Immunological and Gastrointestinal Effects of Galactooligosaccharides (GOS) Supplementation

MISSING IMAGE

Material Information

Title:
Immunological and Gastrointestinal Effects of Galactooligosaccharides (GOS) Supplementation a Randomized, Double-Blind Controlled Study in Healthy Aged Adults
Physical Description:
1 online resource (170 p.)
Language:
english
Creator:
Girard, Stephanie-Anne
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Nutritional Sciences
Committee Chair:
Langkamp-Henken, Bobbi
Committee Members:
Percival, Susan S
Dahl, Wendy Joanne
Mai, Volker

Subjects

Subjects / Keywords:
adults -- aged -- cold -- fiber -- flu -- galactooligosaccharides -- gastrointestinal -- immunity -- microbiota -- symptoms
Nutritional Sciences -- Dissertations, Academic -- UF
Genre:
Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Galactooligosaccharides (GOS) are resistant to digestion and selectively stimulate the growth and activity of beneficial bacteria within the colon conferring health benefits and are therefore classified as prebiotics.  In healthy older adults, GOS supplementation improved natural killer (NK) cell activity and altered cytokine production but no studies examine whether these are associated with a reduction in probability of upper respiratory tract infection (URTI).  The purpose of this work was to examine the ability of GOS in maintaining digestive health and immune strength over cold/flu season. It was hypothesized that participants consuming GOS would have decreased diarrhea, indigestion, constipation and reflux syndromes and a lower probability of URTI due to alterations in the microbiota and cytokine production.  In a randomized, double-blind study, adults received 0 g (n=38) or 5 g (n=43) of GOS daily for 24 weeks.  Blood was drawn at week 0, 3 (seasonal influenza vaccination) and 5 (2 weeks post-vaccination).  Stool samples were collected at week 0 and during week 2.  Gastrointestinal and cold/flu symptoms were collected daily over the 24-week study.  Peripheral blood mononuclear cells were stimulated in vitro with mitogens and cytokine production was quantified.  Lymphocyte subpopulations were determined.  Differences were observed between treatment groups where GOS significantly reduced digestive symptoms of constipation (p=0.01) and abdominal pain (p=0.02).  The probability of URTI was not different between GOS and placebo group.  However, participants receiving GOS were significantly older (p=0.04); therefore participants were sub-divided by age, Younger Aged (?65 y) and Older Aged (³65 y), and the data were reanalyzed.  Older Aged participants receiving GOS had a significantly lower probability of self-reporting a cold (33±10%) compared to Younger Aged participants (77±9%) receiving GOS (p=0.0332).  Older Aged participants in the GOS group had a significantly higher percentage of NK cells (17.9±1.3%) than Younger Aged participants (12.3±1.3%) receiving GOS (p=0.0022).  Older Aged participants receiving GOS had a significantly (p=0.006) higher in vitro production of interferon (IFN)-gamma (11100±1520 pg/mL) compared to the placebo (4460±1210pg/mL).  The lower probability of URTI in the Older Aged participants receiving GOS may be due to a higher percentage of NK cells or an indirect effect of IFN-gamma.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Stephanie-Anne Girard.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Langkamp-Henken, Bobbi.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044379:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 IMMUNOLOGICAL AND GASTROINTESTINAL EFFECTS OF GALACTOOLIGOSACCHARIDES (GOS) SUPPLEMENTATION: A RANDOMIZED, DOUBLE BLIND CONTROLLED STUDY IN HEALTHY AGED ADULTS By STEPHANIE ANNE GIRARD A DISSERTATION PRESENTED TO THE GRADUA TE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Stephanie Anne Girard

PAGE 3

3 To my parents, Yves a nd Danielle, and to all of those that have supported me during this incredible and life changing experience

PAGE 4

4 ACKNOWLEDGMENTS Firstly, I would like to thank my mentor Dr. Bobbi Langkamp Henken who has successfully guided me through this journey where many obstacles were encountered but all surpassed. She was always there to motivate and encourage me whilst helping me acquire new skills along the way. I would also like to acknowledge all of the members of my committee; Dr. Wendy Dahl, Dr. Susan Percival an d Dr. Volker Mai who have challenged me and helped me attain the level of knowledge that I possess today. I give my thanks to my parents, Yves and Danielle, who have been with me, although not physically but rather emotionally and mentally, and without th eir support I surely could not have completed this degree. They have encouraged me throughout these three years and helped me reach my ultimate goal. I would certainly not have completed my PhD without the continual support from my lifelong friend and co mpanion Kaunteya Nundy. I have to share this doctoral degree with him as we have together achieved this huge success. As we prepare to build a life together, I feel that we have accomplished this steppingstone to our prosperous, both with love and succes s, future together. A special thanks go to all of the current and former members of my laboratory; CJ Nieves, Gretchen Specht, Sam Spaiser, Ally Radford and Christine Hughes. They certainly made my days sunnier and kept my hopes up during hard times. I m ust also acknowledge all of the undergraduate students that have worked with me and helped me execute all of the laboratory assays as well as conduct this incredible study; Elaine Tan, Christina Vitale, Nicholas Morrell, Vivek Iyer, and Paula Beers. Additi onally, fellow graduate students of collaborating laboratories such as Rebecca Creasy and Tyler Culpepper have always been there for me when I needed a

PAGE 5

5 friend. They have helped me understand concepts and master techniques and without their support and fri endship, I could not have excelled and achieved my goa ls.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 INTRODUCTION AND SPECIFIC AIMS ................................ ................................ 16 2 REVIEW OF THE LITERATURE ................................ ................................ ............ 18 Introductory Notes ................................ ................................ ................................ .. 18 Galactooligosaccharides ................................ ................................ ......................... 19 Properties ................................ ................................ ................................ ......... 19 GRAS Status and Health Claims ................................ ................................ ...... 20 Research Involving Galactooligosaccharides ................................ ................... 21 Stool improvement ................................ ................................ ..................... 23 Min eral absorption ................................ ................................ ..................... 24 Lipid metabolism ................................ ................................ ........................ 25 Immunomodulation ................................ ................................ .................... 26 Carci nogenesis ................................ ................................ .......................... 28 Common Cold Symptoms and Complementary Health Practices ........................... 28 Cold Assessment in Research ................................ ................................ ......... 30 Nutritional Status, Immune Function and Common Cold ................................ .. 31 Nutritional Modulation of Common Cold ................................ ........................... 33 Echinacea ................................ ................................ ................................ .. 34 Ascorbic acid ................................ ................................ .............................. 35 Zinc ................................ ................................ ................................ ............ 36 Multivitamins and m inerals ................................ ................................ ......... 39 Garlic ................................ ................................ ................................ ......... 3 9 Probiotics ................................ ................................ ................................ ... 41 Prebiotics ................................ ................................ ................................ ... 42 Age and Common Cold ................................ ................................ .................... 43 Immune System ................................ ................................ ................................ ...... 45 Leukocytes ................................ ................................ ................................ ....... 45 Serum Acute Phase Proteins ................................ ................................ ........... 46 Peripheral Blood Mononuclear Cell (PBMC) Cytokine Production to Mitogens ................................ ................................ ................................ ........ 47 Immunosenescence ................................ ................................ ......................... 50

PAGE 7

7 Mucosal Immunity ................................ ................................ ............................ 52 Salivary and Fecal Secretory IgA (sIgA) ................................ ........................... 54 Digestive Health ................................ ................................ ................................ ...... 56 Microbiota ................................ ................................ ................................ ......... 56 Gastrointestinal Symptom Rating Scale ................................ ........................... 57 GOS and the Microbiota ................................ ................................ ................... 58 Aged Adults and the Microbiota ................................ ................................ ........ 59 3 METHODS ................................ ................................ ................................ .............. 66 Participants ................................ ................................ ................................ ............. 66 Experimental Design ................................ ................................ ............................... 67 GOS Administration Protocol ................................ ................................ .................. 68 Influenza Vaccination ................................ ................................ .............................. 69 Study Questionnaires ................................ ................................ .............................. 69 Mini Nutritional Assessment ................................ ................................ .................... 71 Food Frequency Questionnaire (FFQ) ................................ ................................ .... 73 Reagents ................................ ................................ ................................ ................ 74 Blood Sample Collection ................................ ................................ ......................... 74 Serum Collection ................................ ................................ ................................ .... 75 Phenotypic Determination of Lymphocyte Population ................................ ............. 75 CRP Assay ................................ ................................ ................................ ............. 77 PBMC Isolation ................................ ................................ ................................ ....... 77 PBMC Stimulation with Mitogens (PHA and LPS) Assay ................................ ........ 78 Multiplex Bead Based Assay ................................ ................................ .................. 78 Saliva Collection ................................ ................................ ................................ ..... 79 Salivary sIgA Assay ................................ ................................ ................................ 80 Fecal Collection ................................ ................................ ................................ ...... 80 Fecal sIgA Assay ................................ ................................ ................................ .... 81 Microbiota Analysis ................................ ................................ ................................ 81 Statistical Analysis ................................ ................................ ................................ .. 82 4 RESULTS ................................ ................................ ................................ ............... 87 Self Reported Cold Days, Symptoms and Symptom Intensities ............................. 88 Quality of Life Measurements ................................ ................................ ................. 89 Lymphocytes Subpopulation Cell Numbers ................................ ............................ 90 Cytokine Produced Following PHA Stimulation of Peripheral Blood Mononuclear Cells ................................ ................................ ................................ ..................... 91 Cytokine Produced Following LPS Stimulation of Peripheral Blo od Mononuclear Cells ................................ ................................ ................................ ..................... 92 Salivary and Fecal Secretory Immunoglobulin A and C Reactive Protein ............... 92 GSRS Questionnaire ................................ ................................ .............................. 93 Food Frequency Questionnaire ................................ ................................ .............. 93 Bifidobacteria Genome Equivalent (GE) Proportion Changes ................................ 94 5 DISCUSSION AND CONCLUSIONS ................................ ................................ .... 113

PAGE 8

8 Effect of GOS on Symptom Intensity and Quality of Life ................................ ....... 116 GOS and the Immune System ................................ ................................ .............. 117 Increase in Immunogenic Bacteria ................................ ................................ ........ 118 GOS and Digestive Health ................................ ................................ .................... 120 Preventing Attachment of Pathogenic Bacteria ................................ ..................... 122 How GOS through its Influence on Proliferation of Beneficial Bacteria within the Colon May Affect URTI ................................ ................................ ...................... 122 Limitations of the Study ................................ ................................ ......................... 125 Conclusions ................................ ................................ ................................ .......... 126 APPENDIX A IRB APPROVAL LETTER ................................ ................................ ..................... 128 B IRB INFORMED CONSENT ................................ ................................ ................. 130 C QUESTIONNAIRES ................................ ................................ .............................. 142 D DESCRIPTIVE STATISTI CS OF PLACEBO AND GALACTOOLIGOSACCHARIDES BY AGE GROUP ................................ ........... 144 LIST OF REFERENCES ................................ ................................ ............................. 150 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 170

PAGE 9

9 LIST OF TABLES Table page 1 1 Age related changes in production of cytokines following stimulation of isolated peripheral blood mononuclear cells with mitogens ................................ 64 4 1 Demographics and compliance ................................ ................................ ........ 100 4 2 Self reported cold days ................................ ................................ ..................... 102 4 3 Quality of life measurements on days of self reported cold .............................. 104 4 4 Lymphocytes subpopulations cell numbers per microliter of whole blood by treatment and responder group, and blood draw ................................ .............. 105 4 5 Cytokines produced following phytohemagglutinin stimulation of peripheral blood mononuclear cells by treatment and responder group, and blood draw 107 4 6 Cytokines produced following lipopolysaccharide stimulation of peripheral blood mononuclear cells by treatment and responder group, and blood draw 109 4 7 Salivar y and fecal secretory immunoglobulin A and C reactive protein by treatment and responder group, and blood draw ................................ .............. 111 D 1 Descriptive statistics of placebo and galactooligosaccharides supplementa tion by age group ................................ ................................ ......... 145

PAGE 10

10 LIST OF FIGURES Figure page 1 1 (1 4) linked galactooligosaccharide. ............................ 63 1 2 Effects of aging on the microbiota and the subseq uent inflammatory response ................................ ................................ ................................ ............. 63 3 1 Study design ................................ ................................ ................................ ....... 86 4 1 Flow chart of participant recruitment, allocation and analysis ............................. 95 4 2 Effect of treatment group and age group on the probability of self reporting a col d over the 6 month interv ention ................................ ................................ ..... 96 4 3 Effect of treatment group and age group on concentration of interferon produced following stimulation of peripheral blood mononucl ear cells ............... 97 4 4 Effect of treatment group and age group the percentage of lymphocytes that were identifi ed as natural killer cells ................................ ................................ ... 98 4 5 Monthly gastrointestinal symptoms i n participants receiving the placebo or galactooligosacc harides ................................ ................................ ..................... 99

PAGE 11

11 LIST OF ABBREVIATIONS AGE Aged Garlic Extract ANOVA Analysis of Variance AP Autologous Plasma APC Antigen Presenting Cells B cell B Lymphocyte BMI Body Ma ss Index CC Calf Circumference CD Cluster Designation DC Dendritic cells DGGE Denaturing Gradient Gel Electrophoresis EFSA European Food Safety Authority ELISA Enzyme Linked Immuno Sorbent Assay FBS Fetal B ovine Serum FDA U.S. Food and Drug Administration FOS Fructooligosaccharides GALT Gut Associated Lymphoid Tissue GE Genome Equivalents GI Gastrointestinal Tract GOS Galactooligosaccharides GSRS Gastrointestinal Symptom Rating Scale HDL High Density Lipoprotein HEPES 4 (2 hydroxyethyl) 1 piperazineethanesu lfonic acid HIV Human Immunodeficiency Virus IBD Inflammatory Bowel Disease

PAGE 12

12 ICAM 1 Intracellular Cell Adhesion Molecule 1 IFN Interferon IL Interleukin Ig Immunoglobulin IRB Institutional Review Board LAB Lactic Acid Bacteria LPS Lipopolysaccharide MAC Mid Arm Circumference mg Milligram mL Milliliter MHC Major Histocompatibility Complex MLN Mesenteric Lymph Node MNA Mini Nutritional Assessment NK cell Natural Killer cell PAMP Pathogen Associated Molecular Pattern PRR Pattern Recognition Receptor PBMC Pe ripheral Blood Mononuclear Cell PHA L Phytohemagglutinin Leukocyte RBC Red Blood Cell rpm Revolution Per Minute RPMI Roswell Park Memorial Institute RT Room Temperature SCFA Short Chain Fatty Acid SEM Standard Error of the Mean SI Symptom Intensity

PAGE 13

13 sIgA Se cretory Immunoglobulin A T cell T lymphocyte TCR T Cell Receptor Th T helper TNF Tumor Necrosis Factor TOS Transgalactooligosaccharides Treg T regulatory U Units Microgram Microliter Micromolar URTI Upper Respiratory Tract Infection WURSS Wisc onsin Upper Respiratory Syndrome Survey

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IMMUNOLOGICAL AND GASTROINT ESTINAL EFFECTS OF GALACTOOLIGOSACCHARIDES (GOS) SUPPLEMENTATION: A RANDOMIZED, DOUBLE BLIND CONTROLLED STUDY IN HEALTHY AGED ADULTS By Stephanie Anne Girard August 2012 Chair: Bobbi Langkamp Henken Major: Nutritional Sciences G alactooligosaccharide s (GOS) are resistant to dige stion and selectively stimulate the growth and activity of beneficial bacteria within the colon confer ring health benefits and are therefore classified as prebiotics. In healthy older adults, GOS supplementation improved natural k iller (NK) cell activity and altered cytokine production but no studies examine whether these are associated with a reduction in probability of upper respiratory tract infection (URTI). The purpose of this work was to examine the ability of GOS in maint aining digestive health and immune strength over cold/flu season. It was hypothesized that participants consuming GOS would have decreased diarrhea, indigestion, constipation and reflux syndromes and a lower probability of URTI due to alterations in the mi crobiota and cytokine production In a randomized, double blind study, adults received 0 g (n=38) or 5 g (n=43) of GOS daily for 24 w ee k s Blood was drawn at week 0, 3 (seasonal influenza vaccin ation) and 5 (2 weeks post vaccination). Stool samples were collected at week 0 and during week 2. Gastrointestinal and cold/flu symptoms were collected daily over the 24 week study. Peripheral blood mononuclear cells were stimulated in vitro with mitogens and cytokine production was

PAGE 15

15 quantified. Lymphocyte subp opulations were determined. Differences were observed between treatment groups where GOS significantly reduced digestive symptoms of constipation (p=0.01) and abdominal pain (p=0.02). The probability of URTI was not different between GOS and placebo grou p. However, p articipants receiving GOS were significantly older (p=0.04); therefore participants were sub divided by age, Younger Aged ) and Older Aged ( 65 y ) and the data were reanalyzed Older Aged participants receiving GOS had a significantly lower probability of self reporting a cold ( 33 10 %) compared to Y ounger Aged participants (779 %) receiving GOS (p=0.0 332) Older Aged participants in the GOS group had a significantly higher percentage of NK cells (17.91.3 %) t han Younger Aged participa nt s (12.31.3%) receiving GOS (p=0.0022). Older Aged participants receiving GOS had a significantly (p=0.006) higher in vitro production of interferon ( IFN ) 100 15 20 pg/mL) compared to the placebo ( 4460 1210 pg/mL). The lower probability of URTI in the Older Aged participants receiving GOS may be due to a higher percentage of NK cells or an indirect effect of IFN

PAGE 16

16 CHAPTER 1 INTRODUCTION AND SPE CIFIC A IMS Factors such as various diseases, genetics and nutrition can influence the immune system. In recent years, an increase in interest of products exhibiting immune modulatory properties has been observed and this is reflected by a significant increase in foods or beverages with structure/function claims (1) One such category of dietary supplements are prebiotics which are defined as food ingredients resistant to digestion in the s tomach that selectively stimulate the growth and activity of select bacter ia within the colon which then confer s health benefits upon the host (2) One such prebiotic recognized by experts for its clinical evidence of digestive and immune health is the non digestible carbohydrate galactooligosaccharides (GOS). Because of their structural similarity to some of the oligosaccharides found in breast milk which have been found to have bifidogenic effects, GOS have been added to infant formulas. Although GOS have received increased interest, especially in the pediatric field where G OS has been shown to exert immune enhancing effects in infants (3) studies are still lacking as to whether GOS helps maintain immune and digestive health in adults. Galactooligosaccharides have previously been shown to reduce days of upper respiratory tr act infection (URTI) in academically stressed undergraduate students (4) Additionally, studies have shown improved natural killer cell activity and altered cytokine production with the addition of GOS to the diets of healthy older adults (5) ; however, no studies examine whether these changes in immune parameters are associated with a reduction in probability of URTI Since the immune system of aged adults exhibits diminished functions; perhaps supplementation of GOS could improve immune function which wo uld enhance nonspecific resistance of the host to infections such as the common cold.

PAGE 17

17 The purpose of this study was to determine whether the functional fiber GOS can help maintain immune strength and digestive health in free living older adults. More spec ifically, this study was conducted to determine if GOS would decrease the probability of self reporting a cold through modulation of the microbiota, increasing the amounts of bifidobacteria genome equivalents and immune parameter such as NK cells. It is hy pothesized that older adults consuming GOS daily for 24 weeks over cold and flu se ason will have a decreased probability of self reporting a cold due to a proliferation of beneficial bacteria within the colon enhancing immune parameters and altering cytoki ne production. It is also hypothesized that GOS will decrease the symptom intensity (SI) score of cold symptoms on self reported cold days and days with cold symptoms as a proportion of total study days. Following supplementation with GOS, immune cells s uch as natural killer (NK) cells will increase in total cell numbers and as a percentage of total lymphocytes. It is believed that changes in lymphocyte subpopulations will subsequently increase the production of certain cytokines It is also hypothesize d that through modulation of the microbiota, GOS will improve gastrointestinal symptoms such as constipation and diarrhea syndromes.

PAGE 18

18 CHAPTER 2 REVIEW OF THE LITERATURE Introductory Notes D ietary supplementation with micro and macronutrients is believed t o maintain good health and decrease the symptoms and duration of debilitating illnesses such as the common cold. Galactooligosaccharides are classified as prebiotics and have been known to possess immune enhancing effects in infants (3) These non digest ible carbohydrates are generally recognized as safe (GRAS) and added to infant formula to more closely resemble breast milk ; however, studies are lacking as to whether they help maintai n health in adults. D ays of URTI have previously been shown to be redu ced with GOS in academically stressed undergraduate students (4) Additionally, a study conducted by Vulevic and colleagues has shown improved natural killer cell activity and altered cytokine production with the addition of GOS to the diets of healthy ol der adults (5) ; however, no studies examine whether these changes in immune parameters in aged adults are associated with a reduction in probability of URTI. Topics covered in this literature review are GOS their GRAS status and various studies involving the ir use cold and flu symptoms, cold assessment in research, the effects of nutritional status, nutrients and age on cold and flu. The immune system will be reviewed; cells of the immune system, cytokines produced following stimulation by mitogens, imm unosenescence as well the mucosal immune system. Finally, the methodology used to evaluate gastrointestinal (GI) symptoms and factors affecting the microbiota such as GOS and age are also included.

PAGE 19

19 Galactooligosaccharides Properties Galactooligosaccharid e s are galactose containing non digestible carbohydrate s naturally found in hum an milk or synthesized from lactose. Collectively, galactose containing oligosaccharides are found in breast milk at a concentration of approximately 1 g/L. Galactooligosaccha rides in addition to a wide variety of carbohydrates are considered prebiotic s Candidate prebiotics comprise carbohydrates such as manno oligosaccharides, pectic oligosaccharides, soybean oligosaccharides, isomalto oligosaccharides, xylo oligosaccharid es and lactulose which can be further classified according to their chemical structure and degree of polymerization (3) However, oligosaccharides such as inulin, fructooligosaccharides (FOS) naturally found in fruits, vegetables and grains, and GOS are the most commonly studied (6) Since FOS and GOS are considered as being commercially safe, historically, they have been widely used in food products. According to a report from the Global Industry Analysts, the popularity of prebiotic ingredients is on the rise on the US market and projected sales are thought to reach nearly 225 million dollars by the year 2015 (7) The promising future of the prebiotic market mainly through heightened public awareness, has triggered increased interest in prebiotic re search a nd more information and strict guidelines are now becoming available on these useful dietary tools. In order to be characterized as a prebiotic, a food ingredient must satisfy the three following criteria; resist metabolic fate (resisting gastric a cidity, hydrolysis by mammalian enzymes and absorption in the upper gastrointestinal tract), allow for fermentation (fermented by the intestinal microbiota) and have an effect on gastrointestinal microbiota (stimulating the growth and activity of intestina l bacteria

PAGE 20

20 leading to potential health and well being) (2) The prebiotic used in this study, Purimune TM linked GOS in 6) as well as differing degrees of oligomerization which range between 3 and 5 (Figure 1 1) Galactooligosaccharides contain at least 90.4% of GOS, on a dry weight basis, with the remaining material being principally lactose, water as well as small amounts of two monosaccharides dextrose and galactose (8) G alactooligosaccharides are manufactured from food grade lactose galactosidase enzyme obtained from the non toxigenic and non pathogenic bacteria Bacillus circulans LOB 377. The transgalactosylation results in th galactosylactose, longer oligosaccharides, transgalactosylated disaccharides and non reducing oligosaccharides (9) GRAS Status and Health Claims Inulin, FOS and GOS are recognized by the U.S. Food and Drug Administration (FDA) as being safe (2) In 2009, following scientific procedures executed by GTC Nutrition, Purimune TM received the GRAS status and this notice is available online (8) Since GOS are traditionally found in yogurts in Japan and because they can be produced from ingested lactose by the resident intestinal microbiota (10) they are designated as Food for Specific Health Use (FOSHU) by Japanese authorities and have a non novel food status in the EU (11) At present, many countries do not have the premarket restricti ons by which regulatory agencies approve or disapprove of prebiotics because they lack an established system for health claims. As a general rule, scientific validation of health claims attributed to marketed products should still be available in the even t that

PAGE 21

21 authorities request it (2) In the United States, most marketing claims used for prebiotics are structure/function claims due to the fact that health claims and nutrient content claims cannot currently be used; the FDA has yet to approve such claim s and a daily content value for prebiotics has still not been established (2) Recently the European Food Safety Authority (EFSA) rejected a health claim, attributing a reduction GOS marketed in the UK Furthermore, two health claims, which were based on newly developed scientific also rejected (12) despite the fact that a double blind, placebo controlled study looking (13) was published a few months earlier. Nonetheless, in countries like Japan, oligosaccharides and various dietary fibers are additional information obtained from clinical trial results, is required to assist regulatory agencies in coming to a consensus as to what marketing claims should be allowed. Research Involving Galactooligosaccharides breast milk promoted the growth of certain types of intestinal bacteria (14) Breastfed infants seemed to have an intestinal micro biota largely dominated by bifidobacteria resulting from their ability to utilize oligosaccharides found in breast milk (15) For this reason, many studies involving GOS have investigated its effect on microbiological

PAGE 22

22 changes. Although many studies have examined the effects of a mixture of 90% GOS and 10% long chain FOS (inulin) at a 9:1 ratio to simulate the composition of human milk (16, 17) for the purpose of this literature review, studies relating to GOS research; stool improvement, mineral absorpti on, lipid metabolism, immunomodulation and carcinogenesis, use GOS as the sole substrate unless stated otherwise. A placebo controlled study executed by Ito et al. (18) showed that a daily dose of 10 g of GOS fed to 12 healthy male volunteers for 8 weeks i ncreased fecal bifidobacteria and lactobacilli when compared to a placebo. A second study executed by these same investigators looked at the effects of feeding 2.5 g of GOS daily (rather than 10 g) for 3 weeks (instead of 8 weeks). The results obtained fr om 12 healthy males suggested that feeding a smaller amount of GOS over a shorter period of time still increased bifidobacteria in the feces as well as decreased numbers of clostridia and bacteroides (19) An additional study examining changes in the micr obiota was conducted in 30 participants. Each participant was randomized to receive 8.1 g of GOS (n=8), 8.1 g of GOS with 3 x 10 10 Bifidobacterium lactis Bb 12 (n=10) or 3 x 10 10 Bifidobacterium lactis alone (n=10) (20) Unlike the previous studies, litt le change in fecal bifidobacteria was observed in the group receiving GOS alone. An explanation of these results is the method of detection used (polymerase chain reaction enzyme linked immunosorbent assay; PCR ELISA) which gives relative amounts of bifido bacteria rather than total amounts. After ingestion, non digestible poly and oligosaccharides are used as substrates for microbial fermentation and selectively stimulate the growth of bifidobacteria in complex microbial communities that exist in the large intestine. The major end products

PAGE 23

23 of prebiotic fermentation by bacteria are short chain fatty acids (SCFA) (i.e., acetate, propionate and butyrate) (11) Since more than 95 percent of SCFA are rapidly absorbed by the colonocytes in the large intestine, f ecal measurements of SCFA do not provide useful information about the fermentability of different prebiotics. Although in vivo methods of measurements of SCFA still remain to be developed, Bouhnik et al. (21) studied the fermentation profile of GOS using fecal homogenate in an in vitro study model. The investigators showed that the addition of 10 g of GOS to batch cultures inoculated with human fecal homogenates resulted in increased acetate and lactate production which was not observed in control ferment ers. In fact, acetate and lactate formation in the previous study is consistent with other findings demonstrating that these two SCFA are produced from bifidobacteria and lactobacillus metabolism and that butyrate does not seem to be an end product. In t erms of in vivo conditions, it is likely that lactate produced by the fermentation of GOS is in turn utilized by butyrate producing bacteria which increases butyrate production as an indirect consequence. Additionally, microbial fermentation of GOS should liberate small amounts of carbon dioxide, hydrogen, and methane gas (22) Stool i mprovement Many studies involving the use of lactulose, FOS and GOS have demonstrated that these prebiotics possess laxative effects. The gastroenterological effects conferr ed by prebiotics have been exhaustively studied and tools are available to assess their effects on constipation. Although frequency of defecation is generally used as a crude measurement of constipation, additional questionnaires such as the Gastrointesti nal Symptom Rating Scale (GSRS) can be used to assess this syndrome. The GSRS comprises of questions addressing constipation and defines it as a reduced ability to

PAGE 24

24 empty the bowels, being bothered by hardened stool, and the feeling that after finishing a bowel movement, there are still some stools that need to be passed (23) A study by Deguchi et al. examined the outcome of giving 75 women with a propensity to suffer from constipation either 2.5 g or 5 g of GOS daily for seven days (24) The investigato rs concluded that 5 g of GOS significantly improved the defecation frequency. A double blind, randomized, crossover controlled trial conducted in fourteen constipated elderly women investigated whether a yoghurt containing 9 g of GOS could relieve constip ation (25) The results, although not significant, suggested that GOS seemed to make defecation easier (p=0.07). Additionally, when participants were consuming the GOS containing yogurt, the mean defecation frequency per week (7.1stools/week) was higher than during consumption of the placebo (5.9 stools/week). Mineral a bsorption The vast bulk of mineral absorption occurs in the small intestine and the principal route is through the paracellular route (26) Since some of the determinants of mineral absorp tion are mineral solubility, permeability of the intestinal epithelium and luminal transit time, administration of prebiotics and its effects on mineral absorption have been studied. Minerals in the gastrointestinal (GI) tract are present in forms that ar e poorly absorbable and production of SCFA by the microbial fermentation of prebiotics acidifies the gut lumen and increases the solubility and absorption of minerals such as calcium. The majority of studies looking at mineral metabolism and GOS have been executed using animal models. In experiments conducted in rats, GOS supplementation seemed to stimulate calcium absorption and this resulted in an improvement in the efficiency of magnesium absorption (27 30) Human studies of mineral absorption have sh own inconsistent results. A study conducted with healthy male volunteers supplemented

PAGE 25

25 with 15 g of GOS, FOS or inulin looked at calcium and iron absorption through 24 hours urine collections and measurements of calcium isotopes and found no effect on calc ium and iron absorption with any of the prebiotics (31) A later study by the same group, though executed with healthy postmenopausal women, looked at the effect of 20 g of transgalactooligosaccharides (TOS) on calcium absorption. The results from this s tudy showed by measuring administered calcium isotopes in urine collections a significant increase in calcium absorption in this population (32) Lipid m etabolism To reiterate, the ingestion and subsequent fermentation of prebiotics lead to the formation o f SCFA. In turn, SCFA such as propionate and acetate can be absorbed along the colon and reach the liver through the portal vein (33) Once acetate enters the liver and through enzymatic activation, it can enter the cholesterogenesis and lipogenesis path ways. It is thought that acetate can downregulate the rate limiting enzyme in the cholesterol synthesis pathways hence this could explain the hypocholesterolemic effect of prebiotics, such as lactulose, and partly explain the link from diet to atheroscler osis and cardiovascular disease (34) Several animal studies have suggested that prebiotics, such as inulin and FOS, could positively affect serum lipids by lowering blood cholesterol levels (35) However, results from studies executed in human clinical trials are still conflicting. Thus far, two studies have been completed with human participants, both comparing GOS to FOS, inulin or to a placebo and measuring serum cholesterol levels. The first study by van Dokkum et al. (36) was a double blind, rando mized and controlled trial where 12 young healthy male participants were given 15 g per day of GOS, FOS and inulin (during different treatment periods of 3 weeks for each prebiotic) and the authors observed no significant difference in blood

PAGE 26

26 lipids or gluc ose absorption. The second study was completed in healthy aged adults where participants were either given 5.5 g of a GOS mixture or a placebo (5) The results from this study also showed no significant difference in total serum cholesterol or high densit y lipoprotein (HDL) cholesterol levels. The commonality between these two studies is that they were both executed in normolipidemic participants. Further studies could potentially show a decrease in total serum cholesterol and/or an increase in HDL chole sterol if they are done in participants with initial elevated serum cholesterol levels. Immunomodulation The gastrointestinal tract has been known to be a significant component of the immune system. This is perhaps evolutionarily attributable to the fact that this organ is in continuous interaction with foreign antigenic stimuli from food and commensal or pathogenic bacteria (37) The gut associated lymphoid tissue (GALT), the mucosal immune system found in the intestine is comprised of innate and adaptiv e immune cells. The GALT is presumed to be made up of aggregated lymphoid tissue (solitary lymphoid aggregated lymphoid tissue (lamina propria lymphoid cells and intraepithelial lymphocytes) (38) Since the G ALT is in continuous interaction with the commensal bacteria within our gut lumen as well as their metabolic byproducts, dietary substrates such as prebiotics, which are able to be fermented by and influence the microbiota, should in turn indirectly affect the GALT (11) Several means by which prebiotics are thought to impact the immune system have been hypothesized. An example being attenuation of inflammation in the colon through increased SCFA production. Short chain fatty acids can not only provide en ergy to colonic cells but also inhibit tumor formation (39) by inhibiting DNA synthesis and

PAGE 27

27 inducing cell differentiation (40) as well as increasing the numbers of immunomodulatory bacteria such as lactobacilli and bifidobacteria (3) An important immunol ogical role of butyrate is its ability to suppress lymphocyte proliferation through inhibition of cytokine production by T helper 1 (Th1) lymphocytes (such as interferon (IFN) and interleukin (IL) 2) (41) A study by Vulevic et al. (5) looked at the eff ect of supplementing 5.5 g of GOS to the diets of healthy aged adults. This was a double blind, placebo controlled crossover study where participants consumed both the placebo and GOS for 10 weeks each. Results from this study showed significant effects on the immune response where there was a significant increase in phagocytosis of bacteria by monocytes and neutrophils, in NK cell activity and in the secretion of the anti inflammatory cytokine IL 10 by peripheral blood mononuclear cells (PBMCs). A clear positive correlation was observed between the number of bifidobacteria and both phagocytosis and NK cell activity. Recently, a study in Smad3 deficient mice, an animal model linked to gastric neoplasia (42) and increased systemic inflammation, reported t he effect of supplementation with GOS on immune variables (43) The investigators observed that GOS supplementation increased fecal Bifidobacterium spp. by 1.5 fold, significantly increased the percentage of NK cells in the spleen and in the mesenteric ly mph node, stimulated NK expression of certain chemokine receptors (CCR9) and finally stimulated colonic IL 15 production. Additionally GOS, less so FOS and inulin, can mimic eukaryotic cell surface receptors. An in vitro study by Shoaf et al. demonstrate d that GOS can inhibit the attachment of enteropathogenic Escherichia coli to Caco 2 cells (44) Virulent bacteria adhere to the glycoconjugate like structures on these oligosaccharides in lieu of epithelial cells in the gastrointestinal tract

PAGE 28

28 Carcinogen esis Fermentation of GOS and FOS can lead to the production of butyrate. This SCFA has been shown to stimulate apoptosis making it a potential chemopreventive factor in carcinogenesis (45) Additionally, selective fermentation of GOS by specific bacteria can lead to the production of propionate (46) which has also been shown to be anti inflammatory in terms of colon cancer cells (47) Although in vitro studies and studies executed in animals are encouraging, the anti tumorigenic activity of prebiotics h as not been examined thoroughly in humans and there are very few human studies examining specific anti cancer effects of fermentable carbohydrates and colonic microbiota. Epidemiological studies have been inconsistent in regards to the correlation between diet and colorectal cancer risk (48) D Health Study where 121,700 fe male registered nurses aged 30 to 55 years old and residing in the United States completed a mailed questionnaire on known or suspected risk factors for c ancer and coronary heart disease showed no correlation between dietary fiber consumption and colon cancer (49) Additionally, human intervention studies using either FOS a combination of oligosaccharides or even a mixture of prebiotics and probiotics (s ynbiotics) have shown conflicting results in terms of their effects on the colon environment which may or may not impact colorectal neoplasia (50 52) Common Cold Symptoms and Complementary Health Practices The common cold still continues to exert a great financial burden on society despite tremendous advances in the scientific field. Additionally, it is a nuisance in regards to unpleasant and bothersome symptoms (nasal stuffiness and discharge, sneezing, sore throat and cough) (53) The economic burden f rom the common cold arises not only from direct costs such as healthcare resource use (visits to doctors) but

PAGE 29

29 also indirect costs reflected by productivity losses related to absences from work. According to the United States Department of Health and Human Services, it is estimated that in 2008, there were over one billion common cold cases. Each year in the United States, these cold episodes result in about 25 million visits to family doctors, approximately 20 million days of absence from work and 22 mill ion days of absence from school (54) It has been estimated that the common cold affects adults two to four times per year (55) and children can suffer up to five to six colds each year (56, 57) The common cold can be caused by a multitude of different viruses that have different pathogenic mechanisms and this is one of the reasons there is still no universal treatment for this illness. The rhinovirus (30 to 50% of the total cases) and coronavirus (10 to 15% of the total cases) are the most common virus es responsible for the common cold (53) however approximately 200 other viruses are also the cause of the common cold and about 23% of colds are caused by unknown and non infectious agents (58, 59) Unfortunately, although antibiotics are not effective a gainst viruses, they seem to be widely used for treatment of upper respiratory tract viral infections (60) The Agency for Healthcare Research and Quality recently reported that overuse of antibiotics is still a concern; though prescribing patterns are sl owly improving (61) In 2007, the overall annual average of antibiotics prescribed at visits where there was a diagnosis of the common cold stood at 1,728 per 100,000 persons which is still above the Healthy People 2020 objective of 864 courses of antibio tics per 100,000 population (62) For these reasons and in order to manage this prevalent and expensive illness, effective antiviral therapies or dietary means to prevent or reduce symptom severity and duration should be examined.

PAGE 30

30 Cold Assessment in Resea rch Although colds and flu are considered one of the most common infections in humans (63) currently, there are no infallible tools for assessing colds (64) In the literature, certain laboratory parameters such as virus identification, counts of neutrop hils or other leukocytes, as well as quantitative assays of different cytokines including IL 1, IL 6 and IL 8 have been used as biomarkers of this illness (65) The problem with these laboratory measures is that they do not correlate very well with specif ic symptoms and do not predict important health outcomes. As for questionnaires that could help in assessing common cold severity in adults, only one is commonly recognized and accepted; the Jackson scale (66) However, the Jackson scale, which was devel oped in the 1950s, does not include quality of life measures rather, it includes eight symptoms (sneezing, nasal obstruction, nasal discharge, sore throat, cough, headache, chilliness and malaise) which are rated as either absent, mild, moderate or severe and the rating of these symptoms is either self assessed or assessed by a clinician or research assistant (67) Another debate emerges; whether clinical assessment of a cold should be a subjective (self observation) meas ure of health. In the past, studies comparing self reports to reports are extremely unreliable (68) Explicably, it was believed that lay people assessed cold symptoms much differently than clinicians because th e disability caused by this infection was primarily due to the symptoms and the subjective perception of the illness (69) An additional questionnaire called the Wisconsin Upper Respiratory Syndrome Survey (WURSS) has been developed to assess health value s related to cold illnesses and measure change over time (improvements or deteriorations compared to the previous day) in areas which are

PAGE 31

31 important to the participants experiencing the cold. This questionnaire is a 44 item index which consists of impairme nts to daily living, breathing, sleeping, working, and interpersonal relationships. It associates more strongly with health related quality of life lacking in the Jackson scale. Research conducted by Barrett and colleagues used data from an earlier study where nearly four hundred participants were inoculated with a rhinovirus. Biomarkers such as IL 8, nasal neutrophil counts, mucus weight, viral titer, and seroconversion were measured. In this reported study, both the Jackson cold scale and WURSS were ad ministered (67) Although the study was initially conducted to test the effects of echinacea (70) the results were reported as being negative. When Barrett et al. strictly looked at the correlation with biomarkers, although a correlation with laboratory assessed measures was observed, neither the Jackson scale or the WURSS was a good predictor of induced infection. This is not unexpected since, generally, only one third of participants exposed to viruses will develop the cold and only one third of those infected individuals will then develop symptoms (69, 71) Currently, improved questionnaires based on self assessment are commonly used to clinically measure common cold episodes and this is supported by the presence of a good concordance between the par assessment of symptoms through these questionnaires and evaluation by a physician (72) The use of good questionnaires combined with immunological markers in intervention studies should be the gold standard in order to better understand ch anges in immunological markers and their clinical significance (73) Nutritional Status, Immune Function and Common Cold It is well recognized that nutritional status highly influences the immune system and immune dysfunction can result from single nutrien t deficiencies (74, 75)

PAGE 32

32 Deficiencies in trace elements such as copper and iron may negatively impact neutrophil function. In both humans and rats, copper deficiency has been shown to impair neutrophil circulating numbers and function (76, 77) Given th at neutrophils are usually the first immune cells to arrive at sites of tissue damage or infection; this observed loss of function negatively impacts the innate immune system. A deficiency in iron has also been shown to decrease the ability of neutrophils to kill bacteria (78) Vitamin A deficiency in rats (79) and vitamin E (80) deficiency in humans have both shown to negatively impact NK cell numbers and/or activity. Nutritional inadequacies such as the ones mentioned above as well as protein energy ma lnutrition induce a weak immune response to vaccination (81) Undernutrition as well as protein deficiency have both been negatively associated with specific and non specific immunity (82) Nutritional assessment in aged adults can be determined using th e Mini Nutritional Assessment (MNA) questionnaire. This validated assessment tool has been shown to be highly specific (98%) and sensitive (96%) and shows high correlation with other measures of nutritional status such as vitamin status (83) A study by Hudgens and colleagues conducted with nursing home elders suffering from pressure ulcers showed that an MNA score indicative of malnutrition was associated with an impaired immune function (84) Participants that were identified as being malnourished (wit h an MNA score of less than 17 out of a possible score of 30) exhibited reduced neutrophil respiratory burst and decreased whole blood lymphocyte proliferation in response to the mitogens concanavalin A and pokeweed. This study demonstrated that a low MNA score was associated with an impaired immune response validating the use of the MNA questionnaire to link nutritional status and immune function.

PAGE 33

33 Since malnutrition has such an effect on the immune system, it is also a major factor in the occurrence of in fections as the two interact synergistically in worsening the health outcome (75) Atrophy and loss of function of lymphoid organs are associated with malnutrition and increase susceptibility to pathogens, reactivation of viral infections and development of opportunistic infections (85) Consequently, improvement of nutritional status could potentially decrease the incidence of infections such as the common cold. Nutritional Modulation of Common Cold It has been known for quite some time that nutrients fo und in foods, such as vitamins, can influence immunity (86) In fact, the Japanese were the first to observe that food could exert a role beyond gastronomic pleasure and energy supply (87) and that nutrients in foods could enhance certain physiological fu nctions leading to the prevention or management of diseases (88) As previously indicated, very few effective pharmacological therapies exist for the treatment of the common cold. The majority of drugs prescribed against this illness are effective at red ucing the pain symptoms (non steroidal anti inflammatory drugs) but have no apparent effect on overall duration and (89) looked at the effectiveness of antihistamines in reducing the s everity of nasal symptoms (running nose and sneezing) and concluded that chlorphenamine and doxylamine conferred a small reduction in symptoms compared to the placebo. A meta analysis of controlled clinical trials on the effect of nasal decongestants on t he common cold found that there was a small significant decrease (4%) in subjective nasal symptoms after a single dose of decongestant compared to the placebo and that this slight decrease in symptoms is also observed over a longer period of three to five days (90) It is evident from these

PAGE 34

34 studies that there exists a need for safe and efficacious alternate therapies to treat the common cold and that the demand is undoubtedly present. In 2007, the National Center for Complementary and Alternative Medicine published a report where, according to the National Health Interview Survey (NHIS), US adults spent approximately 14.8 billion dollars on non vitamin and non mineral natural products and nearly 2.9 billion dollars on homeopathic medicine (91) Additional ly, a telephone survey of medication use in the United States was conducted from February 1998 through December 1999. This survey named the Slone Survey reported that prevention of colds and influenza as well as immune enhancement were among the top 10 re asons participants took vitamins and herbal supplements (92) This suggests that Americans do remediate to alternative and complementary medicine for enhancement of immune health. Echinacea sed medicinally by Indigenous peoples for quite some time, its popularity grew considerably when it was first used in Europe against infections. The most common species of echinacea recognized for their medicinal value are Echinacea angustifolia Echinace a pallida and Echinacea purpur e a (93) and frequently used plant parts in different products are the flower, the stem and the root. Additionally, all species of echinacea contain water soluble polysaccharides, a lipophilic fraction (alkylamides and polyace tylenes) and caffeoyl conjugates (chicoric acid and caffeic acid) (58) In vitro studies with echinacea have demonstrated its ability to modulate certain immune cells. A study by Goel et al. demonstrated that a formulation prepared from Echinacea p urpure a plants decreased total daily cold symptom scores in participants when

PAGE 35

35 compared to a placebo and increased the total numbers of circulating leukocytes, monocytes, neutrophils and NK cells in fasted blood samples (94) Potential mechanisms by which echina cea exerts its immunomodulatory effects have been investigated by Woelkart and colleagues (95) These investigators looked at the effect of Echinacea angustifolia roots on the endocannabinoid system of a rodent model and more specifically their ability to bind to the cannabinoid receptors CB1 and CB2. They found that alkylamides, a major lipophilic constituent of Echinacea angustifolia roots, showed selective affinity to CB2 receptors suggesting that alkylamides may modulate immune suppression, induction of apoptosis and cell migration. These results support findings from an earlier study by Gertsch et al. reporting that alkylamides from Echinacea purpurea tincture induced de novo synthesis of tumor necrosis (TNF (96) Although in vitro studies seem to suggest that e chinacea can modulate immune responses, whether it can efficiently prevent or treat the common cold is still cont roversial. Recently, a meta analysis was conduc ted to evaluate the ability of e chinacea in modulating duration and incidence of the common cold. This meta analysis included 14 trials comprising 16 a nalyses and suggested that e chinacea brings an additiona l benefit in the prevention as well as the treatment of a cold (58) Nonetheless, it must be noted that clinical trial results have been difficult to interpret partly because there is a lack of consistency in t he use of different species of e chinacea and plant parts. Ascorbic a cid Ascorbic acid, commonly referred to as vitamin C, is a powerful antioxidant required for the inhibition of membrane lipid peroxidation and it also plays a major role

PAGE 36

36 in the prevention of cardiovascular disease, cancer and catarac ts (87) Several the immune system (97) In fact, vitamin C has been shown to be involved in delayed type hypersensitivity skin tests, antibody production as well as l ymphocyte proliferation most particularly in aged adults (98) As for vitamin C use in the treatment of common cold, data seem to indicate that taking a daily vitamin C dose of 200 mg or more at the onset of cold symptoms does not significantly decrease s ymptom severity or duration (99) Indeed, a Cochrane systematic review (100) found seven clinical trials using vitamin C as a treatment and evaluated its effects cold duration. Only one of the seven trials found that participants consuming 8 g of vitamin C at the onset of symptoms had a positive effect on cold duration (less than a day shorter in cold duration) compared to those receiving 4 g. Conflictingly, the remaining six studies showed no effect of vitamin C as a treatment of the common cold. The s ame review looked at the effect of ascorbic acid when taken prophylactically and found that when it is taken as a preventative measure, a very slight decrease in the number of colds is observed however, the same decrease is not detected in cold severity. Additionally, symptom duration decreased by approximately 8% in trials that used a greater than 1 g daily dose of vitamin C. When considering that the common cold has a mean duration of symptoms of seven to ten days and that in certain cases symptoms can still be present after three weeks (53) an 8% decrease in symptom duration can represent up to one to two fewer cold symptoms days. Zinc The effects of zinc on the immune system have been well characterized. In fact, zinc deficiency has led us to underst and more about the important role this essential

PAGE 37

37 mineral plays on the immune system. In humans, during mild zinc deficiency, there is a decrease in NK cell activity, lymphocyte proliferation, IL 2, IFN as well as a lowered CD4 + to C D8 + T lymphocyte ratio (101) In regards to the common cold, zinc has been shown to inhibit viral replication by interfering with rhinovirus protein cleavage or capsid binding to the intracellular cell adhesion molecule 1 (ICAM 1) on nasal epithelium (102 ) Following the discovery of the mechanisms responsible for rhinovirus attachment to cellular components, researchers have attempted to use pharmacological means to block the attachment of the virus to the ICAM 1 receptor by using soluble decoys as well as different viral capsid binders (plecoranil; antirhinoviral drug). However, both of these approaches have resulted in only modest reductions in severity and duration of illness (103) There has been some evidence proposing that zinc may help in reducin g the severity of cold symptoms through its effect as an astringent on the trigeminal nerve (104) A drawback regarding the use of zinc in the context of prevention or treatment of the common cold is the different preparations of zinc which are currently being used. In clinical trials, caution must be exercised when choosing the formulation in which to administer zinc as some modes of administration such as citric or tartaric acids, sorbitol, or mannitol are responsible for binding to and subsequently ina ctivating elemental zinc (105, 106) The formulation must be able to release the ionic form of zinc in order to be efficacious. A study by Mossad and colleagues comparing zinc lozenges (containing 13.3 mg of zinc gluconate; which has been shown not to bi nd to zinc as tightly as citrate) to a placebo and its effect on the symptom duration reported that zinc had positive effects in significantly reducing the duration of common cold symptoms (107) However, a different study conducted by

PAGE 38

38 Smith et al. also l ooking at the effect of 11.5 mg of zinc gluconate lozenges showed that the duration of illness was not affected by zinc but that on days four to seven of treatment the participants taking zinc had significantly lower symptom severity scores than the placeb o group (108) An additional mode of delivery of zinc sulfate is through nasal sprays. Results from a study using a nasal spray, delivering a maximum daily dose of 0.044 mg of elemental zinc, showed that participants receiving zinc had a significantly lo wer nasal symptom score on the first day of a cold but this effect was not observed on the cold days that followed (109) The zinc nasal spray had no effect on the duration of cold symptoms. A more recent study conducted by the Mossad group looked at the ability of a zinc nasal gel, delivering a maximum daily dose of 2.1 mg of elemental zinc, in shortening the duration and reducing the severity of the common cold in healthy adults (110) Throughout the entire duration of the study, participants were to a pply the zinc nasal gel only when they thought they had a cold. The results from this study indicated that zinc was effective in significantly reducing the duration and significantly decreasing the absolute scores of the cold symptoms from the second day to the seventh day of the cold. These results suggest that direct delivery of zinc to the nasal mucosa, which is the area of viral replication, may provide an added benefit compared to the use of lozenges. A very recent meta analysis evaluating eight stu dies and the efficacy and safety of zinc in the treatment of the common cold concluded that oral zinc formulations could shorten the duration of cold symptoms in adults (111) The authors also found that this reduction in duration of symptoms was not stat istically significant among children.

PAGE 39

39 Multivitamins and m inerals A randomized, double blind, placebo controlled trial conducted in the Netherlands investigated the effect of physiological doses of multivitamin and minerals, 200 mg of vitamin E, both, or pl acebo on incidence and severity of self reported acute respiratory tract infection in non institutionalized healthy adults aged 60 years or older (112) The results from this study indicated that the severity of symptoms was not influenced by multivitamin and mineral supplementation and that when vitamin E was used compared to no vitamin E, the severity was actually worsened. No effect was observed for multivitamin and mineral or vitamin E supplementation on the incidence of illness. Garlic Other than for its traditional culinary purposes, historically, garlic ( Allium sativum ) has been used for its medicinal effects (113) Garlic has been shown to provide cardiovascular benefits (114) as well as offer a protective effect against stomach and colorectal can cer (115, 116) Additionally, it has been purported that garlic exhibits antimicrobial, antifungal and antiviral features although the main mechanism by which garlic exerts these effects is still unknown. Several compounds present within the garlic prepa ration itself may impact its effectiveness. Allicin, an organosulfur compound found in garlic, has been demonstrated to have antibacterial (117) and antiviral (118) properties in vitro However, it is important to keep in mind that although a quarter of a fresh clove of garlic, weighing approximately 1 g (119) contains 4.38 to 4.65 mg of allicin (120) the latter is inactivated by cooking and therefore the process used to formulate the product containing the garlic compounds must be considered. This may account for differences in the release of allicin from those different products (121) A 2012 Cochrane review by Lissiman et al. (122) looked at randomized controlled trials

PAGE 40

40 which compared garlic to a placebo, no treatment or standard treatment of the co mmon cold. As a primary outcome, this review focused on both prevention trials where the effects of garlic on occurrences of cold were measured and treatment trials looking at duration of symptoms. The investigators also took into consideration the numbe r of days until recovery. Interestingly, of the six trials that were identified as potentially applicable, five were rejected, being left with only a single study which met their stringent selection criteria. In this study, Josling and colleagues randomi zed 146 adult participants to either receive a capsule containing 180 mg of allicin powder or a placebo for 12 weeks between the months of November and February (123) The participants were instructed to record in a daily diary the number of occurrences o f the common cold. Participants had to self report the cold duration, the number of days when they felt challenged or that a cold was coming on, and the number of days needed to recover from the cold. The authors reported a significant reduction in the n umber of colds in participants receiving the garlic suggesting that garlic may have a preventative effect on the common cold. However, the number of days to recover from a cold did not differ between the groups. Few adverse effects were encountered with only smell and skin rash being reported. Since garlic consumption has been associated with unpleasant gastric side effects (belching and strong breath odor) and body odor following consumption, further studies are interested in aged garlic extract (AGE) s upplementation. In fact, unlike traditional garlic, AGE is nearly odorless and is produced from minced garlic which is incubated in aqueous alcohol (15 to 20%) for 20 months and then concentrated (124) AGE lacks the lipid soluble compound allicin which was the main component previously mentioned. A recent study conducted by

PAGE 41

41 Nantz et al. looked at supplementation with AGE and its effect on immune function and health outcomes (125) More specifically, this randomized, double blind, placebo controlled stu dy conducted in healthy adults looked at the impact of AGE on immune cell function and proliferation and cold and flu symptoms. The results from this study demonstrated that the group receiving the garlic supplement showed significantly higher proliferati T cells) and NK cells as well as a reduction in the number of symptoms and consequently less missed school/work days. These results suggest that perhaps different components alone or in combination within this spe cialized growth bud may be responsible for its numerous and diverse beneficial effects. Probiotics In recent years, the growing numbers of randomized clinical trials executed using prebiotics and probiotics demonstrate the considerable interest in this fie ld. Several of these pre or probiotics have shown significant physiological benefits against disease state (126) In brief, probiotics have first been described almost 60 years ago by Kollath (127) administered in (128) A recent Cochrane review published in 2011 investigated the effects of probiotics on the prevention of acute upper respiratory tract infections (URTI) (129) The authors included single or mixture of strains of probiotics as well as several dosages and routes of administration. As a primary outcome, the investigators were interested in the number as well as the duration of acute episodes of URTIs. Data from 1 0 trials were included in the review and used in the analysis where the mean age of the participants was of about 40 years. As a summary, it was concluded that in regards to the number

PAGE 42

42 of participants that experienced episodes of URTIs, antibiotics used a nd the rate ratio of episodes of acute URTIs, probiotics may provide more benefit than a placebo. In terms of duration of the episodes of URTI, no advantage was observed with the probiotics. Prebiotics As for prebiotics and the common cold, a study conduc ted in infants by Tschernia et al. (130) examined the effect of oligofructose supplementation on general health. This was a double blind, randomized, controlled study where infants attending day care and aged between four and 24 months were either given 1 .1 g per day of oligofructose in a standard weaning cereal or just the cereal (i.e. no oligofructose) for six months. The consumption of the prebiotic cereal was associated with a decrease in occurrence of fever during diarrhea, decrease in number of days absent from the day care because of diarrhea, as well as a significant decrease in occurrence of fever and antibiotic use during respiratory illness. Another study also conducted in infants, aged 15 to 120 days, who were randomized to either a standard f ormula containing GOS/FOS in a 9 to 1 ratio or to a control standard formula (131) This one year open trial looked at the outcome of the prebiotic mixture in reducing the incidence of intestinal and respiratory infections. The results showed that in the GOS/FOS group, the number of children with more than three episodes of URTI was significantly lower and that significantly fewer infants received more than two antibiotic courses per year. A study conducted in both assisted and independent living adults aged 65 years old or older looked at the effects of an experimental nutritional formula containing FOS on days of symptoms of URTI (132) The results from this randomized, double blind, controlled study demonstrated that the participants receiving the FOS containing formula for a total of 183 days had a significant decrease in the median days of URTIs.

PAGE 43

43 However, the FOS formula given also contained antioxidants (vitamins C, E and carotene), B vitamins, zinc, selenium, other vitamins and minerals, as well as structured triacylglycerol which could have acted synergistically and potentiated the beneficial effects observed. More recently, a study conducted by Hughes and colleagues looked at the effects of the prebiotic GOS on the percentage of days with a co ld or flu in 427 academically stressed undergraduate students (4) The main findings from this randomized, double blind, placebo controlled study were that acute psychological stress, from academic exams, was directly related to gastrointestinal dysfuncti on and days of cold or flu and that supplementation with either 2.5 or 5 g of GOS reduced some symptoms of intestinal discomfort as well as the number of cold days. As for the effect on the average cold symptom intensity score, GOS was more effective at s ignificantly reducing the symptom intensity scores at lower levels of stress. Several studies, such as a study by Puccio et al., have examined the effects of a synbiotic on cold episodes (131) These investigators randomized full term newborns who were no t breastfed after the 14 th day of life to either receive a control formula or a formula containing a mixture of GOS/FOS at a 9 to 1 ratio plus Bifidobacterium longum BL999. The results from this study, although not significantly different, showed a trend in infants receiving the synbiotic formula to have fewer URTIs. There seems to be an increasing number of studies demonstrating positive effects of prebiotics, probiotics and synbiotics on days of URTI and this warrants further investigation. Age and Comm on Cold Since the proportion of aged individuals (60 years of age or older) has tripled in the second half of the 20 th century (133) it is not surprising that there is increased

PAGE 44

44 popular and scientific interest in the aging process and its consequences. A lthough the common cold affects persons of all ages (55) exposure to an infectious agent is a major cause of morbidity and mortality in susceptible populations such as the very young and the very old as well as in individuals undergoing psychological stre ss (4, 69) As stress increases, it has been demonstrated that susceptibility to the common cold also increases in a continuous manner similar to a dose response effect (71) In fact, both T and B lymphocytes, mast cells (134) and neutrophils (135) are increased in the nasal mucosa of patients with colds. Consequently, an appropriate inflammatory response is necessary for the clearance of the infection. When compared to the general population, Americans aged 65 years old or older are twice as likely to visit the doctor and three times more likely to be hospitalized (136) Other than the well described effects of age on the immune system which predisposes the aging population to common cold episodes, living conditions, such as assisted or independent liv ing, may also render them more vulnerable to infections. In the United States, since 37% of aged adults will be admitted to a long term nursing home care facility and since infections occur more frequently in nursing home residents than independent living elders (137) living conditions may increase the risk and occurrence of the common cold. Additionally, aging not only increases the risk illnesses but in aged adults that contract a rhinovirus infection, practically two thirds of them will subsequently d evelop lower respiratory complications such as otitis media, sinus infection, exacerbation of asthma and chronic bronchitis and pneumonia (138) Healthy yet vulnerable populations should be examined when conducting nutritional studies and

PAGE 45

45 examining health outcomes since this population would greatly benefit from such interventions. Immune System Leukocytes Leukocytes, also known as white blood cells, are a group of immune cells circulating in the blood and lymph, populating the lymphoid organs. Leukocytes are composed of neutrophils (50 to 70% of total leukocytes), lymphocytes (20 to 25%) (139) monocytes (1 to 6%), eosinophils (1 to 3%) and basophils (140) Lymphocytes are responsible for adaptive immunity, memory and self/non self recognition which makes them central players of the immune response. Of the peripheral blood lymphocytes, approximately 85 to 90% are either T or B cells, however th e remaining 10 to 15% are referred to as NK cells and are part of the innate immune system. T and B lymphocytes are essential for adaptive immunity because of their highly diverse repertoire of antigen specific cell receptors which can easily recognize so me 10 11 different antigens (141) To distinguish these diverse populations of lymphocytes, specific proteins can be detected and these cellular markers are molecules known as cluster of differentiation (CD). In fact, all lymphocytes exhibit the signal tr ansduction molecule CD45. To further distinguish lymphocyte subpopulations, T lymphocytes express CD3 and all B lymphocytes selectively express CD19. A specific subset of T lymphocytes, T helper cells (Th cells), express an adhesion molecule that binds t o class II major histocompatibility complex ( MHC ) molecules called CD4. Cytotoxic T Lymphocytes (CTL) express CD8 an adhesion molecule that binds to class I MHC molecules. Although CTL secrete very few cytokines, these cells have the capacity to recogniz e and subsequently eliminate altered self cells. On the other hand,

PAGE 46

46 NK cells also express very specific adhesion molecule; CD56 and the low affinity receptor for immunoglobulin (Ig) G, CD16. These different CD markers are important as they can be recogni zed by particular monoclonal antibodies and differentiate different lineage or stages of maturation of lymphocytes (e.g., T lymphocytes that harbor both CD4 and CD8 are still immature and yet to terminally differentiate). The analysis of t he different lym phocyte subsets by flow cytometry can provide useful information exemplified by the fact that triggers such as fasting or refeeding can elicit a redistribution of the leukocyte pool (142) Serum Acute Phase Proteins Acute phase responses are defined as cha nges accompanied by inflammation and involving many organ systems at distant sites from the source of inflammation (143) This concept emerged from the discovery of C reactive protein (CRP), specifically named because of its reaction with the pneumococcal C polysaccharide in the plasma of patients suffering from pneumococcal pneumonia (144) Since circulating concentrations of CRP are changing rapidly, it is a useful tool in differentiating inflammatory from non inflammatory conditions (e.g., response of the host to infection) however; it is of low suitability as a marker of immune function. Other acute phase proteins such as glycoprotein, albumin, pre albumin, fibrinogen, mannose binding protein and complement components are found in the serum or plasma and are also indicators of ongoing clinical infections or other diseases (73) Although these proteins may be useful to un derstand results of functional assays, they cannot be extrapolated to immune function or resistance to infection and more immune parameter must be measured for such inferences.

PAGE 47

47 Peripheral Blood Mononuclear Cell (PBMC) Cytokine Production to Mitogens Clinic al trials have investigated the effectiveness of immune components to act as (145) have been discovered and it is needed. Since cytokines and their production have been recognized to be important in many disease states, cytokine production has been utilized as an assessment of immune function. Specifically, measurement of cytokine productio n following mitogenic stimulation of short term and in vitro cultures of PBMCs is widely used in human clinical trials (146) Following isolation and separation of PBMCs from human blood samples by means of a density gradient centrifugation, T and B lymp hocytes, monocytes, NK cells, basophils, and dendritic cells are then stimulated in culture. This assay partly reveals their functional capabilities as the function of Th cells is typically assessed by the level and production of cytokines. While these a ssays are extremely sensitive in measuring cytokine concentrations, information on the functional activities of the cytokines measured is lacking (146) The choice of mitogen employed to stimulate cells in culture is also as important. De Groote et al. (1 47) showed that lipopolysaccharide (LPS) stimulated PBMCs produce IL 6. LPS has previously been shown to stimulate B cells, monocytes and to a lesser extent dendritic cells (DC). D endritic cells of aged adults have been shown to have a s ignificantly increased response to LPS and double stranded RNA induced secretion of TNF 6 (148) LPS selectively induces many genes encoding for a set of cytokines and chemokines (149) As quickly as 30 minutes following exposure to LPS, cells h ave been shown to synthesize and secrete pro inflammatory cytokines such as IL 6 and TNF (150) On the other hand,

PAGE 48

48 PBMCs stimulated with the mitogen phytohemagglutinin (PHA) produce IL 2, IFN well as GM CSF (147) The response from T lympho cytes to PHA has been demonstrated and Th1 cells exclusively produces IFN 12 and IL 2, whereas Th2 cells secrete IL 4, IL 5, IL 6 and IL 10 (151) When planning experiments, determining the duration of the in vitro stimulation of cells by the differe nt mitogens is equally important. A study executed by McHugh and colleagues looked at the temporal production profile of different cytokines following the activation of PBMCs by various mitogens (151) The investigators stimulated PBMCs by adding 10 L of PHA to the culture media and observed the proportion between the highest (100%) and lowest (0%) amounts recorded for multiple cytokines. Following 48 hours of mitogenic stimulation, the authors observed a maximum production of approximately 25% for I L 2, 100% for IL 5, 50% for IL 6, 95% for IL 10 and 40% for IFN cytokine responses were fast and vigorous and seemed to peak between 24 and 96 hours after stimulation. Similarly, a study conducted by Rittig et al. investigated the cytokine release from human monocytes following 60 minutes of stimulation with brucellae display ing smooth or rough LPS at a multiplicity ratio of infection of 20 to 1, or with LPS from E. coli serotype 055:B5 as a positive control (152) The supernatant was harve sted at different intervals (0, 4, 8, 24 and 48 hours) and it was observed that the concentrations of IL 6, IL 8 and TNF were the highest after 48 hours and were also the highest when stimulated by the strains Brucella melitensis B3B2 (rough LPS phenotype) and Brucella suis VIG4 (rough LPS phenotype). When observing changes in immune parameters, it i s imperative to consider that immune function can easily be influenced by many factors such as age, gender, obesity,

PAGE 49

49 health status, disease, and use of medication (139) Hence, when evaluating age related changes in immunity, selection of participant s and their inherent characteristics is of upmost importance. The SENIEUR protocol (153) is employed by many when developing studies where a link between age and immune function must be made without attributing any effects to underlying diseases. This protoco l, developed by the European Economic Community Concerted Action on Aging (EURAGE), uses rigorous health criteria for selection of participants to exclude any possible pathological changes in the immune system and to only describe changes that are caused b y age (154) A weakness emerging from this study design is that the obtained results may really only apply to exceptional individuals that are unus ually healthy and have survived age related illnesses. Other researchers have decided to conduct clinical t rials with generally healthy aged adults following the assumption that results from these experimental protocols will be more applicable to the general aged population. Results from age related changes in cytokine production by PBMCs in response to PHA st imulation are summarized below (Table 1 1 ). Outcomes from these studies seem to indicate that following strong mitogens stimulation with the use of PHA, IL 2 production seems to be lower in the aged adults in comparison to the younger population. Demonst rated in fewer studies and to a lesser extent, IFN production has also been shown to be lower in aged adults. Although IL 6 has previously been considered to be (155) in t hat greater concentration was associated with increasin g age, recent reports have failed to validate such results and no difference seems to be observed in comparison to younger adults.

PAGE 50

50 Immunosenescence It has been known for quite some time that aged adults are at increased risk of infectious diseases and this is thought to be an age related loss of immune function leading to a reduced numbers of lymphoid cell in peripheral circulation and a decline in function (156) Dysregulated immune functions associated with aging, known as immunosenescence, has been char acterized by a decrease in protective immune responses to infectious agents and anti cancerous immune defenses (157) Additionally, modifications in different aspects of cellular immunity are observed with immunosenescence generated by Claudio Franceschi (158) due to the now recognized low grade systemic inflammation observed with immunosenescence. This pro inflammatory status is thought to be mediated through the NF illustrated in Figure 1 2 (159) A hallmark of immunosenescence is the decrease d numbers of mature CD3 + lymphocytes in peripheral circula tion exemplified primarily with a decline in the CD8+ (cytotoxic T cells) subset whereas the CD4+ subset see ms to be maintained (160) as long as nutritional status remains normal (73) However, some evidence suggests that these changes are not necessarily present in all aged adults. The decrease in cytotoxic T cells is not significant in heal thy elderly partic ipants when C D 2+CD3 immature T cell subsets represent only 10 to 15% of the total peripheral T lymphocyte pool (161) An additional feature of immunosenescence is a decreased pool of nave (CD45RA + ) T cells and a predisposition t oward a T helper 2 (Th2) phenotypic expression (154) This decrease in T cells, reported with age, could be attributable to a decreased size and cellularity of the thymus and a subsequent reduction in the T cell compartment (162) By the age of 60, the tissue that constitutes th e thymus is almost completely replaced

PAGE 51

51 by adipose tissue rendering T cell selection and maturation practically impossible (163) A decline in thyroid hormones is also observed progressively following puberty which could contribute to this physiological ch ange. Not only are there observable changes in cell types but also rodent studies have shown that there is an age related shift from a cell mediated immune response a Th1 like response (e.g., IL 2 and IFN antibody mediated Th2 like (e.g., IL 6 an d IL 10) cytokine response. This change is thought to be due to the lifespan accumulation of antigenic pressure (164) A shift to a Th2 antibody mediated response may explain why healthy elderly participant s seem to have similar antibody responses than y ounger adults following antigenic exposure and why serum titers of immunoglobulins are increased (73) Nevertheless, the impaired response of the Th1 cell subset is surely exemplified by the lower IFN elder participant s explaining the reduced cytotoxic activity of lymphocytes and increased incidence of infections in the older population (165) A geing has been associated with an impaired proliferation of T cells caused either by a dysfunction of T cells themselves or a defective activation of T cells by monocytes (166) Previous studies have demonstrated that during an illness, monocytes of aged indivi duals release more I L 1, IL 6 or TNF and this activation of monocytes is thought to help stimulate the depressed lymphocytes to reach a sufficient level of efficiency (167) Gillis and colleagues demonstrated more than three decades ago that with increasing age, there are alterations in the production of cytokines and their recognition by cells of the immune system. In more detail, the investigators showed a decrease in IL 2 production in aged adults compared to young participants (168)

PAGE 52

52 An o ther important characteristic of the immune system in aged adult s is the change in the NK cell population. As previously mentioned NK cells are major contributors to cell mediated immunity by functioning as immunomodulatory cells through the secretion of IFN (169) Older adults seem to exhibit a deficiency in NK cell activity despite their increase in numbers (170, 171) Mucosal Immunity External surfaces of the body such as the skin and the gastrointestinal, respiratory and genitourinary tracts are i mportant first lines of defense by preventing the invasion of pathogens and their products (172) Despite the fact that the immune system of the mucosal surfaces is thought to be the largest immune component of the body, no viable method exists to sample the immune system in the intestine; only indirect and invasive techniques such as endoscopies and biopsies are available (73) Unlike the systemic immune system, where blood sampling can be done with relative ease and is considered to be non invasive, tec hniques allowing for the examination of the immune system in the GI track are still lacking. A test useful in determining the integrity of the intestinal barrier, the first line of defense, is the use of markers (such as non metabolisable sugars; lactulos e or mannitol) given orally and then later measured in the urine (173) Despite risk, a double blind, placebo controlled intervention study by Bovee Oudenhoven et al. was conducted where 32 healthy men ingested a live but attenuated enterogenic Escherichi a coli strain that was able to induce mild but short lived symptoms (174) While the study was primarily looking at the pr otective effects of a milk product containing a high concentration of calcium (1100 mg/day) versus low calcium concentration (60 mg/day) on the E. coli infection, such an approach could potentially be used to measure the mucosal immune system, more specifi cally the

PAGE 53

53 intestinal barrier. Considering the fact that mucosal surfaces are the main interface between the host and its external environment, protection against potentially harmful bacteria is imperative. For this reason, within the entire immune system the gastrointestinal mucosa is the most abundant production site of IgA antibody (175) This explains why, thus far, the most useful marker of the mucosal immune system is IgA. However, care must be taken when extrapolating these measures of the adapti ve immune system to the rest of the mucosal immune system. reducing the need for a systemic immune resp onse, the gut possesses immunosuppressiv e mechanisms and tolerogenic responses to food, commensal microbiota and self antigens Oral tolerance is an essential adaptive immune function which is defined as the s ystemic non responsiveness to ingested antigens (176) In the event that this immunosuppressive mechanism is disrupted, occ urrence of path ologies such as food allergy, c eliac disease and inflammatory bowel disease are observed (177) The constant interaction of the mucosal immune system of the gut with the commensal microbiota facilitates the establishment and maintenance of tolerance to foreign dietary antigen. Lack of tolerance to the non pathogenic microbiota contributes to the colitis. It has also been shown that tolerogenic antigen present ing cells (APCs), such as dendritic cells, can avoid local hyperactivation of the immune system by carrying dietary and microbial antigens, that have somehow penetrated the epithelial barrier, away from the mucosa (178) Epithelial cells and DC can secret e tolerance signals such as

PAGE 54

54 transforming growth f 10 and retinoic acid leading to the development of regulatory T (Treg) cells and maintenance of immune tolerance (179) The intestinal mucosal immune system is composed of three main compartments; the surface epithelium of the mucosa, the underlying connective tissue (lamina propria) and the secondary lymphoid tissue. The lamina propria is thought to constitute the effector site where activated CD4+ T lymphocytes, activated B cells, macrophages, dendritic cells, eosinophils, mast cells, a nd IgA secreting plasma cells are primarily found. The secondary lym phoid tissue comprises the GALT and the mesenteric lymph node (MLN). As previously mentioned are found predominantly in the small intestine, and the isolated lymphoid follicles, found throughout the intestine as well as the appendix (180) The GALT is the main site where antigens are presented to T and B lymphocytes and is considered to be the inductive site of the GI tract responsible for th e adaptive phase of the intestinal immunity. Salivary and Fecal Secretory IgA (sIgA) In the lamina propria of the GI tract, it has been shown that 90% of the plasma cells (mature B cells) secrete IgA (181) This is equivalent to more than 2.5 x 10 10 IgA s ecreting plasma cells. Most of the IgA in the gut lumen is found in the secretory form and is distinct from IgA present in the serum. IgA is the predominant immunoglobulin secreted at mucosal surfaces (73) and is found in secretions such as breast milk, saliva, tears and mucus. In fact, secretory IgA (sIgA) is composed of polymers of 2 to 4 monomeric units of IgA molecules which are joined by a J chain and attached to a secretory component that protects it from proteolysis. The secretory component of th e sIgA antibody is acquired from the receptor after IgA binds to and is transcytosed

PAGE 55

55 across the mucosal surface. The daily production of secretory IgA is greater than that o f any other immunoglobulin Every day, a hum an can secrete anywhere from 5 to 15 g of secretory IgA into mucous secretions (140) IgA is extremely important as a first line of defense It can immobilize mic roorganisms at mucosal surfaces and since sIgA is polymeric, it can bind to large antigens with multiple epitopes and prevent the ir attachment to the epithelial cells of the mucosa. The intestinal microbiota balance has recently been attributed to the presence of sIgA. This has been demonstrated by experiments from van der Waaj et al. where commensal bacteria were found to be coate d with anti commensal sIgA (182) Following coating by sIgA, the intestinal bacteria adhere to M cells and are subsequently internalized where nave B cells are induced and differentiate into IgA committed plasma cells. A fter neutralization of the bacteria a decrease in pro inflammatory cytokines is observed (183) Secretory IgA is believed to be one of the most useful markers of the mucosal immune system (73) whether it be the respiratory, gastrointestinal or vaginal tr act. For this reason, studies h ave explored its effect on URTI There seems to be some evidence that low levels of salivary sIgA are associated with increased incidence of URTI (184) and periods of chronic physical and psychological stress (73) Inverse ly, lactobacilli which are part of the commensal intestinal microbiota, have been reported to enhance IgA responses in 14 children with (185) The relationship between sIgA present in the mucosal surfaces and the occurrence of URTI still n eed to be studied in more details as this immunoglobulin could potentially be an accessible biomarker of health.

PAGE 56

56 Digestive Health Microbiota There has been a rapid increase towards our understanding that commensal microbes, collectively known as the microb iota, have on the mammalian gut. It is estimated that in 2009, more than five hundred articles related to the intestinal microbiota were published (186) ; double the number of publications released in 2004. It is estimated that there are about 10 14 bacteri al cells in the human GI tract and more than 2000 different species of commensal microorganisms (187) The bacteria residing the GI tract are either facultative anaerobes, aerobes or strict anaerobes, the latter dominating by two to three orders of magnit ude. Several studies have demonstrated that the estimated ratio of anaerobic to facultatively anaerobic bacteria is approximately 300 to 1 (188) In the large intestine, particularly the colon, the microbiota consists primarily of anaerobic, Gram negativ e nonsporing bacteria and Gram positive, spore and nonsporing rods. The human gut microbiota is mainly composed of two phyla; the Bacteroidetes, which comprises Flavobacteria and Sphingobacteria, and the Firmicutes, comprising known butyrate producers of the Clostridia class (189) Inter individual variations in the microbial makeup of the GI tract are quite significant. Although numerous studies were conducted to elucidate the factors responsible for these observed differences, the verdict is still out. Some potential sources of variation are t he mode s of child birth (vaginal or C section) (190) the type of infant feeding ( breastfed versus formula fed ), antibiotic use in the first few years of life (191) g enetics (192) diet/e nvironment (193) and m edi cation usage throughout ones lifespan (194) Significant debate surrounds the question does the environment or

PAGE 57

57 have been conducted to answer this question, with conflict ing results. Zoetendal and colleagues recruited individuals that were either related (monozygotic or dizygotic twins) or not and their microbiota composition was examined using DGGE (denaturing gradient gel electrophoresis) (195) What the authors found was that related individuals (mono or dizygotic twins) had a greater similarity in their microbiota profile than non related individuals as well as marital couples despite the fact that these twins had been living apart for years (the range was anywhere fr om 5 to 15 or more years living apart). In fact, married couples had a greater diversity in their microbiota than twins, suggesting that genetic rather than environmental factors had more of an impact on microbiota composition. The microbiota has also be en thought to be implicated in certain diseases from the more obvious inflammatory bowel disease (IBD) (196) to the unexpected activation of the chronic human immunodeficiency virus (HIV) (197) Gastrointestinal Symptom Rating Scale The Gastrointestinal Sy mptom Rating Scale was developed alongside the Comprehensive Psychopathological Rating Scale (CPRS) to assess gastrointestinal symptoms in patients suffering from irritable bowel syndrome (IBS) (198) This questionnaire was created in order to evaluate ga strointestinal symptoms from the shown that the GSRS contains adequate psychometric characteristics and can also be used on patients with GI disorders or suffering from GI related side effects where GI symptoms are not necessarily the chief complaint (23, 199, 200) The GSRS demonstrates good reliability and validity in different populat ions whether the GI

PAGE 58

58 symptoms are caused by immunosuppressive regimens seen in renal transplant patients (201) or by academic stress as observed in undergraduate university students (4) Additionally, this quality of life questionnaire has been evaluated i n the general population providing researchers with norm values (202) The GSRS is a 15 item questionnaire that is divided into five symptom clusters; reflux (heartburn and acid regurgitation), abdominal pain (abdominal pain, hunger pains, and nausea), in digestion (rumbling, bloating, burping and gas), diarrhea (diarrhea, loose stools, and urgent need for defecation) and constipation (constipation, hard stools, and feeling of incomplete evacuation). This questionnaire uses a 7 point graded Likert type sca le where 1 represents no discomfort and conversely very severe discomfort is graded 7. GOS and the Microbiota Prebiotics have been shown to exert positive effects on the microbiota by selectively promoting the growth of bacteria that are considered benefic ial to the human host (e.g., bifidobacteria and lactobacilli), but also by preventing or inhibiting colonization of potentially pathogenic bacteria (e.g., Clostridium ) (203 205) For the past tw o decades, the effects of prebiotics (e.g., GOS and FOS) on th e colonic microbiota have been investigated and it has been found that these oligosaccharides have the potential to increase the concentrations of bifidobacteria in the colon (206) Multiple studies have examined the effect of GOS on the microbiota and, f or the most part, a bifidogenic effect of GOS seems to be observed. A Japanese cross over study, mentioned previously, was conducted in 12 healthy male volunteers who were randomized to receive 0.0, 2.5, 5.0 and 10.0 g of GOS (18) The results from this study showed a linear relationship between the amount of GOS ingested and the number of bifidobacteria per gram of feces. Additionally, this daily amount of prebiotic

PAGE 59

59 did not have a statistically significant effect on abdominal pain. A study by Bouhnik a nd colleagues demonstrated that healthy participant s given 10 g of trans galactooligosaccharides for 21 days had a significant increase of bifidobacteria in their feces. Similarly to the Japanese study, the participants reported that they did not experien ce any gastrointestinal discomfort following the ingestion of 10 g of TOS (21) A more recent study by the same investigators looked at different non digestible carbohydrates and their effect on fecal bifidobacteria (206) The findings from this double b lind, randomized, placebo controlled study suggest that GOS, given at a dose of 10 g per day for 7 days, significantly increased bifidobacteria concentration in the feces and that this bifidogenic effect conferred by GOS was stronger than that of FOS and a debranched retrograded tapioca maltodextri n (type III resistant starch). Vulevic and colleagues examined the effect of a trans galactooligosaccharide mixture on the fecal microbiota profile, however, the study was executed in free living aged adults that were 64 to 79 years old (5) In this protocol, participants were randomized to receive a placebo or 5.5 g of B GOS for ten weeks, followed by a four week washout period and finally the participant s were crossed over to receive the other treatment for an additional ten weeks. The results suggest that the consumption of B GOS significantly increased fecal bifidobacteria when compared to baseline levels as well as placebo supplementation levels. Aged Adults and the Microbiota Aging causes many physical chan ges in the GI tract and this is exemplified by the reduction in physiological processes (207) Reduction in gastric acid production, gastric emptying rate, gut motility, gut blood flow, absorption surface as well as decreased uptake and transport across e pithelial cells have been observed in the GI tract of aged

PAGE 60

60 adults. Additionally, a loss in adaptability following challenges such as changes in the diet or nutritional stress is seen in the older population. Other important changes observed with aging ar e a marked decline in the bifidobacteria population within the intestinal microbiota (208) as well as a change in species diversity (209) A study by Hopkins and colleagues suggests that the levels of bifidobacteria and lactobacilli appear to be lower in elderly participants when compared to younger adults whereas the levels of enterococci, enterobacteria and clostridia appears to be similar in both groups of participants (210) A later study showed slightly different results where, when compared to young er adults, the elder population exhibited higher levels of Rhuminococcus and lower levels of E ubacterium and B acteriodetes (211) With advancing age, variation in ones microbiota seems to be observed; however, there does not appear to be a definitive comp ositional change as factors such as geographic region, medication and genetics, as previously defined, can also influence the microbiota. (194) With age comes an increased incidence of diseases which in turn will cause a greater medication use negatively impacting the microbiota. According to a report published by the Center for Disease Control and prevention (CDC), in 2008, 76% of older Americans (60 years of age or older) used two or more prescription drugs and 37% used five or more (212) Prescription drugs are known to have varied effects on the digestive tract and consequently the microbiota. It has been established that many drugs cause, as an undesirable side effect, dry mouth or xerostomia (213) This dampened ability to produce sufficient saliv a and therefore a reduction in salivary flow rate impacts the antimicrobial oral defenses by decreasing lysozymes, amylases, myeloperoxidase, IgA, IgG, and IgM in the oral cavity (214) and may consequently have

PAGE 61

61 adverse effects on the gut mucosa. In the el derly population, commonly prescribed drugs are proton pump inhibitors recommended to treat ulcers. Lowering the gastric pH, the main mechanism of action of proton pump inhibitors, may promote colonization of the gastrointestinal tract by pathogenic bacte ria who would not have been able to survive otherwise, under normal conditions (215) It is also important to mention that with increased age, there is a reduction in the total SCFA (butyrate, propionate, and acetate) production especially in antibiotic t reated older adults (216) With advancing age, changes in the microbiota, modifications in the total numbers of bacteria, and differences in species diversity of certain genera of bacteria all lead to changes in microbial activity and their end products ( 194) As previously mentioned, SCFA produced by certain bacteria exert many beneficial effects on the large intestine and changes in these fermentation products could be detrimental to the GI tract of aged adults. These organic acids serve as the preferre d energy source of colonic epithelial cells, increase blood flow to the colon mucosa (217) and increase colonic motility (218) A rodent study by Suzuki et al. using isolated caecal mucosa, anaesthetized rats, and cultured Caco 2 cells demonstrated that S CFA, particularly acetate, enhance mucosal barrier function (219) The barrier function of the GI tract is crucial in maintaining a beneficial relationship between the host and the microbiota. This especially hold true in the colon where approximately 1. 5 kg of microbes reside (194) The mucus in the colon and the tight junctions between the colonic epithelial cells are the primary physical barriers of the intestines. This barrier function is essential to prevent the bacteria themselves and their toxic compounds from translocating through the epithelial layer and potentially causing septic shock, systemic inflammatory response syndrome and

PAGE 62

62 ultimately organ failure (220) A plausible mechanism where, with increasing age, an altered microbiota could lead to intestinal permeability and could explain the chronic inflammatory status seen in aged adults is shown in Figure 1 2. One of the most studied interactions between the innate immune system and the infectious non self is the interface between the pathoge n associated molecular patterns (PAMPs), which are conserved microbial components, and the host pattern recognition receptors (PRRs), expressed on cells of the innate immune system. Toll like receptors (TLRs), a class of PRR, are expressed on dendritic ce lls, macrophages, neutrophils, mast cells and epithelial cells. Toll like receptor 4 specifically recognizes the LPS component of Gram negative bacteria (157) Once LPS binds to TLR 4 on an epithelial cell of the GI tract, the transcription factor NF activation of pro inflammatory genes. This continual interaction between LPS and TLR 4 results in the production of inflammatory cytokines by activated genes and could be r esponsible for the chronic low grade inflammation observed in the older population (176)

PAGE 63

63 Figure 1 1 General s tructure of a (1 4) linked galactooligosaccharide molecule where [Galactose]n Glucose. Figure provided with permission by Christina M. V itale. Figure 1 2 Effects of aging on the microbiota and the subsequent inflammatory response (157)

PAGE 64

64 Table 1 1. Age related changes in production of cytokines following stimulation of isolated peripheral blood mononuclear c ells (PBMCs) with mitogens Cytokine Function Results (aged versus young adult) Mitogen used and time of stimulation for reported results Participant n umber (age range or meanSEM) Health status of the aged adults; Healthy or SENIEUR IL 2 Secreted exclusively by T lymphocytes (CD4+ are the main producers) (188) Function: Activation/ Proliferation of T lymphocytes (146) Lower production in the aged adults (221) PHA Cells stimulated for 48 hours aged adults; 16 (79.67.5) young adults; 16 (24.63.1) SENIEUR IFN Secreted mainly by T lymphocytes and NK cells Lower production in the aged adults (221) PHA Cells stimulated for 48 hours aged adults; 16 (79.67.5) young adults; 16 (24.63.1) SENIEUR Lower production in the aged adults (222) PHA Cells stimulated for 48 hours aged adults; 15 (66 84) young adults; 12 (21 40) Healthy IL 6 Secreted by T lymphocytes, macrop hages, monocytes. Induces T cells activation and differentiation No difference in production between the aged and young adults (223) PHA and Fetal Bovine Serum (FBS) or P HA and Autologous plasma (AP) Cells stimulated for 48 hours aged adults; 26 (65 85) young adults; 21 (18 35) SENIEUR No difference in production between the aged and young adults (224) PHA Cells stimulated for 48 hours aged adults 5 (66 87) young adults 9 (20 54) Healthy

PAGE 65

65 Table 1 1. Continued Cytokine Function Results (aged versus young adult) Mitogen used and time of stimulation for reported results Participant n umber (age range or meanSEM) Health status of the aged adults; Healthy or SENIEUR IL 6 Ind uces B cell differentiation and mucosal IgA responses No difference at 24 hours but higher production in the aged adults at 48 and 72 hours compared to the young (225) PHA aged adults 13 (80.82.1) young adults 13 (26.80.8) SENIEUR IL 10 Produced by T an d B lymphocytes, monocytes and macrophages. Inhibits macrophages activity (188) No difference in production between the aged and young adults (226) No stimulation Results taken after 24 hours aged adults 12 (75 102) young adults 12 (19 34) SENIEUR

PAGE 66

66 CH APTER 3 METHODS Participants Participants were healthy older adults aged 60 years or older living independently and who had suffered at least one cold in the previous year. Participants were recruited via listservs, flyers, posters, postcards and newspape r advertisements at the end of the summer of 2010. Potential participant s were excluded if they i) had chronic allergies involving the upper respiratory tract, milk allergy or immunosuppressive illnesses or treatments in the previous year; ii) were curren t smokers; iii) had rec eived antibiotic therapy two months prior to the start of the study; iv) were unwilling to discontinue any fiber or potentially immune enhancing dietary supplements (e.g., prebiotics, probiotics, e first day of the study anti inflammatory drugs or medication for constipation or diarrhea on a regular basis; vi i i) were receiving suppl ement al oxygen; vix ) were not eligible or unwilling to receive the fall influenza vaccination for the year 2010 2011 as p art of the study protocol or x ) were unable to take foods or the study fiber without the aid of another person. Additionally, potential par ticipants had to be willing to i) complete daily and monthly questionnaires; ii) receive the fall influenza vaccination; iii) provide three blood and saliva and two stool samples; iv) answer a food frequency questionnaire towards the end of the study; v) t ake the study fiber twice daily for 24 weeks; and vi) provide a social security number to receive study payment (it is important to note that if the participant s were unwilling to provide their social security number, they could still participate in the st udy, however no financial reimbursement would be provided). Each participant gave

PAGE 67

67 written informed consent and all study procedures were in accordance with the ethical standards of the University of Florida Institutional Review Board. Experimental Design Participants (n=84) were randomly assigned to a supplement group before the cold and flu season at the beginning of October of 2011. Participants took part in the study for a total of 24 weeks during which they were monitored. This study was a prospectiv e, randomized, parallel, double blind, placebo controlled trial (Figure 3 1). The participants were proportionally stratified based on BMI ( randomized via sealed envelopes to receive either 0 g or 5 g of GOS (Purimune TM GTC Nutrition, Golden, CO) each day The stratification and randomization schemes were generated by the study statistician who did not have direct contac t with any of the participant s. The following is a list of study activities that were required in order to take part of the study. The week prior to the study start height and weight were measured for each of the participants; additionally a baseline sto ol sample was collected. On the first day of the study, anthropometric measurements were taken such as height, weight, and arm and calf circumference s Nutritional status was assessed and a short questionnaire about GI symptoms and level of activity was administered. On that same day, blood was drawn and saliva was collected. Every day of the study participants were required to fill out a questionnaire about GOS intake, stress level bowel habits and cold symptoms and participants were asked to consume the study supplement twice daily (Appendix C) Between weeks two and three of supplementation, participants were asked to provide a final stool sample. After three weeks of supplementation, blood was drawn and saliva was collected for a second time, and participants were given the

PAGE 68

68 influenza vaccine. Each month, participants were asked to complete the questionnaire about GI symptoms (GSRS) and level of activity questionnaire. Following five weeks of supplementation, or two weeks post vaccination, blood was drawn and saliva was collected for a third time. On the last day of the study, 24 weeks post supplementation, nutritional status was assessed using the MNA Questionnaires on typical food intake, GI symptoms and level of physical activity as well as a final questionnaire about which treatment group the participants thought that they were on were administered. Throughout the study, participants were contacted by study coordinators, via telephone calls, for follow up in order to encourage compliance an d sustain interest in the study. Additionally, study coordinators met with participants a few times during the study to provide them with additional study supplement s GOS Administration Protocol The GOS supplements were provided in coded packets that wer e similar, both in size and shape, to commercially available single were similar in the way they looked and weighed. Silicon dioxide wa s added to all packets as a flow agent to improve the emptying of package contents. The supplement contained 86% GOS with 21% Degree of Polymerization (DP) 2 and 65% DP3 and above. Participants were instructed to pour the content of the packages into bev erages, preferentially into hot beverages such as coffee or tea or into soft foods such as yogurt or pudding and to consume the supplement in its entirety twice daily, every day, for the entire 24 week study for a total intake of either 0 g or 5 g of GOS p er day. Both the GOS and the placebo had a slight sweet taste to decrease the probability of participants being able to distinguish the GOS packets from the placebo packets.

PAGE 69

69 Influenza Vaccination As part of the study protocol, participants received the 20 10 2011 influenza flu vaccine. Vaccination was done during the second blood draw appointment which took place between Monday November 1 st 2010 and Thursday November 4 th 2010. The influenza vaccination was administered by a licensed nurse. The pre filled syringes of vaccine were purchased from the Student Health Care Center of the University of Florida and came from the same lot 111691 4P with an expiration date of 04/2011. The name of the vaccine was Fluvirin manufactured by Novartis. Each dose of thi s vaccine (0.5 mL) is made from three influenza virus types; A/California/7/2009, NYMC X 181 (H1N1) like virus; A/Perth/16/2009 (H3N2) like virus; and B/Brisbane/60/2008 like virus. This vaccine is intended for intramuscular use only. Fluvirin is prepared from the extraembryonic fluid of embryonated chicken egg inoculated with a specific type of influenza virus suspension which also contains neomycin and polymyxin. Study Questionnaires On the day of randomization (first day of t he study) participants met with the investigators and had their height and weight measured, gave blood and saliva samples, answered an MNA questionnaire, were instructed on the study procedures and obtained the supplement packets. Additionally, each parti cipant was given a with brass fasteners. The folder also contained a monthly GSRS questionnaire. Participants were instructed on how to complete the questionnaires and when study coordinators met the participants three weeks later (for their second blood draw) they

PAGE 70

70 ensured that questionnaires were filled out correctly. Questions regarding participant characteristics were contained in a short questionnaire at baseli ne. Daily questionnaires asked about consumption of the supplement to the nearest quarter packet, level of stress on a scale from 0 (no stress) to 10 (extremely stressed), number of bowel movements, antibiotic use and any cold and flu symptoms (Appendix C ). If the participants were experiencing cold and flu symptoms they were asked to rate the symptom intensity (no symptom, mild symptoms, moderate symptoms, severe symptoms) for nasal symptom (running nose, stuffed nose, blowing the nose, yellow secretion, bloody secretion), pharyngeal symptoms (scratchy throat, sore throat, hoarseness), bronchial symptoms (couch, secretion, yellow secretion), headache, achiness (muscle pain), conjunctivitis (reddish eyes), fatigue, ear discomfort and stiffness/chills. The cold/flu symptom intensity (SI) score was calculated by attributing a score of 0 for no symptom, 1 for mild symptoms, 2 for moderate symptoms and 3 for severe symptoms and summing the individual symptoms intensities (107) The conjunctivitis symptom was not included in the total SI score. The daily questionnaire F was required), use of prescription or non prescription medication questions related to cold or flu symptoms such as problems with work, bathing/washing, getting dressed in the morning, visiting or socializing with friends, shopping or running errands, t aking a vacation and finally if the participant thought they had the cold or the flu. These questions were administered as a generic health status instrument for assessing quality of life and were adapted from the Nottingham Health Profile (227)

PAGE 71

71 The bas eline and monthly questionnaires asked about gastrointestinal symptoms and used the GSRS (23) The final questionnaire administered on the last day of the study asked participants to guess if 5.0 g of GOS or the placebo was in their daily packets and the reason behind their response. Mini Nutritional Assessment Nutritional status was assessed using the long form of the MNA questionnaire ( Nestl Nutrition Institute ), which is the most widely used and best validated nutritional assessment tool for aged adult s. It was developed by Vellas and Guigoz in 1989 (228) Study coordinators assigned to administer the MNA were trained using the information ensured consistency in the adm inistration of the questionnaire. The study coordinators further interpreted ambiguous questions. For example, Question A asks about a decrease in food intake caused by a loss of appetite, digestive problems, chewing, or swallowing difficulties. The answe r options are severe, moderate, and no loss of appetite, and lead to a score of 0, 1, or 2, respectively. This question investigates decreased food intake, while all the answer options involve loss of appetite. Since a participant may have a decrease in a ppetite without having a decrease in food intake, or intake, rather than a change i n appetite, will have a more direct impact on an months. Additionally, study coordinators recorded whether the loss of weight was intentional, from dieting for e xample. Question C, which inquires about mobility, Question G, independent living, and Question N, mode of feeding, were not asked

PAGE 72

72 during the administration of the MNA. In fact, the inclusion/exclusion criteria of our study called for participants to be m obile, live independently, not in assisted living facilities such as a nursing home or hospital, and feed themselves without the help of another person. For this reason, all of the participants were automatically given the maximum score for these three qu estions. Question D relates to psychological stress and asks about neuropsychol ogical problems and study coordinator formulated the question: your depression to be mil the use of a weighing scale (SECA Scale model 7701321134) and stadiometer (SECA model 213). The BMI used for the MNA was the baseline measurement. Question H asks about the number of prescriptio n drugs taken on a daily basis. The researchers included anything found over the counter which was prescribed by their physician, such as aspirin or calcium supplements, as a prescription drug. Question I asks about bed sores or pressure ulcers. Questio n J inquires about the number of full meals the participant eats in general each day. Since this question is ambiguous in regards to three items of a different food group in one sitting. Question K asks about the daily consumption of dairy products, servings of beans or eggs per week and whether or not the participant consumes meat, fish or poultry every day. Regarding what a serving of dairy constitutes in this par ticular question, study coordinators gave examples such as

PAGE 73

73 one cup of milk, three cheese cubes or half a cup of low fat cottage cheese. When talking about bean or egg servings, the examples of one serving of legumes was cup cooked lentils or beans, cu p of raw/regular tofu, cup peanut or 1 cup plain soy milk. Question L asks about how many servings of fruits and vegetables are consumed each day and examples of one serving given by the study coordinators were one piece of fruit, one medium cup of frui t or vegetable juice, or one cup of raw/cooked vegetables. Question M asks about how much fluid is consumed daily and the study coordinators asked the question mentioning to participants that fluids can include water, coffee, juice, soda, tea and milk and that a cup is eight ounces. Rather than asking participants to choose from the list of possible answers, study coordinators asked participants to answer how many cups of fluid they drank every day and coordinators selected the multiple choice answer acco participant to self report his/her nutritional status, more specifically if they would describe it as being pretty good or not so good. Question P asks about the self view of th in comparison to people his/her age. Questions Q and R, which account for mid arm circumference and calf circumference, were measured according measure calibrated for t ightness. Food Frequency Questionnaire (FFQ) This self administered questionnaire was developed to estimate usual and customary intake of a wide array of nutrients and food groups. It contains approximately 110 food items and takes 30 to 40 minutes to com plete. The food list was developed from NHANES 1999 2002 dietary recall data and the nutrient database was developed using the USDA Food and Nutrient Database for Dietary Studies

PAGE 74

74 (FNDDS) version 1.0. Individual portion size was inquired for each food and pictures were provided as a visual help and to increase the quantification exactness. The FFQ was administered at the end of the 24 week study to reflect the dietary habits of the participants throughout the study. This was to ensure that no dietary dis crepancies were observed between the two treatment groups (placebo and GOS) which could account for observed differences. Reagents RPMI 1640 complete with L glutamine and without phenol red was used as cell culture media (Mediatech, Manassas, VA). HEPES b uffer at 25mM (Mediatech, Manassas, VA), penicillin at 100U/mL and streptomycin at 100 g/mL (Sigma Aldrich St. Louis, MO) were added to the RPMI 1640 complete. Sodium Chloride s olution (0.9%, 0.2% and 1.6%). Using the Mettler Toledo AB104 analytical bal ance (Sigma #Z311774) NaCl was weighed and added to a 4000 mL graduated cylinder (Thermo Scientific Nalgene, T.C./T.D. 25 C, Cat# S 06135 90) along with ultrapure H 2 O of Type I to provide the appropriate concentration The NaCl was dissolved using a stir plate and a stirring rod. Under a laminar flow hood, the solution was transferred into three different 1 L Vacuum Filter System s (0.22 Corning # 430517) and the solution was drawn into the collection bottle using a vacuum system. The filter funnel was then removed and the bottle was sealed with the sterile screw cap. The lid was sealed with Parafilm M and the solution was removed from the Laminar Flow Hood. The solution was stored at room temperature. Blood Sample Collection Blood samples were collected at baseline (on the randomization day), during the vaccination appointment (3 weeks post supplementation) and 2 week s post vaccination

PAGE 75

75 (5 weeks post supplementation). The evening prior to blood sample collection, participants were contacted by telephone to remind them of the appointment as well as to restrain from eating after going to bed and on the morning of the blo od draw as they needed to be fasted. Emphasis was made for them to stay hydrated and drink plenty of water. The following morning, between 6 a.m. and 10:30 a. m. the participants met with the study coordinators at the study site where blood samples were c ollected by a trained phlebotomist. Blood was drawn via a venipuncture and was collected into a serum separator (5 mL), L heparin (10 mL), and two 6 mL purple top tubes (BD Vacutainer K2 EDTA 10.8 mg). The two purple top EDTA tubes were then shipped to t he Department of Food Science & Human Nutrition at Michigan State University where subsequent quantification of lymphocyte phenotypes was done. Serum Collection The serum tubes were centrifuged for 20 minutes at room temperature (RT) in a Jouan CR312 centr ifuge at 800 x g (2,000 rpm) to collect the serum. Serum (400 l) was added to tubes containing 1.6 mL of RPMI 1640 (Cellgor; Mediatech, Herndon, VA) complete medium (100,000U/L penicillin; 100mg/L streptomycin; 2mM/L L glutamine; 25mM/L HEPES buffer) to prepare culture medium with 10% autologous serum for each participant. Serum was also aliquoted for use during in vitro assays or stored at 70C until assayed for C reactive protein (CRP, ALPCO Immunoassays, Cat# 30 9710S) and endotoxin assay (Pyrogene TM Recombinant Factor C Lonza endotoxin Detection Assay 50 658U). Phenotypic Determination of Lymphocyte Population In order to assess percent and absolute numbers of lymphocytes per microliter of blood, the TBNK Reagent and True Count tubes (BD Bioscience s cat no. 337166) were

PAGE 76

76 used. The Human TBNK Reagent kit provides a pre mixed antibody cocktail with the antibodies (BD Biosciences cat no. 335775); anti CD3 (clone SK7) FITC, anti CD19 (clone SJ25C1) APC, anti CD16 (clone 73.1) PE, anti 56 (clone NCAM16.2 ) PE, anti CD4 (clone SK3) PE Cy7, anti CD8 (clone SK1) APC Cy7, and anti CD45 (clone 2D1) PerCp Cy5.5. Samples were r un through a f low cytometer (FACS Canto flow) to quantify subpopulations of CD45+ cells and the clinical software FACS Canto was used for analysis. The software automatically creates gates for the lymphocyte populations, however these were the gates used; lymphocytes; low FSC/SSC + CD45+, TruCount Beads; CD19 APC bright, T cells; CD3+/CD45+, T helper cells; CD45+/CD3+/CD4+, Cytotoxic T cel ls; CD45+/CD3+/CD8+, B cells; CD45+/CD3 /CD19+/CD16 CD56 and NK cells; CD45+/CD3 /CD19 /CD16+CD56+. In brief, one TruCount tube was labeled for each sample. Twenty of TBNK reagent were pipetted into the bottom of each TruCount tube, care was taken not to pipette any of the reagent on the side of the tube. To these tubes, 50 L of well mixed anticoagulated whole blood from the 6 mL purple top tubes (BD Vacutainer K 2 EDTA 10.8 mg) were added to t he bottom of the TruCount tubes The tubes were then capped and vortexed gently. A dark incubation step followed where the tubes were left at room temperature. All subsequent procedures were executed in the dark. Followin g the fifteen minutes incubation, of the FACS Lysing solution (BD Biosciences cat no. 349202) was added to the tubes. The tubes were capped and vortexed gently. The tubes were then incubated at room temperature for an additional 15 minutes. Then the samples were run on the BD FAC S Canto II Flow cytometer using the clinical software. The gates were checked for

PAGE 77

77 accuracy and adjusted if needed and the results were exported into an Excel Spreadsheet. CRP Assay Stored serum samples were assayed for C reactive protein using a commercia lly available kit (CRP, ALPCO Immunoassays, Cat# 30 9710S). Samples were diluted at a 1:100 using sample buffer (ALPCO Sample buffer, Cat# K 9710sPV). Data were reported in mg/L. PBMC Isolation Peripheral Blood Mononuclear cells (PBMC) were isolated from the blood in the heparinized tubes using a polysaccharide gradient under a laminar flow hood. Among the PBMCs obtained through this procedure, T cells are the most abundant representers consisting 70% of the PBMCs (70%) (229) The blood was diluted 1:2 with 0.9% filtered NaCl and layered over Lympholyte H ( 1.0770 0.0001 g/cm 3 Cedarlane Labs Ontario, Canada, Product # CL5020) Cell Separation Media. The gradient tubes were centrifuged (Jouan CR312) at 800 x g (2,000 rpm) without a brake at RT for 20 minutes. The PBMC band was removed from the gradient tube into a corresponding pre labeled 50 mL conical tube that contained 20 mL of sterile RPMI Wash solution and centrifuged in the Jouan CR312 centrifuge at RT for 10 minutes at 1,25 0 x g (2,500 rpm). Red blood cells (RBC) within each pellet were lysed with the addition of 10 mL of 0.2% NaCl to each tube. After 30 seconds of brief gentle mixing, 10 mL of 1.6% NaCl was added to each tube followed by a gentle vortex. The tubes were ce ntrifuged (Jouan CR312) centrifuged for 10 minutes at 1,250 x g (2,500 rpm). The supernatant

PAGE 78

78 was poured off and the cells were resuspended in RPMI wash (20 mL) and recentrifuged (Jouan CR312) for 10 minutes at 1,250 x g (2,500 rpm). Following the second wash, the medium was poured off and the pellets were resuspended in 1 mL of the RPMI 1640 complete Media (without phenol red), and the tubes were vortexed. The PBMCs were counted at a 1:20 dilution with trypan blue on a hemocytometer. A preformatted Excel Spreadsheet was used for calculations. The equation used to calculate concentration was = Average of all 4 corners x Dilution x 10 4 = cells/mL. Once the initial dilution of 2.0 x 10 6 cells/mL with 20% autologous serum was obtained using data from the sp readsheet, 7.25 x 10 6 cells were transferred into a total volume of 2.9 mL of RPMI 1640 complete (without phenol red) and 0.725 mL of autologous serum. After a 1:1 dilution of cells with RPMI, or diluted mitogen, the final concentration was of 1.0 x 10 6 c ells/mL in 10% autologous serum. PBMC Stimulation with Mitogens (PHA and LPS) A ssay The PBMCs were plated at 1.0 x 10 6 cells/mL in RPMI 1640 complete media with 10% autologous serum, stimulated with LPS ( Sigma # L3012, 2 0 mg/L ) or PHA L isolectin (MP Biome dicals # 08780361, 10 mg/L). The plates were incubated for 48 hours at 37 C in a humidified atmosphere of 95% humidity and 5% CO 2 After incubation, cells and supernatant fluid were centrifuged (500 x g, 10 min, RT ) and the supernatant fluids were removed and frozen at 70 C until cytokine production was quantified Multiplex Bead Based Assay Different technologies exist to measure cytokines in biological samples. Technologies such as ELISA (Enzyme Linked ImmunoSorbent Assay), ELISPOT

PAGE 79

79 (Enzyme Linked Immun oSorbent SPOT), multiplex cytokine bead arrays (CBAs; Luminex or other), intracellular cytokine staining (ICS) by flow cytometry and gene expression platforms (230) Luminex allows for the rapid analysis of multiple analytes in small volumes of specimen. In vitro cytokine production in response to mitogens was quantified using a Human Cytokine Multiplex Immunoassay kit, according to the Rad, Group I). More specifically, interleukin ( IL) 2, IL 5, IL 10, IL 17A and i nterferon stimulated cultures. Tumor necrosis (TNF) 6, IL 8 and IL 10 were measured in LPS stimulated cultures. The samples were analyzed using a Luminex 200 instrument (Austin, Texas) with xPONENT 3.1 s oftware. Saliva Collection Unstimulated s aliva collections were done on three separate occasions, concurring with the three different blood sample collections, between 6:00 a.m. and 10:30 a.m. S aliva collections were done at weeks 0, 3 (at vaccination) an d 5 (2 weeks post vaccination) of supplementation. Before saliva collection, participant s were asked to fast for 12 hours, this is supported by other studies that recommend that unstimulated saliva collections should be made at rest in the fasted state an d at specific times during the day to limit circadian rhythm variations (231) Participant s were given a timer with a setting of ten minutes and asked to place these timers around their necks. They were then prompted to rinse out their mouth with water f or at least ten seconds and then spit the water out After rinsing their mouth s the timer set for ten minutes was started. When ten minutes had elapsed, the timer was set for two minutes while the participant used half of a straw to passively pass their saliva into a 15 mL conical tube which was pre labeled with the participant

PAGE 80

80 were pl ace in a cooler containing two ice packs and brought back to the laboratory for processing shortly after. The 1 5 mL conical tubes were then centrifuged in a Jouan CR312 centrifuge at 1,250 x g (3,500 rpm) for ten minutes and total volume of each sample was measured and recorded to the closest tenth of a microliter The sup ernatant was divided into two equal portio ns and transferred using a 5 mL serological pipette into 1.5 mL amber microcentrifuge tubes. At this time, notes about Finally, the samples were stored at 70C until assayed. Salivary sIgA Assay Saliva samples were thawed, vortexed, and c entrifuged following storage. Secretory i mmunoglobulin A (sIgA) was measured in saliva samples via ELISA using a commercially available kit (ALPCO Immunoassays, Cat# 30 8870). Samples were di luted at a 1:4000 dilution using wash buffer (ALPCO ELISA Wash Buffer, Cat# K 8870WP). Data were reported in g/min. Previous studies have demonstrated that salivary sIgA could be measured using the ELISA method and this method yielded coefficient of var iations (CV) of 5 to 10% (73) Fecal Collection Fecal samples were collected from participants during pre baseline (1 week before the start of the study) and between weeks 2 and 3 of the study, post supplementation Participant s were instructed to drop of f stool sample in a cooler between 7 a m and 6 p m Monday through Friday in accordance with the protocol and the instructions given during the consenting appointments when the stool colle ction kits were also provided. It is important to note that althou gh participants were given the option of dropping off their samples throughout the day, most of the participants brought their samples with them at

PAGE 81

81 their first and second blood draw appointments. Once collected, stool samples were mixed, divided into aliq uots and frozen at 70C within 6 h ou r s of defecation. Fecal sIgA Assay Prior to analysis, all fecal samples were freeze dried and then weighed for a moisture content value. Secretory immunoglobulin A (sIgA) was measured in freeze dried fecal samples via Enzyme Linked Immuno Sorbent Assay (ELISA) using a commercially available kit (ALPCO Immunoassays, Cat# 30 8870). Results for sIgA concentration were given in micrograms per milliliter (g/mL). Microbiota Analysis Once fecal samples were collected, they w ere processed and analyzed at the Quantitative PCR (qPCR) analysis was used to determine the bifidobacteria genome equivalents (GE) in fecal samples. Briefly, the qPCR reactions were first carri ed out with an initial melting step at 95 C for 10 minutes followed by 40 cycles of 95 C for 30 seconds, 58 C for 60 seconds (for bifidobacteria, 56 C for the V3 universal primer set) and finally 72 C for 1 minute. The primer sequences used for bifidobact GATTCTGGCTCAGGATGAACG CGGGTGCTICCCCACTTTCATG and for the V3 universal primer CCTACGGGAGGCAGCAG and V3 ATTACCGCGGCTGCTGG primer detects all bacte rial genome equivalents and so it was used to determine the proportion of bifidobacteria genome equivalents compared with all bacterial genome equivalents. For the purpose of this study, the response to GOS supplementation was determined by results from t he bifidobacteria genome equivalents. Participants that

PAGE 82

82 of the bifidobacteria genome equivalents in the final stool sample when compared to the baseline stool sample. Par not have a 2 bifidobacteria genome equivalents in the final versus the baseline stool sample. Statistical Analysis Compliance was determined by summing the daily reported proportion of the supplement packets consumed and dividing this number by the number of days that each participant participated in the study (most of the participants were involved in the study for 168 days). On th e daily questionnaire, when the question about supplement intake was left unanswered, an intake of 0 packet was assumed. A lag time between the start of the supplement and its effect on study outcomes was expected and for this reason, data that was collec ted during the first week of the study was not included when evaluating self reported cold and flu symptoms. Hence data for only 161 days were used in the statistical analyses. Additionally, the data collected on the first day of the study (week 0) was u sed to control for variations in individual responses for the monthly GSRS questionnaires. When analyzing the self reported cold data, it was decided that a day of cold quest assessment question blank but answered questions about cold symptoms, an SI score above six, representing at least three different symptoms of which two symptoms would have to be reported with severe intensity (SI of 3) was considered a self reported day of cold. The conjunctivitis cold

PAGE 83

83 symptom was not included in the SI score. The probability of self reporting a cold was determined using a fixed effect model with treatment group and age group as main effects and the treatment group by age group interaction Concentration of IFN following PHA stimulation of PBMCs was determined using a mixed model with the following main e ffects in the main model; draw (baseline, at vaccination and 2 weeks post vaccination), treatment group, age group, responder fold change in fecal bifidobacteria genome equivalents), gender and MNA (as a continuous variable) with two and three wa y interactions and the random effect of participants to account for repeated observations on the same participants. Non significant interactions were removed hierarchically until the final model was obtained. If necessary, d ata were transformed by taking the square root or natural log to co rrect for a skewed distribution. Back transformed least squares means and approximate SEMs for the back transformed least squares means were used and obtained by averaging over all of the other effects and reporting at the average Mini Nutritional Assessment (MNA) for the 81 participants of 27. Percentage of lymphocytes that were positively identified as NK cells was obtained by averaging over the gender and draw (baseline, at vaccination and 2 weeks post vaccination). Data were analyzed using a mixed model with the following main effects in the main model ; draw (baseline, at vaccination and 2 weeks post vaccination), treatment group age group, responder fold change in fecal bifidobacteria genome equivalents), gender and MNA (as a continuous variable) with two and three way interactions and the random effect of participant s to account for repeated

PAGE 84

84 observations on the same participant s. Non signi ficant interactions were removed hierarchically until the final model was obtained. Data represent the LSmean SEM Five main categories (diarrhea syndrome, constipation syndrome, abdominal pain, indigestion syndrome, and reflux syndrome) comprising of fift een gastrointestinal symptoms were measured on a monthly basis. Each of the fifteen symptoms were rated from 1 to 7 where 1 = no discomfort and 7 = severe discomfort. Scores within each category were summed and the gastrointestinal symptoms were adjusted for GSRS questionnaire which was on the day of randomization (day 1 of the study). A generalized linear mixed model was used. c and compliance, the d ifferences between the two treatment groups were calculated using the non parametric Mann Whitney Rank Sum test since the data was not normally distributed Categorical data were compared using the chi square statist ics and d ata are reported as meanSEM Cold symptom data were analyzed using a two way analysis of variance The a verage score for each treatment group was obtained by averaging each proportion of cold days with each of the specific symptoms within a cold and averaging t he colds within a participant Symptom Intensity (SI) score for each of the symptoms on a self reported cold day ranged from 0 to 3 The a verage score for each treatment group was obtained by averaging each symptom score within a cold and averaging the c olds within a participant Total SI score on self reported cold days was obtained by summing the LS m ean for each of the nine symptoms where the average score for each treatment

PAGE 85

85 group was obtained by averaging each symptom within a cold and averaging the c olds within a participant. Quality of life measurements were obtained from the daily questionnaire Average proportion of cold days was obtained by averaging proportion of cold days within a cold and averaging colds within each participant Differences b etween treatment groups were calculated using a two way analysis of variance For lymphocyte subpopulation cell numbers, salivary and fecal sIgA and CRP concentrations, cytokine production following mitogenic (LPS and PHA) stimulation of PBMCs, a mixed mod el was used with the main effects (age group, treatment group, gender, draw [baseline, vaccination, post fold change in fecal bifidobacteria genome equivalents], and Mini Nutritional Assessment [MNA] as a continuous variable), all 2 way intera ctions, and the random effect for participant to account for the repeated observations. Non significant effects and interactions were hierarchically eliminated from the model To correct for a skewed distribution, data were transfo rmed by taking the natu ral log of salivary sIgA, fecal sIgA and serum CRP PHA induced IL 2, IL 5, and IL 10 and LPS induced IL 6, IL 8, IL 10 and TNF Analyses were executed with the use of SigmaPlot for Windows (Build 12.1.0.15 version 12.0, 2011, Systat Software, Inc., San Jose, CA) and the generalized linear mixed models were fitted using SASv9.2 (SAS In stitute, Cary, NC). Unless stated otherwise, data are reported as LSmeanSEM

PAGE 86

86 Figure 3 1 Study d esign

PAGE 87

87 CHAPTER 4 RESULTS Ninety seven participants were consented and assessed for eligibility (Figure 4 1). Of this group, 13 were excluded of which si x did not meet the inclusion criteria and seven declined to participate. Of the 84 participants remaining, 40 were randomized to the placebo group and 44 were randomized to the GOS group. In the placebo group, two participants withdrew from the study (on e participant withdrew on the second day of the study because of allergy like symptoms and another participant withdrew after 9 days for unknown reasons) and in the GOS group, one participant withdrew after 19 days of being part of the study due to a prolo nged illness that she described as study (Figure 4 1). Data from these three participants were not included in any of the analyses since only one out of the three blood draws was completed for these participants. Data was analyzed using intent to treat from 81. The study blinding was successful with 61% of the participants in the placebo group and 59% of the participants in the GOS group, correctly identifying the suppl ement that they were receiving (p=0.993). Both study groups were compliant with an average intake of more than 1.8 supplement packets per day (Table 4 1). There were no significant differences in the number of supplement packets consumed (total number or percentage) or participant characteristics between the two groups with the exception of age and the dietary score of the initial MNA (Table 4 1). Participants in the GOS group were on average 2.8 years older than participants in the placebo group and scor ed 0.5 points higher out of a possible 8 points in the dietary sub score category of the MNA. However, when looking

PAGE 88

88 at the total MNA score, no difference was observed between the placebo and GOS groups. Sel f Reported Cold Days, Symptoms a nd Symptom Intens ities There was no significant difference in the probability of self reporting a cold on the daily questionnaire between the GOS and placebo group (data not shown). Due to the significant difference in age between supplement groups, data were subdivided i nto age [60 to 64 age group, there was a significant effect of age group (p=0.0257) and a trend for the interaction between treatment group and age group (p=0.0846) on the probability of self reporting a cold; consequently, all subsequent analyses were completed based on treatment and age group. Probability of self reporting a cold using these age groups was significantly different with a lower probability (p=0.0332) of self reporting a cold in Older Aged compared to the Younger Aged participants in the GOS group. The Older Aged or Younger Aged adults did not differ within the placebo group or betw een the placebo and GOS groups (Figure 4 2). The proportion of participant s with one or more self reported cold days, the duration of cold episodes and number of cold days for participant s with one or more self reported cold days were not significantly dif ferent between treatment groups or age groups (Table 4 2). S ignificant difference s were observed when looking at the proportion of cold days in respect to total days, where total participants in the GOS group had a significantly lower proportion of self r eported cold days in the Older Aged group (p=0.003) when c ompared to the placebo group. This same effect was not observed in the Younger Aged group where participants receiving the GOS

PAGE 89

89 supplementation had a significantly higher proportion of self reported cold days (p=0.049). The average days of cold for participants who experienced at least one day of cold over the entire study averaged across both treatment and age groups, were not different. Average p roportions of cold days with cold symptoms as well as symptom intensities for each of the symptoms for each participant were examined. A significant interaction (p=0.03) between treatment group and age group was observed when looking at the proportion of cold days with the stuffed/running nose cold sympto m. Younger Aged participants receiving the GOS supplementation had a significantly higher proportion of cold days when they experienced nasal symptoms when compared to the Younger Aged participants receiving the placebo. This significant difference was n ot observed in the Older Aged participants. No other significant difference was observed between both the age groups within each treatment group and the treatment group within each age group for the other cold symptoms as well as the total symptom intensi ty score on days of self reported colds (Table 4 2). When dividing participants only by treatment group and not by age groups, participants receiving the GOS supplementation had a significantly lower fatigue symptom score (p=0.045) on self reported cold da ys and a significantly lower proportion of cold days with fatigue (p=0.0275) (data not shown). Quality of Life M easurements On self reported cold days information on health related quality of life was collected. When looking at quality of life questions o n days of self reported cold, no significant difference was observed between both the age groups within each treatment group and the treatment group wit hin each age group (Table 4 3). Additionally, no difference between treatment groups or age groups was found when looking at the

PAGE 90

90 proportion of cold episodes when participants visited the doctor because of the symptoms. Lymphocytes S ubpopulation C ell N umbers There was an age group by treatment group interaction (p=0.0511) for the percentage of NK cells the p ercentage of NK cells was significantly higher (p=0.0022) in the Older Aged participants in the GOS group when compared to Younger Aged participants in the same group (Figure 4 4). Across age and supplement groups there was a significant draw effect where the percentage of NK cells was significantly lower at vaccination blood draw versus baseline (p=0.0485). There was no difference in NK cell percentages at vaccination and two weeks post vaccination (data not shown). For lymphocyte subpopulations and spec ifically cell numbers per microliter of whole blood, no differences were observed between treatment or age group or blood draw (i.e., baseline, vaccination, or 2 weeks post vaccination Table 4 4). A significant draw effect (p=0.04) was found for the total cell numbers of the immature T lymphocyte subset. A significant difference (p=0.0281), regardless of treatment group, was seen when comparing the total cell counts at baseline (314) and at 2 weeks post vaccination (5 weeks post supplementation) (264) av eraged over all of the participants. Vaccination alone did not affect immune cell phenotypes or numbers in either the GOS or placebo group (Appendix D). When the data were further subdivid ed based on changes in fecal bifidobacteria genome equivalents (i. e., 2 fold increase or responder group versus 2 fold increase or non responder group ) there was no effect of treatment group or age by treatment group interaction for any of the lymphocyte subpopulations.

PAGE 91

91 Cytokine P roduced F ollowing PHA S timulation of P e ripheral B lood M ononuclear C ells Older Aged participants in the placebo group produced significantly lower concentrations of mitogen induced IFN the placebo (p=0.0008), and IFN ly higher with GOS supplementation of the Older Aged participants (p=0.006, Figure 4 3). Concentrations of IFN gender (p=0.0360) and MNA and treatment group (p=0.0128) where con centrations of IFN Cytokine production f ollowing PHA stimulation of peripheral bloo d mononuclear cells was different between participants who were classified as responders versus n on responders based on changes in fecal bifidobacteria. A significant interaction was seen between responder group effect and treatment group effect for the concentration lev els of IL 2 (p=0.0057, Table 4 5 ). Participants who were in the non responder gr oup and receiving GOS had significantly higher concentrations of IL 2 than non responders receiving placebo (p=0.0182). Additionally, participants in the GOS group who were responders had significantly lower concentrations of IL 2, than participants from the same treatment group who were non responders (p=0.0353). As for the concentration of IL 5 produced following PHA stimulation, a significant interaction was observed between the responder group effect and treatment group effect (p=0.0448). Participant s in the responder group that were receivi ng GOS had significantly lower concentrations of IL 5 than responders receiving the placebo (p=0.0092). Finally, concentrations of IL 10 showed a significant interaction between the responder group effect and the treatment group effect (p=0.0014). In fact, many significant differences were observed.

PAGE 92

92 For participants in the placebo group, responders had a significantly higher concentration of IL 10 then non responders (p=0.0097). Inversely, when only looking at p articipants in the GOS group, responders had a significantly lower concentration of IL 10 then non responders (0.0471). When comparing participants who were responders; those in the GOS group had significantly lower concentrations of IL 10 following PHA s timulation than responders in the placebo group (p=0.0205). As for non responders, when receiving the GOS supplementation, IL 10 concentrations were significantly higher than participants receiving the placebo (p=0.022). Cytokine P roduced F ollowing LPS S t imulation of P eripheral B lood M ononuclear C ells Following LPS stimulation of PBMCs, a significant interaction between responder group effect and treatment group was eff ect observed (p=0.048) for concentrations of IL 10 (Table 4 6 ). Participants in the res ponder group receiving the placebo had a significantly higher concentration of IL 10 when compared to the participants supplemented with GOS (p=0.0124). Participants in the placebo group that were classified as responders also had a significantly higher c oncentration of IL 10 when compared to non responders in that same group (p=0.0185). A significant effect of treatment group was observed for IL 1 between treatment group and blood draw. These data suggest that the group differences were present at baseline. Salivary and F ecal S ecretory Immunoglobulin A and C Reactive P rotein No significant differences were observed for concentrations of salivary sIgA amongst the two treatment groups and throughout the three time points. However, a significant responder effect was observed where participants who saw their fecal

PAGE 93

93 bifidobacteria increase more than two fol d, regardless of the treatment group or draw, had higher concentrations of salivary sIgA t hen the non responders (Table 4 7 ). Fecal sIgA yielded no differences between treatment and responder groups in both baseline and final stool samples. S ince general inflammation can be a confounder for tests of nutrient status and because it can also affect immune response, serum C reactive protein, a measure of acute phase reaction, was measured T here was no significant difference in serum CRP across the three time points (baseline, at vaccination and 2 weeks post vaccination) and amongst the two treatment groups (Table 4 7) GSRS Questionnaire Gastrointestinal symptom scores were significantly lower with GOS supplementation for constipation (p=0.0101) syndrome and abdo minal pain (p=0.0207) (Figure 4 5). There was no difference between treatment groups for diarrhea syndrome, indigestion syndrome or reflux syndrome. Participants reported daily bowel movements/stools and when comparing stool output between the placeb o group and the GOS group, there was no effect of treatment group (p=0.76), week (p=0.24) or interaction of treatment group and week (p=0.42) on the daily number of stool. On average, participants in the GOS group had 1.60.1 bowel movements per day and p artic i pants in the placebo group had 1.5 0.1 bowel mo vements per day. Food Frequency Questionnaire In addition no significant differences were observed between placebo responders, placebo non responders, GOS responders and GOS non responders in terms of in take of dietary fiber, dietary soluble fiber, average daily servings of whole grains, daily

PAGE 94

94 servings of grains, dietary fiber from beans, vegetables and fruits, or grains as well as the daily vegetable servings (data not shown). Bifidobacteria Genome Eq uivalent (GE) Proportion Changes Results following qPCR analysis showed significant differences between GOS and placebo supplementation when comparing baseline stool samples and samples obtained during week 2 of supplementation (post treatment) Proportio n of bifidobacteria GE was obtained by normalizing bifidobacteria GE with the universal primer set and change in proportion was obtained by subtracting baseline proportion of bifidobacteria GE from post treatment proportion of bifidobacteria GE. In fact, it was observed that participants consuming 5 g of GOS daily had a significantly (p=0.013) greater positive change (i.e. increase ) in the proportion of bifidobacteria GE (0.0780.023) when compared to changes in proportions of bifidobacteria in the placebo group (0.002 0.007)

PAGE 95

95 Figure 4 1. Flow chart of participant recruitment, allocation and a nalysis GOS, galactooligosaccharides

PAGE 96

96 Figure 4 2 Effect of treatment group and age group on the probability of self reporting a cold over the 6 month intervention. Data were analyzed using a fixed effects model with treatment group and age group as main effects and with the treatment group by age group interaction Data are presented as LSm eanSEM Bars with different letters ar e significantly different (p 0.05).

PAGE 97

97 Figure 4 3 Effect of t reatment group and a ge g roup on concentration of interferon (IFN) with a T cell mitogen. Data were transformed by taking the square root (IFN to correct for a skewed distribution. Data were obtained by averaging over all of the other effects and reporting at the average Mini Nutritional Assessment (MNA) score for the 81 participants (27). Data were analyzed using a mixed model with the followin g main effects; blood draw (baseline, at vaccination and 2 weeks post vaccination), treatment group, age group, responder fold change in fecal bifidobacteria genome equivalents), gender and MNA (as a continuous variable) with two and three way in teractions and the random effect of participants to account for repeated observations on the same participants. Non significant interactions were removed hierarchically until the final model was obtained. Data for IFN concentration are back transformed l east squares means and approximate SEMs for the back transformed least squares means. Bars with different letters are significantly different (p 0.05).

PAGE 98

98 Figure 4 4 Effect of t reatment g roup and a ge group the percentage of lymphocytes that were identifi ed as natural killer (NK) cells. Data were obtained by averaging over the gender and blood draw ( baseline, at vaccination and 2 weeks post vaccination ). Data were analyzed using a mixed model with the following main effects; draw, treatment group age grou p, responder fold change in fecal bifidobacteria genome equivalents), gender and Mini Nutritional Assessment score (as a continuous variable) with two and three way interactions and the random effect of participant s to account for repeated observations on the same participant s. Non significant interactions were removed hierarchically until the final model was obtained. Bars with different letters are significantly different (p 0.05).

PAGE 99

99 Figure 4 5. Monthly gastrointestinal sym ptoms in participants receiving the placebo or galactooligosaccharides ( GOS ) Gastrointestinal (GI) symptoms were scored during the baseline period and then monthly during the 24 w ee k intervention Symptom scores from the baseline period were used to contr ol for variation in individual responses for the subsequent monthly questionnaires. Individual symptoms were scored from 1 (no discomfort at all) to 7 (very severe discomfort) and summed for each symptom within each syndrome. Questions within each syndrome were as follows: d iarrhea syndrome diarrhea, loose stools, urgent need for defecation (possible scores 3 to 21); c onstipation syndrome constipation, hard stools, and feeling of incomplete evacuation (possible scores 3 to 21); a bdominal pain abdomina l pain, hunger pains, and nausea (possible scores 3 to 21); i ndigestion syndrome rumbling, bloating, burping, and gas (possible scores 4 to 28); r eflux syndrome heartburn and acid reflux (possible scores 2 to 14). A generalized linear mixed model was u sed to analyze the data. Data represent the LSmean SEM. Within each GI symptoms, bars with different letters are significantly different (p 0.05). 1 2 3 4 5 6 7 Diarrhea Syndrome Constipation Syndrome Abdominal Pain Indigestion Syndrome Reflux Syndrome Sum of GI symptom scores Placebo (n=38) GOS (n=43) a b a b a a a a a a

PAGE 100

100 Table 4 1. Demographics and compliance 1 Placebo GOS P value 2 n (%) 38 (47%) 43 (53%) NS Gender [n, (%)] Male Female 15 (39%) 23 (61%) 16 (37%) 27 (63%) NS Race/Ethnicity [n, (%)] White Hispanic/Latino African American 34 (89%) 1 (3%) 3 (8%) 36 (84%) 1 (2%) 6 (14%) NS Age (y ears ) 64.81.0 67.61.1 0.04 BMI (kg/m 2 ) 28.90.8 28.40.8 NS BMI category [n, (%)] Normal Weight (18.5 24.9) 3 Overweight (25.0 29.9) Obese (30.0 and above) 10 (26%) 11 (29%) 17 (45%) 13 (30%) 17 (40%) 13 (30%) NS Average packets consumed per d Mean SEM Median (25 th 75 th ) 1.880.04 1.96 (1.85, 1.99) 1.910.02 1.96 (1. 88, 1.99) NS Percentage of supplement packet s consumed per d 942 % 961 % NS Daily stress level (0=no stress, 10=extreme stress) 2.30.2 1.80.2 NS Total initial MNA score Anthropometric subscore 4 Global sub score 5 Dietary sub score 6 Subjective sub sc ore 7 26.80.3 7.40.2 10.60.1 5.40.2 3.50.1 27.30.4 7.70.1 10.40.2 5.90.2 3.30.1 NS NS NS 0.04 NS MNA category [n, (%)] At risk of malnutrition 9 Well nourished 10 3 (8%) 35 (92%) 6 (14%) 37 (86%) NS 1 Abbreviations: galactooligosaccharides, GOS; body mass index, BMI; day, d; Mini Nutritional Assessment, MNA. 2 Differences between the two treatment groups were calculated using the non parametric Mann Whitney Rank Sum test. Categorical data were compared using the chi square statistics. Data are repo rted as meanSEM unless stated otherwise. 3 One of the participants in the GOS group was underweight with a BMI of 18.4 but was analyzed within the normal weight category. 4 Anthropometric sub score: questions related to weight loss during the last 3 months BMI, and mid arm and calf circumference (possible score from 0 to 8). 5 Global sub score: mobility, questions related to psychological stress or acute disease in the past 3 months, neuropsychological problems, living circumstances (independent or not), pr escription drugs per day, pressure sores or skin ulcers, and mode of feeding (possible score from 0 to 11). 6 Dietary sub score: questions related to decline in food intake over the past 3 months due to loss of appetite, digestive problems, chewing or swall owing difficulties, number of

PAGE 101

101 full meals eaten daily, selected consumption markers for protein intake, servings of fruit or vegetables per day, and fluid consumed per day (possible score from 0 to 7). 7 Subjective sub score: questions related to self view o f nutritional and health status (possible score from 0 to 4). 8 Individuals with a score between 17 and 23 out of a maximum of 30 are considered to 9 Individuals with a score of 23.5 or greater out of a maximum of 30 are conside red to be

PAGE 102

102 Table 4 2 Self reported c old d ays 1 Younger Aged (60 to 64 y ) Older Aged (65 y and older) Placebo GOS Placebo GOS P value Participant s with > 1 d of cold/total participant s [n/n, (%)] 11/22 (50%) 17/22 (77%) 7/16 (44%) 7 /21 (33%) Younger Aged: NS Older Aged: NS Total cold days/Total days [n/n, (%)] 103/3689 (2.8%) 134 /3696 ( 3 6 %) 71 /2669 (2.7 %) 55/3528 (1.6%) Younger Aged: 0.049 Older Aged: 0.003 Duration of each cold (consecutive d) 4.50.9 4.80.8 7.11.3 5.01.2 T:NS A:NS I:NS Cold d/participants with > 1 cold days 9.42.0 7.91.6 10.12.5 7.92.5 T:NS A:NS I:NS Proportion of cold d with each symptom 2 Stuffed/Running Nose 79.26.1% a 97.14.9% b 93.67.6% ab 81.07.6% ab T:NS A:NS I:0.03 Scratchy/Sore Throat 61.710.2% 69.88.2% 66.212.8% 60.912.8% T:NS A:NS I:NS Cough 60.411.0 68.88.9% 73.013.8% 65.513.8% T:NS A:NS I:NS Headache 34.511.5% 35.59.3% 44.214.4% 45.314.4% T:NS A:NS I:NS Achiness 25.29.8% 28.57.9% 50.312.3% 27.912.3% T:NS A: NS I:NS Fatigue 69.211.2% 48.69.1% 68.814.1% 55.014.1% T:NS A:NS I:NS Ear Discomfort 21.09.4% 11.57.5% 18.811.7% 20.011.7% T:NS A:NS I:NS Stiffness/Chills 21.310.0% 20.28.1% 32.612.6% 25.612.6% T:NS A:NS I:NS Fever 8.24.2% 4.43.4% 0.05.3% 5.65.3% T:NS A:NS I:NS Symptom Intensity (SI) score on cold d 3 Stuffed/Running Nose 1.180.13 1.220.11 1.330.17 1.160.17 T:NS A:NS I:NS Scratchy/Sore Throat 0.950.17 1.000.14 0.940.22 0.780.22 T:NS A:NS I:NS Cough 0.870.17 0.860.14 1.040.22 0.930.22 T:NS A:NS I:NS Headache 0.560.19 0.480.15 0.470.23 0.680.23 T:NS A:NS I:NS Achiness 0.430.12 0.300.10 0.550.15 0.370.15 T:NS A:NS I:NS Fatigue 0.950.16 0.600.13 0.970.20 0.670.20 T:NS A:NS I:NS Ear Disc omfort 0.230.10 0.150.08 0.190.13 0.240.13 T:NS A:NS I:NS Stiffness/Chills 0.330.15 0.290.12 0.380.19 0.380.19 T:NS A:NS I:NS Fever 4 0.130.11 0.130.09 0.000.13 0.060.13 T:NS A:NS I:NS Total SI score on cold d 5 5.60.8 5.00.7 5.91.1 5.31.1 T:NS A:NS I:NS

PAGE 103

103 1 Self reported cold days are defined as days when participant you say that you have When the question was left unanswered but the symptom intensity scor e was >6 on that day, then it was counted as a day of cold and included in the analysis. Abbreviations: Galactooligosaccharides, GOS; days, d; symptom intensity, SI; treatment group, T; age group, A; interaction, I. Categorical data were compared using the chi square statistics. Symptom data were analyzed using a two way analysis of variance. Data are reported as LS m eanSEM 2 Proportion of cold days when the participant with a self reported cold was experiencing each specific symptom. The average score for e ach treatment group was obtained by averaging each proportion of cold days with each of the symptoms within a cold and averaging the colds within a participant 3 Symptom Intensity score for each of the symptoms (ranging from 0 to 3) on a self reported cold day. Average score for each treatment group was obtained by averaging each symptom score within a cold and averag ing the colds within a participant. 4 Where no fever = 0; Yes with no F reported would get a score of 1, a fever of <100F would =1, 100 102F =2, and >102=3. 5 Data obtained by summing the LS m ean for each of the nine symptoms where the average score for each treatment group was obtained by averaging each symptom within a cold and averaging the colds within a participant

PAGE 104

104 Table 4 3 Quality of l ife measurements on days of self reported cold 1 Younger aged (60 to 64 y ) Older aged (65 y and older) Placebo GOS Placebo GOS P value Proportion of cold episodes Saw a doctor because of the cold/flu symptoms 19.79.5% 5.97.6% 14.311.9% 14.311.9% T :NS A:NS I:NS Proportion of cold days where; Cold/Flu Symptoms interfered with work 2 9.35.5% 3.04.7% 9.86.7% 12.58.2% T:NS A:NS I:NS Used medication to relieve cold/flu symptoms 3 51.411.5% 56.69.3% 54.314.4% 51.814.4% T:NS A:NS I:NS Cold/Flu Symptoms interfered with bathing/washing 1.75.4% 5.94.1% 0.06.4% 5.26.4% T:NS A:NS I:NS Cold/Flu Symptoms interfered with getting dressed in the morning 2.27.4% 6.45.7% 5.98.9% 21.98.9% T:NS A:NS I:NS Cold/Flu Symptoms interfered wit h visiting or socializing friends/family 20.38.2% 11.06.0% 30.89.3% 19.010.1% T:NS A:NS I:NS Cold/Flu Symptoms prevented from shopping/running errands 18.48.6% 10.46.6% 29.410.3% 26.211.2% T:NS A:NS I:NS Cold/Flu Symptoms prevented from takin g a winter vacation or weekend away 4.05.3% 2.83.4% 0.04.8% 12.55.9% T:NS A:NS I:NS 1 Self reported cold days are defined as days when participant s reported YES Based on how you feel today, would you say that you have the cold or the flu W he n the questi on was left unanswered but the symptom intensity score was >6 on that day then it was counted as a day of co ld and included in the analysis Available Yes responses to questions are reported when applicable. Average proportion of days for each treatment group was obtained by averaging each proportion of cold days within a cold and averaging the colds within a participant Differences between treatment groups were calculated using a two way analysis of variance Data are expressed as LS m eanSEM Abbreviations: Galactooligosaccharides, GOS; treatment group, T; age group, A; interaction, I. 2 This question referred to paid employment. 3 This question referred to non and/or prescription medication.

PAGE 105

105 Table 4 4 Lymphocytes subpopulations cell numbers per microliter o f whole blood by treatment and responder group and blood draw (baseline, at vaccination and 2 weeks post vaccination) 1 Non Responders fold increase in fecal bifidobacteria genome equivalents) Responders fold increase in fecal b ifidobacteria genome equivalents) Placebo GOS P value 2 Placebo GOS Placebo GOS P value 3 Total T lymphocytes Baseline At vaccination Post vaccination D1 3: 38 15 60 99 157 0 114 154 0 96 D1 2: 43 4 D3: 42 16 20 96 15 90 85 151 0 81 T: NS D: NS I: NS D1 3: 17 15 30 158 16 20 181 15 50 132 D1 3: 17 1610142 15 60 109 158 0 111 D1 3: 19 1600133 155 0 159 155 0 150 D1 2: 26 D3: 25 16 20 132 160 0 123 14 70 115 T: NS R: NS I: NS Total cytotoxic T cells Baseline At vaccination Post vaccination D1 3: 38 48154 487 60 46349 D1 2: 43 D3: 42 51056 48249 44039 T: NS D: NS I: NS D1 3: 17 48470 50872 48061 D1 3: 17 47068 41951 42746 D1 3: 19 48690 472101 45481 D1 2: 26 D3: 25 53782 52373 44958 T: NS R: NS I: NS Total T helper cells Baseline At vac cination Post vaccination D1 3: 38 104 0 68 105 0 74 10 50 71 D1 2: 43 D3: 42 10 90 63 10 90 60 10 60 64 T: NS D: NS I: NS D1 3: 17 10 20 111 10 80 125 10 40 96 D1 3: 17 11 40 95 11 40 81 11 50 92 D1 3: 19 108088 104 0 98 1070 113 D1 2: 26 D3: 25 10 60 84 105 0 8 5 99487 T: NS R: NS I: NS Total immature T cells Baseline At vaccination Post vaccination D1 3: 38 233 212 223 D1 2: 43 D3: 42 388 347 307 T: NS D: 0.04 5 I: NS D1 3: 17 224 224 213 D1 3: 17 3910 3410 339 D1 3: 19 256 192 235 D1 2: 2 6 D3: 25 3711 3510 2811 T: NS R: NS I: NS Total leukocytes Baseline At vaccination Post vaccination D1 3: 38 228 0 163 23 10 222 225 0 166 D1 2: 43 D3: 42 21 70 107 211 0 99 206 0 94 T: NS D: NS I: NS D1 3: 17 2360308 251 0 436 24 10 309 D1 3: 17 21701 75 2070136 21 40 129 D1 3: 19 2280 171 2190 211 2170 182 D1 2: 26 D3: 25 216 0 139 21 40 140 201 0 132 T: NS R: NS I: NS

PAGE 106

106 Table 4 4. Continued Non Responders fold increase in fecal bifidobacteria genome equivalents) Responders fold increase in fecal bifidobacteria genome equivalents) Placebo GOS P value 2 Placebo GOS Placebo GOS P value 3 Total B cells Baseline At vaccination Post vaccination D1 3: 3 8 35390 380128 36198 D1 2: 43 D3: 42 21014 21114 21915 T: NS D: NS I: NS D1 3: 17 441199 519284 477217 D1 3: 17 19922 19822 21327 D1 3: 19 29726 27728 28022 D1 2: 26 D3: 25 21818 22018 22319 T: NS R: NS I: NS 1 Abbreviations: Galact ooligosaccharides, GOS; treatment group, T; blood draw, D; interaction, I; responder group, R. Data were analyzed using a mixed model with the main effects (age group, treatment group, gender, draw [baseline, vaccination, post vaccination], responder group and Mini Nutritional Assessment [MNA] as a continuous variable), all 2 way interactions, and the random effect for participant to account for the repeated observations. Non significant effects and interactions were hierarchically eliminated from the mode l Unless stated otherwise, data represents the sample meanSEM. 2 P value for the treatment group effect (T); blood draw (D; baseline versus at vaccination v ersus 2 weeks post vaccination), and interaction (I) between blood draw and treatment group. 3 P val ue for the treatment group effect (T), the responder group effect (R) and the interaction between treatment group and responder group (I) 4 The number of participants varies between blood draws (baseline, D1 ; at vaccination, D2; 2 weeks post vaccination, D3) due to limited volume of blood obtained from each of the participants.

PAGE 107

107 Table 4 5. Cytokines produced following phytohemagglutinin stimulation of peripheral blood mononuclear cells by treatment and responder group and blood draw (baseline, at vaccination and two weeks post vaccination) 1 Non Responders fold increase in fecal bifidobacteria genome equivalents) Responders fold increase in fecal bifidobacteria genome equivalents) Placebo GOS P value 2 Placebo GOS Placebo GOS P value 3 PHA Stimulated IL 2 (ng/mL) 5 Baseline At vaccination Post vaccination D1 3: 37 0.680.12 0.330.06 0.300.06 D1 2: 43 4 D2: 42 0.490.08 0.250. 04 0.230.04 T: NS D: 0.004 I: NS D1 3: 16 0.630.23 0.290.09 0.280.10 D1 3: 17 0.490.08 0.300.07 0.180.04 D1 3: 19 0.780.13 0.390.09 0.330.07 D1 2: 26 D3: 25 0.490.12 0.210.05 0.270.06 T: NS R: 0.018 I: 0.006 6 IL 5 (ng/mL) 7 Baseline At v accination Post vaccination D1 3: 38 0.180.04 0.160.04 0.140.03 D1 2: 43 D2: 42 0.110.02 0.090.01 0.100.02 T: NS D: 0.0001 I: NS D1 3: 17 0.140.03 0.100.03 0.090.03 D1 3: 17 0.150.03 0.120.02 0.120.03 D1 3: 19 0.220.08 0.210.07 0.190.0 5 D1 2: 26 D3: 25 0.090.02 0.070.01 0.080.02 T: NS R: NS I: 0.045 8 IL 10 (ng/mL) Baseline At vaccination Post vaccination D1 3: 38 0.210.02 0.210.02 0.230.02 D1 2: 43 D2: 42 0.210.02 0.200.02 0.250.03 T: NS D: NS I: NS D1 3: 17 0.150.02 0.1 70.03 0.190.03 D1 3: 17 0.250.04 0.240.03 0.310.07 D1 3: 19 0.260.04 0.250.03 0.260.03 D1 2: 26 D3: 25 0.180.03 0.180.03 0.220.03 T: NS R: NS I: 0.001 9 1 Abbreviations: Galactooligosaccharides, GOS; peripheral blood mononuclear cell, PBMC; phytohemagglutinin, PHA; interleukin, IL; treatment group, T; blood draw, D; interaction, I; responder group, R. Data were analyzed using a mixed model with the main effects (age group, treatment group, gender, draw [baseline, vaccination, post vaccination ], responder group, and Mini Nutritional Assessment [MNA] as a continuous variable), all 2 way interactions, and the random effect for participant to account for the repeated observations. Non significant effects and interactions were hierarchically elimin ated from the model Data were transformed by taking the natural log (PHA induced IL 2, IL 5, and IL 10) to correct for a skewed distribution. Unless stated otherwise, data represents the sample meanSEM. 2 P value for the treatment group effect (T), blood draw (D; baseline versus at vaccination versus 2 weeks post vaccination) and the interaction (I) between draw and treatment group.

PAGE 108

108 3 P value for the treatment group effect (T), the responder group effect (R), and the interaction between treatment group and responder group (I). 4 The number of participants varies between blood draws (baseline, D1; at vaccination, D2; 2 weeks post vaccination, D3) due to limited volume of blood obtained from each of the participants. 5 6 For participants in the non responder group receiving placebo versus GOS (p=0.0182) and for participants in the GOS group that are responders versus non responders (p=0.0353). 7 8 For participants in the responder group receiving placebo versus GOS (p=0.0092). that are responders versus non responders (p=0.0097) and for participants in the GOS group that are responders versus non responders (p=0.0471).

PAGE 109

109 Table 4 6. Cytokines produced following lipopolysaccharide stimulation of peripheral blood mononuclear cells by treatment and responder group and blood draw (baseline, at vaccination and two weeks post vaccination) 1 Non Responders fold increase in fecal bifidobacteria genome equivalents) Responders fold increase in fecal bifidobacteria genome equivalents) Placebo GOS P value 2 Placebo GOS Placebo GOS P value 3 LPS Stimulated IL Baseline At vaccination Post vaccination D1 3: 36 3.340.30 3.920.39 3.520.33 D1 2: 43 4 D2: 42 2.780.20 2.870.22 2.950.21 T: 0.045 D: NS I: NS D1 3: 17 3.070.38 4.010.58 3.720.60 D1 3: 17 2.760.29 2.780.38 2.810.29 D1 3: 17 3.660.51 3.940.61 3.450.35 D1 2: 26 D3: 25 2.790.28 2.930.27 3.040.30 T: 0.045 R: NS I: NS IL 6 (ng/mL) Baseline At vaccination Post vaccination D1 3: 38 282 282 292 D1 2: 43 D2: 42 242 232 262 T: NS D: NS I: NS D1 3: 17 304 242 253 D1 3: 17 234 213 254 D1 3: 19 282 3 33 323 D1 2: 26 D3: 25 253 242 263 T: NS R: NS I: NS IL 8 (ng/mL) Baseline At vaccination Post vaccination D1 3: 37 17520 18020 16115 D1 2: 39 D2: 38 15017 14411 15817 T: NS D: NS I: NS D1 3: 17 20439 14321 13415 D1 3: 16 16228 15220 18132 D1 3: 18 15616 21635 18725 D1 2: 23 D3: 22 14222 13913 14217 T: NS R: NS I: NS IL 10 (ng/mL) 5 Baseline At vaccination Post vaccination D1 3: 38 28527 29524 32733 D1 2: 43 D2: 42 26830 23922 32348 T: NS D: NS I: NS D1 3: 17 24640 22329 27347 D1 3: 17 29752 25745 399110 D1 3: 19 32939 34834 35744 D1 2: 26 D3: 25 24937 22721 27230 T: NS R: NS I: 0.048 6 TNF Baseline At vaccination Post vaccination D1 3: 38 402 0 394 31 30 373 32 10 414 D1 2: 43 D2: 42 259 0 314 17 20 206 207 0 268 T: 0.019 I: NS D1 3: 17 4240666 26 30 384 29 10 526 D1 3: 17 29 40 618 18 30 413 25 70 583 D1 3: 19 39 80 512 368 0 646 3590682 D1 2: 26 D3: 25 23 70 330 16 50 214 17 40 202 T:0.019 R: NS I: NS

PAGE 110

110 1 Abbreviations: Galactooligosaccha rides, GOS; peripheral blood mononuclear cell, PBMC; lipopolysaccharide, LPS; interleukin, IL; treatment group, T; blood draw, D; interaction, I; responder group, R. Data were analyzed using a mixed model with the main effects (age group, treatment group, gender, blood draw [baseline, vaccination, post vaccination], responder group, and Mini Nutritional Assessment [MNA] as a continuous variable), all 2 way interactions, and the random effect for participant to account for the repeated observations. Non sign ificant effects and interactions were hierarchically eliminated from the model Data were transformed by taking the natural log (LPS induced IL 6, IL 8, IL 10 and TNF Unless stated otherwise, data represents the sample meanSEM. 2 P value for the treatment group effect (T), blood draw (D; baseline versus at vaccination ve rsus 2 weeks post vaccination), and the interaction (I) between draw and treatment group. 3 P value for the treatment group effect (T), the res ponder group effect (R), and the interaction between treatment group and responder group (I) 4 The number of participants varies between blood draws (baseline, D1; at vaccination, D2; 2 weeks post vaccination, D3) due to limited volume of blood obtained fr om each of the participants. 5 For IL 10; reported means are averaged over age group where the main effect of age group (p=0.04) was significant 6 For participants in the responder group receiving placebo versus GOS (p=0.0124) and for participants in the pl acebo group that are responders versus non responders (p=0.0185).

PAGE 111

111 Table 4 7. Salivary and f ecal secretory immunoglobulin A and C reactive pr otein by treatment and responder group and blood draw (baseline, at vaccination and 2 weeks post vaccination) 1 Non Responders fold increase in fecal bifidobacteria genome equivalents) Responders fold increase in fecal bifidobacteria genome equivalents) Placebo GOS P value 2 Placebo GOS Placebo GOS P value 3 4 Baseline At vaccinat ion Post vaccination D1 3: 34 47647 55168 52664 D1 2: 41 5 D3: 40 77996 73892 756143 T: NS D: NS I: NS D1 3: 15 43578 46376 b 47272 D1 3: 16 56699 618111 b 523127 D1 3: 17 51666 633115 a 589111 D1 2: 25 D3: 24 916138 815133 a 911220 T : NS R: 0.050 I: NS Fecal sIgA (ng/mg) Baseline Final B & F: 36 6 366 0 703 35 10 574 B & F: 40 26 70 462 29 40 413 T: NS D: NS I: NS B & F: 16 39 30 134 0 3370836 B & F: 17 288 0 715 32 70 667 B & F: 19 35 60 736 375 0 837 B & F: 23 2510617 269 0 530 T: NS R: NS I: NS Serum CRP (mg/L) Baseline At vaccination Post vaccination D1: 34 D2 3: 35 3.40.8 3.51.1 3.10.9 D1 3: 35 2.90.5 3.50.8 2.90.6 T: NS D: NS I: NS D1 3: 17 4.81.4 3.92.1 3.71.7 D1 3: 16 2.70.7 4.11.5 2.70.8 D1: 15 D2 3: 16 2.00.5 3.40 .8 2.80.7 D1 3: 19 3.20.7 2.90.6 3.00.8 T: NS R: NS I: NS 1 Abbreviations: Galactooligosaccharides, GOS; secretory immunoglobulin A, sIgA; treatment group, T; blood draw, D; interaction, I; responder group, R ; C reactive protein, CRP Data were analy zed using a mixed model with the main effects (age group, treatment group, gender, draw [baseline, vaccination, post vaccination], responder group, and Mini Nutritional Assessment [MNA] as a continuous variable), all 2 way interactions, and the random effe ct for participant to account for the repeated observations. Non significant effects and interactions were hierarchically eliminated from the model Data were transformed by taking the natural log (salivary sIgA, stool sIgA and serum CRP) to correct for a skewed distribution. Unless stated otherwise, data represents the sample meanSEM. 2 P value for the treatment group effect (T), blood draw (D; baseline versus at vaccination versus 2 weeks post vaccination) and for the interaction (I) between draw and tre atment group. 3 P value for the treatment group effect (T), the responder group effect (R) and the interaction between treatment group and responder group (I)

PAGE 112

112 5 The number of participants varies between blood draws (baseline, D1; at vaccination, D2; 2 weeks post vaccination, D3) due to limited volume of blood obtained from each of the participants. 6 The number of participants varies betwee n stool collections ( Baseline B; Final, F) because of inability to produce a stool sample.

PAGE 113

113 CHAPTER 5 DISCUSSION AND CONCL USIONS The primary aim of this study was to determine the effect of GOS on days of cold and flu Since a decrease in cold days w as observed with the same prebiotic in a previous study (4) it was hypothesized that GOS would significantly decrease days of illness; however, this outcome was not observed. However, there was a significant age difference (p=0.04) between the placebo gr oup and the GOS group where participants in the GOS group were significantly older (Table 4 1) The next logic al step was to determine if this significant age difference was also biologically significant specifically if differences in age could influence certain immune parameters Supporting this biological difference, a study by McNerlan and colleagues demonstrated that healthy circulating percentage of NK cells (19%) when co mpared to younger participants aged 40 to 69 years (13%) (232) A study by Vulevic et al. conducted in healthy aged adults demonstrated that a trans GOS had significant effects on the immune system evidenced by an improvement of NK cell activity It is possible th at GOS could be exerting its beneficial e ffects by priming NK cells For these reasons a post hoc analysis was done separating the participants into two age groups. ) an oup (65 y or older ), a significant difference in percentage of NK cells at 2 weeks post vaccination (5 weeks post supplementation) was seen in the GOS group between Participants in the GOS treatment group that were (Figure 4 4). These results are consistent with a study by Yang et al. (233) which

PAGE 114

114 looked at age related changes of peripheral blo od lymphocytes and compared the percentage o f NK cells be tween middle aged (45 to 64 y) and elders (65 y or above). This study also demonstrated that participant s in the elder group had a significantly higher percentage of NK cells Considering the probability of self reporting a cold and ignoring the age of the participants, it was unclear whether the treatment or the age effect was being observed In order to uncouple age from the treatment effect, a model which included both effects was executed and this was possible because both age groups were present in both treatmen t groups There appears to be a treatment group as well as an age group and treatment group interaction (Figure 4 2). T he probability of reporting a cold by participants rece iving the GOS supplement seemed to be dependent upon wh ich age group they were part of. In the GOS group, a significant difference was observed participants. This suggests that by dividing the data into age categories, we successfully separated the treatment from t he age effect. It was found that participants aged 65 years of age or older in the GOS group had a significantly lower probability of reporting a cold tha n participants aged 60 to 64 years old in that same treatment group. Although NK cell function was n ot measured in this study, a study executed by Gills et al. demonstrated that after supplying aged adults with lactic acid bacteria (LAB) the most vulnerable ages within the elder population were the on es benefiting the most from the probiotic supplementat ion (156) This study was also executed in healthy aged adults w h ere the age range was 60 to 84 years old and it was shown that participant s age d over 70 years experienced a significantly higher increase in NK cell function following LAB

PAGE 115

115 consumption when compared to the younger participants less than 70 years old These results are consistent with our findings suggesting age group) are benefiting the most from GOS supplementation and that this could be partly du e to an inherent suppressed NK cell function which is rescued by the intervention. It was also found that participants group receiving GOS had a significantly higher concentration of IFN following mitogen stimulation of peripheral blo od mononuclear cells than participants receiving the placebo in that same age group (Figure 4 3) This result is supported by a study from Holma and colleagues where a combination of probiotics and GOS given to 18 healthy men for two weeks resulted in a s ignificant increase in the selective secretion of IFN (234) This also suggests that IFN the probability of self reporting a cold. If this was the case, there would also be a significant dif ference in self reported colds between participants in the GOS group and those that are in the placebo group Interferon does not seem to be entirely explaining what is happening because, unlike what is observed with IFN there are no differences in self reported receiving the placebo. Interferon properties and confer protection against influenza infection s (235) Although this wa s not observed in this study, the influenza virus w as not specifically considered ; r ather co mmon cold infections in general, caused by more than 200 different viruses, were investigated. Interferon is known to stimulate and be secreted by NK cells and may explain the

PAGE 116

116 which could in turn help interpret the difference seen in self reported cold s A study by Arunachalam and colleagues demonstrated that in healthy elderly pa rticipant s, the oral consumption of a probiotic ( Bifidobacterium lactis HN019) was shown to enhance the capacity of peripheral blood cells to secrete this cytokine (236) In fact, by modulating the microbial population in the GI tract (e.g. increasing the immunoregulatory bifidobacteria), GOS could enhance cellular immunity and lead to a decreased probability of self reporting a cold Effect of GOS o n Symptom Intensity a nd Quality o f Life Although many studies involving nutraceuticals or functional foods h ave been unable to demonstrate an additional benefit in regards to reducing the occurrence of URTI s many showed an improvement i n the severity and duration of cold symptoms. This was not the case in our study where GOS supplementation did not have a sign ificant effect on the proportion of self reported cold days with different cold symptom s or symptom intensity score on those cold days (Table 4 2) The reason behind this lack of effect may be explained by the fact that of the 81 participants over the ent ire 24 week study, only about half self reported a day of cold. The population taking part in our study seemed remarkably healthy considering that it was conducted during peak cold and flu season This explanation may also clarify why we did not capture any differences between the groups and perhaps a larger population sample is needed to increase the likelihood of self reported cold days. The only significant difference observed in terms of symptoms on self reporte d cold days was the proportion of cold days with running or stuffed nose where participants in the Younger Aged group receiving GOS had a significantly higher proportion of cold days with this symptom than participants receiving th e placebo in the same age group, additionally there were

PAGE 117

117 signifi cantly more cold days as a percentage of total study days in these participants with GOS supplementation. Quality of life measurements during cold days were monitored throughout the duration of the study. The objective of these health related questions wa s to determine the impact of the common cold on physical, social an emotional functioning. On a self reported cold day, quality of life questions were analyzed in order to determine if GOS could positively impact participants by decreasing the degree of i nterference of cold symptoms on activities of daily living (Table 4 3). Since the economic burden resulting from the common cold is partly caused by a decrease in income following absences from paid employment, whether GOS could reduce interference of col d symptoms with work was of interest. Although no significant differences were observed between both, treatment groups and age groups, when focusing on the Younger Aged participants, which would be participants more likely still working and not retired, t here seems to be a trend with GOS showing a lower proportion of self reported cold days where symptoms interfered with work. A possible explanation as to why no significant differences were observed between the GOS and placebo group in regards to quality of life questions could be the questions themselves. The questions employed were adapted from the Multidimensional Assessment of Fatigue (MAF) scale and are predominantly used to measure four dimensions of fatigue rather than cold symptoms. GOS and the Im mune System To determine the mechanism by which GOS could have an effect on the probability of self reporting a cold, the ability of GOS to modulate the immune system was examined. When comparing GOS to the placebo in terms of immune parameters, we did no t observe many significant differences. Besides the increase in NK cells as a

PAGE 118

118 percentage of lymphocytes following five weeks of supplementation (Table D 1), GOS did not seem to have modified total cell numbers in terms of lymphocyte subpopulations per mic roliter of whole blood (Table 4 4). These results are consistent with previous findings where supplementation with either Bifidobacterium bifidum Bb12 or Lactobacillus acidophilus strain LA1 did not have an effect on lymphoid cell populations in periphera l blood (237) In human clinical trials, investigators are limited in their ability to obtain samples; blood and external secretions such as saliva are generally the most typical samples obtained. It is important to keep in mind that the majority of immu ne cells do not reside in the blood stream and that at any given time only 2% of total lymphocytes are circulating in the blood (238) Perhaps, what is occurring locally in the GALT is not being captured when measuring lymphocytes in the systemic circulat ion. A murine study by Gopalakrishnan and colleagues showed that GOS supplementation significantly increased the percentage of NK cells in the spleen and in the mesenteric lymph node (43) This suggests that GOS does affect lymphocytes subpopulation cell numbers in specific organ systems and that, for the time being human clinical trials are unable to provide us with such insightful information. Increas e in Immunogenic Bacteria The study by Vulevic and colleagues showed that a trans GOS mixture had signi ficant effects on the immune system of healthy aged adults demonstrated by an impr ovement in NK cell activity. T hese investigators also demonstrated that GOS significantly promoted the growth of Bifidobacterium bifidum and Bifidobacterium longum and hypot hesized that this change in the microbiota enhanced gastrointestinal tract physiological functions and subsequently the immune system (5) N o link was established between these changes in immune parameters and the probability of URTI

PAGE 119

119 To our knowledge, t his was the first prebiotic study where a correlation between changes in bifidobacteria and changes in cytokine production by PBMC s following mitogenic stimulation was investigated. As it was hypothesized that GOS was acting predominantly by altering the microbiota through an increase in bifidobacteria genome equivalents and that this was con sequently changing the cytokine production profile of immune cells it would be expected that placebo responders ( that somehow also increased by two fold their fecal bifidobacteria) and GOS responders to have similar cytokine production promoting a less inflammatory state ; but th is was not the case. W hen strictly comparing the responder participants either receiving GOS or placebo, we found that GOS responders had a significantly lower concentration of IL 5 and IL 10 following PHA stimulation of PBMC s (Table 4 5) as well as a significantly lower concentration of IL 10 following LPS stimulation of PBMCs (Table 4 6) This implies that GOS may be modifying the response to an increase in bifidobacteria or perhaps, these significant differences observed between placebo responders and GOS responders might be purely coincidental These results suggest that bifidobacteria are probably not the only players exerting their ben eficial effects and that maybe other bacterial species are also altering the microflora dependent effects and this was not captured in our study Conceivably, if we would have examined different bacte rial species that have also changed following GOS suppl ementation, we could have subdivided the groups using fold changes in these bacterial species and differences in immune parameters could have been observed A change in bifidobacteria genome equivalents seems to be a piece of the puzzle but not the whole story by itself. Administration of prebiot ics, such as oligofructose, was shown to increase lactate and

PAGE 120

120 acetate production following fermentation by lactobacilli and bifidob acteria but in turn, these SCFA can be subsequently degraded by other bacteria suc h as Anaerostipes caccae or Roseburia intestinalis both known butyrate producers (239) W the bacteria utilizing increases t tight junctions decrease translocat ion of following GOS consumption may also confer growth inhibition of pathogens in the upper respirato ry tract. Stimulation of T and B lymphocytes in the GALT by immunostimulatory bacteria will cause migration of these immune cells to related mucosal effector sites such as the trachea and bronchi and lessen the risk of bacterial infection in the lungs GO S and Digestive Health We investigated the effect of GOS on GI symptoms because the use of prebiotics has previously been associated with GI discomfort, more specifically; gas production in the gut has often been reported in human prebiotic feeding studies (240) Production of gases such as CO 2 and hydrogen is inevitable following fermentation of certain prebiotics and it is one of the major disincentives for consumption of these non digestible carbohydrates. In this present study, all participants, regar dless of their treatment group, were not bothered by GI symptoms. Participants consuming GOS had significantly lower symptoms of constipation and abdominal pain than participants consuming the placebo (Figure 4 5). These results are consistent with findi ngs from a previous study where healthy undergraduate students undergoing academic stress

PAGE 121

121 receiving either 2.5 or 5.0 g of GOS had significantly lower GI symptom scores for all symptom categories (i.e. diarrhea syndrome, constipation syndrome, abdominal sy ndrome, and indigestion) except reflux syndrome than students receiving the placebo (4) A possible explanation for the reduced abdominal pain syndrome observed with GOS supplementation may be due to their beneficial ef fect on the microbiota. P revious st udies have shown that probiotics can relieve abdominal symptoms related to abnormal colonic transit and motility. A study conducted in mice and rats demonstrated that L. acidophilus opiod and cannabinoid receptors on intestinal cells wh ich conferred analgesic effects through the upregulation of the enteric nervous system (241) The modulation of the intestinal microbiota, whether it be through the administration of probiotics or prebiotics, seems to contribute to visceral sensitivity an d gut brain interactions. A study conducted by Diop and colleagues demonstrated that administration of L. acidophilus R 52 and B. longum R 175 significantly reduced 2 stress induced GI symptoms; abdominal pain and nausea/vomiting (242) This supports the hypothesis that probiotics or modulation of the gut microbiome by prebiotics such as GOS can modulate the gut brain axis and improve gastrointestinal symptoms and visceral sensitivity. Another hypothesis as to how GOS may be indirectly modulating the i mmune system could be through increase d barrier function of the gut protecting the host against inflammation and infection. Although the tight junction s located between the epithelial cells of the GI tract were not specifically observed in our study, it i s known that butyrate production in addition to provid ing fuel for the colonocytes also suppress es expression of the transcription factor NK production of pro inflammatory

PAGE 122

122 cytokines (243) This could explain why participants in the G OS group that saw at least a two fold increase in their bifidobacteria genome equivalents had a significantly lower concentration of IL 5 and IL 8 following stimulation of peripheral blood mononuclear cells with PHA and LPS respectively (Table 4 5 and 4 6) T wo ways by which prebiotics were shown to modulate the immune system are by increasing SCFA production and increasing the numbers of immunogenic bacteria such as bifidobacteria and lactobacilli (244) Preventing Attachment of Pathogenic Bacteria Additi onally, GOS could be exhibiting their immunomodulatory potential by protecting the gut from infection through the inhibition of pathogenic bacteria attachment to the colonic epithelium. O n epithelial cells, glycoconjugates on glycoproteins and lipids perm it attachment of bacteria to the microvillus membrane. Galactooligosaccharides have similar structures to thos e glycoconjugates found on the epithelium and because they are capable of binding to bacterial receptor s, they prevent bacteria l attachment to th e GI tract. This could prevent the translocation of pathogenic bacteria to other organs (244) and may explain how GOS is positively altering the immune status of the host. How GOS through i ts Influence on Proliferation of Beneficial Bacteria within the Co lon May Affect URTI Since consumption of prebiotics can ultimately lead to an increase in bifido bacteria and these latter can interact with the immune system, it is of interest to look at the effects of these bacteria and how, synergistically with GOS, the y might de crease the incidence of URTI Winkler (245) and colleagues and de Vrese (246) and colleagues looked at mechanism s by which probiotic s may reduce the occurrence or the duration of

PAGE 123

123 respiratory tract infections and found that probiotic supplementat ion increased total cell counts per microliter of blood (when looking at the change between study day 14 and study day 0) of leukocytes, lymphocytes, CD4+ Th cells, cytotoxic CD8+ T cells and monocytes. However, when looking at the results from our study and executing either a t test or a Mann Whitney Rank Sum test when data were not normally distributed, no such results were found (Table D 1) The total lymphocytes, CD4+ Th cells, cytotoxic T cells, B cells, and NK cells were not different when looking a t the change between baseline and three weeks post supplementation as well as baseline and five weeks post supplementation. A study by Gluck et al. conducted in healthy adults demonstrated that a combination of probiotics decreased the nasal colonization o f pathogenic bacteria and this was thought to be due to stimulation of B cells and the production of antibody in the GALT and subsequent lymphocyte migration to the upper respiratory tract immune system (247) In this present study, concentration of s IgA in the saliva of participants was investigated and no difference between the two treatment groups was observed (Table 4 7). Perhaps measuring salivary sIgA concentrations on days of self reported colds, rather than at three different time points at the be ginning of the study (baseline, at vaccination and 2 weeks post vaccination) would have yielded different results. In a rodent study by Yasui and colleagues, oral administration of probiotics reduced the presence of viral titers in the nasal washing of mic e that were infected with an influenza virus suggesting that probiotics induced the activation of innate immunity in the lungs (248) The investigators hypothesized that this effect was through the observed enhancement of pulmonary NK cell activity in mic e receiving the probiotic

PAGE 124

124 Our results suggest a possible decrease in the inflammatory process in aged adu lts after supplementation with GOS although this decrease in general inflammation was not observed when looking at systemic CRP concentration levels (Table 4 7). A decrease in inflammation, more specifically the reduction in IL 6 mRNA in peripheral blood monocytes, with the use of FOS was previously observed (249) This study conducted with an elderly population showed that by modulating the microbiota and increasing bifidobacteria counts in the feces; a decrease in the inflammatory process was observed. A surprising outcome following the microbiota analysis was that a two fold increase in bifidobacteria genome equivalents was also observed in the placebo group. There were nearly as many responders in the placebo group (53%) than the GOS (60%) treatment g roup. A study by Alles et al. demonstrated the importance of a placebo and the influence of basal bifidobacteria counts on the response to non digestible carbohydrate consumption (250) These investigators conducted a study utilizing the prebiotic TOS an d the results showed no significant increase in bifidobacteria in the feces when compared to a placebo where both, the placebo and prebiotic, caused an increase in bifidobacteria. These results, although surprising, are not impossible as many factors can influence the microbiota makeup. The diet, which was not controlled for in our study, could have played a role in this bifidobacteria increase although no differences in fiber intake were captured between the two treatment groups when a food frequency que stionnaire was administered at the end of the study. This could have been a plausible explanation elucidating the increase in bifidobacteria in the placebo group. Perhaps participating in a nutritional study itself

PAGE 125

125 could have prompted participants to fol coordinators urged participants not to change usual dietary habits, this could have occurred. Davis and colleagues demonstrated that the initial levels of bifidobacteria between the responders and the non resp onders were not different and that even when GOS was administered at high doses (up to 10 g a day) for many weeks, a bifidogenic response did not occur in certain individuals (251) This is supported by a crossover study by Depeint et al. where it was dem onstrated that two GOS mixtures had different effects on the microbiota (252) It was reported that, in healthy humans, one week consumption of a GOS mixture containing mainly 1 3, as well as 1 4 and 1 6 linkages had a more bifidogenic effect than cons umption of a GOS mixture containing mainly a 1 4, as well as 1 6. This suggests that in addition to the purity of the prebiotic, the types of linkages within a prebiotic, which can vary due to the difference in enzymes sources, can also affect its utili zation by the microbiota. This might explain why some participants in the GOS group did not show a two fold increase, sometimes exhibiting a decrease, in fecal bifidobacteria genome equivalents. Limitations of the Study A limitation of this study is that no NK cell activity measurements were made. Since it was suspected that GOS exerted its immunomodulatory effects through NK cells and that Vulevic et al. showed increased NK cell activity with GOS supplementation (5) it would have been interesting to see if NK cell activity was higher in the GOS group in our aged adult population. As mentioned previously, although aging is associated with an increase in NK cell numbers, these leukocytes seem to

PAGE 126

126 exhibit lower activity levels. Additionally, when measuring relative proportions as well as total numbers of NK cells, we specifically looked at CD45+/CD3 /CD19 /CD16 56+ which are the non thymic NK cells. It would be relevant to also measure the dually labeled CD3/CD56 (i.e. NK T cells) which might have been par tly responsible for the observed effects. When categorizing responders and non responders, we decided on an arbitrary twofold increase, which was an arbitrary delineation and if we would have considered a threefold change instead, perhaps we would have obt ained different results. In fact, this twofold change was chosen because of the values of the replicate which were rarely exactly the same, so a cut off of acceptable variance was selected. Another possible explanation as to why we are not observing simi lar results to comparable GOS studies is that this was not a crossover study. A crossover study could have accounted for inter individual differences as each participant would have acted as his/her own control. Finally, Yasui and colleagues conducted a st udy in mice where, following the supplementation with a probiotic ( Bifidobacterium breve YIT4064), they saw an increase in serum anti influenza virus IgG antibodies to oral influenza vaccination (253) Since we did administer the influenza vaccine to all of our participants, it would have been interesting to look at the effects of GOS on the antibody response to the influenza vaccine by looking at antibody titers. Conclusions Galactooligosaccharides regarding the probability of self reporting a cold In this Older Aged population ( 65 years of age); participants receiving GOS had a lower probability of self reporting a cold when

PAGE 127

127 compared to Younger Aged participants in the same treatment group and IFN concentrations were also higher with GOS for Older Aged participants when compared to the placebo in the same age group In regards to NK cells, participants receiving GOS in the Older Aged group had a higher percentage of NK cells as a percentage of ly mphocytes than Younger Aged participants in the GOS group. Galactooligosaccharides supplementation had positive effects on digestive health by reducing certain symptoms of GI dysfunction. Supplementation with GOS did not have a significant effect on cold symptoms or quality of life. Additional studies are needed where the effect of GOS on different strains of bacteria should be investigated as well as functional NK cell assays. These results are very promising in terms of providing a safe alternative fo r the improvement of cellular immunity in aged adults.

PAGE 128

128 APPENDIX A IRB APPROVAL LETTER

PAGE 129

129

PAGE 130

130 APPENDIX B IRB INFORMED CONSENT

PAGE 131

131

PAGE 132

132

PAGE 133

133

PAGE 134

134

PAGE 135

135

PAGE 136

136

PAGE 137

137

PAGE 138

138

PAGE 139

139

PAGE 140

140

PAGE 141

141

PAGE 142

142 APPENDIX C QUESTIONNAIRES

PAGE 143

143

PAGE 144

144 APPENDIX D DESCRIPTIVE STATISTI CS OF PLACEBO AND GALACTOOLIGOSACCHARI DES BY AGE GROUP

PAGE 145

145 Table D 1. Descriptive statistics of placebo and galactooligosaccharides supplementation by age group Younger Aged (60 to 64 y) Older Aged (65 y or older) Placebo GOS Placebo GOS P value n 22 22 16 21 0.656 Gend er Male Female 11 11 8 14 4 12 8 13 0.474 # Cold days SI>6 1.8 0.6 1.6 0.4 2.1 0.9 0.9 0.5 T: 0.259 A: 0.787 I: 0.402 % Days when SI>6 1.1 0.4 1.0 0.3 1.3 0.6 0.6 0.3 T: 0.259 A: 0.787 I: 0.402 MNA Initial Total Score 27.3 0.5 27 .3 0.5 26.2 0.6 27.3 0.5 T: 0.264 A: 0.277 I: 0.264 % NK Draw 1 15.1 1.5 12.2 1.5 14.5 1.7 17.7 1.5 T: 0.911 A: 0.121 I: 0.055 % NK Draw 2 14.9 1.4 ab 10.6 1.4 a 13.9 1.6 a 16.3 1.4 b T: 0.510 A: 0.110 I: 0.022 % NK Draw 3 15.1 1.5 a, b 12.1 1.1 a,b 14.0 1.9 a 17.9 1.6 b T: 0.768 A: 0.129 I: 0.028 % Cytotoxic T cells Draw 1 21.5 2.1 22.3 2.1 20.2 2.4 23.0 2.1 T: 0.398 A: 0.893 I: 0.653

PAGE 146

146 Table D 1. Continued Younger Aged (60 to 64 y) Older Aged (65 y or older) Placeb o GOS Placebo GOS P value % Cytotoxic T cells Draw 2 21.8 1.9 22.3 1.9 20.1 2.3 21.8 2.0 T: 0.591 A: 0.604 I: 0.771 % Cytotoxic T cells Draw 3 21.9 1.9 20.4 1.9 19.5 2.2 21.6 1.9 T: 0.865 A: 0.770 I: 0.377 Salivary sIgA Draw 1 Mean SEM Median (25 th 75 th ) 486 111 a 495 (235, 697) 763 108 b 718 (329, 1219) 463 133 a 387 (224, 621) 796 111 b 590 (302, 1029) T: 0.011 A: 0.966 I: 0.814 Salivary sIgA Draw 2 Mean SEM Median (25 th 75 th ) 529 116 507 (1 77, 754) 717 113 570 (305, 850) 583 139 428 (234, 989) 760 116 522 (331, 923) T: 0.137 A: 0.690 I: 0.961 Salivary sIgA Draw 3 Mean SEM Median (25 th 75 th ) 525 162 576 (369, 674) 726 162 490 (173, 862) 526 193 343 (228, 786) 78 6 162 494 (309, 1120) T: 0.180 A: 0.859 I: 0.862 Fecal sIgA Baseline (ng/mg) 4567 776 3031 776 2397 918 2268 815 T: 0.315 A: 0.079 I: 0.395 Fecal sIgA Post treatment (ng/mg) 3854 666 3240 666 3027 788 2602 700 T: 0.465 A: 0.304 I: 0.89 3 CRP Draw 1 (mg/L) 3.0 0.8 2.5 0.9 4.0 1.1 3.4 0.9 T: 0.570 A: 0.326 I: 0.975 CRP Draw 2 (mg/L) 2.4 1.2 2.6 1.3 5.3 1.4 4.4 1.3 T: 0.793 A: 0.081 I: 0.662

PAGE 147

147 Table D 1. Continued Younger Aged (60 to 64 y) Older Aged (65 y or older) Plac ebo GOS Placebo GOS P value CRP Draw 3 (mg/L) 2.5 0.9 2.7 1.0 4.1 1.1 3.1 1.0 T: 0.695 A: 0.328 I: 0.576 PHA Stimulated PBMC IL 2 Draw 1 (pg/mL) 716 134 606 134 618 163 367 137 T: 0.209 A: 0.241 I: 0.624 IL 2 Draw 2 (pg/mL) 381 6 5 a 318 65 a 254 79 b 171 66 b T: 0.294 A: 0.050 I: 0.881 IL 2 Draw 3 (pg/mL) 354 62 a 306 64 a 207 75 b 158 64 b T: 0.467 A: 0.030 I: 0.991 IL 5 Draw 1 (pg/mL) 199 43 104 43 161 51 125 44 T: 0.152 A: 0.857 I: 0.522 IL 5 Draw 2 (pg/mL) 16 8 35 83 35 145 41 98 36 T: 0.077 A: 0.915 I: 0.604 IL 5 Draw 3 (pg/mL) 141 31 81 31 142 36 115 31 T: 0.180 A: 0.586 I: 0.607 IL 10 Draw 1 (pg/mL) 199 31 230 31 214 36 187 31 T: 0.941 A: 0.665 I: 0.378 IL 10 Draw 2 (pg/mL) 223 28 215 28 194 32 194 28 T: 0.875 A: 0.387 I: 0.886

PAGE 148

148 Table D 1. Continued Younger Aged (60 to 64 y) Older Aged (65 y or older) Placebo GOS Placebo GOS P value IL 10 Draw 3 (pg/mL) 245 39 276 39 201 45 231 39 T: 0.455 A: 0.278 I: 0.993 I FN (pg/mL) 15751 1887 a 11224 1887 ab 9404 2233 b 13938 1887 ab T: 0.999 A: 0.362 I: 0.025 IFN (pg/mL) 12007 1557 a 10892 1557 a 6044 1842 b 9780 1557 b T: 0.425 A: 0.033 I: 0.142 IFN (pg/mL) 16673 2213 a 11958 2213 ab 6026 2556 b 12268 2160 ab T: 0.740 A: 0.027 I: 0.019 LPS Stimulated PBMC IL (pg/mL) 3565 353 2743 336 3061 394 2809 344 T: 0.138 A: 0.542 I: 0.428 IL (pg/mL) 4382 424 a 3009 404 b 3349 474 a 2727 414 b T: 0.023 A: 0.130 I: 0.385 IL (pg/mL) 3982 370 2941 362 2946 414 2952 362 T: 0.175 A: 0.178 I: 0.170 IL 6 Draw 1 (pg/mL) 27943 3144 22496 3144 28957 3687 26226 3218 T: 0.220 A: 0.475 I: 0.682 IL 6 Draw 2 (pg/mL) 27258 2591 a 21643 2 591 b 29775 3038 a 23912 2652 b T: 0.038 A: 382 I: 0.964

PAGE 149

149 Table D 1. Continued Younger Aged (60 to 64 y) Older Aged (65 y or older) Placebo GOS Placebo GOS P value IL 6 Draw 3 (pg/mL) 29054 3088 24886 3160 29567 3621 26546 3160 T: 0.274 A: 0 .740 I: 0.861 IL 8 Draw 1 (pg/m L ) 177378 24331 126191 25519 170339 29466 176022 26182 T: 0.392 A: 0.421 I: 0.286 IL 8 Draw 2 (pg/mL ) 195799 21250 125553 22287 156728 25735 164094 22866 T: 0.178 A: 0.991 I: 0.097 IL 8 Draw 3 (pg/mL ) 1575 99 20562 143279 22126 165808 24902 173457 22126 T: 0.882 A: 0.396 I: 0.627 IL 10 Draw 1 (pg/mL) 247 39 239 39 337 46 298 40 T: 0.564 A: 0.071 I: 0.716 IL 10 Draw 2 (pg/mL) 265 30 a 207 30 a 335 36 b 272 31 b T: 0.063 A: 0.038 I: 0.929 IL 10 Draw 3 (pg/mL) 270 57 299 58 405 66 347 58 T: 0.810 A: 0.132 I: 0.466 TNF (pg/mL) 4188 482 a 2401 482 b 3794 565 a 2794 493 b T: 0.007 A: 0.999 I:0.440 TNF (pg/mL) 3367 395 a 2050 395 b 2797 463 a 1368 404 b T: 0.001 A: 0.136 I: 0.893 TNF (pg/mL) 3426 464 a 2306 475 b 2908 544 a 1841 475 b T: 0.029 A: 0.320 I:0.958

PAGE 150

150 LIST OF REFERENCES 1. Nunes K. An ounce of prevention. Products promoting immune system support are gaining traction. Food Business News: Sosland Publishing Co.; 2010. 2. Brownawell AM, Caers W, Gibson GR, Kendall CW, Le wis KD, Ringel Y, Slavin JL. Prebiotics and the health benefits of fiber: current regulatory status, future research, and goals. J Nutr. 2012;142:962 74. 3. Macfarlane G, Steed H, Macfarlane S. Bacterial metabolism and health related effects of galacto oli gosaccharides and other prebiotics. J Appl Microbiol. 2008;104:305 44. 4. Hughes C, Davoodi Semiromi Y, Colee JC, Culpepper T, Dahl WJ, Mai V, Christman MC, Langkamp Henken B. Galactooligosaccharide supplementation reduces stress induced gastrointestinal d ysfunction and days of cold or flu: a randomized, double blind, controlled trial in healthy university st udents. Am J Clin Nutr. 2011 ;93:1305 11. 5. Vulevic J, Drakoularakou A, Yaqoob P, Tzortzis G, Gibson G. Modulation of the fecal microflora profile and immune function by a novel trans galactooligosaccharide mixture (B GOS) in healthy elderly volu nteers. Am J Clin Nutr. 2008 ;88:1438 46. 6. Macfarlane S, Macfarlane G, Cummings J. Review article: prebiotics in the gastrointestinal tract. Ali ment Pharmacol T her. 2006 ;24:701 14. 7. Lamsal BP. Production, health aspects and potential food uses of dairy prebiotic galactooligosacchar ides. J Sci Food Agric. 2012 8. Nutrition G. Galactooligosaccharide GRAS Notice. Golden; 2009. 9. Angus F, Smart S, Shortt C. Prebi otic ingredients with emphasis on galacto oligosaccharides and fructo oligosaccharides: Oxford: Blackwell Publishing; 2005. 10. Torres DPM, Goncalves MPF, Teixeira JA, Rodrigues LR. Galacto Oligosaccharides: Production, Properties, Applications, and Signif icance as Prebiotics. Comprehensice Reviews in Food Science and Food Safety. 2010;9:438 54. 11. Charalampopoulos D, Rastall RA. Prebiotics and Probiotics: Springer; 2009. 12. EUROPA. European Union Register of nutrition and Health claims made on food:rejec ted health claims;2010. 2010 [cited 2012 05 03]; Available from: http://ec.europa.eu/nuhclaims/?event=search&status_ref_id=5

PAGE 151

151 13. Drakoularakou A, Tzortzis G, Rastall RA, Gibson GR. A double blind, placebo controlled, randomized human study assessing the capacity of a novel galacto oligosaccharide mixture in reducing travellers' diar rhoea. Eur J Clin Nutr. 2010 ;64:146 52. 14. Moro E. Morphologische und bakterogische untersuchungen uber die Dambakterien des Sauglings: die bacterium flora des normalen frauen milch stuhls. Jahb Kinderheilkd. 1900:686 734. 15. Harmsen HJ, Wildeboer Veloo AC, Raangs GC, Wagendorp AA, Klijn N, Bindels JG, Welling GW. Analysis of intestinal flora development in breast fed and formula fed infants by using molecular identification an d detection methods. J Pedi atr Gastroenterol Nutr. 2000 ;30:61 7. 16. Boehm G, Stahl B, Jelinek J, Knol J, Miniello V, Moro GE. Prebiotic carbohydrates in human milk and formula s. Acta Paediatr Suppl. 2005 ;94:18 21. 17. Haarman M, Knol J. Quantitative real time PCR assays to identify and quantify fecal Bifidobacterium species in infants receiving a prebiotic infant formula. Appl Environ Microbiol. 2005 ;71:2318 24. 18. Ito M, Deguchi Y, Miyamori A, Matsumote K, Kikuchi H, Matsumoto K, Yajima T, Kan T. Effects of administration of galactooligosaccharides on the human faecal microflora, stool weigh and abdominal sensation. Microb Ecol Health Dis. 1990;3:285 92. 19. Ito M, Deguchi Y, Matsumoto K, Kimura M, Onodera N, Yajima T. Influence of galactooligosaccharides on the human fecal microflora. J Nutr Sci Vitaminol (Tokyo). 1993 ;39:635 40. 20. Malinen E, Mtt J, Salmitie M, Alander M, Saarela M, Palva A. PCR ELISA II: Analysis of Bifidobacterium populations in human faecal samples from a consumption trial with Bif idobacterium lactis Bb 12 and a galacto oligosaccharide preparatio n. Syst Appl Microbiol. 2002 ;25:249 58. 21. Bouhnik Y, Flouri B, D'Agay Abensour L, Pochart P, Gramet G, Durand M, Rambaud JC. Administration of transgalacto oligosaccharides increases feca l bifidobacteria and modifies colonic fermentation metabolism in healthy humans. J Nutr. 1997 ;127:444 8. 22. Chonan O, Shigehara Sone H, Takahashi R, Ikeda M, Kikuchi Hayakawa H, Ishikawa F, Kimura K, Matsumoto K. Undigestibility of Galactooligosaccharides Journal of the Japanese Society for Food Science and Technology. 2004;51:28 33. 23. Revicki DA, Wood M, Wiklund I, Crawley J. Reliability and validity of the Gastrointestinal Symptom Rating Scale in patients with gastroesophageal reflux disease. Qual Lif e Res. 1998 ;7:75 83.

PAGE 152

152 24. Deguchi Y, Matsumoto K, Ito A, Watanuki M. Effects of b1 4 galacto oligosaccharides administration on defecation of healthy volunteers with constipation tendency. Jpn J Nutr. 1997;55:13 22. 25. Teuri U, Korpela R. Galacto oligosacc harides relieve constipation in elderly people. Ann Nutr Metab. 1998;42:319 27. 26. Bronner F. Calcium absorption -a paradigm for mine ral absorption. J Nutr. 1998 ;128:917 20. 27. Chonan O, Matsumoto K, Watanuki M. Effect of galactooligosaccharides on calci um absorption and preventing bone loss in ovariectomized rats. Bio sci Biotechnol Biochem. 1995 ;59:236 9. 28. Chonan O, Watanuki M. Effect of galactooligosaccharides on calcium absorption in rats. J Nutr Sci Vitaminol (Tokyo). 1995 ;41:95 104. 29. Chonan O, Watanuki M. The effect of 6' galactooligosaccharides on bone mineralization of rats adapted to different levels of dietary calcium. Int J Vitam Nutr Res. 1996;66:244 9. 30. Chonan O, Takahashi R, Watanuki M. Role of activity of gastrointestinal microflora in absorption of calcium and magnesium in rats fed beta1 4 linked galactooligosaccharides. Bio sci Biotechnol Biochem. 2001 ;65:1872 5. 31. van den Heuvel EG, Schaafsma G, Muys T, van Dokkum W. Nondigestible oligosaccharides do not interfere with calcium and nonheme iron absorption in young, healt hy men. Am J Clin Nutr. 1998 ;67:445 51. 32. van den Heuvel E, Schoterman M, Muijs T. Transgalactooligosaccharides stimulate calcium absorption in postme nopausal women. J Nutr. 2000 ;130:2938 42. 33. Demigne C, Remesy C, Morand C. Short Chain Fatty Acids. In: G.R. G, M.B. R, editors. Colonic Microbiota, Nutrition and Health. The Netherlands: Springer; 1999. p. 312. 34. Delzenne NM, Cani PD, Neyrinck AM. Prebiotics and Lipid Metabolism. Therapeutic Microbiology: Probiot ics and Related Strategies: ASM Press; 2008. p. 183 92. 35. Fiordaliso M, Kok N, Desager JP, Goethals F, Deboyser D, Roberfroid M, Delzenne N. Dietary oligofructose lowers triglycerides, phospholipids and cholesterol in serum and very low density lipopr ote ins of rats. Lipids. 1995 ;30:163 7.

PAGE 153

153 36. van Dokkum W, Wezendonk B, Srikumar TS, van den Heuvel EG. Effect of nondigestible oligosaccharides on large bowel functions, blood lipid concentrations and glucose absorption in young healthy male sub jects. Eur J Cl in Nutr. 1999 ;53:1 7. 37. Schley PD, Field CJ. The immune enhancing effects of dietary fibres and prebiotics. Br J Nutr. 2002 ;87 Suppl 2:S221 30. 38. Langkamp Henken B, Glezer JA, Kudsk KA. Immunologic structure and function of the gastrointestinal tract. Nutr Clin Pract. 1992 ;7:100 8. 39. Gropper SAS, Smith JL, Groff JL. Advanced nutrition and human metabolism. 5th ed. Australia ; United States: Wadsworth/Cengage Learning; 2009. 40. Kruh J, Defer N, Tichonicky L. Effects of butyrate on cell proliferation a nd gene expression. In: J.H. C, J.L. R, T. S, editors. Physiological and Clinical Aspects of Short Chain Fatty Acids. Cambridge: Cambridge University Press; 1995. p. 275 88. 41. Cavaglieri CR, Nishiyama A, Fernandes LC, Curi R, Miles EA, Calder PC. Differe ntial effects of short chain fatty acids on proliferation and production of pro and anti inflammatory cytokines by cultured lymphocytes. Life Sci. 2003 ;73:1683 90. 42. Nam KT, O'Neal R, Lee YS, Lee YC, Coffey RJ, Goldenring JR. Gastric tumor development i n Smad3 deficient mice initiates from forestomach/glandular transition zone along the lesser curvature. Lab Invest. 2012 43. Gopalakrishnan A, Clinthorne JF, Rondini EA, McCaskey SJ, Gurzell EA, Langohr IM, Gardner EM, Fenton JI. Supplementation with Gala cto Oligosaccharides Increases the Percentage of NK Cells and Reduces Colitis Severity in Smad3 Deficient Mice. J Nutr. 2012 44. Shoaf K, Mulvey GL, Armstrong GD, Hutkins RW. Prebiotic galactooligosaccharides reduce adherence of enteropathogenic Escherich ia coli to tissue cultu re cells. Infect Immun. 2006 ;74:6920 8. 45. Scheppach W, Weiler F. The butyrate story: old wine in new bottles? Curr Opin Clin Nutr Metab Care. 2004 ;7:563 7. 46. Hernot DC, Boileau TW, Bauer LL, Middelbos IS, Murphy MR, Swanson KS, F ahey GC. In vitro fermentation profiles, gas production rates, and microbiota modulation as affected by certain fructans, galactooligosaccharides, and polydextr ose. J Agric Food Chem. 2009 ;57:1354 61. 47. Nurmi JT, Puolakkainen PA, Rautonen NE. Bifidobacte rium Lactis sp. 420 up regulates cyclooxygenase (Cox) 1 and down regulates Cox 2 gene expression in a Caco 2 cell culture model. Nutr Cancer. 2005;51:83 92.

PAGE 154

154 48. Fund WCR. Food, Nutrition and the prevention of cancer: a global perspective. Wahington, DC: Wo rld Cancer research Fund; 1997. 49. Fuchs CS, Giovannucci EL, Colditz GA, Hunter DJ, Stampfer MJ, Rosner B, Speizer FE, Willett WC. Dietary fiber and the risk of colorectal cancer and adenoma in women. N Engl J Med. 1999 ;340:169 76. 50. Boutron Ruault MC, Marteau P, Lavergne Slove A, Myara A, Gerhardt MF, Franchisseur C, Bornet F, Group ES. Effects of a 3 mo consumption of short chain fructo oligosaccharides on parameters of colorectal carcinogenesis in patients with or without small or large colorectal ade nomas. Nutr Cancer. 2005;53:160 8. 51. Rafter J, Bennett M, Caderni G, Clune Y, Hughes R, Karlsson PC, Klinder A, O'Riordan M, O'Sullivan GC, et al. Dietary synbiotics reduce cancer risk factors in polypectomized and colon cancer pa tients. Am J Clin Nutr. 2007 ;85:488 96. 52. Limburg PJ, Mahoney MR, Ziegler KL, Sontag SJ, Schoen RE, Benya R, Lawson MJ, Weinberg DS, Stoffel E, et al. Randomized phase II trial of sulindac, atorvastatin, and prebiotic dietary fiber for colorectal cancer chemoprevention. C ancer Prev Res (Phila). 2011 ;4:259 69. 53. Heikkinen T, Jrvinen A. T he common cold. Lancet. 2003 ;361:51 9. 54. Adams PF, Hendershot GE, Marano MA, Statistics CfDCaPNCfH. Current estimates from the National Health Interview Survey, 1996 Vital Health Stat 10. 19 99 :1 203. 55. Monto AS. Epidemiology of viral respirator y infections. Am J Med. 2002 ;112 Suppl 6A:4S 12S. 56. Diseases NIoAaI. The Common Cold Overview. Health & Research A to Z [cited 2012 05 07]; Available from: http://www.niaid.nih.gov/topics/commonCo ld/Pages/overview.aspx 57. Arroll B. Common cold. Clin Evid (Online). 2011;2011. 58. Shah SA, Sander S, White CM, Rinaldi M, Coleman CI. Evaluation of echinacea for the prevention and treatment of the common cold: a meta analy sis. Lancet Infect Dis. 2007 ;7 :473 80. 59. Monto AS, Sullivan KM. Acute respiratory illness in the community. Frequency of illness and the agents invo lved. Epidemiol Infect. 1993 ;110:145 60. 60. Gonzales R, Malone DC, Maselli JH, Sande MA. Excessive antibiotic use for acute respiratory infections in the United S tates. Clin Infect Dis. 2001 ;33:757 62. 61. National Health Care Quality Report 2008. 2008:77 85.

PAGE 155

155 62. Immunization and Infectious Diseases. Healthy People 2020 Summary of Objective 2012 [cited 2012 March 15th]; Available from: http://healthypeople.gov/2020/topicsobjectives2020/objectiveslist.aspx?topicId=23 63. Prior L, Evans MR, Prout H. Talking about colds and flu: the lay diagnosis of two common illnesses among older Briti sh people. Soc Sci Med. 2011 ;73:922 8. 64. Barrett B, Brown RL, Mundt MP, Thomas GR, Barlow SK, Highstrom AD, Bahrainian M. Validation of a short form Wisconsin Upper Respiratory Symptom Survey (WURSS 21). Health Qual Life Outcomes. 2009;7:76. 65. Barrett B, Brown R, Mundt M, Safdar N, Dye L, Maberry R, Alt J The Wisconsin Upper Respiratory Symptom Survey is responsive, reliable, and valid. J Clin Epid emiol. 2005 ;58:609 17. 66. Jackson GG, Dowling HF, Spiesman IG, Boand AV. Transmission of the common cold to volunteers under controlled conditions. I. The comm on cold as a clinical entit y. AMA Arch Intern Med. 1958 ;101:267 78. 67. Barrett B, Brown R, Voland R, Maberry R, Turner R. Relations among questionnaire and laboratory measures of rhinovirus i nfection. Eur Respir J. 2006 ;28:358 63. 68. Kirscht JP. Social a nd psychological problems of surveys on health an d illness. Soc Sci Med. 1971 ;5:519 26. 69. Takkouche B, Regueira C, Gestal Otero JJ. A cohort study of stress and the com mon cold. Epidemiology. 2001 ;12:345 9. 70. Turner RB, Bauer R, Woelkart K, Hulsey TC, Gangemi JD. An evaluation of Echinacea angustifolia in experimental rhinovirus in fections. N Engl J Med. 2005 ;353:341 8. 71. Cohen S, Tyrrell DA, Smith AP. Psychological stress and susceptibility to the com mon cold. N Engl J Med. 1991 ;325:606 12. 72. Macin tyre S, Pritchard C. Comparisons between the self assessed and observer assessed presence and severity of colds. Soc Sci Med. 1989;29:1243 8. 73. Albers R, Antoine JM, Bourdet Sicard R, Calder PC, Gleeson M, Lesourd B, Samartn S, Sanderson IR, Van Loo J, et al. Markers to measure immunomodulation in human nutrition intervent ion studies. Br J Nutr. 2005 ;94:452 81. 74. Beisel WR, Edelman R, Nauss K, Suskind RM. Single nutrient effects on immunologic functions. Report of a workshop sponsored by the Department of Food and Nutrition and its nutrition advisory group of the American Med ical Association. JAMA. 1981 ;245:53 8.

PAGE 156

156 75. Scrimshaw NS, SanGiovanni JP. Synergism of nutrition, infection, and immunity: an ov erview. Am J Clin Nutr. 1997 ;66:464S 77S. 76. Percival SS. Neutropenia caused by copper deficiency: possible mechanis ms of action. Nutr Rev. 1995 ;53:59 66. 77. Babu U, Failla ML. Copper status and function of neutrophils are reversibly depressed in marginally and severely copper deficient rats. J Nutr. 1990 ;1 20:1700 9. 78. Yetgin S, Altay C, Ciliv G, Laleli Y. Myeloperoxidase activity and bactericidal function of PMN in iron deficiency. Acta Haematol. 1979;61:10 4. 79. Ross AC. Vitamin A deficiency and retinoid repletion regulate the antibody response to bacte rial antigens and the maintenance of natural killer cells. Cli n Immunol Immunopathol. 1996 ;80:S63 72. 80. Adachi N, Migita M, Ohta T, Higashi A, Matsuda I. Depressed natural killer cell activity due to decreased natural killer cell population in a vitamin E deficient patient with Shwachman syndrome: reversible natural killer cell abnormality by alpha tocopherol suppleme ntation. Eur J Pediatr. 1997 ;156:444 8. 81. Lesourd BM. [Immunologic aging. Effect of denutrition]. Ann Biol Clin (Paris). 1990;48:309 18. 8 2. Lesourd BM. Nutrition and immunity in the elderly: modification of immune responses with nutritional trea tments. Am J Clin Nutr. 1997 ;66:478S 84S. 83. Guigoz Y. The Mini Nutritional Assessment (MNA) review of the literature -What does it tell us? J Nutr Health Aging. 2006 ;10:466 85; discussion 85 7. 84. Hudgens J, Langkamp Henken B, Stechmiller JK, Herrlinger Garcia KA, Nieves C. Immune function is impaired with a mini nutritional assessment score indicative of malnutrition in nursing home elders with pr essure ulcers. JPEN J Parenter Enteral Nutr. 2004 ;28:416 22. 85. Cunningham Rundles S, Lin DH. Nutrition and the immune system of the g ut. Nutrition. 1998 ;14:573 9. 86. Gross RL, Newberne PM. Role of nutrition in immunolo gic function. Physiol Rev. 1980 ;60: 188 302. 87. Lpez Varela S, Gonzlez Gross M, Marcos A. Functional foods and the immune system: a r eview. Eur J Clin Nutr. 2002 ;56 Suppl 3:S29 33. 88. Roberfroid MB. Prebiotics and probiotics: are they functional foods? Am J Clin Nutr. 2000 ;71:1682S 7S; d iscussion 8S 90S.

PAGE 157

157 89. D'Agostino RB, Weintraub M, Russell HK, Stepanians M, Cantilena LR, Graumlich JF, Maldonado S, Honig P, Anello C. The effectiveness of antihistamines in reducing the severity of runny nose and sneezing: a meta analysis. Clin Pharmacol Ther. 1998 ;64:579 96. 90. Taverner D, Latte GJ. WITHDRAWN: Nasal decongestants for the common cold. Cochrane Database Syst Rev. 2009:CD001953. 91. Nahin RL, Barnes PM, Stussman BJ, Bloom B. Costs of Complementary and Alternative Medicine (CAM) and Frequen cy of Visits to CAM Practitioners: United States, 2007: Division of Health Interview Statistics; 2009. 92. Kaufman DW, Kelly JP, Rosenberg L, Anderson TE, Mitchell AA. Recent patterns of medication use in the ambulatory adult population of the United State s: the Slone survey. JAMA. 2002 ;287:337 44. 93. Huntley AL, Thompson Coon J, Ernst E. The safety of herbal medicinal products derived from Echinacea species: a systematic review. Drug Saf. 2005;28:387 400. 94. Goel V, Lovlin R, Chang C, Slama JV, Barton R, Gahler R, Bauer R, Goonewardene L, Basu TK. A proprietary extract from the echinacea plant (Echinacea purpurea) enhances systemic immune response during a comm on cold. Phytother Res. 2005 ;19:689 94. 95. Woelkart K, Xu W, Pei Y, Makriyannis A, Picone RP, B auer R. The endocannabinoid system as a target for alkamides from Echinacea angustif olia roots. Planta Med. 2005 ;71:701 5. 96. Gertsch J, Schoop R, Kuenzle U, Suter A. Echinacea alkylamides modulate TNF alpha gene expression via cannabinoid receptor CB2 an d multiple signal transducti on pathways. FEBS Lett. 2004 ;577:563 9. 97. Hemil H. Vitamin C supplementation and respiratory infections: a syst ematic review. Mil Med. 2004 ;169:920 5. 98. Grimble RF. Effect of antioxidative vitamins on immune function with c linical applications. Int J Vitam Nutr Res. 1997;67:312 20. 99. Simasek M, Blandino DA. Treatment of the common cold. Am Fam Physician. 2007 ;75:515 20. 100. Douglas RM, Hemil H, Chalker E, Treacy B. Vitamin C for preventing and treating the common cold. C ochrane Database Syst Rev. 2007:CD000980. 101. Hoyles L, Vulevic J. Diet, immunity and functional foods. Adv Exp Med Biol. 2008;635:79 92.

PAGE 158

158 102. Nahas R, Balla A. Complementary and alternative medicine for prevention and treatment of the common c old. Can Fa m Physician. 2011 ;57:31 6. 103. Turner RB, Wecker MT, Pohl G, Witek TJ, McNally E, St George R, Winther B, Hayden FG. Efficacy of tremacamra, a soluble intercellular adhesion molecule 1, for experimental rhinovirus infection: a randomize d clinical trial. J AMA. 1999 ;281:1797 804. 104. Novick SG, Godfrey JC, Godfrey NJ, Wilder HR. How does zinc modify the common cold? Clinical observations and implications regarding mechanisms of action. Med Hypotheses. 1996 ;46:295 302. 105. Godfrey JC. Zinc for the common co ld. Antim icrob Agents Chemother. 1988 ;32:605 6. 106. Zarembo JE, Godfrey JC, Godfrey NJ. Zinc(II) in saliva: determination of concentrations produced by different formulations of zinc gluconate lozenges containing common e xcipients. J Pharm Sci. 1992 ;81:128 30. 107. Mossad S, Macknin M, Medendorp S, Mason P. Zinc gluconate lozenges for treating the common cold. A randomized, double blind, placebo controlled study. Ann Intern Med. 1996 ;125:81 8. 108. Smith DS, Helzner EC, Nuttall CE, Collins M, Rofman BA, Ginsberg D, Goswick CB, Magner A. Failure of zinc gluconate in treatment of acute upper respiratory tract infections. Antim icrob Agents Chemother. 1989 ;33:646 8. 109. Belongia EA, Berg R, Liu K. A randomized trial of zinc nasal spray for the treatment of upper respiratory illne ss in adults. Am J Med. 2001 ;111:103 8. 110. Mossad SB. Effect of zincum gluconicum nasal gel on the duration and symptom severity of the common cold in otherwi se healthy adults. QJM. 2003 ;96:35 43. 111. Science M, Johnstone J, Ro th DE, Guyatt G, Loeb M. Zinc for the treatment of the common cold: a systematic review and meta analysis of randomized c ontrolled trials. CMAJ. 2012 112. Graat JM, Schouten EG, Kok FJ. Effect of daily vitamin E and multivitamin mineral supplementation on acute respiratory tract infections in elderly persons: a randomized controlled trial. JAMA. 2002 ;288:715 21. 113. Rivlin RS. Historical perspective on the use of garlic. J Nutr. 2001 ;131:951S 4S. 114. Reinhart KM, Talati R, White CM, Coleman CI. The impac t of garlic on lipid parameters: a systematic review and meta analysis. Nutr Res Rev. 2009 ;22:39 48.

PAGE 159

159 115. Fleischauer AT, Poole C, Arab L. Garlic consumption and cancer prevention: meta analyses of colorectal and stomach c ancers. Am J Clin Nutr. 2000 ;72:10 47 52. 116. Ngo SN, Williams DB, Cobiac L, Head RJ. Does garlic reduce risk of colorectal cancer? A sys tematic review. J Nutr. 2007 ;137:2264 9. 117. Cavallito CJ, Bailey JH. Allicin, the Antibacterial Principle of Allium sativum. I. Isolation, Physical Pro perties and Antibacterial Action. Journal of the American Chemical Society. 1944;66:1950 1. 118. Weber ND, Andersen DO, North JA, Murray BK, Lawson LD, Hughes BG. In vitro virucidal effects of Allium sativum (garlic) extract and compounds. Planta Med. 1992 ;58:417 23. 119. Staba EJ, Lash L, Staba JE. A commentary on the effects of garlic extraction and formulation on produ ct composition. J Nutr. 2001 ;131:1118S 9S. 120. Ruddock PS, Liao M, Foster BC, Lawson L, Arnason JT, Dillon JA. Garlic natural health prod ucts exhibit variable constituent levels and antimicrobial activity against Neisseria gonorrhoeae, Staphylococcus aureus and Enterococcus f aecalis. Phytother Res. 2005 ;19:327 34. 121. Lawson LD, Wang ZJ, Papadimitriou D. Allicin release under simulated gas trointestinal conditions from garlic powder tablets employed in clinical trials on serum c holesterol. Planta Med. 2001 ;67:13 8. 122. Lissiman E, Bhasale AL, Cohen M. Garlic for the common cold. Cochrane Database Syst Rev. 2012;3:CD006206. 123. Josling P. P reventing the common cold with a garlic supplement: a double blind, placebo controlled sur vey. Adv Ther. 2001 ;18:189 93. 124. World Health Organization. WHO monographs on selected medicinal plants. Geneva: World Health Organization; 1999. 125. Nantz MP, Ro we CA, Muller CE, Creasy RA, Stanilka JM, Percival SS. T cell function and reduces the severity of cold and flu symptoms: A randomized, double blind, placebo controlled nutrition intervention Clin Nutr. 2012 126. Marteau P, Boutron Ruault MC. Nutritional advantages of probiotics and prebiotics. Br J Nutr. 2002 ;87 Suppl 2:S153 7. 127. K ollath W. [Nutrition and the tooth system; general review with special reference to vitamins]. Dtsch Zahnarz tl Z. 1953 ;8:Suppl 7 16.

PAGE 160

160 128. Reid G, Sanders ME, Gaskins HR, Gibson GR, Mercenier A, Rastall R, Roberfroid M, Rowland I, Cherbut C, Klaenhammer TR. New scientific paradigms for probiotics and prebiotics J Clin Gastroenterol. 2003 ;37:105 18. 129. Hao Q, L u Z, Dong BR, Huang CQ, Wu T. Probiotics for preventing acute upper respiratory tract infections. Cochrane Database Syst Rev. 2011:CD006895. 130. Tschernia A, Moore N, Abi Hanna A. Effects of long term supplementation of a weaning food supplemented with ol igofructose, a prebiotic, on general infant health status. J Pediatr Gastroenterol Nutr. 1999;29. 131. Bruzzese E, Volpicelli M, Salvini F, Bisceglia M, Lionetti P, Cinquetti M, Iacono G, Guarino A. Early administration of GOS/FOS prevents intestinal and r espiratory infections in infants. Journal of Pediatric Gastroenterology and Nutrition. 2006;42. 132. Langkamp Henken B, Bender BS, Gardner EM, Herrlinger Garcia KA, Kelley MJ, Murasko DM, Schaller JP, Stechmiller JK, Thomas DJ, Wood SM. Nutritional formula enhanced immune function and reduced days of symptoms of upper respiratory tract infection in sen iors. J Am Geriatr Soc. 2004 ;52:3 12. 133. Population Division D. World Population Ageing: 1950 2050. United Nations; 2010. 134. Alho OP, Karttunen TJ, Karttu nen R, Tuokko H, Koskela M, Uhari M. Lymphocyte and mast cell counts are increased in the nasal mucosa in symptomatic natural c olds. Clin Exp Immunol. 2003 ;131:138 42. 135. Wat D. The common cold: a review of the literature. Eur J I ntern Med. 2004 ;15:79 88 136. High KP. Nutritional strategies to boost immunity and prevent infection in elderly indivi duals. Clin Infect Dis. 2001 ;33:1892 900. 137. Meydani SN, Leka LS, Fine BC, Dallal GE, Keusch GT, Singh MF, Hamer DH. Vitamin E and respiratory tract infection s in elderly nursing home residents: a randomized controlled trial. JAMA. 2004 ;292:828 36. 138. Nicholson KG, Kent J, Hammersley V, Cancio E. Risk factors for lower respiratory complications of rhinovirus infections in elderly people living in the communit y: prospec tive cohort study. BMJ. 1996 ;313:1119 23. 139. Cummings J, Antoine J, Azpiroz F, Bourdet Sicard R, Brandtzaeg P, Calder P, Gibson G, Guarner F, Isolauri E, et al. PASSCLAIM -gut health and immunity. Eur J N utr. 2004 ;43 Suppl 2:II118 II73. 140. Ki ndt TJ, Goldsby RA, Osborne BA, Kuby J. Kuby immunology. 6th ed. New York: W.H. Freeman; 2007.

PAGE 161

161 141. Sompayrac L. How the immune system works. 2nd ed. Malden, Mass.: Blackwell Pub.; 2003. 142. Walrand S, Moreau K, Caldefie F, Tridon A, Chassagne J, Portefai x G, Cynober L, Beaufrre B, Vasson MP, Boirie Y. Specific and nonspecific immune responses to fasting and refeeding differ in healthy young adult and elderly p ersons. Am J Clin Nutr. 2001 ;74:670 8. 143. Gabay C, Kushner I. Acute phase proteins and other s ystemic responses to infl ammation. N Engl J Med. 1999 ;340:448 54. 144. Tillett WS, Francis T. Serological reactions in pneumonia with a non protein somatic fraction of p neumococcus. J Exp Med. 1930 ;52:561 71. 145. Williamson S, Munro C, Pickler R, Grap MJ, Elswick RKJ. Comparison of Biomarkers in Blood and Saliva in Healthy Adults. Nursing Research and Practice. 2012;2012:1 4. 146. Gardner EM, Murasko DM. Age related changes in Type 1 and Type 2 cytokine production in humans. Biogerontology. 2002;3:271 90. 147. De Groote D, Zangerle PF, Gevaert Y, Fassotte MF, Beguin Y, Noizat Pirenne F, Pirenne J, Gathy R, Lopez M, Dehart I. Direct stimulation of cytokines (IL 1 beta, TNF alpha, IL 6, IL 2, IFN gamma and GM CSF) in whole blood. I. Comparison with isolated P BMC stimulation. Cytokine. 1992 ;4:239 48. 148. Agrawal A, Agrawal S, Cao JN, Su H, Osann K, Gupta S. Altered innate immune functioning of dendritic cells in elderly humans: a role of phosphoinositide 3 kinase signal ing pathway. J Immunol. 2007 ;178:6912 22. 149. Guha M, Mackman N. LPS induction of gene expression in human monocytes. Cell Signal. 2001 ;13:85 94. 150. Demas GE, Zysling DA, Beechler BR, Muehlenbein MP, French SS. Beyond phytohaemagglutinin: assessing vertebrate immune function across ecological contexts. J Anim Ecol. 2011 151. McHugh S, Deighton J, Rifkin I, Ewan P. Kinetics and functional implications of Th1 and Th2 cytokine production following activation of peripheral blood mononuclear cells in primary culture. Eur J Immunol. 1996 ;26:1260 5. 152. Rittig MG, Kaufmann A, Robins A, Shaw B, Sprenger H, Gemsa D, Foulongne V, Rouot B, Dornand J. Smooth and rough lipopolysaccharide phenotypes of Brucella induce different intracellular trafficking and cytokine/chemokine release in human mo nocytes. J L eukoc Biol. 2003 ;74:1045 55.

PAGE 162

162 153. Ligthart GJ, Corberand JX, Geertzen HG, Meinders AE, Knook DL, Hijmans W. Necessity of the assessment of health status in human immunogerontological studies: evaluation of the SENIEUR pro tocol. Mech Ageing Dev. 1990 ;55:89 105. 154. Rink L, Cakman I, Kirchner H. Altered cytokine production in the el derly. Mech Ageing Dev. 1998 ;102:199 209. 155. Ershler WB, Sun WH, Binkley N, Gravenstein S, Volk MJ, Kamoske G, Klopp RG, Roecker EB, Daynes RA, Weindruch R. Interleukin 6 and ag ing: blood levels and mononuclear cell production increase with advancing age and in vitro production is modifiable by dietary restriction. Lymphokine Cytokine Res. 199 3 ;12:225 30. 156. Gill HS, Rutherfurd KJ, Cross ML. Dietary probiotic supplementation en hances natural killer cell activity in the elderly: an investigation of age related immunological changes. J Clin Immunol. 2001 ;21:264 71. 157. Schiffrin E, Morley J, Donnet Hughes A, Guigoz Y. The inflammatory status of the elderly: The intestinal c ontrib ution. Mutat Res. 2009 158. Franceschi C, Bonaf M, Valensin S, Olivieri F, De Luca M, Ottaviani E, De Benedictis G. Inflamm aging. An evolutionary perspective on immunosenesc ence. Ann N Y Acad Sci. 2000 ;908:244 54. 159. Salminen A, Huuskonen J, Ojala J, Kauppinen A, Kaarniranta K, Suuronen T. Activation of innate immunity system during aging: NF kB signaling is the molecular culprit of inflamm aging. Ag eing Res Rev. 2008 ;7:83 105. 160. Lesourd BM, Mazari L, Ferry M. The role of nutrition in immunity in th e aged. Nutr Rev. 1998 ;56:S113 25. 161. Lesourd BM, Meaume S. Cell mediated immunity changes in ageing, relative importance of cell subpopulation switches and of nutritional factors. Immunol Lett. 1994 ;40:235 42. 162. Steinmann GG. Changes in the human thy mus during aging. Curr Top Pathol. 1986;75:43 88. 163. Wick G, Grubeck Loebenstein B. Primary and secondary alterations of immune reactivity in the elderly: impact of dietary factors an d disease. Immunol Rev. 1997 ;160:171 84. 164. Cakman I, Rohwer J, Scht z RM, Kirchner H, Rink L. Dysregulation between TH1 and TH2 T cell subpopulations in the el derly. Mech Ageing Dev. 1996 ;87:197 209. 165. Saltzman RL, Peterson PK. Immunodeficiency of the elderly. R ev Infect Dis. 1987 ;9:1127 39.

PAGE 163

163 166. Chen WH, Kozlovsky BF, Effros RB, Grubeck Loebenstein B, Edelman R, Sztein MB. Vaccination in the elderly: an immunological perspective. Trend s Immunol. 2009 ;30:351 9. 167. Lesourd BM, Mazari L. Immune responses during recovery from protein energy m alnutrition. Clin Nutr. 1997 ;1 6 Suppl 1:37 46. 168. Gillis S, Kozak R, Durante M, Weksler ME. Immunological studies of aging. Decreased production of and response to T cell growth factor by lymphocytes from aged humans. J Clin Invest. 1981 ;67:937 42. 169. Trinchieri G. Biology of natur al killer cells. Adv Immunol. 1989;47:187 376. 170. Shaw AC, Joshi S, Greenwood H, Panda A, Lord JM. Aging of the innate immune sys tem. Curr Opin Immunol. 2010 ;22:507 13. 171. Krishnaraj R, Blandford G. Age associated alterations in human natural killer ce lls. 2. Increased frequency of selective NK subsets. Cell Immunol. 1988 ;114:137 48. 172. Moens E, Veldhoen M. Epithelial barrier biology: good fences make good neighbours. Immunology. 2012 ;135:1 8. 173. Bjarnason I, MacPherson A, Hollander D. Intestinal pe rmeability: an over view. Gastroenterology. 1995 ;108:1566 81. 174. Bovee Oudenhoven IM, Lettink Wissink ML, Van Doesburg W, Witteman BJ, Van Der Meer R. Diarrhea caused by enterotoxigenic Escherichia coli infection of humans is inhibited by dietary cal cium. Gastroenterology. 2003 ;125:469 76. 175. Mestecky J, Russell MW. Specific antibody activity, glycan heterogeneity and polyreactivity contribute to the protective activity of S IgA at mucosal surfaces. Immunol Lett. 2009 ;124:57 62. 176. Murphy K, Travers P, Walport M, Janeway C. Janeway's immunobiology. 8th ed. New York: Garland Science; 2012. 177. Brandtzaeg P. Mechanisms of gastrointestinal reactions to food. Env iron Toxicol Pharmacol. 1997 ;4:9 24. 178. Milling SW, Cousins L, MacPherson GG. How do DCs inte ract with intestinal a ntigens? Trends Immunol. 2005 ;26:349 52. 179. Bron PA, van Baarlen P, Kleerebezem M. Emerging molecular insights into the interaction between probiotics and the host intestinal muc osa. Nat Rev Microbiol. 2012 ;10:66 78.

PAGE 164

164 180. Brandtzaeg P, Farstad IN, Johansen FE, Morton HC, Norderhaug IN, Yamanaka T. The B cell system of human mucosae and exocri ne glands. Immunol Rev. 1999 ;171:45 87. 181. Laissue JA, Gebbers JO. The intestinal barrier and the gut associated lymphoid tissue. Curr Stud He matol Blood Transfus. 1992:19 43. 182. van der Waaij LA, Limburg PC, Mesander G, van der Waaij D. In vivo IgA coating of anaerobic bacteri a in hu man faeces. Gut. 1996 ;38:348 54. 183. Boullier S, Tanguy M, Kadaoui KA, Caubet C, Sansonetti P, Corthsy B, Phalipon A. Secretory IgA mediated neutralization of Shigella flexneri prevents intestinal tissue destruction by down regulating inflammato ry circuits. J Immunol. 2009 ;183:5879 85. 184. Isaacs D, Webster AD, Valman HB. Immunoglobulin levels and functi on in pre school children with recurrent respiratory infect ion s. Clin Exp Immunol. 1984 ;58:335 40. 185. Malin M, Suomalainen H, Saxelin M, Isolauri E. Promotion of IgA immune response in patients with Crohn's disease by oral bacteriotherapy with Lactob acillus GG. Ann Nutr Metab. 1996;40:137 45. 186. Sekirov I, Russell SL, Antunes LC, Finlay BB. Gut microbiota in health an d disease. Physiol Rev. 2010 ;90:859 904. 187. Neish AS. Microbes in gastrointestinal health and di sease. Gastroenterology. 2009 ;136:65 80. 188. Kuby J. Immunology. 3rd edition (February 1997) ed. New York: W H Freeman & Co (Sd); 1997. 189. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, Gill SR, Nelson KE, Relman DA. Diversity of the human intestinal microbia l flora. Science. 2005 ;308:1635 8. 190. Huurre A, Kalliomki M, Rautava S, Rinne M, Salminen S, Isolauri E. Mode of delivery effects on gut microbiota and humoral immunity. Neonatology. 2008;93:236 40. 191. Penders J, Thijs C, Vink C, Stelma FF, Snij ders B, Kummeling I, van den Brandt PA, Stobberingh EE. Factors influencing the composition of the intestinal microbiota in ear ly infancy. Pediatrics. 2006 ;118:511 21. 192. Khachatryan ZA, Ktsoyan ZA, Manukyan GP, Kelly D, Ghazaryan KA, Aminov RI. Pred ominant role of host genetics in controlling the composition of gut microbiota. PLoS One. 2008;3:e3064.

PAGE 165

165 193. De Filippo C, Cavalieri D, Di Paola M, Ramazzotti M, Poullet JB, Massart S, Collini S, Pieraccini G, Lionetti P. Impact of diet in shaping gut micr obiota revealed by a comparative study in children from Europe and rural Africa. Pr oc Natl Acad Sci U S A. 2010 ;107:14691 6. 194. Tiihonen K, Ouwehand AC, Rautonen N. Human intestinal microbiota and healthy ageing. Ageing Res Rev. 20 10 ;9:107 16. 19 5. Zoetendal EG, Ben Amor K, Akkermans AD, Abee T, de Vos WM. DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal trac t. Syst Appl Microbiol. 2001 ;24:405 10. 196. Hooper LV. Do sym biotic bacteria subvert host immun ity? Nat Rev Microbiol. 2009 ;7:367 74. 197. Hofer U, Speck RF. Disturbance of the gut associated lymphoid tissue is associated with disease progression in chronic HIV infecti on. Semin Immunopathol. 2009 ;31:257 66. 198. Svedlund J, Sjdin I, Dotevall G. GSRS -a clinical rating scale for gastrointestinal symptoms in patients with irritable bowel syndrome and peptic ulce r dis ease. Dig Dis Sci. 1988 ;33:129 34. 199. Eypasch E, Williams JI, Wood Dauphinee S, Ure BM, S chmlling C, Neugebauer E, Troidl H. Gastrointestinal Quality of Life Index: development, validation and application of a new instrument. Br J Surg. 1995 ;82:216 22. 200. Kulich KR, Madisch A, Pacini F, Piqu JM, Regula J, Van Rensburg CJ, Ujszszy L, C arlsson J, Halling K, Wiklund IK. Reliability and validity of the Gastrointestinal Symptom Rating Scale (GSRS) and Quality of Life in Reflux and Dyspepsia (QOLRAD) questionnaire in dyspepsia: a six country study. Health Qual Life Outcomes. 2008;6:12. 201. Kleinman L, Kilburg A, Machnicki G, Faull R, Walker R, Prasad R, Ambuehl P, Bahner U, Margolis MK. Using GI specific patient outcome measures in renal transplant patients: validation of the GSRS an d GIQLI. Qual Life Res. 2006 ;15:1223 32. 202. Dimens E Carlsson G, Glise H, Israelsson B, Wiklund I. Relevance of norm values as part of the documentation of quality of life instruments for use in upper gastrointestinal disease. Scand J Gastroenterol Suppl. 1996;221:8 13. 203. Kolida S, Tuohy K, Gibson GR. P rebiotic effects of inulin and ol igofructose. Br J Nutr. 2002 ;87 Suppl 2:S193 7. 204. Hentges DJ. Human intestinal microflora in health and disease. New York: Academic Press; 1983.

PAGE 166

166 205. Cummings JH, Macfarlane GT. Colonic microflora: nutrition and heal th. Nutrition. 1997 ;13:476 8. 206. Bouhnik Y, Raskine L, Simoneau G, Vicaut E, Neut C, Flouri B, Brouns F, Bornet F. The capacity of nondigestible carbohydrates to stimulate fecal bifidobacteria in healthy humans: a double blind, randomized, placebo c ontrolled, parallel group, dose response relation study. Am J Clin Nutr. 2004 ;80:1658 64. 207. Thomson AB. Small intestinal disorders in the elderly. Best Pract Res Clin Gastroenterol. 2009;23:861 74. 208. Mitsuoka T. Bifidobacteria and their role in h uman health. J Ind Microbiol. 1990:263 7. 209. Maukonen J, Mtt J, Kajander K, Mattila Sandholm T, Saarela M. Diversity and temporal stability of fecal bacterial populations in elderly subjects consuming galacto oligosaccharide containing probiotic yogurt Int Dairy J. 2008:386 95. 210. Hopkins MJ, Sharp R, Macfarlane GT. Age and disease related changes in intestinal bacterial populations assessed by cell culture, 16S rRNA abundance, and community cellular fa tt y acid profiles. Gut. 2001 ;48:198 205. 211 He T, Harmsen HJM, Raangs GC, Welling GW. Composition of faecal microbiota of elderly people. Microb Ecol Health Dis. 2003;15:153 9. 212. Gu Q, Dillon CF, Burt VL. Prescription drug use continues to increase: U.S. prescription drug data for 2007 2008. Hy attsville, MD; 2010. 213. Guggenheimer J, Moore PA. Xerostomia: etiology, recognition and trea tment. J Am Dent Assoc. 2003 ;134:61 9; quiz 118 9. 214. Lhteenmki MT, Salo MS, Tenovuo JO, Helminen AV, Vilja PJ, Huupponen RK. The effects of glycopyrrolat e on oral mucous host defenses in healthy vo lunteers. Anesth Analg. 2000 ;91:467 72. 215. Williams C, McColl KE. Review article: proton pump inhibitors and bacterial overgrowth. Aliment Pharmacol Ther. 2 006 ;23:3 10. 216. Woodmansey EJ. Intestinal ba cteria and ag eing. J Appl Microbiol. 2007 ;102:1178 86. 217. Aaronson PI, McKinnon W, Poston L. Mechanism of butyrate induced vasorelaxation of rat mesenteric resistance artery. Br J Pharm acol. 1996 ;117:365 71.

PAGE 167

167 218. Dass NB, John AK, Bassil AK, Crum bley CW, Shehee WR, Maurio FP, Moore GB, Taylor CM, Sanger GJ. The relationship between the effects of short chain fatty acids on intestinal motility in vitro and GPR43 receptor activation. Ne urogastroenterol Motil. 2007 ;19:66 74. 219. Suzuki T, Yoshid a S, Hara H. Physiological concentrations of short chain fatty acids immediately suppress colonic epithelial p ermeability. Br J Nutr. 2008 ;100:297 305. 220. Yu LC, Wang JT, Wei SC, Ni YH. Host microbial interactions and regulation of intestinal epithel ial barrier function: From physiology to pathology. World J Gas trointest Pathophysiol. 2012 ;3:27 43. 221. Born J, Uthgenannt D, Dodt C, Nnninghoff D, Ringvolt E, Wagner T, Fehm HL. Cytokine production and lymphocyte subpopulations in aged humans. An a ssessment during nocturnal sleep. Mech Ageing Dev. 1995 ;84:113 26. 222. Lio D, D'Anna C, Gervasi F, Scola L, Potestio M, Di Lorenzo G, List F, Colombo A, Candore G, Caruso C. Interleukin 12 release by mitogen stimulated mononuclear cells in the elderl y. Mech Ageing Dev. 1998 ;102:211 9. 223. Beharka AA, Meydani M, Wu D, Leka LS, Meydani A, Meydani SN. Interleukin 6 production does not increase with age. J Geron tol A Bio l Sci Med Sci. 2001 ;56:B81 8. 224. Candore G, Di Lorenzo G, Melluso M, Cigna D, Colucci AT, Modica MA, Caruso C. gamma Interferon, interleukin 4 and interleukin 6 in vitro production in old subjects. Autoimmunity. 1993;16:275 80. 225. Fagiolo U, Cossarizza A, Scala E, Fanales Belasio E, Ortolani C, Cozzi E, Monti D, Franceschi C, P aganelli R. Increased cytokine production in mononuclear cells of healthy elderly people. Eur J Immunol. 1993 ;23:2375 8. 226. Llorente L, Richaud Patin Y, Alvarado C, Vidaller A, Jakez Ocampo J. Autoantibody production in healthy elderly people is not promoted by interleukin 10 although this cytokine is expressed in them by a peculiar CD8+CD3+ large granular cell subpopul ation. Scand J Immunol. 1997 ;45:401 7. 227. Nmeth G. Health related quality of life outcome in struments. Eur Spine J. 2006 ;15 Suppl 1:S44 51. 228. Morley JE. Assessment of malnutrition in older persons: a focus on the Mini Nutritional Assessmen t. J Nutr Health Aging. 2011 ;15:87 90. 229. Gad SC. In vitro toxicology. 2nd ed. New York: Taylor & Francis; 2000. 230. Siebert JC, W alker EB. Monitoring cytokine profiles during immuno therapy. Immunotherapy. 2010 ;2:799 816.

PAGE 168

168 231. Gleeson M. Mucosal immune responses and risk of respiratory illness in elite athletes. Exerc Immunol Rev. 2000;6:5 42. 232. McNerlan SE, Alexander HD, Rea IM. Age related reference intervals for lymphocyte subsets in whole blood of healthy individuals. S cand J Clin Lab Invest. 1999 ;59:89 92. 233. Jiao Y, Qiu Z, Xie J, Li D, Li T. Reference ranges and age related changes of peripheral blood lymphocyte sub sets in Chinese healthy adults Sci China C Life Sci. 2009 ;52:643 50. 234. Holma R, Kekkonen RA, Hatakka K, Poussa T, Vaarala O, Adlercreutz H, Korpela R. Consumption of Galactooligosaccharides Together with Probiotics Stimulate the in vitro Peripheral Healthy M en. ISRN Immunology. 2011 235. Bunout D, Hirsch S, Pa de la Maza M, Muoz C, Haschke F, Steenhout P, Klassen P, Barrera G, Gattas V, Petermann M. Effects of prebiotics on the immu ne response to vaccination in the elderly. JPEN J Parenter Enteral Nutr. 2002 ;26:372 6. 236. Arunachalam K, Gill HS, Chandra RK. Enhancement of natural immune function by dietary consumption of Bifidobacterium lactis (HN019). Eur J Clin Nutr. 2000 ;54:263 7. 237. Schiffrin EJ, Rochat F, Link Amster H, Aeschlimann JM, Donnet Hughes A. Immunomodulation of human blood cells following the ingestion of lactic acid bacteria. J Dairy Sci. 1995 ;78:491 7. 238. Calder PC. Immunological parameters: wha t do they me an? J Nutr. 2007 ;137:773S 80S. 239. Falony G, Vlachou A, Verbrugghe K, De Vuyst L. Cross feeding between Bifidobacterium longum BB536 and acetate converting, butyrate producing colon bacteria during growth on oligofructose. Appl Environ Microbiol. 2006 ;72:7835 41. 240. Cummings JH, Macfarlane GT. Gastrointestinal effects of prebiotics. Br J Nutr. 2002 ;87 Suppl 2:S145 51. 241. Rousseaux C, Thuru X, Gelot A, Barnich N, Neut C, Dubuquoy L, Dubuquoy C, Merour E, Geboes K, et al. Lact obacillus acidophilus modulates intestinal pain and induces opioid and cannabin oid receptors. Nat Med. 2 007 ;13:35 7. 242. Diop L, Guillou S, Durand H. Probiotic food supplement reduces stress induced gastrointestinal symptoms in volunteers: a double bl ind, placebo controlled, rand omized trial. Nutr Res. 2008 ;28:1 5.

PAGE 169

169 243. Inan MS, Rasoulpour RJ, Yin L, Hubbard AK, Rosenberg DW, Giardina C. The luminal short chain fatty acid butyrate modulates NF kappaB activity in a human colonic epithelial cell line Gast roenterology. 2000 ;118:724 34. 244. Sangwan V, Tomar SK, Singh RR, Singh AK, Ali B. Galactooligosaccharides: novel components of desi gner foods. J Food Sci. 2011 ;76:R103 11. 245. Winkler P, de Vrese M, Laue C, Schrezenmeir J. Effect of a diet ary supplement containing probiotic bacteria plus vitamins and minerals on common cold infections and cellular immune parameters. Int J Clin Pharmacol Ther. 2005 ;43:318 26. 246. de Vrese M, Winkler P, Rautenberg P, Harder T, Noah C, Laue C, Ott S, Hamp e J, Schreiber S, et al. Effect of Lactobacillus gasseri PA 16/8, Bifidobacterium longum SP 07/3, B. bifidum MF 20/5 on common cold episodes: a double blind, randomized, contr olled trial. Clin Nutr. 2005 ;24:481 91. 247. Glck U, Gebbers JO. Ingested pr obiotics reduce nasal colonization with pathogenic bacteria (Staphylococcus aureus, Streptococcus pneumoniae, and beta hemolytic strepto cocci). Am J Clin Nutr. 2 003 ;77:517 20. 248. Yasui H, Kiyoshima J, Hori T. Reduction of influenza virus titer and pr otection against influenza virus infection in infant mice fed Lactobacillus casei Shirota. Clin Diagn Lab Immunol. 2004 ;11:675 9. 249. Guigoz Y, Rochat F, Perruisseau Carrier G, Rochat I, Schiffrin EJ. Effects of oligosaccharide on the faecal flora and non specific immune system in elderly people Nutrition Research. 2002:13 25. 250. Alles MS, Hartemink R, Meyboom S, Harryvan JL, Van Laere KM, Nagengast FM, Hautvast JG. Effect of transgalactooligosaccharides on the composition of the human intestinal mic roflora and on putative risk markers for colon cancer. Am J C lin Nutr. 1999 ;69:980 91. 251. Davis LM, Martnez I, Walter J, Hutkins R. A dose dependent impact of prebiotic galactooligosaccharides on the intestinal microbiota of healthy adults. Int J Fo od Microbiol. 2010 ;144:285 92. 252. Depeint F, Tzortzis G, Vulevic J, I'anson K, Gibson GR. Prebiotic evaluation of a novel galactooligosaccharide mixture produced by the enzymatic activity of Bifidobacterium bifidum NCIMB 41171, in healthy humans: a r andomized, double blind, crossover, placebo controlled intervention study. Am J Clin Nutr. 2008 ;87:785 91. 253. Yasui H, Kiyoshima J, Hori T, Shida K. Protection against influenza virus infection of mice fed Bifidobacterium breve YIT4064. Clin Diagn La b Immunol. 1999 ;6:186 92.

PAGE 170

170 BIOGRAPHICAL SKETCH Stephanie Anne Girard was born in Montreal, Canada in 1982 where she has resided most of her life. After completing her high school education with honors, she attended McGill University for her undergra duate studies. She finished her Bachelor of Science degree in microbiology and immunology in April 2005. After working in the pharmacy field for two years, she decided to pursue her education and obtained her rtment of Medicine at Universit de Montral. At that time, her main research focus was the effects of prob iotics on post myocardial infarction depression. More specifically, her interest was the kinetic of biochemical and physiological cerebral changes following a myocardial infarction Her exposure to the probiotic field served as a platform to her current research topic; prebiotics. She received her doctorate from the College of Agricultural and Life Sciences in the summer of 2012, focusing on oligosaccharides and their effect on mucosal immunity and health outcomes.