<%BANNER%>

Production of Recombinant Adeno-Associated Viral Vectors in Yeast

Permanent Link: http://ufdc.ufl.edu/UFE0044702/00001

Material Information

Title: Production of Recombinant Adeno-Associated Viral Vectors in Yeast
Physical Description: 1 online resource (61 p.)
Language: english
Creator: Thakur, Sami Shams
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: adeno-associated-virus -- raav -- yeast
Molecular Genetics and Microbiology -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adeno-associated virus (AAV) is a human parvovirus whichrequires a helper virus for lytic replication. Recombinant AAV viral (rAAV)vectors have been engineered to deliver nucleic acids in vivo for therapeutic purposes. Current methods for producingrAAV utilize cultured mammalian or insect cells which express the AAV proteinsnecessary for viral replication. In this study, we investigated the productionof rAAV using the yeast Saccharomycescerevisiae. Yeast cells were stably transformed with plasmids expressingthe AAV structural and replication proteins along with rAAV vector sequenceswhich encode green fluorescent protein (GFP) under the control of thecytomegalovirus early promoter. The expression of viral proteins was analyzedby Western blot following induction with galactose, and we found that the viralproteins are expressed in the proper ratios and amounts. Production ofinfectious virus was observed by transduction of mammalian cells and qPCR.Various viral extraction and purification methods were assessed to obtainefficient rAAV yields from yeast. We determined that yeast lysis by enzymaticdigestion of the cell wall and CsCl density gradient centrifugationpurification is capable of generating infectious virions. The results show thatproduction of rAAV in S. cerevisiaeis a possible alternative to current methods.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sami Shams Thakur.
Thesis: Thesis (M.S.)--University of Florida, 2012.
Local: Adviser: Snyder, Richard O.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044702:00001

Permanent Link: http://ufdc.ufl.edu/UFE0044702/00001

Material Information

Title: Production of Recombinant Adeno-Associated Viral Vectors in Yeast
Physical Description: 1 online resource (61 p.)
Language: english
Creator: Thakur, Sami Shams
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: adeno-associated-virus -- raav -- yeast
Molecular Genetics and Microbiology -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adeno-associated virus (AAV) is a human parvovirus whichrequires a helper virus for lytic replication. Recombinant AAV viral (rAAV)vectors have been engineered to deliver nucleic acids in vivo for therapeutic purposes. Current methods for producingrAAV utilize cultured mammalian or insect cells which express the AAV proteinsnecessary for viral replication. In this study, we investigated the productionof rAAV using the yeast Saccharomycescerevisiae. Yeast cells were stably transformed with plasmids expressingthe AAV structural and replication proteins along with rAAV vector sequenceswhich encode green fluorescent protein (GFP) under the control of thecytomegalovirus early promoter. The expression of viral proteins was analyzedby Western blot following induction with galactose, and we found that the viralproteins are expressed in the proper ratios and amounts. Production ofinfectious virus was observed by transduction of mammalian cells and qPCR.Various viral extraction and purification methods were assessed to obtainefficient rAAV yields from yeast. We determined that yeast lysis by enzymaticdigestion of the cell wall and CsCl density gradient centrifugationpurification is capable of generating infectious virions. The results show thatproduction of rAAV in S. cerevisiaeis a possible alternative to current methods.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sami Shams Thakur.
Thesis: Thesis (M.S.)--University of Florida, 2012.
Local: Adviser: Snyder, Richard O.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044702:00001


This item has the following downloads:


Full Text

PAGE 1

1 PRODUCTION OF RECOMBINANT ADENO ASSOCIATED VIRAL VECTORS IN YEAST By SAMI S. THAKUR A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTE R OF SCIENCE UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Sami S. Thakur

PAGE 3

3 To all those who gave me a chance and helped me along the way.

PAGE 4

4 ACKNOWLEDGMENTS I thank my parents for their never ending support and love. I thank all my teachers and professor s who instilled in me a love for science and learning. I thank my lab mates Dr. Weiyi Ni and Jennifer Lyles for making me feel welcome and comfortable answering all my novice questions and helping me learn the techniques I needed to complete my research I would also like to thank Stephen G. Kaler at the NIH for providing me with plasmids that were very difficult to find and Jurgen Kleinschmidt at DKFZ, Heidelberg for providing the anti AAP antibodies I thank Dr. Grant McFadden and his lab for allowing m e to use their microscope. I also thank Lijun Wang and Dr. Ma hajoub Bello Roufai at Florida Biologix for graciously taking time out of their busy schedules to teach me viral purification methods and assist me with my project I thank the amazing staff of t he D epartment of Molecular Genetics and Microbiology at UF fo r making my time here so great, especially Dorcas Ortiz, Kristyn Minkoff, and Valerie Cloud Driver They made my life easy when it came to registering for classes or ordering supplies. I also tha nk my thesis committee members, Dr. Sergei Zolotukhin and Dr. Roland Herzog. I sincerely thank Dr. Snyder for providing me with the opportunity to advance myself personally, professionally, and intellectually. I have learned so much from you over six seme sters and enjoyed all of it. Thank you so much for a wonderful educational experience.

PAGE 5

5 TABLE OF CONTENTS P age ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF FIGURES ................................ ................................ ................................ .......... 7 LIST OF ABBREVIATIONS ................................ ................................ ............................. 8 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 12 AAV Classification ................................ ................................ ................................ .. 12 AAV History ................................ ................................ ................................ ............ 12 AAV Biology ................................ ................................ ................................ ............ 13 Genome ................................ ................................ ................................ ............ 13 Life Cycle ................................ ................................ ................................ .......... 15 Cellular Entry ................................ ................................ ................................ .... 16 Replication ................................ ................................ ................................ ........ 16 Development of Recombinant AAV Vectors ................................ ........................... 18 rAAV Vectors in Gene Therapy ................................ ................................ ............... 19 rAAV Production Methods ................................ ................................ ....................... 21 S. cerevisiae Biology ................................ ................................ ............................... 23 2 METHODS ................................ ................................ ................................ .............. 24 Plasmid Construction ................................ ................................ .............................. 24 Engineering of Yeast Strains ................................ ................................ .................. 27 Yeast Culture ................................ ................................ ................................ .......... 28 Yeast Lysis ................................ ................................ ................................ ............. 28 Verification of AAV Protein Production ................................ ................................ .... 30 Viral Purification ................................ ................................ ................................ ...... 31 Transduction Assay ................................ ................................ ................................ 32 PCR Quantification of rAAV ................................ ................................ .................... 33 3 RESULTS ................................ ................................ ................................ ............... 34 AAV Protein Expression Plasmids ................................ ................................ .......... 34 Culture Conditions ................................ ................................ ................................ .. 35 Viral Protein Expression ................................ ................................ .......................... 37 Viral DNA Replication ................................ ................................ ............................. 38 Lysis Methods ................................ ................................ ................................ ......... 40 Purification ................................ ................................ ................................ .............. 43 Creation of Yeast Strain Expressing AAP ................................ ............................... 47

PAGE 6

6 4 DISCUSSION ................................ ................................ ................................ ......... 51 LIST OF REFERENCE S ................................ ................................ ............................... 56 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 61

PAGE 7

7 LIST OF FIGURES Figure P age 3 1 Yeast expression plasmid const ructs harboring AAV viral genes ....................... 35 3 2 Culture growth curve.. ................................ ................................ ........................ 36 3 3 Western blots of protein extracts from YRS 4 ................................ .................... 38 3 4 Replication of viral genomes in yeast. ................................ ................................ 39 3 5 Summaries of lysis methods develo ped to liberate rAAV from yeast .................. 40 3 6 Comparison of protein extraction efficiency of glass bead and NaOH lysis methods. ................................ ................................ ................................ ............. 41 3 7 Summary of Zymolyase based lysis of yeast. ................................ ..................... 42 3 8 Summary of the heparin column chromatography purification method. .............. 44 3 9 Summary of the CsCl gradient centrifugation purification me thod. ..................... 45 3 10 Transduction assays. ................................ ................................ .......................... 46 3 11 Infectious titer. ................................ ................................ ................................ .... 47 3 1 2 Structure of AAP expression plasmid ................................ ................................ 49 3 13 Western blot analysis of AAP expression. ................................ .......................... 49 3 14 Results of rAAV vector genome titer from the three yeast strains. ..................... 50

PAGE 8

8 LIST OF ABBREVIATION S AAP Assembly Activating Protein AAV Adeno Associated Virus Ab Antibody Ad5 Adenovirus serotype 5 C12 HeLa derived cells which contain stably integrated functional c opies of the AAV rep and cap genes under the control of the endogenous AAV promoters CF Cystic Fibrosis CFTR Cystic Fibrosis transmembrane regulator DTT Dithiothreitol GFP Green fluorescent protein HEK293 Human Embryonic Kidney 293 cells ITR Inverted term inal repeat LCA LEU Leucine ORF Open reading frame rAAV Recombinant Adeno Associated Virus RBE Rep binding elements Rf Replicating form SC 3 Synthetic Complete ( LEU, TRP, URA) SDS Sodium dodecyl sulfate TRP Tryptophan TRS Te rminal resolution site URA Uracil VG Vector genome

PAGE 9

9 VLP Virus like particles wtAAV Wild type AAV YPD Yeast Extract Peptone Dextrose YRS 4 Yeast strain expressing Rep and capsid AAV viral proteins YRS5 CT Yeast strain expressing YRS 4 genes and AAP with C te rminal tag YRS5 NoT Yeast strain expressing YRS 4 genes and AAP without C terminal tag

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science PRODUCTION OF RECOMBINANT ADENO ASSOCIATED VIRAL VECTORS IN YEAST By Sami S. Thakur December 2012 Chair: Richard O. Snyder Major: Medical Science Adeno associated virus (AAV) is a human parvovirus which requires a helper virus for lytic repl ication. Recombinant AAV viral (rAAV) vectors have been engineered to deliver nucleic acids in vivo for therapeutic purposes. Current methods for producing rAAV utilize cultured mammalian or insect cells which express the AAV proteins necessary for viral r eplication. In this study, we investigated the production of rAAV using the yeast Saccharomyces cerevisiae Yeast cells were stably transformed with plasmids expressing the AAV structural and replication proteins along with rAAV vector sequences which enco de green fluorescent protein (GFP) under the control of the cytomegalovirus early promoter. The expression of viral proteins was analyzed by W estern blot following induction with galactose, and we found that the viral proteins are expressed in the proper r atios and amounts. Production of infectious virus was observed by transduction of mammalian cells and qPCR. Various viral extraction and purification methods were assessed to obtain efficient rAAV yields from yeast. We determined that yeast lysis by enzyma tic digestion of the cell wall and CsCl density gradient centrifugation purification is capable of generating infectious virions. The

PAGE 11

11 results show that production of rAAV in S. cerevisiae is a possible alternative to current methods.

PAGE 12

12 CHAPTER 1 INTRODUCTIO N AAV Classification Adeno associated virus (AAV) belongs to the Parvoviridae family. The meaning small) are the smallest among the animal DNA viruses. They are found all throughout nature and commonly infect a wide ra nge of hosts including insects and primates ( Muzyczka & Berns, 2001 ) The virion has a diameter of 18 to 26 nm and is composed entirely of protein and DNA. Parvoviridae which are classified into two subfamilies Parvovirinae and Densovirin ae the Densovirinae are viruses which infect insects while the Parvovirinae are found to infect vertebrates Replication of the parvovirus genome is dependent upon host cell enzymes or co infection with another virus because they do not encode their own D NA polymerase ( Brown, 2010 ) AAV belongs to the genus Dependovirus because they require co infection of the host cell with an unrelat ed helper virus such as adenovirus, herpesvirus, human cytomegalovirus, or papillomavirus for the initiation of a productive infection with replication of the virus ( Muzyczka & Berns, 2001 ) Several AAV serotypes exist which differ in cell tropism through variations in capsid protein sequence and structure. AAV History AAV was first discovered in 1965 by Robert W. Atchison and colleagues at the University of Pittsburgh. It was first observed as contaminants in preparations of simian adenov irus type 15 through electron microscopy. They discovered that the AAV of known viruses. This led them to believe that the contaminants were actually viruses.

PAGE 13

13 Atchison th en purified AAV from the adenovirus preparation by filtration and used it to inoculate rhesus monkey kidney cell cultures. He found that the viruses elicited no cytopathic effect and no AAV was found in the culture. They then co infected cell cultures with both AAV and adenovirus and found that the virus was able to successfully replicate. This observation led Atchison to characterize AAV as an incomplete or defective virus. AAV was also used to inoculate newborn mice and hamsters to test for pathogenicity. The infected animals showed no illness two months after exposure indicating that AAV did not cause disease ( Atchison, Casto, & Hammon, 1965 ) AAV Biology Genome The AAV genome is composed of a linear single stranded D NA of 4.7 kb. AAV virions can package both plus and minus strands of the genome into capsids at equal frequency during productive infection. Both ends of the AAV genome contain 145 bp ITRs and two open reading frames (ORFs) are found in between the ITRs. T he first 125 nucleotides of the ITRs are composed of a palindrome that folds upon itself and forms a T shaped secondary hairpin structure ( Srivastava, Lusby, & Berns, 1983 ) The ITRs are important cis active sequences in the biology of AAV. A key role of the ITRs is in AAV DNA replication. The ITR serves as the origin of replication and as a primer for second strand synthesis. The double stranded DNA formed during the synthesis, called replicating form (Rf) monomer, is used for a second round of self priming repli cation and forms a Rf dimer. These double stranded DNA intermediates (replicating form monomer and replicating form dimer) are processed via a strand displacement mechanism, resulting in single stranded DNA that is packaged and double stranded DNA used for transcription ( Ward & Berns, 1995 ) Critical to the replication process are

PAGE 14

14 located within the ITR. These features are recognized by the Rep proteins during AAV replication to process the double stranded intermediates. In addition to their role in AAV replication, the ITR is also essential for AAV genome packaging, transcription, negative regulation under non permissive conditions, and site specific integration ( Musatov, Roberts, Pfaff, & Kaplitt, 2002 ) The AAV genome encodes two ORFs. One ORF contains the rep gene while the other encodes the cap gene. The rep gene encodes four Rep proteins, Rep78, Rep68 Rep52, and Rep40. Rep78 and Rep68 are the larger of the Rep proteins and are produced from transcripts originating at the P5 promoter. Both Rep78 and Rep68 are produced from the same transcript but Rep68 is spliced to produce a smaller transcript ( Bleker, Pawlita, & Kleinschmidt, 2006 ) These proteins are involved in regulation of all stages of the AAV life cycle. During the lytic phase, these Rep proteins increase expression of AAV genes for replication and virion production. During the latent phase, Rep78 and Rep68 function to repress expression of AAV genes and possess site specific endonuclease activity and DNA binding capability. The P19 promoter encodes the tr anscript from which both Rep52 and Rep40 are produced. These smaller Rep proteins are involved in the accumulation of single stranded viral DNA and viral encapsidation. All four Rep proteins have helicase and ATPase activity ( Collaco, Kalman Maltese, Smith, Dignam, & Trempe, 2003 ) The cap gene encodes three viral capsid proteins, VP1, VP2, and VP3 from the P40 promoter. VP1 is the largest protein and is expresse d from a spliced transcript. An alternatively spliced P40 transcript produces the message for VP2 and VP3, and the

PAGE 15

15 VP3 protein is produced from an internal translation initiation site within the transcript. VP2 is initiated from a nonconventional ACG start codon which results in lower efficiency of translation and lower levels of the protein. The VP1, VP2, and VP3 proteins are expressed in a 1:1:10 ratio which reflects the composition of the viral capsid ( Bleker, Sonntag & Kleinschmidt, 2005 ) Within the cap gene is a nested ORF which encodes assembly activating protein (AAP). This 23 kDa protein is translated from a nonconventional start codon. AAP protein localizes to the nucleolus of the host mammalian cell where a ssembly of AAV capsids takes place. AAP functions to direct AAV capsid proteins produced in the cytosol towards the nucle ol us and also plays a role in catalyzing the capsid assembly reactions ( Sonntag, Schmidt, & Kleinschmidt, 2010 ) Life Cycle AAV has two stages of its life cycle. After infecting a cell, the virus enters either the lytic or latent stage of its life cycle. In the presence of a helper virus such as adenovirus, the virus enters the lytic stage and undergoes a productive infection that results from replication of the viral genome, expression of viral genes, and production of virions. The hel per viruses provide various genes that regulate host cell gene expression that provides a permissive environment for AAV productive infection ( Daya & Berns, 2008 ) In the absence of helper viruse s, wild type AAV replication is limited, viral gene expression is repressed, and the AAV genome can establish latency by integrating into a 4 kb region on chromosome 19 (q13.4), termed AAVS1 ( Kotin et al., 1990 ) Both viral and cellular components are necessary for the site specific integration of AAV during the late nt stage of its life cycle. The viral components necessary are the inverted terminal repeats, Rep78 or Rep68 proteins provided in trans and a 138 bp

PAGE 16

16 sequence in the AAV genome known as the integration efficiency element which is located in the P5 promoter The required cellular component is the AAVS1 sequence, which contains sequences similar to those found in the ITRs of the AAV genome. This sequence is necessary and sufficient to target AAV integration ( Giraud, Winocour, & Berns, 1994 ) Cellular Entry AAV enters cells by first binding to cell surface receptors. The internalization frequency of viruses is increased by interactions with one or more of the receptors AAV is known to bind such as he receptor. Upon binding to the receptors, AAV is then endocytosed through clathrin coated vesicles. The viruses t hen escape the vesicles and are transported along microtubules to the nucleus. It is unclear whether the virus releases its DNA at the nuclear envelope or after entry to the nucleus. The method of nuclear entry is also unclear although AAV virions are smal l enough to enter the nucleus through the nuclear pore complex (Asokan, Hamra, Govindasamy, Agbandje McKenna, & Samulski, 2006). Replication In the presence of a helper virus such as adenovirus or herpes simplex virus type 1, AAV will replicate its geno me to produce progeny virions. The helper viruses express proteins that aid AAV replication by enhancing AAV gene expression and altering the cellular environment rendering it permissive to AAV replication. Adenovirus provides the proteins E1a, E1b55K, E2a and E4orf6 along with VA RNA for AAV replication. These adenoviral products cause expression of other adenoviral genes, activate expression of

PAGE 17

17 the AAV genes, stimulate AAV replication process, and degradation of certain cellular protein targets ( Myers, Laughlin, Jay, & Carter, 1980 ) In the case of a host c ell latently infected with AAV that is co infected with adenovirus, the replication process begins by rescue of the integrated AAV sequence from the host genome. The adenovirus causes expression of the Rep78 and Rep68 proteins which then catalyze the excis ion of the AAV sequence by introducing single strand nicks at the TRS within the ITRs. DNA polymerase then elongates the OH ends to displace the single stranded AAV sequence. The free sequence is incomplete, missing one terminal repeat. The sequen ce forms a secondary structure by binding to itself which forms a priming site for DNA polymerase to copy and extend the sequence to replace the missing ITR. This results in a full length, single stranded AAV molecule, which is then able to enter the repli cative cycle ( Berns & Linden, 1995 ) The free and complete single stranded AAV genome with ITR secondary structures enters replication through self priming. The base ITR serves as the orig in of replication. Replication is conducted by host cell DNA between the ITRs then continuing through the terminal repeat by strand displacement activity of the polymerase which unfolds the structure. The terminal end which served as the origin or replication is then bound by Rep78/68 at the RBE and unwinds the DNA so that the TRS is in a single s tranded form which enables the endonuclease catalytic domain of the Rep proteins to introduce a nick on the parental strand at this site, which in turn serves as a new primer for DNA polymerase ( R. O. Snyder, Samulski, &

PAGE 18

18 Muzyczka, 1990 ) The terminal end is then replicated through strand displacement resulting in a full double stranded AAV genome. Another cycle of replication di splaces a single stranded progeny molecule that is packaged. The Rep40/52 proteins then facilitate packaging of the AAV genome into the capsid. Development of Recombinant AAV V ectors The simplicity of AAV, its inability to replicate independently, and its lack of toxicity are characteristics which led to the investigation of its use as a vector providing gene delivery to cells and animals for research and therapeutic purposes. Other characteristics which make AAV attractive for gene therapy are its ability to efficiently attach to and enter a wide variety of target cells, transfer its genetic payload to the nucleus, and sustained expression of the transgene. In the development of recombinant AAV (rAAV) vectors, both the rep and cap genes were removed. The r ep gene was removed because of the potential negative effects from the Rep proteins on the expression of cellular genes and metabolic homeostasis of the cell. The only sequences remaining from the wtAAV genome are the ITRs. These recombinant vectors rarely integrate into the host cell genome because rAAV does not encode Rep proteins or contain any other wtAAV genomic sequences which would direct the process. In muscle and liver, rAAV persists in cells as extrachromosomal molecules because of the lack of the se genes ( Penaud Budloo et al., 2008 ; Sun et al., 2010 ) The genome of rAAV consists of two 145 nucleotide ITRs flanking the transgene. The packaging capacity of rAAV is limited to 5 kb due to the small size of the capsid. The stable expression of the transgene delivered by rAAV depends upon second strand synthesis of the vector genome to be converted into a transcriptionally functional double stranded template. Once the rAAV DNA has been released into the nucle us it is converted to double strand

PAGE 19

19 form through either de novo second strand DNA synthesis from the hairpin at the 3' end of the genome, or the pairing of plus and minus strands from multiple rAAV infection. The duplex rAAV genomes then form circular or l inear concatamers through recombination of the ITRs. The various serotypes of wtAAV that exist exhibit differential host cell type tropism. This allows for the creation of rAAVs with different capsid protein sequences derived from each serotype that vary i n their transduction efficiency of specific cell types ( Gao, Vandenberghe, & Wilson, 2005 ) rAAV Vectors in Gene T herapy Gene therapy entails the transfe r of genes to cells for the treatment of disease. The therapeutic genes carried in rAAV vectors can supplement or replace defective or missing genes, inhibiting cellular genes through delivery of siRNA, or delivering a novel gene or ribozyme. rAAV based ve ctors are among the most common type of viral gene delivery systems. The popularity of rAAV vectors results from achieving long term transgene expression in animal models without toxicity and the lack of inflammatory immune responses. The different AAV ser otypes allow for rAAVs to be produced that exhibit tissue specificity that allows for the localization of treatment, higher transduction efficiency, and prevention of non target tissue infection. The initial trials of gene therapy targeted monogenic disea ses in which the gene had been deleted or mutated to alter normal function of the protein. Cystic fibrosis (CF) was one of the first diseases to be targeted for treatment with rAAV mediated gene therapy. CF is a lethal, autosomal recessive disease in which the CF transmembrane regulator (CFTR) is inactivated by mutation. CFTR is a component of the Cl channel and the lack of functional CFTR affects the transmembrane electrical potential. This leads to the accumulation of thick secretions in the lung coupled with a loss of the

PAGE 20

20 normal respiratory epithelial ciliary activity. The primary difficulty is pu lmonary, with an increased incidence of pulmonary infection, especially by Pseudomonas aeruginosa Additional difficulty occurs with pancreatic secretion, but the loss of the pancreatic enzymes can be treated with supplements. rAAV encoding functional CFTR were delivered to lung tissue by bronchoscope or aerosol inhalation. These early clinical trials of rAAV in humans produced observations of limited immune responses and a lack of measurable toxicity. The therapeutic effect of these rAAV based CF clinical trials measured by pulmonary function was not statistically significant ( Flotte, 2005 ) Hemophilia is another of the monogenic diseases to be targeted in early clinical trials of rAAV. Although this disease can be lethal, i t is functionally chronic with current modes of therapy. The two common forms are hemophilia A and hemophilia B. Clotting requires a complex series of enzymatic reactions. Two of the required enzymes are factors VIII and IX. Deficiency in factor VIII cause s hemophilia A while factor IX deficiency causes hemophilia B. Initial efforts concentrated on the replacement of factor IX, because the coding region and regulatory sequences could readily be encapsidated in the AAV vector. Experiments in animals with the factor IX encoding rAAV showed successful treatment of mice and dogs with hemophilia B ( Herzog et al., 1999 ; Ni emeyer et al., 2009 ; R. O. Snyder et al., 1999 ) In human trials, the rAAV was first delivered through intramuscular injection and this trial ( C. S. Manno et al., 2003 ) showed no vector associated toxicity but no vector derived factor IX could be detected in plasma Factor IX is normally produced in the liver which led to a trial in which the liver was transduced b y delivery of rAAV through the hepatic artery ( C.S. Manno et al., 2006 ) When lower doses were delivered to the liver, no toxicity or raise in plasma level

PAGE 21

21 of factor IX was obser ved. At the highest dose of 2 10 12 vector genomes/kg, the transgenic factor IX was found in the plasma at detectable levels for 4 to 9 weeks after which the levels returned to baseline. The high dose also resulted in an inflammatory response in the liver indicated by a rise in plasma levels of liver transaminases. More recent trials using AAV 8 based vectors showed efficacy in hemophilia B patients ( Nathwani et al., 2011 ) have been conducted and improvements in vision were observed with minimal adverse events associated with the treatment ( Bainbridge et al., 2008 ; Cideciyan et al., 2009 ) LCA is a group of inherited blinding diseases with onset occurring during infancy resulting in total blindness by the third or fourth decade of life. The disease is a result of a mutation in RPE65 which encodes a protein required for enzymatic activity of the retinal pigment epithelium. For clinical trials involving treatment of LCA with gene therapy, rAAV encoding R PE65 cDNA are produced and delivered by injection behind the retina. ( Maguire et al., 2008 ) rAAV Production M ethods Initial rAAV production methods consisted of transfection of mammalian packaging cells with plasmids containing vector, and rep and cap gene sequences followed by infection with adenovirus. This method yielded rAAV stocks that were contaminated with adenovirus. As an improvement, the adenovirus pr oteins which provide helper functions were encoded on a plasmid and used to transfect packaging cells along with plasmids for the vector rep and cap This resulted in adenovirus free preparations of rAAV. Although these methods improve rAAV production and avoid the need for Ad infection, they are difficult to scale up due to their dependence on DNA transfection. Large amounts of purified vector are required for large animal studies and

PAGE 22

22 human clinical trials which can be limited by these methods. A strategy to enhance vector production is to avoid transfection through the generation of packaging cell lines which have AAV rep and cap genes stably integrated into their genomes. Another transfection avoidance strategy for the production of rAAV is the use of re combinant helper viruses to provide helper functions and deliver the viral genes and rAAV DNA ( Wang, Blouin, Brument, Bello Roufai, & Francois, 20 11 ) Insect cells are also used to produce rAAV. In this approach, Sf9 cells, which are ovarian cells isolated from Spodoptera frugiperda (Fall Armyworm), are grown in suspension. These cells are then infected with three baculovirus vectors, BacRep, Ba cVP, and Bac rAAV, encoding the respective components of the rAAV production machinery ( Kohlbrenner et al., 2005 ; Smith, Levy, & Kotin, 2009 ) The advantage of this method is that it is easy to scale up due to the cells being grown in suspension and ease of gene delivery by baculovirus infection. The drawbacks of this process include the genetic instability of the baculovirus stocks and the requirement of viruses to deliver the genes to producer cells. The instability of the baculovirus genome means that random mutations may occur which alter the transgene or negatively affect production efficiency. Because this process requires baculovirus to deliver AAV genes to the producer cells, it necessitates extensive purification to ensure no baculovirus or DNA or proteins from bacu lovirus are present in the final rAAV product ( Merten, Geny Fiamma, & Douar 2005 ) The development of this process was a major advance in the production of rAAV and the use of t he baculovirus system shows that rAAV can be produced in non mammalian cells with Rep and Cap proteins expressed under the control of heterologous prom oters.

PAGE 23

23 S. cerevisiae B iology Saccharomyces cerevisiae is a species of yeast that has been used by humans in baking and brewing for millennia. This organism is one of the most extensively studied and well characterized eukaryotic microbes serving as a model for research in molecular and cellular biology. Their life cycle can occur in both haploid and diploid forms with the diploid form being predominant. The life cycle of the haploid cells consists of growth, mitosis, and death under stressful condition s. The diploid cells have a similar life cycle to the haploid but differ in their response to stress. Under conditions of stress, they are able to enter meiosis and produce haploid spores which are able to mate. S. cerevisiae can metabolize a variety of su gars under aerobic conditions including glucose, fructose, and galactose. S. cerevisiae makes an ideal species for the expression of recombinant proteins for a number of reasons. They can be cultured in suspension inexpensively and in large quantities. T heir genetic sequences are known and they are easy to genetically manipulate. They have a short generation time (2 hours) and no known infectious agents of humans are known to reside in S. cerevisiae As yeasts are eukaryotes, they have protein processing and post translational modification mechanisms similar to those found in mammalian cells. This species of yeast is currently used to produce the majority of the insulin used to treat diabetes and other commercial pharmaceutical biologic products such as th e human papilloma virus vaccine Gardasil. This vaccine consists of virus like particles (VLP) produced in yeast ( Bonander & Bill, 2012 ; Ostergaard, Olsson, & Nielsen, 2000 )

PAGE 24

24 CHAPTER 2 METHODS Plasmid Construction Construction of vector plasmids: A rAAV plasmid pTR UF 5 ( Klein et al., 1998 ) was partially digested with ScaI and NaeI, and the ITR containing AAV v ector fragment (position 6046 4975) was isolated. pESC URA (Stratagene, La Jolla, Calif.) was partially digested in ScaI and NaeI and the fragment containing the high copy 2 micron origin and URA3 elements (position 4786 1679) was isolated. The pESC URA fr agment (position 4786 1679) was ligated to the pTR UF 5 ScaI Nael AAV vector fragment using the Quick Ligation Kit (New England BioLabs, Beverly, Mass.) to create pROS 910 (selections: URA for yeast and Amp for bacteria) and sequenced. The plasmid is prop agated in the SURE bacterial strain under Amp selection. The rAAV plasmid pTR UF 5 ( Klein et al., 1998 ) is digested with AseI (position 3432) and PvuI (position 6219) and blunt ended with Klenow. The AAV vector fragment (position 6219 3432) is isolated and cloned into the SmaI restriction site in the low copy yeast shuttle vector pRS416 [ATCC #87521] to create plasmid pROS 911 (selections: URA for yeast and Amp for bacteria). The plasmid is propagated in the SURE bacterial strain (Stratagene, La Jolla, Calif.) unde r Amp selection. For expression of AAV2 VP3, the AAV VP3 coding region was generated from pIM 45 by PCR using Platinum PCR SuperMix (Invitrogen, Carlsbad, Calif.) and gene specific oligonucleotide primers (200 nM final concentration). The resulting 1603 b p PCR product was digested with BamHI and HindIII and then cloned into BamHI HindIII digested pESC LEU (Stratagene, La Jolla, Calif.) using the Quick Ligation Kit (New England BioLabs, Beverly, Mass.) to create pROS 920 and sequenced. Expression of VP3 is under the control of the GAL1 promoter. The plasmid

PAGE 25

25 is propa gated in the DH5 AAV2 Rep52, the AAV Rep52 coding region was generated from pIM 45 by PCR using Platinum PCR SuperMix (Invitrogen, Carlsbad, Calif.) and gene specific oligonucleotide primers (200 n M final concentration). The 1195 bp PCR product was digested with NotI and PacI and then cloned into NotI PacI digested pROS 920 to create pROS 921 and sequenced. Expression of Rep52 is under the control of the GAL10 promoter. Thus, pROS 921 (selections: L EU for yeast and Amp for bacteria) expresses both AAV VP3 and Rep52 under the control of the galactose inducible GAL1 and GAL10 promoters on a high copy plasmid. The plasmid is propagated in the DH5 bacterial strain under Amp selection. For expression of AAV2 VP1, VP2 and Rep 78, a plasmid was constructed: pRS 414 [ATCC 87519] was digested with ScaI and NaeI. The 2589 bp fragment containing the low copy number origin ARSH4, CEN6, and TRP1 elements (position 3762 1566) was isolated. pESC TRP (Stratagene ) was digested with ScaI and NaeI to remove the high copy number 2 micron origin and TRP1 elements (position 1569 4677). The 2589 bp ScaI NaeI origin fragment from pRS 414 was then ligated to the 3108 bp ScaI NaeI fragment of pESC TRP using the Quick Liga tion Kit (New England BioLabs) to create pROS 711 (selections: TRP1 for yeast and Amp for bacteria), a low copy number plasmid with both the GAL1 and GAL10 promoters. The plasmid is propagated in the DH5 a strain under Amp selection. For expression of AAV 2 VP1, the AAV VP1 coding region was generated from pIM 45 by PCR using Platinum PCR SuperMix (Invitrogen). The 2209 bp PCR product (verified by restriction digest and agarose gel electrophoresis) was digested with BamHI and NheI then cloned into BamHI Nh eI digested pROS 711 to create pROS 912 and

PAGE 26

26 sequenced. Expression of VP1 is under the control of the GAL1 promoter. The plasmid is propagated in the DH5 a strain under Amp selection. For expression of AAV2 VP2, the AAV VP2 coding region was generated fr om pIM 45 by PCR using Platinum PCR SuperMix (Invitrogen). The 1798 bp PCR product (verified by restriction digest and agarose gel electrophoresis) was digested with NotI and PacI and then cloned into NotI PacI digested pROS 912 to create pROS 913 and seq uenced. Expression of VP2 is under the control of the GAL10 promoter. Thus, pROS 913 (selections: TRP for yeast and Amp for bacteria) expresses both AAV VP1 and VP2 under the control of the galactose inducible GAL1 and GAL10 promoters on a low copy plasm id. The plasmid is propagated in the DH5 abacterial strain under Amp selection. For expression of AAV2 Rep78, the AAV Rep78 coding region was generated from pIM 45 by PCR using Platinum PCR SuperMix (Invitrogen). The 1867 bp PCR product (verified by rest riction digest and agarose gel electrophoresis) was digested with NotI and PacI and then cloned into Not1 PacI digested pESC TRP (Stratagene) to create pROS 922 and sequenced. Expression of Rep78 is under the control of the GAL10 promoter. The plasmid is propagated in the DH5 a bacterial strain under Amp selection. pROS 922 was digested with SapI and NaeI and blunt ended using Klenow fragment. The fragment containing the AAV Rep78 coding region was then cloned into the NaeI site of pROS 913 to create pRO S 914 (selections: TRP for yeast and Amp for bacteria), a low copy number plasmid with AAV VP1 under control of the GAL1 promoter, VP2 under control of the GAL10 promoter, and Rep78 under control of the GAL10 promoter. The plasmid is propagated in the DH 5 a bacterial strain under Amp selection.

PAGE 27

27 A plasmid expressing AAP was also constructed using pYES6CT plasmid as a backbone (Generously provided by Stephen G. Kaler, NIH). This plasmid contains a yeast 2 origin and is selected in yeast by conferring resis tance to the antibiotic blasticidin. The plasmid encodes an in frame C terminal tag to proteins which it expresses. A version of the plasmid was generated which lacked the C terminal tag by digesting pYES6CT with PmeI and EcoRV to remove tag encoding seque nces then it is religated to create pYES6NoT. The AAP sequence was amplified from the pLTAAVHelp plasmid using primers from Sonntag et al. (2010 ) Both the amplified AAP sequence and pYES6CT and pYES6NoT were digested with EcoRI and SacI. The AAP fragment was then cloned into pYES6CT and PYES6NoT under the control of a galactose inducible promoter forming pYES6 AA P NoT and pYES6 AAP CT plasmids. The plasmids were then sequenced to verify the placement of the gene in the construct. Engineering of Yeast S trains To generate the rAAV vector producing yeast strain, the rAAV vector plasmid pROS 910 or pROS 911 is transf ormed using electroporation into yeast strain BJ2168 ( a prc1 407, prb1 1122, pep4 3, leu2, trp1, ura3 52 ) [ATCC 208277] plated and selected on uracil deficient agar media; the subsequent strain is called YRS 1. The plasmid pROS 921 expressing AAV VP3 and Rep 52 proteins is transformed into YRS 1 and plated and selected on uracil and leucine deficient agar media to create strain YRS 2. Strain YRS 2 is transformed with pROS 914, expressing AAV capsid proteins VP 1 and VP2, and Rep78, and plated and selected on uracil, leucine, and tryptophan deficient agar media to create strain YRS 4. Strains YRS 5 NoT and YRS 5 CT were created by transformation of YRS 4 with pYES6 AAP NoT or pYES6 AAP CT using the LiAc /SS carrier DNA/PEG method and selected on uracil, leuci ne, and tryptophan

PAGE 28

28 deficient agar media supplemented with blasticidin ( Gietz & Schiestl, 2007 ) Glycerol stocks of the engineered yeast strains are stored at 80 C. Yeast Culture Yeast are rescued from storage at 80 C and plated on agar YPD plates then incubated at 30 C for 24 48 hours until colonies are visible. A single colony is then picked and inoculated into 5 mL of synthetic complete media lacking leucine, tryptophan, and uracil (SC 3) in a 50 mL conical centrifuge tube. The cap is loosely a ttached to allow for gas exchange and the tube is placed in a shaking incubator at 30 C and 125 rpm for 48 hours until saturation. The culture is then used to inoculate 300 mL of SC 3 containing 2% raffinose or glycerol in a 1000 mL flask. The culture is incubated at 30 C and 125 rpm for 48 hours and then is equally divided between two flasks containing 150 mL of YPD each. The cultures are incubated at 30 C and 125 rpm for 2 hours and a solution of galactose is then added to one of the cultures to 2% fin al concentration for AAV protein induction. Both cultures are analyzed for optical density at 600 nm during incubation at 30 C and 125 rpm. Each 24 hours for 5 days the optical density of the cultures is recorded and 6 X 10 mL samples of each culture are harvested by centrifugation at 1500 g for 5 min at 4 C. Cell pellets are stored at 80 C. Yeast Lysis In the glass bead based lysis method, a frozen yeast cell pellet from 10 mL of culture (5 x 10 8 cells) is thawed and resuspended in 400 L of TN1 buf fer (0.01 M Tris hydrochloride, pH 7.5, 0.15 M NaCl) then put through three freeze/thaw cycles. 200 L of 10% deoxycholate solution is then added to 3.3% final and vortexed. The cell suspension is then added to screw top vial filled with 0.5 mL of 150 212

PAGE 29

29 washed glass beads. The vial is placed in a beadbeater (Biospec Products) at maximum spead for 1 min to homogenize cells. The vial is centrifuged for 1 min at 14k rpm. Supernatant is recovered and 50 L of chloroform is added to the lysate to kill any intact and viable yeast cells. The lysate is vortexed then centrifuged 10 min at 14k rpm and stored at 20 C for later analysis. The chemical based method for yeast lysis ( von der Haar, 2007 ) begins with resuspension of approximately 1 x 10 8 cells in 20 0 L lysis buffer (0.1M NaOH, 0.05 M mercaptoethanol) then incubated at 90C for 10 min. 5 L of 4 M acetic acid is added then suspension is vortexed for 30 seconds. Cell suspension is again incubated at 90C for 10 min. Lysate then clar ified by centrifugation at 14k rpm for 1 min. To the lysate are then added 4 volumes of methanol followed by the addition of 1 volume of CHCl 3 and 3 volumes of water in order with vortexing after each addition. The lysate is then centrifuged for 5 mins at 14k rpm and the upper aqueous layer is removed. Three volumes of methanol are added followed by vortexing after which the lysate is centrifuged for 5 min at 14k rpm. The supernatant is removed and the resulting protein pellet is briefly dried. The pellet i s resuspended in water and stored at 20C. The enzyme based lysis of yeast uses Zymolyase to digest yeast cell wall to form spheroplasts. Frozen cell pellets from 10 mL of culture (5 x 10 8 cells) are thawed and resuspended in 2 to 4 volumes of ice cold water then centrifuged 5 min at 1500 x g, 4 C. Supernatant is discarded and cells are resuspended in 1 volume Zymolyase buffer (50 mM Tris Cl, pH 7.5, 10 mM MgCl 2 1 M sorbitol, 30 mM DTT) and incubated 15 min at room temperature. Cells are centrifuged 5 min at 1500 x g, 4 C, resuspended in 3 volumes Zymolyase buffer containing 1mM DTT, and 2 mg of Zymolyase 100T per mL

PAGE 30

30 of original packed c ell volume is added. Cells are incubated 40 min at 30C while shaking at 50 rpm or until majority of cells are converted to spheroplasts. Spheroplast formation is checked microscopically by placing 50 L of cell suspension on a glass slide and adding 1% SD S solution. Spheroplasting is complete when bursting of 80 90% of cells in the presence of SDS is observed. Spheroplasts are centrifuged 5 min at 1500 x g, 4 C and supernatant is decanted. Spheroplasts are washed three times by resuspending in 2 volumes i ce cold Zymolyase buffer followed by centrifugation for 5 min at 1500 x g, 4 C. Spheroplasts are then resuspended in 5 mL of TN2 buffer (20 mM Tris Cl pH 7.5, 50 mM NaCl) followed by addition of 50 L yeast protease inhibitor cocktail (Sigma P8215), deoxy cholate to 1% final concentration, and 12.5 U benzonase and incubated 15 minutes at room temperature. The suspension is then placed in a 15 mL dounce homogenizer with tight fitting pestle and spheroplasts are lysed with 15 strokes of the dounce. The lysate is clarified by centrifugation 5 min a t 1500 x g, 4 C and stored at 20 C. Verification of AAV Protein Production Yeast cell lysates are analyzed for AAV Rep, Cap and AAP protein expression by Western blot. A 24 L sample of lysate from 1 x 10 6 is used to which 8 L of 4X Laem ml i buffer is added and mixed. The sample is then heated for 5 min at 90 C, and then cooled at room temperature. The samples are loaded on a 10% Tris HCl polyacrylamide gel and electrophoresed at 150 V for 1 hour. T he proteins are then transferred to supported nitrocellulose membrane at 0.5 A for 1 hour. The membrane is blocked in PBST (PBS, pH 7.4, with 0.05% Tween 20) containing 5% nonfat dry milk for 1 hour. Blocking solution is removed and 1 Ab is added then mem branes probed

PAGE 31

31 overnight at 4 C with mouse monoclonal anti AAV capsid antibody B1 (American Research Products, Inc.) diluted 1:5000 in 2.5% nonfat milk/PBST or anti Rep monoclonal antibody (clone 303.9; American Research Products, Inc.) at a 1:200 dilution or anti AAP guinea pig polyclonal antibody (Generously provided by Jurgen A. Kleinschmidt, DKFZ, Heidelberg) at a 1:5000 dilution. The membranes are then washed three times in PBST and mouse (Amersham NA931) or guinea pig (Pierce PA1 28679 ) horseradis h peroxidase conjugated seco ndary antibody is added at a 1:2500 dilution in 2.5% nonfat milk/PBST and incubated 1 hour with gentle agitation. The membranes are then washed three times in PBST and treated with chemiluminescent detection reagent (Thermo 3408 7) for 3 minutes. The membranes are covered in plastic and exposed to X ray film. Viral Purification Yeast cell lysates are purified using CsCl gradients. 5 mL of lysate is centrifuged at 5000 x g and supernatant transferred to 12 mL ultraclear ultracent rifugation tube (Beckman Cat. no. 344059). Then 6 mL of CsCl (density 1.30 g/ mL PBS pH 7.5) is added to the tube followed by an underlay of 1 mL CsCl cushion (density 1.5 g/ mL PBS pH 7.5). The 1.3/1.5 g/ mL CsCl interface is marked with a pen and the tubes are centrifuged for 1 hour at 291 ,000 x g. A 21 gage needle is used to pierce the centrifuge tube at the marked line and a 1 mL sample is taken. This sample is adjusted to 12 mL by addition of 1.37 g/ mL CsCl solution and transferred to a fresh 12 mL ultrac lear ultracentrifugation tube and underlayed with 1 mL 1.5 g/ mL CsCl solution. The gradient is centrifuged overnight at 291,000 x g, then the bottom of the tube is punctured allowing the CsCl solution to slowly drip out and 1 mL aliquots are collected. The density of each fraction is calculated after measuring the refractive index.

PAGE 32

32 The yeast cell lysates are also purified using 1 mL heparin columns (GE 17 0406 01 ) The lysates are first filtered through 0.8/0.2 m Supor membrane filters (Pall 4187) then th e heparin columns are washed with 20 mM Tris / 50 mM NaCl. The filtered lysates are applied to the column using a syringe then the column is washed with 10 column volumes of 20 mM Tris / 50 mM NaCl. The virions are then eluted from the column in 3 x 1 mL a liquots with 3 mL of 20 mM Tris / 600 mM NaCl. The column is then stripped with 20 mM Tris / 1 M NaCl. Transduction Assay Transduction assays are used to determine infectious titer of yeast cell lysates and purified fractions. Ninety six well plates of C12 ( Clark, Voulgaropoulou, & Johnson, 1996 ) cells are infected with seri al dilutions and the number of GFP expressing cells is used to calculate the titer. These cells stably express Rep and Cap proteins under the control of endogenous AAV promoters and are used for determining infectious titer because they provide for stronge r expression of the transgene. The C12 cells are maintained in high glucose Dulbecco's Modified Eagle Medium ( DMEM ) containing 5% FBS, 50 g/ mL G418, and 1% penicillin / streptomycin. 96 well plates are seeded with C12 cells that are grown to 80% confluency The cells are then infected with 20 L of yeast lysate or 20 L of purified fractions along with 5 fold serial dilutions. Each well is also infected with adenovirus serotype 5 (Ad5) at a multiplicity of infection of 300. The Ad5 is added to enhance sensi tivity of the assay by inducing expression of AAV genes in C12 cells that promotes replication of virions. The c ells are then incubated 37 C for 48 hours, and GFP expressing cells are counted at each dilution by fluorescence microscopy using a DMI600B mic roscope (Leica) and imaged using a DFC360FX camera (Leica) with Leica AF6000 software

PAGE 33

33 PCR Quantification of rAAV The rAAV genome titers are determined by quantitative, real time PCR analysis of yeast lysates and purified fractions using cytomegalovirus p romoter specific oligonucleotide primers (F ) and probe ( 6FAM TGGGAGGT CTATATAAGC MGBNFQ ) following treatment with 6 U of benzonase for 15 min at room temperature to degrade unp ackaged DNA Quantitative, real time PCR analysis was performed with a primary denaturation step of 3 minutes at 95 C, followed by 40 cycles of 95 C for 30 seconds, 55 C for 30 seconds, and 72 C for 30 seconds using TaqMan Universal PCR Master Mix

PAGE 34

34 CHAPTER 3 RESULTS AAV Protein Expression Plasmids Three yeast expression vectors were created to express the three AAV structural capsid proteins VP1, VP2 and VP3, Rep52 and Rep78 proteins, and vector sequence. Nonstructural AAV protein expre ssion was limited to Rep52 and Rep78 because these have been shown to be sufficient for rAAV production ( Negrete & Kotin, 2008 ) VP3 and Rep52 are expressed from the pROS 921 2 plasmid (Fig 3 1A) which is maintained at a high copy number in the yeast. Because this plasmid is maintained at high copy number, the VP3 and Rep52 proteins are expressed at higher levels to mimic their expression levels in wtAAV. The VP1, VP2, and Rep78 proteins are expressed in pROS 914 (Fig 3 1B) which has a CEN/ARS origin of replication and is maintained at lower copy number relative to the 2 plasmids. The vector sequence is encoded on another CEN/ARS plasmid c alled pROS 910 (Fig 3 1C). This plasmid contains the rAAV genome to be packaged which consists of a GFP reporter gene under the control of a CMV promoter flanked by the ITRs. The expression of AAV Rep and Cap proteins is driven by GAL1/10 promoters that ar e induced by the addition of galactose (2% final) to the yeast growth medium. The plasmids were used to transform the BJ2168 strain of S. Cerevisiae which is protease deficient. Each of the three plasmids encodes an auxotrophic selection marker which allow s the cells to grow in media lacking specific amino acids. Transformed cells were selected by growth in synthetic complete drop out medium lacking leucine, tryptophan, and uracil (SC 3). A strain of yeast which stably expresses the three plasmids was gener ated and named YRS 4.

PAGE 35

35 Figure 3 1 Yeast expression plasmid constructs harboring AAV viral genes. A. The pROS 921 plasmid encodes the VP3 and Rep52 proteins under the control of a galactose inducible promoter. This plasmid contai ns the 2 micron origin of replication that ensures its maintenance at high copy number in the yeast resulting in high expression levels of the proteins. The expression levels of these proteins reflects the expression levels during productive wtAAV infectio ns. B. The pROS 914 plasmid encodes galactose inducible VP1, VP2 and Rep78 and contains the CEN/ARS origin that results in maintenance of the plasmid at lower levels compared to plasmids with the 2 micron origin. C. The pROS 910 plasmid encodes the GFP vec tor that is encapsidated as the genome in rAAV virions. Culture Conditions The culture conditions for YRS 4 maximize the uptake of galactose to ensure efficient induction of viral gene expression from the plasmids. The cells are first grown in a small culture with SC 3 medium containing 2% glucose. This medium maintains selection pressure of the plasmids for YRS 4 and allows for rapid growth as yeast readily metabolize glucose. The starter culture is grown to saturation then it is used to

PAGE 36

36 seed a larger volume of SC 3 medium with 2% raffinose or 2% glycerol. This medium is meant to starve the yeast of glucose which induces expression of glucose transporters. After 48 hours of growth at 30C with shaking, the culture is added to an equal volume of YPD medi um containing yeast extract, peptone, and dextrose. The YPD is a rich medium that allows for rapid growth of yeast culture and the glucose in YPD is quickly depleted. The cells are incubated 2 hours, or one generation, at 30C with shaking. Galactose is th en added to the culture for a final concentration of 2% to induce expression of viral genes. An uninduced culture is also grown similarly except no galactose is added to the medium. The growth of the culture is monitored by measuring the OD600 (Fig 3 2). Figure 3 2 Culture growth curve. The concentration of cells in the culture was monitored daily by OD600 after addition of galactose to medium to induce expression of viral genes. Both cultures are started in auxotrophic select ion medium containing non metabolizable raffinose or glycerol as the carbon source. The induced culture receives galactose to 2% final (OD600 of 1 = 3 x 10 8 cells / mL ).

PAGE 37

37 Viral Protein Expression The AAV gene expression in YRS 4 was analyzed by Western bl ot. Aliquots of the culture were collected every 24 hours for 5 days and stored at 80C. Cells were mechanically lysed using glass beads and a bead beater machine. The lysates were clarified, electrophoresed on a protein gel, and transferred to a membrane for viral Cap antibodies. Five days of both induced and uninduced cultures were analyzed. Lysate from HEK293 cells used to produce rAAV using the transient transfection method served as a positive control. Figure 3 3 A sh ows that induced yeast cultures express both Rep52 and Rep78 while the uninduced cultures show no Rep protein expression. This indicates that viral protein expression from the plasmids is tightly regulated. Maximal Rep protein expression is achieved at day 3 post induction and declines after that. A reduction in Rep protein expression after day 3 was observed. The darker band produced by Rep52 indicates that it is expressed at greater levels than Rep78 due to expression in the 2 plasmid. The induced YRS 4 cells are also able to express VP1, VP2, and VP3 (Fig 3 3B). The stoichiometric ratio of VP1:VP2:VP3 in wtAAV is replicated in YRS 4 by the plasmid constructs where VP3

PAGE 38

38 overexpression is indicated by the darker bands. Figure 3 3 Western blots of protein extracts from YRS 4 analyzed with and without induction. A. The blot shows expression of Rep78 and Rep52 from extracts of YRS 4 grown in induction medium. Cells were harvested every 24 hours post induction for 5 days. Proteins extracts were made by physical lysis with glass beads of induced (I) and uninduced (U) cells from each harvest day using approximately 1 x 10 6 cells Induced cultures show expression of both Rep78 and Rep52 while uninduced cultures show no expression. B. E xpression of capsid proteins VP1, VP2 and VP3 was analyzed. Cells from the induced culture show expression of all capsid proteins at the appropriate ratio. Uninduced culture shows no expression of any viral protein. Lysate of 293 rAAV packaging cells serve d as the control. Viral DNA Replication The ability of yeast to replicate the viral genome from the plasmid was assessed by qPCR using primers and probe for the SV40 polyadenylation sequence (Fwd:

PAGE 39

39 AGCAATAGCATCACAAATTTC ACA Rev: CCAGACATGATAAGATACATTGATGA G T) Lysates of induced and uninduced YRS 4 cultures after 72 hours of induction were prepared using mechanical lysis with glass beads and were not treated with benzonase. Approximately the same number of cells were used to prepare each yeast lysate and co ntrol lysate of 293 cells. The control lysate was prepared by three cycles of freeze and thaw. A 2 L aliquot of the clarified crude lysate was then used in the qPCR reaction. Induction of the cultures resulted in a 10 fold increase of vector genome copies over uninduced cultures indicating that the induced yeast are able to replicate the rAAV vector sequence from the plasmid upon induction (Fig 3 4). The control lysates were found to contain over 5 00 times more copies of vector genome than both induced and uninduced cultures of YRS 4. Figure 3 4. Replication of viral genomes in yeast. Yeast lysates of induced and uninduced YRS 4 cultures were prepared using glass beads without benzonase treatment. Aliquots of the lysate were then analyzed by qPCR to det ermine vector genome copy number. Induction of yeast cultures increased vector genome copy number 10 fold over uninduced yeast. The control cells were found to contain over 500 times more copies than the yeast.

PAGE 40

40 Lysis Methods The W estern blot analyses sh owed that YRS 4 is able to express the AAV Rep and Cap proteins at the ratios found in wtAAV. The lysates produced for the Western blot analyses were then used for transduction assays. C12 cells were cultured in 96 well plates and were co infected with Ad5 and serial dilutions of YRS 4 lysate. Transduction was analyzed by GFP expression using fluorescence microscopy to count transduced cells. Repeated assays showed extremely low levels of transduction indicating low titers. To improve rAAV yield, various cu lture protocols and conditions were tested along with modifications to the glass bead lysis protocol. These changes did not result in any improvement of transduction frequency. These results led to the investigation of a chemical based yeast lysis method ( Figure 3 5 ). The chemical lysis of yeast utili zes a mercaptoethanol. The cells are heated in lysis buffer then proteins are precipitated out of lysate with methanol and resuspended in water. Figure 3 5 Summaries of lysis methods developed to liberate rAAV fro m yeast. The glass bead method begins with 3 freeze / thaw cycles then cells are agitated with glass beads in presence of detergent which facilitates the lysis of the yeast. The lysate is clarified and then treated with chloroform to eliminate any

PAGE 41

41 remainin g viable yeast cells. The NaOH based method involves the chemical mercaptoethanol. The cells are suspended in the lysis buffer then heated at 90C for 10 minutes. The lysate is neutralized with acet ic acid then clarified by centrifugation. The proteins are then precipitated with methanol. The efficiency of the chemical lysis method was tested by Western blot to detect Cap proteins. Lysates were prepared using glass bead and chemical lysis methods then analyzed to compare Cap protein extraction ability The darker and more well defined bands of Cap prote ins in the W estern blot from chemically lysed yeast showed that this method was more effective in liberating proteins from yeast (Fig 3 6 ). These re sults indicated that the chemical lysis could possibly yield more rAAV from YRS 4. To test this hypothesis, transduction assays were conducted on C12 cells but yielded no infectious virus. It was postulated that the harsh conditions of the chemical lysis m ethod were inactivating the liberated rAAV. Figure 3 6 Comparison of protein extraction efficiency of glass bead and NaOH lysis methods by Western blot for capsid protein expression using YRS 4 lysates produced by both methods. The NaOH based chemic al lyssis method is more

PAGE 42

42 efficient at extracting viral proteins from YRS 4 cells indicated by the intensity of the bands of the W estern blot. The Zymolyase based lysis method involves enzymatic digestion of the yeast cell wall to produce spheroplasts (Fig 3 7 ). The spheroplasts are then lysed mechanically with a dounce homogenizer. The lysates produced using this method were analyzed by Western blot for protein extraction and for rAAV liberation with a transduction assay. An extremely low number of transdu ced cells were observed indicating low titers, similar to assays using the glass bead and chemical lysis methods. Figure 3 7 Summary of Zymolyase based lysis of yeast. Cells are first suspended in buffer containing DTT which breaks down disulfide bonds of the yeast cell wall. The yeast cell walls are then digested with zymolyase leaving spheroplasts which are lysed using a dounce homogenizer. The lystates are then purified using CsCl gradient centrifugation or column chromatography. Trials of thr ee different lysis methods yielded no significant difference in rAAV liberation ability measured by transduction assay. The results indicated that some

PAGE 43

43 factor, other than the lysis method, was responsible for the low number o f cells transduced by lysates s o t he effect of yeast proteins on transduction by rAAV was investigated. The lysates produced from YRS 4 using the three previous methods were unpurified and contained yeast proteins along with reagents used in the lysis process. Transduction assays were c onducted in which rAAV2 GFP produced in HEK293 cells was spiked into yeast lysates prior to infection of C12 cells and compared to cells which received only HEK293 produced rAAV2 GFP. The crude yeast lysates were found to have a significant inhibitory effe ct on the transduction ability of rAAV reducing the number of transduced cells by 5 logs. Additionally, published results ( Salamat Miller et al., 2006 ) indicate that yeast express a large number of heparin b inding proteins. This may explain lack of transduction because AAV2 binds the cellular surface via heparan sulfate proteoglycans. Purification Ammonium sulfate fractionation ( R. Snyder, Xiao, & Samulski, 1996 ) of the yeast lysates was investigated as a means to separate rAAV virions from the yeast inhibitor proteins in the lysate. Western blot analysis revealed the ability to precipitate virions but no infec tious virus was detected after the pellet was resuspended (data n ot shown) in an attempt t o eliminate the inhibition of transduction the lysates were purified using a heparin affinity column chromatography protocol (Fig 3 8 ). This purification method is b ased upon the AAV2 capsid binding the heparin in the column ( Zolotukhin et al., 1999 ) The lysate is applied to the column then washed to remove impurities and the bound rAAV is eluted with a high salt s olution. Purified lysates were prepared and used in transduction assays to determine infectious titer. Repeated trials with different lysis methods and heparin column purification protocols yielded no detectable rAAV from

PAGE 44

44 yeast lysates probably due to yeas t heparin binding protein competition mentioned above. Figure 3 8 Summary of the heparin column chromatography purification method. This method of purification is based on the affinity of rAAV2 capsid to specifically bind heparin. In this method, th e clarified lysate is applied to the column and the rAAV2 is allowed to bind. The impurities are then washed away and the rAAV is eluted with a high salt solution which disrupts the bonds between heparin and rAAV. Purification of rAAV preps by CsCl dens ity gradient centrifugation involves application of lysates to a CsCl density step gradient followed by continuous gradient centrifugation (Fig 3 9 ). After the first round of centrifugation, the interface between the 1.3 g/ mL and 1.5 g/ mL layers containing rAAV is collected and applied to a continuous gradient to further purify the sample. The infectious titers of the gradient fractions are then determined by GFP transduction assay. Yeast lysates produced using glass beads or Zymolyase methods were purified using CsCl density gradient centrifugation. Aliquots

PAGE 45

45 of purified fractions were serially diluted and applied to C12 cells. A significant number of cells were transduced by purified fractions with CsCl densities between 1.359 and 1.383 g/ mL produced by bot h glass bead and Zymolyase lysis methods (Fig 3 10 ). The infectious titer was calculated by counting GFP expressing cells and adjusting for dilution factor (Fig 3 1 1 ). The infectious titers of the glass bead sample, Zymolyase sample, and 293 control rAAV sa mple were found to be 6875 IU/ mL 4375 IU/ mL and 3 x 10 5 respectively. These results show that yeast can be used to produce infectious rAAV albeit at low levels limited by either the producer cells, the lysis of the cell, or both. Figure 3 9 Summary of the CsCl gradient centrifugation purification method.Yeast cell lysates are first clarified then applied to a CsCl step gradient. The rAAV is purified by separation from other cellular components in the lysate. The 1.3 g/ mL and 1.5 g/ mL interfac e is applied to a continuous CsCl gradient.

PAGE 46

46 Figure 3 10 Transduction assays were conducted to determine infectious titer of purified rAAV fractions produced in yeast. C12 cells were cultured in 96 well plates and infected with 5 fold serial dilutions o f 20 L of CsCl gradient purified rAAV from YRS 4 along with Ad 5 at an MOI of 300. GFP expression was detected using fluorescence microscopy and the GFP expressing cells counted to calculate infectious titer of fractions. A. B. GFP expression in C12 cell infected with rAAV produced in YRS 4 yeast cells, 50x magnification. C. 200x magn ification of C12 cells from B. D Control C12 cells infected with rAAV produced in 293 cells, 50x magnification.

PAGE 47

47 Figure 3 11 Infectious titer of CsCl gradient purified rAAV fractions produced in YRS 4. The glass bead and Zymolyase lysis methods produced similar amounts of infectious virion s Titers from control rAAV produced in 293 cells were calculated at over two orders of magnitude more than those obtained from yeast Creation of Yeast Strain Expressing AAP The glass bead and Zymolyase lysis and CsCl purification protocols were found to liberate infectious rAAV from yeast producer cells. The infectious titers obtained from yeast were significantly lower than titers attainable by rAAV production in mammalian cells I n an attempt to improve the yeast based production method, a plasmid expressing assembly activating protein (AAP) under the control of the GAL1 promoter was constructed and used to transform YRS 4 (Fig 3 1 2 ). AAP is involved the capsid assembly process in mammalian cells and targets capsid proteins for transport to the nucleolus so it was postulated that overexpression of this protein would improve the yield of rAAV produced in yeast. Two new strains of ye ast, YRS 5 CT and YRS 5 NoT, were generated which stably express AAP under selection for resistance to the

PAGE 48

48 antibiotic blasticidin. The YRS5 CT strain expresses AAP with a C terminal tag while the YRS5 NoT strain expresses AAP without a tag. The yeast expre ssion vector encoding AAP has a 2 origin of replication and is maintained at high copy number which results in high expression levels of the protein. AAP expression was verified by W estern blot AAP Abs (Fig 3 1 3 ), and both YRS 5 CT and YRS 5 NoT e xpress AAP at detectable levels with the former expressing the most protein. As controls, the expression of AAP was not detected in YRS 4 or HEK293 lysates. The effect of AAP expression on rAAV production in yeast was assessed by qPCR measurement of vector genome titer (Fig 3 1 4 ) where AAP overexpression was found to improve rAAV packaging in yeast. YRS 5 CT expressed AAP at the highest level and also produced a significantly higher vector genome titer compared to the YRS 4 strain which does not produce AAP at detectable levels. These results indicated a direct relationship between AAP expression levels and rAAV packaging in yeast.

PAGE 49

49 Figure 3 12 Structure of AAP expression plasmid used to create strains YRS5 CT and YRS5 NoT. AAP expression is driven b y the GAL1 inducible promoter. Two versions of plasmid were constucted, ones with and without C terminal tag on AAP. Figure 3 13 Western blot analysis of AAP expression. The YRS5 and YRS4 extracts were prepared using the NaOH based protein extraction m ethod. The control was rAAV2 cell lysate from 293 cells AAP Abs, AAP expression was found in both strains of YRS5 but not in 293 control or YRS 4.

PAGE 50

50 Figure 3 14 Results of rAAV vector genome titer from the three yeast strains. Lysates were produ ced using the Zymolyase method, after clarification, the samples were diluted 5 fold treated with benzonase, then used in qPCR using primers and probe that recognize the CMV promoter used in the AAV vector. Expression of AAP in YRS5 appears to increase rA AV vector genome titer. YRS5 CT showed the highest AAP expression through W estern blot and also shows the highest rAAV VG titer.

PAGE 51

51 CHAPTER 4 DISCUSSION From research over the past 20 years, rAAV has shown promise as a vector for gene therapy. In clinical trials, rAAV has produced long term therapeutic effects in humans with disorders such as hemophilia B ( Nathwani et al., 2011 ) Congenital Amaur osis ( Bainbridge et al., 2008 ; Cideciyan et al., 2009 ; Her zog et al., 1999 ) One hurdle that remains in the development of rAAV as a gene therapy vector is the expense in producing the virions in amounts required for clinical trials using current methods in mammalian and insect systems. The production of rAAV u sing transiently transfected mammalian cells in adherent culture is costly and inefficient. The baculovirus production method requires extensive purification to ensure the final rAAV product is free from baculovirus, viral DNA, and viral proteins generated in the process. The production of rAAV in yeast presents a possible alternative to these metho ds and presents some advantages: i t is conducted in animal free suspension culture, which is easy to scale up, does not require the use of helper viruses, and ut ilizes production technology used for other biotech nology products. The experiments in this research have shown that yeast are able to express AAV proteins from plasmids and assemble infectious virions. To the best of our knowledge these are some of the f irst data showing an infectious mammalian virus can be produced in S. cerevisiae Yeast have been used to produce VLPs as commercial vaccines but our research shows yeast can also be used to produce infectious virions. More work is required to achieve the level of efficiency currently found in conventional rAAV production methods. One obstacle in the development of yeast based rAAV production is the method of extracting the virus from the yeast cells. The yeast cell wall

PAGE 52

52 presents a challenge for recovering infectious virus. The yeast lysis conditions need to be vigorous enough to break down the cell wall while not being so harsh as to damage liberated virus. The mechanical lysis of yeast using glass beads and a bead beater was investigated in this study and found to be effective at liberating infectious virus. Although this method is able to release virus from yeast, its efficiency and scalability are questionable and t he amounts of virus produced using this method were low. The heat produced by the friction of the glass beads could possibly degrade the rAAV. The bead beater oscillates at a very high frequency producing harsh conditions which, while effective at lysing yeast, may reduce virion viability. This method of lysis would also be difficult to scale up to commercial production levels but the availability of large scale bead mills, microfluidizers, and French presses may address this The chemical lysis method investigated in this study was the most effective for the extraction of proteins but failed to maintain infectious virus after repeated transduction assays. This method mercaptoethanol and involves heating of cells to 90C. These conditions may be too harsh for the preservation of infectious rAAV. T he lysis of yeast using Zymolyase also produced infectious virus but at titers not significantly different from those obtained by the mechanical lysis method. The low yields could be explained by the protocol that requires several washes of the spheroplast suspension to remove the Zymolyase during which virus may be lost. Zymolyase also has protease activities that may cause degradation of produced virus. This method would be costly and difficult to scale up due to the high price of the enzyme and the proto col which involves many manipulations

PAGE 53

53 The production of rAAV in yeast also requires the development of a highly refined producer cell. In this study, the BJ2168 strain of S. cerevisiae was used which is deficient in proteases. This line of cells was tran sfected to express three plasmids under auxotrophic selection producing the YRS 4 strain. While this strain was able to produce infectious virus, the yields per cell were very low. To address this issue, strain YRS 5 was produced which stably harbors a pla smid for the overexpression of AAP. The analysis of AAP expression by W estern blot showed that YRS 5 expressed the protein but YRS 4 and HEK293 rAAV producer cells did not. This finding was unexpected because AAP is required for capsid assembly in mammalia n cells ( Sonntag et al., 2010 ) although it is likely that the protein is expressed in 293 cells but at levels which were unde tectable in our experiments. Viral genome titers measured by qPCR showed an improvement of rAAV production from AAP overexpression in YRS 5 compared to YRS 4 but yields were still significantly lower than those from conventional methods and transduction ex periments need to be performed to determine infectious titers. Future work: Further genetic modifications of the strain may improve the he viral protein expression plasmids can be codon optimized to reflect yeast codon bi as to increase production ( Kotula & Curtis, 1991 ) and o verexpression of chaperones and other protein folding helper genes has been shown to improve recombinant protein expression in yeast ( Idiris, Tohda, Kumagai, & Takegawa, 2010 ) Other species of yeast may also be used to improve yields. Recombinant proteins produced in S. cerevisiae have been found to be

PAGE 54

54 Pichia pastoris does not produce hyperglycosylated proteins and may imp rove the yeast based rAAV production method ( Gellissen et al., 1992 ) The purification of rAAV presents a significant obstacle, in terms of yield and scalability, in the development of a commercially viable large scale production method. Stocks of rAAV need to be free of impurities to be suitable for use in clininical trials. For the production of rAAV2 in yeast, the purification method is critical because S. cerevisiae express a large number of proteins, many of which b ind heparin and some that may cause allergy. CsCl gradients are not practical for large scale purification and t he presence of many heparin binding proteins in S. cerevisiae limits the ability of purification methods utilizing heparin column chromatography because the proteins compete for rAAV binding sites ( Salamat Miller et al., 2006 ) so chromatographic methods that rely on standard chemistries or AVB may be more useful ( Wang et al., 2011 ) Future work to improve the efficiency of rAAV production in yeast includes optimization of lysis and purification methods. In our experiments, the spheroplasting lysis method followed by CsCl centrif ugation yielded the most infectious virions. The paramaters of the method such as the amount of Zymolyase used per gram of yeast cells are critical for lysing the most cells while maintaining conditions which will not degrade liberated virions. The purific ation method is also crucial to ensure a high yield of rAAV. Yeast express a large number of proteins many of which interfere with common purification procedures. Developing conditions suitable for yeast produced virion purification is required to enhance the efficiency of the method. Future work also includes the scale up of the culture, lysis, and purification processes to obtain higher

PAGE 55

55 titers of virus and test the scalability of the method. Lysates will also be made from cells after 24 hours of induction rather than the usual 72 hours to avoid the possible generation of inclusion bodies in the yeast cells. The virions will then need to be characterized for infectivity and to determine the ratio of full to empy particles by electron microscopy. The virion s produced using this method will also be tested in vivo to ensure they have retained efficient gene transfer capability While transduction of cultured cells was achieved, further tests in vivo are needed to evaluate the functionality of the viruses in th e environment for which they are intended. Because these virions are produced in yeast, they may contain differences in post translational modification or other features which interfere with transduction ability or produce adverse immune reactions. The YRS 5 strain of yeast also needs to be analyzed for infectious titer to determine if the strain improves rAAV yield. The results from this work show that yeast can be engineered as a producer cell for the production of infectious rAAV. This method require s no helper virus and is able to be conducted in suspension culture making it amenable towards scale up, however, all aspects of induction, lysis, extraction, and purification need to be optimized. The current methods for rAAV production are expensive for producing gene therapy vectors at commercial scale. For the advancement of commercial gene therapy, new and more inexpensive ways of producing viral vectors need to be established. The method described in this research provides a possible alternative metho d for the production of rAAV for gene therapy purposes.

PAGE 56

56 LIST OF REFERENCES Atchison, R. W., Casto, B. C., & Hammon, W. M. (1965). Adenovirus Associated Defective Virus Particles. Science, 149 (3685), 754 756. Bainbridge, J. W. B ., Smith, A. J., Barker, S. S., Robbie, S., Henderson, R., Balaggan, K., Viswanathan, A., Holder, G. E., Stockman, A., & Tyler, N. (2008). Effect of gene therapy on visual function in Leber's congenital amaurosis. New England Journal of Medicine, 358 (21), 2231 2239. Berns, K. I., & Linden, R. M. (1995). The cryptic life style of adenoassociated virus. Bioessays, 17 (3), 237 245. Bleker, S., Pawlita, M., & Kleinschmidt, J. A. (2006). Impact of capsid conformation and Rep capsid interactions on adeno assoc iated virus type 2 genome packaging. J Virol, 80 (2), 810 820. doi: 10.1128/JVI.80.2.810 820.2006 Bleker, S., Sonntag, F., & Kleinschmidt, J. A. (2005). Mutational analysis of narrow pores at the fivefold symmetry axes of adeno associated virus type 2 caps ids reveals a dual role in genome packaging and activation of phospholipase A2 activity. J Virol, 79 (4), 2528 2540. doi: 10.1128/JVI.79.4.2528 2540.2005 Bonander, N., & Bill, R. M. (2012). Optimising yeast as a host for recombinant protein production (rev iew). Methods in molecular biology (Clifton, NJ), 866 1. Brown, K. E. (2010). The expanding range of parvoviruses which infect humans. Reviews in Medical Virology, 20 (4), 231 244. doi: 10.1002/rmv.648 Cideciyan, A. V., Hauswirth, W. W., Aleman, T. S., Kaushal, S., Schwartz, S. B., Boye, S. L., Windsor, E. A. M., Conlon, T. J., Sumaroka, A., & Pang, J. (2009). Human RPE65 gene therapy for Leber congenital amaurosis: persistence of early visual improvements and safety at 1 year. Human gene therapy, 20 (9), 999 1004. Clark, K. R., Voulgaropoulou, F., & Johnson, P. (1996). A stable cell line carrying adenovirus inducible rep and cap genes allows for infectivity titration of adeno associated virus vectors. Gene therapy, 3 (12), 1124. Collaco, R. F., Kalman Maltese, V., Smith, A. D., Dignam, J. D., & Trempe, J. P. (2003). A biochemical characterization of the adeno associated virus Rep40 helicase. [Research Support, U.S. Gov't, P.H.S.]. J Biol Chem, 278 (36), 34011 34017. doi: 10.1074/jbc.M301537200 Daya, S., & Berns, K. I. (2008). Gene Therapy Using Adeno Associated Virus Vectors. Clinical Microbiology Reviews, 21 (4), 583 593. doi: 10.1128/cmr.00008 08 Flotte, T. R. (2005). Recent developments in recombinant AAV mediated gene therapy for lung diseases. Curr Gene Ther, 5 (3), 361 366.

PAGE 57

57 Gao, G., Vandenberghe, L. H., & Wilson, J. M. (2005). New recombinant serotypes of AAV vectors. Current gene therapy, 5 (3), 285 297. Gellissen, G., Melber, K., Janowicz, Z. A., Dahlems, U. M., Weydemann, U., Piontek, M., Stras ser, A. W. M., & Hollenberg, C. P. (1992). Heterologous protein production in yeast. Antonie van Leeuwenhoek, 62 (1), 79 93. doi: 10.1007/bf00584464 Gietz, R. D., & Schiestl, R. H. (2007). High efficiency yeast transformation using the LiAc/SS carrier DNA/ PEG method. [10.1038/nprot.2007.13]. Nat. Protocols, 2 (1), 31 34. Giraud, C., Winocour, E., & Berns, K. I. (1994). Site specific integration by adeno associated virus is directed by a cellular DNA sequence. Proceedings of the National Academy of Sciences 91 (21), 10039 10043. Herzog, R. W., Yang, E. Y., Couto, L. B., Hagstrom, J. N., Elwell, D., Fields, P. A., Burton, M., Bellinger, D. A., Read, M. S., & Brinkhous, K. M. (1999). Long term correction of canine hemophilia B by gene transfer of blood coagu lation factor IX mediated by adeno associated viral vector. Nat Med, 5 (1), 56 63. Idiris, A., Tohda, H., Kumagai, H., & Takegawa, K. (2010). Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology, 86 (2), 403 417. doi: 10.1007/s00253 010 2447 0 Klein, R. L., Meyer, E. M., Peel, A. L., Zolotukhin, S., Meyers, C., Muzyczka, N., & King, M. A. (1998). Neuron Specific Transduction in the Rat Septohippocampal or Nigrostriatal Pathway by Rec ombinant Adeno associated Virus Vectors. Experimental Neurology, 150 (2), 183 194. doi: 10.1006/exnr.1997.6736 Kohlbrenner, E., Aslanidi, G., Nash, K., Shklyaev, S., Campbell Thompson, M., Byrne, B. J., Snyder, R. O., Muzyczka, N., Warrington, K. H., & Zol otukhin, S. (2005). Successful production of pseudotyped rAAV vectors using a modified baculovirus expression system. Molecular Therapy, 12 (6), 1217 1225. Kotin, R. M., Siniscalco, M., Samulski, R. J., Zhu, X. D., Hunter, L., Laughlin, C. A., McLaughlin, S., Muzyczka, N., Rocchi, M., & Berns, K. I. (1990). Site specific integration by adeno associated virus. Proceedings of the National Academy of Sciences, 87 (6), 2211 2215. Kotula, L., & Curtis, P. J. (1991). Evaluation of Foreign Gene Codon Optimizatio n in Yeast: Expression of a Mouse IG Kappa Chain. [10.1038/nbt1291 1386]. Nat Biotech, 9 (12), 1386 1389.

PAGE 58

58 Maguire, A. M., Simonelli, F., Pierce, E. A., Pugh Jr, E. N., Mingozzi, F., Bennicelli, J., Banfi, S., Marshall, K. A., Testa, F., & Surace, E. M. (2 008). Safety and efficacy of gene transfer for Leber's congenital amaurosis. New England Journal of Medicine, 358 (21), 2240 2248. Manno, C. S., Chew, A. J., Hutchison, S., Larson, P. J., Herzog, R. W., Arruda, V. R., Tai, S. J., Ragni, M. V., Thompson, A ., Ozelo, M., Couto, L. B., Leonard, D. G., Johnson, F. A., McClelland, A., Scallan, C., Skarsgard, E., Flake, A. W., Kay, M. A., Hi gh, K. A., & Glader, B. (2003). AAV mediated factor IX gene transfer to skeletal muscle in patients with severe hemophilia B. [Research Support, U.S. Gov't, P.H.S.]. Blood, 101 (8), 2963 2972. doi: 10.1182/blood 2002 10 3296 Manno, C. S., Pierce, G. F., Ar ruda, V. R., Glader, B., Ragni, M., Rasko, J. J. E., Ozelo, M. C., Hoots, K., Blatt, P., & Konkle, B. (2006). Successful transduction of liver in hemophilia by AAV Factor IX and limitations imposed by the host immune response. Nat Med, 12 (3), 342 347. Me rten, O. W., Geny Fiamma, C., & Douar, A. M. (2005). Current issues in adeno associated viral vector production. Gene Ther, 12 (S1), S51 S61. Musatov, S., Roberts, J., Pfaff, D., & Kaplitt, M. (2002). A cis acting element that directs circular adeno assoc iated virus replication and packaging. J Virol, 76 (24), 12792 12802. Muzyczka, N., & Berns, K. (2001). Parvoviridae: the viruses and their replication. Fields virology, 2 2327 2359. Myers, M. W., Laughlin, C. A., Jay, F. T., & Carter, B. J. (1980). Ad enovirus helper function for growth of adeno associated virus: effect of temperature sensitive mutations in adenovirus early gene region 2. J Virol, 35 (1), 65 75. Nathwani, A. C., Tuddenham, E. G. D., Rangarajan, S., Rosales, C., McIntosh, J., Linch, D. C., Chowdary, P., Riddell, A., Pie, A. J., & Harrington, C. (2011). Adenovirus associated virus vector mediated gene transfer in hemophilia B. New England Journal of Medicine, 365 (25), 2357 2365. Negrete, A., & Kotin, R. M. (2008). Strategies for manufac turing recombinant adeno associated virus vectors for gene therapy applications exploiting baculovirus technology. Brief Funct Genomic Proteomic, 7 (4), 303 311. doi: 10.1093/bfgp/eln034 Niemeyer, G. P., Herzog, R. W., Mount, J., Arruda, V. R., Tillson, D. M., Hathcock, J., van Ginkel, F. W., High, K. A., & Lothrop, C. D., Jr. (2009). Long term correction of inhibitor prone hemophilia B dogs treated with liver directed AAV2 mediated factor IX gene therapy. Blood, 113 (4), 797 806. doi: 10.1182/blood 2008 10 181479

PAGE 59

59 Ostergaard, S., Olsson, L., & Nielsen, J. (2000). Metabolic Engineering of Saccharomyces cerevisiae. Microbiology and Molecular Biology Reviews, 64 (1), 34 50. doi: 10.1128/mmbr.64.1.34 50.2000 Penaud Budloo, M., Le Guiner, C., Nowrouzi, A., Toroman off, A., Chrel, Y., Chenuaud, P., Schmidt, M., Von Kalle, C., Rolling, F., & Moullier, P. (2008). Adeno associated virus vector genomes persist as episomal chromatin in primate muscle. J Virol, 82 (16), 7875 7885. Salamat Miller, N., Fang, J., Seidel, C. W., Smalter, A. M., Assenov, Y., Albrecht, M., & Middaugh, C. R. (2006). A network based analysis of polyanion binding proteins utilizing yeast protein arrays. Molecular & cellular proteomics, 5 (12), 2263 2278. Smith, R. H., Levy, J. R., & Kotin, R. M. (2009). A simplified baculovirus AAV expression vector system coupled with one step affinity purification yields high titer rAAV stocks from insect cells. Molecular Therapy, 17 (11), 1888 1896. Snyder, R., Xiao, X., & Samulski, R. (1996). Production of re combinant adeno associated viral vectors. Current protocols in human genetics, 12 1 12.11. Snyder, R. O., Miao, C., Meuse, L., Tubb, J., Donahue, B. A., Lin, H. F., Stafford, D. W., Patel, S., Thompson, A. R., Nichols, T., Read, M. S., Bellinger, D. A., Brinkhous, K. M., & Kay, M. A. (1999). Correction of hemophilia B in canine and murine models using recombinant adeno associated viral vectors. Nat Med, 5 (1), 64 70. doi: 10.1038/4751 Snyder, R. O., Samulski, R. J., & Muzyczka, N. (1990). In vitro resolu tion of covalently joined AAV chromosome ends. [Research Support, U.S. Gov't, P.H.S.]. Cell, 60 (1), 105 113. Sonntag, F., Schmidt, K., & Kleinschmidt, J. A. (2010). A viral assembly factor promotes AAV2 capsid formation in the nucleolus. Proceedings of t he National Academy of Sciences, 107 (22), 10220 10225. doi: 10.1073/pnas.1001673107 Srivastava, A., Lusby, E. W., & Berns, K. I. (1983). Nucleotide sequence and organization of the adeno associated virus 2 genome. Journal of Virology, 45 (2), 555 564. Su n, X., Lu, Y., Bish, L. T., Calcedo, R., Wilson, J. M., & Gao, G. (2010). Molecular analysis of vector genome structures after liver transduction by conventional and self complementary adeno associated viral serotype vectors in murine and nonhuman primate models. Human gene therapy, 21 (6), 750 761. von der Haar, T. (2007). Optimized protein extraction for quantitative proteomics of yeasts. PLoS One, 2 (10), e1078. doi: 10.1371/journal.pone.0001078

PAGE 60

60 Wang, L., Blouin, V., Brument, N., Bello Roufai, M., & Fran cois, A. (2011). Production and purification of recombinant adeno associated vectors. Methods Mol Biol, 807 361 404. doi: 10.1007/978 1 61779 370 7_16 Ward, P., & Berns, K. I. (1995). Minimum origin requirements for linear duplex AAV DNA replication in v itro. Virology, 209 (2), 692 695. doi: 10.1006/viro.1995.1306 Zolotukhin, S., Byrne, B., Mason, E., Zolotukhin, I., Potter, M., Chesnut, K., Summerford, C., Samulski, R., & Muzyczka, N. (1999). Recombinant adeno associated virus purification using novel me thods improves infectious titer and yield. Gene therapy, 6 (6), 973.

PAGE 61

61 BIOGRAPHICAL SKETCH Sami S. Thakur was born in New York, New York. He moved to Orlando, Florida and attended Winter Park High Scho ol. He then earned his B.A. in b iology from Rollins C ollege in Winter Park, Florida. After graduation, he worked in the construction management field for a period of time then decided to advance his science educat ion. He enrolled in the Master of Science Program in translational b iotechnology at the Universi ty of Florida and earned his M.S. in medical s cience. Upon completion of his degree, Sami will pursue employment in the field of biotechnology.