN a higher specificity to the target sequence and make design much simpler. ( 88, 89) However, TALEN has its own limitations. First, due to its unique 34 amino acid repeat domain, TALENs are 3 to 4 times larger than ZFNs, which may cause problems for some deliv ery methods, such as AAV ( 88) Second, TALEN has only come emerged recently and there are still a lot unknown facts about this technology ( 89) Single Chain Variable Fragment (scFv) Antibody and Its Applica tion Basic Structure of Immunoglobulins There are five isotypes of antibody produced in vertebrates: IgA, IgD, IgE, IgG, and IgM. IgGs are the most abundant immunoglobulins in human blood and the most widely used in therapeutic and diagnostic applications ( 90) Any single IgG consists of 2 identical heavy chains and 2 identical light chains, which are joined by a series of disulfide bonds. A light chain has a variable domain (VL) and a constant domain (CL), while a heavy chain has a variable domain (VH) and three constant domains (CH1, CH2 and CH3). The variable region of the antibody determines the specificity, diversity, and affinity for binding to the epitope and the constant region determines the biological activity of the antibody, such as recognition and binding to T cells or B cells. The high diversity of the antibodies results from the recombination of variable (V), diversity (D), and junctional (J) gene segments in the variable region during the B cell maturation.

PAGE 24

24 Introduction to S cFv Although production of antibodies using hybridoma technology is a critical breakthrough in life science, it requires considerable time, expense, and animals which limits its future usage ( 91) Also, the rodent originated ful l length monoclonal antibody (mAb) has induced unwanted rejection in the human immune system ( 92) Although early attempts of producing antibodies without an Fc region by proteolysis were successful ( 93 ) it still did not yie ld small enough antibody fragments for therapeutic use. From 1985 to 1988, the development of bacteria expression and gene library selection has given antibody development a great assist ( 91) To address the limitations of the mAb, recombinant single chain variable fragment (scFv) has been developed. ScFv antibodies are only 2628 kDa. They consist of one copy each of VH and VL fragments, which are joined by a flexible peptide linker (Gly4Ser3) ( 90) Because s cFv lacks an Fc fragment, scFv has low functional affinity and a short in vivo half life. Such qualities as small size, low cost, and easy engineering make scFv a more attractive therapeutic candidate to a full length mAb ( 94) Cloning of ScFv and Its Therapeutic Applic ation Normally, scFv can be produced from two sources: hybridoma or a pooled gene library. Cloning from an existing hybridoma is a rapid and reliable method of transforming mAb into scFv. Generally, this method uses oligonucleotides that anneal to the cons tant regions of the hybridomas cDNA to amplify the VL and VH fragments and it is then inserted into an expression vector ( 95) The other method, producing sc Fv from a pooled gene library, is currently the most widely used technique. The screening processes are based on molecular display technologies, including phagedisplay ( 96) ribosome display ( 97, 98) and cell surface display ( 99) The basic idea is to express the

PAGE 25

25 matured affinity portion of the scFv on these hosts and keep the genetic information within the host. Then the display library will go through several rounds of high throughput screening against the target antigen and select for the highest affinity scFv ( 100) Extensive review of the three screening methodol ogies shows that the in vitro ribosome display is the most powerful because it overcomes the cell based limitations of library size and negative selection pressure ( 94) During the three decades of development, scFv has been used in various therapeutic and diagnostic applications. In cancer research, radiolabeled scFv has been largely used in tumor imaging and therapy. The advantages of scFv over traditional IgG antibodies are higher tumor penetration and rapid blood clearance properties, which result in faster tumor upt ake and elimination ( 101, 102 ) and a better signal to noise ratio in tumor imaging ( 92) Another application is to use scFv as an immunotoxin. ScFv hybridized to the translocation domai n and a tumor killing toxin bind to the specific tumor cell surface receptor, and then the translocation domain facilitates the delivery of the toxin into the tumor and inactivates the vital cellular processes ( 103 ) Several preclinical studies and clinical trials of immunotoxin are underway for evaluation for cancer therapies ( 104 ) Another application of scFv is intracellular expression of antibodies (intrabody), which can neutralize the target protein in different compartments, such as cytosol, nucleus, or ER ( 94 ) The potential to alter or inhibit the proteinprotein interaction ensures scFvs wide application in the area of neurodegenerative disorders caused by intracellular accumulation of misfolded proteins. These diseases include Huntingtons ( 105) Parkinsons ( 106 ) and Alzheimers ( 107) Although these studies showed

PAGE 26

26 promising results for reducing accumulation, methods of scFv delivery are still not very efficient ( 92)

PAGE 27

27 CHAPTER 2 ESTABLISHMENT OF ALPHA 1 ANTITRYPSIN DEFICI ENCY DISEASE MODEL Introduction In the recent decade, studies have focused on the gainof toxic disease mechanism of AATD within hepatocytes. Understanding the pathology of liver disease in AATD patients has led us to organize a model of how cells respond to misfolded and aggregated proteins. These include the degradation pathway and signaling pathways. Especially, unfolded protein response (UPR), autophagy, and ER overloading response play important roles in maintaining homeostasis within AATD hepatocytes ( 108) In this chapter we will examine the cellular response mechanisms to alpha1 antitrypsin deficiency. To do so, we start by establishing a cell line from a patient with the PI ZZ genotype. Although many established transgenic Z AAT producing nonh epatocyte lines have been established ( 35 39) we believe only hepatocytes with native Z AAT expression c an best reflect the actual situation in AATD patients. We also generated a second cell line from Chinese hamster ovary (CHO) cells, which stable expresses Z AAT and tagged fusion proteins. With these tools, we were able to answer how UPR, autophagy, and ER O response behave in response to accumulation of Z AAT. Materials and Methods Establishing of AT01 (PI ZZ) and Hu339 (PI MM) Hepatocyte Lines Liver tissue was taken from a biopsy of a four month old PI ZZ infant. Standard cell isolation and culture was per formed according to established protocol ( 109 ) In short, the tissue was immediately placed in icecold Hams F 12 medium; then hepatocytes were isolated in a two step perfusion technique ( 110 ) After that, the cells

PAGE 28

28 were dispersed with a blunt tool in icecold buffer to wash them. The cells were transferred to Hams F12 medium with 2% fetal bovine serum (FBS). Forty eight hours after the cells attached to the plate, lentivirus containing human telomerase catalytic domain TERT was added to the cells for 12 hours in the presence of polybrene. The cells were continuo usly cultured in optimized culture medium. After two months, a cell line was established and referred to as AT01 or PI ZZ cells. The same procedure was taken to establish a PI MM cell line, referred to as Hu339. Both cell lines were cultured in DMEM with 1 0% fetal bovine serum (FBS) (Invitrogen), 50 g/mL EGF, HGF, 0.02ng/mL dexamethasone, and 1X insulin transferring selenium (GiBCO). Establishment of CHO mRFP Z AAT Stable Expression Cell Line The RFP gene was cloned into the BamH1 site of human Z AAT cDNA with the same orientation and correct reading frame. The fusion protein was then subcloned into the Hind III and Not I sites of a PCR3.1 eukaryote expression plasmid (Invitrogen) to generate a pCR3.1RFP Z AAT plasmid. The CHO cells (ATCC) were transfecte d with the pCR3.1RFP Z AAT plasmid using a calcium phosphate kit (Stretagene) according to instructions. Two days post transfection, the G418 was added to a final concentration of 500 g/mL. After culturing for 14 days, the RFP positive colony was transferred into individual wells of a 6well plate (Nalgene) for future culturing. Primers and Antibodies Rabbit polyclonal antibodies against alpha1 antitrypsin (AAT) were purchased were purchased from Abcam. Horseradish peroxidase ( HRP ) conjugated anti rabbit IgG (Thermo Scient ific) was used as a secondary antibody. Primers and probes for ATF4 (Hs00909569), AAT (Hs00165475), BiP (Hs99999174), XBP1 unspliced

PAGE 29

29 (Hs00765730), HSPA1A (Hs00359163), IRAK1 (Hs01018347), TGF b1 (Hs00998133), and VEGF (Hs00900055) expression assays were purchased from ABI. BiP expression plasmid was purchased from Origene, Rockville, MD. RNA Interference Specific interference of the human alpha1 antitrypsin gene expression was conducted with 2 AAAGGCAGAGCCACACUUCCUnegative control siRNA (Ambion) using lipofectamin RNAi MAX transfection reagent (Invitrogen) for 48 hours. Cells were washed with DPBS (Invitrogen), and then lysed with RTL buffer (Qiagen) or cel l lysate buffer (reagent listed in the w estern blot procedure) for RNA extraction or w estern blot analysis. Western Blot Analysis Total protein was extracted from hepatocytes using cell lysis buffer containing 5% SDS, 0.05M Tris HCl (PH=6.8), 10% Glycerol, and protease inhibitor cocktail tablets (Roche). After centrifugation (14,000 rpm for 10 minutes), the supernatant was recovered for immunoblotting and stored at 80 until required. The soluble part of AAT was extracted by previously established protocol ( 111) Whole cell lysate was separated by precast 4% 12% NuPAGE Bis Tris gels and transferred to a PVDF membrane (Invitrogen). The membrane was blocked in 5% nonfat milk in DPBS overnight. Immunoreactive proteins were detected by incubating the membrane with the specific antibodies mentioned above. Membranes were exposed using the FluorChem E Western Blot Detection System and images were processed using the Alphaview software package. (Cell Bioscience)

PAGE 30

30 Quantitative RT PCR Assay RNA was isolated using the QIAGEN RNeasy mini Kit (Qiagen, Valencia, CA) by kit instructions. T otal RNA was normalized and reverse transcribed into cDNA using a Universal Reverse Transcription Kit (ABI, Carlsbad, CA). Resulting cDNA was the template for quantitative real time PCR. Specific primers and probes were premade and validated by ABI. Quanti probe mix. Amplification was performed using the 7500 Fast Real Time PCR System (ABI) with the expression of target genes relative to 18s rRNA. The results were processed using the 2 ( 112 ) Fluorescent Immunostaining Samples were held at 20 C for 2 minutes, permeabil ized for 10 minutes with 0.25% Triton X 100, washed with 1% PBS for 5 minutes, blocked with 1% BSA for 30 minutes, and then incubated with rabbit anti human AAT or goat anti human ER antibodies (1:100) (Dako) for 1 hour at 37 C. The solution was decanted and the cells washed with PBS 3 times for 5 minutes each, and then rehybridized with FITC conjugated donkey anti rabbit antibody or Dylight 594 donkey anti goat (Jackson Immunoresearch), respectively, at a 1:200 dilution for 1 hour. Finally the cells were washed with PBS 3 times for 5 minutes each. Detection of Secretion of Alpha Fetal Protein (AFP) and Albumin Ten thousand cells were seeded into one well of 6well plate. Each cell line is triplicated. The cells were cultured in serum reduced medium (Invit rogen) for 24 hours, and then 20 L of culture medium was collected and loaded on to a PAGE gel. After electrophoresis, the protein in the gel was transferred onto a PVDF membrane

PAGE 31

31 (Invitrogen) and hybridized with mouse anti human AFP antibody (Abgene) and rabbit anti human albumin antibody (Sigma). The membranes were subsequently hybridized with HRP conjugated secondary antibodies against rabbit (Chemicon International) or goat (Millipore), respectively. The w estern blot film was scanned the AFP and albumin bands were quantified using Quantity One software (BioRad). Animal and Human Subjects PI*Z mice were maintained on a C57Bl/6J background and C57Bl/6J mice were used as controls as described previously ( 113115) All experiments were approved by the Institutional Animal Care and Use Committee of University of Florida, and were conducted in accordance with the criteria outlined in the Guide for Care and Use of Laboratory Animals. A total of ten mice at the age of 3 months were chosen to sacrifice and their liver tissues were collected. For human studies, ten individuals gave written informed consent to take part in this study, approved by the Liver Tissue Procurement and Distribution System (LTPADS) of University of Minnesota. Statistical Analyses Quantitative PCR and w estern blot data were analyzed with the GraphPad Prism 5.03 software package (GraphPad Software, San Diego, CA). Results were reported as mean SEM and compared by the Students t test. Significant difference was considered as p value < 0.05.

PAGE 32

32 Results Validation of Established Cell Lines After establishment of the stable cell lines, we wanted to validate how well these cells represent clinical charac teristics of AATD cells. Fresh thawed AT01 and Hu339 cells were cultured into T 75 flasks, which were precoated with 0.4mg/mL collagen I. After 24 hours, the morphologies of both cell lines were viewed with a phase contrast microscope (Figure 21A). To validate that both cell lines are hepatocytes, cells were lysed in 40% NP40 buffer with protease inhibitor and subjected to w estern blot. Albumin, alpha fetal protein (AFP), and alpha 1 antitrypsin (AAT) expression were detected in both cell lines, which are key identifiers of hepatocytes (Figure 21B). Immunostaining of AAT and ER marker PDI on AT01 cells shows very strong colocalization (Figure 21C, arrow); however, there is minimum colocalization of AAT and ER resident proteins in Hu339 cells. To furthe r confirm that the Z AAT within the AT01 cells forms characteristic polymers, cells were immunostained with ATZ11 monoclonal antibody from Dr. Janciauskienes lab, which only recognizes polymerized AAT ( 116) (Figure 2 1D). In order to show the location of M AAT and Z AAT within the cell and further demonstrate the mechanism of M AAT gene therapy, we constructed plasmids that express Z AAT fusion with luci ferase, monomer red fluorescent protein (RFP) or Citron (a GFP derived monomer green fluorescent protein). Our previous study found that GFP fusion at the C terminus of M AAT will interfere with protein folding (unpublished data). We chose to insert tags between the signal peptide and functional coding sequence at the N terminus (Figure 22A). By transfecting the plasmid constructs to CHO cells, we found that the secreted Metridia luciferasetagged M AAT levels are approximately 5

PAGE 33

33 times higher than luciferase tagged Z AAT levels, which fits clinical data pattern ( 117) (Figure 2 2B). Also, Z AAT fusion with mRFP or m Citron accumulates more than the M AAT fusion proteins within the cel l (Figure 2 2C). The CHO mRFP Z AAT cell line was validated the same way as AT01 and Hu339. Accumulation of mRFP Z AAT polymer was observed (Figure 22D). Cell lysate from CHO mRFP Z AAT cells was subjected to nondenaturing gel electrophoresis and immunoblotting with a polyclonal anti AAT antibody. Polymer formation was only observed in CHO mRFP Z AAT cells. (Figure 2 2E) AT01 Hepatocytes Have Higher Levels of UPR than Hu339 Hepatocytes Gene expression levels of unfolded protein response (UPR) genes are c ritical to reveal activation of this cellular response. Monocyte studies have shown evidence that individuals with the PI ZZ genotype have higher levels of UPR related gene expression than those with the normal PI MM genotype ( 118) Here, we try to identify the parallel situation in hepatocytes. We explored UPR gene family regulation by looking at expression of activating transcription factor 4 ( ATF4), binding imm unoglobulin protein (BiP), CCAAT/ enhancer binding protein homologous protein (CHOP), transcriptional (NF box binding protein 1 (XBP1) (Figure 2 3A). ATF4, BiP, and NF er in AT01 cells (n=3) than Hu339 cells (n=3) as measured by the quantitative PCR with p values of 0.032, 0.018, and 0.002, respectively. The splicing of XBP1 was identified by the ratio of spliced XBP1 to unspliced XBP1 gene expression levels. The ratio w as also increased in AT01 hepatocytes compared with Hu339 hepatocytes (n=3, p<0.0001). AAT gene expression levels had no significant difference between AT01 and Hu339 hepatocytes.

PAGE 34

34 To validate the gene expression data, we used immunoblotting to identify the differences of the UPR protein synthesis levels between the two cell lines. BiP, CHOP, NF 3B & C). Although the mRNA results showed that NF differences between the two cell lines, the quantitative protein level of NF showed 2.9and 3.9fold increases in the AT01 hepatocytes compared with Hu339 AT01 cells incr eased by 2.8fold compared to Hu339 cells (n=3, p=0.0016). BiP was also significantly increased, 4.2fold, in AT01 cells compared to Hu339 cells. (n=3, p=0.0002). UPR And Cytokine Gene Expressions Decreased After AAT Knockdown In AT01 Hepatocytes But Not I n Hu339 Hepatocytes. To determine whether production of mutant Z AAT will have an effect on the UPR pathway and cell growth factors, we knocked down expression of AAT in AT01 and Hu339 cell lines for 48 hours. While AAT expression from both AT01 and Hu339 cells was decreased to 30% and 49% after siRNA treatment compared to the scrambled siRNA control group (n=3, p=0.00001, 0.000001, respectively), only AT01 cells had a significant response to the knockdown treatment (Figure 24A) compared to the scramble co ntrol. The decreasing levels of gene expression in AT01 hepatocytes are demonstrated in Table 21. Interestingly, the knockdown of AAT in Hu339 cells (n=3) induced the expression of BiP by 74% (p=0.007), heat shock 70 kDa protein 1A (HSPA1A) by 39% (p=0.04 (Figure 2 4B). Immunoblotting of anti p CHOP decreased after AAT knockdown in PI ZZ cells (Figure 2 4C).

PAGE 35

35 Overexpression of Z AAT Induced UPR in A CargoAmount D ependent Manner We next wanted to examine whether UPR will respond to Z AAT induced ER stress by overexpressing Z AAT in AT01 cells. To do this, we constructed three plasmids in which Z AAT was under different promoter control. Forty eight hours after tran sfection, intracellular AAT levels were measured by w estern blot. As Figure 25A shows, expression of AAT produced by the plasmids was highest in the chickenbeta actin promoter, followed by the thymidine kinase promoter, and cytomegalovirus (CMV) TK promo ter. The plasmid with the CMV TK promoter was used to overexpress Z AAT in AT01 cells. The intracellular level of Z AAT increased approximately 2fold after 6 hours, but decreased to baseline level at 24 hours. However, after 48 hours, the AAT level returned to a 2fold increase over baseline (Figure 25B). At each time point, the UPR gene expression levels were determined (Figure 25C). CHOP was activated from 12 to 24 hours post transcription; Spliced XBP1 was activated at 6 hours and increased 3 fold. PE 48 hours post transcription. ATF4 only activate at the 24hour time point. The BiP expression had no significant change. The data suggests that the induction of UPR depends on the am ount of Z AAT cargo retained in the ER. Overexpression of BiP Increased the Soluble Part of Z AAT In AT01 Cells. Endoplasmic reticulum (ER) chaperone protein glucoseregulated protein 78 (GRP78/BiP) is a master regulator of ER homeostasis and stress response ( 119 120 ) It is shown that over expression of BiP in the liver protected against ER stress induced SREBP1c activation and hepatic steatosis in mice ( 121 ) We are curious to know whether BiP will be involved in the processing of Z AAT in the cytoplasm of the cells. To answer this question, we examined the effect of overexpression of BiP in AT01 cells.

PAGE 36

36 We found when BiP is overexpressed, the soluble part of Z AAT increased 1.9fold compared to the GFP expressing control group (Figure 26). This data indicates that Bi P facilitated the folding of Z AAT within the PI ZZ hepatocytes. UPR Related Genes Have Higher Expression Levels In a PI ZZ Mouse and Human Than Normal PI MM Tissues. To further validate whether UPR is activated in PI*Z alpha1 antitrypsin deficiency in vivo we compared the levels of UPR related genes between M and Z mice and human liver tissues. In the mouse experiment, we found that in the PI*Z mouse (n=5 mice) ATF4 increased by 84.8% (p=0.0155), BiP increased by 126.4% (p=0.0286), CHOP increased by 130. 1% (p=0.0286), and NF increased by 83% (p=0.0243) (Figure 27A). To verify this data, we subjected the mouse liver samples to immunoblotting with anti BiP, CHOP, p 7B). The results showed that the BiP protein levels in the PI*Z mouse were 2fold higher than in a normal mouse. In the PI*Z mouse, CHOP increased by 4fold compare to normal mice. Phosphorylation of The same comparisons were done with liver tissue from PI ZZ or PI MM individuals. The results showed only CHOP and pgroups (both with p<0.00001, n=5) (figure 27C). NF To under stand the how NF AAT accumulation, expression levels of 93 NF related genes were compared between AT01 and Hu339 cells. The result of the analysis shows that among 93 genes, 21 were significantly downregulated (p<0.05) and 10 g enes were significantly upregulated .The distribution

PAGE 37

37 of genes is shown in Figure 28. Some of the NF genes are down regulated such as NFKB inhibitor interacting Ras like 1 (NKIRAS1), TANK binding kinase 1 (TBK1), NF IA), as well as some anti inflammation cytokines, like chemokine C C motif ligand 2 (CCL2) and interleukin 10 (IL10). Some upregulated genes are apoptosis inducers or inflammation inducers, such as interleukin 12A (IL12A), Caspase recruitment domain family member 10 (CARD10), tumor necrosis factor 11 (TNFSF11), and tumor necrosis factor receptor 10a (TNFRSF10A). These results support the hypothesis that the proapoptotic direction of the NF in duced during Z AAT accumulation ( 40) Discussion In this study, we compared the UPR related gene expression and protein synthesis levels between Z and M samples in cell lines and in mouse and human liver tissue. We observed that the majority of UPR genes were significantly upregulated in Z samples compared to M controls. By knocking down Z AAT, the UPR activity was downregulated and overexpression of BiP increased the solubility of Z AAT. Overexpression of Z AAT induced UPR in a cargoamount dependent manner. Data from the PI*Z mouse and human liver tissue is consistent with the hepatocyte experiment. This study demonstrated that UPR is activated in the liver cell line and in mouse and human liver tissue in AAT d eficiency. Finally, we provided evidence to support that the NF pathway plays a proapoptotic role during accumulation. Clinical data from PI ZZ individuals with alpha1 antitrypsin deficiency shows that only 1215% developed clinically significant liver disease during childhood ( 122 ) This indicates another hit maybe needed to cause the disease ( 123 124 ) UPR has been shown to be critical for cell survival under protein misfolding and other conformational

PAGE 38

38 diseases ( 125) Therefore, UPR could be part of the mechanism that maintains homeostasis until the second hit comes. A similar study was done on this in 2005, but their results were different, showing UPR is not activa ted ( 126 ) The major difference between the two studies is the cell system. Hidvegi et.al used Z AAT over expressed Tet off HeLa cells instead of hepatocytes wit h native expression of both M and Z AAT. We thought this may explain the difference in findings on the activation of the UPR pathway. We also believe that overexpression of AAT in the cellular system may enhance the UPR, and thus cells choose some more eff icient way to deal with this bulk stress, like an autophagy dependent manner ( 127 ) However, our result showed that Z AAT is also precipitated with BiP, which is consistent with the finding that BiP is involved in recognizing and disposing mutant Z AAT ( 126 ) The biological significance of the AAT knock down experiment could be in question because some gene expression levels only decreased by 20%. Our jus tification is that our treatment time is only 48 hours. During this short time, cells are not be able to dispose of all the accumulated Z AAT in the system, thus the feedback signal transduction chain is maintained and can finish the job. The limitation of transient transfection of siRNA makes it harder to maintain the knock down for a long period of time. Therefore, establishing an AAT knockout cell line is a better way to show the differences during a longer period. We found no significant difference in B iP between tissue samples from M and Z individuals. By looking at patient records, we found that the samples from Z patients were taken from transplanted livers. These livers had severe fibrosis or other liver

PAGE 39

39 diseases and we think they may have overshot steady state and UPR had already given up. The great difference of CHOP, which is an inducer of apoptosis, between the two groups gives support to this hypothesis. The finding that solubility of Z AAT can be increased by overexpression of BiP may provide a new methodology to alleviate accumulation of Z AAT within the cell. Also BiP, as a major regulator of UPR, may reinitiate the UPR after the second hit has occurred and help to reestablish homeostasis in the liver cells. In the future, gene therapy of several UPR related genes could be conducted to see whether one or more of them could reduce Z AAT accumulation within the ER.

PAGE 40

40 Table 21. UPR and cytokinerelated gene expression levels after AAT are knocked down in AT01 cells. p value indicates the significance of each gene expression level between AT01 and Hu339 hepatocytes. Genes Decreased by % p value AAT 69 8.7 < 0.0001 ATF4 35 7.4 0.0003 BiP 30 7.1 0.0007 CHOP 40 9.3 0.0008 NF 35 8.4 0.0011 XBP1(u) 26 9.8 0.0187 XBP1(s) 43 7.4 < 0.0001 Spliced XBP1 Ratio 17 7.3 0.0295 HSPA1A 38 7.4 0.0065 IRAK1 10 3.8 0.0466 39 3.3 0.0003 VEGF 39 7.0 0.0048

PAGE 41

41 A. B. C. D. Figure 21. Validation of AT01 and Hu339 cells. A) AT01 and Hu339 cells under phase contr ast microscope. Images were taken at 20X and 40X, respectively. B) Western blot of AT01 and Hu339 cell lysate. The cell lysate was immunoblotted with polyclonal anti human AAT, anti human albumin, anti actin. C) Co localization of AAT with ER resident proteins in AT01 cells and Hu339 cells. AAT was stained with a polyclonal anti AAT antibody; ER was stained by anti protein disulfide isomerase (PDI). The white arrows indicate where AAT colocalizes with ER. D) AT01 cells were stained by ATZ11 antibody, which only recognizes polymer Z AAT (upper panel). Phase contrast image of AT01 cells is shown in the lower panel. AAT Albumin AFP actin Hu339 AT01 AT01 Hu339 40m 40m 20m 20m Hu339 AT01

PAGE 42

42 A. B. C. D. E. Figure 22. M or Z AAT fusion proteins express properly within CHO cells. A) Schematic of the fusion protein constructs. B) Secreted luciferase fus ion AAT protein levels from CHO cells. Cell culture media from cells transfected with luciferaseM AAT or luciferaseZ AAT plasmids were measured for luciferase activity at 480nm. C) Twenty four hours after transfection with 4 g of mRFP ZAAT or GFP ZAAT e xpressing plasmids in AT01 or Hu339 cells, live cell images were taken at 40X magnification, bar = 2m. D) CHO cells with stable expression of mRFP Z AAT, bar = 20m. E) Expression of mRFP Z AAT can form polymers. Cell lysate from 1. pCR3.1mRFP M AAT tran siently transfected CHO cells, 2. mRFP Z AAT stable expression CHO cells or 3. CHO cells before stable transfection were subjected to nondenaturing or SDS PAGE and immunoblotting with anti AAT antibody. H 4 0

PAGE 43

43 A. B. C. Figure 23. AT01 hepatocytes have increased levels of UPR related genes compared to Hu339 hepatocytes. A) Real time RT PCR analysis of 6 UPR related genes normalized for 18s cDNA. AT01 cells and Hu339 cells from the same batch were recovered from the liquid nitrogen freezer. After 48 hours, RNA was isolated and reverse transcribed to cDNA and subject to quantitative PCR. Hu339 cells expression levels were arbitrary assigned as 100%. B) Representative immunoblot image showing UPR related downstream protein synthesis l actin was used as loading control. C) Quantitative result of the w estern blot. actin, and protein level in Hu339 cells was assigned as 100%. n=3 experiments, *p<0.05, **p<0.01, ***p<0.0001.

PAGE 44

44 A. B. C. Figure 24. UPR and cytokine levels decreased after AAT knock down in AT01 cells, but not in Hu339 cells. Real time quantitative PCR analysis of UPR related gene expression levels in A) AT01 or B) Hu339 cells. Expression levels were normalized by 18s cDNA. Cells were treated with 5nM siRNA to AAT or scramble control for 48 hours. Expression level of scramble siRNA control group was arbitrary assigned as 100%. n=3 experiments *p<0.05, **P<0.01, ***p<0.0001. C) Representative w estern blot of AT01 and Hu339 cell lysate knock down of AAT gene. actin was used as loading control. Albumin p eIF2 actin CHOP Hu339 AT01

PAGE 45

45 A. B. C. Figure 25. UPR gene response to Z AAT transfection in AT01 cells. A) Intracellular Z AAT protein synthesis levels under chicken betaactin (CB), thymidine kinase (TK) or cytomegalovirus (CMV)TK hybrid promoter. B) Z AAT synthesis in AT01 cells after transfection with CMV TK contained Z AAT expression plasmid in time course. Samples from different time points were subject to 412% SDS PAGE and immunoblotting with anti antitrypsin antibody; beta actin served as a loading control. C) UPR and NF responses to overexpression of Z AAT at different time point s. CMV TK ZAAT plasmid was transiently transfected into AT01 cells. Genes involved in UPR or NF Control groups were transfected with pEGM T vector. n=3, mean S.E; *, p<0.05; **, p<0. 01; ***, p<0.00001.

PAGE 46

46 Figure 26. Soluble portion of AAT increased when BiP was overexpressed in AT01 cells. AT01 cells were transfected with of plasmid expressing BiP gene in triplicate. Cells were scraped off in PBS buffer at 24 hours and subject ed to ultra sonification. 200 ng of total protein was loaded in each well. Relative quantity is shown above each well. actin was used as loading control. 2.2 2.3 1.2 1.1 1.2 0.6 AAT Relative quantity Soluble AAT actin Transfection Ctrl Bip

PAGE 47

47 A. B. C. Figure 27. UPR gene expression levels in Z AAT mouse and human are higher than in normal controls. A) RT PCR analysis of 4 UPRrelated genes normalized for mouse GAPDH. Liver tissues were homogenized and subjected to RNA and protein extraction according to established procedure. RNA was purified and reverse transcribed to cDNA and subject to quantitative PCR. Expression level of normal mouse group was arbitrary assigned as 100%. (n=5 mouse, *p<0.05) B) Liver tissue from PI*Z or normal B6 mice were homogenized and subjected to w estern blot against BiP, CHOP, and phosphorylated eIF2 Each group was presented in 5 replicates. actin was used as loading control. C) Liver biopsies from PI MM and PI ZZ human individuals (5 each) were homogenized and subjected to total protein extraction. Each well was actin Bip CHOP p eIF2 PI*M Mouse Pi*Z Mouse eIF2

PAGE 48

48 loaded with 200ng total protein an d blotted with BiP, CHOP and phosphorylated eIF2 GAPDH was used as loading control.

PAGE 49

49 Figure 28. Volcano plot of the NF M. Each dot represents one gene. Red dots indicate the gene is significantly upr egulated. Green dots represent genes that are significantly downregulated. The threshold of significance is p<0.05 and a fold change higher than 1.5.

PAGE 50

50 CHAPTER 3 SINGLE CHAIN ANTIBODY VARIABLE FRAGMENT THERAPY FOR ALPHA ON E ANTITRYPSIN DEFICIENCY Introduct ion In this chapter we will use Single Chain Antibody Fragment Variable (scFv) as a tool to facilitate the degradation of accumulated Z AAT. In the previous chapter, we have shown that UPR is activated during the accumulation of Z AAT. From the literature we know that ERAD is an important UPR downstream degradation system to ameliorate the ER stress ( 25) We believe if we accelerate the degradation rate of newly produced Z AAT, the ER stress can be future reduced. The work done by Lomas D.A. group gives us a great idea of how to proceed in this approach ( 128 ) They design small peptide ( 129) or small molecule ligand ( 130 ) to seal the cavity on surface of the mutant Z AAT, by which the polymerization will be terminated. Their experiment showed very promising results from the in vitro experiments; however, they failed at ex vivo level due to the fact that the small peptide or molecule is not stable or hard to deliver to ER compartment. The limitation from the s tudies above put a challenge on how to efficiently deliver such polymer inhibitor into the ER compartment. To fulfill this goal, antibody or scFv became our best candidate for this mission. It has several advantages over the approaches that mentioned above. First, it is much more stable than small molecules or peptides within the ER ( 131 ) Second, the delivery to the ER will be more efficient. Since the antibody can be synthesized within the cell by gene delivery, and the translation and assembly take place within the ER compartment, this gives a natural environment for antibody to recognize and bind to Z AAT. In this chapter we will introduce the process of gener ation and characterization of the scFv and focus on how to use scFv to facilitate the degradation of Z AAT polymer

PAGE 51

51 within the ER. CHO with mRFP Z AAT stable expression was used as the cell model to demonstrate the effect of scFv. Materials and Methods Cell Lines and Transfections The CHO cell line (Invitrogen, Carlsbad, CA) with stable mRFP Z AAT expression were generated by standard protocols. CHO stableexpression cells were cultured in DMEM F 12 media supplemented with 10% fetal bovine serum, 100 units/ mL penicillin, and 100 mg/mL streptomycin. Cells were incubated at 37C with 5% CO2 and maintained with 500 g/mL Geneticin (all cell culture reagents from Invitrogen). HEK 293 cells were maintained in the same medium but without Geneticin. Twenty four hours before transfection, 1 X 105 CHO mRFP Z AAT or HEK 293 cells were seeded in each well of a 6well plate without Geneticin. The PI ZZ hepatocyte line was created from a liver biopsy from a four month old PI ZZ infant according to the established protocol ( 109) Lentivirus containing human telomerase catalytic domain TERT was used to immortalize the cell. The plasmids were premixed in 500 L Opti MEM and t ransfected with Lipofectamin LTX (Invitrogen, Carlsbad, CA) according to manufacturers instructions. Transfection in the PI ZZ and Huh7 cell line was done in a similar fashion with GenJet In Vitro DNA Transfection Reagent (SignaGen Lab Gaithersburg, MD) and culture media was changed 6 hours after transfection. Cloning of A nti AAT S cFv The hybridoma secreting anti human AAT antibody was generated in the Hybridoma Core Facility at the Interdisciplinary Center for Biotechnology Research (ICBR) at the Unive rsity of Florida. The process was handled under the established

PAGE 52

52 method ( 132) and approved by the University of Florida Institutional Animal Care and Use Committee (UF IACUC protocol #201202356). Positive colonies were screened by ELISA using plates coated with M or Z AAT. Total RNA from clone 3H12 2C2 was isolated with the RNeasy kit (Qiagen, Valencia, CA). The RNA was reverse transcribed into cDNA using the Universal Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) with random hexamers as primers to synthesize first strand cDNA. The first strand was then poly G tailed by incubation with 1 unit of terminal transferase and 100 M dGTP (both from New England Biolabs, Ipswich, MA) for 30 minutes. The tailed cDNA was amplified by PCR using an anchor poly C primer and another primer to anneal to the constant r egion of either the heavy chain (VH) or light chain (VL) ( 95) The first round PCR reaction was carried out with 35 cycles at 96C for 30s, 52C for 30s, and 72C for 45s. The amplicons of VH and VL were digested by Xba I and Hind III and inserted into pEGM Easy vector, (Promega, Madison, WI) respectively for sequencing. To create a single chain construct, VH and VL were amplified with nest primers, which contain an intervening (G4S)3 peptide DNA linker, and assembled in VHVL fashion. The final PCR product was inserted into the Hind III and Not I site of the pSecTag2His plasmid (Invitrogen, Carlsbad, CA) to create pSecTag2ScFv plasmid for protein expression and purification. Construction of S cFv F usion P rotein V ectors To express in the mammalian cell lines, the scFv fragment was digested with Hind III and Not I and inserted into pCR3.1 (Invitrogen, Carlsbad, CA). The AAT signal peptide was inserted at the 5 end of the scFv. KDEL ER targeting sequence, Hsp 70 binding motif (VKKDQ/KFERQ), and FK506binding protein fragment 12 (FKBP12) (107 amino acid) were inserted at the 3 end of the scFv between the Not I and Apa I site.

PAGE 53

53 Myc sequence was added at the 3 end of each tag. FKBP12 was digested from pCR3.1 FKBPmyc (plasmid 20211, Addgene, Cambridge MA). KDELER targeting sequence and Hsp70 binding motif were synthesized by annealing two oligonucleotides. The list of oligo primers above is in Table 32. ScFv A nti AAT B inding A ctivity A ssay Plasmid pSecTag2scFv was transfected into HEK 293 cells and incubated for 48 hours at 37C. Supernatant was collected, purified with MagneHis purification system (Promega, Madison, WI) and subjected to an ELISA based assay. Micr otiter plates per well. Plates were washed, followed by the addition of a dilution series of purified scFv or positive control polyclonal anti AAT antibody (1:5000, Dako). Rabbit anti His antibody labeled with horseradish peroxidase (HRP) (1: 1000, Roche) was used as secondary antibody for the supernatant and goat anti rabbit (1:1500, Jackson laboratories, Bar Harbor, ME) antibody was used as secondary antibody for positive co ntrol. Plates were developed using 3,3,5,5 Tetramethyl bezidine and phosphate citrate buffer (Sigma Aldrich, St. Louis, MO) and analyzed at an absorbance of 450nm using Molecular Device model M3 microplate reader (Molecular Device, Sunnyvale, CA). AAT A ctivity A ssay Pure AAT at 125 nM was diluted with varying amounts of antibody to test for neutralizing effects and then AAT activity was measured by anti neutrophil elastase capacity assay. Samples were incubated with neutrophil elastase (Athens Research and Technology) for 5 minutes at 37C and then combined with nmethoxysuccinyl Ala -

PAGE 54

54 Ala Pro Val p nitroanilide chromogenic substrate (Sigma, St Louis, MO) for a kinetic reading at 405 nm NF B A ctivity A ssay Cells in each well of a 6well plate were transfected with 2g of p NF MetLuc plasmid (Clontech, Mountain View, CA), 8 L Lipofectamin LTX reagent (Invitrogen), and 2 L of Plus reagent. Twenty four hours after transfection, 50 L of cell culture medium from each well was tested with the Ready to Glow secreted luciferase assay according to manufacturers instructions. Immunoblotting for Nondenaturing Gels Forty eight hours after transfection, cells were scraped from the surface of 6w ell plates in DPBS (Invitrogen, Carlsbad, CA) with protease inhibitor (Roche, Pleasanton, CA). The lysate was vortexed for 5 min and centrifuged at 14,000 x g for 10 min. Total protein in the supernatant was normalized by BCA assay (Thermo Scientific, Rock ford, IL) and subjected to nondenaturing gel electrophoresis. Then the gel was transferred to PVDF membrane with iBlot (Invitrogen) and blotted with polyclonal anti AAT antibody (1:5000) (Dako, Carpinteria, CA). Immunofluorescent Microscopy Cells were tra nsferred from 6well plates (Nunc, Rochester, NY) to culture slides (Millipore, Billerica, MA) 6 hours post transfection. After 48 hours, cells were washed twice with DPBS (Invitrogen), fixed with 4% paraformaldehyde for 30 min and permeabilized with 0.5% Triton X 100 for 10 min. After blocking in 10% donkey serum for 10 min, cells were incubated with rabbit anti myc (1:1000) (# ab9160, Abcam, Cambridge, MA) in 3% donkey serum, followed by 5 min in a DPBS wash 3 times. Secondary donkey anti rabbit antibody labeled with Alexa 488 (Jackson Immunolab,

PAGE 55

55 West Grove, PA) was used at 1:250 in 1.5% donkey serum and incubated with samples for 1 hour. Golgi apparatus was labeled with GFP N acetylgalactosaminyl transferase 2 and ER was labeled with GFP KDEL, which were both delivered by Cell Light baculovirus (Invitrogen). Thirty six hours after transfection, 10 l of cell light reagent was added to 500 l of cell culture medium and incubated with CHO cells overnight before taking live cell images. Image J was used to quantify the fluorescent intensity within each cell. Immunoprecipitation CHO cells were lysed in NP40 buffer 48 hours after transfection. Then samples were centrifuged at 14,000 x g for 10 min. The supernatants were incubated with Dynabeads (Invitrogen) conj ugated with a mouse monoclonal anti myc antibody. Followed by 3 washes, the samples were eluted in elution buffer and run on a 412% Bis Tris gel (Invitrogen) for Western blotting and detected by the polyclonal anti AAT antibody (1:3000, Dako) and HRP conj ugated secondary goat anti rabbit antibody (Chemicon International, Billerica, MA). Cell Proliferation Estimated by MTT Assay Six hours after transfection, 3000 cells were seeded into each well of 96well plate. The MTT assay was done at 0, 24, 48, 72, and 96 hours after seeding the cells by using Cell Titer 96 MTT assay kit (Promega) according to the manual. Electron Microscopy Cells were trypsinized and resuspended in Tyrodes buffer (SigmaAldrich).Then the cells were fixed with 2% glutaraldehyde, dehydr ated, and embedded in Epon in preparation for electron microscopy. Ultrathin sections were counter stained with uranyl

PAGE 56

56 acetate followed by lead citrate and examined by Hitachi 7100 Transmission electron microscope. Images were captured at 8000X magnificati on. Statistical analyses Quantitative PCR and w estern blot data were analyzed with GraphPad Prism 5.03 software (GraphPad Software, San Diego, CA). Results were compiled as mean SEM and compared by Students t test. Significance was considered for p valu es < 0.05. Results Cloning and C haracterization of A nti AAT S cFv To generate a high affinity scFv against AAT, we first screened the hybridoma colonies which produce AAT antibodies. As Table 31 shows, multiple single colonies have strong affinity for both M and Z AAT. Clone 3H122C2 was chosen from various monoclonal hybridomas (Table 31) to generate the scFv because the antibody it produced has higher affinity for Z AAT than for M AAT. Both VH and VL fragments are 560bp and were amplified from the cDNA of the hybridoma; the deduced size for the scFv protein is 28 kDa. The aminoacid sequence of anti AAT scFv without a leader sequence is shown in Figure 31A. To verify the affinity of the scFv to AAT, we characterized the anti AAT scFv His expressed in the HEK 293 cell. The 28 kDa band from both the cell culture media and cell lysate was detected on an SDS PAGE gel with anti His antibody (Figure 31B). Media from anti AAT scFv His plasmid transfected cells shows significantly higher signal compared to the negative control in ELISA with M or Z AAT coated plates (Figure 31C). We purified the anti AAT scFv from culture media with a His purification system and detected a 28 kDa band with Coomassie staining (Figure 3 1D). The purified anti AAT scFv His detected AAT by western blot (Figure 31E) and

PAGE 57

57 immunofluorescent staining when used as the primary antibody (Figure 31F). Collectively, these data demonstrate that the anti AAT scFv retains the parental monoclonal antibody (mAb) binding affinity to AAT. Purified Anti AAT Scfv Inhibits ZAAT Polymer Formation in vitro After determining the scFv has affinity to AAT, we tested whether the scFv can function as an inhibitor of Z AAT polymer formation. Since Z AAT can form polymers at 37C ( 133 ) we incubated 0.1mM Z AAT with different amounts of purified anti AAT scFv at 37C overnight and subjected it to nondenaturing PAGE followed by immunoblot with anti AAT polyclonal antibo dy. Polymerized Z AAT diminishes with increasing amounts of scFv, as shown in Figure 32A. In addition, the portion of Z AAT monomer or dimer significantly increases as scFv concentration increases. This data demonstrates that anti AAT scFv inhibits Z AAT polymer formation in vitro Scfv FKBP12 Increases Degradation of ZAAT in Cell Culture Next, we questioned whether the scFv performs the same inhibition of polymer formation in a Z AAT expressing cell line. We first established a stable CHO cell line expr essing mRFP Z AAT (Figure 3 2B ). Polymerized mRFP Z AAT has been identified by nondenaturing PAGE (Figure 3 2C ). Immunofluorescent microscopy revealed mRFP Z AAT colocalized with ER markers (Figure 3 2D ). Then scFv His or pEGFP C3 control plasmids were t ransiently transfected into CHO mRFP Z AAT and PI ZZ hepatocytes ( 134 ) However, no significant reduction of polymerization was observed (Figure 3 2E ). To increase the chance of scFv binding to Z AAT, we replaced the scFv Ig e native AAT signal peptide sequence (MPSSVSWGILLLAGLCCLVPV) at the N terminus of anti AAT scFv. To increase the degradation efficiency, we directed the scFv complex to three specific

PAGE 58

58 degradation pathways. Three vectors were constructed based on the scFv w ith native AAT signal peptide (Figure 33 A). At the C terminus of the scFv, one was fused with Hsc70 binding motif (Hsc 70bm) to direct to the chaperone mediated autophagy pathway ( 135) ; a second was fused with wildtype FK506 binding protein 12 (FKBP12) to direct to the ubiquitin pathway ( 136) ; the third was fused with KDEL sequence ( 137 ) to retain the scFv in the ER to increase the chance of scFv binding to Z AAT protein. Three scFv constructs were transfected into CHO mRFP Z AAT cells and the fusion scFv bands were detected in cell lysates with correct size: scFv KDEL and scFv HSP70bm both showed 28 kDa bands and scFv FKBP12 showed a 35 kDa band (Figure 3 3B). In addition, the cells lysate in PBS was subjected to nondenaturing PAGE and detected with anti AAT primary antibody and anti rabbit HRP secondary antibody. As shown in Figure 3 3 C, the scFv FKBP12 transfected group has the most significant reduction of intracellular polymer and monomer AAT. To further confirm this, cells were transfected with scFv FKBP12 and subjected to fluorescent microscopy. The cells from the scFv FKBP12 treat ed group have reduced Z AAT accumulation represented by total RFP fluorescent intensity (Figure 3 3D). The total intensity of mRFP Z AAT of the treatment group decreased 2fold compared to the control group (Figure 3 3E). To verify that the reduction of Z AAT aggregation is not caused by FKBP12 alone, we used FKBP12myc transfected cells as an additional control. The AAT levels in the western blot show that only the scFv FKBP12 group reduces the total intracellular accumulation of Z AAT (Figure 3 3F). Since Banaszynski et. al. demonstrated that FKBP12 with F36V and L106P mutations will significantly increase the degradation efficiency in NIH3T3 cells ( 138 ) we compared the degradation

PAGE 59

59 efficiency between wildtype and doublemutated scFv FKBP12. As shown in Figure 3 4 although both transfected constructs reduce Z AAT accumulation levels, the mRFP Z AAT accumulation levels between scFv FKBP12 wt and scFv FKBP12 2mu transfected groups shows no significant difference (t test, p=0.28, n=6). These results demonstrate that scFv FKBP12 with native AAT signal peptide significantly r educes the Z AAT accumulation level within the ER. ScFv FKBP12 Reduces Z AAT Polymerization through Proteasome Degradation Pathway Since FKBP12 has been reported as a chaperone for amyloid precursor protein ( 139) we introduced FKBP12myc construct as a negative control to eliminate the possibility th at FKBP12 alone can facilitate degradation of Z AAT. To prove scFv FKBP12 can bind to Z AAT, anti myc antibody was used to pull down scFv FKBP12 Z AAT complex from the cell lysate and the result shows only scFv FKBP12 can bind to Z AAT (Figure 3 5A). In addition, co localization of mRFP Z AAT with scFv FKBP12 but not FKBP12 was detected (Figure 35B). To further confirm that the proteasome pathway degrades the binding complexes, we used MG132, a proteasome inhibitor, to block the degradation chain of the complex. After treatment with MG132 for 2 hours, the scFv FKBP12 transfected group shows the highest increasing of Z AAT accumulation (Figure 3 5C). Further quantification of the fluorescent images (Figure 35D) shows the fluorescent density in the scFv FKBP12 transfected group increased 2.1fold after MG132 treatment (p=0.02, n=4). However, in FKBP12myc control groups, the AAT accumulation level has no significant change after MG132 treatment (p=0.7183, n=4) and only a 1.3fold increase was observed in the EGFP control group (p=0.03, n=4). To further confirm the previous report that inhibition of polymerization will not interfere with

PAGE 60

60 the secretion pathway ( 130) co localization of a Golgi apparatus marker and Z AAT was performed. No colocalization was observed (Figure 35E). These data demonstrate that scFv FKBP12 binds and directs the aggregated complex to proteasome pathway for degradation. Scfv FKBP12 Reduces ER Stress Caused by Z AAT Accumulation The direct effect of Z AAT accumulation is ER stress, which may lead to mitochondria damage and ER dilation ( 140 ) To asse ss whether scFv FKBP12 can restore the growth status of the cell, an MTT assay was performed. CHO mRFP Z AAT cells transfected with scFv FKBP12 grow significantly faster than both EGFP and FKBP12 myc control groups after 48 hours (p<0.01, FKBP12myc and EG FP vs. scFv FKBP12, two way ANOVA with Bonferroni post test) (Figure 3 6A). The characteristic ER globules formed by Z AAT accumulation were reduced (Figure 36B). To assess changes in the ER overloading pathway, NF ( 37, 39, 141 ) CHO mRFP Z AAT cells were cotransfected with pNF MetLuc and pCR3.1scFv FKBP12 as treatments. The control group was cotransfected with pNF MetLuc and pEGFP or pCR3.1FKBP12 myc. As shown in Figure 3 6 C, the reporter activity, an indicator of transcription level of NF 9.3% 1.2% of that in CHO mRFP Z AAT (p=.004, n=4). After transfection with scFv FKBP12, the NF control group in CHO mRFP Z AAT cells (p=0.01, n=4). This data demonstrates that clearance of Z AAT accumulation by scFv FKBP12 reduces activation of the NF pathway, or ER stress within the cell.

PAGE 61

61 Scfv FKBP12 does Not Inter fere the Secretion and the Activity of M AAT Initial studies showed that anti AAT scFv can bind to both M and Z AAT in ELISA. To assess whether scFv can interfere with normal M AAT in the cells, scFv FKBP12 or pEGFPC3 plasmids were transfected into Huh7 cells with normal M AAT expression. Forty eight hours after transfection, 82% 3% of the cells have posit ive EGFP expression (Figure 37A). Cell culture media was subjected to ELISA to measure the amount of M AAT. As shown in Figure 37B, no significant difference in M AAT production between scFv FKBP12 and EGFP transfected groups was observed (p=0.18, n=3). To monitor the activity of secreted M AAT, a neutrophil elastase inhibition assay was performed on cell culture media from the two groups, and showed no significant difference between them (p=0.17, n=4) (Figure 37C). To further confirm, we incubated either 600nM of purified scFv or 1X PBS with different amounts of M AAT for 30 minutes and performed a neutrophil elastase inhibition assay. The result from this experiment showed scFv did not affect M AAT activity (Figure 37D) (two way ANOVA with Bonferroni post test, p=0.06, n=3). In addition, we incubated 125nM M AAT with different amounts of purified scFv. Similarly, no significant effect of scFv on M AAT activity was observed (Figure 6E) (Oneway ANOVA, p=0.6023, n=3). Discussion Alpha1 antitrypsin defici ency has been well recognized as a conformational strand inter linkage ( 142) The mutant Z AAT protein will form polymers and be retained within the ER of hepatocytes, which may lead to ER dysfunction and liver disease. However, clinical studies indicate that not all PI ZZ patients will develop severe liver diseases ( 22) It has been proposed that the equilibrium between polymer formation and degradation is the key reason for these

PAGE 62

62 PIZZ individuals healthy status ( 142 ) The well accepted second hit theory proposed that an insufficient degradation system would break this equilibrium and lead to significant disease ( 143 ) Therefore, the therapy development strategy should focus on how to restore this equilibrium. Previous studies using small peptides ( 129) or sm all molecule ligands ( 130 ) for the inhibition of Z AAT polymerization, or gene delivery of shRNA ( 144) or miRNA ( 55) have shown promising results. In the present study, we designed an anti AAT single chain variable fragment (s cFv) derived from a monoclonal hybridoma as a tool to facilitate the degradation of accumulated Z AAT. This approach has several advantages. First, it is more stable than small molecules or peptides within the ER ( 131) Second, the delivery to the ER will be more efficient because the antibody can be synthesized within the cell by gene delivery, and the translation and assembly take place within the ER compartment, providing a natural environment for the antibody to recognize and bind to Z AAT. Third, compared to the approach of RNA regulation, scFv directly targets mutant Z AAT proteins, which may have less off target effects and higher efficiency of reducing t he accumulation level of Z AAT. ScFv has been used as a great tool in aggregation diseases such as Alzheimers, Huntingtons and Parkinsons ( 145 146) In these studies, KDEL or HSP70bm together with scFv can successfully direct mutant proteins to specific cellular compartments. However, the aggregated proteins in those diseases are located in the cytoplasm rather than within the ER. This might explain why the KDEL or HSP70bm tags didnt function as well as they do in other diseases ( 145 ) This result may also sug gest that among several degradation pathways, the proteasome pathway maybe the best option for targeted degradation of ER accumulated protein.

PAGE 63

63 There are two rather curious aspects to our current data. First is that scFv can inhibit the formation of Z AAT p olymers in vitro but failed to decrease intracellular accumulation by itself. This may suggest that inhibition of polymerization is not enough to increase Z AAT degradation. Since we know that most unfolded Z AAT will be recognized and degraded by the ERA D pathway ( 25) the fast turnover of FKBP12 may provide a good means of enhancing the degradation of whole complex in the ERAD pathway. However, the detailed mechanisms of how the complex gets through the ER membrane are currently unclear. The other aspect is regarding the lack of effect of scFv on either the secretion or the activity of M AAT. Since this scFv can bind both M and Z AAT, theoretically it will have the same effect on both. However, it has been reported that PI MM cells secret e most of the M AAT in a very fast manner and very few proteins remain within the ER ( 147) This may give fewer chances for scFv to bind M AAT, and thu s have a limited effect on the degradation level of M AAT. On the issues of M AAT activity, our explanation is that the binding epitope on AAT is not close to the reactive site, so the docking of neutrophil elastase will not be interrupted. To test this hy pothesis, mapping of the binding epitope will be necessary in the future experiments. Nevertheless, this result opens the door of combining normal rAAV M AAT with scFv FKBP12 into a therapy that can both eliminate accumulated Z AAT and also introduce suff icient M AAT into circulation ( 148 ) Compared to inducing a generous degradation system like macroautophagy or ERAD, the scFv therapy has several advantages. Firs t, the target of the scFv is very specific, so collateral damage to other functional proteins is minimized. Second, the artificial construct is upgradable. Since the functional groups of either scFv or FKBP12

PAGE 64

64 are distinct, we can switch current scFv with a Z AAT specific scFv, which may increase the efficiency and specificity of the treatment. Since the scFv FKBP12 is expressed constitutively within the ER, further kinetic studies will be necessary to determine the optimal expression level to achieve the best efficiency without overwhelming the proteasome ( 149 ) Given that adenoassociated virus type 8 (AAV8) can achieve more than 80% gene delivery efficiency i n the liver though portal vein injection ( 150 ) we will choose this gene delivery method as our first choice for our future in vivo experiments.

PAGE 65

65 Table 3 1. Hyb ridoma screening results for positive affinity antibody to AAT. OD values represent the secreted mouse monoclonal antibody binding affinity to M or Z AAT. Highlighted clone is the one that has been used to create scFv. Assay Plate Well Sub Clone # ZZ OD MM OD Clone type C8 2E8 2.481 3.249 Single colony C9 2F2 2.576 3.339 Single colony E10 3F4 2.605 3.370 Single colony E11 3F7 2.691 3.394 Single colony E12 3F9 2.780 3.448 Single colony F7 4B8 2.497 3.189 Single colony F9 4B12 2.594 3.342 Single c olony F11 4C4 2.467 3.331 Single colony G1 4C7 2.558 3.370 Single colony G6 4E7 2.584 3.279 Single colony H12 4D4 2.420 3.245 Multiple colony B4 1C12 2.363 4.000 Single colony B5 1D1 2.099 4.000 Single colony B12 2C2 3.362 2.267 Single colony C10 2F3 2.404 3.319 Single colony C12 2F8 2.479 3.383 Single colony E9 3E3 2.300 3.341 Single colony F8 4B10 2.140 3.420 Single colony B9 2A12 2.189 3.341 Single colony B11 2B10 2.156 3.340 Single colony

PAGE 66

66 Table 3 2 Primers used to clone scFv and subsequent constructs Pimers Sequence (5' 3') P oly C primer Forward CGT CGATGAGCTCTAGAATTCGCATGTGCAAGTC CGATGGTCCCCCCCCCCCCCC Constant Region Heavy Chain CAGGTCACTGTCACTGGCTCAG Constant Region L ight Chain CTTCCACTTGACATTGATGTCTTTG VH nest pri mers F GGTTGGTACCGTCGACATGGATGTGCAGCTTCA GGAGTCG VH nest primers R AATTGGTCTCCCTCCTCCGCTTCCTCCTCCTCCA GGCTGCAGAGACAGTGAC VL nest primers F AATTGGTCTCAGGAGGAGGAAGCGGAGGAGGA GGAAGCGACATTGTGCTGACACAG VL nest primers R TTAAGCGGCCGCTTTCCAGCTTGGTCCCCC AAT s ignal peptide F CTAGCATGCCGTCTTCTGTCTCGTGGGGCATCCT CCTGCTGGCAGGCCTGTGCTGCCTGGTCCCTGT CTCCCTGGCTGAGGATCCGA AAT signal peptide R AGCTTCGGATCCTCAGCCAGGGAGACAGGGACC AGGCAGCACAGGCCTGCCAGCAGGAGGATGCC CCACGAGACAGAAGACGGCATG KDEL ER targeting sequence F GGCCGCTAA GGACGAGCTGCATCATCATCATCA TCATTGAGGGCC KDEL ER targeting sequence R CTCAATGATGATGATGATGATGCAGCTCGTCCTT AGC Hsp 70 binding motif F GGCCGCTGTTAAGAAGGATCAAGCTGGAGCCGC TGCACCGAAGTTCGAACGTCAACATCATCATCAT CATCATTGAG Hsp 70 binding motif R AAAGGGCCCTCAATGATGATGA TGATGATGTTGA CGTTCGAACTTCGGTGCAGCGGCTCCAGCTTGA TCCTTCTTAACAGCGGCCGCCCGTTTGATTTC 3

PAGE 67

67 A. B. C. D. E. F. Figure 3 1. Expression and binding properties of anti AAT scFv. A) Amino acid sequence alignment of anti AAT scFv. Non AAT specific scFv sequence was used as comparison. B) HEK 293 cells were transiently transfected with anti AAT scFv. Conditioned media was subjected to Western blot analysis: 1. Uncultured DMEM with 10% FBS; 2. Conditioned media from HEK 293 cells transfected with scFv; 3. Purified scFv; 4. Cell lysate from HEK 293 cells transfected with pSecTag2scFv. Primary antibody: anti His (1:1000); detecting antibody: anti rabbit HRP (1:2500). C) 20 L of cell culture media from anti AAT scFv transfected cells or original 3H122C2 hybridoma clone was tested by ELISA using an M or Z AAT coated plate. Culture medium from nontransfected HEK 293 cells was used as a control. ***p<0.0001 versus control. D)Coomassie staining of 1. Uncultured medium with 10% FBS; 2. Culture medium from pSec scFv transfected HEK 293 cells; 3. Elut ion after M AAT Coated (O.D) Z AAT Coated (O.D) Hybridoma 3.3470.018*** 2.3940.052*** ScFv 0.4190.005*** 0.2 840.002*** Ctrl 0.00030.0003 0.00170.001 20 kDa 30 kDa 1 2 3 MW mRFP ScFv Alexa Fluor 488 Merge mRFP CTRL mRFP ZAAT MW 52 KDa M Z Ctrl 1 2 3 4 28 KDa MW

PAGE 68

68 6X His tag purification. Black arrow shows the purified scFv band. E) 0.1 ng of M or Z AAT was subjected to SDS PAGE, blotted with purified anti AAT scFv (1:100) and detected with anti His HRP antibody. 0.1 ng of BSA was used as a negative control. F) CHO mRFP Z AAT cells were fixed and stained with the anti AAT scFv and anti His Alexa Fluor 488. Representative images show anti AAT scFv can recognize mRFP ZAAT. Control group is CHO cells transfected with mRFP plasmid and stained with scFv and anti His Alexa Fluor 488. Bar = 20 m.

PAGE 69

69 A. B. C. D. E. ScFv ( nM ) 0 0. 03 0.06 0.3 0.6 Z AAT (mM) 0.1 0.1 0.1 0.1 0.1 CMV Pr mRFP AAT SP BGH poly A Z AAT 1 2 3 Denatured Non Denatured RFP Anti PDI Merge mRFP Z AAT mRFP M AAT

PAGE 70

70 Figure 3 2. Anti AAT scFv inhibits the polymerization of Z AAT in vitro. A) Co incubation of Z AAT with anti AAT scFv prevents Z AAT polymerization. Purified sc Fv AAT (final concentration) were incubated at 37C for 48 hours, subjected to nondenaturing PAGE, and detected with the anti AAT polyclonal antibody. B) Schematic of mRFP ZAAT expression construct. mRFP was inserted between the s ignal peptide and the rest of the Z AAT. C) Overexpressed mRFP Z AAT can polymerize. Cell lysate from 1. mRFP M AAT transient transfected CHO cells, 2. mRFP Z AAT stable expression CHO cells or 3. CHO cells before stable transfection were subjected to nondenaturing or SDS PAGE and immunoblot with anti AAT antibody. D) ER marker colocalized with mRFP ZAAT within the stable CHO cell line. ER resident protein, Protein Disulfide Isomerase (PDI) was used as an ER marker. CHO cells transiently transfected with m RFP M AAT were used as the control. E ) Anti AAT scFv does not have an effect on Z AAT in cell culture. Anti AAT scFv expressing plasmid was transfected into PI ZZ hepatocytes or mRFP ZAAT stable expression CHO cells for 48 hours. +: transfected with scFv plasmid; : transfected with EGFP plasmid as control. actin was used as loading control.

PAGE 71

71 Intensity ScFv-FKBP12 Ctrl 0 1.0108 2.0108 3.0108*** A. B. C. D. E. F. Figure 3 3. S cFv FKBP12 increase degradation of Z AAT A) Three vectors expressing scFv fusion protein were constructed: one is fused with Hsp70 binding motif, the second is fused with wild type FK506 binding domain 12 (FKBP12), and the third is fused with KDEL sequence. All the vectors have an myc tag at the C terminus. B) Western blot of NP40 lysate, detected with anti myc primary antibody and anti rabbit HRP secondary antibody, showing expression of scFv fused with KDEL, Hsp70 binding motif and FKBP12. C) Nondenaturing gel of transfected CHO mRFP ZAAT cell lysate, detected with anti AAT primary antibody and a nti rabbit HRP secondary antibody showing the actin was used as loading control. The gel represents 3 independent experiments. D) CHO mRFP ZAAT cells were transfected with scFv FKBP12 or GFP control plasmid. For ty eight hours after transfection, images were taken at 40X. Bar = 20m E) Ten cells were chosen in random view from each group and Image J was used to measure the total mRFP ZAAT intensity of each cell. The graph shows mean SEM of 3 independent experime nts ***p<0.0001. F) Cells transfected with scfv FKBP12, FKBP12 myc, or EGFP for 24 hours wer e lysed and subjected to SDS PAGE; representative gel image shows the level of AAT after actin was used as loading control. Phase contrast IF RFP ZAAT Superimpose ScFv FKBP12 Ctrl KDEL Hsp70bm FKBP12 Control Monomer Polymers actin EGFP Ctrl ScFv FKBP12 FKBP12 myc Z AAT Actin

PAGE 72

72 Ctrl 2: EGFP Treatment 1: ScFv FKBP12 Wt Treatment 2: ScFv FKBP 2mu mRFP Z AAT DAPI Merge Ctrl 1: FKBP12 myc

PAGE 73

73 Figure 34. ScFv FKBP12 double mutant does not increase the degradation efficiency. CHO mRFP Z AAT was transfected with scFV FKBP12 wild type or double mutation plasmid. FKPB myc and EGFP were used as negative controls. Forty eight hours after transfection, cells were fixed, stained with DAPI, and subjected to fluorescent microscopy. Images were taken at 2 0X, bar= 20m.

PAGE 74

74 ScFv-FKBP12 FKBP12-myc EGFP-Ctrl 0 50 100 150 200MG132 DMSO Ctrl Relative Flouresent Density %* ns A. B. C. D. ScFv FKBP12 FKBP myc EGFP Control 80Kd MW Myc RFP Z AAT Merge ScFv FKBP12 FKBP12 myc EGFP S cFv FKBP 12 FKBP12 myc GFP Ctrl MG132 Treatment DMSO Ctrl

PAGE 75

75 E. Figure 3 5 ScFv FKBP12 direct s Z AAT into proteasome degradation. A) Western blot of an immunoprecipitation of cell lysate with c myc antibody, detected with anti AAT primary antibody and anti rabbit HRP secondary antibody, showing that scFv Fkbp12 can bind to mRFP ZAAT. B) CHO mRFP ZAAT cells were transfected with scFv FKBP12, FKBP12 myc or EGFP expression plasmid for 48 hours, fixed on slides and then stained with anti myc as primary antibody and Alexa 488 conjugated donkey anti rabbit secondary antibody. Images from red and green channels were taken at 40X, and then merged and deconvoluted to show the colocalization of the expressed proteins to Z AAT. Bar = 20m. C) Forty eight hours post transfection, CHO mRFP cells were treated with 10 M MG132 or DMSO for 2 hours, and images were taken from random fields at 40X. White arrows in the representative images indicate increased aggregated protein. Bar = 20m. D) Quantification of fluores cent density (C). The graph shows mean SEM of 3 independent experiments. E) 1L of baculovirus expressing GFP N acetylgalactosaminyl transferase 2 (Golgi marker) was added to the cell culture media following transfection with scFv FKBP12. Twenty four hou rs later, live cell images were taken at 20X. Bar = 20m. mRFP Z AAT Golgi Marker GFP Merge

PAGE 76

76 RLU ScFv-FKBP12 FKBP-myc GFP Regular CHO 0 2.0105 4.0105 6.0105 8.0105 1.0106 CHO-Z-AAT-mRFP cells ns A. B. C. Figure 3 6 ScFv FKBP12 reduces ER stress caused by Z AAT accumulation. A) ScFv FKBP12, FKBPmyc, or EGFP plasmid was transfected into CHO mRFP ZAAT cells. 4000 cells from the three transfected groups and normal CHO cells were seeded into 96well plates. MTT assays were performed every 24 hours for 4 days. The graph shows average SEM of 8 replicates. The value is expressed in absorption OD. **p<0.01, ***p<0.0001. B) After 48 hours, cells from the three transfected groups in (A) were fixed and processed for transmission electron microscopy. Images were taken at 8000X. Arrows point DaysAbsorption (OD) 0 1 2 3 4 0.0 0.1 0.2 0.3 0.4 0.5 CHO-mRFP-ZAAT +EGFP CHO-mRFP-ZAAT +ScFv-FKBP12 CHO-mRFP-ZAAT +FKBP12-myc CHO ** ** *** ScFv Fkbp12 wt F K BP 12 myc EGFP Ctrl

PAGE 77

77 to the Z AAT accumulation globules. Bar = 1,000nm. C) Plasmid pMet NFkB Luc was co transfected with scFv FKBP12, FKBP12 myc, or EGFP to CHO mRFP ZAAT cells. Normal CHO cells were also transfected with pMet NFKB Luc as baseline control. Cell culture medium was taken 24 hours after transfection and monitored by employing the Ready To Glow Secreted NF kB Luciferase Reporter Assay. The results were normalized to total protein measured by BCA assay. The histogram shows relative NFKB activity to normal CHO cells. RLU stands for relative light unit. *p<0.05 under twotail student t test.

PAGE 78

78 Secreted M-AAT (nM) Scfv-FKBP12 GFP Ctrl 0 10 20 30 40 ns AAT Activity (nM) ScFv-FKBP12 GFP-CTRL 0.0 0.5 1.0 1.5 2.0 ns Residule AAT Activity (nM) 250 nM 200 nM 160 nM 128 nM 102.4 nM 81.92 nM 0 50 100 150 200 250 300 ScFv PBS-Ctrl Exp. Value M-AAT A. B. C. D. E. Figure 3 7 ScFv FKBP12 does not interrupt the secretion and activity of M AAT. A) Representative images showing the efficiency of Huh7 cells transfected with scFv FKBP12 or GFP. After 48 hours, images were taken from the GFP gro up at 20X and transfection efficiency determined by calculating GFP positive cells/total cells (n=5). B) Cell culture medium from (A) was subjected to M AAT ELISA. C) Cell culture medium from (A) was subjected to neutrophil elastase inhibition assay to det ermine the activity of secreted M AAT. D) 10 L of purified scFv or PBS was incubated with 250nM, 200nM, 160nM, 128nM, 102.4nM and 81.92nM of M AAT (final concentration in 50 L) for 1 hour. Residual AAT activities were determined by neutrophil elastase in hibition assay. shows expected values of residual AAT at each concentration. E) 600, 450, 300, 150 nM of purified scFv was incubated with 125nM (final concentration) M AAT for 1 hour, and residual AAT activity was measured as in (C). Broken line shows expected value of residual AAT at 125nM. Phase Contrast GFP Superimpose

PAGE 79

79 CHAPTER 4 AAV DELIVERED WILD T YPE ALPHA1 ANTITRYPSIN REDUCE S POLYMERIZATION OF IT S MUTANT (Z AAT) BY ENHANCING Z AAT SECRETION IN HEPATOCYTES: A NE W APPROACH FOR AAT D EFICIENCY TREATMENT. Introduction In this chapter we will examine the feasibility of using AAV delivered wild type M AAT to reduce accumulation levels of Z AAT within hepatocytes. As introduced in the previous chapter, the Z mutation of AAT leads to lung deficiency and liver dysfunction through differ ent mechanisms ( 25) M AAT gene therapy is a feasible approach to provide sufficient normal AAT to patients. The first literature of gene delivery can dated back to 20 years ago. In the 1990s, M AAT was delivered by viral methods, such as a denovirus ( 151) and retrovirus ( 152) ; and non viral methods, such as liposomes ( 153) naked DNA injections ( 154) and gene bombardment ( 155 ) In the recent decade, the development of t he recombinant adenoassociate virus (AAV) has made gene delivery more efficient and reliable. Song et al., proved that sufficient and sustained expression of M AAT can be achieved by injecting rAAV into mouse muscle ( 148 ) The established methods have been developed into phase I and phase II clinical trials ( 51, 156 ) The studies presented above focused on AAT gene therapy as a treatment for AAT deficiency related lung disease. However, recent clinical observations show that PI*MZ patients can develop liver disease ( 157 ) This leads us to ask whether M delivered to PI ZZ patients will interfere with the Z AAT in their cells. To investigate this, we delivered M AAT to PI ZZ hepatocytes or transgenic mice, and then we monitored the intracellular and extracellular levels of both M and Z AAT and how the cells reacted to the treatment.

PAGE 80

80 Materials and Methods Cell Lines Establishment, Culture and Genotyping Liver biopsies were obtained with informed consent from an infant with alpha1 antitrypsin deficiency suffering from severe cirrhosis to create the AT01 cell line, and from normal liver patients to create the Hu339 cell line. The cells were immortalized with infection of an adenovirus expressing the telomerase i nhibitor gene( 109 ) The hepatoma cell line (Hu339) and PI ZZ alpha1 antitrypsin deficient cell line (AT01) were cultured in DMEM with 10% fetal bovine se ng/mL HGF, 0.02 ng/mL dexamethasone (Invitrogen), and 1X insulin transferring selenium (GiBCO). Western Blot Cell lysate was collected and loaded on a PAGE gel. After electrophoresis, the protein was transferred to a PVDF membrane (Invitrogen) and hybridized with either a mouse anti human AAT monoclonal antibody (Ab) (1:100) or anti beta tubulin Ab (DAKO). The membranes were subsequently hybridized with an HRP conjugated goat anti mouse secondary antibody (1:5000) (B D). Polymer Z AAT ELISA Plates were coated overnight at 4C with polyclonal goat anti human AAT (1:200). The wells were washed with 0.05% PBS Tween and blocked with 1% BSA for 1 hour at room temperature. The wells were then washed and samples added in tr iplicate and incubated for 2 hours at room temperature. After incubation, the wells were washed and ATZ11, an antibody specific for polymerized Z AAT, added (1:300); the plate was incubated for two hours at room temperature on a shaker. The wells were wa shed and a peroxidaseconjugated rabbit anti mouse IgG (1:1000) added and

PAGE 81

81 incubated for two hours at room temperature. Finally, the wells were washed and ophenylenediamine substrate added. After 30 minutes, the reaction was stopped with 2.5 M sulfuric acid and the absorbance read at 490 nm. Florescent Double Immunostaining and Polymer HRP Immunostaining The AT01 cells and Huh339 cells were treated with either AAV1(pTR2) CB MAAT ( 158 ) at MOI=1000 or a mock AAV1 virus treatment. After 120 hours, the samples were held at 20C for 2 min, permeabilized with 0.25% Trition X 100 for 10 minutes, washed with 1% PBS for 5 min, and then blocked with 1% BSA for 30 min. Next, cells were incubated with rabbit anti human AAT or goat anti human ER antibodies (1:100) (Dako) for 1 hour at 37C followed by hybridization with FITC conjugated donkey anti rabbit antibody or Dylight 594 donkey anti goat antibody respectively (Jackson Immunoresearch) (1:200) The image was taken on Leica fluorescent microscope at 485 nm. Immunohistochemistry staining for Z AAT polymer was described previously ( 116, 159) Colocalization measured by Proximity L igation A ssay (PLA) All reagents used for PLA analysis were from Olink Bioscience (Uppsala, Sweden). The PLA reactions were performed following the manufacturers instructions using mon oclonal mouse anti FLAG (1:500, Abcam ab124462) and monoclonal rabbit anti 6XHis (1:400, Abcam ab9108). Briefly each secondary antibod y (PLA probe) has a unique short DNA strand. In conditions of close proximity, these probes can interact with circle form ing DNA oligonucleotides. After enzymatic ligation, the circular DNA is amplified via rolling circle replication by DNA polymerase. Using a fluorescent probe, the amplified products are visualized under a fluorescence microscope.

PAGE 82

82 Pull down experimen t Forty eight hours after transfection with 6XHis M AAT plasmid, CHO mRFP ZAAT cells were lysed and processed with MagneHis purification kit (Promega). Then samples were subjected to SDS PAGE and immunoblot with polyclonal anti AAT primary antibody and goat anti rabbit secondary antibody. In vitro Polymerization I nhibition Experiment Purified M AAT and Z AAT were mixed at a 3:1 ratio (final concentration M : Z = 0.3 mg/mL:0.1 mg/mL) and incubated at 45C for 3 hours. Control groups of M AAT or Z AAT samples were incubated with albumin at the same conditions above (0.3 mg/mL M AAT: 0.1 mg/mL albumin or 0.1 mg/mL Z AAT: 0.3 mg/mL albumin). After incubation, an equal volume of each sample was loaded in triplicate and resolved on a 7% NuPAGE Tris Acetate gel (I nvitrogen) for electrophoresis and immunoblotting using an anti AAT antibody for protein detection. Liver F unction Assays Both SGOT and SGPT assays were done using kits from BioVision Inc (SGOT: # K753100, SGPT: #K752100). The GGT assay kit is from Bio S cientific (Cat# 560101). All assays were done according to the manuals. Mice Experiment The PI*Z transgenic mice were randomly divided into 2 groups. The first group (n= 5) was injected with rAAV8CB MAAT at E+11 particles via the portal vein, the second group (n = 6) was injected with rAAV8CB GFP (UF5) (United States Patent : 6,461,606) at E+11 particles via the portal vein. All surgeries followed the guidelines indicated for rodent surgery by the University of Florida Institutional Animal Care and Use C ommittee (UF IACUC) Aseptic

PAGE 83

83 techniques and sterile instruments were used during all procedures. The abdominal fur of the animal was removed by depilatory cream and cleaned by scrubbing three times with betadine or chlorhexidine scrub, then washing with povidone solution. The animal was placed in supine position on an operating table, and the surgical site was covered with a sterile drape. All animals were anesthetized with 3% isofluorane and given a 2 cm ventral midline abdominal incision into the peritoneal cavity, exposing the portal vein. Treatment of rAAV8CB MAAT or rAAV8 CB GFP was administered into the portal vein using a 0.5 cc 30 G needle. Hemostasis was achieved with application of sterile cotton swag directly on to the portal vein. The abdomen was closed in two layers. The abdominal muscle layer was sewn using 50 vicryl and the skin layer was closed using 5 0 prolene sutures. Surgeries were performed on a thermoregulated operating board designed to maintain a temperature of 37C and routinely took 10 minutes. The temperature of the mouse was monitored by an animal temperature controller unit (World Precision Instruments, ATC1000). Sutures were removed from the animal 10 days post op. Post operation, the mice were placed in a temperaturecontrolle d recovery room and monitored continuously until they regained the righting reflex and ability to ambulate. Surgeries were performed in the morning to allow sufficient time for monitoring during normal duty hours. The mice were then checked every hour for the first 4 hours until eating and drinking as usual. Buprenorphine was administered in a 0.050.1 mg/kg SQ dose every 8 12 hours, with the first dose given right before surgery 50 L of blood was taken from each mouse every weekly after surgery and the serum was separated with a microtainer tube (BD) for measurement of MAAT and total AAT by

PAGE 84

84 ELISA ( 160 ) All mice were sacrificed on the 12th week after surgery. The 4 lobes of the liver were taken and fixed with formalin for HE staining, ATZ11 Ab staining ( 116) ( 161 ) and total M AAT staining ( 162) The liver was fixed with 4% paraformaldehyde for electron microscopy. About of the mouse liver was granulized by mortar and pestle at 80C; the powder was dissolved with 500 L PBS and the mixture sonicated for 5 times for 5 seconds each (Fisher Scientific model 150I). The samples were centrifuged at 140,000 x g for 10 min; the soluble part was collected for measurement of total AAT and M AAT by ELISA. The soluble lysate was diluted 400 fold. One L of lysate was used for a GAPDH assay using the KDalert GAPDH Assay Kit (Ambion) according to the manual. The sera SGOT assay was measur ed by a SGOT kit (Biovision) according to the manual. The intracellular AAT DNA copy number was measured using QPCR methods ( 162) Results Intracellular Z AAT A ccumulation L evel D ecreased after T reated with rAAV1 M AAT We delivered M AAT gene by a recombinant AdenoAssociated Virus vector (rAAV1 M AAT) ( 158 ) into a PI ZZ human hepatocyte line (AT01). 48 hours later, samples from mock treated AT01 and Hu339 cells, and AAV infected AT01 cells were fixed and subjected to immunostaining with polyclonal antibody against AAT. Compared to mock treated AT01 cells, there was a marked decrease of Z AAT retention in the intracellular compartment in the AAV MAAT treated AT01 cells (F igure 41A, left column). This result was further confirmed by electron microscopy (EM). The morphological image shows the intracellular globules disappeared in the AAV1M AAT treatment group compared to the mock treatment group (Figure 41A, middle and ri ght

PAGE 85

85 columns). We also performed a western blot to monitor the intracellular level of AAT in Hu339, AT01, and AAV1MAAT treated AT01 cells (Figure 41B). Quantification of the western blot shows the mean intracellular Z AAT level reduced by 75% after rAAV1M AAT treatment (p<0.01) (Figure 41C). In vivo A ssessment of AAV M AAT G ene D elivery in PI*Z M ouse To assess whether M AAT gene delivery will reduce the Z AAT accumulation in vivo, we subsequently packed rAAV M AAT plasmid into serotype 8 and delivered the virus to PI*Z transgenic mice ( 163 164 ) by portal vein injection. One week after portal vein injection o f AAV8 M AAT, the delivery efficiency was determined by the copy number of AAT DNA. The results from the mouse liver showed cellular AAT DNA copy number increased an average of 2,026 fold compared to the GFP mock treatment group (Figure 4 2A). Immunocytoch emistry for Z AAT specific staining demonstrated the marked abrogate Z AAT polymer accumulation in the ER and extrahepatocytic globules decreased significantly after treatment with rAAV8M AAT for 12 weeks (Figure 42B, left column). Similar to the cell l ine experiment, we confirmed this result by EM studies. The morphology EM images of the murine hepatocyte show that after rAAV M AAT treatment, globulesqueezed nuclei (Fig 42B, middle column) and swollen ERs (Fig 42B, right column) disappeared. Since the ATZ11 immunostaining on the Pi*Z mice was not evenly distributed, to confirm and quantify the amelioration of cytosolic Z AAT protein retention about 1/4 of the total liver of each mouse was granulized and the lysate was subjected to ELISA to measure tot al Z AAT (polymer + monomer) levels. Both lysate and serum levels of Z AAT polymers were measured by polymer specific ELISA. The results were normalized with GAPDH activity from the lysates. As Figure 42C shows, intracellular total Z AAT levels in the rAA V8 M AAT treated group decrease

PAGE 86

86 to 33.5% compared to the PBS control group (p<0.0001, n=6) (Figure 42C). Also total polymer Z AAT levels in the treatment group decreased by 70.8% compared to the control group (p<0.0001, n=6). However, the serum level of polymer Z AAT didnt changed significantly after 12 weeks (p=0.32, n=6) (Figure 42D). Z AAT secretion level increased after treated with rAAV1M AAT in vivo To more specifically determine whether the intracellular Z AAT protein is secreted from the mouse l iver cells after rAAV8M AAT treatment, we measured the weekly change of AAT serum (including total AAT and M AAT (Figure 4 3A) levels by ELISA. The Z AAT level was calculated by subtracting the M AAT level from the total AAT level. We found serum Z AAT le vels increased approximately 5 fold after rAAV8 M AAT treatment compared to the PBS control group (Fig 43B). By regression of M AAT level to Z AAT level, we also found the secretion of Z AAT is dosage dependent on M AAT secretion (R2 =0.495, p=0.01) at a molecular ratio close to 1:1 (slope=0.86, p<0.01). These results demonstrate the expression M AAT can increase the secretion of Z AAT and thus reduce the accumulation level in vivo. Improv ed Liver Function after rAAV8 M AAT T reatment To evaluate possible liver function improvement after M AAT treatment, we measured the mouse sera SGOT (serum glutamic oxaloacetic transaminase), SGPT (serum glutamic pyruvic transaminase), and GGT (gammaglutamyl transpeptidase) levels before and after rAAV8M AAT treatment. In the treatment group, the average SGOT level decreased from 30 U/L to 24U/L (p=0.04) (Fig 44A). The SOGT level returned to normal after treatment, according to the liver function board line level (21U/L
PAGE 87

87 GGT level changes in the AAV8EGFP control group (data no t shown). To evaluate whether the M AAT treatment improves liver fibrosis, we did a hydroxyproline assay and measured the positive cells in tri chromostaining of the mous e liver. No significant changes were observed after 12 weeks of rAAV8M AAT treatment. M AAT Reduces Z AAT Polymerization by ProteinProtein Interaction. Based on 1) our previous result that serum M AAT to Z AAT levels have a 1:1 molecular ratio and 2) the fact that the beta strand of unfolded Z AAT is unstable, we hypothesize that M and Z AAT form a dimer, terminating the characteristic Z AAT head to tail chain polymerization ( 13) To prove this hypothesis, we cotransfected FLAG tagged Z AAT an d 6XHis tagged M AAT into CHO cells and measured the colocalization of two protein species. As Figure 45A shows, only colocalized FLAG MAAT and 6XHis ZAAT show red fluorescence. Also the binding between M AAT and Z AAT reduces the polymerization of Z AAT in vitro, as shown in Fig 45B. Quantification of the polymer bands shows the total polymer AAT level in the M AAT + Z AAT group reduced by 90% compared to the Z AAT only group (Figure 45C). Discussion The data presented in this chapter proved AAV deliver ed M AAT could reduce the accumulation of Z AAT within the ER. The evidence from the transgenic PI*Z mouse demonstrates the secretion of Z AAT is correlated with secretion of M AAT in a 1:1 ratio. Furthermore, we have shown that M and Z AAT are co localize d within the cells. This discovery offers rAAV M AAT liver gene therapy three benefits. First, as it has been proved previously, it can increase the serum AAT to therapeutic levels ( 148) Therefore, the loss of function deficiency will be relieved w ith this treatment. Second, M AAT treatment can terminate the Z AAT accumulation and prevent ER stress This

PAGE 88

88 effect will cure the gain of toxic liver disease caused by Z AAT accumulation. Third, the increased level of Z AAT in the serum is useful in neutrali zing neutrophil elastase and decelerat ing the inflammatory destruction of COPD in PI ZZ patients although the Z AAT monomer has half the activity of M AAT O ur obser vation of the M and Z AAT co localization and pull down assay results suggest s a mechanism for this phenomenon (Figure 4 6 ). H owever, we may not exclude the involvement of other mechanisms, such as ER stress response pathways ( 39) ER associated degradation (ERAD) ( 37 166 ) by ubiquitination dependent or independent degradation, or proteasomal degradation ( 166 167 ) Also, autoph agy may be involved in degrading the mutant Z AAT through piecemeal digestion of insoluble aggregates retained in the ER ( 35, 108 ) ( 168) ( 169) All these possible mechanisms need to be further addressed in future studies. Accumulation of Z AAT polymers inside the ER is associated with activation of or ER overloading response, which can cause cellular proliferation, apoptosis, and cell death. In clinical setti ngs it is related to neonatal hepatitis ( 170 ) cirrhosis ( 171) and hepatocellular carcinoma ( 172 174 ) The PiZ tra nsgenic mouse was widely used as disease model for AAT deficiency studies. In this experiment, w e have shown that r AAVM AAT treatment significantly decreases intracellular globules, the aggregat ion of Z AAT polymers within the ER, and it decreases the SGOT, SGPT and GGT level s. The periportal fibrosis was observed within first few months in this model ( 175 ) However, hepatic fibrosis is the result of the wound healing response of the liver to repeated injury, which has considered being a passive and irreversible process ( 176178) W e didn t find significant reduction in the

PAGE 89

89 level s of fibrosis after M AAT treatment, this might due to low dosage or because the length of treatment too short to reverse liver fibrosis in PI*Z mice, therefore, long term observation and dosage escalation need to be tested in the future. In a ddition to the potential for treatment of liver disease in the PI ZZ patient, the M AAT may be a good helper in the treatment of other inclusion body diseases such as Huntingtons disease ( 179) and Parkinsons disease ( 180 181 )

PAGE 90

90 A. B. C. IF AT01 ( Z AAT ) AT01 ( rAAV1 M AAT ) Hu339 ( M AAT ) um X8000 X8000 X8000 0.5 m X40000 X40000 X40000 X150000 EM 2 m 20 m 20 m 20 m 2 m 2 m 0.5 m 0.5 m AAT Hu339 (M AAT) AT01 ( Z AAT) AT01 (rAAV1 M AAT) 52KDa Tubulin HU339 AT01 AT01 0 50 100 *** Relative Intracelluar AAT (%) +rAAV1-MAAT

PAGE 91

91 Fig ure 4 1. Intracellular Z AAT decreased after treatment with rAAV1M AAT. A) Immortalized hepatocytes from a PiZZ patient (AT01 cells expressing Z AAT only) were infected with M AAT expressing vector (rAAV1CB M AAT at MOI=1X106); noninfected AT01 and Hu339 cells (expressing M AAT only) were used as controls. Twenty four hours post infection, cells were fixed and subjected to detection of cellular Z AAT aggregation by immunohistochemistry (IHC) with polyclonal rabbit anti AAT and donkey anti rabbit FITC (Le ft), as well as by electron microscopy (EM) to show accumulated Z AAT globules. B) Western blot for cellular total AAT. Cell lysate from Hu339, AT01, or rAAV1MAAT infected AT01 cells was analyzed. Beta tubulin served as loading control. C) Comparison of groups based on Western blot quantification. Intracellular AAT from the AT01 control group was defined as 100%. (n=3 independent experiments; ***p<0.0001).

PAGE 92

92 A. B. C. AAV8-M-AAT AAV8-GFP 0 10 20 30 40Human AAT (Copy/Cell)*** C57/B6 ZAATtg rAAV8 GFP ZAAT tg rAAV8 M AAT 20 m 20 m 20 m 2m 2m 0.5 m 0.5 m 0.5 m X40000 2m IHC EM X8000 X8000 X40000 X40000 X8000 Relative Z-AAT (%) Total Z-AAT Polymer Z-AAT 0 50 100 150AAV8-GFP AAV8-MAAT ***

PAGE 93

93 Figure 4 2. The beneficial effects of M AAT gene therapy in Z AAT transgenic mice. Z AAT Transgenic mice were treated with rAAV8M AAT (n=5) or rAAV8 GFP (n=6) by portal vein injection at a dosage of 1x1011 virus genome (VG). Animals were euthanized 12 weeks post injection. A) Using Taqman gene expression assay, AAT DNA copy number was determined from 1mg of mouse liver tissue. B) Fixed liver sections were subjected to Z AAT specific immunohistochemistry (IHC) using mouse anti polymer Z AAT (ATZ11) (Left), and by electron microscopy (EM) to show the detailed intr acellular morphology of mouse hepatocytes (Middle & Right). The thick black arrows show intracellular globules of Z AAT; the white arrow shows a compressed nucleus; the thin black arrow shows a dilated rough ER. Immunohistochemistry (IHC) images were taken at 40X and EM images were taken at 8000X and 40,000X, respectively. C) Total human AAT and M AAT were measured in mouse liver tissue by ELISA. Z AAT was obtained by subtracting M AAT from total AAT (n=6, *p<0.05). Polymer Z AAT in liver tissue was measure d by polymer Z AAT specific antibody (ATZ11). The GFP control group was set as 100% (n=6, ***p<0.0001). The results were normalized with GAPDH activity in the lysate.

PAGE 94

94 Z-AAT (mg/ml) M-AAT ug/ml A. B. C. Figure 43. Serum AAT concentration after treated w ith rAAV8 M AAT. Total serum human AAT and M AAT (left panel) were measured by ELISA. Serum Z AAT (middle panel) was obtained by subtracting M AAT from total AAT (mean SEM; n=6). The corelation between serum levels of M AAT and Z AAT is shown in the rig ht panel: each point represents the weekly average serum M AAT and Z AAT concentrations in M AAT gene therapy treated group. 0 2 4 6 8 10 12 0 200 400 600 800 1000 WeeksM-AAT (ug/ml)rAAV8-MAAT rAAV8-GFP

PAGE 95

95 A. B. C. Figure 44. Improved liver function after rAAV8 M AAT treatment. Mouse serum samples pre and post 12 weeks of treatment from the rAAV8M AAT group were collected and assayed for A) serum glutamic oxaloacetic transaminase (SGOT), B) serum glutamic pyruvic transaminase (SGPT) and C) gammaglutamyl transpeptidase (GGT). (Mean SEM, *p<0.05) Pre Post 0 2 4 6 8 10 *GGT (IU/L) Pre Post 0 10 20 30 40*SGOT (IU/L) Pre Post 0 10 20 30 40*SGPT (IU/L)

PAGE 96

96 M Z M+Z 0 25 50 75 100 *** Relative Polymer Density (%) A. B. C. D. Figure 45 M AAT interacts with Z AAT. A) M AAT reduces Z AAT polymerization. Purified M AAT (0.3 mg/ lane) and Z AAT (0.1 mg/lane) were loaded. In M+Z samples, M AAT (0.3 mg0 and Z AAT (0.1 mg) were mixed in in a total subjected to a denaturing gel (for total AAT) and a nondenaturing gel (for polymer AAT). B) Quantitative analysis of polymer AAT signal in gels of Figure 3A by densitometry. Total polymer signal in Z AAT only samples was set as 100% (***p<0.0001). C) Colocalization of M AAT and Z AAT in CHO cells. The 6His tagged Z AAT and FLAG tagged M AAT (or FLAG tagged luciferase as a negative control) expression plasmids were cotransfected i nto CHO cells. The Duolink kit was used to detect colocalization of M AAT and Z AAT. Only co localized proteins can be detected by a red fluorophore probe (emission at 624nm). FLAG M: FLAG tagged M AAT, FLAG Luc: FLAG tagged Luciferase, His Z: 6 His tagg ed Z AAT. D) ZAAT pulled down together with M AAT. A 6 His tagged M AAT expression plasmid was transfected into mRFP Z AAT stable expression CHO cells for 48 hours (+). A 6His GFP plasmid was used as a negative control ( ). Cells were lysed in PBS and pas sed through a nickel column. Pre and post pull down lysate was subjected to a SDS PAGE gel and immunobloted with polyclonal rabbit anti AAT antibodies. M Z M+Z Total AAT Polymer AAT 470nm 624nm Merge FLAG M + HIS Z FLAG Luc + HIS Z 78KD + Pre + Post 52KD

PAGE 97

97 Figure 46 A schematic model showing M AAT enhances Z AAT secretion. Left, PiZZ hepatocytes have dilated ER and accumulated Z AAT. Only a small portion of monomer Z AAT is secreted. Right, M AAT expression from rAAV vector interacts with Z AAT, reduced Z AAT polymer, reduced ER stress and enhanced Z AAT secretion.

PAGE 98

98 CHAPTER 6 FINAL DISCUS SION AND FUTURE DIRE CTIONS Alpha1 antitrypsin deficiency has been discovered for more than 40 years. The genetic mutation induced lung disease has been efficiently countered with augmentation therapy; however the liver disease caused by the Z mutation is still an unsolved problem. In the recent two decades, strides have been made in dealing with liver disease using various approaches, including traditional chemical drugs like 4phenylbutyric acid (PBA) ( 182) or carbamazepine ( 123 ) and gene therapy ( 55, 57 ) In the meantime, studies on the basic mechanisms of such mutationinduced liver disease provide a steady foundation for therapeutic development. In the chapters present ed in this dissertation, we start the journey understanding the basic mechanisms of liver disease caused by mutant Z AAT ( C hapter 2) and then try to develop therapies based on these mechanism s (Chapter 3 and 4) First, we ask what pathways will be involved with aggregationprone Z mutation. After comparing the gene expression profiles between AT01 and Hu339 cells, we found unfolded protein response (UPR) and NF important pathways to maintain the cells dynamics. The literature indicates that the second hit which causes the imbalance between aggregation and the degradation process might be the direct cause of liver disease ( 25 37 ) The conclusions we generated from the mechanism studies enlightened our path to finding suitable therapeutic treatments. It tells us that the essence of the potential treatments should aim to restore balance within the cell. To achieve this goal, we have three options. Option 1: destroy the mutant Z AAT; Option 2: facilitate and form correct folding; Option 3: increase secretion of Z AAT. These three options are not mutually

PAGE 99

99 exclu sive. The data presented in C hapter 3 provides good support for Option 1. Compared to inducing a generous degradation system like autophagy or ERAD, the scFv project has several advantages. First, scFv target is very specific, so the collateral damage to other functional proteins is minimized. Second, the artificial construct is upgradable. Since the functional groups of our scFv FKBP12 are distinct, each part is interchangeable for a better functional group in the future research. Third, the construct is a very small fragment that can be easily packed into an AAV virus for safe and efficient delivery. The AAV delivered M AAT gene therapy we presented in C hapter 4 is not new for treating AATD lung disease. However, our results suggest that such therapy can do more than just provide M AAT to the serum if delivered to the liver though portal vein injection. We demonstrated that overexpressed M AAT can reduce aggregation within the ER of hepatocytes by increasing the secretion of mutant Z AAT in the mouse serum. We also provided evidence of a possible mechanism for this treatment in which M AAT binds to Z AAT and terminates polymerization. This therapeutic approach adopted Option 3 above and proved it is a feasible way to cure Z AAT induced disease. These two th erapeutic approaches look very exciting to us; however, there is still a long way to go before putting them into clinical studies. In the scFv project, we are eager to see how effective this treatment will be in the transgenic Z mouse. Since we have already established an effective portal vein injection procedure, delivery of this gene will not be an obstacle for us. Also, more detailed mechanism studies are needed for understanding the polymer inhibition and degradation process during the event. How the sc Fv FKBP12 Z AAT complex gets transported outside the ER is essential to these

PAGE 100

100 studies. As mentioned above, the structure of scFv FKBP12wt is interchangeable; therefore, we could expect the current scFv could be replaced by a better one that only recognizes Z AAT. This will permanently reduce the effect of scFv on normal M AAT. In the M AAT gene therapy studies, safety is on the top of the list to investigate. The good news is that muscle M AAT gene therapy has entered phase II clinical trials and no signifi cant side effects have been observed ( 51) Meanwhile, similar to the scFv project, we need to understand how M and Z bind to each other and in what conditions th ey will bind. To solve this problem, crystallization structure of an M and Z mixture may provide the answer to this question. I first started my research project in Dr. Brantlys lab focusing on basic mechanisms such as autophagy and UPR. After acquiring results from these projects, I started to think about how to utilize this basic understanding for development of therapeutic treatment. Fortunately, the collaboration we made with Dr. Dunns lab, Dr. Songs lab, and Dr. Goldes lab provided me with fresh new thoughts and upto date techniques that brought me closer to my goal. Through the journey of four years studying for my Ph.D., I found that the ultimate desire for the unknown is the force that drives me all the way. This force will accompany me through my career. May the force be with you!

PAGE 101

101 APPENDIX PLASMID CONSTRUCTS Plasmid maps of the vectors used in these experiments. Regions designations are: pCB= Chicken Betaactin promoter, TK=thymidine kinase promoter, Amp=ampicillin resistance g ene. BGH= bovine growth hormone polyA signal. pGEM-TK-ZAAT7681 bp Amp(R) SP6 T/C INIT T7 T/C INIT LAC OPERON BGH pA BGH reverse primer TK promoter T7 P SP6 P Z-AAT Xma I (27) Eco RI (11) Eco RI (209) Eco RI (3438) Hin dIII (313) Hin dIII (3542) Hin dIII (4872) pSecTag2-scFv6417 bp Amp Hygromycine ScFv CAG enhancer CMV fwd primer IgK secretion Myc 6xHIS BGH rev primer pBABE 3 primer SV40 enhancer SV40pro F primer EBV rev primer M13 pUC rev primer CMV immearly promoter T7 promoter SV40 promoter M13 reverse primer lac promoter AmpR promoter f1 origin SV40 origin pBR322 origin bGH PA terminator SV40 PA terminator pCR3.1-mRFP-ZAAT7046 bp mRFP-Z-AAT Kan/Neo ORF frame 2 CAG enhancer CMV fwd primer BGH rev primer SV40pro F primer pBABE 3 primer CMV immearly promoter T7 promoter SV40 promoter AmpR promoter pBR322 origin SV40 origin f1 origin bGH PA terminator TK PA terminator pCB-M-AAT7404 bp ORF frame 1 M-AAT Amp CAG enhancer pCAG F primer EBV rev primer pGEX 3 primer AmpR promoter f1 origin pBR322 origin SV40 PA terminator Cla I (4394) Eco RI (2033) Hin dIII (2045) Not I (4156) Bam HI (2170) Bam HI (2176) Bam HI (2860) Sma I (86) Sma I (97) Sma I (2504) Sma I (4152) Sma I (4472) Sma I (4483)

PAGE 102

102 LIST OF REFERENCES 1. Sandhaus RA. alpha1Antitrypsin deficiency 6: new and emerging treatments for alpha1antitrypsin deficiency. Thorax 2004;59:904909. 2. Beatty K, Bieth J, Travis J. K inetics of association of serine proteinases with native and oxidized alpha1 proteinase inhibitor and alpha1 antichymotrypsin. J Biol Chem 1980;255:39313934. 3. Perlino E, Cortese R, Ciliberto G. The human alpha 1antitrypsin gene is transcribed from tw o different promoters in macrophages and hepatocytes. EMBO J 1987;6:27672771. 4. Carrell RW, Jeppsson JO, Laurell CB, Brennan SO, Owen MC, Vaughan L, Boswell DR. Structure and variation of human alpha 1antitrypsin. Nature 1982;298:329334. 5. Mega T, Luj an E, Yoshida A. Studies on the oligosaccharide chains of human alpha 1protease inhibitor. II. Structure of oligosaccharides. J Biol Chem 1980;255:40574061. 6. Crystal RG. The alpha 1antitrypsin gene and its deficiency states. Trends Genet 1989;5:411417. 7. Brantly M, Nukiwa T, Crystal RG. Molecular basis of alpha1 antitrypsin deficiency. Am J Med 1988;84:1331. 8. Bryan CL, Beard KS, Pott GB, Rahkola J, Gardner EM, Janoff EN, Shapiro L. HIV infection is associated with reduced serum alpha1 antitrypsi n concentrations. Clinical and Investigative Medicine 2010;33:E384E389. 9. Laurell CB, Eriksson S. Electrophoretic Alpha1Globulin Pattern of Serum in Alpha1Antitrypsin Deficiency. Scandinavian Journal of Clinical & Laboratory Investigation 1963;15:132& 10. Carrell RW. What we owe to alpha(1) antitrypsin and to Carl Bertil Laurell. COPD 2004;1:7184. 11. Jeppsson JO. AminoAcid Substitution Glu]Lys in Alpha1 Antitrypsin Piz. FEBS Lett 1976;65:195197. 12. Roussel BD, Irving JA, Ekeowa UI, Belorgey D, Haq I, Ordonez A, Kruppa AJ, et al. Unravelling the twists and turns of the serpinopathies. Febs Journal 2011;278:38593867.

PAGE 103

103 13. Yamasaki M, Sendall TJ, Harris LE, Lewis GM, Huntington JA. Loopsheet mechanism of serpin polymerization tested by reactive center loop mutations. J Biol Chem 2010;285:3075230758. 14. Yamasaki M, Li W, Johnson DJ, Huntington JA. Crystal structure of a stable dimer reveals the molecular basis of serpin polymerization. Nature 2008;455:12551258. 15. Sveger T. Liver disease in alpha1 antitrypsin deficiency detected by screening of 200,000 infants. N Engl J Med 1976;294:1316 1321. 16. O'Brien ML, Buist NR, Murphey WH. Neonatal screening for alpha1antitrypsin deficiency. J Pediatr 1978;92:10061010. 17. Silverman EK, Miletich JP, Pie rce JA, Sherman LA, Endicott SK, Broze GJ, Jr., Campbell EJ. Alpha 1 antitrypsin deficiency. High prevalence in the St. Louis area determined by direct population screening. Am Rev Respir Dis 1989;140:961966. 18. Ekeowa UI, Gooptu B, Belorgey D, Hagglof P Karlsson Li S, Miranda E, Perez J, et al. alpha1Antitrypsin deficiency, chronic obstructive pulmonary disease and the serpinopathies. Clin Sci (Lond) 2009;116:837850. 19. Kopito RR, Ron D. Conformational disease. Nat Cell Biol 2000;2:E207209. 20. Lieberman J, Winter B, Sastre A. Alpha 1antitrypsin Pi types in 965 COPD patients. Chest 1986;89:370373. 21. Demeo DL, Sandhaus RA, Barker AF, Brantly ML, Eden E, McElvaney NG, Rennard S, et al. Determinants of airflow obstruction in severe alpha 1 antitryps in deficiency. Thorax 2007;62:806813. 22. Ellgaard L, Helenius A. ER quality control: towards an understanding at the molecular level. Current Opinion in Cell Biology 2001;13:431437. 23. Kumar MB, Potter DW, Hormann RE, Edwards A, Tice CM, Smith HC, Dipi etro MA, et al. Highly flexible ligand binding pocket of ecdysone receptor Nonsteroidal ecdysone agonists. Journal of Biological Chemistry 2004;279:2721127218. 24. Stolk J, Seersholm N, Kalsheker N. Alpha1antitrypsin deficiency: current perspective on research, diagnosis, and management. Int J Chron Obstruct Pulmon Dis 2006;1:151160. 25. Sifers RN. Intracellular processing of alpha1antitrypsin. Proc Am Thorac Soc 2010;7:376380.

PAGE 104

104 26. Wu Y, Swulius MT, Moremen KW, Sifers RN. Elucidation of the molecular logic by which misfolded alpha 1antitrypsin is preferentially selected for degradation. Proc Natl Acad Sci U S A 2003;100:82298234. 27. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 2007;8:519529. 28. Yoshida H. ER stress and diseases. Febs Journal 2007;274:630658. 29. Fewell SW, Travers KJ, Weissman JS, Brodsky JL. The action of molecular chaperones in the early secretory pathway. Annu Rev Genet 2001;35:149191. 30. Yoshida H, Matsui T, Hosokawa N, Kaufman RJ, Nagata K, Mori K. A timedependent phase shift in the mammalian unfolded protein response. Dev Cell 2003;4:265271. 31. Klionsky DJ, Emr SD. Autophagy as a regulated pathway of cellular degradation. Science 2000;290:17171721. 32. Reggiori F, Klionsky DJ. Autophagy in the eukaryotic cell. Eukaryot Cell 2002;1:1121. 33. Teckman JH, Perlmutter DH. Retention of mutant alpha(1) antitrypsin Z in endoplasmic reticulum is associated with an autophagic response. Am J Physiol Gastrointest Liver Physiol 2000;279:G961974. 34. Kamimoto T, Shoji S, Hidvegi T, Mizushima N, Umebayashi K, Perlmutter DH, Yoshimori T. Intracellular inclusions containing mutant alpha1antitrypsin Z are propagated in the absence of autophagic activity. J Biol Chem 2006;281:44674476. 35. Kroeger H, Miranda E, MacLeod I, Perez J, Crowther DC, Marciniak SJ, Lomas DA. Endoplasmic reticulum associated degradation (ERAD) and autophagy cooperate to degrade polymerogenic mutant serpins. J Biol Chem 2009;284:2279322802. 36. Pahl HL, Baeuerle PA. A novel signal transduction pathway from the endoplasmic reticulum to the nucleus is mediated by transcription factor NF kappa B. EMBO J 1995;14:25802588. 37. Lawless MW, Greene CM, Mulgrew A, Taggart CC, O'Neill SJ, McElvaney NG. A ctivation of endoplasmic reticulum specific stress responses associated with the conformational disease Z alpha 1antitrypsin deficiency. J Immunol 2004;172:57225726.

PAGE 105

105 38. Kirnbauer R, Charvat B, Schauer E, Kock A, Urbanski A, Forster E, Neuner P, et al. M odulation of intercellular adhesion molecule1 expression on human melanocytes and melanoma cells: evidence for a regulatory role of IL6, IL 7, TNF beta, and UVB light. J Invest Dermatol 1992;98:320326. 39. Hidvegi T, Schmidt BZ, Hale P, Perlmutter DH. A ccumulation of mutant alpha1antitrypsin Z in the endoplasmic reticulum activates caspases 4 and 12, NFkappaB, and BAP31 but not the unfolded protein response. J Biol Chem 2005;280:3900239015. 40. Miller SD, Greene CM, McLean C, Lawless MW, Taggart CC, O 'Neill SJ, McElvaney NG. Tauroursodeoxycholic acid inhibits apoptosis induced by Z alpha1 antitrypsin via inhibition of Bad. Hepatology 2007;46:496503. 41. Nakagawa T, Zhu H, Morishima N, Li E, Xu J, Yankner BA, Yuan J. Caspase12 mediates endoplasmic re ticulum specific apoptosis and cytotoxicity by amyloidbeta. Nature 2000;403:98103. 42. Wewers MD, Casolaro MA, Sellers SE, Swayze SC, Mcphaul KM, Wittes JT, Crystal RG. Replacement Therapy for Alpha1 Antitrypsin Deficiency Associated with Emphysema. New England Journal of Medicine 1987;316:1055 1062. 43. Wencker M, Banik N, Buhl R, Seidel R, Konietzko N. Long term treatment of alpha1antitrypsin deficiency related pulmonary emphysema with human alpha1antitrypsin. Wissenschaftliche Arbeitsgemeinschaft zur Therapie von Lungenerkrankungen (WATL) alpha1AT study group. Eur Respir J 1998;11:428433. 44. Stoller JK, Fallat R, Schluchter MD, O'Brien RG, Connor JT, Gross N, O'Neil K, et al. Augmentation therapy with alpha1antitrypsin: patterns of use and advers e events. Chest 2003;123:14251434. 45. Courtney M, Jallat S, Tessier LH, Benavente A, Crystal RG, Lecocq JP. Synthesis in E. coli of alpha 1antitrypsin variants of therapeutic potential for emphysema and thrombosis. Nature 1985;313:149151. 46. Cabezon T De Wilde M, Herion P, Loriau R, Bollen A. Expression of human alpha 1antitrypsin cDNA in the yeast Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 1984;81:65946598. 47. Carver AS, Dalrymple MA, Wright G, Cottom DS, Reeves DB, Gibson YH, Keenan JL, et al. Transgenic livestock as bioreactors: stable expression of human alpha1 antitrypsin by a flock of sheep. Biotechnology (N Y) 1993;11:12631270.

PAGE 106

106 48. Wood AM, Stockley RA. Alpha one antitrypsin deficiency: from gene to treatment. Respiration 2007;74:481 492. 49. Lu Y, Choi YK, Campbell Thompson M, Li C, Tang Q, Crawford JM, Flotte TR, et al. Therapeutic level of functional human alpha 1 antitrypsin (hAAT) secreted from murine muscle transduced by adenoassociated virus (rAAV1) vector. J Gene Med 2006;8: 730735. 50. Flotte TR, Brantly ML, Spencer LT, Byrne BJ, Spencer CT, Baker DJ, Humphries M. Phase I trial of intramuscular injection of a recombinant adenoassociated virus alpha 1antitrypsin (rAAV2 CB hAAT) gene vector to AAT deficient adults. Hum Gene Ther 2004;15:93128. 51. Flotte TR, Trapnell BC, Humphries M, Carey B, Calcedo R, Rouhani F, Campbell Thompson M, et al. Phase 2 clinical trial of a recombinant adenoassociated viral vector expressing alpha1antitrypsin: interim results. Hum Gene Ther 201 1;22:12391247. 52. Zern MA, Ozaki I, Duan L, Pomerantz R, Liu SL, Strayer DS. A novel SV40based vector successfully transduces and expresses an alpha 1antitrypsin ribozyme in a human hepatomaderived cell line. Gene Ther 1999;6:114120. 53. Fire A, Xu S Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by doublestranded RNA in Caenorhabditis elegans. Nature 1998;391:806811. 54. Grimm D, Streetz KL, Jopling CL, Storm TA, Pandey K, Davis CR, Marion P, et al. Fatalit y in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 2006;441:537541. 55. Mueller C, Tang Q, Gruntman A, Blomenkamp K, Teckman J, Song L, Zamore PD, et al. Sustained miRNA mediated knockdown of mutant AAT with simultaneo us augmentation of wildtype AAT has minimal effect on global liver miRNA profiles. Mol Ther 2012;20:590600. 56. Li H, Lu Y, Witek RP, Chang LJ, Campbell Thompson M, Jorgensen M, Petersen B, et al. Ex vivo transduction and transplantation of bone marrow c ells for liver gene delivery of alpha1antitrypsin. Mol Ther 2010;18:15531558. 57. Ding J, Yannam GR, Roy Chowdhury N, Hidvegi T, Basma H, Rennard SI, Wong RJ, et al. Spontaneous hepatic repopulation in transgenic mice expressing mutant human alpha1antit rypsin by wildtype donor hepatocytes. J Clin Invest 2011;121:19301934.

PAGE 107

107 58. Rashid ST, Corbineau S, Hannan N, Marciniak SJ, Miranda E, Alexander G, Huang Doran I, et al. Modeling inherited metabolic disorders of the liver using human induced pluripotent s tem cells. Journal of Clinical Investigation 2010;120:31273136. 59. Kaushal S, Annamali M, Blomenkamp K, Rudnick D, Halloran D, Brunt EM, Teckman JH. Rapamycin reduces intrahepatic alpha1 antitrypsin mutant Z protein polymers and liver injury in a mouse model. Experimental Biology and Medicine 2010;235:700709. 60. Hidvegi T, Ewing M, Hale P, Dippold C, Beckett C, Kemp C, Maurice N, et al. An Autophagy Enhancing Drug Promotes Degradation of Mutant alpha 1Antitrypsin Z and Reduces Hepatic Fibrosis. Scienc e 2010;329:229232. 61. Teckman JH. Lack of effect of oral 4phenylbutyrate on serum alpha1 antitrypsin in patients with alpha1 antitrypsin deficiency: A preliminary study. Journal of Pediatric Gastroenterology and Nutrition 2004;39:3437. 62. Mallyat M, Phillips RL, Saldanha SA, Gooptu B, Brown SCL, Termine DJ, Shirvani AM, et al. Small molecules block the polymerization of Z alpha(1) antitrypsin and increase the clearance of intracellular aggregates. J Med Chem 2007;50:53575363. 63. Capecchi MR. Gene t argeting in mice: functional analysis of the mammalian genome for the twenty first century. Nat Rev Genet 2005;6:507512. 64. Carroll D. Genome engineering with zinc finger nucleases. Genetics 2011;188:773782. 65. Latt SA. Sister chromatid exchange format ion. Annu Rev Genet 1981;15:1155. 66. Lange CS, Mayer PJ, Reddy NM. Tests of the doublestrand break, lethal potentially lethal and repair misrepair models for mammalian cell survival using data for survival as a function of delayedplating interval for l og phase Chinese hamster V79 cells. Radiat Res 1997;148:285 292. 67. Langerak P, Russell P. Regulatory networks integrating cell cycle control with DNA damage checkpoints and doublestrand break repair. Philos Trans R Soc Lond B Biol Sci 2011;366:35623571. 68. Rouet P, Smih F, Jasin M. Introduction of doublestrand breaks into the genome of mouse cells by expression of a rarecutting endonuclease. Mol Cell Biol 1994;14:80968106. 69. Li L, Wu LP, Chandrasegaran S. Functional domains in Fok I restriction endonuclease. Proc Natl Acad Sci U S A 1992;89:42754279.

PAGE 108

108 70. Pavletich NP, Pabo CO. Zinc finger DNA recognition: crystal structure of a Zif268 DNA complex at 2.1 A. Science 1991;252:809817. 71. Bitinaite J, Wah DA, Aggarwal AK, Schildkraut I. FokI dimerization is required for DNA cleavage. Proc Natl Acad Sci U S A 1998;95:1057010575. 72. Bibikova M, Golic M, Golic KG, Carroll D. Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc finger nucleases. Genetics 2002;161:11691175. 73. Beumer KJ, Trautman JK, Bozas A, Liu JL, Rutter J, Gall JG, Carroll D. Efficient gene targeting in Drosophila by direct embryo injection with zinc finger nucleases. Proc Natl Acad Sci U S A 2008;105:1982119826. 74. Geurts AM, Cost GJ, Freyvert Y, Zeitler B, Mill er JC, Choi VM, Jenkins SS, et al. Knockout rats via embryo microinjection of zinc finger nucleases. Science 2009;325:433. 75. Meyer M, de Angelis MH, Wurst W, Kuhn R. Gene targeting by homologous recombination in mouse zygotes mediated by zinc finger nucl eases. Proc Natl Acad Sci U S A 2010;107:1502215026. 76. Carbery ID, Ji D, Harrington A, Brown V, Weinstein EJ, Liaw L, Cui X. Targeted genome modification in mice using zinc finger nucleases. Genetics 2010;186:451459. 77. Cui X, Ji D, Fisher DA, Wu Y, B riner DM, Weinstein EJ. Targeted integration in rat and mouse embryos with zinc finger nucleases. Nature Biotechnology 2011;29:6467. 78. Lloyd A, Plaisier CL, Carroll D, Drews GN. Targeted mutagenesis using zinc finger nucleases in Arabidopsis. Proc Natl Acad Sci U S A 2005;102:22322237. 79. Porteus MH, Baltimore D. Chimeric nucleases stimulate gene targeting in human cells. Science 2003;300:763. 80. Urnov FD, Miller JC, Lee YL, Beausejour CM, Rock JM, Augustus S, Jamieson AC, et al. Highly efficient endo genous human gene correction using designed zinc finger nucleases. Nature 2005;435:646651. 81. Alwin S, Gere MB, Guhl E, Effertz K, Barbas CF, 3rd, Segal DJ Weitzman MD, et al. Custom zinc finger nucleases for use in human cells. Mol Ther 2005;12:610617

PAGE 109

109 82. Perez EE, Wang J, Miller JC, Jouvenot Y, Kim KA, Liu O, Wang N, et al. Establishment of HIV 1 resistance in CD4+ T cells by genome editing using zinc finger nucleases. Nature Biotechnology 2008;26:808816. 83. Gregory P, Reik A, Zhou YY, Hamlett A, W agner J, Mendel M, Liu PQ, et al. Zinc finger nucleases targeting the glucocorticoid receptor allow IL13 zetakine transgenic CTLs to kill glioblastoma cells in vivo in the presence of immunosuppressive glucocorticoids. Hum Gene Ther 2008;19:10841084. 84. Holt N, Wang J, Kim K, Friedman G, Wang X, Taupin V, Crooks GM, et al. Human hematopoietic stem/progenitor cells modified by zinc finger nucleases targeted to CCR5 control HIV 1 in vivo. Nature Biotechnology 2010;28:839847. 85. Urnov FD, Rebar EJ, Holmes MC, Zhang HS, Gregory PD. Genome editing with engineered zinc finger nucleases. Nature Reviews Genetics 2010;11:636646. 86. Moore M, Klug A, Choo Y. Improved DNA binding specificity from polyzinc finger peptides by using strings of twofinger units. Proc Natl Acad Sci U S A 2001;98:14371441. 87. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, Lahaye T, et al. Breaking the Code of DNA Binding Specificity of TALType III Effectors. Science 2009;326:15091512. 88. Miller JC, Tan S, Qiao G, Barlow KA, Wang J, Xia DF, Meng X, et al. A TALE nuclease architecture for efficient genome editing. Nature Biotechnology 2011;29:143148. 89. Kiefer JC. Primer and interviews: promises and realities of induced pluripotent stem cells. Dev Dyn 2011;240:20342041. 90. Maynard J, Georgiou G. Antibody engineering. Annual Review of Biomedical Engineering 2000;2:339376. 91. Donzeau M, Knappik A. Recombinant monoclonal antibodies. Methods Mol Biol 2007;378:1431. 92. Holliger P, Hudson PJ. Engineered antibody fragments and the rise of single domains. Nature Biotechnology 2005;23:11261136. 93. Porter RR. The hydrolysis of rabbit y globulin and antibodies with crystalline papain. Biochem J 1959;73:119126. 94. Weisser NE, Hall JC. Applications of single chain variable fr agment antibodies in therapeutics and diagnostics. Biotechnol Adv 2009;27:502520.

PAGE 110

110 95. Gilliland LK, Norris NA, Marquardt H, Tsu TT, Hayden MS, Neubauer MG, Yelton DE, et al. Rapid and reliable cloning of antibody variable regions and generation of recombi nant single chain antibody fragments. Tissue Antigens 1996;47:120. 96. McCafferty J, Griffiths AD, Winter G, Chiswell DJ. Phage antibodies: filamentous phage displaying antibody variable domains. Nature 1990;348:552554. 97. Hanes J, Pluckthun A. In vitro selection and evolution of functional proteins by using ribosome display. Proc Natl Acad Sci U S A 1997;94:49374942. 98. He M, Taussig MJ. Antibody ribosomemRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antib ody combining sites. Nucleic Acids Res 1997;25:51325134. 99. Francisco JA, Campbell R, Iverson BL, Georgiou G. Production and fluorescence activated cell sorting of Escherichia coli expressing a functional antibody fragment on the external surface. Proc N atl Acad Sci U S A 1993;90:1044410448. 100. Hoogenboom HR. Selecting and screening recombinant antibody libraries. Nature Biotechnology 2005;23:11051116. 101. Ferl GZ, Kenanova V, Wu AM, DiStefano JJ, 3rd. A twotiered physiologically based model for dually labeled single chain Fv Fc antibody fragments. Mol Cancer Ther 2006;5:15501558. 102. Jain M, Chauhan SC, Singh AP, Venkatraman G, Colcher D, Batra SK. Penetratin improves tumor retention of singlechain antibodies: a novel step toward optimization of radioimmunotherapy of solid tumors. Cancer Res 2005;65:78407846. 103. Pastan I, Hassan R, FitzGerald DJ, Kreitman RJ. Immunotoxin treatment of cancer. Annu Rev Med 2007;58:221237. 104. Yang ZR, Wang HF, Zhao J, Peng YY, Wang J, Guinn BA, Huang LQ. Recent developments in the use of adenoviruses and immunotoxins in cancer gene therapy. Cancer Gene Therapy 2007;14:599615. 105. Wolfgang WJ, Miller TW, Webster JM, Huston JS, Thompson LM, Marsh JL, Messer A. Suppression of Huntington's disease pathology in Drosophila by human singlechain Fv antibodies. Proc Natl Acad Sci U S A 2005;102:1156311568. 106. Lynch SM, Zhou C, Messer A. An scFv intrabody against the nonamyloid component of alphasynuclein reduces intracellular aggregation and toxicity. J Mol Biol 20 08;377:136 147.

PAGE 111

1 11 107. Paganetti P, Calanca V, Galli C, Stefani M, Molinari M. betasite specific intrabodies to decrease and prevent generation of Alzheimer's Abeta peptide. J Cell Biol 2005;168:863 868. 108. Perlmutter DH. Alpha 1 antitrypsin deficiency: i mportance of proteasomal and autophagic degradative pathways in disposal of liver diseaseassociated protein aggregates. Annu Rev Med 2011;62:333345. 109. Gomez Lechon MJ, Lopez P, Donato T, Montoya A, Larrauri A, Gimenez P, Trullenque R, et al. Culture of human hepatocytes from small surgical liver biopsies. Biochemical characterization and comparison with in vivo. In Vitro Cell Dev Biol 1990;26:6774. 110. Strom SC, Jirtle RL, Jones RS, Novicki DL, Rosenberg MR, Novotny A, Irons G, et al. Isolation, culture, and transplantation of human hepatocytes. J Natl Cancer Inst 1982;68:771778. 111. Schmidt BZ, Perlmutter DH. Grp78, Grp94, and Grp170 interact wi th alpha1antitrypsin mutants that are retained in the endoplasmic reticulum. American journal of physiology. Gastrointestinal and liver physiology 2005;289:G444455. 112. Bernales S, McDonald KL, Walter P. Autophagy counterbalances endoplasmic reticulum expansion during the unfolded protein response. PLoS Biol 2006;4:e423. 113. An JK, Blomenkamp K, Lindblad D, Teckman JH. Quantitative isolation of alphalAT mutant Z protein polymers from human and mouse livers and the effect of heat. Hepatology 2005;41:160167. 114. Rudnick DA, Shikapwashya O, Blomenkamp K, Teckman JH. Indomethacin increases liver damage in a murine model of liver injury from alpha1 antitrypsin deficiency. Hepatology 2006;44:976982. 115. Cruz PE, Mueller C, Cossette TL, Golant A, Tang Q, B eattie SG, Brantly M, et al. In vivo post transcriptional gene silencing of alpha1 antitrypsin by adenoassociated virus vectors expressing siRNA. Laboratory investigation; a journal of technical methods and pathology 2007;87:893902. 116. Janciauskiene S Dominaitiene R, Sternby NH, Piitulainen E, Eriksson S. Detection of circulating and endothelial cell polymers of Z and wild type alpha 1antitrypsin by a monoclonal antibody. J Biol Chem 2002;277:2654026546. 117. Moroz SP, Cutz E, Cox DW, Sass Kortsak A Liver disease associated with alpha1antitrypsin deficiency in childhood. Journal of Pediatrics 1976;88:1925.

PAGE 112

112 118. Carroll TP, Greene CM, O'Connor CA, Nolan AM, O'Neill SJ, McElvaney NG. Evidence for unfolded protein response activation in monocytes fro m individuals with alpha1 antitrypsin deficiency. Journal of immunology 2010;184:45384546. 119. Ji C, Kaplowitz N, Lau MY, Kao E, Petrovic LM, Lee AS. Liver specific loss of GRP78 perturbs globally unfolded protein response and exacerbates a spectrum of acute and chronic liver diseases. Hepatology 2011. 120. Pfaffenbach KT, Lee AS. The critical role of GRP78 in physiologic and pathologic stress. Current opinion in cell biology 2011;23:150156. 121. Kammoun HL, Chabanon H, Hainault I, Luquet S, Magnan C, K oike T, Ferre P, et al. GRP78 expression inhibits insulin and ER stress induced SREBP 1c activation and reduces hepatic steatosis in mice. The Journal of clinical investigation 2009;119:12011215. 122. Wu Y, Whitman I, Molmenti E, Moore K, Hippenmeyer P, P erlmutter DH. A lag in intracellular degradation of mutant alpha 1antitrypsin correlates with the liver disease phenotype in homozygous PiZZ alpha 1antitrypsin deficiency. Proceedings of the National Academy of Sciences of the United States of America 19 94;91:9014 9018. 123. Hidvegi T, Ewing M, Hale P, Dippold C, Beckett C, Kemp C, Maurice N, et al. An autophagy enhancing drug promotes degradation of mutant alpha1antitrypsin Z and reduces hepatic fibrosis. Science 2010;329:229232. 124. Lawless MW, Manka n AK, Gray SG, Norris S. Endoplasmic reticulum stress --a double edged sword for Z alpha1 antitrypsin deficiency hepatoxicity. The international journal of biochemistry & cell biology 2008;40:14031414. 125. Lin JH, Walter P, Yen TS. Endoplasmic reticulum stress in disease pathogenesis. Annual review of pathology 2008;3:399425. 126. Hidvegi T, Schmidt BZ, Hale P, Perlmutter DH. Accumulation of mutant alpha1antitrypsin Z in the endoplasmic reticulum activates caspases 4 and 12, NFkappaB, and BAP31 but not the unfolded protein response. The Journal of biological chemistry 2005;280:3900239015. 127. Kruse KB, Brodsky JL, McCracken AA. Autophagy: an ER protein quality control process. Autophagy 2006;2:135137. 128. Parfrey H, Mahadeva R, Ravenhill NA, Zhou A, Dafforn TR, Foreman RC, Lomas DA. Targeting a surface cavity of alpha 1antitrypsin to prevent conformational disease. J Biol Chem 2003;278:3306033066.

PAGE 113

113 129. Mahadeva R, Dafforn TR, Carrell RW, Lomas DA. 6mer peptide selectively anneals to a pathogenic s erpin conformation and blocks polymerization. Implications for the prevention of Z alpha(1) antitrypsin related cirrhosis. J Biol Chem 2002;277:67716774. 130. Mallya M, Phillips RL, Saldanha SA, Gooptu B, Brown SC, Termine DJ, Shirvani AM, et al. Small mo lecules block the polymerization of Z alpha1antitrypsin and increase the clearance of intracellular aggregates. J Med Chem 2007;50:53575363. 131. Rajpal A, Turi TG. Intracellular stability of anti caspase 3 intrabodies determines efficacy in retargeting the antigen. J Biol Chem 2001;276:3313933146. 132. Brown S, Dilley J, Levy R. Immunoglobulin secretion by mouse X human hybridomas: an approach for the production of anti idiotype reagents useful in monitoring patients with B cell lymphoma. J Immunol 1980;125:1037 1043. 133. Lomas DA. Parker B. Francis lectureship. Antitrypsin deficiency, the serpinopathies, and chronic obstructive pulmonary disease. Proc Am Thorac Soc 2006;3:499501. 134. Xiao K, Wang L, McAndrew E, Rouhani F, Brantly M. Unfolded Protein Response and Autophagy Behave as Complement Pathways to Dispose ZAAT in Hepatocytes. In: Molecular Biology of the Cell; 2010. p. 3056. 135. Bauer PO, Goswami A, Wong HK, Okuno M, Kurosawa M, Yamada M, Miyazaki H, et al. Harnessing chaperonemediated autoph agy for the selective degradation of mutant huntingtin protein. Nature Biotechnology 2010;28:256263. 136. Schneekloth JS, Jr., Fonseca FN, Koldobskiy M, Mandal A, Deshaies R, Sakamoto K, Crews CM. Chemical genetic control of protein levels: selective in v ivo targeted degradation. J Am Chem Soc 2004;126:37483754. 137. Munro S, Pelham HR. A C terminal signal prevents secretion of luminal ER proteins. Cell 1987;48:899907. 138. Banaszynski LA, Chen LC, MaynardSmith LA, Ooi AGL, Wandless TJ. A rapid, reversi ble, and tunable method to regulate protein function in living cells using synthetic small molecules. Cell 2006;126:995 1004. 139. Cao W, Konsolaki M. FKBP immunophilins and Alzheimer's disease: a chaperoned affair. J Biosci 2011;36:493498. 140. Gooptu B, Ekeowa UI, Lomas DA. Mechanisms of emphysema in alpha1antitrypsin deficiency: molecular and cellular insights. Eur Respir J 2009;34:475488.

PAGE 114

114 141. Davies MJ, Miranda E, Roussel BD, Kaufman RJ, Marciniak SJ, Lomas DA. Neuroserpin polymers activate NF kappa B by a calcium signaling pathway that is independent of the unfolded protein response. J Biol Chem 2009;284:1820218209. 142. Zhou A, Stein PE, Huntington JA, Sivasothy P, Lomas DA, Carrell RW. How small peptides block and reverse serpin polymerisation. J Mol Biol 2004;342:931941. 143. Lawless MW, Mankan AK, Gray SG, Norris S. Endoplasmic reticulum stress --a double edged sword for Z alpha1 antitrypsin deficiency hepatoxicity. Int J Biochem Cell Biol 2008;40:14031414. 144. Cruz PE, Mueller C, Cossette TL, Golant A, Tang Q, Beattie SG, Brantly M, et al. In vivo post transcriptional gene silencing of alpha1 antitrypsin by adenoassociated virus vectors expressing siRNA. Lab Invest 2007;87:893902. 145. Levites Y, Jansen K, Smithson LA, Dakin R, Holloway VM, Das P, Golde TE. Intracranial adenoassociated virus mediated delivery of anti pan amyloid beta, amyloid beta40, and amyloid beta42 singlechain variable fragments attenuates plaque pathology in amyloid precursor protein mice. J Neurosci 2006;26:11923119 28. 146. Messer A, McLear J. The therapeutic potential of intrabodies in neurologic disorders: focus on Huntington and Parkinson diseases. BioDrugs 2006;20:327333. 147. Novoradovskaya N, Lee J, Yu ZX, Ferrans VJ, Brantly M. Inhibition of intracellular deg radation increases secretion of a mutant form of alpha1antitrypsin associated with profound deficiency. J Clin Invest 1998;101:26932701. 148. Song S, Morgan M, Ellis T, Poirier A, Chesnut K, Wang J, Brantly M, et al. Sustained secretion of human alpha1 antitrypsin from murine muscle transduced with adeno associated virus vectors. Proc Natl Acad Sci U S A 1998;95:1438414388. 149. Cardinale A, Filesi I, Mattei S, Biocca S. Evidence for proteasome dysfunction in cytotoxicity mediated by anti Ras intracellu lar antibodies. Eur J Biochem 2003;270:33893397. 150. Jiang H, Lillicrap D, Patarroyo White S, Liu T, Qian X, Scallan CD, Powell S, et al. Multiyear therapeutic benefit of AAV serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice and dogs. Blood 2006;108:107115.

PAGE 115

115 151. Kay MA, Graham F, Leland F, Woo SLC. Therapeutic Serum Concentrations of Human Alpha1 Antitrypsin after Adenoviral Mediated GeneTransfer into Mouse Hepatocytes. Hepatology 1995;21:815819. 152. Okuyama T, Huber RM, Bowling W, Pearline R, Kennedy SC, Flye MW, Ponder KP. Liver directed gene therapy: A retroviral vector with a complete LTR and the ApoE enhancer alpha(1) antitrypsin promoter dramatically increases expression of human alpha(1) antitrypsin in vivo. Hum Gene Ther 1996;7:637645. 153. Canonico AE, Brigham KL, Carmichael LC, Plitman JD, King GA, Blackwell TR, Christman JW. Plasmid liposome transfer of the alpha(1) antitrypsin gene to cystic fibrosis bronchial epithelial cells prevents elastaseinduced cell detachment and c ytokine release. Am J Respir Cell Mol Biol 1996;14:348355. 154. Bou Gharios G, Wells DJ, Lu QL, Morgan JE, Partridge T. Differential expression and secretion of alpha 1 anti trypsin between direct DNA injection and implantation of transfected myoblast. Gene Ther 1999;6:10211029. 155. Qiu P, Ziegelhoffer P, Sun J, Yang NS. Gene gun delivery of mRNA in situ results in efficient transgene expression and genetic immunization. Gene Ther 1996;3:262268. 156. Brantly ML, Spencer LT, Humphries M, Conlon TJ, Spenc er CT, Poirier A, Garlington W, et al. Phase I trial of intramuscular injection of a recombinant adenoassociated virus serotype 2 alphal antitrypsin (AAT) vector in AAT deficient adults. Hum Gene Ther 2006;17:11771186. 157. Pittschieler K. Liver involvem ent in alpha1antitrypsindeficient phenotypes PiSZ and PiMZ. Acta Paediatr 2002;91:239240. 158. Liqun Wang R, McLaughlin T, Cossette T, Tang Q, Foust K, Campbell Thompson M, Martino A, et al. Recombinant AAV serotype and capsid mutant comparison for pulm onary gene transfer of alpha1 antitrypsin using invasive and noninvasive delivery. Mol Ther 2009;17:8187. 159. Aldonyte R, Jansson L, Ljungberg O, Larsson S, Janciauskiene S. Polymerized alphaantitrypsin is present on lung vascular endothelium. New insi ghts into the biological significance of alphaantitrypsin polymerization. Histopathology 2004;45:587592. 160. Brantly ML, Chulay JD, Wang L, Mueller C, Humphries M, Spencer LT, Rouhani F, et al. Sustained transgene expression despite T lymphocyte respons es in a clinical trial of rAAV1 AAT gene therapy. Proc Natl Acad Sci U S A 2009;106:1636316368.

PAGE 116

116 161. Aldonyte R, Jansson L, Ljungberg O, Larsson S, Janciauskiene S. Polymerized alpha(1) antitrypsin is present on lung vascular endothelium. New insights int o the biological significance of alpha(1) antitrypsin polymerization. Histopathology 2004;45:587592. 162. Wang RL, McLaughlin T, Cossette T, Tang Q, Foust K, Campbell Thompson M, Martino A, et al. Recombinant AAV Serotype and Capsid Mutant Comparison for Pulmonary Gene Transfer of alpha1 Antitrypsin Using Invasive and Noninvasive Delivery. Molecular Therapy 2009;17:8187. 163. Carlson JA, Rogers BB, Sifers RN, Finegold MJ, Clift SM, DeMayo FJ, Bullock DW, et al. Accumulation of PiZ alpha 1antitrypsin causes liver damage in transgenic mice. J Clin Invest 1989;83:11831190. 164. Sifers RN, Rogers BB, Hawkins HK, Finegold MJ, Woo SL. Elevated synthesis of human alpha 1antitrypsin hinders the secretion of murine alpha 1antitrypsin from hepatocytes of transg enic mice. J Biol Chem 1989;264:1569615700. 165. Kang Y, Stein CS, Heth JA, Sinn PL, Penisten AK, Staber PD, Ratliff KL, et al. In vivo gene transfer using a nonprimate lentiviral vector pseudotyped with Ross River Virus glycoproteins. J Virol 2002;76:937 8 9388. 166. Shen Y, Ballar P, Fang S. Ubiquitin ligase gp78 increases solubility and facilitates degradation of the Z variant of alpha1 antitrypsin. Biochem Biophys Res Commun 2006;349:12851293. 167. Wang H, Li Q, Shen Y, Sun A, Zhu X, Fang S, Shen Y. T he ubiquitin ligase Hrd1 promotes degradation of the Z variant alpha 1 antitrypsin and increases its solubility. Mol Cell Biochem 2011;346:137145. 168. Hidvegi T, Mirnics K, Hale P, Ewing M, Beckett C, Perlmutter DH. Regulator of G Signaling 16 is a marker for the distinct endoplasmic reticulum stress state associated with aggregated mutant alpha1antitrypsin Z in the classical form of alpha1antitrypsin deficiency. J Biol Chem 2007;282:2776927780. 169. Teckman JH, An JK, Loethen S, Perlmutter DH. Fasting in alpha1antitrypsin deficient liver: constitutive [correction of consultative] activation of autophagy. Am J Physiol Gastrointest Liver Physiol 2002;283:G11561165. 170. Lang T, Muhlbauer M, Strobelt M, Weidinger S, Hadorn HB. Alpha1 antitrypsin defici ency in children: liver disease is not reflected by low serum levels of alpha1 antitrypsin a study on 48 pediatric patients. Eur J Med Res 2005;10:509514. 171. Stintzing S, Neureiter D, Hahn EG, Wiest GH. [Alpha 1proteinase inhibitor deficiency and is olated liver cirrhosis without pulmonary emphysema in a 53year old female patient]. Dtsch Med Wochenschr 2005;130:28232825.

PAGE 117

117 172. Eriksson S, Carlson J, Velez R. Risk of cirrhosis and primary liver cancer in alpha 1 antitrypsin deficiency. N Engl J Med 1986;314:736739. 173. Dragani TA. Risk of HCC: genetic heterogeneity and complex genetics. J Hepatol 2010;52:252257. 174. Hadzic N, Quaglia A, MieliVergani G. Hepatocellular carcinoma in a 12year old child with PiZZ alpha1antitrypsin deficiency. Hepatol ogy 2006;43:194. 175. Brunt EM, Blomenkamp K, Ahmed M, Ali F, Marcus N, Teckman J. Hepatic progenitor cell proliferation and liver injury in alpha1 antitrypsin deficiency. J Pediatr Gastroenterol Nutr 2010;51:626630. 176. Bataller R, Brenner DA. Liver fi brosis. J Clin Invest 2005;115:209218. 177. Popper H, Uenfriend S. Hepatic fibrosis. Correlation of biochemical and morphologic investigations. Am J Med 1970;49:707721. 178. Schaffner F, Klion FM. Chronic hepatitis. Annu Rev Med 1968;19:25 38. 179. Mille r J, Arrasate M, Shaby BA, Mitra S, Masliah E, Finkbeiner S. Quantitative relationships between huntingtin levels, polyglutamine length, inclusion body formation, and neuronal death provide novel insight into huntington's disease molecular pathogenesis. J Neurosci 2010;30:1054110550. 180. Marciniak SJ, Lomas DA. Alpha1antitrypsin deficiency and autophagy. N Engl J Med 2010;363:18631864. 181. Hegde AN, Upadhya SC. Role of ubiquitinproteasomemediated proteolysis in nervous system disease. Biochim Biophys Acta 2011;1809:128140. 182. Burrows JA, Willis LK, Perlmutter DH. Chemical chaperones mediate increased secretion of mutant alpha 1antitrypsin (alpha 1AT) Z: A potential pharmacological strategy for prevention of liver injury and emphysema in alpha 1 A T deficiency. Proc Natl Acad Sci U S A 2000;97:17961801.

PAGE 118

118 BIOGRAPHICAL SKETCH Kai (Carl) Xiao was born in Huangshi, Hubei province, P.R. China in 1985. After graduated from Huanggang Middle School in 2003, he received his college education at Sun Yet sen (Zhong Shan) University, where he received his bachelors degree in biotechnology. During his senior years in College he joined National 908 marine survey project in Guangzhou Marine Institute, Chinese Academy of Science. In 2008, he came to Genetics & Genomics programs in University of Florida to pursue a Ph.D. degree in biomedical science. In spring 2009, he began his graduate research in Dr. Mark Brantlys laboratory, conducting research on characterization of basic mechanisms of alpha 1 antitrypsin deficiency and identifying novel therapeutic approaches to the disease. In the fourth year of the Ph.D. study, he got his Master of Science in Management (MSM) from the Warrington School of business at UF. Carl plans to step into biotechnology industry and focus his career on research and development in novel drugs for genetic disorders.