The Role of the Maize Genes Mini-Me and Grass in Establishing Plant Architecture

MISSING IMAGE

Material Information

Title:
The Role of the Maize Genes Mini-Me and Grass in Establishing Plant Architecture
Physical Description:
1 online resource (83 p.)
Language:
english
Creator:
Tan, Sharon C
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Molecular and Cellular Biology
Committee Chair:
Vermerris, Willem Wilfred
Committee Members:
Koch, Karen E
Mccarty, Donald R
Soltis, Pamela S
Mcdaniel, Stuart

Subjects

Subjects / Keywords:
grass -- maize -- mini-me -- uniformmu
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre:
Plant Molecular and Cellular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The maize UniformMu population is a large population of mutants induced by the highly mutagenic Mutator (Mu) transposable element system. The uniformity in the genetic background was achieved by recurrent backcrossing of a Mutator line to inbredline W22. Mutator elements transpose to unlinked sites in the genome. The mutants mini-me and grass were identified from a screen of the UniformMu population. Both mutants are extreme dwarfs, lack a main stem, and form multiple tillers. The mini-me mutant is slightly larger than the grass mutant. Under some conditions, the mini-me mutant will form hermaphrodite floral structures that are, however, not fertile. Both mutant phenotypes are inherited in a manner consistent with a single recessive mutation. The purpose of this research was to 1) investigate the causal mutation(s) in the maize mini-me and grass mutants and 2) use microscopic analysis to analyze in detail the morphological and anatomical features of the mutants. Since Mutator insertions were the most likely cause of the mini-me and grass mutations, the methods MuTAIL and Mu-454 were used to generate libraries of Muflanking regions from mini-me and grass. A total of 65 sequences were tested for co-segregation with the mutant phenotypes, but none of the unique sequences tested co-segregated. Given the phenotypic similarities, crosses to test for allelism between grass and mini-me were performed. The tiller formation in the mutants appears to be caused by the formation of multiple meristems post-embryogenesis. The small size of the mutant plants is caused by a smaller number of cells, rather than by reduced cell size. Detailed analysis of the leaves revealed that the regular patterning observed in the epidermis of the wild-type maize leaves is disrupted in both mutants. In addition, abnormalities in the differentiation of the vascular bundles, bundle sheaths cells and leaf parenchyma cells in the leaves were observed. Based on these complex phenotypes of both mutants, the grass and mini-me genes are hypothesized to be involved in meristem development and/or cell differentiation.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Sharon C Tan.
Thesis:
Thesis (M.S.)--University of Florida, 2012.
Local:
Adviser: Vermerris, Willem Wilfred.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044374:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 THE ROLE OF THE MAIZE GENES MINI ME AND GRASS IN ESTABLISHING PLANT ARCHITECTURE By SHARON TAN CHENG SZE A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS F OR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 S haron Tan Cheng Sze

PAGE 3

3 In memory of my grandmother

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisor Dr. Wilfred Vermerris for his patience, wisdom, and knowledge to gui de me in my learning experience. To my c ommittee members : Dr. Karen Koch, Dr.Don McCarty, Dr. Pamela Soltis, and Dr. Stuart McDaniel for their guidance and advice. I would like to thank past and current members of the Vermerris lab Dr. Ana Saballos, Timot hy Foster Annie Greene, and Randi Wheeler, Dr. Chip Hunter from the Koch lab for the help in generating and analyzing the Mu library for the mutants Frederico Martin from the Settles lab for their help in generating the SNP results from the grass F2 popu lation Forestry lab for allowing me to use their microscope, and Dr. Maria Gallo for allowing me to access her lab to use plant incubator and microscope. I also would like to express my gratitude t o my family and friends for their emotional and financial support I am grateful to the Plant Molecular and Cellular Biology Graduate Program for financial support.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF T ABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 GENETICS AND PHYSIOLOGY OF PLANT GROWTH AND DEVELOPMENT .... 12 Introduction ................................ ................................ ................................ ............. 12 Embryogenesis ................................ ................................ ................................ ....... 13 Phytohormones ................................ ................................ ................................ ....... 15 Auxin ................................ ................................ ................................ ................ 15 Gibberelli n (GA) ................................ ................................ ................................ 17 Cytokinin (CK) ................................ ................................ ................................ .. 18 Brassinosteroids ................................ ................................ ............................... 19 Strigolactones ................................ ................................ ................................ ... 20 Genetic Control of Plant Height ................................ ................................ .............. 21 Genetic Control of Branching and Tillering ................................ ............................. 22 Mutagenesis and Transposable Elements ................................ .............................. 24 Mechanism of Transposition ................................ ................................ ............. 25 The Major Transposable Element Systems in Maiz e ................................ ....... 26 Ac/Ds ................................ ................................ ................................ ......... 26 En/Spm ................................ ................................ ................................ ...... 26 Mutator ................................ ................................ ................................ ....... 27 Research Objectives ................................ ................................ ........................ 28 2 PHENOTYPIC CHARACTERIZATION OF THE MINI ME AND GRASS MUTANTS ................................ ................................ ................................ .............. 30 Introducti on ................................ ................................ ................................ ............. 30 Variation in Embryo Structure ................................ ................................ ........... 30 Variation in Seed Germination ................................ ................................ .......... 31 Variation in Leaf Morphology ................................ ................................ ............ 31 Materials and Methods ................................ ................................ ............................ 31 Plant Material ................................ ................................ ................................ ... 31 Epidermal Peel ................................ ................................ ................................ 32 Formalin Acetic Acid Alcohol (FAA) fixation ................................ ..................... 32 Infiltrating and Embedding Tissues Paraffin/TBA met hod ............................... 32

PAGE 6

6 Sectioning and Staining ................................ ................................ .................... 33 Microscopy ................................ ................................ ................................ ....... 33 Results ................................ ................................ ................................ .................... 34 Variation in Seed Germination ................................ ................................ .......... 34 Variation in Leaf Morphology ................................ ................................ ............ 35 Leaf Blade Dimensions ................................ ................................ .............. 35 Epidermal Peel ................................ ................................ ........................... 35 Cross Sections of the Leaf Blade and Midrib ................................ ............. 36 Cross section of the Meristems ................................ ................................ ........ 36 Discussion ................................ ................................ ................................ .............. 37 3 MOLECULAR GENETIC ANALYSIS AIMED AT CLONING THE MINI ME AND GRASS G ENES ................................ ................................ ................................ ...... 49 Introduction ................................ ................................ ................................ ............. 49 Materials and methods ................................ ................................ ............................ 50 DNA Extraction ................................ ................................ ................................ 50 Plant Material ................................ ................................ ................................ ... 51 Mu TAIL ................................ ................................ ................................ ............. 52 Mu 454 Sequencing ................................ ................................ ......................... 52 Co segregation Analysis ................................ ................................ ................... 53 SSR Analysis ................................ ................................ ................................ .... 53 Allelism Test ................................ ................................ ................................ ..... 54 Results ................................ ................................ ................................ .................... 54 Molecular Analysis of Flanking Sequences Identifed with Mu TAIL and Mu 454 ................................ ................................ ................................ ................ 54 Mapp ing Population ................................ ................................ .......................... 55 ................................ ................................ ................................ .... 55 ................................ ................................ ................................ .... 58 ................................ ................................ ................................ ..... 58 Discussion ................................ ................................ ................................ .............. 59 4 DISCUSSION AND RECOMMENDATIONS FOR FUTURE WORK ....................... 66 APPENDIX: FIGURES AND PRIMERS ................................ ................................ ... 68 LIST OF REFERENCES ................................ ................................ ............................... 74 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 83

PAGE 7

7 LIST OF TABLE S Table page 2 1 Stomatal density within 1x1 mm 2 in mini me, grass and W22 leaf blades .......... 48 3 1 Number of flanking sequence in each chromosome and primers that were tested ................................ ................................ ................................ .................. 64 3 2 mini me and grass for 2011 winter greenhouse, Gainesville, FL with the numbers designating plant number ................................ ................................ .... 65 A 1 Nested Mu primers used to amplify adjacent DNA segments ............................. 68 A 2 Co segregation primers for Mini me ................................ ................................ ... 68 A 3 Co segregation primers for Grass ................................ ................................ ...... 71

PAGE 8

8 LIST OF FIGURE S Figure page 1 1 Known Arabidopsis dwarf mutants affecting the GA biosynthesis pathway ....... 29 1 2 Phenotype of maize grass and mini me mutants. ................................ ............... 29 2 1 Seedlings growth. ................................ ................................ .............................. 40 2 2 A family segregating for grass (S2007:212 S2) 13 DAP. ................................ .... 40 2 3 Seedlings of mini me and grass ................................ ................................ ........ 41 2 4 Front vie w of mini me and grass grown in the winter greenhouse 2011, Gainesville, FL. ................................ ................................ ................................ ... 41 2 5 Comparison of leaf blade size of wild type (W22), mini me and grass. ............. 42 2 6 Translucent sections in the leaf blades of mini me and grass mutants. ............. 42 2 7 Epidermal imprints from leaf blades of wild type, mini me, and grass mutants. ................................ ................................ ................................ ............. 43 2 8 Epidermal imprints stained with Toluidine Blue from wild type, mini me and grass mutants.. ................................ ................................ ................................ ... 44 2 9 Flowering mini me with three hybrid floral structures displaying both branchless male and female characteristics.. ................................ ..................... 45 2 10 Floral structure of mini me A) Close up of the floral structure.. .......................... 45 2 11 Cross section of midrib, leaf blade and meristem. ................................ ............. 46 2 12 mini me epidermal peel stained with Toluidine Blue. ................................ ......... 47 2 13 grass epidermal peel stained with Toluidine blue. ................................ ............. 47 3 1 Schematic representation of the expected result ................................ ................ 62 3 2 Mapping population of mini me and grass ................................ .......................... 62 3 3 Schematic representation of the procedure to make the allelism cross between grass and mini me and the expected outcome ................................ ... 63 3 4 Schematic representation of the allelism cross in the winter 2011 greenhouse, Gainesville, FL ................................ ................................ ............... 63 A 1 Adaxial of wild type,W22, showing p urple stained bulliform cells ....................... 68

PAGE 9

9 LIST OF ABBREVIATIONS DAP Days After Planting DNA Deoxyribonucleic A cid dsDNA Double stranded DNA FAA Formalin Acetic Acid Alcohol FAD Flavin Adenine Dinucleotide NADPH Nicotinamide Adenine Dinucleotide P hosphate PCR Polymerase Chain Reaction SNP Single Nucleotide Polymorphism SSR Simple Sequence Repeat TAIL Thermal Asymmetric Interlaced

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Master of Science THE ROLE OF THE MAIZE GENES MINI ME AND GRASS IN ESTABLISHING PLANT ARCHITECTURE By Sharon Tan Cheng Sze August 2012 Chair: Wilfred Vermerris Major: Plant Molecular and Cellular Biolog y The maize Uniform Mu population is a large population of mutants induced by the highly mutagenic Mutator ( Mu ) transposable element system. The uniformity in the genetic background was achieved by recurrent backcrossing of a Mutator line to inbred line W2 2. Mutator elements transpose to unlinked sites in the genome. The mutants mini me and grass were identified from a screen of the Uniform Mu population Both mutants are extreme dwarfs lack a main stem and form multiple tillers. The mini me mutant is slig htly larger than the grass mutant Under some conditions, the mini me mutant will form hermaphrodite floral structures that are, however not fertile. Both mutant phenotypes are inherited in a manner consistent wi th a single recessive mutation. The purpos e of this research was to 1) investigate the causal mutation(s) in the maize mini me and grass mutants and 2) use microscopic analysis to analyze in detail the morphological and anatomical features of the mutants. Since Mutator insertions were the most l ike l y cause of the mini me and grass mutations, the methods Mu TAIL and Mu 454 were used to generate libraries of Mu flanking regions from mini me and grass A total of 65 sequences were tested for co

PAGE 11

11 segregation with the mutant phenotypes, but none of the unique sequences tested co segregated Given the phenotypic similarities, crosses to test for allelism between grass and mini me were performed. The tiller formation in the mutants appears to be caused by the formation of multiple meristems post embryogene sis. The small size of the mutant plants is cause d by a smaller number of cells, rather than by reduced cell size. Detailed analysis of the leaves revealed that the regular patterning observed in the epidermis of the wild type maize leaves is disrupted in both mutants. In addition, abnormalities in the differentiation of the vascular bundles, bundle sheaths cells and leaf parenchyma cells in the leaves were observed. Based on these complex phenotypes of both mutants, the G rass and M ini me genes are hypoth esized to be involved in meristem development and/or cell differentiation.

PAGE 12

12 CHAPTER 1 GENETICS AND PHYSIOLOGY OF PLANT GROWTH AND DEVELOPMENT Introduction Popul ation growth, climate change, and the need for alternative fuels from plants as oil supplies are expected to dwindle have put pressure on agricultural production systems. These developments will require rapid adaptations to plant composition, metabolism, and architecture so that plants can continue to provide food, feed, fuel, fiber, and medicines ( St icklen, 2008 ) Progress in plant biology has increased significantly due to advances in technology, including the ability to sequence whole plant genomes, with Arabidopsis ( Arabidopsis Genome Initiative, 2000 ), rice (Goff et al. 2002; Yu et al. 2002), po plar (Tuskan et al. 2006), maize (Schnable et al. 2009), and sorghum (Paterson et al. 2009) representing several key plant genomes Additional resources include B rachypodium distachyon (The International Brachypodium initiative, 2010), grapevine (Jaillo n et al. 2007), cucumber (Huang et al. 2009) and strawberry (Shulaev et al. 2011), as part of a growing list With these new resources, scientists are able to more efficiently relate gene sequence to gene function, and to identify gene networks involved in complex metabolic and developmental processes. With the increased knowledge of plant development and its genetic control, we have the ability to modify plants so that food and biomass production can be optimized. For example biomass production may be enhanced by reducing grain production or grain production may be enhanced by reducing biomass production Modification of plant architecture can also increase the ability to capture photosynthetically active radiation (PAR) (Fourcaud et al. 2008). The gra in yield of maize ( Zea mays L.) has continued to increase over time, in part due to its tolerance to high planting density. This

PAGE 13

13 required adaptation of plant architecture, specifically the leaf angle, which is evidenced by the more erect leaves of modern m aize hybrids (Zhu et al. 2010) G rowing food crops for biofuels is not sustainable in the long run, due to the need to produce more food for a growing population, while widespread hunger in developing countries creates ethical concerns about the use of fo od crops for the production of fuels (Tenenbaum, 2008 ). A possible way to meet the increased demand for bio fuels is the use of vegetative residues such as corn stover for the production of cellulosic biofuels. In addition, cellulosic biofuels can be prod uced from biomass crops grown on land that is not sui t able. for the production of food crops. Cellulosic fuels are produced from the unused portion of a plant such as corn stover, sugarcane bagasse or from dedicated biomass crops such as miscanthus and s witc hgrass. The biomass is collected and delivered to a biofuel plant, pretreated with heat and chemicals to make cellulose acce ssible to enzymes, hydrolytic enzymes then break down the sugars and microbes ferment the sugars into ethanol. The ethanol is d istilled and distributed for use (Sticklen, 2008). Crop plants such as rice, wheat, and maize have been bred mostly for enhanced grain yield, while biomass yield and composition have not been taken into much consideration. For example, rice has good grai n yield but is low in biomass yield (Jahn et al. 2011). A better understanding of plant development and its genetic control may lead to crops tha t can simultaneously meet the increasing demand for food and fuel. Embryogenesis Seed formation in flowering plants results from sexual fertilization of the haploid megagametophyte (female) by a haploid microgametophyte (male) produced in the flowers of mature plants. Fertilization results in the formation of an embryo and

PAGE 14

14 endosperm with the full complement of ch romosomes. Two main phases can be identified during plant embryo development. First, the basic cellular patterning of the root and shoot body are formed, followed by post embryonic development involving embryonic cell growth as well as storage of starch, o ils, and proteins for the embryo, which are needed during germination and the early seedling stage (Goldberg et al ., 1994) An initial asymmetric division of the diploid embryo results in a small apical cell and a large basal cell. After this first divisio n, the cells divide along random planes with establishment of the radial axis and bilateral symmetry ( West et al. 1993 Wang et al. 2008 ). Most of the seed is taken up by the endosperm which is formed from two polar nuclei in the c entral cell of the emb ryo sac and one sperm nucleus to generate a triploid (3n) tissue (Oh ad et al. 1996) containing starch and storage proteins. The maize embryo is located on the adaxial side of the endosperm. Once the body plan has been established and important storage res erves have been accumulated, the embryo will go into developmental arrest until germination Embryo and seed development are very complex processes and involve the coordinate expression of many genes. Consequently, if the function of any of these genes is disrupted, the embryo may not form properly. Studying the phenotype of the mutants in which genes involved in embryo development that do not function properly can reveal the normal function of these genes. Examples of this approach led to the identificatio n of the following Arabidopsis genes involved in embryo patterning: WUSCHEL (WUS) CUP SHAPED COTYLEDON ( CUC ) SHOOTMERISTEMLESS ( STM ), and DORNRSCHEN ( DRN ). The WUS transcription factor regulates stem cell identity (Mayer et al. 1998). The CUC gene acti vate s STM to complete the separation

PAGE 15

15 of the apical basal plane (Galinha et al. 2009) The CUC gene is required for cotyledon separation and activates STM to form shoot apical meristem (Aida et al. 1997) with DRN also redundantly control ling cotyledon for mation (Kirch et al. 2003). Phytohormones Phytohormones are small molecules present in low concentrations that mediate growth and development. Several distinct classes of compounds have been identified such as auxin, cytokinin, gibberellic acid, abscisic acid, ethylene, strigolactones, and brassinosteroids The role of the phytohormones auxin, brassinosteroids, cytokinin, ethylene, and gibberellic acid ( GA ) in regulating plant growth and development have been studied extensively ( reviewed Teale et al 200 6). Below follows a brief summary of how mutants affected in their ability to synthesize, transport or recognize the different classes of plant hormones have been used to elucidate the mechanisms of hormone action. Auxin Auxin is mostly present in the for m of indole 3 acetic acid (IAA) (Zhao, 2010) and can be synthesized via a tryptophan dependent pathway and a tryptophan independent pathway. Auxin induce s cell elongation in stems. Auxin suppresses outgrowth of axillary buds (Leyser, 2003) as evidenced by the phenotype of the Arabidopsis auxin resistant1 ( axr1 ) mutant, which has many branches compared to the wild type (Lincoln et al. 1990). Reduced auxin transport increases tillering in rice as shown in PINFORMED1 (Os PIN1) mutants (Xu et al. 2005). The u nderstanding of the pathway of de novo auxin biosynthesis is incomplete. A family of 11 YUCCA ( YUC ) flavin monooxygenases was identified in Arabidopsis. The genes were shown to be expressed mainly in the meristems, you ng primordia vascular tissues

PAGE 16

16 and re productive organs (Cheng et al. 2006), suggesting those are the sites of auxin synthesis. The role of YUCCA genes in tryptophan dependent auxin biosynthesis was demonstrated through the analysis of the dominant Arabidopsis yucca1 D mutant, identified thro ugh T DNA activation tagging. The mutant plant had elongated hypocotyls due to overproduction of auxin and was able to produce many roots on auxin free medium, unlike the wild type control The mutant phenotype was restored by overexpression of the bacteri al iaaL gene, which resulted in the formation of conjugates between free IAA and lysine, thereby reducing the levels of free auxin, and masking the yucca phenotype. The YUCCA1 protein contain s conserved motifs for binding flavin adenine dinucleotide (FAD) and NADPH, and is involved in the N oxygenation of tryptamine, formed from tryptophan (Woodward et al ., 2005, Cheng et al ., 2006) In maize, S parse inflorescence 1 ( Spi 1 ) is essential for localized auxin biosynthesis Spi1 encodes a monocot specific YUC g ene family member. The spi 1 mutant exhibits defects in the formation of branches, spikelets, florets, and floral organs (Gallovotti et al. 2008). Cheng et al. (2006) demonstrated gene redundancy in the Arabidopsis YUC genes by generating triple and quadr uple mutants in Arabidopsis and showing that knockouts of four genes were required to generate a mutant phenotype similar to spi 1 in maize. The degradation of auxin is better understood than its biosynthesis. The AUXIN RESISTANT1 (AXR1) protein is essenti al for proper conjugation of the SCF. F box proteins with S kp1 and C dc53 (cullin) form ubiquitin ligase complexes called SCFs. The Transport Inhibitor Response 1 (TIR1) encodes an F box, an auxin receptor that interacts with SCF (Dharmasiri et al. 2005). Protea some mediated auxin degradation

PAGE 17

17 involves SCF TIR1 that degrades AUX/IAA proteins that are repressors to AUXIN RESPONSE FACTOR (ARF) in a high auxin environment. Mutations in AXR1 exhibit increased branching with fewer lateral roots, and reduced fertil ity As a consequence, mutant AXR1 protein cause defects in downstream auxin responses due to improper conjugation of SCF to enable proper degradation of AUX/IAA proteins ( Lincoln et al. 1990, Leyser et al. 1993, Gray et al. 2001, del Pozo et al. 2002) Gibberellin (GA) Gibberellin was initially isolated from Giberella fujikuroi a pathogenic fungus ( reviewed by Phinney 1983) promotes cell elongation There are more than 125 characterized compounds in the GA family but only a fe w GAs GA 1 GA 3 GA 4 GA 5 GA 6 and GA 7 have been shown to be biologically active ( reviewed by Sponsel and Hedden, 2010). Figure 1 1 shows examples of gibberellic acid ( ga ) mutants that are affected in various steps of the GA biosynthesis pathway. Some of t hese mutants are severely reduced in height and display variation in tillering. The rice gibberellin insensitive dwarf 1 ( gid1 ) lacks a soluble gibberellin receptor The molecular mechanism of this receptor is uncle ar ( Ueguchi Tanaka et al., 2005) The mutant has a severe dwarf phenotype and is un responsive to GA. The GID1 gene was cloned with positional cloning. Using the yeast two hybrid system the GID1 protein was shown to interact with SLENDER1 (SLR1) only in the presence of GA ( Ueguchi Tanaka at al., 2005 )

PAGE 18

18 Cytokinin (CK) The natural form of cytokinin in maize plants is zeatin. It is found in meristematic regions and growing plant tissues and promotes cell division and differentiation (Mok and Mok, 2001) Cy tokinin signaling involves a phosphotransfer cascade (Inoue et al. 2001). An example of an Arabidopsis mutant involved in the CK signaling pathway is cytokinin response 1 ( cre1 ). This mutant was identified by screening a population of mutants induced with ethyl methanesulphonate (EMS). Introduction of the wild type CRE1 gene into a cre1 mutant plant restored normal plant growth (Inoue et al ., 2001) To test for signaling function, the yeast Synthetic L ethal of N end rule ( SLN1 ) gene was replaced with the CRE1 gene from Arabidopsis. The SLN1 gene e ncodes an osmosensing histidine kinase in yeast. Without proper function of SLN1 the mitogen activated protein (MAP) kinase pathway is always activated which is lethal to yeast cells (Inoue et al. 2001). Wh en CRE1 was introduced into the yeast system, the function was restored showing normal plant growth. The SHOOTMERISTEMLESS ( STM ) gene involved in shoot apical meristem ( SAM ) maintenance in Arabidopsis encodes a homeodomain protein in the KNOTTED 1 ( KN1 ) fa mily (Kerstetter et al. 1994). It was proposed that cytokinin acts upstream of STM because of the increasing meristem size when both STM and cytokinin levels were overexpressed individually with CYTOKININ OXIDASE/DEHYDROGENASE ( CKX ) (Werner et al. 2003). In Arabidopsis, it has been identified that overexpression of STM induces cytokinin biosynthesis genes At IPT5 (isopentenyl transferase) and At IPT7 (Yanai et al. 2005).

PAGE 19

19 Cytokinin is also involved in branching: CYTOKININ OXIDASE ( CKX ) is identified as an enzyme that degrades cytokinin (Sakakibara, 2006). A defect in this gene in rice caused an increase in panicle branch and spikelet number (Ashikari et al. 2005). Brassinosteroids Brassinosteroids (BR) are steroidal hormones first isolated from Brassica n apus (Grove et al. 1979) involved in seed germination and cell elongation Brassinolide (BL) is the firs t characterized brassinosteroid from bee collected rape pollen (Greeve et al. 2000 ). The elucidation of BR synthesis and signal transduction was accom plished with the help of Arabidopsis, pea (Nomura et al. 1999), tomato (Bishop et al. 1999; Koka et al. 2000), and rice (Yamamuro et al. 2000) mutants. These mutants were either BR deficient or BR insensitive (BRI) and typically display ed dwarfism with abnormal morphology. The signal transduction pathway has been identified with the help of Arabidopsis mutants. It is now known that BRI1 is a receptor like kinase that interacts with Leucine Rich Repeat RLK BRI1 ASSOCIATED RECEPTOR KINASE1 (BAK1) and down stream BRI1 KINASE INHIBITOR 1 (BKI1) (Wang et al. 2006). The Arabidopsis dwarf1 1 mutant was identified from a mutagenized population and was shown to be a brassinosteroid biosynthetic mutant. The normal phenotype can be restored with exogenous applicat ion of brassinosteroids (Choe et al. 1999). The dwarf1 1 mutant was shown to have a single mutation leading to a reduced ability to bind FAD. The DWARF1 gene encodes an oxidoreductase that requires FAD as a cofactor to function normally (Choe et al. 1999)

PAGE 20

20 Strigolactone s Strigolactones represent a group of hormones discovered fairly recently. Strigolactones are released from root exudates in plants that promote germination of Striga, parasitic plants that infect monocots (Bouwmeester et al. 2007). Unexpec tedly, strigolactones are also associated with variation in branching that had been observed in the Arabidopsis more axillary meristem ( max ), the pea ramosum ( rms ), and the Petunia hybrida decreased apical dominance ( dad ) mutants (Arite et al. 2007; Bever idge et al. 1997). RMS1 RMS5 and MAX4 encode carotenoid cleavage dioxygenases (Gomez Roldan et al. 2008). There are also orthologs in rice such as HIGH TILLERING DWARF1 ( HTD1 ), ortholog of MAX3 (Zou et al. 2006) and DWARF10 ( D10 ), ortholog of MAX4 (A rite et al. 2007). The mutants that were isolated from rice exhibit high tillering phenotypes with low endogenous levels of strigolactone (Umehara et al. 2008). In order to demonstrate that strigolactone suppresses branching, a synthetic analog of strigo lactone, GR24, was applied to rice dwarf mutant s and Arabidopsis max mutant s Upon application, these mutants were restored to the normal phenotype (Umehara et al. 2008). Also, similar mutants in maize deficient in C arotenoid cleavage d ioxygenase8 ( Ccd 8 ) also demonstrated tillering (Guan et al ., unpublished data) The previous section s r epresent a subset of the mutations affecting levels of hormones involved in plant growth and development. In addition other hormones and growth regulators such as abscisic acid, ethylene, jasmonic acid, and salicylic acid are important contributors to plant growth and development The hormones do not work independently of each other, but there is cross talk among hormones that coordinates normal plant growth and development (Weiss, 2007) Although pathways for major hormone biosynthesis, signaling, and perception have been identified, how these

PAGE 21

21 hormones communicate spatially and temporally to regulate plant growth and development remains to be fully elucidated (Durbak et al., 2012) Genetic Control o f Plant Height Plant height is an important agronomic trait especially in crops plants such as rice, reviewed by Khush et al. ( 2001). World wide food production was able to keep up with the demand of a growing population due to th e introduction of dwarfing alleles into rice and wheat. Dwarfing alleles were favorable as they caused a phenotype able to withstand lodging. Severe lodging ty pically results in the inability to combine harvest the crop, while moderate lodging can alter plant growth and de velopment, including flowering time, result in increased damage from rain or hail reduce the photosynthetic capability of the plant and redu ce the efficiency of nutrient transport (Khush et al. 2001). One of the dwarfing alleles of wheat was ide ntified through analysis of the reduced height ( rht ) mutant. The Rht gene encodes a protein resembling a nuclear transcription factor (Peng et al. 19 99) The rht mutant do es not res pond well to gibberellin The Rht gene was shown to mediate the signal transduction pathway of gibberellin (GA) and when mutated caused reduced response to GA. The Arabidopsis and maize Rht orthologs are GIBBERELLIN INSENSITIVE ( GAI ) (Sa saki et al. 2002) and Dwarf 8 (Anderson et al. 2008) respectively T he orthologs of wheat, Arabidopsis and maize, belong to the GRAS family of proteins (Ikeda et al. 2001). The acronym GRAS was derived from three cloned genes, GAI RGA ( REPRESSOR of GA1 ), and SCR ( SCARECROW ) (Benfey et al. 1993, Peng et al. 1997, Silverstone et al. 1998). The GRAS family of proteins is involved in regulatory roles for plant growth and signaling specific to plants. The GRAS family of pr oteins share similarity with their two

PAGE 22

22 conserved regions at the N terminus that include a DELL A domain of 27 amino acid s (Willige et al. 2007). DELLA proteins are repressors of plant gibberellin responses (Peng et al. 1997). Another example of a dwarf mutant in rice known as semidwarf1 ( sd1 ) was identified to be defective in GA biosynthesis (Monna et al. 2002). The phenotype of sd1 can be restored with endogenous GA. The sd1 gene encodes GA 20 oxid ase (GA20ox), an enzyme involved in GA biosynthesis an d a major determinant of GA production (Monna et al. 2002). Another dwarf mutant in maize, known as brachytic2 ( br2 ), has short lower internodes but the ear, tassel, and leaves are not affected in size. The br2 phenotype could not be restored by endogeno us application of auxin, GA, brassinosteroids, or cytokinins, indicating that br2 is not simply defective in hormone biosynthesis (Multani et al. 2003). Upon cloning using Mutator (Mu) transposon tagging, the Br2 gene was identified to be highly similar to Arabidopsis P GLYCOPROTEIN1 (At PGP1 ) (Multani et al. 2003). At PGP1 is also closely related to adenosine triphosphate (ATP) binding cassette transporters (ABC transporter) of the multidrug resistant (MDR) subfamily in humans (Jones et al. 200 4). Multani et al. (2003) concluded that Br2 is involved in polar auxin transport in maize. This was further substantiated by the observations that i n Arabidopsis a mutation in the At PGP1 gene affects auxin transport in a similar manner as in br2 (Multani et al., 2003) Genetic Control of Branching and T illering In angiosperms the apical basal axis is established during embryogenesis with the formation of the shoot apical and root apical meristems that provides polarity to the plant Divers ity in plant morphology is also the result o f the ability to generate axillary branching. The importance of diverse patterns of branching does not only provide

PAGE 23

23 additional surface for a plant to capture light for photosynthesis, but is also an important ag ronomic trait. For example, research was conducted to investigate differences in plant a rchitecture of cultivated rice ( Oryza sativa ) to a related wild species of rice, Oryza rufipogon (Jin et al. 2008). The wild species of rice is short, and has a wide t iller angle, whereas th e cultivated species has a near erect growth form. The traits possessed by cultivated rice are favorable due to the ability to increase photosynthetic efficiency, and allow dense planting because of the erect growth form. The gen e responsible for the upright growth in rice was identified as PROSTRATE GROWTH1 ( PROG1 ) through genetic mapping. PROG1 encodes a 167 residue polypeptide that acts as a transcription factor. It contains a highly conserved C2H2 type zinc finger motif at its N terminal region with the activation domain localized at the C terminus. Following the comparison of the 2.679 kb PROG1 sequence between the wild species and the cultivated rice, the cause for altered plant architecture was shown to be a nucleotide subst itution in the coding region that prevented complete protein binding in cultivated rice Expression analysis revealed that PROG1 was localized at the axillary meristems Another example of a mutant displaying altered branching patterns is teosinte branched 1 ( tb1 ) (Doebley, 1983), a maize mutant with long lateral branches tipped by tassels, and many tillers at the basal node resembling a teosinte plant ( Zea mays ssp. parviglumis ), the progenitor of maize. The function of Tb1 is to suppress lateral branch gro wth in maize. Further investigation (Doebley et al. 1997, Cubas et al. 1999) proved that Tb 1 encodes a transcriptional regulator, member of class II of the TCP family. The name TCP stands for Tb1 in maize, CYCLOIDEA ( CYC ) in Antirrhinum, and P FC (prolife rating cell) proteins in rice. The ortholog s of Tb1 were also identified in rice

PAGE 24

24 (Takeda et al. 2003) and sorghum (Doust, 2007a). In Arabidopsis, a mutation in the ortholog of Tb1 TEOSINTE BRANCHED1 LIKE 1 ( TBL1 ) caused a hyperbranching phenotype (Finla yson, 2007), showing that the function of Tb1 is not unique to the grass family. The maize c orngrass1 ( c g 1 ) looks like a bush because of the repeated initiation of tillers in the axil of each leaf. The c g 1 mutant was initially proposed to be an ancestral type of maize because of its character istic to propagate vegetatively (Galinat, 1954). The severe phenotype of corngrass1 was shown to be caused by two tandem microRNA156 (miR156) genes that are overexpressed in the meristem and lateral organs (Chuck et al 2007). An estimated thirteen maize genes are targeted by miR156 (Chuck et al. 2007), including genes SQUAMOSA Promoter Binding Protein Like ( SPL ) encoding plant specific transcription factors. The other targeted genes are also involved in plant develop mental patterning (Rhoades et al. 2002). Similar mutants from maize such as teopo d 1 and teopod 2 (Singleton, 1951) exhibit similar tiller phenotype but not as severe as cg 1 To date the underlying cause for the teopod phenotype is not clear. The maize muta nt grassy tiller s 1 ( gt1 ) was originally i de ntified in an EMS population The mutation results in the formation of many tillers. The gt1 gene was cloned with positional cloning and was show n to encode a class I homedomain leucine zipper transcription factor (Whipple et al. 2011). The expression of gt1 was detected in shoot axillary buds using in situ RNA hybridization. The function of the gene is to suppress lateral branching in maize. Mutagenesis and Transposable Elements Genome sequences of several plants including Arabidopsis ( Arabidopsis Genome Initiative ), rice (Goff et al. 2002 Yu et al. 2002), maize (Schnable et al. 2009) and

PAGE 25

25 sorghum (Paterson et al. 2009) have been sequenced, but the sequence data alone are not informative to link genes to their functions. Progress in plant biology still relies heavily on the study of mutants and their causal genes. Mutants can either occur naturally (for example as a result of errors during DNA replication), or result from chemical mutagenesis with, for exa mple ethyl methane sulfonate (EMS), or from the forward and reverse genetics approaches. Forward genetics is focused on identifying the causal gene underlying a known mutan t of interest. Reverse genetics is used to identify the function of a known gene by specifically mutating this gene and observing the resulting phenotype. Mechanism of Transposition Transposable elements are DNA sequences that are able to move themselves f rom one location in the genome to another. Transposable elements were first identified by Barbara McClintock (McClintock, 1947). There are t wo classes of transposons. C lass I transposons are retrotransposons that rely on an RNA intermedia te that is reverse transcri bed into a DNA copy, which is then inserted in a different location of the genome. Class II transposons are classified as DNA transposon s that do not involve RNA intermediates. The class II transposable elements contain autonomous and non autonomo us elements. Non autonomous elements can only transpose in the presence of an autonomous element. The autonomous elements encode a transposase, which is An example is the maize Activator/Dissociator ( Ac/Ds ) system (McClintock, 1947), where Ac is the autonomous element and Ds is the non autonomous element. These transposable elements have terminal inverted repeats (TIR). The role of terminal

PAGE 26

26 inverted repeats is to act as a r ecognition site for the transposase encoded by the autonomous element and necessary for transposition. The other two major transposable element systems of maize are Enhancer/ Initiatior ( En/I ) (Peterson, 1953), also known as Suppressor mutator / defective S uppressor mutator ( Spm/ d Spm ) (McClintock, 1954) and Mutator ( Mu ) (Robertson, 1978). The autonomous element is listed first in thes e above systems. The Major Transposable Element Systems in Maize Ac/Ds The Ac element is 4 565 bp in length with 11 bp terminal inverted repeats (TIR) (Federoff et al. 1984). The Ds elements have 11 bp terminal inverted repeats but with variation in internal sequence and length (Doring et al. 1984). Although the Ac/Ds system is used for transposon tagging, this method is not widely used due to its relatively low forward mutation rate of 10 6 /gene/generation. The transposition of Ac/Ds is favored to transpose locally (Wa lbot 2000). T he Waxy gene is an example of a gene cloned successfully using Ac/Ds elements (Fe deroff et al. 1983). En/Spm The En/I system was discovered by Peterson ( 1953 ). McClintock independently discovered this same transposable element system in 1954 and named it Spm/ d Spm (McClintock, 1954) The En element is 8 287 bp long and has 13 bp term inal inverted repeats with the first 5 bp conserved (Masson et al. 1991). The En/Spm element yields two major transcripts, TnpA which is 2.5 kb long identified as Mutator ( M ) and TnpD which is 6 kb long and identified as Suppressor (S) Excision from the genome cannot occur without the presence of both the TNPA and TNPD proteins (Grant et al. 1990,

PAGE 27

27 Frey et al. 1990). The transposition of En/Spm occurs to lin ked sites. The mutation rate is 10 6 /gene/generation similar to Ac/Ds The O paque2 gene was succ essfully cloned with En/Spm (Schmidt et al. 1987). Mutator The Mutator family of transposable elements was first described by Robertson ( 1978). The autonomous element of the Mutator family is MuDR (Qin et al. 1991; James et al. 1993). There are at least 250 non autonomous Mu elements that fall into 5 major sub clades the canonicals Mu1 through Mu8, Mu10 (Mu10 and M u 11), Mu12A, Mu12B, and Mu12C (Lisch, 2002 Hunter, 2010 ). Although Mutator is a diverse family, the non autonomou s elements share conserved ~220 bp terminal inverted repeats (TIR) (Chandler et al. 1986; Lisch, 2002). The first successfully cloned gene from Mutator is Viviparous1 ( Vp1 ) (McCarty et al. 1989). Mutator is favored for transposon tagging due to its relatively high forward mutati on rate of 10 4 /gene/generation (Walbot, 2000). MuDR elements consist of two genes, mudrA which encodes a transposase and mudrB required for new insertion into the genome (Woodhouse et al. 2006). For transposition to occur, the MURA protein encoded by mudrA binds to a specific 32 bp conserved region of Mu TIR and initiates a double strand break (Benito and Walbot, 1997). The mechanism for Mu transposition is similar to that of Ac/Ds but excision of Mu produces a 9 bp direct repeat (Le et al. 2000). Based upon the high forward mutation rate of Mutator the Uniform Mu population was generated as a resource for functional genomics in maize (McCarty et al. 2005, Settles et al. 2007). The Uniform Mu population was developed by introducing active Robertso n's Mutator transposons into inbred line W22 via repeated backcrossing. The homogenous inbred line facilitates genotype and phenotype associations (McCarty et

PAGE 28

28 al. 2005). Methods using Mu TAIL (Settles et al. 2004) and Mu 454 (Eveland et al. 2008) are use d to generate libraries that contain Mu flanking sequences. The flanking sequences can be used in co segregation studies aimed at associating the presence of specific Mu insertions with the observed mutant phenotype. Research Objectives The mutants mini me and grass were identified in the Uniform Mu population, grown as part of the Cell Wall G enomics project (Penning et al. 2009). Both mutants are extreme dwarfs that reach a height of no more than 25 cm and form multiple tillers. The mutants have small an d narrow leaves, lack a true stalk, and do not fo rm functional floral structures, although the mini me mutant has, under certain circumstances, been observed to produce a floral structure that contains both male and female characteristics, but that is not fertile. The objectives of this research were to characterize the mutants phenotypically and to clone t he causal gene(s) The hypotheses for this research are : 1) the mini me and grass mutation s are caused by Mutator insertion s ; 2) the mini me and grass mu tations are allelic; 3) the tillering phenotype is caused by a lack of suppression of axillary meristems.

PAGE 29

29 Figure 1 1 Known Arabidopsis dwarf mutants affecting the GA biosynthesis pathway. GGP: geranylgeranyl diphosphate, CPS: copalyl diphosphate synthase, CPP: cyclodiphosphate KS: kaurene synthase, K: kaurene KO: kaurene oxidase KA: kaurenoic acid KAO: kaurenoic acid oxidase GA3ox: GA 3 oxidase GA20ox: GA 20 oxidase ( Sponsel and Hedden, 2010 ) Figure 1 2 Phenotype of maize grass and mini me mutants A) grass B) mini me Photos taken by Wilfred Vermerris in the Puerto Rico 2005 2006 winter nursery. A B

PAGE 30

30 C HAPTER 2 PHENOTYPIC CHARACTER IZATION OF THE MINI ME AND GRASS MUTANTS Introduction As de s cribed in Chapter 1, t he mini me and grass muta nts are extreme dwarfs with altered plant architecture: They do not grow more t h an 25 cm in height, lack a typical stalk typical instead produce multiple tillers and do not produce functional floral structures The phenotype of both mutants varies depend ing on the environment as illustrated by the images of mini me growing in the field in Puerto Rico ( Figure 1 2 ) versus in a pot in the greenhouse at the University of Florida in Gainesville, Florida (Figure 2 3 ). This chapter describes the morphological a nd anatomic al characterization of both mutants to help identify the physiological basis of the phenotype. The initial focus has been on embryo morphology, seed germination, and leaf morphology as outlined and justified below. Variation in Embryo Structure The meristem consists of undifferentiated cells from which the main organs develop. Above ground organs form from the shoot apical meristem (SAM), whereas the roots form from the root meristem. Since the SAM is ultimately responsible for forming the vario us above ground organs, variations in plant architecture may be caused by abnormalities in the formation of the embryo itself, or by abnormalities in the way the embryo develops into a mature plant. Microscopic analysis of the embryo of wild type and mutan t maize plants can address whether the basis for the altered architecture in the mutants is pre or post embryonic. In the case of post embryonic

PAGE 31

31 changes, it maybe possible to assess at which stage variation in architecture becomes apparent. Variation in S eed Germination Given the role of phytohormones on virtually all aspects of plant growth and development, chemical or spatio temporal changes in phytohormones may manifest themselves as variation in the rate of seed germination. Variation in Leaf Morpholog y Small plant size can result from reduced cell size and reduced cell number. A comparison of epidermal peels of leaves from the mutant and wild type plants viewed under the microscope can provide information on cell size, cell number as well as other morp hological differences. Cross sections through the leaf blades can reveal additional changes in cell size and shape below the epidermis. Materials and M ethods Plant M aterial The sources for mini me were S2008: 234 S3 lfed progeny of and S2008: 234 S4, whereas the sources for grass were S2007:212 S2 and S2007: 212 S4. The parental material s giving rise to these seed sources were known to be heterozygotes, and on average one quarter of these seeds resulted in plants displaying the mutant phenotype. The sources for wild type inbred W22 were S2008: 176 S6 and for inbred B73, S2008:370 S2 and S2008: 370 S3. Seeds were germinated in a Jiffy seedling kit in the dark at 28 C inside a Percival incubator. Once the seeds had germinated, the seedlings were transferred to the greenhouse with daylight length of 12 hours. For each experiment 12 seeds per genotype were planted.

PAGE 32

32 For the winter 2011 planting in the greenhouse at Gai nesville, FL, the plants were grown in MetroMix 930 (BWI C ompanies, Inc.) under supplemental high pressure sodium light ( ACF Greenhouses VA) to ensure 12 hours of light per day. Epidermal P eel A baxial and adaxial epidermal peel s were prepared by covering a leaf section with clear nail hardener (New York Color COTY Inc. ). After the nail hardener dries out, it can be peeled from the leaves and mounted on a glass slide (Corning, Corning, NY). The imprint s of the a b axial and adaxial leaf surface s w ere viewed under the microscope. Freshly peeled a baxial and adaxial epidermal peels were stained with Toluidine Blue (Fisher Scientific, Waltham, MA ). A commercial grid of 1x1 mm 2 ( Sigma Aldrich Co St. Louis, MO) was used to ca lculate stomata l density. Formalin Acetic Acid Alcohol (FAA) fixation One liter of formalin acetic acid a lcohol (FAA) for fixation of plant tissues was prepared by combining 850 ml 70% ethanol (Fis her Scientific, Waltham, MA ), 100 ml 40% formaldehyde (Fish er Scientific, Waltham, MA) and 50 ml glacial acetic acid ( Fisher Scientific, Waltham, MA) (Ruzin, 1999). After the plant material had been placed into FAA solution, it was vacuum infiltrated for faster penetration of the FAA solution into the plant cells and also to remove air bubbles Leaf tissue was fixed for at least 24 hours whereas harder plant tissues such as stem were incubated for 48 hours Infiltrating a nd Embedding Tissues Paraffin/TBA method After FAA fixation the tissue samples were dehydrat ed and infiltrated with the embedding agent paraffin to enable sectioning with a microtome Since paraffin is an apolar compound, e xcess water must first be removed. This was achieved with a graded dehydration series in alcohol of increasing concentration For each change,

PAGE 33

33 harder plant tissues such as stems were left overnight whereas for softer tissues such as leaves, 6 to 12 hours was sufficient (Ruzin et al. 1999). T ert Butanol (TBA) ( Sigma Aldrich Co St. Louis, MO) is preferred for dehydration series (Cutler et al. 2007). Once the plant tissu es were in paraffin ( Sigma Aldrich Co St. Louis, MO tissues were left overnight so that TBA could evaporate and to allow paraffin to infiltrate the plant tissues Sectioning and Staining Tran sfer of the tissue in the warm paraffin to ice solidified the paraffin, enabling sectioning with a rotary microtome (American Optical microtome model 820) The sections were mounted on Superfrost Plus Slides (Fisher Scientific, Waltham MA). The Johansen m ethod was used for staining : a combination of Safranin O ( Sigma Aldrich Co St. Louis, MO ) and Fast Green ( Sigma Aldrich Co St. Louis, MO ) (Johansen, 1940). This staining protocol is preferred because it yields brighter stains of plant tissues. Safranin O stained chromosomes, nuclei, lignified or cutinized cell walls red, while Fast Green stained cytoplasm and unlignified primary cell walls green The working concentration for Safr anin O was 1% in 2:1:1 methyl cellosolve ( Sigma Aldrich Co St. Louis, MO) : 95 % ethanol : water. For Fast Green ( Sigma Aldrich Co St. Louis, M O), the working concentration was 0.15% in 1:1:1 methyl cellosolve: 100% ethanol : clove oil ( Sigma Aldrich Co, St. Louis, MO) (Ruzin, 1999). Microscopy An M VX10 Olympus microscope located in the F orest Genomics lab ( Cancer and Genetics Research Complex ) was used to visualize and capture the images of the plant tissues after staining. The microscope was outfitted with an Olympus MVX TV1XL digital camera.

PAGE 34

34 Results Variation in S eed Germination S eeds from the selfed heterozygous mini me plant S2008:234 S3 began to germinate after four days incubatio 2 1 A ) Of the twelve seeds three seeds were very slow to germinate 3 to 6 days after the W22 control seeds and siblings and were identified as putative mutants. Segregation of t hree mutant seeds out of seven is consistent wit h a 3:1 segregation ratio for a single recessive mutation ( X 2 = 0.13 d.f.= 1 p= 0. 7150 ). After eleven days (Figure 2 1 B ) these putative mutant seedlings remained small relative to their siblings but did not display any obvious differences in morphology. From a total of four trials or 48 seeds planted using the Jiffy seedling kit, only four mini me mutants were obtained based on shorter plant height compared to the siblings This is considerably fewer than the 12 mini me mutants expected from a total of 48 seed s. This discrepancy is due to reduced v iability of the mutants that le d to premature death (Fig ure 2 1 B ) Seedlings from the selfed heterozygous grass plant (S2007:212 S2) also germinated more slowly ( 3 6 days later than W22) and sh owed variation i n size (Figure 2 2 ) but no obvious differences in morphology were observed 13 days after planting (DAP). At 20 DAP however, some of the plants no longer elongated and it became apparent that the leaves were growing opposite of each other (Figure 2 3 B), displaying a symmetry not observed in wild type maize seedlings. In wild type seedlings, subsequent leaves are positioned at an angle of approximately 140 degrees relative to the previous leaf. Three batches of 12 seeds were germinated. Due to arrested gro wth

PAGE 35

35 in the early stages of germination or fungal infections a total of only three grass mutants were obtained ( X 2 = 3.11 d.f.= 1 p =0.078 ). The planting in the 2011 winter greenhouse at Gainesville, FL resulted in four mini me mutants out of 10 seeds from S2008:234 S3 and two grass mutants out of 7 seeds from S2007:212 S2 (Figure 2 4 ) Two of the mini me mutants produced floral structures with both male (tassel) and female (ear) characteristics ( Figure 2 9 ) Pollen was sprinkled on the silks protruding fr om these floral structures but seed formation did not occur based on visual inspection under a dissecting microscope 22 days after pollination (Figure 2 10 ). Variation in Leaf Morphology Leaf Blade Dimensions The length and width of 12 mini me and 8 gras s leaves were measured. Twelve leaves of mini me were measured to be on average 17 cm in length and 1.2 cm in width. For grass the average length was 9 cm and 0.5 cm in width (Figure 2 5 ). The leaves of both mutants contained translucent sections. This is apparent from th e images in Figure 2 6 which were taken with a light source underneath the leaf. Epidermal P eel In order to examine variation in cell patterning or morphology on the leaf surface e pidermal peels using clear nail hardener were prepared fr om nine mini me mutant leaves from different plants (S2008 234 S3) and six grass leaves from different plants (S2007 212 S2) and analyzed under the microscope One of each of the mutant sample s was collected in between 2009 and 2011. Epidermal peels from p henotypically wild type siblings of S2008: 234 S3 and from inbred line W22 were used as controls (Figure 2 7 ) The frequency of stomata was lower for both mutants and the stomata had

PAGE 36

36 irregular shape s compared to wild type plants Furthermore, the cell walls were irregular in shape and size that made counting of the cell files between stomata challenging The stomata density w as calculated using an average of three random 1 x1 mm 2 of the adaxial and abaxial leaf surface s A t test showed that the stomata l dens ity in the two mutants was statistically highly significantly different when compared to controls with control ( Average, M = 48.33 ) and mini me (M = 35.67), t(10.15) = 1.247 p = 0.0005 Also, control (M = 48.33) and grass (M = 28.0), t(8.994) = 2.26, p = 0.0 008 Cross Sections of the Leaf Blade and Midrib The leaf cross section of the mini me mu tant from 2008 234 S3 ( Figure 2 11 E ) revealed irregular cell wall shape in all cells epidermal cells, bundle sheaths, and vascular cells, when compared to th e wi ld type ( Figure 2 11 D ). In addition, the b undle sheaths of the mutants were located closer next to each other and some were improperly formed compared to the control and also smaller in size compared to the wild type. The cross section of the grass leaf ( Figure 2 11 F ) looked overall similar to the mini me mutant, but had an even more irregular epidermis on the adaxial side of the leaf and the improperly formed bundle sheath s were more distinct ( Figure 2 11 E ). Both mutants ( Figure 2 11 B C ) lack a disti nct midrib when compared to the wild type ( Figure 2 11 A). Safranin O typically stains cutinized cells red typically at the epidermis and sclerenchyma as can be observed in wild type ( Figure 2.11 D) but both mutants lack cutinized cells ( Figure 2.11 E F). Cross section of the M eristem s The meristematic tissues of developing seedlings of one grass and three mini me mutants were analyzed and compared to three wild type controls (30 DAP and 20 DAP)

PAGE 37

37 Due to the delay in development it was challenging to obta in seedling tissues of identical developmental stages. All the seedlings contained a main shoot apical meristem (SAM) just below the leaf primordia. A secondary SAM was observed in the mini me and grass seedlings ( Figure 2 11 H I). Discussion The mini me and grass mutants share the extreme dwarf phenotype, the y both lack of a main stem and mid rib and they both form tillers. Nonetheless, under field and greenhouse conditions the two mutants can be distinguished from each other because grass is smaller and has not ever been observed to produce floral structures. The detailed phenotypic characterization described above identified several additional similarities: slower germination rate, altered leaf morphology, both in terms of the number of stomata and epid ermal cell shape and size, and the presence of an additional shoot apical meristem at the base of the main stem in the early seedling stage. These similarities in phenotype make it plausible that the two mutants are caused by defects in the same gene, but with slightly different impacts (penetrance). The extra meristems in the mutants may reflect a premature development of vegetative axial meristems that in wild type plants would ultimately give rise to ears (female flowers) but that in these mutants resul ts mainly in the formation of tillers and occasionally may give rise to the feminized tassel in mini me The additional meristem could be caused by misexpression of an early homeodomain gene. Alternatively, the tillering in the two mutants could result fro m a lack of suppression of the axillary meristem as seen in tb1 and gt1 Both mini me and grass had irregular cell shape s that were challenging to quantify. A close look at the irregular ly shaped cell wall s ( Figure 2.12 B C and 2.13 B

PAGE 38

38 C D ) suggests differe nces in cell differentiation According to Moose et al (1994), maize bulliform cells stain purple with Toluidine blue As observed in the adaxial epidermis of mini me and grass ( Figure 2.8 B C), the cells that are stained purple are uneven in size and dis tribution compared to the wild type control ( Figure 2. 8 ). This is further evidence of changes in cell differentiation. In addition the bundle sheaths of both mutants were not clearly formed compared to the control ( Figure 2.11 E F) The maize tangled 1 ( tan 1 ) (Smith et al 1996 ) mutant was shown to have defects in both epidermis and bundle sheaths due to improper formation of the phragmoplast. Another maize mutant affected in epidermal cell differentiation is discordia1 ( dcd1 ). The functional Dcd1 gene encodes a phosphatase involved in pre prophase band (PPB) formation (Gallagher et al ., 1999, Wright et al ., 2009). The mini me floral structure is shaped like a tassel containing pseudo ovaries with silks. This floral structure, however, appears to be inf ertile, because pollination with W22 pollen did not result in the f ormation of an embryo ( Figure 2.10 C). Examples of similar mutants are a nther ear1 ( a n1 ) and nana1. The an1 mutant is short in stature with anthers present in the spikelet of the ear. This is the result of a defect in the GA biosynthesis pathway (Bensen et al ., 1995). The n ana1 mutant is also short and contains a feminized tassel due to a defect in the brassinosteroid biosynthesis pathway. The mutants will likely be affected by a less effici ent carbon dioxide uptake due to fewer stomata, which will lead to reduce d photosynthetic activity. This could be the reason that most mutants do not live as long as normal maize plants: at most 90 days under extreme care with regular watering, fertilizati on, and avoidance of insect pests.

PAGE 39

39 The similarities in phenotype make it plausible that the two mutants are caused by defects in the same gene, but with slightly different impacts (penetrance). There are many morphological and anatomical changes in the gra ss and mini me mutants, that appear to be more complex than in other known maize mutants that resemble mini me and grass in certain aspects as described above and in Chapter 1. For example, an1 and nana1 have altered floral structures, but produce normal vegetative parts of the plant, tb1 and gt1 produce tillers, but are able to form normal flowers, and br2 and d8 are short, but still look like their wild type counterparts in other aspects. Given that the SAM of mini me and grass appears to be normal, the mutants must be lacking one or more key signals required for normal post embryonic development, and that are involved in meristem development, cell differentiation and/or integration of hormone signaling. B

PAGE 40

40 Figure 2 1 Seedlings grow th. A ) Mini me ( 20 08:234 S3) seedlings in the dark after 4 days in the incubator at 27 C B ) F amily of seedlings segregating for m ini me ( S 2008:234 S3) c) Seedlings with a suspected mutant p henotype 11 days after planting. a) S eed l ings removed due to fungal infection b ) Seedling growth arrested Figure 2 2 A family segregating for g rass (S 2007:212 S2 ) 13 DAP with three putative mutant phenotype marked by red arrows b a A B c

PAGE 41

41 Figure 2 3 A ) Mini me ( S 200 08:234 S3) showing t he first two seedlings from the left are mutants and to the right is the wild type/heterozygote pla nt 20 days after planting. B ) g rass ( S 20 07 :212 S4 ) showing leaves growing in opposites about 30 days after planting, May 2009 Figure 2 4 A) Front view of mini me and grass grown in the winter greenhouse 2011, Gainesv ille, FL. B) top view of grass C) top view of mini me ; scale bar represents 1cm A B

PAGE 42

42 Figure 2 5 Comparison of leaf blade s ize of wild type (W22), mini me and grass Figure 2 6 Translucent sections in the leaf blades of mini me and grass mutants Microscope images were acquired using a light source underneath the samples whereby the exposed sides were cov ered with black paper : A) Wild type (W22), B) mini me C) grass scale bar represents 100 m. 10 cm

PAGE 43

43 Figure 2 7 Ep idermal imprints from leaf blades of wild type, mini me and grass mutants. A) wild type adaxial. B) mini me adaxial. C) grass adaxial. D) wild type abaxial. E) mini me abaxial. F) grass abaxial ; scale bar represents 10 m

PAGE 44

44 Figure 2 8 Epidermal imprints stained with Toluidine Blue from wild t ype, mini me and grass mutants. A) wild type adaxial. B) mini me adaxial. C) grass adaxial. D) wild type abaxial. E) mini me abaxial. F) grass abaxial ; scale bar represents 10 m A B C D E F

PAGE 45

45 Figure 2 9 A) Flowering mini me with three hybrid floral structures displaying both branchless male and female characteristics B) Close up of th e hybrid floral structure ; scale bar represents 1 cm Figure 2 10 Floral structure of mini me A) Close up of the floral structure B) Pseudo ovary with silk ( style ) C) Pseudo ovary sliced in half ; scale bar represents 1 mm

PAGE 46

46 Figure 2 11 Cross section of mid rib leaf blade and meristem W ild type A, D, G. mini me B, E, H. grass C, F, I. In D E F a rrows showing upper and lower epidermis In H, I a rrow showing early differentiation of vegetative axial meristems s stoma ; sc ale bar represents 100 m WT mini me grass 30 DAP 19 DAP 21 DAP s A C D F G H I

PAGE 47

47 Figure 2 12 mini me epidermal peel stained with Toluidine Blue. A) Putative guard cell pre cursor B and C i ncomplete stomata l differentiation ; scale bar represents 10 m Fig ure 2 13 grass epidermal peel stained with Toluidine blue. A) Putative guard cell pre cursor B C, and D i ncomplete stomata l differentiation. E ) irregular macrohair patterning F G ) irregular microhair ; scale bar represents 10 m

PAGE 48

48 Table 2 1 Sto mata l d ensity within 1 x1 mm 2 in mini me grass and W22 leaf blades W22 mini me grass Replicate Abaxial Adaxial Abaxial Adaxial Abaxial Adaxial 1 48 34 37 22 29 20 2 50 35 36 18 24 21 3 47 36 34 24 31 19 Total 14 5 105 107 64 84 60 Average 48 35 35 21 28 20 Std. Deviation 1.5 1 .0 1.5 3.1 3.6 1 .0

PAGE 49

49 CHAPTER 3 M OLECULAR GENETIC ANALYSIS AIMED AT CL ONING THE MINI ME AND GRASS GENES Introduction The mini me and grass mutants were identified in the Uniform Mu population, grown as part of the NSF funded Cell Wall G enomics project (Penning et al. 2009). These mutant phenotype s were inherited as single recessive mutations base d on the 3 wild type : 1 mutant segregation ratio observed wh en the progeny of selfed heterozygotes were planted. As described in Chapter 2 grass and mini me have very similar ph enotypes and may be allelic Given that the mutants were identified in the Uniform Mu population, the cause of both mutations was likely Mu tator insertions, although spontaneous mutations can never be ruled out. In order to identify the Mutator insertion responsible for the mutant phenotype, a co segregation analysis was carried out. The principle of a co segregation analysis is the identific ation of a Mutator element that co segregates with the mutant phenotype, i.e. that is present in all of the mutants while absent in all of the homozygous wild type siblings ( Figure 3 1, 3 2) Several methods exist to identify a co segregating Mutator eleme nt. In the an alysis described in this chapter, two high throughput methods were used: Mu TAIL PCR (TAIL Thermal Asymmetric InterLaced) ( Liu et al. 1995, and Settles et al. 2004 ) and Mu 4 54 (Eveland et al. 2008 ). The principle of Mu TAIL is to generate a library of DNA fragments flanking the Mu insertion by using the Mu TIR sequences as an anchor on one end and an arbitrary primer that anneals to the flanking DNA within amplifiable distance at the other end. The Mu 454 approach is based on the 454 high th roughput sequencing platform (Margulies at al., 2005), with the same

PAGE 50

50 objective as Mu TAIL namely to generate a library of Mu flanking sequences. In principle t he Mu 454 method has better coverage of the genome, is less laborious, faster, and offers higher throughput. Identifying the Mutator element causing the mutation can be complicated by the fact that Mutator is a high copy number transposon. The identification of a map location of the mutation, combined with the map location of the individual Mutator e lements identified with the high throughput sequencing analyses can help narrow down the number of candidate Mu elements. Mapping the mutation can be accomplished in a segregating F2 population derived from a cross between the mutant (or heterozygote) and a genetically different inbred line. Being a member of the Iowa Stiff Stalk Synthetics, inbred B73 represents a different heterotic group than W22, which belongs to the Lancaster Sure Crop group. There ar e two approaches to identify if mini me and grass ar e alleles of the same locus. The classic genetic approach is to cross the two mutants an d show that the progeny display the mutant phenotype This approach is complicated by the fact that both mutants are sterile and cannot be crossed directly. As a conseq uence, it is necessary to cross two heterozygotes, each containing one of the mutant alleles, with each other. The concept of this approach is displayed in Figure s 3 4 and 3 5. A molecular approach that could be used as preliminary evidence for allelism is to show that both mutants contain a mutation in the same gene, and that this mutation co segregate s with the mutant phenotype in both mutants Materials and methods DNA E xtraction Plant DNA was extracted from frozen leaf tissue kept at C DNA was extracted using the DNeasy Plant Mini kit (Qiagen, Carlsbad, CA). The DNA was stored at C.

PAGE 51

51 Plant M aterial For co segregation analysis the following genotypes were used for mini me : S2008:234 S3 an d S2008:234 S4 (Summer 2008, row 234, selfed progeny of plant 3 and plant 4; mutants) and W22 (wild type). Both sources represent progeny from self pollinated heterozygotes so that homozygous mutants are expected among the progeny. As wild type siblings, progeny f rom S2008 : 234 S5 was used. This line was select ed because all progeny had wild type phenotypes, indicating that the parent was a homozygous wild type sibling of heterozygous plant S2008 234 S 3 and S2008 234 S 4. For grass the following sources were used: S2007:21 2 S2 and S2007:212 S4 (mutants). The wil d type sibling for grass was S2007:212 S1. A mapping population was generated to be able to map the mini me and grass loci. The following crosses were made in the Puerto Rico 2009 winter nursery: S2008:234 S3 and S2008:234 S4 (mutants) with B73 ( female wi ld type). For grass the following genotypes were used: S2007:212 S2 and S2007:212 S4 (mutants) and B73 ( female wild type). The F1 progeny of grass and mini me from Puerto Rico were self pollinated in the summer 2010 Live Oak nursery to generate F2 seed s. Due to poor seed set these crosses were repeated in the summer 2010 nursery in Live Oak, FL. Additional mapping populations for mini me and grass were created in the 2011 winter greenhouse in Gainesville, FL. The genotypes that were used were mini me ( S 2008:234 S3 ) and grass ( S2007:212 S2 ) with B73 as the wild type. Backcross es were done with W22 as female with heterozygotes of mini me (S2008 234 S3) and grass (S2007 212 S2) to reduce Mu insertions.

PAGE 52

52 Mu TAIL The Mu flank sequences for mini me obtained via Mu TAIL PCR (kindly provided by the Koch and McCarty Lab s ) were co mpared first to a library of Mu elements from the progenitors of the mutants in an attempt to identify unique Mu flank sequences in the mutants that could be responsible for the mutations. The resulting 71 Mu insertions were then placed on the maize genome by performing a BLAST search of the flanking sequence against the maize genome ( http://www.maizesequence.org ; Schnable et al. 2009). Mu 454 S e quencing One mutant each from mini me (S2008:234 S3) and grass (S2007: 212 S1) were used to prepare Mu 454 libraries. First, the DNA of each mutant was sheared at the ICBR core facility, resulting in many DNA fragments, some of which contained Mu inserts. A biotinylated B adaptor was ligated to the sheared DNA and fragments containing B adapt o r were captured with a streptavidin magnetic bead and a magnetic rack. The primer TIR6, recognizing the TIR of Mu element s was used in a primer extension reaction to make a DNA copy of those fragments containing the TIR of a Mu element. After melting the dsDNA and removal of the template strand with a magnetic bead, the newly synthesized strand served as a template for PCR using a biotinylated B adapter primer and n ested primer TIR8 After size selection streptavidin beads were mixed with the amplified sequences. The biotinylated strand was captured after the dsDNA had been melted in an alkaline solution. A second primer extension reaction with a TDA primer containin g an A adaptor, a 4 base variant library identifier, and a nested Mu TIR primer, was carried out. After removal of the template strand using the streptavidin magnetic beads, the Mu library was ready for 454 sequencing, relying on

PAGE 53

53 the B adapter for annealin g to a bead and using the A adapter as the target for the sequencing primer. Unique sequences were identified with the clustering method from different libraries classified as parents (McCarty et al. 2005) Co segregation A nalysis PCR was used to amplify g enomic DNA fragments of candidate genes. A typical reaction contained per 25 L: 10 ng genomic DNA, and REDTaq ReadyMix PCR Reaction Mix with MgCl 2 (Sigma Aldrich Co St. Louis, MO ). A three step PCR program was used consisting of 94 C for 40 s for denatur ation, 60 C for 30 s for annealing, and 72 C for 40 s for extension with 35 cycles and final extension of 2 min at 72 C with a C 1000 thermal cycler (Bio Rad Laboratories Inc., Hercules, CA) Gene specific primers (GSP) for unique Mu flank sequences identi fied via Mu TAIL PCR of Mu 454 were designe d with Oligo v.6.8 software followed by PCR produ ct analysis on agarose gel (Fig 3 2). The objective was to identify Mu flanking sequences that co segregated with the mutant phenotype. Primers that annealed to ge nomic DNA on the other side of the Mu element could be designed based on the maize genome sequence database ( http://www.maizesequence.org ) SSR Analysis DNA from the 25 F2 grass mutants (obtained from a population of 120 grown in greenhouse individual s) was extracted and pooled and used in a mapping experiment conducted in the Settles lab. The PCR contained 0.25 M SSR primers, 150 M each dNTP, ~ 40 ng DNA, and GoTaq PCR mix ( Promega Co., Madison, WI). A PCR program was used consisting of 34 cycle s of denaturation 94C for 40 s, annealing at 57C for 45 s, and extension at 72C. The SSR primers used in this experiment amplified sequences known to be polymorphic between B73 and W22 (Martin et al.

PAGE 54

54 2010). In order to confirm if the parental alleles w ere segregating as would be expected for an F2 population, an SSR marker in an unknown location near the ZmARF7 gene (Xing et al., 2011) was used to test for segregation Allelism T est In order to conduct an allelism test to determine whether mini me and gr ass are alleles of the same locus, phenotypically wild type plants obtained from selfing a mini me heterozygote were crossed with phenotypically wild type plants obtained from selfing a grass mutant In winter 2011, To identify allelism based on the sequence data, a search was perform ed for Mu flank sequences obtained from the two mutants that mapped to the same locus. A co segregation analysis as described above was subsequently used to identify putative causal mutations. Results Molecular Analysis of Flanking Sequences Identifed with Mu TAIL and Mu 454 For mini me a total of 71 sequences were obtained from Mu TAIL and 10 unique sequences from Mu 454 ( Table 3 1). None of the 10 sequences overlapped with the 71 Mu TAIL sequences. For grass 29 unique sequences were obtained from Mu 454 ( T able 3 1) ; the Mu TAIL analysis was not performed for this mutant. All sequences were mapped to the maize genome ( Table 3 1). Initially co segregation analysis was performed starting with chromosome 1. Not all primer pairs generated products, which may ref lect strong

PAGE 55

55 secondary structures in the DNA and/or high GC content. Of 81 primer pairs tested for mini me 50 generated products, but none of the products co segregated with the mutant phenotype ( Table 3 1). For grass 15 of 29 primer pairs resulted in pr oducts, but none of the products co segregated ( Table 3 1). Mapping P opulation The yield from 2009 Puerto Rico winter nursery where the F2 mapping population was initiated was very poor For mini me only 40 F1 kernels were obta ined, whereas 70 F1 kernels were obtained from the cross with the grass mutant. The F1 progenies from Puerto Rico 2009 were planted in the 2010 summer nursery in Live Oak, FL. The mini me F1 progenies succumbed to larvae, but the grass F1 progenies were a dvanced to the F2 generation. A total of 120 F2 seeds were planted in the greenhouse and yielded 25 mutants, consistent with the expected number assuming that the grass mutation is inherited as a single recessive allele ( X 2 = 1 .11, d.f.= 1 ; p =0.29 ,) The S NP mapping in the Settles lab pointed to enrichment on chromosome 10 The crosses that were repeated at the winter 2011 greenhouse at Gainesville, FL were grown based on six out of ten phenotypically wild type plants from the mini me population to B73 and four (out of seven) phenotypically wild type plant s from the grass population to B73 DNA from 25 F2 grass mutants was pooled. DNA polymorphisms between the pooled DNA from these mutants and B73 identified with a set of SSR markers were analyzed (Martin et al. 2010) in the Settles lab by Frederico Martin. The assumption is

PAGE 56

56 that all mutants contain the W22 allele near the mutant locus, whereas at all other loci they will contain either the W22 or the B73 allele, or bot h (in case of heterozygotes). With bulk segregant analysis (BSA) of the pooled mutants, the results pointed to enrichment on chromosome 3L (SSR marker umc1528). When the mutants were tested individually for the marker allele at this lo cus, however, there w as no apparent linkage between umc1148 and the mutant phenotype. There were 6 individuals homozygous for the B73 allele, 7 homozygous for the W22 allele, and 12 heterozygotes, consistent with a 1:2:1 segregation expected in the absence of linkage ( X 2 = 3.8 4, d.f.= 2, p=0.147). As the putative map location on chromosome 3L was investigated, the embryo9 ( emb9 ) locus ( Clark and Sheridan 1991 ) which maps on chromosome 3L, was considered as a candidate ( Neuffer, 1993). The emb9 mutant produces an enl arged embryo that cannot develop into a seedling, possibly due to a hormone defect. Some of the seeds in the segregating mini me families S2008 234 S3 and S2008 234 S2 were phenotypically similar to emb9 seeds. The emb9 phenotype was observed after the exp eriments that showed the variation in germination of the seedlings Since a mutation of the emb9 locus would explain the reduced germination rate the hypothesis was formulated that the mini me and grass mutants contain weak emb9 alleles, i.e. the penetranc e of the mutation is not complete, allowing some seedlings to germinate. The presence of tillers and reduced height in the mutants is consistent with a hor mone defect, especially auxin. This hypothesis gained further support since the map location for the one Mu insertion identified with Mu 454 that was common in both grass and mini me was located in Zm ARF10 ( Liu et al., 2009),

PAGE 57

57 Two Mu insertions in Zm ARF10 were identifie d in the UniformMu database ( http://uniformmu.uf genome.org/ ): UFMu1449 and UFMu3476. The seeds from the two lines were obtained from the Maize Genetics Stock Center in Champaign Urbana, IL and grown in the 2011 winter greenhouse, Gainesville, FL. The seed s germinated and no apparent mutant phenotype was observed in the plants. The plants were self pollinated to maintain the stock. Two additional SSR markers located near Zm ARF7 and Zm ARF9 both on chromosome 3 ( Xing et al., 2011) were used to test for li nkage to the grass locus. There was no polymorphism between W22 and B73 for the SSR marker near Zm ARF9 The SSR marker near ZmARF7 was polymorphic, but there was no evidence for linkage to the grass locus in the F2 population. There were 5 individuals homo zygous for the B73 allele, 7 homozygous for the W22 allele, and 11 heterozygotes, consistent with a 1:2:1 segregation expected in the absence of linkage ( X 2 = 3.84, d.f.= 2, p=0.147). In summary, there was no evidence to support a map location for grass on chromosome 3, nor for an involvement of Zm ARF candidate genes on this chromosome.

PAGE 58

58 Based on SNP analysis (Liu et al. 2009) of pooled grass samples in the Settles lab, there was a strong enrichment for the W22 allele on chromosome 10, spannin g a 56 Mbp region (AGPv2 84 140 Mbp). There are three Mu insertions on chromosome 10 that could either be responsible for the grass phenotype, or, given the possibility that not all Mu insertions were captured, that may show linkage to the mutation. In the latter case the 56 Mbp region could be narrowed down. None of the three Mu insertions co segregated with the mutant phenotype, ruling out their involvement in causing the mutation i n the F2 grass population Analysis of the 25 grass mutants in the F2 pop ulation showed that all plants were homozygous wild type at the Mu insertion sites from chromosome 10 because PCR amplification with gene specific primers generated a product, whereas amplification with a gene specific primer and a Mu TIR primer did not Homozygosity for wild type alleles at these loci can be explained by the Mu insertions are unlinked to the grass phenotype. Also, if the heterozygo us plant containing the Mu insertion is crossed to B73 and only the wild type allele from the heterozygote plant is inherited in the F1 only the wild type allele will be produced in the F2. In addition, based on the putative enrichment in the mutant s for a region of chromosome 10, an SSR marker near Zm ARF28 was tested based on Xing et al ( 2011 ). This marker was not polymorphic between B73 and W22.

PAGE 59

59 Discussion A very large number of unique Mu flanking sequences w as identified in mini me with Mu TAIL (71 sequences) whereas a much smaller number of sequences w as identified wi th 454 Mu (10 sequences) Since the 10 sequences obtained from 454 Mu did not show overlap with the library obtained from Mu TAIL this indicate technical problems (poor DNA quantification, poor library, poor sequencing data) with the 454 Mu procedure. It a lso suggests an even larger number of Mu insertions may exist than the 71 identified with Mu TAIL since typically 20 30 unique Mu insertions are expected, the mini me mutant represents an unusual situation. The Mu 454 data for grass are more typical (30 insertions) but this may not represent complete coverage either given the mini me results. Mu TAIL and Mu 454 library did not work out A similar approach had been used to identify a candidate gene

PAGE 60

60 underlying a different mutation in the Uniform Mu populat ion, but also without success (Tayengwa, 2008, thesis). Based on these experiences, the depth of coverage with these methods may not be adequate Indeed, according to Settles et al ( 2004 ) only 67% 86% of the known Mu inserts were identified with the Mu T AIL procedure Hence, i t is likely that not all Mu insertions from mini me and grass were sequenced The chromosome 3 location was identified in both mini me and grass with the Mu 454 data The Zm ARF gene s are transcription factors that bind to ear ly auxin response genes (Tiwari et al., 2003) and would be a good candidate gene given the role of auxin in suppressing axillary meristems but t he co segregation analysis did not confirm the role of this gene as a potential candidate. The three Mu inserti ons identified on chromosome 10 did not co segregate with the mutant phenotype. Instead wild type alleles were amplified in all mutants and control s indicated that these three insertions are not responsible for the mutant phenotype or the heterozygote pare nt of the insertion is not associated with the mutant phenotype. A probable explanation for generating wild type alleles in the grass F2 population is that the Mu insertions are unlinked to the grass phenotype Also, if the heterozygote plant containing th e Mu insertion is crossed to B73 and only the wild type allele is inherited in the F1 only the wild type allele will be present in the F2. Despite the lack of clear support for linkage between the mutant phenotype and Mu insertions in Zm ARF1 0 and on chromosome 10, these candidate loci cannot be completely ruled out as a result of inherent challenges with PCR. The inclusion of positive and negative controls would be able to take away some of this uncertainty.

PAGE 61

61 There could be a possibility that the candidates Zm ARF10 and the three Mu insertions from chromosome 10 could be the candidate gene Alternative methods could be devised to re analyzed the candidate genes that includes a positive and a negative PCR control As for the allelism test condu cted in the winter 2011 greenhouse, the two mutants will be considered allelic if mutants are the same phenotype is observed in the progenies of grass and mini me crosses. Verification as to whether the grass allele is segregating in the progenies can be o btained based on phenotypic characterization of seedlings originating from selfed grass seeds. Lack of mutant plants in the progenies from the allelism test could be the result of an absence of the mutant mini me allele (all parents were homozygous wild ty pe by chance), or progeny sizes that are too small to observed mutants, given that the pooling strategy employed may reduce the frequency of the mutant alleles.

PAGE 62

62 Figure 3 1 Schematic representation of the expected result when the Mu insertion and th e mutant phenotype co segregate F 1 (self) F 2 (for mapping) Figure 3 2 Mapping population of mini me and grass

PAGE 63

63 Ear (female) Ear (female) 1/3 grass WT 2/3 grass HET Tassel (male) 1/3 mini me WT 1/9 2/9 Tassel (male) 2/3 mini me HET 1/9 4/9 Figure 3 3 Schematic representation of the procedure to make the allelism cross between grass and mini me and the expected outcome Grass (male) Plant 1 (self) Plant 2 (self) Plant 3 (self) Plant 4 (self) Pooled Grass pollen Mini me (female) Plant 1 Plant 2 Plant 3 Plant 4 Plant 5 Figure 3 4 Schematic rep resentation of the allelism cross in the winter 2011 greenhouse, Gainesville, FL Probability of heterozygote Pr obability of heterozygote 2/3 2/3 2/3 2/3 2/3 2/3 2/3 2/3 2/3

PAGE 64

64 Table 3 1 Number of flanking sequence in each chromosome and primers that were tested Mini me Grass Chromosome Mu TAIL Mu 454 Successful amplif ication Mu 454 Successful amplification 1 10 1 8 0 0 2 15 0 11 7 4 3 11 3 9 2 1 4 8 1 6 1 0 5 4 1 1 1 0 6 1 1 1 6 3 7 4 0 2 2 1 8 7 0 5 1 1 9 7 0 6 1 0 10 4 3 1 6 5 Unknown 0 0 0 1 0 Total 71 10 50 30 15

PAGE 65

65 Table 3 2 mini me a nd grass for 2011 winter greenhouse, Gainesville, FL with the numbers designating plant number Label Name Phenotype Selfed Ear(W22) Ear (B73) Pollen S2008 234 S3 1 Mini me Normal no 30 2 Mini me Normal no 31 G 11,12,15,16 3 Mini me No rmal no 43 G 11,12,15,16 4 Mini me mutant 5 Mini me Normal no 17 29 G 11,12,15,16 6 Mini me mutant 7 Mini me Normal no 28 G 11,12,15,16 8 Mini me mutant 9 Mini me mutant 10 Mini me Normal no 40 G 11,12,15,16 S2007 212 S2 11 Gras s Normal no 26 35 12 Grass Normal yes 32,41 13 Grass mutant 14 Grass mutant 15 Grass Normal yes 45 16 Grass Normal yes 23 27,34,36

PAGE 66

66 CHAPTER 4 DISCUSSION AND RECOM MENDATIONS FOR FUTUR E WORK The morphological analysis indi cated that the tillering was caused by the initiation of an axillary meristem. This axillary meristem appears to be initiated as part of the post embryonic development. T he appearance of tillering may be due to changes in the synthesis or perception of one or more hormones that are known to suppress branching, such as auxin and strigolactone. Arabidopsis branching mutants are defective in hormone biosynthesis or signaling but cross section analysis of the mutant meristems was not carried out (Sorefan et al ., 2003, Schwartz et al., 2004, Zou et al ., 2006) so that it is difficult to use the morphologic changes as evidence for the deficiency in a hormone. Another possibility is that the mutants are misexpressing a gene encoding a transcription factor that is activated in response to a hormone that controls tillering and height, similar to tb1 and gt1 Uneven patterning in the epidermal cell and stomata in the mutants could indicate a defect in cell differentiation. In order to further investigate cell differe ntiation pattern, the nuclei and cell wall can be stained using propidium iodide visualized with a confocal microscope. If the mutants are defective in cell wall differentiation, we would expect to see random cell wall formation. Visualization of the nucle i would further prove if the cells have divided in random formation when compared to the wild type controls. Molecular data obtained from the Mu library, together with the results obtained from SNPs have proven that the candidate gene for grass and mini m e has yet to be identified. The allelism test will be verified once the crosses from the 2011 winter greenhouse are planted out.

PAGE 67

67 The mini me and grass mutants are extreme in their phenotype and the fact that they are the result of a single gene mutations p oints to an unusual degree of pleiotropy. Results presented in this thesis provide evidence against the involvement of more downstream effectors in the hierarchy of possible signals. In the future, the mutation line should be further back crossed into a known homozygous inbred line such as W22 for at least four generations to reduce the copy number of Mu elements so that fewer Mu elements need to be considered for the co segregation analysis. It will be a good plan to include at least two or three individ ual plants of the same mutant for the Mu 454 sequencing after back crossed to avoid discrepancies such as incomplete sequencing of Mu insertions in generating the Mu library The mutation that caused mini me and grass could be a spontaneous mutation. The refore, a map based followed by positional cloning approach or with SNPs with more mutant individuals instead of 25 mutants to obtain a higher resolution of mapping location. A l though time and space consuming, would be more reliable than a providential eve nt

PAGE 68

68 APPENDIX FIGURES AND PRIMERS Figure A 1 Adaxial of wild type,W22, showing purple stained bulliform cells Table A 1 Nested Mu primers used to amplify adjacent DNA segments Primer TIR6 AGAGA AGCCAACGCCAWCGCCTCYATTTCGTC TIR8.1 CGCCTCCATTTCGTCGAATCCCCTS TIR8.2 CGCCTCCATTTCGTCGAATCCSCTT TIR8.3 SGCCTCCATTTCGTCGAATCCCKT TIR8.4 CGCCTCCATTTCGTCGAATCACCTC Table A 2 Co segregation pri mers for Mini me Name Sequence Zmmim 3.1 U144 CATTGCTCGTCTCTTTGGTCACGC Zmmim 3.1 L1643 TCTCCACCGTCATCGCCATTGCT Zmmim 3.2 U367 TAGGTTGCGAGAAAGCCAGTCCCT Zmmim 3.2 L2390 ACTCCCAACGACAGCGAGAAGTGA Zmmim 3.3 U289 TAACTCGGCTCGCTTGCTCATGTC Zmmim 3.4 U328 A GAAGCCCGATTATGGACGCTGTGT Zmmim 3.4 L1460 GTAGACCCAGTCACGATCCTAAAATCC Zmmim 3.5 U309 TCACTGGGGTTCACTCCTCTTGC Zmmim 3.5 L1307 CCATTTGGCTGCTCTGTATTTGTAATCC Zmmim 3.6 U327 GGAGAGGGGGTAACAAAGTAAAGAGC Zmmim 3.6 L1266 CACTTTTTCCTGCTACACCGTAGTGC Zmmim 3.7U95 TCTTCGCACACGCACTCCACAC

PAGE 69

69 Table A 2 Continued. Name Sequence Zmmim 3.7 L1371 TATGTCCCCCCAGTTTCGTCGTCT Zmmim 3.8 U148 TAAGGCGTGATGTGGGTGGGGAA Zmmim 3.8 L937 CTGTGGGCTTCAACAATATACCATCCG Zmmim 3.9U59 TCACCGCTTCGCTCAGTATCGCTT Zmmim 3.9 L1340 TGTCGGATTGGTGGGTCGGAAC Zmmim 3 .10 U181 ATCACCACCAGCAGTACCACAGGA Zmmim 3.10 L1253 TCTCGGGTACAATTTCGGGTCGG Zmmim 3.11 U525 AGACCGCTCTTTGTGCCGACTATG Zmmim 3.11 L1811 TCCACCGCAGATTTTTGGGGACGA Zmmim 3.12 U97 CAGACCGATCATGTGTAGCATCAGC Zmmim 3.12 L1428 CTCGTGCGAAAAGCCATCACAGCAT Zmmim 3. 13 U302 GATTCGGTGTGGTCTCTTTGTAGGG Zmmim 3.13 L1199 GAGGGGGAAAAACTTCAGTGGCAG Zmmim 3.14 U97 CAGACCGATCATGTGTAGCATCAGC Zmmim 3.14 L1446 AGTGCGATATAGGAATCCCTCGTGC Zmmim 4.2 U233 CTCTGCGTGAGTGCGTGTTTGGAT Zmmim 4.2 L1253 ACTGGGGCACACCTGTATTCTCC Zmmim 4.3U 26 GAGAAGGGCAAATCTGTCTAGTGGAG Zmmim 4.3 L1446 ACAACCCGCCGTCTGTAACACC Zmmim 4.4 U182 AGACCGCTTCAGTTTACCCACTTTGC Zmmim 4.4 L1022 GAGATGGGAGAGGATAGAGATGGAC Zmmim 5.1 U445 AGTCCAGCCAAGAGTCATCGGTAC Zmmim 5.1 L952 CAATGGGCTAGTAGGGGTAACTCG Zmmim 5.3 U642 A TTGCGGACATGGCTCGGTCTTG Zmmim 5.3 L1338 GTGGGCTCCGACAAGTGTGGTA Zmmim 5.4 U275 CTAGCCAAACAGGATATTTGCTGAGTAC Zmmim 5.4 L1151 TTTCCGACTATTACCGACCGTTTTCATTC Zmmim 6.1 U517 CTCCGCCTTGAATCTCCATCAGATC Zmmim 6.1 L1234 AGGGATCAGGAGCCACGGTGT Zmmim 6.2 U574 TAAG GGGGAGTAAGCGGACAGCAA Zmmim 6.2 L1120 TAGGCGTGAGGCGTATCGTCTTC Zmmim 7.1 U343 GTGTGCCAATACTCCTCCTAGTCC Zmmim 7.1 L1106 AAGAGCGACGGGATGATGCTGTAG Zmmim 7.2 U242 ACAGCCGCCCTTCCAGATGGT Zmmim 7.2 L1272 TCTAGCCGTGCCAAATGTCAAATATGG Zmmim 7.3 U591 CACAGCCAACGA GTACACGAACTTG Zmmim 7.3 L1447 AAGCCCCGAACACACTGACCACT Zmmim 7.4 U464 ACTATGCTGTGTACTTGGTAGTTTGAAC Zmmim 7.4 L1330 CTCAGCGTTACAAGTCAACTAGAACA Zmmim 8.1 U530 AGGGGGAGGAGATGGAGTAGGAA Zmmim 8.1 L1404 GAACTGGTGGGCTTAGTGGTTGG

PAGE 70

70 Table A 2 Continued. Name Sequence Zmmim 8.2 U140 TAACGGCGTGTTGGA ATCTTGATGCG Zmmim 8.2 L1355 CTATTTCCGACGAGTTATCCACGACG Zmmim 8.3 U636 AAAACCCTCTCCTCTCTCATCCGC Zmmim 8.3 L1436 TGGTGGGGTGGGATAGCACACT Zmmim 8.4 U618 AATCCGCCATACCCGTGCCCTAAT Zmmim 8.4 L1003 TAAAGCCGCCAAGTCTGAGGTGAG Zmmim 8.5 U594 GTATGGCTCTTTGTACTGCT CCAGC Zmmim 8.5 L1160 TCATCGTCGCCTCCAACCCTGT Zmmim 8.6 U306 TGAAGGGAGATGTGAGCACCGACT Zmmim 8.6 L1145 TTCTGCTGCTGTAGGTGTGGGTGT Zmmim 8.7 U476 GGTTGGGCTGAGGTTATTTGGTCTG Zmmim 8.7 L1263 AGACTCGCCAAACTGCTGCCC Zmmim 9.1 U414 TAACGGTGGAGAAGGTCAAGTCGG Zmmi m 9.1 L767 TACCTCTCGCCCCCACTGCC Zmmim 9.2 U606 CTGCCGCTGTCACAGAAACCCA Zmmim 9.2 L930 TGGTGCCCTCGTCAAAGTGTAGC Zmmim 9.3 L1090 CGTACGGCACCTTATTTCAATCTCGC Zmmim 9.4U72 GGAGCCGTTCTCTTTCCCTTCATAT Zmmim 9.4 L1273 CTTGGGTGGATGAGATGTCTGAAAAAC Zmmim 9.5U62 TCACCCCCAAAATCTTCCACATGCG Zmmim 9.5 L766 CCTTCCCCAGTCCCCACTACC Zmmim 9.6 U632 TTTGCGGGACCTTTTTGCTGCTGC Zmmim 9.6 L988 GGACCCGATACATGCTAACTAATGGAG Zmmim 9.7 U523 TGTCGGGAAGAAGGGCTAGGGTTT Zmmim 9.7 L1239 GTCTGCTCGGTTCGCTGTCTAACT Zmmim 10.1 U80 AGAGGCTG GAATCACTCGTGGACT Zmmim 10.1 L1264 TGCGGCGACCAGATTAGCAACC Zmmim 10.2 U664 ATAGCCAACAGAACTACGACCAGTGG Zmmim 10.2 L124 GATACCCGCCCACCTTCTTTAAGTTACT Zmmim 10.3 U620 GTTGGCGTATGTAGCATACCGTACAG Zmmim 10.3 L1095 GAGGGGAGAGAGAAAGATCAGAGC Zmmim 10.4 U585 CGTC CCGTTTTCATCCCTACATCAAC Zmmim 10.4 L1329 AAACCCCCCAAATCCAGTTACACCC Zmmim 10.5 U207 TCAGCGGCATTACTGGCAGATTCCAT Zmmim 10.5 L1078 CTTCGGGGTCGTTCACGCTCT Zmmim 10.6 U506 TGACCCCACCTGTCAGTAAAGTTACC Zmmim 10.6 L885 TCACGCCGACCACCACCGAAAATA Zmmim 10.7 U681 GT TCGCCCAGGTCTACTCCTATCT Zmmim 10.7 L1191 GAGGACCCATCACACTAACTTGTCAC Zmmim 4.3r U367 TCTTGGGACGGAGGTAGTATGTCC Zmmim 4.3r L1565 TCAGGGGAGACCATAACACGGGA

PAGE 71

71 Table A 2 Continued Name Sequence Zmmim 4.4r U377 AGGTCGCACAACAGCAAAGGCTAG Zmmim 4.4r L1364 TTTCGCTCCATCGTGTTGTTCTTTCTG Zmmim 4.11r U93 ATAGGCACAGTATGGGACAGCGAC Zmmim 4.11r L1164 ACCGCCCCTTCCTCCGATTTGTT Zmmim 4.12r U354 AAGCCGAGTCCACCACCAAGCAT Zmmim 4.12r L820 TTTCGCCGTCTTATCCCTTCGTCC Zmmim 5.1r U104 AACCCGACCCATTGCCATCCCTAT Zmmim 5.1r L1532 TTCCCCTTCCTCCTCCTCGTCAT Zmmim 5.2r U738 C TTGCCATCCATGAACAACCCAGAG Zmmim 5.2r L1800 GTCGCCCAATTCGTTTACCTCCTC Zmmim 6.1r U260 ACTCGGTCAAGCAAGTAGTTCTGG Zmmim 6.1r L1773 CTTGGCATGGAGTCATAACATGGTC Zmmim 7.1r U507 GTTGCGTCCCTGTTTACATGATCTG Zmmim 7.1r L1099 GTTTGGCGACAACAAGGAGCAGTG Zmmim 8.3r U132 GTTGGGACCAGAGAGGAACAACTTTT Zmmim 8.3r L1245 AAAACGGCAATGGTTAGGGTATCCAC Zmmim 8.6r U576 GGTTGGGCTGAGGTTATTTGGTCTG Zmmim 8.6r L1525 GTTGCGGACAGTCTAAGAGTGGTCT Zmmim 9.3r L1373 CTTGGGTGGATGAGATGTCTGAAAAAC Zmmim 10.1r U374 ATCCGCAAGGAGGTCTTCGTCTC Zmmim 1 0.1r L1017 CGTCCCGTTTTCATCCCTACATCAAC Table A 3 Co segregation primers for Grass Name Sequence Zmgra_2.2 U308 CTAACTCGGTGCTAAAGGTGTTGGTG Zmgra_2.2 L995 GAGATGCGTGATGTTGCTTGCCAC Zmgra_2.3 U481 AAACTGCTTTGCTCCATTTCTCTCGC Zmgra_2.3 L1042 AGA TCGTGGATGCCTCCTGGTG Zmgra_2.4 U488 GTCAGCCTTACCTAACGCAAGCC Zmgra_2.4 L681 CTCTCGCTCTCGTGGACTGACT Zmgra_2.5 U394 TAGACCGTTTTCACCGTAAAAGGCACA Zmgra_2.5 L1061 TTTGAGGGAACTTGATGACTGCTCG Zmgra_2.6 U279 TGAAGGGAAACAAGTAGCAACCATGAAC Zmgra_2.6 L627 GGACTCCAG CAGGCAGTCCAA Zmgra_2.7 U130 GCAACGGAGGACATTTATACACACAT Zmgra_2.7 L1016 CTTCACCCTGGTTCAGATTTCCTTAT Zmgra_3.2 U192 GAGAGGGGAGATTCGGTGTGGT Zmgra_3.2 L988 GAGTAGGGGAAGAGGTGCTGTC Zmgra_6.4 U127 ATAGGTTCGGTTTGGTTCGGCTCG Zmgra_6.4 L1057 GAACTCCGTGTTCGTCTCTG GGTA Zmgra_6.6 U276 GATATTGAGGATTATGCCACCCTACCA

PAGE 72

72 Table A 3 Continued. Name Sequence Zmgra_6.6 L997 TCTCACTTTCGTATAGAGATAGGTCAGG Zmgra_6.7 U113 GAGACCCCTCACACACTCACAGA Zmgra_6.7 L1072 GATAGGCAGAGTGGAGTCTTGTAGTG Zmgra_7.1 U113 GAGACCCCTCACACACTCACAGA Zmgra_7.1 L903 GACACGACGAGCACACAGAGAT TG Zmgra_7.2 U228 GTCTAAGCGATCTTCACCATAATACAACG Zmgra_7.2 L687 TGAGGAGGCGTTGAGGAACTTGAG Zmgra_8.1 U412 AAATCCGCCATACCCGTGCCCTAA Zmgra_8.1 L900 AAGAAGCAAGTACCTGGTTCAGAACTC Zmgra_9.1 U335 GCTCGGCTCGTTTCCACTCCTA Zmgra_9.1 L1082 CATTCTCGGCACATATCTCGTCACT G Zmgra_10.2 U373 AAATCCCACTCGCCAACTCACCCT Zmgra_10.2 L904 TACCTCCGAGACCGAGAAGCATTCTT Zmgra_10.6 U46 AGATTGGTGCGTCCACACGAGAGT Zmgra_10.6 L831 GTATCCGTCCCGTTTTCATCCCTAC Zmgra 2.2r U92 GTTTAGCAAGGTCAGGAGATGGTGG Zmgra 2.2r L1037 GATGGGACTGTTTGTTTGTGGGAC G Zmgra 2.5r U682 TTGCCGCCTTGCCTCCACTCCA Zmgra 2.5r L807 GTGGGGACTGGAAACGTGGGGT Zmgra 2.6r U117 ACCACCTGATGCCATTTGAACTGGAG Zmgra 2.6r L1375 CTGCCGCTGCTTTGCTTTGCTC Zmgra 2.7r U331 CAACGGAGGACATTTATACACACATAGGT Zmgra 2.7r L819 ACGCCCGACATCAGCCTCGTAT Z mgra 6.4r U548 CCTACGGTCCTACCTGGCTACC Zmgra 6.4r L1006 GGAGCGGAGGTTGAGGGACTTGA Zmgra 6.6r U620 GAATCCGCTTACTAAAAGGCTTCCATCC Zmgra 6.6r L1123 CTAGCGATGTTGGTGGCTTTCCTC Zmgra 6.7r U314 AGACCCCTCACACACTCACAGACA Zmgra 6.7r L1098 GACGAGCACACAGAGATTGGTTGG Z mgra 7.1r U295 GATGGGGGATTGGGATTTGGGACT Zmgra 7.1r L786 TAGTGCCCTAGTTCCTGTCCAAGC Zmgra 7.2r U526 TAAGGGGCAGGTGGAACTCTCC Zmgra 7.2r L827 GAGGAGGCGTTGAGGAACTTGAG Zmgra 9.1r U436 CTCGGCTCGTTTCCACTCCTAGGT Zmgra 9.1r L973 CTCGGGCATCGGCAGTGGGAA Zmgra 2.1 c hr6B73 U551 CTACCGCTCTCCATGAGTGGCAAAT Zmgra 2.1 chr6B73 L1121 GAAGGGGGAAGAAGAAAAGGCTGC Zmgra 2.2r2 U510 AACTCGGTGCTAAAGGTGTTGGTGTT Zmgra 2.2r2 L1465 ACTCGCAGGTCTGGGAGATTCATTC Zmgra 2.5r2 U297 TATGGCAAAAATGTACGACCAGATCAAA Zmgra 2.5r2 L1639 CACACGGTTCTA CTATGTCCAACA

PAGE 73

73 Table A 3 Continued. Name Sequence Zmgra 2.6r2 U408 CATGCCGCAATGTAGAATGCTTCAATC Zmgra 2.6r2 L1595 GAAGGCGACAATCTGTTGCTCGG Zmgra 2.7r2 U211 ATTCGGAAGAGAAGCGTTGACTCG Zmgra 2.7r2 L1353 ATCTTGCCGTGTAGACACTTCGCA Zmgra 6.4r2 U650 TACGGTCCTACCTGGCTACCTTC Zmgra 6.4r2 L1542 CTCCCC AAACATAGTCAGCGGAAG Zmgra 6.6r2 U162 TAAGCCCTCTTCTGAATCATTACCTCCC Zmgra 6.6r2 L1696 ATCGGGTTTATGTTCGTGCTCTCGGA Zmgra 6.7r2 U27 TGACCGTGGTTAGTAGAGTCTCAATCTG Zmgra 6.7r2 L1425 TCGGCGAGCTGTGGTAAAGCGTA Zmgra 7.1r2 U396 ATGGGGGATTGGGATTTGGGACTTG Zmgra 7.1r 2 L1713 CTGTGGCGGAACTGCGTGAATTATTC Zmgra 7.2r2 U158 CTAGGGCTCTCTTACAGAGGGTTG Zmgra 7.2r2 L1682 CAGTGCCCACATCATGCCAAACTAC Zmgra 9.1r2 U2 TCATCGGTGGAAGAGGAGACAGACT Zmgra 9.1r2 1802 TGAGCCGTTCAAAGCGTGCCAAAAC

PAGE 74

74 LIST OF REFERENCES Arite T, Iwata H, Ohshi ma K, Maekawa M, Nakajima M, Kojima M, Sakakibara H, Kyozuka J (2007). DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud outgrowth in rice. Plant J 51: 1019 1029. Ashikari M, Sasaki A, Ueguchi Tanaka M, Itoh H, Nishimura A, Datta S, Ishiyama K, Sai to T, Kobayashi M, Khush GS, Kitano H, Matsuoka M (2002). Loss of function of a rice gibberellins biosynthetic gene, GA20 oxidase (GA20ox 2), led to the rice green revolution. Breed Sci 52: 143 150. Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, N ishimura A, Angeles A, Qian Q, Kitano H, Matsuoka M. (2005). Cytokinin oxidase regulates rice grain production. Science 309: 741 745. Benfey PN, Linstead PJ, Roberts K, Schiefelbein JW, Hauser M T, Aeschbache, RA (1993). Root development in Arabidopsis : f our mutants with dramatically altered root morphogenesis. Development 119: 57 70. Benito MI, Walbot V (1997). Characterization of the maize M utator transposable element MURA transposase as a DNA binding protein. Mol Cell Biol 17: 5165 5175. Bennetzen JL (1 984). Transposable element Mu1 is found in multiple copies only in Mutator maize lines. J Mol Appl Genet 2: 519 524 Beveridge CA, Symons GM, Murfet IC, Ross JJ, Rameau C (1997). The rms1 mutant of pea has elevated indole 3 acetic acid levels an d reduced root sap zeatin riboside content but increased branching controlled by graft transmissible signal(s). Plant Physiol 115: 1251 1258. Bishop GJ, Nomura T, Yokota T, Harrison K, Noguchi T (1999). The tomato DWARF enzyme catalyses C 6 oxidation in br assinosteroid biosynthesis. Proc Natl Acad Sci USA 96:1761 1766. Bleckman A, Simon R (2009). Interdomain signaling in stem cell maintenance of plant shoot meristems. Mol Cells 27: 615 620. Booker J, Sieberer T, Wright W, Williamson L, Willett B, Sternberg P, Turnbull C, Srinivasen M, Goddard P, Leyser O (2005). MAX1 encodes a cytochrome P450 family member that acts downstream of MAX3 /4 to produce a carotenoid derived branch inhibiting hormone. Dev Cell 8:443 449. Bouwmeester HJ, Roux C, Lopez R, Guillaume B (2007).Rhizosphere communication of plants, parasitic plants and AM fungi. Trends Plant Sci 12: 224 230.

PAGE 75

75 Chandler V, Rivin C, Walbot V (1986). S Table. non mutator stocks of maize have sequences homologous to the Mu1 transposable element. Genetics 114: 10 07 1021. Chandler VL, Walbot V ( 1986). DNA modification of a maize transposable element correlates with loss of activity. Proc Natl Acad Sci USA 83: 1767 1771. monooxygenases controls Arabidopsis. Genes Dev 20: 1790 1799. Chuck GE, Cigan MA, Saeteurn K, Hake S ( 2007). The heterochronic maize mutant Corngrass1 results from over expression of a tandem microRNA. Nat Genet 39: 544 549. C lark SE, Williams RW, Meyerowitz EM. (1997). The CLAVATA1 gene encodes a Arabidopsis. Cell 89, 575 585. Cubas P, Lauter N, Doebley J, Coen, E. (1999). The TCP domain: a motif found in proteins regulating plant growth and development. Plant J 18: 215 222. Doebley J, Stec A, Hubbard L (1997). The evolution of apical dominance in maize. Nature 386: 485 488. Doebley J (1983). The taxonomy and evolution of Tripsacum and teosinte, the closest relatives of maize. Pp. 15 28 in Gordon DT, Knoke JK Nault LR, eds., Proc Intl Maize Virus Disease Colloquium and Workshop. The Ohio State University, Ohio Agricultural Research and Development Center, Wooster, Ohio. Doust A (2007a). Architectural evolut ion and its implications for domestication in grasses. Ann Bot 100: 941 950. Doust A (2007b). Grass architecture: genetic and environmental control of branching. Curr Opin Plant Biol 10: 21 25. Dun EA, Ferguson BJ, Beveridge CA (2006). Apical dominance and shoot branching: divergent opinions or divergent mechanisms? Plant Physiol 142: 812 819. Eveland AL, McCarty DR, Koch KE (2008). Transcript profiling by 3' untranslated region sequencing resolves expression of gene families. Plant Physiol 146:32 44. Fergu son BJ, Beveridge CA (2009). Roles for auxin, cytokinin, and strigolactone in regulating shoot branching. Plant Physiol 149: 1929 1944. Finlayson FA ( 2007). Arabidopsis TEOSINTE BRANCHED1 LIKE 1 regulates axillary bud outgrowth and is homologous to monocot TEOSINTE BRANCHED1. Plant Cell Physiol 48: 667 677.

PAGE 76

76 Gale MD, Law CN, Marshall GA, Worland AJ. (1975). The genetic control of gibberellic 399. Galinat WC (1954). Corn grass: I. corn grass as a prototype or a false progenitor of maize. The American Naturalist 8: 101 104. Gallavotti A, Yang Y, Schmidt RJ, Jackson D (2008). The relationship between auxin transport and maize branching. Plant Physiol 147:1913 1923. Gomez Roldan V, Fermas S, Brewer PB, Puech Page`s V, Dun EA, Pillot JP, Letisse F, Matusova R, Danoun S, Portais JC (2008). Strigolactone inhibition of shoot branching. Nature 455: 189 194. Gray JE, Stuart C, Lee H (2008). Intercellular peptide signals regulate plant meristemati c cell fate decisions. Sci Signal 49:e53. Gray WM., Kepinski S., Rouse D., Leyser O, Estelle, M (2001). Auxin regulates SCF (TIR1) dependent degradation of AUX/IAA proteins. Nature 414 :271 6. Grove MD, Spencer GF, Rohwedder WK, Mandava N, Worley JF (1979) Brassinolide, a plant growth promoting steroid isolated from Brassica napus pollen. Nature 281:216 17. Harberd NP, Freeling M (1989). Genetics o f dominant gibberellin maize. Genetics 121:827 38. Hulbert SH, Richter TE, Axtell JD, Bennetzen JL (1990). Genetic mapping and characterization of sorghum and related crops by means of maize DNA probes. Proc Natl Acad Sci USA 87: 425 1 4255. Ikeda A, Tanaka MA, Sonoda Y, Kitano H, Koshioka M, Futsuhara M, Matsuoka M, Yamaguchi J.2001. Rice, a constitutive gibberellin response mutant, is caused by a null mutation of the SLR1 gene, an ortholog of the height regulating gene GAI/RGA/RHT/D8 Plant Cell 13: 999 1010. Jackson D, Hake S (1999). Control of phyllotaxy in maize by the abphyl1 gene. Development 126: 315 323. James MG, Scanlon MJ, Qin M, Robertson DS, and Myers AM (1993). DNA sequence and transcript analysis of transposon MuA2, a re gulator of mutator transposable element activity in maize. Plant Mol Biol 21: 1181 1185. Jasinski S, Piazza P, Craft J, Hay A, Woolley L, et al (2005). KNOX action in Arabidopsis is mediated by coordinate regulation of cytokinin and gibberellin activities. Curr Biol 15:1560 65. Jin J, Huang W, Gao J P, Yang J, Shi M, Zhu MZ, Luo D Lin HX (2008). Genetic control of rice plant architecture under domestication. Nat Genet 40: 365 369.

PAGE 77

77 Jones PM, George AM (2004). The ABC transporter structure and mechanism: per spectives on recent research. Cell Mol Life Sci 61:682 99. Kebrom TH, Brutnell TP (2007). The molecular analysis of the shade avoidance syndrome in the grasses has begun. J Exp Bot 58: 3079 3089. Kellogg EA (1998). Relationships of cereal crops and other g rasses. Proc Natl Acad Sci USA 95: 2005 2010 Kerstetter KE, Vollbrecht YE, Lowe B, Veit B, Yamaguchi J, Hake S (1994). Sequence analysis and expression patterns divide the maize knottedl like homeobox genes into two classes. Plant Cell 6: 1877 1887. Khamli chi RC, Huntley R, Jacqmard A, Murray JH (1999). Cytokinin activation of Arabidopsis cell division through a D type cyclin. Science 283: 1541 1544. Khush GS (2001). Green Revolution: The way forward. Nature Rev Genet 2: 815 822. Koka CV, Cerny RE, Gardner RG, Noguchi T, Fujioka S, Takatsuto S, Yoshida S, Clouse SD (2000). A putative role for the tomato genes DUMPY and CURL 3 in brassinosteroid biosynthesis and response. Plant Physiol 122:85 98. Le QH, Wright S, Yu Z, Bureau T (2000). Transposon diversity in Arabidopsis thaliana. Proc Natl Acad Sci USA 97: 7376 7381. Leyser O (2003).Regulation of shoot branching by auxin. Trends Plant Sci 8: 541 545. Lincoln C, Britton JH, Estelle M (1990). Growth and development of the axr1 mutants of Arabidopsis. Plant Cell 2: 1071 1080. Lisch D (2002). Mutator transposons. Trends Plant Sci 7: 498 504. Mandava B.N. (1988). Plant growth promoting brassinosteroids.Annu. Rev. Plant Physiol. Plant Mol. Biol 39:23 5 May EW, Craig NL (1996). Switching from cut and paste to replica tive Tn7 transposition. Science 272: 401 404. Mayer KFX, Schoof H, Haecker A, Lenhard M, Jrgens G, Laux T (1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95: 805 815. McCarty DR, Carson CB, Stinard PS, Robertso n DS (1989). Molecular analysis of viviparous 1: an abscisic acid insensitive mutant of maize. Plant Cell 1: 523 532. McCarty DR, Settles AM, Suzuki M, Tan BC, Latshaw S, Porch T, Robin K, Baier J, Avigne W, Lai Messing J, Koch KE, Hannah K. (2005).Steady state transposon mutagenesis in inbred maize. Plant J 44: 52 61.

PAGE 78

78 McClintock B (1950).The origin and behavior of mu Table. loci in maize. Proc Natl Acad Sci USA 36: 344 355. McClintock B (1947). Cytogenetic studies of maize and Neurospora. Carnegie Inst Was h Year 46:146 152. McLaughlin M, Walbot V (1987). Cloning of a mu Table. bz2 allele of maize by transposon tagging and differential hybridization. Genetics 117: 771 776. Monna L, Kitazawa N, Yoshino R, Suzuki J, Masuda H, Maehara Y, Tanji M, Sato M, Nasu S, 1: rice synthesis. DNA Res 9: 11 17. Muller R, Bleckmann A, and Simon R (2008). The receptor kinase CORYNE of Arabidop sis transmits the stem cell limiting signal CLAVATA3 independently of CLAVATA1. Plant Cell 20: 934 946. Multani SM, Briggs SP, Mark SA. Chamberlin, Blakeslee JJ, Murphy AS, Johal JS. (2003). Loss of an MDR transporter in compact stalks of maize br2 and sor ghum dw3 mutants. Science 302: 81 84. Nomura T, Kitasaka Y, Takatsuto S, Reid JB, Fukami M (1999). Brassinosteroid/sterol synthesis and plant growth as affected by lka and lkb mutations of pea. Plant Physiol 119:1517 526. Nomura T, Nakayama M, Reid JB, Tak euchi Y, Yokota T (1997). Blockage of Physiol 113:31 37. Ohyama K, Shinohara H, Ogawa Ohnishi M, Matsubayashi Y ( 2009). A glycopeptide regulating stem cell fate in Arabidopsis thaliana. Nature 5: 578 580. Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A et al. (2009). The Sorghum bicolor genome and the diversification of grasses. Nature 457 : 551 556. Peng JR, Ri chards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE, Beals J, Fish LJ, Worland AJ, Pelica F, Sudhakar D, Christau P, Snape J, Gale MD, Herberd NP (1999). Green revolution genes encode mutant gibberellin response modulators. Nature 400: 256 261. Peng J Carol P, Richards DE, King KE, Cowling RJ (1997). The Arabidopsis GAI gene Genes Dev 11: 3194 3205.

PAGE 79

79 Pysh LD, Wysocka Diller JW, Camilleri C, Bouchez D, Benfey PN (1999). The GRAS gene family in Arabidopsis: sequence characterization and basic expression analysis of the SCARECROW LIKE genes. Plant J 18: 111 119. Qin MM, Robertson DS, Ellingboe AH (1991). Cloning of the mutator transposable element MuA2, a putative regulator of soma tic mutability of the a1 mum2 allele in maize. Genetics 129: 845 854. Reilly CO, Shepherd NS, Pereira A, Schwarz Sommer Z, Bertram I, Robertson D, Peterson PA, Saedler HS. (1985). Molecular cloning of the a1 locus of Zea mays using the transposable element s En and Mu1. EMBO J 4: 887 882. Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP (2002). Prediction of plant microRNA targets. Cell 110: 513 520. Riou Khamlichi C, Huntley R, Jacqmard A, Murray JA (1999). Cytokinin activation of Arabidopsis cell division through a D type cyclin. Science 283:1541 44. Robertson DS (1978). Characterization of a mutator system in maize. Mutat Res 51: 21 28. Rojo E, Sharma VK, Kovaleva V, Raikhel NV, Fletcher J (2002). CLV3 is localized to the extracellular space, where it activates the Arabidopsis clavata stem cell signaling pathway. Plant Cell 14: 969 977. Sakakibara H ( 2006). Cytokinins: activity, biosynthesis, and translocation. Annu Rev Plant Biol 57:431 49. Sasaki A, Ashikara M, Ueguchi Tanaka M, Itoh H, Nish imura A, Swapan D, Ishiyama K, Saito T, Kobayashi M, Khush GH, Kitano H, Matsuoka M (2002). Green revolution: a mutant gibberellin synthesis gene in rice new insight into the rice variant that helped to avert famine over thirty years ago. Nature 416: 701 702. Schnable PS Ware D Fulton RS Stein JC Wei FS Pasternak S Liang CZ Zhang JW Fulton L Graves TA et al. (2009). The B73 Maize Genome: Complexity, Diversity, and Dynamics. Science 326 : 1112 1115. Settles AM, Holding DR, Tan BC, Latshaw SP, Liu, Suzuki M, Li L, O'Brien BA, Fajardo DS, Wroclawska EA, Tseung CW, Lai JS, Hunter CT III, Avigne WT, Baier JP, Messing JP Hannah CS, Koch KE, Becraft BE, Larkins BE McCarty DR. (2007). Sequence indexed mutations in maize using the UniformMu transposon tagging popula tion. BMC Genomics 8:116. Silverstone AL, Ciampaglio CN, Sun T P (1998). The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway. Plant Cell 10: 155 169.

PAGE 80

8 0 Singleton WR (1951). Inheritance of Corn g rass, a macromutation in maize, and its 96. Siobhan A, Braybrook Kuhlemeier C (2010). How a Plant Builds Leaves. Plant Cell 22: 1006 1018. Takeda T, Suwa Y, Suzuki M, Kitano H, Tanaka MU, Ashikari MU, Matsuoka M, Ueguchi C (2003). The OsTB1 gene negatively regulates lateral branching in rice. Plant J 33: 513 520. Teale WD, Paponov IA, Klaus Palme ( 2006). Auxin in action: signalling, transport and the control of plant growth and development. Nature Rev Mol Cell Biol 7: 857 859. Trotochaud AE, Hao T, Wu G, Yang Z, Clark SE (1999). The CLAVATA1 receptor like kinase requires CLAVATA3 for its assembly into a signaling complex that includes KAPP and a Rho related protein. Plant Cell 11: 393 406. Umehara M Hanada A, Yoshida S, Akiyama K, Arite T, Takeda Kamiya N, Magome H, Kamiya Y, Shirasu K, Yoneyama K (2008). Inhibition of shoot branching by new terpenoid plant hormones. Nature 455: 195 200. Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Kamiya KT Magome H, Kamiya Y, Shirasu K, Yoneyama K, Kyozuka J, Yamaguchi S (2008). Inhibition of shoot branching by new terpenoid plant hormones. Nature 455: 195 200. Vermerris W, Vreugdenhill D, Visser RGF (2001). mRNA localization in invitro grown microtubers of potato as a tool to study starch metabolism. Plant Physiol Biochem 39: 161 166. Walbot V (2000). Saturation mutagenesis using maize transposons. Curr Opin Plant Biol 3:103 107. Wang J, Roe B, Macmil S, Yu Q, Murray JE, Tang H, Chen C, Najar F, Wiley G, Bo wers J, Sluys MAV, Rokhsar DS Hudson ME, Moose SP, Paterson AP, Ming R. (2010). Microcollinearity between autopolyploid sugarcane and diploid sorghum genomes. BMC Genomics 11: 261. Wang X, Chory J (2006). Brassinosteroids regulate dissociation of BKI1, a negative regulator of BRI1 signaling, from the plasma membrane. Science 313:1118 22. Wang ZY, He JX. (2004). Brassinosteroid signal transduction choices of signals and receptors. Trends Plant Sci 9:91 96. Weil CF, Kunze R (2000). Transposition of maize Ac/ Ds transposable elements in the yeast Saccharomyces cerevisiae. Nat Genet 26: 187 190.

PAGE 81

81 Werner T, Motyka V, Laucou V, Smets R, Van Onckelen H, Schmulling T (2003). Cytokinin alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem ac tivity. Plant Cell 15: 2532 2550. Willige BC, Ghosh S, Nil C, Zourelidou M,. Dohmann EMN, Maier A, Schwechheimer C ( 2007). The DELLA domain of GA INSENSITIVE mediates the interaction with the GA INSENSITIVE DWARF1A gibberellins receptor of Arabidopsis. Pla nt Cell 19: 1209 1220. Winkler RG, Freeling M (1994). Analysis of the autonomy of maize dwarf 1 action in genetic mosaics. J Hered 85: 377 80. Woodhouse MR, Freeling M, Lisch D (2006). Initiation, establishment, and maintenance of heri Table. MuDR transposo n silencing in maize are mediated by distinct factors. PLoS Biol 4: e339. Woodhouse MR, Freeling M, Lisch D (2006). The mop1 (mediator of paramutation1) mutant progressively reactivates one of the two genes encoded by the MuDR transposon in maize. Genetics 172: 579 592. Xu M, Zhu L, Shou HX, Wu P (2005). A PIN1 family gene, OsPIN1, involved in auxin dependent adventitious root emergence and tillering in rice. Plant Cell Physiol 46: 1674 1681. Yabuta T, Sumiki Y (1938). On the crystal of gibberellin, a subst ance to promote plant growth. J Agric Chem Soc Japan. 14:1526. Yamamoto Y, Kamiya N, Morinaka Y, Matsuoka M, Sazuka T (2007). Auxin biosynthesis by the YUCCA genes in rice. Plant Physiol 143: 1362 1371. Yamamuro C, Ihara Y, Wu X, Noguchi T, Fujioka S, et a l (2000). Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 12:1591 606. Yamamuro C, Ihara Y, Wu X, Noguchi T, Fujioka S, Takatsuto S, Ashikari M, Kitano H, Matsuoka Ml (2000). Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 12:1591 1605. Yanai O, Shani E, Dolezal K, Tarkowski P, Sablowski R, Sandberg G, Samach A, Naomi O (2005). Ar abidopsis KNOXI proteins activate cytokinin biosynthesis. Curr Biol 15:1566 71. Yu J, Hu SN, Wang J, Wong GKS, Li SG, Liu B, Deng YJ, Dai L, Zhou Y, Zhang XQ et al (2002). A draft sequence of the rice genome (Oryza sativa L. ssp indica). Science 296 : 79 92

PAGE 82

82 Zou JH, Zhang SY, Zhang WP, Li G, Chen ZX, Zhai WX, Zhao XF, Pan XB, Xie Q, Zhu LH (2006). The rice HIGH TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant J 48: 687 696.

PAGE 83

83 BIOGRAPHICAL SKETCH Sharon Tan attended Tunku Abdul Rahman College, Penang, Malaysia and earned a diploma in electrical and electronic e ngineering in 2003 After graduation she attended Damansara Utama College, Penang, Malaysia into the American University Transfer Program (AUTP) and continued on to Linfield College, McMinnville, Oregon in 2005. In spring of 2007 she earned her B Sc. in b iology. Upon gradua tion she joined the marker assisted breeding lab at Nunhems Inc., Salem, Oregon in 2007. In 2008 s he decided to go back to school to pursue a Master of Science and joined Dr. Wilfred the University of Florida.