GW182 Silences microRNA Targets by Divergent Functional Domains and Regulates microRNA Stability

MISSING IMAGE

Material Information

Title:
GW182 Silences microRNA Targets by Divergent Functional Domains and Regulates microRNA Stability
Physical Description:
1 online resource (134 p.)
Language:
english
Creator:
Yao, Bing
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Molecular Cell Biology (IDP)
Committee Chair:
Chan, Edward K
Committee Members:
Zhou, Lei
Terada, Naohiro
Swanson, Maurice S
Kilberg, Michael S

Subjects

Subjects / Keywords:
argonaute -- gw182 -- microrna
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
MicroRNA (miRNA) is a relatively new class of shortendogenous non-coding RNA. MiRNA can pair to the 3’ untranslated region ofmRNA. This interaction inactivates protein translation from the mRNA, andeventually triggers mRNA decay. All important cellular processes are known tobe regulated in part by miRNA. Aberrant expression of miRNA often associateswith a variety of diseases including cancer. The goal of my dissertationresearch is to understand the miRNA silencing mechanism, identify andcharacterize key protein players in this process, and elucidate how the maturemiRNA level is regulated. These discoveries will expand our knowledge inunderstanding this key post-transcriptional gene regulation pathway and offerthe possibility in developing miRNA-mediated therapeutic approaches. GW182 is an 182kDaprotein with multiple glycine/tryptophan repeats (GW or WG) playing a centralrole in miRNA-mediated gene silencing. GW182 interacts with its functionalpartner Argonaute proteins (AGO) via multiple domains to exert its silencingactivity. Using tethering functional assays, we identified two non-overlappingGW182 silencing domains, namely , induced primarily translationalrepression rather than mRNA decay.  GW orWG repeats on these two domains were critical for silencing activity. Thesedata implicated a dynamic and diversified role of GW182 in miRNA-mediated gene silencingconveyed by its  silencing domains and further established GW182 as acentral player in silencing gene expression. Furthermore, we identified a newrole of GW182 in regulating miRNA stability aside from its silencing function.Depletion of GW182 reduced mature miRNA level in different time points andcaused impaired miRNA export through secretory vesicles termed exosomes. A3’-5’ exoribonuclease complex was identified to be responsible for the miRNAdegradation. These findings revealed a novel role of GW182 in regulating mature miRNA stability by binding to Argonaute proteins This work alsop supported of the importance of GW182 in miRNA-mediated silencing homeostasis.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Bing Yao.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Chan, Edward K.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044363:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 GW182 SILENCES MICRORNA TARGETS BY DIVERGENT FUNCTIONAL DOMAINS AND REGULATES MICRORNA STABILITY By BING YAO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIR EMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Bing Yao

PAGE 3

3 To my grandparents and parents for their selfless devotion to my life; to my wife for her deepest lov e and constant encourages to me ; to my mentor for hi s ti reless help during my PhD study

PAGE 4

4 ACKNOWLEDGMENTS It is with great appreciation and sincere thanks that I acknowledge the following individuals for their professional or personal role in my academic career as well as my personal life. First and the m ost, I thank my family, my grandfather Xiaoliang Liu, grandmother Lianjie Shan, my father Mingqin Yao and my mother Youzhen Liu, for raising and educating me. I thank my mentor Dr. Edward Chan, for his guidance and mentoring throughout this dissertation s tudy. He has taught me the research skills, scientific attitude, and critical thinking that will benefit my future career. Dr. Chan has also mentored me to become a mature individual and provided me with a second family. I would also like to thank my forme r mentor Dr. Keith Robertson, for his initial guidance in the first two years of my graduation life. I thank Dr. Lei Zhou, who offered me a position in his laboratory and brought me to a brand new scientific world in the United States after my graduation i n China. I would also like to thank my master mentor Dr. Zhenmin Bao in Ocean University of China, who taught me the basic molecular biology knowledge from the beginning. I thank my committee members, Dr. Michael Kilberg, Dr. Maurice Swanson, Dr. Nahiro Te rada, and Dr. Lei Zhou, for their advice and inspiration on my research throughout my PhD life. I also thank Dr. Minoru Satoh, Dr. Hideko Kasahara, Dr. Lung Ji Chang, and Dr. Marvin Fritzler for their collaboration and help on my dissertation research. I t hank Ying Chi Chen and Yu Ling Yeh in Lung Ji Chang laboratory for providing me the critical reagent for my experiments. I thank Dr. Alexander Ishov for his suggestions to my AGO immunoprecipitation experiments.

PAGE 5

5 I thank all the current and past Chan lab me mbers for their friendship, assistance and collaboration. Especially thank Dr. Songqing Li, Dr. Shangli Lian, Dr. Kaleb Pauley, Dr. Andrew Jakymiw, Hyun Min Jung, Wendy Carcamo, Dr. Angela Ceribelli, Lan La, Grant Abadal, Brad Pauley, John Calise, Paul Dom inguez Gutierrez, and Dr. Abu Nahid for their help to my experiments. I thank my friends in Gainesville who made my life colorful. In particular, I thank Weiyi Ni, Shuibin Lin, Nianwei Lin, Chao Chen, Robert Ng, Yue Liu, Chen Ling, Huiming Xia, Bo Liu, and Guangyao Li. I particularly thank my wife Can Zhang, for her long term support regardless of the circumstances.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 L IST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF TABLES ................................ ................................ ................................ .......... 11 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 INTRODU CTION ................................ ................................ ................................ .... 14 Role of GW182 and GWBs in siRNA Silencing Pathway ................................ ........ 17 Disruption of GW Bodies Impaired Mammalian RNA Interference ................... 17 Small Interfering RNA Mediated Silencing Induced Target Dependent Assembly of GW/P Bodies ................................ ................................ ............ 19 Role of GW182 and GWBs in miRNA Silenc ing Pathway ................................ ....... 20 TNGW1 Is a Novel Isoform of GW182 and Distinct at both Transcriptional and Translational Levels ................................ ................................ ............... 20 The C Terminal Half of Human Ago2 Bound to Multiple GW Rich Regions of GW182 and Required GW182 to Mediate Silencing ................................ 23 Summary ................................ ................................ ................................ ................ 25 2 DIVERGENT GW182 FUNCTIONAL DOMAINS IN THE REGULATION OF TRANSLATIONAL SILENCING ................................ ................................ .............. 29 Background ................................ ................................ ................................ ............. 29 Materials and Methods ................................ ................................ ............................ 31 Plasmids ................................ ................................ ................................ ........... 31 Antibodies ................................ ................................ ................................ ......... 33 Cell Culture and Transfection ................................ ................................ ........... 33 GST Pull Down Assays and Western Blot Analysis ................................ ......... 33 Micrococcal Nuclease Assay ................................ ................................ ............ 34 Teth ering Assay and miRNA Interference Assay Using a Dual Luciferase Assay ................................ ................................ ................................ ............ 35 siRNA and qRT PCR ................................ ................................ ........................ 36 Results ................................ ................................ ................................ .................... 37 Non Repression Effects to Full Length GW182/TNGW1 ................................ ...... 37 Contribution of Defined Domains Within and Ago2 Binding ................................ ................................ .......................... 38 Reducing Endogenous Repressor Levels Did Not Affect Reporter Repression Induced by 12 and 5 ................................ .............................. 41

PAGE 7

7 5, Not 12, Enhanced Ago2 Mediated Repression in Tethering Function Assay ................................ ................................ ................................ ............ 42 12, Not 5, Interfered with Endogenous miRNA Repression ......................... 43 Assay Activity, as Well as Its Interference with Endogenous miRNA Repression ................................ ................................ ................................ .... 45 Degradation ................................ ................................ ................................ ... 46 Discussion ................................ ................................ ................................ .............. 47 Overlapping Domai ns Mediating Repression ................................ ................................ ................................ .... 47 GW182 Mediated Translational Repression Distinguished from miRNA Deadenylation and Decay ................................ ................................ ............. 51 Distinct GW182? ................................ ................................ ................................ ........ 53 3 DEFINING A NOVEL ROLE OF GW182 IN MAINTAINING MICRORNA STABILITY ................................ ................................ ................................ .............. 70 Background ................................ ................................ ................................ ............. 70 Materials and Methods ................................ ................................ ............................ 73 Plasmids, siRNA, and miRNA mimic ................................ ................................ 73 Lentiviral Constructs ................................ ................................ ......................... 74 Cell Culture and Transfection ................................ ................................ ........... 74 Nucleofection ................................ ................................ ................................ .... 75 RNA Extraction, Reverse Transcription and Quantitative PCR (qPCR) ........... 75 In Vitro Assay for GW182 Dependent Differential miRNA Sensitivity to RNase ................................ ................................ ................................ ........... 76 Secretory Exosomes Purification ................................ ................................ ...... 77 Calculation of miRNA Secretion Ratio ................................ .............................. 77 Results ................................ ................................ ................................ .................... 77 Knockdown of GW182 and Its Paralog TNRC6B Impaired miRNA Stability ..... 77 Replenishment of GW182 and Its Paralogs R estored the Shortened miRNA Stability ................................ ................................ ................................ .......... 81 GW182 Knockdown Decreased Exosomal Secretion of miRNA ...................... 83 GW182 Protected Argonaute Boun d miRNA from Degradation by Direct Interaction ................................ ................................ ................................ ..... 85 Discussion ................................ ................................ ................................ .............. 88 How GW182 Maintains miRNA Stability by Binding to Argonaute Prot eins ...... 88 Reduced miRNA in GW182 KD Cells Was Not Due To Enhanced Secretion into Extracellular Space ................................ ................................ ................ 91 Identification of Critical microRNase Affecting miRNA Stability in GW182 KD Cells ................................ ................................ ................................ ........ 92 4 SUMMARY AND PROSPECTIVE ................................ ................................ ........ 107 GW182 Plays a Key Role in miRNA Gene Si lencing ................................ ............ 107

PAGE 8

8 Role of AGO and GW182 in miRNA Pathway ................................ ................. 107 Dual GW182 Silencing Domains Independently Silence miRNA Targets ....... 109 The Current Knowledge of GW182 in miRNA Mediated Translational Repression and miRNA Degradation ................................ .......................... 111 GW182 May Play a Role in miRNA S tability by Directly Interacting with AGOs .... 114 MiRNA Levels Are Tightly Regulated in Multiple Steps of Their Biogenesis .. 114 RISC Components in Regulating Mature miRNA Stability .............................. 115 Role of GW182 in miRNA Secretion via Secretory Vesicle Exosomes ........... 116 Prospec tive ................................ ................................ ................................ ........... 118 LIST OF REFERENCES ................................ ................................ ............................. 122 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 134

PAGE 9

9 LIST OF FIGURES Figure page 1 1 GW bodies (GWBs) are heterogeneous structures with some obvious differences in protein composition ................................ ................................ ...... 26 1 2 Biogenesis and me chanism of the two main classe s of small regulatory RNA ... 27 2 1 overlapping GW182 domains harboring repressio n in tethering function assay ................................ ................................ .................. 56 2 2 The expressions of selected NHA constructs from representative tethering experiments we re monitored by western blot usin g anti HA monoclonal antibody ................................ ................................ ................................ .............. 57 2 3 Roles of Ago hook and RRM domains for repression in tethering fun ction assay and binding to Ago2 ................................ ................................ ................. 58 2 4 The interactions of GW182 repression domains and Ago2 PIWI domain was independent of RNA ................................ ................................ ........................... 59 2 5 TNRC6C expression was very low in HeLa cells compa red to A549 and HEK293 cells ................................ ................................ ................................ ...... 60 2 6 Knockdown of endogenous repressors did not affect repression activity of the two defined domains 12 and 5 in the tethering assay ................................ .... 61 2 7 Tethered NHA TNGW1 was employed as an additional control to monitor the GW182 siRNA effects. ................................ ................................ ........................ 62 2 8 12, enhanced Ago2 mediated repres sion in the tethering function assay ................................ ................................ ................................ ..... 63 2 9 ....................... 64 2 10 Substitution of glycine (G) and tryptophan (W) residues with alanine (A) in miRNA repression activity. ................................ ................................ ................. 65 2 11 o PABPC1 did not significantly affect reporter mRNA degradation. ................................ ................................ ................................ ........ 66 2 12 The interactions of GW182 repression domains and PABPC1 was independent of RNA. ................................ ................................ .......................... 67 2 13 NHA PABPC1. ................................ .............. 68

PAGE 10

10 2 14 Summary of GW182 domain functional characteristics. DUF, sequence identified to be important for PABPC1 binding ................................ .................... 69 3 1 Knockdown of GW182 and TNRC6B impaired miRNA stability.. ........................ 95 3 2 TNRC6B and TNRC6C specifically knocked down by lentiviral shRNA. ............ 97 3 3 Replenishment of GW182 and its paralogs restored the shortened miRNA stability. ................................ ................................ ................................ .............. 98 3 4 miRNAs were secreted into extracellular space via exoso mes ......................... 100 3 5 Knockdown of GW182 reduced miRNA secretion via exosomes. .................... 101 3 6 GW182 protected loaded miRNA decay by interacting w ith Argonaute proteins. ................................ ................................ ................................ ............ 102 3 7 siRNA effectively knocked down exoribonucleases ................................ .......... 104 3 8 A model of GW182 binding to AGO and prot ected miRNA from being de ................................ ................................ ... 105 4 1 Schemetic map of GW182 two conserved domains PAM2 and P GL .............. 121

PAGE 11

11 LIST OF TABLES Table page 3 1 List of primers for lentiviral shRNA knockdown ................................ ................. 106

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GW182 SILENCES MICRORNA TARGETS BY DIVERGENT FUNCTIONAL DOMAINS AND REGULATES MICRORNA STABILITY By Bing Yao August 2012 Chair: Edward K. L. Chan Major: Medical Scie nces Molecular Cell Biology MicroRNA (miRNA) is a relatively new class of short endogenous non coding RNA. MiRNA can pair with inactivates protein translation from the mRNA, and eventually triggers mRNA decay. Almost all important cellular processes are known to be regulated in part by miRNA. Aberrant expression of miRNA is often associate d with a variety of diseases including cancer. The goal of my dissertation research was to understand the miRNA silen cing mechanism, identify and characterize key protein players in this process, and elucidate how the mature miRNA level is regulated. These discoveries will expand our knowledge of this key post transcriptional gene regulation pathway and offer the possibi lity of developing miRNA mediated therapeutic approaches. GW182 is an 182kD a protein with multiple glycine/tryptophan repeats (GW or WG) playing a central role in miRNA mediated gene silencing. GW182 interacts with its functional partner s, the Argonaute pr oteins (AGO) via multiple domains to exert its silencing activity. Using tethering functional assays, we identified two non overlapping GW182 silencing domains, namely primarily induced translational repression rather than mRNA decay. GW or WG repeats within these two domains

PAGE 13

13 were critical for silencing activity. These data implicated a dynamic and diversified role of GW182 in miRNA mediated gene silencing c onveyed by its silencing domains and further established GW182 as a central player in silencing gene expression. Furthermore, we identified a new role of GW182 in regulating miRNA stability aside from its silencing function. Depletion of GW182 reduced matu re miRNA level at different time points and caused impaired miRNA export through secretory vesicles termed miRNA degradation These findings revealed a novel role of GW182 in re gulating mature miRNA stability by binding to Argonaute proteins T his work also supported the importance of GW182 in miRNA mediated silencing homeostasis.

PAGE 14

14 CHAPTER 1 INTRODUCTION The protein GW182, was discovered in 2002 using a serum from an autoimmune p atient with motor and sensory neuropathy ( 1 ) is characterized by a large number of glycine/tryptophan (GW and WG) repeats that are distributed in various mot ifs throughout its sequence. GW182 is an 182 kDa phosphoprotein with up to 60 copies of GW/WG motifs, some of which have been shown to bind to its functional partner in the Argonaute protein family (Ago1 4) and are critical in microRNA (miRNA) mediated sil encing function. The GW182 protein family has three paralogs in mammals named TNRC6A, B, and C, all of which have been demonstrated to play key roles in small interference RNA (siRNA) and miRNA silencing ( 2 5 ) The initial discovery of GW182 noted that it was primarily localized to distinct cytoplasmic foci with dynamic morphology and movement ( 1 6 ) Based on their unique GW content and cytoplasmic localization, these foci therefore were provisionally termed GW bodies (GWBs). A set of other proteins involved in RNA degradation were later shown to reside in GWBs linking this structure to the function of RNA turnover ( 7 10 ) (Figure 1 1). These bodies are generally acknowle dged to be conserved among species since mammalian GWBs share a similar subset of protein homologs with yeast or Drosophila processing bodies (P bodies). However, Ago2 and GW182 are examples of some key proteins that do not have homologs in yeast P bodies ( 11 ) In addition, t he size and number of GWBs increase during cell proliferation in mammalian cells ( 6 ) whereas as a reflection of their functional differences, the number and size of P bodies in yeast increase in response to stress ( 7 10 ) The heterogeneity of GWBs is denoted by obser vations that not all foci have the same composition: some foci contain

PAGE 15

15 undetectable or very low levels of Ago2, mRNA decapping activator DCP1a, and DEAD box RNA helicase rck/p54. siRNAs and miRNAs partially share the same pathway in silencing their target s based on their Watson Crick base pair matching for target recognition (Figure 1 2). miRNAs are usually derived from endogenous transcripts from their respective gene loci to first form primary miRNAs (pri mRNAs) with 7 methylguanosine (m7G) caps and poly ends flanking hairpin structures as shown in (Figure 1 2, right panel). Mammalian genes for miRNAs exist as single genes, gene clusters, and within introns of other genes. The RNase III endonuclease Drosha DGCR8 complex processes pri miR NAs into about 70 nucleotide hairpin structures referred as precursor miRNAs (pre miRNAs). After being transported into cytoplasm, pre miRNAs further associate with Dicer, another RNase III endonuclease, resulting in a ~22 base pairs miRNA:miRNA* duplex ( 2 5 12 13 ) In contrast, siRNAs originate from long double stranded RNAs that can be derived from viral replication, transposons, or convergent transcripts. The Dicer complex slices these long RNAs into 20~25 base pairs, perfectly matching a double str anded RNA duplex. Synthetic siRNA duplexes of the same size can also knockdown target genes. siRNA or miRNA duplexes undergo a selective loading process to AGO based on the thermodynamic preference of the two strands. Guiding strands directly associate wit h AGO proteins and the passenger strand will be ejected and eventually degraded ( 12 14 15 ) G uiding strands form a perfect complementarity with their target mRNAs, following which, Ago2 cleaves the target mRNA by its endonuclease activity localized in its C terminal PIWI (RNase H like P element induced wimpy testis) domain ( 16 ) miRNA loaded AGO complexes are

PAGE 16

16 usually strictly matched at miR ( 17 ) All 4 AGO proteins (Ago1 4) are involved in miRNA mediated gene silencing and the GW182 protein family functions downstream as key repressors by inhibiting active translation, a s well as trigger bound mRNA deadenylation and eventual degradation ( 4 5 13 ) (Figure 1 2). Extensive mapping of AGO interacting and repression domains on GW182 generated consensus that the GW182 N terminal GW rich domain primarily binds to AGO on multiple sites, whereas the C terminal domain possesses intr insic silencing activity ( 18 22 ) However, in addition to that, the Drosophila and human N terminal effective domain, which in fact covers much of the middle region of GW182, also has silencing activity ( 22 24 ) Although the detailed molecular mechanism underlying translational repression remains elusive, increasin g evidence has suggested that the conserved GW182 Pam2 motif (Poly A binding protein (PABP) interacting motif 2) functions as a major docking site to interact with PABP ( 25 26 ) In addition, GW182 can further recruit CCR4 NOT deadenylase complex to facilitate mRNA decay ( 27 29 ) This dynamic process may occur in GWBs and a general model of how they affect translational repression and mRNA degradation will be discussed in Chapter 4. Although a number of studies have dissected the function of GW182, it needs to be pointed out that there are a few inconsistencies. These discrepancies may arise from differences in the selection of systems (e.g. using Drosophila, yeast, versus mammals) or methodologies employed (e.g. investigating miRNA and mRNA by qRT PCR vs Northern blot). In this chapter we focus primarily on the role of GW182 and GWBs in

PAGE 17

17 siRNA and miRNA silencing pathway based on a number of published reports from our laboratory over the past ten years ( 1 6 7 20 24 30 36 ) to help understand the rationale and development of my dissertation study. Role of GW182 and GWBs in siRNA Silencing Pathway In 1998, Fire and Mello systematically described that double stranded RN A can potently and specifically interfere gene expression in Caenorhabditis elegans ( 37 ) For this work, a Nobel Prize was awarded within less than a decade, ind icating its fundamental implications and important prospects for the future of cell and molecular biology. Elucidating the mechanism of this post transcriptional gene regulation is tremendously beneficial for basic research and has clear implications for c linical applications. GW182 appears to be a core protein in cellular process and our laboratory has been investing in studies of the relationships between GW182 and the siRNA pathway. Disruption of GW Bodies Impaired Mammalian RNA I nterference Since the di scovery of GW182 and GWBs in 2002, substantial efforts have elucidated their functional implications. In 2005, Jakymiw et al. and others simultaneously reported that GW182 bound to Ago2 ( 31 38 ) linking it to the then newly established siRNA and miRNA work ( 37 39 ) By using an Ago2 specific antibody, we demonstrated that Ago2 localized to discrete cytoplasmic foci that were co stained with an anti GW182 monoclonal antibody as well as the prototype human anti GWB serum 180 33 ( 31 ) Co immunoprecipitation data using polyclonal human serum 18033 or mouse monoclonal anti GW182 antibody 4B6 pulled down Ago2, demonstrating the stron g interaction between Ago2 and GW182. Intriguingly, Cy3 end labeled lamin A/C specific antisense siRNA duplex localized to GWB and co immunoprecipated with anti

PAGE 18

18 GW182 antibody implying the potential functional connections between GWBs and siRNA pathway. ( 31 ) Our laboratory had previously demonstrated that knocking down the GWB scaff old protein GW182 by specific siRNA could affect the stability of GWBs ( 6 ) Therefore, a sequential knockdown strategy was performed to first knockdown the endogen ous GW182 protein followed by a second transfection conducted with siRNA against lamin A/C 48 hours later. The results clearly demonstrated that depletion of GW182 caused the disappearance of the GWB foci and more importantly, abolished the knockdown of la min A/C. In contrast, the knockdown of lamin A/C was affected when the cells were firstly transfected with a siRNA against luciferase, which was not a target in these cells. Similar results in reduced lamin A/C siRNA reporter activity were obtained when la min A/C siRNA was co transfected with siRNA to GW182 ( 32 ) GW182 paralogs TNRC6B and TNRC6C largely share conserved domains and have been shown to have functional redundancy ( 3 40 ) In fact, depletion of individual GW182 family members caused partial de repression of silenced reporters ( 22 ) and tethering assa ys mapped similar silencing domains on all GW182 family proteins ( 18 19 22 41 ) It remained to be determined the distinctive functions of each GW182 paralogs, in particular cellular context. In brief, GW182 binds to Ago2 both in vivo and in vitro This protein complex serves as a core component of the human RISC complex that co localizes to the GWBs with transfected siRNA. GWBs play a critical role in siRNA silencing function as disassembly of GWBs by either dominant negative constructs or siRNA d irectly knocking down GWB scaffold protein GW182 lead s to the loss of siRNA function. These

PAGE 19

19 data provided strong evidence for linking between GW182 and GWBs to siRNA function. Small Interfering RNA M ediated Silencing Induce d Target D ependent Assembly of GW /P Bodies To address the correlation between siRNA and GWBs, siRNA against endogenous lamin A/C or siRNA against luciferase was transfected into HeLa cells. The size and number of GWBs were monitored by indirect immunofluorescence using both prototype huma n serum 18033 and rabbit anti Dcp1a antibody. Intriguingly, larger and greater numbers of GWBs were observed only in lamin A/C siRNA transfection s but not in mock or luciferase siRNA that lacked endogenous target ( 34 ) Another siRNA against the endogenous target RAGE showed similar effects as lamin A/C siRNA induced higher numbers and increased the modifie d siRNA ( 34 ) siRNAs against endogenous targets do not appear to affect stress granules as detected by the marker TIAR, the T cell intracellular antigen 1(TIA 1) related protein. The mRNA dependent effect in these experiments was further examined in 3T3 cells stably transfected with GFP vs untransfected 3T3 cells using a single siRNA to GFP. The transfection of the GFP siRNA led to a significant increase in both th e size and number of GWBs in the stable GFP expressing 3T3 cells, but not in wildtype 3T3 lacking GFP transcripts ( 34 ) The protein levels of several GWB componen ts, such as Ago2, DCP1a, rck/p54 and RNA binding protein Lsm4, did not increase upon lamin A/C siRNA transfection an observation that is consistent with the concept that these proteins are recruited from free cytoplasmic forms into GWBs. In summary, trans fection of endogenous targeted functional siRNA can modulate the size and number of GWBs. GW182 and Ago2 were required for functional siRNA

PAGE 20

20 silencing activity. Based on these data, it can be concluded that RNAi was a key regulatory mechanism for the assemb ly of GWBs. Role of GW182 and GWBs in miRNA Silencing Pathway The first described miRNA, lin 4 can negatively regulate its target gene LIN 14 during different developmental stages in C.elegans ( 39 ) The identification of let 7 miRNA as the first miRNA conserved across species has opened a door for the remar kable advances in the field of miRNA research dating to 2000 ( 42 ) It is currently held that more than 50% of mRNAs are regulated by miRNAs involved in alm ost all known cellular pathways ( 2 4 ) GW182, discovered two years after let 7 was described in mammals, ha s become a central player in the miRNA mediated silencing pathway ( 4 5 ) Our laboratory has been working on the role of GW182 in miRNA pathway including identification of novel GW182 isoform, elucidation of Ago2 binding domains and mRNA silencing domains for the past few years ( 20 24 35 ) TNGW1 Is a Novel I soform of GW182 and D istinct at both Transcriptional and Translational Level s Human TNRC6A (the gene encoding GW18 2) is located on chromosome 16p11.2. Since the discovery of GW182 ( 1 ) homologs have been subsequently characterized in various species including Drosophila a nd C. elegans ( 43 46 ) However, the isoforms of GW182 were not explored until 2008 ( 35 ) Interestingly, both the NCBI database and University of California Santa Cruz Genome Browser predicted a novel isoform of GW182, later named as TNGW1 by Li et al with a nucleic acid sequence identical to GW182 but having an additional N t erminal region containing trinucleotide repeats (TNRs). The mRNA for TNRC6A longer isoform TNGW1 contained 5 additional exons upstream of the putative AUG start codon of GW182 and the TNR repeat domain was

PAGE 21

21 encoded by the fifth exon. To verify the presence of this isoform, reverse transcriptase PCR using primers flanking the unique N terminal TNR domain were utilized to examine RNA from a number of different human cell lines and tissue samples. The amplified PCR products were submitted to direct DNA sequenci ng, which validated the correct length and an in found in the various cells examined. The next question was whether TNGW1 mRNA is expressed as a native protein. To address this question, a rec ombinant protein containing the TNR domain alone was generated to raise monoclonal and polyclonal antibodies as specific probes for the expression of this putative longer isoform of GW182. After confirming the specificity of these antibodies (i.e. cross re activity with GW182 minus the TNR domain) by addressable laser bead immunoassay and Western blot, the differential expression of TNGW1 and GW182 in HeLa cells was examined by immunoprecipitation Western blots. Antibodies specific for the TNGW1 TNR domain o nly recognized the slower migrating TNGW1 band whereas rabbit polyclonal and mouse monoclonal antibodies directed against GW182 recognized both the 210 and 182 kDa forms of GW182. This supported the notion that both TNGW1 and GW182 proteins were expressed in HeLa cells. Of note, the expression of GW182 was considerably higher than TNGW1. We then asked, what is the relationship between these two proteins? They could be independently translated as distinct mRNAs, from the same mRNA with a different AUG start codon, or GW182 could simply be a post translationally processed form of TNGW1. To distinguish these three possibilities, siRNA specifically targeted TNGW1 mRNA (referred as siTNR, thereafter) was applied to discriminate TNGW1 and GW182

PAGE 22

22 mRNA. Forty eight h ours after transfection, only TNGW1 protein became undetectable whereas levels of the GW182 protein remained the same compared to the control or mock transfection ( 35 ) These results demonstrated that TNGW1 protein was derived from its own unique mRNA. It remained unclear whether GW182 was the post translational product from TNGW1 because the GW182 band observed after siTNR treatment could be a stable product process ed from TNGW1. However, the Western blot result from cells treated with siRNA targeted a common region of TNGW1 and GW182 (referred as siGW182) ruled out this possibility because the disappearance of both proteins suggesting both isoforms retained similar turnover rates. We concluded that each protein isoform is reasonably considered as a product translated from its individual mRNA. Collectively, TNGW1 and GW182 appear to be derived from distinct transcription and translation events ( 35 ) Indirect immunofluorescence data implied that TNGW1 was either absent or expressed at much lower level compared to GW182 in a subset of GWBs. However, their silencing activity seemed to be identical. To determine the silencing effect induced work ( 47 ) An N hemagglutinin (NHA) polypeptide tag was fused to TNGW1, GW182, or Ago2. The NHA tag binds strongly to the 5BoxB RNA secondary reporter. Co transfe ction with NHA tagged GW182 or Ago2 fragments with the RL 5BoxB reporter allowed discrimination of their repression activity. RL or FL no sites in to the reporter when NHA

PAGE 23

23 consistent with the original report describing this tethering assay ( 47 ) In comparison, tethered NHA TNGW1 or GW182 induced stronger repression (67.6% and 65.3%, respectively), which was 46.9% or 41.3% stronger than that induced by Ago2, respectively ( 35 ) Quantitative RT PCR was also performed to analyze the stability of reporter mRNA level. Interestingly, tethered Ago2 induced 50.8% reporter mRNA degradation as compared to tethered TNGW1 and GW182 (24.5% and 23.7%, respectively). These data together indicate that tethered GW182 and TNGW1 possess stronger silencing activity than Ago2. The silencing activity in this experiment is primarily caused by interfering wit h translation with only mild effects on the reporter mRNA stability. In contrast, tethered Ago2 causes more reporter decay than GW182/TNGW1. To further characterize the hierarchical relationship between Ago2 and GW182 isoforms, tethering assays were perfor med in siRNA mediated Ago2 and GW182 knockdown cells, respectively. The repression effect induced by tethered Ago2 was completely abolished in GW182 knockdown cells. By contrast, the TNGW1 and GW182 repressions were not affected by introducing Ago2 siRNA. These data suggested that TNGW1/GW182 has a more direct and central role on repression than Ago2, which may carry miRNAs and secure miRNA:mRNA interactions. The C Terminal Half of Human Ago2 Bound to Multiple GW R ich Regions of GW182 and Required GW182 to Mediate Silencing Since the AGO GW182 interaction is important, A series of deletion constructs were generated spanning the entire TNGW1 for initial mapping of the Ago2 binding domain(s) ( 20 ) An in vivo GST pulldown assay was utilized to determ ine the interactions between different constructs. Most of our data was consistent with what Takimoto et al. published almost at the same time: there were three Ago2 binding sites

PAGE 24

24 in N terminal GW182. One was in equivalent to the GW182 N terminal (aa 25 4 751) region and other two were in the GW182 middle (aa 896 1219) region. An additional binding site localized in the GW182 C (aa 1670 1962) was observed in our experiments but not in those of Takimoto et al ( all GW182 deletion fragments s hown in Figure 2 1) PIWI PIWI ( 24 ) Interestingly, all the Ago2 binding domains were enriched in the PIWI interaction might result from low affinity of C GW/WG motifs in this region ( 3 ) Taken together, our laboratory and others identified four Ago2 binding regions on GW182 protein and that the Ago2 PIWI domain interacted with Ago2. A Renilla 5BoxB tethering reporter was also used to determine the silencing ability of Ago2 fra gments and other Ago family proteins and, more importantly, evaluate their 5BoxB reporter, NHA PIWI induced almost equally strong repression as the NHA full length Ago2 ( 20 ) In contras t, NHA PAZ did not repress Ago2. These data suggested that the silencing ability harbored by Ago2 was mainly within its C terminal PIWI domain. Other Ago family proteins including Ago1 and Ago4 were tethered to the reporter to assess their repression abili ties. Comparable repression effects were observed in Ago1 and 4 similar to that of tethered Ago2 or PIWI. Intriguingly, Ago3m that did not bind to GW182 as described previously, did not have repression activity in tethering assays. These observations, toge ther with those of Li et al ( 35 ) demonstrated that the repression induced by the AGO family is dependent on their interaction with GW182.

PAGE 25

25 Summary It has been ten y ears since the discovery of GW182, an amazing protein with many unique features that deserved attention. This discovery opened the door for numerous studies on miRNA silencing mechanisms, which were poorly understood dating to the identification of the fir st miRNA Lin 4 in 1993 ( 39 ) Currently, it has been widely accepted that GW182, together with its paralogs, is a key component of the RISC associated miRNA silencing pathways. We therefore sought to further map the GW182 silencing domain(s) to gain a better understanding of this protein (Chapter 2). In the meanwhile, we used lentiviral based shRNA strategy to deplete GW182 in HEK293 cells to define its role in regulating AGO bound miRNA level (Chapter 3). My dissertation research defined two non overlapping silencing domains on GW182, and demonstrated GW182 is important in regulating mature miRNA half life. bodies

PAGE 26

26 Figu re 1 1. GW bodies (GWBs) are heterogeneous structures with some obvious differences in protein composition ( 7 ) A) HEp 2 cells costaining with prototype human anti GWB serum 18033 (green), known to contain antibodies to GW182, hAgo 2, and Ge 1, but not Dcp1, and rabbit anti Dcp1 antibody (often used as a marker for P bodies; red) demonstrate that although there are many costained foci (arrowheads), not all GWBs contain detectable Dcp1 (arrows). B) HEp 2 cells costaining with mouse a nti hAgo2 monoclonal 4F9 (green) and rabbit anti RCK/p54 (red) polyclonal antibodies demonstrate again that most foci have both (arrowheads) but not all containing both RCK/p54 and hAgo2 (arrows). Nuclei (blue) were counterstained with DAPI.

PAGE 27

27 Figure 1 2. Biogenesis and mechanism of the two main classes of small regulatory RNA. Long double stranded RNA (dsRNA) derived from viral infection, transposon or convergent transcription can be recognized and processed by Dicer, an RNAase III endoribonuc lease, to become 20 25 bp small interference RNA (siRNA, left panel). The siRNA duplex including both the guiding strand (red) and passenger strand (blue) is transferred from Dicer onto Ago2, the catalytic component of RNA induced silencing complex (RISC) complex also possessing endonuclease activity on its C terminal PIWI domain. Core protein components Ago and GW182 are representing the holo RISC complex. During the loading process, the passenger strand is cleaved and ejected. Ago2 and GW182 together with the guiding strand identify and hybridize perfectly with the target mRNA. Ago2 then catalyzes the cleavage at the middle region of the siRNA mRNA duplex to slice the mRNA into two halves. The complex may be recycled for multiple rounds of cleavage. In con trast, miRNA is often derived from primary miRNA (pri miRNA) which is transcribed from a single miRNA gene locus, multiple gene clusters, or processed from introns. Pri miRNA end cap, a poly A tail, and a hairpin stem loop secondary structure and is processed by Drosha DGCR8 protein complex in the nucleus to become hairpin precursor miRNA (pre miRNA). Pre miRNA is translocated into cytoplasm through a nuclear transporter and then bound by Dicer. Similar to the siRNA pathway, Dicer processes the pre miRNA into matured miRNA miRNA* duplex (guiding strand and passenger strand (also known as miRNA*) which is then transferred to Ago. The guiding strand loaded complex forms imperfect Argonaute family proteins can be involved in miRNA mediated silencing and GW182 plays a critical role in translation repression, deadenylation, and mRNA decay. Modified from Jinek, M. and Doudna, J.A. ( 12 )

PAGE 28

28

PAGE 29

29 CHAPTER 2 DIVERGENT GW182 FUNC TIONAL DOMAI NS IN THE REGULATION OF TRANSLATIONAL SILENC ING Background MicroRNAs (miRNA) are endogenous 20 25 nt RNAs largely transcribed from independent miRNA genes or gene clusters and play many key roles in a variety of normal and pathological cellular processes ( 13 ) MiRNAs are incorporated into the RNA induced silencing complex (RISC) to effect translational repression or RNA degradation of their target mRNAs ( 2 7 17 48 49 ) The Argonaute protein famil y, a highly conserved key component of the RISC complex, is represented by four proteins (Ago1 Ago4) in mammals that are involved in miRNA mediated translational silencing ( 15 ) Only Ago2 harbors RNase H type activity in its C terminal P element induced wimpy testis (PIWI) domain and is kno wn to function in small interfering RNA (siRNA) mediated slicing of mRNA targets by endonucleolytic cleavage ( 16 50 51 ) GW182 (Gene name TNRC6A) was first identified and characterized by our laboratories in 2002 as a novel protein recognized by an autoimmune serum from a patient with motor and sensory ne uropathy ( 1 ) It is an 182 kDa protein characterized by multiple glycine (G) and tryptophan (W) motifs and is an essential component of GW bodies (also known as mammalian processing bodies, or P bodies) ( 6 7 ) Two isoforms of GW182, named TNGW1 (long isoform) and GW 182 (short isoform) respectively, have been subsequently reported with TNGW1 being identical in sequences with GW182 but has additional N terminal 253 amino acids (aa) containing trinucleotide glutamine repeat (TNR Q repeat) domain ( 35 ) In the GW182 family, there are three paralogues of TNRC6 (GW182 related) proteins comprising GW182/TNGW1, TNRC6B (containing 3 isoforms) and TNRC6C in mammal, a single Drosophila or tholog

PAGE 30

30 (dGW182, also known as Gawky) and two C. elegans ortholog AIN 1 and AIN 2. ( 2 3 13 40 52 ) They are known to play a critical role in the silencing and degradation of miRNA targeted mRNAs ac ross different species ( 18 19 21 23 25 26 31 35 38 41 52 61 ) Significant progress has been made in characterizing the 3 UTR sequence element required for efficient t argeting and regulation of miRNA ( 62 63 ) but the detailed molecular basis of the miRNA mediated translation al silencing and mRNA degradation, especially with respect to their role of human GW182/TNGW1 is not completely understood ( 2 3 13 40 52 ) The Argonaute proteins, including Ago1 to Ago4, are the m ost highly characterized factors in the miRNA induced silencing complex (miRISC), where they bind miRNA to mediate recognition of target mRNAs ( 12 64 ) Argonaute ( 47 56 65 ) However, the Ago miRNA/mRNA complex requires recruitment of additional protein factors to effect subsequent translational repression ( 35 45 54 ) Multiple candidates have been proposed to play an important role in the miRN A mediated translational silencing. Among these, GW182 is a conserved factor that retains a key role in miRNA mediated translational repression and mRNA degradation across different species, as evidenced by studying of GW182 proteins in humans ( 18 19 21 22 25 26 38 56 58 ) Drosophila ( 23 41 45 53 55 57 59 ) and C. elegans ( 43 61 ) An important feature of the GW182 family in this process is its conserved ability to bind with Ago proteins ( 18 19 21 22 31 38 41 43 5 4 56 59 60 ) In addition, the GW182 family is shown to induce translational silencing effec t despite the absence of Ago2 ( 35 41 56 59 ) Knockdown of individual GW182 related proteins by specific siRNAs only partially rescue the repression indicating the functional redundancy among

PAGE 31

31 those paralogues ( 22 ) However, they ap pear not to have identical roles in repression as TNRC6B and TNRC6C form distinct protein complexes with the four human Argonaute proteins ( 18 ) Significant efforts have been made to map the repression domains of human ( 18 19 22 ) and Drosophila GW182 related prote ins ( 23 41 53 55 ) The C terminal domain including the DUF, M GW, RRM, and C GW is commonly identified as the 'silencing domain' in a variety of species. However, it is controversial and remains to be terminal Ago binding dom GW region possesses full silencing effects ( 23 53 ) is partially active ( 22 ) or completely inactive ( 18 19 41 ) albeit these studies use slightly different deletion construct boundaries and/or different species. In the current study, mapping of the repression domain(s) of human GW182 was performed by generating a series of deletion constructs covering the full length GW182 protein. Two non 1219) and a C 1962), were shown to trigger translational silencing when tethered to the 3 UTR. We showed that these domains rep resenting the minimum length of middle and C terminal deletion constructs caused comparable silencing effects on the reporter compared to two full length GW182 isoforms, TNGW1 and GW182. The present study defined a novel silencing domain on human GW182 an d the role of GW/WG motifs within this domain. Materials and Methods Plasmids were constructed as described in our previous studies ( 7 35 56 ) The N terminal

PAGE 32

32 to excise the 3 fragment from the full length construct pENTR TNGW1; the con struct was completed by T4 DNA ligase reaction to re circularize the truncate d linearized AAAAAGCAGGCTCCTCATCCTTGAACACCACG 3 reverse 5 AGAAAGCTGGGTTCAGCTGGAACCTGGGGTAT ATCT 3 AAAAAGCAGGCTCCTCATCCTTGAACACCACG 3 reverse 5 AGAAAGCTGGGTTCAGTCTCCACAGTTAGTTCCCGACA 3 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATTAGACAGAATGGCAATCC 3 reverse 5 GGGGACCACTTTGTACAAGAAAGCTGGGTTAGGCAACATCAAGGCATAG 3 forward 5 AAAAAGCAGGCTTCACTTGGGGAAACAACATA 3 reverse 5 AGAAAGCTGGGTTCACTCTGGTGAGTCTCTCGAAAA 3 o synthesized by GenScript. The PABPC1 expression vector was purchased from OriGene (Rockville, MD). All of the variants used in current study were subcloned into the Gateway destination vector for GST, GFP, or NHA ( 35 ) expression using the Gateway LR recombination reaction (Invitrogen, Carlsbad, CA). The tethering assay plasmids, including pCIneo NHA vector, NHA Ago2, Renilla luciferase (RL), and firefly luciferas e (FL), with or without the 5BoxB structure in the 3 UTR, were obtained from Dr. Witold Filipowicz, Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland ( 47 ) The miR20

PAGE 33

33 luciferase reporter RL 20 bulge and RL 20 perfect was obtained from Dr. Phillip Sharp, Massachusetts Institute of Technology ( 66 ) All DNA constructs used in this study were confirmed by direct DNA sequencing. Antibodies Rabbit polyclonal anti GST and RCK/p54 were purchased from MBL International (Woburn, MA). Mouse monoclonal anti HA was purchased from Covance (Emeryville, CA). Mouse monoclonal anti tubulin was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Cell Culture and Transfection HeLa, A549 and HEK293 cells were cultured in DMEM containing 10% fetal bovine serum in a 37C incubator with 5% CO 2 The plasmid transfection was performed using Lipo The tethering assays were performed in a 24 well plate format. Six hundred nanograms of NHA GW182 construct were co transfected with either 10ng RL 5BoxB/100ng FL or 100ng FL 5BoxB/10ng R L in HEK293 cells. Cells were harvested 48 hours after transfection for luciferase assays. For the GST pull down assays, 2 g of GST tagged GW182 construct was co transfected with 2 g NHA tagged construct into HeLa cells. HeLa cells were harvested 24 h ours after transfection, lysed by NET/NP40 buffer (150 mM NaCl, 5 mM EDTA, 50 mM Tris, pH 7.4, 0.3% NP40) with Complete Protease Cocktail Inhibitor (Roche Diagnostics, Indianapolis, IN), and then applied to GST pull down assays. GST Pull Down Assays and We stern Blot Analysis Cell lysates were sonicated at 20% amplitude for 10 sec three times on ice and then centrifuged at 13,200 rpm for 5 min. A fraction of soluble lysate was mixed with

PAGE 34

34 Laemmli sample buffer as input for Western blot analysis. Two hundred mL of the soluble fractions were incubated with Glutathione Sepharose 4B (GE Healthcare, Piscataway, NJ) and mixed at 4C for 2 h for GST pull downs. After the incubation, the beads were washed with NET/0.3% NP40 buffer four times and the samples were el uted in Laemmli sample buffer. The input and GST pull down samples were separated on 10% polyacrylamide gels and transferred to nitrocellulose and western blotting performed as described previously ( 34 ) The dilutions of primary antibodies were: 1:1000 for anti GST, and 1:1000 for anti GFP. Micrococcal Nuclease Assay Three parallel transfections in HeLa cells were set up with indicated combinations of GST PIWI an d NHA tagged constructs. Whole cell lysates were harvested in EDTA free lysis buffer containing 150mM NaCl and EDTA free Protease Cocktail Inhibitor (Roche Diagnostics, Indianapolis, IN) 24 hours after transfection. Samples (200ul) were diluted in equal v olume of the same buffer without NaCl to adjust to a final concentration of 75mM NaCl. Untreated group was immediately transferred on ice until ready for the pull down assay. Mock and micrococcal nuclease (MNase ) treated groups were added 0.1M CaCl2. 0.2U MNase (Sigma, St. Louis, MO) was added only to the MNase treated group. Both Mock and MNase groups were incubated i n 37C for 10 minutes. 0.5M EGTA was added to inactivate MNase. An aliquot of ce ll lysate from each group were separated for RNA extraction using mirVana total RNA isolation kit (Applied Biosystems, Foster City, CA). All three groups were subjected to GST pull down assay protocol described above.

PAGE 35

35 Tethering Assay and miRNA Interference Assay Using a Dual Luciferase Assay HEK293 cells were harvested 48 hours after transfection with tethering constructs and dual luciferase reporters. The FL and RL activities were measured using the Dual Luciferase Reporter Assay System (Promega, Madison WI) following the targeted luciferase activities over control luciferase activities ( 47 ) The repression levels of experimental groups were calculated by the percentage reduction of relative luciferase activities compared wi th that in the NHA control group ( 35 ) The relative repression effects of each construct were normalized to that of NHA, which was standardized as 1. Data for eac h construct were collected in 6 to 18 replicates. HeLa and A549 adenocarcinoma human alveolar basal epithelial cells were also used to address any cell specific effects. For miRNA interference assays, RL 20 bulge and RL 20 perfect, containing 7 copies of miR or perfect matches with endogenous miR 20 were co transfected into HEK293, HeLa, and A549 cells with FL internal control and tested constructs. Luciferase activities were measured as described above. Cell lysates from representative luciferase assays were mixed directly with Laemmli sample buffer and separated in 4 20% HCl Tris Ready Gels (BioRad, Hercules, CA) to quantify the expression levels of different NHA tagged GW182 constructs. Samples were t hen transferred to nitrocellulose membranes and analyzed by Western blot using anti HA tag antibody. To avoid the relatively narrow dynamic range of traditional film systems, bands visualized by an enhanced chemiluminescence assay were captured with a Gel iance 600 (PerkinElmer, Waltham, MA) to obtain optimal images. The results were then analyzed by GeneTools software

PAGE 36

36 (PerkinElmer) or Image J ( http://rsbweb.nih.gov/ij/ ) to quantify the amount of protein expressed in individual assays. s iRNA and qRT PCR HeLa cells were seeded at a concentration of 5104 cells/well into 24 well plates in 0.5 mL culture medium. siGENOME SMARTpool siRNA for GFP, GW182 (NM_014494), and TNRC6B (NM_015088) or RCK/p54 (NM_004397) were pur chased from Dharmacon, Inc (Lafayette, CO). The final concentration used for transfection was 100 nM. Four different duplexes of GW182 siGENOME siRNA were purchased separately from Dharmacon (Cat No. D 014107 01 ~ D 014107 04). Since duplex 1 targets se quences residing in 4 were used to knockdown endogenous GW182 in experiments when the co To monitor the efficiency of the siRNA knockdown, parallel experimental groups were set up. Total RNA samples were harvested us ing mirVana total RNA isolation kit instructions. Reverse transcription was performed using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The relative mRNA levels of target genes were measured in duplicate using TaqMan Fast Universal Master Mix (Applied Biosystems) with the corresponding TaqMan Gene Expression Assay (Applied Biosystems). Quantification of mRNA degradation using SYBR Green quantitative r eal time polymerase chain reaction (qRT PCR) was described ( 35 )

PAGE 37

37 Results Non Overlapping GW182 Repression Effects to Full L ength GW182 / TNGW1 As shown in Figure 2 1A, human GW182 and its longer isoform TNGW1 ( 35 ) contain three glycine/tryptophan (GW) rich regions in their N terminal, mid dle, and C terminal domains (N GW, M GW, and C GW, respectively), as well as an RNA recognition motif (RRM, aa1780 1853, cd00590). Another interesting domain is a short 1144, pfam10427) that b inds to PIWI domains of Ago proteins ( 60 ) There is also a short stretch of glutamine repeats in the N terminal domain of TNGW1 (trinucleotide repeat (TNR) Q rep eat, aa93 127) ( 35 ) and a glutamine/asparagine rich region (Q/N rich, aa1264 1553) between the N GW and M GW regions ( 67 ) A conserved ubiquitin associated domain (UBA) ( 59 ) and another domain of unknown function (DUF, aa160 4 1641) ( 22 25 ) are also shown in recent reviews ( 3 40 ) Right after reporting our findings that human GW182 induced silencing independent of Ago2 ( 35 ) the current study was initiated with multiple truncated constructs of GW182 spanning the full length protein (Figure 2 1) to narrow down the region responsible for the repression effect in the tethering assay. These c onstructs were adapted to the tethering assay ( 35 47 ) and examined for their repression effects accordingly. As shown in the right panel, the relative repression effects observed for different GW182 truncated constructs was sorted into three categories: 1) no repression effect including 1 repression effect comparable to full length p that there were more than one non overlapping region able to induce a repression effect

PAGE 38

38 when tethered to the 3 UTR of the the smallest representative, non overlapping constructs that retained the most repression effect of the full length protein without being expressed significantly higher than other truncated constructs (Figure 2 2). Both FL 5Boxb and RL 5Boxb reporters were used in these tethering assays and similar effects were observed from using either reporter. In subsequent studies, primarily the RL 5Boxb reporter was utilized. Since Ago proteins ( 56 ) an initial interpretation was that their repression activities wer e related to their binding of Ago proteins. Contradicting terminal truncated construct of GW182 that strongly binds to all four human Ago proteins ( 56 ) did not show repression in the tethering assay. This finding is consistent with previous reports that Ago proteins were not the direct effectors of repression ( 19 41 ) GW182/TNGW1 with a comparable silencing activity to the established silencing length GW182/TNGW1. Contribution Ago2 Binding An intriguing finding was that the two identified GW182 domains with repression activities 3A) and 3B). The Ago hook has been shown to bind to Ago2 independently in vitro but it is not conserved in all GW182 related proteins ( 3 41 60 ) The RRM is linked to RNA binding activity ( 1 ) and is highly conserved in the GW182 family. Initial experiments were designed to examine whether the Ago hook or RRM was important for the repression effect of better evaluate the silencing roles of these two domains, truncated constructs were

PAGE 39

39 generated (Figures 2 3A and 2 which contain about equal distribution of GW/WG moti fs, both truncated constructs had Ago hook significantly lost the repression activity (Figure 2 3A). Thus, these results showed that the Ago hook was induced repression in the tethering assay. To examine the importance of the RRM domain, two C terminal deletion cons RRM domain, M GW region and part of the C GW region, retained repression activity contained M GW but no t the RRM domain, was significantly reduced compared to full 3B). Our data with human GW182 were consistent with recent reports on human TNRC6C ( 2 2 ) and dGW182 ( 3 40 41 55 ) showing that the RRM and its flanking sequences enriched in GW/WG motifs (M GW and C GW) were pivotal for the To determine whether the observed repression activity was correlated with the activity using a GST pull down assay (Figure 2 3C). The results showed that NHA NHA re all pulled down by GST PIWI albeit at different efficiency. For a semi quantitative analysis, when normalized to the pulled down GST PIWI levels and compared to NHA

PAGE 40

40 expressed NHA d down,(Figure 2 3C). This estimation was consistent with the results showing that the Ago hook alone was insufficient to achieve maximum binding to Ago2 ( 19 21 ) Intriguingly, the integrity of structure to perform both Ago2 binding and silencing of the bound mRNA. The positive control NHA binding sites reported by Takimoto et al. ( 21 ) efficiently bound to GST PIWI a s evidenced by up to 85% pull down of the input protein (Figure 2 3C). NHA TNR, previously shown not to bind to GST PIWI, served as a negative control in this experiment ( 56 ) When NHA only 4.2% versus 18% bound to GST PIWI representing 23% relative efficiency. The very weak binding of this C terminal GW182 f interaction was not reported in previous studies ( 3 ) In order to further characterize whether the interaction between GST PIWI and NHA dependent, whole cell lysates were harvested 24 hours post transfection and treated with or without MNase prior to the pull down assay. RNA degradation was monitored by 18S and lamin A/C RNA levels using qRT PCR (Fig ure 2 4A). The interactions of NHA PIWI were shown to be RNA independent (Figure 2 4B). Taken induced repression in the tethering assay nor important f or optimal binding to Ago2. Its full function may rely on the tertiary structure and its relationship to adjacent Ago interacted with Ago2 relatively weakly when compared wit

PAGE 41

41 Reducing Endogenous Repressor Levels Did Not Affect Reporter Repression Induced by 12 and 5 Although it was demonstrated earlier that Ago2 protein was not required for tethered GW182 mediated repression in the tethering function assay ( 35 56 59 ) it was important factors of the miRNA pathway machinery, including endogenous GW182 paralogues. This possibility was tested in a series of tethering assays in HeLa cells where siRNA knockdown was used as an approach to evaluat ing the roles of GW182 used as described in Methods. The other two factors examined were RCK/p54 and TNRC6B, both of which are reported to be important for miRNA function. For example, knockdown of RCK/p54 impaired miRNA function ( 68 ) and tethered RCK/p54 ( 69 70 ) or TNRC6B ( 18 19 22 ) induced translational repression effects. Since HeLa cells expressed both GW182 and TNRC6B but only very low levels of TNRC6C compared to A549 or HEK293 cells (Figure 2 5), knockdown of both GW182 and TNRC6B together activity in each knockdown experiment for NHA normalized to the same siRNA transfected control NHA group. With about 70% reduction of endogenous GW182 or TNRC6B mRNA levels compared to mock transfected or siGFP transfected controls (Figure 2 6B, C, D), the repression effec ts of 6A; t test p value >0.05 between siGFP and other siRNA knockdown in both NHA Efficient knockdown of GW182, TNRC6B and RCK/p54 was monitored by either qRT

PAGE 42

42 PCR or Wes tern blot (Figure 2 6B 6E). An addition control experiment was performed to monitor the effects of siGW182 and siGW182/siTNRC6B knockdown in the tethering assay using NHA TNGW1, NHA 7 shows the siRNA transfection significantly af fected the reporter silencing induced by NHA TNGW1, but not NHA endogenous GW182/TNGW1/TNRC6B and the NHA TNGW1 construct but not NHA tethering assay compared to data shown in Figures 2 1 and 2 3 might be resulted from the introduction of siRNA transfection. In summary, knockdown of endogenous repressors GW182, TNRC6B, and RCK/p54 did not significantly affect the repression previously described in Drosophila ( 23 ) and further emphasizes the independence of GW182 in inducing translation silencing in human cells. 5 Not 12 Enhanced Ago2 Mediated Repression in Tethering Function Assay Since both 5 and 12 have comparable silencing activity when tethered to the luciferase reporter 3 UTR (Figure 2 1 and 2 3) and none of the known endogenous factors tested were req uired for their repression function, it remained unclear whether their mechanism of inducing repression was similar. Therefore, experiments were designed to determine whether the expression of 5 and 12 as a GST tag fusion proteins could interfere with N HA Ago2 tethered assays, as shown in Figure 2 8. As expected, the positive control NHA TNGW1 typically showed 85 90% repression expressed as a reduction of luciferase activity compared to the NHA control when tethered to the RL 5boxB reporter ( 35 ) There was also the typical ~60% repression

PAGE 43

43 compared to the NHA control when NHA Ago2 was tethered to the RL 5boxB reporter ( 35 47 ) Interestingly, there was significantly (33%) enhanced repression with the co expression of GST 5 (Figure 2 8A, *, t test, p <0.01, n = 3). In co ntrast, significant differences were not observed for co expression of GST 12, Ago2, or QN (Figure 2 8A). Furthermore, neither GST 5 nor 12 co expression affected repression in the tethering assay utilizing NHA GW182 or NHA TNGW1 (data not shown). Since both NHA GW182 and NHA TNGW1 consistently showed the highest levels of repression, it was not likely that any further enhancement could be observed for GST 5 or GST 12. Similar significantly enhanced repression for NHA Ago2 was observed by co expr ession of GFP 5 but not GFP 12 (Figure 2 8B) indicating the effect is not related to the GST tag. The 5 mediated enhancement in repression by NHA Ago2 implied that this could be due to binding to other translational machinery or RNA decay factors that remain to be determined. Although 12 strongly bind to Ago2, it did not affect repression by tethered Ago2. 12 Not 5 Interfered with Endogenous miRNA Repression ble to bind Ago proteins ( 56 ) Thus, the next experiment was to examine whether thes e three Ago binding regions would interfere with endogenous miRNA function in a dominant negative manner. The RL reporter for miR 20 (RL 20 bulge), which contains seven miR 20 target sites and forms bulge structures with miR 20 ( 66 ) was used to monitor the cellular miR 20 functional status. In normal conditions, the expression of RL 20 bulge is inhibited by the endogenous basal miR 20 (data not shown). To our surprise, when GST TNR, transfected with the RL 20 bulge reporter using the dual luciferase system, only G ST

PAGE 44

44 expression of RL 20 bulge in all three conditions when increasing amounts of GST plasmids were used (Figure 2 induced repress ion with >3 fold 20 bulge reporter silencing (p<0.01). As already shown in Figure 2 induced repression in a tethering assay no r responsible for maximum binding with Ago2. Therefore, the next question was whether the Ago hook domain could be responsible for the miRNA interference effect or de also avoid any potential tag dependent effects when onl y GST tag was used, NHA Meanwhile, another RL reporter with miR 20 target sites forming perfect match with endogenous miR 20, thus acting as reporter for the siRNA pathway, was utilized to determine whether this interference also applies to the siRNA pathway. The results capability to interfere with 20 bulge reporter miRNA function (Figure 2 9B, le ft panel, p miR20 induced repression (Figure 2 9B, left panel). This interference was only observed with the 20 bulge but not the 20 perfect reporter, thus demonstrating over miRNA specific manner. Compared to the 20 bulge reporter, the 20 perfect reporter showed enhanced repression effects from efficient mRNA degradation induced by the siRNA machin

PAGE 45

45 3C) and yet its miRNA interference effect was weaker, indicating there were additional factors involving in interfering this miRN A mediated silencing. This led us to further examine the role of GW/WG motifs residing in this fragment by generating mutations of those motifs. Substitution of GW / WG Motifs with Alanines in Hindered Its Tethering Assay Activity, as Well as Its Inte rference with Endogenous miRNA Repression Since the results showed that the Ago hook was not critical for function but 12a retained almost the same capability to interfere with RL 20 bulge reporter, it was important for functions besides binding to Ago2 (Figure 2 alanine (AA) residues. In a tethering assay using RL 5BoxB, NHA ilencing when compared to NHA the interference of RL 10C). These dat a suggested that the interference in miR bind efficiently to Ago2 (Figure 2 ht be responsible for both mediating strong repression and impairing miRNA mediated silencing. It appeared that the GW/WG motifs in different regions of GW182 have different functional ined Ago binding site but it was not efficient in both tethering and 20 bulge interference assays Ago binding ( 56 ) However, it is acknowledged that these mutations may influence the

PAGE 46

46 global folding of the fragment and more detailed mutagenesis is needed in future studies to further define the roles of these GW/WG motifs. Collectively, GW/WG motifs miRNA induced repression. GW/WG motifs located in different regions of GW18 2 might have different functional preferences or formed a particular three dimensional structure that requires further investigation. and Bound to PABPC1 but Only Mildly Affected miRNA Degradation In the eukaryotic cap dependent translation initiat ion step, mRNAs usually form circularized structures facilitated by the binding between the cap binding complex eIF4E/4G and Poly A binding protein PABPC1 to favor association with the 40S ribosome ( 71 ) Thus, PABPC1 has been shown to play a critical role in mRNA degradation ( 25 ) play differential roles in mRNA degradation, GST pull down experiments were designed to investigate the interaction between GW182 fragments with PABPC1. The positive e C terminal half of TNWG1, including the PAM2 (DUF) domain, bound strongly to GST PABPC1 (Figure 2 11A). This data is consistent with the results showed weak binding (arro w) for PABPC1 and this is consistent with a recent report ( 26 ) describing weak binding activity in the C terminal region of GW182. It is ther the interaction between GST PABPC1 and NHA hours post transfection and treated with or without MNase prior to the pull down assay as described in Figure 2 4. The interactions of NHA PABPC1

PAGE 47

47 were shown to be RNA independent (Figure 2 12). To further fine mapping the PABPC1 binding sites on two GW182 repression domain, additional pull down assays have been set up to examine the detailed interaction. PABPC1 interacte d with NHA NHA 13). Note that the reflecting that these are weak interactions (data not shown). A qRT PCR was utilized to measure the level of degradation of the RL 5Boxb reporter mRNA in tethering assay normalized to the FL mRNA level ( 35 ) As shown in Figure 2 11B, both NHA when tethered to the reporter comparable to the activities of NHA GW182 and TNGW1, respectively. The observation that NHA is consistent with the recent comparable dGW182 silencing domain (aa205 490, cf. dGW182) also induced mRNA degradation in tethering assay ( 53 ) This difference in the extent in mRNA degradation may be explained by variations in methodology used to detect degradation (i.e. qRT PCR in this study versus Northern blot ( 53 ) ), as well as differences in the activity of human GW182 versus the Drosophila orthologs. Discussion Overlapping Domains Mediating Repression Since its discovery in 2002 ( 1 ) increasing and compelling evidence from different labor atories has shown that GW182 and its paralogues have important functions in miRNA mediated translational repression, as well as mRNA degradation ( 18 19 21 23 25 26 31 35 38 41 53 60 ) A summary of the functional characteristics of different domains of GW182 in this study is shown in Figure 2 14, where their differential Ago2

PAGE 48

48 binding, repression in tethering assays, enhancing Ago2 mediated repression, and releasi ng endogenous miR 20 repression are compared and contrasted. Our previous data showed translational repression of tethered Ago2 to reporter 3 UTR required GW182 and that tethered GW182 exerted a stronger repression than tethered Ago2 ( 35 ) As exemplified in the present study, these observations led to further mapping of the functional repression domain(s) of human GW182 by generating a series of deletion constructs using tethering assays. Recent reports have shown that the C terminal domain of human GW182/TNGW1, TNRC6B, and TNRC6C ( 18 19 22 ) and Drosophila GW182 ( 23 41 53 55 ) exert strong translational repression when tethered to the 3 UTR of the reporter mRNA. Our current data from human GW182 tru ncated constructs also support the conclusion that GW182 C luciferase activity of the 5BoxB reporter when tethered to its 3 (aa1670 1962) was the minimum domain that retained the full a ctivity. It was well established by Izaurralde and colleagues that the M GW and C GW domains in the C terminus of Drosophila GW182 act as a bipartite silencing domain and the RRM contributed to, but was not required for, silencing in tethering and complem entation assays ( 3 40 41 55 ) In a study of TNRC6C by Filipowicz and co workers, C terminal mutation and deletion constructs were generated to elucidate the importance of the integrity of M GW and C GW in silencing domains; only RRM mutations mildly affected ( 22 ) Our data of human GW182 supported these GW deletion was impaired but still maintained ~50% repression through the M

PAGE 49

49 with the C GW, RRM and C GW retained full repression activity. In contrast to reports to date, the current study demonstrated that another repression domain 1219), in the middle regi on of human GW182 appear s to be crucial for this repression function. This is the first time that the functional repression 14) of human GW182. However, it should be noted that some TNRC6C fragments such as aa1 405 or aa1 1304 have been shown to be partially active with about 50% repression activity in tethering assays ( 22 ) Our data ruled out the Ago hook as a critical region for repression ac tivity. Since the Ago hook domain was defined in binding the Ago PIWI domain both in vitro and in vivo ( 60 ) a number of recent studies showed that additional Ag o hook independent GW182 fragments could efficiently bind Ago protein in human GW182, TNRC6B, and TNRC6C as well as dGW182 ( 18 19 21 41 56 ) For example, the report of Takimoto et al ( 21 ) identified three defined Ago2 binding domains that corresponded to aa697 739, aa969 1031, and aa1059 1163 (Figure 2 14). It has also been shown that deletion of the Ago hook in GW182 and TNRC6C did not totally abolish the binding to Ago proteins ( 19 ) Chekulaeva et al observed that three dGW182 regions were respon sible for the repression in Drosophila ( 23 ) The first repression region was the C terminal domain of dGW182; the second repression region was the N terminal domain aa1 605 (cf. dGW182); the third region (aa605 830, cf. dGW182), including the QN rich region, also triggered repression. We note that comparable activity for the corresponding region in hum an GW182 was not observed in our present study, an inconsistency that could be due to paralogue or

PAGE 50

50 species specific effects. During the preparation of this manuscript, Chekulaeva et al published a report showing the functional significance of GW/WG rep eats on dGW182 repression domain (aa205 490) that induced reporter silencing ( 53 ) These investigators showed alignment of their repression domain with other GW182 homologs and found that mutation of certain conserved amino acid residues abolished repression induced by these dGW182 fragments. Interestingly, the alignment showed the second 1343). In agreement (Figure 2 ents a new core repression region with somewhat higher repression than 1, In order to investigate whether the repression effects caused by these fragments were direct or indirect, knockdown tethering experiments utilizin g endogenous GW182, TNRC6B, or RCK/p54 did not dramatically impair the 5BoxB reporter repression independent repression domains in human GW182 with differences discussed further in 1, and Figure 2 3A) and its ability to enhance Ago2 mediated repression in a tether ing assay (Figure 2 8). However, since it is still unclear how these domains bind in vivo it GW182 has been shown to bind multiple Ago miRNA complexes ( 19 21 41 56 ) Studies have showed t hat closely spaced miRNA target sites often act synergistically

PAGE 51

51 and result in stronger repression than those separated by greater distances ( 62 ) The demonstra tion that there is more than one repression domain in each molecule of GW182 as described in this study and described by others in Drosophila ( 23 53 ) suggests that re examination is in order to elucidate how enhanced repression may be triggered when miRNA sites are approximated to each other in 3 UTRs. The functional advantages of the dual repression domain GW182 with their own functional bias requires elucidation. It is conceivable that GW182, and perhaps its paralogues, function best to regulate mRNA with multiple miRNA binding sites. Future studies will need to address the molecu lar mechanism how mRNAs with multiple putative miRNA binding sites will benefit the efficiency of regulation in concerted manners. GW182 Mediated Translational Repression Distinguished from miRNA Deadenylation and Decay MicroRNAs bind primarily to the 3 U TR of their target mRNA, and mediate translational repression and/or mRNA decay, although the detailed molecular mechanism is still not completely understood. Several models have been proposed indicating that translation repression is achieved by inhibiti on of translational initiation, elongation, or mRNA deadenylation ( 2 13 ) A recent report utilizing in vitro translation extracts from mouse Krebs 2 ascites cells showed miRNA mediated deadenylation occurred 1 2 hours after initial translational inhibition ( 25 ) These investigators and others also showed that the C terminal domain of GW182 bound to deadenylases through the DUF conserved domain located between the QN rich domain and the RRM domain ( 25 26 ) (also known as PAM2 domains ( 40 ) Figure 2 14) and recruited deadenylase s to the target mRNA. This deadenylation process requires binding of

PAGE 52

52 Ago2 and GW182 paralogues and this binding appears to be RNA independent ( 25 ) Similar res ults have been observed in mouse 3T3 cells where it was shown that when mRNA is bound by miRNA, a two step deadenylation takes place followed by decapping ( 58 ) I n Drosophila S2 cells, the DUF domain of dGW182 binds to PABPC1 and thus competes for eIF4G binding and leading to the disruption of the circularized mRNA structure that would normally favor translation ( 57 ) It is proposed that PAM2, M2 (betwee n PAM2 and RRM), and C terminal region on dGW182 together define a binding region to PABPC1 ( 40 57 ) (F igure 2 14). In contrast, PAM2 on TNRC6C appears to be the major binding site for its interaction with PABPC1 ( 25 40 ) Another weak PABPC1 binding site was subsequently identified on the TNRC6C C terminal domain downstream from the RRM ( 26 ) These recent data indicate that there are differences in GW182 PABPC1 complex formation when different GW182 related protei ns are compared. Of relevance to the pre lack the known PABPC1 binding domain DUF (Figure 2 14) but still caused remarkable repression in a tethering assay and exhibited enhanced Ago2 mediated repression GST pull down assays PABPC1 (Figure 2 11); nevertheless, these reactivities with PABPC1 appeared specific Thus, it is interesting that the two defined repression domains, lacking DUF, somehow still associated with PABPC1. It can be speculated that when mRNA is bound by specific miRNA Ago complex, translational inhibition occurs relatively rapidly and is medi ated by one or the other repression domains of GW182 (or from its paralogues), but the

PAGE 53

53 deadenylation step can be delayed. This process may be reversible within a narrow time frame and the repressed mRNA still may be released for further translation. Whet demonstrated that human GW182 repression domains can be clearly separated from the putative PABPC1 binding domain DUF. Distinct Implying Differenti al Functions for GW182 ? It has been shown by us ( 31 56 ) and others ( 19 21 41 ) that the N terminal and middle region of the GW182 family and dGW182 possess multiple Ago2 binding sites. Our co substantially lower affinity for Ago2. Co NA rather than siRNA activity, as determined by the difference between activity of RL 20 bulge and RL 20 of miRNA function following overexpression of dGW182 or human GW1 82 paralogue fragments that bind Ago has been reported. For example, overexpression of the N terminal half of Drosophila GW182, which bind Ago1 protein, impaired miRNA function and the impairment was rescued by overexpression of Ago protein ( 54 ) Other data showed that synthetic peptides or recombinant proteins corresponding to the Ago hook domain impaired translational efficiency in an in vitro translation ass ay ( 60 ) or impaired miRNA mediated deadenylation ( 25 ) In particul ar, let 7 mediated translational repression is inhibited by a GW182 fragment containing multiple Ago2 binding sites in vitro ( 21 ) As summarized in Figure 2

PAGE 54

54 apparent effect on miR 20 repression, but not the siRNA like repression by miR 20 or affect Ago2 repression in tethering assay? Clearly, more studies are needed to address these questions. Speculations on the potential implication of these questions will undoubtedly stimulate discussion, debate and future research directions. GW182 was identified as a marker for cytoplasmic foci GW/P bodies ( 1 ) dy the two putative pools has not been studied extensively as there are many factors that may influence this dynamic process. For example, transfection of siRNA into culture cells ( 34 ) or lipopolysaccharide stimulated monocytes ( 72 ) cause an increase in nu mber and size of these foci and probably switch GW182 from the soluble to the insoluble pool. In contrast, induced cell quiescence ( 6 ) or blocking the biogenesis of miRNA ( 33 ) lead to disassembly of GW/P bodies and increases in the soluble pool of GW182. A technical c onsideration is that, the separation of soluble versus insoluble pool also likely depends on the composition of the lysis buffer including whether commonly used detergents are used. The significance of the two distinct repression domains in GW182 and thei r relationship to two or more cytoplasmic pools also deserves consideration. Whether certain GW182 can exert inhibition of repression as demonstrated by 20 repression will also need to be explored. In conclusion, this study ident ified two distinct repression domains in GW182 using tethering assays and showed their characteristics in different functional assays. Observations that GW182 is characterized by having multiple Ago binding sites with

PAGE 55

55 different binding affinities, as well as two distinct repression domains, is highly miRNA mRNA complexes or in aggregating Ago miRNA mRNA complexes to establish an efficient repressed state. Alternatively, our data also suggest t hat GW182 may regulate the fate of repressed mRNA and potentially direct the repressed complex to decay or reversal to a translational state. This work has been published: Yao, B., Li, S., Jung, H.M., Lian, S.L., Abadal, G.X., Han, F., Fritzler, M.J. and C han, E.K. (2011) Divergent GW182 functional domains in the regulation of translational silencing. Nucleic Acids Res, 39, 2534 2547.

PAGE 56

56 Figure 2 1. overlapping GW182 domains harboring repression in tethering function assay. The left panel shows GW182/TNGW1 and their series of truncation constructs. Amino acid residues of GW182 constructs are referenced to TNGW1, the longer is oform of GW182 (GenBank Accession NM_014494.2). TNR Q repeat (green), glutamine repeat at the N terminal domain of TNGW1; N GW, M GW, and C GW (yellow), three glycine/tryptophan rich regions; Ago hook (red), a region reported to bind Ago protein; Q/N rich (purple), glutamine/asparagine rich region; DUF, domain of unknown function (orange); RRM (blue), RNA recognition motif. The right panel shows relative repression effects on reporter (either FL 5BoxB or RL 5BoxB; data combined as no difference was observ ed between reporters) by tethering the corresponding Their repression effects were normalized to NHA control, which was assigned as 1. Bar graphs show averages with standard errors (error bars); n, numbers of r epeated experiments; represents significant difference from NHA in t test, p <0.01; NS, no statistical significance.

PAGE 57

57 Figure 2 2. The expressionof selected NHA constructs from representative tethering experiments were monitored by western blot using a nti HA monoclonal antibody. Signals were enhanced by increasing contrast to better visualize the low level of the NHA TNGW1 band.

PAGE 58

58 Figure 2 3. Roles of Ago hook and RRM domains for repression in tethering function assay and binding to Ago2. A) The Ago mean standard error from three independent experiments. represents significant difference between using t test, p re presents significantly different compared to in t from three independent experiments. C) Semi quantit ative Western blot analysis showed differential binding of NHA GW182 domains to GST PIWI in GST pull down assay. Bands (arrows) in blotting data were quantified and normalized to the total input (left panel) to obtain percent pull down as shown for each l ane at the bottom of the anti HA panel. NHA NHA down, respectively, whereas NHA only 1.1%, 20%, 23% binding, respectively, to GST PIWI com pared to NHA TNR and NHA controls respectively. *, nonspecific bands.

PAGE 59

59 Figure 2 4. The interactions of GW182 repression domains and Ago2 PIWI d omain was independent of RNA. A) The conditions for MN ase digestion effectively reduced the RNA level in HeLa whole cell lysates. Note that the incubation conditions for MNase (Mock) already demonstrated si gnificant degradation of RNA. NHA TN R served as negative control.

PAGE 60

60 Figure 2 5. TNRC6C expression was very low in HeLa cells compared to A549 and HEK293 cells. To evaluate the relative expression levels of GW182 related protein and Ago2 in different cell lines that were used to perform t ethering and RNA interference assay, RNA from each cell line was extracted and examined by qPCR. For comparison, mRNA levels in HEK293 were normalized to 1.

PAGE 61

61 Figure 2 6. Knockdown of endogenous repressors did not affect repression activity of the two defined domains 12 and 5 in the tethering assay. A) Repression by 12 and 5 were not significantly altered when GW182, TNRC6B, GW182/TNRC6B, or RCK/p54 was knocked down by respective siRNAs. Results are expressed as mean standard error from three in dependent experiments. There is no statistical significance difference comparing each knockdown to siGFP within NHA t test ). Efficiency of siRNA knockdown was monitored in each individual experiment using qRT PCR for B) G W182 C D) TNRC6B compared to the untreated HeLa cell control, or E) Western blot analysis for RCK/p54 compared t o siGFP transfected controls The extract from cells transfected with NHA and siGFP was loaded at three concentrations (100%, 50%, and 25%) to demonstrat e the semi quantitative detection of RCK/p54.

PAGE 62

62 Figure 2 7. Tethered NHA TNGW1 was employed as an additional control to monitor were independent of endogenous GW182/TNGW1. SiGW182 knockdown impaired NHA TNGW1 induced tethering repression as ex pected. In comparison with control siGFP, both siGW182 and the combination of siGW182+siTNRC6B severely impaired the tethered reporter repression indicating the full length TNGW1 was efficiently knockdown. Results are expressed as mean standard error f rom three independent experiments. represents significant difference in t test compared with siGFP, p<0.01.

PAGE 63

63 Figure 2 8. 12, enhanced Ago2 mediated repression in the tethering function assay. A) Co expressing GST 5 with NHA Ago2 that was tethered to the RL 5boxB reporter enhanced the NHA Ago2 mediating repression from 60% to 80% (33% enhanced repression). In contrast, co expression of GST 12, QN, or Ago2 did not show significant change. Results are expressed as mean standard error from three independent experiments. represents t test compared NHA Ago2+GST with NHA Ago2 alone, p<0.01. B) Identical experiments as in panel A except GFP tagged proteins were used in place of GST fusion proteins. Results are expressed as mean standard error from three independent experiments. Representative cell lysates were analyzed by Western blot to demonstrate e xpression of NHA Ago2 and GFP fusion proteins with tubulin expression shown as loading controls.

PAGE 64

64 Figure 2 9. A) GST 12, but not GST 5, interfered with miR 20 mediated repression. Three different amounts (0.6, 0.3, 0.15 g) of GST TNR, plasmids were co transfected with the RL 20 bulge reporter into HEK293 cells. The RL 20 bulge expression was significantly increased when cells co function. represents significant difference in t test compared with +GST TNR, p <0.01, n=3; ** represents highly significant difference in t test compared with +GST TNR, p<0.0001, n=3. constructs only interfered with miRNA but not siRNA mediated repression. NHA tag, NHA TNGW1, co transfected with reporters RL 20 bulge/FL or RL 20 perfect/FL in HEK293 cells. Compared to the NHA control, the relative activity of RL 20 bulge was significantly increased in cells expressing NHA cells expressing TNGW1 or not interfere with RL 20 perfect reporter that repressed by siRNA pathway. Results are expressed as mean standard error from three independent experiments. represents significant difference in t test comp ared with +NHA, p<0.01.

PAGE 65

65 Figure 2 10. Substitution of glycine (G) and tryptophan (W) residues with alanine (A) in miRNA repression activity ith GW and WG residues are underlined; these residues are substituted with AA to 5BoxB tethering assay. NHA controls. represents signifi cant different in t test compared with NHA mediated repression. Experiment was performed as described in Figure 2 9B.

PAGE 66

66 Figure 2 ficantly affect reporter PABPC1 was co transfected with different NHA tagged constructs into HeLa cells as shown above the panels for the designed GST pull down a ssay. After 24 hours, cell lysates were harvested and analyzed by GST pull down followed by Western blot analysis. GST PABPC1 strongly pulled down NHA pression with only moderate reporter mRNA degradation. To determine the mRNA level of the reporter in tethering assay, a pair of each RL and FL primers was utilized in SYBR Green qRT PCR. The RL mRNA level was normalized to FL mRNA. All results are expr essed as mean S.D. from three independent experiments. represents significant difference in t test compared with NHA, p<0.01. No significant difference observed in mRNA degradation for any of the constructs compared with NHA.

PAGE 67

67 Figure 2 12. The in teractions of GW182 repression domains and PABPC1 was independent of RNA. MNase digestion effect has been demonstrated in Figure 2 4.

PAGE 68

68 Figure 2 13. NHA PABPC1. GST PABPC1 was co transfected with different NHA tagged constru cts into HeLa cells as shown above the panels for the designed GST pull down assay. After 24 hours, cell lysates were harvested and analyzed by GST pull down followed by Western blot analysis. NHA 11.

PAGE 69

69 Figure 2 14. Summary of GW182 domain functional characteristics. DUF, sequence identified to be important for PABPC1 binding. A reference schematic map of TNGW1 in one recent review ( 40 ) is included for comparison. UBA, Ubiquitin associated domain; PAM2, PABP interacting motif 2. Regions M1 and M2 together with PAM2 formed the Mid region. Middle region and C terminal region but not RRM defined the bipart ite silencing domain.

PAGE 70

70 CHAPTER 3 DEFINING A NOVEL ROLE OF GW182 IN MAINTAINING MICRORNA STABILITY Background MicroRNAs (miRNAs), a family of 20~25 nt single stranded non coding RNAs, has become a major focus in many biological processes due to their pote nt ability to moderate target mRNA function ( 17 ) To date, 50% or more mRNAs are regulated by miRNAs involved in almost all known cellular pathways ( 5 13 ) miRNAs are commonly transcribed from endogenous genomic loci and their biogenesis comprises multiple steps, including the processing of primary miRNAs (pri miRNAs) by Drosha in the nucleus and precursor miRNAs (pre miRNAs) by Dicer in cytoplasm to become mature miRNAs. The guiding strands then directly associate with Argonaute (AGO) proteins, core components of the RNA induced silencing complex (RISC), serving as address labels t o guide RISC to downregulate their target mRNAs by imperfect sequence matches ( 2 4 ) Maintaining proper le vels of cellular miRNA is important for normal cellular activities. Aberrant expression of certain miRNAs has been described in many diseases, including cancer ( 73 ) Although different mechanisms have been reported to regulate each step of the miRNA biogenesis process, the understanding of mature miRNA turnover is lagging behind ( 4 74 ) Several recent studies begin to shed light on this issue by demonstrating that particular mature miRNAs show dynamic and distinct turnover rates during the cell cycle ( 75 76 ) or from cells that are grown at different densities ( 77 ) even though those miRNAs are closely related to or are from the same gene clusters. Others show that miRNA decay in retina n eurons is much faster than non neuronal cells and this may contribute to neuronal activity ( 78 ) In contrast, global

PAGE 71

71 transcriptional arrest reveals the majority o f miRNA remain stable, with a few exceptions, suggesting a protective mechanism against decay under quiescent condition ( 79 ) Argonaute proteins directly associate with miRNAs and may protect miRNA from being degraded from ribonuclease. In fact, Argonaute proteins have been shown to positively correlate with mature miRNA levels ( 80 ) A very recent report directly shows that Argonaute protein increased miRN A abundance due to enhanced mature miRNA stability ( 81 ) Recent observations that miRNA can be exchanged between cells via secretory exosomes, multi vesicular endosome derived vesicles ranging from 50 to 100 nm, that are actively secreted through an exocytosis pathway for intercellular cross talk ( 82 ) This introduces the possibility that cells can regulate their intracellular miRNA level through this process ( 83 86 ) Alternatively, mature miRNA has been proposed to be degraded by endogenous ribonuclease. Significant effort has been made to identify the ribonuclease that is responsible for this process in different species ( 79 87 88 ) and has ( 89 ) However, a critical question how microRNase accesses the RISC protected miRNA remains. It has been ten years since GW182 and GW bodies (also known as mammalian P bodies) were initially discovered by our immunostaining and immunoprecipitation with an autoimmune dise ase patient serum ( 1 ) The unique subcellular localization of GW182 and unusual high glycine tryptophan repeat (GW) distribution had immediately drawn our att ention. The function of GW182, however, remained elusive until Argonaute proteins were shown by us and others to co localize and directly bind to GW182 in humans ( 31 38 90 ) Drosophila ( 44 46 ) C. elegans ( 43 ) and Arabidopsis ( 91 ) linking

PAGE 72

72 GW182 to the miRNA silencing pathway. GW182 binds to Argonaute proteins through its unique GW/WG repeats ( 21 41 60 92 ) an d this interaction is crucial for miRNA mediated translational repression, as well as mRNA destabilization ( 35 5 4 58 61 ) GW182 and its longer isoform TNGW1 serve as downstream repressors of Argonaute proteins for gene silencing ( 35 41 46 ) Extensive mapping of AGO inter acting and repression domains on GW182 generated a consensus that the GW182 N terminal GW rich domain primarily binds to AGO on multiple sites, whereas the C terminal domain possesses an intrinsic silencing ability ( 18 22 ) However, in addition to that, the N terminal effective domain, which actually covers much of the middle region of GW182, has also been identified to demonstrate silencing activity in both Dr osophila ( 53 93 ) and humans ( 22 24 ) It is still unclear how miRNA hampers mRNA translation, but important progress has recently been made to illustrate the mRNA decay mechanism induced by miRNA ( 5 ) The conserved GW182 Pam2 motif [Poly A binding protein (PABP ) interacting motif 2] functions as a major docking site to interact with PABP ( 25 26 ) Three very recent studies simultaneously report GW182 can directly interact and recruit the CCR4 NOT deadenylase complex through C term inal conserved W motifs independent of PABP interaction ( 27 29 ) Therefore, GW182 functions as a coordinative platform that disrupts circularized mRNA by interact ing with PABP to initiate translational interference. The proposed mechanism includes displacement of PABP from the Poly A tail and deadenylation by recruitment and activation of deadenylase ( 27 29 ) Since GW182 binds to Argonaute proteins to play a central role in miRNA mediated gene silencing, an interesting question is whether the AGO GW182

PAGE 73

73 interaction also plays a role in protecting AGO associated mature miRNA on top of their silencing function. In the present study, we have identified a novel function of GW182 in protecting mature miRNA from being degraded by interacting with Argonaute proteins. Beside its silencing activities, this study suggests an addition al role of GW182, that of maintaining AGO bound miRNA stability. Materials and Methods Plasmids, siRNA, and miRNA mimic and Ago2 were constructed as described in previous studies ( 20 24 35 ) All cDNAs were cloned in described tethering assay pla smid pCIneo NHA vector ( 35 ) GFP GW182, TNRC6B, and TNRC6C were cloned using the Gateway (Invitrogen) clone system. NHA GW182 and TNGW1 with 5 mutations (5568 T to C, 5571 T to C, 5577 C to G, 5578 C to A, 5580 C to A) that were resistant to shRNA knockdown without Directed Mutagenesis Kit (Stratagene, La Jolla, CA). pSuper pre miR 146a and pCDNA pre miR 155 were generously provided, respectively, by Dr. Nan Shen at the Shanghai Institute for Biomedical Sciences ( 94 ) and Dr. Rolf Renne at th e University of Florida ( 95 ) Ago2 mutant constructs F2V2 and F2W2 were kindly provided by Dr. Zissimos Mourelatos at the University of Pennsylvania. siRNAs agai nst XRN1, XRN2, and RRP41 were synthesized as described in other studies ( 96 97 ) by Dharmacon (Thermo Fish er Scientific, Lafayette, CO). miRNA mimics were purchased from Applied Biosystems (Carlsbad, CA).

PAGE 74

74 Lentiviral Constructs ShRNA sequence against GW182/TNGW1 common region (5567 5585bp on TNGW1 mRNA) is shown in Figure 3 1A, upper panel. shRNA sequence agai nst TNRC6B and TNRC6C was selected from a previous report ( 22 ) shRNA sequence mutant (shGW182 mut) was cloned based on the same strategy serving as a negative control (Figure 3 1A, upper panel). All shRNA sequences were fused with miR 30 stem loop backbone structure (Open Biosystems, Huntsville, AL) to achieve better processing efficiency. Primer sequences for shRNA containing BamHI/MluI restriction enzyme cutting sites, miR 30 stem loop and RNA Polymerase III stop codon are shown in Table 3 1. Forward and reverse primers were then directly annealed and cloned into lentiviral vector pTYF EF carrying GFP and puromycin resistant markers. ShRNA expression was driven by Pol III specific H1 promoter, a transcriptionally weaker promoter t o avoid major cytotoxic effects from lentiviral transduction ( 98 ) GFP was used to monitor the transduction efficiency and identify transduced cells, and puromycin re sistant marker for establishing long term stable cells. Viruses were produced as described ( 99 ) HEK293 cells were transduced with lentivirus that contained shRNA and GFP marker at a multiplicity of infection (M OI) of 20 40 in the presence of 5 g/mL polybrene. Forty eight hours post transduction, live cells were observed under fluorescent microscope for GFP expression. Cells were then tran sferred into puromycin 2.5 g/mL medium for culture. Cell Culture and Tran sfection HEK293 cells were cultured in DMEM containing 10% fetal bov ine serum (FBS) and 100 units/mL penicillin/streptomycin in a 37 C incubator with 5% CO 2 Plasmid coding pre miRNA, siRNA, and miRNA mimic were transfected using Lipofectamine 2000 (Invi 5

PAGE 75

75 wildtype or GW182 KD 293 cells were seeded into 12 well plates one day prior transfection. The next day, 2 g plasmids, 100 nM siRNA, or 40 nM miRNA mimic were transfected into cells for various time points as indicated. Cells were washed once with PBS and subjected to total RNA extraction or whole cell lysate preparation. Nucleofection Cells were transfected by electroporation using the Nucleofector system as per tructions (Lonza, Walkersville, MD). In brief, 5x10 5 cells were seeded into T 25 flask two days prior to nucleofection and maintained in a 37 C incubator with 5% CO 2 On the day of nucleofection, cells were trypsinized and counted. One million cells were mixed with 1 5 g of plasmid DNA together with 100 L Cell Line Nucleofector Solution V from Amaxa Cell Line Nucleofector Kit V specific for HEK293 cells (Lonza Cologne AG, Cologne, Germany). The cell plasmid mixture was immediately transferred into a cert ified cuvette and inserted into the Nucleofector II device (Lonza Cologne AG) and transfection was initiated with program Q 0 01. After nucleofection, ~500 L of the culture medium was immediately added and gently transferred into prepared 6 well plates for continuous culture. Viewed under a fluorescent microscope, GFP expression was visualized within 12 hours with more than 80% transfection efficiency. RNA Extraction, Reverse Transcription and Quantitative PCR (qPCR) Total RNA samples from cultured cells w ere harvested using a mirVana total RNA transcription was performed using High Capacity cDNA Reverse Transcription Kit or miRNA Reverse Transcription Kit (Applied Biosyst ems). The relative mRNA or miRNA levels of target genes were measured in duplicate using TaqMan Fast Universal Master

PAGE 76

76 Mix (Applied Biosystems) with the corresponding TaqMan Gene Expression or miRNA expression Assay (Applied Biosystems). Primer with the seq uence specific to the unique TNGW1 region was used to distinguish TNGW1 and GW182 isoforms. Ribosomal 18s and small RNA RNU44 served as normalizers for mRNA or miRNA levels, respectively. In Vitro Assay for GW182 Dependent Differential miRNA Sensitivity to R N ase Mouse monoclonal anti Ago2 (4F9) was used to immunoprecipitate endogenous Ago2 as described ( 100 ) Rabbit polyclonal anti Ago2 (C34C6, Cell Signaling, Da nvers, MA) was used for Ago2 Western blot. Rabbit polyclonal anti GW182 (5182) was previously described and used for Western blot ( 35 ) To determine the role of GW1 82 in affecting miRNA half lives, 40 mM miR 146a mimic was transfected into both wildtype and GW182 KD cells. Cells were harvested 6 hours after transfection, lysed using NET/NP40 buffer (150 mM NaCl, 5 mM EDTA, 50 mM Tris, pH 7.4, 0.3% NP40) with Complet e Protease Cocktail Inhibitor (Roche Diagnostics, Indianapolis, IN), and then immunoprecipitated by mouse anti Ago2 monoclonal antibody 4F9 ( 100 ) Cell lysates w ere sonicated for 10 sec three times on ice and then centrifuged at 13,200 rpm for 5 min. S upernatant was mixed with 2 00 L 4F9 and 50 l Protein L beads at 4 C for 1 hour. After incubation, the beads were washed a total of four times with NET/NP40 buffer containing 500 mM NaCl Beads were aliquoted evenly and treated with different concentration of RNase at 37 C for 30 min. Total RNA samples were harvested using mirVana total RNA isolation kit (Applied Biosystems) and the levels of miRNA determined by a Taqman qRT PCR (Applied Biosystems). To monitor the levels of GW182, parallel cell lysates and IP samples were analyzed by Western blot.

PAGE 77

77 Secretory Exosomes Purification Exosomes purification was performed as described ( 101 ) HEK293 cell culture medium was subjected to a series of differential centrifugations. In brief, raw cell culture media was processed by centrifuging at 1000 g for 5 min to remove live cells, 3000 g for 10 min to remove dead cells, and 10000 g for 30 min to remove cell debris, then passed through a 0.22 m filter to remove large secretory vesicles and residual debris. The exosomes enriched medium was then either directly exposed to RNA extracti on or further processed at 100,000 g ultracentrifugation for 1 hour to collect the exosome pellet. The exosome pellet was washed once with cold PBS and centrifuged for an additional hour at 100,000 g. The final exosome pellet was resuspended in 30 L of PB S for RNA analysis or Western blot. Mouse monoclonal anti CD63 (BD Pharmingen, San Diego, CA) and rabbit polyclonal anti Rab5b (Santa Cruz Biotechnology, Santa Cruz, CA) were used as exosomal markers. Calculation of miRNA Secretion Ratio The calculation o f the miRNA secretion ratio was based on described methods ( 85 ) with some modifications. The fold changes of intracellular and extracellular miRNAs were determined by qRT PCR. The overall intracellular miRNA fold changes were calculated by PCR fold change per ng x total RNA harvested. The overall extracellul ar miRNA fold changes were calculated by PCR fold change per media volume x total volume. Thereby the ratio of extracellular/intracellular miRNA was calculated. Results Knockdown of GW182 and Its Paralog TNRC6B Impaired miRNA Stability A lentivial based s hRNA strategy was used to generate stable knockdown cells (Materials and Methods in this Chapter). The shRNA sequence against GW182 and its

PAGE 78

78 mutated negative control are shown in Figure 3 1A, upper panel. This negative control was tested throughout the enti re study to ensure that none of the observations were related to false positive from the lentiviral transduction. Nearly 100% of lentiviral transduction efficiency was obtained after 48 hours, as demonstrated by the GFP reporter expression, and cell s were switched into a 2.5 g/mL puromycin containing medium for long term maintenance (referred as GW182 KD and shGW182 mut cells). Lentiviral GW182 KD showed a specific and effective knockdown of 79.1% of GW182 mRNA without affecting its paralogs, TNRC6B and TN RC6C, or its interaction partner, Ago2, and pre miRNA processor Dicer mRNA (Figure 3 1A, lower left panel). In contrast, shGW182 mut did not significantly affect expression. Western blot was carried out to measure the GW182 and Ago2 protein level in all th ree cell lines (Figure 3 1A, lower right panel). Cell lysates were loaded in three different concentrations to obtain a better quantification in Western blot. Compared to wildtype 293, GW182 KD and shGW182 mut cells showed elevated Ago2 protein levels (com pare lanes loaded with 12.5 g total protein); this increase in Ago2 levels as a result of elevated levels of siRNA was reported in another study ( 102 ) In contrast, both GW182 and TNGW1 proteins were effectively knocked down in GW182 KD, but not in shGW182 mut cells. To observe the GW182 knockdown effect, we went on to examine transfected miRNA levels in GW182 KD cells and their wildtype controls. Two plas mids expressing miR 146a and miR 155 were transfected in wildtype and GW182 KD cells. Interestingly, both transfected miR 146a and miR 155 level were significantly lower (50.7%, p<0.01, and 64.2%, p<0.01, respectively) in GW182 KD cells compared to wildtyp e that was normalized to 1 (Figure 3 1B). Renilla and Firefly luciferase reporters were transfected

PAGE 79

79 in both wildtype and GW182 KD cells in separate experiments, which demonstrated that they have comparable transfection efficiency in GW182 KD cells (data no t shown). This interesting observation led us to hypothesize the role of GW182 in regulating miRNA stability. In independent experiments to directly evaluate the mature miRNA levels, 40 nM of miR 146a mimic and miR 132 mimic were transfected into wildtype, GW182 KD, and shGW182 mut cells seeded in equal cell number. Cells were harvested at 6, 24, and 48 hours to analyze for miRNA levels by qPCR. At all three time points, both transfections exerted significantly low miRNA levels, specifically in GW182 KD cel ls compared to wildtype that was normalized to 1, and shGW182 mut controls (Figure 3 1C). For instance, miR 146a levels in GW182 KD cells were 42.7% (p<0.01) at 6 hours compared to the level in wildtype and dropped to 25.5% (p<0.001) at 48 hours. Similarly miR 132 levels in GW182 KD cells were 57.4% (p<0.05) at 6 hours and 44.7% (p<0.001) at 48 hours compared to wildtype. Based on this data, the half life of miR 146a was determined to be 15.3 and 9.0 hours in wildtype and GW182 KD cells, respectively. Simi larly, the half life of miR 132 was 11.9 hours in wildtype and 8.8 hours in GW182 KD cells. Thus the half lives of miR 146a and miR 132 were reduced by 41.1% and 26.0%, respectively, in GW182 KD cells compared to wildtype. Synthetic mature miRNA mimics wer e therefore primarily used in a subsequent study to evaluate the impact of GW182 knockdown on mature miRNA levels. miRNA mimics have been used in similar studies to monitor the dynamic changes of miRNA during different cellular activity and proved to be fa ithfully recapitulating endogenous miRNA activity ( 75 77 ) Transfected miRNA mimics offered a boosted signal f or easy detection, as well as potentially saturating compensatory GW182 paralogs. miR 146a

PAGE 80

80 mimic transfection was also performed in concentrations of 5, 10, and 40 nM for 24 hours, and significant lower levels from each concentration (41.4%, 31.8%, and 24. 4%, respectively; p<0.01) were observed in GW182 KD cells compared to wildtype in all three concentrations tested (Figure 3 1D). Transfection of 40 nM miRNA mimic was primarily used throughout the rest of the study. Taken together, these data demonstrated that GW182 knockdown significantly reduced mature miRNA mimic levels. In mammals, there are three paralogs of GW182 with gene names TNRC6A, B, and C ( 5 ) These paralogs shared broad functional similarities in terms of AGO interaction and miRNA mediated mRNA repression in tethering functional assays ( 18 19 22 ) Transient knockdown of individual paralog caused partially de repression of reporter activity, also implying their functional redundancy ( 22 ) However, clear functional difference of these paralogs has not been described. To investigate whether TNRC6B and TNRC6C also play a role in regulating miRNA stability, lentiviral shRNA based stable TNRC6B knockdown (6B KD) and TNRC6C knockdown (6 C KD) cells were also established. MiR 146a mimic was again transfected into wildtype, GW182 KD, 6B KD, and 6C KD cells for 6 and 24 hours. Intriguingly, TNRC6B, but not TNRC6C, was also required for miRNA stability in these two time points (Figure 3 1E). The lentiviral shRNA knockdown efficiency and specificity is shown in Figure 3 2. Collectively, knockdown of GW182 and its paralog TNRC6B reduced mature miRNA stability. Beside its miRNA silencing activity, the present study shows for the first time a nove l function of GW182 in regulating miRNA stability.

PAGE 81

81 Replenishment of GW182 and Its Paralogs Restored the Shortened miRNA Stability Since knockdown of GW182 and TNRC6B reduced miRNA stability, it was important to perform complementation experiments to exami ne the role of GW182 in regulating miRNA stability. To this end, we tested the wild type and a series of deleted GW182 constructs (Figure 3 3A). Transfections of 5 g NHA vector, NHA Ago2, and NHA GW182 were introduced into wildtype cells by nucleofection for 16 hours, followed by transfection of an miR 146a mimic. Total RNA was harvested 6 hours later for miR 146a qRT PCR analysis (Figure 3 3B, open bars). miR 146a levels in wildtype cells transfected with vector alone were normalized to 1. miR 146a level increased 42.2% (p<0.05) when co transfected with NHA Ago2, consistent with previous observation that elevated Ago2 enhanced miRNA level ( 80 ) NHA GW182 transfection only mildly increased the transfected miR 146a level and was not statistically significant compared to the NHA vector control in w ildtype 293 cells. The transfected miR 146a level in GW182 KD cells without plasmid transfection (no vector) showed reduced level (53.9%) compared to wildtype, consistent with data already shown in Figure 3 1C. The transfected miR 146a level in vector alon e transfection did not show any significant difference compared to no vector control in GW182 KD cells (Figure 3 3B). In contrast, the transfected miR 146a level in GW182 KD cells was restored to comparable levels as in wildtype cells with the expression o f a GW182 construct that was specifically mutated to be resistant to the lentiviral shRNA in GW182 KD cells, in a dose dependent manner (Figure 3 3B, 1 g, 74.0%, p<0.05; 2 g, 74.1%, p<0.05; and 5 g, 91.4%, p<0.001 compared to 56.9% for vector alone). In terestingly, transfection of the 146a

PAGE 82

82 levels comparable to transfected full length GW182 (1 g, 87.4%, p<0.001; 5 g, 106%, p<0.001 vs 56.9% for vector alone). Another GW182 fr restoration of miR 146a level (66.7% vs 56.9%, p<0.05). Transfection of Ago2 in GW182 KD cells also showed mild restoration (70.8% vs 56.9%, p<0.05) and this might imply GW182 was a limiting factor in this reaction. All transfected co nstructs were monitored in Western blot, ruling out the effects caused solely by differential protein expression (Figure 3 3B). leofected in GW182 KD cells for a direct repression ( 24 ) Expression of transfected constructs was mon itored in Western blot (Figure 3 3C). Re expression of TNGW1 in GW182 KD cells by transfection of a shRNA resistant GFP TNGW1 construct in increasing amounts (1, 2, and 5 g) also restored transfected miR 146a levels, peaking at the 2 g level (Figure 3 3D ). Units of 5 g of GFP TNRC6B or GFP TNRC6C transfected by nucleofection into GW182 KD cells for cross complementation analysis each restored the stability of transfected miR 146a (Figure 3 3D). The expression levels of TNGW1, TNRC6B, and TNRC6C were moni tored by qPCR (Figure 3 3E). These data indicated the functional redundancy of the GW182

PAGE 83

83 family in regulating miRNA stability, probably by their comparable affinity to Argonaute proteins ( 19 ) Collectively, re expression of GW182 and its paralogs TNRC6B and TNRC6C, as stability of transfected miRNA levels in GW182 KD cells. The se data strongly support the hypothesis that GW182 regulates miRNA levels by binding to Ago2. GW182 Knockdown Decreased Exosomal Secretion of miRNA In GW182 KD cells, there were two possible pathways for reduction of the transfected miRNA, either secrete d into extracellular space via exosomes or degraded intracellularly by cytoplasmic ribonucleases. To address these two possibilities, extracellular secreted miRNA levels were investigated first. Recent studies suggest that the extracellular miRNAs are prim arily protected by exosomes, the secretory vesicles shed from almost all cell types, and that GW182 may be involved in this process ( 83 84 ) Either upregulation of endogenous or exogenous miRNA results in elevated miRNA secretion via exosomes that can be taken up by recipient cells and has been demonstrated to silence reporter mRNA ( 85 86 ) However, it is disadvantageous to use a miRNA mimic to evaluate miRNA secretion rates in GW182 KD cells due to their pers istence in the media and interference with secreted miRNA measurements ( 85 ) To overcome this issue, plasmids expressing miR 146a and miR 155 were transfected into wildtype and GW182 KD cells to examine the export of these miRNAs. In agreement with a previous study ( 85 ) both miR 146a and miR 155 secretions by exosom es increased in the culture medium (Figure 3 4A). To further confirm miRNA was secreted via exosomes, an established differential ultra centrifugation protocol ( 101 ) was applied to transfected 293 cells media for exosomes purification. Two exosomes markers, CD63

PAGE 84

84 and Rab5b ( 103 ) were used to confirm the successful puri fication by Western blot (Figure 3 4B). Upregulation of either miR 146a or miR 155 did not appear to increase exosomal CD63 or Rab5b suggesting the transfection of miRNA expression plasmids did not increase non specific exosomal export in these experiments RNA was extracted from both the exosome fraction and the supernatant depleted of exosomes. Our data showed the majority of extracellular miRNA (was co purified with exosomes (Figure 3 5B miR 146a: 92.7% vs 7.3%; miR 155: 78.7% vs 21.3%). Both wildtype 293 and GW182 KD cells were transfected with miR 146a and miR 155 plasmids, as shown in Figure 3 5C Relative fold change of both intracellular and extracellular miR 146a and miR 155 compared to GW182 KD and wildtype cells was determined by qPCR and the ra tios of extracellular to intracellular miRNA were calculated based on a previous report ( 85 ) with modifications (Materials and Methods in this Chapter). In bot h plasmid transfections, GW182 KD cells showed a reduced ratio compared to wildtype, demonstrating that the knockdown of GW182 decreased miRNA secretion via exosomes (Figure 3 5C ). Note that the percentage of miRNA in the exosomal fraction was low (0.1% fo r miR 146a and 1% for miR 155) and this was consistent with data from a report evaluating the miRNA level in secretory microvesicles compared to their cellular content in THP 1 monocytes ( 86 ) In summary, elevated intracellular miRNA was detected in exosomes and GW182 knockdown reduced both miR 146a (37.5%, p<0.05) and miR 155 (48.2%, p<0.05) secretion. The fraction of miRNA exported was low and thus ruling out s ecretion as a major miRNA turnover pathway when GW182 was knocked down. These results

PAGE 85

85 demonstrated that the reduced miRNA level in GW182 KD cells was an intracellular event and not due to elevated secretion. GW182 Protected Argonaute Bound miRNA from Degra dation by Direct Interaction By excluding the possibility that the reduced stability of transfected miRNA in GW182 KD cells was due to enhanced secretion into extracellular space, the alternative possibility was that the knockdown of GW182 caused AGO bound miRNA to be more readily accessed and degraded by cytoplasmic ribonuclease. Previous studies identified different exoribonuclease responsible for miRNA degradation in Arabidopsis ( 87 ) C. elegans ( 88 ) and humans ( 79 ) ( 89 ) ribonuclease that plays a role in GW182 KD cells, the effect on siRNA knockdown of the exoribonucle ase complex component RRP41) were examined in GW182 KD cells. First siRNA for XRN1, XRN2, and RRP41 were transfected into wildtype and GW182 KD cells. After 48 hours, miR 146a mimic was subsequently transfected, and RNA was harvested after another 6 hours for qPCR analysis. Interestingly, the miR 146a levels remained unchanged in wildtype 293 cells with all three individual nuclease knockdowns compared to levels in cells transfected with two siRNAs controls (siLamin A/C, Figure 3 6A, left panel, and siGFP, data not shown). Remarkably, the miR 146a level in GW182 KD cells transfected with siRRP41 was 51.4% higher than the same levels in siLamin A/C, siXRN1, and siXRN2 (Figure 3 6A, right panel, p<0.01). These data demonstrated that the miRNA was protected fr om degradation by the AGO GW182 complex in wildtype cells and therefore knockdown of these nucleases did not show any effect. However, in GW182 KD cells, AGO bound miRNAs were more sensitive to degradation,

PAGE 86

86 primarily by the RRP41 lease complex, which is consistent with a previous report showing the role of this exoribonuclease as miRNase in mammalian cells ( 79 ) Furthermore, mRNA qPCR analysis revealed only RRP41, but not XRN1 or XRN2, mRNA was significantly elevated by 52.6% in GW182 KD cells; this apparent compensatory effect might further implicate a role of RRP41 in this process (Figure 3 7). To further confirm that GW182 protected AGO bound miRNA from ribonuclease degradation, immunoprecipitation of Ago2 was performed with monoclonal anti Ago2 4F9 using lysates from wildtype and GW182 KD cells transfected with miR 146a mimic for 6 hours. After three washings, the beads were aliquoted equally into five tubes. One set of aliquoted samples was saved for Western blot analysis to demonstrate the efficient knockdown of both TNGW1 and GW182 in GW182 KD cells (Figure 3 6B, right panel). The four r emaining tubes were subjected either to no treatment or to three different concentrations of RNase A treatments incubated in 37 C for 30 min. Total RNA was extracted from the beads and qRT PCR was performed to evaluate the transfected miR 146a and endogen ous miR 16 levels (Figure 3 6B, left two panels). miRNA levels in untreated groups of wildtype and GW182 KD were individually normalized to 1. Both miR 146a and miR 16 precipitated from GW182 KD cell lysates showed increased sensitivity to RNase A treatmen ts compared to those from wildtype lysates. miR 146a level from GW182 KD cell lysate was 25.3% lower than that fro m wildtype treated with 10 g/mL RNase A. In contrast, compared to the wildtype, the endogenous miR 16 level from GW182 KD lysate was re duced 49.5% using only a 1 g/mL RNase A treatment. The difference in sensitivity was likely due to the high

PAGE 87

87 number of copies of overexpressed miR 146a compared to endogenous miR 16. Thus these data demonstrated similar sensitivity to RNase A for both miRNA mimi c and endogenous miRNA in GW182 KD cells and the role of GW182 in protecting miRNA by binding to Ago2. In order to provide additional evidence that the AGO GW182 interaction is critical for AGO bound miRNAs, a set of Ago2 constructs with differential GW18 2 binding abilities was employed in the next experiment. Two Ago2 constructs harboring mutations on two conserved phenylalanines (Phe470 and Phe505) in the MID domain to valines (F2V2) or tryptophans (F2W2) were first studied for their mRNA cap binding abi lity ( 104 ) It was demonstrated that F2V2 severely impaired binding to GW182 and mature miRNA loading, whereas F2W2 partially retained its ability to intera ct with GW182 and Drosophila miRNAs ( 41 46 58 ) NHA ta gged Ago2 wildtype and mutated plasmids were then transfected into wildtype and GW182 KD cells. Twenty four hours post transfections, the miR 146a mimic was transfected for an additional 6 hours. Cell lysates were harvested for HA immunoprecipitation and a ssociated RNAs were extracted for miRNA analysis. F2V2 showed significantly lower miRNA association from both wildtype and GW182 KD cells in agreement with previous studies that this construct was defective in miRNA loading ( 41 46 ) Ago2 wildtype and F2W2 showed comparable miRNA loading (Figure 3 6C, left panel). When comparing miRNA associated with Ago2, F2 V2, and F2W2 in Ago2 IP, F2V2 showed a significantly lower level (35% in wildtype Ago2 pulldown and 41.3% in GW182 KD pulldown) compared to Ago2 wildtype of miRNA association in both wildtype and GW182 KD cells, consistent with previous observations. Impor tantly, however, both Ago2 wildtype and F2W2 bound

PAGE 88

88 miRNA from GW182 KD cell lysate showed significantly lower levels compared to that from wildtype lysate (Figure 3 6C, left panel, 41.7% and 40.4% reduction, respectively; p<0.05). No significant difference was observed for F2V2 bound miRNA from wildtype and GW182 KD cells. Since previous studies suggested AGO loading is dispensable to GW182 ( 41 ) our data suggested that GW182 protected loaded miRNAs only in Ago2 constructs with normal miRNA loading capacity. Western blot conf irmed the precipitated Ago2 constructs and their putative interactions with endogenous GW182 (Figure 3 6C, right panel). Collectively, our data strongly supported that GW182 binds to Argonaute proteins in RISC complex and play an important role in maintai ning AGO bound miRNA stability. Discussion How GW182 Maintains miRNA Stability by Binding to Argonaute Proteins In the past ten years since GW182 was identified ( 1 ) great progress has been made to establish the role of this unique protein as a central player in miRNA silencing pathways ( 2 5 13 ) It is now becoming clearer that this multi domain protein anchors to the miRNA mRNA complex by binding to Argonaute proteins and facilitates translational repressi on, as well as mRNA deadenylation ( 27 29 ) Argonaute proteins directly associate with miRNA ( 15 105 ) and require GW182 interaction for their functions in translational inhibition and mRNA decay ( 35 54 58 61 ) Argonaute proteins have been proposed to be limiting factors in fo rming miRISC complexes as overexpression of each individual AGO protein enhanced mature miRNA abundance ( 80 ) In fact, our data was consistent with a previous study that concluded that the overexpression of Ago2 in wildtype cells enhanced transfected miRNA levels. However, reduced miRNA level in GW182 KD cells could not be simply explained by a reduction in Ago2 levels. In fact,

PAGE 89

89 GW182 KD and shGW182 mutant cells showed that elevated Ago2 protein levels likely correlated with the elevated level of shRNA ( 102 ) This data suggested a direct role of GW182 in maintaining miRNA stability. Transient knockdown of GW182 and its paralogs individually causes partial alleviation of repression, indicating they are functionally redundant ( 22 ) In our study, stable knockdown of TNRC6B also caused reduction of miRNA but this was not observed when TNRC6C was knocked down. The TNRC6B shRNA appeared to be less potent than TNRC6C as we could ach ieve only a 33.4% knockdown for TNRC6B mRNA, but a 53.6% knockdown for TNRC6C mRNA. This may be due to the different efficacies of shRNAs. The functional differences among GW182 and its paralogs have not been observed so far in different functional assays ( 19 22 ) but TNRC6C seems to be dispensable and tissue specific as HeLa cells have less than 10% of TNRC6C mRNA levels comparing to HEK293 cells ( 24 ) Interestingly, re expression of any GW182 family protein could restore the stability of transfected miRNA in GW182 KD cells, once ag ain indicating their functional redundancy. A previous study suggests that the three GW182 paralogs and four AGO paralogs can form discrete complexes of 12 in total ( 18 ) raising the possibility for differential binding of these complexes to different miRNA subsets. However, recent PAR CLIP experiments demonstrate that AGO and the GW182 family of proteins are associated with similar subsets of miRNA ( 106 ) Conserved domains or amino acids, especially tryptophan on GW182 proteins, usually play a critical functional role by interacting with AGO proteins and affecting the ir silencing activity in tethering assays ( 24 27 29 ) Furth er mapping of the domains that can rescue miRNA stability in GW182 KD cells identified a previously defined silencing

PAGE 90

90 ( 24 ) defined Ago2 binding region ( 21 ) The consensus is that the major GW182 silencing domain represented by the C in restoring stability of the transfected miR 146a in GW812 KD cells (data not shown). has a strong silencing function, it has low or no AGO binding ability ( 107 ) Notably, the conserved tryptophan on the GW182 sequence has proved to be very import ant for interaction with AGO ( 21 41 60 92 ) and the deadenylation machinery ( 27 29 ) Future experiments should be carried out to further define conserved amino acid residues for their role in protecting miRNA stability. Two sets of immunoprecipitation experiments were designed to directly evaluate the requirement of GW182 in the AGO miRNA complex for miRNA stability. Endogenous Ago2 IP from wildtype and GW182 KD cells showed a distinct sensitivity to RNase A treatments with miRNA being more stable in the presence of GW182. Transfected Ago2 wildtype and two conserved phenylalanines mutated to tryptophans (F2W2) that retained miRNA association showed a significant difference in miRNA pulled down from wildtype cells or GW182 KD cells. In comparison, miRNAs recovered from F2V2 that impaired miRNA loading did not show a significant difference between wildtype and GW182 KD. These data implied the presence of GW182 in th e AGO miRNA complex is critical for loaded miRNA stability, although GW182 is not required for the miRNA loading process ( 41 46 ) Previous studies have shown that Argonaute proteins can bind to miRNA through its MID and PAZ domains ( 15 105 ) In fact, several reports have investigated the interplay between AGO miRNA and AGO GW182 in the

PAGE 91

91 RISC complex. For example, Eulalio et al. ( 41 ) and Miyoshi et al. ( 46 ) have systematically examined the different Drosophila Ago1 mutations/deletions for their ability to load miRNA and subsequent GW182 interaction. Their data indicated that GW182 and miRNA binding sites on AGO proteins are uncoupled, def ining miRNA loading and AGO GW182 interaction as two separate events. Our results confirmed previous results that F2V2, but nor Ago2 or F2W2, showed an impaired miRNA loading. Since the knockdown of GW182 did not affect miRNA loaded onto AGO proteins, the reduced Ago2 and F2W2 bound miRNA from GW182 KD cell lysate IP may be due to a lack of GW182 protection from endogenous miRNase. Eulalio et al. also found that some Drosophila Ago1 mutations, such as F777A, showed no GW182 interaction in immunoprecipitatio n, but could still pull down miRNA Bantam. However, the investigators stated that, although these mutations did not interact with GW182 in IP, they exhibited a residual binding ability in vivo. Taken together, our data, along with previous reports, suggest that the absence of GW182 did not alter the miRNA loading onto AGO proteins or the ability of AGO to function in direct association with miRNAs, but may make them more accessible and vulnerable to ribonuclease. Reduced miRNA in GW182 KD Cells Was Not Due To Enhanced Secretion into Extracellular Space It has been noticed that many body fluids, including plasma, urine, milk, and saliva, contain miRNAs ( 108 ) These miRNAs are apparently resistant to nucleases, suggesting the existence of a protective mechanism ( 108 ) Exosomes were initially studied as a vehicle to exchange macromolecules, such as MHC mol ecules between cells in the immune system ( 82 ) Recent exosomes pr ofilings reveal a broad spectrum of genetic materials including mRNA and miRNA that can be taken up by and become

PAGE 92

92 functional in recipient cells ( 83 ) Secretory exosomes derive from endo lysosomal compartments termed multivesicular b odies. Blocking multivesicular body formation compromises miRNA mediated gene silencing linking miRNA activity with endosomal trafficking ( 84 109 ) In particular, GW182, but not Ago2, was found to enrich in exosomes, suggesting a possible alternative miRNA turnover pathway ( 84 ) Our data from cells with elevated endogenous miRNA confirmed the secretion of miRNA mainly via exosomes. These exosomal mi RNAs play an important role in cell to cell communication by regulating recipient cellular activity ( 86 ) However, our data using miRNA expression plasmids show ed a relatively low ratio between extracellular and intracellular miRNA. Therefore, the results suggest that the miRNA secretion via exosomes may not be a major miRNA turnover channel. The decreased stability of transfected miRNA in GW182 KD cells was not due to elevated secretion into extracellular space, but rather due to rapid endogenous degradation. Reduced secretion in GW182 KD cells is consistent with the notion that GW182 may play a role in miRNA secretion via exosomes. However, GW182 was not detecte d in the purifed exosomes in our experiments to date. Further experiments are certainly required to elucidate whether there is a role for GW182, as well as other RISC components, in miRNA secretion. Identification of Critical microRNase Affecting miRNA Sta bility in GW182 KD Cells A few studies have reported variations in the stability of miRNAs in different cell types or conditions. For example, cardiac specific miR 208 is highly stable ( 110 ) whereas miRNAs in retinal neurons decay much faster than in non neuronal cells ( 78 ) likely caused by their tissue specific ac tivities. Cell cycle stage specific miRNA expression patterns have also been investigated. miR 29b was generally unstable in all cell cycle stages but specifically accumulated during mitosis ( 75 ) In contrast, the miR

PAGE 93

93 16 family is accumulated when cells are arrested in G0, but decreased rapidly during cell cycle re entry ( 76 ) Some miRNAs, such as miR 141, but not miR 200c, that are transcribed in the same gene cluster, are very sensitive to cell density and cell cell contact ( 77 ) Consensus sequences have been identified for mature miRNA degradation, implying some sequence specific recognition ( 76 77 ) In our experiments, the stability of plasmid derived miRNA and synthetic miRNA appeared universally reduced, implying a common mechanism of degradation pathway. However, additional regulation of the degradation of specific miRNA controlled by GW182 remained a viable question and identifying putative co factors may help understand this process. Important steps have been made to identify the ribonucleases that are responsible for miRNA degradati on. A family of small RNA degrading nucleases in Arabidopsis can ( 87 ) A screen of a nuclease panel has identified XRN miRNAs in C. elegans both in vi tro and in vivo ( 88 ) Global transcription blocking has i dentified a few miRNA targets, such as miR 382, but they are not stable in HEK293 cells. Knocking down RRP41 results in significant and specific stabilization of miR 382 ( 79 ) Our data supported this observation. In wildtype 293 cells, neither knockdown of XRN1, XRN2, or RRP41 showed any significant elevation of transfected miR 146a levels. Remarkably, knockdown of R RP41, but not XRN1 or XRN2, in GW182 KD cells showed a significant elevation of the synthetic miR 146a level, suggesting that the RRP41 Accordingly, we found that RRP41, but not XRN1 or XRN2 mRNA levels readily increased in GW182 KD cells compared to wildtype cells, implicating an associated

PAGE 94

94 functional role. However, how the RRP41/exosome complex is recruited on site remains to be determined. Knockdown of RRP41 was only effective when GW182 was knocked down, indicating the role of GW182 in protecting AGO bound miRNA. Interestingly, the levels of GW182 and GW/P bodies fluctuated during the cell cycle, suggesting the delicate control of GW182 level in a specific cellular state ( 6 ) In addition, the size and number of GW/P bodies increased when functional siRNAs were transfected ( 34 ) Although the changing levels of GW182 have not been examined in great detail, it is clear that the expression in GW182 is relatively low compared to other genes, such as Ago2. Thus a subtle change of GW182 may have a significant im pact on miRNA stability. In summary, our data suggest a model where GW182 interacts with Ago2 through its N terminal AGO loaded miRNA from 8). This Chapter has been submitted for peer review: Yao, B., La, L. B., Chen, Y. C., Chang, L. J. and Chan, E.K.L. (2012) Defining a novel role of GW182 in maintaining miRNA stability.

PAGE 95

95 Figure 3 1. Knockdown of GW182 and TNRC6B impaired miRNA stability. A) Lenti viral shRNA effectively and specifically knockdowned GW182. ShRNA for GW182/TNGW1 (5567 5585nt) cloned into a lentiviral expression vector for stable knockdown in HEK293 cells (GW182 KD). A negative control lentiviral construct was also generated with mis matched mutations (shGW182 mut) based on the same strategy. Lower left panel, GW182 KD effectively and specifically knockdown GW182 without significantly affecting its paralogs TNRC6B, TNRC6C, its interaction partner Ago2, and Dicer mRNA as determined by q RT PCR. The two stable HEK293 cell lines were therefore referred as GW182 KD and shGW182 mut cells. Lower right panel, total cell lysate from wildtype HEK293 and two stable cell lines were loaded at 50, 25 and 12.5 g total protein. Western blot showed GW1 82 KD, but not shGW182 mut, was specifically depleted of both GW182 and TNGW1 proteins. Ago2 protein levels were elevated in both stable cells comparing to parental HEK293 cells. B) Level of transfected miR 146a and miR 155 reduced in GW182 KD. Plasmid enc oding pre miR 146a and pre miR 155 were transfected in both wildtype HEK293 and GW182 KD cells. qPCR demonstrated that mature miR 146a and miR 155 level were reduced to 35.9% and 74.8%, respectively, in GW182 KD cells compared to wildtype which was normali zed to 1. C) Transfected miRNA levels reduced in GW182 KD. Synthetic miR 146a and miR 132 mimic were transfected into wildtype, GW182 KD, and shGW182 mut cells for 6, 24, and 48 h. The miRNA levels in wildtype with 6 hour mimic transfection were normalize d to 1. D) Transfected miR 146a after 24 hours showed more rapid elimination in 5nM, 10nM and 40nM transfection concentrations in GW182 KD cells compared to wildtype. E) Stability of transfected miRNA was affected most in GW182 KD and TNRC6B KD, but not in TNRC6C KD cells. Lentiviral shRNA against TNRC6B and TNRC6C were transduced into 293 cells to generate TNRC6B and 6C stable knockdown cells (6B and 6C KD). miR 146a mimic was transfected into wildtype, GW182 6B and 6C KD cells. Knockdown of TNRC6B al so affected miR 146a stability after 6 hours and 24 hours transfection although the effect was weaker than in GW182 KD cells. TNRC6C knockdown did not affect transfected miR 146a stability. The miRNA levels in wildtype with 6 hour mimic transfection were n ormalized to 1. miRNA results are expressed as mean S.D. from three independent experiments. t test was used for statistics. *, p<0.05; **, 0.01
PAGE 96

96

PAGE 97

97 Figure 3 2. TNRC6B and TNRC6C specifically knocked down by lentiviral shRNA. TNRC6B and TNRC6C were knocked down 33.4% and 53.6% in 6B KD and 6C KD cells, respectively. Interestingly, TNRC6A/GW182 mRNA levels were significantly elevated in both 6B and 6C KD cells (43.7%, p<0.05 and 23.5%, p<0.01, respectively).

PAGE 98

98 Figure 3 3. Replenishm ent of GW182 and its paralogs restored the shortened miRNA stability. A) Schematic map showed TNGW1, GW182 and their truncated domains. B) Re GW182 KD cells significantly restored miRNA level. Wildtype 293 cells were nucleofected with NHA vector alone, NHA tagged Ago2 or GW182. NHA GW182 full length mutations on shGW182 binding sites (GW1 82) was nucleofected into shGW182 KD cells in three titrations (1, 2, and 5 g). NHA 146a mimic was subsequently transfecte d 16 hours post nucleofection and cells were harvested 6 hours later. The synthetic miR 146a level in GW182 KD cells was significantly restored to comparable to that in wildtype cells (open bar) with re Another GW182 Ago2 only had mild effects in GW182 KD cells compared to vector alone, which did not show significant effects and served as negative control. Expression of transfected proteins were monitored by blotted with anti HA antib ody. miR 146a level from wildtype cells with vector in complementation assay. D) Re expression of GW182 longer isoform TNGW1, TNRC6B, or TNRC6C in GW182 KD cells significantly res tored miRNA level. Wildtype 293 cells were nucleofected with NHA vector alone. GW182 KD cell were nucleofected with NHA TNGW1 with mutations on shGW182 binding sites in three concentrations (1,2 and 5 g), or GFP tagged TNRC6B, TNRC6C in 5 g concentratio n. miR 146a mimic was subsequently transfected 16 hours post nucleofection and cells were harvested 6 hours later. miR 146a level from wildtype cells with vector transfection was normalized as 1. E) mRNA of transfected TNGW1, TNRC6B AND TNRC6C were measur ed by qRT PCR.

PAGE 99

99

PAGE 100

100 Figure 3 4. miRNAs were secreted into extracellular space via exosomes. A) miRNA secreted into culture media in 293 cells. Plasmids encoding miR 146a and miR 155 were transfected in wildtype 293 cells for 24 hours. Cells were pelleted and culture media undergone a series of differential centrifugation to remove cell debris. Both intracellular and extracellular miRNAs fold changes were measured by qPCR relative to untransfected controls. Average CT values are shown for intracellular miR NA in 25 ng total RNA or equivalent of extracellular miRNA in 10 l culture media. B) Purified exosomes from 293 cell culture media with or without plasmid transfection was lysed and blotted for two exosomes marker proteins CD63 and Rab5b to confirm a succ essful enrichment of exosomes. Whole cell lysate of 293 cells was loaded as positive control.

PAGE 101

101 Figure 3 5 Knockdown of GW182 reduced miRNA secretion via exosomes. A) Exosomes purification strategy. B ) Majority of sec reted miR 146a and miR 155 was co purified with secretory exosomes. Exosomes were purified by ultracentrifugation from cell culture media. Total RNA was extracted from exosomes fraction and supernatant that was depleted of exosomes. C ) Knockdown of GW182 r educed miRNA secretion. Wildtype and GW182 KD cells were transfected with miR 146a and miR 155 expression plasmids. Both whole cells and culture media were harvested 24 hours post transfection and subjected to total RNA extraction and qPCR. Knockdown of GW 182 reduced miR 146a and miR 155 ratio outside/inside cells suggesting an intrinsic mature miRNA degradation mechanism. Two or five microgram of plasmids were transfected in both cells independently for accurate measurements. Three independent data sets we re acquired and pooled for statistical analysis.

PAGE 102

102 Figure 3 6. GW182 protected loaded miRNA decay by interacting with Argonaute proteins. A) Exoribonuclease complex was responsible for miRNA degradation in GW182 XRN1, into wildtype and GW182 KD cells. Forty eight hours after transfection, miR 146a mimic was transfected to evaluate its stability. MiR 146a level showed no significant difference in wildtype cells when any of the three nucleases was knocked down compared to control siRNA for lamin A/C. However, miR 146a level was significantly extended to 51.4% more in GW182 KD cells only when RRP41 was knockdown. B) miRNA proned to degradation wit hout GW182 in Ago RISC complex in vitro Ago2 immunoprecipitation was performed using lysates from both wildtype and GW182 KD cell transfected with miR 146a mimic. After three washing, the beads were aliquoted equally into five tubes. Four aliquots were su bjected to either untreated (UT) or incubated 1, 5, or 10 g/mL RNase A at 37 C for 30 min. All four beads associated total RNA was extracted and qRT PCR was performed to evaluate the residual transfected miR 146a and endogenous miR 16 level. The remain ing aliquot analyzed by Western blot for GW182 and Ago2 levels. C) Argonaute constructs showed decrease miRNA association in the absence of GW182. miRNA associated with wildtype NHA Ago2 and two conserved phenylalanines (Phe470 and Phe505) mutation constru cts to valines (F2V2, poor miRNA loading GW182 binding) and tryptophans (F2W2, retained miRNA loading and GW182 binding) were compared in HA pull down assays using both wildtype and GW182 KD cell lysate. RNAs from pull down assays were subjected to qRT PCR miRNA levels recovered from HA pull down using both wildtype and GW182 KD cell lysates showed strong dependence on GW182 interaction. Ago2 wildtype, F2V2 andF2W2 pull down were blotted by HA and GW182 antibodies.

PAGE 103

103

PAGE 104

104 Figure 3 7. siRNA effectively knocke d down exoribonucleases. 100nM of each siRNA against XRN1, XRN2 or RRP41 were transfected into wildtype and GW182 KD cells side by side with control siRNA to lamin A/C. Forty eight hours after transfections, cells were harvested and subjected to RNA extrac tion and qRT PCR. XRN1, XRN2 and RRP41 mRNA was reduced to 38%, 24%, and 23% in wildtype cells, respectively. The comparison of mRNA level between wildtype and GW182 KD cells revealed that only RRP41 mRNA in GW182 KD cells significantly increased by 52.6% compared to wildtype.

PAGE 105

105 Figure 3 8. A model of GW182 binding to AGO and protected miRNA from being rimarily through its N (Protein s are not drawn in scale).

PAGE 106

106 Table 3 1. List of primers for lentiviral shRNA knockdown Targets Seq uence Length GW182 (TNRC6A) GATCCCGTGAGCGATGCTCTGGTCCGCTACAGTAGTGA AGCCACAGATGTACTGTAGCGGACCAGAGCATTGCCTAT TTTTTGGAAA 87nt CGCGTTTCCAAAAAATAGGCAATGCTCTGGTCCGCTACA GTACATCTGTGGCTTCACTACTGTAGCGGACCAGAGCAT CGCTCACGG 87nt GW182 m utant (Negative Control) GATCCCGTGAGCGATGTTCTAGTCCGTCGTAGTAGTGAA GCCACAGATGTACTACGACGGACTAGAACATTGCCTATT TTTTGGAAA 87nt CGCGTTTCCAAAAAATAGGCAATGTTCTAGTCCGTCGTA GTACATCTGTGGCTTCACTACTACGACGGACTAGAACAT CGCTCACGG 87nt TNRC6B Forwa GATCCCGTGAGCGGGAGTGCCATGGAAAGGTATAGTGA AGCCACAGATGTATACCTTTCCATGGCACTCCTGCCTAT TTTTTGGAAA 87nt CGCGTTTCCAAAAAATAGGCAGGAGTGCCATGGAAAGG TATACATCTGTGGCTTCACTATACCTTTCCATGGCACTCC CGCTCACGG 87nt TNRC6C GATCCCGTGAGCGGCATTAA GTGCTAAACAAATAGTGAA GCCACAGATGTATTTGTTTAGCACTTAATGCTGCCTATTT TTTGGAAA 87nt CGCGTTTCCAAAAAATAGGCAGCATTAAGTGCTAAACAA ATACATCTGTGGCTTCACTATTTGTTTAGCACTTAATGCC GCTCACGG 87nt

PAGE 107

107 CHAPTER 4 SUMMARY AND PROSPECTIVE GW182 Plays a Key Role in miRNA Ge ne Silencing Role of AGO and GW182 in miRNA Pathway The first miRNA was described in C. elegans only two decades ago ( 39 ) but now miRNA have quickly become one of the major post transcriptional gene regulation pathway ( 17 ) Several viable models have been proposed to illustrate the m iRNA mediated silencing mechanism, namely interfering with various steps in translation and triggering mRNA decay ( 2 5 ) Either via translational repression or mRNA decay, miRNA associated protein complex (or RNA induced silencing complex, RISC) played a central role. Numerous efforts have been put to identify individual proteins in RISC, among which two mo st important protein families emerge Argonaute proteins (AGOs) and GW182 proteins. They form tight complex by directly interacting with each other though GW/WG motifs on GW182 to the C terminal PIWI domain on AGOs ( 21 41 60 92 ) and this interaction tur ns out to be critical in miRNA silencing function ( 20 35 54 58 61 ) Crystal structure of T. thermophiles AGOs ( 105 111 ) and human Ago2 ( 112 ) confirms AGO proteins directly associate with miRNAs through its MID and PAZ domains. All four mammalian AGO proteins are thought to play an equal role in miRNA mediat ed gene silencing due to their association with similar miRNA pool ( 106 ) although only Ago2 possessed endonucleolytic activity in its C terminal PIWI domain in siRNA pathway to directly cut target mRNA ( 16 ) In addition, AGO protein can also interact with Dicer, in a GW182 mutual exclusive manner ( 46 ) The Dicer processed mature miRNA duplex could then undergo unwinding step, and only guiding strand could be loaded onto AGO proteins with the help of Dicer complex ( 113 115 ) Other

PAGE 108

108 studies show the miRNA:miRNA* duplex could be loaded onto AGO proteins, and the separation of the two strand occurs within AGO proteins ( 116 ) The Dicer AGO complex is also termed as miRNA loading complex (miRLC). In some rare cases, such as miR 451, its maturation is independent of Dicer but requires Ago2 cleavage activity ( 117 118 ) Nonetheless, the miRLC dissociated after miRNA unwinding and loading, and AGO then bound to GW182 to form the mature functional miRNA RISC complex (miRISC). Tethering functional assays offered an unique opportunity to individually examine the silencing potential of each RISC components ( 47 ) and GW182 is clearly highlighted as key repressors downstream of AGO proteins ( 35 41 46 ) Therefore, it is now well established that AGO proteins play important roles in miRNA maturation, unwinding and loading whereas GW182 proteins are the actually silencer, in collaboration with other co fa ctors, triggered translational repression and mRNA degradation (discussed in next section). In fact, deplete both Ago2 and GW182 has been demonstrated to cause severe consequences. Ago2 knockout mice showed embryonic lethality and display several developme ntal abnormalities ( 16 ) Disruption of GW182 in mouse yolk sac led to growth arrest and apoptosis ( 119 ) These data confirm the critical role of miRNA and its functional RISC in maintaining normal cellular activities. GW182 has been shown to bind multiple AGO miRNA complexes ( 19 21 41 ) Studies have shown that closely spaced miRNA target sites often act synergistically and result in stronger repression than those separated by greater distances ( 62 ) These observations raise a possibility that multiple AGOs miRNA complexes anchor to their target mRNA and share one GW182 as their repressor. This may lock GW182 mo re

PAGE 109

109 tightly onto mRNA with multiple AGO miRNA mRNA bindings to further recruit its co factors for silencing. However, one study showed that GW182 was not permanently associated with mRNA in their pull down experiments ( 57 ) Instead, they showed GW 182 was actively removed from mRNA by NOT1 complex. Depletion of NOT1 resulted in the retention of GW182 on mRNA ( 57 ) This observation led these investigators to concluded that GW182 was required to initiate, but not to maintain, silencing and G W182 dissociated from silenced mRNAs after deadenylation ( 57 ) Clearly, more work needs to be done to further confirm the details in this process. For example, i n vitro experiments may be set up to determine the hierarchical assembly of RISC components and their dynamics in silencing miRNA targets. Alternatively, live cell imaging can be applied to track the subcellular localization and movement of GW182 and GWBs. In fact, our preliminary data suggest the involvement of cytoskeleton such as actin in this process. Dual GW182 Silencing Domains Independently Silence miRNA Targets Although it is now a general consensus that GW182 is the key repressor, some discrepant results remain from various laboratories in establishing its silencing domains. The C terminal domain of GW182 is wildly accepted in possessing autonomous silencing activities defined by bipartite domains flanking the RNA Recognition Motif (RRM, Figure 2 1 4) ( 18 19 22 24 41 ) Our data support this notion since GW182 C on the N terminal and the middle region of GW182 was under debate. Our data from tethering assays together with other groups clearly supported the GW182 middle ( 22 24 53 93 ) An immediate question therefore needs to be addressed is the need for

PAGE 110

110 GW182 to have multiple silencing domains and how these domains function together in the full length GW182/TNGW1. Both transfected length GW182/TNGW1 in side by side transfections yet their repression abilities in tethering assays are comparable. These observations suggest the integrity of the full length GW182 evolves into suc h form to achieve maximum silencing effects. equal distribution of GW/WG motifs, both truncated constructs have significant 12. A very recent study systemically examined the role of tryptophans on GW182 N terminal and C terminal domains for silencing activity. Their data revealed tryptophans dispersed across both domains and act in an additive manner by recruiting deadenylase c omplex to trigger both translation repression and mRNA degradation ( 28 ) A binding protein (PABPC1), suggesting the functional redundancy of different GW182 silencing domains. On the other hand, distinctive functionalities were also clearly observed in between Figure 2 14, including their differential ability for AGO interaction, dominant negative effects, and even subcellular localization. These differences may define diverse GW182 functions as discussed below. Collectively, GW182 silencing domains worked independently for silencing mRNA targets. The GW182 wildtype protein possesses maximum silencing activity, likely conveyed by its unique tryptophan motifs. My dissertation work for the very first time identified two non overlapping silencing domains on human GW182 with distinct characters. My research, together with others, leads to

PAGE 111

111 the conclusion that multiple GW182 domains can recruit components of deadenylase by conserved tryptophan residues to inhibit translation and cause mRNA destabilization ( 28 ) The Current Knowledge of GW182 in miRNA Mediated Translational Repression and miRNA Degradation miRNAs bind primarily to the 3 UTR of their target mRNA, and mediate translational repression and/or mRNA decay, although the detailed molecular mechanism for translational repression is still not completely understood. Several models have been proposed indicating that translation repression is achieved by either inhibition of translational initiation, elongation, termination or mRNA deadenylation ( 2 13 ) Contradiction remains that some investigators believethe translation repression only occurs on the initiation stage or elongation stage but others think it might occur on multiple steps simultaneously. As discussed in Chapter 2, a recent rep ort utilizing in vitro translation extracts from mouse Krebs 2 ascites cells showed miRNA mediated deadenylation occurred 1 2 hours after initial translational inhibition ( 25 ) These investigators and others also showed that the C terminal domain of GW182 bound to deadenylases through the DUF (domain of unknown function) conserved domain located between the QN rich domain and the RRM domain ( 25 26 ) (now known as PAM2 domains ( 40 ) Figure 2 14) and A tail can be brought into close proximity by the interaction between cap bin ding protein eIF4G to the PABPC1. This looped structure is in favor to recruit ribosomes for active translation ( 5 ) One model argues that the newly identified GW182 PAB P interaction could competitively disrupt PABP eIF4G interaction, loosen the

PAGE 112

112 circularized mRNA structure to impair translation. In addition, GW182 PABP interaction may facilitate the dissociation of PABP from poly A tail to directly expose unprotected poly A tail from the deadenylase ( 5 40 ) In fact, three recent studies simultaneously report GW182 can di rectly interact and recruit the CCR4 NOT deadenylase complex through its C terminal domain containing conserved tryptophan in adjacent to glycine/serine/threonine rich region; they also show that the formation of the GW182 deadenylast complex is independen t of PABP ( 27 29 ) This model, however, has been subsequently challenged by Fukaya and Tomari et al. ( 93 ) These authors utilized in vitro Drosophila embryo system to demonstrate neither PABP function nor GW182 PABP interaction was prerequisite for shortening of poly A tail and pure translational repression ( 93 ) The absolute requirement of PABP in miRNA mediated gene silencing especially deadenylation process waits to be determined. Another important unanswer ed question is the temporal hierarchy and dynamics between translational repression versus mRNA deadenylation and decay. In some occasions, pure translation repression is observed with little effect on mRNA stability ( 24 120 ) On the other hand, global miRNA induced mRNA decay is proposed to be predominant for miRNA silencing effects ( 121 ) Recent progress has been made to dissect these events using zebrafish ( 122 123 ) and Dr osophila S2 cells ( 124 ) These publications reach an agreement that translational repression and mRNA decay are independent events. Translational repression usually occurs in the early stage of repression before complete deadenylation while mRNA decay takes place in the late stage. These observations are consistent with previous in vitro experiments that translation repression occurs in the early stage before complete deadenylation in mouse

PAGE 113

113 Krebs 2 ascites cells ( 2 5 ) Interestingly, Mishima et al. further suggested that translational repression in zebrafish by GW182 can be divided into two distinct mechanisms. One is previously defined interaction between GW182 PAM2 domain and PABP, as mutations on PAM2 domain tha t abolish the GW182 PABP interaction partially impaired translation repression. In addition, these investigators are able to (P GL domain). Mutations on P GL domains also imp air GW182 mediated translational repression without affecting GW182 PABP interaction. This clearly suggests a PABP independent silencing mechanism. Notably, combined mutations on PAM2 and P GL domains show additive effects in impairing silencing activity suggests multiple mechanisms are involved in miRNA mediated translation repression ( 123 ) A figure from Mishima et al. is shown to better illustrate the PAM2 a nd P GL domains on GW182 (Figure 4 1). GW182 protein family is composed of three paralogs in mammals, gene named TNRC6A, B and C and they seems to have equal silencing potentials ( 18 19 22 35 41 ) Knocking down one of the three paralogs partially de repressed silenced targets indicating their functional redundancy ( 22 ) Tethering experiments showed comparable results among all three paralogs ( 18 20 22 41 ) Their functional differences have not been explored. Intriguingly, TNRC6C seemed to be dispensable as HeLa cells express ten fold less compared to HEK293 cells ( 24 ) Our data indicated that knockdown of TNRC6C did not significantly impair miRNA mimic stability, implying functional difference of GW182 paralogs. However, all three paralogs can complement the

PAGE 114

114 reduced miRNA stability when GW182 was knocked down once again showed that they are functional redundant Although more details need to be further investigated on miRNA mediated translational repression versus mRNA destabilization, the current data taken together strongly suggest a pivotal role of GW182 in miRNA mediated gene silencing. GW182 May Play a Role in miRNA Stability by Directly Interacting with AGOs M iRNA Levels Are Tightly Regulated in Multiple Steps of Their Biogenesis miRNAs are commonly transcribed from endogenous genomic loci and their biogenesis comprises multiple steps, including the processing of primary miRNAs (pri miRNAs) by Drosh a in the nucleus and precursor miRNAs (pre miRNAs) by Dicer in the cytoplasm to become mature miRNAs. The guiding strands then directly associate with Argonaute (AGO) proteins, core components of the RISC, serving as address labels to guide RISC to downreg ulate their target mRNAs by imperfect sequence matches ( 2 4 ) Maintaining proper cellular level of miRNA is fundamental as aberrant expression of certain miRNAs has been described in many diseases, including cancer ( 73 ) Multiple regulations have been described on each step of miRNA biogenes is. For example, miRNA can be regulated on the transcriptional level similar as other protein coding genes. Given the ability of miRNA to regulate gene expression in a post transcriptional manner, negative feedback loop is often observed ( 4 ) In a model of endotoxin tolerance, for instance, miR 146a and many cytokine tra nscripts such as TNF regulated by transcriptional factor NF 146a then in turn down regulates adaptor molecule IRAK1 and TRAF6 on NF prevent overproduction of cytokines ( 125 126 )

PAGE 115

115 Since two RNase III type endonucleases Drosha and Dicer can process primary and precursor miRNAs, many regulations ar e also occurring on these steps by altering their protein levels, their enzymatic activities and specificities, their binding partners or even directly altering the base pairing, to affect the mature miRNA outcomes ( 4 ) Comparing to thes e advances, however, our knowledge of how mature miRNAs are regulated is lagging behind. Mature miRNA dynamic changes have been described in previous studies (Discussion, Chapter 3). The detailed mature miRNA turnover mechanism as well as the role of RISC components in this process remains unclear. Deep sequencing data has now suggested a large pool of mature miRNA undergoing modifications that could potentially regulate their stability as well as their silencing potentials. These modifications included ade nylation, uridylation, and 2 O methylation catalyzed by unique enzymes in plants and animals ( 4 74 127 ) Efforts have also been put to identify the ribonucleases that are responsible for miRNA degradation. Chen and colleagues first identified a class of enzymes defined as small RNA degrading nuclease (SDN) genes in ( 87 ) Grosshans and co workers discovered another ribonuclease XRN 2 that catalyzed ( 88 ) A very recent study showed two exoribonucleases, exosome complex and QIP (a putative exonuclease identified in fun gi ( 128 ) ), are important for fungi small RNAs maturation and degradation in fungi ( 129 ) This is consistent with our data and others ( 79 ) using HEK293 cells that identified ( 89 ) RISC Components in Regulating Mature miRNA Stability AGO proteins have long been shown to correlate with the mature miRNA level, possibly by direct association and protection ( 80 ) Recent progress confirms this

PAGE 116

116 observation by showing AGO proteins directly stabilize miRNA and overexpression of wildtype AGO proteins or even endonucleolytic cleavage inactive AGOs decelerate miRNA decay ( 81 ) However, are other RISC components also involved in regulating miRNA stability? In Chapter 3, knockdown of GW182 did not impair endogenous Ago2 mRNA and protein level but reduced transfected mi RNA mimic stability. Exosome complex was responsible for reduced miRNA level only when endogenous GW182 was depleted. In vitro experiments also suggested miRNAs were more vulnerable to nuclease treatment in the absence of GW182. These observations for the very first time offered more insight of GW182 in protecting loaded miRNA by directly interacting with AGO proteins. Why AGO proteins need GW182 to further protect their bound miRNA from being degraded by exoribonuclease? One viable model is that the miRN A maturation, unwinding, and loading process require the help of some exoribonucleases such as exosome complex, as observed in fungi ( 129 ) A fter the formation of complete miRISC, cells may then need to ensure functional miRNA to be protected. On the other hand, miRNA triggered for decay by exosome complex to help recyc le AGO proteins as they have ( 80 ) A model of AGO GW182 protecting miRNA from exoribonucleases was included in Chapter 3 (Figure 3 8). Role of GW182 in miRNA Secretion via Secretory Vesicle Exosomes It has been noticed that a wide spe ctrum of miRNAs exists in a variety of body fluid including serum, plasma, saliva, urine, and milk ( 108 130 ) The escape from being degraded by ribonucleases in these body fluids suggests certain protective mechanisms

PAGE 117

117 for these miRNA. There are two current interpretations: i) miRNAs and other nucleic acids such as mRNA are packed into membrane bound secretory v esicles such as exosomes and actively secreted into extracellular space ( 83 131 ) ; ii) miRNAs actively secret in a vesicle free manner but are protected by their associated proteins such as Ago2 or high density lipoproteins (HDL) ( 132 133 ) Nonetheless, RISC components such as Ago2 and GW182 are inevitably involved in these two processes as they form complex with mature miRNAs. These secretory miRNAs have been shown to serve an ce ll communication by regulating recipient cells gene expression ( 82 130 134 135 ) Secretory vesicles include exosomes, microvesicles, ectosomes, membrane particles, exosome like vesicles, and apoptotic vesicles that are defined by their difference in phy sicochemical characteristics ( 82 ) Among these vesicles, exosomes are 50 100 nm in diameter derived from endosome. It has long been thought to help promote antigen presentation between immune cells ( 136 ) Recent studies show exosomes are shed from almost all kinds of cells, including cancer cells, and they carried genetic materials, including mRNA and miRNA, that can alter recipient cell gene expression ( 83 85 131 137 ) These studies also show that exosomes containing miRNAs are not ran domly packed but rather undergone a selective process through an unknown mechanism ( 130 ) The formation of exosomes relies on the endosomal sorting complex required for transport (ESCRT) complexes ( 138 139 ) Depletion of ESCRT impaired miRNA activity in both Drosophila and human cells, indicating the functional RISC were coupled to multivesicular bodies that can later form e xosomes ( 84 109 ) Interestingly, Voinnet and colleagues showed a strong enrichment of GW182, but not

PAGE 118

11 8 Ago2, in purified exosomes ( 84 ) whereas others demonstrated Ago2, but not GW182, was co purified with exosomes ( 86 ) We have not been successful in detecting GW182 or Ago2 in purified exosomes following an e stablished protocol ( 101 ) However, in Chapter 3, stabl e knockdown of GW182 in HEK293 cells showed reduced miRNA secretion via exosomes, suggesting GW182 may inde ed regulate miRNA selection and secretion through exosomes. A couple of reports have raised another possibility that miRNAs can be secret ed in a vesicle independent manner but protected by their bound proteins such as Ago2 or HDL proteins ( 132 133 ) In our results, we did observe a fraction of miRNA existing in exosomes depleted soluble fraction. Although detailed protein components associated with vesicle free miRNAs are still not clear, it is likely that GW182 helps Ago2 protecting vesicle free miRNA. Future work will be needed to elucidate the protein identity and the functional difference between exosom es carrying and vesicle free miRNAs. It has not been very clear how exosomes can specifically target recipient cells and how the exosomal miRNAs are released and become functional in recipient cells. A prospective is provided below to address the advantage s and limitations of current studies on exosomes. Prospective In my dissertation study, I have shown that GW182 plays a critical role in silencing miRNA targets and protecting miRNA stability. GW182 has quickly evolved as a key repressor in RISC evidenced from numerous studies. Strong silencing effect has been observed when GW182 was brought to proximity of mRNA reporter. It is reasonable to postulate that the primary and direct function of GW182 resides on its silencing activity. Since GW182 physically b inds to AGOs, my work suggests a novel role of GW182 in

PAGE 119

119 protecting AGO bound miRNA. This finding indicates a miRNA quality control function that has not described. However, miRNA levels are controlled in many steps of their biogenesis pathway; it might not be the prioritized function of GW182 in cellular content. GW182 has been shown to reside in cytoplasmic foci called GW bodies or P bodies ( 1 ) Disassembly of GWBs by depleting GWB components LSm1, LSm3, HPat, or Ge 1 did not reduce the ability of GW182 in silencing its tethered reporters ( 140 ) However, the possibility remains experiments. Our observations that the number and size of GWBs increase upon the introduction of siRNA or miRNA ( 34 ) suggests a functional relevance of GWBs in siRNA or miRNA induced gene silencing. Many mRNAs bound by miRNAs can form GWBs, possibly through some GW182 domains that play a role in aggregating miRNA bound proteins. The extraction and sequestration of mRNA from the cytoplasm may be a quick and highly efficient method in translation repression. Deadenylation/decay of mRNA is secondary to the biological need for quick repression of mRNA translation. It could also be possible that GWBs help protecting miRNA stability by limiting their accessibility to exoribunuclease. However, GW182 KD cells used in Chapter 3 did not totally abolish the formation of GWBs in H EK293 cells possibly due to the incomplete knockdown efficiency and putative compensatory effects contributed by the abundance of TNRC6B and 6C. Further experiments need to be designed to test the role of GWBs in regulating mature miRNA stability. Although numerous reports have shown that exosomal miRNA can be transferred into recipient cells to regulate their cellular activities, further experiments are still required to confirm this notion. Many studies use artificial reporters to evaluate the

PAGE 120

120 exosomal mi RNA in recipient cells without demonstrating their effect on endogenous targets. Others overexpress siRNA or miRNA in exosomes or use chemical compounds to stimulate exosomes secretion ( 130 ) Therefore, it is difficult to conclude absolutely that this process plays import ant roles in physiological conditions. GW182 or Argonaute proteins have been separately reported to be in exosomes ( 84 86 ) although our data did not confirm these observations. In our hand, knockdown of GW182 causes reduced miRNA secretion but apparently without affecting the number of exosomes. However, the regulation of quality and potency of exosomal RNA in shaping recipient cells remains questionable. The selectivity of exosomes in locating their putatively designated recipient cells is not clear. Most importantly, how GW182 regulated miRNA packing and secretion via exosomes and its impact on recipient ce ll silencing activity need to be addressed. Although there are increasing numbers of studies focusing on exosomes and it is promising, much more efforts are clearly needed to make it into an attractive potential therapeutic application. In summary, my diss ertation identifies and characterizes the GW182 silencing domains and defining a novel function of GW182 in regulating miRNA stability by binding to AGO proteins. These studies offer new insights in understanding the miRNA silencing mechanism.

PAGE 121

121 Figure. 4 1. Schematic map of GW182 two conserved domains PAM2 and P GL. Sequence alignments are shown in comparison among zebrafish, human, and Drosophila GW182 proteins. Asterisks indicate the conserved amino acids among species. Alanine substitutes are shown t o study the requirement of these two conserved domains in binding to PABP proteins and translational repression. This figure is adopted from Mishima et al. (2012). Translational inhibition by deadenylation independent mechanisms is central to microRNA medi ated silencing in zebrafish. Proc Natl Acad Sci U S A 109 1104 1109.

PAGE 122

122 LIST OF REFERENCES 1. Eystathioy, T., Chan, E.K., Tenenbaum, S.A., Keene, J.D., Griffith, K. and Fritzler, M.J. (2002) A phosphorylated cytoplasmic autoantigen, GW1 82, associates with a unique population of human mRNAs within novel cytoplasmic speckles. Mol Biol Cell 13 1338 1351. 2. Filipowicz, W., Bhattacharyya, S.N. and Sonenberg, N. (2008) Mechanisms of post transcriptional regulation by microRNAs: are the answ ers in sight? Nat Rev Genet 9 102 114. 3. Eulalio, A., Tritschler, F. and Izaurralde, E. (2009) The GW182 protein family in animal cells: new insights into domains required for miRNA mediated gene silencing. RNA 15 1433 1442. 4. Krol, J., Loedige, I. a nd Filipowicz, W. (2010) The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet 11 597 610. 5. Huntzinger, E. and Izaurralde, E. (2011) Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Na t Rev Genet 12 99 110. 6. Yang, Z., Jakymiw, A., Wood, M.R., Eystathioy, T., Rubin, R.L., Fritzler, M.J. and Chan, E.K. (2004) GW182 is critical for the stability of GW bodies expressed during the cell cycle and cell proliferation. J Cell Sci 117 5567 5578. 7. Jakymiw, A., Pauley, K.M., Li, S., Ikeda, K., Lian, S., Eystathioy, T., Satoh, M., Fritzler, M.J. and Chan, E.K. (2007) The role of GW/P bodies in RNA processing and silencing. J Cell Sci 120 1317 1323. 8. Meaux, S., van Hoof, A. and Baker, K.E. (2008) Nonsense mediated mRNA decay in yeast does not require PAB1 or a poly(A) tail. Mol Cell 29 134 140. 9. Anderson, P. and Kedersha, N. (2009) RNA granules: post transcriptional and epigenetic modulators of gene expression. Nat Rev Mol Cell Biol 10 430 436. 10. Erickson, S.L. and Lykke Andersen, J. (2011) Cytoplasmic mRNP granules at a glance. J Cell Sci 124 293 297. 11. Anderson, P. and Kedersha, N. (2006) RNA granules. J Cell Biol 172 803 808. 12. Jinek, M. and Doudna, J.A. (2009) A three dim ensional view of the molecular machinery of RNA interference. Nature 457 405 412. 13. Fabian, M.R., Sonenberg, N. and Filipowicz, W. (2010) Regulation of mRNA translation and stability by microRNAs. Annu. Rev. Biochem. 79 351 379.

PAGE 123

123 14. Rana, T.M. (2007) Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol 8 23 36. 15. Hutvagner, G. and Simard, M.J. (2008) Argonaute proteins: key players in RNA silencing. Nat Rev Mol Cell Biol 9 22 32. 16. Liu, J., Ca rmell, M.A., Rivas, F.V., Marsden, C.G., Thomson, J.M., Song, J.J., Hammond, S.M., Joshua Tor, L. and Hannon, G.J. (2004) Argonaute2 is the catalytic engine of mammalian RNAi. Science 305 1437 1441. 17. Bartel, D.P. (2009) MicroRNAs: target recognition a nd regulatory functions. Cell 136 215 233. 18. Baillat, D. and Shiekhattar, R. (2009) Functional dissection of the human TNRC6 (GW182 related) family of proteins. Mol. Cell. Biol. 29 4144 4155. 19. Lazzaretti, D., Tournier, I. and Izaurralde, E. (2009) The C terminal domains of human TNRC6A, TNRC6B, and TNRC6C silence bound transcripts independently of Argonaute proteins. RNA 15 1059 1066. 20. Lian, S.L., Li, S., Abadal, G.X., Pauley, B.A., Fritzler, M.J. and Chan, E.K.L. (2009) The C terminal half of human Ago2 binds to multiple GW rich regions of GW182 and requires GW182 to mediate silencing. RNA 15 804 813. 21. Takimoto, K., Wakiyama, M. and Yokoyama, S. (2009) Mammalian GW182 contains multiple Argonaute binding sites and functions in microRNA med iated translational repression. RNA 15 1078 1089. 22. Zipprich, J.T., Bhattacharyya, S., Mathys, H. and Filipowicz, W. (2009) Importance of the C terminal domain of the human GW182 protein TNRC6C for translational repression. RNA 15 781 793. 23. Chekul aeva, M., Filipowicz, W. and Parker, R. (2009) Multiple independent domains of dGW182 function in miRNA mediated repression in Drosophila. RNA 15 794 803. 24. Yao, B., Li, S., Jung, H.M., Lian, S.L., Abadal, G.X., Han, F., Fritzler, M.J. and Chan, E.K.L. (2011) Divergent GW182 functional domains in the regulation of translational silencing. Nucleic Acids Res 39 2534 2547. 25. Fabian, M.R., Mathonnet, G., Sundermeier, T., Mathys, H., Zipprich, J.T., Svitkin, Y.V., Rivas, F., Jinek, M., Wohlschlegel, J., Doudna, J.A. et al. (2009) Mammalian miRNA RISC recruits CAF1 and PABP to affect PABP dependent deadenylation. Mol Cell 35 868 880. 26. Jinek, M., Fabian, M.R., Coyle, S.M., Sonenberg, N. and Doudna, J.A. (2010) Structural insights into the human GW182 P ABC interaction in microRNA mediated deadenylation. Nat Struct Mol Biol 17 238 240.

PAGE 124

124 27. Braun, J.E., Huntzinger, E., Fauser, M. and Izaurralde, E. (2011) GW182 proteins directly recruit cytoplasmic deadenylase complexes to miRNA targets. Mol Cell 44 12 0 133. 28. Chekulaeva, M., Mathys, H., Zipprich, J.T., Attig, J., Colic, M., Parker, R. and Filipowicz, W. (2011) miRNA repression involves GW182 mediated recruitment of CCR4 NOT through conserved W containing motifs. Nat Struct Mol Biol 18 1218 1226. 29 Fabian, M.R., Cieplak, M.K., Frank, F., Morita, M., Green, J., Srikumar, T., Nagar, B., Yamamoto, T., Raught, B., Duchaine, T.F. et al. (2011) miRNA mediated deadenylation is orchestrated by GW182 through two conserved motifs that interact with CCR4 NOT. Nat Struct Mol Biol 18 1211 1217. 30. Eystathioy, T., Jakymiw, A., Chan, E.K., Seraphin, B., Cougot, N. and Fritzler, M.J. (2003) The GW182 protein colocalizes with mRNA degradation associated proteins hDcp1 and hLSm4 in cytoplasmic GW bodies. RNA 9 1 171 1173. 31. Jakymiw, A., Lian, S., Eystathioy, T., Li, S., Satoh, M., Hamel, J.C., Fritzler, M.J. and Chan, E.K. (2005) Disruption of GW bodies impairs mammalian RNA interference. Nat Cell Biol 7 1267 1274. 32. Lian, S., Jakymiw, A., Eystathioy, T., Ha mel, J.C., Fritzler, M.J. and Chan, E.K.L. (2006) GW bodies, microRNAs and the cell cycle. Cell Cycle 5 242 245. 33. Pauley, K.M., Eystathioy, T., Jakymiw, A., Hamel, J.C., Fritzler, M.J. and Chan, E.K. (2006) Formation of GW bodies is a consequence of m icroRNA genesis. EMBO Rep 7 904 910. 34. Lian, S., Fritzler, M.J., Katz, J., Hamazaki, T., Terada, N., Satoh, M. and Chan, E.K. (2007) Small interfering RNA mediated silencing induces target dependent assembly of GW/P bodies. Mol Biol Cell 18 3375 3387 35. Li, S., Lian, S.L., Moser, J.J., Fritzler, M.L., Fritzler, M.J., Satoh, M. and Chan, E.K. (2008) Identification of GW182 and its novel isoform TNGW1 as translational repressors in Ago2 mediated silencing. J Cell Sci 121 4134 4144. 36. Pauley, K.M., Satoh, M., Pauley, B.A., Dominguez Gutierrez, P.R., Wallet, S.M., Holliday, L.S., Cha, S., Reeves, W.H. and Chan, E.K.L. (2010) Formation of GW/P bodies as marker for microRNA mediated regulation of innate immune signaling in THP 1 cells. Immunol. Cell Bi ol. 88 205 212. 37. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. and Mello, C.C. (1998) Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature 391 806 811.

PAGE 125

125 38. Liu, J., Rivas, F.V., Wohlschle gel, J., Yates, J.R., 3rd, Parker, R. and Hannon, G.J. (2005) A role for the P body component GW182 in microRNA function. Nat Cell Biol 7 1261 1266. 39. Lee, R.C., Feinbaum, R.L. and Ambros, V. (1993) The C. elegans heterochronic gene lin 4 encodes small RNAs with antisense complementarity to lin 14. Cell 75 843 854. 40. Tritschler, F., Huntzinger, E. and Izaurralde, E. (2010) Role of GW182 proteins and PABPC1 in the miRNA pathway: a sense of deja vu. Nat Rev Mol Cell Biol 11 379 384. 41. Eulalio, A., Helms, S., Fritzsch, C., Fauser, M. and Izaurralde, E. (2009) A C terminal silencing domain in GW182 is essential for miRNA function. RNA 15 1067 1077. 42. Pasquinelli, A.E., Reinhart, B.J., Slack, F., Martindale, M.Q., Kuroda, M.I., Maller, B., Hayward D.C., Ball, E.E., Degnan, B., Muller, P. et al. (2000) Conservation of the sequence and temporal expression of let 7 heterochronic regulatory RNA. Nature 408 86 89. 43. Ding, L., Spencer, A., Morita, K. and Han, M. (2005) The developmental timing regul ator AIN 1 interacts with miRISCs and may target the argonaute protein ALG 1 to cytoplasmic P bodies in C. elegans. Mol Cell 19 437 447. 44. Schneider, M.D., Najand, N., Chaker, S., Pare, J.M., Haskins, J., Hughes, S.C., Hobman, T.C., Locke, J. and Simmo nds, A.J. (2006) Gawky is a component of cytoplasmic mRNA processing bodies required for early Drosophila development. J Cell Biol 174 349 358. 45. Eulalio, A., Rehwinkel, J., Stricker, M., Huntzinger, E., Yang, S.F., Doerks, T., Dorner, S., Bork, P., Bo utros, M. and Izaurralde, E. (2007) Target specific requirements for enhancers of decapping in miRNA mediated gene silencing. Genes Dev 21 2558 2570. 46. Miyoshi, K., Okada, T.N., Siomi, H. and Siomi, M.C. (2009) Characterization of the miRNA RISC loadin g complex and miRNA RISC formed in the Drosophila miRNA pathway. RNA 15 1282 1291. 47. Pillai, R.S., Artus, C.G. and Filipowicz, W. (2004) Tethering of human Ago proteins to mRNA mimics the miRNA mediated repression of protein synthesis. RNA 10 1518 15 25. 48. Chekulaeva, M. and Filipowicz, W. (2009) Mechanisms of miRNA mediated post transcriptional regulation in animal cells. Curr Opin Cell Biol 21 452 460. 49. Eulalio, A., Huntzinger, E. and Izaurralde, E. (2008) Getting to the root of miRNA mediated gene silencing. Cell 132 9 14.

PAGE 126

126 50. Meister, G., Landthaler, M., Patkaniowska, A., Dorsett, Y., Teng, G. and Tuschl, T. (2004) Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol Cell 15 185 197. 51. Jaronczyk, K., Carmichael, J.B and Hobman, T.C. (2005) Exploring the functions of RNA interference pathway proteins: some functions are more RISCy than others? Biochem J 387 561 571. 52. Ding, L. and Han, M. (2007) GW182 family proteins are crucial for microRNA mediated gene silenci ng. Trends Cell Biol 17 411 416. 53. Chekulaeva, M., Parker, R. and Filipowicz, W. (2010) The GW/WG repeats of Drosophila GW182 function as effector motifs for miRNA mediated repression. Nucleic Acids Res 54. Eulalio, A., Huntzinger, E. and Izaurralde, E. (2008) GW182 interaction with Argonaute is essential for miRNA mediated translational repression and mRNA decay. Nat Struct Mol Biol 15 346 353. 55. Eulalio, A., Tritschler, F., Buttner, R., Weichenrieder, O., Izaurralde, E. and Truffault, V. (2009) T he RRM domain in GW182 proteins contributes to miRNA mediated gene silencing. Nucleic Acids Res 37 2974 2983. 56. Lian, S.L., Li, S., Abadal, G.X., Pauley, B.A., Fritzler, M.J. and Chan, E.K. (2009) The C terminal half of human Ago2 binds to multiple GW rich regions of GW182 and requires GW182 to mediate silencing. RNA 15 804 813. 57. Zekri, L., Huntzinger, E., Heimstadt, S. and Izaurralde, E. (2009) The silencing domain of GW182 interacts with PABPC1 to promote translational repression and degradation of microRNA targets and is required for target release. Mol. Cell. Biol. 29 6220 6231. 58. Chen, C.Y., Zheng, D., Xia, Z. and Shyu, A.B. (2009) Ago TNRC6 triggers microRNA mediated decay by promoting two deadenylation steps. Nat Struct Mol Biol 16 1160 1166. 59. Behm Ansmant, I., Rehwinkel, J., Doerks, T., Stark, A., Bork, P. and Izaurralde, E. (2006) mRNA degradation by miRNAs and GW182 requires both CCR4:NOT deadenylase and DCP1:DCP2 decapping complexes. Genes Dev 20 1885 1898. 60. Till, S., Lejeune E., Thermann, R., Bortfeld, M., Hothorn, M., Enderle, D., Heinrich, C., Hentze, M.W. and Ladurner, A.G. (2007) A conserved motif in Argonaute interacting proteins mediates functional interactions through the Argonaute PIWI domain. Nat Struct Mol Biol 14 897 903. 61. Ding, X.C. and Grosshans, H. (2009) Repression of C. elegans microRNA targets at the initiation level of translation requires GW182 proteins. EMBO J 28 213 222.

PAGE 127

127 62. Grimson, A., Farh, K.K., Johnston, W.K., Garrett Engele, P., Lim, L.P. and Bartel, D.P. (2007) MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27 91 105. 63. Lewis, B.P., Burge, C.B. and Bartel, D.P. (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of hu man genes are microRNA targets. Cell 120 15 20. 64. Peters, L. and Meister, G. (2007) Argonaute proteins: mediators of RNA silencing. Mol Cell 26 611 623. 65. Wu, L., Fan, J. and Belasco, J.G. (2008) Importance of translation and nonnucleolytic ago pro teins for on target RNA interference. Curr Biol 18 1327 1332. 66. Ebert, M.S., Neilson, J.R. and Sharp, P.A. (2007) MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Methods 4 721 726. 67. Decker, C.J., Teixeira, D. and Par ker, R. (2007) Edc3p and a glutamine/asparagine rich domain of Lsm4p function in processing body assembly in Saccharomyces cerevisiae. J Cell Biol 179 437 449. 68. Chu, C.Y. and Rana, T.M. (2006) Translation repression in human cells by microRNA induced gene silencing requires RCK/p54. PLoS Biol 4 e210. 69. Minshall, N., Kress, M., Weil, D. and Standart, N. (2009) Role of p54 RNA helicase activity and its C terminal domain in translational repression, P body localization and assembly. Mol Biol Cell 20 2464 2472. 70. Tritschler, F., Braun, J.E., Eulalio, A., Truffault, V., Izaurralde, E. and Weichenrieder, O. (2009) Structural basis for the mutually exclusive anchoring of P body components EDC3 and Tral to the DEAD box protein DDX6/Me31B. Mol Cell 33 661 668. 71. Kahvejian, A., Svitkin, Y.V., Sukarieh, R., M'Boutchou, M.N. and Sonenberg, N. (2005) Mammalian poly(A) binding protein is a eukaryotic translation initiation factor, which acts via multiple mechanisms. Genes Dev 19 104 113. 72. Pauley, K.M. Satoh, M., Pauley, B.A., Dominguez Gutierrez, P.R., Wallet, S.M., Holliday, L.S., Cha, S., Reeves, W.H. and Chan, E.K. (2010) Formation of GW/P bodies as marker for microRNA mediated regulation of innate immune signaling in THP 1 cells. Immunol Cell Biol 88 205 212. 73. Croce, C.M. (2009) Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 10 704 714. 74. Kai, Z.S. and Pasquinelli, A.E. (2010) MicroRNA assassins: factors that regulate the disappearance of miRNAs. Nat Struct Mol Biol 17 5 10.

PAGE 128

128 75. Hwang, H.W., Wentzel, E.A. and Mendell, J.T. (2007) A hexanucleotide element directs microRNA nuclear import. Science 315 97 100. 76. Rissland, O.S., Hong, S.J. and Bartel, D.P. (2011) MicroRNA Destabilization Enables Dynamic Regulati on of the miR 16 Family in Response to Cell Cycle Changes. Mol. Cell 43 993 1004. 77. Kim, Y.K., Yeo, J., Ha, M., Kim, B. and Kim, V.N. (2011) Cell Adhesion Dependent Control of MicroRNA Decay. Mol. Cell 43 1005 1014. 78. Krol, J., Busskamp, V., Markie wicz, I., Stadler, M.B., Ribi, S., Richter, J., Duebel, J., Bicker, S., Fehling, H.J., Schubeler, D. et al. (2010) Characterizing light regulated retinal microRNAs reveals rapid turnover as a common property of neuronal microRNAs. Cell 141 618 631. 79. B ail, S., Swerdel, M., Liu, H., Jiao, X., Goff, L.A., Hart, R.P. and Kiledjian, M. (2010) Differential regulation of microRNA stability. RNA 16 1032 1039. 80. Diederichs, S. and Haber, D.A. (2007) Dual role for argonautes in microRNA processing and posttr anscriptional regulation of microRNA expression. Cell 131 1097 1108. 81. Winter, J. and Diederichs, S. (2011) Argonaute proteins regulate microRNA stability: Increased microRNA abundance by Argonaute proteins is due to microRNA stabilization. RNA Biol 8 82. Thery, C., Ostrowski, M. and Segura, E. (2009) Membrane vesicles as conveyors of immune responses. Nat Rev Immunol 9 581 593. 83. Valadi, H., Ekstrom, K., Bossios, A., Sjostrand, M., Lee, J.J. and Lotvall, J.O. (2007) Exosome mediated transfer of m RNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 9 654 659. 84. Gibbings, D.J., Ciaudo, C., Erhardt, M. and Voinnet, O. (2009) Multivesicular bodies associate with components of miRNA effector complexes and modulat e miRNA activity. Nat Cell Biol 11 1143 1149. 85. Kosaka, N., Iguchi, H., Yoshioka, Y., Takeshita, F., Matsuki, Y. and Ochiya, T. (2010) Secretory mechanisms and intercellular transfer of microRNAs in living cells. J. Biol. Chem. 285 17442 17452. 86. Z hang, Y., Liu, D., Chen, X., Li, J., Li, L., Bian, Z., Sun, F., Lu, J., Yin, Y., Cai, X. et al. (2010) Secreted monocytic miR 150 enhances targeted endothelial cell migration. Mol. Cell 39 133 144. 87. Ramachandran, V. and Chen, X. (2008) Degradation of microRNAs by a family of exoribonucleases in Arabidopsis. Science 321 1490 1492.

PAGE 129

129 88. Chatterjee, S. and Grosshans, H. (2009) Active turnover modulates mature microRNA activity in Caenorhabditis elegans. Nature 461 546 549. 89. Grosshans, H. and Chatter jee, S. (2010) MicroRNases and the Regulated Degradation of Mature Animal miRNAs. Adv Exp Med Biol 700 140 155. 90. Sen, G.L. and Blau, H.M. (2005) Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat Cell Biol 7 6 33 636. 91. Karlowski, W.M., Zielezinski, A., Carrere, J., Pontier, D., Lagrange, T. and Cooke, R. (2010) Genome wide computational identification of WG/GW Argonaute binding proteins in Arabidopsis. Nucleic Acids Res 38 4231 4245. 92. El Shami, M., Ponti er, D., Lahmy, S., Braun, L., Picart, C., Vega, D., Hakimi, M.A., Jacobsen, S.E., Cooke, R. and Lagrange, T. (2007) Reiterated WG/GW motifs form functionally and evolutionarily conserved ARGONAUTE binding platforms in RNAi related components. Genes Dev 21 2539 2544. 93. Fukaya, T. and Tomari, Y. (2011) PABP is not essential for microRNA mediated translational repression and deadenylation in vitro. EMBO J 30 4998 5009. 94. Tang, Y., Luo, X., Cui, H., Ni, X., Yuan, M., Guo, Y., Huang, X., Zhou, H., de Vri es, N., Tak, P.P. et al. (2009) MicroRNA 146A contributes to abnormal activation of the type I interferon pathway in human lupus by targeting the key signaling proteins. Arthritis Rheum 60 1065 1075. 95. Boss, I.W., Nadeau, P.E., Abbott, J.R., Yang, Y., Mergia, A. and Renne, R. (2011) A Kaposi's sarcoma associated herpesvirus encoded ortholog of microRNA miR 155 induces human splenic B cell expansion in NOD/LtSz scid IL2Rgammanull mice. J. Virol. 85 9877 9886. 96. Damgaard, C.K., Kahns, S., Lykke Anders en, S., Nielsen, A.L., Jensen, T.H. and Kjems, J. (2008) A 5' splice site enhances the recruitment of basal transcription initiation factors in vivo. Mol Cell 29 271 278. 97. Eberle, A.B., Lykke Andersen, S., Muhlemann, O. and Jensen, T.H. (2009) SMG6 pr omotes endonucleolytic cleavage of nonsense mRNA in human cells. Nat Struct Mol Biol 16 49 55. 98. An, D.S., Qin, F.X., Auyeung, V.C., Mao, S.H., Kung, S.K., Baltimore, D. and Chen, I.S. (2006) Optimization and functional effects of stable short hairpin RNA expression in primary human lymphocytes via lentiviral vectors. Mol Ther 14 494 504. 99. Chang, L.J. (2010) Lentiviral vector transduction of dendritic cells for novel vaccine strategies. Methods Mol Biol 614 161 171.

PAGE 130

130 100. Ikeda, K., Satoh, M., Pau ley, K.M., Fritzler, M.J., Reeves, W.H. and Chan, E.K. (2006) Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody. J Immunol Methods 317 38 44. 101. Thery, C., Amigorena, S., Rapos o, G. and Clayton, A. (2006) Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr Protoc Cell Biol Chapter 3 Unit 3 22. 102. Jagannath, A. and Wood, M.J. (2009) Localization of double stranded small interf ering RNA to cytoplasmic processing bodies is Ago2 dependent and results in up regulation of GW182 and Argonaute 2. Mol. Biol. Cell 20 521 529. 103. Logozzi, M., De Milito, A., Lugini, L., Borghi, M., Calabro, L., Spada, M., Perdicchio, M., Marino, M.L., Federici, C., Iessi, E. et al. (2009) High levels of exosomes expressing CD63 and caveolin 1 in plasma of melanoma patients. PLoS One 4 e5219. 104. Kiriakidou, M., Tan, G.S., Lamprinaki, S., De Planell Saguer, M., Nelson, P.T. and Mourelatos, Z. (2007) An mRNA m7G cap binding like motif within human Ago2 represses translation. Cell 129 1141 1151. 105. Wang, Y., Juranek, S., Li, H., Sheng, G., Wardle, G.S., Tuschl, T. and Patel, D.J. (2009) Nucleation, propagation and cleavage of target RNAs in Ago sile ncing complexes. Nature 461 754 761. 106. Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M., Jr., Jungkamp, A.C., Munschauer, M. et al. (2010) Transcriptome wide identification of RNA binding pro tein and microRNA target sites by PAR CLIP. Cell 141 129 141. 107. Yao, B., Li, S., Jung, H.M., Lian, S.L., Abadal, G.X., Han, F., Fritzler, M.J. and Chan, E.K. (2011) Divergent GW182 functional domains in the regulation of translational silencing. Nucle ic Acids Res 39 2534 2547. 108. Kosaka, N., Iguchi, H. and Ochiya, T. (2010) Circulating microRNA in body fluid: a new potential biomarker for cancer diagnosis and prognosis. Cancer Sci 101 2087 2092. 109. Lee, Y.S., Pressman, S., Andress, A.P., Kim, K ., White, J.L., Cassidy, J.J., Li, X., Lubell, K., Lim do, H., Cho, I.S. et al. (2009) Silencing by small RNAs is linked to endosomal trafficking. Nat Cell Biol 11 1150 1156. 110. van Rooij, E., Sutherland, L.B., Qi, X., Richardson, J.A., Hill, J. and Ol son, E.N. (2007) Control of stress dependent cardiac growth and gene expression by a microRNA. Science 316 575 579.

PAGE 131

131 111. Wang, Y., Sheng, G., Juranek, S., Tuschl, T. and Patel, D.J. (2008) Structure of the guide strand containing argonaute silencing comp lex. Nature 456 209 213. 112. Schirle, N.T. and Macrae, I.J. (2012) The Crystal Structure of Human Argonaute2. Science 113. Gregory, R.I., Chendrimada, T.P., Cooch, N. and Shiekhattar, R. (2005) Human RISC couples microRNA biogenesis and posttranscripti onal gene silencing. Cell 123 631 640. 114. MacRae, I.J., Ma, E., Zhou, M., Robinson, C.V. and Doudna, J.A. (2008) In vitro reconstitution of the human RISC loading complex. Proc Natl Acad Sci U S A 105 512 517. 115. Maniataki, E. and Mourelatos, Z. (2 005) A human, ATP independent, RISC assembly machine fueled by pre miRNA. Genes Dev 19 2979 2990. 116. Kawamata, T., Yoda, M. and Tomari, Y. (2011) Multilayer checkpoints for microRNA authenticity during RISC assembly. EMBO Rep 12 944 949. 117. Chelouf i, S., Dos Santos, C.O., Chong, M.M. and Hannon, G.J. (2010) A dicer independent miRNA biogenesis pathway that requires Ago catalysis. Nature 465 584 589. 118. Cifuentes, D., Xue, H., Taylor, D.W., Patnode, H., Mishima, Y., Cheloufi, S., Ma, E., Mane, S. Hannon, G.J., Lawson, N.D. et al. (2010) A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity. Science 328 1694 1698. 119. Jiang, Z., Yu, N., Kuang, P., Chen, M., Shao, F., Martin, G., Chui, D.H., Cardoso, W.V., Ai, X. and Lu, J. (2012) Trinucleotide repeat containing 6a (Tnrc6a) mediated microRNA function is required for development of yolk sac endoderm. J Biol Chem 287 5979 5987. 120. Pillai, R.S., Bhattacharyya, S.N., Artus, C.G., Zoller, T., Cougot, N., Basy uk, E., Bertrand, E. and Filipowicz, W. (2005) Inhibition of translational initiation by Let 7 MicroRNA in human cells. Science 309 1573 1576. 121. Guo, H., Ingolia, N.T., Weissman, J.S. and Bartel, D.P. (2010) Mammalian microRNAs predominantly act to de crease target mRNA levels. Nature 466 835 840. 122. Bazzini, A.A., Lee, M.T. and Giraldez, A.J. (2012) Ribosome profiling shows that miR 430 reduces translation before causing mRNA decay in zebrafish. Science 336 233 237.

PAGE 132

132 123. Mishima, Y., Fukao, A., K ishimoto, T., Sakamoto, H., Fujiwara, T. and Inoue, K. (2012) Translational inhibition by deadenylation independent mechanisms is central to microRNA mediated silencing in zebrafish. Proc Natl Acad Sci U S A 109 1104 1109. 124. Djuranovic, S., Nahvi, A. and Green, R. (2012) miRNA mediated gene silencing by translational repression followed by mRNA deadenylation and decay. Science 336 237 240. 125. Taganov, K.D., Boldin, M.P., Chang, K.J. and Baltimore, D. (2006) NF kappaB dependent induction of microRNA miR 146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci U S A 103 12481 12486. 126. Nahid, M.A., Pauley, K.M., Satoh, M. and Chan, E.K.L. (2009) miR 146a is critical for endotoxin induced tolerance: Implicatio n in innate immunity. J. Biol. Chem. 284 34590 34599. 127. Ji, L. and Chen, X. (2012) Regulation of small RNA stability: methylation and beyond. Cell Res 128. Maiti, M., Lee, H.C. and Liu, Y. (2007) QIP, a putative exonuclease, interacts with the Neuros pora Argonaute protein and facilitates conversion of duplex siRNA into single strands. Genes Dev 21 590 600. 129. Xue, Z., Yuan, H., Guo, J. and Liu, Y. (2012) Reconstitution of an Argonaute Dependent Small RNA Biogenesis Pathway Reveals a Handover Mecha nism Involving the RNA Exosome and the Exonuclease QIP. Mol Cell 130. Chen, X., Liang, H., Zhang, J., Zen, K. and Zhang, C.Y. (2012) Secreted microRNAs: a new form of intercellular communication. Trends Cell Biol 22 125 132. 131. Skog, J., Wurdinger, T. van Rijn, S., Meijer, D.H., Gainche, L., Sena Esteves, M., Curry, W.T., Jr., Carter, B.S., Krichevsky, A.M. and Breakefield, X.O. (2008) Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. N at Cell Biol 10 1470 1476. 132. Arroyo, J.D., Chevillet, J.R., Kroh, E.M., Ruf, I.K., Pritchard, C.C., Gibson, D.F., Mitchell, P.S., Bennett, C.F., Pogosova Agadjanyan, E.L., Stirewalt, D.L. et al. (2011) Argonaute2 complexes carry a population of circul ating microRNAs independent of vesicles in human plasma. Proc. Natl. Acad. Sci. U. S. A. 108 5003 5008. 133. Vickers, K.C., Palmisano, B.T., Shoucri, B.M., Shamburek, R.D. and Remaley, A.T. (2011) MicroRNAs are transported in plasma and delivered to reci pient cells by high density lipoproteins. Nat Cell Biol 13 423 433.

PAGE 133

133 134. Hu, G., Drescher, K.M. and Chen, X.M. (2012) Exosomal miRNAs: Biological Properties and Therapeutic Potential. Front Genet 3 56. 135. Mittelbrunn, M. and Sanchez Madrid, F. (2012) Intercellular communication: diverse structures for exchange of genetic information. Nat Rev Mol Cell Biol 13 328 335. 136. Thery, C., Zitvogel, L. and Amigorena, S. (2002) Exosomes: composition, biogenesis and function. Nat Rev Immunol 2 569 579. 137 Mittelbrunn, M., Gutierrez Vazquez, C., Villarroya Beltri, C., Gonzalez, S., Sanchez Cabo, F., Gonzalez, M.A., Bernad, A. and Sanchez Madrid, F. (2011) Unidirectional transfer of microRNA loaded exosomes from T cells to antigen presenting cells. Nat Comm un 2 282. 138. Hurley, J.H. (2008) ESCRT complexes and the biogenesis of multivesicular bodies. Curr Opin Cell Biol 20 4 11. 139. Hurley, J.H. and Hanson, P.I. (2010) Membrane budding and scission by the ESCRT machinery: it's all in the neck. Nat Rev M ol Cell Biol 11 556 566. 140. Eulalio, A., Behm Ansmant, I., Schweizer, D. and Izaurralde, E. (2007) P body formation is a consequence, not the cause, of RNA mediated gene silencing. Mol Cell Biol 27 3970 3981.

PAGE 134

134 BIOGRAPHICAL SKETCH Bing Yao was born He graduated from Qingdao No. 19 middle school in 1998, and then attended Ocean University of Chi na in Qingdao, China, with the marine b iotechnology major. He earned his Bachelor in Science in 200 2. At this time, Bing developed his interests in molecular molecular genetics and breeding of scallops, aiming to establish a new scallop breeder that is resistant to certain viral infection. He received his Master in Science in 2005. In the fall of 2005, Bing received an opportunity to work in Dr. Lei Zhou laboratory at the University of Florida focusing on epigenetic regulation of irradiation induced cell death in Drosophila Bing became a graduate student in the Interdisciplinary Program in Biomedical Sciences (IDP) at the University of Florida in 2006, and married his beloved wife, Can Zhang, in the same year. Bing decided to join Dr. Keith Robertson laboratory in 2007 st udying functional characterization of the interplay between the DNA methylation machinery and Polycomb proteins in mammalian cells. He successfully passed his qualifying examination in late 2008. Due to the relocation of Dr. Robertson to another institutio n, Bing decided to face a new challenge in joining Dr. Edward Chan laboratory in the beginning of 2009, working on role of GW182 in inducing miRNA mediated gene repression and regulating miRNA stability. After graduation, Bing plans on accepting a postdoct oral position in Dr. Peng Jin laboratory in Department of Human Genetics at the Emory University, where he can combine epigenetic regulation and miRNA together to investigate their interplay in human diseases.