Transcriptional Regulation of Notch Signaling

MISSING IMAGE

Material Information

Title:
Transcriptional Regulation of Notch Signaling
Physical Description:
1 online resource (127 p.)
Language:
english
Creator:
Lin, Shuibin
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Genetics (IDP)
Committee Chair:
Wu, Lizi
Committee Members:
Bloom, David C
Lu, Jianrong
Huang, Suming

Subjects

Subjects / Keywords:
ddx5 -- epigenetics -- maml1 -- myogenesis -- notch -- sfmbt1
Genetics (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Notch signaling is a highly conserved, critical developmental signaling pathway. Deregulated Notch signaling is linked with a variety of diseases including cancers. Therefore, a better understanding of how Notch signaling is tightly regulated is critical for the identification of new therapeutic approaches to block Notch-deregulated diseases. My work focused on two aspects of Notch transcriptional regulation, including the Notch transcription factor CSL-mediated transcriptional repression and Notch signal-induced switch in CSL transcriptional activation. I also studied the mechanisms and functions of one novel CSL-interacting protein, SFMBT1, in skeletal myogenesis.   First, to investigate the molecular basis of CSL-mediated transcriptional repression, we isolated the in vivo CSL protein complex followed by mass spectrometric analysis. We showed that CSL is associated with transcriptional co-regulators including histone demethylase LSD1 complex proteins and polycomb protein SFMBT1. Combined with the further analysis showing that the SFMBT1 protein complex includes the CtBP/LSD1/HDACs complex, polycomb repressive complex components, and MBT family proteins, our study revealed the biochemical basis of CSL-mediated transcriptional repression.  Next, we characterized the CSL/Notch/MAML transcription complex in leukemic cells harboring activating NOTCH1 mutations. We revealed that DDX5, an ATP-dependent DEAD-box RNA helicase, as an interacting protein for the Notch transcriptional co-activator MAML1. DDX5 regulates transcription of Notch target genes, and is required for proliferation and survival of T-ALL leukemic cells. Additionally, DDX5 is highly expressed in primary human T-ALL samples. Therefore, DDX5 is an important positive regulator of Notch signaling.  Finally, we characterized the biological functions and mechanisms of SFMBT1 in skeletal myogenesis. We found that SFMBT1 negatively regulates myogenic differentiation. Though SFMBT1 represses certain Notch target genes in myoblasts, the major function of SFMBT1 is to interact with MyoD, the master regulator of myogenesis, and induce epigenetic silencing of MyoD-mediated transcription. Importantly, Sfmbt1 depletion resulted in impaired muscle regeneration in vivo. Therefore, our study identified a mechanism accounting for the functions of SFMBT1 in transcriptional repression, and revealed essential roles of Sfmbt1 in myogenesis.  In summary, my research identified novel molecular mechanisms of Notch signaling and revealed the roles and mechanisms of the novel epigenetic regulator SFMBT1 in myogenesis.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Shuibin Lin.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Wu, Lizi.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044651:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 TRANSCRIPTIONAL REGULATION OF NOTCH SIGNALING By SHUIBIN LIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Shuibin Lin

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to thank my PhD advisor, Dr. Lizi Wu, for her encouragement and support over the past few years. Her passion and vision in science always inspire me to pursue interesting scientific questions. Most importantly, she supported me to think critically and helped me grow as an independent researcher. I would like to sincerely thank my committee members, Drs. David Bloom, Suming Huang, and Jianro ng Lu, for their valuable efforts, suggestions, and support over the years. They offered helpful comments from different perspectives, which made my project progress much faster. I would also like to thank all the Wu lab members. The Wu lab members are re ally wonderful and have become my second family. I would like to specifically thank Dr. Baofeng Jin and Dr. Huangxuan Shen for teaching me the basic laboratory techniques and helping me both scientifically and personally. I also would like to thank Qiuna W ang, Yumei Gu, Chunxia Cao, Zirong Chen, and Chengbin Hu for their support, assistance, and friendship during my PhD training. I really appreciate the support and assistance from the administrative and secretarial staffs in the College of Medicine and the Genetics Concentration. I would like to thank Dr Wayne McCormack, Susan Gardener and Valerie Cloud Driver for their wonderful help in my first year of study In addition I would like to thank Dr. Henry Baker, Joyce Conners and Kristyn Minkoff for thei r support in the Genetics Concentration. I also want to thank our collaborators, Drs. Charles Keller, Jianliang (Jason) Li, Jianrong Lu, Warren S. Pear and M. James You, for providing reagents, technical assistance, and valuable comments for our projects.

PAGE 5

5 Last but not least, I sincerely thank my parents, Yunsheng Lin and Manying Luo, my wife, Chunxiang Zhang, for their support, dedication, and encouragement in every step of my life. In addition, I would like to thank my daughter, Kexin Lin, for bringing so much joy to our family.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF F IGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 BACKGRO UND AND SIGNIFICANCE ................................ ................................ ... 15 Transcriptional Regulation ................................ ................................ ...................... 15 Eukaryotic Chromatin Structure ................................ ................................ ........ 15 Epigenetic Modifications ................................ ................................ ................... 15 Epigenetic Regulators ................................ ................................ ...................... 16 The LSD1 histone modification complex ................................ .................... 16 The polycomb protein SFMBT1 ................................ ................................ 17 Transcriptional Regulation of Notch Signaling ................................ ........................ 18 Notch Signaling in Development and Cancers ................................ ........................ 19 Notch Signaling in Embryonic Stem Cells ................................ ........................ 19 Notch Signaling in Hematopoiesis ................................ ................................ .... 19 Leukemogenic Activties of Notch Signaling ................................ ...................... 20 2 IDENTIFICATION OF NOVEL CSL INTERACTING NOTCH REGULATORS ........ 23 Introduction ................................ ................................ ................................ ............. 23 Materials and Methods ................................ ................................ ............................ 24 Plasmids ................................ ................................ ................................ ........... 24 Antibodies ................................ ................................ ................................ ......... 24 Cell Culture ................................ ................................ ................................ ....... 25 Virus Production, Titering and Transduction ................................ ..................... 25 Nuclear Extract Preparation, Protein Complex Isolation and Western Blot Analysis ................................ ................................ ................................ ......... 25 Luciferase Assay ................................ ................................ .............................. 26 Results ................................ ................................ ................................ .................... 26 Identification of CSL Associated Protein Complex ................................ ........... 26 LSD1 and SFMBT1 Interact with Notch Trans cription Factor CSL ................... 27 The polycomb Protein SFMBT1 Interacts with Multiple Transcriptional Repressive Complexes ................................ ................................ ................. 28 The CSL Inter acting Transcriptional Repressors Control Notch Transcription 30 Discussion ................................ ................................ ................................ .............. 30

PAGE 7

7 3 DDX5 IS A POSITIVE REGULATOR OF ONCOGENIC NOTCH 1 SIGNALING IN T CELL ACUTE LYMPHOBLASTIC LEUKEMIA ................................ ................ 41 Introduction ................................ ................................ ................................ ............. 41 Materials and Methods ................................ ................................ ............................ 43 Plasmids ................................ ................................ ................................ ........... 43 Antibodies ................................ ................................ ................................ ......... 43 Cell Culture, Transient Transfection and Reporter Assays ............................... 44 Immunoprecipitation and Western Blot Analysis ................................ .............. 44 Protein Complex Purification and Identification ................................ ................ 44 GST Pull Down Assay ................................ ................................ ...................... 45 Lentiviral Mediated ShRNA Knockdown ................................ ........................... 45 Real Time RT PCR ................................ ................................ .......................... 45 Proliferation Assays ................................ ................................ .......................... 46 Cell Cycle Analysis ................................ ................................ ........................... 46 Apoptosis Analysis ................................ ................................ ........................... 46 Chromatin Immunoprecipitation (ChIP) ................................ ............................ 47 Immunohistochemical Staining ................................ ................................ ......... 47 In Vivo Tumor Xenograft ................................ ................................ ................... 48 Results ................................ ................................ ................................ .................... 48 DDX5 Is Identified as a MAML1 Interacting Protein in a Proteomic Study ....... 48 MAML1 Interacts with DDX5 in Vitro and in Vivo ................................ .............. 49 DDX5 Is Associated with the Notch Transcription Activation Complex in Leukemic Cells ................................ ................................ .............................. 51 DDX5 Enhances Notch Mediated Transcription and DDX5 Depletion Reduces Expression of Notch Signature Genes in Leukemic Cells .............. 52 DDX5 Regulates Leukemic Cell Proliferation and Survival ............................... 54 DDX5 Depletion Results in Reduced T ALL Cell Growth in Vivo ...................... 55 DDX5 Is Highly Expres sed in Human T ALL Patient Samples ......................... 56 Discussion ................................ ................................ ................................ .............. 56 4 THE MBT PROTEIN SFMBT1 REGULATES MYOD MEDIATED EPIGENETIC SILENCING IN SKE LETAL MYOGENESIS ................................ ............................ 71 Introduction ................................ ................................ ................................ ............. 71 Materials and Methods ................................ ................................ ............................ 72 Pla smids ................................ ................................ ................................ ........... 72 Antibodies ................................ ................................ ................................ ......... 72 Cell Culture ................................ ................................ ................................ ....... 73 Virus Production, Titerin g and Transduction ................................ ..................... 73 Immunofluorescence Staining and Luciferase Assays ................................ ..... 73 Microarray Analyses ................................ ................................ ......................... 74 GST Pull Down Assay ................................ ................................ ...................... 74 Real Time RT PCR ................................ ................................ .......................... 74 Chromatin Immunoprecipitation (ChIP) ................................ ............................ 74 Dnase I Sensitivity Assay ................................ ................................ ................. 75

PAGE 8

8 Intramuscular Injection of Lentiviruses and CTX Induced Muscle Regeneration ................................ ................................ ................................ 75 Statistical Analyses of Experimental Data ................................ ........................ 75 Results ................................ ................................ ................................ .................... 76 Sfmbt1 Expression Is Down Regulated dur ing Myogenic Differentiation .......... 76 Over Expression of Exogenous SFMBT1 Blocks Myogenic Differentiation ...... 76 Sfmbt1 Depletion Enhances Myogenic Differentiation ................................ ...... 77 Sfmbt1 Represses the Transcription of Myogenin and Myofibrillar Genes ....... 78 Sfmbt1 Interacts with Musc le Transcription Factor MyoD ................................ 79 Sfmbt1 Recruits Multiple Repressive Complexes to Mediate Epigenetic Silencing of MyoD Targets ................................ ................................ ............ 80 Muscle Regeneration Is Impaired in Sfmbt1 Knockdown Muscles. .................. 82 Discussion ................................ ................................ ................................ .............. 83 5 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 108 Conclusions ................................ ................................ ................................ .......... 108 Future Directions ................................ ................................ ................................ .. 110 LIST OF REFERENCES ................................ ................................ ............................. 113 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 127

PAGE 9

9 LIST OF TABLES Table page 4 1 List of primers used in the study. ................................ ................................ ........ 87 4 2 List of genes up regulated in Sfmbt1 knockdown C2C12 myoblasts. ................. 88 4 3 List of genes down regulated in Sfmbt1 knockdown C2C12 myob lasts. ............ 93

PAGE 10

10 LIST OF FIGURES Figure page 1 1 The Notch signaling pathway ................................ ................................ .............. 22 2 1 Overvi ew of the experimental design ................................ ................................ .. 34 2 2 Identification of the in vivo CSL interacting protein complex ............................... 35 2 3 LSD1 and SFMBT1 intera ct with Notch transcription factor CSL ........................ 36 2 4 Identification of the SFMBT1 protein complex ................................ .................... 37 2 5 SFMBT1 interacts with multiple transcriptiona l repressive complexes proteins .. 38 2 6 The CSL interacting epigenetic regulators repress the transcription of Notch signaling ................................ ................................ ................................ ............. 39 2 7 Model of CSL mediated epigenetic regulation of Notch signaling ....................... 40 3 1 MAML1 specifically interacts with DDX5 in vitro and in vivo ............................... 61 3 2 DDX5 is associated with the Notch transcription activation complex in leukemic cells ................................ ................................ ................................ ..... 62 3 3 Interaction between MAML1 and DDX5 is independent of nuclear acids ........... 63 3 4 DDX5 enhances Notch mediated transcription and its depletion reduces expression levels of Notch target genes in NOTCH1 mutated KOPT K1 cells ... 64 3 5 DDX5 depletion has little effects on expression of Notch target genes and cell proliferation in SUPT13 cells that do es not have abnormally active Notch signaling ................................ ................................ ................................ ............. 65 3 6 DDX5 knockdown results in a reduction in T ALL cell proliferation and survival ................................ ................................ ................................ ............... 66 3 7 DDX5 knockdown reduces growth of human T ALL leukemia xenograft in nude mice ................................ ................................ ................................ ........... 67 3 8 The DDX5 knockdown and control cells have similar level of luciferase activities ................................ ................................ ................................ .............. 68 3 9 DDX5 gene expression is significantly up regulated in human T ALL patient samples ................................ ................................ ................................ .............. 69

PAGE 11

11 3 10 GSI (Compound E; ComE) treatment inhibits expression of Notch target genes, but has little or no effects on T ALL cell proliferation after two and four day treatmen t ................................ ................................ ................................ ..... 70 4 1 Sfmbt1 is a negative regulator of myogenic differentiation ............................... 101 4 2 Sfmbt1 knockdown promotes myogenic differentiation ................................ ..... 102 4 3 Sfmbt1 regulates MyoD target genes in C2C12 myoblasts .............................. 103 4 4 Sfmbt1 interacts with myogenic master transcription factor MyoD ................... 104 4 5 Sfmbt1 recruits multiple transcriptionally repressive complexes and epigenetically represses MyoD mediated transcription of Myogenin ( Myog ) .... 105 4 6 Dynamic changes in muscle regeneration ................................ ........................ 106 4 7 Sfmbt1 regulates muscle regeneration in vivo ................................ .................. 1 07

PAGE 12

12 L IST OF ABBREVIATIONS AML Ac ute myeloid leukemia Bp Base pair CSL CBF1 /Su (H)/Lag1 CTX Cardiotoxin DN Double negative ETP Early lymphoid progenitor s GFP Green f luorescent p rotein HSC Hematopoietic stem cells HSPCs H ematopoietic stem and progenitor cells FBS Fetal b ovine s erum IACUC Institutional Animal Care & Use Committee ICN Intracellular domain of Notch I.p. I ntraperitoneal PBS Phosphate b uffered s aline PhoRC Pho repressive complex PRE polycomb responsive element PRC polycomb repressive complex MBT M alignant brain tumor TA T ibia lis anterior T ALL T cell acute lymphoblastic leukemia TAN1 T runcated, constitutively active Notch1

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TRANSCRIPTIONAL REGU LATION OF NOTCH SIGN ALING By Shuibin Lin August 20 1 2 Chair: Lizi Wu Major: Medical Science Genetics Notch signaling is a highly conserved critical developmental signaling pathway. Deregulated Notch signaling is linked with a variety of diseases including cancers. Therefore, a better understanding of how Notch signaling is tightly regulated is critical for the identification of new therapeutic approaches to block Notch deregulated diseases My work f ocused on two aspects of Notch transcriptional regulation, including the Notch transcription factor CSL mediated transcriptional repression and Notch signal induced switch in CSL transcriptional activation. I also studied the mechanisms and functions of on e novel CSL interacting protein, SFMBT1, in skeletal myogenesis. First, to investigate the molecular basis of CSL mediated transcriptional repression we isolated the in vivo CSL protein complex followed by mass spectrometric analysis We showed th at CSL is associated with t ranscriptional co regulators including histone demethylase LSD1 complex proteins and polycomb protein SFMBT1. Combined with the further analysis showing that the SFMBT1 protein complex includ es the CtBP/LSD1/HDACs complex, polyco mb repressive co mplex components, and MBT family proteins, our study revealed the biochemical basis of CSL mediated transcription al repression.

PAGE 14

14 Next, we characterized the CSL/Notch/MAML transcription complex in leukemic cells harboring activa ting NOTCH1 mutations. We revealed that DDX5, an ATP dependent DEAD box RNA helicase, as an interacting protein for the Notch transcriptional co activator MAML1. DDX5 regulates transcription of Notch target gene s and is required for proliferation and survival of T ALL leukemic cells Additionally, DDX5 is highly expressed in primary human T ALL samples. Therefore, DDX5 is an important positive regulator of Notch signaling Finally, we characterized the biological functions and mechanisms of SFMBT1 in skeletal m yogenesis We found that SFMBT1 negatively regulates myogenic differentiation. Though SFMBT1 represses certain Notch target genes in myoblasts, the major function of SFMBT1 is to interact with MyoD, the master regulator of myogenesis and induce epigenetic silencing of MyoD mediated transcription. Importantly, Sfmbt1 depletion resulted in impaired muscle regeneration in vivo Therefore, our study identified a mechanism accounting for the functions of SFMBT1 in transcription al repression, and revealed essent ial roles of Sfmbt1 in myogenesis. In summary, my research identified novel molecular mechanisms of Notch signaling and revealed the roles and mechanisms of the novel epigenetic regulator SFMBT1 in myogenesis.

PAGE 15

15 CHAPTER 1 BACKGROUND AND SIGNI FICANCE Transc riptional Regulation Eukaryotic Chromatin Structure E ukaryotic chromatin, which consists of DNA and its associated proteins, undergoes multiple levels of compaction that eventually pack s DNA of about 3 meter s in length into a nucleus with less than 10 M i n diameter (1) Structurally, eukaryotic chromatin can be grouped into heterochromatin and euchromatin (2) The chromatin structure is dynamically regulated and plays imp ortant functions in diverse processes including DNA replication and repair, gene transcription and cell cycle progression (1) For example, h eterochromatin is highly condensed and associated with transcriptional repression b ecause DNA is inaccessible to tr an scriptional machinery, while euchromatin is open and indicates regions of active gene transcription. Eukaryotic chromatin consists of the repeating nucleosome core particle s and the f the eukaryotic chromatin, the nucleosome, is a nucleic acid protein complex including approximately 147 base pairs of DNA wound around an octameric histone cor e, a globular structure consisting of two molecules of histone H2A, H2B, H3 and H4. The tails of the histones, mostly the N terminal tails protrude outside of the octamer and are subject to different posttranslational modifications (3, 4) Epigenetic Modifications Epigenetic modifications regulate the gene transcriptional events without changing genetic DNA sequence (5) Two important forms of e pigenetic modifications are DNA methylation and histone modifications. DNA methylation is a dynamic process that

PAGE 16

16 regulates multiple cellular events such as genomic imprinting, chromatin structure, gene transcription and cell identity (6 8) Histone modifications such as acetylation, methylation, ubiquitination and phosphorylation can occur at over 60 different residues on his tones, mostly on the N terminal tails, regulating chromatin structure, DN A replication and repair and gene transcription (9) Histone modification statu s on gene promoters is linked with transcriptional activities (10) F or example, histone methylation on H3K4 and histone acetylation are generally associated with transcriptional act ivation while methylation on H3K9, H3K27 and deacetylation are usually linked with transcriptional repression (9, 10) E pigenetic Regulators D iverse epigenetic modifications are established and maintained by specific epigenetic regulators DNA methyltransfer ases and the TET family proteins regulate dynamic DNA methylation/demethylation processes (7, 8) H istone modification enzymes modify the histones and establish specific histone epigenetic marks (11) C hromatin reader proteins such as the MBT fam ily members recognize the epigenetic marks and coordinate different epigenetic modification processes (12) The functional cooperation of different epigenetic regulators modifies chromatin structure s and impacts target gene transcription. The LSD1 histone modification complex The LSD1 demethylase (also known as AOF2, BHC110, and KDM1 A ) is the first discovered lysine specific demethylase that removes methylatio n residues from H3K4me1/ 2, which are histone ma rks commonly associated with active transcription (13) Therefore, LSD1 mainly functions as a transcriptional co repressor. LSD1 associate s with HDAC1/2, CoREST and BHC80 which function cooperatively with

PAGE 17

17 LSD1 in regulating transcriptional repression (13 15) For example, HDACs provide hypoacetylated histone substrates, which are more susceptible to CoREST/LSD1 mediated histone demethylation (15) Conversely LSD1 interplay s with HDACs and further en hances deacetylation of histone H3 by HDAC1 (16) Intriguingly L SD1 can also promote tra nscription of androgen receptor and estrogen receptor target genes by deme thyl ating H3K9me1/2, a mark associat ed with transcriptional silencing (17 19) Functionally, LSD1 regulates diverse b iological processes such as hematopoiesis (20, 21) germline immortality (22) DNA methylation maintenance (23) cancer invasion and metastasis (24) The polycomb protein SFMBT1 Polyc omb repressive complex proteins are essential for the establishment and maintenance of tissue specific gene expression patterns during embryonic development. Three distinct polycomb repressive complexes (PRC) PRC1, PRC2 and PhoRC (Pho repressive complex ) function cooperatively in transcriptional repression (25 28) The mammalian PRC2 complex, which consists of EED, EZH1/2, SUZ12 and RBBP4/7, function s in the initiation of transcription repression by catalyzing H3K2 7 tri methylation. The PRC1 complex mainly composed of RING1/2, CBX2/4/8, PHC1/2/3, BMI1 and SCMH1/SCML2 binds to H3K27me3 and catalyzes H2AK119 ubiquitination. In addition, PRC1 is found to perturb the RNA Pol ymerase II function and compact chromatin (25) The recently characterized PhoRC (Pho repressiv e complex ) in Drosophila, consisting of the DNA binding protein Pho and MBT (malignant brain tumor) d omain containing protein dSfmbt, might function in recruitment of other polycomb proteins to target loci (29, 30)

PAGE 18

18 T he polycomb protein SFMBT1 (Scm like with four mbt domains1) belong s to MBT protein family with the members characterized by the presence of two (dScm homologs), three (dL3mbtl homologs) or four (dSfmbt homologs) MBT domains. The MBT containing protein preferential binding to low methylated histones and recruit other co repressors to mediate transcriptional silencing (31 33) The PhoRC component SFMBT1 contain s four MBT domains and specifically recognizes mono and di methylated histones such as H3K9 me1/2 and H4K20 me1/2 in vitro (34, 35) Drosophila dSfmbt interacts with dScm and cooperates with dScm in repression of polyc omb target genes (34) dSfmbt knockout in Drosophila displays a classic polycomb phenotype showing strong and widespread de re pression of HOX genes (29) However, the biological functions and mechanisms of mammalian SFMBT1 remain unknown. Transcriptional Regulation of Notch Signaling Notch signaling is a highly conserved pathway regulati ng cell fate decisions in embryonic development and adult tissue homeostasis. After binding of the ligands (Jagged1, 2 and Dll1, 3, 4 in mammals), Notch receptors (Notch 1 4) undergo two proteolytic cleavages catalyzed by ADAM family metalloproteases and secretase, resulting in the release of the intracellular domain of Notch receptor s (ICN s ) from the cell membrane. ICN s then enter the nucleus where they bind to the transcription factor CSL ( C BF1, S u(H) and L AG 1) and activate transcription of Notch targ et genes (Figure 1 1 ) (36) In the abse nce of Notch receptor activation, CSL represses transcription by associating with transcriptional co repressors. For instance CSL was shown to interact

PAGE 19

19 with co repressors including SMRT (NCOR2)/HDAC1 complex (37) CIR (CBF1 interacting co repressor) (38) SPEN (SHARP, or SM RT/HDAC1 associated repressor protein) CtIP/CtBP co repressors (39 41) ETO (42) and SKIP (Ski interacting protein) (40, 43) and rep ress transcription of Notch target gene s When Notch receptors are activated, ICN interacts with CSL which further recruits co activators such as MAML1, h istone acetyltransferases (HATs) p300 and PCAF to activate transcription (44 46) Therefore, CSL functions as a transcriptional switch in response to Notch signals. However, the detailed molecular mechanisms underlying the CSL functional switch remain incomplete. Notch Signaling in Development and Cancers Notch Si gnaling i n Embryonic Stem Cells The Notch signaling path way regulates cell fate determination stem cell self renew al, and differentiation (47) In embryonic stem cells (ESCs) expression of multiple Notch ligands a nd receptors is detectable at both the mRNA and protein levels (48 51) ; however, Notch activity is low in embryonic stem cells, as indicated by low level of active cleaved forms of Notch receptors (49, 51) As a result, expression levels of Notch targets such as the Hes and Hey family genes are very low in ESCs. The Notch activity was found to increase during differentiation of ESCs. Furthermore, forced activation of Notc h si gnaling in ESCs promotes differentiation of ESCs to different lineages such as neural cells and T cells (50 52) N otch Signaling i n Hematopoiesis Hematopoiesis is a dynamic process in which hematopoietic stem cell s (HSC s ) differentiate into diverse types of blood lineage cells. Notch signaling is important in regulating hematopoietic stem cell generation and differentiation, since knockout of

PAGE 20

20 Notch1 severely impaired HSC development and hematopoietic cell different iation (53) One well characterized activity of Notch signaling is to promote T cell development at the expense of B cells as inactivation of Notch1 in mice blocked T cell development while causing an increase in B c ells (54) Conversely, mice transplanted with constitutively activated Notch1 transduced bon e marrow cells develop ed leukemia with increased populations of immature CD4+ CD8+ T cells in the bone marrow and in circulation (55) Also, when co cultured with the bone marrow stromal cells line OP9 over expressing Notch ligands, mouse hematopoietic pr ogenitor cells and human cord blood hematopoietic stem cells (CD34 + CD38 ) differentiate d into T cells (56, 57) indicating that Notch signaling can be used to promote T cell generation in vitro Emerging data also i ndicate th e important roles of Notch signaling in development of other hematopoietic cell li neages such as megakaryocyte (58) dendritic cells (59) and NK cells (60, 61) Leukemogenic Activties of Notch Signaling Abnormal Notch signaling is important in the pathogenesis of human T cell acute lymphoblastic leukemia (T ALL). The t(7;9)(q34;q34.3) chromosomal translocations encoding the trun cated, constitutively active Notch1 (TAN1) were first identified in a rare subset of the human T ALL patients (62) Later activat ing N OTCH1 mutations were detected in about 50 70% of human T ALL cases. There are tw o mutation hotspots: one in the Notch1 heterodimerization domain (HD) which increase s ICN1 cleavage and the other in the PEST domain which stabilize s the cleaved ICN1 (63) In addition, the los s of function mutat ions in the ubiquitin ligase FBW7 result ing in decrease d degradation of ICN1 were also frequently found in T ALL patients (64) M ice transplanted with bone marrow cells transduced with the activated Notch1 mutatio ns developed T ALL

PAGE 21

21 leukemia (65 67) further supporting t he oncogenic functions of Notch signaling Importantly i nhibition of aberrant Notch signaling suppress ed the growth and survival of certain leukemic cell lin es derived f rom human T ALL patients (63) Therefore, Notch signaling induces leukemogenesis and is required for leukemic cell survival

PAGE 22

22 Figure 1 1. A diagram of the Notch signaling pathway is shown (68) Notch signaling is a highly conserved pathway that is mediated by cell cell communication. The ligands on signaling cells interact with Notch receptors on the adjacent signal receiving cells and subsequently induce proteo lytic cleavages of Notch receptors, causing the release of the intracellular domains of Notch receptors (ICN) from the cell membrane followed by ICN nuclear entry. In the absence of Notch receptor activation, the Notch transcription factor CSL binds to the transcriptional co repressors and represses transcription of Notch target genes. In the presence of Notch receptor activation, the binding of nuclear ICN to CSL causes the release of transcriptional co repressors and the recruitment of transcriptional co activators to CSL, resulting in transcriptional activation of Notch target genes.

PAGE 23

23 CHAPTER 2 IDENTIFICATION OF NOVEL CSL INTERACTING NOTCH REGULATORS Introduction The Notch signaling pathway is essential for embryonic and postnatal development, control lin g cell proliferation, differentiation, and survival. A berrant Notch signaling is frequently associated with developmental disorders and tumor i genesis. Therefore, it is important to understand the mechanisms underlying the transcription al regulation of the Notch signaling pathway. CSL ( CBF1 /Su (H)/Lag1 ) is t he only Notch pathway transcription factor CSL that mediates transcription of Notch target genes. In the absence of Notch signals, CSL represses target gene transcription via associating with transcriptio n repressors. After Notch receptor activation by ligand stimulation, binding of ICNs to CSL then induce s the release of co repressors and recruit ment of Notch co activators, resulting in transcriptional activation of Notch targets. Eukaryotic DNA is highl y packaged into chromatin through tight interactions with histone proteins, which prevents the accessibility of DNA to cellular machiner ies for DNA replication, transcription and repair For gene transcription, chromatin must be open first so that DNA is a ccess ible to RNA Polymerase II Previous studies revealed that certain epigenetic modifiers such as HDACs and HATs interact with CSL and play important functions in the regulation of Notch signaling (36) However, gene transcription is a complex process that requires the cooperation of multiple epigenetic modifications including chromatin remodeling, DNA methylation and histone modifications. The detailed molecular mechanisms underlying the functions of CSL in the epigenetic regulation of Notch target gene transcription remains incomplete.

PAGE 24

24 To investigate how CSL functions as a molecular switch in response to Notch activities we utilized a proteomic approach to isolate and characterize the CSL protein complex In this study, we found that the majority of CSL associated proteins function in chromatin remodeling and histone modifications suggesting the importance of epigenetic modifications i n the regulation of Notch signaling Materials and Methods Plasmids The cDNAs for h uman CSL w as cloned into the pOZ FH vector (69) to generate pOZ FH_CSL that express FLAG HA tagged CSL proteins. T he retroviral based ICN1 expression vector (pMigR1_ICN1) (67) and a Notch responsive reporter containing 4 artificial CSL binding site (pCSL luc) (70) were previously described. pQCXIP FLAG SFMBT1 plasmid was kindly provided by Dr. Judd C. Rice. GFP SFMBT1 was generated with the pEGFP C3 vector. pCMV2 FLAG L3MBTL3 was kindly provided by Dr. Toru Miyazaki The FLAG tagged RING2 and HPH2 plasmids were kindly provided by Dr. Hengbin Wang The FLAG EZH2 was a gift from Dr. Jianrong Lu. The FLAG SUZ12 was kindly provided by Dr. Akihide Yoshimi Antibodies The antibodies were obtained from commercial sources: LSD1 (Abcam ab17721); M2 (Sigma F 3165); GFP ( Santa Cruz sc8334 ); CoREST (Millipore 07 455); BHC80 (Abcam ab41631); HDAC1 (Thermo PA1 860 Santa Cruz sc7872 ); HDAC2 (Thermo PA1 861); EZH2 ( Millipore 07 400, Active Motif 39875); RNF2 (Active Motif 39663); PHC1 (Active Motif 39723 ); and SUZ12 (Millipore 07 379 )

PAGE 25

25 Cell Culture HeLa S3 U2OS and 293T medium (DMEM) with 10% heat inactivated fetal bovine serum and penicillin/streptomycin. Virus Production, Ti tering a nd Transduction Retroviral constructs ( pOZ FH, pQCXIP) were co transfected with the pMD.MLV.gag.pol (helper plasmid) and pMD. G (VSVG pseudotype) with Superfect Transfection Reagent in 293T to produce retrovirus es Supernatants containing retro virus es were collected and centrifuged at 25 000 rpm for 2 hours at 4 C using a SW28 rotor (Beckman). The pellets were suspended with 200 l PBS and the viral titers were determined following the technical manual from Open Biosystems. Viral transduction in cells was previously described (71) Stably transduced cells (polyclonal) were obtained and maintained by puromycin selection. Nuclear Ext ract Preparation, Protein Complex Isolation a nd Western Blot Analysis The detailed purification pro cedure was previously described (72) Briefly, nuclear extracts were first prepared from HeLa S3 or 293T cell s stabl y transduced with FLAG CSL or FLAG SFMBT1 T he CSL or SFMBT1 complexes were then purified by using anti F LAG M2 mAb conjugated agarose beads (Sigma) After extensive washing, protein complexes were eluted using a 50 g/ml FLAG elution buffer at r oom temper ature for 30 min. The eluted protein samples were separated on the 4 12% NuPAGE Bis tris gels (Invitrogen) and analyzed by LC MS/MS mass spectrometry. The procedure s for Western blotting and immunoprecipitation studies were described previously (73)

PAGE 26

26 Luciferase Assay Human U2OS o steosarcoma cells were used for the luciferase assays to determine the effects of the CSL associating proteins on the regulation of a Notch responsive promoter. Transfection s were performed using Superfect T ransfection R based reporter assays were performed using a dual luciferase kit from Promega as previously described (74) Results Identification of CSL Associated Protein Complex To understand the molecular mechanisms underlying transcriptional regulation of Notch signaling, Dr. Huangxuan Shen, a former postdoc in our lab, i dentified the CSL associated complex proteins by immunoprecip it ation of the CSL protein complex using the HeLa cells that stably expressed the F LAG CSL followed by mass spectr ometric analysis (Figure 2 1) The nuclear extracts from the FLAG CSL expressing cells and the control cells (transduced with emp ty vector) were used for immunoprecipitation with anti FLAG beads to pull down the in vivo CSL interacting protein complex. Then the pull down products were analyzed with SDS PAGE and the differential bands between the control and the CSL pull down product s were cut out and analyzed by mass spectrometry. As shown in Figure 2 2 Dr. Shen found the known CSL interacting proteins including HDAC1, SHARP, SMRT, MAML1 and NOTCH2 in the CSL protein complex. Also, he identified some novel CSL interacting protein candidates. The majority of the CSL associated proteins function in chromatin remodeling and histone modification, regulating gene transcription T he CSL interacting proteins can be classified into the

PAGE 27

27 following categories: 1) transcriptional co repressors including SHARP, SMRT, TBL1XR1 and the LSD1/CoREST complex components including LSD1, CoREST, HDAC1 and BHC80; 2) Pho r epressive c omplex (Ph oRC) complex protein SFMBT1, MBT protein L3MBTL3 and polycomb r epressi ve c omplex 2 (PRC2) anchor protein RBBP4; 3 ) DNA damage repair proteins such as PRKDC, PARP1, LIG3, XRCC5 and MSH2; 4) t ranscription co activators MAML1 and Notch2; and 5) mRNA processing machinery RNGTT, EEF1A1 and HNRPH1. These data suggest that these CSL interacting proteins might function co operatively in the regulation of Notch induced transcription. LSD1 a nd SFMBT1 Interact w ith Notch Transcription Factor CSL Our protein complex data identified novel CSL interacting epigenetic modifiers including the five core components of LSD1 complex and the polycomb protein SFMBT1 These data suggest potential critical role s of LSD1 and SFMBT1 in regulating Notch signaling. W e therefore hypothesized that LSD1 and SFMBT1 interact wi th CSL and negatively influence Notch/CSL regulated transcription. To test this hypothesis, Dr. Shen and I first validated the interactions between LSD1 SFMBT1 and CSL by co immunoprecipitation assay s Specifically, exogenous CSL proteins were immunoprecipitated with anti FLAG antibody from a stable HeLa cell line expressing FL AG CSL. We found that endogenous LSD1 was readily detected in the CSL immunoprecipitates by Western blot analysis indicating that LSD1 interacts with CSL in vivo (Fig ure 2 3 A ). Using a similar approach, we also confirmed that the polycomb protein SFMBT1 i nteracts with Notch transcription factor CSL (Fig ure 2 3 A ). Dr. Baofeng Jin, a former postdoc and Ms. Qiuna Wang, a former technician, next determined the binding domain of CSL that mediates the interaction of LSD1 and

PAGE 28

28 SFMBT1 The CSL protein contains dist inct domains including: 1) RHR N, which makes major groove contacts with DNA; 2) a beta trefoil domain (BTD) known to interact with Notch ICN1 a nd SMRT/N CoR; and 3) RHR C, which is required for DNA binding but does not make DNA contact (75, 76) They made various truncation mutants according to these domain arrangements of CSL as well as a form of repression defective CSL mutant, CBF1 (EEF219AAA). They generated GST fusion proteins bound to GST beads which were used as baits to bind the cellular lysates harvested from 293T cells with the transfection of FLAG LSD1 or FLAG SFMBT1 They found that the RHR N domain of CSL (aa1 159) is sufficient and necessary for the interaction with LSD1 and SFMBT1 because CSL (1 159aa) binds to LSD1, while the CSL mutant that lacks the N terminal domains fail s to bind to LSD1 and SFMBT1 (Fig ure 2 3B and C ). Therefore, the data indicate that both LSD1 and SFMBT1 interact with Notch transcription factor CSL and the N terminal region of CS L (1 159aa) is responsible for their interactions. The polycomb Protein SFMBT1 Interacts with Multiple Transcriptional Repressive Complexes The biological functions and mechanisms of action of the polycomb protein SFMBT1 are poorly characterized. Since t he Notch transcription factor CSL interacts with SFMBT1 that might function in recruitment of other transcriptional repressors, we hypothesized that SFMBT1 recruits other transcriptional repressors to regulate transcription of Notch target genes. Therefore Dr. Shen and I first determined the SFMBT1 intera cting partners by analyzing the cellular SFMBT1 protein complex. 293T cells were stably transduced with FLAG tagged SFMBT1 by retroviral infection followed by puromycin selection The SFMBT1 protein comple x was then purified by immunoprecipitati on with nuclear extracts from FLAG SFMBT1 expressing 29 3T cells

PAGE 29

29 using anti FLAG beads and subsequently eluted with FLAG peptides. The SFMBT1 associated proteins were separated by SDS PAGE and visualized by silver sta ining (Figure 2 4A) The subsequent mass spectrometric (MS) analysis revealed that SFMBT1 is associated with distinct transcriptional repressors including 17 components of CtBP/LSD1 protein complex, 11 members of polycomb repressive complexes, and 4 MBT pr otein family members (Figure 2 4B) This data revealed biochemical components of SFMBT1 protein complex, indicating that SFMBT1 mediates transcriptional repression by interacting with multiple transcriptional repression complexes. I next validated SFMBT1 interactions with transcription al co repressors including the LSD1 complex components, PRC members and MBT proteins identified from our MS analysis (Figure 2 4B) As shown in Figure 2 5A I immunoprecipitated FLAG SFMBT1 followed by Western blotting and v alidated that LSD1 core complex components, including LSD1, CoREST, BHC80, HDAC1 and HDAC2, are present in the SFMBT1 immunoprecipitates. Using similar assays, I observed that SFMBT1 interacts with PRC1 proteins, PHC1 and RNF2, but not with PRC2 members, EZH2 and SUZ12 (Figure 2 5B) which is consistent with our MS data (Figure 2 4B) Since our MS data also indicated significant interaction of SFMBT1 and L3MBTL3, I performed transient expression of GFP tagged SFMBT1 and FLAG tagged L3MBTL3 followed by co i mmunoprecipitation with anti FLAG antibodies and confirmed the interaction between SFMBT1 and L3MBTL3 (Figure 2 5C) In addition, I failed to detect SFMBT1 interaction with SMRT/HDAC3 co repressors, which is also consistent with our MS study (Figure 2 5D) Therefore, SFMBT1 specifically interacts with multiple

PAGE 30

30 transcriptional co repressors which suggests that SFMBT1 might be important in recruiting the CtBP/LSD1 /HDACs complex, PRC components and the MBT family proteins and coordinating transcriptional repr ession mediated by multiple repressors The CSL Interacting Transcriptional Repressors Control Notch Transcription To study the functions of CSL interacting epigenetic regulators in transcriptional regulation of Notch target genes, I utilized a Notch resp onsive luciferase reporter system. In this reporter (Figure 2 6A), transcription of the firefly luciferase gene is under the control of a promoter containing four copies of the CSL binding sites (70) Thus, Notch tr anscription factor CSL binds to the promoter and regulate transcription of the luciferase gene in response to Notch activities. As shown in Figure 2 6B, transcription of the luciferase reporter was strongly activated when the luciferase reporter was co tra nsfected with the active form of Notch, ICN1. However, activation of Notch responsive luciferase transcription was greatly reduced by the known CSL associated repressor SHARP. Using this system, we found that the LSD1 complex components and SFMBT1 strongly repressed the activity of the Notch responsive reporter. Also, the SFMBT1 associating PRC1 components, HPH2 and RNF2, repressed Notch reporter transcription, yet the PRC2 proteins EZH2 and SUZ12, which are not in the SFMBT1 protein complex, show little in hibitory effect of Notch mediated luciferase transcription. Therefore, the CSL interacting proteins we identified repress Notch target gene transcription. Discussion CSL is the only transcription factor of the Notch pathway that mediates the transcription of Notch target genes. Without ligand stimulation, CSL associates with the transcription co repressors and represses the transcription of Notch target genes CSL

PAGE 31

31 is known to recruit HDACs/HATs to Notch target promoters and controls repression/activation t hrough histone deacetylation/acetylation. However, histone deacetylation/acetylation enzymes do not work independently but cooperate with other enzymes to facilitate transcription regulation (9) From our proteomic study, we found that all the LSD1 complex proteins (LSD1, Co REST, B HC80, HDAC1 and HDAC2) are present in the CSL protein complex, indicating that the LSD1 com plex proteins might regulat e Notch target genes expression. In consistent with our data, i t was reported in 2002 that the CoREST co repressor complex including the LSD1 homolog, Spr 5 in Caenorhabdit is elegans functions in t ranscriptional repression of genes in Notch signaling pathway (77) In addition, knock out of Lsd1 markedly increased the Notch target gene Hey1 expression in the E17.5 pituitary, suggesting repressing the Notch target genes expression (78) Recently, two papers reported that LSD1 regulates Notch target gene transcription in both drosophila and mammalian systems, further confirming our p roteomic data (79, 80) Another important epigenetic regulator identified in the CSL protein complex is the SFMBT1. S FMBT1 is a polycomb protein that contains 4 MBT domains I t has both MBT and polycomb characterist ics and displays strong transcription repressive activities (29, 34, 35) However, the mechanisms accounting for S FMBT 1 function in transcriptional repression remain ed undetermined. I n Drosoph il a, dSfmbt forms the P hoRC with Pho, which recruits other polycomb proteins and meditates H3K27 trimethylation at target loci for transcriptional silencing H owever, SFMBT1 is not present in the mammalian Pho homolog YY1 protein complex (81) which suggests alternative mechanisms for SFMBT1 in transcription al regulation.

PAGE 32

32 Our data revealed that SFMBT1 is associated with multiple transcriptional repressors including CtBP /LSD1/HDAC s PRC and MBT proteins A ll these proteins are crit ical regulators of histone modifications, polycomb recruitment and chromatin compaction. The CtBP/LSD1/HDACs complex components catalyze histone demethylation/deacetylation (13, 82) and recruit polycomb proteins to target promoters (83, 84) In addition, the LSD1 complex functionally cooperates with PRC2 complex and media tes histone modifications on bivalent promoters that are established by PRC2 components (85, 86) PRC1 components maintain transcription repression and compact chromatin at target promoters (25) Moreover, the MBT protein Scm in the PRC1 complex ha s been reported to recruit other components of PRC2 and PRC1 to mediate histone modifications at target loci and repress transcription (33) In addition, L3MBTL proteins function as chromatin reader s and compact chromatin (31, 32) I dentification of the above transcriptional repressors in the SFMBT1 complex suggests that SFMBT1 might play a central role in coordinating diverse repressive complexes in transcrip tion repression. Given that SFMBT1 binds to low methylated repressive histone marks in vitro (29, 34, 35) SFMBT1 might function as a repressive chromatin reader and recruit multiple co repressor complexes to regula te the histone modifications and chromatin compaction at t arget loci to repress transcription. In summary, we identified novel CSL interacting epigenetic modifiers including the LSD1 complex proteins and the polycomb protein SFMBT1 through proteomic analys is of the CSL protein complex. We further studied the in vivo SFMBT1 protein complex to identify potential transcriptional regulators that might be recruited to Notch transcription factor CSL by SFMBT1. Our data revealed that SFMBT1 interacts with multiple

PAGE 33

33 transcriptional repressive complexes including the LSD1 complex proteins, MBT proteins, and PRC1 components. Using a Notch responsive luciferase reporter system, we showed that the CSL and SFMBT1 associated proteins function in transcriptional repression of Notch signaling. Therefore, our data indicate that the Notch transcription factor CSL recruits the LSD1 complex proteins and SFMBT1, which might further recruit other polycomb proteins and MBT proteins to mediate the epigenetic silencing of Notch signal ing (Figure 2 7).

PAGE 34

34 Figure 2 1 An o verview of the isolation and functional characterization of the CSL protein complex was shown The nuclear extracts from the FLAG CSL expressing cells and the control cells were collected for the purification of CSL a ssociated protein complex. The pull down products were separated by SDS PAGE and specific CSL associated proteins were further analyzed by mass spectrometry to identify the CSL interacting proteins. Mass spectrometry Digestion Data processing Affinity Binding Novel CSL partners Validation Functional c haracterization SDS PAGE (FLAG Tag Protein of Interest)

PAGE 35

35 Figure 2 2 Identification of the in vivo CSL inter acting protein complex A: The CSL protein complex was purified from the nuclear extract of HeLa S3 cells stably transduced with retroviruses expressing FLAG CSL using the anti FLAG agarose and analyzed by SDS PAGE. B: Mass spectrometry analysis revealed m ultiple proteins were presen t in the CSL protein complex. ( ( S S H H A A R R P P ) )

PAGE 36

36 Figure 2 3 LSD1 and SFMBT1 interact with the Notch transcription factor CSL A: Nuclear extracts of FLAG CSL expressing HeLa cells (upper panel) or FLAG SFMBT1 expressing 293T cells (lower pane l) were used for immunoprecipitations with anti FLAG antibody and blot with indicated antibod ies; B and C: GST CSL FL and various truncated mutant fusion proteins bound to GST beads were incubated with FLAG LSD1 or FLAG SFMBT1 and pulldown p roducts were su bjected to SDS PAGE followed by Western blotting with indicated antibodies

PAGE 37

37 Figure 2 4 Identification of the SFMBT1 protein complex. A: SFMBT1 protein complex was purified from the nuclear extracts of FLAG SFMBT1 expressing 293T cells using anti FLAG agarose and analyzed by SDS PAGE followed by silver staining B: Mass spectrometry analysis revealed a list of proteins identified in the SFMBT1 protein complex: Red line indicates the interactions between SFMBT1 and its associated partners; Blue line ind icates the interactions inside the same repressive protein complex; Black line indicates the interactions across different repressive complexes. A B

PAGE 38

38 Figure 2 5 SFMBT1 interacts with multiple transcriptional repressive complexes proteins A B and D : Nu cl ear extracts of stably transduced 293T cells expressing FLAG SFMBT1 were collected for immunoprecipitaion using anti FLAG agarose and analyzed by western blotting using indicated antibodies C : GFP tagged SFMBT1 and FLAG tagged L3MBTL3 were co transfected in 293T cells. 48 hours after transfection, cell lysates were collected for the immunoprecipatation using anti FLAG agarose and analyzed by western blotting using indicated antibodies. A B C D

PAGE 39

39 Figure 2 6 The CSL interacting epigenetic regulators repress the t ranscription of Notch signaling. A: The schematic diagram of the Notch responsive reporter. B: CSL interacting epigenetic regulators repress Notch responsive luciferase transcription.

PAGE 40

40 Figure 2 7 Model of CSL mediated epigenetic regulation of Notch sig naling. T he Notch transcription factor CSL recruit s the LSD1 complex proteins and SFMBT1, and SFMBT1 might further recruit other polycomb proteins to mediate epigenetic silencing of Notch signaling

PAGE 41

41 CHAPTER 3 DDX5 IS A POSITIVE REGULATOR OF ONCOGENIC NOTC H1 SIGNALING IN T CELL ACUTE LYMPHOBLASTIC LEUKEMIA Introduction Notch signaling is a highly conserved developmental signaling pathway, regulating cell proliferation, differentiation, and survival (87) Deregulated Notch signaling i s linked to many epithelial cancers and hematological malignancies (88, 89) In particular, aberrant Notch signaling repres ents an important oncogenic mechanism for T cell acute lymphoblastic leukemia (T ALL), an aggressive subset of the most common malignant childhood cancer ALL. More than 60% of T ALL cases harbor activated NOTCH1 mutations (63, 90) Sustained high levels of NOTCH1 signaling cause leukemic cell transformation and are required for the maintenance of the leukemic phenotype (66) ; thus the Notch pathway is a promising, highly specif ic molecular therapeutic target for T ALL. Moreover, the Notch pathway also is an important target for solid cancers including breast cancer, lung cancer, pancreatic cancer, brain tumors and melanoma (91) Consequently, manipulation of Notch signaling has a great promise as a major new therapeutic strategy for treating the large array of Notch hyperactive cancers. Canonical Notch signaling is initiated by ligand recep tor interactions between adjacent cells (92) Ligand binding results in proteolytic cleav ages of Notch receptors and subsequent release of the intracellular domain of Notch (ICN) from the cell membrane. ICN then enters the nucleus and forms a complex with transcription factor CSL which recruits the co activators including Mastermind like (MAML ) and other cofactors such as histone acetyltransferase resulting in transcriptional activation. Our current understanding of molecular mechanisms regulating Notch mediated transcription remains incomplete. The elucidation of new critical regulators of th e Notch

PAGE 42

42 signaling pathway will lead to the identification of therapeutic targets that modify deregulated Notch activity in cancers. Our group and others have previously identified the family of three MAML transcriptional co activators (MAML1, 2, 3) that a re essential components of the Notch transcription activation complex (73, 74, 93) MAML1 is a major co activator that regulates NOTCH1 oncogenic activities in leukemic cells, and is essential for maintaining leukem ic cell growth and survival (unpublished). Hence, our data suggest that the manipulation of MAML1 expression or functional activities will affect leukemia initiation and progression. Currently, the molecular basis underlying the MAML1 co activation functio n remains very limited (68) We hypothesize that cellular factors associated with MAML1 contribute to the MAML1 co activation function in enhancing Notch mediated transcription by molecular mechanisms, for instance, through interacting with chromatin remodeling/modification cofactors or promoting formation or function (transcription or elongation) of the pre initiation complex. Therefore, to gain insights into the molecular basis underlying MAML1 function in regulat ing Notch signaling, we undertook the task of identifying cellular factors that interact with MAML1 and characterizing their roles in Notch signaling regulation and Notch mediated T cell leukemia. In this study, we revealed that DDX5 (also known as p68), a n ATP dependent RNA helicase (94, 95) is a component of the MAML1 protein complex and is associated with the Notch transcription complex. Given a role for DDX5 as a transcriptional modulator (96, 97) we reasoned that DDX5 might be a critical regulator for Notch mediated transcription and consequently for oncogenic Notch signaling. Our findings in this study demonstrated a biochemical link of DDX5 with the

PAGE 43

43 Notch transcription complex through its interaction with MAML1, and also revealed its critical role for efficient Notch mediated transcription in leukemic cells and potentially in other human cancers in which the Notch pathway is active. Therefore, our study suggests that DD X5 is critical for Notch mediated T ALL pathogenesis and has the potential as a drug target in leukemia. Materials and Methods Plasmids Expression plasmids expressing FLAG tagged full length and truncation forms of MAML1, NOTCH1 (ICN1) as well as Notch res ponsive promoter construct were described previously (73, 74) FLAG tagged DDX5, Myc tagged DDX5 and Myc tagged DDX5 K144R cloned in the pSG5 vectors were kindly provided by Dr. Vittorio Sartorelli (98) DDX5 and DDX5 K144R cDNAs were sub cloned into a modified pBIND vector to express G al4 DB DDX5 fusions. Antibodies The following antibodies were purchased from commercial sources: mouse anti Flag antibody (clone M2, Sigma, 1:500 for immunoprecipitation (IP), 1:1000 for Western Blotting (WB); anti Myc (clone 9E10, Santa Cruz, 1:1000 for WB); anti DDX5 (4387, Cell Signaling, 1:5000 for WB); anti DDX5 (PAb204, Upstate, 1:100 for ChIP); anti DDX5 (IHC 00156, Bethyl, 1:200 for IHC); anti NOTCH1 (SC 6014R, Santa Cruz, 1:500 for IP, 1:1000 for WB), anti cleaved NOTCH1 Val 1744 (4147, Cell Signa ling, 1:500 for WB), anti CSL (T 6709, Institute of Immunology Co., 1:500 for WB), anti Cleaved caspase3 (9664S, Cell Signaling, 1:1000 for WB), anti MAML1 (A300 673A, Bethyl, 1:5000 for WB), anti MAML1 (4608, Cell Signaling, 1:500 for IP) and anti actin (A5316, Sigma, 1: 10000 for WB).

PAGE 44

44 Cell Culture, Transient Transfection a nd Reporter Assays Human U2OS Osteosarcoma cells and cervical cancer HeLa cells (obtained from ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal bovine s erum (FBS) and antibiotics. Leukemic cells including KOPT K1 and HPB ALL were cultured in RPMI 1640 medium plus 10% FBS and antibiotics. Transfection was performed using Superfect T ransfection R eagent (QIAGEN) according to the The luciferase based reporter assays were performed using a dual luciferase kit from Promega as previously described (74) Immunoprecipitation and Western B lot A nalysis Whole cell protein extracts were prepared as previously described (73) For digestion of nuclear acids, KOPT K1 protein lysates were treated with DNase (10U/ml) and RNase (10ug/ml) at room temperature for 20 minutes Immunoprecipitations were performed with antibodies and protein A/G agarose overnight at 4C. For immunoblot analysis, immunoprecipitates were washed five times and fractionated by SDS polyacrylamide (PAGE) gels and electrotransferred to NC membranes. The membranes were blocked for 1 h in a buffe r containing 10 mM Tris, pH 8.0, 150 mM NaCl, 0.05% Tween 20, and 5% nonfat dry milk. The membranes were incubated with the antibodies overnight at 4C, then washed and incubated with a horseradish peroxidase conjugated secondary antibody for 1 h at RT. Th e protein bands were visualized by enhanced chemiluminescence (Pierce). Protein Complex Purification a nd Identification About 30mg of whole cell lysates from KOPT K1 were used for immunoprecipitation with anti MAML1 antibody and protein A/G agarose at 4C over night. Protein complexes were washed and eluted from a gar ose using an elution

PAGE 45

45 solution containing MAML1 peptide. The eluted protein samples were separated on the 4 12% NuPAGE Bis tris gels, and stained with a colloidal blue stain kit (Invitrogen). The MAML1 associated complex was then analyzed by LC MS/MS mass spectrometry. GST Pull Down Assay The GST fusion proteins GST MAML1 full length and 1 302 aa were expressed in BL21 Escherichia coli and purified on glutathione sepharose beads according to the manufacturer's protocol. Equivalent amounts of purified GST fusion proteins or GST bound to glutathione sepharose beads were incubated with 293T cell lysate expressing transfected FLAG tagged DDX5 proteins overnight at 4C. The beads were washed extensivel y and the proteins bound to the beads were resolved on SDS polyacrylamide (PAGE) gels and detected by Western blot analysis. Lentiviral Mediated Sh RNA Knockdown The pLKO.1_DDX5 shRNA and the control luciferase shRNA constructs were purchased from OpenBiosy stems. Lentiviruses were produced as previously described (99) In brief, 293FT cells were transfected with shRNA targeting DDX5 or luciferase control plasmid togethe r with packing plasmid psPAX2 and envelope plasmid pMD2.G. Viral supernatants were harvested at 48 h and 72 h post transfection, t arget cells were infected in the presence of 4 ug/ml polybrene for 8 h twice for two consecutive days and then selected with pu Real Time RT PCR Real time RT PCR was performed as previously described (99) RNA was isolated and then reverse transcribed into cDNA usi ng a GeneAmp RNA PCR kit (Applied Biosystems). Real time PCR was performed using the StepOne Real Time PCR System (Applied Biosystems) with the SYBR Green PCR Core Reagents Kit

PAGE 46

46 (Applied Biosystems). GAPDH was used as an internal control to normalize gene e T and GAPDH primer Proliferation Assays Cell growth was determined by counting the cell numbers in culture. Briefly, 2 ml of 110 5 /ml cells were cultured in RPMI1640 containing 10% FBS in the 6 wel l plates at day 0, and the cell numbers were scored by trypan blue exclusion at day 2 and day 4. Cell Cycle Analysis Cell cycle profiles were analyzed by BrdU/7 AAD staining using the BD instructions. After staining, a minimum of 10000 events were collected to create each DNA content histogram with Accuri C6 Flow Cytometer (BD Biosciences). Apoptosis Analysis Cell apoptosis were detected by measuring Caspase 3/7 activity with the C aspase Glo 3/7 Assay kit (Promega) and the Annexin V/PI FACS analysis (BD

PAGE 47

47 analysis, ~1X10 4 cells (20 u l) and an equal volume of Caspase Glo 3/7 reagent were added to a well in the 96 well plate. After incubation for 1 2 h in room temperature, the luminescence of each sample and blank control were measured in a plate reading luminometer (FLUOstar OPTIMA) For Annexin V/PI FACS analysis, the cells were stained with Annexin V FITC and Propidium Iodide for 15 min at room temperature in the dark and then analyzed with Accuri C6 Flow Cytometer (BD Biosciences). Chromatin Immunoprecipitation (ChIP) The ChIP assays were performed based on the Millipore ChIP protocol with minor mo difications as previously described (99) Briefly, cells were fixed with 1% formaldehyde for 10 minutes at room temperature and sonicated to shear DNA to about 200 and 800 bp. The DNA protein complex was then immunoprecipitated with the DDX5 antibodies or control IgG. The ChIP DNA was purified and eluted with 100ul of H 2 O. ChIP DNA (2.5ul) was used for the real time PCR analysis using the primers flanking the CSL bindin g site of the Notch target HES1 promoter. The primer sequences are: Immunohistochemical Staining Formalin fixed paraffin embedded bone marrow samples were from The University of Texas MD Anderson Cancer Center with an approved IRB. These slides were heated at 50 C for 1 h before being deparaffinized and rehydrated. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 10 min. Optimal staining with rabbit an ti DDX5 (IHC 00156, Bethyl) required 25 min. of heat antigen retrieval in 10mM Citrate buffer pH 6.0. Sections were sequentially blocked with normal serum, avidin and biotin prior to the application of rabbit anti DDX5 (1:200) overnight at 4 C. Slides we re

PAGE 48

48 stained using the ABC Elite kit (Vector Labs) and counter stained with Hematoxylin (SurgiPath). In Vivo Tumor Xenograft Tumor xenograft studies were performed following a protocol approved by IACUC (Institutional Animal Care & Use Committee) of Universi ty of Florida. HPB ALL cells that had been engineered to stably express firefly luciferase (HPB ALL Luc) by transducing with pMSCV GFP Luc retroviruses were infected with lentiviruses carrying control shRNA, or DDX5 targeting shRNA. A total of 5x10 6 leukem ia cells were diluted in 100 u l 50% Matrigel (BD Biosciences)/50% PBS and injected subcutaneously into the right flank of 6 week old female NCR nude mice. For bioluminescence imaging, mice were given 150 u g/g of D luciferin in PBS by i.p. injection. Fiftee n minutes after injection, bioluminescence was imaged with a Xenogen In vivo Imaging System (Caliper Life Sciences). Tumor volumes were measured in two dimensions (length and width) using Dial Caliper and calculated using the formula: tumor volume = (lengt h x width 2 ) x 0.5. After 10 days post implantation, tumor volumes were measured every two days and bioluminescence images were taken once a week. Results DDX5 Is Identified a s a MAML1 Interacting Protein in a Proteomic Study We recently found that MAML1 i s a major transcriptional co activator contributing to Notch signaling in human T ALL leukemic cells that contain NOTCH1 activating mutations, as depletion of MAML1 expression resulted in a significant decrease in Notch target gene expression (unpublished) secretase inhibitor treatment that blocks Notch receptor processing (100) We hypothesized that MAML1 functions by recruiting specific co regulators that activate transcription of Notch

PAGE 49

49 target genes. MAML1 was shown to interact with p300/CBP, (45, 101 103) that exert positive or negative effects on Notch transactivation. However, these interact ions cannot account for all MAML1 co ac tivation function s To systematically identify co regulators that are important for MAML1 transcriptional co activation, Dr. Huangxuan Shen isolated the endogeno us MAML1 complex from activated NOTCH1 mutations containing leukemic cells (KOPT K1) by immunop recipitation using rabbit antibodies generated from the MAML1 peptide. Mass spectrometric analysis was then performed to identify proteins in the MAML1 protein complex. These data showed that MAML1 is associated with known interacting proteins including NO TCH1 and the Notch pathway transcription factor CSL, indicative of the presence of the core transcriptional complex, NO TCH1/CSL/MAML1. Importantly, novel potential MAML1 interacting proteins were identified in this analysis I then focus ed on one of the MA ML1 interacting protein candidates, the ATP dependent RNA helicase DDX5, since DDX5 has been functionally linked to transcriptional co activation and many oncogenic events (96, 97) MAML1 Interacts w ith DDX5 in V it ro a nd i n V ivo Ms. Liang Tian a former visiting student in our lab, and I validated the interaction between MAML1 and DDX5 using a series of assays. First, GST pull down assays were performed to determine whether DDX5 specifically interacts with MAML1 i n vitro Bacterially expressed GST or GST MAML1 fusion proteins were immobilized on glutathione sepharose, which were used as baits for cellular lysates expressing FL AG tagged DDX5 We found that GST tagged full length (FL) or 1 302aa of MAML1, but not GST specifically pulled down FLAG tagged DDX5 (Figure 3 1 A ), indicating a specific interaction between the N terminal region of MAML1 and DDX5 in vitro Second, co

PAGE 50

50 immunoprecipitation assays were performed to determine the in vivo interaction of FLAG tagged MAML1 and Myc tagged DDX5. 293T cells were transfected with plasmids encoding FLAG tagged MAML1 or Myc tagged DDX5 individually or together. MAML1 was immunoprecipitated with anti FLAG antibodies and then any associated Myc tagged DDX5 was detected by immu noblotting with anti Myc antibodies. We found that MAML1 readily co precipitated with DDX5 when over expressed in the cells (Figure 3 1 B ). Third, we used co immunoprecipitation assays to determine the interaction between MAML1 and DDX5 proteins at the endog enous protein levels. Here, HeLa cell lysates were prepared and endogenous MAML1 immunoprecipitation using rabbit anti MAML1 antibodies was performed. We found that DDX5 co immunoprecipitated with MAML1 endogenously in HeLa cells (Figure 3 1 C ). To further confirm the interaction between MAML1 and DDX5 in a more physiological condition, we performed mammalian two hybrid assays. The wild type (wt) DDX5 and enzyme inactive K144R mutant ( mutation in ATP binding domain, mut) constructs were expressed as fusion p roteins with a GAL4 DNA binding domain, and MAML1 was expressed as a fusion protein with the activation domain (AD) in U2OS cells. The interaction between DDX5 and MAML1 was quantified by the activation of a luciferase reporter containing GAL4 binding site s in the promoter. We found that the luciferase activity from cells expressing both proteins was significantly increased compared to the control, indicating that MAML1 and DDX5 interact with each other in vivo Moreover, the enzyme inactive mutant of DDX5 appeared not to interact with MAML1 (Figure 3 1 D ). Overall, the above data indicate a specific interaction between MAML1 and DDX5 in vitro and in vivo.

PAGE 51

51 DDX5 Is Associated with t he Notch Transcription Activation Complex in Leukemic Cells It was reported tha t more than half o f T ALL patients carry activating NOTCH1 mutations, which result in the formation of active NOTCH1/CSL/MAML1 transcriptional complex and subsequent expression of Notch target genes, contributing to leukemic phenotype (63, 66) To explore the potential functions of DDX5 in T ALLs, we first surveyed the expression levels of leukemic cells that carry active NOTCH1 signaling. By Western blot analysis, we found that DDX5 is expressed in a variety of T A LL leukemic cell lines and DDX5 expression levels appear to be higher in a majority of T ALL cells in comparison with three AML (acute myeloid leukemia) cell lines we tested (Figure 3 2 A ). Based on the evidence that MAML1 interacts with DDX5 in a protein complex and that DDX5 functions in transcriptional co activation, DDX5 might have a role in mediating MAML1 coactivator function and thereby modulating Not ch signaling in T ALL leukemia. Therefore, we next determined whether DDX5 is associated with the NOT CH1 transcription activation complex. First, we determined whether MAML1 interacts with DDX5 in the presence or the absence of active NOTCH1 signaling. Here, activating NOTCH1 mutation containing KOPT K1 leukemic cells were treated with the vehicle control DMSO secretase inhibitor (GSI) that interferes with NOTCH1 receptor processing and hence blocks Notch signaling, and then cell lysates were prepared for endogenous MAML1 immunoprecipitation using anti MAML1 antibodies. We found that GSI treatment greatly r educed cleaved NOTCH1 levels (Figure 3 2 B ), indicating effective blockade of NOTCH1 signaling. In consistence with these data, cleaved NOTCH1 and CSL levels were significantly reduced in the MAML1 immunoprecipitates ( Figure 3 2B and not shown), indicating a reduced level of active

PAGE 52

52 Notch transcription complex. Importantly, we found that the levels of DDX5 co immunoprecipitated with MAML1 remained similar in both the presence and absence of active Notch signaling (Figure 3 2 B ) suggesting that MAML1 interacte d with DDX5 irrespective of cellular Notch signal status. Next, we performed NOTCH1 (ICN1) immunoprecipitation using antibodies against the cytoplasmic domain of NOTCH1, and detected any possible DDX5 co immunoprecipitated with NOTCH1. We found that DDX5 i s readily detectable in NOTCH1 im m unoprecipitates (Figure 3 2 C ). The reverse immunoprecipitation using anti DDX5 antibodies also supported an interaction between DDX5 and the NOTCH1 (ICN1)/MAML1/CSL transcription complex (Figure 3 2 D ). Since DDX5 is an RNA binding protein, we further determined whether there is a role for RNA in the interaction of DDX5 and MAML1. KOPT K1 protein lysates were first treated with RNase/DNase to remove the nuclear acids before being subjected to immunoprecipitation. Our data sh owed that MAML1 was able to pull down DDX5 protein after digestion with RNase/DNase, indicating that the interaction between MAML1 and DDX5 is independent of nuclear acids ( Figure 3 3 ). These data indicate that DDX5 interacts with MAML1 independent of cell ular Notch signaling status and is recruited to the NOTCH1 (ICN1) transcription complex, hence suggesting a role for DDX5 in modulating Notch signaling in Notch active leukemic cells. DDX5 Enhances Notch Mediated Transcription a nd DDX5 Depletion Reduces Ex pression of Notch Signature Genes in Leukemic Cells To evaluate a potential role of DDX5 in Notch mediated transcription, we first determined whether DDX5 promotes NOTCH1 (ICN1) induced transcription. Here, U2OS cells were transfected with a Notch responsi ve promoter reporter (pCSL luc containing four copies of CSL binding sites in the promoter) and activated NOTCH1

PAGE 53

53 (ICN1) in the presence and absence of wild type or enzymatically inactive forms of DDX5 (Figure 3 4 A ). We found that DDX5 enhanced NOTCH1 (ICN1 ) induced reporter activity and such enhancement is dependent on the intact DDX5 enzymatic activity, as the mutation (K144R) renders inactive enzyme failed to show the enhanced activity (Figure 3 4 A ). These data suggest that DDX5 activation of Notch media ted transcription is dependent on DDX5 enzyme activity. Moreover, chromatin immunoprecipitation (ChIP) assay revealed that DDX5 was enriched on the CSL binding promoter region of the Notch target gene HES1 and that the level of DDX5 protein associated wit h HES1 promoter was reduced in DDX5 knockdown cells (Figure 3 4 B ), which further supported a function of DDX5 in the regulation of Notch mediated transcription. Next, we investigated whether DDX5 loss of function impairs Notch signaling in leukemic cells. We utilized a pLKO.1 based lentiviral shRNA set containing five U6 promoter regulated shRNA targeting DDX5, and identified two forms of shRNA (shDDX5 3 and shDDX5 4) that were effective to knock down DDX5 in HeLa cells (not shown). We then infected activat ing NOTCH1 mutation bearing cells KOPT K1, with these two forms of DDX5 shRNA (shDDX5 3, and 4) or luciferase shRNA as controls, and collected RNA and protein samples for analysis. We found that there was about 70% reduction in the DDX5 transcript level by real time RT PCR assays, and more than 90% of DDX5 protein reduction though Western blot analysis (Figure 3 4 C ). We subsequently compared the levels of endogenous Notch signature genes in DDX5 knockdown cells and the control cells by real time RT PCR. W e found that DDX5 depletion by two forms of shRNA resulted in decreased expression levels of Notch signature genes including HES1, HEY1, MYC and DTX1 (Figure 3 4 D ). In contrast,

PAGE 54

54 knockdown of DDX5 failed to significantly affect Notch target gene expression in SUPT13 T ALL cells that have wild type NOTCH1 gene and are insensitive to Notch signaling inhibition ( Figure 3 5 ). These data indicate that DDX5 is essential for efficient Notch mediated transcription in Notch active leukemic cells. DDX5 Regulates Leuke mic Cell Proliferation a nd Survival Since activated NOTCH1 signaling is essential for leukemic cell growth and survival and DDX5 modulates Notch signaling, we predicted that DDX5 loss of function and subsequent reduced Notch signaling will inhibit leukemic cell proliferation and survival. Therefore, we knocked down DDX5 expression in a series of leukemic cells by lentiviral infection on two consecutive days followed by puromycin selection for 2 days. At day 6 post infection (D0), cells were set up for cell proliferation, cell cycle, and apoptosis assays while cell lysates were made simultaneously to determine the extent of DDX5 knockdown. We were able to knock down DDX5 protein levels by about 70% and 90% in several cell lines including KOPT K1, HPB ALL, MOL T4 and Jurkat (Figure 3 4C and not shown). We found that DDX5 knockdown led to a decrease in cell growth in these Notch overactive leukemic cells, but not in the Notch insensitive SUPT13 cells ( Figure 3 6A and Figure 3 5 ). To study the mechanisms underlyin g cell growth suppression caused by DDX5 loss of function, we first investigated the impact of DDX5 knockdown on cell cycle profile using BrdU/7 AAD staining followed by FACS analysis. We found that DDX5 depletion resulted in inhibition of G1 S phase trans ition ( Figure 3 6B) Next, we investigated whether DDX5 loss of function affects cell survival by various apoptotic assays. We found that DDX5 knockdown led to enhanced apoptotic activities by measuring Caspase Glo 3/7 activity ( Figure 3 6C ), cleaved Caspa se 3 level by Western blot analysis ( Figure 3 6D ) and Annexin V/PI staining ( Figure 3 6E ). These

PAGE 55

55 data indicates that DDX5 depletion induced cell growth suppression could be due to both cell cycle arrest and induction of apoptosis. Combined with the previou s data, our findings indicate that DDX5 modulates cell proliferation and survival in leukemic cells at least in part through regulating Notch signaling. DDX5 Depletion Results in Reduced T ALL Cell Growth in Vivo To test the function of DDX5 in Notch ov eractive T ALL cell growth in vivo Dr. Yumei Gu, a postdoc in our lab, generated HPB ALL cells expressing the luciferase gene (HPB ALL luc) by infecting the HPB ALL cells with retroviruses that co express GFP and luciferase under a bicistronic transcript FACS sorting for GFP+ cells was performed to enrich transduced cells, which were further validated for luciferase expression by luciferase assays. HPB ALL luc cells were then infected with lentiviruses that expressed the shRNA against DDX5 or lentiviruses generated from the vector control. At about 72 hours after first infection, cell lysates were collected for the confirmation of DDX5 knockdown by Western blotting (Figure 3 7 A) At the same day, an equivalent number of the viable DDX5 depleted and control cells (based on Trypan blue assays and luciferase assays shown in Figure 3 8 ) were subcutaneously injected into nude mice. The growth of tumor xenografts was then monitored by measuring tumor volume and luciferase intensities at different time points afte r leukemia cell injection (Figure 3 7 B). The tumors in the mice injected with the control cells grew and reached to a size of about 800 mm3 at 30 days after injection. However, knockdown of DDX5 resulted in the suppression of tumor growth (Figure 3 7 C). Th us, DDX5 expression is required for the growth of T cell acute lymphoblastic leukemia in vivo

PAGE 56

56 DDX5 Is Highly Expressed i n Human T ALL Patient Samples The expression of DDX5 in T ALL has not been investigated. Searching of DDX5 expression in the Oncomine d atabase revealed that DDX5 is expressed at significantly higher transcriptional level s in T ALL in comparison with peripheral blood mononuclear cells (PBMC) (Figure 3 9 A), which is based on microarray gene expression data of 174 T ALL cases and 74 normal P BMC cells (104) To further determine the relevance of DDX5 in human T ALLs, we assessed DDX5 protein expression in bone marrow aspirates from three normal individuals and three patients with T ALLs by i mmunohistoch emical staining. Bone marrow aspirates were formalin fixed and paraffin embedded, and then the sections were stained with rabbit anti DDX5 antibodies. In normal bone marrow aspirates, certain subsets of cells showed positive nuclear DDX5 staining, likely i ncluding lymphocytes, granulocytes and megakaryotes (Figure 3 9 B). In T ALL samples, strong nuclear DDX5 staining was observed in the majority of T ALL cells in all three T ALL specimens (Figure 3 9 B and not shown). In addition, the cellular morphologies s eem to be abnormal for T ALL. These data suggest two possibilities: one is that DDX5 is expressed at a low level in normal T lineage but an abnormally high level in T ALL cells, and the other is that DDX5 is expressed in immature T lineage, and the clonal expansion of immature T ALL cells results in the more uniform DDX5 staining in T ALL. Overall, our data indicate that DDX5 expression is highly expressed in human primary T ALL samples Discussion Notch signaling is a major oncogenic pathway in the pathoge nesis of T ALLs and is a promising therapeutic target. Therefore, the identification of regulators that modulate Notch signaling is of great importance. In this study, we identified DDX5 as a

PAGE 57

57 novel interacting protein for the Notch transcriptional co acti vator MAML1. DDX5 interacts with the Notch transcription activation complex via the association with MAML1, and is required for optimal Notch activities in leukemic cells. DDX5 is essential for leukemic cell growth and survival in cultured cells and xenogr aft tumor models. Importantly, DDX5 is highly expressed in human T ALL samples. Therefore, DDX5 regulates oncogenic Notch signaling at the transcriptional level and is likely to have a critical role in NOTCH1 mediated T ALL pathogenesis DDX5 is a member of the DEAD box family of RNA helicases with diverse cellular functions including RNA processing, mRNA translation, ribosome assembly, and gene transcription (96, 97, 105) It was shown that DDX5 co activates sever al transcription factors including p53 (106) androgen receptor (107) estrogen receptor (108) MyoD (98) Runx2 (109) and NFAT5 (110) by mediating chromatin remodeling and transcription initiation complex on target promoters (98) DDX5 is significantly up regulated in multiple tumors such as breast cancers, prostate cancers, bladder cance rs, colon cancers, colorectal tumors and myeloma (97, 111) which suggest important functions of DDX5 in tumor development and progression. Moreover, DDX5 is responsible for the anti apoptotic functions of tumor cel ls when treated with anticancer drugs (112, 113) as depletion of DDX5 in tumor cells abolishes their ability to escape from death and results in acceleration of cell killing by drugs (113) Therefore, DDX5 represents a potential important therapeutic target for cancer treatment. The expression and function of DDX5 in leukemia had not been investigated previously. In this study, we found that DDX5 is expressed in multiple T AL L leukemic cell lines (Figure 3 2A), and appears to be up regulated in the bone marrow specimens

PAGE 58

58 derived from human T ALL patients in comparison to the normal bone marrow control (Figure 3 9 ). Therefore, DDX5 might have a regulatory role in the oncogenic e vents in T ALL. Indeed, our data showed that DDX5 is required for T cell growth and survival of T ALL cells with constitutive activation of Notch signaling, as DDX5 knockdown inhibited leukemic cell growth and promoted cell apoptosis. Furthermore, we showe d that DDX5 depletion results in reduced leukemic xenograft growth. Therefore, DDX5 is an important cellular factor required for leukemic cell growth and survival The functional effects of DDX5 knockdown on leukemic cell proliferation and survival are at least partially mediated by the ability of DDX5 to modulate Notch signaling. We showed that DDX5 is recruited to the Notch transcription activation complex, and is physically localized to the Notch responsive promoter, the HES1 promoter. DDX5 regulates No tch induced transcription, as DDX5 promotes Notch mediated transcription and DDX5 knockdown reduces expression of Notch signature genes in leukemic cells. However, the exact mechanism by which DDX5 regulates transcriptional activation is still unclear Pre vious data indicate that reducing the levels of DDX5 and its homologous protein DDX17 (p72) protein impaired recruitment of the TATA binding protein TBP, RNA polymerase II, and the catalytic subunit of the ATPase SWI/SNF complex, Brg 1 (98) Therefore, it is likely that DDX5 recruitment to the Notch target promoter promotes the formation or function of the pre initiation complex. This might be one of the mechanisms that contribute to MAML1 co activator function in en hancing Notch transcription. Intriguingly, inhibition of Notch signaling via targeting different steps of the Notch pathway appears to have distinct effects on cell growth and survival. Notch signaling

PAGE 59

59 inhibition via gamma secretase inhibitors (GSIs) tha t block Notch receptor processing significantly reduces transcription of Notch target genes within 24 hours, but usually has mild and progressive effects on the growth and survival of Notch mutated T ALL cell lines ( 63) Consistent with the published data, our data showed that the GSI Compound E inhibited expression of Notch target genes in activating Notch1 mutation containing KOPT K1 cells, but had little effects on cell proliferation at day 2 and day 4 under treat ment ( Figure 3 10 ). On the other hand, inhibition of Notch signaling via siRNA mediated NOTCH1 knockdown (114) or via blocking MAML1 expression by shRNA (unpublished) or expression of dnMAML1 (100, 115) results in better and more rapid suppression of cell growth and induction of apoptosis. DDX5 is associated with Notch/MAML1/CSL transcriptional activation complex, which might explain our data that DDX5 depletion functionally r esembled MAML1 inhibition, in comparison to GSI mediated Notch signaling blockade. These data suggest that differential mechanisms of action accounting for targeting Notch signaling at various steps of the pathway or Notch independent roles of MAML1 in the regulation of cell growth and survival. Importantly, it should be noted that DDX5 might regulate leukemic cell growth and survival through other uncharacterized Notch independent mechanisms due to its ability to interact with other cellular factors. Howev er, it appears that DDX5 has a crucial role in regulating NOTCH1 activated T ALLs, as DDX5 depletion affected growth and survival of NOTCH1 activated T ALLs, but not of T ALL cells without abnormally activated NOTCH1 signaling. Collectively, we identified DDX5 as a novel MAML1 asociated protein that is required for MAML1 transcriptional co activation function. DDX5 modulates Notch

PAGE 60

60 signaling and is crucial for the growth and survival of T ALL cells with constitutive activation of Notch signaling, supporting the role of DDX5 as a novel regulator of oncogenic Notch signaling in leukemic cells. Therefore, DDX5 might be critical for Notch mediated T ALL pathogenesis and has the potential as a drug target in leukemia. Given the importance of DDX5 in the oncogenes is of multiple cancer types and its function in drugs resistance in tumor cells, development of specific DDX5 inhibitors might hold great promises for the therapy of DDX5 over expressing tumors including the Notch mutated T ALL.

PAGE 61

61 Figure 3 1 MAML1 spe cifically interacts with DDX5 in vitro and in vivo A: MAML1 interacts with DDX5 by GST pull down assays. GST MAML1 FL and 1 302aa fusion proteins were induced expressed in BL21 bacterial cells, and purified, and then incubated with cellular lysates from 2 93T cells trans fected with FLAG DDX5. The pull down proteins were analyzed by Western blotting with anti FLAG antibodies. B: MAML1 co immunoprecipitates with DDX5. 293T cells were transfected with FLAG MAML1 and Myc DDX5 plasmids, and cell lysates were co llected 48 hours after transfection for IP and Western blot analysis. C: MAML1 and DDX5 interact at the endogenous protein levels in HeLa cells. Whole cell lysates collected from HeLa cells were used for immunoprecipitation with anti MAML1 antibodies. The MAML1 immunopre c ipi t ates were analyzed by Western blotting. D: MAML1 interacts with wild type (wt), but not enzyme inactive version (mut), of DDX5 by mammalian two hybrid assays. U2OS cells were co transfected with pBIND DDX5 and different amounts of MAML1 plasmids. The cell lysates were collected for luciferase assay 48 hours after transfection. Data were shown as average values from three independent experiments. **p<0.01.

PAGE 62

62 Figure 3 2 DDX5 is associated with the Notch transcription activation comple x in leukemic cells. A: DDX5 expression levels in a panel of AML and T ALL leukemia cell lines were determined by Western blot analysis. B: MAML1 interacts with DDX5 in T ALL cells. KOPT K1 cells were treated with GSI (1 u M ComE) for 24 hours and then lysa tes were collected for IP with anti MAML1 antibodies and blotted with indicated antibodies C: NOTCH1 interacts with DDX5 in KOPT K1 cells. Protein lysates of KOPT K1 cells were used for IP with an anti NOTCH1 antibody raised against the intracellular doma in of the NOTCH1 receptor, and then blotted with an anti DDX5 antibody. D: DDX5 is associated with the core Notch transcriptional activation complex (i.e. NOTCH1/CSL/MAML1). IP was performed using KOPT K1 cellular lysates with an anti DDX5 antibody followi ng by Western blotting with indicated antibodies

PAGE 63

63 Figure 3 3 Interaction between MAML1 and DDX5 is independent of nuclear acids. A: KOPT K1 protein lysates were treated with or without DNase (10 U/ml) and RNase (10 u g/ml) at room temperature for 20 minutes. ~30 u g protein lysates were loaded on agarose gel to confirm the digestion of nuclear acids. B: The lysates with or without digestion were used for immunoprecipitation using anti MAML1 antibodies and the MAML1 immunoprecipitates were analyzed for DDX5 and MAML1 by Western blot analysis.

PAGE 64

64 Figure 3 4 DDX5 enhances Notch mediated transcription and its depletion reduces expression levels of Notch target genes in NOTCH1 mutated KOPT K1 cells. A: DDX5 enhances Notch mediated transcription. Data were shown as average from three independent experiments. **p<0.01; ***p<0.001. B: DDX5 directly binds to NOTCH target HES1 promoter. ChIP assay was performed in KOPT K1 cells using DDX5 antibody or control IgG. The upper panel shows the location of primers on HES1 promoter. C: DDX5 is effectively knocked down in KOPT K1 cells. KOPT K1 cells were infected with lentiviruses that contain two independent shRNAs that target KD DDX5, and the control viruses expressing shRNA target luciferase gene. Transduced cells w ere assayed for DDX5 expression by Western blotting analysis (upper panel) and real time RT PCR (lower panel). D: Real time RT PCR assays showed that DDX5 depletion reduces expression levels of NOTCH target genes. B D: the Real time PCR data were shown as average from three independent experiments.

PAGE 65

65 Figure 3 5 DDX5 depletion has little effects on expression of Notch target genes and cell proliferation in SUPT13 cells that do es not have abnormally active Notch signaling. A: Two forms of lentiviral based shDDX5 effectively knocked down DDX5 expression in SUPT13 cells. SUPT13 cells were infected with lentiviruses that contain two independent shRNAs that target DDX5, and the control viruses expressing shRNA target luciferase gene. Transduced cells were assa yed for DDX5 expression by real time RT PCR. B: Real time RT PCR assays showed that DDX5 depletion had little effect on the expression levels of NOTCH target genes such as HES1 and MYC in SUPT13. C: DDX5 depletion did not affect cell proliferation of SUPT1 3 cells.

PAGE 66

66 Figure 3 6 DDX5 knockdown results in a reduction in T ALL cell proliferation and survival. A: DDX5 knockdown reduces T ALL leukemic cell proliferation. KOPT K1 cells were infected with lentiviruses expressing shRNA against DDX5 or control shLuc on two consecutive days, and then selected with puromycin for 2 days. At 6 days after the first infection (considered D0), cell growth, cell cycle and survival assays were performed. Control and DDX5 knockdown leukemic cells were cultured under the s ame conditions (a total of 2 ml at 1X10 5 cells/ml) and cell numbers were counted at day 2 (D2) and D 4. Data were shown as average values from three independent experiments. **p<0.01. B: Cell cycle distribution of DDX5 knockdown and control cells were deter mined by BrdU/7 AAD straining followed by FACS analysis. C: DDX5 knockdown caused an increase in Caspase 3/7 activities in leukemic cells. About 1x10 4 cells were used for the quantification of Caspase 3/7 activities. Data were shown as average from three i ndependent experiments. **p<0.01 ; ***p<0.001. D: DDX5 knockdown caused an increased level of cleaved Caspase 3 level by Western blot analysis. E: DDX5 knockdown caused an increased percentage of apoptotic cells in KOPT K1 cells determined by Annexin V PI s taining followed by FACS analysis

PAGE 67

67 Figure 3 7 DDX5 knockdown reduces growth of human T ALL leukemia xenograft in nude mice. A: DDX5 knockdown in luciferase expressing HPB ALL cells (HPB ALL luc). DDX5 expression in HPB ALL Luc transduced with shRNA against DDX5 (KD) as compared to cells transduced with a nontargeting shRNA (Ctl) was analyzed by Western Blot analysis with anti DDX5 antibodies. B: A representative bioluminescent image shows that two mice implanted with HPB ALL luc cells transduced with control shRNA and DDX5 shRNA, respectively. The image was taken on Day 24 after leukemic cell injection. C: Tumor growth was inhibited significantly in mice implanted with DDX5 knockdown cells compared to control (n=5, p<0.01). Tumor volumes were measured every two days starting at day 10 after leukemic cell injection.

PAGE 68

68 Figure 3 8 The DDX5 knockdown and control cells have similar level of luciferase activities. Cell lysates were collected from the DDX5 knockdown and control cells for the analysis of luciferase activities before injection into mice. Data were shown as luciferase intensity/ u g protein

PAGE 69

69 Figure 3 9 DDX5 gene expression is significantly up regulated in human T ALL patient samples. A: DDX5 transcript levels are significantly higher in T cell acute lymphoblastic leukemia as compared to peripheral blood mononuclear cells (PBMC) based on microarray gene expression data of 174 T ALL cases and 74 normal PBMC cells (104) *** p<0.00 1 B: DDX5 is over ex p ressed in bone marrow aspirates from the patients of T ALLs by IHC analysis using anti DDX5 antibodies.

PAGE 70

70 Figure 3 10 GSI (Compound E; ComE) treatment inhibits expression of Notch target genes, but has little or no effects on T ALL cell proliferat ion after two and four day treatment. A: GSI (ComE) inhibits NOTCH1 receptor cleavage. KOPT K1 cells were treated with ComE (2 u M) for 24 hours and then lysates were collected for Western Blot analysis to detect the cleaved NOTCH1 levels. B: ComE treatment inhibited Notch target gene expression in KOPT K1 cells. C: ComE treatment has no apparent effect on the proliferation of Notch overactive KOPT K1 T ALL cells

PAGE 71

71 CHAPTER 4 THE MBT PROTEIN SFMBT1 REGULATES MYOD MEDIATED EPIGENETIC SILENCING IN SKELETAL MYOGENESIS Introduction Skeletal myogenesis is a complex process that generates functional muscle tissues from muscle precursor cells and is critical for muscle development and regeneration. In response to myogenic signals, myogenic progenitor myoblasts ex it from the cell cycle, fuse and differentiate i nto multinucleated myotubes, which further mature as functional muscles (116) T he basic helix loop helix (bHLH) transcription factor MyoD is the master regulator of the myogenic processes by coordinating diverse epigenetic factors to regulate target genes expression in response to the developmental signals (117, 118) In proliferating myoblasts, MyoD is associated with transcriptional co repressors such as HDACs (119 121) HP1 (122) and Suv39h1 (123) that repress the expression of myogenic targets. Upon differentiation, MyoD cooperates with Six4 and MEF2 proteins to recruit transcriptional co activators including P300/CBP (124, 125) PCAF (126) the Trithorax Group proteins SWI/SNF chromatin remodeling complex (127) UTX (128) and Ash2L/MLL2 (129) and facilitate s transcription al activation of myogenic target genes (118) Polycomb family proteins repress important developmental genes and regulate diverse developmental processes such as myogenesis (130 132) Genome wide mapping revealed that the promoters of key myoge nic regulators such as Pax7, MyoD and Myogenin are occupied by polycomb proteins, suggesting important functions of polycomb in regulating myogenesis (130, 131) A lso, one polycomb protein Ezh2 was shown to repres s transcription of myogenic targets and prevent premature differentiation of myogenic progenitors (30, 133) and is required for in vivo muscle

PAGE 72

72 re ge ne ration (134) Genome wide ChIP analysis revealed that dSfmbt is physically associated with many important target genes function ing in muscle development (135) However, it was un known whether S fmbt 1 has any functional roles in regulat ion of myogenesis. S ince epigenetic regulati on h as critical roles in the myogenic process in this study, I utilize d myogenic models to investigate the biological functions of Sfmbt1 in skeletal myogenesis Through gain of function and loss of function studies in combination with microarray studies, we found that Sfmbt1 has an important role in regulating myogenesis in vitro and in vivo through transcriptional silencing of the myogenic mast er regulator MyoD. Materials and Methods Plasmids pLKO.1 lentiviral shRNA plasmids targeting mouse Sfmbt1 we re purchased from Open Biosystems. SFMBT1 truncation mutants (1 473aa, 494 699aa, 721 866aa) were cloned to pGex vector to generate GST fusion proteins. pQCXIP FLAG SFMBT1 was kindly provided by Dr. Judd C. Rice. HA MyoD (FL) and the HA tagged MyoD mutants (N: 1 66aa; N: 84 318aa; C: 173 318aa; C: 1 240aa) were kindly provided by Drs. Serge A. Leibovitch and Slimane AIT SI ALI. Antibodies The antibodies were obtained from commercial sources: LSD1 (Abcam ab17721); M2 (Sigma F 3165); HA (Covance MMS 101P); HDAC1 ( Santa Cruz sc7872 ); EZH2 (Active Motif 39875); RNF2 (Active Motif 39663); Beta Actin (Sigma A5316); H3K4me2 (Millipore 07 030); H3K27me3 (Millipore 07 449); H3Ac (Millipore 06 599); H 4 Ac

PAGE 73

73 (Millipore 06 59 8 ); Myosin (RD Systems MF20); Myogenin (BD Ph armingen 556358); MyoD (BD Pharmingen 556130); Pax7 (DSHB, University of Iowa). Cell C ulture 293FT and 293T (DMEM) with 10% heat inactivated fetal bovine serum and penicillin/streptomycin. C2C12 cel ls (ATCC) were cultured in DMEM with 20% heat inactivated fetal bovine serum and penicillin/streptomycin. P rimary myoblasts were isolated and maintained as described previously (136) For the myogenesis assay, cells were grown to 80 90% confluence, and induced for differentiation by switching from growth medium to differentiation medium (DMEM containing 2% horse serum). Virus Production, Tit ering a nd Transdu ction Lentiviral constructs (pLKO.1) were co transfected with the pMD2.G envelope vector and pSPAX2 packaging vector into 293FT cells using Superfect Transfection Reagent (Qiagen). Retroviral constructs (pQCXIP) were co transfected with the pMD.MLV.gag.pol (helper plasmid) and pMD.G (VSVG pseudotype) with Superfect Transfection Reagent in 293T to produce retrovirus. Supernatants containing virus were collected and centrifuged at 25 000rpm for 2 hours at 4 using a SW28 rotor (Beckman). The pellets were sus pended with 200ul PBS and the titers were determined following the technical manual from Open Biosystems. Viral transduction in cells was previously described (71) Stably transduced cells (polyclonal) were obtained and maintained by puromycin selection. Im munofluorescence S taining and L uciferase A ssays Immunofluorescence staining and luciferase reporter assays were performed as previously described (73)

PAGE 74

74 Microarray Analyses Microarray experiments were performed using RNA samples isolated from the C2C12 vector and C2C12 Sfmbt1 knockdown. The total RNA was extracted using Trizol reagents (Invitrogen) and purified using a QIAGEN column with in column DNase digestion. Hybridizations of Affymetrix Mouse Genome 430 2.0 Arra ys were performed at the Dana Farber Microarray core facility. Genes with a fold change equal to or greater than 1.5 and a p value of less than 0.01 were considered differentially expressed. GST Pull Down Assay GST pull down assay was performed as previous ly described (73) Briefly, bacterially expressed GST or GST SFMBT1 fusion proteins were induced and purified with glutathione sepharose. Equivalent amounts of GST or GST SFMBT1 immobilized on glutathione sepharose were then incubated with nuclear extract of 293T transfected with HA tagged MyoD. After extensive washing, the pull down HA tagged MyoD was detected by Western blot analysis. Real Time RT PCR cDNA was generated with 2ug of total RNA using a GeneAmp RNA PC R kit (Applied Biosystems). Real time PCR was performed using the Step one TM Real Time PCR System (Applied Biosystems) with the SYBR Green PCR Core Reagents Kit (Applied Biosystems). The sequences for the primers used are listed in Table 4 1. Chromatin Imm unoprecipitation (Ch IP ) ChIP assay was performed based on as previous described (99) Briefly, cells were fixed with formaldehyde for 10 minutes at room temperature to crosslink the DNA to chromatin associated prote in complexes. The crosslinking was stopped with Glycine

PAGE 75

75 and c ells were sonicated using the MISONIX S 4000 sonicator to shear DNA to lengths between 200 and 800 bp. The DNA protein complex was then immunoprecipitated with the indicated antibodies and washed extensively. The ChIP DNA was then purified and eluted with 100 ul of H2O. 2.5 ul of ChIP DNA was used for Real time PCR analysis. The primer sequences are listed in Table 4 1. Dnase I Sensitivity Assay DNase I sensitivity assay was performed with RQ1 RNa se Free Dnase (Promega). Nuclei of 5 *10 5 cells were treated with DNase at 37 for 30 minutes and then the reactions were stopped with EDTA at final concentration of 25mM. Genome DNA samples were purified by Protease K digestion and phenol chloroform extrac tion. The purified DNA samples were analyzed by Real time PCR to detect the relative amount of DNA remaining at the promoter region of Myogenin Intramuscular Injection of Lentiviruses a nd C TX Induced Muscle Regeneration M ice studies were performed followi ng a protocol approved by the University of Florida IACUC ( Institutional Animal Care & Use Committee ) In brief, tibialis anterior (TA) muscles of about 8 weeks old mice were injected with shRNA producing pLKO.1 lentiviral particles ( 10 0,000 transducing un it in PBS) three times i n two day intervals. Three days after the final injection, TA muscles were injected with 30 ul of 10 uM CTX to induce damage. TA muscles were dissected at various days post injection for expression studies and histological analysis Statistical Analyses of Experimental Data Independent Student's t test was used to analyze data from proliferation and real time PCR experiments.

PAGE 76

76 Results Sfmbt1 Expression Is Down Regulated d uring Myogenic Differentiation Epigenetic silencing is importa nt to restrict the expression of muscle genes in myoblasts (30, 118, 130, 131, 133) Sfmbt1 was shown to express in skeletal muscles by Northern blot analysis (137) and its D rosophila homologue dSfmbt constitutively occupies the promoters of genes involved in muscle development in both embryo s and larvae in a ChIP chip study (135) Therefore, I investigated the possible role of Sfmbt1 in regulating myogenic differentiation. I first investigated the expression pattern of Sfmbt1 during myogenic differentiation by real time RT PCR. I found that the Sfmbt1 expression was highest in undifferentiated C2C12 myoblasts and became reduced during differentiation, whereas expression of myogenic transcription factor Myogenin was induced in response to differentiation signals (Figure 4 1A) The observation that Sfmbt1 transcript levels are highest in undifferentiated myoblasts but reduced during the course of differentiation suggests a possible role for Sfmbt1 in repressing myogenic differentiation. Over Expression of Exogenous SFMBT1 Blocks Myog enic Differentiation The down regulation of Sfmbt1 expression during myogenic differentiation suggests that Sfmbt1 might be important for the maintenance of myogenic progenitor functions by preventing the pre mature differentiation of myoblasts. Therefore, I next determined wheth er ectopic expression of human SFMBT1 gene affects myoblasts proliferation and differentiation. C2C12 cells were infected with retroviruses expressing FLAG tagged SFMBT1 or vector control viruses. After puromycin selection, exogenou s SFMBT1 expression was confirmed by Western blot analysis using anti FLAG antibodies ( Figure 4 1 B ). The cells were induced to differentiate and myotube formation

PAGE 77

77 and muscle specific gene expression were examined. I found that ectopic SFMBT1 expression res ulted in a block in myotube formation ( Fig ure 4 1 C ) and a decrease in the expression of muscle differentiation markers (My osin and Myo genin ) ( Figure 4 1 D ). Ectopic SFMBT1 expression appeared to have little effect on cell proliferation of undifferentiated m yoblasts in growth medium ( Fig ure 4 1 E ). These data suggest that Sfmbt1 is critical for regulating myogenic differentiation likely by silencing muscle specific gene expression. Sfmbt1 Depletion Enhances Myogenic Differentiation Since SFMBT1 represses myoge nic differentiation which would contribute to the maintenance of the undifferentiated state of myoblasts, I therefore hypothesized that S fmbt 1 depletion will promote myogenic differentiation. To test this hypothesis, I knocked down expression of Sfmbt1 in C2C12 myoblasts and determined the functional consequences of Sfmbt1 depletion on myogenic differentiation. In brief, C2C12 cells were stably transduced with lentiviral mediated shRNA against Sfmbt1 (shSfmbt1), or shRNA against luciferase as a control (shL uc). I found that the expression level of endogenous Sfmbt1 decreased by 75% in stably transduced Sfmbt1 knockdown cells, as compared to shLuc controls ( Figure 4 2A ). When induced to undergo myogenic differentiation C2C12 cells with Sfmbt1 knockdown diffe rentiated better than the control cells, as shown by the formation of larger and more myotubes ( Figure 4 2 B ) and enhanced expression levels of myogenic transcription factor Myogenin and muscle differentiation marker Myosin ( Figure 4 2 C ) Moreover, Sfmbt1 knockdown significantly reduced the proliferation rate of C2C12 myoblast s cultured in growth medium ( Figure 4 2 D ) The decrease in cell proliferation might be due to the up regulation of cell cycle inhibitors such as P21 which is required for the cell cyc le exit during myogenic

PAGE 78

78 differentiation ( Figure 4 2 E ) In addition, the expression of muscle stem cell marker Pax7 decrease d in the Sfmbt1 knockdown cells, further confirming the role of Sfmbt1 in preventing muscle precursor cells from premature differenti ation ( Figure 4 2 F ) The shRNA knockdown effects are specific, as I observed similar effects with another shRNA construct that was able to knock down S fmbt1 expression ( data not shown ) Furthermore, I determined the functional effects of Sfmbt1 on primary mouse myoblasts, and found that Sfmbt1 knockdown reduced primary mouse myogenic cell proliferation and promoted differentiation ( Figure 4 2 G J ) Therefore, combined gain of function a nd loss of function studies, these data strongly indicate that Sfmbt1 is required for proper proliferation of myogenic progenitor cells and prevention of premature differentiation. S fmbt 1 Represses Transcription of Myogenin a nd Myofibrillar Genes To uncover the mechanisms underlying Sfmbt1 regulation of myogenic processes, I determined Sfmbt1 target genes in undifferentiated myoblasts. Specifically, I performed microarray analysis on proliferating C2C12 myoblasts stably expressing shRNA against Sfmbt1 in comparison with the control scramble. I found that there are a total of 2 0 1 up regulated genes (Table 4 2) and 300 down regulated genes (Table 4 3) when the criteria of fold change 1.5 and p< 0.05 were used ( Figure 4 3A ) T he up regulated genes with highest fold changes are numerous muscle differentiation genes, indicating th at Sfmbt1 knockdown increased expression of muscle differentiation genes even without exposure to differentiation cues (Table 4 2). These genes include muscle transcription factors, M yogenin and Mef2C, and many myofibrillar genes including the troponin ge nes, Tnnc Tnnt and Tnni, M yosin light and heavy chains, actin and etc.

PAGE 79

79 E levated expression of some typical muscle genes such as M yogenin Mef2c Mylpf Myh3 Gas2 and Tnnc2 in Sfmbt1 knockdown cells w as further confirmed by real time RT PCR ( Figure 4 3 B ) Since expression levels of those muscle genes are normally very low in proliferating undifferentiated muscle c ells, our findings thus support that Sfmbt1 is critical in conferring the transcriptional silencing of muscle genes in the myogenic progenitor cells Sfmbt1 Interacts w ith Muscle Transcription Factor Myo D Myogenic transcription factor MyoD is associate d with transcriptional repressors to repress target gene expressio n and maintain the undifferenti ated status of myogenic progenitor cells. Sfmbt 1 depletion results in the enhanced expression of important MyoD target genes such as Myogenin and Mef2c in myoblasts, suggesting that Sfmbt1 might interact with MyoD. A previous study by Cao et al. (138) used ChIP seq approach to identify genes whose promoters are physically associated with MyoD in undifferentiated myoblasts. With the help of Shaojun Tang from Dr. Alberto Riva lab, we compar ed Sfmbt1 target gene candidates from our microarray data with this MyoD ChIP Seq data, we found a significant overlap between two sets of genes and a total of 59 out of 20 1 up regulated genes due to Sfmbt1 knockdown show physical MyoD binding to their pr omoters ( Figure 4 3C ) Therefore, Sfmbt1 likely repress es MyoD dependent transcription in myogenic progenitors. To test this possibility, I determined whether there is a physical interaction between Sfmbt1 and MyoD by co immunoprecipitation assays. In bri ef, I used stably transduced C2C12 cells expressing FLAG tagged SFMBT1, and performed reciprocal co IP assays by antibodies against endogenous MyoD or anti FLAG antibodies. I found that FLAG tagged SFMBT1 is present in endogenous MyoD immunoprecipitates, a nd

PAGE 80

80 endogenous MyoD in FLAG tagged SFMBT1 immunoprecipiates ( Figure 4 4A ) indicating that SFMBT1 interacts with MyoD. We further mapped their respective interaction domains using a series of SFMBT1 (GST fusion) and MyoD (HA tagged) domains, and found that MyoD interacts with the N terminal domain and the middle part of SFMBT1 ( Figure 4 4B and C ) and the bHLH domain of MyoD is required for its interaction with SFMBT1 ( Figure 4 4D and E ) Sfmbt1 Recruits Multiple Repressive Complexes to Mediate Epigenetic S ilencing o f Myo D Targets Myogenin is a MyoD target gene that is essential for muscle cell differentiation. Therefore, I focused on the Myogenin gene to study molecular mechanisms by which S fmbt 1 regulates MyoD mediated transcription al repression using the following assays. First, I determined whether Sfmbt1 inhibited MyoD responsive Myogenin promoter activity using luciferase reporter assays. I found that exogenous SFMBT1 repressed the activities of Myogenin promoter reporter in a dose dependent manner ( Fi gure 4 5A ) Conversely, depletion of endogenous Sfmbt1 in C2C 12 resulted in increased M yogenin promoter activity ( Figure 4 5B ) To determine whether Sfmbt1 directly regulates M yogenin gene transcription, I performed chromatin immunoprecipitation (ChIP) to determine whether Sfmbt1 is localized to the M yogenin promoter. Since no good ChIP antibodies are available for Sfmbt1, I performed ChIP using stably transduced C2C12 cells expressing FLAG SFMBT1 and showed that FLAG tagged SFMBT1 is enriched on the M yog e n in promoter, indicating that Sfmbt1 directly regulates MyoD target gene transcription ( Figure 4 5C ) Consistent with the promoter assays, Sfmbt1 knockdown resulted in enhanced transcript levels of the Myogenin gene ( Figure 4 3B ) Moreover, Sfmbt1 knockdown in C2C12 showed an increase in Myogenin protein expression 1 day

PAGE 81

81 after growing in the differentiation medium, indicated by W estern blot ting ( Figure 4 2C ) Therefore, my data indicate that Sfmbt1 physically interacts with MyoD, localizes on the MyoD target M yogenin promoter and represses MyoD dependent transcriptions that are required for myogenic differentiation. The MBT proteins such as dScm and L3MBTLs were reported to recruit other transcriptional repressors to target promoters to repress transcri ption (31 33) I showed that Sfmbt1 is associated with multiple repressive complexes including CtBP/LSD1/HDACs complex, PRC and MBT family proteins in protein complexes ( Figure 2 4 ) SFMBT1 interacts with MyoD and direct ly regulates MyoD target genes transcription ( Figure 4 3 and 4 4 ) Combining these data, I propose d a model in which Sfmbt1 recruit s multiple transcriptional repression complexes to the MyoD target promoters (e.g. Myogenin ) and mediate s the epigenetic sile ncing. To address this model, I first determined the effect of Sfmbt1 depletion on the recruitment of multiple co repressors to the M yogenin gene promoter by ChIP assays. As shown in ( Figure 4 5D ) Sfmbt1 knockdown resulted in decrease d binding of multiple transcription repressors such as LSD1, HDAC1, RING2 and EZH2 to the Myogenin promote r, indicating that Sfmbt1 is required for the recruitment of multiple repressive complexes components to MyoD target loci. Since Sfmbt1 associated CtBP/LSD1/HDAC s compl ex and PRC components have enzymatic activities to catalyze histone methylation/demethylation and acetylation/deacetylation, I further determined whether Sfmbt1 depletion affects the histone modification status of MyoD target promoters by ChIP assays I fo und that S fmbt1 knockdown resulted in decreased levels in transcription repressive mark

PAGE 82

82 H3K27me3, and increase d levels of active marks, H3K4me 2 AcH3 and AcH4 ( Figure 4 5E ) i n the MyoD binding region of Myogenin gene promoter. In addition, the MBT family p roteins and PRC1 proteins that function in chromatin compaction were identified in the SFMBT1 protein complex. This suggests that Sfmbt1 might cause chromatin structure compaction on target promoters, a potential novel mechanism that contribute s to Sfmbt1 repression function. Therefore, I compared the chromatin accessibility flanking the transcription initiation site of MyoD target gene M yogenin before and after Sfmbt1 knockdown using the DNase I sensitivity assay. In brief, intact nuclei isolated from Sfmb t1 knockdown C2C12 cells and control cells were treated with DNase I. Genomic DNA was then extracted for real time RT PCR analysis to measure the uncut DNA of TSS sites of Myogenin and Gapdh Gapdh was used as a control, as it is constitutively expressed a nd its expression is not regulated by Sfmbt1. I found that Sfmbt1 knockdown reduced the level of uncut DNA at the Myogenin promoter region, suggesting that the region spanning the TSS site of the Myogenin gene is relatively more accessible to DNase I diges tion in Sfmbt1 knockdown cells ( Figure 4 5F ) This data suggest that Sfmbt1 causes chromatin compaction of target promoters and represses transcription. Muscle Regeneration Is Impaired i n Sfmbt1 Knockdown Muscles. To reveal an in vivo role of Sfmbt1, I inv estigated the effects of Sfmbt1 depletion on cardiotoxin (CTX) induced muscle regeneration in Tibialis anterior (TA) muscle s TA muscles of about 8 week old mice were injected with CTX to induce muscle regener ation, which is a multi step process including inflammatory response, activation and proliferation of muscle stem cells (satellite cells) differentiation of muscle stem cells into functional muscle cells and reconstitution of muscle structure ( Figure 4 6 )

PAGE 83

83 To determine whether Sfmbt1 knockdown affect s muscle regeneration I knocked down Sfmbt1 expression in TA muscles via intramuscular injection of concentrated lentiviruses containing shRNA targeting Sfmbt1 or control Luciferase three times on two days intervals. Muscles were then injected with cardio toxin three days after the last viral injection ( Figure 4 7A and B ) I found that the muscle stem cell marker Pax7 expression level decreases in the Sfmbt1 knockdown muscles two days after CTX injection, indicating a delay in muscle stem cell proliferation Defeat in muscle stem cells proliferation resulted in the impaired myogenic differentiation, as shown by the reduced level of Myogenin at day 3 ( Figure 4 7C ) HE staining of TA muscle within injected sites revealed muscle structure was reconstituted with the newly generated centralized nuclei myofibers in the control muscles, while in the Sfmbt1 knockdown muscles, only fewer and smaller centralized nuclei myofibers were generated, indicating that the reconstitution of muscle fiber structure is delayed in the Sfmbt1 knockdown muscles ( Figure 4 7D ) I n summary these findings suggest that Sfmbt1 is required for appropriate muscle stem cell proliferation and muscle regeneration in vivo Discussion S FMBT1 is a polycomb protein containing 4 MBT domains I t has both MBT and polycomb characteristics and displays strong transcription repressive activities (29, 34, 35) However, the mechanisms of S FMBT 1 in transcriptional repression remain undetermined. Our proteomic analysi s reveals that SFMBT1 interacts with C tBP /LSD1/HDAC, PRC and MBT transcriptional repressors (Figure 2 4), which suggests the important functions of SFMBT1 in coordinating diverse repressive complexes in transcription repression.

PAGE 84

84 I then utilized both in vi tro and in vivo myogenesis model s to further address mechanisms of Sfmbt1 in transcriptional regulation and its biological functions. It was shown that myogenesis is under the epigenetic control. For instance, Ezh2, the enzymatic component of PRC2, repress es muscle gene expression and regulates in vitro myogenic differentiation and in vivo muscle regeneration (30, 133, 134, 139) Drosophila ortholog of SFMBT1, dSfmbt binds to muscle development regulators (135) Therefore, I used this system to probe the molecular mechanisms. I showed that Sfmbt1 expression is down regulat ed during myogenic differentiation. Importantly, gain of function and loss of function significantly impact myogenic processes. Over expression of SFMBT1 in C2C12 myoblasts blocks the myogenic differentiation; on the other hand, knockdown of Sfmbt1 promote s the myogenic differentiation. Similar effects of Sfmbt1 on myogenic cell proliferation and differentiation were observed in primary myoblasts. M o r eover, in vivo muscle regeneration is impaired in the Sfmbt1 knockdown TA muscles, suggesting that Sfmbt1 mi ght mediate the transcriptional repression of myogenic regulators and thus regulate the myogenic differentiation. To investigate the mechanisms of Sfmbt1 mediated regulation of myogenesis, I performed microarray to identify the Sfmbt1 regulating genes by comparing the global gene expression profile in the Sfmbt1 knockdown and the control C2C12 myoblasts. The microarray analyses revealed that the important muscle genes such as M yogenin Mef2c T roponin and M yosin family members are de repressed in the Sfmbt 1 knockdown myoblasts, mimicking the phenotype of myogenic differentiation, thus suggest ing that Sfmbt1 mediates repression of important muscle genes and prevents premature differentiation of myogenic progenitor myoblasts.

PAGE 85

85 The mechanisms of polycomb and M BT proteins recruitment in mammalian system are still unclear (12, 25, 140) D iverse studies have revealed that transcription factors are crucial for the polycomb and MBT proteins recruitment to target promoters (12, 30 33, 141) D uring myogenesis, t he bHLH transcription factor MyoD recruits different epigenetic regulators to the myogenic targets and establishes spatial temporal muscle specific gene expression patterns in the myogenic developmental process (118) About 30% of the de repressed genes in Sfmbt1 knockdown C2C12 cells are the direct MyoD targets, suggesting that MyoD might recruit the Sfmbt1 protein to its t arget promoters to mediate the transcription silencing I found that SFMBT1 interacts with both exogenous and endogenous MyoD and represses the MyoD target Myogenin transcription. Moreover, S FMBT 1 directly binds to MyoD target Myogenin promoters and is req uired for the recruitment of its associated transcriptional repressors to target loci. Accordingly, the transcriptional repressive histone mark H3K27me3 decreases while the active marks H3K4me 2 AcH3 and AcH4 increase on MyoD target promoters when Sfmbt1 i s depleted Further, in vivo chromatin accessibility assay revealed that chromatin structure in promoter region of MyoD target Myogenin become loose in Sfmbt1 knockdown C2C12 cells, suggesting that Sfmbt1 is required for the chromatin compaction of MyoD ta rget regions. Therefore Sf mb t1 is required for the recruitment of multiple repressive complexes to MyoD and maintenance of repressive histone marks and chromatin compaction on MyoD target promoters. O verall, the MBT domain containing polycomb protein Sfm bt1 associates with multiple transcriptional repressive complexes and functions as a negative regulator of myogenic differentiation (Model, Fig ure 4 7E ). I n the undifferentiated myoblasts, Sfmbt1

PAGE 86

86 interacts with MyoD and recruits its associated repressors t o MyoD to mediate the histone modifications and chromatin compaction on MyoD target promoters, which excludes the binding of co activators and results in the epigenetic silencing of muscle genes and maintains the undifferentiated state of the myogenic prog enitor cells. W hen S fmbt1 is depleted, other co repressors are no longer associated with MyoD, which facilitates transcriptional de repression of MyoD target genes and promotes myogenic differentiation.

PAGE 87

87 Table 4 1. A l ist of the primers used in the study Genes Forward primer Reverse primer bp Sfmbt1 AGTGTGGCCGATGTCGTGCG GAGCAAAAGGGCCTGCCCGT 99 Myog GTCCCAACCCAGGAGATCATT GACGTAAGGGAGTGCAGATTGTG 70 P21 CGGTGGAACTTTGACTTCGT CAGGGCAGAGGAAGTACTGG 159 Pax7 AGGACGACGAGGAAGGAGACA TCATCCAGACGGTTCCCTTT 100 M ef2c ACTGGGAAACCCCAATCTTC ATCAGACCGCCTGTGTTACC 111 Mylpf CGGACCCGGAGGATGTG TGGTGCCCTTCCCTTCTG 63 Myh3 CAATAAACTGCGGGCAAAGAC CTTGCTCACTCCTCGCTTTCA 75 Gas2 ACTTTCTGCCCCATCTCCTT CTTGCAGGGAGGATCTTCAG 115 Tnnc2 AAGAGGAACTGGCTGAGTGCTT GCTAGCTCCTCAGCATCAATGTA G 73 Gapdh AACTTTGGGATTGTGGAAGG ACACATTGGGGGTAGGAACA 222 Myog Pro ChIP GAATCACATGTAATCCACTGGA ACGCCAACTGCTGGGTGCCA 151 Myog Pro DNase GAATCACATGTAATCCACTGGA GCTCCATCAGGTCGGAAAAGGCTTG 201

PAGE 88

88 Table 4 2. A l ist of genes showing up regulated expression in Sfmbt1 knockdown C2C12 myoblasts. Probe ID Fold change Gene Gene Title 1452651_a_at 7.20 Myl1 myosin, light polypeptide 1 1448371_at 6.35 Mylpf myosin light chain, phosphorylatable, fast skeletal muscle 1427115_at 5.18 Myh3 myosin, heavy polypeptid e 3, skeletal muscle, embryonic 1427868_x_at 5.13 Myh1 myosin, heavy polypeptide 1, skeletal muscle, adult 1417464_at 4.06 Tnnc2 troponin C2, fast 1419391_at 4.02 Myog Myogenin 1448201_at 3.96 Sfrp2 secreted frizzled related protein 2 1415927_at 3.96 Actc1 actin, alpha, cardiac muscle 1 1427735_a_at 3.83 Acta1 actin, alpha 1, skeletal muscle 1418370_at 3.80 Tnnc1 troponin C, cardiac/slow skeletal 1418095_at 3.67 Smpx small muscle protein, X linked 1418072_at 3.62 Hist1h2bc histone cluster 1, H2bc 1450813_a_at 3.31 Tnni1 troponin I, skeletal, slow 1 1422580_at 3.09 Myl4 myosin, light polypeptide 4 1419606_a_at 3.09 Tnnt1 troponin T1, skeletal, slow 1436994_a_at 2.81 Hist1h1c histone cluster 1, H1c 1423606_at 2.74 Postn periostin, osteoblast spec ific factor 1423669_at 2.71 Col1a1 collagen, type I, alpha 1 1437502_x_at 2.61 Cd24a CD24a antigen 1455792_x_at 2.54 Ndn Necdin 1418046_at 2.49 Nap1l2 nucleosome assembly protein 1 like 2 1417185_at 2.46 Ly6a lymphocyte antigen 6 complex, locus A 144 7657_s_at 2.46 Synpo2l synaptopodin 2 like 1454673_at 2.41 Wasf2 WAS protein family, member 2 1433640_at 2.37 Fubp1 far upstream element (FUSE) binding protein 1 1416613_at 2.37 Cyp1b1 cytochrome P450, family 1, subfamily b, polypeptide 1 1434070_at 2. 36 Jag1 jagged 1 1418209_a_at 2.35 Pfn2 profilin 2 1424780_a_at 2.26 Reep3 receptor accessory protein 3 1426208_x_at 2.18 Plagl1 pleiomorphic adenoma gene like 1 1417399_at 2.18 Gas6 growth arrest specific 6 1419123_a_at 2.17 Pdgfc platelet derived gr owth factor, C polypeptide 1421679_a_at 2.14 Cdkn1a cyclin dependent kinase inhibitor 1A (P21) 1419050_at 2.13 Tmem8c transmembrane protein 8C 1426015_s_at 2.10 Asph aspartate beta hydroxylase 1419397_at 2.10 Pola1 polymerase (DNA directed), alpha 1 1 452540_a_at 2.09 Gm11277 predicted gene 11277 1422300_at 2.08 Nog Noggin 1454838_s_at 2.06 Pkdcc protein kinase domain containing, cytoplasmic 1441667_s_at 2.06 Smyd1 SET and MYND domain containing 1 1426555_at 2.02 Scpep1 serine carboxypeptidase 1 1 418603_at 2.01 Avpr1a arginine vasopressin receptor 1A

PAGE 89

89 Table 4 2 Continued Probe ID Fold change Gene Gene Title 1428891_at 2.01 Parm1 prostate androgen regulated mucin like protein 1 1435274_at 2.00 Spopl speckle type POZ protein like 1417785_at 1 .99 Pla1a phospholipase A1 member A 1452880_at 1.99 Znhit3 zinc finger, HIT type 3 1433789_at 1.98 Snhg3 small nucleolar RNA host gene (non protein coding) 3 1450112_a_at 1.97 Gas2 growth arrest specific 2 1416953_at 1.94 Ctgf connective tissue growth factor 1425476_at 1.93 Col4a5 collagen, type IV, alpha 5 1444061_at 1.93 Prr9 proline rich 9 1455966_s_at 1.92 Nudt21 nudix (nucleoside diphosphate linked moiety X) type motif 21 1450387_s_at 1.92 Ak4 adenylate kinase 4 1444494_at 1.92 Kbtbd10 kelch r epeat and BTB (POZ) domain containing 10 1427256_at 1.90 Vcan Versican 1436867_at 1.89 Srl Sarcalumenin 1419487_at 1.88 Mybph myosin binding protein H 1451341_s_at 1.87 Tmem189 transmembrane protein 189 1451989_a_at 1.87 Mapre2 microtubule associated protein, RP/EB family, member 2 1434499_a_at 1.86 Ldhb lactate dehydrogenase B 1422644_at 1.85 Sh3bgr SH3 binding domain glutamic acid rich protein 1435355_at 1.85 Neb Nebulin 1450118_a_at 1.84 Tnnt3 troponin T3, skeletal, fast 1416408_at 1.84 Acox1 a cyl Coenzyme A oxidase 1, palmitoyl 1450455_s_at 1.83 Akr1c12 aldo keto reductase family 1, member C12 /// aldo keto reductase family 1, member C13 1434129_s_at 1.83 Lhfpl2 lipoma HMGIC fusion partner like 2 1429459_at 1.83 Sema3d sema domain, immunogl obulin domain (Ig), short basic domain, secreted, (semaphorin) 3D 1423057_at 1.81 Capza2 capping protein (actin filament) muscle Z line, alpha 2 1450917_at 1.81 Myom2 myomesin 2 1449178_at 1.80 Pdlim3 PDZ and LIM domain 3 1438683_at 1.79 Wasf2 WAS prot ein family, member 2 1421664_a_at 1.79 Styx serine/threonine/tyrosine interaction protein 1421571_a_at 1.78 Ly6c1 lymphocyte antigen 6 complex, locus C1 /// lymphocyte antigen 6 complex, locus C2 1437288_at 1.78 Impad1 inositol monophosphatase domain c ontaining 1 1428125_at 1.77 Atxn7l3b ataxin 7 like 3B 1438200_at 1.77 Sulf1 sulfatase 1 1416666_at 1.77 Serpine2 serine (or cysteine) peptidase inhibitor, clade E, member 2 1460208_at 1.77 Fbn1 fibrillin 1 1454752_at 1.77 Rbm24 RNA binding motif prote in 24 1416645_a_at 1.76 Afp alpha fetoprotein 1448664_a_at 1.75 Speg SPEG complex locus 1416498_at 1.74 Ppic peptidylprolyl isomerase C 1456035_at 1.74 Nxf3 nuclear RNA export factor 3 1452107_s_at 1.73 Npnt Nephronectin

PAGE 90

90 Table 4 2 Continued Prob e ID Fold change Gene Gene Title 1416680_at 1.73 Ube3a ubiquitin protein ligase E3A 1420859_at 1.73 Pkia protein kinase inhibitor, alpha 1447977_x_at 1.73 Gm14430 predicted gene 14430 /// predicted gene 14434 1449133_at 1.73 Sprr1a small proline rich p rotein 1A 1439766_x_at 1.72 Vegfc vascular endothelial growth factor C 1415897_a_at 1.72 Mgst1 microsomal glutathione S transferase 1 1428083_at 1.72 Neat1 nuclear paraspeckle assembly transcript 1 (non protein coding) 1434549_at 1.72 Rab11a RAB11a, me mber RAS oncogene family 1451348_at 1.72 Depdc6 DEP domain containing 6 1422606_at 1.71 C1qtnf3 C1q and tumor necrosis factor related protein 3 1451475_at 1.71 Plxnd1 plexin D1 1433676_at 1.71 Wnk1 WNK lysine deficient protein kinase 1 1460430_at 1.70 Rap2c RAP2C, member of RAS oncogene family 1449118_at 1.69 Dbt dihydrolipoamide branched chain transacylase E2 1436944_x_at 1.68 Pisd ps1 /// Pisd ps3 phosphatidylserine decarboxylase, pseudogene 1 /// phosphatidylserine decarboxylase, pseudogene 3 1433 730_at 1.68 Elmod2 ELMO domain containing 2 1426349_s_at 1.68 Tmpo Thymopoietin 1436534_at 1.68 Trove2 TROVE domain family, member 2 1436935_x_at 1.67 Clns1a chloride channel, nucleotide sensitive, 1A 1420642_a_at 1.67 Romo1 reactive oxygen species mod ulator 1 1421027_a_at 1.67 Mef2c myocyte enhancer factor 2C 1450922_a_at 1.67 Tgfb2 transforming growth factor, beta 2 1448152_at 1.66 Igf2 insulin like growth factor 2 1417644_at 1.66 Sspn Sarcospan 1448933_at 1.65 Pcdhb17 protocadherin beta 17 1434 411_at 1.65 Col12a1 collagen, type XII, alpha 1 1455184_at 1.63 Mobkl1a MOB1, Mps One Binder kinase activator like 1A (yeast) 1416911_a_at 1.63 Akirin1 akirin 1 1437845_x_at 1.62 Pofut2 protein O fucosyltransferase 2 1452237_at 1.62 Agfg1 ArfGAP with F G repeats 1 1452893_s_at 1.62 Enho energy homeostasis associated 1422520_at 1.62 Nefm neurofilament, medium polypeptide 1418308_at 1.61 Hus1 Hus1 homolog (S. pombe) 1420608_at 1.61 Rbm18 RNA binding motif protein 18 1423287_at 1.61 Cbln1 cerebellin 1 precursor protein 1418304_at 1.61 Cdhr1 cadherin related family member 1 1460656_a_at 1.61 Sft2d1 SFT2 domain containing 1 1434552_at 1.61 Wdr77 WD repeat domain 77 1421858_at 1.61 Adam17 a disintegrin and metallopeptidase domain 17 1449410_a_at 1.60 Gas5 growth arrest specific 5 1451412_a_at 1.60 Ift20 intraflagellar transport 20 homolog (Chlamydomonas) 1426852_x_at 1.60 Nov nephroblastoma overexpressed gene 1435524_at 1.60 Snhg8 small nucleolar RNA host gene 8 1418004_a_at 1.60 Tmem176 b transmemb rane protein 176B

PAGE 91

91 Table 4 2 Continued Probe ID Fold change Gene Gene Title 1434187_at 1.60 Alg11 asparagine linked glycosylation 11 homolog (yeast, alpha 1,2 mannosyltransferase) 1448875_at 1.60 Zhx1 zinc fingers and homeoboxes 1 1418973_at 1.59 B lzf1 basic leucine zipper nuclear factor 1 1448124_at 1.59 Gusb glucuronidase, beta 1453851_a_at 1.59 Gadd45g growth arrest and DNA damage inducible 45 gamma 1449929_at 1.59 Dynlt3 dynein light chain Tctex type 3 1425603_at 1.59 Tmem176 a transmembrane protein 176A 1436361_at 1.59 Vgll2 vestigial like 2 homolog (Drosophila) 1448961_at 1.58 Plscr2 phospholipid scramblase 2 1436387_at 1.58 Homer1 RIKEN cDNA C330006P03 gene /// homer homolog 1 (Drosophila) 1459981_s_at 1.58 Rsbn1 rosbin, round spermatid basic protein 1 1436210_at 1.58 Gk5 glycerol kinase 5 (putative) 1420875_at 1.58 Twf1 twinfilin, actin binding protein, homolog 1 (Drosophila) 1419662_at 1.57 Ogn Osteoglycin 1447967_at 1.57 Tmem69 transmembrane protein 69 1437466_at 1.57 Alcam activ ated leukocyte cell adhesion molecule 1460125_at 1.57 Ccdc141 coiled coil domain containing 141 1428277_at 1.56 Otud6b OTU domain containing 6B 1416318_at 1.56 Serpinb1a serine (or cysteine) peptidase inhibitor, clade B, member 1a 1437409_s_at 1.56 Gpr 126 G protein coupled receptor 126 1424567_at 1.56 Tspan2 tetraspanin 2 1427446_s_at 1.56 Ttn Titin 1448335_s_at 1.56 Ccni cyclin I 1434479_at 1.56 Col5a1 collagen, type V, alpha 1 1440559_at 1.56 Hmga2 ps1 high mobility group AT hook 2, pseudogene 1 1452352_at 1.55 Ctla2b cytotoxic T lymphocyte associated protein 2 beta 1459850_x_at 1.55 Glrb glycine receptor, beta subunit 1416985_at 1.55 Sirpa signal regulatory protein alpha 1450625_at 1.55 Col5a2 collagen, type V, alpha 2 1439364_a_at 1.55 Mmp2 matrix metallopeptidase 2 1456739_x_at 1.55 Armcx2 armadillo repeat containing, X linked 2 1416735_at 1.55 Asah1 N acylsphingosine amidohydrolase 1 1423110_at 1.55 Col1a2 collagen, type I, alpha 2 1424289_at 1.55 Osgin2 oxidative stress induced growth inhibitor family member 2 1455316_x_at 1.54 BC094435 cDNA sequence BC094435 1448269_a_at 1.54 Klhl13 kelch like 13 (Drosophila) 1435713_at 1.54 Mettl2 methyltransferase like 2 1439606_at 1.53 Katnal1 katanin p60 subunit A like 1 1418417_at 1.53 Msc M usculin 1416072_at 1.53 Cd34 CD34 antigen 1453304_s_at 1.53 Ly6e lymphocyte antigen 6 complex, locus E

PAGE 92

92 Table 4 2 Continued Probe ID Fold change Gene Gene Title 1415863_at 1.53 Eif4g2 eukaryotic translation initiation factor 4, gamma 2 1423309_at 1.53 Tgoln1 trans golgi network protein 1455070_at 1.53 Dcp2 DCP2 decapping enzyme homolog (S. cerevisiae) 1433887_at 1.53 Dnajc3 DnaJ (Hsp40) homolog, subfamily C, member 3 1417273_at 1.53 Pdk4 pyruvate dehydrogenase kinase, isoenzyme 4 1418860_a_at 1 .53 Letmd1 LETM1 domain containing 1 1421217_a_at 1.53 Lgals9 lectin, galactose binding, soluble 9 1443779_s_at 1.52 Lcor ligand dependent nuclear receptor corepressor 1428103_at 1.52 Adam10 a disintegrin and metallopeptidase domain 10 1433864_at 1.52 Lrp12 low density lipoprotein related protein 12 1428715_at 1.52 Gfpt1 glutamine fructose 6 phosphate transaminase 1 1417675_a_at 1.52 Mdn1 midasin homolog (yeast) 1422668_at 1.52 Serpinb9b serine (or cysteine) peptidase inhibitor, clade B, member 9b 1 441994_at 1.52 Pcdhb16 protocadherin beta 16 1416432_at 1.52 Pfkfb3 6 phosphofructo 2 kinase/fructose 2,6 biphosphatase 3 1452214_at 1.52 Skil SKI like 1419220_at 1.52 Xirp1 xin actin binding repeat containing 1 1448706_at 1.52 Tdp2 tyrosyl DNA phospho diesterase 2 1424215_at 1.51 Fundc1 FUN14 domain containing 1 1427306_at 1.51 Ryr1 ryanodine receptor 1, skeletal muscle 1448593_at 1.51 Wisp1 WNT1 inducible signaling pathway protein 1 1440815_x_at 1.51 Gm8267 predicted gene 8267 1433924_at 1.51 Peg3 paternally expressed 3 1433502_s_at 1.51 Tsr1 TSR1, 20S rRNA accumulation, homolog (yeast) 1441315_s_at 1.51 Slc19a2 solute carrier family 19 (thiamine transporter), member 2 1416907_at 1.51 Tsn Translin 1426570_a_at 1.51 Frk fyn related kinase 14578 25_x_at 1.51 Tcn2 transcobalamin 2 1428899_at 1.51 Tmem182 transmembrane protein 182 1417254_at 1.51 Spata5 spermatogenesis associated 5 1436736_x_at 1.50 D0H4S11 4 DNA segment, human D4S114 1430034_at 1.50 Cct4 chaperonin containing Tcp1, subunit 4 (de lta)

PAGE 93

93 Table 4 3 A l ist of genes showing down regulated expression in Sfmbt1 knockdown C2C12 myoblasts. Probe ID Fold change Gene Symbol Gene Title 1418188_a_at 3.77 Malat1 metastasis associated lung adenocarcinoma transcript 1 (non coding RNA) 14487 47_at 3.34 Fbxo32 F box protein 32 1451020_at 3.33 Gsk3b glycogen synthase kinase 3 beta 1420908_at 3.31 Cd2ap CD2 associated protein 1448733_at 3.26 Bmi1 Bmi1 polycomb ring finger oncogene 1437554_at 3.24 Plec Plectin 1453997_a_at 3.17 Nes Nest in 1425357_a_at 2.85 Grem1 gremlin 1 1416200_at 2.83 Il33 interleukin 33 1451071_a_at 2.82 Atp1a1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 1417403_at 2.77 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) 1419459_a _at 2.65 Magt1 magnesium transporter 1 1450651_at 2.54 Myo10 myosin X 1450051_at 2.50 Atrx alpha thalassemia/mental retardation syndrome X linked homolog (human) 1452670_at 2.49 Myl9 myosin, light polypeptide 9, regulatory 1429434_at 2.47 Pik3ca p hosphatidylinositol 3 kinase, catalytic, alpha polypeptide 1448525_a_at 2.43 Bnip3l BCL2/adenovirus E1B interacting protein 3 like 1457281_at 2.39 Dnajc21 DnaJ (Hsp40) homolog, subfamily C, member 21 1436343_at 2.36 Chd4 chromodomain helicase DNA bin ding protein 4 1415802_at 2.35 Slc16a1 solute carrier family 16 (monocarboxylic acid transporters), member 1 1439122_at 2.34 Ddx6 DEAD (Asp Glu Ala Asp) box polypeptide 6 1436158_at 2.27 Eif4ebp2 eukaryotic translation initiation factor 4E binding pr otein 2 1455102_at 2.24 Larp4 La ribonucleoprotein domain family, member 4 1439037_at 2.22 Ddx17 DEAD (Asp Glu Ala Asp) box polypeptide 17 1458802_at 2.22 Hivep3 human immunodeficiency virus type I enhancer binding protein 3 1450071_at 2.19 Ash1l a sh1 (absent, small, or homeotic) like (Drosophila) 1423154_at 2.18 BC005537 cDNA sequence BC005537 1451100_a_at 2.18 Cdv3 carnitine deficiency associated gene expressed in ventricle 3 1458385_at 2.17 Hspa4l heat shock protein 4 like 1424572_a_at 2. 17 H2afy H2A histone family, member Y 1458226_at 2.15 Flnb filamin, beta 1423501_at 2.13 Max Max protein 1453504_at 2.13 Taf15 TAF15 RNA polymerase II, TATA box binding protein (TBP) associated factor 1429658_a_at 2.12 Smc2 structural maintenance o f chromosomes 2 1438833_at 2.11 Casc5 cancer susceptibility candidate 5 1427488_a_at 2.11 Birc6 baculoviral IAP repeat containing 6

PAGE 94

94 Table 4 3 Continued Probe ID Fold change Gene Symbol Gene Title 1422894_at 2.11 Sfmbt1 Scm like with four mbt domain s 1 1436188_a_at 2.09 Ndrg4 N myc downstream regulated gene 4 1450767_at 2.09 Nedd9 neural precursor cell expressed, developmentally down regulated gene 9 1417623_at 2.06 Slc12a2 solute carrier family 12, member 2 1423249_at 2.04 Nktr natural kille r tumor recognition sequence 1460729_at 2.04 Rock1 Rho associated coiled coil containing protein kinase 1 1435265_at 2.03 LOC1005 04698 hypothetical LOC100504698 1431254_at 2.02 Kbtbd11 kelch repeat and BTB (POZ) domain containing 11 1449311_at 2.02 Bach1 BTB and CNC homology 1 1416555_at 2.02 Ei24 etoposide induced 2.4 mRNA 1421431_at 2.02 Ptrf polymerase I and transcript release factor 1442367_at 2.01 Atp11c ATPase, class VI, type 11C 1424768_at 2.01 Cald1 caldesmon 1 1419055_a_at 2.00 Pt pn21 protein tyrosine phosphatase, non receptor type 21 1441897_at 2.00 B230120H 23Rik RIKEN cDNA B230120H23 gene 1438201_at 2.00 Pdp1 pyruvate dehyrogenase phosphatase catalytic subunit 1 1417719_at 1.99 Sap30 sin3 associated polypeptide 1426892_at 1.99 Utrn Utrophin 1456361_at 1.98 Afap1 actin filament associated protein 1 1422490_at 1.98 Bnip2 BCL2/adenovirus E1B interacting protein 2 1418043_at 1.97 Abcc5 ATP binding cassette, sub family C (CFTR/MRP), member 5 1451437_at 1.97 Zdhhc20 zinc finger, DHHC domain containing 20 1419037_at 1.95 Csnk2a1 casein kinase 2, alpha 1 polypeptide 1454769_at 1.95 Tatdn2 TatD DNase domain containing 2 1427414_at 1.94 Prkar2a protein kinase, cAMP dependent regulatory, type II alpha 1431395_a_at 1.94 Iqgap1 IQ motif containing GTPase activating protein 1 1451458_at 1.93 Tmem2 transmembrane protein 2 1452942_at 1.93 Tmem65 transmembrane protein 65 1449292_at 1.92 Rb1cc1 RB1 inducible coiled coil 1 1438160_x_at 1.92 Slco4a1 solute carrier organi c anion transporter family, member 4a1 1438686_at 1.92 Eif4g1 eukaryotic translation initiation factor 4, gamma 1 1424254_at 1.90 Ifitm1 interferon induced transmembrane protein 1 1427267_at 1.90 Tnrc18 trinucleotide repeat containing 18 1416524_at 1.90 Spop speckle type POZ protein 1424708_at 1.89 Tmed10 transmembrane emp24 like trafficking protein 10 (yeast) 1455998_at 1.89 Zbed6 zinc finger, BED domain containing 6 1433140_a_at 1.89 Nacc1 nucleus accumbens associated 1, BEN and BTB (POZ) do main containing 1416253_at 1.89 Cdkn2d cyclin dependent kinase inhibitor 2D (p19, inhibits CDK4) /// predicted gene 4694 1434480_at 1.89 Pdpr pyruvate dehydrogenase phosphatase regulatory subunit

PAGE 95

95 Table 4 3 Continued Probe ID Fold change Gene Symbol Gene Title 1416572_at 1.88 Mmp14 matrix metallopeptidase 14 (membrane inserted) 1448207_at 1.88 Lasp1 LIM and SH3 protein 1 1437422_at 1.88 Sema5a sema domain, seven thrombospondin repeats (type 1 and type 1 like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A 1442802_x_at 1.88 Bat2 HLA B associated transcript 2 1458447_at 1.88 Cenpf centromere protein F 1419728_at 1.87 Cxcl5 chemokine (C X C motif) ligand 5 1455836_at 1.87 Papola poly (A) polymerase alpha 1436954_at 1.87 Wipf1 WAS/WASL interacting protein family, member 1 1432164_a_at 1.87 Gcsh glycine cleavage system protein H (aminomethyl carrier) 1418573_a_at 1.86 Raly hnRNP associated with lethal yellow 1423241_a_at 1.86 Tfdp1 transcription factor Dp 1 14 60498_a_at 1.85 Dnajc5 DnaJ (Hsp40) homolog, subfamily C, member 5 1436223_at 1.85 Itgb8 integrin beta 8 1435184_at 1.84 Npr3 natriuretic peptide receptor 3 1452292_at 1.84 Ap2b1 adaptor related protein complex 2, beta 1 subunit 1424025_at 1.84 BC 013529 cDNA sequence BC013529 1424207_at 1.83 Smarca5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 1423184_at 1.83 Itsn2 intersectin 2 1438771_at 1.81 Brd1 bromodomain containing 1 1432349_a_at 1 .81 Sync Syncoilin 1425166_at 1.81 Rbl1 retinoblastoma like 1 (p107) 1421453_at 1.81 Jph2 junctophilin 2 1422910_s_at 1.80 Smc6 structural maintenance of chromosomes 6 1443832_s_at 1.79 Sdpr serum deprivation response 1429172_a_at 1.79 Ncapg non SMC condensin I complex, subunit G 1438246_at 1.78 Csnk1g1 casein kinase 1, gamma 1 1424306_at 1.78 Elovl4 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast) like 4 1416154_at 1.78 Srp54a signal recognition particle 54A /// sign al recognition particle 54B 1450035_a_at 1.78 Prpf40a PRP40 pre mRNA processing factor 40 homolog A (yeast) 1419416_a_at 1.78 Rarg retinoic acid receptor, gamma 1415988_at 1.78 Hdlbp high density lipoprotein (HDL) binding protein 1430216_at 1.78 Zf p292 zinc finger protein 292 1436970_a_at 1.78 Pdgfrb platelet derived growth factor receptor, beta polypeptide 1431213_a_at 1.77 Gm3579 predicted gene 3579 1418911_s_at 1.77 Acsl4 acyl CoA synthetase long chain family member 4 1449325_at 1.77 Fads 2 fatty acid desaturase 2 1433960_at 1.77 Isg20l2 interferon stimulated exonuclease gene 20 like 2 1421032_a_at 1.76 Dnajb12 DnaJ (Hsp40) homolog, subfamily B, member 12 1424077_at 1.76 Gdpd1 glycerophosphodiester phosphodiesterase domain containing 1 1427665_a_at 1.76 Nfic nuclear factor I/C

PAGE 96

96 Table 4 3 Continued Probe ID Fold change Gene Symbol Gene Title 1427688_a_at 1.76 Ptprs protein tyrosine phosphatase, receptor type, S 1418127_a_at 1.76 Aifm1 apoptosis inducing factor, mitochondrion asso ciated 1 1433719_at 1.75 Slc9a9 solute carrier family 9 (sodium/hydrogen exchanger), member 9 1429432_at 1.75 Bat2l2 HLA B associated transcript 2 like 2 1441520_at 1.75 Aspm asp (abnormal spindle) like, microcephaly associated (Drosophila) 1449556_ at 1.75 C920025E 04Rik RIKEN cDNA C920025E04 gene /// histocompatibility 2, T region locus 23 /// h 2 class I histocompatibility antigen, D 37 alpha chain like 1422571_at 1.75 Thbs2 thrombospondin 2 1417978_at 1.74 Eif4e3 eukaryotic translation initiat ion factor 4E member 3 1455034_at 1.74 Nr4a2 nuclear receptor subfamily 4, group A, member 2 1456110_at 1.73 Ankrd11 ankyrin repeat domain 11 1443923_at 1.73 Akap13 A kinase (PRKA) anchor protein 13 1444319_at 1.73 E2f8 E2F transcription factor 8 1427764_a_at 1.73 Tcf3 transcription factor 3 1448623_at 1.73 Tmem123 transmembrane protein 123 1442072_at 1.72 C230081A 13Rik RIKEN cDNA C230081A13 gene 1434601_at 1.72 Amigo2 adhesion molecule with Ig like domain 2 1422313_a_at 1.72 Igfbp5 insuli n like growth factor binding protein 5 1456503_at 1.71 Nup214 nucleoporin 214 1452722_a_at 1.71 Cul5 cullin 5 1418288_at 1.71 Lpin1 lipin 1 1426255_at 1.71 Nefl neurofilament, light polypeptide 1429679_at 1.71 Lrrc17 leucine rich repeat containin g 17 1426933_at 1.71 Oxsr1 oxidative stress responsive 1 1434131_at 1.70 Rufy1 RUN and FYVE domain containing 1 1452392_a_at 1.70 Wipi1 WD repeat domain, phosphoinositide interacting 1 1416038_at 1.70 Snd1 staphylococcal nuclease and tudor domain c ontaining 1 1426326_at 1.70 Zfp91 zinc finger protein 91 1451793_at 1.70 Klhl24 kelch like 24 (Drosophila) 1424024_at 1.69 Mcfd2 multiple coagulation factor deficiency 2 1451771_at 1.69 Tpcn1 two pore channel 1 1448016_at 1.69 Sass6 spindle assem bly 6 homolog (C. elegans) 1450068_at 1.69 Baz1b bromodomain adjacent to zinc finger domain, 1B 1429088_at 1.69 Lbh limb bud and heart 1457009_at 1.68 Rhobtb3 Rho related BTB domain containing 3 1444016_at 1.68 Anxa1 annexin A1 1451920_a_at 1.68 Rfc1 replication factor C (activator 1) 1 1437657_at 1.67 Scaper S phase cyclin A associated protein in the ER 1425481_at 1.67 Cnot6l CCR4 NOT transcription complex, subunit 6 like 1450378_at 1.67 Tapbp TAP binding protein 1438658_a_at 1.67 S1pr3 s phingosine 1 phosphate receptor 3 1455089_at 1.67 Gng12 guanine nucleotide binding protein (G protein), gamma 12

PAGE 97

97 Table 4 3 Continued Probe ID Fold change Gene Symbol Gene Title 1423886_at 1.67 Lamc1 laminin, gamma 1 1428174_x_at 1.67 Khsrp KH type splicing regulatory protein 1424350_s_at 1.67 Lpgat1 lysophosphatidylglycerol acyltransferase 1 1451200_at 1.67 Kif1b kinesin family member 1B 1418129_at 1.66 Dhcr24 24 dehydrocholesterol reductase 1422987_at 1.66 Ntn1 netrin 1 1415965_at 1.66 Sc d1 stearoyl Coenzyme A desaturase 1 1419497_at 1.66 Cdkn1b cyclin dependent kinase inhibitor 1B 1438099_at 1.66 Trio triple functional domain (PTPRF interacting) 1449405_at 1.65 Tns1 tensin 1 1434282_at 1.65 Ibtk inhibitor of Bruton agammaglobuline mia tyrosine kinase 1425991_a_at 1.65 Kank2 KN motif and ankyrin repeat domains 2 1417951_at 1.64 Eno3 enolase 3, beta muscle 1419356_at 1.64 Klf7 Kruppel like factor 7 (ubiquitous) 1422748_at 1.64 Zeb2 zinc finger E box binding homeobox 2 1450953 _at 1.63 Ciao1 cytosolic iron sulfur protein assembly 1 homolog (S. cerevisiae) 1426235_a_at 1.63 Glul glutamate ammonia ligase (glutamine synthetase) 1421411_at 1.63 Pstpip2 proline serine threonine phosphatase interacting protein 2 1439040_at 1.63 Cenpe centromere protein E 1448710_at 1.63 Cxcr4 chemokine (C X C motif) receptor 4 1440857_at 1.63 Cad carbamoyl phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1455884_at 1.63 Dpp9 dipeptidylpeptidase 9 1444058_at 1.63 Dzi p3 DAZ interacting protein 3, zinc finger 1429385_at 1.63 Dcaf7 DDB1 and CUL4 associated factor 7 1434149_at 1.63 Tcf4 transcription factor 4 1449512_a_at 1.63 Zfx zinc finger protein X linked 1456341_a_at 1.63 Klf9 Kruppel like factor 9 1423520_a t 1.63 Lmnb1 lamin B1 1453295_at 1.62 Asxl2 additional sex combs like 2 (Drosophila) 1417161_at 1.62 Cdk2ap2 CDK2 associated protein 2 1422170_at 1.62 Slc5a3 solute carrier family 5 (inositol transporters), member 3 1419277_at 1.62 Usp48 ubiquitin specific peptidase 48 1433571_at 1.62 Serinc5 serine incorporator 5 1416516_at 1.62 Fscn1 fascin homolog 1, actin bundling protein (Strongylocentrotus purpuratus) 1460645_at 1.62 Chordc1 cysteine and histidine rich domain (CHORD) containing, zinc bi nding protein 1 1437794_at 1.61 Cabin1 calcineurin binding protein 1 1450786_x_at 1.61 Pdlim5 PDZ and LIM domain 5 1418203_at 1.61 Pmaip1 phorbol 12 myristate 13 acetate induced protein 1 1437118_at 1.61 Usp7 ubiquitin specific peptidase 7 1418946 _at 1.61 St3gal1 ST3 beta galactoside alpha 2,3 sialyltransferase 1 1427311_at 1.61 Bptf bromodomain PHD finger transcription factor 1448458_at 1.61 Top2b topoisomerase (DNA) II beta

PAGE 98

98 Table 4 3 Continued Probe ID Fold change Gene Symbol Gene Title 1 442031_at 1.61 Ccdc109a coiled coil domain containing 109A 1425573_a_at 1.61 Asap1 ArfGAP with SH# domain, ankyrin repeat and PH domain1 1456112_at 1.61 Tpr translocated promoter region 1418509_at 1.61 Cbr2 carbonyl reductase 2 1440437_at 1.60 Her c1 hect (homologous to the E6 AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1) like domain (RLD) 1 1427040_at 1.60 Mdfic MyoD family inhibitor domain containing 1417831_at 1.60 Smc1a structural maintenance of chromosomes 1A 1460353_at 1.60 Tmem48 transmembrane protein 48 1430996_at 1.60 Etnk1 ethanolamine kinase 1 1451878_a_at 1.60 Jmy junction mediating and regulatory protein 1448494_at 1.60 Gas1 growth arrest specific 1 1452360_a_at 1.60 Kdm5a lysine (K) specific demethylase 5A 1456060_ at 1.60 Maf avian musculoaponeurotic fibrosarcoma (v maf) AS42 oncogene homolog 1421230_a_at 1.60 Msi2 Musashi homolog 2 (Drosophila) 1425741_at 1.60 Srgap3 SLIT ROBO Rho GTPase activating protein 3 1428637_at 1.59 Dyrk2 dual specificity tyrosine (Y ) phosphorylation regulated kinase 2 1437330_at 1.59 Lrrk1 leucine rich repeat kinase 1 1421933_at 1.59 Cbx5 chromobox homolog 5 (Drosophila HP1a) 1451849_a_at 1.59 Lmnb2 lamin B2 1433561_at 1.59 Acap2 ArfGAP with coiled coil, ankyrin repeat and PH domains 2 1434039_at 1.59 Appbp2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 1421146_at 1.59 Rapgef1 Rap guanine nucleotide exchange factor (GEF) 1 1431425_a_at 1.59 Rprd2 regulation of nuclear pre mRNA domain containing 2 1 437047_at 1.59 Zfp664 zinc finger protein 664 1426114_at 1.59 Hnrnpab heterogeneous nuclear ribonucleoprotein A/B 1459804_at 1.58 Crebbp CREB binding protein 1427902_at 1.58 Srrm2 serine/arginine repetitive matrix 2 1423674_at 1.58 Usp1 ubiquitin specific peptidase 1 1433453_a_at 1.58 Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 1442827_at 1.58 Tlr4 toll like receptor 4 1439129_at 1.58 Dock5 dedicator of cytokinesis 5 1449356_at 1.58 Asb5 ankyrin repeat and SOCs box containing 5 1431133_at 1.58 Arhgap18 Rho GTPase activating protein 18 1430801_at 1.58 Vps13b vacuolar protein sorting 13B (yeast) 1436904_at 1.58 Med13 mediator complex subunit 13 1426458_at 1.57 Slmap sarcolemma associated protein 1428432_at 1.57 Zcchc24 zin c finger, CCHC domain containing 24 1460304_a_at 1.57 Ubtf upstream binding transcription factor, RNA polymerase I 1449546_a_at 1.57 Zfp617 zinc finger protein 617 1426086_a_at 1.57 Fmr1 fragile X mental retardation syndrome 1 homolog

PAGE 99

99 Table 4 3 Cont inued Probe ID Fold change Gene Symbol Gene Title 1430969_at 1.57 Mtch2 mitochondrial carrier homolog 2 (C. elegans) 1418030_at 1.57 Slco3a1 solute carrier organic anion transporter family, member 3a1 1424487_x_at 1.57 Txnrd1 thioredoxin reductase 1 1420973_at 1.57 Arid5b AT rich interactive domain 5B (MRF1 like) 1417821_at 1.57 D17H6S5 6E 5 DNA segment, Chr 17, human D6S56E 5 1426020_at 1.57 Tmpo thymopoietin 1444295_at 1.56 Neo1 neogenin 1422340_a_at 1.56 Actg2 actin, gamma 2, smooth muscl e, enteric 1452180_at 1.56 Phf17 PHD finger protein 17 1456088_at 1.56 Xiap X linked inhibitor of apoptosis 1418890_a_at 1.56 Rab3d RAB3D, member RAS oncogene family 1429362_a_at 1.56 Sf3b2 splicing factor 3b, subunit 2 1456533_at 1.56 Dpy19l1 dp y 19 like 1 (C. elegans) 1454289_at 1.56 Zhx3 zinc fingers and homeoboxes 3 1423015_at 1.55 Kirrel kin of IRRE like (Drosophila) 1450255_at 1.55 Arhgap31 Rho GTPase activating protein 31 1427992_a_at 1.55 Rab12 RAB12, member RAS oncogene family 14 27884_at 1.55 Col3a1 collagen, type III, alpha 1 1451287_s_at 1.55 Aif1l allograft inflammatory factor 1 like 1426755_at 1.55 Ckap4 cytoskeleton associated protein 4 1437864_at 1.55 Adipor2 adiponectin receptor 2 1455960_at 1.54 Megf9 multiple EGF like domains 9 1426686_s_at 1.54 Map3k3 mitogen activated protein kinase kinase kinase 3 1427353_at 1.54 Clasp1 CLIP associating protein 1 1423756_s_at 1.54 Igfbp4 insulin like growth factor binding protein 4 1436356_at 1.54 Samd4 sterile alpha mo tif domain containing 4 1452038_at 1.54 Capza1 capping protein (actin filament) muscle Z line, alpha 1 1428971_at 1.54 Ccny cyclin Y 1439555_at 1.54 Rlf rearranged L myc fusion sequence 1419099_x_at 1.54 Stom stomatin 1452703_at 1.53 Ahcyl2 S ade nosylhomocysteine hydrolase like 2 1449042_at 1.53 Ctcf CCCTC binding factor 1416625_at 1.53 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 1418514_at 1.53 Mtf2 metal response element binding transcription factor 2 1421319_at 1.53 Ptgfrn prostaglandin F2 receptor negative regulator 1440868_at 1.53 Gabpb2 GA repeat binding protein, beta 2 1434877_at 1.53 Nptx1 neuronal pentraxin 1 1429517_at 1.53 Zfyve20 zinc finger, FYVE domain containing 20 1451411_at 1.53 Gprc5b G pro tein coupled receptor, family C, group 5, member B 1456488_at 1.53 Wdr33 WD repeat domain 33 1444281_at 1.53 LOC1005 04841 hypothetical LOC100504841 1440397_at 1.53 Cacna2d1 calcium channel, voltage dependent, alpha2/delta subunit 1

PAGE 100

100 Table 4 3 Continu ed Probe ID Fold change Gene Symbol Gene Title 1426744_at 1.52 Srebf2 sterol regulatory element binding factor 2 1438046_at 1.52 AU019823 expressed sequence AU019823 1418731_at 1.52 Rlim ring finger protein, LIM domain interacting 1451045_at 1.52 Syt13 synaptotagmin XIII 1426259_at 1.52 Pank3 pantothenate kinase 3 1443868_at 1.52 Atp13a3 ATPase type 13A3 1453582_at 1.52 Chka choline kinase alpha 1448008_at 1.51 Ankhd1 ankyrin repeat and KH domain containing 1 1450629_at 1.51 Lima1 LIM dom ain and actin binding 1 1427918_a_at 1.51 Rhoq ras homolog gene family, member Q 1423417_at 1.51 Smarcc1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 1438773_at 1.51 Steap2 six transmembrane epithe lial antigen of prostate 2 1427279_at 1.51 Clip4 CAP GLY domain containing linker protein family, member 4 1451747_a_at 1.51 Atg12 autophagy related 12 (yeast) 1423505_at 1.51 Tagln transgelin 1422032_a_at 1.51 Zfand6 zinc finger, AN1 type domain 6 1438032_at 1.51 Lrch1 leucine rich repeats and calponin homology (CH) domain containing 1 1425592_at 1.50 Tnpo2 transportin 2 (importin 3, karyopherin beta 2b) 1419502_at 1.50 Ghdc GH3 domain containing 1450377_at 1.50 Thbs1 thrombospondin 1

PAGE 101

101 Fig ure 4 1 Sfmbt1 is a negative regulator of myogenic differentiation. A: Sfmbt1 expression level decreases during myoblast differentiation. C2C12 cells were switched from growth medium to differentiation medium to induce myogenic differentiation and RNA samples were collected at different time points. The transcript levels of Sfmbt1 (left) and Myogenin (right) are represented as mean +/ SEM. B: FLAG tagged SFMBT1 is expressed in C2C12. C2C12 cells are stably transduced with FLAG SFMBT1 or mock retrovirus es, and whole cell lysates were used for Western blot analysis with anti FLAG antibody. C: SFMBT1 over expression blocks myotube formation. FLAG tagged SFMBT1 expressing C2C12 cells and the control were induced to undergo differentiation. Myosin staining ( green) was performed 3 days after differentiation using an anti Myosin antibody. Nuclei were counter stained with DAPI. D: SFMBT1 over expression inhibits expression of muscle specific proteins. Cell lysates were collected at indicated days after different iation and detected for expression of Myosin and Myogenin by Western blot. E: SFMBT1 over expression does not affect proliferation of C2C12 myoblasts. Cells were seeded to 10 cm plates at 1*10 5 cells/plate, and cell numbers were counted 3 days later. n= 3. Data are represented as fold change with cells transduced with empty vector as 1.

PAGE 102

102 Fig ure 4 2 Sfmbt1 knockdown promotes myogenic differentiation ( A D ) : knockdown of Sfmbt1 promotes C2C12 myoblasts differentiation. A: Sfmbt1 knockdown was measured by Real t ime RT PCR. D ata are represented as mean +/ SEM B : C2C12 Sfmbt1 knockdown and control cells were induced for differentiation for 3 days. Myotubes were stained with anti Myosin antibodies (green), and nuclei were counter stained ( blue ) with DAPI ( C ) : whole cell lysates were collected to analyze expression levels of Myosin and Myogenin by Western blot analysis D: Sfmbt1 knockdown significantly decreased C2C12 proliferation E and F: Sfmbt1 knockdown result s in increased expression of P21 and decrea sed expression of Pax7 Real Time RT PCR analysis of P21 and Pax7 expression in C2C12 transduced with lentivirus expressing ShRNA against Sfmbt1 and control. D ata are represented as mean +/ SEM G J: Sfmbt1 knockdown promote s differentiation of primary m yoblasts isolated from neonatal mice.

PAGE 103

103 Figure 4 3. Sfmbt1 regulates MyoD target genes in C2C12 myoblasts. A: Microarray analysis of gene expression profiling of Sfmbt1 knockdown C2C12 cells vs. the controls to identify target genes regulated by Sfmbt1. B: Several Sfmbt1 targets were validated by real time RT PCR. Data are represented as mean +/ SEM. C: Genes up regulated by Sfmbt1 knockdown shows a significant overlap with direct MyoD target genes. The Sfmbt1 target genes and the MyoD direct target gen e identified by MyoD ChIP Seq (SRA: SRX016191 ) (138) were compared, which showed 30% of the up regulated Sfmbt1 target genes are direct MyoD target genes.

PAGE 104

104 Figure 4 4 Sfmbt1 interacts with myogenic master tran scription factor MyoD. A: Exogenous SFMBT1 interacts with endogenous MyoD in C2C12 by reciprocal immunoprecipitations. Nuclear extracts from C2C12 cells expressing FLAG SFMBT1 were used for IP with MyoD antibody (left) and anti FLAG agarose (right), and su bsequently blotted with indicated antibodies. B: A diagram of full length and truncated mutants of SFMBT1. C: GST pull down assays show that MyoD binds to the N and central region of SFMBT1 protein. Various GST SFMBT1 fusion immobilized on glutathione seph arose were incubated with whole cell lysates of 293T cells transfected with HA MyoD. The pull down products were analyzed by Western blot with HA antibody. D. Domain structure of MyoD and various truncated mutants were shown. E: Co immunoprecipitation assa ys show that the bHLH domain of MyoD interacts specifically with SFMBT1. 293T cells were co transfected with FLAG SFMBT1 and full length or truncated mutants of HA MyoD. Immunoprecipitation with anti FLAG agaroses were performed with whole cell lysates har vested 48 hours after transfection, and then blotted with HA antibodies.

PAGE 105

105 Fig ure 4 5 Sfmbt1 recruits multiple transcriptionally repressive complexes and epigenetically represses MyoD mediated transcription of Myogenin ( Myog ). A: SFMBT1 overexpression i nhibits Myogenin promoter reporter activities. B: Sfmbt1 knockdown results in an increase in Myogenin promoter reporter activities. C: SFMBT1 is bound to the Myogenin promoter by ChIP assays. ChIP assays using anti FLAG agaroses were performed using C2C12 cells stably expressing FLAG SFMBT1, and the purified ChIP DNA was used as templates for real Time PCR with Myogenin promoter primers. D: Sfmbt1 depletion resulted in a decrease in the binding of transcriptional repressors, including EZH2, RNF2, LSD1 and H DAC1, to the Myogenin promoter. E: Sfmbt1 depletion leads to enhanced levels of active histone marks and reduced levels of repressive marks. F: DNase I sensitivity assays show that Sfmbt1 knockdown led to increased chromatin accessibility of the TSS region of the myogenin gene.

PAGE 106

106 Fig ure 4 6 : Dynamic changes in muscle regeneration: HE stained TA muscle sections collected at various time points after cardiotoxin induced injury are shown. Early after injection, the main event is the activation and prolifer ation of muscle stem cells (D1 D3), while later the muscle stem cells differentiate and fuse into myotubes to reconstitute the functional muscles (D4 D10).

PAGE 107

107 Figure 4 7. Sfmbt1 regulates muscle regeneration in vivo A : Experimental design with respect to injection and assay schedule. B : Intramuscular injection of shSfmbt1 lentiviruses causes Sfmbt1 knockdown in TA muscles. RNA samples were collected from TA muscles at Day 0 to analyze Sfmbt1 expression by r eal time RT PCR. n=5. C : Sfmbt1 knockdown resulte d in a decrease in expression of Pax7 and Myogenin. D : muscle regeneration is impaired in Sfmbt1 knockdown TA. Sfmbt1 knockdown and control TA samples collected at day 8 after CTX injection were fixed, sectioned and stained with HE to analyze muscle morph ology. E : A model of Sfmbt1 in mediating epigenetic silencing of myogenesis: In undifferentiated muscle progenitor cells, Sfmbt1 interacts with MyoD and recruits multiple transcriptional co repressors including CtBP/LSD1/HDACs complexes, PRC1 and MBT prote ins to mediate histone modifications and chromatin compaction on MyoD target promoters. MyoD target genes are transcriptional repressed, which contributes to the maintenance of the undifferentiated status. When Sfmbt1 is depleted, other co repressors are n o longer associated with MyoD, which facilitates transcriptional de repression of MyoD target genes and promotes myogenic differentiation.

PAGE 108

108 CHAPTER 5 CONCLUSIONS AND FUTURE DIRECTIONS Conclusions The Notch receptor s mediated signal transduction pathway co nverts extra cellular signals to specific transcriptional programs and regulates cellular processes during development and disease pathogenesis. CSL is the only transcription factor for the canonical Notch pathway functioning as a transcriptional switch t o mediate specific Notch transcriptional responses. However, the molecular events underlying the tight regulation of Notch signal induced C SL switch from transcriptional repress or to activ ator remain incomplete. To further understand molecular regulation o f Notch mediated transcription, we isolated th e CSL protein complex and showed that CSL is associated with multiple transcriptional co regulators including the epigenetic modifiers LSD1 complex proteins and polycomb protein SFMBT1 SFMBT1 belongs to the M BT (malignant brain tumor) domain containing chromatin reader family that recognizes mono and di methylated lysines on histone tails and represses transcription. The biological functions and molecular basis underlying SFMBT1 mediated transcriptional repre ssion were poorly elucidated. Here, our proteomic analysis of the SFMBT1 protein complexes revealed that SFMBT1 is associated with multiple transcriptional co repress or complexes including CtBP/LSD1/HDACs complexes, polycomb repressive complex es and MBT f amily proteins which collectively contribute to the SFMBT1 repressor activity. These data indicate the important function of SFMBT1 in cooperation of CSL mediated transcriptional regulation of Notch signaling pathway.

PAGE 109

109 The role of polycomb protein SFMBT1 in development is poorly understood. Given the important functions of other polycomb proteins in skeletal myogenesis, we further investigated the function of SFMBT1 in myogenesis. SFMBT1 negatively regulates myogenic differentiation of cultured and primary myoblasts. Mechanistically, SFMBT1 interacts with the master regulator of myogenesis, MyoD, and mediates epigenetic silencing of MyoD target genes via recruitment of its associated repressors and subsequent induction of epigenetic modifications and chroma tin compaction. Importantly muscle regeneration is impaired after lentiviral shRNA mediated depletion of Sfmbt1 in vivo likely due to impaired satellite cell activation and differentiation. Therefore, our study identified a mechanism accounting for SFMBT 1 transcription repression, and revealed essential roles of Sfmbt1 in regulating MyoD mediated transcriptional silencing and maintenance of undifferentiated states of myogenic progenitor cells. Aberrant activation of Notch signaling represents an importan t oncogenic mechanism for T cell acute lymphoblastic leukemia (T ALL), an aggressive subset of the most common malignant childhood cancer ALL. Therefore, understanding the molecular regulation of Notch activation is critical to indentify new approaches to block aberrant Notch oncogenic activity. The family of three MAML transcriptional co activators is crucial for Notch signaling activation. The prototypic member MAML1 is the major co activator that regulates Notch oncogenic activities in leukemic cells. Ho wever, the molecular basis underlying MAML1 co activator function that contributes to Notch signaling remains unclear. In this study, we performed proteomic studies and identified DDX5, an ATP dependent DEAD box RNA helicase, as a component of the MAML1

PAGE 110

110 pr otein complex. DDX5 interacts with MAML1 in vitro and in vivo and is associated with the endogenous NOTCH1 transcription activation complex in human T ALL leukemic cells. Lentivirus mediated shRNA knockdown of DDX5 resulted in decreased expression of Notc h target signature, reduced cell proliferation, and increased apoptosis in cultured leukemic cells. Also, DDX5 depletion inhibited the growth of human leukemia xenograft in nude mice. Moreover, DDX5 is highly expressed in primary human T ALL leukemic cells based on the analyses of Oncomine database and Immunohistochemical staining. Our findings revealed a critical role of DDX5 in promoting efficient Notch mediated transcription in leukemic cells, suggesting that DDX5 might be critical for NOTCH1 mediated T ALL pathogenesis and thus is a potential new target for modulating the Notch signaling in leukemia. Future Directions In this study, we have identified important novel CSL associating epigenetic modifiers including LSD1 complex proteins, PRC components and MBT proteins, suggesting their potential functions in Notch regulation. Using a Notch responsive luciferase reporter system, we further revealed that those CSL associating epigenetic modifiers function in the transcriptional repression of Notch signaling. In the future, we are going to study the functions and mechanisms of those epigenetic modifiers in the regulation of Notch dependent developmental processes and cancer progression. The Notch signaling pathway functions crucially in cell fate determination In the embryonic stem cells, although the key Notch components are highly expressed, the expression of Notch target genes remains at a low level. Polycomb repressive complex proteins establish and maintain the repressive status of important developmental genes in the embryonic stem cells Large scale genome wide polycomb target s by ChIP Seq

PAGE 111

111 and ChIP Chip revealed that the Notch target promoters are bound by the polycomb proteins (54 56) The polycomb proteins are responsible for the establishment of bival ent domain (contain both H3K4me3 and H3K27me3) on the promoters of important developmental genes and thus repress the expression of target genes. Analysis of the ChIP seq data in embryonic stem cells revealed that majority of the Notch targets has biva lent domains on their promoters This suggests that the polycomb proteins directly regulate the transcriptional repression of Notch target genes. However, the mechanisms underlying how polycomb proteins regulate Notch signaling in the embryonic stem cells rema ins unknown. Our proteomic data revealed that the Notch transcription factor CSL is associated with polycomb proteins SFMBT1 and PRC1 components, suggesting that polycomb proteins might regulate the CSL mediated Notch target gene transcription. Since littl e is known about the functions and mechanisms of CSL SFMBT1 polycomb proteins in Notch regulation, we are going to investigate the potential link between polycomb proteins and Notch, and the mechanisms of CSL in epigenetic silencing of Notch signaling in t he embryonic stem cells. We will first address the functions of CSL in the recruitment of its associated epigenetic modifiers and the regulation of related epigenetic modifications on Notch target promoters. Since SFMBT1 interacts with CSL and might functi on in recruitment of other transcriptional co repressors, we will further determine the functions of SFMBT1 in epigenetic regulation of Notch signaling pathway in the embryonic stem cells. We will also address the functions of CSL interacting epigenetic modifiers in Notch dependent developmental processes. Notch signaling plays an essential role in

PAGE 112

112 the development of T cells from common lymphoid progenitors (ETP) and enforced NOTCH1 signaling leads to T cell differentiation at the expense of B cell differ entiation (142, 143) Notch/CSL signaling is required for ETP generation and the transition from DN3 to DN4 (144, 145) To investigate the biological function s of CSL assoc iated epigenetic regulators as potential Notch regulators, we will utilize an in vitro co culture system (146) to determine functions of epigenetic regulators in T cell generation that are critically dependent on Notch/CSL signaling. In this assay, hematopoietic stem and progenitor cells (HSPCs) are co cultured with OP9 bone marrow stromal line that expresses Notch ligand Delta like 1 (OP9 DL1, co expressing GFP) or stromal cells i nfected with control viruses (OP9 GFP) (146) Culturing with OP9 DL1 supports the normal program of T cell development from HSPCs, whereas culturing cells with control OP9 GFP fav ors the generation of B cells and myeloid cells (56, 146) We have tested OP9 GFP and OP9 DL1 stromal cells (gifts of Dr. Zuniga Pflucker) and verified that OP9 DL1 cells can functionally activate Notch responsive promoter reporters (pCSL luc and pHES1 luc) (73) in co cultured cell populations. We will determine gain of function and loss of function effects of LSD1 and SFMBT1 in Notch mediated T cells development In brief the fetal liver cells will be transduced with retroviruses or lentiviruses and cultured overnight. The transduced cells will be plated on OP9 DL1 monolayers or control OP9 GFP cells and then the kinetics of T/B cell development will be monitored by flow cytometric analysis using the cell surface markers Using this system, we can further reveal the functions and the related mechanisms of CSL interacting epigenetic modifiers in regulation of Notch signaling pathway.

PAGE 113

113 LIST OF REFERENCES 1. Felsenfeld, G., and Groudine, M. 2003. Controlling the double helix. Nature 421:448 453. 2. Babu, A., and Verma, R.S. 1987. Chromosome structure: euchromatin and heterochromatin. Int Rev Cytol 108:1 60. 3. Luger, K., and Richmond, T.J. 1998. DNA bindi ng within the nucleosome core. Curr Opin Struct Biol 8:33 40. 4. Luger, K., and Hansen, J.C. 2005. Nucleosome and chromatin fiber dynamics. Curr Opin Struct Biol 15:188 196. 5. Goldberg, A.D., Allis, C.D., and Bernstein, E. 2007. Epigenetics: a landscape takes shape. Cell 128:635 638. 6. Bird, A. 2002. DNA methylation patterns and epigenetic memory. Genes Dev 16:6 21. 7. Goll, M.G., and Bestor, T.H. 2005. Eukaryotic cytosine methyltransferases. Annu Rev Biochem 74:481 514. 8. Guo, J.U., Su, Y., Zhong, C., Ming, G.L., and Song, H. 2011. Emerging roles of TET proteins and 5 hydroxymethylcytosines in active DNA demethylation and beyond. Cell Cycle 10:2662 2668. 9. Kouzarides, T. 2007. Chromatin modifications and their function. Cell 128:693 705. 10. Li, B., Carey, M., and Workman, J.L. 2007. The role of chromatin during transcription. Cell 128:707 719. 11. Bannister, A.J., and Kouzarides, T. 2011. Regulation of chromatin by histone modifications. Cell Res 21:381 395. 12. Bonasio, R., Lecona, E., and Rei nberg, D. 2010. MBT domain proteins in development and disease. Semin Cell Dev Biol 21:221 230. 13. Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J.R., Cole, P.A., Casero, R.A., and Shi, Y. 2004. Histone demethylation mediated by the nuclear amin e oxidase homolog LSD1. Cell 119:941 953. 14. Hakimi, M.A., Dong, Y., Lane, W.S., Speicher, D.W., and Shiekhattar, R. 2003. A candidate X linked mental retardation gene is a component of a new family of histone deacetylase containing complexes. J Biol Che m 278:7234 7239.

PAGE 114

114 15. Shi, Y.J., Matson, C., Lan, F., Iwase, S., Baba, T., and Shi, Y. 2005. Regulation of LSD1 histone demethylase activity by its associated factors. Mol Cell 19:857 864. 16. Lee, M.G., Wynder, C., Bochar, D.A., Hakimi, M.A., Cooch, N., a nd Shiekhattar, R. 2006. Functional interplay between histone demethylase and deacetylase enzymes. Mol Cell Biol 26:6395 6402. 17. Metzger, E., Wissmann, M., Yin, N., Muller, J.M., Schneider, R., Peters, A.H., Gunther, T., Buettner, R., and Schule, R. 200 5. LSD1 demethylates repressive histone marks to promote androgen receptor dependent transcription. Nature 437:436 439. 18. Garcia Bassets, I., Kwon, Y.S., Telese, F., Prefontaine, G.G., Hutt, K.R., Cheng, C.S., Ju, B.G., Ohgi, K.A., Wang, J., Escoubet Lo zach, L., et al. 2007. Histone methylation dependent mechanisms impose ligand dependency for gene activation by nuclear receptors. Cell 128:505 518. 19. Wissmann, M., Yin, N., Muller, J.M., Greschik, H., Fodor, B.D., Jenuwein, T., Vogler, C., Schneider, R ., Gunther, T., Buettner, R., et al. 2007. Cooperative demethylation by JMJD2C and LSD1 promotes androgen receptor dependent gene expression. Nat Cell Biol 9:347 353. 20. Saleque, S., Kim, J., Rooke, H.M., and Orkin, S.H. 2007. Epigenetic regulation of he matopoietic differentiation by Gfi 1 and Gfi 1b is mediated by the cofactors CoREST and LSD1. Mol Cell 27:562 572. 21. Hu, X., Li, X., Valverde, K., Fu, X., Noguchi, C., Qiu, Y., and Huang, S. 2009. LSD1 mediated epigenetic modification is required for TA L1 function and hematopoiesis. Proc Natl Acad Sci U S A 106:10141 10146. 22. Katz, D.J., Edwards, T.M., Reinke, V., and Kelly, W.G. 2009. A C. elegans LSD1 demethylase contributes to germline immortality by reprogramming epigenetic memory. Cell 137:308 32 0. 23. Wang, J., Hevi, S., Kurash, J.K., Lei, H., Gay, F., Bajko, J., Su, H., Sun, W., Chang, H., Xu, G., et al. 2009. The lysine demethylase LSD1 (KDM1) is required for maintenance of global DNA methylation. Nat Genet 41:125 129. 24. Wang, Y., Zhang, H. Chen, Y., Sun, Y., Yang, F., Yu, W., Liang, J., Sun, L., Yang, X., Shi, L., et al. 2009. LSD1 is a subunit of the NuRD complex and targets the metastasis programs in breast cancer. Cell 138:660 672. 25. Simon, J.A., and Kingston, R.E. 2009. Mechanisms o f polycomb gene silencing: knowns and unknowns. Nat Rev Mol Cell Biol 10:697 708.

PAGE 115

115 26. Muller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. 2002. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111:197 208. 27. Schwartz, Y.B., and Pirrotta, V. 2007. Polycomb silencing mechanisms and the management of genomic programmes. Nat Rev Genet 8:9 22. 28. Wang, L., Brown, J.L., Cao, R., Zha ng, Y., Kassis, J.A., and Jones, R.S. 2004. Hierarchical recruitment of polycomb group silencing complexes. Mol Cell 14:637 646. 29. Klymenko, T., Papp, B., Fischle, W., Kocher, T., Schelder, M., Fritsch, C., Wild, B., Wilm, M., and Muller, J. 2006. A Pol ycomb group protein complex with sequence specific DNA binding and selective methyl lysine binding activities. Genes Dev 20:1110 1122. 30. Caretti, G., Di Padova, M., Micales, B., Lyons, G.E., and Sartorelli, V. 2004. The Polycomb Ezh2 methyltransferase r egulates muscle gene expression and skeletal muscle differentiation. Genes Dev 18:2627 2638. 31. Trojer, P., Li, G., Sims, R.J., 3rd, Vaquero, A., Kalakonda, N., Boccuni, P., Lee, D., Erdjument Bromage, H., Tempst, P., Nimer, S.D., et al. 2007. L3MBTL1, a histone methylation dependent chromatin lock. Cell 129:915 928. 32. Trojer, P., Cao, A.R., Gao, Z., Li, Y., Zhang, J., Xu, X., Li, G., Losson, R., Erdjument Bromage, H., Tempst, P., et al. 2011. L3MBTL2 Protein Acts in Concert with PcG Protein Mediated M onoubiquitination of H2A to Establish a Repressive Chromatin Structure. Mol Cell 42:438 450. 33. Wang, L., Jahren, N., Miller, E.L., Ketel, C.S., Mallin, D.R., and Simon, J.A. 2010. Comparative analysis of chromatin binding by Sex Comb on Midleg (SCM) and other polycomb group repressors at a Drosophila Hox gene. Mol Cell Biol 30:2584 2593. 34. Grimm, C., Matos, R., Ly Hartig, N., Steuerwald, U., Lindner, D., Rybin, V., Muller, J., and Muller, C.W. 2009. Molecular recognition of histone lysine methylation by the Polycomb group repressor dSfmbt. Embo J 28:1965 1977. 35. Wu, S., Trievel, R.C., and Rice, J.C. 2007. Human SFMBT is a transcriptional repressor protein that selectively binds the N terminal tail of histone H3. FEBS Lett 581:3289 3296. 36. Bray, S .J. 2006. Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol 7:678 689.

PAGE 116

116 37. Kao, H.Y., Ordentlich, P., Koyano Nakagawa, N., Tang, Z., Downes, M., Kintner, C.R., Evans, R.M., and Kadesch, T. 1998. A histone deacetylase corepressor com plex regulates the Notch signal transduction pathway. Genes Dev 12:2269 2277. 38. Hsieh, J.J., Zhou, S., Chen, L., Young, D.B., and Hayward, S.D. 1999. CIR, a corepressor linking the DNA binding factor CBF1 to the histone deacetylase complex. Proc Natl Ac ad Sci U S A 96:23 28. 39. Shi, Y., Downes, M., Xie, W., Kao, H.Y., Ordentlich, P., Tsai, C.C., Hon, M., and Evans, R.M. 2001. Sharp, an inducible cofactor that integrates nuclear receptor repression and activation. Genes Dev 15:1140 1151. 40. Oswald, F. Kostezka, U., Astrahantseff, K., Bourteele, S., Dillinger, K., Zechner, U., Ludwig, L., Wilda, M., Hameister, H., Knochel, W., et al. 2002. SHARP is a novel component of the Notch/RBP Jkappa signalling pathway. Embo J 21:5417 5426. 41. Oswald, F., Winkl er, M., Cao, Y., Astrahantseff, K., Bourteele, S., Knochel, W., and Borggrefe, T. 2005. RBP Jkappa/SHARP recruits CtIP/CtBP corepressors to silence Notch target genes. Mol Cell Biol 25:10379 10390. 42. Salat, D., Liefke, R., Wiedenmann, J., Borggrefe, T., and Oswald, F. 2008. ETO, but not leukemogenic fusion protein AML1/ETO, augments RBP Jkappa/SHARP mediated repression of notch target genes. Mol Cell Biol 28:3502 3512. 43. Zhou, S., Fujimuro, M., Hsieh, J.J., Chen, L., and Hayward, S.D. 2000. A role for SKIP in EBNA2 activation of CBF1 repressed promoters. J Virol 74:1939 1947. 44. Wallberg, A.E., Pedersen, K., Lendahl, U., and Roeder, R.G. 2002. p300 and PCAF act cooperatively to mediate transcriptional activation from chromatin templates by notch intr acellular domains in vitro. Mol Cell Biol 22:7812 7819. 45. Fryer, C.J., Lamar, E., Turbachova, I., Kintner, C., and Jones, K.A. 2002. Mastermind mediates chromatin specific transcription and turnover of the Notch enhancer complex. Genes Dev 16:1397 1411. 46. Saint Just Ribeiro, M., Hansson, M.L., and Wallberg, A.E. 2007. A proline repeat domain in the Notch co activator MAML1 is important for the p300 mediated acetylation of MAML1. Biochem J 404:289 298. 47. Liu, J., Sato, C., Cerletti, M., and Wagers, A. 2010. Notch signaling in the regulation of stem cell self renewal and differentiation. Curr Top Dev Biol 92:367 409.

PAGE 117

117 48. Walsh, J., and Andrews, P.W. 2003. Expression of Wnt and Notch pathway genes in a pluripotent human embryonal carcinoma cell line an d embryonic stem cell. APMIS 111:197 210; discussion 210 191. 49. Noggle, S.A., Weiler, D., and Condie, B.G. 2006. Notch signaling is inactive but inducible in human embryonic stem cells. Stem Cells 24:1646 1653. 50. Lowell, S., Benchoua, A., Heavey, B., and Smith, A.G. 2006. Notch promotes neural lineage entry by pluripotent embryonic stem cells. PLoS Biol 4:e121. 51. Yu, X., Zou, J., Ye, Z., Hammond, H., Chen, G., Tokunaga, A., Mali, P., Li, Y.M., Civin, C., Gaiano, N., et al. 2008. Notch signaling act ivation in human embryonic stem cells is required for embryonic, but not trophoblastic, lineage commitment. Cell Stem Cell 2:461 471. 52. Schmitt, T.M., de Pooter, R.F., Gronski, M.A., Cho, S.K., Ohashi, P.S., and Zuniga Pflucker, J.C. 2004. Induction of T cell development and establishment of T cell competence from embryonic stem cells differentiated in vitro. Nat Immunol 5:410 417. 53. Kumano, K., Chiba, S., Kunisato, A., Sata, M., Saito, T., Nakagami Yamaguchi, E., Yamaguchi, T., Masuda, S., Shimizu, K ., Takahashi, T., et al. 2003. Notch1 but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity 18:699 711. 54. Radtke, F., Wilson, A., Stark, G., Bauer, M., van Meerwijk, J., MacDonald, H.R., and Aguet, M. 1999. Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 10:547 558. 55. Pui, J.C., Allman, D., Xu, L., DeRocco, S., Karnell, F.G., Bakkour, S., Lee, J.Y., Kadesch, T., Hardy, R.R., Aster, J.C., et al. 1999. Notch1 exp ression in early lymphopoiesis influences B versus T lineage determination. Immunity 11:299 308. 56. Schmitt, T.M., and Zuniga Pflucker, J.C. 2002. Induction of T cell development from hematopoietic progenitor cells by delta like 1 in vitro. Immunity 17:7 49 756. 57. La Motte Mohs, R.N., Herer, E., and Zuniga Pflucker, J.C. 2005. Induction of T cell development from human cord blood hematopoietic stem cells by Delta like 1 in vitro. Blood 105:1431 1439. 58. Mercher, T., Cornejo, M.G., Sears, C., Kindler, T., Moore, S.A., Maillard, I., Pear, W.S., Aster, J.C., and Gilliland, D.G. 2008. Notch signaling specifies megakaryocyte development from hematopoietic stem cells. Cell Stem Cell 3:314 326.

PAGE 118

118 59. Zhou, J., Cheng, P., Youn, J.I., Cotter, M.J., and Gabrilovic h, D.I. 2009. Notch and wingless signaling cooperate in regulation of dendritic cell differentiation. Immunity 30:845 859. 60. Beck, R.C., Padival, M., Yeh, D., Ralston, J., Cooke, K.R., and Lowe, J.B. 2009. The Notch ligands Jagged2, Delta1, and Delta4 i nduce differentiation and expansion of functional human NK cells from CD34(+) cord blood hematopoietic progenitor cells. Biol Blood Marrow Transplant 15:1026 1037. 61. Haraguchi, K., Suzuki, T., Koyama, N., Kumano, K., Nakahara, F., Matsumoto, A., Yokoyam a, Y., Sakata Yanagimoto, M., Masuda, S., Takahashi, T., et al. 2009. Notch activation induces the generation of functional NK cells from human cord blood CD34 positive cells devoid of IL 15. J Immunol 182:6168 6178. 62. Ellisen, L.W., Bird, J., West, D.C ., Soreng, A.L., Reynolds, T.C., Smith, S.D., and Sklar, J. 1991. TAN 1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66:649 661. 63. Weng, A.P., Ferrando, A.A., Lee, W., Morris J.P.t., Silverman, L.B., Sanchez Irizarry, C., Blacklow, S.C., Look, A.T., and Aster, J.C. 2004. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306:269 271. 64. O'Neil, J., Grim, J., Strack, P., Rao, S., Tibbitts, D ., Winter, C., Hardwick, J., Welcker, M., Meijerink, J.P., Pieters, R., et al. 2007. FBW7 mutations in leukemic cells mediate NOTCH pathway activation and resistance to gamma secretase inhibitors. J Exp Med 204:1813 1824. 65. Pear, W.S., Aster, J.C., Scot t, M.L., Hasserjian, R.P., Soffer, B., Sklar, J., and Baltimore, D. 1996. Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles. J Exp Med 183:2283 2291. 66. Chiang, M.Y., Xu, L., Shestova, O., Histen, G., L'Heureux, S., Romany, C., Childs, M.E., Gimotty, P.A., Aster, J.C., and Pear, W.S. 2008. Leukemia associated NOTCH1 alleles are weak tumor initiators but accelerate K ras initiated leukemia. J Clin Invest 118:3181 3194. 67. Aster, J.C., Xu, L ., Karnell, F.G., Patriub, V., Pui, J.C., and Pear, W.S. 2000. Essential roles for ankyrin repeat and transactivation domains in induction of T cell leukemia by notch1. Mol Cell Biol 20:7505 7515. 68. McElhinny, A.S., Li, J.L., and Wu, L. 2008. Mastermind like transcriptional co activators: emerging roles in regulating cross talk among multiple signaling pathways. Oncogene 27:5138 5147.

PAGE 119

119 69. Nakatani, Y., and Ogryzko, V. 2003. Immunoaffinity purification of mammalian protein complexes. Methods Enzymol 370:4 30 444. 70. Hsieh, J.J., Henkel, T., Salmon, P., Robey, E., Peterson, M.G., and Hayward, S.D. 1996. Truncated mammalian Notch1 activates CBF1/RBPJk repressed genes by a mechanism resembling that of Epstein Barr virus EBNA2. Mol Cell Biol 16:952 959. 71. Shen, H., McElhinny, A.S., Cao, Y., Gao, P., Liu, J., Bronson, R., Griffin, J.D., and Wu, L. 2006. The Notch coactivator, MAML1, functions as a novel coactivator for MEF2C mediated transcription and is required for normal myogenesis. Genes Dev 20:675 688. 72. Ogawa, H., Ishiguro, K., Gaubatz, S., Livingston, D.M., and Nakatani, Y. 2002. A complex with chromatin modifiers that occupies E2F and Myc responsive genes in G0 cells. Science 296:1132 1136. 73. Wu, L., Aster, J.C., Blacklow, S.C., Lake, R., Artav anis Tsakonas, S., and Griffin, J.D. 2000. MAML1, a human homologue of Drosophila mastermind, is a transcriptional co activator for NOTCH receptors. Nat Genet 26:484 489. 74. Wu, L., Sun, T., Kobayashi, K., Gao, P., and Griffin, J.D. 2002. Identification of a family of mastermind like transcriptional coactivators for mammalian notch receptors. Mol Cell Biol 22:7688 7700. 75. Kovall, R.A., and Hendrickson, W.A. 2004. Crystal structure of the nuclear effector of Notch signaling, CSL, bound to DNA. Embo J 23 :3441 3451. 76. Wilson, J.J., and Kovall, R.A. 2006. Crystal structure of the CSL Notch Mastermind ternary complex bound to DNA. Cell 124:985 996. 77. Jarriault, S., and Greenwald, I. 2002. Suppressors of the egg laying defective phenotype of sel 12 pres enilin mutants implicate the CoREST corepressor complex in LIN 12/Notch signaling in C. elegans. Genes Dev 16:2713 2728. 78. Wang, J., Scully, K., Zhu, X., Cai, L., Zhang, J., Prefontaine, G.G., Krones, A., Ohgi, K.A., Zhu, P., Garcia Bassets, I., et al. 2007. Opposing LSD1 complexes function in developmental gene activation and repression programmes. Nature 446:882 887. 79. Di Stefano, L., Walker, J.A., Burgio, G., Corona, D.F., Mulligan, P., Naar, A.M., and Dyson, N.J. 2011. Functional antagonism betwee n histone H3K4 demethylases in vivo. Genes Dev 25:17 28.

PAGE 120

120 80. Mulligan, P., Yang, F., Di Stefano, L., Ji, J.Y., Ouyang, J., Nishikawa, J.L., Toiber, D., Kulkarni, M., Wang, Q., Najafi Shoushtari, S.H., et al. 2011. A SIRT1 LSD1 corepressor complex regula tes Notch target gene expression and development. Mol Cell 42:689 699. 81. Wu, S., Shi, Y., Mulligan, P., Gay, F., Landry, J., Liu, H., Lu, J., Qi, H.H., Wang, W., Nickoloff, J.A., et al. 2007. A YY1 INO80 complex regulates genomic stability through homol ogous recombination based repair. Nat Struct Mol Biol 14:1165 1172. 82. Shi, Y., Sawada, J., Sui, G., Affar el, B., Whetstine, J.R., Lan, F., Ogawa, H., Luke, M.P., Nakatani, Y., and Shi, Y. 2003. Coordinated histone modifications mediated by a CtBP co re pressor complex. Nature 422:735 738. 83. Srinivasan, L., and Atchison, M.L. 2004. YY1 DNA binding and PcG recruitment requires CtBP. Genes Dev 18:2596 2601. 84. Basu, A., and Atchison, M.L. 2010. CtBP levels control intergenic transcripts, PHO/YY1 DNA bi nding, and PcG recruitment to DNA. J Cell Biochem 110:62 69. 85. Tsai, M.C., Manor, O., Wan, Y., Mosammaparast, N., Wang, J.K., Lan, F., Shi, Y., Segal, E., and Chang, H.Y. 2010. Long noncoding RNA as modular scaffold of histone modification complexes. Sc ience 329:689 693. 86. Adamo, A., Sese, B., Boue, S., Castano, J., Paramonov, I., Barrero, M.J., and Izpisua Belmonte, J.C. 2011. LSD1 regulates the balance between self renewal and differentiation in human embryonic stem cells. Nat Cell Biol 13:652 659. 87. Artavanis Tsakonas, S., and Muskavitch, M.A. 2010. Notch: the past, the present, and the future. Curr Top Dev Biol 92:1 29. 88. Koch, U., and Radtke, F. 2010. Notch signaling in solid tumors. Curr Top Dev Biol 92:411 455. 89. Paganin, M., and Ferran do, A. 2010. Molecular pathogenesis and targeted therapies for NOTCH1 induced T cell acute lymphoblastic leukemia. Blood Rev 90. Aster, J.C., Blacklow, S.C., and Pear, W.S. 2011. Notch signalling in T cell lymphoblastic leukaemia/lymphoma and other haema tological malignancies. J Pathol 223:262 273. 91. Ranganathan, P., Weaver, K.L., and Capobianco, A.J. 2011. Notch signalling in solid tumours: a little bit of everything but not all the time. Nat Rev Cancer 11:338 351.

PAGE 121

121 92. Kopan, R., and Ilagan, M.X. 200 9. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137:216 233. 93. Lin, S.E., Oyama, T., Nagase, T., Harigaya, K., and Kitagawa, M. 2002. Identification of new human mastermind proteins defines a family that consists of po sitive regulators for notch signaling. J Biol Chem 277:50612 50620. 94. Ford, M.J., Anton, I.A., and Lane, D.P. 1988. Nuclear protein with sequence homology to translation initiation factor eIF 4A. Nature 332:736 738. 95. Hirling, H., Scheffner, M., Rest le, T., and Stahl, H. 1989. RNA helicase activity associated with the human p68 protein. Nature 339:562 564. 96. Fuller Pace, F.V., and Ali, S. 2008. The DEAD box RNA helicases p68 (Ddx5) and p72 (Ddx17): novel transcriptional co regulators. Biochem Soc T rans 36:609 612. 97. Fuller Pace, F.V., and Moore, H.C. 2011. RNA helicases p68 and p72: multifunctional proteins with important implications for cancer development. Future Oncol 7:239 251. 98. Caretti, G., Schiltz, R.L., Dilworth, F.J., Di Padova, M., Z hao, P., Ogryzko, V., Fuller Pace, F.V., Hoffman, E.P., Tapscott, S.J., and Sartorelli, V. 2006. The RNA helicases p68/p72 and the noncoding RNA SRA are coregulators of MyoD and skeletal muscle differentiation. Dev Cell 11:547 560. 99. Gu, Y., Lin, S., Li J.L., Nakagawa, H., Chen, Z., Jin, B., Tian, L., Ucar, D.A., Shen, H., Lu, J., et al. 2012. Altered LKB1/CREB regulated transcription co activator (CRTC) signaling axis promotes esophageal cancer cell migration and invasion. Oncogene 31:469 479. 100. Mo ellering, R.E., Cornejo, M., Davis, T.N., Del Bianco, C., Aster, J.C., Blacklow, S.C., Kung, A.L., Gilliland, D.G., Verdine, G.L., and Bradner, J.E. 2009. Direct inhibition of the NOTCH transcription factor complex. Nature 462:182 188. 101. Fryer, C.J., W hite, J.B., and Jones, K.A. 2004. Mastermind recruits CycC:CDK8 to phosphorylate the Notch ICD and coordinate activation with turnover. Mol Cell 16:509 520. 102. Hansson, M.L., Popko Scibor, A.E., Saint Just Ribeiro, M., Dancy, B.M., Lindberg, M.J., Cole, P.A., and Wallberg, A.E. 2009. The transcriptional coactivator MAML1 regulates p300 autoacetylation and HAT activity. Nucleic Acids Res 37:2996 3006.

PAGE 122

122 103. Saint Just Ribeiro, M., Hansson, M.L., Lindberg, M.J., Popko Scibor, A.E., and Wallberg, A.E. 2009. GSK3beta is a negative regulator of the transcriptional coactivator MAML1. Nucleic Acids Res 37:6691 6700. 104. Haferlach, T., Kohlmann, A., Wieczorek, L., Basso, G., Kronnie, G.T., Bene, M.C., De Vos, J., Hernandez, J.M., Hofmann, W.K., Mills, K.I., et al. 2010. Clinical utility of microarray based gene expression profiling in the diagnosis and subclassification of leukemia: report from the International Microarray Innovations in Leukemia Study Group. J Clin Oncol 28:2529 2537. 105. Caretti, G., Lei, E. P., and Sartorelli, V. 2007. The DEAD box p68/p72 proteins and the noncoding RNA steroid receptor activator SRA: eclectic regulators of disparate biological functions. Cell Cycle 6:1172 1176. 106. Nicol, S.M. and Fuller Pace, F.V. 2010 Analysis of the R NA helicase p68 (Ddx5) as a transcriptional regulator Methods Mol Biol 587 : 265 279 107. Clark, E.L., Coulson, A., Dalgliesh, C., Rajan, P., Nicol, S.M., Fleming, S., Heer, R., Gaughan, L., Leung, H.Y., Elliott, D.J., et al. 2008. The RNA helicase p68 is a novel androgen receptor coactivator involved in splicing and is overexpressed in prostate cancer. Cancer Res 68:7938 7946. 108. Endoh, H., Maruyama, K., Masuhiro, Y., Kobayashi, Y., Goto, M., Tai, H., Yanagisawa, J., Metzger, D., Hashimoto, S., and Kat o, S. 1999. Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor alpha. Mol Cell Biol 19:5363 5372. 109. Jensen, E.D., Niu, L., Caretti, G., Nicol, S. M., Teplyuk, N., Stein, G.S., Sartorelli, V., van Wijnen, A.J., Fuller Pace, F.V., and Westendorf, J.J. 2008. p68 (Ddx5) interacts with Runx2 and regulates osteoblast differentiation. J Cell Biochem 103:1438 1451. 110. Germann, S., Gratadou, L., Zonta, E. Dardenne, E., Gaudineau, B., Fougere, M., Samaan, S., Dutertre, M., Jauliac, S., and Auboeuf, D. 2012. Dual role of the ddx5/ddx17 RNA helicases in the control of the pro migratory NFAT5 transcription factor. Oncogene 111. Janknecht, R. 2010. Multi tal ented DEAD box proteins and potential tumor promoters: p68 RNA helicase (DDX5) and its paralog, p72 RNA helicase (DDX17). Am J Transl Res 2:223 234. 112. Yang, L., Lin, C., Sun, S.Y., Zhao, S., and Liu, Z.R. 2007. A double tyrosine phosphorylation of P68 RNA helicase confers resistance to TRAIL induced apoptosis. Oncogene 26:6082 6092.

PAGE 123

123 113. Cohen, A.A., Geva Zatorsky, N., Eden, E., Frenkel Morgenstern, M., Issaeva, I., Sigal, A., Milo, R., Cohen Saidon, C., Liron, Y., Kam, Z., et al. 2008. Dynamic proteomi cs of individual cancer cells in response to a drug. Science 322:1511 1516. 114. Guo, D., Ye, J., Dai, J., Li, L., Chen, F., Ma, D., and Ji, C. 2009. Notch 1 regulates Akt signaling pathway and the expression of cell cycle regulatory proteins cyclin D1, C DK2 and p21 in T ALL cell lines. Leuk Res 33:678 685. 115. Weng, A.P., Nam, Y., Wolfe, M.S., Pear, W.S., Griffin, J.D., Blacklow, S.C., and Aster, J.C. 2003. Growth suppression of pre T acute lymphoblastic leukemia cells by inhibition of notch signaling. Mol Cell Biol 23:655 664. 116. Pownall, M.E., Gustafsson, M.K., and Emerson, C.P., Jr. 2002. Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu Rev Cell Dev Biol 18:747 783. 117. Berkes, C.A., and Tapscott S.J. 2005. MyoD and the transcriptional control of myogenesis. Semin Cell Dev Biol 16:585 595. 118. Aziz, A., Liu, Q.C., and Dilworth, F.J. 2010. Regulating a master regulator: establishing tissue specific gene expression in skeletal muscle. Epigenetics 5:691 695. 119. Mal, A., Sturniolo, M., Schiltz, R.L., Ghosh, M.K., and Harter, M.L. 2001. A role for histone deacetylase HDAC1 in modulating the transcriptional activity of MyoD: inhibition of the myogenic program. Embo J 20:1739 1753. 120. Lu, J., McK insey, T.A., Zhang, C.L., and Olson, E.N. 2000. Regulation of skeletal myogenesis by association of the MEF2 transcription factor with class II histone deacetylases. Mol Cell 6:233 244. 121. Fulco, M., Schiltz, R.L., Iezzi, S., King, M.T., Zhao, P., Kashi waya, Y., Hoffman, E., Veech, R.L., and Sartorelli, V. 2003. Sir2 regulates skeletal muscle differentiation as a potential sensor of the redox state. Mol Cell 12:51 62. 122. Yahi, H., Fritsch, L., Philipot, O., Guasconi, V., Souidi, M., Robin, P., Polessk aya, A., Losson, R., Harel Bellan, A., and Ait Si Ali, S. 2008. Differential cooperation between heterochromatin protein HP1 isoforms and MyoD in myoblasts. J Biol Chem 283:23692 23700. 123. Mal, A.K. 2006. Histone methyltransferase Suv39h1 represses MyoD stimulated myogenic differentiation. Embo J 25:3323 3334.

PAGE 124

124 124. Sartorelli, V., Huang, J., Hamamori, Y., and Kedes, L. 1997. Molecular mechanisms of myogenic coactivation by p300: direct interaction with the activation domain of MyoD and with the MADS bo x of MEF2C. Mol Cell Biol 17:1010 1026. 125. Yuan, W., Condorelli, G., Caruso, M., Felsani, A., and Giordano, A. 1996. Human p300 protein is a coactivator for the transcription factor MyoD. J Biol Chem 271:9009 9013. 126. Puri, P.L., Sartorelli, V., Yang X.J., Hamamori, Y., Ogryzko, V.V., Howard, B.H., Kedes, L., Wang, J.Y., Graessmann, A., Nakatani, Y., et al. 1997. Differential roles of p300 and PCAF acetyltransferases in muscle differentiation. Mol Cell 1:35 45. 127. Roy, K., de la Serna, I.L., and I mbalzano, A.N. 2002. The myogenic basic helix loop helix family of transcription factors shows similar requirements for SWI/SNF chromatin remodeling enzymes during muscle differentiation in culture. J Biol Chem 277:33818 33824. 128. Seenundun, S., Rampall i, S., Liu, Q.C., Aziz, A., Palii, C., Hong, S., Blais, A., Brand, M., Ge, K., and Dilworth, F.J. 2010. UTX mediates demethylation of H3K27me3 at muscle specific genes during myogenesis. Embo J 29:1401 1411. 129. Rampalli, S., Li, L., Mak, E., Ge, K., Bra nd, M., Tapscott, S.J., and Dilworth, F.J. 2007. p38 MAPK signaling regulates recruitment of Ash2L containing methyltransferase complexes to specific genes during differentiation. Nat Struct Mol Biol 14:1150 1156. 130. Lee, T.I., Jenner, R.G., Boyer, L.A. Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B., Johnstone, S.E., Cole, M.F., Isono, K., et al. 2006. Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125:301 313. 131. Bracken, A.P., Dietrich, N., Pasini, D., Hansen, K.H., and Helin, K. 2006. Genome wide mapping of Polycomb target genes unravels their roles in cell fate transitions. Genes Dev 20:1123 1136. 132. Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wer nig, M., Tajonar, A., Ray, M.K., et al. 2006. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441:349 353.

PAGE 125

125 133. Palacios, D., Mozzetta, C., Consalvi, S., Car etti, G., Saccone, V., Proserpio, V., Marquez, V.E., Valente, S., Mai, A., Forcales, S.V., et al. 2010. TNF/p38alpha/polycomb signaling to Pax7 locus in satellite cells links inflammation to the epigenetic control of muscle regeneration. Cell Stem Cell 7:4 55 469. 134. Juan, A.H., Derfoul, A., Feng, X., Ryall, J.G., Dell'Orso, S., Pasut, A., Zare, H., Simone, J.M., Rudnicki, M.A., and Sartorelli, V. 2011. Polycomb EZH2 controls self renewal and safeguards the transcriptional identity of skeletal muscle stem cells. Genes Dev 25:789 794. 135. Oktaba, K., Gutierrez, L., Gagneur, J., Girardot, C., Sengupta, A.K., Furlong, E.E., and Muller, J. 2008. Dynamic regulation by polycomb group protein complexes controls pattern formation and the cell cycle in Drosophila Dev Cell 15:877 889. 136. Springer, M.L., Rando, T.A., and Blau, H.M. 2002. Gene delivery to muscle. Curr Protoc Hum Genet Chapter 13:Unit13 14. 137. Usui, H., Ichikawa, T., Kobayashi, K., and Kumanishi, T. 2000. Cloning of a novel murine gene Sfmbt, S cm related gene containing four mbt domains, structurally belonging to the Polycomb group of genes. Gene 248:127 135. 138. Cao, Y., Yao, Z., Sarkar, D., Lawrence, M., Sanchez, G.J., Parker, M.H., MacQuarrie, K.L., Davison, J., Morgan, M.T., Ruzzo, W.L., e t al. 2010. Genome wide MyoD binding in skeletal muscle cells: a potential for broad cellular reprogramming. Dev Cell 18:662 674. 139. Stojic, L., Jasencakova, Z., Prezioso, C., Stutzer, A., Bodega, B., Pasini, D., Klingberg, R., Mozzetta, C., Margueron, R., Puri, P.L., et al. 2011. Chromatin regulated interchange between PRC2 Ezh2 and PRC2 Ezh1 complexes controls Myogenin activation in skeletal muscle cells. Epigenetics Chromatin 4:16. 140. Schuettengruber, B., and Cavalli, G. 2009. Recruitment of polyco mb group complexes and their role in the dynamic regulation of cell fate choice. Development 136:3531 3542. 141. Squazzo, S.L., O'Geen, H., Komashko, V.M., Krig, S.R., Jin, V.X., Jang, S.W., Margueron, R., Reinberg, D., Green, R., and Farnham, P.J. 2006. Suz12 binds to silenced regions of the genome in a cell type specific manner. Genome Res 16:890 900. 142. Maillard, I., Fang, T., and Pear, W.S. 2005. Regulation of lymphoid development, differentiation, and function by the Notch pathway. Annu Rev Immunol 23:945 974.

PAGE 126

126 143. Radtke, F., Wilson, A., Mancini, S.J., and MacDonald, H.R. 2004. Notch regulation of lymphocyte development and function. Nat Immunol 5:247 253. 144. Sultana, D.A., Bell, J.J., Zlotoff, D.A., De Obaldia, M.E., and Bhandoola, A. 2010. Eli citing the T cell fate with Notch. Semin Immunol 22:254 260. 145. Yuan, J.S., Kousis, P.C., Suliman, S., Visan, I., and Guidos, C.J. 2010. Functions of notch signaling in the immune system: consensus and controversies. Annu Rev Immunol 28:343 365. 146. d e Pooter, R., and Zuniga Pflucker, J.C. 2007. T cell potential and development in vitro: the OP9 DL1 approach. Curr Opin Immunol 19:163 168.

PAGE 127

127 BIOGRAPHICAL SKETCH Shuibin Lin was born i n 19 81 in Longyan Fujian Province China In 2000, s huibin attended Xiamen University where he graduated with bachelor s degree in biological science in 2004. He continued his graduate study in Xiamen University and got his s degree in biomedical science in 2007 In August, 2007, s huibin was admitted into the Inter disciplinary Program in Biomedical Sciences at University of Florida where he began his doctoral study under the guidance of Dr. Lizi Wu in the Department of Molecular Genetics and Microb iology. During his PhD study, Shuibin focused his research on investi gating the mechanisms of transcriptional regulation of Notch signaling using development and cancer models. His scientific achievements include a co first author article published in Oncogene in 20 1 2 and several first author papers in preparation