Exploring Molecular Mechanisms of Liver to Pancreatic Beta Cell Reprogramming

MISSING IMAGE

Material Information

Title:
Exploring Molecular Mechanisms of Liver to Pancreatic Beta Cell Reprogramming
Physical Description:
1 online resource (158 p.)
Language:
english
Creator:
Donelan, William L
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Molecular Cell Biology (IDP)
Committee Chair:
Yang, Lijun
Committee Members:
Bungert, Jorg
Terada, Naohiro
Chan, Edward K
Atkinson, Mark A

Subjects

Subjects / Keywords:
autoantibodies -- diabetes -- factors -- hnf1alpha -- hnf4alpha -- lips -- luciferase -- ngn3 -- nkx6-1 -- paa -- pdx1 -- reprogramming -- transcription -- transdifferentiation
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Ectopic expression of pancreatic transcription factors (PTFs) reprograms hepatic cells toward pancreatic beta cells. However, molecular mechanisms underlying this process have not been well studied, particularly regarding suppression of the hepatocyte phenotype.  To study the mechanisms involved in hepatic to pancreatic beta cell reprogramming, we generated lentiviral vectors expressing PTFs (Pdx1, Pdx1-VP16, and Ngn3),transduced hepatocellular carcinoma Huh7 cells, and examined the early effectson expression of key pancreatic and hepatic genes.  We demonstrated that Pdx1 not only activates betacell-specific genes but also suppresses the key hepatic transcription factor HNF1alpha and hepatic functional gene ALB by RT-PCR and western blotting.  Luciferase reporter assays further confirmed Pdx1-mediatedsuppression of HNF1alpha in hepatic cells. HNF1alpha suppression may be, in part, due to up-regulation of HNF4alphaP2 isoforms, which was also observed following ectopic Pdx1 expression, becausethese isoforms are weaker than P1-driven isoforms and they may compete forbinding the HNF1alpha proximal promoter. We also cloned a 3kb proximal HNF1alpha promoter element into the pGL3luciferase reporter to further study its regulation.  We found that NK6homeodomain 1 (Nkx6.1) binds to a cis regulatory element in the HNF1alpha promoter and is a major regulator of this gene in betacells.  We identified an Nkx6.1recognition sequence in the distal region of the HNF1alpha promoter and demonstrated specific binding of Nkx6.1 inbeta cells by EMSAs and ChIP assays. Site directed mutagenesis of the Nkx6.1 core binding sequence eliminatesNkx6.1 mediated activation and substantially decreases activity of the HNF1alphapromoter in beta cells.  Over-expressionor siRNA-mediated knockdown of Nkx6.1 gene expression results in increased ordiminished HNF1a gene expression, respectively, in beta cells.  We conclude that Nkx6.1 is a novel regulatorof HNF1alpha in pancreatic beta cells.  In addition, following our lab’s discovery of Pdx1 autoantibodies (PAA), we developed a sensitive, specific, and non-radioactive liquid-phase luciferase immunoprecipitation systems (LIPS) assay for detection of PAA.  We screened sera from patients with type 1 diabetes, systemiclupus erythematosus, rheumatoid arthritis, and various forms of cancer (including pancreatic cancer) and detected positive PAA sera from all groups.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by William L Donelan.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Yang, Lijun.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044663:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 EXPLORING MOLECULAR MECHANISMS OF LIVER TO PANCREATIC BETA CELL REPROGRAMMING By WILLIAM LEPAGE DONELAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 William LePage Donelan

PAGE 3

3 To my financial advisor s and best friend s, Grandma Jane and Grandpa Billy

PAGE 4

4 ACKNOWLEDGMENTS This work was su pported in part by grants from T he National Institutes of Health, NIDDK DK071831 and DK64054 (LJ Yang ). I would also like to thank T he University The Pathology Department, The Molecular Cell Biology Concentration, my graduate research committee and T he Laboratory of Dr LiJun Yang (with special thanks to Dr. Shi Wu Li) for supporting my graduate education Most importantly, I thank my friends and family for their love and support.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 12 Type 1 Diabetes Introduction ................................ ................................ .................. 12 Tissue Pathology and Cellular Pathology ................................ ......................... 12 Molecular Pathology ................................ ................................ ......................... 13 Susceptibility: Genetic and Environmental ................................ ....................... 14 Therapy and Treatment ................................ ................................ .................... 15 Diabetic Complications ................................ ................................ ..................... 17 MODY ................................ ................................ ................................ ..................... 18 Transcription Factors ................................ ................................ .............................. 20 Pdx1 ................................ ................................ ................................ ................. 21 Ngn3 ................................ ................................ ................................ ................. 22 Nkx6.1 ................................ ................................ ................................ .............. 23 ................................ ................................ ................................ .............. 24 ................................ ................................ ................................ .............. 35 HNF Re gulatory Circuit ................................ ................................ ..................... 38 2 PDX1 MEDIATED SUPPRESSION OF HNF1 DURING REPROGRAMMING OF HUMAN HEPATIC CELLS TOWARDS PANCREATIC BETA CELLS .............. 40 Introduction ................................ ................................ ................................ ............. 40 Materials and Methods ................................ ................................ ............................ 42 Cell Lines and Cell Culture ................................ ................................ ............... 42 Construction of Plasmids ................................ ................................ .................. 43 Lent iviral Vector (LV) Preparation, Titration, and Transduction ........................ 43 RT PCR and Real Time RT PCR Analysis ................................ ....................... 44 Western Blotting and Immunocytochemistry (ICC) ................................ ........... 45 Transfections and Luciferase Assay ................................ ................................ 45 Statistical Analysis ................................ ................................ ............................ 46 Results ................................ ................................ ................................ .................... 46 Pdx1 VP16 (PV) and Ngn3 Toge ther Strongly Induced Insulin Promoter Activity ................................ ................................ ................................ ........... 46 Pdx1 and Ngn3 Induced Expression of Genes Related to Endocrine Pancreas ................................ ................................ ................................ ....... 47 Quantitative Analysis of PTF Promoter Activities ................................ ............. 48 ................................ ....................... 49

PAGE 6

6 in Hepatic Cells ................................ .. 49 Pdx1 Competitive Inhibition ................................ ................................ .................... 50 Discussion ................................ ................................ ................................ .............. 51 3 DISTINCT REGULATION OF HNF1 BY Nkx6.1 IN PANCREATIC BETA CELLS ................................ ................................ ................................ .................... 76 Introduction ................................ ................................ ................................ ............. 76 Materials and Methods ................................ ................................ ............................ 78 Cell Culture ................................ ................................ ................................ ....... 78 Plasmid Construc tion ................................ ................................ ....................... 78 Transient Transfection and Luciferase Assays ................................ ................. 79 Site Directed Mutagenesis ................................ ................................ ................ 79 Electrophoretic Mobility Shift Assay (EMSA) ................................ .................... 80 Chromatin Immunoprecipitation (ChIP) Assay ................................ .................. 80 Gene Expression and Quantitative RT PCR ................................ .................... 81 Statistical Analysis ................................ ................................ ............................ 81 Results ................................ ................................ ................................ .................... 81 .......................... 81 Beta Cells ................................ ................................ ................................ ...... 82 ................................ ................................ 82 ................................ .......................... 83 Promoter in Beta Cells ................................ ................................ .................. 84 .............................. 84 Nkx6.1 O ............. 85 ......... 86 Discussion ................................ ................................ ................................ .............. 86 4 NOVEL DETECTION OF PANCREATIC AND DUODENAL HOMEOBOX 1 (Pdx1) AUTOANTIBODIES (PAA) IN HUMAN SERA USING LUCIFERASE IMMUNOPRECIPITATION SYSTEMS (LIPS) ASSAY ................................ ......... 109 Introduction ................................ ................................ ................................ ........... 109 Materials and Methods ................................ ................................ .......................... 109 Plasmid Construction ................................ ................................ ..................... 109 Fusion Protein Lysate ................................ ................................ ..................... 110 Sera ................................ ................................ ................................ ................ 110 LIPS Assay ................................ ................................ ................................ ..... 111 Results ................................ ................................ ................................ .................. 111 Discussion ................................ ................................ ................................ ............ 113 5 P ANCREATIC AND DUODENAL HOMEOBOX 1 (PDX1) AUTOANTIBODIES (PAA) FROM HUMAN SERA DETECTED IN AUTOIMMUNE DISEASES AND CANCER ................................ ................................ ................................ ............... 122

PAGE 7

7 Introduction ................................ ................................ ................................ ........... 122 Materials and Methods ................................ ................................ .......................... 122 Results ................................ ................................ ................................ .................. 123 Discussion ................................ ................................ ................................ ............ 123 6 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 127 LIST OF REFERENCES ................................ ................................ ............................. 134 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 158

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Confirmation of LV PTF gene expression by RT PCR.. ................................ ..... 56 2 2 Confirmation of LV PTF gene expression by western blotting.. .......................... 57 2 3 Confirmation of LV PTF gene expression by immunocytochemistry .................. 58 2 4 Activation of rat insulin I gene in Huh7 cells with Pdx1, PV, Ngn3 and combinations ................................ ................................ ................................ ...... 59 2 5 Time course activation of rat insulin I gene in Huh7 cells with Pdx1/Ngn3 or PV/Ngn3 .. ................................ ................................ ................................ ........... 60 2 6 RT PCR analysis of pancreatic gene expression. ................................ .............. 61 2 7 RT PCR analysis of liver specific gene expression ................................ ............ 62 2 8 Pax4 luciferase reporter gene analysis during reprogramming .......................... 63 2 9 NeuroD luciferase reporter g ene analysis during reprogramming ...................... 64 2 10 INS1 luciferase reporter gene analysis during reprogramming ........................... 65 2 11 Ngn3 luciferase reporter gene analysis during reprogramming. ......................... 66 2 12 Nkx2.2 luciferase reporter gene analysis during reprogramming. ...................... 67 2 13 Down regulation of and ATT in Huh7 cells over expressing Pdx1 by western blotting ................................ ................................ .................... 68 2 14 Down regulation of luciferase reporter in Huh7 cells over expressing Pdx1. ................................ ................................ ................................ ................. 69 2 15 Down regulation of by full length Pdx1. ................................ .................. 70 2 16 Pdx1 increases P2 transcripts tha t compete with P1 transcripts. .......... 71 2 17 Cell luc. ........... 72 2 18 Down regulation of luciferase reporter by Pdx1 in 3T3 cells. ................ 73 2 19 Down regulation of luciferase reporter by in 3T3 cells. ............ 74 2 20 A proposed mechanism of Pdx1 medeated hepatocyte to ward IPC reprogramming ................................ ................................ ................................ 75

PAGE 9

9 3 1 ....................... 92 3 2 Deletion analysis of the ................................ ..... 93 3 3 ................... 94 3 4 ................................ ................................ ................ 95 3 5 oncentration dependent manner .... 96 3 6 ................................ ................................ ................ 97 3 7 HNF ................................ ................................ 98 3 8 r constructs ................................ ............... 99 3 9 Luciferase activity of Nkx6.1 binding site mutant cells. ................................ ................................ ................................ ................. 100 3 10 r by EMSA with INS1 cell lysate ................. 101 3 11 Nkx6.1 ChIP assay. ................................ ................................ ......................... 102 3 12 ................................ ................................ ........................... 103 3 13 ................ 104 3 14 with NIT1 cell lysate ................. 105 3 15 RT PCR for de termination of gene expression. ................................ ................ 106 3 16 Effect of Nkx6.1 o ver expression on mRNA levels ................................ ........... 107 3 17 Effect of Nk x6.1 knockdown on mRNA levels ................................ .................. 108 4 1 Detection of GAD A in human sera by LIPS assay. ................................ .......... 116 4 2 Detection of IA 2 A in human sera by LIPS assay ................................ ............. 117 4 3 Sensitivity and specificity of LIPS assay vs. RIPA for GADA and IA 2A.. ......... 118 4 4 Detection of PAA in human sera by LI PS assay ................................ ............... 119 4 5 Antigenic specificity of PAA using luciferase only control. ............................... 120 4 6 Antigenic specificity of PAA by competit ion with purified rP dx1 protein ........... 121 5 1 PAA detec ted in human T1D patient sera ................................ ........................ 125 5 2 PAA detected in human autoimmune disease and cancer patient sera. .......... 126

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy E XPLORING MOLECULAR MECHANISMS OF LIVER TO PANCREATIC BETA CELL REPROGRAMMING By William LePage Donelan August 2012 Chair: LiJun Yang Major: Medical Sciences Molecular Cell Biology Ectopic expression of pancreatic transcription factors (PTFs) reprograms hepatic cells toward pancreatic beta cells. However, molecular mechanisms underlying this process have not been well studied, particularly regarding suppression of the hepat ic phenotype. To study the mechanisms involved in hepatic to pancreatic beta cell reprogramming, we generated lentiviral vectors expressing PTFs (Pdx1, Pdx1 VP16, and Ngn3), transduced hepatocellular carcinoma Huh7 cells, and examined the early effects on expression of key pancreatic and hepatic genes. We demonstrated that P dx1 not only activates beta cell specific genes but also suppresses the key hepatic transcription factor HNF1 alpha and hepatic functional gene ALB by RT PCR and western blotting. L uciferase reporter assays further confirmed Pdx1 mediated suppression of HN F1 alpha in hepatic cells HNF1 alpha suppression may be, in part, due to up regulation of HNF4 alpha P2 isoforms, which was also observed following ectopic Pdx1 expression because these isoforms are weaker than P1 driven isoforms and they may compete for b inding the HNF1 alpha proximal promoter. We also cloned a 3kb proximal HNF1 alpha promoter element into the pGL3 luciferase reporter to further study its regulation We found that NK6 homeodomain 1 (Nkx 6.1) binds to a c is

PAGE 11

11 regulatory element in the HNF 1 alpha promoter and is a major regulator of this gene in b eta cells. We identified an Nkx 6.1 recognition sequence in the distal region of the HNF 1 alpha promoter and demo nstrated specific binding of Nkx 6.1 in beta cells by EMSAs and ChIP assays. Site direc ted mutagen esis of the Nkx 6.1 core binding sequence eliminates Nkx 6.1 mediated activation and substantial ly decreases activity of the HNF 1 alpha promoter in beta cells. Over expression or siRNA mediated knockdown of Nkx6.1 gene expression results in increa sed or diminish ed HNF 1 alpha gene expression, respectively, in b eta cells. We conclude that Nkx6.1 is a novel regulator of HNF 1 alpha in pancreatic beta cells. develope d a sensiti ve, specific, and non radioactive liquid phase luciferase immunopre cipitation systems (LIPS) assay for detection of PAA W e screened sera from patients with type 1 diabetes, systemic lupus erythematosus, rheumatoid arthritis, and various forms of cancer ( including pancreatic cancer) and detected positive PAA sera from all groups.

PAGE 12

12 CHAPTER 1 LITERATURE REVIEW Type 1 Diabetes Introduction Autoimmune (type 1) diabetes is a disease in which the immune system targets and destroys the insulin producing beta cells within the pancreatic islets of Langerhans resulting in the inability to produce sufficient insulin in response to elevated glucose levels 1, 2 Insulin replacement is the most widely used therapy f or controlling blood glucose concentration to prevent acute disease. Although this therapy provides short term benefit to patients with type 1 diabetes, euglycemia is extremely difficult to maintain. The serious acute complications of hypoglycemia, such as diabetic coma, and the difficulty of maintaining euglycemia lead type 1 diabetic patients to frequently have blood glucose levels that are elevated from the physiological norm. Unfortunately, long term hyperglycemia can damage the integrity of the vasc ulature and is commonly associated with disease of the heart, kidneys, and retinas, and extremities. Tissue Pathology and Cellular Pathology Type 1 diabetes is an autoimmune disease characterized by the immunological destruction of beta cells within the pa ncreatic islets of Langerhans 1 Islets are clusters of endocrine cells consisting of insulin secreting beta cells, glucagon secreting alpha cells, somatostatin secreting delta cells, pancreatic peptide secreting PP cells, and ghrelin producing epsilon cells. Beta cells account for about 70% of cells within the islet and are responsible for synthesizing and releasing insulin in order to maintain physiological blood glucose concentration. Insulin release allows for the cellular uptake and utili zation of glucose for energy. Clinical diagnosis of type 1 diabetes usually occurs after 80% 90% of pancreatic beta cell mass has been destroyed 3 At this time,

PAGE 13

13 remaining beta cells often have enlarged nuclei and degranulated cytoplasm and isle ts become abnormally small due to the destruction of the majority of their cells 1 The mechanism by which beta cell destruction occurs is through autoimmune attack 1 This autoimmunity is associated with a chronic inflammatory inf iltrate known as insulitis consisting primarily of CD8+ T lymphocytes, although CD4+ T lymphocytes, B lymphocytes, macrophages, and natural killer cells are also involved in the response. The T cell mediated destruction of beta cells is due to autoreactiv e T cells for specific beta cell proteins including insulin, glutamic acid decarboxylase (GAD), insulinoma 2 associated protein (IA 2), and zinc transporter 8 protein (ZnT8) 4 6 Autoantibodies can serve as an early indicator for increased susceptibility to type 1 diabetes because they are present in 70% 80% of newly diagnosed patients as opposed to their presence in only 0.5% of the general population 1 Molecular Pathology Genes provide both susceptibility and protection for type 1 diabetes 1 3, 5 The greatest contributing genetic component is the major histocompatibility complex (MHC), located on hu man chromosome 6. The region containing the highly polymorphic human leukocyte antigen (HLA) genes has been determined to have the greatest influence on disease susceptibility. There are three classes of HLA genes differing in their function. HLA class I molecules form dimeric proteins composed of alpha chains in association with 2 microglobulin. These molecules are present on the surface of all nucleated cells and platelets and their function is to present antigenic peptide fragments to T cell recepto rs on CD8+ T lymphocytes. The HLA class II molecules consist of three subclasses (HLA DR, HLA DQ, and HLA DP) and are also dimeric proteins composed of alpha and beta chains. They are constitutively expressed in antigen presenting

PAGE 14

14 dendritic cells and B l ymphocytes while expression can be induced in macrophages and endothelial cells. These molecules contain a binding site for peptide fragments of antigens and present these antigenic peptides to T cell receptors on CD4+ T lymphocytes. The HLA class III m olecules form a variety of structures with many differing functions ; examples include complement components, tumor necrosis factor, and heat shock protein Hsp70 Although the functions of HLA genes are well characterized, their specific contribution to disease pathogenesis is poorly understood 3, 5 It is obvious that the structural differences between suscepti ve and protective HLA proteins will functionally affect their interaction with antigens and autoreactive T lymphocytes. Several hypot hesized mechanisms have been proposed. It is possible that defective HLA molecules bind to beta cell specific antigens in the periphery and induce an autoreactive T cell response. Another explanation is that unstable HLA/self antigen complexes in the thy mus fail to induce self tolerance and release auto reactive T cells to the periphery. Yet a third hypothesis is that defective HLA molecules alter T cell activity by their interactions with T cell receptors and modulate their phenotype from regulatory to inflammatory. Susceptibility: Genetic and Environmental It is clear that there are both environmental and genetic components related to type 1 diabetes susceptibility 3 This is evident from its familial occurrence ; however, it does not follow a M e ndelian pattern of inheritance, likely because it is a multifactorial disease. In the United States there is increased lifetime susceptibility for first degree relatives of diabetics when compared to members of the general population (5% vs. 0.3%). Twin studies also demonstrate a higher concordance rate for monozygotic twins

PAGE 15

15 when compared to dizygotic twins (30 50% vs. 6 10%) 3 Although there is a clear genetic relationship to type 1 diabetes susceptibility, the concordance rate for identical twi ns is very low relative to other genetic diseases Nutrition, viral infections, exposure to toxins, vaccinations, climate, and stress are all commonly implicated in the manifestation of the disease ; however, extensive research has been unable to determin e that any environmental factor actually causes the disease 2, 3, 5 It is therefore likely that genetic susceptibility for type 1 diabetes is inherited and that environmental factors influence or modify its development. Therapy and Treatment Currently, insulin replacement therapy is required to maintain euglycemia and to prevent serious acute disease. Unfortunately, this therapy is incapable of maintaining the equivalent stringent control of blood glucose levels provided by healthy beta cells. Without proper blood glucose regulation, several complications due to vascu lature degradation can occur. New therapies for the treatment or cure of type 1 diabetes must focus on two elements: beta cell replacement and recurrent autoimmunity 2, 7 Transplantation therapies are an option, but donor organs are difficult to acquire and require the use of long term immunosuppression in order to prevent allograft rejection and recurrent autoimmune destruction 2 In addition, average transplantation fails after five years. Islet transplantation is perhaps a safer treatment option, but requires several donor pancreata for each patient 8 10 In vitro differentiation of beta cells, however, could theoretically supply an indefinite source of islet tissue 8 Gene therapy for the generation of beta cells ( or insulin producing beta like cells ) may provide a source of cells for transplantation or a method of in vivo beta cell reprogramming 11 Many studies 12 28 have demonstrated that beta like cell differentiation

PAGE 16

16 is inducible by modulating external conditions or delivering pancreatic transcriptional factors. Exposing beta cell precursors to a high glucose environment alone has the ability to shift the cells towards a beta cell gene expression profile 22, 25 It is also clear, from reprogramming studies, that various transcriptional factors exhibit a primary role in the induction of beta cell like differentiation and insulin gene regulation, m ost importantly the pancreatic and duodenal homeobox gene 1 (Pdx1). Depending on the conditions and transcriptional factors used, beta cell precursors can differentiate into glucose responsive insulin producing cells that are morphologically indistinguish able from true beta cells. Several sources for cells have been successfully utilized including hepatic cells, 12 21, 23 28 bone marrow cells, 22 and pancreatic exocrine cells 29 Transp lantation of beta like cells into chemically induced diabetic mice has been shown to restore euglycemia 12 14, 17, 19, 20 22 25, 27, 28 Several methods have been employed in successful gene therapy including direct protein delivery, lentiviral mediated delivery, and protein transduction technology. Protein transduction technology is of specific interest due to its rela tive safety and efficacy of transduction 30 36 Some of the transcriptional factors involved in beta cell like differentiation (Pdx1 31, 35, 36 and NeuroD 3 0, 32 ) contain protein transduction domains (PTDs) which are specific amino acid sequences, enriched with positively charged arginine and lysine residues, allowing for their transduction across cellular membranes by lipid raft mediated macropinocytosis. Molecules can also be engineered to utilize the same mechanism by addition of a PTD, as has been done for TAT mediated Ngn3 37 Following beta cell transplantation or regeneration requires either long term immunosuppression or an immune system modulation to elimi nate the possibility of

PAGE 17

17 recurrent autoimmunity. Studies have been focusing on modulation of the T cell repertoire toward a regulatory status with the goal of establishing a T cell profile that consists of a majority of regulatory cells in order to establ ish long term tolerance 7, 38 Diabetic Complications The majority of the morbidity and mortality associated with type 1 diabetes is due to complications arising from poor glycemic control 39 In theory, mai ntaining euglycemia would effectively eliminate the complications related to diabetes, but this is nearly impossible to achieve. Hypoglycemia results in serious acute disease that can quickly lead to diabetic coma and possible death. Recurrent or long la sting episodes of hypoglycemia can lead to cognitive impairment and predisposes individuals to future hypoglycemic occurrences. The fear of hypoglycemia often leads patients to maintain hyperglycemia because the short term problems are much less severe. However, long term hyperglycemia leads to several complications as the result of microvascular and macrovascular disorders including nephropathy, retinopathy, neuropathy, and cardiovascular disease 39 Vascular dysfunction plays a major role in the aforementioned complications related to long term hyperglycemia. The damage to endothelial tissue results in organ and tissue failure. Hyperglycemia leads to the accumulation of reactive oxygen species such as superoxide, hydrogen peroxide, and hypochlorous acid and also reactive nitrogen species such as nitric oxide 40 The reactive oxygen species initiate lipid pe roxidation leading to inflammation. The increase in oxidative stress is due to advanced glycation end product accumulation which activates vascular NADPH oxidase. Mitochondrial uncoupling and activation of poly ADP ribose polymerase also plays a role res ulting in endothelial damage.

PAGE 18

18 Endothelial progenitor cells play a major role in protecting the integrity of the vasculature system as well as promoting angiogenesis 41 They are derived from the bone marrow and can be mobilized through release of growth factors and cytokines to sites of ischemia and endothelial injury. At the site of injury endothelial progenitor cells adhere to the vessel walls where they begin to migrate through the extracellular matrix. Their expansion leads to the formation of new vasculatu re structures. Most type 1 diabetic patients have decreased levels of circulating endothelial progenitor cells and increased dysfunction of these cells. The accumulation of vascular ischemic sites prevents adequate blood supply to several tissues and can lead to organ failures and critical limb ischemia requiring amputation. MODY Monogenetic diabetes accounts for 1 2% of all diabetes cases and because it is caused by mutation in a single gene, it can be diagnosed by genetic testing 42 45 Maturity onset diabetes of the young (MODY) is caused by autosomal dominant mutation in one of at least six beta cell specific genes incl uding the enzyme glucokinase NeuroD1 that result in diabetes are respectively termed MODY1 6 46 49 MODY2 is characterized by hyperglycemia onset at birth that does not progress with age and is most often controlled by diet. MODY2 patients rarely develop complications due t o hyperglycemia. MODY3 is the most prominent form of MODY and accounts for about 70% of the disease. MODY1 is less common, accounting for about 5% of MODY but has similar disease progression as MODY3. These forms are characterized by adolescent onset of hyperglycemia that progressively worsens with age and most often

PAGE 19

19 requires pharmacological treatment. Patients with MODY1 or MODY3 often suffer from is an important develo pmental transcription factor, MODY4 is characterized by a wide range of developmental pathologies that affect several systems and accounts for about 2% of MODY. The other transcription factor forms of MODY have only been found in a few families and accoun t for less than 2% of MODY. In general, they progress similarly to MODY1 and MODY3 but they are too rare to be well characterized. In more than 10% of patients who are considered to have MODY, the cause is unknown and suggests that other genes or unknown regulatory elements for the known MODY genes are likely to contribute to disease. The group comprising unknown MODY may also be higher than estimated due to misdiagnosis of type 1 or type 2 diabetes in these patients 50 52 Defining the etiology of MODY is essential for proper pharmacogenetic treatment of the disease 42 45 MO DY1 and MODY3 genes regulate the expression of a plethora of genes involved in glucose stimulated insulin secretion 48 mainly result in defective glucose metabolism and insulin secretion in the beta cell 48 For this reason, it is not surprising that MODY1 and MODY3 patients respond well to treatment with oral sulfonylureas given that these drugs bind the K ATP channel which is do wnstream of glucose metabolism in the insulin secretion pathway 44 Sulfonylurea therapy can cl ose the K ATP channel which increases intracellular Ca 2+ and stimulates insulin secretion by an ATP independent pathway. MODY1 and MODY 3 patients, who are initially misdiagnosed with type 1 or type 2 diabetes, have successfully transferred to sulfonylurea treatment without deterioration in glycemic control 50, 53, 54 Sulfonylurea

PAGE 20

20 treatment often leads to better glycemic control than insulin especially for children and adolescents. Sulfonylurea therapy has been shown to be ineffective in treating other forms of MODY 42 45 Sulfonylurea treatment reduces the serious risk of hypoglycemia compared to insulin t reatment and patients who have switched from insulin to sulfonylurea report a great increase in their quality of life 44 However, current treatments for MODY3 are not sufficient because patients with MODY3 have hyperglycemia that often worsens with time and up to 40% require the use of insulin 46 Long term hyperglycemia in this disease can lead to the full scale of diabetic complications especially neuropathy and retinopathy 46 Transcription Factors DNA binding proteins have long been studied for their important roles in a variety of cellular processes including transcription 55 (For Review s regarding transcription see Refs 56 59 ). Trans cription factors play a crucial role during development and tissue differentiation 21, 60 63 and their role in the reprogramming of mature adult tissues into alternative tissue lineages has become an important topic of study in the field of regenerative medicine 64 66 Several transcription factors have been discovered that act as master switch genes and regulate a cascade of downstream gene expression leading to cellular differentiation, s uch as MyoD 67 for muscle cell differentiation and Pdx1 21, 60, 61 for pancreatic beta cells. Induced expression of MyoD alone in many differentiated cell types including primary fibroblasts, melanoma, ad ipocytes, and hepatocytes induces expression of muscle cell markers and adoption of the muscle cell phenotype 67 More recently, it has been found that transcription factors can lead to the reprogramming of both mouse 68 70 and human 71 73 fibroblasts into induced pluri potent cells that closely resemble embryonic stem cells with the capacity to differentiate into all

PAGE 21

21 three germ layers. Transdifferentiation of cells occurs by shifting their gene expression and phenotype from one differentiated cell type to another 64 66 (Note: Originally, transdifferentiation was defined as direct conversion of o ne cell type to another without acquiring an intermediate state, whereas reprogramming required cellular dedifferentiation before converting to another cell type. H owever, current literature often uses these terms synonymously.) Transcription factors maintain cellular phenotype by working with epigenetic modulators 74 77 and by regulating cell specific gene expression 21 and are involved in many diseases including MODY 42 45 Pdx1 Pancreatic and duodenal homeobox 1 (Pdx1) also known as STF1, IDX1, IUF1, and IPF1, is a transcription factor necessary for pancreatic development and beta cell maturation 78 The Pdx1 gene 79 has been cloned independently by several labs 80 82 and in humans, encodes a 283 amino acid protein that is part of the ParaHox gene cluster 83 Pdx1 expression is first detected in the primitive foregut endoderm as the ventral and dorsal pancreatic buds develop 84, 85 which later merge to form the pancreas. Pdx1 expression later shifts to the endocrine compartment as islets form and the exocrine cells begin to appe ar in the pancreas. Later in development, Pdx1 becomes mostly restricted to the mature beta cells, with limited expression in other endocrine cells 80 82, 84 Homozygous mutations to the Pdx1 gene in mice lead to pancreatic agenesis 85, 86 (while all other internal organs appear normal including the gastrointestinal tract) leading to death shortly after birth 86 No pancreatic tissue or insulin gene expression was detected in these neonates. It has also been reported that a human with a homozygous inactivating mutation to the Pdx1 gene was born without a pancreas 87

PAGE 22

22 Regulation of the Pdx1 gene has been well characterized by several reports ; 88 99 89 91, 94, 99 90 MafA 98 Pax6 94 NeuroD 95 Nkx2.2 97 USF 96 and Pdx1 90 itself. Pdx1 is also positively regulated by nutritional and ho rmonal factors such as glucose, GLP 1, insulin, T 3 HB EGF, and TNF 88 Pdx1 is involved in the expression of many genes (including insulin 82 somatostatin 80 Glut2 100 islet amyloid peptide 101 and glucokinase 102 ) and is considered the master transcriptional regulator of pancreatic beta cells 103 Pdx1 also inhibits expression of glucagon 104 Ectopic expression of Pdx1 has been shown to induce hepatic dedifferentiation by suppressing the expression of CCAAT/enhancer binding protein beta (CEBP ) 105 Pdx1 contain s an intrinsic protein transduction domain (PTD ) which is a specific amino acid sequence enriched with positively charged arginine and lysine residues, allowing for transduction across cellular membranes by lipid raft mediated macropinocytosis 31, 35, 36 It is also interesting to note that Pdx1 has been previously implicated in immune modulation by preventing development of hyperglyc emia in non obese diabetic (NOD) mice following intraperitoneal injection of Pdx1 protein 17 Ngn3 Neurogenin 3 (Ngn3) also known as Atoh5, bHLHa7, and Math4B, is expressed by all pancreatic endocrine cell precursors and regulates islet formation 106 It peaks in expression during endocrine cell development and is only detectable at low levels in adult pancreas. Ngn3 has bee n cloned and encodes a 214 amino protein that is a member of a family of basic helix loop helix transcription factors 107 Mice with homozygous mutations to the Ngn3 gene fail to develop endocrine cells or precursors and die from diabetes shortly after birth 106 Over expression of Ngn3 also leads to a

PAGE 23

23 reduced endocrine mass 108 demonstrating the importance of strin gent regulation of this gene during development Ngn3 is positively regulated by HNF 1 109 HNF 3 109 and HNF 6 110 while Hes 1 represses Ngn3 expression through the Notch signaling pathway by binding to silencing elements in its proximal pro moter 109 Ngn3 is involved in the expression of many endocrine genes 111, 112 and is a direct regulator of NeuroD 113 and Pax4 114 Nkx6.1 NK6 homeobox 1 ( Nkx6.1 ), also known as NKX6A, is a homeodomain transcription factor involved in pancreatic differentiation and beta cell homeostasis 115 It has been cloned and enco des a 367 amino acid protein 116 In the mature human islet, it is exclusively expressed in the beta cell 117 and is required for normal glucose stimulated insulin secretion 118 Embryonic expression of Nkx6.1 is dependent on Nkx2.2 119, 120 and in the mature beta cell it is regulated by Pdx1 120 Nkx6.1 maintains beta cell phenotype in part by direct interaction with the glucagon promoter suppressing its activity 118, 121 Nkx6.1 inhibits glucagon expression by competing with Pax6 (glucagon activator) for occupancy of the G1 element on the glucagon promoter. Nk x6.1 has also been linked to beta cell proliferation by up regulating cyclins A, B, and E as well as many regulatory kinases 122 Over expression of Nk x6.1 has been shown to increase glucose stimulated insulin secretion in rat islets while in human islets it caused beta cell replication and maintained normal glucose stimulated insulin secretion 122 Nkx6.1 homeodomain constructs have been shown to bind sequences containing the core homeodomain binding site (5' TAAT 3' or 5' ATTA 3') and direct both gene repression and gene activation 123, 124 In its own promoter, it has been shown to bind a similar sequence (5' ATTT 3') to positively regulate its own expression 125 Nkx6.1 has the ability to function

PAGE 24

24 as both a transcriptional activator and repressor which may be sequence dependent 125 The transcriptional repression domain has been isolated to the N terminus 124 while the tr anscriptional activation domain has been shown to be dependent on the C terminus 125 The C terminus has also been observed to interfere with DNA binding but greatly enhance specificity for homeodomain core containing sequences 126 It is also of interest that type 2 diabetic islets have been shown to have altered Nkx6.1 expression 127 The specific function of Nkx6.1 in glucose stimulated insulin secretion of the mature beta cell remains elusive. B1, TCF1, APF, and HP1) is an important gene involved in the pancreat ic beta cell transcriptional regulatory network 128 It is also involved in the regulation of important beta cell specific genes such as Pdx1, 90 IGF 1, 129 and insulin 130 Loss of function mutations 131, 132 in of monogenic diabetes in humans 46, 47, 49, 133, 134 MODY3 is characterized by impaired beta cell function caused by defective insulin secretion in response to glucose stimulation. While clinical presentation of the disease is often mild, hyperglycemia worsens with time and up to 40% of patients require treatment with insulin. Long term hyperglycemia can lead to the full range of diabetic complications, especially an incomplete dominant manner, disease occurs with the loss of function of a single allele. The haploinsufficiency of this gene demonstrates the critical importance of gene dosage to maintain normal beta cell function. Abnormal regulation of gene transcription to a defective insulin secretory pathway, loss of beta cell mass, or both.

PAGE 25

25 Therefore, precise regulation of this gene is necessary to prevent a prominent form of diabetes. exocr ine and endocrine cells and all islet cells of the murine pancreas 135, 136 (For bri ef 13 7, 138 ). The rat species 139 141 12q24.3 and 5F respectively 139, 141 Human and r at nucleotide sequences show an overall 94% homology in coding regions and overall amino acid homology of 95% 139, 140 Rat and mouse amino acid sequence homology was found to be 99% 141 There is even considerable homology within the intronic gene sequences, especially in the flanking regions of exons, betw een species 139 141 This demonstrates high conservation of g enomic structure and suggests that this protein acts in a very specific manner and contains critical structures required for natural function. The DNA sequence consists of a long open reading frame of 1884 bp and the sequence surrounding the first ATG cod GGAGCC ATG G consensus sequence 142 A / G CC ATG 143 There is also a TATA like box ( GATAAATA 144 with very close homology to the TATA box co nsensus sequence 145 TATA A / T AA A / G 144, 146 148 and this complex has been crystallized 149 One study 150 using a 497 bp proximal that this reporter was activate in hepatocytes, but not in rat insulinoma (INS1) cells.

PAGE 26

26 The rat and mouse gene both contain 9 exons and 8 introns and the rat full length coding region is less than 40kb 140 The full length cDNA encodes a 628 amino acid 88kd dimeric protein and was first cloned from rat liver 142 dim ers in the presence or absence of DNA 151, 152 The N terminus contains a DNA binding site that is structurally, though distantly related to the homeobox domain 142, 151 (See Refs 153 155 for comprehensive reviews regarding the homeodomain and Ref 153 an additional 21 amino acid sequence loop connecting helix 2 and helix 3 with 100% homology between mouse and rat 141 The protein also shares some similarity to the POU family of transcriptional activators 156, 157 GTTAATNATTAAC 137 on 158 Three separat e isoforms have been identified ( ) by real time PCR and no evidence for additional transcripts was found 159 The different isoforms are generated through differential selection of polyadenylation and alternative splicing 159 The fact that distributed differently between tissues and during different time points in development suggests that they may control gene expression in a temporal and tissue specific manner 159 The alternate isoform ratios may also contribut e to differential gene regulation between cell types. Alternative splicing of transcripts increases versatility of function and several documented proteins act as activators and repressors from the same gene 160

PAGE 27

27 Electron mobility shift assays (EMSA) demonstrate that the dimerize and bind DNA with similar affinity 159 Transient CAT transfection assays in n have a five fold 159 It is noteworthy that did not suggesting that this coactivator was not a limiting step in this experimental procedure. A few studies demonstrate the biochemical characterization of the full length 152, 161 The DNA binding domain is a tripartite homeodomain composed of 81 amino acids and contains an N terminal helix similar to part of m y osin 152 The N terminal 31 amino acids mediate dimerization with these helical regions essential for DNA binding 152 The A domain (amino acids 1 33) is responsible for DNA binding which can be abolished by subs titutions 152 The B domain (amino acids 100 184) shows weak similarity to the subregion of A of th e POU domain 157 and is important for efficient DNA binding. (See Refs 157, 162, 163 for brief reviews or Ref 164 for a comprehensive review of the POU homeodomain). Mutations in the POU binding 152 The highly divergent homeodomain is located in domain C (amino acids 198 281), and substitutions here can lead to loss of binding activity, ev en when using conserved substitutions 152 The c terminal 150 amino acids are rich in serine and th reonine 159 and deletion of the c terminus porti on DNA binding 142, 152 networks 128 (See Ref 58 for review of tissue specific gene regulation). It is involved in

PAGE 28

28 the development of the pancreas and critical for insulin and glucose regulation in the adult 46, 49, 165 There are several excellent reviews and studies that document these transcriptional regulatory networks in liver 128, 163, 166 and pancreas 60, 128, 167, 168 tissue distribution is predominantly endodermal 141, 156 In the mouse 141 transcripts have been found in the liver, kidney, stomach, and intestine, but not in the ovary, brain, heart, or lung. In rats 156 transcripts have been found in t he liver 142 kidney, and at low level in the intestine, spleen and thymus, but not in the skin, lung, hea rt, or 159 liver 159, 169 intestine 159 thymus 159 adult and fetal pancreas 169 and isolated islets 169 but at almost null levels in skeletal muscle 169 and visce ral adipose 169 examined mRNAs in certain fetal and adult human tissue cell lines by a semi quantitative RT PCR method did not attempt to quantify absolute amounts of each mRNA but rather compared the ratios between each isoform at the RNA level 159 tios in a variety of cell lines. Pancreas was not examined in this study. The RNAse protection method was not sensitive PCR another g roup 169 the kidney and liver and all tissues examined (fetal liver was not examined). A

PAGE 29

29 determined in skeletal muscle or visceral adipose as expected. It is interesting to note 60, 61 The role of miRNA in post translational gene regulation has been shown to be highly important in the regulation of gene expression. Traditionally, miRNA has been shown to be a translational repressor but in some cases it can function to increase gene expression 170 (See Ref 171 for a review of miRNA function). During intestinal epithelial differentiation in Caco miR 194 2 172, 173 of miRNAs, and provide greater u nderstanding of gene regulation in beta cells. null pups display no obvious phenotypic abnormalities required for embryonic development 174 in dedifferentiated hepatoma cell lines and hepatic extinguishing somatic hybrids 156, 175 178 developing murine pancreas 135 its transcriptional activation becomes dependent only in terminally differentiated cells 167 This may be due to the reciprocal expression of a that share dimerization domains and homeodomains, but not activation domains 179, 180 prominent in differentiated cells 156, 175 178, 180 182

PAGE 30

30 heterodimers in vitro 18 0, 183 obvious abnormalities during embryonic development but following birth they fail to thrive and suffer from a progressive wasting syndrome 174 These mutant mice suffer from hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome 174 expression is important for beta cell function and maintaining glucose homeo stasis. glucose tolerance without loss of beta cell mass 184 Genes involved in beta ce ll 185 Decreased steady state mRNA levels were observed for genes encoding glucose transporter 2 (Glut2), neutral and basic amino acid transporter, liver pyruvate kinase (L Pk), and insulin NeuroD 185 loxP recombination system develop Laron dwarfism and non insulin dependent diabetes 186 ous and fasting hyperglycemia leading to the development of diabetes 174, 184 186 dependent operon speci fically in beta cells demonstrates that over expression also leads to a diabetic phenotype 187 ression compromises islet morphology and reduces beta cell mass. These mice show a threefold reduction in beta cells and many appear scattered near ductal structures. Over expression also

PAGE 31

31 suppresses beta cell cycle activity and induces cell death. Ki67 staining shows that expression of cell cycle inhibitor p27. Apoptosis is induced in a significant density of r expression causes hyperglycemia at birth that progressively worsens with age. Other studies in mice show MODY3 like phenotype 188, 189 collectrin which facilitates S NARE complex formation and controls insulin exocytosis 190, 191 Studies in INS1 insulinoma cells over expressing a dominant negative mutant under control of a reverse tetracycline dependent transactivator ( or ) ll homeostasis 192 negative over expressing cells activated caspase 3 leading to apoptosi s. Apoptosis was accompanied by mitochondrial hyperpolarization, decreased expression of anti apoptotic Bcl xL, and mitochondrial release of cytochrome c and caspase 9. Apoptosis could be rescued with transient over expression of Bcl xL. Another study u sing the same dominant negative conditions showed pronounced decrease in insulin expression and other genes involved in glucose stimulated insulin secretion 193 Other interes ting studies in INS 1 insulinoma P291fsinC, with the most common MODY3 mutation, under control of the reverse tetracycline dependent transactivator 129, 194 This forces the

PAGE 32

32 e xpression of several genes important for beta cell function. Insulin secretory responses to glucose were also impaired in these cells. chromatin structure and alters gene expression 75 In the liver, the phenylalanine hydroxylase (PAH) gene is activated prenatal and is regulated by several transcription livers 75, 174 Hepatic PAH expression could not be induce d by traditional activation enhancing hormones in these mice. Liver specific DNase I hypersensitivity sites of the was also associated with chromatin structure and gene expression of alpha 1 antitrypsin (AAT) and corticosteroid binding globulin (CBG) in hepatocytes 76 nucleosomal hyperacetylation in a tissue specific manner 74 and L type pyruvate kinase (pklr) in both pancreatic islets and liver cells of norm al mice. expression is maintained in liver cells. These expression patterns correlate directly with hyperacetylation of GLUT2 and pklr promoter nucleosomes in pancrea tic insulin producing cells, but not in liver cells. Studies in dedifferentiated M29 cells show that 195 These studies

PAGE 33

33 epigenetic modification and that its cellular concentration may determine chromatin architecture. a t ranscriptional network that regulates cell type specific global gene expression and maintains normal cellular phenotype and function. Liver and pancreas share common embryonic lineage 196 and both are derived from the same endoderm tissue mass 61 63 They also share expression of several HNF transcription factors 60, 128, 163, 166 168, 197 G / A GTTA A / C TNNT C / T NNC A / C 177 One st target genes by computer assisted analysis and subsequent binding assays 198 In a genome scale promoter analysis in human liver and pancreatic islets 128 found to occupy the p romoters of at least 222 genes in liver and 106 in pancreas analyzed on a micro array of 13,000 genes (Hu13K array). The targeted promoter regions span 700 to +200 from the transcription start site, where most identified transcription factor binding site occur. Analysis of distal promoters would likely reveal individual ChIP experiments and stringent threshold criteria to have a high accuracy. es encode important biochemical proteins related to normal cellular function as well as important transcriptional regulators of gene expression. Transient transfection assays in HepG2 cells have demonstrated that an indirect negative autoregulatory feedba regulation 146

PAGE 34

34 dependent genes 146 by a direct interaction with the AF 199, 200 also known as PHS or PCD is an 11kDa homotetrameric protein (45kDA) that selectively stabilizes mers and enhances transcriptional activity 201 204 The cDNAs from human, mouse, and rat encode a 104 amino acid protein 204 but transcriptional modification has been demonstrated in the liver of humans and rats 205 DCoH binds as a dimmer to the helical dimerization domain of di 206 It has been purified from human and displays identical protein primary structures to rat 205 Its crystal structure has been determined alone 202, 206 206, 20 7 leading to the biochemical characterization of some MODY3 mutations 207 Interestingly, mice that are DCoH null display mild glu cose intolerance, but do not develop diabetes 208 were reduced. It was also ob served that low levels of a second DCoH related gene (DCoH2) may have had a complementing activity. The crystal structure of DCoH2 has been determined and biochemical studies have found it to be partially redundant in enzymatic and transcriptional function s 209 GLUT2 promoter in HIT T15 cells 210 Coimmunoprecipitation assays demonstrate that histone acet yltransferases (HATs), CREB binding protein (CPB), p300/CPB associated factor (P/CAF0 ) Src 77 CBP was shown to

PAGE 35

35 interact with the N terminal region and P/CAF, Src 1, and RAC3 interacted with the C terminal activation domain. The diverse functions of these coactivators suggest that ptional machinery recruitment. All of the aforementioned coactivators have been shown to acetylate surrounding nucleosomes allowing greater access for other transcription factors to their promoters. (For excellent reviews regarding transcriptional regul ation by nucleosomal histone acetylation see Refs 211, 212 ). Increased transcriptional activat ion fold above basal levels and co transfection with CBP, P/CAF, Src 1, and RAC3 expression vec tors increased activation by 20 fold, 44 fold, 26 fold, and 19 fold respectively. 1, and RAC3 increased activation respectively by 135 fold, 121 fold, and 89 Src 1 a nd RAC3 increased activation 132 fold and 152 fold respectively. The dramatic increase in activation after coactivator recruitment is clearly a synergistic reaction. The a coactivator for transcription 199 for cell specific regulation of gene expression and that these factors can positively regul 128, 134, 167, 168, 213, 214 the pancreas in mice 136 and in murine beta cells it is essential for the regulation of gene expression and for glucose metabolism 215 218 liver nuclear extra cts 219 and has been well characterized structurally and functionally by

PAGE 36

36 several reports 149, 167, 1 99, 219 237 The A/B region contains an AF 1 strong terminal transactivation domain. The DNA binding region is in the C domain and the E region contains a ligand binding domain, dimerization domain, and AF 2 transactivation domain. The F region is va riable and some isoforms contain a coactivator recruiting 219 and binds DNA as a homodiomer 220 238 while th e mouse gene contains only 10 exons 235 The 1365 base pair open reading frame of huma different structural regions 219 Almost half of protein coding genes function by use of alternative promoters and the functional consequences of alternat ive promoter use in mammalian genomes have been reviewed 239 promoter usage and alternative transcript splicing 238 and they c an be organized into two 3) contain exon 1A with the strong AF 1 activation domain whereas isoforms generated from the P2 9) contain exon 1D, or exon 1D and 1E, and lack t his activation 6 223 isoforms may be unreliable and these isoforms are unlikely to exist as suggested by more recent reports 150, 224, 240 The two promoters are separated by approximately 46 kilobases 236 Both the P1 and 167, 221, 236 and the P2 promoter also contains Pdx1 236 and HNF6 221, 236 (also known as OC 2) binding sites. Similar to mice 167, 222 229, 236, 240, 241 is driven predominantly from the P2 promot er producing 9 isoforms (and potentially

PAGE 37

37 12 238 ) in similar concentrations as demonstrated by RT PCR analysis of transcripts. Liver expression is predominantly driven by the P1 promoter 229, 236, 240, 241 In concordance wit h these findings, murine nucleosomal histones of the P2 region are hyperacetylated in pancreatic islets; P1 regions are hyperacetylated in liver 167 Another predominant transcripts in human beta cells 2 24 but also found very low levels of 6. It was previously shown 224, 229 232 To generalize the expression o in hepatocytes is most prominently expressed through the P1 promoter while in beta cell s most reports pts cannot be detected 238 Primarily P2 isoforms have been detected in adult beta cell s, and they have been associated with reduced transcriptiona l activation potential when compared to P1 isoforms 224, 229, 232 10 amino acid sequence in the F domain. Studies show deletion of the F domain 229, 242 and the 10 amino acid insert can help to abrogate this inhibitory effect 233, 234 The inhibitory effect caused by the F domain has been localized to a 14 amino acid residue (428 441) that is sufficient to repress activity of the AF 2 activ ation domain 230 however, 10 fold decreases were found in the pancreas 167 167 establishing a different

PAGE 38

38 regulatory network than in hepatocyt es 128, 166, 213 repress P2 activity in transfection a ssays in rodent liver 221 only knock in mice were generated to examine the in vivo role of the AF 1 activation domain 222 Both mouse types show no obvious phenotypic abnormalities although HN total knockouts which are embryonic lethal 243, 244 and also demonstrates the embryonic functional redundancy of the two isoforms. own transcription and that it can also repress the 146, 200 200 thereby functioning as both an activator and a repressor to regulate gene expression. HNF Regulatory Circuit HNF transcription factors are part of a complex regulatory circuit that is known to maintain hepatocyte phenotype 163 and maintain insulin secretion in response to glucose stimulation in the beta cell 134, 167, 168 In 245, 246 regulate each other as a feedback loop 166 A genome scale promoter analysis 128 in human liver and pancreatic islets using a micro array of 13,000 genes (Hu13K array) ccupied the promoters of at least 1575 genes in hepatocyte s and 1428 in pancreatic islet s, least 222 genes in hepatocyte s and 106 in the pancreatic islet s Promoter occupancy of ase II for 80% of hepatic genes and 73% of islet genes

PAGE 39

39 2% of islet genes, suggests that a large number of genes are actively transcribed by

PAGE 40

40 CHAPTER 2 PDX1 MEDIATED SUPPRESSION OF HNF1 DURING REPROGRAMMING OF HUMAN HEPATIC CELLS TOWARDS PANCREATIC BETA CELLS Introduction Reprogramming of hepatocytes into pancreatic beta cell like insulin producing cells (IPCs) by ectopic expression of pancreatic transcripti on factors (PTFs) has been well established through detailed in vitro characterization of pancreatic beta cell gene expression 12, 15, 16, 18, 19, 23 25, 27, 28 and in vivo restoration of normoglycemia in chemically induced diabetic mice 12, 13, 17, 19, 20, 23 25, 27, 28 This has significant clinical implications due to its therapeutic implication for type 1 diabetes (T1D). Transdifferentiation studies aimed at the treatment of T1D have mainly focused on using the liver 12, 13, 15 20, 23 25, 27, 28 as a tissue source due to its tissue abundance and high regenerative capacity 247 common developmental kinship with the pancreas 196 and the glucose sensing system shared by hepatocytes and pancreatic beta cells 248, 249 Since the liver and pancreas share a remarkably similar gene expression profile, including the expression of many specific tran scription factors 128, 245 and both tissues are responsive to glucose 248, 249 hepatocytes are an excellent target for reprogramming into pancreatic beta like IPCs. Although much attention has been given to understanding how to activate genes related to pancreatic beta cell development, understanding of the molecular mechanisms involved in shutting down the hepatocyte phenotype during PTF mediated hepatocyte to beta like IPC conversion remains quite limited 64 66 Hepatocytes make up 70 80% of the mass of the liver and perform an astonishing number of metabolic, endocrine, and secretory functions 63, 250 The liver plays a major role in metabolism, glycogen storage, plasma protein synthesis, hormone production, and detoxification. Ectopic expression of Pdx1 triggers hepatocyte

PAGE 41

41 dedifferentiation by down regulating several liver specific functional genes including albumin (ALB), alcohol dehydrogenase phosphatase (G6PC), 1 antitrypsin (AAT), and hexokinase 2 (Hxk 2) 105, 251 However, the molecular links between Pdx1 over expression and down regulation of th ese hepatic genes are not entirely understood. Several transcription factors are necessary for the differentiation and maintenance of hepatocyte phenotype 128, 163, 166, 252, 253 In particular, h epatocyte nuclear factor 1 alpha (HNF1 ) and 4 alpha (HNF4 ) are important liver enriched transcription factors that play an important role in establishment and maintenance of the hepatocyte phenotype 128, 185, 245 downstream target genes in both hepatocytes and beta cells 128 and the regulatio n of specific isoforms and levels of expression by alternative splicing differ significantly between hepatocytes and beta cells 128, 240, 245 A developmental switch in the relative een the fetal and adult pancreas 169, 240 ontains two promoters (P1 and P2) that drive the expression of P1 3) or P2 derived 9) by alternative splicing and alternate usage of the promoters 236 The different promoters are used in different tissues and at different times during isoforms are exclusively detected in adult pancreatic islets 236, 240, 241 isoforms are present in developing human fetal pancreas 240 In contrast, P1 derived isoforms are most abundant in adult hepatic tissues with relatively low levels of P2 isoforms 222, 240, 241 Due to the tissue

PAGE 42

42 transactivation capacities than P1 isoforms 224, 229, 232 Pdx1, which is not normally to the P2 promoter 236 i soforms following ectopic expression of Pdx1 may be responsible for hepatic cell dedifferentiation and transdifferentiation toward pancreatic beta cells. Here, we tested mediated hepatic dedifferentiation. In this study, we constructed lentiviral vectors to deliver PTFs into human hepatocellular carcinoma cells (Huh7 cell line), examined early molecular events related to the activation of pancreatic endocrine genes and suppression of hepatic genes, and ve inhibition. This work provides some insights into the mechanism of reprogramming from hepatocytes into pancreatic beta like IPCs. Understanding the molecular events during cell type conversion may help to elucidate the mechanisms underlying tissue reg eneration and plasticity. Materials and Methods Cell Lines and Cell Culture H uman hepatocellular carcinoma cell line Huh7, 3T3 mouse fibroblast cells, and 293 human embryonic kidney cells were purchased from ATCC and were cultured in DMEM supplemented with 10% FBS and 1% Penicillin/Streptomycin in a 37C incubator

PAGE 43

43 with 100% humidity and 5% CO 2 Rat insulinoma (INS 1) cells were cultured in RMPI 1640 supplemented with 200mM L glutamine, 100mM sodium pyruvate, 2 mercaptoethanol, and 1% Penicillin/Streptomyci n in the same incubator. Construction of Plasmids The human Pdx1 expression plasmid (pCMV6 XL5) was purchased from Origene. The mouse Pdx1 expression plasmid was constructed by insertion of mouse Pdx1 cDNA into the BamHI/XbaI sites of the pCDNA3 vector (I nvitrogen). The truncated mouse Pdx1 expression vectors were constructed as previously described 254 The Sport6) was purchased from Open Biosystems. expression plasmids code for proteins lacking the 41 amino acids from the extended exon 8). The pRL TK expression vector was purchased from Promega. The mouse 255 The rat insulin I promoter (RIP) luciferase reporter was constructed by removing the TK promoter from the pRL TK plasmid and cloning the RIP promoter into this site using the BglII/HindIII restriction sites. The Pax4, NeuroD, Ngn3, and Nkx2.2 luciferase reporters (pFOXluc) were generous gifts from Michael German, the University of California, San Francisco, CA Lentiviral Vector (LV) Preparation, Titration, and Transduction The RIP driving the green f luorescence protein ( RIP GFP ) reporter was constructed as previously described 12 The LV containing the mouse Pdx1 VP16 (PV)

PAGE 44

44 fusion gene was constructed as previously published 12, 22 The LV containing rhGFP and mouse Pdx1 were constructed as previously described 24 The LV containing mouse Ngn3 was constructed by inserting the cDNA of mouse Ngn3 into the pTYF vector cassette under the control of elongation factor 1 alpha (EF were generated and titrated as previously described 256 258 For lentiviral transduction, Huh7 cells were transduced with different LVs as indicated at a multiplicity of infection (MOI) of 10 in th efficiency was monitored by transducing Huh7 cells with LV encoding rhGFP. The insulin 1 promoter activities in Huh7 cells were detected by observing RIP GFP expression under a fluorescence m icroscope. RT PCR and Real Time RT PCR Analysis Total RNA was extracted from Huh7 cells transduced with different combinations of transcription factors or from human islets (generous gift from Dr. Xiaoping Deng at The University of Pennsylvania) using Triz Gene expression was detected by RT PCR. The forward and reverse PCR primers were designed (IDT Technologies) to be located in different exons. Amplification was performed for 35 cycles at 94C for 30s, 56C f or 30s, and 72C for 30s, and followed by 72C for 7 min. The PCR products were separated in 2% agarose gels by electrophoresis in TAE buffer. Digital images were captured and analyzed with a Qua n tity O ne Imager (BioRad). All of the PCR products were co nfirmed by Big Dye DNA sequence analysis in an ABI 377 sequencer (Global Medical Instrumentation, Inc.) PCR was performed on selected samples, collected as described above, using SYBR Green PCR Master Mi x (Applied

PAGE 45

45 terminal modifications by detecting exon 9, exon9+, or exon 8+. Primer sequences are available upon request. Western Blotting and Immunocytochemistry (ICC) Huh7 cell lysates were harvested at day 4 post LV Pdx1, LV PV, LV Ngn3, or LV GFP treatment. The cellular proteins were quantified and standardized. Pdx1, PV, alpha 1 anti trypsin to our previously published methods 12, 24 In brief, cellular proteins were separated by SDS PAGE using 12% Tris HCl gels ( Bio Rad) and transferred to the filter membrane. Proteins were blotted with rabbit anti anti VP16 (1:200, BD Pharmagen), anti ALB (1:200, Santa Cruz), and anti AAT (1:200, Sant a Cruz) followed by HRP conjugated secondary antibody (1:20 000). All proteins were visualized by enhanced chemiluminescence (ECL) using a western blotting detection kit (Amersham Bioscience). For ICC, cytospin slides were prepared from Huh7 cells and Ng n3 protein was detected by rabbit anti serum against mouse Ngn3 (a generous gift from Michael S. German, University of California, San Francisco) at a dilution of 1:3000 according to our previously published methods 12, 24 Transfections and Luciferase Assay Cells were plated in 12 well plates and transfected with 0.1 DNA (as indicated) using Lipofectamine 2000 Reagent (Invitrogen) according to Luc plasmid was used as a transfection efficiency control in all experiments. Cell lysates were harvested and measured 24 hours post transfection using the Dual Luciferase Reporter Kit (Promega) according to

PAGE 46

46 only 50l of each substrate reagent was used (as optimized by our lab) to read samples using a Lumat LB 9507 Luminometer (Berthold Technologies). All luciferase assays were done in duplicate or triplicate as indicated. All results are expressed as fold/c ontrol using pcDNA3 null expression vector following standardization by TK Luc for transfection efficiency. Statistical Analysis The statistical significance of our experimental findings was analyzed by using test (2 tailed, assuming equal vari ance). P values represent comparison to controls unless otherwise indicated. = p<0.05 and ** = p<0.001 Results Pdx1 VP16 (PV) and Ngn3 Together Strongly I n duced Insulin P romoter A ctivity We first assessed if our LVs designed to express PTFs were functional. We confirmed the transgene expressions of Pdx1, PV, and Ngn3 at the mRNA level by RT PCR (Fig. 2 1 ) and protein levels by western blotting for Pdx1 and PV (Fig. 2 2 ) and ICC for Ngn3 (Fig. 2 3 ). In order to monitor the activation of the insulin gene during the reprogramming process from hepatic cells toward pancreatic beta like IPCs, we constructed and produced LV RIP GFP as a reporter for monitoring RIP activity. The transduction efficiency of Huh7 cells was determined by LV GFP and more than 99% of transduced Huh7 cell expressing GFP was observed at day 2 (data not shown). RIP GFP was co transduced in to Huh7 cells with Pdx1, PV, Ngn3, or with combinations of Pdx1 /Ngn3 or PV/Ngn3 as indicated. At 96 hours of transduction, the expression of GFP was examin ed ( Fig. 2 4 ). Green fluorescence was observ ed in rare Huh7 cells transduced with single gene Pdx1, PV, or Ngn3, therefore Pdx1, PV, or Ngn3 alone cannot effectiv ely activate the insulin promoter RIP GFP at day 4 post transduction.

PAGE 47

47 Green fluorescence was observed in nearly 50% of Huh7 cells transduced with Pdx1/Ngn3 and in more than 90% of Huh7 cells transduced with PV/Ngn3, indicating a synergistic effect of Ngn3 and Pdx1 in activating RIP GFP. This result is consistent with previous studies demonstrating that the insulin promoter can be more effectively activated by PV, a super active form of Pdx1 12, 16 To further compare the effect of Pdx1 and PV, we consecutively observed GFP expression at 48, 72, a nd 96 hours after Huh7 cells were transduced with Pdx1/Ngn3 or PV/Ngn3 (Fig. 2 5 ) The results show that PV is much more effective than Pdx1 to activate RIP GFP. Green fluorescence was observed in 50% of Huh7 cells transduced with PV/Ngn3 at day 2 compar ed with only 2% of cells treated with Pdx1/Ngn3. Pdx1 and Ngn3 Induced Expression of Genes Related to Endocrine P ancreas Given the limitations imposed by the chromatin structure on endogenous genes, we next asked whether the activation of the RIP GFP repor ter might be applicable to the endogenous human insulin gene. As shown in Fig. 2 5 although transduction of PV/Ngn3 led to activation of the ectopic promoter RIP GFP reporter as early as 24 hours, the activation of the endogenous human insulin gene could only be detected at 96 hours by RT PCR (Fig. 2 6 ). Notably, the absolute level of activation of the human insulin gene in the cells still remains low, implying that limitations may be due to the inaccessible chromatin structure of the endogenous gene. To investigate the gene expression profile of Huh7 cells with different treatment after 96 hours, cellular RNA samples were collected and RT PCR analysis was performed (Fig. 2 6 and 2 7 ). We screened several endocrine pancreas functional genes and found t hat endogenous expression of Pdx1 and Nkx6.1 could be activated by all treatments. Cells treated with Ngn3, Pdx1/Ngn3, and PV/Ngn3 activated NeuroD,

PAGE 48

48 Pax4, and Isl 1 genes which are involved in pancreatic endocrine and beta cell development, and this is co nsistent with previous findings that NeuroD 113 and Pax4 114 are direct targets of Ngn3 112 All treatments using Ngn3 activated insulin gene expression. PV, not Pdx1, alone or combined with Ngn3 induced expression of somatostat in (SS) Pancreatic type glucokinase (P GK) was only expressed in cells transduced with Pdx1/Ngn3 or PV/Ngn3. No glucagon (GLUC) was detected in any sample s. Huh7 cells did have basal expression of Pax6, GLUT M). Huh7 cells regulated observed in cells with over expressi on of Pdx1 or PV. Quantitative Analysis of PTF Promoter A ctivities Using the dual luciferase assay we quantitatively analyzed the promoter activity of PTFs in the Huh7 cells undergoing reprogramming. Huh7 cells were treated with LVs carrying Pdx1, PV, Ng n3, Pdx1/Ngn3 or PV/Ngn3 for 72 hours and then transfected separately with PTF luciferase reporter plasmids (Pax4, NeuroD, INS1, Ngn3, or Nkx2.2). The relative luciferase activities are shown in Fig. 2 (8 12) Consistent with published data and our own g ene expression results, Ngn3 alone can directly activate Pax4, NeuroD, INS1, and Nkx2.2 genes, and suppress its own activation. Ngn3 combined with Pdx1 or PV did not show a synergistic effect on the Ngn3 mediated activation of Pax4, NeuroD, and Nkx2.2 gen es, but showed a significantly synergistic activation of INS1 (6 fold in Pdx1/Ngn3, and 16 fold in PV/Ngn3). In addition, Pdx1, but not PV, could effectively activate Pax4, Nkx2.2, and Ngn3 promoter reporters, indicating

PAGE 49

49 that PV, the super active form of Pdx1, has no activation effect in this experimental setting. Pdx1 S in Hepatic C ells Previous studies have shown that several hepatic genes are down regulated following over expression of Pdx1 in hepatic cells 105, 251 In our current study, we have shown a down in Huh7 cells following treatment with Pdx1 or PV by RT PCR (Fig. 2 7 ). To confirm this finding, proteins of cell lysates harvested from day 4 LV Pdx1 or LV GFP treated Huh7 cells were separated by SDS/PAGE and probed by western blotting using antibodi es against down treated Huh7 cells (Fig. 2 13 ). This prompted us to evaluate the effect of Pdx1 on the expression of luciferase reporter and various concentrations of human Pdx1 or mouse Pdx1 expression plasmid as promoter activity in a concentration dependent manner (Fig. 2 14 ). With 0.8ug Pdx1 fact that C terminal truncated Pdx1 constructs did not show any inhibitory activity (Fig. 2 15 ). Pdx1 I Transcripts in Hepatic C ells 147 complex gene regulated by two distinct promoters (P1 and P2) and alternative

PAGE 50

50 splicing 232, 236 238 that shows tissue specific expression 222, 240, 241 In the adult human adult human pancreas and islets, P2 driven isoforms are predominant 222, 240, 241 I n binding site in the P2 proximal promoter 236 To test our hypothesis, we performed real time RT PCR in Huh7 cells following treatment with LV PV to examine the effects on 9) isoform expression. As expected, we observed a pronounced i 2 16 ). 2 16 ). Pdx1 soforms S Via a Competitive I nhibition transactivators of their target genes 224, 229, 232 We therefore investigated the 1 and P2 promoters in Huh7, INS luciferase reporter (Fig. 2 17 ). In all of their corresponding (same c terminal modification) P2 drive n isoforms. However, 1 cells. In 1 cells, the strongest activators are the isoforms containing the trun cated C terminal end To further investigate the mechanism by which Pdx1 influences down regulation of

PAGE 51

51 transcription factors related to our system (data n ot shown). We first demonstrated that luciferase reporter (Fig. 2 18 ). We then demonstrate that Pdx1 can then suppress this activation i n a concentration dependent manner (Fig. 2 18 promoter, we hypothesized that it may function indirectly by altering the regulation of its isoforms, we set up a competition assay in 3T3 cells to examine the effect of expressing 2 19 luciferase nd then examined the effect of the same C terminal modification). As expected and similar to the effect of Pdx1, luciferase r eporter in a concentration expressed Pdx1 in hepatic cells enhances the expression of H that are able to compete with P1 driven isoforms for the same binding site on the contributes to the early events of dedifferentiation of hepatic phenoty pe during liver to beta cell reprogramming. Discussion In the present study, we have established an effective model by LV expression of Pdx1, PV, Ngn3, and combinations of Pdx1/Ngn3 or PV/Ngn3 in Huh7 cells in which to study the early events of hepatic gen e down regulation and pancreatic gene up

PAGE 52

52 regulation during the process of Pdx1 mediated hepatic reprogramming into beta like IPCs. We have demonstrated that coexpression of Ngn3 with Pdx1 is important for the activation of several endocrine pancreas genes such as Pax4, NeuroD, Isl 1, and Nkx2.2. We also examined the role of a Pdx1 fusion protein (PV) that is known to strongly activate insulin gene expression and increase the efficiency of hepatic to pancreatic reprogramming 12, 16, 23 Previous studies have shown that this modified form of Pdx1 carrying the VP16 transcriptional activation domain from the herpes simplex virus more efficiently induces insulin gene expression in the human HepG2 cell line and the rat WB cell line 12, 16 but whether this attribute was a general characteristic of other PTF genes or limited only to insulin gene was not explored. Our results show that insulin promoter a ctivity was about 3 fold higher in cells treated with PV/Ngn3 than in those treated with Pdx1/Ngn3. However, the Pdx1 modified with VP16 showed lower activation on Pax4, Ngn3, and Nkx2.2 promoters when compared to Pdx1 alone. Therefore, the addition of V P16 restricts Pdx1 transactivation in some contexts, suggesting the mechanism of activation of insulin by Pdx1 may be different from activation of the Pax4, Ngn3, and Nkx2.2 genes. The liver is largely composed of hepatocytes, which occupy 70 80% of parenc hymal liver volume in the rat 63, 250 Hepatocytes carry out the primary functions of the liver such as m etabolism, detoxification, and protein synthesis of several essential compounds including serum ALB, fibrinogen, and transferrin. It has been suggested that the dominant mechanism for controlling the expression of hepatocyte specific genes is at the trans criptional level 259 however, the molecular mechanism by which Pdx1 regulates the expression of these hepatic genes is not well established. Using our

PAGE 53

53 reprogramming model, we have demonstrated that over expression of Pdx1 can down t genes (ALB and AAT) in hepatic cells by RT wide array of hepatic genes 128, 252 it may play a fundamental role in the process of dedifferentiation of hepatocyte phenotype during the reprogramming toward IPCs. Our findings are consistent w ith a previous study 105 where adenovirus mediated expression of Pdx1 led to down regulation of several mature hepatocyte specific genes including ALB ADH1B, G6PC, GLUL, and AAT. Several key hepatic genes are direct fibrinogen, transthyretin, and pyruvate kinase 260 266 Therefore, Pdx1 induced down ssion can affect these downstream target genes and may be important in the process of dedifferentiation of hepatic cells by down regulating the expression of an array of genes that determine hepatocyte phenotype. Our results also suggest that the mechanis m for down http://www.sladeklab.ucr.edu/HNF4.shtml). We demonstrated that spe isoforms function differently in hepatocytes and in beta cells (Fig. 2 17 ). In hepatic terminal modification that results from using different promoters (P1 vs. P2). HNF4 that are expressed using the P1 promoter contain exon 1A and are the strongest activators in hepatic cells. The C terminal modifications that result from alternative ur

PAGE 54

54 experimental setting. In pancreatic beta cells the C terminal modifications appear to 2 17 ). P1 driven isoforms are still stronger activators in beta cells when compared to their corresponding P2 driven isoforms (with similar C terminal ends) but having the truncated C terminal end that stops in exon 8 increases the activity independent of the first exon. The isoform driven than specific function. According to our real time RT PCR data (Fig. 2 16 that are stronger transcriptional activators containing exon 1A (AF 1 activation domain) or n exon regulated. Exons 9 and 10 comprise the inhibitory F domain which inhibits transactivation potential by blocking coactivator binding 234 requires stronger activators (P1 driven) than in beta cells which predominantly rely on P2 driven isoforms and this may be due to cell specific mechanisms for regulating this gene. For example, the PTF Nkx6.1, which is expressed in beta cells but not in hepatocytes 14 inding to its distal promoter 255 We also show evidence (Fig. 2 19 ) that promoter specific isoforms can compete with each other for activation of their target genes. It is possible that induced expression of

PAGE 55

55 process of hepatocyte toward IPCs, as the opposite has been shown during rodent liver development 221 These findings are similar t 246 Taken together, we propose the following molecular mechanism that may be in part responsible for Pdx1 me diated dedifferentiation of hepatocyte phenotype in transition toward pancreatic beta like IPCs (Fig. 2 20 P1 its downstream target genes and maintains hepatic phenotype. Following ectopic regulation of isoforms for the same DNA binding site P2 isoforms, may be a driving force in the dedifferentiation of the hepatic phenotype by suppressing downstream target gene s.

PAGE 56

56 Figure 2 1. Confirmation of LV PTF gene expression by RT PCR. Total RNA was collected from Huh7 cells following transduction with expression vectors for Pdx1, PV Ngn3, or combinations as indicated. Indicated gene expression was measured by RT PCR.

PAGE 57

57 Figure 2 2. Confirmation of LV PTF gene expression by western blotting. Huh7 cells were transduced with expression vectors for Pdx1, PV Ngn3, or combinations as indicated. Following transduction, Huh7 cells were scraped off and lysed in RIPA buffer. Equal amount s of cell lysates were separated on 12% polyacrylamide gels by SDS PAGE and immunoblotted with polyclonal antibody against Pdx1 or PV as indicated. INS 1 cell lysates were used as a positive control for Pdx1

PAGE 58

58 Figure 2 3. Confirmation of LV PTF gene expression by immunocytochemistry. Huh7 cells were transduced with expression vectors for Pdx1, PV Ngn3, or combinations as indicated. Following transduction, cytospin slides made from Huh7 cells were air dried, fixed an d stained with Anti Ngn3 antibod ies using ICC

PAGE 59

59 Figure 2 4. A ctivation of rat insulin I gene in Huh7 cells with Pdx1, PV, Ngn3 and combinations. Huh7 cells were transduced with RIP GFP reporter and Pdx1, PV Ngn3, or combinations as indicated for 96 h. The expression of GFP was observed under a fluorescence microscop e

PAGE 60

60 Figure 2 5. Time course a ctivation of rat insulin I gene in Huh7 cells with Pdx1/Ngn3 or PV/Ngn3 Huh7 cells were transduced with LV Pdx1/Ngn3 or LV PV/Ngn3 in LVs in the presence of LV RIP GFP reporter The expression of GFP at 48h, 72h, and 96h was recorded by fluorescence microscopy.

PAGE 61

61 Figure 2 6. RT PCR analysis of pancreatic gene expression. Huh7 cells were treated with LV transgenes ( Pdx1, PV Ngn3, or combinations as indicated ) for 96h. Equal amounts of total RNA/ cDNA sample were used for RT PCR analysis with gene specific primers.

PAGE 62

62 Figure 2 7. RT PCR analysis of liver specific gene expression. Huh7 cells were treated with LV transgenes ( Pdx1, PV Ngn3, or combinations as indicated ) for 96h. Equal amounts of total RNA/ cDNA sample were used for RT PCR analysis with gene specific primers.

PAGE 63

63 Figure 2 8. Pax4 l uciferase reporter gene analysis during reprogramming. Relative activity was measured for the Pax4 luciferase reporter following Huh7 cell transduction with LVs for Pdx1 PV Ngn3, or combinations as indicated for 72h. Huh7 cells transduced with LV GFP were used as a control. All experiments were done in triplicate and repeated independently at least three times. All p values are compared to non treated controls. ** = p<0.001

PAGE 64

64 Figure 2 9. NeuroD l uciferase reporter gene analysis during reprogramming. Relative activit y was measured for the NeuroD luciferase reporter following Huh7 cell transduction with LVs for Pdx1 PV Ngn3, or combinations as indicated for 72h. Huh7 cells transduced with LV GFP were used as a control. All experiments were done in triplicate and re peated independently at least three times. All p values are compared to non treated controls. ** = p<0.001

PAGE 65

65 Figure 2 10. INS1 l uciferase reporter gene analysis during reprogramming. Relative activity was measured for the INS1 luciferase reporter following Huh7 cell transduction with LVs for Pdx1 PV Ngn3, or combinations as indicated for 72h. Huh7 cells transduced with LV GFP were used as a control. All experiments were done in triplicate and repeated independently at least three times. All p values are compared to non treated controls. ** = p<0.001

PAGE 66

66 Figure 2 11. Ngn3 l uciferase reporter gene analysis during reprogramming. Relative activit y was measured for the Ngn3 luciferase reporter following Huh7 cell transduction with LVs for Pdx1 PV Ngn3, or combinations as indicated for 72h. Huh7 cells transduced with LV GFP were used as a control. All experiments were done in triplicate and repe ated independently at least three times. All p values are compared to non treated controls. ** = p<0.001

PAGE 67

67 Figure 2 12. Nkx2.2 l uciferase reporter gene analysis during reprogramming. Relative activity was measured for the Nkx2.2 luciferase reporte r following Huh7 cell transduction with LVs for Pdx1 PV Ngn3, or combinations as indicated for 72h. Huh7 cells transduced with LV GFP were used as a control. All experiments were done in triplicate and repeated independently at least three times. All p values are compared to non treated controls. ** = p<0.001

PAGE 68

68 Figure 2 13. Down regulation of and ATT in Huh7 cells over expressing Pdx1 by western blotting Huh7 cells were transduced with or without LV Pdx1 or LV rhGFP for 96h. Following transduction, Huh7 cells were lysed in RIPA buffer. Equal amount of cell lysate s were separated on 12% SDS polyacrylamide gels and immunoblotted with antibod ies against Pdx1, ALB ATT, or a ctin.

PAGE 69

69 Figure 2 14. Down regulation of luciferase reporter in Huh7 cells over expressing Pdx1. Huh7 cells were transfected with 1.0g of luciferase reporter plasmid and 0.2 0.8g Pdx1 expression plasmid as indicated pcDNA3 was used as a DNA quantity control. All values are signi ficant (p<0.05) compared to mock transfection controls.

PAGE 70

70 Figure 2 15. Down regulation of by full length Pdx1. Huh7 cells were transfected with 1.0g of luciferase reporter plasmid and 0.8g of each Pdx1 truncated (120, 160, or 200 ami no acids) or full length (283 amino acids) plasmid with pcDNA3 as a DNA quantity control. ** = p<0.001

PAGE 71

71 Figure 2 16. Pdx1 increases P2 transcripts that compete with P1 transcripts. Total RNA was collected from Huh7 cells following transduction with LV PV or control ( LV GFP ). Indicated gene expression was measured by real time RT PCR. Primers were designed to detect expression from the P1 promoter (Exon 1A) or the P2 promoter (Exon 1D) as well as the three C terminal modifications. This experiment was done in triplicate and repeated independently at least 3 times.

PAGE 72

72 Figure 2 17. Cell luc. Relative act ivity was measured for the mouse luciferase reporter (1g /well) following transduction of various isoforms (1g /well) in Huh7, INS 1, and 293 cells. Activity was normalized in each cell type to the pcDNA3 empty vector control. This experiment was done in triplicate and repeated independently at least 3 times. All values are significant (p<0.05) compared to mock transfection controls.

PAGE 73

73 Figure 2 18. Down regulation of luc iferase reporter by Pdx1 in 3T3 cells. Relative activity w as measured for the mouse luc iferase reporter (1g /well) following transduction of and Pdx1 alone, and in combination. + indicates 1 g/well and the concentration gradient shows three concentrations (0.1, 0.5 and 1.0 g) per well. All activation and suppression values are significant (p<0.05) except for activation by Pdx1 alone. Experiments were done in triplicate and repeated independently at least three times.

PAGE 74

74 Figure 2 19. Down regulation of luc iferase reporter by in 3T3 cells. Relative activity was measured for the mouse luciferase reporter (1 g/well) following transduction of and alone, and in combination. + indicates 1 g/well and the concentration gradient shows three concentrations ( 0.1, 0.5, and 1.0 g)/well. All activation and suppression Experiments were done in triplicate and repeated independently at least three times.

PAGE 75

75 Figure 2 20. A proposed mechanism of Pdx1 medi ated hepatocyte toward IPC reprogramming This cartoon depicts our proposed molecular mechanism for Pdx1 mediated down regulation of during hepatocyte to IPC reprogramming. The left side shows the molecular events involved in normal hepatocytes and the right side shows how these molecular events may be altered following ectopic expression of Pdx1 (based on our cumulative data). The HN and genes and promoters are shown in order to understand how their relationship and downstream gene targeting is affected by the expression of Pdx1 during reprogramming from hepatocytes toward IPCs. We propose that the competitive inhibition of HNF4a P1 isoforms, by P2 isoforms, suppresses and its downstream target gene expression and promotes hepatocyte dedifferentiation.

PAGE 76

76 CHAPTER 3 DISTINCT REGULATION OF HNF1 BY Nkx 6.1 IN PANCREATIC BETA CELLS Introduction Hepatic nuclear factor glucose stimulated insulin secretion (GSIS) and is the major factor involved in most cases of maturity onset diabetes of the young (MODY) which accounts for about 1% of worldwide diabetes cases 46, 49 to maintain normal beta cell function and both under expression and over expression have been shown to lead to diabetes 75, 174, 184 187, 192 of the liver, pancreas, kidneys, stomach, and intestines 138, 141, 156, 1 69, 267 This transcription factor is essential for control of mature cellular phenotype in these tissues. In pancreatic beta involved in glycolysis and glucose stimula ted insulin secretion such as insulin 130 Glut2 glucose transporter 210 pyruvate kinase 268 aldolase B 269 167 167 regulat ion in beta cells has not been studied in detail, and this gene is assumed to be regulated based on mechanistic studies from hepatocytes 245 be sufficient for its activation in hepatocytes 144, 147 but evidence exists to suggest that expressed as three isoforms (A, B, and C) that have tissue specific distribution ratios 169 This research was originally published in The Journal of Biological Chemistry. William Donelan, Vijay Koya, Shi Wu Li, and Li Jun Yang. Distinct Regulation of Hepatic Nuclear Factor 1 by NKX6.1 in Pancreatic Be ta Cells. The Journal of Biological Chemistry. 2010; Vol 285:12181 12189. the American Society for Biochemistry and Molecular Biology.

PAGE 77

77 pote 159 Second, the major regula predominantly expressed from the P1 promoter in hepatocytes, whereas in the pancreas only transcripts from the P2 promoter can be detected according to most reports 238, 240, 241 have a truncated N terminal region containing the transactivation domain and these isoforms have bee n shown to have lower transactivation potential when compared to isoforms expressed from the P1 promoter 224, 229, 232 the pancreas. Third, Huang et al 150 show that while a 497 bp pr luciferase reporter was shown to be activated in hepatocytes, it failed to be activated in site used for activation in hepatocytes. The aforementioned data may utilize a different mechanism for gene transcription in beta cells than previously identified for hepatocytes. NK6 homeodomain 1 (Nkx6.1) is a homeodomain transcription factor involved in pancreatic differentiation and beta cell ho meostasis 115 In mature human islets, it is exclusively expressed in beta cells 117 and is required for normal GSIS 118 Over expression of Nkx6.1 has been shown to increase GSIS in rat islets 122 It is also of interest that islets isolated from type 2 diabetic patients have altered Nkx6.1 expression 127 However, the specific function of Nk x6.1 in GSIS of mature beta cells remains elusive.

PAGE 78

78 gene expression exists in pancreatic beta cells. Here we report a novel finding that ssion in beta cells, which may provide insight into the understanding of the regulation of GSIS in beta cells. Materials and Methods Cell Culture and Huh7 human hepatocarcinoma cells were cultured in DMEM supplemented with 10% FBS, 1% Penicillin/Streptomycin, and 0.1% Kanamycin in a 37 incubator with 100% humidity and 5% CO 2 Plasmid Construction into the pGL3 vector (Promega) using the EcoRI and BglII restriction sites. pGL TK: The pGL TK expression vector was purchased from Promega. pcDNA3: The pcDNA3 vector was purchased from Invitrogen. CMV Pdx1: The human Pdx1 expression plasmid ( pCMV6 XL5 ) was purchased from Origene. Nkx6.1: The human Nkx6.1 expression plasmid (pBAT12) was a generous gift from Dr. Michael German from the University of California, San Francisco, CA. Ngn3: The mouse Ngn3 expression plasmid was a generous gift from Dr. Mark o Horb at the Institute de Recherches Cliniques de Montral, Montral, QC Canada. Mouse Ngn3 cDNA was cloned into the pcDNA3 vector using the BamHI restriction site. MafA: Human MafA cDNA was cloned into the pTYF lentiviral vector cassette under control of the elongation factor 1 alpha promoter using the BamHI and SpeI restriction sites. NeuroD1: Mouse NeuroD1 cDNA was cloned into the pcDNA3.1 CT GFP TOPO vector. Pax6: The xenopus Pax6 expression plasmid (a

PAGE 79

79 generous gift from Dr. Marko Horb) was derived by inserting Pax6 cDNA into the cDNA was cloned into the pCMV plasmid (pCMV Sport6) was purchased from Open Biosystems. Pbx1: Mouse Pbx1 was cloned into the pcDNA3 vector using the BamHI and XbaI restriction sites. Transient Transfection and Luciferase Assays Cells were cultured as previously indicated and transfected with 0.1 (as indicated) using Lipofectamine 2000 Reagent (Invitrogen) according to Luc plasmid wa s used as a transfection control in all experiments. Cell lysates were harvested and measured 24 hours post transfection using the Dual Luciferase Reporter Kit (Promega) according to protocol was used (as optimized by our lab) to read samples using a Lumat LB 9507 Luminometer (Berthold Technologies). All luciferase assays were done in triplicate. Site Directed Mutagenesis Primers were designed (IDT Technologies) to induce a block mutation of 4 6 base pairs as indicated at the core sequence inducing a restriction enzyme site for easy confirmation of mutation. Primer sequences are as follows: Nkx6.1, (F:5' GGACCTGTT CCTCGAGGAAATGTGACACTTTAC 3') and (R:5' GTAAAGTGTCACATTTCCTCGAG GAACAGGTCC 3') HN CTTGCA AGGCTGAAGTCCGGCCGTCAGTCCCTTCCT AAGCGCAC 3') and (F:5'

PAGE 80

80 GCTTAGGAAG GGACTGACGGCCGGACTTCAGCCTTGCAAGTGCAG 3'). Mutations were induced using PCR on relevant plasmid with Pfu polymerase enzyme. PCR products were incubated for 1 hour with DpnI (New England Biolabs) methylation sensitive restriction enzyme to remove template plasmid and transformed into competent E. coli. Positive colonies were inoculated in LB medium (MP Biomedicals) and plasmid was purified using a Qiagen plasmid purification maxi kit. Electrophoretic Mobility Shift Assay (EMSA ) Biotin labeled probes were designed (IDT Technologies) spanning the cis regulatory element identified. Sequences are as follows: (F:5' GAAGGATGGACCTGTTCCTAATGG AAATGTGACACTTTA 3') and (R:5' TAAA GTGTC ACATTTCCATTAGGAACAGGTCCATCCTTC 3'). Nuclear lysate from beta cell lines PER nuclear generous gift from Dr. Christopher Ne wgard at the Duke University Medical Center, Durham, NC. Anti Nkx6.1 polyclonal antibodies (Santa Cruz) were used. Binding reactions were performed using the LightShift Chemiluminescent EMSA Kit (Promega) according to manufacturer's protocol. Binding re actions were resolved by polyacrylamide gel electrophoresis using a 7.5% Tris HCl polyacrylamide gel (Biorad). Complexes were detected with the Chemiluminescent Nucleic Acid Detection Module (Pierce) according to manufacturer's protocol. Chromatin Immunop recipitation (ChIP) Assay ChIP assay was performed using the chromatin immunoprecipitation assay kit (Millipore) according to manufacturer's protocol. Beta cells cultured in 10cm culture dishes were used both with and without indicated transfection. Spec ific polyclonal

PAGE 81

81 Following DNA isolation, sequences were evaluated by PCR using primers (IDT Technologies) flanking respective cis regulatory elements as indicated. Amplificatio n primer sequences are as follows: Nkx6.1, (F:5' CCCATCCAGGATGAAGTGAG 3') and (R:5' GACAAGGAGTTCTGGGCTAG TCACTCCCAATTGCAAGCCATG 3') and (F:5' TGCTGCTCTGTTTACATTGG 3'). Gene Expression and Quantitative RT PCR Cells were cultured as previous ly indicated and transfected with DNA or siRNA (as indicated) using Lipofectamine 2000 Reagent (Invitrogen) according to protocol. Nkx6.1 specific siRNA and control siRNA was purchased from Santa Cruz. Total RNA was extracted from cells us ing Trizol Reagent (Invitrogen) and RT PCR and real time RT PCR were performed as previously described(38). All sequences of primer pairs are available upon request. Statistical Analysis Statistical analysis was carried out using the two sample Student's t test. A P value < 0.01 was considered significant. All indicated significant values are in comparison to controls. Results ells ocytes. Transcription is regulated through a TATA like box ( 21 to binding site ( 47) 144, 147, 148 binding site) is fully active in hepatocytes but not in rat insulinoma INS1 cells 150 providing evidence that its regulation may be controlled by alternative elements in other

PAGE 82

82 tissue types. To test this hypothesis, we have cloned a 2772 base pair (bp) region of am of the firefly luciferase gene in a pGL3 has full activity in both beta cells (Fig. 3 1) and hepatic cells (Fig. 3 2 ). We created tructs by 5' deletion analysis (Fig. 3 1 ) using cells is conferred through a more distal regulatory element ( 2772/ 1820). Loss of this regulatory region significantly dimi cells (Fig. 3 1 ) but not in hepatic cells (Fig. 3 2 ). NIH 3T3 cells serve as a control in regulatory region emplo C ells binding site (Fig. 3 6 ). As previously reported 144, 147, 148 transactivation in hepatic cells (Fig. 3 3 3 3 ). This demonstrates that beta cells are reg ulated by a separate response element that is different from hepatic cells. ctivated by Nkx6.1 2772/ 1820) that is beta cell specific, we were interested in discovering which factors regula te transcription at this site. Several beta cell specific transcription factors were screened (Pdx1, Ngn3, MafA,

PAGE 83

83 rase reporter (Fig. 3 4 144, 147, 148 and we have found that Nkx6.1 is also a strong activator. Nkx6.1 can ac 3 5 ) and is likely to be the regulator of the cis regulatory element that is unique to beta cells. Mutational A nalysis of HNF romoter The literature pertaining to Nkx6.1 binding suggests that the most common core DNA sequence utilized by Nkx6.1 for binding is: (5' TAAT 3')(49 54) or its compliment (5' ATTA 3') and it has also been shown to bind a similar sequence (5' ATTT 3')(55). transactivation in beta cells ( 2772/ 1820) and found there is a single (5' TAAT 3') DNA sequence in this entire region (Fig. 3 6 ). An alignment of this promoter region between mouse and rat shows a very high level of homology similar to alignment of the promoter region near 7 ). This prompted us to use site directed mutagenesis to induce a mutation (Fig. 3 6 ) at this potential Nkx6.1 binding site in order to examine the effect on transactivation by Nkx6.1. We also gene rated a double mutant Nkx6.1 binding site mutation cells (Fig. 3 8 ). Results were as still be activated by Nkx6.1. Similarly, the Nkx6.1 binding site mutant failed to respond

PAGE 84

84 Nkx6.1 binding site that is used for ini Beta C ells Since the Nkx6.1 binding site mutation was sufficient to prevent Nkx6.1 mediated beta cells. Transfection of the Nkx6.1 binding site mutant construct shows approxim 3 9 ). Four other random (5' TAAT 3') mutant constructs were generated and had no change in activity when compared to the normal promoter construct in similar assays (data not shown). Activity was not completely diminished in the Nkx6.1 binding site mutant construct suggesting that other beta cell specific This r cells. lement To further evaluate DNA promoter element ( 2772/ 1820) we designed biotin labeled oligonucleotide probes spanning the potential Nkx6.1 binding site (5' TAAT 3'). Using EMSA, we have demonstrated that Nkx6.1 protein from beta cell lysate can bind to our probe (Fig. 3 10 Lane 2). Addition of Nkx6.1 polyclona l antibody caused a disruption and supershift of the DNA protein band (Lane 3) confirming the protein is indeed Nkx6.1. Unlabeled cold probe is able to compete for binding Nkx6.1 (Lanes 4 & 5) while nonspecific probe is

PAGE 85

85 unable to compete (Lane 6). This r esult confirms that Nkx6.1 protein is capable of ells were grown normally ( ) or transfected with the Nkx6.1 expression plasmid (+). Following chromatin immunoprecipitation with Nkx6.1 polyclonal antibody, 3 11 ). The ted with the Nkx6.1 expression plasmid show an increase in the intensity of the band confirming Nkx6.1 binding at this site. Our cumulative data able to positively regulate its expression. assay (Fig. 3 12 n normally ( ) or transfected with the specific isoform) shows a weak amplification band indicating that the binding site may still have function to allow its detection. It may also b

PAGE 86

86 n Pancreatic Beta C ells mouse beta cell using (Fig. 3 13) and NIT (Fig. 3 14) cell lysate. Next, we confirmed that both beta cell lines expressed key important for maintaining beta cell function (Fig. 3 15 ). T o determine whether Nkx6.1 O ver expression of Nkx6.1 in n 3 fold over control ( Fig. 3 16 ), while Nkx6.1 specific siRNA knocked down endogenous expression of Fig. 3 17 ), providing further support that Nkx6.1 is a ntrol because it has been previously shown to be regulated by Nkx6.1 through distal promoter binding 122 ta cells. Discussion cells. Different from hepatocytes, we demonstrate that Nkx6.1 is a key regulator for cells. We by EMSA and ChIP assays. Furthermore, we also demonstrated that the endogenous best of pancreatic beta cells.

PAGE 87

87 Nkx6.1 is known to be involved in pancreatic differentiation and beta cell function 115, 117, 118 Embryonic expression of Nkx6.1 is dependent on Nkx2.2 119, 120 and in mature beta cells it is regulated by Pdx1 120 Nkx6.1 maintains beta cell phenotype in part by direct interaction with the glucagon promoter, suppressing its activity 118, 121 Nkx6.1 inhibits glucago n expression by competing with Pax6 (glucagon activator) for occupancy of the G1 element on the glucagon promoter. Nkx6.1 has also been linked to beta cell proliferation by up regulating cyclins A, B, and E as well as many regulatory kinases 122 Studies in knockout mice reveal that Nkx6.1 gene is required for beta cell development, terminal differentiation, and biological function 119 Over expression of Nkx6.1 has been shown to increase GSIS in rat islets 122 To address what happens to gene expression in beta cells when Nkx6.1 expression is altered, we performed functional studies in beta cell lines to show the effects of Nkx6.1 over expression (Fig. 3 16) and knockdown (F ig. 3 17 ). As expected, Nkx6.1 over expression l ed to an time PCR while Nkx6.1 knockdown by siRNA led to decreased expression. In addition, Uchizono et al. 2009 270 shows that mice leading to significant changes in blood glucose levels. The same paper, by exploring homozygous deficient mice, reveals decreased Nkx6.1 gene expression. It also shows chang es in expression of genes involved in beta cell growth and proliferation, providing cell functional studies using islets, Newgard's group has published a study 122 showing

PAGE 88

88 that over expression of Nkx6.1 increases GSIS in rat and human islets by inducing beta cell replication. In contrast, knockdown of Nkx6.1 in human islets leads to impaired GSIS 122 A recent report indicates that mutations affecting the expression of B lymphocyte kinase (BLK) gene was found to be responsible for some patients with MODY s ymptoms but without mutations in known MODY genes 271 BLK is a previously unidentified modulator of insulin synthesis and GSIS in beta cells by the mechanism of enhancing the expression of Nkx6.1, providing further evidence that Nkx6.1 may be a new candidate gene involved in MODY. Nkx6.1 homeodomain constructs have been shown to bind sequences containing the core homeodomain bindin g site (5' TAAT 3' or 5' ATTA 3') and direct both gene repression and gene activation 123, 124 In its own promoter, it has been shown to bind a similar sequence (5' ATTT 3') to positively regulate its own expression 125 Nkx6.1 h as the ability to function as both a transcriptional activator and repressor which may be sequence dependent 125 The transcriptional repression domain has been isolated to the N terminus 124 while the transcriptional activation domain has been shown to be dependent on the C terminus 125 The C terminus has also been observed to interfere with DNA binding but greatly enhance specificity for homeodomain core containing sequences 126 t alternative isoforms of 159, 169 Three separate isoforms confirmed by real time PCR and no evidence for additional forms was found 159 The

PAGE 89

89 different isoforms are generated through differential selection of polyadenylation and alternative splicing generat 159 nscription does not use an alternative promoter as demonstrated by 5' RACE analysis 159 The time points in development suggesting that they may control gene expression in a temporal and tissue specific manner. The alternate isoform ratios may also contribute to differential gene regulation between cell types. Alternative splicing of transcripts increases versatility of function of products and several documented proteins act as activators and repressors from the s ame gene 160 mice develop many symptoms of diabetes 186 knockout mice marked by hyperglycemia and impaired glucose tolerance without loss of beta cell mass 184 Genes involved in beta cell regulation and metabolism are expressed the islet enriched transcription facto 185 abnormal beta cell gene expression, impaired glucose tolerance, and fasting hyperglycemia leading to the development of diabetes 174, 184 186 Mice eng ineered to 187 marked by compromised islet morphology and expression 75

PAGE 90

90 MODY is a form of monogenetic diabetes caused by an autosomal dominant mutation in one of several genes. The most prominent form of this disease (>70%) is 42, 48, 50, 272 MODY3 is characterized by adolescent onset of hypergl ycemia that progressively worsens with a ge and most often requires pharmacological treatment. Patients with MODY3 often suffer from diabetic complications. Defining the etiology of MODY is essential for proper pharmacogenetic treatment of the disease 42 45 GSIS 48 and mutations mainly result in defective glucose metabolism and insulin secretion in beta cells 48 For this reason, it is not surprising that MODY3 patients respond well to treatment with oral sulfon ylureas given that these drugs bind the K ATP channel which is downstream of glucose metabolism in the insulin secretion pathway 44 Sulfonylurea therapy can close the K ATP channel which increases intracellular Ca 2+ and stimulates insulin secretion by an ATP independent pathway. Patients who are misdiagnosed with type 1 or type 2 diabetes have succes sfully transferred to sulfonylurea treatment without deterioration in glycemic control 50, 53, 54 Following etiologic identification of MODY3, patients have been transferred from insulin to oral sulfonylurea treatment and show improved glycemic control, reduced risks of hypoglycemia, and delay or prevention of diabetic complications 50, 53, 54 However, etiologic identification is essential to alter treatment in MODY patients because sulfonylureas are not effective f or all other forms of this disease 42 45 Current screening ximal promoter 43, 272

PAGE 91

91 In up to 20% of MODY patients, the etiology of the disease is unknown, making it very difficult to predict the clinical cour se of the disease or provide the most effective this regulatory system is unique to beta cells. Our work provides potential novel regulatory elements that should be include d when screening for mutations that effect pancreas 117 but not expressed in the liver 14 This novel regul atory network may provide potential new targets for diagnosis and MODY and possibly implicate a new gene (Nkx6.1) involved in this disease. Identification of novel molecular targets that cause MODY has the potential to greatly improve treatment and the qu ality of life for a great deal of diabetic patients.

PAGE 92

92 Figure 3 1. in 3T3 and (3T3 and were transfected full length constructs that were arbitrarily set to 1.0. For transactivation was set equal. Bracket indicates beta cell specific cis response element. S amples were measured 24 hours following transfection and experiments were repeated independently at least three times. (*** p<0.001 )

PAGE 93

93 Figure 3 2. Deletion analysis of in Huh7 cells. Huh7 c ells were as indicated. Luciferase values are relative to the full length constructs that were arbitrarily set to 1.0. S amples were meas ured 24 hours following transfection and experiments were repeated independently at least three times.

PAGE 94

94 Figure 3 3. and Huh7 (open box) and 1.0. S amples were measured 24 hours following transfection and experiments were repeated independe ntly at least three times.

PAGE 95

95 Figure 3 4. Full length ( cotransfected with various beta cell specific transcription factor expression S amples were measured 24 h ours following transfection and experiments were repeated inde pendently at least three times.

PAGE 96

96 Figure 3 5. Full length ( in 3T3 cells with increasing amounts of Nkx6.1 expression plasmid as indicated. pcDNA3 was used as a control to equalize DNA quantity used for each transfection. S amples were measured 24 hours following transfection and experiments were repeated indepen dently at least three times.

PAGE 97

97 Figure 3 6. sites are indicated in boxes on the promoter. Sequences below the shaded boxes show the induced mutations.

PAGE 98

98 Figure 3 7. omoter species alignment. Mouse and rat (GenBank accession #: upper alignment lower alignment ) binding sites are shown. Vertical lines indicate the close homology between species. The shaded boxes indicate core biding sequences.

PAGE 99

99 Figure 3 8. Normal ( top left panel ), top right panel ), mutant Nkx6.1 binding site ( bottom left panel ), or double mutant ( bot tom right panel mutation and open boxes indicate normal sequence. pcDNA3 was used as a control and the relative value obtained was arbitrarily set to 1.0. S amples were measured 24 hours following transfection and experiments were repeated independently at least three times.

PAGE 100

100 Figure 3 9. promoter in beta cells. 1.0. S amples we re measured 24 hours following transfection and experiments were repeated independently at least three times. (*** p<0.001 )

PAGE 101

101 Figure 3 10. INS1 cell lysate EMSAs were conducted with INS1 cell lysate an oligonucleotide (probe) as indicated. Arrows indicate Nkx6.1 binding and supershift. In competition assays, DNA binding reactions were preincubated with 10 fold (10x) or 100 on specific (NS) oligonucleotide as indicated.

PAGE 102

102 Figure 3 11. Nkx6.1 ChIP assay. Nkx6.1 binding experiments are shown with (+) or without ( ) Nkx6.1 over expression in cells Representative images are shown following agarose gel electrophoresis of PCR products. Quantification of bands was done with Microsoft Photoshop quantification tool.

PAGE 103

103 Figure 3 12. ChIP assay. without ( in cells Representative images are shown following agarose gel electrophoresis of PCR products. Quantification of bands was done with Microsoft Photoshop quantification tool.

PAGE 104

104 Figure 3 13. lysate. promoter oligonucleotide (probe) as indicated. Arrows indicate Nkx6.1 binding and supershift. In competition assays, DNA binding reactions were preincubated with 10 fold (10x) or 100 f oligonucleotide or non specific (NS) oligonucleotide as indicated.

PAGE 105

105 Figure 3 14. with NIT1 cell lysate EMSAs were conducted with NIT1 oligonucleotide (probe) as indicated. Arrows indicate Nkx6.1 binding and supershift. In competition assays, DNA binding reactions were preincubated with 10 fold (10x) or 100 specific (NS) oligonucleotide as indicated.

PAGE 106

106 Figure 3 15. RT PCR for determination of gene expression. Total RNA was isolated from indicated cell lines and expression of pancreatic genes was measured by RT PCR.

PAGE 107

107 Figure 3 16. Effect of Nkx6.1 over expression on mRNA levels. NIT1 mouse beta cells were transfected with CMV Nkx6.1 expression plasmid for 48 hours. Total RNA was isolated and subjected to reverse transcription. Target gene expression was quantified by real time PCR and expressed as fold over control as in dicated. Empty vector plasmid (pcDNA3) transfection was used for a negative control for all tested genes and arbitrarily set to 1.0.

PAGE 108

108 Figure 3 17. Effect of Nkx6.1 knockdown on mRNA levels. NIT1 mouse beta cells were transfected with Nkx6.1 siRN A for 48 hours. Total RNA was isolated and subjected to reverse transcription. Target gene expression was quantified by real time PCR and expressed as fold over control as indicated. Empty vector plasmid (pcDNA3) transfection was used for a negative contr ol for all tested genes and arbitrarily set to 1.0.

PAGE 109

109 CHAPTER 4 NOVEL DETECTION OF PANCREATIC AND DUODENAL HOMEOBOX 1 (Pdx1) AUTOANTIBODIES (PAA) IN HUMAN SERA USING LUCIFERASE IMMUNOPRECIPITATION SYSTEMS (LIPS) ASSAY Introduction Pancreatic and duodenal homeobox 1 (Pdx1) is a key transcription factor for pancreatic development and beta cell maturation and function, and it also plays important roles pancreatic beta cell survival and regeneration 273 Pdx1 autoantibodies (PAA) have recently been identified in serum from both non obese diabetic (NOD) mice and human type 1 diabetes (T1D) patients 254 Other autoantibodies in T1D such as insulin autoantibodies (I AA) 274 islet cell autoantibodies (ICA) 275 glutamic acid decarboxylase (GAD) autoantibodies (GADA) 276 and insulinoma 2 (IA 2) associated autoantibodies (IA 2A) 277 are useful markers for diagnosis as well as for predicting disease onset and may have a role for the timing of interventions 6 Clinical liquid phase radioimmunoprecipitation assays (RIPA) for these autoantibodies are available However, a non radioactive alternative assay has been developed for detection of GADA 278, 279 and IA 2A 279, 280 with similar sensitivity and specificity know as the luminescence immunoprecipitation system (LIPS) assay 281, 282 Here, we report a LIPS assay for detecting PAA in human sera using a Pdx1 luciferase fusion protein produced in mammalian cells. This new liquid phase assay provides a non radioactive means of detecting PAA in human sera. Materials and Methods Plasmi d C onstruction The human Pdx1 renilla luciferase fusion plasmid was constructed by cloning the renilla luciferase gene (from the pRen2 plasmid) upstream of the Pdx1 gene in pCMV

PAGE 110

110 XL5 (Open Biosystems) using HindIII/BamHI restriction sites for expression in site directed mutagenesis to construct the luciferase only expression control. Renilla luciferase GAD65 278 and renilla luciferase IA2 280 fusion plasmids were generous gifts from Dr. Peter Burbelo (NIH, Bethesda, MD). All plasmids were purified using the Plasmid Maxi Kit (Qiagen ). Fusion Protein L ysate Mammalian fusion protein lysates were prepared by transfecting human embryonic kidney (293) cells with each plasmid using Lipofectamine 2000 Reagent (Invitrogen) 2 culture dishes. Fort y eight hours following transfection, lysates were harvested using 1ml Passive Lysis Buffer (Promega) per dish and supernatant (lysate) was collected following centrifugation. 293 cells were cultured at 37C in DMEM containing 10% fetal bovine serum and 1 % Penicillin/Streptomycin. Sera Healthy human donor sera (n = 10) with no known history of autoimmune diseases were used to establish the cut off between positive and negative. Fifty four serum samples from the University of Florida Pathology Laboratori es, Endocrine Autoantibody Laboratory were used to validate the LIPS assay, 29 of which are clinically tested triple positive for ICA (by indirect immunofluorescence), GADA, and IA 2A (by RIPA). The ICA assay has been validated previously and was the basis for the Diabetes Prevent ion Trial 1 study 283 and is used in the current T1D TrialNet studies 284 The GADA and IA 2A assays were manufactured by Kronus, Inc. (Star, Indiana) and validated previously. In addition, four sera from T1D patients awaiting renal transplants (that were previously

PAGE 111

111 identified as PAA positive) were used for determination of PAA antigenic specificity. All sera were measured blindly LIPS A ssay LIPS assays were performed similarly to the previously published protocols 281, 282 wit h minor modifications. Pdx1 7 RLUs in Berthold Lumat LB9507) was incubated with 10 l human serum for PAA (or 1 l serum for GADA and IA 2A) in 96 well round bottom plates at a total volume of 100 l in PBS overnight with agitation. Healthy normal donor control sera were used to establish a normal range. Samples were then transferred to 96 well filter plates containing 10 l Immobilized Protein A/G plus Beads (Pierce) of 50% concentration (beads/volume) and incubated at 4C for 2hrs with agitation. All samples were washed 8 times with Buffer A as previously described 281, 282 20ul PBS was added to each well before reading in a LUMIstar Omega plate reader (BMG Labtech). Competition assays used purified recombinant Pdx1 protein (rPdx1) 285 or BSA at indicated concentrations and were incubated with Pdx1 luciferase fusion cell lysate overnight. Due to limited sera volumes, all assays were performed in singlet. We obtained extra sera for negative controls and some strong PAA positives that were used for competition assays to determine antigenic specificity. Results Because PAA are a recent discovery, there is no standard assay for detecting these antibodies in the clinical setting. To validate the LIPS assay, we first compared our detection of GADA (Fig. 4 1 ) and IA 2A (Fig. 4 2 ) by LIPS assay to clinical data previ ously determined by RIPA. Sera from patients (n = 54) and control subjects (n = 10) were screened for GADA or IA 2A by LIPS assay and a positive cutoff was set at 3

PAGE 112

112 standard deviations (SD) above the mean of control subjects. For GADA, LIPS identified 28 out of 29 (97%) RIPA positive sera and 6 additional LIPS positive sera that were RIPA negative. For IA 2A, LIPS identified all 29 (100%) RIPA positive sera and one additional LIPS positive serum that was RIPA negative However, the degree of positivity for individual samples varied greatly between RIPA and LIPS assay without a linear correlation. For example, a particular sample may yield a high positive value by RIPA but a low to moderate value by LIPS assay, or vice versa. Compared to clinical RIPA, LIPS assay shows 97% sensitivity and 76 % specificity for GADA detection and 100% sensitivity and 96% specificity for IA 2A detection (Fig. 4 3 ) However, since the accuracy of the reference assay (RIPA) is unknown, the low specificity could alternatively indicate that the LIPS assay is actually more sensitive than RIPA. Taken together, these results suggest that the LIPS assay is comparable to the clinical RIPA for GADA and IA 2A in our hands. Next, we tested the above serum samples (54 patients and 10 he althy control s) for PAA by LIPS assay (Fig. 4 4 ). We arbitrarily set the positive cutoff as the mean +3 SD of 10 healthy control sera and defined any sample above this cutoff as positive for PAA. Using this cutoff, 7 out of 54 sera were positive for PAA (13%). Among the PAA positive samples, 6 out of 29 triple positive serum samples were PAA positive (21%) and 1 out of 25 triple negative serum samples was PAA positive (4%). Despite the abundance, PAA did not reach statistical significance in association with triple positive T1D To validate the antigenic specificity of the LIPS assay for PAA, we selected serum samples from T1D patients awaiting renal transplants that previously tested neg ative,

PAGE 113

113 medium, and high positive for PAA by LIPS assay To exclude the possibility of antibody binding to luciferase, immuno reactivity with both Pdx1 luciferase antigen and with luciferase antigen alone was tested, demonstrating that the PAA positive sera bound only to Pdx1 luciferase (Fig. 4 5 ). We next confirmed Pdx1 antigenic specificity using a competition assa y with purified rPdx1 (Fig. 4 6 ). We selected our high est PAA positive sample for LI PS assay to detect PAA by incubating serum with various concentrations of rPdx1 or bovine serum albumin (BSA) as control. The PAA signal was reduced with increasing concentrations of rPdx1 but not with BSA, confirming that the PAA signal is specific for P dx1 protein. BSA non specifically reduced the signal but was unable to block detection of PAA even at high concentrations (0.125mg/ml). Discussion We have developed a liquid phase, non radioactive assay to detect PAA in human sera and confirmed t he prese nce of PAA in 7 out of 54 samples While developing our assay, we first performed LIPS assays to detect GADA (Fig. 4 1) and IA 2A (Fig. 4 2) from samples that had been previously evaluated clinically by RIPA. If RIPA is held as the reference standard, on e would conclude that our LIPS assay has nearly identical sensitivity but a reduced specificity for detection of these autoantibodies. This would suggest that we have identified several false positive sera. However, another interpretation of the data is that our assay is more sensitive than RIPA and that these RIPA. We conclude that the LIPS assay has similar sensitivity to RIPA and because it does not involve the use o f radioisotopes, it is safer and more convenient. Thus, the LIPS assay may be valuable in the clinical setting for detecting autoantibodies

PAGE 114

114 Insulin is considered to be an early autoantigen in T1D and it has been proposed to be the primary antigen relat ed to T1D 286 288 This is ba sed on the early detection of IAA in people later developing T1D and by the fact that insulin is uniquely expressed and secreted by the beta cell whereas other autoantigens are not unique to the beta cell (e.g., GAD or IA 2A). Pdx1 could also be an early autoantigen with respect to T1D development and s ome evidence suggest s that Pdx1 may be a primary autoantigen related to T1D. In our previous report 254 we detected PAA in NOD mice by ELISA, western b lotting, and RIPA We also followed the PAA titer of several female NOD mice during the development of diabetes and found that PAA titers tended to peak prior to the onset of hyperglycemia and then dropped to undetectable levels after several weeks. This may be due to a lack of Pdx1 antigen stimulation following destruction of beta cells. To determine whether this is the case for humans will require evaluation of PAA in human T1D patients throughout disease development. Serum from individual patients sh ould be measured for PAA at various time points during disease development, from pre diabetic to clinical manifestation of diabetes. were not significantly associated with the presence of triple positive (ICA, GADA, and IA 2A) T1D related autoantibodies ( p = 0.10) Since our study only examined sera that was triple positive (or negative) for other T1D related autoantibodies and since the p value was relatively low, PAA association with other T1D related autoantibodi es merits further investigation. Future studies should examine whether PAA are significantly associated with sera from patients with only one or two T1D related autoantibodies and in patients with other T1D related autoantibodies such as zinc transporter 8 protein (ZnT8) islet autoantibodies

PAGE 115

115 (ZnT8A) 289 or IAA 274 In addition, T1D patients that are negative for all othe r known T1D related autoantibodies could be examined. Due to our limited resources, several questions remain unanswered regarding PAA. Large scale systematic, longitudinal studies will be required to determine the prevalence of PAA in the normal populatio n, T1D patients, high risk or prediabetic populations, and in other diseases as well as to identify if there exists any clinical value of PAA for prediction, diagnosis, or monitoring of T1D patients.

PAGE 116

116 Figure 4 1. Detection of GADA in human sera by LIPS assay. Sera (n = 54) that were tested for ICA, GADA and IA 2A clinically by RIPA or healthy normal donor control sera (n = 10) were used and the transverse line is 3SD above control mean. RLU (relative light units) are expressed as fold increase over cont rol mean (left y axis). Standard LIPS assay as performed with renilla luciferase GAD65 fusion protein lysate and compared to c linical RIPA data (right y axis).

PAGE 117

117 Figure 4 2. Detection of IA 2A in human sera by LIPS assay. Sera (n = 54) that were tested for ICA, GADA and IA 2A clinically by RIPA or healthy normal donor control sera (n = 10) were used and the transverse line is 3SD above control mean. RLU (relative light units) are expressed as fold increase ove r control mean (left y axis). Standard LIPS assay as performed with renilla luciferase IA 2 fusion protein lysate and compar ed to clinical RIPA data (right y axis).

PAGE 118

118 Sensitivity Specificity GADA 97% 76% IA 2A 100% 96% Figure 4 3. Sensitivity and specificity of LIPS assay vs. RIPA for GADA and IA 2A. Sera (n = 54) that were tested for ICA, GADA and IA 2A clinically by RIPA or healthy normal donor control sera (n = 10) were used. Standard LIPS assays GAD65 fusion protein lysate or renilla luciferase IA 2 fusion protein lysate Sensitivity and specificity were calculated using RIPA as a reference assay.

PAGE 119

119 Figure 4 4. Detection of PAA in human sera by LIPS assay. Sera (n = 54) that were tested for ICA, GADA and IA 2A clinically by RIPA or healthy normal donor con trol sera (n = 10) were used to detect PAA using a standard LIPS assay with Pdx1 luciferase fusion protein lysate T he transverse line is 3SD above control mean. RLU (relative light units) are expressed as fold increase over control mean AA b = autoantibody.

PAGE 120

120 Figure 4 5. Antigenic specificity of PAA using luciferase only control. were negative (Ctrl), medium (A & B), or high signal positive ( C ) for PAA (from T1D patients awaiting renal transplants) were used in a standard LIPS assay using either Pdx1 luciferase antigen or luciferase only antigen for detection

PAGE 121

121 Figure 4 6. Antigenic specificity of PAA by competition with purified rPdx1 protein. A standard LIPS assay was performed to detect PAA from our high est signal positive serum incubated with indicated concentrations of rPdx1 or BSA.

PAGE 122

122 CHAPTER 5 P ANCREATIC AND DUODENAL HOMEOBOX 1 (PDX1) AU TOANTIBODIES (PAA) FROM HUMAN SERA DETE CTED IN AUTOIMMUNE DISEASES AND CANCER Introduction In our previous report, we developed a liquid phase non radioactive luciferase immunoprecipitation systems (LIPS) assay 281, 290 for detection of pancreatic and duodenal homeobo x 1 (Pdx1) autoantibodies (PAA) 254 in human sera and we determined that PAA are not significantly associated with the presence of triple positive T1D autoantibodies (to ICA, GADA, and IA2A) In the present repo rt we have assessed the presence of PAA in patient sera with recent onset (RO) T1D and age matched non T1D control s and longstanding (LS) T1D in order to determine the relationship of PAA with T1D. We also assessed the presence of PAA in patient sera with systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), and various forms of cancer (including pancreatic cancer) in order to determine if PAA are unique to T1D. Materials and Methods The human Pdx1 renilla luciferase fusion plasmid was constr ucted and purified and m ammalian fusion protein lysates were prepared and used for LIPS assay as previously described. All sera were measured blindly and consisted of samples from patients with RO T1D (n = 100) and age matched non T1D control s (n = 100) LS T1D (N = 50), SLE ( n = 48), RA ( n = 30), or various forms of cancer (n = 70). Healthy human donor sera (n = 10) with no known history of autoimmune diseases were used as normal controls for setting up the cut off between positive and negative (3SD abov e control mean)

PAGE 123

123 Results Using a cutoff of three standard deviations above the mean of norm human control sera, we detected positive PAA sera (Fig. 5 1 and 5 2 ) as follows: 7% from RO T1D patients (n = 100) and 13% from age matched non T1D control s (n = 100) 20% from LS T1D patients (N = 50), 48% from SLE patients (n=48), 3% from RA patients (n=30), and 16% from cancer patients (n=70). Sera that produced high positive signal for detection were assayed several times whenever possible (based on serum volu me) and consistent results were produced. It is interesting to note that a high PAA positive signal was detectable in a patient with pancreatic cancer (Fig. 5 2 cancer plot). Discussion Based on our data, the relationship of PAA to T1D is unclear. Altho ugh PAA were found in 7% of RO T1D patients, we surprisingly found PAA in 13% of age matched non T1D controls and also identified PAA in 20% of LS T1D patients. The high prevalence of PAA in the non T1D age matched controls is confounding. One possibilit y for this data is that the age matched control group may not actually be a normal population, and this is supported by the fact that our control group (used to establish PAA positive cutoff) was completely negative for PAA. Another possibility is that th is is an anomaly due to small sample size and larger scale studies may be required to identify the true prevalence of PAA in T1D vs normal patient sera. Finally, PAA could be the result of cross reactive autoantibodies to another antigen 291 This is the first report of PAA association with diseases other than T1D. We have observed a high prevalence (48%) of PAA in patients with SLE. Since double stranded DNA autoantibodies are common among SLE patients 292 and because Pdx1 is a DNA binding protein 293 we have assessed whether detection of our PAA positive signal from

PAGE 124

124 SLE patient samples was actually due to double stranded DNA autoantibodies. A standard radioimmunoprecipitation assay was used to assess the presence of double stranded DNA autoantibodies in the SLE patient sera. Double stranded DNA autoantibodies were only detected in PAA negative sera (data not shown) confirming that PAA and double stranded DNA autoantibodies are distinct and have no association. One of the most intriguing pieces of data we found was that one of the highest signal s of detection for PAA was from a pancreatic cancer patient. We hypothesize that the resulting lesion from pancreatic cancer could cause leaking of Pdx1 protein and subsequent presentation to the immune system leading to production of PAA. If this is true, o ver production of Pdx1 from pancreatic cancer cells could lead to high titer PAA production by B cells. If PAA is directly associated with pancreatic cancer, detection of PAA could be useful for screening and diagnosing pancreatic cancer which remains one of the most elusive forms of cancer with a poor prognosis and 5 year survival rate less than 5% 294 PAA are detected in human sera from patients with autoimmune diseases or cancer by LIPS assay, but whether there is an association of PAA with each disease is unknown. Large scale sy stematic, and longitudinal studies are still required to determine the clinical value of PAA for prediction, diagnosis, or monitoring of T1D patients or patients with other diseases.

PAGE 125

125 Figure 5 1. PAA detected in human T1D patient sera. Sera from recent onset (RO) T1D patients (n = 100) and non T1D age matched controls (n = 100) long standing (LS) T1D patient s (n = 50), or healthy normal donor controls (Ctrl, n = 10) were screened for PAA by stand ard LIPS assay using mammalian produced Pdx1 luciferase fusion protein lysate. The transverse line is 3SD above control mean. RLU (relative light units) are expressed as fold increase over control mean.

PAGE 126

126 Figure 5 2. PAA detected in human autoimmune disease and cancer patient sera. Sera from healthy normal donor controls (Ctrl, n = 10) and patients with systemic lupus erythematosus (SLE, n = 48), rheumatoid arthritis (RA, n = 30), and various forms of cancer (Cancer, n = 70) were screened for PAA by standard LIPS assay using mammalian produced Pdx1 luciferase fusion protein lysate. The transverse line is 3SD above control mean. RLU = relative light units and are expressed as fold over control mean.

PAGE 127

127 CHAPTER 6 C ONCLUSIONS AND FUTUR E DIRECTIONS Before the discovery of insulin by Banting and Best in 1921 295 T1D was a fatal disease. I nsulin replacement therapy is not a cure for T1D because t he difficulty of maintaining normal blood glucose concentration causes most T1D patients to have a hyperglycemic condition leading to vascular degradation and subsequent tissue damage and organ failure 1 However, in 2012, insulin replacement therapy continues to be the standard treatment for T1D. This provide s the rationale for the work in this dissertation with the ultimate goal of prov iding adequate control of blood glucose to T1D patients without any harmful side effects. Successful pancreas 296, 297 and islet transplantations 8, 298, 299 have o ccurred but are not suitable for the entire T1D population because they require use of immunosuppressants that cause harmful side effects and they are not permanent cures. For these reason s investigators have focus ed on alternative methods for generatin g beta cells Success in these attempts may still not be sufficient to provide a cure for T1D. As mentioned before, the pathogenesis of diabetes is two fold, and surrogate beta cells will face possible destruction from recurrent autoimmunity 297 Enhanced knowledge of t he mechanisms involved in T1D pathogenesis and beta cell differentiation will be important in developing a cure. Previous studies aimed at beta cell generation have used many different tissue sources and many different factors to investigate the reprogram ming process. We have focused our work on studying the mechanism s involved in reprogramming liver to pancreatic beta cells We chose this system based on previous reports that demonstrate the extraordinary ability of hepatic cells to transform into insul in producing beta cells. We investigated the reprogramming of liver into beta cells by ectopic

PAGE 128

128 expression of pancreatic beta cell specific transcription factors Pdx1 and Ngn3 because they are fundamental factors that are shown to be essential for beta cel l development. Most of the other factors used in similar reprogramming studies are downstream targets of Pdx1 and Ngn3 or expressed during later stages of development 60, 293 Using these factors allowed us to study the fundamental early events involved in reprogramming liver to beta cells. Discovering suppression of HNF1 in Huh7 cells followi ng ectopic expression of Pdx1 was a key finding in our early studies and prompted us to further investigate the mechanism as to how this occurred. Although we cannot rule out the possibility that many mechanisms account for Pdx1 mediated HNF1 suppression we did discover major changes in the regulation and expression of its major activator HNF4 and beta cells used primarily P1 and P2 promoter respe 2 40 event in Pdx1 mediated liver to beta cell reprogramming. The fact that Pdx1 is a known regulator of the P2 promoter specifically in beta cells 236 further supports this notion. In order to study this process in greater detail, we cloned approxi mately 3kb of the reprogramming is a major focus of our lab, we have produced or acquired many transcription factor expression plasmids related to beta cells. Having these tools available pr ompted us to luciferase construct for potential transcriptional activators that are beta cell specific. Another driving factor in this exploration was the fact that, previously,

PAGE 129

129 mal promoter) was found to be active in hepatic cells but completely inactive in rodent INS1 beta cells 150 and this beta cell specific transcription regulator s And i ndeed, Nkx6.1, which is not expressed in hepatic cells. Future studies should investigate the beta cell specific regulation of HNF1 greater detail. One of the main point s left unresolved from our work is the role of the line 150 cell line 255 However, much of our luciferase reporter data obtained from both liver specific isoforms generated from the P1 promoter and beta cell specific is o forms generated from the P2 promoter Although all the same DNA binding domain differences may allow for interactions with other molecu les that prevent them from functioning in a similar manner. The N exon 1D or exon 1D and exon 1E. These unrelated domains (1A vs 1D) have the potential to interact with other proteins in a cell type specific manner and form protein reporter was not active in the INS1 beta cell line, even considering that the cell line

PAGE 130

130 expressed the major activator It is possible that exon 1D is not sufficient alone to recruit the necessary molecules for transcription, while exon 1A may be sufficient. It is possible that protein DNA complexes (normally prese nt in the endogenous context) are not available to interact with architecture of expressed in beta cells may not confer transactivation al one, but may require the participation from proteins or protein complexes that bind the distal regions of the DNA complexes may not be present or functional in hepatic cells but may be required for proper regulation in beta cells regulation of target genes The specific mechanisms that govern can lead to three potential C are believed to have the potential to acquire any of the three possible C terminal consequences for its regulation of target genes because it affects the interactions with other proteins and complexes. Since Pdx1 is a known r promoter in beta cells, it is possible that Pdx1 has influence on the specific mechanism s of alternative splicing and thus Pdx1 may play a role in the regulation of specific It is also possible that in general, the data from luciferase transfection assays is not representative of endogenous regulatory events since the gene architecture and

PAGE 131

131 expression will make these s tudies difficult, but understanding cell specific mechanisms of regulation will certainly enhance our understanding of beta cell function and may provide additional markers useful for following liver to beta cell reprogramming. The discovery of PAA was ver y interesting within the context of my work, considering that Pd x1 is the primary transcription factor used during the reprogramming of hepatic cells into beta cells and because Pdx1 expression in hepatic cells leads to Our lab initially discovered PAA 254 by accident following our development of a system to produce rPdx1 in Pichia pastoris 285 Pdx1 is a transcription factor that contains a protein transduction domain (PTD ) which is a specifi c amino acid sequence enriched with positively charged arginine and lysine residues, allowing for its t ransduction across cellular membranes by lipid raft mediated macropinocytosis 31, 35, 36 For this reason, our lab injected NOD mice direct ly with Pdx1 protein in order to stimulate beta cell expansion and hepatic reprogramming into insulin producing cells to prevent the onset of diabetes 17 As a control, we generated a mutant non functional rPdx1 protein with the PTD (as well as DNA binding domain) removed. Although injecting NOD mice with mutant rPdx1 did not stimulate beta cell expansion or hepatic reprogramming, it prevented the onset of diabetes similarly to normal Pdx1 (unpublished data). We hypothesized that this protection was induced by antigen specific immunotherapy 300 following rPdx1 or mutant rPdx1 injection prompting us to examine the presence of Pdx1 antibodies in the serum of these mi ce. We also examined the serum of NOD mice for the presence of Pdx1 antibodies before treatment leading to the discovery of PAA in NOD mice (which spontaneously develop autoim mune diabetes) but not in other strains examined, incl udi ng NOD scid, C57/B6,

PAGE 132

132 and BALB /c. It is interesting to note that, in general, the appearance of PAA in NOD mice peaked before the onset of hyperglycemia and then tapered off to very low or undetectable levels by ELISA. In this report 254 we also discovered the presence of PAA in human serum by western blotting, but were unable to detect human PAA from the same samples by ELISA which is possibly due to distortion of the PAA specific epitope. For this reason, I developed the liquid phase luciferase immunoprecipitation systems (LIPS) assay for detection of PAA in human sera. In regard to our work on PAA, a utoantibodies related to T1D are useful markers for diagnosis as well as for predicting disease onset 6 Although we have demonstrated that PAA are detected in human sera, it is unclear w hat their relationship is to T1D, if any. While a search of the scientific literature for autoantibodies in T1D patient sera will yield hundreds of results, few studies are able to demonstrate any association with disease and most fail to have any clinica l utility. While our follow up study demonstrated more PAA positive sera from non T1D patients compared to T1D patients our initial work did find 6 out of 29 triple positive serum (ICA, GADA, and IA 2A) samples were PAA positive (21%) and 1 out of 25 tri ple negative serum samples was PAA positive (4%) Although this finding is not statistically significant (p = 0.10) according to Fisher s exact test, the relatively low p value for a limited sample number merits further investigation of PAA in order to de termine their clini cal value for prediction, diagnosis, or monitoring of T1D patients or patients with other diseases. Perhaps the most interesting data from this study is the discovery of PAA from a patient with pancreatic cancer ( 5 year survival rate le ss than 5% 294 ). Pdx1 and pancreatic cancer are colocalized to the pancreas and it is reasonable to hypothesize that the molecular instability within the cancer tissue

PAGE 133

133 could lead to presentation of Pdx1 to the immune system resu lting in PAA production by B cells. Due to the severity of pancreatic cancer, this single discovery merits further investigation to determine if PAA are a marker for pancreatic cancer as it could lead to earlier detection and improve prognosis for patien ts. In conclusion, this work sheds further insight into the molecular mechanisms involved in liver to pancreatic beta cell reprogramming and also presents a system that will be useful for determining the clinical utility of PAA. Future studies will be required to determine and employ other molecular mechanisms involved in the reprogramming process in order to successfully restore beta cell mass for the growing diabetic population.

PAGE 134

134 LIST OF REFERENCES 1. Atkinson,M.A. & Maclaren,N.K. The pathogenesis of insulin dependent diabetes mellitus. N. Engl. J. Med. 331 1428 1436 (1994). 2. Atkinson,M.A. & Eisenbarth,G.S. Type 1 diabetes: new perspectives on disease pathogenesis and treatment. Lancet 358 221 229 (2001). 3. Haller,M.J., Atkinson,M.A., & Schatz,D. Type 1 diabetes mellitus: e tiology, presentation, and management. Pediatr. Clin. North Am. 52 1553 1578 (2005). 4. Isermann,B., Ritzel,R., Zorn,M., Schilling,T., & Nawroth,P.P. Autoantibodies in diabetes mellitus: current utility and perspectives. Exp. Clin. Endocrinol. Diabet es 115 483 490 (2007). 5. Kelly,M.A., Rayner,M.L., Mijovic,C.H., & Barnett,A.H. Molecular aspects of type 1 diabetes. Mol. Pathol. 56 1 10 (2003). 6. Winter,W.E. & Schatz,D.A. Autoimmune markers in diabetes. Clin. Chem. 57 168 175 (2011). 7. Chatenoud,L. & Bluestone,J.A. CD3 specific antibodies: a portal to the treatment of autoimmunity. Nat. Rev. Immunol. 7 622 632 (2007). 8. Berney,T. & Ricordi,C. Islet cell transplantation: the future? Langenbecks Arch. Surg. 385 373 378 (200 0). 9. Limbert,C., Path,G., Jakob,F., & Seufert,J. Beta cell replacement and regeneration: Strategies of cell based therapy for type 1 diabetes mellitus. Diabetes Res. Clin. Pract. 79 389 399 (2008). 10. Titus,T., Badet,L., & Gray,D.W. Islet cell tr ansplantation for insulin dependent diabetes mellitus: perspectives from the present and prospects for the future. Expert. Rev. Mol. Med. 2 1 28 (2000). 11. Samson,S.L. & Chan,L. Gene therapy for diabetes: reinventing the islet. Trends Endocrinol. Metab 1 7 92 100 (2006). 12. Cao,L.Z., Tang,D.Q., Horb,M.E., Li,S.W., & Yang,L.J. High glucose is necessary for complete maturation of Pdx1 VP16 expressing hepatic cells into functional insulin producing cells. Diabetes 53 3168 3178 (2004). 13. Ferber,S. et al. Pancreatic and duodenal homeobox gene 1 induces expression of insulin genes in liver and ameliorates streptozotocin induced hyperglycemia. Nat Med 6 568 572 (2000).

PAGE 135

135 14. Fodor,A. et al. Adult rat liver cells transdifferentiated with lentiviral IPF1 vector s reverse diabetes in mice: an ex vivo gene therapy approach. Diabetologia 50 121 130 (2007). 15. Gefen Halevi,S. et al. NKX6.1 promotes PDX 1 induced liver to pancreatic beta cells reprogramming. Cell Reprogram 12 655 664 (2010). 16. Horb,M.E., Shen,C.N., Tosh,D., & Slack,J.M. Experimental conversion of liver to pancreas. Curr. Biol. 13 105 115 (2003). 17. Koya,V. et al. Reversal of streptozotocin induced diabetes in mice by cellular transduction with recombinant pancreatic transcription factor pancreatic duodenal homeobox 1: a novel protein transduction domain based therapy. Diabetes 57 757 769 (2008). 18. Li,W.C., H orb,M.E., Tosh,D., & Slack,J.M. In vitro transdifferentiation of hepatoma cells into functional pancreatic cells. Mech. Dev. 122 835 847 (2005). 19. Sapir,T. et al. Cell replacement therapy for diabetes: Generating functional insulin producing tissue f rom adult human liver cells. Proc. Natl. Acad. Sci. U. S. A 102 7964 7969 (2005). 20. Shternhall Ron,K. et al. Ectopic PDX 1 expression in liver ameliorates type 1 diabetes. J. Autoimmun. 28 134 142 (2007). 21. Soria,B. In vitro differentiation of pancreatic beta cells. Differentiation 68 205 219 (2001). 22. Tang,D.Q. et al. In vivo and in vitro characterization of insulin producing cells obtained from murine bone marrow. Diabetes 53 1721 1732 (2004). 23. Tang,D.Q. et al. Role of Pax4 in Pdx 1 VP16 mediated liver to endocrine pancreas transdifferentiation. Lab Invest 86 829 841 (2006). 24. Tang,D.Q. et al. Reprogramming liver stem WB cells into functional insulin producing cells by persistent expression of Pdx1 and Pdx1 VP16 mediated by l entiviral vectors. Lab Invest 86 83 93 (2006). 25. Yang,L. et al. In vitro trans differentiation of adult hepatic stem cells into pancreatic endocrine hormone producing cells. Proc. Natl. Acad. Sci. U. S. A 99 8078 8083 (2002). 26. Yang,L.J. Liver stem cell derived beta cell surrogates for treatment of type 1 diabetes. Autoimmun. Rev. 5 409 413 (2006). 27. Zalzman,M. et al. Reversal of hyperglycemia in mice by using human expandable insulin producing cells differentiated from fetal liver progeni tor cells. Proc. Natl. Acad. Sci. U. S. A 100 7253 7258 (2003).

PAGE 136

136 28. Zalzman,M., nker Kitai,L., & Efrat,S. Differentiation of human liver derived, insulin producing cells toward the beta cell phenotype. Diabetes 54 2568 2575 (2005). 29. Zhou,Q., Brown,J., Kanarek,A., Rajagopal,J., & Melton,D.A. In vivo reprogramming of adult pancreatic exocrine cells to beta cells. Nature 455 627 632 (2008). 30. Chen,J. et al. A novel type of PTD, common helix loop helix motif, could efficiently mediate protein transduction into mammalian cells. Biochem. Biophys. Res. Commun. 347 931 940 (2006). 31. Noguchi,H., Kaneto,H., Weir,G.C., & Bonner Weir,S. PDX 1 protein containing its own antennapedia like protein transduction domain can transduce pancreatic duct and islet cells. Diabetes 52 1732 1737 (2003). 32. Noguchi,H., Bonner Weir,S., Wei,F.Y., Matsushita,M., & Matsumoto,S. BETA2/NeuroD protein can be transduced into cells due to an arginine and lysine rich sequence. Diabetes 54 2859 2866 (2005). 3 3. Noguchi,H. & Matsumoto,S. Protein transduction technology: a novel therapeutic perspective. Acta Med. Okayama 60 1 11 (2006). 34. Noguchi,H. & Matsumoto,S. Protein transduction technology offers a novel therapeutic approach for diabetes. J Hepatobi liary. Pancreat. Surg. 13 306 313 (2006). 35. Noguchi,H. et al. PDX 1 protein is internalized by lipid raft dependent macropinocytosis. Cell Transplant. 14 637 645 (2005). 36. Noguchi,H. et al. Mechanism of PDX 1 protein transduction. Biochem Biophys Res Commun 332 68 74 (2005). 37. Dominguez Bendala,J. et al. TAT mediated neurogenin 3 protein transduction stimulates pancreatic endocrine differentiation in vitro. Diabetes 54 720 726 (2005). 38. Voltarelli,J.C. et al. Autologous nonmyeloablative hematopoietic stem cell transplantation in newly diagnosed type 1 diabetes mellitus. JAMA 297 1568 1576 (2007). 39. Daneman,D. Type 1 diabetes. Lancet 367 847 858 (2006). 40. Nicolls,M.R., Haskins,K., & Flores,S.C. Oxidant stress, immune dysregulation, and vascular function in type I diabetes. Antioxid. Redox. Signal. 9 879 889 (2007). 41. Fadini,G.P., Sartore,S., Agostini,C., & Avogaro,A. Significance of endothelial progenitor cells in subjects with diabetes. Diabetes Care 30 1305 1313 (2007).

PAGE 137

137 42. Ellard,S., Bellanne Chantelot,C., & Hattersley,A.T. Best practice guidelines for the molecular genetic diagnosis of maturity onset diabetes of the young. Diabetologia 51 546 553 (2008). 43. Hattersl ey,A., Bruining,J., Shield,J., Njolstad,P., & Donaghue,K. ISPAD Clinical Practice Consensus Guidelines 2006 2007. The diagnosis and management of monogenic diabetes in children. Pediatr. Diabetes 7 352 360 (2006). 44. Hattersley,A.T. Molecular genetics goes to the diabetes clinic. Clin. Med 5 476 481 (2005). 45. Murphy,R., Ellard,S., & Hattersley,A.T. Clinical implications of a molecular genetic classification of monogenic beta cell diabetes. Nat Clin. Pract. Endocrinol. Metab 4 200 213 (2008). 46. Fajans,S.S., Bell,G.I., & Polonsky,K.S. Molecular mechanisms and clinical pathophysiology of maturity onset diabetes of the young. N. Engl. J. Med. 345 971 980 (2001). 47. Lehto,M. et al. Characterization of the MODY3 phenotype. Early onset diab etes caused by an insulin secretion defect. J. Clin. Invest 99 582 591 (1997). 48. Mitchell,S.M. & Frayling,T.M. The role of transcription factors in maturity onset diabetes of the young. Mol. Genet. Metab 77 35 43 (2002). 49. Ryffel,G.U. Mutations in the human genes encoding the transcription factors of the hepatocyte nuclear factor (HNF)1 and HNF4 families: functional and pathological consequences. J. Mol. Endocrinol. 27 11 29 (2001). 50. Della,M.T. Not every diabetic child has type 1 diabetes mellitus. J Pediatr. (Rio J) 83 S178 S183 (2007). 51. Lambert,A.P. et al. Identifying hepatic nuclear factor 1alpha mutations in children and young adults with a clinical diagnosis of type 1 diabetes. Diabetes Care 26 333 337 (2003). 52. Moller,A. M. et al. Mutations in the hepatocyte nuclear factor 1alpha gene in Caucasian families originally classified as having Type I diabetes. Diabetologia 41 1528 1531 (1998). 53. Pearson,E.R., Liddell,W.G., Shepherd,M., Corrall,R.J., & Hattersley,A.T. Sensitivity to sulphonylureas in patients with hepatocyte nuclear factor 1alpha gene mutations: evidence for pharmacogenetics in diabetes. Diabet. Med 17 543 545 (2000). 54. Shepherd,M. et al. No deterioration in glycemic control in HN F 1alpha maturity onset diabetes of the young following transfer from long term insulin to sulphonylureas. Diabetes Care 26 3191 3192 (2003).

PAGE 138

138 55. Rhodes,D., Schwabe,J.W., Chapman,L., & Fairall,L. Towards an understanding of protein DNA recognition. Phi los. Trans. R. Soc. Lond B Biol. Sci. 351 501 509 (1996). 56. Kadonaga,J.T. Regulation of RNA polymerase II transcription by sequence specific DNA binding factors. Cell 116 247 257 (2004). 57. Kornberg,R.D. The molecular basis of eucaryotic transcr iption. Cell Death. Differ. 14 1989 1997 (2007). 58. Maniatis,T., Goodbourn,S., & Fischer,J.A. Regulation of inducible and tissue specific gene expression. Science 236 1237 1245 (1987). 59. Ptashne,M. How eukaryotic transcriptional activators work. Nature 335 683 689 (1988). 60. Habener,J.F., Kemp,D.M., & Thomas,M.K. Minireview: transcriptional regulation in pancreatic development. Endocrinology 146 1025 1034 (2005). 61. Pieler,T. & Chen,Y. Forgotten and novel aspects in pancreas development Biol. Cell 98 79 88 (2006). 62. Zaret,K.S. Regulatory phases of early liver development: paradigms of organogenesis. Nat. Rev. Genet. 3 499 512 (2002). 63. Zhao,R. & Duncan,S.A. Embryonic development of the liver. Hepatology 41 956 967 (2005). 6 4. Eguchi,G. & Kodama,R. Transdifferentiation. Curr. Opin. Cell Biol. 5 1023 1028 (1993). 65. Li,W.C., Yu,W.Y., Quinlan,J.M., Burke,Z.D., & Tosh,D. The molecular basis of transdifferentiation. J. Cell Mol. Med. 9 569 582 (2005). 66. Slack,J.M. & Tosh,D. Transdifferentiation and metaplasia -switching cell types. Curr. Opin. Genet. Dev. 11 581 586 (2001). 67. Weintraub,H. et al. Activation of muscle specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc. Natl. Acad. Sci. U. S. A 86 5434 5438 (1989). 68. Meissner,A., Wernig,M., & Jaenisch,R. Direct reprogramming of geneticall y unmodified fibroblasts into pluripotent stem cells. Nat. Biotechnol. 25 1177 1181 (2007). 69. Takahashi,K. & Yamanaka,S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126 663 676 (200 6).

PAGE 139

139 70. Wernig,M. et al. In vitro reprogramming of fibroblasts into a pluripotent ES cell like state. Nature 448 318 324 (2007). 71. Nakagawa,M. et al. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Bi otechnol 26 101 106 (2008). 72. Okita,K. et al. A more efficient method to generate integration free human iPS cells. Nat Methods 8 409 412 (2011). 73. Takahashi,K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131 861 872 (2007). 74. Parrizas,M. et al. Hepatic nuclear factor 1 alpha directs nucleosomal hyperacetylation to its tissue specific transcriptional targets. Mol. Cell Biol. 21 3234 3243 (2001). 75. Pontoglio,M., Faust,D.M., Doyen,A., Yaniv,M., & Weiss,M.C. Hepatocyte nuclear factor 1alpha gene inactivation impairs chromatin remodeling and demethylation of the phenylalanine hydroxylase gene. Mol. Cell Biol. 17 4948 4956 (1997). 76. Rollini,P. & Fo urnier,R.E. The HNF 4/HNF 1alpha transactivation cascade regulates gene activity and chromatin structure of the human serine protease inhibitor gene cluster at 14q32.1. Proc. Natl. Acad. Sci. U. S. A 96 10308 10313 (1999). 77. Soutoglou,E., Papafotiou, G., Katrakili,N., & Talianidis,I. Transcriptional activation by hepatocyte nuclear factor 1 requires synergism between multiple coactivator proteins. J. Biol. Chem. 275 12515 12520 (2000). 78. Hui,H. & Perfetti,R. Pancreas duodenum homeobox 1 regulates pancreas development during embryogenesis and islet cell function in adulthood. Eur. J Endocrinol. 146 129 141 (2002). 79. Stoffel,M. et al. Localization of human homeodomain transcription factor insulin promoter factor 1 (IPF1) to chromosome band 13q12.1. Genomics 28 125 126 (1995). 80. Leonard,J. et al. Characterization of somatostatin transactivating factor 1, a novel homeobox factor th at stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol. 7 1275 1283 (1993). 81. Miller,C.P., McGehee,R.E., Jr., & Habener,J.F. IDX 1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that t ransactivates the somatostatin gene. EMBO J 13 1145 1156 (1994). 82. Ohlsson,H., Karlsson,K., & Edlund,T. IPF1, a homeodomain containing transactivator of the insulin gene. EMBO J 12 4251 4259 (1993).

PAGE 140

140 83. Brooke,N.M., Garcia Fernandez,J., & Holland ,P.W. The ParaHox gene cluster is an evolutionary sister of the Hox gene cluster. Nature 392 920 922 (1998). 84. Guz,Y. et al. Expression of murine STF 1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121 11 18 (1995). 85. Offield,M.F. et al. PDX 1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122 983 995 (1996). 86. Jonsson ,J., Carlsson,L., Edlund,T., & Edlund,H. Insulin promoter factor 1 is required for pancreas development in mice. Nature 371 606 609 (1994). 87. Stoffers,D.A., Zinkin,N.T., Stanojevic,V., Clarke,W.L., & Habener,J.F. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet 15 106 110 (1997). 88. Campbell,S.C. & Macfarlane,W.M. Regulation of the pdx1 gene promoter in pancreatic beta cells. Biochem. Biophys. Res. Commun. 299 277 284 (2002). 89. Gao,N. et al. Dynamic regulation of Pdx1 enhancers by Foxa1 and Foxa2 is essential for pancreas development. Genes Dev 22 3435 3448 (2008). 90. Gerrish,K., Cissell,M.A., & Stein,R. The role of hepatic nuclear factor 1 alpha and PDX 1 in transcriptio nal regulation of the pdx 1 gene. J. Biol. Chem. 276 47775 47784 (2001). 91. Gerrish,K. et al. Pancreatic beta cell specific transcription of the pdx 1 gene. The role of conserved upstream control regions and their hepatic nuclear factor 3beta sites. J Biol Chem 275 3485 3492 (2000). 92. Melloul,D., Marshak,S., & Cerasi,E. Regulation of pdx 1 gene expression. Diabetes 51 Suppl 3 S320 S325 (2002). 93. Samaras,S.E. et al. The islet beta cell enriched RIPE3b1/Maf transcription factor regulates pdx 1 expression. J Biol Chem 278 12263 12270 (2003). 94. Samaras,S.E. et al. Conserved sequences in a tissue specific regulatory region of the pdx 1 gene mediate transcription in Pancreatic beta cells: role for hepatocyte nuclear factor 3 beta and Pax6. M ol Cell Biol 22 4702 4713 (2002). 95. Sharma,S. et al. Hormonal regulation of an islet specific enhancer in the pancreatic homeobox gene STF 1. Mol Cell Biol 17 2598 2604 (1997). 96. Sharma,S. et al. Pancreatic islet expression of the homeobox fact or STF 1 relies on an E box motif that binds USF. J Biol Chem 271 2294 2299 (1996).

PAGE 141

141 97. Van Velkinburgh,J.C., Samaras,S.E., Gerrish,K., Artner,I., & Stein,R. Interactions between areas I and II direct pdx 1 expression specifically to islet cell types o f the mature and developing pancreas. J Biol Chem 280 38438 38444 (2005). 98. Vanhoose,A.M. et al. MafA and MafB regulate Pdx1 transcription through the Area II control region in pancreatic beta cells. J Biol Chem 283 22612 22619 (2008). 99. Wu,K.L et al. Hepatocyte nuclear factor 3beta is involved in pancreatic beta cell specific transcription of the pdx 1 gene. Mol Cell Biol 17 6002 6013 (1997). 100. Waeber,G., Thompson,N., Nicod,P., & Bonny,C. Transcriptional activation of the GLUT2 gene by th e IPF 1/STF 1/IDX 1 homeobox factor. Mol Endocrinol. 10 1327 1334 (1996). 101. Watada,H. et al. Involvement of the homeodomain containing transcription factor PDX 1 in islet amyloid polypeptide gene transcription. Biochem Biophys Res Commun 229 746 751 (1996). 102. Watada,H. et al. PDX 1 induces insulin and glucokinase gene expressions in alphaTC1 clone 6 cells in the presence of betacellulin. Diabetes 45 1826 1831 (1996). 103. Kaneto,H. et al. PDX 1 functions as a master factor in the pancreas. Front Biosci. 13 6406 6420 (2008). 104. Ritz Laser,B. et al. Ectopic expression of the beta cell specific transcription factor Pdx1 inhibits glucagon gene transcription. Diabetologia 46 810 821 (2003). 105. Meivar Levy,I. et al. Pancreatic and duodenal home obox gene 1 induces hepatic dedifferentiation by suppressing the expression of CCAAT/enhancer binding protein beta. Hepatology 46 898 905 (2007). 106. Gradwohl,G., Dierich,A., LeMeur,M., & Guillemot,F. neurogenin3 is required for the development of the f our endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97 1607 1611 (2000). 107. Sommer,L., Ma,Q., & Anderson,D.J. neurogenins, a novel family of atonal related bHLH transcription factors, are putative mammalian neuronal determination gene s that reveal progenitor cell heterogeneity in the developing CNS and PNS. Mol Cell Neurosci. 8 221 241 (1996). 108. Apelqvist,A. et al. Notch signalling controls pancreatic cell differentiation. Nature 400 877 881 (1999). 109. Lee,J.C. et al. Regulati on of the pancreatic pro endocrine gene neurogenin3. Diabetes 50 928 936 (2001).

PAGE 142

142 110. Jacquemin,P. et al. Transcription factor hepatocyte nuclear factor 6 regulates pancreatic endocrine cell differentiation and controls expression of the proendocrine gen e ngn3. Mol Cell Biol 20 4445 4454 (2000). 111. Rukstalis,J.M. & Habener,J.F. Neurogenin3: a master regulator of pancreatic islet differentiation and regeneration. Islets. 1 177 184 (2009). 112. Watada,H. Neurogenin 3 is a key transcription factor for differentiation of the endocrine pancreas. Endocr. J. 51 255 264 (2004). 113. Huang,H.P. et al. Regulation of the pancreatic islet specific gene BETA2 (neuroD) by neurogenin 3. Mol Cell Biol 20 3292 3307 (2000). 114. Smith,S.B. et al. Neurogenin3 and hepatic nuclear factor 1 cooperate in activating pancreatic expression of Pax4. J Biol Chem 278 38254 38259 (2003). 115. Oster,A. et al. Rat endocrine pancreatic development in relation to two homeobox gene products (Pdx 1 and Nkx 6.1). J Histochem. Cytochem. 46 707 715 (1998). 116. Inoue,H. et al. Isolation, characterization, and chromosomal mapping of the human Nkx6.1 gene (NKX6A), a new pancreatic islet homeobox gene. Genomics 40 367 370 (1997). 117. Lyttle,B.M. et al. Transcriptio n factor expression in the developing human fetal endocrine pancreas. Diabetologia 51 1169 1180 (2008). 118. Schisler,J.C. et al. The Nkx6.1 homeodomain transcription factor suppresses glucagon expression and regulates glucose stimulated insulin secretio n in islet beta cells. Proc. Natl. Acad. Sci. U. S. A 102 7297 7302 (2005). 119. Sander,M. et al. Homeobox gene Nkx6.1 lies downstream of Nkx2.2 in the major pathway of beta cell formation in the pancreas. Development 127 5533 5540 (2000). 120. Watada, H., Mirmira,R.G., Leung,J., & German,M.S. Transcriptional and translational regulation of beta cell differentiation factor Nkx6.1. J Biol. Chem. 275 34224 34230 (2000). 121. Gauthier,B.R., Gosmain,Y., Mamin,A., & Philippe,J. The beta cell specific transc ription factor Nkx6.1 inhibits glucagon gene transcription by interfering with Pax6. Biochem. J 403 593 601 (2007). 122. Schisler,J.C. et al. Stimulation of human and rat islet beta cell proliferation with retention of function by the homeodomain transcr iption factor Nkx6.1. Mol. Cell Biol. 28 3465 3476 (2008).

PAGE 143

143 123. Jorgensen,M.C., Vestergard,P.H., Ericson,J., Madsen,O.D., & Serup,P. Cloning and DNA binding properties of the rat pancreatic beta cell specific factor Nkx6.1. FEBS Lett. 461 287 294 (1999) 124. Mirmira,R.G., Watada,H., & German,M.S. Beta cell differentiation factor Nkx6.1 contains distinct DNA binding interference and transcriptional repression domains. J Biol. Chem. 275 14743 14751 (2000). 125. Iype,T. et al. The transcriptional repressor Nkx6.1 also functions as a deoxyribonucleic acid context dependent transcriptional activator during pancreatic beta cell differentiation: evidence for feedback activation of the nkx6.1 gene by Nkx6.1. Mol. Endocrinol. 18 136 3 1375 (2004). 126. Taylor,D.G., Babu,D., & Mirmira,R.G. The C terminal domain of the beta cell homeodomain factor Nkx6.1 enhances sequence selective DNA binding at the insulin promoter. Biochemistry 44 11269 11278 (2005). 127. Lupi,R. et al. Transcript ion factors of beta cell differentiation and maturation in isolated human islets: effects of high glucose, high free fatty acids and type 2 diabetes. Nutr. Metab Cardiovasc. Dis. 16 e7 e8 (2006). 128. Odom,D.T. et al. Control of pancreas and liver gene e xpression by HNF transcription factors. Science 303 1378 1381 (2004). 129. Yang,Q. et al. Hepatocyte nuclear factor 1alpha modulates pancreatic beta cell growth by regulating the expression of insulin like growth factor 1 in INS 1 cells. Diabetes 51 178 5 1792 (2002). 130. Emens,L.A., Landers,D.W., & Moss,L.G. Hepatocyte nuclear factor 1 alpha is expressed in a hamster insulinoma line and transactivates the rat insulin I gene. Proc. Natl. Acad. Sci. U. S. A 89 7300 7304 (1992). 131. Vaxillaire,M. et al Identification of nine novel mutations in the hepatocyte nuclear factor 1 alpha gene associated with maturity onset diabetes of the young (MODY3). Hum. Mol. Genet. 6 583 586 (1997). 132. Yamagata,K. et al. Mutations in the hepatocyte nuclear factor 1alpha gene in maturity onset diabetes of the young (MODY3). Nature 384 455 458 (1996). 133. Byrne,M.M. et al. Altered insulin secretory responses to glucose in diabetic and nondiabetic subjects with mutations in the diabetes susceptibility gene MODY3 on chromosome 12. Diabetes 45 1503 1510 (1996). 134. Ferrer,J. A genetic switch in pancreatic beta cells: implications for differentiation and haploinsufficiency. Diabetes 51 2355 2362 (2002). 135. Nammo,T. et al. Expression profile of MODY3/HNF 1alpha protein in the developing mouse pancreas. Diabetologia 45 1142 1153 (2002).

PAGE 144

144 136. Nammo,T. et al. Expression of HNF 4alpha (MODY1), HNF 1beta (MODY5), and HNF 1alpha (MODY3) proteins in the developing mouse pancreas. Gene Expr. Patterns. 8 96 106 (2008). 137. Baumhueter,S., Courtois,G., Morgan,J.G., & Crabtree,G.R. The role of HNF 1 in liver specifi c gene expression. Ann. N. Y. Acad. Sci. 557 272 8, discussion (1989). 138. Mendel,D.B. & Crabtree,G.R. HNF 1, a member of a novel class of dimerizing homeodomain proteins. J. Biol. Chem. 266 677 680 (1991). 139. Bach,I. et al. Cloning of human hepatic nuclear factor 1 (HNF1) and chromosomal localization of its gene in man and mouse. Genomics 8 155 164 (1990). 140. Bach,I., Pontoglio,M., & Yaniv,M. Structure of the gene encoding hepatocyte nuclear factor 1 (HNF1). Nucleic Acids Res. 20 4199 4204 (199 2). 141. Kuo,C.J., Conley,P.B., Hsieh,C.L., Francke,U., & Crabtree,G.R. Molecular cloning, functional expression, and chromosomal localization of mouse hepatocyte nuclear factor 1. Proc. Natl. Acad. Sci. U. S. A 87 9838 9842 (1990). 142. Frain,M. et al. The liver specific transcription factor LF B1 contains a highly diverged homeobox DNA binding domain. Cell 59 145 157 (1989). 143. Kozak,M. An analysis of 5' noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15 8125 8148 (1987) 144. Tian,J.M. & Schibler,U. Tissue specific expression of the gene encoding hepatocyte nuclear factor 1 may involve hepatocyte nuclear factor 4. Genes Dev. 5 2225 2234 (1991). 145. Juven Gershon,T., Hsu,J.Y., Theisen,J.W., & Kadonaga,J.T. The RNA pol ymerase II core promoter the gateway to transcription. Curr. Opin. Cell Biol. 20 253 259 (2008). 146. Kritis,A.A., Ktistaki,E., Barda,D., Zannis,V.I., & Talianidis,I. An indirect negative autoregulatory mechanism involved in hepatocyte nuclear factor 1 gene expression. Nucleic Acids Res. 21 5882 5889 (1993). 147. Miura,N. & Tanaka,K. Analysis of the rat hepatocyte nuclear factor (HNF) 1 gene promoter: synergistic activation by HNF4 and HNF1 proteins. Nucleic Acids Res. 21 3731 3736 (1993). 148. Webe r,H. et al. Regulation and function of the tissue specific transcription factor HNF1 alpha (LFB1) during Xenopus development. Int. J. Dev. Biol. 40 297 304 (1996).

PAGE 145

145 149. Lu,P., Liu,J., Melikishvili,M., Fried,M.G., & Chi,Y.I. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element. Acta Crystallogr. Sect. F. Struct. Biol. Cryst. Commun. 64 313 317 (2008). 150. Huang,J., Karakucuk,V., Levitsky,L.L., & Rhoads,D .B. Expression of HNF4alpha variants in pancreatic islets and Ins 1 beta cells. Diabetes Metab Res. Rev. (2008). 151. Chouard,T. et al. A distal dimerization domain is essential for DNA binding by the atypical HNF1 homeodomain. Nucleic Acids Res. 18 5853 5863 (1990). 152. Nicosia,A. et al. A myosin like dimerization helix and an extra large homeodomain are essential elements of the tripartite DNA binding structure of LFB1. Cell 61 1225 1236 (1990). 153. Affolter,M., Schier,A., & Gehring,W.J. Homeodomain proteins and the regulation of gene expression. Curr. Opin. Cell Biol. 2 485 495 (1990). 154. Gehring,W.J. et al. The structure of the homeodomain and its functional implications. Trends Genet. 6 323 329 (1990). 155. Gehring,W.J. et al. Homeodomain DN A recognition. Cell 78 211 223 (1994). 156. Baumhueter,S. et al. HNF 1 shares three sequence motifs with the POU domain proteins and is identical to LF B1 and APF. Genes Dev. 4 372 379 (1990). 157. Sturm,R.A. & Herr,W. The POU domain is a bipartite DNA binding structure. Nature 336 601 604 (1988). 158. Chouard,T., Jeannequin,O., Rey Campos,J., Yaniv,M., & Traincard,F. A set of polyclonal and monoclonal antibodies reveals major differences in post translational modification of the rat HNF1 and vHNF1 ho meoproteins. Biochimie 79 707 715 (1997). 159. Bach,I. & Yaniv,M. More potent transcriptional activators or a transdominant inhibitor of the HNF1 homeoprotein family are generated by alternative RNA processing. EMBO J. 12 4229 4242 (1993). 160. Foulkes ,N.S. & Sassone Corsi,P. More is better: activators and repressors from the same gene. Cell 68 411 414 (1992). 161. Frain,M., Hardon,E., Ciliberto,G., & Sala Trepat,J.M. Binding of a liver specific factor to the human albumin gene promoter and enhancer. Mol. Cell Biol. 10 991 999 (1990). 162. Herr,W. et al. The POU domain: a large conserved region in the mammalian pit 1, oct 1, oct 2, and Caenorhabditis elegans unc 86 gene products. Genes Dev. 2 1513 1516 (1988).

PAGE 146

146 163. Schrem,H., Klempnauer,J., & Borlak,J. Liver enriched transcription factors in liver function and development. Part I: the hepatocyte nuclear factor network and liver specific gene expression. Pharmacol. Rev. 54 129 158 (2002). 164. Herr,W. & Cleary,M.A. The POU domain: versatility in transcriptional regulation by a flexible two in one DNA binding domain. Genes Dev. 9 1679 1693 (1995). 165. Pontoglio,M. Hepatocyte nuclear factor 1, a transcription factor at the crossroads of glucose homeostasis. J. Am. Soc. Nephrol. 11 Suppl 16 S 140 S143 (2000). 166. Nagaki,M. & Moriwaki,H. Transcription factor HNF and hepatocyte differentiation. Hepatol. Res. (2008). 167. Boj,S.F., Parrizas,M., Maestro,M.A., & Ferrer,J. A transcription factor regulatory circuit in differentiated pancreatic cells Proc. Natl. Acad. Sci. U. S. A 98 14481 14486 (2001). 168. Shih,D.Q. & Stoffel,M. Dissecting the transcriptional network of pancreatic islets during development and differentiation. Proc. Natl. Acad. Sci. U. S. A 98 14189 14191 (2001). 169. Harries,L .W., Ellard,S., Stride,A., Morgan,N.G., & Hattersley,A.T. Isomers of the TCF1 gene encoding hepatocyte nuclear factor 1 alpha show differential expression in the pancreas and define the relationship between mutation position and clinical phenotype in monog enic diabetes. Hum. Mol. Genet. 15 2216 2224 (2006). 170. Orom,U.A., Nielsen,F.C., & Lund,A.H. MicroRNA 10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. Mol Cell 30 460 471 (2008). 171. Filipowicz,W., Bhattacharyya,S.N., & Sonenberg,N. Mechanisms of post transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet 9 102 114 (2008). 172. Hino,K., Fukao,T., & Watanabe,M. Regulatory interaction of HNF1 alpha to microRNA 194 gene during intestinal epitheli al cell differentiation. Nucleic Acids Symp. Ser. (Oxf) 415 416 (2007). 173. Hino,K. et al. Inducible expression of microRNA 194 is regulated by HNF 1alpha during intestinal epithelial cell differentiation. RNA. 14 1433 1442 (2008). 174. Pontoglio,M. et al. Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome. Cell 84 575 585 (1996).

PAGE 147

147 175. Baumhueter,S., Courtois,G., & Crabtree,G.R. A variant nuclear protein in dedifferentiated hepatoma cell s binds to the same functional sequences in the beta fibrinogen gene promoter as HNF 1. EMBO J. 7 2485 2493 (1988). 176. Cereghini,S., Blumenfeld,M., & Yaniv,M. A liver specific factor essential for albumin transcription differs between differentiated and dedifferentiated rat hepatoma cells. Genes Dev. 2 957 974 (1988). 177. Cereghini,S., Yaniv,M., & Cortese,R. Hepatocyte dedifferentiation and extincti on is accompanied by a block in the synthesis of mRNA coding for the transcription factor HNF1/LFB1. EMBO J. 9 2257 2263 (1990). 178. de,S., V et al. LFB3, a heterodimer forming homeoprotein of the LFB1 family, is expressed in specialized epithelia. EMBO J. 10 1435 1443 (1991). 179. Bach,I., Mattei,M.G., Cereghini,S., & Yaniv,M. Two members of an HNF1 homeoprotein family are expressed in human liver. Nucleic Acids Res. 19 3553 3559 (1991). 180. Mendel,D.B., Hansen,L.P., Graves,M.K., Conley,P.B., & Cra btree,G.R. HNF 1 alpha and HNF 1 beta (vHNF 1) share dimerization and homeo domains, but not activation domains, and form heterodimers in vitro. Genes Dev. 5 1042 1056 (1991). 181. Lazzaro,D., de,S., V, De Magistris,L., Lehtonen,E., & Cortese,R. LFB1 and LFB3 homeoproteins are sequentially expressed during kidney development. Development 114 469 479 (1992). 182. Ott,M.O., Rey Campos,J., Cereghini,S., & Yaniv,M. vHNF1 is expressed in epithelial cells of distinct embryonic origin during development and pr ecedes HNF1 expression. Mech. Dev. 36 47 58 (1991). 183. Rey Campos,J., Chouard,T., Yaniv,M., & Cereghini,S. vHNF1 is a homeoprotein that activates transcription and forms heterodimers with HNF1. EMBO J. 10 1445 1457 (1991). 184. Pontoglio,M. et al. De fective insulin secretion in hepatocyte nuclear factor 1alpha deficient mice. J. Clin. Invest 101 2215 2222 (1998). 185. Shih,D.Q. et al. Loss of HNF 1alpha function in mice leads to abnormal expression of genes involved in pancreatic islet development a nd metabolism. Diabetes 50 2472 2480 (2001). 186. Lee,Y.H., Sauer,B., & Gonzalez,F.J. Laron dwarfism and non insulin dependent diabetes mellitus in the Hnf 1alpha knockout mouse. Mol. Cell Biol. 18 3059 3068 (1998).

PAGE 148

148 187. Luco,R.F. et al. A conditional model reveals that induction of hepatocyte nuclear factor 1alpha in Hnf1alpha null mutant beta cells can activate silenced genes postnatally, whereas overexpression is deleterious. Diabetes 55 2202 2211 (2006). 188. Hagenfeldt Johansson,K.A. et al. Beta cell targeted expression of a dominant negative hepatocyte nuclear factor 1 alpha induces a maturity onset diabetes of the young (MODY)3 like phenotype in transgenic mice. Endocrinology 142 5311 5320 (2001). 189. Yamagata,K. et al. Overexpression o f dominant negative mutant hepatocyte nuclear fctor 1 alpha in pancreatic beta cells causes abnormal islet architecture with decreased expression of E cadherin, reduced beta cell proliferation, and diabetes. Diabetes 51 114 123 (2002). 190. Fukui,K. et al. The HNF 1 target collectrin controls insulin exocytosis by SNARE complex formation. Cell Metab 2 373 384 (2005). 191. Yamagata,K. et al. The HNF 1alpha SNARE connection. Diabetes Obes. Metab 9 Suppl 2 40 45 (2007). 192. Wobser,H. et al. Dominant ne gative suppression of HNF 1 alpha results in mitochondrial dysfunction, INS 1 cell apoptosis, and increased sensitivity to ceramide but not to high glucose induced cell death. J. Biol. Chem. 277 6413 6421 (2002). 193. Wang,H., Maechler,P., Hagenfeldt,K .A., & Wollheim,C.B. Dominant negative suppression of HNF 1alpha function results in defective insulin gene transcription and impaired metabolism secretion coupling in a pancreatic beta cell line. EMBO J. 17 6701 6713 (1998). 194. Wang,H., Antinozzi,P.A. Hagenfeldt,K.A., Maechler,P., & Wollheim,C.B. Molecular targets of a human HNF1 alpha mutation responsible for pancreatic beta cell dysfunction. EMBO J. 19 4257 4264 (2000). 195. Bulla,G.A. & Kraus,D.M. Dissociation of the hepatic phenotype from HNF4 a nd HNF1alpha expression. Biosci. Rep. 24 595 608 (2004). 196. Deutsch,G., Jung,J., Zheng,M., Lora,J., & Zaret,K.S. A bipotential precursor population for pancreas and liver within the embryonic endoderm. Development 128 871 881 (2001). 197. Cereghini,S Liver enriched transcription factors and hepatocyte differentiation. FASEB J. 10 267 282 (1996). 198. Tronche,F., Ringeisen,F., Blumenfeld,M., Yaniv,M., & Pontoglio,M. Analysis of the distribution of binding sites for a tissue specific transcription fa ctor in the vertebrate genome. J. Mol. Biol. 266 231 245 (1997).

PAGE 149

149 199. Eeckhoute,J., Formstecher,P., & Laine,B. Hepatocyte nuclear factor 4alpha enhances the hepatocyte nuclear factor 1alpha mediated activation of transcription. Nucleic Acids Res. 32 258 6 2593 (2004). 200. Ktistaki,E. & Talianidis,I. Modulation of hepatic gene expression by hepatocyte nuclear factor 1. Science 277 109 112 (1997). 201. Citron,B.A. et al. Identity of 4a carbinolamine dehydratase, a component of the phenylalanine hydroxylation system, and DCoH, a transregulator of homeodomain proteins. Proc Natl Acad Sci U S A 89 11891 11894 (1992). 202. Endrizzi,J.A., Cronk,J.D., Wang,W., Crabtree,G.R., & Alber,T. Crystal structure of DCoH, a bifunctional, protein binding transcriptional coactivator. Science 268 556 559 (1995). 203. Johnen,G. & Kaufman,S. Studies on the enzymatic and transcriptional activity of the dimerization cofactor for hepatocyte n uclear factor 1. Proc. Natl. Acad. Sci. U. S. A 94 13469 13474 (1997). 204. Mendel,D.B. et al. Characterization of a cofactor that regulates dimerization of a mammalian homeodomain protein. Science 254 1762 1767 (1991). 205. Hauer,C.R. et al. Phenylala nine hydroxylase stimulating protein/pterin 4 alpha carbinolamine dehydratase from rat and human liver. Purification, characterization, and complete amino acid sequence. J Biol Chem 268 4828 4831 (1993). 206. Ficner,R., Sauer,U.H., Ceska,T.A., Stier,G., & Suck,D. Crystallization and preliminary crystallographic studies of recombinant dimerization cofactor of transcription factor HNF1/pterin 4 alpha carbinolamine dehydratase from liver. FEBS Lett 357 62 64 (1995). 207. Rose,R.B. et al. Structural basis o f dimerization, coactivator recognition and MODY3 mutations in HNF 1alpha. Nat Struct. Biol 7 744 748 (2000). 208. Bayle,J.H. et al. Hyperphenylalaninemia and impaired glucose tolerance in mice lacking the bifunctional DCoH gene. J. Biol. Chem. 277 2888 4 28891 (2002). 209. Rose,R.B., Pullen,K.E., Bayle,J.H., Crabtree,G.R., & Alber,T. Biochemical and structural basis for partially redundant enzymatic and transcriptional functions of DCoH and DCoH2. Biochemistry 43 7345 7355 (2004). 210. Ban,N. et al. H epatocyte nuclear factor 1alpha recruits the transcriptional co activator p300 on the GLUT2 gene promoter. Diabetes 51 1409 1418 (2002). 211. Struhl,K. Histone acetylation and transcriptional regulatory mechanisms. Genes Dev. 12 599 606 (1998).

PAGE 150

150 212. Wo rkman,J.L. & Kingston,R.E. Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu. Rev. Biochem. 67 545 579 (1998). 213. Kuo,C.J. et al. A transcriptional hierarchy involved in mammalian cell type specification. Nature 355 457 461 (1992). 214. Watt,A.J., Garrison,W.D., & Duncan,S.A. HNF4: a central regulator of hepatocyte differentiation and function. Hepatology 37 1249 1253 (2003). 215. Gupta,R.K. et al. The MODY1 gene HNF 4alpha regulates selected genes involved in ins ulin secretion. J. Clin. Invest 115 1006 1015 (2005). 216. Miura,A. et al. Hepatocyte nuclear factor 4alpha is essential for glucose stimulated insulin secretion by pancreatic beta cells. J. Biol. Chem. 281 5246 5257 (2006). 217. Rhee,J. et al. Regulat ion of hepatic fasting response by PPARgamma coactivator 1alpha (PGC 1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc. Natl. Acad. Sci. U. S. A 100 4012 4017 (2003). 218. Wang,H., Maechler,P., Antinozzi,P.A., Hagenfeldt,K.A., & Wollheim,C.B. Hepatocyte nuclear factor 4alpha regulates the expression of pancreatic beta cell genes implicated in glucose metabolism and nutrient induced insulin secretion. J. Biol. Chem. 275 35953 35959 (2000). 219. Sladek,F.M., Zhong,W.M., Lai,E., & Darnell,J.E., Jr. Liver enriched transcription factor HNF 4 is a novel member of the steroid hormone receptor superfamily. Genes Dev. 4 2353 2365 (1990). 220. Bogan,A.A. et al. Analysis of protein dimerization and ligan d binding of orphan receptor HNF4alpha. J. Mol. Biol. 302 831 851 (2000). 221. Briancon,N. et al. Expression of the alpha7 isoform of hepatocyte nuclear factor (HNF) 4 is activated by HNF6/OC 2 and HNF1 and repressed by HNF4alpha1 in the liver. J. Biol. Chem. 279 33398 33408 (2004). 222. Briancon,N. & Weiss,M.C. In vivo role of the HNF4alpha AF 1 activation domain revealed by exon swapping. EMBO J. 25 1253 1262 (2006). 223. Drewes,T., Senkel,S., Holewa,B., & Ryffel,G.U. Human hepatocyte nuclear factor 4 isoforms are encoded by distinct and differentially expressed genes. Mol. Cell Biol. 16 925 931 (1996). 224. Eeckhoute,J. et al. Hepatocyte nuclear factor 4 alpha isoforms originated from the P1 promoter are expressed in human pancreatic beta cells and exhibit stronger transcriptional potentials than P2 promoter driven isoforms. Endocrinology 144 1686 1694 (2003).

PAGE 151

151 225. Furuta,H. et al. Organization and partial sequence of the hepatocyte nuclear factor 4 alpha/MODY1 gene and identification of a missense mutation, R127W, in a Japanese family with MODY. Diabetes 46 1652 1657 (1997). 226. Green,V.J., Kokkotou,E., & Ladias,J.A. Criti cal structural elements and multitarget protein interactions of the transcriptional activator AF 1 of hepatocyte nuclear factor 4. J. Biol. Chem. 273 29950 29957 (1998). 227. Hata,S., Tsukamoto,T., & Osumi,T. A novel isoform of rat hepatocyte nuclear fac tor 4 (HNF 4). Biochim. Biophys. Acta 1131 211 213 (1992). 228. Hata,S. et al. Identification of two splice isoforms of mRNA for mouse hepatocyte nuclear factor 4 (HNF 4). Biochim. Biophys. Acta 1260 55 61 (1995). 229. Ihara,A. et al. Functional charac terization of the HNF4alpha isoform (HNF4alpha8) expressed in pancreatic beta cells. Biochem. Biophys. Res. Commun. 329 984 990 (2005). 230. Iyemere,V.P., Davies,N.H., & Brownlee,G.G. The activation function 2 domain of hepatic nuclear factor 4 is regula ted by a short C terminal proline rich repressor domain. Nucleic Acids Res. 26 2098 2104 (1998). 231. Kistanova,E. et al. The activation function 1 of hepatocyte nuclear factor 4 is an acidic activator that mediates interactions through bulky hydrophobic residues. Biochem. J. 356 635 642 (2001). 232. Nakhei,H., Lingott,A., Lemm,I., & Ryffel,G.U. An alternative splice variant of the tissue specific transcription factor HNF4alpha predominates in undifferentiated murine cell types. Nucleic Acids Res. 26 4 97 504 (1998). 233. Ruse,M.D., Jr., Privalsky,M.L., & Sladek,F.M. Competitive cofactor recruitment by orphan receptor hepatocyte nuclear factor 4alpha1: modulation by the F domain. Mol. Cell Biol. 22 1626 1638 (2002). 234. Sladek,F.M., Ruse,M.D., Jr., N epomuceno,L., Huang,S.M., & Stallcup,M.R. Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 4alpha1. Mol. Cell Biol. 19 6509 6522 (1999). 235. Taravi ras,S., Monaghan,A.P., Schutz,G., & Kelsey,G. Characterization of the mouse HNF 4 gene and its expression during mouse embryogenesis. Mech. Dev. 48 67 79 (1994). 236. Thomas,H. et al. A distant upstream promoter of the HNF 4alpha gene connects the transc ription factors involved in maturity onset diabetes of the young. Hum. Mol. Genet. 10 2089 2097 (2001).

PAGE 152

152 237. Torres Padilla,M.E., Fougere Deschatrette,C., & Weiss,M.C. Expression of HNF4alpha isoforms in mouse liver development is regulated by sequential promoter usage and constitutive 3' end splicing. Mech. Dev. 109 183 193 (2001). 238. Huang,J.M., Levitsky,L.L., & Rhoads,D.B. Novel P2 promoter derived HNF 4 alpha isoforms with different N terminus generated by alternate exon insertion. Experimental Cell Research 315 1200 1211 (2009). 239. Davuluri,R.V., Suzuki,Y., Sugano,S., Plass,C., & Huang,T.H. The functional consequences of alternative promoter use in mammalian genomes. Trends Genet. 24 167 177 (2008). 240. Harries,L.W. et al. The diabetic phenotype in HNF4A mutation carriers is moderated by the expression of HNF4A isoforms from the P1 promoter during fetal development. Diabetes 57 1745 1752 (2008). 241. Hansen,S.K. et al. Genetic evidence that HNF 1alpha dependent transcriptional control of HNF 4alpha is essential for human pancreatic beta cell function. J. Clin. Invest 110 827 833 (2002). 242. Hadzopoulou Cladaras,M. et al. Functional domains of the nuclear receptor hepatocyte nuclear factor 4. J. Biol. Chem. 272 539 550 (1997). 243. Chen,W.S. et al. Disruption of the HNF 4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos Genes Dev. 8 2466 2477 (1994). 244. Duncan,S.A., Nagy,A., & Chan,W. Murine gastrulation requires HNF 4 regulated gene expression in the visceral endoderm: tetraploid rescue of Hnf 4( / ) embryos. Development 124 279 287 (1997). 245. Kulkarni,R.N. & K ahn,C.R. Molecular biology. HNFs -linking the liver and pancreatic islets in diabetes. Science 303 1311 1312 (2004). 246. Duncan,S.A., Navas,M.A., Dufort,D., Rossant,J., & Stoffel,M. Regulation of a transcription factor network required for differentiati on and metabolism. Science 281 692 695 (1998). 247. Thorgeirsson,S.S. Hepatic stem cells in liver regeneration. FASEB J 10 1249 1256 (1996). 248. Iynedjian,P.B. Mammalian glucokinase and its gene. Biochem J 293 ( Pt 1) 1 13 (1993). 249. Printz,R.L., Magnuson,M.A., & Granner,D.K. Mammalian glucokinase. Annu. Rev Nutr. 13 463 496 (1993).

PAGE 153

153 250. Blouin,A., Bolender,R.P., & Weibel,E.R. Distribution of organelles and membranes between hepatocytes and nonhepatocytes in the rat liver parenchyma. A stereological study. J. Cell Biol. 72 441 455 (1977). 251. Pillich,R.T., Scarsella,G., & Risuleo,G. Overexpression of the Pdx 1 homeodomain transcription factor impairs glucose metabolism in cultured rat hepatocytes. Molecules. 13 2659 2673 (2008). 2 52. Odom,D.T. et al. Core transcriptional regulatory circuitry in human hepatocytes. Mol Syst. Biol 2 2006 (2006). 253. Schrem,H., Klempnauer,J., & Borlak,J. Liver enriched transcription factors in liver function and development. Part II: the C/EBPs and D site binding protein in cell cycle control, carcinogenesis, circadian gene regulation, liver regeneration, apoptosis, and liver specific gene regulation. Pharmacol. Rev 56 291 330 (2004). 254. Li,S.W. et al. Pancreatic duodenal homeobox 1 protein is a novel beta cell specific autoantigen for type I diabetes. Lab Invest 90 31 39 (2010). 255. Donelan,W.L., Koya,V., Li,S.W., & Yang,L.J. Distinct regulation of HNF1alpha by NKX6.1 in pancreatic beta cells. J. Biol. Chem. (2010). 256. Chang,L.J., Urlacher, V., Iwakuma,T., Cui,Y., & Zucali,J. Efficacy and safety analyses of a recombinant human immunodeficiency virus type 1 derived vector system. Gene Ther. 6 715 728 (1999). 257. Chang,L.J. & Zaiss,A.K. Lentiviral vectors. Preparation and use. Methods Mol. M ed. 69 303 318 (2002). 258. Chang,L.J. & Zaiss,A.K. Self inactivating lentiviral vectors and a sensitive Cre loxP reporter system. Methods Mol. Med. 76 367 382 (2003). 259. Derman,E. et al. Transcriptional control in the production of liver specific mR NAs. Cell 23 731 739 (1981). 260. Courtois,G., Baumhueter,S., & Crabtree,G.R. Purified hepatocyte nuclear factor 1 interacts with a family of hepatocyte specific promoters. Proc. Natl. Acad. Sci. U. S. A 85 7937 7941 (1988). 261. Jose Estanyol,M., Poli ard,A., Foiret,D., & Danan,J.L. A common liver specific factor binds to the rat albumin and alpha foetoprotein promoters in vitro and acts as a positive trans acting factor in vivo. Eur. J. Biochem. 181 761 766 (1989). 262. Lichtsteiner,S. & Schibler,U. A glycosylated liver specific transcription factor stimulates transcription of the albumin gene. Cell 57 1179 1187 (1989).

PAGE 154

154 263. Monaci,P., Nicosia,A., & Cortese,R. Two different liver specific factors stimulate in vitro transcription from the human alpha 1 antitrypsin promoter. EMBO J. 7 2075 2087 (1988). 264. Ramji,D.P., Tadros,M.H., Hardon,E.M., & Cortese,R. The transcription factor LF A1 interacts wi th a bipartite recognition sequence in the promoter regions of several liver specific genes. Nucleic Acids Res. 19 1139 1146 (1991). 265. Vaulont,S. et al. Proteins binding to the liver specific pyruvate kinase gene promoter. A unique combination of know n factors. J. Mol. Biol. 209 205 219 (1989). 266. Vaulont,S., Puzenat,N., Kahn,A., & Raymondjean,M. Analysis by cell free transcription of the liver specific pyruvate kinase gene promoter. Mol. Cell Biol. 9 4409 4415 (1989). 267. Blumenfeld,M., Maury,M ., Chouard,T., Yaniv,M., & Condamine,H. Hepatic nuclear factor 1 (HNF1) shows a wider distribution than products of its known target genes in developing mouse. Development 113 589 599 (1991). 268. Satoh,S. et al. Nuclear factor 1 family members interact with hepatocyte nuclear factor 1alpha to synergistically activate L type pyruvate kinase gene transcription. J Biol. Chem. 280 39827 39834 (2005). 269. Gregori,C., Kahn,A., & Pichard,A.L. Competition between transcription factors HNF1 and HNF3, and alter native cell specific activation by DBP and C/EBP contribute to the regulation of the liver specific aldolase B promoter. Nucleic Acids Res. 21 897 903 (1993). 270. Uchizono,Y. et al. Role of HNF 1alpha in regulating the expression of genes involved in ce llular growth and proliferation in pancreatic beta cells. Diabetes Res. Clin. Pract. 84 19 26 (2009). 271. Borowiec,M. et al. Mutations at the BLK locus linked to maturity onset diabetes of the young and beta cell dysfunction. Proc. Natl. Acad. Sci. U. S A 106 14460 14465 (2009). 272. McCarthy,M.I. & Hattersley,A.T. Learning from molecular genetics: novel insights arising from the definition of genes for monogenic and type 2 diabetes. Diabetes 57 2889 2898 (2008). 273. Fujimoto,K. & Polonsky,K.S. Pdx1 and other factors that regulate pancreatic beta cell survival. Diabetes Obes. Metab 11 Suppl 4 30 37 (2009). 274. Palmer,J.P. et al. Insulin antibodies in insulin dependent diabetics before insulin treatment. Science 222 1337 1339 (1 983).

PAGE 155

155 275. Bottazzo,G.F., Florin Christensen,A., & Doniach,D. Islet cell antibodies in diabetes mellitus with autoimmune polyendocrine deficiencies. Lancet 2 1279 1283 (1974). 276. Baekkeskov,S. et al. Identification of the 64K autoantigen in insulin de pendent diabetes as the GABA synthesizing enzyme glutamic acid decarboxylase. Nature 347 151 156 (1990). 277. Bonifacio,E., Lampasona,V., Genovese,S., Ferrari,M., & Bosi,E. Identification of protein tyrosine phosphatase like IA2 (islet cell antigen 512) as the insulin dependent diabetes related 37/40K autoantigen and a target of islet cell antibodies. J Immunol 155 5419 5426 (1995). 278. Burbelo,P.D., Groot,S., Dal akas,M.C., & Iadarola,M.J. High definition profiling of autoantibodies to glutamic acid decarboxylases GAD65/GAD67 in stiff person syndrome. Biochem. Biophys. Res. Commun. 366 1 7 (2008). 279. Burbelo,P.D. et al. Comparison of radioimmunoprecipitation wi th luciferase immunoprecipitation for autoantibodies to GAD65 and IA 2beta. Diabetes Care 33 754 756 (2010). 280. Burbelo,P.D. et al. A new luminescence assay for autoantibodies to mammalian cell prepared insulinoma associated protein 2. Diabetes Care 31 1824 1826 (2008). 281. Burbelo,P.D., Goldman,R., & Mattson,T.L. A simplified immunoprecipitation method for quantitatively measuring antibody responses in clinical sera samples by using mammalian produced Renilla luciferase antigen fusion proteins. BMC. Biotechnol. 5 22 (2005). 282. Burbelo,P.D. et al. Rapid antibody quantification and generation of whole proteome antibody response profiles using LIPS (luciferase immunoprecipitation systems). Biochem. Biophys. Res. Commun. 352 889 895 (2007). 283. Eff ects of insulin in relatives of patients with type 1 diabetes mellitus. N. Engl. J Med 346 1685 1691 (2002). 284. Mahon,J.L. et al. The TrialNet Natural History Study of the Development of Type 1 Diabetes: objectives, design, and initial results. Pediatr. Diabetes 10 97 104 (2009). 285. Li,S.W. et al. Expression, purification, and characterization of recombinant human pancreatic duodenal homeobox 1 protein in Pichia pastoris. Protein Expr. Purif. 72 157 161 (2010). 286. Bonifacio,E. et al. Inte rnational Workshop on Lessons From Animal Models for Human Type 1 Diabetes: identification of insulin but not glutamic acid decarboxylase or IA 2 as specific autoantigens of humoral autoimmunity in nonobese diabetic mice. Diabetes 50 2451 2458 (2001).

PAGE 156

156 287 Chen,W. et al. Evidence that a peptide spanning the B C junction of proinsulin is an early Autoantigen epitope in the pathogenesis of type 1 diabetes. J Immunol 167 4926 4935 (2001). 288. Zhang,L., Nakayama,M., & Eisenbarth,G.S. Insulin as an autoanti gen in NOD/human diabetes. Curr. Opin. Immunol 20 111 118 (2008). 289. Wenzlau,J.M. et al. The cation efflux transporter ZnT8 (Slc30A8) is a major autoantigen in human type 1 diabetes. Proc. Natl. Acad. Sci. U. S. A 104 17040 17045 (2007). 290. Burbelo ,P.D., Kisailus,A.E., & Peck,J.W. Detecting protein protein interactions using Renilla luciferase fusion proteins. Biotechniques 33 1044 8, 1050 (2002). 291. Predki,P.F., Mattoon,D., Bangham,R., Schweitzer,B., & Michaud,G. Protein microarrays: a new tool for profiling antibody cross reactivity. Hum. Antibodies 14 7 15 (2005). 292. Rahman,A. & Isenberg,D.A. Systemic lupus erythematosus. N. Engl. J Med 358 929 939 (2008). 293. Ashizawa,S., Brunicardi,F.C., & Wang,X.P. PDX 1 and the pancreas. Pancreas 28 109 120 (2004). 294. Hidalgo,M. Pancreatic cancer. N. Engl. J Med 362 1605 1617 (2010). 295. Banting,F.G., Best,C.H., Collip,J.B., Campbell,W.R., & Fletcher,A.A. Pancreatic Extracts in the Treatment of Diabetes Mellitus. Can. Med Assoc. J 12 141 146 (1922). 296. Robertson,R.P. Prevention of recurrent hypoglycemia in type 1 diabetes by pancreas transplantation. Acta Diabetol. 36 3 9 (1999). 297. Sutherland,D.E. et al. Twin to twin pancreas transplantation: reversal and reenactment of the pathogenesis of type I diabetes. Trans. Assoc. Am Physicians 97 80 87 (1984). 298. Shapiro,A.M. et al. Islet transplantation in seven patients with type 1 diabetes mellitus using a g lucocorticoid free immunosuppressive regimen. N. Engl. J Med 343 230 238 (2000). 299. Tzakis,A.G. et al. Pancreatic islet transplantation after upper abdominal exenteration and liver replacement. Lancet 336 402 405 (1990).

PAGE 157

157 300. Shuhong Han, Wi lliam Donelan, Westley Reeves & Li Jun Yang (2011). Autoantigen Specific Immunotherapy, Type 1 Diabetes Pathogenesis, Genetics and Immunotherapy, David Wagner (Ed.), ISBN: 978 953 307 362 0, InTech, Available from: http://www.intechopen.com/books/type 1 diabetes pathogenesis genetics and immunotherapy/autoantigen specific immunotherapy

PAGE 158

158 BIOGRAPHICAL SKETCH William LePage Donelan was born in Adams, M assachusetts in the United States of America on May 10, 1982. Early in life, h e moved to New York and gradua ted from Saratoga Springs High School in 2000. He attended the Crane School of Music and t he State University of New York (SUNY) at Potsdam unt il 2006 and received a B.A. in m usic and a B.S. i n b iology. Will then moved to Gainesville Florid a to attend gr aduate school at t he University of Florida College of Medicine. He was accepted to the Interdisciplinary Program in Biomedical Sciences and worked in the laboratory of Dr. Li Jun Yang until grad uating in 2012 with a Ph.D. in medical s cience s