Characterization of Human IL-15-Induced Dendritic Cells and Molecular Signaling Mechanisms Involved in Dendritic Cell Ma...

MISSING IMAGE

Material Information

Title:
Characterization of Human IL-15-Induced Dendritic Cells and Molecular Signaling Mechanisms Involved in Dendritic Cell Maturation and Immune Functions
Physical Description:
1 online resource (158 p.)
Language:
english
Creator:
Okada, S
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Immunology and Microbiology (IDP)
Committee Chair:
Chang, Lung-Ji
Committee Members:
Bloom, David C
Scott, Edward W
Terada, Naohiro

Subjects

Subjects / Keywords:
dc -- dendritic-cell -- il-15 -- nk -- stat3 -- stat5 -- t-cell
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Dendritic cells (DCs) have an essential role in inducting and modulating innate and adaptive immunity. The discovery of how to generate large numbers of human immunostimulatory DCs in vitro using monocytes, GM-CSF, and IL-4 lead to numerous studies attempting to exploit the immunogenic nature of DCs for immune therapies. Currently most DC-immune studies and DC-based clinical trials utilize these IL-4 DCs. IL-4 DC-based immunotherapy shows promising results but low efficacy. Thus alternative cytokine combinations to generate DCs with stronger immunostimulatory abilities have been evaluated. DCs generated with GM-CSF and IL-15 (IL-15 DCs) were the first alternative DC subset to the IL-4 DCs that are capable of priming cytolytic CD8+T cell responses. IL-15 DCs stimulate stronger T cells responses than IL-4 DCs,but the mechanism(s) how this occurs is unknown. In our work, IL-15 DCs elicited significantly greater antigen-specific cytolytic CD8+ and CD4+ T cell responses compared to IL-4 DCs. We found that IL-15 DCs were phenotypically less differentiated and mature than IL-4 DCs; however, many surface molecules involved in priming T cells were similarly expressed on both DC subsets. Compared to IL-4 DCs, IL-15 DCs secreted more pro-inflammatory cytokines including IL-6, IFN-G, and TNFa which may facilitate polarization of cytolytic T cell responses. Our assessment of IL-4- and IL-15-mediated molecular signaling pathways indicated that each of the DC subsets have their own distinctive signaling profile which consequentially modulates their particular immune functions. The STAT5, STAT6, and ERK1/2 pathways were significantly more activated in IL-4 DCs compared to IL-15 DCs. IL-15 does not directly activate theSTAT5 or STAT3 pathways in DCs although it strongly up-regulates pSTAT5 levels in lymphocytes. Although IL-15 does not directly activate the conventional STAT pathways, activation of the p38 and STAT3 pathways are increased during IL-15DC maturation but not in IL-4 DCs. Furthermore, the STAT3 pathway appears to regulate IFN-G production in the DCs. These results suggest that in comparison to IL-4 DCs, greater activation of STAT3 in mature IL-15 DCs helps to increase IFN-G production by the IL-15 DCs, and the subsequent polarization of more antigen-specific cytolytic T cell responses.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by S Okada.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Chang, Lung-Ji.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044614:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF HUMAN IL 15 INDUCED DENDRITIC CELLS AND MOLECULAR SIGNALING MECHANISMS INVOLVED IN DENDRITIC CELL MATURATION AND IMMUNE FUNCTIONS By STARLYN OKADA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Starlyn Okada

PAGE 3

3 This is dedicated t o my grandmother who has been my motivation for this journey

PAGE 4

4 AC KNOWLEDGMENTS I thank my pa rents Phyllis Hanta and Howard Okada as well as my younger sister Dawn Okada Grove for their love and patience through the many, many y ears of school and science Thank you for always making life interesting. A special thanks to my mother for her constant support in everything from elementary school aerospace camps to those violin/ukulele/contrabass/swimming/tennis lessons to helping paint fruit fly eggs onto small felt squares I am deeply grateful to my fianc Aaron Rising who has been my anchor. Thank you so much for all of your support, patience and the many cups of coffee Also I am grateful to the Rising family for their concern and support. I thank Dr. Chang for the opportunity to work in his lab and his assistance with th is project Also, I am very grateful to Dr. David Bloom, Dr. Edward Scott, and Dr. Nao hiro Terada for serving on my committee as well as for your support and guidance Thank you all for believing in my potential I am deeply grateful to my former co worker s for being some of friendliest and sincere lab mates in the world I appreciate all of the lab managers including Sh anell Williams, Yingchi Chen, and Yuling Yeh for their cheer and help around the lab I thank Dr. Matthew Cotter and Wayne Chou for their a ssistance with learning flow cytometry. I am very grateful to Dr. Shuhong Han for her endless patience and guidance A nd to Dr. Ekta Patel thank you very much for your companionship. I would not have made it through graduate school without your wit and th oughtful advice.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 OVERVIEW ................................ ................................ ................................ ............ 16 Human Dendritic Cells ................................ ................................ ............................ 16 In Vitro Monocyte derived Dendritic Cells ................................ ......................... 19 T Cells ................................ ................................ ................................ .............. 21 Natural Killer Cells ................................ ................................ ............................ 23 IL 4 ................................ ................................ ................................ .......................... 26 IL 15 ................................ ................................ ................................ ........................ 26 JAK STAT Signaling Pathway ................................ ................................ ................ 29 STAT6 ................................ ................................ ................................ .............. 30 STAT5 ................................ ................................ ................................ .............. 31 STAT3 ................................ ................................ ................................ .............. 32 MAPK Signaling Pathway ................................ ................................ ....................... 33 ERK ................................ ................................ ................................ .................. 35 p38 ................................ ................................ ................................ ................... 35 2 CHARACTERIZATION OF HUMAN MONOCYTE DERIVED IL 15 DCS BY COMPARISON WITH TRADITIONAL IL 4 DCS ................................ ..................... 39 Intro duction ................................ ................................ ................................ ............. 39 Materials and Methods ................................ ................................ ............................ 41 Monocyte Isolation ................................ ................................ ........................... 41 Monocy te derived DC Differentiation and Maturation ................................ ....... 41 Monoclonal Antibodies ................................ ................................ ..................... 42 Flow Cytometry ................................ ................................ ................................ 43 Antigen Uptake Assay ................................ ................................ ...................... 43 Multiplex ELISA ................................ ................................ ................................ 43 Semi quantitative and Quantitative Reverse Transcription P CR ...................... 44 mDC:PBL Co culture ................................ ................................ ........................ 45 Antigen Recall Assay ................................ ................................ ........................ 46 Results ................................ ................................ ................................ .................... 47 Cellular Morphology During DC Differentiation and Maturation ........................ 47

PAGE 6

6 Surface Marker Phenotype of imDCs ................................ ............................... 48 Surface Marker Phenotype of mDCs ................................ ................................ 49 Antigen Uptake by mDCs ................................ ................................ ................. 50 Production of IL 12 and Pro in flammatory Cytokines by mDCs ........................ 50 Pro inflammatory Cytokine Transcript Regulation ................................ ............ 51 CMV specific Memory Immune Responses by CD3 + T Cells ........................... 52 HCV specific Primary Immune Responses by CD3 + T cells ............................. 54 Effect of mIL 15 DC Stimulation on Distribution of T Cell Su bset Populations 55 Effect of Stimulation by IL 15 DCs versus IL 4 DCs on NK Cells ..................... 56 Discussion ................................ ................................ ................................ .............. 57 3 IDENTIFICATION OF DIFFERENTIALLY ACTIVATED STAT OR MAPK SIGNALING PATHWAYS IN IL 4 DCS VERSUS IL 15 DCS AND THEIR EFFECT ON DC MATURATION ................................ ................................ ............. 81 Introduction ................................ ................................ ................................ ............. 81 Materials and Methods ................................ ................................ ............................ 83 Monocyte derived DCs and Monocytic Cell Lines ................................ ............ 83 Monoclonal Antibodies and Inhibitors ................................ ............................... 84 Phospho protein Flow Cytometry ................................ ................................ ..... 84 DC Intracellular Cytokine Flow Cytometry ................................ ........................ 85 Results ................................ ................................ ................................ .................... 86 Expression of Surface Cytokine Receptors on DCs ................................ ......... 86 Identifying the IL 4 DC and the IL 15 DC Basal Signaling Profiles ................... 87 Cytokine Receptor Expression on Monocytic Cell Lines ................................ .. 89 Op timization of Phosphorylated Protein Detection Using Monocytic Cell Lines ................................ ................................ ................................ ............. 89 Direct Induction of STAT and MAPK Signaling in Monocytic Cell Lines by IL 4 or IL 15 ................................ ................................ ................................ ... 90 Direct Activation of STAT and MAPK Pathways During DC Maturation in the Presence of IL 4 or IL 15 ................................ ................................ ............... 91 Effect of STAT3 or p38 MAPK Inhibition on IFN Production in mDCs ................................ ................................ ................................ ............ 92 Discussion ................................ ................................ ................................ .............. 93 4 CONCLUSIONS ................................ ................................ ................................ ... 116 Findings and Future Directions ................................ ................................ ............. 116 Clinical Implications ................................ ................................ .............................. 123 Monocyte derived IL 15 DCs ................................ ................................ .......... 123 Potential Limitations ................................ ................................ ....................... 124 APPENDIX A STIMULATION BY A PARTICULAR DC SUBSET DOES NOT AFFECT NK CELL SUBSET DISTRIBUTIO N OR CYTOLYTIC FUNCTION ............................ 126

PAGE 7

7 B CYTOKINE INDUCED STAT PROTEIN ACTIVATION IN CD3 + T CELLS ........... 128 C ACTIVATION OF MAPK SIGNALING PATHWA YS IN MONOCYTIC CELL LINES BY PMA OR ANISOMYCIN ................................ ................................ ....... 130 D RELATIVE QUANTITATION OF STAT PROTEIN TRANSCRIPT EXPRESSION LEVELS DURING DC DIFFERENTITATION AND MATURATION ....................... 131 E EFFECT OF IL 4 VERSUS IL 15 ON CYTOKINE PRODUCTION BY MATURE DCS ................................ ................................ ................................ ...................... 133 F EFFECT OF CYTOKINE ENVIRONMENT ON LEVEL OF CD3 + T CELL ACTIVATION ................................ ................................ ................................ ........ 135 LIST OF REFERENCES ................................ ................................ ............................. 138 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 158

PAGE 8

8 LIST OF TABLES Table page 2 1 Comparison of cytokine production by mDCs ................................ ..................... 80 E 1 IFN 4 and/or IL 15 .............. 134

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Diagram of the GM CSFR, IL 15R, and IL 4R complexes along with the classically activated STAT or MAPK pathways ................................ ................... 37 1 2 Diagram of the three IL 15 signaling mechanisms ................................ .............. 38 2 1 Cellular morphology of immature and mature DCs generated in the presence of IL 4 or IL 15 ................................ ................................ ................................ .... 65 2 2 Expression of Ag presentation and co stimulation molecules on the imDC subsets ................................ ................................ ................................ ............... 66 2 3 Expression of receptors involved in DC differentiation/matura tion and additional molecules regulating co stimulation and motility on imDC subsets .... 68 2 4 Expression of Ag presentation and co stimulatory molecules on mDC subsets ................................ ................................ ................................ ............... 69 2 5 Expression of receptors involved in DC differentiation/ maturation and additional molecules involved in regulating co stimulation and motility in mDC subsets ................................ ................................ ................................ ............... 71 2 6 Comparison of antigen up take capacities by mDC subsets ............................... 72 2 7 Differential regulation and expression of IFN 6 transcripts in DC subsets ................................ ................................ ................................ ......... 73 2 8 Antigen specific memory T cell responses against CMV pp65 ........................... 74 2 9 Antigen specific primary T cell responses against HCV core ............................. 76 2 10 Distribution of CD4 + and CD8 + T cell subsets after stimulation with Ag pulsed mDCs on day 16 17 of DC :PBL co culture ................................ ......................... 78 2 11 NK cell populations in DC stimulated PBLs are not affected by the subset of DC used to prime PBLs ................................ ................................ ...................... 79 3 1 Expre ssion of cytokine receptors and membrane bound IL 15 detected on immature and mature DC subsets ................................ ................................ .... 103 3 2 Comparison of signaling pathway profiles between the CD11c + imDC subsets 105 3 3 Comparison of signaling pathway profiles between the mature CD11c + DCs .. 107 3 4 Expression of the three cytokine receptors on the monocytic cell lines U937, THP 1, and HL 60 ................................ ................................ ............................ 109

PAGE 10

10 3 5 Temporal activation of the STAT6, STAT5, and STAT3 pathways in U937 cells by cytokine stimulation ................................ ................................ ............. 110 3 6 Direct activation of the STAT6, STAT5, and STAT3 pathways by IL 15, IL 4, or GM CSF in U937 and THP 1 cells ................................ ............................... 111 3 7 Immediate activation of the STAT and MAPK pathways by IL 4 or IL 15 du ring DC maturation ................................ ................................ ....................... 112 3 8 STAT3 inhibition down regulated IFN did not affect IFN production in mDCs ................................ ............. 114 3 9 ........... 115 A 1 Evaluation of NK cell lytic function after being co cultured with mIL 4 DCs or mIL 15 DCs ................................ ................................ ................................ ...... 127 B 1 STAT and MAPK activation in stimulated PBLs ................................ ................ 129 C 1 pERK1/2 and pp38 induction by PMA or anisomycin in monocytic cell lines .... 130 D 1 Quantification of expression of the STAT3, STAT5a, STAT5b, and STAT6 transcript levels in monocytes, imDCs, and mDCs ................................ ........... 13 2 E 1 Presence of IL 15 up relegates IL 6 transcript levels but does not affect IFN or TNF transcripts ................................ ................................ ........................... 134 F 1 Effect of IFN IL 15, IL 6, or all four inflammatory cytokines on the activation of CD3 + T cells ................................ ................................ .................. 137

PAGE 11

11 LIST OF ABBREVIATION S Ag Antigen APC Antigen presenting cell APC A llophycoc yanin BFA Brefeldin A CD Cluster of differentiation cDNA Complementary deoxyribonucleic acid (DNA) CMV H uman cytomegalovirus CyC Cy c hrome CSFE C arboxyfluorescein diacetate, succinimidyl ester DC Dendritic cell DC SIGN Dendritic cell specific intercellul ar adhesion molecule 3 grabbing non integrin DMSO D imethylsulfoxide EDTA E thylenediamine tetraacetic acid ELISA Enzyme linked immunos orbent assay ERK Extracellular signal regulated kinase FBS Fetal bovine serum FITC F l uorescein isothiocyanate C ytokine receptor c ommon subunit gamma (in terleukin 2 receptor subunit gamma ) GM CSF Granulocyte macrophage colony stimulating factor GM CSFR Granulocyte macrophage colony stimulating factor receptor subunit alpha HCV Human h epatitis C virus HLA Histocompatibility leukocyte antigen

PAGE 12

12 JAK Janus kinase IFN Interferon gamma IL 1 Interleukin 1 alpha IL 1 Interleukin 1 beta IL 2R Int erleukin 2 re ceptor subunit beta IL 4 Interleukin 4 IL 4R Inte rleukin 4 receptor subunit alpha IL 6 Interleukin 6 IL 15 Interleukin 15 IL 15R Inter leukin 15 receptor subunit alpha imDC Immature dendritic cell LPS Lipopolysaccharide MAPK M itogen activated protein kina ses mDC Mature dendritic cell MFI Mean fluorescence intensity MHC Major histocompatibility complex NK cell Natural killer cell OVA O valbumin PBL Peripheral blood lymphocyte PBMC Peripheral blood mononuclear cell PBS Phosphate buffered saline PCR Polymeras e chain reaction PD L1 Programmed cell death ligand 1 PE P hycoerythrin PMA P horbol 12 myristate 13 acetate

PAGE 13

13 qRT PCR Quantitative real time polymerase chain reaction RT PCR Reverse transcriptase polymerase chain reaction SEM S tandard error of the mean STAT3 Signal transducer and activator of transcription 3 STAT5 Signal transducer and activator of transcription 5 STAT6 Signal transducer and activator of transcription 6 TBS Tris buffered saline TCR T cell receptor TLR 4 Toll like receptor 4 TNF Tumor necrosis factor alpha

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARA CTERIZATION OF HUMAN IL 15 INDUCED DENDRITIC CE LLS AND MOLECULAR SIGNALING MECHANISMS INVOLVED IN DENDRIT I C CELL MATURATION AND IMMUNE FUNCTIONS By Starlyn Okada August 2012 Chair: Lung Ji Chang Major: Medical Sciences Immunology and Microbiology Dendritic cells (DCs) have an essential role in induct ing and modulating innate and a daptive immunity T he d iscovery of how to generate large numbers of human immunostimulatory DCs in vitro using monocytes, GM CSF and IL 4 lead to numerous studies attempting to exploit the immunogeni c nature of DCs for immun e therapies Currently most DC immune studies and DC based clinical trials utilize these IL 4 DCs. IL 4 DC based immunotherap y show s promising results but low efficacy Thus a lternative cytoki ne combinations to generate DCs with stronge r immunostimulatory abilities have been evaluated DCs generated with GM CSF and IL 15 (IL 1 5 DCs) were the first alternative DC subset to the IL 4 DCs that are capable of priming cytolytic CD8 + T cell responses IL 15 DCs stimulate stronger T cells responses than IL 4 DCs, b ut the mechanism(s) how this occurs is unknown. In our work IL 15 DCs eli cited significantly greater antigen specific cytolytic CD8 + and CD4 + T cell resp onses compared to IL 4 DCs. We found that IL 15 DCs were phenotypically less differentiated and mature than IL 4 DCs; however, many surface molecules involved in priming T cells were similarly expressed on both DC subsets.

PAGE 15

15 C ompared to IL 4 DCs IL 15 DCs secreted more pro inflammatory cytokines including IL 6, IFN and TNF which may facilitate polarizat ion of cytolytic T cell responses. Our a ssessment of IL 4 and IL 15 mediated mo lecular signaling pathways indicated that each of the DC subsets have their own distinctive signaling profile which consequentially modulates their particular immune functions The STAT 5 STAT 6 and ERK1/2 p athways were significantly more activated in IL 4 DCs compared to IL 15 DCs IL 15 does not directly activate the STAT5 or STAT3 pathways in DCs although it strongly up regulates p STAT5 levels in lymphocytes. Although IL 15 does not directly activate the conventional STAT pathways, activation of the p38 and STAT3 pathways are increased during IL 15 DC maturation but not in IL 4 DCs. Furthermore, the STAT3 pathway appears to regulate IFN These results suggest that in comparison to IL 4 DCs, greater activation of STAT3 in mature IL 15 DCs helps to increase IFN production by the IL 15 DCs, and the subsequent polarization of more antigen specific cytolytic T cell responses.

PAGE 16

16 CHAPTER 1 OVERVIEW Huma n Den dritic Cells Dendritic cells (DCs) are bone marrow derived professional antigen presenting cells (APCs) whi ch play an essential role in the induction and modulation of adaptive and innate immune responses. DCs are a heterogeneous population of cells that a re identified primarily by their abilities to up take antigens (Ags) in the peripheral blood and tissues, migrate to lymph nodes, and stimulate lymphocytes responses specifically against the particular Ag DC s were first identified and characterized in mic e by Steinman and Cohn in a series of publications from 1973 to 1974 ( 1 3 ) Since then two major types of human DCs have been recognized which can be differentia ted from each other based on a distinct ive expression pattern of surface markers and unique immune behaviors The se DC types are called m yeloid DCs which are the more conventional and longer studied DC type and more newly discov er ed plasmacytoid DCs (pDC s) which are also referred to as interferon producing cells (IPCs). Human m yeloid DCs are CD11c + TLR4 + TLR7 DC SIGN + whereas pDCs are CD11c low TLR4 TLR7 + IL 3R + dependent on IL 3 rather than GM CSF for differentiation, and secrete very high levels of t ype 1 interferon s (IFN ) ( 4 5 ) In this report, we will focus on the more highly studied myeloid DCs. Myeloid DCs have two distinct fun ctional states, the immature and mature. After differentiation into immature DCs (imDCs), the imDCs enter the peripheral blood into non lymphoid tissues. CD11c + immature DCs (imDCs) typically express a few other DC identifying surface markers such as CD1a and DC specific interc ellular adhesion molecule 3 (ICAM 3) grabbing non in tegrin ( DC SIGN ) CD1a is involved in the

PAGE 17

17 presentation of primarily self or microbial lipid s or glycolipid Ags to T cells and its expression may be sensitive to the availability of serum ( 6 7 ) DC SIGN is considered to be a DC specific surface marker. It is highly expressed on DCs and its e xpression is positively regulated by IL 4 ( 8 ) DC SIGN stabilizes physical interactions between ICAM3 expressing nave T cells and consequently promotes primary T cell responses ( 8 11 ) It is also involved in capturing human immunodeficiency virus (HIV) and the subsequent transmission of HIV to permissive T cells imDCs are functionally characterized by the ir hig h cap ability for endocytosing Ag s or pathog ens allowing the Ags to be processed and eventual present ed to neighboring T cells ( 11 12 ) Ag peptides are presented to T cells by the m ajor histocompatibility complex (MHC) class I or class II molecules in order to elicit CD8 + or CD4 + T cell immune response s respectively imD Cs characteristically exhibit the phenotype of CD14 low CD11c + MHC class I + MHC class II low DC SIGN + co stimulatory molecules (CD80, CD86, CD83) low CCR7 low PD L1 low ( 10 13 14 ) D ue to the low expression levels of the classical co stimulatory molecules (CD80, CD86, CD83) stimulation of T cells by imDCs usu ally induces the T cells to become anergic ( 14 16 ) Also their low expression of MHC class II molecules impairs the physical interactions between imDCs and CD4 + T ce lls. Detection of microbial components via toll like receptors (TLRs) or other similar receptors and/or stimulation by pro in flammatory cytokines induce imDCs to under go maturation. DC maturation is typically marked by reduction in Ag up take capacity as well as the up regulation of MHC class II molecules like HLA DR, co stimulatory molecules such as CD80, CD83, and CD86, as well as the CCR7 recept or on the surface of the

PAGE 18

18 cell. The significant increase in the molecule expression levels correlate with the a bilities of mature DCs (mDCs) to stimulate both CD8 + and CD4 + T cell immune responses, provide a high level of co stimulatory signaling, and effectively mob ilize to the lymphoid organs ( 13 17 ) mDCs also up regulate the surface expression of other co stimulatory molecules such as CD40. Increased expression of CD40 on the activated DCs leads to enhanced production o f IL 12p70 when stimulated by CD40 ligand ( CD40L ) which is expressed on T cells and B cells. Secretion of IL 12 is an important stimulatory factor for T cell activities which will be described in more depth later. Finally another surface marker up regulate d upon DC maturation i s the p rogrammed cell death ligand 1 (PD L1) ( 18 ) PD L1 on mDCs binds to the programmed cell death protein 1 (PD 1) expressed on the surface o f activated T cells and consequentially negat ively regulates the effector functions of the particular T cell The ability to generate large numbers of functional DCs ex vivo has fueled the interest in develop ing DC based immune therapeutic applications tha t can exploit the immunogenic natur e of DCs. Up to now most of the DC vaccine clinical trials use monocyte derived IL 4 DCs that are loaded with a tumor Ag or tumor associated Ag to stimulate immune responses against the particular cancer or virus These DCs would then present the tumor/tumor consequently induce robust cytolytic T cell responses specifically targeting the cancer cells expressing the particular tumor/tumor associated Ag. Many studies have evaluated various DC preparation methods and Ag loading techniques at initiating tumor Ag or viral Ag specific immune responses in vitro and ex vivo including imDCs, mDCs, DCs loaded ex vivo with Ags, DCs that are genetically modified to express spe cific Ag(s),

PAGE 19

19 and DCs loading with defined Ag peptides or solid tumor lysates ( 19 25 ) Nearly all of these DC vaccine strategies except imDCs, are capable of induc ing stro ng Ag specific T cell responses. Additionally, m any of the cancer patients treated with IL 4 DC vaccines demonstrate d Ag specific immune responses ( 19 22 24 26 28 ) However, the major problem that prevents IL 4 DC vaccine strategies from becoming a standard cancer immune treatment is that only a few DC va ccine clinical trials report substantial objective clinical response s. In Vitro Monocyte derived Dendritic Cells In vitro derived human DCs are routinely generated using purified peripheral blood monocytes. The first method to generate human immune stimula tory DCs in vitro was described in 1994 by Sallusto et al ( 29 ) Since then, differentiation of monocyte derived DCs in vitro using GM CSF and IL 4 has been the most used c ombination of cytokines and consequently the most comprehensively characterized human DC subset. As other groups evaluated other factors involved in the process of monocyte to DC differentiation and maturation, it became clear that DC differentiation was a fairly permissive event which is influenced by its surround environmental conditions ( 30 31 ) Monocyte derived DC di fferentiation can be affected by the manner of monocyte purification (magnetic activated cell sorting (MACS) or by plastic adherence), the cell media, and presence of serum ( 7 32 ) Investigations of the effect of different cytokines on DC differentiation determined that GM CSF appeared to be necessary for survival of the monocytes and promote monocyte to DC diffe rentiation over monocyte to macrophage differentiation. The presence of GM CSF is necessary for generating monocyte derived DCs that are capable of eliciting cytolytic IFN producing immune responses. Studies investigated monocyte derived DCs differentiat ed with only IL 4 or IL 3 and IL 4 compared to the

PAGE 20

20 traditional IL 4 DCs showed that the DCs prepared with out GM CSF secreted less IFN and IL 12p70 and less IFN T cell responses than IL 4 DCs ( 33 34 ) IL 4 is used in conjunction with GM CSF since it can also inhibit macrophage differentiation ( 35 ) In the absence of IL 4, monocyte derived DCs that were gene rated with GM CSF alone appear ed less mature due to their lower expression of the classical co stimulatory molecules in comparison to the traditional IL 4 DCs ( 36 38 ) They also secrete d more IL 10 and only low amounts of IL 12, thus indicating that this DC subset would likely stimulate less cytolytic T cell responses than conventional IL 4 DCs. O ther substitutions for IL 4 was used to generate monocyte derived DCs inc luded t hymic stromal lymphopoietin (TSLP), IFN or IL 15 and then their immunostimulatory capabilities were compared to IL 4 DCs DCs generated with GM CSF and TSLP induce d strong proliferation of CD4 + T cell s but did not induce activation of the CD8 + T cell population ( 39 40 ) DCs prepared from monocytes using GM CSF and IFN could not express the typical surfa ce markers associated with DC maturation and demonstrated only limited abilities to stimulate T cell responses compared to the more traditional IL 4 DCs ( 41 ) DCs generated using GM CSF paired with IL 4 which are called IL 15 induced DCs or simply IL 15 DCs ( 42 46 ) I n 2001 Mohamadzadeh et al. and Saikh et al. were the first to independently demonstrate that the presence of IL 15 alone or GM CSF and IL 15 can differentiate monocytes into immune regulatory DCs ( 42 44 ) IL 15 DCs can even be generated by culturing monocytes with conditioned media from alveolar or bronchial epithelial tumor cells that secrete high levels of IL 15 ( 47 ) These I L 15 DCs are the first alterative DC subset to the conventional IL 4 DCs that are capable of

PAGE 21

21 eliciting Ag specific cytolytic CD8 + T cell activity IL 15 DCs were described to express the following DC surface markers CD14 low HLA DR + HLA class I + CD11c + CD86 + at similar expression levels to the classical IL 4 DCs IL 15 DCs can stimulate melanoma specific autologous and allogeneic CD8 + cytolytic T cell responses more efficiently than the conventional IL 4 DCs ( 43 45 ) They were also shown to be able to initiate more cytolytic CD8 + T cells activity against viral Ags as well ( 46 ) And i n contrast with the conventional im IL 4 DCs, stimulation by imIL 15 DCs does not induce immune tolerance but stimulate s CD8 + T cell proliferation. However, how IL 15 DCs stimulate more CD8 + effecto r T cell responses against Ags compared to the more commonly studied IL 4 DCs remains unclear ( 43 45 ) Also how t he molecular signaling mechanisms regulated by either IL 15 or IL 4 affect monocyte derived DC differentiation and/or maturation as well as subsequent immunostimulatory functions are unknown. T C ells T cells can be identified by their expression of the CD3 complex which is an essential component of the overall T cell receptor (TCR) complex. The TCR can recognize fragments of the Ag peptides being presented to them by DCs. T cells can be divided into two major classes that are identified by the expression of one of the two TCR co receptors CD8 or CD4 ( 48 ) CD8 + T cells interact with MHC class I molecules whereas CD4 + T cells assoc iate with MHC class II molecules. U pon activation, CD8 + T cells display Ag specific cytotoxic responses including direct ed cell lysis, degranulation of cytolytic granules containing perforin and granzyme, and production of IFN ( 49 ) In contrast, CD 4 + T cells are traditionally called helper T cell s due to their involvement in facilitating the a ctivation of other immune cells. Upon activation, CD4 + T cells differentiate into specialized CD4 + populations ( 50 51 ) The two most studied types of

PAGE 22

22 CD4 + T cells subsets are the type 1 helper (Th1) and type 2 helper (Th2) cells. Th1 cells characteristically produce IFN IL 2, and TNF against intracellular microbial and viral infections, whereas Th2 typically secrete IL 4, IL 5, and IL 13 to help activate B cells and address extracellu lar parasites In addition CD 8 + and CD 4 + T cell ca n be further sub divided into three functional subsets known as central memory (Tcm), effector memory (Tem), and effector T cell subsets (Teff) ( 52 53 ) These subsets can be identified by the expression of certain surface markers such as markers to indicated differentiation or activated status (CD45RA, CD27, and CD28) and ability to mobilize to lymphoid tissues (CD 62L and CCR7). T cm cells (CD45RA CD27 + CD28 + CD62L + CCR7 + ) are normally found in secondary lymphoid tissues. They exhibit marginal levels of cytolytic activity and are considered to have only a limited migratory potential. T em cells (CD45RA CD27 + CD28 + C D62L CCR7 ) circulate in non lymph oid tissues and exhibit some cytolytic activity Teff cells (CD45RA CD27 CD28 CD62L CCR7 ) produce the highest amounts of IFN As a heterogeneous group of immune cells, DCs are defined by their capacity to elicit Ag specific responses from T cells as measured by consequential T cell proliferat ion, cytolytic activity an d /or production of immunoregulatory cytokines DCs prime Ag specific T cell immune activities by providing three major signals ( 13 54 ) Signal 1 is the presentation of Ag s which is mediated by MHC cla ss I and II molecules and other molecules such as CD1a ( 6 11 54 ) Signal 2 is the sufficiently expression of c o stimulatory molecules such as CD80, CD83, CD86, and CD40 which are up regulated after DC maturation The availability of s ignal 3 determines whether CD4 + T

PAGE 23

23 cells will differentiate into Th1 or Th2 cells or for CD8 + T cells it helps to promote the activation of the cytolytic CD8 + T cell responses. Signal 3 is classically the production of IL 12 by DCs but sign al 3 can also include other pro inflammatory cytokines that induce IFN production ( 50 55 57 ) Natural Killer Cells In addition to priming T cell immune response, DCs can also ac tivate natural killer (NK) cells. NK cells are specialized innate immune cell s that respond to detected viral or pathogen inf ected a nd tumor cells by either lysing the target cell s or se creting immunoregulatory cytokines. Human NK cells are identified as CD3 CD56 + ly m phocytes ( 58 60 ) They, like T cells, are functionally heterogeneous and can be s ub divided into two major subsets based on their distinctive immune activities. These NK cell subsets are often referred to as the cytolytic or immunoregulatory NK cells and can be identified by the differential expression of CD56 and CD16. CD56 is a neural cell adhesion molecule with unknown functionality on NK cells and CD16 which also called Fc receptor III (Fc RIII) binds to antibody coated target cells and then facilitates antibody dependent cellular cytotoxicity (ADCC). Most of the circulating NK cells are CD56 dim CD16 + and considered to be the cytotoxic subset on NK cells. Upon activation, CD56 dim CD16 + NK cell s are readily able to direct ly kill target cells by either exocytosis of cytolytic granules containing perforin and granzyme and/or the death receptor pathway Additionally CD56 dim CD16 + NK cells can exhibit high levels of ADCC which is mediated by CD16 The second major subset of NK cell s are CD56 bright CD16 and commonly referred to as immunoregulatory NK cell s CD56 dim CD16 + NK cells can kill target cells without engagement of CD16 or prior stimulation. Activated CD56 bright CD16

PAGE 24

24 NK cells are generally not efficient at killing their target cells ; however they can produce large amounts of immunoregulatory cytokines such as IFN TNF 10 ( 61 ) Unlike T cells and their TCRs, NK cells do not rearrange genes that encode Ag s pecific receptors for activation Instead they express a variety of surface receptors called the NK cell receptors (NKRs) that can either activate or inhibit the NK cell immune functions. NK cell activation is mediated by the balance of activating and inhi bitory signals from the NKRs as well as the presence of inflammatory cytokines Along with their cytolytic functions, NK cells can regulate immune functions of other cells including T cells and DCs. CD56 bright NK cells secrete high amounts of IFN which can facilitate the polarization of IFN responses by T cells and restrict tumor angiogenesis ( 58 62 63 ) The presence of activated NK cells synergistically enhances the anti tu mor cytolytic T cell responses primed by mDCs ( 64 ) Production of IFN by CD56 bright NK cells is generally based on two signals. The first signal usually being the availability of IL 12 and the second one includes the presence of IL 2, IL 15, IL 18 or stimulation of an NK activating receptor like CD1 6 In contrast, NK cells stimulated wi th IL 12 paired with IL 15 can secret large amounts of the anti inflammatory cytokine IL 10 which can inhibit the T cell IFN responses. Additionally, highly cytolytic NK cells can provide particles of the infected or tumor cells for DCs to up take, process, and present for priming T cell responses. Crosstalk between DC s and NK cells is important for both cell types Cell to cell interaction between DCs and NK cells enhances NK cell cytokine production, proliferation, and cytolytic activity ( 65 67 ) mDCs are the main producers of IL 12 which is essential for inducing IFN production in the NK cells ( 61 ) mDCs also secrete IL 2,

PAGE 25

25 IL 15, and IL 18 which can enhance the production of IFN by the NK cells Furthermore secretion of IL 15 by mDCs help s to maintain the NK cell population and cytotoxicity functions ( 68 70 ) Additi onally mDCs present IL 15 bound to the IL 15 receptor alpha subunit (IL in trans to neighboring NK cells which necessary for NK cell development and survival ( 71 74 ) I L 15 trans presentation is also demonstrated to be essential for NK cell activation and the enhancement of NK cell cytolytic functions ( 72 75 ) In mu rine models it was shown that NK cells are not consistently poised on the brink of activation in vivo thus they require trans presentation of IL 15 by mDCs to prime these resting NK cells for immune activation ( 76 77 ) Soluble IL 15 can bind to IL trans presentation of IL 15 occurs in mDCs co expressing both IL 15 and Il ( 73 78 79 ) NK cells can directly lyse im DC s at high NK cell to DC ratios due to low expression levels of MHC class I molecules on the imDCs, a classic NK cell activation scenario ( 80 81 ) Alternatively, at low NK cell to DC ratios p hysical interaction with NK cell s and the availability of large amoun ts of NK cell derived IFN DC maturation and enhance the immune stimulatory functions of the resulting mDCs ( 67 80 82 83 ) Additionally, NK cells also produce GM CSF which support s DC maturation as well as monocyte to DC differentiation and s urvival ( 63 81 84 ) The decision for NK cells to lyse imDCs or induce maturation was hypothesized to be dependent on the NK cell to DC density but the results of later studies suggested that other factors including DC NK cell co culture duration or culture conditions for imDC differentiation may influence the outc ome ( 77 85 )

PAGE 26

26 IL 4 IL 4 is mainly produced by activated type 2 helper ( Th2 ) CD4 + T cells basophils, and mas t cells ( 86 87 ) IL 4 is a critical factor for inducing differentiation of nave CD4 + T cell s into the specialize d Th2 CD4 + T cell subset. It inhibits IFN transcription which ultimately prevents the differentiation of the nave CD4 + T cells into Th1 cells the other specialized CD4 + T cell subset IL 4 also inhibits the production of inflammatory cytokines such as IL 6, IL 15, and TNF ( 88 ) In DC precursor cells, IL 4 plays a role in the in vitro differentiation of monocyte derived myeloid DCs ( 29 ) It enhances LPS induced maturation and IL 12 production in murine bone marrow derived DCs as well as induce s IL 4 production ( 89 91 ) Moreov er, the presence of IL 4 inhibited the bone marrow precursor cells from differentiating to macrophages, and consequently promoted DC differentiation ( 35 92 ) In hematopoietic cells the IL 4 receptor (IL 4R) is composed of two subunits the IL 4 receptor alpha (IL common gamma chain ( c, CD132) which is a subunit shared among several cytokine receptors in cluding IL 2 and IL 15 ( 87 88 93 94 ) (Figure 1 1) IL 4 signaling is initiated with IL to IL 4 (K d = 20 300 12 M) and then dimerizing with the c chain This leads to the activation of the Janus kinase 1 ( Jak1 ) and Jak3 which are respectively associated with IL 4R and c which, subsequently results in the activation of the signal transducer and activator of transcription 6 (STAT6) ( 86 ) IL 15 IL 15 is pleotropic cytoki ne which is mainly secreted by monocytes and DCs. IL 15 is essential for NK cell devel opment and activation as well as proli feration and maintenance of CD8 + memory T cells ( 68 72 75 95 97 ) IL 15 is highly regulated

PAGE 27

27 through multiple mechanisms at the transcr iptional, translational and the post translational levels ( 98 100 ) IL 15 mR NA is expressed in a wide variety of cells and tissues including monocytes, DCs, epit he lial cells, and fibroblasts but it is absent in T cells ( 98 101 ) The IL 15 transcription is regulate d by the 10 transcriptional initiation sites (AUG sites) in alternative splicing ( 98 102 ) Alternative splicing generates two IL 1 5 isoform precursor proteins which can be distinguished from each other by the length of their signal peptide sequence s ( 102 103 ) One of the IL 15 precursor proteins has a 48 amino acid (aa) long signal peptide (I L 15LSP) and the other has a 21 aa short signal p eptide (IL 15SSP). Notably, t he longer IL 15 isoform is secreted while the shorter isoform is not secret ed. The IL 15LSP precursor protein is translocated to the Golgi apparatus for further protein modification while the IL 15SSP remains in the cytoplasm. While in the Golgi apparatus, the maturing IL 15 protein binds to the IL 15 receptor alpha (IL 15R chain that also localizes in the Golgi apparatus ( 75 104 ) The IL acts as a chaperone protein for the associated IL 15 protein where it directs mobilization from the Golgi apparatus to the surface membrane. IL 15 can also be stored intracellularly until the appropriate stimulation ( LPS or GM CSF ) which then causes the sequestered IL 15 to translocate to t he surface membrane ( 105 ) O nce o n the cell surface, the IL IL 15 complex is released by proteolytic cleavage of matrix metalloproteinases The IL 15 receptor (IL 15R) is composed of IL 15R IL 2 receptor beta ( IL 2R ) and c (Figure 1 1) Unlike IL 4, there are three distinct sig naling mechanisms mediated by IL 15, which occur in different cell types and are commonly called IL 15R mediated signaling reverse signaling, an d trans presentation (Figure 1 2 ). In the classic IL 15R

PAGE 28

28 mediated mechanism, IL 15R first binds to IL 15 and t hen complexes with the IL 2R dimer ( 98 100 ) Jak1 is rapidly recruited to the IL 2R chain to be activated while Jak3, which is associated with the c chain is also activated The p hosphorylated Jak 1 and Jak3 proteins will then activate the STAT3 and STAT5 pathways respectively An alternative IL 15R complex called IL 15RX has been discovered in mast cells ( 98 100 ) The IL 15RX complex is not well studied but it does not associate with the traditional IL the JAK2 STAT5 and tyrosine kinase 2 (TYK2) STAT6 pathways. The IL 15R chain binds IL 15 with very high affinity (K d = 10 11 M) but it does not transduce intracellular signaling by itself ( 101 ) It is needed for IL 15R mediated signaling but seems more involved in anchor ing IL 15 to the membrane of mainly DCs or monocytes The p resenta tion of IL 15 in trans to the IL 2R dimer on a neighboring NK or T cell is another IL 15 signaling mechanism referred to as IL 15 trans presentation ( 73 75 ) IL 15 trans presentation is critical for NK cell development and activation as well as for the maintenance of CD8 + memory T cells ( 68 75 97 ) Addition of soluble IL 15R on the cell surface but IL 15 is mostly likely associated with IL 15R in the cytoplasm of IL 15 producing cells such as monocytes and DCs ( 73 75 79 106 ) IL 15 bound to IL 15R on the cell membrane can undergo trans endosomal recycling which prolongs the effect of IL 15 trans presentation on responding NK and T cells ( 78 ) The e ngagement of IL 15 with the IL 2R (K d =~10 9 M) activates the Jak1 STAT3 and Jak3 STAT5 pathways in a similar manner as the IL 15R mediated mechanism

PAGE 29

29 The third IL 15 signaling mechanism called IL 15 reverse signaling also involves biologically active membrane bound IL 15 on mon ocytes and monocytic cell lines H owever in this mechanism, IL 15 is not attached to the surface membrane using the IL 15R chain but an unidentified anchor ( 107 108 ) Cross linking membrane bound IL 15 using anti IL 15 antibodies on monocytes activated Rac3, a Rho GTPase involved in actin rearrang ement and consequently increased cellular adherence ( 109 ) In prostate cancer and renal cancer cells, activation of the membrane bound IL 15 leads to phosphorylation and activation of focal adhesion kinase 1 (FAK) which mediates cell motility and adhesion ( 107 110 ) Additionally, c ross linking of the IL 15 on the cell surface also act ivates two mitogen activated protein kinase (MAPK) family members the extracellular signal regulated kinase 1/2 (ERK1/2) and p38 ( 107 109 110 ) Activation of ERK1/2 and p38 in monocytes and monocytic cell lines increase d production of the inflammatory IL 8, IL 6, and TNF mRNA transcript and protein levels ( 107 109 ) JAK STAT Signaling Pathway T he Jak STAT signaling pathway is activated by many cytokines, growth facto rs, and hormones. The Jak kinase family consists of four protein kin ases JAK1, JAK2, JAK3, and TYK 2. Jak kinases are usually bound to the cytoplasmic domain s of their receptors, where they function to phosphorylate tyrosine residues on the receptor chains and recruited STAT proteins. There are seven STAT proteins STAT1, STAT2, STAT3, STAT4, STAT5a ST AT5b and STAT6 Before activation the non phosphorylated STAT proteins are mainly found in the cytoplasm. Activated STAT proteins have dual functions as mole cular signaling molecules in the cytoplasm and transcription factors (TFs) in the nucleus Each STAT family protein responds to a defined set of cytokines, and each also regulates, with other transcription factors and/or

PAGE 30

30 cofactors, a group of specific gene s. In this report we will focus on STAT6, STAT5, and the STAT3 proteins since they are known to be d irectly activated by at least one of the three cytokines used in IL 4 DC or IL 15 DC differentiation. The start of the JAK STAT signaling cascade begins wi th receptor cytokine association leading to the dimerization or trimerization of all of the activated receptor subunits This allows the associated JAK s to become activated and cross cytoplasmic domai ns. The phospho tyrosine residues consequently recruit certain STAT proteins to these docking sites After binding to the phospho tyrosine docking site with their Src homology 2 (SH2) domain, the STAT proteins are phosphorylated by nearby JAK s, released fr om the receptor, form homo or hetrodimers and then translocate into the nucleus to regulate target gene transcription Depending on the particular STAT protein, STAT proteins either bind directly to the STAT specific DNA binding sequence in the gene prom oter called interferon (IFN) activated sequences (GAS) or first associate with co activator proteins such as p300 and creb binding protein (CBP) before binding to the gene promoter ( 111 113 ) The phosphorylated state of the STAT protein is transient due to its numerous negative regulatory mechanisms Phosphorylation is negatively re gulated by wide array of proteins ranging from protein tyrosine dephosphorylases, pro tein inhibitors of activated STATs (PIASs ) which directly bind to tyrosine phosphatases s uppressor of cytokine signaling ( SOCS ) which bind phospho tyrosine sites on the receptor and/or the JAK catalytic sites ( 114 116 ) STAT6 IL 4 is the primary activator for the STAT6 pathway ( 117 119 ) STAT6 activation occurs by the phos phorylation of tyrosine 641 (Tyr641) by the IL 4R associated JAK1

PAGE 31

31 associated JAK3 Phosphorylation of STAT6 (pSTAT6) leads to their homodimerization before they are translocated to the nucleus. STAT6 is necessary for IL 4 responsiveness by T cells and differentiation into Th2 cells which character istically secrete IL 4 and stimulate B cells immune responses. Activation of the STAT6 pathway induces transcription of genes involve with diff erentiation and functions of Th2 cells such as MHC class II, IL 4 and IL 4R ( 112 118 120 121 ) pSTAT6 also negativ ely regulates the transcription of genes associated with Th1 cell differentiation and functions like IFN in addition to anti apoptosis genes such as GATA3 BCL xL and BCL 2 Murine STAT6 knock out (KO) models demonstrated the necessity of the STAT6 pathway for IL 4 mediated signaling ( 117 122 ) STAT6 KO mi ce were deficient for Th2 cells Additionally, l ymphocytes from STAT6 KO mice could not up regulate the normally IL 4 responsive MHC class II and IL 4R upon IL 4 stimulation. STAT5 STAT5 a and STAT5 b protein s but in some cell types it sometimes is used to describe the STAT5a and/or STAT5b homodimers STAT5a and STAT5b are by independently encoded by two genes and share about 96% homology with each other at the protein level Both proteins are e xpressed in many types of cells and tissues but some cells and tissues predominantly express much higher amounts of only one of the STAT5 proteins. For exampl e, STAT5a is the preferred form in the mammary gland yet in the liver STAT5b is more favored STAT5 protein ( 123 124 ) STAT5a and STAT5b are activated by a wide range of cytokines and growth factors, including IL 2, IL 7, IL 15, GM CSF growth hormone, and prolactin U pon appropriate stimulation, Tyr694 is phosphorylated on STAT5a and Tyr699 is phosphorylated on STAT5b ( 125 ) Activated STAT5a and

PAGE 32

32 STAT5b can heterodimerize or occasionally homodimerize which may be dependent on cell type. Originally STAT 5a was determined to be necessary for prolactin signaling and subsequent ly directed mammary gland development, whereas STAT5b is essential in growth factor mediated signaling and involved in body mass growth in males ( 111 112 124 126 127 ) Only when both STAT proteins were knocked out were there more severe immunological deficiencies such as reduction in the number of circulating NK and T cells. Recently, p STAT5 has also been discovered to be essential for the developmen t and/or maintenance of pDCs, regulatory T cells (Tregs), and NK cells by regulating the transcription of TFs essential for those immune cell types such as forkhead box P3 (Fox P3 ) for Tregs and interferon regulatory factor 8 ( IRF8 or interferon consensus s equence binding protein (ICSBP )) which negatively regulates pDC development ( 126 128 129 ) In addition to the FoxP3 and IRF8 genes, STAT5 is a transcriptional activator of many other genes involved myeloid DC differentiation (Id2) survival (c myc, Bcl x, cyclinD1) and negative regulatory proteins for its own pathway (Socs 1, Socs 3, Cis 1 ) ( 111 123 126 130 ) C onstitutive activation of STAT5 is frequently observed in many myeloid related leukemi a types and solid tumors STAT3 STAT3 is activated by several ligands such as IL 6, IL 10 and epidermal growth f actor (EGF) which results in phosphorylation of the STAT3 protein on Tyr 705 by JAK1, JAK 2 or TYK2 ( 131 133 ) STAT3 is also phosphorylated on a serine residue Ser 7 27 by an unidentified kinase ( 120 131 134 ) Phosphorylation of Ser727 does not affect the phosphorylation of the two tyrosine residues nor does it enhance nuclear translocation

PAGE 33

33 of the activated STAT3 dimer Ser727 phosphorylation has been suggested to increase the DNA binding capacity of activated STAT3 but it has no t been definitively proven yet. Upon activation, STAT3 homodimerizes with another activated STAT3 or heterodimerizes with an activated STAT1 protein. Activation of STAT 3 positively regulates transcription of anti apoptosis genes such as c myc Bcl 2, BCL x L, and cyclin D1 ( 120 132 133 135 ) Activated STAT3 also up regulates transcription of IL 6 and IL 10 and down regulates transcription of IFN and IL 12 as well as MHC class II molecules and co stimulatory molecules (CD80, CD86) ( 135 136 ) Due to it positive regulation of inflammatory cytokines and anti apoptotic genes constitutive activation of STAT3 is found in many cancer types such as leukemias, lymphomas, breast c arcinoma, and multiple myeloma ( 120 132 133 135 137 ) STAT3 is essential for embryonic development since attempts to establish a murine STAT3 KO model has proven to be embryonic lethal. However c ondition al STAT3 KO in murine macrophages and neutrophils displayed enhanced production of inflammatory cytokines like TNF IL 1, and IFN ( 136 ) The increased IFN TNF and IL 6 production by murine macrophages, NK cells or tumor cells after disruption of the STAT3 signaling pathway resulted in enhanced anti tumo r T cell r esponses ( 120 137 ) Recently, other murine conditional STAT3 KO and inhibition of the up stream JAK (JAK2) in murine DCs indicated that activation of STAT3 is detrimental for DC immunostim ulatory functions ( 138 139 ) MAPK Signaling Pathway M itogen activated protein kinases (MAPKs) are ubiquitou sly expressed serine threonine kinases that regulate a plethora of diverse cellular activity including gene expression, metabolism, motility/adhesion, survival/apoptosis, and differentiation ( 140

PAGE 34

34 145 ) There are three major groups of MAPKs characterized in mammals, the extracellular signal regulated kinase (ERK) family c Jun am ino terminal kinase (JNK ) family and the p38 family. W e will focus on the ERK 1 and 2 kin ases ( ERK1/2 ) and the p38 kinase family in this report since they are activated by at least one of the cytokines used for DC differentiation and maturation ( 86 146 149 ) Each MAPK group is activated by a distinct kinase cascade which is initiated by activation of a MAPK group specific MAPK kinase kinase (MAPKKK or MAP 3K) or a MAPK/ERK kinase kinase (MEKK), which then phosphorylates a downstream MAPK kinase (MAPKK or MAP2K ) or a MAPK/ERK kinase (MEK), that subsequently activates the MAPK protein The MAPK protein is activated by dual phosphorylat ion of two threonine and tyrosine residues that are located within activati on loops of the kinase P hosphorylation of both of the threonine and tyrosine residues causes activation loops which originally sterically hinder access to the kinase catalytic sites, to undergo conformational changes which, then, allow the kinase to asso ciate with its substrate MAPK protein activities are negatively regulated by three general groups of phosphat ases that exhibit a preference for deph osphorylating phospho tyrosine or phospho serine/ threonine. The last group of phosphatases readily dephosph orylate both tyrosine and serine/threonine residues and are called a dual s (D U SP s ) ( 142 ) MAPK proteins are activated by a variety of dif ferent stimuli, but in gen eral, ERK1/2 are mainly activated by growth factors and phorbol esters whereas the p38 kinases are more responsive to cellular stress (oxidative stress, DNA damage) and cytokine stimulation. LPS mediated activation of the ERK1/2 and/or p38 pathways

PAGE 35

35 increas e expression of the classical co stimulatory molecules (CD80, CD86, CD83) and negatively regulate transcription of MHC class II molecules ( 150 152 ) ERK The ERK family contains two isoforms, ERK1 and ERK2, which ar e commonly referred to as ERK1/2 collectively due to their structural and functional similarities ERK1 and ERK2 are also called p44 MAPK or p42 MAPK respectively (or p44/42 MAPK) ERK is activated by th e p hosphorylation of both Thr202 and Tyr204 residues on ERK1 and residues Thr183 and Tyr185 on ERK2 ERK1/2 is activated by many growth factors (epidermal growth factor (EGF) and GM CSF) phorbal esters LPS, and inflammatory cytokines (TNF IL 1 ) ( 153 156 ) ERK1/2 activation induces transcription of TFs such as Egr 1 which in turn enhances transcription of the TNF gene ( 154 ) It can also negatively regulate transcription of TFs like class II transactivator gene ( CIITA ) which is involved in the transcription of MHC class II molecules ( 151 152 ) Activation of ERK1/2 also activates TFs involved in tumor suppression ( p53 ), anti apoptosis ( Bim, Bad Bcl 2, BCL xL ) and ce ll cycle modulation (c myc, p21 CIP1 and cyclin D1). Activation of the ERK1/2 pathway also leads to the phosphorylation of other essential TFs such as c jun, Ets 1, inhibitor kappa B k inase (IKK ), retinoblastoma protein ( Rb), CREB binding protein (CBP), CC AAT/enhancer binding protein ( C/EBP ) and Elk 1 ( 140 155 157 ) Activated Elk 1 ini tiates transcription of c fos which can then dimerize with c jun to form the TF activator protein 1 (AP 1) that is involved in facilitating IFN and GM CSF transcription p38 The p38 MAPK family consists of four isoforms p38 encod ed by separate gene s The p38 isotype s are about 60% homologous with each

PAGE 36

36 another and differentially express ed among various tissues and cell types Of the four p38 kinase isotypes, p38 the most abundant and expressed in most cell types while p38 widely expressed but it is found at lower levels than p38 ( 158 159 ) E xpression of the the mo st cell re stricted which is suggestive of having more specialized functions than p38 p38 In general, p38 becomes activated by the dual phosphorylation at Thr180 and Tyr182 residues in response to cellular stress (oxidative stress or DNA damage) gro wth factors ( GM CSF ) LPS, inflammatory cytokines ( TNF IL 6) and IL 4 ( 146 147 158 160 ) p38 activation regulates transcription of TFs like c fos and CIITA which promotes as well as induces phosphorylation of other TFs such as tumor suppressor p53, onco gene c myc, myocyte enhance factor 2 C (MEF2C), MEF2A, c jun and activating transcription factor 2 (ATF2) Finally, activation of the p38 pathway up regulates production of many pro inflammatory cytokines like IFN IL 1, IL 6, IL 8, IL 12p40 by either inducing transcription o r stabilizing the mRNA t ranscripts and consequently enhancing translation of the cytokine protein.

PAGE 37

37 Figure 1 1 Diagram of the GM CSFR, IL 15R, and IL 4R complexes along with the classically activated STAT or MAPK pathways GM CSFR consists of two GM CSFR chains and two com mon chain s ( c) that forms a h exameric complex when bound to two GM CSF molecules. GM CSF activates STAT5 and ERK1/2 pathways. IL 15R consists of IL 15R IL 2R 15 primarily activates STAT5 but sometimes STAT3. IL 4R consist s of IL 4R 4 activates STAT6 by JAK 1 and JAK 3 as well as the ERK1/2 pathway

PAGE 38

38 Figure 1 2. Diagram of the three IL 15 signaling mechanisms. A) Classical IL 15R mediated activation of STAT3 and STAT5. IL indicated B) IL 15 reverse signaling that occurs on monocytic cells leading to activation of p38 and ERK1/2 MAPK pathways. Membrane bound IL 15 may or may not be attached to membrane by engagement with IL depicted here. C) IL 15 trans presentation from DC to NK cell or T cell which likely results in STAT3 or STAT5 activation

PAGE 39

39 CHAPTER 2 CHARACTERIZATION OF HUMAN MONOCYTE DERIVED IL 15 DCS BY COMPARISON WITH TRADITIONAL IL 4 DCS Introduction Dendritic cells ( D Cs ) are mainly characterized by the extent of the ir abilities to stimulate antigen (Ag) specific T cell responses ( 13 161 163 ) DCs provide three important sign als to activate T cells and induce Ag specific cytolytic responses ( 11 55 56 ) The first two signals are Ag presentation and co stimulation which are essential for Ag specific T cell activation and proliferation. Production of IL 12 or other IFN inducing cytokines is the third required signal for the develop ment of cytolytic effector functions by the activated T cells Monocyte derived DCs can be generated in vitro using a variety of cytokines ( 22 30 31 ) Since 19 94, differentiation of purified monocytes using GM CSF combined with IL 4 has been the most common method for generating the large numbers of DCs necessary for clinical therapies and immune studies ( 29 ) Unlike DC differentia ted using other cytokines, IL 4 DCs c an elicit CD8 + effector T cell and Th1 CD4 + T cell responses which are the highly desired T cells responses in DC based immune therapy strategies ( 43 45 46 ) Monocyte derived IL 4 DCs express high levels of DC specific surface markers such as CD11c, CD1a, and DC SIGN. Matured IL 4 DCs produced high amounts of IL 1 2 as well as up regulate expression of HLA DR, CD80, CD86, and CD83 which all have a significant impact in stimulating Ag specific T cell activities. IL 4 DCs are the only in vitro derived DC subsets capable of stimulating cytolytic Ag specific CD8 + T cell responses. In 2001 Saikh et al. demonstrated that monocytes cultured in IL 15 differentiate into immune stimulatory DCs comparable with the more traditional IL 4 DCs ( 44 ) In

PAGE 40

40 contrast with the more traditionally studied i mIL 4 DCs, imIL 15 DCS were capable of stimulating T cell responses however imIL 15 DCs expressed unusually low levels of the common DC surface markers CD1a and/or DC SIGN ( 42 44 46 ) They also expressed the L angerhans cell specific marker l angerin in three out of four publications that evaluated the expression of langerin on IL 15 DC s ( 42 45 47 ) Maturation of IL 15 DCs was induced by various stimuli depending on the research groups, ranging from LPS alone to coc ktails containing p rostaglandin E 2 (PGE 2 ), TNF IL 1 IL 6. mIL 15 DC s are described to exhibit typical DC morphologically and to be phenotypically alike to the more conventional mIL 4DCs. Both DC subsets exhibit typical hooded veil morphology and ex press comparable levels of MHC class I and HLA DR ( 43 45 ) CD80 ( 45 46 ) and CD86 ( 45 46 ) Expression of CD83 and CD40 differed between the two DC subsets but no correlation between t hese markers and the DC function were reported ( 43 45 47 ) The presence of cytokines that promote T cell effector functions IL 12p70, IFN and soluble IL 15 were not consistently detected in IL 15 DC supernatants ( 43 45 46 164 165 ) Nonetheless, IL 15 DCs have been reported to stimulate Ag specific CD8 + T c ell responses more efficient ly than the traditional IL 4 DCs ( 43 45 ) How IL 15 DCs prime stronger Ag specific cytolytic CD8 + T cell responses compa red to IL 4 DCs is not well understood. Dubsky et al. suggested that IL 15 DCs express greater amounts of an unidentified surface proteins that promotes T cell activation during DC to T cell interactions ( 45 ) suggestion, t he other study comparing anti melanoma CD8 + T cell responses by IL 15 DCs versus IL 4 DCs report ed there was 0.2% more NK cells contaminating the IL 15 DC prepar ations compared to IL 4 DCs This elevated number of NK cells se creted

PAGE 41

41 large amounts of IFN which was hypothesized to enhance CD8 + T cell responses ( 43 ) In this ch apter, we assessed the extent of signals 1, 2, and 3 provided by IL 15 DCs compared to IL 4 DCs t o determine how IL 15 DCs elicit stronger cytolytic T cell responses. We evaluated signal 1 and 2 based on the expression of molecules involved in Ag presentat ion and co stimulation as well as Ag up take. We measured the strength of signal 3 produced by mIL 15 DCs including IFN and IL 15. And finally, we evaluated the immune stimulatory abilities of IL 15 DCs to elicit CD8 + and CD4 + cytolytic T cells responses against CMV or HCV. Materials and Methods Monocyte Isolation Buffy coat preparations from healthy donors were obtained from LifeSouth Civitan Blood Cent er (Gainesville, FL, USA). Peripheral blood mononuclear cells ( PBMCs ) were isolated by gradient density centrifugation in Ficoll Hypaque (GE Healthcare Bio Sciences AB, Piscataway, NJ, USA) Cell v iability was dete rmined by trypan blue staining and then cryogenically frozen until needed. Monocyte derived DC Differentiation and Maturation PBMCs were plated a t 1x10 7 cells/well in 6 well plates using AIM V media (Gibco BR L, Invitrogen, Inc., Carlsbad, CA), then the plates were incubated for 2 hours at 37C to allow for monocyte attachment. Next, n on adherent PBLs were gently washed away and cry ogenically frozen for experiments. M onocytes were cultured in AIM V media supplemented with 50 ng/mL GM CSF (BioSourc e, Invitrogen Inc., Carlsbad, CA ) and either 25 ng/mL IL 4 (BioSource) to generate IL 4 DCs or 100 ng/mL IL 15 (Gentaur Molecular, Brussels, Belgium) to gen erate IL 15 DCs. On the third day fresh AIM V

PAGE 42

42 media containing the same final concentration of cytokines was added to the wells After 5 days, imDCs were harvested using 10 mM EDTA PBS (S igma Aldrich, St. Louis, MO ) and a cell lifter. ImDCs were either cry ogenically stored or cultured with maturation factors. DC maturation was induced by culturing up to 1x10 6 imDCs/well in low adherent 24 well plates with 50 ng/mL TNF (Gentaur) and 1 g/mL LPS (Sigma) in addition to GM CSF and IL 4 or IL 15 at the same final concentrations as before After 24 to 48 hours mDCs were harvested for experimental use Monoclonal Antibodies F luorop hore conjugated monoclonal antibodies again st human CD11c ( clone B ly6 PE ), CD25/ IL clone hIL4R M57 PE), CD1a ( clone HI149 APC), CD40 (clone 5C3, APC), IFN ( clone B27 APC), CD86 ( clone FUN 1 FITC ), CD45RA ( clone HI100 FITC), CD107a/LAMP 1 (clone H4A3, FITC), CD14 ( clone M5E2 pacific b lue), CD3 ( clone UCHT1 pacific blue), CD16 (clone 3G8, pacific blue), CD8 ( clone SK1 APC Cy7), CD80 ( clone L307.4 CyC), CCR7 ( clone 3D12 PE Cy7 ) and CD56 ( clone B159 PE Cy7) were purchased from BD Biosciences (San Diego, CA). CD11c ( clone BU15 FITC ) HLA DR ( clone T36 FITC ), HLA class I ( clone T149 FITC ), CD14 ( clone TK4 FITC), CD3 ( clone S4.1 FITC ) CD83 ( clone HB15e APC ) CD4 ( clone S3.5 PE TexasRed), and CD8 ( clone 3B5 Alexa700 ) antibodies were obtained from Caltag, In vitrogen, Inc., (Ca rlsbad, CA). Antibodies against CD11c ( clone 3.9 PE Cy7 ), PD L1 ( clone MIH1 PE Cy7), IL clone eBioJM7A4 FITC), TLR4 ( clone HTA125 PE), CD27 ( clone M T271 APC), DC SIGN /CD209 ( clone eB h209 APC ) and CD28 ( clone O323 APC Alexa750 ) antibodies we re purchased from eBioscience (San Diego, CA).

PAGE 43

43 Flow Cytometry For analysis of surface proteins, cells were washed with PBS containing 2% fetal bovine serum ( FBS ) (Gibco), blocked with 10% mouse and human serum mixture for 30 min utes at 4 C, incubated with the desired antibodies for 30 minutes at 4 C, washed again, and then fixed with 2% formaldehyde. Cells stained with isotype matched antibodies were used for controls. Data was collected and analyzed using BD FACSAria flow cytometer and Flowjo ( Tree Star, I nc. Ashland, OR ). Isotype value was subtracted from sample value to calculate change in the mean fluorescent index ( MFI) or change in percentage of cells expressing a particular protein ( percentage). Statistical significance between DC subsets was deter mined via two tailed wilcoxon matched pairs signed rank tests with calculated p values being considered significant. Antigen Uptake Assay Donor matched mIL 4 DCs and mIL 15 DCs were incubated with 10 g/mL DQ ovalbumin (DQ OVA; Molecular Probes Inv itro g en, Inc.) in AIM V media for 30 minutes at 37 C. Controls were incubated on ice for 30 minutes with the same concentration of DQ OVA. mDCs were thoroughly washed and the surface stained as described before with anti CD11c Ab. Finally the percentages o f DQ OVA + CD11c + mDCs were determined using the BD LSRII or the BD Caliber flow cytometer. Data was analyzed with Flowjo. S tatistical significance was evaluated by paired, two tailed t test with p values being significant. Multiplex ELISA ImDCs were matured for 24 hours as previously described. Next, the 24 hour matured DCs were extensively washed and transferred into second 24 well plate in AIM V media not containing any cytokines at a density of 1x10 6 mDCs/mL. After an

PAGE 44

44 additional 24 hours, the supernatant was collected and frozen. Frozen supernatant samples were sent to Quansys Biosciences (Logan, UT) for their modified multiplex ELISA array service. Each cytokine was analyzed in triplicate. Semi q uantitative and Quantitative Reverse Transcription PCR RNA was isolated with Tri Reagent (Invitrogen). cDNA was generated isolated total RNA using oligo(dT) primers from the cell to cDNA II kit as directed by the manufacturer (Ambion, Invitrogen) For the semi quantitative reve rse transcription PCR (RT PCR), the generated cDNA was serially diluted ranging from no di lution to 1:10, 1:100, and 1:1000 ratios to be used for the RT PCR template. R eaction s consisted of 1 L template, 12.5 L PCR mastermix (Promega Madison, WI ) and 2.5 nM of each primer. R eaction conditions were 95C for the first 1 0 minutes, then 35 cycl es of 95C for 30 seconds, 60C for 30 seconds, a nd 72C for 30 seconds, then followed by a final extension step at 72C for 5 minutes. RT PCR products were separated on a 2% agarose gel and visualized with ethidium bromide staining. RT PCR primers were de signed to span two adjacent exons in the desired gene transcript They were purchased from Integrated DNA Technologies, Inc ( Co ralville, IA). Primer s equences for the cytokines and actin were as follows: IFN TCAGCTCTGCATCGTTTTGG GTTCCATTATCCGCTACATCTG AA TCTTCTCGAACCCCGAGTGA CCTCTG ATGGCACCACCAG ; IL 6, GTAGCCGCCCCACACAGACAGCC (sense) and GCCATCTTTGGAAGGTTCAGG ; and actin, ACCTT CTACAATGAGCTGCG CCTGGATAGCAACGTACATGG For quantitative SYBR green real time PCR (qRT PCR), the same cDNA samples and IFN TNF and actin primers wer e used in the qRT PCR analysis New IL 6

PAGE 45

45 primers were designed in order to match generate the same amplicon product size as the other three transcripts as required. The new IL 6 primer sequences were CCACTCACCTCTTCAGAACG (sense) and TCTGCCAGTGCCTCTTTGC (antisense) Amplification of each gene transcript was completed in triplicate reacti ons which consisted of 1 L template, 12.5 L 2x SYBR green qPCR mastermix (SABiosciences, Qiagen, Inc, Valencia CA) and determined optimal primer concentration. Optimized primer concentrations used in qRT PCR reactions were determined to be 500 nM of ea ch primer for IFN and IL 6, 300 nM of each primer for TNF and 100 nM of each primer for actin. Conditions for the qRT PCR reaction was conducted as suggested by SABioscience using the MX3000P qPCR system (Stratagene, Agilent Technologies, Santa Clara CA) as 10 minutes at 95C, followed by 40 cycles of 95C for 30 seconds, 60C for 30 seconds, and finally a dissociation curve analysis to confirm amplification of a single amplicon. Also the ampli fi cation efficienc y for the four gene s was verified to be similar to one another b efore analyzing the relative gene expression levels in D Cs Relative levels of the cytokine trans cripts were calculated by the 2 ( m ethod and then normalized using actin expression levels. mDC: PBL Co culture H uman cytomegalovirus (CMV) matrix phosphoprotein 65 (pp65), hepatitis C virus (HCV) core and Wilms tumor (WT 1) protein peptide mixtures were obtained from JPT Peptide Technologies, Inc. (Acton, MA). Each peptide mixture consisted of over a hundred 15 mer synthetic peptides which overlap each other to collectively span the entire length of the particular protein.

PAGE 46

46 mIL 4 DCs and mIL 15 DCs were pulsed with 1 g/mL microg lobin along with either 1 g/mL CMV pp65 or 5 g/mL HCV core peptide mixtures in AIM V media for 2 4 hours at 37C. Next, mDCs were irradiated for 2,000 rad ian s, washed, and mixed with autologous PBLs at a ratio of 1:20 DC to P BLs per well in 96 well U bot tom plate in AIM V supplemented with 5% human serum After 3 days, half of the media in the wells was replaced with complete AIM V media containing 5% human serum and the final concentration of the cytokines 12.5 U/mL IL 2 5 ng/mL IL 7, and 20 ng/mL IL 15 (Gentaur). One half of the media was replenished with fresh complete AIM V containing human serum and cytokines every two days. As the stimulated PBLs began to proliferate, they were transferred to plates with larger sized wells as needed. PBL proliferati on was assessed by trypan blue staining in which the average number of viable cells from two wells of the co culture were determined on the days indicated. T cell immune responses against CMV pp65 and HCV core proteins were analyzed on day 14 of the co cul ture using T cell antigen recall assay as described later T cell and NK cell subsets were identified by their specific surface marker phenotypes on the 15 th day of the co culture by flow cytometry. Antigen Recall Assay PBLs co cultured with mDCs were re st imulated with the C MV pp65/ HCV core Ag (specific peptide ) or th e WT 1 tumor Ag (non specific peptide ) Ag specific induction of CD3 + T cell s was determined by measuring IFN production and CD107 degranulation. On day 13 of the DC:PBL co culture, PBLs were washed and cultured without cytokines overnight to decrease non specific T cell immune activity. The following day PBLs were re stimulated at a ratio of 1:20 DC:PBLs u sing the autologous mDC s pulsed with the

PAGE 47

47 CMV pp65/HVC core or WT 1 peptide s in a 96 well U bottom plate for a total of 5 hours at 37C in AIM V media Non stimulated PBLs were used as controls Anti CD107a antibody was added to each sample from the beginni ng of the assay After the first hour, 6 g/mL monensin A (Sigma) was added then incubated at 37C for the remaining 4 hours CD3, CD4, and CD8 were stained on the cell surface as explained previously. Cells were fixed and permeabilized with BD Cytofix/Cyt operm solution at 4C Next, cells were washed in BD Perm/Wash buffer stained with anti IFN antibody for 30 min utes on ice and washed T he data was collected on the BD Aria flow cytometer and analyzed using Flowjo. Ag specific IFN production and/or CD 107a degranulation was calculated by subtracting the percentage of CD3 + T cells responding to the WT 1 peptide from those reacting to the original peptide Statistical significance was determined by two tailed wilcoxon matched pairs signed rank tests with p values considered to be significant. Results Cellular Morphology During DC Differentiation and Maturation ImDCs were derived by culturing monocytes in GM CSF and IL 4 (for IL 4 DCs) or IL 15 (for IL 15 DCs) for 5 days ad morphology was analyzed by light m icroscopy The imIL 4 DCs were lightly attached or floating ov al shaped cells with irregular edges and a few protrusions radiating from the main cell body (Figure 2 1 A ). However nearly all of the imIL 15 DCs remain ed firmly adhered to the plate during di fferentiation and seem ed slightly larger. imIL 15 DCs usually resembled either thin, spindle like shaped cells with small dendrites at the ends or had a fried egg appearance On day 5 imDCs were harvested, washed, and cultured with LPS and TNF along with GM CSF and IL 4 or IL 15 for an additional 24 hours to induce maturation mIL 4

PAGE 48

48 DCs and mIL 15 DCs no longer exhibit their own distinctive morphological differences. Both mIL 4 DCs and mIL 15 DCs are thin and elongated adherent cells with smal l dendrite protrusions (Figure 2 1B) Surface Marker Phenotype of imDCs T cell activation and requires three signals: Ag presentation (signal 1), co stimulation (signal 2), and production of IL 12 (signal 3). Since the presence of IL 4 or IL 15 affected D C morphology, we investigated how the cytokines impacted expression of DC surface markers. First we confirmed DC differentiation from the precursor monocytes which is indicated by the down regulation of the monocytic surface marker CD14 and the expression of DC s pecific markers such as DC SIGN We observed that both imIL 4 DCs and imIL 15 DCs display low levels of CD14 and express DC SIGN (Figures 2 3C and 2 3D). Interestingly, imIL 15 DCs express significantly lower amounts of DC SIGN ( n =7, p =0.02) compare d to the conventional IL 4 DCs. Ag presentation and co stimulation molecule expression on CD11c + immature and mature IL 4 DCs and IL 15 DC were evaluated We found that in relation to imIL 4 DCs, MHC class I molecules (HLA I) were expressed at significantl y greater levels on imIL 15 DCs ( p =0.02 n =8 ) and it was detected on a greater number of CD11c + imIL 15 DCs ( p =0.008) ( Figure s 2 2 A and 2 2B ) T he expression levels of the lipid Ag presenting molecule CD1a was significantly reduced on imIL 15 DCs compared t o imIL 4DCs ( p =0.004, n =9 ) It was also expressed on the surface of less imIL 15 DCs than imIL 4 DCs ( p =0.008). HLA DR expression was not particularly affected by generating imDCs with IL 15 and GM CSF instead of IL 4 and GM CSF. Co stimulatory molecules CD80, CD83, and PD L1 as well as the chemokines receptor CC R7 were expressed at similar levels on imIL 4 DCs and imIL 15 DCs (Figures 2 2C and 2 2D) For the other co stimulatory molecules, imIL 4

PAGE 49

49 DCs expressed significantly more CD86 ( p =0.03, n =6 ) but les s CD40 ( p =0.04, n =8 ) in contrast with imIL 15 DCs. We also compared the surface expression of TLR4, IL 4R and IL 15R between imIL 4 DCs and imIL 15 DCs to determine whether a particular DC subset would be more responsive to IL 4, IL 15, or LPS during subsequent maturation protocols. We found that the three surface receptors were detected at similar levels on both of the imDC subsets (Figures 2 3A and 2 3B). Surface Marker Phenotype of mDCs Addition of LPS and TNF for about 48 hour to induce DC maturation caused the expression levels of HLA DR, CD83, and CD86 as well as the number of CD11c + DCs expressing t he markers increased on IL 4 DCs and IL 15 DCs which confirmed the maturation status of mIL 4 DCs and mIL 15 DCs (Figure s 2 4 C and 2 4D ) In contrast with mIL 4 DCs, mIL 15 DCs did not up regulate CCR7 which is another DC maturation marker that directs mDC migration to secondary lymphoid organs in vivo (imIL 15 DC median MFI=484.7 versus mIL 15 DC median MFI=288) ( Figures 2 3C and 2 5C) ( 166 ) However, the number of CCR7 + mDCs did increase compared to imDCs (imIL 15 DC median%=18% versus mIL 15 DC median%=30.3. imIL 4 DC median%=17.9 versus mIL 4 DC median%= 41.5). Donor matched m IL 4 DCs exhibit the typical elevated expression CCR7 levels compared to imIL 4 DCs (imIL 4 DC median MFI=296.5 versus mIL 4DC median MFI = 684.4). Additionally, compared with mIL 4 DCs, DC SIGN expression was significantly decreased ( p =0.03, n =7 ) and detected on less CD11c + mIL 15 DCs ( p =0.08) ( Figures 2 5C and 2 5D). Another commonly used DC surface marker, CD1a was significantly reduced on mIL 15 DCs compared to mIL 4 DCs ( p =0.02, n =7 ) and expressed on a considerably lower percentage of mIL 15 DCs than on mIL 4 DCs ( p =0.03) ( Figures 2 4A and 2 4B).

PAGE 50

50 mIL 4 DCs and mIL 15 DCs express similar levels of HL A class I molecules and HLA DR suggest ing that mIL 15 DCs present peptide Ags at the same effici ency with the more conventional mIL 4 DCs (Figure s 2 4 A and 2 4B ). The co stimulatory molecules CD80 and CD83 wer e individually detected on lower numbers of CD11c + mIL 15 DCs in relation to mIL 4 DCs however they were expressed on both of the mDC subsets at similar amounts (Figure s 2 4C and 2 4D). The other co stimulatory molecule CD86 ( p =0.008, n =8 ) and the negative T cell activation regulator PD L1 ( p =0.02, n =8 ) were significantly reduced on mIL 15 DCs compared to mIL 4 DCs. Finally the expression of CD40, IL 4R IL 15R and TLR 4 were not significantly different between the mIL 4 DCs and the mIL 15 DCs (Figure s 2 4C, 2 4D, 2 5A, and 2 5 B). Antigen Uptake by mDCs The ability of the mIL 4 DCs and mIL 15 DCs to present Ags to elicit lymphocyte immune responses wa s further assessed by a flow cy tometry based Ag uptake assay. mDCs were incubated with o valbumin (OVA) that had been conjugated to a fluorophore and then the percentage s of CD11c + mDCs that endocytosed the OVA flu orophore conjugate were determined On ave rage, mIL 15 DCs were more efficient at internalizing OVA than their donor matched mIL 4 DCs; however, the difference between the mDC subsets was not found to be statistically significant (Figure 2 6). Production of IL 12 and Pro i nfla mmatory Cytokines by mDCs The third signal necessary for the development of cytotoxic effector function s in T cells is presence of IL 12 ( 55 167 168 ) O ther pro inflammatory as well as anti inflammatory cytokines secreted by mDCs such as IL 1, IL 6, IL 15, IFN TNF IL 4, and IL 10 can also influenc e T cell effector functions or maintenance of certain T cell functional subsets ( 169 174 ) We compared the produ ction of these cytokines by mI L 4

PAGE 51

51 DCs to those secreted by mIL 15 DCs by ELISA. In both donors, mIL 15 DCs produce d slightly more IL 12 p70 than mIL 4 DCs (Table 2 1) mIL 15 DCs also secreted more pro inflammatory cytokines IL 1 IL 1 IL 6, IL 15, IFN and TNF compared to mIL 4 DCs IL 4 was produced at low amount by both DC subsets but the amounts of IL 10 produced by a particular DC subset depended on the donor. These results suggest that production of more IL 12p70 and pro inflammatory cytokines by mIL 15 DCs than mIL 4 DCs may help promote more cytolytic responses by T cells primed by mIL 15 DCs Pro i nflammatory Cytokine Transcript R egulation The four pro inflammatory cytokines IFN TNF IL 15, and IL 6 were secreted at much higher amounts by I L 15 DCs in comparison with mIL 4 DCs (Table 2 1). D ifferential production of IFN TNF IL 15, and IL 6 may be influenced by the continual presence of IL 15 or IL 4 during mDC generation These four cytokines are regulated at multiple levels ranging fro m transcriptional to post translational ( 75 95 104 175 176 ) IL 4 can inhibit transcription of IL 6 in monocytic cell lines and IFN in T cells ( 172 177 ) On the other hand, IL 15 plays a role in promoting IL 6 and TNF production in monocytes ( 178 ) W e investigated whether the four cytokines were differentially regulated at the transcriptional level in the two DC subsets during DC di fferentiation or maturation To reduce potential donor variation s we pooled RNA from three donors before comparing cytokine mRNA levels in the original monocyte precursors, mIL 4 DCs, and mIL 15 DCs Potential differences in cytokine transcript levels were first compared semi quantitatively using serially diluted cDNA and reverse transcription PCR ( RT PCR ) Our results show ed IFN and IL 6 transcripts were more notably more abundant in mIL 15 DCs compared to mIL 4 DCs an d monocyte s (Figure 2 7 A). TNF tran script levels appeared to be marginally greater in mIL 15 DCs and

PAGE 52

52 monocytes than in mIL 4 DCs B oth of the IL 15 isoforms, the shorter IL 15SSP that encodes the non secreted protein and the longer IL 15LSP transcript that encodes the secreted protein, were detected in the monocytes, mIL 4 DCs, and mIL 15 DCs at nearly the same levels Hence, it is likely that the higher secretion of IL 15 by mIL 15 DCs than mIL 4 DCs caused by post transcriptional regulation ( 75 104 ) To quantify differences in IFN TNF and IL 6 transcr ipt levels in mIL 4 DCs and mIL 15 DCs we used SYBR green quantitative real time PCR (qR T PCR). Conditions for the qRT PCR were optimized and the amplification efficiency for each primer set was matched to the other three primer sets (data not shown). Cytokine expression were normalized to actin transcript levels and then the relative expre ssion levels were calculated using the 2 ( method. We confirmed that IFN TNF and IL 6 transcripts were more abundant in mIL 15 DCs compared to d onor matched mIL 4 DCs (Figure 2 7 B). IFN mRNA levels are at least 330 fold greater in mIL 15 DCs com pared to mIL 4 DCs. TNF transcripts were at least 14 fold higher in mIL 15 DCs than mIL 4 DCs. Finally, IL 6 transcript level was found to be 20 fold higher in mIL 15 DCs in comparison with mIL 4 DCs. Therefore, the differences in IFN and IL 6 pr oduction in the two mDC subsets are regulated at least to som e degree by either gene transcription or stabilization (or destabilization) of the cytokine mRNA transcripts. CMV s pecific Memory Immune Responses by CD3 + T Cell s W e investigated whether mIL 15 D Cs are more efficient than the conventional mIL 4 DCs at elicit ing cytolytic CD3 + T cell immune responses against human cy tomegalo virus (CMV). PBLs were stimulated with autologous mDCs pulsed with CMV pp65 for 14 days and then re stimulated with the relev ant mDCs. Since T cell activation can be characterized by clonal proliferation, we first determined the extent of mIL 15

PAGE 53

53 DC versus mIL 4 DC induced T cell stimulation by comparing the rate at which the lymphocytes expanded through the co culture. Over the duration of the DC:PBL co cultures, the number of PBLs steadily increased over the 16 days following either stimulation with mIL 4 DCs or mIL 15 DCs. The expansion rate of the lymphocytes that were co cultured with mIL 15 DCs showed no difference from the lymphocytes that were primed with donor matched mIL 4 DCs which suggests that mIL 15 DCs and mIL 4 DCs induce comparable levels of T cell activation to one another (Figure 2 7A). To determine whether mIL 15 DCs elicit stronger cytolytic T cell responses a gainst CMV pp65 than mIL 4 DCs, CD3 + T cell IFN production ( IFN + ) and CD107a, a vesicle membrane protein, translocation to the cell surface (CD107a + ) were measured separately or in combination with each other (Figure 2 8 B). Using a series of Ag recall assays, the cultured PBLs were re stimulated with the same autologous mDC subset and then the extent of the Ag specific reactions are assessed. CMV pp65 specificity was calculated by subtracting the percentage of T cells reacting to the non specific control from the CMV pp65 responding cells for CD8 + and CD4 + T cell populations. We observed that akin to mIL 4 DCs, mIL 15 DCs is able to elicit CMV specific cytolytic T cells responses from CD4 + T cells as well as the more commonly investigated CD8 + T cells. Furthermore, stimulation by either mIL 15 DCs or mIL 4 DCs results in more CD8 + T cells exhibiting IFN + CD107a + and IFN + CD107a + responses against CMV in comparison with their CD4 + T cell counterparts. Since this trend did not appear to be linked with a particular mDC subset suggests that the i ncreased CD8 + T cell populations are associated with the CMV pp65 peptides. Concerning the extent of CMV T cell responses, compared with the donor matched mIL

PAGE 54

54 4 DCs, lymphocytes co cultured with mIL 15 DCs showed significantly higher cytolytic responses to CMV for CD8 + T cells as well as CD4 + T cells. HCV s pecific Primary Immune Responses by CD3 + T cells Next, we investigated potential differences in the extent of primary T cell cytolytic responses against hepatitis C virus (HCV) induced by mIL 15 DCs vers us the conventional mIL 4 DCs The DC:PBL co cultures and Ag recall assays using HCV core peptide mixtures were completed in parallel with the previously described CMV pp65 peptide experiments. We first compared the expansion rate of the lymphocytes primed with the HCV pulsed mIL 15 DCs and the mIL 4 DCs over the duration of the co culture. Again we observed that PBLs cultured with mIL 4 DCs proliferated at the same rate as those stimulated with mIL 15 DCs (Figure 2 9 A). In comparing the distribution of CD8 + and CD4 + T cells, we found the percentage of HCV responsive CD8 + T cells to be nearly the same as CD4 + T cells. Thus the previously noted preference for CD8 + T cells over the CD4 + T cells in the CMV experiments was likely a peptide dependent phenomenon. As expected there were less CD3 + T cells with HCV specific cytolytic responses compared to the large number of T cells responding to CMV pp65 peptides. Nonetheless, there was a marked difference in the number of CD8 + and CD4 + T cells that exhibited IFN + CD107a + or both immune activities against HCV following stimulation by mIL 15 DCs compared with mIL 4 DCs (Figure 2 9B) The mIL 15 DC primed CD8 + T cells showed significantly greater HCV specific IFN responses than those CD8 + T cells cultured w ith mIL 4 DCs. Furthermore, there were significantly more CD4 + T cells producing IFN and undergoing CD107a degranulation after being primed by mIL 15 DCs than their donor matched mIL 4 DCs.

PAGE 55

55 Effect of mIL 15 DC Stimulation on Distribution of T Cell Subset Populations Next we evaluated the possible effect of the two mDC subsets on the distribution of the memory and effector T cell subset populations in both CD8 + and CD4 + T cells following mDC co culture. In several murine studies IL 15 produced by DCs has b een reported to play a role in promoting or maintaining the CD8 + memory T cell populations ( 97 179 181 ) Thus we investigated whether human mIL 15 DCs, which we have shown to secrete relatively high levels of IL 15, may also support the CD8 + memory T cell populations. We assessed the distribution of the three major CD3 + T cell functional subsets at the end of the DC:PBL co cultures. Central memory (Tcm), effector memory (Tem), and effector (Teff) T cells were identified from the CD8 + CD3 + T cells or the CD4 + CD3 + T cells based the expression of five surface markers which have been discussed in prior T cell rev iews ( 52 53 ) Tcm cells are defined as CD45RA CD27 + CD28 + CD62L + CCR7 + while Tem are identified by CD45RA CD 27 + CD28 + CD62L CCR7 CD8 + and CD4 + Teff cells have slightly different phenotypes. CD8+ Teff cells are CD45RA +/ CD27 CD28 CD62L CCR7 whereas CD4+ Teff cells do not express any of the five markers. Only about half of the CD3 + gated T cells from our m DC primed lymphocyte cultures were determined to be Tcm, Tem, or Teff cells due to our stringent surface phenotype requirements for T cell subset classification (data not shown). The type of peptide, whe ther it was CMV pp65 (Figure 2 10A) or HCV (Figure 2 10 B), did not affect the memory and effector T cell subset distribution. In Figure 2 10 we show for the first time that culture with human mIL 15 DCs does not actively support the CD8 + memory T cells in relation to their donor matched mIL 4 DCs. Also T ce ll priming by mIL 15 DCs does not promote memory T cell subsets in the CD4 + T cell population compared with mIL 4DCs. Actually mIL 15 DCs stimulation results in decreased

PAGE 56

56 numbers of Tcm and Tcm cells in nearly all the comparisons with mIL 4 DC lymphocyte c o cultures. Teff cell populations in the CD8 + and CD4 + T cells were much larger in mIL 15 DC stimulated cultures in contrast with the mIL 4 DC primed cultures, especially for the CD8 + T cells. The relative increase of Teff cell percentages detected in mIL 15 DC stimulated CD8 + and CD4 + T cells corresponds with the greater number of T cells exhibiting CMV or HCV specific cytolytic responses. Thus, in contrast with the suggestions from murine DC studies, human IL 15 DCs promote CD8 + and CD4 + Teff cells and t hey do not promote memory T cells populations in either CD8 + or CD4 + T cells. Furthermore, the preference towards Teff cells in IL 15 DC lymphocyte co cultures correlates with the increased number of Ag specific IFN + and/or CD107a + T cells when compared with the donor matched IL 4 DC stimulated lymphocytes. Effect of Stimulation by IL 15 DCs versus IL 4 DCs on NK Cells IL 15 is an essential component in the development and activation of NK cell s ( 73 74 95 ) In addition to their innate cytolytic activities, activat ed NK cells modulate DC functions and promote T cell activity ( 182 183 ) Generation of IL 15 DCs has been shown to increase the number of r esidual NK cells found after monocyte purifi cation. The increased number of contaminating NK cells in IL 15 DC preparations then subsequently enhance T cell stimulation ( 43 ) Therefore we investigated whether our culture conditions for generating mIL 15 DCs also modulates NK cell expansion and activity. First we compared the percentage of CD3 CD56 + NK cells in the lymphocyte size gated popul ations following stimulation by mIL 4 DCs and mIL 15 DCs in CMV and HCV primed lymphocytes (Figure s 2 11 A and 2 11 B). Stimulation by mIL 15 DCs or mIL 4 DCs did not affect the number of NK cells. In 2 out of 6 donors evaluated, there were high levels of N K cells in the mIL 15 DC stimulated lymphocytes compared with

PAGE 57

57 mIL 4 DC primed lymphocytes which may have skewed the median NK cell percentages slightly. Since the surface phenotype of human NK cells has been directly associated with their effector activity ( 58 63 ) we finally assessed whether mIL 15 DC stimulation affected the NK cell activity in CMV and HCV prim ed lymphocytes (Figure s 2 11 C and 2 11 D). CD3 CD56 + NK cells were separated in subpopulations based on their CD56 expression level (dim or bright) and CD16 expression. CD56 bright CD16 NK cells are considered to be immunoregulatory due to their high produ ction of cytokines including IFN and TNF and relative meager cytotoxicity abilities upon activation. On the other hand, CD56 dim CD16 + NK cells secrete only low levels of cytokines but exhibit high cytotoxic functions against target cells ( 58 59 63 ) Co cultured with mIL 15 DCs or mIL 4 DCs did not affect the distribution of the NK cell subp opulations which means that the subset of stimulating mDCs did not affect NK cell functions. We confirmed that mDC subset did not affect the cytolytic activity of NK cells from a n overall lymphocyte co culture (Appendix A). Discussion IL 15 DCs are the fir st monocyte derived DC subset other than the more conventionally used IL 4 DCs that are capable of priming Ag specific CD8 + T cell responses Furthermore IL 15 DCs were reported to be more efficient at priming cytolytic CD8 + T cells responses against melan oma Ags than the more classically utilized IL 4 DCs ( 43 45 46 ) Similarly, we also demonstrated that IL 15 DCs are more potent tools for sti mulating CMV and HCV specific cytolytic CD8 + and CD4 + T cell responses compared to IL 4 DCs (Figures 2 7 and 2 8). In this report, we characterized the physical attributes an d immune stimulatory functions of the monocyte derived IL 15 DCs in relation to the more conventional IL 4 DCs.

PAGE 58

58 We first evaluated the surface phenotype of immature and mature IL 15 DC s to determine their extent of DC differentiation and maturation state a s well as expression of signal 1 and 2 DC differentiation is evaluated based on decreased expression of monocyte surface markers and presence of DC specific markers whereas the extent of maturation is determined by its potential immune stimulatory abiliti es after activation. Typically maturation is defined up regulation of signal 1 and 2 related molecules (HLA DR and the classic co stimulatory molecules CD80, CD83, and CD86), lymphoid tissue homing receptors (CCR7), and decreased Ag up take capacity. In ou r flow cytometry analyses, we focused on the m onocyte derived DC populations that were the appropriate size for a myeloid cell and expressed high levels of CD11c which is a c omm only used myeloid DC marker We confirmed t hat CD11c + gated IL 15 DCs and IL 4 DCs differentiated into DCs based on the decreased CD14 levels (F igures 2 1 and 2 3). However, t he expression of the DC specific surface markers CD1a a nd DC SIGN on IL 15 DCs were considerably lower compared to IL 4 DC s suggesting that IL 15 DCs may be les s differentiated than IL 4 DCs (Figure s 2 2 and 2 4). IL 15 DCs were previously shown to express the L angerhans cell (LC) specific marker l angerin ( 42 43 45 ) However, in our hands, we observed that l angerin transcript levels decreased in dif ferentiating IL 15 DCs whereas l angerin mRNA was abundantly expressed in IL 4 DCs (data not shown). After maturation, CD83, CD86, and CCR7 levels increased on CD11c + IL 4 DCs but at best the expression of these markers were only mildly increased on the surface of mIL 15 DCs (Figure s 2 2 2 3, 2 4, and 2 5). The decreased ex pression levels of DC and maturation specific marker s suggest that IL 15 DCs exhibited a less differentiated or less mature DC phenotype than the traditional IL 4

PAGE 59

59 DC s. Overall the r elatively lower CD1a, DC SIGN, co stimulatory molecules and CCR7 expr essi on indicate IL 15 DCs, respectively, present fewer lipid Ag s have less stable physical interactions with n ave T cells be less efficient at providing signal 2 and have decreased homing to secondary lympho id organs DC s urface markers suggests that IL 15 DC s may be a significantly unique DC subset from IL 4 DCs 4 DCs may not be applicable to IL 15 DCs. Ag presentation and co stimulation For our assessment of sig nal 1 we found that the expression of HLA class I and HLA DR molecules on mIL 15 DCs were similar compared to those detected on mIL 4 DCs (Figur e 2 4). Since peptides are loaded onto HLA mo lecules before being transported to the cell surface t he concentration of surface HLA molecules indicates amount of Ag being presented. Hence there were no differences in peptide Ag presentation abilities between the mDC subsets In addition to the ability to present Ag, w e also compared their capacit y to upt ake soluble Ag such as viral peptides or OVA O ur results indicate that CD11c + mIL 15 DCs endocytose OVA Ag more efficiently than mIL 4 DCs (Figure 2 6). P revious literature had also described HLA DR expression on either immature or mature I L 15 DCs to be alike to IL 4 DC counterpart however it was also reported that both mDC subsets equally uptake dextran Ag ( 43 46 47 ) W e considered the abilities o f the mDC subsets at providing signal 2 to induce T cell responses by comparing expression of a handful of co stimulatory molecules on mDCs. M ost of the co stimulato ry molecules evaluated were detected at similar levels on mIL 15 DCs and mIL 4 DCs including CD80, CD83, and CD40 (Figure 2 4). Unlike

PAGE 60

60 some of the previous IL 15 DCs reports, we did not observe extensive decreased expression of CD83 o n mIL 15 DCs in relati on to mIL 4 DCs as previously described ( 45 47 ) Only PD L1 and CD86 were significantly reduced on CD11c + mIL 15 DCs compared to mIL 4 DCs which was surprising sinc e PD L1 and CD86 have been shown to be positively regulated by IL 15 stimulation on monocytes and monocyte derived IL 15 DCs respectively ( 47 184 185 ) Nonetheless reduced levels of CD86 or CD80 and lower affinity Ags have been demonstrated to increase IFN production by activated T cells without affecting their proliferation; thus t he restricted amount of CD86 and MHC class I expression on mIL 15 DCs may be advantageous in stimulating IFN production in T cells ( 17 186 ) Overall, the lack of up regulation of HLA DR and co stimulatory molecules as well as the relatively high Ag uptake levels 15 DCs exhibit a surface phenotype and behaviors more attributed to immature DC s Finally the third important signal for T cell activation often is the production of cytok ines by the DCs. The classical signal 3 provided by DCs is IL 12 production. IL 12 secreted by activated DCs and induces IFN production by T cells via direct activation of the STAT4 signaling pathway In contrast to the prior IL 15 DC characterizations ( 43 45 46 ) our LPS matured mIL 15 DCs secrete d somewhat hi gher concentrations of IL 12p70 than mIL 4 DCs (Table 2 1) W e also observed that mIL 15 DCs also produce d greate r amounts of IL 1 IL 1 IL 6, and TNF in comparison to IL 4 DCs which is consistent with previous IL 15 DC descriptions ( 43 45 46 ) These inflammatory cytokines are known to influence T cell activation or their activities along ; thus the elevated levels of these cytokines may give mIL 15 DCs an advantage in eliciting T cell responses ( 169 171 18 7 ) I n addition to more

PAGE 61

61 inflammatory cytokines, IFN and IL 15 were more highly secreted by mIL 15 DCs compared to mIL 4 DCs, even though the cytokines were undetectable in the m DC supernatant s by Dubsky et al. and Anguille et al. ( 45 46 ) Higher IFN secretion by IL 15 DCs may also play a role in elevated IL 12p70 production by IL 15 DCs ( 164 ) IFN and IL 6 mRNA level s in monocytes and in mIL 4DCs were very similar however in mIL 15 DCs the IFN and IL 6 transcript s are up regulated as the monocytes differentiate i nto mIL 15 DCs (Figure 2 7A) For qRT PCR analysis, new IL 6 primers were designed to meet the more stringent qRT PCR requirements. IL 15 is regulated through multiple transcriptional and post transcriptional mechanisms. It is mainly regulated at post tran scriptionally via translation and surface translocation. It is stored intracellularly thus it is even regulated at a secretion level ( 105 ) We did not observe any noticeable IFN driven up regulation of MHC class I and II on mIL 15 DCs that would have probably e n hanced mIL 15 DC T cell Ag priming ( 188 ) It is likely that the high production of IL 1 15 DCs may impair transcription of the CIITA gene and hence inhibit IFN induced MHC class II up regulation ( 189 ) Nonetheless, c ulturing nave T cells w it h IFN and IL 4 neutralizing antibodie s is a commonly used to induce IFN producing Th1 CD4 + T cells in vitro and the presence of IFN is well known to suppress IL 4 transcription in T cells ( 190 ) Hence i ncreased levels of IFN secreted by mIL 15 DCs may help polarize co cultured T cells to demonstrate IFN + Th1 responses Higher concentrations of IFN may also be involved in the elevated amounts of IL 15 detected in the supernatant which has been shown to occur on a dose dependent basis in NK cells, T cells and monocytes ( 69 95 ) On the other hand, production or trans presentati on of IL 15 by DCs activate s NK cells,

PAGE 62

62 maintain s memory CD8 + T cel l populations as well as promotes CD8 + T cells immune responses ( 98 191 192 ) IL 15 trans presentat ion by IL 15R to NK and T cells requires coordinated expression of both IL 15R and IL 15 from the same DC ( 73 75 79 ) IL 15R is also an essential component in regulation of IL 15 secretion ( 75 104 193 ) IL 15R binds the IL 15 precursor protein wit h in the endoplasmic reticulu m or early Golgi and then acts like a chaperon e protein until the IL 15 precursor is processed Both IL 15R and IL 15 proteins are finally translocated together to the cell trans presente d S ince mIL 15 DCs secrete higher amounts of IL 15 than mIL 4 DCs, they likely also trans present more IL 15 and subsequently effect NK and T cell immune responses IL 15 DCs have been sh own to prime stronger melanoma specific CD8 + T cell responses than IL 4 DCs ( 43 45 ) Rather than using HLA A 0201* immunodominant melanoma peptide s, we used CMV and HCV peptide s to elicit primary and memory T cell responses specifically. The Center s for Disease Control and Prevention (CDC) cites a 2006 survey that up to 2% of American adults are infected by HCV while approximately 50 80% adults by the age of 40 are estimated to have been chronically infected with CMV ( 194 ) Thus, we used HCV or CMV peptide s known to stimulate strong immune responses to induce primary or memory T cell resp onses respectively. We demonstrate for the first time that mIL 15 DCs are more efficient than donor matched mIL 4 DCs at priming CMV and HCV specific cytolytic responses from autologous CD8 + T cells as well as CD4 + T cells (Figure s 2 8 and 2 9 ). W e demons trate that stimulation a particular mDC subset does not affect the lymphocyte proliferation rate nor does it affect the final number of NK cells and distribution of NK cell subsets at

PAGE 63

63 the end of the co culture (Figures 2 8 2 9 and 2 1 1 ). H owever, mIL 15 DC stimulation tends to promote CD8 + effector T cel l s (Teff) over memory T cell subsets (Tcm and Tem) whereas mIL 4 DCs favor CD8 + memory T cell subsets over effector T cells (Figure 2 10 ) Due to the stringency of using eight surface markers to determine each of the T cell subsets, only about one half of either the CD8 + or CD4 + gated CD3 + T cells were able to be classified into one of the three subsets Nonetheless, t he relatively high numbers of Teff and Tem T cells following mIL 15 DC stimulation likely corresponds with the increased percentage of IFN + T cells primed with mIL 15 DCs versus mIL 4 DCs (Figures 2 8 2 9, and 2 10 ). D issimilarities noted between our IL 1 5 DC characterization result s and the previous reported findings likely stem from our p rotocol difference s For example different monocyte purification protocols (plastic adherence versus antibody based magnetic bead separation kits) may affect the purity of isolated monocyte s and/or quality of the monocytes Hardy et al. found that even sm all amounts of NK cells that remain after monocyte purification may affect subsequent T cell responses ( 43 ) The extent of the DC primed T cell responses may a lso be a ffected by HLA serotype s among donors and the relative compatibility of CMV pp65 or HCV core peptide s with the ( i.e. CMV pp65 is the immunodominant peptide for HLA A*0201 serotype). Unlike Dubsky et al. and Hardy e t al. we did not use HLA matc hed donors in our study. Thus we would likely see a larger range in the percentage s of responding T cells ( 43 45 ) Also, w e also used a mo re dilute DC:PBL ratio for our co cultures and Ag recall assays than described by other groups. Furthermore, differences in surface marke r expression may be caused by our IL 15 DCs being differentiated with less IL 15 (100

PAGE 64

64 ng/mL) t han the other groups (200 ng/mL). A dditionally culturing DCs in serum free media can reduce the expression levels of certain surface markers such as CD1a ( 7 ) Th is may explain the unusually low CD1a expression on our IL 15 DCs as noted in Figures 2 2 and 2 4 when compared with the previous IL 15 DC descriptions from groups who cultured their DCs in RPMI media containing varying concentration of human serum ( 2.5 10 %) Finally, o ur IL 15 DCs characterization results differed from prior studies simply because our cytometry analysis were more stringent We evaluated cells that were of the general myeloid cell size whi ch also express ed high levels of CD11c. Due to the inherent heterogeneity of primary cell cultures, the percentage s of CD11c + DCs from the myeloid cell size gated population s ranged from 60 98% depen ding on the particular donor. In our study, we assessed t he abilities of human monocyte derived IL 15 DCs to prov ide the three necessary signals to effective ly in i tiate T cell activation and prime the ir Ag specific cytolytic effector responses in comparison to IL 4 DCs While both mIL 15 DCs and mIL 4 DCs seem ed to provide comparable levels of Ag presentation and co stimulation, mIL 15 DCs secrete d much more pro inflammatory cytokines and IL 12p70. The gene transcripts of the more highly expressed pro inflammatory cytokines IFN TNF and IL 6 by mIL 15 DCs were also more abundant in mIL 15 DCs than mIL 4 DCs. Additionally, mIL 15 DCs prime d CMV pp65 and HCV core specific CD4 + and CD8 + T cell exhibited greater cytolytic responses than the traditional IL 4 DCs. mIL 15 DC F urthermore, mIl 15 DC stimulation tended to favor the T cell subsets which are associated with cytolytic activities, the CD8 + effector and CD4 + effector memory and effector T cell subsets.

PAGE 65

65 Figure 2 1. Cellular morphology of immature and mature DCs gene rated in the presence of IL 4 or IL 15. Images shown are representative images of PB mon ocyte derived DCs in culture (10x) A) Immature DCs after differentiation from monocytes for 5 days. B) D Cs matured for about 36 hours. Scale b ar in lower right corner indicates 0.1 mm

PAGE 66

66 Figure 2 2. Expression of Ag presentation and co stimulation molecules on the imDC subsets A B) Expression of Ag presentation molecules on imIL 4 DCs (light grey bars) and imIL 15 DC (dark grey bars). n =8 9. C D) Expression of lym p hocyte co stimulatory molecules. n =5 9. A and C) Change in the mean + gated imDCs after subtracting isotype + gated imDC after subtracting isotype val ues. Statistically significant differences bet ween IL 4 DCs and IL 15 DCs are indicated. Significance calculated by wilcoxon matched pai rs signed rank test with the determined p considered significant

PAGE 67

67 Figure 2 2. Continued

PAGE 68

68 Figure 2 3 Expression of receptors involved in DC dif ferentiation / maturation and additional molecules regulating co stimulation and motili ty on imDC subsets A B) R + gated im IL 4 DC s (light grey bars) and CD11c + gated imIL 15 DCs (dark grey bars) n =6 8. C D) DC differen + imDC. n =7 9. + of CD11c + gated imDCs. Statistically significant differences between I L 4 DCs and IL 15 DCs are indicated. Significance cal culated by wilcoxon matched pairs signed rank test with the determined p significant

PAGE 69

69 Figure 2 4. Expression of Ag presentation and co stimulatory molecules on mDC subsets A B presentation molecules expressed on CD11c + gated m IL 4 DCs (light grey bars) and CD11c + gated mIL 15 DCs (dark grey bars) n =7 8. C ge of co stimulatory molecules on CD11c + mDCs. n =7 9. + + gated mDCs. Statistically significant differences between IL 4 DCs and IL 15 DCs are indicated. Significance calculated by wilcoxon matched pairs signed rank test with the determined p

PAGE 70

70 Figure 2 4. Continued

PAGE 71

71 Figure 2 5. Expression of receptors involved in DC differentiation/ maturation and additional molecules involved in r egulating co stimulation and motility in mDC subsets A + gated m IL 4 DCs (light grey bars) and CD11c + gated mIL 15 DCs (dark grey bars) n =9. C DC differentiation and maturation markers on CD11c + mDCs. n =7 8. A + CD11c + gated mDCs. Statistically significant differences between IL 4 DC s and IL 15 DCs are indicated. Sig nificance calculated by wilcoxon matched pairs signed rank test with the determined p is considered to be significant

PAGE 72

72 Figure 2 6. Comparison of antigen up take capacities by mDC subsets mDCs were incubat ed with OVA DQ at 37C or 4C then stained with anti CD11c antibody and analyzed by flow cytometry. A) Percentage of CD11c + OVA + mDCs after incubation at 37C (empty line) or 4C control (shaded line). Histogram data shown is representative of 3 donors. B + CD11c + mDCs from 3 donors. OVA uptake was calculated by subtracting the percentage of CD11c + mDCs that non specifically internalized OVA DQ at 4C from the percentage of OVA + CD11c + mDCs incubated at 37C. Average percentages of mDCs SEM are indicated. Paired t tests found the difference between the CD11c + mDC subsets to not be significant

PAGE 73

7 3 Figure 2 7. Differential regulation and expression of IFN TNF and IL 6 transcripts in DC subsets A) semi quantitative RT PCR analysis o f IFN TNF IL 6, IL actin transcript levels in monocytes and mDCs. cDNA generated from RNA pooled from 3 donors was serially diluted ( no dilution, 1:10, 1:100, and 1:1000 ) Non template control is indicated by dash ( ). B) quantitative SYBR g reen RT PCR analysis of IFN TNF and IL 6 gene expression in mDCs usin g cDNA generated from the same pool ed donor s and 2 additional donors. Re lative cytokine gene expression is normalized using the actin transcript expression levels mIL 4 DC is ind icated by the light grey square while the donor matched mIL 15 DC is shown by dark grey triangle. mDCs prepared from the individual donors are connected by the lines

PAGE 74

74 Figure 2 8 Antigen specific memory T cell responses against CMV pp65. A) The n umber of PBLs from the first day of the DC:PBL co culture (d0) through the 16 th day (d16) was determined by trypan blue staining mIL 4 DC primed PBLs are indicated by light grey squares and dark triangles represent PBLs co cultur ed with mIL 15 DCs. The average number of cell s SEM is indicated. n =4. B) Percentages of CD4 + or CD8 + gated CD3 + T cells that produce IFN ( IFN + ) and/or degranulate CD107 (CD107 + ). CMV specific responses were calculated by subtracting the percentage of non specific response from th e percentage of CMV pp65 responses. Light squares represents the percentage mIL 4 DC primed CD3 + T cells (+IL 4 DC) while dark triangles show mIL 15 DC primed T cells (+IL 15 DC). Median percentage of responding T cells are indicated by the bar. Donor pair ed responses are indicated by the line connecting the squares to triangles. n =6 Statistically significant differences between IL 4 DCs and IL 15 DCs are indicated. Significance calculated by wilcoxon matched pairs signed rank test with the determined p va

PAGE 75

75 Figure 2 8. Continued

PAGE 76

76 Figure 2 9 Antigen specific primary T cell responses agai nst HCV core A) The number of PBLs from the first day of the DC:PBL co culture (d0) through the 16 th day (d16) was determined by trypan blue staining. The average cell number SEM is indicated. n =4. B) Percentages of CD4 + or CD8 + gated CD3 + T cells producing IFN ( IFN + ) and/or CD107 degranulation (CD107 + ) HCV specific responses were calculated by subtracting the non specific r esponses from the HCV specific responses Light squares represents the mIL 4 DC primed CD3 + T cells (+IL 4 DC) while dark triangles show mIL 15 DCs stimu la ted T cells (+IL 15 D C). Median percentage of responding T cells are indicated by the bar. Donor pair ed responses are indicated by the line connecting the squares to triangles. n =6. Statistically significant differences between IL 4 DCs and IL 15 DCs are indicated. Significance calculated by wilcoxon matched pairs signed rank test with the determined p va considered significant

PAGE 77

77 Figure 2 9. Continued

PAGE 78

78 Figure 2 10 Distribution of CD4 + and CD8 + T cell subsets after stimulation with Ag pulsed mDCs on day 16 17 of DC:PBL co culture. Central memory (Tcm), effector memory (Tem), and effector (Teff) CD3 + T cell s were identified using five characteristic T cell functional surface markers in addition to CD3, CD4, and CD8 by flow cytometry. Light grey bars indicate the percentage of either CD8 + or CD4 + gated CD3 + T cells primed by mIL 4 DCs. Da rk grey bars represent T cells stimu lated with mIL 15 DCs. A) T cells primed against CMV pp65. n =6. B) T cells stimulated against HCV core. n=6. Significance calculated by wilcoxon matched pairs signed rank test with the determined p

PAGE 79

79 Figure 2 11 NK cell populations in DC stimulated PBLs are not affected by the subset of DC used to prime PBLs NK cell populations (CD3 CD56 + cells from the lymphocyte cell population ) were evaluated at the end of the PBL co culture using mIL 4 DCs (light grey squares or bars) or mIL 15 DC s (dark trian gles or bars) Donor matched DC subsets are indicated by t he line connecting the shapes. The m edian NK cell percentage s are represented by the dark bar s A) Percent age of NK cells detected in the lymphocyte size population after primed against CMV pp65. n =6. B) Percentage of NK cells in the lymphocyte size population after primed against HCV core. n =6. C) Distribution of NK cell subset s in CMV primed lymphocytes. n =5 D) Distribution of NK cell subset s in HCV primed lymphocytes. n =5. No statistical significance was found between mIL 4 DC and mIL 15 DC stimulated lymphocyte cultures Significance calculated by wilcoxon matched pairs signed rank test with the determined p

PAGE 80

80 Table 2 1. Comparison o f cytokine production by m DCs Cytokine Donor A (pg/mL) Donor B (pg/mL) mIL 4 DC mIL 15 DC mIL 4 DC mIL 15 DC IL 12p70 6 0.3 16 1.5 2 0.3 25 2.1 Pro inflammatory: IL 1 135 5.3 332 30 32 0.4 1,228 37 IL 1 338 28 601 54 92 3.2 2,696 90 IL 6 652 56 1,664 34 52 2.3 8,036 311 IL 15 25 3.5 2,358 147 23 2.2 248 27 IFN <1 2,332 185 <1 1,905 35 TNF 149 16 1,438 41 72 2.5 3,152 104 Anti inflammatory: IL 4 3 0.5 4 0.1 3 0.3 2 0.3 IL 10 67.8 2.3 6.7 0.6 52.5 0.6 113.5 9.8 Results are expressed as average concentration SEM (pg/mL).

PAGE 81

81 CHAPTER 3 IDENTIFICATION OF DIFFERENTIALLY ACTIVATED STAT OR MAPK SIGNALING P ATHWAYS IN IL 4 DC S VERSUS IL 15 DC S AND THEIR EFFECT ON DC MATURATION Introduction The molecular signaling events down stream of IL 4 and IL 15 have been characterized individually in NK and T cells Yet when these two cytokines are combined separately wi th GM CSF, they generate two monocyte derived DC subsets that display their own distinctive surface phenotype and exhibit different abilities to stimulate Ag specific T cell responses. The molecular events regulated by GM CSF and IL 15 versus GM CSF and IL 4 that drive monocytes to differentiate into DCs and the modulation of their immunostimulatory functions are unknown A s described previously in chapter 1 the binding of IL 4 and IL 15 to their receptor complexes predominantly activates the STAT6 and STA T5 pathway s respectively in NK and T cells ( 86 98 146 ) In ot her cell types, IL 4 can activate ERK1/2 or p38 whereas IL 15 stimulation can induce pSTAT3. M embran e bound IL 15 on IL 15 producing cells can also be trans presented to nearby NK and T cells to likely activate STAT5 in those lymphocytes ( 75 98 100 195 196 ) Cross linkage of membrane bound IL 15 in IL 15 reverse signaling can also directly lead the phosphorylation and activation of the p38, ERK1/2, FAK, and Rac3 proteins ( 98 105 107 110 196 ) I n cont rast to the IL 4R and IL 15R, the receptor for GM CSF (GM CSFR) functions as a hexameric complex consisting of 2 GM CSFR chains, 2 common beta chains ( c), and 2 GM CSF molecules ( 197 ) The GM CSFR chain specifically binds the GM CSF molecule while c is associated with JAK2 and a SH2 domain containing (Shc) adaptor protein and functions as the major signaling subunit ( 156 ) The hexameric

PAGE 82

82 configuration of the GM CSFR complex allows th e two c associated JAK proteins to tr ans phosphorylate the receptors leading to the act ivation of STAT5 and/or ERK1/2. There have been only few studies that have demonstrated direct causation of STAT or MAPK activities on myeloid DC immune functions. For exampl e, IL 4 induced pSTAT6 up regulates CD86 and DC SIGN or suppresses TNF and IL 6 production ( 8 177 198 199 ) In murine DC studies, STAT3 is essential for differentiation of bone marrow derived DCs using F ms like tyrosine kinase 3 ligand (Flt3L) but not for GM SCF mediated DC differentiation ( 200 ) Additional m urine conditional STAT 3 KO studies concluded that ablation of STAT3 did not affect the number of CD11c + DCs but inhibited the up regulation of DC maturation related proteins (HLA class II, CD86, IFN and subsequently the abilities to stimulate T cell responses was reduc ed compared to wild type ( 139 201 ) Inhibition of the up stream kinase (JAK2) and the IL 6 KO murine model stu dies also showed the same results ( 138 201 ) A ctivation of ERK1/2 and p38 in monocytes by IL 15 reverse signal ing was shown to induce TNF IL 6, and IL 8 production ( 107 109 ) A dditionally a ctivated p38 in DCs up regul ates expression of co stimulatory molecules ( 158 202 204 ) In order to effectively study the cytokine induced molecular signaling involved in DC differentiation and maturation, an effective DC tumor cell model would allow for rapid and reproducible testing. Despite the lack of an established human DC cell line, we evaluated the potential use of three commonly used monocyte like tumor cell lines to study the cytokine induced molecular events. These monocyte like cell lines U937, THP 1, and HL 60 can be differentiate into macrophages with PMA treatment. Unfortunately these human tumor monocytic cell lines cannot diff erentiate into

PAGE 83

83 immunostimulatory functional DCs which may limit their usefulness in studying signal pathways ( 205 206 ) Nonetheless these cell lines would provide an unlimited source of cells and eliminate possible donor to donor variation. In this chapter, we identified that IL 4 DCs and IL 15 DCs exhibit their own distinct signaling profiles These diffe rentially activated pathways appear to directly affect DC phenotype and cytokine production. A dditionally, we show that monocytic cell lines are not an ideal model for studying the more complex molecular signaling pathwa ys involved in human DC differentiat ion and maturation but they may function as a more simplistic model for IL 4 and GM CSF signaling mechanisms in DCs. Materials and Methods Monocyte derived DC s and Monocytic Cell Lines Immature and mature IL 4 and IL 15 DCs were generated as described p reviously. For signaling studies, DCs were not cryogenically stored during experiment. Human monocytic cell lines U937, HL 60, and THP 1 were purchased from ATCC ( Manassas, VA ) and maintained in complete RPMI media containing 10% FBS. To detect phosphoryl ated signaling proteins in the monocytic cell lines, cells were serum starved overnight to decrease potentially high basal pSTAT levels that would mask detection of cytokine induced responses. Serum starved cells were stimulated with 25 ng/mL IL 4, 100 ng/ mL IL 15, 50 ng/mL GM CSF, IL4+GM CSF, IL 15+GM CSF, 50 g/mL IL 6, 5 mM H 2 O 2 50 M phorbol 12 myristate 13 acetate (PMA, Sigma), or 25 g/mL anisomycin (Sigma) for 15 minutes at 37 C. For staining of the basal level of phosphorylated proteins in DCs, fre shly harvested DCs were briefly rested in AIM V media at 37C for 1 2 hours as recommended by BD before fixation. To investigate direct activation of signaling proteins by IL 4 or IL 15 during DC maturation, 2 3x10 5

PAGE 84

84 imDCs were cultured with the maturatio n mixture (50 ng/mL GM CSF, 1 mg/mL LPS, and 25 ng/mL TNF ) along with one of the following for 30 minutes at 37 C: 25 ng/mL IL 4, 100 ng/mL IL 15, or both IL 4 and IL 15. Monoclonal Antibodies and Inhibitors Antibodies against the phosphorylated proteins STAT3 pY705 ( clone 4/P STAT3 pacific blue), STAT5 pY694 ( clone 47/Stat5 Alexa488), STAT6 pY641 ( clone 18/Stat6 Alexa647), p38 MAPK pT180/pY18 ( clone 36/p38 pacific blue), ERK1/2 pT202/pY204 ( clone 20A Alexa647) as well as CD11c ( clone B ly6 PE ) CD11c (clone B ly6, APC), GM CSFR /CD116 (clone M5D12, FITC), CD25/ IL clone hIL4R M57 PE), and IFN (clone B27, APC) were from BD. Anti TNF (clone MP9 20A4, APC) was from Caltag. Anti IL 15R ( clone eBioJM7A4 FITC) was purchased from eBioscience and anti IL 15 (clone 34559, PE) was obtained from R&D systems (Minneapolis, MN). The inhibitors for p38 MAPK (SB203580) and STAT3 (stattic) were purchased from Tocris Bioscience ( R&D Systems, Inc. Minneapolis, MN ). Phospho p rotein Flow Cytometry To crosslink membrane bound IL 15 to either the IL 15R or the cell me mbrane, freshly harvested DCs were immediately fixed in 2% paraformaldhyde (PFA) final concentration for 10 minutes at 37 C before proceeding with the usual surface staining protocol. Staining for surface markers was described in the previous chapter. In tracellular phosphorylated proteins were stained according to the ( 207 ) For basal signaling levels harvested DCs were rested for 2 hours without cytokines to allow recovery from the prior manual manipulations before fixation. Monocytic cell lines were serum starved overnight and then stimulated for 15 minutes at 37C before fixation. For

PAGE 85

85 determining the dir ect ef fects of IL 4 or IL 15 during DC maturation, harvested imDCs were cultured with maturation mixture along with IL 4, IL 15, or IL 4 and IL 15 for 30 minutes at 37 C before fixation. All of the c ells were fixed with a final concentration of 2% PFA for 10 min utes at 37C, permeabilized with cold 90% methanol for 1 hour on ice or overnight at 20C, washed, and stai ned with anti phospho protein antibodie s for 1 hour at room temperature. Anti CD11c antibody was also added when staining DCs Matched isotype antib odies were not used as controls for intracellular phospho protein staining due the ir high background. Non stimulated cells and non stained cells were used to determine the phospho protein background and autofluorescence Data was collected on the BD LSRII protein + cells were determined by subtracting the non specific autofluorescence value from the sample value. Statistical signi ficance was determined via two tailed wilcoxon matched pa irs signed rank test or the two tailed t test when there were only a small number of donors The calculated p value s were considered to be significant DC Intracellular Cytokine Flow Cytometry DCs matured as described previously for 24 hours. Next the donor matched mDCs from 8 individuals were collected, washed, transferred into low adhesion plates in AIM V media without cytokines, and treated with 10 M SB203580, 30 M stattic, or 0.3% DMSO in the presence of 1 L/mL BD GolgiPlug for 6 hours at 37 C. GolgiPlug was also added to the no treatment control consisting of 5 donors. The following described steps were completed on ice. mDCs were washed, blocked with 10% human mouse serum for 30 minutes, stained with anti CD11c antibody for 30 minutes, fixed and permeabilized with BD Fix/Perm Buffer, stained with anti IFN or anti TNF for 1 hour

PAGE 86

86 IFN + or TNF + from the CD11c + gated mDC s were determined Sta tistical significance was determined using the two tailed wilcoxon matched pairs signed rank test in which calculated p Results E xpression of Surface Cytokine Receptors on DC s Expression of IL 4R IL 15R and GM CSFR were assessed on immature and mature IL 4 DCs as well as IL 15 DCs prepared from a new donor group GM CSFR was the highest expressed cytokine receptor on both immature and mature DCs (Figure 3 1) Expression of GM CSFR was significantly hig her levels on imIL 15 DCs in com parison with imIL 4 DCs ( p =0.03 n =6 ) ( Figure 3 1A) GM CSFR exp ression seemed to be down regulated with DC maturation especially mIL 15 DCs. Consequently GM CSFR expression was determined to be much higher on mIL 4 DCs a nd detected on a significantly larger number of mIL 4 DCs in relatio n to mIL 15 DCs ( p =0.03, n =6) ( Figures 3 1C and 3 1D ). A dditionally, the expression levels of I L 4R and IL 15R on the surface of immature and mature IL 4 DCs were similar to those determ ined on the corresponding IL 15 DC populations The number s of IL 4 DCs that expressed either I L 4R or IL 15R were also comparable to number of IL 15 DCs expressing I L 4R or IL 15R In addition to cytokine receptors, we also assessed the relative level of IL 15 on membrane surface (membrane IL 15) which would signify the DCs are trans presenting IL 15 and/or involved in IL 15 reve rse signaling IL 15 trans presentation by DCs has recently been determined to have an essential role in modifying T cell imm une activities as well as NK cell development and activation whereas IL 15 reverse signaling in

PAGE 87

87 monocytes leads to inflammatory cytokine production ( 72 97 105 107 109 208 211 ) In order to detect IL 15 on the cell membrane, cells were treated with PFA to crosslink IL 15 to its receptor or the cell membrane. The level s of membrane IL 15 on immature and mature CD11c + IL 15 DCs were much higher compared to the amount s of membrane IL 15 found on the surface of the IL 4 DCs (imDCs, p =0.03 n =6 ) (mDCs, p =0.06, n =6 ). IL 15 was also detected on the membrane of a greater percentage of CD11c + IL 15 DCs th an IL 4 DCs (imDCs, p =0.03, n =6 ) (mDCs, p =0.06, n =6 ). Identifying the IL 4 DC and the IL 15 DC Basal Signaling Pr ofiles Replacing the traditional GM CSF and IL 4 combination with GM CSF and IL 15 likely has significant repercussions on the molecular signaling event in generation of monocyte derived DCs Using phospho protein flow cytometry, w e measured the basal acti vity level s of the STAT and MAPK pathways responsive to IL 4, IL 15, or GM CSF in order to determine the signaling profiles for IL 4 DCs and IL 15 DCs IL 4 has been strongly linked with the STAT6 pathway but it also induces pp38 and pERK1/2 ( 86 146 ) ERK1/2 is also activated by GM CSF but the primary signaling mechanism for GM CSF is considered to be STAT5 ( 148 212 214 ) IL 15 stimulation predominantly activates STAT5 as well, along with the STAT3 pathway ( 123 192 215 217 ) Thus we assess ed the pSTAT6, pSTAT5, pSTAT3 pp38, and pERK1/2 signaling pathways in the DCs Out of the five signaling pathways evaluated, STAT6, STAT5, and ERK1/2 were found to be more active in CD11c + IL 4 DCs compared to IL 15 DCs regardless of the DC maturation status (Figures 3 2 and 3 3) Th e levels of pSTAT6 (imDC, p =0.03, n =6 ) (mDC, p =0.01 n =9 ) and pERK1/2 (imDC, p =0.06 n =5 ) ( mDC p =0.02 n =7 ) were considerably greater in immature and mature IL 4 DCs compared to IL 15 DC p opulations Furthermore the percentages of the CD11c + I L 4 DCs exhi biting pSTAT6

PAGE 88

88 (imDC, p =0.03 n =6 ) (mDC, p =0.03 n =9 ) or pERK1/2 (imDCs, p =0. 06 n =5 ) ( mDC s, p =0.05 n =7 ) were higher compared to IL 15 DCs. Inte restingly, there were significantly lower numbers of immature and mature IL 15 DCs that exhibited activated S TA T5 compared to IL 4 DCs (imDC, p =0.0005 n =12 ) (mDC, p =0.02 n =10 ). Furthermore the levels of phosphorylated STAT5 in both immature and mature IL 15 DCs were significantly less than those in the donor matched IL 4 DCs (imDC: p =0.0005 n =12 ) (mDC, p =0.03 n =10 ). Relative q uantification of the STAT5A and STAT5B transcripts via SYBR green qRT PCR during monocyte to mDC differentiation demonstrated that the two STAT5 transcripts were detected at similar levels in IL 4 DCs and IL 15 DCs (Appendix D). This indica tes that the relatively lower pSTAT5 activity in IL 15 DCs is not caused by a limit ed availability of STAT5 but STAT5 is simply not becoming activated in IL 15 DCs. We found pSTAT3 ( n =6) and pp38 ( n =5) to be nearly the same level in imIL 4 DCs and imIL 15 DCs. Following DC maturation, the pSTAT3 ( MFI ~18 to ~125) and the pp38 ( MFI ~18 to ~83) levels were mildly elevated in CD11 + mIL 15 DCs whereas the activated proteins are barely detectable in the mIL 4 DC population. In addition to the level of pSTAT3 ( p =0.008 n =8 ) and pp38 ( p =0.02 n =7 ) being significantly different between the mDC subsets, there were more mIL 15 DCs exhibiting pSTAT3 ( p =0.02) and pp38 ( p =0.02) activity than mIL 4 DCs. In summary, IL 15 DCs exhibit much less STAT6, STAT5, and ERK1/2 s ignaling than in comparison to their donor matched IL 4 DCs. STAT3 and p38 pathways become up regulated by DC maturation exclusively in IL 15 DCs which suggests that STAT3 and p38 may have influence mIL 15 DC phenotype or functions in a subset specific

PAGE 89

89 man ner. N ext we assess which signaling mechanism(s) are directly activated by IL 4, IL 15, and GM CS F during DC differentiation and/or maturation. Cytokine Receptor Expression on Monocytic Cell Lines Monocytic tumor cells lines, though they cannot successfull y differentiate into APCs with DC phenotype and function, are frequently used as a cellular model for human m onocyte and macrophage molecular studies ( 205 206 ) To determine whether we could utilize the monocytic cell lines U937, THP 1, and HL 60 to study IL 4, IL 15, and GM CSF signaling, we first examined th e expression of the cytokine receptors on the c ell lines. IL 4R IL 15R and GM CSFR were detected on the surface of all of the monocytic cell lines (Figure 3 4 ) Of the three cytokine receptors, GM CSFR was the highest expressed receptor and IL 4R was the least expressed receptor. Additionally, we found that com pared to the other two monocytic cell lines, HL 60 cells expressed the lowest amounts of surface IL 4R which may in relation to the other two monocytic cell lines Thus, U937 and THP 1 cell lines read ily expressed the three recepto rs suggesting that they could be used to evaluate the molecular signaling pathways involved in differentiation of IL 4 DCs and IL 15 DCs Optimization of Phosphorylated Protein Detection Using Monocytic Cell Line s STAT protein activation is very transient. To determine the optima l time to detect phosphorylated STAT proteins after cytokine stimulation, we evaluated pSTAT6, pSTAT5, and pSTAT3 in time c ourse experiment s by stimulating U937 cells for 15 minutes, 30 minutes, 1 hour, and 48 hours We observed pSTAT6 and pSTAT5 levels to be up regulated within 15 minutes after adding IL 4 or GM CSF respectively (Figure 3 5 ). pSTAT 6 and pSTAT5 proteins in U937 cells remained up regulated for 15 30 minutes post stimulation By the first hour following GM CSF stimulation, elevated

PAGE 90

90 pSTAT5 beg an to notably decrease and then 48 hours post stimulation pSTAT5 was nearly the same level as the non stimulated control W e analyzed cytokine induced pSTAT protein responses in the following experiments b y the first 30 minutes after stimulation. Direct I nduction of STAT and MAPK S ignaling in Monocytic Cell Lines by IL 4 or IL 15 Next we evaluated the STAT and MAPK signaling pathways classically associated IL 4, IL 15, or GM CSF stimulation in the two candidate monocytic cell lines U937 and THP 1 via phosp ho protein flow cytometry. Our results showed that IL 4 stimulation directly activated STAT6 without affecting the other STAT pathways in U937 and THP 1 cells (Figure 3 6 ). STAT3 was responsive to IL 4, IL 15, or GM CSF stimulation. pSTAT3 was only increas ed in the presence of IL 6 one of the main activators for the STAT3 pathway Similarly the pp38 or pERK1/2 pathways were not up regulated by IL 4, IL 15, or GM CSF (data not shown). However treatment with the known positive stimulators P MA or anisomycin i ncreased pERK1/2 and pp38 levels (Appendix C ). The positive control results indicated the p38 and ERK1/2 pathways in the cancer cell line s simply did not respond to IL 4 stimulation The presence of GM CSF alone or GM CSF combined with IL 4 or IL 15 induce d STAT5 activation in U937 and THP 1 cell lines Interestingly the addition of IL 15 alone d id not induce up regulation of p STAT5 or pSTAT3 in either m onocytic cell line In summary, U937 and THP 1 cells exhibited strong IL 4 STAT6 and GM CSF STAT5 respon ses. However U937 and THP 1 cell lines did not demonstrate any known molecular signaling responses to IL 15 stimulation H ence, these cell lines are likely not a good model system to study IL 15 signaling mechanisms in differentiating DCs These

PAGE 91

91 results al so suggest that monocytic cells do not respond to IL 15 stimulation even though they express IL 15R or that IL 15 activates different signaling pathways than the traditional STAT5 and STAT3 pat hways identified in lymphocytes. Direct Activation of STAT and MAPK Pathways During DC Maturation in the Presence of IL 4 or IL 15 To confirm the absence of pSTAT5 or pSTAT3 in DCs stimulated with IL 15 and whether STAT3 and/or p38 are directly activated during IL 15 DC maturation, w e analyzed the IL 4 or IL 15 molec ular signaling events during DC maturation imDCs were cultured with maturation factors (GM CSF, TNF and LPS) along with IL 4, IL 15 or IL 4 and IL 15 for 30 minutes before assessing pSTAT and pMAPK levels in CD11c + DCs First, we compared the imIL 4 DCs (Figure 3 7, indicated by squares) cultured with maturation factors and IL 4 alone (imIL 4 DC+IL 4 ) versus imIL 4 DCs matured in the presence of IL 15 alone (imIL 4 DC+IL 15) or IL 4 and IL 15 (imIL 4 DC+IL 4+IL 15). When IL 4 is used in IL 4 DC maturation pSTAT6 is significantly up regulated in relation to the imIL 4 DC+IL 15 condition in which IL 4 was not added (imIL 4 DC+IL 4 p =0.003) (imIL 4 DC+IL 4+IL 15, p =0.02). The percentage of IL 4 DCs exhibiti ng pSTAT6 also greatly increased when matured with IL 4 (imIL 4 DC+IL 4, p =0.006) (imIL 4 DC+IL 4+IL 15, p =0.008). The other STAT and MAPK pathways w ere not differentially activated in imIL 4 DCs by culturing the cells with IL 4 and/or IL 15. Next, imIL 15 DCs (Figure 3 7, in dicated by triangles) cultured with matur ation factors along with IL 4 alone (imIL 15 DC+IL 4) or IL 4 and IL 15 (imIL 15 DC+IL 4 +IL 15) were compared to the imIL 15 DCs cultured with maturation factors along with IL 15 (imIL 15 DC+IL 15). Again, pSTAT6 levels increased only in the presence of IL 4 (imIL 15 DC+IL 4 p =0.008; imIL 15 DC+IL 4+IL 15 p =0.003). There were also more

PAGE 92

92 pSTA T6 + imIL 15 DCs when cultured with IL 4 than in its absence (imIL 15 DC+IL 4 and imIL 15+IL 4+IL 15, p =0.001). Fin ally, consistent with the maturing IL 4 DCs responses maturation in the presence of IL 4 and/or IL 15 did not lead to up regulation of pSTAT5 pSTAT3, pE RK1/2, or pp38 levels in the CD11c + IL 15 DCs. We also evaluated pST AT or pMAPK responses between IL 4 DCs and IL 15 DCs. Despite the relative lack of up regulated pSTAT6, there was a significant difference in the pSTAT6 levels in imIL 4 DC+IL 15 and imIL 15 DC+IL 15 ( p =0.008). There was also significantly more pSTAT6 + imIL 4DC+IL 15 cells than in the imIL 15 DC+IL 15 population ( p =0.01). These results suggest that imIL 4 DCs are continuously secreting low levels of IL 4 or they are predisposed to have a higher basal pSTAT6 than imIL 15 DCs. Stimulated imIL 4 DCs also exhibited slightly higher averages of pSTAT5, pSTAT3. pERK1/2, and pp38 than their imIL 15 DC counterparts but the differences were not statistically significant. Overall, the up re gulation of pSTAT6 or the lack of phospho protein responses by IL 4 and/or IL 15 were the same in maturing imIL 4 DCs and maturing imIL 15 DCs. The level of phospho protein following the addition of both IL 4 and IL 15 showed the same results for stimulati on by only IL 4. Hence the presence of IL 15 in maturing IL 4 DCs or IL 15 DCs does not directly activate any of the evaluated STAT or MAPK pathways including STAT3 or p38 MAPK. Effect of STAT3 or p38 MAPK Inhibition on IFN and TNF Production in mDC s We have previously shown that STAT3 and p38 MAPK are more active in mIL 15 DCs than in mIL 4 DCs and that pSTAT3 and pp38 level are elevated during IL 15 DC maturation (Figures 3 2 and 3 3) We have also shown that mIL 15 DCs produce higher levels of IFN and TNF mRNA transcripts and proteins (Figure 2 7). p38 activity promotes TNF production. Inhibition of p38 by the inhibitor SB203580 or dominant

PAGE 93

93 negative p38 leads to decreased production of TNF and IFN ( 203 ) Using commercial inhibitors and intracellular cytokine flow cytometry, we investigated whether pSTAT3 or pp38 promote IFN and/or TNF in mIL 15 DCs. Mimicking the ELISA protocol, DCs were matured for 24 hours, thoroughly washed, cultured with p38 MAPK inhibitor (SB203580) or STAT3 inhibitor (stattic) along with BFA for 6 hours, and then intracellular IFN or TNF was a ssessed in CD11c + gated mDCs. SB203580 is a commonly used p38 inhibitor that specially inhibits the p38 and p38 isoforms kinase activities ( 158 ) SB203580 binds to the ATP pocket of the enzyme and thus sterically hinders its kinase activity. Stattic is a relatively novel STAT3 inhibitor that can act specifically against STAT3 without affecting other major signaling pathways ( 218 ) Optimal concentrations of inhibitors were determined using THP 1 cells and PBMCs (data no t shown). SB203580 treatment did not affect the production of IFN or TNF in either mIL 4 DCs or mIL 15 DCs (Figure s 3 8 and 3 9). Additionally, inhibition of pSTAT3 activity did not notably affect TNF production in mDCs. However, IFN production was s ignificantly down regulated in CD11c + mIL 4 DCs ( p =0.008 n =8 ) and mIL 15 DCs ( p =0.04 n =8 ) treated with stattic compared to the DMSO controls. pSTAT3 inhibition also reduced the percentages of IFN + mIL 4 DCs ( p =0.02) as well as the IFN + mIL 15 DCs ( p = 0.02). Discussion The cytokine regulated signaling mechanisms that drive the differentiation of monocytes into immunostimulatory DCs are not well understood. Individually the binding of the cytokines IL 4, IL 15, or GM CSF to their respective receptor comp lex predominantly activates the STAT6, STAT5 /STAT3 or STAT5/ ERK1/2 pathways respectively ( 86 98 148 156 ) Depending on the cell type, IL 4 can also activate the

PAGE 94

94 ERK1/2 or p38 pathways ( 86 146 ) Monocyte derived DCs generated with IL 4, IL 15, or GM CSF alone have impaired immunostimulatory functions compared to DCs prepared with GM CSF combined with either IL 4 or IL 15 ( 33 37 38 ) Thus the molecular mechanisms regulated by pai ring of GM C SF and IL 4 or IL 15 plays a responses. However, what molecular mechanisms are being regulated in human monocytes and in vitro generated DCs is unknown In this chapter, we identified the molecular signaling events that are directed by GM CSF and IL 4 or GM CSF and IL 15 during DC maturation that likely play a role in DC functions We also demonstrated for the first time that human monocytic cells and DC s do not activate STAT5 or STAT3 in response to IL 15. To determine the activity of the five STAT and MAPK pathways classically linked with IL 4 IL 15, and/or GM CSF in IL 4 DCs and IL 15 DCs w e assessed the activity of STAT6, STAT5, STAT3, ERK1/2 and p3 8 pathways W e first verified addition of IL 4 or IL 15 at same concentration used to generate our DCs activated STAT6, STAT5, and/or STAT3 pathways in CD3 + T cells (Appendix B). Using phospho protein flow cytometry, we confirmed IL 4 activated STAT6 and I L 15 induced p STAT5 in T cells The other pathways, STAT3, p38, and ERK1/2 were not responsive to either IL 4 or IL 15 stimulation but they were activated to their respective positive control s. Next we evaluated the basal STAT and MAPK activity levels in immature and mature DCs. We found the pSTAT6, pSTAT5, and pERK1/2 proteins were consistently more abundant in CD11c + IL 4 DCs than compared to IL 15 DCs regardless of the DC maturation state (Figures 3 2 and 3 3). GM CSF and IL 4 can activate ERK1/2 and

PAGE 95

95 S TAT6 respectively thus the elevated pERK1/2 and pSTAT6 protein levels in IL 4 DCs are probably due the presence of IL 4 during generation of IL 4 DCs ( 86 117 119 156 ) Additionally, we demonstrated that pSTAT6 is directly up regulated in either imIL 4 DCs or imIL 15 DCs in the presence of IL 4 ( Figure 3 7) Along the same line, GM CSF and IL 15 can also activate STAT5 and both DC subsets were generated in the presence of GM CSF. Therefore it we interesting that CD11c + IL 4 DCs exhibited significantly highe r pSTAT5 levels in comparison to IL 15 DCs (Figures 3 2 and 3 3). We did not notice any dramatic differences in the relative expression of STAT5A and STAT5B mRNA transcripts in IL 4 DCs and IL 15 DCs that could explain the unexpected absence of pSTAT5 from CD 11c + IL 15 DCs (Appendix D). Considering that the expression of IL 15R was nearly equal on both imDCs and that GM CSFR was more abundant on the imIL 15 DCs than on imIL 4 DCs the higher pSTAT5 in imIL 4 DCs was even more surprising (Figure 3 1) One po tential reason for lower pSTAT5 levels in IL 15 DCs compared to IL 4 DCs could potentially be the transient nature of STAT protein activation The tyrosine phosphorylation of STAT protein s is a highly reg ulated process involving tyrosine kinase s as well as multiple tyrosine de phosphorylases and tyrosine kinase inhibitors ( 115 219 ) In a time c ourse experiment we noted that GM CSF stimulated pSTAT5 levels peaked around 15 30 minutes af ter adding the cytokine, and then the elevated pSTAT5 levels began to decrease (Figure 3 5). The pSTAT5 levels were reduced by about half the maximum level about an hour after GM CSF stimulation. Therefore measuring the p hosphorylated STAT protein levels 3 6 48 hours after adding GM CSF and IL 15 in the freshly harvested mDCs would likely be too late to determine a direct

PAGE 96

96 correlation between cytokine stimulation and an increase in pSTAT5 or pSTAT3. Therefore in order to the optimal time to quantify phospho p rotein levels, w e evaluated the immediate pSTAT5 and pSTAT3 responses in U937 cells, THP 1 cells, imIL 4 DCs, and imIL 15 DCs after a brief IL 15 stimulation We did not observe any pSTAT5 or pSTAT3 increase s in response to IL 15 stimulation even though th e different cell types were shown to express IL regulation w hich were observed in the PBL controls (Figures 3 1, 3 4, 3 5, 3 6, and 3 7). As a result, w e are the first to demonstrate that IL 15 does not directly activate the classical ST AT5 or STAT3 pathways in monocytic cell lines or monocytic derived DCs (Figures 3 5, 3 6, and 3 7). In addition to the differential activation of the S TAT5, STAT6, and ERK1/2 pathways between the DC subsets we noticed that the p38 and STAT3 activity leve ls were enhanced specifically in IL 15 DCs after maturation (Figures 3 2 and 3 3). This would suggest that the p38 and STAT3 pathways may be involved in regulating the different phenotypes and behaviors exhibited between the mDC subsets However, our resul ts indicate that IL 4 or IL 15 stimulation of the monocytic cell lines did not activate p38 or STAT3 (Figures 3 5 and 3 6 ). Additionally, we evaluated whether or not p38 or STAT3 activation only occurred in maturing DCs. im IL 4 DCs and imIL 15 DCs were bri efly cultured with maturation factors (GM CSF, LPS, TNF ) in the presence of IL 4 or IL 15, but we did not observe up regulation of p p38 or p STAT3 (Figure 3 7). Potentially the up regulation of pSTAT3 in mIL 15 DCs could be due to the greater production of IL 6 by mIL 15 DCs and/or relative responsiveness of m IL 4 DCs or mIL 15 DCs to the presence of IL 6 (Figure 2 7 and Table 2 1). To support this i n a pilot experiment, mDCs were briefly cultured with IL 6 and then assessed for changes in

PAGE 97

97 pSTAT3 levels using IL 6 stimulated PBLs as controls. We found that afte r IL 6 stimulation, CD11c + mIL 4 DCs only showed a minor increase in pSTAT3 whereas pSTAT3 was noticeably up regulated in mIL 15 DCs (data not shown). IL 6 stimulation of mIL 4 DCs prepared from another donor and confirmed the lack of pSTAT3 res ponse compa red to PBL controls. Increased pp38 activity levels in mIL 15 DCs compared to mIL 4 DCs may be one of the molecular mechanisms regulating immunostimulatory functions of mIL 15 DCs In mature murine DCs, greater p38 MAPK activity promotes DC maturation by i ncreasing co stimulatory molecule expression and cytokine production ( 150 155 202 ) pp38 induces production of IL 12, IL 6, and TNF as well as enhance s IFN transcription and subsequent protein production ( 220 222 ) T hus t he significantly higher pp38 levels that we noted in human mIL 15 DCs compared to mIL 4 DCs could play a role in the relatively higher amounts of IL 6 TNF and IFN secreted by the mIL 15 DCs (Figure 3 5 and Table 2 1). To determine whethe r the increase d pp38 levels in mIL 15 DCs influenced the TNF or IFN production we treated m DCs with the commonly used p38 inhibitor SB203580 and measured cytokine production by intracellular cytokine flow cytometry. p38 activity promotes the translatio ( 158 204 223 ) Although intracellular cytokine production in DCs i s not usually measured by flow cytometry, this method allowed us to evaluate cytokine production from a defined CD11c + gated DC population. Attempting to mimic the previous ELISA assay, imDCs were matured for 24 hours before determining

PAGE 98

98 cytokine production (Table 2 1) These mDCs were cultured for 6 hours in the presence of BFA and SB203580 and then analyzed for intracellular TNF or IFN + DCs. PCR, the relative detected in mIL 15 DCs + CD11c + mIL 15 DCs were significantly greater than in mIL 4 DCs (Figure s 2 7 and 3 9, Tab le 2 1). However we found that i nhibiting the p38 signaling pathway did not decrease th e number of DCs producing or production of as reported to occur in other types of cell s (Figures 3 8 and 3 9) ( 158 224 225 ) I nhibiting p38 activity also did not affect the numbers of mIL 4 DCs that were generating IFN or the production of IFN of the DC subsets Evaluation of the relative intracellular IFN levels in mDCs via western blot using whole cell lysates prepared from two individual donors suggested that mIL 15 DC may have more intracellular I FN than mIL 4 DCs but unfortunately the data was not conclusive (data not shown ). The discrepancy between our intracellular IFN previous ELISA and IFN tion is likely due not measuring IFN production in DCs at the optimal time point One of the limitations of intracellular cytokine flow cytometry is that cytokine production can only be measured for short period s of time due to the toxicity of BFA Moreover, the optimal window of time depends on the partic ular cytokine and cell t ype. It is l ikely that the best time to capture the expected differences IFN in the DC subsets is not the same time period as previously reported for ( 226 ) Finally at least o ne of the benefit s of attempting to measure intracellular cytokines by flow cytometry analysis was that we

PAGE 99

99 repeatedly demonstrate d CD11c + DCs produce IFN conclusions that IL 15 DCs do not produce IFN ( 43 ) To determine whether the presence of IL 15 effects transcription of either the IFN ng pathways we also evaluated whether the presence of IL 4, IL 15, or both IL 4 and IL 15 during DC maturation along with the other matur ation factors (GM CSF, LPS, TNF IFN the IFN ix E ). Although we only assessed two donors, there was no clear trend whether IFN 4 or IL 15 as measured via ELISA. I n the qRT PCR analysis, we did note that the IFN levels in imIL 4 DCs matured in the presence o f IL 15 or IL 4+IL 15 were up regulated compared to imIL 4 DCs matured in only IL 4 Unfortunately when we looked at imIL 15 DCs, we did not see the same pattern. IFN 15 DCs matured with IL 4 or IL 4+IL 15 were lower than imIL 15 DCs matu red with IL 15. T he effect of IL 4 or IL 6 mRNA levels was also not clear. STAT3 seems to have a dual role in DC development and maturation. STAT3 is essential for murine DC differentiation but it inhibits murine DC maturation as measured by the lack of co stimulatory molecule up regulation and subsequently reduces their efficiency to prime T cell responses ( 138 139 200 201 227 ) It also pro motes production of IL 12, IL 6, TNF and IFN in murine DCs and since the STAT3 conditional KO DCs are no longer responsive to IL 10 stimulus, pro inflammatory cytokines are continuously secreted by the DCs Inhibition of STAT3 in murine DCs compared to non inhibited wild type controls shows an increase in CD80, CD86, and

PAGE 100

100 MHC class II expression but reduces the capacity for OVA Ag up take. Thus our previous phenotypical analysis on human IL 15 DCs in chapter 2 with their increased pSTAT3 activities appea rs to be consistent with the murine DCs with activated STAT3. We demonstrated that inhibition of STAT3 negatively affects IFN CD11c + gated mDC subsets using intracellular cytokine flow cytometry analysis (Figures 3 8 and 3 9). STAT3 inhibition did not affect TNF production in the mDCs. Perhaps m onocytic cell lines and monocyte derived DCs may utilize another signaling p athway down stream of the IL 15 R that we have not examined in this study. Direct activation of STAT5 and STAT3 pathways by IL 15 exposure has been established using NK and T cells but IL 15 mediated signaling in monocytic cell lines or DCs has not been confirmed to occur in the same manner ( 98 100 ) M onocytic cell lines and DCs could also use an alternative IL 15 receptor complex similar to mast cells though it is not likely ( 98 ) Mast cells express an alternative IL 15 receptor consisting of a novel IL 15RX receptor subunit and the normal IL 15R chain ( 228 ) Although this alternate IL 15 receptor is still not well characterized, it is associated with STAT5 and STAT6 activation and thus likely not the reason for the relative lack of pSTAT5 and pSTAT6 in IL 15 stimulated monocytic cell lines or DCs. In general, there are three IL 15 mediated signaling mechanisms, IL 15 receptor mediated, trans presentation, and reverse signaling ( 98 196 ) IL 15 receptor mediated is initiated by the classical IL 15 interaction with its heterotrimer receptor which results in STAT5 and STAT3 activation. IL 15 trans presentation and reverse signa ling are important alternative IL 15 signaling mechanisms involving IL 15 that is attached to the surface membrane of DCs and monocytes. Since the trans presented IL 15 binds to the

PAGE 101

101 IL 2R c dimer on the neighbor ing NK or T cells, it is likely that the traditional STAT5 and STAT3 pathways become activated but so far no study has shown this to be the case. The mechanism i n IL 15 reverse signaling, membrane bound IL 15 on monocytes and THP 1 cells are cross linked b y anti IL 15 antibody which activates ERK1/2 and p38 and consequently induces TNF IL 6, and IL 8 production ( 107 109 ) Additionally, IL 15 reverse signaling also increased cellular adhesio n in monocytes and cancer cells. It is likely that if IL 15 DCs participate in IL 15 trans presentation they also activate the reverse signaling pathway IL 15 DCs exhibit greater amount s of membrane IL 15 and appear to be a more adherent cell type than the IL 4 DCs with less membrane IL 15 (Figures 2 1 and 3 1). Furthermore, IL 15 DCs express high amounts of TNF and IL 6 mRNA transcripts and protein production compared with IL 4 DCs ( Table 2 1). We attempted to determine whether the higher levels of membrane IL 15 on more IL 15 mediated cell to cell contact among IL 15 DCs promotes TNF production. The membranes of IL 15 DCs were labeled fluorescent dye, co cultured with non labeled IL 4 DCs, and then TNF production was assessed by flow cytometry. Both DC subsets, regardless of maturation status, shared a lot of cell cell interaction. Unfortunately, this cell ce ll interaction involved large amounts of membrane exchange between the membrane labeled IL 15 DCs and unlabeled IL 4 DCs and caused difficulties in clearly identifying the two DC subsets (data not shown). Due to the complications in studying the molecular signaling mechanisms regulated by IL 15 trans presentation/ reverse signaling in primary APCs, we did not further investigate these alternative IL 15 signaling pathways.

PAGE 102

102 O verall o ur results show that mon ocyte derived IL 15 DCs exhibit a molecular signaling profile that is unique from the one observed in IL 4 DCs and may have implications with their immune functions The basal activity levels of STAT and MAPK proteins in IL 15 DCs are generally reduced compared to in IL 4 DCs. Phosphorylated STAT6, STAT5, an d ERK1/2 proteins were much more abundant in IL 4 DCs compared to IL 15 DCs We demonstrate that in contradiction to the classical IL 15 STAT5 concept IL 15R expressing monocytic cell lines and monocyte derived DCs do not respond to IL 15 stimulation by activating STAT5, or even STAT3. Finally, pSTAT3 is up regulat ed during DC maturation in only CD11c + gated IL 15 DCs and a ppears to enhance IFN production b y mDCs

PAGE 103

103 Figure 3 1. Expression of cytokine receptors and membrane bound IL 15 detected on immature and mature DC subsets A ) Expression of surface protein of CD11c + imIL 4 DCs (light grey bars) and CD11c + imIL 15 DCs (dark grey ntage protein + CD11c + imDC subsets C ) Expression of surface protein of CD11c + m IL 4 DCs and mIL 15 DCs of protein + CD11c + m DC subsets n =6 Significance calculated by wilcoxon matched pairs signed rank test with the determined p value significant

PAGE 104

104 Figure 3 1. Continued

PAGE 105

105 Figure 3 2. Comparison of signa ling pathway profiles between the CD11c + im DC subsets A) Representative histogram data of CD11c + gated imDCs Grey shaded histogram s indicate the non stained imDC controls imIL 4 DC s are shown by the solid line s and imIL 15 DCs are indicated by the dashed line s. B) Phospho protein + + gated cells after subtraction of the non stained mDC values C ) Phospho protein + + imDCs after subtraction of the non stained imDC values. imIL 4 DCs are shown as light squares and imIL 15 DCs are indicated by dark triangles. Median values are indicated by the bars. n =5 12 Significance calculated by wilcoxon matched pairs signed rank test with the determined p significant

PAGE 106

106 Figure 3 2. Continued

PAGE 107

107 Figure 3 3. Comparison o f signaling pathway profiles between the m ature CD11c + DCs A) Representative histogram data of CD11c + gated mDCs. Grey shaded histograms indicate the non stained mDCs. mIL 4 DC s is shown by the solid line s and mIL 15 DCs are represented by the dashed line s B) Phospho protein + + gated cells after subtraction of the non stained mDC values C ) Phospho protein + + mDCs after subtractio n of the non staine d mDC values. mIL 4 DCs are shown as light squares and mIL 15 DCs are indicated by dark triangles. Bar indicates the median value s n =7 10 Significance calculated by wilcoxon matched pairs signed rank test with the determined p 0.05 considered significant

PAGE 108

108 Figure 3 3 Continued

PAGE 109

109 Figure 3 4 Expression of the three cytokine receptors on the monocytic cell li nes U937, THP 1, and HL 60 Isotype is represented by grey peak and surface cytokine receptors are indicated by the black line. Histogram data shown here a re representative images of at least two independent experiments

PAGE 110

110 Figure 3 5. Temporal activation of the STAT6, STAT5, and STAT3 pathways in U937 cells by cytokine stimulation Serum starved U937 cells were stim ulat ed with IL 4, IL 15, GM CSF, IL 6, or combinations of GM CSF and IL 4 (IL 4+GM CSF) or GM CSF and IL 15 ( IL 15 + GM CSF ) for the time s indicated. Non stimulated c ells were used as controls Histograms displayed here are representative data of two indepen dent experiments. Temporal pSTAT responses in HL 60 cells were analyzed with similar results

PAGE 111

111 Figure 3 6 Dire ct activation of the STAT6, STAT5, and STAT3 pathways by IL 15, IL 4, or GM CSF in U937 and THP 1 cells Monocytic cell lines were serum sta rved prior to stimulation. IL 4 and IL 15 were added to the cells alone or in combinati on with GM CSF (IL 4+GM CSF, IL 15+GM CSF). No stimulation and IL 6 stimulated cells served as controls for the basal signaling levels and for pSTAT3 respectively. H isto grams that are shown here are representative data from at le ast two independent experiments

PAGE 112

112 Figure 3 7. Immediate activation of the STAT and MAPK pathways by IL 4 or IL 15 during DC maturation. i mIL 4 and imIL 15 DCs we re incubated with DC maturation factors (GM CSF, LPS, and TNF ) in presence of IL 4 alone (+IL 4, light grey), IL 15 alone (+IL 15, medium grey), or in IL 4 combined with IL 15 (+IL 4+IL 15, dark grey) for 30 minutes before assessing pSTAT or pMAPK change in CD11c + gated imDCs Shaded squares indicate imIL 4 DCs and shaded triangles represent imIL 15 DCs. A) Phospho protein + of CD11c + gated cells after normalization wit h non stained imDCs B) Phospho protein + + cells after normalizing with non stained imDCs Due to the lower n value evaluated t he bar indicates the mean value. n =4 Significance calculated by paired t tests with the determined p

PAGE 113

113 Figure 3 7. Continued

PAGE 114

114 Figure 3 8. STAT3 inhibition down regulate d IFN production however inhibition of p38 did not a ffect IFN or TNF production in mDCs imDCs were matured for 24 hours, washed, and incubated with STAT3 or p38 inhibitors along with BFA for 6 hours. IFN + or TNF + CD11c + DCs were evaluated. CD11c + gated mIL 4 DCs are light grey squares while CD11c + mIL 15 DCs are shown in dark grey squares. M edian percentage s of IFN + or TNF + mDCs are shown by the bars. n =7 Significance calculated by wilcoxon matched pairs signed rank test with the determined p

PAGE 115

115 Figure 3 9. Inhib ition of STAT3 or p38 had no effect on TNF production in mDCs imDCs were matured for 24 hours, washed, and incubated with STAT3 or p38 inhibitors and BFA for 6 hours. IFN + or TNF + CD11c + DCs were evaluated. CD11c + gated mIL 4 DCs a re represented by light grey squares while CD11c + mIL 15 DCs are shown by the dark grey squares. M edian percentage s of the IFN + or TNF + mDCs are indicated by the bars n =7 Significance calculated by wilcoxon matched pairs signed rank test with the dete rmined p 0.05 considered significant

PAGE 116

116 CHAPTER 4 CONCLUSIONS Findings and Future Directions D ue to their abilities at regulating immune responses and the discovery of how to generate monocyte derived IL 4 DCs there has been a strong interest to dev elop an effective DC vaccine for cancer immune therapy applications. The general therapeutic goal for DC vaccine strategies is the complete eradication of the tumor cells by administrating DCs loaded with the tumor/tumor associated Ag. Unfortunately althou gh the many of the clinical trials using IL 4 DCs to treat cancer patients report immune responses in the patients, the majority of the studies do not objective clinical responses ( 19 25 ) Seeking to over come this problem, alternative cytokine combinations from the original pairing of GM CSF and IL 4 that generate d immunostimulatory monocyte derived DC subsets wer e evaluated ( 30 31 ) The capacity of these DC subsets to elicit Ag specific cytolytic CD8 + T cell responses were usua lly compared with to the more well known monocyte derived IL 4 DCs Unfortunately these alternative DC subsets either did not undergo maturation which was evaluated by the up regulate the cla ssical co stimulatory molecules or only primed CD4 + T cell respon ses without activation of the desired cytolytic CD8 + T cell response s Monocyte derived DCs prepared with GM CSF combined with IL 15 were the fir st DC subset that was more efficient at p riming melanoma specific cytolytic CD8 + T cell responses than IL 4 DCs and they induced NK cell proliferation suggesting that IL 15 DCs could be a more potent immune therapeutic tool ( 43 45 ) However, these IL 15 DCs were not well characterized and the descriptions concerning the IL 15 DC surface phenotype and c ytokine production were not consistent among the IL 15 DC

PAGE 117

117 studies ( 42 47 ) Furthermore, whether IL 15 DCs can induce stronger melanoma Ag specific T cell responses than the conventional IL 4 DCs via a unique cell to cell contact mechanism or secreting a soluble factor to enhance T c ell activation remains inconclusive Of two studies that investigated this mechanism, Dubsky et al. purported IL 15 DCs provide an unidentified cell to cell contact mechanism to enhance Ag specific T cell proliferation whereas Hardy et al. reported that g reater amounts of IFN helped prime T cell responses ( 43 45 ) Therefore we conducted our own extensive comp arative analysis between IL 15 DCs and IL 4 DCs to first assess the expression levels of surface molecules potentially interacting with T cells as well as the production of cytokines from the DC subsets. I n our hands CD11c + gated IL 15 DCs do not highly e xpress all of the typical DC specific surface markers such as CD1a and DC SIGN (Chapter 2). Furthermore, LPS matured IL 15 DCs do not up regulate the expression of every surface mar ker that is traditionally associated with DC maturation like CD86 (Chapter 2) Thes e phenotypical differences from typical IL 4 DCs caus e IL 15 DCs to appear physically less differentiated and mature than IL 4 DCs Consistent with being more phenotypically immature mIL 15 DCs endocytosed OVA Ags more efficiently than the mIL 4 D Cs. They also tended to promote the effector CD8 + T cell subset over the memo ry T cell subsets and induce d greater CMV and HCV specific cytolytic effector responses from both CD8 + and CD4 + T cells (Chapter 2). In contrast with prior IL 15 DC literature, we observed each DC subset exhibited their own distinctive cell morphologies and IL 15 DCs secrete d higher amounts of pro inflammatory cytokines such as IFN TNF and IL 6 ( 42 43 45 46 ) In spite of Hardy

PAGE 118

118 the IFN detected in the I L 15 DC culture supernatant was secreted by the small number of contaminating NK cells and not the DCs, we confirmed by intracellular cytokine flow cytometry analysis that CD11c + IL 15 DCs produce a large amount of IFN (Chapter 3) ( 43 ) Also we noted that the amount of IFN mRNA transcript in IL 15 DCs were considerably more abundant in comparison to the level in IL 4 DCs which further supports that the IFN L 15 DC culture supernatants is produced by IL 15 DCs, and not from the very small amount of NK cell s contam inating the DC cultures (Chapter 2 ). It was clear that the presence of GM CSF and IL 15 and their down stream molecular signaling mechanisms affected the differentiation of monocyte derived DCs compared to GM CSF and IL 4. We attempted to identify which of the STAT or MAPK signaling pathways which are traditionally associated with GM CSF IL 4 or IL 15 stimulation were unique ly affected in IL 4 DCs versus IL 15 DCs. We found that IL 4 DCs always exhibited higher activity levels of STAT6, ERK1/2, and STA T5 (Chapter 3). T he tendency for IL 4 DCs to have more active STAT6 and ER K 1/2 pathways can be attributed to the presence of IL 4 which are the dominant molecular signaling pathways activated by IL 4 in other cell types ( 86 ) The absence of a strong up regulation of the pSTAT5 protein levels in IL 15 stimulated monocytic cell lines and imDCs was surprising According to the established IL 15 receptor mediated signali ng model, STAT5 is phosphorylated by JAK3 and in some cell types STAT3 is activated by JAK1 leading to increased amounts of pSTAT5 and/or pSTAT3 ( 98 ) In our study, w e demonstrated for the fir st time that IL 15 stimulation does not affect the STAT5 or STAT3 pathways in monocytic cell lines and

PAGE 119

119 DCs despite the se cells expressing IL 15R (Chapter 3) We showed that the monocyte derived DCs transcribed the genes for STAT5a, STAT5b, and STAT3 as well as these two STAT pathways are directly activated by other cytokines in monocytic cells and DCs ( Chapter 3, Appendix es B and D). The lack of change in the pSTAT5 levels following IL 15 stimulation in monocytic cell lines and DCs could be due to the preferential activation of the STAT5b isoform rather than the STAT5a which was the isoform that we had measured Other potential reasons for the abs ence of pSTAT5 up regulation after adding IL 15 to monocytic cell lines and in vitro generated DCs include decreased exp ression of either the other two IL 15R subunits (IL 2R and c) or the associated JAKs (JAK3 and JAK1 ). The potential lack of IL 15 receptor chains, JAK1, or JAK3 expression in monocytic cell lines and DCs can easily be determined by western blot or flow cytometry Also the association of JAK3 and/or JAK1 wit h the cytoplasmic domains of the IL 2R and c proteins respectively can be verified in the IL 4 DCs and IL 15 DCs by i mmunoprecipitation Although IL 15 stimulation does not directly activate any of the signaling pathways evaluated in our study, the prese nce of IL 15 during DC differentiation must induce activation of some typ e of molecular signaling pathways via IL 15R. Blocking IL 15 or IL 15R via neutralizing antibodies targeting either IL 15 or impaired generation of monocyte de rived IL 15 DCs ( 42 47 ) Also in one of the studies, they showed that the presence of recombinant IL 15 (~50 pg/mL) during differentiation of DCs from monocytes promoted the expression of co stimulatory molecules (CD80, CD83, CD86) in relation to DCs generated in the absence of IL 15 To further understand how the presence of IL 15 affects DC differentiation and maturation, the

PAGE 120

120 activities of other molecular signaling pathways, including the remaining STAT family proteins STAT1, STAT2, and STAT4, should also be assessed Other signaling pathways commonly activated by cytokines in many cell types include the th i rd MAPK signaling mechanism c Jun N terminal kinase (JNK) pathway as well as the p hosphatidylinositol 3 kinase (PI3 K) pathway. S ome of the physical and functional differences noted in the two DC subsets can be directly associated with the continual prese nce of IL 4 or IL 15. For example IL 4 inhibits transcription of the TNF IL 1 IL 1 IL 6, IL 8, and IL 15 gene s and subsequent ly the negatively regulates production of the cytokine proteins ( 86 89 199 220 229 231 ) Hence the lower production of TNF IL 1 IL 1 IL 6, and IL 15 by our mIL 4 DCs could be simply due to negative regulation by IL 4 (Chapter 2). Murine DCs treated with IL 15 appears to exhibit similar functions as human monocyte derived IL 15 DCs. In the murine DCs, the pres ence of IL 15 was reported to markedly increase IFN production and enhance Ag + T cell proliferation ( 208 232 ) We also assessed if th e molecular signaling profile s of the DC subsets were affected by DC maturation or remained the same There were no obvious differences in the relative activities of the STAT6, STAT5, and ERK pathways after inducing maturation (C hapter 3). However t he p38 and STAT3 pathways were mildly activated in the mIL 15 DCs compared to the imIL 15 DCs and these changes were only observed in the IL 15 DCs Interestingly it seems that mIL 4 DCs do not up regulate pSTAT3 in contrast to mIL 15 DCs because of some unknown impairment in the activation of the STAT3 pathway The lower pSTAT3 levels in mIL 4 DCs is not caused by the relatively lower levels of IL 6 or other cytokines that strongly activate STAT3 in the mIL 4 DC

PAGE 121

121 culture supernatant as noted in the mDC ELISA results (Chapter 2). In a small pilot study using two individual donors we found that pSTAT3 levels in mIL 4 DCs were only slightly incre ased after IL 6 stimulation in comparison to the IL 6 treated mIL 15 DCs and PBL controls (data not shown). The increased STAT3 activity in the mIL 15 DCs may play an important role in modulating the differential immunostimulatory capacities shown between mIL 15 DCs and mIL 4DCs. W e later noted t hat inhibiting STAT3 activity significantly down regul ated the production of IFN did not affect the production TNF Since STAT3 has not been reported to directly regulate IFN known IFN producing types of cell s such as Th1 CD4 + cells and CD8 + T cells we at tempted to verify if the reduction of STAT3 activity in DCs can quantitatively down regulate secretion of IFN affect IFN specific manner However we found that incubating the DCs with the only commercially av ailable inhibitor specific for STAT3 seemed to be cytotoxic to DCs. Short term or longer term incubation of the IL 4 DCs in IL 15 or IL 6 only induces little to no pSTAT3 up regulation and had little effect on the IFN or IFN n (Appe n dix E and data not shown). Finally, i n the future it would be beneficial to determine whether IL 15 DCs elicit stronger Ag specific cytolytic T cells responses by a cell to cell contact mechanism such as IL 15 trans presentation or by secreting la rge amounts of inflammatory cy tokines like IFN two studies investigating how human IL 15 DCs induce more T cell responses than IL 4 DCs contradicted each other ( 43 45 ) Dubsky et al. concluded that IL 15 DCs promote T cell response s due to an unidentified cell to cell contact based on the proliferation of T cells co cultured with IL 15 DCs compared to a

PAGE 122

122 trans well experiment involving IL 4 DCs, IL 15 DCs, and the T cells ( 45 ) Dubsky et al. hypothesize that this cell to cell mechanism could be trans presentation of IL 15. On the other hand, Hardy et al. concluded that the high concentration of IFN supernatant of IL 15 DCs by contaminating NK cells promote T cells responses ( 43 ) L 15 DCs did not secrete IFN production of IL 15 in their mIL 15 DCs. We assessed if the presence of the pro inflammatory cytokine IFN IL 6, IL 15 at the average concentration determined in our prior ELISA help ed to promote T cell activation or had no effect (Chapter 2). PBLs were stimulated in a polyclonal manner overnight with anti CD3/anti CD28 antibody covered beads in the presence of IFN 6, IL 15, or all four combined (A ppendix F ). Of the four c ytokines, IL 6 was the most effective at increasing the number of activated T cells which emphasizes the potential importance of the high production of IL 6 by mIL 15 DCs. It also suggests that the IFN nto Th1 or cytolytic T cells and not in promoting activation of T cells. indicated that the greater amount of membrane bound IL 15 on IL 15 DCs may have a significant effect on T cell activation/polarization (Chap ter 3). To reduce the additional variables of DC produced cytokines, and differentially expressed surface markers, IL 15 trans presentation in the future can studied by using micro spheres loaded with recombinant IL 15R and IL 15 proteins as described in previous NK cell publications ( 107 209 ) Reverse signaling for IL 15 can also be evaluated by loading the mi cro spheres with anti IL 15 antibodies alone. Overall, the required mechanisms involved in

PAGE 123

123 human DC development and the regulation of DC immune stimulatory functions is complex and still not well understood. Clinical Implications M onocyte derived IL 15 DC s The basic DC vaccine strategy involves of loading in vitro generated DCs with tumor or tumor associated Ag and then administering these DCs into patients in order to stimulate an immune response against cells expressing the particular Ag Human clinical trials have demonstrated that DC vaccines are non toxic and have littl e to no side effects in the patients ( 19 24 26 ) These DC vaccines have demonstrated to be immunogenic in vivo in many the clinical trials by a range of methods including tetramer staining, ELISpot, Ag recall killing assay, and T cell prolifera tion Yet significant redu ction of the tumor size/mass is rare ly observed and the necessity for the development of a more effective DC based immune therapeutic strategy is widely acknowledged. M onocytes cultured in the presence of GM CSF and IL 15 differen tiate into a rather novel DC subset which elicit greater Ag specific CD8 + T cells responses derived IL 4 DCs ( 43 45 46 ) Based on this demonstrated ability, human IL 15 DCs appear to be a promising tool to improve DC based immunotherapy This study demonstrated that human monocyte derived IL 15 DCs can stimulate stronger CMV or HCV specific cytolytic T cell response from either the CD8 + T cell or the CD4 + T cell populations. Usage of IL 15 DCs to prime T cells responses tended to favor the effector T cell subset over the memory T cell popu lation which may be beneficial for priming more immediate cytolytic T cell responses for currently infected individuals. IL 15 DCs may retain their im munostimulatory functions near tumor

PAGE 124

124 microenvironments with high IL 6 concentrations which normally inhibi ts mIL 4 DC immune functions A lso the relatively lower expression of the lymph node homing receptor CCR7 on the surface of mIL 15 DCs suggest that if these mDCs are re introduced into the patient, mIL 15 DCs will likely remain in a concentrated populatio n near the injection site. In addition to stimulating cytolytic T cells responses, IL 15 DCs may also provide a source IL 15 and TNF which are important for NK cells. NK cells are another potential tool for cancer immune therapeutic applications ( 233 235 ) Unlike T cells which respond to a sing le Ag, NK cell s c an become activated by a range of different Ags. Their cytolytic activities against target cells provide a source of tumor Ags for DCs to engulf and present to T cells. They also produce high amounts IFN promote s Th1 responses and facilitate DC maturation. Potential Limitations All IL 15 DC characterization studies including this one concur that IL 15 DCs stimulate stronger CD8 + T cell responses than IL 4 DCs H owever the method of isolating the monocytes the culture conditions utilized to differentiate IL 15 DCs (type of cell media, percentage of serum added to cell media, number of days in culture), and the type of stimuli used to mature the DCs can notably affect the expression of surface markers and cytokine production Alth ough differences in CCR7 expression or cytokine production would not affect the immunostimulatory abilities of IL 15 DCs in vitro these differences could have a large impact on their abilities to mobilize to lymph nodes and/or attract lymphocytes in vivo It is 15 DC culture method to obtain consistent and comparable results among the various groups that are evaluating IL 5 DCs for future immune therapeutically applications

PAGE 125

125 A few possible drawback s to using IL 15 DCs in f uture cancer immune therapy strategies would be that IL 15 DCs are an adherent cell type, only have low expression of CCR7, and they secrete relatively high levels of pro inflammatory cytokines such as IL 6 and TNF IL 15 DCs could attached themselves to tissues near the DC vaccine injection site and, without migrating to the draining lymph nodes, produce large amounts of IL 6 and TNF The secretion of pro inflammatory cytokines in a localized area may have detrimentally e ffect s P rolonged inflammat ion c a n damage tissues and is associated with many inflammatory and autoimmune diseases like rheumatoid arthritis. Furthermore using a DC subset that produce s high levels of IL 6 m ight not be ideal type of cells to use for treating some types of cancer s Some c ancers are known to promote their own proliferation by secreting high amounts of IL 6 on their own such as melanoma, multiple myeloma, and prostate cancer ; thus, additional production of IL 6 would likely allow these types of IL 6 responsive cancers to pro liferate ( 120 133 135 236 ) T he production of IL 6 by these cancers has also been shown to suppress cytolytic T cells responses by inhibiting Th1 differentiation as well as inhibiting DC maturation which consequentially induces immune tolerance ( 138 139 171 201 237 )

PAGE 126

126 APPENDIX A STIMULATION BY A PAR TICULAR DC SUBSET DO ES NOT AFFECT NK CEL L SUBSET DISTRIBUTION OR CYTOLYTIC FUNCTIO N In addition to assessing CMV or HCV specific CD3 + T cells responses elicited by mI L 15 DC s versus mIL 4 DCs, we evaluated the cytolytic functionality of the NK cells previously detected at the end of the DC:PBL co culture Using a non radio isotype method, c ultured NK cells were tested for cytotoxic activity using the NK sensitive cell l ine K 562 as a target cell. K562 target cells were labeled with 1 M CSFE then cultured in a U bottom 96 well plate along with increasing ratios of the PBLs that had been previously co cultured with mDCs. The labeled K562 cells and PBLs were co cultured for 5 hours in AIM V media with 5% human serum at 37 C. Next, the cells were washed with FACS buffer a set amount of APC labeled beads were added per sample immediate before collecting data on the BD Aria FACS machine, and the number of CSFE labeled was quan tified in relation to a defined number of APC labeled beads (3000 beads per sample). Data was analyzed on the same BD FACSDIVA program used to obtain the data. We evaluated two donors with each effector to target ratio completed in either duplicates or tri plicates. The percentage of CD3 CD56 + NK cells in the DC primed PBL population was determined in a previous described assay. Overall, it seems NK cells co cultured with Ag pulsed mIL 15 DCs may induce more cell death to their target cells regardless of Ag type However, since we did use the same number of purified NK cells to compare the effect of mIL 4 DCs and mIL 15 DCs, we cannot disregard the possibility the observed increased lytic function is simply due to the presence of more NK cells

PAGE 127

127 Figure A 1 Evaluation of NK cell lytic function after being co cultured with mIL 4 DCs or mIL 15 DCs NK cell surface staining data a nd NK cell specific lysis data are r epresentative of one out of two donors evaluated A) Percentage of CD3 CD56 + NK cells in the ge neral lymphocyte gated population after being co cultured with CMV pulsed mIL 4 DC (+mIL 4DC) or mIL 15 DC (+mIL 15 DC). B) Determined percentage s of specific lysis of the CSFE labeled K562 target cells. The light squares represent cells exposed to mIL 4 D Cs and the dark triangles indicate the cells co cultured with mIL 15 DCs. Each data point repre sents the mean values SEM from the particular ratio analyzed in triplicate. C) Percentages of NK cells after PBLs co cultured with HCV pulsed mDCs. D) Calculat ed percentage of specific lysis of CSFE labeled K562 target cells

PAGE 128

128 APPENDIX B CYTOKINE INDUCED STA T PROTEIN ACTIVATION IN CD3 + T CELLS PBLs were thawed and then stimulated with 25 ng/mL IL 4, 100 ng/mL IL 15, 50 ng/mL GM CSF, 50 g/mL IL 6, 5 mM hydrogen peroxide ( H 2 O 2 ) or 50 M phorbol 12 myristate 13 acetate (PMA) for 15 minutes at 37 C. Stimulated cells were fixed with 2% PFA, permeated in 90% methanol overnight at 20 C before washing and staining the cells with phospho protein antibodies for 1 hour at room temperature. Data was collected on the BD LSRII flow cytometer and analyzed with Flowjo. Following IL 4 stimulation, CD3 + gated T cell s increased pSTAT6 without activation of the other STAT pathways Addition of soluble IL 15 exclusively activated STAT5. STAT3 was not activated by either IL 4 or IL 15 stimulation. GM CSF did not stimulate any of the three STAT pathways since T ce lls do not express GM CSFR As expected, the p38 MAPK and ERK1/2 MAPK pathways were not activated by IL 4, IL 15, GM SF, or IL 6 (data not shown). Up regulation of pSTAT3 and the two pMAPK proteins were only observed when stimulated with the commonly used positive controls which were IL 6 for pSTAT3, H 2 O 2 for pp38 and PMA for pERK1/2 IL 6 is a key activator of the STAT3 pa thway in many cell types ( 120 ) Activation of the T cell receptor (TCR) signaling pathway leads to phosphorylation of the p38 and ERK1/2 proteins Both H 2 O 2 and PMA can initiate the TCR signaling pathway by respectively, the induction of oxidative stress or mimicking diacylglycerol (DAG) which a TCR signaling protein necessary for ERK1 /2 activation ( 238 239 )

PAGE 129

129 Figure B 1 STAT and MAPK activation in stimulated PBLs. PBLs were stimulated with IL4 IL 15, GM CSF, IL 6, PMA, or H 2 O 2 for 15 minutes. Non stimulated, non stained and non stimulated controls were included to determine background cellular auto fluorescence and basal protein phosphorylation state. Phosphorylated proteins were detected in C D3 + gated T cells. Histograms are representative of cytokine phorbol ester or oxidative stress induced activation of STAT or MAPK prot eins for at least three independent experiment s

PAGE 130

130 APPENDIX C ACTIVATION OF MAPK SIGNALING PATHWAYS IN MONOCYTIC CELL L INES BY PMA OR ANISOMYCIN Serum starved U937 and THP 1 cells were stimulated with 50 nM PMA or 25 ng/mL anisomycin to determine ERK1/2 or p38 activation respectively. C ells were stimulated for 15 minutes at 37 C. Then the cells were fixed with 2% PFA, perm eated in 90% methanol overnight at 20 C before washing and staining the cells with phospho protein antibodies for 1 hour at room temperature. Data was collected on BD LSRII flow cytometer and analyzed with Flowjo. PMA and anisomycin are the positive stimu latory controls suggested by BD. Of the two monocytic cell lines, it appears that THP 1 cells are more responsive to PMA and anisomycin. Figure C 1 pERK1/2 and pp38 induction by PMA or anisomycin in monocytic cell lines U937 and THP cells were stimul ated with anisomycin or PMA for 15 minutes at 37C. Cells were fixed and stained for pERK1/2 or pp38. Non stimulated, non stained control used to determine the cellular auto fluorescence levels are indicated by grey histogram. PMA stimulated cells are show n by dashed line whereas the anisomycin stimulated cells are displayed as solid line

PAGE 131

131 APPENDIX D RELATIVE QUANTITATIO N OF STAT PROTEIN TRANSCRIPT EXPRESSION LEVELS DURING DC DIFFERENTI TATION AND MATURATIO N The human transcription factor and human RT 2 RNA Q C PCR arrays were obtained from SABiosciences (Qiagen, Valencia, CA). Monocyte, imIL 4 DC, imIL 15 DC, mIL 4 DC, and mIL 15 DC total cellular RNA were extracted and pooled together trogen). The pooled RNA was treated wi th DNAse I (Promega ) then purified using the RNeasy mini kit (Qiagen). RNA concentration and purity was measured with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Wilmington, DE ) and general RNA integrity wa s evaluated via denaturing agarose gel elect rophoresis followed by ethidium bromide staining cDNA was generated from 1 g total RNA using the RT 2 First Strand transcription factor gene expression were determined with the Human RT 2 RNA QC PCR array and the Human transcription factor q PCR array respectively. SYBR green based quantitative PCR (qPCR) data was collected and analyzed using the MX3000P thermal cycler ( Agilent Technologies, Inc., Santa Clara, CA). Overall, STAT3, STAT5A, STAT5B, and STAT6 transcripts were detected in monocytes, imDCs and mDCs. We found that the transcripts level for STAT3, STAT5A, STAT5B, and STAT6 are very similar as the monocyte under DC differentiation a nd maturation. In the TF qRT PCR array, the STAT1 transcript was one of the most differentially expressed TF between IL 4 DCs and IL 15 DCs. The relative difference in the abundance of STAT1 transcripts in IL 4 DCs and IL 15 DCs progressivel y increases fro m imDCs to mDCs.

PAGE 132

132 Figure D 1 Quantification of expression of the STAT3, STAT5a, STAT5b, and STAT6 transcript levels in monocyte s imDCs and mDCs. RNA was pooled from 3 individual donors and used to generate cDNA which was used in the SYBR green based q PCR arrays. The average expression level of 5 housekeeping genes including GAPDH and actin provided in the array were used for normalization as suggested by the manufacturer. The calculated 2 Ct values for IL 4 DCs are shown by the light grey squares while IL 15 DCs are indicated by the dark grey triangles

PAGE 133

133 APPENDIX E EFFECT OF IL 4 VE RSUS IL 15 ON CYTOKINE PRODU CTION BY MATURE DCS imDCs were matured with LPS, TNF GM CSF, and either IL 4 or IL 15 for 24 hours as in the previous multiplex ELISA Then the DCs were thoroughly washed and cultured for another 24 hours in AIM V media withou t cytokines at the same cell density as before (1x10 6 mDCs/mL) The mDC s upernatant was collected and stored at 80 C until analysis. Total cellular RNA from the mDCs was isolated using Tri Reagent while The SYB R gree n qRT PCR analysis of the expression levels of the IFN TNF and IL 6 mRNA transcripts in mDCs was determined and normalized to actin mRNA transcript levels as described previously. The secreted IFN concentration in the mDC super natant was measured by ELISA. The mini human IFN ELISA kit w as purchased from PeproTech ( Rocky Hill, NJ ) and t he IFN concentration a 96 well Falcon BD Pro bind plate and azino bis(3 ethylbenz thiazoline 6 sulfonic acid) ) liquid substrate ( Sigma ) Plates w ere washed with the Biotek ELx405 plate washer ( Winooski, VT ) and final absorbance data was collected and analyzed with BioRad model 680 scanner ( Hercules, CA )

PAGE 134

134 Figure E 1 Presence of IL 15 up relegates IL 6 transcript levels but does not affect IFN or TNF transcripts Relative cytokine mRNA levels were normalized with actin gene expression. Bar indicates the mean value. n =2 Table E 1 IFN production from DCs matured in presence of IL 4 and/or IL 15 imIL 4 DC (pg/mL) imIL 15 DC (pg/mL) Dono r +IL 4 +IL 15 +IL 4 +IL 15 +IL 4 +IL 15 +IL 4 +IL 15 1 416.9 309.6 394.3 255.6 174.8 238.4 2 955.0 1050.9 714.0 834.5 999.6 1108.9 imDCs matured with GM CSF, LPS, TNF and indicated cytokine for 24 hours.

PAGE 135

135 APPENDIX F EFFECT OF CYTOKINE E NVIR ONMENT ON LEVEL OF CD3 + T CELL ACTIVATION IL 12 and type I IFNs secreted by mDCs is the third essential signal to induce T cell immune responses ( 56 169 187 240 ) Since IFN TNF IL 6, and IL 15 are produced in hig h levels by mIL 15 DCs, we assessed whether the presence of these cytokines would affect T cell stimulation (Table 2 1) PBLs were stimulated with anti CD3/ anti CD28 beads (Dynal, Invitrogen, San Diego, CA) in th e presence of exogenous cytokines in AIM V media supplemented with 5% human serum as in our previous DC:PBL co cultures W e tried to mimic the average secreted cytokine(s) concentration determined by mDC ELISA and were added at the following concentrations : 5 ng/mL IFN (Gentaur), 5 ng/mL TNF 10 ng/mL IL 6, 5 ng/mL IL 15, or all four cytokines combined. 3x10 5 PBLs were plated in to a 96 well U bottom p late and then cytokines were added to the appropriate wells Finally anti CD3/ anti CD28 beads were added to the wel ls to stimulate T cells following t overnight T cell activation was measured via flow cytometry by up regulation of CD25 and CD69 which are two common markers for activation in CD3 + gated T cells. The surface of the stimulate d P BLs were stained with anti CD3, CD25, and CD69 antibodie s as described previously prior to collecting the data on BD LSRII and then analysis with Flowjo. Statistical significance was determined by two tailed, paired t test s due to the small number of do nors evaluated. Overall, nearly all the cytokines increased the number of activ ated T cells in relation to the control. However, IL 6 by itself significantly increased the percentage of CD69 + CD3 + T cells ( p =0.04) as well as CD25 + CD69 + CD3 + T cells ( p =0.0 5). The presence of TNF also p romote d T cell activation but additional donors w ould be needed to confirm the slight increased observed Future experiments

PAGE 136

136 evaluating potential dose dependence of IL 6 and/or TNF would necessary to confirm that these inflammatory cytokines help to increase T cell activation. Additionally the potential increase in T cell activation by the cytokines secreted from mIL 15 DC s as well activities should also be ver ified

PAGE 137

137 Figure F 1 Effect of IFN IL 15, IL 6, or all four inflammatory cytokines on the activation of CD3 + T cell s PBLs were stimulated overnight with anti CD3/anti CD28 beads in the presence of the indicated cytokine. T cell activation was evaluated by the up regulation of CD25 and CD69 expression on the surface of CD3 + gated T cells A) Percentage of CD25 + T cells. B) Percentage of CD69 + T cells. C) Percentage of CD25 + CD69 + T cells. Mean value s SEM are indicated by the bars and whiskers Statistical significance determin ed by two tailed paired t test with p considered significant. n =4

PAGE 138

138 LIST OF REFERENCES 1. Steinman, R. M., D. S. Lustig, and Z. A. Cohn. 1974. Identification of a novel cell type in peripheral lymphoid organs of mice. 3. Functional properties in vivo. J Exp Med 139:1431 1445. 2. Steinman, R. M., and Z. A. Cohn. 1974. Identification of a novel cell type in peripheral lymphoid organs of mice. II. Functional properties in vitro. J Exp Med 139:380 397. 3. Steinman, R. M., and Z. A. Cohn. 1973. Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution. J Exp Med 137:1142 1162. 4. McKenna, K., A. S. Beignon, and N. Bhardwaj. 2005. Plasmacytoid dendritic cells: linking innate and adaptive immunity. J Virol 79:17 27. 5. Liu, Y. J. 2005. IPC: professional type 1 interferon producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol 23:275 306. 6. Brigl, M., and M. B. Brenner. 2004. CD1: antigen presentation and T cell function. Annu Rev Immunol 22:817 890. 7. Tkachenko, N., K. Wojas, J. Tabarkiewicz, and J. Rolinski. 2005. Generation of dendritic cells from human peripheral blood monocytes -comparison of different culture media. Folia histochemica et cytobiologica / Polish Academy of Scie nces, Polish Histochemical and Cytochemical Society 43:25 30. 8. Relloso, M., A. Puig Kroger, O. M. Pello, J. L. Rodriguez Fernandez, G. de la Rosa, N. Longo, J. Navarro, M. A. Munoz Fernandez, P. Sanchez Mateos, and A. L. Corbi. 2002. DC SIGN (CD209) expr ession is IL 4 dependent and is negatively regulated by IFN, TGF beta, and anti inflammatory agents. J Immunol 168:2634 2643. 9. Geijtenbeek, T. B., R. Torensma, S. J. van Vliet, G. C. van Duijnhoven, G. J. Adema, Y. van Kooyk, and C. G. Figdor. 2000. Iden tification of DC SIGN, a novel dendritic cell specific ICAM 3 receptor that supports primary immune responses. Cell 100:575 585. 10. Steinman, R. M. 2000. DC SIGN: a guide to some mysteries of dendritic cells. Cell 100:491 494. 11. Guermonprez, P., J. Vall adeau, L. Zitvogel, C. Thery, and S. Amigorena. 2002. Antigen presentation and T cell stimulation by dendritic cells. Annu Rev Immunol 20:621 667. 12. Steinman, R. M. 2003. Some interfaces of dendritic cell biology. Apmis 111:675 697.

PAGE 139

139 13. Banchereau, J., F Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu Rev Immunol 18:767 811. 14. Lutz, M. B., and G. Schuler. 2002. Immature, semi mature and fully mature dendritic cells: which s ignals induce tolerance or immunity? Trends Immunol 23:445 449. 15. Dhodapkar, M. V., R. M. Steinman, J. Krasovsky, C. Munz, and N. Bhardwaj. 2001. Antigen specific inhibition of effector T cell function in humans after injection of immature dendritic cell s. J Exp Med 193:233 238. 16. Dhodapkar, M. V., K. M. Dhodapkar, and A. K. Palucka. 2007. Interactions of tumor cells with dendritic cells: balancing immunity and tolerance. Cell Death Differ 15:39 50. 17. Hall, H. T., J. Petrovic, and P. Hoglund. 2004. Re duced antigen concentration and costimulatory blockade increase IFN gamma secretion in naive CD8+ T cells. Eur J Immunol 34:3091 3101. 18. Brown, J. A., D. M. Dorfman, F. R. Ma, E. L. Sullivan, O. Munoz, C. R. Wood, E. A. Greenfield, and G. J. Freeman. 200 3. Blockade of programmed death 1 ligands on dendritic cells enhances T cell activation and cytokine production. J Immunol 170:1257 1266. 19. Tacken, P. J., I. J. de Vries, R. Torensma, and C. G. Figdor. 2007. Dendritic cell immunotherapy: from ex vivo loa ding to in vivo targeting. Nat Rev Immunol 7:790 802. 20. Ribas, A. 2005. Genetically modified dendritic cells for cancer immunotherapy. Curr Gene Ther 5:619 628. 21. O'Neill, D. W., S. Adams, and N. Bhardwaj. 2004. Manipulating dendritic cell biology for the active immunotherapy of cancer. Blood 104:2235 2246. 22. Banchereau, J., and A. K. Palucka. 2005. Dendritic cells as therapeutic vaccines against cancer. Nat Rev Immunol 5:296 306. 23. Osada, T., T. M. Clay, C. Y. Woo, M. A. Morse, and H. K. Lyerly. 20 06. Dendritic cell based immunotherapy. Int Rev Immunol 25:377 413. 24. Nencioni, A., F. Grunebach, S. M. Schmidt, M. R. Muller, D. Boy, F. Patrone, A. Ballestrero, and P. Brossart. 2008. The use of dendritic cells in cancer immunotherapy. Crit Rev Oncol H ematol 65:191 199. 25. Palucka, A. K., H. Ueno, J. W. Fay, and J. Banchereau. 2007. Taming cancer by inducing immunity via dendritic cells. Immunol Rev 220:129 150.

PAGE 140

140 26. Figdor, C. G., I. J. de Vries, W. J. Lesterhuis, and C. J. Melief. 2004. Dendritic cell immunotherapy: mapping the way. Nat Med 10:475 480. 27. Kawakami, Y., T. Fujita, C. Kudo, T. Sakurai, M. Udagawa, T. Yaguchi, G. Hasegawa, E. Hayashi, Y. Ueda, T. Iwata, Q. Wang, S. Okada, N. Tsukamoto, Y. Matsuzaki, and H. Sumimoto. 2008. Dendritic cell based personalized immunotherapy based on cancer antigen research. Front Biosci 13:1952 1958. 28. Andrews, D. M., E. Maraskovsky, and M. J. Smyth. 2008. Cancer vaccines for established cancer: how to make them better? Immunol Rev 222:242 255. 29. Sallusto, F., and A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 179 :1109 1118. 30. Zou, G. M., and Y. K. Tam. 2002. Cytokines in the generation and maturation of dendritic cells: recent advances. Eur Cytokine Netw 13:186 199. 31. Conti, L., and S. Gessani. 2008. GM CSF in the generation of dendritic cells from human blood monocyte precursors: recent advances. Immunobiology 213:859 870. 32. Elkord, E., P. E. Williams, H. Kynaston, and A. W. Rowbottom. 2005. Human monocyte isolation methods influence cytokine production from in vitro generated dendritic cells. Immunology 114 :204 212. 33. Roy, K. C., G. Bandyopadhyay, S. Rakshit, M. Ray, and S. Bandyopadhyay. 2004. IL 4 alone without the involvement of GM CSF transforms human peripheral blood monocytes to a CD1adim, CD83+ myeloid dendritic cell subset. J Cell Sci 117:3435 3445 34. Ebner, S., S. Hofer, V. A. Nguyen, C. Furhapter, M. Herold, P. Fritsch, C. Heufler, and N. Romani. 2002. A Novel Role for IL 3: Human Monocytes Cultured in the Presence of IL 3 and IL 4 Differentiate into Dendritic Cells That Produce Less IL 12 and S hift Th Cell Responses Toward a Th2 Cytokine Pattern. J Immunol 168:6199 6207. 35. Jansen, J. H., G. J. Wientjens, W. E. Fibbe, R. Willemze, and H. C. Kluin Nelemans. 1989. Inhibition of human macrophage colony formation by interleukin 4. J Exp Med 170:577 582. 36. Conti, L., M. Cardone, B. Varano, P. Puddu, F. Belardelli, and S. Gessani. 2008. Role of the cytokine environment and cytokine receptor expression on the generation of functionally distinct dendritic cells from human monocytes. Eur J Immunol 38:7 50 762.

PAGE 141

141 37. Ganguly, D., K. Paul, J. Bagchi, S. Rakshit, L. Mandal, G. Bandyopadhyay, and S. Bandyopadhyay. 2007. Granulocyte macrophage colony stimulating factor drives monocytes to CD14low CD83+ DCSIGN interleukin 10 producing myeloid cells with differe ntial effects on T cell subsets. Immunology 121:499 507. 38. Chitta, S., L. Santambrogio, and L. J. Stern. 2008. GMCSF in the absence of other cytokines sustains human dendritic cell precursors with T cell regulatory activity and capacity to differentiate into functional dendritic cells. Immunol Lett 116:41 54. 39. Rochman, Y., R. Spolski, and W. J. Leonard. 2009. New insights into the regulation of T cells by c family cytokines. Nat Rev Immunol 9:480 490. 40. Jacobs, B., M. Wuttke, C. Papewalis, J. Seissl er, and M. Schott. 2008. Dendritic cell subtypes and in vitro generation of dendritic cells. Horm Metab Res 40:99 107. 41. Dauer, M., K. Pohl, B. Obermaier, T. Meskendahl, J. Robe, M. Schnurr, S. Endres, and A. Eigler. 2003. Interferon alpha disables dendr itic cell precursors: dendritic cells derived from interferon alpha treated monocytes are defective in maturation and T cell stimulation. Immunology 110:38 47. 42. Mohamadzadeh, M., F. Berard, G. Essert, C. Chalouni, B. Pulendran, J. Davoust, G. Bridges, A K. Palucka, and J. Banchereau. 2001. Interleukin 15 skews monocyte differentiation into dendritic cells with features of Langerhans cells. J Exp Med 194:1013 1020. 43. Hardy, M. Y., A. J. Kassianos, A. Vulink, R. Wilkinson, S. L. Jongbloed, D. N. Hart, a nd K. J. Radford. 2009. NK cells enhance the induction of CTL responses by IL 15 monocyte derived dendritic cells. Immunol Cell Biol 87:606 614. 44. Saikh, K. U., A. S. Khan, T. Kissner, and R. G. Ulrich. 2001. IL 15 induced conversion of monocytes to matu re dendritic cells. Clin Exp Immunol 126:447 455. 45. Dubsky, P., H. Saito, M. Leogier, C. Dantin, J. E. Connolly, J. Banchereau, and A. K. Palucka. 2007. IL 15 induced human DC efficiently prime melanoma specific naive CD8+ T cells to differentiate into C TL. Eur J Immunol 37:1678 1690. 46. Anguille, S., E. L. Smits, N. Cools, H. Goossens, Z. N. Berneman, and V. F. Van Tendeloo. 2009. Short term cultured, interleukin 15 differentiated dendritic cells have potent immunostimulatory properties. J Transl Med 7: 109. 47. Regamey, N., C. Obregon, S. Ferrari Lacraz, C. van Leer, M. Chanson, L. P. Nicod, and T. Geiser. 2007. Airway epithelial IL 15 transforms monocytes into dendritic cells. Am J Respir Cell Mol Biol 37:75 84. 48. Bosselut, R. 2004. CD4/CD8 lineage di fferentiation in the thymus: from nuclear effectors to membrane signals. Nat Rev Immunol 4:529 540.

PAGE 142

142 49. Andersen, M. H., D. Schrama, P. Thor Straten, and J. C. Becker. 2006. Cytotoxic T cells. J Invest Dermatol 126:32 41. 50. Zhu, J., H. Yamane, and W. E. Paul. 2010. Differentiation of effector CD4 T cell populations. Annu Rev Immunol 28:445 489. 51. Ansel, K. M., D. U. Lee, and A. Rao. 2003. An epigenetic view of helper T cell differentiation. Nat Immunol 4:616 623. 52. Sallusto, F., J. Geginat, and A. Lan zavecchia. 2004. Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu Rev Immunol 22:745 763. 53. Okada, R., T. Kondo, F. Matsuki, H. Takata, and M. Takiguchi. 2008. Phenotypic classification of human CD4+ T cell s ubsets and their differentiation. Int Immunol 20:1189 1199. 54. Williams, M. A., and M. J. Bevan. 2007. Effector and memory CTL differentiation. Annu Rev Immunol 25:171 192. 55. Curtsinger, J. M., D. C. Lins, and M. F. Mescher. 2003. Signal 3 determines to lerance versus full activation of naive CD8 T cells: dissociating proliferation and development of effector function. J Exp Med 197:1141 1151. 56. Mescher, M. F., J. M. Curtsinger, P. Agarwal, K. A. Casey, M. Gerner, C. D. Hammerbeck, F. Popescu, and Z. Xi ao. 2006. Signals required for programming effector and memory development by CD8+ T cells. Immunol Rev 211:81 92. 57. Langenkamp, A., M. Messi, A. Lanzavecchia, and F. Sallusto. 2000. Kinetics of dendritic cell activation: impact on priming of TH1, TH2 an d nonpolarized T cells. Nat Immunol 1:311 316. 58. Cooper, M. A., T. A. Fehniger, and M. A. Caligiuri. 2001. The biology of human natural killer cell subsets. Trends Immunol 22:633 640. 59. Farag, S. S., and M. A. Caligiuri. 2006. Human natural killer cell development and biology. Blood Rev 20:123 137. 60. Smyth, M. J., E. Cretney, J. M. Kelly, J. A. Westwood, S. E. Street, H. Yagita, K. Takeda, S. L. van Dommelen, M. A. Degli Esposti, and Y. Hayakawa. 2005. Activation of NK cell cytotoxicity. Mol Immunol 4 2:501 510. 61. Vitale, M., M. Della Chiesa, S. Carlomagno, C. Romagnani, A. Thiel, L. Moretta, and A. Moretta. 2004. The small subset of CD56brightCD16 natural killer cells is selectively responsible for both cell proliferation and interferon gamma produc tion upon interaction with dendritic cells. Eur J Immunol 34:1715 1722.

PAGE 143

143 62. Fehniger, T. A., W. E. Carson, and M. A. Caligiuri. 1999. Costimulation of human natural killer cells is required for interferon gamma production. Transplantation proceedings 31:14 76 1478. 63. Caligiuri, M. A. 2008. Human natural killer cells. Blood 112:461 469. 64. Karimi, K., J. E. Boudreau, K. Fraser, H. Liu, J. Delanghe, J. Gauldie, Z. Xing, J. L. Bramson, and Y. Wan. 2008. Enhanced antitumor immunity elicited by dendritic cell vaccines is a result of their ability to engage both CTL and IFN gamma producing NK cells. Mol Ther 16:411 418. 65. Amakata, Y., Y. Fujiyama, A. Andoh, K. Hodohara, and T. Bamba. 2001. Mechanism of NK cell activation induced by coculture with dendritic cel ls derived from peripheral blood monocytes. Clin Exp Immunol 124:214 222. 66. Osada, T., H. Nagawa, J. Kitayama, N. H. Tsuno, S. Ishihara, M. Takamizawa, and Y. Shibata. 2001. Peripheral blood dendritic cells, but not monocyte derived dendritic cells, can augment human NK cell function. Cell Immunol 213:14 23. 67. Cooper, M. A., T. A. Fehniger, A. Fuchs, M. Colonna, and M. A. Caligiuri. 2004. NK cell and DC interactions. Trends Immunol 25:47 52. 68. Ranson, T., C. A. J. Vosshenrich, E. Corcuff, O. Richard, W. Muller, and J. P. Di Santo. 2003. IL 15 is an essential mediator of peripheral NK cell homeostasis. Blood 101:4887 4893. 69. Zhang, C., J. Zhang, J. Niu, J. Zhang, and Z. Tian. 2008. Interleukin 15 improves cytotoxicity of natural killer cells via up re gulating NKG2D and cytotoxic effector molecule expression as well as STAT1 and ERK1/2 phosphorylation. Cytokine 42:128 136. 70. Zheng, X., Y. Wang, H. Wei, B. Ling, R. Sun, and Z. Tian. 2008. Bcl xL is associated with the anti apoptotic effect of IL 15 on the survival of CD56(dim) natural killer cells. Mol Immunol 45:2559 2569. 71. Brilot, F., T. Strowig, S. M. Roberts, F. Arrey, and C. Munz. 2007. NK cell survival mediated through the regulatory synapse with human DCs requires IL 15Ralpha. J Clin Invest 11 7:3316 3329. 72. Huntington, N. D., N. Legrand, N. L. Alves, B. Jaron, K. Weijer, A. Plet, E. Corcuff, E. Mortier, Y. Jacques, H. Spits, and J. P. Di Santo. 2009. IL 15 trans presentation promotes human NK cell development and differentiation in vivo. J Ex p Med 206:25 34. 73. Burkett, P. R., R. Koka, M. Chien, S. Chai, D. L. Boone, and A. Ma. 2004. Coordinate expression and trans presentation of interleukin (IL) 15Ralpha and IL 15 supports natural killer cell and memory CD8+ T cell homeostasis. J Exp Med 20 0:825 834.

PAGE 144

144 74. Castillo, E. F., S. W. Stonier, L. Frasca, and K. S. Schluns. 2009. Dendritic cells support the in vivo development and maintenance of NK cells via IL 15 trans presentation. J Immunol 183:4948 4956. 75. Mortier, E., T. Woo, R. Advincula, S. Gozalo, and A. Ma. 2008. IL 15Ralpha chaperones IL 15 to stable dendritic cell membrane complexes that activate NK cells via trans presentation. J Exp Med 205:1213 1225. 76. Lucas, M., W. Schachterle, K. Oberle, P. Aichele, and A. Diefenbach. 2007. Dendrit ic cells prime natural killer cells by trans presenting interleukin 15. Immunity 26:503 517. 77. Ferlazzo, G., M. L. Tsang, L. Moretta, G. Melioli, R. M. Steinman, and C. Munz. 2002. Human dendritic cells activate resting natural killer (NK) cells and are recognized via the NKp30 receptor by activated NK cells. J Exp Med 195:343 351. 78. Dubois, S., J. Mariner, T. A. Waldmann, and Y. Tagaya. 2002. IL 15Ralpha recycles and presents IL 15 In trans to neighboring cells. Immunity 17:537 547. 79. Sandau, M. M., K. S. Schluns, L. Lefrancois, and S. C. Jameson. 2004. Cutting edge: transpresentation of IL 15 by bone marrow derived cells necessitates expression of IL 15 and IL 15R alpha by the same cells. J Immunol 173:6537 6541. 80. Moretta, L., G. Ferlazzo, C. Bott ino, M. Vitale, D. Pende, M. C. Mingari, and A. Moretta. 2006. Effector and regulatory events during natural killer dendritic cell interactions. Immunol Rev 214:219 228. 81. Walzer, T., M. Dalod, S. H. Robbins, L. Zitvogel, and E. Vivier. 2005. Natural kil ler cells and dendritic cells: "l'union fait la force". Blood 106:2252 2258. 82. Gerosa, F., B. Baldani Guerra, C. Nisii, V. Marchesini, G. Carra, and G. Trinchieri. 2002. Reciprocal activating interaction between natural killer cells and dendritic cells. J Exp Med 195:327 333. 83. Kalinski, P., A. Giermasz, Y. Nakamura, P. Basse, W. J. Storkus, J. M. Kirkwood, and R. B. Mailliard. 2005. Helper role of NK cells during the induction of anticancer responses by dendritic cells. Mol Immunol 42:535 539. 84. Zhan g, A. L., P. Colmenero, U. Purath, C. Teixeira de Matos, W. Hueber, L. Klareskog, I. H. Tarner, E. G. Engleman, and K. Soderstrom. 2007. Natural killer cells trigger differentiation of monocytes into dendritic cells. Blood 110:2484 2493. 85. Zitvogel, L. 2 002. Dendritic and natural killer cells cooperate in the control/switch of innate immunity. J Exp Med 195:F9 14.

PAGE 145

145 86. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, and W. E. Paul. 1999. The IL 4 receptor: signaling mechanisms and biologic functions. Ann u Rev Immunol 17:701 738. 87. Jiang, H., M. B. Harris, and P. Rothman. 2000. IL 4/IL 13 signaling beyond JAK/STAT. J Allergy Clin Immunol 105:1063 1070. 88. Akdis, M., S. Burgler, R. Crameri, T. Eiwegger, H. Fujita, E. Gomez, S. Klunker, N. Meyer, L. O'Mah ony, O. Palomares, C. Rhyner, N. Ouaked, A. Schaffartzik, W. Van De Veen, S. Zeller, M. Zimmermann, and C. A. Akdis. 2011. Interleukins, from 1 to 37, and interferon gamma: receptors, functions, and roles in diseases. J Allergy Clin Immunol 127:701 721 e70 1 770. 89. Sriram, U., C. Biswas, E. M. Behrens, J. A. Dinnall, D. K. Shivers, M. Monestier, Y. Argon, and S. Gallucci. 2007. IL 4 suppresses dendritic cell response to type I interferons. J Immunol 179:6446 6455. 90. Maroof, A., M. Penny, R. Kingston, C. Murray, S. Islam, P. A. Bedford, and S. C. Knight. 2006. Interleukin 4 can induce interleukin 4 production in dendritic cells. Immunology 117:271 279. 91. Lutz, M. B., M. Schnare, M. Menges, S. Rossner, M. Rollinghoff, G. Schuler, and A. Gessner. 2002. Dif ferential functions of IL 4 receptor types I and II for dendritic cell maturation and IL 12 production and their dependency on GM CSF. J Immunol 169:3574 3580. 92. Chapuis, F., M. Rosenzwajg, M. Yagello, M. Ekman, P. Biberfeld, and J. C. Gluckman. 1997. Di fferentiation of human dendritic cells from monocytes in vitro. Eur J Immunol 27:431 441. 93. Wang, X., P. Lupardus, S. L. Laporte, and K. C. Garcia. 2009. Structural biology of shared cytokine receptors. Annu Rev Immunol 27:29 60. 94. Chomarat, P., and J. Banchereau. 1997. An update on interleukin 4 and its receptor. Eur Cytokine Netw 8:333 344. 95. Waldmann, T. A., and Y. Tagaya. 1999. The multifaceted regulation of interleukin 15 expression and the role of this cytokine in NK cell differentiation and hos t response to intracellular pathogens. Annu Rev Immunol 17:19 49. 96. Berard, M., K. Brandt, S. B. Paus, and D. F. Tough. 2003. IL 15 Promotes the Survival of Naive and Memory Phenotype CD8+ T Cells. J Immunol 170:5018 5026. 97. Stonier, S. W., L. J. Ma, E F. Castillo, and K. S. Schluns. 2008. Dendritic cells drive memory CD8 T cell homeostasis via IL 15 transpresentation. Blood 112:4546 4554.

PAGE 146

146 98. Budagian, V., E. Bulanova, R. Paus, and S. Bulfone Paus. 2006. IL 15/IL 15 receptor biology: a guided tour thr ough an expanding universe. Cytokine Growth Factor Rev 17:259 280. 99. Fehniger, T. A., and M. A. Caligiuri. 2001. Interleukin 15: biology and relevance to human disease. Blood 97:14 32. 100. Tagaya, Y., R. N. Bamford, A. P. DeFilippis, and T. A. Waldmann. 1996. IL 15: a pleiotropic cytokine with diverse receptor/signaling pathways whose expression is controlled at multiple levels. Immunity 4:329 336. 101. Anderson, D. M., S. Kumaki, M. Ahdieh, J. Bertles, M. Tometsko, A. Loomis, J. Giri, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, and et al. 1995. Functional characterization of the human interleukin 15 receptor alpha chain and close linkage of IL15RA and IL2RA genes. J Biol Chem 270:29862 29869. 102. Bamford, R. N., A. P. DeFilippis, N. Azimi, G. Kurys, a nd T. A. Waldmann. 1998. The 5' untranslated region, signal peptide, and the coding sequence of the carboxyl terminus of IL 15 participate in its multifaceted translational control. J Immunol 160:4418 4426. 103. Onu, A., T. Pohl, H. Krause, and S. Bulfone Paus. 1997. Regulation of IL 15 secretion via the leader peptide of two IL 15 isoforms. J Immunol 158:255 262. 104. Duitman, E. H., Z. Orinska, E. Bulanova, R. Paus, and S. Bulfone Paus. 2008. How a cytokine is chaperoned through the secretory pathway by c omplexing with its own receptor: lessons from interleukin 15 (IL 15)/IL 15 receptor alpha. Mol Cell Biol 28:4851 4861. 105. Neely, G. G., S. M. Robbins, E. K. Amankwah, S. Epelman, H. Wong, J. C. Spurrell, K. K. Jandu, W. Zhu, D. K. Fogg, C. B. Brown, and C. H. Mody. 2001. Lipopolysaccharide stimulated or granulocyte macrophage colony stimulating factor stimulated monocytes rapidly express biologically active IL 15 on their cell surface independent of new protein synthesis. J Immunol 167:5011 5017. 106. Wu, Z., H. H. Xue, J. Bernard, R. Zeng, D. Issakov, J. Bollenbacher Reilley, I. M. Belyakov, S. Oh, J. A. Berzofsky, and W. J. Leonard. 2008. The IL 15 receptor {alpha} chain cytoplasmic domain is critical for normal IL 15Ralpha function but is not required f or trans presentation. Blood 112:4411 4419. 107. Budagian, V., E. Bulanova, Z. Orinska, T. Pohl, E. C. Borden, R. Silverman, and S. Bulfone Paus. 2004. Reverse signaling through membrane bound interleukin 15. J Biol Chem 279:42192 42201. 108. Musso, T., L. Calosso, M. Zucca, M. Millesimo, D. Ravarino, M. Giovarelli, F. Malavasi, A. N. Ponzi, R. Paus, and S. Bulfone Paus. 1999. Human monocytes constitutively express membrane bound, biologically active, and interferon gamma upregulated interleukin 15. Blood 9 3:3531 3539.

PAGE 147

147 109. Neely, G. G., S. Epelman, L. L. Ma, P. Colarusso, C. J. Howlett, E. K. Amankwah, A. C. McIntyre, S. M. Robbins, and C. H. Mody. 2004. Monocyte surface bound IL 15 can function as an activating receptor and participate in reverse signaling J Immunol 172:4225 4234. 110. Khawam, K., J. Giron Michel, Y. Gu, A. Perier, M. Giuliani, A. Caignard, A. Devocelle, S. Ferrini, M. Fabbi, B. Charpentier, A. Ludwig, S. Chouaib, B. Azzarone, and P. Eid. 2009. Human renal cancer cells express a novel memb rane bound interleukin 15 that induces, in response to the soluble interleukin 15 receptor alpha chain, epithelial to mesenchymal transition. Cancer Res 69:1561 1569. 111. Lin, J. X., and W. J. Leonard. 2000. The role of Stat5a and Stat5b in signaling by I L 2 family cytokines. Oncogene 19:2566 2576. 112. Leonard, W. J., and J. J. O'Shea. 1998. Jaks and STATs: biological implications. Annu Rev Immunol 16:293 322. 113. Darnell, J. E., Jr. 1997. STATs and Gene Regulation. Science 277:1630 1635. 114. Levy, D. E ., and J. E. Darnell, Jr. 2002. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3:651 662. 115. Chen, W., M. O. Daines, and G. K. Khurana Hershey. 2004. Turning off signal transducer and activator of transcription (STAT): the ne gative regulation of STAT signaling. J Allergy Clin Immunol 114:476 489; quiz 490. 116. Shuai, K., and B. Liu. 2003. Regulation of JAK STAT signalling in the immune system. Nat Rev Immunol 3:900 911. 117. Wurster, A. L., T. Tanaka, and M. J. Grusby. 2000. The biology of Stat4 and Stat6. Oncogene 19:2577 2584. 118. Hebenstreit, D., G. Wirnsberger, J. Horejs Hoeck, and A. Duschl. 2006. Signaling mechanisms, interaction partners, and target genes of STAT6. Cytokine Growth Factor Rev 17:173 188. 119. Andrews, R P., M. B. Ericksen, C. M. Cunningham, M. O. Daines, and G. K. Hershey. 2002. Analysis of the life cycle of stat6. Continuous cycling of STAT6 is required for IL 4 signaling. J Biol Chem 277:36563 36569. 120. Yu, H., D. Pardoll, and R. Jove. 2009. STATs i n cancer inflammation and immunity: a leading role for STAT3. Nat Rev Cancer 9:798 809. 121. Kurata, H., H. J. Lee, A. O'Garra, and N. Arai. 1999. Ectopic expression of activated Stat6 induces the expression of Th2 specific cytokines and transcription fact ors in developing Th1 cells. Immunity 11:677 688.

PAGE 148

148 122. Ward, A. C., I. Touw, and A. Yoshimura. 2000. The Jak Stat pathway in normal and perturbed hematopoiesis. Blood 95:19 29. 123. Grimley, P. M., F. Dong, and H. Rui. 1999. Stat5a and Stat5b: fraternal tw ins of signal transduction and transcriptional activation. Cytokine Growth Factor Rev 10:131 157. 124. Paukku, K., and O. Silvennoinen. 2004. STATs as critical mediators of signal transduction and transcription: lessons learned from STAT5. Cytokine Growth Factor Rev 15:435 455. 125. Stephens, J. M., R. F. Morrison, Z. Wu, and S. R. Farmer. 1999. PPARgamma ligand dependent induction of STAT1, STAT5A, and STAT5B during adipogenesis. Biochem Biophys Res Commun 262:216 222. 126. Hennighausen, L., and G. W. Robi nson. 2008. Interpretation of cytokine signaling through the transcription factors STAT5A and STAT5B. Genes Dev 22:711 721. 127. Teglund, S., C. McKay, E. Schuetz, J. M. van Deursen, D. Stravopodis, D. Wang, M. Brown, S. Bodner, G. Grosveld, and J. N. Ihle 1998. Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93:841 850. 128. Imada, K., E. T. Bloom, H. Nakajima, J. A. Horvath Arcidiacono, G. B. Udy, H. W. Davey, and W. J. Leonard. 1998. Stat5b is essential for natural killer cell mediated proliferation and cytolytic activity. J Exp Med 188:2067 2074. 129. Esashi, E., Y. H. Wang, O. Perng, X. F. Qin, Y. J. Liu, and S. S. Watowich. 2008. The signal transducer STAT5 inhibits plasmacytoid dendritic cel l development by suppressing transcription factor IRF8. Immunity 28:509 520. 130. Basham, B., M. Sathe, J. Grein, T. McClanahan, A. D'Andrea, E. Lees, and A. Rascle. 2008. In vivo identification of novel STAT5 target genes. Nucleic Acids Res 36:3802 3818. 131. Groner, B., P. Lucks, and C. Borghouts. 2008. The function of Stat3 in tumor cells and their microenvironment. Semin Cell Dev Biol 19:341 350. 132. Stepkowski, S. M., W. Chen, J. A. Ross, Z. S. Nagy, and R. A. Kirken. 2008. STAT3: an important regulat or of multiple cytokine functions. Transplantation 85:1372 1377. 133. Kamimura, D., K. Ishihara, and T. Hirano. 2003. IL 6 signal transduction and its physiological roles: the signal orchestration model. Rev Physiol Biochem Pharmacol 149:1 38. 134. Decker, T., and P. Kovarik. 2000. Serine phosphorylation of STATs. Oncogene 19:2628 2637.

PAGE 149

149 135. Yu, H., M. Kortylewski, and D. Pardoll. 2007. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol 7:41 51. 136. Cof fer, P. J., L. Koenderman, and R. P. de Groot. 2000. The role of STATs in myeloid differentiation and leukemia. Oncogene 19:2511 2522. 137. Wang, T., G. Niu, M. Kortylewski, L. Burdelya, K. Shain, S. Zhang, R. Bhattacharya, D. Gabrilovich, R. Heller, D. Co ppola, W. Dalton, R. Jove, D. Pardoll, and H. Yu. 2004. Regulation of the innate and adaptive immune responses by Stat 3 signaling in tumor cells. Nat Med 10:48 54. 138. Nefedova, Y., P. Cheng, D. Gilkes, M. Blaskovich, A. A. Beg, S. M. Sebti, and D. I. Ga brilovich. 2005. Activation of Dendritic Cells via Inhibition of Jak2/STAT3 Signaling. J Immunol 175:4338 4346. 139. Melillo, J. A., L. Song, G. Bhagat, A. B. Blazquez, C. R. Plumlee, C. Lee, C. Berin, B. Reizis, and C. Schindler. 2010. Dendritic cell (DC) specific targeting reveals Stat3 as a negative regulator of DC function. J Immunol 184:2638 2645. 140. Geest, C. R., and P. J. Coffer. 2009. MAPK signaling pathways in the regulation of hematopoiesis. J Leukoc Biol 86:237 250. 141. Dong, C., R. J. Davis, and R. A. Flavell. 2002. MAP kinases in the immune response. Annu Rev Immunol 20:55 72. 142. Raman, M., W. Chen, and M. H. Cobb. 2007. Differential regulation and properties of MAPKs. Oncogene 26:3100 3112. 143. Roux, P. P., and J. Blenis. 2004. ERK and p3 8 MAPK activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68:320 344. 144. Platanias, L. C. 2003. Map kinase signaling pathways and hematologic malignancies. Blood 101:4667 4679. 145. Zarubin, T ., and J. Han. 2005. Activation and signaling of the p38 MAP kinase pathway. Cell Res 15:11 18. 146. Hunt, A. E., L. M. Williams, F. V. Lali, and B. M. J. Foxwell. 2002. IL 4 regulation of p38 MAPK signaling is dependent on cell type. Cytokine 18:295 303. 147. Wery Zennaro, S., J. L. Zugaza, M. Letourneur, J. Bertoglio, and J. Pierre. 2000. IL 4 regulation of IL 6 production involves Rac/Cdc42 and p38 MAPK dependent pathways in keratinocytes. Oncogene 19:1596 1604.

PAGE 150

150 148. Lendemans, S., M. Rani, C. Selbach, E. Kreuzfelder, F. U. Schade, and S. Flohe. 2006. GM CSF priming of human monocytes is dependent on ERK1/2 activation. J Endotoxin Res 12:10 20. 149. Sato, N., K. Sakamaki, N. Terada, K. Arai, and A. Miyajima. 1993. Signal transduction by the high affinity GM CSF receptor: two distinct cytoplasmic regions of the common beta subunit responsible for different signaling. Embo J 12:4181 4189. 150. Ardeshna, K. M., A. R. Pizzey, S. Devereux, and A. Khwaja. 2000. The PI3 kinase, p38 SAP kinase, and NF kappaB sign al transduction pathways are involved in the survival and maturation of lipopolysaccharide stimulated human monocyte derived dendritic cells. Blood 96:1039 1046. 151. Yao, Y., Q. Xu, M. J. Kwon, R. Matta, Y. Liu, S. C. Hong, and C. H. Chang. 2006. ERK and p38 MAPK signaling pathways negatively regulate CIITA gene expression in dendritic cells and macrophages. J Immunol 177:70 76. 152. Voong, L. N., A. R. Slater, S. Kratovac, and D. E. Cressman. 2008. Mitogen activated protein kinase ERK1/2 regulates the cla ss II transactivator. J Biol Chem 283:9031 9039. 153. Guha, M., M. A. O'Connell, R. Pawlinski, A. Hollis, P. McGovern, S. F. Yan, D. Stern, and N. Mackman. 2001. Lipopolysaccharide activation of the MEK ERK1/2 pathway in human monocytic cells mediates tiss ue factor and tumor necrosis factor expression by inducing Elk 1 phosphorylation and Egr 1 expression. Blood 98:1429 1439. 154. Yoon, S., and R. Seger. 2006. The extracellular signal regulated kinase: multiple substrates regulate diverse cellular functio ns. Growth Factors 24:21 44. 155. Puig Kroger, A., M. Relloso, O. Fernandez Capetillo, A. Zubiaga, A. Silva, C. Bernabeu, and A. L. Corbi. 2001. Extracellular signal regulated protein kinase signaling pathway negatively regulates the phenotypic and functio nal maturation of monocyte derived human dendritic cells. Blood 98:2175 2182. 156. Matsuguchi, T., Y. Zhao, M. B. Lilly, and A. S. Kraft. 1997. The cytoplasmic domain of granulocyte macrophage colony stimulating factor (GM CSF) receptor alpha subunit is es sential for both GM CSF mediated growth and differentiation. J Biol Chem 272:17450 17459. 157. Chang, F., L. S. Steelman, J. T. Lee, J. G. Shelton, P. M. Navolanic, W. L. Blalock, R. A. Franklin, and J. A. McCubrey. 2003. Signal transduction mediated by th e Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia 17:1263 1293. 158. Ono, K., and J. Han. 2000. The p38 signal transduction pathway: activation and function. Cell Signal 1 2:1 13.

PAGE 151

151 159. Wagner, E. F., and A. R. Nebreda. 2009. Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer 9:537 549. 160. Zauberman, A., D. Zipori, M. Krupsky, and R. Ben Levy. 1999. Stress activated protein kinase p38 is i nvolved in IL 6 induced transcriptional activation of STAT3. Oncogene 18:3886 3893. 161. Liu, Y. J. 2001. Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell 106:259 262. 162. MacDonald, K. P., D. J. Munster, G. J Clark, A. Dzionek, J. Schmitz, and D. N. Hart. 2002. Characterization of human blood dendritic cell subsets. Blood 100:4512 4520. 163. Maldonado Lopez, R., and M. Moser. 2001. Dendritic cell subsets and the regulation of Th1/Th2 responses. Semin Immunol 13:275 282. 164. Vieira, P. L., E. C. de Jong, E. A. Wierenga, M. L. Kapsenberg, and P. Kalinski. 2000. Development of Th1 inducing capacity in myeloid dendritic cells requires environmental instruction. J Immunol 164:4507 4512. 165. Scott, K., M. Manunta, C. Germain, P. Smith, M. Jones, P. Mitchell, D. Dessi, K. Branigan Bamford, R. I. Lechler, P. L. Fiori, G. R. Foster, and G. Lombardi. 2005. Qualitatively distinct patterns of cytokines are released by human dendritic cells in response to different pathog ens. Immunology 116:245 254. 166. Forster, R., A. C. Davalos Misslitz, and A. Rot. 2008. CCR7 and its ligands: balancing immunity and tolerance. Nat Rev Immunol 8:362 371. 167. Valenzuela, J., C. Schmidt, and M. Mescher. 2002. The roles of IL 12 in providi ng a third signal for clonal expansion of naive CD8 T cells. J Immunol 169:6842 6849. 168. Curtsinger, J. M., and M. F. Mescher. 2010. Inflammatory cytokines as a third signal for T cell activation. Curr Opin Immunol 22:333 340. 169. Curtsinger, J. M., C. S. Schmidt, A. Mondino, D. C. Lins, R. M. Kedl, M. K. Jenkins, and M. F. Mescher. 1999. Inflammatory cytokines provide a third signal for activation of naive CD4+ and CD8+ T cells. J Immunol 162:3256 3262. 170. Lodolce, J., P. Burkett, R. Koka, D. Boone, M Chien, F. Chan, M. Madonia, S. Chai, and A. Ma. 2002. Interleukin 15 and the regulation of lymphoid homeostasis. Mol Immunol 39:537 544. 171. Diehl, S., and M. Rincon. 2002. The two faces of IL 6 on Th1/Th2 differentiation. Mol Immunol 39:531 536. 172. S chroder, K., P. J. Hertzog, T. Ravasi, and D. A. Hume. 2004. Interferon gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 75:163 189.

PAGE 152

152 173. Gagnon, J., S. Ramanathan, C. Leblanc, A. Cloutier, P. P. McDonald, and S. Ilangumaran. 2008. IL 6, in synergy with IL 7 or IL 15, stimulates TCR independent proliferation and functional differentiation of CD8+ T lymphocytes. J Immunol 180:7958 7968. 174. Kapsenberg, M. L. 2003. Dendritic cell control of pathogen driven T cell polarization. Nat Rev I mmunol 3:984 993. 175. Anderson, P. 2008. Post transcriptional control of cytokine production. Nat Immunol 9:353 359. 176. Young, H. A. 1996. Regulation of interferon gamma gene expression. J Interferon Cytokine Res 16:563 568. 177. Takeshita, S., J. R. Ga ge, T. Kishimoto, D. L. Vredevoe, and O. Martinez Maza. 1996. Differential regulation of IL 6 gene transcription and expression by IL 4 and IL 10 in human monocytic cell lines. J Immunol 156:2591 2598. 178. Gonzalez Alvaro, I., C. Dominguez Jimenez, A. M. Ortiz, V. Nunez Gonzalez, P. Roda Navarro, E. Fernandez Ruiz, D. Sancho, and F. Sanchez Madrid. 2006. Interleukin 15 and interferon gamma participate in the cross talk between natural killer and monocytic cells required for tumour necrosis factor productio n. Arthritis Res Ther 8:R88. 179. Rubinstein, M. P., A. N. Kadima, M. L. Salem, C. L. Nguyen, W. E. Gillanders, and D. J. Cole. 2002. Systemic administration of IL 15 augments the antigen specific primary CD8+ T cell response following vaccination with pep tide pulsed dendritic cells. J Immunol 169:4928 4935. 180. Ruckert, R., K. Brandt, E. Bulanova, F. Mirghomizadeh, R. Paus, and S. Bulfone Paus. 2003. Dendritic cell derived IL 15 controls the induction of CD8 T cell immune responses. Eur J Immunol 33:3493 3503. 181. McGill, J., N. Van Rooijen, and K. L. Legge. 2010. IL 15 trans presentation by pulmonary dendritic cells promotes effector CD8 T cell survival during influenza virus infection. J Exp Med 207:521 534. 182. Moretta, A. 2002. Natural killer cells a nd dendritic cells: rendezvous in abused tissues. Nat Rev Immunol 2:957 965. 183. Newman, K. C., and E. M. Riley. 2007. Whatever turns you on: accessory cell dependent activation of NK cells by pathogens. Nat Rev Immunol 7:279 291. 184. Kinter, A. L., E. J Godbout, J. P. McNally, I. Sereti, G. A. Roby, M. A. O'Shea, and A. S. Fauci. 2008. The common gamma chain cytokines IL 2, IL 7, IL 15, and IL 21 induce the expression of programmed death 1 and its ligands. J Immunol 181:6738 6746.

PAGE 153

153 185. Mostbock, S., S. Vidal, J. Schlom, and H. Sabzevari. 2007. Enhanced levels of costimulation lead to reduced effector/memory CD8+ T cell functionality. J Immunol 179:3524 3534. 186. Murtaza, A., V. K. Kuchroo, and G. J. Freeman. 1999. Changes in the strength of co stimulati on through the B7/CD28 pathway alter functional T cell responses to altered peptide ligands. Int Immunol 11:407 416. 187. Curtsinger, J. M., J. O. Valenzuela, P. Agarwal, D. Lins, and M. F. Mescher. 2005. Type I IFNs provide a third signal to CD8 T cells t o stimulate clonal expansion and differentiation. J Immunol 174:4465 4469. 188. Bach, E. A., M. Aguet, and R. D. Schreiber. 1997. The IFN gamma receptor: a paradigm for cytokine receptor signaling. Annu Rev Immunol 15:563 591. 189. Rohn, W., L. P. Tang, Y. Dong, and E. N. Benveniste. 1999. IL 1 beta inhibits IFN gamma induced class II MHC expression by suppressing transcription of the class II transactivator gene. J Immunol 162:886 896. 190. Ansel, K. M., D. U. Lee, and A. Rao. 2003. An epigenetic view of h elper T cell differentiation. Nat Immunol 4:616 623. 191. Jakobisiak, M., J. Golab, and W. Lasek. 2011. Interleukin 15 as a promising candidate for tumor immunotherapy. Cytokine Growth Factor Rev 22:99 108. 192. Waldmann, T. A. 2006. The biology of interle ukin 2 and interleukin 15: implications for cancer therapy and vaccine design. Nat Rev Immunol 6:595 601. 193. Bergamaschi, C., M. Rosati, R. Jalah, A. Valentin, V. Kulkarni, C. Alicea, G. M. Zhang, V. Patel, B. K. Felber, and G. N. Pavlakis. 2008. Intrace llular interaction of interleukin 15 with its receptor alpha during production leads to mutual stabilization and increased bioactivity. J Biol Chem 283:4189 4199. 194. Armstrong, G. L., A. Wasley, E. P. Simard, G. M. McQuillan, W. L. Kuhnert, and M. J. Alt er. 2006. The prevalence of hepatitis C virus infection in the United States, 1999 through 2002. Annals of internal medicine 144:705 714. 195. Stonier, S. W., and K. S. Schluns. 2009. Trans presentation: a novel mechanism regulating IL 15 delivery and resp onses. Immunol Lett 127:85 92. 196. Bulfone Paus, S., E. Bulanova, V. Budagian, and R. Paus. 2006. The interleukin 15/interleukin 15 receptor system as a model for juxtacrine and reverse signaling. Bioessays 28:362 377. 197. Hercus, T. R., D. Thomas, M. A. Guthridge, P. G. Ekert, J. King Scott, M. W. Parker, and A. F. Lopez. 2009. The granulocyte macrophage colony stimulating factor receptor: linking its structure to cell signaling and its role in disease. Blood 114:1289 1298.

PAGE 154

154 198. Deszo, E. L., D. K. Brake K. W. Kelley, and G. G. Freund. 2004. IL 4 dependent CD86 expression requires JAK/STAT6 activation and is negatively regulated by PKCdelta. Cell Signal 16:271 280. 199. Essner, R., K. Rhoades, W. H. McBride, D. L. Morton, and J. S. Economou. 1989. IL 4 d own regulates IL 1 and TNF gene expression in human monocytes. J Immunol 142:3857 3861. 200. Laouar, Y., T. Welte, X. Y. Fu, and R. A. Flavell. 2003. STAT3 is required for Flt3L dependent dendritic cell differentiation. Immunity 19:903 912. 201. Park, S. J ., T. Nakagawa, H. Kitamura, T. Atsumi, H. Kamon, S. Sawa, D. Kamimura, N. Ueda, Y. Iwakura, K. Ishihara, M. Murakami, and T. Hirano. 2004. IL 6 regulates in vivo dendritic cell differentiation through STAT3 activation. J Immunol 173:3844 3854. 202. Nakaha ra, T., Y. Moroi, H. Uchi, and M. Furue. 2006. Differential role of MAPK signaling in human dendritic cell maturation and Th1/Th2 engagement. J Dermatol Sci 42:1 11. 203. Ashwell, J. D. 2006. The many paths to p38 mitogen activated protein kinase activatio n in the immune system. Nat Rev Immunol 6:532 540. 204. Katsoulidis, E., Y. Li, H. Mears, and L. C. Platanias. 2005. The p38 mitogen activated protein kinase pathway in interferon signal transduction. J Interferon Cytokine Res 25:749 756. 205. van Helden, S. F. G., F. N. van Leeuwen, and C. G. Figdor. 2008. Human and murine model cell lines for dendritic cell biology evaluated. Immunology Letters 117:191 197. 206. Santegoets, S. J., A. J. van den Eertwegh, A. A. van de Loosdrecht, R. J. Scheper, and T. D. d e Gruijl. 2008. Human dendritic cell line models for DC differentiation and clinical DC vaccination studies. J Leukoc Biol 84:1364 1373. 207. Krutzik, P. O., and G. P. Nolan. 2003. Intracellular phospho protein staining techniques for flow cytometry: monit oring single cell signaling events. Cytometry A 55:61 70. 208. Mattei, F., G. Schiavoni, F. Belardelli, and D. F. Tough. 2001. IL 15 is expressed by dendritic cells in response to type I IFN, double stranded RNA, or lipopolysaccharide and promotes dendriti c cell activation. J Immunol 167:1179 1187. 209. Kokaji, A. I., D. L. Hockley, and K. P. Kane. 2008. IL 15 transpresentation augments CD8+ T cell activation and is required for optimal recall responses by central memory CD8+ T cells. J Immunol 180:4391 440 1.

PAGE 155

155 210. Kobayashi, H., S. Dubois, N. Sato, H. Sabzevari, Y. Sakai, T. A. Waldmann, and Y. Tagaya. 2005. Role of trans cellular IL 15 presentation in the activation of NK cell mediated killing, which leads to enhanced tumor immunosurveillance. Blood 105:721 727. 211. Horng, T., J. S. Bezbradica, and R. Medzhitov. 2007. NKG2D signaling is coupled to the interleukin 15 receptor signaling pathway. Nat Immunol 8:1345 1352. 212. Lehtonen, A., S. Matikainen, M. Miettinen, and I. Julkunen. 2002. Granulocyte macroph age colony stimulating factor (GM CSF) induced STAT5 activation and target gene expression during human monocyte/macrophage differentiation. J Leukoc Biol 71:511 519. 213. Rosen, R. L., K. D. Winestock, G. Chen, X. Liu, L. Hennighausen, and D. S. Finbloom. 1996. Granulocyte macrophage colony stimulating factor preferentially activates the 94 kD STAT5A and an 80 kD STAT5A isoform in human peripheral blood monocytes. Blood 88:1206 1214. 214. de Groot, R. P., P. J. Coffer, and L. Koenderman. 1998. Regulation o f proliferation, differentiation and survival by the IL 3/IL 5/GM CSF receptor family. Cell Signal 10:619 628. 215. Giron Michel, J., A. Caignard, M. Fogli, D. Brouty Boye, D. Briard, M. van Dijk, R. Meazza, S. Ferrini, C. Lebousse Kerdiles, D. Clay, H. Bompais, S. Chouaib, B. Peault, and B. Azzarone. 2003. Differential STAT3, STAT5, and NF kappaB activation in human hematopoietic progenitors by endogenous interleukin 15: implications in the expression of functional molecules. Blood 102:109 117. 216. Cohen, P. A., G. K. Koski, B. J. Czerniecki, K. D. Bunting, X. Y. Fu, Z. Wang, W. J. Zhang, C. S. Carter, M. Awad, C. A. Distel, H. Nagem, C. C. Paustian, T. D. Johnson, J. F. Tisdale, and S. Shu. 2008. STAT3 and STAT5 dependent pathways competitive ly regulate the pan differentiation of CD34pos cells into tumor competent dendritic cells. Blood 112:1832 1843. 217. Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya, J. R. Ortaldo, S. Gupta, Y. Q. Chen, and J. D. Giri. 1995. Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15. Proc Natl Acad Sci USA 92:8705 8709. 218. Schust, J., B. Sperl, A. Hollis, T. U. Mayer, and T. Berg. 2006. Stattic: a small molecule inhibitor of STAT3 ac tivation and dimerization. Chemistry & biology 13:1235 1242. 219. Yoshimura, A., T. Naka, and M. Kubo. 2007. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol 7:454 465.

PAGE 156

156 220. Soutto, M., F. Zhang, B. Enerson, Y. Tong, M. Boothby, an d T. M. Aune. 2002. A minimal IFN gamma promoter confers Th1 selective expression. J Immunol 169:4205 4212. 221. Zhang, S., and M. H. Kaplan. 2000. The p38 mitogen activated protein kinase is required for IL 12 induced IFN gamma expression. J Immunol 165:1 374 1380. 222. Rincon, M., H. Enslen, J. Raingeaud, M. Recht, T. Zapton, M. S. Su, L. A. Penix, R. J. Davis, and R. A. Flavell. 1998. Interferon gamma expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. Embo J 17:2817 2829. 223. Bradham, C., and D. R. McClay. 2006. p38 MAPK in development and cancer. Cell cycle 5:824 828. 224. Campbell, J., C. J. Ciesielski, A. E. Hunt, N. J. Horwood, J. T. Beech, L. A. Hayes, A. Denys, M. Feldmann, F. M. Brennan, and B. M. Foxwell. 2004. A novel mechanism for TNF alpha regulation by p38 MAPK: involvement of NF kappa B with implications for therapy in rheumatoid arthritis. J Immunol 173:6928 6937. 225. Surewicz, K., H. Aung, R. A. Kanost, L. Jones, R. Hejal, and Z. Toossi. 2004. The different ial interaction of p38 MAP kinase and tumor necrosis factor alpha in human alveolar macrophages and monocytes induced by Mycobacterium tuberculois. Cell Immunol 228:34 41. 226. Bueno, C., J. Almeida, M. C. Alguero, M. L. Sanchez, J. M. Vaquero, F. J. Laso, J. F. San Miguel, L. Escribano, and A. Orfao. 2001. Flow cytometric analysis of cytokine production by normal human peripheral blood dendritic cells and monocytes: comparative analysis of different stimuli, secretion blocking agents and incubation periods Cytometry 46:33 40. 227. Iwata Kajihara, T., H. Sumimoto, N. Kawamura, R. Ueda, T. Takahashi, H. Mizuguchi, M. Miyagishi, K. Takeda, and Y. Kawakami. 2011. Enhanced cancer immunotherapy using STAT3 depleted dendritic cells with high Th1 inducing ability and resistance to cancer cell derived inhibitory factors. J Immunol 187:27 36. 228. Schluns, K. S., and L. Lefrancois. 2003. Cytokine control of memory T cell development and survival. Nat Rev Immunol 3:269 279. 229. Rhoades, K. L., S. Cai, S. H. Golub, an d J. S. Economou. 1995. Granulocyte macrophage colony stimulating factor and interleukin 4 differentially regulate the human tumor necrosis factor alpha promoter region. Cell Immunol 161:125 131. 230. Levings, M. K., and J. W. Schrader. 1999. IL 4 inhibits the production of TNF alpha and IL 12 by STAT6 dependent and independent mechanisms. J Immunol 162:5224 5229.

PAGE 157

157 231. Standiford, T. J., R. M. Strieter, S. W. Chensue, J. Westwick, K. Kasahara, and S. L. Kunkel. 1990. IL 4 inhibits the expression of IL 8 fr om stimulated human monocytes. J Immunol 145:1435 1439. 232. Dubois, S. P., T. A. Waldmann, and J. R. Muller. 2005. Survival adjustment of mature dendritic cells by IL 15. Proc Natl Acad Sci USA 102:8662 8667. 233. Smyth, M. J., Y. Hayakawa, K. Takeda, and H. Yagita. 2002. New aspects of natural killer cell surveillance and therapy of cancer. Nat Rev Cancer 2:850 861. 234. Ljunggren, H. G., and K. J. Malmberg. 2007. Prospects for the use of NK cells in immunotherapy of human cancer. Nat Rev Immunol 7:329 33 9. 235. Degli Esposti, M. A., and M. J. Smyth. 2005. Close encounters of different kinds: Dendritic cells and NK cells take centre stage. Nat Rev Immunol 5:112 124. 236. Keller, E. T., J. Wanagat, and W. B. Ershler. 1996. Molecular and cellular biology of interleukin 6 and its receptor. Front Biosci 1:d340 357. 237. Dhodapkar, M. V., K. M. Dhodapkar, and A. K. Palucka. 2008. Interactions of tumor cells with dendritic cells: balancing immunity and tolerance. Cell Death Differ 15:39 50. 238. Kim, J. E., and F M. White. 2006. Quantitative analysis of phosphotyrosine signaling networks triggered by CD3 and CD28 costimulation in Jurkat cells. J Immunol 176:2833 2843. 239. Haas, A., G. Weckbecker, and K. Welzenbach. 2008. Intracellular Phospho Flow cytometry reve als novel insights into TCR proximal signaling events. A comparison with Western blot. Cytometry A 73:799 807. 240. Lanzavecchia, A., and F. Sallusto. 2000. Dynamics of T lymphocyte responses: intermediates, effectors, and memory cells. Science 290:92 97.

PAGE 158

158 BIOGRAPHICAL SKETCH Starlyn Leinani Mitsuko Okada was born in 1982 in Honolulu, Hawaii. She lived in Kaneohe, Hawaii until graduation from James B. Castle High S chool in 2000. That year s he moved to Seattle, Washington to attend the University of Washin gton (UW) as a member of the UW Honors Program. She became an undergraduate lab assistant for Dr. Fred Farin in 2001. Based on Gates Research Scholarship in 2002. In 2003, Star lyn worked a s summer research student at the Max Plank Institute of Molecular Cell Biology and Genetics in Dresden, German y with Dr. David Drechsel. After returning to Seattle, s he completed her honors thesis on the foamy virus Gag protein with Dr. Maxine Linial as an UW Early Identification Program Presidential scholar at the Fred Hutchinson Cancer Research Center. She graduated in 2005 with a Bachelor of Science with College Honors in microbiology and a Bachelor of Arts in Japanese language. She was admit ted into the Interdisciplinary Program in Biomedical Sciences at the University of Florida (UF) for a D octor of Philosophy in 2005 with a UF Alumni Graduate Fellowship. After the first semester, she too k a leave of absence to complete research at Keio Univ ersity School of Medicine in Tokyo, Japan with Dr. Yutaka Kawakami from 2006 to 2007 as a Japanese government ( Monbuk agakusho) sponsored r esearc h scholar. She returned to UF in 2007 and joined Dr. Lung monocyte derived IL 15 i nduced DCs in the Immunology and Microbiology concentration Florida in the summer of 2012