The Role of Regulatory Changes and Quorum Sensing during Salmonella Colonization of Non-Traditional Hosts

MISSING IMAGE

Material Information

Title:
The Role of Regulatory Changes and Quorum Sensing during Salmonella Colonization of Non-Traditional Hosts
Physical Description:
1 online resource (241 p.)
Language:
english
Creator:
Cox, Clayton Evan
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Interdisciplinary Ecology
Committee Chair:
Teplitski, Max
Committee Members:
Montague, Clay L
Wright, Anita C
Baker, Shirley M
Lorca, Graciela Liliana

Subjects

Subjects / Keywords:
ahl -- ai-2 -- gaca -- gacs -- gfp -- host -- interactions -- lsrg -- luxs -- oyster -- pathogen -- pectobacterium -- quorum -- rivet -- rot -- salmonella -- sdia -- sensing -- sira -- soft -- ssrb -- tomato
Interdisciplinary Ecology -- Dissertations, Academic -- UF
Genre:
Interdisciplinary Ecology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Salmonella caused foodborne gastroenteritis is a tremendous public health burden,accounting for 1.4 million infections, 400-500 deaths and several billion dollars in costs each year in the US alone. Contaminated fresh produce and seafood now account for more Salmonella outbreaks than beef, poultry or eggs. Relatively little is known about how Salmonella successfully colonizes these “non-traditional”hosts. Because they are typically consumed raw, oysters and tomatoes represent important vectors for salmonellosis. Understanding the mechanisms Salmonella employs to invade and persist in these hosts will help devise preventative strategies which would benefit public health as well as the state of Florida which is a major producer of both commodities. As antibiotic resistant bacteria become more common new strategies to control pathogens are needed. Non-essential targets which contribute to environmental persistence maybe one strategy to avoid evolved resistance. Because these strategies are not be lethal there would be less selective pressure for individuals which are resistant to a potential small molecule inhibitor of the targeted system. The GacS/GacA two-component system is a non-essential regulator which controls expression of virulence genes, biofilm formation, motility and surface colonization. In an attempt to identify the unknown GacS signal or a signal agonist, I developed a screening methodology based on luminescent reporters. I screened two chemical libraries for activity but was unable to identify any potential candidates. A gfp promoter probe library was screened in live oysters; identifying 19 interesting targets. RIVET reporters confirmed specific promoter activity for 8 genes. Competitive co-infections with defined mutants identified an ssrB mutant as colonization deficient but non-lethal. ssrB is a global regulator of SPI-2, which controls intracellular invasion during Salmonella pathogenesis. To establish within a new host, Salmonella must also interact with the host’s native microbiota. The process of quorum sensing allows bacteria to regulate their gene expression in response to population density. Salmonella is known to possess three independent quorum sensing systems. The utilization of these systems as a strategy to successfully colonize oysters and tomatoes was examined using RIVET reporters and defined mutants. However, no role for signaling was found during this study.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Clayton Evan Cox.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Teplitski, Max.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044650:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 THE ROLE OF REGULATORY CHANGES AND QUORUM SENSING DURING SALMONELLA COLONIZATION OF NON TRADITIONAL HOSTS By CLAYTON E COX A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLM ENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Clayton E Cox

PAGE 3

3 To my family for their co ntinued support of my education

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank the National Science Foundati on for the generous support provided by their Graduate Research Fellowship. I thank the University of Florida and the School of Natural Resources and Environment for the generous support provided by their Graduate Alumni Award. I would also like to thank t he Howard Hughes Medical Institute and the Group Advantaged Training of Research Program for their support and wonderful opportunity to improve my mentoring abilities. I thank Tommy Ward for graciously providing the oysters used during these studies and t he students of the Wright lab who cared for them prior to my use. I also thank Marianne Fatica and the Schneider lab for their supply of green tomatoes. I appreciate the members of the Teplitski lab for their innumerous small favors, willingness to trouble shoot or lend advice as well as the general camaraderie which have been tremendously appreciated over the past 5 years. I especially thank Beth Creary for the cons tant support and humor she lent the lab. Finally, I thank my advisor Max Teplitksi for always encouraging me to focus on what matters

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 ALTERNATIVE HOSTS AND THEIR ROLE IN THE LIFESTYLE OF SALMONELLA ................................ ................................ ................................ ........ 17 Introduction ................................ ................................ ................................ ............. 17 Environmental Survival ................................ ................................ ........................... 19 Survival of Salmonella in Aquatic Environments ................................ .............. 19 Survival of Salmonella in Mollusks ................................ ................................ ... 22 Survival of Salmonella in Soil ................................ ................................ ........... 24 Survival of Salmonella in Manure ................................ ................................ ..... 26 Survival of Salmonella on Plants and Pro duce ................................ ................. 27 Survival of Salmonella in Single Celled Hosts ................................ .................. 31 Interactions with Host Associated Microbial Communities ................................ ...... 32 Role of Diversity ................................ ................................ ............................... 32 Self Destruction Cooperation ................................ ................................ ............ 32 The Role of Quorum Sens ing ................................ ................................ ........... 33 Quorum Quenching ................................ ................................ .......................... 35 gacS/gacA ................................ ................................ ................................ ........ 36 Project Rationale ................................ ................................ ................................ .... 37 2 COMMON MATERIALS AND METHODS ................................ .............................. 41 Growth Conditions ................................ ................................ ................................ .. 41 Media ................................ ................................ ................................ ................ 41 Strain Storage ................................ ................................ ................................ .. 42 Cell Washing ................................ ................................ ................................ .... 42 DNA Techniques ................................ ................................ ................................ ..... 42 DNA Isolation ................................ ................................ ................................ ... 42 DNA Imaging ................................ ................................ ................................ .... 43 DNA Amplification via PCR ................................ ................................ .............. 43 Cloning and Mutant Construction ................................ ................................ ............ 44 Subcloning ................................ ................................ ................................ ........ 44 Preparation of other Plasmid Vect ors ................................ ............................... 45

PAGE 6

6 Heat Shock Transformation of Ligated Vectors ................................ ................ 45 Electroporation ................................ ................................ ................................ 46 Phage Transductions ................................ ................................ ....................... 47 Deletion Mutants ................................ ................................ .............................. 48 RIVET Reporters ................................ ................................ .............................. 50 Handling of Oysters ................................ ................................ ................................ 55 3 A HIGH THROUGHPUT SCREEN FOR INHIBITORS OF THE GACS/GACA TWO COMPONENT SIGNALING SYSTEM ................................ .......................... 57 Int roduction ................................ ................................ ................................ ............. 57 The Ecological Role of the GacS/GacA Two Component System ................... 57 Potential Effects of GacS /GacA Two Component System In hibitors ................ 58 Materials and Methods ................................ ................................ ............................ 59 Bacterial Strains and Growth Conditions ................................ .......................... 59 Chemical Libraries ................................ ................................ ............................ 60 Construction and Selection of Reporter Plasmids ................................ ............ 60 P csrB LUX Screens ................................ ................................ ......................... 61 Statistical Comparison of Assay Runs ................................ .............................. 64 Biofilm Formation Assays ................................ ................................ ................. 64 Results ................................ ................................ ................................ .................... 65 Selection of a P csrB LUX Reporter Plasmid ................................ ....................... 65 Initial Screens of the LOPAC Library ................................ ................................ 66 Dilution Series Screens of the LOPAC Library ................................ ................. 67 LOPAC Biofilm Assays ................................ ................................ ..................... 67 HBOI Library Screens ................................ ................................ ...................... 67 Discussion ................................ ................................ ................................ .............. 68 4 PROMOTER PROBE LIBRARY SCREEN OF SALMONELLA ENTERICA SV. TYPHIMURIUM FOR GENES ASSOCIATED WITH PERISTENCE IN THE EASTERN OYSTE R, CRASSOSTREA VIRGINICA ................................ ............... 96 Introduction ................................ ................................ ................................ ............. 96 Materials and Methods ................................ ................................ ............................ 98 Bacterial Strains and Culture ................................ ................................ ............ 98 Oyster Maintenance ................................ ................................ ......................... 99 gfp Labeled Promoter Probe Library Screen ................................ .................... 99 Promoter Expression in Live Oysters Measured via RIVET Assays ............... 101 Competitive Co Infection of Deletion Mutants in Live Oysters ........................ 102 Hemocyte Assays ................................ ................................ ........................... 104 Results ................................ ................................ ................................ .................. 104 Identification of Oyster Specific Promoters using a gfp Promoter Probe Library ................................ ................................ ................................ ......... 104 Confirmation of Oyster Specific Promoter Activity using RIVET Reporters .... 104 ssrB Increases Compet itive Fitness but does not Regulate Hemocyte Invasion in Oysters ................................ ................................ ...................... 108 Discussion ................................ ................................ ................................ ............ 111

PAGE 7

7 5 THE ROLE OF QUORUM SENSING DURING THE ESTA BLISHMENT OF SALMONELLA ENTERICA SV. TYPHIMURIUM WITHIN THE NATIVE MICROBIOTA OF THE EASTERN OYSTER, CRASSOSTREA VIRGINICA ....... 132 Introduction ................................ ................................ ................................ ........... 132 Materials and Methods ................................ ................................ .......................... 136 Bacterial Strains and Culture ................................ ................................ .......... 136 Oyster Maintenance ................................ ................................ ....................... 137 Construction of QS System RIVET Reporters ................................ ................ 137 Activity of QS Related Promoters in Live Oysters Measured via RIVET Assays ................................ ................................ ................................ ......... 139 Response of the lsrG tnpR Reporter to Exogenous AI 2 ................................ 140 Expression of sdiA tnpR in response to NaCl concentration .......................... 142 Fitness Phenotype as Determined by Competitive Co Infection of Deletion Mutants in Live Oysters ................................ ................................ ............... 142 Confirmation of AI 2 Production via the Vibrio harveyi LUX Assay ................. 144 Results ................................ ................................ ................................ .................. 144 Confirmation of the lsrG tnpR Reporter ................................ .......................... 144 Activity of QS Systems during Colonization of Oysters ................................ .. 145 Fitness Phenotypes Associated with QS during Oyster Colonization ............. 146 Effect of Environmental Conditions on sdiA Activity ................................ ....... 146 Discussion ................................ ................................ ................................ ............ 147 6 ANALYSIS OF SALMONELLA LUXS AND LSR OPERON MUTANTS REVEAL NO ROLE FOR AI 2 SIGNALING DURING COLONIZATION OF TOMATOES IN THE PRESENCE OR ABSENCE OF THE SOFT ROT PATHOGEN PECTOBACTERIUM CAROTOVORUM ................................ ............................... 166 Introduction ................................ ................................ ................................ ........... 166 Materials and Methods ................................ ................................ .......................... 169 Strains and Culture Conditions ................................ ................................ ....... 169 Confirmation of AI 2 Production via the Vib rio harveyi LUX Assay ................. 170 In vitro Reception of Pectobacterium AI 2 Signaling by Salmonella ............... 170 In vivo Competition Assays in th e Presence and Absence of Soft Rot ........... 171 In vivo Promoter Expression Measured via RIVET assays ............................. 172 Results ................................ ................................ ................................ .................. 173 In vitro Perception of the Pectobacterium AI 2 Signal by Salmonella ............. 173 In vivo Promoter Expression Measured via RIVET Assays ............................ 174 In vivo Competition Assays in the Presence and Absence of Soft Rot ........... 176 Discussion ................................ ................................ ................................ ............ 179 7 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS ................................ .. 190 Conclusions ................................ ................................ ................................ .......... 190 Future Directions ................................ ................................ ................................ .. 192

PAGE 8

8 APPEN DIX A COMPOSITION OF COMMON GROWTH MEDIA ................................ ............... 195 B COMPOUND KEY FOR LOPAC PLATE 1 ................................ ........................... 198 C COMPOUND KE Y FOR LOPAC PLATE 2 ................................ ........................... 200 D COMPOUND KEY FOR LOPAC PLATE 3 ................................ ........................... 202 E COMPOUND KEY FOR LOPAC PLATE 4 ................................ ........................... 204 F COMPOUND KEY FOR HBOI PURE PLATE #1 LIBRARY ................................ .. 206 LIST OF REFERENCES ................................ ................................ ............................. 209 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 240

PAGE 9

9 LIST OF TABLES Table page 1 1 Salmonella contamination rates of selected studied watersheds ....................... 40 3 1 List of bacterial strains used in Chapter 3 ................................ ........................... 72 3 2 List of plasmids used in Chapter 3 ................................ ................................ ...... 73 3 3 List of primers u sed in Chapter 3 ................................ ................................ ........ 74 4 1 List of bacterial strains used in Chapter 4 ................................ ......................... 114 4 2 List of bacterial strains constructed for use in Cha pter 4 ................................ .. 115 4 3 List of plasmids used in Chapter 4 ................................ ................................ .... 116 4 4 List of primers used in Chapter 4 ................................ ................................ ...... 117 4 5 Oyster active promoters identified by the promoter probe library screen .......... 123 5 1 Common culturable oyster associated bacteria ................................ ................ 153 5 2 List of bacterial strains used in Chapter 5 ................................ ......................... 154 5 3 List of plasmids used in Chapter 5 ................................ ................................ .... 155 5 4 List of primers used in Chapter 5 ................................ ................................ ...... 156 6 1 List of bacterial strains used in Chapter 6 ................................ ......................... 184

PAGE 10

10 LIST OF FIGURES Figure page 3 1 Methodology for the P csrB LUX screen ................................ ................................ 75 3 2 Results of P csrB LUX reporter plasmids selection trials in Salmonella hosts ....... 76 3 3 Results of the first round LOPAC library screen. ................................ ................ 81 3 4 Results of the second round LOPAC screen. ................................ ..................... 82 3 5 Results of the third round dilution series for the 9 compounds selected as potentially inhibitory ................................ ................................ ............................ 83 3 6 Biofilm assay results for the 9 compounds selected as potentiall y inhibitory ..... 92 3 7 P csrB LUX dilution series for Diiscyanoamphilectin, identified as possibly inhibitory during the screen of the HBOI library ................................ .................. 95 4 1 Construction of RIVET reporters ................................ ................................ ....... 124 4 2 FACS sorts of a gfp labeled Salmonella promoter probe library in live oysters and relevant controls ................................ ................................ ....................... 125 4 3 Percent resolution of RIVET reporters during 24 hour incubation in live oysters or on aga ................................ ................................ 126 4 4 Competitive co infections of selected defined mutants vs. wild type S. enterica 14028 in live oysters. log CI (competive index) was calculated using Equation 4 1 ................................ ................................ ................................ ..... 12 9 4 5 24 hour Infection of oyster hemocytes with gfp labeled S. enterica 14028 wild type and MJW129 ssrB ::cm mutant ................................ ................................ .. 130 4 6 2 ho ur Infection of oyster hemocytes with gfp labeled S. enterica 14028 wild type and MJW129 ssrB::cm mutant ................................ ................................ .. 131 5 1 Activity of the lsrG tnpR lacZY reporter in response to DPD. ........................... 158 5 2 Resolution of AHL related RIVET reporters during 24 hour incubation in live ................................ ................................ ................................ 159 5 3 Resolution of AI 2 related RIVET repo rters during 24 hour incubation in live ................................ ................................ ................................ 160 5 4 Resolution of two component regulator RIVET promoters during 24 hour ................................ ................................ ..... 161

PAGE 11

11 5 5 Growth curves of QS mutants in LB. ................................ ................................ 162 5 6 Competitive co infections of defined mutants vs. wild type S. enterica 14028 in live oysters ................................ ................................ ................................ .... 163 5 7 Percent resolution of an sdiA tnpR reporter in response to LB containing ................................ ............. 164 5 8 AI 2 activity in CFS ................................ ................................ ........................... 165 6 1 Resolution of the lsrG tnpR RIVET reporter in the 14028 wild type (CEC0015) or isogenic luxS ::FRT kanR FRT (CEC0018) backgrounds alone or in co culture with Pectobacterium ................................ ................................ 185 6 2 AI 2 activity of Salmonella and Pectobacterium CFS ................................ ....... 186 6 3 Resolution of RIVET reporters in normal and soft rotted green tomatoes ........ 187 6 4 Competitive co infections of defined Salmonella mutants versus 14028 wild type in normal and soft rotted tomat oes ................................ ........................... 188 6 5 JS246 vs. 14028 in normal tomatoes ................................ ............................... 189

PAGE 12

12 LIST OF ABBREVIATION S AB r Anti b iotic Resistance AHL N Acyl Homoserine Lactone AI 2 Auto Inducer 2 AI 3 Au to Inducer 3 AMC Activated Methyl Cycle amp Ampicillin ASW Artificial Seaw ater BSA Bovine Serum Albumin BSLII Biosafety Level 2 CFA Colony Forming Antigen CFU Colony Forming Unit CFS Cell Free Supernatant CI Competitive Index CIAP Calf Intestinal Alkaline Phosphatase CPS Counts p er Second cv Cul t ivar DI H 2 O D e I onized W ater DMSO Dimethyl S ulfoxide DNA Deoxyribonucleic A cid dNTPS Deoxyn ucleotide Tri phosphates DPD (S ) 4,5 Dihydroxy 2,3 P entandione EBU Evans Blue Uranine A gar EGTA Ethylene Glycol Tetraacetic A cid FACS Flourescence Activated Cell Sorting

PAGE 13

13 g Standard Gravity gfp Green Flourescent Protein HBOI Harbor Branch Oceanographic Institute HDPE High Density Polye thylene ICBR Interdisciplinary Center for Biotechnology Research kan Kanamycin LB Luria Broth L OPAC Library of Pharmaceutically Active Compounds LUX Luminescence, Specifically B ioluminescence from the luxCDABE C assette MB Marine Broth MA Marine A gar OA Oyster A gar OD 600 Optical Density at 600 nm ONPG O rtho Nitrophenyl galactoside PBS Phosphate Buf fered Saline PCR Polymerase Chain Reaction PEL Pectate Lyase ppt Parts per Thousand PS Poly s tyrene QS Quorum Sensing RIVET Recombinase based In Vivo Expression Technology RNA Ribonucleic A cid ROS Reactive Oxygen Species SAH S A denosylhomocysteine SAM S Ade nosyl Methionine

PAGE 14

14 SDS Sodium Dodecyl Sulfate sm Streptomycin SPI Salmonella Pathogenicity Island s RNA Small Regulatory RNA sv Serovar TAE Tris A cetate EDTA B uffer tet Tetracycline TTSS Type Three Secretion System UF University of Florida US United States of America USPS United States Postal Service v/v Volume to Volume WT Wild Type w/v Weight / Volume, Mass Concentration of S olution X gal 5 Bromo 4 Chloro 3 I ndolyl beta D D alactopyranoside XLD Xylose Lysine Deoxycholate A gar

PAGE 15

15 Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF REGULATORY CHANGES AND QUORUM SENSING DURING SALMONELLA COLONIZATION OF NON TRADITION AL HOSTS By Clayton E. Cox August 2012 Chair: Max Teplitski Major: Interdisciplinary Ecology Salmonella caused foodborne gastroenteritis is a tremendous public health burden, accounting for 1.4 million infections, 400 500 deaths and several billion dol lars in costs each year in the US alone C ontaminated fresh produce and seafood now account for more Salmonella outbreaks than beef, poultry or eggs. R elatively little is known about how Salmonella successfully colonize s these hosts. Beca use they are typically consumed raw, oysters and tomatoes r epresent important vectors for s almonellosis. Understanding the mechanisms Salmonella employs to invade and persist in these hosts will help devise preventative strategies which would benefit publi c health as well as the state of Florida which is a major producer of both commodities. As antibiotic resistan t bacteria become more common new strategies to control pathogens are needed. N on essential targets which contribute to environmental persistence may be one strat egy to avoid evolved resistance. Because these strategies are not be lethal there would be less selective pressure for individuals which are resistant to a potential small molecule inhibitor of the targeted system. The GacS/GacA two compon ent system is a non essential regulator which controls expression of

PAGE 16

16 virulence genes, biofilm formation, motility and surface colonization. In an attempt to identify the unknown GacS signal or a signal agonis t, I developed a screening methodology based on luminescent reporters. I screened t wo chemical libraries for activity but was unable to identify any potential candidates. A gfp promoter probe library was screen ed in live oysters ; identifying 19 interesting targets. RIVET reporters confirmed specific pr omoter activity for 8 genes. Competitive co infections with defined mutants identified an ssrB mutant as colonization deficient but non lethal. ssrB is a glo bal regulator of SPI 2, which controls intracellular invasion during Salmonella pathogenesis. To es tablish within a new host, Salmonella must also bacteria to regulate their gene expression in response to population density. Salmonella is known to possess three independent quorum sensing systems. The utilization of these systems as a strategy to successfully colonize oysters and tomatoes was examined using RIVET reporters and defined mutants. However, no role for signaling was found during this study

PAGE 17

17 CHAPTER 1 ALTERNATIVE HOSTS AND THEIR ROLE IN THE LIFESTYLE OF SALMONELLA Introduction The increasing number of outbreaks of foodborne illness is becoming a primary public health concern. Infections with Salmonella are the largest cause of foodborne gastroenteritis (56) and are estimated to infect 1.3 1.4 million people per year in the United States alone. The publ ic health burden is enormous accounting for several billion dollars in medical costs and 400 500 deaths per year (47, 201, 320) The link between Salmonella and livestock is well known and has received considerable regulatory attention (47, 114, 339) However, Salmonella is able to colonize and persist within a wide variety of shellfish, fruits, vegetables and spices (29, 113, 114, 145, 248, 250, 290) Although livestock related outbreaks have declined in recent years, the overall outbreak rate and produce now account for more instances of salmonellosis per year than animal based products. From 1990 to 200 4 seafood (33%) and produce (22%) accounted for more outbreaks than beef, poultry and eggs (18, 16 and 13% respectively) (55) Despite the problem, relatively little is known about how Salmonella persists in the environment outside of their vertebrate hosts or how alternative hosts, such as invertebrates and plants, are colonized. Often, these alternate ho sts carry Salmonella without apparent harm and the lack of symptoms makes identifying contamination more difficult. It also remains unclear if colonization of food stuffs is a normal part of the Salmonella lifestyle or simply serves as one possible route b ack to vertebrate hosts. For healthy humans, the typical infectious dose ranges between 10 6 and 10 8 CFU

PAGE 18

18 depending on the strain (73) Given this relatively large infectious dose and the high incidence of infections, Salmonella may be more ubiquitous in the environment than believed. Indeed, market surveys of produce and seafood routinely isolate Salmonella from tested samples, the vast majority of which are unassociated with known outbreaks (41, 145, 248, 3 30) Salmonella is typically spread to new areas through human activities, either directly from infected individuals or more commonly from domesticated livestock closely associated with human habitation. Indeed, Salmonella is known to infect a vast array of animals, including most domesticated species (339) As humans have spread throughout the globe so has Salmonella ; the environments Salmonella has been isolated from appear to be limited by those that have been examined. For instance, Salm onella was first isolated in Antarctica in 1970 and believed to be introduced through the establishment of research bases although human exposure goes back at Salmonella sv. Antarcti ca has been isolated (153) opening the possibility that Salmonella has established a reservoir in this extreme environment and per haps persisted longer than traditionally believed. Although Antarctica represents an extreme example, Salmonella has become so globally dispersed into natural environments that it can be considered an environmental organism. Once shed from vertebrate host s, Salmonella enters a drastically different environment. Persistence requires adaptation to any number of environmental stressors including desiccation, starvation, UV exposure and temperature fluctuations. These new environments are colonized by their ow n native microbiota with which Salmonella must

PAGE 19

19 interact to establish a niche. To colonize environmental organisms Salmonella must also overcome invertebrate and plant host defenses which present their own unique challenges. This review will examine the mi crobial ecology associated with colonization of non traditional hosts including environmental sources, interactions with native microbiota, conserved regulatory changes and adaptation to new environments as well as the role of inter species and inter king dom signaling. Environmental Survival Survival of Salmonella in Aquatic Environments As a known waterborne pathogen, persistence in aquatic environments is important for understanding the underlying ecology of salmonellosis. Although human c ases of salmonellosis are more prevalent in the summer, there is no apparent link betwe en temperature or even season and environmental isolation rates Furthermore, m icrocosm studies have consistently shown that Salmonella survives longer at temperatures (1, 52, 138, 254, 291) The only factor which is consistently correlated with an increased prevalence of culturable Salmonella is recent precipitation (138, 274, 278) Interestingly, in the few studies which identified weak likely a link with general trends in precipitation (138, 278) The precipitation correlation is so strong, that extreme rainfall events account ed for 51% of Salmone lla outbreaks in the US over a 46 year period (78) This strong link wit h precipitation clearly indicates runoff from terrestrial habits as the primary source for Salmonella contamination. Salmonella is routinely isolated from all types of water bodies worldwide, from small fresh water streams to coastal lagoons. I solation ra tes for individual water samples which test positive for the presence of Salmonella are typically less than 10%

PAGE 20

20 of all samples within a study, but can be much higher, approaching 80% in some cases (Table 1 1). Microcosm studies have shown that Salmonella i s capable of long term survival in water even when starved and can persist past 1 year under certain circumstances (1, 28, 191, 216, 254, 267, 291) Benthic sediments may afford additional protection as inclusion of sediments in microcosms increases survival times 2 3 fold versus the water column only (111, 216) Although microcosm populations typically experience a rapid initial decline, long term studies have shown the surviving population experiences sufficient metabolic activity and replication to exhibit phenotypic adaptations to the environment and could favor the persistence of strains with certain traits (28, 191) In environmental survival studies, Salmonella is able to persist longer than E scherichia coli in fresh and salt waters, Listeria innocua in estuarine and marine water as well as Vibrio cholera and Staphylococcus aureus in polluted runoff and ground water (58, 104, 215, 254, 321) However, the mechanisms are not currently understood and because these differences are not observed in all study conditions they may depend on the individual strains (157, 184) Studies of the strain makeup of populations of environmental isolates typically identify 12 20 unique Salmonella strains associated with specific water bodies over ti me although as many as 241 have been reported during a yearlong study of a large estuary system in southern Japan (316) The isolation rates of individual Salmonella strains may show seasonal variability while the overall population does not. Although common s erovars such as Typhimurium were present in multiple studies there is little ove rlap of the predominate strain between the study sites

PAGE 21

21 indicating the importance of local source populations (14, 24, 40, 54, 138, 197, 243, 274, 278, 316, 336) (Table 1 1). The vari able prevalence of strain types is a reflection of the diversity of watershed use s waste water disposal practices and prevailing environmental conditions which may temporarily favor certain strains. Comparisons to strains prevalent in the human and lives tock populations from surrounding areas show the dominant source is specific to each watershed and may vary depending on season as inflow patterns changes (138) Since aquatic environments tend to act as sinks for Salmonella populations the long term persistence of a single dominant strain is most likely when conditions become relatively stable Especially when short feedback loops where a pathogen is continually re introduced into the environment, with the source populations are formed. Source tracking of Salmonella sv. Seftenberg isolated in large numb ers from edible mussels in Spain, determined the source to be the on shore processing plants for the harvested mussels indicating that such short feedback loops are possible (195) Other studies have also identified Salmonella strains preferentially linked to cases of shellfi sh contamination (9, 41, 195) Similarly, high isolation rates have also been linked to an environmental reservoir in wild reptile populations indicating at least some strains of Salmonella may be naturally occurring in certain ecos ystems (138) The long term fluctuations in isolati on rates and strain abundance indicate various biotic and physical forces exert control over the Salmonella population. Within aquatic environments predation by bacteriovores and exposure to sunlight have been identified as the primary factors affecting Sa lmonella survival and tend to reduce total population numbers between precipitation events (58, 71, 104, 184, 264) Exposure to sunlight

PAGE 22

22 exhibits strong control on Salmonella survival, primarily due to UV wavelengths, and is more pronounced in salt water (82) Control by sunlight is particularly biologically relevant in clear s hallow water or where poor mixing of runoff entering marine waters tends to float the less dense fresh water increasing the UV exposure of the runoff entrained bacteria (278) However, this may not occur in well mixed water bodies o r in areas of sub surface discharge of effluent. Preda tion has also been observed as a domina n t control mechanism in fresh, estuarine and marine waters indicating Salmonella are susc eptible to a number of bacteriovores. Pr edation levels may also depend on runoff quality and how it is mixed with the receiving water body (206) S ome waterborne pathogens, such as V. cholera a re able to benefit by attaching to chitinous zooplankton such as copepods (189) Salmonella can form biofilms by attaching to chitin in fungal hyphae and could u se the strategy as a persistence mechanism (37) However, Salmonella were not associated with zooplankton in fractioned water samples from a Japanese estuary and do not appear to benefit from attachment to zooplankton (316) Similarly, although Salmonella were able to contaminate chironomid larvae, either through attachment or ingestion in freshwater sediments, the association was not sufficient to spread to new environments when contaminated larvae were introduced to sterile microcosms (216) Survival of Salmonella in M ollusks As filter feeders, bivalves can filter immense volu mes of water and are the dominant grazers in some ecosystems (224, 331) Healthy bivalve populations can filter an entire estuary in 1 3 days (79, 224) Processing such large volumes of water causes bivalves to concentrate particles, including bacteria from the water column. H owever, the comp osition of bivalve associated microbial communities differ from the water

PAGE 23

23 column indicating selection for certain species occurs. Vibrio species are routinely isolated from bivalves in large numbers and may live as commensals. Enteric bacteria are typical ly regarded as transients associated with contaminated freshwater inflows. Depuration studies typically show significant reductions in enteric pathogens from oysters within the 2 days following exposure and are the basis for shellfish regulations which cl ose harvesting waters after large rainfalls or when fecal indicator counts are high but allow them to reopen once conditions subside. A year long sampling study of a mussel producing estuary in Spain f ound Salmonella contamination in 2.5% of samples and linked the contamination to a single type of S Seftenberg (196) A nationwide survey by the FDA found Salmonella contamination in 8.6% of oyster sampl es (85) A similar study of market oyster s from the 3 US coasts isolated Salmonella in 7.4% of oysters (41) A single strain of Salmonella sv. Newport accounted for 75% of isolates, possibly indicating certain strains may be more oyster adapted than others (40) A follow up study compared the survival of E. coli and several Salmonella serovars including the Newport strain associated with oyster contamination. At 60 days E. coli had been completely eliminated, while all Salmonella strains survived, persisting at around 10 2 CFU/g (219) These results along with several microcosm studies show that long term survival on oysters may be common (155, 219, 228) Very little is known about the mechanisms governing bacterial persistence in bivalves. Vibrio strains pathogenic to oysters reach higher populations than environmental strains and bacterial virulence factors have been po sitively correlated with persistence in oysters (49, 231, 237) Type IV pilins increase persistence whi le type

PAGE 24

24 1 fimbriae and some membrane proteins, like OmpR, serve as recognition factors which initiate an immune response (49, 234, 345, 347) However, deletion of the well known virulence factors, Salmonella pathogenicity islands (SPI) 1 and 2, did not impact the mollusks than for mammals (220) As inver tebrates mollusks do not have adaptive immunity, therefore they rely on the components of innate immu nity for defense. The immune active cells, hemocytes identify, engulf and destroy bacteria via reactive oxygen intermediates (ROIs), nitric oxide (NO) and lysozymal enzymes (165, 176, 257) Immune activity varies seasonally and even geographically within species indicating a role for environmental cues (49, 61, 121, 165, 222, 244) However, the presence of viable enteric bacteria i n oyster feces indicates many may be shed without being digested or destroyed. Some even appear to benefit as a 100 fold increas e in concentration of Salmonella has been observed in the shed feces compared the surrounding contaminated water (263) Interestingly, infection of mollusks and concentration in their feces is not limited to aquatic bivalves. Grape snails ( Helix pomatia ) fed infected cress ( Lepidium sativum ) shoots shed Salmonella at densities up to 5 10 5 CFU/g of dry feces (271) The mobility of snails may serve as a possible method of spreading Salmonella between plants in an agricultural environment. Survival of Salmonella in S oil Because terrestrial vertebrates are their traditional hosts, most shed enteric pathogens enter the environment by being deposited onto the soil. Salmonella may enter the soil through animal wa ste or irrigation with contaminated waste water and although the soil is typically a sink for Salmonella long term persistence is possible.

PAGE 25

25 Multi year survival has been observed in certain circumstances, including over 7 years in a California almond orcha rd, 4 years on a Danish pig farm and 4 years in the sediment of seas onal ponds on Stone Mountain, Georgia (19, 310, 313) In each case the studies identified a single strain or phage type responsible for the persistence. It is unclear if the long term survival stems from a single infection event or an environmental reservoir host re infection cycle but Salmonella survival in soil clearly represents a legitimate long term danger. Little is known about how soil parameters affect survival. Lower ambient temperatures favor soil survival, just as in water samples (80, 116) N itrogen content shows a negative correlation with survival under some conditions but not others (115) It has been suggested that both soil moisture and clay content are positively correlated to increased survival of pathogens with clay particles benefiting survival by promoting adsorption and providing a protected surface (266) Interestingly, incorporation of soil organic matter appears to interrupt these bonds and decreases particle retention in silt and clays. Retention in sandy soils is generally poor ; likely due to poor surface adhesion to the particles which allow the bacteria to be easily flushed away (133, 266) In addition to particle surface properties, flagellar adhesion also plays a significant role as flagella deficient Salmonella mutants were more easily flushed through pore water in an experimental quartz matrix (144) Although binding to small particles may make pathogens less mobile within the soil it increases the risk of pathogen contamination in runoff as small particles are entrained at lower flow velocities (154, 266) Because large amounts of land can feed into an individual water body, runoff may serve to concentrate pathogens to dangerous

PAGE 26

26 levels (158, 311) This is especially important where livestock and crop production share water resources as irrigation from contaminated sources may infe ct plants directly or inoculate the soil allowing bacterial contamination via root uptake or splashing during precipitation (154, 207) I n typical soils the surface layer hosts the greatest microbial diversity and activity (31, 101, 109) In comparisons between sterile and natural soils amended with contaminated manure, pathogen survival is significantly lower in natural soi ls. The observed population declines are correlated with increases in the protozoan population indicating predation as the primary biotic control (116, 344) It is hypothesized that the nutrient addition increases total bacterial p opulation driving an increase in the protozoan population and predation rates in typically predator prey interactions. Interestingly, s ub surface application of manure has been proposed as a strategy to reduce spreading pathogen contaminated dust but may i ncrease Salmonella survival times by allow ing Salmonella to bypass the biologically diverse surface layer and avoid high predation rates (154) Survival of Salmonella in Manure Livestock waste production is 100 times that of the human population and manure has historically been used as a fertilizer T he three most common livestock, cattle, swine and poultry are primary vectors of Salmonella although many wild animals can also be carriers (41, 114, 120, 130) Animal manure presents a considerable ri sk for soil contamination and its widespread us as fertilizer makes manure the primary source for soil borne Salmonella (122) In agricultural settings, high density a nimal production requires the collection and removal of waste and facilitates its use as fertilizer (114, 122, 154) The microbial qua lity of the waste can vary and Salmonella incidence has been

PAGE 27

27 observed to range from 1 31.5% (154) Salmonella typically persists in waste longer than E. coli and Listeria monocytogenes but is not significantly influenced b y pH, aeration or nutrient content (115, 225, 272) However, Salmonella persistence is much greater in liquid slurries compared to solid waste (12, 225, 312) Overall, maximum survival times in both types of waste are h ighly influenced by storage temperature. The temperatures in liquid slurries largely reflect ambient temperatures while solid manure tends to compost when stored in large volumes leading to higher internal temperatures and shorter survival times. Ma ximum survival in liquid slurries decreases from greater than to 40 100 heated to (12) In contrast, composting 4 days for most enteric pathogens, including Salmonella and internal complete elimination of Salmonella within 18 hours (225, 312) Efficient elimination of Salmonella from waste prior to use as fertilizer is important as Salmonella may persist 200 300% longer once in the soil (312, 344) Survival times of 100+ days post inoculation are common and a llow persistence of Salmonella through the entire growing season of most crops increasing the opportunity for produce contamination (225, 312, 344) Survival of Salmonella on P lants and P roduce An ability t o colonize edible plants is an effective population survival strategy as it provides a direct route back to numerous herbivorous hosts. Enteric pathogens were once believed to be ill adapted to for plant survival due to differences in host phy siology. However, recent evidence is showing that many enteric pathogens, including Salmonella are quite capable of colonizing plants from the rhizosphere to the

PAGE 28

28 associated outbreaks, foodborne salmonellosis has received considerable attention and is the subject of several recent reviews. Therefore, mechanisms which contribute to fitness during plant colonization will only be discussed briefly (29, 35, 106, 114, 302) For colonizing bacteria, the surface of leaves and fruits is a challenging environment, presenting stresses such as desiccation, starvation and exposure to UV radiation (35, 106, 328) Enteric bacteria preferentially move towards stomata, glandular trichomes, lesions or other surface irregularities which provide shelter from these stresses and exploit them to multiply rapidly (13, 21, 36, 171) It is likely that bacteria find these sites via chemotaxis to ward exuded sugars (21, 171) Because these sites are also attractive to phytobacteria the colo nizing enterics must interact with establis hed microbial communities in order to gain access to preferred sites (35) The nature of these interactions appear highly dependent on t he established community as some species serve as competitors which may reduce or prevent colonization an e ffect which increases with community diversity (70, 168, 198) Other studies show that Salmonella is able to integrate into multicellular consortia formed by epiphytes on leaf sur faces and benefits from mechanical d amage induced by phytopathogens, reaching higher densities when growing in bacterial lesions on fruit and leaves (21, 36, 38) Pectolytic bacteria may increase both the incidence and de nsity of Salmonella and E. coli on produce (13, 22, 230, 330, 343) It is hypothesized that the plant polymer degradative abilities of the p hytopathogens allow the enteric bacteria to access protected environments and/or increase s available nutrients (35, 74, 305, 328)

PAGE 29

29 Salmonella is capable of colonizing plants through multiple routes including contaminated soil, in fected seeds or colonizing flowers prior to fertilization (22, 275) Although evidence for root uptake has been presented in hydroponically gr own plants, this remains a controversial subject. However, it is contamination of the edible leaves and fruits of produce which is most problematic for consumers. However, b ecause Salmonella can move through the vascular system of plants from the initial i nfection site to fruits and leaves all routes of transmission are important for produce safety. To colonize and move throughout the plant Salmonella must attach to and invade plant tissues and then evade plant defenses, however, it remains unclear which f actors control the processes (328) Screens of Salmonella mutant libraries for those unable to attach to alfalfa sprouts and colonize tomato fruits identified 20 and 55 unique genes (without overlap) respectively (20, 230) Using defined mutants to confirm the colonization phenotype only a cysB mutant was found to have a competitive disadvantage in tomatoes. The effect was cultivar dependent pointing to a response to specific to mato conditions (230) Follow up screens in alfalfa identified agfB and rpoS mutants, genes which are involved in the formation and regulation of curli, as deficient in initial attachment to plant surfaces. Curli also play a significant role in the colonization of parsl ey following irrigation with Salmonella contaminated water (180) Differences in population densities on the surface s of lettuce and cabbage showed Salmonella serovar specific dif ferences in biofilm attachment which positively correlated to differences in biofilm formation in vitro (239)

PAGE 30

30 Mobility factors, such as flagella, likely also c ontribute to the survival of Salmonella on plant surfaces by allowing movement to preferential sites for nutrient acquisition or internalization although more data is needed (21, 70) Because in ternalization is dependent on plant species, cultivar and growth conditions bacteria may exert little control over their fate (21, 125) This is supported for E. coli where internalization rates into lettuce wer e the same for living bacteria, dead cells and inert particles (283) However, Salmonella attachment is dependent on living cells indicating that internalization, at least for Salmonella is an active proce ss (265) The genetic capabilities of Salmonella also play a role in the ability to exploit plants as population density but not the ability to colonize plants varies in a serovar dependent manner (93, 168) Once internalized into plant tissues Salmonella must contend with sophisticated plant defense mechanisms which have evolved to identify and remove potential pathogens. However, plants are seemingly blind to Salmonella which does not harm them, as Salmonella does not induce stomata closure a plant defense response to limit internal access to phytopathogens (171) Salmonella also actively suppresses the i mmune response in some plants; tobacco plant defenses are activated by heat killed cells but not live Salmonella (277) Suppression of immune functions relies on type three secretion system s (TTSS). A SPI 1( invA ) mutant triggered oxidative burst in tobacco and SPI 1( invA prgH ) and SPI 2 ( ssaV ssaF ) mutants elicit a h ypersensitive response in Arabidopsis In both instances wild type Salmonella elicits no response and i s able to multipl y to higher densities (270, 277) During intracellular infection of Arabidopsis wild type Salmonella induces changes similar to those that occur during

PAGE 31

31 infection of animal cells pointing to conserved mechanisms for intracellular colonization (270) Survival of Salmonella in S ingle C elled H osts Within human hosts Salmonella utilizes sophisticated systems to infiltrate and survive inside macrophages (102, 112) Within the environment Salmonella is often subject to predation b y protists which share many similarities to eukaryote macrophages. Salmonella appears to resist digestion and survive within the protists more effectively than other enteric pathogens an ability which may provide important survival advantages and access to additional environmental reservoirs (39, 307) Salmonella is able to resist digestion by several common protists isolated from leafy greens and agricultural soil, such as Tetrahymena and Glaucoma by persisting in phagocytic food vacuoles which are even tually excreted by the host (39, 131) Passage through Tetrahymena induces a large number of regulatory changes affecting between 989 1,282 genes or approximately of the Salmonella genome. Most changes are associated with the switch to anaerobic metabolism although the most strongly regulated gene, mgtC may favor increased up take by the protist; indicating Salmonella may purposely seek this environment. Acid resistance genes adiA and adiY were also strongly regulated and may play a role in the enhanced survival of the excreted Salmonella (39, 252) Upon Salmonella p assage through the amoeba Acanthamoeba polyphaga the genes sseC, ssaU and phoP a re associated with survival within contractile vacuoles (30, 307) These genes are associated with SPI 2, which is responsible for intracellular replication in macrophages. Once established within the contractile vacuole, the bacteria entered logarithmic growth producing a population of over 2 00 cells which were

PAGE 32

32 able to persist for at least 4 days (119) The surviving Salmonella a re subsequently able to Passage also induces a filamentation response which appears to provide protection from predation although the mechanisms involved are unclea r (119) Interactions with Hos t Associated Microbial Communities Role of Diversity The traditional host for Salmonella is the mammalian gut which represents a rich and complex environment that harbors a native community of up t o 10 13 14 microbes comprised of 500 1,000 strains (44, 83) This complexity is far greater than that in simple organisms like insects, which m ay harbor a couple to a dozen bacterial species, and represents about 10 4 cfu/g greater microbial density than is found in typical soils ( 33, 89, 333) Because invading pathogens are less adapted to the host environment than entrenched residents obtaining an exploitable niche can be a difficult task (43, 44) Higher diversity in host associated communities tends to amplify this difficulty and thought to be important for vertebrate hosts (110, 210, 285) Few examples exist for non traditional hosts, however, the effect has been demonstrated in locusts and plants (70, 89, 168, 198, 275) Salmonella is a very capable human pathogen which skillfully interacts with the resident microbiota and it is likely that some of these strategies are employed during colonization of non traditional hosts as well (286) Self Destruction Cooperatio n In mice, Salmonella enterica serovar Ty p h imurium uses the host inflammatory immune response to reduce the density of the commensal microbial community (287) Through a process called self destructive cooperation only about 15% of invading S.

PAGE 33

33 enterica express virulence factors due to phenotypic noise or the irregular expression of certai n promoters tied to stochastic processes within the cell (2) The virulence fac tors elicit the host response and the expressers are killed along with the native microbes allowing the remaining Salmonella to establish an infection (102) Because Salmonella does not provoke an immune response in ma ny non traditional hosts and actively suppresses the immune response in plants it is unclea r what role host responses or s e lf destructive cooperation may play in Salmonella survival. The Role of Quorum Sensing The structure of host associated microbial communities depends on intra species, inter species and inter kingdom exchange of signals and metabolites. In order to sense and adapt to their external environment coordinate gene expression with other bacter ia or their eukaryote host. Over the years, wide changes in bacterial gene expression in response to production and perception of extracellular ion limited environments. While the N acyl homoserine lactone ( (AHLs) produced by gram negative bacteria are the most widely known signals, at least seven other families of compounds are used (48, 323, 335) Because different bacteria are known to utilize the same or similar QS signals there are many opportunities for cross ta lk in microbial communities. The role of QS in mediating ho st symbiont relationships, host associated community interactions and colonization or virulence phenotypes is well established in a wide range of bacteria (32, 213, 329, 335) Because many enteric bacteria and native commensal microbiota share components of QS signaling pathways it is commonly hypothesized that signal

PAGE 34

34 exchange plays a major role in mediating interaction s during colonization of non traditional hosts (35, 86, 170, 175, 190, 240, 305, 306) There are two well characterized population density dependent gene regulatory QS systems in bacteria; those based on AHL signals and th ose using the AI 2 signal produced via the pathway involving LuxS. Both Salmonella and E. coli lack any known AHL synthases and are not known to produce AHL signals, however, they do possess a functional AHL receptor ( sdiA ) (208) In Salmonella SdiA activates the rck operon (resistance to complement killing) as well as the single gene srgE (function unknown) (167, 281) Th e environmental relevance of sdiA activity is unclear as only srgE is stron gly regulated by perception of AHLs at common environmental temperatures and an sdiA reporter was not activated during passage through 5 vertebrate hosts (280, 281) However, sdiA does detect AHLs produced by the pathogen Yersinia enterocolitica in infected mice and pigs (99, 282) Interestingly, sdiA is also active during passage through turtles, possibly in response to Aeromonas hydrophila suggesting Salmonella actively recognizes signals out side of vertebrate hosts (280) sdiA activity in turtles is especially intriguing as reptiles can serve as an environmental reservoir for Salmonella (138) However, follow up infections with an sdiA mutant showed no fitness phenotype and it is unclear what benefit AHL signaling may provide in the turtle gut. Pectinolytic phytopathogens use AHLs to regulate virulence and although Salmonell a can recognize AHL signaling by Pectobacterium carotovorum in vitr o the signal played no role during co infection of tomatoes as the low pH prevents expression of sdiA and deletion of sdiA does not induce a survival phen o type (229)

PAGE 35

35 LuxS is a widely distributed gene leading to the initial hypothesis that it serves as a ver, LuxS catalyzes the formation of 4,5 dihydroxy 2,3 pentanedione (DPD) from S adenosylhomocysteine (SAH) which is a toxic intermediate of S Adenosyl methionine (SAM), a major methyl donor in the cell (162) Because LuxS provides 1 of 2 possible pa thways for SAH processing, its function is also tied to metabolism in general. Comparing whole genome sequences it became apparent that although many species can produce AI 2 they do not contain a known receptor casting doubts on AI utility as a sign al (253) In Salmonella, the receptor for AI 2 is encoded within the lsr operon. This operon is also responsible for uptake and turnover of the signal and is the only known target (296) However, AI 2 has been shown to play a role in establishment of biofilm for Salmonella luxS mutants and in regulation of flagellar motility (156, 163, 245) In the only known study of AI 2 regulation under environmental conditions a luxS mutant inoculated onto cilantro leaves showed no discernible phenotype and was not influenced by co culture with AI 2 producing phytobacteria alt hough the same mutant was deficient in the colonization of chicks (38) Quorum Q uenching For QS signals to be useful they must be received and efficiently turned over by the cell in order to reduce noise in these inherently stochastic systems. In addition to hijacking signals for inter species communication some species have evolved (90, 92) Quenching can occur by actively removing the signal from the environment, degrading signal molecules or producing compounds that interfere with signaling. Quenching strategies are employed by both bacteria and eukaryotic hosts demonstrating their importa nce in microbial community interactions (15, 90, 304)

PAGE 36

36 Simply remo ving a signal from the external environment may be enough to disrupt the phenotype of a competitor and confer an advantage to an invading pathogen. Signal turn over rates can be extremely high in active environments and could indicate intense competition f or signals. This has been demonstrated in a model system where E. coli is able to uptake AI 2 at a rate sufficient to disrupt the light production of Vibrio harveyi (341) Signal degradation is common in the soil where bacteria typically compete for proximity to plant roots which are a rich source of nutrients (304) Plants themselves can break down AHLs, probably via exuded enzymes, which may be a strategy to control the root associated microbial community (88) A wide range of organisms produce molecules which can disrupt QS (90) Red algae is known to produce furanones to prevent AHL mediated biofilm formation on their leaves and surveys of other marine samples have identified QS antagonistic activity in 23% of samples s uggesting that this strategy may be widespread in certain circumstances (251, 279) gacS/gacA In ad dition to QS, bacteria rely on two component regulators to sense their external environment and alter gene expression accordingly. Two component regulators consist of a transmembrane receptor (typically a histidine kinase) and a related response regulator which alter s gene expression and direct s cellular behavior. These systems interact to control host associated phenotypes such as biofilm formation, antibiotic production, motility and virulence (181) Some two component regulators, such as gacS / gacA respond in a population dependent manner and can control QS systems (317) Orthologs of the GacS/GacA (BarA/SirA in Salmonella ) two component regulatory system and the members of the GacS/GacA regulon are universally required for biofilm formation in all proteobacteria (181, 303)

PAGE 37

37 In Salmonella BarA/SirA is known to also regulate virulence genes on SPI I, IV and V, motility, surface attachment and specific metabolic changes in response to host adaptation (5, 182, 300, 301, 303) Most, if not all, regulatory effects of SirA are via the Csr post tran scriptional regulatory system. SirA (phosphorylated by BarA) binds within promoters of csrB and csrC which encode small regulatory RNA (sRNA). The csrB and csrC sRNAs bind to the CsrA protein, thus reducing its active concentrations within the cell. When free of the csrB/C sRNA, CsrA binds within messages of the regulated genes to effect their translation or target them for degradation (259) BarA/SirA regulates the secretion of virulence factors by SPI 1 through hilA in response to Na Cl concentration (214) Th e response i s strongest at the approximate salinity of human body fluid and secretion of both the virulence factor an d a flagellar protein control a re poor at concentrations above 600 mM, below the salinity found in estuarine and marine environments. Regulation of sirA appears to be fine tuned to host environments ; an effect relevant to pathogenesis as a sirA mutant i s l ess virulent in calves but not mice (5) Ultimately, the relevance of gacS/gacA to the environmental persist ence and colonization non traditional hosts by Salmonella is currently unknown. Project Rationale Despite many scientific advances in disease control and prevention the incidence of salmonellosis remains high. Salmonella is the most common cause of food b orne illness, and although infections from beef, pork and poultry have declined, Salmonella is increasingly associated with non traditional hosts, such as seafood and produce. Once shed from a host, Salmonella has demonstrated an ability to persist in soil and water for long periods of time and is more successful in these environments than other enteric pathogens. Because of this enhanced capacity for environmental survival, Salmonella is

PAGE 38

38 increasingly being thought of as an environmental organism and combat ing this public health burden requires an increased understanding of how Salmonella survives in the environment. The overall hypothesis I examined is that specific genetic factors are responsible for the persistence of Salmonella on non traditional hosts. Oysters and tomatoes are two common commodities which have been associated with high rates of Salmonella contamination in market surveys. Florida is a major supplier of both commodities, which are typically consumed raw, increasing the risk of illness. Be cause very little is known about the genetic determinants of how Salmonella colonizes alternative hosts, a whole genome promoter probe library was screened to test the hypothesis that specific genes respond to these environments and are required for the es tablishment of persistent infections. I screened the library in live oysters while the same library was screened in tomatoes by other members of the lab. Both oysters and tomatoes host a large and diverse community of microbiota with which Salmonella must interact in order to establish a niche during colonization. Quorum sensing provides a method for bacteria to coordinate gene expression based on intra and inter species signals. Salmonella possesses three quorum sensing systems, however, little is known about how signaling effects the fitness of Salmonella during the colonization of alternative hosts. RIVET reporters and q uorum sensing deficient Salmonella mutants were used to test the hypothesis that the ability to detect signals increases competitive fitness during the colonization of oysters or tomatoes. The GacS/GacA two component system is known to regulate bacterial behaviors which enhance environmental persistence, such as biofilm formation, in all

PAGE 39

39 proteobacteria, including Salmonel la However, neither the signal for GacS nor its ecological roles are known In order to test the specific hypothesis that disruption of GacS/GacA regulation would inhibit the colonization of environmental hosts by Salmonella two chemical libraries were s creened for GacS/GacA inhibitors. Identifying specific genetic factors which Salmonella relies on to colonize and persist on alternative hosts would provide new targets for devising alternative strategies for reducing Salmonella contamination and preventin g outbreaks. By interrupting the colonization process in a non lethal manner these strategies would induce less selective pressure for the evolution of resistance an increasing problem with the current use of toxic antibiotics.

PAGE 40

40 Table 1 1 Salmonella co ntamination rates of selected studied watersheds Location Water Type Watershed Type Isolation Rate Number of Serovars Recovered Dominant Serovar Driver Source Mexico Coastal rural 4.8% 20 typhimurium rain livestock Spain Estuarine mix 7.4% 20 senftenber g rain mussel processing Morocco Coastal urban 7.1% 3 blockley rain livestock USA Fresh water River rural 79.2% 13 arizonea rain wild reptiles Portugal Mixed urban 48.4% 17 virchoi humans France Mixed mix 65.8% 8 typhimurium rain mix Spain Freshwater River mix 58.7% 33 virchow rain humans Spain Freshwater Reservoir mix 14.8% 12 mikawasima rain humans Spain Marine mix 5.9% 42 enteridis rain humans Greece Freshwater River urban 27.4% 19 Tshiongwe poultry Hawai'i Freshwater Stream mix 34.1% lives tock Canada Freshwater river rural 6.2% rubislaw rain birds California Mixed mix 30.7% rain Canada Freshwater River rural 9.6% rain Brazil Estuarine urban 30.0% 4

PAGE 41

41 CHAPTER 2 COMMON MATERIALS AND METHODS Growth Conditions Media Liquid grow th media including Luria Broth (LB), NZY+, M9 minimal media, Marine Broth (MB), Phosphate Buffered Saline (PBS) and half strength Artificial Sea Water (1/2 ASW) were used in this study. Solid media including LB agar, Evans blue uranine agar (EBU), Oyste r agar (OA) (adapted from Eyre (105) and Colwell and Liston (68) ), Xylose lysine deoxycholate agar (XL D), Marine Agar (MA), M9 glucose agar and strength Artificial Seawater soft agar were also used. See Appendix A Prior to use in assays, overnight cultures were prepared via inoculation of desired strains from glycerol stock into growth media and allowe d to grow to stationary phase over night (minimum 12 hours). When grown in liquid culture, 5 mL of media was placed in 12mm x 75 mm glass cultures tubes (catalogue # 14 961 26, Fisher Scientific, Pittsburgh, PA) and incubated in a shaker rotating at 200 rp m. Solid media was poured in 95mm x 15 mm polystyrene petri dishes (catalogue # 0875714G, Fisher Scientific, Pittsburgh, PA) and incubated in an Isotemp lab oven (Fisher Scientific, Pittsburgh, PA). Cultures were incubated at 37 antibiotics were added to the media from 1 000 X stocks maintained at Commonly used antibiotics and their final concentrations were ampicillin (200 g/mL), kanamycin (50 g/mL) tetracycline (10 g /mL) and streptomycin (50 g/mL). X gal was used for blue white screening at a concentration of 40 g/mL.

PAGE 42

42 Strain Storage All strains used or constructed during these studies were stored at 80 C in an ultra low temperature chest freezer (So Low, Cincinna ti, OH). Glycerol stocks for cryogenic storage were prepared by mixing 1 mL of overnight culture with 500 L of an autoclave sterile glycerol solution (70% w/v with distilled water) in a cryostorage vial. Cell Washing When required, cells were washed by c entrifugation. 1 mL of culture was placed in a sterile micro centrifuge tube and pelleted by centrifugation at 13,000 x g (unless a slower speed was required to avoid flagella damage). The resulting supernatant was removed by pipetting and then the pellet resuspened in 1 mL of media by vortexing. This process was repeated 3 times to ensure the cells were sufficiently clean. When a large number of cells were required the culture was concentrated prior to washing. To concentrate cells, 1 mL of culture was pel leted and the supernatant removed. An additional 1 mL of culture was then added via pipette and re pelleted. Typically 3 or 5 mL of culture was concentrated in this manner. DNA Techniques DNA Isolation Genomic DNA was isolated from 3 mL of concentrated cu lture using a GenElute Bacterial Genomic DNA Kit (catalogue # NA2100, Sigma, St. Louis, MO) according to 5 mL of concentrated culture using a QIAprep Spin Miniprep Kit (catalogue # 27106 Qiagen, Va lencia, CA) or a Wizard Plus SV Minipreps DNA Purification System (catalogue # A1460, Promega, fragments or from PCR reactions was isolated using an illustra GFX PCR DNA an d Gel

PAGE 43

43 Band Purification Kit (catalogue # 28 9034 70, GE Healthcare, Piscataway, NJ) DNA water and stored at 1000 s pectrometer running software version 3.6.0 (Thermo Scientific, Wilmington, DE). DNA Imaging Visualization of DNA was accomplished with agarose gel electrophoresis using 7 cm x 10 cm trays in a mini sub cell GT electrophoresis system (Bio Rad, Hercules C A) controlled by a FB300 power supply (Fisher Scientific, Pittsburgh, PA). To make gels agarose was dissolved in TAE buffer at 0.9% (w/v) by boiling in a microwave. 1X TAE buffer was prepared from a 50X stock. Unless noted, a 10 L of sample DNA was loade d to each well and 3 L of the exACTGene 1kb plus ladder was used for size comparison (catalogue # BP2579100, Fisher Scientific, Pittsburgh, PA). DNA was stained with 1% ethidium bromide added directly to liquid agarose gel at a ratio of 4 L / 400 mL. Gel images were developed with the Molecular Imager Gel Doc XR+ System running version 3.0 of the Image Lab software (Bio Rad, Hercules CA). DNA Amplification via PCR Amplification of DNA fragments was accomplished via Polymerase Chain Reaction (PCR) run on either a TC412 (Techne, Minneapolis, MN) or MJ mini (Bio Rad, Hercules CA) thermal cycler. React ion conditions consisted of an initial m minutes, 35 ampl ification cycles consisting of d enat a nnealing at 52 e longation at 72 for 2 minutes followed by a f extended to 3 minutes for products larger than 2,000 base pairs. PCR reactions were

PAGE 44

44 performed usi ng a 25 L reaction volume unless noted. Each reaction contained the following reagents: 20.5 L sterile DNA water 2.5 L Taq polymerase buffer (catalogue # B9014s, New England Biolabs, Ipswich, MA) 1 L 2.5mM deoxynucleotide triphosphates (dNTPs) 0.5 L forward primer (50 M) 0.5 L reverse primer (50 M) 0.1667 L Taq DNA polymerase (5,000 U/mL catalogue #M0273, New England Biolabs, Ipswich, MA) DNA was added to the reaction either from prepared DNA solutions or directly from colonies using a sterile pi pette tip. Typically 3 dilutions we re set up for each reaction. For prepared DNA 1 L of isolated DNA was added to the first dilution, m ixed and 1 L of reaction mix was transferred between the dilutions. For colony PCR a pipette ti p wa s touched to a col ony on solid medi um stirred in the first dilution and the same tip serially transferred to each subsequent dilution. Cloning and M ut ant C onstruction Subcloning Standard subcloning was accomplished using the pCR2.1 plasmid vector via the TOPO or TOPO TA ki ts (Invitrogen, Carlsbad, CA) using ultra competent E. coli (F lacZ recA1 endA1 hsdR17 supE44 thi 1 gyrA96 relA1 ( lacZYA argF ) U169 ) except transformants were recovered in 1 mL NZY+ instead of SOB broth. Colonies were selected by blue white screening on LB agar with kanamycin and X gal. The inserts were confirmed by

PAGE 45

45 y the UF ICBR core lab using the M13R primer. Ultra competent E. coli shock transformation was prepared in advance using the method of Inoue et. al. and stored at (152) Preparation of other Plasmid V ectors Plasmid vectors other than pCR2.1 were prepared for cloning by restriction digest and subsequent treatment with calf intestinal alkaline phosphotase (CIAP) to prevent self ligation by removing recommendations. In general restriction digests were performed using a 50 L volume. 1 g of DNA was mixed with 5 L of 10X react ion buffer, 5 L of 1 mg/mL bovine serum albumin (BSA) if needed and 1 L of restriction enzyme (generally 1 or 10 units depending on supplied concentration). DNA water was a dded to a final volume of 50 L. D igests were typically directly to the reaction mix by adding 39 L DNA water, 10 L 10X CIAP buffer and 1 L CIAP (10 units) (catalogue # M0290S, New England Biolabs, Ipswich, MA). The reaction mix was then incubated f vectors were then imaged by gel electrophoresis and recovered from the gel using an illustra GFX PCR DNA and Gel Band Purification Kit (catalogue # 28 9034 70, GE Healthcare, Piscataway, NJ) according to vectors were eluted in 50 L of DNA water and stored at Heat Shock Transformation of Ligated Vectors Cloned DNA fragments were isolated from plasmid vectors by restriction digest and recovered from agarose gel as described above. CIAP treatment was not used.

PAGE 46

46 Cloned fragments and plasmid vectors were ligated using T4 ligase. The ligation reaction consisted of 4.5 L of DNA water, 3.5 L of prepared plasmid vector, 0.5 L of insert DNA, 1 L of T4 ligase buffe r and 0.5 L of T4 ligase (2,000,000 units / mL, catalogue # M0202M, New England Biolabs, Ipswich, MA) mixed in a sterile micro centrifuge tube. Two controls were used ; a no insert control to test for self ligation and a no insert, no ligase control to tes t for uncut plasmid vector. Additional DNA water was added to bring the final volume of control reactions to 10 L. The reaction mix was into ultra competent E. coli by adding all 10 L of the l igation mix directly to frozen he micro centrifuge tubes were ice cold NZY+ added and recove harvested by centrifuging, plated o n an appropriate selective medium and incubated at Electroporation Electroporations were used to move plasmids between hosts. Electro competent recip ient strains were prepared from overnight cultures by initially chilling the cultures on ice for 15 minutes. Up to 3 mL of the cultures were concentrated if necessary and washed 3 times in DNA water to remove all salts. The resulting cells were chilled o n ice for an additional 15 minutes. While on ice 50 L of cells were added to sterile 2 mm gap electroporation cuvettes (catalogue # 940001013, Eppendorf, Hamburg, Germany). Between 3 5 L of plasmid was added to the cuvette depending on plasmid DNA conce ntration. The cells were then shocked using a MicroPulser electroporater (Bio Rad, Hercules CA) on setting EC2 (one 5 ms pulse at 2.5 KV). 1 mL of room

PAGE 47

47 temperature NZY+ was then added to the cuvettes as a recovery medium and the solution transferred to mic ro efore plating on an appropriate selective medium The resulting colonies were purified by 2 additi onal sub cultures on solid medium and the plasmid co nfirmed by PCR or observing a relevant phenotype. When moving plasmids between E. coli and Salmonella strain BW20767 (RP4 2 tet :Mu 1 kan ::Tn 7 integrant leu 63 ::IS 10 recA1 creC510 hsdR17 endA1 zbf 5 uidA (D Mlu I): pir / thi ) was used as an intermediate host (205) Phage T ransductions Transduction employing the P22 phage was used as a method of m oving mutations between Salmonella chromosomes. Donor lysates were prepared from overnight cultures of the donor mutant washed in PBS to remove antibiotics. Then 200 L of culture was added to each of 8 culture tubes containing 2 mL of LB without antibioti cs. 40 L of P22 phage was added to the first tube and a 1/10 serial dilution set up by transferring 200 L between the culture tubes. The final tube was left without phage as a control. The cul hours. The tubes were compared visually for culture density. Because phage infection results in cell lysis the dilution with the highest degree of culture clearing (lowest optical density) was select ed for phage isolation. The phage was harvested by adding 1 mL of culture to a micro centrifuge tube, centrifuging at 13,000 x g for 15 minutes and transferring the resulting supernatant to a fresh micro centrifuge tube. 100 L of chloroform was added to t he supernatant and vortexed until thoroughly mixed. The resulting suspension was then centrifuged at 13,000 x g for an additional 15 minutes, the supernatant removed to a sterile glass vial, 100 L of chloroform added and then

PAGE 48

48 thoroughly mixed by vortexing transduction. Recipient strains were prepared for transduction by washing 1 mL of overnight culture in PBS. A six fold 1/10 serial dilution was set up in micro centrifuge tubes by adding 100 L of washed culture to 100 L of LB. 10 L of lysate is added to the first tube of the series and diluted by transf erring 20 L between tubes. A no bacteria control (200 L LB and 10 L phage) as well as a no phage control (100 L LB and 100 L culture) were a lso prepared. The tubes we hen 1 mL of LB with 10 mM EGTA was added. The cultures we re incubated for an additional ++ which is required for phage attachment. Removal of Ca ++ from solution by EG TA prevents phage adsor ption. After 1 hour the cells we re harvested by centrifuging at 13,000 x g for 1 minute and plated on LB agar containing 10 mM EGTA and an appropriate selective antibiotic. Plates we re rnight. The resulting col onies we re patched to LB 10 mM EGTA selective medium to ensure removal of non int egrated phage. Single colonies we re then streaked to LB with selective antibiotic for confirmation of the transduc tion by PCR. The same colonies we re cross streaked against P2 2 on EBU plates to test for phage sensitivity/purity. Deletion M utants Red recombinase method described by Datsenko and Wanner which uses homolgous recombination to insert linear DNA into the bacterial chromosome (81) To delete a gene of interest, the 48 b ase p airs immediately upstream of the start codon and the 48 base pairs immediatel y downstream of the stop codon were identified. Primers we re made by ad ding the

PAGE 49

49 become the forward and reverse primers respectively. The arms correspond to regions on the pKD4 ( oriR6K bla rgnB FRT kanR FRT) plasmid which flank a FRT kanR FRT kanamycin resistance cassette (81) The fragment wa s then amplified via PCR using the following amplification cycle; d enat for 1 minute and e A 50 L reaction volume wa s used to ensure a large yi eld of product. A 5 L aliquot wa s imaged by gel electrophoresis and the DNA recovered from the rema ining reaction using an illustra GFX PCR DNA and Gel Band Purification Kit (catalogue # 28 9034 70, GE Healthcare, Piscataway, NJ) The fragment wa s then electroporated into Salmonella enterica sv. T yphimurium 14028 h osting plasmid pKD46 ( repA101ts oriR101 bla araC P araB exo) tL3 ) (81) o us recombination system which i s Red system is under the control of an arabinose inducible promoter and the plasmid is temperature sensitive (in the absenc e of competent cells S. enterica 14028 p KD46 wa s grown overnight in 5 mL of LB with 0.2% glucose and 1 mL of overnight culture wa s washed to remove g lucose and a 1/ 500 sub culture wa s made into 5 mL of LB with 0.1 M arabinose and 100 g/mL for 4 hours. The culture tubes we re then placed on ice for 15 min utes to chill. 3 mL of culture wa s concentrated for each gene to be deleted. The cells we re was hed in DNA water to remove salt, antibiotics and arabinose. The cells are then

PAGE 50

50 resuspended in 200 L of DNA water yielding a very thick suspension of cells. Three electroporations we re set up in 2mm cuvettes each containing 50 L of cell suspension with 0 L (control), 5 L and 10 L of the recovered p KD4 fragment. The cuvettes we re shocked using a MicroPulser electroporater (Bio Rad, Hercules CA) using setting EC2 (one 5ms pulse at 2.5 KV). 1 mL of room temperature NZY+ is added to the cuvettes as a recove ry medium and the solution wa s transferred to fresh micro centrifuge t ubes. Cells we The plates we The resulting colonies wer e purified by 2 addit ional streaks on LB agar with kanamycin. The deletion wa s then confirmed via PCR using primers which bind outside of the gene of interest. A proper mutant should yield a product that is the size of the wild type PCR product minus the actual gene and plus 1550 bp for the FRT kanR FRT insertion. Colonies we re also checked for ampicillin sensitivity to ensure a complete temperature cure of pKD46. If desired the kanamycin resistance cassette was removed by using the pCP20 helper plasmid which encodes flp reco mbines which r ecognize s the FRT sites and excise s the kanR cassette between them. Typically during the described studies, the FRT kanR FRT cassette wa s left in place to serve as a marker for competition assays. RIVET R eporters Recombinase based In vivo Ex pression Technology (RIVET) reporters use a (204) This is achieved by inserting an antibiotic resistance gene ( AB r ) flanked by two resolvase recognition sites ( res ) into a neutral site of the chromosome. The tnpR resolvase gene is then inserted into the chromosome linked to a promoter or gene of interest. Once

PAGE 51

51 activated, the resolvase gene is transcribed Inducing recombination between the res sites, removing AB r and causin g the cell to lo os e antibiotic resistance. The resulting infected hosts by plating homogenized sample tissue on non selective media. The ratio of resolved colonies i s determined by patching single colonies from non selective recovery media to selective media containing the antibiotic specific to AB r where resolved colonies are unable to grow. The strength of the RIVET strategy is its ability to record activity in vitr o at any point during host colonization. Two distinct approaches were used to construct RIVET mutants during the study. Both approaches relied on homologous recombination to introduce tnpR into a desired site of the host chromosome. The first approach beg an with standard sub cloning of a promoter region of interest into the commercial pCR2.1 vector (or any similar vector). The target region is amplified using a forward primer binding upstream of the promoter region and a reverse primer binding inside the g ene anywhere after the st art codon. The primers we re modified by including xho1 restriction digest sites me incorporated into the fragment allowing for easy removal from cloning v ectors. The resulting fragment wa s then clone d into pCR2.1 and confirmed via PCR with the M13F and M13R primers. Over night growth in liquid culture wa s use d to amplify the plasmid which wa s recovered using a commercial kit. The fragment of interest wa s isolated by restriction digest using enzyme xho1 purified and imaged via agarose gel electrophoresis and recovered from the gel using a commercial kit. The fragment was ligated into plasmid pGOA1193 ( oriR6K mobRP4 promoterless tnpR lacZY bla ) which

PAGE 52

52 was xho1 digested and treated with CIAP. pGOA1193 cont ains a multiple cloning site (including xho1) followed by stop codons in all 3 reading frames just upstream of the promoterless tnpR (233) The ligated plasmid wa s heat oriR6K (192) and plated on LB agar with ampicil lin. The presence of the insert wa s PCR verified using the forward prime r which was tnpR Verified plasmids are recovered after overnight growth in liquid culture using a commercial kit. The construct wa s then verified via sequencing performed the by UF ICBR core lab using primer MT59. The sequences were mapped to the Salmonella sv. T yphimurium LT2 chromosome using BLAST to determine homology with the planned target sequence. Confirmed plasmid constructs we re electropor ated into E. coli strain BW20767 and recovered on ampicillin selective agar. The transformed BW20767 wa s mated with Salmonella strain JS246 (14028 zjg8103::res1 tetRA res1) which provides the res tet res site for RIVET (202) Both the transformed BW20767 donor and the JS246 recipient we ltures we re washed 3 times in PBS at low speed (6,000 rpm) to prevent damaging their flagella. 100 L of each we re mixed together in micro centrifuge tubes and pelleted by centrifuging at 6,000 rpm. The resulting pellet wa s resuspened in 30 L of LB, spotted on LB agar tes we re sealed with parafilm to prevent the spot from drying out. The resulting bacterial colo ny wa s streaked on to M9 agar containing 0.2% glucose, ampicillin, tetracycline and X gal. Ampicillin selects for the pGOA1193 plasmid, tetracycline selects for JS246 and X gal allows for blue white

PAGE 53

53 screening. Because JS246 is pir deficient the plasmid is forced to integrat e into the chromosome via double crossover at the homologous promoter region. This places the target promoter linked to tnpR lacZ into the native location of the chromosome and provides a complete copy of the wild type gene with promoter d ownstream. Indivi dual colonies we re re st reaked on to fresh plates to purity Integration of the promoter tnpR lacZ fusion into the chromosome was confirmed via PCR using a forward primer which binds upstream of the initial forward primer used to amplify the target fragment and MT59 which binds in tnpR Confirmed colonies we re used to make glycerol stocks following overnight growth in LB with ampicillin and tetracycline. The second approach u sed Red method to introduce the FRT kanR FRT cassette into the chromosome (202) Forward primer selection allows the cassette to be placed either d ownstream of a gene directly after its stop codon or for the cassette to be fused to the promoter, replacing the gene entirely. Selecting the final 48 base pairs of the gene (including the stop codon) place s the FRT kanR FRT cassette directly downstream of the gene. Selecting the 48 base pairs directly upstream of (but not including) the start codon replace s the gene with the FRT kanR FRT cassette as described in deletion mutant construct ion. The reverse primer consisted of the 48 base pairs immediately dow nstream of the stop codon. The following extension arms we re plasmid allowing amplification of the FRT kanR FRT cassette with the 48 bp homologous region s on either ends. The fragment wa s then electroporated into a host containing the res AB r res cassette. For the described studies, Salmonella strain JS246

PAGE 54

54 with the pKD46 helper plasmid was used. The li near FRT kanR FR T fragment amplified from pKD4 wa Red deletion mutants. The presence of FRT kanR FRT wa s confirmed via PCR. Confirmation at this step is preferred as incorporation of the FRT kanR FRT cass ette into the chromosome is the most technically challenging step of the mutagenesis. In most cases primers which bind outside the region of interest we re used for confirmation However, when FRT kanR FRT wa s inserted after longer genes the resulting PCR product may be too long to easily produce. In these instances primers internal to the gene or FRT kanR FRT can be used to reduce the PCR product length to a manageable size. The use of an internal FRT kanR FRT primer precludes using the product from the w ild type strain as a positive control since no product would be generated and should be avoided if possible. Once the insertion of the FRT kanR FRT cassette wa s confirmed, the helper plasmid pCP20 ( pR Flp ci857 cat bla ) (62) wa s added by electroporatio n the transformants we hour in or der to maintain the temperature sensitive plasmid and then plated on LB agar encodes Flp recombinase wh ich removes kanamycin resistance by inducing recombination between the FRT sites resulting in removal of kanR leaving a single FRT scar in the chromosome which can be utilized as a site to introduce tnpR from a suicide p lasmid. The resulting colonies we r e patched to LB agar with kanamycin to confirm removal of the FRT kanR FRT cassette. The now ka namycin sensitive constructs we re grown in liquid culture in 5 mL LB nt by chilling on ice and washing to remove salts. Two separate electroporations we re set up, one for plasmid

PAGE 55

55 pCE70 and the second for plasmid pCE71. Both plasm ids are oriR6K FRT promoterless tnpR but differ in the orientation of the FRT scar as the homologous recombination mediated by pCP20 can leave the chromosomal FRT scar in either a forward or reverse orientation. The use of both pCE70/71 ensured that one construct would receive tnpR with the proper downstream orientation. After electroporation the transformants we re recovered in NZY+ a we C. Because the pCE70/71 is forced to integrate into the chromosome at the FRT site. The insertion and orientation of tnpR wa s confirmed by PCR using a forward primer which binds to the chromosome outside the gene of interest and MT59, an internal reverse primer which binds to tnpR Overnight cultures of the confirmed transforman ts we re prepared for glycerol stock by overnight growth in LB containing both kanamycin and tetracycline. The tetracycline select ed for unresolved transformants which still retain the res tet res cassette. This wa s necessary to avoid false positives during assays resulting from introducing already resolved ( tetS ) colonies into th e host. Tetracycline selection wa s used only for the preparation of glycerol stocks or culturing from glycerol stock directly before a host infection to reduce selective pressure for strains with weak resolvase activity which would decrease the sensitivity of the assay. Handling of Oysters Oysters were obtained from the University of Florida Gulf Coast Research lab in Apalachicola, FL Market o ysters were harvested from varying locations within the bay from leases operated by Tommy Ward. The harvested oysters w ere shipped o n ice via USPS express mail in S tyrofoam coolers on Thursdays.

PAGE 56

56 The oysters arrived on Fridays and were rinsed with running tap water to remove any mud or debris. The clean oysters were then placed in two 45 gallon high density polyethylene (HD PE) tanks (catalogue #14100 0065, Fisher Scientific, Pittsburgh, PA) containing 25 gallons of ASW at 20 ppt with charcoal filtration and left to acclimate to lab conditions over the weekend. No more than 36 oysters were placed in a single tank. For use in assays, individual oysters were removed from the bulk tanks and scrubbed under running deionized water with a plastic bristle scrub brush. The scrubbed oysters were placed in smaller HDPE bins (catalogue # 7120 0010, Fisher Scientific, Pittsburgh, PA ) wi th 5 L of ASW at 16 ppt without filtration. RIVET assays were performed with 1 oyster per bin while 3 oysters per bin were used for competition assays. To begin assays, the colonizing bacteria were added directly to the water and uptake occurred via the Oysters were incubated for 24 hours at room temperature. Oysters were removed individually from the tanks with flame sterilized steel tongs. The oysters were shucked with a flame sterilized k nife and the meat placed in a Whirl Pak bag (catalogue # BO1348WA, Nasco, Fort Atkinson, WI) along with 50 mL of PBS. The oysters were homogenized in a Stomacher 4000 Circulator (Seward, West Sussex, UK) at 260 rpm for 1 minute. The resulting homogenate wa s plated on a suitable media and incubated

PAGE 57

5 7 CHAPTER 3 A HIGH THROUGHPUT SCREEN FO R INHIBITORS OF THE GACS/GAC A TWO COMPONENT SIGNALING SYSTEM Introduction The stability and resilience of host associated microbial communities depend on precisely timed signaling and gene regulation in members of the community. To control their multi cellular behaviors and to coordinate their interactions with eukaryotic hosts, all proteobacteria rely on orthologs of the GacS/GacA two component system. Hundreds of genes have been assigned to GacS/GacA regulons, however neither the signal for GacS nor its ecological roles are known. It is also not known how or whether this gene expression contributes to the resilience of native host associated microbi al communities. The Ecological Role of the GacS/GacA Two Component System In most natural environments, bacteria exist within multi cellular sessile pathogens to establish an d persist on a host (139, 2 36) Transitioning to a biofilm lifestyle is a co mplex, multi step process, involving 1 10% of bacterial genes (140, 319, 326, 332 338) Among these, orthologs of the GacS/GacA (BarA/SirA in Salmonella spp.) two component regulatory system and the members of the GacS/GacA regulon are universally required for biofilm formation in all proteobacteria (181, 303) Upon recognizing the currently unknown signal, t he sensor kinase GacS autophosphorylates and then transphosporylates the response regulator GacA (241, 303) T he phosphorylated GacA then binds within promoter regions of the genes e n coding small regulatory RNAs (s RNAs known as csr or rsm in Salmonella E.coli and pseudomonads, respectively). csr and rsm regulatory RNAs are functionally

PAGE 58

58 homologous, although there is little sequence identity. Salmonella enterica possesses both csrB an d csrC which function by controlling the intracellular availability of the RNA binding protein CsrA. CsrA directly controls gene expression by modulating translation of target mRNAs by either stabilizing or de stabilizing transcripts (259) The system is capable of very fine control ; csrB and csrC can bi nd and sequester up to 18 CsrA molecules but have a quick turnover time (1 4 minutes) al lowing rapid transduction of GacS/GacA signaling (16) In S. enterica the orthologs of GacS/Ga cA regulate virulence genes on Salmonella pathogenicity islands I, IV and V, biofilm formation, motility a nd colonization of surfaces as well as specific metabolic changes in response to host adaptation ( 5, 182, 300, 301, 303) In S. enterica the SirA and the Csr systems promote biofilm formation by increasing the expression of type I fimbriae and decreas ing the expression of flagella. Additionally, r epression of CsrA activity by csrB promotes synthesis o f polymers required for biofilm formation (181, 294, 301, 327) Although differences in the biochemical mechanisms of phosphorylation of GacA orthologs exist between different species, the interactions of GacA with the target promoters of the cs r s RNA appear to be evolutionarily conserved (12 8, 129, 181) Cross complementation of gacA mutants from various species has been reported (77, 103) These observations further establish that GacA orthologs from closely related bacteria most likely target and bind to the same conserved sequences within promoters of regulated genes. Potential Effects of GacS /GacA Two Component System Inhibitors The culturable microbiome of the Eastern oyster ( Crassostrea virginica ) is dominated by vibrios a nd pseudomonads which utilize GacS/GacA homologues to

PAGE 59

59 regulate virulence, biofilm formation and quorum sensing (118, 235) The GacS system also enable s cross species communication and expression of anti biotic compounds in pseudomonads (96) These phenotypes are required for bacterial colonization of eukaryotic hosts and establishment within host associated microb ial communities which, once established, are stable and nearly impenetrable to invaders. Because the environmental signal(s) perceived by GacS is unknown it remains unclear whether the signal is the same in all bacteria. Similar signals could enable an inv ading pathogen to take advantage of native host community signaling. Dissimilar signals could allow for differential disruption of the signaling mechanisms of certain species Identification of compounds which disrupt GacS/GacA signaling could help elucida te the chemical structure of the natural GacS signal and inform the design of This report describes attempts to 1) locate potential signals or inhibitory compounds and 2) elucidate specific mechanisms of activity within the GacS /GacA system Compound screeing was conducted by testing a P csrB luxCDABE reporter against a library of pharmaceutically active compounds (LOPAC Sigma Pharmaceuticals) as well as against a library of natural isolates from Harbor Branch Oceanographic Inst itute in Ft. Pierce, Fl (HBOI). Materials and Methods Bacterial Strains and Growth Conditions Bacterial s trains, plasmids and primers used in this study are listed in Table s 3 1 3 2 and 3 3. mately 200 rpm) in LB unless otherwise noted. Antibiotics were used as required for overnight cultures at the following concentrations ; not used

PAGE 60

60 during assays. Cultures for use in assays were always started from glycerol stocks o n the evening prior to use. Chemical Libraries An aliquot of the Sigma Library of Pharmaceutically Active Compounds (LOPAC) (Appendices B E ) was provided by the S cripps Research Institute Florida. The library contains 1 280 unique compounds which have a known pharmaceutical activity. The four 2.5 mM dissolved in dimethyl sulfoxide (DMSO). The compounds were sealed and stored at the master p lates were allowed to thaw at room temperatire aliquoted to test plates in a BSLII hood and re covered with a fresh polyolefin plate seal. Compounds were re ordered from Sigma as necessary and dissolved in DMSO to a concentration of 10 mM. A further 96 compounds isolated from deep sea sa mples was supplied by Harbor Branch Oceanographic Institute (HBOI) (Appendix F ) in Fort Pierce, Florida. The compounds were supplied as 0.2 mg of dried powder in a 96 well plate. Compounds were resuspended to a concentration of 10 mM in reagent grade ethan ol, sealed with a polyolefin plate seal and stored at use. Prior to use in assays HBOI compounds were aliquoted into fresh plates and allowed to dry for 1 hour in a sterile flow bench to ensure removal of ethanol. Construction and Selection o f Reporter P lasmids Plasmids with predicted promoters of csrB orthologs cloned upstream of the promoterless luxCDABE cassette on a multicopy plasmid were used as reporters to directly search for compounds which inhibit bacterial GacS/GacA/Csr regulatory pa thways. The P csrB luxCDABE reporter plasmids used in this study were previously available in the lab and their construction has been previously described (118, 303)

PAGE 61

61 Briefly, the geno mic fragment spanning a predicted csrB promoter (s) of E. coli K 12, Salmonella enterica sv. Typhimurium 14028 or Vibrio vulnificus were amplified via PCR. The resulting fragments were cloned into a commercial cloning vector, excised via restriction digest with EcoRI and gel purified Plasmid pSB401, was digested with EcoRI to remove the luxRI fragment, leaving a promoterless luxCDABE cassette from Photorhabdus luminescens The csrB fragment was cl oned into the digest site and c onstructs were confirmed via PCR, DNA sequencing and validated in a bioassay. A P csrA luxCDABE reporter was constructed in a similar manner to the csrB reporters. Briefly, the fragment containing the csrA (STM2826) promoter was amplified from the S. enterica 14028 chromosome using pr imers BA1009 and BA1010. The resulting product was gel purified (illustra GFX, GE Healthcare, UK), cloned into the pCR2.1 White colonies were selected for confirmation via colony PCR with primers M13F and M13R. The resulting plasmid was recovered (QIAprep Spin Miniprep Kit, Qiagen Sciences, Germantown, MD) and digested with EcoRI. The excised fragment was gel purified and ligated into the EcoRI site of pSB401 and then transformed i nto chemically BA247 and visually for luminescence. Positive colonies were confirmed by sequencing in the UF ICBR core lab. The final plasmid was named pCLUX1 and moved into d esired backgrounds via electroporation. P csrB LUX S creens To ensure a population of active cells overnight cultures of reporter strains were diluted 1/100 in fresh LB broth with appropriate antibiotics and incubated at 37C. After 3 hours the resulting o ptical density at 600 nm (OD 600 ) was measured using a

PAGE 62

62 spectro photometer. The ide al OD 600 was 0.3, however, due to slight differences in growth rates between strains and differences in initial overn ight cultures the actual OD 600 values were variable. In ord er to ensure an even starting point for all cultures used in a single experiment as well as between separate experiments the dilutions were standardize d for all the report er strains to an O D 600 = 0.3 basis 1 using E quation 3 1 : Where R dil is the volume of 3 hour sub culture to be added to the 1/1 000 test culture in L and V T is the total desired volume of 1/1 000 test culture in mL. Equation 3 1 results in a 1/1,000 dilution The total desired volume was depend ent on the number of plates used for each experiment as well as the desired volume of each well In our assays 100 L of culture was used in each well Typically 2 times the amount of culture required was prepared to ensure sufficient volume for aliquotin g and to avoid problems due to pipetting errors T he calculated volume of each reporter strain is added to the desired volume of fresh LB broth with tetracycline to maintain the reporter plasmids. Assays were performed in 96 or 384 well flat bottom black p olystyrene (PS) plates (Nunc 142761 and Costar 3916). To monitor both luminescence and growth microtiter plates with clear bottoms were used. Prepared test plates containing specific concentrations of test compounds were inoculated with the diluted repo rter strains and mixed via pipetting. An initial hour 0 measurement was recorded using a multi mode microtiter plate reader 1 Th is equation assumes a linear relationship betw een OD 600 and CFU which was not explicitly determined. In practice it has worked well for us for OD 600 values near 0.3 (3 1)

PAGE 63

63 (V ictor 3 Perkin Elmer, Fremont, CA), equipped with Wallac1420 Manager Work station software. Luminescence was measured as counts pe r second (CPS) for 0.1s per well in a chamber heated to 37C to reduce temperature fluctuations. B etween measurements plates were incubated at 37C and kept in plastic bag s with a moist paper towel to reduce drying. If the experiment consisted of several p lates they were removed one at a time from the incubator. CPS counts were recorded every hour for 10 hours which was sufficient to reach stationary phase. Raw data was exported from the plate reader in MS and graphed in a 3 dimension al column chart to enable visualization of the time series. Results for each compound were compared visually to control strains f or log reduction in CPS counts. Because of the size of the LOPAC library (1 280 compounds) and the limited using only the MG1655 pMT41 (P csrB luxCDABE ) reporter for Round 1 screens Although this is a high concentration for biological compounds the initial screen was intended to pick up any potential inhibitory compounds. Because the initial screen used only the pMT41 reporter, it was unable to rule out non specific inhibition of the LUX reporter. Non specific inhibition could arise from compounds which limit cell gro wth, disrupt metabolism or those that interfere with the LUX cassette by disrupting the production, activity or substrate of luciferase. In order to control for non specific inhibition of the LUX cassette, the pTIM2442 reporter was also used in second r oun d 2 In pTIM2442, the luxCDABE cassette is driven by a strongly (6) A compound that is a specific inhibitor would

PAGE 64

64 inhibit luminescence of MG1655 pMT41 to the level of luminescence of RG133 pMT41, without affecting light production by MG1655 pTIM2442. Statistical Comparison of Assay Runs (3 2 ) (3 3 ) W her Both the Z factor (Equation 3 2 ) factor (Equation 3 3 ) which were developed for high throughput screening were used to analyze assay performance (346) factor compares the positive and performance of the assay design The Z factor compares the average of all compound samples tested to the negative control. Because the assay is searching fo r agonists the majority of compounds in a library should have no activity and generate results similar to the positive control. Th e Z factor examines whether inhibitory compounds can be conclusively identified from the background of the entire library screen. The Z factor is not useful for secondary screens as most compounds should have an inhibitory activity. facto r can be used to monitor indivi dual assay plates by comparing the MG1655 and RG133 controls within each plate Hours 5 9 were used for compa ring the factors as the initial induction phase could be highly variable and some cultures were declining by hour 1 0. Biofilm Formation Assays Biofilm assays were performed as previously reported with the modification that only strains BA746 ( sirA ), TIM118 ( csrB csrC ), 14028 (wild type) and AT351 ( flhD )

PAGE 65

65 were used (301) These strains were chosen to reduce the size of the assay while still covering deletions of the most important pathways. Briefly, cultures were grown overnight in 5 mL LB plus antibiotics. The cultures were then washed 3 times and diluted 1/100 in colony forming antigen (CFA) medium Un treated PS plates (Fisher 12 565 501) were set up as required and 100 L of culture added to the appropriate wells. 25 L of 1% crystal violet solution and incubating for 15 minutes. Wells were empti ed via decanting and washed 3 time s by submersion in de ionized water. Stained biofilms were solubilized in 150 pipetting. 100 L was then transferred to a clean PS plate. Absorbance at 595 nm was recorded using a multi mode microti ter plate reader (V ictor 3 Perkin Elmer, Fremont, CA), equipped with Wallac1420 Manager Work station software. Results Selection of a P csrB LUX Reporter P lasmid In order to obtain the highest possible resolution in the library screens five different P csrB L UX reporters were tested using wild type Salmonella enterica sv. Typhimurium 14028 and BA746 ( sirA ) background s The purpose of the screen was to identify the LUX reporter plasmid with the largest dynamic signal range; the greatest difference in activity between the wild type and sirA backgrounds. The sirA control should perform in the same manner as a compound which specifically inhibits any part of the GacS/GacA signaling pathway (Figur e 3 1 ). A larger dynamic signal range allows for a more sensitive s creen. A time series analysis of the different plasmid born LUX reporters available showed that pMT41 produced the highest csrB specific resolution in a Salmonella background with a dynamic signal range of 1.25 log (Figure 3 2)

PAGE 66

66 Because E. coli is a less dangerous background to work with, plasmid pMT41 was moved into the wild type MG1655 and RG133 uvrY ( gacA ) minus backgrounds. Dynamic signal range and insensitivity to up to 3% DMSO were confirmed via additional screens. Based on these assays, MG1655 pMT 41 was selected as the test reporter and positive control with RG133 as the negative control. A retrospective analysis of controls from the second round screen showed the dynamic signal range from the MG1655 and RG133 controls remained above 2 log through stationary phase and never fell below 1.85 log for any samples, supporting both the choice of the pMT41 reporter and the E. coli background. Initial Screens of the LOPAC L ibrary The time series for each compound was compared to the positive (MG1655 pMT41) and negative (RG133 pMT41) controls which maintained the 2 log difference factor of the controls from all plates had an overall average of 0.60 a nd 63% of hourly measurements from individual plates were over the similar to the negative control. None of the compounds produced such a pattern. The Z factor of the test compounds was below 0 for each plate. In order to cast as wide a net as pos sible any compound which did not correspond to the typical pattern was selected by visual examination of the time series. In total 161 c ompounds were selected for the second round screen. A representative sample of selected compounds is shown in Figure 3 3 The 161 compounds identified in the initial screen were rescreened with both MG1655 pMT41 and MG1655 pTIM2442 at a concentration of 150 M. Due to limited compound volumes, only one screen was performed. Based on comparisons between

PAGE 67

67 the two reporter sys tems, 9 compounds were selected for more in depth analysis using a dilution series. Typical results are shown in Figure 3 4. Dilution Series Screens of the LOPAC Library Many of the compounds identified in the second round of screens inhibited LUX values below the RG133 pMT41 control. This could be an effect of the single test previous screens had narrowed the pool of candidates to a manageable level fresh compounds were ordered and a series of eight 3 fold dilutions was pre 68.5 nM. A wide range of concentrations was desired as some compounds with anti bacterial activity at high concentrations are known to have signaling roles at lower concentrations (84) The dilution series for each compound was tested with the MG1655 pMT41 reporter a s well as the MG1655 pTIM2442 reporter to control for non specific inhibition on three independent plates. The screens did not identify any compounds with GacS/GacA specific activity, however, the compounds were also tested using the biofilm assay for ana lysis of the assay protocol (Figure 3 5) LOPAC Biofilm Assays Three biologically independent assays were performed. Each assay contained 8 identical wells which served as technical replicates. The chosen series of mutants enable d the mechanism of action of the inhibitory compound within the GacS/GacA biofilm regulatory cascade to be determined However, n one of the tested compounds displayed a pattern consistent with GacS/GacA mediated biofilm inhibition (Figure 3 6). HBOI Library S creens The 96 compoun ds from the HBOI library were screened with both the P csrB LUX and P csrA LUX reporters. Because CsrA and csrB have antagonistic roles in the signal

PAGE 68

68 cascade, the use of both reporters was expected to yield a more detailed picture of potential activity. The P csrA LUX screen did not identify any compounds of interest. The P csrB LUX screen identified only 1 compound (Diisocyanoamphilectin) which was further analyzed via the biofilm assay (Figure 3 7). However, results from the biofilm assay were not consistent with GacS/GacA specific activity. Discussion In my screens of small molecule libraries, no compounds which specifically inhibit the GacS/GacA signaling pathway were detected. However, the results validate the screening approach. The LOPAC library screen generated a 12.6% hit rate in the initial screen and a 0.7% hit rate on the second csrB specific screen. Traditionally, luminescent reporters have been used as versatile tools for documenting bacterial gene regulation i n real time. While these reporters ar e convenient, it is important to include appropriate controls to account for any potential indire ct inhibition of luminescence. To address this possibility the pTIM2442 reporter was used (6, 91) A compound that is a specific inhibitor would inhibit luminescence of MG1655 pMT41 to the level of luminescence of RG133 pMT41, without affecting light production by MG1655 pTIM2442. No inhibitors met this criteria during the third round screen. The hit rates in rounds 1 and 2 of the LOPAC library screen are in good agreement with a previously reported screen of the LOPAC library for general anesthetic s That screen produced a general hit rate of 15% and a 1% hit rate using a computational filter to remove uninteresting compounds and those with less specific activity (183) Despite using less sophist icated methods my hit rates were similar despite the P csrB LUX screen searching for a more specific method of action.

PAGE 69

69 Analysis of assay performance with the high factor confirmed the assay design (346) The overall first round average of 0.60 is considered eening of 0.44 is acceptable. When several low performing plates were removed from the analysis the Examining the data trends showed variability from the MG1655 pMT41 reporter to be the primary d riving factor behind the low overall Z factor. The low Z factors within the first round screen plates showed that variability from the test compounds confounded interpretation of the screen. Several sources may have contributed to the high variability. The high initial compound concentrati on used for the assays resulted in strong repression of LUX activity for active compounds. The 6% concentration of DMSO may have affect ed E. coli growth rate slightly during the assay but the presence or absence of DMSO di d not appear to affect control reporters and was considered acceptable (193) Physical factors such as pipetting errors when making compound aliquots or reporter dilutions and the nece ssity to split sample assay runs over several days may have also play ed a role in creating inter assay variability Visual selection of interesting compounds was used to overcome the limitations of the assay. Despite the low compound volume limiting the nu mber sampl e screens that could be run, the reproducibility between rounds was reliable enough that it enabled detecting a labeling error in the compound key supplied with the LOPAC library. Among the compounds tested two primary patterns were observed ( F igure 3 5 ) The first group i ncluded strongly inhibitory compounds which produce d very low CPS

PAGE 70

70 values at all dilutions used in the bioassays. This was most likely indicative of compound s that inhibit bacterial growth and were not specific to the test pathw ay. Among these compounds we re several known antibiotics such as oxolinic acid and trimethoprim. Other compounds in this group, such as Azido deoxythymidine an HIV drug, are active against DNA replication. These compounds are likely to be toxic. The second group wa s composed of compounds that are inhibitory only at higher concentrations tested in the bioassays. All such compounds inhibited both reporters to the same extent. These compounds were most likely non specific inhibitors of metabolism and/or luminescence. Similar to the more toxic compounds, the chemicals in this group were either antibiotics or DNA inhibitory compounds. T he screen also picked up several flouraquinolone antibiotics whose method of action is the prevention of DNA replication. This may be an artifact of the csrB promoter used for the reporter system which relies on the GacA dimer for activation. DNA inhibit ory compounds likely interfere with GacA production and may lead to increased sensitivity of the screen. S. enterica also possesses the A cr A B efflux pump which has been shown to enable multi drug resistance to a variety of antibiotics, including flouraquin olones (18, 226, 227) This may explain wh y these compounds inhibit ed luminescence to a lesser extent than specifically toxic compounds. In general, the biofilm screens showed a much higher variability than the LUX reporter plasmid screens. In addition to GacS/GacA the biofilm phenotype is regul ated by multiple pathways (139, 140, 161, 185) Because none of the compounds were specific to GacS/GacA it is not possible to predict their impact on biofilm formation. As several compounds tested actually increased biofilm formation in certain mutants, it i s

PAGE 71

71 likely that these compounds act through a different pathway or mecha nism. Another possibility is protection of the cells against reactive oxygen species (ROS) afforded by the use of DMSO as a solvent The biofilm assays contained a final DMSO concentrati on of 0.211 M. Concentrations as low as 0.5mM have been shown to reduce biofilm inhibition by low concentrations of antibiotics (172) Although the screens of the LOPAC and HBOI libraries were unsuccessful the approach appears to be verified. Companies and research labs which routinely screen chemical libraries to discovery pharmaceutically active compounds currently use a utomated machinery and libraries in the tens or hundreds of thousand s of compounds (160, 174, 209, 223, 288) Perhaps then it is unsurprising that the screens described in this report con sisting of only 1,376 compounds, did not isolate any compounds of interest. Control of virulence and biofilm formation throug h disruption of two component systems has received interest as a strategy for deve lopment of next generation anti biotics (199) Disrupting signaling cascades has proven difficult due to complex regulatory networks and false positives during screens. Many possible hits represent c ompounds which do not directly interrupt the signal cascade (288) Until the synthase responsible for the production of the GacS signal is i dentified, these reporters could be used to screen additional available libraries.

PAGE 72

72 Table 3 1. List of bacterial strains used in Chapter 3 Strain Genotype Source lacZ deo R endA 1 gyrA 96 hsdR 17 recA 1 relA 1 supE 44 thi lacZYA argF )U 169 Life Technologies Macinga et. al. 1995 MG1655 Wild type Escherichia coli E. coli Genetic Stock Center RG133 MG1655 uvrY33 ::Tn5 Goodier and Ahmer 2001 14028 Wild type S. enterica serovar Typhimurium American Type Cu lture Collection BA746 14028 sirA3 ::cam Ahmer et al. 1999b JS198 LT2 metE 551 metA 22 ilv 452 trpB 2 hisC 527(am) galE 496 xyl 404 rpsL 120 flaA 66 hsdL 6 hsdSA 29 zjg 8103::pir+ recA 1 Ellermeier et. al. 2002 TIM118 csrB csrC 30 Teplitski et. al. 2006a AT 351 14028 flhD ::Tn10 Teplitski et. al. 2003

PAGE 73

73 Table 3 2. List of plasmids used in Chapter 3 Plasmids Functions Source pMT39 P csrB1 luxCDABE fusion from V.vulnificus in pSB401 (amp R ) Gauthier et. al. 2010 pMT40 P csrB3 luxCDABE fusion from V. vulnifi cus in pSB401 (amp R ) Gauthier et. al. 2010 pMT41 P csrB luxCDABE fusion from E. coli in pSB401 (amp R ) unpublished pMT42 P csrB2 luxCDABE fusion from V. vulnificus in pSB401 (amp R ) Gauthier et. al. 2010 pMT100 P csrB luxCDABE fusion from S. enterica in pSB3 77 (amp R ) Teplitski et. al. 2006b pTIM2442 luxCDABE R ) Alagely et. al. 2011 pCR2.1 TOPO general cloning vector lacZ R amp R ) Invitrogen pSB401 luxCDABE transcriptional fusion vector, (tet R ) Winson et. al. 1998 pCLUX1 P csrA luxCDABE fusion in pSB401 (amp R ) This Study

PAGE 74

74 Table 3 3. List of primers used in Chapter 3 Primer Sequence Use M13F GTAAAACGACGGCCAG pCR2.1 clone confirmation M13R CAGGAAACAGCTATGAC pCR2.1 clone confirmation BA1009 ACTCGACGAGTCAGAATC AGCATTCTT construction of pCLUX1 BA1010 CTGCAGCGTTAGCCAGTGTACAAGGCT construction of pCLUX1 BA247 GAGTCATTCAATATTGGCAGGTAAACAC construction of pCLUX1

PAGE 75

75 Figure 3 1. Methodology for the P csrB LUX screen. A) MG1655 wild type control B) RG133 control C) expected methods of compound inhibition D) The GacS/GacA regulon

PAGE 76

76 Figure 3 2. Results of P csrB LUX reporter plasmids selection trials in Salmonella hosts. CPS counts were determined every hour and the dynamic range of each reporter was determined by t he difference in log CPS between the S. enterica 14028 wild type and BA746 ( sirA ) control. A) pMT39 contains the csrB 1 promoter from V. vulnificus B) pMT40 contains the csrB 3 promoter from V. vulnificus C) pMT41 contains the csrB promoter from E. coli D) pMT42 contains the csrB 2 promoter from V. vulnificus E) pMT100 contains the csrB promoter from S. enterica 1.E+00 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 1.E+07 0 1 2 3 4 5 6 7 8 9 10 log (CPS) Hour A 14028 pMT39 BA746 pMT39

PAGE 77

77 Figure 3 2 C ontinued 1.E+00 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 1.E+07 0 1 2 3 4 5 6 7 8 9 10 log (CPS) Hour B 14028 pMT40 BA746 pMT40

PAGE 78

78 Figure 3 2. C ontinued 1.E+00 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 1.E+07 0 1 2 3 4 5 6 7 8 9 10 log (CPS) Hour C 14028 pMT41 BA746 pMT41

PAGE 79

79 Figure 3 2 C ontinued 1.E+00 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 1.E+07 0 1 2 3 4 5 6 7 8 9 10 log (CPS) Hour D 14028 pMT42 BA746 pMT42

PAGE 80

80 Figure 3 2 C ontinued 1.E+00 1.E+01 1.E+02 1.E+03 1.E+04 1.E+05 1.E+06 1.E+07 0 1 2 3 4 5 6 7 8 9 10 log (CPS) Hour E 14028 pMT100 BA746 pMT100

PAGE 81

81 Figure 3 3. Results of the first round LOPAC library screen. Only results for selected compounds are shown C ompounds potentiall y inhibitory to MG1655 pMT41 were selected visually based on repressed CPS counts as compared to the MG1655 wild type control. Compound concentration was 150 M

PAGE 82

82 Figure 3 4. Resul ts of the second round LOPAC screen. Only results for selected compounds are shown Inhibition was selected visually based based on repressed CPS counts as determined by comparison to the MG1655 control. Compound concentration was 15 0 M. The reporter pTIM224 was used as a control for non specific inhibition of the LUX reporter. No compounds show P csrB specific inhibition, however, these 9 compounds were selected for further study as they were not completely inhibitory at the high con centration

PAGE 83

83 Figure 3 5. Results of the third round dilution series for the 9 compounds selected as potentially inhibitory. Comparison between the P csrB LUX and P LUX reporter s were used to identify GacS/GacA specific activity. No compounds specific to GacS/GacA were found. Azido Azacytidine. D) Cinoxacin. E) Nalidixic acid. F) Oxolinic acid. G) Trimethoprim. H) 5 flouracil. I) Sanguinarine.

PAGE 84

84 Figure 3 5 C ontinu ed

PAGE 85

85 Figure 3 5 Continued

PAGE 86

86 Figure 3 5 Continued

PAGE 87

87 Figure 3 5 Continued

PAGE 88

88 Figure 3 5 Continued

PAGE 89

89 Figure 3 5 Continued

PAGE 90

90 Figure 3 5 Continued

PAGE 91

91 Figure 3 5 Continued

PAGE 92

92 Figure 3 6. Biofilm assay results for the 9 compounds selected as potentially inhibitory A Ga cS signal blind mutant (BA746), response regulator mutant (Tim118) and a flagella regulation mutant (AT351) were used to determine wh ich aspect of GacS/GacA mediated biofilm formation was disrupted by the putative inhibitors. B iofilm formation was quantifi ed spectrophotometrically and compared to DMSO only controls. Azido Azacytidine. D) Cinoxacin. E) Nalidixic acid. F) Oxolinic acid. G) Trimethoprim. H) 5 flouracil. I) Sanguinarine. J) DMSO only controls.

PAGE 93

93 Fi gure 3 6 Continued

PAGE 94

94 Figure 3 6 Continued

PAGE 95

95 Figure 3 7. P csrB LUX d ilution series for Diiscyanoamphilectin identified as possibly inhibitory during the screen of the HBOI library Dilutions 2 and 3 (3.3 mM 1.1 mM) show slight inhibition. These co ncentrations are very high for biological systems. GacS/GacA specific inhibition was not observed in down stream studies.

PAGE 96

96 CHAPTER 4 PROMOTER PROBE LIBRARY SCREEN OF SALMONELLA ENTERICA SV. TYPHIMURIUM FOR GENES ASSOCIATED WITH PERISTENCE IN THE EASTERN O YSTER, CRASSOSTREA VIRGINICA Introduction As the consumption of seafood and shellfish increases, so have incidents and outbreaks of associated illnesses. In the 1980s eafood accounted 10 19% and was the most significant single source of foodborn e gastroenteritis outbreaks (46) On a per serving basis, consuming shellfish carries six times the risk of contracting a food borne illness than chicken (3) Because many are consumed raw or lightly cooked, shellfish are a significant source of Salmonella outbreaks (55) Contaminated oysters have been a known vector of Salmonella since being linked to several typhoid outbreaks in the early 20 th century (45, 123, 232) Market surveys have isolated Salmonella in 2.8 % of domestic raw seafood samples and between 7.4 8.6% of domestic raw oysters (41, 85, 145) Contamination rates can be much higher locally, especia lly during the warmer months,; up to 77% of market ready oysters harvested from a single large bay in Florida tested positive for S almonella (41) Despite clear evidence that Salmonella colonizes oysters in the environment, the relationship that Salmonella forms with oysters is unclear. In lab studies, Salmonella can be isolated from shellfish in as little as 15 minut es after exposure to contaminated water (143) Comparison studies show Salmonella c an survive for longer periods in oyster s than other enteric species, with survival of at least 60 days possible (155, 219, 228) It is unclear what factors allow certain bacterial species to persist for extended periods of time while others are destroyed or shed Bacterial p ersistence in oysters app ears to exist on a continuum. Some species, such as E. coli are quickly eliminated

PAGE 97

97 while other well adapted species, such as Vibrio vulnificus are able to form long term commensal communities (75, 340) The oyster envi ronment selects for certain bacteria; oyster associated microbial community composition is different from the surrounding seawater nor is it homogenous within tissues indicating that different species may utilize differing mechanisms as strategies for per sistence (53, 68, 150, 173, 244) Bacterial colonization appears to be limited to the digestive tract as digestive organs host high microbial densities while the mantle cavity and oyst er surface are not colonized (117) However, because the spacing of the gills is too large to filter bacterial sized particles efficiently and the nutrit ion gained from bacteria makes up a very small percentage of the oyster diet it is unlikely bacteria are used as a food source (179) Once ingested, Salmonella initially colonizes the intestinal lumen, as well a s the digestive glands and passes through the epithelial barrier into the connective tissue. After 15 days, Salmonella is only associated with the connective tissue (220) Although crossing the epithelial barrier is associated with disease progression in humans, Salmonella is not pathogenic to oysters and has never been observed to replicate during as sociation with oysters At least two studies have linked contamination of shellfish to a specific Salmonella strain. Salmonella sv. Senftenberg was consistently isolated from mussels ( Mytilus galloprovincialis ) harvested in northwest Spain over a 5 year p eriod. The source of contamination was traced to a mussel processing facility located upstream from the beds providing evidence for a re infection cycle (195) Salmonella sv. Newport accounted for 77% of contaminated samples during a year long survey of commercially harvested oysters ( Crassostrea gigas and Crassostrea virginica ) from major

PAGE 98

98 shellfisheries in the United States (40) The same strain was the most common isolate, account ing for 43% of positive samples, during tests of oysters served in restaurants five years later (42) Although the source of contamination was not tracked, S. Newport is known to persist for long periods of time in agricultural water sources and appears to be associated with cattle production (7, 207) These results clearly show that long term associations of specific strains of Salmonella with shellfish occur and may indicate a genetic basis for the persistence of certain strains. However, few stud ies of the genetic determinants of bacterial colonization of oysters have been reported. Targeted studies have identified a role for surface attachment via pilins, cell surface proteins such as OmpU and virulence factors like metalloproteases in Vibrio spp (97, 246, 268) The only known study in Salmonella tested SPI 1 and SPI 2 mutants and found no effect on persistence in live oysters (220) The goal of this study was to understand which factors allow Salmonella to establish persistent infections which can contribute to seafood related outbreaks. This was accomplished by using a whole genome Salmonella promoter pro be library to identify genes associated with colonization and persistence in live oysters. Materials and Methods Bacterial Strains and Culture Salmonella necessary. Antibiotics were used a t the following concentrations; ampicillin (200 g/mL), kanamycin (50 g/mL) and tetracycline (10 g/mL). All strains, plasmid and primers used in this study are listed in Tables 4 1, 4 2, 4 3 and 4 4 respectively Oyster Agar (OA) was prepared using a mod ified protocol (1, 2) Aseptically shucke d oysters meats were blended in a volume of sterile 1/2 strength artificial seawater (ASW) twice the total

PAGE 99

99 mass of the oysters and extracted by boiling for 30 minutes. The resulting broth was filtered through mesh screens and 11m cellulose filter paper un der vacuum (Whatman #1, GE) to remove coagulated proteins and debris. The filtrate was brought up to the original volume with de ionized water (DI H 2 O), 1.5% agar was added and the medium was autoclaved. strength artificial seawater was prepared from com mercial aquarium salts in distilled water at a concentration of 16 ppt (either 15.23 g/L of Instant Ocean, Aquarium Systems Inc., Mentor, Ohio or 17.47 g/L of Coral Pro Salt, Red Sea, Eilat, Israel salt mixes were used depending on availability from local suppliers). Recovered samples were plated on Xylose Lysine Deoxycholate agar (XLD) with antibiotics as necessary for the identification of Salmonella Oyster Maintenance Eastern oysters ( Crassostrea virginica ) were obtained from commercial sources in Apal achicola Bay or Cedar Key, Florida and transported to Gainesville in coolers. Upon receipt, oysters were scrubbed under running tap water to remove mud and debris and acclimated in strength artificial seawater (16 ppt) at Acclimation tanks were fi ltered (Whisper 10i, Tetra) and aerated to maintain water quality. Prior to use in assays, oysters were removed from the acclimation tank and rinsed under distilled water. Assays were performed in polystyrene bins with 5L of strength artificial seawater unless noted. All oyster infections were incubated at in 5L bins for 24 hours before harvest. gfp Labeled Promoter P robe Library S creen Prior to the screen, a negative reporter control was constructed by removing the Tn5 promoter from the commercial pTurboGFP B reporter plasmid (Evrogen, Moscow, Russia ) via restriction digest and self ligating the plasmid to create a promoterless gfp

PAGE 100

100 ON) which strongly expressed gfp during growth on LB agar was used as a positive control. The reporter library was constructed by clo ning random small fragments of the S enterica 14028 genome upstream of the promoterless gfp as reported previously (11) Prior to oyster infection a 1 mL aliquot of the mL aliquot was analyzed via Fluorescence Activated Cell Sorting (FACS) using a FACSAria flow cytometer (Beckton Dickinson, Franklin Lakes, NJ) to select for inactive promot confirm promoter inactivity and aliquots were saved as glycerol stocks for future screens. For the initial screen in live oysters amplified via overnight growth in 5 mL LB, washed and concentrated to 1 mL in ASW. The li brary was added to an assay bin with two oysters in 10L of ASW which took up the Sa lmonella by natural filtration. Oysters were considered active when either the shells were observed to open or close or feces were excreted into the bin After incubatio for 24 hours both oysters were s hucked into a blender with 50 mL of PBS and homogenized f or 60 seconds. The resulting homogenate was sequentially filtered through mesh screens and 11m cellulose filter paper under vacuum (Whatman #1, GE) to prep are for FACS. Sorting gates were established using a negative control to identify non induced bacteria (14028 pGFP Off), a positive control to identify gfp expressing cells (14028 pGFP ON) and uninfected oyster homogenate. Active reporters were recovered, washed in LB to remove the capture buffer and stored as a glycerol

PAGE 101

101 stock between infections. The resulting oyster active (Oys+) population was screened in live oysters two more times to ensure the reporters were consistently active during oyster colonizati on. After the final selection, the recovered cells were washed and concentrated into 250 L of LB. 1/10 serial dilutions were prepared and 10 L aliquots were plated on LB ampicillin agar. To further select against constituently active promoters, only opa que colonies whose promoters we re inactive on LB, were saved for fur ther analysis by transfer to 96 well plates. A total of 576 colonies were recovered. These colonies were subjected to further selection for oyster specific activity by analyzing for the di fferential fluorescence activity of each strain following growth in LB or oyster homogenate for 24 hours at 37 96 well plates were inoculated from the master stock and fluorescence analyzed using a multi mode microtiter plate reader (Victor 3 Perkin El mer, Fremont, CA), equipped with Wallac1420 Manager Work station software. To select the promoters most strongly associated with oysters, those colonies with gfp activity one standard deviation above the in plate mean when grown i n oyster homogenate but n ot LB were considered to be up regulated and those one standard deviation below the in plate mean when grown in LB but not oyster homogenate were considered to be down regulated. This screen identified a subset of 41 strongly diff erentially regulated colo nies. The r eporter plasmids were isolated from the colonies of interest and the putative promoters were identified by plasmid sequencing using the primer Insert1R (CCACCAGCTCGAACTCCAC). Promoter E xpression in Live Oysters Measured via RIVET A ssays Recombin ase based In Vivo Expression Technology (RIVET) r eporters utilize a heritable antibiotic

PAGE 102

102 expression or signals which may occur only transiently during host colonization and have been shown to provid e sensitive quantification of gene expression during Salmonella colonization of host environments (202) RIVET reporte r s were constructed using either red) method as adapted for Salmonella (81, 202, 233) (Figure 4 1). Constructs were confirmed via PCR or sequencing as needed. Single oysters were inoculated with1 mL of wa shed overnight culture. The Salmonella reporters were recovered by blending as before and then plated he ratio of resolved colonies. As a control for the specificity of resolution to oyster colonization 10 L of the used as a control for reporters which may be activated by growth on solid media or at using oysters as a nutrient source instead of interacting with the live host. strength artificial seawater 0.3% soft agar (1/2 ASW) was us ed as a control for regulatory changes specific to starvation and desiccation induced by a planktonic lifestyle in estuarine conditions. Samples were recovered with a sterile wire loop directly from the plates after 24 hours and analyzed in the same manner as the oyster samples. Reporters which were expressed at consistently high or low leve ls across all the treatments were excluded from further analysis. Competitive Co Infection of Deletion Mutants in Live O ysters Deletion mutants were constructed using t Red recombinase method described by Datsenko and Wanner (81) The mutations were confirmed via PCR and

PAGE 103

103 transduced into a fres h S. enterica 14028 background using the P22 phage. The competitive fitness of the mutant was determined by calculating a competitive index as described previously (229) Briefly, three oysters per bin were inoculated with a roughly 50:50 mix of mutant to wild type Salmonella prepared from 1/100 dilutions of overnight cultures. Oysters were harve sted by stomaching in Whirl Pak bag s (Nasco, Fort Atkinson, WI) with 50 mL of PBS in a Stomacher 4000 Circulator (Seward, West Sussex, UK) at 260 rpm for 1 minute. The resu lting homogenate was plated on XLD at h of oyster commensals. A 1,000 fold dilution of the original inoculum was plated to XLD to d etermine the initial mutant to wild type ratio. Fifty individual colonies were patched from XLD to LB kanamycin and the proportion of m utants was determined by counting the number of kanamycin resistant colonies. Shifts i n the mutant to wild type ratio between the inoculum and recovered samples were used to calculate a competitive index (CI) according to Equation 4 1: (4 1) where M is the number of mutant cells and WT is the number of th e wild type cells in the inoculum (in) or in the recovered samples (out). The CI values were log transformed to allow even comparison between increases and decreases in competitive fitness. test, which is more conservative than individual pair wise t test s Co infections between S. enterica 14028 and JS246, which contains a neutral tetracycline resista nce marker, were used as the control.

PAGE 104

104 Hemocyte A ssays The colonization of oyster hemocytes was examined by adapting a method previously reported in Vibrio splendidus (98) A constitutively on gfp reporter (pGFP ON) was transformed into both wild type Salmonella (14028) and an ssrB mutant (MJW129) by electroporation. The colonization of hemocytes was confirmed via fluorescent microscopy. The reporters were used to quantify hemocyte infection following either a two hour i ncubation with freshly drawn hemolymph or a 24 hour infection of live oysters. Hemolymph was drawn from the pericardial cavity of freshly schucked oysters using a 22 guage needle. Samples were analyzed via flow cytometry with sorting gates set using the gf p gfp Results Identi fication of Oyster S pecific Promoters using a gfp P romoter Probe L ibrary To identify genes specifically active during oyster colonization, a previously constructed library of Salm onella gfp promoter probe reporters was screened in live oysters. The established sorting gates were able to clearly identify gfp labeled bacteria and FACS screening was consistently able to isolate a large population of Salmonella mutants with active prom oters (Figure 4 2). Sequence analysis of the selected colonies revealed 19 independent putative promoters (Table 4 5) Three of the sequences, ssrB rfaZ and STM0306, identified regions internal to genes and oriented in the anti sense direction which could represent cis encoded regulatory elements which have a role in post transcriptional regulation. Confirmation of Oyster Specific P romoter Activity using RIVET R eporters RIVET reporters were constructed for 18 of the 19 indentified promoters. Several attem pts were made to construct a pckA tnpR reporter but were unsuccessful. pckA

PAGE 105

105 encodes phosphoenolpyruvate carboxykinase which catalyzes the rate controlling step of glucogenesis. A pckA only mutant retaine s full virulence in mice while a pckA ppaA double mut ant, which is complete ly deficient in glucogenesis, i s slightly attenuat ed indicating the pathway plays only a minor role in regulating Salmonella virulence (299) Because of its central metabolic function and lack of a significant role in virulence during infection of mice, pckA was not examined further. Eight of the eighteen successfully constructed reporters were selected as significantly responsive to oyster colonizatio n following RIVET assays (Figure 4 3). The reporter most strongly regulated in live oysters was upd the gene that encodes uridine phosphorylase, which regulates pyrimidine metabolism. upd was less active in live oysters and was also down regulated in oys ter homogenate compared to growth on LB, likely due to a decrease in overall metabolic activity. pabC encodes 4 amino 4 deoxychorismate lyase and catalyzes the formation of 4 aminobenzoate and pyruvate from 4 amino 4 deoxychorismate. Salmonella is unable to scavenge for folate and mutants deficient in the formation of 4 aminobenzoate are avirulent in mice (17) Up regulation of pabC during the promoter probe screen and growth on oyster homogenate indicates either an increased demand for 4 aminobenzoate due to folate limitation or an increased need to degrade pyruvate due to altered carbon source utilization. Because folate is also a co factor for DNA synthesis the decrease in activity during the R IVET screen could be due to a lowered growth rate. phsA encodes a component of thiosulfate reductase which produces hydrogen sulfide via the reduction of thiosulfate. The phs operon provide s only a small contribution to anaerobic metabolism but is induced in stationary phase and may help

PAGE 106

106 non growing cells maintain their membrane potential for energy acquisition (146) yhdG ( dusB ) catalyzes the synthesis of dihydrouridine, a nucleotide found in tRNA an d rRNA. The RIVET analysis showed full resolution of yhdG tnpR during growth on LB and OA and reduced resolution in live oysters, likely because of a reduced demand for protein synthes is due to a lower overall growth rate. yibL encodes a highly conserved hypothetical ribosome associated protein with no known function. yggB encodes the MscS mechanosen sitive channel which is active at high osmolarity as well as during stationary phase and is regulated by rpoS (289) The channel helps regulates the osmotic tension of the cell membrane by allowing the cell to quickly vent solute concentrations during periods of high intracellular pressure. The up regulation of yggB appears to be a hedging strategy against over adaptation to high osmolarity by providing a mechanism to quickly ad apt to low osmolarity and avoid bursting (187) yggB is two genes upstream of yggE which is also regulated by rpoS and encodes an oxidative stress defense protein. Both genes were identified in a microarray study of genes induced by oxidative stress in E. coli and may represent a protection to cellular stress operon (166) yggB and yggE a re also identified as virulence factors rec ognized by catfish ( Ictalurus punctatus ) anti serum associated with enteric septicemia caused by the proteobacterial pathogen Edwardsiella ictaluri (217) pagN encodes an outer membrane adhesin/invasin that shows specificity for binding to cell surface heparin sulphate proteoglycans and allows invasion of human epithelial cells (178) Although the complete invasion mechanism is not currently understood, a pagN mutation severely attenuates invasion of human epithelial cells and survival in mice (69, 147, 177) The pagN gene is induced by acidic pH as well as low

PAGE 107

107 cation concentrations. It is regulated by the PhoP/Q two component regulator which is known to regulate virulence and resistance to host de fenses in response to environmental signals (137) PagN is related to Rck, an ou ter membrane protein which classic TTSS mechanism for invasion encoded by SPI 1 (262) Interestingly, Rck is one of two known targets of sdiA the orphan AHL receptor in Salmonella which may aid in host adaptation (282) Both pagN and rck have low activity during in vitro culture and these alternative invasion factors may represent conserved mechanisms for the colonization of host environments in response to environmental conditions (4, 147) ssrB is part of the two component response re gulator SsrA/SsrB which controls expression of SPI 2, the TTSS which governs infection and survival within macrophages (87) ssrB also counters DNA silencing by H NS, a global regulator which preferentially silences acqui red DNA in Salmonella while allowing transcription of virulence factors (324) The SPI 2 TTSS is used by Salmonella to excrete a number of effector proteins once inside macrophage s, altering the environment to favor replication of additional Salmon ella cells. ssrB mutants are attenuated for macrophage colonization and virulence in mice (65, 148) ssrB responds to multiple environmental signals including acidic pH, low Mg + and PO 4 3 concentration, nutrient limitat ions and is down regulated in the presence probiotic microbes. The ssrB tnpR reporter displayed high varia bility in all treatments which wa s much stronger than the observed trends. The initial gfp library screen identified an internal anti sense sequence r epresenting a putative cis encoded RNA regulator and the RIVET reporter was constructed in this anti sense direction. These regulatory elements are known to provide very fast acting adaptation to changes

PAGE 108

108 in environment. Thus these small changes in the reso lution of the RIVET reporter may represent optimization of ssrB activity in response different conditions experienced by portions of the Salmonella population during survival and passage through the oyster digestive tract. ssrB I ncreases C ompetitive Fitne ss but does not R egulate H emocyte Invasion in O ysters To verify a colonization or persistence related phenotype for the identified active red mutagenesis for those genes selected during the RIVET infections. Shifts in the ratio of a defined mutant to wild type S. enterica 14028 in an initial inoculum ve rsus the recovered population following a 24 hour infection of live oysters were used to calculate a competitive index for the mutant. Of the eight mutants tested, only an ssrB mutant was significantly less competitive than the wild type (Figure 4 4). As the master regulator of SPI 2, ssrB is required for intra cellular survival and virulence in vertebrate macrophages. In bivalves, hemocytes are the immune competent cells responsible for pathogen recognition and killing via phagocytosis (50) The hypothesis that Salmonella colonizes oyster hemocytes in an ssrB dependent ma nner and uses SPI 2 as a conserved mechanism for persistence within oyster hemocytes was tested by using gfp labeled reporters to analyze differences in hemocyte colonization between wild type Salmonella and an ssrB mutant. FACS analysis of whole hemolymp h drawn from oysters following a 24 hour infection showed low levels of gfp expression in hemocytes for both the 14028 and ssrB mutant infections (Figure 4 5). In order to simplify the infection the reporters were incubated with hemolymph harvested from l ive oysters for 2 hours (Figure 4 6) Both

PAGE 109

109 mutant and wild type were able to successfully colonize hemocytes to high levels. Subsequent examination by fluorescent microscopy shows high concentrations of Salmonella can associate with a single hemocyte and b oth the mutant and wild types are capable of entering hemocytes. However, no significant differences were observed between the wild type and ssrB mutant in any of the samples, indicating ssrB does not mediate Salmonella internalization of or persistence in hemocytes. The drastic decrease in the percentage of gfp positive hemocytes between the 2 hour hemocyte infection and 24 hour live oyster infection indicate that persistence in hemocytes does not contribute to the long term persistence of Salmonella in oy sters under biologically relevant conditions. This could be due to low survival in the hemocytes due to phagocytosis or to low colonization rates of hemocytes following ingestion of Salmonella from the water column. The specific tissues targeted by Salmon ella during infection of oysters have only recently been identified. Anti body staining of oysters infected with a S N ewport strain associated with oyster contamination showed colonization was primarily associated with gut epithelial cells, columnar cells within the digestive glands and could spread to the connective tissue throughout the body. 15 days following the initial infection, Salmonella contamination was predominately located in the connective tissue, including the associated hemocytes. Mutants we re used to test the survival phenotypes associated wit h SPI 1 ( invA ) or SPI 2 ( ssaV ) but there were no discernible differences in population size between either of the mutants or the wild type S. Newport strain during a 30 day infection of oysters (220)

PAGE 110

110 Although t he colonization deficient phenotype of SPI 2 mutants is well established in the mouse model several studies using pigs have demonstrated that the contribution of SPI 2 to persistent infections is not uniform. An examination of specific organs follow ing competitive co infection between a sifB (a SPI 2 effector protein) mutant and wild type Salmonella showed the mutant is less competitive in the digestive tract but was more competitive during infection of tonsils (238) Although the mutant reached smaller populations in most tissues, the long term persistence of the established populations were not impaired. A side by side study betw een wild type Salmonella and an ssrA/B mutant individually inoculated into pigs orally f ound no significant differences in the colonization of 14 different tissues types or the systemic population size during the infection (34) However, a competitive intravenous co infection between the same mutants did show tissue specific differences in persistence and an overall lowered competitive fitness of the ssrA/B mutant indicating the inoculation conditions and co occurring micro bes can play a larger role in colonization fitness than the host. R ecent evidence shows that hemocytes can be exploited as a mechanism for increased persistence by some pathogenic bacteria. An isogenic ompU mutant of the oyster pathogen Vibrio splendidus was severely deficient in hemocyte colonization (98) A model was proposed where OmpU acts as an opsonin for the host superoxide dismutase, Cg EcSOD, a integrins on the surface of oyster hemocytes which are then exploited to gain access to the interior of the cell. Once inside the cell, V. splendidus is able to persist by suppressing the formation of antimicrobial peptides and prod uction of reactive oxygen species.

PAGE 111

111 Discussion In order to colonize and persist in oyster tissues Salmonella must evade killing by hemoctyes, which engulf bacteria via phagocytosis and induce cellular destruction via reactive oxygen species or lysozyme pro duction. Induction of lysozyme is dependent on the bacterial challenger; E. coli and non pathogenic vibrios stimulate lysozyme activity while pathogenic V. splendidus represses lysozyme production (8, 60, 188) Oyster hemocytes can also secrete several defensin like antimicrobial peptides (AMPs) which have demonstrated activit y against E. coli V. parahemolyticus and Staphylococcus aureus and can interact synergistically with a proline rich peptide expressed by the hemocytes to increase antimicrobial activity (126, 134, 273) Hemocyte bacteria interactions are primarily mediated by cell surface factors. Adhesins and cell surface prot eins associated with virulence appear to be the primary targets. Hemocytes recognize and respond to the outer membrane protein OmpR of known oyster pathogens (rickettsia like organisms) (347) A mannose sensitive hemagglutinin (MSHA) deficient mutant in Vibrio cholerae O1 El Tor i s less susceptible to hemocyte adherence and ba ctericidal activity than wild type V. cholera A n E. coli m utant lacking type 1 fimbriae i s resistant to agglutination and intra cellular killing by Mytilus galloprovincialis hemocytes when compared to wild type (49, 345) However, some surface factors may provide pathogens an advantage. The interruption of type IV pilins significantly reduce s persistence of V. vulnificus when compared to wild type and V. splendidus ut ilizes agglutiniation of oyster hemocytes to OmpU to establish intercellular infections (98, 234) Interestingly, 7 of the 19 promoters identifie d in the library screen we re cell surface proteins, stress response genes or virulence factors indicating these genes may

PAGE 112

112 mediate Salmonella interactions with hemocytes to facilitate persistence. Of these genes, only ssrB was linked to increased competitiv e fitness in oysters. However, deletion of ssrB did not affect interactions with hemocytes as compared to wild type. A previous study found the competitive fitness of an ssaV mutant is not impaired during a 30 day infection of oysters, also indicating that SPI 2 has no effect on long term persistence (220) T he results of this study could indicate that ssrB contributes to oyster fitness through a currently unknown mechanism. ssrB has shown tissue and environmental specific responses in a number of studies and could regulate targets other than SPI 2 under certain conditions. Compared to a study in red t omatoes which used the same library and screening approach the current study identified a lower number of active promoters (19 vs. 51) and confirmed fewer genes as having a significant colonization phentoype (1/18 vs 6/51) (230) Screens of similar Salmonella reporter libraries identified 12, 21 and 86 active promoters specific to mouse models of colon carcinoma, enteritis and human prostate tumors respectively (11, 186, 258) The number of unique promot ers isolated during this study wa s on the low end but in line with those studies. The lower number of positive hits could be due to several factors. A low number of cells (25,000) were isolated during the initial in vivo screen which could have created a population bottleneck in the following screens. Alternatively, Salmonella could be subject to low selective pressure during oyster colonization leading to a less stringent screen. Salmonella does not reach the same population density in oysters as it does during mouse and tomato infections. Studies of persistence in oysters typically s how initial colonization densities 1 to 2 log fold below the inoculum followed by a population

PAGE 113

113 decrease with in the fir st 24 48 hours. A similar trend was observed in this study; the water in the oyster incubation tanks was inoculated with approximately 10 4 cfu/mL and Salmonella was typically recovered from oysters at 10 2 3 cfu/g after 24 hour incubation. In long term studies survival is marked by a smaller population of persisters that slowly declines over time. A S. Newport infection established with a 1 0 6 cfu/g inoculum led to an initial population density of 10 4 cfu/g at five days post inoculation which steadily declined to 10 2 cfu/g at thirty days post inoculation (219) Significant growth of Salmonella on live oysters is unlikely as no known study has observed a population expansion following the initial inoculation. The isolation of viable Salmonella in oyster feces may indicate that most cells are shed intac t and populations experience low mortality during passage through oysters (263) The low growth and low mortality environment may place low selective pressure on the Salmonella population, decreasing the power of the screen to identify promoters specific for oyster colonization. Manu of the promoters identified during this screen we re involved in metabolic regulat ion during stationary phase which could indicate the importance of maintaining cellular functions over active growth. The RIVET assays and competitive co infections confirmed that although many of the identified promoters are expressed in live oysters they do not contribute to fitness. Ultimately the colonization and per sistence of Salmonella on oysters may be more a function of its enhanced capability to adapt to and survive in a wider range of environmental conditions, as compared to other bacteria like E. coli than specific genetic abilities (337)

PAGE 114

114 Table 4 1. List of bacterial strains used in Chapter 4 Strain Genotype Source E. coli lacZ deoR endA 1 gyrA 96 hsdR 17 recA 1 relA 1 supE 44 thi 1 lacZYA argF )U169 Life Technologies ogen Macinga et. al. 1995 BW20767 E. coli K12 RP4 2 tet :Mu 1 kan ::Tn 7 integrant leu 63::IS10 recA 1 creC 510 hsdR 17 endA 1 zbf 5 uidA (D Mlu I): pir / thi Metcalf et. al. 1996 14028 Wild type S. enterica serovar Typhimurium American Type Culture Collection JS246 14028 yje P8103:: res 1 tetAR res 1 Merighi et. al. 2005 MJW129 ssrB :: cmR van der Velden et al. 2000 MM_011_C12 phsA::FRT kanR FRT Santiviago et al. 2009 MM_009_E04 kanR FRT Santiviago et al. 2009

PAGE 115

115 Table 4 2. List of bacterial strains constructed for use in Chapter 4 Strain Genotype Source CEC0001 JS246 ssrB::tnpR lacZY amp R This Stu dy CEC0002 JS246 csiE::tnpR lacZY ampR This Study CEC0003 JS246 yggB tnpR lacZY kanR This Study CEC0004 JS 246 STM4596:: tnpR lacZY ampR This Study CEC0005 JS246 pckA::tnpR lacZY ampR This Study CEC0006 JS246 yhdG tnpR lacZY kanR This Study CEC0007 JS 246 pagN :: tnpR lacZY ampR This Study CEC0008 JS246 glk::tnpR lacZY ampR This Study CEC0009 JS246 qor::tnpR lacZY kanR This Study CEC0010 JS 246 yjfO::tnpR lacZY ampR This Study CEC0011 JS246 STM11470:: tnpR lacZY ampR This Study CEC0012 JS246 pabC: :tnpR lacZY ampR This Study CEC0013 JS246 dkgA::tnpR lacZY ampR This Study CEC0014 JS246 rfaZ tnpR lacZY kanR This Study CEC0019 JS246 yibL tnpR lacZY kanR This Study CEC0020 JS246 udp tnpR lacZY kanR This Study CEC0021 JS246 dppA tnpR lacZY kanR T his Study CEC0022 JS246 phsA tnpR lacZY kanR This Study CEC0023 yihX ::FRT kanR FRT This Study CEC0027 pabC ::FRT kanR FRT This Study CEC0028 yibL ::FRT kanR FRT This Study CEC0029 udp ::FRT kanR FRT This Study CEC0031 yggB ::FRT kanR FRT This Study CEC0033 yhdG ::FRT kanR FRT T his Study

PAGE 116

116 Table 4 3. List of plasmids used in Chapter 4 Plasmids Functions Source pGFP Turbo B P lacZ TurboGFP ( ampR ) Evrogen pCR2.1 TOPO general cloning vector ( kanR ampR ) Invitrogen pGOA1193 pIVET5n with promoterless tnpR ( ampR ) O sorio et. al. 2005 pKD4 oriR6K bla rgnB FRT kanR FRT ( kanR ) Datsenko and Wanner 2000 pKD46 repA101ts oriR101 araC P araB exo) tL3 ) ( ampR ) Datsenko and Wanner 2000 pCP20 pR Flp ci857 (ampR kanR) Cherepanov and Wackernagel 1995 pCE70 oriR6K FRT promoterless tnpR (kanR) Merighi et. al. 2005 pCE71 oriR6K FRT promoterless tnpR (kanR) Merighi et. al. 2005

PAGE 117

117 Table 4 4. List of primers used in Chapter 4 Primer Sequence Use Insert 1R CCACCAGCTCGAACTCCAC Sequencing from pTurbo GFP B M13F GTAAAACGACGGCCAG pCR2.1 clone confirmation M13R CAGGAAACAGCTATGAC pCR2.1 clone confirmation MT59 CAAAAAGTCGCATAAAAATTTATCC RIVET confirmation BA184 CAAAAAGTCGCATAAAAATTTATCC RIVET confirmation cec003 ctcgagCCAGCGGTAGCGTAAAGGTCAATA csiE tn pR construction cec004 ctcgagGATCTCCAGGCTTGTCTCAGTGAT csiE tnpR construction cec005 TCGTGATATCGCTGTCCTGGTCAT csiE tnpR construction cec006 ctcgagAATTCAGAAAAAAACGCAGAGAGG pckA tnpR construction cec007 ctcgagACCTTTACCCTTATCGGACCACCA pckA tnpR constructio n cec008 TCCATGTCGTTATCCAGAATGATG pckA tnpR construction cec015 ctcgagTGAGACACCGCAGCCCATTACAAT STM4596 tnpR construction cec016 ctcgagGATGTTCATCGCTTCGCTATCCTG STM4596 tnpR construction cec017 GTCCAGTACCGCTAACCGCTTATG STM4596 tnpR construction cec018 c tcgagAGCAGTTGATGATTGGTCGTGTCA ssrB tnpR construction cec019 ctcgagCGAGGGCAGCATTATGAAAGAATA ssrB tnpR construction cec020 ATATTCATCCGGTGTGTTTCGACG ssrB tnpR construction

PAGE 118

118 Table 4 4 Continued Primers Sequence Use cec021 ctcgagCCCACAGGACCAGCTATTTT pagN tnpR construction cec022 ctcgagGTGAGACGGATGCTAAAGGC pagN tnpR construction cec023 AACTCAACCTTCAGCCAGGA pagN tnpR construction cec024 ctcgagACGCGAAGGTAAAAAGCAAA STM1147 tnpR construction cec025 ctcgagGCGATGGAACGAAAGTGATT STM1147 tnpR construction cec0 26 GCGATTGTTGAGCCACTGT STM1147 tnpR construction cec027 ctcgagAGTCAGTCTTTGGCGATGCT pabC tnpR construction cec028 ctcgagAGCGGTATGGGACTAAGGGT pabC tnpR construction cec029 AAATCGTCGGCTTTGGTATG pabC tnpR construction cec030 ctcgagATCTTCCACGCTGACGCTAT glk tnpR construction cec031 ctcgagCGGATAATCAAACCCACCAC glk tnpR construction cec032 AAACTTACCCCACCAGCAAG glk tnpR construction cec033 ctcgagCCTGCAATATGCTGAACGTG dkgA tnpR construction cec034 ctcgagTGATAAACAGCTCTTCCCGC dkgA tnpR construction cec035 TATCGT TCTGCCTGCGCTAT dkgA tnpR construction cec042 ctcgagTAATAATCGGCTTTCGCAGC yjfO tnpR construction cec043 ctcgagGGGCAACGGCAAAATAACTA yjfO tnpR construction cec044 AAGTAGCCAGTTTTCCGCCT yjfO tnpR construction

PAGE 119

119 Table 4 4 Continued Primers Sequence Use cec0 62 AGCGAACAGCTGGAGGCGTTGGAGGCATACTTCGAAAATTTTGC GTAATGTAGGCTGGAGCTGCTTCG yhdG construction cec063 GAATTTACGCGTTGTTCGAACATAGTTCTGTCAGCTCTTTATTTCT GTCATATGAATATCCTCCTTAG yhdG construction cec064 GAAATGGGGCTCAAAGAGATGACAGGTTTCGCGAAGAGCGAGT TCTAATGTAGGCTGGAGC TGCTTCG yibL construction cec065 GACATCCTCCGTACAACGGGTGTCCTGAGAGCCTGGGATGCGG AAGGTCATATGAATATCCTCCTTAG yibL construction cec066 AGCCACGCGGTGAAAATCGTCGTGGAAGCGGCCCGTCGTCTGC TGTAATGTAGGCTGGAGCTGCTTCG udp construction cec067 GCAAAAAGAAAAGGCCGAACGCGTCGGCCT TTGCAAAAGAGAG GAGAACATATGAATATCCTCCTTAG udp construction cec068 GATACCCCGGCAGGCGAAGCGCTGGTTAGCGCCGGACCGAAG CTGTAATGTAGGCTGGAGCTGCTTCG pckA construction cec069 TTCTCAACGCCGGATGACGCCGTTCAAAGCCGCCATCCGGCCT GTTCCCATATGAATATCCTCCTTAG pckA construction cec070 TCCGGTACGGTAGTGCATACCGCAGGCGTGACGCTGAGCCGGG CATGATGTAGGCTGGAGCTGCTTCG phsA construction cec071 GCAGCATGACGTACTGATTCGTTAAATGATTCATGGTTCCCTCCT CCCCATATGAATATCCTCCTTAG phsA construction cec072 GTTGATCCATTAGGCAAACATCACTTCGAAAACGTCTCTGTCGAA TAATGTAGGCTGGAGCTG CTTCG dppA construction cec073 GCTGCGCTTATCCGGCCTACACAACACCGGGGCGCAGCGCTCT TTTAACATATGAATATCCTCCTTAG dppA construction

PAGE 120

120 Table 4 4 Continued Primers Sequence Use cec074 CAGATGGACGTCAATTTTAAACGCGTGAAAGATAACGCCGCGGA GTAATGTAGGCTGGAGCTGCTTCG yggB constru ction cec075 ATACTGGAGGCGGATAAGCGCAGCGCCGGCAGGCAGCGCGGG AGAAAACATATGAATATCCTCCTTAG yggB construction cec076 GTGCTGGAAAGCCGGGCCACACAGGGCTCAAGCCTGCTGATTC CGTAATGTAGGCTGGAGCTGCTTCG qor construction cec077 AAAAAGAAAGGGCTTCCCGGGTGGAAGCCCAATTTCTTTGCAGA GCTACAT ATGAATATCCTCCTTAG qor construction cec078 TATGTTTATCATGCAACCTATAAATAAATGTTATATTCAATAACTA ATTGTAGGCTGGAGCTGCTTCG rfaZ construction cec079 TTATTTGCTGCAGCGTTATGACATACTTGAGAGAATTTGAGATGT AATCATATGAATATCCTCCTTAG rfaZ construction cec080 AAGGATAAAGCCACCATCCC TGACTATTTCGCGAAGCTGTTATG CTAATGTAGGCTGGAGCTGCTTCG yihX construction cec081 AGGCCCGAACAGGGCGCGTATGGCGTCCAGCTTTTTGGTGAAC GGTTTCATATGAATATCCTCCTTAG yihX construction cec089 GTGGGACCCGCGTCTGACTC yibL construction cec090 TGCGGGTCAATCATATTCTGCGGGA yibL cons truction cec091 AGGGGCAAGTGGGGAGGCTG udp construction cec092 TGATCGGCGTGCGCTTTCGT udp construction cec093 TCGCTGGACGACGCCGTTTC yihX construction cec094 CGCCCACCGCCGTCATTTTG yihX construction

PAGE 121

121 Table 4 4 Continued Primers Sequence Use cec095 TGC GAACGGAATCCCCACCTCT dppA construction cec096 TCGCCGGGGATCATGTGGACA dppA construction cec097 CACGCCTGGCAGCCGATACAA phsA construction cec098 AGGCATAAGGGAGCGGGTCGG phsA construction cec099 AATGCGTGCCGAAGCAACG rfaZ construction cec100 AAGCGGAAGGATCAT GGCGGC yggB construction cec101 CTACTGCTGGCGGTGGCTGTG qor construction cec102 ACGGGTCTGGTTACCACGGGT yhdG construction cec103 GGGATGCTGGAGATTGGCACC pckA construction cec107 TTACCCATCTCCCCATCGGT RIVET confirmation cec123 GTGAGAATGATCTCATTTGCTTGTTTT GCTATGACCAAGGAATATT GAtgtaggctggagctgcttcg yggB construction cec124 GCGCGCATACTATAAGGTATCTATCCCATTTCTATCAGAAGCTATC CCtgtaggctggagctgcttcg yibL construction cec125 GTGTCTCTTTGCTTCTTCTGACAAACCCGATTCACAGAGGAGTTTT ATtgtaggctggagctgcttcg udp construction cec 126 TGCGTTATTCATCCTGCCACACTAACAGGCGACGGATAAGGAGC CACTtgtaggctggagctgcttcg pabC construction cec127 CCAGCACAACCAACAGCAGAAGGAAAACGCCTGACAATTTTTTCA TAAcatatgaatatcctccttag pabC construction cec128 ACGGGCTTTATCCAGGTCG

PAGE 122

122 Table 4 4 Con tinued Primers Sequence Use cec129 GGGGCTGTTTTTGGGCAG cec130 TCGATGCTCAACCAGCGTTT cec131 TGCGTTGGATGCCTGTTCA cec132 TGGACCTCTTGCTGGCTGA cec133 CTGCGTGGCGTAAGGCTC STM1391 construction cec134 TCCCCCTGTGGCGTGAAT cec135 CCTGGCTATTGCTGGCGG cec136 ACGGCAATACCCAGCACA pabC construction cec137 TACTGGAGGCGGATAAGCG yggB construction cec138 CGGAGAGCGGCGTTAGTTA yggB constructi on cec139 GCGTAATATACGCCGCCTTGCAGTCACAGTATGGTCATTTCTTAA CTCtgtaggctggagctgcttcg yhdG construction cec140 GAATTTACGCGTTGTTCGAACATAGTTCTGTCAGCTCTTTATTTCT GTcatatgaatatcctccttag yhdG construction cec141 TACGCCGCCTTGCAGTC yhdG construction cec142 AGCAGCAC GGGTCTGGTT yhdG construction cec143 TATACCGTGAAACTTGTCTTTTAGCCCAATATTAAGGCAGGTTCT GAAtgtaggctggagctgcttcg cec144 CATTGCGCCTTCGGGAACCCACAGGACCAGCTATTTTACCGATA GTGTcatatgaatatcctccttag

PAGE 123

123 Table 4 5 Oyster active promoter s identified by the promoter probe library screen. White arrows indicate the probe location, black arrows indicate selected targets. Genes down regulated r egulated on oyster homogenate are indicated

PAGE 124

124 Figure 4 1. Construction of RIVET repo rters. A) Integration of the suicide plasmid pGOA1193 by double crossover generate d a tnpR lacZY ampR fusion to the targeted promoter region and reconstitute d the full targeted gene downstream of the plasmid integration si red method utilized the FRT scar generated by Wanner Datsenko mutagenesis to integrate the suicide plasmid pCE70 or pCE71, depending on the orientation of the FRT scar, just downstream of the stop codon of the target gene creating a tnpR lacZY kanR fusion to the upstream gene of interest. In either construction method perception of the promoter signal drives expression of the tnpR resolvase which induces recombination between the RES sites, removing the associated antibiotic resistance cassette (tetracycline resistance in JS246). The antibiotic sensitivity is also inherited by subsequent daughter cells.

PAGE 125

125 Figure 4 2. FACS sorts of a gfp labeled Salmonella promoter probe library in live oysters and relevant controls. A) Un infected control oys ter. B) gfp gfp gate P1. D) Initial screen of the Oys+) saved and used for 2 nd screen 25,000 cells were recovered. E) Sec ond screen in live oysters. P1 saved 2 50,000 cell recovered (LB Oys++) F) Third screen in live oysters. P1 and P3 saved 150,000 cells recovered (LB ,OYS+++). Aliquots were then plated on LB agar plates. Only opaque (non green) colonies were saved aft er overnight growth. Resulting 576 colonies are LB Oys+++, LB G) Sample distribution of cells recovered in F showing the

PAGE 126

126 Figure 4 3. Percen t resolution of RIVET repor ters Oys = infection of live oysters. OA = Oyster agar plates. LB = 1.5% agar plates. ASW = 0.3% agar strength artificial seawater plates. All experiments performed in triplicate. Bars represent standard error. A) pabC B) dkgA C) glk D) qor E) udp F) phsA G) yhdG H) csiE I) STM4596 J) rfaZ K) dppA L) yggB M) pagN N) yjfO O) ssrB P) STM1147 Q) yibL R) yihX

PAGE 127

127 Figure 4 3 Continued

PAGE 128

128 Figure 4 3 Continued

PAGE 129

129 Figure 4 4. Competitiv e co infections of selected defined mutants vs. wild type S. enterica 14028 in live oysters. log CI (competive index) was calculated using E quation 4 1. The res tet res insertion in JS246 does not affect competitive fitness and was used as a control. Box p lots present the 10%, 25%, 75% and 90% quantiles as well as the media n. Points outside the whiskers we re treated as outliers. Diamonds represent the group mean as well as 95 % t test was used to test for significance at p<0.0 5. Only the competitive fitness of the ssrB mutant wa s significantly different (less competitive) than wild type Salmonella mutants.

PAGE 130

130 Figure 4 5. 24 hour Infection of oyster hemocytes with gfp labeled S enterica 14028 wild type and MJW129 ssrB ::cm mutant. A) 14028 WT control. B) 14028 pGFP ON control. C) ssrB pGFP ON control. D & G ) Hemolymph of un infected oyster control. E & H ) 24 hour oyster infection with 14028 pGFP ON. F & I ) 24 hour oyster infection with ssrB pGFP ON. All experiments repeated at least 4 times. Results shown are representative samples fsc = forward scatter, ssc = side scatt er, FL1 = fluorescence intensity, count = numbe of cells counted during FACS.

PAGE 131

131 Figure 4 6 2 hour Infection of oyster hemocytes with gfp labeled S enterica 14028 wild type and MJW129 ssrB::cm mutant. A B ) Population distributions of 14028 pGFP ON. C D ) Bright field and gfp image of a 14028 pGFP ON colonized hemocyte. E F ) Population distributions of ssrB :: cm pGFP ON. G H ) Bright field and gfp image of a ssrB pGFP ON colonized hemocyte. All experiments repeated at least 4 times. Results shown are repres entative samples P Q

PAGE 132

132 CHAPTER 5 THE ROLE OF QUORUM S ENSING DURING THE ES TABLISHMENT OF SALMONELLA ENTERICA SV. TYPHIMURIUM WITH IN THE NATIVE MICROB IOTA OF THE EASTERN OYSTE R, CRASSOSTREA VIRGINIC A Introduction Quorum sensing (QS) is a mechanism of populati on density dependent signaling and gene regulation within a community of unicellular organisms. QS dependent changes in gene expression are effected once a certain population density is reached within a diffusion limited environment. Bacteria are thought t o be able to sense a certain threshold differential between extra and intra cellular concentrations of excreted and/or diffusible signal molecules. The majority of signaling serves as inter species communication within a population but can also facilitate inter kingdom signaling microbiota has been shown as a way for invading bacteria to gain an advantage when colonizing a new host (15) Marine surfaces are heavily co lonized with microbes and quorum sensing is quite common in marine bacteria (90) Studies of oyster associated microbiota have consistently shown vibrios, along with pseudomonads, as the most common culturable genera, ( Table 5 1 ) (27, 68, 76, 135, 142, 149, 150, 173, 221, 247, 256, 314) The three most commercially exploited oyster species the Pacific oyster ( Crassostrea gigas ), the Eastern oyster, ( C. virginica ) and the European flat oyster ( Ostrea edulis ), are all know n to concentrate vibrios from the surrounding seawater (173, 244, 247, 340) Vibrio vulnificus has a slower transit time through the oyster gut than most other bacteria allowing cells to accumulate faster than they are shed and reach h igh population densities within the hindgut (53, 68, 150, 173, 244) Because of this potentially commensal relationship and its pathogenicity

PAGE 133

133 towards humans, V. vulnificus is the most well known and studie d oyster associated bacterium. More recent studies utilizing sequence based approaches have confirmed the high prevalence of Vibrio spp. while also identifying a high diversity of non culturable species (108, 149, 260) The most widely studied QS signals are a family of related molecules, known as N Acyl homoserine lactones (AHLs), whi ch are used by many different species of bacteria. Salmonella, E.coli and Klebsiella are unable to produce their own AHLs but are able to sense those produced by other species via the receptor encoded by sdiA (280) The ability of SdiA to sense signals during colonization is dependent on host conditions ; sdiA is active during transit throug h turtles and mice infected with Yersinia enterocolitica but not healthy mice, 4 other mammals, chickens or tomatoes (99, 229, 280) It remains unknown if AHLs are produced a s a normal part of the oyster m icrobiome but it seems likely since most vibrios and pseudomonads, as well as less prevelant member s such as the Cytophaga Flavobacterium Bacteroides group can produce AHLs (261) Like Salmonella V. vulnifucus is also unable to produce AHLs. Instead, both possess a functional signaling system based on Autoinducer 2 (AI 2) which forms spontaneously from 4,5 dihydroxy 2,3 pentanedione (DPD) a product of the S Adenosyl methionine (SAM) degradation pathway catalyzed by LuxS. AI 2 was initially luxS is widespread across families of gra m positive and gram negative bacteria. DPD is known to exist in two forms, a furanosyl borate diester recognized by vibrios and a non bromated form recognized by

PAGE 134

134 Salmonella (212) The molecules both form spontaneously from DPD and appear to exist in equilibrium depending on the concentration of boron In V. vulnificus, the AI 2 signa l is received by LuxP/Q, which then dephosphorylates and inactivates LuxO, eliminating expression of five small regulatory RNAs. In the absence of the sRNAs, SmcR, a LuxR homologue, mRNA is stabilized allowing activation of ta rget genes. Both protease prod uction and biofilm production are regulated by AI 2 via SmcR and are known virulence factors. Also, a luxS mut ation reduces survival, but not LD 50 in mice (136, 200, 276) Although the effect of AI 2 signaling on persistence in oysters is not known increased virulence of vibrios has been correl ated with increased survival in bivalves (237) In the studied bacterial systems, ther e is a documented diversity of mechanisms for detection o f AI 2 therefore it is not surprising that the canonical AI 2 receptors (found in vibrios) do not have h omologues in other bacteria. In Salmonella and E. coli AI 2 is detected by the lsrACDBFG operon which encodes an ABC transport system. It is the only known target of AI 2 in Salmonella and its only known function is the uptake and processing of AI 2. (296) LsrB bind s AI 2 which is then transported through a transmembrane channel formed by LsrA, LsrC and LsrD. Once inside the cell, LsrK phosphorylates AI 2 and binds to LsrR relieving repression of the lsrACDBFG operon. The known regulon of the LsrR repressor is limite d to the lsr operon and pyrL which is involved in pyrimidine synthesis (309) LsrG and LsrF play a role in the process ing and degradation of accumulated AI 2 signal (194, 298, 342) There is evidence t hat AI 2 may regulate phenotypes such as biofilm formation and motility in E. coli via the interaction of LsrK with mqsR which is a regulato r of

PAGE 135

135 QseB/C (127) In Salmonella luxS mutants show a reduction in the establishment of biofilm, flagellar motility and virulence in mice (63, 156, 163, 245) luxS mutations have been tie d to a number of phenotypes and large regulons, however, few of the luxS regulated genes are responsive to AI 2 (156, 164, 334) Because LuxS catalyzes production of AI 2 via degradation of toxic intermediates in the activated methyl cycle (AMC), it is difficult to remove the metabolic effects of luxS mutation from those specifically associated with AI 2 signaling (141 162, 315) Interestingly, both Sinorhizobium meliloti and Pseudomonas aeruginosa which lack luxS and do not produce AI 2 are able to detect and respond to AI 2 signals produced by other bacteria. S. meliloti perceives AI 2 via lsr operon homologues wh ich it may employ to disrupt the AI 2 signaling of phytopathogens (240) T he reception mechanism in P. aeruginosa remains unknown (94, 95) Pseudomonads are known for utilizing a diverse array of quorum sensing systems often with complex layers of control (317) P. aeruginosa has two AHL receptor systems, LasR/I and RhlR/I with overlapping regulatory roles. Typically they are arranged in a hierarchical structure with LasR/I feeding into RhlR/I, however, the exact regulatory mechanisms are hi ghly reliant on environmental conditions (95) AHL mutations in pseudomonads decrease persistence related phenotypes such as biofilm f ormation, extracellular enzymes, siderophore production and reduce vir ulence in a variety of hosts including non vertebrates (159, 249) Interaction with pseudomonads may be important for host colonization as several environmental strains produce antibiotic compounds with demonstrated activity against Salmonella and a variety of virulent vibrios (64, 124, 198, 308)

PAGE 136

136 Bacteria also rely on two component regulators to sense their external environment and alter gene e xpression acc ordingly. Some two component regulators, such as GacS/G acA can respond in a population dependent manner and may modulate AHL activity based on environmental signals (159, 31 7, 318) Orthologs of the GacS/GacA (BarA/SirA in Salmonella ) two component regulatory system and the members of the GacS/GacA regulon are universally required for biofilm for mation in all proteobacteria and is responsible for regulation of virulence fa ctors in both pseudomonads and Salmonella (181, 303) In Salmonella BarA/SirA is also known to regulate virulence genes on SPI I, IV and V, motility, surface attachment and specific metabolic changes in response to host adaptation (5 182, 300, 301, 303) The potential role of signaling in structuring oyster associated microbial communities has not been examined. Signal exchange is common in the marine environment, especially during colonization of new surfaces. Because filter fee ding bivalves concentrate bacteria from the surrounding seawater and many of the species have overlapping QS capabilities signal exchange seems likely. This study examine d the ability of Salmonella to detect and benefit from QS signals during the coloniz ation of oysters. Materials and Methods Bacterial Strains and Culture Salmonella in Luria broth (LB) with antibiotics as necessary Antibiotics were used at the following concentrations; ampicillin (200 g/mL), kanamycin (50 g/mL) and tetracycline (10 g/mL). All strains used in this study are listed in Ta ble 5 1. Oyster Agar (OA) was prepared using a modified protocol (1, 2) Aseptically shucked oysters meats were blended in a volume of sterile 1/2 strength

PAGE 137

137 artificial seawater (ASW) twice the total mass of the oysters and extracted by boiling for 30 minutes. The resulting broth was filtered throu gh mesh screens and 11m cellulose filter paper under vacuum (Whatman #1, GE) to remove coagulated proteins and debris. The filtrate was brought up to the original volume with de ionized water (DI H 2 O), 1.5% agar was added and the medium was autoclaved. strength artificial seawater was prepared from commercial aquarium salts in distilled water at a concentration of 16 ppt (either 15.23 g/L of Instant Ocean, Aquarium Systems Inc., Mentor, Ohio or 17.47 g/L of Coral Pro Salt, Red Sea, Eilat, Israel salt mix es were used depending on availability from local suppliers) Recovered samples were plated on Xylose Lysine Deoxycholate agar (XLD) with antibiotics as necessary for the identification of Salmonella Oyster Maintenance Eastern oysters ( Crassostrea virgin ica ) were obtained from commercial sources in Apalachicola Bay or Cedar Key, Florida and transported to Gainesville in coolers. Upon receipt, oysters were scrubbed under running tap water to remove mud and debris and acclimated in strength artificial sea water (16 ppt) at filtered (Whisper 10i, Tetra) and aerated to maintain water quality. Prior to use in assays, oysters were removed from the acclimation tank and rinsed under distilled water. Assays were performed in polystyre ne bins with 5L of strength artificial hours before harvest. Construction of QS System RIVET Reporters In order to determine the relevance of AI 2 signaling to Salmon ella colonization in vivo an lsrG tnpR RIVET reporter was constructed using the method of Osorio et al. (233) The lsrACDBFG operon is controlled by a single promoter upstream of lsrA As

PAGE 138

138 the last gene in the lsr operon, the lsrG::tnpR reporter should record a ll activity driven via the lsr operon promoter, P lsrA with minimal disruption to the operon. Additionally, microarray evidence from E. coli shows lsrG is highly activated by luxS in stationary phase suggesting the locus is an ideal location for a reporte r (325) An lsrG fragment was amplified from S. enterica sv. Typhimurium 14028 genomic DNA using primers cec045 and cec046. The fragment spans the 4,288,872 4,289,347 region of the S. enterica sv. Typhimurium LT 2 chromosome. This region encompasses a segment of DNA from 234 b ase p airs upstream (located in lsrF ) to the first 241 b ase p airs of lsrG The fragment ends 24 base pairs upstream of the putative location of the lsr operon transcriptional terminator as in ferred by homology to E. coli This fusion should allow transcription to read through the entire operon and into tnpR Strain CEC0015 was constructed by electroporating the suicide plasmid pGOA1193, containing the lsrG fragment cloned ahead of promoter le ss tnpR into JS246. The integration of pGOA1193 into the chromosome generated an lsrG :: tnpR fusion along with the duplication of an intact lsrG approximately 7,000 bp downstream (see Figure 4 luxS ::FRT k anR FRT from MM_019 C10 into CEC0015 via P22. The luxS mutation rendered CEC0018 unable to produce its own AI 2 making expression of the lsrG tnpR dependent on extra cellular signaling. Strain CEC0026 was constructed to ensure conditions associated with oyster colonization did not inhibit the activity of luxS Using primers cec111 and cec112 the region of luxS between the start and stop codons in the RIVET host JS246 was replaced with FRT kanR luxS ::FRT kanR FRT cassette was removed by flp

PAGE 139

139 FRT homologous recombination using plasmid pCP20. The resulting FRT scar was utilized as an integration site for the suicide plasmids pCE70/71 which contain s a promoterless tnpR lacZ kanR cassette j ust downstream of a FRT site. The plasmids differ ed only in the orientation of the FRT site as the flp FRT recombination used to remove the original FRT kanR FRT insertion could leave a FRT scar in either o rientation. The final reporter wa s P luxS tnpR lacZ kanR and lacks LuxS. Several reports identify QseB/C as a third quorum sensing system in E. coli and Salmonella however, the exact function of the system is still contentious (127, 164, 203, 218, 322) The system responds to the hormones epinephrine and norepinephrine and an as yet unidentified AI 3 auto inducer signal in E. coli The system may also be regulated indirectly by AI 2/ luxS via mqsR luxS induced metabolic changes. Strain CEC0024 was cons tructed by inserting FRT kanR FRT into JS246 just down stream of the stop codon of qseC to avoid interrupting the operon. The tnpR lacZY kanR cassette was then inserted in the same manner as fo r CEC0026. Strain CEC0025 was constructed by transducing the qseC tnpR lacZY kanR cassette from CEC0024 luxS :: FRT prescursor used to construct CEC0026. The transduction was confirmed by antibiotic resistance and with primers that bind upstream of the qseC stop codon (cec104) and in tnpR (MT59). Activity of QS Related Promoters in Live Oysters Measured via RIVET Assays Recombinase based In Vivo Expression Technology (RIVET) reporters utilize a heritable antibiotic sensitive phenotype wh ich can record low levels of gene expression or signals which may occur only transiently during host colonization As such, they have been shown to provide sensitive quantification of gene expression during Salmonella colonization of host environments (202) Single oysters were inoculated with1 mL of

PAGE 140

140 washed overnight culture. The Salmonella reporters were recovered by bl ending as before and then plating the homogenate reporters. Fifty colonies were patched from the recovery plate onto LB tetracycline at 37 As a control for the specificity of resolution to oyster colonization 10 L of the used as a control for reporters which may be activated by growth on solid media or at ced by growth using oysters as a nutrient source instead of interacting with the live host. strength artificial seawater soft agar (1/2 ASW) was used as a control for regulatory changes specific to starvation and desiccation induced by estuarine conditi ons. Samples were recovered with a sterile wire loop directly from the plates after 24 hours and analyzed in the same manner as the oyster samples. Response of the lsrG tnpR Reporter to Exogenous AI 2 T o test for the perception of AI 2 by the lsrG tnpR rep orter, both the lacZ activity and resolution of strain CEC0018 ( lsrG tnpR lacZY luxS ) was determined in response to synthetic AI 2 and Salmonella cell free supernatant (CFS). Strain CEC0015 ( lsrG tnpR lacZY wild type luxS ) was used as a positive control f or natural expression levels. CFS was obtained from wild type 14028 subcultures grown to an OD 600 of approximately 1, which typically took 3.5 centrifug ation for 15 minutes at 10,000 X g passed through 0.22 m filters and stored at unive rsal AI 2 precursor, was purchased from OMM scientific (Dallas, TX ) DPD was supplied in a 3.7 mM stock solution and stored at

PAGE 141

141 Prior to assays, overnight cultures of the reporters were started from glycerol stocks in LB with antibiotics. Cells were washed to remove tetracycline and diluted 1/100 into fresh LB without antibiotics. Cultures were amended with 1% or 10% (v/v) CFS prior to inoculation. DPD was used at a final concentration of 10 M and added to the medium just prior to the ass ay or after 2 hours of growth. Assays were perfor med at lacZ and at 24 hours for analysis of tnpR resolution. lacZ activity was determined using a modified Miller assay based on the adapted 9 6 well protocol of Griffith and Wo lf (132, 211) Briefly, a 50 L aliquot of the culture was added to 150 L of dist illed water in a polystyrene 96 well plate and the OD 600 recorded. Another 50 L aliquot was added to 500 L of Z buffer with 0.1% SDS (sodium dodecyl sulfate) in a 2.2 mL deep well polypropylene 96 well block. Cells were then permeabilized by a dding 20 L of chloroform and aspirating 10 times via pipette. The resulting suspension was allowed to settle for at least 30 minutes. 100 L of supernatant was then transferred to a fresh 96 galactosidase reaction was ONPG (ortho Nitrophenyl galacto the reaction was sto pped by adding 50 L of 1M NaCO 3 to each well. The absorbance at 405 nm was recorded using a multi mode microtiter plate reader (Victor 3 Perkin Elmer, Fremont, CA), equipped with Wallac1420 Manager Work station software. Modified mill er units were calcula ted using E quation 5 1 : (5 1)

PAGE 142

142 At 24 hours an aliquot of the culture was streaked onto XLD using a sterile wire loop. RIVET resolution was then quantified as above. Expression of sdiA tnpR in response to NaCl concentration In order to test the effect of salt concentration on the expression of sdiA tnpR LB (10 g tryptone, 5 g yeast extract / L) was prepared with NaCl concentrations of 0.5 M (2.922 g/L), 0. 1 M (5.844 g/L), 0.25 M (14.61 g/L and 0.5 M (29.22 g/L) either as a liquid broth, soft agar (0.3% w/v) or solid agar (1.5% w/v). Overnight cultures were grown in standard LB Lennox broth (5g NaCl / L) with antibiotics from glycerol stock. Prior to assays cells were washed to remove tetracycline. Soft agar overlay plates were prepared by first allowing 10 mL of solid LB agar to solidify in a petri plate and then overlaying 7 mL of soft agar. The prepared plates were inoculated with 10 L of reporter cultur e via stab into the soft agar. For liquid cultur e assays 5 mL of fresh LB broth was inoculated with a 1/10,000 dilution of washed reporter culture. All assays were quantified as above. Fitness Phenotype as Determined b y Competitive Co Infection of Deletion Mutants in Live Oysters Red recombinase method described by Datsenko and Wanner (81) The mutations were confirmed via PCR and transduced into a fresh 14028 background using the P22 phage. To check for possible growth defects which could affect the co infections gro wth curves were measured for each mutant. Cultures of each strain were grown to stationary phase from glycerol stock. Cells were washed to remove antibiotics and

PAGE 143

143 hours respectively. Each hour a 1 mL aliquot was removed from the culture and the OD 600 recorded using a spectrophotometer (Biospec mini, Shimadzu) The in vivo competitive fitness of each strain versus wild type was determined by calculating a competitive ind ex as described previously (229) Briefly, three oysters per bin were inoculated with a roug hly 50:50 mix of mutant to wild type prepared from 1/100 dilutions of overnight cultures. After 24 hours, indiivudal oysters were harvested by stomaching in Whirl Pak bag s (Nasco, Fort Atkinson, WI) with 50 mL of PBS in a Stomacher 4000 Circulator (Seward, West Sussex, UK) at 260 rpm for 1 minute. The A 1,000 fold dilution of the original inoculum was plated on XLD to determine the initial mutan t to wild type ratio. Fifty individual colonies were patched from XLD to LB kanamycin and the numbers of mutants determined by counting the number of kanamycin resistant colonies. Shifts in the mutant to wild type ratio between the inoculum and recovered samples were used to calcula te a competitive index (CI) according to Equation 4 1: (4 1) where M is the number of mutant cells and WT is the number of the wild type cells in the inoculum (in) or in the recovered samples (out). The CI values were log transformed to allow even comparison between increases and decreases in competitive fitness. test, which is more conservative than individual pair wise t tests. Co infections between 14028 and JS246, which contains a neutral tetracycline resistance marker, were used as the control.

PAGE 144

144 Confirmation of AI 2 Production via the Vibrio harveyi LUX Assay The production of AI 2 by the S. enterica and P. carotovorum strains used in this study was confirmed using the V. harveyi BB170 reporter, as pre viously described (23, 297) Overnight cultures of th e strains were washed 3 times in PBS and diluted 1/100 into fresh LB without antibiotics. Cell free supernatants (CFS) were harvested 4 hours after sub culture. 1 mL of sub subculture was centrifuged at 13,000 x g for 1 min to pellet cells and the resultin g supernatant was sterilized by passing through a 0.22 m filter. Recovered CFS was stored at Results Confirmation of the lsrG tnpR Reporter In the absence of luxS the lsrG tnpR reporter wa s almost completely non expressed (Figure 5 1). This wa s expected as the luxS mutant is completely deficient in AI 2 production. The small amount of resolution observed for CEC0018 (less than 5% in all samples) wa s likely due to leaky repression by lsrR which is desirable to maintain a basal expression of the lsr operon. In the wild type luxS background the reporter wa s only moderately active, with resolution typically around 45% +/ 10%. Previou s reports indicate the lsr operon genes are strongly up regulated in late exponential phase growth and higher res olution was expected. lacZ activity show ed a similar trend. The wild type reporter wa s induced approximately 2 fold compared to the luxS mutant, which is slightly below the 3 4 fold induction of previously reported MET708 based reporters (296, 298) The ability of the reporter to recognize exogenous signaling was tested by culturing the CEC0018 reporter in the presence of wild type Salmonella CFS or 10 M of synthetic DPD, a concentration that is sufficient to activate previously reported lsr

PAGE 145

145 operon reporters (163, 212) DPD induced a slight increase in lacZ activity compared to CEC0018 but was unable to rescue activity back to wild type levels in contrast to other studies (163, 298) Interestingly, adding DPD 2 hours into the incubation, when AI 2 activity in t he supernatant is typically at its lowest, produced a stronger effect indicating some degradation of AI 2 may occur in the first 2 hours Despite the increased lacZ activity, the small increase in tnpR resolution from 1% to 4% was still 1/10 of resolution in the wild type reporter. The addition of CFS at 1% or 10% did not affect lacZ or tnpR activity. Activity of QS Systems during Colonization of Oysters Expression of the RIVET reporters during a 24 hour colonization of oysters was compared to growth on co ntrol agar s 2 ). sdiA was moderately active may repress sdiA srgE is one of two known targets of SdiA in Salmonella and was used to determine if activation of sdiA (presumably by AHLs) could drive downstream expression via SdiA. The resolution profile of srgE wa s similar to that of sdiA in the wild type bac kground and was eliminated in an sdiA mutant background as expected. Alt h ough srgE was inactive in live oysters it wa s not possible to conclude if this is due to lack of AHL signal perception or repression of sdiA by environmental conditions. The luxS promoter wa s constitutively active o n LB agar A slight decrease in luxS activity was noted in live oysters and on oyster agar (Figure 5 3) This could be due to a relatively inactive metabol ic state under these less permissive growth conditions, however, the reduction is not significant. lsrG respond ed in a luxS dependent manner in all treatments. lsrG wa s most active on LB and was resolved at a similarly lower level in live oysters as compared to oyster agar and ASW. The consistent redu ction across

PAGE 146

146 the media indicated that lsrG wa s likely responding to nutritive changes instead of biotic interactions within oysters. csrB wa s constitutively active which is not surprising given its global regulatory role (Figure 5 4 ). qseC appears inactive under all co nditions indicating conditions for signal ing was not present in live oysters. Fitness Phenotypes Associated with QS du ring Oyster Colonization Competitive co infections between wild type S. enterica sv. Typhimurium 14028 and mutants in all three QS systems were used to more thoroughly examine the potential contribution of signal exchange to oyster colonization. Prior to in vivo infections growth curves were established to search for slow growing strains which could artificially bias results (Figure 5 5 ). All of the defined QS mutants grew simila rly to 14028 except for BA612 ( sdiA ) which was growth impaired. To account f or the growth defect the initial co infection inoculums for BA612 were made using a 5:1 mixture with wild type instead of the typical 1:1 mix. Of all the strains tested, only the sdiA mutant demonstrated a competitive phenotype in oysters and was found to be more fit than wild type (Figure 5 6 in vitro and the inactivity of the sdiA tnpR reporter in oysters. Because the mutant is signal blind, the i ncrease in competitive fitness wa s not signaling occurring between oyster associated bacteria. Effect of Environmental Conditions on sdiA Activity To determine if environmental conditions were interfering with the activity of sdiA expression of the sdiA tnpR repo rter was determined in LB with varying salt (Figure 5 7 ). Surprisingly, sdiA showed activation by high NaCl concentrations and wa s repressed by growth at 37 temperature wa s opposite previous reports which sh ow a lack of srgE expression at 22

PAGE 147

147 (281) However, the result wa s conserved between the independent soft agar and liquid culture experiments. The respon se to NaCl in liquid media peaked around the salinity associated with ve rteb rate body fluids. The response wa s stronger on soft agar plates and resolution increased almost linearly with NaCl concentration. The highest concentration tested, 0.5 M, is approximately the salinity of seawater. Discussion Although QS is widely asso ciated with surface colonization and inter species interactions in the marine environment the current screen failed to identify any relevant signal exchange in Salmonella three known QS systems. Although the presence of these systems in Salmonella is wel l known, examples of signal exchange leading to relevant phenotypes during host colonization are rare. Competitive co infection s between the sdiA +/ srgE tnpR reporters (JNS3206 and JNS3226) in 7 dif ferent animal species show low rates of srgE tnpR activi ty and only demonstrate a competitive fitness phenotype in 2 species (280) In terestin gly, the strain which i s more fit differs between the species. The sdiA mutant i s more competitive in chicks but less competitive in turtles, where the effect did not appear until day 14 of the infection. However, the authors consider CI values below 3 to be biologically non significant. Neit her of the species, chickens or turtles, me e t the threshold. In the current study the average CI for the ssrB mutant wa s 2.24 5, short of the value considered to be biologically relevant. Aeromonas hydrophilia isolated from the turtles i s able to activate expression of srgE in an sdiA dependent manner suggesting detection of AHLs is possible in the digestive tract and may become important during long term survival. sdiA also detect s AHLs from Yersinia enterocolitica in mice but does not a ffect competitive fitness over a

PAGE 148

148 27 day infection (99) A study of AHL mediated signaling between Salmonella and Pectobacterium carotovorum f ound that cross communication i s possible in vitro but that sdiA i s not expressed in the a cidic environment of tomato fruits Also, an sdiA mutant h as no fitness phenotype in P. carotovorum soft rotted tomatoes (229) Taken together with the results of this study, the potential role of sdiA seems to be very context dependent. It remains unclear how an sdiA mutation could affect competitive fitn ess when the RIVET data suggest sdiA wa s not expressed in oysters. The SdiA regulon in Salmonella is only known to include srgE and the rck operon. The function of srgE is unknown. The rck operon encodes resistance to complement killing and enables cellular invasion via a non functions of rck appear to be mediat ed by cell surface properties (262, 280) Regulation of both loci appears to be sensitive to environmental conditions with both increasingly active as agar concentration decreases in solid media. Rck activity does not respond to AHLs while srgE activ ity only respo nds specifically to AHLs above (281) In the present study sdiA activity strongly responded to bo t h temperature and NaCl concentration on 0.3% soft agar and in liquid culture. The reporter was also les as compared to solid LB agar indicating nutrient conditions affect sdiA regulation as well. In the current study AI 2 signaling was not linked to expression of an lsr operon reporter or competitive fit ness. Neither an lsrACDBF mutant, luxS mutant nor double mutant was impaired during colonization of live oysters, indicating neither production nor reception of the signal is important. Also, the RIVET reporter constructed in this study did not respond str ongly to synthetic DPD.

PAGE 149

149 The clear difference in activity between the two Salmonella reporters shows a strong response of the lsrG reporter to the presence of luxS Typically, once the lsr operon is induced, Salmonella rapidly removes AI 2 from the extrace llular environment. Deletion of luxS can slow this response by 50%, although the mechanism for this is unknown (107, 296) It is possible that intra cellular, and not external, concentrations of AI 2 are the primary driving force behind lsr operon activation. Thus, a luxS mutant may be delayed in increasing intra cellular concentrations of AI 2 su fficient to overcome repression by lsrR and activate the lsr operon. Although it remains a possibility, it seems unlikely that mutant construction impaired the response to AI 2. The strains CEC0015 and CEC0018 are isogenic and it is unlikely the transducti luxS via P22 would have interfered with the lsr operon. Despite reconstituting a downstream copy, the integration of pGOA1193 into lsrG could have reduced or eliminated its activity. However, LsrG is known to degrad e AI 2 signal and lsrFG mutants ar e known to increase the response of P lsrA reporters to AI 2 (194, 298) Unintended polar effects resulting from integration of the suicide plasmid, such as the introduction of bla near the downstream end of the integration, could increase lsrG activity causing increased signa l degradation. However, no difference in extracellular AI 2 concentrations, as measured by V. harveyi BB170, were observed between 14028 and CE0015 making increased signal degradation unlikely (Figure 5 8 ). Existing lsr operon reporters are based on a du plicate copy of P lsrA MET708 and its derivatives have a chromosomal P lsrA lacZ fusion inserted into a neutral locus (PutRA) (298) The LUX plasmid reporters, pLSR and pCMPG5638, consist of P lsrA cloned upstream of a promoter less luxCDABE cassette on the low copy number

PAGE 150

150 plasmid pCS26 ( luxCDABE kanR pSC101 ) (163, 167) Because the activ ity of these reporters has to be measured soon after removal from an assay to produce meaningful results they are not suitable for in vivo studies of oyster colonization as Salmonella must be recovered on selective media. The use of RIVET reporters allowed promoter expression under biologically relevant conditions. Unlike the previous reporters the lsrG tnpR lacZY is under control of the native P lsrA which should ma ke its activity more biologically relevant. The lsrR repressor and lsr operon are adjacent on the chromosome and driven by a divergent promoter. By adding a second copy of P lsrA in a non native location the previously constructed AI 2 reporters may have in advertently altered the activity of P lsrA By removing repressor activity, lsrR mutants are known to cause hyper expression of lsr operon reporters (298) Because the lsrG tnpR reporter relies on a single copy of P lsrA in its native location it may be inherently less sensitive to AI 2 signals. However, lacZ activity d id show a small response to extra cellular AI 2 signal. Because lacZ activity is measured via an enzymatic assay it can detect small incremental changes in enzyme activity. RIVET assays rely on tnpR mediated recombination of the res tet res cassette. A cer tain threshold concentration of tnpR within the cell is required for resolvase activity. In instances were a promoter is only weakly expressed the threshold may not be achieved during the assay and only low levels of reporter resolution will be recorded. T he weak resolution of the reporter, CEC0018, in response to synthetic DPD, the universal AI 2 precursor, supports the view that extracellular AI 2 may have a less significant role in driving lsr operon expression

PAGE 151

151 than originally believed. However, because of the strong differences in activity between the wild type and mutant luxS background the reporters were included in screens of live oysters. Although microarray evidence from E. coli suggests that lsrG is a highly active locus, more recent Salmonella mi croarray data shows that while lsrG activity responds to the presence of luxS it responds just as strongly to growth phase and nutrient conditions (156, 325) Differential regulat ion occurs in 13, 16, 60 or 547 genes between wild type Salmonella and a luxS mutant depending on growth phase and the presence or absence of glucose (156) Also, although the lsr operon genes are generally up regulated, lsrG is down regulated in respon se to the addition of CFS. V ery few of the genes differently regulated in luxS mutants are rescued by supplying exogenous AI 2; supporting a primarily metabolic role for luxS (156, 334) Of the 43 genes reported to respond to a luxS mutant and the addition of exogenous AI 2 (via Salmonella CFS), the majority (31) of the genes are more responsive to luxS Interestingly, of the 12 which respond more strongly to CFS, all were cell surface proteins associated with virulence and all were down regulated. However, the lack of significant differences in t he competitive fitness assays clearly showed that AI 2 mediated processes do not contribute to the colonization of live oysters. Also, a proteomic screen between wild type Salmonella and its luxS mutant shows only 12 proteins, with primarily housekeeping, global regulatory or central metabolic functions are differentially expressed providing further support for a limited AI 2 phenotype (284) This study also found no role for QseB/C, a two component regulator which may respond to epinephrin e/norepinephrine or a putative AI 3 in a concentration dependent

PAGE 152

152 manner (66) The inactivity of the qseC tnpR reporter indicate s signaling was not occurring under the tested conditions. The fitness of a qseC mutant was also not impaired showing QseB/C does not regulate pheno types relevant to colonization of live oysters. In vivo studies have shown decreased virulence of a qseC in mice and pigs associated with a decrease in motility (26, 218) However, recent whole genome profiling failed to detect significant regulation of motility genes or a response to host signals. However, it did confirm a regulatory role for QseB/C in virulence via regulation of S PI 1 and SPI 2 (203, 218) qseBC has been reported to be auto regulated by QseB, however, the lack of resolution suggests the conditions to move beyond basal expression were not present (67) Because of the association of epinephrine and norepinephrine with vertebrate hosts qseBC may not be active at environmental temperatures. The possibility of signal exchange between huma n pathogens and commensal microbiota continues to be of interest as food borne infections become increasingly associated with non traditional sources of infections. The majority of the work regarding QS function in E. coli and Salmonella has been driven by interest in the infectious process of vertebrate hosts, typically humans and livestock However, results continue to show the importance of environmental conditions on the ability for signal exchange. Although no biologically relevant effects of QS sensin g systems on the colonization of oysters were observed in this study the conditions under which signal exchange can take place in the environment deserve more attention.

PAGE 153

153 Table 5 1. Common cultu rable oyster associated bacteria Sources: A ) Colwell and Liston 1960. B) Vasconcelos and Lee 1972. C) Kueh and Chan 1985. D) Iida et al. 2000. E ) Cruz Rom ero et al. 2008. F) Murcehlano and Brown 1968. G) Hariharan et al. 1995. H ) Pujalte et al. 1999 Analysis by selective media and FISH. Percentages reported f or selected species only Species Location Proteobacteria Bacteroidetes Gram + Gamma Beta Actinobacter Vibrio Pseudo monas Acinetobacter / Moraxella Alteromonas / Pseudo Altermonas Achromo bacter / Alcaligenes Flavo bacterium / Cytophaga Micrococcus / Coryneforms C. gigas US Pacific NW A 52% 7% 17% 14% US Pacific NW B 38% 17% 27% 0% Hong Kong C 18% 49% 9% 4% 9% 8% Japan D 39% 6% 14% 14% 19% 6% Ireland E 45% 40% 2% 7% C. virginica New York F 25% 31% 18% 26% Canada G 34% 21% O. edulis Spain h 66% 0% 4% 1%

PAGE 154

154 Table 5 2. List of bacterial strains used in Chapter 5 Strain Genotype Source 14028 Wild type S. enterica serovar Typhimurium American Type Culture Collection JS246 14028 yje P8103:: res 1 tetAR res 1 Merig hi et. al. 2005 MM_019_C10 luxS ::FRT kanR FRT Santiviago et al. 2009 MM_073_D12 lsrACDBF ::FRT kanR FRT Santiviago et al. 2009 BA612 14028 sdiA:tn3 Ahmer et al. 1998 BA736 14028 sirA :: kanR Ahmer et al. 1999b JNS3206 JS246 srgE tnpR lacZY kanR Ahmer et al. 2007 JNS3 216 JS246 sdiA tnpR lacZY kanR Noel et al. 2010 JNS3226 JS246 srgE tnpR lacZY kanR sdiA::tn3 Ahmer et al.2007 JNS3236 JS246 csrB tnpR lacZY kanR unpublished CEC0015 JS246 lsrG::tnpR lacZY ampR This Study CEC0018 JS246 lsrG::tnpR lacZY luxS ::FRT kanR F RT ampR This Study CEC0024 JS246 qseC tnpR lacZY This Study CEC0025 JS246 qseC tnpR lacZY luxS This Study CEC0026 JS246 P luxS tnpR lacZY luxS ::FRT kanR FRT This Study CEC0030 qseC::FRT kanR FRT This Study CEC0034 lsrACDBF This Stu dy CEC0035 lsrACDBF luxS ::FRT kanR FRT This Study BB170 Vibrio harvei BB120 luxN ::Tn5 Bassler et al. 1994

PAGE 155

155 Table 5 3. List of plasmids used in Chapter 5 Plasmids Functions Source pCR2.1 TOPO general cloning vector (kanR, ampR) Invitro gen pGOA1193 pIVET5n with promoterless tnpR (ampR) Osorio et. al. 2005 pKD4 oriR6K bla rgnB FRT kanR FRT (kanR) Datsenko and Wanner 2000 pKD46 repA101ts oriR101 araC P araB exo) tL3 ) (ampR) Datsenko and Wanner 2000 pCP20 pR F lp ci857 ( ampR, kanR ) Cherepanov and Wackernagel 1995 pCE70 oriR6K FRT promoterless tnpR (kanR) Merighi et. al. 2005 pCE71 oriR6K FRT promoterless tnpR (kanR) Merighi et. al. 2005

PAGE 156

156 Table 5 4. List of primers used in Chapter 5 Primer Seq uence Use M13F GTAAAACGACGGCCAG pCR2.1 clone confirmation M13R CAGGAAACAGCTATGAC pCR2.1 clone confirmation MT59 CAAAAAGTCGCATAAAAATTTATCC RIVET confirmation cec045 CTCGAGAGGCGATTGACCAGGGGGCT construction of lsrG tnpR cec046 CTCTGAGGGTTCAAGCTGCTCCACGC A construction of lsrG tnpR cec047 TGCTGCTGCCGCACAGGTTT construction of lsrG tnpR cec050 TGCTAAAAACCCCATCGACCGGC construction of lsrG tnpR cec051 ATTGGCGGCACCGGGAAAGC construction of lsrG tnpR cec061 TTTGGCAACGCCGCGGAAGGTGGATTTGAGGCCGTAGTAAGTT GGTAATGTA GGCTGGAGCTGCTTCG qseC Red cec062 AATTAGCAAAATGTGCAAAGTCTTTTGCGTTTTTGGCAAAAGTCT CTGCATATGAATATCCTCCTTAG qseC Red cec104 ATTGAGGTCGCCGCCCGT qseC confirmation cec105 CGCCCATCCACCAGCCTG qseC confirmation cec111 GCCATAAACCGGGGTTAATTTAAATACTGGAACCGCTTACAA ATA AGAtgtaggctggagctgcttcg P luxS tnpR co n s truction cec112 GGAACAAAGAGTTCAGTTTATTTTTAAAAAATTATCGGAGGTGAC TAAcatatgaatatcctccttag P luxS tnpR co n s truction cec113 GAAGGCATTGGCGGCACC P luxS tnpR co n s truction

PAGE 157

157 Table 5 4. Continued Primer Sequence Use cec114 GGCTCGGCGGACTGGAC P luxS tnpR co n s truction cec115 ATTCTGGAGCGTGATGTGCG P luxS tnpR co n s truction cec122 CGAATTTATTCGCACCGTGCACGGCATCGGCTACACCCTGGGTG ACGCtgtaggctggagctgcttcg qseC

PAGE 158

158 Figure 5 1. Activity of the lsrG tnpR lacZY reporter in response to DPD. A) lacZY activity as measured by a modified M iller assay. Bars represent standard error of three biological replicates each consisting of 4 averaged technical replicate s. B) tnpR resolution determined after 24 hours. Bars represent three biological replicates measured with three technical replicates.

PAGE 159

159 Figure 5 2 R esolution of AHL related RIVET reporters tion of live oysters. OA = Oyster agar plates. LB = 1.5% agar plates. ASW = 0.3% agar strength artificial seawater plates. Experiments were performed in triplicate and b ars represent standard error A) JNS3216 ( sdiA tnpR) B) JNS3206 ( srgE tnpR sdiA +) C) JNS3226 ( srgE tnpR sdiA )

PAGE 160

160 Figure 5 3 Resolution of AI 2 related RIVET reporters live oysters. OA = Oyster agar plates. LB = 1.5% agar plates. ASW = 0.3% agar strength artificial seawater plates.Experiments were performed in triplicate and bars represent standa rd error. A) CEC0026 (P l uxS tnpR) B) CEC0015 ( lsrG tnpR luxS +) C) CEC0018 ( lsrG tnpR luxS )

PAGE 161

161 Figure 5 4 Resolution of two component regulator RIVET promoters during 24 Oys = infection of live oysters. OA = O yster agar plates. LB = 1.5% agar plates. ASW = 0.3% agar strength artificial seawater plates. Experiments were performed in triplicate and bars represent standard error. A) JNS3236 ( csrB tnpR) B) CEC0024 ( qseC tnpR luxS +) C) CEC0025 ( qseC tnpR luxS )

PAGE 162

162 Figure 5 5 Growth curves of QS mut Experiments were performed in triplicate and bars represent standard error. 0.00 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 0 1 2 3 4 5 6 7 8 9 10 11 12 OD 600 A 0.00 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00 2.25 0 1 2 3 4 5 6 7 8 OD 600 luxSlsrACDBFlsrACDBFluxSlsrGqseCsdiAsirA14028 B

PAGE 163

163 Figure 5 6 Competitive co infections of defined mutants vs. wild type S. enterica 14028 in live oysters. The res tet res insertion in JS246 did not affect competitive fitness and was used as a control. Box plots present the 10%, 25%, 75% and 90% quantiles as well as the media n. Points outside the whiskers we re treated as outliers. Diamonds represent the group mean as well as 9 5% confidence intervals. Dunnet t t test was used to test for significance at p<0.05; Only the sdiA mutant wa s significantly different (more competitive) than wild type Salmonella

PAGE 164

164 Figure 5 7 Percent resolution of an sdiA tnpR reporter in response to LB containing varying NaCl concentration s All experiments performed with three biological and three technical reps. Bars represent standard error.

PAGE 165

165 Figure 5 8 AI 2 activity in CFS. Luminescent activity of the V. harveyi BB170 reporter was assayed 3.5 hours after the initial inoculation of 90 L of BB170 with 10 L of CFS. Luminescence was measured in counts per second. Fold activation was calculated by dividing the luminescent activity of the CFS samples by the activity of the BB170 + LB only control. AI 2 activity in strain CEC0018 was very low, indicating the luxS mu tation essentially eliminated signal production. 0 250 500 750 1000 1250 1500 14028 CE0015 CEC0018 Fold activation of V. harveyi BB170

PAGE 166

166 CHAPTER 6 ANALYSIS OF SALMONELLA LUXS AND LSR OPERON MUTANTS REVEA L NO ROLE FOR AI 2 SIGNALING DURING C OLONIZATION OF TOMAT OES IN THE PRESENCE OR ABSENCE OF THE SOFT ROT PATHOGEN PECTOBACTERIUM CAROTOVORU M Introduction Salmonella contamination of produce is responsible for a n increasing number of foodborne outbreaks. Raw tomatoes are a prominent produce vector of salmonellosis and have been linked to at least 12 multi state outbreaks of salmonellosis since 1990 (10, 57) M arketing surveys and laboratory studies establish a clear link between the composition of p lant associated microbiota and Salmonella persistence on plants (21, 168, 330) Sal monella is able to integrate into multicellular consortia formed by epiphytes on leaf surfaces and benefits from mechanical damage induced by phytopathogens reaching higher densities when growing in bacterial lesions on fruit and leaves (21, 36, 38) Market produce with visual soft rot symptoms is twice as likely to harbor Salmonella and harbors the pathogen at levels over a log fold higher than asymptomatic or mechanically damaged produce (330) Studies in our lab using a Salmonella enterica Pectobacterium carotovorum co infection model have shown that the presence of P. carotovorum soft rot s increases S. enterica proliferation up to 3 log fold in green market tomatoes (229) Although the beneficial association between human enteric pathogens and phytobacteria i s well established and may ultimately determine the safety of fresh produce the mechanisms governing these interactions are currently unknown. It is hypothesized that human enteric pathogens specifically benefit from the plant polymer degradative abiliti es of pectinolytic bacteria, such as P. carotovorum whic h are normal members of produce associated microbial communities, to gain access to

PAGE 167

167 protected environments and/or increased availability of nutrients (35, 114, 255, 328, 330) On lettuce, E. coli O1 57:H7 preferentially colonizes damaged surfaces and reaches a 27 fold higher population size when grown on leaves infected with Dickeya dadantii (formerly Erwinia chrysanthemi ) 3937 (36) Production of extracellular pectate lysases (PEL) by D. dadantii is solel y respon sible for the commensal benefit. E. coli O157:H7 gr own on leaves infected with a D. dadantii outC muta n t deficient in PEL export reached popul ation sizes indistinguishable from those on leaves infected with E. coli only (343) P. carotovorum a rel ative of D. dadantii is a broad host range pectinolytic bacterium, which utilizes QS systems to help regulate production of hydrolytic exoenzymes required for plant virulence (5 9, 72, 175, 242) There are two well characterized population density systems in these bacteria; one based on the production and perception of N acyl homoserine lactone (AHL) signals and the second which uti lizes the LuxS dependent autoinducer (AI) 2 signal. The role of these QS systems in medi ating interactions within plant associated microbial communities is well established (25, 32, 43, 236, 329, 335) Because many enteric and phytobacteria share components of QS signaling pathways, it has been commonly hypothesized that signal exchange plays a major role in mediating interactions in planta and could specifically empower beneficial interactions between Salmonella and soft rot causing organisms in tomatoes (305) By exploiting these QS signals S. enterica may be able to increase the suitability of the produce environment and induce its own favorable genetic regulatory changes. P. carotovorum possess a f ully functional AHL system which is required for plant virulence.

PAGE 168

168 Salmonella lacks an AHL synthase but possesses an orphan yet functional AHL receptor, encoded by sdiA which would allow it to receive P. carotovorum AHL signals (282) Studies by Noel et al. reveal that although S. enterica can respond to AHL signals produced by P. carotovorum in rich laboratory media, it is unable to recogniz e AHLs in planta as sdiA i s not expressed in tomato soft rot s (229) Furthermore, fitness of a Salmonella sdiA mutant i s not reduced in soft rot s, indicating that the ability of Salmonella to interact with phytobacteria does not depend on AHL/SdiA mediated signal exchange (229) Given the wide distribution of the luxS synthase gene, AI 2 mediated QS was originally believed to be a common method for interspecies communication (269) This view has been somewhat tempered by evidence showing a relative rarity of AI 2 receptors / response regulators (162, 253 292) However, both Salmonella and P. carotovorum are known to possess functional AI 2 signaling systems making inter species communication feasible. Additionally, AI 2 activity is known to peak in late exponential phase before declining into stationary phase in both species which could be an indication of conserved regulatory mechanisms (72, 293) Interruption of AI 2 signaling in P. carotovorum delays production of virulence factors including PEL, at low population densities and luxS deficient strains are les s virulent, but not completely avirulent, in potatoes (72, 175) In Salmonella the only known target of AI 2 is the lsr operon which encodes AI 2 uptake and processing (296) However, luxS mutants show differential regulation of virulence phenotypes in vitro and in vertebrate hosts (38, 63, 156, 245, 334)

PAGE 169

169 Little i s known abo ut the role of AI 2 signaling by enteric bacteria in the produce environment. A Salmonella luxS muta nt has no effect on colonization of cilantro leaves and neither the mutant nor wild type Salmonella benefits from co colonization with AI 2 producing phytobacteria (38) However, Salmonella lu xS activity is known to increase in response to the rich environment, acidic pH and high osmolarity of the human gut (293) These conditions are not present on leaves but are similar to those encountered in tomato fruits, which may represent an ideal surrogate en vironment for Salmonella AI 2 activity. A screen of several types of fresh produce identified AI 2 like activity from their normal microbiota. Rinses taken from the surface of tomatoes ar e able to enhance biofilm formation of an E. coli luxS mutant in poly styrene plates (190) suggestive of AI 2 activity. The goal of thi s study was to determ ine the role AI 2 based QS plays in determining the fitness of Salmonella during colonization of market tomatoes and in tomatoes with P. caratovorum soft rot s using defined luxS and lsr operon mutants. Materials and Methods Strains an d Culture C onditions Salmonella and E. coli Pectobacterium strains at SCC3193 and SCC6023 for use in tomato infections were grow n in LB 0.2% (w/v) glucose in order to induce acid tolerance. Without induction these strains produced tomato soft rot s unreliably Antibiotics used and their final concentrations were ampicillin (200 g/mL), kanamycin (50 g/mL) tetracycline (10 g/mL) and chloramphenicol (10 g/mL). All strains used i n this study are listed in Table 6 1. Deletion mutants and Resolvase In Vivo Expression Technology (RIVET) reporters

PAGE 170

170 were constructed using the methods described by Datsenko and Wanner (81) or Osorio et. al. (233) as adapted for Salmonella (202) Confirmation of AI 2 P roduction via the Vibr io harveyi LUX A ssay The production of AI 2 by the S. enterica and P. carotovorum strains used in this study was confirmed using the V. harveyi BB170 reporter as previously described (23, 297) Overnight cultur es of the strains were washed 3 times in PBS and diluted 1/100 into fresh LB without antib iotics. Cel l free supernatants (CFS) were harvested 4 hours after sub culture. 1 mL of sub subculture was centrifuged at 13,000 x g for 1 min to pellet cells and the resulting supernatant was sterilized by passing through a 0.22 m filter. Recovered CFS wa s stored at I n vitro R eception of Pectobacterium AI 2 Signaling by Salmonella Perception of AI 2 signals from Pectobacterium by Salmonella was investigated in vitro using soft agar co cultures. Overnight reporter cultures were washed 3 t imes in sterile PBS to remove antibiotics. Assay plates were set up using a soft agar overlay on LB media. Initially, 1.5% agar LB plates were poured and allowed to set. Diluted overnight cultures were mixed with warm LB 0.3% agar, poured over the previous ly prepared 1.5% agar plates and allowed to set in a sterile flow hood. Plates were recovered with a sterile wire loop directly from the soft agar and streaked to Xylose Lysine Deo to select for Salmonella After overnight growth, 50 ind ividual colonies were patched on LB tetracycline plates to assay for RIVET resolution. Activation of the reporters produces T npR, which catalyzes recombination between the res sites flanking the tetracycline resistance cassette resulting in the removal of tetracycline resistance which

PAGE 171

171 is inherited by subsequent daughter cells. Comparing the ratio of tetracycline sensitive to tet racycline resistant colonies allows comparisons of the frequency of promoter activation in vivo In vivo Competition Assays in the Presence and Absence of Soft Rot The competitive fitness of defined deletion mutants compared to wild type S. enterica sv. T yphimurium 14028 was determined using a competitive index as described previously (229) Bri efly, red ripe market tomato fruit (cv. Campari) and mature green tomato fruit (cv. Florida 47) were wounded three times by piercing the skin with sterile paper clips. Care was taken to wound the tomato between the seed sacks for a more uniform infection. For soft rot samples, 3 L of Pectobacterium (10 9 cfu/mL) was introduced into each wound and allowed to infiltrate the tomato tissue. Next, 3 L of a roughly 50:50 mix of the wild type and mutant Salmonella (10 4 cfu/mL) was introduced to each wound. S. ent erica sv. Typhimurium 14028 and its isogenic tetracycline resistant derivative JS246 were similarly inoculated as a control. A sampl e of each inoculum was plated on XLD and 50 individual colonies were patched to LB kanamycin or tetracycline plates to de ter mine the initial mutant to wild type ratio. The infected tomatoes were incubated at room temperature for 3 days for green fruit and 5 days for red fruit. These incubation times were sufficient for development of full soft rot of the fruit. Salmonella was r ecovered directly from the wound using a flame sterilized wire loop quenched in sterile phosphate buffered s aline (PBS) and quad streaked on recovered by stomaching in a W hirl Pak bag (Nasco, Fort Atkinson, WI) along with 50 mL of PBS at 260 rpm in a Stomacher 4000 Circulator (Seward, West Sussex, UK) for 1 minute. 200 L of the re sulting homogenate was plated on XLD.

PAGE 172

172 After over night growth 50 individual colonies were pat ched to LB antibiotic plates to count the number of antibiotic resistant mutant colonies. Shifts in the mutant to wild type ratio between the inoculum and recovered samples were used to calculate a competitive index (CI) according to Equation 4 1: (4 1) where M is the number of mutant cells and WT is the number of the wild type cells in the inoculum (in) or in the recovered samples (out). The CI values were log transformed to allow even comparison between increases and decreases in competitive fitness. A two test with unequal variances (p < 0.05) was used to compare each competitive co in fection to a control infection between 14028 and JS246. Box plots comparing all tr eatments for each mutant were generated using JMP 9.0 (SAS, Cary, NC). An ANOVA and the Tukey Kramer honestly significant difference (HSD) method w ere performed to compare groups. In vivo Promoter Expression Measured via RIVET assays The RIVET reporters C EC0015, CEC0018 and CEC0026 were used to examine the activity of the luxS promoter and the lsr operon during the colonization of normal and soft rotted green tomatoes. Tomato infections were prepared in the same manner as the comp etition assays. Each wound was inoculated with 3 L of 10 4 cfu/mL was sufficient for 20 mm or larger soft rot lesions to appear. Salmonella was recovered directly from the wound using a flamed wire loop quenched in sterile phos phate buffered s aline (PBS) and quad streaked on

PAGE 173

173 night growth, 50 ind ividual colonies were patched on LB tetracycline plates to analyze the proportion of resolved colonies. Results In vitro P erception o f the Pectobacterium AI 2 S ignal by Salmonella The Salmonella lsrG tnpR RIVET reporter strains, CEC0015 and CEC0018, were used to test for the perception of AI 2 produced by the P. carotovorum strains SR38 (wild type), SCC3193 (wild type) or SCC6023 (SCC31 93 luxS::cmR ) at sufficient levels to drive gene expression (Figure 6 1). CEC0018 lacks the luxS synthase and is unable to produce its own AI 2. SCC6023 cannot produce an AI 2 signal and was included as a control for non AI 2 related competition with P. ca rotovorum AI 2 production in rich laboratory medium was confirmed by the V. harveyi assay and all strains produced AI 2 as expected (Figure 6 2). Notably, SR38 produce d more AI 2 than SCC3193 which may explain its hyper virulence. Production of AI 2 by th e strai ns in a tomato juice based medium could not be tested as the low pH and the presence of glucose interfered with light production by V. harveyi (162) Results of the soft agar co cultures show ed no difference in reporter resolution when grown a t or indicating the reporter wa s active at environmental temperatures. The strong difference in resolu tion between the wild type and luxS bac kgrounds indicate the reporter wa s primarily responsive to the luxS background at all temperatures C o c ultu re with AI 2 producing strains wa s unable to rescue activity of the lsrG tnpR luxS reporter back to wild type luxS + levels. The inability to fully complement CEC0018 by co culture with 14028 indicate d exogenous AI 2 concentrations are insufficient to drive significant operon expression. This could also be due to competition for signal as luxS mutations are known to delay induction of the lsr

PAGE 174

174 operon. Although there wa s no growth rate difference between the two strains, the wild type may have begu n remov ing signal from solution before lsr induction occured in CEC0018. Once the lsr operon wa s induce d completely, the removal of AI 2 from solution can occur in as little as 60 minutes. It is also possible the reporter responded to intra cellular AI 2 levels t hrough a mechanism which is not dependent on export and uptake of AI 2. However, no such mechanism has been reported Although slight, there wa s a similar increase in resolution between co cultures with 14028 as well as all the P. carotovorum strains. How ever, co culture with SCC6023 should not have alter ed resolution of CE C0018. Because SCC6023 does not produ ce AI 2, the observed increase wa s not due to AI 2 signaling. Interestingly, co culture s with SCC6023 unexpectedly decrease d lsrG tnpR resolution in the wild type luxS + background. Because SCC6023 cannot affect resolution through AI 2 signaling, the decrease wa s evidence for metabolic competition. Alternatively, co c ulture between a wild type and luxS strain could limit the population of AI 2 produci ng cells, diluting extracellular AI 2 concentrations and leading to a weaker signal. The soft agar media may also slow diffusion of AI 2 away from producers and dampen the signal. In vivo Promoter E x pression Measured via RIVET A ssays Because production of AI 2 by Salmonella during growth in tomatoes could not be determined via the V. harveyi assay, the activity of a P luxS tnpR RIVET reporter (CEC0026) was measured in normal and soft rotted green tomatoes. The reporter was strongly expressed in all samples indicating the luxS promoter wa s highly active (Figure 6 3). Salmonella AI 2 production i s induced by preferred carbon sources, low pH and high osmolarity; conditions which should all be present in tomatoes (293) It is therefore reasonable to assume that Salmone lla produces AI 2 within tomatoes and soft rots.

PAGE 175

175 Resolution of lsrG tnpR in respon se to the soft rot environment was more varied and wa s strain dependent. Both SR38 and SCC3193 slightly increased the resolution of the reporter in both luxS backgrounds on soft agar. SCC3193 maintains this effect in soft rot ted tomatoes, and induced slight but non significant increases in resolution as compared to either Salmonella reporter alone. However, SR38 soft rot s significantly decreased resolutio n in both reporters. Signaling wa s dependent on the extracellular concentration of AI 2, which i s governed by the rates of exportation and importation by the population of cells. The timing of AI 2 release and uptake is precisely regulated with growth phase in both S. enterica and P. carotovorum with extra cellular concentration s peaking in late exponential phase (175, 293) Although S. enterica growth rates are higher than P. carotov orum in LB, P. carotovorum is better adapted to the tomato environment and is able to multiply more quickly than Salmonella (229) When coupled with a 10 5 fold larger initial inoculum for the RIVET assay, which was used to produce consistent soft rot symptoms across all samples, SR38 may overwhelm the comparatively small Salmonella population. SR 38 is hyper virulent in tomatoes and produces soft rot s more aggressively than SCC3193. In the expanding soft rots, SR38 may be actively removing AI 2 from the environment maintaining concentrations below that necessary for activation of the lsr operon in Salmonella The active removal of auto inducer compounds to hamper the signaling of (92) This strategy is purposefully employed by some phytobacteria, such a s the plant symbiont Sinorhizobium meliloti which can completel y eliminate the AI 2 activity of P. carotovora SCC3193 in co culture

PAGE 176

176 (92, 240) Some strains of P. carotovora such as hyper virulent SR38, may aggressively take up AI 2 as a pro active defense aga inst quenching. Interestingly, SCC6023 soft rot s decrease d resolution of CEC0015 and increase d resolution of CEC0018. Being unable to produce AI 2, SCC6023 was not expected to affect resolution of either reporter. The virulence and growth rate of SCC6023 wa s ability to uptake and degrade AI 2. By only removing signal SCC6023 may effectively reduce AI 2 concentrations in a manner similar to the more virulent SR38. Howev er, the increase in strains ar e AI 2 deficient. The increase was not significant and wa s likely due to sample variability but may provide further support for a metabolic influence on the lsr operon. In vivo Competition Assays in the Presence and A bsence of S oft R ot To further examine the role of AI 2 signaling during Salmonella colonization of tomatoes co infections between wild type S. enterica 14028 and defined luxS lsrACDBF and ls rG mutants were examined in normal and soft rotted tomatoes. The three day infection period was sufficient to generate a 1,000 10,000 fold expansion of the Salmonella population and produced large soft rot lesions in tomatoes inoculated with P. caratovorum (230) If AI 2 signaling has a role in adaptation to the tomato environment or interaction with P. caratovorum one or more of the mutants should display a distinct fitness phenotype. The competitive fitness of the luxS mutant increased in soft rot s compared to both n ormal green and red tomatoes (Figure 6 4). Although an ANOVA found a significant difference between the treatment means (F=2.7868, p=0.0255) only the comparison between SCC6023 soft rotted green tomatoes and normal red tomato es was found to

PAGE 177

177 be significant using the Tukey Kramer HSD test (p=0.0213). Because the chemical composition of red tomatoes is significantly different than green tomatoes and all the green tomato treatments and red tomato treatments grouped together it wa s not possible to attribute the difference to the presence of P. caratovorum However, the trend in th e data suggested that Salmonella luxS mutants may be less competitive than wild type The only previous study of the luxS phenotype in produce found no difference in ultimate population density, growth dynamics or formation of cell aggregates (an important survival phenotype to resist desiccation in the phyllosphere) between a luxS mutant and wild type Salmonella during colonization of cilantro leaves. Co culture of the Salmonella luxS mu tant with known AI 2 producing phytopathogens, Erwinia chrysanthemi or Pantoea agglomerans also produces no effects. The same luxS mutation significantly reduces population densities in the intestines, spleen and feces during infection of live chicks. The luxS mutant utilize s some carbon sources less efficiently as compared to the wild type and differences in the nutrition available to Salmonella in the respective environment s was believed to be responsible for the different luxS phenotypes observed in chi cks and cilantro leaves (38) It remains unclear how the luxS mutation would increase the fitness of Salmonella in P. caratovorum soft rot s. Interestingly, the Salmonella luxS mutant was most c ompetitive in SCC6023 soft rot ted tomatoes. Because SCC6023 is also AI 2 deficien t the observed trend, if real, wa s not related to AI 2 signal exchange with P. caratovorum Deletion of luxS reduces motility in a number of species including both Salmonell a and P. carotovora (72, 141, 156) Motility has also been lin ked to plant virulence in P. carotovora (72) .Comparisons of microarray profiles between wild type Salmonella and

PAGE 178

178 its luxS mutant shows differential regulation in a large number of flagellar genes and the presence of flagella is known to reduce the competitive fitness of Salmonella in tomatoes and alfalfa sprouts (15 1, 156, 230) The increased fitness of CEC0018 could be due to a lower susceptibility to plant defenses caused by reduced production of flagella. A similar effect may occur for SCC6023 leading to a preferential attack of the flagellated Salmonella wild ty pe during competitive co infection in SCC6023 soft rot s. The deletion of lsrACDBF eliminated the ability of Salmonella to take up AI 2 2 signaling provide d a benefit to Salmonella the wild type would be able to per ceive the signal and out compete the mutant. A general decrease in the competitive fitness of the lsrACDBF mutant wa s observed in SR38 soft rotted green tomatoes, however, given the increased variabilit y within the sample the change wa s not significant (F= 0.1307, p=0.9413). The luxS lsrACDBF double mutant, which can neither produce nor receive AI 2, ha d a similar competitive fitness compared to the lsrACDBF only mutant across all treatments. Although an ANOVA found a significant difference between the luxS lsrACDBF double mutant group means, none of the groups were distinguishable by the Tukey Kramer HSD (F=2.5183, p=0.0390). Interestingly, the trend observed in the luxS only mutant wa s not present in the luxS lsrACDBF double mutant. Both the lsrACDBF only m utant and double mutant appear ed to be more competitively fit than the luxS only mutant in non soft rot ted tomatoes. This indicates the trend observed in the luxS mutant may be a result of the ability to receive signal, not the inability to produce it. De letion of lsrG inhibits but does not completely abolish the ability of Salmonella to degrade AI 2 leading to an elevated intra cellular signal concentration which persists

PAGE 179

179 longer than the wild type (298) The lsrG mutant should be more sensitive to AI 2 th an the wild type and also served as a control for the competit ive fitness of the lsrG tnpR RIVET reporters. The fitness of the mutant wa s slightly above 0 in all tomato treatments and the difference between means was non significant (F = 0.1190, p=0.9484) indicating lsrG did not affect Salmonella during col onization of normal or soft rot ted tomatoes. Discussion Because the role of AI 2 signaling in Salmonella ha s primarily been studied in relation to vertebrate hosts there are few examples of in planta interactions. In the present study, there were no signi ficant differences in the competitive fitness of mutants deficient in AI 2 production, uptake or both indicating that AI 2 based signal exchange did not significantly influence ability to colonize tomatoes or interact with P. caratovorum in so ft rot s. These results agree with the only other known study of Salmonella AI 2 signaling in planta which shows no significant differences between wild type Salmonella and a luxS mutant during colonization of cilantro leaves (38) The lack of significant diff erences in competitive fitness is evidence for the lack of a relevant in planta AI 2 signaling phenotype in Salmonella In general, there were large variation s in the competitive indices be tween individual infections within each treatment. This high level of variability could preclude trends in th e data such as those observed for the luxS mutant co infections. However, the variability did not appear to be inherent in the assay and wa s not ob served in the JS246 vs. 14028 control infections of normal tomatoes (Figure 6 5), or in competitive co infections with defined mutants of genes identified as active by a promoter probe screen in normal red tomatoes (230) Soft rot s cause extensive tissue degradation and

PAGE 180

180 chemical alteration of the tomato environment and their colonization may be an inherently stochastic process. AI 2 signaling is concentration dependent and is tightly regulated with growth phase. Changing conditions within tomatoes, especially deteriorati on within the soft rot environment, may disrupt AI 2 flux and the physical proximity of cells creating a difficult environment for AI 2 based signal exchange. A study of fresh produce identified AI 2 activity in surface swabs of 11 of the 12 commodities e xamined indicating AI 2 based signaling is likely to be widespread in the phyllosphere (190) The AI 2 concentration isolated from surface washes during a nine day study of stored Roma tomatoes varied independently of the total bacterial count indicating the concentration is dynamically controlled by the commensal popula tion (190) Because AI 2 concentration is difficult to assay direc tly, activation of V. harveyi BB170 is typically used to estimate effective concentration s The produce wash samples induce 10 300 fold activation of BB170 which is similar to the 300 fold activation of BB170 induced by P. carotovorum cell free supernatant s (175, 190) However, Salmonella cell free supernatants typically result in up to 1,500 fold induction of the BB170 reporter indicating high AI 2 concentrations are typically used for signaling by Salmonella (297) While AI 2 concentrations in the picomolar range can induce biofilm formati on in some species of oral microbiota, Salmonella typically responds to concentrations of synthetic DPD in the range of 10 100 M which may not be provided by typical phytobacteria (163, 169, 212, 284) Studies of AI 2 related phenotypes in Salmonella and E. coli typically use luxS mutants to eliminate AI 2 production. Bec ause LuxS has a dual role in signal production and the degradation of toxic intermediat es in the activated methyl cycle (AMC), it is

PAGE 181

181 difficult to remove effects due to metabolic regulation from those specifically associated with AI 2 signaling (141, 162, 315) Microarray studies have shown the majority of luxS responsive genes are not influenced by AI 2 signaling. In Streptococcus mutans a total of 644 genes were differentially regulated between wild type and a l uxS mutant. However, only 59 genes (9.2%) responded to exogenous AI 2 (295) A similar result is seen by comparing results between 2 separate microarray studies in Salmonella A luxS mutation results in differential regulation of 547 gen es while only 23 genes (4.2%) a re differentially regulated in the same luxS mutant gr own with exogenous AI 2 (156, 334) In E. c oli 0157:H7 only 1.9% of genes (18/951) respond directly to AI 2 when metabolic effects of the high c oncentration of DPD (100 M) a re controlled for (164) In this study the use of the lsrACDBF mutant, which is deficient in AI 2 u ptake, provided an opportunity to observe AI 2 signaling phenotypes without the metabolic side effects of the luxS mutant. However, the competitive co infections showed no role for the uptake and processing of AI 2 during colonization of normal or soft ro tted tomatoes which ag rees with the limited regulon associated with AI 2 signaling in vitro as shown in previous studies Co infections with a double lsrACDBF luxS mutant further confirmed that neither AI 2 uptake nor production are linked to colonization phenotype in tomatoes. The altered resolution of the lsrG tnpR reporter in P. carotovorum soft rot s as compared to normal tomatoes demonstrate that inter species influence on the lsr operon activity of Salmonella is possible. Because both the luxS promot er was expressed at similar levels in vivo and in vitro the effect is not due to environmental repression of signaling which was seen for AHL based signal exchange between S.

PAGE 182

182 enterica and P. carotovorum (229) As both SR38 and SCC6023 repr ess resolution, the effect wa s not related to production of AI 2 by P. carotovorum It is possible that the c ompetition for signal between Salmonella and P. carotovorum may reduce extra cellular AI 2 concentration s strongly represse d resolution of CEC0018. Because CEC0018 does not supply AI 2 to the surrounding e nvironment, quenching should not reduce resolution as compared to the reporter only control infection. The reduction may be due to increased metabolic competition within the tomato or alteration of the environment by P. carotovorum AI 2 signaling depends heavily on environmental conditions and alterations in the available nutrient sources causes large changes in the regulon associated with luxS or AI 2 (51, 156, 323, 325) The metabolic conditions in tomatoes are complicated as the concentrations of at least 60 metabolites, i ncluding glucose which is major regulator of AI 2 activity in Salmonella constantly change during the ripening process. P. carotovorum soft rot s are a dynamic environment where the tomato is rapidly degrading fr om solid tissue into a nutrient rich liquid causing additional alterations in nutrient availability. The differing nutrient levels induced by ripening and or soft rot may reduce the applicability of AI 2 signaling. The competitive co infections show that although AI 2 genotypes may induce trend s they did not significantly influence Salmonella colonization of tomatoes or interactions with P. carotovorum soft rot s. No reduction in the tomato virulence of the P. carotovorum luxS mutant was observed in this study. Although a luxS mutation reduces but does not eliminate P. carotovorum v irulence in other studies, it i s not a primary regulator of potato virulence or PEL activity (72, 175) The necessity of large P.

PAGE 183

183 caratovorum ino culums to consistently reproduce soft rot s and the drastic difference in the development of soft rots between red and green tomatoes during this study indicate d the importance of other factors in controlling the formation of soft rot s within tomatoes. Th e relationship between Salmonella and P. carotovorum during colonization of produce continues to be an interesting area of research relevant to produce safety. However, this study shows that these interactions are not significantly influenced by AI 2 signa ling.

PAGE 184

184 Table 6 1. List of bacterial strains used in Chapter 6 Strain Genotype Source 14028 Wild type S. enterica serovar Typhimurium American Type Culture Collection JS246 14028 yje P8103:: res 1 tetAR res 1 Merighi et al. 2005 MM_019 C10 luxS ::FRT kanR FRT Santiviago et al. 2009 MM_074 D12 lsrACDBF ::FRT kanR FRT Santiviago et al. 2009 MM_015 G07 14028 lsrG ::FRT kanR FRT Santiviago et al. 2009 CEC0015 JS246 lsrG :: tnpR ampR Chapter 5 CEC0018 JS246 lsrG::tnpR luxS ::FRT kan R FRT ampR Chapter 5 CEC0026 P luxS tnpR luxS kanR Chapter 5 CEC0035 lsrACDBF luxS ::FRT kanR FRT Chapter 5 SR38 Wild type P. carotovorum isolated from soft rotted Florida tomatoes Bender et al. 1992 SCC3193 Wild type P. carotovorum isolated f rom soft rotted Finnish Potatoes Laasik et al. 2006 SCC6023 SCC3193 luxSEcc ::CmR Laasik et al. 2006 BB170 Vibrio harvei BB120 luxN ::Tn5 Bassler et al. 1994

PAGE 185

185 Figure 6 1. Resolution of the lsrG tnpR RIVET reporter in the 14028 wild type (CEC0015) o r iso genic luxS ::FRT kanR FRT (CEC0018) backgroun ds alone or in co culture with Pectobacterium A) Salmonella reporters incubated at 37 Salmonella cultured with P. carotovorum cultured with P. carotovorum agar, averages of 3 biological replicates which consist of the 3 averaged tec hnical replications are plotted. Bars represent standard error. Letters indicate significance groups using the Tukey Kramer HSD. Groupings were

PAGE 186

186 Figure 6 2. AI 2 activity of Salmonella and Pectobacterium CFS. Luminescent activity of the V. harveyi BB170 reporter was assayed 3.5 hours after the initial inoculation of 90 L of BB170 with 10 L of CFS. Luminescence was measured in coun ts per second. Fold activation was calculated by dividing the l uminescent activity of the CFS samples by the activity of the BB170 + LB only control. Activation of the luxS mutants strains was very low, 2 fold and 5 fold for CEC0018 and SCC6023 respect ivel y indicating AI 2 activity wa s essentially absent in these strains. 0 250 500 750 1000 1250 1500 14028 CE0015 CEC0018 SR38 SCC3193 SCC6023 Fold activation of V. harveyi BB170

PAGE 187

187 Figure 6 3. Resolution of RIVET reporters in normal and soft rotted green tomatoes. A) Resolution of the luxS promoter during 48 hour infections of green tomatoes with or without P carotorvorum soft rot The slight reduction of expression in SR38 soft rot s was the result of 3 out of 11 samples not reaching 100% resolution and wa s not significant, p=0.193. B) Resolution of lsrG tnpR in luxS +/ backgrounds during 48 hour infections of green tomatoes with or without P. carotorvorum soft rot denotes significance within reporter group due to the P. carotovorum soft rot at p<0.05 (p=0.000001 for CEC0015/SR38, 0.000670 for CEC0015/SCC6023 and 0.00220 for CEC0018/SR38 respectively). indicates a significant difference between the CEC0015 and CEC0018 reporters due to the luxS mutation p<0.05 (p=0.00001 in green tomatoes and p=0.0263 in SCC3193 soft rot s). Bars represent standard error.

PAGE 188

188 Figure 6 4. Competitive co infection s of defi ned Salmonella mutants versus 14028 wild type in normal and soft rotted tomatoes. The box plots show the 10% 25%, 75% and 90% quantiles as well as the median value. Points not within the whiskers we re treated as outliers. A) luxS vs. 14028 a and b repres ent the only treatment s which were distinguishable by the Tukey Kramer HSD at p<0.05 (p=0.0213). represent s significance versus JS246 control infection of normal green tomatoes at p<0.05, (p=0.018). B) lsrACBF vs. 14028, (p=0.044). No groups distinguisha ble by Tukey Kramer HSD. C) lsrACBF luxS vs. 14028. No significance found. D) lsrG vs. 14028. No significance found.

PAGE 189

189 Figure 6 5. JS246 vs. 14028 in normal tomatoes. No signifi cant difference between green or red tomatoes.

PAGE 190

190 CHAPTER 7 GENERAL CONCL USIONS AND FUTURE DI RECTIONS Conclusions The hypothesis that specific genetic factors are responsible for the persistence of Salmonella on non traditional hosts was examined using a promoter probe library screen to search for genes specifically regulated d uring oyster colonization, co infections between wild type Salmonella and quorum sensing deficient mutants to determine the role of signal exchange during the colonization of oysters and tomatoes, as well as a high throughput luminescent reporter screen fo r inhibitors of GacS/GacA two component regulatory system. The GacS/GacA two component system regulates bacterial behaviors which enhance environmental persistence, such as biofilm formation, in all proteobacteria. The i dentification of compounds which disrupt GacS/GacA signaling could help elucidate the chemical struct ure of the natural GacS signal and would be useful for disrupting the cascade in vivo allowing the role of GacS/GacA in regulating the colonization and structuring of host associated comm unities to be examined in living hosts. In order to screen the libraries, a P csrB LUX reporter based on the csrB promoter from E. coli was identified as providing the largest dynamic reporter range and conditions for the assay were optimized. The dynamic r ange between the MG1655 wild type host and the RG133 sirA considered excellent performance. The 1,280 compounds of the library of pharmaceutically active compounds (LOPAC) as well as against a 96 comp ound library of natural isolates from Harbor Branch Oceanographic Institute were screened for inhibitory compounds. However, no compounds specifically inhibitory to GacS/GacA

PAGE 191

191 were found. A follow up biofilm assay of the nine most promising compounds also f ound no GacS/GacA specific effects on biofilm formation. A whole genome Salmonella promoter probe library was screened in live oyster s and successfully identified 19 unique promoters regions as specifically responsive during oyster colonization. Follow up studies using RIVET reporters and defined deletion mutants were used to confirm a colonization phenotype associated with the targets. However, ssrB the regulator of SPI 2, was the only gene identified as having a specific, beneficial response during Salm onella colonization of live oysters. FACS hemocytes subjected to either a gfp labeled wild type Salmonella or an ssrB mutant was used to test the hypothesis that ssrB mediated colonization of oyster hemocytes was responsible for the competitive phenotype. Although SPI 2 is known to be required for the colonization of vertebrate macrophages, the ssrB mutation did not impair hemocyte colonization. Of the genes involved in Salmonella three QS systems only sdiA was linked to a phenotype during colonization of oysters. However, because an sdiA tnpR reporter was not significantly active in live oysters and an sdiA mutant was more competitive than wild type Salmonella during oyster colonization it is unlikely that AHL signal exchange was responsible for the phe notype. Because inhibition of SdiA by environmental conditions can disrupt signaling the effects of NaCl concentration and temperature on sdiA tnpR activity were examined. Interestingly, sdiA was more active and high NaCl concentrations and at 22 C. The interaction with temperature is perplexing as the downstream targets of SdiA, srgE and the rck operon, only respond specifically to AHLs

PAGE 192

192 above 30 and 37 C respectively. The results of this study may indicate SdiA has other regulatory targets or re sponds to other signals under different environmental conditions The presence of soft rots is known to be beneficial to Salmonella however, the mechanism governing the interaction remains unknown. Because the production of AI 2 is regulated similarly in Salmonella and Pectobacterium carotovorum and AI 2 helps regulate pectate lyase production in P. carotovorum it was hypothesized that AI 2 signal exchange between Salmonella and P. carotovorum may increase PEL activity providing a benefit to Salmonella via increased nutrient availability. Salmonella RIVET reporters show that AI 2 production is possible in tomatoes and provided evidence that signal exchange may occur between the species. However, the presence of P. carotovorum slightly increased Salmonella A I 2 activity in vitro but reduced AI 2 activity in tomatoes. These contradictory results indicate signal exchange is context dependent, with either cross communication or quorum quenching possible depending on the exact conditions. However, despite these p ossible interactions, P. carotovorum PEL activity was not induced by Salmonella A lso, co infections between wild type Salmonella and defined AI 2 mutants in normal and soft rotted tomatoes show that neither AI 2 production nor reception significantly affe cts colonization, which appears to be a largely stochastic process. Future Directions The association of both ssrB and sdiA known virulence regulators in mice, with colonization phenotypes in live oysters provides support for conserved colonization mecha nism s Although both genes encode regulatory proteins, the observed phenotypes were not linked to their traditional targets or signals. In general, identifying specific factors which govern host colonization is difficult. The majority of what is known

PAGE 193

193 abou t the Salmonella infectious process was determined in the mouse model. However, these results do not always extend to other hosts, including other mammals. Studies in pigs show that responses can vary between different tissue types within the same host and outcomes are dependent on how Salmonella is introduced into the host. The results of this study highlight the importance of understanding the response of regulatory elements to specific environmental conditions. Further study of these regulators under en vironmentally relevant conditions should be performed. Specifically the interaction between S diA and the rck operon should be examined at ambient temperatures and increased NaCl concentrations as compared to standard growth conditions. The role of ssrB and SPI 2 in interactions with the innate immune system in non vertebrate hosts should also be examined. Specifically, the promoter probe library screen identified a putative sRNA sequence within ssrB which may control post transcriptional regulation or deter mine which effectors are active under specific environmental conditions. Although Salmonella is capable of colonizing oysters and persisting for long periods the population is not actively expanding. Therefore, approaches to studying the contamination of live oyster s by enteric bacteria should emphasize stationary phase processes which are important for cellular persistence instead of utilizing growth permissive conditions which favor processes involved in logarithmic growth and cell replication. Although AI 2 did not contribute to Salmonella Pectobacterium interactions in soft rots, the co existence is known to benefit both bacteria. Further studies should concentrate on signaling mechanisms which may be more relevant in the tomato

PAGE 194

194 environment as well as metabolic interactions between the species Additionally, the lsrG tnpR RIVET reporter constructed to study AI 2 activity in Salmonella did not respond strongly to synthetic AI 2. This is in contrast to previous reporters which rely on a second copy of the lsr operon promoter. However, my reporter uses a single copy of the lsr promoter in its native location and my results may indicate that the Salmonella response to extra cellular AI 2 is not as strong as currently believed. The response should be confirm ed with other methods, either qRT PCR to verify lsr transcript levels or by constructing a P lsr tnpR reporter would avoid any possible issues with the placement of the lsrG tnpR reporter at the end of the operon. Although the chemical library screens were unsuccessful in identifying specific inhibitors of the GacS/GacA two component system, the assay design produced a high quality screen. Chemical library screens have inherently low success rates requiring large numbers of compounds to be analyzed using au tomated procedures. The reporter strains and multi well plate set up used in this study could easily be adapted for automated screening to continue the search for inhibitory molecules. Also, once the GacS signal is identified, these reporters could be used to screen targeted libraries of related molecules for signal agonists.

PAGE 195

195 APPENDIX A COMPOSITION OF COMMO N GROWTH MEDIA Liquid growth media L uria Broth Lennox (LB) (catalogue # BP1427 2, Fisher Scientific, Pittsburgh, PA) 10g tryptone 5g yeast extrac t 5g NaCl 1L distilled water (DI H 2 O) Autoclave sterilize M9 minimal media 900 mL DI H 2 O autoclave sterile 100 mL sterile 10X M9 salts 2 mL of 1M MgSO 4 filter sterile 100 L 1M CaCl 2 filter sterile Filter sterile carbon source 10X M9 salts 113g Na 2 HPO 4 7 H 2 O 30 g KH 2 PO 4 5 g NaCl 10 g NH 4 Cl 1L DI H 2 O Adjust pH to 7.4 and autoclave sterilize NZY + 100 mL of prepared NZY broth (catalogue #BP2465 2, Fisher Scientific, Pittsburgh, PA) 1.25 mL of 1M MgCl 2 2 mL 20% glucose w/v in DI H 2 O strength Artificial Seawater (1/2 ASW) 262g Red Sea Coral Pro Salt (Red Sea USA, Houston TX) 15L DI H 2 O Check solution salinity (should be approximately 16 ppt) Marine Broth (MB) (catalogue# 279110, Becton Dickinson, Sparks, MD) Phosphate Buffered Saline (PBS) (catalogue #BP661 50, Fisher Scientific, Pittsburgh, PA) Solid Growth media LB agar (1.5%) 1L LB Lennox 15g agar Autoclave sterilize

PAGE 196

196 LB soft agar (0.3%) 1L LB Lennox 3g agar Autoclave sterilize Evans blue uranine agar (EBU) 10g tryptone 5g yeast extract 5g NaCl 2.5g glucose 15 g agar 960 mL DI H 2 O Autoclave sterilize and allow to cool 28.71 mL of 1M K 2 HPO 4 1.25 mL of 1% Evans Blue in DI H 2 O 2.5 mL of 1% Uranine in DI H 2 O Store covered with aluminum foil Oyster agar (OA) (adapted from Eyre (105) and Colwell and Liston (68) ) 500 g Oyster meat 500 mL ASW Homogenize in a blender until smooth Top up to 1 L with ASW Extract by boiling for 30 minutes Strain Top up to 1L with DI H 2 O 15g agar Autoclave sterilize strength Artificial Seawater soft agar (0.3%) 1L ASW 3g agar Autoclave sterilize M9 glucose agar 900 mL DI H 2 O autoclave sterile 15 g agar Autoclave s terilize Allow to cool and add 100 mL sterile 10X M9 salts 2 mL of 1M MgSO 4 filter sterile 100 L 1M CaCl 2 filter sterile 10 mL of 20% (w/v) glucose filter sterile

PAGE 197

197 Xylose lysine deoxycholate agar (XLD) (catalogue #28820, Becton Dickinson, Sparks, MD) Mari ne Agar (MA) (catalogue# 212185, Becton Dickinson, Sparks, MD)

PAGE 198

198 APPENDIX B COMPOUND KEY FOR LOP AC PLATE 1 Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID A03 C 9758 C03 C 9754 E03 C 9611 G03 C 9511 A04 C 2755 C04 C 2538 E04 C 2505 G04 C 2321 A05 C 8759 C05 C 8645 E05 C 8417 G05 C 8395 A06 C 1610 C06 C 1290 E06 C 1251 G06 C 1172 A07 C 8088 C07 C 8031 E07 C 8011 G07 C 7971 A08 C 0768 C08 C 0750 E08 C 0737 G08 C 0625 A09 C 752 2 C09 C 7291 E09 C 7255 G09 C 7230 A10 C 0256 C10 C 0253 E10 B 175 G10 B 173 A11 C 6645 C11 C 6643 E11 C 6628 G11 C 6506 A12 B 152 C12 B 138 E12 B 135 G12 B 134 A13 C 6019 C13 C 5982 E13 C 5976 G13 C 5923 A14 B 019 C14 B 016 E14 B 015 G14 B 012 A15 C 5270 C15 C 5259 E15 C 5134 G15 C 5040 A16 B 9130 C16 B 8406 E16 B 8385 G16 B 8279 A17 C 4662 C17 C 4542 E17 C 4522 G17 C 4520 A18 B 7283 C18 B 7148 E18 B 7005 G18 B 6506 A19 C 4238 C19 C 4042 E19 C 4024 G19 G 5918 A20 B 5275 C20 B 5016 E20 B 5002 G20 B 4558 A21 C 3635 C21 C 3412 E21 C 3353 G21 C 3270 A22 B 2640 C22 B 2515 E22 B 2417 G22 B 2390 B03 B 2009 D03 B 1552 F03 B 1427 H03 B 1381 B04 A 7162 D04 A 7148 F04 A 7127 H04 A 7009 B05 B 0385 D05 A 2 65 F05 A 263 H05 A 255 B06 A 6566 D06 G 8543 F06 A 6351 H06 A 6134 B07 A 242 D07 A 236 F07 A 230 H07 A 206 B08 A 5879 D08 A 5791 F08 A 5626 H08 A 5585 B09 A 167 D09 S 0568 F09 P 9872 H09 A 164 B10 A 5006 D10 A 4910 F10 S 9318 H10 A 46 87 B11 A 143 D11 A 142 F11 A 140 H11 A 138 B12 A 4393 D12 A 4147 F12 A 3940 H12 A 3846 B13 A 023 D13 A 022 F13 A 013 H13 A 003 B14 A 3281 D14 A 3145 F14 A 3134 H14 A 3085 B15 A 9809 D15 A 9755 F15 A 9699 H15 A 9657 B16 A 1977 D16 A 19 10 F16 A 1895 H16 A 1824 B17 A 9345 D17 A 9335 F17 A 9256 H17 A 9251 B18 R 0875 D18 A 0966 F18 A 0937 H18 A 0788 B19 A 8676 D19 A 8598 F19 A 8456 H19 A 8423 B20 A 0430 D20 A 0384 F20 A 0382 H20 A 0257 B21 H 123 D21 A 7762 F21 A 7755 H 21 A 7655 B22 265128 D22 246557 F22 246379 H22 211672

PAGE 199

199 Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID I03 C 9510 K03 C 9033 M03 C 8903 O03 C 8773 I04 C 2235 K04 C 2137 M04 C 1754 O04 C 1671 I05 C 8270 K05 C 8221 M05 C 8145 O05 C 8138 I06 C 1159 K06 C 1112 M06 C 0987 O06 C 0862 I07 C 7912 K07 C 7897 M07 C 7861 O07 C 7632 I08 C 0424 K08 C 0400 M08 C 0331 O08 C 0330 I09 C 7041 K09 C 7005 M09 C 6895 O09 C 6862 I10 B 169 K10 B 168 M10 B 161 O10 B 154 I11 C 6305 K11 C 6048 M11 C 6042 O11 C 6022 I12 B 121 K12 B 112 M12 B 103 O12 B 102 I13 C 5913 K13 C 5793 M13 S 0693 O13 C 5554 I14 B 003 K14 B 9929 M14 B 9647 O14 B 9308 I15 C 5020 K15 C 4915 M15 C 4911 O15 C 4895 I16 B 8262 K16 B 7880 M16 B 7777 O16 B 7651 I17 C 4479 K17 C 4418 M17 C 4397 O17 C 4382 I18 B 5683 K18 B 5681 M18 S 7067 O18 B 5399 I19 C 3930 K19 C 3912 M19 C 3909 O19 C 3662 I20 B 4555 K20 B 3650 M20 B 3501 O20 B 3023 I21 C 3130 K21 C 3025 M21 C 3010 O21 C 2932 I22 B 2377 K22 B 2292 M22 B 2134 O22 B 2050 J03 B 1266 L03 B 1183 N03 S 5192 P03 B 0753 J04 A 6976 L04 A 6883 N04 A 6770 P04 A 6671 J05 A 254 L05 A 252 N05 A 244 P05 A 243 J06 A 6011 L06 A 5922 N06 T 9034 P06 A 5909 J07 A 202 L07 A 201 N07 A 196 P07 A 178 J08 A 5376 L08 A 5330 N08 A 5282 P08 A 5157 J09 A 162 L09 A 156 N09 A 155 P09 A 145 J10 A 4669 L10 A 4638 N10 A 4562 P10 A 4508 J11 A 129 L11 A 114 N11 P 0248 P11 A 024 J1 2 A 3773 L12 A 3711 N12 A 3595 P12 A 3539 J13 A 9950 L13 A 9899 N13 A 9898 P13 A 9834 J14 A 2385 L14 A 2251 N14 A 2169 P14 A 2129 J15 A 9630 L15 A 9561 N15 A 9512 P15 A 9501 J16 A 1784 L16 A 1782 N16 A 1755 P16 A 1260 J17 A 9013 L17 A 8835 N17 A 8762 P17 A 8723 J18 A 0779 L18 A 0760 N18 A 0666 P18 A 0500 J19 A 8404 L19 A 8003 N19 A 7845 P19 A 7824 J20 A 0152 L20 861804 N20 861669 P20 291552 J21 A 7410 L21 A 7342 N21 A 7275 P21 A 7250 J22 194336 L22 190047 N22 144509 P22 120693

PAGE 200

200 APPENDIX C COMPOUND KEY FOR LOP AC PLATE 2 Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID A03 I 2760 C03 I 2279 E03 S 2318 G03 I 1899 A04 G 9659 C04 G 8134 E04 G 7788 G04 G 67 93 A05 I 0782 C05 N 1786 E05 I 0404 G05 I 0375 A06 G 3416 C06 G 3126 E06 G 2536 G06 G 2128 A07 H 140 C07 H 135 E07 H 128 G07 H 127 A08 F 132 C08 F 131 E08 F 124 G08 F 114 A09 H 9876 C09 H 9772 E09 L 2167 G09 H 9523 A10 F 9397 C10 F 89 27 E10 F 8791 G10 F 8257 A11 H 8876 C11 H 8759 E11 H 8653 G11 H 8645 A12 F 6800 C12 F 6777 E12 F 6627 G12 F 6513 A13 H 8034 C13 H 7779 E13 H 7278 G13 H 7258 A14 F 4765 C14 F 4646 E14 F 4381 G14 F 4303 A15 H 5257 C15 S 8817 E15 H 4759 G15 L 4408 A16 F 1553 C16 F 1016 E16 F 0881 G16 F 0778 A17 H 2380 C17 H 2270 E17 H 2138 G17 H 1877 A18 E 100 C18 E 007 E18 E 006 G18 E 002 A19 H 1252 C19 H 0879 E19 H 0627 G19 H 0131 A20 E 7881 C20 E 7649 E20 E 7138 G20 E 4642 A21 G 11 9 C21 G 117 E21 G 111 G21 G 110 A22 E 3645 C22 E 3520 E22 E 3380 G22 E 3263 B03 E 3132 D03 E 2387 F03 E 2375 H03 C 8863 B04 D 5891 D04 D 5886 F04 D 5814 H04 D 5794 B05 E 0516 D05 E 0381 F05 E 0137 H05 D 206 B06 D 5439 D06 D 5385 F06 D 5297 H06 D 5294 B07 D 153 D07 D 149 F07 D14204 H07 D 142 B08 D 4434 D08 D 4268 F08 D 4007 H08 D 4000 B09 D 131 D09 D 130 F09 D 129 H09 D 127 B10 D 3648 D10 D 3634 F10 D 3630 H10 D 2926 B11 D 103 D11 D 101 F11 D 054 H11 D 052 B12 D 20 64 D12 D 1916 F12 D 1791 H12 D 1542 B13 D 033 D13 D 031 F13 D 030 H13 D 029 B14 D 1262 D14 D 1260 F14 D 1064 H14 D 0676 B15 D 9815 D15 D 9766 F15 D 9628 H15 D 9305 B16 C 271 D16 C 239 F16 C 237 H16 C 231 B17 S 5567 D17 D 8690 F17 D 85 55 H17 D 8399 B18 C 197 D18 C 192 F18 C 191 H18 C 147 B19 D 8040 D19 D 8008 F19 D 7938 H19 D 7910 B20 C 130 D20 C 126 F20 C 125 H20 C 121 B21 D 7505 D21 D 6940 F21 D 6908 H21 D 6899 B22 C 102 D22 C 101 F22 C 011 H22 C 008

PAGE 201

201 Well Positio n LOPAC ID Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID I03 I 1656 K03 I 1637 M03 I 1392 O03 I 1149 I04 G 6649 K04 G 6416 M04 G 5668 O04 G 4788 I05 I 0157 K05 I 0154 M05 G 6043 O05 H 168 I06 G 1043 K06 G 0668 M06 G 0639 O06 D 8816 I07 H 121 K07 H 120 M07 H 108 O07 H 9882 I08 F 100 K08 F 9677 M08 F 9552 O08 F 9427 I09 H 9382 K09 B 8433 M09 H 9003 O09 H 9002 I10 F 8175 K10 F 7927 M10 F 6889 O10 F 6886 I11 H 8627 K11 H 8502 M11 H 8250 O1 1 H 8125 I12 F 6426 K12 F 6300 M12 F 6145 O12 F 6020 I13 H 7250 K13 H 6892 M13 H 6036 O13 H 5752 I14 F 3764 K14 F 2927 M14 F 2802 O14 F 1678 I15 H 4001 K15 H 3146 M15 H 3132 O15 H 2775 I16 E 140 K16 E 114 M16 E 111 O16 E 101 I17 H 1753 K17 H 1512 M17 H 1384 O17 H 1377 I18 E 9750 K18 E 8875 M18 N 3911 O18 E 8375 I19 H 0126 K19 G 154 M19 G 133 O19 G 120 I20 E 4378 K20 E 4375 M20 E 3876 O20 E 3770 I21 G 019 K21 G 017 M21 G 007 O21 G 002 I22 E 3256 K22 E 3250 M22 E 314 9 O22 S 3567 J03 E 1896 L03 E 1779 N03 E 1383 P03 E 1279 J04 D 5782 L04 D 5766 N04 D 5689 P04 D 5564 J05 S 4443 L05 D 193 N05 D1920 6 P05 D 155 J06 D 5290 L06 P 152 N06 D 4526 P06 D 4505 J07 D 138 L07 D 134 N07 D 133 P07 D 132 J08 D 3 900 L08 D 3775 N08 D 3768 P08 D 3689 J09 D126608 L09 D 122 N09 D 108 P09 D 104 J10 D 2763 L10 S 0443 N10 D 2531 P10 D 2521 J11 D 047 L11 I 9532 N11 D 044 P11 D 042 J12 D 1507 L12 D 1414 N12 D 1413 P12 D 1306 J13 D 027 L13 D 003 N13 D 002 P13 D 9891 J14 D 0670 L14 D 0540 N14 D 0411 P14 C 277 J15 D 9190 L15 D 9175 N15 D 9128 P15 D 9035 J16 C 223 L16 C 207 N16 C 203 P16 C 199 J17 G 5168 L17 D 8296 N17 D 8190 P17 D 8065 J18 C 145 L18 C 144 N18 Y 0503 P18 C 141 J19 D 7 909 L19 D 7814 N19 D 7802 P19 D 7644 J20 C 117 L20 C 108 N20 C 106 P20 C 104 J21 D 6518 L21 D 6140 N21 D 6035 P21 D 5919 J22 C 007 L22 C 9911 N22 C 9901 P22 C 9847

PAGE 202

202 APPENDIX D COMPOUND KEY FOR LOP AC PLATE 3 Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID A03 P 6628 C03 P 6503 E03 P 6500 G03 P 6402 A04 N 142 C04 N 140 E04 N 115 G04 N 9765 A05 P 5396 C05 P 5295 E05 P 5114 G05 P 5052 A06 N 8534 C06 N 8403 E06 N 7906 G06 N 7904 A07 P 4532 C07 P 4509 E07 P 4484 G07 P 4405 A08 N 7505 C08 N 7261 E08 N 7127 G08 N 5751 A09 P 3510 C09 P 2742 E09 P 2738 G09 P 2607 A10 N 5023 C10 N 4784 E10 N 4779 G10 N 4396 A11 P 1801 C11 P 1793 E11 P 1784 G11 P 1726 A12 N 35 29 C12 N 3510 E12 N 3398 G12 N 3136 A13 P 0778 C13 P 0667 E13 P 0618 G13 P 0547 A14 N 1530 C14 N 1392 E14 N 1016 G14 N 0630 A15 O 100 C15 O 9637 E15 S 3442 G15 O 9387 A16 M 204 C16 M 187 E16 M 184 G16 Z 4626 A17 O 3636 C17 O 3125 E17 O 3011 G17 O 2881 A18 M 140 C18 M 137 E18 M 129 G18 M 120 A19 O 0877 C19 O 0383 E19 O 0250 G19 N 211 A20 M 107 C20 M 105 E20 M 104 G20 M 003 A21 B 9305 C21 N 158 E21 N 156 G21 N 154 A22 M 9440 C22 M 9292 E22 M 9125 G22 M 9020 B03 D 89 41 D03 G 5793 F03 M 7684 H03 M 7277 B04 L 106 D04 L 9908 F04 L 9787 H04 L 9756 B05 M 6680 D05 M 6628 F05 M 6545 H05 M 6524 B06 L 8539 D06 L 8533 F06 L 8401 H06 L 8397 B07 M 6191 D07 M 5685 F07 M 5644 H07 M 5560 B08 L 4900 D08 L 4762 F 08 L 4376 H08 L 3791 B09 M 5379 D09 M 5250 F09 M 5171 H09 M 5154 B10 L 2037 D10 L 1788 F10 L 1415 H10 L 1011 B11 M 4251 D11 M 4145 F11 M 4008 H11 M 3935 B12 K 3375 D12 K 2628 F12 K 1888 H12 K 1751 B13 M 3315 D13 M 3281 F13 M 3262 H13 M 3184 B14 J 4252 D14 I18008 F14 I 160 H14 I 151 B15 M 2776 D15 M 2727 F15 M 2692 H15 M 2547 B16 I 127 D16 I 122 F16 I 120 H16 I 119 B17 M 2011 D17 M 1809 F17 M 1777 H17 M 1692 B18 I 9778 D18 I 9531 F18 I 8898 H18 I 8768 B19 M 1275 D19 M 1022 F19 M 0814 H19 M 0763 B20 I 7388 D20 I 7379 F20 I 7378 H20 I 7016 B21 L 131 D21 L 122 F21 L 121 H21 L 119 B22 I 5627 D22 I 5531 F22 I 4883 H22 I 3766

PAGE 203

203 Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID We ll Position LOPAC ID I03 P 6126 K03 P 5679 M03 P 5654 O03 P 5514 I04 N 9007 K04 N 8784 M04 N 8659 O04 N 8652 I05 P 4670 K05 P 4668 M05 P 4651 O05 P 4543 I06 N 7778 K06 N 7758 M06 N 7634 O06 N 7510 I07 P 4394 K07 T 9567 M07 P 4015 O07 P 3520 I08 N 5636 K08 N 5504 M08 N 5501 O08 N 5260 I09 P 2278 K09 P 2116 M09 P 2016 O09 P 1918 I10 N 4382 K10 N 4159 M10 N 4148 O10 N 4034 I11 P 1675 K11 P 1061 M11 P 0884 O11 P 0878 I12 N 2255 K12 N 2034 M12 N 2001 O12 N 1771 I13 P 04 53 K13 P 0359 M13 P 0130 O13 O 111 I14 M 231 K14 M 226 M14 M 225 O14 M 216 I15 O 9126 K15 O 8757 M15 T 5575 O15 O 3752 I16 M 166 K16 M 153 M16 M 152 O16 M 149 I17 O 2751 K17 O 2378 M17 O 1008 O17 O 0886 I18 M 116 K18 M 110 M18 M 109 O18 M 108 I19 N 183 K19 N 176 M19 N 170 O19 N 165 I20 M 001 K20 M 9656 M20 M 9651 O20 M 9511 I21 N 153 K21 N 151 M21 N 149 O21 N 144 I22 M 8878 K22 S 1068 M22 M 8131 O22 M 8046 J03 M 7065 L03 M 7033 N03 M 6760 P03 M 6690 J04 L 9664 L0 4 L 9539 N04 N 0287 P04 L 8789 J05 M 6517 L05 M 6500 N05 M 6383 P05 M 6316 J06 L 5783 L06 L 5647 N06 V 1889 P06 L 5025 J07 M 5501 L07 M 5441 N07 M 5435 P07 M 5391 J08 L 2906 L08 L 2540 N08 L 2536 P08 L 2411 J09 M 4910 L09 M 4796 N09 M 4659 P09 M 4531 J10 L 0664 L10 L 0258 N10 K 4262 P10 K 3888 J11 M 3808 L11 M 3778 N11 U 106 P11 M 3668 J12 K 1136 L12 K 1003 N12 K 0250 P12 J 102 J13 M 3127 L13 M 3047 N13 M 2922 P13 M 2901 J14 I 146 L14 I 139 N14 I 138 P14 I 135 J15 M 2537 L15 M 2525 N15 M 2398 P15 M 2381 J16 I 117 L16 I 114 N16 I 106 P16 I 9890 J17 M 1559 L17 M 1514 N17 M 1404 P17 M 1387 J18 I 8250 L18 I 8021 N18 I 8005 P18 I 7627 J19 L 137 L19 L 135 N19 L 134 P19 L 133 J20 I 6504 L20 I 6391 N20 I 6138 P20 I 5879 J21 L 118 L21 L 110 N21 L 109 P21 L 107 J22 I 3639 L22 I 2892 N22 I 2765 P22 I 2764

PAGE 204

204 APPENDIX E COMPOUND KEY FOR LOP AC PLATE 4 Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID A03 P 6656 C03 P 6777 E03 P 6902 G03 P 6909 A04 R 0758 C04 R 1402 E04 R 2625 G04 R 2751 A05 P 7412 C05 P 7505 E05 P 7561 G05 P 7780 A06 R 5523 C06 R 5648 E06 R 6152 G06 R 6520 A07 P 8227 C07 P 8293 E07 P 8352 G07 P 8386 A08 R 890 0 C08 R 9525 E08 R 9644 G08 R 101 A09 P 8782 C09 P 8813 E09 P 8828 G09 P 8852 A10 R 108 C10 R 115 E10 R 116 G10 R 118 A11 P 9233 C11 P 9297 E11 P 9375 G11 P 9391 A12 R 140 C12 S 0278 E12 S 0441 G12 S 0501 A13 P 9879 C13 P 101 E13 P 10 2 G13 P 103 A14 S 1441 C14 S 1563 E14 S 1688 G14 S 1875 A15 P 118 C15 P 119 E15 P 120 G15 S 3317 A16 S 2501 C16 S 2812 E16 S 2816 G16 S 2876 A17 P 162 C17 P 178 E17 P 183 G17 P 203 A18 S 3313 C18 O 2139 E18 S 3378 G18 S 4063 A19 P 233 C19 S 9692 E19 P63204 G19 Q 0125 A20 S 6879 C20 S 7389 E20 S 7395 G20 S 7690 A21 Q 3251 C21 Q 3504 E21 Q 102 G21 Q 107 A22 S 8010 C22 C 7238 E22 S 8139 G22 S 8251 B03 S 8567 D03 S 8688 F03 B 5559 H03 S 9066 B04 T 7402 D04 T 7508 F04 T 7540 H04 T 7665 B05 S 008 D05 S 009 F05 S 103 H05 S 106 B06 T 7947 D06 T 8067 F06 T 8160 H06 T 8516 B07 S 154 D07 S 159 F07 S 168 H07 S 174 B08 T 9262 D08 T 9652 F08 T 9778 H08 T 101 B09 T 0410 D09 T 0625 F09 T 0780 H09 T 0891 B10 T 122 D10 T 123 F10 T 144 H10 T 165 B11 T 1516 D11 T 1633 F11 T 1694 H11 T 1698 B12 U 4125 D12 U 5882 F12 U 6007 H12 U 6756 B13 T 2528 D13 T 2879 F13 T 2896 H13 T 3146 B14 U 103 D14 U 104 F14 U 105 H14 U 108 B15 T 4182 D15 T 4264 F15 T 4318 H15 T 4376 B16 U 116 D16 U 120 F16 V 1377 H16 V 4629 B17 T 4568 D17 T 4680 F17 T 4693 H17 T 4818 B18 V 8879 D18 V 9130 F18 V 100 H18 X 3628 B19 T 5625 D19 T 6031 F19 T 6050 H19 T 6154 B20 W 104 D20 W 105 F20 W 108 H20 W 110 B21 T 6764 D21 T 6943 F21 T 7040 H21 T 7165 B22 Y 3125 D22 Y 101 F22 Y 102 H22 Z 0878

PAGE 205

205 Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID Well Position LOPAC ID I03 P 7083 K03 P 7136 M03 P 7295 O03 P 7340 I04 R 3255 K04 R 3277 M04 R 4152 O04 R 5010 I05 P 7791 K05 P 7912 M05 P 8013 O05 P 8139 I06 R 7150 K06 R 7385 M06 R 7772 O06 R 8875 I07 P 8477 K07 P 8511 M07 P 8688 O07 P 8765 I08 R 103 K08 R 104 M08 R 106 O08 R 107 I09 P 8887 K09 P 8891 M09 P 9 159 O09 P 9178 I10 R 121 K10 S 4692 M10 R 134 O10 D 7815 I11 P 9547 K11 P 9689 M11 P 9708 O11 P 9797 I12 S 0752 K12 S 0758 M12 S 1316 O12 S 1438 I13 P 105 K13 P 106 M13 P 107 O13 P 108 I14 S 2064 K14 S 2201 M14 S 2250 O14 S 2381 I15 P 126 K15 I 0658 M15 P 152 O15 P 154 I16 S 2941 K16 S 3065 M16 S 3066 O16 S 3191 I17 P 204 K17 P 209 M17 P 215 O17 P 216 I18 S 4250 K18 S 5013 M18 S 5890 O18 S 6633 I19 Q 0875 K19 Q 1004 M19 Q 1250 O19 Q 2128 I20 S 7771 K20 S 7809 M20 S 7882 O20 S 7936 I21 Q 109 K21 Q 110 M21 Q 111 O21 R 0500 I22 S 8260 K22 S 5068 M22 S 8442 O22 S 8502 J03 S 9186 L03 S 9311 N03 S 003 P03 S 006 J04 T 7692 L04 T 7697 N04 T 7822 P04 T 7883 J05 S 143 L05 S 145 N05 S 149 P05 S 153 J06 T 8543 L06 T 9025 N06 T 9033 P06 T 9177 J07 S 180 L07 S 201 N07 T 0254 P07 T 0318 J08 T 103 L08 T 104 N08 T 112 P08 T 113 J09 T 1132 L09 T 1443 N09 T 1505 P09 T 1512 J10 T 173 L10 T 182 N10 T 200 P10 U 1508 J11 T 2057 L11 T 2067 N11 T 2265 P11 T 2408 J12 S 5317 L12 U 7500 N12 U 100 P12 U 101 J13 T 3434 L13 T 3757 N13 L 3040 P13 T 4143 J14 U 109 L14 U 110 N14 U 111 P14 U 115 J15 T 4425 L15 T 4443 N15 T 4500 P15 T 4512 J16 V 5888 L16 V 6383 N16 V 8138 P16 V 8261 J17 T 5193 L17 T 5318 N17 T 5515 P17 T 5568 J18 W 1628 L18 W 4262 N18 W 4761 P18 W 102 J19 T 6318 L19 T 6376 N19 T 6394 P19 T 6692 J20 X 1251 L20 X 3253 N20 X 6000 P20 X 103 J21 T 7188 L21 T 7254 N21 T 7290 P21 T 7313 J22 Z 2001 L22 Z 3003 N22 Z 4900 P22 Z 101

PAGE 206

206 APPENDIX F COMPOUND KEY FOR HBO I PURE PLATE #1 LIBR ARY Well Position BAN_No Compound Name A01 HB 004 Puupehenone A02 HB 007 Duryne A03 HB 010 Latrunculin A A04 HB 011 Isospongiadiol A05 HB 018 Topsentin A06 HB 019 Bromotopse ntin A07 HB 020 Illimaquinone A08 HB 021 Curcuphenol A09 HB 022 Theonelline isocyanide A10 HB 025 Reiswigin A A11 HB 027 Dercitin A12 HB 028 Di(OH) di(Me) indolenium Cl B01 HB 029 Crassin acetate B02 HB 031 Diisocyanoamphilectin B03 HB 032 Petrosi aquinol B04 HB 037 Acetylenic 3 ol (1) B05 HB 038 Acetylenic 3 ol (2) B06 HB 039 Acetylenic 3 ol (3) B07 HB 041 Acetylenic 3 ol (5) B08 HB 045 Onnamide A B09 HB 049 Deoxyprepacifinol B10 HB 053 Dercitamide B11 HB 057 Dercitin N oxide B12 HB 059 Di bromo(4,5) 2 pyrrolic acid C01 HB 061 Oroidin C02 HB 068 Manzamine B C03 HB 070 Manzamine F C04 HB 074 Nordercitin C05 HB 077 Cyclic peroxyacid 2 C06 HB 078 Cyclic peroxyacid 1 C07 HB 079 Strongylin A C08 HB 080 Isonitrileformamide C09 HB 083 Stro ngylin A acetate C10 HB 085 Tubastrine C11 HB 086 Spongiatriol C12 HB 088 Theonelline B

PAGE 207

207 Well Position BAN_No Compound Name D01 HB 090 Aureol D02 HB 097 Mycalamide A D03 HB 105 Batzelline A D04 HB 106 Batzelline B D05 HB 110 Bromo(5) tyramine D06 HB 114 Isobatzelline C D07 HB 115 Isobatzelline D D08 HB 116 Discorhabdin A D09 HB 117 Discorhabdin C D10 HB 118 Discorhabdin D D11 HB 120 Corticimine D12 HB 121 Microcolin A E01 HB 122 Microcolin B E02 HB 124 Orthosterol B E03 HB 126 Mycalamide B E04 HB 127 Nortopsentin A E05 HB 128 Nortopsentin B E06 HB 134 Kabiramide B E07 HB 135 Kabiramide C E08 HB 144 Manzamine D E09 HB 146 Chondrillin E10 HB 147 Manoalide A E11 HB 149 Pacifinol E12 HB 150 Prepacifenol F01 HB 151 Laurinterol F02 HB 152 Debromolaurinterol F03 HB 157 Dragmacidin D F04 HB 159 Epihippuristanol F05 HB 160 Pachydictyol A F06 HB 162 Thysiferol 23 acetate F07 HB 163 Johnstonol F08 HB 165 Hymenidin F09 HB 169 Dictyol C F10 HB 170 Spongian acid ester F11 HB 171 Chamig rene A F12 HB 172 Demethylaaptamine

PAGE 208

208 Well Position BAN_No Compound Name G01 HB 173 Hippurin G02 HB 174 Hippuristanol G03 HB 175 Halenaquinol G04 HB 176 Halinaquinone G05 HB 178 Xestoquinone G06 HB 182 Diterpene SS IV 21 6 G07 HB 184 Heteronemin G08 HB 186 Deoxytopsentin G09 HB 187 Dragmacidin G10 HB 190 Chamigrene A 9 ol G11 HB 194 Ophirapstanol G12 HB 195 Halistanol H01 HB 200 Epiplakinic acid Me ester H02 HB 206 Batzelline D H03 HB 214 Eruloside A H04 HB 223 Aerophobin 1 H05 HB 224 Discorhabdin P H06 HB 225 Secobatzelline A H07 HB 229 Bis(2,2) 6 Br indol 3 yl Et amine H08 HB 231 Secobatzelline B H09 HB 256 Discalamide A H10 HB 285 Discodermindole H11 HB 297 Discorhabdin S H12 HB 300 Cyclo(L pro L tyr)idiketopiperazi ne 1

PAGE 209

209 LIST OF REFERENCES 1. Abhirosh C., A. Mazumder, S. Varghese, and A. Thomas 2004. Influence of a Salt Water Regulator on the Survival Response of Salmonella Paratyphi in Vembanadu Lake: India, pp. 4 7 63. In Y. Kumar (ed.), Salmonella a diversified superbug. InTech, Rijeka, Croatia. 2. Ackermann M., B. Stecher, N. E. Freed, P. Songhet, W. D. Hardt, and M. Doebeli 2008. Self destructive cooperation mediated by phenotypic noise. Nature 454 :987 90. 3. 2005. Disease risks from foods, England and Wales, 1996 2000. Emerging infectious diseases 11 :365 72. 4. Ahmer B. M., J. van Reeuwijk, C. D. Timmers, P. J. Valentine, and F. Heffron 1998 Salmonella typhimurium encodes an SdiA homolog, a putative quorum sensor of the LuxR family, that regulates genes on the virulence plasmid. Journal of bacteriology 180 :1185 93. 5. Ahmer B. M., J. van Reeuwijk, P. R. Watson, T. S. Wallis, and F. Heffron 1999. Salmonella SirA is a global regulator of genes mediating enteropathogenesis. Molecular microbiology 31 :971 82. 6. Alagely A., S. Rajamani, and M. Teplitski 2011. Luminescent reporters and their applications for the characterization of signals and si gnal mimics that alter LasR mediated quorum sensing. Methods in molecular biology 692 :113 30. 7. Alcaine S. D., Y. Soyer, L. D. Warnick, W. L. Su, S. Sukhnanand, J. Richards, E. D. Fortes, P. McDonough, T. P. Root, N. B. Dumas, Y. Grhn, and M. Wiedmann 2 006. Multilocus sequence typing supports the hypothesis that cow and human associated Salmonella isolates represent distinct and overlapping populations. Applied and environmental microbiology 72 :7575 85. 8. Allam B., C. Paillard, and M. Auffret 2000. Al terations in hemolymph and extrapallial fluid parameters in the Manila clam, Ruditapes philippinarum, challenged with the pathogen Vibrio tapetis. Journal of invertebrate pathology 76 :63 9. 9. Anderson K. L., J. E. Whitlock, and V. J. Harwood 2005. Persis tence and differential survival of fecal indicator bacteria in subtropical waters and sediments. Applied and environmental microbiology 71 :3041 8. 10. Anderson M., L. A. Jaykus, S. Beaulieu, and S. Dennis 2011. Pathogen produce pair attribution risk ranki ng tool to prioritize fresh produce commodity and pathogen combinations for further evaluation (P3ARRT). Food Control 22 :1865 1872.

PAGE 210

210 11. Arrach N., M. Zhao, S. Porwollik, R. M. Hoffman, and M. McClelland 2008. Salmonella promoters preferentially activated inside tumors. Cancer research 68 :4827 32. 12. Arrus K. M., R. A. Holley, K. H. Ominski, M. Tenuta, and G. Blank 2006. Influence of temperature on Salmonella survival in hog manure slurry and seasonal temperature profiles in farm manure storage reservoirs Livestock Science 102 :226 236. 13. Aruscavage D., P. L. Phelan, K. Lee, and J. T. LeJeune 2010. Impact of changes in sugar exudate created by biological damage to tomato plants on the persistence of Escherichia coli O157:H7. Journal of food science 75 :M 187 92. 14. Arvanitidou M., K. Kanellou, and D. G. Vagiona 2005. Diversity of Salmonella spp. and fungi in northern Greek rivers and their correlation to fecal pollution indicators. Environmental research 99 :278 84. 15. Atkinson S., and P. Williams 2009. Quorum sensing and social networking in the microbial world. Journal of the Royal Society, Interface 6 :959 78. 16. Babitzke P., and T. Romeo 2007. CsrB sRNA family: sequestration of RNA binding regulatory proteins. Current opinion in microbiology 10 :156 63. 17. Bacon G. A., T. W. Burrows, and M. Yates 1950. The effects of biochemical mutation on the virulence of Bacterium typhosum: the virulence of mutants. British journal of experimental pathology 31 :714 24. 18. Bailey A. M., A. Ivens, R. Kingsley, J. L Cottell, J. Wain, and L. J. V. Piddock 2010. RamA, a member of the AraC/XylS family, influences both virulence and efflux in Salmonella enterica serovar Typhimurium. Journal of bacteriology 192 :1607 16. 19. Baloda S. B., L. Christensen, and S. Trajcevsk a 2001. Persistence of a Salmonella enterica serovar typhimurium DT12 clone in a piggery and in agricultural soil amended with Salmonella contaminated slurry. Applied and environmental microbiology 67 :2859 62. 20. Barak J. D., L. Gorski, P. Naraghi Arani, and A. O. Charkowski 2005. Salmonella enterica virulence genes are required for bacterial attachment to plant tissue. Applied and environmental microbiology 71 :5685 91. 21. Barak J. D., L. C. Kramer, and L. Y. Hao 2011. Colonization of tomato plants by Salmonella enterica is cultivar dependent, and type 1 trichomes are preferred colonization sites. Applied and environmental microbiology 77 :498 504. 22. Barak J. D., and A. S. Liang 2008. Role of soil, crop debris, and a plant pathogen in Salmonella enter ica contamination of tomato plants. PloS One 3 :e1657.

PAGE 211

211 23. Bassler B. L., M. Wright, and M. R. Silverman 1994. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pa thway. Molecular microbiology 13 :273 86. 24. Baudart J., K. Lemarchand, A. Brisabois, and P. Lebaron 2000. Diversity of Salmonella strains isolated from the aquatic environment as determined by serotyping and amplification of the ribosomal DNA spacer regi ons. Applied and environmental microbiology 66 :1544 52. 25. Bauer W. D., and U. Mathesius 2004. Plant responses to bacterial quorum sensing signals. Current opinion in plant biology 7 :429 33. 26. Bearson B. L., and S. M. D. Bearson 2008. The role of the QseC quorum sensing sensor kinase in colonization and norepinephrine enhanced motility of Salmonella enterica serovar Typhimurium. Microbial pathogenesis 44 :271 8. 27. Beleneva I. A., N. V. Zhukova, Le lanH, and D. H. Ngueyen Tran 2007. Taxonomic composit ion of bacteria associated with cultivated mollusks Crassostrea lugubris and Perna viridis and with the water of the Gulf of Nha Trang Lagoon, Vietnam. Mikrobiologiia 76 :253 62. 28. Ben Abdallah F., K. Chaieb, M. Snoussi, A. Bakhrouf, and K. Gaddour 2007. Phenotypic variations and molecular identification of Salmonella enterica serovar Typhimurium cells under starvation in seawater. Current microbiology 55 :485 91. 29. Berger C. N., S. V. Sodha, R. K. Shaw, P. M. Griffin, D. Pink, P. Hand, and G. Frankel 2 010. Fresh fruit and vegetables as vehicles for the transmission of human pathogens. Environmental microbiology 12 :2385 97. 30. Bleasdale B., P. J. Lott, A. Jagannathan, M. P. Stevens, R. J. Birtles, and P. Wigley 2009. The Salmonella pathogenicity island 2 encoded type III secretion system is essential for the survival of Salmonella enterica serovar Typhimurium in free living amoebae. Applied and environmental microbiology 75 :1793 5. 31. Blume E., M. Bischoff, J. M. Reichert, T. Moorman, A. Konopka, and R F. Turco 2002. Surface and subsurface microbial biomass, community structure and metabolic activity as a function of soil depth and season. Applied Soil Ecology 20 :171 181. 32. Bodman S. B. Von, W. D. Bauer, and D. L. Coplin 2003. Quorum sensing in pla nt pathogenic bacteria. Annual review of phytopathology 41 :455 82. 33. Borlee B. R., G. D. Geske, C. J. Robinson, H. E. Blackwell, and J. Handelsman 2008. Quorum sensing signals in the microbial community of the cabbage white butterfly larval midgut. Isme Journal 2 :1101 1111.

PAGE 212

212 34. Boyen F., F. Pasmans, F. Van Immerseel, E. Morgan, N. Botteldoorn, M. Heyndrickx, J. Volf, H. Favoreel, J. P. Hernalsteens, R. Ducatelle, and F. Haesebrouck 2008. A limited role for SsrA/B in persistent Salmonella Typhimurium inf ections in pigs. Veterinary microbiology 128 :364 73. 35. Brandl M. T. 2006. Fitness of human enteric pathogens on plants and implications for food safety. Annual review of phytopathology 44 :367 92. 36. Brandl M. T. 2008. Plant lesions promote the rapid mul tiplication of Escherichia coli O157:H7 on postharvest lettuce. Applied and environmental microbiology 74 :5285 9. 37. Brandl M. T., M. Q. Carter, C. T. Parker, M. R. Chapman, S. Huynh, and Y. Zhou 2011. Salmonella Biofilm Formation on Aspergillus niger In volves Cellulose Chitin Interactions. PLoS One 6 :e25553. 38. Brandl M. T., W. G. Miller, A. H. Bates, and R. E. Mandrell 2005. Production of autoinducer 2 in Salmonella enterica serovar Thompson contributes to its fitness in chickens but not on cilantro leaf surfaces. Applied and environmental microbiology 71 :2653 62. 39. Brandl M. T., B. M. Rosenthal, A. F. Haxo, and S. G. Berk 2005. Enhanced survival of Salmonella enterica in vesicles released by a soilborne Tetrahymena species. Applied and environmen tal microbiology 71 :1562 9. 40. Brands D. A., S. J. Billington, J. F. Levine, and L. A. Joens 2005. Genotypes and antibiotic resistance of salmonella newport isolates from U.S. market oysters. Foodborne pathogens and disease 2 :111 4. 41. Brands D. A., A. E. Inman, C. P. Gerba, C. J. Mar, S. J. Billington, L. A. Saif, J. F. Levine, and L. A. Joens 2005. Prevalence of Salmonella spp. in oysters in the United States. Applied and environmental microbiology 71 :893 7. 42. Brillhart C. D., and L. A. Joens 2011 Prevalence and characterization of Salmonella serovars isolated from oysters served raw in restaurants. Journal of food protection 74 :1025 9. 43. Brown S. P., R. F. Inglis, and F. Taddei 2009. Evolutionary ecology of microbial wars: within host competit ion and (incidental) virulence. Evolutionary Applications 2 :32 39. 44. Brown S. P., L. Le Chat, and F. Taddei 2008. Evolution of virulence: triggering host inflammation allows invading pathogens to exclude competitors. Ecology letters 11 :44. 45. Bundesen H. N. 1925. Typhoid Epidemic in Chicago apparently due to Oysters. The Journal of the American Medical Association 84 :641 650.

PAGE 213

213 46. Butt A. A., K. E. Aldridge, and C. V. Sanders 2004. Infections related to the ingestion of seafood Part I: Viral and bacteri al infections. The Lancet infectious diseases 4 :201 12. 47. Callaway T. R., T. S. Edrington, R. C. Anderson, J. A. Byrd, and D. J. Nisbet 2008. Gastrointestinal microbial ecology and the safety of our food supply as related to Salmonella. Journal of anima l science 86 :E163 72. 48. Camilli A., and B. L. Bassler 2006. Bacterial small molecule signaling pathways. Science 311 :1113 6. 49. Canesi L., C. Pruzzo, R. Tarsi, and G. Gallo 2001. Surface interactions between Escherichia coli and hemocytes of the Medit erranean mussel Mytilus galloprovincialis lam. leading to efficient bacterial clearance. Applied and environmental microbiology 67 :464 8. 50. Canesi L., G. Gallo, M. Gavioli, and C. Pruzzo 2002. Bacteria hemocyte interactions and phagocytosis in marine bi valves. Microscopy research and technique 57 :469 76. 51. Cappuyns A. M., K. Bernaerts, J. Vanderleyden, and J. F. Van Impe 2009. A dynamic model for diauxic growth, overflow metabolism, and AI 2 mediated cell cell communication of Salmonella Typhimurium b ased on systems biology concepts. Biotechnology and bioengineering 102 :280 93. 52. Castaeda Chvez M. D. R., V. Pardio Sedas, E. Orrantia Borunda, and F. Lango Reynoso 2005. Influence of water temperature and salinity on seasonal occurrences of Vibrio ch olerae and enteric bacteria in oyster producing areas of Veracruz, Mxico. Marine pollution bulletin 50 :1641 8. 53. Castro D., M. J. Pujalte, L. Lopez Cortes, E. Garay, and J. J. Borrego 2002. Vibrios isolated from the cultured manila clam (Ruditapes phil ippinarum): numerical taxonomy and antibacterial activities. Journal of applied microbiology 93 :438 47. 54. Catalao Dionisio L. P., M. Joao, V. S. Ferreiro, M. L. Fidalgo, M. E. Garca Rosado, and J. J. Borrego 2000. Occurrence of Salmonella spp in estuar ine and coastal waters of Portugal. Antonie van Leeuwenhoek 78 :99 106. 55. Center for Science in the Public Interest 2004. Closing the gap in our federal food safety net. Washington, D.C. 56. Centers for Disease Control and Prevention (CDC) 2011. Foodbor ne Diseases Active Surveillance Network (FoodNet): FoodNet Surveillance Report for 2009 (Final Report). 57. Centers for Disease Control and Prevention (CDC) 2007. Multistate outbreaks of Salmonella infections associated with raw tomatoes eaten in restaura nts -United States, 2005 2006. Morbidity and mortality weekly report 56 :909 11.

PAGE 214

214 58. Chao W. L., R. S. Chen, and C. L. Tai 1988. Factors affecting the survival of pathogenic bacteria in subtropical river water. Chinese journal of microbiology and immunolog y 21 :85 92. 59. Chatterjee A., Y. Cui, and A. K. Chatterjee 2002. RsmA and the quorum sensing signal, N [3 oxohexanoyl] L homoserine lactone, control the levels of rsmB RNA in Erwinia carotovora subsp. carotovora by affecting its stability. Journal of bac teriology 184 :4089 95. 60. Cheng T. C. 1992. Selective induction of release of hydrolases from Crassostrea virginica hemocytes by certain bacteria. Journal of Invertebrate Pathology 59 :197 200. 61. Cheng T. C., and K. H. Howland 1979. Chemotactic attracti on between hemocytes of the oyster, Crassostrea virginica, and bacteria. Journal of Invertebrate Pathology 33 :204 210. 62. Cherepanov P. P., and W. Wackernagel 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp catalyz ed excision of the antibiotic resistance determinant. Gene 158 :9 14. 63. Choi J., D. Shin, and S. Ryu 2007. Implication of quorum sensing in Salmonella enterica serovar typhimurium virulence: the luxS gene is necessary for expression of genes in pathogeni city island 1. Infection and immunity 75 :4885 90. 64. Chythanya R., I. Karunasagar, and I. Karunasagar 2002. Inhibition of shrimp pathogenic vibrios by a marine Pseudomonas I 2 strain. Aquaculture 208 :1 10. 65. Cirillo D. M., R. H. Valdivia, D. M. Monack, and S. Falkow 1998. Macrophage dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survival. Molecular microbiology 30 :175 88. 66. Clarke M. B., D. T. Hughes, C. Zhu, E. C. Boedeker, and V. Sperandio 2006. The QseC sensor kinase: a bacterial adrenergic receptor. Proceedings of the National Academy of Sciences of the United States of America 103 :10420 5. 67. Clarke M. B., and V. Sperandio 2005. Transcriptional autoregulation by quorum sensi ng Escherichia coli regulators B and C (QseBC) in enterohaemorrhagic E. coli (EHEC). Molecular microbiology 58 :441 55. 68. Colwell R. R., and J. Liston 1960. Microbiology of shellfish. Bacteriological study of the natural flora of Pacific oysters (Crassos trea gigas). Applied microbiology 8 :104 9. 69. Conner C. P., D. M. Heithoff, S. M. Julio, R. L. Sinsheimer, and M. J. Mahan 1998. Differential patterns of acquired virulence genes distinguish Salmonella strains. Proceedings of the National Academy of Scie nces of the United States of America 95 :4641 5.

PAGE 215

215 70. Cooley M. B., W. G. Miller, and R. E. Mandrell 2003. Colonization of Arabidopsis thaliana with Salmonella enterica and enterohemorrhagic Escherichia coli O157:H7 and competition by Enterobacter asburiae. Applied and environmental microbiology 69 :4915 26. 71. Cornax R., and P. Romero 1990. Survival of pathogenic microorganisms in seawater. Current microbiology 20 :293 298. 72. Coulthurst S. J., K. S. Lilley, and G. P. C. Salmond 2006. Genetic and proteomi c analysis of the role of luxS in the enteric phytopathogen, Erwinia carotovora. Molecular plant pathology 7 :31 45. 73. Cox J. 2000. Salmonella, pp. 1928 37. In R.K. Robinson, C.A. Batt, and P. Patel (eds.), Encyclopedia of food microbiology. Academic Pres s Ltd, San Diego, CA. 74. Critzer F. J., and M. P. Doyle 2010. Microbial ecology of foodborne pathogens associated with produce. Current opinion in biotechnology 21 :125 30. 75. Croci L., E. Suffredini, L. Cozzi, and L. Toti 2002. Effects of depuration of molluscs experimentally contaminated with Escherichia coli, Vibrio cholerae 01 and Vibrio parahaemolyticus. Journal of applied microbiology 92 :460 5. 76. Cruz Romero M., A. L. Kelly, and J. P. Kerry 2008. Effects of high pressure treatment on the microfl ora of oysters (Crassostrea gigas) during chilled storage. Innovative Food Science & Emerging Technologies 9 :441 447. 77. Cui Y., A. Chatterjee, and a K. Chatterjee 2001. Effects of the two component system comprising GacA and GacS of Erwinia carotovora s ubsp. carotovora on the production of global regulatory rsmB RNA, extracellular enzymes, and harpinEcc. Molecular plant microbe interactions 14 :516 26. 78. Curriero F. C., J. a Patz, J. B. Rose, and S. Lele 2001. The association between extreme precipitat ion and waterborne disease outbreaks in the United States, 1948 1994. American journal of public health 91 :1194 9. 79. Dame R. 1996. Ecology of marine bivalves: an ecosystem approach. CRC Press, Boca Raton, FL. 80. Danyluk M. D., M. Nozawa Inoue, K. R. Hri stova, K. M. Scow, B. Lampinen, and L. J. Harris 2008. Survival and growth of Salmonella Enteritidis PT 30 in almond orchard soils. Journal of applied microbiology 104 :1391 9. 81. Datsenko K. A., and B. L. Wanner 2000. One step inactivation of chromosoma l genes in Escherichia coli K 12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America 97 :6640 5. 82. Davies C. M., and L. M. Evison 1991. Sunlight and the survival of enteric bacteria in natural waters. The J ournal of applied bacteriology 70 :265 74.

PAGE 216

216 83. Davies J. 2009. Everything depends on everything else. Clinical microbiology and infection 15 Suppl 1 :1 4. 84. Davies J., G. B. Spiegelman, and G. Yim 2006. The world of subinhibitory antibiotic concentrations Current opinion in microbiology 9 :445 53. 85. DePaola A., J. L. Jones, J. Woods, W. Burkhardt, K. R. Calci, J. A. Krantz, J. C. Bowers, K. Kasturi, R. H. Byars, E. Jacobs, D. Williams Hill, and K. Nabe 2010. Bacterial and viral pathogens in live oysters : 2007 United States market survey. Applied and environmental microbiology 76 :2754 68. 86. Defoirdt T., R. Crab, T. K. Wood, P. Sorgeloos, W. Verstraete, and P. Bossier 2006. Quorum sensing disrupting brominated furanones protect the gnotobiotic brine shr imp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates. Applied and environmental microbiology 72 :6419 23. 87. Deiwick J., T. Nikolaus, S. Erdogan, and M. Hensel 1999. Environmental regulation of Sa lmonella pathogenicity island 2 gene expression. Molecular microbiology 31 :1759 73. 88. Picard, M. Elasri, A. Carlier, R. Berruyer, A. Petit, P. Williams, and Y. Dessaux 2005. N hexanoyl L homoserin e lactone, a mediator of bacterial quorum sensing regulation, exhibits plant dependent stability and may be inactivated by germinating Lotus corniculatus seedlings. FEMS microbiology ecology 52 :13 20. 89. Dillon R. J., C. T. Vennard, A. Buckling, and A. K. Charnley 2005. Diversity of locust gut bacteria protects against pathogen invasion. Ecology Letters 8 :1291 1298. 90. Dobretsov S., M. Teplitski, and V. Paul 2009. Mini review: quorum sensing in the marine environment and its relationship to biofouling. Biofouling 25 :413 427. 91. Dobretsov S., M. Teplitski, M. Bayer, S. Gunasekera, P. Proksch, and V. J. Paul 2011. Inhibition of marine biofouling by bacterial quorum sensing inhibitors. Biofouling 27 :893 905. 92. Dong Y. H., L. H. Wang, J. L. Xu, H. B. Zha ng, X. F. Zhang, and L. H. Zhang 2001. Quenching quorum sensing dependent bacterial infection by an N acyl homoserine lactonase. Nature 411 :813 7. 93. Dong Y., A. L. Iniguez, B. M. M. Ahmer, and E. W. Triplett 2003. Kinetics and strain specificity of rhi zosphere and endophytic colonization by enteric bacteria on seedlings of Medicago sativa and Medicago truncatula. Applied and environmental microbiology 69 :1783 90.

PAGE 217

217 94. Duan K., C. Dammel, J. Stein, H. Rabin, and M. G. Surette 2003. Modulation of Pseudomo nas aeruginosa gene expression by host microflora through interspecies communication. Molecular microbiology 50 :1477 91. 95. Duan K., and M. G. Surette 2007. Environmental regulation of Pseudomonas aeruginosa PAO1 Las and Rhl quorum sensing systems. Journ al of bacteriology 189 :4827 36. 96. Dubuis C., and D. Haas 2007. Cross species GacA controlled induction of antibiosis in pseudomonads. Applied and environmental microbiology 73 :650 4. 97. Duperthuy M., J. Binesse, F. Le Roux, B. Romestand, A. Caro, P. Go t, A. Givaudan, D. Mazel, E. Bachre, and D. Destoumieux Garzn 2010. The major outer membrane protein OmpU of Vibrio splendidus contributes to host antimicrobial peptide resistance and is required for virulence in the oyster Crassostrea gigas. Environmen tal microbiology 12 :951 63. 98. Duperthuy M., P. Schmitt, E. Garzn, A. Caro, R. D. Rosa, F. Le Roux, N. Lautrdou Audouy, P. Got, B. Romestand, J. de Lorgeril, S. Kieffer Jaquinod, E. Bachre, and D. Destoumieux Garzn 2011. Use of OmpU porins for attach ment and invasion of Crassostrea gigas immune cells by the oyster pathogen Vibrio splendidus. Proceedings of the National Academy of Sciences of the United States of America 108 :2993 8. 99. Dyszel J. L., J. N. Smith, D. E. Lucas, J. A. Soares, M. C. Sweari ngen, M. A. Vross, G. M. Young, and B. M. M. Ahmer 2010. Salmonella enterica serovar Typhimurium can detect acyl homoserine lactone production by Yersinia enterocolitica in mice. Journal of bacteriology 192 :29 37. 100. Edwards T. M., B. K. Smith, D. L. Wa tts, C. C. Germain Aubrey, A. M. Roark, S. M. Bybee, C. E. Cox, H. J. Hamlin, and L. J. Guillette 2011. Group Advantaged Training of Research (GATOR): A Metamorphosis of Mentorship. BioScience 61 :301 311. 101. Eilers K. G., S. Debenport, S. Anderson, and N. Fierer 2012. Digging deeper to find unique microbial communities: The strong effect of depth on the structure of bacterial and archaeal communities in soil. Soil Biology and Biochemistry 50 :58 65. 102. Ellermeier C., and J. Slauch 2006. The Genus Salm onella, pp. 123 158. In M. Dworkin, S. Falkow, E. Rosenberg, K. H. Schleifer, and E. Stackebrandt (eds.), Prokaryotes. Springer, New York, NY. 103. Eriksson A. R. B., R. A. Andersson, M. Pirhonen, and E. T. Palva 1998. Two component regulators involved in the global control of virulence in Erwinia carotovora subsp. carotovora. Molecular plant microbe interactions 11 :743 52.

PAGE 218

218 104. Evison L. 1988. Comparative studies on the survival of indicator organisms and pathogens in fresh and sea water. Water Science & TechnologyTechnology 20 :309 315. 105. Eyre J. W. H. 1923. Some notes on the bacteriology of the Oyster. Journal of the Royal Microscopical Society 385 389. 106. Fatica M. K., and K. R. Schneider 2011. Salmonella and produce: Survival in the plant environm ent and implications in food safety. Virulence 2 :1 7. 107. Federle M. J. 2009. Autoinducer 2 based chemical communication in bacteria: complexities of interspecies signaling. Contributions to microbiology 16 :18 32. 108. Fernandez Piquer J., J. P. Bowman, T Ross, and M. L. Tamplin 2012. Molecular analysis of the bacterial communities in the live Pacific oyster (Crassostrea gigas) and the influence of postharvest temperature on its structure. Journal of applied microbiology 112 :1134 43. 109. Fierer N., J. P Schimel, and P. A. Holden 2003. Variations in microbial community composition through two soil depth profiles. Soil Biology and Biochemistry 35 :167 176. 110. Filho Lima J. V., E. C. Vieira, and J. R. Nicoli 2000. Antagonistic effect of Lactobacillus ac idophilus, Saccharomyces boulardii and Escherichia coli combinations against experimental infections with Shigella flexneri and Salmonella enteritidis subsp. typhimurium in gnotobiotic mice. Journal of applied microbiology 88 :365 70. 111. Fish J. T., and G W. Pettibone 1995. Influence of freshwater sediment on the survival of Escherichia coli and Salmonella sp. as measured by three methods of enumeration. Letters in applied microbiology 20 :277 81. 112. Foster J. W., and M. P. Spector 1995. How Salmonella survive against the odds. Annual review of microbiology 49 :145 74. 113. Fraiser M., and J. Koburger 1983. Incidence ofSsalmonellae in Clams, Oysters, Crabs and Mullet Harvested from two Locations in Florida, pp. 126 133. In Proceedings of the eighth annual Tropical and Subtropical Fisheries Conference of the Americas. 114. Franz E., and A. H. C. van Bruggen 2008. Ecology of E. coli O157:H7 and Salmonella enterica in the primary vegetable production chain. Critical reviews i n microbiology 34 :143 61.

PAGE 219

219 115. Franz E., A. D. van Diepeningen, O. J. de Vos, and A. H. C. van Bruggen 2005. Effects of cattle feeding regimen and soil management type on the fate of Escherichia coli O157:H7 and salmonella enterica serovar typhimurium in manure, manure amended soil, and lettuce. Applied and environmental microbiology 71 :6165 74. 116. Garca R., J. Baelum, L. Fredslund, P. Santorum, and C. S. Jacobsen 2010. Influence of temperature and predation on survival of Salmonella enterica serovar T yphimurium and expression of invA in soil and manure amended soil. Applied and environmental microbiology 76 :5025 31. 117. Garland C. D., G. V. Nash, and T. A. McMeekin 1982. Absence of surface associated microorganisms in adult oysters (Crassostrea gigas ). Applied and environmental microbiology 44 :1205 11. 118. Gauthier J. D., M. K. Jones, P. Thiaville, J. L. Joseph, R. A. Swain, C. J. Krediet, P. A. Gulig, M. Teplitski, and A. C. Wright 2010. Role of GacA in virulence of Vibrio vulnificus. Microbiology 156 :3722 33. 119. Gaze W. H., N. Burroughs, M. P. Gallagher, and E. M. H. Wellington 2003. Interactions between Salmonella typhimurium and Acanthamoeba polyphaga, and observation of a new mode of intracellular growth within contractile vacuoles. Microbial ecology 46 :358 69. 120. Geiger J., W. E. Ward, and M. Jacobson 1926. The Bacterial Flora of Market Oysters. The Journal of Infectious Diseases 38 :273 280. 121. Genthner F. J., A. K. Volety, L. M. Oliver, and W. S. Fisher 1999. Factors influencing in vit ro killing of bacteria by hemocytes of the eastern oyster (Crassostrea virginica). Applied and environmental microbiology 65 :3015 20. 122. Gerba C. P., and J. E. Smith 2005. Sources of pathogenic microorganisms and their fate during land application of wa stes. Journal of environmental quality 34 :42 8. 123. Glynn J. R., and D. J. Bradley 1992. The relationship between infecting dose and severity of disease in reported outbreaks of Salmonella infections. Epidemiology and infection 109 :371 88. 124. Goatcher L., and D. Westhoff 1975. Repression of Vibrio parahaemolyticus by Pseudomonas species isolated from processed oysters. Journal of Food Science 40 :533 536. 125. Golberg D., Y. Kroupitski, E. Belausov, R. Pinto, and S. Sela 2011. Salmonella Typhimurium in ternalization is variable in leafy vegetables and fresh herbs. International journal of food microbiology 145 :250 7.

PAGE 220

220 126. Gonzalez M., Y. Gueguen, G. Desserre, J. de Lorgeril, B. Romestand, and E. Bachre 2007. Molecular characterization of two isoforms o f defensin from hemocytes of the oyster Crassostrea gigas. Developmental and comparative immunology 31 :332 9. 127. Gonzlez Barrios A. F., R. Zuo, Y. Hashimoto, L. Yang, W. E. Bentley, and T. K. Wood 2006. Autoinducer 2 controls biofilm formation in Esche richia coli through a novel motility quorum sensing regulator (MqsR, B3022). Journal of bacteriology 188 :305 16. 128. Goodman A. L., B. Kulasekara, A. Rietsch, D. Boyd, R. S. Smith, and S. Lory 2004. A signaling network reciprocally regulates genes associ ated with acute infection and chronic persistence in Pseudomonas aeruginosa. Developmental cell 7 :745 54. 129. Goodman A. L., M. Merighi, M. Hyodo, I. Ventre, A. Filloux, and S. Lory 2009. Direct interaction between sensor kinase proteins mediates acute a nd chronic disease phenotypes in a bacterial pathogen. Genes & development 23 :249 59. 130. Gorski L., C. T. Parker, A. Liang, M. B. Cooley, M. T. Jay Russell, A. G. Gordus, E. R. Atwill, and R. E. Mandrell 2011. Prevalence, distribution, and diversity of Salmonella enterica in a major produce region of California. Applied and environmental microbiology 77 :2734 48. 131. Gourabathini P., M. T. Brandl, K. S. Redding, J. H. Gunderson, and S. G. Berk 2008. Interactions between food borne pathogens and protozoa isolated from lettuce and spinach. Applied and environmental microbiology 74 :2518 25. 132. Griffith K. L., and R. E. Wolf 2002. Measuring beta galactosidase activity in bacteria: cell growth, permeabilization, and enzyme assays in 96 well arrays. Biochem ical and biophysical research communications 290 :397 402. 133. Guber A. K., Y. A. Pachepsky, D. R. Shelton, and O. Yu 2007. Effect of bovine manure on fecal coliform attachment to soil and soil particles of different sizes. Applied and environmental micro biology 73 :3363 70. 134. Gueguen Y., R. Bernard, F. Julie, S. Paulina, D. G. Delphine, V. Franck, B. Philippe, and B. Evelyne 2009. Oyster hemocytes express a proline rich peptide displaying synergistic antimicrobial activity with a defensin. Molecular im munology 46 :516 22. 135. Guisande J., M. Montes, R. Farto, S. Armada, M. Perez, and T. Nieto 2004. A set of tests for the phenotypic identification of culturable bacteria associated with Galician bivalve mollusc production. Journal of Shellfish Research 2 3 :599 609. 136. Gulig P. A., K. L. Bourdage, and A. M. Starks 2005. Molecular Pathogenesis of Vibrio vulnificus. Journal of microbiology 43 :118 31.

PAGE 221

221 137. Gunn J. S., W. J. Belden, and S. I. Miller 1998. Identification of PhoP PhoQ activated genes within a duplicated region of the Salmonella typhimurium chromosome. Microbial pathogenesis 25 :77 90. 138. Haley B. J., D. J. Cole, and E. K. Lipp 2009. Distribution, Diversity, and Seasonality of Waterborne Salmonellae in a Rural Watershed. Applied and Environme ntal Microbiology 75 :1248 1255. 139. Hall Stoodley L., J. W. Costerton, and P. Stoodley 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nature reviews. Microbiology 2 :95 108. 140. Hamilton S., R. J. M. Bongaerts, F. Mulholla nd, B. Cochrane, J. Porter, S. Lucchini, H. M. Lappin Scott, and J. C. D. Hinton 2009. The transcriptional programme of Salmonella enterica serovar Typhimurium reveals a key role for tryptophan metabolism in biofilms. BMC genomics 10 :599. 141. Hardie K. R ., and K. Heurlier Microbiology 6 :635 43. 142. Hariharan H., J. Giles, S. Heaney, G. Arsenault, N. McNair, and D. Rainnie 1995. Ba cteriological studies on mussels and oysters from six river systems in Prince Edward Island, Canada. Journal of Shellfish Research 14 :527 532. 143. Hartland B. J., and J. F. Timoney 1979. In Vivo clearance of enteric bacteria from the hemolymph of the har d clam and the American oyster. Applied and environmental microbiology 37 :517 20. 144. Haznedaroglu B. Z., O. Zorlu, J. E. Hill, and S. L. Walker 2010. Identifying the role of flagella in the transport of motile and nonmotile Salmonella enterica serovars. Environmental science & technology 44 :4184 90. 145. Heinitz M. L., R. D. Ruble, D. E. Wagner, and S. R. Tatini 2000. Incidence of Salmonella in fish and seafood. Journal of food protection 63 :579 92. 146. Heinzinger N. K., S. Y. Fujimoto, M. A. Clark, M. S. Moreno, and E. L. Barrett 1995. Sequence analysis of the phs operon in Salmonella typhimurium and the contribution of thiosulfate reduction to anaerobic energy metabolism. Journal of bacteriology 177 :2813 20. 147. Heithoff D. M., C. P. Conner, P. C. H anna, S. M. Julio, U. Hentschel, and M. J. Mahan 1997. Bacterial infection as assessed by in vivo gene expression. Proceedings of the National Academy of Sciences of the United States of America 94 :934 9.

PAGE 222

222 148. Hensel M., J. E. Shea, S. R. Waterman, R. Mun dy, T. Nikolaus, G. Banks, A. Vazquez Torres, C. Gleeson, F. C. Fang, and D. W. Holden 1998. Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and prolifera tion in macrophages. Molecular microbiology 30 :163 74. 149. Hernndez Zrate G., and J. Olmos Soto 2006. Identification of bacterial diversity in the oyster Crassostrea gigas by fluorescent in situ hybridization and polymerase chain reaction. Journal of a pplied microbiology 100 :664 72. 150. Iida Y., R. Honda, M. Nishihara, and K. Muroga 2000. Bacterial flora in the digestive tract of cultured pacific oyster. Fish Pathology 35 :173 177. 151. Iniguez A. L., Y. Dong, H. D. Carter, B. M. M. Ahmer, J. M. Stone, and E. W. Triplett 2005. Regulation of enteric endophytic bacterial colonization by plant defenses. Molecular plant microbe interactions 18 :169 78. 152. Inoue H., H. Nojima, and H. Okayama 1990. High efficiency transformation of Escherichia coli with pl asmids. Gene 96 :23 8. 153. Iveson J. B., G. R. Shellam, S. D. Bradshaw, D. W. Smith, J. S. Mackenzie, and R. G. Mofflin 2009. Salmonella infections in Antarctic fauna and island populations of wildlife exposed to human activities in coastal areas of Austr alia. Epidemiology and infection 137 :858 70. 154. Jacobsen C. S., and T. B. Bech 2012. Soil survival of Salmonella and transfer to freshwater and fresh produce. Food Research International 45 :557 566. 155. Janssen W. A. 1974. Oysters: retention and excret ion of three types of human waterborne disease bacteria. Health laboratory science 11 :20 4. 156. Jesudhasan P. R., M. L. Cepeda, K. Widmer, S. E. Dowd, K. A. Soni, M. E. Hume, J. Zhu, and S. D. Pillai 2010. Transcriptome analysis of genes controlled by lu xS/autoinducer 2 in Salmonella enterica serovar Typhimurium. Foodborne pathogens and disease 7 :399 410. 157. Jimnez L., I. Muiz, G. A. Toranzos, and T. C. Hazen 1989. Survival and activity of Salmonella typhimurium and Escherichia coli in tropical fresh water. The Journal of applied bacteriology 67 :61 9. 158. Jokinen C. C., T. A. Edge, W. Koning, C. R. Laing, D. R. Lapen, J. Miller, S. Mutschall, A. Scott, E. N. Taboada, J. E. Thomas, E. Topp, G. Wilkes, and V. P. J. Gannon 2012. Spatial and temporal dri vers of zoonotic pathogen contamination of an agricultural watershed. Journal of environmental quality 41 :242 52. 159. Juhas M., L. Eberl, and B. Tmmler 2005. Quorum sensing: the power of cooperation in the world of Pseudomonas. Environmental microbiolog y 7 :459 71.

PAGE 223

223 160. Junker L. M., and J. Clardy 2007. High throughput screens for small molecule inhibitors of Pseudomonas aeruginosa biofilm development. Antimicrobial agents and chemotherapy 51 :3582 90. 161. Karatan E., and P. Watnick 2009. Signals, regul atory networks, and materials that build and break bacterial biofilms. Microbiology and molecular biology reviews 73 :310 47. 162. Keersmaecker S. C. J. De, K. Sonck, and J. Vanderleyden 2006. Let LuxS speak up in AI 2 signaling. Trends in microbiology 14 : 114 9. 163. Keersmaecker S. C. J. De, C. Varszegi, N. van Boxel, L. W. Habel, K. Metzger, R. Daniels, K. Marchal, D. De Vos, and J. Vanderleyden 2005. Chemical synthesis of (S) 4,5 dihydroxy 2,3 pentanedione, a bacterial signal molecule precursor, and val idation of its activity in Salmonella typhimurium. The Journal of biological chemistry 280 :19563 8. 164. Kendall M. M., D. A. Rasko, and V. Sperandio 2007. Global effects of the cell to cell signaling molecules autoinducer 2, autoinducer 3, and epinephrin e in a luxS mutant of enterohemorrhagic Escherichia coli. Infection and immunity 75 :4875 84. 165. Kennedy V., R. Newell, and A. Eble 1996. The Eastern oyster: Crassostrea virginica. Univ of Maryland Sea Grant College, College Park, Md. 166. Kim S. Y., M. Nishioka, S. Hayashi, H. Honda, T. Kobayashi, and M. Taya 2005. The gene yggE functions in restoring physiological defects of Escherichia coli cultivated under oxidative stress conditions. Applied and environmental microbiology 71 :2762 5. 167. Kim W., and M. G. Surette 2006. Coordinated regulation of two independent cell cell signaling systems and swarmer differentiation in Salmonella enterica serovar Typhimurium. Journal of bacteriology 188 :431 40. 168. Klerks M. M., E. Franz, M. van Gent Pelzer, C. Zijl stra, and A. H. C. van Bruggen 2007. Differential interaction of Salmonella enterica serovars with lettuce cultivars and plant microbe factors influencing the colonization efficiency. The ISME journal 1 :620 31. 169. Kolenbrander P. E., R. J. Palmer, S. Pe riasamy, and N. S. Jakubovics 2010. Oral multispecies biofilm development and the key role of cell cell distance. Nature reviews. Microbiology 8 :471 80. 170. Kong P., B. W. K. Lee, Z. S. Zhou, and C. Hong 2010. Zoosporic plant pathogens produce bacterial autoinducer 2 that affects Vibrio harveyi quorum sensing. FEMS microbiology letters 303 :55 60.

PAGE 224

224 171. Kroupitski Y., D. Golberg, E. Belausov, R. Pinto, D. Swartzberg, D. Granot, and S. Sela 2009. Internalization of Salmonella enterica in leaves is induced by light and involves chemotaxis and penetration through open stomata. Applied and environmental microbiology 75 :6076 86. 172. Grudowska, P. Szczepaniak, and E. Laskowska 2010. An tibiotics promoting oxidative stress inhibit formation of Escherichia coli biofilm via indole signalling. Research in microbiology 161 :847 53. 173. Kueh C. S., and K. Y. Chan 1985. Bacteria in bivalve shellfish with special reference to the oyster. The Jo urnal of applied bacteriology 59 :41 7. 174. La Fuente R. De, N. D. Sonawane, D. Arumainayagam, and A. S. Verkman 2006. Small molecules with antimicrobial activity against E. coli and P. aeruginosa identified by high throughput screening. British journal o f pharmacology 149 :551 9. 175. Laasik E., L. Andresen, and A. Me 2006. Type II quorum sensing regulates virulence in Erwinia carotovora ssp. carotovora. FEMS microbiology letters 258 :227 34. 176. Lambert C., P. Soudant, L. Degremont, M. Delaporte, J. Moa l, P. Boudry, F. Jean, A. Huvet, and J. F. Samain 2007. Hemocyte characteristics in families of oysters, Crassostrea gigas, selected for differential survival during summer and reared in three sites. Aquaculture 270 :276 288. 177. Lambert M. A., and S. G. J. Smith 2009. The PagN protein mediates invasion via interaction with proteoglycan. FEMS microbiology letters 297 :209 16. 178. Lambert M. A., and S. G. J. Smith 2008. The PagN protein of Salmonella enterica serovar Typhimurium is an adhesin and invasin. BMC microbiology 8 :142. 179. Langdon C., and R. Newell 1990. Utilization of detritus and bacteria as food sources by two bivalve suspension feeders, the oyster Crassostrea virginica and the mussel Geukensia demissa. Marine Ecology Progress Series 58 :299 310. 180. Lapidot A., and S. Yaron 2009. Transfer of Salmonella enterica serovar Typhimurium from contaminated irrigation water to parsley is dependent on curli and cellulose, the biofilm matrix components. Journal of food protection 72 :618 23. 181. Lapou ge K., M. Schubert, F. H. T. Allain, and D. Haas 2008. Gac/Rsm signal transduction pathway of gamma proteobacteria: from RNA recognition to regulation of social behaviour. Molecular microbiology 67 :241 53. 182. Lawhon S. D., J. G. Frye, M. Suyemoto, S. Po rwollik, M. McClelland, and C. Altier 2003. Global regulation by CsrA in Salmonella typhimurium. Molecular microbiology 48 :1633 45.

PAGE 225

225 183. Lea W. A., J. Xi, A. Jadhav, L. Lu, C. P. Austin, A. Simeonov, and R. G. Eckenhoff 2009. A high throughput approach f or identification of novel general anesthetics. PloS one 4 :e7150. 184. Lee C. W., A. Y. F. Ng, C. W. Bong, K. Narayanan, E. U. H. Sim, and C. C. Ng 2011. Investigating the decay rates of Escherichia coli relative to Vibrio parahemolyticus and Salmonella T yphi in tropical coastal waters. Water research 45 :1561 70. 185. Lee J., A. Jayaraman, and T. K. Wood 2007. Indole is an inter species biofilm signal mediated by SdiA. BMC microbiology 7 :42. 186. Leschner S., I. V. Deyneko, S. Lienenklaus, K. Wolf, H. Blo ecker, D. Bumann, H. Loessner, and S. Weiss 2012. Identification of tumor specific Salmonella Typhimurium promoters and their regulatory logic. Nucleic acids research 40 :2984 94. 187. Levina N., S. Ttemeyer, N. R. Stokes, P. Louis, M. A. Jones, and I. R. Booth 1999. Protection of Escherichia coli cells against extreme turgor by activation of MscS and MscL mechanosensitive channels: identification of genes required for MscS activity. The EMBO journal 18 :1730 7. 188. Li H., M. G. Parisi, M. Toubiana, M. Ca mmarata, and P. Roch 2008. Lysozyme gene expression and hemocyte behaviour in the Mediterranean mussel, Mytilus galloprovincialis, after injection of various bacteria or temperature stresses. Fish & shellfish immunology 25 :143 52. 189. Lipp E. K., A. Huq, and R. R. Colwell 2002. Effects of global climate on infectious disease: the cholera model. Clinical microbiology reviews 15 :757 70. 190. Lu L., M. E. Hume, and S. D. Pillai 2005. Autoinducer 2 like activity on vegetable produce and its potential involv ement in bacterial biofilm formation on tomatoes. Foodborne pathogens and disease 2 :242 9. 191. Lpez Amors R., J. Comas, and J. Vives Rego 1995. Flow cytometric assessment of Escherichia coli and Salmonella typhimurium starvation survival in seawater us ing rhodamine 123, propidium iodide, and oxonol. Applied and environmental microbiology 61 :2521 6. 192. Macinga D. R., M. M. Parojcic, and P. N. Rather 1995. Identification and analysis N acetyltransferase in Providencia stuartii. Journal of bacteriology 177 :3407 13. 193. Markarian S. A., A. A. Poladyan, G. R. Kirakosyan, A. A. Trchounian, and K. A. Bagramyan 2002. Effect of diethylsulphoxide on growth, survival and ion exchange of Escherichia coli. Letters i n applied microbiology 34 :417 21.

PAGE 226

226 194. Marques J. C., P. Lamosa, C. Russell, R. Ventura, C. Maycock, M. F. Semmelhack, S. T. Miller, and K. B. Xavier 2011. Processing the interspecies quorum sensing signal autoinducer 2 (AI 2): characterization of phospho (S) 4,5 dihydroxy 2,3 pentanedione isomerization by LsrG protein. The Journal of biological chemistry 286 :18331 43. 195. Martinez Urtaza J., and E. Liebana 2005. Investigation of clonal distribution and persistence of Salmonella Senftenberg in the marine environment and identification of potential sources of contamination. FEMS microbiology ecology 52 :255 63. 196. Martinez Urtaza J., M. Saco, G. Hernandez Cordova, A. Lozano, O. Garcia Martin, and J. Espinosa 2003. Identification of Salmonella serovars is olated from live molluscan shellfish and their significance in the marine environment. Journal of food protection 66 :226 32. 197. Martinez Urtaza J., M. Saco, J. de Novoa, P. Perez Pieiro, J. Peiteado, A. Lozano Leon, and O. Garcia Martin 2004. Influence of environmental factors and human activity on the presence of Salmonella serovars in a marine environment. Applied and environmental microbiology 70 :2089 97. 198. Matos A., and J. L. Garland 2005. Effects of community versus single strain inoculants on the biocontrol of Salmonella and microbial community dynamics in alfalfa sprouts. Journal of food protection 68 :40 8. 199. Matsushita M., and K. D. Janda 2002. Histidine kinases as targets for new antimicrobial agents. Bioorganic & medicinal chemistry 10 : 855 67. 200. McDougald D., W. H. Lin, S. A. Rice, and S. Kjelleberg 2006. The role of quorum sensing and the effect of environmental conditions on biofilm formation by strains of Vibrio vulnificus. Biofouling 22 :133 44. 201. Mead P. S., L. Slutsker, V. Di etz, L. F. McCaig, J. S. Bresee, C. Shapiro, P. M. Griffin, and R. V. Tauxe 1999. Food related illness and death in the United States. Emerging infectious diseases 5 :607 25. 202. Merighi M., C. D. Ellermeier, J. M. Slauch, and J. S. Gunn 2005. Resolvase in vivo expression technology analysis of the Salmonella enterica serovar Typhimurium PhoP and PmrA regulons in BALB/c mice. Journal of bacteriology 187 :7407 16. 203. Merighi M., A. N. Septer, A. Carroll Portillo, A. Bhatiya, S. Porwollik, M. McClelland, a nd J. S. Gunn 2009. Genome wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium. BMC microbiology 9 :42. 204. Merrell D. S., and A. Camilli 2000. Detection and analysis of gene expression during infection by in viv o expression technology. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 355 :587 99.

PAGE 227

227 205. Metcalf W. W., W. Jiang, L. L. Daniels, S. K. Kim, A. Haldimann, and B. L. Wanner 1996. Conditionally replicative and conjug ative plasmids carrying lacZ alpha for cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35 :1 13. 206. Mezrioui N., and B. Baleux 1995. A microcosm study of the survival of Escherichia coli and Salmonella typhimurium in brackish water. Wat er research 29 207. Micallef S. A., R. E. Rosenberg Goldstein, A. George, L. Kleinfelter, M. S. Boyer, C. R. McLaughlin, A. Estrin, L. Ewing, J. Jean Gilles Beaubrun, D. E. Hanes, M. H. Kothary, B. D. Tall, J. H. Razeq, S. W. Joseph, and A. R. Sapkota 20 12. Occurrence and antibiotic resistance of multiple Salmonella serotypes recovered from water, sediment and soil on mid Atlantic tomato farms. Environmental research 114 :31 9. 208. Michael B., J. N. Smith, S. Swift, F. Heffron, and B. M. Ahmer 2001. SdiA of Salmonella enterica is a LuxR homolog that detects mixed microbial communities. Journal of bacteriology 183 :5733 42. 209. Michael S., D. Auld, C. Klumpp, A. Jadhav, W. Zheng, N. Thorne, C. P. Austin, J. Inglese, and A. Simeonov 2008. A robotic platfor m for quantitative high throughput screening. Assay and drug development technologies 6 :637 57. 210. Miller C. E., and J. C. Feeley 1975. Competitive effects of intestinal microflora on Vibrio cholerae in gnotobiotic mice. Laboratory animal science 25 :454 8. 211. Miller J. 1972. Experiments in molecular genetics. Cold Springs Harbor Laboratory, Cold Springs Harbor, NY. 212. Miller S. T., K. B. Xavier, S. R. Campagna, M. E. Taga, M. F. Semmelhack, B. L. Bassler, and F. M. Hughson 2004. Salmonella typhimuri um recognizes a chemically distinct form of the bacterial quorum sensing signal AI 2. Molecular cell 15 :677 87. 213. Milton D. L. 2006. Quorum sensing in vibrios: complexity for diversification. International journal of medical microbiology 296 :61 71. 214. Mizusaki H., A. Takaya, T. Yamamoto, and S. I. Aizawa 2008. Signal pathway in salt activated expression of the Salmonella pathogenicity island 1 type III secretion system in Salmonella enterica serovar Typhimurium. Journal of bacteriology 190 :4624 31. 21 5. Monfort P., and G. Piclet 2000. Listeria innocua and Salmonella panama in estuarine water and seawater: a comparative study. Water Research 34 216. Moore B. C., E. Martinez, J. M. Gay, and D. H. Rice 2003. Survival of Salmonella enterica in freshwate r and sediments and transmission by the aquatic midge Chironomus tentans (Chironomidae: Diptera). Applied and environmental microbiology 69 :4556 60.

PAGE 228

228 217. Moore M. M., D. L. Fernandez, and R. L. Thune 2002. Cloning and characterization of Edwardsiella icta luri proteins expressed and recognized by the channel catfish Ictalurus punctatus immune response during infection. Diseases of aquatic organisms 52 :93 107. 218. Moreira C. G., D. Weinshenker, and V. Sperandio 2010. QseC mediates Salmonella enterica serov ar typhimurium virulence in vitro and in vivo. Infection and immunity 78 :914 26. 219. Morrison C. M., A. E. Armstrong, S. Evans, R. M. Mild, C. J. Langdon, and L. A. Joens 2011. Survival of Salmonella Newport in oysters. International journal of food micr obiology 148 :93 8. 220. Morrison C. M., S. M. Dial, W. A. Day, and L. A. Joens 2012. Investigations of Salmonella enterica serovar newport infections of oysters by using immunohistochemistry and knockout mutagenesis. Applied and environmental microbiology 78 :2867 73. 221. Murchelano R. A., and C. Brown 1968. Bacteriological study of the natural flora of the eastern oyster, Crassostrea virginica. Journal of Invertebrate Pathology 11 :519 520. 222. Murphree R. L., and M. L. Tamplin 1995. Uptake and retentio n of Vibrio cholerae O1 in the Eastern oyster, Crassostrea virginica. Applied and environmental microbiology 61 :3656 60. 223. Mh U., M. Schuster, R. Heim, A. Singh, E. R. Olson, and E. P. Greenberg 2006. Novel Pseudomonas aeruginosa quorum sensing inhibi tors identified in an ultra high throughput screen. Antimicrobial agents and chemotherapy 50 :3674 9. 224. Newell R. I. E. 1988. Ecological changes in Chesapeake Bay: Are they the result of overharvesting the American oyster, Crassostrea virginica, pp. 536 546. In Understanding the estuary: advances in Chesapeake Bay research. Chesapeake Research Consortium. 225. Nicholson F. A., S. J. Groves, and B. J. Chambers 2005. Pathogen survival during livestock manure storage and following land application. Bioresou rce technology 96 :135 43. 226. Nikaido E., I. Shirosaka, A. Yamaguchi, and K. Nishino 2011. Regulation of the AcrAB multidrug efflux pump in Salmonella enterica serovar Typhimurium in response to indole and paraquat. Microbiology 157 :648 55. 227. Nikaido E., A. Yamaguchi, and K. Nishino 2008. AcrAB multidrug efflux pump regulation in Salmonella enterica serovar Typhimurium by RamA in response to environmental signals. The Journal of biological chemistry 283 :24245 53.

PAGE 229

229 228. Nishio T., J. Nakamori, and K. Mi yazaki 1981. Survival of Salmonella typhi in oysters. Zentralblatt fr Bakteriologie, Mikrobiologie und Hygiene. 1. Abt. Originale B, Hygiene 172 :415 26. 229. Noel J. T., J. Joy, J. N. Smith, M. Fatica, K. R. Schneider, B. M. M. Ahmer, and M. Teplitski 2 010. Salmonella SdiA recognizes N acyl homoserine lactone signals from Pectobacterium carotovorum in vitro, but not in a bacterial soft rot. Molecular plant microbe interactions 23 :273 82. 230. Noel J. T., N. Arrach, A. Alagely, M. McClelland, and M. Tepli tski 2010. Specific responses of Salmonella enterica to tomato varieties and fruit ripeness identified by in vivo expression technology. PloS one 5 :e12406. 231. Olafsen J. A., H. V. Mikkelsen, H. M. Giaever, and G. Hvik Hansen 1993. Indigenous bacteria in hemolymph and tissues of marine bivalves at low temperatures. Applied and environmental microbiology 59 :1848 54. 232. Old H. N., and S. L. Gill 1940. A Typhoid Fever Epidemic Caused by Carrier 30 :633 40. 233. Osorio C. G., J. A. Crawford, J. Michalski, H. Martinez Wilson, J. B. Kaper, and A. Camilli 2005. Second generation recombination based in vivo expression technology for large scale screening for Vibrio cholerae genes induced during infection of the mouse small intestine. Infection and immunity 73 :972 80. 234. Paranjpye R. N., A. B. Johnson, A. E. Baxter, and M. S. Strom 2007. Role of type IV pilins in persistence of Vibrio vulnificus in Crassostrea virginica oysters. Applied and environmental microbiology 73 :5041 4. 235. Parkins M. D., H. Ceri, and D. G. Storey 2001. Pseudomonas aeruginosa GacA, a factor in multihost virulence, is also essential for biofilm formation. Molecular microbiology 40 :1215 26. 236. Parsek M. R., and P. K. Singh 2003. Bacterial biofilms: an emerging link to disease pathogenesis. Annual review of microbiology 57 :677 701. 237. Parveen S., W. C. Wolf, and G. P. Richards 2003. Uptake, persistence and localization of virulent and avirulent Vibrio vulnificus in the eastern oyster, Crassostrea virginica. Abstracts of the General Meeting of the American Society for Microbiology 103 :Q 080. 238. Parys A. Van, F. Boyen, B. Leyman, E. Verbrugghe, F. Haesebrouck, and F. Pasmans 2011. Tissue Specific Salm onella Typhimurium Gene Expression during Persistence in Pigs. PloS one 6 :e24120.

PAGE 230

230 239. Patel J., and M. Sharma 2010. Differences in attachment of Salmonella enterica serovars to cabbage and lettuce leaves. International journal of food microbiology 139 :41 7. 240. Pereira C. S., J. R. McAuley, M. E. Taga, K. B. Xavier, and S. T. Miller 2008. Sinorhizobium meliloti, a bacterium lacking the autoinducer 2 (AI 2) synthase, responds to AI 2 supplied by other bacteria. Molecular microbiology 70 :1223 35. 241. Per nestig A. K., O. Melefors, and D. Georgellis 2001. Identification of UvrY as the cognate response regulator for the BarA sensor kinase in Escherichia coli. The Journal of biological chemistry 276 :225 31. 242. Pirhonen M., D. Flego, R. Heikinheimo, and E. T. Palva 1993. A small diffusible signal molecule is responsible for the global control of virulence and exoenzyme production in the plant pathogen Erwinia carotovora. The EMBO journal 12 :2467 76. 243. Polo F., M. J. Figueras, I. Inza, J. Sala, J. M. Flei sher, and J. Guarro 1999. Prevalence of Salmonella serotypes in environmental waters and their relationships with indicator organisms. Antonie van Leeuwenhoek 75 :285 92. 244. Prieur D., G. Mevel, J. Nicolas, A. Plusquellec, and M. Vigneulle 1990. Interac tions between bivalve molluscs and bacteria in the marine environment. Oceanography and Marine Biology Annual Review 28 :277 352. 245. Prouty A. M., W. H. Schwesinger, and J. S. Gunn 2002. Biofilm formation and interaction with the surfaces of gallstones b y Salmonella spp. Infection and immunity 70 :2640 9. 246. Pruzzo C., G. Gallo, and L. Canesi 2005. Persistence of vibrios in marine bivalves: the role of interactions with haemolymph components. Environmental microbiology 7 :761 72. 247. Pujalte M. J., M. O rtigosa, M. C. Macin, and E. Garay 1999. Aerobic and facultative anaerobic heterotrophic bacteria associated to Mediterranean oysters and seawater. International microbiology 2 :259 66. 248. Quiroz Santiago C., O. R. Rodas Surez, V. Carlos R, F. J. Fern ndez, E. I. Quiones Ramrez, and C. Vzquez Salinas 2009. Prevalence of Salmonella in vegetables from Mexico. Journal of food protection 72 :1279 82. 249. Quiones B., G. Dulla, and S. E. Lindow 2005. Quorum sensing regulates exopolysaccharide production motility, and virulence in Pseudomonas syringae. Molecular plant microbe interactions 18 :682 93. 250. Rai P. K., and B. D. Tripathi 2007. Microbial contamination in vegetables due to irrigation with partially treated municipal wastewater in a tropical c ity. International journal of environmental health research 17 :389 95.

PAGE 231

231 251. Rasmussen T. B., M. Manefield, J. B. Andersen, L. Eberl, U. Anthoni, C. Christophersen, P. Steinberg, S. Kjelleberg, and M. Givskov 2000. How Delisea pulchra furanones affect quor um sensing and swarming motility in Serratia liquefaciens MG1. Microbiology 146 :3237 44. 252. Rehfuss M. Y. M., C. T. Parker, and M. T. Brandl 2011. Salmonella transcriptional signature in Tetrahymena phagosomes and role of acid tolerance in passage throu gh the protist. The ISME journal 5 :262 73. 253. Rezzonico F., and B. Duffy 2008. Lack of genomic evidence of AI 2 receptors suggests a non quorum sensing role for luxS in most bacteria. BMC microbiology 8 :154. 254. Rhodes M. W., and H. Kator 1988. Surviv al of Escherichia coli and Salmonella spp. in estuarine environments. Applied and environmental microbiology 54 :2902 7. 255. Richards G. M., and L. R. Beuchat 2005. Metabiotic associations of molds and Salmonella Poona on intact and wounded cantaloupe rin d. International journal of food microbiology 97 :327 39. 256. Ristori C. A., S. T. Iaria, D. S. Gelli, and I. N. G. Rivera 2007. Pathogenic bacteria associated with oysters (Crassostrea brasiliana) and estuarine water along the south coast of Brazil. Inte rnational journal of environmental health research 17 :259 69. 257. Roch P. 1999. Defense mechanisms and disease prevention in farmed marine invertebrates. Aquaculture 172 :125 145. 258. Rollenhagen C., and D. Bumann 2006. Salmonella enterica highly express ed genes are disease specific. Infection and immunity 74 :1649 60. 259. Romeo T. 1998. Global regulation by the small RNA binding protein CsrA and the non coding RNA molecule CsrB. Molecular microbiology 29 :1321 1330. 260. Romero J., M. Garca Varela, J. P. Laclette, and R. T. Espejo 2002. Bacterial 16S rRNA gene analysis revealed that bacteria related to Arcobacter spp. constitute an abundant and common component of the oyster microbiota (Tiostrea chilensis). Microbial ecology 44 :365 71. 261. Romero M., R. Avendao Herrera, B. Magarios, M. Cmara, and A. Otero 2010. Acylhomoserine lactone production and degradation by the fish pathogen Tenacibaculum maritimum, a member of the Cytophaga Flavobacterium Bacteroides (CFB) group. FEMS microbiology letters 304 : 131 9.

PAGE 232

232 262. Rosselin M., I. Virlogeux Payant, C. Roy, E. Bottreau, P. Y. Sizaret, L. Mijouin, P. Germon, E. Caron, P. Velge, and A. Wiedemann 2010. Rck of Salmonella enterica, subspecies enterica serovar enteritidis, mediates zipper like internalization. Cell research 20 :647 64. 263. Rowse A. J., and G. H. Fleet 1982. Viability and release of Salmonella charity and Escherichia coli from oyster feces. Applied and environmental microbiology 44 :544 8. 264. Rozen Y., and S. Belkin 2001. Survival of enteric b acteria in seawater. FEMS microbiology reviews 25 :513 29. 265. Saggers E. J., C. R. Waspe, M. L. Parker, K. W. Waldron, and T. F. Brocklehurst 2008. Salmonella must be viable in order to attach to the surface of prepared vegetable tissues. Journal of appl ied microbiology 105 :1239 45. 266. Santamara J., and G. A. Toranzos 2003. Enteric pathogens and soil: a short review. International microbiology 6 :5 9. 267. Santo Domingo J. W., S. Harmon, and J. Bennett 2000. Survival of Salmonella species in river wat er. Current microbiology 40 :409 17. 268. Saulnier D., S. De Decker, P. Haffner, L. Cobret, M. Robert, and C. Garcia 2010. A large scale epidemiological study to identify bacteria pathogenic to Pacific oyster Crassostrea gigas and correlation between virul ence and metalloprotease like activity. Microbial ecology 59 :787 98. 269. Schauder S., K. Shokat, M. G. Surette, and B. L. Bassler 2001. The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum sensing signal molecule. Molecular microbiol ogy 41 :463 76. 270. Schikora A., I. Virlogeux Payant, E. Bueso, A. V. Garcia, T. Nilau, A. Charrier, S. Pelletier, P. Menanteau, M. Baccarini, P. Velge, and H. Hirt 2011. Conservation of salmonella infection mechanisms in plants and animals. PloS one 6 :e2 4112. 271. Semenov A. M., A. A. Kuprianov, and A. H. C. van Bruggen 2010. Transfer of enteric pathogens to successive habitats as part of microbial cycles. Microbial ecology 60 :239 49. 272. Semenov A. V., L. van Overbeek, A. J. Termorshuizen, and A. H. C. van Bruggen 2011. Influence of aerobic and anaerobic conditions on survival of Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium in Luria Bertani broth, farm yard manure and slurry. Journal of environmental management 92 :780 7. 273. Se o J. K., J. M. Crawford, K. L. Stone, and E. J. Noga 2005. Purification of a novel arthropod defensin from the American oyster, Crassostrea virginica. Biochemical and biophysical research communications 338 :1998 2004.

PAGE 233

233 274. Setti I., A. Rodriguez Castro, M P. Pata, C. Cadarso Suarez, B. Yacoubi, L. Bensmael, A. Moukrim, and J. Martinez Urtaza 2009. Characteristics and dynamics of Salmonella contamination along the coast of Agadir, Morocco. Applied and environmental microbiology 75 :7700 9. 275. Shi X., Z. Wu, A. Namvar, M. Kostrzynska, K. Dunfield, and K. Warriner 2009. Microbial population profiles of the microflora associated with pre and postharvest tomatoes contaminated with Salmonella typhimurium or Salmonella montevideo. Journal of applied microbiol ogy 107 :329 38. 276. Shin N., C. Baek, D. Lee, Y. Cho, D. Park, K. Lee, K. Kim, and H. Yoo 2005. luxS and smcR Quorum Sension System of Vibrio vulnificus as an Important Factor for In Vivo Survival. Journal of microbiology and biotechnology 15 :1197 1206. 277. Shirron N., and S. Yaron 2011. Active suppression of early immune response in tobacco by the human pathogen Salmonella Typhimurium. PloS one 6 :e18855. 278. Simental L., and J. Martinez Urtaza 2008. Climate patterns governing the presence and permane nce of salmonellae in coastal areas of Bahia de Todos Santos, Mexico. Applied and environmental microbiology 74 :5918 24. 279. Skindersoe M. E., P. Ettinger Epstein, T. B. Rasmussen, T. Bjarnsholt, R. de Nys, and M. Givskov 2008. Quorum sensing antagonism from marine organisms. Marine biotechnology 10 :56 63. 280. Smith J. N., J. L. Dyszel, J. A. Soares, C. D. Ellermeier, C. Altier, S. D. Lawhon, L. G. Adams, V. Konjufca, R. Curtiss, J. M. Slauch, and B. M. M. Ahmer 2008. SdiA, an N acylhomoserine lactone r eceptor, becomes active during the transit of Salmonella enterica through the gastrointestinal tract of turtles. PloS one 3 :e2826. 281. Smith J. N., and B. M. M. Ahmer 2003. Detection of other microbial species by Salmonella: expression of the SdiA regulo n. Journal of bacteriology 185 :1357 66. 282. Soares J. A., and B. M. M. Ahmer 2011. Detection of acyl homoserine lactones by Escherichia and Salmonella. Current opinion in microbiology 14 :188 93. 283. Solomon E. B., and K. R. Matthews 2006. Interaction o f live and dead Escherichia coli O157:H7 and fluorescent microspheres with lettuce tissue suggests bacterial processes do not mediate adherence. Letters in applied microbiology 42 :88 93. 284. Soni K. A., P. R. Jesudhasan, M. Cepeda, B. Williams, M. Hume, W K. Russell, A. Jayaraman, and S. D. Pillai 2008. Autoinducer AI 2 is involved in regulating a variety of cellular processes in Salmonella Typhimurium. Foodborne pathogens and disease 5 :147 53. 285. Stecher B., and W. D. Hardt 2011. Mechanisms controlli ng pathogen colonization of the gut. Current opinion in microbiology 14 :82 91.

PAGE 234

234 286. Stecher B., and W. D. Hardt 2008. The role of microbiota in infectious disease. Trends in microbiology 16 :107 14. 287. Stecher B., R. Robbiani, A. W. Walker, A. M. Westend orf, M. Barthel, M. Kremer, S. Chaffron, A. J. Macpherson, J. Buer, J. Parkhill, G. Dougan, C. von Mering, and W. D. Hardt 2007. Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota. PLoS biology 5 :2177 8 9. 288. Stephenson K., and J. A. Hoch 2004. Developing inhibitors to selectively target two component and phosphorelay signal transduction systems of pathogenic microorganisms. Current medicinal chemistry 11 :765 73. 289. Stokes N. R., H. D. Murray, C. Sub ramaniam, R. L. Gourse, P. Louis, W. Bartlett, S. Miller, and I. R. Booth 2003. A role for mechanosensitive channels in survival of stationary phase: regulation of channel expression by RpoS. Proceedings of the National Academy of Sciences of the United S tates of America 100 :15959 64. 290. Strawn L. K., K. R. Schneider, and M. D. Danyluk 2011. Microbial safety of tropical fruits. Critical reviews in food science and nutrition 51 :132 45. 291. Sugumar G., and S. Mariappan 2003. Survival of Salmonella sp. i n Freshwater and Seawater Microcosms Under Starvation. Asian fisheries science 16 :247 256. 292. Sun J., R. Daniel, I. Wagner Dbler, and A. P. Zeng 2004. Is autoinducer 2 a universal signal for interspecies communication: a comparative genomic and phyloge netic analysis of the synthesis and signal transduction pathways. BMC evolutionary biology 4 :36. 293. Surette M. G., and B. L. Bassler 1999. Regulation of autoinducer production in Salmonella typhimurium. Molecular microbiology 31 :585 95. 294. Suzuki K., X. Wang, T. Weilbacher, A. karin Pernestig, O. Melefors, D. Georgellis, P. Babitzke, and T. Romeo 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli. Journal of bacteriology 184 :5130 40. 295. Sztajer H., A. Lemme, R. Vil chez, S. Schulz, R. Geffers, C. Y. Y. Yip, C. M. Levesque, D. G. Cvitkovitch, and I. Wagner Dbler 2008. Autoinducer 2 regulated genes in Streptococcus mutans UA159 and global metabolic effect of the luxS mutation. Journal of bacteriology 190 :401 15. 296. Taga M. E., J. L. Semmelhack, and B. L. Bassler 2001. The LuxS dependent autoinducer AI 2 controls the expression of an ABC transporter that functions in AI 2 uptake in Salmonella typhimurium. Molecular microbiology 42 :777 93. 297. Taga M. E. 2005. Metho ds for analysis of bacterial autoinducer 2 production. Current protocols in microbiology Chapter 1 :Unit 1C.1.

PAGE 235

235 298. Taga M. E., S. T. Miller, and B. L. Bassler 2003. Lsr mediated transport and processing of AI 2 in Salmonella typhimurium. Molecular microbi ology 50 :1411 27. 299. Tchawa Yimga M., M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen 2006. Role of gluconeogenesis and the tricarboxylic acid cycle in the virulence of Salmonella enterica serovar Typhimurium in BALB/c mice. Infection and immunity 74 :1130 40. 300. Teplitski M., and B. M. M. Ahmer 2005. The control of secondary metabolism, motility, and virulence by the two component regulatory system BarA/SirA of proteobacteria, pp. 107 132. In B.M. Prss (ed.), Global regulatory networks in enteric bacteria. Research Signpost, Trivandrum, India. 301. Teplitski M., A. Al Agely, and B. M. M. Ahmer 2006. Contribution of the SirA regulon to biofilm formation in Salmonella enterica serovar Typhimurium. Microbiology 152 :3411 24. 302. Teplitski M., J. D. Barak, and K. R. Schneider 2009. Human enteric pathogens in produce: un answered ecological questions with direct implications for food safety. Current opinion in biotechnology 20 :166 71. 303. Teplitski M., R. I. Good ier, and B. M. M. Ahmer 2003. Pathways leading from BarA/SirA to motility and virulence gene expression in Salmonella. Journal of bacteriology 185 :7257 65. 304. Teplitski M., U. Mathesius, and K. P. Rumbaugh 2011. Perception and degradation of N acyl hom oserine lactone quorum sensing signals by mammalian and plant cells. Chemical reviews 111 :100 16. 305. Teplitski M., K. Warriner, J. Bartz, and K. R. Schneider 2011. Untangling metabolic and communication networks: interactions of enterics with phytobacte ria and their implications in produce safety. Trends in microbiology 19 :121 7. 306. Teplitski M., A. C. Wright, and G. Lorca 2009. Biological approaches for controlling shellfish associated pathogens. Current opinion in biotechnology 20 :185 90. 307. Tezca n Merdol D., M. Ljungstrm, J. Winiecka Krusnell, E. Linder, L. Engstrand, and M. Rhen 2004. Uptake and replication of Salmonella enterica in Acanthamoeba rhysodes. Applied and environmental microbiology 70 :3706 14. 308. Than P. P., C. S. Del Castillo, T. Yoshikawa, and T. Sakata 2004. Extracellular protease production of bacteriolytic bacteria isolated from marine environments. Fisheries Science 70 :659 666. 309. Thijs I. M., H. Zhao, A. De Weerdt, K. Engelen, D. De Coster, G. Schoofs, M. McClelland, J. V anderleyden, K. Marchal, and S. C. J. De Keersmaecker 2010. The AI 2 dependent regulator LsrR has a limited regulon in Salmonella Typhimurium. Cell research 20 :966 9.

PAGE 236

236 310. Thomason B. M., D. J. Dodd, and W. B. Cherry 1977. Increased recovery of salmonell ae from environmental samples enriched with buffered peptone water. Applied and environmental microbiology 34 :270 3. 311. Thurston Enriquez J. A., J. E. Gilley, and B. Eghball 2005. Microbial quality of runoff following land application of cattle manure a nd swine slurry. Journal of water and health 3 :157 71. 312. Toth J. D., H. W. Aceto, S. C. Rankin, and Z. Dou 2011. Survival characteristics of Salmonella enterica serovar Newport in the dairy farm environment. Journal of dairy science 94 :5238 46. 313. Ue sugi A. R., M. D. Danyluk, R. E. Mandrell, and L. J. Harris 2007. Isolation of Salmonella Enteritidis phage type 30 from a single almond orchard over a 5 year period. Journal of food protection 70 :1784 9. 314. Vasconcelos G., and J. Lee 1972. Microbial f lora of Pacific oysters (Crassostrea gigas) subjected to ultraviolet irradiated seawater. Applied Microbiology 23 :11 16. 315. Vendeville A., K. Winzer, K. Heurlier, C. M. Tang, and K. R. Hardie 2005. Making 2, LuxS and p athogenic bacteria. Nature reviews. Microbiology 3 :383 96. 316. Venkateswaran K., T. Takai, I. M. Navarro, H. Nakano, H. Hashimoto, and R. J. Siebeling 1989. Ecology of Vibrio cholerae non O1 and Salmonella spp. and role of zooplankton in their seasonal d istribution in Fukuyama coastal waters, Japan. Applied and environmental microbiology 55 :1591 8. 317. Venturi V. 2006. Regulation of quorum sensing in Pseudomonas. FEMS microbiology reviews 30 :274 91. 318. Venturi V., G. Rampioni, S. Pongor, and L. Leoni 2011. The virtue of temperance: built in negative regulators of quorum sensing in Pseudomonas. Molecular microbiology 82 :1060 70. 319. Verstraeten N., K. Braeken, B. Debkumari, M. Fauvart, J. Fransaer, J. Vermant, and J. Michiels 2008. Living on a surface : swarming and biofilm formation. Trends in microbiology 16 :496 506. 320. Voetsch A. C., T. J. Van Gilder, F. J. Angulo, M. M. Farley, S. Shallow, R. Marcus, P. R. Cieslak, V. C. Deneen, and R. V. Tauxe 2004. FoodNet estimate of the burden of illness caus ed by nontyphoidal Salmonella infections in the United States. Clinical infectious diseases 38 :S127 34. 321. Wait D. A., and M. D. Sobsey 2001. Comparative survival of enteric viruses and bacteria in Atlantic Ocean seawater. Water science and technology 4 3 :139 42.

PAGE 237

237 322. Walters M., M. P. Sircili, and V. Sperandio 2006. AI 3 synthesis is not dependent on luxS in Escherichia coli. Journal of bacteriology 188 :5668 81. 323. Walters M., and V. Sperandio 2006. Quorum sensing in Escherichia coli and Salmonella. International journal of medical microbiology 296 :125 31. 324. Walthers D., R. K. Carroll, W. W. Navarre, S. J. Libby, F. C. Fang, and L. J. Kenney 2007. The response regulator SsrB activates expression of diverse Salmonella pathogenicity island 2 promote rs and counters silencing by the nucleoid associated protein H NS. Molecular microbiology 65 :477 93. 325. Wang L., J. Li, J. C. March, J. J. Valdes, and W. E. Bentley 2005. luxS dependent gene regulation in Escherichia coli K 12 revealed by genomic expres sion profiling. Journal of bacteriology 187 :8350 60. 326. Wang Q., J. G. Frye, M. Mcclelland, and R. M. Harshey 2004. Gene expression growth and putative new motility and patho genicity genes. Molecular Microbiology 52 :169 187. 327. Wang X., A. K. Dubey, K. Suzuki, C. S. Baker, P. Babitzke, and T. Romeo 2005. CsrA post transcriptionally represses pgaABCD, responsible for synthesis of a biofilm polysaccharide adhesin of Escherich ia coli. Molecular microbiology 56 :1648 63. 328. Warriner K., and A. Namvar 2010. The tricks learnt by human enteric pathogens from phytopathogens to persist within the plant environment. Current opinion in biotechnology 21 :131 6. 329. Waters C. M., and B L. Bassler 2005. Quorum sensing: cell to cell communication in bacteria. Annual review of cell and developmental biology 21 :319 46. 330. Wells J. M., and J. E. Butterfield 1997. Salmonella Contamination Associated with Bacterial Soft Rot of Fresh Fruit s and Vegetables in the Marketplace. Plant Disease 81 :867 872. 331. Wetz M., A. Lewitus, E. Koepfler, and K. Hayes 2002. Impact of the eastern oyster Crassostrea virginica on microbial community structure in a salt marsh estuary. Aquatic Microbial Ecology 28 :87 97. 332. White A. P., A. M. Weljie, D. Apel, P. Zhang, R. Shaykhutdinov, H. J. Vogel, and M. G. Surette 2010. A global metabolic shift is linked to Salmonella multicellular development. PloS one 5 :e11814. 333. Whitman W. B., D. C. Coleman, and W. J Wiebe 1998. Prokaryotes: the unseen majority. Proceedings of the National Academy of Sciences of the United States of America 95 :6578 83.

PAGE 238

238 334. Widmer K. W., P. R. Jesudhasan, S. E. Dowd, and S. D. Pillai 2007. Differential expression of virulence relat ed genes in A Salmonella enterica serotype typhimurium luxS mutant in response to autoinducer AI 2 and poultry meat derived AI 2 inhibitor. Foodborne pathogens and disease 4 :5 15. 335. Williams P. 2007. Quorum sensing, communication and cross kingdom signa lling in the bacterial world. Microbiology 153 :3923 38. 336. Wilson I. G., and J. E. Moore 1996. Presence of Salmonella spp. and Campylobacter spp. in shellfish. Epidemiology and infection 116 :147 53. 337. Winfield M. D., and E. A. Groisman 2003. Role of nonhost environments in the lifestyles of Salmonella and Escherichia coli. Applied and environmental microbiology 69 :3687 94. 338. Wood T. K. 2009. Insights on Escherichia coli biofilm formation and inhibition from whole transcriptome profiling. Environme ntal microbiology 11 :1 15. 339. Wray C., and A. Wray 2000. Salmonella in domestic animals. CABI Publishing, New York, NY. 340. Wright A. C., R. T. Hill, J. A. Johnson, M. C. Roghman, R. R. Colwell, and J. G. Morris 1996. Distribution of Vibrio vulnificus in the Chesapeake Bay. Applied and environmental microbiology 62 :717 24. 341. Xavier K. B., and B. L. Bassler 2005. Interference with AI 2 mediated bacterial cell cell communication. Nature 437 :750 3. 342. Xavier K. B., S. T. Miller, W. Lu, J. H. Kim, J. Rabinowitz, I. Pelczer, M. F. Semmelhack, and B. L. Bassler 2007. Phosphorylation and processing of the quorum sensing molecule autoinducer 2 in enteric bacteria. ACS chemical biology 2 :128 36. 343. Yamazaki A., J. Li, W. C. Hutchins, L. Wang, J. Ma, A. M. Ibekwe, and C. H. Yang 2011. Commensal effect of pectate lyases secreted from Dickeya dadantii on proliferation of Escherichia coli O157:H7 EDL933 on lettuce leaves. Applied and environmental microbiology 77 :156 62. 344. You Y., S. C. Rankin, H. W. Ace to, C. E. Benson, J. D. Toth, and Z. Dou 2006. Survival of Salmonella enterica Serovar Newport in Manure and Manure Amended Soils. Applied and Environmental Microbiology 72 :5777 5783. 345. Zampini M., L. Canesi, M. Betti, C. Ciacci, R. Tarsi, G. Gallo, an d C. Pruzzo 2003. Role for mannose sensitive hemagglutinin in promoting interactions between Vibrio cholerae El Tor and mussel hemolymph. Applied and environmental microbiology 69 :5711 5.

PAGE 239

239 346. Zhang J. H., T. Chung, and K. Oldenburg 1999. A Simple Statis tical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. Journal of biomolecular screening 4 :67 73. 347. Zhu B. J., and X. Z. Wu 2008. Identification of outer membrane protein ompR from rickettsia like organism and inducti on of immune response in Crassostrea ariakensis. Molecular Immunology 45 :3198 3204.

PAGE 240

240 BIOGRAPHICAL SKETCH Prior to pursui aterial s cience (bi omaterials specialization) and international b usiness (emphasis on s trategic management of tech start ups) at the University of Florida. Clayton then went to work as the Director of Business Development for AngioRay, a biomedical device firm working with anti stenosis technology, in conjunction with the seed stage investme nt firm Synogen. A desire to ret urn to research and understand how microbial level process contribute to environmental health led Clayton to pursue his Ph.D. at UF through the School of Natural Resources and Environment. During his program, Clayton was s upported by the Graduate Alumni Award from U F as well as a Graduate Research Fellowship awarded by the National Science Foundation. During his program C layton was also selected to participate in the Howard Hughes Medical Institute (HHMI) funded Group Advan taged Training of Research (GATOR) tiered mentoring program. The program paired two early stage undergraduate students with graduate student mentors who were in turned mentored by a post doctoral scientist and faculty members. Both of Cox ed posters at the Southeastern and Florida Branch of the American Society for Microbiology annual meeting (November 2008) and the UF Celebration of Undergraduate Creativity in the Und ergraduate Presentation at the Southeastern and Florida Branch ASM meeting. Cox co Advantaged guide to improve u ndergraduate mentoring (100)

PAGE 241

241 Clayton was awarded a certificate in ecological engineering from the D epartment of Environmental Engineering for work during his program and seeks to apply the theroretical concepts learned in the program towards microbial ecology, especially the establishment of invasive pathogens in native communities In his spare time, Clayton enjoys competitive rowing and is a USRowing level 2 certified crew coach who has experience coaching college women, co ed middle school ers an d masters level rowing programs.