<%BANNER%>
DARK ITEM
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UFE0044802/00001
 Material Information
Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-08-31.
Physical Description: Book
Language: english
Creator: Yuan, Xiong
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012
 Subjects
Subjects / Keywords: Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation
 Notes
Statement of Responsibility: by Xiong Yuan.
Thesis: Thesis (M.S.)--University of Florida, 2012.
Local: Adviser: Altpeter, Fredy.
Local: Co-adviser: Gallo, Maria.
Electronic Access: INACCESSIBLE UNTIL 2014-08-31
 Record Information
Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044802:00001


This item has the following downloads:

( CONFIG )

( PDF )


Full Text

PAGE 1

1 SUPPRESSION OF THE LIGNIN BIOSYNTHETIC GENE 4 COUMARATE COA LIGASE ( 4CL ) IN SUGARCANE BY RNA INTERFERENCE By Y UAN XIONG A THESIS PRESE NTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL F UL FILLMENT OF THE REQ UIREMENTS FOR THE DE GREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Yuan Xiong

PAGE 3

3 To my parents, Zhiyao for their support and unfaltering faith in me

PAGE 4

4 ACKNOWLEDGMENTS I am very gratef ul to my major advisor, Dr. Fredy Altpeter, f or his continual guidance, patience, encouragement and financial support. His knowledge of research and his enthusiasm for work has been a great source of inspiration for me. I thank my committee members for their time effort and guidance I also wish t o thank Dr. Maria Gallo and Dr. Robert Gilbert for their encouragement, their keen observations and helpf ul suggestions. Sincere thank s to Dr. Wilfred Vermerris for his instruction in lignin analysis. I thank all of my lab members for their assistance and camaraderie that made the lab an enjoyable working environment. I wo u l d e specially like to thank Je Hyeong Jung for his valuable suggestions and demonstrations I w o u l d like to thank Dr. Janice Zale for her assistance in editing my thesis. Sincere th ank s to Dr. Qianchun Zeng for his instruction s in tissue c u l ture Dr. Jae Yoon Kim for his instruction s in molec ul ar biology and Dr. Walid Fouad for his instruction in vector construction. I especially appreciate the friendship of Dr. Hao Wu, Dr. Hanging s Zhang, Yang Zhao, Yogesh Taparia and Elizabeth Mayers. There were other people outside of the lab who supported my research project I wo ul d like to thank Dr. Max Teplitski for his help with the MUG assay s and Dr s John Erickson and Lynn Sollenberge r for providing specific laboratory equipment and materials. I am gratef ul to Dr. Jerry M. Bennett for his moral support. Most of all I wo ul d like to express sincere appreciat ion to Zhiyao Luo for her continue d love, support and inspiration

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 11 Introduction ................................ ................................ ................................ ............. 11 Sugarcane Breeding ................................ ................................ ............................... 11 In Vitro Culture of Sugarcane ................................ ................................ .................. 13 Genetic Transformation of Sugarcane ................................ ................................ .... 14 RNA Interference (RNAi) ................................ ................................ ........................ 16 Biofuels ................................ ................................ ................................ ................... 17 Lignin B iosynthes is ................................ ................................ ................................ 19 2 COMPARISON OF PRO C EDURES FOR DNA COATING OF MICRO CARRIERS IN THE TRANSIENT AND STABLE BIOLISTIC TRANSFORMATION OF SUGARCAN E ................................ ................................ 22 Introduction ................................ ................................ ................................ ............. 22 Materials and Methods ................................ ................................ ............................ 24 Tissue Culture and Gene Transfe r ................................ ................................ ... 24 Selection and Regeneration of Transgenic Plants ................................ ............ 25 Analysis of Reporter Gene Activity ................................ ................................ ... 25 Statistical Analysis ................................ ................................ ............................ 26 Results ................................ ................................ ................................ .................... 26 Discussion ................................ ................................ ................................ .............. 27 3 RN AI S UPPRESSION OF 4 C OUMARATE COA LIGASE ( 4CL ) IN SUGARCANE ................................ ................................ ................................ ......... 33 Introduction ................................ ................................ ................................ ............. 33 Materials and Methods ................................ ................................ ............................ 36 Cloning of Sc4CL and Vector Construction ................................ ...................... 36 Tissue Culture, Biolistic G ene T ransfer, and Plant Regeneration ..................... 37 NPTII ELISA ................................ ................................ ................................ ..... 38 Northern Blot Analysis ................................ ................................ ...................... 38 Small RNA Northern Blot Analysis ................................ ................................ ... 39 Southern Blot Analysis ................................ ................................ ..................... 39

PAGE 6

6 Quantitative Real Time RT PCR Analysis ................................ ........................ 39 Acetyl Bromide (AcBr) Lignin Analysis and Visual Observations ...................... 40 Statistics ................................ ................................ ................................ ........... 41 Results ................................ ................................ ................................ .................... 41 Cloning and Expression Pattern of Sc4CL_2 ................................ ................... 41 Suppression of Sc4CL_2 by RNAi ................................ ................................ .... 41 Analysis of Lignin Content and Evaluation of Phenotype ................................ 42 Discussion ................................ ................................ ................................ .............. 43 4 C ONCLUSION ................................ ................................ ................................ ........ 53 APPENDIX LABORATORY PROTOCOLS USED IN MOLECULAR BIOLOGY, BIOLISTICS TISSUE CULTURE, AND IDENTIFICATION/CHARACTERIZATION OF TRANSGENIC SUGARCANE PLANTS ................................ ................................ .............. 56 LIST OF REFERENCES ................................ ................................ ............................... 74 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 88

PAGE 7

7 LIST OF TABLES Table page 2 1 Stable transformation efficiency for three coating treatments ............................ 29 3 1 Means S.E. for plant height, fresh weight, node diameter, AcBr lignin content, and qRT PCR expression for four transgenic plants and non transgenic sugarcane CP88 1762 control ................................ .......................... 46

PAGE 8

8 LIST OF FIGU RES Figure page 2 1 Schematic representation of the uidA expression cassette and the npt II expression cassette. ................................ ................................ ........................... 30 2 2 Transient GUS expression level in sugarcane callus 48 hours after bombardment. ................................ ................................ ................................ .... 31 2 3 Southern blot analysis of the stable transformed sugarcane lines. ..................... 32 3 1 Schematic representation of the sugarcane 4CL partial genomic sequence Sc4CL_2 cDNA clone and the RNAi suppression cassette. ............................ 47 3 2 The expression pattern o f Sc4CL_2 in non transgenic control plants. ................ 48 3 3 Vegetative progeny of transgenic sugarcane lines with RNAi suppression of Sc4CL 2 grown under controlled environment conditions ................................ 49 3 4 Northern blot analysis. ................................ ................................ ........................ 50 3 5 Southern blot analysis of independent sugarcane transformants. ...................... 51 3 6 Small RNA northern blot.. ................................ ................................ ................... 52

PAGE 9

9 Abstract of T hesis Presented to the Graduate School of the University of Florida in Partial F ul fillment of the Requirements for the Degree of Master of Science SUPPRESSION OF THE LIGNIN BIOSYNTHETIC GENE 4 COUMARATE COA LIGASE ( 4CL ) IN SUGARCANE BY RNA INTERFERENCE By Yuan Xiong A ugust 2012 Chair: Fredy Altpeter Cochair: Maria Gallo Major: Agronomy Sugarcane ( Saccharum spp. ) is one of the most productive herbaceous monocot s use d as the main source of table sugar and as a feedstock in the production of ethanol. In this study DNA coating protocols for biolistic gene transfer w ere compared, and w ere used to produce trans genic sugarcane with decrease d lignin content presumably more amenable to fermentation into cell ul osic ethanol. Biolistic gene transfer is a relatively rapid, genotype independent method of producing transgenic plants T hree methods of precipitating DNA o nto gold microparticles were compare d in biolistic gene transfer : spermidine free base, protamine s ul fate, and the proprietary Seashell DNAdel TM Gold Carrier For stable transformation using minimal, linear expression cassettes, protamine, spermidine and th e Seashell DNAdel TM Gold c arrier were equally effective. For transient gene expression, spermidine res ul ted in significantly higher efficiencies compared to the other two protocols. Stable transgenic sugarcane lines were produced using biolistic gene trans fer of an RNAi hairpin construct, targeted to downreg ul ate the 4 coumarate CoA Ligase ( 4CL ) gene involved in lignin bio synthesis The transgenic sugarcane lines were characterized by Southern blot northern blot siRNA northern blot s, and

PAGE 10

10 q uantitative Real time RT PCR. Three lines with strong suppression of 4 CL and one line with moderate suppression of 4CL were selected for lignin analysis. A trend of lignin reduction was observed in all four transgenic sugarcane lines, with two of them produc ing significan tly less lignin (5 9%) than non transgenic control L ignin reduction of 5% in transgenic sugarcane did not compromise biomass production under controlled environment conditions. The res ul ts presented here indicate successf ul RNAi suppression of the targete d 4CL gene of the highly polyploid sugarcane and its potential prospects for crop improvement

PAGE 11

11 CHAPTER 1 LITERATURE REVIEW Introduction In 2010, the Food and Agric ul ture Organization (FAO) reported that a total of 1. 7 billion tons of sugarcane were pro duced on 23.8 million hectares ( ha ) of c ul tivated land worldwide (FAO 2010). The five largest sugarcane producing countries, in decreasing order, are Brazil, India, China, Thailand and Mexico (FAO 2010). The average sugarcane yield in Brazil was 79 1 tons/ ha. This yield was higher than the sweet sorghum yield in China (65 tons/ha) and the corn yield in the United States (95 tons/ha) ( FAO 2010 ; Dal Bianco et al. 2012 ). Sucrose in sugarcane is the source of approximately nd in 2011, approximately 54% of the industrialized sugarcane production was dedicated to sucrose based biofuel production to generate 27.67 billion liters of bioethanol (Dal Bianco et al. 2012). It has been recognized that the use of sugarcane residues wi ll be a valuable source of cell ul osic materials for bioethanol production (Altpeter and Oraby 2010). Sugarcane Breeding The genus Saccharum is composed of six species S accharum officinarum S accharum spontaneum S accharum robustum S accharum barberi S acc harum sinense and S accharum cinarum ( Tew and Corbill, 2008 ). C ul tivated sugarcane ( Saccharum spp. hybrid s ) is a highly polyploid interspecific hybrid with genetic contributions from these species and other related grass genera (Brandes 1958; Purseglove 1 972; Daniels and Roach 1987 ; Altpeter and Oraby 2010 ). Current sugarcane c ul tivars are derived from crosses between S. officinarum and S. spontaneum to incorporate traits for higher yield and pathogen resistance. The

PAGE 12

12 interspecific hybrids are backcrossed t o S. officinarum several times to reconstitute the S. officinarum genetic background (Matsuoka et al. 2009). Traditional breeding of sugarcane is impeded by a narrow gene pool and complex genom e because most c ul tivars are derived from a relatively small g roup of progenitor clones (Jackson 2005). Other factors such as infertility, long breeding cycles, and cold intolerance also limit breeding advancements of some sugarcane lines. Despite these limitations, conventional breeding of sugarcane has significa ntly improved yield, sugar content, ratooning ability, and disease resistance over the last three to four decades (Jackson 2005; Lakshmanan et al. 200 6 ; Ming et al. 2006). In Brazil, sugarcane yield and sugar content have increased 69% and 34%, respectivel y, during the last 35 years (FAO 2010; Dal Bianco et al. 2012). Biotechnology and molec ul ar breeding have become important tools for introducing new traits and accelerating sugarcane breeding Through genetic engineering and marker assisted selection, sug arcane lines with improved pathogen resistance, herbicide tolerance, increased sucrose yields, and floral inhibition have been regenerated and evaluated in the field (Matsuoka 2009). Because sugarcane is vegetative ly propagated, this prevents the problem o f segregating progeny and reduces the risk of introducing transgenes into the environment (Bonnett et al. 2008). However, The complexity of the sugarcane genome also can impede the use of certain molec ul ar tools (Arruda 2011). For example, i t is diffic ul t to sequence sugarcane because of its highly polyploid and aneuploid genome (Dal Bianco et al. 2012). Other limitations include relatively low transformation efficiencies and transgene silencing (Hota et al. 2011). Therefore, s trategies such as the use of molec ul ar markers, whole genome shot

PAGE 13

13 gun sequencing (WGS) and BAC to BAC map based cloning are expected to contribute to sugarcane molec ul ar breeding in the future (Dal Bianco et al. 2012). Sugarcane genome database s like the SUCEST database also have prov en usef ul in molec ul ar studies of sugarcane (Nishiyama et al. 2010). In Vitro C ul ture of Sugarcane In vitro c ul ture is a valuable tool for the genetic engineering of sugarcane. Substantial progress has been made in utilizing young meristematic tissues whic h have the ability to develop into whole plants via embryogenesis or organogenesis (Altpeter and Oraby 2010). The first reports of in vitro c ul ture in sugarcane were published 1969 ( Barba and Nikell 1969 ; Heinz and Mee 1969). Somatic embryos can be formed via indirect embryogenesis, with a callus stage, or direct embryogenesis, without a callus stage. During indirect embryogenesis, somatic embryos are derived from pro embryogenic masses induced from single cells (Vasil and Vasil 1994). Plant regeneration f rom calli derived from immature inflorescences (Gallo and Irvine 1996), basal shoot meristems (Arencibia et al. 1998) and immature leaves (Snyman et al. 2001) have been reported. The embryogenic calli induced from these protocols have been widely used as s tarting materials for transformation experiments. Nevertheless, limitations include long periods of callus c ul ture increasing the possibility of somaclonal variants and genotypic restrictions (Snyman et al. 2006). Alternately, direct somatic embryos derive d from single cells also have been reported (Ho and Vasil, 1983). Compared to indirect embryogenesis, direct embryogenesis generally produces plants that are more genetically uniform (Vasil et al. 1987), require no time in the callus phase, and as a conseq uence, produce fewer somaclonal variants (Burner 1995). Protocols for direct

PAGE 14

14 embryogenesis in sugarcane have been established with immature leaf whorls (Snyman et al. 2006 ; Taparia et al. 2012 ) and segments of immature inflorescence (Desai et al. 2004). Em bryogenesis is also efficient in eliminating viruses from the explants (Goussard and Wiid 1992; Strandberg 1993). This is because the vasc ul ar system between somatic embryos and explants are not interconnected (Newton and Goussard 1990). Organogenesis in cludes three steps: dedifferentiation, re entry of quiescent cells into the cell cycle, and determination of specific organ formation (Sugiyama 1999 ; Altpeter and Oraby 2010 ). Organogenesis has been extensively used in the commercial propagation of sugarca ne, primarily using nodal buds which also eliminates viruses (Lakshamanan et al. 2005). Genetic Transformation of Sugarcane Agrobacterium mediated and biolistic transformation protocols are the most common gene delivery methods in plant genetic engineerin g (Vain 2007). In general, Agrobacterium mediated transformation generates transgenic plants with simple transgen e integration patterns, but this procedure may be genotype dependent. In contrast, biolistic gene transfer generally produces more complex tra nsgene integration patterns. However it is less genotype dependent, and vector construction is more facile as m ul tiple unlinked transgene expression cassettes can be co bombarded, which is usef ul in pathway engineering (Wu et al. 2002; Datta et al. 2003; Altpeter et al. 2005). I mprovements of and modifications to sugarcane transformation protocols have been reported (Khanna et al. 2008; Kim et al. 201 2 ; Taparia et al. 201 2 ). Biolistics is the preferred method of gene delivery because a variety of target tissues can be used and a wide range of genotypes are amenable to transformation

PAGE 15

15 (Lakshmanan et al 200 6 ). Pioneer ing studies i n biolistic gene transfer to sugarcane w ere reported in the 19 90 s ( Bower and Birch 1992; Gallo Meagher and Irvine 1993; Gallo M eagher and Irvine 1994; Gallo and Irvine 1996 ; Meagher et al. 1996 ) Following th e s e reports biolistics has been used to deliver novel genes into sugarcane Various traits such as insect or disease resistance (Nutt et al. 1999; Setamou et al. 2002; Fal co and Silva Filho 2003; Weng et al. 2006; Gilbert et al. 2009), herbicide tolerance (Falco et al. 2000; Leibbrandt and Snyman 2003), and drought tolerance ( Correa Molinari et al. 2007; Wu et al. 2008) Also the accum ul ation of sucrose or sucrose isomers ( Ma et al. 2000; Groenewald and Botha 2008 ; Hamerli and Birch 2011; Basnayake et al. 2012 ) cell ul olytic enzymes (Mark et al. 2011) and other valuable molec ul es ( L a rs A Petrasovits et al. 2012) have been goals of transformation experiments. E mbryogenic call us is the prefer red tissue for biolistic transformation due to the high plant regeneration potential Successf ul transformation of sugarcane has also been achieved using cell suspension c ul tures which readily regenerate plants (Chowdhury and Vasil 1992), a pical meristems (Gambley et al. 1993), leaf whorls, and inflorescences (Elliott et al. 2002). The first reports of Agrobacterium mediated sugarcane transformation were published in 1998 (Arencibia et al. 1998; Enriquez Obregon et al. 1998). Arencibia et al. (1998) generated transgenic sugarcane by co c ul tivation of calli with Agrobacterium strain s LBA4404 and EHA101. Enriquez Obrigon et al. (1998) co c ul tivated immature leaf explants with Agrobacterium strain G V 2260. Agrobacterium mediated transformatio n of sugarcane was also reported using axillary buds as explants (Manikavasagam et al. 2004). Agrobacterium mediated transformation has been widely used in sugarcane improvement, such as for pathogen resistance, protein expression,

PAGE 16

16 and herbicide tolerance (Enriquez et al. 200 0 ; Manickavasagam et al. 2004 ; Kalunke et al. 2009 ). In addition, Agrobacterium mediated transformation has been a tool in functional genomics and to alter metabolic reg ul atatory mechanisms in sugarcane (Melotto Passarin 2009 ; Wang e t al. 2009 ). RNA Interference (RNAi) RNA interference (RNAi) is an RNA dependent gene silencing phenomenon conferred by double stranded RNA (dsRNA) that occurs in plants, worms, insects, and mammals I t is a mechanism that induces resistance to pathogens, genetic reg ul ation, and gene silencing (Kusaba 2004). The phenomenon of RNAi was first reported as coat protein mediated virus protection in transgenic plants (Ecker and David 1986) and since then, the mechanisms of RNAi have been elucidated (Fire and Me llo 1998). The common mechanism for all RNAi phenomena is the endonucleolytic fragmentation of long dsRNAs into small interfering RNAs (siRNAs) by a ribonuclease enzyme, Dicer (Kusaba 2004; Watanabe 2011). Dicer binds to the long dsRNA and this triggers c leavage into 19 25 bp siRNA fragments (Berstain et al. 2001). The siRNAs are then unwound into single stranded RNAs (ssRNAs) that bind to an enzyme complex, the RNA induced silencing complex (RISC) (Kusaba 2004). The activated RISC siRNA complex binds to complementary mRNAs within the cytoplasm to trigger additional endonucleolytic cleavage reactions until the majority of the target mRNAs are degraded. This process silences gene expression by preventing translation of a gene or gene family. MicroRNAs (m iRNAs) are endogenous siRNA like, non coding RNAs involved in genetic reg ul ation of developmental growth stages and in physiology responses (Kusaba 2004; Poethig et al. 2006). They are structurally similar to siRNAs and share

PAGE 17

17 similar mechanisms of targete d mRNA degradation. Primary miRNAs (pri miRNAs) are transcribed and folded into 70 nucleotide stem loop RNA structures, pre mRNAs (Gregory et al. 200 6 ). The dsRNA portion of this structure is recognized by Dicer and is cleaved into fragments as mature miR NAs. These miRNAs are less specific in base pairing with target mRNAs than siRNAs. siRNAs and miRNAs are important mechanisms of silencing gene expression. The former can be applied in genetic engineering and functional genomics to knockdown, rather than knockout, gene function, while the latter is an essential, innate mechanism of gene silencing and gene reg ul ation during plant growth and development (Voorhoeve and Agami 2003; Watanabe 2011). Biofuels energy demands have forced technological developments in the renewable energy sectors such as plant biomass, plant oils, wind, hydro electric solar, and geothermal energy. Cell ul osic bioethanol and biodiesel produced by the utilization of lignocell ul osic feedstocks and plants oils, respectively, co ul d potentially replace part of petroleum consumption (Sarkar et al. 2012). In addition, biofuels are forecast to reduce 50% of greenhouse gas emissions compared to emissions from fossil fuels (EPA 2010). Curr ently, the bioethanol produced from starch and sucrose based technologies are the most widely used biofuels in motor vehicles. Global production of bioethanol reached approximately 88 billion liters in 2011 ( RFA 2011a ). The US and Brazil are the two large st producers, responsible for 85% of global bioethanol production (RFA 2011 b ). In the US, significant quantities of bioethanol are produced from starch derived from corn, whereas in Brazil, bioethanol is produced from sucrose found in sugarcane.

PAGE 18

18 In order to increase bioethanol production, and avoid the competition of food versus fuel commodities grown on limited far ml and at escalating prices, it is desirable to produce bioethanol from lignocell ul osic biomass (Schubert 2006). Lignocell ul osic biomass is an i nexpensive, abundant, and renewable source material. This feedstock includes grasses, wood chips, sawdust, and crop residues such as sugarcane bagasse, and straw from corn, rice, or wheat (Sarkar et al. 2012). It is estimated that by usin g l ignocell ul osic biomass, ethanol yields co ul d be drastically increase d (Kim et al. 2004 ; Vermerris 2008 ). Due to its inherent strength and diverse polymeric structure, there are limitations to the utilization of lignocell ul osic feedstocks. Lignocell ul ose is a complex st ructure in which the polysaccharides (cell ul ose and hemicell ul ose) are crosslinked with the lignin via ester and ether linkages Lignin imparts rigidity to the cell wall, provides stiffness and strength to the stem, defense against pathogens, and water tr ansport within the xylem (Boerjan et al. 2003). Lignin is the most recalcitrant component in the cell wall and it impedes enzymatic hydrolysis of cell ul ose and hemicell ul ose. Altering the lignin composition or lignin content, as well as the type of bonds w ithin the lignin, cell ul ose and hemicell ul ose polymers are promising strategies to produce high quality biomass feedstock ( Vermerris et al. 200 7 ; Hisano et al. 2009). The production of ethanol from lignocell ul os ic feedstocks essentially consists of three steps: pretreatment, enzymatic hydrolysis or saccharification, and fermentation. Pretreatment breaks down the cell wall matrix, rendering it more accessible to hydrolysis. Different pretreatments such as steam explosion, liquid hot water extraction, acid and alkali t reatments, physical methods, a wet oxidation method, and biological

PAGE 19

19 degradation have been tested on different lignocell ul osic materials (Sarkar et al. 2012). In enzymatic hydrolysis, cell ul ases convert the polysaccharides present in cell ul ose a nd hemicell ul ose to simple monomeric sugars, primarily glucose and xylose, respectively, in addition to other minor sugars. These monomeric sugars are fermented to ethanol by microorganisms in the final step. There is room for improvement in almost every step of bioethanol production from lignocell ul osic feedstocks (Schubert 2006). Current research to optimize the processes include developing novel cell ul ases, bioengineering microbes for fermentation with broader substrate specificities and higher effici encies, reducing the inhibitors of fermentation, designing higher quality biomass feedstocks, and implementing novel pretreatment technologies. It is believed that these efforts will eventually decrease the costs associated with cell ul osic ethanol producti on. Lignin B iosynthesis Lignin is a phenolic polymer mainly present in the cell walls of vasc ul ar plants (Zhao and Dixon, 2012). It is primarily composed of three hydroxycinnamyl alcohols: coniferyl alcohol, sinapyl plants is variable depending on cell type and species. During the last decade, revisions to the lignin biosynthetic pathway have continually been made because of new res ul ts obtained from mutant analyses and reverse genetics in a variety of species (Vanholme et al. 2010). Monolignols are b iosynthesized from the amino acid phenylalanine via the phenylpropanoid and the monolignol pathways (Umezawa 2009). It is currently thought that twelve major gene families are involved in the lignin biosynthetic pathway (Zhao and Dixon, 2012). The phenylpr opanoid pathway is also important for the biosynthesis of plant secondary

PAGE 20

20 compounds such as coumarins, suberins, flavonoids, isoflavonoids, and stilbenes (Boud et al. 2007; Umezawa 2009). Recent data suggest that lignin biosynthesis is reg ul ated by variou s transcription factors. AC rich promoter elements, which are the binding motifs for MYB transcription factors, are found in most lignin biosynthetic genes except fer ul ic acid 5 hydroxylase ( F5H ) (Zhao and Dixon, 2012). Various transcription factors appear to act differently For example, transcription factors MYB46 and MYB83 can activate the entire formation of secondary cell walls, while AtMYB85, AtMYB58 and AtMYB63 are lignin specific ( Zhong et al. 2008 ; McCarthy et al. 2009; Zhou et al. 2009; Zhao and Di xon, 2012). Additionally, lignin deposition in response to various stim ul i may be reg ul ated by the binding of activators such as NAC transcription factor ( NST ) or its homolog VND, or it can be downreg ul ated by lignin repressors such as AtMYB32, which acts in non lignified floral tissue (Zhao and Dixon, 2012). Additionally, the activities of lignin transcriptional factors are closely related to the developmental stage of the plant, the environment condition, and the hormone status of the plant (Zhao and Di xon, 2012). To date, the exact mechanism of transport of monolignols to the cell wall where they become polymerized into lignin, remains largely unknown ( Ehlting et al. 2005 ; Lanot et al. 2006; Kaneda et al. 2008). Lignin polymerization starts with the ox idization of monolignol phenols, generating phenolic radicals. Subsequently, single monomer radicals couple to form dimers by establishing covalent bonds between the subunits (Vanholme et al. 2010). Following dimerization, they are dehydrogenated by peroxi dases/laccases into phenolic radicals that connect to other monomer or dimer radicals to form the lignin polymers (Vanholme et al. 2010).

PAGE 21

21 stim ul ated technological developments in the r enewable energy sectors such as plant biomass, plant oils, wind, hydro electric solar, and geothermal energy. Cell ul osic bioethanol and biodiesel produced by the utilization of lignocell ul osic feedstocks and plants oils, respectively, co ul d potentially r eplace petroleum (Sarkar et al. 2012). In addition, biofuels are forecast to reduce 50% of greenhouse gas emissions compared to emissions from fossil fuels (EPA 2010).

PAGE 22

22 CHAPTER 2 COMPARISON OF PRO C EDURES FOR DNA COATING OF MICRO CARRIERS IN THE TRANSIEN T AND STABLE BIOLISTIC TRANSFORMATION OF SUGARCANE Introduction Biolistic transformation (also termed microparticle bombardment) is a direct plant transformation method (Klein et al. 1987). With this technique, plasmid DNA is precipitated onto particles i n the presence of positively charged polyamine and buffer followed by bombardment of plant cells with DNA coated particles. Biolistic transformation has become an important tool for studying gene expression and for crop improvement (Taylor et al. 2002). Co mpared to Agrobacterium mediated transformation, biolistic transformation is less genotype dependent (Altpeter et al. 2005) and vector construction is simplified since m ul tiple unlinked transgene expression cassettes can be co bombarded (Datta et al. 200 2 ; Wu et al. 2002 ). In preparation for biolistic transformation, plasmid DNA is typically precipitated onto gold or tungsten micro particles in the presence of spermidine and CaCl 2 (Klein et.al 1987; Finer et.al 1992 ; Sanford et al. 1993). Spermidine is a c ationic polyamine, naturally produced in all eukaryotes and most prokaryotes and plays an important role in germination, root development, flowering and abiotic/biotic stress resistance (Minois et al. 2011; Wimalasekera et al. 2011). Spermidine stabilizes the DNA double helix (Tabor 1962) and leads to its compaction and precipitation following electrostatic interactions (Razin and Rosansky 1959). Spermidine also prevents activation of endonucleases and DNA fragmentation (Brune et al. 1991). The use of sperm idine for biolistic transformation was first described by Sanford and collaborators in order to promote DNA precipitation onto microparticle (Klein et.al 1987). It has become the

PAGE 23

23 standard coating reagent in biolistic transformation (Sivamani et al. 2009). Although Perl et al. (1992) reported higher transformatio n efficiency without spermidine subsequent studies concluded that spermidine increases transformation efficiency (Rasco Guant et al. 1999; Sivamani et al. 2009). The l ack of spermidine during DNA c oating res ul ted in decreased precipitation efficiency and loss of DNA during the washing steps (Rasco Guant et al. 1999). As an alternative to spermidine, other cationic polymers have been used to condense and stabilize DNA for delivery in animal studies (Wagner et al. 1991). More recently protamine was used for precipitation of DNA onto gold particles prior to biolistic gene transfer into maize and rice (Sivamani et al. 2009). Protamine is a small arginine rich protein produced in spermatids where it cont ributes to condensation of the genome (Balhorn 2007). The protamine coated plasmid DNA resisted degradation by DNase longer than spermidine coated plasmid DNA (Sivamani et al. 2009). Seashell DNAdel TM Gold Carrier Particles (Seashell Biotechnology, La Jol la, CA) have a COOH terminal modification that has a neutral charge in the binding buffer and is negatively charged at physiological pH. The proprietary precipitation buffer supplied with the DNAdel TM Gold Carrier Particles is free of spermidine (free bas e) or protamine used in the other DNA precipitation methods. In this study, transient and stable transformation efficiencies for sugarcane were evaluated following the precipitation of minimal transgene expression cassettes onto gold particles using protam ine, spermidine or Seashell DNAdel TM (Seashell) protocols.

PAGE 24

24 Materials and Methods Tissue C ul ture and Gene Transfer Sugarcane embryogenic callus was induced from immature leaf cross sections on modified MS basal medium (CI3) (Chengalrayan and Gallo Meagher 2001) at 28C under illumination (150 mol m 2 s 1 ) with a 16 h light/8 h dark regime.Transient GUS expression was assayed as described by Allen et al. (1993). Embryogenic callus was bombarded with uidA (Jefferson et al. 1987) under the transcriptional con trol of the maize ubiquitin promoter (Christensen et al. 1992) with first intron (Toki et al. 1992) and ) (Fig. 2 1 A ) following 4 hours of osmotic treatment on CI3 medium (72.7 g L 1 D sorbitol ). Bombardments were performed with the PDS 1000/He Particle Delivery System (Bio Rad, Herc ul es, CA) according to the protocol described by Sandhu and Altpeter (2009). C alli (25 30) were placed in the center of the petri dish to cover a circ ul ar area of 4.6 cm 2 per bombardment. Gold particles (1 m diameter, Bio Rad) were suspended in 50% glycerol (v/v). The suspension of gold particles was vortexed and 1.8 mg 30 L 1 were transferred to a 1.5 m L Eppendorf tube (Eppendorf, Hamburg, German y ) The uidA cassette DNA (1 g 30 L 1 ) was transferred to the suspension of gold particles and mixed by vortexing for 1 0 sec. Then 20 L of 0.1 M spermidine (Sigma, St. Louis, MO) or 20 L of protamine (1 mg m L 1 ) (Sigma) and 50 L of 2.5 M CaCl 2 were added for precipitation of DNA onto the gold particles during continuous vortexing (1 min) Spermidine and protamine were used in concentrations that res ul ted in the highest transformation efficiency in earlier experiments by Sivamani et al. (2009). The mixture was centrifuged briefly and washed 2 times with absolut e ethanol. The DNA coated gold particles were resuspended in 90 L absolute ethanol by sonication for 2 s (Branson, Danbury, CT). Alternatively DNA was precipitated onto

PAGE 25

25 Seashell DNAdel TM gold particles using the proto col provided by the manufacturer (htt p://www.seashelltech.com/protocols.sht ml ). In brief, 1.5 mg of Seashell DNAdel TM gold particles (s1000d) were suspended in 50 L binding buffer (20 mM sodium acetate, pH 4.5) and mixed with 1 g of the uidA cassette DNA in a 1.5 m L tube by vortexing for 10 s. A n equal volume of precipitation buffer was added and incubated at room temperature for 3 min. The DNA particle mixture was washed and resuspended following the same protocol described for spermidine/protamine coating. Following bombardment callus was transferred to CI3 medium. Selection and Regeneration of Transgenic Plants For stable transformation, callus induction and particle bombardment were carried out with the same procedure described for transient transformation. Callus was bombarded with a n pt II expression cassette (Fraley et al. 1983) under the control of the maize ubiquitin 2 1 B ). Callus selection and plant regeneration w ere performed as described by Kim et al. (2012). In brief, bombarded callus was transferred to CI3 medium without selective agent for 1 week followed by three biweekly subc ul tures on CI3 medium containing 20 mg L 1 geneticin. Callus regeneration occurred after two to three biweekly subc ul tures on hormon e free medium containing 20 mg L 1 paromomycin and formed roots after 2 4 additional biweekly subc ul tures on paromomycin containing hormone free medium. Analysis of Reporter Gene Activity All calli from each bombarded plate were transferred 48 h after bom bardment into one 2 m L tube (Eppendorf) followed by protein extraction (Jefferson et al. 1987). Protein concentration of each sample was determined using CoomassiePlus Protein Assay reagent (Thermo Fisher Scientific Inc., Rockfort, IL) and bovine serum alb umin

PAGE 26

26 standards. Sample fluorescence was measured with a VICTOR TM X3 M ul tilabel Plate Reader (Perkin Elmer, Waltham, MA) using 365 nm excitation; 460 nm emission filters after 0, 30 and 60 min incubation with MUG assay buffer (Sigma) in the dark. GUS activi ty was normalized by subtracting the average fluorescence reading of negative control samples (bombarded without uidA ). Statistical Analysis Statistical analysis was performed using the SAS system (SAS 2009) and the general linear model (GLM) procedure wi th the t test was applied. Res ul ts Spermidine res ul ted in 3 times higher transient GUS expression than protamine and 2 .65 times higher expression than the Seashell method on average over 10 coating reactions per treatment (Fig. 2 2). Protamine coating di d not res ul t in significant different transient GUS activity than Seashell coating (p< 0.05). Initially, the transgenic nature of the regenerated lines was confirmed by PCR and NPTII ELISA (data not shown). From a total of three independent experiments an d 30 bombardments per treatment 53, 48 and 41 independent transgenic sugarcane lines were produced following spermidine, protamine or Seashell coating reactions, respectively (Table 2 1). The three coating reactions did not differ significantly in stable t ransformation efficiency (p<0.05). For Southern blot hybridization analysis, six lines derived from the spermidine treatment, four lines from the protamine treatment and four lines from the Seashell treatment were rando ml y selected. In contrast to genomic DNA from non transgenic sugarcane, all of the transgenic lines displayed hybridization signals following digestion with Eco RI and hybridization with npt II. The pattern of the hybridization signals differed

PAGE 27

27 for all the evaluated lines. The number of npt II hybridization signals ranged from one to more than 10. A trend for increased complexity following protamine coating compared to Seashell and spermidine was observed with this relatively small number of evaluated samples (Fig. 2 3). Discussion The procedur e that is used for precipitation of DNA onto gold micro particles prior to biolistic transformation may impact transformation success and efficiency (Rasco Guant et al. 1999; Sivamani et al. 2009). Typically DNA is precipitated onto micro particles in the presence of spermidine and CaCl 2 for biolistic transformation of plants (Klein et al. 1987; Finer et al. 1992; Sivamani et al. 2009 ) including sugarcane (Bower and Birch 199 2 ). While the earlier publications utilized f ul l plasmids for biolistic gene transf er, recently minimal expression cassettes without vector backbone were introduced into sugarcane (Kim et al. 2012) and other crops (Fu et al 2000; Romano et al. 2003; Lowe et al. 2009). Sivamani et al. (2009) reported that by using a cationic polymer prot amine instead of spermidine for biolistic transfer of f ul l plasmids to rice and maize res ul ted in a over 5 fold increase in transient transformation efficiency and 3.3 fold increases in stable transformation efficiency. Our observations in sugarcane sugge st that for stable transformation of minimal, linear expression cassettes by biolistic transfer to sugarcane protamine, spermidine and Seashell protocol s are equally effective. In contrast to the earlier report the current study utilized linear DNA molec ul es. Interestingly in our observations, spermidine res ul ted in significantly higher transient expression than the other two precipitat ion protocols. This may suggest that spermidine may be more efficient in precipitation of the linear minimal expression cas sette DNA. The fact that this does not translate into significantly more stable trans genic events

PAGE 28

28 compared to the two other methods co ul d be explained by inferior protection by spermidine against degradation compared to the other coating agents. Sivamani e t al. (2009) found that protamine coating protects plasmid DNA longer from degradation by DNase than spermidine. Southern blot res ul ts suggest that protamine coating may contribute to increased copy number when compared to Seashell and spermidine The copy number following biolisitic gene transfer depends on the quantity of the DNA that is delivered to the nucleus (Sandhu and Altpeter 2008, Lowe et al. 2009, Kim et al. 2012). Further experiments sho ul d clarify if differences observed after the different coa ting reactions are associated with the precipitation efficiency, release of the DNA from the gold particle or stability of the delivered DNA in the cell ul ar environment. Fur ther optimizations of the coating protocols may be possible by changing the concent ration of DNA, cationic polyamine or CaCl 2 (Zlatanova et al. 1998; Makita et al. 2009). In conclusion, we observed that DNA precipitations using spermidine, protamine or the Seashell DNAdel TM protocol are similarly effective for stable genetic transformatio n of sugarcane by biolistic gene transfer.

PAGE 29

29 Table 2 1. Stable transformation efficiency for three coating treatments Treatment Experiment Number of bombardments Number of transgenic plants Number of transgenic plants/ bombardment Spermidine I 8 13 1.6 3 II 8 15 1.88 III 14 25 1.79 Spermidine total 30 53 1.76 0.07 a Protamine I 8 23 2.88 II 8 9 1.13 III 14 16 1.14 Protamine total 30 45 1.71 0.58 a Seashell DNAdel TM I 8 7 0.88 II 8 9 1.13 III 14 2 5 1.79 Seashell DNAdel TM total 30 41 1.26 0.27 a

PAGE 30

30 Figure 2 1. A, Schematic representation of the uidA expression cassette used for transient transformation assays. B, Schematic representation of the npt II expression cassette for stable transformation analysis. The black line underneath npt II gene represents the npt II ORF region (703 bps) that was used as probe in Southern blot hybridization.

PAGE 31

31 Figure 2 2. Transient GUS expression in sugarcane callus 48 hours aft er bombardment. Gold particles were coated with expression cassette DNA using spermidine or protamine or following the Seashell DNAdel TM protocol. Each column represents the mean value of 10 different coating reactions per treatment. The standard error ba r is shown. Significant differences at P<0.05, are indicated by different letters.

PAGE 32

32 Figure 2 3. Southern blot analysis of stable transformed sugarcane lines. Genomic DNA was hybridized with a radiolabeled 703 bp npt II probe following restriction digestion with Eco RI. M, 2 Log DNA ladder (0.1 10.0kb); wt, non transgenic CP88 1762 sugarcane control ; 1 6, sugarcane transformed with spermidine; 7 10, sugarcane lines transformed with protamine; 11 14, sugarcane transformed with Seashell DNAdel TM Gold c arrier

PAGE 33

33 CHAPTER 3 RNAI SUPPRESSION OF 4 COUMARATE COA LIGASE ( 4CL ) IN SUGARCANE Introduction corn and sugarcane as feedstocks, respectively (Valdes 2011). Th ese first generation energy crops can be efficiently converted to biofuels because the sucrose store d in sugarcane internodes can be directly fermented into ethanol and the corn starch can be readily converted to fermentable glucose (Bai et al. 2008; Ra e t al. 2012). The Environmental Protection Agency (EPA) considers ethanol produced from sucrose in sugarcane to be an advanced biofuel that reduces greenhouse gas emissions by more than 50% compared to gasoline (EPA, 2010). The energy yield per land area of sugarcane ethanol is four to six times greater than that of corn based ethanol (von Blottnitz and Curran, 2006; Macedo and Seabra, 2008; Shapouri et al., 2010; Valdes 2011). To further increase the sugarcane derived ethanol yield per land area, it is d esirable to include the structural polysaccharides, cell ul ose and hemicell ul ose from the abundant lignocell ul osic sugarcane residues in the conversion process (Byrt et al. 2011). Cell ul ose and hemicell ul ose represent approximately 70 80% of the total biom ass in sugarcane bagasse (Peng et al. 2009). Lignin is the most recalcitrant component of the plant cell wall, impeding the saccharification of cell ul ose and hemicell ul ose. Lignin content and composition influence the conversion efficiency to biofuels. In grasses, fer ul ic and p coumaric acids are esterified to hemicell ul oses and lignin, respectively (Jeffries 1990). Lignin is essential for the structural integrity of the cell wall, the stiffness and strength of the stem,

PAGE 34

34 enabling water transportation throu gh the vasc ul ar system, and it contributes to pathogen defense (Boerjan et al. 2003). From a biofuels perspective, high quality biomass refers to a composition that can be easily and inexpensively converted to liquid transport fuels. This depends on the a ccessible yield of monosaccharides and disaccharides, and the amount of easily extractable polysaccharides (Byrt et al. 2011). Lignin is one of the most important factors in the recalcitrance of plant cell walls against polysaccharide utilization (Withers 2012). Therefore, genetic modifications res ul ting in reduced lignin content or altered composition will likely improve the quality of lignocell ul osic biomass (Hisano et al. 2009). Lignin is a phenolic polymer primarily synthesized from three p hydroxycin namyl alcohols (monolignols), p coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol via combinatorial radical coupling reactions (Ralph et al. 2004a). In the current view of lignin biosynthesis, 12 gene families are involved in this pathway: phenylal anine ammonia lyase (PAL) ; cinnamate 4 hydroxylase (C4H); 4 coumarate CoA ligase (4CL); cinnamoyl CoA reductase (CCR); hydroxycinnamoyl CoA: shikimate hydroxycinnamoyl transferase (HCT); coumarate 3 hydroxylase (C3H); caffeoyl CoA 3 O methyltransferase (CC oAOMT); fer ul ate 5 hydroxylase (F5H); caffeic acid 3 O methyltransferase (COMT); cinnamyl alcohol dehydrogenase (CAD) ; peroxidase (PER); and laccase (LAC) (Zhao and Dixon 2012). The suppression of lignin biosynthetic genes has been successf ul in increasi ng p ul ping efficiency, producing forages with better digestibility, or promoting saccharification efficiency of lignocell ul osic biofuel feedstocks (Pilate et al. 2002; Chen et al. 2003; Fu et al. 2011). Recalcitrance to both acid pretreatment and enzymatic

PAGE 35

35 digestion is directly proportional to the amount of lignin present in alfalfa biomass (Chen and Dixon 2007). 4 Co u m a rate CoA ligase (4CL) catalyzes thioester formation from hydroxycinnamic acid in the last step of the general phenylpropanoid pathway (Wa gner et al. 2009), providing precursors for various monolignols and plant secondary metabolic compounds such as coumarins, suberins, flavonoids, isoflavonoids and stilbenes ( Dixon and Reddy 2003 ; Boudet 2007; Umezawa 2010). The 4CL gene family has m ul tiple isoforms with different substrate specificities, directing metabolic flux from the general phenylpropanoid pathway into various branch pathways (Ehlting et al. 1999). Transgenic suppression of 4CL has been reported in several dicots. In tobacco, suppressi on of 4CL res ul ted in a 25% decrease in lignin content and brown color in the xylem of transgenic plants (Kajita et al. 1996). Antisense suppression of 4CL in Arabidopsis caused a 20 30% reduction of lignin without inducing changes in plant phenotype (Lee et al. 1997). In transgenic aspen, up to a 45% reduction of lignin and accum ul ation of cell ul ose was observed as a res ul t of the depletion of 4CL activity (Hu et al. 1999; Li et al. 2003). In contrast to aspen, a strong decrease in lignin content in Pinus radiata res ul ted in dwarf trees and the collapse of the water conducting vessels (Wagner et al. 2009). While there are numerous stud ies describing 4CL suppression via RNAi and other methods in dicots, only a few studies have been reported in monocots. RNA i suppression of 4CL in switchgrass res ul ted in less lignin, no significant alteration in biomass yield, and improved yields of fermentable sugars (Xu et al. 2011). In rice, suppression of 4CL res ul ted in less lignin, reduced fertility, reduced plant heigh t,

PAGE 36

36 decreased 1000 grain weight, and increased cell ul ose expression in the walls of sclerenchyma cells (Gui et al. 2011). Materials and Methods Cloning of Sc4CL and Vector Construction Sequences of 4 coumarate: coenzyme A ligase ( 4CL ) from Arabidopsis t haliana (Q42524 and Q9S725), Nicotiana tabacum (O24145 and O24146), and Oryza sativa (P17814 and Q42982) were retrieved from GenBank and aligned to identify conserved regions for the design of degenerate primers. Degenerate p rimer s were designed to anneal to the conserved regions 5 CARGGITAYGGIATGACNGARGC 3 and 5 ACRAAIGCIACIGGNAYYTCNCC 3 for amplification of a partial 4CL sequence from genomic DNA of sugarcane cv. CP88 1762. Amplifications were carried out with 35 cycles of denaturation at 94C for 45 s 60 s of annealing at 58C and extension of 72C for 2 min and produce d a 7 4 3 bp product in which 4 exons are interrupted by three introns (Fig. 3 1 A). Following gel electrophoresis t he PCR band was gel extracted (QiaQuick Gel Extraction Kit; Valencia CA), cloned into a TOPO 2.1 TA Cloning vector (Invitrogen, Carlsbad, CA), and sequenced for confirmation. A blast search was performed with the Sc4cl_2 sequence as a query to identify the ORF. Amplification of exon 1 w as carried out using specific pr imers Sc4Cle1 F ( 5 caagggtacgggatgacggaagcc 3 ) and Sc4Cle1 R ( 5 ccctttcatgatctgcgggc 3 ) The amplified fragment was sequenced for confirmation, and subcloned into compatible cloning sites of vector pWF_BG_4CL RNAi (Fouad et al. 2009 ). This res ul ted i n an inverted repeat of the 208 bp Sc4CL_2 of exon I with both repeats being separated by a 94 bp intron from Bahiagrass ( Paspalum notatum ) 4CL under transcriptional control of

PAGE 37

37 the OsC4H 3 1 C ) (Yang et al. 2005; Dixon et al. 1986). For biolistic gene transfer the RNAi cassette including OsC4H promoter, inverted repeats of Sc4CL_2 released from the vector by restriction digestion with Xmn I (New England Biolabs Inc., Ipswi ch, MA, USA), gel purified (QIAquick Gel Extraction Kit; Qiagen) and used for biolistic gene transfer Tissue C ul ture, Biolistic G ene T ransfer and Plant Regeneration Tops of s ugarcane c ul tivar CP88 1762 w ere collected from the UF IFAS Everglades Research and Education Center in Belle Glade, Florida. Embryog enic calli were induced from cross sections of immature leaf whorls (Kim et al. 2012). Two to three mm cross sections of the immature lea f whorl were c ul tured on modified MS basal medium (CI3) (Chengal rayan and Gallo Meagher 2001) at 28 C under 16 h 2 s 1 ) Tissue c ul tures were transferred to fresh medium every 2 wks for 2 3 mo s Calli were transferred to CI3 medium containing 0.4M D sorbitol for 4 h of osmotic treatment prior to bombardment. Biolistic transformations were performed as npt II selection cassette were co precipitated onto 1.0 M diameter gold microparticles (Sigma, St. Louis, MO, U SA) with 0.96 M CaCl 2 and 0.04 M spermidine free base (Sigma). The particles were delivered into embryogenic calli using the PDS 1000/He Particle Delivery System (Bio Rad, Herc ul es, CA, USA). Following a 6 d rest ing period on C I 3 medi um t he calli were tr ansferred to CI3 medi um supplemented with 20 mg L 1 geneticin. After three biweekly subc ul tures, actively growing calli were transferred to MS medium (Murashige a g L 1 sucrose and placed in a growth chamber 2 s 1 light intensity with a 16 h

PAGE 38

38 photoperiod at 28 2 C for 1 wk. Regenerating calli were placed on hormone free medi um with 20 mg L 1 paromomycin for selection of transgenic plants. Regenerated shoots were transferred to soil and maintained in an air conditioned greenhouse under natural photoperiod at 28/22 4 C day/night temperature, respectively, until maturity. NPTII ELISA The ex pression of npt II in putative sugarcane lines was tested using a commercially available NPTII ELISA assay (Agdia, Elkhart, IN, USA). Protein was extracted from 100 mg of mature leaf tissue using the extraction buffer supplied with the kit. Protein concentr ations were measured spectrophotometrically ( Evolution 300 UV VIS) at 595nm using the Coomassie Plus (Bradford) Protein Assay reagent (Pierce, and the samples were visual ly examined for color intensity and compared against positive and negative control s Northern Blot Analysis Secondary tillers of sugarcane, approximately 15 cm in length, were collected and immersed in liquid nitrogen be for e storage at 80 C. Total RNA w as extracted from was denatured in a 65 C water bath for 10 min, separated by denaturing gel electrophoresis, and transferred to the Hybond N + tions (GE Healthcare Biosciences, Pittsburgh, PA, USA). For the probe, the 730 bp open reading frame (ORF) of Sc4CL _2 was PCR amplified from a cDNA clone according to the conditions previously described, and labeled with 32 P dCTP using the Prime a Gene Lab eling System (Promega, San Luis Obispo, CA, USA). The hybridization procedure was carried out as described by Jeffreys and Flavell (1977). After hybridization, the

PAGE 39

39 membrane was washed with 0.1X SSC and 0.1% SDS three times at 65 C, 20 min per wash, and ex posed to X Research Products, Asheville, NC, USA) at 80 C for 2 d. Small RNA Northern Blot Analysis For siRNA northern blot analysis, total RNA was extracted (Shirzadegan et al. 1991) using ti ssue from the third youngest internode. Small RNA was separated from w as loaded in each lane of a 15% polyacrylamide TBE/urea gel (Bio Rad, Herc ul es, CA, USA), separated by electrophoresis, and transferred to Hybond N + membrane (GE Healthcare Biosciences) according to the directions of the manufacturer. The 730 bp Sc4CL _2 exon I was used as a probe in hybridization. Washing and detection were carried out as previously described. Southern Blot Analysis High mol ec ul ar weight genomic DNA was extracted from leaf tissue using a modification of the hexadecyltrimethylammonium bromide (CTAB) method (James et al. w as digested to completion with Eco RI (New England Biolabs Inc., Ip swich, MA, USA), separated by agarose gel electrophoresis (0.8%), and transferred to Hybond N + membrane according to the hybridization was the 803 bp fragment of the OsC4H promot er sequence obtained by PCR. Quantitative Real Time RT PCR Analysis Total RNA was extracted from the second youngest internode using Trizol reagent

PAGE 40

40 Free RQ1 DNase (Prome ga) was added to the RNA extract to remove DNA. For the cDNA synthesis step, 500 ng of total RNA was reverse transcribed into cDNA by using iScript cDNA Synthesis Kit (Bio Rad). Quantitative Real time PCR was performed with the MyiQ cycler (Bio Rad) with i Q SYBR Green supermix (Bio Rad). Sugarcane glyceraldehyde 3 phosphate dehydrogenase (GAPDH) was used as the control. Acetyl Bromide (AcBr) Lignin Analysis and Visual Observations I nsoluble lignin content was measured with the a cetyl b romide (AcBr) lignin method described by Hatfield et al. (1999) with the following modifications. Stalks with 12 internodes were collected from clonally propagated transgenic or non transgenic control plants, and the mature internode # 6 was selected for analysis Color of lea f veins of f ul ly expanded leaves was evaluated before sampling of the internodes. I nternode cross section s w ere examined for color immediately after cutting. Internodes were dried at 55C for 2 d, and ground to a powder using a coffee grinder. The powder w as suspended in 50% ethanol, sonicated three times (Branson, Danbury, CT, USA) for 30 min each. The samples were dried at 55C for 2 d, the powder was passed through a 0.2 5 mm sieve, and collected. For each transgenic line three biological and three tech nical replications were evaluated by transferring 2 mg of powder into a 1.5 m L tube with 1 m L of 25% v/v AcBr in glacial acetic acid. The tubes were incubated at 50 C for 4 h, with vortexing every 15 min, followed by 30 min incubation on ice. Samples wer e prepared for spectrophotometry by adding 1.7 m L of 25% v/v AcBr in glacial acetic acid, L L sample to Sub Micro Cells (ThermoFisher,Waltham, MA, USA), and mixed thoroughly. The absorption was measured on a spectrophotometer (Evolut ion 300, ThermoFisher) at 280 nm.

PAGE 41

41 Statistics Replicated samples were grown in randomized complete blocks with 8 replications. Data were collected for variables such as plant height (cm), fresh weight (g), node diameter (cm), lignin content and analyzed b y ANOVA using SAS TM Version 9.3. Mean comparisons were perform ed usin g L SD at the 5% level. For AcBr determinations, sample size was nine for each replication ( three biological replicat ions x three technical replicat ions ). Res ul ts Cloning and Expressio n Pattern of Sc4CL_2 The expression pattern of Sc4CL_ 2 in four different tissues of field grown sugarcane w as analyzed by northern blot analyses. Sc4CL_2 showed the highest express ion levels in the youngest internode and emerging tiller There was barely detectable expression in the youngest node, leaf whorl (immature leaf) and youngest expanded leaf (Fig. 3 2 ). Suppression of Sc4CL_2 by RNAi Co transformation of embryogenic calli with the linearized, minimal RNAi cassette and the minimal npt II selectable marker cassette using biolistic gene transfer generated 66 transgenic lines as identified by PCR and NPTII ELISAs (data not shown) (Fig. 3 3 ) Reduced transcript levels of Sc4CL_2 (Fig. 3 4 ) were observed in 1 2 transgenic sugarcane lines ( 21; 22; 23; 31; 32; 41; 44; 5 3 ; 55; 64; 71; 74) as determined by northern blot analysis using the Sc4CL_2 ORF as a probe (Fig. 3 1B) The independent transgenic nature of these 1 1 lines was confirmed by Southern blot analysis using the OsC4H promoter sequence as a probe (Fig. 3 5 ). Different patterns of hybridization signals were observed for all 1 1 lines, and the number of hybridization signals ranged

PAGE 42

42 from two (line 71) to six for the majority of lines (Fig. 3 5 ). RNAi suppression of Sc4CL_2 was confirmed in four of thes e sugarcane lines (41, 44, 71 and 74) by small RNA northern blot analysis (Fig. 3 6 ). Quantitative Real time RT PCR analysis of these four transgenic lines displayed 4.1%, 12.1%, 11.6% and 16.1% expression of the Sc4CL_2 transcript in lines 41, 44, 71 and 7 4 compared to non transgenic sugarcane control respectively (Table 3 1). Analysis of Lignin Content and Evaluation of Phenotype The four primary transformants were vegetatively propagated, grown in the greenhouse in randomized complete blocks with eight replications, and lignin content was measured using samples derived from basal internodes. The AcBr lignin content of the four lines (41, 44, 71, 74) w as used in compariso ns with the non transgenic control (Table. 3 1). Lines 41 and 71 had a 9.3% and 5.2% reduction in lignin, respectively. No significant reductions of lignin were observed for lines 44 and 74. Variables such as biomass, plant height, node diameter, and color were measured from greenhouse grown replicates and compared with non transgenic co ntrol (Table 3 1). Transgenic lines 71 and 44 accum ul ated similar amounts of biomass as non transgenic control while lines 74 and 41 accum ul ated significantly less biomass, 24% and 49%, respectively, compared to the non transgenic control In terms of p lant height, lines 44 and 74 were not significantly different from non transgenic contro l However, line 71 was 21 % taller than non transgenic control and line 41 was 22% shorter than non transgenic control Stalk diameters of lines 71, 44, 74 and 41 wer e reduced by 12, 13, 15 and 36%, respectively, compared to non transgenic control The color of the mature internode tissues and the lea f veins did not differ from non transgenic control as determined by visual assessments.

PAGE 43

43 Discussion In this study R NAi w as used for the first time successf ul ly to suppress a 4 c o u m a rate c oA ligase ( 4CL ) gene in the complex and highly polyploid sugarcane genome. A single earlier report demonstrated the utility of RNAi for targeted downreg ul ation of candidate genes in sugarca ne using the p h ytoene desaturaturase ( PDS ) gene which res ul t ed in photo bleaching ( Osabe et al. 2009) RNAi allow s one to evaluate the correlation between the level of 4CL suppression or other lignin biosynthetic genes, lignin content and plant performance (Carrol and Somerville, 2009; Xu et al. 2011). Four transgenic sugarcane lines with 4CL suppression were studied in detail. Moderate reduction of lignin (5%) did not compromise biomass production under controlled environment al conditions. However, t he lin e with the strongest suppression of 4CL displayed a 9% reduction in lignin content along with a severe reduction (49%) of biomass. It cannot be r ul ed out that part or all of the observed reduction on plant biomass may have been due to the tissue c ul ture or transformation process For example line 74 which did not have a significant reduction in lignin content also displayed reduced biomass content. Some deleterious effects of tissue c ul ture on sugarcane plant performance can be eliminated during vegetative propagation (Lourens and Martin, 1986). Sexual reproduction is very effective in eliminating somac l onal variation (Bregitzer et al. 2008) but will cause significant segregation in sugarcane. Reducing the time in tissue c ul ture by utilizing direct embryo genesis in sugarcane is expected to reduce the occurrence of somaclonal variation (Taparia et al. 2012). Sc4CL_2 is primarily expressed in the internode s of the immature stem and the newly emerging tillers and barely detectable in leaf tissue. Th is expre ssion profile is consistent with other monocot 4CL s of t he monolignol pathway (Gui et al. 2011; Xu et al.

PAGE 44

44 2011) In contrast, 4CL s of the flavonoid pathway display low and similar e xpression levels in internodes and leaves (Gui et al. 2011; Xu et al. 2011) S uppression of Sc4CL_2 in transgenic sugarcane lines by RNAi is confirmed i n the present study, by mRNA northern blot, quantitative Real time RT PCR and the si RNA northern blot The level of siRNA expression, target gene suppression, and lignin reduct ion were consistent in the analyzed sugarcane lines The general trend for lignin reduction was observed in all transgenic sugarcane lines and two of them were statistically significant. Line 71, with 5. 2 % suppression of lignin did no t display a signific ant reduction in biomass compared to non transgenic control In COMT suppressed transgenic sugarcane lines, a 4% reduction of lignin increased saccharification efficiency by 30% (Jung et al. 20 11 ). Suppression of Os4CL_3 in diploid rice and Pv4CL1 in tetraploid switchgrass res ul ted in approximately 29% and 21% reduction of lignin, respectively (Gui et al. 2011; Xu et al. 2011). The sorghum brown mid rib 2 mutant ( bmr2) showed a 20% reduction in lignin in both stover and leaf tissue (Saballos et al. 20 12). In the present study, the reduction of lignin caused by suppression of Sc4CL_2 is 4 9% which is less than reported for other plant species (Ehlting et al. 1999; Kajita et al. 1996; Hu et al. 1999; Wagner et al. 2009) The highly polyploidy sugarcane c ontains several 4CL loci with significant sequence diversion and more drastic reduction of the lignin content may require co suppression of m ul tiple alleles Different genetic backgrounds in various plant species may also influence plant performance and biomass in response to reduced lignin content (Oliver et al. 2005) Future work sho ul d identify and co suppress additional 4CL loci Replicated field testing of transgenic sugarcane lines will enable a

PAGE 45

45 better estimation of genotype x environment interacti ons saccharification efficiency of lignocell ul osic biomass and its conversion efficiency to ethanol

PAGE 46

46 Table 3 1. Means S.E. for plant height, fresh weight, node diameter, AcBr lignin content, and qRT PCR expression for four transgen ic plants and non transgenic sugarcane CP88 1762 control Lines Plant height (cm) Fresh weight (g) Node diameter (cm) AcBr lignin (%) Sc4CL 2 expression WT 91.5 3.9 525.1 34.4 2.2 0.1 20.5 0.1 100.0 41 71.4 5.9 267.1 34.1 1.4 0 .1 18.50.2 4.1 44 83.7 6.3 435.4 31.2 1.9 0.1 19.80.2 12.1 71 110.7 5. 4 479.8 36.1 1.9 0.1 19.30.3 11.6 74 97.5 5.5 399.4 15.2 1.9 0.0 19.9 0.5 16.1 Significantly different from wild type at P<0.01 as determined by LSD T; non transgenic sugarcane CP88 1762 control

PAGE 47

47 Figure 3 1. A, Schematic representation of the sugarcane 4CL partial genomic sequence of Sc4CL_2. The 743 bp of the partial genomic Sc4CL_2 sequence include 4 exons and 3 introns. B, Schematic represent ation of Sc4CL_2 cDNA clone. The 730 bp probe derived from Sc4CL_2 ORF and 3 UTR is shown. C, Schematic representation of the RNAi suppression cassette. Inverted repeats of the 20 8 bp Sc4CL_2 exon1, separated by the BG4CL intron, under transcriptional con trol of the OsC4H promoter and CaMV35S 3 bp probe derived from the OsC4H promoter and used in Southern blot hybridizations is shown.

PAGE 48

48 Figure 3 2 The expression pattern of Sc4CL_2 in non transgenic sugarcane CP88 1762 control plants. Up per panel: Total RNA was extracted from different tissues of non transgenic sugarcane plants. RNA w as separated in electrophoresis and hybridized to a 7 30 bp probe derived from the Sc4CL_2 cDNA clone 1: immature leaf whorl ; 2: young, expanded leaf; 3: I mmature node; 4: Immature internode; 5: young, secondary tiller; Lower panel: Total RNA

PAGE 49

49 Figure 3 3 Vegetative progeny of transgenic sugarcane lines with RNAi suppression of Sc4CL 2 grown under controlled environment al conditions

PAGE 50

50 Figure 3 4 Northern blot analysis. Upper panel: Total RNA was separated by electrophoresis and hybridized to a 7 30 bp probe derived from the Sc4CL_2 cDNA clone WT: non transgenic sugar c ane CP88 1762 control ; lanes 2 1 3 : independe nt transgenic events; Lower panel: total RNA was used as a control.

PAGE 51

51 Figure 3 5 Southern blot analysis of independent sugarcane transformants. Genomic DNA was extracted from leaf rolls, digested with Eco R I and the blots were hybridized wit h a 80 3 bp open reading frame of OsC4H promoter. W T : non transgenic sugarcane CP88 1762 control ; 22; 31; 32; 41; 42; 44; 52; 64; 71; 72; 74 represent independent transgenic sugarcane lines with co integration of the 4CL construct ; 23; 53 represent nptII t ransgenic sugarcane lines without co integration of the 4CL construct PC: plasmid control

PAGE 52

52 Figure 3 6. Small RNA northern blot analysis The small RNAs were separated by electrophoresis and hybridized to a 730 bp probe derived from the Sc4CL_2 cDNA clone PC: plasmid control; 11 numerically labeled lanes: 1 1 transgenic sugarcane lines

PAGE 53

53 CHAPTER 4 CONCLUSION Sugarcane is a perennial C4 grass in the genus Saccharum and it is one of the highest yielding biomass crops in the world (FAO 2010). M odern sugarcane c ul tivars are highly polyploid, interspecific hybrids derived from crosse s among S. spontaneum, S. officinarum, S barberi, S. robustum, S. sinense, Miscanthus, and other related grass genera ( Altpeter and Oraby 2010; Brandes 1958; Purseglove 1972; Daniels and Roach 1987 ). Approximately 70% of the world from sugarcane. Since the 1970s, the sugar derived from sugarcane has been used for sucrose based bioethanol production to replace fossil fuels, primarily in Brazil. It has been suggested that by the inclusion of the structural polysaccharides of the resi dues, cell ul ose and hemicell ul ose, into the conversion process, ethanol yields can be substantially increased (Kim et al. 2004). Genetic transformation provides a relatively rapid method to improve the biomass quality of sugarcane for cell ul osic eth anol production. Biolistics is a n important gene transfer method for both transient gene expression studies and for stable genetic transformation in crop improvement. During the last two decade s protocols for biolistic gene transfer have been improved (S anford et al. 1993; Sivamani et al. 2009). The precipitation of plasmid DNA onto gold or tungsten micro particles in the presence of spermidine and CaCl 2 is an important step in the procedure. Protamine, a small arginine rich protein, has been substituted for s permidine, in order to increase transformation efficiencies in rice and maize (Sivamani et al. 2009). The present study compared three different DNA coating procedures in the biolistic transformation of sugarcane: spermidine free base, protamine s ul f ate, and the Seashell DNAdel TM Gold

PAGE 54

54 Carrier with a proprietary precipitation buffer derived from Seashell Technology. For stable transformation using minimal, linear expression cassettes, protamine, spermidine and the Seashell were equally effective. D iffer ences compared to the earlier report by Sivamani et al. ( 2009 ) may be associated with the difference in size and form (linear versus circ ul ar) of the precipitated DNA molec ul es. Further optimizations of the coating protocols may be possible by changing the concentration of DNA, cationic polyamine or CaCl 2 concentrations (Zlatanova et al. 1998; Makita et al. 2009). Biolistic transfer of an RNAi hairpin construct was used to suppress 4CL expression in sugarcane. By using degenerate primers that annealed to the conserved regions of the 4CL family, a 4CL partial sequence, Sc4CL_2 was amplified from the sugarcane genome. Exon 1 of Sc4CL_2 was used to construct the RNAi expression cassette. The transgenic nature of the transgenic sugarcane lines was confirmed by NPTII ELISA PCR Southern blot analysis si RNA Northern blot and realtime RT PCR Four lines with suppression of Sc_4CL2 were selected for lignin analysis. The observed lignin reduction was corresponding to the level of siRNA expression and target gene su ppression in the analyzed sugarcane lines A general trend of lignin reduction was observed in all four transgenic sugarcane lines, and two of them displayed significant lignin reduction compared to non transgenic control This is the first report of succe ssf ul suppression of a 4CL gene by RNAi in sugarcane. Future research sho ul d include field evaluation of performance and conversion efficiency to ethanol. Additional co suppression studies targeting m ul tiple 4CL loci co ul d be performed for stronger suppr ession of lignin content in combination with different genetic backgrounds (high or low fiber content) In conclusion, this study

PAGE 55

55 generated and characterized transgenic sugarcane lines, with RNAi suppression of the 4CL gene

PAGE 56

56 APPENDIX LABORATORY PROTOCOLS USED IN MOLEC UL AR BIOLOGY, BIOLISTIC S TISSUE C UL TURE AND IDENTIFICATION/ CHARACTERIZATION OF TRANSGENIC SUGARCANE PLANTS Molec ul ar C loning Plasmid DNA Purification U sing QIAGEN Plasmid Midi Kit QIAGEN plasmid purification protocol as provided by the manufacturer 1. Pick a single colony from a freshly streaked selective plate and inoc ul ate a starter c ul ture of 2 5 m L LB medium containing the appropriate selective antibiotic. Incubate for approx. 8 h at 37C with vigorous shaking (approx. 300 rpm). 2. Dilute the starter c ul ture 1/500 to 1/1000 into selective LB medium. I noc ul ate 25 m L with 25 50 of starter c ul ture. Grow at 37C for 12 16 h with vigorous shaking (approx. 300 rpm). 3. Harvest the bacterial cells by centrifugation at 6000 x g for 15 min at 4C. 4. Resuspend the bacterial pellet in 4 m L Buffer P1. 5. Add 4 m L Buffer P2, mix thoroughly by v igorously inverting the sealed tube 4 6 times, and incubate at room temperature (15 25C) for 5 min. 6. Add 4 m L of chilled Buffer P3, mix immediately and thoroughly by vigorously inverting 4 6 times, and incubate on ice for 15 min 7. for 30 min at 4C. Remove supernatant containing plasmid DNA promptly. 8. supernatant containing plasmid DNA promptly. 9. Equilibrate a QIAGEN tip 100 by applying 4 m L Buffer QBT, and allo w the column to empty by gravity flow. 10. Apply the supernatant from step 8 to the QIAGEN tip and allow it to enter the resin by gravity flow. 11. Wash the QIAGEN tip with 2 x 10 m L Buffer QC. 12. Elute DNA with 5 m L Buffer QF. 13. Precipitate DNA by adding 3.5 m L (0.7 v olumes) room temperature isopropanol to the eluted DNA. 14. Mix a ul ly decant the supernatant. 15. Wash DNA pellet with 2 m L of room temperature 70% ethanol, and centrifuge at ul ly decant the supernatant without disturbing the pelle t. 16. Air dry the pellet for 5 10 min, and redissolve the DNA in a suitable volume of buffer (e.g., TE buffer, pH 8.0, or 10 mM TrisCl, pH 8.5). Restriction Digestion to Prepare Minimal Expression Cassette 1. Digest 100 g of plasmid DNA with restriction enz ymes. En sure there is no restriction site inside the cassette.

PAGE 57

57 2. Confirm the completion of digestion by electrophoresis. Load 2 L of DNA dilution on a 0.8% a g a rose gel along with DNA ladder. Electrophorese at 80 100 V for 1h to achieve good separation o f bands. Check the gel using a UV transilluminator. Check the band number and size to confirm that the digestion is complete. 3. Cut out the gel that contains the expression cassette and purify the DNA with QIAquick gel purification kit (Qiagen Inc., Valenci a, CA) 4. Quantify the yield using nanodrop (ND 1000 spectrophotometer, Nanodrop Technologies, Wilmington, DE) 5. Check the quality of DNA by electrophoresis. Gel Extraction U sing QIAquick Gel Extraction Kit ided by the manufacturer 1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. 2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 ). 3. Incubate at 50C for 10 min (or until the gel slic e has completely dissolved). To help dissolve gel, mix by vortexing the tube every 2 3 min during the incubation. 4. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). 5. Add 1 gel volume of isopropanol to the sample and mix. 6. Place a QIAquick spin column in a provided 2 m L collection tube. 7. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min. 8. Discard flow through and place QIAquick column back in t he same collection tube. 9. Recommended: Add 0.5 m L of Buffer QG to QIAquick column and centrifuge for 1 min. 10. To wash, add 0.75 m L of Buffer PE to QIAquick column and centrifuge for 1 min. 11. Discard the flow through and centrifuge the QIAquick column for an add itional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 m L microcentrifuge tube. 13. To elute DNA, add 50 of Buffer EB (10 mM TrisCl, pH 8.5) or water (pH 7.0 8.5) to the center of the QIAquick membrane and centrifuge the column for 1 min. Alternatively, for increased DNA concentration, add 30 elution buffer to the center of the QIAquick membrane, let t he column stand for 1 min, and then centrifuge for 1 min. 14. If the purified DNA is to be analyzed on a gel, add 1 volume of Loading Dye to 5 volumes of purified DNA. Mix the solution by pipetting up and down before loading the gel. Biolistic T ransformation U sing PDS 1000/He Preparation of Gold Stock (60 mg m L 1 ) 1. Weigh 30 mg of 1.0 m gold particles in a sterile 1.5 m L microfuge tube.

PAGE 58

58 2. Add 1 m L of 70% ethanol, v ortex for 3 5 min, incubate at room temperature for 15 min. 3. Centrifuge briefly (5 s) to pellet the gold particles. 4. Discard the supernatant, wash the pellet with 1 m L autoclaved ddH 2 O ( 3 times ) 5. Vortex for 1 min. 6. Centrifuge briefly (3 5 s), discard the supernatant. 7. Add 500 L sterile 50% v/v glycerol. 8. Store the gold stock at 20C. Preparation of DNA Co ated Microparticles i. Spermidine/ Protamine c oating 1. Vortex the gold stock for 30 s. Mix 30 l of the gold stock and 30 l of DNA in a 1.5 m L sterile microfuge tube, vortex for 1 min. 2. Add 20 L 0.1 M freshly prepared spermidine (or 20 L 1 mg m L 1 pro tamine) and 50 L 2.5 M CaCl 2 while continu ing to vortex. 3. Mix all components by vortex for 1 min. 4. Centrifuge briefly (3 5 s) to pellet the gold. 5. Discard the supernatant without disturbing the pellet and wash the pellet with 250 l absolute ethanol. 6. Centrif uge briefly (3 5 s) and remove the supernatant. 7. Repeat the washing one more time. 8. Resuspend the pellet in 90 L absolute ethanol by sonication for 2 s. 9. Keep the DNA microparticles mixture on ice. ii. Seashell b iotechnology DNAdel TM g old c arrier p articles p rotocol as provided by Seashell Biotechnology 1. The DNAdel TM gold particles are supplied as a 50 mg m L 1 suspension in binding buffer. Sonicate briefly to dissociate any aggregates prior to form ul ation. Dilute the gold into binding buffer t o yield a final concentration of 30 mg m L 1 (minimum volume of 50 buffer; 1.5 mg gold (30 volume of 50 mg m L 1 ; 20 buffer)). Add the plasmid DNA (stock 1 mg m L 1 ) to gold at a ratio of 2 gold. (This concentration has yielded significantly higher expression levels compared to standard particles an d protocols). Vortex briefly. 2. Add an equal volume of precipitation buffer. Vortex bri efly and let stand for 3 min Spin (10,000 rpm in Eppendorf microfuge 10 s) to pellet the DNA coated particles. 3. Remove the supernatant and add 500 of 100% cold ethanol. Vortex briefly and spin (10,000 rpm in Eppendorf microfuge 10 s) to pellet particles. Remove the supernatant and add 100% ethanol to the desired gold concentration. Briefly sonicate the solution to resuspend the gold particles and process for appropriate delivery device The sonication step minimizes aggregation and is important for reproducible particle delivery.

PAGE 59

59 Biolistic s 1. Turn on PDS 1000/He Particle Delivery System and vacuum pump. 2. Sterilize the inside of PDS 1000/He Particle Delivery System with 70% ethanol. Autoclave macrocarrier holders, stopping screens, macrocarriers, and a device for securing macrocarriers into the macrocarrier holders. 3. Place macrocarriers into holders. 4. Prior to use, resuspend the DNA coated microparticles by briefly vortex ing. 5. Add 5 l of the DNA microparticles mixture into the center (inner 5 mm diameter) of the macrocarrier; allow for complete evaporation of ethanol before use. 6. Place stopping screen into the macrocarrier plate and insert the inverted macrocarrier assembl y on top. Secure the lid on top of the shelf assembly. 7. Place macrocarrier plate containing the macrocarrier at the highest level of the inner chamber. 8. Place tissue c ul ture plate on shelf 2 below the macrocarrier plate (6 cm below). 9. Initiate a vacuum to 27 .5 Hg; press and hold the fire button until the disc ruptures at 1100 psi. Eye protection must be worn. 10. Vent the vacuum and remove petri dish. 11. Dismantle the assembly and prepare for the next shot. Tissue C ul ture and P lant R egeneration Embryogenic Callus I nduction Selection and Plant Regeneration 1. Obtain sugarcane c ul tivar CP88 1762 from the greenhouse or field. 2. Remove outer mature leaves and sterilize the leaf whorl with 70% ethanol. Remove a dditional layers with sterilized forceps and scalpel to obta in a tightly furled spindle of immature leave 3. Cut 3 4 mm thick cross sections from the lea f base above the apical meristem tissue with sterilized forceps and scalpel 4. P lace the cross section on to MS basal medium (CI3) at 28C under illumination ( 30 mol m 2 s 1 ) with a 16 h light/8 h dark regim e 5. Subc ul ture the explants biweekly for 3 4 months. 6. Transfer the embryogenic calli to CI3 medium supplement with 0.4 M sorbitol 4 h before bombardment. 7. Transfer bombarded calli to reg ul ar CI3 medium 12 h after bomb ardment. 8. Transfer calli onto selection medium ( CI3 medium wit h 2 0 mg L 1 of geneticin ) 7 d after gene transfer Subc ul ture biweekly for 2 months. 9. Transfer the growing calli to regeneration medium with 2.5 M TDZ for 1 week and maintain at 100 mol m 2 s 1 light intensity with 16/8 h (light/dark) photoperiod at 28C 10. Regenerated c alli are then transferred to rooting media containing 20 mg L 1 paromomycin Subc ul ture biweekly for 2 3 months. 11. Regenerated plant lets are transplanted to soil and c ul tivated in air conditioned greenhouse at 22/2 8 C day/night temperature and natural photoperiod

PAGE 60

60 Molec ul ar C haracterization of P utative Transgenics ELISA NPTII ELISA KIT protocol (Agdia, Elkhart, IN) as provided b y the manufacturer a. Protein e xtraction 1. Harvest 1 00 mg of young fresh leaf tissue. Store samples on ice. 2. Add 10 mg polyvinyl pyrrolidone (PVP) and 600 10 x PEB1 buffer (supplied with the nptII A gdia ELISA kit) to each sample. 3. Grind the leaf samples using a micro pestle. Keep the samples on ice. 4. Centrifuge the samples at 20,800 x g at 4C for 15 min. 5. Transfer the supernatant to a new micro centrifuge tube and store on ice. b. Protein e stimation 1. Dilute Protein Determination Reagent (USB Corporation, product code 30098) 1:1 using sterile ddH 2 O. Prepare enough to use 1 m L per sample including standards and blank. 2. Prepare a standard dilution series u sin g BSA (0 3. Add 1 m L diluted Protein Determination R eagent to each cuvette. Add 5 of sample to eac h cuvette and mix by vortexing 4. Incubate at room temperature while preparing the remaining samples. 5. Measure OD 595 of each sample (ideally these sho u l d be between 0.2 and 0.8). 6. Plot a standard curve using BSA and use it to estimate total protein concentration of the samples. 7. Calc ul g total protein per well. c. Assay 1. Prepare the samples, including wild t buffer PEB1 required L 2. Prep are standards as follows: 110 of the provided positive control. 3. Prepare a humid box by putting damp paper tow el in a box with a lid. 4. Add 100 of each sample and standard in the ELISA microplate provided with the kit. The order of samples sho ul d be noted at this time. 5. Place the plate in the hu mid box and incubate for 2 h at room temperature. 6. Prepare the wash buffer PBST by diluting 5 m L to 100 m L (20) with ddH 2 O. 7. Prepare the enzyme conjugate diluent by mixing 1 part MRS buffer PBST. Make enough to add 100 per well.

PAGE 61

61 8. A few minutes befor e the incubation ends, add 10 from bottle A and 10 from bot tle B per 1 m L of enzyme conjugate diluent to prepare the enzyme conjugate. 9. When the incubation is complete, remove plate from humid box and empty wells. 10. Fill all wells with 1 X buffer PBST and then empty wells gently Repeat 5 times. 11. Ensure complete removal of wash solution by tapping the frame fir ml y upside down on paper towels. 12. Add 100 of the prepared enzyme conjugate into each well and incubate the plate in the humid box for 2 h at room temperature. 13. In the mean time aliquot sufficient TMB substrate (1 00 per well) and allow it to warm to room temperature. 14. When the incubation is complete, wash the plate with 1 x buffer PBST as before. 15. Add 100 of room temperature TMB substrate solution to each well and place the plate back in the humid box for 15 min. A blue color will develop, the intensity of which will be directly proportional to the amount of NPTII protein in the sample, while negative samples will remain white. 16. To stop the reaction, add 50 3M s ul phuric acid to each well. T he substrate color w ill change from blue to yellow. 17. The res ul ts must be recorded within 15 min after addition of the stop solution otherwise the reading will decline. 18. Color development can be visually scored or recorded with the help of an ELISA plate rea der. Genomic DNA E xtraction (CTAB) 1. Autoclave mortars, pestles and spat ul as for 20 min at 121 o C and dry in an incubator oven at 60C. 2. Prepare enough CTAB buffer (5 m L g 1 leaf material) for use by adding mercaptoethanol fresh (200 mercaptoethanol per 100 m L buffer or 30 in 15 m L ). Heat to 65C in a water bath. 3. Harvest 3 g youn g l eaf material and store on ice or freeze in liquid nitrogen. 4. Cool mortar and pestle by addin g l iquid nitrogen. Grind f resh leaf in liquid nitrogen to a fine powder. 5. Add frozen leaf powde r to 15 m L pre heated buffer in a 50 m L disposable polypropylene tube and mix well using a spat ul a or glass rod. 6. Incubate at 65C for 1 h Mix the contents thoroughly 1 3 times during in cubation. 7. Add 3 RN a se A to each sample at the start of incubation. 8. Cool to room temperature. 9. Add equal volume (15 m L ) chloroform: iso amyl alcohol (24:1) and mix gently to form an em ul sion for approximately 30 min. Mix by hand by gently inverting the tubes and shake on a rotary shaker for 10 15 min. 10. Spin at 4000 rpm for 30 min. Tra nsfer the top layer to a fresh 50 m L tube using a wide bore 10 m L pipet tip. 11. Repeat step 8 through 9 again.

PAGE 62

62 12. Repetition of step 8 will depend on the quantity of precipitate visible at the organo aq u eous interface. 13. precipitate. 14. Use a blue pipette tip with wide bore to pipette the DNA out of the aqueous mixture. 15. Transfer DNA to a clean 15 m L tube containing 10 m L of 70% ethanol. 16. Wash one m ore time in 70% ethanol by inverting the tube several times. 17. Transfer washed DNA pellet to a clean 1.5 m L microfuge tube and air dry R esuspend in 200 TE buffer 18. Prepare 10x di lution of the DNA stock. Use 1 to check concentration and quality using the NanoDrop spectrophotometer and by gel electrophoresis of samples in a 0.8% agarose gel (80 V, 40 min). 19. Store the dilutions and stocks at 4C. Southern Blotting and Hybridization a. DNA digestion and electrophoresis 1. Extract genomic DNA from trans genic lines and wild type using the CTAB method described above. 2. Southern blotting. Run the digested DNA on a 1% agarose gel to ensure complete restriction digestion. 3. E stimate the volume of each sample required for d pipette it into a sterile 1.5 m L micro centrifuge tube. Add sterile ddH 2 O to make up the volume to 30 4. Set up the digestion as follows: 2 O) 1 0 Eco R1 buffer 3.0 100 BSA 0.3 Eco R1 (1000 U/ ) 1.5 Sterile ddH 2 O ~15.2 Final volume 30 5. Prepare a master mix for all samples that includes the buffer, BSA (if required for the enzyme chosen), enzy me and water Mix by pipetting and add 30 of DNA. Mix well, centrifuge briefly and incubate in a water bath at 37C over night. 6. Run 2 from each digest on a 1% agarose gel to ensure complete digestion. 7. Prepare a 1 cm thick 1% agarose gel for Southe rn blotting using 0.5 TBE. 8. Concentrate all the digests to L ) in a Speed Vac. 9. Centrifuge the samples briefly and add 6 loading dye (6 x ). Mix well by pipetting.

PAGE 63

63 10. Load samples on the gel. Also load a molec ul ar weight mar ker (1 kb ladder, New England Biolabs ) for estimating band size following hybridization. 11. Dilute the plasmid containing the transgene and load 50 pg as a positive control. 12. Run the gel at 15V over night (750 min) in 0.5 TBE. Remove the gel from the elec trophoresis and cut excess gel using a scalpel. Measure the dimensions of the gel. 13. Stain the gel for one hour using freshly prepared ethidium bromide stain (0.05 g L 1 ). 14. Wash the gel five times using de ionized water (DI H 2 O). 15. Visualize the gel on a gel documentation system to check complete digestion of all samples. Also measure and record the distance of the bands of the molec ul ar weight marker from the top of the gel. b. DNA b lotting p rocedure 1. Prepare 500 m L 0.125 N hydrochloric acid (HC l) denaturation buffer and neutralization buffer 2. Treat the gel with 0.125 N HCl on a shaker with gentle shaking for 3 0 min for depurination. Wash the gel three times with DI H 2 O. 3. Cut three pieces of filter paper to match the size of the gel and two pieces for the bridge (24 x 18 cm). N + membrane (Amersham Biosciences, Piscataway, NJ) to match the size of the gel. 4. Treat the gel with denaturation buffer on a shaker with gentle shaking for 30 min followed by 30 min treat ment with neutralization buffer. 5. Ass emble the tray and the platform on which the blot is to be set up. Place the filter paper bridge on top of each other on the platform and fold them so that it dips into the tray on both sides. 6. Pour 20 x SSC on the bridge to wet it completely. Roll a glass rod over it several times to remove air bubbles. Pour more 20 x SSC onto the bridge. 7. Place the gel in the center of the bridge, pour 20 x SSC over it and remove air bubbles. 8. Mark the membrane to determine the orientation of the gel following blotting. 9. W et the membrane using 20 x SSC place the membrane on the ge l; pour 20 x SSC onto it and remove air bubbles. 10. Place three pieces of Whatmann filter paper on the membrane; remove air bubbles after placing each piece. Pour more 20x SSC over the top to avoid drying of the filter papers. 11. Place pieces of parafilm all around the gel to cover the bridge to ensure that the mo vement of the transfer buffer takes place only through the gel. 12. Fill the tray with the transfer buffer to the top and cover the tra y with Saran wrap to prevent evaporation of the buffer during blotting. 13. Place a stack of absorbent paper towels on the gel and place another piece of plexi glass on top. On this, place a small weight (ca. 750 g) to ensure uniform blotting and leave over n ight (16 18 h).

PAGE 64

64 14. Disassemble the blot. Wrap the membrane in a cling film and expose it to UV for 2 min to fix the DNA on the membrane. Store the me mbrane in a zip loc bag at 4C. 15. Visualize the gel using a gel documentation system to make sure the transfer w as complete. c. Hybridization u sing the Prime a Gene l abeling s ystem ( p romega ) 1. Check the radioactive working area for previous contamination before working. Thaw blocking DNA (sheared salmon sperm DNA), labeling buffer, dNTPs (dATP, dGTP, dTTP), BSA and probe o 32P ] dCTP behind the plexiglass shield to thaw. 2. Pre heat the hybridization oven and water bath to 65C. Place the hybridization buffer in the water bath. 3. Roll the membrane and place it inside t he hybridization tube. Add 50 m L 5 SSC to th e tube and pre wet the membrane for 5 10 min. Mak e sure that there are no leaks. 4. Estimate the volume of probe required to get 25 ng of the probe and pipette it into a clean microcentrifuge t ube. Make up the volume to 30 using the nuclease free water pro vided with the labeling kit. 5. Close the tube tightly and boil the p robe for 5 min. Also boil 500 of salmon sperm DNA in a separate tube. Place on ice for 5 min immediately after boiling. 6. Discard the 5 x SSC into the sink and invert the hybridization tu bes on a paper tissue to drain. 7. Prepare the dNT 8. P mix by mixing equal parts of dTTP, dATP and dGTP. Prepare enough to use 2 per labeling reaction. 9. Set up the labeling reaction as follows: 10. Add the fo llowing to the denatured probe 5 x labelling buffer 10 Unlabeled dNTP mix 2 BSA 2 1 Total volume 45 11. l 32P ] dCTP and mix well by pipetting. Final volume of the reaction is 50 12. Incubate the mixture behind the plexiglass shield at room temperature for 4 h. 13. For pre hybridization, add 15 m L pre heated (65C) hybridization buffer and 500 denatured salmon sper m DNA in the hybridization tube. 14. Place the tubes in the hybridization oven and incubate at 65C for 4 h. 15. Add 500 salmon sperm DNA to the labeled probe and boil for 5 min behind the plexiglass shield. 16. Discard the pre hybridization solution into the si nk and d rain the tube on a paper towel.

PAGE 65

65 17. B efore the probe is ready, add 8 m L pre heated hybridization buffer in the hybridization tube and move the tube behind the plexiglass shield. 18. Immediately after boiling, add the probe mixture to the hybridization tub e. Take care to avoid any spills. 19. Place the hybridization tube in the hybridization oven and incubate over night at 65C (18 h). 20. Prepare the wash solution (0.1 SSC + 0.1% S DS). Prepare enough to use 50 m L per wash for three washes per blot. 21. Heat t he solution to 65C using the water bath. 22. Remove hybridization tubes from the oven and place behind the plexiglass shield. 23. Working behind the plexiglass shield, dispose the hybridization solution into the hazardous waste container using a funnel taking c are to avoid any spills. 24. Pour 70 m L pre heated wash solution (65C) into the hybridization tube; replace the lid tightly and perform a quick wash by shaking the tube for a few seconds. 25. Dispose the wash solution into the hazardous waste container and add ano ther 70 m L pre heat ed wash solution into the tube. 26. Place the tubes in the oven for 20 min. Work behind the plexiglass shield, dispose the wash solution into the hazardo us waste container and add 70 m L preheated wash solution into the tube for the final wash. 27. Place the tube in the oven for 20 min. Remove the tubes from the oven and place them behind the plexiglass shield. Dispose the wash solution into the hazardous waste container and w rap the membrane in Saran wrap. 28. Check for radioactivity on the membr ane using a Geiger counter. Also check the working area for any radioactive contamination. 29. Place the membrane with an X ray film (Kodak) in an autoradiography cassette and allow 16 18 h for exposure depending on the intensity of the signal from the Geiger counter. Place the cassette at 80C during exposure. RNA Extractions 1. Treat mortars, pestles and spat ul as with 0.1% DEPC (Sigma) water over night. Autoclave for 30 min and dry in an incubator oven at 60 C Prepare extraction buffer. 2. Harvest secondary ti llers or internode from sugarcane and immerse the tissue into liquid nitrogen immediately Store samples at 80 C. 3. Cool mortar and pestle by addin g L iquid nitrogen. Gr i nd the secondary tillers under liquid nitrogen. 4. Add 10 m L pre heated (65 ) acidic phe no l (pH 4.5) and 10 m L of extraction buffer. Mix the homogenate well. 5. Incubate at 65 C water bath for 5 min 6. Centrifuged at 15,000 x g (4 C) for 15 min. 7. Caref ul ly transfer the supernatant to a new 50 m L tube. 8. Add equal volume of chloroform. 9. Mix well. Incu bate at room temperature for 10 min. 10. Centrifuged at 15,000 x g (4 C) for 15 min.

PAGE 66

66 11. Caref ul ly transfer the supernatant to a new 50 m L tube. 12. Add equal volume of isopropanol. Mix by inverting the tube gently 13. Centrifuged at 15,000 x g (4 C) for 30 min. 14. Caref ul l y remove the supernatant without disrupting the pellet. 15. Wash the pellet with 70% ethanol (prepare with DEPC treated ddH 2 O) two times. 16. Air dry the pellet for 10 min until the pellet turn into transparent color. Do not over dry the pellet. 17. Dissolve the pell et in 50 DEPC treated ddH 2 O. 18. Use 2 to check concentration and quality using the NanoDrop spectrophotometer 19. Store the dilutions and stocks at 80 C. Quantitative Real Time RT PCR Analysis a. DNase treatment 1. Total RNA is extracted from internode as describ ed above. 2. Set up the D N ase digestion reaction as follows: RNA in water (1 g) 8 RQ1 R Nase Free DNase 10X Reaction Buffer 1 RQ1 RNase Free DNase 1u/ g Nuclease free water to a final volume of 1 0 3. Incubate at 37 C for 30 min. 4. Add 1 of RQ1 DNase Stop Solution to terminate the reaction. 5. Incubate at 65 C for 10 min to inactive the DNase. 6. Add portion of the treated RNA to RT PCR reaction. b. I Script TM cDNA s ynthesis k it Protocol as provided by the manufacturer 1. Prepare the reaction solution as described below. 5 x iScript reaction mix 4 iScript reverse tr anscriptase 1 Nuclease free water 4 RNA template (1 g) 11 Total Volumn 20 2. Reaction protocol Incubate the complete reaction mix 5 min at 25 C 30 min at 42 C 5 min at 85 C

PAGE 67

67 Hold at 4 C c. q Real Time PCR 1. End point PCR Reaction mix 10 x Buffer 5 L 5 x Q solution 10 L dNTP (2 mM stock) 1 L Primer F 1 L Primer R 1 L Hotsta rt Polymerase 0.25 L cDNA template (50 ng) 1 L ddH 2 O 30. 8 L Total 50 L 2. Check the end point PCR production by electrophoresis 3. PCR was performe d in the MyiQ cycler (Bio Rad) wit h iQ SYBR Green supermix (Bio R ad). Sugarcane GAPDH was used as an internal control. Northern B lot A nalysis 1. Extract t otal RNA from transgenic lines and wild type using the method described above. 2. r each transgenic sugarcane line was denatured in 65 C water bath for 10 min 3. Load the RNA samples into 18% formaldehyde a g a rose gel. 4. Total RNA were separated by electrophoresis at 50 V for 4 h 5. Seperated RNA are blotted as described in Southern Blotting. 6. Hybridization using the Prime a Gene Labeling System (Promega ) as described in Southern Blotting. S iRNA N orthern B lot A nalysis 1. Extract t otal RNA from transgenic lines as well as wild type using the method as described above. 2. Add 0.1 Volume of 5 M NaC l and 50% PEG (w/v, M.W. 8,000) to the RNA solution. Mix t horoughly 3. Incubate on ice for 1 h. 4. Centrifuge at 20,000 x g (4 C ) for 10 min. 5. Transfer the supernatant to a new tube. 6. Precipitate small RNA with equal volume of isopropanol at 20 o C overnight. 7. Cen trifuge 20,000 x g (4 C ) for 30 min 8. Wash the pellet with 70% ethanol 2 X 9. Air dry the pellet.

PAGE 68

68 10. Dilute the pellet in DEPC treated H 2 O. 11. Load 30 g of small RNA in to a 15% polyacrylamide TBE/urea gel (Bio R ad) and 12. RNA s are blotted as described in Southern Blotting. 13. Hybridization using the Prime a Gene Labeling System (Promega ) as described in Sout hern Blotting. AcBr L ignin M easurement 1. Harvest the mature internode and dry in 55 C for 2 d. 2. Ground the dry tissue using family us ing commercial coffee grounder. 3. Add 50 m L of 50% ethanol. Sonicate the mixture at 55 C for 30 min x 3 4. Filter the tissues a nd discard the flow through. 5. Dry the powders in 55 C oven for 2 d 6. Apply the powder to 0.2 mm sieve and collect the fine powders that pass through the sieve. 7. For each line, load 2 mg sampl e into 1.5 m L Eppendorf (Eppendorf, Hamburg, Germany) tube with 3 t echnical replications. 8. Add 1 m L of 25% AcBr in acetic acid into the tube. 9. Incubate at 50 C for 3 h. 10. V o rtex the tube for 10 s. Incubate at 50 C for another 15 min. 11. Repeat 3 X 12. Incubate the tube on ice for 30 min. 13. Mix 1.7 m L 25% AcBr in acetic acid, 200 L 2M L sample in Sub microCell (ThermoFisher, Waltham, MA) and mix thoroughly. 14. Read the absorption at 280 nm by Evolution 300 (ThermoFisher). MUG assays a. Protein e xtraction 1. Collect calli and put into 2 m L ep p endorf tube 2. Gr in d the tissue int o fine powders with liquid nitrogen. 3. Add 500 l protein extraction buffer 3 4. Centrifuge at 13000 rpm in a microfuge at 4 C for 15 min. 5. Remove supernatant to a fresh 1.5 m L tube 6. Centrifuge again at 13000 rpm in microfuge at 4 C for 15 min 7. Remove supernat ant to a fresh 1.5 m L tube, store on ice b. Protein concentration 1. Dilute 200 L protein assay reagent in 800 L water for each sample 2. Aliquot 1 m L per plastic cuvette 3. Add 4 L of sample per cuvette. Invert to mix 4. Add 4 L of extraction buffer t o one e xtra cuvette as a contro l. 5. Measure absorbance at 595nm c. Assay

PAGE 69

69 1. Place 180 L of MUG a ssay b uffer in clear 96 well plate (4.932 mg MUG / 14 m L / plate) using m ul tichannel pipette. 2. Transfer clear plate to 37 C water bath. 3. Place 180 L of s top buffer in e ach of the corresponding 96 well black fl uo ro plate (T0 min, T30 min, T60 min) using m ul tichannel pipette 4. Add 20 L of sample to the 3 appropriate wells in the clear plate (with plate still in 37 C water bath). Place 20 L of water in A2. Place 20 L of M U 50 M in B2 5. At timed interval s (0 30, 60 min) remove 20 L from each well of the clear plate (in 37 C bath) and add to the corresponding well in the black fluoro plate using m ul tichannel pipette. Keep fluoro plates in the dark. For time 0, add one row of samples to clear plate d. Plate r eading Once all the required samples have been collected, read the fluoro plates using the Titertek Fluoroscan II. Save slope and coefficient. Calc ul ate pmol MU/min/mg protein (Average slope of triplicate sample / 2) x 1000 / ug protein L 1 Subtract average background fluorescence (35 4 pmol MU min 1 mg 1 protein (p<0.05), measured in more than 50 negative control samples over several independent assays) from all fluorometric GUS activity values. Due to the variation associated with background measurements, samples with less than twice the background value are considered as negligible Include at least one negative control sample in each fluorometric assay. Buffer s and Solution Macro stock solution dd H 2 O 800 m L Ammonium n itrate 16.5 g Potassium n itrate 19.0 g Calcium c hloride dihydrate 4.4 g Magnesium s ul fate heptahydrate 3.7 g Potassium p hosphate, monobasic 1.7 g Mix all ingredients with constant stirring. Bring final solution up to 1 Liter and store in bottle in refrigerator. Micr o stock solution dd H 2 O 400 m L Potassium i odide 0.04150 g Boric a cid 0.31000 g Mangane se s ul fate 0.64000 g

PAGE 70

70 Zinc s ul fate heptahydrate 0.43000 g Sodium m olybdate dehydrate 0.01250 g Cupric s ul fate pentahydrate 0 .00125 g Cobalt c hloride hexahydrate 0.00125 g Mix all ingredients under constant stirring. Bring final solution up to 500 m L and store at 4 o C in refrigerator. Iron stock solution dd H 2 O 400 m L Na 2 EDTA 0.93 g FeSO 4 7H 2 O 0.65 g dd H 2 O Fill up to 500 m L Heat 400 m L ddH 2 O in beaker, but do not boil water. Add Na 2 EDTA to hot water with constant stirring. Once it dissol ves, remove from heat before adding f errous s ul fate and continue stirring. Bring final solution up to 500 m L and store in bottle wrapped in aluminum foil (to protect from light) in refrigerator. Paromomycin (30 mg m L 1 ) Dissolve 0.3 g paromomycin s ul pha te in 10 m L ddH 2 O. Filter sterilize and store in aliquots at 20C. Use 1 m L L 1 media. CuSO4 (12.45 mg m L 1 ) 0.6225 g CuSO 4 .5H 2 O dissolved in 50 m L ddH 2 O. Filter sterilize by using 1 micron filter fitted to a syringe. Store in aliquots at 20C. Use 10 0 L L 1 media. B5G Vitamin Stock solution, filter sterilized: dd H 2 O 90 m L Nicotinic Acid 0.10 g Thiamine HCl 1.00 g Pyridoxine HCl 0.10 g Glycine 0.20 g Myo i nositol 10.0 g Bring final solution up to 100 m L F ilter sterilize with syringe into sterile Eppendorf tubes. Freeze tubes in 20C freezer and only open in clean bench when preparing media. Before adding to media thaw tubes completely and vortex 2,4 Dich lorophenoxyacetic acid (3 mg m L 1 ) L 1N NaOH. Make up to 50 m L with ddH 2 O. Store in aliquots at 20C. Use 1 m L L 1 media. Media i. Embryogenesis Media (IEM) ( 500 m L ) Pre Autoclave dd H 2 O 400 m L Sucrose 10 g

PAGE 71

71 Macro stock 50 m L Micro stock 5 m L Fe stock 10 m L 2,4 Dichlorophenoxyacetic acid stock 500 L CuSO 4 L dd H 2 O 500 m L pH Measurement 5.8 for each bottle Phytagel (Gelrite) 1.5 g per bottle Post Autoclave B 5 G Vitamin stock L per bottle ii. Osmotic p retreatment medium for p article b ombardment (500 m L ) dd H 2 O ( 400 m L ) Sucrose 10 g Macro Stock 50 m L Micro Stock 5 m L Fe Stock 10 m L Phytohormone stock solution L CuSO 4 L Sorbitol 36.44 g dd H 2 O Fill up to 500 m L pH Measurement 5.8 for each bottle Phytagel (Gelrite) 1.5 g per bottle Post a utoclave B 5 G Vitamin Stock L per bottle iii. Re generation m edium (500 m L ) dd H 2 O 400 m L Sucrose 10 g Macro Stock 50 m L Micro Stock 5 m L Fe Stock 10 m L CuSO 4 L TDZ dd H 2 O Fill up to 500 m L pH Measurement 5.8 for each bottle Phy tagel (Gelrite) 1.5 g per bottle Post a utoclave B 5 G Vitamin Stock L per bottle CTAB buffer (500 m L ) 50 m L 1M Tris HCl

PAGE 72

72 20 m L 0.5M EDTA (disodium salt) 40.91 g NaCl 10g CTAB Make up the volume to 500 m L with ddH 2 O and autoclave for 20 min. 3M S odium acetate (50 m L ) Dissolve 4.1 g sodium acetate in 50 m L ddH 2 O. Adjust pH to 5.2 with glacial acetic acid. 0.5M EDTA disodium salt, pH 8.0 (100 m L ) Dissolve 18.61 g EDTA disodium salt in 100 m L ddH 2 O. 6x Loading dye (100 m L ) 0.25% bromophenol blue 0.25% xylene cyanol FF 15% Ficoll Dissolve 15 g Ficoll in 60 m L ddH2O while stirring constantly. Add 20 m L ddH2O and warm the mixture. Add 0.25 g of both dyes, dissolve com pletely and make up volume to 100 m L with ddH2O. Autoclave for 20 min and store at room temperature. 50x TAE (1L) 242 g Tris base 57.1 m L glacial acetic acid 100 m L 0.5M EDTA (pH 8.0) Combine all components in ddH 2 O, make the final volume to 1000 m L Au toclave for 20 min. Use 1x TAE as running buffer. 5X TBE (1L) 54 g Tris base 27.5 g B oric acid 20 m L 0.5M EDTA (pH 8.0) Combine all components in ddH2O, make the final volume to 1000 m L Autoclave for 20 min. Use 0.5x TBE as running buffer. Hybridizatio n Buffer (500 m L ) 125 m L 1M Na 2 HPO 4 (pH 7.4) 1 m L 0.5M EDTA (pH 8.0) 5 g BSA 175 m L 20% SDS Make up the volume to 500 m L with ddH 2 O. Autoclave for 20 min and store at 4 C 1M Na 2 HPO 4 pH 7.4 (1L). Dissolve 142 g Na 2 HPO 4 in 800 m L ddH 2 0. Adjust the pH to 7.4 with phosphoric acid and make up the volume to 1L. 20x SSC, pH 7.0 (1L) 175.3 g NaCl

PAGE 73

73 88.2 g sodium citrate Dissolve in 800 m L ddH 2 O. Adjust pH to 7.0 with 1N HCl, make up the volume to 1L and autoclave for 20 min. 0.125N HCl 11 m L conc HCl 898 m L dd H 2 0 Den a turation b uffer 87.66g NaCl 20g NaOH Dissolve in 800 m L ddH 2 0 and make final volume to 1000 m L Neutralization B uffer 87.66g NaCl 60.5g Trizma base Dissolve in 800 m L ddH 2 0. Adjust pH to 7.5 with conc entrated HCl. Make final volume to 1000 m L wit h dd H 2 0. RNA Extraction Buffer 0.1 M LiCl 0.1 M T ris HCl (pH 8.0) 0.01M EDTA (pH 8.0) 1 % SDS (w/v), and 0.1% PVP (w/v) Protein Extraction Buffer 3 250 m L 0.2M NaPO 4 (pH 7) 10 m L 1M DTT, 2 m L 0.5M EDTA 10 m L 10% SLS, 10 m L 10% T riton X 100 Make up to 1L vol ume with dH 2 0. Solution filter sterilized and stored at 4 C

PAGE 74

74 LIST OF REFERENCES Allen GC, Hall GE, Childs LC, Weissinger AK, Spiker S, Thompson WF (1993) Scaffold attachment regions increase reporter gene expression in stably transformed plant cells. Pla nt Cell 5:603 613 Altpeter F, Baisakh N, Beachy R, Bock R, Capell T, Christou P, Daniell H, Datta K, Datta S, Dix PJ, Fauquet C, Huang N, Kohli A, Mooibroek H, Nicholson L, Nguyen TT, Nugent G, Raemakers K, Romano A, Somers DA, Stoger E, Taylor N, Visser R (2005) Particle bombardment and the genetic enhancement of crops: myths and realities. Molec ul ar Breeding 15:305 327 Altpeter F, Oraby H (2010) Sugarcane. In: Kempken F, Lorz H, Nagata T (eds) Genetic Modification of Plants: Agric ul ture, Hortic ul ture an d Forestry, vol 64. Biotechnology in Agric ul ture and Forestry. Springer Verlag Berlin, Germany, pp 453 472 Altpeter F, Vasil V, Srivastava V, Stoger E, Vasil IK (1996) Accelerated production of transgenic wheat ( Triticum aestivum L) plants. Plant Cell Rep orts 16:12 17 Arencibia AD, Carmona ER, Tellez P, Chan MT, Yu SM, Trujillo LE, Oramas P (1998) An efficient protocol for sugarcane ( Saccharum spp. L.) transformation mediated by Agrobacterium tumefaciens Transgenic Research 7 :213 222 Arruda P (2011) Per spective of the sugarcane industry in Brazil. Tropical Plant Biology 4:3 8 Artschwager E, Brandes EW (1958) Sugarcane ( Saccharum officinarum L.): O rigin, classification characteristics, and descriptions of representative clones. Agric ul tural Handb ook, US Dep artment of Agric ul ture 122:307 Bai FW, Anderson WA, Moo Young M (2008) Ethanol fermentation technologies from sugar and starch feedst ocks. Biotechnology Advances 26 :89 105 Balhorn R (2007) The protamine family of sperm nuclear proteins. Genome Biolog y 8:277 Barba R, Nickell LG (1969) Nutrition and organ differentiation in tissue c ul tures of sugarcane, a monocotyledon. Planta 89:299 Basnayake SWV, Morgan TC, Wu L, Birch RG (2012) Field performance of transgenic sugarcane expressing isomalt ul ose syntha se. Plant Biotechnology Journal 10:217 225 Bernstein E, Caudy AA, Hammond SM, Hannon GJ (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Natu re 409 :363 366

PAGE 75

75 Bevan M (1984) Binary Agrobacterium vectors for plant transforma tion. Nucleic Acids Research 12:8711 8721 Boerjan W, Ralph J, Baucher M (2003) Lignin biosynthesis. Annual Review of Plant Biology 54:519 546 Bonnett GD, Nowak E, Olivares Villegas JJ, Berding N, Morgan T, Aitken KS (2008) Identifying the risks of transge ne escape from sugarcane crops to related species, with partic ul ar reference to Saccharum spontaneum in Australia. Tropical Plant Biology 1:58 71 Boudet A M (2007) Evolution and current status of research in phenolic compounds. Phytochemistry 68 : 22 24 Bo wer R, Birch RG (1992) Transgenic sugarcane plants via microprojectile bombardment. Plant Journal 2:409 416 Brune B, Hartzell P, Nicotera P, Orrenius S (1991) Spermine prevents endonuclease activation and apoptosis in thymocytes. Experimental Cell Researc h 195:323 329 Burner DM, Grisham MP (1995) Induction and stability of phenotypic variation in sugarcane as affected by propagation procedure. Crop Science 35:875 880 Byrt CS, Grof CPL, Furbank RT (2011) C4 plants as biofuel feedstocks: O ptimi z ing biomass production and feedstock quality from a lignocell ul osic perspective. Journal of Integrative Plant Biology 53:120 135 Carroll A, Somerville C (2009) Cell ul osic biofuels. Annual Review of Plant Biology 60:165 182 Chen F, Dixon RA (2007) Lignin modificatio n improves fermentable sugar yields for biofuel production. Nature Biotechnology 25:759 761 Chen L, Auh CK, Dowling P, Bell J, Chen F, Hopkins A, Dixon RA, Wang ZY (2003) Improved forage digestibility of tall fescue ( Festuca arundinacea ) by transgenic do wn reg ul ation of cinnamyl alcohol dehydrogenase. Plant Biotechnology Journal 1:437 449 Chengalrayan K, Gallo Meagher M (2001) Effect of various growth reg ul ators on shoot regeneration of sugarcane. In Vitro Cell ul ar & Developmental Biology Plant 37:434 439 Chowdhury MKU, Vasil IK (1992) Stably transformed herbicide resistant callus of sugarcane via microprojectile bombardment of cell suspension c ul tures and electroporation of protoplasts. Plant Cell Reports 11:494 498

PAGE 76

76 Christensen AH, Sharrock RA, Quail PH (1992) Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Molec ul ar Biology 18:675 689 Correa Molinari HB, Marur CJ, Daros E, Freitas de Campos MK, Rodrigues Portela de Carvalho JF, Bespalhok Filho JC, Protasio Pereira LF, Esteves Vieira LG (2007) Evaluation of the stress inducible production of proline in transgenic sugarcane ( Saccharum spp.): osmotic adjustment, chlorophyll fl uorescence and oxidative stress. Physiologia Plantarum 130:218 229 Dal Bianco M, Carneiro MS, Hotta CT, Chapola RG, Hoffmann HP, Garcia AAF, Souza GM (2012) Sugarcane improvement: how far can we go? Current opinion in biotechnology 23:265 270 Daniels J, Roach BT (1987) A taxonomic listing of Saccharum and related genera. Sugar Cane (Spring Supplement):16 20 Datta K, Baisakh N, Thet KM, Tu J, Datta SK (2002) Pyramiding transgenes for m ul tiple resistance in rice against bacterial blight, yellow stem borer and sheath blight. Theoretical and Applied Genetics 106:1 8 Desai NS, Suprasanna P, Bapat VA (2004) Simple and reproducible protocol for direct somatic embryogenesis from c ul tured immature inflorescence segments of sugarcane ( Saccharum spp.). Current Scie nce 87:764 768 Dixon L, Nyffenegger T, Delley G, Martinezizquierdo J, Hohn T (1986) Evidence for replicative recombination in ca ul iflower mosaic virus. Virology 150:463 468 Dixon RA, Srinivasa Reddy AS (2003) Biosynthesis of monolignols. Genomic and reve rse genetic approaches. Phytochemistry Reviews 2:289 306 Ecker JR, Davis RW (1986) Inhibition of gene expression in plant cells by expression of antisense RNA. Proceedings of the National Academy of Sciences 83:5372 5376 Ehlting J, Buttner D, Wang Q, Dou glas CJ, Somssich IE, Kombrink E (1999) Three 4 coumarate : coenzyme A ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms. Plant Journal 19:9 20 Ehlting J, Mattheus N, Aeschliman DS, Li EY, Hamberger B, C ul lis IF Zhuang J, Kaneda M, Mansfield SD, Samuels L, Ritland K, Ellis BE, Bohlmann J, Douglas CJ (2005) Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missin g l inks in lignin biosynthesis and transcriptional reg ul ators of fiber differentiation. Plant Journal 42:618 640

PAGE 77

77 Elliott AR, Geijskes RJ, Lakshmanan P, McKeon MG, Wan g L F, Berding N, Grof CPL, Smith GR (2002) Direct regeneration of transgenic sugarcane following microprojectile transformation of regenerab le cells in thin transverse section explants. In Vitro Cell ul ar and Developmental Biology Animal 38 (Abstract) Enriquez GA, Trujillo LE, Menendez C, Vazquez RI, Tiel K, Dafhnis F, Arrieta J, Selman G, Hernandez L (2000) Sugarcane ( Saccharum hybrid) geneti c transformation mediated by Agrobacterium tumefaciens : production of transgenic plants expressing proteins with agronomic and industrial value. Plant genetic engineering: towards the third millennium: Proceedings of the International Symposium on Plant Ge netic Engineering, Havana, Cuba, December 6 10 5:76 81 Enriquez Obregon GA, Vazquez Padron RI, Prieto Samsonov DL, De la Riva GA, Selman Housein G (1998) Herbicide resistant sugarcane (Saccharum officinarum L.) plants by Agrobacterium mediated transform ation. Planta 206:20 27 E nvironmental P rotection A gency (EPA) (2010) EPA Finalizes Reg ul ations for the National Renewable Fuel Standard Program for 2010 and Beyond http://www.e pa.gov/otaq/fuels/renewablefuels/reg ul ations.htm a ccessed April 27, 2012 Falco MC, Neto AT, UL ian EC (2000) Transformation and expression of a gene for herbicide resistance in a Brazilian sugarcane. Plant Cell Reports 19:1188 1194 Falco MC, Silva Filho MC (2003) Expression of soybean proteinase inhibitors in transgenic sugarcane plants: effects on natural defense against Diatraea saccharalis Plant Physiology and Biochemistry 41:761 766 F ood and A gric ul tural O rganization (FAO) 2010 database, http://faostat.fao.org/site/567/defa ul t.aspx#ancor accessed April 27, 2012 Fouad W, Martin L, Vermerris W, Altpeter F (2010) Alterin g l ignin Content in Bahia Grass ( Paspalum notatum Flugge ) by Downreg ul ation of 4 Coumarate CoA Ligase. In Vitro Cell ul ar & Developmental Biology Animal 46:114 115 Finer JJ, Vain P, Jones MW, McM ul len MD (1992) Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Reports 11:323 328 Fire A, Xu SQ, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans Nature 391:806 811

PAGE 78

78 Fraley RT, Rogers SG, Horsch RB, Sanders PR, Flick JS, Adams SP, Bittner ML Bran d LA, Fink CL, Fry JS, Galluppi GR, Goldberg SB, Hoffmann NL, Woo SC (1983) Expression of bacterial genes in plant cells. Proceedings of the National Academy of Sciences of the United States of America Biological Sciences 80:4803 4807 Fu C, Xiao X, Xi Y, Ge Y, Chen F, Bouton J, Dixon RA, Wang Z Y (2011) Downreg ul ation of cinnamyl alcohol dehydrogenase (CAD) leads to improved saccharification efficiency in switchgrass. Bioenergy Research 4:153 164 Fu XD, Duc LT, Fontana S, Bong BB, Tinjuangjun P, Sudhakar D, Twyman RM, Christou P, Kohli A (2000) Linear transgene constructs lacking vector backbone sequences generate low copy number transgenic plants with simple integration patterns. Transgenic Research 9:11 19 Gallo M eagher M, Irvine JE (1993) Effects of ti ssue type and promter strength on transient GUS expression in sugarcane following particle bombardment. Plant Cell Reports 12:666 670 Gallo Meagher M Irvine JE (1994) Evidence for genetic transformation of sugarcane with the bar gene. Sugar y Azucar 89:34 35 Gallo Meagher M, Irvine JE (1996) Herbicide resistant transgenic sugarcane plants containing the bar gene. Crop Science 36:1367 1374 Gambley RL, Ford R, Smith GR (1993) Microprojectile transformation of sugarcane meristems and regeneration of shoots e xpression beta glucuronidase. Plant Cell Reports 12:343 346 Gilbert RA, Glynn NC, Comstock JC, Davis MJ (2009) Agronomic performance and genetic characterization of sugarcane transformed for resistance to sugarcane yellow leaf virus. Field Crops Research 111:39 46 Goussard PG, Wiid J (1992) The elimination of fan leaf virus from grapevines using in vitro somatic embryogenesis combined with heat therapy. South African Journal for Enology and Vitic ul ture 13:81 83 Gregory RI, Chendrimada TP, Shiekhattar R ( 2006) MicroRNA biogenesis Isolation and characterization of the microprocessor complex. In: Ying SY (ed) Methods in Molec ul ar Biology, vol 342 Humana Press Inc, Totowa, N J, USA, pp 33 47 Groenewald J H, Botha FC (2008) Down reg ul ation of pyrophosphate: fructose 6 phosphate 1 phosphotransferase (PFP) activity in sugarcane enhances sucrose accum ul ation in immature internodes. Transgenic Research 17:85 92

PAGE 79

79 Gui J, Shen J, Li L (2011) Functional Characterization of Evolutionarily Divergent 4 Coumarat e: Coenzyme A Ligases in Rice. Plant Physiology 157:574 586 Hamerli D, Birch RG (2011) Transgenic expression of trehal ul ose synthase res ul ts in high concentrations of the sucrose isomer trehal ul ose in mature stems of field grown sugarcane. Plant Biotechno logy Journal 9:32 37 Harrison MD, Geijskes J, Coleman HD, Shand K, Kinkema M, Palupe A, Hassall R, Sainz M, Lloyd R, Miles S, Dale JL (2011) Accum ul ation of recombinant cellobiohydrolase and endoglucanase in the leaves of mature transgenic sugar cane. Plan t Biotechnology Journal 9:884 896 Hatfield RD, Grabber J, Ralph J, Brei K (1999) Using the acetyl bromide assay to determine lignin concentrations in herbaceous plants: Some cautionary notes. Journal of Agric ul tural and Food Chemistry 47:628 632 Heinz DJ, Mee GWP (1969) Plant differentiation from callus tissue of Saccharum species. Crop Science 9:346 348 Hisano H, Nandakumar R, Wang Z Y (2009) Genetic modification of lignin biosynthesis for improved biofuel production. In Vitro Cell ul ar & Developmental Bio logy Plant 45:306 313 Ho WJ, Vasil IK (1983) Somatic embryogenesis in sugarcane ( Saccharum officinarum L.) I. The morphology and physiology of callus formation and the ontogeny of somatic embryos. Protoplasma 118:169 180 Hotta CT, Lembke CG, Domingues DS, Ochoa EA, Cruz GMQ, Melotto Passarin DM, Marconi TG, Santos MO, Mollinari M, Margarido GRA, Crivellari AC, Santos WDd, Souza APd, Hoshino AA, Carrer H, Souza AP, Garcia AAF, Buckeridge MS, Menossi M, Sluys Mv, Souza GM, dos Santos WD, de Souza AP, van Sluy s M (2010) The biotechnology roadmap for sugarcane improvement. Tropical Plant Biology 3:75 87 Hu WJ, Harding SA, Lung J, Popko JL, Ralph J, Stokke DD, Tsai CJ, Chiang VL (1999) Repression of lignin biosynthesis promotes cell ul ose accum ul ation and growth in transgenic trees. Nature Biotechnology 17:808 812 Jackson PA (2005) Breeding for improved sugar content in sugarcane. Field Crops Research 92:277 290 James VA, Neibaur I, Altpeter F (2008) Stress inducible expression of the DREB 1A transcription factor from xeric, Hordeum spontaneum L. in turf and forage grass ( Paspalum notatum Flugge) enhances abiotic stress tolerance. Transgenic Research 17:93 104

PAGE 80

80 Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta glucuronidase as a sensitive and versatile g ene fusion marker in higher plants. Embo Journal 6:3901 3907 Jeffreys AJ, Flavell RA (1977) The rabbit beta globin gene contains a large insert in the coding sequence. Cell 12:1097 1108 Jeffries TW (1990) Biodegradation of lignin carbohydr ate complexes. Biodegradation 1 :163 176 Jung JH, Xiong Y, Kim JY, Fouad W, Vermerris W, Gallo M, Altpeter F (2011) RNA Interference Suppresses Lignin Biosynthetic Genes Caffeic Acid 3 O methyltransferase ( COMT ) and/or 4 Coumarate CoA Ligase ( 4CL ) in Sugarcane. In Vitro Cell ul ar & Developmental Biology Animal 47:S36 S36 Kajita S, Katayama Y, Omori S (1996) Alterations in the biosynthesis of lignin in transgenic plants with chimeric genes for 4 coumarate:coenzyme a ligase. Plant and Cell Physiology 37:957 965 Kalunke RM, Kolge AM, Babu KH, Prasad DT (2009) Agrobacterium mediated transformation of sugarcane for borer resistance using Cry1Aa 3 gene and one step regeneration of transgenic plants. Sugar Tech 11:355 359 Kaneda M, Rensing KH, Wong JCT, Banno B, Mansfield SD, Sam uels AL (2008) Tracking monolignols during wood development in lodgepole pine. Plant Physiology 147:1750 1760 Khanna HK, Bokan M, Harrison M, Kancherela L, Dickman MB, Dale JL (2008) Enhancing Agrobacterium mediated transformation efficiency of sugarcane: Progress towards an efficient, genotype independent method. In Vitro Cell ul ar & Developmental Biology Animal 44:S42 Kim J, Gallo M, Altpeter F (2012) Analysis of transgene integration and expression following biolistic transfer of different quantities of minimal expression cassette into sugarcane ( Saccharum spp. hybrids). Plant Cell Tiss ue and Organ C ul t ure 108:297 302 Klein TM, Wolf ED, Wu R, Sanford JC (1987) High velocity microprojectiles for delivering nucleic acids into living cells. Nature 327:70 73 Kusaba M (2004) RNA interference in crop plants. Current Opinion in Biotechnology 15 ):139 143 Lakshmanan P (2006) Somatic embryogenesis in sugarcane An addendum to the In Vitro Cell ul ar & Developmental Biology P lant 42:201 205

PAGE 81

81 Lanot A, Hodge D, Jackson RG, George GL, Elias L, Lim E K, Vaistij FE, Bowles DJ (2006) The glucosyltransferase UGT72E2 is responsible for monolignol 4 O glucoside production in Arabidopsis thaliana Plant Journal 48:286 295 Lars A. Petras ovits LZ, Richard BM Kristi D S Maria N S Nii A P Lars K N Stevens M B (2012) Enhanced polyhydroxybutyrate production in transgenic sugarcane. Plant Biotechnology Journal. doi:DOI: 10.1111/j.1467 7652.2012.00686.x Lee D, Meyer K, Chapple C, Douglas CJ (199 7) Antisense suppression of 4 coumarate:coenzyme A ligase activity in Arabidopsis leads to altered lignin subunit composition. Plant Cell 9:1985 1998 Leibbrandt NB, Snyman SJ (2003) Stability of gene expression and agronomic performance of a transgenic he rbicide resistant sugarcane line in South Africa. Crop Science 43:671 677 Li L, Zhou YH, Cheng XF, Sun JY, Marita JM, Ralph J, Chiang VL (2003) Combinatorial modification of m ul tiple lignin traits in trees through m ul tigene cotransformation. Proceedings o f the National Academy of Sciences 100:4939 4944 Lourens AG, Martin FA (1987) Evaluation of in vitro propagated sugarcane hybrids for somaclonal variation. Crop Science 27:793 796 Lowe BA, Prakash NS, Way M, Mann MT, Spencer TM, Boddupalli RS (2009) Enhan ced single copy integration events in corn via particle bombardment usin g l ow quantities of DNA. Transgenic Research 18:831 840 Lu C, Meyers BC, Green PJ (2007) Construction of small RNA cDNA libraries for deep sequencing. Methods 43:110 117 Ma HM, Alber t HH, Pa ul l R, Moore PH (2000) Metabolic engineering of invertase activities in different subcell ul ar compartments affects sucrose accum ul ation in sugarcane cells. Australian Journal of Plant Physiology 27:1021 1030 Macedo IC, Seabra JEA, Silva JEAR (2008 ) Green house gases emissions in the production and use of ethanol from sugarcane in Brazil: The 2005/2006 averages and a prediction for 2020. Biomass & Bioenergy 32:582 595 Makita N, Yoshikawa Y, Takenaka Y, Sakaue T, Suzuki M, Watanabe C, Kanai T, Kanbe T, Imanaka T, Yoshikawa K (2011) Salt has a biphasic effect on the higher order structure of a DNA protamine complex. Journal of Physical Chemistry 115:4453 4459

PAGE 82

82 Manickavasagam M, Ganapathi A, Anbazhagan VR, Sudhakar B, Selvaraj N, Vasudevan A, Kasthurir engan S (2004) Agrobacterium mediated genetic transformation and development of herbicide resistant sugarcane ( Saccharum species hybrids) using axillary buds. Plant Cell Reports 23:134 143 Matsuoka S, Ferro J, Arruda P (2009) The Brazilian experience of su garcane ethanol industry. In Vitro Cell ul ar & Developmental Biology Plant 45:372 381 McCarthy RL, Zhong R, Ye Z H (2009) MYB83 is a direct target of SND1 and acts redundantly with MYB46 in the reg ul ation of secondary cell wall biosynthesis in Arabidopsi s. Plant and Cell Physiology 50:1950 1964 Meagher RL, Irvine JE, Breene RG, Pfannenstiel RS, Gallo Meagher M (1996) Resistance mechanisms of sugarcane to Mexican rice borer ( Lepidoptera: Pyralidae ). Journal of Economic Entomology 89:536 543 Melotto Passari n DM (2009) Genetic transformation of sugarcane by biolistic and Agrobacterium tumefaciens to study the mechanism of programmed cell death. Universidade de So Pa ul o, April 8 Ming R, Moore PH, Wu K K, D'Hont A, Glaszmann JC, Tew TL, Mirkov TE, da Silva J, Jifon J, Rai M, Schnell RJ, Brumbley SM, Lakshmanan P, Comstock JC, Paterson AH (2006) Sugarcane improvement through breeding and biotechnology. Plant Breeding Reviews, 27 :15 118 Minois N, Carmona Gutierrez D, Madeo F (2011) Polyamines in aging and disea se. Aging 3:1 16 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue c ul tures. Physiologia Plantarum 15:473 497 Newton DJ, Goussard PG (1990) The ontogeny of somatic embryos from in vitro c ul tured grapevine an thers. South African Journal for Enology and Vitic ul ture 11:70 75 Nishiyama MY Jr VF, Lembke CG, Sato PM, Dal Bianco ML FoR, Hotta CT, Souza GM (2010) The SUCEST FUN reg ul atory network database: designing and energy grass accessed April 27, 2012 Novo Uzal E, Ros LVG, Pomar F, Bernal MA, Paradela A, Albar JP, Ros Barcelo A (2009) The presence of sinapyl lignin in Ginkgo biloba cell c ul tures changes our views of the evolution of lignin biosynthesis. Physiologia Plantarum 135:196 213

PAGE 83

83 Nutt KA, Allsopp PG McGhie TK, Shepherd KM, Joyce PA, Taylor GO, McQualter RB, Smith GR (1999) Transgenic sugarcane with increased resistance to cane grubs. Proceedings of a Conference of the Australian Society of Sugar Cane Technologists, Townsville, Queensland, Australia, April 27 30 p 171 176 Oliver AL, Pedersen JF, Grant RJ, Klopfenstein TJ (2005) Comparative effects of the sorghum bmr 6 and bmr 12 genes: I. Forage sorghum yield and quality. Crop Science 45:2234 2239 Osabe K, Mudge SR, Graham MW, Birch RG (2009) RNAi m ediated down Reg ul ation of PDS gene expression in sugarcane ( Saccharum) a highly polyploid crop. Tropical Plant Biology 2:143 148 Peng F, Ren JL, Xu F, Bian J, Peng P, Sun R (2009) Comparative study of hemicell ul oses obtained by graded ethanol precipitati on from sugarcane bagasse. Abstracts of Papers of the American Chemical Society 238:188 Perl A, Kless H, Blumenthal A, Galili G, Galun E (1992) Improvement of plant regeneration and GUS expression in scutellar wheat calli by optimization of c ul ture condit ions and DNA microprojectile delivery procedures. Molec ul ar & General Genetics 235:279 284 Pilate G, Guiney E, Holt K, Petit Conil M, Lapierre C, Leple JC, Pollet B, Mila I, Webster EA, Marstorp HG, Hopkins DW, Jouanin L, Boerjan W, Schuch W, Cornu D, Hal pin C (2002) Field and p ul ping performances of transgenic trees with altered lignification. Nature Biotechnology 20:607 612 Poethig RS, Peragine A, Yoshikawa M, Hunter C, Willmann M, Wu G (2006) The function of RNAi in plant development. Cold Spring Harbor Symposia on Quantitative Biology 71:165 170 Purseglove JW (1972) Tropical crops: monocotyledons Volume 1. Tropical crops: monocotyledons 334 pp. Ralph J, Lundquist K, Brunow G, Lu F, Kim H, Schatz PF, Marita JM, Hatfield RD, Ralph SA, Christensen JH, Bo erjan W (2004) Lignins: Natural polymers from oxidative coupling of 4 hydroxyphenylpropanoids. Phytochemistry Reviews 3:29 60 Rasco Gaunt S, Riley A, Barcelo P, Lazzeri PA (1999) Analysis of particle bombardment parameters to optimi z e DNA delivery into whe at tissues. Plant Cell Reports 19:118 127 Razin S, Rozansky R (1959) Mechanism of the antibacterial action of spermine. Archives of Biochemistry and Biophysics 81:36 54

PAGE 84

84 R enewable F uels A ssociation (RFA) (2011a) Global Ethanol Production to Reach 88.7 Bill ion Litres in 2011 http://www.ethanolrfa.org/news/entry/global ethanol production to reach 88. 7 billion litres in 2011/, February 14, 2011; accessed April 27, 2012. R enewabe F uels A ssociation (RFA) (2011b) World Fuel Ethanol Production. http://ethanol rfa.org/pages/World Fuel Ethanol Production, accessed April 27, 2012 Romano A, Raemakers K, Bernardi J, Visser R, Mooibroek H (2003) Transgene organi z ation in potato after particle bombardment mediated (co )transformation using plasmids and gene cassettes Transgenic Research 12:461 473 Saballos A, Sattler S, Sanchez E, Foster T, Xin Z, Kang C, Pedersen J, Vermerris W (2012) Brown midrib2 ( Bmr2 ) encodes the major 4 coumarate:coenzyme A ligase involved in lignin biosynthesis in sorghum ( Sorghum bicolor (L. ) Moench). The Plant Journal doi: 10.1111/j.1365 313X.2012.04933.x Sandhu S, Altpeter F (2008) Co integration, co expression and inheritance of unlinked minimal transgene expression cassettes in an apomictic turf and forage grass ( Paspalum notatum Flugge). Plant Cell Reports 27:1755 1765 Sanford J, Smith F, Russell J (1993) Optimizing the biolistic process for different biological applications. Methods Enzymol 217:483 509 Sarkar N, Ghosh SK, Bannerjee S, Aikat K (2012) Bioethanol production from agric ul tur al wastes: a n overview. Renewable Energy 37:19 27 Schubert C (2006) Can biofuels finally take center stage? Nature Biotechnology 24:777 784 Setamou M, Bernal JS, Legaspi JC, Mirkov TE, Legaspi BC (2002) Evaluation of lectin expressing transgenic sugarcan e against stalkborers ( Lepidoptera : Pyralidae ): Effects on life history parameters. Journal of Economic Entomology 95:469 477 Shapouri H GP, Nefstead W, Schwartz R, Noe S, Conway R (2008) Energy balance for the corn ethanol industry http://cdn.intechweb.org/pdfs/20058.pdf ; pp 85 100 Shirzadegan M, Christie P, Seeman JR (1991) An efficient method for isolation of RNA from tissue c ul tured plant cells. Nucleic Acids Research 19:6055 6055 Sivamani E, De Long RK, Qu R (2009) Protamine mediated DNA coating remarkably improves bombardment transformation efficiency in plant cells. Plant Cell Reports 28:213 221

PAGE 85

85 Snyman SJ, Huckett BI, Botha FC, Watt MP (2001) A comparison of direct and indirect somatic morphog enesis for the production of transgenic sugarcane (Saccharum spp. hybrids). Acta Hortic ul turae 560:105 108 Snyman SJ, Meyer GM, Richards JM, Haricharan N, Ramgareeb S, Huckett BI (2006) Refining the application of direct embryogenesis in sugarcane: effect of the developmental phase of leaf disc explants and the timing of DNA transfer on transformation efficiency. Plant Cell Reports 25:1016 1023 Strandberg JO (1993) Meristem c ul ture of Ophiopogon japonicus and production of embryo like structures. Plant Cel l Tissue and Organ C ul ture 32:277 282 Sugiyama M (1999) Organogenesis in vitro Current Opinion in Plant Biology 2:61 64 Tabor H (1962) The protective effect of spermine and other polyamines against heat denaturation of deoxyribonucleic acid. Biochemistry 1 :496 Taparia Y, Fouad WM, Gallo M, Altpeter F (2012) Rapid production of transgenic sugarcane with the introduction of simple loci following biolistic transfer of a minimal expression cassette and direct embryogenesis. In Vitro Cell ul ar & Developmental Biology Plant 48:15 22 Taylor NJ, Fauquet CM (2002) Microparticle bombardment as a tool in plant science and agric ul tural biotechnology. DNA and Cell Biology 21:963 977 Tew LT and Corbill MR (2008) Genetic Improvement of Sugarcane ( Saccharum spp. ) as an Energy Crop Genetic Improvement of Bioenergy Crops. Spri nger Verlag Berlin, Germany, pp 273 294 Toki S, Takamatsu S, Nojiri C, Ooba S, Anzai H, Iwata M, Christensen AH, Quail PH, Uchimiya H (1992) Expression of a maize ubiquitin gene promoter bar chimeric gene in transgenic rice plants. Plant Physiology 100:15 03 1507 Umezawa T (2010) The cinnamate/monolignol pathway. Phytochemistry Reviews 9:1 17 Vain P (2007) Thirty years of plant transformation technology development. Plant Biotechnology Journal 5:221 229 Valdes C (2011) Can Brazil meet the world's gr owing need for ethanol? Amber Waves 9:38 45 Vanholme R, Demedts B, Morreel K, Ralph J, Boerjan W (2010) Lignin biosynthesis and structure. Plant Physiology 153:895 905

PAGE 86

86 Vasil IK (1987) Developing cell and tissue c ul ture systems for the improvement of ce real and grass crops. Journal of Plant Physiology 128:193 218 Vasil IK, Vasil V (1994) In vitro c ul ture of cereals and grasses. Plant cell and tissue c ul ture 83 :293 312 Vermerris W (2008) Why bioenergy makes sense. In: Vermerris W (ed) Genetic Improvemen t of Bioenergy Crops. Springer Verlag Berlin, Germany, pp 3 42 Vermerris W, Saballos A, Ejeta G, Mosier NS, Ladisch MR, Carpita NC (2007) Molec ul ar breeding to enhance ethanol production from corn and sorghum stover. Crop Science 47:S142 S153 Voelker SL, L achenbruch B, Meinzer FC, Jourdes M, Ki C, Patten AM, Davin LB, Lewis NG, Tuskan GA, Gunter L, Decker SR, Selig MJ, Sykes R, Himmel ME, Kitin P, Shevchenko O, Strauss SH (2010) Antisense down reg ul ation of 4CL expression alters lignification, tree growth, and saccharification potential of field grown poplar. Plant Physiology 154 (2):874 886 von Blottnitz H, Curran MA (2007) A review of assessments conducted on bio ethanol as a transportation fuel from a net energy, greenhouse gas, and environmental life cy cle perspective. Journal of Cleaner Production 15 (7):607 619 Voorhoeve PM, Agami R (2003) Knockdown stands up. Trends in Biotechnology 21 (1):2 4 Wagner E, Cotten M, Foisner R, Birnstiel ML (1991) Transferrin polycation DNA complexes: the effect of polyc ations on the structure of the complex and DNA delivery to cells. Proceedings of the National Academy of Sciences of the United States of America 88 (10):4255 4259 Wang A, Dong W, Wei Y, Huang C, He L, Yan g L Li Y, Wang AQ, Dong WQ, Wei YW, Huang CM, He LF, Yan g L T, Li YR (2009) Transformation of sugarcane with ACC oxidase antisense gene. Sugar Tech 11:39 43 Watanabe Y (2011) Overview of plant RNAi. RNAi and plant gene function analysis: Methods and protocols 744:1 11 Wen g L X, Deng HH, Xu JL, Li Q, Wan g L H, Jiang ZD, Zhang HB, Li QW, Zhan g L H (2006) Regeneration of sugarcane elite breedin g L ines and engineering of stem borer resistance. Pest Management Science 62:178 187 Wimalasekera R, Tebartz F, Scherer GFE (2011) Polyamines, polyamine oxidases and nit ric oxide in development, abiotic and biotic stresses. Plant Science 181:593 603

PAGE 87

87 Withers S, Lu F, Kim H, Zhu Y, Ralph J, Wilkerson CG (2012) Identification of grass specific enzyme that acylates monolignols with p coumarate. Journal of Biological Chemistr y 287:8347 8355 Wu LY, Nandi S, Chen LF, Rodriguez RL, Huang N (2002) Expression and inheritance of nine transgenes in rice. Transgenic Research 11:533 541 Wu Y, Zhou H, Que YX, Chen RK, Zhang MQ (2008) Cloning and identification of promoter Prd29A and it s application in sugarcane drought resistance. Sugar Tech 10:36 41 Xu B, Escamilla Trevino LL, Sathitsuksanoh N, Shen Z, Shen H, Zhang YHP, Dixon RA, Zhao B (2011) Silencing of 4 coumarate:coenzyme A ligase in switchgrass leads to reduced lignin content an d improved fermentable sugar yields for biofuel production. New Phytologist 192:611 625 Yang DH, Chung BY, Kim JS, Kim JH, Yun PY, Lee YK, Lim YP, Lee MC (2005) cDNA cloning and sequence analysis of the rice cinnamate 4 hydroxylase gene, a cytochrome P450 dependent monooxygenase involved in the general phenylpropanoid pathway. Journal of Plant Biology 48:311 318 Zhao Q, Dixon RA (2011) Transcriptional networks for lignin biosynthesis: more complex than we thought? Trends in Plant Science 16:227 233 Zhong R Lee C, Zhou J, McCarthy RL, Ye Z H (2008) A battery of transcription factors involved in the reg ul ation of secondary cell wall biosynthesis in Arabidopsis Plant Cell 20:2763 2782 Zhou J, Lee C, Zhong R, Ye Z H (2009) MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis Plant Cell 21:248 266 Zlatanova J, Leuba SH, van Holde K (1998) Chromatin fiber structure: Morphology, molec ul ar determinants, structural transitions. Biophy sical Journal 74:2554 2566

PAGE 88

88 BIOGRAPHICAL SKETCH Yuan Xiong was born in Cheng Du, Chin a, to parents Xue Ou Xiong and X in Qian. He graduated from Shen z hen Experimental School, China in 2004 and graduated with a Bachelor of Science from Sun Yat Sen Univer sity, Guangzhou, China in 2008 In 2009 2012 h e attended the University of Florida and earned a M aster of Science in Department of A gronomy




TRACE ROUTE

Total Execution Time: 36 Milliseconds

MILLISECOND   CLASS.METHODMESSAGE
0sobekcm_page_globals.constructor
0sobekcm_page_globals.constructorApplication State validated or built
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.constructorNavigation Object created from URI query string
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.display_itemRetrieving item or group information
0sobekcm_page_globals.get_entire_collection_hierarchyRetrieving hierarchy information
0sobekcm_assistant.get_entire_collection_hierarchy
0cached_data_manager.retrieve_item_aggregation
0cached_data_manager.retrieve_item_aggregationFound item aggregation on local cache
0item_aggregation_builder.get_item_aggregationFound 'all' item aggregation in cache
0system.web.ui.page.page_load (ufdc.page_load)
0sobekcm_page_globals.constructor.on_page_load
0html_echo_mainwriter.add_style_referencesAdding style references to HTML
0html_echo_mainwriter.add_text_to_pageReading the text from the file and echoing back to the output stream
36html_echo_mainwriter.add_text_to_pageFinished reading and writing the file