Effect of Hepatocyte-Specific Inactivation of Divalent Metal-Ion Transporter-1 (Dmt1) on Iron Homeostasis and Characteri...

MISSING IMAGE

Material Information

Title:
Effect of Hepatocyte-Specific Inactivation of Divalent Metal-Ion Transporter-1 (Dmt1) on Iron Homeostasis and Characterization of Zip8 as a Novel Iron Transporter
Physical Description:
1 online resource (92 p.)
Language:
english
Creator:
Wang, Chia-Yu
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Nutritional Sciences
Committee Chair:
Knutson, Mitchell D
Committee Members:
Sitren, Harry S
Collins, James Forrest
Kim, Jae-Sung

Subjects

Subjects / Keywords:
dmt1 -- zip8
Nutritional Sciences -- Dissertations, Academic -- UF
Genre:
Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Divalent metal-ion transporter-1 (DMT1) is a transmembrane protein that is known to be essential for iron uptake by enterocytes and erythroid precursors. DMT1 is also present in the liver, where it is believed to play a role in hepatic iron uptake, either through transferrin-bound iron (TBI) or non-transferrin-bound iron (NTBI), which appears in the plasma during iron overload. I investigated the role of DMT1 in hepatic iron uptake by using DMT1 hepatocyte-specific knockout (Dmt1liv/liv) mice and by crossing them with two mouse models of genetic iron overload. To directly access the role of DMT1 in NTBI and TBI uptake, I injected 59Fe-labeled ferric citrate or 59Fe-transferrin intravenously into Dmt1liv/liv and Dmt1flox/flox mice and measured hepatic 59Fe uptake. I found that DMT1 is dispensable for hepatic iron accumulation or for NTBI uptake. Although TBI uptake was 40% lower in Dmt1liv/liv mice, the contribution to the overall iron economy of the liver is minor because hepatic iron levels were unaffected. Given that DMT1 is dispensable for hepatic iron homeostasis, other iron transport mechanisms must exist. One possibility is ZIP8 (ZRT/IRT-like Protein 8), a close homologue of ZIP14, a transmembrane protein that has recently been shown to transport iron. ZIP8 has been shown to transport zinc, cadmium, and manganese, but the capability of ZIP8 to mediate iron transport has not been reported. I tested the hypothesis that ZIP8 transports iron and investigated its regulation by iron and tissue distribution. I found that overexpression of ZIP8 in HEK 293T cells increased NTBI uptake by 200%. I also found that cell-surface ZIP8 is upregulated by iron loading in H4IIE cells, a rat hepatoma cell line, and that ZIP8 mediates NTBI uptake at both pH 7.5 and 6.5. By screening ZIP8 mRNA levels from 20 different human tissues, I found that ZIP8 was most abundantly expressed in the lung and placenta. Moreover, siRNA-mediated suppression of ZIP8 expression in BeWo cells, a placental cell line, decreased NTBI uptake by 37%. These data reveal ZIP8 as a novel iron transporter that may play a role in iron metabolism, possibly in hepatic iron uptake and/or in placental iron transport.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Chia-Yu Wang.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Knutson, Mitchell D.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-06-30

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044841:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 EFFECT OF HEPATOCYTE SPECIFIC INACTIVATION OF DIVALENT METAL ION TRANSPORTER 1 (DMT1) ON IRON HOMEOSTASIS AND CHARACTERIZATION OF ZIP8 AS A NOVEL IRON TRANSPORTER By CHIA YU WANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Chia Yu Wang

PAGE 3

3 To my wonderful parents

PAGE 4

4 ACKNOWLEDGMENTS Completion of my dissertation could not have been possible without the guidance of my committee members help from colleagues and friends, and the support of my family. I would like to express my deepest gratitude to my major advisor Dr. Mitchell D. Knutson for the outstanding guidanc e and the patience shown throughout my doctoral studies. I thank my other committee members, Dr. Harry S. Sitren, Dr. James F. Collins and Dr. Jae Sung Kim for their constructive comments and invaluable support over the years. I thank my first mentor, the late Dr. Hiromi Gunshin, who le d me into the molecular iron field and ignited my passion for scientific research. Hyeyoung Nam, Ningning Zhao, Supak Jenkitkasemwong Wei Zhang, Lin Zhang, and Richard S. Coffey, who are my colleagues and friends. They alwa ys help me in various aspects in experiments as well as in life. I sincerely thank my father, Wen Ching Wang and my mother, Mei Ch i n Liao for their love, understanding, support and encouragement.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 12 C HAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 14 Biological Functions of Iron and Bo dy Iron Distribution ................................ ........... 14 Iron Homeostasis ................................ ................................ ................................ .... 15 Intestinal Iron Absorption ................................ ................................ .................. 15 Heme iron absorption ................................ ................................ ................. 16 Nonheme iron absorption ................................ ................................ ........... 16 Circulation and Storage of Iron ................................ ................................ ......... 17 Hepcidin Regulates Iron Homeostasis ................................ ............................. 18 Iron Overload Disorders ................................ ................................ .......................... 18 Primary Iron Overload ................................ ................................ ...................... 18 Sec ondary Iron Overload ................................ ................................ .................. 19 Divalent Metal ion Transporter 1 ................................ ................................ ............ 20 DMT1 Mutations in Rodents and Humans ................................ ........................ 21 Rodents ................................ ................................ ................................ ...... 21 Humans ................................ ................................ ................................ ...... 21 Function of DMT1 in Intestine and Erythroid Cells ................................ ........... 23 Regulation of DMT1 ................................ ................................ ......................... 23 Intestine ................................ ................................ ................................ ..... 23 Liver ................................ ................................ ................................ ........... 25 Post transcriptional regulation ................................ ................................ .... 26 Z IP8, ZIP14 and the Possible Relation to Iron Homeostasis ................................ .. 26 ZIP14 and Iron Homeostasis ................................ ................................ ............ 27 Metal Transport Capability of ZIP8 ................................ ................................ ... 28 Regulation of ZIP8 ................................ ................................ ............................ 28 Tissue and Subcellular Distribution of ZIP8 ................................ ...................... 29 ZIP8 and Diseases ................................ ................................ ........................... 29 2 MATERIALS AND METHODS ................................ ................................ ................ 33 Animal Care and Genotyping ................................ ................................ .................. 33 Measurement of mRNA Levels ................................ ................................ ............... 34

PAGE 6

6 Crude Membrane and Tissue Homogenate Preparation ................................ ........ 34 Western Blot Analysis ................................ ................................ ............................. 35 Iron Status Parameters, Liver M ineral Concentrations and Histological Analysis ... 36 Measurement of TBI and NTBI Uptake ................................ ................................ ... 36 Cell Culture ................................ ................................ ................................ ............. 37 Immunoprecipitation ................................ ................................ ............................... 37 Measurement of Iron and Zinc Uptake ................................ ................................ .... 37 Measurement of pH Dependence of ZIP8 mediated Iron Transport Activity ........... 38 Iron Loading and Cell Surface Biotinylation ................................ ............................ 38 Assessment of N linked Glycosylation ................................ ................................ .... 38 Suppression of ZIP8 Expression in BeWo Cells ................................ ..................... 39 Statistic al Analysis ................................ ................................ ................................ .. 39 3 EFFECT OF HEPATOCYTE SPECIFIC INACTIVATION OF DIVALENT METAL ION TRANSPORTER 1 (DMT1) ON IRON HOMEOSTASIS ..................... 40 Introduction ................................ ................................ ................................ ............. 40 Results ................................ ................................ ................................ .................... 42 Inactivation of DMT1 Specifically in the Live r ................................ ................... 42 Liver specific Inactivation of Dmt1 in Hfe / or Trf hpx/hpx Mice does not affect Hepatic Iron Loading or Body Iron Status ................................ ...................... 43 Effect of Liver specific Inactivation of Dmt1 on NTBI and TBI Uptake by the Liver ................................ ................................ ................................ .............. 44 Discussion ................................ ................................ ................................ .............. 45 4 CHARACTERIZATION OF ZIP8 AS A NOVEL IRON TRANSPORTER ................. 56 I ntroduction ................................ ................................ ................................ ............. 56 Results ................................ ................................ ................................ .................... 57 Overexpression of ZIP8 Increases Cellular Uptake of Zinc and Iron ................ 57 ZIP8 mediated Iron Transport Activity is pH Dependent ................................ .. 57 ZIP8 is Glycosylated and Detectable at the Cell Surface in H4IIE Cells ........... 57 ZIP8 Protein Expression is Induced upon Iron Treatment in H4IIE Cells ......... 58 Tissue Expression of ZIP8, ZIP14 and DMT1 ................................ .................. 58 Suppression of ZIP8 Expression in BeWo Cells ................................ ............... 59 Discussio n ................................ ................................ ................................ .............. 59 5 C ONCLUSIONS LIMITATIONS AND FUTURE DIRECTIONS ............................. 68 Conclusions ................................ ................................ ................................ ............ 68 Apparent Discrepancies with the Literature ................................ ............................ 69 Limitations ................................ ................................ ................................ ............... 70 Future Directions ................................ ................................ ................................ .... 70 APPENDI X : R EGULATION OF ZIP14 BY IRON OVERLOAD ................................ ...... 72 LIST OF REFERENCES ................................ ................................ ............................... 77

PAGE 7

7 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 92

PAGE 8

8 LIST OF TABLES Table page 3 1 Iron status parameters of Dmt1 flox/flox and Dmt1 liv/liv mice ................................ .... 54 3 2 Liver mineral concentrations in Dmt1 liv/liv Hfe / ;Dmt1 liv/liv and Trf hpx/hpx ;Dmt1 liv/liv mice and their respective Dmt1 flox/flox controls ........................ 55

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Model of DMT1 function in iron acqu isition by erythroid precursors .................. 31 1 2 Simila rity of ZIP14 and ZIP8 proteins ................................ ................................ 32 3 1 Disruption of Dmt1 in the liver ................................ ................................ ............. 48 3 2 Relative Dmt1 mRNA levels in livers of Dmt1 liv/liv mice at various ages .............. 49 3 3 Plasma iron levels, transferrin saturation and hepatic iron accumulation are not affected by liver specific inactivation of Dmt1 in Hfe / mice .......................... 50 3 4 Plasma iron, hemoglobin levels and hepatic iron accumulation are not affected by liver specific inactivation of Dmt1 in hypotransferrinemic mi ce ....... 51 3 5 Tissue uptake of 59 Fe from NTBI or TBI injected into the plasma of Dmt1 flox/flox and Dmt1 liv/liv mice ................................ ................................ .............................. 52 3 6 Effect of liver specific inactivation of Dmt1 on hepatic levels of TfR1, TfR2, and ZIP14 ................................ ................................ ................................ ........... 53 4 1 Overexpression of ZIP8 increases the c ellular uptake of iron and zinc .............. 62 4 2 pH dependence of ZIP8 mediated iron transport ................................ ................ 63 4 3 Immunoprecipitation and glycosylation analysis of endogenous ZIP8 in H4IIE rat hepatoma cells ................................ ................................ .............................. 64 4 4 Iron and zinc loading increases ZIP8 lev els in H4IIE rat hepatoma cells ............ 65 4 5 Tissue expression of ZIP8 ZIP14 and DMT1 ................................ .................... 66 4 6 Suppression of ZIP8 expression decr eases iron uptake in BeWo cells .............. 67 A 1 Validation of the immunore activity of anti ZIP14 antibody ................................ .. 74 A 2 Effect of dietary iron deficiency and overlo ad on ZIP14 levels in rat liver, pancreas, and heart ................................ ................................ ............................ 75 A 3 Effect of genetic iron overload on ZIP14 lev els in mouse liver and pancreas .... 76

PAGE 10

10 LIST OF ABBREVIATION S CCS Copper chaperone for superoxide dismutase D CYTB Duodenal cytochrome b DMEM modified E DMT 1 Divalent metal ion transporter 1 FBS Fetal bovine serum HH Hereditary hemochromatosis HIF Hypoxia inducible factor ICP MS Inductively coupled plasma mass spectrometry IRE Iron responsive element IRP Iron regulatory protein TBI Transferrin bound iron L DOPA 3,4 dihydroxyphenylalanine LPS Lipopolysaccharide NDFIP Nedd4 family interacting protein NTA Nitrilotriacetic acid NTBI Non transferrin bound iron PNGASE F Peptide: N Glycosidase F SLC 11 A 2 Solute carrier family 11, member 2 SLC 46 A 1 Solute carrier family 46, member 1 TFR 1 Transferrin receptor 1 TFR 2 Transferrin receptor 2 TF TFR Transferrin transferrin receptor SRB 1 Scavenger receptor class B type I W T wild type

PAGE 11

11 ZIP 8 ZRT/IRT like Protein 8 Z n C l 2 Zinc chloride

PAGE 12

12 Abstract of Dis sertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECT OF HEPATOCYTE SPECIFIC INACTIVATION OF DIVALENT METAL ION TRANSPORTER 1 (DMT1) ON IRON HOMEOSTASIS AND CHARACTERIZATION OF ZIP8 AS A NOVEL IRON TRANSPORTER By Chia Yu Wang December 2012 Chair: Mitchell D Knutson Major: Nutritional Sciences Divalent metal ion transporter 1 (DM T1) is a transmembrane protein that is known to be essential for iron uptake by enterocytes and erythroid precursors. DMT1 is also present in the liver, where it is believe d to play a role in hepatic iron uptake either through transferrin bound iron (TBI) or non transferrin bound iron (NTBI), which app ears in the plasma during iron overload. I investigated the role of DMT1 in hepatic iron uptake by using DMT1 hepatocyte specific knockout ( Dmt1 liv/liv ) mice and by crossing them with two mouse models of genetic iron overload. To directly access the role of DMT1 in NTBI and TBI uptake, I injected 59 Fe la beled ferric citrate or 59 Fe transferrin intravenously in to Dmt1 liv/liv and Dmt1 flox/flox mice and measured hepatic 59 Fe uptake I found that DMT1 is dispensable for hepatic iron accumulation or for NTBI uptake. Although TBI uptake was 40% lower in Dmt1 liv/liv mice the contribution to the overall iron economy of the liver is minor be cause hepatic iron level s were u naffected Given that DMT1 is dispensable for hepatic iron homeost asis, other iron transport mechanisms must exist. One possibility is ZIP8 ( ZRT/IRT like Protein 8 ) a close homologue of ZIP14, a transmembrane protein that has recently been shown to transport iron. ZIP8

PAGE 13

13 has been shown to transport zinc, cadmium and man ganese, but the capability of ZIP8 to mediate iron transport has not been reported. I tested the hypothesis that ZIP8 transports iron and investigated its regulation by iron and tissue distribution. I found that overexpression of ZIP8 in HEK 293T cells inc reased NTBI uptake by 200% I also found that cell surface ZIP8 is up regulated by iron loading in H4IIE cells a rat hepatoma cell line, and that ZIP8 mediates NTBI up take at both pH 7.5 and 6.5 By scre ening ZIP 8 mRNA levels from 20 different human tissues, I found that ZIP8 was most abundantly expressed in the lung and placenta. Moreover, siRNA mediated suppression of ZIP8 expression in BeWo cells, a placental cell line, decreased NTBI uptake by 37%. These data reveal ZIP8 as a novel iron transporte r that may play a role in iron metabolism, possibly in hepatic iron uptake and/or in placental iron transport.

PAGE 14

14 CHAPTER 1 LITERATURE REVIEW In the first section of this chapter, I will provide a general overview of iron biological functions, body distribution, homeostasis, and overload disorders. In the second section, I will review DMT1, focus ing on its function, regulation and mutati ons that affect its function. In the last section, I will introduce ZIP8 and its possible relation to iron metabolism. Biological Functions of Iron and Body Iron Distribution Protein s containing iron can be divided into three groups: heme protein s iron sulfur protein s and other iron containing protein s The most commonly recognized biological function of iron is as a constituent of the heme moiety in heme protein s Heme proteins play diverse roles in the body, such as hemoglobin and myoglobin in oxygen transpo rt ( 1 4 ) catalase and peroxidase s in catalysis ( 5 ) and cytochromes in electron transfer ( 6 ) Iron sulfur (Fe S) cluster proteins usually contain equal numbers of iron and sulfide ions, 2Fe 2S or 4Fe 4S. These proteins function in electron transfer reactions, such as NADH dehydrogenase, succinate dehydrogenase and cytochrome c reductase in comple x I, II and III of the mitochondrial electron transport chain, respectively ( 7 ) There are also non redox enzymes containing Fe S clusters, such as aconitase. Mitochondrial aconitase catalyzes the conversion of citrate to iso citrate whereas cytosolic aconitase functions as an iron regulatory protein (IRP) when iron is scarce ( 8 ) Other iron containing proteins do not have a heme m oiety or an Fe S cluster such as hydroxylases For example, p rolyl hydroxylase catalyzes the synthesis of hydroxyproline in the production of collagen and tyrosine hydroxylase catalyzes the conversion of

PAGE 15

15 tyrosine to 3,4 dihydroxyphenylalanine (L DOPA), the rate limiting step in the biosynthesis of catecholamines ( 9 10 ) An ad ult man contains approximately 3 5 gram of iron with 65% of total body iron in hemoglobin ( 11 12 ) and 10 15% in myoglobin and other iron containing enzy mes ( 13 ) The remainder, approximately 20 25%, is store d in the liver, macrophage s and bone marrow in the form of ferritin and/or hemosiderin ( 11 14 ) Less than 1% of total body iron is in the circulation bound with transferrin ( 13 ) An adult female usually has 2 3 g of iron, but with lo w iron stores. Iron Homeostas is The ability of iron to donate and accept electrons contributes in large part to its involvement in enzymatic reactions and biological functions; however, too much iron can be toxic due to free radical generation through the Fenton reaction ( 15 ) Dietary iron absorption contributes 1 2 mg of iron daily on average and is needed to replace the same amount of iron lost through occult blood loss, desquamation of mucosal and skin cells, and menstruation in females ( 13 14 ) Because there is no effective way of excreting excess iron ( 12 ) the regulation of iron absorption becomes critical in maintaining iron homeostasis in the body. Intestinal Iron Absorption Dietary sources of iron can be divided in to two types, heme iron and non heme iron. Heme iron only comes from animal sources, in which iron is locked with in the porphyrin ring ( 16 ) Non heme iron refers to all other forms of iron. For non vegetarians, heme iron is onl y ~10% of total iron intake; however, it is more bioavailable and can contribute up to two thirds of absorbed iron ( 17 )

PAGE 16

16 Heme iron absorption Dietary heme i s abso rbed intact by enterocytes and the iron is released from the heme moiety by heme oxygenase ( 18 20 ) The liberated iron enters a low molecular weight pool containing absorbed diet ary non heme iron before being transported out of the enterocyte through ferroportin a transmembrane protein situated on the basolateral membran e ( 21 22 ) R ecently, the protein SLC46A1 (solute carrier family 46 member 1 ) was identified as a heme iron transporter at the apical membrane of enterocyte s by using subtractive hybridization screening in hypotransferrinemic mice ( 23 ) However, it was later shown to be a folate transporter by using a database mining approach based on homology to a facilitative reduced folate carrier ( 24 ) Indeed, compared to heme with a transport affinity K m 46 A1 has a much higher affinity for 5 methyltetrahydrofolate (K m at pH 6.5) Moreover, a mutation in this gene results in syndromes of hereditary folate malabsorption ( 23 24 ) Therefore, the mechanistic details of heme iron a bsorption remain to be elucidated. Non heme iron absorption The molecular mechanism s of nonheme iron absorption ha ve been intensively studied since 1997, when the transporter DMT1 was identified ( 25 ) The official gene symbol of DMT1 is Slc11a2 solute carrier family 11, member 2 ( 26 ) DMT1 is abundantly expressed in the proximal duodenum, where it serves as the major iron importer at the apical membrane of epithelial cells ( 25 26 ) As the majority of dietary nonheme iron is in ferric (Fe 3+ ) state ( 17 ) a cell surface ferrireductase ( 27 28 ) or r educing agent such as ascorbic acid ( 29 ) is required to reduce dietary ferric iron to its ferrous (Fe 2+ ) form before it can be transported across the intestinal epithelium. Duodenal cytochrome b (Dcytb; Cybrd1 ) was recognized as the ferrireductase at the

PAGE 17

17 apical membrane of enterocyte ; however the lack of an iron deficient phenotype in C ybrd1 knockout mice raises the question of its essentiality ( 30 ) It is possible that, unlike human s which depend on exogenous source s of v itamin C, mice can synthesize ascorbic acid ( 31 ) and the concentration of ascorbic acid in small intestine is high (~2 ( 32 33 ) and therefore, a ferrireductase is not required After iron traverses the apical membrane of enterocyte s through DMT1, it can be either stored as ferritin or exported across the basolateral membrane via ferroportin. Ferroportin ( Slc40a1 ) is the sole known iron exporter and it is r equired for transporting iron from enterocytes to the circulation ( 22 ) After export from the ent erocyt e the ferrous i on is oxidized to the ferric (Fe 3+ ) form by hephaestin, a copper dependent ferroxidase, before it binds to transferrin ( 34 ) Circulation and Storage of Iron The majority of iron in plasma is bound to transferrin. Under normal condition s about one third of total transferrin is loaded with iron whereas NTBI is nearly un detectable. NTBI refers to iron that is not in heme, ferritin or bound with transferrin, but in a low molecular mass form and bound with small ligands, such as citrate and albumin ( 35 36 ) In iron overload condition s the amount of circulating iron c an exceed the binding capacity of transferrin and plasma NTBI concentrations may increase up to 1 ( 37 ) Iron is store d inside the cell as ferritin or hemosiderin. Ferritin has two distinct subunits, H and L. Different proportions of H and L subunits assemble to form apoferritin, a 24 subunit hollow structure that can accommodate up to 4500 iron atoms ( 38 ) Ferritin is also present in the serum and is commonly used as an indicator of body iron stores Serum ferritin is secreted by macrophages ( 39 ) and can increase to over thalassemia patients ( 40 ) Hemosiderin a water ins oluble protein with

PAGE 18

18 a high iron to protein ratio, is thought to be product of lysosomal degradation of ferritin and observed primarily in iron loaded tissues ( 41 42 ) H epcidin Regulates Iron Homeostasis Hepcidin is a 25 amino acid peptide hormone secreted by hepatocytes Hepcidin circulates in blood plasma and prevents iron efflux from enterocytes, hepatocytes and macrophages and therefore, lowers plasma iron concentrations ( 43 44 ) Hepcidin regulates cellular iron efflux by bind ing to the iron exporter ferroportin and inducing its intern alization and degradation ( 45 ) H epcidin is regulated by a number of conditions including anemia, hypoxia, inflammation, and iron overload ( 46 47 ) Iron Overload Disorders Iron overload is a serious consequence in patients with hereditary hemochromatosis and in patients with bone marrow defects who undergo blood transfusions. E arly signs of iron overload are increased transferrin saturation and elevated concentrations of pla sma iron and ferritin ( 48 ) Accumulation of iron can lead to irreversible tissue damage, fibrosis and organ failure due to the formation of damaging oxygen radi cals catalyzed by free iron ( 13 49 ) The main tissues affected are the liver, heart, and pancreas resulting in increased risks of hepatocellular carcinoma, cirrhosis, cardiomyopathy, and diabetes ( 13 50 ) Primary Iron Overload Primary iron overload or hereditary hemochromatosis (HH) is a genetic disorder that result s from increased absorption of dietary iron. In HH, a homozygous substitution of tyrosine for cysteine at position 28 2 (C282Y) in the H FE protein is the most common mutation with a prevalence of about 1 in 200 to 400 individuals of Northern European descent ( 51 53 ) Another missense mutation found in HFE results in the substitution of

PAGE 19

19 histidine with aspartate at position 63 (H63D). Althou gh the most common HFE mutation in HH is C282Y, H63D substitution is the most common HFE mutation overall. The prevalence of H63D homozygotes or compound heterozygotes (C282Y/H63D) is about 1:50 ( 52 54 ) ; however, this mutation has a much lower penetrance than C282Y mutation ( 55 57 ) Individuals with HFE associated hemochromatosis usually present with clinical symptoms in the fourth or fifth decade of life. Other mutations that contribute to hemochromatosis include those in genes encoding hemojuvelin ( HJV ) hepcidin ( HAMP ) transferrin receptor 2 ( TFR2 ) and ferroportin ( SlC40A1 ). Mutations in HFE, TFR2, HJV and HAMP result in dysregulation of hepcidin that leads to systemic iron overload ( 50 ) With these mutations, hepcidin level s are low due to a defect in HAMP itself or a regulato r of hepcidin. HJV and HAMP mutations cause accelerated iron loading and early onset organ disease, usually before the age of 30 ( 58 60 ) ; therefore, it is also called juvenile hemochromatosis. Mutation s in ferroprotin are inhe rited in an autosomal dominant fashion Some mutations, such as A77D and W158C, are either loss of function or result in impaired trafficking to the plasma membrane, and therefore, iron accumulates predomin antly in reticuloend othelial cells ( 61 62 ) With o ther mutations such as N144H and H507R, ferroportin appears to lose its ability to interact with hepcidin, thereby mimicking hepcidin deficiency, and le ad ing to hemochromatosis ( 62 64 ) Secondary Iron Overload Secondary iron overload results from blood transfusions, such as in the treatment thalasse mia ( 65 ) globin synthesis, resulting in deficient hemoglobin synthesis and anemia ( 66 ) Severe form s usually arise from hom ozygosity or compound heterozygosity and affected patients require blood

PAGE 20

20 transfusion s to survive ( 66 67 ) Blood transfusions increase body iron burden, leading to increased iron loading in tissues ( 68 ) As these patients are also anemic, they have increased iron absorption, which further contributes to iron loading ( 69 70 ) Phlebotomy and chelation therapies have been used in patients with hereditary hemochromatosis ( 71 ) Patients with secondary iron overload are treated with ch elation therapy to relieve iron overload caused by blood transfusions ( 72 ) However, b oth phlebotomy and chelation treatments have adverse side effects. Once the molecular mechanisms of iron uptake in tissues are further clarified, researchers wil l be able to target the responsible molecule(s) to develop new treatments that can help these patients. Divalent Metal ion Transporter 1 DMT1 was cloned from iron deficient rat duodenum in 1997 and is the first mammalian iron transporter identified ( 25 ) Functional studies using Xenopus oocytes revealed that it transports not only iron, but also other dival ent metals including Cd 2+ Co 2+ Mn 2+ and Ni 2+ ( 25 73 ) D mt 1 mRNA has four different isoforms differing in their that are derived from alternative splicing and alternative promoters A lternative splicing at the the IRE and non IRE forms. The IRE form of D mt 1 mRNA harbors an iron ted region (UTR) whereas the non IRE form does not ( 74 ) At the iants ( D mt 1 1A and D mt 1 1B ) derive from alternative promoter usage result ing exons ( 75 ) Regulation and ex pression of the se four isoforms appear s to be tissue specific ( 75 )

PAGE 21

21 DMT1 Mutation s in Rodents and Humans Rodents Mutations in Dmt1 have been identified in the microcytic anemia ( mk ) m ouse and the Belgrade ( b ) rat Both mutant animal models have severe hypochromic microcytic anemia due to a single nucleotide, glycine to arginine, substitution at amino acid codon 185 (G185R) of DMT1 that leads to impaired iron absorption and erythroid iron utilization ( 76 77 ) Functional analyses in HEK293T (Human Embryonic Kidney) cells trans fected with mutant constructs have established that the G185R mutation diminishe s transport activity by altering the function of DMT1, rather than affecting levels of protein expression ( 78 ) Studies in mk mice further demonstrated that although intestinal DMT1 exp ression was greatly induced, the mutation impaired i ts targeting to brush border membrane thus affecting iron absorption ( 79 ) Humans Mutation s in human D MT 1 have been repo rted in five unrelated cases. Most of DMT 1 mutations have been associated with hypochromic microcytic anemia and hepatic iron overload ( 80 83 ) The first case reported was a m issense mutation a G to C transition in exon 12 of the DMT1 gene (1285 G>C) that resulted in two consequences : (i) 90% of the transcripts have exon 12 deleted due to impaired splicing and (ii) t he remaining 10% contain ed exon 12 but had E399D substitution in the protein ( 84 ) Immunofluorescen ce analysis and functional analysis revealed that the E339D mutant did not affect its targeting, expression or transport activities ( 85 86 ) although one study suggested it may partially decrease transport ability ( 87 ) On t he other hand, the deletion of exon 12 impaired protein targeting to endosomes, decreased the

PAGE 22

22 expression of mature, complex glycosylated form of DMT1 and abolished its transport activities ( 86 87 ) Three cases of compound heterozygous mutations have been identified. The first case is a 3 bp deletio n in intron 4 result ing in abnormal splicing and a C>T transition in exon 13 (1246 C>T) resulting in R416C substitution ( 81 ) Th e 3 bp deletion caused 30 35% of the transcripts to have exon 5 deleted I mmunoblotting demonstrated that DMT1 protein levels in peripheral blood mononuclear cells (PBMCs) w ere decreased by 4 0% ( 81 ) Functional analysis of the stably express ed mutant protein revealed that the R416C substitution impaired DMT1 protein processing and transport activity ( 88 ) I mmunofluorescence analysis suggested that the R416C mutant was retained in the endoplasmic reticulum and barely localized in the recycling endosom e, consistent with its low cell surface expression ( 88 ) The second heterozygous compound mutation was a GTG deletion in exon 5 (c.428 30) result ing in the deletion of V114 and a G>T substitution in exon 8 result ing in Gly 212 to Val (G212V) substitution ( 82 ) The last case of compound heterozygous mutation was t he previously described G212V substitution and a novel N491S mutation ( 83 ) T hese mutants hav e not been functionally characterized except for the N491S substitution. S equencing of mRNA isolated from peripheral blood revealed that the N491S mutation resulted in different mRNA splicing that may contribute to aberrant cell trafficking and i mpaired tr ansport activity ( 83 ) The only homozygous case of human D MT 1 mutation was in exon 4 (311G>A) resulting in a G75R substitution. Similar to others this patient had microcytic anemia,

PAGE 23

23 moderate serum iron level s and elevate d transferrin saturation; however, no sign of liver iron overload was observed at the age of 7 ( 89 ) Function of DMT1 in Intestine and Erythroid C ells Studies using mk mice and the Belgrade rat have amply documented that erythroid precursors acquire iron through the transferrin transferrin receptor (T f TfR) pathway, in which TBI enters developing r ed blood cells through receptor mediated endocytosis of transferrin ( 90 93 ) and DMT1 transports iron out of the endosome and into the cytoplasm ( 77 94 ) ( Fig ure 1 1 ) Prior to trans port by DMT1 in the endosome Fe 3+ is reduced to Fe 2+ by six transmembrane epithelial antigen of the prostate 3 ( Steap3 ) ( 95 ) It wa s also shown that intestinal iron absorption in mk mice and b rat was impaired ( 96 97 ) Studies in D mt 1 knockout ( Dmt1 / ) mice have confirmed that DMT1 plays an essential role in iron acquisition by erythroid precursors and in intestinal iron absorption by the enterocyte ( 26 ) Regulation of DMT1 Intestine Anemia and erythropoiesis. DMT1 expression in the small intestine is responsive to both systemic and local signals of iron status. Iron deficie ncy anemia ( 25 98 99 ) and other conditions driving erythropoiesis, such as erythropoietin injected into rats ( 100 ) and phlebotomy in the treatment of HH patients ( 101 ) result in increased DMT1 expression at the mRNA and protein levels. Anemia caused by genetic mutations in mice, such as in mk and Trf hpx/hpx mice also results in elevated DMT1 protein levels in the intestine In mk mice, the G185R mutation causes improper targeting of the protein in the apical membrane ( 79 102 ) M ice with a mutation in hephaestin ( Heph ) are anemic due to impaired iron transport out of enterocyte, but DMT 1 protein expression is

PAGE 24

24 not upregulated because of iron retention in enterocyte, suggesting local signal s can modulate DMT 1 expression despite the need for erythropoiesis ( 103 ) Hepcidin and its modulators. Hepcidin, the hormone that plays an importan t role in regulating iron homeostasis ( 43 ) may also modulate DMT1 expression. In hepcidin deficient ( Usf2 / ) mice, in spite of systemic iron overload ( 104 ) DMT1 protein expression was induced in the intestine, probably because upregulation of ferroportin resulted in low iron level s in the enterocyte ( 105 ) Similarly, in human intestinal Caco 2 cells (epithelial colorectal adenocarcin oma), hepcidin treatment significantly decreased DMT1 protein expression ( 106 ) supporting the concept that DMT1 expression is regulated by local signals of iron status. Modulators that contr ol hepcidin expression (i.e. HFE, TfR 2, S MAD 4), also regulate DMT1 expression. Studies in Hfe Tfr2 knockout as well as Smad4 liver specific knockout mice showed increase DMT1 expression in the intestine ( 107 109 ) possibly through downregulation of hepcidin expression ( 108 112 ) Consistent with this finding, duodenal DMT1 expression is upregulated in patients with both HFE associated and non HFE as sociated hemochromatosis ( 113 114 ) However, a study in HH patients with the HFE mutation showed increase d intestinal D mt 1 mRNA expression as well as stronger DMT1 staining in the apical membrane of duodenal tissue but only when patients were treated by phlebotomy ( 101 ) Iron Regulatory Proteins (IRPs). It is well est ablished that when iron is scarce, IRPs bind to transferrin receptor 1 ( TfR 1 ) to stabilize the mRNA transcript resulting in increased Tf R 1 protein translation and cellular iron acquisition ( 115 117 ) Dmt 1 mRNA isoforms also contain an IRE in the

PAGE 25

25 is respo nsive to iron deficiency ( 25 74 75 118 ) A recent study by Galy et al ( 119 ) inv estigated the role of IRPs in vivo by deleting IRPs specifically in the intestine. The y found that inactivation of intestinal IRPs reduced DMT1 protein levels and resulted in abnormal duodenum development, nutrient malabsorption growth defect s, and lethal ity by 4 weeks of age ( 119 ) Hypoxia Inducible Factors (HIFs). HIFs are transcription factors that are stabilized by hypoxia They induce the expression of several genes invo lved in cell survival during low oxygen conditions ( 120 ) Studies of intestine specific and knockout mice suggest that H IF induces DMT1 expression by directly interacting with the Dmt 1 1A promoter ( 121 ) Ferritin H Ferritin H ( Fth ) is a subunit of ferritin that has ferroxidase activity. It is required for ferritin formation and was recently shown to regulate iron efflux from the enterocyte ( 122 ) Studies of intestine specific Fth knockout mice showed i ncreased hepcidin level s in res ponse to systemic iron overload, and therefore Dmt1 expression was decreased. Unexpectedly, intestinal ferroprotin levels were great ly induced and the mice displayed increased iron absorption resulting in greater hepatic iron loading ( 122 ) Liver The l iterature regarding hepatic DMT1 and its regulation is very limited and inconclusive DMT1 staining in rat liver was reported stronger in iron loaded animals but diminished in the iron deficient group, suggesting that hepatic DMT1 is regulated by iron ( 123 ) However, D mt 1 mRNA expression was reported increased in iron deficient liver in mice ( 124 ) Other confl icting observations have been reported in studies of the Hfe knockout ( Hfe / ) mice, a mouse model of hereditary hemochromatosis. A microarray study examining changes in duodenal and hepatic gene expression in Hfe / as well as

PAGE 26

26 wild type (WT) mice that were challenged with iron dextran injections reported that hepatic D mt 1 expression was unaffected by primary and secondary iron overload conditions ( 125 ) However, studies of primary hepatocytes isolated from Hfe / mice found higher Dmt 1 expression at the mRNA and protein levels ( 126 ) Post transcriptional regulation More recently, DMT1 was reported to interact with the Nedd4 family interac ting proteins ( Ndfips ) which recruits E3 ligases to promot e ubiquitination and degradation of target proteins ( 127 128 ) Overexpression of Ndfip1 and Ndfip2 in CHO (Chinese hamster ovary) cells inhibited DMT1 transport activity by ~35% ( 127 ) Studies of Ndfip1 knockout ( Ndfip / ) mice fed with iron deficient diet showed stronger duodenal DMT1 staining and increased transport activities ( 129 ) When Ndfip / mice were fed a standard diet, hepatic DMT1 protein levels w ere upregulated and primary hepatocytes isolated from Ndfip / mice s howed a ~70% increase in transport activity ( 127 ) taining showed iron deposition in the periportal region of Ndfip / livers, when compared with WT littermates ( 127 ) ZIP 8 ZIP14 and the Possible Relation to Iron Homeostasis A second research direction that I pursued involved studying the metal ion transporter ZIP8. The name of the ZIP superfamily stands for Z rt (zinc regulated transporter ), I rt like (iron regulated transporter like) p roteins. The ZIP superfamily is an important group of metal ion transporters that import substrates across cellular membranes into the cytoplasm ( 131 ) Of the fourteen ZIP proteins encoded by human and mouse genome s ZIP8 and ZIP14 are the most closely related : t hey are similar in Reprinted with permission from 130. Jenkitkasemwong S, Wang CY, Mackenzie B, Knutson MD. Physiologic implications of metal ion transport by ZIP14 and ZIP8. Biometals 2012.

PAGE 27

27 length (462 vs. 489 amino acids); have ~50% amino acids identical; and each contains N linked glycos ylation sites in the N terminal region ( Fig ure 1 2 ) The similarity between the two proteins is notably evident in the putative transmembrane domains. The highly conserved transmembrane domains IV and V with their metal binding histidine and glutamic residues, have been proposed to comprise part of an ion channel ( 132 ) ZIP14 and Iron Homeostasis The ability of ZIP1 4 to transport zinc was established by transfection of ZIP14 cDNA in CHO and K562 (human erythroleukemia) cells which resulted in accumulation of intracellular zinc ( 133 134 ) S ubsequently it was found that overexpression of ZIP14 in HEK293H and Sf9 insect cells not only increased intracellular accumulation of zinc, but also NTBI, suggesting a role for ZIP14 in iron uptake ( 135 ) Moreover, th e NTBI uptake activities decreased when Zip 14 mRNA was suppresse d by siRNA in AML12 mouse hepatocyte cells ( 135 ) suggesting that ZIP14 play s a role in mediating hepatic iron uptake. This finding was of particular importance because only one other mammalian iron import protein, DMT1, was known. Similar to DMT1 being a broad scope metal ion transporter ZIP14 transports not only zinc and iron but also o ther divalent metals such as Cd 2+ and Mn 2+ in the Xenopus laevis oocyte heterologous expression system ( 136 ) Functional studies in both Z ip 14 RNA injected oocyte s and HEK 293T cells expressing ZIP14 suggested that ZIP14 mediated iron transpo rt is at both pH 7.5 and 6.5 but not at pH 5.5 ( 136 137 ) in contrast to DMT1 with optimal fu nction at pH 5.5 ( 25 ) C onsistent with the finding that ZIP14 fun ctions at pH 6.5, transfection of ZIP14 cDNA i n to HEK 293T cells promote d iron assimilation from transferrin ( 137 ) further supporting the role of ZIP14 in hepatic iron uptake.

PAGE 28

28 Studies examining the tissue distribution of ZIP14 showed that it is most abundan t in the liver, panc reas and heart ( 130 ) wh ereas DMT1 is abundantly expressed in kidney, brain and thymus ( 25 ) Compar ing th e transcript abundance of DMT1 and ZIP14 by measuring copy number in HepG2 (human hepatocellular carcinoma) cells, it was show n that ZIP14 abundance is 10 times higher than that of DMT1 ( 137 ) The differ en ce in pH dependence and tissue distribution of DMT1 and ZIP14 suggest they may function in different tissues and/or different subcellular compartments Metal Transport Capability of ZIP8 Z IP8 was first identified from monocyte s that w ere induced during innate immune activation and overexpression of ZIP8 in CHO cells increased intracellular zinc accumulation ( 138 ) Subsequently, o ver expression of ZIP8 in mouse fetal fibroblast s stimulated the accumulation of cadmium and manganese ( 139 140 ) suggesting ZIP8 may be also a bro ad scope metal ion transporter. Regulation of ZIP8 A previous study exam ined the expression of all ZIP proteins in rat liver and found that Zip 8 mRNA expression was unaffected by iron deficiency or iron overload ( 141 ) Interestingly, in a microarray analysis of iron deficient rat duodenum, Z ip 8 was found to be down regulated by iron deficiency ( 142 ) Inflammation is known to affect iron and zinc metabolism. Studies showed that ZIP8 mRNA expression was down regulated in the liver of mice given lipopolysaccharide ( LPS ) ( 143 ) but unaffected in pulmonary artery endothelial cells ( 144 ) Other studies reported that Z ip8 mRNA was upregulated by LPS and TNF in human monocytes ( 138 ) and by the activation of human T cells ( 145 )

PAGE 29

29 Tissue and Subc ellular Distribution of ZIP8 The majori ty of studies examining tissue distribution of ZIP8 reported that Zip8 is most abundantly expressed in lung, followed by testis, kidney and liver ( 139 146 147 ) however ; there were only 6 tissues examined in these studies In a stu dy where 16 tissues were compared, ZIP8 is most a bundantly expressed in pancreas followed by placenta, lung and liver ( 138 ) A nu mber of studies investigated cellular localization of ZIP8 by overexpressing epitope tagged ZIP8 in cell lines and detected it localize d to the plasma membran e, consistent with its proposed role of transporti ng metal s from the extracellular space into cytoplasm ( 139 140 148 149 ) In addition to the plasma membrane, ZIP8 has also been detected in the cytosol ( 148 ) lysosomes ( 145 ) and mitochondria ( 148 ) although the significance remains unclear. ZIP8 and Diseases A single nucleotide polymorphism (SNP) in the ZIP8 gene was reported to be associated with body mass index/obesity ( 150 ) the risk of coronary artery disease ( 151 ) and schizophrenia ( 152 ) The SNP rs131073 25 at the ZIP8 locus locates in exon 8 and results in A391T substitution that is associated with lower circulating levels of HDL cholesterol ( 151 ) The authors concluded that ZIP8 may be associated with HDL cholesterol through inflammation. With respect to schizophrenia, the SNP at ZIP8 is thought to affe ct Zn/Mg homeostasis in the brain, possibly by disrupting the blood brain barrier which results in high metal concentrations loading to neurotoxicity ( 152 ) Consistent with ZIP8 being regulated by inflammation, it has been associate d with human immunodeficiency virus (HIV) infection ( 153 ) and sepsis ( 15 4 ) ZIP8 mRNA expression as well as intracellular zinc levels were found to be increased in monocytes from HIV infected subjec ts ( 153 ) Studies of zinc chelator TPEN treated monocytes

PAGE 30

30 revealed that high zinc level retained the resistance of apoptosis suggesting that ZIP8 contributes to the survival of monocytes from HIV infected subjects therefore affecting disease activity ( 153 ) With respect to sepsis, ZIP8 mRNA was also found to increase in monocytes from septic subjects while the levels of plasma zinc were decreased, which correlated with increased severity of the disease ( 154 ) In summary, the research described herein tested the hypothesis that DMT1 plays a role in hepatic iron uptake and ac cumulation. Studies were also undertaken to characterize an other mammalian iron import protein, ZIP8, as a first step to investigate novel iron transport mechanisms.

PAGE 31

31 Fig ure 1 1. Model of DMT 1 function in iron acquisition by erythroid precursors. The binding of holo transferrin (Holo T f ) and TfR1 induces endocytosis of the T f TfR1 complex. In the early endosome, acidification causes T f to release ferric ion (Fe 3+ ) which is reduced to Fe 2 + by Steap3 prior to transport into cytosol via DMT1. The Tf TfR1complex recycles to the pla sma membrane where apo Tf dissociates from TfR1.

PAGE 32

32 Fig ure 1 2 Similarity of ZIP14 and ZIP8 proteins. A) Simplified dendrogram showing relationships of the ZIP family proteins. B) Amino acid sequences for mZIP14 (NP_001128623.1) and m ZIP8 (NP_001128621.1) were obtained from GenBank and aligned by using Vector NTI. Yellow shading indicates identical amino acids and green shading i ndicates conservative substitutions. Putative transmembrane (TM) domains, indicated by Roman numerals, were predicted by using MEMSAT SVM. The histidine rich repeat region (HXHXHXHX) between TM domains III and IV, the metalloprotease motif (HEXXH) in TM do mains V, and the N linked glycosylation sites a re also indicated. A B

PAGE 33

33 CHAPTER 2 MATERIALS AND METHOD S Animal C are and G enotyping All animal protocols were approved by the Institutional Animal Care and U se Committee at the University of Florida. Hfe / ( 155 ) D mt 1 flox/flox and D mt 1 liv/liv ( 26 ) mice were on the 129S6/SvEvTac background. Hypotransferrinemic ( Trf hpx/hpx ) mice were on BALB/cJ background ( 156 ) All mice were weaned at three weeks of age, maintained on a standard diet containing 240 ppm iron (Teklad 7912, Harlan Laboratories) and housed in a 12 h light dark cycle. Mice were genotyped at weaning by extracting genomic DNA from snipped tail samples (DNeasy Blood & Tissue kit; Qiagen ) and subjecting it to PCR analysis To identify Dmt1 flox/flox mice, I ATGGGCGAGTTAGAGGCTTT CCTGCATGTCAGAACCAATG ( 26 ) Cre TTACCGGTCGATGCAACGAGT TTCCATGAGTGAACGAACCTGG ) were used to detect integration of the Cre gene into the mouse genome and to identify Dmt1 liv/liv mice. TTCTCTTGGGACAATCTGGG ( 26 ) were used to confirm Cre mediated excision in the liver. Trf hpx/hpx mice we re identified at birth by their pallor and small size, and for survival, were injected intraperitoneally with human apo transferrin (EMD Chemicals), 0.1 mL of a 6 mg/mL solution at 4 days of age, 0.2 mL in the second week and 0. 3 mL weekly until 14 weeks of age Dmt1 flox/flox and Dmt1 liv/liv mice were crossed with Hfe / and Trf hpx/hpx mice to produce double mutant strains along with single mutant strains on the same genetic background.

PAGE 34

34 Measurement of mRNA L evels Total RNA was extracted from flash frozen tissue by using RNAzol RT solution (Molecular Research Center, Inc.). Transcript abundance of D mt 1 (all isoforms) was determined by using quantitative RT PCR with TCCTCATCACCATCGCAGACACTT exon 7 TCCAAACGTGAGGGCCATGATAGT of the murine Dmt1 gene ( 75 ) Ribosomal protein L13a ( Rpl 13a ) was quantified as an internal control by using forward GCAAGTTCACA GAGGTCCTCAA GGCATGAGGCAAACAGT CTTTA Transcript copy numbers of Z IP 8 Z IP 14 and D MT 1 mRNA in human RNA (Human Total RNA Master Panel II, Clontech) were determined by using quantitative RT PCR and standard curves generated from plasmids pCMV Sport6 human ZIP8 (BC012125; Open Biosystems), pCMV XL4 human ZIP14 ( BC015770 ; Open Biosystems) and p BluescriptR human DMT1 (BC100014; Open Biosystems) Crude M embrane and Tissue H omogenate P reparation Liver crude membrane fraction was use d to measure DMT1, TfR1 and TfR2 To isolate membranes, liver samples were homogenized by a D ounce homogenizer in ice cold H EM buffer (20 mM HEPES, 1 mM EDTA, 200 mM mannitol, pH 7.4) containing 1X complete mini protease inhibitor cocktail ( R oche) The homogenate was centrifuged at 10,000 x g for 10 min at 4 C to pellet insoluble cell debris. The supernatant was centrifuged at 100,000 x g for 30 min at 4 C and the membrane pellet was then resuspended in H EM buffer. To measure Z IP 14 tissues were homogenized in ice cold RIPA lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% IGEPAL CA 630 ( S igma Aldrich ), 0.5% Na deoxycholate, 0.1% SDS) containing protease inhibitor s

PAGE 35

35 Homogenates were centrifuged at 10,000 x g for 10 min at 4 C to pellet and remove insoluble cell debris. Total protein concentration was determined colorimetrically by using the RC DC protein assay (Bio Rad). Western B lot A nalysis Proteins were mixed with Laemmli buffer and eletrophoretically separated on a 7.5% SDS polyacrylamide gel. Before loading into the gel, samples analyzed for Tf R 1 and Tf R 2 were heated at 95 C for 5 min. For DMT1 and ZIP8, samples were incubated at 37 C for 30 min. For ZIP14, samples were not heated prior to electrophoresis. The s eparated proteins were transfe rred to nitrocellulose membrane s (Schleicher and Schuell) and incubated for 1 h in blocking buffer (5% nonfat dry milk in Tris buffered saline with 0.1 % Tween 20, TBST). Blots were then incubated overnight at 4 C in blocking buffer containing anti DMT1 antiserum (1:2000 ; courtesy of Dr. Philippe Gros, McGill University, Montreal, Canada ), mouse anti Tf R 1 (1: 4 000, Invitrogen) rabbit anti TfR 2 (1:2500, Santa Cruz), 1 g/mL affinity purified rabbit anti Z IP 14 or 2 g/mL affinity purified rabbit anti Z IP8 After washing blots in TBST, blots were incubated 40 min with species specific horseradish peroxidase conjugated secondary antibodies. Immunoreactivity was visualized by using enhanced chemiluminescence (SuperSignal West Pico, Pierce) and X ray film or t he FluorChem E digital darkroom (ProteinSimple). For loading control blots were stripped and reprobed with mouse anti Na + /K + ATPase (1:1 0 000, Santa Cruz) rabbit anti scavenger receptor class B type I, SR B1, (1:5000; Novus Biologicals), rabbit anti cop per chaperone for superoxide dismutase, CCS (1:5000; Santa Cruz Biotechnology) or mouse anti tubulin (1:10,000; S igma Aldrich ) and processed as described above

PAGE 36

36 Iron S tatus P arameters, Liver M ineral C oncentr ations and Histological A nalysis Hemoglobin was measured in heparinized blood by using a HemoCue 201+ hemoglobin analyzer (HemoCue). Plasma was obtained by centrifugation of heparinized blood at 2,000 x g at 4 C for 10 min. Plasma iron and total iron binding capacity (TIBC) were determin ed as described previously ( 157 ) Transferrin saturation was calculated as plasma iron/TIBC x100. Tissue non heme iron concentrations were determined by using the method of Torranc e and Bothwell (1968). Briefly, 0.05 g of tissue w as incubated in 1 mL acid solution (3M HCl and 10% trichloroacetic acid) least 20 h. Chromogen reagent ( 0.1 % bathophenanthroline sulfphonate and 1% thioglycolic acid) was added and tissue non heme iron was determined colorimetrically at absorbance 535 nm. Hepatic co ncentrations of total iron (non heme and heme), zinc, copper, manganese, and cobalt were measured by using inductively coupled plasma mass spectrometry (ICP MS). For histological anal ysis, livers fixed in 10% neutral buffered formalin for 20 h were subjected to routine histologic processing S ections stain. Measurement of TBI and NTBI U ptake For TBI uptake D mt 1 liv/liv and D mt 1 flox/flox mice were injected with 150 g of 59 Fe transferrin (2 Ci) intravenously. For NTBI citrate to transiently saturate plasma transferrin. After 10 min, 59 Fe labeled fer ric citrate (2 Ci) was administered intravenously. M ice were sa crificed 2 h after 59 Fe w as administered and whole body counts per minute (cpm) were measured by using Perkin Elmer Wizard gamma counter. Tissues were harvested and cpm was determined for each organ to calculate percentage TBI or NTBI uptake.

PAGE 37

37 Cell C ulture HEK 293T (human embryonic kidney) and H4IIE (rat hepatoma) cells were and BeWo (human choriocarcinoma) cells were maintained in F 12K medium with L glutamine (ATCC). All media were supplemented with 10% (v/v) fetal bovine serum (FBS; At lanta Biologicals), 100 units/mL penicillin and 100 g/m L streptomycin Cells were maintained at 37 C in 5% CO 2 Immunoprecipitation H4IIE total cell lysates were pre cleared with 50 L EZview Red Protein A Affinity Gel ( S igma Aldrich ) for 1 h at 4 C to minimize non specific binding. Z IP 8 or non relevant antibody (CCS) was gently mixed with the affinity gel for 3 h at 4 C. Lysates were then added into bead antibody mixtures and incubate d at 4 C overnight. To elute samples, 2X L aemmli buf fer and 5% 2 mercaptoethanol were added and samples were boiled for 10 min. Measurement of I ron and Z inc U ptake HEK 293T cells were transiently transfected with rZ IP 8 (GenBank accession number BC089844) or empty vector pExpress 1 (Open Biosystems ) for 48 h (Fugene HD, Roche). Prior to uptake, cel ls were washed twice with serum free medium (SFM) and incubated for 1 h in SFM containing 2% BSA to deplete cells o f transferrin and to block nonspecific binding at 37 C in 5% CO 2 For uptake, cells were incubated with 2 M 59 Fe ferric citrate in SFM in the presence of 1 mM ascorbate for 2 h at 37 C with or without a 10 fold molar excess of zinc, followed by three washes with an iron chelator solution (1 mM bathophenanthroline sulfonate and 1 mM diethylenetriaminepentaacetic acid ) to remove surface bound iron. Cells were lysed in buffer containing 0.2 N NaOH

PAGE 38

38 and 0.2% SDS. Radioactivity was de termined by gamma counting and protein concentration was determined colorimetrically by using the RC DC protein assay (Bio R ad). Measur ement of pH D ependence of Z IP 8 mediated I ron T ransport A ctivity The pH dependent iron transport activity was determined a s previously described ( 137 ) Briefly, the uptake buffer (130 mM NaCl, 10 mM KCl, 1 mM CaCl 2 and 1 mM MgSO 4 ) was adjusted to pH 7.5, 6.5, and 5.5 by using 20 mM Hepes or MES buffers ( 158 ) Cells transiently transfect ed for 48 h with mZ IP 8 (GenBank accession number BC006731) or empty vector pCMVSport6 were washed tw ice with SFM and incubated for 1 h in SFM containing 2% BSA at 37 C in 5% CO 2 For uptake, cells were incubated with 2 M 59 Fe ferric citrate in uptake bu ffer in the presence of 1 mM ascorbic acid at 37 C for 60 min. Iron L oading and C ell S urface B iotiny lation To load cells with iron, H4IIE cells were treated with 100 or 250 M ferric nitrilotriacetic acid (NTA) for 72 h. Cell surface proteins were isolated by using the Pierce Cell Surface Protein Isolation kit according to the man (Thermo Scientific ). Briefly, H4IIE cells were exposed to EZ Link Sulfo NHS SS Biotin to biotinylate cell surface protein s, which were subsequently affinity purified by using NeutrAvidin Agarose resin. B ound proteins were released by incubating with SDS P AGE buffer containing 50 mM DTT. Assessment of N linked G lycosylation To inhibit N glycosylation of endogenous Z IP 8, H4IIE cells were incubated with 2 N linked glycans, samples were i ncubated with denaturing buffer containing 1% 2 mercaptoethanol and 0.5% SDS for 30 min at 37 C

PAGE 39

39 and then digested with Peptide: N Glycosidase F ( PNGase F ) (50,000 unit/mL of 37 C Su ppression of ZIP8 E xpression in BeWo C ells BeWo cells were reverse transfected with 50 nM siRNA targeting ZIP8 mRNA (FlexiTube siRNA, Qiagen) or AllStars Negative Control siRNA (Qiagen) by using Lipofectamin e RNAiMax (Invitrogen). After 72 h, cells were ly sed in RIPA buffer and analyzed by Western blotting. For primary antibody, rabbit anti human SLC39A8, Prestige antibody (S igma Aldr ich) was used at 1:5000 Statistical A nalysis Data are presented as means standard error (SE). Group means were t test. When more than two group means were compared, data were analyzed by one hoc test. A P value < 0.05 was considered statistically significant. Analyses were performed by using Prism (version 5; GraphPad) software.

PAGE 40

40 CHAPTER 3 EFFECT OF HEPATOCYTE SPECIFIC INACTIVATIO N OF DIVALENT METAL ION TRANSPORTER 1 (DMT1) ON IRON HOM EOSTASIS Introduction Iron overload is a serious consequence in patients with here ditary hemochromatosis and in patients with bone marrow defects who undergo blood transfusions. Accumulation of iron can lead to irreversible tissue damage, fibrosis and organ failure due to the formation of damaging oxygen radicals catalyzed by free iron ( 13 49 ) As the main tissues affected are the liver, heart, and pancreas t issue iron overload is associated wi th various disorders, including liver cirrhosis, cardiomyopathy, and diabetes ( 13 50 ) There are two forms of iron in blood plasma: TBI and NTBI. U nder normal conditions, >95% of plasma iron is bound to transferrin. However, during iron overload, the amount of iron in plasma can exceed the carry ing capacity of transferrin, giving rise to NTBI, which is bound to small ligands, mainly by citrate ( 126 159 160 ) In iron overload, both transferrin saturation and NTBI levels are high. After iron is absorbed in the intestine, it is tr ansported to the liver the main excess iron storage organ. However, t he mechanisms involved in hepatic iron uptake and accumulation are not fully understood. DMT1 is the first mammalian iron transporter identifie d. It is a proton coupled metal ion transp orter that transports not only iron, but also other cation metals, such as Cd 2+ Co 2+ Mn 2+ and Ni 2+ ( 25 73 ) Studies have conclusively demonstrated that DMT1 is the major iron transporter in the apical membrane of epithelial cells a nd is essential Reprinted with permission from Wang CY, Knutson MD. Hepatocyte divalent metal ion transporter 1 is dispensable for hepatic iron accu mulation and non transferrin bound iron uptake in mice. Submi t t ed to Hepatology.

PAGE 41

41 for iron utilization in erythroid precursors, where TBI enter s the cell through receptor mediated endocytosis of transferrin and DMT1 transports iron out of the endosome and into the cytoplasm ( 26 77 ) As DMT1 is present in the liver ( 25 ) it is possible that hepatocyte DMT1 releases iron from endosomes in the transferrin cycle. Hepatocytes can also acquire iron from NTBI ( 126 ) A previous study showed that o verexpression of DMT1 GFP in human hepatoma ( HLF ) cells increase d ferrous ir on uptake, indicating that DMT1 in hepatocytes may play a role in NTBI uptake ( 161 ) The role of DMT1 in hepatocytes has also been implicated in vivo Studies have shown that DMT1 s taining in rat liver was stronger in iron loaded animals and diminished in an iron deficient group ( 123 ) and that NTBI uptake along with DMT1 protein levels was increased in primary hepatocytes from Hfe / mice ( 126 ) These data suggest that DMT1 may play a role in hepatic iron uptake. In contrast elevated hepatic iron levels was observed in Dmt1 / neonates and in Belgrade rat s consuming a high iron diet suggesting that DMT1 is dispensable for iron uptake by the liver ( 30 162 ) However, this observation was confounded by the fact that Dmt1 / mice had severe anemia and prominent extramedullary erythropoiesis ( 26 ) Belgrade rat s were also anemic and had elevated levels of serum iron and transferrin saturation when fed a high iron diet ( 162 ) When iron dextran was injected into Dmt 1 / n eonates iron accumulated in hepatocytes as well as macrophages ( 26 ) Although these data indicate that at least one non DMT1 involved pathwa y exists in hepatocyte s it is unclear how relevant these data are to usual pathways of hepatic iron uptake and accumulation. Nonetheless, it has been widely accepted that DMT1 plays a role in NTBI uptake in the liver ( 83 129 163 170 ) In this chapter, I used a conditional knockout mouse model in which DMT1 was inactivated

PAGE 42

42 speci fically in hepatocytes ( Dmt 1 liv/liv ). I also crosse d Dmt 1 liv/liv with two genetically modified iron overload mouse models, Hfe / and Trf h px /hpx mice to evaluate if DMT1 plays a role in liver iron accumulation during iron overload conditions. Hfe / mice are an animal model of hereditary hemochromatosis ( 171 ) In Hfe / mice, iron absorption is increased due to abnormally low levels of hepcidin, the iron regulato ry hormone that blocks iron export from cells to the circulation ( 45 110 ) As a result, levels of plasma iron and transferrin saturation are high and ir on progressively deposits in the liver ( 155 171 ) Trf hpx/hpx mice have virtually no transferrin (less than 1% of normal) ( 172 ) Without transferrin, iron cannot be delivered to bone marrow. Therefore Trf hpx/hpx mice are severely anemic, have in crea sed iron absorption, and iron is massively loaded into tissues including liver, heart, kidney, pancreas and adrenal gland ( 156 ) Lastly, 59 Fe labeled ferric citrate or 59 Fe labeled transferrin were injected into mice through the tail vein and the uptake of hepatic 59 Fe was compared between D mt 1 liv/liv and D mt 1 flox/flox controls Results Inactivation of DMT1 S pecifically in the L iver To investigate the role of DMT1 in hepatic iron uptake, mice harboring loxP recombina tion sites flanking exon 6 to 8 of the D mt 1 gene ( DMT 1 flox/flox ) ( 26 ) were crossed with mice carrying a n Alb cre transgene, which allow s for Cre expression under the control of the liver specific albumin promoter and inactivate s DMT1 specifically in the hepatocyte ( 173 ) I confirmed the excision by PCR using F 1, R1, and R2 primers assuring the spe cificity of recombination in liver (Fig ure 3 1A,B). Quantitative RT PCR analysis demonstrated that D mt 1 mRNA levels were lower in the liver by > 90% in D mt 1 liv/liv than in D mt 1 flox/flox mice D mt 1 mRNA leve ls in heart and kidney were also

PAGE 43

43 measured to ensure th at expression in extrahepatic tissue w as not affected (Fig ure 3 1C) Western blot analysis of liver lysates detected a DMT1 immunoreactive band at ~70 kDa in D mt 1 flox/flox but not in D mt 1 liv/liv mice, confirming DMT1 inactivation in the liver (Fig ure 3 1D). I ron status parameters were compared between D mt 1 flox/flox and D mt 1 liv/liv mice. Hemoglobin, plasma iron level, transferrin saturation and levels of hepatic total iron and nonheme iron were similar i n D mt 1 flox/flox and D mt 1 liv/liv mice (Table 3 1) Body weight, liver weight or ratio of liver/body weight also did not differ between groups. To ensure the age groups selected in this study had efficient Cre Lox recombination hepatic Dmt 1 mRNA levels of D mt 1 liv/liv mice were analyzed by qRT PCR up to 16 weeks old and this confirmed a > 80% inactivation at all age groups ( Fig ure 3 2 ). Liver specific I nactivation of Dmt1 in H f e / or Trf hpx/hpx M ice does not affect H epatic I ron L oading or B ody I ron S tatus To determine if DMT1 plays a role in hepatic iron accumulation, D mt 1 liv/liv mice were crossed with Hfe / and Trf hpx/hpx mice to generate Hfe / ; Dmt 1 liv/liv and Trf hpx/hpx ; Dmt 1 liv/liv mice along with their respective controls ( Hfe / ;Dmt1 flox/flox and Trf hpx/hpx ;Dmt1 flox/flox ) mice. Hepatic Dmt1 mRNA levels in double mutant Dmt1 liv/liv mice were >90% lower than in the Dmt1 flox/flox controls (data not shown) thus confirming inactivation of Dmt1 in these strains. Hfe / ;D mt 1 flox/flox mice had increased plasma iron level, higher transferrin saturation (Fig ure 3 3 A,B) and the h epatic nonheme iron level was 3 fold higher than that of D mt 1 flox/flox mice (Figure 3 3 C) I nactivation of Dmt1 specifically in hepatocytes however, did not affect these p arameters in Hfe / mice Similarly, Trf hpx/hpx mice had lower levels of hemoglobin and plasma iron (Fig ure 3 4 A,B) and hepatic nonheme iron

PAGE 44

44 level of Trf hpx/hpx ;D mt 1 flox/flox mice was 11 times higher than that of D mt 1 flox/flox mice H owever, none of these parameters were different between Trf hpx/hpx ;D mt 1 liv / liv and Trf hpx/hpx ;D mt 1 flox/flox mice To exclude the possibility that iron is not loaded in hepatocyte s but in Ku pffer cells in the liver, I performed histological analysis to stain ferric iron by using sian blue stain I found that under normal condition s hepatic iron is only detectable in Kupffer cells and that i n iron overload conditions (with Hfe or Trf mutation), inactivation of DMT1 did not prevent iron loading into hepatocyte s (Fig ure 3 3 D; Fig ure 3 4 D). Hepatic concentrations of total iron (nonheme and heme), zinc, copper, manganese, and cobalt were also compared between Dmt1 flox/flox and Dmt1 liv/liv mice as single or double mutants by using ICP MS (Table 3 2 ) I f ound o nly copper showed ~37% lower levels in Hfe / ;D mt 1 liv/liv compared to Hfe / ;D mt 1 flox/flox controls The concentrations of other metals measured were unaffected in Dmt1 liv/liv as single mutants or as double mutants intercrossed with Hfe / or Trf hpx/ hpx mice compared with their respective controls. Effect of Liver specific I nactivation of Dmt1 on NTBI and TBI Uptake by the L iver To determine if DMT1 is required for NTBI and TBI uptake by the liver, 5 9 Fe labeled NTBI or TBI was injected into D mt 1 liv/liv mice intravenously and 59 Fe uptak e by the liver was measured The l iver took up the most NTBI among tissues measured (~60%) followed by kidney (10%), pancreas (5%) and heart (1%). There was no difference in hepatic NTBI uptake in Dmt 1 liv/liv mice compared with D mt 1 flox/flox animals (Fig ure 3 5 A) Similarly, when 59 Fe labeled transferrin was injected into mice, the liver took up ~25% of whole body counts, followed by ~4% kidney, < 1% in heart and pancreas. TBI uptake in D mt 1 liv/liv mice was reduced by 40% in the liver (Fig ure 3 5 B).

PAGE 45

45 Tf R 1 Tf R 2 and ZIP14 ( receptor s or transporter s that may partic ipate in hepatic iron uptake ) were analyzed by Western blotting. The levels of these proteins did not differ between D mt 1 flox/flox and D mt 1 liv/liv mice (Fig ure 3 6 ). Discussion The l iver is the main organ that store s excess iron; however, the molecular mechanism s of how liver takes up iron under physiologic or pathologic conditions, is not fully elucidated. DMT1 is the first mammalian iron transporter identi fied ( 25 ) The importance of DMT1 has been well characterized in enterocytes and developing red blood cells ( 26 77 94 ) Studies have suggested that DMT1 may play a role in hepatic iron uptake ( 123 126 161 ) although it may not be the sole iron transporter/pathway by which the liver acquires iron ( 26 163 ) I used a mouse model that had Dmt1 inactivated specifically in hepatocytes, the major cell type in the liver, to investigate the role of DMT1 in hepatic iron uptak e My results show that total and non heme iron levels do not differ between Dmt1 liv/liv and Dmt1 flox/flox controls, indicating that DMT1 is dispensable for the overall iron economy of the liver. Moreover, h epatic non heme iron levels did not differ between Hfe / ;Dmt1 liv/liv and Hfe / ;Dmt1 flox/flox mice or between Trf hpx/hpx ;D mt 1 liv / liv and Trf hpx/hpx ;D mt 1 flox/flox mice indicating that DMT1 is not required for hepatic iron overload characteristic of hemochromatosis or hypotransferrinemia. Plasma iron, total iron binding capacity, transferrin saturation, and hemoglobin levels also did not differ between single or double mutant Dmt1 liv/liv mice suggesting that systemic iron metabolism was not affected. Similar to HFE related hemochromatosis patients, Hfe / mice deposit the excess iron starting with periportal hepatocytes ( 171 ) and have elevated NTBI in the plasma ( 126 ) I found a similar pattern of iron deposition in the livers of Hfe / ;Dmt1 liv/liv mice,

PAGE 46

46 indicating DMT1 is not required for hepatocyte iron accumulation in this animal model. Plasma NTBI is believed to be the major contributor to hepatic iron accumulation because of its elevated levels during iron overload conditions and rapid clearance by hepatocytes ( 126 168 ) Therefore, hepatic nonheme levels did not differ between Hfe / ;Dmt1 liv/liv and Hfe / ;Dmt 1 flox/flox mice also suggests that hepatocyte DMT1 is not required for NTBI uptake This likelihood is strongly supported by the observation that hepatic iron deposition was not affected in Trf hpx/hpx ;Dmt1 liv/liv mice compared to controls because Trf hpx/hp x mice have no plasma transferrin ( 156 ) therefore most iron in the plasma is NTBI. I formally examined the role of hepatocyte DMT1 in NTBI clearance by injecting 59 Fe labeled ferric citrate, the physiological form of NTBI in iron overload patients into Dmt1 liv/liv mice. I found that without hepatocyte DMT1, the liver still takes up NTBI efficiently. Similarly, previous studies of iron loaded mice showed ~50% of NTBI uptake into the liver and ~3 % to pancreas ( 172 ) and that the rank order of NTBI uptake in Trf hpx/hpx mice was liver > kidney > pancreas > heart ( 174 ) In c ontrast, hepatic 59 Fe labeled TBI uptake was 40% lower in D mt 1 liv/liv mice while other players that have been implicated in hepatic iron transport, such as Tf R 1, Tf R 2 and ZIP14 were not upregulated, indicating that DMT1 is partially required for TBI uptake. Conversely, t he fact that TBI uptake wa s on ly 40% lower in D mt 1 liv/liv mice also indicated that there are other transp orter ( s ) that can compensate for the loss of DMT1. One such possible transporter is Z IP 14. A previous study s howed that overexpression of Z IP 14 in HEK 293T cells increased TBI uptake, whereas H epG2 cell s treated with Z IP 14 siRNA showed nearly a 40% decrease in TBI uptake ( 137 ) Although Z IP 14

PAGE 47

47 protein levels were not upregulated in D mt 1 liv/liv mice, it is still a good candidate to compensate for the loss of DMT1 because its expression is 10 times higher than D mt 1 in HepG2 cells and it mediates iron transport at pH 6.5 ( 137 ) More recently, Z IP 8 was also sh own to be an iron transporte r that transports NTBI in HEK 293T cells and in Xenopus oocytes ( 175 ) Moreover, Z IP 8 hypomorphic mice (which express 90% less ZIP8 than normal) had 50% lower hepatic iron levels at birth suggesting that Z IP 8 may play a role in hepatic iron transport or in maternofetal iron transfer ( 176 ) In conclusion, t he se data indicate that hepatocyte DMT1 is not required for hepatic iron accumulation during n ormal and overload conditions or for NTBI uptake, but is partially required for efficient iron assimilation from transferrin. Further studies including those using Z ip 14 and/or Z ip 8 knockout mice are thus warranted to examine other possible pathways of hepatic iron uptake

PAGE 48

48 Figure 3 1. Disruption of D mt 1 in the liver. A) Schematic depictions of the LoxP flanked allele and conditional knockout alleles. F1, R1, and R2 indicate primers used for PCR genotyping. B) PCR analysis of genomic DNA extracted from tissues of mice at 8 weeks of age. C) Relative Dmt 1 mRNA expression in liver, heart, and kidney by usi ng quantitative RT PCR with R pl 13a as an internal control gene Values represent mean SE, n =3 4 *** P <0.001. D) Western blot analysis of DMT1 in crude membrane isolated from livers of D mt 1 flox/flox and D mt 1 liv/liv mice. All analyses were performed on samples from 8 week old mice. A 5 6 7 8 5 9 9 F1 R1 R2 F1 Floxed allele Cre mediated excision 100238637 100234237 B C D 75 50 D mt 1 flox/flox Na + /K + ATPase DMT1 D mt 1 liv/liv

PAGE 49

49 Fig ure 3 2 Relative Dmt1 mRNA levels in livers of Dmt1 liv/liv mice at various ages by using q uant itative with Rpl13a as an internal control gene. Transcript levels are expressed as a percent of levels in Dmt1 flox/flox control livers. Values represent mean SE, n=3 7.

PAGE 50

50 Fig ure 3 3 Plasma iron levels, transferrin saturation and hepatic iron accumulation are not affected by liver specific inactivation of Dmt1 in Hfe / mice A ) Pla sma iron concentration and B ) t ransferrin saturation were determined by using standard methods. C ) Liver nonheme iron levels were determined colorim etrically after acid digestion of tissues. Values represent mean SE, n=6. Means without a common superscript differ significantly ( P < 0.05). D) Histological examination of iron loading in the liver by using blue staining All analyses we re performed on samples from 16 week old mice. A B C D Hfe / ;Dmt 1 flox/flox Dmt 1 flox/flox Dmt 1 liv/liv Hfe / ;Dmt 1 liv/liv

PAGE 51

51 Fig ure 3 4 Plasma iron, hemoglobin levels and hepatic i ron accumulation are not affected by liver specific inactivation of Dmt1 in hypotransferrinemic ( Trf hpx/hpx ) mice. A ) Hemoglobin and B ) p lasma iron concentration were determined by using st andard methods. C) Hepatic non heme iron levels were determined colorimetrically after acid digestion of tissues. Values represent mean SE, n=6, except for hemoglobin levels in Trf hpx/hpx mice (n=3 4). Means without a common superscript differ significantly ( P < 0.05). D) Histological examination of iron loading in the liver by usin g All analyses were performed on samples from 16 week old mice. A B C D Trf hpx/hpx ;Dmt 1 flox/flox Dmt 1 flox/flox D mt 1 liv/liv Trf hpx/hpx ;Dmt 1 liv/liv

PAGE 52

52 Fig ure 3 5 Tissue uptake of 59 Fe from NTBI or TBI injected into the plasma of Dmt1 flox/flox and Dmt1 liv/liv mice. A) NTBI uptake by the liver (n=10), kidney (n=5), pancreas (n=5) and heart (n=5). Mice were injected with ferric citrate to transiently saturate plasma transferrin and 59 Fe labeled ferric citrate was injected 10 min later. After 2 h, mice were sacrificed and whole body and tissue 59 Fe were determined by gamma counting Tissue uptake of 59 Fe from NTBI was calculated as a percentage of whole body cpm. B) TBI uptake by the liver (n=14), kidney (n=6), pancreas (n=6) and heart (n=6). Mice were injected with 59 Fe transferrin and sacrificed after 2 h. Whole body and tissue 59 Fe were determined by gamma counting Tissue uptake of 59 Fe from TBI was calculated as a percentage of whole body cpm. Values represent mean SE. All measurements were performed on mice at 8 week old. A B

PAGE 53

53 Fig ure 3 6 Effect of liver specific inactivation of Dmt1 on hepatic levels of TfR1, TfR2, and ZIP14 A) Western blot analysis of Tf R 1 and B) the quantification by densitometry in livers of D mt 1 fl ox/flox and Dmt1 liv/liv mice. C ) Western blot analysis of TfR2 and D) the quantification by densitometry. E) Western blot analysis of Z IP 14 and F) the quantification by densitometry Blots were stripped and reprobed for SR B1. Values represent mean SE, n=6. All analyses were performed on samples from 8 week old mice. A B E F C D Dmt1 flox/flox Dmt1 liv/liv TfR1 SRB1 Dmt1 flox/flox Dmt1 liv/liv Z IP 14 SRB1 TfR2 SRB1 Dmt1 flox/flox Dmt1 liv/liv 100 75 100 75 1 5 0 75

PAGE 54

54 Table 3 1. Iron status parameters of D mt 1 flox/flox and D mt 1 liv/liv mice Parameter Units Dmt 1 flox/flox D mt 1 liv/liv n P Body weight g 19.98 0.56 19.55 0.47 6 0.565 Liver weight g 0.83 0.07 0.81 0.04 6 0.873 Hemoglobin g/dL 15.30 0.33 15.18 0.47 6 0.843 Plasma iron level g/dL 270.32 17.72 283.56 14.44 6 0.575 TIBC g/dL 372.63 15.01 375.00 27.72 4 5 0.938 Transferrin saturation % 72.36 4.25 73.88 3.69 4 5 0.802 Hepatic total iron g Fe/g 796 7 0 65 .0 8 885.00 12.66 3 0.254 Hepatic nonheme iron g Fe/g 132.12 22.24 125.92 26.24 6 0.861 TIBC, total iron binding capac ity. Hepatic iron (heme and non heme ) levels were determined by ICP tissue wet weight. Values are means SE. Measurements were at 8 weeks of age. P t test.

PAGE 55

55 Table 3 2. Liver mineral concentrations in Dmt1 liv/liv Hfe / ;Dmt1 liv/liv and Trf hpx/hpx ;Dmt1 liv/liv mice and their respective Dmt1 flox/flox controls WT Hfe / Trf hpx/hpx D mt 1 flox/flox D mt 1 liv/liv D mt 1 flox/flox D mt 1 liv/liv D mt 1 flox/flox D mt 1 liv/liv Fe 507.8 82.7 468.8 100.6 1911 175.6 2503 540.4 4656 690.1 4369 549.0 Zn 94.17 5.43 105.0 2.79 102.3 2.50 122.0 12.54 109.7 4.57 96.60 8.18 Cu 29.50 6.23 41.17 5.49 4 0. 50 5.01 25 5 0 1 86* 20.17 1.35 18.20 0.73 Mn 3.87 0.41 3.93 0.25 3.90 0.07 3.25 0.29 4.25 0.31 3.22 0.53 Co 0.16 0.01 0.19 0.01 0.16 0.01 0.18 0.02 0.17 0.01 0.14 0.01 Liver mineral concentrations (ppm) were determined by ICP MS. Values are means SE of 5 6 mice per group. Comparisons between Dmt1 flox/flox and Dmt1 liv/liv mice as single or double mutants, were performed by usi t test P < 0.05. Measurements were at 16 weeks of age.

PAGE 56

56 CHAPTER 4 CHARACTERIZATION OF ZIP8 AS A NOVEL IRON TRANSPORTER Introduction Iron is an essential metal to life ye t too much is toxic Iron homeostasis needs to be tightly regulated; however, the molecular detail of how iron gets into mammalian tissues is not fully understood except for two cell types: enterocytes and developing erythroid cells It is well established that DMT1 is required in both cell types. In enterocytes, iron is reduced to the ferrous form before it can b e taken up by DMT1 at the brush border membrane ( 25 26 ) In developing eryth roid cells, DMT1 is essential for releasing iron from endosomes to cytoplasm ( 77 79 ) Studies of D mt 1 / mice revealed that iron accumulated in the liver, sugg esting DMT1 is not required in materno fetal transfer and that there is at least one DMT1 independent iron transport pathway in the liver ( 26 ) One such pathway may involve ZIP 14 which has been shown to mediate the uptake of NTBI and to localize to the plasma membrane of hepatocytes ( 135 ) ZIP 14 belongs to the ZIP superfamily of transmembrane proteins that are responsible for zinc transport into cells. Functional studies using the Xenopus laevis oocyte heterologous expression system showed that ZIP 14 mediated iron uptake was optimal at pH 7.5 ( 136 ) consistent with the implication that Z IP 14 may play a role in NTBI upta ke in the liver and in contrast to DMT1, which mediates iron uptake optimally at pH 5.5 ( 25 ) In the ZIP superfamily, Z IP 8 shares high homology with Z IP 14 (~50% amino acid identical). Z IP 8 has been shown to transport zinc, cadmium and m anganese ( 138 140 ) Reprinted with permission from 177. Wang CY, Jenkitkasemwong S, Duarte S, Sparkman B, Shawki A, Mackenzie B, Knutson MD. ZIP8 Is an Iron and Zinc Transport er Whose Cell surface Expression Is Upregulated by Cellular Iron Loading. J Biol Chem 2012.

PAGE 57

57 but the capabi lity of Z IP 8 to transport iron has not been reported. Given that Z IP 8 shares high homology with Z IP 14 I investigated the possibility that Z IP 8 functions as an iron transporter. Results Overexpression of Z IP 8 Increases C ellular U ptake of Z inc and I ron To determine if Z IP 8 transports iron in addition to zinc I t ransiently overexpressed rZ IP 8 in HEK293T cells and measured the uptake of 59 Fe ferric citrate in the presence of 1 mM ascorb ate Overexpression of Z IP 8 was confirmed by Western blotting (Fig ure 4 1 A). The data showed a two fold increase in iron uptake and a 45% increase in zinc uptake in cells overexpressing Z IP 8 (Fig ure 4 1B). When 10 fold molar excess of unlabeled zinc was added to the medium, >90% of iron uptake activity was inhibited. Likewise, 10 fold molar excess iron inhibited zinc uptake (Fig ure 4 1C). Z IP 8 mediated Iron T ransport A ctivity is pH D ependent To determine the pH dependence of Z IP 8 mediated iron transport iron uptake was measured in medium at pH 7.5, 6.5, or 5.5 in HEK293T cells overexpressing mZ IP 8. ZIP8 mediated iron transport occurs at both pH 7.5 and 6.5, but not at pH 5.5 in HEK293T transfected cells (Fig ure 4 2). Z IP 8 is G lycosylated and D etectable at the C ell S urface in H4IIE C ells The observation that Z IP 8 mediated iron transport activity at p H 7.5 and 6.5 led me to characterize ZIP 8 in H4IIE rat hepatoma cells because hepatocytes take up NTBI ( 126 ) and TBI ( 178 ) at pH 7.5 and 6.5, respectively. By immunoprecipitation, the major ZIP8 immunoreactive band in H4IIE cells is at approximately 140 kDa (Fig ure 4 3A) which is greater than the predicted molecular mass of 50 kDa To determine if endogenous Z IP 8 is glycosylated, I blocked endogenous glycosylation by treating H4IIE

PAGE 58

58 cells with tunicamycin and further removed existing N linked glycans by treating lys ates with PGNase F. Z IP 8 shifted down to 100 kDa when t reated cells with tunicamycin and to 75 kDa when PNGase F was added into lysates (Fig ure 4 3B ). To determine if Z IP 8 is detectable at the cell surface, I isolated the b iotinylated fraction of H4IIE cel ls followed by Western blotting. The data suggested that the 140 kDa form of Z IP 8 is the predominant glycosylated form present at the cell surface (Fig ure 4 3C). Z IP 8 P rotein E xpression is I nduced upon I ron T reatm ent in H4IIE C ells To determine if Z IP 8 i s regulated by iron, H4IIE cells were treated with 100 or 250 M Fe NTA for 72 h and protein expression was examined by Western blotting. Iron treatment increased Z IP 8 levels in b oth total cell lysates and cell surface fr actions (Figure 4 4A). It is well established that Tf R 1 expression decrease s during iron loaded conditions ( 179 ) and thus it was used as an iron loading indicator. SR BI was probed to demonstrate the enrichment of the cell surface biotinylated fraction and the equivalent lane loading. CCS is a cytosolic protein, thu s indicating that the isolated cell surface biotinylated fraction was not contaminated with cytosolic proteins and that total cell lysates were equally loaded (Fig ure 4 4A). I next examined whether Z IP 8 expression is also regulated by zinc by treating H4I zinc chloride ( ZnCl 2 ) for 3 h or 48 h. Z IP 8 protein expression was induced by 3 h ZnCl 2 treatment but not 48 h (Fig ure 4 4B). Tissue Expression of Z IP 8, Z IP 14 and DMT1 To compare tissue expression of Z IP 8 with other known mammalian iron transporters Z IP 14 and DMT1 I determined the copy number for each gene from pooled human total RNA. Among 20 different tissues examined, Z IP 8 is most abundant in lung, placenta, salivary gland and thymus and lowest in skeletal muscle, fetal brain

PAGE 59

59 and testis. Z IP 14 i s most abundant in liver, heart, thyroid gland and small intestine whereas DMT1 is most abundant in cerebellum, thymus, prostate and kidney (Fig ure 4 5) Suppression of ZIP8 E xpression in BeWo C ells To a ss ess iron transport capability of endogenous ZIP8, I suppressed ZIP8 expression by using siRNA targeting ZIP8 mRNA and measured iron transport activity in BeWo cells, a placental cell line derived human choriocarcinoma In BeWo cells treated with ZIP8 siRNA ZIP8 protein expression was suppressed by 90% and iron transport activity was decreased by 37%, compared to control cells treated with negative control siRNA (Fig ure 4 6). Discussion In this chapter, I have demonstrated that Z IP 8 can mediate cellular ir on transport, making it the third mammalian iron import protein to be identified. Z IP 8 was first cloned from monocyte s that w ere induced during innate immune activation stimulated by Mycobacterium bovis BCG cell wall and the induction increased intracellul ar zinc concentrations ( 138 ) It was later found to be responsible for cadmium toxicity in testis and kidney ( 139 146 ) Here, I showed that Z IP 8 can mediate cellular iron transport, in addition to zinc, and the presence of excessive unlabeled zinc or iron showed mutual inh ibition of the uptake activity suggesting that the transport pathway mediated by Z IP 8 is shared by zinc and iron. Treatment of H4IIE cells with iron increased Z IP 8 expression at the cell surface, suggesting Z IP 8 is regulated by iron. Treatment of H4IIE cells with zinc also increased Z IP 8 expression; however, the effect was transient. The fact that Z IP 8 expression is upregulated at the cell surface by ir on loading and that ZIP 8 is an

PAGE 60

60 iron/zinc transporter may explain hepatic zinc accumulation during iron overload conditions ( 141 180 181 ) DMT1 is the best characterized mammalian iron transporter thus far, and it is widely cited to be responsible for NTBI uptake in the liver ( 163 165 168 182 ) However, my studies indicate that hepatocyte DMT1 i s dispensable for hepatic NTBI uptake It is established that Z IP 14 can mediate NTBI uptake by overexpressing mZ IP 14 in HEK 293H and Sf9 insect cells ( 135 ) Considering that DMT1 mediated iron uptake was optimal at pH 5.5, but poor at pH 7.5 ( 25 ) and that Z IP 14 mediated iron uptake is optimal at pH 7.5 ( 136 ) mak es Z IP 14 a promising candidate for hepatic NTBI uptake. Similar to Z IP 14, Z IP 8 mediated iron uptake occurs at pH 7.5 and 6.5, but not at 5.5, indicating that Z IP 8 may facilitate NTBI clearance from blood into tissues and/or playing a role in iron assimilation from TBI but unlikely to mobilize iron from lysosomes, where it has been detected previously ( 138 145 ) Although Z IP 8 mediates iron uptake at pH 7.5 and is detectable at the surfa ce of H4IIE cells, according to its expression profile, it is not abundant in the liver or heart, the iron susceptible organs in iron overload, but in lung and placenta. Others reported its expression is high in pancreas ( 138 ) which was not included in the human total RNA master panel I used. Nonetheless, a microarray study using hearts from beta thalassemic mice showed a 1.8 fold increase in ZIP 8 expression and in contrast, DMT1 showed a 1.7 fold decreas e ( 183 ) suggesting ZIP 8 may be playing a role in NTBI uptake in beta thalassemic hearts. According to th e tissue expression profile, ZIP 8 is abundant in placenta and iron uptake activity was decreased by 37% in BeWo cells treated with ZIP8 siRNA r a ising the possibility that ZIP8 plays a role in maternofetal

PAGE 61

61 iron transfer in vivo This seems even more p lausible considering that the other two known iron import proteins, DMT1 and Z IP 14 are dispensable for iron transfer across the placenta ( 26 184 ) Studies of Z IP 8 hypomorph mice revealed that homozygotes died between gestational day 18.5 and postnatal 48 h ( 176 ) Moreover, hemoglobin, hematocrit and RBC levels were significantly de crease d at gestational day 16.5 and hepatic iron and zinc levels were decreased at postnatal day 1 ( 176 ) indicating Z IP 8 may play an important role in placental iron transfer and possibly hepatic iron uptake. In conclusion, Z IP 8 is the third mammalian iron importer to be identified. Whether it plays an important role in placental iron transfer under ph ysiologic condition s and /or NTBI uptake during iron overload in iron susceptible organs such us liver, heart and pancreas, need s to be further investigated by using tissue specific knockout mouse models.

PAGE 62

62 Figure 4 1. Overexpression of Z IP 8 increases the cellular uptake of iron and zinc. A) Western blot analysis of Z IP 8 in total cell lysates of HEK 293T cells transiently transfected with empty pE xpress vector or pE xpress rat Z IP 8. B ) Cellular uptake of iron and zinc in HEK 293T cells overexpressing Z IP 8. Forty eight hours after transfection, cells were incubated for 1 h in uptake medium containing 2 M 59 Fe ferric citrate or 65 Zn ZnCl 2 and cellular uptake of 59 Fe (left) or 65 Zn (right) w as measured by gamma counting. C ) Mutual inhibition of iron and zinc uptake in cells overexpressing Z IP 8. 59 Fe and 65 Zn uptake were measured in the presence of a 10 fold molar excess of unlabeled zinc (left) or iron (right). The amount of 59 Fe or 65 Zn taken up by cells is expressed as pmol/mg protein. Data represent the mean S.E. of three independent experiments. Treat ment group means were compared by unpaired Student's t test. A B C

PAGE 63

63 Figure 4 2 pH dependence of Z IP 8 mediated iron transport. HEK 293T cells were transfected with empty pCMV Sport6 vector or pCMV Sport6 mouse Z IP 8. Forty eight h after transfection, cells were incubated with 2 M 59 Fe ferric citrate for 1 h in uptake buffer at pH 5.5, 6.5 and 7.5. The amount of 59 Fe taken up by cells is expressed as pmol/mg of protein. Data represent the mean S.E. of three indepe ndent experiments.

PAGE 64

64 Figure 4 3 Immunoprecipitation and g lycosylation analysis of endogenous ZIP8 in H4IIE rat hepatoma cells. A) Immunoprecipitation of Z IP 8 followed by SDS PAGE and immunoblotting in H4IIE total cell lysates B) Western blot analysis of endogenous ZIP8 in H4IIE cells/cell lysates treated withou t ( ) or with (+) tunicamycin or PNGase F. C) Western blot analysis of cell surface ZIP8 in H4IIE cell lysates treated without ( ) or with (+) PNGase F. Cell surface proteins were labeled with Sulfo NHS SS Biotin and affinity purified by using streptavidin aga rose prior to Western analysis. I P CCS ZIP 8 Z IP 8 H4IIE total cell lysate 150 100 75 A B C

PAGE 65

65 F igure 4 4. Iron and zinc loading increases Z IP 8 levels in H4IIE rat hepatoma cells. A ) Western blot analysis of Z IP 8, Tf R 1, SR B1, and CCS in total cell lysate and cell surface proteins isolated from cells treated for 72 h with 0, 100, or 250 M FeNTA. Cell surface proteins were labeled with Sulfo NHS SS Biotin and affinity purified by using streptavidin agarose prior to Wes tern analysis. B) Western blot analysis of ZIP 8 and SR B1 in total cell lysates from H4IIE cells treated for 3 h and 48 h with 40 M ZnCl 2 A B

PAGE 66

66 0 5 10 15 20 Skeletal muscle Fetal brain Testis Fetal liver Small intestine Brain, whole Heart Uterus Spleen Liver Kidney Colon w/ mucosa Brain, cerebellum Prostate Thyroid gland Trachea Thymus Salivary gland Placenta Lung Copy number/mg total RNA (X10 4 ) ZIP8 ZIP14 DMT1 Figure 4 5. Tissue expression of Z IP 8 Z IP 14 and DMT1 Tissue expression profiles were determined by using the Human Total RNA Master Panel II derived from 20 different tissues (Clontech). Transcript copy numbers were determined by using quantitative RT PCR.

PAGE 67

67 F igure 4 6. Suppression of ZIP8 exp ression decreases iron uptake in BeWo cells. A) Western blot analysis of lysates from BeWo cells treated with negative control (NC) siRNA or siRNA targeting ZIP8 mRNA. As a positive control for ZIP8, BeWo cells were transfected with p CMV Sport6 human ZIP8 cDNA (ZIP8) or empty p CMVSport6 vector (Vector). B) Cellular 59 Fe uptake in BeWo cells transfected with negative control (NC) siRNA or siRNA targeting ZIP8 mRNA. Data represent the mean S.E. of three independent experiments. B A

PAGE 68

68 CHAPTER 5 CONCLUSIONS, LIMITAT IONS, AND FUTURE DIR ECTIONS Conclusions The first part of my dissertation was to test the hypothesis that DMT1 plays a role in hepatic iron uptake and accumulation. I tested this hypothesis by using DMT1 hepatocyte specific knockout mice and by crossing them with two mouse models of genetic iron overload. I found that hepatic total iron, nonheme iron concentrations, and other iron status parameters incl uding hemoglobin, plasma iron, and TIBC were not affected by the inactivation of DMT1 specifically in hepatocytes, indicating that DMT1 is not required for hepatic iron accumulation under normal or iron overload conditions. I also injected 59 Fe labeled NT BI and 59 Fe labeled TBI into mice intravenously to evaluate iron uptake activities by the liver through these two pathways C onsistent with DMT1 not being required for hepatic iron accumulation, NTBI clearance by the liver was not affected in D mt 1 liv/liv m ice. Although I did find that DMT1 was partially required for hepatic iron uptake from transferrin (i.e. 40% lower in livers of D mt 1 liv/liv mice) the contribution of this pathway to the overall iron economy of the liver is minor as hepatic iron concentration was unaffected in the knockout animals. The second part of my dissertation tested the hypothesis that ZIP8 transports iron and investigated its regulation by iron and zinc as well as the tissue distribution. I found th at overexpression of ZIP8 in HEK293T cells increased both zinc and NTBI uptake and that a 10 fold molar excess zinc inhibited iron uptake by 90%. Zinc uptake was likewise inhibited by iron, suggesting iron and zinc share a single common pathway. Cell surface ZIP 8 is upregul ated by iron loading in H4IIE cells and ZIP8 mediates NTBI uptake at pH 7.5 and pH 6.5, suggesting that ZIP8 may contribute to NTBI clearance from plasma

PAGE 69

69 into tissues and/or participate in iron assimilation from transferrin. By screening ZIP8 mRNA levels f rom 20 different tissues, I found that ZIP8 was most abundantly expressed in the lung and placenta. Moreover, siRNA mediated suppression of ZIP8 expression in BeWo cells decreased NTBI uptake by 37%. These data reveal ZIP8 as a novel iron transporter that may play a role i n iron metabolism, possibly in hepatic iron accumulation and /or in placental iron transport. Apparent Discrepancies with the Literature My finding that DMT1 is dispensable for NTBI uptake directly challenges the commonly held assumption t hat DMT1 plays a role in hepatic iron accumulation The most cited evidence that DMT1 plays a role in hepatic iron accumulation was that DMT1 staining in rat liver was stronger in iron loaded animals and diminished in an iron deficient group ( 123 ) and that NTBI uptake along with DMT1 protein expression, was increa sed in primary hepatocytes from Hfe / mice ( 126 ) However, the validation of the anti DMT1 antibody used in these two studies was not shown, raising the question of specificity of the antibody. Moreover, in the studies of Hfe / mice the authors concluded that DMT1 protein levels in isolated he patocytes of Hfe / mice were two fold higher than that of control animals, but the immunoblots were shown without proper lane loading controls and the conclusion was made by normalizing the hepatocyte expression of DMT1 from Hfe / mice to the levels from control mice Another often cited study that supports a role for DMT1 in NTBI uptake was in HLF cells which showed that DMT1 overexpression led to an increase in ferrous iron uptake ( 161 ) However, it was also shown that in HLF cells loaded with ferric ammonium citrate DMT1 localized mainly in the cytoplasm but not plasma membrane ( 161 ) where it would need to be to function in NTBI uptake during iron overload. Moreover, it is uncertain how relevant

PAGE 70

70 overexpression systems are to normal physiology, especially since DMT1 levels in liver are usually very low ( 25 75 ) Limitations There are some limitations in my studies First, I assessed the role of DMT1 in NTBI uptake by using normal mice, which have very little, if any, NTBI. Perhaps it would have been better to assess hepatic NTBI uptake in Hfe / mice, for they have been repor ted to have elevated DMT1 levels in hepatocytes (although I have not been able to verify this using whole liver) So, if I compare NTBI clearance in these iron loaded animals ( Hfe / ;Dmt1 flox/flox and Hfe / ;Dmt1 liv/liv ), I might see a difference. Second I only evaluated iron concentrations at two time points 8 weeks and 16 weeks. It is known that iron status varies with age ( 185 ) and I did find a 100% increase in hepatic TfR1 levels in Dmt1 liv/liv mice at age of 16 weeks but not 8 weeks (data not shown) Lastly I used both male and female mice for all analysis. Compared to male mice, f emale s tend to have higher hepatic iron stores that contributed to higher variation in this study and thus would be more difficult to see difference with n=6 The major limitation of the ZIP8 project was that the study was performed exclusively in cell culture models. Future studies using whole animals will be required to define the in vivo role of ZIP8 in iron metabolism, especially in the liver and placen ta. Future Directions The conclusion from DMT1 project suggested two directions. First, as DMT1 is dispensable for hepat ic iron uptake and accumulation studies using Zip14 and/or Zip8 knockout mice are thus warranted to examine other possible pathways of hepatic iron accumulation Second, the fact of DMT1 is partially required for TBI uptake but hepatic iron levels did not differ suggested that under normal conditions, the major contributor of

PAGE 71

71 hepatic iron source is not from TBI. As liver can also acquire iron from other pathways, such as heme hemopexin, hemoglobin haptoglobin, ferritin, and lactoferrin ( 163 ) future experiments will be needed to take these pathways into consideration to elucidate hepatic iron metabolism With respect to the ZIP8 project, studies using Zip8 / and Zip8 flox/flox ;Meox2 Cre which will inactivate ZIP8 in all tissues except extramebryonic visceral endoderm and placenta, are needed to examine the role of ZIP8 in placental iron transfer. Whether ZIP8 plays an important role during iron overload in iron susceptible organs such us liver, heart and panc reas, also needs to be further investigated by using tissue specific knockout mouse models.

PAGE 72

72 APPENDIX A REGULATION OF ZIP14 BY IRON OVERLOAD ZIP14 has been implicated in NTBI uptake. I measured ZIP14 expression in iron susceptible organs, namely liver, pancreas and heart of rats fed with iro n deficient (10 ppm), adequate (50 ppm) and overload (18916 ppm) as well as in liver and pancreas of Hpx mice a genetic mouse model of iron overload. Levels of nonheme iron in rat tissues were confirmed elsewh ere. Briefly, hepatic nonheme iron level s of iron loaded rat were 60 fold higher than that of adequate group, whereas iron deficient rat s had 60% lower hepatic non heme iron concentrations than iron adequate animals In iron loaded rats, nonheme iron levels in pancreas and heart were 300% and 50% higher respectively, than those in iron adequate controls In pancreas or heart, nonheme iron concentrations did not differ between iron deficient and iron adequate animals. Hepatic non heme concentration of Hpx mic e were 11 fold higher than that of WT mice (1658 142 g/g v.s.135 3.0 whereas pancreatic nonheme levels of Hpx mice were 5 fold higher than that of WT mice ( 191 21 g/g v.s. 29.4 3.0 g/g). To validate the anti ZIP14 antibody, I used tissues from WT, Zip14 / mice, and rats. T he major ZIP 14 immunoreactive band in livers from WT mice and rat was detected at approximately 1 3 0 kDa along with a smear of high molecular mass bands likely representing glycosylated oligomers, consistent with previous findings ( 184 ) The band at 130 kDa is not detected in livers from Zip14 / mice thus confirming that this band is ZIP14. ZIP14 in pancreas and heart was also detected at 130 kDa (Fig ure A 1). Reprinted with permission from Nam H, Wang CY, Zhang W, Hojyo S, Fukada T, Knutson MD. ZIP14 and DMT1 in the liver, pancreas, and heart are differentially regu lated by iron deficiency and overload: implications for tissue iron uptake in iron related disorders. Haematologica. Under r eview.

PAGE 73

73 By immunoblotting, I demonstrated that ZIP14 in liver and pancreas of iron overload rat were 100% and 70% higher than that of adequate controls (Fig ure A 2) and that in Hpx liver, levels of ZIP14 were 50% higher than that of WT livers (Fig ure A 3) The up regulation of ZIP14 by iron loading in iron loaded rat liver and pancreas and in the livers of Hpx mice su ggests it may contribute to NTBI uptake in iron overload disorders.

PAGE 74

74 F i gure A 1. Validation of the immunoreactivity of anti ZIP14 antibody. L ysates of l iver, pancreas and heart from wildtype (WT) and ZIP14 knockout (KO) mice and rat fed with iron adequate diet were analyzed by Western blotting. The ZIP14 specific (arrowhead) and non specific (NS) immunoreactive bands are indicated. To indicate lane loading, the blot was stripped and reprobed with the integral membra ne protein SR B1.

PAGE 75

75 Fi gure A 2 Effect of dietary iron deficiency and overload on ZIP14 levels A) Western blot analysis of ZIP14 and the quantification by densitometry in rat liver. B) Western blot analysis of ZIP14 and the quantification by densitometry in rat pancreas. C) Western blot analysis of ZIP14 and the quantification by densitometry in rat heart To indicate lane loading, the blot was stripped and reprobed with the integral mem brane protein SR B1. A C B

PAGE 76

76 Figure A 3 Effect of genetic iron overload on ZIP14 levels in m ouse liver and pancreas. A) Western blot analysis of ZIP14 and the quantification by densitometry in mouse liver. B) Western blot analysis of ZIP14 and the quantification by densitometry in mouse pancreas. To indicate lane loading, the blot was stripped and reprobed with the integ ral membrane protein SR B1. B A

PAGE 77

77 LIST OF REFERENCES 1. Scholander PF. Oxygen transport through hemoglobin solutions. Science 1960;131:585 590. 2. Wittenberg JB. The molecular mechanism of hemoglobin facilitated oxygen diffusion. J Biol Chem 1966;241:104 114. 3. Wyman J. Facilitated diffusion and the possible role of myoglobin as a transport mechanism. J Biol Chem 1966;241:115 121. 4. Wittenberg JB. Myoglobin facilitated oxygen diffusion: role of myoglobin in oxygen entry into muscle Physiol Rev 1970;50:559 636. 5. Chelikani P, Fita I, Loewen PC. Diversity of structures and properties among catalases. Cell Mol Life Sci 2004;61:192 208. 6. Belevich I, Verkhovsky MI, Wikstrom M. Proton coupled electron transfer drives the proton pump o f cytochrome c oxidase. Nature 2006;440:829 832. 7. Hall DO, Evans MC. Iron sulphur proteins. Nature 1969;223:1342 1348. 8. Beinert H, Kennedy MC. Aconitase, a two faced protein: enzyme and iron regulatory factor. FASEB J 1993;7:1442 1449. 9. Tuderman L, M yllyla R, Kivirikko KI. Mechanism of the prolyl hydroxylase reaction. 1. Role of co substrates. Eur J Biochem 1977;80:341 348. 10. Nagatsu T, Levitt M, Udenfriend S. Tyrosine Hydroxylase. The Initial Step in Norepinephrine Biosynthesis. J Biol Chem 1964;23 9:2910 2917. 11. Smith, Rs. Iron Deficiency and Iron Overload. Arch Dis Child 1965;40:343 363. 12. Andrews NC. Iron homeostasis: insights from genetics and animal models. Nat Rev Genet 2000;1:208 217. 13. Andrews NC. Disorders of iron metabolism. N Engl J Med 1999;341:1986 1995. 14. Munoz M, Villar I, Garcia Erce JA. An update on iron physiology. World J Gastroenterol 2009;15:4617 4626. 15. Chevion M. A site specific mechanism for free radical induced biological damage: the essential role of redox active tr ansition metals. Free Radic Biol Med 1988;5:27 37. 16. Cook JD. Determinants of Non Heme Iron Absorption in Man. Food Technology 1983;37:124 126. 17. Carpenter CE, Mahoney AW. Contributions of heme and nonheme iron to human nutrition. Crit Rev Food Sci Nut r 1992;31:333 367.

PAGE 78

78 18. Turnbull A, Cleton F, Finch CA. Iron absorption. IV. The absorption of hemoglobin iron. J Clin Invest 1962;41:1897 1907. 19. Weintraub LR, Weinstein MB, Huser HJ, Rafal S. Absorption of hemoglobin iron: the role of a heme splitting s ubstance in the intestinal mucosa. J Clin Invest 1968;47:531 539. 20. Parmley RT, Barton JC, Conrad ME, Austin RL, Holland RM. Ultrastructural cytochemistry and radioautography of hemoglobin -iron absorption. Exp Mol Pathol 1981;34:131 144. 21. Donovan A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, Paw BH, et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 2000;403:776 781. 22. McKie AT, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, Miret S, et al. A novel duodenal iron regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 2000;5:299 309. 23. Shayeghi M, Latunde Dada GO, Oakhill JS, Laftah AH, Takeuchi K, Halliday N, Khan Y, et al. Identi fication of an intestinal heme transporter. Cell 2005;122:789 801. 24. Qiu A, Jansen M, Sakaris A, Min SH, Chattopadhyay S, Tsai E, Sandoval C, et al. Identification of an intestinal folate transporter and the molecular basis for hereditary folate malabsor ption. Cell 2006;127:917 928. 25. Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, et al. Cloning and characterization of a mammalian proton coupled metal ion transporter. Nature 1997;388:482 488. 26. Gunshin H, Fujiwara Y, Custodio AO, Direnzo C, Robine S, Andrews NC. Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver. J Clin Invest 2005;115:1258 1266. 27. Raja KB, Simpson RJ, Peters TJ. Investigation of a role for reduction in ferric iron uptake by mouse duodenum. Biochim Biophys Acta 1992;1135:141 146. 28. Riedel HD, Remus AJ, Fitscher BA, Stremmel W. Characterization and partial purification of a ferrireductase from human duodenal microvillus membranes. Biochem J 1995;309 ( Pt 3):745 748. 29. Han O, Failla ML, Hill AD, Morris ER, Smith JC, Jr. Reduction of Fe(III) is required for uptake of nonheme iron by Caco 2 cells. J Nutr 1995;125:1291 1299. 30. Gunshin H, Starr CN, Direnzo C, Fleming MD, Jin J, Greer EL, Selle rs VM, et al. Cybrd1 (duodenal cytochrome b) is not necessary for dietary iron absorption in mice. Blood 2005;106:2879 2883.

PAGE 79

79 31. Maeda N, Hagihara H, Nakata Y, Hiller S, Wilder J, Reddick R. Aortic wall damage in mice unable to synthesize ascorbic acid. Pr oc Natl Acad Sci U S A 2000;97:841 846. 32. Iwama M, Amano A, Shimokado K, Maruyama N, Ishigami A. Ascorbic Acid Levels in Various Tissues, Plasma and Urine of Mice during Aging. J Nutr Sci Vitaminol (Tokyo) 2012;58:169 174. 33. Kim H, Bae S, Yu Y, Kim Y, Kim HR, Hwang YI, Kang JS, et al. The analysis of vitamin C concentration in organs of gulo( / ) mice upon vitamin C withdrawal. Immune Netw 2012;12:18 26. 34. Vulpe CD, Kuo YM, Murphy TL, Cowley L, Askwith C, Libina N, Gitschier J, et al. Hephaestin, a ce ruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 1999;21:195 199. 35. Grootveld M, Bell JD, Halliwell B, Aruoma OI, Bomford A, Sadler PJ. Non transferrin bound iron in plasma or serum from patients wit h idiopathic hemochromatosis. Characterization by high performance liquid chromatography and nuclear magnetic resonance spectroscopy. J Biol Chem 1989;264:4417 4422. 36. Lovstad RA. Interaction of serum albumin with the Fe(III) citrate complex. Int J Bioch em 1993;25:1015 1017. 37. Breuer W, Hershko C, Cabantchik ZI. The importance of non transferrin bound iron in disorders of iron metabolism. Transfus Sci 2000;23:185 192. 38. Harrison PM, Arosio P. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta 1996;1275:161 203. 39. Cohen LA, Gutierrez L, Weiss A, Leichtmann Bardoogo Y, Zhang DL, Crooks DR, Sougrat R, et al. Serum ferritin is derived primarily from macrophages through a nonclassical secretory pathway Blood 2010;116:1574 1584. 40. Viprakasit V, Gattermann N, Lee JW, Porter JB, Taher AT, Habr D, Martin N, et al. Geographical variations in current clinical practice on transfusions and iron chelation therapy across various transfusion dependent anaemias. Blood Transfus 2012:1 14. 41. Ward RJ, Ramsey M, Dickson DP, Hunt C, Douglas T, Mann S, Aquad F, et al. Further characterisation of forms of haemosiderin in iron overloaded tissues. Eur J Biochem 1994;225:187 194. 42. Ward RJ, Legssyer R, Henry C, Crichto n RR. Does the haemosiderin iron core determine its potential for chelation and the development of iron induced tissue damage? J Inorg Biochem 2000;79:311 317. 43. Ganz T. Hepcidin, a key regulator of iron metabolism and mediator of anemia of inflammation. Blood 2003;102:783 788.

PAGE 80

80 44. Nemeth E. Targeting the hepcidin ferroportin axis in the diagnosis and treatment of anemias. Adv Hematol 2010;2010:750643. 45. Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, Ganz T, et al. Hepcidin regulates ce llular iron efflux by binding to ferroportin and inducing its internalization. Science 2004;306:2090 2093. 46. Nicolas G, Chauvet C, Viatte L, Danan JL, Bigard X, Devaux I, Beaumont C, et al. The gene encoding the iron regulatory peptide hepcidin is regula ted by anemia, hypoxia, and inflammation. J Clin Invest 2002;110:1037 1044. 47. Pigeon C, Ilyin G, Courselaud B, Leroyer P, Turlin B, Brissot P, Loreal O. A new mouse liver specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload. J Biol Chem 2001;276:7811 7819. 48. Andersen RV, Tybjaerg Hansen A, Appleyard M, Birgens H, Nordestgaard BG. Hemochromatosis mutations in the general population: iron overload progression rate. Blood 2004;10 3:2914 2919. 49. Okada S. Iron induced tissue damage and cancer: the role of reactive oxygen species free radicals. Pathol Int 1996;46:311 332. 50. Pietrangelo A. Hereditary hemochromatosis. Annu Rev Nutr 2006;26:251 270. 51. Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishian F, et al. A novel MHC class I like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13:399 408. 52. Adams PC, Reboussin DM, Barton JC, McLaren CE, Eckfeldt JH, McLaren GD, Dawkins FW et al. Hemochromatosis and iron overload screening in a racially diverse population. N Engl J Med 2005;352:1769 1778. 53. Allen KJ, Gurrin LC, Constantine CC, Osborne NJ, Delatycki MB, Nicoll AJ, McLaren CE, et al. Iron overload related disease in HFE he reditary hemochromatosis. N Engl J Med 2008;358:221 230. 54. Steinberg KK, Cogswell ME, Chang JC, Caudill SP, McQuillan GM, Bowman BA, Grummer Strawn LM, et al. Prevalence of C282Y and H63D mutations in the hemochromatosis (HFE) gene in the United States. JAMA 2001;285:2216 2222. 55. Beutler E. The significance of the 187G (H63D) mutation in hemochromatosis. Am J Hum Genet 1997;61:762 764. 56. Burt MJ, George PM, Upton JD, Collett JA, Frampton CM, Chapman TM, Walmsley TA, et al. The significance of haemochromatosis gene mutations in the general population: implications for screening. Gut 1998;43:830 836.

PAGE 81

81 57. Aguilar Martinez P, Bismuth M, Picot MC, Thelcide C, Pageaux GP, Blanc F, Blanc P, et al. Variable phenotypic presentation of iron overload in H 63D homozygotes: are genetic modifiers the cause? Gut 2001;48:836 842. 58. Camaschella C, Roetto A, Cicilano M, Pasquero P, Bosio S, Gubetta L, Di Vito F, et al. Juvenile and adult hemochromatosis are distinct genetic disorders. Eur J Hum Genet 1997;5:371 375. 59. Camaschella C, Roetto A, De Gobbi M. Juvenile hemochromatosis. Semin Hematol 2002;39:242 248. 60. Roetto A, Papanikolaou G, Politou M, Alberti F, Girelli D, Christakis J, Loukopoulos D, et al. Mutant antimicrobial peptide hepcidin is associated wi th severe juvenile hemochromatosis. Nat Genet 2003;33:21 22. 61. Montosi G, Donovan A, Totaro A, Garuti C, Pignatti E, Cassanelli S, Trenor CC, et al. Autosomal dominant hemochromatosis is associated with a mutation in the ferroportin (SLC11A3) gene. J Cli n Invest 2001;108:619 623. 62. Mayr R, Griffiths WJ, Hermann M, McFarlane I, Halsall DJ, Finkenstedt A, Douds A, et al. Identification of mutations in SLC40A1 that affect ferroportin function and phenotype of human ferroportin iron overload. Gastroenterolo gy 2011;140:2056 2063, 2063 e2051. 63. Njajou OT, Vaessen N, Joosse M, Berghuis B, van Dongen JW, Breuning MH, Snijders PJ, et al. A mutation in SLC11A3 is associated with autosomal dominant hemochromatosis. Nat Genet 2001;28:213 214. 64. Letocart E, Le Ga c G, Majore S, Ka C, Radio FC, Gourlaouen I, De Bernardo C, et al. A novel missense mutation in SLC40A1 results in resistance to hepcidin and confirms the existence of two ferroportin associated iron overload diseases. Br J Haematol 2009;147:379 385. 65. K ushner JP, Porter JP, Olivieri NF. Secondary iron overload. Hematology Am Soc Hematol Educ Program 2001:47 61. 66. Olivieri NF. The beta thalassemias. N Engl J Med 1999;341:99 109. 67. Cao A, Galanello R. Beta thalassemia. Genet Med 2010;12:61 76. 68. Brit tenham GM. Iron chelating therapy for transfusional iron overload. N Engl J Med 2011;364:146 156. 69. McLaren GD, Muir WA, Kellermeyer RW. Iron overload disorders: natural history, pathogenesis, diagnosis, and therapy. Crit Rev Clin Lab Sci 1983;19:205 266

PAGE 82

82 70. Gardenghi S, Grady RW, Rivella S. Anemia, ineffective erythropoiesis, and hepcidin: interacting factors in abnormal iron metabolism leading to iron overload in beta thalassemia. Hematol Oncol Clin North Am 2010;24:1089 1107. 71. Camaschella C, Pipern o A. Hereditary hemochromatosis: recent advances in molecular genetics and clinical management. Haematologica 1997;82:77 84. 72. Neufeld EJ. Oral chelators deferasirox and deferiprone for transfusional iron overload in thalassemia major: new data, new ques tions. Blood 2006;107:3436 3441. 73. Mackenzie B, Takanaga H, Hubert N, Rolfs A, Hediger MA. Functional properties of multiple isoforms of human divalent metal ion transporter 1 (DMT1). Biochem J 2007;403:59 69. 74. Lee PL, Gelbart T, West C, Halloran C, B eutler E. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 1998;24:199 215. 75. Hubert N, Hentze MW. Previously uncharacterized isoforms of divalent metal transporte r (DMT) 1: implications for regulation and cellular function. Proc Natl Acad Sci U S A 2002;99:12345 12350. 76. Fleming MD, Trenor CC, 3rd, Su MA, Foernzler D, Beier DR, Dietrich WF, Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidat e iron transporter gene. Nat Genet 1997;16:383 386. 77. Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD, Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci U S A 1998;95:1148 1153. 78. Su MA, Trenor CC, Fleming JC, Fleming MD, Andrews NC. The G185R mutation disrupts function of the iron transporter Nramp2. Blood 1998;92:2157 2163. 79. Canonne Hergaux F, Fleming MD, Levy JE, Gauthier S, Ralph T, Picard V, Andrews NC et al. The Nramp2/DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border. Blood 2000;96:3964 3970. 80. Priwitzerova M, Pospisilova D, Prchal JT, Indrak K, Hlobilkova A, Mi hal V, Ponka P, et al. Severe hypochromic microcytic anemia caused by a congenital defect of the iron transport pathway in erythroid cells. Blood 2004;103:3991 3992. 81. Iolascon A, d'Apolito M, Servedio V, Cimmino F, Piga A, Camaschella C. Microcytic anem ia and hepatic iron overload in a child with compound heterozygous mutations in DMT1 (SCL11A2). Blood 2006;107:349 354.

PAGE 83

83 82. Beaumont C, Delaunay J, Hetet G, Grandchamp B, de Montalembert M, Tchernia G. Two new human DMT1 gene mutations in a patient with mi crocytic anemia, low ferritinemia, and liver iron overload. Blood 2006;107:4168 4170. 83. Bardou Jacquet E, Island ML, Jouanolle AM, Detivaud L, Fatih N, Ropert M, Brissot E, et al. A novel N491S mutation in the human SLC11A2 gene impairs protein trafficking and in association with the G212V mutation leads to microcytic anemia and liver iron overload. Blood Cells Mol Dis 2011;47:243 248. 84. Mims MP, Guan Y, Pospisilova D, Priwitzerova M, Indrak K, Ponka P, Divoky V, et al. Identification of a huma n mutation of DMT1 in a patient with microcytic anemia and iron overload. Blood 2005;105:1337 1342. 85. Lam Yuk Tseung S, Mathieu M, Gros P. Functional characterization of the E399D DMT1/NRAMP2/SLC11A2 protein produced by an exon 12 mutation in a patient w ith microcytic anemia and iron overload. Blood Cells Mol Dis 2005;35:212 216. 86. Priwitzerova M, Nie G, Sheftel AD, Pospisilova D, Divoky V, Ponka P. Functional consequences of the human DMT1 (SLC11A2) mutation on protein expression and iron uptake. Blood 2005;106:3985 3987. 87. Gunshin H, Jin J, Fujiwara Y, Andrews NC, Mims M, Prchal J. Analysis of the E399D mutation in SLC11A2. Blood 2005;106:2221; author reply 2221 2222. 88. Lam Yuk Tseung S, Camaschella C, Iolascon A, Gros P. A novel R416C mutation in human DMT1 (SLC11A2) displays pleiotropic effects on function and causes microcytic anemia and hepatic iron overload. Blood Cells Mol Dis 2006;36:347 354. 89. Blanco E, Kannengiesser C, Grandchamp B, Tasso M, Beaumont C. Not all DMT1 mutations lead to iron overload. Blood Cells Mol Dis 2009;43:199 201. 90. Edwards JA, Hoke JE. Red cell iron uptake in hereditary microcytic anemia. Blood 1975;46:381 388. 91. Edwards JA, Sullivan AL, Hoke JE. Defective delivery of iron to the developing red cell of the Belgrad e laboratory rat. Blood 1980;55:645 648. 92. Farcich EA, Morgan EH. Uptake of transferrin bound and nontransferrin bound iron by reticulocytes from the Belgrade laboratory rat: comparison with Wistar rat transferrin and reticulocytes. Am J Hematol 1992;39: 9 14. 93. Garrick MD, Gniecko K, Liu Y, Cohan DS, Garrick LM. Transferrin and the transferrin cycle in Belgrade rat reticulocytes. J Biol Chem 1993;268:14867 14874. 94. Canonne Hergaux F, Zhang AS, Ponka P, Gros P. Characterization of the iron transporter DMT1 (NRAMP2/DCT1) in red blood cells of normal and anemic mk/mk mice. Blood 2001;98:3823 3830.

PAGE 84

84 95. Ohgami RS, Campagna DR, Greer EL, Antiochos B, McDonald A, Chen J, Sharp JJ, et al. Identification of a ferrireductase required for efficient transferrin de pendent iron uptake in erythroid cells. Nat Genet 2005;37:1264 1269. 96. Oates PS, Morgan EH. Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am J Physiol 1996;270:G826 832. 97. Garrick M, Scott D, Walpole S, Fi nkelstein E, Whitbred J, Chopra S, Trivikram L, et al. Iron supplementation moderates but does not cure the Belgrade anemia. Biometals 1997;10:65 76. 98. Dupic F, Fruchon S, Bensaid M, Loreal O, Brissot P, Borot N, Roth MP, et al. Duodenal mRNA expression of iron related genes in response to iron loading and iron deficiency in four strains of mice. Gut 2002;51:648 653. 99. Stuart KA, Anderson GJ, Frazer DM, Powell LW, McCullen M, Fletcher LM, Crawford DH. Duodenal expression of iron transport molecules in u ntreated haemochromatosis subjects. Gut 2003;52:953 959. 100. Kong WN, Chang YZ, Wang SM, Zhai XL, Shang JX, Li LX, Duan XL. Effect of erythropoietin on hepcidin, DMT1 with IRE, and hephaestin gene expression in duodenum of rats. J Gastroenterol 2008;43:13 6 143. 101. Kelleher T, Ryan E, Barrett S, Sweeney M, Byrnes V, O'Keane C, Crowe J. Increased DMT1 but not IREG1 or HFE mRNA following iron depletion therapy in hereditary haemochromatosis. Gut 2004;53:1174 1179. 102. Canonne Hergaux F, Levy JE, Fleming MD Montross LK, Andrews NC, Gros P. Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron overload disorders. Blood 2001;97:1138 1140. 103. Chen H, Su T, Attieh ZK, Fox TC, McKie AT, Anderson GJ, Vulpe CD. Systemic regulation of He phaestin and Ireg1 revealed in studies of genetic and nutritional iron deficiency. Blood 2003;102:1893 1899. 104. Nicolas G, Bennoun M, Devaux I, Beaumont C, Grandchamp B, Kahn A, Vaulont S. Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad Sci U S A 2001;98:8780 8785. 105. Viatte L, Lesbordes Brion JC, Lou DQ, Bennoun M, Nicolas G, Kahn A, Canonne Hergaux F, et al. Deregulation of proteins involved in iron metabolism in he pcidin deficient mice. Blood 2005;105:4861 4864. 106. Chung B, Chaston T, Marks J, Srai SK, Sharp PA. Hepcidin decreases iron transporter expression in vivo in mouse duodenum and spleen and in vitro in THP 1 macrophages and intestinal Caco 2 cells. J Nutr 2009;139:1457 1462.

PAGE 85

85 107. Fleming RE, Migas MC, Zhou X, Jiang J, Britton RS, Brunt EM, Tomatsu S, et al. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the iron transporter DMT1. Proc N atl Acad Sci U S A 1999;96:3143 3148. 108. Kawabata H, Fleming RE, Gui D, Moon SY, Saitoh T, O'Kelly J, Umehara Y, et al. Expression of hepcidin is down regulated in TfR2 mutant mice manifesting a phenotype of hereditary hemochromatosis. Blood 2005;105:376 381. 109. Wang RH, Li C, Xu X, Zheng Y, Xiao C, Zerfas P, Cooperman S, et al. A role of SMAD4 in iron metabolism through the positive regulation of hepcidin expression. Cell Metab 2005;2:399 409. 110. Ahmad KA, Ahmann JR, Migas MC, Waheed A, Britton RS, B acon BR, Sly WS, et al. Decreased liver hepcidin expression in the Hfe knockout mouse. Blood Cells Mol Dis 2002;29:361 366. 111. Bridle KR, Frazer DM, Wilkins SJ, Dixon JL, Purdie DM, Crawford DH, Subramaniam VN, et al. Disrupted hepcidin regulation in HFE associated haemochromatosis and the liver as a regulator of body iron homoeostasis. Lancet 2003;361:669 673. 112. Nemeth E, Roetto A, Garozzo G, Ganz T, Camaschella C. Hepcidin is decreased in TFR2 hemochromatosis. Blood 2005;105:1803 1806. 113. Zoller H, Koch RO, Theurl I, Obrist P, Pietrangelo A, Montosi G, Haile DJ, et al. Expression of the duodenal iron transporters divalent metal transporter 1 and ferroportin 1 in iron deficiency and iron overload. Gastroenterology 2001;120:1412 1419. 114. Rolfs A, Bonkovsky HL, Kohlroser JG, McNeal K, Sharma A, Berger UV, Hediger MA. Intestinal expression of genes involved in iron absorption in humans. Am J Physiol Gastrointest Liver Physiol 2002;282:G598 607. 115. Casey JL, Hentze MW, Koeller DM, Caughman SW, Roua ult TA, Klausner RD, Harford JB. Iron responsive elements: regulatory RNA sequences that control mRNA levels and translation. Science 1988;240:924 928. 116. Koeller DM, Casey JL, Hentze MW, Gerhardt EM, Chan LN, Klausner RD, Harford JB. A cytosolic protein binds to structural elements within the iron regulatory region of the transferrin receptor mRNA. Proc Natl Acad Sci U S A 1989;86:3574 3578. 117. Casey JL, Koeller DM, Ramin VC, Klausner RD, Harford JB. Iron regulation of transferrin receptor mRNA levels requires iron responsive elements and a rapid turnover determinant in the 3' untranslated region of the mRNA. EMBO J 1989;8:3693 3699.

PAGE 86

86 118. Gunshin H, Allerson CR, Polycarpou Schwarz M, Rofts A, Rogers JT, Kishi F, Hentze MW, et al. Iron dependent regulati on of the divalent metal ion transporter. FEBS Lett 2001;509:309 316. 119. Galy B, Ferring Appel D, Kaden S, Grone HJ, Hentze MW. Iron regulatory proteins are essential for intestinal function and control key iron absorption molecules in the duodenum. Cell Metab 2008;7:79 85. 120. Smith TG, Robbins PA, Ratcliffe PJ. The human side of hypoxia inducible factor. Br J Haematol 2008;141:325 334. 121. Mastrogiannaki M, Matak P, Keith B, Simon MC, Vaulont S, Peyssonnaux C. HIF 2alpha, but not HIF 1alpha, promotes iron absorption in mice. J Clin Invest 2009;119:1159 1166. 122. Vanoaica L, Darshan D, Richman L, Schumann K, Kuhn LC. Intestinal ferritin H is required for an accurate control of iron absorption. Cell Metab 2010;12:273 282. 123. Trinder D, Oates PS, Thoma s C, Sadleir J, Morgan EH. Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 2000;46:270 276. 124. Kim DW, Kim KY, Choi BS, Youn P, Ryu D Y, Klaassen CD, Park JD. Regulation of metal transporters by dietary iron, and the relationship between body iron levels and cadmium uptake. Arch Toxicol 2007;81:327 334. 125. Muckenthaler M, Roy CN, Custodio AO, Minana B, deGraaf J, Montross LK, Andrews N C, et al. Regulatory defects in liver and intestine implicate abnormal hepcidin and Cybrd1 expression in mouse hemochromatosis. Nat Genet 2003;34:102 107. 126. Chua AC, Olynyk JK, Leedman PJ, Trinder D. Nontransferrin bound iron uptake by hepatocytes is in creased in the Hfe knockout mouse model of hereditary hemochromatosis. Blood 2004;104:1519 1525. 127. Foot NJ, Dalton HE, Shearwin Whyatt LM, Dorstyn L, Tan SS, Yang B, Kumar S. Regulation of the divalent metal ion transporter DMT1 and iron homeostasis by a ubiquitin dependent mechanism involving Ndfips and WWP2. Blood 2008;112:4268 4275. 128. Howitt J, Putz U, Lackovic J, Doan A, Dorstyn L, Cheng H, Yang B, et al. Divalent metal transporter 1 (DMT1) regulation by Ndfip1 prevents metal toxicity in human neu rons. Proc Natl Acad Sci U S A 2009;106:15489 15494. 129. Foot NJ, Leong YA, Dorstyn LE, Dalton HE, Ho K, Zhao L, Garrick MD, et al. Ndfip1 deficient mice have impaired DMT1 regulation and iron homeostasis. Blood 2011;117:638 646.

PAGE 87

87 130. Jenkitkasemwong S, W ang CY, Mackenzie B, Knutson MD. Physiologic implications of metal ion transport by ZIP14 and ZIP8. Biometals 2012. 131. Eide DJ. The SLC39 family of metal ion transporters. Pflugers Arch 2004;447:796 800. 132. Eng BH, Guerinot ML, Eide D, Saier MH, Jr. Se quence analyses and phylogenetic characterization of the ZIP family of metal ion transport proteins. J Membr Biol 1998;166:1 7. 133. Taylor KM, Morgan HE, Johnson A, Nicholson RI. Structure function analysis of a novel member of the LIV 1 subfamily of zinc transporters, ZIP14. FEBS Lett 2005;579:427 432. 134. Tominaga K, Kagata T, Johmura Y, Hishida T, Nishizuka M, Imagawa M. SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc. FEBS J 2005;272:1590 1599. 135. Liuzzi JP, Aydemir F, Nam H, Knutson MD, Cousins RJ. Zip14 (Slc39a14) mediates non transferrin bound iron uptake into cells. Proc Natl Acad Sci U S A 2006;103:13612 13617. 136. Pinilla Tenas JJ, Sparkman BK, Shawki A, Illing AC, Mitchell CJ, Zhao N, Liuzzi JP, et al. Zip14 is a compl ex broad scope metal ion transporter whose functional properties support roles in the cellular uptake of zinc and nontransferrin bound iron. Am J Physiol Cell Physiol 2011;301:C862 871. 137. Zhao N, Gao J, Enns CA, Knutson MD. ZRT/IRT like protein 14 (ZIP1 4) promotes the cellular assimilation of iron from transferrin. J Biol Chem 2010;285:32141 32150. 138. Begum NA, Kobayashi M, Moriwaki Y, Matsumoto M, Toyoshima K, Seya T. Mycobacterium bovis BCG cell wall and lipopolysaccharide induce a novel gene, BIGM103, encoding a 7 TM protein: identification of a new protein family having Zn transporter and Zn metalloprotease signatures. Genomics 2002;80:630 645. 139. Dalton TP, He L, Wang B, Miller ML, Jin L, Stringer KF, Chang X, et al. Identification of mouse SLC39A8 as the transporter responsible for cadmium induced toxicity in the testis. Proc Natl Acad Sci U S A 2005;102:3401 3406. 140. He L, Girijashanker K, Dalton TP, Reed J, Li H, Soleimani M, Nebert DW. ZIP8, member of the solute carrier 39 (SLC39) meta l transporter family: characterization of transporter properties. Mol Pharmacol 2006;70:171 180. 141. Nam H, Knutson MD. Effect of dietary iron deficiency and overload on the expression of ZIP metal ion transporters in rat liver. Biometals 2012;25:115 124.

PAGE 88

88 142. Collins JF, Franck CA, Kowdley KV, Ghishan FK. Identification of differentially expressed genes in response to dietary iron deprivation in rat duodenum. Am J Physiol Gastrointest Liver Physiol 2005;288:G964 971. 143. Liuzzi JP, Lichten LA, Rivera S, Blanchard RK, Aydemir TB, Knutson MD, Ganz T, et al. Interleukin 6 regulates the zinc transporter Zip14 in liver and contributes to the hypozincemia of the acute phase response. Proc Natl Acad Sci U S A 2005;102:6843 6848. 144. Thambiayya K, Wasserloos KJ, Huang Z, Kagan VE, St Croix CM, Pitt BR. LPS induced decrease in intracellular labile zinc, [Zn]i, contributes to apoptosis in cultured sheep pulmonary artery endothelial cells. Am J Physiol Lung Cell Mol Physiol 2011;300:L624 632. 145. Aydemir TB, Liuzzi JP, McClellan S, Cousins RJ. Zinc transporter ZIP8 (SLC39A8) and zinc influence IFN gamma expression in activated human T cells. J Leukoc Biol 2009;86:337 348. 146. Wang B, Schneider SN, Dragin N, Girijashanker K, Dalton TP, He L, Miller ML, et al. Enhanc ed cadmium induced testicular necrosis and renal proximal tubule damage caused by gene dose increase in a Slc39a8 transgenic mouse line. Am J Physiol Cell Physiol 2007;292:C1523 1535. 147. Girijashanker K, He L, Soleimani M, Reed JM, Li H, Liu Z, Wang B, e t al. Slc39a14 gene encodes ZIP14, a metal/bicarbonate symporter: similarities to the ZIP8 transporter. Mol Pharmacol 2008;73:1413 1423. 148. Besecker B, Bao S, Bohacova B, Papp A, Sadee W, Knoell DL. The human zinc transporter SLC39A8 (Zip8) is critical i n zinc mediated cytoprotection in lung epithelia. Am J Physiol Lung Cell Mol Physiol 2008;294:L1127 1136. 149. Liu Z, Li H, Soleimani M, Girijashanker K, Reed JM, He L, Dalton TP, et al. Cd2+ versus Zn2+ uptake by the ZIP8 HCO3 -dependent symporter: kineti cs, electrogenicity and trafficking. Biochem Biophys Res Commun 2008;365:814 820. 150. Speliotes EK, Willer CJ, Berndt SI, Monda KL, Thorleifsson G, Jackson AU, Lango Allen H, et al. Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. Nat Genet 2010;42:937 948. 151. Waterworth DM, Ricketts SL, Song K, Chen L, Zhao JH, Ripatti S, Aulchenko YS, et al. Genetic variants influencing circulating lipid levels and risk of coronary artery disease. Arterioscler Thromb Vasc Biol 2010;30:2264 2276. 152. Carrera N, Arrojo M, Sanjuan J, Ramos Rios R, Paz E, Suarez Rama JJ, Paramo M, et al. Association study of nonsynonymous single nucleotide polymorphisms in schizophrenia. Biol Psychiatry 2012;71:169 177.

PAGE 89

89 153. Raymond AD, Gekong e B, Giri MS, Hancock A, Papasavvas E, Chehimi J, Kossenkov AV, et al. Increased metallothionein gene expression, zinc, and zinc dependent resistance to apoptosis in circulating monocytes during HIV viremia. J Leukoc Biol 2010;88:589 596. 154. Besecker BY, Exline MC, Hollyfield J, Phillips G, Disilvestro RA, Wewers MD, Knoell DL. A comparison of zinc metabolism, inflammation, and disease severity in critically ill infected and noninfected adults early after intensive care unit admission. Am J Clin Nutr 2011 ;93:1356 1364. 155. Levy JE, Montross LK, Cohen DE, Fleming MD, Andrews NC. The C282Y mutation causing hereditary hemochromatosis does not produce a null allele. Blood 1999;94:9 11. 156. Trenor CC, 3rd, Campagna DR, Sellers VM, Andrews NC, Fleming MD. The molecular defect in hypotransferrinemic mice. Blood 2000;96:1113 1118. 157. Knutson MD, Walter PB, Ames BN, Viteri FE. Both iron deficiency and daily iron supplements increase lipid peroxidation in rats. J Nutr 2000;130:621 628. 158. Worthington MT, Browne L, Battle EH, Luo RQ. Functional properties of transfected human DMT1 iron transporter. Am J Physiol Gastrointest Liver Physiol 2000;279:G1265 1273. 159. Batey RG, Shamir S, Wilms J. Properties and hepatic metabolism of non transferrin bound iron. Dig Dis Sci 1981;26:1084 1088. 160. Scheiber Mojdehkar B, Zimmermann I, Dresow B, Goldenberg H. Differential response of non transferrin bound iron uptake in rat liver cells on long term and short term treatment with iron. J Hepatol 1999;31:61 70. 161. Shindo M, Torimoto Y, Saito H, Motomura W, Ikuta K, Sato K, Fujimoto Y, et al. Functional role of DMT1 in transferrin independent iron uptake by human hepatocyte and hepatocellular carcinoma cell, HLF. Hepatol Res 2006;35:152 162. 162. Thompson K, Molina RM, Brain J D, Wessling Resnick M. Belgrade rats display liver iron loading. J Nutr 2006;136:3010 3014. 163. Graham RM, Chua AC, Herbison CE, Olynyk JK, Trinder D. Liver iron transport. World J Gastroenterol 2007;13:4725 4736. 164. Bergmann OM, Mathahs MM, Broadhurst KA, Weydert JA, Wilkinson N, Howe JR, Han O, et al. Altered expression of iron regulatory genes in cirrhotic human livers: clues to the cause of hemosiderosis? Lab Invest 2008;88:1349 1357. 165. Anderson GJ, Vulpe CD. Mammalian iron transport. Cell Mol Lif e Sci 2009;66:3241 3261.

PAGE 90

90 166. Chepelev NL, Willmore WG. Regulation of iron pathways in response to hypoxia. Free Radic Biol Med 2011;50:645 666. 167. Takami T, Sakaida I. Iron regulation by hepatocytes and free radicals. J Clin Biochem Nutr 2011;48:103 106. 168. Brissot P, Ropert M, Le Lan C, Loreal O. Non transferrin bound iron: A key role in iron overload and iron toxicity. Biochim Biophys Acta 2012;1820:403 410. 169. Li YQ, Bai B, Cao XX, Zhang YH, Yan H, Zheng QQ, Zhuang GH. Divalent meta l transporter 1 expression and regulation in human placenta. Biol Trace Elem Res 2012;146:6 12. 170. Yamasaki T, Sakaida I. Hepatic arterial infusion chemotherapy for advanced hepatocellular carcinoma and future treatments for the poor responders. Hepatol Res 2012;42:340 348. 171. Zhou XY, Tomatsu S, Fleming RE, Parkkila S, Waheed A, Jiang J, Fei Y, et al. HFE gene knockout produces mouse model of hereditary hemochromatosis. Proc Natl Acad Sci U S A 1998;95:2492 2497. 172. Craven CM, Alexander J, Eldridge M Kushner JP, Bernstein S, Kaplan J. Tissue distribution and clearance kinetics of non transferrin bound iron in the hypotransferrinemic mouse: a rodent model for hemochromatosis. Proc Natl Acad Sci U S A 1987;84:3457 3461. 173. Postic C, Shiota M, Niswend er KD, Jetton TL, Chen Y, Moates JM, Shelton KD, et al. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell specific gene knock outs using Cre recombinase. J Biol Chem 1999;274:305 315. 174. Bradbury MW, Raja K Ueda F. Contrasting uptakes of 59Fe into spleen, liver, kidney and some other soft tissues in normal and hypotransferrinaemic mice. Influence of an antibody against the transferrin receptor. Biochem Pharmacol 1994;47:969 974. 175. Wang CY, Jenkitkasemwon g S, Sparkman BK, Shawki A, Mackenzie B, Knutson MD. Metal transport, subcellular localization, and tissue distribution of Zip8, a Zip14 homologue. FASEB J. 2012;26. 176. Galvez Peralta M, He L, Jorge Nebert LF, Wang B, Miller ML, Eppert BL, Afton S, et al ZIP8 Zinc Transporter: Indispensable Role for Both Multiple Organ Organogenesis and Hematopoiesis In Utero. PLoS One 2012;7:e36055. 177. Wang CY, Jenkitkasemwong S, Duarte S, Sparkman B, Shawki A, Mackenzie B, Knutson MD. ZIP8 Is an Iron and Zinc Transpo rter Whose Cell surface Expression Is Upregulated by Cellular Iron Loading. J Biol Chem 2012.

PAGE 91

91 178. Morgan EH, Smith GD, Peters TJ. Uptake and subcellular processing of 59Fe 125I labelled transferrin by rat liver. Biochem J 1986;237:163 173. 179. Kawabata H Germain RS, Ikezoe T, Tong X, Green EM, Gombart AF, Koeffler HP. Regulation of expression of murine transferrin receptor 2. Blood 2001;98:1949 1954. 180. Adams PC, Bradley C, Frei JV. Hepatic zinc in hemochromatosis. Clin Invest Med 1991;14:16 20. 181. V ayenas DV, Repanti M, Vassilopoulos A, Papanastasiou DA. Influence of iron overload on manganese, zinc, and copper concentration in rat tissues in vivo: study of liver, spleen, and brain. Int J Clin Lab Res 1998;28:183 186. 182. Anderson GJ, Frazer DM. Hep atic iron metabolism. Semin Liver Dis 2005;25:420 432. 183. Kumfu S, Chattipakorn S, Srichairatanakool S, Settakorn J, Fucharoen S, Chattipakorn N. T type calcium channel as a portal of iron uptake into cardiomyocytes of beta thalassemic mice. Eur J Haemat ol 2011;86:156 166. 184. Hojyo S, Fukada T, Shimoda S, Ohashi W, Bin BH, Koseki H, Hirano T. The Zinc Transporter SLC39A14/ZIP14 Controls G Protein Coupled Receptor Mediated Signaling Required for Systemic Growth. PLoS One 2011;6. 185. Hahn P, Song Y, Ying GS, He X, Beard J, Dunaief JL. Age dependent and gender specific changes in mouse tissue iron by strain. Exp Gerontol 2009;44:594 600.

PAGE 92

92 BIOGRAPHICAL SKETCH Chia Yu Wang was born in Taoyuan, Taiwan. She received her B achelor of Education degree in Nutritional Science and in Health Education from National Taiwan Normal University, Taipei, Taiwan. She worked with Dr. Li Ching Lyu as an undergraduate volunteer and helped in database management as well as initial statistical analy sis in a prospective study of dietary intakes and influential factors from pregnancy to postpartum on maternal weight retention in Taipei In August 2005 she came to the Department of Nutrition for the m aster program at University of Massachusetts, Amhe rst and reapplied for PhD program one year after working with the late Dr. Hiromi Gunshin in molecular mechanisms of liver iron accumulation S he joined Dr. M itchell Knutson in the Department of Food Science and Human Nutrition for the PhD program in Nutri tional Science at University of Florida in August 2008, continued her work in molecular aspects of iron metabolism.