The Survival and Longevity of Raffaelea Lauricola and the Redbay Ambrosia Beetle (Xyleborus Glabratus) in Chipped and In...

MISSING IMAGE

Material Information

Title:
The Survival and Longevity of Raffaelea Lauricola and the Redbay Ambrosia Beetle (Xyleborus Glabratus) in Chipped and Intact Wood
Physical Description:
1 online resource (134 p.)
Language:
english
Creator:
Spence, Donald John
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
Smith, Jason A.
Committee Members:
Ploetz, Randy C
Stelinski, Lukasz L.
Hulcr, Jiri
Mayfield, Albert

Subjects

Subjects / Keywords:
ambrosia -- avocado -- beetle -- borbonia -- chipping -- exotic -- florida -- forest -- fungicide -- glabratus -- lauraceae -- laurel -- lauricola -- ophiostomaceae -- pathogen -- persea -- pest -- phytosanitary -- propiconazole -- raffaelea -- redbay -- scolytidae -- tree -- wilt -- xyleborus
Plant Pathology -- Dissertations, Academic -- UF
Genre:
Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Laurel wilt is a relatively new tree disease in the southeastern U.S. that kills members of the Lauraceae plant family. This irreversible disease is caused by the exotic fungus Raffaelea lauricola and the exotic redbay ambrosia beetle, Xyleborus glabratus, which serves as a vector for the pathogen. R. lauricola colonizes the sapwood and can move into all portions of the tree. The presence of the fungus inside the tree causes it to wilt and die, within a week during the summer. To date, the disease has killed millions of trees in this family and currently occurs from North Carolina, west to Mississippi and to south Florida. This study was designed to examine 1) the survival of the beetle and fungus in chipped redbay (Persea borbonia) trees that were killed by laurel wilt, 2) identify how long the fungal pathogen can persist in standing dead trees, 3) determine the thermal limit of the fungal pathogen, and 4) potential endophytic fungal competitors in redbay trees. Finally, we explored the effectiveness of protecting redbay trees with fungicide injections before they are attacked by the redbay ambrosia beetle. We monitored the survival of X. glabratus and R. lauricola in wood chips that were generated using a standard commercial-grade chipper over seven months. After two weeks, fourteen X. glabratus were found in the 11 wood chips while 339 X. glabratus emerged from non-chipped bolts under netting durring the same period. From the wood chips, R. lauricola was only recovered after two days post chipping indicating that the pathogen is not likely to survive outside its beetle host or be moved from wood chips to other species. R. lauricola persisted in dead, standing trees for fourteen months and its optimum growth temperature was 28° C. Although this temperature is below the phytosanitary guidelines for treating wood pallets, it is above daily temperature that the fungus would be exposed to indicating that the pathogen will easily persist in temperate and subtropical areas. Finally, pre-treating trees with propiconazole protected over 70% of the study trees.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Donald John Spence.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Smith, Jason A.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044537:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 THE SURVIVAL AND LONGEVITY OF Raffaelea lauricola AND THE REDBAY AMBROSIA BEETLE ( Xyleborus glabratus ) IN CHIPPED AND INTACT WOOD By DONALD JOHN SPENCE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Donald John Spence

PAGE 3

3 To my family, thank you for all of your love and support For life: It's a dangerous business going out o f your door, Frodo. You step into the r oad, and if you don't keep your feet, there is no telling wh ere you might be swept off to. J. R. R. Tolkien The Lord of the Rings, The Fellowship of the Ring For Science : One never notices what has been done; one can on ly see what remains to be done. Marie Curie For Knowledge : If I have one apple and you have one apple and we trade, we each have one apple. If you have an idea and I have an idea, and we trade, we now each have two ideas. Ge orge Bernard Shaw

PAGE 4

4 ACKNOWLEDGMENTS A research project of this size can only be accomplished with the assistance of many people. First and foremost, I would like to thank Jason Smith for taking me on as his graduate student and for his support and guidance. In addition, thank you to my graduate committee Jiri Hulcr, Bud Mayfield, Randy Ploetz and Lukasz Stelinski for your guidance during the development and imp lementation of these studies. With great appreciation, I would like to thank the UF Forest Pathology Laboratory members an d the other research assistants who hel ped me carry out this project Thank You for all your hard work. My field assistants were: Fred Beckman Alina Campbell Jon Col burn Cody Dreaden Tyler Dreaden Marc Hughes Keumchul S hin Claudia Paez Candace Palmer, Siddh Pitroda Brenda Nava Kathy S l ifer Aaron Trulock and Nat Spence. For access to Austin Cary Memorial Forest I must extend my thanks to Michael A ndreu Dan S chultz and Scott Sager The Florida Department of Agriculture, Division Plant Industry was an excellent resource for information on beetle taxonomy. Thank you to Kate Okins and M ike Thomas I began my graduate work in the Doctor of Plant Medicine Program Thank you to the program administrators for giving me my start at UF The DPM program is an excellent program of study that needs to continue. I must extend my most heartfelt appreciation to Candace Palmer and Aaron Trulock for their assistance throughout this project. Candace was indispensable when it came to assisting me with processing fungal samples. Aaron was always available and

PAGE 5

5 willing h elp whenever I needed to bounce ideas off or had statistical question s, Thank You! Finally, I must express my appreciation to the Florida Park Service for access to research sites in District 3, to the International Society of Arbo r i culture, John White Sch olarship and to the University of Florida, Institute for Food and Agricultural Sciences, Office of Research for providing funding that made this research possible.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPT ER 1 INTRODUCTION TO THE LAUREL WILT PATHOSYSTEM ................................ .. 13 Laurel Wilt ................................ ................................ ................................ ............... 13 Raffaelea lauricola ................................ ................................ ................................ .. 15 Xyleboru s glabratus ................................ ................................ ................................ 16 Future Concerns of Laurel Wilt ................................ ................................ ............... 18 The Danger of Moving Exotic Wood Boring Insects ................................ ................ 19 Concluding Remarks ................................ ................................ ............................... 22 2 ASSESSIN G THE SURVIVAL OF THE REDBAY AMBROSIA BEETLE AND LAUREL WILT PATHOGEN IN WOOD CHIPS ................................ ...................... 24 Introduction ................................ ................................ ................................ ............. 24 Materials and Methods ................................ ................................ ............................ 26 Emergence of X. glabratus from Wood Chips and Non Chipped Bolts ............ 27 Survival of X. glabratus in Wood Chips ................................ ............................ 28 R. lauricola Recovery from Chipped and Non Chipped Wood .......................... 29 Confirmation of Suspect R lauricola Isolates in Culture ................................ ... 30 Moisture and Temperature Measurements ................................ ....................... 30 Beetle Presence Near the Study Site ................................ ............................... 31 Quantitative Analysis ................................ ................................ ........................ 31 Results ................................ ................................ ................................ .................... 32 Emergence of X. glabratus from Wood Chips and Non Chipped Bolts ............ 32 Survival of X. glabratus in Wood Chips ................................ ............................ 33 R. lauricola Recovery from Chipped and Non Chipped W ood .......................... 34 Moisture and Temperature Effects ................................ ................................ ... 34 Temperature of the Bins and Piles ................................ ................................ ... 35 Beetle Presence Near the Study Site ................................ ............................... 35 Discussion ................................ ................................ ................................ .............. 36 3 EFFECT OF TEMPERATURE ON GROWTH AND VIABILITY OF RAFFAELEA LAURICOLA ................................ ................................ ................................ ........... 58 Introduction ................................ ................................ ................................ ............. 58

PAGE 7

7 Materials and Methods ................................ ................................ ............................ 60 In Vitro Growth of R. lauricola at Different Temperatures ................................ 60 Temperature of Infected and Healthy Redbay Trees ................................ ........ 62 Statistical Analyses ................................ ................................ .......................... 63 Results ................................ ................................ ................................ .................... 6 3 In Vitro Growth of R. lauricola at Different Temperatures ................................ 63 Temperature of Infected and Healthy Redbay Trees ................................ ........ 64 Discussion ................................ ................................ ................................ .............. 65 4 PERSISTENCE AND DISTRIBUTION OF RAFFAELEA LAURICOLA IN DEAD, STANDING REDBAY TREES ( PERSEA BOR BONIA ) ................................ ........... 73 Introduction ................................ ................................ ................................ ............. 73 Materials and Methods ................................ ................................ ............................ 76 Persis tence of R. lauricola in Standing Trees ................................ ................... 76 Tree Sapwood Moisture ................................ ................................ ................... 77 Potential R. lauricola Competitors ................................ ................................ .... 77 Assessment of Saprophytic Capability of R. lauricola ................................ ....... 78 Distribution of R. lauricola in Standing Redbay Trees ................................ ...... 80 Statistical Analysis ................................ ................................ ............................ 81 Results ................................ ................................ ................................ .................... 81 Persistence of R. lauricola in Standing Trees ................................ ................... 82 Tree sapwood moisture ................................ ................................ .................... 82 Potential R. lauricola Competitors ................................ ................................ .... 83 Assessment of Saprophytic Capability of R. lauricola ................................ ....... 83 Distribution of R. lauricola in Standing Redbay Trees ................................ ...... 85 Discussion ................................ ................................ ................................ .............. 86 5 EVALUATING THE EFFECTIVENESS OF PRE TREATING REDBAY TREES ( PERSEA BORBONIA ) WITH PROPICONAZOLE AND PINE SOL TO PROTECT THEM AGAINST LAUREL WILT ................................ ........................ 103 Introduction ................................ ................................ ................................ ........... 103 Materials and Methods ................................ ................................ .......................... 107 Pre treatment of Healthy Redbay Trees with Propiconazole and Pine Sol Over Four Years ................................ ................................ .......................... 107 Effectiveness of Pine sol as a Deterrent to X. glabratus ................................ 108 Effectiveness of Cover Spray Treatments of Pine Sol ................................ .... 109 Occurrence o f Root Grafts in Redbay ................................ ............................. 110 Statistical Analysis ................................ ................................ .......................... 110 Results ................................ ................................ ................................ .................. 111 Propiconazole Treatm ent of Healthy Redbay Trees ................................ ....... 111 2009 2012 treatments, 4 years of data ................................ ................. 111 2009 2010 treatments, 2 years of data ................................ ................. 112 Effectiveness of Pine sol as a Deterrent to X. glabratus ................................ 113 Occurrence of Root Grafts Between Redbay Trees ................................ ....... 113 Discussion ................................ ................................ ................................ ...... 113

PAGE 8

8 LIST OF REFERENCES ................................ ................................ ............................. 120 BIO G RAPHICAL SKETCH ................................ ................................ .......................... 133

PAGE 9

9 LIST OF TABLES Table page 2 1 Features of non chipped bolts placed under netting. ................................ .......... 40 2 2 Features of bolts that were chipped and placed under netting ........................... 41 2 3 Fungal species identified from wood chips in 2010. ................................ ........... 42 2 4 Average moisture of wood chips in full sun in days post chipping. ..................... 43 2 5 Average moisture of wood chips in full shade in days post chipping. ................. 44 2 6 Average moisture of wood chips for tarp sun in days post chipping. .................. 45 2 7 Average moisture of wood chips for tarp shade in days post chipping. .............. 46 2 8 Average moisture of non chipped bolts in 2010 in days post chi pping. .............. 47 2 9 Average moisture of non chipped bolts in 2011 in days post chipping. .............. 48 2 10 Average moisture of wood chips in 2010 in days post chipping indoors under netting. ................................ ................................ ................................ ...... 49 2 11 Average moisture of wood chips in 2011 in days post chipping indoors under netting. ................................ ................................ ................................ ...... 50 4 1 Arrival dates and persistence of R. lauricola inside standing dead redbay trees at Washington Oaks Garden State Park, Flagler County, FL. ................... 89 4 2 Endophytic fungi from redbay trees.. ................................ ................................ .. 92 4 3 Percent occurrence of R. lauricola in the trunks and braches of individual dead redbay trees that were cultured from the inside, middle and outer regions of each tree. ................................ ................................ ........................... 95

PAGE 10

10 LIST OF FIGURES Figure page 2 1 Beetle emergence from non chipped bolts from August 2010 to January 2011. ................................ ................................ ................................ .................. 51 2 2 Xyleborus glabratus emergence and bolt moisture. ................................ ............ 52 2 3 Xyleborus glabratus emergence and daily temperature. ................................ .... 53 2 4 Xyleborus glabratus emergence from July 2010 through January 2011 ............. 54 2 5 Temperatures of wood chip in piles and bins, in fu ll sun, shade and under tarps. ................................ ................................ ................................ ................. 55 2 6 Temperature and moisture of wood chips (Inside bin measurements). .............. 56 2 7 Xyleborus glabratus trap catches from 14 July 2010 21 July 2011. ................. 57 3 1 Growth of R. lauricola at varying temperatures. ................................ .................. 68 3 2 Growth of R. lauricola from wood plugs at varying temperatures ....................... 69 3 3 Internal temperatures of dead and living trees.. ................................ .................. 70 3 4 Internal sapwood temperatures of dead and living redbay trees vs. ambient air temperature.. ................................ ................................ ................................ 71 3 5 In ternal and external temperatures from one large redbay tree. ......................... 72 4 1 A t ypical section of redbay trunk ................................ ................................ ......... 98 4 2 Moisture trend in dead redbay trees.. ................................ ................................ 99 4 3 Moisture of wood chips. ................................ ................................ ................... 100 4 4 Percent of wood samples from each tree that were positive for R. lauricola Inner samples came from the center of the stem.. ................................ ............ 101 4 5 Proportion of growth of R lauricola from the inside, outside, and middle sections of sapwood. ................................ ................................ ........................ 102 5 1 Typical setup of the macroinjection system. ................................ ..................... 117 5 2 Three of the five treatments for the Pine sol experiment on tree 3 ................. 118 5 3 Survivability of redbay trees by size class (in cm) treated with propiconazole from 2009 & 2010 ................................ ................................ ........................... 119

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the Universi ty of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE SURVIVAL AND LONGEVITY OF Raffaelea lauricola AND THE REDBAY AMBROSIA BEETLE ( Xyleborus glabratus ) IN CHIPPED AND INTACT WOOD By Donald John Spence August 2012 Chair: Jason A. Smith Major: Plant Pathology Laurel wilt is a relatively new tree disease in the southeastern U.S. that kills members of the Lauraceae plant family. Th is irreversible disease is caused by the exotic fungus Raffae lea lauricola and the exotic redbay ambrosia beetle, Xyleborus glabratus which serves as a vector for the pathogen R. lauricola colonizes the sapwood and can move into all portions of the tree. The presence of the fungus inside the tree causes it to wi lt and die, within a few week s during the summer. To date the disease has killed millions of trees in this family and currently occurs from North Carolina, west to Mississippi and to s outh Florida. This study was designed to examine 1) the survival of t he beetle and fungus in chipped redbay ( Persea borbonia ) trees that were killed by laurel wilt, 2) identify how long the fungal pathogen can persist in standing dead trees, 3) determine the thermal limit of the fungal pathogen, and 4) potential endophytic fungal competitors in redbay trees. Finally, we explored the effectiveness of protecting redbay trees with fungicide injections before they are attacked by the redbay ambrosia beetle. We monitored the survival of X. glabratus and R. lauricola in wood chips that were generated using a standard commercial grade chipper over seven months. After

PAGE 12

12 two weeks, fourteen X. glabratus were found in the wood chips while 339 X. glabratus emerged from non chipped bolts under netting du ring the same period From the wood chips, R. lauricola was only recovered after two days post chipping indicating that the pathogen is not likely to survive outside its beetle vector or intact plant host or be move d from wood chips to other species R. lauricola persisted in dead, standing trees for fourteen months and its optimum growth temperature was 28 C Although this temperature is below the IPPC phytosanitary guidelines for treating wood pallets, it is similar to the maximum daily temperature that the fungus would be exposed to in temperate and subtropical areas Finally, pre treating asymptomatic trees with propiconazole protected over 70% of the study trees.

PAGE 13

13 CHAPTER 1 INTRODUCTION TO THE LAUREL WILT PATHOSYSTEM Laurel Wilt Laurel wilt (LW) is a tree wilt disease that affects t he Lauraceae plant family and caused by a non native fungal pathogen ( Raffaelea lauricola T. C. Harrin., Aghayeva, & Fraedrich) that is vectored by a non native redbay ambrosia beetle, Xyleborus gl abratus (Eichhoff, Coleoptera: Curculionidae) (Hanula et al. 2008). X. glabratus was first detected near Port Wentworth, GA in 2002 and mortality to redbay trees ( Persea borbonia ) was first observed around that time ( Rabaglia 2006, Fraedr ich et al 2008 ). To date, millions of tre e s in the Lauraceae have been killed. In addition to redbay, swampbay ( P. palustris ), scrubbay ( P. humilis ), avocado ( P. americana ), sassafras ( Sassafras albidum ), pondberry ( Lindera melissifolia ), northern spicebush ( L. benzoin ) and pondspice ( Litsea aestivalis ) have been found to be susceptible in natural areas ( Fraedrich et al. 2006, Fraedrich et al. 2008, Hanula et al. 2008 and Hughes et al. 2011 ) Both pepperleaf ( Licaria triandra ) and spicebush ( L. latifolia ) were f ound to be susceptible when artificially inoculated. Diseased c amphor ( Cinnamomum camphora ) has also been found infected in the field, however, entire trees are not dying, just portions are developing branch d ie back ( Smith et al. 2009). R. lauricola is carried by ambrosia beetles inside their bodies near the mandibles, in sacs called mycangia (Beaver 1989 ) The fungal pathogen gains entry into trees through the boring activity of the beetle. LW currently occurs from North Carolina (Forest Health Note s 2011), west to Mississippi (Riggins et al. 2010) and to south Fl orida (DPI 2012, USDA Laurel Wilt Distribution Map). The northern expansion of LW has not progressed as rapidly as the southern movement, although the disease has reached four southeastern counties of North Carolina. LW is likely to continue making long distance jumps in its range due to

PAGE 14

14 people transporting infested host material (Mayfield et al. 2009, Chemically Speaking 2009). Symptoms of LW in redbay include the rapid wilting of the cano py, where the leaves may stay attached to the tree for over a year and dark blue to black staining of the sapwood, which is only visible when the bark is removed. During periods of heavy X. glabratus infestation, boring dust piles or boring dust tubes can be observed on trunks of trees; these are created by the boring activity of the beetle. The disease is irreversible and has caused the mortality of at least 90% of redbay greater than 1 inch diameter at Fort George Island, FL. (Fraedrich et al. 2008) and 100% of mature redbays in Etoniah Creek State Forest, FL over t wo years. (Shields et al. 2011). In Chapter 2, I examine the effectiveness of chipping dead trees to eliminate both the fungus and beetle. The results clearly showed that both the beetle and fungus do not tolerate chipping, demonstrating that it is a very effective means of managing these exotic pests. Data from C hapter 3 indicates that R. lauricola optimum growth occurs a 28 C and that it can be killed at 47 C and that R. lauricola can pe rsist on wood as a saprophyte In C hapter 4 I explored how long R. lauricola can persist in a standing dead redbay tree and its distribution inside the stem of dead trees I also identified sixty fungal endophytes from the sapwood of 25 trees that were growing in LW symptomatic and asymptomatic redbay trees in Washington Oaks Garden State Park, Flagler County, FL. Our 18 month study found that R. lauricola persisted for over 14 months and that it can colonize sapwood up to 7 cm below the vascular cambium The final chapter of this dissertation presents data on the effectiveness of injecting trees with a systemic fungicide before they are infected with R. lauricola Pre injecting trees with a fungicide creates a barrier against the fungus in the t Overall, we found that injecting trees with

PAGE 15

15 propiconazole before they are attacked by the redbay ambrosia beetle provides better than 70% chance that they will be temporally protected against the LW pathogen R. lauricola R affaelea lauricola LW is caused by the fungus R. lauricola an ophiostomatoid relative of the fungus t hat causes Dutch elm disease. R. lauricola is one of several fungal symbionts of X. glabratus (Harrington and Fraedrich 2010) and typical of ambrosia bee tles, it is assumed that X. glabratus feeds on the fungal symbionts it carries with it in its mandibular mycangia ( Beaver 1989, Hanula et al. 2008, Mayfield et al. 2009 ). Fungi that are symbionts of ambrosia beetles are asexual haploid s that typically prod uce small conidia in tight clusters called sporodochia (Harrington and Fraedrich 2010). It is thought that adult beetles and larvae feed on the spores that develop inside the galleries create d by female beetles (Batra 1967, Biedermann and Taborsky 2011). To some degree, R. lauricola and possibly the other mycangia fungi, are capable of persisting as saprophytes inside dead or dying trees for many months. The exact mechanism by which trees die is un known. To date, no phytotoxic compounds have been identi fied (personal communication with the Forest Pathology Laboratory, University of Florida) and it does not seem as though the myceli a or spore 2011). When fungal tissu e was observed with a scanning electron microscope lipids and tyloses were present which would block water flow ultimately causing the trees to wilt. Since toxins and an overabundance of fungal tissue have not been found, it is possible that trees die due to an over stimulation of their defense system ( Hulcr and Dunn 2012 ). To explore how many spores X. glabratus may deposit inside a tree, Harrington and Fraedrich (2010) macerated beetles from Asia and the southeast USA and cultured their

PAGE 16

16 mycangial cont ents. The y found that X. glabratus may carry several species of fungi and that they carry between 10 3 to 10 6 spores of R. lauricola in their mycangia. A study at the University of Florida found that a s few as 100 R. lauricola spores were enough kill heal thy swampbay and avocado saplings (Hughes et al. unpublished). Hughes et al. (unpublished) and Dreaden et al. (2011) also explored the g enetic variation of R. lauricola isolates from Asia and North American populations When using AFLP profiles and micro satellites as genetic markers they found that R. lauricola showed little to no genetic differences. Since R. lauricola has been recovered from experimentally infected and naturally infected leaves, stems, roots and trunks of trees, it illustrates that the fungus is a systemic pathogen and quite mobile within trees, however, t he fu ngus does not move into fruits (Inch and Ploetz 2011). It is common for redbay, and many other species, to produce green sprouts and suckers from the trunk and root system as a t ree is dying. This is not a sign of resistance or recovery. These sprouts are a physiological response to stress by the tree. Of the millions of trees that have died from LW, there have been no reports of trunk or root sprouts persisting and developing into a new tree. In a host range study, 30 different plant taxa representing 6 families were challenged with R. lauricola Fortunately in North America, only the Lauraceae were found to be susceptible to LW (Ploetz and Smith unpublished). Xyleborus glabratus Xyleborus glabratus Eichhoff (Coleoptera: Scolytidae) is a 2mm long wood boring ambrosia beetle native to Asia. It is thought that X. glabratus and its fungal symbionts (including R. lauricola ) entered the U.S. prior to 2003 and spread into the local fo rests (Rabaglia et al. 2006). The home range of X. glabratus is thought to be from Japan to

PAGE 17

17 Taiwan (and likely other areas of s outheast Asia) where it is not known to be a pest. In S.E. Asia, X. glabratus has been known to use members of the Dipterocarpaceae, Fagaceae, Fabaceae and Laur aceae (Rabaglia et al. 2006). X. glabratus Males are flightless and haploid while females are diploid and act as the dispersal agents of the species. X. glabratus is most numerous in late summer and is most active just before sunset, and more often than not, beetles are captured in flight between 1 and 3 meters above the ground (Hanula et al. 2008). Only female X. glabratus anula et al. 2008, Mayfield e t al. 2008, and Beaver 1989). As females construct galleries in the sapwood of trees, fungal spores are released to develop into a fungal layer upon which the adults and larvae feed (Hanula et al. 2008, Rabaglia et al. 2006). X. glabratus has a haplo diploidy reproductive strategy Females have the ability to lay haploid eggs in the absence of males. The haploid eggs develop into males, which allows for the female to mate with male progeny to produce diploid eggs t hat will de velop into females. Thus, one female can give rise to a new population of ambrosia beetles (Hamilton 1967 and Normark et al. 1999). The reproductive cycle of X. glabratus is thought to be between 50 60 days (Hanula et al. 2008 ) where females may lay be tween 1 and 8 eggs in the galleries she created (Brar unpublished). In general, ambrosia beetles are typically associated with stressed, dy ing or dead trees. Ambrosia beetles use olfactory cues to identify stressed or dead trees which are then colonized b y the beetles (Hulcr and Dunn 2011). One of the factors that makes LW unique is that X. glabratus attacks apparently healthy living trees in the Lauraceae. The cues directing X. glabratus to bore into living trees in the southeastern United States are un known but it may be due to an olfactory mi smatch (Hulcr and Dunn, 2011). If this were

PAGE 18

18 the case, then dead trees in Asia would have a similar olfactory signature as healthy Lauraceous trees in North America, but this has not been substantiated by research yet. In newly infected trees, there is no t an overwhelming massive attack by X. glabratus on one tree, possibly indicating that a sing le beetle has bored into the tree depositing enough R. lauricola spores to kill the tree. Future Concerns of Laurel W ilt The complex biology of bark and ambrosia beetles, not only in their native range but in novel areas as well, makes managing diseases vectored by them more difficult (Six and Wingfield 2011). In the case of LW, what the ultimate national and regional biodiversity implications are have yet to be realized (Mayfield et al. 2009) however, it is likely to be significant with the severe reduction of at least a couple of species within the Lauraceae and associated organisms, such as obligate arthropods (Goldberg and Heine 2009). R. lauricola has been cultured out of the mycangia of ambrosia beetles other than X. glabratus (Ploetz et al unpublished) a nd R. lauricola has been found in the sapwood of other dead tree species not known to be hosts of X. glabratus (Smith and Black, unpublished). Whether R. lauricola was the cause of the tree mortality is not known, but it should be a cautionary note that o ther beetle species are potentially moving R. lauricola into other tree species which may serve as reservoirs for the fungus in the future X. glabratus surveys have been conducted in northern Florida and coastal Georgia since the initial detection in 200 2 Researchers have found the beetle to still be present in low numbers (Hanula et al. 200 8 Hughes et al. unpublished ), which is a sign that X. glabratus is persisting on either the few remnant Lauraceous hosts or it has found an alte rnative host to comp lete its lif e cycle.

PAGE 19

19 The D anger of M oving Exotic Wood Boring I nsects Wood boring beetles, both native and non native, can be moved considerable distances within unfinished wood products, causing direct damage or serving as vectors of plant disease outbreaks in new locations. There have been many outbreaks of exotic species arriving in places where they did not exist before and they have affected all types of plants; agricultural monocots and dicots, ornament als, and trees (Brasier 2008). The moveme nt of exotic organisms has increased dramatically over the last two hundre d years (Liebold et al. 1995). Often, the impact is limited and does not pose a threat to food security and ecological integrity; however there are many examples of new exotic pest s that have led to significant ecological damage (Pimentel 1986, Liebhold et al. 1995). More specifically, wood borne pests have threatened silviculture production (Pimentel 1986), urban trees (Dreistadt et al. 1990), and disrupted forest ecology (Liebhol d et al. 1995). The primary means of movement of plant pests has been through the movement of ornamental plants from other countries (Perrings et al. 2005) and in untreated wood products (USDA 1992, USDA 1993, Bridges 1995). At U.S. ports of entry alone, 6788 individual exotic scolytid beetle interceptions were made between 1985 and 2000 at inspection stations (representing 67 species), one of which was X. glabratus in 2002. These beetles came from 49 d ifferent countries (Haack 2001). A few of the import ant exotic insect pests of trees that have become established in the U.S. are: the Gypsy moth ( Lymantria dispar ), common pine shoot beetle ( Tomicus sp.), sirex woodwasp ( Sirex noctilio ); and its associated pathogenic fungus, Amylostereum areolatum the exo tic beech scale ( Cryptococcus fagisuga ) that began transmitting a native fungus ( Nectria coccinea var. faginata ) which has led to a serious decline of American beech trees ( Fagus grandifolia ), the walnut twig borer ( Pityophthorus juglandis ), European

PAGE 20

20 elm b eetle ( Scolytus multistriatus ), the vector of Ophiostoma novo ulmi causal agent of Dutch elm disease (DED), Asian longhorned beetle (ALB) ( Anoplophora glabripennis ), emerald ash borer (EAB) ( Agrilus planipennis ) and the redbay ambrosia beetle ( Xyleborus glabratus ). DED and EAB have decimated urban and forest elm and ash stands and ALB is threatening many species of hardwood across the N.E. US. Although keeping these pests from expanding their range through active management has not happened, it is import ant that federal, state, local governments and private landowners work to limit the spread of these diseases and pests through tree removal, proactive pruning and sanitation, public education outreach and prohibitions on m oving untreated wood products. In an attempt to combat this problem, wood sterilization treatments have been developed to kill wood boring pests either before they depart or upon arrival at the port of entry. The main ways wood has been phytosanitized are by chipping the wood into small p ieces, fumigation, or exposure to high temperatures (Denlinger and Yocum 1998, Burks et al. 2000, Wang et al. 2000, Cyr 2004, Simpson 2004, McCullough et al. 2007, Nzoko et al. 2008, Haack and Petrice 2009). International Standards for Phytosanitary Measu res ( CFR 2002 FAO 2009) require that wood products that are used in commercial shipping must be heat treated for a m inimum of 30 minutes to a core temperature of 56 C. Most nations honor this guideline and certify that their wood dunnage or unfinished wood products have been properly treated. However, even with phytosanitary rules in place, pests like the X. glabratus and other exotic wood boring beetles have, and will continue to arrive in the USA and damage urban and natural forests (Atkinson et al. 1991, Wang et al. 2000, Haack and Poland 2001, Evans and Oszako 2007, Nzoko et al. 2008, Haack and Petrice 2009).

PAGE 21

21 LW highlights the danger of moving untreated wood product s around the planet and that an innocuous organism from one place can lead to a major ecological catastrophe in another. Brasier (2008) has warned of a disease like this occurring for many years and he has argued for more stringent controls on the movemen t of non treat wood, forest and landscape products. LW should be a sobering wake up call to anyone who cares about trees and maintaining a healthy forest system. As Dr. Whitney Crenshaw (University of Continental Dialogue on Non American chestnut tree ( Castanea dentata ); a tree that o nce dominated eastern forest systems. And, it is happening again with the entire Lauraceae family in North America. The point is that massive tree mortality could happen to other culturally, ecologically and economically important species such as live oa k ( Quercus virginiana ), bald cypress ( Taxodium distichum ), or giant redwood ( Sequoia sempervirens ) if the moveme nt of untreated wood continues. Endophytic fungi have been found in most trees species when they have been investigated. Any given tree species can potentially have several to a dozen endophytes present in its wood. W ith the movement of wood products around the globe, the potential for the introduction of fungi into new areas in untreated wood products is significant (Vannini et al. 2012). This has a major implication for phytosanitary concerns. With LW, one beetle and one species of fungus have killed tens of millions of trees in the southeastern U.S. It is possible then that the introduction of any fungus that is moved about by i t s evolution ary partner or by a native insect, has the potential to decimate any species at any time, without warning, and without the ability to predict the impending

PAGE 22

22 catastrophe. The global community needs to recognize that shipping untreated wood products around t he world pose s a significant threat to urban and natural forests. The parties involved in global trade should make every effort to ensure that all wood products moved across any great distances are properly treated to kill hitch hiking insects and fungi. Concluding Remarks Laurel wilt is likely here to stay. From observations of movement since 2002, it appears that mortality will continue to be high for species in the Lauraceae plant family (Mayfield et al. 2009 and Ploetz et al. 2011). As of yet, there is no demonstrated genetic resistance within the native North American Laura ceae. Genetic resistance in redbay and avocado is being tested (Ploetz et al. 2011 and Hughes unpublished) but more work is needed to verify and deploy resistant germplasm. With so many invasive species present, there is a real concern that a threshold of biological stress might be reached that will either eliminate species outri ght or cause local extinctions. LW threatens the ecology of inland swamps, coastal hammocks, and the urban tree canopy. The loss of the tree will have a negative impact on food w ebs for organisms that depend on the tree. In particular, LW could cause the extinction of the Palamedes swallowtail butterfly ( Papilio palamedes ). This beautiful butterfly only lays eggs on Persea species (Minno et al. 1999, Hall and Butler 2005), meani ng that without this genus of trees, the butterfly may be unable to reproduce. Its entire range of existence is from Virginia to Louisiana, the same range that LW may eventually occur. Global trade will continue, therefore, the introduction of new pathogens will continue to occur here and across the globe. The knowledge gained by understanding the dynamics of this beetle vectored fungal disease may allow for better risk assessment and management of future invasions.

PAGE 23

23 Even if all or most Lauraceous species in urban and forest settings are killed, active LW management programs, based on a combination of sanitation and pruning, could be instituted in avocado fields, which could aid in keeping this important agricultural crop fro m being decimated by LW. These practices may also be a useful tool when attempting to manage other wood bound fungi and insects pests. The work in this dissertation, and the work of dozens of other researchers, will hopefully aid in the identification of solutions to these pest s Here, I summarize my work demonstrating that chipping trees infested with X. glabratus and R. lauricola is an effective sanitation technique to significantly reduce the numbers of both pests. We identified the heat tolerance thr eshold of R. lauricola and its distribution inside trees and attempted to identify some of the fungal endophytes that may play a role in limiting the duration that R. lauricola can persists within a dead tree. Finally, fungicide injections were evaluated for their potential to protect a tree from this pathogenic fungus.

PAGE 24

24 CHAPTER 2 ASSESSING THE SURVIVAL OF THE REDBAY AMBROSIA BEETLE AND LAUREL WILT PATHOGEN IN WOOD CHIPS Introduction Laurel wilt (LW) is a non native vascular wilt disease that kills members of the Lauraceae plant family. The disease can kill a large tree within weeks of infection in the summer and is irreversible. The pathogen, R. lauricola can be recovered from sapw ood, leaves, and roots of trees. The disease has caused the mortality of over 90% of the redbays greater than 2.5 cm dbh at Fort George Island, FL (Fraedrich et al. 2008) and 100% of the mature redbays in Etoniah Creek State Fore st, FL (Shields et al. 20 11). LW was first detected near Savannah, GA in 2002 (Rabaglia 200 6 ) and currently occurs from North Carolina, west to Mississippi and south to southeastern Florida (Riggins et al. 2010, Forest Health Notes 2011, DPI 2012). LW has moved faster than was pr edicted (Koch and Smith 2008) through the natural dispersal of its beetle symbiont, X. glabratus Large jumps in its distribution occurred within Florida and to Mississippi, North Carolina, and Alabama (Riggins et al. 2010, Forest Health Notes 2011) and a nthropogenic movement of the LW vector and pathogen are responsible for a few of these jumps in distribution (Chemically Speaking 2009, Mayfield et al. 2009). The movement of exotic organisms has increased dramatically over the last 200 years (Liebhold et al. 1995). Often, the impact is limited and does not pose a threat to food security and ecological integrity; however there are plenty of examples of new exotic pests that have led to significant ecological damage (Pimentel 1986, Liebhold et al. 1995). M ore specifically, wood borne pests have damaged silviculture production (Pimentel 1986), urban trees (Dreistadt et al. 1990), and disrupted forest ecology (Liebhold et al. 1995). The primary means of movement of invasive plant pests has been through the

PAGE 25

25 m ovement of ornamental plants from other countries (Perrings et al. 2005) and in untreated wood products (USDA 1992, USDA 1993, Bridges 1995). At U.S. ports of entry alone, 6788 individual exotic scolytid beetle interceptions were made between 1985 and 200 0 at inspection stations (representing 67 species), one of which was the X. glabratus in 2002. These beetles came from 49 different countries (Haack 2001). Over the past decade, the emerald ash borer (EAB) (Poland and McCullough 2006, McCullough et al 20 07) and Asian longhorn beetle (Wang et al. 2000), have become established in the N.E. U.S, leading to the destruction of millions of trees. Maybe the two most infamous exotic pathogens to become established in North America and have played a role in killi ng tens of millions of trees are Ophiostoma novo ulmi causal agent of Dutch elm disease (Dunn 2000 ), and Cryphonectria parasitica which causes chestnut blight and has functionally eliminated chestnut ( Castanea dentata ) from North America ( Anagnostakis 198 7). Although exotic pests and pathogens have successfully colonized the USA, there are programs in place to monitor manage and prevent the introduction of these pests. Since 1995, the U.S.A. has been a signatory on the international treaty that sets guid elines for the importation of solid wood packing material and followed international phytosanitary rules to reduce the potential for pests and pathogens to be transported (USDA 2000). To combat the introduction of pests, countries have developed a series of guidelines to minimize and kill pests before they leave the country of origin or once they arrive at a new loca tion (CFR 2002 and IPPC 2009). Common phytosanitary techniques for eliminating wood bound pests include heat sterilization (Denlinger and Yoc um 1998, Nzoko et al., 2008), fumigation (Cyr 2004), and chipping of potentially infested material (McCullough et al. 2007, Wang 2000).

PAGE 26

26 Since R. lauricola is vectored by a small beetle, chipping provides a potential option to elimina te the pest from dead trees. In a study by McCullough et al. (2007) on the management of the EAB two types of wood processing machinery to kill the EAB were tested chipping and grinding. Chipping was found to be more effective than grinding. In addition, heating emerald ash borer infested wood bolts between 60 to 65 C for 48 hours was sufficient to kill the beetle in a laboratory setting (Denlinger and Yocum 1998, McCullough et al. 200 7). In a study to assess the survival of the Asian long horned beetle ( Anoplo phora glabripennis ALB) surrogates (gypsy moth larva and plastic worms) that were c hipped were essentially killed (Wang 2000). These results have led municipalities to recommend chipping as a means to dispose of dead and infested ALB trees as well as systemic insectic ide injections when appropriate fo r ALB management (MDAG 2012). This study explore s the effectiveness of chipping trees as a means of sanitation and evaluates the persistence of R. lauricola and X. glabratus in chipped wood. The objective s of the study were to: 1) evaluate the survival of X. glabratus after infested wood is chipped; 2) determine how long R. lauricola remains viable in wood chips following chipping; 3) determine if small wood chips can provide an adequate environment for X. glabratus development, and 4) determine if wood moisture and temperature are correlated with the occupation of intact bolts of wood by X. glabratus and R. lauricola Materials and Methods ry Memorial Forest (ACMF), just north of Gainesville, FL during the summers of 2010 and 2011. Redbay ( Persea borbonia (L.) Spreng.) trees used for this study had a dbh (diameter at breast height) of at least 7 c m and had recently died from LW. E ach tree had completely wilted canopy, discolored sapwood and evidence of X. glabratus beetle boring activity.

PAGE 27

27 Approximately 30 dead infested trees in 2010 and 20 dead infested trees in 2011 were harvested and chipped using a Vermeer model BC 935 wood chipper. Emergence of X. glabratus from W ood Chips and Non Chipped B olts During the summers of 2010 and 2011, 20 bolts of infested redbay wood, each 50 cm long, were used to evaluate the effectiveness of chipping to kill X. glabratus The diameter and moisture for each bolt are listed in Table 2 1 and Table 2 2. Ten of the 20 bolts were randomly selected and individually chipped onto a clean tarp (wood chip average size was 1.3 cm 2 ). Wood chips were collected and placed in individu al piles (4.5 x 4.5 x 1.8 dm); the remaining ten bolts were set on end. Wood chip piles and bolts were maintained in a non temperature controlled structure at the Austin Cary Memorial Forest near Gainesville, FL. Both the wood chips and intact bolts were covered with a fine mesh (400 m weave) where the mesh netting was stapled to the inside of a wood frame. A plastic trough that contained propylene glycol was placed around the perimeter of the wood chip piles and bolts. Beetles that emerged flew into t he netting and would fall into the collection trough. Insects that emerged from the wood chips and bolts were collected every two weeks. At each collection event, the moisture of the wood chips and non chipped bolts were recorded using a Protimeter Timb ermaster (General Electric Corporation, Shannon, Ireland) Insects that emerged were placed into separate containers and returned to the laboratory for identification. In addition to the troughs, one yellow sticky card (Seabright Laboratories, Emeryville, CA) was stapled to the interior top portion of each netted structure and ; it was also collected every two weeks to help assess the emergence of X. glabratus Four sticky cards were also placed around the interior of the garage to survey for the presence of any X. glabratus that escaped from the netted structures

PAGE 28

28 Survival of X. glabratus in Wood C hips Trees that were not used in the previous study were chipped onto a clean tarp and used to fill mesh bags, bins, and t o create piles of wood chips. Eighteen 1 m 3 bins were filled with chips and ten 0.5 m 3 piles of wood chips were created to determine if X. glabratus and R. lauricola would persist in wood chips Nine of the bins were placed in full sun (bin sun) while the other nine were placed in constant sha de (bin shade). For the piles of wood chips, a tarp was placed over all ten piles, where five were placed in full sun (tarp sun) and five in constant shade (tarp shade). Tarps were held down with cement blocks and completely cover ed the entire wood chip pile. Infested redbay wood chips were used to fill 352 mesh bags ( 150 cm 3 ) that were placed in the center and top of each pile and bin. A 1 m long string was tied to each bag to aid in their retrieval. The bags were filled within three hours of tree chi pp ing (during the middle of the day). The material used for the mesh bags was the same as the material used for the netting over the wood chip piles and non chipped bolts. Mesh bags were extracted from the center and top of each bin and pile every other d ay after chipping for one month There afterwards, bags were collected every two weeks for a total sampling period of ten weeks For wood chip piles, mesh bags were placed on top of the chips but under the tarp. Underneath each bin and pile a wood board was placed to isolate the wood chips from soil microorganisms. A total of 352 mesh bags were extracted over a 10 week period. The mesh bags were taken back to the laboratory where the wood chips were placed on a white piece of paper to obser ve any moving beetles. Four wood chips from each mesh bag were set aside to test for the viability of R. lauricola From those four wood chips the moisture content was recorded, which were representative of the moisture at the center and top of

PAGE 29

29 the bins and piles. The rest of the wood chips were placed into a 226 cm 3 insect rearing chamber to monitor for the emergence of the X glabratus Rearing chambers were kept at room temperature (24 C) and were exposed to approximately 12 hrs of light daily. Ea ch collection jar was evaluated weekly for 90 days for the presence of X. glabratus a nd other wood boring insects. After 90 days, contents of each rearing chamber were evaluated using a dissecting microscope to determine if any X. glabratus remained insid e the chambers. To test whether the rearing chambers provided an adequate environment for survival of X. glabratus ten small LW infested redbay bolts (3 cm in diameter x 11 cm long) were placed into individual rearing chambers. The bolts were monitored ev ery 14 days for six months. R. lauricola Recovery from Chipped and Non C hipp ed W ood At the beginning of the chipping study, wood plugs (approximately 13 x 1.5 mm) were taken from the non chipped infested wood pile with a n increment bore hammer (Haglf Swe den) to confirm t he presence of R. lauricola Wood cores were cut into smaller fragments (approximately 2 x 3 mm in size), surface sterilized for 60 seconds in 70% ethanol and rinsed in ddH 2 O for 60 seconds When dry, the wood sections were plated on cyclohexi mide streptomycin malt agar (CSMA), a semi selective medium for ophiostomatoid fungi (Harrington 1981), with antibacterial amendments. The amendments were the addition of 350 mg of ampicillin sodium salt and 500 L of a 9 mg RifAmpin+1000 DMSO mixture (Ploetz et al. 2011). Hereafter, we refer to this medium as CSMA++. R. lauricola every three days.

PAGE 30

30 Confirmation of S uspect R lauricola Isolates in C ulture R. lauricola confirmation for all wood plugs taken during the study were c onfirmed based on morphology. All isolates from wood chips that appeared to be R. lauricola were conf irmed through genetic analysis. Suspect isolates from wood chips were sub cultured on CSMA++ for approximately 10 days and then DNA was extracted (Justesen et al. 2002) with the addition of a proteinase K digestion step. The small subunit (18s) rDNA was amplified via PCR using GTAGTCATATGCTTGTCTC CT TCCGTCAATTCCTTTAAG g of Amplitaq Gold (Applied BioSy L of of each primer was used. A MJ Research, PTC 200 Peltier thermocycler was used for PCR with the following cycling conditions: 95 C for 6 minutes then 40 cycles of 95 C for one min., 48 C for 30 sec. and 72 C for two minutes for DNA extension. ExoSAP it (Affymetrix, Inc, USB Products, Santa Clara, CA) was used to purify the amplicon, which Biotechnology Research for Sanger sequencing. The sequenced amplicons were compared to th e GenBank (http://www.ncbi.nlm.nih.gov/) library, see Table 2 3 Moisture and Temperature M easurements Wood chip moisture content was taken from four randomly selected wood chips from each mesh bag from the inside and top of each bin or pile Tables 2 4 th rough 2 7. For the non chipped bolts, three moisture measurements were taken from the middle of the bolt, where readings were taken along the vertical axis of the bolt of wood (in the same direction of the wood grain) Tables 2 8 and 2 9 Four moistures readings wer e recorded from four wood chips from the c hipped bolt piles, Tables 2 10 and 2 11.

PAGE 31

31 Temperature probes (CAS Data Loggers, Chesterland, Ohio) were placed in the center of six bins and two piles for the sun and shade treatments. Temperature probe s at the center of the piles recorded the temperature of the wood chips every hour. To determine the temperature on the tops of the bins we used a University of Florida weather station t hat was located 50 meters away. Beetle Presence Near the Study S ite Two weeks prior to chipping, five, six tier, manuka oil baited multifunnel traps were suspended from trees 2 m above the ground around the study site to attract X. glabratus (Ke ndra et al. 2011) Traps were checked weekly from July through mid December, e very two weeks from mid December through April, then weekly again through July 2011. The multifunnel traps were fitted with wet collection jars containing propylene glycol. Trap catches were collected and tabulated for scolytid catches only and t he numbe r of X. glabratus were tabulated for each collection. Both X. affinis and X. volvulus were common around the site but due to the time required to differentiate between the two, their numbers were combined. Quantitative A nalysis A one way ANOVA was used to identify di fferences between the emergence of X. glabratus from wood chips and non chipped bolts as well as differences between non chipped bolt and chipped bolt moisture and diameters used in 2010 and 2011 ( Microsoft Excel 2010 ) When significant dif ferences were found ( = 0.05) a Tukey HSD comparison of means was used to determine the differences among samples. Linear r egression analysis of X. glabratus emergence from non chipped bolts vs. daily temperature, moisture and weeks since wood was chippe d were conducted with Microsoft Excel 2010

PAGE 32

32 Results Emergence of X. glabratus from Wood Chips and Non Chipped B olts The difference s in moisture of felled trees that were used for the chipping study ranged from 100 % to 27.7 % with a mean of 60.4 % and a standard deviation of 25 % A compari son the moisture of 50 randomly selected wood chips taken one hour after chipping ranged from 80 % to 22 % with a mean of 37.9 % and a standard deviation of 11.9 % When the data from all non chipped bolts were combi ned for 2010 and 2011, there were a total of 2461 scolytid beetles that emerged over ten months Over the first two weeks of both studies, 1200 scolytid beetles emerged, of which 339 were X. glabratus Over the remaining six and a half months, 1261 scoly tid beetles emerged, 1034 of which were X. glabratus Figure 2 1. Over the same periods for both years, the emergence of X. glabratus from wood chips was statistically different, where onl y 14 X. glabratus emerged over seven months F (2,27) = 6.92, P = 0.0037 A T test comparing the moisture of bolts for both the non chipped study was not significant F (1, 18), = 0. 18, P = 0.676 A T test comparing non chipped bolt diameters from 2010 and 2011 was also not significant F (1,18),= 0.018, P = 0.895 A T test comparing the moisture of bolts used to make wood chips in both the 2010 and 2011 studies was not significant F (1,18), = 0. 322 P = 0. 577 However, a T test comparing the diameters of bolts to be chipped in 2010 and 2011 was significant F (1,18),= 7.67 P = 0. 0163 even though X. glabratus emergence was not statistically different F (1,18),= 0.343 P = 0. 628 In addition to discerning the effectiveness of chipping infested trees, potential correlations between the emergence of X. glabratus and non chipped bolt moisture (Figure 2 2), daily outside temperature (Figure 2 3) and weeks since chipping (Figure 2 4) were

PAGE 33

33 evaluated. Daily outside temperature and moisture were not well correlated with X. glabratus emergence ( r 2 = 0.123 and r 2 = 0.064 re spectively). The emergence of X. glabratus was correlated ( r 2 = 0.698 ) to the length of time that the study ran, from July 2010 through January 2011 Survival of X. glabratus in Wood C hips Over the course of the study, only 3 of 352 insect rearing chambers yielded X. glabratus Two X. glabratus emerged from wood chips, from the same rearing chamber, four days post chipping. Both beetles were female; one dark and one light yellow, indicating it likely just eclosed After 90 days, t he wood chips in the rearing chambers were examined for dead intact or fragments of X. glabratus Two whole X. glabratus were found in two other rearing chambers when they were dissected, along with more than a dozen X. glabratus fragments. The two intac t beetles came from wood chips in mesh bags that were extracted from the study pil es at two days post chipping. In total, fourteen scolytid beetles emerged from either wood chips in the garage piles or in the insect collection jars. No beetles were recove red more than two weeks post chipping. Other than X. glabratus the species that were found in collection jars or by dissection were three Xyleborus affinis five Xylosandrus crassiusculus and one Xyl ebor inus saxeseni From the ten small bolts of redbay that were placed inside the rearing chambers to test suitability of the rearing chambers, 24 X. glabratus emerged over a six month period. No other species were found in the collection jars. These bolts were not dissected at the end of the evaluation. Th is study was designed to run for ten weeks. However, the non chipped bolts were left under netting for an additional eight weeks to observe X. glabratus activity.

PAGE 34

34 Sixteen weeks after the start of the study, X. glabratus emergence from non chipped bolts c eased. The remaining bolts were placed in an incubator at 30 C in an attempt to force out any remaining ambrosia beetles. Within one week, X. glabratus (and a few other scolytids) began emerging again. In total, an additional 241 X. glabratus emerged. R. lauricola Recovery from Chipped and Non Chipped W ood Of the 20 wood cores extracted before chipping, all yielded R. lauricola which were confirmed by morphology. Three weeks after chipping, ten wood cores were taken from the non chipped bolts, eight of ten cores yielded R. lauricola which were also confirmed by morphology. Over the course of the chipping study, approximately 3600 wood pieces were plated from 352 mesh bags. R. lauricola grew from wood chips from only four mesh bags, two from the top of a bin sun treatment and two from the top of a bin shade treatment. These four mesh bags were collected two days post chipping. R. lauricola was never recovered be yond two days post chipping. Each of the four isolates produced a 99%, or 100% match to voucher isolates of R. lauricola in GenBank Table 2 3 A few other fungi that were also isolated and identified by PCR from wood chips are listed Table 2 3 Moisture and Temperature E ffects Wood and wood chip moisture had no effect on the emergence of beetles from non chipped bolts or survival of R. lauricola in wood chips. In fact, since R. lauricola was only found after two days post chipping, moisture and temperature could not have been the reason for its disappearance. In T ables 2 4 through 2 11 the change in moisture of the wood chips for each treatment and bolts can be observed.

PAGE 35

35 Temperature of the Bins and P iles The maximum temperature of wood chips inside bin sun, bin shade, tarp sun pile, and tarp shade piles were 63.5, 60, 46, and 40 C respectively. The internal temperature data from each replicate for ea ch treatment was averaged, Figure 2 5. Figure 2 6 illustrates that as moisture remained relatively constant the temperature of the wood chip piles decreased over time. To represent the temperature on the surface of the wood chip piles and bins, temperatures from the nearby weather station were used over the course of the study (May through July) The maximum temperature reached at the ACMF weather station was 35 C. The maximum daily temperature reached at Gainesville Regional Airport (approximately 9 km away) over the same period was 35. 5 C. ( http://www.wunderground.com/history/airport/KGNV/2011/5/31/DailyHistory.html?req_city =NA&req_state=NA&req_statename=NA ). Beetle Presence Near the Study S ite Scolytids collected from the five multifunnel traps monitored over a 12 month period were: 706 X. glabratus 572 Xylosandrus crassiusculus 125 Xyloborinus saxeseni 814 Xyleborus affini s/ Xyleborus volvulus (due to the similarity between these two species species level identification was not undertaken), 16 Monarthrum mali 51 Hypothenemus sp. a nd 65 Euplatypus sp. A T test comparing two weeks of X. glabratus catches from five traps before and after chipping for both years showed that the means were not statistically different F (1,18),= 1.057 P = 0. 152 `

PAGE 36

36 Discussion Data collected during this study clearly shows that very few X. glabratus will survive the chipping process and that R. lauricola did not persist in wood chips longer than two days Over 1,300 X. glabratus emerged from intact bolts while only 13 emerged from wood chips. All beetle s that did emerge did so within two weeks of chipping. R. lauricola was only recovered two days post chipping (and only from 4 of 352 mesh bags) while the X. glabratus population was reduced by 99.5% compared to non chipped bolts. Since the only beetles that survived chipping came from uncovered bins, it may be prudent to cover wood chips with a tarp for a week to ensure that any survivors are killed Wood chips that came from inside the bins and from under the tarps were wet from condensation and coloni zed by Aspergillis fumigatus, Syncephalastrum racemosum and Rhizopus microporus along with other opportunistic saprophytic species. Thus, R. lauricola was no longer actively growing in the wood and may have been out competed by these fungi Use of living, dead, dying and decaying trees by ambrosia beetles is driven by a complex set of variables, one of which is wood moisture ( Graham 1925, Adams and Six 2007). However, this study did not show a correlation between a change in non chipped bolt moisture and emergence of X. glabratus X. glabratus emerged at a fairly constant rate for eight weeks from the non chipped bolts while the other scolytid species emerged i n mass over the first two weeks. Neither the quick emergence by the other scolytids nor the con tinued emergence of X. glabratus were positively correlated to non chipped bolt moisture. Another factor of X. glabratus emergence that was analyzed was time in weeks since chipping. There was a correlation with time since chipping ( r 2 = 0.69 8) however, the change in daylight hours due to the coming fall, generation time, the disappearance of R.

PAGE 37

37 lauricola from the bolts or the arrival of an antagonistic fungal saprophyte could have played a role in that phenomenon Eight weeks into the study we removed Netted Log 1 (NL1) from the experiment to dissect it and look for X. glabratus Due to the similar bore hole sizes between X. glabratus and Xyleborinus saxeseni Xyleborus affinis, X. ferrugineus and X. volvulus we de termined that any comparisons based on the number of bore holes would not be accurate. In addition, the small size of the beetles (2 mm in length) would also make it difficult to find all X. glabratus still inhabiting bolts of wood; therefore no data are provided on the number of beetles that could potentially inh abit any given volume of wood. For the bolts that were transferred to incubators after 18 weeks, it is interesting that the addition of sudden, intense heat caused X. glabratus to emerge. If the bolts were left at the study site, those 241 beetles may have emerged the following spring when the bolts w ould have warmed up naturally. With tens of thousands of dead trees across Florida, there is the potential for wood processing facilities to convert these trees into mulch. This research also showed that R. lauricola would not be viable in wood chips for any length of time, meaning that there is virtually no chance for movement of R. lauricola fro m wood chips to healthy trees. A study on the thermal tolerance of R. lauricola (Spence et al. unpublished) found that R. lauricola w as killed in culture at 47 C. The center temperature of wood chips in the sun treatment reached 60 C, making it even more unlikely that R. lauricola could spread from a wood chip to anything else or be picked up by another beetle when wood chips are left for at least a few days in a pile. Although not directly tested, it is unlikely that R. lauricola poses a threat to healthy Lauraceous species when used as mulch.

PAGE 38

38 Sanitation of fungal pathogens through heat treatments has been investigated for many crop pathogens and post harvest saprophytes. Downer et al. (2008) tracked four fungal species for eight weeks inside unturned piles of green plant debris and compost. A rmillaria mellea and Trichoderma semipenetrans did not survive more than two days in fresh green waste, while Phytophthora cinnamomi persisted for over 21 days in compost piles that reached 70 C. Another study examined of 38 fungal and oomycete pathogens in compost and found that 87% of them were reduced below detection levels at temperatures between 64 70 C after 21 days (Noble and Roberts 2004). With bins of freshly chipped redbay trees, it is a bit surprising that multifunnel trap catches were not sig nificantly different before and after chipping. There would have been fresh wood volatiles in the air from all the piles of wood chips which should have acted as an attractant to X. glabratus This is in contrast to a study that found cut or rasped redba y bolts were more attractive to X. glabratus than bolts with intact bark ( Niogret et al. 2011 Mayfield and Hanula 2012). One possible explanation is that the volatiles that are attractive to X. glabratus do not persist in wood chips comprised of a small volume of wood X. glabratus activity over a twelve month period did not match the findings of Hanula et al. (2011). They found that X. glabratus was most active in September while our largest catches were in April. These studies have demonstrated that chipping trees is an effective means of reducing both pests In particular, the danger of moving the pathogen in wood chips is almost zero. This means that if dead trees are chipped for landscaping mulch, th e pathogen will not persist and will not pose a threat to health of L auraceous species. Even if all or most Lauraceous species in urban and forest settings are killed, active LW management programs could be instituted in avocado fields to prune out and ch ip infested

PAGE 39

39 branches or whole trees. An active LW monitoring program that removes infested trees or branches as soon as LW is observed could aid in keeping this important crop from being decimated by LW. This process of chipping beetle and fungus infeste d wood may also be useful when attempting to manage other tree diseases

PAGE 40

40 Table 2 1 Features of non chipped bolts placed under netting Avg. dia. Maximum dia. Minimum dia. Avg. moisture content 2010 13.43 cm 13.70 cm 12.80 cm 91.72 % 2011 13.50 cm 15.60 cm 10.80 cm 92.87 % n = 20

PAGE 41

41 Table 2 2. Features of bolts that were chipped and placed under netting Avg. dia. Maximum dia. Minimum dia. Avg. moisture content 2010 13.91 cm 15.80 cm 13.00 cm 92.74 % 2011 12.35 cm 15.20 cm 10.60 cm 91.32 % n = 20

PAGE 42

42 Table 2 3. Fungal species identified from wood chips in 2010 Treatment Species % match Primer pair Accession # Sun top 2 R. lauricola 100 NS1 4 EU257806.1 Sun top 1 R. lauricola 99 NS1 4 EU257806.1 Shade top 2 R. lauricola 100 NS1 4 JF797171.1 Shade top 1 R. lauricola 99 NS1 4 JF797172.1 Sun top 1 Pichia caribbica 100 ITS1 4 FN428931.1 Tarp sun top 5 Aspergillis fumigatus 99 ITS1 4 GU205082.1 Shade top 1 Syncephalastrum racemosum 88 ITS1 4 EU409811.1 Sun inside 5 A. fumigatus 99 ITS1 4 GU205082.1 Tarp sun inside 5 Rhizopus microporus 100 ITS1 4 FJ810505.1 Tarp sun inside 4 Syncephalastrum racemosum 92 ITS1 4 AB054045.1 Tarp shade inside 4 Cunninghamella bertholletiae 99 ITS1 4 DQ155288.1

PAGE 43

43 Tabl e 2 4 Average moisture of wood chips in full sun in d ays post chipping Treatment 2 4 6 8 10 12 14 29 40 56 70 84 Avg. Moisture Std. Dev. ST1 43.4 43.4 29.0 22.3 13.1 31.4 32.8 34.2 11.5 10.4 7.2 13.0 24.3 13.1 SM1 50.6 41.4 38.1 36.2 25.3 56.0 32.0 50.1 58.2 44.2 20.4 54.1 42.2 12.2 ST2 52.1 47.7 29.3 42.8 25.9 20.3 30.6 50.1 16.9 8.1 7.5 15.1 28.9 16.1 SM2 39.3 51.7 37.1 57.4 34.7 43.0 27.1 44.7 33.8 41.4 59.7 57.7 44.0 10.6 ST3 32.7 46.6 44.6 24.2 12.7 58.2 29.3 44.6 10.1 11.0 6.6 13.2 27.8 17.5 SM3 46.2 36.5 33.5 44.9 37.4 38.7 32.4 38.4 53.6 57.3 40.9 25.6 40.5 8.9 ST4 48.9 20.8 37.2 31.0 12.4 42.1 31.1 46.5 22.0 8.7 7.6 15.2 27.0 14.6 SM4 56.7 37.7 49.3 29.5 37.9 42.4 29.3 48.2 54.8 35.3 50.5 39.8 42.6 9.3 Avg. top moisture 44.3 39.6 35.0 30.1 16.0 38.0 31.0 43.9 15.1 9.6 7.2 14.1 27.0 13.7 Avg. mid moisture 48.2 41.8 39.5 42.0 33.8 45.0 30.2 45.4 50.1 44.6 42.9 44.3 42.3 5.6 ST = sun top, SM = sun middle of the pile, HT = shade top, HM = shade middle of the pile

PAGE 44

44 Table 2 5 Average moisture of wood chips in full shade in days post chipping. Treatment 2 8 10 12 14 29 40 56 70 84 Avg. Moisture Std. Dev. HT1 53.4 59.4 38.0 62.4 54.1 47.2 26.0 23.7 32.3 22.1 7.9 14.5 36.8 18.4 HM1 49.3 46.3 37.9 48.8 46.2 28.4 25.8 32.7 25.6 24.8 27.6 22.0 34.6 10.5 HT2 55.3 36.9 38.2 39.7 42.9 26.7 23.2 21.8 20.6 16.4 7.9 12.9 28.5 14.0 HM2 55.7 43.5 36.1 41.4 45.2 41.0 24.5 25.9 30.7 28.2 26.6 25.3 35.3 10.0 HT3 57.3 33.5 35.5 47.8 34.6 32.4 27.6 21.9 17.0 13.4 8.2 13.0 28.5 14.7 HM3 40.1 40.8 37.1 49.0 36.8 39.6 25.9 25.1 19.9 29.0 26.6 24.2 32.8 8.8 HT4 58.5 45.0 38.2 29.0 22.0 32.4 18.0 18.6 23.4 12.8 7.8 14.2 26.7 14.8 HM4 41.6 49.8 40.2 26.2 52.6 41.6 27.5 27.6 24.9 22.2 25.4 24.5 33.7 10.8 HT = shade top, HM = shade middle of the pile

PAGE 45

45 Table 2 6 Average moisture of wood chips for tarp sun in days post chipping. Treatment 14 29 40 56 70 84 Avg. Moisture Std. Dev. TST1 29.0 32.0 24.7 24.9 13.8 29.2 25.6 6.4 TSM1 27.1 29.1 22.4 27.6 31.3 49.5 31.2 9.5 TST2 14.0 18.8 16.3 18.9 13.4 25.8 17.9 4.5 TSM2 39.3 28.2 25.4 27.6 25.7 25.3 28.6 5.4 TST3 22.9 19.6 21.2 14.9 14.6 21.8 19.2 3.6 TSM3 27.9 26.3 34.7 19.6 22.6 24.5 25.9 5.2 TST4 37.7 20.6 42.6 33.5 40.1 42.3 36.1 8.3 TSM4 28.1 24.9 27.6 24.4 19.3 16.0 23.4 4.8 TS T = tarp sun top, TSM = tarp sun middle of the pile

PAGE 46

46 Table 2 7 Average moisture of wood chips for tarp shade in days post chipping. Treatment 14 29 40 56 70 84 Avg. Moisture Std. Dev. THT1 26.7 35.8 37.1 40.6 51.7 46.3 39.7 8.7 TH M1 24.9 25.5 26.3 28.5 29.9 27.2 27.1 1.9 THT2 23.5 22.7 29.7 50.5 39.8 42.9 34.9 11.3 THM2 25.1 32.6 32.8 26.6 21.1 26.1 27.4 4.5 THT3 27.6 36.7 47.2 42.6 76.3 66.8 49.5 18.5 THM3 24.8 33.7 29.1 27.6 26.2 25.6 27.8 3.3 THT4 26.1 27.3 54.3 50.7 71.8 64.0 49.0 18.8 THM4 29.7 33.1 28.4 22.5 24.8 23.7 27.0 4.1 THT = tarp shade top, TH M = tarp shade middle of the pile

PAGE 47

47 Table 2 8 Average moisture of non chipped bolts in 2010 in days post chipping. Treatment 14 29 40 56 70 84 98 112 127 140 Avg. Moisture Std. Dev. NL1 83.9 83.2 100.0 100.0 91.8 9.5 NL2 89.9 57.8 100.0 89.9 99.1 91.7 65.3 43.3 56.1 24.8 71.8 26.0 NL3 25.4 23.3 25.7 24.0 24.9 22.4 22.3 23.4 24.6 18.2 23.4 2.2 NL4 68.3 59.7 60.7 45.9 42.2 52.9 43.6 47.9 35.2 26.4 48.3 12.6 NL5 41.7 33.9 24.2 26.5 29.6 24.2 27.6 25.4 26.6 19.0 27.9 6.2 NL6 56 70.4 59.6 58.1 39.7 37.5 36.4 36.9 39.7 21.4 45.6 14.8 NL7 66.8 99.6 80.7 85.9 39.5 52.5 50.0 50.0 56.6 28.5 61.0 22.1 NL8 58.9 85.0 91.2 100.0 91.5 68.8 56.6 57.0 46.4 23.9 67.9 23.9 NL9 27.1 29.1 49.5 54.2 32.2 34.8 28.0 28.7 29.9 22.8 33.6 10.2 NL10 100 100.0 99.9 90.1 99.3 88.4 90.4 87.7 88.3 33.3 87.7 19.9 NL = netted log

PAGE 48

48 Table 2 9 Average moisture of non chipped bolts in 2011 in days post chipping. Treatment 14 29 40 56 70 84 98 112 127 140 Avg. Moisture Std. Dev. 11 23 68.1 6.1 NL1 72.4 63.8 60.6 2.6 NL2 62.4 58.7 75.0 1.1 NL3 75.7 74.2 68.0 0.8 NL4 68.5 67.4 93.2 1.3 NL5 92.3 94.1 53.2 9.8 NL6 46.2 60.1 70.6 0.7 NL7 70.1 71.1 91.2 0.6 NL8 91.6 90.8 91.7 3.0 NL9 89.5 93.8 66.1 1.4 NL10 67.1 65.1 68.1 6.1 NL = netted log

PAGE 49

49 Table 2 10 Average moisture of wood chip s in 2010 in days post chipping indoors under netting. Treatment 14 29 40 56 70 84 Avg. Moisture Std. Dev. NM1 19.4 18.9 14.9 15.2 10.9 13.9 15.5 3.2 NM2 19.0 18.1 15.1 13.5 10.8 14.9 15.2 3.0 NM3 17.3 19.2 16.4 15.1 11.2 14.8 15.7 2.7 NM4 18.3 19.1 16.1 15.1 11.3 14.8 15.8 2.8 NM5 18.9 18.4 17.7 15.8 11.5 13.8 16.0 2.9 NM6 16.7 18.0 14.0 13.9 10.3 11.7 14.1 2.9 NM7 18.8 16.8 16.1 14.1 12.2 12.5 15.1 2.6 NM8 19.0 18.5 18.1 14.5 11.6 14.0 16.0 3.0 NM9 17.6 20.4 14.2 13.4 11.3 11.6 14.8 3.6 NM10 16.2 17.2 14.8 13.3 11.4 11.9 14.1 2.3 NM = netted wood chips

PAGE 50

50 Table 2 1 1 Average moisture of wood chips in 2011 in days post chipping indoors under netting. Treatment 14 29 Avg. Moisture Std. Dev. NM1 13.2 9.5 11.4 2.6 NM2 11.2 10.5 10.9 0.5 NM3 12.0 10.3 11.2 1.2 NM4 15.6 10.1 12.9 3.9 NM5 19.7 11.8 15.8 5.6 NM6 36.2 10.1 23.2 18.5 NM7 10.4 8.9 9.7 1.1 NM8 26.6 9.0 17.8 12.4 NM9 32.0 13.6 22.8 13.0 NM10 20.7 13.1 16.9 5.4 NM = netted wood chips

PAGE 51

51 Figure 2 1. Beetle emergence from non chipped bolts from August 2010 to January 2011 X affinis and X volvulus are species that are time consuming to differentiate therefore their numbers were combined. 0 50 100 150 200 250 300 350 400 No. of beetles Date X. glabratus X. crassiusculus X. saxeseni X.affinis/volvulus Other

PAGE 52

52 Figure 2 2. Xyleborus glabratus emergence and bolt moisture. Beetle emergence from non chipped bolts was not correlated to bolt moisture, y = 0.1 33x + 0.175, r 2 = 0.064. 0 10 20 30 40 50 60 70 0.0 20.0 40.0 60.0 80.0 100.0 120.0 Emergence Moisture

PAGE 53

53 Figure 2 3. Xyleborus glabratus emergence and daily temperature. Beetle emergence from non chipped bolts, y = 0.9467x 3.502, r 2 = 0.123. 0 10 20 30 40 50 60 70 0 5 10 15 20 25 30 35 Beetle Emergence Temperature C

PAGE 54

54 Figure 2 4. Xyleborus glabratus emergence from July 2010 through January 2011 y = 9.6537x + 177.66 r 2 = 0.698 0 20 40 60 80 100 120 140 160 180 200 0 2 4 6 8 10 12 14 16 18 20 Beetel Emergence Weeks Since Chipping

PAGE 55

55 Figure 2 5 Temperatures of wood chip in piles and bins, in full sun, shade and under tarps Temperature probe s were placed in the center of each treatment 20 25 30 35 40 45 50 55 60 65 70 27/05/2011 27/05/2011 28/05/2011 29/05/2011 30/05/2011 30/05/2011 31/05/2011 1/6/2011 2/6/2011 2/6/2011 3/6/2011 4/6/2011 5/6/2011 5/6/2011 6/6/2011 7/6/2011 8/6/2011 8/6/2011 9/6/2011 10/6/2011 11/6/2011 11/6/2011 12/6/2011 13/06/2011 14/06/2011 14/06/2011 15/06/2011 16/06/2011 Temperature C Date Bin Sun Bin Shade Tarp Sun Tarp Shade

PAGE 56

56 Figure 2 6 Temperature and moisture of wood chips (Inside bin measurements) This graph represents the c hange in wood chip moisture in relation to the temperature at the center of the wood chip piles 0 10 20 30 40 50 60 30 35 40 45 50 55 60 65 27-May-11 29-May-11 31-May-11 2-Jun-11 4-Jun-11 6-Jun-11 8-Jun-11 10-Jun-11 Moisture Temperature Date Temperature Moisture

PAGE 57

57 Figure 2 7 Xyleborus glabratus multifunel trap catches from 14 July 2010 21 July 2011. Beetles were captured in manuka oil baited six tier multifunnel traps at ACMF. Asterisks indicate when chipping occurred during both summers 0 20 40 60 80 100 120 140 14-Jul 4-Aug 25-Aug 15-Sep 6-Oct 27-Oct 17-Nov 8-Dec 29-Dec 19-Jan 9-Feb 2-Mar 23-Mar 13-Apr 4-May 25-May 15-Jun 6-Jul Emergence No. Collection Dates

PAGE 58

58 CHAPTER 3 EFFECT OF TEMPERATURE ON GROWTH AND VIABILITY OF RAFFAELEA LAURICOLA Introduction The Kingdom Fungi is estimated to contain 5.1 million species (Blackwell 2011) which occur in all ecosystems, from deep sea vents to the Antarctic ( Ruisi et al. 2007, Le Calvez et al. 2009 ). Despite increasing knowledge of fungal diversity in surprising habitats, endophytes (fungal organisms living within plants) represent a potentially large pool of undescribed fungal species (Hawkswo rth 2001, Arnold et al. 2007). Endophytes can occur across broad regions or occur only inside individual host species and possibly for short periods of time (Arnold 2007, Pirttil and Frank 2011 ) Since the 1960s, endopyhytes have been found occurring as hotspots of tropical biodiversity ( Cooney and Emerson 1964, Arnold 2007), an d have been investigated for their role in plant health and more recently, for their ecological (Clay and Holah 1999) and physiological roles (Sc ott 2001, Rudgers et al. 2006). Endophytes occupy a niche within the leaves, roots, or wood of plants (Wilson 1995, Arnold et al. 2000, Hawksworth 2001). E ndophytes that occur within woody tissue presumably exist in a fairly stable dark environment that does not differ greatly from the s urrounding air temperature. Since plants can grow in extreme temperature conditions, from polar regions to deserts, it is likely that endophytes of plants in those environments have similar temperature tolerances. Not surprising then, yeasts have been do cumented to grow from 0 to 37 C (van Uden 1984) while optimum growth of Neurospora crassa is at 36 C and it remains viable from 3 to 44 C (Cooney and Emerson 1964).

PAGE 59

59 Maximum photosynthetic activity for most plants occurs between 20 35 C and declines below and above those temperatures ( Kozlowski and Pallardy 1997 ). The optimum temperature for vegetative growth may be similar for endophytic fungi, based on sapwood temperature s When Acacia sp. trees were monitored for sap flow, it was found that air temperatures fluctuated between 15 29 C while sapwood temperatures were always higher, ranging from 18 31 C ( Do and Rocheteau 2002). In a study in TN, two species of oak ( Quercus alba and Q. prinus ) and red maple ( Acer rubrum ) were monitored for sap flow, respiration and sapwood temperature. Their stem temperature data indicated that south sides of trees were hotter than north sides while daily air temperatures ranged from 2 to 26 C and sapwood temperatures ranged from 5 and 30 C (Edwards and Han son 1996). As for the growth of pathogens and saprophytes in relation to temperature, Aspergillus fumigatus was grown for a period of two weeks between 4 and 30 C. Growth did not occur at 4 C, but the fungus grew more as heat increased with maximum grow th at 30 C ( Pasanen et al. 1991). In another study using Aspergillus and Penicillium optimum growth was between 24 and 40 C while maximum observed heat tolerance was between 38 and 53 C (Ayerst 1969). The optimum growth of Ophiostoma novo ulmi ca usal agent of Dutch elm disease was between 20 and 22 C and the non aggressive O. ulmi had its optimum growth between 27.5 and 30 C (Bra s i er et al. 1981). At 32 C, the causal agent of oak wilt ( Ceratocystis fagacerum ) was characterized by having reduce d hyphal growth (Appel 1995). The study reported here is part of a larger investigation into the fungal biology of Raffaelea lauricola causal agent of laurel wilt (LW) and a native of southeast Asia,

PAGE 60

60 which was positively identified in 2008 (Fraedrich et a l. 2008). Epidemic levels of redbay tree mortality were found in coastal Georgia, likely indicating that LW has been in the southeastern USA since at least 2002 R. lauricola is carried by the redbay ambrosia beetle ( Xyleborus glabratus ) in their mandibu lar mycangia and used as the sole source of nutrition by the adults and larvae in the galleries the beetles create in trees ( Fraedrich et al. 2008 ) In North America, X glabratus vectors R. lauricola to trees, which kills them within a matter of weeks R. lauricola has been recovered from dead trees in excess of 11 months (Spence unpublished). Unfortunately, humans are moving wood infested with R. lauricola and X. glabratus throughout the southeastern U.S. (Riggins et al. 2010) and it is likely that thi s disease will spread into other parts of the country where susceptible hosts exist, from the sub tropical south to the northe rn edge of the temperate biome. Since all native and some ornamental North American Lauraceae species are susceptible to R. lauric ola including the important economic agricultural crop of avocado ( Persea americana ) (Mayfield et al. 2009, Ploetz et al. 2011 ) limiting the spread of this disease is an important goal The objectives of this study were to 1) test growth of R. lauricola at a wide range of temperatures to identify its thermal metabolic limit, 2) evaluate viability of R. lauricola from infected wood following exposure to a range of temperatures, and 3) explore the ambient sapwood temperatures of living and dead redbay trees Materials and Methods In Vitro G rowth of R. lauricola at Different T emperatures Pure cultures of R. lauricola recovered from sapwood of a LW infected redbay tree (isolate PL57; GenBank Accession # JQ861956.1) were grown on cyclohexamide

PAGE 61

61 streptomycin malt agar (CSMA) (Harrington 1981) with antibacterial amendments. The CSMA amendments were the addition of 350 mg of a DMSO mixture, hereafter, we refer to this medium as CSMA++ (Ploetz et al. 201 1). Once there was at least 4 cm of mycelia growth on the CSMA++ plates, single 5 mm agar and mycelium plugs were placed upside down on malt extract agar (MEA) (34 g of Difco malt extra agar and 4 g of agar/1 L of ddH 2 O), sealed in individual growth chamb ers and placed in a dark incubator at varying temperatures. Growth was measured after 10 days of exposure to 7, 10, 15, 20, 24, 25, 28, 30, 33.5, 35 and 47 C. For each treatment there were ten sealed and separated replicates. Radial growth was measure d in two directions, at right angles from each other, from the edge of the agar plug to the outer edge of myceliu m. After each temperature trial, plates were transferred to a dark incubator set at 25 C to determine the extent that R. lauricola can grow wh en returned to a more optimum temperature. Plates were left in the 25 C incubator for ten additional days; mycelial growth was measured as noted above. Three incubators were used during these studies. All cultures that were assessed at 25 C were placed in a Fisher Scientific bench top incubator (Isotemp Model 637D). For cultures exposed to 10, 15 and 20 C a Conviron Adaptis (model A1000) was used and for 28, 30, 33.5, 35 and 47 C assays, a Precision Scientific Forced Air Incubator (mode l 6M 31487) was used. All cultures were grown in the dark except for one 24 C trial that was left in continuous light. For this trial,2 0 agar plugs of R. lauricola were placed on MEA for 10 days where ten plates were left in 24 hrs. of light and ten kep t in comple te darkness at room temperature at 24 C. For the final

PAGE 62

62 comparison, growth of R. lauricola on MEA was compared to the growth of R. lauricola on CSMA ++ at 25 C for 10 days. In addition to assessing the growth of R. lauricola on media at differe nt temperatures, f ive sapwood cores (3 x 6 mm) from R. lauricola colonized wood were taken from each of five bolts (10 x 7 cm) for two temperature treatments. Ten w ood cores were extracted from all bolts and placed on CSMA++ to confirm the presence of the pathogen, which were kept at 2 5 C Five bolts were then exposed to 33 and five to 35 C for ten days. After ten days, five more cores were taken from each of the bolts and placed on CSMA++ at 2 5 C to ascertain viability of R. lauricola Temperature of Infected and Healthy Redbay T rees Data on the in vitro growth of R. lauricola may help determine the optimum growth conditions for the fungus within tree s However, growth on artificial medium may not approximate conditions in the tree and may allow fo r greater temperature tolerance. Thus, temperature profiles of redbay trees were also assessed in vivo Sapwood temperatures of living and dead redbay trees, which were killed by LW, were measured to identify the daily fluctuations that occur. Thermocouple data loggers ( CAS Data Loggers, Chesterland, Ohio ) were used to record sapwood temperatures of redbay trees on private property in South Daytona, FL. Each tree had a 3 mm hole drilled 10 cm deep into the trees at 1 meter above ground level Each time a data logger was placed in a tree, the space around the probe was sealed with standard window caulk to k eep out moisture and limit air flow around the probe tip. Data loggers were left in place for four days and for one week on three different occasions. All measurements were taken in March and April 2012.

PAGE 63

63 For the first trial, probes were placed in three li ving trees and two dead trees. Outside air temperatures were not recorded. In the second trial, one probe was installed into the sapwood o f living and dead tree s while a partner probe was left outside the hole of each tree exposed to the air around the tree. The probe recording air temp erature was placed next to the bark on the north side of the tree to keep it in full shade during the day. This set up was used for two dead and one living trees. The final sapwood temperature measurement was taken from a single large redbay tree (53 cm DBH) where two probes were placed inside the tree on the northeast and northwest sides of the tree. Each probe had a companion probe to monitor the air temperature. The outside probes were placed against the trunk so th at they were in constant shade. Statistical A nalyses O ne way ANOVA s were used to determine if the in vitro growth of R. lauricola was different at ten different temperatures and used to determine if the growth of R. lauricola from wood cores at to 33 and 35 C were statistically different from wood cores grown at 25 C. An alpha level of 0.05 and a post hoc means comparison was Results In Vitro G rowth of R. lauricola at Different T emperatures There was a significant effect of temperature on mean 10 day growth of R. lauricola on MEA (F = 143.71, df= 23 P<0.001), Fig ure 3 1. After ten days, growth of R. lauricola was greatest at 28 C (mean growth = 12.5 mm). R. lauricola also grew at 24 (dark), 25, 30 and 32 C (mean growth of = 10.1. 11, 6.7 and 2.1 mm, respectively). R. lauricola showed no initial growth at 10, 15, 20, 33.5, 35 and 47 C.

PAGE 64

64 After the initial exposures at 7, 10 15 20, 28, 30, 32, 33.5, 35 and 47 C all plates were transferred to 25 C for an additional 10 days. The regrowth of R. lauricola at 25 C occurred for all temperatures except 47 C Figure 3 1. An interesting observation was that R. lauricola on CSMA++ grew statistically more than R. lauricola on MEA ( F (1,18) = 168.35, P < 0.0001 ) Growth of R. lauricola from LW infested bolts showed declining growth at 33 and 35 C when compared to growth at 25 C Figure 3 2 For the three temperature comparisons average growth of R. lauricola fro m wood plugs at 25 C was 21.9 mm After ten days wood plugs exposed to 33 C grew an average of 11.6 mm After ten days, wood plugs exposed to 35 C grew an average of 4. 5 mm at 2 5 C The difference between growth at the tree temperatures was statistically significant F (2,27), = 175.3 P < 0.0001 Temperature of Infected and Healthy R e dbay T rees For the first sapwood temperature measurement, three living and two dead redbay trees were monitored over the same eight days. The maximum temperatur e reached for the living trees was 29.5 C while the maximum temperature for the dead trees was 30.5 C. T he living tree generally lagged behind the dead tree in its warming and cooling cycle each day Fig ure 3 3 The second sapwood measurement taken was f rom one living and two dead trees. The probes were left in the sapwood for four days. Living trees become hotter (mean daily maximum = 26.9 C) than the surrounding air (mean daily maximum = 25.6 C) and are also hotter than dead trees (mean daily maximum = 25.1 C), Figure 3 4 A

PAGE 65

65 review of the temperatures showed no obvious differences between the living, dead, and air temperatures For the third sapwood temperature test, the average internal sapwood temperature ( 24.3 C) of the 53 cm diameter redbay tree was much more stable than the average outside temperature (23.9 C), however they did not differ significantly F (1,826) = 0.45, P = 0.50 Fig ure 3 5 On April 4, the high temperature at the Daytona Beach, FL. airport was 33 C (wunderground.com), which was similar to the outside probe temperature which was 35 C on the same day Discussion Except for 47 C R. lauricola resumed growth after it was frozen and after it was heated in excess of 33.5 C And, for the temper atures where it did grow, growth was more vigorous 25 C, indicating that seasonal temperatures (hot or cold) will not reduce viability of this fungal pathogen. The only temperature tested where R. lauricola was killed was only at 47 o C. This sugges ts that IPPC heat treatments of wood, or pallets, might be sufficient to kill this pathogen In an early review of the biology of R. lauricola Harrington et al. (2008) measured the growth of the pathogen on malt extract agar (MEA) at three temp eratures, 10, 25 and 30 C. At 25 C the radiu s of the colonies averaged 30 m m while at 10 and 30 C, growth was less than 5 mm (Harrington et al. 2008). Their data for growth at 25 and 30 C produced similar results to our findings; however, the growt h they observed at 10 C was more than we observed, which was zero. Although seasonal fluctuations of sapwood temperatures were not fully evaluated here, the temperature profiles represent the period of time when X. glabratus is most

PAGE 66

66 active (Hanula et al. 200 8 ) and trees are expressing wilt symptoms and dying often in less than a week It is interesting that optimum growth in this study occurred at 28 C, which is similar to the maximum average sapwood temperature of living and dead re dbay trees, which was 24.7 C. It seems that when a redbay tree may be at its photosynthetic optimum, the fungus is also near a temperature that is optimal for its growth. For the other two tree pathogens that are classified as wilt diseases, R. lauricola was not all that dissimilar. The optimum temperature for in vitro growth of R. lauricola was slightly higher than species of Ophiostoma which cause Dutch elm disease (Brasier et al. 1981). Although the European and North American strains of O. novo ulmi had optimal in vitro growth at temperatures between 20 and 22 C. The thermal optimum of R. lauricola was more similar to the non aggressive O. ulmi which had its optimum growth between 27.5 and 30 C (Brasier et al. 1981). At 32 C, the causal agent o f oak wilt ( Ceratocystis fagace a rum ) exhibited reduced hyphal growth (Appel 1995). In another report on the tolerance of C fagace a rum temperatures between 30 35C reduced growth of the fungus in vitro (Lewis 1979, Tainter 1986). From a phytosanitation perspective, the LW pathogen, R. lauricola was killed at a temperature that was lower than temperatures that are recommended for wood treatment by the Food and Agriculture Org anization of the United Nations (FAO 2008 ). The FAO oversaw the implementation of International Plant Protection Convention (IPPC) that developed the International Standards for Phytosanitary Measures ISPM 15, which were revised in 1997. The current phytosanitary regulations for the heat treatmen t of pallets and other wood products calls for the wood products to be heated

PAGE 67

67 for a minimum of 30 minutes to reach a core temperature of 56 C (FAO 2008). Data from this study provides an initial assessment that R. lauricola might be eliminated from wood packing material if the wood products are heated to IPPC standards. As for low temperature tolerance of R. lauricola it appears that temperatures below freezing do not have a negative impact on the viability of R. lauricola The implication of this finding is that logs or trees infected with R. lauricola in northern temperate areas could remain colonized and that cold temperatures alone may not eliminate this pathogen from the environment. T he thermal tolerance of X. glabratus is unknown and what role it could play as vector in cooler temperate areas has not been tested.

PAGE 68

68 Figure 3 1. Growth of R. lauricola at varying temperatures 10 sealed petri dishes of R. lauricola were exposed to each temperature for 10 days. Solid bars represent the average growth of R. lauricola at specific temperatures h ashed bars represent R. lauricola re growth after b eing moved to 25 C measured after 10 days Letters represent homogenous subgroups determined by a Tukey HSD ( F = 143.71, df = 23, P < 0.001 ) 0 5 10 15 20 25 30 Growth in mm Varying temperatures Growth at initial temperature Growth when moved to 25 C B B A C D E C D A C C C D C D D E F D E F G D E F G E F G F G G H H H H H H H H

PAGE 69

69 Figure 3 2. Growth of R. lauricola from wood plugs at varying temperatures. F ive plugs from R. lauricola infested wood were taken from five bolts for each treatment and plated on MEA to confirm the presence of the pathogen, noted as 2 5 C Five bolts were exposed to 33 and 35 C for ten days. After ten days five more cores were taken from each of the five bolts and placed on MEA to ascertain viability of R. lauricola at 2 5 C growth was statistically different F (2,27), = 175.32. P < 0.0001, Letters represent homogenous subgroups determined by a Tukey HSD 0 5 10 15 20 25 25 C 33 to 25 C 35 to 25 C Growth in mm. Treatments A B C

PAGE 70

70 Figure 3 3. Internal temperatures of dead and living trees. Average internal sapwood temperatures measured from three living and teo dead redbay trees in Daytona Beach, FL Each tree had a probe inserted approximately 10 cm into the sapwood where temperature was recorded once an hour for 8 days 15.0 17.0 19.0 21.0 23.0 25.0 27.0 29.0 31.0 19-Mar-12 19-Mar-12 19-Mar-12 19-Mar-12 19-Mar-12 20-Mar-12 20-Mar-12 20-Mar-12 20-Mar-12 20-Mar-12 21-Mar-12 21-Mar-12 21-Mar-12 21-Mar-12 21-Mar-12 22-Mar-12 22-Mar-12 22-Mar-12 22-Mar-12 22-Mar-12 23-Mar-12 23-Mar-12 23-Mar-12 23-Mar-12 24-Mar-12 24-Mar-12 24-Mar-12 24-Mar-12 24-Mar-12 25-Mar-12 25-Mar-12 25-Mar-12 25-Mar-12 25-Mar-12 26-Mar-12 26-Mar-12 26-Mar-12 26-Mar-12 26-Mar-12 27-Mar-12 27-Mar-12 Temperature C Date AVG Dead AVG Living

PAGE 71

71 Figure 3 4. Internal sapwood temperatures of dead and living redbay trees vs. ambient air temperature. Average internal sapwood temperatures from one living and two dead trees and ambient air temperatures. Each tree had a probe inserted into the sapwood and a partner probe that was left exposed to shaded air on the north side of the tree. 15 17 19 21 23 25 27 29 31 33 11/4/2012 16:56 11/4/2012 19:56 11/4/2012 22:56 12/4/2012 1:56 12/4/2012 4:56 12/4/2012 7:56 12/4/2012 10:56 12/4/2012 13:56 12/4/2012 16:56 12/4/2012 19:56 12/4/2012 22:56 13/04/2012 01:56:43 13/04/2012 04:56:43 13/04/2012 07:56:43 13/04/2012 10:56:43 13/04/2012 13:56:43 13/04/2012 16:56:43 13/04/2012 19:56:43 13/04/2012 22:56:43 14/04/2012 01:56:43 14/04/2012 04:56:43 14/04/2012 07:56:43 14/04/2012 10:56:43 14/04/2012 13:56:43 14/04/2012 16:56:43 14/04/2012 19:56:43 14/04/2012 22:56:43 15/04/2012 01:56:43 Temperature C Date Avg. Inside Dead Avg. Inside Living Avg. Outside

PAGE 72

72 Figure 3 5. Internal and external temperatures from one large redbay tree. Two probes were in the northwest side. Each probe had a partner probe that was left just outside the bark and situated so it would not be exposed to full sun and record air temperature. 15 20 25 30 35 1/4/2012 1:38 1/4/2012 8:38 1/4/2012 15:38 1/4/2012 22:38 2/4/2012 5:38 2/4/2012 12:38 2/4/2012 19:38 3/4/2012 2:38 3/4/2012 9:38 3/4/2012 16:38 3/4/2012 23:38 4/4/2012 6:38 4/4/2012 13:38 4/4/2012 20:38 5/4/2012 3:38 5/4/2012 10:38 5/4/2012 17:38 6/4/2012 0:38 6/4/2012 7:38 6/4/2012 14:38 6/4/2012 21:38 7/4/2012 4:38 Temperature C Date Inside C Outside C

PAGE 73

73 CHAPTER 4 PERSISTENCE AND DISTRIBUTION OF RAFFAELEA LAURICOLA IN DEAD, STANDING REDBAY TREES ( PERSEA BORBONIA ) Introduction Fungi occur in a wide variety of niches, on and in building material (Jellison et al. 1997, Schirra et al. 2000), as saprophytes (Sc hirra et al. 2000, Zuccaro et al. 2011), pathogens (Mendgen and Hahn 2002, Lowe and Howlett 2012), and as endophytes inside many species of plants (Arnold et al. 2003, Ge nnaro et al. 2003, Scott 2011) competing for space and nutrients (Glass and Kuldau 19 92). Fungal succession and persistence are determined by many factors including nutrient availability, competition, and their interaction with insects (Paine et al. 1997, Hyde and Jones 2002, Suzuki 2002, Rollins et al. 2001, Hyde and Soytong 2008). Funga l succession, like plant succession (Noble and Slayter 1980, van der Valk 1992), can occur in a linear replacement pattern, through broad seral steps, or through competition or interference (Frankland 1998, Boddy 2001, Fukasawa 2009). Fungi, like plants and animals, might also create an environment better suited for later successional species; ultimately displacing the pioneer (Jellison et al. 1 997, Frankland 1998, Boddy 2001, Xu and Gordon 2003) In part, this study explores the species present inside li ving and dead redbay trees ( Persea borbonia ), which are termed endophytes. Endophytes are fungi that can persist as latent pathogens or saprophytes, waiting for the right environmental conditions to grow and exploit the host. The biology of endophytes ha s not been precisely determined (Saikkonen 2007, Hyde and Soytong 2008 ), but it is known that s ome endophytes persist within an asymptomatic host for long periods of time and decline as the tree declines (ref) Others gain entry into in a tree, persist

PAGE 74

74 a symptomatically but then actively grow as tree health declines, either through natural senescence or one mediated by disease (Oses et al. 2008, Parfitt et al. 2010 ). Endophytes may also gain entry into the woody stems of a plant through horizontal transmis sion, where fungi may occur on bark and are then incorporated into the sapwood over time, or they could gain access through lenticels and other natural openings or wounds (Saikkonen 20 07, Chaverri and Gazis 2011). Some endophytic fungi can enter trees wit h the help of bark or ambrosia beetles (Batra 1966, Goheen and Hansen 1993, Hulcr et al. 2007). Introduction of a fungus into a tree by an insect usually occurs when trees are in a state of decline or dead (Hulcr et al. 2007, Hulcr and D unn 2011, Six and Wingfield 2011. In some cases, fungi are passively transmitted by insects while some ambrosia beetles for example, have specialized sacs for carrying fungi which are then deposited inside trees for the beetles to eat In addition to being food for beet les, these fungi may be able to grow as saprophytes, aid ing in the decomposition of the tree (Rollins et al 2001, Henriques et al. 2006). When ambrosia beetles occur within their native range they tend to go unnoticed without posin g problems to healthy tr ees when they do appear outside of their natural range they can significantly damage naive hosts In the southea stern coastal plain of the USA, a new tree disease called laurel wilt (LW) has been identified. The disease is caused by the boring activity of the exotic redbay ambrosia beetle (Xyleborus glabratus ) and the host response to the deposition of its fungal symbiont, Raffaelea lauricola The fungus is causing significant mortality to trees in the Lauraceae (Fraedrich et al. 2007, Fraedrich et al. 2008, Hanula et al. 2008, Mayfield et al. 2008). Both the beetle and its

PAGE 75

75 fungus are Asian in origin (Rabaglia 2008, Harrington et al. 2011) The beetle was first found in the Savannah GA area in 2003; its method of introduction is unknown Because of its ability to kill or facilitate the death of trees (Hulcr and Dunn 2011), R. lauricola is classified as a pathogen, however the mechanisms by which it causes hosts to wilt and die are apparently different from other wilt pathogens such as Fusarium and Verti cillium (Agrios 2005 ). Due to a lack of direct evidence, it is thought that Lauraceous hosts are to over react ing to the presence of R. lauricola ultimately killing themselves in the p rocess ( Hulcr and Dunn 2012 ). Like many plant pathogens, R. lauricola must be able to persist as a saprophyte, to some degree, to acquire nutrients for it to survive while it exists as food for X. glabratus To date, no studies have evaluated the persistence and distribution of R. lauricola with in LW killed redbay trees The p hysical changes that take place in wood over time (i.e. moisture) and resource competition (fungal competitors) are two factors that may regulate the persistence of R. lauricola inside dead standing trees. Redbay is a ubiquitous species in coast al ec osystems in the southeast, however, there are no published papers regarding the endophytic constituents of these trees and no clue as to what role these endophytes might play in determining how long R. lauricola can persist inside a dead standing tree. Un d erstanding how long R. lauricola can persist as a saprophyte, how extensively it colonizes dead sapwood and an enumeration of fungal competitors would be useful for better understanding the epidemiology of LW and may help improve efforts to manage the dise ase through sanitation strategies. This study focused on the following fou r objectives: 1) evaluation of R. lauricola persistence inside dead standing

PAGE 76

76 redbay trees, 2) identification of fungal endophytes from diseased and healthy trees, 3) assessment of R ability to grow as a saprophyte in vitro and 4) determination of the spatial distribution of R. lauricola in sapwood of infected trees Materials and Methods Twenty six redbay trees ( Persea borbonia ) were evaluated from January 2011 to July 2012 in Washington Oaks Garden State Park, FL. The park covers 425 acres on a barrier island in Flagler County, FL. The study trees occurred in a typical maritime hammock (Spence et al. 1998) dominated by live oak ( Quercus virginiana ), pignut hickory ( C arya glabra ), southern magnolia ( Magnolia grandiflora ) and southern red cedar ( Juniperus virginiana ) with an understory of redbay ( Persea borbonia ) and yaupon holly ( Ilex vomitoria ). Study trees had a DBH ( diameter at breast height, measured at 1.3 m abov e grade) that range d from 6.4 to 24 cm. Trees were evaluated using a subjective disease rating scale at each visit until each tree died. The rating scale was based on crown wilt symptoms and ranged from 0 4, where 4 represented a dead tree and 0 was an asymptomatic tree. Of the 26 trees ten were dissected and fourteen were regularly visited to determine how long R. lauricola would persist in wood tissue. Two trees were dropped over the course of the study, one because it never died and two because th ey fell over. Persistence of R. lauricola in Standing T rees Over the course of the 1 8 month study, eleven trunk cores were taken from each of the thirteen trees used for the R. lauricola persistence study Sapwood cores (15 x 5 mm) were collected using an increment hammer (Haglf Sweden) to test for the presence of the pat hogen at the start of the study Two samples were collected at 2 m and two samples from 30 cm above natural grade, one from each side of the tree. The

PAGE 77

77 head of the increment hammer was rinsed with 70% ethanol between samples for each tree. Samples were placed in separate vials and were kept in a cooler for transport back to the laboratory. Sapwood core samples were cut into 4 or 5 smaller fragments (approximately 2 x 3 mm in size) and surface sterilized for 60 seconds in 70% ethanol and rinsed in ddH 2 O for 60 seconds. Wood fragments were placed on cyclohexamide streptomycin malt agar (CSMA), a semi selective medium for ophiostomatoid fung i (Harrington 1981), with antibacterial amendments. The CSMA amendments were the addition of 350 mg of L of a 9 mg RifAmp DMSO mixture, hereafter; we refer to this medium as CSMA++ (Ploetz et al. 2011). All plate s were kept under diurnal conditions Samples were evaluated for the presence or absence of R. lauricola after ten days and determinations were made based on morphology. Tree Sapwood M oisture Over the course of the study, seven moisture readings were taken from each tree at 1.5 meters above grade. Moisture was recorded from three points around the stem, evenly spaced and taken along the vertical axis of the tree. On trees with thick outer bar k, readings were taken between bark plates. The electrode needles were inserted approximately 1 cm into the sapwood. Moisture readings were taken with a Protimeter Timbermaster (General Electric Corporation, Shannon, Ireland). Potential R. lauricola C ompetitors One of the upper and one lower sapwood cores that were used to track the persistence of R. lauricola was surface sterilized as noted above and plated on 2% malt extract agar (MEA) Fungi with unique morphological characteristics (morphotypes) w ere subcultured and stored on slants at 80 C until the DNA was extract ed

PAGE 78

78 Twenty four of the twenty six trees were alive at the first sampling event in March of 2011, t rees 24 and 25 died in February of 2011. The second set of wood cores were taken in m id April 2011 where eight additional trees had died, leaving twelve samples from asymptomatic trees. To assess the taxonomic groups of fungi present in the wood cores, nuclear DNA was extracted from subcultures using the method Justesen et al. (2002) with the addition of proteinase K. The small subunit (18s) rDNA was amplified via PCR using the GTAGTCATATGCTTGTCTC CTTCCGTCAATTCCTTTAAG (ITS) was amplified using primers I master mix containing 12.5 of Amplitaq Gold (Applied BioSystems, Foster City, CA.), 9.5 of ddH2O, 1 of template DNA, plus 1 of each primer was used. A MJ Research, PTC 200 Peltier thermocycler was used for PCR with the following cycling conditions: 95 C for 6 minutes then 40 cycles of 95 C for one min., 48 C for 30 sec. and 72 C for two minutes for DNA extension. ExoSAPit ( Affymetrix, Inc, USB Products, Santa Clara, CA) was used to purify the amplicon which was then sent to the Research for Sanger sequencing. Assessment of Saprophytic C apability of R. lauricola To evaluate the ability of R. lauricola to grow as a saprophyte, agar plugs containing R. lauricola from a symptomatic redbay (strain PL1235; GenBank Accession # HM446155) were placed on 20 wood chips and 20 wood disks. The wood disks were appro ximately 5 cm in diameter and between 1 and 2 cm thick. Ten w ood disks were

PAGE 79

79 from a non LW colonized tree and 10 were from a tree tha t died from LW within t hree months of this study; wood disks for both studies were collected from Washington Oaks Garden St ate Park, FL. 3 days before the study Wood chips used for this study were from redbay trees that died from LW approximately one year prior to this study R. lauricola was no longer alive in these wood chips To make the wood chips, d ead redbay trees were chipped were using a standard arborist wood chippe r, ( Vermeer model BC 935 ) average wood ch ip size was 2.2 x 1.7 cm. Prior to the pl acement of the agar plugs on each of the treatments, 10 wood chips were soaked in ddH 2 O for three day s and ten were not. All twenty wood disks were also soaked in ddH 2 O for three days The wood chips and disks were soaked in ddH 2 O in an attempt to make the moisture content of each treatment as even as possible 10 wood chips were not soaked in water. All wood chips and disks were autoclaved and cooled to room temperature before the agar plugs were placed on them. The moisture content of each wood sample was recorded after they were autoclaved but before agar plugs were placed on them. Single, 5 mm pl ugs of R. lauricola were placed on ten autoclaved non LW infected disks, ten autoclaved LW infected disks, and on ten autoclaved and once LW infected wood chips (4 x 3 cm 2 ). The mycelia side of the agar plug was placed against the wood for all s amples whi ch were then placed in glass petri dishes and sealed with Parafilm. Plugs of R. lauricola were grown on 2% malt extract agar as a positive control. The growth of each culture was evaluated after two weeks for the presence mycelium or changes in wood colo r or moisture, which might indicate fungal penetration of wood tissue. All samples were kept at room temperatu re (24 C) under diurnal conditions

PAGE 80

80 To confirm the presence of R. lauricola after 10 days, agar plugs were removed from wood samples and sections of wood were excavated from below the area of the agar plug since this was the area where R. lauricola would have likely first penetrated into the wood. Excavate d wood samples were pla ced on MEA for 10 days. Cultures that morphologically matched R. lauricola were then used for molecular identification. DNA was extracted from the cultures using the same procedures described previously. PCR with semi specific LW primers ( AACGCGTC AAAAGACAACAG TTCTAGGACCGCCGTAATG sequence of SSU rDNA of R. lauricola (Dreaden et al. 2008). Five L of PCR amplicons, 1 L of loading buffer and 0.5 L of SYBR Green per sample were visualized on a 1. 5% agarose gel. The presence or absence of the amplicon was used as the criterion to determine if samples were positive for R. lauricola Distribution of R. lauricola in Standing R ed bay T rees Ten redbay trees were felled and dissected to identify which po rtions (trunk, branches, twigs, or leaves) of the tree colonized by R. lauricola Samples were taken at 30 cm above grade and approximately every 1. 5 2 m above the basal sample. Since redbay is not a dominant canopy tree, the trees were often leaning t owards light or had multiple leaders towards the apex. Samples were collected as evenly as possible based on the branching architecture of the tree. In addition to trunk samples, samples were collected from scaffolding and lateral branches and from twigs and leaves at the outer edges of the canopy. Samples were put in sealed bags and kept in a cool container and transported back to the Forest Pathology Laboratory at the University of Florida. Each trunk sample was dissected such that three grou ps of subs amples were collected from the outer,

PAGE 81

81 inner and middle region of the sapwood, Figure 4 1 Wood samples were cut into small bits (1 x 1 cm) where the o uter sapwood samples were collected from just below the vascular cambium and inner samples were collected from the center of the sample. Middle samples were collected half way between the inner and outer samples. For branch samples, just the outer sapwoo d below the cambium was used and the center of the branch for the inner sample. Wood samples were processed, stored, and evaluated as described above for R. lauricola persistence. For all samples, wood sections with beetle galleries were avoided. The confirmation of R. lauricola was based on morphology except for two trees. PCR using NS1/NS4 primers (procedure as noted above) was used to positively identify putative R. lauricola isolates from those two trees as well as several unique endophytes t hat w ere cultured at the same time Statistical A nalysis A one way ANOVA was used to identify differences in moisture content in redbay trunks over the length of the study, differences in moisture content of wood samples used for the saprophytic ability of R. lauricola and the proportion of the occurrence of R. lauricola from different areas of the stem. When differences were found a Tukey HSD comparison of means was used to determine which treatment groups differed from one another. An alpha level o f 0.05 was used for all tests. Results Thirteen of the 26 redbay trees were tracked for the persistence of R. lauricola while ten trees were dissected to determine where R. lauricola occurs in the stem of the trees three trees were dropped from the study T able 4 1 Tree 5 in this study never

PAGE 82

82 succumbed to the disease. After five months of taking samples, this tree was dropped from the study. Trees 10 and 19 had significant cavities which led to portions of the tree falling over ; these trees were not disse cted or tracked for the persistence of R. lauricola due to their deteriorated condition, however, wood cores were collected for the endophytic assay. Persistence of R. lauricola in Standing T rees Over the course of the 1 8 month study, R. lauricola disappeared in six of the thirteen trees For three trees ( 12, 15, and 21) the fungus disappeared after 1 4 months, Table 4 1 Seven trees were found to have R. lauricola in the outer sapwood for eight months where the fungus finally disappeared after 1 2 months (trees 1, 2, 6, 9, 11, 13 and 14). Tree 25 was the first tree to begin to wilt in February of 2011. This tree was cut down and dissected in August of 2011 since R. lauricola had not been detected in the outer sapwood since May of 2011. When thi s tree was dissected in August of 2011, R. lauricola was found to be present in wood that was dissected from inner sapwood. Due to time constraints, the study was ended before the ultimate longevity of R. lauricola in sapwood was determined for all the samples Tree sapwood moisture Moisture fluctuate d over time, likely tied to rainfall, which was not recorded. The overall trend showed that there was a decline in moisture over time; however, the decline was not linear since some measurements showed that dead trees can soak up water in high hum idity or from rainfall Figure 4 2 The relationship between survey date, moisture and disease rating were significant yielding ANOVAs of F (4,120), = 8.93 P < 0.001 and F (4,120), = 3.40 P <

PAGE 83

83 0.011), respectfully These data reaffirm the understanding that dead and dying trees will not have as much moisture in the outer sapwood as living trees Potential R. lauricola C ompetitors Eighty one fungal morphotypes were sub cultured and grown as pure cultures. In total 4 6 isolates were identified either using NS1 4 or ITS1 4 primers. Of the 4 6 isolates, 20 unique fungi were identified through sequence comparison to Genbank ( http://www.ncbi.nlm.nih.gov/genbank/ ) Table 4 2 A number of studies suggest that endophytes of woody plants are rather loosely associated with their hosts, with a higher correlation between endophyte communities in a specific location rather than with a specific host in different locations (Arnold et al 2003 Saikkonen 2007 ). The species identified in these redbay trees represent species that are present in divergent plant families and from distant places on the planet. DNA from t welve samples were not identified to the genera level and are reported a s fungal endophyte or funal species based on the Genbank blast information All but four of the 46 isolates were from the Ascomycota, where there were 14 r epresentatives from the S ordariomycetes, 6 from the Eurotiomycetes and 5 from the Dothideomycetes. The four remaining isolates were from the Mucorales, representing two species Umbelopsis isabellina and Grongronella butleri Zone lines were observed in wood core indicating that species of B asid i omyc etes were present inside the trees, however, this group of fungi did not grow out of our wood plugs allowing us to identify them. Assessment of Saprophytic C apability of R. lauricola Tests of the saprophytic ability of R. lauricola yielded mixed results. The pathogen was recovered from seven of the 10 wood chip s that had been soaked in water. None of the non soaked wood chips produced R. lauricola Interestingly, the

PAGE 84

84 agar plugs placed on the non soaked wood chips shrived up and fell off, indicating that R. l auricola is not likely to colonize dry wood, like heat treated pallets R. lauricola did not grow from any of the samples from the LW infec ted or non LW infected disks. However, all 10 of the non LW disks had a white mycelia mat covering some portion of the disk. All attempts to gr ow this fungus on MEA failed. A ll of the positive controls yielded R. lauricola on MEA. The mean moisture content of LW colonized disks was 42.8 % (with a range of 40.4 to 50%); non LW colonized disks was 32.7% (with a range of 26.8 to 36.2%) for the water soaked wood chips it was 34.2 % (w ith a range of 26.4 to 44.6) and for the non water soaked wood chips the mean moisture content was 9.45 % (with a range of 7 to 1 3 ). The means of each treatment were statistically different from one another between the wood chips and LW colonized disks being similar but the LW colonized disks being different ( F ( 3,36 ),= 142.05 P < 0.001 ) Figure 4 3. Saprophytic fungi have the ability to degrade cellulose as a means of nutrient acquisition, and t hrough the production of cellulolytic enzymes (Boddy 2001); fungi can persist in and on wood Since R. lauricola exists inside trees, it seems that R. laurico la should have the ability to breakdown cellulose to survive. W ood chips and disks should provide a suitable substrate for R. lauricola Standing dead trees do retain water for many months after they die (Figure 4 1). The average wood chip moisture from which R. lauricola was cultured from was 34%. In another test, 10 wood chips with a moisture content of 8% (with a range of 5 to 17 % ) were tested for the ability of R. lauricola to penetrate the wood chips Here, R. lauricola did not grow on wood chips at this

PAGE 85

85 moisture level at all ; in fact, the dry wood absorbed the moisture in the agar plug, causing it to shrivel. Distribution of R. lauricola in Standing Redbay T rees R. lauricola was recovered from the branches and trunks of all trees in the study. Ten dead redbay trees were dissected to evaluate the distribution of R. lauricola in the sapwood. R. lauricola was consistently recovered from outer sapwood (2 mm below the bark) of tree trunks and branches for all 10 trees, Fig ure 4 4 R. lauricola was cultured from as deep as 7 cm below the active vascular cambium in tree 20, 6 cm in tree 8 and 6.5 cm in tree 16. Forty seven percent of the samples produced R. lauricola from deeper than 2 cm in the stem a nd, 11% of the samples yielded R. lauricola from 5 cm or deeper in the stem. In contrast, R. lauricola was recovered from 92% of outer sapwood samples. Although R. lauricola has been recovered from roots, the pathogen was only cultured from the center (inner region) of one tree at 30 cm above grade (Tre e 17). Table 4 4 lists the proportion of samples that produced R. lauricola for all nine trees for each of the three sections of the tree. Location of recovery of R. lauricola in either the inner, middle or outer regions of the stems differed significantl y ( F (2,152), = 4.74 P = 0.0101 ) Figure 4 5 meaning that R. lauricola was more commonly cultured from the outer region of t he sapwood than inner regions. The pathogen was found equally in all portions of the tree both vertically and horizontally (radius data) and the pathogen was recovered from all trees in the study Due to the length of time between when the trees died and when samples were collected for dissection, none of the twigs or leaves yielded R. lauri cola

PAGE 86

86 Discussion Over the 1 8 months that samples were collected from the sapwood of redbay trees, R. lauricola was recovered from 100% of the trees for at least 6 months and for as long as 14 months From the thirteen trees that that were followed for the persistence of R. lauricola all but one ( tree 26 ) continued to support R. lauricola in their tissues through April 2012 At no time during the study was R. lauricola recovered from leaves or twigs from these trees; however it has been recovered from these tissues by the Forest Pathology Laboratory at the University of Florida This was not surprising since the leaves dry out quickly due to the wilt produced by the fungus. It also highlights that if samples were going to b e collected for a LW assay, leaves and twigs should be avoided. These data make it clear that R. lauricola has the ability to persist for approximately one year inside dead redbay trees. If the persistence of a species of fungi inside trees is dependent o n it symbiotic insect than as long as those insects continue to protect and cultivate them, the fungi are likely to persist for long periods of time (Biedermann and Taborsky 2011 ). Since R. lauricola is persisting inside dead trees, it is likely that it is due to the activity of X. glabratus And, X. glabratus is still being collected in low numbers in areas where the disease has killed most, if not all, suitable hosts (Hughes personal communication, Hanula et al. 2008 ). With R. lauricola and X. glabrat us persisting in forest stands for many years, other wood boring beetles will likely come into contact with R. lauricola These beetles may feed on the f ungi or acquire it passively. In south FL several species of xyleborini were found to be carrying R. lauricola in their mycangia (Ploetz unpublished).

PAGE 87

87 If saprophytic endophytes do play a role in the ultimate exclusion of R. lauricola it is not happening quickly. This study identified 46 unique fungal isolates that should be in completion with R. lauric ola ; however, it is not clear whether or not these organisms will play a role in the ultimate elimination of R. lauricola from trees. Of the endophytes that were identified, several species, such as Xylaria Pestalotiopsis and Botryosphaeria occurred in se veral trees. In addition to these commonly found fungal endophytes several had broad distributions occurring across broad geographic areas and across many divergent groups of plants. A few endophytes had a narrow range of plant associations; a Lecythop hora sp. was found in only one tree and in Genbank ( http://www.ncbi.nlm.nih.gov/nuccore/gu166485.1#feature_312192301 ) a publication noted it was associated with Changnienia amoena an orchid species from China. Byssochlamys nivea was another redbay endophyte that appeared in one tree but it is also a fungus that is associated with food spoilage. What factors will ultimately lead to the loss of R. lauricola from trees is unknown. Its disappearance could be due to lack of grooming o r attention from its beetle symbiont or the fungus could have been overrun by other endophytes (fungal or bacterial). Whether the ultimate loss of R. lauricola is due to autogenic (within system endophytic competition, displacement or interference) or all ogenic processes (external force such as moisture or temperature) was not explored in this study. It was demonstrated that R. lauricola has the ability to persist as a saprophyte on wood chips although it did not grow into the wood of the LW infected and n on LW disks. The only difference between the wood chips and the wood disks was age. The wood

PAGE 88

88 disks were used within 5 days of being field collected while the wood chips were a year old and had been stored in a mesh bag. It is likely that fungi and or ba cteria had already begun to break down the lignin and cellulose of the wood chips, making it easier for R. lauricola to colonize them. The exact role that moisture plays in the occupation of wood tissue by R. lauricola is not known. An attempt was made t o control the moisture content of the wood chips, non LW disks and LW disks at different levels. However, holding these wood samples at constant moisture after autoclaving was not achieved. Therefore, w e only tested wood chips with wood moisture greater than 25% and below 15%. R. lauricola did not grow on wood with moisture below 15%. Since R. lauricola has shown to be a fairly persistent resident inside dead redbay trees, it is likely that it is going to remain as a biotic component in south eastern for est syste ms for the foreseeable future. However a host range study showed that only the Lauraceae are susceptible to LW in Florida (Ploetz and Smith unpublished) so if R. lauricola is transferred to other species of trees by other beetles species it may not be as catastrophic as it has been for the L auraceae

PAGE 89

89 Table 4 1. Arrival dates and persistence of R. lauricola i nside standing dead redbay trees at Washington Oaks Garden State Park, Flagler County, FL. For each cell associated wi th a tree and a particular date, the percent of samples that produced a positive identification of R. lauricola are listed above the number of samples tested. The dates that trees were remove d and dissected are also noted. Tree No. 3 Jan 2011 27 Feb 2011 27 Mar 2011 18 Apr 2011 15 May 2011 15 Jun 2011 10 Jul 2011 9 Aug 2011 2 Oct 2012 22 Mar 2012 8 Jul 2012 1 0 (0/10) 0 (0/11) 0 (0/10) 0 (0/9) 0 (0/9) 0 (0/8) 20% (2/10) 75% (6/8) 0 (0/10) 57% (8/14) 0 (0/14) 2 0 (0/10) 0 (0/7) 0 (0/10) 0 (0/10) 0 (0/6) 0 (0/11) 50% (5/10) 50% (2/4) 36% (4/11) 46% (6/13) 2 5 % (2/8) 3 0 (0/12) 0 (0/14) 0 (0/12) 0 (0/12) 0 (0/9) 0 (0/9) 67% (6/9) 71% (5/7) 90% (9/10) Dissected on 14 Dec 4 0 (0/10) 0 (0/11) 0 (0/10) 0 (0/10) 0 (0/8) 0 (0/10) 100% (9/9) Tree dissected on 10 Aug 2011. 5 0 (0/10) 0 (0/10) 0 (0/10) 0 (0/11) 0 (0/8) Tree never died, stopped taking cores. 6 0 (0/9) 0 (0/12) 0 (0/13) 0 (0/11) 0 (0/7) 0 (1/11) 25% (2/8) 25% (1/5) 27% (3/11) 67% (6/9) 21% (3/14) 7 0 (0/9) 0 (0/11) 0 (0/9) 0 (0/11) 0 (0/10) 0.08% (1/12) 100% (8/8) 86% (6/7) 55% (6/11) Dissected on 14 Dec 8 0 (0/11) 0 (0/11) 0 (0/11) 0 (0/10) 0 (0/9) 10% (1/10) 75% (6/8) Tree dissected on 10 Aug 2011. 9 0 (0/10) 0 (0/13) 0 (0/10) 0 (0/13) 0 (0/10) 0 (0/9) 22% (2/9) 0 (0/7) 0 (0/11) 69% (9/13) 14% (2/14) 10 0 (0/10 0 (0/11) 75% (9/12) The tree fell over and was dropped from the study

PAGE 90

90 Table 4 1. Continued Tree No. 3 Jan 2011 27 Feb 2011 27 Mar 2011 18 Apr 2011 15 May 2011 15 Jun 2011 10 Jul 2011 9 Aug 2011 2 Oct 2012 22 Mar 2012 8 Jul 2012 11 0 (0/10) 0 (0/11) 0 (0/11) 0 (0/11) 0 (0/11) 0 (0/8) 10% (1/10) 63% (5/8) 36% (4/11) 36% (5/14) 15% (2/13) 12 0 (0/12) 0 (0/14) 0 (0/11) 45% (5/11) 50% (6/12) 64% (7/11) 33% (3/9) 38% (3/8) 58% (7/12) 58% (7/12) 0 (0/12) 13 0 (0/11) 0 (0/11) 0 (0/11) 0 (0/11) 0 (0/11) 0 (0/9) 50% (4/8) 63% (5/8) 73% (8/11) 21% (3/14) 0 (0/13) 14 0 (0/11) 0 (0/10) 0 (0/11) 0 (0/10) 0 (0/10) 0 (0/10) 33% (3/9) 86% (6/7) 36% (4/11) 18% (2/11) 0 (0/12) 15 0 (0/11) 0 (0/11) 0 (0/11) 79% (11/14) 42% (5/12) 42% (5/12) 50% (5/10) 100% (8/8) 42% (5/12) 67% (8/12) 14% ( 2/14 ) 16 0 (0/11) 0 (0/11) 0 (0/11) 77% (10/13) 17% (2/12) Tree dissected on 8 June 2011. 17 0 (0/10) 0 (0/14) 0 (0/10) 100% (13/13) 42% (5/12) 42% (5/12) Tree dissected on 1 July 2011. 18 0 (0/12) 0 (0/12) 0 (0/12) 100% (13/13) 100% (10/10) 90% (9/10) Tree dissected on 1 July 2011. 19 0 (0/11) 0 (0/11) 50% (6/12) The tree fell over and was dropped from the study 20 0 (0/10) 0 (0/10) 0 (0/10) 92% (12/13) 42% (5/12) Tree dissected on 8 June 2011. 21 0 (0/10) 0 (0/13) 0 (0/14) 100% (11/11) 29% (4/14) 40% (4/10) 70% (7/10) 50% (4/8) 20% (2/10) 0.06% (1/15) 0 (0/13)

PAGE 91

91 Table 4 1. Continued Tree No. 3 Jan 2011 27 Feb 2011 27 Mar 2011 18 Apr 2011 15 May 2011 15 Jun 2011 10 Jul 2011 9 Aug 2011 2 Oct 2012 22 Mar 2012 8 Jul 2012 22 0 (0/9) 0 (0/9) 0 (0/12) 0 (0/11) 0 (0/11) 0 (0/9) 0 (0/10) 56% (5/9) 0 (0/11) 21% (3/14) 58% (7/12) 23 0 (0/10) 0 (0/12) 0 (0/11) 64% (7/11) 50% (5/10) 18% (2/11) 25% (2/8) 71% (5/7) 36% (4/11) 37% (8/12) 27% (4/15) 24 0 (0/14) 40% (4/10) 45% (5/11) 58% (7/12) 17% (2/12) 0 (0/8) 0 (0/7) Tree dissected on 10 Aug 2011. 25 0 (0/10) 50% (5/10 ) 53% (8/15) 92% (12/13) 0 (0/12) 0 (0/11) 0 (0/9) Tree dissected on 10 Aug 2011. 26 0 (0/9) 0 (0/11) 0 (0/10 86% (12/14) 36% (5/14) 100% (11/11) 75% (6/8) 45% (5/11) 91% (10/11) 0 (0/14) 0 (0/13)

PAGE 92

92 Table 4 2. Endophytic fungi from redbay trees. Of the eighty one morphologically unique endophytes identified in culture, forty six were successfully sequenced using the 18s ribosomal small subunit Tree # Primers Genbank Accession # Species best match Max identity 19Ua1 NS1 4 AY315416.1| Xylaria sp. 407/407 (100%) 19Ua2 NS1 4 JN940801.1| Pestalotiopsis adusta 659/659 (100%) 8La NS1 4 JN941734.1| Elaphocordyceps ophioglossoides 766/766 (100%) 12La5 NS1 4 EU593767.1| Xylaria sp. 521/521 (100%) 3Ua1 NS1 4 JQ621878.1| Xylaria sp. 511/511 (100%) 19Ua2 ITS1 4 GQ154594.1| Phaeomoniella prunicola 394/404 (98%) 4Lb2 NS1 4 DQ195805.1| Pestalotiopsis disseminata 750/750 (100%) 17La NS1 4 FJ215705.1| Dothidotthia ramulicola 809/809 (100%) 4Ua ITS1 4 GQ154596.1| Phaeomoniella prunicola 352/357 (99%) 13Ub2* NS1 4 JN940801.1| Pestalotiopsis adusta 677/677 (100%) 4La1 ITS1 4 HQ630365.1| Umbelopsis isabellina 352/357 (99%) 19Ua2 ITS1 4 AB032070.1| Penicillium lagena 571/571 (100%) 19La1 NS1 4 AY190271.1| Sordariomycete sp. 737/745 (99%) 24Ua ITS1 4 JF440625.1| Umbelopsis isabellina 389/391 (99%) 6La2 NS1 4 JN938959.1| Penicillium corylophilum 556/556 (100%) 7Ua NS1 4 HQ878597.1| Jattaea discreta 774/776 (99%) 4La ITS1 4 GQ154596.1| Phaeomoniella prunicola 423/437 (97%) 18Ua NS1 4 DQ979498.1| Fungal endophyte 566/568 (99%) 13Ua NS1 4 AY190271.1| Sordariomycete sp. 492/494 (99%) 25Lb ITS1 4 GU187838.1| Uncultured fungus 403/403 (100%) 12Ua3 NS1 4 AY190271.1| Sordariomycete sp. 702/704 (99%) 5Ua NS1 4 GU733368.1| Byssochlamys nivea 540/540 (100%) 1Ua ITS1 4 HQ630365.1| Umbelopsis isabellina 393/393 (100%)

PAGE 93

93 Table 4 2 Continued Tree # Primers Genbank Accession # Species best match Max identity 12La1 ITS1 4 FJ042515.1| Botryosphaeria sp. 535/546 (98%) 12La2 ITS1 4 GQ996147.1| Fungal sp 576/583 (99%) 16Ua ITS1 4 JN002164.1| Pestalotiopsis sp. 489/495 (99%) 16Ub ITS1 4 GU166485.1| Lecythophora sp 429/437 (98%) 17Ub ITS1 4 FJ042515.1| Botryosphaeria sp. 534/534 (100%) 19La2 ITS1 4 GQ996133.1| Fungal sp 463/465 (99%) 20Ub ITS1 4 EU054426.1| Fungal endophyte sp. 513/525 (98%) 22Lb ITS1 4 FJ527869.1| Botryosphaeria sp. 538/540 (99%) 24La ITS1 4 GQ377490.1| Biscogniauxia mediterranea 539/542 (99%) 2La2 ITS1 4 FJ527869.1| Botryosphaeria sp 548/550 (99%) 3Ua ITS1 4 GQ996147.1| Fungal sp. 578/583 (99%) 5Lb ITS1 4 EU686817.1| Fungal endophyte 845/845 (100%) 11La1 ITS1 4 FJ613086.1| Fungal sp. 574/574 (100%) 11La2 ITS1 4 FJ613086.1 Fungal sp. 1061/1061 (100%) 12La ITS1 4 Q996147.1| Fungal sp. 576/583 (99%) 13Ub1 ITS1 4 EU686817.1| Fungal endophyte 840/841 (99%) 13Ub2 ITS1 4 EU326205.1| Chaetomium funicola 533/535 (99%) Tree 16, trunk NS1 4 A Y858654.1 Ambrosiella brunnea strain CBS 378.68 99 Tree 16, trunk NS1 4 JF797171.1 R. lauricola 100 Tree 16, trunk NS1 4 EU257806.1 R. lauricola 99 Tree 16, branch NS1 4 EU257806.1 R. lauricola 100

PAGE 94

94 Table 4 2 Continued Tree # Primers Genbank Accession # Species best match Max identity Tree 20, trunk NS1 4 JQ040320.1 Trichoderma asperellum strain SHBS2013 92 Tree 20, trunk NS1 4 HQ839775.1 Gongronella butleri strain F13 88 Tree 20, trunk NS1 4 EU257806.1 R. lauricola 98 Tree 20, branch NS1 4 JF797171.1 R. lauricola 99 Tree 20, NS1 4 JF797171.1 R. lauricola 99 Tree 20 NS1 4 JN890295.1 Uncultured fungus 99

PAGE 95

95 Table 4 3 Percent occurrence of R. lauricola in the trunks and braches of individual dead redbay trees that were cultured from the inside, middle and outer regions of each tree. For each tree, the height of sample collection and stem diameter are listed. Sample location Inner Middle Outer Height in cm Radius of stem in cm Tree 3 DBH = 10.2 cm Total height = 4.6 m trunk 1 0.1 0 0.75 6 30 trunk 2 0 0.8 0.9 4.5 213 trunk 3 0 0 0.5 3.5 412 branch 1 1 0.9 2 412 Tree 4 DBH = 5.8 cm Total height = 3.4 m trunk 1 0.2 0.2 1 30 3.5 trunk 2 0 1 1 130 3 branch 1 0.2 0.9 152 1 branch 2 0 0 163 0.75 Tree 7 DBH = 13.2 cm Total height = 4.6 m trunk 1 0 0.1 0.1 30 6.5 trunk 2 0.8 0.5 0.9 314 4.5 trunk 3 0.8 1 0.5 427 3.5 Tree 8 DBH = 15 cm Total height = 7.9 m trunk 1 0 0 0.4 30 8.5 trunk 2 0.2 0 0.9 315 6 trunk 3 0 0 0.1 587 5 trunk 4 0 0.2 0.5 823 3.5 branch 1 0 0.5 152 3 branch 2 0 0.4 244 2 branch 3 0.7 0.6 597 3.5 branch 4 0.4 0.9 663 3 Tree 16 DBH = 13.5 cm Total height = 8 m trunk 1 0.1 0.2 0.4 30 6.5 trunk 2 0 0.2 0.4 244 4 trunk 3 1 0.3 1 366 3.5 trunk 4 0 0.3 0.4 640 3.5 branch 1 0.6 0.6 315 2 branch 2 0.4 0.5 467 2 branch 3 0 0.9 640 2.5 branch 4 1 0.8 815 2.5

PAGE 96

96 Table 4 3 Continued Sample location Inner Middle Outer Height in cm Radius of stem in cm Tree 17 DBH = 10.0 cm Total height = 10.7 m trunk 1 0.2 0.3 0.3 30 5.5 trunk 2 0 0.2 0.4 244 5 trunk 3 0.2 0.2 0.6 518 4.5 branch 1 0.3 1 315 4 branch 2 0.5 0.7 467 2.5 branch 3 0.3 0.9 640 1.4 branch 4 0.7 0.9 815 1.3 Tree 18 DBH = 11.2 cm Total height = 12.5 m trunk 1 0 0.2 0.5 15 11 trunk 2 0 0 0.7 191 6 trunk 3 0.6 1 0.9 612 4 trunk 4 0.5 0.7 0.5 706 3 branch 1 0 0 315 1.5 branch 2 0 0 467 1.7 branch 3 0.9 1 640 3 branch 4 0 0 815 2.5 branch 5 0 0 732 1 branch 6 0 0 752 1 Tree 20 DBH = 24.1 cm Total height = 16 m trunk 1 0 0 0.7 30 17 trunk 2 0 0 1 170 13 trunk 3 1 0.9 1 191 3 trunk 4 1 1 0.7 284 2.5 trunk 5 0.1 0.1 0.2 241 7 trunk 6 0.7 0.2 0.4 569 4 trunk 7 1 0.6 0.5 813 3 trunk 8 0.7 0.9 0.5 864 1.5 trunk 9 0 0 0 1046 2 branch 1 1 1 315 1.5 branch 2 0.3 0.3 467 2.5 branch 3 0 0 640 0.5 branch 4 0.3 0.3 815 6 Tree 24 DBH = 16.5 cm Total height = 12 m trunk 1 0 0 0 33 9 trunk 2 0 0.9 1 305 6 trunk 3 0 1 1 607 3 branch 1 0 0 432 2

PAGE 97

97 Table 4 3 Continued Sample location Inner Middle Outer Height in cm Radius of stem in cm branch 2 0 0 686 1.5 branch 3 0 0 798 2 Tree 25 DBH = 16 cm Total height = 8.7 m trunk 1 0 0 0 30 7.5 trunk 2 0 0 0.3 226 3.5 trunk 3 1 0 0 470 3.5 branch 1 0 1 470 2.5 branch 2 1 1 638 3 branch 3 0 0.2 726 2

PAGE 98

98 Figure 4 1. A typical section of redbay trunk indicating where samples were taken from to investigate the distribution of R. lauricola in the sapwood of standing trees. Photo by Don Spence. Outer Middle Inner

PAGE 99

99 Figure 4 2 Moisture trend in dead redbay trees. The moisture for all trees (n = 23) over 12 months. The sharp drop in moisture during March 3011 corresponds 10 20 30 40 50 60 70 80 90 100 Moisture Sample date

PAGE 100

100 Figure 4 3 Moisture of wood chips. Each treatment had ten replicates, ( F ( 3,36 ),= 142.05 P < 0.001 l etters represent homogenous subgroups determined by a Tukey HSD 0 5 10 15 20 25 30 35 40 45 non-soaked wood chip wood chips LW-disk non-LW disk Percent moisture Treatment A B C B

PAGE 101

101 Figure 4 4 Percent of wood samples from each tree that were positive for R. lauricola Inner samples came from the center of the stem. Outer samples were collected from 2 mm below the vascular cambium. Middle samples were collected half way between the inner and outer samples. In all cases, except tree 25, there was a greater recovery of R. lau ricola from the outer sapwood than the inner. Tree 25 was the first tree to die and it appears that R. lauricola disappeared from the outer sapwood, but persisted further inside the tree. 0 0.2 0.4 0.6 0.8 1 1.2 3 4 7 8 16 17 18 20 24 25 Percent of samples positive for R. lauricola Trees Inner Middle Outer

PAGE 102

102 Figure 4 5 Proportion of growth of R lauricola from the inside, outside, and middle sections of sapwood. Differences in growth were statistically different, F (2,152), = 4.74 P = 0.0101 Letters represent homogenous subgroups determined by a Tukey HSD 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 Inner midle outer Percent occurance Portion of stem A B AB

PAGE 103

103 CHAPTER 5 EVALUATING THE EFFECTIVENESS OF PRE TREATING REDBAY TREES ( PERSEA BORBONIA ) WITH PROPICONAZOLE AND PINE SOL TO PROTECT THEM AGAINST LAUREL WILT Introduction Laurel wilt ( LW ) is an exotic disease of the Lauraceae plant family (Fraedrich et al. 2007, Fraedrich et al. 2008, Hanula et al. 2008). The disease is caused by a n exotic fungal pathogen Raffaelea lauricola which is vectored by the exotic redbay ambrosia beetle ( Xyleborus glabratus ) (Fraedrich et al. 2008). The fungus is carried in mandibular sacs (mycangia) insid spores are inoculated into the surrounding tree tissue (Beaver 1989) The disease was first detected in 2002 near Savannah, GA. and has since spread to North Carolina and South Carolina, Mississippi, Alabama, and throughout most of Florida (Riggins et al. 2010, Forest Health Notes 2011, Laurel Wilt Working Group Meeting 30 M arch 2012). T he native ra nge of the beetle and fungus are the temperate areas of S.E. Asia, where laurel wilt has not been observed (Rabaglia et al. 2006 Harrington et al. 2011). Ambrosia beetles usually attack dead or dying trees; thus the behavior of X. glabratus in North America is unusual. Female beetles excavate deep galleries into the sapwood of a tree where eggs are laid. As the female beetle bores into a tree, one or more symbiotic mycangial fungi (one of which is R. lauricola ) may be deposited in to the galleries on which adults and larvae will feed (Hanula et al. 2008 and Mayfield et al. 2008). In the case of redbay ( Persea borbonia ) and other members of the Lauraceae in the S.E. USA, X. glabratus has been boring into healthy trees. Why the beetles are attacking healthy trees is unknown but one hypothesis is that healthy trees in the S.E.

PAGE 104

104 USA are perceived as dead trees by the beetles (Hulcr and Dunn 2011). Whatever the reason, once attacked a he althy tree can die within in a few weeks. Avocado ( Persea americana ) is a member of the Lauraceae and is also susceptible to the disease threatening this important food crop world wide An investigation into the physiological response of avocado to R. l auricola found that the trees produced deposits of lipid and gums in the water conducting cells of the trees in response to the presence of the fungus. However, the fungus was not present in overwhelming quantities that would lead to the occlusion of the water conducting tissue (Inch and Ploetz 2011). It has also been postulated that redbay trees, and other members of this plant family, inadvertently kill themselves due to an overreaction to the presence of the fungus (Hulcr and Dunn 2011). Once the smal This is supported by the fact that the pathogen has been recovered from leaves, stems and roots (Hughes, unpublished). Since LW sympto ms appears in the canopy first, it is xylem mobile. But since it has also been recovered from roots, it is likely that spores can be t ransported passively downward through non functional xylem or through the phloem cells (which move p h otosynthates to the roots and to developing tissue s ) Using fungicides to protect trees against pathogens has become commonplace, in particular for managing Dutch elm disease and oak wilt. Since the causal agent of Dutch elm disease (DED), Ophiostoma novo ulmi and R. lauric ola are taxonomically related (Harrington et al. 2010), techniques used to manage DED have shortened the learning curve when it comes to pre treating trees for LW. Individual elm trees ( Ulmus sp.) have been kept alive for decades through macro injections of propiconazole.

PAGE 105

105 However, they require repeated treatments to maintain the protection against the fungus ( Haugen and Stennes 1999, Dunn 2000) In managing Ceratocystis fagacearum the causal agent of oak wilt, macro injections of propiconazole have signi ficantly reduced disease severity (Appel and Kurdyla 1992, Appel 2001). In this disease cycle, insects may be involved; however the greatest disease spread co mes from below ground root graft s between oak trees. In untreated trees, the pathogen easily mo ves from tree to tree through the vascular tissue, ultimately causing wilt and death. T renching around trees has proven successful for limiting disease spread but so has the use of fungicides (Osterbauer and French 1992, Appel, 2001; Eggers e t al., 2005, Ward et al. 2005). In the only published study regarding fungicide efficacy against the LW pathogen in redbay Ma yfield et al. (2008) used Alamo propiconazole in varying concentrations and found that it inhibited the growth of R. lauricola in culture. In field trials at Ft. Clinch State Park, FL., they treated 17 redbay trees with the label rate of propiconazole in 2007 and achieved measurable levels of success in protecting the trees against R. lauricola Beyond this one study, no publis hed data on the successful use of propiconazole e xists for the treatment of LW in redbay Macro injections o f Alamo can be expensive. F or trees that are too small or for homeowners who cannot afford the cost of the fungicide injections, cover sprays migh t be a potential option. Cover sprays of insecticides have been noted as a potential treatment for agricultural crop trees by Mayfield et al. (2008) but no direct information exists on it s use for urban landscapes. In a review of the effectiveness of ins ecticides in an agricultural setting, Pena et al. (2011) observed mixed results of beetle attacks and

PAGE 106

106 beetle emergence from insecticide treated bolts of avocado. Ultimately, they did not find a difference in beetle emergence or beetle attack between insec ticide on treated and non treated control bolts. Although the use of insecticides may prove at some point to be an effective treatment against X. glabratus the broadcast spraying of insecticides would pose human health risks as well as risks to beneficia l insects (Raupp et al. 2010). be a Based on this concept, a non toxic repellant may be a more viable option. In dealing with beetles that attack pi ne trees, there is evidence that non host volatiles (extracts from flowering plants) can disrupt the olfactory cues pine bark beetles use to locate host coniferous trees (Zhang and Schlyter 2004, Campbell and Borden 2006). T o some degree non host volatil es and anti aggregation pheromones dissuaded beetles from preferred hosts (Huber et al. 2000, Huber and Borden 2000, Fettig et al. 2005, Campbell and Borden 2006). To this end, the use of Pine Sol ( Sodium petroleum sulfonate 1 5% Isopropyl alcohol 1 5% Alkyl alcohol ethoxylates 3 7% and Pine oil 8 10% The Chlorox Company, Oakland, California) might be a non host volatile that could disrupt ability to find Lauraceous hosts The objectives of this study were: 1) to evaluate the eff ectiveness of propiconazole (Alamo fungicide) treatments to protect healthy redbay trees ( Persea borbonia L. Spreng.) against R. lauricola 2) test the efficacy of Pine sol as a repellent 3 ) test the effectiveness of cover spray treatments of Pine Sol at deterring X. glabratus from boring into healthy redbay trees and 4) attempt to identify how often redbay trees form root gra ft s.

PAGE 107

107 Materials and Methods Pre treatment of H ealth y Redbay Trees with P ropiconazole and Pine Sol Over Four Y ears Over a 38 month period (February 2009 to May 2012), 226 healthy redbay trees i n Putnam and Volusia Counties, FL., ranging from 2 to 203 cm (1 to 80 in) diameter at breast height (DBH) were either injected with Alamo a propiconazole fungicide (Syngenta Crop Protection Inc. Greensboro, NC) or given a cover spray of Pine sol All trees were planted in residential areas, occurring in clusters or alone. Results of these treatments were analyzed in two sets; as a whole data set (all four years) and the first two years (200 9 & 2010). Since the dynamics of host choice by X. glabratus are poorly understood, it is possible that some trees in areas in high disease incidence areas have not been attacked. By only looking at the data from 2009 and 2010 alone, we may gain a better understanding of the efficacy of propiconazole in relation to protecting trees from the LW pa thogen For most trees the maximum label rate recommended for injections was used (Rainbow Scientific Macro injection Manual 2005), which was 20 ml of propiconazo le in 300 ml of water for each 2.54 cm DBH of tree. The appropriate solution mixture was solution pressure evenly around the circumference of the tree and to each inj ector port. Tree injection ports were installed in healthy root flares and generally placed 10 to 30 cm apart but in some instances they were farther apart due to d ecay or lack of solid wood (Figure 5 to the root collar to a depth of 2.5 to 3 cm and injection tips were tapped into place with a rubber or wooden mallet. Once the tips and tubing were in place, 5 psi of pressure was applied to bleed

PAGE 108

108 off any air in the tubing. Once air bubbles were removed tank pressure was increased to 20 psi and then monitored for any leaks. When leaks were observed, the pressure valve was turned off and the set up modified to eliminate the leak. Due to the time involved with the uptake of the solution, the set up was often left overnight and checked the following day. If trees required more than 9 L of solution, the tank was reset as noted above to bring the total volume for the tree to the specifications noted in the macro injection guide ( Rainbow Tree Care Scientifi c Advancements 2005 ). In most cases the trees took up the full volume of solution; however some trees did not. After 48 hours, any remaining solution was poured onto the root collar. Once the injection process was completed, plastic tubes and injection tips were soaked in water with a 10% bleach solution for several hours. All trees treated in 2009 and 2010 with propiconazole that had not died were revisited in May of 2012 and evaluated for LW symptoms. At the beginning of the study, the label rate for Al amo as reported by the chemical distributor, Rainbow Scientific Tree Care, was 10 ml per 1 L of water for each DBH 2.54 cm. The recommendations by the distributor changed in the fall of 2009 to the volume noted in the materials and methods. Only the first 11 injections were done at the lower rate, all other solutions were mixed as noted above. All fungicide injections and cover sprays were applied by individuals who retain current Florida Department of A griculture Pesticide licenses. Effectiveness of Pine sol as a D eterrent to X. glabratus To test th e effectiveness of Pine Sol as a repellent five 100 cm 2 areas of bark were chipped off the trunk of three redbay trees on 4 March 2012. Since exposed sapwood is more attractive to X. glabratus than bark (Niogret et al. 2011, Mayfield and

PAGE 109

109 Hanula 2012) the bare areas should act as an effective attractant to any X. glabratus in the area. The bark and phelloderm were removed using a chisel and hammer, exposing the sapwood between 7 dm and 1.5 meters above g rade. The distance between each exposed area was between 10 and 30 cm apart ( Figure 5 2 ) Four treatments were used to test the repellant ability of Pine s ol : (1) control, scraped bark with no treatment, (2) distilled water, (3) 10 %, (4) 40% and (5) 80% Pine Sol in distilled water. Solutions were applied with a small disposable 3 cm wide paint brush. The volume applied was approximately 30 milliliters per treatment. For 1 4 weeks the trees were checked weekly for the presence of X. glabratus boring ac tivity. The determining factor for a positive X. glabratus attack was the presence of an appropriately sized bore hole, which was approximately 1 mm. To assess the potential movement of X. glabratus at this study site, a six tier multi funnel trap baited with manuka oil bait was set up and also monitored weekly for 4 weeks. The control for both the propiconazole and Pine sol treatments were considered to be redbay trees growing in the area near the treatment trees. A survey of adjacent trees was made at the time of treatment applications and trees were revisited in excess of 24 months later to determine their condition. Effectiveness of Cover Spray T reatments of Pine Sol For foliar and bark applications were applied to 13 trees between 2010 and 2011 Pi ne Sol was mixed at a rate between 40 and 50% in tap water and applied at a volume sufficient to wet as much as the tree as possible A typical tank sprayer was used to drench the trunk, branches, and canopy as much as possible. The treatments were re a s wishes.

PAGE 110

110 Occurrence of Root Gra ft s in R edbay To ascertain how often or whether or not redbay trees form root gra ft s, a supersonic airknife X LT (Alison Park, PA.) was used to expose the roots of t welve trees. The tree s were located in a pine flatwoods ecosystem. The airknife was used with a n Ingersoll Rand commercial air compressor that produce d 185 cfm (c ubic f eet per m inute ) and 100 psi (pounds per square inch) of pressure Statistical A nalysis Chi square test was performed on both data sets (2009/2010 and 2011/2012). The response variable was tree survival, which was compared to thirteen variables : DBH, location of tree (tow n), location of tree (address) date of treatment, months dead after treatment, re treatment date, volume of fungicide or Pine sol hot spots of LW (6 or more LW symptomatic trees within 1 km ), technician doing the application, presence of cavities or structural damage, uptake time, whether the tree was already showing LW symptoms, and whether the tree had multiple trunks or had a single trunk The Pearson value was reported for all Chi square values along with the significant value, n, and degrees of freedom I n addition to the Chi square test, regression analysis was reported as an r squared value. The parameter of tree size, DBH, was an important variable to consider. DBH measurement was transformed into its natural log, [ln] DBH and then compare d to survival and town of disease was cross with hot spots of disease and compared to tree mortality. For the assessment of the Pine Sol applications, a one way ANOVA would have been used; h owever after 1 4 weeks no beetle activity has been observed on any of the

PAGE 111

111 treatments. The same has occurred with the Pine Sol cover sprays, no trees have died that were given this treatment Results Propiconazole Treatment of Healthy Redbay T rees Results of these treatments were analyzed in two sets; as a whole data se t (all four years 2009 & 2012 ) and then just the first two years (2009 & 2010). 2009 2012 treatments, 4 years of data To date, a total of 200 trees were injected with Alamo propiconazole and 90% (179 of 20 0) were still alive in May of 20 12. All 13 trees given a Pine Sol cover spray were also still alive in May 2012. Since the host choice dynamics of X. glabratus are poorly understood, enough time may not have elapsed to make any definitive statements about the trees treated between 2009 and 2012. Not included in the propaconazole survival number were 12 redbay trees that had LW symptoms or were immediately next to those trees. All 12 trees that had LW symptoms or were next to symptomatic trees at the beginning of the treatments died. Since these 12 trees did not accurately represent the effectiveness of the treatments they were not included in the percent survival analysis. This also indicates that propiconazole may not work as a therapeutic treatment. Of the thirteen variables examined in the f our year data set, only three had a significant interaction with survival. Tree DBH data were ln transformed to approximate normal distribution and were found to be significant ( X 2 = 3.82, P = 0.0488, df = 1, n = 226). In addition to [ln]DBH, fungicide uptake time ( X 2 = 15.02 P = 0.0 05 df = 4, n = 2 01, r 2 = .05 ) and trees that were already infected with R. lauricola ( X 2 = 6 4. 29 P < 0.0001, df = 2, n = 2 26 r 2 = .27) were significant For both of those variables the P

PAGE 112

112 value was significant but the r 2 was not, indicating that those parameters did not fully explain tree survival. 2009 2010 treatments, 2 years of data Data presented in this section will focus on the first two years of work (75 trees), from February 2009 through November 2010. Seventy one trees were injected with propiconazole and four were given a cover spray of Pine sol Of the 71 trees that were initially injected with propiconazole, 12 were LW symptomatic before fungicide injection or the trees were in close proximity to symptoma tic redbay trees and had likely already been attacked and were infected with R. lauricola at the time of treatment. Each of these trees was given the label volume propiconazole; however, 100% of the trees that showed LW symptoms prior to fungicide injecti on died. Of the other 59 t rees that did not exhibit any LW symptoms, survival as of May 2012 was 75% (44 of 59 ) The age classe s of survival are listed in Figure 5 3 As can been seen in F igure 5 3 the survival was even for the most part with the size class of 61 80 cm having the highest survival rate. Of the thirteen factors that were tested for correlation with r edbay survival between 2009 and 2010, only three were significant town of treatment+hot spots of disease, date of injection, and potential ly pre LW infected. Chi square analysis of town of treatment crossed with hot spots of disease ( X 2 = 15.88, P = 0.0262 df = 7, n = 75 r 2 = 1 6 ) date of fungicide injection (X 2 = 53.66, P = 0.0262 df = 28, n = 75, r 2 = .69) an d potentially pre LW infecte d (X 2 = 15.35, P = 0.0262 df = 2, n = 75, r 2 = .16) all had a signi ficant effect on tree survival.

PAGE 113

113 Effectiveness of Pine sol as a D eterrent to X. glabratus Six weeks after the Pine Sol concentration study was initiated; no X. glabratus activity was observed on any of the treated stem sections. The applications were reapplied on 11 April 2012, six weeks after the initial a pplication. After a total of 14 weeks, no beetle activity has been observed on any of the replicates. As of May 20 12, five X. glabratus have been captured in the baited multifunnel trap. Occurrence of Root Grafts Between Redbay T rees None of the roots systems of the twelve trees produced any root grafts between any other redbay or other species. Discussion These data suggest that propiconazole can provide protection to redbay trees as long as they are asymptomatic The first confirmed LW infected tree was identified in Dayto na Beach, FL in January of 2009. And, t his area of town has a significantly higher proportion of dead trees than the surrounding areas ( X 2 = 29.51, P < 0.0017, df = 226) which indicates that the disease tends to spread to trees close to infected trees. This initial tree was over 50 miles from the next known LW infected area. However, t wo years after the initial diseased tree was identified, symptomatic LW trees were found over ten miles away from the initial diseased tree Trees treated by Mayfield et al. (2008) were relatively small (17 to 39 cm). Their success rate after two years was 65% (11 Of 17) and after three years with no additional treatments survival went down to 29% (5 of 17) (personal communication with Jeff Eickwort, co author, F L Division of Plant Industry). Eggers et al. (2005) found that protecting large trees against oak wilt was difficult. Dat a presented here did not show any difference between the survivability of

PAGE 114

114 small vs. large trees when injected with propiconazole. A possible reason that Eggers et al. (2005) had a lower level of success of protecting larger tre es may be due to the fact that a large diameter tree will have a large amount of functional sapwood that conducting tissue (xylem) is not infused with propiconazole, t he pathogen may gain entry into the stem and become mobile in sapwood tissue behind the m ore functional secondary xylem. Additionally, oak trees create root grafts that allow the pathogen to move from tree to tree underground. Our investigation found no evidence that redbay trees form root grafts in the pine flatwoods ecosystem in north central Florida. After three years of data, none of the trees that were given Pine Sol cover spray have died However, d efinitive statements on successful protection of trees against the LW pathogen whether the treatment was a cover spray or an injection, should be tempered with the caveat of time based on the dis ease severity in a given area. If a Lauraceous host is treated in an area where the disease does not exist t han it is misleading to say that its continued survival is d ue to the fungicide injection. Propiconazole fungicide injections have been successful in combating Dutch elm disease f or decades (Stennes 2000) and since this disease is similar to LW in several ways, macro injections seem to provide the potential for similar levels of protection for years to come. In treatment of oak wilt, Wilson et al. (2005) observed some level of therapeutic success through the use of propiconazole. Therapeutic use was gener ally limited to the more resistant white oak group. Propaconizole injected after the pathogen had invaded the tree did not kill the fungus but it was able to keep red oaks alive longer

PAGE 115

115 than non treated controls. The therapeutic use of propiconazole again st LW was always ine ffective and trees always died Pruning out symptomatic limbs was observed to be a functional tool in the management of oak wilt (Eggers et. al. 2005) Three to four months after treating asymptomatic redbay trees, four trees began to wilt. The wilted areas of the canopy were pruned out approximately four months after the initial fungicide injection. Each of these trees is still alive as of May 2012. Although not part of this study, a tree on campus was given a macro injection of propiconazole in the summer of 2010. In the fall of that year the end of one branch began to wilt. Three months later that wilted limb was pruned off; to date the tree is still alive LW can cause a redbay tree to wi lt within a few days, indicating that the vertical movement of the pathogen in the xylem happens quickly. Since we have had success in keeping trees alive by pruning out wilted limbs, we suspect that the downward movement of the pathogen in non functional xylem or through the phloem happens slower than the vertical movement. There are several tragedies associated with the loss of redbay and other members of this family. From a biological perspective, the fruit produced by this plant is used by a variety o f wildlife such as migratory birds and turkeys (Nelson 1994, Coder 2006, Mayfield 2007). However, the greatest loss associated with this disease may be lack of host plant material for the Palamedes swallowtail ( Papilio palamedes ) butterfly, a species that exclusively uses lauraceous species for its development (Hall 1994, Minno et al. 1999).

PAGE 116

116 From a human perspective, the loss of this tree from coastal urban forests will be dramatic since in some communities it comprises upwards of 20% of the canopy (Spence 2008). A direct economic study has not been produced that outlines any negative impact on urban communities due to LW. However the cost incurred to remove trees will not be insignificant. Not only will property values decline with the loss of prominent shade trees (Anderson and Cordell 1988, CTLA 2000, Laverne and Winson Geideman 2003) but a sense of community identity may also be lost to some degree. The strong connections people have towards trees ( Ulrich 1986, Robbins 2012) have led some to use expe rimental treatments in at tempts to protect their trees. Data from the earliest treatments (2009 and 2010) have provided two years of observations where propiconazole protected 7 5 % of asymptomatic trees. These data suggest that propiconazole can provide protection to redbay trees that are infused with the propiconaz o le before they are attacked by X. glabratus

PAGE 117

117 Figure 5 1. Typical setup of the macroinjection system. The root collar was excavated to observe root orientation and injection ports were spaced approximately 10 15 cm apart. Photo by Don Spence.

PAGE 118

118 Figure 5 2. Three of the five treatments for the Pine sol experiment on tree 3. Each square is 100 cm 2 where the bark and phelloderm were scraped down to the sapwood. Photo by Don Spence

PAGE 119

119 Figure 5 3 Survivability of redbay trees by size class (in cm) treated with propiconazole from 2009 & 2010 The number of trees in each size class that died is noted above each bar. 0 10 20 30 40 50 60 70 2 20 21 40 41 60 61 80 81 100 100+ Percent size classes of redbay in cm n = 17 n = 21 n = 10 n = 12 n = 5 n = 6

PAGE 120

120 LIST OF REFERENCES Adams, A. S. and D. L. Six. 2007. Temporal variation in mycophagy and prevalence of fungi associate d with developmental stages of D endroctonus ponderosae (Coleoptera: Curculionidae). Environm ental Entomology 36(1): 64 72. Agrios, G. N. 2005. Plant Pathology, 5th Ed., Elsevier Academic Press, Burlington, MA. Anagnostakis, S. L. 1987. Chestnut blight: the classical problem of an int roduced pathogen. Mycologia 79: 23 37. Appel, D. N. and T. Ku rdyla. 1992. Intr avascular injection with propi conazole in live oak for oak wilt control. Plant Disease 76:1121 1124. Appel, D. N. 1995. The oak wilt enigma: perspectives from the Texas epidemic Annu. Rev. Phytopathology 33: 103 18. Appel, D. N. 2001. The use of Alamo for oak wilt management, pp 101 106. In: Ash, C.L. (Ed.). Shade Tree Wilt Diseases. APS Press, St. Paul, MN. Anderson, L. M. and H. K. Cordell. 1988. Influence of trees on residential property values in Athens, Georgia (USA): A survey based on actual sale s prices. Landscape Urban Planning 15:153 164. Arnold, A. E., M. Zuleyka, G. S. Gilbert, P. D. Coley and T. A. Kursar. 2000. Are tropical fungal endophytes h yperdiverse? Ecology Letters 3: 267 274. Arnold, A. E., L. C. Meja, D. Kyllo, E. Rojas, Z. Maynard, N. Robbins and E. A. Herre. 2003. Fungal endophytes limit pathogen damage in leaves of a tropical tree. Proceedings of the Nationa l Academy of Sciences, USA 100:15649 15654. Arnold, E. and F. Lutzoni. 2007. Diversity and host range of foliar fungal endophytes: are tropical leaves biodive rsity hotspots? Ecology 88(3): 541 549. Ayerst, G. 1969. The effects of moisture and temperature on growth and spore germination in s ome fungi. J. Stored Prod. Res. 5: 127 141. Atkinson, T. H., R. J. Rabaglia, S. B. Peck and J. L. Foltz. 1991. New records of Scolytidae and Platypodidae (Coleoptera) from the United States and the Bahamas. The Coleopterists Bulletin 45(2): 152 164. Batra, L. R. 1966. Ambrosia fungi: extent of specificity to a mbrosia beetles. Science 153: 193 195.

PAGE 121

121 Beaver, R.A. 1989. Insect fungus relationships in the bark and ambrosia beetles. Insect Fungus Interactions (ed. by N. Wilding, N.M. Collins, P.M. Hammond and J.F. Webber), pp. 121 143. Academic Press, London. Biedermann, P. H. W. and M. Taborsky. 2011. Larval helpers and age polytheism in a mbrosia beetles. PNAS 108(41): 17064 17069. Blackwell, M. 2011. The fungi: 1, 2, 3... 5.1 million species? American Journal of Botany 98: 426 438. Boddy, L. 2001. F ungal community ecology and wood decomposition processes in angiosperms: from standing tree to complete decay of coarse woody de bris. Ecological Bulletins 49: 43 56. Brasier, C. M., J. Lea, and M. K. Rawlings. 1981. The aggressive and non aggressive strains of Ceratocystis ulmi have different temperature optima for g rowth. Trans Br Mycol Soc. 76: 213 218. Brasier C. 2008. The biosecurity threat to the UK and global environment from international trade in plants. Plant Pathology 57: 792 808. Bridges, J. R. 1995. Exotic pests: major threats to forest health. In: pp. 105 116. Forest Health Through Silvicul ture; Proceedings of the 1995 National Silviculture Workshop. Mescalero, New Mexico. May 8 11, 1995. Burks, C. S., J. A. Johnson, D. E. Maier and J. W. Heaps. 2000. Temperature, pp. 73 104. In B. Subramanyam and D. W. Hagstrum [eds.], Alternatives t o pesticides in stored product IPM. Kluwer, Boston, MA. Campbell, S. A. and J. H. Borden. 2006. Integration of visual and olfactory cues of hosts and non hosts by three bark beetles (Coleoptera: Scolytidae). Ecological Entomology 31:437 449. CFR Code of Federal Regulations. 2002. Title 7 Agriculture, Chapter III -Animal and Plant Health Inspection Service, Department of Agriculture, Part 319, Foreign Quarantine Notices. Chaverri, P. and R. O. Gazis. 2011. Linking ex planta fungi wi th their endophytic stages: perisporiopsis, a common leaf litter and soil fungus, is a frequent endophyte of Hevea spp. and ot her plants. Fungal Ecology 4: 94 102. Chemically Speaking, February 2009. Pesticide p otpourri. Pg. 6. Univ. Fla., IFAS Ext. Pesticide Information Office. Gainesville. http://pested.ifas.ufl.edu/newsletter.html Clay, K. and J. Holah. 1999. Fungal endophyte symbiosis and plant diversit y in successional. Science 285: 1742 1744.

PAGE 122

122 Coder, K. D. 2006. Identifying characteristics of redbay ( Persea borbonia ). Outreach publication SFNR06 4, Warnell School of Forestry and Natural Resources, University of Georgia, Athens, GA. 5 p. Cooney, D. G. and R. Emerson. 1964. Thermophilic Fungi. Feedman, San Francisco. 188 pp. CTLA Council of Tree and Landscape Appraisers. 2000. Guide for Plant Appraisal (9th ed.). International Society of Arboriculture. Champaign, IL. 143 pp. Cyr A. S. 2004. Heat as a methyl bromide replacement for structural applications. American Institute of Bakin g. Technical Bulletin XXVI(5): 1 6. Denlinger, D. L. and G. D. Yocum. 1998. Physiology of heat sensitivity, pp 7 53. in D. L. Delinger a nd G. J. Hallman [eds.], Temperature Sensitivity in Insects and Application in Integrated Pes t Management. Westview Press. 311 pp. Do, F. and A. Rocheteau. 2002. Influence of natural temperature gradients on measurements of xylem sap flow with ther mal dissipation probes. 1. Field observations and possible remedies. Tree Physiology 22: 641 648. Downer, A. J., D. Crohn, B. Faber, O. Daugovish, J. O. Becker, J. A. Menge and M. J. Mochizuki. 2008. Survival of Plant Pathogens in Static Piles of Grou nd Green Wa ste. Phytopathology 98(5): 547 554. DPI Florida Department of Agriculture, Division of Plant Industry. Date Accessed: 3 May 2012. http://www.freshfromflorida.com/pi/enpp/pathology/images/lw_county_year.pdf Dreaden T. J., J. A. Smi th and A. E. Mayfield III. 2008. Development of a realtime PCR assay for detection of the Raffaelea species causing laurel wilt disease. Phytopathology 98:S48. Dreistadt, S. H., D. L. Dahlsten and G. W. Frankie. 1990. Urban forests and insect ecology: complex interactions among trees, insects, and people. BioScience 40(3):192 198. Dunn, C. P. 2000. The elms: breeding, conservation, and disease management. Springer 384 pp. Edwards, N. T. and P. J. Hanson. 1996. Stem respiration in a c losed canopy upland o ak forest. Tree Physiology 16: 433 439. Eggers, J., J. Juzwik, S. Bernick and L. M ordaunt. 2005. Evaluation of propiconazole o pera tional treatments of oaks for oak wilt c ontrol. USDA Forest Service, North Central Region. Res earch Note NC 390. 6 pgs.

PAGE 123

123 Evans, H. and T. Oszako. 2007. Alien Invasive Species and International Trade. Forest Research Institute, Warsaw. 179 pp. [FAO] Food and Agriculture Organization. 2008. International standards for phytosanitary measures: Revision of ISPM No. 15, Regulating wood packaging material in international trade, Draft Publ. No. 15. Food and Agriculture Organization of the United Nations, Rome, Italy. ( https://www.ippc.int/id/201049?language=en ). Fettig C. J., S. R. McKelvey and D. P.W. Huber. 2005. Nonhost angiosperm volatiles and verbenone disrupt response of western pine beetle, Dendroctonus brevicomis (Coleoptera:Scolytidae), to attractant baited traps. J. Econ. Entomol. 98(6):2041 2048. Forest Health Notes, North Carolina Forest Service. 2011. Laurel Wilt Confirmed In North Carolina. Frankland, J. C. 1998. Fungal succession unravelling the unpredictable. Mycol. Res. 102(1):1 15. Fr aedrich, S.W., T.C. Harrington and R.J. Rabag lia. 2006. An Ophiostoma species and Xyleborus glabratus threat en red bay ( Persea borbonia ) and other members of the Lauraceae in the southeastern USA. Poster presented at the conference: Advances in threat a ssessment and their a ppli cation to fore st and rangeland m anagement July 18 20, Boulder, CO. Accessed 27 April 2007 athttp://www.urbanforestrysouth.org/Resources/Library/ Fraedrich, S. W., T. C. Harrington and R. J. Rabaglia. 2007. Laurel wilt: a new and devastating disease of redbay caused by a fungal symbiont of the exotic redbay ambrosia beetle. Newsletter of the Michigan Entomological Society 52: 15 16. Fraedrich, S. W., T. C. Harrington, R. J. Rabaglia, M. D. Ulyshen, A. E. Mayfield III, J. L. Hanula, J. M. Eickwort and D. R. Miller. 2008. A fungal symbiont of the redbay ambrosia beetle causes a lethal wilt in redbay and other Lauraceae in the southeastern USA. Plant Disease 92: 215 224. Fukasawa, Y., T. Osono and H. Takeda. 2009. Dyn amics of physicochemical properties and occurrence of fungal fruit bodies during decomposition of coarse woody debris of Fagus crenata. J. For Res. 14: 20 29. Gardes, M. and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes application to the identification of mycorrhizae and rusts. Molecular Ecology 2(2):113 118. Gennaro, M., P. Gonthier and G. Nicolotti. 2003. Fungal endophytic communities in healthy and declining Quercus robur L. and Q. cerris L. T rees in Northern Italy. Phytopathology 151: 529 534.

PAGE 124

124 Glass, N. L. and G. A. Kuldau. 1992. Mating type and vegetative incompatibility in filamentous ascomyc etes. Annu. Rev. Phytopathology 3 0: 201 204. Goheen, D. and E. Hansen. 1993. Effects of pat hogens and bark beetles on forests, pp. 175 196 in: T. D. Schowalter and G. M. Filip (eds) Beetle Pathogen Interactions in Conifer Forests, Academic Press, London. 252 pp. Goldberg, N. and J. Heine. 2009. A comparison of arborescent vegetation pre (1983) and post (2008) outbreak of the invasive species the Asian ambrosia beetle Xyleborus glabratus in a Florida maritime hammock. Pl ant Ecology & Diversity 2(1): 77 83. Graham, S. A. 1925. The felled tree trunk as an ecological unit. Ecology 6(4): 397 411. Hall, D. W. and J. F. Butler. 2005. Palamedes Swallowtail, Papilio palamedes (Drury). University of Florida, Institute of Food and Agricultural Sciences Extension, Document EENY 060. 2 p. Haack, R. A. 2001. Intercepted Scolytidae (Coleoptera) at U.S. ports of entry: 1985 and 2000. Integrat. Pest Manage. Rev. 6: 253 282. Haack, R.A. and T. M. Poland. 2001. Evolving management strategies for a recently discovered exotic forest pest: Tomicus piniperda (Coleoptera: Scolytidae). Biol. Invasions 3:307 22. Haack, R. A. and T. R. Pertrice. 2009. Bark and wood borer colonization of logs and lumber after heat treatment to ISPM 15 Specifications: the role of residual bark. J. Econ. E ntomo l. 102(3): 1075 1084. Hanula, J. L., A. E. Mayfield III, S. W. Fraedrich and R. J. Rabaglia. 2008. Biology and host associations of redbay ambrosia beetle (Coleoptera: Curculionidae: Scolytinae), exotic vector of laurel wilt killing redbay trees in the southeastern United States. J. Econ. Entomol. 101: 1276 1286. Hanula, J. L. and B. L. Sullivan. 2008. Manuka oil and phoebe oil are attractive baits for redbay ambrosia beetle, Xyleborus glabratus (Coleoptera: Scolytinae), the vector of lau rel wilt. Env ironmental Entomology 37: 1403 1409. Hanula, J. L., M. D. Ulyshen and S. Horn. 2011. Effect of trap type, trap Position, time of year, and beetle density on captures of the redbay ambrosia beetle (Coleoptera: Curculionidae: Scolytinae). J. Econ. Entomol. 104(2): 501 508. Hamilton, W. D. 1967. Extraordi nary Sex Ratios. Science 156: 477 488.

PAGE 125

125 Harrington, T. C. 1981. Cycloheximide sensitivity as a taxonomic character in Ceratocystis Mycologia 73: 1123 112 9. Harrington, T. C., S. W. Fraedrich and D. N. Aghayeva. 2008. Raffaelea lauricola a new ambrosia beetle symbiont and pathogen on the Lauraceae. Mycotaxon. 104: 399 404. Harrington, T. C. and S. W. Fraedrich. 2010. Quantification of propagules o f the laurel wilt fungus and other mycangial fungi from the redbay ambrosia beetle, Xyleborus 0 glabr atus Phytopathology 110(10): 118 1123. Harrington, T. C., D. N. Aghayeva and S. W. Fraedrich. 2010. New combinations in Raffaelea Ambrosiella and Hyalorhinocladiella and four new species from the red bay ambrosia beetle, Xylebo rus glabratus Mycotaxon 111: 337 361. Harrington, T. C., H. Yun, S. Lu, H. Goto, D. Aghayeva and S. W. Fraedrich. 2011. Isolations from the redbay ambrosia beet le, Xyleborus glabratus confirm that the laurel wilt pathogen, Raffaelea lauricola originat ed in Asia. Mycologia 103(5): 1028 1036. Haugen, L. and M. Stennes. 1999. Fungicide injection to control Dutch elm disease: Understanding the options. Pla nt Diagnostics Quarterly 20:29 38. Hawksworth, D. L. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycological Research 105:1422 1432. Huber, D. P. W. and J. H. Borden. 2000. Protection of lodgepole pines from mass attack by mountain pine beetle, Dendroctonus ponderosae with nonhost angiosperm volatiles and verbenone. Entomologia Experimentalis et Applicata 92: 131 141. Huber, D P., W., R. Gries, J. H. Borden and H. D. Pierce Jr. 2000. A survey of antennal responses by five species of coniferophagous bark beetles (Coleoptera: Scolytidae) to bark volatiles of six species of angi osperm trees. Chemoecology 10: 103 113. Hug hes, M, J. A. Smith, A. E. Mayfield III, M. C. Minno, and K. Shin. 2009. First Report of Laurel Wilt Disease Caused by Raffaelea lauricola on Pondspice in Florida. Plant Disease Notes 95(12) 1588. Hulcr, J., M. Mogia, B. Isua and V. Novotny. 2007. Ho st specificity of ambrosia and bark beetles (Col., Curculionidae: Scolytinae and Platypodinae) in a New Guinea rai nforest. Ecological Entomology 32: 762 772.

PAGE 126

126 Hulcr, J. and R. R. Dunn. 2011. The sudden emergence of pathogenicity in insect fungus symbioses threatens naive forest ec osystems. Proc. R. Soc. B. 278: 2866 2873. Hyde, K. D. and E. B. G. Jones. 2002. Introduction to fungal succession. In: Fungal Succession (eds. K.D. Hyde and E.B.G Jones). Fungal Diversity 10: 1 4. Hyde, K. D. and K. Soytong. 2008. The fungal endophyte dilemma. Fungal Diversity 33: 163 173. Inch, S. A. and R. C. Ploetz. 2011. Impact of laurel wilt, caused by Raffaelea lauricola on xylem function in avocado, Persea americana Forest Pathology doi: 10.1111/j.1439 0329.2011.00749.x IPPC International Plant Protection Convention, Regulation of Wood Packing Material in International Trade, ISPM 15. 2009. 17 pp. Jellison, J., J. Connolly, B. Goodell, B. Doyle, B. Illman, F. Fekete and A. Ostrofsk ya. 1997. The role of cations in the biodegradation of wood by the brown rot fungi. Inrernarional Biodereriom ion & Biodegradarion 39:(2 3): 165 179. Justesen, A. F., C. J. Ridout and M. S. Hovmller. 2002. The recent history of Puccinia striifor mis f. sp. tritici in Denmark as revealed by disease incidence and AFL P markers. Plant Pathology 51: 13 23. Kendra, P. E., J. S. Sanchez, W. S. Montgomery, K. E. Okins, J. Niogret, J. E. Pea, N. D. Epsky and R. R. Heath. 2011. Diversity of Scolytina e (Coleoptera: Curculionidae) attracted to avocado, lychee and essential oil lure s. Florida Entomologist 94:(2): 123 130. Koch, F. H. and W. D. Smith. 2008. Spatio temporal analysis of Xyleborus glabratus (Coleoptera: Circulionidae: Scolytinae) invasion in eastern U.S. Forests. Environmental Entomo logy 37: 442 452. Kozlowski, T. T. and S. G. Pallardy. 1997. Physiology of Woody Plants, Academic Press Inc., New York. 464 pp. Laverne, R. J. and K. Winson Geideman. 2003. The influence of trees and landscaping n rental rates at office buildings. Arboriculture & Urban Forestry 29(5): 281 290. Le Calvez, T., G. Burgaud, S. Mah, G. Barbier and P. Vandenkoornhuyse. 2009. Fungal diversity in deep sea hydrothermal ecosystems. Appl Environ Microbiol. 75: 6415 6421.

PAGE 127

127 Lewis R, F. Oliveria. 1979. Live oak decline in Texas. Arboriculture & Urban Forestry 5:241 244. Liebhold, A.M., W. L. Macdonald, D. Bergdahl and V.C. Mastro. 1995. Invasion b y exotic forest pests: a threat to forest eco systems. For. Sci. Monogr. 30: 1 49. Lowe, G. T. R. and B. J. Howlett. 2012. Indifferent, affectionate, or deceitful: lifestyles and secreto mes of fungi. PLoS Pathog 8(3): e1002515.doi:10.1371/journal.p pat.1002515. Mangan, S. A., S. A. Schnitzer and E. A. Herre. 2010. Negative plant soil feedback predicts tree species relative abundan ce in tropical forest. Nature 466: 752 755. MDAG Massachusetts Department of Agricultural Resources. Introduced Pest Outbreak Project. Date Accessed, 30 April 2012. Mayfield, A.E. III. 2007. Laurel wilt: A serious threat to redbay and other rela ted native plants. The Palmetto 24:8 11. Mayfield, A. E. III, E. L. Barnard, J. A. Smith, S. C. Bernick, J. M. Eickwort and T. J. Dreaden. 2008. Effect of propiconazole on laurel wilt disease development in redbay trees and on the pathogen in vitro. Arboriculture & Urban Forestry 34(5):317:324. Mayfield A. E. III, E. L. Barnard, T. C. Harrington, S. W. Fraedrich, J. Hanula, V. Vankus, R. J. Rabaglia, D. Duerr, R. Bulluck, J. Johnson, C. Bates, S. Camero n, J. A. Smith, J. Pea, F. Campbell and A. Boone. 2009. Recovery plan for laurel wilt on redbay and other forest species caused by Raffaelea lauricola vector Xyleborus glabratus National Plant Disease Recovery System, a cooperative project of The Amer ican Phytopathological Society and The United States Department of Agriculture. ( http://www.ars.usda.gov/SP2UserFiles/Place/00000000/opmp/ForestLaurelWilt1001 07.pdf ). Mayfield, A. E. III and J. L. Hanula. 2012. Effect of tree species and end seal on a ttractiveness and utility of cut bolts to the redbay ambrosia beetle and granulate ambrosia beetle (Coleoptera: Curculionidae: Scolytinae). J. Econ. Entomol. 105(2): 1080 1085. Mccullough, D. G., T. M. Poland, D. Cappaert, E. L. Clark, I. Fraser, V. Mastro, S. Smith and C. Pell. 2007. Effects of chipping, grinding, and heat on survival of emerald ash borer, Agrilus planipennis (Coleoptera: Buprestidae), in Chips. J. Econ. Entomol. 100(4): 1304 1315.

PAGE 128

128 M endgen, K. and M. Hahn. 2002. Plant infection and the establishment of fungal biotrophy. Trends Plant Sci. 7: 352 356. Microsoft Office Excel 2010. Microsoft, Redmond, WA Minno, M, M. Minno and D. Pierce. 199 9 Florida Butterfly Gardening: A Complete Guide to Attracting, Identifying, and Enjoying Butterflies. University of Florida Press, Gainesville, FL. 224 pgs. Nelson, G. 1994. The trees of Florida: a reference and field guide. Pineapple Press, Inc. Sarasota, FL. 338 p. Niogret, J., P. E. Ke ndra, N. D. Epsky and R. R. Heath. 2011. Comparative analysis of terpenoid emissions from Florida host trees of the redbay ambrosia b eetle, Xyleborus glabratus (Coleoptera: Curculionidae: Scolytinae). Florida Entomol ogist 94(4): 1010 1017. Noble, I. R. and R. O. Slayter. 1980. The use of vital attributes to predict successional changes in plant communities subject to recurr ent disturbance. Plant Ecology 43: 5 21. Noble, R. and S. J. Roberts. 2004. Eradication of plant pathogens and nematodes during composting: a review. Plant Pathology 53: 548 568. Normark, B. B., B. H. Jordal and B. D. Farrell. 1999. Origin of a haplodiploid beetle lineag e. Proc. R. Soc. London B. 266: 2253 2259. Nzoko, P., S. Tourtellot and D. P. Kamdem. 2008. Sanitization of logs infested by exotic pests: case study of the emerald ash borer (Agrilus planipennis Fairmaire) treatments using conventional heat and microwave Forest Pr oducts Journal 58: 1 20. Osterbauer, N.K. and D.W. French. 1992. Propiconazole as a treatment for oak wilt in Quercus rubra and Q. ellipsoidalis Arboriculture & Urban Forestry 18:221 226. Oses, R, S. Valenzuela, J. Freer, E. Sanfuentes, J. Rodriguez. 2008. Fungal endophytes in xylem of healthy Chilean trees and their possible role in earl y wood decay. Fungal Divers ity 33: 77 86. Paine, T. D., K. F. Raffa and T. C. Harrington. 1997. Interactions among scolytid bark beetles, their associated fungi, and live host con ifers. Annu. Rev. Entomol. 42: 179 206. Parfitt, D, J. Hunt, D. Dockrell, H. J. Rogers, L. Boddy. 2010. Do all trees carry the seeds of their own destruction? PCR r eveals numerous wood decay fungi latently present in sapwood of a wide range of a ngiosperm trees. Fungal Ecol 3: 338 346.

PAGE 129

129 Pasanen, A. L., P. Kalliokoski, and P. Pasanen. 1991. Laboratory studies on the relationship between fungal growth and atmospheric temperature and humid ity. Environment International 17:225 228. Pena, J. E., J. H. Crane, J. L. Capinera, R. E. Duncan, P. E. Kendra, R. C. Ploetz, S. McLean, G. Brar, M. C. Thomas an d R. D. Cave. 2011. Chemical control of the redbay a mbrosia b eetle, Xyleborus glabratus and other s colytinae (Coleoptera: Curculionidae) Florida Entomologist 94(4): 882 896. Perrings, C., K. Dehnen Schmutz1, J. Touza and M. Williamson. 2005. How to manage biological invasions under globalization. Tren ds in Ecology and Evolution 5 : 212 215. Pimentel, D. 1986. Biological invasions of plants and animals in agriculture and forestry. P. 149 162 in H. A. Mooney and J. A. Drake (eds.), Ecology of Biological Invasions of North America and Hawaii. Ecological Studies. Springer Verlag, New York. 321 pp. Pirttil, A. M. and A. C. Frank. 2011. Endophytes of Forest Trees: Biology and Applications. Springer. Ploetz, R. C., T. Harrington, J. Hulcr, R. Bostoc k, A. Eskalen, B. Faber, J. Crane, C. Fraedrich, J. Hanula, A. Mayfield III, B. Rabaglia and M. Wingfield. 2011 a Recovery p lan for laurel wilt of a vocad o (caused by Raffaelea lauricola ) National Plant Disease Recovery System. USDA ARS: HSPD 9. [http:// www.ars.usda.gov/SP2UserFiles/Place/00000000/opmp/Avocado%20LW%2011082 9.pdf ] Ploetz, R. C., J. M. Prez Martnez, J. A. Smith, M. Hughes, T. J. Dreaden, S. A. Inch, Y. Fu. 2011 b Responses of avocado to laurel wilt, caused by Raffaelea lauricola Plant Pathology Doi: 10.1111/j.1365 3059.2011.02564.x. Poland, T. M. and D. G. McCullough. 2006. Emerald ash borer: invasion of the urban forest and the thr Journal of Forestry 104(3): 118 124. Rabaglia R. J., S. A. Dole and A. Cognato. 2006. Review of American Xyleborina (Coleoptera: Curculionidae: Scolytinae) occurring north of Mexico, with an illustrated key. A nn. Entomol. Soc. America. 99: 1034 1056. Rainbow Treecare Scientific Advancements 2005. Macro infusion: A guide to high volume tree care infusions.

PAGE 130

130 Raupp, M. J., P. M. Shrewsbury and D. A. Herms 2010. Ecology of herbivorous arthropods in urban la ndscapes Annu. Rev. Entomol. 55:19 38. Riggins, J .J., M. Hughes, J. A. Smith, A. E. Mayfield III, B. Layton, C. Balbalian and R. Campbell. 2010. First occurrence of laurel wilt disease on redbay trees in M ississippi. Plant Disease 94: 634. Rob bins, J. 2012 April 11. Why Trees Matter. New York Times: The Opinion Pages ( http://www.nytimes.com/2012/04/12/opinion/why trees ) matter.html?_r=1&emc=eta1 ). Rollins, F., K. G. Jones, P. Krokene, H. Solheim and M. Blackwell. 2001. Phylogeny of a sexual fungi associated with bark and ambro sia beetles. Mycologia 93(5): 991 996. Rudgers, J. A., J. Holah, S. P. Orr and K. Clay. 2007. Forest succession suppressed by an introduced plant fun gal symbiosis. Ecology 88(1): 18 25. Ruisi, S., D. Barreca L. Selbmann, L. Zucconi and S. Onofri. 2007. Fungi in Antarctica. Rev Environ Sci Biotechnol. 6: 127 141. Saikkonen, K. 2007. Forest structure and fungal endophyt es. Fungal Biology Reviews 21: 67 74. SAS Institute Inc. 2012. SAS Campus Drive, Cary, North Carolina. Yehoshua and E. Fallik. 2000. Host pathogen interactions modulated by heat treatment. Postharv est Biology and Technology 21: 71 85. Scott, B. 2001. Epichlo endophytes: fungal symbiont s of grasses. Microbiology 4: 393 398. Shields, J., S. Jose, J. Freeman, M. Bunyan, G. Celis, D. Hagan, M. Morgan, C. E. Pieterson and J. Zak. 2011. Short term impacts of laurel wilt on redbay ( Persea borbonia [L.] Spreng.) in a mixed evergreen de ciduous forest in northern Florida. Journal of Forestr. 109(2): 82 88. Simberloff, D. 2003. How much information on population biology is needed to manage introduced spe cies? Conservation Biology 17: 83 92. Simpson, W. T. and B. L. Illman. 2004. H eat sterilization times of red pine boards. Forest Prod. J. 54(12):240 244. Six, D. L. 2003. Bark beetle fungus symbioses. In Insect symbiosis (eds K. Bourtzis & T. A. Miller), pp. 97 114. New York, NY: CRC Press.

PAGE 131

131 Six, D. L. and M. J. Wingfield. 2011. The role of phytopathogenicity in bark beetle fungus symbioses: a challenge to the classic pa radigm. Annu. Rev. Entomol. 56: 255 272. (doi:10.1146/annurev ento 120709 144839) Smith, J. A., L. Mount, A. E. Mayfield III, C. A. Bates, W. A. Lamborn and S. W. Fraedrich. 2009. First report of laurel wilt disease caused by Raffaelea lauricola on camphor in Florida and Georgia. Plant Disease 93(2): pg 198. Spence, D. J., J. Weishample, J. Stout and W. Taylor. 1998. Composition and change of maritime hammock flora in east central Florida after 20 years. Master of Science Thesis, Department of Biology, University of Central Florida, 100 pp. Spence, D. J. 2008. Urban Forest Management Plant for the Town of Ponce Inlet FL. Native Florida Landscapes, LLC. 108 pp. Stennes, M. A. Dutch elm disease chemotherapy with Arbotech 20 S and Alamo. 2000. In: The Elms: Breeding, Conservation, and Disease Man agement, Ed. C. P. Dunn. Kluwer Academic Publishers pgs. 173 188. Suzuki, A. 2002. Fungal succession at different scales. In: Fungal Succession (eds. K.D. Hyde and E.B.G. Jones). Fungal Diversity 10: 11 20. Tainter FH. 1986. Growth, sporulatio n, and mucilage production by Ceratocystis fagacearum at high temperatures. Plant Dis ease 70:339 42. Ulrich, R. S. 1986. Human responses to vegetation and landscapes. Landscape and Urban Planning 13:29 44. U.S. Department of Agriculture. 1992. Pest risk assessment of the importation of Pinus radiata and d ouglas fir logs from New Zealand. Miscellaneous Publication No. 1508, Washington, D.C.: U.S. Department of Agriculture, Forest Service.52p.+ 11 appendices. U.S. Office of Technology Assessment. 1993. Harmful non indigenous species in the United States. U.S. Congress Off. of Techn. Assess. OTA F 565.391. U.S. Department of Agriculture, Forest Service, Forest Health Protection, Southern Region. 2012. Laurel Wilt Distribution Map. Available at: http://www.fs.fed.us/r8/foresthealth/laurelwilt/dist_map.shtml [Accessed 10 May 2012]. van der Valk, A. G. 1992. Establishment, colonization and persistence. In: Plant Succession Theory and Prediction, Population and Community Biology Series 11 (eds. D.C. Glenn Lewin, R. K. Peet and T. T. Veblen). Chapman & Hall, London. 368 pp.

PAGE 132

132 van Uden, N. 1984. Temperature profiles of yea sts. Adv. Microb. Physiol. 25: 195 251. Vannini, A., S. Franceschini and A. M. Vettraino. 2012. Manufactured wood trade to Europe: a potential uninspected carrier of alien fungi. Biol Invasions. DOI 10.1007/s10530 012 0222 0 Wang, B., V. C. Mastro and W. H. McLane. 2000. Impacts of chipping on surrogates for the long horned beetle Anoplophora glabripennis (Coleoptera: Cerambycidae) in logs. J. Econ. Entomol. 93(6): 1832 1836. Ward, K., J. Juzwik and S. Bernick. 2005. Efficacy of a lamo for prophylactic and therapeutic treatme nt of oak wilt in red oaks, 2004. Fungicide and Nematicide Tests 60:OT018. White, T., T. Bruns, S. Lee and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315 322 In: M. A. Innis, D. H. Gelfand, J. J. Sninsky, T. J. White (eds). PCR Protocols: a Sequencing Guide to Methods and Applications. Academic Press, San Diego. 482 pp. Wilson, D. 1995. Endophyte: the evolution of a term, and clarification of its use and definition. Oikos 73(2): 274 276. Wunderground.com Accessed 20 May 2012 for the day of 4 April 2012. http://www.wunderground.com/history/airport/KDAB/2012/4/4/DailyHistory. html?req_ city=NA&req_state=NA&req_statename=NA Xu, J. and J. Gordon. 2003. Honor thy symbionts Proc. Natl. Acad. Sci. 100: 10452 10459. Zhang, Q. H. and F. Schlyter. 2004. Olfactory recognition and behavioral avoidance of angiosperm nonhost v olatiles by conifer inhabiting bark beetles. Agricultural and Forest Entomology 6: 1 19. Zuccaro A, U. Lahrmann, U. Guldener, G. Langen and S. Pfiffi. 2011. Endophytic life strategies decoded by genome and transcriptome analyses of the mutualistic r oot symbiont Piriformospora indica. PLoS Pathog 7:e1002290.doi:10.1371/journal.ppat.1002290

PAGE 133

133 BIO G RAPHICAL SKETCH Donald John Spence was born in Daytona Beach, F L. in 1964. He graduated from Seabreeze High School, and although his academic achievements were limited, he was an accomplished surfer, swimmer and spr ing board diver. As a senior, Don won the 1 meter spring board competition for Volusia County, the regional competition and placed tenth at the State Championships. After high schoo l, Don enlisted in the United States Coast Guard and served first on the law enforcement cutter USCGC Steadfast and aboard the Icebreaker USCGC Polar Sea. His travels took him from the arctic to Antarctic, across the date line, timeline and around Cape H orn. In all, he circumnavigated North Americ a, sailed six of the seven seas and visited five of the six Offic in northeastern Spain. Don returned to Daytona Beach to attend Daytona State College whe re he graduated with his AA in b Colleges. He was also inducted into the DBCC Hall of Fame for his extracurricular activities with student government and Amnesty International. In 1992, Don won the Vaughn Jordan Scholarship at Stetson University to complete his Bachelor of Science degree in b iology. Don graduated from Stetson University in 1994 and won the Service Award for the Biology Dep artment. In 1995, Don started his consulting business, Botanical Systems, where he specialized in wetland identification, ecological restoration, plant surveys and plant identification. In 1996 Don matriculated into a graduate program at the University o change in tree diversity over twenty years in nine maritime hammocks in East Central Florida. In 2001

PAGE 134

134 and changed the focus of his business so that he could concentrate on tree surveys, protection, and health assessments. In the same year, Don also began teaching at Daytona State College as an adjunct professor of botany and biology. Due to a desire environment, in 2006 Don ran for and won and election for Seat 5 of the Volusia Soil and Water Conservation Dist passion was in teaching. In an attempt to compete for a faculty position at the university level, Don entered the University Doctor of Plant Medicine Program in 2009. After a year in the DPM program, Don had an opportunity to study an emerging tree disease (laurel wilt) and moved to a Ph.D. program in Plant Pathology. Don was accepted to work with Dr. Jason Smith in the Forest Pathology Laboratory where he studied features of the fungal pathogen that causes laurel wilt along with its symbiont, the redbay ambrosia beetle. Don received his Ph.D. from the University of Florida in the summer of 2012 and he hopes to return to the beginning of his educational adventure and teach at Daytona State College again.