Analysis of Kaposi's Sarcoma-Associated Herpesvirus Mirnas' Role in the Maintenance of Viral Latency

MISSING IMAGE

Material Information

Title:
Analysis of Kaposi's Sarcoma-Associated Herpesvirus Mirnas' Role in the Maintenance of Viral Latency
Physical Description:
1 online resource (116 p.)
Language:
english
Creator:
Bonstaff, Karlie P
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Genetics (IDP)
Committee Chair:
Renne, Rolf
Committee Members:
Bloom, David C
Bungert, Jorg
Chan, Edward K

Subjects

Subjects / Keywords:
kshv -- latency -- mirna -- reactivation
Genetics (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
MicroRNAs are short, non-coding RNAs thatpost-transcriptionally regulate gene expression by targeting 3’ UTRs of mRNAs.  Kaposi sarcoma-associated herpesvirus (KSHV)-encodedmiRNAs are located in the latency-associated region, which plays an importantrole in the maintenance of viral latency. Several cellular targets of KSHV miRNAs have been discovered implicatingroles for KSHV miRNAs in promoting angiogenesis, cell proliferation, andinhibition of apoptosis.  Here, wedemonstrate that viral miRNAs play a role in the maintenance of latency bytargeting cellular transcription factors known to activate the lytic transactivatorRTA.  BC-3-G, a PEL-derived RTA-reportercell line, was used to observe the effects of viral miRNA knockdown onreactivation.  Our data demonstrate thatinhibition of miR-K12-3 and miR-K12-11 leads to increased reactivation.  Moreover, both miRNAs are predicted to targetcellular transcription factors (TFs) MYB, Ets-1, and C/EBPalpha, which are known toinduce lytic reactivation by activating the RTA promoter. Knockdown ofmiR-K12-3 and -11 in PEL cells causes de-repression of all three cellular TFs andresulted in increased lytic gene expression and virus egress.  Next, we created miR-K12-3 and -11 deleted recombinantviruses using BAC16.  IndividualmiRNA-deleted recombinant viruses were reconstituted in 293T cells thenco-cultured with iSLK cells and induced to release packaged recombinantviruses.  This strategy resulted in thefirst bacmid producer cell lines which generated a significant amount of viruswhen compared to 293T cells.  iSLK cellsharboring recombinant virus were confirmed for viral gene expression and miRNAexpression.  BJAB BAC16 cells were alsoestablished and provide the first system with an isogenic control for studyingKSHV in lymphoid cells.  iSLK cells infectedwith either of the deletion mutants (deltamiR-K12-3/ deltamiR-K12-11)displayed increased spontaneous reactivation and were more sensitive to inducersof reactivation than WT infected cells.  In summary, we have established a new system for studyingmiRNA function in cells of both endothelial and lymphoid origin through bacmidtechnology and our data show that the KSHV-encoded miRNAs, miR-K12-3 andmiR-K12-11, target Myb, Ets-1, and C/EBPalpha which in turn regulate key steps in the viral life cycle: themaintenance of latency and the transition from latent to lytic replication.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Karlie P Bonstaff.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Renne, Rolf.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-02-28

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044447:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 IN THE MAINTENANCE OF VIRAL LATENCY By KARLIE PLAISANCE BONSTAFF A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FUL FILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Karlie Plaisance Bonstaff

PAGE 3

3 To my supporting husband and my wonderful family for their constant encouragement throughout my life

PAGE 4

4 ACKNOWLED GMENTS I would like to acknowledge all of the people who contributed to this work and help guide me in my laboratory studies. First, I would like to thank all the current and past members of the Renne Lab: Dr. Jianhong Hu, Dr. Soo Jin Han, Dr. Irina Haecke r, Dr. Rebecca Skalsky, Dr. Mark Samols, Dr. Isaac Boss, Dr. Brian Krueger, Hong Seok Choi, Nonhlanhla Diamini, Yajie Yang, Lauren Gay, Vaibhav Jain and Curtis Lanier I would particularly like to thank Drs. Jianhong Hu and Irina Haecker for their helpfu l discussions and guidance in addition to Dr. Brian Krueger and Tyler Beals for collaborating with me. Thanks to members of my committee: Dr. David Bloom, Dr. Jorg Bungert, and Dr. Edward Chan for their helpful suggestions. Thanks also to the training gra nt in Cancer Biology for supporting me for 3 years while at UF. I want to say a special thanks to my husband, Christopher Bonstaff, for his constant support and for being willing to move where ever my education and career takes me. Lastly, thank you to my advisor, Dr. Rolf Renne, for his support, guidance, and encouragement, for which I could not have achieved my goal of becoming a scientist.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 BACKGROUND ................................ ................................ ................................ ...... 12 Associated Herpesvirus Discovery and Associated Diseases .. 12 KSHV Genome and Lif ecycle ................................ ................................ ................. 14 KSHV Encodes miRNAs ................................ ................................ ......................... 17 MiRNA Discovery ................................ ................................ ................................ .... 18 MiRNA Biogen esis and Function ................................ ................................ ............ 19 Viral miRNAs ................................ ................................ ................................ .......... 20 Targets of KSHV miRNAs ................................ ................................ ....................... 24 2 KSHV ENCODED MIRNAS REGULATE RTA PROMOTER ACTIVATION BY TARGETING CELLULAR TRANSCRIPTION FACTORS MYB, ETS 1, and ................................ ................................ ................................ ................... 38 Introduction ................................ ................................ ................................ ............. 38 Results ................................ ................................ ................................ .................... 39 KSHV miRNA Knockdown in BC 3 G Cells ................................ ...................... 39 In silico Target Prediction for miR K12 3 and miR K12 11 Identifi ed Ets 1, Myb, and C/EBP as Potential Targets ................................ ......................... 41 Ets 1, MYB and C/EBP Expression is De repressed upon miR K12 3/miR K12 11 Knockdown in PEL cells ................................ ................................ ... 42 L ytic Gene Expression and Virus Production Increases upon miR K12 3 and miR K12 11 Knockdown in PEL cells ................................ ..................... 43 Generation of miRNA Deleted Recombinant KSHV BACmids and Latently Infected iSLK cell s ................................ ................................ ......................... 44 Discussion ................................ ................................ ................................ .............. 45 Materials and Methods ................................ ................................ ............................ 49 Cell Lines ................................ ................................ ................................ .......... 49 Flow Cytometry ................................ ................................ ................................ 50 Luciferase Assays and Reporter Construction ................................ ................. 50 Antag omir Derepression Assays and Quantitative Reverse Transcription PCR (RT qPCR) Analysis ................................ ................................ ............. 51 Virus Isolation and Quantitation ................................ ................................ ........ 51

PAGE 6

6 G eneration of iSLK KSHV BAC Cells ................................ ............................... 52 Immunofluressence Assay ................................ ................................ ............... 52 3 GENERATION AND ANALYSIS OF KSHV MIRNA DELETED RECOMBINANT VIRUS ES ................................ ................................ ................................ ................ 62 Mutational Strategy ................................ ................................ ................................ 64 Reconstitution of KSHV BAC16 miRNA in 293T Cells ................................ ........... 66 RTA Inducible SLK cells Serve as a Recombinant Virus Producer Cell Line .......... 67 Collection and Analysis of BA C16 iSLK Virus ................................ ......................... 68 Infection of Endothelial Cells using iSLK BAC16 Virus ................................ ........... 69 Generation of BJAB BAC16 Cells through Co culturing ................................ .......... 70 4 CONCLUSIONS AND FUTURE DIRECTIONS ................................ ...................... 86 KSHV miR K12 3 and miR K12 11 Help to Prevent Reactivation by Targeting Cellular Transc ription Factors ................................ ................................ .............. 86 KSHV miR K12 3 and 11 Deleted Recombinant Viruses have a More Lytic Phenotype in Endothelial Cells ................................ ................................ ............ 90 Genera tion of Endothelial and Lymphoid Cells Harboring miRNA Deleted Recombinant Virus ................................ ................................ .............................. 91 Future Directions using KSHV BAC16 miRNA Recombinant Viruses ................... 93 Future Prospective on KSHV miRNAs ................................ ................................ .... 96 LIST OF REFERENCES ................................ ................................ ............................. 100 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 116

PAGE 7

7 LIST OF TABLES Table page 1 1 Verified known viral miRNAs. ................................ ................................ ............. 36 1 2 Experimentally verified viral miRNA targets. ................................ ....................... 37 2 1 Primer Sequences ................................ ................................ .............................. 60 2 2 iSLK BAC16 Sequencin g Results ................................ ................................ ....... 61

PAGE 8

8 LIST OF FIGURES Figure page 1 1 The KSHV Genome. ................................ ................................ ........................... 32 1 2 MiRNAs are encoded in the KSHV lat ency associated region (KLAR). .............. 33 1 3 Biogenesi s pathway for metazoan miRNAs ................................ ........................ 34 1 4 Schematic representation of miRNAs found for several herpesviruses. ............. 35 2 1 Antago mir screen in BC 3 G cells ................................ ................................ ...... 54 2 2 MYB, Ets geted by miR K12 3 & miR K12 11 ................. 55 2 3 Confirmation of miRNA knockdown after antagomir transfection. ....................... 56 2 4 MYB, Ets K12 3 and miR K12 11 knockdown in PEL cells. ................................ ................................ ................ 57 2 5 Lytic gene expression and virus production increases upon miR K12 3 and mi R K12 11 knockdown in PEL cells ................................ ................................ .. 58 2 6 Analysis of KSHV miRNA del eted recombinant bacmid viruses ......................... 59 3 1 pBelo45 plasmid construct ................................ ................................ ................. 73 3 2 Mutational strategy ................................ ................................ ............................. 74 3 3 Two step red recombination ................................ ................................ ............... 75 3 4 Screening of clones ................................ ................................ ............................ 76 3 5 Viral copy number comparison ................................ ................................ ........... 77 3 6 miRNA expression in iSLK BAC16 miRNA compared to WT ............................ 78 3 7 TIVE and SLK infection f low cytometry of GFP expression ................................ 79 3 8 GFP expression in SL K cells 48 hpi w ith BAC16 recombinant viruses. .............. 80 3 9 IFA for LANA e xpression in SLK cells 96 hpi ................................ ...................... 81 3 10 Lytic gene expression in BJAB BAC16 infected cells ................................ ......... 82 3 11 BJAB BAC 16 vs BCBL 1 miRNA expression. ................................ .................... 83 3 12 BCBL 1 vs BJ AB BAC16 intracellular LANA expression ................................ .... 84

PAGE 9

9 3 13 BJAB BAC16 MYB and BACH1 expression. ................................ ...................... 85

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of th e University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IN THE MAINTENANCE OF VIRAL LATENCY By Karlie Plaisance Bonstaff Au gust 2012 Chair: Rolf Renne Major: Medical Sciences Genetics MicroRNAs are short, non coding RNAs that post transcriptionally regulate gene a associated herpesvirus (KSHV) encoded mi RNAs are located in the latency associated region, which plays an important role in the maintenance of viral latency. Several cellular targets of KSHV miRNAs have been discovered implicating roles for KSHV miRNAs in promoting angiogenesis, cell proliferation, and inhibit ion of apoptosis. Here, we demonstrate that viral miRNAs play a role in the maintenance of latency by targeting cell ular transcription factors known to activate the lytic transactivator RTA. BC 3 G, a PEL derived RTA reporter cell line, was used to obser ve the effects o f viral miRNA knockdown on reactivation. Our data demonstrate that inhibition of miR K12 3 and miR K12 11 leads to increased reactivation. Moreover, both miRNAs are predicted to target cellular transcription factors (TFs) MYB, Ets 1, and reactivation by activating the RTA promoter. K nockdown of miR K12 3 and 11 in PEL cells causes de repr ession of all three cellular TFs and result ed in increased lytic gene expression and virus egress

PAGE 11

11 Next, we cre ated miR K12 3 and 11 deleted recombinant viruses using BAC16 Individual miRNA deleted recombinant viruses were reconstituted in 293T cells then co cultured with iSLK cells and induced to release packaged recombinant viruses. This strategy resulted in the fi rst bacmid producer cell lines which generated a significant amount of virus when compared to 293T cells. iSLK cells harboring recombinant virus were confirmed for viral gene expression and miRNA expression. BJAB BAC16 cells were also established a nd provide the first system with an isogenic con trol for studying KSHV in lymphoid cells. iSLK cells infected with either of the deletion mutants ( miR K12 3/ miR K12 11) displayed increased spontaneous reactivation and were more sensitive to inducers of reactivation than WT infected cells In summary, we have established a new system for studying miRNA function in cells of both endothelial and lymphoid origin through bacmid technology and our data show that the KSHV encoded miRNAs miR K12 3 and miR K1 2 11 target Myb, Ets 1, and C/EBP which in turn regulate key steps in the viral life cycle: the maintenance of latency and the transition from latent to lytic replication.

PAGE 12

12 CHAPTER 1 BACKGROUND Associated Herpesvirus Discovery and Associated Diseases a ssociated herpesvirus (KSHV), also known as Human Herpesvirus 8 (HHV cells (Chang et al. 1994) In 1872, Moritz Kaposi described a highly vascular abnormal growth in Mediterranean men that is now known as cla ssical KS (Kaposi, 1872) The cy syndr ome (AIDS) epidemic in the 1970 s, KS was thought to be a relatively rare tumor form. There are now four defined clinical variants of KS: classical, endemic, iatrogenic, and epidemic or AIDS KS. All four types of KS have similar histological featu res being that they are highly vascular lesions and are characterized by proliferating spindle cells among infiltrating inflammatory cells. Classic KS lesions predominantly are confined to the lower extremities and tend to infect elderly men rather than wo men. Those patients affected by the disease generally live with KS for 10 years or greater and are usually not killed by it (Dourmishev et al. 2003; Hengge et al. 2002) Endemic KS is primarily located in eastern and central Africa and is a more aggressive subtype of KS. Unlike classical KS, the endemic form is not only found in men but often affects children with disseminated lymphadenopathy and results in a high mortality rate (Dutz and Stout, 1960) Iatrogenic KS, or post organ transplant KS, is associated with patients after immunosuppressive therapy. Renal tra nsplant patients are the most susceptible to develop of this subtype of KS, which tends to be more aggressive than classical KS (Barozzi et al. 2003) In the late 1970 s

PAGE 13

13 upon the AIDS epidemic, KS was initially one of the most common AIDS symptoms, and continues to be the most common malignancy associated with HIV infection and can lead to significantly high mortality rates. AIDS associated KS is extremely aggressive and displays a mo re frequent mucosal progression and lymph node spreading than in the other epidemiologic forms After the introduction of highly active antiretrovi ral therapy (HAART) in the 1990 s, the incidence and fatality of AIDS KS has dropped significantly in the United States (Tam et al. 2002) However, AIDS KS continues to have high incidence in developing countries and KS is the most common tumor in African men (Campbell et al. 2003) Early on it was proposed that an infectious agent caused KS. In 1972 herpesvirus like particles were found in KS cultures and were believed to be Human cytomegalovirus. However upon the introduction of HIV and AIDS and the dramatic r ise in KS incidence in the 1980 s, HIV was then believed to be the causative agent. It was not until 1994 that KSHV was first discovered in the lesions of AIDS KS patients by Chang et al using representa tion al difference analysis (RDA) (Chang et al. 1994) RDA is a technique used to compare two DNA samples by PCR amplification and analyze differences using s ubtractive DNA hybridization (Schutte et al. 1995) Sequencing analysis of KSHV placed the virus in the gamma herpesvirus family along with Epstein Barr virus (Neipel et al. 1997; Russo et al. 1996) KSHV is most related to a primate herpesvirus, herpesvirus saimiri (HVS), thus placing it in the rhadinovirus subfamily (Desrosiers e t al. 1997) Since the discovery of KSHV, two other lymphoproliferative disorders have been linked to the virus. Primary effusion lymphoma (PEL) is a type of non

PAGE 14

14 lymphoma also known as body cavity based lymphoma (BCBL) that is more commonly found in immunoc ompromised AIDS patients (Cesarman et al., 1995a) PEL differs from KS in that it is derived from clonally expanded malignant B cells that are contained in various body cavities such as the pericardium, pleurum, and peritoneum (Arvanitakis et al. 1996) PEL cells have an arrested ph enotype between an antigen selected germinal center B cell and a terminally differentiated plasma cell (Nador et al. 1996) PEL cells can either be only KSHV infected with genome copy numbers ranging from 50 150 g enomes per infected cell, or can be co infected with EBV (Cesarman et al., 1995a; Renne et al., 1996a; Staudt et al., 2004) PEL is much more aggressive than KS, and rapid progression can cause high mortality with an average survival time of 2 6 months (Komanduri et al. 1996) Along with KS and PEL, KSHV is also variable found in patients with multicentric Castleman disease (MCD) (Soulier et al. 1995) MCD is a rare angiolymphoproliferative disorder that is found mostly in AIDS patients, 90% of which are also infec ted with KSHV, whereas KS and PEL patients are 100% associated with KSHV infection (Grandadam et al. 1997) MCD also differs from KS and PEL in that infected cells have a more lytic replication program compared to predominantly latent as in KS and PEL, suggesting that the pathogenic role of KSHV in these different diseases might be determined by different gene expression programs of the virus (Staskus et al. 1999) KSHV Genome and Lifecycle KSHV is an enveloped, double stranded DN A virus that has a genome size ranging from 165 to 170 kbp in length. The unique long region (ULR) is ~140 kbp and contains all 87 of the viral open reading frames (ORF). The ULR is flanked by terminal

PAGE 15

15 repeat (TR) sequences at both ends of the linear vir al genome. Each TR is 801 bp long, is highly GC rich, and contains the origin of latent DNA replication (Hu et al., 2002; Lagunoff and Ganem, 1997) Although many of the KSHV ORFs are conserved among other herpesv iruses, it does contain 15 unique ORFs designated K1 to K15. KSHV also contains several viral genes that have been pirated from the host genome and function as cellular homologues (Swanton et al. 1997) KSHV, like all herpesviruses, is known for having both lytic and latent modes of infection. Lytic replication involves genome wide activation of viral gene expression, viral polymerase dependent DNA replication, and production of progeny virions. This phase is assoc iated with death of the infected cell. Latency, on the other hand, involves highly restricted gene expression and does not lead to death of the host cell. Instead, the viral genome remains stably associated as a circular molecule called an episome, which d oes not integrate in the host chromosome and persists for many generations without virus production (Renne et al., 1998; Renne et al., 1996b; Roizman and Sears, 1993; Zhong et al., 1996) There are three stages of g ene expression during lytic replication: immediate early, delayed early, and late. The first protein to be expressed is open reading frame 50 (ORF50) also known as the regulator of transcription activation (RTA). RTA is considered the switch protein essent ial for lytic reactivation (Lukac et al. 1998; Sun et al. 1998) Once expressed, RTA induces the expression of a number of delayed early lytic genes which play a role in viral DNA replication, immune evasion, and signaling affecting the host cellular environment. From there, other delayed early and late viral

PAGE 16

16 proteins are expressed leading to the production of progeny virus and subsequently causing lysis of the host cell (Renne et al. 1996b) Latency can be described as the ability of the virus to lie dormant within a cell. KSHV accomplishes this by forming a circular episome and expressing a very limited number of latency associated genes that a ssist in evading immune response and promoting cell proliferation. One particular protein, the latency associated nuclear antigen (LANA), is crucial for latency. The ORF73/ LANA gene is located in the KSHV latency associated region (KLAR) along with v FLIP (promotes cell survival), v cyclin (cyclin D homologue that promotes S phase entry), a cluster of viral encoded miRNAs (discussed later), and the Kaposin gene family (involved in cytokine mRNA stabilization and cell transformation) (Cai et al. 2005; Dittmer et al. 1998; Grundhoff et al. 2006; Kedes et al. 1997; Pfeffer et al. 2005; Sadler et al. 1999; Samols et al. 2005) LANA is present i n all KSHV infected cells of KS, PEL and MCD and is commonly used as a marker of infection (Verma et al. 2007) ctions include maintaining the viral episome, tethering the viral episome to the host chromosome, supporting latent DNA replication, and promoting cell proliferation and survival (Dourmishev et al. 2003) Lytic vs. latent replication is tightly regulated by controlling the levels of RTA and also auto act ivates itself (Deng et al. 2000; Gradoville et al. 2000) RTA recruits a number of cellular proteins such as RBPJ 1, Sp1, and Sp3 to bind and activate its own promoter (Chen et al. 2000; Liang et al. 2002; Sakakibara et al. 2001; Zhang et al. 1998) RTA also interacts with C / up regulate gene expression (Wang et al. 2003) expression resulting in a

PAGE 17

17 negative feedback loop RTA binds the LANA promoter and activates transcription. On the other hand, LANA can suppress RTA expression through direct interaction with the (Lan et al. 2004; Lan et al. 2005) During latency the promoter region of RTA displays the histone markings of bivalent chromatin, in which H3K27 me3 repressing marks and H3K9/K14 ac activating marks are present simu ltaneously so that RTA is in a poised state for reactivation (Gunther and Grundhoff) In tissue culture, RTA can b e reactivated in to lytic phase by adding TPA or sodium butyrate (NaB) (Miller et al. 1997; Renne et al. 1996b) TPA, a phorbol ester and pleotropic activator of gene expression, can de methylate RTAs promoter and NaB is an inhibitor of histone deacetylase (HDAC) both of which can allow RTAs promoter to beco me ac cessible for activation (Chen et al. 2001) KSHV Encodes miRNAs In 2005 and 20 06 four independent groups cloned miRNAs from KSHV infected PEL and identified a total of 12 miRNA genes giving rise to 18 mature miRNAs (Cai et al., 2005; Grundhoff et al., 2006; Pfeffer et al., 2005; Samols et al., 2005; Umbach and Cullen, 2010) Surprisingly, all KSHV miRNAs are located within the major latency associated region of the genome with 10 of the 12 miRN As organized in a cluster in a 2.6 kb intragenic region between v FLIP and the K12/Kaposin gene. Two additional miRNAs were found to be located within K12 open reading frame. Expression of the 12 pri miRNA stem loops (discussed in MiRNA Biogenesis) is controlled by three promoters, 2 latent and 1 lytic. The latent promoters results in expression of all 12 miRNAs whereas the lytic promoter slightly upstream of Kaposin results in increased levels of miR K12 10 and miR K12 12 expression during lytic replication (Cai and Cullen, 2006)

PAGE 18

18 MiRNA Discovery The first miRNA, lin 4 of C. elegans, was found through analysis of a strong developmental timin g defect. The responsible gene, lin 4, did not contain an ORF, and instead only expressed two short transcripts of 60 and 24 nucleotides in length. It was subsequently shown that the lin 4 RNA was involved in translationally silencing the lin 14 transcript by binding to complementary sequences within the lin UTR (Lee et al. 1993; Ruvkun et al. 2004; Wightman et al. 1991; Wightman et al. 1993) This novel RNA based inhibition wa s specific to C. elegans until the discovery of the let 7 miRNA, which was found to be conserved in metazoans, including humans and flies (Pasquinelli et al. 2000; Reinhart et al. 2000; Slack et al. 2000) M iRNAs have been discovered in every metazoan and plant species tested thus far, and according to estimates, around 30% of all metazoan miRNAs are conserved in all species (Ambros, 2004) There are cur rently 1, 921 human miRNAs known and this number is predicted to expa nd as more sensitive techniques for discovering miRNAs are developed ( http://microrna .org ) (Griffiths Jones, 2004) The major function of miRNAs appears to be regulation of gene expression throu gh translational inhibition and mRNA degradation; however, there a re classes of miRNAs discovered which have different m echanisms of action. MiRNAs are an integral part of innate immunity against viruses in plants, and in many organisms, miRNAs are also involved in chromatin silencing (for revi ews see (Iorio et al., ; Li e t al., 2002; Lippman and Martienssen, 2004) M iRNAs participate in the reg ulation of apoptosis, cell fate decisions, cell differentiation, stress response, and development (Ambros, 2004; Bartel, 2004) However, tho se miRNAs where targets are known and the rapid identification of n ew targets showcase that miRNAs regulate fundamental processes during development and differentiation and

PAGE 19

19 that miRNA expression is tightly regulated in both spatial and temporal manners (Ambros, 2004; Bartel, 2004) This is further supported by the finding that aberrant miRN A expression is associated with pathogenesis including many hum an malignancies (for review see [ Calin and Croce, 2006 ] ) MiRNA Biogenesis and Function Viral miRNA genes are expressed from pol II transcripts or in the case of murine g herpesvirus t ype 68 (MHV 68), in which miRNA genes are embedded in tRNA like genes by pol II I (Ambros, 2004; Bartel, 2004; Bogerd et al. ; Diebel et al. ) M iRNAs can occur individuall y or be organized into clusters and they can exist as stand al one genes or located within the introns and exons of protein coding genes (Ambros, 2004; Bartel, 2004) Like metazoan miRNAs, viral miRNA proce ssing begins with the formation of an imperfect stem loop with a hairpin bulge that forms in a RNA transc ript termed the pri miRNA (F igure 1 3). The dsRNA region of the pri miRNA i s recognized by DGCR8 (Pasha in flies), which recruits the en donuclease Drosha to cleave and release a 60 80 nt long hairpin. This pre miRNA is then exported to the cytoplasm by the Expo rtin 5/RAN GTPase pathw ay, where it is recognized by Dic er and cleaved to leave a short dsRNA molecule. One strand of this dsRNA product is loaded by Dicer and the dsRNA bind ing protein TRBP (also known as R2D2 in flies and RDE 4 in nematodes) into the RNA induced silencing comp lex (RISC). The other strand, known as the star (*) strand, is often degraded, but i n many cases can also be loaded into RISC with variable efficiency (for review see [ Ambros, 2004; Bartel, 2004 ] ). RISC functions by guiding miRNAs to semicomplementary UTRs of target transcripts and induces translational silencing. For targets that are completely complementary, siRNA like degradation occurs rather than translational silencing. end of the miRN A,

PAGE 20

20 specifically nts 2 through 8 termed the seed sequence, is critical for determining mRNA target binding, but there are rare cases of miRNA bind ing sites that have little seed compen satory complementarity instead. Many target tr anscripts have multip le binding sites for a specific miRNA, and it is also common th at a single mRNA is targeted by multiple miRNAs. Due to the rather flexib le requirements for recognition between the miRNA and its target, a single miRNA can regulate many targets (Grimson et al. 2007) There fore, miRNAs constitute a large posttranscriptional regulatory network which controls complex processes such as development and cell differentiation. Aft er binding of RISC to the accomplished thr ough a yet not fully deciphered mechanism(s). Current evidence suggest s several different mechanisms: inhibition of translational initiation by interfering with the interaction of eIF4E, eIF6E, a nd the poly(A) binding protein, premature termination of tr anslation by inducing ribosomal drop off following initiation, a nd messenger RNA degradation by relocation of the RISC to cy toplasmic Processing (P) bodies which contain the RNA degradation machin ery (Filipowicz et al. 2008) Viral miRNAs In 2004, Pfeffer et al. reported the cloning and identification of five miRNAs from Epstein Bar r virus (EBV). Initially, three miRNAs were found to be loc ated in the BHRF region and two miRNAs in the BART region of EBV (Pfeffer et al. 2004) This first report of virally encoded miRNAs opened a new fie ld of virology. The possibility that viral miR NAs can regulate hundreds of target genes suggests a novel and extremely complex level of host/virus interaction. A number of herpesvirus proteins, o ften pirated from host genomes, target specific cellular process es such as immune surveillance,

PAGE 21

21 apoptosis, and proliferation, and in retrospect, it seems obvious that viruses would also utilize miR NAs to regulate these pathways. To date, more than 200 mi RNAs have been identified in 20 different DNA viruses (Table 1 1, Figure 1 4 ). After EBV was shown to encode miRNAs, four independent groups cloned sarcoma associated herpesvirus (KSHV) infected primar y effusion lymphoma cells (PEL) and identified a total of 12 miRNA genes giving rise to 18 mature miRNAs (Cai et al., 2005; Grundhoff et al., 2006; Pfeffer et al., 2005; Samols et al., 2005; Umbach and Cullen, 2010) Next, a combination of tiled arrays, cloning, and bioinformatic approaches identified 18 additional EBV m iRNAs, located within the 12 kb del etion specific to the B95 8 strain analyzed in the original report (Pfeffer et al. 2004) and three more within the BART region outside of the B95 8 deletion (Cai et al. 2006 ; Grundhoff et al. 2006) Rece ntly, two additional BART miRNA genes were identified in EBV pos itive nasopharyngeal carcinomas (NPC) tissue samples (Zhu et al. 2009) Thi s brings the total of EBV miRNA genes to 25. Cai et al. also reported 16 miRNAs within the EBV related Rhesus lymphocryptov irus (rLCV), eight of which are conserved to EBV miRNAs (Cai et al. 2006) Recently, both Grundhoff and Steitz groups have identified additional rLCV encoded miRNAs bringing the total to 36, 18 of which are conserve d to EBV (Riley et al. ; Walz et al. ) The extent of conservat ion between EBV and rLCV miRNAs sequences is not found elsewhere in g herpesviruses. Schaefer et al. reported seven miRNAs within the Rhesus Rhadinoviru s (RRV), a g herpesvirus closely related to KSHV (Schafer et al. 2007) Like KSHV, RRV miRNAs are located within t he latency associated region of RRV; however, their sequences are not evolutionary conserved. Murine g herpesvirus type 68 (MHV68) encod es nine miRNAs which are located within

PAGE 22

22 t ransfer RNA like gene end of the genome and have been shown to be transcribed by RNA pol III (Bogerd et al. ; Diebel et al. ; Pfeffer et al. 2005) Within b herpesviruses, nine mi RNAs were identified from human cytomegalov irus (HCMV), scatte red throughout the viral genome (Pfeffer et al. 2005) (Figure 1 4). Dunn et al. clone d a previously unreported miRNA and Grey et al. used a bioinformatic s approach to predict conserved hairpins between HCMV and chimpanzee CCMV (Dunn et al. 2005; Grey et al. 2005) Both approaches predi cted and confirmed two new HCMV miRNAs for a current total of 11 HCMV miRNAs. Th ese studies also illustrated that bioinformatics ap proaches alone are not reliable tools for the identification of miRNAs. In a herpesviruses, miRNAs have be en identified in Herpes simplex virus 1 and 2 (HSV 1 and and 2 (MDV 1 and 2) (Burnside et al. 2006; Burnside et al. 2008; Cui et al. 2006; Jurak et al. ; Tang et al. 2008; Tang et al. 2009; Umbach et al. 2008; Umbach et al. 2009; Waidner et al. 2009; Yao et al. 2007) La tency of HSV is primarily established in the sensory neuro ns of the trigeminal and sacral ganglia. As seen in KSHV, a herpesviruses al so encode miRNAs during latency. In 2006, Cui et al. predicted several miRNAs within and upstream of the HSV 1 and HSV 2 l atency associated transcript (LAT) (Cui et al. 2006) LAT is a noncoding mRNA and is believed to be the only transcript expressed abundantly during latency. S ubsequently, Umbach et al. showed that the HS V 1 LAT functions as a pr imiRNA giving rise to four miRNAs (Umbach et al. 2008) Additionally, one miRNA is located directly upst ream of LAT and was found to be expressed in latently infected mouse trigeminal ganglia (Umbach et al. 2008) Tang et al. first reported LAT encoded

PAGE 23

23 miRNAs of HSV 2 (Tang et al. 2008; Tang et al. 2009) Umbach and colleagues valida ted the expression of the HSV 1 and HSV 2 miRNAs i n human trigeminal ganglia and sacral ganglia by using sensitive deep sequen cing methods. Additionally, two more miRNAs located within LAT of HSV 1 and three novel HSV 2 miRNAs were identified (Umbach and Cullen, 201 0; Umbach et al., 2009) Recently, Jurak et al. utilized deep sequencing to co nfirm previously identified and predicted miRNAs by Cui, Umbach, a nd Tang, along with identifying 19 new HSV 1 and HSV 2 encoded miRNAs, bringing the total number of HSV 1 miRNA s and HSV 2 miRNAs to 16 and 17, respectively (Table 1 1, Figure 1 4). Interestingly, HSV 1 and HSV 2 share nine miRNAs that are either positional conserved and/or show limited sequence homology (Jurak et al. ) Burnside et al. used 454 deep s equencing to identify 13 miRNAs us type 1 (MDV 1), which map to the inverted repeat short and l ong regions (IRs and IRL) (Figure 1 4). Eight of these miRNAs are loca ted within the meq oncogene and the remaining map to the LAT region of MDV 1 (Burnside et al. 2006; Burnside et al. 2008) Conventi onal miRNA cloning and recently deep sequencing, revealed 18 miRNAs within the closely related MDV 2 virus, 17 of which were clustered within IRL with one additional located in IRS (Waidner et al. 2009; Yao et al. 2007; Yao et al. 2008) Outside the herpesvirus fami ly, two miRNAs resulting from a single hairp in were transcript (Sullivan et al., 2005) Positional hom ologs of the se SV40 miRNAs were also isolated from SA12 infected cells (Cantalupo et al., 2005) Human polyomaviruses BKV and JCV along wit h Merkel cell polyomavirus were also shown to encode one miRNA each (Seo et al., 2009; Seo et al., 200 8) Recently, Sullivan et al. also showed that murine polyomavirus (PyV) encodes

PAGE 24

24 one miRNA gene (Sullivan et al., 2009) All polyomavirus miRNAs are located antisense to the viral mRNAs en coding large T antigen. He nce, while common in he rpesviruses and polyomaviruses, miRNA encoding genes appear to b e rare in other virus families. It appears that no RNA vir us investigated to date encodes miRNAs. Pfeffer et al. were unable to clone miRNAs fr om cells infected with eit her hepatitis C vi rus, yellow fever virus, or HIV (Pfeffer et al., 2005) and there have been no other reports of miRNAs being predicted and verified in other RNA viruses. T hus, it appears as if miRNAs are a DNA virus specific phenomenon. Since all RNA vi ruses (except for retroviruses) progres s through a dsRNA intermediate, miRNAs would ultimately act as siRNA and inhibit viral replication. Additionally, transcri pts from RNA viruses that often replicate exclusively in the cyto plasm would have to be shuttled into the nucleus to be processed by Drosha. This same issue arises with poxviruses replicating sol ely in the cytoplasm, which may explain why only very few mi RNAs have been predicted within the more than 300 kbp large double stranded DNA genomes of poxviruses and none have been experimentally confirmed (Pfeffer et al., 2005) At this admittedl y early stage in the field it appears that predominantly herpesviruses encode miRNAs, which may be just another example for host cellular genes that have been successfully captured and subsequently coevolved into herpesvirus genomes. Targets of KSHV miRNA s Up to 25% of all herpesvirus genes modulate host cellular functions during both latent and lytic in fection and it was hypothesized early on that viral miRNAs will greatly increase the complexity of virus/host interaction (Areste and Blackbourn, 2009) To da te, most efforts on identifying cellular genes targeted by vi ral miRNAs have been focused on KSHV and EBV. In summary, these studies reveal that viral miRN As target

PAGE 25

25 ke y cellular pathways, inc luding immunity, proliferation, angiogenesis, and apoptosis (Table 2 2 ). The first cellular target genes for viral miRNAs were identified by gene expression profiling of HEK 293 cells stably expressing KSHV miRNA cluster containing 10 miRNAs (Samols, 2007) A total of 65 genes were downr egulated in the presence of the miRNAs. SPP1, PRG1, and THBS1 were verified as miRNA targets using luciferase repor UTRs. Additionally, protein levels of THBS1 w ere decr eased >10 fold in KSHV miRNA expressing cells. This was s ignificant since THBS, a strong tumor suppressor and antiangioge nic factor, had previously been reported to be downregulated in KS lesions (Taraboletti et al., 1999) UTR of THBS contained seed sequence binding sites for multiple KSHV miRNAs suggestin g that viral miRNAs in clusters coordinately regulate host cellu lar target genes. SPP1 and PRG1 are involved in cell mediated immuni ty and apo ptosis, respectively. These initial findings, albeit obtained in 293 cells, suggest that KSHV encoded miRNAs cont ribute to viral pathogenesis by promoting angiogenesis (a hallmark of KS tumors) and by inhibiting cellular immunity and apoptosis (Samols, 2007 ) Viral miRNAs can mimic cellular miRNA function. We and the Cullen group showed th at miR K12 11 and human miR 155 shared complete seed sequence identity (Gottwein et al., 2007; Skalsky et al., 2007) Mir 155 is a berrantly expressed in many human malignan cies, and when overexpressed in mice, causes lymphoproliferative disease (Garzon and Croce, 2008) Th is led to question if miR K12 11 and miR 155 can target a common set of genes. Bioinformatics ident ified the BACH1 gene, which has four binding sites for both mi R K12 11 and miR UTR. BACH1 is a

PAGE 26

26 transcriptional repressor affecting expressio n of heme oxygenase 1 (HMOX1 ), a protein that promotes cell survival and proliferation. Lucif erase reporter assays confirmed regulation of BACH1, and fu rthermore, BACH1 protein levels were decreased in miR K12 1 1 and miR 155 expressing cells. Gene expressi on profiling al so revealed that miR K12 11 and miR 155 can regulate a common set of genes (Gottwein et al., 2007; Skalsky et al., 2007) In addition, Qin et al. showed that miR K12 11 dependent regulation of BACH 1 not only affected oxida tive stress responses, but also led to an increase of xCT express ion, an amino acid transporter, which was previously shown to function as fusion receptor for KSHV (Qin et al., 2010a) Qin and colleagues also showed that KSHV encoded miRNAs induce IL 6 and IL 10 secr etion in murine macrophages and human myelomonocytic cells (Qin et al., 2010b) C/EBP a known regulator of IL 6 and IL 10 transcription, was shown to be targeted by the KSHV miRNA cluster. Specifically, miR K12 3 and miR K12 7 inhibited the LIP isoform of C/EBPb, whi ch functions as transcriptional suppressor. These data suggest that KSHV encoded miRNAs directly regulate cytokine secretion of latently infected cells (Qin et al., 2010b) Recently, Isaac Boss from our lab has shown that miR K12 11 also targets C/EBP As described above, miR K12 11 i s an ortholog of human miR 155. To compare both miRNAs function in vivo miRNAs were expressed in human hematopoietic progenitor cells and reconstituted in NOD/LtSz scid IL2R null mice. Results showed that B cells within the spleens of miR K12 11 or miR 155 expressing mice have decreased C/EBP expression. MiR K12 11 targeting of C/EBP was further

PAGE 27

27 confirmed (Boss et al., 2011) Endothelial cells infected with KSHV have been shown to undergo transcriptional reprog ramming, expressing markers for both lymphatic (LECs ) and blood endothelial cells (BECs) (Carroll et al., 2004; Wang et al., 2004) Hansen et al. recently s howed that KSHV miRNAs directly contribute to this reprogramming by targeting the cellular transcription factor musculoap oneurotic fibrosarcoma oncogene homolog (MAF). MiR K12 6 and miR K12 UTR of MAF, thereby inducing e ndothelial cell differentiation and possibly contribute to KSHV oncogenesis (Hanse n et al., 2010) Interestingly, miR K12 11, the ortholog of miR 155, is also involved in B cell differentiation and proliferation in vivo (Boss et al., 2011) A study by Abend et al. demonstrated KSHV miR K10a targets tumor necrosis factor (TNF) like weak inducer of apoptosis receptor (TWEAKR) This was observed by overexpressing miR K 12 10a in prim ary endothelial cells which resulted in reduced production of the pro inflammatory cytokine IL 8 and monocyte chemoattractant protein 1 (MCP 1) (Abend et al., 2010) Interestingly these pro inflammato ry cytokines are induced by KSHV proteins (vFLIP and vGPCR) and may promote tumorigenesis (Schwarz and Murphy, 2001; Sun et al., 2006) To understand this conflicting regulation the authors hypothesize that miR K10 a dependent regulation of IL 8 and MCP 1 may provide a mechanism that fine tunes cytokine expression to levels beneficial for the virus, without eliciting a strong immune response (Abend et al., 2010) KSHV miRNAs have been shown to target genes involved in immune evasion. Recently, it was shown that KSHV miR K12 11 targets I kappa

PAGE 28

28 an important signaling molecule in the antiviral interferon response pathway (Liang et al., 2011) Also miR K12 7 has been shown to target MICB, a stressed induced ligand that is essential for natural killer cell recognition of virus infected cells (Nachmani et al., 2009) Interestingly, two other herpesviruses, HCMV and EBV, also encode miRNAs that have been shown to target MICB (Nachmani et al., 2009; Stern Ginossar et al., 2007) Thus, this coevolution suggests that targeting MICB to prevent virus infected cells from being recognized by NK cells is a critical step for viral persistence in vivo. The Ganem group devised an elegant tandem array approach to identify KSHV miRNA targ ets that were either induced by miRNA kn ockdown in latently inf ected PEL cells or inhibited in uninfected B cells ectopically ex pressing the corresponding KSHV miRNA (Ziegelbauer et al., 2009) This analysis revealed that miR K12 5, along with K12 9 and miR K12 10b, targets Bcl 2 associated factor (BCLAF1). BCLAF1 is a transcription al repressor and overexpression can promote apopto sis. However, BCLA F1 expression in latently infected PEL cells can inhibit viral replication. Antagomir based inhibition of KSHV miRNAs targeting BCLAF1 resulted in sensitizing latently infec ted endothelial cells for lytic reactivation. This data suggest that KSHV miRNAs ca n contribute to latency control by both targeting the viral RTA gene as discussed above and cellular genes like BCLAF1 (Ziegelbauer et al., 2009) Unlike the above study, there have been several reports that KSHV miRNAs help contribute to latency by targeting cellular factors. Lu et al. found that both human and viral miRNA expression is important for the pre vention of lytic reactivation. They further went on to show that by overexpression of miR K12 3 by lentivirus in BC 3 cells resulted in decreased RTA mRNA levels. Next, miR K12 3 was shown to directly target

PAGE 29

29 NFIB, a cellular transcription factor. The mu rine version of NFIB was shown by Yu et al. to reactivate KSHV in BC 3 cells when over expressed by a genome wide cDNA library screen (Yu et al., 2007) Further analysis by promoter luciferase assays in 293 cells c onfirmed that human NFIB does activate the RTA promoter, although it is not known if this is a direct interaction (Lu et al., 2010a) This study provides indirect evidence that miR K12 3 maintains latency by targeting NFIB, but further experiments using antagomirs or a miR K 12 3 knockout virus are needed to prove this mechanism. The above studies on KSHV were based on eith er latently infected cell lines or cell lines engineered to e xpress viral miRNAs. Two recent studies addresse d the role of KSHV miRNA within the context of the viral genome (Lei et al., 2010; Lu et al., 2010b) Both developed a to study viral replication. Lei et al. observed a marked inhibition of NF kB in 293 cell s infected with the virus mutant, whic h was accompanied by a moderate increase in lytic replication. IkBa, the NF k B repressor was subsequently shown to be targeted by miR K12 1 (Lei et al., 2010) This is the second example of a KSHV miRNA that contributes to latency by targeting cellular genes. Gottwein and colleagues reported another target for miR K12 1 which like NF k B is crucial for cell survival and proliferation. Using bioinforma tic tools and luciferase assays and mutagenesis, it was shown that miR K12 1 directl y targets p21, a key inducer of cell cycle arrest and tumor suppressor (Gottwein and Cullen) Using a very similar miRNA knock out virus, Lu et al. also observed a moderate increase in ly tic replication, but iden tified entirely different mechanisms. In addition to inhibiti ng RTA through miR K12 5, Lu et al. observed a drastic inhibition of DNA methylation throughout the KSHV genome after deleting the miRN A cluster.

PAGE 30

30 Subsequently, it was shown that Retinoblastoma (R b) l ike protein 2 (Rbl 2), a potent inhibitor of DNA (cytosine 5 ) methyltransferases (DnmT1, 3a, and 3b), was targeted by several KSHV miRNAs. These data showed for the first time a rol e of viral miRNAs in epigenetic regulation of latency (Lu et al., 2010b) The latest technique to identify miRNA targets utilizes immunoprecipitation of RISCs followed by microarray or HTS sequencing analysis of the RISC bound miRNA targets (Chi et al., 2009; Hafner et al., 2010) Using this technique, Dolken et al. wa s able to confirm a significant number of the above discussed targe ts, and in addition, determined six novel targets of KSHV miRNAs and two targets of EBV miRNAs (Dolken et al., 2010) KSH V miR K12 3 was shown to target LRRC8D, thought to be involved in prolifer ation and activation of lymphocytes and macrophages and NHP2L1, a nuclear protein that binds to U4 snRN A. MiR K12 4 3p targets GEMIN 8, which is required for spliceosomal snRNP assembly in the cytoplasm and pre mRNA splicing in the nucleus. Also, the KSHV miR cluster was fou nd to target EXOC6, ZNF684, and CDK5RAP1; however, no functio nal studies have been presented on these novel target genes (Dolken et al., 2010) Recently it has been shown that KSHV miRNAs target within the viral genome. To investigate whether KSHV mi RNAs target KSHV immediateearly transactivators, Bellare and colleagues utiliz ed luciferase UTR of the KSHV reactivation and transcrip tional activator gene (RTA) was cotransfected with individual KSHV miRNA mimics. Further analysis of miRNA knockdown using antagomirs (sequence specific miRNA inhibitors ) in latently infected PEL cells showed that miR K12 9* modulates RTA expression at the protein level (Bellare and Ganem, 2009) Lu et

PAGE 31

31 al. also found that a KSHV miR K12 5 can inhibit RTA expression. However, this may reflect an indirect effect rather than direct targeting, UTR of RTA does not contai n a favorable miR K12 5 seed sequence (Lu et al., 2010b) Later it was demonstrated that miR 7 5p also targets RTA. Lin et al found a 7mer seed match site c expression of miR K12 7 5p in latently infected cell lines reduces the amount of progeny virus produced (Lin et al., 2011 ) Although these studies suggest that miRNAs function as major regulators of latency by directly targeting RTA, it is likely that KSHV miRNAs fi ne tunes latency rather than operate as a major controller of the switch between latency and reactivation. Chapter 2 focuses on two miRNAs, miR K12 3 and 11, and their role in the regulation of latency by targeting cellular transcription factors known to activate the RTA promoter. Chapter 3 describes the generation of individual miRNA deleted recombinant viruses and how they can serve as tools to study miRNA function in the context of both endothelial and lymphoid cell s. Lastly, in C hapter 4 I will dis cuss ongoing work and future studies on KSHV miRNA functions in latency and possible role as novel therapeutic targets for KSHV malignancies.

PAGE 32

32 Figure 1 1. The KSHV Genome. Open reading frames (ORFS) are labeled in color base d on their expression pattern during latent, immediate early, early, or late infection. The KSHV latency associated region (KLAR) is underlined in blue and the miRNA genes are labeled in orange.

PAGE 33

33 Figure 1 2. MiRNAs are encoded in the KSHV latency asso ciated region (KLAR). The latent genes in KLAR are in orange with the direction of latent transcription denoted by orange arrows. Latent p romoters are indicated by the black directional arrows. The miRNA cluster contains 10 miRNA genes and downstream of the cluster are 2 additional miRNA genes are encoded.

PAGE 34

34 Figure 1 3 Biogenesis pathway for metazoan miRNAs. MiRNA precursors begin as hairpin loops in pol II or pol III transcripts in introns or exons. Drosha cleaves the pri miRNA transcript leaving a ~80 bp stem loop which is exported into the cytoplasm. Dicer cleaves off the loop structure leaving a 21 24 nt dsRNA molecule. The miRNA is incorporated into the RISC where it binds to the lencing or transcriptional degradation depending on the level of complementarity. The seed sequence of the miRNA, nts 2 through 8, is known to be a critical component of target recognition and binding.

PAGE 35

35 Figure 1 4 Schematic representation of miRNAs foun d for several herpesviruses. Genomes are represented for HSV 1, 2, MDV 1, 2, HCMV, EBV, LCV, RRV, KSHV and MHV 68 with black arrows for ORFs, black triangles for tRNA genes, and black bars or rectangles for repeat sequences. MiRNA locations are indicat ed with green arrows. Genomes are not drawn to scale. MDV 1 & 2 are drawn as one complete genome with the respective miRNA coding regions shown in more detail Abbreviations: U S unique short; U L unique long; LAT, latency associated transcript.

PAGE 36

36 Table 1 1 Verified known viral miRNAs. Virus Number of miRNA genes HSV 1 16 HSV 2 17 MDV 1 13 MDV 2 17 HCMV 11 MCMV 18 EBV 25 LCV 36 RRV 7 KSHV 12 MHV 68 9 SV40 1 SA12 1 BKV 1 JCV 1 MCV 1 PyV 1

PAGE 37

37 Table 1 2. Experimentally verified vira l miRNA targets. KSHV Viral Targets miR K12 9* miR K12 5 miR K12 7 RTA Replication and Transcriptional Activator Cellular Targets miR Cluster THBS1 EXOC6 ZNF684 CDK5RAP1 Angiogenesis inhibitor SEC15 gene family Zinc finger protein Regulation of neuron al differentiation miR K12 1 p21 NF Inducer of cell cycle arrest miR K12 3 LRRC8D NHP2L1 NFIB Immune cell activator U4 snRNA nuclear binding protein Transcriptional Activator miR K12 3 miR K12 7 miR K12 11 Transcriptional Activator miR K12 4 3p GEMIN8 Required for splicing miR K12 5 BCLAF1 Pro apoptotic factor Rbl 2 Rb like protein miR K12 6 miR K12 11 MAF Transcription factor miR K12 7 MICB NK cell ligand miR K12 11 BACH1 Transcriptional suppressor Ind ucer of interferon miR K12 10a TWEAKR Pro apoptotic factor

PAGE 38

38 CHAPTER 2 KSHV ENCODED MIRNAS REGUL ATE RTA PROMOTER ACT IVATION BY TARGETING CELLULAR T RANSCRIPTION FACTORS MYB, ETS Introduction associated herpesvirus (KSHV), also known as Human Herpesvirus 8 (HHV sarcoma (KS) in endothelial cells (Chang et al. 1994) KSHV has also been linked to two B cell lymphoproliferative disorders, primary effusion lymphoma (PEL) and a subset ( Cesarman et al., 1995a; Soulier et al., 1995) As with all herpesviruses, KSHV has both lytic and latent modes of replication. During lytic replication/reactivation, genome wide expression occurs in a temporally regulated cascade of immediate early, ear ly, and late genes, which results in release of progeny virus and lyses of the host cell (Sarid et al. 1998) During latency only a limited number of genes are expressed, the majority residing in the latency associated region, which encodes the latency associated nuclear antigen (LANA), v FLIP v cyclin, kaposin, vIRF3, vIL 6, K1, and 12 miRNA genes (Cai et al., 2005; Chandriani and Ganem, 2010; Dittmer et al., 1998; Grundhoff et al., 2006; Pfeffer et al., 2005; Rivas et al., 2001; Samols et al., 2005; Sa rid et al., 1998; Talbot et al., 1999) MicroRNAs (miRNAs) are short, non coding RNAs 19 23 nucleotides in length that post (UTRs) of messenger RNAs (for review see [ Bartel, 2004 ] ) Since the discovery of KSHV encoded miRNAs are highly expressed in all KSHV associated tumors (O'Hara et al. 2009; O'Hara et al. 2008) several cellular targets of KSHV encoded miRNAs have been identified, implicating roles for KSHV miRNAs in promoting angioge nesis, cell cycle regulation, and inhibition of apoptosis (for reviews see [ Plaisance Bonstaff and

PAGE 39

39 Renne, 2011; Skalsky and Cullen ] ). In addition, viral lytic genes have also been suggested to be targeted by viral miRNAs. Using in vitro assays, miR K12 9*, miR K12 5, and miR K12 gene ORF50, encoding the replication and transcriptional activator (RTA) (Bell are an d Ganem, 2009; Lin et al., 2011 ; Lu et al., 2010b) RTA is the first gene to be expressed during reactivation and initiates the cascade of lytic gene expression by activating several early lytic gene promoters (Lukac et al. 1998; Sun et al. 1998) Hence, direct targeting of RTA by miRNAs would prevent reactivation from latency. Here we report on an alternative scenario by which KSHV miRNAs contribute to the maintenance of latency by targeting cellular tra nscription factors that can trigger lytic reactivation. Our data demonstrate that miR K12 3 and miR K12 11 are important for preventing lytic reactivation by targeting three cellular transcription factors Ets 1, MYB, and C/EBP which have previously been report ed as activators of the RTA promoter (Lacoste et al. 2007; Wang et al. 2003; Yu et al. 2007) To confirm the importance of these miRNAs in contributing to latency, recombinant viruses harboring individual miRNA deletions were created. In the absence of miR K12 3 or miR K12 11 both spontaneous and induced RTA expression was increased. These data suggest that KSHV miR K12 3 and miR K12 11 contribute to the maintenance of viral latency by targeting cellular genes Ets 1, MYB, and C/EBP thereby acting as a gatekeeper to fine tune latency. Results KSHV miRNA K nockdown in BC 3 G C ells In order to determine which KSHV encoded miRNAs may be important for preventing lytic reactivation, miRNA knockdown studies were performed in BC 3 G, a

PAGE 40

40 PEL derived indicator cell line. BC 3 G contains a PAN promoter driven GFP expression cassette, which is highly transactivated by RTA. Upon lytic reactivation, RTA is the first protein expressed, activates the PAN promoter and as a result turns cells green (Yu et al. 2007) BC 3 G cells were transfected with sequence specific miRNA inhibitors, 2'OMe antagomirs, for each of the 12 KSHV encoded miRNAs. Cells were observed by fluorescence microscopy for GFP expressi on at 72 hours post transfection (hpt). Mock transfected control cells displayed a small number of GFP expressing cells representing spontaneous reactivation. After performing a screen by inhibiting all 12 KSHV encoded miRNAs individually or in combinati ons, the greatest increase in GFP expression was observed when miR K12 3 and miR K12 11 were knocked down ( Figure 2 1a ). MiR K12 3 is the most highly expressed miRNA in BC 3 cells (Gottwein et al. 2011) (Haecker et al. under revision ). Interestingly, miR K12 11 is a mimic of hsa mIR 155 and has been shown to play an important role in B cell proliferation (Boss et al. 2011; Gottwein et al. 2007; Skalsky et al. 2007) Reactivation of BC 3 G cells after antagomir knockdown was then quantified by using flow cytometry. Figure 2 1b shows a graph depicting the percent of GFP expressing cells over a time course of 96 hpt post antagomir transfection. MiR K12 3 knockdown lead to a 26% increase in GFP expressing cells when compared to the control. GFP expression was also induced wh en both miR K12 3 and miR K12 11 were knocked down together, although at a lesser extent (Fi gure 2 1b).

PAGE 41

41 In silico Target P redictio n for miR K12 3 and miR K12 11 I dentified Ets 1, Myb, and C/EBP as Potential T argets K12 3 or 11. We therefore focused on transcription factors known to activate the viral RTA promoter and performed miRNA target prediction (Grimson et al. 2007) Interestingly, we found p utative binding sites for miR K12 3 and miR K12 Ets 1, MYB, and C/EBP (Lacoste et al. 2007; Wang et al. 2003; Yu et al. 20 07) Ets 1 is a member of the Ets family of transcription factors, which are downstream effectors of the Ras MAPK signaling cascades (Wasylyk et al. 1998) The Ets family binds to a specific DNA consensus sequence and has been identified to bind and activate genes involved in the regulation of cell proliferation, differ entiation, and survival (Dejana et al. 2007) The proto oncogene MYB acts mostly as a transcriptional activator which plays a central role in hematopoiesis and has been shown to cooperate with a number of transcription factors including the CEBP and Ets families. Targets of the MYB transcription factors include genes involved in development, cell survival, proliferation, and homeostasis (Ramsay and Gonda, 2008) C/EBP is a member of the CCAAT/ Enhancer Binding Protein family, which are bZIP nuclear transcription factors. C/EBP is an important transcription factor involved in controlling tissue specific gene expression in myeloid tissues and growth arrest (Koschmieder et al. 2009) Ets 1 has three predicted binding sites for miR K12 3 and for miR K12 11. Myb has two potential sites for miR K12 11, and C/EBP has two potential sites for miR K12 3. All sites consist of at least a 6mer seed match with some extending to 8mer seed matches ( Figure 2 2a). 3'UTR luciferase reporter assays were performed to confirm miR K12 3 and/or miR K12 11 targeting of these tra nscription factors. The

PAGE 42

42 3'UTRs of Ets 1, MYB, and C/EBP were cloned downstream of firefly luciferase and co transfected into 293 cells with either a miR K12 3 or miR K12 11 expression vector. As shown in Figure 2 2b, MYB was targeted by miR K12 11 since increased miRNA 1 has a number of additional putative binding sites for KSHV miRNAs. Hence we tested miR K12 3 and 11 alone and in combination, as well as the pcDNA3.1/cl uster, which expresses 10 KSHV miRNAs (Samols, 2007) While expression of miR K12 3 had no significant effect, miR K12 3 and 11 in combination as well as the cluster lead to significant repression suggesting that Ets 1 is targeted by multiple KSHV miRNAs Equally C/EBP contained additional seed sequence matches and miR K12 3 expression alone did not lead to significant repression levels; however transfection of the miRNA cluster significantly reduced luciferase expression. Furthermore, independent Ago HITS CLIP data de monstrate that miR K12 3 directly targets C/EBP in BCBL 1 cells ( Figure 2 2c) (Haecker, 2012) In summary, these in vitro data show that all three transcription factors can be target ed by KSHV miRNAs. Ets 1, MYB and C/EBP Expression is D e rep ressed upon miR K12 3/mi R K12 11 K nockdown in PEL cells To investigate whether ETS 1, MYB, and C/EBP are regulated by KSHV miRNAs in latently infected PEL cells, BCBL 1 and BC 3 cells were transfected with increasing amount of miR K12 3 or miR K12 11 ant agomirs. To validate efficiency and specificity, miRNA knock down was measured by stem loop TaqMan qPCR which showed that antagomir transfection specifically inhibited miRNA expression up to 80% (Fig ure 2 3 ). RT qPCR was performed 48 hpt which revealed inc reased gene expression in a dose dependent manner upon miRNA knockdown ( Figure 2 4 ). Ets 2

PAGE 43

43 fold increases and MYB a 1.5 fold increase in expression compared to control. Ets 1 was also significantly de repressed in the presence of antagomirs for miR K12 3 and miR K12 11, confirming that both miRNAs are important for targeting. Lytic Gene Expression and Virus Production Increases upon miR K12 3 and miR K12 11 K nockdown in PEL cells We next asked whether miR K12 3 and miR K12 11 knockdown affects virus lytic gene expression beyond RTA and subsequently virus productio n. Following the same method as in Figure 2 4 BCBL 1 and BC 3 cells were transfected with increasing amounts of miR K12 3 antagomir, or a combination of miR K12 3 and miR K12 11. RT qPCR was performed 48 hpt to monitor RTA (immediate early gene), ORF59 (early gene involved in DNA replication), and ORF19 (late glycoprotein) expression Significant d e repression of lytic gene expression was observed at all stages of reactivation upon knockdown of miR K12 3 (Figure 2 5a) Moreover, lytic gene expression wa s induced more efficiently when both miR K12 3 and miR K12 11 were knocked down simultaneously. Next, we wanted to confirm that the increase in lytic gene expression translates into production of progeny virus. Cell free virus was isolated from BCBL 1 sup ernatants 6 days post antagomir transfection, viral DNA was extracted, and viral genome copy number was determined by qPCR. Figure 2 5 b shows that virus production increased in a dose dependent manner when both miR K12 3 and miR K12 11 were knocked down. Collectively, these data demonstrate that KSHV miR K12 3 and miR K12 11 contribute to the maintenance of viral latency presumably by targeting Ets 1, MYB, and C/EBP

PAGE 44

44 Generation of miRNA Deleted Recombinant KSHV BACmids and Latently I nfected iSLK cells In order to validate the role of miR K12 3 and miR K12 11 in the context of the viral genome, we generated two miRNA deletion mutants using the recently described KS HV BAC16, which was derived from the PEL cell line JSC 1 (Campbell et al. ) Briefly, short 20 to 25 bp regions were deleted from one arm of each pre miRNA, destroying pre miRNA hairpin formation without affecting neighboring miRNA expression. A modified version of the protocol detailed by Tischer et al was used to create markerless microRNA deletions within BAC16 (Tischer et al. 2006) Recombinant bacmids were validated by PCR and pulse field gel electrophoreses to monitor intact terminal repeats. Further details on the gener ation of r ecombinant bacmids in iSLK cells will be discussed in C hapter 3. Briefly, miRNA deletion mutants and wild type ( WT ) bacmids were transfected into 293T cells. After selection, BAC16 containing 293T cells were induced with TPA and valproic acid, and co cultured with iSLK cells, which harbor a doxycyclin inducible RTA and produce high levels of progeny virions (Myoung and Ganem, 2011) Co culturing of 293T and iSLK resulted in higher infection efficiency th an either cell free virus or direct transfection of bacmid DNA into 12 12 11 containing iSLK cells produce high titer progeny virus after doxycyclin induction (up to 1.14x10 7 genome copies/ ml). As a final qua lity control, episomal DNA isolated from latently infected iSLK cells containing miRNA deletion mutants or WT BAC16 were analyzed by Illumina based genome wide sequencing, which confirmed the presence of the appropriate deletion and only detected a very sm all number of mutations in each genome (Table 2 2 ).

PAGE 45

45 To test whether deletion of miR K12 3 or miR K12 11 had an effect on the maintenance of latency in iSLK cells, we analyzed spontaneous lytic gene expression during latent infection and reactivation upon i nduction with sodium butyrate by RT qPCR. During latency, both wild type BAC16 and miRNA deleted BAC16 infected iSLK K12 K12 11) expressed similar amounts of LANA ( Figure 2 6 K12 11 infected iSLK ce fold higher levels of lytic gene expression for RTA, ORF59, and ORF19 when compared to WT ( Figure 2 6 K12 3 iSLK cells did not display increased levels of spontaneous lytic gene expression. K12 3 and K12 11 are more sensitive to induction of lytic replication we treated bacmid infected iSLK cells with two different sub optimal concentrations of sodium butyrate (NaB), and analyzed RTA expression by RT qPCR at 12 and 72 hours post induction (hpi ). As shown in Figure 2 6 c, at 12 hpi K12 11 iSLK cells demonstrated increased RTA expression compared to K12 K12 11 iSLK cells displayed increased RTA expression. These results confirm t K12 3 and K12 11 expression contribute to the maintenance of latency in iSLK cells and are in agreement with the antagomir inhibition experiments in PELs (Fig ure 2 4 ). In summary, our results point to a mechanism in which the KSHV mi RNAs miR K12 3 and miR K12 11 function as gatekeepers of the RTA promoter by modulating cellular transcription factors in cells of both endothelial and lymphoid origin. Discussion Early after the discovery of herpesvirus encoded miRNAs it was hypothesized that these novel viral post transcriptional regulators may play a role in the regulation of

PAGE 46

46 latency by targeting lytic genes (Murphy et al. 2008) Indeed, one EBV miRNA gene miR BART2 is encoded antisense to BALF5 the EBV DNA polymerase, and targeting and cleavage of t he BALF5 mRNA has been experimentally confirmed (Barth et al. 2008; Pfeffer et al. 2004) For KSHV, elegant work from the Ganem lab utilizing miRNA mimic and anta gomir based screens provided evidence that KSHV miRNAs can modulate latent/lytic transition through direct targeting of RTA by miR K12 9*, and by miR K12 5 and 11 targeting a host factor BCLAF1, which was shown to sensitize cells for reactivation (Bellare and Ganem, 2009; Ziegelbauer et al., 2009) Based on in silico prediction and in vitro luciferase assays direct targeting of RTA expression was also demonstrated for miR K12 5 and 7 (Lin et al., 2011 ; Lu et al., 2010b) Here we used BC 3 G cells, that report RTA activity using the highly RTA responsive PAN promoter driving GFP, to ask whether antagomir based inhibition of KSHV miRNAs activates RTA. Inhibition of s ingle or multiple miRNAs in combination revealed that in this experimental system only miR K12 3 and mir K12 11 lead to significantly increased RTA expression levels (Fig ure 2 1). It is not clear why inhibition of miR K12 5 and 7 did not activate RTA expr ession in BC 3 G, however, we note that miR K12 3 and 11 expression levels are higher in BC 3 cells compared to BCBL 1 cells used in previous screens (Gottwein et al. 2011) Additionally, miR K12 9* is not expressed at all in BC 3 cells due to the presence of a highly polymorphic miR K12 9 pre miRNA (Marshall et al. 2007) Hence, BCLAF1 targeting may not play a role in BC 3 cells. We note that recent ribonomics reports on KSHV miRNA targetomes using PAR CLIP and HITS CLIP did not reveal KSHV miRNA targeting of RTA in two different PEL cell lines i ncluding BC 3 during latency In contrast, BCLAF1, which was reported to sensitize

PAGE 47

47 cells for reactivation, was validated as a viral miRNA target in BCBL 1 (Gottwein et al. 2011; Haecker, 2012; Ziegelbauer et al. 2 009) coding region contains any mir K12 3 and 11 seed sequence matches, miRNAs in BC 3 G cells must indirectly regulate RTA by targeting cellular genes that positively regulate RTA. A number of cellular transcrip tion factors have been identified to activate the RTA promoter including MYB, Ets (Lacoste et al. 2007; Wang et al. 2003; Yu et al. 2007) which all contain seed sequence matches for miR K12 3 and 11 and where de repressed in antagomir transfected PEL cells (Fig ure 2 4 ). Lacoste and colleagues demonstrated that MYB transactivates the RTA promoter in the absence of any KSHV protein expression and furthermore that v FLIP and v GPCR induction of NF leads to downregulation of MYB expression in PEL cells (Lacoste et al. 2007) Thus, miR K12 11 fine tunes MYB expression post transcriptionally in conjunction with virally encoded proteins that regulate MYB throu gh NF regulated by miR K12 1 thereby also inhibiting lytic growth (Lei et al. 2010) Ets 1 was originally identified as activator of RTA by utilizing BC 3 G to perform a genome wide screen to identify cellular proteins and pathways that reactivate KSHV (Yu et al. 2007) The Raf/MEK/ERK pathway was demonstrated to mediate KSHV reactivation and Ets 1, which is a downstream effector of this pathway, directly activates the RTA promoter. Ets 1 contains multiple putative KSHV miRNA binding sites in addition to 6 seed sequence matches for miR K12 3 and assays (Fig ure 2 2b). Hence, miR K12 3 and 11 targeting of Ets 1 contributes to maintenance of latency by inhibiting Raf/MEK/ERK induced activation of RTA. Wang

PAGE 48

48 romoter (Wang et al. 2003) functions during lytic reactivation by interacting with RTA to bind and activate the K8 promoter, an early replication associated protein. K8 then interacts with an d stabilizes genes PAN and ORF57 (Wang et al. 2003) Therefore, miR K12 represents a central regulatory node to negatively modulate several immediate early and early genes. A common feature of these transcription factors is their involvement in signaling pathways as par t of cellular stress responses. The RTA promoter contains multiple transcription factor binding sites thereby sensing multiple stress response pathways which link cell stress to lytic reactivation. We believe that KSHV miRNAs fine tune the regulation of MYB, Ets has to be overcome before the lytic cascade is initiated. Rather than acting like an on/ off switch, viral miRNAs serve as gatekeepers of latency by controlling multiple host cellular p athways that when activated lead to RTA activation. In contrast to directly regulating RTA, targeting multiple cellular genes allows for greater flexibility in regulation of latency in different tissues and cell types where both the viral miRNAs and their cognate targets are expressed differentially (O'Hara et al. 2009; O'Hara et al. 2008) For example Ets 1 levels are higher in endothelial cells while MYB is a master regulator of hematopoietic cells. In this co ntext, we demonstrated that iSLK cells 11 BAC16 were able to reactivate at a

PAGE 49

49 significantly higher rate under sub optimal induction when compared to cells infected with WT BAC16 (Fig ure 2 6 c). Hence, miR K12 3 and miR K1 2 11 contribute to maintenance of latency in cells of endothelial and lymphoid origin, and their knock down or absence is associated with a more lytic phenotype. In summary, our data on miRK 12 3 and 11 as well as other reports (Ziegelbauer et al. 2009) suggest a model whereby viral miRNAs contribute to the regulation of a key step in the herpesviral life c ycle, the transition from latency to lytic replication by post transcriptionally modulating multiple signaling pathways. It is noteworthy that again some of these targets are co regulated by other latency associated genes as in the case of M Therefore, we propose that the miRNA regulation contributes to the ability to quickly respond to environmental stimuli based on small changes in RNA expression levels, which can overcome the intricate balance between miRNA copy numb er and their cognate targets (Baccarini et al. 2011; Mukherji et al. 2011) A similar miRNA based factors that regulate pluripoten cy during differentiation (Marson et al. 2008) In conclusion, our data strongly suggest that miR K12 3 and miR K12 11 contribute to viral latency by targeting the host cellular transcription factors MYB, Ets 1, a cells of lymphoid and endothelial origin. Materials and Methods Cell L ines BC 3 G cells were kindly provided by Ren Sun (UCLA) (Yu et al. 2007) BC 3 G, BC 3 and BCBL 1 cells were cultured in RMPI su pplemented with 10% FBS, 1% P/S, and 1% sodium pyruvate. HEK293 and HEK293T cells were cultured in DMEM with

PAGE 50

50 10% FBS and 1% P/S. iSLK cells were kindly provided by Don Gamen (UCSF) (Myoung and Ganem, 2011) and were cultured under the same conditions as 293 cells. Flow Cytometry BC 3 G cells (1x10 6 ) were pelleted and resuspended in 1XPBS with 2% FBS. Cells were analyzed for GFP expression using the Accuri C6 flow cytometer in the ICBR, University of Florida. 10,000 cells were counted in triplicates and cells were normalized to background fluorescence from BC 3 cells. Luciferase Assays and Reporter C onstruction MYB, Ets the luciferase gene in pGL3 pr omoter (Promega) using pCRII TOPO (Invitrogen) for MYB and GeneArt Seemless Cloning (Invitrogen) for Ets g can be found in T able 2 1. HEK293 cells were transfected using TransIT 293 reagent (Mirus) in 24 well cell cu lture dishes according to the Renilla 400 or 800 ng of the pcDNA3.1 miRNA expression vector complemented with 800, 400, or 0 ng of empty pcDNA3.1 vector as filler to reach 800 ng total pcDNA3.1 in each transfection (Samols, 2007) Cells were harvested 72 hrs post transfection and luciferase activity was quantified using the Dual Luciferase Repo rter kit (Promega) activity using a FLUOstar OPTIMA reader (BMG Labtech). Firefly luciferase activity for each sample was normalized to Renilla expression and sample s were compared to the miRNA mock transfection control. Transfection assays were performed in triplicate and repeated at least 3 times. Standard deviation was calculated for triplicates and

PAGE 51

51 displayed as error bars in the figures. Significance of the rep ression of the reporter construct relative to the 0 ng miRNA expression vector was tested by one tailed, unpaired t test. Antagomir Derepression Assays and Quantitative Reverse Transcription PCR (RT qPCR) A nalysis ntagomirs were used as previously described (Skalsky et al. 2007) PEL cells (1x10 6 ) were transfected with 50 400 nM of antagomir using TransIT TKO transfection reagent (Mirus) as described (Boss et al. 2011) At 48 hours post transfection (hpt) cells were harvested using RNA Bee (Tel Test) a suggestions. Quantitative PCR (qPCR) analysis was carried out using an ABI StepOne Plus syst em along with ABI Fast SYBR reagent (Applied Biosystems, Carlsbad, CA). actin expression and student t tests were performed to determine statistical significance compared to the mock control. Primers for ge nes can be found in T able 2 1. Virus Isolation and Q uantitation Virus particles were har vested from PEL cells 6 days post transfection (dpt) of antagomirs. Cells were pelleted at 1100 RPM for 5 minutes and media supernatant was Virus particles were then pelleted by ultra centrifugation using a Beckman SW 40 rotor at 100,000 x g for 1 hr on a 25% sucrose cushion. Virus pellets were then resuspended in 1% of its original volume using serum free RPMI. DNA was extracted from 25 2 O. Viral genome copy

PAGE 52

52 number was determined by qPCR assay using serial diluted LANA expression plasmid as a standard curve. Generation of iSLK KS HV BAC C ell s KSHV BAC16 was kindly provided by the Jung lab (USC). A detailed modified version of the protocol by Tischer et al was used as described in the results section (Tischer et al. 2006) BAC DNA was isolated from bacteria using the Large Construct were then 293 reagent (Mirus) according to the B and were expanded for 10 15 days. Transfected cells, which express GFP, were monitored under fluorescence microscope. Once the expanded cell population was 100% GFP positive, cells were co cultured with iSLK cells (Myoung and Ganem) and induction was performed using 20 pg/mL of TPA and 1 mM valproic acid. Cells were washed 4 days post induction (dpi), and infected iSLK cells were selected using 1 1 mM NaB. Virus was collected and quantified 4 days later using the protocol desc ribed above. Immunofluressence Assay fixed using 1% formaldehyde 12 16 hrs later. After a brief washing in PBS cells were permeabilized using 0.2% triton X 100 in PBS for 15 min. o n ice followed by two washings with PBS. Primary antibody Rabbit anti LANA was applied 1:300 for 1 hour at room temperature as described previously (An et al. 2006) Cells were washed and

PAGE 53

53 incubated for 45 min. in Alexa 594 conjugated goat anti rabbit antibody at 1:1000 dilution. After washing, coverslips were mounted using Vector Shield which provided DAPI staining. Cells were then observed under a fluorescence microscope to visualize staining.

PAGE 54

54 Figure 2 1 Anta gomir screen in BC 3 G cells. (a ) BC 3 G cells 72hpt of antagomirs. 1x10 6 BC 3 K12 3 or miR K12 3 and miR K12 11 combined antagomirs. The mock sample underwent transfection in the absence of antagomir. Ce lls were observed 72hpt under a fluorescence microscope. Three different fields are shown for each transfection. (b ) miR K12 3 inhibition increases reactivation by 26% compared to mock control. Flow cytometry results of 3 independent experiments. Transfect ions were carried out as explained above. GFP expression was scored in triplicates from each sample every 24 hours until 96 hpt.

PAGE 55

55 Figure 2 2. MYB, Ets ed by miR K12 3 & miR K12 11. (a ) scanned for potential miRNA binding sites. (b ) Dual reporter luciferase assays using MYB, Ets GL3 promoter co transfected with increasing amounts of miRNA expression vectors into 293 cells. Cell lysates were collected 72 hpt firefly readings were normalized to the corresponding renilla luciferase values. (c ) Ago miRNA derived clusters of reads are visualized in UCSC genome browser as wiggle tracks. Shown are the positions of read clusters miRNA seed match positions are indicated by c olored bars; those of human miRNAs as predicted by TargetScan are shown as black bars (Haecker 2012 under review).

PAGE 56

56 Figure 2 3. Confirmation of miRNA knockdown afte r antagomir transfection. 1x10 6 BCBL 1 cells were transfected with increasing amount of miR K12 3 or miR K12 1 1 antagomir or a combination of both. RNA was harvested 48 hpt and TaqMan miRNA RT and qPCR was performed using primers and probes specific to miR K12 3 and miR K12 11. Primers and a probe spec ific to RNU66 were used as a loading c ontrol and all samples were normalized to mock transfected controls.

PAGE 57

57 Figur e 2 4. MYB, Ets creases upon miR K12 3 and miR K12 11 knockdown in PEL cells. 1x10 6 BC 3 and BCBL 1 cells were transfected with varying amounts of miRNA specific antagomir. Tot al RNA was collected 48 hpt and reverse transcribed. qPCR was performed using primers specific for MYB, Ets 1, and actin expression and compared to gene expression in the mock transfected co ntrol. p<0.05(*), p<0.01(**), p<0.001(***)

PAGE 58

58 Figure 2 5. Lytic gene expression and virus prod uction increases upon miR K12 3 and miR K 12 11 knockdown in PEL cells. (a ) 1x10 6 B C 3 cells were transfected with varying amounts of miRNA specific antago mir. Tot al RNA was collected 48 hpt and reverse transcribed. qPCR was performed using primers specific for RTA, ORF59, and actin expression and compared to gene expression in the mock transfected control. (b ) 1x10 6 BCBL 1 cells were transfected with varying amounts of miRNA specific antagomir. Cell media harboring progeny virus was colle cted and was used for qPCR along with a plasmid standard to determine genome copy number

PAGE 59

59 Figure 2 6. Analysis of KSHV miRNA deleted recomb inant bacmid viruses. (a) miR K12 3 and miR K12 11 deleted virus was gene rated individually using BAC16. K12 3 BAC16 was used to infect iSLK cells to make a bacmid producer cell line. Infection was monitored by observing GFP expression (left panel) a nd infected cells were selected using hygromycin B. IFA for L ANA was performed using rabbit polyclonal antibody and nuclear staining with DAPI (right panel). (b ) iSLK cells latently K12 K12 11 BAC16 were harvested for R NA and RT qPCR was performed using primers specific for LANA, RTA, ORF59, and ORF19. All samples were actin expression. (c ) iSLK cells infected with and selected for K12 K12 11 BAC16 were induced with 2mM and 4mM NaB Total RNA was harvested 12 and 72 hours post induction. RT qPCR was performed using primers specific for RTA. All sam ples were actin expression. Samples were compared to the WT control for each corresponding concentration and time point. p<0.05(*), p<0.01(**), p<0.001(***)

PAGE 60

60 Table 2 1 Primer Sequences Gene Ref FWD GATGGAGGAGCAGATGACATC REV AGGTAAAATAAGGGCAC Ets FWD CGTGTTGGTTGGACTCTGAA REV TCTCCAGCAAAATGATGTGC FWD CTTGTGCCTTGG AAATGCAAACTCACC REV AAGAAGAGAACCAAGCCGTCCTTC MYB FWD TCAGGAAACTTCTTCTGCTCACA REV AGGTTCCCAGGTACTGCT Ets 1 FWD AAGGGAGATCGAAGGAGGAA REV TCTGCTATAGGAACTGCAGGAG FWD TGTATACCCCTGGTGGGAGA REV TCATAACTCCGGTCCCTCTG RTA FWD CACAAAAATG GCGCAAGATGA REV TGGTAGAGTTGGGCCTTCAGTT (Lei et al., 2010) ORF59 FWD TTAGAAGTGGAAGGTGTGCC REV TCCTGGAGTCCGGTATAGAATC (Majerciak et al.) ORF19 FWD GGCGAAAAAGTCAGCGGTGGT REV CGGCGCGTCTTCCCTAAAGA (Persson and Wilson) LANA N Terminus FWD GCG CCCTTAACGAGAGGAAGTT REV TTCCTTCGCGGTTGTAGATG actin FWD CATGTACGTTGCTATCCAGGC REV CTCCTTAATGTCACGCACGAT Primerbank ID 4501885a1

PAGE 61

61 Table 2 2 iSLK BAC16 Sequencing Results Position Ref Variants Allele Variations Freq Counts Coverage Overlapping Annotations Amino Acid Change Wildtype 137761 T 2 T/G 60.7/39.3 17/11 28 Repeat region: direct 137795 G 1 C 66.7 18 27 Repeat region: direct miR K3 Mutant 8061 AG 2 T/C 63.6/36.4 56/32 88 CDS: ORF7 Arg485Ser 23787 G 2 A/G 64.3/35.7 9/5 14 Repeat re gion: LIR1 23789 A 2 A/T 52.6/47.4 10/9 19 Repeat region: LIR1 138021 A 1 C 100 16 16 Repeat region: direct miR K1 Mutant 137795 G 2 G/C 60.0/40.0 27/18 45 Repeat region: direct miR K12 11 mutant (miR K6) 66571 C 1 T 68.5 902 1317 CDS: ORF44 Leu622Phe 138021 A 1 C 100 5 5 Repeat region: direct

PAGE 62

62 CHAPTER 3 GENERATION AND ANALY SIS OF KSHV MIRNA DE LETED RECOMBINANT VIRUSES Since the discovery of KSHV encoded miRNAs, our lab has focused on func tional studies to determine the roles of these miRNAs. Prediction algorithms are used to scan (Grimson et al., 2007) Luciferase reporter assays in 293 cells are used to confirm targeting of a g ene (as described and shown in C hapter 2), followed by site directed mutagenesis of seed match sites to relieve targeting or co transfection with antagomirs to show de repression ( Samols, 2007; Skalsky et al., 2007) 293 cells stably expressing viral miRNAs have been established and gene expression profiling has been performed to compare empty vector vs miRNA expressing cells to determine possible cellular targets (Samols, 2007; Skalsky et al., 2007) Recently Isaac Boss has generated a humanized mouse model expressing miR K12 11 or human miR 155 to determine the in vivo phenotype of these two miRNAs, which share the same seed sequence (Boss et al., 2011) Current work in the lab by Irina Haecker is focused on determinin g targets of KSHV miRNAs in PEL cells by HITS CLIP, a new technique in which RNA protein complexes are UV crosslinked, followed by immunoprecipitation of Ago miRNA mRNA complexes and high throughput sequencing (HTS) of isolated RNA to determine the miRNA t arget profile of cells (Haecker, 2012) While all of these approaches have improved our understanding of miRNA function and targeting, they lack the ability to investigate miRNA function in the context of the viral genome. This limitation can be overcome by developing a genetic system to mutate viral miRNA and generate recombinant viruses. However, studying KSHV genetics has been difficult due to gamma herpesviruses having low replication turnover in latently infected cells and lacks an effici ent infection system. This

PAGE 63

63 hinders the ability of mutant viruses to be generated by homologous recombination in mammalian cells as is routinely done in alpha herpesviruses such as HSV 1 (Bloom, 1998) Therefore we collaborated with the Jung lab at USC and set up a core facility here at UF to produce individual miRNA deleted recombinant viruses using bacterial artificial chromosomes (BACs also bacmids). BACs facilitate the propagation and manipulation of large DNA viruses, where previous attempts at genetic ma nipulation were dependent on rare recombination events in eukaryotic cells. The first herpesvirus BAC system was developed in MCMV which is one of the largest herpesvirus with a genome size of 230 kbp (Messerle et a l., 1997) Cloning of such large viral genomes requires the insertion of a minimal fertility factor replicon (mini F) vector which is flanked by sequences of the desired insertion site and allows up to 300 kb of DNA to be cloned after homologous recombin ation. The BAC vector also contains a bacteria origin of replication and antibiotic resistance along with selection and visualization cassettes for use in mammalian cells. Currently there are BAC systems for all human herpesviruses with the exception of HHV 7 (for review see (Tischer and Kaufer, 2012) ) The first KSHV BAC was generated by Delecluse et al. using BC 3 cells which were recombined with the bacmid backbone at ORF56, resulting in a replication deficient virus. Upon introduction of ORF56 expressing in KSHV BAC 293 cells, virus replication was restored and viral progeny was produced (Delecluse et al ., 2001) Shortly after the creation of the ORF56 disrupted KSHV BAC, Zhou and colleges generated another KSHV BAC using BCBL 1 cells, termed BAC36. Unlike the previous study, the bacmid backbone was designed to be inserted between ORF18 and ORF19, ther efore not disrupting viral replication and able to complete

PAGE 64

64 abortive lytic replication when induced (Zhou et al., 2002) BAC36 provided the first tool in which KSHV genetic analysis could be performed due to its ab ility to be shuttled between bacteria and mammalian cells. However, recent work has shown that BAC36 contain duplications and deletions in both the unique coding region and terminal repeats of the KSHV genome (Yakushko et al., 2010) Therefore the Jung Lab established BAC16, which has been confirmed by HTS sequencing to conta in no mutations to the KSHV genome (Campbell et al., 2012) Unlike BAC36 which is derived from BCBL 1 cells, BAC16 was cloned from JSC 1 cells which are believed to yield a higher titer virus than BCBL 1 cells. BA C16 was created by inserting the pBelo45 backbone in between vIRF 1 and ORF57 a region of the virus known to be non coding (Campbell et al.) pBelo45 allows the virus to replicate in bacteria, encodes antibiotic resistance genes to be used in both bacteria and eukaryotic cells, and contains a GFP marker to monitor transfection/infection in cell culture (Figure 3 1). Thanks to the Jung Lab providing this useful tool to us, we now have a new approach to studying KS HV miRNA functi on. In 2009 a core facility, ru n by post doc Brian Krueger, was established and primarily focused on the generation of individual miRNA deleted viruses. Below is a brief description of the work done by Brian Krueger and the core facility o n the creation of the miRNA mutation in E. coli harboring BAC16. Next I describe my contribution of reconstituting the bacmid DNA in mammalian cells and establishing a highly robust producer cell line for the efficient harvesting of recombinant virus. Mut ational Strategy Short 20 25 bp regions of the virus representing the mature miRNA sequence were deleted in order to create the KSHV miRNA mutant viruses. By deleting this short sequence, pre miRNA stem loop structure should be effectively destroyed, and both 5p

PAGE 65

65 and 3p strands of the miRNA should not be processed (Figure 3 2). Also this small deletion should have minimal to no effect on the processing of other nearby miRNAs. This strategy was used for 10 miRNAs that are located in the intragenic region b etween v FLIP and Kaposin. MiR K12 10 and 12 are located in the Kaposin open reading frame and therefore point mutations were inserted into the sequence containing the mature miRNA sequence, destroying pre miRNA hairpin formation but still maintaining th e protein coding sequence of the Kaposin gene. As mentioned in C hapter 2, a modified version of the protocol detailed by Tischer et al was used to create the miRNA deleted viruses (Tischer et al., 2006) The mutations were generated in a two step process using E. coli GS1783 which is a rec minus strain containing the Re d recombination system and contains WT KSHV BAC16 (Figure 3 3). In the first step, a mutation cassette containing a kanamycin selectable marker was created and recombined into the KSHV genome at the exact position where the miRNA of interest is deleted. In the second step, recombination is performed again to remove the kanamycin selection marker and the deletion of the target miRNA sequence. Primers were created flanking the region targeted for deletion and included sequence corresponding to the kanamyci n marker. These primers were then used to amplify the kanamycin selection marker out of a plasmid resulting in the creation of a mutation cassette (Figure 3 2). E. coli was cultured, induced to express red recombinase, then electroporated with the mutati on cassette. The electroporated cells were incubated for 1 hour then plated on a kanamycin positive agar plate to select for colonies containing the inserted mutation cassette into BAC16.

PAGE 66

66 Clones from the first step of recombination were screen by colony P CR to confirm insertion of the kanamycin selection marker in the correct position within BAC16. The integrity of the terminal repeats was confirmed to be intact after recombination by digesting bacmid DNA using NheI and performing pulse field gel electrop horesis (PFGE) (Figure 3 4). Only clones passing these screens were used in the next recombination step. The second step of recombination was performed by growing high quality clones then inducing I secI expression by the addition of arabinose. This resu lted in linearization of the bacmid and allows for recombination to occur, removing the kanamycin selection marker and generates a markerless virus mutant. A second round of screens were performed to confirm sensitivity to kanamycin, loss of kanamycin cas sette and miRNA sequence by colony PCR, and integrity of terminal repeats by PFGE. Lastly, bacmid DNA was isolated from bacteria using the Large Construct Kit (Qiagen) All of the above work was done by Brian Krueger and our core facility. Reconstitution of KSHV BAC16 miRNA in 293T C ells In order to produce packaged recombinant KSHV virus KSHV BAC16 DNA was transfected into 293T cells. For this c ells were seeded into 6 well plates and the next day were trans fected using Trans It 293 reagent (Mir us) Transfection efficiency was determined by observing GFP express ion 48 hpt The h ighest transfection efficiency, between 40 60%, wa s seen when freshly made b acmid DNA along with newly thawed 293T cells were used Once cells were observed to express GFP, confirmin g successful transfection of b acmid DNA, cells were expanded and transferred in a 10cm dish containing fresh media along with 100 hygromycin B to select for BAC16 containing cells. 293T cells were continuously

PAGE 67

67 cultured for several days to recover from antibiotic selection and expanded to 15 cm pla tes. This process usually took 10 15 days p ost transfection. RTA I nducible SLK cells S erve as a Recombinant Virus P roducer Cell Line Previously, if more recombinant virus was needed, the above procedure would have to be repeated and virus was induced and collected from 293T cells Constantly repeating this inefficient procedure may lead to pos sible mutations within the viral genome and is also inconsistent in the amount of virus produced. The longer the transfected 293T cells are passaged, the smaller amount of virus produced. Moreover, transfected 293T cells cannot be reactivated to make recombinant virus after being thawed from frozen stocks. iSLK cells were generated and provided by the Ganem Lab (Myoung and Ganem, 2011) These cells were produced by transducing SLK uninfected endothelia l cells which were derived from a gingival KS lesion of an HIV negative renal transplant recipient (Siegal et al., 1990) with a RTA expression construct which is tightly regulated by a promoter bearing a tet opera tor sequence. The cells were also transduced with the rtTA (Tet On) transactivator, which requires doxycycline as a cofactor for activation. Efficient and controlled RTA expression allows iSLK cells to serve as a prod ucer cell line for recombinant b acmid KSHV. Attempts were made to directly transfect BAC16 DNA into iSLK cells, bypassing the use of 293T cells, but transfection efficiency was very low. Our next approach was to use virus stock that was collected from induced BAC16 293T cells to infect iSLK cells and this worked in varying efficiencies with each of the mutated and WT recombinant viruses. Recent work by Myoung and Ganem demonstrated that cell cell interaction is needed for higher infection efficiency rather than infecting with cell free vir us (Myoung and Ganem) Therefore BAC16 293T cells were co cultured with iSLK cells at a ratio of 1:1. BAC16

PAGE 68

68 293T cells were then induced by the addition of 20ng/mL TPA and 1mM valproic acid. Cell media was replaced 4 days post induction, and antibiotic selection specific for infected iSLK cells was added (1 g/mL puromycin, 250 g/mL G418, and 1.2 mg/mL hygromycin B) BAC16 iSLK cells were allowed to recover from selection and dead 293T cells were washed away. Infection efficiency was monitored by GFP expression using fluorescence microscopy. Once cells reached 40 60% confluency in 15cm plates, cells were induced u A expression, and 1mM of NaB Virus was harvested 4 days post induction membrane Collection and Analysis of BAC16 iSLK V irus Filter ed media from bacmid infected cells was pipetted upon a 25 % sucrose cushion and subjected to ultracentrifugation at 100,000g for 1 hour using a Beckman Coulter SW 28 rotor Virus pellets were resuspended in 1% of original volume using serum free media and stored at toc ks was isolated using DNAzol 2 Time qPCR was performed using pcDNA3.1 Orf73 plasmid as a standard along with primers specifi c for the N terminus of LANA. Viral genome copy number was determined by comparing viral DNA to the plasmid standard cu rve. Results show that BAC16 iSLK cells are able to reactivate at significantly higher levels than BAC16 293T cells and can produce up to 20 times more virus. Also, infected iSLK cells that had been frozen for 2 months, when thawed, expanded, and induced they produce d recombinant virus at significantly higher levels than 293T cells (Figure 3 5) Th ese data confirm the ability of

PAGE 69

69 iSLK cel ls to serve as a producer cells line for the production of recombinant KSHV virus. To confirm the deletion of individual miRNA from each recombinan t virus, ABI TaqMan miRNA RT qPCR was performed to detect the expression of the specific miRNA in the mutant virus infected cells. RNA from iSLK cells infected with BAC16 miRNA was isolated using RNA suggestions. 10 n g of total RNA was used for reverse transcription ( ABI ) RT looped primers specific for each individual KSHV miRNA was used to make cDNA pools. Parallel experiments were p erformed with RNU66 which served as an endogenous control. TaqMan mi RNA qPCR was performed using specific primers and probes for each KSHV encoded miRN A along with the RNU66 control. Figure 3 6 shows miRNA expression levels of BAC16 1 BAC16 K12 3, a nd BAC16 K12 11 virus compared to WT BAC16 Results confirm the deletion of the corresponding miRNA and that expression of the other 11 KSHV miRNAs is intact. Infection of Endothelial Cells using iSLK BAC16 V irus Since latency is the default pathway after KSHV infection, the genome copy number of virus stock does not necessarily correlate with the number of infectious particles. In order to show that iSLK BAC16 cells are able to produce infectious virus, virus stocks were used to infect two different endo thelial cell lines. Telomerase immortalized vascular endothelial (TIVE) cells and SLK cells were infected with various amount of cell free virus stock in the presence of polybrene, a cationic polymer used to increase the efficiency of infection (An, 2005) Infection efficiency was monitored by observing GFP expression by both fluorescence microscopy and flow cytometry (Figures 3 7 and 3 8). Results show that iSLK derived BAC16 virus stocks are

PAGE 70

70 infectio us at varying degrees, with WT usually having a slightly higher infectious rate when compared to K12 3 and K12 11 virus stocks. Also, SLK cells show overall greater susceptibility to infection when compared to TIVE cells. Infection was further confirme d by detection of LANA expression by IFA. Using this method we also saw that SLK cells harbor more copies of the viral genome than TIVE cells (Figure 3 9), which is consistent with our previous finding that TIVE cells contain less copies of the viral geno me (An et al., 2005),pointing to SLK cells being more susceptible to infection than TIVE cells. Generation of BJAB BAC16 Cells through C o culturing Although there are a limited number of cell types that are infected by KSHV in vivo, in vitro KSHV virions c an infect a wide variety of cell lines. Unfortunately, no established B cell line being tested has been able to be infected with KSHV. This has greatly limited the study of KSHV infection in lymphoid compartment. Using again the proven methodology of co culturing developed by Myoung and Ganem, iSLK BAC16 cells were induced and co cultured with BJAB cells to establish BJAB BAC16 cells. for the study of KSHV latent infectio n; however there is no isogeneic control, or non infected PEL cells, to use as a comparison. With the establishment of BJAB BAC16, we now have a system in which not only can we compare non infected BJAB to BJAB BAC16, but we can also look at the effects o f miRNA deletion on infection in B cells. iSLK BAC16 cells were plated on a 6 well plate and induced with doxycycline and NaB the next day. BJAB cells were added at a 1:1 ratio on top of the iSLK BAC16 cells 2 days post induction and cells were co culture d for an additional 4 days. Cell media containing BJAB cells were spun down and resuspended in fresh RPMI with 100 g/mL

PAGE 71

71 hygromycin b. BJAB BAC16 cells were allowed to recover from selection for 2 weeks and dead cells were diluted out by passaging. Once cells were 100% GFP positive, total RNA and cell lysates were collected for analysis. RT qPCR was performed to detect viral gene expression. LANA, RTA, ORF59, and ORF19 expression was normalized to actin levels and results showed that these viral genes are expressed at similar levels in WT, miR K12 3, and miR K12 11cells with the exception of miR K12 11 expressing higher amounts of RTA than both WT and miR K12 3 (Figure 3 10). These results are similar to what we observed in iSLK miR K12 11 cells d iscussed in C hapter 2. Expression of viral miRNAs in BJAB BAC16 cells was confirmed by TaqMan miRNA qPCR as previously described with iSLK BAC16 cells in BJAB WT, BJAB K12 3 and BJAB K12 11 cells (Figure 3 11). Both mutants had complete abolishment of t heir corresponding miRNA mutants, and similar expression of the other miRNA when compared to BJAB WT. However, miR K12 3 and 11 expression in all BJAB BAC16 cells was ~75% lower compared to BCBL 1 miRNA expression levels. PEL cells such as BCBL 1 normal ly have between 50 80 copies of the viral genome in each cell. qPCR results show that BJAB BAC16 cells express significantly lower copies of intracellular LANA when compared to BCBL 1, which translates to ~10 15 genome copies per cell (Figure 3 12). Thes e results explain the reduced miRNA expression in BJAB BAC16 vs BCBL 1. Lastly, as discussed in C hapter 2, we investigated the expression of the B cell transcription factor MYB, which is regulated by miR K12 11, in BJAB K12 11 cells. MYB expression in the absence of miR K12 11 compared to WT virus infected cells was

PAGE 72

72 tested by RT qPCR and western blot was performed (Figure 3 13). Results show that MYB expression does not increase when miR K12 11 is deleted from the KSHV genome. This may be due to low geno me copy and miRNA expression in BJAB BAC16 cells; therefore the miRNA expression level may not be high enough to see a significant change in MYB gene and protein expression. In summary, we were able to utilize BAC16 to generate individual miRNA deleted rec ombinant viruses. Through the use of iSLK cells, bacmid producer cell lines were established for the first time. These developments have allowed increased productivity using recombinant virus and a more efficient way to produce large amounts of recombina nt virus for future work. Also through co culturing techniques, BJAB BAC16 cells were established, producing the first isogeneic control for studying KSHV infection in B cells.

PAGE 73

73 Figure 3 1. pBelo45 plasmid construct. Inserted in between vIRF1 and ORF 57 in the KSHV genome. The plasmid contains bacterial origin of replication and chloramphenicol resistance gene for growth in bacteria. It also contains GFP cassette and hygromycin b resistance gene for selection in eukaryotic cells.

PAGE 74

74 Figure 3 2. Mutational strategy. 20 base pairs were deleted from one arm of each pre miRNA hairpin. Hairpin disruption was confirmed by M fold. Primers were designed to amplify kanamycin positive selection marker (PSM). Forward primer contained 40 bp sequence upst ream of deletion, 20 bp downstream of deletion, and sequence specific for PSM that include and I SecI restriction enzyme site. Reverse primer contained sequence specific for PSM, 20 bp sequence upstream of deletion, and 40 bp downstream of deletion. PSM was amplified by PCR to generate the mutation cassette which is used in the next recombination step.

PAGE 75

75 Figure 3 3. Two step red recombination. Mutation cassette was electroporated into E. coli GS1783 containing BAC16. Red recombinase was induced to f acilitate intermolecular recombination between mutation cassette and BAC16. High quality clones were used in the second recombination step. I SceI expression was induced to linearize bacmid. Red recombinase was induced to facilitate intramolecular recomb ination which resulted in a markerless KSHV mutant.

PAGE 76

76 Figure 3 4. Screening of clones. All clones were screened after the first recombination event for the incorporation of the mutation cassette into BAC16 by performing colony PCR using primers contain ing sequences from both BAC16 and the PSM. DNA was then digested with NheI and terminal repeat integrity was tested by PFGE. Clones 1,3,and 4 are examples of having intact terminal repeats.

PAGE 77

77 Figure 3 5. Viral copy number comparison. 293T, iSLK and i SLK frozen stock cells were induced to release progeny virus. Cell media harboring progeny virus was colle dp i DNA was collected from the virus stock and was used for qPCR along with a plasmid standard to determine genome copy number per m L.

PAGE 78

78 Figure 3 6. miRNA expression in iSLK BAC16 miRNA compared to WT. Total RNA was harvested from iSLK BAC16 cells and TaqMan miRNA RT and qPCR was performed using primers and probes specific for all 12 KSHV miRNAs along with RNU66 as a loading control. All samples were normalized to WT miRNA expression.

PAGE 79

79 Figure 3 7. TIVE and SLK infection flow cytometry of GFP expression. (A) Non infected TIVE cells, M1 set at 1%. (B) TIVE WT 100 vg/cell. (C) TIVE WT 250 vg/cell. (D) TIVE WT 500 vg/cell. (E) TIVE K12 3 100 vg/cell. (F) TIVE K12 3 250 vg/cell. (G) Non infected SLK cells, M1 set at 1%. (H) SLK WT 100 vg/cell. (I) SLK K12 3 100 vg/cell. (J) SLK K12 3 200 vg/cell. (K) SLK K12 11 100 vg/cell. (L) SLK K12 11 200 vg/cell. vg= copies of viral genome. All readings were done 48 hpi.

PAGE 80

80 Figure 3 8. GFP expression in SLK cells 48 hpi with BAC16 recombinant viruses. SLK cells were infected with recombinant virus and observed for GFP expression by fluorescence microscopy 48 hours later.

PAGE 81

81 Figur e 3 9. IFA for LANA expression in SLK cells 96 hpi. SLK cells were infected with recombinant virus and 96 hpi cells were fixed and stained using a rabbit anti LANA polyclonal antibody. Cells were mounted and observed by fluorescence microscopy. DAPI sho ws nuclear staining.

PAGE 82

82 Figure 3 10. Lytic gene expression in BJAB BAC16 infected cells. Total RNA was harvested from BAC16 infected BJAB cells. RT qPCR was performed using primers specific for LANA, RTA, ORF59, and ORF19. All samples were norm alized to cellular actin levels. K12 3 and K12 11 samples were compared to WT BAC16 gene expression.

PAGE 83

83 Figure 3 11. BJAB BAC16 vs BCBL 1 miRNA expression. TaqMan miRNA RT and qPCR was performed using primers and probes specific for miR K12 3 and miR K12 11 along with RNU66 as a loading control. All samples were normalized to BCBL 1 miRNA expression.

PAGE 84

84 Figure 3 12. BCBL 1 vs BJAB BAC16 intracellular LANA expression. Genomic DNA was collected from BCBL 1, BJAB WT, and BJAB K12 11 cells 100 ng was used in qPCR along with a standard plasmid to determine viral genome copy number per cell. BCBL 1= 44 copies/cell, BJAB WT= 10 copies/cell, and BJAB K12 11= 15 copies/cell. BCBL 1 11 BJAB WT

PAGE 85

85 Figure 3 13. BJAB BAC16 MYB and BACH1 expression. Top panel shows RT qPCR results from BJAB BAC16 cells using primers specific for MYB and BACH1. All samples were normalized to actin and compared to WT infected cells. Bottom panel is a western blot probing for MYB, BACH1, and actin in non infected BJAB along with BAC16 infected BJAB cells. Loading is normalized to actin levels.

PAGE 86

86 CHAPTER 4 CONCLUSIONS AND FUTU RE DIRECTIONS KSHV encoded miRNAs are located in the latency associated region, the area of the genome required for the establishment and maintenan ce of viral latency. The focus of my research has been to determine which KSHV miRNAs are important for the maintenance of latency and prevent ion of lytic reactivation. In C hapter 2, I describe miRNA knockdown studies performed in PEL cells and miR K12 3 and 11 were shown to be important for the prevention of reactivation. Next, MYB, Ets 1, and C/EBP were determined to be targets of these two miRNAs. These three transcription factors have been previously shown to activate the promoter of RTA, leading to lytic reactivation. Chapter 3 describes the generation and analysis of miRNA deleted recombinant viruses. These viruse s were also used in studies in C hapter 2. Individual miRNA knockout viruses are able to infect both endothelial and lymphoid cells and allows for miRNA functional studies in both cell types. MiRNA knockdown studies together with re combinant miRNA knockout viruses show that miR K12 3 and 11 are important for the maintenance of latency and when deleted from the viral genome, present a more lytic phenotype. KSHV miR K12 3 and miR K12 11 Help to Prevent Reactivation by Targeting C ellul ar Transcription F actors To determine which KSHV miRNAs are important for the prevention of lytic reactivation, antagomir knockdown studies were performed in BC 3 G indicator PEL cells. After a panel of individual and combining antagomirs, it was shown by fluorescence microscopy and flow cytometry that knockdown of miR K12 3 had a 26% increase in GFP, therefore RTA, expression (Figure 2 1). Mir K12 11 and the combination of 3 and 11 also had an increased effect on lytic reactivation. Since it has

PAGE 87

87 been already shown that miR K12 9*, 5, and find any other potential miRNA binding sites, we focused our target analysis on known activators of RTA (Bellare and Ganem, 2009; Lin e t al., 2011 ; Lu et al., 2010b) The scanned for potential KSHV miRNA binding sites and several were found to have seed match sites for both miR K12 3 and 11(Figure 2 2). We decided to focus on MYB, Ets 1 and C/EBP Other RTA activating transcription factors such as HIF1 HMGB1, and EGR 1 also contain KSHV miRNA seed match sites and need to be further investigated (Dalton Griffin et al., 2009; Dyson et al., 2012; Harrison and Whitehouse, 2008) MYB, Ets 1, and C/EBP were all shown to be directly targeted by KSHV miRNAs by luciferase reporter assays (Figure 2 2). For Ets 1 and C/EBP the effect was not as substantial as seen i n MYB. Ets 1 displayed only ~35% decrease in luciferase when both miR K12 3 and 11 were expressed. However when compared to the no miRNA expressing control, it was statistically significant. Moreover human miR 155, an ortholog of miR K12 11, was shown to target Ets and they saw ~45% decrease in luciferase activity when miR 155 mimics were expressed (Zhu et al., 2011) site 2 was the most important in targeting. Therefore miR 155 targeting of Ets 1 suggest that miR K12 11 is also capable of regulating Ets 1 expression. C/EBP did not show any decrease in luciferase expression in the presence of miR K12 3, however when the entire cluster was expressed I observed ~40% decrease in expression. Besides miR K12 3, C/EBP is predicted to be targeted by several other KSHV miRNAs K12 3 may not

PAGE 88

88 strongly target th the KSHV miRNA cluster does. Further evidence of C/EBP being a target of KSHV miRNAs is seen in HITS CLIP data provided by Irina Haecker in the lab and is shown in figure 2 2c. In order to determine if miR K12 3 and 11 target MYB, Ets 1, and C/EBP in PEL cells, antagomir knockdown studies were performed in BCBL 1 and BC 3 cells. Results show that upon increasing amounts of antagomir, gene expression increased 48 hpt for all three transcription factors by 1.5 to 2 fold (Figure 2 3). I also attempted to look at protein expression at 48 and 72 hpt, but no visible changes in protein level were detected by western blot (data not shown). There are a few possible reasons for the lack in protein expression changes seen in antagomir transfe cted PEL cells. First, later time points should be observed for changes in protein expression. 48 and 72 hpt may not be enough time to see significant increases in protein expression. One complication in looking at later time points is that the antagomi r affect is diluted out as cells expand, therefore no changes can be seen unless cells are continuously transfected to maintain antagomir concentrations within cells. Recent developments in miRNA inhibition have shown that short complementary sequences of as little as 8 nucleotides are sufficient to miRNA and have locked nucleic acid (LNA) modifications. LNAs con tain a biochemical oxygen an carbon atoms of the ribose rings are chemically brid confers high thermal stability an d resistance to exo and endonucleases (Chan et al., 2005) An advantage of using tinymers vs antagomirs is that tinymers are able to be taken up by the cell without needing the aid of a transfection reagent. The use of tinymers will allow miRNAs to be inhibited over a long

PAGE 89

89 period of time without the need to re transfect cells. Stein et al. have shown that by maintaining tinymer concentrations, they see significant protein repr ession at 7 and 10 days post tinymer addition. By using this strategy, MYB, Ets 1, and C/EBP expression levels can be observed by western blot 7 10 days post miRNA inhibition in PEL cells. These results may confirm the ~2 fold increase in mRNA expression that we observed by qPCR. Additionally, recent data has indicated that miRNAs primarily ac t to decrease target mRNA levels. Guo et al. performed ribosome profiling while simultaneously measuring mRNA levels and determined that miRNAs downregulate gene expression mostly through mRNA destabilization with a small effect on translational efficienc y. Thus even though western blots were not able to detect changes in protein levels 48 hpt the results we obtained by qPCR are representative of the miRNAs effect on target mRNA levels (Guo et al., 2010) Antagomir knockdown of miR K12 3 and 11 in PEL cells also led to increased viral gene expression and production of progeny virus (Figure 2 4). Resu lts show that upon increasing amount of miR K12 3 antagomir, viral gene expression increased in a dose dependent response. Also when both miR K12 3 and 11 antagomirs were transfected at the medium dosage, the greatest increase in viral gene expression wa s seen. Lastly, progeny virus was measured 6 dpt in antagomir transfected PEL cells. Standard plasmid qPCR revealed that as miR K12 3 or 11 is knocked down, progeny virus released into the media increases. These data suggest that both miR K12 3 and 11 are important for the maintenance of viral latency in PEL cells.

PAGE 90

90 KSHV miR K12 3 and 11 Deleted Recombinant Viruses have a More Lytic Phenotype in Endothelial C ells In order to study KSHV miRNA function in the context of the viral genome, individual miRNA deleted recombinant viruses were generated using KSHV BAC16 and producer cell lines were established in iSLK endothelial cells (generation discussed in Chapter 3). Upon analysis of iSLK BAC16 cells, RT qPCR results show that iSLK BAC16 miR K12 11 cells have increased lytic gene expression. Further investigation through sub optimal induction with NaB showed that both miR K12 3 and 11 deleted viruses reactivated better than WT BAC16 infected iSLK cells (Figure 2 5). These data are in a greement with the results in PEL cells treated with miRNA antagomirs, confirming that miR K12 3 and 11 expression are important for the maintenance of viral latency. Further analysis of MYB, Ets 1, and C/EBP expression in iSLK BAC16 miR K12 3 and 11 c ells did not show significant changes in gene or protein expression (data not shown). However MYB is a B cell transcription factor and is therefore not expressed in endothelial cells, and Ets 1 and C/EBP are expressed at higher levels in iSLK cells than in PEL cells. Furthermore, PEL cells express KSHV miRNAs at a much higher level than BAC16 infected iSLK cells. The combination of high mRNA transcript levels and low miRNA expression levels in iSLK BAC16 WT infected cells may be the cause for not seeing a difference in expression when compared to miRNA infected cells. Recent studies by Mukerji and colleges have determined that miRNAs can generate thresholds in target gene expression. Results using single cell analysis of miRNA mediated protein repression suggest that if the target pool of a miRN A is below saturation, then all the targets will be repressed to the same degree regardless of

PAGE 91

91 expression level. However if the target pool size grows, then it is possible to saturate the pool of miRNAs, therefore protein repression is no longer seen (Mukherji et al., 20 11) I believe this to be the case when comparing miRNA targeting of MYB, Ets 1, and C/EBP in PEL and iSLK BAC16 cells. Due to miRNA expression being in lower in iSLK BAC16 cells, they may be saturated with the highly abundant Ets 1 and C/EBP transcri pts, hence no changes in transcript or protein level can be detected. These data suggest there are other targets of miR K12 3 and 11 in endothelial cells that are important for prevention of lytic reactivation and this needs to be further investigated, w hich is described below in future directions. Generation of Endothelial and Lymphoid Cells Harboring miRNA Deleted Recombinant V irus Bacmids are a very useful tool to study specific gene function in herpesviruses. Previously, KSHV BAC36 was widely used fo r genome studies, including a miRNA cluster knockout to investigate the role of KSHV miRNAs. Lei et al. deleted the ~2.9 kb region within the latency associated region containing 10 of the 12 KSHV miRNA hairpins. The miRNA cluster deleted virus was then reconstituted in 293 cells and were shown to have higher RTA expression than WT infected 293 cells. Next, NF B activity was observed to be lower in the miRNA cluster knockout virus infected cells when compared to WT KSHV infected cells. It was determined that miR K12 1 targets I B resulting in activation of NF B activity and inhibition of viral lytic reactivat ion (Lei et al., 2010) These data do suggest a role for miR K12 1 in the maintenance of latency, however these experiments were done in cells that are not naturally infected by the virus and further investigation of miR K12 1 targeting I B in PEL and endotheli al cells is needed. Furthermore, BAC36 was recently shown to contain duplications and

PAGE 92

92 deletions within the viral genome (Yakushko et al., 2010) Therefore we set out to use a new bacmid system, BAC16, to investigate individual miRNAs by generating 12 KSHV miRNA deleted recombinant viruses. As explained in C hapter 3, short sequences were deleted from each mature miRNA sequence, disrupting pre miRNA formation and drosha recognition. This was performed in a two step red recombination process that resulted in a markerless mutant. I was able to establish reconstitution of bacm id DNA into mammalian cells and developed the protocol for the generation of iSLK producer cell lines for the first four bacmids made in the core laboratory: WT, K12 1, K12 3, and K12 11. BAC16 transfected 293T cells were co cultured with iSLK cells then induced to release recombinant virions. BAC16 infected iSLK cells were selected, expanded, and analyzed for GFP expression by fluorescence microscopy, LANA ex pression by IFA, miRNA expression by TaqMan qPCR, and viral gene expressio n by RT qPCR. As discussed in C hapter 2, miR K12 3 and miR K12 11 expression are important for the prevention of lytic reactivation, therefore I focused on these two recombinant vir uses. BJAB BAC16 cells were established using co culturing techniques with iSLK producer cells. Viral gene expression, miRNA expression, and viral genome copy number per cell were confirmed by qPCR in BAC16 infected BJAB cells. Results showed that altho ugh BJAB cells are of lymphoid origin like PEL cells, they harbor about of viral genomes when compared to PEL cells (Figure 3 12). BJAB cells harboring less copies of the viral genome also results in lower miRNA expression when compared to PEL cells. T hese results may explain why no significant increase in MYB or BACH1 expression was seen in BJAB BAC16 WT cells when compared to BJAB miR K12 11

PAGE 93

93 cells. KSHV miRNA expression is not high enough in BJAB BAC16 cells to overcome MYB transcript levels; however this does not mean miR K12 11 is not still binding and a tool for the generation of individual miRNA deletion mutant viruses and through co culturing, we have established endothelial and lymphoid cells harboring recombinant KSHV virions. This has also for the first time generated the ability to study KSHV inf ection in lymphoid cells while having an isogeneic control. Future D irections using KSHV BAC16 miRNA Recombinant V iruses iSLK BAC16 miR K12 3 and iSLK BAC16 miR K12 11 cells displayed a more lytic phenotype than WT infected cells, however I did not see an increase in MYB, Ets 1, and C/EBP expression in the cells. This may be due to the lower miRN A expression in iSLK cells when compared to PEL cells. Nevertheless, these cells infected with miRNA knockout virus still reactivate better than cells infected with WT KSHV suggesting that there may be other targets of miR K12 3 and 11 that are important for the maintenance of latency. Also because iSLK cells are of endothelial origin and PEL cells are of lymphoid origin, there may be different cellular factors contributing to activation of the RTA promoter. In order to investigate this further, several different experiments can be performed. The first approach can be the comparison of gene expression profiling among uninfected, WT infected, and miRNA deleted virus infected cells. Our lab has conducted these types of analysis in the past and has found several KSHV targets (Samols, 2007; Skalsky et al., 2007) With this approach not only will we see gene expression changes that occ ur upon infection with KSHV in endothelial cells, but we will also see how the deletion of miR K12 3 and 11 affects gene expression and how that

PAGE 94

94 compares back to uninfected cells. A second approach to determining viral miRNA targets in recombinant KSHV i nfected endothelial cells is to perform HITS CLIP in uninfected, WT infected, and miRNA deleted KSHV infected iSLK cells. This technique was recently established in the lab by Iri na Haecker and is discussed in C hapter 2 (Figure 2 2). Basically, miRNA/mRN A complexes are isolated and sequenced to determine which mRNAs are actually being targeted in a population of cells. Using this method, we are able to determine how often and where a message is targeted by a specific miRNA. This will allow us to determi ne specific targets of KSHV miRNAs in endothelial cells; also this may give insight as to whether MYB, Ets 1 and C/EBP are targeted in iSLK cells by miR K12 3 and 11, yet not at high capacity. PEL cells have been the model for studying latent KSHV infection in B cells since their establishment in 1996 (Cesarman et al., 1995b; Kom anduri et al., 1996; Renne et al., 1996b) Unlike EBV, KSHV is not able to stably infect primary B cells, nor is it able to infect cultured lymphoid cells efficiently (Bechtel et al., 2003; Blackbourn et al., 2000; Renne et al., 1998) Because of this, there has never been an isogenic non infected control for KSHV infection in B cells. However a recent report by Myoung and Ganem has introduced co culturing as a method for infected BJAB cells (Myoung and Ganem) Using this technique we now have uninfected and BAC16 infected BJAB cells. Although BJAB BAC16 cells harbor less copies of the KSHV genome than PEL cells, and therefore express miRNAs at a lower level, gene expression profiling and HITS CLIP can still be performed in order to determine KSHV miRNA targets. The establishment of BJAB BAC16 cells provides for the first time an isogeneic control for

PAGE 95

95 studying KSHV infection in B cells. It will be interesting to perform HITS CLIP and compare profiling in BCBL 1, other PEL cells, and BJAB BAC16 infected cells. As discussed in C hapter 2, antagomir knockdown studies were perf ormed in BC 3 G indicator cells. Results showed that miR K12 3 knockdown had the greatest effect on GFP, representing RTA expression. It would be interesting to confirm this study in iSLK BAC16 miRNA cells. I have already looked at lytic gene expression and reactivation in miR K12 3 and miR K12 11 infected cells, however I believe the rest of the individual miRNA deleted virus infected cells should be tested. As mentioned above, miR K12 1 wa s shown to target I B which leads to reactivation. I did not see a significant increase in GFP expression in BC 3 G cells when miR K12 1 was knocked down, however miR K12 1 is highly expressed in PEL cells and therefore a greater effect may be seen when using BAC16 miR K12 1 infected cells. Also other interesting miRNAs miR K12 9*, 7, and 5 (Bellare and Ganem, 2009; Lin et al., 2011 ; Lu et al., 2010b) Lastly, BAC16 can be used to make new mutations in the miRNA encoding region to further investigate the role of KSHV miRNAs. A double knockout of miR K12 3 and miR K12 11 would be noteworthy to observe in both iSLK and BJAB cells for reactivation phenotypes. Knockdown studies in PEL cells show that when antagomirs for both miRNAs were transfected into cells, the highest increase in lytic gene expression was observed. There is current work in progress by the core facility to gene rate a KSHV complete miRNA knockout virus. Recent studies by Lei et al. has used BAC36 containing a 2.9 kb deletion of the miRNA cluster region, which includes 10 of the 12 KSHV miRNAs (Lei et al., 2010) However, such a large deletion may have

PAGE 96

96 an effect on othe r viral gene expression. The mutational strategy used to make individual miRNA deletions can be used to make an entire KSHV miRNA knockout virus with minimal deletions to the viral genome. Each miRNA hairpin can be disrupted by deleting very few base pai rs, and miRNAs located in the coding region of Kaposin can be mutated to disrupt pre miRNA formation but keep protein coding intact. This recombinant virus would be the first that would allow studies to be performed on all 12 KSHV encoded miRNAs. Future P rospective on KSHV miRNAs KSHV encoded miRNAs have been shown to play an important role in the biology and pathogenesis of KSHV by targeting genes involved in promoting proliferation, preventing apoptosis, evading the immune system, promoting oncogenesis, and contributing to latent/ lytic control (Table 1 2). The work described in this thesis provides additional insight on the role of two specific miRNAs, miR K12 3 and 11, in helping to maintain viral latency through targeting cellular transcription facto rs that are known to activate the RTA promoter. In addition I have also had the opportunity to collaborate on several projects involved in determining KSHV miRNA targets and functions other than maintaining latency. I worked with previous lab member Rebe cca Skalsky to determine which of the four predicted miR K12 11/ miR 155 predicted analysis, we determined that site 2 was the most important in targeting (Skalsky et al., 2007) Next I collaborated with Chris Parsons at MUSC and helped with target analysis of KSHV miRNAs. Using a prediction algorithm that was made in collaboration with Alberto Riva in bioinformatics here at UF, I scanne genes for KSHV miRNAs. This work resulted in two publications with the Parsons lab,

PAGE 97

97 one showing that miR K12 3 and 7 target C/EBP and the other demonstrates that xCT is upregulated in KSHV infected cells as a result of K12 11 targeting BACH1 (Qin et al., 2010a; Qin et al., 2010b) Lastly, I collaborated with Amy Hanson from the Boshoff lab at UCL to help determine that MAF is targeted by KSHV miRNAs. I performed antagomir tra nsfections in our 293 cells stably expression miR K12 6 or miR K12 11 and collected total RNA and cell lystates used to confirm MAF derepression upon miRNA knockdown. These data helped to confirm that MAF is indeed a target of KSHV miRNAs (Hansen et al., 2010) To date, the majority of viral miRNAs identified are encoded in the herpesvirus family. Although there is no sequence homology found between miRNAs in herpesviruses, there are common themes between them. One is the targeting of the same gene in different herpesviruses by miRNAs that have no sequence homology: HCMV, EBV, and KSHV all encode a miRNA that targets MICB, which is important for NK cell recognition and therefore aids in immune evasion (Nachmani et al., 2009; Stern Ginossar et al., 2007) Another theme is that both KSHV and MDV encode a miR 155 ortholog, KSHV miR K12 11 and MDV miR M4, which share a common set of targets as the oncomir miR 155 (Gottwein et al., 2007; Skalsky et al., 2007; Zhao et al., 2011). Interestingly, miR 155 is downregulated in KSHV infected PEL cells and miR K12 11 seems to take over miR 155 functions (Boss et al., 2011). In contrast however, in EBV transformed lymphoblastoid cel ls miR 155 is upregulated and essential for the survival and growth (Linnstaedt et al., 2010). It is possible that these miRNAs have co evolved the same seed sequence to target host key pathways. However, it could be that similar to other viral genes like vFLIP and vCyclin, these viral miRNAs have been pirated from

PAGE 98

98 the host genome as yet another means of ensuring viral persistence and evasion of host defenses. Further investigation of the overall function of miRNAs in the context of the viral genome is s till needed and the generation of a complete miRNA knockout virus may shed further light on their essential roles in herpesviral biology. The targeting of the same host pathways by seemingly unrelated miRNAs in different herpesviruses strong ly indicates t hat these miRNAs, and p ossibly viral miRNAs in general, are involved in key regulatory functions for viral life cycle, which makes them interesting and important targets for therapeutics development. Aberrant miRNA expression has been demonstrated for se veral diseases and cancers (Iorio and Croce, 2012) Recently, miRNA inhibitors have been used for treatment of such diseases in vivo M iR 132 inhibition was shown to prevent angiogenesis in an orthotopic mouse model of ovarian and breast carcinoma (Anand et al., 2010) In addition, miR 21 inhibition led to regression of malignant pre B lymphoid tumors in vivo (Medina et al., 2010) Hepatitis C Virus (HCV) is known to hijack miR 122 and is required for virus replication. miR 122 binds two sites upstream of an HCV IRES and drives synthesis of the viral polyprotein, therefore miR 122 is a candidate for drug targeting in HCV infected individuals with hepatocellu lar carcinoma (Jopling et al., 2005) Santaris Pharma has developed a specific inhibitor of miR 122 called SPC3649 which is a locked nucleic acid antisense molecule 15 bases in length. A phase I clinical trial consisted of SPC3649 administered intravenously to chimpanzees and demonstrated reduced serum concentrations of HCV. The study showed that effective doses (5mg/kg) of ant isense molecule can be delivered to liver for 12 weeks without causing major toxic effects (Hildebrandt Eriksen et al., 2012) However due to miR 122

PAGE 99

99 being a host cellular miRNA, inhibition may disrupt normal physiology and a cause metabolic change, which needs to be further investigated. KSHV miRNAs are a prime candidate for antisense targeted therapy because sequences are spec ific to the virus and therefore should not disrupt any cellular physiology or have pleotropic effects. Specific miRNAs, such as miR K12 3 and 11 can be targeted by LNAs to inhibit function, therefore increase lytic reactivation in infected cells. This w ould sensitize KSHV infected tumor cells to anti viral drugs such as gancyclovir which would need to be administered together with miRNA inhibitors. Furthermore, miRNA inhibitors can be delivered ectopically for KS lesions of the skin which would be more cost effective and easier to administer than intravenous injections. Another KSHV miRNA that can be targeted through antisense therapy is miR K12 7, which is known to target MICB, a natural killer cell ligand (Nachm ani et al., 2009) This would assist in immune recognition of an infected cell. In summary, KSHV miRNAs may serve as a novel therapeutic target, and together with currently available anti viral drugs, provide and alternative treatment of KSHV associated malignancies.

PAGE 100

100 LIST OF REFERENCES Abend, J.R., Uldrick, T., and Ziegelbauer, J.M. (2010). Regulation of tumor necrosis factor like weak inducer of apoptosis receptor protein (TWEAKR) expression by Kaposi's sarcoma associated herpesviru s microRNA prevents TWEAK induced apoptosis and inflammatory cytokine expression. Journal of virology 84, 12139 12151. Ambros, V. (2004). The functions of animal microRNAs. Nature 431, 350 355. An, F., Compitello, N., Folarin, H., Roth, J., Gerson, SL., Mc Crae, K., and R. Renne (2005). Telomerase immortalized endothelial cells: a model system to study KSHV infection, latency, and tumorigenesis in vivo. accepted for publication in Journal of Virology. An, F.Q., Folarin, H.M., Compitello, N., Roth, J., Gerso n, S.L., McCrae, K.R., Fakhari, F.D., Dittmer, D.P., and Renne, R. (2006). Long term infected telomerase immortalized endothelial cells: a model for Kaposi's sarcoma associated herpesvirus latency in vitro and in vivo. Journal of virology 80 4833 4846. An and, S., Majeti, B.K., Acevedo, L.M., Murphy, E.A., Mukthavaram, R., Scheppke, L., Huang, M., Shields, D.J., Lindquist, J.N., Lapinski, P.E. et al. (2010). MicroRNA 132 mediated loss of p120RasGAP activates the endothelium to facilitate pathological angio genesis. Nat Med 16 909 914. Areste, C., and Blackbourn, D.J. (2009). Modulation of the immune system by Kaposi's sarcoma associated herpesvirus. Trends Microbiol 17 119 129. Arvanitakis, L., Mesri, E.A., Nador, R.G., Said, J.W., Asch, A.S., Knowles, D.M ., and Cesarman, E. (1996). Establishment and characterization of a primary effusion (body cavity based) lymphoma cell line (BC 3) harboring kaposi's sarcoma associated herpesvirus (KSHV/HHV 8) in the absence of Epstein Barr virus. Blood 88 2648 2654. Bac carini, A., Chauhan, H., Gardner, T.J., Jayaprakash, A.D., Sachidanandam, R., and Brown, B.D. (2011). Kinetic analysis reveals the fate of a microRNA following target regulation in mammalian cells. Curr Biol 21 369 376. Barozzi, P., Luppi, M., Facchetti, F., Mecucci, C., Alu, M., Sarid, R., Rasini, V., Ravazzini, L., Rossi, E., Festa, S. et al. (2003). Post transplant Kaposi sarcoma originates from the seeding of donor derived progenitors. Nat Med 9 554 561. Bartel, D.P. (2004). MicroRNAs: genomics, biog enesis, mechanism, and function. Cell 116 281 297.

PAGE 101

101 Barth, S., Pfuhl, T., Mamiani, A., Ehses, C., Roemer, K., Kremmer, E., Jaker, C., Hock, J., Meister, G., and Grasser, F.A. (2008). Epstein Barr virus encoded microRNA miR BART2 down regulates the viral DN A polymerase BALF5. Nucleic Acids Res 36 666 675. Bechtel, J.T., Liang, Y., Hvidding, J., and Ganem, D. (2003). Host range of Kaposi's sarcoma associated herpesvirus in cultured cells. Journal of virology 77 6474 6481. Bellare, P., and Ganem, D. (2009). Regulation of KSHV lytic switch protein expression by a virus encoded microRNA: an evolutionary adaptation that fine tunes lytic reactivation. Cell host & microbe 6 570 575. Blackbourn, D.J., Lennette, E., Klencke, B., Moses, A., Chandran, B., Weinstein, M., Glogau, R.G., Witte, M.H., Way, D.L., Kutzkey, T. et al. (2000). The restricted cellular host range of human herpesvirus 8. Aids 14 1123 1133. Bloom, D.C. (1998). HSV Vectors for Gene Therapy. Methods in molecular medicine 10 369 386. Bogerd, H.P., Karnowski, H.W., Cai, X., Shin, J., Pohlers, M., and Cullen, B.R. A mammalian herpesvirus uses noncanonical expression and processing mechanisms to generate viral MicroRNAs. Mol Cell 37 135 142. Boss, I.W., Nadeau, P.E., Abbott, J.R., Y ang, Y., Mergia, A., and Renne, R. (2011). A KSHV encoded ortholog of miR 155 induces human splenic B cell expansion in NOD/LtSz scid IL2R{gamma}null mice. Journal of virology. Burnside, J., Bernberg, E., Anderson, A., Lu, C., Meyers, B.C., Green, P.J., Ja in, N., Isaacs, G., and Morgan, R.W. (2006). Marek's disease virus encodes MicroRNAs that map to meq and the latency associated transcript. Journal of virology 80 8778 8786. Burnside, J., Ouyang, M., Anderson, A., Bernberg, E., Lu, C., Meyers, B.C., Green P.J., Markis, M., Isaacs, G., Huang, E., and Morgan, R.W. (2008). Deep sequencing of chicken microRNAs. BMC Genomics 9 185. Cai, X., and Cullen, B.R. (2006). Transcriptional origin of Kaposi's sarcoma associated herpesvirus microRNAs. Journal of virolog y 80 2234 2242. Cai, X., Lu, S., Zhang, Z., Gonzalez, C.M., Damania, B., and Cullen, B.R. (2005). Kaposi's sarcoma associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proceedings of the National Academy of Sciences of the United States of America 102 5570 5575. Cai, X., Schafer, A., Lu, S., Bilello, J.P., Desrosiers, R.C., Edwards, R., Raab Traub, N., and Cullen, B.R. (2006). Epstein Barr virus microRNAs are evolutionarily conserved and differentially expressed. PLoS P athog 2 e23.

PAGE 102

102 Calin, G.A., and Croce, C.M. (2006). MicroRNA signatures in human cancers. Nat Rev Cancer 6 857 866. Campbell, M., Chang, P.C., Huerta, S., Izumiya, C., Davis, R., Tepper, C.G., Kim, K.Y., Shevchenko, B., Wang, D.H., Jung, J.U. et al. Prote in arginine methyltransferase 1 directed methylation of Kaposi sarcoma associated herpesvirus latency associated nuclear antigen. J Biol Chem 287 5806 5818. Campbell, M., Chang, P.C., Huerta, S., Izumiya, C., Davis, R., Tepper, C.G., Kim, K.Y., Shevchenko B., Wang, D.H., Jung, J.U. et al. (2012). Protein arginine methyltransferase 1 directed methylation of Kaposi sarcoma associated herpesvirus latency associated nuclear antigen. J Biol Chem 287 5806 5818. Campbell, T.B., Borok, M., White, I.E., Gudza, I ., Ndemera, B., Taziwa, A., Weinberg, A., and Gwanzura, L. (2003). Relationship of Kaposi sarcoma (KS) associated herpesvirus viremia and KS disease in Zimbabwe. Clin Infect Dis 36 1144 1151. Cantalupo, P., Doering, A., Sullivan, C.S., Pal, A., Peden, K.W ., Lewis, A.M., and Pipas, J.M. (2005). Complete nucleotide sequence of polyomavirus SA12. Journal of virology 79 13094 13104. Carroll, P.A., Brazeau, E., and Lagunoff, M. (2004). Kaposi's sarcoma associated herpesvirus infection of blood endothelial cell s induces lymphatic differentiation. Virology 328 7 18. Cesarman, E., Chang, Y., Moore, P.S., Said, J.W., and Knowles, D.M. (1995a). Kaposi's sarcoma associated herpesvirus like DNA sequences in AIDS related body cavity based lymphomas. N Engl J Med 332 1186 1191. Cesarman, E., Moore, P.S., Rao, P.H., Inghirami, G., Knowles, D.M., and Chang, Y. (1995b). In vitro establishment and characterization of two acquired immunodeficiency syndrome related lymphoma cell lines (BC 1 and BC 2) containing Kaposi's sarc oma associated herpesvirus like (KSHV) DNA sequences. Blood 86 2708 2714. Chan, J.A., Krichevsky, A.M., and Kosik, K.S. (2005). MicroRNA 21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 65 6029 6033. Chandriani, S., and Ganem, D. (20 10). Array based transcript profiling and limiting dilution reverse transcription PCR analysis identify additional latent genes in Kaposi's sarcoma associated herpesvirus. Journal of virology 84 5565 5573. Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., C ulpepper, J., Knowles, D.M., and Moore, P.S. (1994). Identification of herpesvirus like DNA sequences in AIDS associated Kaposi's sarcoma [see comments]. Science 266 1865 1869.

PAGE 103

103 Chen, J., Ueda, K., Sakakibara, S., Okuno, T., Parravicini, C., Corbellino, M. and Yamanishi, K. (2001). Activation of latent Kaposi's sarcoma associated herpesvirus by demethylation of the promoter of the lytic transactivator. Proceedings of the National Academy of Sciences of the United States of America 98 4119 4124. Chen, J., Ueda, K., Sakakibara, S., Okuno, T., and Yamanishi, K. (2000). Transcriptional regulation of the Kaposi's sarcoma associated herpesvirus viral interferon regulatory factor gene. Journal of virology 74 8623 8634. Chi, S.W., Zang, J.B., Mele, A., and Darnel l, R.B. (2009). Argonaute HITS CLIP decodes microRNA mRNA interaction maps. Nature 460 479 486. Cui, C., Griffiths, A., Li, G., Silva, L.M., Kramer, M.F., Gaasterland, T., Wang, X.J., and Coen, D.M. (2006). Prediction and identification of herpes simplex virus 1 encoded microRNAs. Journal of virology 80 5499 5508. Dalton Griffin, L., Wilson, S.J., and Kellam, P. (2009). X box binding protein 1 contributes to induction of the Kaposi's sarcoma associated herpesvirus lytic cycle under hypoxic conditions. Jou rnal of virology 83 7202 7209. Dejana, E., Taddei, A., and Randi, A.M. (2007). Foxs and Ets in the transcriptional regulation of endothelial cell differentiation and angiogenesis. Biochim Biophys Acta 1775 298 312. Delecluse, H.J., Kost, M., Feederle, R. Wilson, L., and Hammerschmidt, W. (2001). Spontaneous activation of the lytic cycle in cells infected with a recombinant Kaposi's sarcoma associated virus. Journal of virology 75 2921 2928. Deng, H., Young, A., and Sun, R. (2000). Auto activation of the rta gene of human herpesvirus 8/Kaposi's sarcoma associated herpesvirus. J Gen Virol 81 3043 3048. Desrosiers, R.C., Sasseville, V.G., Czajak, S.C., Zhang, X., Mansfield, K.G., Kaur, A., Johnson, R.P., Lackner, A.A., and Jung, J.U. (1997). A herpesvirus of rhesus monkeys related to the human Kaposi's sarcoma associated herpesvirus. Journal of virology 71 9764 9769. Diebel, K.W., Smith, A.L., and van Dyk, L.F. Mature and functional viral miRNAs transcribed from novel RNA polymerase III promoters. Rna 16 170 185. Dittmer, D., Lagunoff, M., Renne, R., Staskus, K., Haase, A., and Ganem, D. (1998). A cluster of latently expressed genes in Kaposi's sarcoma associated herpesvirus. Journal of virology 72 8309 8315.

PAGE 104

104 Dolken, L., Malterer, G., Erhard, F., Kothe, S ., Friedel, C.C., Suffert, G., Marcinowski, L., Motsch, N., Barth, S., Beitzinger, M. et al. (2010). Systematic analysis of viral and cellular microRNA targets in cells latently infected with human gamma herpesviruses by RISC immunoprecipitation assay. Ce ll host & microbe 7 324 334. Dourmishev, L.A., Dourmishev, A.L., Palmeri, D., Schwartz, R.A., and Lukac, D.M. (2003). Molecular genetics of Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) epidemiology and pathogenesis. Microbiol Mol Biol Rev 67 175 212, table of contents. Dunn, W., Trang, P., Zhong, Q., Yang, E., van Belle, C., and Liu, F. (2005). Human cytomegalovirus expresses novel microRNAs during productive viral infection. Cell Microbiol 7 1684 1695. Dutz, W., and Stout, A.P. (1960). Kaposi's sarcoma in infants and children. Cancer 13 684 694. Dyson, O.F., Walker, L.R., Whitehouse, A., Cook, P.P., and Akula, S.M. (2012). Resveratrol inhibits KSHV reactivation by lowering the levels of cellular EGR 1. PloS one 7 e33364. Filipowicz, W. Bhattacharyya, S.N., and Sonenberg, N. (2008). Mechanisms of post transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet 9 102 114. Garzon, R., and Croce, C.M. (2008). MicroRNAs in normal and malignant hematopoiesis. Current op inion in hematology 15 352 358. Gottwein, E., Corcoran, D.L., Mukherjee, N., Skalsky, R.L., Hafner, M., Nusbaum, J.D., Shamulailatpam, P., Love, C.L., Dave, S.S., Tuschl, T. et al. (2011). Viral microRNA targetome of KSHV infected primary effusion lympho ma cell lines. Cell host & microbe 10 515 526. Gottwein, E., and Cullen, B.R. A human herpesvirus microRNA inhibits p21 expression and attenuates p21 mediated cell cycle arrest. Journal of virology 84 5229 5237. Gottwein, E., Mukherjee, N., Sachse, C., F renzel, C., Majoros, W.H., Chi, J.T., Braich, R., Manoharan, M., Soutschek, J., Ohler, U., and Cullen, B.R. (2007). A viral microRNA functions as an orthologue of cellular miR 155. Nature 450 1096 1099. Gradoville, L., Gerlach, J., Grogan, E., Shedd, D., Nikiforow, S., Metroka, C., and Miller, G. (2000). Kaposi's sarcoma associated herpesvirus open reading frame 50/Rta protein activates the entire viral lytic cycle in the HH B2 primary effusion lymphoma cell line. Journal of virology 74 6207 6212.

PAGE 105

105 Grandad am, M., Dupin, N., Calvez, V., Gorin, I., Blum, L., Kernbaum, S., Sicard, D., Buisson, Y., Agut, H., Escande, J.P., and Huraux, J.M. (1997). Exacerbations of clinical symptoms in human immunodeficiency virus type 1 infected patients with multicentric Castl eman's disease are associated with a high increase in Kaposi's sarcoma herpesvirus DNA load in peripheral blood mononuclear cells. J Infect Dis 175 1198 1201. Grey, F., Antoniewicz, A., Allen, E., Saugstad, J., McShea, A., Carrington, J.C., and Nelson, J. (2005). Identification and characterization of human cytomegalovirus encoded microRNAs. Journal of virology 79 12095 12099. Griffiths Jones, S. (2004). The microRNA Registry. Nucleic Acids Res 32 D109 111. Grimson, A., Farh, K.K., Johnston, W.K., Garret t Engele, P., Lim, L.P., and Bartel, D.P. (2007). MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27 91 105. Grundhoff, A., Sullivan, C.S., and Ganem, D. (2006). A combined computational and microarray based approach identifies novel microRNAs encoded by human gamma herpesviruses. Rna 12 733 750. Gunther, T., and Grundhoff, A. The epigenetic landscape of latent Kaposi sarcoma associated herpesvirus genomes. PLoS Pathog 6 e1000935. Guo, H., Ingolia, N.T., Weissman, J. S., and Bartel, D.P. (2010). Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466 835 840. Haecker, I., L.A. Gay, Y. Yang, J. Hu, A.M. Morse, L. McIntyre, and R. Renne (2012). Ago HITS coma associated Herpesvirus miRNA Function in Primary Effusion Lymphomas. PLoS Pathog Under Review Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M., Jr., Jungkamp, A.C., Munschauer, M. et al. (2 010). Transcriptome wide identification of RNA binding protein and microRNA target sites by PAR CLIP. Cell 141 129 141. Hansen, A., Henderson, S., Lagos, D., Nikitenko, L., Coulter, E., Roberts, S., Gratrix, F., Plaisance, K., Renne, R., Bower, M. et al. (2010). KSHV encoded miRNAs target MAF to induce endothelial cell reprogramming. Genes Dev 24 195 205. Harrison, S.M., and Whitehouse, A. (2008). Kaposi's sarcoma associated herpesvirus (KSHV) Rta and cellular HMGB1 proteins synergistically transactivate the KSHV ORF50 promoter. FEBS Lett 582 3080 3084.

PAGE 106

106 Hengge, U.R., Ruzicka, T., Tyring, S.K., Stuschke, M., Roggendorf, M., Schwartz, R.A., and Seeber, S. (2002). Update on Kaposi's sarcoma and other HHV8 associated diseases. Part 2: pathogenesis, Castleman 's disease, and pleural effusion lymphoma. The Lancet infectious diseases 2 344 352. Hildebrandt Eriksen, E.S., Aarup, V., Persson, R., Hansen, H.F., Munk, M.E., and Orum, H. (2012). A Locked Nucleic Acid Oligonucleotide Targeting MicroRNA 122 Is Well Tol erated in Cynomolgus Monkeys. Nucleic acid therapeutics. Hu, J., Garber, A.C., and Renne, R. (2002). The latency associated nuclear antigen of Kaposi's sarcoma associated herpesvirus supports latent DNA replication in dividing cells. Journal of virology 76 11677 11687. Iorio, M.V., and Croce, C.M. (2012). microRNA involvement in human cancer. Carcinogenesis. Iorio, M.V., Piovan, C., and Croce, C.M. Interplay between microRNAs and the epigenetic machinery: an intricate network. Biochim Biophys Acta 1799 69 4 701. Jopling, C.L., Yi, M., Lancaster, A.M., Lemon, S.M., and Sarnow, P. (2005). Modulation of hepatitis C virus RNA abundance by a liver specific MicroRNA. Science 309 1577 1581. Jurak, I., Kramer, M.F., Mellor, J.C., van Lint, A.L., Roth, F.P., Knipe, D.M., and Coen, D.M. Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2. Journal of virology 84 4659 4672. Kaposi, M. (1872). Idiopathic multiple pigmented sarcoma of the skin. Arch Dertmatol Syphil 4 265 273. Kedes, D.H., Lagunoff, M., Renne, R., and Ganem, D. (1997). Identification of the gene encoding the major latency associated nuclear antigen of the Kaposi's sarcoma associated herpesvirus. J Clin Invest 100 2606 2610. Komanduri, K.V., Luce, J.A., McGrath, M.S., Herndier, B.G., and Ng, V.L. (1996). The natural history and molecular heterogeneity of HIV associated primary malignant lymphomatous effusions. J Acquir Immune Defic Syndr Hum Retrovirol 13 215 226. Koschmieder, S., Halmos, B., Levantini, E., and Tenen, D.G. (2009). Dysregulation of the C/EBPalpha differentiation pathway in human cancer. J Clin Oncol 27 619 628. Lacoste, V., Nicot, C., Gessain, A., Valensi, F., Gabarre, J., Matta, H., Chaudhary, P.M., and Mahieux, R. (2007). In primary effusion lymphoma cells, MYB transcriptional repression is associated with v FLIP expression during latent KSHV infection while both v FLIP and v GPCR become involved during the lytic cycle. Br J Haematol 138 487 501.

PAGE 107

107 Lagunoff, M., and Ganem, D. (1997). The structure and c oding organization of the genomic termini of Kaposi's sarcoma associated herpesvirus. Virology 236 147 154. Lan, K., Kuppers, D.A., Verma, S.C., and Robertson, E.S. (2004). Kaposi's sarcoma associated herpesvirus encoded latency associated nuclear antigen inhibits lytic replication by targeting Rta: a potential mechanism for virus mediated control of latency. Journal of virology 78 6585 6594. Lan, K., Kuppers, D.A., Verma, S.C., Sharma, N., Murakami, M., and Robertson, E.S. (2005). Induction of Kaposi's s arcoma associated herpesvirus latency associated nuclear antigen by the lytic transactivator RTA: a novel mechanism for establishment of latency. Journal of virology 79 7453 7465. Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochro nic gene lin 4 encodes small RNAs with antisense complementarity to lin 14. Cell 75 843 854. Lei, X., Bai, Z., Ye, F., Xie, J., Kim, C.G., Huang, Y., and Gao, S.J. (2010). Regulation of NF kappaB inhibitor IkappaBalpha and viral replication by a KSHV micr oRNA. Nat Cell Biol 12 193 199. Li, H., Li, W.X., and Ding, S.W. (2002). Induction and suppression of RNA silencing by an animal virus. Science 296 1319 1321. Liang, D., Gao, Y., Lin, X., He, Z., Zhao, Q., Deng, Q., and Lan, K. (2011). A human herpesviru s miRNA attenuates interferon signaling and contributes to maintenance of viral latency by targeting IKKvarepsilon. Cell research 21 793 806. Liang, Y., Chang, J., Lynch, S.J., Lukac, D.M., and Ganem, D. (2002). The lytic switch protein of KSHV activates gene expression via functional interaction with RBP Jkappa (CSL), the target of the Notch signaling pathway. Genes Dev 16 1977 1989. Lin, X., Liang, D., He, Z., Deng, Q., Rob ertson, E.S., and Lan, K. (2011 ). miR K12 7 5p encoded by Kaposi's sarcoma associ ated herpesvirus stabilizes the latent state by targeting viral ORF50/RTA. PloS one 6 e16224. Linnstaedt, S.D., Gottwein, E., Skalsky, R.L., Luftig, M.A., and Cullen, B.R. (2010). Virally induced cellular microRNA miR 155 plays a key role in B cell immort alization by Epstein Barr virus. Journal of virology 84 11670 11678. Lippman, Z., and Martienssen, R. (2004). The role of RNA interference in heterochromatic silencing. Nature 431 364 370. Lu, C.C., Li, Z., Chu, C.Y., Feng, J., Feng, J., Sun, R., and Ran a, T.M. (2010a). MicroRNAs encoded by Kaposi's sarcoma associated herpesvirus regulate viral life cycle. EMBO Rep 11 784 790.

PAGE 108

108 Lu, F., Stedman, W., Yousef, M., Renne, R., and Lieberman, P.M. (2010b). Epigenetic regulation of Kaposi's sarcoma associated her pesvirus latency by virus encoded microRNAs that target Rta and the cellular Rbl2 DNMT pathway. Journal of virology 84 2697 2706. Lukac, D.M., Renne, R., Kirshner, J.R., and Ganem, D. (1998). Reactivation of Kaposi's sarcoma associated herpesvirus infecti on from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252 304 312. Majerciak, V., Uranishi, H., Kruhlak, M., Pilkington, G.R., Massimelli, M.J., Bear, J., Pavlakis, G.N., Felber, B.K., and Zheng, Z.M. Kaposi' s sarcoma associated herpesvirus ORF57 interacts with cellular RNA export cofactors RBM15 and OTT3 to promote expression of viral ORF59. Journal of virology 85 1528 1540. Marshall, V., Parks, T., Bagni, R., Wang, C.D., Samols, M.A., Hu, J., Wyvil, K.M., A leman, K., Little, R.F., Yarchoan, R. et al. (2007). Conservation of virally encoded micrornas in Kaposi sarcoma -associated herpesvirus in primary effusion lymphoma cell lines and in patients with Kaposi sarcoma or multicentric castleman disease. J Infec t Dis 195 645 659. Marson, A., Levine, S.S., Cole, M.F., Frampton, G.M., Brambrink, T., Johnstone, S., Guenther, M.G., Johnston, W.K., Wernig, M., Newman, J. et al. (2008). Connecting microRNA genes to the core transcriptional regulatory circuitry of emb ryonic stem cells. Cell 134 521 533. Medina, P.P., Nolde, M., and Slack, F.J. (2010). OncomiR addiction in an in vivo model of microRNA 21 induced pre B cell lymphoma. Nature 467 86 90. Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H., and Kosz inowski, U.H. (1997). Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proceedings of the National Academy of Sciences of the United States of America 94 14759 14763. Miller, G., Heston, L., Grogan, E., Gra doville, L., Rigsby, M., Sun, R., Shedd, D., Kushnaryov, V.M., Grossberg, S., and Chang, Y. (1997). Selective switch between latency and lytic replication of Kaposi's sarcoma herpesvirus and Epstein Barr virus in dually infected body cavity lymphoma cells. Journal of virology 71 314 324. Mukherji, S., Ebert, M.S., Zheng, G.X., Tsang, J.S., Sharp, P.A., and van Oudenaarden, A. (2011). MicroRNAs can generate thresholds in target gene expression. Nat Genet 43 854 859. Murphy, E., Vanicek, J., Robins, H., She nk, T., and Levine, A.J. (2008). Suppression of immediate early viral gene expression by herpesvirus coded microRNAs: implications for latency. Proceedings of the National Academy of Sciences of the United States of America 105 5453 5458.

PAGE 109

109 Myoung, J., and Ganem, D. Infection of lymphoblastoid cell lines by Kaposi's sarcoma associated herpesvirus: critical role of cell associated virus. Journal of virology 85 9767 9777. Myoung, J., and Ganem, D. (2011). Generation of a doxycycline inducible KSHV producer ce ll line of endothelial origin: Maintenance of tight latency with efficient reactivation upon induction. Journal of virological methods 174 12 21. Nachmani, D., Stern Ginossar, N., Sarid, R., and Mandelboim, O. (2009). Diverse herpesvirus microRNAs target the stress induced immune ligand MICB to escape recognition by natural killer cells. Cell host & microbe 5 376 385. Nador, R.G., Cesarman, E., Chadburn, A., Dawson, D.B., Ansari, M.Q., Sald, J., and Knowles, D.M. (1996). Primary effusion lymphoma: a disti nct clinicopathologic entity associated with the Kaposi's sarcoma associated herpes virus. Blood 88 645 656. Neipel, F., Albrecht, J.C., and Fleckenstein, B. (1997). Cell homologous genes in the Kaposi's sarcoma associated rhadinovirus human herpesvirus 8 : determinants of its pathogenicity? Journal of virology 71 4187 4192. O'Hara, A.J., Chugh, P., Wang, L., Netto, E.M., Luz, E., Harrington, W.J., Dezube, B.J., Damania, B., and Dittmer, D.P. (2009). Pre micro RNA signatures delineate stages of endothelial cell transformation in Kaposi sarcoma. PLoS Pathog 5 e1000389. O'Hara, A.J., Vahrson, W., and Dittmer, D.P. (2008). Gene alteration and precursor and mature microRNA transcription changes contribute to the miRNA signature of primary effusion lymphoma. Bl ood 111 2347 2353. Pasquinelli, A.E., Reinhart, B.J., Slack, F., Martindale, M.Q., Kuroda, M.I., Maller, B., Hayward, D.C., Ball, E.E., Degnan, B., Muller, P. et al. (2000). Conservation of the sequence and temporal expression of let 7 heterochronic regu latory RNA. Nature 408 86 89. Persson, L.M., and Wilson, A.C. Wide scale use of Notch signaling factor CSL/RBP Jkappa in RTA mediated activation of Kaposi's sarcoma associated herpesvirus lytic genes. Journal of virology 84 1334 1347. Pfeffer, S., Sewer, A., Lagos Quintana, M., Sheridan, R., Sander, C., Grasser, F.A., van Dyk, L.F., Ho, C.K., Shuman, S., Chien, M. et al. (2005). Identification of microRNAs of the herpesvirus family. Nat Methods 2 269 276. Pfeffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John, B., Enright, A.J., Marks, D., Sander, C., and Tuschl, T. (2004). Identification of virus encoded microRNAs. Science 304 734 736.

PAGE 110

110 Plaisance Bonstaff, K., and Renne, R. (2011). Viral miRNAs. Methods Mol Biol 721 43 66. Qin, Z ., Freitas, E., Sullivan, R., Mohan, S., Bacelieri, R., Branch, D., Romano, M., Kearney, P., Oates, J., Plaisance, K. et al. (2010a). Upregulation of xCT by KSHV encoded microRNAs facilitates KSHV dissemination and persistence in an environment of oxidati ve stress. PLoS Pathog 6 e1000742. Qin, Z., Kearney, P., Plaisance, K., and Parsons, C.H. (2010b). Pivotal advance: Kaposi's sarcoma associated herpesvirus (KSHV) encoded microRNA specifically induce IL 6 and IL 10 secretion by macrophages and monocytes. Journal of leukocyte biology 87 25 34. Ramsay, R.G., and Gonda, T.J. (2008). MYB function in normal and cancer cells. Nat Rev Cancer 8 523 534. Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21 nucleotide let 7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403 901 906. Renne, R., Blackbourn, D., Whitby, D., Levy, J., and Ganem, D. (1998). Limited transmission of Kaposi's sarcoma associated herpes virus in cultured cells. Journal of virology 72 5182 5188. Renne, R., Lagunoff, M., Zhong, W., and Ganem, D. (1996a). The size and conformation of Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) DNA in infected cells and virions. Journal of virology 70 8151 8154. Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D., and Ganem, D. (1996b). Lytic growth of Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) in culture. Nat Med 2 342 346. Riley, K.J., Rabinowitz, G.S ., and Steitz, J.A. Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression. Journal of virology 84 5148 5157. Rivas, C., Thlick, A.E., Parravicini, C., Moore, P.S., and Chang, Y. (2001). Kaposi's sarcoma associated herpesvirus LANA2 is a B cell specific latent viral protein that inhibits p53. Journal of virology 75 429 438. Roizman, B., and Sears, A.E. (1993). Herpes Simplex viruses and their replication. In The Human Herpesviruses, B. Roizman, R.J. Whitley, and C. Lopez, eds. (New York, N Y: Raven Press), pp. 11 68. Russo, J.J., Bohenzky, R.A., Chien, M.C., Chen, J., Yan, M., Maddalena, D., Parry, J.P., Peruzzi, D., Edelman, I.S., Chang, Y., and Moore, P.S. (1996). Nucleotide sequence of the Kaposi sarcoma associated herpesvirus (HHV8). Pro ceedings of the National Academy of Sciences of the United States of America 93 14862 14867.

PAGE 111

1 11 Ruvkun, G., Wightman, B., and Ha, I. (2004). The 20 years it took to recognize the importance of tiny RNAs. Cell 116 S93 96, 92 p following S96. Sadler, R., Wu, L., Forghani, B., Renne, R., Zhong, W., Herndier, B., and Ganem, D. (1999). A complex translational program generates multiple novel proteins from the latently expressed kaposin (K12) locus of Kaposi's sarcoma associated herpesvirus. Journal of virology 7 3 5722 5730. Sakakibara, S., Ueda, K., Chen, J., Okuno, T., and Yamanishi, K. (2001). Octamer binding sequence is a key element for the autoregulation of Kaposi's sarcoma associated herpesvirus ORF50/Lyta gene expression. Journal of virology 75 6894 6900 Samols, M.A., Hu, J., Skalsky, R.L., and Renne, R. (2005). Cloning and identification of a microRNA cluster within the latency associated region of Kaposi's sarcoma associated herpesvirus. Journal of virology 79 9301 9305. Samols, M.A., Hu, J., Skalsky, R.L., Maldonado, A.M., Riva, A., Lopez, M.C., Baker, H.V., and R. Renne (2007). Identification of cellular genes targeted by KSHV encoded microRNAs. PLoS Pathog. Sarid, R., Flore, O., Bohenzky, R.A., Chang, Y., and Moore, P.S. (1998). Transcription mappin g of the Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) genome in a body cavity based lymphoma cell line (BC 1). Journal of virology 72 1005 1012. Schafer, A., Cai, X., Bilello, J.P., Desrosiers, R.C., and Cullen, B.R. (2007). Cloning and a nalysis of microRNAs encoded by the primate gamma herpesvirus rhesus monkey rhadinovirus. Virology 364 21 27. Schutte, M., da Costa, L.T., Hahn, S.A., Moskaluk, C., Hoque, A.T., Rozenblum, E., Weinstein, C.L., Bittner, M., Meltzer, P.S., Trent, J.M., and et al. (1995). Identification by representational difference analysis of a homozygous deletion in pancreatic carcinoma that lies within the BRCA2 region. Proceedings of the National Academy of Sciences of the United States of America 92 5950 5954. Schwarz M., and Murphy, P.M. (2001). Kaposi's sarcoma associated herpesvirus G protein coupled receptor constitutively activates NF kappa B and induces proinflammatory cytokine and chemokine production via a C terminal signaling determinant. J Immunol 167 505 5 13. Seo, G.J., Chen, C.J., and Sullivan, C.S. (2009). Merkel cell polyomavirus encodes a microRNA with the ability to autoregulate viral gene expression. Virology 383 183 187. Seo, G.J., Fink, L.H., O'Hara, B., Atwood, W.J., and Sullivan, C.S. (2008). Evo lutionarily conserved function of a viral microRNA. Journal of virology 82 9823 9828.

PAGE 112

112 Siegal, B., Levinton Kriss, S., Schiffer, A., Sayar, J., Engelberg, I., Vonsover, A., Ramon, Y., and Rubinstein, E. (1990). Kaposi's sarcoma in immunosuppression. Possib ly the result of a dual viral infection. Cancer 65 492 498. Skalsky, R.L., and Cullen, B.R. Viruses, microRNAs, and host interactions. Annual review of microbiology 64 123 141. Skalsky, R.L., Samols, M.A., Plaisance, K.B., Boss, I.W., Riva, A., Lopez, M. C., Baker, H.V., and Renne, R. (2007). Kaposi's sarcoma associated herpesvirus encodes an ortholog of miR 155. Journal of virology 81 12836 12845. Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., and Ruvkun, G. (2000). The lin 41 RBCC gene act s in the C. elegans heterochronic pathway between the let 7 regulatory RNA and the LIN 29 transcription factor. Mol Cell 5 659 669. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals Hatem, D., Babinet, P., d'Agay, M.F., Clauvel, J.P., Raphael M., Degos, L., and et al. (1995). Kaposi's sarcoma associated herpesvirus like DNA sequences in multicentric Castleman's disease. Blood 86 1276 1280. Staskus, K.A., Sun, R., Miller, G., Racz, P., Jaslowski, A., Metroka, C., Brett Smith, H., and Haase, A .T. (1999). Cellular tropism and viral interleukin 6 expression distinguish human herpesvirus 8 involvement in Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. Journal of virology 73 4181 4187. Staudt, M.R., Kanan, Y., Je ong, J.H., Papin, J.F., Hines Boykin, R., and Dittmer, D.P. (2004). The tumor microenvironment controls primary effusion lymphoma growth in vivo. Cancer Res 64 4790 4799. Stern Ginossar, N., Elefant, N., Zimmermann, A., Wolf, D.G., Saleh, N., Biton, M., H orwitz, E., Prokocimer, Z., Prichard, M., Hahn, G. et al. (2007). Host immune system gene targeting by a viral miRNA. Science 317 376 381. Sullivan, C.S., Grundhoff, A.T., Tevethia, S., Pipas, J.M., and Ganem, D. (2005). SV40 encoded microRNAs regulate v iral gene expression and reduce susceptibility to cytotoxic T cells. Nature 435 682 686. Sullivan, C.S., Sung, C.K., Pack, C.D., Grundhoff, A., Lukacher, A.E., Benjamin, T.L., and Ganem, D. (2009). Murine Polyomavirus encodes a microRNA that cleaves early RNA transcripts but is not essential for experimental infection. Virology 387 157 167 Sun, Q., Matta, H., Lu, G., and Chaudhary, P.M. (2006). Induction of IL 8 expression by human herpesvirus 8 encoded vFLIP K13 via NF kappaB activation. Oncogene 25 271 7 2726.

PAGE 113

113 Sun, R., Lin, S.F., Gradoville, L., Yuan, Y., Zhu, F., and Miller, G. (1998). A viral gene that activates lytic cycle expression of Kaposi's sarcoma associated herpesvirus. Proceedings of the National Academy of Sciences of the United States of Am erica 95 10866 10871. Swanton, C., Mann, D.J., Fleckenstein, B., Neipel, F., Peters, G., and Jones, N. (1997). Herpes viral cyclin/Cdk6 complexes evade inhibition by CDK inhibitor proteins. Nature 390 184 187. Talbot, S.J., Weiss, R.A., Kellam, P., and B oshoff, C. (1999). Transcriptional analysis of human herpesvirus 8 open reading frames 71, 72, 73, K14, and 74 in a primary effusion lymphoma cell line. Virology 257 84 94. Tam, W., Hughes, S.H., Hayward, W.S., and Besmer, P. (2002). Avian bic, a gene iso lated from a common retroviral site in avian leukosis virus induced lymphomas that encodes a noncoding RNA, cooperates with c myc in lymphomagenesis and erythroleukemogenesis. Journal of virology 76 4275 4286. Tang, S., Bertke, A.S., Patel, A., Wang, K., Cohen, J.I., and Krause, P.R. (2008). An acutely and latently expressed herpes simplex virus 2 viral microRNA inhibits expression of ICP34.5, a viral neurovirulence factor. Proceedings of the National Academy of Sciences of the United States of America 105 10931 10936. Tang, S., Patel, A., and Krause, P.R. (2009). Novel less abundant viral microRNAs encoded by herpes simplex virus 2 latency associated transcript and their roles in regulating ICP34.5 and ICP0 mRNAs. Journal of virology 83 1433 1442. Tarabo letti, G., Benelli, R., Borsotti, P., Rusnati, M., Presta, M., Giavazzi, R., Ruco, L., and Albini, A. (1999). Thrombospondin 1 inhibits Kaposi's sarcoma (KS) cell and HIV 1 Tat induced angiogenesis and is poorly expressed in KS lesions. J Pathol 188 76 81 Tischer, B.K., and Kaufer, B.B. (2012). Viral bacterial artificial chromosomes: generation, mutagenesis, and removal of mini F sequences. Journal of biomedicine & biotechnology 2012 472537. Tischer, B.K., von Einem, J., Kaufer, B., and Osterrieder, N. ( 2006). Two step red mediated recombination for versatile high efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40 191 197. Umbach, J.L., and Cullen, B.R. (2010). In depth analysis of Kaposi's sarcoma associated herpesvirus microRN A expression provides insights into the mammalian microRNA processing machinery. Journal of virology 84 695 703. Umbach, J.L., Kramer, M.F., Jurak, I., Karnowski, H.W., Coen, D.M., and Cullen, B.R. (2008). MicroRNAs expressed by herpes simplex virus 1 dur ing latent infection regulate viral mRNAs. Nature 454 780 783.

PAGE 114

114 Umbach, J.L., Nagel, M.A., Cohrs, R.J., Gilden, D.H., and Cullen, B.R. (2009). Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia. Journal of virology 83 10677 10683. Verma, S.C., Lan, K., Choudhuri, T., Cotter, M.A., and Robertson, E.S. (2007). An autonomous replicating element within the KSHV genome. Cell host & microbe 2 106 118. Waidner, L.A., Morgan, R.W., Anderson, A.S., Bernberg, E.L., Kamboj, S., Garcia, M., Riblet, S.M., Ouyang, M., Isaacs, G.K., Markis, M. et al. (2009). MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus specific. Virology 388 128 136. Walz, N., Christalla, T., T essmer, U., and Grundhoff, A. A global analysis of evolutionary conservation among known and predicted gammaherpesvirus microRNAs. Journal of virology 84 716 728. Wang, H.W., Trotter, M.W., Lagos, D., Bourboulia, D., Henderson, S., Makinen, T., Elliman, S ., Flanagan, A.M., Alitalo, K., and Boshoff, C. (2004). Kaposi sarcoma herpesvirus induced cellular reprogramming contributes to the lymphatic endothelial gene expression in Kaposi sarcoma. Nat Genet 36 687 693. Wang, S.E., Wu, F.Y., Yu, Y., and Hayward, G.S. (2003). CCAAT/enhancer binding protein alpha is induced during the early stages of Kaposi's sarcoma associated herpesvirus (KSHV) lytic cycle reactivation and together with the KSHV replication and transcription activator (RTA) cooperatively stimulate s the viral RTA, MTA, and PAN promoters. Journal of virology 77 9590 9612. Wasylyk, B., Hagman, J., and Gutierrez Hartmann, A. (1998). Ets transcription factors: nuclear effectors of the Ras MAP kinase signaling pathway. Trends Biochem Sci 23 213 216. Wi ghtman, B., Burglin, T.R., Gatto, J., Arasu, P., and Ruvkun, G. (1991). Negative regulatory sequences in the lin 14 3' untranslated region are necessary to generate a temporal switch during Caenorhabditis elegans development. Genes Dev 5 1813 1824. Wightm an, B., Ha, I., and Ruvkun, G. (1993). Posttranscriptional regulation of the heterochronic gene lin 14 by lin 4 mediates temporal pattern formation in C. elegans. Cell 75 855 862. Yakushko, Y., Hackmann, C., Gunther, T., Ruckert, J., Henke, M., Koste, L., Alkharsah, K., Bohne, J., Grundhoff, A., Schulz, T.F., and Henke Gendo, C. (2010). Kaposi's Sarcoma Associated Herpesvirus Bacterial Artificial Chromosome Contains a Duplication of a Long Unique Region Fragment within the Terminal Repeat Region. Journal o f virology 85 4612 4617.

PAGE 115

115 Yao, Y., Zhao, Y., Xu, H., Smith, L.P., Lawrie, C.H., Sewer, A., Zavolan, M., and Nair, V. (2007). Marek's disease virus type 2 (MDV 2) encoded microRNAs show no sequence conservation with those encoded by MDV 1. Journal of virolo gy 81 7164 7170. Yao, Y., Zhao, Y., Xu, H., Smith, L.P., Lawrie, C.H., Watson, M., and Nair, V. (2008). MicroRNA profile of Marek's disease virus transformed T cell line MSB 1: predominance of virus encoded microRNAs. Journal of virology 82 4007 4015. Yu F., Harada, J.N., Brown, H.J., Deng, H., Song, M.J., Wu, T.T., Kato Stankiewicz, J., Nelson, C.G., Vieira, J., Tamanoi, F. et al. (2007). Systematic identification of cellular signals reactivating Kaposi sarcoma associated herpesvirus. PLoS Pathog 3 e4 4. Zhang, D., Frappier, L., Gibbs, E., Hurwitz, J., and O'Donnell, M. (1998). Human RPA (hSSB) interacts with EBNA1, the latent origin binding protein of Epstein Barr virus. Nucleic Acids Res 26 631 637. Zhao, Y., Xu, H., Yao, Y., Smith, L.P., Kgosana, L. Green, J., Petherbridge, L., Baigent, S.J., and Nair, V. (2011). Critical role of the virus encoded microRNA 155 ortholog in the induction of Marek's disease lymphomas. PLoS Pathog 7 e1001305. Zhong, W., Wang, H., Herndier, B., and Ganem, D. (1996). Res tricted expression of Kaposi sarcoma associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma. Proceedings of the National Academy of Sciences of the United States of America 93 6641 6646. Zhou, F.C., Zhang, Y.J., Deng, J.H., Wang, X.P., Pan, H.Y., Hettler, E., and Gao, S.J. (2002). Efficient infection by a recombinant Kaposi's sarcoma associated herpesvirus cloned in a bacterial artificial chromosome: application for genetic analysis. Journal of virology 76 6185 6196. Zhu, J.Y., Pfuhl, T., Mo tsch, N., Barth, S., Nicholls, J., Grasser, F., and Meister, G. (2009). Identification of novel Epstein Barr virus microRNA genes from nasopharyngeal carcinomas. Journal of virology 83 3333 3341. Zhu, N., Zhang, D., Chen, S., Liu, X., Lin, L., Huang, X., Guo, Z., Liu, J., Wang, Y., Yuan, W., and Qin, Y. (2011). Endothelial enriched microRNAs regulate angiotensin II induced endothelial inflammation and migration. Atherosclerosis 215 286 293. Ziegelbauer, J.M., Sullivan, C.S., and Ganem, D. (2009). Tandem a rray based expression screens identify host mRNA targets of virus encoded microRNAs. Nat Genet 41 130 134.

PAGE 116

116 BIOGRAPHICAL SKETCH Karlie Belle Plaisance Bonstaff was born in New Orleans, LA and raised in Laffite, LA where she attended Fisher High School a nd graduated in 2001. She then moved to Baton Rouge, LA and attended Louisiana State University where she received her B.S. in Biological Sciences with a minor in Chemistry in 2006. Upon graduation, she continued her education at the University of Florid a as a Ph.D. student in the Interdisciplinary Program in Biomedical Sciences where she joined the laboratory of Dr. associated herpes virus miRNAs. She received her Ph.D. in Me dical Sciences with a concentration in Genetics from the University of Florida in the summer of 2012 Upon completion of her Ph.D. program, Karlie will explore post doctoral opportunities in the gamma herpesvirus field. She has been married to Christophe r Bonstaff, a registered nurse, for nearly 3 years and they welcomed their first child Abigail on July 2 nd 2012.