Genetic Studies of Intervertebral Disc Development

MISSING IMAGE

Material Information

Title:
Genetic Studies of Intervertebral Disc Development
Physical Description:
1 online resource (103 p.)
Language:
english
Creator:
Maier, Jennifer A
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Genetics (IDP)
Committee Chair:
Harfe, Brian D
Committee Members:
Swanson, Maurice S
Cohn, Martin J
Terada, Naohiro

Subjects

Subjects / Keywords:
disc -- foxa1 -- foxa2 -- gdf5 -- intervertebral -- notochord -- sclerotome -- shh
Genetics (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The intervertebral disc has three components: the nucleus pulposus (NP), annulus fibrosus (AF), and endplates. The NP is a watery gel-like substance that is surrounded by the collagenous AF. The endplates are hyaline cartilage and connect the rest of the disc to the vertebral bodies. Correct development of the intervertebral disc requires interactions between the embryonic notochord and sclerotome, which form the NP, and the vertebrae and AF, respectively. The NP has been described only in mammals. During aging, several changes occur to the disc, which can lead to disc degeneration, a major cause of back pain. There are few effective treatments for back pain (surgery, for example) and none that address disc degeneration. Discovery of genes and pathways that are involved in proper disc development may lead to better therapies for back pain caused by disc degeneration.  To examine the development of the disc, a variety of transgenic and knockout mouse alleles were employed. The first study fate-mapped the notochord to NP transition in the Gdf5 mutant mouse, which was reported to have a disc defect. Gdf5 (growth and differentiation factor 5) has been implicated in mouse and human chondrodysplasias. NP formation in Gdf5 mutants was found to be indistinguishable from control animals, suggesting that reported disc defects are not due to errors in development. The next study focused on the transcription factors Foxa1 and Foxa2, which are expressed in the notochord. To examine their potential role in disc formation, the Foxa genes were removed from the mouse notochord. The NP in double mutants was severely deformed, and they also had defects in hedgehog signaling. The hedgehog pathway has previously been implicated in normal disc patterning. It was found that Foxa1 and Foxa2 are functionally redundant in the notochord; both must be removed in order to see the phenotype.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Jennifer A Maier.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Harfe, Brian D.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-06-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044854:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 GENETIC STUDIES OF INTERVERTEBRAL DISC DEVELOPMENT By JENNIFER ANN MAIER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Jennifer Ann Maier

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS For getting me into science in the first place, I acknowledge the numerous middle and high school teacher s I had over the years, and several undergraduate professors, especially Dr. Jeanette Wyneken and Dr. Larry Lemanski for giving me a start in developmental biology and scientific research. I thank my mentor Brian Harfe, for giving me the opportunity to wor k in his lab and for his patience, encouragement, and support throughout my doctoral research. I am grateful to my committee members, Naohiro Terada, Marty Cohn, and Maurice Swanson, for their input and constructive criticism that have made me a better sci entist. I also thank the present and former members of the Harfe and Cohn lab for fruitful discussions and their friendship. Credit is also due to Michele Ramsey, Jenneene Spencer, and Kris Minkoff for their assistance in arranging classes, travel, and all the other miscellanea involved in completing graduate work. For travel award funding so that I could attend various meetings throughout my graduate career I am grateful to the College of Medicine, the Department of Molecular Genetics and Microbiology, an d the University of Florida Graduate School. Finally, I thank my parents, Jean and Kevin Maier, my siblings, Mike and Stef, and the rest of my family for their support and encouragement. I especially thank my significant other Steven Langerholc, and a wond erful group of friends I met in graduate school for always being there when I need them.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ 4 LIST OF TABLES ................................ ................................ ................................ ........... 8 LIST OF FIGURES ................................ ................................ ................................ ........ 9 LIST OF ABBREVIATIONS ................................ ................................ .......................... 10 ABSTRACT ................................ ................................ ................................ .................. 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ ...... 13 Intervertebral Disc Anatomy ................................ ................................ .................. 13 Age related Changes to the IVD and Their Consequences ................................ .... 14 Back Pain and Current Treatments ................................ ................................ ........ 15 Developmental Biology of the IVD ................................ ................................ ......... 16 The Sclerotome and Notochord are both Resp onsible for IVD Formation .............. 18 2 MATERIALS AND METHODS ................................ ................................ .................. 20 A Note on Methods ................................ ................................ ................................ 20 Mouse Husbandry ................................ ................................ ................................ 20 Collection of Embryos and Adults ................................ ................................ .......... 21 Paraffin Embedding of Animal Tissue ................................ ................................ .... 21 Paraffin Sectioning ................................ ................................ ................................ 22 LacZ Fate Mapping ................................ ................................ ................................ 23 Histological Staining ................................ ................................ .............................. 23 Alcian Blue and Picrosirius Red Staining ................................ ......................... 23 Hematoxylin and Eosin Staining ................................ ................................ ...... 24 Im munohistochemistry ................................ ................................ ........................... 24 Skeletal Preparation ................................ ................................ .............................. 25 LysoTracker Red Staining ................................ ................................ .................... 25 Synthesis of Probes for in situ Hybridization ................................ .......................... 25 Whole mount In situ Hybridization ................................ ................................ ......... 26 OCT Embedding and Sectioning ................................ ................................ ........... 27 Section in situ Hybridization ................................ ................................ ................... 27 Genotyping ................................ ................................ ................................ ............ 28 3 COMPARATIVE ST UDIES OF DISC DEVELOPMENT ................................ ............. 29 Additional Materials & Methods ................................ ................................ ............. 31 Specimen Collection ................................ ................................ ....................... 31

PAGE 6

6 Mouse LacZ Fatemapping ................................ ................................ ............... 31 Immunohistochemistry, Cryo embedding, RNA In situ Hybridization, Paraffin Embedding and Picrosirius Red Staining ................................ ........ 31 Embryonic Microsurgery and DiI, DiA Labeling ................................ ............... 32 Results ................................ ................................ ................................ .................. 32 Chicken and Quail Intervertebral Discs Lack Nuclei Pulposi ............................ 32 Fate Mapping of the Chicken IVD ................................ ................................ ... 33 Mouse Annulus Fibrosus is Formed From Sclerotome ................................ .... 34 Nuclei Pulposi Are Only Found in Mammalian Discs ................................ ....... 34 Discussion ................................ ................................ ................................ ............. 35 4 NUCLEI P ULPOSI FORMATION FROM THE EMBRYONIC NOTOCHORD OCCURS NORMALLY IN GDF 5 DEFICIENT MICE ................................ ............. 44 Additional Materials and Methods ................................ ................................ .......... 46 Ani mal Model ................................ ................................ ................................ .. 46 In situ Hybridization ................................ ................................ ......................... 47 LacZ Fatemapping, Skeletal Preparations, and Histology ............................... 47 Results ................................ ................................ ................................ .................. 47 Gdf5 Is Expressed in the Annulus Fibrosus But Not the Nucleus Pulposus of the Forming Discs ................................ ................................ .................... 47 The Embryonic Notochord Forms Normal Nuclei Pulposi in Newborn Gdf5 / Mice ................................ ................................ ................................ ............. 48 Twenty Four Week Old Gdf5 / Mice Contain Nuclei Pulposi Derived From the Embryonic Notochord ................................ ................................ ............. 49 Discussion ................................ ................................ ................................ ............. 49 5 FOXA1 AND FOXA2 ARE REQUIRED FOR THE FORMATION OF THE INTERVERTEBRAL DISC ................................ ................................ ..................... 57 Forkhead Box Transcription Factors ................................ ................................ ...... 57 Additional Materials & Methods ................................ ................................ ............. 58 Mouse Alleles ................................ ................................ ................................ .. 58 In situ Hybridization ................................ ................................ ......................... 59 Histology, LacZ Staining, and Lysotracker Assay ................................ ............ 59 Resu lts ................................ ................................ ................................ .................. 59 Removal of Foxa1 and Foxa2 in the Mouse Notochord ................................ ... 59 Foxa1;Foxa2 Double Knockouts Have Severely Deformed Nuclei Pulposi ...... 61 The Notochord to Nuclei Pulposi Transition is Abnormal in Foxa1 ; Foxa2 Double Mutants ................................ ................................ ............................ 62 Cell Death is Increased in Posterior S omites and the Tail of Foxa1;Foxa2 Double Mutants ................................ ................................ ............................ 63 Noto and T ( Brachyury ) Expression in Foxa1 ; Foxa2 Double Mutants .............. 63 Foxa Exp ression in the Notochord is not Required for Formation of the Sclerotome ................................ ................................ ................................ ... 64 Expression of Shh and Activation of the Hedgehog Signaling Pathway Requires Foxa Gene Expression in the Notochord ................................ ....... 65

PAGE 7

7 Foxa Expression in the Notochord is Required for Dorsal Ventral Patterning of the Neural Tube ................................ ................................ ....................... 66 Discussion ................................ ................................ ................................ ............. 67 Foxa1 and Foxa2 are Functionally Redundant in the Notochord ..................... 67 The Caudal Vertebral Column is More Severely Affected in Foxa1;Foxa2 Double Knock outs ................................ ................................ ........................ 68 Foxa1 and Foxa2 are Required for Activation of the Hedgehog Signaling Pathway in the Notochord ................................ ................................ ............ 69 Foxa1;Foxa2 Double Mutants ............... 70 Noto Expression is not Maintained in Foxa1;Foxa2 Double Knockout Embryos ................................ ................................ ................................ ....... 71 6 CONCLU DING REMARKS ................................ ................................ ....................... 81 APPENDIX A PRIMER SEQUENCES USED FOR GENOTYPING ................................ ................ 85 B IN SITU HYBRIDIZATION: PLASMIDS AND DETAILED METHODS ....................... 87 C UNABRIDGED IN SITU METHODS ................................ ................................ ......... 88 Unabridged Methods: Section in situ Hybridization ................................ ................ 88 Whole Mount in situ Hybridization ................................ ................................ .......... 89 LIST OF REFERENCES ................................ ................................ .............................. 93 BIOGRAPHICAL SKETCH ................................ ................................ ......................... 103

PAGE 8

8 LIST OF TABLES Table page A 1 Oligonucleotides in PCR ................................ ................................ .................... 86 B 1 Plasmids used for in situ hybridization ................................ ............................... 87

PAGE 9

9 LIST OF FIGURES Figure page 3 1 Analysis of bird disc formation. ................................ ................................ ............ 39 3 2 Fate mapping of the chick somite. ................................ ................................ ........ 40 3 3 The mouse annulus fibrosus is derived from the sclerotome. ............................... 41 3 4 Histology of the intervertebr al disc in various species.. ................................ ........ 42 3 5 The rostral half sclerotome forms the chicken intervertebral disc and the caudal region of adjacent vertebrae.. ................................ ................................ 43 4 1 Gdf5 deficient ( brachypodism ) animals contain a reproducible and highly penetrant limb phenotype. ................................ ................................ ................. 53 4 2 Gdf5 and Shh expression in the intervertebral disc.. ................................ ............ 54 4 3 Fatemap of notochord cells in P0 (newborn) Gdf5 heterozygous and null animals.. ................................ ................................ ................................ ............ 55 4 4 Fatemap of notochord cells in 2 4 week old Gdf5 heterozygous and null mice. .... 56 5 1 Foxa1 and Foxa2 expression in the notochord. ................................ .................... 73 5 2 Strategy to remove FO XA2 from the mouse notochord. ................................ ....... 74 5 3 Foxa1;Foxa2 double mutants have severe defects in intervertebral disc formation. ................................ ................................ ................................ .......... 75 5 4 Cell Death is increased in the tail of E11.5 but not E10.5 Foxa1;Foxa2 double mutant embryos.. ................................ ................................ .............................. 76 5 5 Expression of some notochord and sclerotome expressed genes are unaffected in Foxa1;Fox a2 double knockouts.. ................................ .................. 77 5 6 Hedgehog signaling is decreased in Foxa1;Foxa2 double knockouts. ................. 78 5 7 Dorsal ventral patterni ng of the neural tube is abnormal in Foxa1;Foxa2 double knockouts. ................................ ................................ ................................ ......... 79 5 8 Forelimb level expression of sclerotome and neural tube markers are normal in double mutants. ................................ ................................ ................................ 80

PAGE 10

10 LIST OF ABBREVIATION S AF Annulus fibrosus DEPC Diethyl pyrocarbonate DIG Digoxygenin Fox Forkhead box Gdf Growth and differentiation factor IVD Intervertebral disc NP Nucleus pulposus OCT Optimal cutting temperature PBS Phosphate buffered sa line PCR Polymerase chain reaction PFA Paraformaldehyde VB Vertebral body

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philoso phy GENETIC STUDIES OF INTERVERTEBRAL DISC DEVELOPMENT By Jennifer Ann Maier December 2012 Chair: Brian Harfe Major: M edical Sciences The intervertebral disc has three components: the nucleus pulposus (NP), annulus fibrosus (AF), and endplates. The NP is a watery gel like substance that is surrounded by the collagenous AF The endplates are hyaline cartilage and connect the rest of the disc to the vertebral bodies. Correct developmen t of the intervertebral disc requires interactions between the embryoni c notochord and sclerotome, which form the NP and the vertebrae and AF, respectively. The NP has been described only in mammals. During aging, several changes occur to the disc, which can lead to disc degeneration, a major cause of back pain. There are fe w effective treatments for back pain (surgery, for example) and none that address disc degeneration. Discovery of genes and pathways that are involved in proper disc development may lead to better therapies for back pain caused by disc degeneration. To ex amine the development of the disc, a variety of transgenic and knockout mouse alleles were employed. The first study fate mapped the notochord to NP transition in the Gdf5 mutant mouse which was reported to have a disc defect Gdf5 (growth and differentia tion factor 5) has been implicated in mouse and human chondrodysplasias NP formation in Gdf5 mutants was found to be indistinguishable

PAGE 12

12 from control animals, suggesting that reported disc defects are not due to errors in development. The next study focused on the transcription factors Foxa1 and Foxa2 which are expressed in the notochord To examine their potential role in disc formation, t he Foxa genes were removed from the mouse notochord. The NP in double mutants was severely deformed, and they also had defects in hedgehog signaling. The hedgehog pathway has previously been implicated in normal disc patterning. It was found that Foxa1 and Foxa2 are functionally redundant in the notochord; both must be removed in order to see the phenotype.

PAGE 13

13 CHAPTER 1 I NTRODUCTION Intervertebral Disc Anatomy The intervertebral disc (IVD) is a structure that imparts flexibility to the spinal column and supports the body ( Deverea ux, 2007 ; Raj, 2008 ) One disc is found between two vertebral bodies along the axial column of all vertebrates. The IVD is comprised of three main structures: the nucleus pulposus (NP), annulus fibrosus ( AF) and endplates (EP). The nucleus pulposus is a watery, gel like substance that is in the center of the disc. It contains primarily water and proteogylcans (mainly aggrecan), and also type II collagen and elastin fibers. Other collagens and proteoglycans are present in small amounts. The NP has low cell density and contains two types of cells, notochordal and chondrocytic ( Devereaux, 2007 ; Hunter et al., 2003 ; Raj, 2008 ) Notochordal cells are large and vacuolated, while chondrocytic cells are smaller and similar looking to chondrocytes ( Risbud et al., 2010 ) The NP is surrounded by the annulus fibrosus, which is composed of many concentric lamellae (from 15 25 rings) of collagen. There is also a minor elastin compon ent to the AF. Collagen fibers are obliquely arranged in the lamellae, and the collagen fibers extend to the outside of the AF to the vertebral bodies and endplates ( Devereaux, 2007 ; Raj, 2008 ) The AF is sometimes divided into inner and outer AF layers ( Smith et al., 2011 ) The endplates are made of a thin layer of hyaline ca rtilage and are present inferior and superior to the disc. They attach the disc to the vertebral bodies. The majority of nutrients reaching the interior of the disc diffuse through the endplates (though a small amount of diffusion can occur through the out er AF as well). During development, the endplates are supplied by capillaries; in humans these regress by

PAGE 14

14 skeletal maturity ( Moore, 2006 ; Urban et al., 2004 ) The adult disc is avascular and aneural, which limits nutrient acquisition and waste disposal. The vertebrae and discs are ventral to the spinal cord. Neural arches coming off the vertebral bodies protect the dorsally oriented spinal cord. Coming out from the spinal cord are various nerves innervating complicated arrangements of muscles of the trunk and limbs ( Devere aux, 2007 ; Raj, 2008 ) Age related Changes to the IVD and Their Consequences As the body ages, several changes occur to the disc The boundary between the NP and AF becomes less distinct. The annulus fibr osus acquires small tears. The nucleus pulposus loses cells. In addition, the cells transition from a notochordal to a chondrocytic phenotype and the NP becomes less watery (aggrecan is lost, resulting in loss of hydration) and becomes more fibrous ( Raj, 2008 ) The nucleus pulposus can herniate through the annulus fibrosus ( Boos e t al., 2002 ; Hunter et al., 2003 ; Peacock, 1952 ; Smith et al., 2011 ) The NP can herniate (pro trude) up or down through the endplate, which is known even fracture, which is thought to interfere with nutrient transport ( Moore, 2006 ; Urban et al., 2004 ; Wang et al., 2012 ) These changes are known as disc degeneration. In some ca ses, disc degeneration will cause the compression of the disc, or herniation of the disc material. This can cause pressure to be placed on the many spinal nerves emanating from the spinal cord, and cause pain ( Hunter et al., 2003 ; Raj, 2008 ; Smith et al., 2011 ) It has also been noted that nerves grow into the dege nerated disc ( Kepler et al., 2011 ) Degeneration of the disc begins as early as the second decade of life in humans and level of degeneration can be graded accord ing to various diagnostic

PAGE 15

15 criteria ( Boos et al., 2002 ; Raj, 2008 ) Disc degeneration and aging has also been studie d extensively in the mouse model ( Dahia et al., 2009 ) Back Pain and Current Treatments Most people will experience back pain at some point in their lives. For ma ny, conservative treatments will resolve pain symptoms in a short time. For a small percentage (<5%) back pain can become chronic, and there are few effective treatment options ( Katz, 2006 ) Chronic back pain costs billions of dollars per year in the United States due to lost productivity and medical bills ( Katz, 2006 ; Martin et al., 2009 ) Surgery, such as spinal fusion, is sometimes done. The damaged disc is removed and bone re grown between the two vertebrae. This limits the mobility of the spinal column and can accelerate degeneration of the discs superior and inferior to the point of fusion. It also has many potentially unacceptable complications ( Chrastil and Patel, 2012 ) and not all patients are candidates for surgery. Pain killers and physical therapy may also aid in pain relief. There are also disc replacement surgeries, in which the damaged disc is replaced with an artificial material. These have had limited success as fail ure of the replacement is high and additional revision surgeries may be required ( de Kleuver et al., 2003 ) The main drawbacks to many current treatments for chronic back pain are that they do not address disc degeneration, which is commonly a cause (however other conditions can also cause back pain, such as cancer ( Casazza, 2012 ) ). There is a need to create therapies that prevent or ameliorate disc degeneration. Some avenues of research that have been examined have been injection of growth factors to stimulate ECM production or cell growth in the disc and gene therapy ( Kepler et al., 2011 ; Walsh et al., 2004 ) These are not without their drawbacks as well; BMP (bone morphogenetic

PAGE 16

16 protein) has been used in di sc surgeries before and was associated with complications such as osteolysis and pain ( Chrastil and Patel, 2012 ) Other avenues of research include stem cell th erapies ( Liu et al., 2011 ) and gene therapy ( Kepler et al., 2011 ) Stud ying how the disc forms properly, how it is maintained, and what factors contribute to its degeneration may lead to more effective therapies for disc degeneration and back pain ; disc formation will be the focus of this dissertation Developmental Biology o f the IVD The nucleus pulposus is derived from the embryonic notochord. The notochord is a temporary structure in most chordates (includes vertebrates, lampreys, tunicates, and lancelets) and is the main body support for the embryo. It arises from cells of the node, which is the organizer of the body plan in vertebrate embryos ( Yamanaka et al., 2007 ) The notochord is a rod surrounded by a sturdy sheath composed of collagen, laminins, and other extracellular matrix molecules. The sheath is secreted by the notochord itself and allows for the notochord to have some flexion without bending completely in half. This gives locomotion to some embryonic and larval chorda tes ( Stemple, 2005 ) The notochord also serves as an important source of signa ls for the developing embryo. It is known that SHH (sonic hedgehog) protein is secreted from the notochord, and patterns the floorplate of the neural tube ( Jessell, 2000 ) The notocho rd is the scaffold on which the rest of the body plan is built. Signals from the notochord are involved in left right symmetry and other functions, as reviewed by Stemple ( Stemple, 2005 ) The notochord is a temporary embryoni c structure in most animals; its remnants are thought to be the nucleus pulposus. In mammals, this has been s upported by histological studies ( Rufai et al., 1995 )

PAGE 17

17 Recently, the notochord to nucleus pulposus tra nsition was fate mapped in the mouse model by use of the LacZ reporter line, R26R and the Shhgfpcre allele. LacZ galactosidase enzyme. In short, all notochord cells, which express Shh and thus the Cre allele, produced LacZ in notochord cells. When treated with x gal, the substrate of galactosidase blue cells could be found in the nucleus pulposus of the disc (and other areas of the body in which Shh is found, such as the posterior limbbud) ( Choi et al., 2008 ) These data indicat ed that all cells of the nucleus pulposus were derived from the notochord ( Choi et al., 2008 ; Risbud et al., 2010 ) The annulus fibrosus is thought to arise from the sclerotome, which is a compartment of the somite (large blocks of mesoderm that form on either side of the notochord during embryonic development. Somite formation will be further discussed in Chapter 4 of this dissertation. The vertebral bodies themselves are also derived from the sclerotome. Briefly, the cells of the sclerotome migrate and surround the notochord. This occurs at E12 in mice and distinct NP can be seen by E13.5. Regions of more and les s condensed cells, representing the forming IVD and vertebral bodies can be seen along the vertebral column. The sclerotomes split, known as resegmentation, and the caudal half of one sclerotome joins with the rostral half of the adjacent sclerotome to for m the vertebral body and disc ( Peacock, 1951 ) This resegmentation will be discussed further in Chapter 4. While this is happening, the notochord is dismantled in the areas that the vertebral bodies are forming, while it expands i n the region of the NP; but it is not understood how this occurs ( Aszodi et al., 1998 ) In mice, the endplates

PAGE 18

18 appear during postnatal development and are thought to be derived from cells of the AF ( Dahia et al., 2009 ) The Sclerotome and Notochord are both Responsible for IVD Formation Study of the genes required for the pr oper formation of the disc could lead to therapies that may repair disc tissue or prevent disc damage. In the past several years, numerous naturally occurring mutants have been described, and knockout and transgenic alleles have been created and used to s tudy the formation of the disc in mice ( Abdelkhalek et al., 2004 ; Aszodi et al., 1998 ; Bussen et al., 2004 ; Chiang et al., 1996 ; Herrmann et al., 1990 ; Peters et al., 1999 ; Smits and Lefebvre, 2003 ) Assays for gene or protein expression in the NP and AF have also been done to elucidate any signaling pathways that may be important for the formation o f the normal disc ( Le Maitre et al., 2009 ) Removal of genes from either the notochord or sclerotome can result in various phenotypes, ranging from the complet e absence of a disc to just slight deformities. Animals null for Foxa2 a transcription factor expressed early in the node and notochord, die lacking either structure, and do not form the disc ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) The role of the Foxa family in disc development will be discussed at length in Chapter 5. Shh null animals initially form a notochord, which degenerates in a rostral to caudal fashion ( Chiang et al., 1996 ) As they lack a notochord, the NP does not form, and they also do not have a v ertebral column. Further work removing hedgehog signaling from the notochord using a conditional allele revealed that hedgehog signaling is required to form the notochord sheath and to pattern the NP ( Choi and Harfe, 2011 ) A shortened tail results from the absence of a copy of T ( Brachyury ); animals missing both copies die due to abnormalities in mesoderm formation ( Herrmann et al., 1990 ; Stott et al., 1993 ; Wilkinson et al., 1990 )

PAGE 19

19 Noto removal, normally expressed in the posterior notochord, also results in a shortened tail ( Abdelkhalek et al., 2004 ) Sox5 and Sox6 cooperate to form the sheath, promote notochord cell su rvival, and to form the disc ( Smits and Lefebvre, 2003 ) Downstream targets of the hedgehog pathway Gli2 and Gli3 are expressed in the sclerotome. Removal of Gli2 results in the absence of ossification centers in t he vertebrae and malformed IVDs. An embryo lacking both copies of Gli2 and one copy of Gli3 has a more dramatically deformed axial column, suggesting some functional redundancy of their roles in chondrogenesis ( Mo et al., 1997 ) Two other transcription factors in the sclerotome, Pax1 and Pax9 have also been shown to have functionally redundant roles in disc and vertebrae formation ( Peters et al., 1999 ) That the removal of either notochord or sclerotome genes can result in disc abnormalities reflects the complex interaction of the notochord, its sheath, and the sclerotome play in the formation of the intervertebral discs. This dissertation focuses mainly on the use of null and conditional knockout mice to examine the formation of the disc, and also the fatemapping of some of the components of the mouse disc. The uniqueness of the nucleus pulposus to mammals will also be briefly discussed.

PAGE 20

20 CHAPTER 2 MATERIALS AND METHODS A Note on Methods The methods detailed in this chapter were used for experiments in the three results chapters. Specific notes on mouse alleles are detailed i n the results chapters relevant to them. Any deviations from these general methods will be addressed as they arise in Chapters 3 5 Mouse Husbandry Mice were maintained in a Specific Pathogen Free (SPF) facility and all procedures were done in accordance w ith the University of Florida Institutional Care and Use of Animal (UF IACUC) guidelines Animals were given regular animal chow and water. Cages were lined with corn cob substrate and a cotton pad that could be made into bedding. No more than five adults of the same sex were housed together. Pregnant females were separated from cage mates to give birth and to raise their litters. All new animals were weaned from their mothers at 3 weeks. New animals were given an ear tag and genotyped using the last few mi llimeters of their tails. Animals that were not needed were euthanized by CO 2 asphyxiation followed by cervical dislocation. After weaning, animals were separated by sex until ready for breeding. For females, crosses were set up when animals were at least 6 weeks of age, males were aged to 8 weeks before they were set up for breeding. For timed matings, females were added to the cage of a single male in the late afternoon. The next morning the females were monitored for the presence of a semen plug, indicat ing that mating had occurred. By convention, mating was recorded to have occurred at 12:00am the previous night, thus at 12:00pm the day the plug was found the

PAGE 21

21 embryos would be at E0.5. Embryos were harvested when needed, which ranged from E7.5 to P0 (newb orn). When necessary, tamoxifen dissolved in corn oil was administered to pregnant females. Females were given tamoxifen through a 20 gauge gavage needle attached to a sterile syringe. 70% Ethanol was used to clean the needle afterwards. To dissolve tamoxi fen, it was mixed in corn oil at 20 mg/mL and incubated with rotation at 65C for 20 30 minutes. Females were given 200 L of the corn oil:tamoxifen mixture. Collection of Embryos and Adults To collect adult vertebral columns animals were euthanized by c ervical dislocation followed by thoracotomy. Skin was removed from the back and sturdy scissors used to cut out the vertebral columns. Limbs and ribcage were removed with scissors. Organs were removed using forceps. To collect embryos from E7.5 to E14.5, t he pregnant dam was euthanized by cervical dislocation followed by thoracotomy Embryos were quickly removed from the uterus and placed into phosphate buffered saline (PBS). Extra embryonic tissues were used for genotyping. Depending on what embryos were b eing used for, they were fixed overnight in either 0.2% paraformaldehyde (PFA), 4% PFA, or 4% diethylpyrocarbonate (DEPC) PFA. Fixing was at 4C with agitation. Embryos harvested after E14.5 up to P0 were decapitated with scissors before being collected as above. Vertebral columns were removed with forceps from large embryos and newborns to allow fix to penetrate the tissue better. Paraffin Embedding of Animal Tissue When processing tissue for paraffin embedding, tissue was dissected out and fixed overnight in 4% PFA. Large adult samples were fixed for 2 days in PFA. If samples

PAGE 22

22 were P0 and older, they were decalcified in Cal Ex (Fisher Scientific) for one day at room temperature. After decalcification (if needed), tissue was washed 3 times for 20 minutes in PBS. This was followed by 2 30 minute washes in 70% EtOH, and then dehydration for at least 24 hours in 70% EtOH at 4C. For adult samples dehydration could go for as long as 2 3 days, for very large samples (adult chicken vertebral columns) dehydration w ent on for as long as a week. Early in the morning on the day the tissue was to be embedded, it was washed for one hour in 95% EtOH, then 3 times for 30 minutes in 100% EtOH. Tissue was cleared with xylenes, time was dependent on the size of the tissue. Wa shes were changed every 6 8 minutes until tissue was cleared and then xylenes were removed and replaced with either Leica Histowax (manufacturer has since discontinued this product) or Blue Ribbon (Leica) Six washes of 20 minutes each were done in Histowax or Blue Ribbon (Leica) at 60C. Finally TissuePrep (Fisher Scientific) w ax was added for at least 30 minutes at 60C. Tissues were oriented and embedded and allowed to sit overnight. When tissue was very large (adult chicken) or there were no embedding mold s available tissue was left in paraffin overnight. To remove the blocks from the embedding molds, they were refrigerated for at least 10 minutes and then removed. Paraffin Sectioning To cut sections blocks were trimmed of excess wax with a razorblade and mounted on a Leica microtome. Sections of 7m were floated in a warm water bath before being lifted onto glass slides. Slides were allowed to dry overnight on a slide warmer. Slides were stored at room temperature until ready to use for either histological staining or immunohistochemistry.

PAGE 23

23 LacZ Fate Mapping When processing tissue for LacZ fatemapping, animals containing the R26R allele ( Sorian o, 1999 ) and either the Shhgfpcre or ShhcreER T2 allele ( Harfe et al., 2004 ) were fixed overnight in 0.2% PFA. The next morning tissue was washed 3 x 10 minutes i n LacZ Concentrated Rinse Buffer, which contains (0.1M sodium phosphate [pH7.4], 0.1% sodium deoxycholate, 2mM MgCl 2 0.2% NP 40) before being put in LacZ staining solution (1mg/mL X gal in DMF, 5mM K 3 Fe(CN) 6 5mM K 4 Fe(CN) 6 ) overnight in the dark at room t emperature. Reactions were stopped the following day by 3 x 10 minute washes in PBS. Embryos were photographed and then fixed overnight in 4% PFA. If tissue was to be embedded and sectioned, embedding protocol detailed above was followed. Slides were not counterstained but were dewaxed with xylenes for 10 minutes, rehydrated with 10 minute washes in 100%, 95%, and 70% EtOH followed by distilled deionized water (ddH 2 O), then 1 minute each of 70%, 95%, and 100% EtOH and 5 minutes xylenes before being mounte d and coverslipped with Permount. Otherwise samples were transferred to 1% PFA and stored at 4C. Histological Staining Alcian Blue and Picrosirius Red Staining Alcian blue stains mucopolysaccharides ( Yamada, 1963 ) and picrosirius red stains collagens ( Junqueira et al., 1978 ; Junqueira et al., 1982 ) After dewaxing in xylenes for 10 minutes, slides were rehydrated by 10 minutes each in 100%, 95%, and 70% EtOH, then 5 minutes in ddH 2 O. Next, slides were washed for 15 minutes in Alcian blue stain (Sigma, pH2.5), followed by 10 minutes in tap water. Picrosirius red (PolyScientific) staining was done for 45 minutes and then an acid wash f ollowed (0.025% acetic acid in deionized water), followed by de staining for 1 minute each in

PAGE 24

24 95% and 100% ethanol, then 10 minutes in xylenes. Slides were mounted with Permount (Fisher Scientific) and coverslipped. Hem at oxylin and Eosin Staining Slides were dewaxed and rehydrated as above, and then treated with hematoxylin for 1 minute, followed by washing in ddH 2 0, 70% and 95% EtOH for 1 minute each, then eosin counterstaining for 30 s. Slides were then washed for one minute each in 95%, and 100% EtOH followed by 5 minutes of xylenes before being mounted with Permount (Fisher Scientific) and coverslipped. Immunohistochemistry Paraffin slides were dewaxed and rehydrated as described above, and then antigen retrieval was performed in a conventional micro wave at 70% power for 15 minutes in 10mM sodium citrate buffer + 0.1% Tween20. Slides were allowed to cool for 30 minutes and then were blocked for 30 minutes to 2 hr with 10% donkey serum in PBST. Primary antibody for was added in 10% donkey serum, cover slipped with parafilm, and left overnight at 4C. The next day slides were washed with PBST several times, blocked again for 30 minutes in 10% donkey serum/PBST, and secondary antibody was added for 1 hour. After washing 3 times with PBST and counterstaini ng with DAPI (1:1000 in PBS for 5 minutes), followed by 3 more washes in PBST, slides were mounted with DAKO Fluorescent mounting media and coverslipped. Samples were stored in the dark at 4C until imaging. The following primary antibodies and dilutions w ere used: (1:75) goat anti FOXA2 (AbCam, ab5074), (1:200) rabbit anti LAMININ (DAKO, Z0097), and (1:200) goat anti T (BRACHYURY) (Santa Cruz, sc 17743) Secondaries and their dilutions were (1:300) AlexaFluor 568 donkey anti goat

PAGE 25

25 IgG (Invitrogen) or (1:300 ) DyLight 488 donkey anti rabbit IgG (Jackson ImmunoResearch). Skeletal Preparation Animals were skinned and eviscerated then fixed in 4% PFA overnight. The next morning they were washed in PBS for 30 minutes. Alcian blue (0.02%) in ethanol and acetic aci d (30% by volume) was added and allowed to stain cartilage overnight. Next, limbs were rehydrated in an ethanol series for an hour each before being placed in Alizarin red overnight (stock solution is 0.1% dye in 1% KOH, dilute 2 mL stock in 48 mL 1% KOH). Tissue was then washed in 1% KOH until it was cleared enough to be photographed. This could take anywhere from a few days to a couple of weeks depending on sample size. Lyso T racker Red Staining Embryos were quickly dissected into PBS that had been warme d to 37C in order to keep them alive for as long as possible. Lyso T racker Red DND 99 (from here on referred to as LysoTracker ) reagent (Invitrogen) was added (25 L to 5 mL warm PBS) and 500 L of this was added to each embryo. Embryos were incubated at 37C in the dark for 30 minutes and then rinsed several times with PBS before being fixed in 4% PFA overnight. The next day, embryos were washed in PBS for 30 minutes and then dehydrated in a methanol series for at least 30 minutes each of 25%, 50%, 75%, and 100% methanol. Embryos were stored at 20C in the dark until photographed. Synthesis of Probes for in situ Hybridization Protocols for probe synthesis and in situ hybridization were based on those of Nieto et. al. and Murtaugh et. al. ( Murtaugh et al., 1999 ; Nieto et al., 1996 ) Probes were synthesized using Roche reagents. The dNTPs contained digoxygenin (DIG), which

PAGE 26

26 makes a DIG labeled anti sense probe to your mRNA of interest. For descriptions of the plasmids used as a template and the antisense restriction enzymes and polymerases, see Appendix B, Table B 1. To make the linear template, plasmid DNA was d igested with the appropriate restriction enzyme and buffer for 2 hours at 37C. In some cases, T7 T3 PCR was used to amplify the template (Table B 1). For each reaction, 8 L template, 6.5 L DEPC H 2 0, 2 L 10x transcription buffer, 2 L DIG labeled dNTP m ix, 0.5 L RNAse inhibitor, and 1 L polymerase were mixed and incubated for 2 hours at 37C. The probe was purified in a Roche Mini Spin column (1 min at 3000 rpm to remove buffer from column, add probe, 4 min at 3000 rpm to purify). Purified probes were stored at 80C until use. Whole mount In situ Hybridization For whole mount in situ hybridization, embryos between E7.5 and E10.5 were dissected out in PBS and fixed overnight in 4% PFA. The next day they were transferred to 1% PFA for storage or process ed for in situs The protocol takes 4 days, for unabridged methods, see Appendix C. In brief, embryos were dehydrated in a methanol series (25%, 50%, 75%, and 100%), and could be stored for years at 20C after this point. Embryos were bleached in 6% H 2 O 2 in MeOH for an hour, and then placed into 100% MeOH for storage or in situ continued. Day 1 continued with proteinase K treatment (time dependent upon embryonic stage; E7.5 embryos were not PK treated), fixation, and incubation in prehybridization solution then probe overnight at 70C. The next day, embryos were put through a series of washes in formamide and salt solutions before being treated with anti DIG antibody at 1:2000. The antibody is conjugated to alkaline phosphatase, which will allow for develo pment of the in situ Day 3 was extensive washing with a maleic acid and salt buffer, D ay 4 was development in

PAGE 27

27 BM Purple or a mixture of BCIP and NBT (all are substrates of alkaline phosphatase, which is conjugated to the antibody). Embryos were developed in the dark until a purple precipitate appeared where the mRNA was expressed, then washed in PBS, fixed overnight, and photographed. Embryos were stored in the dark in 1% PFA after photography. OCT Embedding and Sectioning To embed embryos for section in situ hybridization, samples were harvested in DEPC treated PBS with RNase Zap (Ambion) treated tools. They were fixed overnight in 4% DEPC PFA. The next day, embryos were transferred to 30% sucrose in DEPC PBS overnight. Once embryos sank, they were put in a mixture of 50% Tissue Tek O.C.T. (Optimal C utting T emperature ) and sucrose. After a couple hours of incubation, embryos were embedded in 100% Tissue Tek O C T on dry ice and kept at 80C until section. A Leica cryostat was used to cut transverse, fr ontal, and sagittal sections between 12 16 m. Slides were stored at 80C until they were used for section in situs Section in situ Hybridization For section in situ hybridization, slides were removed from the freezer and thawed until dry. This procedur e takes 3 4 days to complete. For complete instructions, see Appendix C. In brief, on Day 1 sections were rehydrated, treated with 0.2 M HCl, proteinase K, fixed in 4% PFA, acetylated, and incubated with prehyb ridization solution to which 10% dextran sulph ate had been added. Probe was added (1 L/slide) in prehyb ridization slides were covered with a strip of Parafilm (Pechiney Plastic Packaging) and incubated overnight at 65C. For day 2, excess probe was washed off and anti DIG antibody was added (1:200 0) in 5% goat serum, and incubated overnight at 4C. Day 3 excess antibody was washed off with buffer and either left overnight in

PAGE 28

28 buffer or the color developed. Color was processed with BM Purple or a mixture of BCIP, NBT, DMF, and AP buffer, similar to w hole mount in situs BM Purple treated slides were coverslipped with P arafilm and incubated at 37C until they had developed (30 minutes to several hours). Once color was developed slides were fixed, coverslipped, and photographed. Genotyping Genotyping was done using polymerase chain reaction (PCR). For weanlings, tail snips were lysed in 25 mM NaOH at 95C for at least 30 minutes and neutralized in an equal volume of 40 mM Tris HCl. To genotype embryos, extraembryonic membranes were collected during emb ryo harvests and lysed in NaOH as for the weanlings. 1 2 L of DNA was used for each PCR reaction. For each reaction, the components were as follows: 2.5 L 10x Buffer (NEB Labs), 1 L each primer, 0.5 L 10mM dNTPs, 0.25 L Taq polymerase (NEB Labs) and w ater to 25 L. The alleles for R26R Shhcre Foxa1 and Foxa2 were genotyped according to previous literature ( Harfe et al., 2004 ; Kaestner et al., 1999 ; Soriano, 1999 ; Sund et al., 2000 ) For primer sequences and melting temperatures, see Appendix A Table A 1.

PAGE 29

29 CHAPTER 3 COMPARATIVE STUDIES OF DISC DEVELOPMENT This was a study with Bradley Bruggeman and several other collaborators. I will focus on my contributions to this study and clarify the work done by others. As stated in Chapter 1, the nucleus pulposus in the mouse IVD is formed entirely from cells of the embryonic notochord ( Choi et al., 2008 ; Risbud et al., 201 0 ) However, the origin of the annulus fibrosus is less clear. It is thought to be derived from the sclerotome, which is the ventral compartment of each of the somites. The sclerotome also forms the vertebral bodies ( Peacock, 1951 ) ; and removal of some sclerotomal genes results in the aberrant formation of the vertebral column ( Bussen et al., 2004 ; Peters et al., 1999 ) The somites are large blocks of mesoderm on either side of the notochord. They form from the paraxial mesoderm during primary gastrulation. In chickens, the first 28 pairs of somites are formed in this way. Secondary ga strulation forms the remaining somites later ( Christ and Ordahl, 1995 ) The somites are polarized in a cranial to caudal fashion, and these polarizations will give rise to different somitic compartments, such as the dermomyotome (form s dermis and muscle) and the sclerotome (vertebrae, ribs, etc) ( Brent et al., 2003 ; Brent and Tabin, 2002 ) The s clerotome undergoes a phenomenon known as resegmentation, which is required in order for the vertebral column and its muscle and nerves to form and function properly. As a result of this resegmentation, etween rostral caudal halves), the vertebral body is formed from the caudal half of one somite fused with the cranial half of the adjacent somite ( Bagnall and Sande rs, 1989 ; Peacock, 1951 )

PAGE 30

30 The formation of the chicken disc is less well studied than that of the mouse. In mammals, the notochord is surrounded by cells of the sclerotome. These cells take on a segme nted pattern in which there are alternating dense and less dense regions, which will give rise to the AF (less condensed), and vertebral body (more condensed) ( Pea cock, 1951 ; Rufai et al., 1995 ; Smith et al., 2011 ) Resegmentation and dismantling of the notochord occurs during this time, and the AF takes on a la mellar structure ( Rufai et al., 1995 ) There are conflicting data in current literature with regard to which half sclerotome gives rise to the disc in chickens. Using peanut lectin, which preferentially binds to the caudal half of each sclerotome, Bagnall and Sanders did chick fatemaps that concluded the caudal half somite contributes to the disk ( Bagnall and Sanders, 1989 ) Huang and colleagues did chick quail transplants of the somitocoele, and some of these cells were found in the peripheral disk. They determined that the som itocoele contributes to the caudal somite half, concluding that the IVD is composed of caudal somitic cells ( Huang et al., 1994 ) Goldstein and Kalcheim used transplantation experiments in the chick; rostral or caudal halves of quail somites were inserted into chick recipients. In contrast to Bagnall and Sanders and Huan g et al, they found that the the rostral half somite forms the disc ( Goldstein and Kalcheim, 1992 ) To fate map the regions of each half somite in chicke ns, the lipophilic fluorescent octadecyl tetramethylindo carbocyanine perchlorate) and DiA (4 (4 (dihexamecylamino)styrl) N methylpyridinium iodide) were used. The anterior sclerotome of the mouse was fatemapped with Tbx18:C re ( Cai et al., 2008 ) and R26R ( Soriano, 1999 ) alleles. Based on these analyses, we conclude the rostral half sclerotome contributes to the caudal half of the vertebral body and to the intervertebral

PAGE 31

31 disc. The caudal half of the sclerotome contributes to the rostral half of the vertebral body. Furtherm ore, the notochord persists in chickens at least until birth, and the chicken IVD lacks nuclei pulposi. Analysis of other vertebrate taxa revealed that only mammals have the nucleus pulposus. Additional Materials & Methods Specimen Collection For chicken embryos chicken ( G. gallus ) eggs were purchased commercially from Charles River Laboratories and stored at 16 1C before incubation. Humidified incubators were kept at 38 1C and harvested at various timepoints. Adult quail and chicken were purchased from Publix Supermarket. A. laysanensis (E13; equivalent to HH38 in chickens ), P. molarus bivittatus (approximately pre hatching), T. scripta (E30) and S. canicula (stage 34 prehatchling, ~145 175 days old) were a gift from Dr. Martin Cohn. C. perspicilla ta (>250 day old adult) was a gift from Dr. Chris Cretekos. A. mexicanum (~6 month old animal that had not undergone metamorphosis) was a gift from Dr. Malcolm Maden. The age of the adult fire bellied toad ( B. orientalis ) was unknown. Mouse LacZ Fatemappi ng Mice containing the R26R ( Soriano, 1999 ) allele and the Tbx18Cre ( Cai et al., 2008 ) alleles were crossed and embryos harvested at E16.5. Embryos were LacZ stained, embedded, and sectioned as described in Chapter 2. Immunohistochemistry, Cryo embedding, RNA In situ Hybridization, Paraffin Embedding a nd Picrosirius Red Staining These were procedures were all done as described in Chapter 2. For immunohistochemistry, the following antibodies and dilutions were used: (1:200) goat

PAGE 32

32 anti T (BRACHYURY) (Santa Cruz, sc 17743) and (1:300) AlexaFluor 568 donkey anti goat IgG (Invitrogen). A mouse Tbx18 probe and a chicken Shh probe were used for in situ hybridization. Adult chickens, being much larger pieces of tissue, required two to three days of decalcification and up to one week of dehydration in 70% EtOH. Ti ssue was left in paraffin in the incubator at least overnight to allow it to be properly penetrated with wax. Embryonic Microsurgery and DiI, DiA Labeling This was done by Bradley Bruggeman. De tailed methods can be found in Bruggeman et al 2012 ( Bruggeman et al., 2012 ) Results Chicken and Quail Intervertebral Discs Lack Nuclei Pulposi Histological work on chicken embryos from HH19 to HH44 was done by Yasmin Mohiuddin and Rae Powers ; my histological analysis was done on adult chickens. Histology was preformed to examine the structure of the chicken disc material to see if it is similar to the mouse disc. This study determined that the chicken disc lacks a nucleus pulposus; but retains the notochord in the ven tral midline until birth (Figure 3 1A H). The disc material appears to be made of collagens, with a ring of collagen with the notochord running through it. They also examined adult quail and found that there is no NP like structure. In adult chicken verteb rae it was found that while the notochord is no longer persistent through the vertebral column, there is still no nucleus pulposus. The intervertebral material consists of collagens, indicated by its red staining after treatment with picrosirius red (Figur e 3 1J). Birefringence (examining picrosirius red stained tissue under polarized light) shows a strip of collagen III in the center of the disc which is surrounded by type I or type II collagens (Figure 3 1K). This work highlights differences

PAGE 33

33 between mouse and chick; the mouse does not retain the notochord at birth or post natally, the notochord becomes the nucleus pulposus of the IVD (Figure 3 1I); whereas in chicken the notochord is retained at least until birth, but never becomes the NP. Fate Mapping of the Chicken IVD Using the lipophilic dyes, DiI and DiA, Bruggeman marked populations of cells in the chicken somites at an early stage and followed their fate. In summary, the ventral rostral half of one sclerotome was injected with DiI (red dot, Figure 3 2D) and the ventral caudal half of the same sclerotome injected with DiA (green dot, Figure 3 2D). This was done in ovo on HH16 chickens. The chickens were harvested at Day 16, vertebral columns embedded and sectioned, and visualized under fluorescent ligh t. It was determined that the rostral half sclerotome forms the chicken IVD, and not the caudal half sclerotome (Figure 3 2E,F). An injection of DiI into the notochord showed that the chicken notochord, while retained at the time the samples were taken, do es not contribute to the chicken IVD (Figure 3 2G I). My work provided f urther evidence in support for the notochord not contributing to the disc I did in situ hybridization for Shh a notochord gene, on chicken notochords at Day 16. Shh mRNA is robustly expressed in the notochord but not in any part of the disk (Figure 3 2J). Furthermore, immunohistochemistry for T (BRACHYURY), a gene found in the notochord (and nucleus pulposus) of mice (Figure 3 2K), was not expressed in the Day 16 chicken IVD (Figure 3 2L). These experiments together are a molecular confirmation of what we concluded from histological studies (Figure 3 1); the chicken IVD is not formed from any part of the notochord at the stages examined, and the notochord is retained until hatching. T he chicken IVD has little resemblance to the mouse IVD.

PAGE 34

34 Mouse Annulus Fibrosus i s Formed From Sclerotome The mice described in this experiment were generated and LacZ stained by Nuno Camboa and Sylvia Evans. The animals were sent to me for the remaining p rocesseing. T he LacZ stained tissue was photographed, embedded and sectioned to provide Figure 3 3B D. Tbx18 plasmid was provided by the Evans lab, which was used to do the in situ for Tbx18 shown in Figure 3 3A. Previously, we demonstrated that in mice al l cell types located in the nucleus pulposus were derived from the embryonic notochord ( Choi and Harfe, 2011 ) Chickens do not contain a visible nucleus pulposus. I nstead, their intervertebral discs are composed, at least in part, of cells derived from the sclerotome (Fig. 3 2). To determine if the mouse annulus fibrosus, which surrounds the nucleus pulposus, is derived from sclerotome a Tbx18:Cre allele was used. T he Tbx18:Cre allele expresses Cre in all cells that express Tbx18 ( Cai et al., 2008 ) In the somites, Tbx18 is expressed in the anterior region of the sclerotome and is not expressed in the intervertebral discs ( Fig. 3 3A; ( Kraus et al., 2001 ) ). To fate map these cells, Tbx18:Cre mice were crossed to the CRE inducible L acZ all ele R26R ( Soriano, 1999 ) LacZ positive cells were found throughout the anterior annulus fibrosus but were excluded from the nucleus pulpo sus (Fig. 3 3B D). These data indicated that in mice at least part of the annulus fibrosus is composed of sclerotome cells. Nuclei Pulposi Are Only Found in Mammalian Discs This work was done in conjunction with Brad Bruggeman and YinTing Lo. Finding that quail and chickens lack a nucleus pulposus led us to investigate when in vertebrate evolution this structure appeared We obtained several different of organisms from the vertebrate taxa (fish, amphibians, reptiles, birds, and mammals). The small spotted

PAGE 35

35 c atshark ( S. canicula ) had wide regions of collagen stained tissue between vertebrae (Figure 3 4A,D). Similar to the quail and chicken, the disk material of the Laysan duck ( A. laysanensis Figure 3 4I,L), Pond slider turtle ( T. scripta Figure 3 4G,J), and Burmese python ( P. molurus bivittatus Figure 3 4H,K) lacked a nucleus pulposus and had a strip of collagen staining tissue between the vertebral bodies T he Mexican axolotl ( A. mexicanum ) and Fire Bellied Toad ( B. orientalis ) (Figure 3 4C,F) both contain ed vacuolated cells that were Alcian blue stained; indicating the disks were composed of glycosaminoglycans. Both metamorphosed (data not shown) and nonmetamorphosed (Fig. 3 4B,E) axolotls had the same intervertebral anatomy Finally, a mammal, ( C. perspic illata tailed bat; Fig. 3 4M,N) was found to have a nucleus pulposus. Consistent with these findings, all mammals examined to date in the published literature have been reported to contain intervertebral discs with a nucleus pulposus and a nnulus fibrosus. Our data suggest that nuclei pulposi are only present in mammals Discussion The origin of the chicken intervertebral disc has been disputed for years. Use of the fluorescent dyes DiI and DiA produced a fate map of sclerotome derived cells which allowed us to conclude that the rostral half sclerotome is the somitic compartment that forms the chicken intervertebral disc. Fate mapping of the Tbx18 expressing cells of the mouse (labels the anterior sclerotome) showed the annulus fibrosus was composed of sclerotome cells, which is in line with our chicken experiments. These data and previous literature documenting the resegmentation of the sclerotome before the formation of the vertebral bodies ( Brent and Tabin, 2002 ; Christ et al., 2000 ; Goldstein and Kalcheim, 1992 ; Peacock, 1951 ) led us to propose the model that the rostral half

PAGE 36

36 sclerotome contributes to the formation of the disc and the caudal vertebral body. The caudal half sclerotome forms the rostral vertebral body. Our model can be seen i n (Figure 3 5). In prior mouse fate mapping experiments we have shown that the embryonic notochord becomes the nucleus pulposus of the intervertebral disc ( Choi et a l., 2008 ) Use of dye labeling in chickens indicates that the notochord does not contribute to the disc or vertebrae during embryogenesis. This is consistent with histology, and the absence of Shh mRNA or T protein from any part of the chicken disc and v ertebrae (Figures 3 1 and 3 2). However, the final fate of notochord cells of later stage and adult chickens is unclear. We cannot exclude the possibility that the notochord contributes to the vertebral bodies, similar to that proposed for fish vertebral d evelopment ( Hyman and Wake, 1992 ) We found that in chickens, the notochord persists until birth and stil l expresses Shh mRNA at this time. Mice, in contrast, dismantle the notochord (becomes nuclei pulposi) at the same time the vertebrae are forming, and this process is complete by birth. Mice and chicks both require about 21 days for embryonic development, but the formation of their body plans and organ systems varies greatly. For instance, the chick limb begins to form around 2.5 days, while this process does not occur in mice until E9.5 ( Hamburger and Hamilton, 1992 ; Martin, 1990 ) In mice, the vertebral column is patterned by E13.0, while chicken vertebral column formation continues after hatching ( Choi and Harfe, 2011 ; Christ et al., 2000 ; Hamburger and Hamilton, 1992 ) Perhaps in the chick notochord SHH is still required after birth to finish patterning the vertebrae.

PAGE 37

37 In mammals, the annulus fibrosus develops around the nucleus pulposus, though its cellular origin was unclear. It is thought to be sclerotomally d erived. Using the Tbx18:Cre which is expressed in the anterior sclerotome, to do a fate map, we found that at least part of the mouse AF is formed from sclerotome. Not all cells in the AF were marked and it is possible that the rest of the AF forms from c ells of the posterior sclerotome. We were surprised to find in our histological studies that only mammals contained a nucleus pulposus. The NP is thought to facilitate flexibility of the spinal column and to play a key role in shock and compression resista nce ( Hunter et al., 2003 ; Smith et al., 2011 ) The AF and NP are thought to cooperate in the motion of the int ervertebral joint. That non mammallian vertebrates lack a nucleus pulposus suggests the disc tissue they do have replaces the functions of the nucleus pulposus; or that they do not require the specialized roles of the NP. In general, reptiles and amphibian s have a posture in which the limbs are sprawled outwards to the side. The mammals generally have their limbs under the body. This may exert different forces on the vertebral column while the animal is walking; perhaps mammalian locomotion as a result of this different limb posture requires the function of an NP ( Kardong, 2006 ) Except in amphibians (Mexican axolotl and Fire bellied toad), the intervertebral material was composed of collagen (as assessed by picrosi rius red staining). The amphibians had discs composed mostly of glycosaminoglycans (as assessed by Alcian blue staining) and very small amounts of collagen protein. The disc material of amphibians was vacuolated, and slightly resembled notochord cells. Per haps the amphibian disc is notochordally derived, not from the somites as we have found in other animals. The amphibian disc, if

PAGE 38

38 notochordally derived, may be a sort of primitive nucleus pulposus. In contrast, the chick disc is derived from the somites, wh ile notochord cells are excluded from the disc (on the basis of T and Shh expression). Thus the chick and other nonmammal discs (except the amphibians) are similar to the mammalian annulus fibrosus. We conclude that the nucleus pulposus forms from the noto chord exclusively in mammals, while the like structure.

PAGE 39

39 Figure 3 1. Analysis of bird disc formation. Picrosirius red and Alcian blue were used to determine the structure of the chicken intervertebral disc beginn ing at Hamburger and Hamilton stage (HH) 19 through adulthood. A F: At HH19 (A), HH27 (B), and HH33 (C) no disc structures were between adjacent vertebrae (D F). D F: Sections through the same disc. E ) The notochord was present in the middle of the ring of collagen. G ) At HH44, a thin layer of collagen was located between adjacent vertebrae. H ) In adult quail, the intervertebral disc was composed of glycosaminoglycan s (GAG). I ) Intervertebral discs from newborn mice contained a nucleus pulposus surrounded by an annulus fibrosus. J ) Adult chickens did not contain a nucleus pulposus. K ) An analysis of collagen fibers using polarized light revealed that the middle region intervertebral disc; NP, nucleus pulposus; AF, annulus fibrosus. Bru ggeman BJ, Maier JA, Mohiuddin YS, Powers R, Lo Y, Guimaraes Camboa N, Evans SM, Harfe BD; Copyright 2012 Developmental Dynamics.

PAGE 40

4 0 Figure 3 2. Fate mapping of the chick somite. A C: Labeling of the ventral region of Hamburger and Hamilton stage (HH) 16 somites with DiI (A; 1,1 0 di octadecyl 3,3,3 0 ,3 0 tetramethylindo carbocyanine perchlorate) marked cells in the vertebral bodies and intervertebral discs of day 16 embryos (B,C). D F: Double labeling of the ventral rostral region of the HH20 somite with DiI and the ventral caudal region with DiA (D; 4 (4 (dihexadecylamino)styryl) N methylpyridinium iodide) resulted in DiI but not DiA labeled cells present in the intervertebral discs at day 16 (E,F). G I: Labeling of the HH16 notochord with DiI resulted i n the presence of labeled cells only within the notochord at day 16. No labeled cells were observed within vertebrae or the intervertebral discs. Panels C, F, and I are enlargements of the boxed areas in B, E, and H, respectively. J: Shh mRNA is present in HH44 stage chick embryos. K,L: T (brachyury) is present in nuclei pulposi of mouse intervertebral discs (K) but is absent from the chicken disc (L). S, somite; D, dorsal; V, ventral; R, rostral; C, caudal; N and NC, notochord; VB, vertebrae; N, notochord; NP, nucleus pulposus; AF, annulus fibrosus; IVD, intervertebral disc. Bruggeman BJ, Maier JA, Mohiuddin YS, Powers R, Lo Y, Guimaraes Camboa N, Evans SM, Harfe BD; Copyright 2012 Developmental Dynamics.

PAGE 41

41 Figure 3 3. The mouse annulus fibrosus is deriv ed from the sclerotome. A ) Tbx18 mRNA was expressed in the anterior sclerotome at embryonic day E10.5 (sagittal section). Tbx18Cre;R26R E16.5 embryos were generated to fate map Tbx18 expressing cells. Staining was observed in the annulus fibrosus of the in tervertebral discs (B). Sectioning of vertebral columns of E16.5 embryos revealed that cells that had expressed Tbx18 formed most of the anterior annulus fibrosus and very little of the posterior annulus fibrosus. Staining was not observed in the nucleus p anterior; P, posterior; NP, nucleus pulposus; AF, annulus fibrosus; VB, vertebrae. Bruggeman BJ, Maier JA, Mohiuddin YS, Powers R, Lo Y, Guimaraes Camboa N, Evans SM, Harfe BD ; Copyright 2012 Developmental Dynamics.

PAGE 42

42 Figure 3 4. Histology of the intervertebral disc in various species. A M: Examination of the intervertebral region of S. canicula (A,D), A. mexicanum (B,E), B. orientallis (C,F), T. scripta (G,J), P. molurus bivittatus (H,K), A laysanensis (I,L), and C. perspicillata (M,N). White arrows denote intervertebral discs. 200x magnifications are of the intervertebral region of the disc. V, vertebrae; NP, nucleus pulposus; AF, annulus fibrosus. All p anels are frontal sections. At all stages shown (see Materials and Methods) discs should be fully formed. Bruggeman BJ, Maier JA, Mohiuddin YS, Powers R, Lo Y, Guimaraes Camboa N, Evans SM, Harfe BD; Copyright 2012 Developmental Dynamics.

PAGE 43

43 Figure 3 5. T he rostral half sclerotome forms the chicken intervertebral disc and the caudal region of cells that form this structure. R, rostral; C, caudal; IVD, intervert ebral disc. Bruggeman BJ, Maier JA, Mohiuddin YS, Powers R, Lo Y, Guimaraes Camboa N, Evans SM, Harfe BD; Copyright 2012 Developmental Dynamics.

PAGE 44

44 CHAPTER 4 NUCLEI PULPOSI FORMA TION FROM THE EMBRYO NIC NOTOCHORD OCCURS NORMALLY IN GDF 5 DEFICIENT MICE In this chapter, GDF 5 refers to protein, and Gdf5 refers to the gene or mRNA. Growth and Differentiation Factor 5 (GDF 5, also called BMP 14), a member of the transforming growth factor beta superfamily, has previously been i mplicated in disc formation ( Li et al., 2004 ) Mutations in transforming growth factor beta family members can lead to developmental disorders. In humans, aberrations in cartilage derived morphogenet ic protein 1, the human homologue of GDF 5, result in Hunter Thompson and Grebe type chondrodysplasias. Patients exhibit shortening of the long bones of the limbs and shortening of other limb elements. Both Hunter Thompson and Grebe type chondrodysplasias are autosomal recessive mutations ( Thomas et al., 1997 ; Thomas et al., 1996 ) Less severe is brachydactyly ty pe C, which results from the inactivation of one copy of cartilage derived morphogenetic protein 1 ( Polinkovsky et al., 1997 ) In these patients some of the distal phalanges are shortened. In the axial skeleton of humans, premature endplate disease was noted in the vertebral column of four carriers of a cartilage derived morphogenetic protein 1 mutation ( Savarirayan et al., 2003 ) suggesting that mutation of this gene in humans may cause disc defects. In the mouse there is a naturally occurring missense mutation in Gdf 5 called brachypodism which renders GDF 5 p rotein nonfunctional ( Storm et al., 1994 ) GDF 5 deficient mice have several skeletal abnormalities, including shorter long bones of the limb and a reduction of ph alanges in the digits ( Gruneberg and Lee, 1973 ; Li et al., 2004 ; Storm et al., 1994 ) In rabbits containing damaged discs, injection of GDF 5 protein was reported to increase disc height ( Chujo et al., 2006 ) Studies of GDF 5 protein treated damaged

PAGE 45

45 mouse discs found increases in collagens and proteoglycans ( Walsh et al., 2004 ) GDF 5 has also been overexpressed by inserting the Gdf5 cDNA into an adenovirus vector and infecting disc cells ; this treatment was found to increase cell proliferation and proteoglycans in vitro ( Wang et al., 2004 ) Nucleofection of disc cells with an expression vector containing Gdf 5 also resulted in increases of type II collagen and aggrecan ( Cui et al., 2008 ) Although mut ations i n Gdf 5 are thought to affect only the appendicular skeleton, it was re cently reported that Gdf5 / mice also contained deformed nuclei pulposi and a decrease in type II collagen and proteoglycans in the disc ( Li et al., 2004 ) Another report crossed the Gdf5 / mouse with a Gdf6 knockout mouse to generate Gdf5;Gdf6 double mutants. Some of the Gdf5;Gdf 6 double mutants developed scoliosis postnatally and had redu ced staining for cartilage matrix in vertebral processes ( Settle et al., 2003 ) To determine whether the reported defects in nuclei pulposi of Gdf 5 / mice were due to abnormal transitioning of the embry onic notochord into the nucleus pulposus, we performed a notochord fate mapping analysis in this mutant background. To do this we employed the Shhcre allele, which can be used to determine the cellular origin of n uclei pulposi in mutant mice. Mouse Cre alleles are used to remove DNA placed between two loxP DN A sequences in a tissue specifi c manner. CRE (Cre Recombinase) protein recognizes loxP DNA sequences and can instigate recombination between two loxP sites pre sent as direct repeats in the genome ( Lewandoski, 2001 ) In mice containing the Shhcre allele, CRE was expressed in all cells in which Shh messenger RNA (mRNA ) was observed, including the embryonic notochord. Our data show that embryonic notochord cells normally form the nucleus

PAGE 46

46 pulposus of the intervertebral disc in Gdf 5 / mice. This suggests that GDF 5 protein is not required for the transition of embryonic notochord cells into mature nuclei pulposi. In adult Gdf 5 / mice, nuclei pulposi were found to be composed of cells derived from the notochord, paralleling the situation in normal animals. Using RNA in situ hybridization, we found that Gdf 5 mRNA expressio n was absent from the notochord but surpris ingly present in the annulus fi brosus after discs had formed. No Gdf 5 mRNA was found within the nucleus pulposus. Additional Materials and Methods Animal Model All animals were maintained at the University of Flor ida under pathogen free conditions. All procedures were approved by the University of Florida Institutional Animal Care and Use Committee (UF IACUC). Gdf 5 ( brachypodism ) null mice (allele Gdf5 bp J ) were obtained from Jackson Laboratories (Bar Harbor, MI) and mated to animals containing both the Shhcre ( Harfe et al., 2004 ) and R26R ( Soriano, 1999 ) alleles. The Gdf5 bp J mouse has a premature stop codon resulting from a frameshift mutation that occurred when a dinucleotide was inserted (Jackson Laboratories). For the remainder of this chapter, Gdf5 bp J will be referred to as Gdf5 / The presence of the Shhcre and R26R alleles was determined by polymerase chain reaction (PCR) as published previously ( Harfe et al., 2004 ) and ( Soriano, 1999 ) Gdf 5 / mice were genotyped by examining the autopo ds of mutant animals (Figure 4 1 A). The autopod is the dis tal most portion of the limb and includes the bones of the carpals/tarsals and phalanges. The limb phenotype in Gdf 5 / mice is highly penetrant and observation of the limbs is frequently used to genotype these animals as opposed to PCR ( Li et al., 2004 ; Storm et al., 1994 ) Only homozygous mutant animals will display the phenotype;

PAGE 47

47 wild type and heterozygous animals are indistinguishable. The limb phenotype is identifi able at birth ( Storm et al., 1994 ) A m ale mouse of the genotype Gdf 5 + / ;Shhgfpcre;R26R was crossed with Gdf 5 / female mice to obtain animals for analysis. This mating scheme maximizes the number of mutant animals with the transgenic alleles and provides heterozygotic animals to use as controls. For timed matings, animals were set up late in the afternoon and the female mouse checked for the presence of a semen plug early the next morning. The day a plug was detected was d esignated E0.5. Newborn mice (P 0 ) were harvested for LacZ staining. RNA section in situ hybridization was done on wild type animals at E10.5, E12.5, and E14.5 while other mutant mice were aged up to 24 weeks for analysis. All animals were on a mixed genetic background. For the fate mapping and histology, three animals were examined for each genotype. In s itu Hybridization Section in situ hybridization for Gdf 5 and Shh were performed. For details, see Chapter 2 and Appendixes B and C. LacZ Fatemapping Skeletal Preparations, and Histology LacZ fatemapping, skeletal preparations, and hemotoxylin & eosin stai ning on Gdf 5 / and heterozygous littermates was done as described in Chapter 2. Results Gdf 5 Is Expressed in the Annulus Fibrosus But Not the Nucleus Pulposus of the Forming Discs Injection of GDF 5 within the disc has been reported to aid in disc repair ( Chujo et al., 2006 ; Walsh et al., 2004 ) However, the expression pattern of this gene during normal disc deve lopment had not been reported. To determine the in vivo localization of

PAGE 48

48 Gdf 5 mRNA, RNA in situ hybridization, a technique that determines mRNA localization in a tissue of interest, was performed. In E14.5 dis cs, Gdf 5 was found to be confined to the annulus fi brosus, which s urrounds the nucleus pulposus (Figure 4 2 red arrow). Surprisingly, no staining was observed in the nucleus pulposus (Figure 4 2 ). Gdf 5 was also observed in the rib joints, limbs, and parts of the brain, as previously reported ( Storm et al., 1994 ) (Figure 4 2 and data not shown). In addition, no expression was observed in the notochord of E10.5 and E12.5 embryos (Figure 4 2). Gdf 5 is strongly expr essed in the limbs of E12.5 embryos (data not shown). Shh in situs were performed on adjacent 16 (E10.5 and E12.5) or the nucleus pulposus (E14.5). Shh was confi ned to the noto chord, nucleus pulposus, and fl oorplate of the neural tube and was not expressed in the annulus fibrosus (Figure 4 2). In addition, Shh was found in the dorsal root ganglia at E14.5 (Figure 4 2 ). The Embryonic Notochord Forms Normal Nuclei Pulposi in Newborn Gdf 5 / Mice GDF 5 is required for t he formation of joints and recently has been demonstrated to be essential for the proper formation of adult nuclei pulposi ( Li et al., 2004 ) Previously, it was unkno wn if the disc defects reported in adult (20 week old mice) were due to defects during embryonic development or the result of GDF 5 playing an important role during postembryonic development. To determine whether GDF 5 was essential for formation of nuclei pulposi from the embryonic notochord we used the Shhcre and R26R alleles to fatemap the notochord in Gdf 5 / mice. Newborn m utant Gdf 5 mice were identifi ed at birth because of their characteristic small paw size ( Storm et al., 1994 ) (Figure 4 1A ). T his autopod phenotype is highly penetrant and found in both the forelimbs and hindlimbs. Limbs in Gdf 5 heterozygous (Figure 4 1 A) and wild type animals (not shown) are i ndistinguishable. Adults are shown

PAGE 49

49 here but newborns also displayed the same ph enotype. The presence of Shhcre and R26R alleles was determined using PCR (see Materials and Methods). Examination of the formation of nuclei pulposi from the embryonic notochor d revealed no defects in this structure in P 0 (newborn) mice (Figure 4 3A,B ). Consistent with what our laboratory previously observed in normal mice, the entire nucleus pulposus was composed of cells that arose from the embryonic notochord ( Choi et al., 2008 ; Risbud et al., 2010 ) In normal mice, rare notochord cells called notochordal remnants (blue cells outside the nucleus pulposus) were no ted to reside in the annulus fi brosus ( Choi et al., 2008 ) No increase in notochordal remnants was observed in the annulus fibrosus of Gdf 5 / mice (Figure 4 3B ). Twenty Four Week Old Gdf 5 / Mice Contain Nuclei Pulposi Derived From the Embryonic Notochord The discs of 24 week old mice containing the Shhcre and R26R alleles were examined to determine whether nuclei pulposi were composed o f notochord cells. The nuclei pulposi of both normal and Gdf 5 / mice were composed of cells derived from the emb ryonic notochord (Figure 4 4A,B ). There were no cells located in nuclei pulposi that were not ga lactosidase positive in Gdf 5 / mice indicati ng that nuclei pulposi, similar to the discs of normal adult mice, are not composed of cells that have migrated from the surrounding annulus fi brosus or disc end plates. Discussion In this study, we used the Shhcre and R26R alleles to determine whether nu clei pulposi in Gdf 5 / mice form correctly. Our fate mapping in both P0 (newborns) and animals aged 24 weeks revealed that all cells of the nuclei pulposi were derived from the embryonic notochord. This is in agreement with published fatemaps of wild type

PAGE 50

50 mice ( Choi et al., 2008 ; Risbud et al., 2010 ) There were a few cells outside the nucleus pulposus that were d erived from and have previously been proposed in humans to form a rare type of tumor called chordoma ( Choi et al ., 2008 ; Chugh et al., 2007 ; Vujovic et al., 2006 ) In Gdf 5 / animals, there did not appear any difference in the number of notochordal remnants c ompared with control littermates. Gdf 5 is expressed in many different tissues in the mouse and is known to be important for joint formation ( Francis West et a l., 1999 ; Storm et al., 1994 ; Storm and Kingsley, 1999 ; Thomas et al., 1996 ) Previous reports ha ve suggested that GDF 5 is required for formation of normal adult nuclei pulposi ( Li et al., 2004 ) Recently, a microarray analysis determined that Gdf 5 mRNA was high ly expressed in the discs of E13.5 embryos but this study did not investigate which region of the disc Gdf 5 was expressed in ( Sohn et al., 2010 ) Our data indicate that this gene is expressed in the annulus fi brosus but not the notochord or nuclei pulposi. GDF 5 is a secreted protein and it is possible that GDF 5 protein is secreted into the nucle us pulposus from the annulus fi brosus. Supporting this hypothesis, in the adult human, GDF 5 protein has been localized to the nucl eus pulposus via immunohistochemistry ( Le Maitre et al., 2009 ) Cu rrently, we have only detected Gdf 5 mRNA localization during embryogenesis. It is possibl e that during postnatal life Gdf 5 mRNA is expressed in nuclei pulposi and/or additional regions of the intervertebral discs O ur studies indicate that Gdf 5 is not necessary for the transitioning of the embryonic notochord into nuclei pulposi in the mouse. The reported defect in the morphology of nuclei pulposi and decreases in collagen and proteoglycans in the Gdf 5 /

PAGE 51

51 mouse intervertebral discs may be due to a degenerative effect ( Li et al., 2004 ) On the basis of our fate mapping of the notochord, there appears to be no developmental defect of the nucleus pulposus upon loss of GDF 5 protein. We cannot rule out the possibility that a defect in the formation of the annu lus fibrosus caused by Gdf 5 deficiency results in abnormal nuclei pulposi; however, histological analysis suggested that the annulus fibrosus formed normally in mutant mice. We do note that our studies were performed on a mixed genetic st rain background, w hich may infl uence the phenotypes produced upon removal of Gdf 5 This could explain the discrepancy between our results and that of Li and colleagues ( Li et al., 2004 ) in which they reported a deformity of the nucleus pulposus in Gdf5 / Our study used animals that were on a mixed background while Li et al did not. The presence of a mixed genetic background in our studies may have masked the role this gene may play in intervertebral disc development. However, the mixed ge netic background of the Gdf 5 / mice had no effect on the Gdf5 limb phenotype. Furthermore, there is more than one Gdf5 mouse strain available from Jackson Laboratories. The strain we used was Gdf5 bp J which has a premature stop codon caused by a frameshift mutation. Another strain also has a frameshift mutation that causes a stop codon, and another strain is an uncharacterized spontaneous mutation. It is possible that only one strain has a disc defect We do not know what strain Li and colleagues used in their experiments. Artifi cial introduction of GDF 5 protein into the intervertebral discs has been proposed as a potential treatment for disc degeneration ( Chujo et al., 2006 ; Walsh et al., 2004 ; Wang et al., 2004 ) In vivo studies were done, which involved the injection of GDF 5 protein into the disc ( Chujo et al., 2006 ; Walsh et al., 2004 ) Several in vitro

PAGE 52

52 studie s have also been performed where cultured disc cells were treated with GDF 5 protein ( Chujo et al., 2006 ; Le Maitre et al., 2009 ) Gdf 5 / disc cells have also been treated with GDF 5 and shown to undergo upregulation of collagens and proteogylcans (Li et al 2004) Cultured disc cells have been transfected with expression vectors containing GDF 5 ( Cui et al., 2008 ) Finally, GDF 5 has been overexpressed with an adenovirus in cultured disc cells ( Wang et al., 2004 ) Our data suggest that in a normal disc, Gdf 5 is produced in the annulus fi brosus, not the nucleus pulposus, suggesting that GDF 5 disc based therapies may increase their effectiveness by expressing GDF 5 in the annulus fi brosus of the intervertebral discs. The use of a genetic based system to follow the fate of notochord cells throughout the life of Gdf 5 / mice has allowed us to demonstrate that nuclei pulposi formation occurs normally in this mutant background. Our fate mapping technique can be used in any mouse mutant background t o determine whether nuclei pulposi are formed correctly from the embryonic notochord. The ability to follow the fate of cells that normally form nuclei pulposi in various mutant backgrounds may uncover unique genetic pathways that are involved in forming the intervertebral discs.

PAGE 53

53 Figure 4 1. Gdf 5 deficient ( brachypodism ) animals contain a reproducible and highly penetrant limb phenotype. Gdf 5 heterozygous and mutant adult limbs are shown. A ) Skeletal preparations of Gdf 5 adults demonstrating the presence of a smaller autopod in the mutant. B ) Shhcre and R26R alleles permit the fate mapping of cells that expressed Shh Maier JA, Harfe BD; Copyright 2011 Spine.

PAGE 54

54 Figure 4 2. Gdf 5 and Shh ex pression in the intervertebral disc. In situ hybridizations for Gdf 5 (left) and Shh (right). Gdf 5 is expressed in the annulus fi brosus of E14.5 embryos (red arrows) but not the notochord and nucleus pulposus (black arrows). Gdf 5 is also present in the E14. 5 rib joint (blue arrow). Shh is expressed in the notochord of E10.5 and E12.5 embryos and nucleus pulposus of E14.5 embryos (dark pink arrows). Shh is also present in the dorsal root ganglia (E14.5, dark blue arrow). Maier JA, Harfe BD; Copyright 2011 Spin e.

PAGE 55

55 Figure 4 3. Fatemap of notochord cells in P 0 (newborn) Gdf 5 heterozygous and null animals. Total magnifi cation: 100X. Newborn Gdf 5 animals containing R26R and Shhcre alleles demonstrated that notochord cells were correctly localized to the nucleus p ulposus. Both control and mutant mice contained notoc hordal remnants (black arrows). A ) Gdf 5 heterozygote. B ) Gdf 5 / Lower panels: hematoxylin and eosin stain of newborn discs. Maier JA, Harfe BD; Copyright 2011 Spine.

PAGE 56

56 Figure 4 4. Fatemap of notoch ord cells in 24 week old Gdf 5 heterozygous and null mice. Total magnifi cation: 50X. Both animals have the Shhcre and R26R alleles. A) Gdf 5 heterozygote disc. B ) Gdf 5 / disc. As in Figure 3, cells of the notochord w ere found to comprise the nucleus pulposu s. Lower panels: hematoxylin and eosin stained discs. Maier JA, Harfe BD; Copyright 2011 Spine

PAGE 57

57 CHAPTER 5 FOXA1 AND FOXA2 ARE REQUIRED FOR THE FOR MATION OF THE INTERVERTEBRAL DISC Forkhead Box Transcription Factors In the current study, mutant mice were used to examine the role of the Foxa gene family in the formation of the intervertebral disc. Fox a genes, formerly termed HNF3 (hepatocyte nuclear factors), were identified by their ability to bind to liver specific genes ( Clevidence et al., 1993 ; Costa et al., 1989 ) The first Fox gene, forkhead ( fkh ), was cloned in Drosophila Mutants in this gene, which is e xpressed in terminal regions of the fly embryo, contained homeotic transformations of these regions ( Weigel et al., 1989 ) Since their initial discovery, hundred s of Fox genes have been found in all animals including yeast, and nomenclature for this highly conserved family has been standardized ( Kaestner et al., 2000 ) In mice, the Foxa subfamily has three members, Foxa1 Foxa2 and Foxa3 ( Kaestner et al., 1994 ) They have been extensively studied in several tissues ( Kaestner et al., 1999 ; Lee et al., 2005a ; Sund et al., 2001 ; Wan et al., 2005 ) and are required for embryonic development and post natal life ( Kaestner, 2010 ) Foxa1 and Foxa2 are expressed in the notochord (Figure 5 1) and ( Besnard et al., 2004 ; Kaestner et al., 1994 ; Monaghan et al., 1993 ; Sasaki and Hogan, 1993 ) ; Foxa3 is not reported to be found in this structure and was not investigated in the current study. Foxa1 null mice contained a normal notochord and intervertebral discs but died within days of birth as a result of hypoglycemia and dehydration ( Kaestner et al., 1999 ) Foxa2 null mice died during early embryogenesis, completely lacked a node and notochord and contained abnormalities in all germ layers ( Ang and Rossant, 1994 ; Weinstein et al., 1994 )

PAGE 58

58 Due to the lack of a notochord in the Foxa2 null mouse, nuclei pulposi do not form and the function of this gene in the role of intervertebral disc formation could not be characterized. To circumvent the early lethality of the Foxa2 null mouse, our study utilized a Foxa2 conditional floxed mouse ( Sund et al., 2000 ) The Foxa2 conditional floxed allele has been used in conjunction with the Foxa1 null allele to examine lung and liver development, among other tissues ( Lee et al., 2005a ; Mavromatakis et al., 2011 ; Wan et al., 2005 ) To remove Foxa2 from the notochord, the tamoxife n inducible ShhcreER T2 allele was used ( Harfe et al., 2004 ) This allowed us to produce CRE protein in the embryonic notochord and remove a floxed Foxa2 allele in this tissue. Removal of both Foxa1 and Foxa2 from the notochord resulted in severe defects in the formation of the axial skeleton and aberrant dorsal ventral patterning of the neural tube. A molecular analysis revealed that Foxa gene expression in the noto chord was required for expression of Shh The individual removal of either Foxa1 or Foxa2 resulted in normal disc formation indicating that the Foxa genes are functionally redundant in the mouse notochord. Additional Materials & Methods Mouse Alleles Anima ls containing the Foxa1 null allele ( Foxa1 / ) and Foxa2 conditional allele ( Foxa2 c / c ) were originally generated by the Kaestner laboratory ( Kaestner et al., 1999 ; Sund et al., 2000 ) These animals were mated to mice containing the tamoxifen inducible ShhcreER T2 ( Harfe et a l., 2004 ) and R26R ( Soriano, 1999 ) alleles to create mice in which Foxa1 and Foxa2 could be deleted from the notochord (Fo xa1 / ; Foxa2 c / c ; ShhCreER T2 ; R26R R26R allele allowed for fate mapping of mutant cells. Matings

PAGE 59

59 were set up as described in Chapter 2. Animals homozygous for the Foxa2 conditional allele were phenotypically normal. Genotyping was performed as previously described ( Harfe et al., 2004 ; Kaestner et al., 1999 ; Soriano, 1999 ; Sund et al., 2000 ) Chapter 2 and Appendix A. At least three mutant animals were examined for each experiment. Control ani mal s were either Foxa1 +/+ ;Foxa2 c/c or Foxa1 +/ ;Foxa2 c/c Mice were maintained on a mixed genetic background. In situ Hybridization Probes used have been described previously: Shh ( Echelard et al., 1993 ) T ( Brachyury ) ( Wilkinson et al., 1990 ) Noto ( Abdelkhalek et al., 2004 ) Tbx18 ( Cai et al., 2008 ) Pax1 ( Brent et al., 2003 ) Pax3 ( Goulding et al., 1991 ) Nkx2.2 ( Qiu et al., 1998 ) Nkx6.1 ( Qiu et al., 1998 ) and Ptch1 ( Goodrich et al., 1996 ) Foxa1 and Foxa2 probes were made from IMAGE clones from Open Biosystems: Foxa1 (4911145) and Foxa2 (6488102). Protocol was done according to Chapter 2 and Appendices B and C. Histology, LacZ Staining, and Lyso T racker Assay Done as described in Chapter 2. Lyso T racker was performed on E10.5 and E11.5 embryos. LacZ used E10.5 and E12.5 embryos. For histology, paraffin embedded tissue was sectioned and stained with picrosi rius red and Alcian blue. Results Removal of Foxa1 and Foxa2 in the M ouse N otochord The Foxa1 null allele and the Foxa2 conditional floxed allele have been described previously ( Kaestner et al., 1999 ; Sund et al., 2000 ) Mice containing these alleles were crossed to animals containing the ShhcreER T2 allele ( Harfe et al., 2004 ) to generate Foxa1 +/ ; Foxa2 c/c ; ShhcreER T2 mice. These animals were phenotypically normal since the ShhcreER T2 allele only produces CRE protein in the presence of

PAGE 60

60 tamoxifen. Double mutant embryos were obtained by crossing Foxa1 +/ ; Foxa2 c/c ; ShhcreER T2 males to Foxa1 +/ ;Foxa2 c/ c females (diagrammed in Figure 5 2A). Tamoxifen was administered at E7.5 by oral gavage to remove the Foxa2 conditional allele in embryos that were homozygous for the Foxa1 null allele. In this report, mice that were null for Foxa1 and had Foxa2 removed in the notochord are referred to as Cre activity in the notochord, upon administration of tamoxifen at E7.5, was confirmed using the CRE inducible R26R reporter allele ( Soriano, 1999 ) ; ( Figure 5 2B). Shh is normally expressed in many tissues besides the notochord, including the floorplate ( Echelard et al., 1993 ) At the stage embryos were exposed to tamoxifen (E7.5), Shh has not been reported to be expressed in the floorplate. Consistent with these observa tions, CRE recombination of the R26R reporter was observed in the notochord but not the floorplate in embryos that had been given a single dose of tamoxifen at E7.5. These data are consistent with a previous published report in which we demonstrated that t amoxifen administration at E7.5 drives Cre expression in the notochord but not the floor plate ( Choi et al., 2012 ) To confirm the removal of Foxa2 from the notochord in tamoxifen treated embryos, immunohistochemistry for FOXA2 was performed using an antibody raised to a part of the protein that is deleted upon CRE induced recombination ( Lee et al., 2005b ) FOXA2 protein was found in the floorplate and notochord of E9.5 control embryos t hat had been treated with tamoxifen at E7.5 but lacked the ShhcreER T2 allele (Figure 5 2C). In Foxa2 c/c ; ShhcreER T2 embryos, FOXA2 was present in the floorplate but was absent from the notochord (Figure 5 2D). Immunohistochemistry was

PAGE 61

61 performed for LAMININ protein, which outlined the notochord, demonstrating that despite a lack of FOXA2 staining in the notochord that this tissue was still present in mutant animals (Figure 5 2E,F). Foxa1; Foxa2 D ouble K nockouts H ave S everely D eformed N uclei P ulposi To determi ne if Foxa1 ; Foxa2 double mutants contained defects in the intervertebral discs, late stage embryos were analyzed ( Foxa1 null mice die just after birth ( Kaestner e t al., 1999 ) ). Double mutants were observed to contain a shortened tail that lacked any discernable structures such as vertebrae or discs (data not shown). Vertebral columns of controls and mutants were analyzed using Alcian blue and picrosirius red stai ns. Picrosirius red stains collagens ( Junqueira et al., 1978 ; Junqueira et al., 1982 ) while Alcian blue stains cartilage and mucopolysaccharides ( Yamada, 1963 ) Control animals had fully formed intervertebral discs with clearly identifiable nuclei pulposi and annuli fibrosi (Figure 5 3A,D). Throughout this study control animals were either homozygous for the Foxa2 floxed allele ( Foxa 2 c/c ) or homozygous for the Foxa2 allele and heterozygous for the Foxa1 null allele ( Foxa1 +/ ; Foxa2 c/c ). Animals containing these genotypes were indistinguishable from wild type animals. It has been reported that expression of CRE protein can cause phenoty pes in some tissue types ( Naiche and Papaioannou, 2007 ) To determine if CRE protein produced from the ShhcreER T2 locus could cause disc defects Foxa2 c/c ;ShhcreER T2 animals were examined in detail. An extensive histological analysis revealed that the vertebral columns from these embryos were indistinguishable from controls (Figure 5 3B,E). These data also indicated that removal of only Foxa2 from the notochord was not sufficient to cause a phenotype in the vertebral column. In addition, removal of onl y

PAGE 62

62 Foxa1 from all cells ( Foxa1 / ; Foxa2 c/c embryos) also resulted in normal NP and vertebrae (data not shown). To determine if the lack of a phenotype in individual Foxa mutants was a result of compensation by the remaining gene, both Foxa1 and Foxa2 were r emoved from the embryonic notochord ( Foxa1 / ;Foxa2 c/c ;ShhcreER T2 ). In double mutants the NP was compressed and small (Figure 5 3C and F). The disc defects were more severe posteriorly than anteriorly. Double mutant embryos, in addition to having shorter t ails, also had shorter bodies than their littermates. These data suggest that Foxa1 and Foxa2 can compensate for each other during formation of the intervertebral discs and vertebrae, consistent with reports in other tissues in which phenotypes were only o bserved when both genes were removed from the same tissue ( Lee et al., 2005a ; Wan et al., 2005 ) The N otochord to N uclei P ulposi T ransition is A bnormal in Foxa1 ; Foxa2 D ouble M utants Nuclei pulposi form entirely from the embryonic notochord ( Choi et al., 2008 ) To determine if t he notochord to nuclei pulposi transition was abnormal in Foxa1 ; Foxa2 double mutants, notochord cells were fate mapped using the R26R CRE inducible reporter allele ( Soriano, 1999 ) The R26R reporter allele expresses LacZ in all cells in which CRE protein has been expressed. Embryos containing the ShhcreER T2 allele that have been exposed to tamoxifen at E7.5 express LacZ in the notochord. Imp ortantly, once cells express LacZ they, and all their descendants will express LacZ even if CRE protein is not longer present. Double mutants containing the R26R allele were harvested at E17.5 and treated with galactosidase to determine the fate of notoc hord cells. In control embryos (Figure

PAGE 63

63 5 3G) and embryos lacking Foxa2 (Figure 5 3H) notochord cells formed nuclei pulposi. In contrast, in double mutant embryos notochord cells were observed to reside throughout the vertebral column (Figure 5 3I). Consist ent with the observed increased lumbar severity in disc defects in the histological analysis, more notochord cells were found to be located outside nuclei pulposi in the lumbar region than in the thoracic region. Since it was not possible to obtain control animals from the floxed Foxa2 c/c mating (all embryos would be missing at least one copy of Foxa2 if they were positive for CRE), the control embryo was Shhgfpcre;R26R Mice containing the Shhgfpcre allele constitutively express Cre in all Shh descendants including the dorsal root ganglia (Figure 5 3G, ( Choi et al., 2008 ) ). Cell D eath is I ncreased in P osterior S omites and the T ail of Foxa1; Foxa2 D ouble M utants To ex amine cell death in Foxa1; Foxa2 knockout embryos, Lyso T racker reagent (Invitrogen) was used. At E10.5 similar levels of cell death were observed in control, single and double mutants (Figure 5 4A C). However, at E11.5 Foxa1; Foxa2 double mutants displayed massive cell death in the posterior somites and midline of the tail (Figure 5 4F,I) compared to control and Foxa2 notochord mutant littermates (Figure 5 4D,E,G,H). This dramatic amount of cell death likely results in the short tail found in E17.5 and E19.5 embryos examined. Due to the presence of ectopic cell death in double mutants beginning at E11.5, all gene expression analysis was performed prior to this embryonic stage. Noto and T ( Brachyury ) E xpression in Foxa1 ; Foxa2 D ouble M utants The transcription factors Noto and T ( Brachyury ) were examined by whole mount RNA in situ hybridization. Noto is responsible for the truncate ( tc ) mutation in mice,

PAGE 64

64 which affects development of the posterior notochord resulting in the lack of a tail ( Abdelkhalek et al., 2004 ) The zebrafish homologue of Noto flh (floating head), results in the absence of the notochord ( Talbot et al., 1995 ) Noto expression is reported to be dependent on the initial expression of both Foxa2 and T ( Abdelkhalek et al., 2004 ) To determine if Noto was downstream of Foxa RNA in situ hybridization was performed on E9.5 and E10.5 double mutant embryos. At this stage of development, FOXA2 protein is absent in the notochord of mutant embryos (see Figure 5 2D). In E9 .5 double mutants and littermates, Noto was robustly expressed throughout the tail (Figure 5 5A C). By E10.5 Noto was not detectable in the tail of double mutants (Figure 5 5 F ) but was found in the tails of control (Figure 5 5D), Foxa1 null (not shown), an d Foxa2 notochord knockouts (Figure 5 5E). T is expressed in the notochord ( Herrmann et al., 1990 ; Inman and Downs, 2006 ) and mice heterozygous for a mutation in this gene have been reported to have shorter tails ( Stott et al., 1993 ) In Foxa2 nu ll embryos the notochord does not form and as a result T is not expressed. In controls, mice that lacked Foxa2 in the notochord, Foxa1 null embryos (not shown) and double mutants, T was expressed throughout the posterior notochord at E10.5 ( Figure 5 5 G I ). The massive cell death observed in E11.5 embryos precluded an analysis of T expression at later stages. Foxa E xpression in the N otochord is not R equired for F ormation of the S clerotome Pax1 and Pax9 two transcription factors expressed in the sclerotome, are involved in the development of the vertebral column. Pax1; Pax9 double mutant mice do not form IVDs and lose the segmental arrangement of vertebrae ( Peters et a l., 1999 ) Analysis of Pax1 which is expressed in the early sclerotome, was performed using

PAGE 65

65 section RNA in situ hybridization. Pax1 was expressed in the sclerotome in the E10.5 forelimb (Figure 5 8A C) and hindlimb levels of all embryos ( Figure 5 5 J L ). Tbx18 maintains the anterior posterior polarity of the somites, and its loss results in abnormalities of the axial skeleton ( Bussen et al., 2004 ) Tbx18 express ed in the anterior somite ( Bussen et al., 2004 ; Kraus et al., 2001 ) was also found to be indistinguishable fr om control (Figure 5 5M), single knockout (Figure 5 5N), and Foxa1; Foxa2 double mutants ( Figure 5 5 O). Expression of Shh and A ctivation of the H edgehog S ignaling P athway R equires Foxa G ene E xpression in the N otochord Shh is expressed in the notochord and is required for the formation of IVDs ( Chiang et al., 1996 ; Choi and Harfe, 2011 ; Choi et al., 2012 ; Echelard et al., 1993 ) The Shh notochord enhancer element has been identified and shown to contain binding sites for FOXA family members ( Epstein et al., 1999 ) suggesting that FOXA proteins directly regulate expression of Shh within the notochord. The apparent functional redundancy between FOXA family members and the e arly lethality observed in Foxa2 null embryos has precluded a genetic analysis of the role FOXA proteins may play in activation of Shh and the hedgehog signaling pathway in the vertebrae notochord. To analyze the role FOXA proteins may play in regulating S hh E10.5 double mutant embryos were initially analyzed using RNA in situ hybridization. In control, Foxa1 null or Foxa2 notochord knockout mice, Shh was robustly expressed in the notochord and floorplate (Figure 5 6D, E, G, H). In Foxa1; Foxa2 double knock out embryos, Shh expression was decreased in the notochord of the tail and absent from the floorplate ( Figure 5 6 F and I ). Shh was expressed robustly in the posterior limbs of double mutants (Figure 5 6 F), consistent with the absence of CRE expression in t hese

PAGE 66

66 tissues (at E7.5, the time point of tamoxifen exposure, the ShhcreER T2 allele is not expressed in the limbs since these structures have not yet formed). To examine if this decrease of detectable Shh occurred earlier, we also performed in situ hybridiz ation with E9.5 mice. Control, Foxa1 null, and Foxa2 notochord knockout mice had robust expression of Shh in the brain, hindgut, and midline (Figure 5 6A,B). In contrast, the double mutant embryos lost Shh from the midline in the distal half of the body, t hough it was maintained in the hindgut and brain (Figure 5 6C, arrow). To confirm a decrease in hedgehog signaling in the notochord of double mutants, Ptch1 a direct target of the hedgehog pathway, was examined ( Goodrich et al., 1996 ; Jeong et al., 2004 ) In the tails of double knockout embryos, Ptch1 was decreased (Figure 5 6 L ) compared to control littermate s and embryos that had either Foxa1 or Foxa2 absent in the notochord (Figure 5 6J,K). Foxa E xpression in the N otochord is R equired for D orsal V entral P atterning of the N eural T ube The notochord is an important embryonic signaling center that is required for patterning the floorplate ( Stemple, 2005 ) Shh secreted from the notochord patterns the floorplate in a concentration dependent manner ( Ribes et al., 2010 ) Since Shh was decreased in Foxa1; Foxa2 double mutants (Figure 5 6), it was possi ble that neural tube patterning would be aberrant. Furthermore, dorsal ventral mispatterning of the neural tube has been described in Foxa2 null mice ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) Nkx6.1 a transcription factor that is typically expressed in the ventral half of the neural tube ( Qiu et al., 1998 ) was found to be normal at the hindlimb level of control (Figure 6A) and Foxa2 notochord knockout (Figure 5 7B) embryos at E10.5. In double

PAGE 67

67 mutants, Nkx6.1 expression was restricted to a smaller wedge shaped area in the double mutant when compared to its littermates (Figure 5 7C). Nkx2.2 is normally expressed on either side of the neural tube just above the floorplate. In double mutants (Figure 5 7F) expression was undetectable at the hindlimb level. Expression was present in the ventral neural tube of single mutants (Figure 5 7E and data not shown). Pax3 which is expressed in the dermomyotome and dorsal neural tube ( Gould ing et al., 1991 ) was examined in E10.5 embryos. At the hindlimb level, Pax3 was extended ventrally in the neural tube of Foxa1; Foxa2 double mutants (Figure 5 7I). Dermomyotome expression of Pax3 appeared unchanged in double mutants. At the level of the double mutant forelimb, expression of all genes examined was indistinguishable from controls (Figure 5 8). Discussion Foxa1 and Foxa2 are F unctionally R edundant in the N otochord Foxa2 null mice die lacking the node, which during later embryonic developme nt forms the notochord ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) To bypass the early requirement for F oxa2 in node formation, we removed Foxa2 from the notochord using a tissue specific Shh Cre line. In these mice, Foxa2 was expressed in the node but not the notochord, which allowed for the characterization of the role this gene played in the notochord and disc development during later stages of embryogenesis. In Foxa1 ; Foxa2 double mutants, Foxa1 was absent from all cells (null allele) while Foxa2 was only removed from the notochord in the vertebral column. Since Foxa1 null mice die postnatally and have full y formed discs ( ( Kaestner et al., 1999 ) and this report ) the phenotypes present in the double mutants were likely due to the removal of both of these genes from the notochord. However, we cannot rule out the possibility that Foxa 2

PAGE 68

68 expression in the floorplate plays a role in disc development in vertebral columns that lack Foxa2 in the notochord. In our study, Foxa2 was not removed from the floorplate since the Sh h promoter was not active in the floorplate during the time that embryos were exposed to tamoxifen. Finally, we cannot rule out any interaction between tamoxifen and Foxa1 in our single Foxa2 notochord knockout mice. FOXA1 protein has been shown to bind th e promoters of estrogen responsive genes (which are also bound by estrogen receptor alpha, ER ) throughout the genome ( Laganiere et al., 2005 ) Adding tamoxifen to the Foxa2 c/c ;ShhcreER T2 embryos may cause an interaction between the Foxa1 that still re mains and the estrogen receptors on the Cre allele, compensating for any potential phenotypes that could be seen in the disc. The C audal V ertebral C olumn is M ore S everely A ffected in Foxa1;Foxa2 D ouble K nockouts A common feature present in most mouse mu tants that have abnormal notochord development is that the caudal part of the animal is more severely malformed than the rostral part ( Abdelkhalek et al., 2004 ; Choi and Harfe, 2011 ; Herrmann et al., 1990 ) Consistent with these reports, the tails of double mutant Foxa1;Foxa2 mice lacked any discernable ver tebrae or disc structures at birth. In double mutant animals, defects were less severe in the rostral region of the embryo with well developed discs found above the forelimb level in double mutants. The rostral decrease in severity of disc defects was also observed in our analysis of molecular markers; forelimb level sections had normal gene expression of sclerotome and neural tube markers, while sections from the hindlimb level of double mutant embryos had aberrant gene expression. The forming notochord h as been fate mapped and found to be composed of three distinct regions: head notochord which is not derived from node cells, trunk

PAGE 69

69 notochord that is node derived, and tail notochord that forms from migrating node cells ( Yamanaka et al., 2007 ) The increasing severity of notochord defects in the caudal region of the embryo may be due to the notochord being derived from different regions of the embryo. The ShhcreE R T2 allele used in the current study to remove Foxa2 is expressed throughout the notochord ( Choi et al., 2008 ) However, it is currently unknown if this Cre allele is expressed in all regions of the notochord at E7.5, the time that tamoxifen was administered to remove Foxa 2. It is possible that CRE protein driven from the ShhcreER T2 allele is first expressed in caudal notochord cells, which would result in a transien t burst of FOXA2 protein expression in the anterior notochord prior to CRE induced recombination of the Foxa2 allele. Foxa1 and Foxa2 are R equired for A ctivation of the H edgehog S ignaling P athway in the N otochord SHH protein secreted from the notochord is required to pattern the neural tube, for formation of the notochordal sheath that surrounds the notochord and formation of nuclei pulposi ( Chiang et al., 1996 ; Choi and Harfe, 2011 ; Choi et al., 2012 ; Echelard et al., 1993 ; Jessell, 2000 ) In Foxa1;Foxa2 double knockouts, Shh mRNA was undetectable in the tail by E9.5 and decreased in the notochord at the hindlimb level of E10.5 embryos. Foxa2 has been proposed to activate transcription of Shh in the notochor d ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) and other embryonic tissues ( Mavromatakis et al., 2011 ; Wan et al., 2005 ) suggesting that FOXA proteins directly regulate the transcription of Shh in the embryonic notochord. A previous report identified a Shh notochord enhancer that was sufficient to drive reporter expression specifically in the notochord ( Epstein et al., 19 99 ) This enhancer element contained three Foxa binding sites that were required for reporter gene

PAGE 70

70 expression in the notochord ( Epstein et al., 1999 ) However, due to the early lethality of Foxa2 null embryos and functional redundancy between FOXA proteins, previous studies have been unable to confirm Shh regulation by FOXA proteins in vivo Our data directly demonstrate that expression of Shh in the notochord r equires FOXA proteins, suggesting that the previously identified FOXA binding sites in the Shh notochord enhancer are functional. Consistent with these data Ptch1 expression, a direct target of hedgehog signaling, in the caudal region of Foxa1;Foxa2 double knockouts was also reduced. The N eural T D Foxa1;Foxa2 D ouble M utants Studies using explant cultures have shown that Shh signaling counteracts expression of genes that are required for formation of the dorsal neural tube ( Fan and Tessier Lavigne, 1994 ) The expansion of dorsally expre ssed genes in the neural tube and the loss of ventral neural tube identity and motor neurons have been documented in the Foxa2 null mouse ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) A similar phenotype has also been reported in the Shh null mouse ( Chiang et al., 1996 ) In mice in which Foxa2 was absent in all cells (null animals), Pax3 was expanded throughout the entire neural tube ( Ang and Rossant, 1994 ) while markers of motor neurons such as Islet 1 were reported to be absent from the neural tube ( Weinstein et al., 1994 ) In double Foxa1;Foxa2 mutants, in which Foxa2 was absent fr om the notochord, expression domains of dorsal neural tube genes were expanded at the expense of ventral identity in the neural tube of double Foxa1 ; Foxa2 mutants was consistent wit h the observed decrease in Shh expression in the notochord.

PAGE 71

71 In the caudal region of double Foxa1 ; Foxa2 mutants, the floorplate appeared to be absent. The Foxa2 null mouse has also been reported to lack a floorplate (presumably because no notochord forms i n null embryos resulting in the absence of notochord produced SHH protein) ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) We speculate that the floorplate in Foxa1;Foxa2 double mutants does not form in the caudal embryo due to a requirement of FOXA expression in the notochord, which is required to activate Shh ( Ribes et al., 2010 ) Noto E xpression is not M aintained in Foxa1;Foxa2 D ouble K nockout E mbryos Noto has been proposed to be a target of FOXA2 since it is not expressed in chimeras between Foxa2 null ES cells and wild type tetraploid embryos ( Abdelkhalek et al., 2004 ) Tetraploid chimeras between Foxa2 null ES cells and wild type embryos have been described, and while they do not form the node or notochord, primitive streak morphogenesis is rescued ( Dufort et al., 1998 ) In our experiments, Noto was robustly expressed in the notochord of all double mutant embryos examined at E9.5. However at E10.5, Noto was absent from the tail of double knockout embryos. The presence of a notochor d in E10.5 embryos was confirmed by analysis of T which is expressed in the caudal notochord. These data suggest that Noto requires FOXA in the notochord to maintain its expression. However, it is currently unclear if FOXA proteins directly regulate Noto expression or if transcription of this gene is downstream of the hedgehog, or a yet unidentified signaling pathway. Foxa1 and Foxa2 transcription factors expressed in the notochord, play an important and functionally redundant role in intervertebral disc formation. The loss of both Foxa1 and Foxa2 from notochord cells results in an aberrant notochord to NP transition, cell death in the posterior somites and tail, and severe deformation of the NP.

PAGE 72

72 Our data demonstrate in vivo evidence for Shh being downstr eam of Foxa signaling in the notochord. The observed decrease in hedgehog signaling ultimately leads to a deformed IVD.

PAGE 73

73 Figure 5 1. Foxa1 and Foxa2 expression in the notochord. A D: Whole mount Foxa1 in situ hybridization. I K: Section in situ hybri dization for Foxa1 Foxa1 is undetectable at E7.5 (A), but expressed in the notochord at E8.5 (B D,I,J), floorplate (B D, J), midbrain and gut (B D, I). It remains on in the notochord until E12.5 (not shown). Foxa1 is not expressed in the NP (K), but remai ns in the floorplate until at least this stage (not shown). E H: Whole mount Foxa2 in situ hybridization. L N: Section in situ hybridization for Foxa2 Foxa2 is detectable at E7.5 (E) and remains faintly in the notochord until E8.5 (F,L). It is also expres sed in the floorplate, gut, and midbrain (F H), much like Foxa1 Foxa2 remains detectable in the floorplate until at least E14.5 (F H, L M, and data not shown). Purple staining in brain vesicles in (G) is signal pooling in the brain. Scale bars are 50 m fo r I and L, 100 m for J and M, and 200 m for K and N. Black arrow in I,J,L and M point to the notochord.

PAGE 74

74 Figure 5 2. Strategy to remove FOXA2 from the mouse notochord. A ) Mice heterozygous for the Foxa1 null allele ( Foxa1 +/ ), homozygous f or the Foxa2 floxed conditional allele (noted as Foxa2 c/c in this paper) and that contained the ShhcreER T2 allele were crossed to Foxa1 +/ ; Foxa2 c/c mice to create double knockouts. The pregnant dam was given tamoxifen by oral gavage (4mg) in corn oil when embryos were E7.5. B ) : Exposure of E7.5 embryos to tamoxifen that contained the ShhcreER T2 and CRE inducible R26R LacZ reporter resulted in reporter expression in the notochord (NC) but not the floorplate. The ShhcreER T2 allele is not active in the floor plate at E7.5. Scale bar is 100m. The ventral neural tube is outlined in black for clarity. C F: Confirmation of removal of Foxa2 c/c from the notochord using a FOXA2 specific antibody. C and D: FOXA2 protein was present in the notochord and floorplate of control embryos (C) but absent from the notochord of Foxa2 c/c ;ShhcreER T2 embryos (D; the notochord is outlined in white). E and F: The presence of a notochord in Foxa2 c/c ;ShhcreER T2 embryos was confirmed by staining for LAMININ protein. Dissociation of the notochord from the neural tube in D and F is likely a result of tissue processing. White arrows in C F denote the notochord. C F: Scale bar is 50m.

PAGE 75

75 Figure 5 3. Foxa1;Foxa2 double mutants have severe defects in intervertebral disc formation. A F: Alc ian blue and picrosirius red staining of disc sections. Scale bar is 200m. Thoracic sections at E19.5 show a normal sized nucleus pulposus (NP) surrounded by a red stained annulus fibrosus (AF) in control (A) Foxa2 notochord knockout (B) and Foxa1 null (d ata not shown) E19.5 embryos. Disc morphology was also normal at the lumbar region in these mice (D, E and data not shown). In Foxa1;Foxa2 double mutants (C and F) nuclei pulposi were abnormal. Nuclei pulposi were observed to be much smaller than nuclei pu lposi present in control or individual single mutants. The annulus fibrosus was present in double mutants but was disorganized. G and H: A fatemap of notochord cells using the R26R reporter allele demonstrated proper nuclei pulposi formation in control (G) and Foxa2 notochord knockouts (H). In contrast, Foxa1;Foxa2 double mutants (I) had severely deformed nuclei pulposi. Defects were more severe in the posterior. (G) is an embryo of the genotype Shhgfpcre;R26R White asterisk marks dorsal root ganglia. The Shhgfpcre allele is constitutively active, therefore all Shh expressing cells, including dorsal root ganglia, and their descendants are LacZ positive. All LacZ positive cells in H and I are derived exclusively from the notochord ( Choi et al., 2008 )

PAGE 76

76 Figure 5 4. Cell Death is increased in the tail of E11.5 but not E10.5 Foxa1;Foxa2 double mutant embryos. Cell death was assayed using Lyso T racker on live embryos a t E10.5 and E11.5. A C. Control (A), Foxa2 notochord knockouts (B), Foxa1 null (not shown) and Foxa1 ; Foxa2 double knockout embryos had similar amounts of cell death at E10.5. D I: At E11.5, control (D and G) and Foxa2 knockout (E and H) embryos had a small amount of cell death in the somites, dorsal tail, and end of the tail. In contrast, double mutant embryos (F and I) had a large increase in cell death in the somites and midline of the tail (white arrows). Cell death in the tail of double mutants at E11.5 may explain the shortening of the tail observed in later stage embryos. Images G I are zoomed in areas denoted by the boxes in D F.

PAGE 77

77 Figure 5 5. Expression of some notochord and sclerotome expressed genes are unaffected in Foxa1;Foxa2 double knockouts A C: E9.5 and D F: E10.5 whole mount in situ hybridization for Noto G I: E10.5 whole mount in situ hybridization for T ( Brachyury ). Both genes are expressed in the posterior notochord and expression extends through the tail of the embryo. Noto expressi on at E9.5 in single (B) and double mutants (C) was indistinguishable from control embryos (A). However, at E10.5, Noto was barely detectable in the tail of double mutants (F). J L: Pax1 expression at the hindlimb level (transverse sections are shown). Pax 1 is expressed in the sclerotome at E10.5. In controls (J), Foxa2 notochord knockouts (K), Foxa1 nulls (data not shown), and double mutants (L) there was no difference in Pax1 expression. M O: Sagittal sections showing Tbx18 expression at mid trunk level a t E10.5 Tbx18 is confined to the anterior sclerotome. No differences in expression of Tbx18 were observed in single (N and not shown) and double (O) mutants compared to control embryos (M). Scale bars are 200m.

PAGE 78

78 Figure 5 6. Hedgehog signaling is decr eased in Foxa1;Foxa2 double knockouts. A F: Shh whole mount RNA in situ hybridization. At E9.5, Shh mRNA is found in the brain, midline, and hindgut of control (A) and Foxa2 knockout embryos (B). In Foxa1;Foxa2 double mutants, midline expression terminates at the posterior end of the embryo (C, arrow) while it remains in control and single knockout embryos (A,B, arrows). At E10.5, Shh mRNA was robustly expressed in the posterior limbs and midline of control and Foxa2 knockout embryos (D and E). In Foxa1;Fox a2 double mutants, Shh was expressed in the posterior limbs but absent from the midline of the tail (F). G I: Scale bars are 50m. At the hindlimb level, Shh was expressed in the notochord (arrow) and floorplate (arrowhead) in control and single mutant emb ryos (D and E and data not shown). No Shh expression was observed in the floor plate of E10.5 double mutants (F). Expression was downregulated in the notochord (arrow). G I are transverse sections at the hindlimb level of E10.5 embryos. J L: Ptch1 whole mo unt in situ hybridization. Ptch1 expression was decreased in the tail of Foxa1;Foxa2 double mutants (L) compared to control (J) and Foxa2 mutants (K). Insets in A C, D F and J L are close up views of the boxed region shown in the respective figures.

PAGE 79

79 Fi gure 5 7. Dorsal ventral patterning of the neural tube is abnormal in Foxa1;Foxa2 double knockouts. Section in situ hybridization at E10.5 for Nkx6.1 (A C). Control (A), Foxa2 notochord knockout (B) and Foxa1 nulls (data not shown) had similar expression patterns in the ventral neural tube. However, in double Foxa1;Foxa2 knockouts (C), Nkx6.1 mRNA was restricted to a F: Nkx2.2 was constricted to a ventrally located band of cells in the neural tube in contro ls (D), Foxa1 nulls (data not shown) and Foxa2 notochord knockout (E). In Foxa1;Foxa2 double mutants, Nkx2.2 was undetectable (F). G I: Pax3 is normally expressed in the dorsal neural tube and in the dermomyotome. In control (G), Foxa1 nulls (data not show n) and Foxa2 notochord knockouts (H) Pax3 was expressed normally. In double mutants (I), Pax3 expression was expanded ventrally (black bars). Pax3 expression in the dermomyotome of double mutants was normal (I). A F: Scale bar 100m, G I: Scale bar 200m.

PAGE 80

80 Figure 5 8. Forelimb level expression of sclerotome and neural tube markers are normal in double mutants. A C: Forelimb level sections of Pax1 Controls (A), Foxa2 notochord knockouts (B), Foxa1 null (not shown), and double Foxa1;Foxa2 knockouts have robust Pax1 staining in the sclerotome. D F: Forelimb level sections of Nkx6.1 Nkx6.1 is confined to the ventral half of the neural tube in control (D), Foxa2 notochord knockout (E), Foxa1 null (data not shown), and double Foxa1;Foxa2 knockout embryos. G I: Nkx2.2 at the forelimb level. Nkx2.2 is expressed just dorsal to the floorplate in control (G), Foxa2 notochord knockout (H), Foxa1 null (data not shown), and double Foxa1;Foxa2 knockouts (I). J L: Pax3 at forelimb level. Pax3 is expressed in the dermom yotome and dorsal half of the neural tube in control (J), Foxa2 notochord knockout (K), Foxa1 null (data not shown), and double Foxa1;Foxa2 knockouts (L). Scale bars: A C, J L: 200m. D I: 100m.

PAGE 81

81 CHAPTER 6 CONCLUDING REMARKS These studies described examin ed the formation of the intervertebral disc, focusing mainly on the nucleus pulposus, which forms from the embryonic notochord ( Choi et al., 2008 ) Using both natur ally occurring mouse mutants and knockout and conditional alleles, we examined the effects of gene removal on the nucleus pulposus development. In Chapter 3, a histological study on a selection of vertebrates demonstrated that the nucleus pulposus is a u niquely mammalian structure. Perhaps other organisms can adequately transmit forces and resist compression in the axial skeleton without the NP. It could be possible that the different changes in posture throughout vertebrate evolution (from a sprawled out limb posture, to a posture where the limbs are under the body) ( Kardong, 2006 ) may require the function of a nucleus pulposus. The nucleus pulposus is present in both quadrupedal and bipedal mammals. Through fate mapping with lipophilic dyes and by Shh and Brachyury staining, the origin of the chicken disc was found to be non notochordal. The disc in chicks comes from the rostral portion of the sclerotome. In mice, use of the Tbx18:Cre allele allowed the fate of an terior sclerotome cells to be followed. Tbx18 descendants were found to contribute to part of the annulus fibrosus in mice. Thus we confirmed the origin of the development of the mouse annulus fibrosus and also contributed to knowledge of chicken disc deve lopment. Previous literature showed deformity of the disc in the Gdf5 / mouse ( Li et al., 2004 ) which has well characterized chondrodysplasias affecting the bones o f the limbs. Gdf5 is not expressed in the notochord or nucleus pulposus, but in the annulus fibrosus. In Chapter 4 we sought to determine if the observed disc deformity was a result of

PAGE 82

82 aberrant notochord to nucleus pulposus transition. To do this the Gdf 5 null mouse NP was fate mapped by crossing them with R26R and Shhgfpcre alleles, allowing the expression of LacZ in all cells that express Shh and their descendants. To our surprise, this resulted in a properly formed disc, despite following mice for up t o 6 months of age. The limb phenotype described in the Gdf5 null mouse was still maintained. This highlights the complexity of the development of the disc; we proposed that genetic factors (perhaps keeping our mice on a mixed background) could obscure the previously observed phenotype. In addition, there was more than one allele available with the Gdf5 mutation; two resulted in a premature stop codon, truncating the protein, and the other was an uncharacterized mutant. It could be that our study made use of a different allele than Li et al, as we have no knowledge of what background their mice were. Thus, Gdf5 may still have an important role in disc formation. Finally, in Chapter 5, the previously unknown role of the Foxa1 and Foxa2 genes in the formation of the disc were elucidated. Due to embryonic lethality and lack of a notochord in the Foxa2 null mouse, its potential role in disc development had not been evaluated ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) By combining the Foxa1 null allele with the Foxa2 conditional floxed allele (under the control of the tamoxifen inducible ShhcreER T2 allele), we were able to remove Foxa2 from the notochord in the Foxa1 null mouse. Consistent with data in other organ systems ( Lee et al., 2005a ; Wan et al., 2005 ) Foxa genes were found to have compensatory roles in the notochord; both had to be removed to see the severely deformed nucleus pulposus. The Foxa genes were found to be required for the activation of Shh in the notochord; Shh (and hedgehog signaling) has been well established to be required for patterning of the disc ( Chiang et

PAGE 83

83 al., 1996 ; Choi and Harfe, 2011 ; Choi et al., 2012 ) The reduction of Shh in the notochord also had consequences for the dorso ventral patterning of the neural tube. Thus, this study confirmed that Shh is do wnstream of Foxa in the notochord in vivo Perhaps by replacing hedgehog signaling in these Foxa1;Foxa2 double mutants, the disc defect can be ameliorated. There is an activating mutation in Smoothened, which is usually inhibited by the Patched1 gene is he dgehog signaling. This mutation has been described in basal cell carcinomas, and results in the permanent activation of hedgehog signaling ( Xie et al., 1998 ) The m utation has also been made into a mouse allele, which has been used to study craniofacial development ( Jeong et al., 2004 ) By crossing this Activated smoothened a llele into our Foxa1;Foxa2 mice, we can activate hedgehog signaling in the notochord in the Foxa1;Foxa2 knockouts. If Foxa is really required for activation of hedgehog signaling in the notochord, this experiment should override the effect of the knockout and at least form a more normal disc. This experiment is ongoing at the time of this dissertation. These data supplement the growing body of literature on disc development. Removal of genes from the sclerotome and/or notochord can have drastic effects on formation and patterning of proper intervertebral discs, highlighting the importance of the interactions between these two tissues. An important next step in the examination of the disc would be to uncover the molecular signals involved in maintaining a h ealthy disc and finally, signals that contribute to the degeneration of the disc. We have shown in Chapter 5, and others have demonstrated previously that sonic and the hedgehog signaling pathway is important in the formation of the intervertebral disc ( Choi and Harfe, 2011 ; Choi et al., 2012 ) In newborn and later stages, o ther investigators have

PAGE 84

84 showed a role for p ost natal hedgehog signaling being active in the disc ( Dahia et al., 2012 ) and also suggested that hedgehog controls other pathways, such as TGF beta and Wnt ( Dahia et al., 2012 ) TGF beta signaling is also proposed to control growth and disc maintenance post natally ( Jin et al., 2011 ) Perhaps the use of RNA or protein microarray technology to uncover other potential genes in the developed and degenerating disc could be done, not only in mouse but also in humans. This could provide an insight into other pathways we could potentially reactivate or inhibit to ameliorate disc degeneration. Use of the mouse model has proved a powerful tool for the elucidation of the proper formation of various tissues, including the disc. It is possible th at work could lead to the reactivation of developmental pathways, or reintroduction of molecules important for maintaining disc health in order to regenerate a healthy disc. Discovery of and use of inhibitory molecules that keep the disc from degenerating are another potential avenue down which to develop treatments for disc degeneration, and back pain.

PAGE 85

85 APPENDIX A PRIMER SEQUENCES USE D FOR GENOTYPING

PAGE 86

86 Table A 1 Oligonucleotides in PCR Allele Primer name Primer sequence T m (C) Reference Shhcre BHCreF2 TGACGGTGGGAGAATGTTAAT 53.8 ( Harfe et al., 2004 ) BHCreR1 GCCGTAAATCAATCGATGAGT 52.9 Rosa26R SorF AAAGTCGCTCTGAGTTGTTAT 51.8 ( Soriano, 1999 ) SorR1 GCGAAGAGTTTGTCCTCAACC 56.2 SorR2 GGAGCGGGAGAAATGGATATG 55.3 Foxa1 Foxa1F CTCCGGCCTGGGCTCTATGAAC 61.8 ( Kaestner et al., 1999 ) Foxa1L CGCCATTCGCCATTCAGGCTGC 63.9 Foxa1R GCCCATGGAGCCCATGCCTCC 65.7 Foxa2 Foxa2F CCCCTGAGTTGGCGGT 62.8 ( Sund et al., 2000 ) Foxa2R TTGCTCACGGAAGAGTAGCC 57.0 n/a T7* TAATACGACTCACTATAG GG 48.3 idtdna.com n/a T3* AATTAACCCTCACTAAAGGG 50.4 idtdna.com

PAGE 87

87 APPENDIX B IN SITU HYBRIDIZATIO N: PLASMIDS AND DETA ILED METHODS Table B 1 Plasmids used for in situ hybridization Gene name Plasmid number Organism Antisense enzyme Antisense polymerase Reference Foxa1 BH230 Mouse SalI T7 IMAGE Foxa2 BH217 Mouse SalI T7 IMAGE G df 5 BH53 Mouse EcoRI T7 Gift from Cliff Tabin Nkx2.2 BH286 Mouse T7 T3 PCR T7 ( Qiu et al., 1998 ) Nkx6.1 BH287 Mouse BamHI T7 ( Qiu et al., 1998 ) Noto BH223 Mouse Sac2 Sp6 ( Abdelkhalek et al., 2004 ) Pax1 BH264 Mouse T7 T3 PCR T3 ( Brent et al., 2003 ) Pax3 BH259 Mouse T7 T3 PCR T7 ( Goulding et al., 1 991 ) Ptch1 BH141 Mouse BamHI T3 ( Goodrich et al., 1996 ) Shh BH39 Mouse HindIII T3 ( Echelard et al., 1993 ) Shh BH16 Chicken SalI Sp6 Gift from Cliff Tabin T (Brachyury) BH218 Mouse BamHI T3 ( Wilkinson et al., 1990 ) Tbx18 BH298 mouse EcoRI Sp6 ( Cai et al., 2008 )

PAGE 88

88 APPENDIX C UNABRIDGED IN SITU M ETHODS Unabridg ed Methods: Section in situ Hybridization Embedding: 1. Dissect embryos in DEPC PBS, fix in 4% DEPC PFA overnight at 4C. 2. Put in 30% DEPC sucrose overnight at 4C. 3. Put in OCT: sucrose for a few hours at RT. 4. Embed in 100% OCT on dry ice, store at 80C un til ready to section. 5. Cut sections at 12 14m, store in 80C. ISH Day 1 (Use DEPC treated solutions for everything!) 1. Spray slide box with RNAse Zap, add slides and let them thaw/dry (I stopped doing the RNase Zap). 2. PAP Pen around sections. 3. Rinse with DEP C water. 4. Acid hydrolysis: 0.2M HCl 15 min. (833L 12M HCl in 50mL DEPC water). 5. Wash 2x 5min DEPC PBS. 6. Wash 1x 6min Proteinase K (1g/mL). 1L in 10mL DEPC PBS *do not let this go over 6 min* 7. Wash 1x 10 min DEPC PBS 8. Fix with 4% DEPC PFA 5 min. 9. Wash 2x 5 mi n DEPC PBS 10. Acetylation: 0.25% acetic acid for 10 min. (25L glacial acetic acid in 10mL DEPC water). 11. Wash 2x 5 min DEPC PBS 12. Add pre warmed prehybe at 65C, incubate 15 min. (add 10% dextran sulphate to prehybe and dissolve beforehand). Also add probe to prehybe at warm up for 15 min. (usually 1uL probe for 200 300L prehybe). 13. Remove prehybe, add probe and coverslip with a piece of parafilm. Add an open bottle of water to incubator, can also pour DEPC water into slide box. Incubate overnight at 65C. I SH Day 2 (No longer need DEPC solutions). Pre warm SSC solutions. 1. Wash 1x 5 min in 5X SSC + 0.1% Triton X100 at 65C. 2. Wash 1x 30 min in 2X SSC + 50% formamide + 0.1% Triton X100 at 65C. 3. Wash 2x 30 min in 2X SSC + 0.1% Triton X100 at 65C. 4. Wash 2x 30 min in 0.2X SSC + 0.1% Triton X100 at 65C. 5. Wash 3x in KTBT 5 min. each at RT 6. Block 1 hr RT in 10% goat serum (heat inactivated) in KTBT. Also block antibody in 5% goat serum in KTBT (1:2000). 7. Add antibody, coverslip with parafilm and incubate overnight at 4 C. ISH Day 3 (optional to do for part of day and then move to day 4) 1. KTBT washes all day (about 1 hr each, at least 6 times). Leave in cold room overnight.

PAGE 89

89 ISH Day 4 1. Wash 1x in AP buffer 5 min. 2. Wash 1x in AP buffer 30 min. 3. Put into color solution (BM p urple) add parafilm, put at 37C, usually comes up quick but can leave overnight if background is not coming up. 4. Once color is done, wash 2x in AP 30 min. 5. Rinse with PBS 6. Fix in 4% PFA 10 min. 7. Rinse with PBS 8. Mount with glycergel, coverslip. 9. Dry overnight, p hotograph the next day. Solutions: KTBT: 50mM Tris pH 7.5 150mM NaCl 10mM KCl 0.1% Tween For 1L use 50mL 1M Tris, 30mL 5M NaCl, 10mL 1M KCl, 1mL Tween20, water to fill. AP: 100mM NaCl 100mM Tris pH 9.5 0.1% Tween20 For 1L use 20mL 5M NaCl, 100m L Tris pH 9.5, 1mL Tween20, water to fill. Color Solutions *have been using BM purple instead of this For 50mL: 45mL AP buffer 5mL DMF (dimethylformamide) 350uL BCIP 338uL NBT NBT: dissolve powder at 75mg/mL in 70% DMF BCIP: dissolve powder at 50 mg/mL in 100% DMF If using INT (fluorescein probe) stock is 50mg/mL in 100% DMF, use instead of NBT. Whole Mount in situ Hybridization Dissect out embryos (early stage to E10.5/11.5) in PBS, fix in 4% PFA overnight at 4 C. Change embryos to 1% PFA the ne xt day or start Day1 (can store like this for weeks). Day 1 : Wash 2x 5 min in PBT 25% MeOH/PBT 5 min

PAGE 90

90 50% MeOH/PBT 5 min 75% MeOH/PBT 5 min 100% MeOH 5 min (can stop here and put in 20 C) 6% H 2 O 2 /MeOH 1 hour 100% MeOH 2x 5 min (can also stop here an d freeze embryos at 20 C, will keep for at least 2 years) 75% MeOH/PBT 10 min 50% MeOH/PBT 10 min 25% MeOH/PBT 10 min PBT 3x 5 min Proteinase K Treatment: time and concentration dependent upon embryo size. DO NOT OVERTREAT. E7.5/E8.5: No Prot K treatment, just go to fix E9.5: 10mg/mL for 10 min. E10.5: 10mg/mL for 15 20 min PBT Rinse Fix in 4% PFA + 0.2% gluteraldehyde in PBT 20 min PBT rinse Wash 2x 5 min PBT Add prehybe, incubate at least 1 hour at 70 C (Can also leave overnight or over a Add fresh prehybe and add probe, incubate overnight at 70 C. (I add 1L/embryo). Day 2 : Prewarm solution 1 to 70 C before starting, make blocking solutions early as they take time to dissolve. Rinse with Solu tion 1 4x 30 min. solution 1 at 70 C 5 min at room temp in 50/50 Solution 1: MABT (store leftover at 4 C)

PAGE 91

91 2x 30 min in MABT Block for 1 hr in 2% BR/MABT (can store leftover in freezer) Block for 1 or more hrs in 20% HINGS/2% BR/MABT (can store leftov er in freezer) Add anti DIG (or anti Fluorescein) antibody at 1:2000 to the 20% HINGS/2%BR/MABT, incubate overnight at 4 C. Day 3 : MABT wash all day. Sometimes MABT gets cloudy, you can gravity filter it if this happens. First rinse in MABT 3x. Then 6 washes for 45 60 min (time is not critical on this, change it when you can). Final wash put in 4 C overnight. Day 4 : Developing Color. NTMT gets cloudy sometimes, it can be gravity filtered. 4x 10 min in NTMT Add BM purple (Roche) and keep in the dark. Once developed, wash a few times with NTMT, then PBS, and fix in 4% PFA overnight. Can store at 4 C in 1% PFA for months. Alternately, develop with BCIP/NBT, use 5L of each reagent for every 1mL NTMT, incubate in dark, and once develop do as listed abo ve. Solutions Used: 10x PBS (1L): 80g NaCl 2g KCl 14.4g Na 2 PO 4 2.4g KH 2 PO 4 pH to 7.4 w/ HCl PBT: 1x PBS + 0.1% Tween 20 Prehybridization solution: 50% formamide 5x SSC (pH to 4.5 w. citric acid) (20x stock) 2% SDS (20% stock) 2% BR (Blocking reagent, Roche) 250g/mL tRNA (Roche) 100g/mL heparin (Sigma) Mix dry ingredients, add liquids, use water to bring to volume, mix and dissolve at 65 C until blocking reagent is in solution, aliquot and freeze at 20 C.

PAGE 92

92 Solution 1: Keep in dark bottle in refrigerator 50% formamide 2X SSC pH4.5 1% SDS Bring to volume with water MABT (1X): 100mM Maleic acid 150mM NaCl Bring to pH 7.5 w. NaOH pellets (start with 7g, then add extra pellets very slowly, easy to overshoot). A dd Tween 20 0.1% NTMT pH9.5 100mM NaCl 100mM Tris pH9.5 50mM MgCl 2 0.1% Tween 20 NBT stock: 50mg/mL in 70% DMF (dimethyl formamide), store at 20 C BCIP stock: 25mg/mL in water (store at 20 C). There is also a DMF soluble form, this can be us ed too, just double check from manufacturer which solution it is soluble in! HINGS (heat inactivated goat serum): Goat serum, heat inactivate at 56 C for 30 min, aliquot and store at 20 C. 2% BR: Blocking reagent (Roche), dissolve in MABT at 55 C.

PAGE 93

93 LIST OF REFERENCES Abdelkhalek, H.B., Beckers, A., Schuster Gossler, K., Pavlova, M.N., Burkhardt, H., Lickert, H., Rossant, J., Reinhardt, R., Schalkwyk, L.C., Muller, I., Herrmann, B.G., Ceolin, M., Rivera Pomar, R., Gossler, A., 2004. Th e mouse homeobox gene Not is required for caudal notochord development and affected by the truncate mutation. Genes & development 18, 1725 1736. Ang, S.L., Rossant, J., 1994. HNF 3 beta is essential for node and notochord formation in mouse development. Ce ll 78, 561 574. Aszodi, A., Chan, D., Hunziker, E., Bateman, J.F., Fassler, R., 1998. Collagen II is essential for the removal of the notochord and the formation of intervertebral discs. The Journal of cell biology 143, 1399 1412. Bagnall, K.M., Sanders, E .J., 1989. The binding pattern of peanut lectin associated with sclerotome migration and the formation of the vertebral axis in the chick embryo. Anatomy and embryology 180, 505 513. Besnard, V., Wert, S.E., Hull, W.M., Whitsett, J.A., 2004. Immunohistoche mical localization of Foxa1 and Foxa2 in mouse embryos and adult tissues. Gene expression patterns : GEP 5, 193 208. Boos, N., Weissbach, S., Rohrbach, H., Weiler, C., Spratt, K.F., Nerlich, A.G., 2002. Classification of age related changes in lumbar inter vertebral discs: 2002 Volvo Award in basic science. Spine 27, 2631 2644. Brent, A.E., Schweitzer, R., Tabin, C.J., 2003. A somitic compartment of tendon progenitors. Cell 113, 235 248. Brent, A.E., Tabin, C.J., 2002. Developmental regulation of somite deri vatives: muscle, cartilage and tendon. Current opinion in genetics & development 12, 548 557. Bruggeman, B.J., Maier, J.A., Mohiuddin, Y.S., Powers, R., Lo, Y., Guimaraes Camboa, N., Evans, S.M., Harfe, B.D., 2012. Avian intervertebral disc arises from ros tral sclerotome and lacks a nucleus pulposus: implications for evolution of the vertebrate disc. Developmental dynamics : an official publication of the American Association of Anatomists 241, 675 683. Bussen, M., Petry, M., Schuster Gossler, K., Leitges, M., Gossler, A., Kispert, A., 2004. The T box transcription factor Tbx18 maintains the separation of anterior and posterior somite compartments. Genes & development 18, 1209 1221. Cai, C.L., Martin, J.C., Sun, Y., Cui, L., Wang, L., Ouyang, K., Yang, L., B u, L., Liang, X., Zhang, X., Stallcup, W.B., Denton, C.P., McCulloch, A., Chen, J., Evans, S.M., 2008. A myocardial lineage derives from Tbx18 epicardial cells. Nature 454, 104 108.

PAGE 94

94 Casazza, B.A., 2012. Diagnosis and treatment of acute low back pain. Ameri can family physician 85, 343 350. Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H., Beachy, P.A., 1996. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383, 407 413. Choi, K.S., Cohn, M.J., Harfe, B.D., 2008. Identification of nucleus pulposus precursor cells and notochordal remnants in the mouse: implications for disk degeneration and chordoma formation. Developmental dynamics : an official publication of the American Association of A natomists 237, 3953 3958. Choi, K.S., Harfe, B.D., 2011. Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs. Proceedings of the National Academy of Sciences of the United St ates of America 108, 9484 9489. Choi, K.S., Lee, C., Harfe, B.D., 2012. Sonic hedgehog in the notochord is sufficient for patterning of the intervertebral discs. Mechanisms of development. Chrastil, J., Patel, A.A., 2012. Complications associated with post erior and transforaminal lumbar interbody fusion. The Journal of the American Academy of Orthopaedic Surgeons 20, 283 291. Christ, B., Huang, R., Wilting, J., 2000. The development of the avian vertebral column. Anatomy and embryology 202, 179 194. Christ, B., Ordahl, C.P., 1995. Early stages of chick somite development. Anatomy and embryology 191, 381 396. Chugh, R., Tawbi, H., Lucas, D.R., Biermann, J.S., Schuetze, S.M., Baker, L.H., 2007. Chordoma: the nonsarcoma primary bone tumor. The oncologist 12, 13 44 1350. Chujo, T., An, H.S., Akeda, K., Miyamoto, K., Muehleman, C., Attawia, M., Andersson, G., Masuda, K., 2006. Effects of growth differentiation factor 5 on the intervertebral disc -in vitro bovine study and in vivo rabbit disc degeneration model stud y. Spine 31, 2909 2917. Clevidence, D.E., Overdier, D.G., Tao, W., Qian, X., Pani, L., Lai, E., Costa, R.H., 1993. Identification of nine tissue specific transcription factors of the hepatocyte nuclear factor 3/forkhead DNA binding domain family. Proceedin gs of the National Academy of Sciences of the United States of America 90, 3948 3952. Costa, R.H., Grayson, D.R., Darnell, J.E., Jr., 1989. Multiple hepatocyte enriched nuclear factors function in the regulation of transthyretin and alpha 1 antitrypsin gen es. Molecular and cellular biology 9, 1415 1425.

PAGE 95

95 Cui, M., Wan, Y., Anderson, D.G., Shen, F.H., Leo, B.M., Laurencin, C.T., Balian, G., Li, X., 2008. Mouse growth and differentiation factor 5 protein and DNA therapy potentiates intervertebral disc cell aggr egation and chondrogenic gene expression. The spine journal : official journal of the North American Spine Society 8, 287 295. Dahia, C.L., Mahoney, E., Wylie, C., 2012. Shh signaling from the nucleus pulposus is required for the postnatal growth and diffe rentiation of the mouse intervertebral disc. PloS one 7, e35944. Dahia, C.L., Mahoney, E.J., Durrani, A.A., Wylie, C., 2009. Postnatal growth, differentiation, and aging of the mouse intervertebral disc. Spine 34, 447 455. de Kleuver, M., Oner, F.C., Jacob s, W.C., 2003. Total disc replacement for chronic low back pain: background and a systematic review of the literature. European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Sect ion of the Cervical Spine Research Society 12, 108 116. Devereaux, M.W., 2007. Anatomy and examination of the spine. Neurologic clinics 25, 331 351. Dufort, D., Schwartz, L., Harpal, K., Rossant, J., 1998. The transcription factor HNF3beta is required in v isceral endoderm for normal primitive streak morphogenesis. Development 125, 3015 3025. Echelard, Y., Epstein, D.J., St Jacques, B., Shen, L., Mohler, J., McMahon, J.A., McMahon, A.P., 1993. Sonic hedgehog, a member of a family of putative signaling molecu les, is implicated in the regulation of CNS polarity. Cell 75, 1417 1430. Epstein, D.J., McMahon, A.P., Joyner, A.L., 1999. Regionalization of Sonic hedgehog transcription along the anteroposterior axis of the mouse central nervous system is regulated by H nf3 dependent and independent mechanisms. Development 126, 281 292. Fan, C.M., Tessier Lavigne, M., 1994. Patterning of mammalian somites by surface ectoderm and notochord: evidence for sclerotome induction by a hedgehog homolog. Cell 79, 1175 1186. Franc is West, P.H., Abdelfattah, A., Chen, P., Allen, C., Parish, J., Ladher, R., Allen, S., MacPherson, S., Luyten, F.P., Archer, C.W., 1999. Mechanisms of GDF 5 action during skeletal development. Development 126, 1305 1315. Goldstein, R.S., Kalcheim, C., 199 2. Determination of epithelial half somites in skeletal morphogenesis. Development 116, 441 445.

PAGE 96

96 Goodrich, L.V., Johnson, R.L., Milenkovic, L., McMahon, J.A., Scott, M.P., 1996. Conservation of the hedgehog/patched signaling pathway from flies to mice: ind uction of a mouse patched gene by Hedgehog. Genes & development 10, 301 312. Goulding, M.D., Chalepakis, G., Deutsch, U., Erselius, J.R., Gruss, P., 1991. Pax 3, a novel murine DNA binding protein expressed during early neurogenesis. The EMBO journal 10, 1 135 1147. Gruneberg, H., Lee, A.J., 1973. The anatomy and development of brachypodism in the mouse. Journal of embryology and experimental morphology 30, 119 141. Hamburger, V., Hamilton, H.L., 1992. A series of normal stages in the development of the chic k embryo. 1951. Developmental dynamics : an official publication of the American Association of Anatomists 195, 231 272. Harfe, B.D., Scherz, P.J., Nissim, S., Tian, H., McMahon, A.P., Tabin, C.J., 2004. Evidence for an expansion based temporal Shh gradien t in specifying vertebrate digit identities. Cell 118, 517 528. Herrmann, B.G., Labeit, S., Poustka, A., King, T.R., Lehrach, H., 1990. Cloning of the T gene required in mesoderm formation in the mouse. Nature 343, 617 622. Huang, R., Zhi, Q., Wilting, J., Christ, B., 1994. The fate of somitocoele cells in avian embryos. Anatomy and embryology 190, 243 250. Hunter, C.J., Matyas, J.R., Duncan, N.A., 2003. The notochordal cell in the nucleus pulposus: a review in the context of tissue engineering. Tissue engi neering 9, 667 677. Hyman, L.H., Wake, M.H., 1992. Hyman's comparative vertebrate anatomy, 3rd ed. University of Chicago Press, Chicago. Inman, K.E., Downs, K.M., 2006. Localization of Brachyury (T) in embryonic and extraembryonic tissues during mouse gast rulation. Gene expression patterns : GEP 6, 783 793. Jeong, J., Mao, J., Tenzen, T., Kottmann, A.H., McMahon, A.P., 2004. Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia. Genes & development 18, 937 951. Jessell, T.M., 2000. Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nature reviews. Genetics 1, 20 29. Jin, H., Shen, J., Wang, B., Wang, M., Shu, B., Chen, D., 2011. TGF beta signaling plays an essential role in t he growth and maintenance of intervertebral disc tissue. FEBS letters 585, 1209 1215.

PAGE 97

97 Junqueira, L.C., Cossermelli, W., Brentani, R., 1978. Differential staining of collagens type I, II and III by Sirius Red and polarization microscopy. Archivum histologic um Japonicum = Nihon soshikigaku kiroku 41, 267 274. Junqueira, L.C., Montes, G.S., Sanchez, E.M., 1982. The influence of tissue section thickness on the study of collagen by the Picrosirius polarization method. Histochemistry 74, 153 156. Kaestner, K.H., 2010. The FoxA factors in organogenesis and differentiation. Current opinion in genetics & development 20, 527 532. Kaestner, K.H., Hiemisch, H., Luckow, B., Schutz, G., 1994. The HNF 3 gene family of transcription factors in mice: gene structure, cDNA seq uence, and mRNA distribution. Genomics 20, 377 385. Kaestner, K.H., Katz, J., Liu, Y., Drucker, D.J., Schutz, G., 1999. Inactivation of the winged helix transcription factor HNF3alpha affects glucose homeostasis and islet glucagon gene expression in vivo. Genes & development 13, 495 504. Kaestner, K.H., Knochel, W., Martinez, D.E., 2000. Unified nomenclature for the winged helix/forkhead transcription factors. Genes & development 14, 142 146. Kardong, K.V., 2006. Vertebrates : comparative anatomy, function, evolution, 4th ed. McGraw Hill Higher Education, Boston. Katz, J.N., 2006. Lumbar disc disorders and low back pain: socioeconomic factors and consequences. The Journal of bone and joint surgery. American volume 88 Suppl 2, 21 24. Kepler, C.K., Anderson, D .G., Tannoury, C., Ponnappan, R.K., 2011. Intervertebral disk degeneration and emerging biologic treatments. The Journal of the American Academy of Orthopaedic Surgeons 19, 543 553. Kraus, F., Haenig, B., Kispert, A., 2001. Cloning and expression analysis of the mouse T box gene Tbx18. Mechanisms of development 100, 83 86. Laganiere, J., Deblois, G., Lefebvre, C., Bataille, A.R., Robert, F., Giguere, V., 2005. From the Cover: Location analysis of estrogen receptor alpha target promoters reveals that FOXA1 d efines a domain of the estrogen response. Proceedings of the National Academy of Sciences of the United States of America 102, 11651 11656. Le Maitre, C.L., Freemont, A.J., Hoyland, J.A., 2009. Expression of cartilage derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells. Arthritis research & therapy 11, R137.

PAGE 98

98 Lee, C.S., Friedman, J.R., Fulmer, J.T., Kaestner, K.H., 2005a. The initiation of liver development is dependent on Foxa transcription factors. Nature 435, 944 947. Lee, C.S., Sund, N.J., Behr, R., Herrera, P.L., Kaestner, K.H., 2005b. Foxa2 is required for the differentiation of pancreatic alpha cells. Developmental biology 278, 484 495. Lewandoski, M., 2001. Condition al control of gene expression in the mouse. Nature reviews. Genetics 2, 743 755. Li, X., Leo, B.M., Beck, G., Balian, G., Anderson, G.D., 2004. Collagen and proteoglycan abnormalities in the GDF 5 deficient mice and molecular changes when treating disk cel ls with recombinant growth factor. Spine 29, 2229 2234. Liu, L.T., Huang, B., Li, C.Q., Zhuang, Y., Wang, J., Zhou, Y., 2011. Characteristics of stem cells derived from the degenerated human intervertebral disc cartilage endplate. PloS one 6, e26285. Marti n, B.I., Turner, J.A., Mirza, S.K., Lee, M.J., Comstock, B.A., Deyo, R.A., 2009. Trends in health care expenditures, utilization, and health status among US adults with spine problems, 1997 2006. Spine 34, 2077 2084. Martin, P., 1990. Tissue patterning in the developing mouse limb. The International journal of developmental biology 34, 323 336. Mavromatakis, Y.E., Lin, W., Metzakopian, E., Ferri, A.L., Yan, C.H., Sasaki, H., Whisett, J., Ang, S.L., 2011. Foxa1 and Foxa2 positively and negatively regulate Sh h signalling to specify ventral midbrain progenitor identity. Mechanisms of development 128, 90 103. Mo, R., Freer, A.M., Zinyk, D.L., Crackower, M.A., Michaud, J., Heng, H.H., Chik, K.W., Shi, X.M., Tsui, L.C., Cheng, S.H., Joyner, A.L., Hui, C., 1997. Sp ecific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development. Development 124, 113 123. Monaghan, A.P., Kaestner, K.H., Grau, E., Schutz, G., 1993. Postimplantation expression patterns indicate a role for the mou se forkhead/HNF 3 alpha, beta and gamma genes in determination of the definitive endoderm, chordamesoderm and neuroectoderm. Development 119, 567 578. Moore, R.J., 2006. The vertebral endplate: disc degeneration, disc regeneration. European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society 15 Suppl 3, S333 337. Murtaugh, L.C., Chyung, J.H., Lassar, A.B., 1999. Sonic hedgehog promotes somi tic chondrogenesis by altering the cellular response to BMP signaling. Genes & development 13, 225 237.

PAGE 99

99 Naiche, L.A., Papaioannou, V.E., 2007. Cre activity causes widespread apoptosis and lethal anemia during embryonic development. Genesis 45, 768 775. Nie to, M.A., Patel, K., Wilkinson, D.G., 1996. In situ hybridization analysis of chick embryos in whole mount and tissue sections. Methods in cell biology 51, 219 235. Peacock, A., 1951. Observations on the prenatal development of the intervertebral disc in m an. Journal of anatomy 85, 260 274. Peacock, A., 1952. Observations on the postnatal structure of the intervertebral disc in man. Journal of anatomy 86, 162 179. Peters, H., Wilm, B., Sakai, N., Imai, K., Maas, R., Balling, R., 1999. Pax1 and Pax9 synergis tically regulate vertebral column development. Development 126, 5399 5408. Polinkovsky, A., Robin, N.H., Thomas, J.T., Irons, M., Lynn, A., Goodman, F.R., Reardon, W., Kant, S.G., Brunner, H.G., van der Burgt, I., Chitayat, D., McGaughran, J., Donnai, D., Luyten, F.P., Warman, M.L., 1997. Mutations in CDMP1 cause autosomal dominant brachydactyly type C. Nature genetics 17, 18 19. Qiu, M., Shimamura, K., Sussel, L., Chen, S., Rubenstein, J.L., 1998. Control of anteroposterior and dorsoventral domains of Nkx 6.1 gene expression relative to other Nkx genes during vertebrate CNS development. Mechanisms of development 72, 77 88. Raj, P.P., 2008. Intervertebral disc: anatomy physiology pathophysiology treatment. Pain practice : the official journal of World Instit ute of Pain 8, 18 44. Ribes, V., Balaskas, N., Sasai, N., Cruz, C., Dessaud, E., Cayuso, J., Tozer, S., Yang, L.L., Novitch, B., Marti, E., Briscoe, J., 2010. Distinct Sonic Hedgehog signaling dynamics specify floor plate and ventral neuronal progenitors i n the vertebrate neural tube. Genes & development 24, 1186 1200. Risbud, M.V., Schaer, T.P., Shapiro, I.M., 2010. Toward an understanding of the role of notochordal cells in the adult intervertebral disc: from discord to accord. Developmental dynamics : an official publication of the American Association of Anatomists 239, 2141 2148. Rufai, A., Benjamin, M., Ralphs, J.R., 1995. The development of fibrocartilage in the rat intervertebral disc. Anatomy and embryology 192, 53 62. Sasaki, H., Hogan, B.L., 1993. Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo. Development 118, 47 59.

PAGE 100

100 Savarirayan, R., White, S.M., Goodman, F.R., Graham, J.M., Jr., Delatycki, M.B., Lachman, R.S., Rimoin D.L., Everman, D.B., Warman, M.L., 2003. Broad phenotypic spectrum caused by an identical heterozygous CDMP 1 mutation in three unrelated families. American journal of medical genetics. Part A 117A, 136 142. Settle, S.H., Jr., Rountree, R.B., Sinha, A., Thacker, A., Higgins, K., Kingsley, D.M., 2003. Multiple joint and skeletal patterning defects caused by single and double mutations in the mouse Gdf6 and Gdf5 genes. Developmental biology 254, 116 130. Smith, L.J., Nerurkar, N.L., Choi, K.S., Harfe, B.D., Elliott, D.M., 2011. Degeneration and regeneration of the intervertebral disc: lessons from development. Disease models & mechanisms 4, 31 41. Smits, P., Lefebvre, V., 2003. Sox5 and Sox6 are required for notochord extracellular matrix sheath formation, n otochord cell survival and development of the nucleus pulposus of intervertebral discs. Development 130, 1135 1148. Sohn, P., Cox, M., Chen, D., Serra, R., 2010. Molecular profiling of the developing mouse axial skeleton: a role for Tgfbr2 in the developme nt of the intervertebral disc. BMC developmental biology 10, 29. Soriano, P., 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nature genetics 21, 70 71. Stemple, D.L., 2005. Structure and function of the notochord: an essential organ for chordate development. Development 132, 2503 2512. Storm, E.E., Huynh, T.V., Copeland, N.G., Jenkins, N.A., Kingsley, D.M., Lee, S.J., 1994. Limb alterations in brachypodism mice due to mutations in a new member of the TGF beta superfamily. Nature 368, 639 643. Storm, E.E., Kingsley, D.M., 1999. GDF5 coordinates bone and joint formation during digit development. Developmental biology 209, 11 27. Stott, D., Kispert, A., Herrmann, B.G., 1993. Rescue of the tail defect of Brachyury mice. Genes & developmen t 7, 197 203. Sund, N.J., Ang, S.L., Sackett, S.D., Shen, W., Daigle, N., Magnuson, M.A., Kaestner, K.H., 2000. Hepatocyte nuclear factor 3beta (Foxa2) is dispensable for maintaining the differentiated state of the adult hepatocyte. Molecular and cellular biology 20, 5175 5183. Sund, N.J., Vatamaniuk, M.Z., Casey, M., Ang, S.L., Magnuson, M.A., Stoffers, D.A., Matschinsky, F.M., Kaestner, K.H., 2001. Tissue specific deletion of Foxa2 in pancreatic beta cells results in hyperinsulinemic hypoglycemia. Genes & development 15, 1706 1715.

PAGE 101

101 Talbot, W.S., Trevarrow, B., Halpern, M.E., Melby, A.E., Farr, G., Postlethwait, J.H., Jowett, T., Kimmel, C.B., Kimelman, D., 1995. A homeobox gene essential for zebrafish notochord development. Nature 378, 150 157. Thomas, J.T ., Kilpatrick, M.W., Lin, K., Erlacher, L., Lembessis, P., Costa, T., Tsipouras, P., Luyten, F.P., 1997. Disruption of human limb morphogenesis by a dominant negative mutation in CDMP1. Nature genetics 17, 58 64. Thomas, J.T., Lin, K., Nandedkar, M., Camar go, M., Cervenka, J., Luyten, F.P., 1996. A human chondrodysplasia due to a mutation in a TGF beta superfamily member. Nature genetics 12, 315 317. Urban, J.P., Smith, S., Fairbank, J.C., 2004. Nutrition of the intervertebral disc. Spine 29, 2700 2709. Vuj ovic, S., Henderson, S., Presneau, N., Odell, E., Jacques, T.S., Tirabosco, R., Boshoff, C., Flanagan, A.M., 2006. Brachyury, a crucial regulator of notochordal development, is a novel biomarker for chordomas. The Journal of pathology 209, 157 165. Walsh, A.J., Bradford, D.S., Lotz, J.C., 2004. In vivo growth factor treatment of degenerated intervertebral discs. Spine 29, 156 163. Wan, H., Dingle, S., Xu, Y., Besnard, V., Kaestner, K.H., Ang, S.L., Wert, S., Stahlman, M.T., Whitsett, J.A., 2005. Compensator y roles of Foxa1 and Foxa2 during lung morphogenesis. The Journal of biological chemistry 280, 13809 13816. Wang, H., Kroeber, M., Hanke, M., Ries, R., Schmid, C., Poller, W., Richter, W., 2004. Release of active and depot GDF 5 after adenovirus mediated o verexpression stimulates rabbit and human intervertebral disc cells. J Mol Med (Berl) 82, 126 134. Wang, Y., Videman, T., Battie, M.C., 2012. Lumbar Vertebral Endplate Lesions: Prevalence, Classification and Association with Age. Spine. Weigel, D., Jurgens G., Kuttner, F., Seifert, E., Jackle, H., 1989. The homeotic gene fork head encodes a nuclear protein and is expressed in the terminal regions of the Drosophila embryo. Cell 57, 645 658. Weinstein, D.C., Ruiz i Altaba, A., Chen, W.S., Hoodless, P., Prezi oso, V.R., Jessell, T.M., Darnell, J.E., Jr., 1994. The winged helix transcription factor HNF 3 beta is required for notochord development in the mouse embryo. Cell 78, 575 588. Wilkinson, D.G., Bhatt, S., Herrmann, B.G., 1990. Expression pattern of the mouse T gene and its role in mesoderm formation. Nature 343, 657 659.

PAGE 102

102 Xie, J., Murone, M., Luoh, S.M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J.M., Lam, C.W., Hynes, M., Goddard, A., Rosenthal, A., Epstein, E.H., Jr., de Sauvage, F.J., 1998. Activating Smoothened mutations in sporadic basal cell carcinoma. Nature 391, 90 92. Yamada, K., 1963. Staining of sulphated polysaccharides by means of alcian blue. Nature 198, 799 800. Yamanaka, Y., Tamplin, O.J., Beckers, A., Gossler, A., Ro ssant, J., 2007. Live imaging and genetic analysis of mouse notochord formation reveals regional morphogenetic mechanisms. Developmental cell 13, 884 896.

PAGE 103

103 BIOGRAPHICAL SKETCH Jennifer Maier was born in New Jersey and raised in south Florida. She was interested in science from an early age and went on to do her Bachelor of Science at Florida Atlantic University in biology. As an undergraduate she did research in the lab of ere she earned her Masters of Science degree; her work involved using the yeast three hybrid system to discover RNA binding proteins involved in heart development. In 2007, she moved to Gainesville to do her Doctor of Philosophy at the University of Florid a in knockout models to study the development of the intervertebral disc. She also attempted to model chordoma, a rare tumor found along the axial skeleton, in the mouse model. Wh en not in the lab, she enjoys cooking, exercise, music, and video games.