<%BANNER%>

Engineering Multifunctional DNA Nanomachines for Analytical and Biomedical Applications

Permanent Link: http://ufdc.ufl.edu/UFE0044844/00001

Material Information

Title: Engineering Multifunctional DNA Nanomachines for Analytical and Biomedical Applications
Physical Description: 1 online resource (186 p.)
Language: english
Creator: You, Mingxu
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: dna -- nanomachine -- nanowalker -- photocontrol
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The development of nanotechnology has been largelyinspired by the biological world. The complex, but well-organized, livingsystem hosts an array of molecular-sized machines responsible for informationprocessing, structure building, and sometimes movement. Recently, the specific hybridization of DNAmolecules has been used to construct self-assembled devices, e.g., a mechanical device to mimic cellular protein motors in nature. Future smartnanostructures will have to rely on molecular assembly for unique and advanced functions. The objective of this research is to design and realize multifunctionalnucleic acid-based nanomachines, which can mimic the magic biological world andfurther provide tools to rival nature and regulate the cellular environments. First, an efficient pyrene-assisted method wasdeveloped for the photolysis of disulfide bonds. To demonstrate the biomedical applicationsof such pyrene disulfide molecular assemblies, the rapid photo-driven disassembly of a DNAmicelle structure and multiple turnover properties of a DNAzyme analog werestudied. Based on this interesting phenomenon, a novel light-powered DNAmechanical device, which is reminiscent of cellular protein motors in nature, was developed.This walking device is capable of autonomous locomotion, with light control ofinitiation, termination and velocity. To address the problem of reversibility androute selection for DNA walkers, we further studied a newlight-powered DNA mechanical device based on the photoisomerization ofazobenzene moieties and toehold-mediated strand displacement. This autonomousdevice is capable of moving towards either end of the track, simply byswitching the wavelength of light irradiation, UV (365nm) or visible(>450nm). Similarly, the structures and activities of azobenzene-modified DNA/enzymenano-conjugates could be fine-tuned by light. Finally, we describe our attempt to make use of easily availableand smartly engineered DNA aptamer logic circuits that perform simultaneouslogical analysis of different cancer cell-surface markers and, in response,produce a diagnostic signal and targeted photodynamic therapy. This strategyis capableof programmable profiling of at least four coexisting cell surface markers. The new multifunctional DNA nanomachines developedin our study will provide advanced tools, with sensing, “thinking”, andregulating abilities, for unique analytical and biomedical applications.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mingxu You.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044844:00001

Permanent Link: http://ufdc.ufl.edu/UFE0044844/00001

Material Information

Title: Engineering Multifunctional DNA Nanomachines for Analytical and Biomedical Applications
Physical Description: 1 online resource (186 p.)
Language: english
Creator: You, Mingxu
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: dna -- nanomachine -- nanowalker -- photocontrol
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The development of nanotechnology has been largelyinspired by the biological world. The complex, but well-organized, livingsystem hosts an array of molecular-sized machines responsible for informationprocessing, structure building, and sometimes movement. Recently, the specific hybridization of DNAmolecules has been used to construct self-assembled devices, e.g., a mechanical device to mimic cellular protein motors in nature. Future smartnanostructures will have to rely on molecular assembly for unique and advanced functions. The objective of this research is to design and realize multifunctionalnucleic acid-based nanomachines, which can mimic the magic biological world andfurther provide tools to rival nature and regulate the cellular environments. First, an efficient pyrene-assisted method wasdeveloped for the photolysis of disulfide bonds. To demonstrate the biomedical applicationsof such pyrene disulfide molecular assemblies, the rapid photo-driven disassembly of a DNAmicelle structure and multiple turnover properties of a DNAzyme analog werestudied. Based on this interesting phenomenon, a novel light-powered DNAmechanical device, which is reminiscent of cellular protein motors in nature, was developed.This walking device is capable of autonomous locomotion, with light control ofinitiation, termination and velocity. To address the problem of reversibility androute selection for DNA walkers, we further studied a newlight-powered DNA mechanical device based on the photoisomerization ofazobenzene moieties and toehold-mediated strand displacement. This autonomousdevice is capable of moving towards either end of the track, simply byswitching the wavelength of light irradiation, UV (365nm) or visible(>450nm). Similarly, the structures and activities of azobenzene-modified DNA/enzymenano-conjugates could be fine-tuned by light. Finally, we describe our attempt to make use of easily availableand smartly engineered DNA aptamer logic circuits that perform simultaneouslogical analysis of different cancer cell-surface markers and, in response,produce a diagnostic signal and targeted photodynamic therapy. This strategyis capableof programmable profiling of at least four coexisting cell surface markers. The new multifunctional DNA nanomachines developedin our study will provide advanced tools, with sensing, “thinking”, andregulating abilities, for unique analytical and biomedical applications.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mingxu You.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044844:00001


This item has the following downloads:


Full Text

PAGE 1

1 ENGINEERING MULTIFUNCTIONAL DNA NANOMACHINES FOR ANALYTICAL AND BIOMEDICAL APPLICATIONS By MINGXU YOU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Mingxu You

PAGE 3

3 To My Beloved Wife and Parents

PAGE 4

4 ACKNOWLEDGMENTS I am deeply indebted to a long list of people, without whom this dissertation would not be possible. My first thanks go to my exceptional research advisor, Dr. Weihong Tan, for the invaluable guidance, suggestions and help from different aspects during my study and life at the University of Florida. The encouragement and inspiration he constantly delivered have made me into a more mature, confident person and a better scientist. I would also express my sincere gratitude to my committee members, Dr. W. David Wei, Dr. Gail E. Fanucci Dr. Y. Charles Cao and Dr. Gregory Sch ultz for t heir advice, support and encouragement. I greatly appreciate Dr. Kathryn R. Williams for her kindness and help with all my projects and the manuscript preparations. I would like to thank Dr. Valeria D. Kleiman, Dr. John R. Eyler and Dr. Steven B enner for the ir critical comments I also want to thank Dr. Ben Smith for all the help and support. This dissertation is a result of successful collaborations with scientists in different areas. I am very thankful for the guidance and tremendous help from Dr. Haipeng Liu during my first year of research; he has taught me not only the skills in the area of nucleic acid study and organic synthesis, but more importantly the scientific way of thinking. I appreciate Dr. Yan Chen, Dr. Ruowen Wang and Dr. Kelong Wang for their critical comments and helpful discussions. I would also thank Dr. YuFen Huang, Dr. Kwame Sefah, Dr. Youngmi Kim, Dr. Joseph Phillips, Dr. Huaizhi Kang, Dr. Xiaoling Zhang, Dr. Ling Meng, Dr. Dalia Lopez Colon, Dr. Suwussa Bamrungsap Dr. Hu i Wang, Dr. Liu Yang, Dr. Meghan Altman, Dr. Dimitri van Simaeys, Dr. Marie Carmen Estevez, Dr. Jilin Yan and Xiangling Xiong for their training of the instrument usage and kindness h elp

PAGE 5

5 It has been a great privilege to spend several years in the Tan research group, and its members will always remain dear to me. I would like to thank Dr. Xiaohong Tan, Dr. Zilong Zhao, Dr. Quan Yuan, Dr. Ibrahim Shukoor, Dr. Yanrong Wu, Dr. William Chen, Dr. Basri Gulbakan, Dr. Dosung Sohn, Lu Peng, Tao Chen, Guizhi Zhu, Ji n Huang, Elizabeth Jimenez, Sena Cansiz for their helpful discussions and support. I am grateful to Dr. Erqun Song, Cuichen Wu, Ismail Ocsoy, Emir Yasun, Yunfei Zhang, Fujian Huang, Bincheng Yin, Jing Zheng, Jian Wang, Chunmei Li, Bo Liu, Dr. Xilin Xiao and others for their kindness and help. Each of them has made this journey very enjoyable and pleasant. Also, I am deeply grateful to my wife, Ying Lu, for being a wonderful companion, friend, and lover. Without her, I can achieve nothing. She made me mature and keep improving; she made me know the responsibility of a husband and a good person. I owed her a lot. Finally, I owe a huge debt of gratitude to my parents for their unfailing love, encouragement, support and companion. Their great personality, end less love and constant guidance make me who I am. Their love will drive me to succeed in different stage of my life.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 ABSTRACT ................................................................................................................... 14 CHAPTER 1 INTRODUCTION .................................................................................................... 16 Molecular Engineering of Nucleic Acid Probes ....................................................... 16 Review of Nucleic Acid Structures .................................................................... 16 Aptamers: Molecules for BioRecognition ......................................................... 18 Molecular Beacons (MBs) ................................................................................ 21 DNAzymes: Catalytical Nucleic Acids .............................................................. 23 Functional Nucleic AcidBased Nanomachines ...................................................... 24 DNA Micelles .................................................................................................... 24 ToeholdMediated Strand Displacement .......................................................... 25 Functional Nucleic Acid Nanomachines for Cellular Studies ............................ 26 Phot oresponsive Molecules and Photocontrollable Nanomachines ........................ 27 Photoresponsive Molecules .............................................................................. 27 Azobenzene Molecules .................................................................................... 29 Molecular Motors and Artificial Mimics .................................................................... 29 ProteinBased Molecular Motors ...................................................................... 29 Small Mo lecule Based Artificial Walkers .......................................................... 30 Nucleic Acid Based Artificial Walkers ............................................................... 31 2 PYRENE ASSISTED EFFICIENT PHOTOLYSIS OF DISULFIDE BO NDS IN DNA BASED MOLECULAR ENGINEERING .......................................................... 36 Background ............................................................................................................. 36 Experimental Section .............................................................................................. 37 Chemicals and Reagents ................................................................................. 37 DNA Synthesis ................................................................................................. 37 Synthesis of D isulfide B ridged P yrene D erivative ............................................. 37 Gel Electrophoresis and Data Analysis ............................................................ 38 Micelle Characterization ................................................................................... 38 Gel Based DNAzyme Mi mic Activity Assay ...................................................... 38 Results and Discussion ........................................................................................... 39 The Proof of Efficient Disulfide Bond Cleavage ................................................ 39 The Effect of Number, Distance of Pyrenes on the Cleavage Efficiency .......... 39 The Mechanism of the Disulfide Bond Photolysis ............................................. 40

PAGE 7

7 Application in Dissociating Micelle Structure .................................................... 41 Application in Building DNA Enzyme Analog .................................................... 42 Conclusions ............................................................................................................ 43 3 AN AUTONOMOUS AND CONTROLLABLE LIGHT DRIVEN DNA WALKING DEVICE .................................................................................................................. 50 Background ............................................................................................................. 50 Experimental Section .............................................................................................. 52 Chemicals and Reagents ................................................................................. 52 Synthesis of P yrene P hosphoramidite and DNA .............................................. 52 PAGE Gel Analysis .......................................................................................... 53 FRET M easurements ....................................................................................... 54 Manipulation of the W alking S ystem ................................................................ 54 Results and Discussion ........................................................................................... 55 The Formation of the Walking System ............................................................. 55 The P roperty of Directionality ........................................................................... 56 The Property of Progression ............................................................................. 57 The Property of Controllability .......................................................................... 58 Other Properties ............................................................................................... 58 Conclusions ............................................................................................................ 59 4 BUILDING A NANOSTRUCTURE WITH REVERSIBLE MOTIONS USING PHOTONIC E NERGY ............................................................................................. 71 Background ............................................................................................................. 71 Experimental Section .............................................................................................. 72 Chemicals and Reagents ................................................................................. 72 Synthesis of Azobenzene P hosphoramidite and DNA ...................................... 73 PAGE Gel A nalysis .......................................................................................... 73 Oligonucleotides Employed .............................................................................. 73 Manipulation of the Walking System ................................................................ 74 FRET Measurements ....................................................................................... 75 Results and Discussion ........................................................................................... 75 The Formation of the Walking System ............................................................. 75 Two Step Photocontrollable Locomotion .......................................................... 77 The Reversible Movement ................................................................................ 79 Route Selection in Multipath Systems .............................................................. 79 Longer Distance Motion ................................................................................... 80 Conclusions ............................................................................................................ 81 5 PHOTON REGULATED DNA ENZYMATIC NANOSTRUCTURES BY MOLECULAR ASSEMBLY ..................................................................................... 91 Background ............................................................................................................. 91 Experimental Section .............................................................................................. 92 Chemicals and R eagents ................................................................................. 92

PAGE 8

8 Synthesis of Azobenzene P hosphoramidite and DNA ...................................... 93 Preparation of O ligonucleotideM odified GOx .................................................. 93 Preparation of O ligonucleotideM odified HRP .................................................. 94 FRET M easurements of A zo DNA ................................................................... 94 HRP DNAzyme A ctivity P hotoM odulation A ssays ........................................... 94 GOx/HRP DNAzyme A ctivity A ssays ............................................................... 95 GOx/HRP C ascade A ctivity A ssays ................................................................. 95 Results and Discussion ........................................................................................... 96 The Principle of Regulation .............................................................................. 96 The FRET Study ............................................................................................... 96 Photoregulation of GOx/HRP Cascade Activity ................................................ 97 Photoregulation of HRP DNAzyme Activity ...................................................... 98 Photoregulat ion of GOx/HRP DNAzyme Cascade Activity ............................. 100 Conclusions .......................................................................................................... 101 6 PROFILING MULTICELL SURFACE MARKERS BY APTAMER ENCODED LOGIC CIRCUIT TO ACHIEVE INTELLIGENT CANCER THERANOSTICS ....... 113 Background ........................................................................................................... 113 Experimental Section ............................................................................................ 115 Chemicals, C ell L ines and R eagents .............................................................. 115 DNA S ynthesis ............................................................................................... 116 Synthesis of P hotosensitizer M odified O ligonucleot ides ................................ 116 Manipulation of the L ogic M achines ............................................................... 117 Photodynamic T herapy and C ell V iability T est ............................................... 117 Formation and Purification of DNA Nanostructures ........................................ 118 Manipulation of the 3 Input and 4Input Cell Surface Logic Circuit s ............... 118 Results and Discussion ......................................................................................... 1 19 Cell Surface OR Gate ..................................................................................... 119 Cell Surface AND Gate .................................................................................. 120 Aptamer Switch Based AND Gate .................................................................. 121 Cell Surface INHIBIT Gate ............................................................................. 122 3 Input and 4Input Cell Surface Logic Circuits .............................................. 123 Targeted Photodynamic Therapy ................................................................... 123 Conclusions .......................................................................................................... 124 7 SUMMARY AND FUTURE DIRECTIONS ............................................................ 166 Multifunctional DNA Nanomachines for Analytical and Biomedical Applications .. 166 Future Di rections .................................................................................................. 170 Direct Observation of Stepwise Motion of the Walking Devices ..................... 170 Antibody and NanoparticleBased Cell Surface Logic Circuits ...................... 172 LIST OF REFERENCES ............................................................................................. 174 BIOGRAPHICAL SKETCH .......................................................................................... 186

PAGE 9

9 LIST OF TABLES Table page 2 1 Sequences of DNA used in the paper ................................................................ 44 3 1 DNA sequences for PAGE characterization ....................................................... 61 3 2 DNA sequences for FRET assay. ....................................................................... 62 5 1 Sequences of DNA switch probes and DNA linkers ......................................... 102 5 2 Regulation of the activities of HRP DNAzyme probes by UV or visible light ..... 103 6 1 DNA sequences used in the 2 input theranostic stud ies ................................. 125 6 2 DNA sequences used for demonstrating the programmable and scalable cell surface logic gates ........................................................................................... 126

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Structure of DN A or RNA, and c ommonly used nucleotide modi fications in aptamer structures .............................................................................................. 32 1 2 Aptamer nanomaterial assembly for diagnostic and therapeutic appl ications .... 3 3 1 3 The molecular beacon structures and engineering methodologies ..................... 33 1 4 Aptamers as building blocks to generate DNA micelle structures for drug delivery and sensing ........................................................................................... 34 1 5 The mechanism of toeholdmediat ed strand displacement reaction ................... 34 1 6 Schematics of the azobenzenebased photoregulator y inhibitor (PCI ) design ... 35 2 1 Mass spectra of disulfidebridged pyrene derivative PnSS before and after irradiation ............................................................................................................ 45 2 2 Cleavage efficiency f or PS2, PS1 o r SS as a function of UV irradiation time ..... 45 2 3 R adical cleavage mechanism study ................................................................... 46 2 4 The struct ure and photodissociation of the P y/S S mo dified DNA micelle ........ 47 2 5 A garo se gel analysis of DNA micelles ................................................................ 48 2 6 Design scheme for photomodulated DNAz yme analog ..................................... 48 2 7 Catalytic activity of light modulated DNAzyme analog ........................................ 49 2 8 Catal ytic activity of DNAzyme analog ................................................................. 49 3 1 Photolysi s and DNA walker system .................................................................... 63 3 2 The synt hesis of pyrene phosphoramidite .......................................................... 63 3 3 Native PAGE characterization of the DNA walking system ................................ 64 3 4 Directional and autonomous locomotion ............................................................. 64 3 5 Photolysis of anchorage site without adding DNA walker ................................... 65 3 6 The motion of DNA walker along another designed track T* .............................. 66 3 7 Progressive wal king demonstrated by FRET assay ........................................... 67

PAGE 11

11 3 8 De tailed FRET assay to demonstrated p rogressive wal kin g .............................. 68 3 9 Time dependence of FRET ................................................................................ 68 3 10 Controllable locomotion ...................................................................................... 69 3 11 FRET experiments demonstrating controllable locomotion speed ...................... 69 3 12 The motion of WS and WL along track T ............................................................. 70 4 1 Principle of the DNA based walking device ........................................................ 82 4 2 Sequences of DNA for constructing walking system .......................................... 83 4 3 Native gel electrophores is to demonstrate the construction of walking system .. 84 4 4 FRET between the Dabcyl labeled Walker ( W ) and FAM /TMR labeled S1/S2 ... 85 4 5 Progressive wal king demonstrated by FRET assay ........................................... 85 4 6 Processive motion of DNA walker ...................................................................... 86 4 7 R eversible walking demonstrated by FRET assay ............................................. 87 4 8 Programmed control o f route selection at a junction ........................................... 88 4 9 Fluorescence study confirming the photocontrollable direction selectivity .......... 89 4 10 Progressive operation of the walker on a 3step track ........................................ 90 5 1 The synthesi s of azobenzene phosphoramidite ................................................ 104 5 2 PAGE gel results and absorption spectra to confirm the binding between enzyme and DNA ............................................................................................. 105 5 3 Working scheme for photoregulat ion of DNA enzyme nanostructure .............. 106 5 4 Photoregulation of azobenzeneincorporated DNA duplex .............................. 106 5 5 Photoregulation effect on various concentration of GOx/ HRP enzyme conjugat es ........................................................................................................ 107 5 6 Influence of UV irradiation on the enzymatic activities of native GOx and HR .. 107 5 7 Working scheme for photoregulat ion of DNA enzyme nanostructure .............. 108 5 8 Fluorescence study c onfirming the photoregu lation of HRP DNAzyme structure ........................................................................................................... 108

PAGE 12

12 5 9 Absorbance/time profiles for Xc Yazo probe optimization ................................ 109 5 10 Effect of UV or visible light on the regulation efficiency of various HRP DNAzyme probes ............................................................................................. 110 5 11 Photoregulation of GOx/DNAzyme cascade activity ....................................... 111 5 12 Reversibl e regulation of GOx/HRP DNAzyme reactivity by alternate visible and UV irradiation ............................................................................................. 112 6 1 Schemes of the cell surface logic gates. General theranostic principle ............ 128 6 2 Flow cytometric analysis for the OR gate ......................................................... 128 6 3 Aptamer target selectivity and barcodespecificity proof .................................. 129 6 4 The optimization of cX*/cY* F s equences for the first AND gate ...................... 130 6 5 Flow cyt ometry analysis of the AND gate ......................................................... 133 6 6 Symbols, truth tables and experimental schemes of toehold based strand displaceme nt AND gate ................................................................................... 134 6 7 Flow cytometric analysis for Sgc 8c X*/Sgc4f Y* based AND gate ................... 135 6 8 Flu orescence confocal microscopy images of the ce llsurface logic gates ....... 136 6 9 Flow cytometric analysis for T E02 X*/TD05 Y* based AND gate ..................... 138 6 10 Symbols, truth tables and schem es of aptamer switch AND gat e .................... 139 6 11 Determination of the binding region of PTK7 on the Sgc8c aptamer ................ 140 6 12 Flow cytometric analysis for aptamer switch AND gate .................................... 141 6 13 The influence of di fferent sequence lengths of the cX probe on second AND gate efficiency ................................................................................................... 142 6 14 A djusting the gating properties by changing the DNA sequence design .......... 143 6 15 Flow cytometry analysis of the individual aptamer targeting marker profile on the surfaces d ifferent cells ................................................................................ 144 6 16 Optimization of the INH gate ............................................................................ 145 6 17 Flow cytometric analysis for aptamer switch INH gate ..................................... 146 6 18 Flow cytometry analysis o f the competition of different tagged aptamers ......... 147

PAGE 13

13 6 19 Schemes o f the cell surface logic gates. Apt A [d]/ apt B [c]/ apt C a based 3 input a AND b ANDNO T c gate ................................................................... 149 6 20 The optimization of assistant probe concentration for cell surface NOT gate ... 150 6 21 The symbols, truth tables and experimental schemes of constructing twelve 3 input cell surface logic gates ......................................................................... 152 6 22 Flow cytometry analysis of the competition of different tagged aptamers, Sgc4f, Sgc 8c, TE17 and TC01 ......................................................................... 159 6 23 Construction of programmable and sc alable cell surface logic gates ............... 160 6 24 Symbols, truth tables and experimental schemes of 4 input l ogic circuits ........ 162 6 25 Ce6 mediated singlet oxygen generation after white light irradiation................ 163 6 26 Cell viability test for the AND gate after visible irradiation ................................ 164 6 27 Cell vi ability test for the OR AND and INH gates after visible irradiation ......... 165

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ENGINEERING MULTIFUNCTIONAL DNA NANOMACHINES FOR ANALYTICAL AND BIOMEDICAL APPLICATIONS By Mingxu You December 2012 Chair: Weihong Tan Major: Chemistry The development of nanotechnology has been largely inspired by the biological world. The complex, but well organized, living system hosts an array of molecular sized machines responsible for information processing, structure building and sometimes movem ent. Recently, the specific hybridization of DNA molecules has been used to construct self assembled devices, e.g. a mechanical device to mimic cellular protein motors in nature. Future smart nanostructures will have to rely on molecular assembly for uni q ue and advanced functions. The objective of this research is to design and realize multifunctional nucleic acid based nanomachines, which can mimic the magic biological world and further provide tools to rival nature and regulate the cellular environments First a n efficient pyreneassisted method was developed for the photolysis of disulfide bonds T o demonstrate the biomedical applications of such pyrene disulfide molecular assemblies, the r apid photodriven disassembly of a DNA micelle structure and m ultiple turnover properties of a DNAzyme analog were studied. Based on this interesting phenomenon, a novel light powered DNA mechanical device, which is reminiscent of cellular protein motors in nature, was developed. Th is

PAGE 15

15 walking device is capable of au tonomous locomotion, with light control of initiation, termination and velocity. To address the problem of reversibility and route selection for DNA walkers we further studied a new light powered DNA mechanical device based on the photoisomerization of az obenzene moieties and toeholdmediated strand displacement. This autonomous device is capable of moving towards either end of the track, simply by switching the wavelength of light irradiation, UV (365nm) or visible (>450nm). Similarly, the structures and activities of azobenzenemodified DNA/ enzyme nanoconjugates could be fine tuned by light. Finally, we describe our attempt to make use of easily available and smartly engineered DNA aptamer logic circuits that perform simultaneous logical analysis of diff erent cancer cell surface markers and, in response, produce a diagnostic signal an d targeted photodynamic therapy. This strategy is capable of programmable profi ling of at least four coexisting cell surface markers. The new multifunctional DNA nanomachines developed in our study will provide advanced tools, with sensing, thinking and regulating abilities, for unique analytical and biomedical applications.

PAGE 16

16 CHAPTER 1 INTRODUCTION Molecular Engineering of Nucleic Acid Probes Review of Nucleic Acid Structu res S ince their structures and functions as genetic information carr ier were elucidated in the 1950s, n ucleic acids have be en found to regulate many cellular reactions in nature. With the development of modern chemical approach es for synthesizing oligonucl eotides, nucleic acids have been diversified and applied into various research areas, from basic biolog ical studies to engineering nanotechnologies, computational studies and material science. Basically, natural nucleic acids can be divided into two groups: deoxyribonucleic acid s (DNA s) and ribonucleic acids (RNA s). T he first section of this dissertation will give a brief overview of nucleic acid structures and some basic functions A typical molecular building block for DNA or RNA oligonucleotide structure s is shown in Figure 11. The monomer units, called nucleotides, contain a sugar ring (2 deoxyribose in DNA and ribose in RNA) that are on one side esterified to a phosphate, with the other side linked to a cyclic base via N glycosidic bond. Differe nt nucleotides are link ed between the carbons of the sugar rings through a phosphate group into a n oligonucleotide chain structure. I n 1953, Nobel laureates Watson and Crick ingenious ly proposed the well known double helix model for DNA structu res ,1 in which t he two strands align antiparallel to each other in the coil Such double helix structure is a result of specific interactions through hydrogen bonds ( three for C G and two for A T) between t he complementary bases on each strand.

PAGE 17

17 P rimarily found in the nuclei region of eukaryotic cells or the nucleoti de region of prokaryotic cells ( e.g ., bacteria) DNA encode s b iological information via groups of three successive nucleotides ; e ach three base code corres ponds to a certain amino acid of the coded protein. T o transfer the information patterns from DNA to the corresponding proteins, other types of natural nucleic acids, RNA s, implement the transcription and translation process Several type s of RNAs have been identified with different cellular fu nctions : (1 ) ribosomal RNAs (rRNAs), which comprise t he largest subgroup (8590%) of RNAs are the major component s of ribosomes ; (2 ) m essenger RNAs (mRNAs) bring the tr anscribed code to the ribosomes ; (3 ) t ransfer RNAs (tRNAs) carry a certain amino acid t o the correct position of the growing polypeptide chain; a nd m ore r ecently (4) regulatory RNAs, e.g ., mi RNAs (microRNAs) and siRNAs (small interfering RNAs) which have been discovered in nature to have some important cellular effects After elucidat ing the complete structures of nucleic acids, another major advancement of nucleic acid chemistry has result ed from the development of the phosphoramidite method, for preparation of a rtificial nucleic acid chains by an automated solid support system .2 3 In thi s system, four reaction steps are repeated, including : (1) dichloroacetic acid (DCA) detritylation to activate the 5 hydroxyl group; (2) tetrazole coupling to protonate the nitrogen of the incoming nucleotide and to form the phosphate linkage; (3) acetic anhydride and N methylimidazole capping to block the influence from failure sequences ; and finally (4) iodine oxidation to form the stable pentavalent phosphate tri ester bond and prepare for the next round of conjugation. The commonly used p hosphoramidites are composed of several functional groups such as protecting groups to block primary amine groups of each base, a dimethoxytrityl (DMT)

PAGE 18

18 group to cap the 5 O site and the diisopropylamino and 2cyanoethyl groups to protect the phosphate site T he same strategy of designing functional phosphoramidites can be shared among different modifiers, including various fluorophores, biotin, amine or polyethylene glycol linker s; several phosphoramidite structures have been synthesized as part of this dissertation, such as the pyrene phosphoramidite used in Chapter s 2 and 3, and the azobenzene phosphoramidite used in Chapter s 4 and 5. Currently due to their capability for selective recognition, as well as the advancement of automated technology for highly efficient and reproducible synthesis ( with a variety of modifications ), nucleic acids have become popular building blocks for designing molecular probes for numerous applications in many smart and useful biological and analytical studies. Some types of widely used f unctional nucleic acid probes will be discussed below Aptamer s : Molecules for BioRecognition In the early 1990s, three research groups reported the isolation of nucleic acids with strong binding properties to organic dyes and proteins.4 6 The new antibody like compounds, called aptamers, are singlestranded DNAs or RNAs that fold into unique threedimensional structures having binding pockets and clefts for molecular recognition. Aptamers are generated by a process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX) from a library pool of up to 1016 DNA or RNA sequences. This large pool of nucleic acid molecules ensures high diversity in forming different threedimensional structures to fit a wide variety of targets, from small molec ules to proteins and whole cells.7 9 In 2004, research on aptamers gained further momentum by the discovery of riboswitches,10,1 1 which are comprised of a natural aptamer and an expression platform as regulatory elements for gene expression. At

PAGE 19

19 this time, aptamers have been applied to fulfill diverse functions, including sensing, purification, diagnostics and therapeutics.121 7 However, compared with antibodies, which are produced by living systems, laboratory made aptamer molecules are still in their earl y stage s of development and s everal concerns need to be addressed before aptamer based technology is widely utili zed: for example, biostability availability of versatile aptamer choices for different targets, cost, and managable platforms. This section describes the methodologies and recent developments in engineering aptamer molecules, as well as smart modification of these versatile molecules for advanced biomedical and bioanalytical functions. Current molecular engineering of DNA aptamers has focused on several aspects: (1) improving aptamers bioavailability through chemical modifications; (2) engineering regulat able aptamers by controlling their recognition and inhibition properties; and (3) exploiting versatile functions. Aptamers bioavailability can be improved through chemical modification to increase their in vivo stability, cellular uptake efficiency and target binding affinity. Aptamers have great potential for applications in diagnostics and therapeutics. However, some critical problems hinder aptamer use for in vivo clinical applications: the natural nucleic acid bases in aptamers are susceptible to nucleasemediated degradation, and the negatively charged backbones result in inefficient cellular internalization. To overcome these inherent st ability and internalization issues is an emerging goal for aptamer technology. A ptamers are now commonly available with chemical modifications using nonnatural nucleotides (Figure 1 1) ,1 8 macromolecules19 or delivery vehicles2 0 to enhance their bioavailability for in vivo applications.

PAGE 20

20 A second area of interest is the design of regulatable aptamers by exogenously controlling the recognition and inhibition properties to extend the applications of these molecules. The intercalation of chemical or physical t riggers has assisted chemists and biologists to fine tune aptamer functions or to maintain control over molecules even in complex environments, such as the human body. The possibility of installing switches into aptamer molecules for improved functional control is very favorable, given the ease of nucleic acid (especially DNA) synthesis and versatile modification methodologies. Currently nucleic acid aptamer probes have been modified with small competing molecules,2 1 complementary oligonucleotides2 2 and physical triggers (such as chromophores which will be further discussed later2 3) to achieve refined and extended functions. Aptamers are also being engineered to perform diverse functions, opening the way for design of advanced biosensors and clinical syst ems. In addition to their function as target recognition agents, more and more studies have demonstrated the therapeutic and allosteric effects of aptamers. The rational engineering of nucleic acid aptamers with multiple functions is interesting and meaningful, considering the efficient conversion of recognition events into physically detectable signals or therapeutic outputs ( e.g ., targeted drug delivery) (Figure 1 2 ) From another point of view, if functional molecules are assembled using nucleic acids only, instead of combining different biological agents (such as proteins) or conjugations, it will be reasonable to expect a cost efficient, simplified synthesis/modification process, and a homogenous, easily manipulated and stable system. Advanced diagnosti c and therapeutic applications will be accessible,

PAGE 21

21 thereby exploring the full range of potentials of aptamers to meet various requirements of biological systems. Molecular Beacons (MB s) Molecular beacons (MBs) are short hairpin oligonucleotides specifical ly designed to bind to target oligonucleotide sequence and produce a fluorescence signal. MBs are normally composed of three parts: stem, loop and the reporters on the two ends (Fig ure 1 3 ). Since the discovery of molecular beacons in 1996,24 these fluores cent probes have been widely used for gene detection in living cells as well as the development of other biosensors and biochips.252 7 However, there are still many challenges and opportunities to optimize MBs performance or to extend their functions, especially for intracellular applications. Current molecular beacon engineering has focused on several aspects: generation of MB probes with high sensitivity, elimination of false positive signals, enhance ment of intracellular stability and development of reg ulatable probes for biomedical applications. For target sequences with a very low copy number, such as in a single living cell, the sensitivity of conventional MBs is often insufficient for adequate detection. As a result, most applications of MBs have be en limited to abundant or stimulated gene target reporting, because single copy target sensing is quite difficult.28, 29 Because t he sensitivity depends on the signal to background ratio in the presence of the target sequences; from a direct way of thinking the sensitivity of MBs could be improved by optimizing the reporting system to enhance either quenching efficiency (closed state) or fluorescence intensity (open state). Additionally, some nonfluorescence signals ( e.g ., absorbance chemiluminescence, or electrochemical signals) can be also employed to develop sensitive probes Other than the reporter modification, the proper choice of

PAGE 22

22 stem and loop regions can also be crucial. Efficient hybridization with the target (enhanced sensitivity) and the close proximity of the dyes in the closed form (reduced background signal) must both be considered. The bioavailability of molecular beacons, especially for in vivo applications, is hindered by their susceptibility to nucleasemediated digestion and the generati on of false positive signals. Long term, real time gene monitoring in living cells using natural nucleotidebased MBs is almost impossible, as MBs were shown to degrade inside cells within around 45 min utes .29 As a result, nucleaseresistant MBs must be ge nerated and employed for intracellular measurements. The nucleaseresistant MBs developed by far have primarily employ ed some non natural nucleotides within the stem and loop regions. The most widely used examples include 2 OMe derivatives30,3 1 and MBs base d on locked nucleic acids (LNA) .32,3 3 Other issues hindering bioavailability of MBs are MBs nontarget gene binding and nonspecific protein recognition, both of which lead to the generation of false positive signals and inhibit the MBs availability toward target genes. To address these pr oblems, homoMBs ,3 4 reverse stem MBs3 5 and s ome nonnatural nucleotide MBs36,37 have been engineered. For molecular engineering of MBs, some novel areas of interest involve the design of regulable molecular beacons and MBs capable of performing diverse functions. As mentioned above, t he intercalation of chemical or physical triggers has assisted chemists and biologists to finetune MBs functions or to maintain control o f molecules even in complex environments. Given the ease of nucleic acid (especially DNA) synthesis and the versatility of modification methodologies, molecular beacons are also being explored for some advanced biological applications. For example, in

PAGE 23

23 addition to their function as signaling agents, more and more studies have demonstrated the therapeutic potential of MBs, e.g. in photodynamic therapy (PDT) for targeted cancer treatment.3 8 The rational engineering of nucleic acid MBs with multiple functions is interesting and meaningful, considering the eff icient conversion of recognition events into physically detectable signals, as well as therapeutic outputs. Further development in this direction could make use of the full range of potentials of MBs to meet various requirements of biological systems. DNAz yme s : Catalytical Nucleic Acids For many years, biochemists thought that enzymes were always specialized proteins. But in the 1980s, Kruger et al discovered an RNA based enzyme, ribozyme.39 DNA based enzyme have not been found in nature, the first deoxyri bozyme (or DNAzyme) was isolated and customized via an in vitro selection technique by Breaker and Joyce in 1994. This molecule catalyze s the cleavage of a single ribonucleotide linkage embedded within a DNA oligonucleotide strand.4 0 Even though naturally RNA or DNA molecules are only comprised of four types of nucleotides, (whereas twenty amino acids are available for proteins) when assembled into long polymer chains, even this variety can give rise to complex threedimensional structures with various functions, such as reaction catalysis P robes containing functional nucleic acid have been employed as chemical sensors,414 3 to ols to construct nanostructures,44 molecular machines4 5 and computing systems.4 6 ,4 7 Most DNAzymes are metalloenzymes because thei r activity involve s cleavage of a complementa ry oligonucleotide substrate with the help of a metal ion cofactor mostly divalent ion s, such as Pb2+, Mg2+, Ca2+, or Zn2+.4 8 All of these DNA zymes have been identified and designed using an in vitro selection process similar to that for aptamer

PAGE 24

24 se lection. N ucleic acids with specific binding affinity and cleavage efficiency towards a particular target molecule are isolated from a library of around 1015 nucleic acids and amplified by the polymerase chain reaction (PCR). The DNAzyme s selected in this method are true catalyst s, as t hey can perf orm multiple turnover reactions. DNAzymes are, in fact man made analogues of proteinbased enzymes b ut these analogues have several advantages even over their protein count erparts : (1) chemically stability ; (2) reproducibly synthesis and easy amplification by PCR; (3) lower cost and production time Functional Nucleic AcidBased Nanomachines In this section some typical nanomachines based on nucleic acids will be discussed providing both an overview of the current art of nucleic acid nanomachines, on the other side and background for subsequent chapters DNA Micelle s Micelles belong to supramolecular structures made by self assembly of amphiphilic compounds, i.e molec ules having both a polar or ionic headgroup and a hydrophobic tail. Micelles are widely used as detergents, as well as in areas such as molecular electronics and biomedicines .495 2 Due to their relatively small size, good biocompatibility and biostabil ity micelle structures have been widely used in pharmaceuticals especially to deliver hydrophobic compounds into the hydrophilic intracellular environment Recently, DNA based micelles, composed of a singlestranded DNA corona and a hydrophobic core hav e emerged as new types of functional nanostructures.5 3 These DNA micelles have been synthesized and applied as a combinatorial tool for cancer nanotechnology ,54, 55 or as a 3D scaffold for organic reactions .56 The Tan group has

PAGE 25

25 been investigating DNA based micelle structures having hydrophobic diacyllipid tails (Figure 1 4 ) ,57 which can be ef ficiently incorporated at the 5 end of oligonucleotides by solid phase DNA synthesis. Interestingly it has been demonstrated that these DNA micelles disintegrate spont aneously when they encounter the lipid bilayers of the cell surface and they permeate the cell membr ane by an endocytosis process ToeholdMediated Strand Displacement DNA strand displacement was discovered in renatured circular molecules58 and has been w ell known in molecular biology. Strand displacement describes the ability of a n attacking DNA strand partially paired with its complement to extend its pairing by displacing a homologous target strand ( Figure 15 ) Extending this concept to DNA nanotechnol ogy,59,6 0 Yurke et al. constructed a type of dynamic DNA fueled molecular machine,6 1 which they termed as toeholdmediated DNA strand displacement. In this machine, a singlestranded DNA in a doublestranded complex is displaced by another singlestranded DNA with the help of a short sequence of contiguous bases called a toehold ( Figure 15 ) and today this concept prevails in dynamic DNA nanostructures worldwide.626 4 For example, toeholdmediated strand displacement has been used to trigger the assembly of DNA species,6567 build DNA machines,687 2 initiate the synchronized assembly of gold nanoparticles and the construction of logic gates.7 3 Most notably, it has been applied to the construction of catalytic circuits,7476 logic circuits77,78 and chemi cal reaction networks.79 In most dynamic DNA nanostructures and DNA circuit systems, oligonucleotide chains act as catalysts or as inputs that fuel the DNA based molecular machine by a series of toeholdmediated strand displacement reactions. For DNA circu its, each toeholdbearing DNA duplex must be purified in order to remove extra single strands

PAGE 26

26 when the stoichiometry is not perfect. This step avoids undesired reactions with other components in the circuit.78,80 The use of toeholdmediated strand displace ment for DNA circuit operations will be further discussed below, and this concept will be the basis for Chapter 6. In contrast to the well established overhanging toehold systems, Liu et al. developed an ATP activated hidden toehold system,81 which allow s regulation of a DNA strand displacement reaction by an environmental stimul us In comparison with these reported works light is a clean energy source with controllable intensity, which can activate a hidden toehold without addition of any chemicals or generation of waste DNA molecules. Therefore, compared to the well established overhanging toehold DNA duplexes prepared from two separate DNA strands, this dissertation will describe the use of photo regulatable toehold formation methods in the DNA walke r project, presented in Chapter 4 Functional Nucleic Acid Nanomachines for Cell ular Studies As discussed above, aptamers are oligonucleotides capable of specific target recognition. T he hydrophilic property of nucleic acids can also be employed to utilize aptamers for const ruc tion of nanoplatforms such as aptamer based DNA micelles The Tan group has shown that an aptamer bas ed micelle structure c an bind specifically with a target cancer cell and deliver drugs ( Figure 1 4 ).8 2 Interestingly, the multivalent effect, which enhances binding affinities and target regulation activities, also exists within aptamer micelle structures. At physiological temperatures, normally unbound free aptamers can recognize and bind to target cancer cells. Moreover, using a flow channel system to mimic drug delivery in the human blood system, the dynamic specificity of an aptamer micelle assembly was shown to be an effective detection/ delivery vehicle. As

PAGE 27

27 these examples suggest, engineering DNA aptamers as building blocks for n anostructures can still preserve the binding affinity of aptamers, while the target recognition process can trigger larger scaffold structure alterations to realize novel functions, such as drug release and molecular detection. Because of its predictable Watson Crick hybridization and immense informationencoding capacity, DNA has been widely used to construct devices performing intelligent tasks, such as sensing48,83 and computation8487 for cellular studies For example, the Krishnan group demonstrated a DNA nanomachine to map the spatial and temporal pH changes in the range of 5.5 to 6.8 inside livin g cells, by an I motif structure and fluorescence resonance energy transfer (FRET) mechanism .8 8 Recently, the Church group reported an interesting logic gate d DNA nanorobot, which is capable of transporting molecular payloads, such as dyes or particles, to specific cells based on the coexpression of two biomarkers.8 4 So far, nucleic acids based functional nanomachines are still in their infancy, and the repor ts of the real cellular studies are really rare. However as promising molecules for the design and controlled assembly of nanostructures, nucleic acids, especially DNA s, will find more and unique places in the cellular application s. Photoresponsive Molecu le s and Photocontrollable Nanomachines Photoresponsive Molecul es The extremely complex biological functions in living organisms are governed by a spatial and temporal organization, whereby living processes are managed by interconnected networks of functio nal units. Chemical tools have long been used to manipulate and control actions of cells and intracellular pathways.88 One important criterion in these studies is the selective control of the probe after it enters the cell.

PAGE 28

28 Photoresponsive molecules offer a means to achieve such spatiotemporal selectivity, even within living cells. Compared to other external stimuli, such as temperature, pH or electric field, photoregulation has several advantages:89,90 (1) No additional chemical components are needed, only light energy for driving the reactions or movement. (2) The timing, location and intensity of the incident light can be easily controlled. (3) The excitation wavelength can be controlled through the design of the photoresponsive molecules, providing tun able properties. (4) The cells commonly studied in laboratories are transparent to irradiation, and normally do not have inherent light activated properties. Photoresponsive molecules can be generally divided into two groups, those outgoing irreversible pr ocesses, and molecules with reversible changes Compounds which undergo reversible photochemical reactions called photochromic switches, are normally considered more useful These photochromic compounds have two (or more) molecular states that can be inte rconverted by photoirradiation at different wavelengths The two (or more) molecular states can be very different from each other in terms of p hysical and/or chemical properties, including geometrical structure absorption, refractive index dielectric co nstant oxidation potential etc Based on the transformation mechanisms these switches can be further separated into these groups: phototautomerizations, cis trans isomerizations, and photocyclizations. (1) Salicylideneaniline is the best known example of a phototautomeri sm switch which can be reversibly interconverted through hydrogen transfer by the absorption of UV/Vis light.9 1 (2) 1,3,5hexatriene, fulgides, diarylethenes and spiropyrans are typical examples for the photocyclization switches, whic h involve

PAGE 29

29 electrocyclic reaction s. These compounds have been employed in the study of photocontrolled magnetism, liquid crystalline phase switching, and the development of other photomodulating devices. (3) Stilbenes represent the best known examples of cis trans isomerization switches. There have been a number of studies reporting the use of photoresponsive molecules to photocontrol DNA machine functions, one example being azobenzene molecules. Azobe nzene Molecules As shown in Figure 16 t he highly e fficient light driven cis/trans isomerization of the azobenzene moiety is wavelength dependent ,92 with UV light at 365nm corresponding to the trans to cis conversion, and visible light at 465nm wavelength, corresponding to the cis to trans isomerization. Azobenzene is a stilbene derivative, composed of two phenyl rings linked by an azo (N=N) group. By incorporating electrondonor groups on the benzene ring, a redshift i n the excitation wavelength could be induced, sometimes even into the visible region.9 3 ,94 This isomerization has been widely used as a photoresponsive molecular tool, which induces significant conformational and biochemical changes in nucleic acids,9 5 peptides9 6 and proteins.9 7 As a consequence of cis/trans isomerization, biological activi ty dependent spatial changes occur, forming the basis of azobenzenebased photomodulation of biological processes. Molecular Motors and Artificial Mimics Protein Based Molecular Motors The development of nanotechnology has been largely inspired by the bi ological world. The complex, but well organized, living system hosts an array of molecular sized

PAGE 30

30 machines responsible for information processing, structure building and sometimes movement. In the cellular world, m olecular motors are tiny protein machines that power motion, e.g ., myosins moving on actin filaments and dyneins or kinesins walking along microtubule tracks.98 These motors are actually ATPases, which convert chemical energy (the hydrolysis of ATP) into mechanical energy (movement). They can literally walk processively and progressively along polymeric filaments. The biological functions of these motors include microscopic transport of cargoes (such as membranous organelles, proteins or mRNAs), and ultimately, power generation for macroscopic m ovement Biological motors normally operate in a constant environment without external intervention, and they remain in operation as long as a source of energy is available. Thus, these biological motors are considered to be autonomous. Small Molecule Based Artificial Walkers To mimic these movements, there has been considerable effort to develop artificial walking devices including some recent reports on stimuli responsive walkers based on either small molecular systems or on DNAs. Small molecules are nor mally several orders of magnitude smaller in size compared with proteinbased molecular motors O nly a few successful small molecular walkers have been described so far, all with quite slow and inefficient motion. For example, Feringa et al. developed an electric powered, four wheel drive, single molecule nanocar that travel s over a copper surface.9 9 Leigh et al reported several twolegged molecular units moving along a four foothold track stimulated by pH,

PAGE 31

31 redox condition change or light.100102 External control l ability is one advantage of artificial walkers, not found in natural molecular motors. Nucleic Acid Based Artificial Walkers Artificial DNA based motors have recently emerged to mimic molecular motors103106 and to perform tasks in cargo transpor t107 and biosynthesis.108 The programmable assembly and simplicity of polynucleotide interactions have made DNAs suitable for the control of progressive and directional movement at the molecular level. Some recent efforts have focus ed on the development o f stimuliresponsive DNA walkers Willner et al. designed bipedal DNA walkers activated by acid/base and Hg2+/cysteine triggers.109 Qu et al. also reported a pH sensitive molecular switch with translocation ability, but not in a directional and progressive manner.110 However, energy supply is a major concern for any motor. Biological molecular motors employ free energy based on the binding and hydrolysis of ATP, while artificial DNA walkers have previously explored energy supplied by DNA hybridization111113 or hydrolysis of either the DNA/RNA backbone114117 or ATP molecules.118 These artificial walking devices are still in their infancy, and they are not as powerful as their protein counterparts from nature. Still, identification of new types of energy supplies could play a major role in the development of the next generation of mechanical robots. Chapters 3 and 4 in this dissertation will describe our efforts in using light as a new energy source to power the motion of DNA walkers.

PAGE 32

32 R3 R1 O H H H O P O R2 O O H H H H B a s e H O R4 R1= H F N H2, O C H3R4= b a s e A T C G o r C 5 m o d i f i c a t i o n R2= O S BH3 R3= O S D a s h l i n e = m e t h y l e n e g r ou p b r i d g i n g ( L N A )N N O O N O2 e g C a g e d T : Figure 11 Structure of DNA or RNA, and c ommonly used nucleotide modifications in aptamer structures.

PAGE 33

33 Figure 12 Aptamer nanomaterial assembly for diagnostic and therapeutic applications. Figure 13. The molecular beacon structures and summarized engineering methodologies for different parts.

PAGE 34

34 Figure 14. Aptamers as building blocks to generate DNA micelle structures for drug delivery and sensing. Figure 15. The mechanism of toeholdmediated strand displacement reaction.

PAGE 35

35 Figure 16. Schematics of the photoregulatory inhibitor (PCI) design. Treating with visible light, the self hybridization with the regulatory domain activates the thrombin function; under UV light, 15Apt becomes free to bind to the target, inducing low enzyme activity.

PAGE 36

3 6 CHAPTER 2 PYRENE ASSISTED EFFICIENT PHOTOLYSIS OF DISULFI DE BONDS IN DNA BASED MOLECULAR ENGI NEERING Background In the late 1950s, Walling and Rabinowitz119 demonstrated that the homolysis of alkyl disulfides could be sensitized by aromatic hydrocarbons. To date, there have been few applications of this cleavage because of the relatively low cleavage efficiency (<30% after hours of irradiation), the need for UV irradiation, and the aqueous insolubility of aromatic hydrocarbons. However, disulfide linkages play an important role in the folding/unfolding structure switch of proteins,120,121 and chemical cleavage of the disulfide bonds can result in the inactivation of sul fur containing proteins .122,123 At the same time, extensive efforts have been devoted to disulfidebased carrier systems124,125 because disulfide bonds provide temporary high stability in the extracellular compartment, followed by relatively rapid cleavage inside cells, facilitating the release of therapeutic drugs or nucleic acids. However, the reduction of cellular disulfides is highly dependent on the expression level and location of redox enzymes.126 Thus, some extraneous stimulus, such as heat, chemical reaction or irradiation, is needed. It is conceivable that when the cleavage is triggered by light, precise control of initiation and termination is possible, in preference to using an additional reducing reagent, such as dithiothreitol (DTT), which coul d be toxic. In this work, we report an efficient pyreneassisted disulfide photolysis strategy using 350nm light. Pyrene is a common, spatially sensitive fluorescent dye.127129 Its high extinction coefficients (~2104 M1cm1 at 350nm) and long lived (~1 10ns), highenergy (~70kcal/mol) excited singlet state make pyrene useful for driving numerous photochemical reactions .130

PAGE 37

37 Experimental Section Chemicals and Reagents The materials for DNA synthesis, including C 6 disulfide phosphoramidite, 6fluorescei n (FAM) phosphoramidite, 5 4 (4 dimethylaminophenylazo) benzoic acid (Dabcyl) phosphoramidite and CPG columns, were purchased from Glen Research (Sterling, VA). Unless otherwise stated, all the chemicals were used without further purification. The synthes es of pyrene phosphoramidite and lipid phosphoramidite were reported previously.127 All reagents for buffer preparation and HPLC purification came from Fisher Scientific. DNA Synthesis All of the oligonucleotides were synthesized using an ABI 3400 DNA sy nthesizer (Applied Biosystems, Inc. Foster City, CA) at 1.0 micromolar scale. After complete cleavage and deprotection, most DNA sequences were purified on a ProStar HPLC system (Varian, Palo Alto, CA) with a C 18 reversed250mm 4.6 mm). The DNA with 5 end lipid modification was purified using a C 4 column (BioBasic 4, 200mm 4.6mm, Thermo Scientific). In both cases, the eluent was 100mM triethylamineacetic acid buffer (TEAA, pH 7.5) and acetonitrile (030min, 10100%). All DNA concentrations were characterized with a Cary Bio300UV spectrometer (Varian) using the absorbance of DNA at 260nm. Synthesis of D isulfide B ridged P yrene D erivative The conjugation of pyrene and the disulfide bond was realized by the amide bond forma tion via the reaction between 1aminopyrene and 3, 3 dithiodipropanoyl chloride. The product was characterized by 1H NMR (CDCl3 8.04

PAGE 38

38 Gel Electrophoresis and Data Analysis For the photoregulation of the pyrenedisulfide molecular assembly, all samples were irradiated in deionized water at 350 nm with a UV B lamp centered at 302 nm (SANKYO DENKI, Japan) with a 352 nm optical filter (3 nm half bandwidth; Oriel Instruments, Stratford, CT, Newport). Polyacrylamide gel electrophoresis (PAGE) was performed on a 20% denatured gel in TBE buffer (89mM Tris HCl, 89mM b oric acid, 2mM EDTA, pH 8.0) for 45min at 150V. After that, gels were stained using Stains All (Sigma Aldrich) to image the position of DNA. Photographic images were obtained under visible light with a digital camera and were then quantitatively analyzed w ith Image J software from NIH. Origin 8.0 was used for data analysis. Micelle Characterization A FluoroMax 4 Spectrofluorometer with a temperature controller (Jobin Yvon) was used for all steady state fluorescence measurements. Fluorescence intensity was recorded using excitation at 350nm (spectral bandwidth=3nm). Agarose gel electrophoresis was performed using a 4% agarose gel in TBE buffer with constant 75V for about 90 min. The DNA bands were visualized by UV illumination (312nm) and photographed by a digital camera. GelBased DNAzymeMimic Activity Assay After a series of 350nm irradiation times, fluorescence intensities at 515nm were recorded using a FluoroMax 4 Spectrofluorometer with excitation at 488 nm. Then a 12% Native gel in TBE buffer was applied for 50min at 100V. The fluorescence images of gels were recorded by FAM fluorescence, with excitation at 488nm and emission at 526nm using a Typhoon 9410 variable mode imager.

PAGE 39

39 Results and Discussion The Proof of Efficient Disulfide Bond Cleavage The max of the pyrene ring) results in highly efficient disulfide bond cleavage, as demonstrated in ESI MS experiments ( Figure 2 1 ). Photocleavage of disulfide bonds results in the intensity changes in two peaks: m/z=631 (pyrene derivative +Na+) decreases while m/z=305 (photolysis product) increases. For further studies of pyreneassisted disulfide photolysis, the S S linkage and pyrene were incorporated into a DNA framework, which also provi ded feasible detection using gel electrophoresis and fluorescence analysis. Other advantages of using DNA can also be identified: (a) DNA base stacking allows efficient long range charge transfer, which has been reported to facilitate electron transfer in donor acceptor systems;131 (b) the sequence structure can be modified to place the disulfide and pyrene at specific sites; and (c) oligonucleotides can be routinely synthesized by solidphase synthesis using the phosphoramidite method. The Effect of Number Distance of Pyrenes on the Cleavage Efficiency Two groups of DNA molecules with pyrene and disulfide bridge assemblies were synthesized, and gel analysis was employed to quantify the cleavage efficiency. The base sequences are shown in Table 2 1. The fir st group, termed as PS2 and PS1, linked, respectively, double and single pyrene moieties to the disulfide bond. The same base sequence with no pyrene moiety, SS, functioned as a control molecule. The difference in cleavage efficiency is obvious when the g el results are compared (Figure 2 2 ). The photocleavage of PS1 and PS2 was found to be more rapid, and had better yields, than that of SS. The yields of PS1 and PS2 photocleavage products increased rapidly with time, and after only 20 minutes (0.3W) the yi elds for

PAGE 40

40 PS1 and PS2 were 52% and 77%, respectively. The yield of SS products increased slowly, less than 10%, even after irradiation for 1h. The weakened photocleavage activity for PS1 and PS2 after 20 min perhaps stemmed from the equilibrium between the two disulfide molecular states, the oxidized form (S S) and the reduced form ( SH). To study the effect of distance between the pyrene moiety and the S S link, a second group of DNA molecules, termed as P1S, P3S and P5S, was prepared with the same base seq uence as group 1, but with the pyrene group separated from the S S by 1, 3 or 5 nucleotides (Table 2 1). Under 350nm light irradiation, the photocleavage efficiency decreased in accordance with the extended distance from the pyrene moiety: 53%, 26% and 8.3% after 40 minutes (0.3W), respectively, for P1S, P3S and P5S. Such distancedependent cleavage may potentially be useful for controllable photolysis of specific disulfide bonds, especially considering the sharp spatial control achievable by irradiation. T aking all these findings together, it may be concluded that the photolysis of disulfide bonds can be facilitated by nearby pyrene moieties in DNA frameworks. The Mechanism of the Disulfide Bond Photolysis Such efficient disulfide photocleavage at 350nm, t o the best of our knowledg e, has never been reported. We asked what properties of pyrene would account for this effect. The mechanism of disulfide cleavage in proteins via UV irradiation at 280nm max of the tryptophan group) was investig ated by Hayon and coworkers .132134 The di sulfide radical anion and tryptophan radical cation were believed to form by the electron transfer. It has also been widely accepted that pyrenemediated photoinduced electrons can be injected into the DNA base stack,135137 thus generating large amounts of pyrene radical cations. A possible mechanism is:

PAGE 41

41 P y R S S R P y R S S R + + h v (2 1) R S R S + R S S R (2 2) 4 M1cm1) ,128 a low concentration of pyrene can capture a significant fraction of the incident light. However, this property is not sufficient by itself. Two other dyes with relatively hig h 5 M1cm1) and FAM (5 4 M1cm1) were studied, and no obvious cleavage was max of dyes (488nm for Cy5, 650nm for FAM) or at 350nm. To v erify the possible radical cleavage mechanism, p benzoquinone, a radical scavenger substrate, was added to capture any radicals formed. No photolysis of the disulfide bridge occurred, as indicated by the cleavage band having disappeared in gel analysis ( Fi gure 2 3 ), thus proving that blocking the radical pathway prohibited the disulfide bond photocleavage. To further confirm this radical pathway, the radical indicator TEMPO 9 AC was employed. This compound fluoresces weakly at ~430nm in the absence of radic als (FI~8105 in Figure 2 3 ), but the fluorescence intensity increased to ~ 1.1106 when SS was present and to ~1.4106 in the presence of PS1. These results are consistent with a radical pathway for S S cleavage, which is further enhanced in the presence of pyrene. Application in Dissociating Micelle Structure Micelle structures are of particular interest for biomedical applications ,138,139 because of their biocompatibility, stability both in vitro and in vivo and their ability to carry poorly soluble pharmaceuticals into intracellular areas. Our group has been investigating DNA based micelle structures57, 82 composed of a singlestranded DNA

PAGE 42

42 corona and a hydrophobic diacyllipid core, which can be rapidly dissociated by UV/Vis irradiation. It is conceivable that photoinduced release of compounds carried in the micelle will allow precise spatial and temporal control of drug delivery. To achieve this goal, we have designed a pyrenedisulfide bridge assembly to separate the hydrophobic core forming lipid block from the hydrophilic DNA block ( Figure 2 4 ). Upon irradiation at 350nm, disulfide bridge cleavage detaches the DNA from the lipid, leading to dissociation of the micelles. Here, the pyrene unit also acts as a fluorescence reporter; its unique excimer signal has been widely used to probe micelle formation and dissociation .140 After excitation at 350nm for 1 minute (band width=3nm), the broad emission of the pyrene excimer at 480n chromophores inside the micelle systems, indicating the well organized state of the assembled micelles ( Figure 2 4 ). After scanning the emission spectrum 6 times from ex=350nm), the excimer band at ~475nm disappeared, indicating that the micelles had completely dissociated. To provide direct evidence of micelle disaggregation, agarose gel electrophoresis experiments were conducted. ( Figure 2 5 ) Before irradiation, the slow moving bands with green fluorescence (pyrene excimer) indicated the presence of only aggregated pyrene (micelles). After irradiation, the intensity of the green band decreased, but there was an additional violet, fast moving band indicative of monomeric pyrene (dissociated micelles). Application in Building DNA Enzyme Analog DNAs having catalytic function, called deoxyribozymes or DNAzymes, have become important tools for numerous biochemical applications .48,141,142 The catalytic efficiency of DNAzymes depends on the existence o f cofactors and specific cleavage sites. A photomodulated DNAzyme analog employing pyrene and disulfide bonds as

PAGE 43

43 cofactors and cleavage sites, respectively, was designed and tested ( Figure 2 6 ). The pyrene DNAzyme analog catalyzed the cleavage of the compl ementary DNA substrate through the photoinduced breakage of active disulfide linkage. T he relatively slow diffusion based DNA duplex formation, and subsequently rapid light induced radical formation and cleavage formed the b asis for the DNAzyme analog .143 In this application, light provides an effective way of intentionally inducing enzyme reactivity for studying complex biological processes. As shown in Figure 2 7 the initial rate increased with increasing concentration of DNAzyme analog. Multipleturnov er reactions were also observed ( Figure 2 8 ), and the data for the initial cleavag e rate were fit to a Lineweaver Burk plot ( Figure 2 7 ). Under these conditions, the calculated values of KM and kcat 1, respectively. The catalytic efficiency (kcat /KM=0.22 min1M1) of this photomodulated DNAzyme analog was comparable to that for common DNAzymes (e.g., 1.1 min1M1 for 8 17 DNAzyme144), while the large kcat of 10.2 min1 could result from the high efficiency of the photoreacti on. This result indicates that this enzyme analog is a real catalyst and can perform multipleturnover reactions. Conclusions In conclusion, we have demonstrated high efficiency pyreneassisted photolysis of disulfide bonds using 350nm irradiation. DNA provides a feasible matrix for quantitatively exploiting the cleavage efficiency and mechanism. As indicated by the examples of DNA micelle photodisaggregation and catalytic function of DNAzyme analogs, numerous applications of pyrenedisulfide molecular assemblies are possible in biomedical and proteomics scenarios, with light induced spatiotemporal control.

PAGE 44

44 Table 2 1 Seq uences of DNA used in the paper a Probe Sequence PS2 5 AAAAAAAATC /Pyr/ SS /Pyr/ ACAGATGAGT 3 SS 5 AAAAAAAATC SS ACAGATGAGT 3 P1S 5 AAAAAAAAT /Pyr/ C SS ACAGATGAGT 3 P3S 5 AAAAAAA /Pyr/ ATC SS ACAGATGAGT 3 P5S 5 AAAAA /Pyr/ AAATC SS ACAGATGAGT 3 P20 5 /Pyr/ AAAAAAAATCACAGATGAGT 3 LP 20 5 Lip /Pyr/ AAAAAAAATCACAGATGAGT 3 LSP 20 5 Lip SS /Pyr/ AAAAAAAATCACA GATGAGT 3 PS2 5 AAAAAAAATC /Pyr/ SS /Pyr/ ACAGATGAGT 3 a Pyr, SS and Lip stand for pyrene, disulfide and lipid modified nucleotide, respectively. b The actual structure of /Pyr/ SS molecular assembly in PS1 is: O O P O O O S S O N H O P O O 5 3 O P O O O O C O O O A

PAGE 45

45 Figure 21. Mass spectra of disulfidebridged pyrene derivative PnSS before and after A 0 20 40 60 80 100 0 20 40 60 80 100 Cleavage Percentage (%)Irradiation Time (min) 0 20 40 60 0 20 40 60 80 100 Cleavage Percentage (%)Irradiation Time (min) B Figure 22. Cleava irradiation time. Denatured PAGE gel image was obtained with a digital camera for A ) PS2 (red), PS1 (black) and SS (blue); B ) P1S (green), P3S (red) and P5S (blue) after 5, 15, 25, 40 and 60 min of irradiation. Data were analyzed with Image J software from NIH.

PAGE 46

46 A 400 450 500 550 0 300000 600000 900000 1200000 1500000 Fluorescence Intensity (a.u.)Wavelength (nm) TEMPO-9-AC + PS1 TEMPO-9-AC + SS TEMPO-9-AC B Figure 23. Radical cleavage mechanism study: A ) Q stands for 1M p benzoquinone, a radical scavenger substrate; D stands for 1M DMSO, an OH radical sca venger. The first 4 solutions were irradiated simultaneously at 350nm for 20min; the photolysis of disulfides was blocked only by adding pbenzoquinone (no fast moving component). B ) radical indicator TEMPO 9 AC (4 ((9 acridinecarbonyl) amino) 2, 2, 6, 6t etramethylpiperidn1 oxyl, purchased from Invitrogen Co.) can be used to detect hydroxyl radicals, 9 AC was added, followed by irradiation for 15min (0.3W), before fluorescence detection with an excitation wavelength of 361nm.

PAGE 47

47 Figure 24 A ) The structure and photodissociation of the pyrenedisulfide modified DNA micelle. B ) Fluorescence spectra of a DNA micelle molecular assembly immediately after 350nm excitation for one minute (black line), and after 5 scan

PAGE 48

48 Figure 25. 4% agarose gel analysis of DNA micelles: first three samples were irradiated at 350nm for 10min before imaging. (Lane 1) 5 /Pyr/ AAAAAAAATC ACAGATGAGT 3: violet monomeric pyrene signal after 350nm irradiation. (Lane 2) 5 Lip /Pyr/ AAAAAAAATCACAGATGAGT 3: green pyrene aggregate signal after 350nm irradiation. (Lane 3) 5 Lip SS/Pyr/ AAAAAAAA TCACAGATGAGT 3: After 350nm irradiation, pyrene is present in both monomeric and aggregate forms. (Lane 4) 5 Lip SS/Pyr/ AAAAAAAATCACA GATGAGT 3: same as Lane 3 but without 350nm irradiation. Figure 26. Design scheme for photomodulated DNAzyme analog. (Substrate DNA): 5 FAM ACTCACTATCT SSGGAAGAGATG3; (DNAzyme): 5CATCTCTTC T /Pyr/ CCGAGCCGGTCGAA /Pyr/ AT AGTGAGT Dabcyl 3

PAGE 49

49 A B Figure 27. Catalytic activity of light modulated DNAzyme analog: A ) Influence of DNAzyme concentration on the initial rate of cleavage of substrate DNA. 350nm, 0.3W light irradiation. B ) Lineweaver Burk plot for initial cleavage rate of substrate by DNAzyme analog (100nM). Figure 28. Catalytic activity of DNAzyme analog: confirmation of multiple turnovers by shown in Figure 25. 0 10 20 30 40 50 0 10 20 30 40 # of turnoverTime (min)

PAGE 50

50 CHAPTER 3 AN AUTONOMOUS AND CO NTROLLABLE LIGHT DRIVEN DNA WALKING DEVICE Background The development of nanotechnology has been largely inspired by the biological world. The complex, but well organized, living system hosts an array of molecular sized machines responsible for information processing, structure building and, sometimes, movement. Molecular motors are tiny protein machines that power motion in the cellular world, e.g ., myosins moving on actin filaments and dyneins or kinesins walking along microtubule tracks.98 Artificial DNA based motors have recently emerged to mimic molecular motors103106 and to perform tasks in cargo transport107 and biosynthesis.108 The programmable assembly and simplicity of polynucleotide interactions have made DNAs suitable for the control of progressive and directional movement at the molecular level. However, energy supply is a major concern for any motor. 145 Biological molecular motors employ free energy based on the binding and hydrolysis of ATP while artificial DNA walkers have previously explored energy supplied by DNA hybridization111113 or hydrolysis of either the DNA/RNA backbone114117 or ATP molecules.118 These artificial walking devices are still in their infancy, and they are not as powerful as their protein counterparts from nature. Still, identification of new types of energy supplies could play a major role in the development of the next generation mechanical robots. Biological motors normally operate in a constant environment witho ut external intervention, and they remain in operation as long as a source of energy is available. Thus, these biological motors are considered to be autonomous. For artificial DNA walkers, however, non autonomous locomotion by regular addition of fuel1 09, 146,147 is

PAGE 51

51 always much simpler from a design standpoint, compared to an autonomous device. On the other hand, the capability of autonomous motion sometimes results in decreased controllability103108, 114118 because the device cannot be stopped at a desir ed position or time, or once stopped, it cannot be easily restarted. Therefore, construction of freerunning and autonomous true molecular motors ,104 in comparison to nonautonomous designs, is still essential to the operation of nanomachines that mimic biological function. The availability of such an easily controllable, freerunning DNA walker would also be significant for the future design of nanorobots to perform multiple and complex functions. We report here a new light energy powered DNA walker capable of regulated autonomous movement along a nucleic acid track. It has been widely known that photochemical energy sources can serve as inputs for molecular level switches in the operation of nanomachines.148151 We recently found that aromatic hydrocarbons ( e.g ., pyrene molecules) can efficiently facilitate the photolysis of disulfide bonds within artificial nucleic acid backbones152 and that a catalytic cleavage function could be achieved through the design of pyreneincorporated DNAzyme analogs (Figure 3 1 ). This same pyreneassisted photolysis reaction is also a major component of our DNA walker design (Figure 3 1 ). Photon radiation, which is virtually unlimited, supplies the energy (together with DNA hybridization free energy) for this type of nanomac hine, and the amount of energy input to operate such machines can be readily controlled by using different intensities of excitation light. Moreover, by taking advantage of recent developments in laser and near field techniques, high spatial and temporal r esolution can be achieved from light

PAGE 52

52 control as well .153,154 With its renewable energy supply, we envision that the light powered DNA walker will allow us to precisely control the speed and motion of nanorobots and, hence, advance the progress of molecular biology in the future. This work represents the first light powered DNA walking devices able to achieve controllable, autonomous and directional movement, and it expands the scope of energy supplies available to power nanosized motion. Experimental Sect ion Chemicals and Reagents The materials for DNA synthesis were purchased from Glen Research (Sterling, VA), including 1O Dimethoxytrityl hexyl disulfide phosphoramidite (thiol modifier C6 S S), 6 (3',6' dipivaloylfluoresceinyl 6 carboxamido) hexyl phos phoramidite (6FAM), 5' Dimethoxytrityloxy 5 [N ((tetramethylrhodaminyl) aminohexyl) 3 acrylimido] 2' deoxyuridine phosphoramidite (TAMRA dT), and 1[3 (4 monomethoxytrityloxy)propyl] 1' [3 [(2 cyanoethyl) (N,Ndiisopropyl phosphoramidityl] propyl] 3,3,3', 3' tetramethy lindodicarbocyanine chloride (Cy5). Other chemicals were purchased from SigmaAldrich. All reagents for buffer preparation and HPLC purification came from Fisher Scientific. Unless otherwise stated, all chemicals were used without further purification. Synthesis of P yrene P hosphoramidite and DNA Pyrene phosphoramidite was synthesized in three steps, as shown in Figure 32 and NMR spectroscopy was used for product characterization: Product 1, 1H NMR (300 7.7 (m, 9H), 6.2 (d, 1H), 4.2 3.8 (m, 4H), 3.0 (m, 2H), 2.32.2 (m, 4H), 1.2 (d, 3H); Product 2, 1 7.5 (m, 22H), 6.1 (d, 1H), 4.2 3.9 (m, 2H), 3.7 (d, 6H), 3.43.3 (m, 4H), 2.4 2.2 (m, 4H), 1.2 (d, 3H); Product 3, 1H 3 6.6 (m, 21H), 5.82 (d, 1H), 4.44.2 (m, 2H), 3.8 (s, 3H),

PAGE 53

53 3.7 (d, 6H), 3.63.1 (m, 8H), 2.5 (m, 1H), 2.42.2 (m, 5H), 1.3 0.9 (m, 20H) & 31P NMR (CDCl3) 149. All oligonucleotides were synthesized using an ABI 3400 DNA synthesizer (Applied Biosystems, Inc., Foster City, CA) at the 1.0 micromolar scale. After complete cleavage and deprotection, the DNA sequences were purified on a ProStar HPLC system (Varian, Palo Alto, CA) with a C 18 reversed250mm 4.6 mm). The eluent was 10 0mM triethylamineacetic acid buffer (TEAA, pH 7.5) and acetonitrile (0 30min, 10 100%). All DNA concentrations were characterized with a Cary Bio 300UV spectrometer (Varian) using the absorbance of DNA at 260nm. PAGE Gel Analysis The denatured PAGE gels were run in 15% acrylamide (containing 19/1 acrylamide/bisacrylamide and 8.3M urea), at 200V constant voltage for 1.5 hours using 1Tris borateEDTA (TBE) as the separation buffer; normally 10 L 1.0 M DNA strands are loaded for each well. The fluorescenc e images of gels were recorded by FAM fluorescence, with excitation at 488nm and emission at 526nm, using a Typhoon 9410 variable mode imager (GE Healthcare, Piscataway, NJ). The band intensities were analyzed with Image J software from NIH. Origin 8.0 was used for data analysis. Native PAGE analysis : The binding and three dimensional structures of the DNA walking system were observed using native PAGE gel. Normally the gel was run in 810% acrylamide (containing 19/1 acrylamide/bisacrylamide) solution wit h 1TBE/15mM Mg2+ buffer, at 100V constant voltage for 1 hour (4C). After that, the gel was stained 30 min using Stains All (Sigma Aldrich) to image the position of DNA. Photographic images were obtained under visible light with a digital camera.

PAGE 54

54 FRET M easurements A FluoroMax 4 Spectrofluorometer with a temperature controller (Jobin Yvon) was used for all steady state fluorescence measurements. The locomotion of walker along the track was realized by excitation at 350nm using the spectrofluorometer source (spectral bandwidth=10nm; interval time=0.1s). After a series of irradiation time periods, fluorescence intensities at 515nm (FAM), 575nm (TAMRA) and 662nm (Cy5) were recorded using an excitation wavelength of 488nm. Manipulation of the W alking S ystem T he oligonucleotides employed are listed in Supplementary Table S1 and Table S2. Using S4 S1 as an example, the formation of the walking system was as follows. After separate annealing (95C 10C, over 20 min) in 20mM Tris buffer (pH=7.5, containing 100mM NaCl and 10mM MgCl2), T S1 S2 S3 and S4W conjugates were mixed with final concentration for each sequence of 1.0M, and the sample was irradiated with a UV B lamp (SANKO DENKI, Japan) with a 352nm photochemical optical filter (3nm half bandwidth; Oriel Instruments, Stratford, CT, Newport). The irradiation power employed was measured using a power meter (Newport Corp., Irvine, CA). After a series of irradiation times, the samples were removed and subjected to denatured PAGE for analysis and imaging. The FRE T experiments were performed using a FluoroMax 4 Spectrofluorometer with a temperature controller (Jobin Yvon). 300nM final concentration of each DNA strand was mixed in the 10mM Tris buffer (pH=7.5, containing 50mM NaCl and 5mM MgCl2). Locomotion of the w alker along the track was realized by irradiation at 350nm using the source in the spectrofluorometer (spectral bandwidth=10nm; interval time=0.1s; light power 66 W /cm2). After a series of

PAGE 55

55 irradiation times, fluorescence intensities at 515nm (FAM), 575nm (TAMRA) and 662nm ex for FAM). Results and Discussion The Formation of the Walking System The walking system consists of three parts: a singlestranded DNA track ( T ), four anchorage sites (S1, S2, S3 and S4), and a light sensitive walker (W) (Figure 3 1 ). Similar as previous design of processive walker by He et al .,108,114 the track contains four 21nucleotide binding regions that are complementary to the recognition tag of the respective anchorage sites. Thro ugh specific basepairing, the track organizes the four anchorage sites into one self assembled construction, with four walker (W) binding sites extending from the track. After the assembly, the distance between two adjacent anchorage sites corresponds to two helical pitches, roughly 7nm. It is worth mentioning that, the sequence design of the walking system is not limited to this established one, and we just employ it for demonstration of the light controlled motion. The DNA walker contains two motion legs a short leg (7nt) and a long leg (16nt), and they are linked by a pyrene moiety that works as a photosensitizer and is incorporated into a DNA oligomer. The two motion legs are designed to respectively bind the two extender segments, which are connect ed by a weak disulfide bond. The recognition event between legs and anchorage sites brings the pyrene and disulfide moieties together. Irradiation at 350nm causes pyrenefacilitated photolysis of the disulfide bond with the sufficiency required to initiate movement. Once the disulfide bond is cleaved, the shorter leg dissociates to search its surroundings for the next accessible anchorage site, while the longer leg remains bound to the extender segment, thus preventing the walker from leaving the track. Bas ed on the toeholdmediated

PAGE 56

56 strand displacement,114 117 the longer leg will further move onto the anchorage site that the shorter leg binding with, finally complete one step forward. The construction of the overall walking system was verified by native poly acrylamide gel electrophoresis (N PAGE, Figure 3 3 ). In the nano sized world, random Brownian motion is much more important than gravity and momentum, which govern movement in the macroscopic world. To overcome random motion, a Burnt Bridge mechanism155,156 was incorporated to make the revisiting of the same anchorage site less probable. That is, by consuming the anchorage site after stepping, forward motion results in higher thermostability and statistical probability compared with the backward motion ( revisiting the cleaved site) provides the basis for the directional movement In our design, this is achieved by the light energy powered photolysis of the anchorage extenders. The Property of Directionality Light powered autonomous and directional locom otion was demonstrated by monitoring the anchorage cleavage (separation of two extender segments on opposite sides of the disulfide linker) after the DNA walker takes a step (Figure 3 4 ). Directional walking pathways, e.g ., S1 S4 or S4 S1, were investigated. For example, from S4 to S1, the walker was specifically positioned through separately prepared T(track) S1 S2 S3 and S4W(walker) conjugates. Mixing the conjugates immediately prior to light irradiation ensured that the S4 anchorage was the initiating s ite (the largest distribution binding position before irradiation) for the walker. Sequential cleavage is observed in Figure 3 4 by the amounts of the respective cleaved anchorage strands (shorter extender segments on one side of disulfide linker). The res ults are consistent with the expected direction: S1>S2>S3>S4 for S1 S4 and S4>S3>S2>S1 for S4 S1. As

PAGE 57

57 control, negligible bond cleavage was observed in the absence of the pyreneincorporated walker (Figure 3 5 ). To test the integrity of this system, we synt hesized another DNA track (T*), with the anchorage sites in the order of S3S2 S1 S4, and the gel results followed the nucleotide sequence from the track (Figure 3 6 ). The Property of Progression The progressive locomotion of the DNA walker is limited onl y by the spatial dimensions available to it. Specifically, after the shorter leg (7nt) dissociates from the track, the closest anchorage site will be in the most accessible location to serve as the replacement strand. The walker will prefer the stepwise m otion, instead of hopping, i.e., after leaving S4 site, the next step will be to the S3, not S2 site. The progressive locomotion of the DNA walker was investigated using a fluorescence resonance energy transfer (FRET) assay. As the FRET donor, 6 FAM fluo rphores were labeled on the walkers longer leg, and Cy5, an acceptor for FAM fluorescence energy, was attached to anchorage site S3. Because the FRET efficiency is proportional to an inverse 6th power of the donor acceptor distance, distancedependent FRE T is expected to occur most efficiently when the walker steps onto the S3 site, thereby bringing FAM and Cy5 together. Indeed, consistent with our expectations, the S1S2 S3 S4 track required a longer time to reach maximal fluorescence signal than the S4S 3 S2 S1 track (longer distance and more steps for progressive motion from two step S1 S3 than one step S4 S3, Figure 3 7 ). Moreover, anchorage site S2 was labeled with another FRET acceptor, TAMRA, and sequential transient FRET was demonstrated following t he progressive motion (Figure 38 ). In a control experiment, to further confirm such progressive movement, an S2* site was synthesized without a disulfide bond. Without this cleavage point to keep the walker moving, a much longer residence time on S2*

PAGE 58

58 was observed (Figure 3 9 ). These experiments confirmed the directionality and progressive motion of our light powered walker. The Property of Controllability The major merit of light regulated DNA walker is its precise controllability, which is essential for nano sized devices. In contrast to DNA walkers fueled by DNA103, 114117 or ATP hydrolysis ,118 light energy can be transmitted to the system without physical contact. As a result, the initiation and termination of walking activities can be simply and immed iately achieved via on/off switching of the light power source. Additionally, the motional velocity of the walker can be controlled by the intensity of the light source. As shown in Figure 3 10, the motion of the DNA walker was accelerated by increasing th e light intensity. Control of locomotion speed was also investigated using bulk fluorescence assay. Based on the FRET measurement after 350 nm irradiation with varied light power, more rapid movement was observed with increasing light intensity (Figure 3 1 1 ). An inherent hindrance of chemically modulated nanomachines is the difficulty in controlling their STOP and RESTART actions by the addition or removal of chemicals. However, this problem is easily overcome by the light powered walking system. Figure 3 10 shows that the miniature walker can be regulated by simply switching the irradiation light ON or OFF. Such controllable autonomous movement will be a significant improvement for regulating and optimizing nanorobot devices, making them potentially useful for cargo transport and other tasks. Ot he r Propert ies Other properties of this light powered nanowalker system include broad choices in design and operation. First, there is freedom in DNA sequence design. As mentioned

PAGE 59

59 above, the walker is comprised of three parts: two legs and one body. Irrespective of catalytic efficiency, each of these parts can be freely modified to optimize the motion. For example, the length of the body sequence, which connects the two pyrene moieties, can be readily modified to optimize the spatial dimension available to the walker and the motional style .157 As a demonstration, two additional light sensitive walkers, WS and WL, were synthesized with different body lengths. Both probes demonstrated programmable walking along the track, but with different motional speeds (Figure 3 12). It should be noted that elongating the body does allow faster motion, but with increased risk of more hopping (more than onesized step) than stepping (because of increased spatial dimensions available to it, which disturb the progressive locomotion). Therefore, a compromise between speed and hopping could be struck for different applications. For example, in walker based synthesis,108 product purity and reaction efficiency may be more important th an time requirements, thereby making the DNA walker with shorter linker length more desirable. Other operational freedoms exist with respect to physical conditions, e.g ., temperature and solution components. Unlike enzyme or DNAzyme based walkers,114118 which normally function at physiological temperature or certain cofactor concentration ( e.g ., Mg2+) the light powered walker can theoretically be operated over a broader physical condition (as long as the DNA strands still bind together) thus enhancing t he potential application area of the walking device. Conclusions In conclusion, we demonstrated in this work the feasibility of designing an autonomous, but controllable, DNA walking device by incorporating photosensitive moieties within DNAzyme analog str uctures. Compared with molecular motors in nature, such light powered walkers are still not as fast and powerful (the fraction of

PAGE 60

60 walkers reach the end of track is still lower than 40%, which might due to the equilibrium between the the two disulfide mol ecular states, the oxidized form, S S, and the reduced form, SH) However, as a new type of energy supply for powering nanosized robots, photon energy has the benefits of precise controllability and optimization freedom, while preserving autonomous, prog ressive motion. Considering the continuous effort to identify clean and renewable energy sources, more rationally designed light energy powered miniature mechanical devices will arise, emulating natures stepping rate for performing various tasks, e.g ., tr ansferring cargoes and stimulating macroscopic motion.

PAGE 61

61 Table 31. DNA sequences for PAGE characterization Probe Sequence T 5' ACC ATC TGT GGC ATA GCA GCG AGT ATC TAA CGC ATG GAA GCG TCG ATC TTG AGC ATT GGA GCG GCA A T C TCC TGC ATC ATC GCG 3 T* 5' ACC A TC TGT GGC ATA GCA GCG GCA ATC TCCTGC ATC ATC GCG TCG ATC TTG AGC ATT GGA GCG AGTATC TAA CGC ATG GAA GCG3 S1 5 FAM TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CGCG ATG ATG CAG GAG ATT GC 3 S2 5 FAM TTTTT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CG CT CCA ATG CTC AAG ATC GA 3 S3 5 FAM TTTTT TTTTT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CGCT TCC ATG CGT TAG ATA CT 3 S4 5 FAM TTTTT TTTTT TTTTT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CGCT GCT ATG CCA CAG ATG GT 3 W 5 AGT GCT GAT TCG G AC A Pyrene GG CTA GCT ACA ACG A Pyrene GA GTG AC 3 W S 5 AGT GCT GAT TCG GAC A Pyrene GG CTA GAC GA Pyrene GA GTG AC 3 W L 5 AGT GCT GAT TCG GAC A Pyrene GG CTA GCT TTTTT ACA ACG A Pyrene GA GTG AC 3 T and T* = Track to arrange anchorage site in the order of S4S3 S2 S1 and S4S1 S2 S3 ; S1, S2, S3, S4 = Anchorage sites containing cleavable disulfide linkage; W, WS, WL= Walkers with different body lengths (segment between pyrenes)

PAGE 62

62 Table 32 DNA sequences for FRET assay. For FRET experiments W was labeled on the 5 end with 6carboxyfluorescein (FAM) dye. The anchorage sites S1and S4 were unlabeled; S2 and S3 were labeled with cyanine 5 (Cy5) and TAMRA dT (TMR), respectively: Probe Sequence T 5' ACC ATC TGT GGC ATA GCA GCG AGT ATC TAA CGC ATGGAA GCG TCG ATC TTG AGC ATT GGA GCG GCAATC TCC TGC ATC ATC GCG 3 S1 5 TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CGCG ATG ATG CAG GAG ATT GC 3 S2 5 TTTTT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CGCT CCA ATG CTC AAG ATC GA 3 S2 5 TTT TT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT Cy5 TT CGCT CCA ATG CTC AAG ATC GA 3 S2* 5 TTTTT TTTTT GTC ACT C GTC CGA ATC AGC ACT Cy5 TT CGCT CCA ATG CTC AAG ATC GA 3 S3 5 TTTTT TTTTT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CGCT TCC ATG CGT TAG ATA CT 3 S3 5 TTTTT TTTTT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TMR TT CGCT TCC ATG CGT TAG ATA CT 3 S4 5 TTTTT TTTTT TTTTT TTTTT GTC ACT C SS GTC CGA ATC AGC ACT TT CGCT GCT ATG CCA CAG ATG GT 3 W 5 FAM AGT GCT GAT TCG GAC A Pyrene GG CT A GCT ACA ACG A Pyrene GA GTG AC 3

PAGE 63

63 A B Figure 31. Photolysis and DNA walker system. A ) Pyrene assisted photolysis of disulfide within DNA structures. B ) The walking principle: walker, four anchorage sites, and track form the walking system thro ugh self assembly; when the walker takes a step, light triggered photolysis of anchorage sites provides the energy for locomotion. Figure 32. The synthesis of pyrene phosphoramidite.

PAGE 64

64 Figure 33. Native PAGE characterization of the DNA walki ng system. Each DNA mixture appeared mostly as a single band, suggesting stable complex formation. Every band migrated as expected, verifying the combination and formation of the walking system. A B Figure 34. Directional and autonomous locomotion. A ) Denatured PAGE analysis for walker movement in the S4 S1 and S1 S4 directions; the band shows the short cleaved substrate fragments for the respective anchorage site as a function of irradiation time. B ) Quantification of the cleavage fraction using Image J software.

PAGE 65

65 Figure 35 Photolysis of anchorage site without adding DNA walker. 1.0M T, S1, S2, S3 and S4 DNA strands were annealed (95C 10C over 20 min) and incubated in Tris buffer before light irradiation. Ten L aliquots were removed from the li ght source at 0, 10, 20, 40 and 60 minutes. Before running the denatured PAGE gel, the samples were kept in the dark on ice.

PAGE 66

66 Figure 36. The motion of DNA walker along another designed track T*. For S4 S3, S4 W and T* S1 S2 S3 complexes were separat ely prepared (95C 10C over 20 min) and mixed immediately before light irradiation, while for S3 S4, separate S3W and T* S1 S2 S4 complexes were prepared in a similar way. The band intensities were analyzed by Image J software.

PAGE 67

67 A B Figure 37. P rogressive walking demonstrated by FRET assay. A ) Cy5 (S2 anchorage site) fluorescence intensity (662nm) and B ) FAM (FRET donor for TAMRA modified S3 anchorage site) fluorescence intensity (519nm) during light initiated (350nm) walker locomotion along trac k S4 S3 S2 S1 (S4 S1, red line) and S1S2 S3 S4 (S1 intensity of Cy5 reaches a maximum when the most probable location of the walker is at the S2 site; while the fluorescence intensity of FAM reaches a minimum when the most probable location of the walker is at the S3 site.

PAGE 68

68 A B Figure 38. Progressive walking demonstrated by FRET assay. FAM (donor fluorophore, green star) labelled walker moves on the anchorage site labelled by FRET acceptor fluorophore TAMRA (red) and Cy5 (blue). Fluorescence intensit y (662nm for Cy5, 575nm for TAMRA, during A ) S4 S1 and B ) S1 S4 tracks. The light source was obtained using the fluorometer, with light power of 66W/cm2 at 350nm (spectral bandwidth=10nm, interval time=0.1s). Figure 39. Time dependence of FRET. Slower sequential movement from S1S2 S3 S4, when using a S2* site without disulfide bond (Table S2). The fluorescence

PAGE 69

69 A B Figure 310. Controllable locomotion. A ) Walking speed controlled by dif ferent irradiation power; the cleavage fraction of respective anchorage site (along S4 S1 direction) was analyzed after 45 min irradiation at 350 nm. B ) The STOP and RESTART actions of the DNA walker are controlled by light irradiation. Monitoring the Cy5 (S2 anchorage site) fluorescence intensity source in the fluorometer at 350 nm, light power 66W/cm2). Walker moves along anchorage S1S2 S3 S4 on track T. Figure 311. FR ET experiments demonstrating controllable locomotion speed. Varying irradiation powers obtained by changing the slit width (20W/cm2, 66W/cm2 and 66W/cm2) were employed to initiate the walker motion.

PAGE 70

70 A B Figure 312. The motion of WS and WL (Table S2) along track T, with directional locomotion S4S3 S2 S1. Faster motion was observed for WL, with longer body length. The band intensities were analyzed by Image J software.

PAGE 71

71 CHAPTER 4 BUILDING A NANOSTRUCTURE WITH REVERSIBLE MOTIONS USING PHOTON IC ENERGY Background Nature has evolved various tiny protein machines ( e.g ., myosin, kinesin and dynein) that travel along a network of tracks within the cell to transport organelles and power cellular motion.98 158 Inspired by these proteinbased molecular motors, artificial devices,62,105,107,108,145 especially DNA based motors, have recently emerged and started to mimic the function of biological motors in cargo transport107 and biosynthesis.108 As biological macromolecules similar in size to molecular motors, an d with the added capability of simple programmable assembly, DNAs are suitable for the control of progressive, processive and directional movement at the molecular level. Energy supply is a major concern for any motor, and various energy sources (e.g., DN A hybridization,112,113,159,160 hydrolysis of either DNA/RNA backbones1 03, 1141 16 or ATP molecules1 17) have been previously explored for DNA walkers. Still, these artificial walkers are in their infancy; they are not as powerful or organized as their natural protein counterparts. In this regard, identification of new types of energy supplies could be meaningful in the development of the next generation mechanical robots, ideally with more powerful and controllable operation.105 We recently reported a new light energy powered DNA walker, which is capable of regulated autonomous movement along a nucleic acid track.69 Construction of freerunning and autonomous motors, which remain in operation as long as a source of energy is available, is essential to the operation of nanomachines that mimic biological function. However, the capability of autonomous motion sometimes results in decreased controllability. That is, the device cannot be easily stopped at a desired position or time,

PAGE 72

72 or once stopped, it is diffic ult to restart. The availability of an easily controllable, freerunning walking device would also be significant for the future design of nanorobots to perform multiple and complex functions. We have demonstrated that photochemical energy sources can serv e as inputs in the operation of nanosized DNA walkers, where light initiated chemical cleavage allows precise control of the speed and motion of autonomous nanorobots.69, 152 The directional movement of the abovementioned light driven walker stems from the burnt bridge mechanism, whereby the anchorage sites on the track are irreversibly consumed during the motion. However, as a result, the reversible, cyclic operation of the walking device has been eliminated, preventing the walker from mimicking natur al molecular motors ( e.g ., kinesin) that change the directionality of movement towards both ends of the tracks,158 and seriously restricting future usage of the device for multiple trips. Advancing the functions of the walking system to facilitate reversible and multidirectional locomotion is one goal of DNA engineering. In the present work, we describe a new light driven walking system, which enables the DNA walker to travel in either direction on the track, with precise controllability, by using different wavelengths of light irradiation. Experimental Section Chemicals and Reagents The materials for DNA synthesis were purchased from Glen Research (Sterling, VA), including 6(3', 6' dipivaloylfluoresceinyl 6 carboxamido) hexyl phosphoramidite (6FAM), 5' Dimethoxytrityloxy 5 [N ((tetramethylrhodaminyl) aminohexyl) 3 acrylimido] 2' deoxyuridine phosphoramidite (TAMRA dT), and 5 dabcyl phosphoramidite. Other chemicals were purchased from SigmaAldrich. All reagents for buffer preparation and

PAGE 73

73 HPLC purificat ion came from Fisher Scientific. Unless otherwise stated, all chemicals were used without further purification. Synthesis of Azobenzene P hosphoramidite and DNA The synthesis of azobenzene phosphoramidite has been reported before.1 49,150 The purity of the product has been proven by 1H NMR (CDCl3) 1.25 (m, 15H). 31P NMR (CDCl3 All oligonucleotides were synthesized using an ABI 3400 DNA synthesizer (Applied Biosystems, Inc., Foster City, CA) at the 1.0 micromolar scale. After complete cleavage and deprotection, the DNA sequences were purified on a ProStar HPLC system (Varian, Palo Alto, CA) with a C 18 reversed, 250mm 4.6 mm). The eluent was 100mM triethylamineacetic acid buffer (TEAA, pH 7.5) and acetonitrile (0 30min, 10 100%). All DNA concentrations were characterized with a Cary Bio 300UV spectrometer (Varian) using the absorbance of DNA at 260nm. PAGE G el A nalysis The binding and threedimensional structures of the DNA walking system were observed using native PAGE gel. The gel was run in 810% acrylamide (containing 19/1 acrylamide/bisacrylamide) mixture with 1TBE/15mM Mg2+ buffer, at 100V constant vo ltage for 1 hour (4C). After that, the gel was stained 30 min using Stains All (Sigma Aldrich) to image the position of DNA. Photographic images were obtained under visible light with a digital camera. Oligonucleotides Employed All oligonucleotides were s ynthesized using an ABI 3400 DNA synthesizer (Applied Biosystems, Inc., Foster City, CA). The DNA sequences employed in this

PAGE 74

74 study: Track T1 2* 3: 5 ACC ATC TGT GGC ATA GCA GCG AGT ATC TAA CGC ATG GAA GCG TCG ATC TTG AGC ATT GGA GCG3; T1 0 2: 5 AGT ATC TAA CGC ATG GAA GCG ACC ATC TGT GGC ATA GCA GCG TCG ATC TTG AGC ATT GGA GCG3; T1 2: 5 AGT ATC TAA CGC ATG GAA TCG ATC TTG AGC ATT GGA GCG3; Anchorage site S0: 5 GTC CGA ATC AGC ACT TTC GCT GCT ATG CCA CAG AT G GT 3; S1: 5 GTC ACT CTTGTC CGA ATC A GC ACT FAM TTC GCT CCA ATG CTC AAG ATC GA 3; S2: 5 CA Z TTZ GGZ AG Z TC Z AC Z TC Z TTZ GT Z C CGA ATC AGC ACT TAMRA TTC GCT TCC ATG CGT TAG ATA CT3; S2*: 5 GGZ AG Z TC Z ACT CTTGTC CGA ATC AGC ACT TAMRA TTC GCT TCC ATG CGT TAG ATA CT 3; S3: 5 CA Z TTZ GGZ AG Z TC Z AC Z TC Z TTZ GT Z C CGA ATC AGC ACT TTC GCT GCT ATG CCA CAG ATG GT 3; Walker W: 5 Dabcyl AGT GCT GAT TCG GAC AGG CTA GCT ACA ACG AGA GTG ACT CCA ATG 3 ( T1 2 = track to arrange anchorage site in the order of S1S2; Z = a zobenzenemodified position in the anchorage site). Manipulation of the Walking System Using S3 S2* S1 as an example, the formation of the walking system was as follows. After separate annealing (95C 10C, over 20 min) in 25mM Tris buffer (pH=7.5, contai ning 50mM NaCl and 5mM MgCl2), T S1 S2* and S3W conjugates were mixed to give a final concentration for each sequence of 0.1M, and the sample was irradiated with either a 6W portable UV lamp (60 Hz with center wavelength at 365 nm and measured light sour ce power around 0.2mW) or a table lamp (60Hz, 120V with 60W bulb). The irradiation power employed was measured using a power meter (Newport Corp., Irvine, CA). During irradiation, the temperature of the sample was

PAGE 75

75 maintained at 23.0C using a water bath (T hermoNESLAB Inc.). After a series of irradiation times, the samples were removed and subjected to FRET experiments. FRET Measurements A FluoroMax 4 Spectrofluorometer with a temperature controller (Jobin Yvon) was used for all steady state fluorescence me asurements. After a series of irradiation ex=488nm; slit number=5nm, ex=550nm; slit number=5nm, 0.2s integration time) were recorded, with temperature controll ed at 23C. Results and Discussion The Formation of the Walking System The movement of the DNA walker is guided by the prescriptive landscape. Through precise specification of walker/ environment interactions, directional locomotion can be realized without a cleavage process. In DNA strand exchange, one prehybridized strand in a DNA duplex is displaced by an invading strand. The rate of strand exchange can be quantitatively controlled by varying the length of toeholds (short single stranded domains to init iate displacement).1 61, 162 Based on toeholdmediated strand displacement, we demonstrate in this study the reversible, autonomous and controllable movement of DNA walkers along an azobenzeneincorporated prescriptive track. The walking system consists of three parts: a singlestranded DNA track (T), several photosensitive anchorage sites ( e.g ., S1 and S2), and a DNA walker (W) (Figure 4 1 ). The track contains three 21nucleotide (nt) long binding regions that are complementary to the recognition tags of t he respective anchorage sites. Through specific DNA interaction, the track organizes the anchorage sites into one self -

PAGE 76

76 assembled construction, with the walker (W) binding sites extending from the track. (Figure 4 2 ) After assembly, the distance between two adjacent anchorage sites corresponds to two helical pitches, roughly 7nm. The construction of the overall walking system was verified by native polyacrylamide gel electrophoresis (Figure 4 3 ). The DNA walker contains two legs, a searching leg and a holding leg, and they are linked by a DNA oligomer as the body. The two motion legs are designed to respectively bind the two extender segments of each anchorage site. The holding leg binds the 16nt extender segment, which is identical in all anchorage sites to prevent the walker from leaving the track. The other extender segment, which serves as the toehold to mediate the locomotion (strand displacement) of the walker, is designed to be complementary with the searching leg of the DNA walker. Various numbers of azobenzene moieties were incorporated into different extender segments. The photoinduced isomerization of azobenzene molecules has been broadly used to induce significant conformational and biochemical changes in nucleic acids,149,150,163,164 peptides and proteins .1 6 5 The light driven cis/trans isomerization of the azobenzene moiety is wavelengthdependent: UV light at 365nm drives the trans to cis conversion, while visible light at around 465nm corresponds to the cis to trans isomerization. When incorporated into the DNA structure, the UV light induced cis form lowers the binding affinity of the DNA duplex based on the spatial hindrance to DNA hybridization. In contrast, visible light irradiation reverses the isomerization and enables DNA duplex binding. B y introducing azobenzene moieties into the toehold domain of extender segments, the moving direction of the walker ( i.e.,

PAGE 77

77 the stranddisplacement pathway towards the longer toehold binding site) is controllable by irradiation with different wavelengths of light (Figure 4 1). Two Step Photocontrollable Locomotion The directional locomotion of the DNA walker was investigated using a fluorescence resonance energy transfer (FRET) assay. As the FRET acceptor, Dabcyl quencher was labeled on the walkers holding leg, and fluorescence donors, 6carboxyfluorescein (6FAM) and tetramethylrhodamine (TAMRA), were attached to anchorage sites S1 and S2, respectively (Figure 4 4 ). Because FRET efficiency is proportional to the inverse 6th power of the donor acceptor distance, FRET is expected to occur most efficiently when the walker steps onto the respective anchorage site, thereby bringing FAM (or TAMRA) and Dabcyl together. We first tested the feasibility of our method by using the simplest twostep photocontrollable l ocomotion (Figure 4 5 ). The FAM labeled S1 anchorage site containing 7 nucleotides (7nt) served as the toehold domain for binding the searching leg of the DNA walker. In comparison, the TAMRA labeled S2 site containing a longer toehold region (14nt) also included nine azobenzene moieties (one after every two bases, see Experimental Section). Such azobenzene/ nucleic acid ratio has previously been proven to be highly efficient in regulating DNA hybridization efficiency.149,150,163,164 Based on the nearest neighbor model of azobenzeneincorporated DNA duplex formation,164 a full thermodynamic description has been presented and successfully used to predict the melting temperature of azobenzeneincorporated DNA duplexes. Under visible light, the trans form o f azobenzene facilitates DNA duplex binding, and the longer toehold within the S2 anchorage mediates the directional motion of walker from S1 to S2 site. In contrast, UV light irradiation induces the trans to cis isomerization of

PAGE 78

78 azobenzene and reduces the length of the available toehold within the S2 anchorage site to reverse the direction of motion (S2 to S1). Using locomotion from S2 to S1 as an example, the assumption was experimentally tested. The walker was specifically positioned on the S2 site thro ugh separately prepared T(track) S1 and S2W(walker) conjugates (Figure 4 3 ). Mixing the conjugates immediately prior to light irradiation ensured that the S2 anchorage would be the initiating site (the largest distribution binding position) for the walker Indeed, consistent with our expectation, directional walking pathways, i.e., S1 S2 under visible light (azobenzene trans) and S2 S1 under UV light (azobenzene cis), were observed (Figure 4 5 ). When initiated at the S2 site, W was expected to stay under t he visible light, instead of stepping onto the S1 site. Following the expected motional mode, irradiation for the first 1000s with visible light (450nm, Figure 4 5 ) did not have a great effect on the fluorescence from either FAM or TAMRA; however, UV light irradiation (365nm) immediately initiated the quenching of the FAM signal and the recovery of TAMRA fluorescence. As control, it was demonstrated that the same UV light does not affect the fluorescence signal of either dye (data not shown); the fluorescence change was indeed associated with locomotion of the walker from S2 to S1 site. In another control experiment, we demonstrated that the free anchorage site (with the same legs as S2) under the same conditions would not disturb migration of the walker between S1 and S2 along the track (Figure 4 6 ). This observation is important in proving that the DNA walker remains attached to the same track during the entire operation. Such

PAGE 79

79 processive locomotion3 prevents formation of a bridge between two tracks and forces the walker to move a longer distance along the track. The Reversible Movement The reversible movement of the walker along this photocontrollable track was also verified. As shown in Figure 4 7 by alternating the wavelength of light (450nm or 365 nm), the direction of locomotion was switched accordingly. At the end of each cycle of light irradiation, the device can be reset, and the walker is able to repeatedly perform similar mechanical motion. It is noteworthy that such reversible locomotion cann ot be achieved by movements based on the abovementioned burnt bridge mechanism whereby the track is irreversibly damaged during passage. Furthermore, no waste molecules (neither DNA duplex166, 167 nor chemical triggers109, 110) accumulate during the rever sible operation, an important consideration for the continuous long term usage of the walking device. Route Selection in Multipath Systems When given a selection of routes in multipath systems, DNA walkers based on the burnt bridge mechanism will lose control of direction, with equal chance of moving on either path. This difficulty is viewed as one of main challenges for active DNA nanostructures.168, 169 However, we have demonstrated that route selection can be easily achieved in this azobenzenemodified walking device via irradiation with different wavelengths of light. As shown in Figure 4 8 a S0 anchorage site was introduced between the abovementioned S1 and S2 sites, as the initiating binding site (crossing point) for the walker. When irradiated with visible light, after 50 minutes incubation, c.a. 94% of the walker strands move to the S2 site (longer toehold and faster, more stable binding), and only 6% of the strands bind to S1. In another study, under UV light, as

PAGE 80

80 expected, more walker strands turn ed to the S1 site (69% at equilibrium) compared with S2 (31%, see Figure 4 9 ). With UV light irradiation, it was also proven that 1) it takes longer for walkers to choose the route and 2) the final walker strand distribution is less controllable. This result is associated with the fact that a smaller toehold length difference (comparing that between S1 and S0 sites with that of between S2 and S0) can result in a longer time to reach equilibrium and a smaller equilibrium constant.1 61 162 Potentially, this pr ocess could be further optimized by varying the numbers of toehold nucleotides and azobenzenes in the anchorage sites. Longer Distance Motion Finally, we wanted to prove that movement over a longer distance can be achieved by logical programming of the anchorage sites. As an example, an S2* anchorage site was introduced between S1 and S3 sites (with the same extender segments as S2, Experimental Section), with the distance from each site as 7nm (Figure 4 10). With visible irradiation, S2* has a 10nt long segment in between S1 (7nt) and S3 (14nt) to bind with the walkers searching leg. The toehold length difference mediates the movement in the direction of S1 S2* S3. Moreover, these three anchorage sites were designed with various numbers of azobenzene m oieties: 0, 3 and 9 for S1, S2* and S3, respectively. These numbers were selected so that the binding strength with the DNA walker followed the order of S1>S2*>S3 under UV light,164 because trans to cis isomerization of the azobenzene moieties results in a different degree of change to the three sites. Based on the switched toehold length and dynamic binding affinity, the walker should preferentially move in the direction of S3 S2* S1, reversing the previous movement.

PAGE 81

81 As demonstrated from the fluorescence m easurements (Figure 410 ), when walking was initiated at S1 site (visible light irradiation), about an hour on average was required to pass through TAMRA modified S2* (minimum fluorescence) and further move on to the S3 site (recovered TAMRA fluorescence). Under UV light irradiation, the reverse motion was demonstrated, starting from S3 site, passing through S2*, and finally reaching the S1 destination, proving that the walker can move in either direction along a prescriptive photoswitchable track. Conclus ions Based on the isomerization of azobenzene moieties and toeholdmediated strand displacement, we have designed a light controlled DNA walking device that can move to either end of the oligonucleotide track, and the direction of motion can be switched u sing different wavelengths of light. Compared with other reported DNA walkers, 62,103108,112116,145 this new strategy not only preserves the autonomous and controllable movement, but also provides a reusable track, making it feasible to reset the device after the complete trip, as observed in nature for kinesin and myosin.98,158 So far, the rate and step number of this device are still limited, which might be due to the imperfect photoisomerization efficiency of the azobenzene moieties. However, the princ iple of photoisomerizationinduced toehold length switching could be further used in designing other autonomous DNA based walking devices, where sequential and controllable release of the toehold is required.103, 114116 Moreover, as the first study (based on our knowledge) of using photoswitchable molecules for alternating the DNA toehold binding regions, this system can be employed for external control of the route selection in multi pathway systems, e.g ., crossing or T junction, for more advanced wal king devices that can rival molecular motors in nature.

PAGE 82

82 A B Figure 4 1 Principle of the DNA based walking device. Walker, anchorage sites, and track form the walking system through self assembly; the locomotion of the walker is realized through toeh old mediated strand displacement. A ) Visible light irradiation (azobenzene, trans ) triggers walker motion in the direction of S1 S3; B ) UV light (azobenzene, cis ) induces the reverse movement of S3 S1. (Domains a, b, c and d are complementary to a, b, c and d, respectively).

PAGE 83

83 Figure 4 2 Sequences of DNA for constructing walking system.

PAGE 84

84 A B Figure 4 3 Native gel electrophoresis to demonstrate the construction of walking system. The higher molecular weight structure results in a slower movement i n gel electrophoresis and an upper band. The construction of both S1S2 W T1 2 conjugate B ) and S0S1 S2 W T1 0 2 conjugate A ) are proven.

PAGE 85

85 A B Figure 4 4 A ) Fluorescence resonance energy transfer (FRET) between the Dabcyl labeled Walker ( W ) and FAM la ex = 488 nm; B ) FRET between Dabcyl labeled Walker ( W ) and TAMRA dT ex = 550 nm. A B Figure 4 5 Progressive walking demonstrated by FRET assay. Dabcyl (quencher, star)labeled walker moves on the anchorage site labeled with fluorophore TAMRA (circle) and FAM (triangle). Fluorescence intensity (515nm for FAM, ex= 488nm; 580nm for TAMRA, ex= 550nm) was monitored during A ) S1 S2 locomotion (continuous visible irradiation) and B ) S2 S1 locomotion (visible irradiation for 1000s followed by UV irradiation)

PAGE 86

86 Figure 4 6 Processive motion of DNA walker. If free S3 could displace the walker strand from the track to which it is bound, the TAMRA fluorescence would be recovered; and only a neglectable effect was observed in the experiment. Preannealed S1FAM/ W Dabcyl sample was mixed separately with S2TAMRA/T1 2 (red line) and S3/S2TAMRA/T1 2 (blue line) sample. The TAMRA fluorescence was monitored post mixing ( em ex = 550 nm ).

PAGE 87

87 Figure 4 7 R eversible walking demonstrated by FRET assay. T he reversible movement of the walker during the alternate period of UV and visible irradiation.

PAGE 88

88 Figure 4 8 Programmed control of route selection at a junction. Left turn (S0 S1) was achieved under UV light irradiation, and right turn (S0 S2) was induced by visible light. The fractions of the walker (labeled with Dabcyl, star) moving towards S2 (labeled with TAMRA, circle) or S1 (labeled with FAM, tri angle) were monitored based on the fluorescence intensity change and further calculated using a standard calibration curve.

PAGE 89

89 A B C D Figure 4 9 Fluorescence study confirming the photocontrollabl e direction selectivity. Both A ) TAMRA and B ) FAM flu orescence were recorded after periods of UV or visible light irradiation; at time=0 min, preannealed S0W and S1 S2 T sample were mixed. Based on the standar d calibration curve of either C ) FAM or D ) TAMRA, the percentage of walker steps towards each direc tion was calculated. The calibration curve was prepared by monitoring the fluorescence intensities of S1FAM (or S2 TAMRA) during the titration by W Dabcyl. The concentration of S1FAM (or S2 TAMRA) was fixed as 100nM, while the concentration of W Dabcyl was varied among samples in the range of 0 100nM [the X axis of figure C ) and D ) is the concentration of the left over free S1 or S2 strand after W binding].

PAGE 90

90 A B Figure 4 10. Progressive operation of the walker on a 3step track. Motion was demonstrated in the direction of S1 S2* S3 under visible light, and it was reversed to follow the S3 S2* S1 direction with UV irradiation. Fluorescence intensity was monitored at 515nm for FAM (triangle) labeled S1 site ( ex= 488nm) and at 580nm for TAMRA (circle) labeled S1* site ( ex= 550nm).

PAGE 91

91 CHAPTER 5 PHOTON REGULATED DNA ENZYMATIC NANOSTRUCT URES BY MOLECULAR ASSEMBLY Background Molecular assembly enables the development of smart nanostructures designed to perform a desired function. Perfecting such assembled nanostructures depends on the availability of molecules which can serve as linkers or as both linkers and functional units for the assembly. In addition to its primary role as a carrier of genetic information, DNA has recently gained considerable attention as one of the most promising building blocks for the design and assembly of nanostructures.1 70172 Owing to its high sequence specificity and addressability, DNA molecules can also be used to direct the assembly of other functional molecules. Examples include DNA templated organic synthesis,1 73 identification of ligands for protein targets,1 74 and DNA guided nanoparticle1 75,176 and protein1 77183 arrays. Because DNA molecules are both readily accessible and easi ly modified by chemical synthesis, decorating DNA with various functional moieties for analytical and biomedical applications is feasible. In particular, incorporating enzymatic functionality into DNA nanostructures could increase the utility of both types of macromolecules. In the present report, we demonstrate a general method for precisely controlling the catalytic activity of a DNA enzyme assembly. To the best of our knowledge, this study is the first to report precise modulation of the structures and f unctions of an enzymatic assembly based on light induced DNA scaffold switching. As efficient and clean external triggers, light regulated processes provide precise temporal and spatial control over various biological and analytical systems.1 84 Among vari ous photoresponsive molecular tools, the photoinduced isomerization of azobenzene molecules has been broadly studied and used to induce significant

PAGE 92

92 conformational and biochemical changes in nucleic acids,1 85 peptides and proteins.1 86,187 The light driven cis/trans isomerization of the azobenzene moiety is wavelengthdependent: UV light at 365nm drives the trans to cis conversion, while visible light at around 465nm corresponds to the cis to trans isomerization. As a consequence of spatial structure alternation during cis/trans isomerization, geometry dependent biological activity changes occur, forming the foundation of the azobenzenebased photomodulation of biological processes. In biology, different enzymatic reactions often work together in a cascade fashion. Such concatenated catalytic transformations are important for controlling cellular signaling, and they have also found applications in biotechnology,1 88194 e.g. biosynthesis. The cellular response to a stimulus usually depends on when and how a specific enzyme is activated.1 95197 Thus, for example, the ability to control enzymatic activity in the context of physiological cell signaling would be very useful in clinical applications. Experimental Section Chemicals and R eagents N maleimidocaproyloxy] sulfosuccinimide ester (SulfoEMCS) was purchased from Pierce Biotechnology. Other chemicals and enzymes (glucose oxidase, horseradish peroxidase) were purchased from SigmaAldrich. The materials for DNA synthesis were purchased from Glen Research (Sterling, VA). All reagents for buffer preparation and HPLC purification came from Fisher Scientific. Unless otherwise stated, all chemicals were used without further purification.

PAGE 93

93 Synthesis of Azobenzene P hosphoramidite and DNA The synthesis of azobenz ene phosphoramidite was similar to the reported protocol and is shown as Figure 51 Compound 1. 1H NMR (CDCl3 7.38 (m, Compound 2. 1H NMR (CDCl3 1H NMR (CDCl3 8.004.10 (m, 2H), 1.25 (m, 15H). 31P NMR (CDCl3 All oligonucleotides were synthesized using a n ABI 3400 DNA synthesizer (Applied Biosystems, Inc., Foster City, CA) at the 1.0 micromolar scale. After complete cleavage and deprotection, the DNA sequences were purified on a ProStar HPLC system (Varian, Palo Alto, CA) with a C 18 reversedphase column 250mm 4.6 mm). The eluent was 100mM triethylamineacetic acid buffer (TEAA, pH 7.5) and acetonitrile (0 30min, 10 100%). All DNA concentrations were characterized with a Cary Bio 300UV spectrometer (Varian) using the absorbance of DNA at 260nm. Preparation of O ligonucleotide M odified GOx The thiolated DNAzyme solution (100L, 25M) was reacted with 25mM dithiothreitol (DTT) for 1 hour at 25C, and then the solution was purified using a NAP 5 column (GE Healthcare). After 1105M GOx and 504M Sulfo EMCS linker were incubated in phosphate buffer (12mM, pH=7.4) for 45 min at 25C, the excess SulfoEMCS linker was removed by a centrifugal filter (Ultracel 30K membrane, Millipore). The 1105M Sulfo EMCS linked GOx was further incubated wit h 5105M of freshly prepared thiolated DNAzyme probe for 2 hours at 25C, after which the excess

PAGE 94

94 DNAzyme was removed using a centrifugal filter (Ultracel 100K membrane, Millipore). Finally, the resulting products were confirmed by polyacrylamide gel elec trophoresis (PAGE) experiments, which were performed on an 8% native gel in TBE buffer (89mM Tris HCl, 89mM boric acid, 2mM EDTA, pH 8.0) for 1 hour at 100V. After that, gels were stained using Stains All (Sigma Aldrich) to image the position of DNA. Prep aration of O ligonucleotide M odified HRP The procedure was similar to that for modified GOx, except that 1105M Sulfo EMCS linked HRP was incubated with 7105M of freshly prepared thiolated DNAzyme probe for 3 hours at 25C, and excess of DNAzyme was rem oved using a 30K centrifugal filter. FRET M easurements of A zo DNA The mixture of 100nM FAM labeled 24mer DNA and 100nM Dabcyl labeled azocDNA was incubated 10min in Tris buffer (10nM, pH 7.5, mixed with 50mM NaCl and 10mM MgCl2). By exciting at 488nm, the FAM fluorescence (515nm) of the probes was recorded after 2min with alternating intervals of UV (365nm) and visible (500nm) light irradiation. HRP DNAzyme A ctivity P hotoM odulation A ssays The Xc Yazo probe (300nM) was first annealed 20 min in HEPES buff er (25mM, pH 7.8, mixed with 30mM KCl and 200mM NaCl), followed by addition of 2M hemin (all concentrations refer to the final solution). After a 10 min incubation period at RT, 190L of the above solution was either irradiated 10 min by a 6W portable UV lamp (60 Hz with center wavelength at 365 nm and measured light source power around 0.2mW) or kept under room light. Immediately after removing the sample from the light source, 2.5mM ABTS2 and 5mM H2O2 were added, in order (final volume = 200L). The ti me -

PAGE 95

95 dependent absorbance change was recorded at 415nm, and the value was recorded 3 min after adding H2O2. GOx/HRP DNAzyme A ctivity A ssays As shown in Figure 5 2 in the Supporting Information, the conjugation between GOx and 10c 5azo probe reached an appr oximate 1:1 ratio, based on the absorbance result. An aliquot of 100nM conjugated GOx/10c 5azo probe (or separately added 100nM GOx and 10c 5azo probe) was incubated with 50nM hemin in HEPES buffer (25mM, pH 7.8, mixed with 30mM KCl and 200mM NaCl). Then, 190L of the above solution was either irradiated 10 min by the portable UV lamp or kept under room light. Immediately after removing the sample from the light source, 2.5mM ABTS2 and 10mM glucose were added, in order (final volume = 200L). The timedependent absorbance change was recorded at 415nm. GOx/HRP C ascade A ctivity A ssays After spectrophotometric determination of concentrations, equal amounts of GOx azo cDNA and HRP 24mer DNA probe from 1nM to 32nM were incubated in HEPES buffer (25mM, pH 7.8, mixed with 20mM MgCl2 and 200mM NaCl). A 190L aliquot of the above solution was either irradiated 10 min by the portable UV lamp or kept under room light. Immediately after removing the sample from the light source, 2.5mM ABTS2 and 5mM glucose were adde d, in order (final volume = 200L). The time dependent absorbance change was recorded at 415nm 9min after initiating the reactions.

PAGE 96

96 Results and Discussion The Principle of Regulation Figure 5 3 illustrates the principle of using photoresponsive DNA to s caffold the glucose oxidase (GOx)/horseradish peroxidase (HRP) multienzyme system. Hybridization/ dehybridization of DNA nanoarchitectures modulate the proximity of the catalytic centers ( i.e. functional domains within GOx and HRP enzymes) that determines the efficiency of enzyme cascade reactions.1 88,190 When in close proximity, the high local concentration of intermediate product allows cascade reactions, which would otherwise be limited by the substrate diffusion rate, to occur. UV light induces the tra ns to cis conversion of azobenzene, which provides low binding affinity of the DNA duplex and keeps the enzymes separated. In contrast, visible light irradiation reverses the isomerization, thus enabling DNA duplex binding and direct proximity of the catal ytic domains within the two enzymes. The glucose oxidase (GOx) and horseradish peroxidase (HRP) system was utilized for proof of concept. Specifically, the primary enzyme GOx catalyzes the oxidation of glucose to gluconic acid, with the concomitant forma tion of H2O2, and the latter product acts as the substrate for HRP, mediating the oxidation of ABTS2 to the colored radical product ABTS-. In this way, the efficiency of cascade reactions can be directly monitored from the absorbance of ABTSradical at 415nm. The FRET Study First, the photo induced conformational change of the DNA duplex structure was verified on the basis of distancedependent fluorescence resonance energy transfer (FRET) between fluorescein and dabcyl dyes. The azomodified DNA was synthesized with an azobenzene moiety every two bases and was labeled with dabcyl at the 3 end.

PAGE 97

97 The complementary DNA sequence without azo modification was labeled at the 5 end with fluorescein, the donor dye for the dabcyl quencher. The hybridization or dehybridization of the DNA strands led to quenched or highly fluorescent signals, respectively. By alternating UV and visible light irradiation, the reversible conformational change of the DNA duplex was demonstrated ( Figure 5 4 ). Photoregulation of GOx/ HRP Cascade Activity Instead of direct chemical coupling, the conjugation of DNA and enzyme was facilitated by a commercial cross linker, sulfo EMCS. Following the standard protocol, the alkylthiol modified DNA oligomers were conjugated at the active lysine site of GOx or HRP enzymes, as verified by polyacrylamide gel electrophoresis and absorption spectra (Figure 5 2 ). The GOx enzyme was conjugated to the azomodified DNA, while the HRP enzyme was linked to the complementary DNA. After conjugation, their a ctivities were tested and found to correspond to ca. 85% of those of the native enzymes. The reactivity of the GOx/HRP cascade system was monitored by continuous measurement of the absorbance of the cascade product ABTSat 415nm. After 10 minutes of incu bation at 450nm (azobenzene trans ; DNA hybridized), generation of ABTSwas observed immediately after adding the initial reactant (glucose). However, after 10 minutes of UV (365nm) irradiation (azobenzene cis ; DNA unhybridized), the production of ABTSwas blocked (Figure 5 5 ). The enhancement in cascade reactivity between UV and visible irradiation was calculated to be in the range of 10to 25 fold, depending on the concentration of each enzyme moiety. The difference between cis and trans states could be observed by the colorless to yellow green color change during the turnover of ABTS2 to ABTS-. When UV irradiation was used as a control, the enzymatic activities of GOx and HRP were only marginally affected (318%) under

PAGE 98

98 these experimental conditions (Figure 5 6 ), indicating that hybridization/ dehybridization is the major reason for the observed photoregulation. The high local concentration of generated H2O2 in the vicinity of the secondary HRP catalytic center accelerates the cascade reaction, as n oted previously, and guarantees a high turnover of ABTS2 to ABTS-. Photoregulation of HRP DNAzyme Activity The promising photoregulation demonstrated for the GOx/HRP system led us to extend the design to nucleic acid enzymes. In addition to naturally occurring proteinbased enzymes and ribozymes, socalled DNAzymes have been developed to catalyze reactions, such as RNA/DNA cleavage, ligation, phosphorylation and branching.48, 1 98 We further demonstrate that a general method for photoregulation of DNA based enzymatic nanostructures can also be developed on the basis of azobenzenemodified DNA structures. The HRP DNAzyme, perhaps the most widely used biocatalytic DNAzyme for amplified biosensing,199 202 consists of a hemin cofactor intercalated G quadrupl ex structure. This DNAzyme was chosen for concatenation to GOx, as shown in Figure 5 7 The azobenzene moieties were positioned within a DNA oligomer complementary to the HRP DNAzyme sequence. The basis for photomodulation is the competition between the f ormation of the DNA duplex and the G quadruplex. The cascade reaction is deactivated under visible irradiation because the DNAzyme hybridizes with cDNA in the trans azobenzene configuration. However, when UV is applied, the trans to cis conversion induces dissociation of the DNA duplex, freeing the DNAzyme to bind hemin and catalyze the cascade reaction.

PAGE 99

99 First, the photo regulation efficiency of the DNA switch probe was optimized. (Figure 5 8 ) Since even minor modification to the DNAzyme sequence could result in significant disruption of enzymatic activity, we decided to incorporate the azobenzene moieties into the complementary part, not the DNAzyme sequence itself. Optimization of the probe was based on maximizing the efficacy of photoisomerization by adjusting the number and positions of azobenzene moieties and the resulting DNA duplex binding strength. One merit of employing DNAs as scaffolds is their flexibility in synthesizing sequences with various binding strengths and functional groups. A series of probes was prepared with varying base pair number, azobenzene content and position ( Table 5 1). The probes were named as Xc Yazo, where X is the number of complementary base pairs, and Y is the number of azobenzene moieties in the regulatory domain. Simil ar to the protocol followed in assessing the GOx/HRP cascade, the DNA probe and H2O2 were added to determine HRP DNAzyme activity, and ABTSabsorbance was monitored (415nm) after applying either UV or visible light irradiation ( Figure 5 9 ). A 2 to 12 fo ld enhanced catalytic efficiency after 10min of UV light irradiation was observed for the DNA switch probes investigated (Table 5 2 ). DNA probes with a single azobenzene moiety a fter every 2 bases showed higher regulation efficiency than probes possessing the maximum azobenzene number, consistent with the previous report.2 0 3,163 For probes with similar azo/cDNA base number ratio, the enhanced hybridization strength, achieved by elongating the DNA duplex, resulted in an attenuated catalytic activity of DNA switch probes under visible light: e.g. 14c 7azo < 11c 5azo < 9c 4azo < 7c 3azo. However, this trend was not obvious after UV irradiation, where different

PAGE 100

100 probes gave almost the same signal enhancement (Figure 5 10 ). These results are attributed to the ef ficient light regulated DNA duplex dehybridization. That is, in the cis form (ON state), different azoDNAs all have very low binding affinities with the complementary oligomer, but in the trans form (OFF state), the difference in cascade efficiency can be distinguished at room temperature. The almost fully recovered catalytic efficiency after UV irradiation was also confirmed by a readout similar to that of the original HRP When the complementary DNA length exceeded 10 base pairs, relatively similar photoregulation efficiency was observed. Therefore, the 10c 5azo probe was chosen for subsequent experiments, considering that the hybridization/dehybridization rate would probably be faster compared to that of longer DNA probes.2 0 4 Photoregulation of GOx/HRP DNAzyme Cascade Activity To prove the feasibility of modulating DNA enzyme conjugation, molecular assembly of the proteinbased enzyme GOx and nucleic acidbased HRP DNAzyme cascade system was f urther studied. The azobenzenemodified complementary DNA was linked on one end to glucose oxidase, with the other end linked to the HRP DNAzyme by a polyethylene glycol (PEG) spacer. Photoregulation was demonstrated in both covalently linked and freely m ixed GOx/ HRP DNAzyme cascade systems (Figure 5 11). In both cases, the gentle UV light irradiation before initiating the reactions activated the formation of HRP DNAzyme and enhanced the reaction efficiency. The covalently linked enzymatic constructions displayed higher cascade ability, consistent with the immediate proximity of the catalytic centers, accelerating the reactions which would otherwise be limited by substrate diffusion. Moreover, the reversible ON/OFF

PAGE 101

101 regulation of the enzymatic activity for several rounds was demonstrated by alternated UV and visible light irradiation (Figure 5 12). Conclusions This study has demonstrated the molecular assembly of nanostructures functionalized by light regulation. The azobenzenemodified DNA linkers can be used as arms to mediate signal transduction in an enzyme assembly. To the best of our knowledge, this is the first study to report the photomanipulation of DNA enzymatic molecular assemblies. Taking advantage of the photoisomerization property of azobenz ene moieties and highly specific self assemblies of DNA oligomers, we were able to achieve rapid and precise translocation of either small molecules (cofactors like hemin) or macromolecules (protein enzymes) to activate a cascade reaction. We believe that this approach can be applied to different types of protein enzyme or DNA enzyme structures. With the increased number of DNAzymes isolated by in vitro selection procedures,48,198 more enzyme cascade reactions based on photocontrollable capture of cofactor s ( e.g. hemin in HRP DNAzyme) will be realized. Such assemblies will be useful in future biomedical and pharmaceutical applications, especially since ordered sequential cascade processes are central to many complex biological phenomena, such as the coagul ation cascade for blood clotting and the apoptosis cascade for controlled cell deletion. The location, timing and overall activity of any biochemical transformation inside the cell can have distinct biological consequences. While there may be initial concern that the UV light may harm biological systems, the speed of this light driven procedure, as well as the recent development of azobenzene molecules responsive to visible, or even near infrared light,93, 94 could help to overcome this issue.

PAGE 102

102 Table 5 1. S equences of DNA swit ch probes and DNA linkers Probe Sequence 14c 7azo 5 T z TC z CC z AA z CC z CG z CC z C(PEG) 5 G GGTAGGGCGGGTTGGGAA 3 12c 6azo 5 T z TC z CC z AA z CC z CG z C (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 11c 10azo 5 T z T z C z C z C z A z A z C z C z C z G (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 11c 5azo 5 T z TC z CC z AA z CC z CG (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 10c 9azo 5 T z T z C z C z C z A z A z C z C z C (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 10c 5azo 5 T z TC z CC z AA z CC z C (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 9c 8azo 5 T z T z C z C z C z A z A z C z C (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 9 c 4 azo 8 c4azo 5 T z TC z CC z AA z CC (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 5 T z TC z CC z AAzC (PEG)5GGGTAGGGCGGGTTGGGAA 3 7c 6azo 7c 3azo 5 T z T z C z C z C z A z A (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 5 T z TC z CC z AA (PEG) 5 GGGTAGGGCGGGTTGGGAA 3 HRP DNAzyme 5 GGGTAGGGCGGGTTGGGAA 3 24mer FAM 5 FAM ACTCATCTGTGAAGAGAACCTGGG 3 C24 azo Dcl 5 CC z CA z GG z TT z CT z CT z TC z AC z AG z AT z GA z GT Dabcyl 3 24mer arm 5 ACTCATCTGTGAAGAGAACCTGGGTTTTTTTT SH 3 C24 azo arm 5 HS TTTTTTTTCC z CA z GG z TT z CT z CT z TC z AC z AG z AT z GA z GT 3 The switch probe was named Xc Yazo, where X is the number of complementary base pairs, and Y is the number of azobenzene moieties in the regulatory domain. In the sequence, z stands for azobenzene moieties.

PAGE 103

103 Table 5 2 Regulation of the activities of HRP DNAzyme probes by UV or visible light Probe [a] 415 (vis) [b] 415 (UV) A UV / A VIS 7c 3azo 0.0470.003 0.1230.009 2.6 7c 6azo 0.0560.002 0.1290.002 2.3 8c 4azo 0.0380.003 0.1560.001 4.1 9c 4azo 0.0280.003 0.1230.006 4.4 9c 8azo 0.0590.001 0.1350.007 2.3 10c 5azo 0.0200.001 0.1260.003 6 .3 10c 9azo 0.0450.002 0.1370.004 3.0 11c 5azo 0.0190.002 0.1210.005 6.4 11c 10azo 0.0430.006 0.1440.011 3.3 12c 6azo 0.0190.005 0.1290.012 6.8 14c 7azo 0.0100.001 0.1230.006 12.3 [ a] The sequences of different probes are shown in the supporting information. [b] The absorbance of ABTSwas measured at 415nm, 3min after initiating the cascade.

PAGE 104

104 Figure 5 1 The synthesis of azobenzene phosphoramidite, which was further utilized for azoincorporated DNA synthesis.

PAGE 105

105 A B Figure 5 2 P AGE gel results A ) and absorption spectra B ) to confirm the binding between enzyme and DNA. The native PAGE gel results confirm the binding between enzyme and oligonucleotides: 1) 10c 5azo DNA modified GOx; 2) C24 azo DNA modified GOx; 3) GOx; 4) 10c 5azo DNA; 5) C24 azo DNA. The loading number of nucleic acids on the enzyme surface was determined by calibration based on the DNA absorbance at 260nm, HRP enzyme at 402nm and GOx enzyme at 450nm. Several rounds of centrifugal filter purification were further performed before starting the absorption experiments.

PAGE 106

106 Figure 5 3 Working scheme for photoregulation of DNA enzyme nanostructure. Light responsive azobenzeneintegrated DNA duplex controlling glucose oxidase (GOx)/ horseradish peroxidase (HRP) protein enzyme cascade activity. Figure 5 4 Photoregulation of azobenzeneincorporated DNA duplex. Fluorescent state and quenched state represent DNA duplex dehybridization and hybridization, respectively.

PAGE 107

107 Figure 5 5 Photoregulation effect on various concentration of GOx/ HRP enzyme conjugates. The absorbance data were obtained 9 min after initiating the reactions. The image was taken for the 16nM, 32nM and 8nM enzyme samples, left to right respectively. Figure 5 6 Influence of UV irradiation on the enzymatic activities of native GOx and HRP (enzyme concentration=2107 M).

PAGE 108

108 Figure 5 7 Working scheme for photoregulation of DNA enzyme nanostructure. DNA switch probe for regulating the function of GOx/HRP DNAzyme hybrid enzyme nanodevice. Figure 5 8 Fluorescence study confirming the photoregulation of HRP DNAzyme structure. Fluorescent state and quenched state represent DNA duplex dehybridization and hybridization, respectively. FAM and Dabcyl were labeled at the 5 and 3 ends, respectively. After UV irradiation, the quenched fluorescence demonstrates the dehybridization process.

PAGE 109

109 Figure 5 9 Absorbance/time profiles for Xc Yazo probe optimization. Immediately after removing the sample from the light source, 2.5mM ABTS2 and 5mM H2O2 were added, in order. The timedependent absorbance change was recorded at 415nm; blank sample contains the same amount of ABTS2 -, H2O2 and buffer condition in the absence of Xc Yazo probes.

PAGE 110

110 Figure 5 10. Effect of UV or visible light on the reg ulation efficiency of various HRP DNAzyme probes. In the cis form (UV), all the probes demonstrated similar activity, as a result of the very low binding affinity with the complementary oligomer, but in the trans form, the difference in cascade efficiency can be distinguished at the room temperature.

PAGE 111

111 Figure 5 11. Photoregulation of GOx/DNAzyme cascade activity: ( 1, 3) covalently linked GOx DNA after 10min under UV or visible light irradiation; ( 2, 4) freely mixed GOx and DNA after UV or visible li ght irradiation; ( 5, 6) GOx after UV or visible light irradiation.

PAGE 112

112 Figure 5 12. Reversible regulation of GOx/HRP DNAzyme (10c 5azo) reactivity by alternate visible (table lamp, 0.7min) and UV (365nm, 1.5min) irradiation. Under the visible light, the decreased absorbance at 415nm may be due to the short lifetime of the ABTSproduct.

PAGE 113

113 CHAPTER 6 PROFILING MULTICELL SURFACE MARKERS BY APTAMER ENCODED LOGIC CIRCUIT TO ACHIEVE I NTELLIGENT CANCER THERANOSTICS Background In r ecent decades advances in biomedicine have expanded our knowledge of the molecular signatures of diseases, including genetic and metabolic changes, as well as protein profiles.205207 Particularly, cell surfaces consist of thousands of compounds, such as lipids, proteins, and c arbohydrates, which play significant roles in cell growth, proliferation and signaling.208 For example, c ell surface receptors are specialized integral membrane proteins that participate in the communication between the cell and the outside world. Extrac ellular signaling molecules, such as cytokines or growth factors, attach to the receptor, triggering changes in the cells function. However, If the membrane receptors are altered directly or deficient for some reason, signal transduction can be hindered a nd cause diseases. This is true in cancer cells where alterations in the expression level and/or function of cell membrane receptors leads to systematic dysfunction as manifested in aberrant cellular metabolism, signaling and proliferation.209,210 By profi ling the high or low expression level of these surface membrane receptors, it may be possible to target the specific offending cancer cell types, thus enabling more precise diagnosis and therapy. Single receptor targeting currently dominates cell differentiation studies.211,212 Although significant, this strategy can only distinguish those cells having a common receptor. However, a receptor overexpressed in cancer cells may also be expressed at a lower level in some normal cells.213 Furthermore, in diseas es such as leukemia, both healthy and diseased subpopulations of white blood cells display surface markers that are indistinguishable by the current singlereceptor antibody therapy potentially leading

PAGE 114

114 to serious complications and even death by the indisc riminate invas ion of the host defense system .214,215 In comparison, a more practical and less risk prone approach would combine multiple surface receptors to pinpoint specific disease cells and thus, enhance diagnostic accuracy in differentiating similar cells.216,217 With this goal in mind we report a method of screening multiple cell surface markers by implementing a series of Boolean l ogic al operations. Basically, we have borrowed the artificial intelligence (AI) concept from computer science and developed a device that can exhibit a form of reasoning. Because of its predictable WatsonCrick hybridization and immense informationencoding capacity, DNA has been widely used to construct devices performing intelligent tasks, such as sensing48 and computat ion.8487, 218222 In these DNA based devices, Boolean logical operations ( e.g ., AND OR and NOT ), which are based on one or more inputs to produce an output, can be layered for construction of more complex programs. Although these devices are unlikely to replace the current von Neumann microprocessors, we hope to demonstrate that DNA computation can still find unique biomedical applications, considering the combination of programmable logic function, nanometer size and the ability to interact with the biol ogical microenvironment. As a specific type of functional oligonucleotides, aptamers can selectively recognize a range of possible targets, from small organic/inorganic molecules to proteins.2 23 ,224 The aptamer for a ligand of interest can be easily obtai ned through a process known as SELEX (systematic evolution of li gands by exponential enrichment .225 Recently, we and others have developed a cell based SELEX process for the selection of a panel of cancer cell specific aptamers.226 The membrane protein

PAGE 115

115 tar gets of these selected aptamers represent the molecular signatures of the cancer cells. These aptamers have demonstrated the capability to identify different expression patterns of the same membrane receptors in a variety of cell types, and it is possible that they may even hold the ability to differentiate the same population of cancer cells within various stages of the cell cycle.227 Our goal is to demonstrate that oligonucleotide aptamers can be used as components in smart molecular devices that can 1 ) a ssess the biological tapestry of the cancer cell surface, 2) identify the profiles of target proteins, and 3) deliver the appropriate drug upon positive recognition. Compared with the existing systems,84 87 the devices described in this report represent, t o the best of our knowledge, the first programmable cellsurface logic system able to easily target and report clinically important cancer cell specific profiles according to the Boolean operations shown in Figure 6 1 .84 Experimental Section Chemicals, C ell L ines and R eagents The materials for DNA synthesis were purchased from Glen Research (Sterling, VA), including 6(3',6' dipivaloylfluoresceinyl 6 carboxamido) hexyl phosphoramidite (6FAM) and 5 amino phosphoramidite. Photodynamic ligand chlorine e6 (Ce6) was purchased from Frontier Scientific, Logan, UT. Other chemicals were purchased from Sigma Aldrich. HeLa cells were cultured in DMEM medium (Sigma), and CCRF CEM (CCL 119, T cell line, human ALL), Ramos (CRL1596, B cell line, human Burkitts lym phoma) and K562 (CCL240, acute promyelocytic leukemia, CML) were cultured in RPMI 1640 medium (American Type Culture Collection) with 10% fetal bovine serum (Invitrogen, Carlsbad, CA) and 0.5 mg/mL penicillinstreptomycin (American Type Culture Collection ) at 37C under a 5% CO2 atmosphere. Cells were washed before and

PAGE 116

116 after incubation with washing buffer [4.5g/L glucose and 5 mM MgCl2 in Dulbeccos PBS with calcium chloride and magnesium chloride (SigmaAldrich)]. Binding buffer was prepared by adding yeast tRNA (0.1mg/mL; Sigma Aldrich) and BSA (1mg/mL; Fisher Scientific) to the washing buffer to reduce background binding. All reagents for buffer preparation and HPLC purification came from Fisher Scientific. Unless otherwise stated, all chemicals were use d without further purification. DNA S ynthesis All oligonucleotides were synthesized using an ABI 3400 DNA synthesizer (Applied Biosystems, Inc., Foster City, CA) at the 1.0 micromole scale. After complete cleavage and deprotection, the DNA sequences were purified on a ProStar HPLC system (Varian, Palo Alto, CA) with a C 18 reversedphase column mm 4.6 mm). The eluent was 100mM triethylamineacetic acid buffer (TEAA, pH 7.5) and acetonitrile (030min, 10100%). All DNA concentrations were characterized with a Cary Bio 300UV spectrometer (Varian) using the absorbance of DNA at 260nm. Synthesis of P hotosensitizer M odified O ligonucleotides The 5 amino modified oligonucleotide was synthesized and the MMT protection group removed using an ABI 3400 DNA synthesizer in order to conjugate the carboxyl group with the Ce6 molecule. To improve the coupling efficiency and reduce the multiple coupling products, the amount of Ce6 was 10 times that of the oligonucleotides equivalent amount of coupling agents, N, NDicyclohexylcarbodiimide (DCC) and N Dimethylformamide (DMF) for the activation reaction. The product was then washed with acetonitrile until clear, dried using a vacuum dryer, and further purified by reversedphas e HPLC.

PAGE 117

117 Manipulation of the L ogic M achines The preannealed DNA duplex was prepared by a cooling process from 95C to 4C over 30 min in a 12mM PBS buffer (pH=7.4 with 137mM NaCl and 2.7mM KCl); other DNA probes were cooled on ice for 10 min before usage. Tagged aptamer probes (or aptamer duplex conjugation for the aptamer switchbased AND gate and INH gate) were incubated at a concentration of 200nM with 106 cells in binding buffer on ice and shaken for 30min. After washing and discarding the nonbinding probes, 200nM FAM labeled reporter probe or duplex was added for 1 hour of strand binding and incubation on ice. The aptamer switchbased AND gate does not need this step; 100nM cX probe was added for the INH gate. After further washing to remove nonbinding probes, the final detection of cellular fluorescence signal was performed with a FACScan cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA) by counting 20 000 events, using channel #3 for the FITC dye and channel #5 for the PE Cy5.5 dye. Photodynamic T herapy and C ell V iability T est The cell viability of different cell lines was determined using the propidium iodide (PI) staining assay (Molecular Probes Inc., Eugene, OR). At first, the cells (100k cells/well) were incubated with the logic machines, following the above mentioned method. For photodynamic therapy, the cells were separately placed in a 48well plate on ice for 3h irradiation with white light (15W, 60Hz table lamp). After irradiation, the cells were incubated in culture medium at 37C under 5% CO2 atmosphere for further cell growth (48 h). To measure the cell viability, 1.5L PI (10fold dilution from 1.0mg/mL water solution) was added to each well and incubated for 15 min at room temperature before analyzing cells on the flow c ytometer. Ten thousand events were counted for each well, using channel #4 for the PI dye.

PAGE 118

118 Formation and Purification of DNA Nanostructures The preannealed DNA nanostructure was prepared by a slower cooling process from 95C to room temperature over night in a 12mM PBS buffer (pH=7.4 with 137mM NaCl and 2.7mM KCl) Each nanostructure for different gates was separately purified from a gel electrophoresis experiment. The gel was run in 10% acrylamide (containing 19/1 acrylamide/bisacrylamide) mixture with 1T BE/15mM Mg2+ buffer, at 100V constant voltage for 1.5 hour (4C). Such gel purification process allowed the removal of partially assembled structures and decreased the false positive signals. After purification, the concentrations of DNA nanostructures wer e characterized with a Cary Bio 300UV spectrometer (Varian) using the absorbance of DNA at 260nm. The extinction coefficients for the formed nanostructures were calculated from the equation ( 20ds ssss(str2) 3200 x NAT 2000 x NGC, wher ssss(str2) stand for the extinction coefficient of each component single strand in the duplex, and NAT and NGC strand for the number of A T and G C pairs in the duplex form, respectively. Manipulation of the 3 Input and 4 I nput Cell S urface L ogic C ircuit s The preannealed DNA nanostructure was prepared as mentioned above; other DNA probes were cooled on ice for 10 min before usage. Tagged aptamer probes were incubated at a concentration of 200nM with 106 cells in binding buffer on ice and shaken for 30min. After washing and discarding the nonbinding probes, 200nM Biotin labeled DNA nanostructure for each gate was added for 4 hour s of strand binding and incubation on ice. 50 nM assistant probe (a or d strand) was added for each NOT gate. 100 nM a ssistant probe (a strand) was added for a ANDNOT (b AND c) gate. After further washing to remove nonbinding probes, strepavidin tagged PE Cy5.5 dye was added (free PE Cy5.5 dye was removed after 15min incubation) and the final detection

PAGE 119

119 of cellular fluor escence signal was performed with a FACScan cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA) by counting 20 000 events, using channel # 5. Results and Discussion Cell Surface OR Gate In our method, short oligonucleotide tags with specifi c sequences were labeled on the cell surface after targeted binding between the aptamers and cell surface markers. These nucleic acid tags function as unique barcodes for profiling the presence/absence of different biological markers on the cell surface. I n the simplest example, the same tag (named as Y) was introduced to the 3 ends of three well characterized cancer targeting aptamer sequences (see T able 6 1 for all DNA sequences): Sgc8c, against tyrosineprotein kinaselike 7 (PTK7), expressed by cell lines, including the human acute lymphoblastic leukemia (CCRF CEM);227 TD05, against immunoglobulin heavy mu chain (IgM), expressed by cell lines, including human Burkitts lymphoma cell line (Ramos);228 and Sgc4f, whose target protein is not known at this t ime, targeting both CEM and Ramos cell lines.227 After aptamer binding to the cell surface, further addition of a fluorescein (FAM) labeled reporter sequence (cY, complementary to the Y tag) recognizes cells with at least one of the associated markers pres ent. This system can be described as a simple logic model of an OR gate (Fig ure 6 2 ). The unique barcode property of the tagged aptamers was demonstrated by testing with either sequencemismatched tag reporter conjugates ( e.g ., X tag with cY reporter) or n ontargeting tagged aptamer sequences ( e.g ., Sgc8c Y for Ramos or TD05 Y for CEM cell line). The inactive cellular fluorescence signals for both tests

PAGE 120

120 prove the preservation of precise DNA duplex binding on the cell surface, as well as the target specific binding of the aptamer sequences ( Fig ure 6 3 ). Cell Surface AND Gate In practice, it would be helpful to simultaneously identify the presence of two marker molecules on the same cell surface, i.e ., the equivalent of a logic model of an AND gate [input (1, 1), output 1]. The AND molecular tool is based on DNA strand displacement reactions.229 In this configuration, one strand (cY*) in a DNA duplex (cX*/cY*) is displaced by an invading strand (X*) via the toehold (singlestranded domain that initiates displ acement; see Fig ure 6 4 ) in cX* to form new DNA duplex X* / cX*. The displaced cY* then hybridizes with invading strand Y* to form another new duplex, Y* / cY*. In this way, the two invading strands (X* and Y*) are individually tagged onto two types of cancer celltargeting aptamers ( e.g. Sgc8c and Sgc4f), respectively. The rate of strand exchange can be quantitatively controlled2 30 by varying the length of the toehold in the reporting duplex (cX*/cY*). The system was tested by adding a FAM label to the 3 end of the reporting duplex (cX*/cY* FAM). The targeted labeling was achieved only when both barcode tags were attached to the cell surface ( Fig ure 6 5 ). As a result, the input/output pattern was demonstrated to execute according to the truth table ( Fig ure 6 6 ). ON signaling (output 1) is possible only if both sets of aptamer targeting antigens are present on the cell surface ( e.g. CCRF CEM cells); conversely, OFF signaling (output 0) is observed in the absence of one of the receptors ( e.g. either Ramos cel l or HeLa cervical cancer cell) or both receptors ( e.g. human erythromyeloblastoid leukemia cell, K562, Fig ure 6 7 and Fig ure 6 8 ). Moreover, this DNA strand displacement design can be generalized for different aptamer based mapping systems. For example, based on the same pair of oligonucleotide tags, we

PAGE 121

121 have also tested the binding properties of another set of tagged aptamers, TD05Y* and TE02 X*,228 each one targeting a different marker on Ramos cells. As expected, this new set can be used to identify t he presence of both markers on the cell surface ( Fig ure 6 9 ). Aptamer Switch Based AND Gate In addition to strand displacement reactions, the engineering of the AND logic gate can also be achieved on the basis of structureswitching aptamers,48 which undergo target induced switching between an aptamer cell complex and an aptamer complementary duplex ( Fig ure 6 10). In this design, an output oligonucleotide (cX), which is displaced from the aptamer complementary duplex ( e.g ., Sgc8c/cX) by an input marker ( PTK7 on the cell surface), serves as an input for a downstream gate to form the Sgc4f X/cX conjugate. A positive diagnostic signal is observed only when both Sgc8c and Sgc4f are attached to the cell surface. In previous investigations of the binding prof ile of Sgc8c probe,2 31 our group successfully identified the active region within the aptamer that determines PTK7 binding. We further designed the cX probe to bind in this active region of the Sgc8c aptamer, and this probe is sufficiently flexible to be replaced after cellular binding ( Fig ure 6 1 1 ). As expected, this alternative Boolean AND logic tool could accurately interpret the cell surface environment, resulting in diagnosis of specific diseased cells which overexpress two markers simultaneously ( Fig ure 6 1 2 ). Since molecular marker concentrations are broadly distributed on different cell surfaces, the ideal medical diagnostic tools should be capable of determining and regulating these different expression levels. For this purpose, a thresholding function can also be introduced into DNA based tools. For example, in the aptamer switchbased

PAGE 122

122 AND gate described above, the cX probe could be synthesized with different sequence lengths to finetune aptamer cell interactions. Thus, a longer cX probe would require a higher number of PTK7 molecules on the cell surface to activate the gate signal ( Fig ure 6 1 3 ). Such thresholding property allows targeting of different surface marker patterns otherwise difficult to sense given various relative expression levels of molecular markers. For example, the Sgc8c+++/Sgc4f+ HeLa cell and Sgc8c++/Sgc4f++ CEM cell could be either dually targeted or distinguished through the design of the cX sequence ( Fig ure 6 14 and Fig ure 6 1 5 ). Such freedom in the design of DNA based mol ecular tools could potentially favor adjustment of tool performance for broader targeting abilities. Cell Surface INHIBIT Gate In electronics, an integrated circuit consists of multiple layered Boolean logic gates. To demonstrate the ability of these theranostic tools to systematically create more complex yet reliable programs, we first test an INHIBIT gate, or INH whose output is exclusively energized in the presence of only one specific input. Such INH gate can be engineered by modifying the aptamer s witch based AND gate, as described above, with a NOT gate that implements logical negation. To illustrate, the gate switch is ON (output, 1) only if the second input is present [input (0, 1)]. In a single test, this tool is therefore capable of mapping the underexpression of one receptor and the overexpression of another on the cell surface. The underexpressed target functions as a safeguard against treating normal cells which may also exhibit cancer markers. Instead of direct dye or photosensitizer labeling on the cX probe, nonlabeled cX functions here as an inhibitor to block the binding event between an additional cX reporter sequence and Sgc4f X (NOT gate) (Fig ure 6 16) Hence, the presence of input Sgc8c binding

PAGE 123

123 marker (PTK7) has the power to disable the entire system, regardless of the presence/absence of the other input ( Fig ure 6 1 7 ). 3 Input and 4 Input Cell Surface Logic Circuits After proving the construction of several 2input logic gates, we further developed chemical circuits identifying sequentially three input membrane markers, for example, those targeted by Sgc4f, Sgc8c and TE17 aptamers ( Fig ure 6 18) Fig ure 6 19 shows an AND/ANDNOT circuit assembled from a reporter strand (c), an assistant strand ([a]) and three gate strands (a*, b and d) ( Fig ure 6 20 and d etailed sequences are listed in Table 6 2) Once the first input on the cell membrane removes the first gate strand (d) and exposes the second toehold, the assistant strand will automatically displaces the second gate strand (a*), whi ch facilitates the second input strand to bind with the reporter strand and give out signals. However, the presence of the third cell membrane input inhibits this process, due to the more preferable interaction of the assistant strand with this input, compared with that with only toehold region of a* gate strand (NOT gate) Since the set of AND, OR and NOT logic gates is sufficient of creating any Boolean circuits, to demonstrate the modularity and scalability of such DNA based approaches, similarly, another eleven 3input logic circuits (the detailed experimental schemes for individual circuits were displayed in Fig ure 6 21) and two 4input systems ( Fig ure 6 22) were proven to be operated successfully ( Fig ure 6 23 and Fig ure 6 24). Targeted Photodynamic Therapy These molecular tools are not only capable of analyzing the expression levels of cell surface receptors, but they can also trigger a response to produce a targeted therapeutic effect. Instead of utilizing an output fluorescence signal to indicate a positive diagnosis, a biologically effective molecule can be activated. For example, chlorine e6

PAGE 124

124 (Ce6) is a porphyrinbased photosensitizer, which can be easily conjugated using an amine modified nucleic acid probe. The toxicity of Ce6 results from the generation of reactive oxygen species (ROS) upon light irradiation, termed photodynamic therapy (PDT).2 32,233 Because of the limited therapeutic window, which equals the travelling distance of ROS, specific localization of the photosensitizer at the diseased site is required for efficient PDT. To test this triggering response, we incorporated Ce6 with the reporter probes, and the effect of modified probe on generation of reactive oxygen species was evaluated using a commercially available singlet oxygen sensor green reagent ( Fig ure 6 2 5 ). Cell viability was determined by propidium iodide (PI) staining after incubation with the logic aptamer based complex and Ce6receptor probe. As shown in Fig ure 6 2 6 and Fig ure 6 2 7 efficient photoinduced therapy was achieved for target cancer cells expressing abnormal levels of surface markers. In contrast, the nontarget control cell lines remained intact. Conclusions In conclusion, we have designed and engineered a series of aptamer encoded AND, OR and NOT logic gates that screen for various abnormal conditions on the cell surfaces. These Boolean logic gates could be further programmed to build more complex circuit systems. By coupling multiple molecular signature inputs into a fluorescence signal or therapeutic modality, i. e. PDT, a diagnostic assessment and/or therapeutic action can be taken. This integrated multi ligand profiling approach will be a major advancement over singleligand systems to prevent extraneous target effects on normal cells. The predictable and programmable nature of the aptamer probes can be employed to construct smarter devices for applications in basic research, biomedical engineering, and personalized medicine.

PAGE 125

125 Table 6 1 DNA sequences used in the 2 input theranostic stud ies The colored nucleot ides represent the complementary parts ; the parts in parentheses [ e.g ., ( F)] represent two probes of the same sequence, w/ or w/o labeling. Ce6 = chlorine e6 photosensitizer modified probe. Probe Sequence Sgc4f Y* 5 ATC ACT TAT AAC GAG TGC GGA TGC AAA C GC CAG ACA GGG GG A CAG GAG ATA AGT GAT TTT TTC AGA ATG AGA TTC CTC Biotin 3 Sgc8c X* 5 ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTAGA TTTT TATAGG AGG TGC GAC GAGG AA T Biotin 3 TD05 Y* 5 AAC ACC GTG GAG GAT AGT TCG GTG GCT GTT CAG GGT CTC CT C CGG TGT TTT TTC AGA ATG AGA TTC CTC Biotin 3 TE02 X* 5 TAG GCA GTG GTT TGA CGT CCG CAT GTT GGG AAT AGC CAC GC C TTT TTTATA GGA GGT GCG ACGA GG AAT Biotin 3 Sgc4f X 5 ATC ACT TAT AAC GAG TGC GGA TGC AAA CGC CAG ACA GGG G GA CAG GAG ATA AGT G AA AAA ATA CTG TAC GGT TAG A3 Sgc8c 5 ATC TAA CTG CTG CGCCGC CGGGAA AAT ACT GTACGG TTA GA 3 cX1* 5 AAT GAG ATT CCT CGT CGC ACC TCC TAT 3 cX2* 5 AG AAT GAG ATT CCT CGT CGC ACC TCC TAT 3 cX3* 5 TCA GAA TGA GAT TCC TCG TCG CAC CTC CTA T 3 cX4* 5 TTT CAG AAT GAG ATT CCT CGT CGC ACC TCC TAT 3 cX1* F 5 (Ce6) GAG GAA TCT CAT TCT FAM 3 cX2* F 5 (Ce6) GAG GAA TCT CAT TCT GA FAM 3 cX3* F 5 (Ce6) GAG GAA TCT CAT TCT GAA A FAM 3 cX4* F 5 (Ce6) GAG GAA TCT CAT TCT GA A AAA FAM 3 cX0( F) 5 (Ce6) TCT AAC CGT AC (or FAM) 3' cX1( F) 5 (Ce6) TCT AAC CGT ACA GTA (or FAM) 3' cX2( F) 5 (Ce6) TCT AAC CGT ACA GTA TTT T (or FAM) 3'

PAGE 126

126 Table 6 2 DNA sequences used for demonstrating the programmable and scalable cell surface logic gates The colored nucleotides represent the respective toehold regions. The underlined nucleotides represent the attached tag parts for each aptamer. Ce6 = chlorine e6 photosensitizer modified probe; FAM= fluorescein (FITC)modifi ed probe. Bracketedletter labeled strand ( e.g ., [c] strand) is complementary to the strand labeled with the same letter ( e.g ., c strand). Probe Sequence Sgc4f [c] 5 ATC ACT TAT AAC GAG TGC GGA TGC AAA CGC CAG ACA GGG GG A CAG GAG ATA AGT GA ttttt GGC AT A TC GTG TTT ATA GCG GAC CC C TA 3 Sgc8c a 5 GTC TTC GT GGT TTG TAT TGG CAT ATC ACT CTT GGA G ttttt ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA 3 Sgc8c [a] 5 CTC CAA GAG TGA TAT GCC AAT ACA AAC C ACG AAG AC ttttt ATC TAA CTG CTG CGC C GC CGG GAA AAT ACT GTA CGG TTA GA 3 Sgc8c d 5 ACG AAG ACG CAA AAG TAA TG TGA AAC CG ttttt ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA 3 Sgc8c [d] 5 CGG TTT CA CAT TAC TTT TGC GTC TTC GT ttttt ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GT A CGG TTA GA 3 Sgc8c [e] 5 ATA GCG GA CTG ACG GTC ACG AAG ACG ttttt ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA 3 TE17 a 5 GTC TTC GT GGT TTG TAT TGG CAT ATC ACT CTTGGAG ttttt CAG C TA CGC AAT ACAAAACTC CGA ACA CCT GCTTCTGACTGGGTG CTG 3 TE17 [a] 5 CTC CAA GAG TGA TAT GCC AAT ACA AAC CACGAAGAC ttttt CAG C TA CGCAATACAAAA CTCCGA ACA CCT GCT TCTGACTGG GTG CTG 3 TE17 d 5 ACG AAG ACG CAA AAG TAA TG TGA AAC CG ttttt CAG CTA CGC AAT ACA AAA CTC CGA ACA CCT GCT TCT GAC TGG GTG CTG 3 TE17 [e] 5 ATA GCG GAC TGA CGG TCA CGA AGA CG ttttt CAG CTA CGC AAT ACA AAA CTC CGA ACA CCT GCT TCT GAC TGG GTG CTG 3 TC01 [e] 5 ATA GCG GAC TGA CGG TCA CGA AGA CG ttttt ACC AAA CAC AGA TGC AAC CTG ACT TCT AAC GTC ATT TGG T 3 TC01 [f] 5 TCC GCT AT TAG AAC AAC AGA TTG TTC TA ttttt ACC AAA CAC AGA TGC AAC CTG ACT TCT AAC GTC ATT TGG T 3 a 5 GTCTTCGTGGTTTGTATTGGCATATC 3

PAGE 127

127 Table 6 2 Continued. Probe Sequence a* 5 CATTACTTTTGCGTCTTCGTGGTTTGTATTGGCATATC 3 [a] 5 CTCCAA GAGTGATAT GCCAATACAAACCACGAAGAC 3 [a]* 5 CTGACGGT GATATGCCAATACAAAC CACGAAGACG 3 b 5 GTGTTTATAGCGGACCCCTA 3 c F 5 FAM TAGGGGTCCGCTATAAACACGATATGCCAATACAAACC 3 c Bio 5 TAGGGGTCCGCTATAAACACGATATGCCAATACAAACC Biotin 3 d 5 ACGAAGA CGCAAAAGTAATGTGAAACCG 3 [d] 5 CGGTTTCACATTACTTTTGCGTCTTCGT 3 e 5 CGTCTTCGTG ACCGTCAGTCCGCTAT 3 e* 5 CGTCTTCGTG ACCGTCAGTCCGCTATTAGAACAACAGA 3 f 5 TAGAACAATCTGTTGTTCTAATAGCGGA 3

PAGE 128

128 Figure 6 1 Schemes of the cell surface logic gates. General theranostic principle displayed using 2input AND gate as example. Figure 6 2 Flow cytometric analysis and comparison of the fluorescence signal with/without the gate probes for the OR gate. The fluorescence values were calculated based on the FITC signal using channel # 3 in the flow cytometer, from three experiments.

PAGE 129

129 A B Figure 6 3 Aptamer target selectivity and barcodespecificity proof from flow cytometry analysis. A ) CEM and B ) Ramos cell surface fluorescence intensity, after adding different OR gate probes, and FITC labeled cY4 reporter were recorded by counting 20 000 events using channel #3 in the flow cytometer; X tag represents the mismatched tag for cY4 reporter.

PAGE 130

130 Figure 6 4 The optimization of cX*/cY* F sequences for the first AND gate. A ) Different lengths of cX* and cY* F probes were synthesized and annealed beforehand. For the cell binding study, cY* probe was fixed at the concentration of 200nM, while the concentration of the cX* probe varied: 200nM, 300nM, 4 00nM, 600nM or 800nM. The extra cX* probe was added to prevent a false positive signal by free cY* probe inside the solution. To prevent the unexpected hybridization between Sgc8c X* and Sgc4f Y* probes, X* tag and Y* tag were designed to have only seven base pairs (7bp) complementary to each other, while the more stable X*/cX* and Y*/c Y4* duplexes each have 21bp. B ), C ) For each cX*/cY* F duplex structure (cX1*/cY1*, cX2*/cY1*, cX1*/cY2*, cX2*/cY2*, cX3*/cY3*, cX4*/cY3*, cX1*/cY4*, cX2*/cY4*, cX3*/cY4* a nd cX4*/cY4*), five different molar ratios (1:1, 1.5:1, 2:1, 3:1 and 4:1) of cX*/cY* were tested for both CEM and Ramos cells. Based on the flow cytometry analysis, the mean cell surface fluorescence intensity was determined for three cases; i.e., when onl y Sgc8c X* [1, 0], only Sgc4f Y* [0, 1], or Sgc8c X*+Sgc4f Y* [1, 1] was attached on the CEM cell surface. The same optimization was performed by using the TE02X* and TD05Y* probes for the Ramos cells. By comparing the signal to background (S/B) ratios a nd the gating properties for each testing, the cX2*/cY2* F (2:1 concentration ratio) and cX4*/cY4* F (1.5:1 concentration ratio) complexes were finally chosen, respectively, for further CEM and Ramos cell AND gate study. In these two duplexes, each cY* has a two base overhang at the 3 end to assure the binding strength after Y* recognition and, at the same time, prevent direct strand displacement in the absence of X* probe (the falsepositive signals).

PAGE 131

131 A B

PAGE 132

132 C Figure 64. Continued

PAGE 133

133 A B Fi gure 6 5 Flow cytometry analysis of the AND gate. A ) For CEM cells, both Sgc8c X* and Sgc4f Y* probes should be attached on the cell sur face to activate the AND gate; B ) for Ramos cells, both TE02X* and TD05Y* probes are required. Fluorescence values and their error bars (mean s.d.) are calculated based on the FITC signal using channel #3 in the flow cytometer, from three experiments.

PAGE 134

134 Figure 6 6 Schemes of the cell surface logic gates. Symbols, truth tables and experimental schemes of toehol d based strand displacement AND gate.

PAGE 135

135 Figure 6 7. Flow cytometric analysis and comparison of the fluorescence signal with/without the gate probes for Sgc8c X*/Sgc4f Y* based AND gate. The fluorescence values and their error bars (mean s.d. ) were calculated based on the FITC signal using channel # 3 in the flow cytometer, from three experiments. The relatively high fluorescence signal from the HeLa cells (Sgc8c + ; Sgc4f ) is attributed to the low, but nonzero, expression level of the Sgc4f tar get The microscopy images were taken after adding the gate probes to each type of cell, and the expected cell surface fluorescence patterns were observed; the optical images are shown in the Figure 68

PAGE 136

136 A Figure 6 8. Fluorescence confocal microscopy images of the studied cell surface logic gates. The optical image and fluorescence image are shown a fter adding gating probes for A ) Ramos, B ) CEM, C ) K562 and D ) HeLa cells. The fluorescence signal comes from TAMRA dyemodified DNA reporter probes, and the images were taken by an Olympus FV500IX81 confocal microscope (Olympus America, Melville, NY).

PAGE 137

137 B C Figure 68. Continued

PAGE 138

138 D Figure 68. Continued Figure 6 9 Flow cytometric analysis and comparison of the fluorescence signal with /without the gate probes for TE02 X*/TD05 Y* based AND gate. The fluorescence values and their error bars (mean s.d.) were calculated based on the FITC signal using channel # 3 in the flow cytometer, from three experiments. The microscopy images were ta ken after adding the gate probes to each type of cell, and the expected cell surface fluorescence patterns were observed; the optical images are shown in the Figure 68.

PAGE 139

139 Figure 6 10. Schemes of the cell surface logic gates. Symbols, truth tabl es and experimental schemes of aptamer switch AND gate. Bracketedletter labeled strand ( e.g ., [c] strand) is complementary to the strand labeled with the same letter ( e.g ., c strand).

PAGE 140

140 Figure 6 11. Determination of the binding region of PTK7 on th e Sgc8c aptamer; this binding test was used to design the cX probe, which can be displaced from the cX/Sgc8c duplex by PTK7 Sgc8c binding. Based on our previous study ( 31) the Sgc8c aptamer sequences could be separated into two parts for the PTK7 binding test, as shown in the sequence below of the full complementary c41 probe (blue and red parts, respectively): c41: 5 TCT AAC CGT ACA GTA TTT TCC CGG CGG CGC AGC AGT TAG AT 3 We synthesized different lengths of cDNA probes for each part, including 11nt cX0, 15nt cX1 and 19nt cX2 probes from the blue region and 14nt T14, 19nt T19 and 22nt T22 probes from the red region (data not shown). We then studied (a) their influence on Sgc8c PTK7 binding and (b) their displacement by PTK7 binding (unpublished results). The blue region probes, cX0, cX1, cX2, were determined to be the better candidates because they did not inhibit the Sgc8c PTK7 binding and could be successfully displaced from the cX/Sgc8c duplex.

PAGE 141

141 Figure 6 12. Flow cytometric analysis and comparison of the fluorescence signal with/without the gate probes for aptamer switch AND gate. The fluorescence values and their error bars (mean s.d.) were calculated based on the FITC signal using channel # 3 in the flow cytometer, from three experiments. The microscopy images were taken after adding the gate probes to each type of cell, and the expected cell surface fluorescence patterns were observed; the optical images are shown in the Figure 68.

PAGE 142

142 Figure 6 13. The influence of differe nt sequence lengths of the cX probe on second AND gate efficiency. The longer cX probe (19nt cX2 > 15nt cX1 > 11nt cX0) binds more strongly with Sgc8c aptamer for successful DNA strand displacement after cellular binding to activate the gate signal, r equiring, in turn, a higher number of cell surface PTK7 markers. By adjusting the sequence length and concentration of the cX probe, it is possible to finetune the gating condition. Specifically, if the cX probe is too short ( e.g ., cX0 probe), it cannot be totally rehybridized with the Sgc4f X probe, even after 100% displacement by PTK7, by its weaker duplex binding strength, which results in a weak ON signal. On the other hand, if the cX probe is too long ( e.g ., cX2 probe), binding to cell surface P TK7 will be not strong enough to completely displace the cX probe from the Sgc8c/cX complex, also producing a poor S/B ratio. In this study, cX1 probe was used for further experimentation, considering the optimized gating function. Fluorescence values and their error bars (mean s.d.) are calculated based on the FITC signal from channel #3 in flow cytometry, from three experiments. Based on the concentrationdependent DNA hybridization effect, the short cX0 probe (11nt) and medium long cX1 probe (15nt ) could not be fully rehybridized with the small number of tagged Sgc4f on the HeLa cell surface (OFF Signal for HeLa); in contrast, the long cX2 probe (19nt) was capable of binding with the small number of tagged surface Sgc4f (ON Signal for HeLa). Meanw hile, the release of the longer cX probe from the Sgc8c/cX conjugate requires a higher number of cell surface PTK7 molecules. This results in a leveling effect to produce similar fluorescence signals on both CEM (Sgc8c++/Sgc4f++) and HeLa (Sgc8c+++/Sgc4f+) cell surfaces.

PAGE 143

143 Figure 6 14. Flow cytometric analysis and comparison of the fluorescence signal with/without the gate probes: adjusting the gating properties by changing the DNA sequence design.

PAGE 144

144 A B C D Figure 6 15. Flow cytometry analysis o f the individual aptamer targeting marker pro file on the surfaces of A ) K562 cells, B ) HeLa cells, C ) CEM cells and D ) Ramos cells. After biotin labeled individual aptamer was attached on the cell surface, avidin tagged PE Cy5.5 dye was added (free PE Cy5. 5 dye was removed after 15min incubation) to provide the fluorescence signal, using channel #5 in the flow cytometer for detection.

PAGE 145

145 A B Figure 6 16. Optimization of the INH gate. A ) Different reporter sequences and concentrations were tested, and 1 00nM cX0 F was finally chosen as it had the best S/B ratio; B ) Sgc8c/cX0 complex was proven to be the best choice when using 100nM cX0 F as the reporter sequence.

PAGE 146

146 Figure 6 17. Flow cytometric analysis and comparison of the fluorescence signal with /without the gate probes for aptamer switch INH gate. The fluorescence values and their error bars (mean s.d.) were calculated based on the FITC signal using channel # 3 in the flow cytometer, from three experiments. The microscopy images were taken aft er adding the gate probes to each type of cell, and the expected cell surface fluorescence patterns were observed; the optical images are shown in the Figure 68.

PAGE 147

147 Figure 6 18. Flow cytometry analysis of the competition of different tagged aptamers, Sg c4f, Sgc8c and TE17, on the CEM cell surface markers After biotinlabeled individual aptamer and nonlabeled same amount of competition aptamers (200nM) w ere attached on the cell surface, avidintagged PE Cy5.5 dye was added (free PE Cy5.5 dye was removed after 15min incubation) to provide the fluorescence signal, using channel #5 in the flow cytometer for detection.

PAGE 148

148 Figure 618. Continued.

PAGE 149

149 Figure 6 19. Schemes of the cell surface logic gates. Apt A [d]/ apt B [c]/ apt C a based 3in put a AND b ANDNOT c gate. Bracketedletter labeled strand ( e.g ., [c] strand) is complementary to the strand labeled with the same letter ( e.g ., c strand).

PAGE 150

150 Figure 6 20. The optimization of assistant probe concentration for cell surface NOT gate. The efficiency of Sgc4f/Sgc8c/TE17 based 3input logic gates were determined after adding 200nM a*/b/c Bio nanostructure and various amounts of assistant [a] probes (from 0 to 150nM, respectively). As shown in the figure, [a] probe could facilitate the opening of the nanostructure, and results in the enhancement of cell surface fluorescence intensities. The fluorescence intensities were based on averaged cytometry distributions, from three experiments. The assistant probe is used for realizing toehold based strand displacement and uncovering the real reporter strand from duplex structure. The concentration of useful assistant probe, e.g ., [a] or [d] strand in this study, for gating properties is dependent on the cell surface conjugating amount of targeted apt amer for NOT gate. These assistant probes will be more preferable to bind with easier assessable free a/dtagged cell surface aptamer, instead of the reporting DNA nanostructure, which has the competition effect and only toehold region unburied. Theoretically, NOR and NAND gates are unique, since they are functionally complete, i.e., any computational circuit could be built by scaling up either of these two gates only. The realization of AND and NOT gates provide the basis for building up these two types of important logic gates, as demonstrated in the design shown in the scheme (e) and (f) in Fig. S11. For 3input cell surface logic gate, if provided an output of either 0 or 1 for each possible cell status, there will be 28 = 256 kinds of possible logic gat e. Theoretically, the toeholdbased strand displacement strategy demonstrated in this cell surface study could realize 27 = 128 possible logic gates: since this strategy requires at least one aptamer binding on the cell membrane to give out the signal, as a result, the cell surface condition of marker a/marker b/marker c will be always reported as 0 instead of 1

PAGE 151

151

PAGE 152

152 Figure 6 21. The symbols, truth tables and experimental schemes of constructing twelve 3input cell surface logic gates: to demonstr ate the programmability and scalability of the approach. Rationally designed taggedSgc4f/ Sgc8c/ TE17 aptamer pairs and CEM cell were employed as the examples. Bracketed letter labeled strand ( e.g ., [c] strand) is complementary to the strand labeled with the same letter ( e.g ., c strand). The fluorescence intensity results were based on averaged flow cytometry distributions, from three experiments. A

PAGE 153

153 B C Figure 621. Continued.

PAGE 154

154 D E Figure 621. Continued.

PAGE 155

155 F G Figure 621. Continued.

PAGE 156

156 H I Figure 621. Continued.

PAGE 157

157 J K Figure 621. Continued.

PAGE 158

158 L Figure 621. Continued.

PAGE 159

159 Figure 6 22. Flow cytometry analysis of the competition of different tagged aptamers, Sgc4f, Sgc8c, TE17 and TC01, on the CEM cell surface markers After bi otin labeled individual aptamer and nonlabeled same amount of competition aptamers (200nM) w ere attached on the cell surface, avidintagged PE Cy5.5 dye was added (free PE Cy5.5 dye was removed after 15min incubation) to provide the fluorescence signal, using channel #5 in the flow cytometer for detection. These experiments demonstrate that the four aptamers employed in these 4input logic gate studies, Sgc4f, Sgc8c, TE17 and TC01, bind with different cell surface markers.

PAGE 160

160 Figure 6 23. Construction of programmable and scalable cell surface logic gates. The realization of several useful 3input cell surface logic gates, using rationally designed taggedSgc4f/ Sgc8c/ TE17 aptamer pairs and CEM cell as examples (the experimental schemes for each gate are shown in the Figure 6 21). The fluorescence values and their error bars (mean s.d.) were calculated based on the distributions in the flow cytometer, from three experiments.

PAGE 161

161 Figure 623. Continued.

PAGE 162

162 Figure 6 24. Symbols, truth tables and experimental schemes of (top) Sgc8c [d]/ Sgc4f [c]/ TE17 [e]/ TC01 [f] based 4input a AND b AND c AND d gate, and (bottom) Sgc8c [d]/ Sgc4f [c]/ TE17 a/ TC01[e] based 4input a AND b AND d ANDNOT c gate. The fluorescence intensity results in the t ruth table were based on averaged cytometry distributions, from three experiments.

PAGE 163

163 Figure 6 24. Continued. Figure 6 25. Ce6 mediated singlet oxygen generation after white light irradiation, as demonstrated by detecting the singlet oxygen sensor green (SOSG) fluorescence. The free Ce6 and oligonucleotidemodified Ce6 ( e.g. cY4 Ce6) displayed similar singlet oxygen generation efficiency for photodynamic therapy, while without Ce6, no obvious SOSG fluorescence change was detected (data not shown). To extend the lifetime of the generated singlet oxygen, 10M Ce6 probe and 2.0M SOSG were introduced within each 200L of D2O solution, and the fluorescence intensity was read using excitation at 504 nm and maximum emission at 525 nm.

PAGE 164

164 Figure 6 26. Cell viability test for the AND gate after visible irradiation for 3h and subsequent growth for 48h (*: pvalue< 0.05; **: pvalue<0.001; n=3).

PAGE 165

165 Figure 6 27. Cell viability test for the OR, AND and INH gates after visible irradiation for 3h and subsequent growth for 48h (*: pvalue< 0.05; **: pvalue<0.001; n=3).

PAGE 166

166 CHAPTER 7 SUMMARY AND FUTURE DIRECTIONS Multifunctional DNA Nanomachines for Analytical and Biomedical Applications In an attempt to engineer multifunctional DNA nanomachines for smart analytical and biomedical applications, this research wa s ins pired by nature and utilized a gift from nature: the self assembly of nucleic acid nanostructures. Incorporation of photoresponsive molecules into the DNA structures al lowed the structures or functions of these DNA nanomachines to be modulated remotely by l ight irradiation, with temporal and spatial resolution. The first project of this research demonstrat ed the high efficiency pyreneassisted photolysis of disulfide bonds using 350nm irradiation. DNA provides a feasible matrix for quantitatively exploiting the cleavage efficiency and mechanism in this process As indicated by the examples of DNA micelle photodisaggregation and the catalytic function of DNAzyme analogs, numerous applications of pyrenedisulfide molecular assemblies are possible in biomedical and proteomics scenarios with light induced spatiotemporal control. Based on this phenomenon, we further entered the area of designing and applying artificial nanowalkers. In nature, m olecular motors are tiny protein machines that power motion in the cellular world, e.g ., myosins moving on actin filaments and dyneins or kinesins walking along microtubule tracks. Artificial DNA based motors have recently emerged to mimic molecular motors and to perform tasks in cargo transport and biosynthesis. The programmable assembly and simplicity of polynucleotide interactions have made DNAs suitable for the control of progressive and directional movement at the molecular level. However, energy supply is a major concern for any motor

PAGE 167

167 W e just demonstrated the feasibility of designing an autonomous, but controllable, DNA walking device by incorporating photosensitive moieties within DNAzyme analog structures. Compared with molecular motors in nature, such light powered walkers are less fast and powerful (T he fraction of walkers reaching the end of track was lower than 40%, possibly due to the equilibrium between the two disulfide molecular states: the oxidized S S form, and the reduced SH form.) However, as a new type of energy supply for powering nanosized robots, photon energy has the benefits of precise controllability and optimization freedom, while preserving autonomous, progressive motion. The directional movement of the abovementioned light driven walker involved the burnt bridge mechanism, whereby the anchorage sites on the track are irreversibly consumed during the motion. However, as a result, the reversible, cyclic operation of the walking device was not possible, and the walkers could not mimic natural molecular motors ( e.g ., kinesin ) that change the direction of movement towards both ends of the tracks. This limitation seriously restricted future usage of the device for multiple trips. As a result, we further designed the second generation of light controlled DNA walking device which can move to either end of the oligonucleotide track, and the direction of motion can be switched using different wavelengths of light. This new design is based on the isomerization of azobenzene moieties and toeholdmediated strand displacement Compared with other reported DNA walkers, th is new strategy not only preserves the autonomous and controllable movement, but also provides a reusable track, making it feasible to reset the device after the complete trip, as observed in nature for kinesin and myosin. Currently the rate and step number of this device are

PAGE 168

168 still limited, which may be due to the imperfect photoisomerization efficiency of the azobenzene moieties. However, the princ iple of photoisomerizationinduced toehold length switching could be further used in the design of other autonomous DNA based walking devices, where sequential and controllable release of the toehold is required. Moreover, as the first study (based on our knowledge) of using photoswitchable molecules for alternating the DNA toehold binding regions, this system can be employed for external control of route selection in multi pathway systems, e.g ., crossing or T junction, for more advanced walking devices that can rival molecular motors in nature. The third phase of this research was also inspired by nature as different enzymatic reactions often work together in a cascade fashion. Such concatenated catalytic transformations are important for controlling c ellular signaling, and t he cellular response to a stimulus usually depends on when and how a specific enzyme is activated. This phase of the research demonstrated the molecular assembly of nanostructures functionalized by light regulation. The azobenz enem odified DNA linkers were used as arms to mediate signal transduction in an enzyme assembly. To the best of our knowledge, this is the first study to report the photomanipulation of DNA enzymatic molecular assemblies. Taking advantage of the photoisomeri zation property of azobenzene moieties and highly specific self assemblies of DNA oligomers, we were able to achieve rapid and precise translocation of either small molecules (cofactors such as hemin) or macromolecules (protein enzymes) to activate a casca de reaction. We believe that this approach can be applied to different types of protein enzyme or DNA enzyme structures.

PAGE 169

169 In r ecent decades advances in biomedicine have expanded our knowledge of the molecular signatures of diseases By profiling the high or low expression level of these surface membrane receptors, it may be possible to target the specific offending cancer cell types, thus enabling more precise diagnosis and therapy. Single receptor targeting currently dominates cell differentiation studies Although significant, this strategy can distinguish only those cells having a common receptor In comparison, a more practical and less risk prone approach would combine multiple surface receptors to pinpoint specific disease cells The fourth phase of this research was the development of a method to regulate a living system by screening multiple cellsurface markers via a series of Boolean l ogic al operations. W e designed and engineered a series of aptamer encoded AND, OR and NOT logic gates that screen for various abnormal conditions on the cell surfaces. These Boolean logic gates could be further programmed to build more complex circuit systems. C oupling multiple molecular signature inputs to a fluorescence signal or therapeutic modality, i.e. PDT, ena bles a diagnostic assessment and/or therapeutic action. This integrated multi ligand profiling approach wil l be a major advancement over s i ngle ligand systems to prevent extraneous target effects on normal cells. The predictable and programmable nature of the aptamer probes can be employed to construct smarter devices for applications in basic research, biomedical engineering, and personalized medicine. In summary, our lines of research have demonstrated the potential of utilizing multifunctional DNA nanom achines in analytical and biomedical applications. Inspired

PAGE 170

170 by nature, these DNA nanomachines provide several novel tools for the future study of bionanotechnology, with the ultimate goal of rivaling nature. Future Directions Direct Observation of Stepwise Motion of the Walking Device s Although we have successfully demonstrated the motion o f our DNA walkers, the evidence is still indirect, from either fluorescence resonance energy transfer (FRET) or polyacrylamide gel electrophoresis (PAGE) experiments. A iming to directly observe the stepwise movement of our walker devices and examine the potential of their moving a longer distance, we will expand our studies based on real time atomic force microscopy (AFM) in cooperation with Prof. Masayuki Endo at Kyoto University. Basically, we will first assemble a 4step track on a twodimensional rectangular DNA origami, c.a 100nm x 70nm. These DNA origami structures typically comprise a 7,249nucleotide (nt) singlestranded DNA template tile (genome of bacteriophag e M13) and several tens of short synthetic staple DNA strands, which hybridize into a network of nucleic acid self assembly. The flexible extending stators, which could not be visualized in the AFM images, are used to hybridize with the walker strand. Thes e stators are assembled in a line with a separation of 6nm, each parallel to a hairpinmodified staple as reference marker for accurate walker position measurements. The pyrenemodified walker strand will be precisely positioned at one end of the track by omitting the first stator during origami assembly. Because o nly the relatively rigid structures of the walker stator duplex will be visualized in AFM the position of the walker in the track can be view ed. After UV laser irradiation for 0, 1.5 or 3 hours, the origami assembly will be deposited on mica and observed using AFM. The individual

PAGE 171

171 walker position on hundreds of origami track s will be measured, and then statistical ly analyzed to confirm the light controlled motion. The h igh speed AFM imaging system will also be employed to study the stepwise motion of individual walker molecules along the track. AFM frame rates of 0.1 s1 will be sufficient to capture individual stepping in real time, and each frame then will be grouped and analyzed in a height dist ribution kymograph to study the step size, stepping rate and detailed process. If successful, a much longer journey, e.g ., the nano world record of 17 consecutive steps ( c.a. 100nm) will be tested to examine the potential of this light driven walking device. From another aspect, we will attempt to improve the performance of the azobenzenebased s econdgeneration walking device using s imilar rectangular DNA origami structures. H owever, instead of the linear track, a network with several branches will be used. Based on the design of specific toehold sequences at the crossing, the walker will navigate this network of tracks reversibly. Using the abovementioned AFM imaging strategy, the distribution of individual walkers along the track network will be deter mined after periods of UV or visible light irradiations. In addition, the real time motion of individual walkers will be recorded based on the high speed AFM imaging system. By f ulfilling these research aims we will expand our knowledge of nanoscale moti on and advance the development of programmable and adaptable molecular systems. Potentially, the controlled, long range motion achieved here could be integrated further with a molecular assembly line, providing an autonomous nanoscale manufacturing system

PAGE 172

172 Antibody and Nanoparticle Based Cell Surface Logic Circuits As mentioned above, s ingle receptor targeting currently dominates cell differentiation studies. However a more practical and less risk prone approach would com bine multiple surface receptors to pinpoint specific disease cells and thereby enhance diagnostic accuracy in differentiating similar cells. With this goal in mind, we have successfully proved a DNA aptamer based method of screening multiple cell surface m arkers by implementing a series of Boolean l ogic al operations. As a specific typ e of functional oligonucleotide, aptamers can selectively recognize a range of possible targets However, nucleic acidbased apta mers are still in their infancy, and the targe ted cell surface molecules of these oligonucleotides and profiles on different types of diseased cells are still quite unknown. To prove the benefits of cell surf ace logic circuit systems in real biological applications, a known antibody based cell targeti ng approach will be further applied. Numerous cancer cell surface markers and the associated antibodies have been identified and evaluated for their biological functions. Clinically important T cell leukemia and/or B cell leukemia will be tested as target s, based on the DNA circuit design. Several markers have been identified for these types of cancer cells, including CD4, CD19, CD20, CD45, and so on. Similar to the aptamer encoded logic circuits, a short piece of specifically designed oligonucleotide will be attached via chemical modification onto the specific antibodies targeting those CD markers. These nucleic acid tags function as unique barcodes for profiling the presence/absence of different biological markers on the cell surface. A series of AND, OR and NOT gates will be designed and further integrated into the circuit system to fulfill the autonomous examination of multiple markers on a cell surface and to make logical decisions on signaling and drug release.

PAGE 173

173 Moreover, the employ ment of nanoparticle systems could further expa nd the ability of these logic tools in sensing ( e.g. fluorescent nanoparticles and magnetic nanoparticles for fluorescent and magnetic measurements) and therapeutic applications ( e.g. mesoporous silica n anop articles for drug delivery ) Instead of the commonly used direct immobilization of targeting moieties (such as aptamers or antibodies) onto the particle surface, the reporting nucleic acid strand, which targets the oligonucleotide tags on the aptamer/antibody will instead bind on the surface of nanoparticles. This indirect targeting mode will ensure the performance of logic circuits in profiling the existence/absence of multiple cell surface markers, and provide a general route for innovative disease targeting, for applications in various, complicated situations. The success in this part of future work could systematically demonstrate the idea of logic profiling mult i markers for disease targeting and improve our understanding and ability to regulate cellu lar environments. These multifunctional nucleic acid nanomachines will then rival and ch ange the biological world in beneficial ways

PAGE 174

174 LIST OF REFERENCES 1. Watson, J. D.; Crick, F. H. C. Nature 1953 171 737. 2. Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49 6123. 3. Beaucage, S. L.; Iyer, R. P. Tetrahedron 1992, 48 2223. 4. Tuerk, C.; Gold, L. Science 1990, 249 505. 5. Ellington, A. D.; Szostak, J. W. Nature 1990 346 818. 6. Robertson, D. L.; Joyce, G. F. Nature 1990 344 467. 7. Daniels, D. A.; Chen, H.; Hicke, B. J.; Swiderek, K. M.; Gold, L. A. Proc. Natl. Acad. Sci. U.S.A. 2003 100 15416. 8. Shangguan, D.; Li, Y.; Tang, Z.; Cao, Z.; Chen, H.; Mallikaratchy, P.; Sefah, K.; Yang, C.; Tan, W. Proc. Natl. Acad. Sci. U.S.A. 2006, 103 11838. 9. Blank, M. ; Weinsc henk, T. ; Priemer M. ; Schluesener, H. J. Biol. Chem. 2001, 276, 16464 10. Mandal, M.; Breaker, R. R. Rev. Mol. Cell Biol. 2004, 5 451 11. Tucker, B. J.; Breaker, R. R. Curr. Opin. Struct. Biol. 2005, 15, 342 12. Bunka D. H. ; Stockey, P. G. Nat. Rev. Microbiol. 2006, 4 588 13. Fang X. ; Tan, W. Acc. Chem. Res. 2010, 43, 48 14. Famulok, M. ; Hartig J. S. ; Mayer, G. Chem. Rev. 2007, 107 3715 15. Mayer, G. Angew. Chem., Int. Ed. 2009, 48 2 672. 16. Navani N. K. ; Li, Y. Curr. Opin. Chem. Biol. 2006, 10 272. 17. Keefe, A. D.; Pai, S. ; Ellington, A. Nat. Rev. Drug. Discov. 2010, 9 537 18. Keefe A. D. ; Cload, S. T. Curr. Opin. Chem. Biol. 2008, 12 448. 19. Boomer, R. M. ; Lewis, S. D. ; Healy, J. M. ; Ku rz, M. ; Wilson C. ; McCauley, T. G. Oligonucleotides 2005 15, 183 20. Cao, Z. ; Tong, R. ; Mishra, A. ; Xu, W. ; Wong, G. C.; Cheng J. ; Lu, Y. Angew. Chem., Int. Ed. 2009, 48, 6494.

PAGE 175

175 21. Joachimi, A. ; Mayer G. ; Hartig, J. S. J. Am. Chem. Soc. 2007 129 3036. 22. Ru sconi, C. P. ; Scardino, E. ; Layzer, J. ; Pitoc, G. A.; Ortel, T. L.; Monroe, D. ; Sullenger, B. A. Nature 2002, 419 90 23. Heckel A. ; Mayer, G. J. Am. Chem. Soc. 2005, 127 822 24. Tyagi, S.; Kramer, F. R. Nat. Biotechnol 1996 14, 303. 25. Wang, K.; Tang, Z.; Y ang, C. J. Angew. Chem., Int. Ed. 2008, 48 856. 26. Tan, W.; Wang, K.; Drake, T. J. Curr. Opin. Chem. Biol 2004, 8 547. 27. Goel, G.; Kumar, A.; Puniya, A. K.; Chen, W.; Singh, K. J. Appl. Microbiol. 2005, 99, 435. 28. Bratu, D. P.; Cha, B. J.; Mhlanga, M. M.; K ramer, F. R.; Tyagi, S. Proc. Natl. Acad. Sci. U.S.A. 2003 100 13308. 29. Medley, C. D.; Drake, T. J.; Tomasini, J. M.; Rogers, R. J.; Tan, W. Anal. Chem 2005, 77 4713. 30. Tsourkas, A.; Behlke, M. A.; Bao, G. Nucleic Acids Res. 2002, 30, 5168. 31. Molenaar, C. ; Marras, S. A.; Slats, J. C. M Nucleic Acids Res. 2001 29, e89. 32. Wang, L.; Yang, C. J.; Medley, C. D.; Benner, S. A.; Tan, W. J. Am. Chem. Soc. 2005, 127 15664. 33. Yang, C. J.; Wang, L.; Wu, Y.; Kim, Y.; Medley, C. D.; Lin, H.; Tan, W. Nucleic Acids Res. 2007, 35, 4030. 34. Crey Desbiolles, C.; Ahn, D.; Leumann, C. J. Nucleic Acids Res. 2005 33, e77. 35. Browne, K. A J. Am. Chem. Soc 2005 127 19889. 36. Kim, Y.; Yang, C. J.; Tan, W. Nucleic Acids Res. 2007 35 7279. 37. Sheng, P.; Yang, Z.; Kim, Y.; Wu, Y.; Tan W.; Benner, S. A. Chem. Commun. 2008, 41 51285130. 38. Zheng, G.; Chen, J.; Stefflova, K.; Jarvi, M.; Li, H.; Wilson, B. C. Proc. Natl. Acad. Sci. U.S.A. 2007, 104 8989. 39. Kruger, K.; Grabowski, P. J.; Zaug, A. J.; Sands, J.; Gottschling, D. E.; Cech, T. R. Cell 1982, 31 147.

PAGE 176

176 40. Breaker, R. R.; Joyce, G. F. Chem. Biol. 1994 1 223. 41. Liu, J.; Lu, Y. J. Am. Chem. Soc. 2005 127 12677. 42. Fahlman, R. P.; Sen, D. J. Am. Chem. Soc. 2002, 124 4610. 43. Li, J.; Lu, Y. J. Am. Chem. Soc. 2000, 122 10466. 44. Liu, J.; Wer nette, D. P.; Lu, Y. Angew. Chem., Int. Ed. 2005 44 7290. 45. Chen. T.; Mao, C. J. Am. Chem. Soc. 2004 126 13240. 46. Stojanovic, M. N.; Stefanovic, D. Nat. Biotechnol. 2003 21 1069. 47. Stojanovic, M. N.; Stefanovic, D. J. Am. Chem. Soc. 2003, 125 6673. 48. L iu, J.; Cao, Z.; Lu, Y. Chem. Rev. 2009, 109 1948. 49. Hartgerink, J. D.; Beniash, E.; Stupp, S. I. Science 2001, 294 1684. 50. Lim, Y.; Lee, E.; Lee, M. Angew. Chem., Int. Ed. 2007, 46, 9011. 51. Li, Z.; Zhang, Y.; Fullhart, P.; Mirkin, C. A. Nano Lett. 2004, 4 1055. 52. Chan, Y. M.; Boxer, S. G. Curr. Opin. Chem. Biol. 2007, 11 1. 53. Gosse, C.; Boutorine, A.; Aujard, I.; Chami, M.; Kononov, A.; Cogne Laage, E.; Allemand, J. F.; Li, J.; Jullien, L. J. Phys. Chem. B 2004, 108 6485. 54. Dentinger, P. M.; Simmons, B. A. ; Cruz, E.; Sprague, M. Langmuir 2006, 22 2935. 55. Alemdaroglu, F. E.; Alemdaroglu, N. C.; Langguth, P. Adv. Mater. 2008, 20 899. 56. Alemdaroglu, F. E.; Ding, K.; Berger, R.; Herrmann, A. Angew. Chem., Int. Ed. 2006, 118 4313. 57. Liu, H.; Zhu, Z.; Kang, H.; Wu, Y.; Sefah, K.; Tan, W. Chem. Eur. J. 2010, 16 3791. 58. Lee, C. S.; Davis, R. W.; Davidson, N. J. Mol. Biol. 1970 48 1 59. Seeman, N. C. Angew. Chem., Int. Ed. 1998, 37, 3220. 60. Seeman, N. C. Nature 2003, 421 427

PAGE 177

177 61. Yurke, B.; Turberfield, A. J.; Mills, A. P.; Simmel, F. C.; Neumann, J. L. Nature 2000, 406 605 62. Bath, J.; Turberfield, A. J. Nat. Nanotechnol. 2007, 2 275 63. Liu, H.; Liu, D. S. Chem. Commun. 2009 2625 64. Krishnan, Y.; Simmel, F. C. Angew. Chem., Int. Ed. 2011, 50 3124. 65. Yan, H.; Zhang, X. P.; Shen, Z. Y.; Seeman, N. C. Nature 2002, 415 62 66. Tian, Y.; Mao, C. D. J. Am. Chem. Soc. 2004, 126 11410 67. Yin, P.; Yan, H.; Daniell, X. G.; Turberfield, A. J.; Reif, J. H. Angew. Chem., Int. Ed. 2004 43 4906. 68. Bath, J.; Green, S. J.; Turberfield, A J. Angew. Chem., Int. Ed. 2005 44 4358 69. You, M.; Chen, Y.; Zhang, X.; Liu, H.; Wang, R.; Wang, K.; Williams, K. R.; Tan, W. Angew. Chem., Int. Ed. 2012, 51, 2457. 70. Dirks, R. M.; Pierce, N. A. Proc. Natl. Acad. Sci. U.S.A. 2004, 101 15275 71. Venkataram an, S.; Dirks, R. M.; Rothemund, P. W. K.; Winfree, E.; Pierce, N. A. Nat. Nanotechnol. 2007 2 490 72. Yin, P.; Choi, H. M. T.; Calvert, C. R.; Pierce, N. A. Nature 2008 451, 318 73. Liang, T. S. a. H. J. Am. Chem. Soc. 2012 134 10803. 74. Seelig, G.; Yurke, B.; Winfree, E. J. Am. Chem. Soc. 2006, 128 12211 75. Zhang, D. Y.; Turberfield, A. J.; Yurke, B.; Winfree, E. Science 2007 318 1121 76. Zhang, D. Y.; Winfree, E. J. Am. Chem. Soc. 2008, 130 13921 77. Seelig, G.; Soloveichik, D.; Zhang, D. Y.; Winfree, E. S cience 2006, 314, 1585. 78. Qian, L. L.; Winfree, E. Science 2011, 332 1196. 79. Soloveichik, D.; Seelig, G.; Winfree, E. Proc. Natl. Acad. Sci. U.S.A. 2010, 107 5393. 80. Qian, L.; Winfree, E.; Bruck, J. Nature 2011 475 368 81. Xing, Y.; Yang, Z.; Liu, D. Angew. Chem., Int. Ed. 2011, 50, 11934

PAGE 178

178 82. Wu, Y.; Sefah, K.; Liu, H.; Wang, R.; Tan, W. Proc. Natl. Acad. Sci. U.S.A. 2009, 107, 5. 83. Krishnan, Y.; Simmel, F. C. Angew. Chem., Int. Ed. 2011, 50 3124. 84. Douglas, S. M.; Bachelet, I.; Church, G. M. Science 2012, 335 831. 85. Xie, Z.; Wroblewska, L.; Prochazka, L.; Weiss, R.; Benenson, Y. Science 2011, 333, 1307. 86. Benenson, Y.; Gil, B.; Ben Dor, U.; Adar, R.; Shapiro, E. Nature 2004 429 423. 87. Gil, B.; Kahan Hanum, M.; Skirtenko, N.; Adar, R.; Shapiro, E. Nano Lett. 2011 11, 2989. 88. Lee, H.; Larson, D. R.; Lawrence, D. S. ACS Chem. Biol. 2009, 4 409. 89. Gorostiza, P.; Isacoff, E. Y. Science 2008 322 395. 90. Mayer, G.; Heckel, A. Angew. Chem., Int. Ed. 2006, 45, 4900. 91. Horspool, W. M. CRC Handbook of organic photochemistry and photobiology. CRC press, Boca Raton, 1995 92. Yager, K. G.; Barrett, C. J. J. Photochem. Photobiol. A 2006, 182 250. 93. Sadovski, O.; Beharry, A. A.; Zhang, F.; Wooley, G. A. Angew. Chem., Int. Ed. 2009, 48 1484. 94. Venkataramani, S.; Jana, U.; Dommaschk, M.; Sonnichsen, F. D.; Tuczek, F.; Herges, R. Science 2011, 331 445. 95. Zhou, M.; Liang, X.; Mochizuki, T.; Asanuma, H. Angew. Chem., Int. Ed. 2010 49 2167. 96. Hayashi, G.; Hagihara, M.; Dohno, C.; Nakatani, K. J. Am. Chem. Soc. 2007, 129 8678. 97. Bonardi, F .; London, G.; Nouwen, N.; Feringa, B. L.; Driessen, A. M. Angew. Chem., Int. Ed. 2010, 49, 7234. 98. Schliwa, M.; Woehlke, G. Nature 2003, 422 759. 99. Kudemac, T.; Ruangsupapichat, N.; Parschau, M.; Macia, B.; Katsonis, N.; Harutyunyan, S. R.; Ernst, K. H.; F eringa, B. J. Nature 2011, 479 208.

PAGE 179

179 100. Von Delius, M.; Geersema, E. M.; Leigh, D. A. Nat. Chem. 2010, 2 96. 101. Von Delius, M.; Geersema, E. M.; Leigh, D. A.; Tang, D. T. D. J. Am. Chem. Soc. 2010, 132 16134. 102. Barrell, M. J.; Campana, A. G.; von Delius, M.; Geersema, E. M.; Leigh, D. A. Angew. Chem., Int. Ed. 2011, 50, 285. 103. Lund, K.; Manzo, A. J.; Dabby, N.; Michelotti, N.; JohnsonBuck, A.; Nangreave, J.; Pei, R.; Stojanovic, M. N.; Walter, N. G.; Winfree, E.; Yan, H. Nature 2010, 465, 206. 104. Bath, J.; Turberfield, A. J. Nat. Nanotechnol. 2007, 2 275. 105. Von Delius, M.; Leigh, D. A. Chem. Soc. Rev. 2011, 40, 3656. 106. Krishnan, Y.; Simmel, F. C. Angew. Chem., Int. Ed. 2011, 50 3124. 107. Gu, H.; Chao, J.; Xiao, S.; Seeman, N. C. Nature 2010, 465 202. 108. He, Y.; Liu, D. R. Nat. Nanotechnol. 2010 5 778. 109. Wang, Z.; Elbaz, J.; Willner, I. Nano Lett. 2011 11 304. 110. Wang, C.; Ren, J.; Qu, X. Chem. Commun. 2011, 47 1428. 111. Yin, P.; Choi, H. M. T.; Calvert, C. R.; Pierce, N. A. Nature 2008 451, 318. 112. Omabegho, T.; Sha, R. ; Seeman, N. C. Science 2009, 324 67. 113. Green, S. J.; Bath, J.; Tuberfield, A. J. Phys. Rev. Lett. 2008, 101 238101. 114. Tian, Y.; He, Y.; Chen, Y.; Yin, P.; Mao, C. Angew. Chem., Int. Ed. 2005, 44 4355. 115. Bath, J.; Green, S. J.; Tuberfield, A. J. Angew. Che m., Int. Ed. 2005 44 4358. 116. Wickham, S. F. J.; Endo, M.; Katsuda, Y.; Hidaka, K.; Bath, J.; Sugiyama, H.; Turberfield, A. J. Nat. Nanotechnol. 2011 6 166. 117. Pei, R.; Taylor, S. K.; Stefanovic, D.; Rudchenko, S.; Mitchell, T. E. J. Am. Chem. Soc 2006 1 28, 12693. 118. Yin, P.; Yan, H.; Daniell, X. G.; Turberfield, A. J.; Reif, J. H. Angew. Chem., Int. Ed. 2004 43 4906.

PAGE 180

180 119. Walling, C.; Rabinowitz, R. J Am. Chem. Soc. 1959, 81, 1137. 120. Riemer, J.; Bulleid, N.; Herrmann, J. M. Science 2009, 324 1284 121. Park, S W.; Zhen, G. H.; Verhaeghe, C.; Nakagami, Y.; Nguyenvu, L. T.; Barczak, A. J.; Killeen, N.; Erle, D. Proc. Natl. Acad. Sci. U.S.A. 2009 106 6950. 122. Matsumura, M.; Matthews, B. W. Science 1989 243 792 123. Hogg, P. J. Trends Biochem. Sci. 2003, 28, 210 124. Saito, G.; Swanson, J. A.; Lee, K. D. Adv. Drug. Deliver. Rev 2003, 55, 199 125. Chari, R. V. J. Acc. Chem. Res. 2008, 41 98 126. Bauhuber, S.; Hozsa, C.; Breunig, M.; Gopferich, A. Adv. Mater. 2009 21, 3286. 127. Conlon, P.; Yang, J. C.; Wu, Y. R.; Chen, Y.; Mar tinez, K.; Kim, Y.; Stevens, N.; Marti, A. A.; Jockusch, S.; Turro, N. J.; Tan, W. J. Am. Chem. Soc. 2008, 130 336. 128. Kumar, C. V.; Buranaprapuk, A.; Opiteck, G. J.; Moyer, M. B.; Jockusch, S.; Turro, N. J. Proc. Natl. Acad. Sci. U.S.A. 1998 95, 10361 129. X u, Z.; Singh, N. J.; Lim, J.; Pan, J.; Kim, H. N.; Park, S.; Kim, K. S.; Yoon, J. J. Am. Chem. Soc. 2009, 131 15528 130. Mack, E. T.; Carle, A. B.; Liang, J. T.; Coyle, W.; Wilson, M. J. Am. Chem. Soc. 2004, 126 15324 131. Boussicault, F.; Robert, M. Chem. Rev 2008 108 2622 132. Bent, D. V.; Hayon, E. J. Am. Chem. Soc. 1975, 97, 2612. 133. Fung, Y. M. E.; Kjeldsen, F.; Silivra, O. A.; Chan, T. W. D.; Zubarev, R. A. Angew. Chem. Int. Ed. 2005, 44, 6399. 134. Ly, T.; Julian, R. R. Angew. Chem. Int. Ed. 2009, 48 2 135. Ta shiro, R.; Ohtsuki, A.; Sugiyama, H. J. Am. Chem. Soc. 2010, 132 14361. 136. Daublain, P.; Thazhathveetil, A. K.; Wang, Q.; Trifonov, A.; Fiebig, T.; Lewis, F. D. J. Am. Chem. Soc. 2009, 131 16790 137. Kawai, K.; Takada, T.; Tojo, S.; Ichinose, N.; Majima, T. J Am. Chem. Soc. 2001, 123, 12688

PAGE 181

181 138. Bae, Y.; Kataoka, K. Adv. Drug Delivery Rev. 2009, 61, 768 139. Discher, D. E.; Eisenberg, A. Science 2002 297, 967 140. Behera, G. B.; Mishra, B. K.; Behera, P. K.; Panda, M. Adv. Colloid. Interface. Sci. 1999, 82, 1 141. Silve rman, S. K. Angew. Chem. Int. Ed. 2010 49 2 142. Silverman, S. K. Acc. Chem. Res. 2009, 42, 1521. 143. Stoll, R. S.; Hecht, S. Angew. Chem. Int. Ed. 2010, 49, 5054. 144. Yim, T.; Liu, J.; Lu, Y.; Kane, R. S.; Dordick, J. S. J. Am. Chem. Soc. 2005, 127 12200. 145. Ba rrell, M. J.; Campana, A. G.; von Delius, M.; Geertsema, E. M.; Leigh, D. A. Angew. Chem. Int. Ed. 2011, 123 299. 146. Shin, J.; Pierce, N. A. J. Am. Chem. Soc. 2004, 126 10834. 147. Sherman, W. B.; Seeman, N. C. Nano Lett. 2011, 11, 304. 148. Gorostiza, P.; Isacoff, E. Y. Science 2008 322 395. 149. Zhou, M.; Liang, X.; Mochizuki, T.; Asanuma, H. Angew. Chem. Int. Ed. 2010, 122, 2167. 150. Kang, H.; Liu, H.; Phillips, J. A.; Cao, Z.; Kim, Y.; Chen, Y.; Yang, Z.; Li, J.; Tan, W. Nano Lett. 2009 9 2690. 151. Kiim, Y.; Cao, Z .; Tan, W. Proc. Natl. Acad. Sci. U.S.A. 2008, 105 5664. 152. You, M.; Zhu, Z.; Liu, H.; Gulbakan, B.; Han, D.; Wang, R.; Williams, K. R.; Tan, W. ACS Appl. Mater. Interfaces 2010 2, 3601. 153. Kopelman, R.; Tan, W. Science 1993, 262 1382. 154. Tan, W.; Shi, Z.; Sm ith, S.; Birnbaum, D.; Kopelman, R. Science 1992 258 778. 155. Mai, J.; Sokolov, I. M.; Blumen, A. Phys. Rev. E 2001, 64 011102. 156. Saffarian, S.; Collier, I. E.; Marmer, B. L.; Elson, E. L.; Goldberg, G. Science 2004, 306 108.

PAGE 182

182 157. Wang, Z. Proc. Natl. Acad. Sc i. U.S.A. 2007 104, 17921. 158. Roostalu, J.; Hentrich, C.; Bieling, P.; Telley, I. A.; Schiebel, E.; Surrey, T. Science 2011, 332 94 159. Yin, P.; Choi, H. M. T.; Calvert, C. R.; Pierce, N. A. Nature 2008 451, 318 160. Muscat, R. A.; Bath, J.; Turberfield, A. J. Nano Lett. 2011, 11, 982 161. Zhang, D. Y.; Seelig, G. Nat. Chem. 2011, 3 ,103 162. Genot, A. J.; Zhang, D Y.; Bath, J.; Turberfield, A. J. J. Am. Chem. Soc. 2011 133, 2177. 163. Liang, X.; Mochizuki, T.; Asanuma, H. Small 2009, 5 1761. 164. Asanuma, H.; Matsunaga, D .; Komiyama, M. Nucleic. Acids. Symp. Ser. 2005 49, 35 165. Schierling, B. ; Noel, A. J.; Wende, W.; Hien Le, T.; Volkov, E.; Kubareva, E.; Oretskaya, T.; Kokkinidis, M.; Rompp, A.; Spengler, B. Proc. Natl. Acad. Sci. U S A 2010, 107 1361 166. Shin, J.; Pierce N. A. J. Am. Chem. Soc. 2004, 126 10834 167. Sherman, W. B.; Seeman, N. C. Nano Lett 2004, 4 1203 168. Pinheiro, A. V.; Han, D.; Shih, W. M.; Yan, H. Nat. Nanotechnol. 2011 6 763 169. Wickham, S. F. J.; Bath, J.; Katsuda, Y.; Endo, M.; Hidaka, K.; Sugiyama, H.; Turberfield, A. J. Nat. Nanotechnol 2012 7 169. 170. Bath, J.; Turberfield, A. J. Nat. Nanotechnol. 2007, 2 275 171. Teller, C.; Willner, I. Curr. Opin. Biotechnol. 2010, 21 376 172. Feldkamp, U.; Niemeyer, C. M. Angew. Chem., Int. Ed. 2006, 45 1856. 173. Kana n, M. W.; Rozenman, M. M.; Sakurai, K.; Snyder, T. M; Liu, D. R. Nature 2004, 431 545 174. Melkko, S.; Scheuermann, J.; Dumelin, C. E; Neri, D. Nat. Biotechnol. 2004, 22 568. 175. Park, S.; Lytton Jean, A. K. R.; Lee, B.; Weigand, S.; Schatz, G. C.; Mirkin, C. A. Nature 2008 451 553

PAGE 183

183 176. Nykypanchuk, D.; Maye, M. M.; Lelie, D.; Gang, O. Nature 2008 451 549 177. Niemeyer, C. M. Angew. Chem., Int. Ed. 2010 49 1200 178. Yan, H.; Park, S. H.; Finkelstein, G.; Reif, J. H.; LaBean, T. H. Science 2003, 301, 1882. 179. Niemey er, C. M.; Koehler, J.; Wuerdemann, C. ChemBioChem 2002, 3 242 180. Rinker, S.; Ke, Y.; Liu, Y.; Chhabra, R.; Yan, H. Nat. Nanotechnol. 2008, 3 418 181. Cohen, J. D.; Sadowski, J. P.; Dervan, P. B. J. Am. Chem. Soc. 2008 130 402 182. Carter, J. D.; LaBean, T. H ACS Nano 2011, 5 2200 183. Sacca, B.; Meyer, R.; Erkelenz, M.; Kiko, K.; Arndt, A.; Schroeder, H.; Rabe, K. S.; Niemeyer, C. M. Angew. Chem., Int. Ed. 2010, 49 9378. 184. Willner, I.; Rubin, S. Angew. Chem., Int. Ed. 1996, 35 367. 185. Mayer, G.; Heckel, A. Ange w. Chem., Int. Ed. 2006, 45, 4900. 186. Schierling, B. Proc. Natl. Acad. Sci. U S A 2010, 107 1361. 187. Gorostiza, P.; Isacoff, E. Y. Science 2008 322 395 188. Wilner, O. I.; Weizmann, Y.; Gill, R.; Lioubashevski, O.; Freeman, R.; Willner, I. Nat. Nanotechnol. 2 009 4 249 189. Vriezema, D. M.; Garcia, P. M.; Sancho Oltra, N.; Hatzakis, N. S; Kuiper, S. M.; Nolte, R. J.; Rowan, A. E.; van Hest, J. C. Angew. Chem., Int. Ed. 2007, 46 7378. 190. Wang, Z.; Wilner, O. I.; Willner, I. Nano Lett. 2009, 9 4098. 191. Wilner, O. I.; Shimron, S.; Weizmann, Y.; Wang, Z.; Willner, I. Nano Lett. 2009, 9 2040. 192. Good, M. C.; Zalatan, J. G.; Lim, W. A. Science 2011, 332 680 193. Bashor, C. J.; Helman, N. C.; Yan, S.; Lim, W. A. Science 2008, 319, 1539. 194. Erkelenz, M.; Kuo, C.; Niemeyer, C. M J. Am. Chem. Soc. 2011, 133 16111 195. Ghosh, M.; Song, X ; Mouneimne, G.; Sidani, M.; Lawrence, D. S.; Condeelis, J. S. Science 2004, 304 743.

PAGE 184

184 196. Li, H.; Hah, J.; Lawrence, D. S. J. Am. Chem. Soc. 2008, 130 10474 197. Gautier, A.; Deiters, A.; Chin, J. W. J. Am. Chem. Soc. 2011, 133 2124. 198. Silverman, S. K. Acc. Chem. Res. 2009, 42, 1521. 199. Yin, B.; Ye, B.; Tan, W.; Wang, H.; Xie, C J. Am. Chem. Soc. 2009, 131 14624 200. Liu, X.; Freeman, R.; Golub, E.; Willner, I. ACS Nano 2011, 5 7648. 201. Shlyahovsky, B.; Li, D.; Katz, E.; Willner, I. Biosen. Bioelectron. 2007 22 2570 202. Shimron, S.; Elbz, J.; Henning, A.; Willner, I. Chem. Commun. 2010 46, 3250. 203. Asanuma, H.; Liang, X.; Nishioka, H.; Matsunaga, D.; Liu, M.; Komiyama, M. Nat. Protoc 2007, 2 203 204. Kim, Y.; P hillips, J.; Liu, H.; Kang, H.; Tan, W. Proc. Natl. Acad. Sci. U. S A 2009, 106, 6489. 205. Garnett, M. J. Nature 2012, 483 570. 206. Revankar, C. M.; Cimino,; Sklar, D. F. L. A.; Arterburn, J. B.; Prossnitz, E. R. Science 2005, 307 1625. 207. Vivier, E.; Ugolini, S .; Blaise, D.; Chabannon, C.; Brossay, L. Nat. Rev. Immun 2012, 12 239. 208. Mager, M. D.; LaPointe, V.; Stevens, M. M. Nat. Chem 2011, 3 582. 209. Hollingsworth, M. A.; Swanson, B. J. Nat. Rev. Cancer. 2004, 4 45. 210. Png, K. J.; Halberg, N.; Yoshida, M.; Tavaz oie, S. F. Nature 2012, 481 190. 211. Keefe, A. D.; Pai, S.; Ellington, A. Nat. Rev. Drug Discovery 2010 9 537. 212. Torchilin, V. Expert Opin. Drug Delivery 2008 5 1027. 213. Ross, J. F.; Chaudhuri, P. K.; Ratnam, M. Cancer 1994, 73 2432. 214. Aribi, A.; Ravandi, F .; Giles, F. The Cancer J 2006, 12, 77. 215. Ikeda A. Mol. Genet. Metab. 2006 88 216. 216. Zhou, H.; Jiao, P.; Yang, L.; Li, X.; Yan, B. J. Am. Chem. Soc 2011, 133 680.

PAGE 185

185 217. Kluza E. Nano Lett 2010, 10, 52. 218. Krishnan, Y.; Simmel, F. C. Angew. Chem., Int. Ed. 201 1 50 3124. 219. Seelig, G.; Soloveichik, D.; Zhang, D. Y.; Winfree, E. Science 2006, 314, 1585. 220. Pei, R.; Matamoros, E.; Liu, M.; Stefanovic, D.; Stojanovic, M. N. Nat. Nanotechnol. 2010 5 773. 221. Qian, L.; Winfree, E. Science 2011, 332 1196. 222. Elbaz, J. Nat Nanotechnol 2010, 5 417. 223. Famulok, M.; Hartig, J. S.; Mayer, G. Chem. Rev. 2007, 107 3715. 224. Breaker, R. D. Nature 2004, 432 838. 225. Sefah, K.; Shangguan, D.; Xiong, X.; ODonoghue, M. B.; Tan, W. Nat. Protoc. 2010, 5 1169. 226. Fang, X.; Tan, W. Acc. Chem Res 2010, 43, 48. 227. Shangguang, D. Proc. Natl. Acad. Sci. USA 2006, 103 11838. 228. Tang, Z. Anal. Chem 2007, 79 4900. 229. Zhang, D. Y.; Seelig, G. Nat. Chem 2011, 3 103. 230. Zhang, D. Y.; Winfree, E. J. Am. Chem. Soc. 2009, 131 17303. 231. Phillips, J. A. Bioc onjugate Chem. 2011, 22, 282. 232. Castano, A. P.; Mroz, P.; Hamblin, M. R. Nat. Rev. Cancer 2006, 6 535. 233. Lovell, J. F.; Liu, T. W.; Chen, J.; Zheng, G. Chem. Rev. 2010, 110 2839.

PAGE 186

186 BIOGRAPHICAL SKETCH Mingxu You was born in Heilongjiang China in 1985. He attended the Daqing No. 1 High School for his secondary education, where he was inspired to become a chemist. Thereafter he attended Peking University to study chemistry. After obtaining his B. S. degree, Mingxu came to the United States in the f all of 200 8, to pursue his Ph. D. degree under the supervision of Dr. Weihong Tan. He completed his Doctor of Philosophy in chemistry from University of Florida in 2012.