Resilience of the coral holobiont

MISSING IMAGE

Material Information

Title:
Resilience of the coral holobiont dynamic interactions between coral commensal bacteria and opportunistic pathogens
Physical Description:
1 online resource (164 p.)
Language:
english
Creator:
Krediet, Cory J
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Interdisciplinary Ecology
Committee Chair:
Teplitski, Max
Committee Members:
Ogram, Andrew V
Silliman, Brian
Julian, David
Ritchie, Kimberly

Subjects

Subjects / Keywords:
bacteria -- commensal -- coral -- holobiont -- marcescens -- pathogen -- serratia
Interdisciplinary Ecology -- Dissertations, Academic -- UF
Genre:
Interdisciplinary Ecology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The coral holobiont is a complex symbiotic association between the polyp animal, photosynthetic dinoflagellates, and their associated microbes. During colonization of coral mucus, opportunistic pathogens, including the white pox pathogen Serratia marcescens PDL100, compete with native bacteria for available nutrients in coral mucus and rely on catabolic enzymes, such as beta-galactosidase and chitinase. This study tested the hypothesis that specific glycosidases and chitinase were critical for the growth of S. marcescens on mucus, and that their inhibition by native coral microbiota reduces fitness of the pathogen. Consistent with this hypothesis, a S. marcescens transposon mutant defective in glycosidase and chitinase activities was unable to compete with the wild type on the mucus of the host coral Acropora palmata. A survey revealed that approximately 8 percent of culturable coral commensal bacteria have the ability to inhibit glycosidases in the pathogen. In an attempt to understand how coral pathogens infect their hosts, the hypothesis that in the necrotizing coral pathogen S. marcescens PDL100, gacA is involved in the interactions of the pathogen with the polyp hosts was examined. A disruption of the S. marcescens gacA resulted in an increased competitive fitness of the mutant on crude mucus of the host coral Acropora palmata and on the high molecular weight fraction of the mucus, whereas the mutant was as competitive as the wild type on the low molecular weight fraction of the mucus. This indicates a critical role for the gacA-mediated phenotypes in the efficient utilization of coral mucus and establishment within the surface mucopolysaccharide layer. The susceptibility of the sea anemone Aiptasia pallida to common coral pathogens (Serratia marcescens, Vibrio coralliilyticus, and V. shiloi) was also tested. A. pallida responded to the pathogens with symptoms that closely resemble the progression of the coral diseases caused by necrotizing pathogens. Infection studies with this model polyp will elucidate some virulence mechanisms used by coral pathogens to infect and degrade polyps. These results demonstrate, that indeed, coral pathogens rely on specific regulated behaviors to infect their coral hosts and that coral commensal bacteria show the potential to disrupt these early infection strategies.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Cory J Krediet.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Teplitski, Max.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044349:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 RESILIENCE OF THE CORAL HOLOBIONT: DYNAMIC INTERACTIONS BETWEEN CORAL COMMENSAL BACTERIA AND OPPORTUNISTIC PATHOGENS By CORY JON KREDIET A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Cory Jon Krediet

PAGE 3

3 To my parents, David and Sandy Krediet, and my sister, Katie, for all of their unconditional love and support

PAGE 4

4 ACKNOWLEDGMENTS I owe heartfelt thanks to so many people who contributed to my dissertation project and graduate student experience I first wish to thank my major ad viser, Dr. Max Teplitski for his constant mentoring support and for pushing me to s ucceed at every opportunity given to me. I am grateful for his dedication and tireless hours reading drafts and thinking about how my project could be made stronger. Without his guidance and persistence, I would not be the scientist and teacher I am today. I am thankful for the excellent example he has provided as a successful young professor in science. I would also like to thank my co adviser, Dr. Kim Ritchie, who recognized potential high quality field work throughout my graduate career. I will be forever indebted to her giving me countless opportunities to meet and work with fellow coral reef scientists and to teach and mentor undergraduate interns. To the other members of my superv isory committee, Dr. Andrew Ogram, Dr. David Julian, and Dr. Brian Sill i man: thank you for always taking the time to come to my committee meetings, meet with me individually, and provide useful insight and feedback relating to my project. I also thank the support staff of the Soil and Water Science Department and School of Natural Resources (SNRE) for their continued programmatic assistance Data collection and experimentation for this project were primarily conducted in the Teplitski Lab at UF. Within ou r lab, I wish to thank Dr. Mengsheng Gao for teaching me about the subtleties of molecular biology and providing technical assistance for the last six years. I thank the graduate and undergraduate students in our lab and our technician, Elizabeth Creary, for providing a dynamic work environment that was constantly interesting.

PAGE 5

5 Outside of our lab, I must express my appreciation and thanks for my fellow graduate student friends and colleagues that went through the process with me. Specifically, I thank Ri cardo Valladares, Clint McDaniel, Erin Collins, Algevis Wrenc h, Ken Lau, and Tyler Culpepper. Each of you has impacted my life by being the brightest, most socially outgoing, and supportive fri ends and colleagues I have ever had the privilege of knowing. Lastly, I thank my parents, David and Sandy, and my sister, Katie, for their love and support that allow ed me to follow my dreams wherever they take me. I could not ask for anything more

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLE DGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBR EVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 LITERATURE REVIEW AND INTRODUCTION ................................ ..................... 17 The Coral Holobiont ................................ ................................ ................................ 19 Host Genetic and Epigenetic Factors that Control the Structure of Coral Associated Microbiota ................................ ................................ ................... 20 The Coral Holobiont and Disease ................................ ................................ ..... 23 Horizontal Arms Race: Gene Transfer on the Coral Surface ............................ 24 Chemical and Physical Properties of Coral Mucus ................................ ........... 26 Coral Mucus Utilization by Commensal Bacteria and Opportunistic Pathogens ................................ ................................ ................................ ..... 26 Cell to Cell Signaling and Interference within the Coral Surface Mucopolysaccharide Layer ................................ ................................ ............ 28 Coral Associated Microbiota: A Key to Nutrient Cycling and Sustainability of Reef Ecosystems ................................ ................................ .......................... 29 Curative Functions of the Native Coral Microbiota ................................ .................. 32 Phage Therapy ................................ ................................ ................................ 32 Production of Biocides and Uncertainties Associated with Their in situ Functions ................................ ................................ ................................ ....... 33 Competitive Exclusion of Pat hogens by Coral Commensal Bacteria ................ 34 The White Pox Pathogen Serratia marcescens as a Model Pathogen ................... 35 Comparison to Other Well Studied Host Microbe Interactions ................................ 37 Hypotheses and Goals ................................ ................................ ............................ 39 2 MATERIALS AND METHODS ................................ ................................ ................ 42 Bacterial Strains, Plasmids, and Culture Conditions. ................................ .............. 42 Manipulations of DNA ................................ ................................ ............................. 42 Genomic DNA Isolation ................................ ................................ .................... 42 Polymerase Chain Reaction (PCR) ................................ ................................ .. 44 Generic Cloning ................................ ................................ ................................ 44 DNA Transformation Methods ................................ ................................ ................ 45 Chemically Competent Transformation ................................ ............................ 45

PAGE 7

7 Electrocompetent Transformation ................................ ................................ .... 46 Tri Parental Conjugation ................................ ................................ ................... 46 Phage Mediated Transduction ................................ ................................ ......... 47 RNA Isolation and Quantitative PCR ................................ ................................ ...... 48 RNA Isolation ................................ ................................ ................................ ... 48 DNAseI Treatment and cDNA Synthesis ................................ .......................... 49 Quantitative Real Time PCR ................................ ................................ ............ 50 3 Aiptasia pallida : A SURROGATE MODEL POLYP SUSCEPTIBLE TO INFECTIONS WITH CORAL OPPORTUNISTIC PATHOGENS ............................. 52 Introduction ................................ ................................ ................................ ............. 52 Materials and Methods ................................ ................................ ............................ 55 Aiptas ia pallida Husbandry ................................ ................................ ............... 55 Bacterial Strains and Culture Conditions ................................ .......................... 56 Aiptasia pallida Infections with Coral Opportunistic Pathogens ........................ 56 Results ................................ ................................ ................................ .................... 57 Aiptasia pallida Inf ections with S. marcescens PDL100 ................................ ... 57 Aiptasia pallida Infections with Vibrio spp. ................................ ........................ 58 Discussion ................................ ................................ ................................ .............. 59 4 MEMBERS OF NATIVE CORAL MICROBIOTA THWART COLONIZATION OF CORAL MUCUS BY AN OPPORTUNISTIC PATHOGEN ................................ ...... 64 Introduction ................................ ................................ ................................ ............. 64 Materials and Methods ................................ ................................ ............................ 66 Bacterial Strains, Media, and Growth Conditions ................................ ............. 66 Mariner Transposon Mutagenesis of Serratia marcescens PDL100 ................ 67 galactosidase Activity Assays ................................ ................................ ....... 68 Competitive Fitness Assays ................................ ................................ ............. 68 Preliminary Characterization of Inhibitory Compounds in Exiguobacterium sp. 33G8 ................................ ................................ ................................ ........ 69 Swarming Inhibition in S. marcescens PDL100 by Coral Commensal Bacteria ................................ ................................ ................................ ......... 71 Virulence in a Sea Anemone Model ................................ ................................ 71 Results ................................ ................................ ................................ .................... 72 Glycosidase and Chitinase Inhibition in S. marcescens ................................ ... 72 Competitive Fitness of S. marcescens PDL100 and CK2A4 ............................ 72 Virulence of S. marcescens PDL100 and CK2A4 in a Polyp Model ................. 73 Coral Commensal Bacteria Capable of Inhibiting Enzymatic Activities Limit Growth of S. marcescens in Co Culture ................................ ........................ 74 Preliminary Characterization of Inhibitory Compounds in Exiguobacterium sp. 33G8 ................................ ................................ ................................ ........ 74 Swarming Motility Inhibition in S. marcescens PDL100 by Coral Bacteria ....... 76 Discussion ................................ ................................ ................................ .............. 77

PAGE 8

8 5 CHARACTERIZATION OF THE gacA DEPENDENT BEHAVIORS IN AN OPPORTUNISTIC CORAL PATHOGEN Serratia marcescens PDL100 ................ 90 Introduction ................................ ................................ ................................ ............. 90 Materials and Methods ................................ ................................ ............................ 94 Bacterial Strains and Culture Conditions ................................ .......................... 94 Strain and Plasmid Construction ................................ ................................ ...... 95 Competitive Fitness on Coral Mucus ................................ ................................ 96 Swarming Motility ................................ ................................ ............................. 97 Biofilm Formation ................................ ................................ ............................. 97 Virulence in a Model Polyp Aiptasia pallida ................................ ...................... 98 Luciferase Assays ................................ ................................ ............................ 98 Quantitative RT PCR (qRT PCR) ................................ ................................ ..... 99 Results ................................ ................................ ................................ .................... 99 Regulation of csrB in a gacA Dependent Manner ................................ ............ 99 Contribution of gacA to Fitness of the Pathogen on Coral Mucus .................. 101 Surface Swarming Motility and Biofilm Format ion ................................ .......... 101 Virulence in a Model Polyp Aiptasia pallida ................................ .................... 102 Discussion ................................ ................................ ................................ ............ 103 6 PRELIMINARY CH ARACTERIZATION OF CHITINASE GENES FROM Serratia marcescens PDL100 ................................ ................................ ............................. 119 Introduction ................................ ................................ ................................ ........... 119 Materials and Methods ................................ ................................ .......................... 121 Preliminary Results ................................ ................................ ............................... 122 Discussi on and Future Directions ................................ ................................ ......... 123 7 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 130 APPENDIX: SUPPLEMENTAL MATERAL TO CHAPTER 4 ................................ ... 138 Characterization and Complementation of S. marcescens CK2A4 ....................... 138 Transductions of Individual malE malF and malG Mutants ................................ 139 Preliminary Characterization of Inhi bitory Compounds from Exiguobacterium sp. 33G8 ................................ ................................ ................................ .................. 139 LIST OF REFERENCES ................................ ................................ ............................. 143 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 163

PAGE 9

9 LIST OF TABLES Table page 2 1 E. coli generalized transduction mix ................................ ................................ ... 51 4 1 Bacterial strains and plasmids ................................ ................................ ............ 80 5 1 Bacterial strains and plamids ................................ ................................ ............ 108 5 2 Primers used for PCR ................................ ................................ ....................... 109 6 1 Primers used for PCR ................................ ................................ ....................... 127

PAGE 10

10 LIST OF FIGURES Figure page 3 1 Infections of Aiptasia pallida polyps with individual pathogens. .......................... 62 3 2 Survivorship of A. pallida polyps infected with individual pathogens. ................ 63 4 1 Catabolic enzymatic activities in mutants of S. marcescens and E. coli ......... 82 4 2 Competitive fitness of S. marcescens PDL100 and CK2A4.. ............................. 84 4 3 Survivorship of A. pallida polyps infected with S. marcescens .. ......................... 85 4 4 Competitive fitness of S. marcescens with coral commensals.. .......................... 86 4 5 Inhibition of enzymatic activities in S. marcescens PDL100 by Exiguobacterium sp. 33G8.. ................................ ................................ ............... 87 4 6 Inhibition of swarming of S. marcescens PDL100 by coral commensals. .......... 89 5 1 Clustal W Alignment of deduced GacA protein from S. marcescens PDL100 and other characterized GacA orthologs.. ................................ ........................ 110 5 2 Regulation of csrB in a gacA dependent manner in S. marcescens .. ............... 111 5 3 Serratia marcescens PDL100 csrB .. ................................ ................................ 113 5 4 Competitive fitness of S. marcescens PDL100 and CJKGacA3.. ..................... 115 5 5 GacA regulation of swarming motility in S. marcescens PDL100 and CJKGacA3.. ................................ ................................ ................................ ...... 116 5 6 Biofilm formation in S. marcescens PDL100 and CJKGacA3. .......................... 117 5 7 Survivorship of Aiptasia pallida polyps infected with S. marcescens .. .............. 118 6 1 Chitinase activities of Serratia marcescens PDL100 a nd Vibrio coralliilyticus ................................ ................................ ................................ ........................ 128 6 2 PCR amplification and molecular cloning of chiB from S. marcescens PDL100.. ................................ ................................ ................................ .......... 1 29 A 1 Inhibition of the S. marcescens galactosidase activity by coral commensal bacteria.. ................................ ................................ ................................ ........... 141 A 2 Preliminary characterization of inhibitory compounds produced by Exiguobacterium sp. 33G8 in co culture with S. marcescens PDL100.. ........... 142

PAGE 11

11 LIST OF ABBREVIATION S A 405 absorbance at 405 nm A 595 absorbance at 595 nm A p ampicillin Ap100 ampicillin 100 g ml 1 A p r ampicillin resistance ASW artificial seawater ME mercaptoethanol BLAST Basic Local Alignment Search Tool bp base pair BSA bovine serum albumin CaCl 2 calcium chloride Cb carbenicillin Cb400 carbenicillin 400 g ml 1 Cb r carbenicillin resistance CIP calf intestinal phosphatase enzyme cm centimeter Cm chloramphenicol Cm r chloramphenicol resistance CFU colony forming units CPS counts per second CYBD Caribbean Yellow Band Disease DNA deoxyribonucleic acid dNTPs deoxyribonucleotide triphosphates DMSO dimethyl sulfoxide

PAGE 12

12 DTB DNAse Toludine Blue agar EDTA ethylenediaminetetraacetic acid FLP f lippase recombination enzyme Gm gentamycin Gm50 gentamycin 50 g ml 1 Gm r gentamycin resistance GTA gene transfer agent HCl hydrochloric acid Kb kilobase pair KCl potassium chloride kDa kilodalton Km kanamycin Km50 kanamycin 50 g ml 1 Km r kanamycin resistance L liter LB Luria Bertani broth LD 50 median lethal dose MA marine broth supplemented with 1.5% agar MB marine broth M molar MCS multiple cloning site mg milligram MgCl magnesium chloride MgSO 4 m agnesium sulfate min minutes

PAGE 13

13 ml milliliter mm millimeter mM milimolar MnCl 2 manganese(II) chloride MOPS 3 (N Morpholino)propanesulfonic acid, 4 Morpholinepropanesulfonic acid mRNA messenger RNA MWCO molecular weight cutoff Na 2 HPO 4 d isodium hydrogen phosphate NaCl sodium c hloride NaH 2 PO 4 sodium dihydrogen phosphate NCBI National Center for Biotechnology Information ng nanogram nm nanometer NZY NZ amine/yeast extract broth NZY+ NZY broth supplemented with glucose and MgCl 2 ppt parts per thousand C degree Celsius ONPG ortho Nitrophenyl D galactopyranoside OD 600 optical density at 600 nm ORF open reading frame PCR polymerase chain reaction qRT PCR quantitative real time PCR RNA ribonucleic acid rpm revolutions per minute rRNA ribosomal RNA

PAGE 14

14 SDS PAGE sodium dodecyl sulfa te polyacrylamide gel electrophoresis sRNA small non coding RNAs SOB super optimal broth TAE t ris acetate EDTA TB transformation buffer Tc tetracycline Tc r tetracycline resistance Tris t ris(hydroxymethyl)aminomethane UAS upstream activation sequence g microgram l microliter M micromolar UV ultraviolet VBNC viable but non culturable v / v volume to volume w / v weight to volume WT wild type X gal 5 bromo 4 chloro indolyl D galactopyranoside

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy RESILIENCE OF THE CORAL HOLOBIONT: DYNAMIC INTERACTIONS BETWEEN CORAL COMMENSAL BACTERIA AND OPPORTUNISTIC PATHOGENS By C ory Jon Krediet August 2012 Chair: Max Teplitski Major: Interdisciplinary Ecology The coral holobiont is a complex symbiotic association between the polyp animal, photosynthetic dinoflagellates, and their associated microbes. During colonization of coral mucus, opportunistic pathogens, including the white pox pathogen Serratia marcesce ns PDL100, compete with native bacteria for available nutrients in coral mucus and rely on catabolic enzymes, such as galactosidase and chitinase. This study tested the hypothesis that specific glycosidases and chitinase were critical for the growth of S. marcescens on mucus, and that their inhibition by native coral microbiota reduces fitness of the pathogen. Consistent with this hypothesis, a S. marcescens transposon mutant defective in glycosidase and chitinase activities was unable to compete with t he wild type on the mucus of the host coral Acropora palmata A survey revealed that approximately 8% of culturable coral commensal bacteria have the ability to inhibit glycosidases in the pathogen. In an attempt to understand how coral pathogens infect their hosts, the hypothesis that in the necrotizing coral pathogen S. marcescens PDL100, gacA is involved in the interactions of the pathogen with the polyp hosts was examined. A disruption of the S. marcescens gacA resulted in an increased competitive fitness of the mutant on crude mucus of the host coral Acropora palmata

PAGE 16

16 and on the high molecular weight fraction of the mucus, whereas the mutant was as competitive as the wild type on the low molecular weight fractio n of the mucus. This indicates a critical role for the gacA mediated phenotypes in the efficient utilization of coral mucus and establishment within the surface mucopolysaccharide layer. T he susceptibility of the sea anemone Aiptasia pallida to common cor al pathogens ( Serratia marcescens Vibrio coralliilyticus and V. shiloi ) was also tested A. pallida responded to the pathogens with symptoms that closely resemble the progression of the coral diseases caus ed by necrotizing pathogens. Infection studies with this model polyp will elucidate some virulence mechanisms used by coral pathogens to infect and degrade polyps These results demonstrate, that indeed, coral pathogens rely on specific regulated behaviors to infect their coral hosts and that coral co mmensal bacteria show the potential to disrupt these early infection strategies.

PAGE 17

17 CHAPTER 1 LITERATURE REVIEW AND INTRODUCTION Corals are intimately co evolved symbioses formed by polyps, unicellular algae and associated bacteria; this complex symbiotic assemblage is commonly called a holobiont deter mine the health of the reef ecosystem and its resis tance and resilience to stressors and disease Shifts in the composition of coral associated microbial communities are concomitant with bleaching events, which may lead to death of the reef. Colonization and infection of corals by both pathogens and symbionts are precisely regulated process es, which rely on coordinated expression of specific genes. recruit beneficial b acteria ( Ritchie, 2006 ; Teplitski et al., 2009 ) In this respect, corals are similar to other invertebrates, which have evolved to recruit beneficial bacteria and form either stable or shifting alliances with beneficial microorganisms. These beneficial microbes produce an impressive array of antibacterial, algicidal, and fungicidal compounds as well as compounds affecting bacterial cell to cell signaling (rev. Holmstrom and Kjellebe rg, 1999 ; Taylor et al., 2007 ) Our understanding of the microbe microbe interactions on the surface of corals has increased dramatically over the last 10 15 years with the advance of cultu re based, microscopic and molecular technologies. Our ability to isolate, culture, and study the genetics of these microbes has uncovered complex and dynamic interactions and functions, but we still have only scratched the surface. Garren and Azam recen tly reviewed the new directions in microbial ecology and highlighted the need to understand coral reef functions as integrated systems from the scale of microbes and

PAGE 18

18 molecules to that of ocean ecosystems in order to accurately predict ecosystem resilience and response to environmental stressors ( Garren and Azam, 2012b ) Similarly, Bourne and colleagues collectively reviewed the ecology of many coral disease causing pathogenic bacteria and showed that the study of the coral holobiont will benefit from an integrated study of all of the associated members ( Bourne et al., 2009 ) There are three questions at the forefront of coral host microbe interactions. What determines th e structure and function of coral associated microbial communities? What is the ecology of opportunistic pathogens that cause coral diseases? How do members of the coral native microbiota influence the resilience of the coral holobiont to both abiotic and biotic stressors? The goal of this review is to focus on the coral associated microbes and their role in the overall health of the coral holobiont. We will discuss recent discoveries made that elucidate interactions between commensal and pathogenic bact eria on the coral surface and compare these to other well studied systems. For the purposes of this dissertation, the following terms are defined here for clarification as they are used throughout. A symbiont is an organism living in a close and often lon g term interaction with organism. C oral commensal bacteria are microorganism s living in a suspected mutually advantageous relationship with the coral host ( McGuckin et al., 2011 ) to describe these organisms in this dissertation since it is often the case that the exact nature of the advantageous relationship between coral host and bacteri a remains unclear. An opportunistic pathogen is one that is ubiquitous in the environment and does not lead to disease under normal conditions. These pathogens are not specific to any one host

PAGE 19

19 and are capable of causing infections during environmental co nditions that favor their growth and replication and when their hosts are stress ed or immunocompro mised. These bacteria can live in non pathogenic relationships with their hosts but will induce virulence when a new niche is available due to weakened host defenses. The Coral H olobiont Just as many other animals, a coral is a complex holobiont formed by the animal and its associated suite of internal and external microbiota ( Rohwer et al., 2002 ; Knowlton and Rohwer, 2003 ; Rosenberg et al., 2007 ) The coral holobiont is made even more complex by the symbiotic algae, also called zooxanthellae that reside intracellularly and produce photosynthate as nutrients for the coral and the microbiota. The algae translocate up to 7 8 90% of their photosynthate to the coral host, allowing corals and other symbiotic invertebrates to thrive in otherwise nutrient poor waters ( Tremblay et al., 2012 ) Coral zooxanthellae associations are both dynamic and flexible in that corals can associate with different clades of Symbiodinium throughout their lifetime and thus the alg al endosymbionts can contribute significantly to the physiological attributes of the coral holobiont ( Little et al., 2004 ) This flexibility allows for associations with clades that may be more stable under an array of environmental conditions, which may aid in the holobiont response to environmental stressors. In additio n to the benefits provided by the zooxanthellae, the associated microbiota, which include bacteria, archaea, viruses, fungi, and endolithic algae also provide mutualistic benefits ( Rohwer et al., 2002 ; Ritchie, 2006 ; Wegley et a l., 2007 ; Dinsdale et al., 2008 ; Marhaver et al., 2008 ; Willner et al., 2009 ; Thurber and Correa, 2011 ) and are thought to be important for the ability of corals to resist and/or adapt to environmental change ( Reshef et al., 2006 ) Due to the tight and often obligate associations of the partners of

PAGE 20

20 the coral holobiont, it can be thought that these partners function as a single unit upon with evolutionary selection acts ( Rosenberg and Zilber Rosenberg, 2008 2011 ) Host Genetic and Epigenetic Factors that Control the Structure of Coral Associated Microbiota Coral rely heavily on their endosymbionts and associated microbes for their overall health and function, but the coral host itself is able to influence the structure and composition of its microbiota. Corals, and other Cnidarians, lack complex adaptive immune systems found in higher organisms and vertebrates. Instead, they employ basic host defenses such as mechanical/physical barriers to infection, the ab ility to shed or expel pathogens, secretion of chemicals and bioactive compounds, and phagocytosis ( Mullen et al., 2004 ; Reed et al., 2010 ) Corals produce lysozyme like proteins and antioxidants (phenoloxidase and prophenoloxidase) ( Mydlarz et al., 2006 ; Mydlarz et al., 2008 ; Palmer et al., 2008 ) Corals also produce chitinases in response to fungal infections and due to their algal endosymbionts, corals have plant like physiological qualities ( Mull en et al., 2004 ) Either wounding or an inflammatory response to infection generally elicits production of these compounds and activities. Geffen and Rosenberg showed that mechanical stress to Pocillopora damicornis led to antibacterial production eff ective against the coral pathogen Vibrio coralliilyticus ( Geffen and Rosenberg, 2005 ) The antibacterial comp ounds produced by corals may vary depending on the type of immune challenge. A recent study found that P. damicornis produces an antimicrobial peptide; Damicornin constitutively produced in ectodermal cells in response to non pathogenic immune challenges ( Vidal Dupiol et al., 2011b ) The peptide was effective against Gram positive bacteria and the fungus Fusarium oxysporum but was repressed by the presence of Vibrio coralliilyticus ( Vidal Dupiol et al., 2011b ) Variability in

PAGE 21

21 temperature also induces host defense responses in corals. In sea fan corals, increased temperature induced disease resistance (as m easured as antifungal metabolite activity) by 30% in young edge tissues but not in the center of the colony ( Ward, 2007 ) This is consistent with other observations of Caribbean sea fan disease outbreaks as well as modeling of host defense response induced by pathogenic infection ( Ellner et al., 2007 ) Upon physiochemical insults, injury, and pathogen infecti on, the starlet sea anemone, Nematostella vectensis expresses genes involved in response to reactive oxygen species (ROS), toxic metals, osmotic shock, thermal stress, and wounding ( Reitzel et al., 2008 ) Indeed the relatively simple immune response of corals and other Cnidaria is seemly robust and well equipped to respond to a wide array of environmental and pathogenic stressors. Although corals do not have a true adaptive immune system, which involves the ability to recognize and respond to specific pathogens, corals do show adaptive like immunological responses ( Rosenberg et al., 2007 ) Numerous recent studies have used gen omics, transcriptomics, and EST libraries to determine genes involved in immune responses and functions. Comparisons to Drosophila and Caenorhabditis have yielded insights into the origins of immune functions now that genome sequences for some of the simp ( Hemmrich et al., 2007 ) EST collections from the coral Acropora millepora the sea anemones Nematostella and Aiptasia and Hydra contain Toll like receptors (TLRs) and complement pathways ( Miller et al., 2007 ; Reitzel et al., 2008 ) I n vertebrates, the Toll/TLR receptors mediate the activation of the appropriate response genes to a microbial challenge ( Miller et a l., 2007 ) Similar receptors and pathways have been found in Caribbean Staghorn coral,

PAGE 22

22 Acropora cervicornis A study to determine the rate of natural disease resistance of this coral to white band disease revealed that 6% of the coral genotypes tested were resistant to the disease ( Vollmer and Kline, 2008 ) The precise genes involved remain unclear but in other systems this type of resistance is based on pathogen recognition and innate immunity. Therefore, TLRs may be the foundation for this observed disease resistance. Specific immune lectins have recently been identified in corals. Kvenn efors et al. ( 2008 ) identified a mannose binding lectin in A. millepora involved in pathogen and symbiont recognition. The lectin is homologou s to the domain of a range of C type lectin involved in immunity in other animals and glycan/lectin interactions are important for early symbiosis of coral larvae ( Kvennefors et al., 2008 ; Iguchi et al., 2011 ) Six immune related proteins induced upon bacterial exposure were recently identified in Pocillopora d amicornis of which, three were lectin like molecules involved in recognition pathways ( Vidal Dupiol et al., 2011a ) The other immune proteins were metal biding proteins putative ly involved in antibacterial response and one cysteine protease inhibitor ( Vidal Dupiol et al., 2011a ) Genomic investigations have elucidated immune pathways and genes involved in non self recognition in corals and analysis of the genome of A. digitifera compared to Nematostella revealed that the innate immunity of corals is more complex than the anemone with additional genes involved in symbiosis and coloniality ( Shinzato et al., 2011 ) These results demonstrate that the coral innate immune repertoire is notably complex and consists of adaptive like functions that allow the host to respond to stressors and thereby alter the structure of its associated microbiota.

PAGE 23

23 The Coral Holobiont and Disease The prevalence and incidence of coral diseases are on the rise with the constant onslaught of environmental stressors including warming temperatures and ocean acidification. Recently, Bourne and colleagues reviewed the impa ct of coral disease on the holobiont and suggested the application of techniques historically employed in human and veterinary medicine in order to enhance our understanding of how the ecology of coral associated microbiota changes with disease ( Bourne et al., 2009 ) There are currently at least 18 identified coral diseases and the causative agents for some h ave been determined including Aurantimonas coralicida for white plague type II ( Denner et al., 2003 ) Vibrio shiloi for bleaching of Oculina patagonica ( Kushmaro et al., 1996 ; Kushmaro et al., 1997 ) Serratia marcescens for white pox disease ( Patterson et al., 2002 ; Patterson Sutherland and Ritchie, 2004 ) Aspergillus sydowii for sea fan disease ( Geiser et al., 1998 ) and Vibrio coralliilyticus for bleaching and lysis of Pocillopora damicornis ( Ben Haim and Rosenberg, 2002 ; B en Haim et al., 2003b ) and white syndrome in Pacific corals ( Sussman et al., 2008 ) Although these agents responsible for disease have been ide ntified and characterized, still little is known about the mechanisms used to cause disease on corals. Much of our understanding of coral diseases is historically dependent on field surveys and pathological signs are quite general making assignment of gro ss lesion morphology difficult between diseases. Also, observations of coral resistance to previous disease ( e.g. Oculina patagonica is now able to resist V shiloi infection, Rosenberg et al., 2007 ) lead us to question whether or not the initially isolated agents are still the primary pathogens causing disease ( rev. Bourne et al., 2009 )

PAGE 24

24 Invasion by opportunistic pathogens during a disease outbreak leads to shifts in the members of the coral associated microbiota. During a bleaching event in A. millepora Bourne et al. used DGGE finger print analysis to show that the microbial populations shifted drastically and increasing temperatures correlated with the presence of Vibrio associated sequences ( Bourne et al., 2008 ) The bacterial communities on the surface of corals change composition during bacterial disease as well. In Montastraea colonies infected with white plague, high density 16S rRNA gene microarrays documented shifts in the associated bacterial populations that were distinct from healthy colonies ( Sunagawa et al., 2009b ) The resident microbial community is critical to the healthy functions of the coral holobiont and during disease pathogenic microbes, often dominated by Vibrio spp., replace this community. Interactions of the surface microbial community facilitates the resistance to these alternate states as well as the ability to return to p re disease conditions after an infection ( Mumby et al., 2007 ; Mao Jones et al., 2010 ) Horizontal Arms Race: Gene Transfer on the Coral Surface Resident microbes and invading pathogens are in direct competition for available nutrients and niches in the coral surf ace mucus environment. The presence of specific genes for antimicrobial activity or specific carbon source utilization may confer a selective advantage to those microbes in this environment. Bacteria rely on mutation and horizontal gene transfer through conjugation, transformation and transduction to acquire new traits. The mucus of corals is rich in the compatible solute dimethylsulfoniopropionate (DMSP), which is produced by the symbiotic zooxanthellae ( Raina et al., 2010 ) Other microbes, such as Aspergillus can catabolize DMSP liberating dimethyl sulfide gas (DMS). Different strains of A. sydowii isolated from

PAGE 25

25 diseased corals and other environments were tested for the presence of a Ddd+ phenotype ( Kirkwood et al., 2010 ) The dddP gene encodes an enzyme that reduces DMS from DMSP and occurs in other Ddd+ fungi and marine bacteria. The presence of this enzyme in Aspergillus is due to horizontal gene transfer, likely originating from the proteobacteria Roseovarius sp. ( Kirkwood et al., 2010 ) Gene transfe r agents (GTAs) were first discovered in Rhodobacter capsulatus and are host encoded virus like elements that package random fragments of the host chromosome ( McDaniel et al., 2010 ) GTAs from coral isolated Roseovarius nubinhibens and Reugeria mobilis showed a wide host range and inter specific gene transfer of a Tn5 encoded kanamycin resistance marker under ecologically relevant conditions at frequencies drastically more efficient than transformation and transduction ( McDaniel et al., 2010 ) These host encoded transfer elements allow for mixing of genes in the ocean environment, allowing selective advantage to some microbes associated with the coral holobiont. Similar to GTAs, coral mucus associated Vibrio integrons are hotspots for enviro nmental adaptations to the coral resistome through lateral gene transfer ( D'Costa et al., 2006 ; Koenig et al., 2011 ) These integrons are crucial for the spread of antibiotic resistance in human and anim al pathogens and are well studied chromosomal elements in pathogenic and environmental Vibrio spp. The spread of antibiotic resistance genes can be beneficial to the resident microbiota to resist invading pathogens but also can benefit pathogens that have to evade the host defenses of the coral holobiont. Genome comparison analysis revealed that potential resistance cassettes were shared exclusively between Vibrio species in mucus and coral and human pathogens ( Koenig et al., 2011 ) These data illustrate a connection

PAGE 26

26 between microbial niches through exchange genes through mechanisms of horizontal gene transfer and reveals that the rate of genetic transfer in the ocean system may be faster than originally presumed. Chemical and Physical Properties of Coral Mucus Coral microbes are generally associated with coral tissues or perhaps more o ften with the surface mucus layer. Fixed carbon produced by zooxanthellae is transferred to the coral host and secreted through epidermal mucus cells ( Ritchie and Smith, 2004 ; Tremblay et al., 2012 ) Both hard and soft corals secrete mucus continuously and each species has a distinctive composition ( Ducklow and Mitchell, 1979 ; Meikle et al., 1988 ; Ritchie and Smith, 2004 ; Wild et al., 2004 ) which can vary temporally and with depth ( Crossland, 1987 ; Ritchie, 2006 ) Coral mucus is a polymer made in specialized mucocytes of the polyp from the photosynthate produced by their endosymbiotic dinofla gellates and then secreted onto the coral surface ( Brown and Bythell, 2005 ; Bythell and Wild, 2011 ) The chemical structure of coral mucus has been solved for only several species ( Ducklow and Mitchell, 1979 ; Molchanova et al., 1985 ; Meikle et al., 1987 1988 ; Jatkar et al., 2010 ; Wild et al., 2010 ; Tremblay et al., 2011 ) The mucus polymer is a glyc oprotein containing sulfated oligosaccharide side chains attached through O glycosidic linkages to serine and threonine, the principle amino acids in the polypeptide ( Meikle et al., 1987 ) The major sugar residues found in coral mucus of are D arabinose, D mannose, N acetyl D glucosamine, and D galactose ( Meikle et al., 1988 ; Jatkar et al., 2010 ; Tremblay et al., 2011 ) Coral Mucus Utilization by Commensal Bacteria and Opportunistic Pathogens Coral mucus supports growth of bacteria up to 10 6 10 8 cfu ml 1 ( Wild et al., 2004 ; Sharon and Rosenberg, 2008 ; Krediet et al., 2009b ; Garren and Azam, 2010 ) This

PAGE 27

27 provides a nutrient rich environment for microbes as comp ared to the pelagic water column and in fact, culturable bacteria isolated from the mucus layer were 100x more abundant as compared to the surrounding water mass and were many orders of magnitude higher in metabolic activity ( Ritchie et al., 1996 ) Bacterial community profiling using DGGE analysis has shown that bacterial communities can be specific to coral species and may be unique to either coral tissue or coral skeleto n ( Tremblay et al., 2011 ) These bacterial communities, however, can also vary between corals of the same species in the field versus in aquaria ( Kooperman et al., 2007 ) or may vary with environmental conditions ( Ainsworth and Hoegh Guldberg, 2009 ) To grow on coral mucus bacteria employ glycosidases, proteases, and esterases ( Vacelet and Thomassin, 1991 ; Krediet et al., 2009b ) Coral mucus contains both high and low molecular weight sugars available as nutrients for microbes. The role of these sugars in coral ecology is not fully clear but may influence the microbial communities associated w ith corals. Kuntz et al. ( 2005 ) exposed fragments of Montastraea annularis and Porites furcata to varying concentrations of lactose, a disaccharide that is not known to occur naturally on coral reefs, for 30 days leading to nearly 100% mortality of M. annularis fragments, while survivorship of P. furcata was only moderately affected ( Kuntz et al., 2005 ) Exposure to mannose, however, led to significant mortality in P. furcata but not in M. annularis ( Kuntz et al., 2005 ) It is unclear whether exposure to these sugars (1) destabilized the symbiosis between the coral and the zooxanthellae; (2) led to growth of opportunistic pathogens that caused disease; or (3) potentially regulate virulence genes in the resident microbiota on the coral surface. Sugars of coral mucus may also allow for co existence of both commensal bacteria and opportunistic

PAGE 28

28 pathogens. Serratia marcescens was able to utilize the same sugars in Acropora palmata mucus as two commensal strains of Photobacterium spp. but there were significant differences in the sequence with which the pathogen and the commensal bacteria utilized components A. palmata mucus ( Krediet et al., 2009b ; Krediet et al., 2009a ) These differences in the preference of substrates in coral mucus may explain how S. marcescens and other opportunistic pathogens become established within the coral surface mucus layer and compete against the native coral associated microbial community. Cell to Cell Signaling and Interference within the Coral Surface Mucopolysaccharide Layer Because virulence is often controlled by quorum sensing ( QS ) the disruption of this cell to cell communication mechanism has been suggested as a way to manipulate virulence related behaviors in bacterial pathogens ( Bauer et al., 2005 ; Rasmussen and G ivskov, 2006 ) QS inhibitory compounds and QS signal mimics have been isolated from both prokaryotes and eukaryotes ( Bauer et al., 2005 ; Rasmussen and Givskov, 2006 ; Rajamani et al., 2008 ) E xtracts from marine organisms (including sponges and corals) contain ed activities that disrupt ed QS in reporter bacteria under laboratory conditions ( Skindersoe et al., 2008 ) Coral associated bacteria have the potential to produce QS signals (acyl homoserine lactones, AHLs and autoinducer 2, AI 2) that regulate the interspecific interactions on coral surfaces. Rece nt work has shown that coral associated Vibrios isolated from both healthy and diseased corals are able to produce QS signaling molecules in vitro ( Tait et al., 2010 ; Golberg et al., 2011 ) Some strains were able to inhibit quorum sensing signal production, most notably, Vibrio harveyi although the mechanism behind this inhibition is not clear ( Tait et al., 2010 )

PAGE 29

29 Since this initial report, studies have shown that coral associated bacteria do produce AHLs when grown on coral mucus as analyzed by TLC and hydrophobic bio active compounds have been extracted from the surface of Montastraea faveolata in situ and inhibited biofilm formation in the white pox pathogen S. marcescens ( Alagely et al., 2011 ) As corals are holobionts, a complex symbiotic organism consisting of the polyp, zooxanthellae and associated microbes ( Rosenberg et al., 2007 ; Rosenberg and Zi lber Rosenberg, 2008 ) these bioactive compounds could have originated from any of the partners. Individual cor al commensal isolates were also screened for their ability to produce AHLs and inhibit known virulence related behaviors in S. marcescens ( Alagely e t al., 2011 ) In addition to affecting biofilm formation and swarming motility in the pathogen, a multi species cocktail of isolates including Marinobacter spp. and an protoeobacterial isolate 44B9 slowed disease progression caused by S. marcescens PDL100 in a model polyp Aiptasia pallida ( Alagely et al., 2011 ) As our understanding of the role of AHL production and quorum sensing signalin g on the coral surface strengthens so will our understanding of the interspecific interactions that structure and regulate the coral holobiont. Coral Associated Microbiota: A Key to Nutrient Cycling and Sustainability of Reef Ecosystems Corals typically re ceive the majority of their carbon requirement from their symbiotic association with zooxanthellae ( Tremblay et al., 2012 ) They are also passive suspension feeders and trap suspended particles and bacteria in their mucus as a nutrient source ( rev. Kushmaro and Kamarsky Winter, 2004 ) Besides serving as a direct source of nutrition to corals through bacterivory, microbial members of the coral holobiont contribute functions and servic es to nutrient cycling processes important to

PAGE 30

30 the sustainability of reef ecosystems. Nitrogen fixation by coral associated bacteria is an important nutritive cycling role in a nitrogen limited environment ( Kushmaro and Kamarsky Winter, 2004 ) Vibrio harveyi and V. alginolyticus are capable of nitrogen fixation in coral mucus and dominate the culturable nitrogen fixing bacteria of the Brazilian coral Mussismilia hispida ( Chimetto et al., 2008 ) The fact that many Vibrios are able to fix nitrogen may help to explain their abundance and often dominance of the micro biota associated with corals worldwide. The importance of dimethylsulfoniopropionate (DMSP) in the biogeochemical sulfur cycle in reef ecosystems is of recent interest since high levels of DMSP have been recorded from coral reef organisms harboring symbiotic dinoflagellates ( Broadbent et al., 2002 ; Raina et al., 2010 ) The bacteria associated with corals are presumed to be involved in the cycling of DMSP and dimethyl sulfide (DMS) on coral reefs throu gh bacterial metabolic processes. Between 50 and 80% of the DMS produced on coral reefs are directly consumed by bacteria ( Raina et al., 2010 ) Members of the SAR11, the most numerous and ubiquitous clade of marine bacteria require exogenous sources of reduced sul fate for growth ( Tripp et al., 2008 ) Bacterial groups c apable of metabolizing DMSP/DMS were the dominant species in clone libraries from corals ( Raina et al., 2009 ) suggesting that these compounds play a role in the structuring of the microbial communities associated with corals and that bacteria capable of degrading these compounds facilitate cycling of these nutrients in reef ecos ystems. The coral reef environment is as dynamic as the coral holobiont and is ever changing. With changing environmental conditions and increased environmental stressors, the microbial landscape and functions therein are constantly in a state of flux.

PAGE 31

31 O cean warming and acidification are now recognized as critical threats to coral reef ecosystems as evident from the fact that over half of the publications about ocean acidification focus on impacts to reefs ( Hoegh Guldberg et al., 2007 ; Veron et al., 2009 ; Anthony et al., 2011 ; Veron, 2011 ) As the chemistry of the oceans continues to turn more acidic, the resilience of corals to disease and other stressors is predicted to decrease ( Anthony et al., 2011 ) A predicted [CO 2 ] of 560 ppm will decrease coral growth and calcification by up to 40% opening the possibility of reefs reaching tipping points leading to algal dominated alternative states ( Hoegh Guldberg et al., 2007 ; Mumby and Steneck, 2008 ) Coral as sociated microbial communities are predicted to change significantly due to reduced pH of reef waters. Just as corals are subject to the effects of temperature, nutrients, and pH, so are the associated bacteria. Changes in environmental parameters and co ral mucus greatly affected the growth and survival of Serratia marcescens PDL100. The pathogen was unable to grow in field samples of coral mucus from Acropora palmata but showed increased survivability at warmer temperatures, leading the authors to concl ude that the pathogen was not well adapted to growth in the marine environment ( Looney et al., 2010 ) The health and stability of the coral holobiont is dependent on the adaptability of the associated microbial communities but it is becoming clear that coral as sociated bacteria are sensitive to environment perturbations as well. Meron et al. ( 2011 ) demonstrated the impact of pH on microbial communities of Acropora eurystoma under pH 8.2 and 7.3. With reduced pH the DGGE community patterns shifted to bacteria associated with diseased and stressed corals with most members representing Vibrionaceae and Altermonadaceae and bacteria from corals exposed to low pH showed increased antibacterial activity

PAGE 32

32 ( Meron et al., 2011 ) indicating that the resident microbiota may be trying to fend off invading opportunistic pathogens. Curative F unctions of the Native Coral Microbiota farming and food production industries ( Hudson et al., 2005 ) A recent review evaluated the potential for using biocontrol agents (phages and native coral associated microorganisms) to manage coral diseases ( Teplitski and Ritchie, 2009 ) While the science behind these techniques applied to coral diseases is still in its infancy, there is promising potential to use these strategies in the future, especially to seed coral fragments grown in aquaculture for transplantation onto the reef with a beneficial microbial community. Phage Therapy Phage therapy is considered more advantageous tha n application of antibiotics because the phage will be replicated continuously so long as the bacterial host remains, therefore, only one application of the phage should be necessary for long term treatment ( Jensen et al., 2006 ) Phages are extremely specific to their respective host so therefore would not b e inclusive of all pathogens but will also unlikely affect the resident coral associated bacteria Bacteriophages specific to Vibrio coralliilyticus and Thalassomonas loyana have been applied to infected corals in controlled aquaria settings ( Efrony et al., 2007 ) These phages are specific to the coral pathogens and do not affect the resident microbiota ( Efrony et al., 2007 ; Efrony et al., 2009 ) A potential concern with phage therapy is that exposure of the pathogen to the phage can lead to bacterial resistance through mutation (rev. Efrony et al., 2009 ; Teplitski and Ritchie, 2009 ) It may be possible to carry out phage therapy in the field with more than one

PAGE 33

33 specific lytic phage but th e time of application is also critical for preventing coral disease. If the phage is applied too late (more than two days after infection) prevention of coral tissue loss and death was not observed ( Efrony et al., 2009 ) All experiments thus far have been in controlled aquaria and field trials are needed to evaluate the effectiveness of phage therapy as a potential management strategy of coral diseases. Similar to well characterized biocontrol agents, coral mutualistic bacteria have the atabolic enzymes and disrupt cell to cell communication in pathogens and competitively exclude pathogens from host surfaces ( rev. Teplitski and Ritchie, 2009 ) As mentioned above, a multi species A. palm ata mucus inhibited progression of disease caused by S. marcescens PDL100 in a model polyp Aiptasia pallida ( Alagely et al., 2011 ) A similar ef fect was observed by a single proteobacterial isolate 44B9 but the mechanism of this inhibition by the coral commensal bacteria is unclear. As we continue to learn more and more about the coral holobiont, the microbial members present and their dynamic interactions, the potential of using them as biocontrol agents will come to fruition. Production of Biocides and Uncertainties Associated with Their in situ Functions An array of antibacterial, algicidal, anti biofouling, and cytotoxic compounds have been isolated from marine invertebrates and their microbial associates ( rev. Mydlarz et al., 2006 ) though it is not yet clear whether any of the biocide producing microbes are capable of providing the magnitude of protection typically found in successful biocontrol organisms. Culturable microbes associated with A. palmata produce antibacterials agains t a broad spectrum of pathogens, including the opportunistic pathogen S. marcescens ( Ritchie, 2006 ) Similar findings were obtained form bacteria isolated from

PAGE 34

34 Acropora millepora Commensal bacteria from healt hy corals were able to inhibit growth of known coral pathogens however, isolates associated with and often found on diseased colonies ( Vibrio coralliilyticus and Pseudoalteromonas spp.) showed strong antimicrobial activities against coral bacteria, indicat ing that these strains may have a conditions ( Kvennefors et al., 2012 ) Although it is not known whether the levels of antibiotics produced by these bacteria are able to kill pathogens in situ local concentrations of antibiotics within the coral mucu s layer, and in the associated microbial biofilm, could be sufficient to prevent the initial establishment of pathogens on the coral surface in the proximity of antibiotic producing organisms. Moreover there was a substantial reduction in the number of an tibiotic producing isolates in correlation with temperature induced coral bleaching events ( Ritchie, 2006 ) and bleached Acroporid corals have been shown to be more susceptible to attacks by opportunistic pathog ens ( Muller et al., 2008 ) This observed link between the loss of antibiotic producing bacteria and an increased susceptibility to opportunistic pathogens provides and interesting hint about the possible role of robust native communities in the disease resistance of corals. Competitive E xclusion of Pathogens by Coral Commensal Bacteria Many bacteria are able to grow on components of coral mucus ( Sharon and Rosenberg, 2008 ; Krediet et al., 2009b ) During their growth on mucus of the coral Acropora palmata fo r example, the coral pathogen S. marcescens and coral commensal ba cteria generally used a similar set of carbohydrate degrading enzymes but differed in the temporal regulation of these activities ( Krediet et al., 2009b ) The differences in the pattern of enzymatic degradation of mucus by commensal bacteria

PAGE 35

35 and pathogens are reminiscent of those observed during the colonization of intestinal mucus by pathogenic and commensal strains of E. coli ( Fabich et al., 2008 ) Fabich et al. ( 2008 ) formulated a hypothesis that invading pathogens gain advantage by efficient ly co metabolizing those carbon sources that are not consumed by the commensal microflora at the same time. If this hypothesis is also supported by studies with coral commensal microbiota, then competitive exclusion of pathogens from coral surfaces could be achieved by simply promoting diverse microflora capable of efficiently utilizing coral mucus. It may also be possible to exclude pathogens from coral surfaces by promoting l mucus. For example, galactosidase was induced in coral pathogens and environmental bacteria during their growth on coral mucus ( Krediet et al., 2009a ) The enzyme is hypothesized to cleave the galactoside residues, which decorate the major polymer in the Acropora mucus ( Meikle et al., 1987 ) Eight percent of coral commensals secreted substances that inhibited the activity of the en zyme in the coral pathogen S. marcescens and related opportunistic pathogens ( Krediet et al., 2012 a ) Such metabolic inhibition of opportunistic pathogens by native coral associated commensal bacteria could also be explored as a potential exclusion mechanism during colonization of the coral surface mucopolysaccharide layer. The White Pox P athogen S erratia marcescens as a Model P athoge n Serratia marcescens is one of the better characterized opportunistic pathogens of Caribbean corals ( Patterson et al., 2002 ; Sutherland et al., 2004 ) and is closely related to other Serratia spp. which have been linked to diseases of animals, invertebrates and their larvae ( Krediet et al., 2009b ) S. marcescens P DL100 is associated with the

PAGE 36

36 appearance of white pox disease symptoms, a disease which progresses rapidly at a rate of 2.5 cm 1 day 1 ( Patterson et al., 2002 ) The etiology of Serratia induced pathologies in other invertebrates suggests that the colonization of host surfaces is (in most cases) the first in a s eries of events eventually leading to the appearance of disease signs. In addition to corals, Serratia marcescens infects a wide variety of hosts and can be viewed as a model opportunistic pathogen. Serratia marcescens is able to cause disease (and ofte n high mortality) in C. elegans ( Kurz and Ewbank, 2000 ; Kurz et al., 2003 ; Schulenburg and Ewbank, 2004 ) Costelytra zealandica (New Zealand grass grub) ( Tan et al., 2006 ) numerous insects, plants, vert ebrates, and humans ( Grimont and Grimont, 2006 ) During infection o f C. elegans S. marcescens is capable of killing the host by a toxin based mechanism or following the establishment of an infection. The bacteria are able to live within the digestive tract of the nematode and proliferate and spread, eventually causing a systemic infection ( Kurz and Ewbank, 2000 ) In a screen of Serr atia marcescens mutants, specific genes involved in a two component regulatory system, magnesium and iron transport, hemolysin production and the biosysthesis of O antigen and lipopolysaccharides (LPS) were found to be important to the virulence of the pat hogen ( Kurz et al., 2003 ) A similar study investigating gene expression in Pseudomonas aeruginosa during C. elegans infe ction identified similar genes ( e.g. two component global regulation system genes, Tan et al., 1999 ) Recently research has demonstrated that S. marcescens PDL100 relies on regulation of c atabolic enzymes in order to be competitive on coral mucus ( Krediet et al., 2012a ) Understand ing virulence mechanisms of this pathogen in multiple hosts will reveal

PAGE 37

37 evolutionarily conserved mechanisms of host invasion and will shed light onto the potential mechanisms used to infect corals. Comparison to Other Well Studied Host M icrobe I nteractio ns Host associated microbiota across species have long been suspected of conferring important functions to their respective hosts including playing roles in nutrition and susceptibility to disease ( Savage, 1977 ; Robinson et al., 2010 ) Shared ecological concepts among host microbe communities include temporal stability, structure and functional resistance/resilience and prot ection from invasion ( rev. Robinson et al., 2010 ) These shared functions are found in microbial communities linked with humans and other mammals, insects and invertebrates, and in soil and water envir onments. These microbial communities are often associated with mucous lined surfaces of the host including the oral cavity, the gastrointestinal tract, and the reproductive tract and serve as a barrier for infection by invading pathogens ( rev. Robinson et al., 2010 ) Lactobacillus competitively excludes pathogens form binding to the mucus and epithelial cells of the host through antimicrobial production ( Boris and Barbes, 2000 ; Srinivasan and Fredricks, 2008 ) The mucus derived from the host epithelial cells has a glycoprotein backbone similar to the co mposition of coral mucus and also serves as an initial barrier to protect against pathogenic bacteria ( Dharmani et al., 2009 ; McGuckin et al., 2011 ; Ashida et al., 2012 ) The mucin is typically produced continuously at a basal rate, but the rate of production can vary with environmental conditions and bacterial infection. Just as in corals, the mucin layer can be sloughed of f as an early defense mechanism in response to bacterial infection.

PAGE 38

38 Mechanisms of virulence of opportunistic pathogens that infect other well studied systems such as the human gastrointestinal tract and model organisms such as Drosophila melanogaster and C aenorhabditis elegans are strikingly similar to those employed by coral pathogens. Flagella based motility and chemotaxis towards mucus and the nutrients within are early mechanisms for adherence and colonization of host tissues ( Ashida et al., 2012 ) Some enteric pathogens secrete enzymes such as zinc metalloproteases (e.g. StcE) that cleave mucin type O glycosylated proteins ( Silva et al., 2003 ; Grys et al., 2005 ; Szabady et al., 2011 ) which is similar to the zinc metalloprotease employed by the coral pathogen Vibrio coralliilyticus ( Sussman et al., 2009 ) Once enteric pathogens have crossed o ver the mucin layer and adhered to host epithelial cells, they keep the cells alive while gaining their replicative foothold whereas later in the infection process they induce the lysis of host cells to facilitate an outlet from their niches ( Kim et al., 2010a ; Ashid a et al., 2012 ) In defense the host can increase turnover of epithelial cells as seen in Drosophila melanogaster in response to infection by Erwri na carotovora Pseudomonas spp., and Serratia marcescens ( Amcheslavsky et al., 2009 ; Pitsouli et al., 2009 ) Together, the mucus layer as well as host associated microbiota serves as the first line of defense against invasion by opportunistic pathogens. In addition to resistance and resilience to invasion by pathogens, the host associated microbiota are critical for nutrient exchange and metabolic cooperation. These types of interactions range from development of light organs in the Hawaiian bobtail squid Euprymna scolopes to the production of vitamins and essential amino acids in humans, and nitrogen fixation and sulfur cycl ing on corals ( Gibson and

PAGE 39

39 Roberfroid, 1995 ; Koropatnick et al., 2004 ; Kushmaro and Kamarsky Winter, 2004 ; Raina et al., 2010 ) The stability and overall health of the host is dependent on these critical functions and services provided by the associated microbial communities. This stresses the need to not only understand the higher level characteristics of these communities but also the identities of the individual memb ers of the community and their respective roles in community structure and function. Hypotheses and Goals This study tested the overall hypothesis that opportunistic pathogens such as Serratia marcescens PDL100 rely on specific genes and metabolic pathways in order to infect their coral hosts and that coral commensal bacteria are capable of interfering with early colonization and infection behaviors in the pathogen was tested. The experiments within this study are centered on microbial interactions between coral commensal bacteria and opportunistic pathogens. This work builds on previous research that demonstrated coral commensal bacteria and strains of S. marcescens are equally capable to utilizing and degrading mucus constituents from Acropora palmata but they did so with different preferences, potentially allowing for their co existence on the coral surface ( Krediet et al., 2009b ; Krediet et al., 2009a ) The presence of these traits in coral associated bacteria may be a consequence of evolution of the coral holobiont. The coral holobiont is made up of the host and its associated microbiota ( Rohwer et al., 2002 ) and therefore the hologenome is the sum of the genetic information of the host and its microbiota ( Rosenberg and Zilber Rosenberg, 2008 2011 ) Within the hologenome theory, the coral holobiont and its hologenome acts as a unit of selection in evolution in which all members contribute to the variation of the genomes and are also affected by it. These co evo lved traits can be passed on to the next generation and

PAGE 40

40 contribute to the fitness of the holobiont ( Rosenberg and Zilber Rosenberg, 2008 2011 ) Based on this potential for co evolved mucus utilization capabilities in both pathogens and coral commensal bacteria I hypothesize that catabolic enzymes induced during growth on coral mu cus, specifically glucopyranosidase, and N acetyl glucosaminidase (chitinase) are critical for proper utilization of coral mucus and competitive fitness in the coral mucus environment. I hypothesize further that coral commensal bacter ia are able to inhibit s uch catabolic enzymatic activities in the pathogen. In order to sense their immediate environment and evade host defenses, pathogens rely on global regulators to control their gene expression relating to carbon acquisition, motilit y, and virulence. Therefore, I hypothesize t hat GacA is critical for the ability of S. marcescens PDL100 to grow and survive in the coral mucus environment. Finally, I propose that the sea anemone polyp, Aiptasia pallida be used as a surrogate host for c oral infection studies using opportunistic coral pathogens. To test these hypotheses, a S. marcescens PDL100 transposon mutant deficient in catabolic enzyme activities were isolated and characterized and coral commensal bacteria were screened and assayed f or capabilities to interfere with early colonization and infection associated behaviors in the pathogen. The presence, functionality, and role of the global regulator GacA for S. marcescens growth and survival on coral mucus were also tested. Additionall y, individual A. pallida polyps were infected with opportunistic pathogens ( S. marcescens Vibrio coralliilyticus and V. shiloi ) and the resulting disease manifestations were compared to those observed in their respective coral hosts.

PAGE 41

41 This study begins to uncover the mechanisms used by Serratia marcescens PDL100 as it colonizes the coral surface degrades coral mucus, and interacts with the resident coral associated microbiota. The data presented here show that the pathogen relies on specific catabolic en zymes in order to be competitive on coral mucus and that early colonization behaviors are regulated indirectly by global regulator systems as is true for other well proteobacterial pathogens. The study of the interactions between coral associate d bacteria and invading opportunistic pathogens is still in its infancy, but the results presented here elucidate behaviors and traits of coral pathogens that are likely to be evolutionarily conserved in other opportunistic pathogens detrimental to corals worldwide. As we continue to uncover these dynamic interactions we will be more equipped to manipulate and harness them for use in the management and preservation of coral reef ecosystems.

PAGE 42

42 CHAPTER 2 MATERIALS AND METHOD S Bacterial Strains, Plasmids, and Culture Conditions. Unless otherwise indicated, Serratia marcescens and coral commensal isolates were grown in marine broth (Difco Becton, Dickinson and Company, Franklin Lakes, NJ ) or in GASW broth (per liter: 356 mM NaCl; 8 mM KCl; 40 mM MgSO 4 ; 20 mM MgCl 2 2 O; 60 M K 2 HPO 4 ; 7 M FeSO 4 ; 33 M Tris; 0.05% peptone; 0.2 % yeast extract; 2.0% glycerol, ( Smith and Hayasaka, 1982 ; Smith et al., 1982 ) and Escherichia coli strain s we re grown in LB broth (per liter: 1.0% tryptone; 0.5% yeast extract; 0.5% NaCl Fisher Scientific, Atlanta, GA ). Antibiotics were used in selection media at the following concentrations for strain indicated in the sections to follow : Ap (100 g/ml); Gm (50 g ml 1 ); Km (50 g ml 1 ), Cb (400 g ml 1 ) Tc (10 g ml 1 ) Cm (10 g ml 1 ) Coral mucus was collected from apparently healthy colonies of Acropora palmata at Looe Key Reef, Florida (24 ( Ritchie, 2006 ) To prepare mucus as a growth medium, samples were pre filtered through glass fiber filter followed by filtration through a 0.22 m MCE filter. Aliquots of the sample were then size fractionated using VivaSpin 1 5 spin dialysis assemblies (Sartorium Stedim Biotech, Goettingen, Germany). High molecular weight fractions were brought up to volume in filter sterile artificial seawater (ASW; Red Sea Coral Pro Salt, Eilat Israel) Manipulations of DNA Genomic DNA Isola tion Genomic DNA was prepared by standard methods as described previously ( Sambrook and Russell, 2001 ) with the following modifications for optimization. Cells

PAGE 43

43 from a 5 ml overnight culture were pelleted and washed with DNA grade water. Cell were lysed by vortexing with acid washed glass beads (150 212 m in diameter, Sigma Aldrich, St. Louis, MO ) with equal volumes phosphate buffer (120 mM K 2 PO 4 pH 8.0) and wa ter saturated phenol, pH 8.0 (Fisher Scientific, Atlanta, GA ). The mixture was vortexed for 15 seconds before centrifugation at 14, 500 rcf for 5 minutes. The aqueous phase was treated with RNAse A for 2 minutes at room temperature. One volume of satura ted phenol (pH 8.0) was mixed with the DNA and centrifuged at high speed for 1 minute. The aqueous phase was mixed with one volume of phenol:chloroform:isoamyl alcohol (25:25:1, pH 8.0, Fisher Scientific, Atlanta, GA ) and centrifuged at high speed for one minute. The aqueous phase was mixed with one volume of chloroform:isoamyl alcohol (24:1) and centrifuged for one minute yielding an aqueous containing protein free DNA. 0.34 volumes of 3.0 M sodium acetate (pH 5.2) and 3.5 volumes of isopropanol were ad ded and inverted until DNA was visible. DNA was spooled with a plastic pipette tip and transferred into a new microcentrifuge tube and left to air dry. 0.1 volumes of 3.0 M sodium acetate (pH 5.2) and 3 volumes of ice cold absolute ethanol were added to dried DNA and placed at centrifuged at 10,000 rcf for 10 minutes and supernatant was discarded. The DNA was then washed twice with ice cold 70% ethanol in the same manner as above. After the second wash, precipit ated DNA was dried completely and was stored at used. Genomic DNA was reconstituted in 50 100 L of DNA grade water (Fisher Scientific, Atlanta, GA ) Genomic DNA from Serratia marcescens PDL100 and coral commensal bacteria was also isolated using the GenElute Bacterial Genomic DNA kit (Sigma Aldrich, St.

PAGE 44

44 Louis, MO ). Total genomic DNA was eluted in a total of 400 l DNA grade water and stored at 20C. Polymerase Chain Reaction (PCR) Polymerase chain reaction (PCR) was routinely performed to amplify DNA fragments using plasmid DNA, genomic DNA or individual bacterial colonies as a template. Individual PCR reactions were prepared using the following recipe: per 25 l reaction, 1x NEB Standard Taq buff er with MgCl 2 200 M dNTP mix, 0.5 M forward primer, 0.5 M reverse primer, 0.625 units/l Taq polymerase enzyme. For PCR reactions using isolated DNA as a template, 1 l of DNA was added to each reaction. For colony PCR, individual colonies were light ly picked from a plate and patched onto an agar plate with appropriate antibiotics and then added to the PCR reaction mix. Standard PCR reactions were routinely subjected to the following cycle conditions: 1 cycle at 95C for 5 minutes; 35 c ycles of 95C for 1 minute, 53C for 1 minute, 72C for 2 minutes; final extension of 72C for 10 minutes. Extension times were modified based on the expected product size. Generic Cloning Restriction enzymes, T4 DNA ligase, and Taq Polymerase were purchased from New England BioLabs (Ipswich, MA) and used as recommended by the supplier. Plasmid DNA was routinely isolated using QIAprep spin mini prep kit (Qiagen, Santa Clarita, CA). DNA was eluted in DNA g rade water and the plasmid DNA concentration was measured on a N anod rop spectrophotometer PCR products were routinely cloned into pCR2.1 TO PO TA (Invitrogen, Carlsbad, CA ) according to the the construct was digested with EcoRI (for bi directional cloning) or EcoRI/SalI (for directional cloning)

PAGE 45

45 for a minimum of four hours or overnight at 37 C using NEB 10x Buffer 3. Recipient vectors were digested in the same enzymes in parallel. If only one enzyme was used (bi dir ectional cloning), the recipient vector was treated with calf intestinal phosphatase (CIP) enzyme to inhibit downstream self ligation. R estriction fragments were excised and eluted in DNA grade water from 0.9% agarose gels in 1x TAE buffer by utilizing t he Illustra DNA and gel band purification kit (GE Healthcare, Buckinghamshire, UK). All ligation reactions were conducted at 14C for a minimum of four hours unless otherwise specified. Ligation reactions between recipient vector and insert fragments we re set up as follows: (1) 1:1 Vector: Insert; (2) 1:0 Vector:Insert to control for self ligation of the vector; (3) 1:1 no ligase Vector:Insert to control for undigested vector. After incubation, ligations were transformed into E. coli for maintenance of the plasmid. DNA Transformation Methods Chemically Competent Transformation Chemically competent cells were routinely made using the Inoue Method resulting in a transformation efficiency of 1.12 x 10 8 ( Inoue et al., 1990 ) Briefly, overnight cultures of E. coli DH5 or E. coli DH5 pir were grown in LB, subcultured 1/500 into SOB broth (per liter: 2.0% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl 2 10 mM MgSO 4 pH 6.7 7.0, Fisher Scientific, Atlanta, GA ) and grown at 18 C to an OD 600 of 0.3. Cells were washed twice with TB (per li ter: 10 mM PIPES; 55 mM MnCl 2 ; 15 mM CaCl 2 ; 250 mM KCl; pH 6.7) on ice and pelleted at 2500 x g for 10 were then resuspended in TB and DMSO was added to a final concentration of 7%. Cells were aliquoted and flash frozen with liquid nitrogen and stored at

PAGE 46

46 Electrocompetent Transformation Strains of E. coli were readily made electrocompetent for easy transfer of DNA between hosts. Overnight cultures were grown in LB, incubated on ice for 15 minutes and washed three times in ice cold sterile DNA grade water (Fisher Scientific) by centrifugation at 10,000 x g and washed cells were resuspended into 500 l of ice cold DNA grade water. Resuspended cells (50 l ) were added to a pre chilled electroporation cuvette with a 2 mm diameter (Eppendorf) and mixed with 3 l of plasmid DNA. The cuvette was dried thoroughly with a chem wipe and pulsed (25 F, using a Bio Rad MicroPulser (Bio Rad Laboratories, Hercules, CA) Pulsed cells were recovered in 1 ml NZY+ (per liter: 10 g NZ amine, 5 g yeast extract, 5 g NaCl, 12.5 mM MgCl 2 and 2.5% w/v Glucose) and incubated at 37 C for 60 minutes. After incubation, cells were pelleted at 10,000 x g for 1 minute and resuspended in 100 l of supernatant and plated onto LB agar supple mented with appropriate antibiotics. Methods were optimized to induce electrocompetency in Serratia marcescens PDL100. The same protocol was followed for E. coli as described above with the following modifications. After incubation of the culture on ice for 15 minutes, cells were washed three times in ice cold 300 mM sucrose solution ( Choi et al., 2006 ) Recovered cells were incubated in NZY+ for 60 minutes at 30 C and routinely plated onto marine agar supplemented with appropriate antibiotics. Tri Parental Conjugation Efficiency of DNA transformation by electroporation with S. marcescens PDL100 was low as compared to E. coli Therefore, tri parental conjugation was routinely used to facilitate plasmid transfer from an E. coli host to S. marcescens PDL100. E. coli DH1

PAGE 47

47 harboring plasmid pRK600 (which encodes tra genes for DNA transfer) was used a to be transferred was harbored in either E. coli DH5 or DH5 pir. Individual cultures of each strain (donor E. coli S. marcescens PDL100) were grown from glycerol stock in LB with appropriate antibiotics. After overnight incu bation, 1 ml of cells were pelleted at 11,000 x g for 1 minute and washed three times in sterile LB without antibiotics. After washing, cells were resuspended in 5 ml of LB without antibiotics and E. coli strains were incubated at 37 C at 220 rpm for 2.5 hours followed by 30 minutes at 37 C statically. S. marcescens PDL100 was incubated at 30 C at 220 rpm for 3 hours. After incubation, the cultures were mixed 1:1:1, 1:2:1, and 2:1:1 (Donor:Recipient:Helper) and pelleted at 11,000 x g for 1 minute. The p ellet was resuspended in 100 l of LB and cells were spotted onto the center of an LB agar plate and incubated at 30 C overnight. Following overnight incubation, cells from the mating spot were quad streaked onto LB agar with appropriate antibiotics to al low for growth of only S. marcescens PDL100 harboring the desired plasmid. Plates were incubated at 30 C and individual colonies were tested by PCR to confirm presence of the plasmid. Phage Mediated Transduction To transfer a muta tion form one strain of E coli to another, generalized transduction using phage P1 was performed as described in ( Lennox, 1955 ; Ikeda and Tomizawa, 1965 ) To prepare cell lysates specific to each mutation the individual mutant donor strain was grown in 5 ml LB at 250 rpm at 37 C overnight. Form the overnight culture, 50 l were inoculated into each of four 5 ml LB tubes supplemented with 0.2% glucose, 5 mM CaCl 2 and 100 mM MgSO 4 The subcultures were incubated

PAGE 48

48 for 30 minutes at 37C at 250 rpm to an approximate OD 600 of 0.1. Leaving one tube as a n egative control, P1 phage was added to the remaining tubes (20 l, 50 l, and 100 l respectively). Tubes with phage were incubated for 2 3 hours at 37C until cell lysis occurred compared to the negative control tube. 100 l of chloroform were added to the tube with the most efficient cell lysis and mixed by votexing. The culture was centrifuged at 16,000 x g for 10 minutes to pellet the cellular debris and the supernatant was transferred to a sterile glass screw top vial for storage at 4C. Mutations w ere transduced using pre made cell lysates and growing the recipient strain of E. coli in 5 ml LB overnight at 37C The culture was pelleted at 16,000 x g for 10 minutes and resuspended in 2.5 ml MC buffer (10 mM MgSO 4 and 5 mM CaCl 2 ). Into microcentrif uge tubes (five tubes total), 100 l of resuspended cells and P1 cell lysate were added as shown in Table 2 1 The microcentrifuge tubes were incubated at 30C statically and then 200 l of 1 M sodium citrate were added to each tube followed by 1 ml LB an d tubes were incubated at 37C for 1 hour. After incubation, the tubes were pelleted at 6,000 x g for three minutes and the pellet was resuspended into 100 l LB with 100 mM sodium citrate, plated onto LB agar with the appropriate antibiotics and incubate d at 37C. RNA Isolation and Quantitative PCR RNA Isolation Total RNA was extracted from overnight cultures of S. marcescens PDL100 (OD 600 = 1.1) using a GenElute Total RNA Purification Kit (Simga Aldrich, St. Louis, MO). 700 l of culture were pelleted a t 5,000 x g for 5 minutes and the supernatant was and incubated at room temperature for 10 minutes. After incubation 500

PAGE 49

49 solution/ and the mix was immediately vortex ed for 5 seconds to mix thoroughly. The resulting lysate was p ipetted into a GenElute filtration column and centrifuged at 14,000 x g for two minutes. This step removes cellular debris and shears DNA. The column was discarded and the flow through was retained and mixed with 350 l 95 100% reagent ethanol by vortexing briefly. To isolate the RNA, 700 l of the lysate/ethanol mixture w as added at a time to the GenElute binding column. The columns were centrifuged at 16,000 x g for 15 seconds, the flow through was discarded and the remaining lysate/ethanol mix was applied. Then 500 l of Wash solution 1 was added to the column and cent rifuged at 16,000 x g for 15 seconds followed by a wash with 500 l Wash solution 2 (ethanol added) and a second wash with Wash solution 2. After the final wash, the column was centrifuged for 2 minutes to dry the column of excess ethanol. The column was then transferred to a clean collection tube and the RNA was eluted into 50 l of RNA grade water (Fisher Scientific, Atlanta, GA ) by incubating the column at room temperature for one minute and centrifugation at 16,000 x g for one minute. The eluted RNA concentration was immediately quantified on the Nanodrop spectrophotometer. RNA was then stored at 80 C until further use. DNAseI Treatment and cDNA Synthesis DNA contamination was removed with a DNA Free Kit (Applied Biosystems, Carlsbad, CA). To puri fied RNA, 0.1 volume of 10 DNAseI Buffer and 1 l of rDNAseI enzyme was added and the reaction was incubated at 37C for 60 minutes. To the digestion reaction, 0.1 volume of resuspended DNAse inactivation reagent was added and the reaction was mixed well, incubated at room temperature for 2 minutes with occasional mixing. The reaction was centrifuged at 10,000 x g for 1.5 minutes to pellet

PAGE 50

50 the DNAse and other reagents. The supernatant containing the DNA free RNA was transferred to a new tube and used as template for cDNA sysnthesis. cDNA was synthesized using iScript cDNA sysnthesis kit (Bio Rad, Hercules, CA). Prior to setting up synthesis reactions, all compoentents of the kit were defrosted and mixed well and held of ice. Up to 1 g of RNA was added to each 20 l reaction containing 1x cDNA synthesis mix and 1 l reverse transcriptase enzyme in a 200 l reaction tube. The reactions were vortexed gently and centrifuged briefly to collect the contents. Reaction tubes were placed in an MJ Mini thermoc ylcer (Bio Rad, Hercules, CA ) and subjected to the following cycle conditions: 1 cycle at 22C for 5 minutes; 1 cycle at 42C; 1 cycle at 85C for 5 minutes. The reactions were held at 4C until quantitative real time PCR reactions were set up. Quantitati ve Real Time PCR Quantitative PCRs were performed in a reaction volume of 50 l containing 1x iQ SYBR Green Supermix (Bio Rad, Hercules, CA), 200 nM each forwa rd and reverse primers and 5 ng of cDNA. DNA concentrations were determined with the Nanodrop spectrophotom e ter. Amplification and detection of DNA were performed in four biological replications and two technical replicates for each biological replicate with the iCycler detection system (Bio Rad) with optical grade 96 well PCR plates and optical film. The reaction conditions were 50 C for 2 minutes and 95 C for 10 minutes, followed by 45 cycles of 95 C for 15 seconds and 60 C for 1 minute. Data analysis was conducted with the software supplied by Bio Rad and data are presented as fold change in expression based on the comparative C T method using 16S rRNA gene expression as a reference ( Livak and Schmittgen, 2001 ; Schmittgen and Livak, 2008 )

PAGE 51

51 Table 2 1. E. coli generalized transduction mix Microcent rifuge Tube Cells P1 lysate 1 2 3 4 5 0.1 ml 0.1 ml 0.1 ml 0.1 ml ------20 l 50 l 100 l 100 l

PAGE 52

52 CHAPTER 3 Aiptasia pallida : A SURROGATE MODEL POLYP SUSCEPTIBLE TO INFECTIONS WITH CORAL OPPORTUNISTIC PATHOGENS Introduction Several pathogens of c orals were recently identified (e.g., Kushmaro et al., 2001: V. shiloi ; Ben Haim and Rosenberg, 20 02: Vibrio coralliilyticus ; Patterson et al., 2002: Serratia marcescens ) It appears that most coral pathogens are opportunistic, causing infections in hosts that are stressed. Because of the inherent logistical difficulties with re fully for only some of presumed etiological agents. Serratia marcescens is one of the better characterized opportunistic pathogens of Caribbean corals ( Patterson et al., 2002 ; Sutherland et al., 2004 ; Krediet et al., 2009b ; Krediet et al., 2009a ; Sutherland et al., 2011 ) In the late 1990s, S. marcescens PDL100 was associated with the appearance of the signs of the white pox disease, a coral tissue necrosis, which progresses rapidly (at a rate of 2.5 cm day 1 ) exposing the coral calcium carbonate skeleton ( Patterson et al., 2002 ) Of note, another clone of S. marcescens was recovered fro m white pox lesions more recently ( Sutherland et al., 2010 ; Sutherland et al., 2011 ) Therefore it appears that multiple strains of S. marcescens likely derived from human or animal wastes are capable of causing tissue necrosis in the Caribbean coral Acropora palmata Interactions of vibrios with corals are more nuanced. They are ubiqu itous in the ocean are commonly recovered from the surface mucopolysaccharide layer of asymptomatic corals. In corals, vibrios have been linked to diseases that involve loss of the endosymbiotic algae with resulting bleaching signs. Vibrio shiloi AK1, for example, has long been associated with bleaching in Mediterranean corals through inhibition of photosynthesis and lysis of Symbiodinium cells during periods of elevated sea surface

PAGE 53

53 temperatures ( Kushmaro et al., 2001 ; Rosenberg and Falkovitz, 2004 ) Interestingly, interactions of V. shiloi with its winter host, fireworm Hermodice carunculata appear to be commensal ( Sussman et al., 2003 ) V. shiloi can reach up to 10 8 cfu per worm, although the majority of cells are in a viable but non culturable (VBNC) state ( Sussman et al., 2003 ) Infections of corals with Vibrio coralliilyticus lead to bacterially induced bleaching ( Ben Haim et al., 2003b ) and white syndrome of Indo Pacific corals ( Sussman et al., 2008 ) V. coralliilyticus produces an impressive suite of proteases ( Kimes et al., 2011 ) The zinc metalloprotease produced at warm temperatures (>26C) is the primary virulence factor leading to the signs of the white syndrome, which include inhibition of the photosystem II of Symbiodinium paling of coral tissue, and the spread of coral tissue lesions culminating in mortality ( Sussman et al., 2009 ) While at 24 26C proteases of V. coralliilyticus appear to target primarily the coral symbiotic dinoflagellates, at 27 29C coral tissue is the primary target with tissue necrosis as the only ob servable disease sign ( Ben Haim et al., 2003a ) Similar temperat ure sensitive proteases have been shown to disrupt photosynthesis. Although the exact mechanism by which these proteases inhibit photosystem II of Symbiodinium remains unclear, it resembles the effect of thermolysin of Bacillus termoproteolyticus on the o uter envelope membrane of chloroplasts ( Cline et al., 1984 ) and a ToxB protein produced by the fungal wheat pathogen, Pyrenophora tritici repentis which inhibits photosynthesis and results in chlorosis ( Kim et al., 2010b ) In addition to being able to cause coral diseases individually, vibrios form polymicrobial consortia described as C aribbean Yellow Band Disease (CYBD). CYBD is well documented in Montastraea spp. around the greater Caribbean ( Weil et al.,

PAGE 54

54 2008 ) and manifests as pale yellow blotc hes or bands that spread over the surface of the coral ( Cervino et al., 2004 ) Cervino et al ( 2008 ) ide ntified a core Vibrio group consistently associated with CYBD in affected colonies. However, sequencing of culturable vibrios from both asymptomatic and diseased colonies did not demonstrate the presence of this core group in the diseased colonies and ab sence from healthy corals ( Cunning et al., 2008 ) Although differences in the dominant Vibrio strains were observed in pooled samples, there was inconsistency between individual sam ples within groups ( Cunning et al., 2008 ) Thus, it appears that the outcome of the interactions of corals with environmental vibrios may depend on the numbers of the bacteria, stress status of the host and the integri ty of the associated commensal microbiota. When any or all of these factors are outside the stable equilibrium, various vibrios collectively or resulting in the disease signs ( Cervino et al., 2008 ; Cunning et al., 2008 ) It is clear that the prevalence and frequency of coral diseases are increasing but our understanding of the mechanisms by which pathogens infect corals is still fairly limited. Even though much progress has bee n made in understanding interactions between various corals and their pathogens the model systems approach has not been adapted to the field of coral biology. Because recent progress in the fields of molecular, cell, and developmental biology is largely due to the intense study of a few well characterized model organisms ( Davis, 2004 ) Weis et al. ( 2008 ) nominated sea anemone Aiptasia pallida as a model organism for studying various aspects of coral genetics and physiology, including symbiotic interactions with the dinoflagel l ate partner Symbiodinium Like the major reef building corals, Aiptasia is an anthozaon that is also

PAGE 55

55 symbiotic with di noflagellates of the genus Symbiodinium ( Santos et al., 2002 ) Unlike corals, Aiptasia polyps are fast growing and a re tolerant of a variety of conditions ( Veron, 2000 ) While the availability of natural corals for study in the laboratory is rapidly declining, Aiptasia can be grown in large numbers. Clonal populations of Aiptasia (e.g. CC7) are available, which allow for genetic manipulation with greater ease ( Veron, 2000 ; Vollmer and Palumbi, 2002 ) including a recent generation and analysis of the A. pallida transcriptome ( Sunagawa et al., 2009a ) In the current study, we aimed to test the suitability of Aiptasia pallida as a model organism for the study of coral infection by opportunistic pathogens. We tested the hypothesis that mono microbial infections by known pathogens could cause the same disease symptoms and signs in the polyp model as they do on their respective coral hosts. Materials and Methods Aiptasia pallida H usbandry An initial stock of Aiptasia pallida clonal strain CC7 was generously provided by Dr. John Pringle (Stanford University). Polyps were maintained in 10 gallon saltwater aquaria of artificial seawater (ASW; Red Sea Coral Pro Salt, Eilat Israel) fitted with activated carbon filters at ambient temperature (~22C) under blue actinic (460 nm) and super daylight white 6500 k fluorescent bulbs on a 12 hour:12 hour light:dark cycle. Tank salinity was maintained between 32 and 34 ppt. Polyps were fed weekly with Artemia (brine shrimp) nauplii hatche d u nder the laboratory conditions. Glass surfaces of the aquaria were the only substratum for the attachment of polyps.

PAGE 56

56 Bacterial Strains and Culture C onditions Three individual coral opportunistic pathogens were used in this study. All strains were obta ined from ATCC. Serratia marcescens PDL100, Vibrio coralliilyticus and Vibrio shiloi AK1 were routinely cultured in marine broth or on marine agar plates (Becton, Dickenson, Franklin Lakes, NJ) at 30C, with shaking at 250 rpm for broth cultures or stati cally for plates. Unless otherwise specified, S. marcescens PDL100 cultures were supplemented with tetracycline (Tc) 10 g ml 1 Aiptasia pallida I nfections wit h Coral Opportunistic P athogens Individual polyps (stalk length approximately 1 cm) were tran sferred from the stock tanks into wells of six well plates (Corning Scientific, Corning, NY) with 10 ml of filter sterilized (0.22 m) ASW. At least three polyps were used per treatment. Polyps were acclimated in the wells for 24 hours at room temperatur e on a tabletop rotary shaker at 70 rpm. Four routes of infection were tested: injecting the suspension of the pathogen into the mouth of the animal, feeding it brine shrimp pre infected with the pathogen, wounding prior to the infection and inoculating t he water in which the animals were cultured. For inoculations with individual coral pathogens, overnight cultures grown in marine broth were washed three times in filter sterile ASW and diluted to approximately 10 8 10 7 and 10 6 cfu ml 1 ; the water in the wells was replaced with 10 ml of these suspensions. For un infected polyps, the well water was replaced with 10 ml of filter sterile ASW. The polyps were monitored for disease signs and were photographed daily with a Cannon Eos Rebel Xsi digital camera. Images of polyps presented were corrected in Adobe Photoshop using auto default settings. Kaplan Meier survivorship analyses were

PAGE 57

57 performed for each infection using JMP 9.0 Pro statistical software (SAS Institute Inc., Cary, NC) and m ortality across treatments was compared with a Cox proportional haza rds chi 2 ) model ( Hosmer and Lemeshow, 1999 ) Results Aiptasia pallida I nfections with S. marcescens PDL100 Four infection routes were tested. Wounding of the polyp did not appear to increase its susceptibility to the pathogen. When bacterial suspen sions were directly injected into the mouth of the animal, the polyp immediately expelled bacteria Infections of the polyps using brine shrimp as vectors of pathogens were not easily reproducible. Of the four routes of infection tested, we chose to proc eed with directly inoculating pathogens into the seawater, in which the animals were maintained. Un infected polyps could be maintained in 10 ml of se a water in the six well plates at room temperature for up to two weeks without a water change (data not sh own). A total of 45 A. pallida polyps were used to test the virulence of S. marcescens PDL100 over a seven day period. Polyps were scored daily for disease signs or mortality (Figure 3 1A). After 24 hours of incubation at the highest concentration (10 8 c fu ml 1 ) the polyps compressed their stalk length, retracted their tentacles and exhibited darkening of the tissue. These responses were seen to a lesser degree at the 10 7 cfu ml 1 treatment and rarely at the 10 6 cfu ml 1 concentration (Figure 3 1A). The differences in survivorship between the different treatments were statistically significant 2 =38.60; dF=4; p<0.0001, Figure 3 2A). From these results the estimated LD50 is ~5 x 10 7 cfu ml 1 for S. marcescens PDL100. As S. marcescens PDL100 is a necrotizing pathogen, mortality was defined as complete degradation of the Aiptasia polyp.

PAGE 58

58 After some of the infection studies, polyps were macerated and tissue homogenate was dilution plated onto marine agar and DNAse Toludine Blue Agar (DTB Agar) supplemented with 0.25% deoxycholic acid (bile salts) to re isolate S. marcescens from dead polyps and the water in which the polyps were maintained. Colonies of S. marcescens routinely formed on marine agar plates incubated overnight at 30C but no t on the selective media. It is possible that S. marcescens recovered from the polyp is in the physiological state that makes it more susceptible to the biocidal bile that is added to the selective media. Aiptasia pallida I nfections with Vibrio spp. I ndividual polyps were infected with V. coralliilyticus and V. shiloi AK1. Six polyps were infected at each concentration of bacterial culture (10 6 10 7 and 10 8 cfu ml 1 ) with uninfected animals as negative controls. As with S. marcescens infection, the polyps responded to Vibrio infection through increased melanin production (darkening of the tissue), retraction of tentacles, and mortality (defined as polyp tissue degradation by the pathogen). Although both V. coralliilyticus and V. shiloi AK1 are assoc iated with bacterial bleaching in corals, no bleaching signs were observed in the A. pallida polyps post infection at any of the tested concentrations (Figure 3 1B). V. shiloi infections were only carried out for three days due to complete mortality of th e polyps infected at the highest concentration. Even though the infection was only carried out for a short period, the overall survivorship trend for polyps infected with V shiloi matched those of V. coralliilyticus and S. marcescens PDL100 infected poly ps (data not shown). In polyps infected with V. coralliilyticus 100% of polyps infected at 10 8 cfu ml 1 succumbed to infection by day three and at the 10 7 cfu ml 1 concentration, 50% of the population were still alive at day seven but all polyps were los t by day thirteen (Figure 3 2B).

PAGE 59

59 Survivorship analysis indicated that while the two higher concentrations resulted in 2 =37.95; dF=3; p<0.0001, Figure 3 2B). Discussion The opportunistic pathogens used in this study are capable of infecting corals and other animals. For example, isolates of Serratia have also been linked to diseases of inverte brate animals and their larvae (rev. Kurtz and Franz, 2003 ; Grimont and Grimont, 2006 ; Nehme et al., 2007 ) To cause disease in the nematode Caenorhabditis elegans and the fruit fly Drosophilia melanogaster S. marcescens first colonizes the intestine s, degrades cells of the alimentary tract, and then spreads to other organs ( Kurz and Ewbank, 2000 ; Ku rz et al., 2003 ; Nehme et al., 2007 ) There are exceptions to this mode of infection. S. entomophila the causal agent of amber disease in grubs, grows within the alimentary tract of the animal to greater than 10 6 cfu. The bacteria do not attach to nor colonize the surfaces of the gut, but rather, they adhere to the gut contents ( Jackson et al., 2001 ) How Serratia establi shes on polyp surfaces and causes the di sease is not yet known. The establishment of A. pallida as a model for coral tissue necrosis caused by S. marcescens is likely to significantly advance our understanding of the disease mechanisms in this multi host opportunistic pathogen. Members of the genus Vibrio also show a wide range of associations with human and animal hosts. Vibrio coralliilyticus in addition to infecting corals, also causes disease in many fish species, including rainbow trout, and in Art emia nauplii ( Austin et al., 2005 ) After infection with the pathogen, fish developed severe muscle tissue necrosis with hemorrhaging and infected Artemia died ( Austin et al., 2005 ) In coral infections, V. coralliilyticus is known to produce a zinc metalloprotease as a virulence

PAGE 60

60 factor that is required for virulence ( Sussman et al., 2009 ) Other Vibrio pathogens also produce this virulence factor, but recent evidence has shown that in V. vulnificus which produces sepsis and wound infections in humans after consumption of uncooked, contaminated seafood ( Gulig et al., 2005 ) the produced metalloprotease is not essential for virulence in an iron dextran treated mouse model ( Shao and Hor, 2000 ; Cerveny et al., 2002 ; Brown and Gulig, 2008 ) From the discussion of known pathogens used in model organism infection studies, it should be clear that the bacterial pathogens do not elicit the same responses in each host and that no one model organism is able to mimic the response of t he host absolutely. Vibrio cholerae colonizes the human small intestine and causes a life threatening diarrheal disease, cholera. Normal adult mammals (except for humans) are not colonized by V. cholerae but the pathogen is able to colonize the small int estine of many suckling mammals, including mice ( Klose, 2000 ) Recent work by Olivier and colleagues ( 2009 ) has demonstrated that V. cholerae can colonize the small intestine of adult mice but that colonization is dependent on anesthesia with ketamine xylazine and neutralization of the stomach acid with sodium bicarbonate but not streptomycin treatment. It is clear that the pathogen ic vibrios do not elicit the same signs in each host and that no one model organism is able to mimic the response of all hosts absolutely. As the fields of cnidarian dinoflagellate symbiosis biology and coral disease ecology continue to progress, the nee d for a reliable surrogate host is ever present. In this study, we attempted to contribute to the establishment of A. pallida as a model for coral molecular biology and microbiology. A. pallida appear to be susceptible to

PAGE 61

61 infection by coral opportunistic pathogens and polyps exhibit similar disease manifestations in a similar dose dependent manner. Further studies using this surrogate host will surely enhance our understanding of the mechanisms by which opportunistic pathogens attach to, colonize, and in fect their invertebrate hosts.

PAGE 62

62 Figure 3 1. Infections of Aiptasia pallida polyps with individual pathogens. Individual A. pallida were first acclimated in 10 ml filter sterile artificial seawater (ASW) for 24 hours in a sterile 6 well polystyrene plate. Then ASW in the wells was exchanged with sterile ASW (controls) or bacterial suspensions in ASW (10 6 10 8 cfu ml 1 ) of either A) Serratia marcescens PDL100 or B) Vibrio coralliilyticus (n=6 for all treatments). Infections were carried out for seven days at room temperature and polyps were monitored and photographed daily and representative animals are shown.

PAGE 63

63 Figure 3 2. Survivorship of A. pallida polyps infected with individual p athogens. Each line represents the proportion of polyps surviving at each concentration (10 6 cfu ml 1 10 7 cfu ml 1 10 8 cfu ml 1 or control as shown in the key). Survivorship decreased significantly with increasing pathogenic concentration for polyps i nfected with A) S. marcescens PDL100 ( 2 =38.604, dF=4, p<0.0001) and B) V. coralliilyticus ( 2 =37.951, dF=3, p<0.0001).

PAGE 64

64 CHAPTER 4 MEMBERS OF NATIVE CORAL MICROBIOTA THWART COLONIZATION OF CORAL MUCUS BY AN OPPORTUNISTIC PATHOGEN Introduction The founda tion of reef ecosystems is the coral holobiont: a dynamic symbiosis comprised of the coral polyp, the dinoflagellate Symbiodinium spp., and their associated microbial communities. The composition of this tripartite symbiosis determines the overall health of the coral colony and its resistance to stressors, such as diseases caused by opportunistic pathogens ( Reshef et al., 2006 ) The subject of this investigation is S. marcescens PDL100, one of the strains that causes white pox disease in Acropora palmata and is associated with anthropogenic sources ( Patterson et al., 2002 ; Sutherlan d et al., 2011 ) In order to colonize and infect the coral host, S. marcescens PDL100 must first establish within the surface mucus s ecreted by the coral. Coral mucus is a polymer made in specialized mucocytes of the polyp from the photosynthate produced by their endosymbiotic dinoflagellates and then excreted onto the coral surface ( Brown and Bythe ll, 2005 ; Bythell and Wild, 2011 ) The chemical structure of coral mucus has been solved for only several species ( Ducklow and Mitchell, 1979 ; Meikle et al., 1987 1988 ) The mucus polym er of Acropora formosa is a glycoprotein containing sulfated oligosaccharide side chains attached through O glycosidic linkages to serine and threonine, the principle amino acids in the polypeptide ( Meikle et al., 1987 ) The major sugar residues found in mucus of A. formosa are D arabinose, D mannose, N acetyl D glucosamine, and D galactose ( Meikle et al., 1988 ) Coral mucus supports growth of bacteria up to 10 6 10 8 cfu ml 1 ( Sharon and Rosenberg, 2008 ; Krediet et al., 2009b ; Garren and Azam, 2010 ) Nutrients and chemicals from the host excreted with the mucus determine the composition and structure of the associated

PAGE 65

65 microbial communities ( Ritchie, 2006 ; Garren and Azam, 2012b ) The ability to efficiently utilize carbon and nitrogen sources within mucus likely directly affects competitiveness of the microorganisms in this environment. Aside from the need to be able to grow on available substrates, successful establishment within a niche requires that microorganisms efficiently spread to the site s where nutrients are available and colonize them. Coordinated, multi cellular spreading over semi solid surfaces (swarming) is on e such mechanism of expansion and surface colonization ( Verstraeten et al., 2008 ) Swarming is often co regulated with certain metabolic pathways ( Toguchi et al., 2000 ; Wang et al., 2004 ) Global regulatory networks (GacS/GacA Csr, FlhDC FilA, and EnvZ OmpR) contribute to the regulation of both the motility and catabolism of specific carbon sources ( Park and Forst, 2006 ; Jonas et al., 2008 ; Jones et al., 2008a ; Timmermans and Van Melderen, 2010 ) This co regulation may be instrumental for the regulatory switch that contributes to the efficient establishment within a particular niche. A better understanding o f the interactions between coral commensals and opportunistic pathogens led to the appreciation of the fact that commensals have evolved to protect their nutrient niche (and the coral hosts) from the invading opportunists ( Reshef et al., 2006 ) Coral commensals produce antibiotics ( Shnit Orland and Kushmaro, 2009 ) inhibitors of cell to cell communication ( Rypi en et al., 2010 ; Tait et al., 2010 ) and currently unknown compounds capable of inhi biting swarming and biofilm formation ( Alagely et al., 2011 ) When coral commensals capable of interfering with swarming and biofilm formation i n a pathogen were pre colonized onto a model polyp, they completely inhibited the progression of a disease caused by S. marcescens

PAGE 66

66 ( Alagely et al., 2011 ) This is similar to the ability of the commensal microbiota of vertebrates to act as a barrier to colonization and infection by pathogens ( Leatham et al., 2009 ) With this study we aimed to test whether the ability of the native commensal microbiota to inhibit specific catabolic enzymes in the c oral pathogen S. marcescens will disrupt the ability of the pathogen to establish within coral mucus. S. marcescens PDL100 possesses a broad suite of catabolic enzymes. While many of the tested glycosidases are accumulated apparently constitutively, D galactosidase, N acetyl glucosaminidase, and D glucopyranosidase were differently accumulated when the pathogen was grown on mucus ( Krediet et al., 2009a ) The upregulation of these enzymatic activities is consistent with the structu ral composition o f mucus of A croporid corals. The over arching hypothesis was tested with a three step experiment: first, a Serratia mutant defective in mucus utilization was identified to test the role of specific catabolic enzymes in growth on mucus; se cond, coral commensals capable of inhibiting specific enzymatic activities were identified; third, interactions of S. marcescens with the commensals were tested in mesocosm experiments. Materials and Methods Bacterial Strains, Media, and Growth Conditions Bacterial strains used in this study are listed in Table 4 1. Coral associated bacteria were isolated from mucus of Acropora palmata by dilution plating onto Glycerol Artificial Sea Water medium (GASW: Smit h and Hayasaka, 1982 ; Smith et al., 1982 ) as in ( Ritchie, 2006 ) The identities of the marine isolates were confirmed by first PCR amplifying fragments of their 16S rRNA genes as previously described ( Alagely et al.,

PAGE 67

67 2011 ) Data are deposite d in GenBank (Accession numbers JQ954975; JQ954976 ; JQ954977; JQ954978; JQ954979; JQ954980 ). S. marcescens PDL100 and coral commensal bacteria were routinely grown at 30 C on the GASW medium or marine broth (Difco Becton, Dickinson and Company, Franklin Lakes, NJ ); E. coli strains were grown at 37 C in Lur ia Bertani (LB) broth (Fisher Scientific, Atlanta, GA ) and when necessary on 1.5% agar plates. Swarming experiments were conducted on AB swarming agar as in ( Alagely et al., 2011 ) Unless otherwise specified, S. marcescens cultures were supplemented with tetracycline 10 g ml 1 (Tc10), to which S. marcescens PDL100 is spontaneously resistant. Coral mucus was collected from apparently healthy colonies of Acropora palmata at Looe Key Reef, Florida (24 previously described ( Ritchie, 2006 ; Krediet et al., 2009a ) Mariner Transposon Mutagenesis of Serratia marcescens PDL100 Tri parental conjugation was conducted using E. coli SM10 pir pBT20, S. marcescens PDL100 a nd the helper strain E. coli DH5 pRK600 as previously described ( Kalivoda et al., 2008 ) 1,000 colonies from each of the three independent matings were compi led into a library. This library was then screened for galactosidase activity (see below). To characterize mutants of interest, inverse PCR (iPCR) of DNA sequences flanking the transposon insertion wa s performed ( Ochman et al., 1988, see Appendix ) To confirm that the transposon mutation in CK2A4 was involved with the maltose transport, malEFG operon, enzymatic activity in CK2A4 was compared to individual knockout deletion mutants in E. coli Individual E. coli BW2 5113 mutants were obtained

PAGE 68

68 through the Keio Collection ( Baba et al., 2006 ) and each of the mutants was transduced into strain W3110 ( lac + ) using phage P1 ( Lennox, 1955 ; Ikeda and Tomizawa, 1965 ) galactosidase Activity Assays Independent screens were conducted either with a libr ary of transposon mutants or with coral commensals. The ability of the commensals to inhibit galactosidase in S. marcescens PDL100 was tested by co inoculating coral commensals with PDL100 in 0.3% marine agar in 96 well plates supplemented with 5 bromo 4 chloro indolyl D galactopyranoside (X gal) at 40 g ml 1 (Gold Biotechnology, St Louis, MO ). Plates were incubated at 30 C overnight, and were monitored for blue color. Interesting candidates were re tested in cross streaks on marine agar. Inhibitory capabilities of the coral commensal strains were tested against PDL100 in galactosidase assays through co incubation of S. marcescens in the spent cell free culture supernatants of coral commensals. The ability of the cell free supernatants to inhibit the E. coli galactosidase enzym e (Sigma Aldrich, St. Louis, MO ) was tested ( see Appendix ). Individual transposon mutants we re assayed in soft marine agar with X gal and were monitored for blue color development. Those mutants deficient in galactosidase activity compared the wild type were isolated to single colony on X gal containing media and then assayed quantitatively ag ainst the wild type using ONPG ( Miller, 1972 ) Competitive Fitness Assays Overnight cultures of S. marcescens PDL100 and CK2A4 were grown from glycerol stock in marine broth to an approximate OD 600 of 1.7 and cultures were serially diluted and mixed 1:1. Strains were in oculated individually or as a mix at starting concentrations of 10 2 cfu ml 1 into filter sterilized coral mucus, high molecular weight fraction of coral mucus from A. palmata and an artificial seawater (ASW) based

PAGE 69

69 casamino acids/glycerol media (in ASW: 0. 05% Casamino acids, 0.4% glycerol, 10 mM HEPES, pH 7.1). All cultures were grown in triplicates. For enumeration, cultures were dilution plated at 0, 12, 24, 48, 72, and 96 hours on marine agar supplemented with Tc10. All assays on each medium were repe ated at least twice. To distinguish between the wild type and the mutant, individual colonies were patched onto selective media with Tc10 and gentamycin (Gm) 50 g ml 1 For the three strain competition assay, S. marcescens PDL100, CK2A4 and commensals wi th galactosidase inhibitory properties, strains were grown individually in marine broth overnight and diluted as above. Serratia were inoculated at 10 2 cfu ml 1 and the cocktail of the six inhibitory coral commensals was inoculated at 10 4 cfu ml 1 into high molecular weight coral mucus from A. palmata Competitive indices were calculated for each treatment using the formula (M out /WT out )/(M in /WT in ), where M is the proportion of mutant cells and WT is the proportion of wild type cells in the inocula ( in ) or in the recovered samples ( out ). Statistical significance of each competitive index was established by comparing log values of the competitive indices using a two tailed t test. Preliminary Characterization of Inhibitory C ompounds in Exiguobacterium sp. 33G8 Potential antibiotic production by the coral commensal strains was tested by filling agar cores of the commensal strains into semi solid marine agar (0.5%) seeded with PDL100. The co inoculated strains were incubated at 30 C overnight and monitored for inhibition of growth in PDL100. Enzymatic inhibition of galactopyranosidase, N acetyl D glucosaminidase, and D glucopyranosidase activities in PDL100 by coral commensal bacteria were tested through co incubation of the strains using dialysis pouc hes. Cellulose ester dialysis

PAGE 70

70 membrane (MWCO: 1,000,000) stored in 0.05% sodium azide (Spectrum Laboratories, Inc., Rancho Dominguez, CA ) was cut into 10 cm strips and washed in sterile DI water (10 water changes) at 4 C. S. marcescens PDL100 was grown f rom glycerol stock in 5 ml marine broth and then subcultured into 100 ml marine broth. Exiguobacterium sp. 33G8 was grown from glycerol stock in 5 ml of marine broth overnight at 30 C and subcultured into 100 ml of sterile marine broth. After overnight i ncubation, the OD 600 of PDL100 was 0.7 and Exiguobacterium 33G8 was at 1.8. The PDL100 culture was concentrated to an OD 600 of 1.2 and 5 ml of these cells were transferred into the dialysis pouches. The entire 100 ml culture of Exiguobacterium 33G8 was t ransferred into 500 ml of sterile marine broth. A dialysis tube containing PDL100 cells was placed into the 33G8 culture and into a flask of sterile marine broth as a control. The co cultures were incubated at 30 C for six hours and enzymatic activities of all three enzymes in PDL100 were measured at the beginning of the experiment and six hours later using nitrophenyl substrates as in ( Miller, 1972 ) In order to begin to determine the type of inhibitory activity produced by Exiguobacterium sp. 33G8 in co culture, cell free supernatant from the Exiguobacteriu Serratia co incubation experiment was subjected to flash ion exchange chromatography (DOWEX 50 W, Sigma Aldrich, St. Louis, MO ) and the flow through was then subjected to reverse phase Silica C 18 chromatography (All tech Associates, Inc., Deerfield, IL, USA) ( see Appendix ) Each of the eluted fractions was dried, re extracted as described in the Appendix serially diluted (3 fold) and then subjected to a bioassay. The highest dilution contained

PAGE 71

71 evaporated in the chamber of the Centrivap Concentr ator (Labconco, Kansa s City, MO ) at 50 C for 30 minutes. 650 l of S. marcescens PDL100 culture (OD 600 = 0.922) that had been washed in equal volume of sterile marine broth were added to each sample. Cells were incubated with the diluted fractions for six hours at 30 C and as sayed for D glucopyranosidase activity as described by ( Miller, 1972 ) Swarming Inhibition in S. marcescens PDL100 by Coral Commensal Bacteria In addition to inhibition of enzymatic activities in PDL100, coral commensal bacteria were tested for their ability to interfe re with motility in S. marcescens Cultures of individual commensal strains grown overnight in marine broth (20 l) were spotted onto a sterile glass fiber GF/C filter disk on a marine agar plate. Cultures of S. marcescens (5 l) were spotted onto an AB swarm agar plate approximately 2 cm from the commensal strain on the disk as described previously ( Alagely et al., 2011 ) For swimming motility, 5 l of each culture were stab inoculated into marine broth 0.3% agar plates 2 cm apart. Plates were incubated at 30 C overnight and photographed with a Cannon Eos Rebel Xsi digital camera. Images were corrected for auto levels in Adobe Photoshop. Vir ulence in a Sea Anemone Model I ndividual polyp infections with PDL100 wild type and CK2A4 were performed as described previously ( Krediet et al., 2012b ) The polyps were monitored for disease signs and K aplan Meier survivorship analyses were performed for each infection using JMP 9.0 Pro statistical software (SAS Institute Inc., Cary, NC) and mortality across treatments was compared with a Cox proportional hazards chi square ( 2 ) model ( Hosmer and Lemeshow, 1999 )

PAGE 72

72 Results Glycos idase and Chitinase Inhibition in S. marcescens In order to test the importance of galactosidase, N acetyl D glucosaminidase, and D glucopyranosidase for the ability of S. marcescens to utilize components of coral mucus, a transposon mutant, S. marce scens CK2A4 deficient in these activities was isolated. The characterization of CK2A4 through inverse PCR suggested that DNA sequences flanking the transposon were homologous to the malF gene (Spro_4473; base pairs 283 715) of Serratia proteamaculans In order to corroborate this observation, glycosidase and chitinase activities in E. coli W3110 and isogenic individual knockout deletion mutants in malE malF and malG were tested. The CK2A4 mutant demonstrated a decrease in the enzymatic activities for eac h of the three enzymes tested (Figure 4 1). This is similar to the phenotypes of the individual E. coli malE malF and malG mutants in which a 30 fold reduction in the activity of galactosidase and a slight decrease (1 2 fold) in D glucopyranosidase w ere observed (Figure 4 1). Note, that E. coli W3110 does not produce N acetyl D glucosaminidase (Figure 4 1). Despite a correlation of the phenotypes of the S marcescens CK2A4 and E. coli malE malF and malG mutants, attempts to complement the transposon mutant and the individual E. coli mutants with the entire 4.8 malEFG S. marcescens PDL100 genomic DNA did not restore enzymatic activities to the wild type levels (data not shown). Competitive Fitness of S. marcescens PDL100 and CK2A4 The ecological importance of galactosidase and other catabolic enzymes for utilization of coral mucus from A. palmata was tested by growing wild type PDL100 and the CK2A4 mutant on total coral mucus and high molecular weight fraction of mucus

PAGE 73

73 both individually and in a 1:1 co culture. Individual growth curves for both strains showed the same trend on total mucus and high molecular weight coral mucus (Figure 4 2A and C). Importantly, however, within the co culture, CK2A4 was not competitively fit on either total coral mucus or on high molecular weight fraction of the mucus (Figure 4 2B and D; log competitive indices 1.64 and 1.23 respectively), consistent with the predicted role of the galactosid ase, N acetyl D glucosaminidase, and D glucosaminidase enzymes in mucus degradation ( Kr ediet et al., 2009b ; Krediet et al., 2009a ) After 12 24 hours, the wild type dominated the culture and after 48 hours th e wild type held and represented ~95% of the culture. Furthermore, in the absence of the suitable substrates (i.e. when grown on casamino acids and glycerol), the CK2A4 mutant showed a slight competitive advantage (Figure 4 2F ; log competitive index 0.480). This indicates that the reduced fitness of the mutant on coral mucus is not due to a general reduction in the metabolism, but rather is due to a disruption of the specific catabolic activities required for the utilization of coral mucus. Virulence of S. marcescens PDL100 and CK2A4 in a Polyp Model Sixty nine A. pallida polyps were used to test the virulence of S. marcescens PDL100 and CK2A4 over a seven day period. After 24 hours of incubation at the highest concentration (10 8 cfu ml 1 ) the polyps compressed their stalk length, retracted their tentacles and exhibited darkening of the tissue. These responses were seen to a lesser degree at the 10 7 cfu ml 1 treatment and rarely at the 10 6 cfu ml 1 concentration in the wild type but no mortality was o bserved at the lower concentrations in CK2A4 The survivorship of the infected polyps is plotted in Figure 4 3 The differences in survivorship between the different treatments were statistically significant ( PDL100: 2 =38.60; dF=4; p<0.0001 ; CK2A4: 2 =2 8.25; dF=3; p<0.0001 ).

PAGE 74

74 Coral Commensal Bacteria Capable of Inhibiting Enzymatic Activities Limit Growth of S. marcescens in Co Culture Initial screens of a library of commensal isolates collected from Acropora palmata coral mucus revealed that approximat ely 8% of isolates are capable of inhibiting galactosidase activity in S. marcescens (Figure A 1). The competitive fitness of PDL100 and CK2A4 on high molecular weight mucus was tested in the presence of these inhibitory coral commensal strains ( Photoba cterium sp. 33G2, P. damselae 33G4, Exiguobacterium sp. 33G8, P. leiognathi 33C4, and P. leiognathi 33E3, and Vibrio harveyi 34B3). We tested the hypothesis that in the presence of the commensals that inhibit glycosidase and chitinase activities, the CK2A4 mutant will be as fit as the wild type due to the ability of the commensals to inhibit enzymatic activities in the wild ty pe. In the coral mucus co culture of Serratia with the commensals, growth of Serratia was reduced by 10 100 fold (compared to the monoculture of Serratia ; Figure 4 4A). Furthermore, the CK2A4 mutant (defective in the enzymatic activities targeted by the commensals) was more competitive against the wild type compared to the mesocosms without the commensals at 12 and 24 hours (Figure 4 2D vs 4 4B; log competitive index 0.729 vs 0.129, t 3.82 =4.769, p=0.0099). These observations suggest that the ability of commensals to specifically inhibit catabolic enzymes (glycosidases and chitinase) is at least in part responsible for the reduction in growth of S. marcescens on coral mucus in the presence of these commensals. Our subsequent experiments focused on the characterization of the activities produced by the commensals. Preliminary Characterization of Inhibitory C ompounds in Exiguobacterium sp. 33G8 Exiguobacterium sp. 33G8 strongly inhibited galactosidase activity in S. marcescens strains PDL100 and MG1 (F igure A 1) and was chosen for further

PAGE 75

75 investigation. Our experiments aimed to (a) test mode of action of the compound(s) and (b) characterize chemical properties of the activity. Reduction in enzymatic activity in PDL100 in the co culture with Exiguobacte rium sp. was first assayed by growing PDL100 in a dialysis pouch in the presence of Exiguobacterium sp. At the start of the experiment, the enzymatic activities were not significantly different between the control culture and PDL100 inoculated with Exiguo bacterium sp. (Figure 4 5). After the six hour co culture, the enzymatic activities of PDL100 in co culture were significantly reduced for each enzyme ( galactosidase: t=9.340, dF=4.2, p=0.0005; N acetyl D glucosaminidase: t=4.410, dF=3.27, p=0.0180; D glucopyranosidase: t=22.191; dF=4.34; p<0.0001; Figure 4 5). We then tested whether the substance(s) produced by the commensal directly inhibit the enzymatic activity or regulation of the enzyme synthesis. Incubation of Serratia in the cell free super natant from the monoculture of Exiguobacterium did not reduce the wild type galactosidase activity, nor did the coral commensal cultures reduce enzyme activity of a purified galactosidase from E. coli (data not shown). This indicates that the substanc e is not a compound that inhibits the function of the galactosidase enzyme. The inhibitory activity was extracellular, but was produced by Exiguobacterium sp. only when it was cultured with S. marcescens Preliminary characterization of the chemical pro duced by Exiguobacterium sp. 33G8 was performed by extraction of cell free supernatant from the 33G8 culture used for the dialysis pouch co culture enzyme assay. Cell free supernatant was passed through an ion exchange column and then the flow through fro m the ion exchange column was subjected to reverse phase Si C 18 chromatograpy. Eluent from both

PAGE 76

76 columns was dried, re extracted with two different solvents and the resulting samples were assayed for their ability to reduce D glucopyranosidase activity in PDL100. This enzyme was chosen out of the three initially tested because of the strong inhibition seen in the co culture experiment (Figure 4 5). Of the fractions assayed, the ethanol soluble extract of the eluent from th e ion exchange column showed the greatest reduction in activity (nearly 1.5 fold reduction) as compared to the solvent alone control (Figure A 2A). Swarming Motility I nhibition in S. marcescens PDL100 by Coral B acteria Even though the inhibition of enzym atic activities by the commensals was at least in part responsible for the reduced fitness of S marcescens within coral mucus, it did not fully account for the observed phenotype. The conclusion that the activities produced by commensals target induction of enzymatic activities, rather than a function of the enzyme, suggests that the compounds may affect a higher level regulator. Therefore, we explored the possibility that the commensals inhibit behaviors associated with niche colonization and co regulat ed with metabolism. To further characterize the potential co regulation of metabolic enzymes and motility, swarming motility of PDL100 was assayed with and without the commensals as in ( Alagely et al., 2011 ) When spotted onto an AB swarm agar plate, PDL100 swarms as seen in Figure 4 6A. Five of the six strains inhibited swarming of S. marcescens Exiguobacterium sp. 33G8 did not inhibit swarming although this strain showed the greatest inhibition of enzyme induction during growth in co culture (Figure 4 6D). We then tested three hypotheses that explain these observations: commensals produce antibiotics, motility inhibitors or specific inhibitor s of swarming.

PAGE 77

77 No growth inhibition of S. marcescens was observed in diffusion assays to test for the antibiotic production by the coral commensals (data not shown) indicating that neither the limitation of growth seen in the competitive fitness co cultur e test, nor inhibition of swarming is due to antibiotic production by commensals. Five of the six of the commensal strains tested reduced swarming motility in S. marcescens however none inhibited swimming within soft agar. These data suggest that the co mmensal strains may produce inhibitory compounds specific to the co regulation of swarming motility and metabolism, perhaps by targeting a higher level regulator that controls both pathways. Discussion Metabolic enzymes, especially glycosidases and chitina se are differentially induced during growth of Serratia marcescens PDL100 on coral mucus ( Kr ediet et al., 2009b ; Krediet et al., 2009a ) This study sought to test the consequences of inhibition of these enzymatic activities in S. marcescens by coral associated bacteria. A transposon mutant deficient in these activities was identified and tentatively typed to the operon homologous to the E. coli malEFG maltose/maltodextrin transporter This high af finity ABC transporter system consists of a periplasmic maltose binding protein encoded by malE and a transport complex encoded by malF malG and malK ( Jones et al., 2008b ) Based on the transport functions of the operon, it was hypothesized that malEFG is n ecessary for proper colonization and utilization of coral mucus by the pathogen. While the S. marcescens malEFG mutant showed a 3 fold decrease in galactosidase activity and a 2 fold decrease in N acetyl D glucosaminidase activity compared to the wild type, the mutation did not fully explain the ability of t he pathogen to utilize and grow on coral mucus. In a monoculture, the mutant grew to the same

PAGE 78

78 population density as the wild type, however was not competitive against the wild type on coral mucus i n co culture. It is plausible that the reduced affinity for the substrate resulting from the disruption of the transporters is responsible for the reduced competitive fitness of the strain. The decrease in the virulence of the mutant in a surrogate host is also likely due to its reduced fitness within the surface mucus layer. Coral pathogens compete with the native coral associated bacteria in order to establish a niche and utilize preferred carbon sources of coral mucus. These coral associated bacteria interact with and can interfere with the invading pathogen through antibio tic production, inhibition of quorum sensing, and secondary metabolite production ( Shnit Orland and Kushmaro, 2009 ; Teplitski and Ritchie, 2009 ; Rypien et al., 2010 ) This stu dy characterized six coral associated strains capable of interfering with metabolic enzymatic activities and decreasing the overall growth of S. marcescens on coral mucus. Interference of enzymatic activities was cell associated and dependent on co cultur ing of commensals and the pathogen. Interestingly, Clark et al. ( 2011 ) identified azagugars produced by Bacil lus spp. as potent inhibitors of glycosidases. Even though interactions of the substance(s) produced by Exiguobacterium with solvents and resins is similar to those of azasugars, the mode of action of the compound from Exiguobacterium sp. 33G8 is distinct from that of azasugars. Even though the chemical structure of the compound is not yet known, it is likely to be a novel substance. In addition to inhibiting enzymatic activities in S. marcescens that are involved in coral mucus utilization the coral as sociated bacteria also inhibited swarming motility in the pathogen. We do not yet know whether the same compound is involved in the

PAGE 79

79 inhibition of both swarming and catabolism. However, if this were the case, it is possible to hypothesize that a higher le vel re gulatory system (GacS/GacA Csr or FlhDC, Romeo, 1998 ; Pruss et al., 2003 ; Park and Forst, 2006 ; Jonas et al., 2008 ; Timmermans and Van Melderen, 2010 ) may be the target. The GacS/GacA Csr system is not likely to be affected by the activities of these commensals: first, the phenotype of the gacA mutant (data not shown) is distinct from what is observed when the wild type is exposed to the commensals te sted here, and, second, the commensals did not affect the expression of the gacA::lacZ reporter (Krediet, unpublished data). It is also unlikely that FlhDC is affected by the commensals: even though FlhDC in Enterobacteriacea e is known to contribute to th e regulation of both motility and metabolism ( Pruss et al., 2003 ) the fact that none of the commensals inhibited swimming motility suggests that FlhDC is a lso an unlikely target of these activities. Therefore, these observations suggest that either the compounds target another regulatory cascade, or that different compounds disrupt swarming and the induction of enzymatic activities separately. The interacti ons between coral associated mutualistic bacteria and invading pathogens are numerous, complex, and still poorly understood. The results of this study demonstrate that coral associated bacteria affect the co regulation of metabolic activities and swarming motility, and thus, S. marcescens PDL100 ability to compete in the coral mucus environment. Further research will elucidate the exact level of these regulatory pathways at which coral commensal strains interfere.

PAGE 80

80 Table 4 1. Bacterial strains and plasmids Isolate or strain Relevant characteristic(s) a Source or reference Escherichia coli strains F lac lac ZYA arg F) U169 rec A1 end A1 hsd R17 (rk mk+) pho A sup thi 1 gyr A96 rel A1 Invitrogen pir 434 derivative containing the pir gene ( Macinga et al., 1995 ) Top10 F mcrA (mrr hsdRMS mcrBC) 80lacZ M15 lacX74 deoR recA1 araD139 (ara leu)7697 galU galK Invitrogen W3110 rpsL endA1 nupG ( Hayashi et al., 2006 ) BW25113 rph 1 ( Baba et al., 2006 ) malG Single knockout deletion mutant o f malG ( Baba et al., 2006 ) malF Single knockout deletion mutant of malF ( Baba et al., 2006 ) malE Single knockout deletion mutant of malE ( Ba ba et al., 2006 ) malG transduced into W3110 by P1 This study malF transduced into W3110 by P1 This study malE transduced into W3110 by P1 This study Serratia marcescens strains Serratia marcescens PDL100 Coral pathogen isolated from white pox lesion on Acropora palmata ATCC BAA 632, Tet R ATCC, ( Patterson et al., 2002 ) Serratia marcescens CK2A4 galactosidase activity This study Serratia marcescens MG1 Isolated from rotten cucumber ( Givskov et al., 1997 ) Serratia marcescens ATCC 43422 Human throat isolate, pigmented ATCC, ( Krediet et al., 2009b ) Coral commensal strains Photobacterium sp. 33G2 Isolated from A. palmata mucus; identity confirmed by 16S rRNA gene sequencing; JQ954975 This study, ( Ritchie, 2006 ) Photobacterium damselae 33G4 Isolated from A. palmata mucus; identity confirmed by 16S rRNA gene sequencing; JQ954976 This study, ( Ritchie, 2006 ) Photobacterium leiognathi 33E3 Isolated from A. palmata mucus; identity confirmed by 16S rRNA gene sequencing; JQ954977 This study, ( Rit chie, 2006 ) Photobacterium leiognathi 33C4 Isolated from A. palmata mucus; identity confirmed by 16S rRNA gene sequencing; JQ954978 This study, ( Ritchie, 2006 ) Exiguobacterium sp. 33G8 Isolated from A. palm ata mucus; identity confirmed by 16S rRNA gene sequencing; JQ954979 This study, ( Ritchie, 2006 ) Vibrio harveyi 34B3 Isolated from A. palmata mucus; identity confirmed by 16S rRNA gene sequencing; JQ954980 This study, ( Ritchie, 2006 )

PAGE 81

81 Table 4 1 Continued Isolate or strain Relevant characteristic(s) a Source or reference Plasmids pCR2.1 TOPO Cloning vector; Km R Invitrogen pRK600 ColE1 replicon with RK2 tra genes, conjugation helper plasmid ( Karunakaran et al., 2005 ) pBT20 Mariner transposon delivery vector, Gm R R6K ori ( Kalivoda et al., 2008 ) pCP20 Temperature sensitive replicon, thermal induction of FLP synthesis, Cm R Ap R ( Datsenko and Wanner, 2000 ) pBBR1 MCS2 kan Cloning vector, Km R ( Kovach et al., 1995 ) pBAD18 kan Cloning vector, Km R under arabinose inducible ara BAD promoter ( Guzman et al., 1995 ) pCJK16 malEFG from PDL100 PCR amplified and cloned into pCR2.1 TOPO, Ap R Km R This study pCJK17 malEFG from pCJK16 subcloned into EcoRI site of pBAD18 kan, Km R This study pCJK18 malEFG from pCJK17 subcloned into EcoRI site of pBBR1 MCS2 kan, Km R This study a Ap r ampicillin resistance; Cm r chloramphenicol resistance; Gm r gentamicin resistance; Km r kanamycin resistance; Tet r tetracycline resistance

PAGE 82

82 Figure 4 1. Catabolic enzymatic activities in mutants of S. marcescens and E. coli Overnight cultures of S. marcescens PDL100 wild type and the transposon mutant (CK2A4) were tested for activities of A) D galactopyranosidsase, B) N acetyl D glucosaminidase, and C) D glucopyranosidase using a Miller Assay ( Miller, 1972 ) and appropriate nitrophen yl substrates. E. coli W3110 and individual in frame single gene knockouts of malE malF and malG were also tested to compare phenotypes of CK2A4 with those of the defined well

PAGE 83

83 characterized E. coli mutants in the malEFG operon. All cultures were grown o vernight prior to the assays; S. marcescens was cultured in Marine b roth, E. coli was grown in LB. Averages of three biological and four technical replications are shown. Error bars are standard error. There was a significant reduction in the enzymatic a ctivities between S. marcescens wild type and CK2A4 ( D galactopyranosidsase: t=13.55, dF=6, p<0.0001; N acetyl D glucosaminidase: t=12.22, dF=3.3, p=0.0008; D glucopyranosidase: t=20.86, dF=4.87, p<0.0001). In E. coli, D galactopyranosidsase and D glucopyranosidase activities were reduced in malE, malF and malG mutants.

PAGE 84

84 Figure 4 2. Competitive fitness of S. marcescens PDL100 and CK2A4. To test the importance of catabolic enzymes for growth of S. marcescens on coral mucus, both wild type and CK2A4 were grown both individually and in co culture on mucus of A. palmata and in the HEPES buffered (10 mM, pH 7.1) artificial seawater with casamino acids (0.5 g L 1 ) and glycerol (0.4% vol/vol). For competition expe riments, overnight culture inocula were serially dilut ed and mixed 1:1. Cultures in A) crude (total) mucus of Acropora palmata C) high molecular weight (> 5 kDa) fraction of A. palmata mucus, or E) casamino acids/glycerol were inoculated at 10 2 cfu ml 1 Cultures were incubated at 30 C with shaking. To enumerate cells, at 12, 24, 48, 72, and 96 hours cultures were dilution plated onto marine agar supplemented with Tc10. Averages of three biological replications of the experiment (three independent cult ures) are shown, error bars are standard error. In monocultures, all strains grew similarly and reached the same final population densities. CK2A4 was at a growth advantage on the casamino acid/glycerol defined medium and grew to higher population densit ies than wild type and the 1:1 co culture. To estimate the percentage of each strain within each co culture (competitive fitness), colonies were patched onto marine agar supplemented with Tc10 and Gm50 to differentiate between the wild type and the transp oson mutant. The relative proportion of the wild type is shown as the gray portion of the stacked column. Competitive fitness experiments were repeated at least twice, and averages are shown (error bars are sta ndard errors). On total mucus B) and high mo lecula r weight fraction of the mucus D) the mutant was not competitive against the wild type. However, the competitive fitness of the mutant was increased on casamino acids and led to a slight growth advantage of the mutant over the wild type.

PAGE 85

85 Figur e 4 3. Survivorship of A. pallida polyps in fected with S. marcescens Ten fold dilutions of overnight cultures of S. marcescens PDL100 and CK2A4 were inoculated into microtiter plate wells with Aiptasia pallida Infections were maintained at room temper ature (22 24 C) with illumination. Polyps were scored daily. Each line represents the proportion of polyps surviving at each concentration (10 6 cfu ml 1 10 7 cfu ml 1 10 8 cfu ml 1 or control as shown in the key) Survivorship decreased significantly with increasing pathogenic concentr ation for polyps infected with A) S. marcescens PDL100 ( 2 =38.604; dF=4; p<0.0001) and B) S. marcescens CK2A4 ( 2 =28.249 ; dF=3; p<0.0001).

PAGE 86

86 Figure 4 4. Competitive fitness of S. marcescens with coral commensals. Co ral commensal strains shown to inhibit D galactopyranosidase activity in S. marcescens PDL100 were grown in co culture on high molecular weight fraction of A. palmata mucus with wild type PDL100 and transposon mutant CK2A4. To prepare inoculum of S. mar cescens strains, overnight cultures were serially diluted and wild type and CK2A4 were mixed 1:1 and inoculated at 10 2 cfu ml 1 The coral commensals ( Photobacterium sp. 33G2, P. damselae 33G4, Exiguobacterium sp. 33G8, P. leiognathi 33C4, P. leiognathi 3 3E3, and Vibrio harveyi 34B3) were grown separately, mixed as a cocktail and inoculated at 10 4 cfu ml 1 concurrently with S. marcescens A) In monocultures (black lines) of S. marcescens without coral commensals, the wild type (filled square) and CK2A4 mutant (empty square) reached the same population densities. In the co culture on high molecular weight fraction of A. palmata mucus in the presence of the coral commensals, growth of S. ma rcescens was significantly reduced (grey line). Averages of three biological replicates (three independent cultures) are shown. Error bars are standard erro rs. B) Fitness of the mutant vs the wild type in the presence of the commensals was estimated by patching of Serratia colonies onto media with the appropriate antibiotics. The relative proportion of the wild type is shown as the gray portion of the stacked column.

PAGE 87

87 Figure 4 5. Inhibition of enzymatic activities in S. marcescens PDL100 by Exiguob acterium sp. 33G8. Exiguobacterium sp. 33G8 was grown in co culture with PDL100 to test for inhibition of the enzymatic activities that are normally induced in S. marcescens grown on mucus of A. palmata As detailed in Materials and Methods, within the c o culture, bacteria were separated with a dialysis membrane (MWCO: 1,000,000) for the ease of recovering cells for enzymatic assays. The dialysis pouch pore size was enough to retain cells but allow compounds produced by both organisms to pass through E nzymatic assays for PDL100 A) D galactopyranosidase, B)

PAGE 88

88 N acetyl D gl ucosaminidase (chitinase), and C) D glucopyranosidase activities were conducted at the time of inoculation and after six hours of co culture using nitrophenyl substrates as in ( Miller, 1972 ) Enz ymatic activities of S. marcescens PDL100 in a monoculture or in the co culture with Exiguobacterium sp 33G8 are shown. Experiments were repeated twice, each time with four technical replicates. Data from one replicated experiment are shown. There was n o difference in initial activity between the treatments for each enzyme assayed. After co incubation for six hours, S. marcescens PDL100 showed strongly significantly reduced enzymatic activities as a result of 33G8 for D galactopyranosidase (t=9.340 d F= 4.2 p=0.0005) and D glucopyranosidase (t=22.191, dF= 4.34 p<0.0001) and modestly significantly reduced activity of chitinase (t=4.410, dF= 3.27 p=0.0180).

PAGE 89

89 Figure 4 6. Inhibition of swarming of S. marcescens PDL100 by coral commensals. Swarming of S. marcescens PDL100 on AB 0.4% swarm agar next to a sterile glass fiber GF/C disk is shown in panel A. Individual coral commensal strains [ B) Photobacterium sp. 33G2 C) P. damselae 33G4 D) Exiguobacterium sp. 3 3G8 E) P. leiognathi 33C4 F) P. leiognathi 33E3 and G) Vibrio harveyi 34B3 ] were grown in marine broth and 20 l were spotted onto a glass fiber GF/C disk on solid marine agar and disks were incubated at 30 C overnight. Filter disks were placed next t o PDL100 (5 l of overnight culture diluted 1:100 and grown for two hours). Plates were incubated at 30 C overnight and all strains except 33G8 inhibited swarming motility in the pathogen. The experiments were repeated three times; data from one represen tative experiment are shown.

PAGE 90

90 CHAPTER 5 CHARACTERIZATION OF THE g ac A DEPENDENT BEHAVIORS IN AN OPPORTUNISTIC CORAL PATHOGEN Serratia m arcescens PDL100 Introduction Opportunistic bacterial pathogens, including Serratia marcescens can infect a number of hosts including plants, invertebrate, and vertebrate animals ( Kurz et al., 2003 ; Grimont and Grimont, 2006 ; Nehme et al., 2007 ) In their interactions with their diverse hosts, pathogens must either adapt to their new host environment or modify it so that they are able to overcome the host defenses and outcom pet e the native microbiota. Involved in this are the recognition of the host, colonization, and exploitation of host resources, events that are typically dependent on an arsenal of bacterial sensors and regula tors ( Hoch, 2000 ) While a great deal is known about the interactions of pathogens with various plant and animal hosts, significantly less is known about the regulation of virulence in coral pathogens. Coral pathogens that cause bleaching produce a variety of herbicidal tox ins ( Banin et al., 2000 ; Rosenberg and Falkovitz, 2004 ; Sussman et al., 2009 ) Significantly less is known about regulation of virulence in necrotizing pathogens, such as Serratia marcescens and Vibrio coralliilyticus The genome sequencing of Vibrio coralliilyticus BAA 450 led to the identification of the structural and regulatory genes, which contributed to these virulence related behaviors ( Kimes et al., 2011 ) Motility, host degradation, effector mo lecule secretion, and antimicrobial resistance are shown to be important to its virulence in corals ( Meron et al., 2009 ; Kimes et al., 2011 ) Understanding the genetics of virulence of coral pathogens is important for several reasons. First, a better understanding of virulence gene regulation in coral pathogens will help establish evolutionary parallels between similar strategies in multi hos t

PAGE 91

91 pathogens (like S. marcescens ). This knowledge will also allow comparing and contrasting virulence strategies employed by necrotizing and bleaching inducing coral pathogens. Lastly, understanding the genetics of virulence of coral pathogens will help b etter define coral diseases, as some of the current debate on the issue still focuses on understanding whether coral diseases are true pathologies caused by pathogens or u ncontrolled proliferation of microorganisms or various stress responses of the corals ( Lesser et al., 2007 ) In this study, we chose to focus on the role of the GacS/GacA two component regulatory system in the interactions of the necrotizing coral p athogen S. marcescens PDL100 with its polyp hosts. GacS/GacA is one of the two component regulatory proteobacteria ( with the exception of those endosymbionts of insects whose genomes have undergone significant reduction, Goodier and Ahmer, 2001 ) Unlike most two component regulatory systems, orthologs of gacS and gacA are not encoded next to each other. The gacS gene encodes an unorthodox sensor kinase with a HAMP phosphatase, histidine kinase A (dimerization/phosphoacceptor), HA TPase_C; REC (signal receiver) and a histidine phosphotransfer (HPT) domains. Recently, the metabolic endproducts formate and acetate were found to stimulate BarA (the GacS homolog in E. coli ), however, these stimuli may be specific to individual species, strains, or culture conditions ( Chavez et al., 2010 ) Upon perception of a signal, GacS orthologs autophosphorylate and then trans phosporylate GacA ( Pernestig et al., 2001 ) although a RetS/LadS mediated

PAGE 92

92 phosphorylation of GacS was demonstrated in Pseudomonas and this is distinct from other proteobact eria ( Ve ntre et al., 2006 ; Goodman et al., 2009 ) GacA is a FixJ/LuxR transcriptional regulator, which is activated by trans phos phorylation (typically, by GacS, Pernestig et al., 2001 ; Teplitski et al., 2003 ) Even though most gacA orthologs were identified as defective in motility, virulence or production of secondary metabolites, all regulatory effects of GacA are likely through its control of the Csr (Rs m) post transcriptional regulatory system ( Kay et al., 2005 ; Lapouge et al., 2008 ; Brencic and Lory, 2009 ) Phosphorylated GacA is thought to dimerize, and then binds within promoters of the small regulatory csr RNA s ( Suzuki et al., 2002 ; Teplitski et al., 2006a ; Teplitski and Compton, 2006 ) The csr sRNAs bind to and sequester the regulatory protein CsrA ( Romeo et al., 1993 ; Romeo, 1998 ) Binding of free CsrA to messages either stabilizes them or targets them for degradation, and this provides global post transcriptional regulation of genes involved in virulence, quorum sensing, motility, carbon acquisition, and biofilm formation ( Jonas et al., 2008 ; Jones et a l., 2008a ; Timmermans and Van Melderen, 2010 ) GacA has been characterized in only two species of Serr atia the biocontrol soil isolate IC1270 of S. plymuthica and S. marcescens 39006. In S. plymuthica GacA regulated production of anti fungal compounds, quorum sensing, and degradation of chitin ( Ovadis et al., 2004 ) In S. marcescens 39006, GacS/GacA control synthesis of the prodigiosin pigment ( Williamson et al., 2006 ) In the present study, we hypothesized GacA regulates carbon source utilization and fitness of an opportunistic pathogen, S. marcescens PDL100 on polyp surfaces.

PAGE 93

93 Surfa ces of polyps are covered with mucus, a sulfonated glycoprotein made in the specialized cells of polyps from the photosynthate assimilated by the endosymbiotic dinoflagellates ( Brown and Bythell, 2005 ; Bythell and Wild, 2011 ) The coral surface mucus layer is dynamic and highly variable with regards to the availability of nutrients and the composition of the associated native microbiota. The composition of coral mucus is known for only a few coral species ( Ducklow and Mitchell, 1979 ; Meikle et al., 1987 1988 ) and can vary temporally, sp atially, and with coral species ( Klaus et al., 2007 ; Bythell and Wild, 2011 ) With this inherent variability, opportunistic pathogens capable of sensing the environment and efficiently switching between available carbon sources may have a higher fitness. This study focused on the phenotypes controlled by gacA, as it is known to regulate virulence and carbon metabolism through the Csr system, where CsrA balances carbon flow in the cell by activating genes of glycolysis and by repressing the genes involved i n gluconeogenesis in a post transcriptional manner ( Romeo, 1998 ) Pernestig et al. ( 2003 ) demonstrated that co cultures in LB were dominated by an uvrY ( gacA homolog in E. coli ) mutant over the wild type over ten day trials. When cultured in a minimal medium co ntaining glycolytic carbon sources, the wild type showed a competitive advantage over the mutant. This led to the conclusion that the growth advantage of the mutant when grown on carbon sources that enter downstream of glycolysis could be due to the fact that (1) the mutants were defective in shifting between metabolic pathways, which were not necessary during the long term culture conditions of the co culture; or (2) due to the relative down regulation of gluconeogenic enzymes by the Csr system in the mut ants, conferred a growth advantage because

PAGE 94

94 these pathways were less important and rather were a burden in the wild type bacteria ( Pernestig et al., 2003 ) The ability to shift between metabolic pathways seems to be important for the ability of opportunistic coral pathogens to utilize the carbon sources available in mucus in order t o out compete the native coral associated microbiota and establish within the new environmental niches. To test this hypothesis, a gacA disruption mutant was constructed. Consistently with the evolutionarily conserved function of gacA expression of csrB was strongly reduced in the mutant. Upon validation of the mutant, we tested the hypothesis that GacA regulation was important for the ability of the pathogen to establish within coral mucus and for the control of early colonization behaviors (swarming mo tility and biofilm formation). Materials and Methods Bacterial Strains and Culture C onditions Bacterial strains and plasmid used in this study are listed in Table 5 1. Bacteria were maintained at 80 C in 35% (v/v) glycerol in LB (Fisher Scientific, Atlanta, GA) or marine broth (Difco Becton, Dickinson and Company, Franklin Lakes, NJ). Isolated colonies were recovered on LB or marine agar (1.5%) plates with or without antibiotics as described below. Serratia strains were routinely grown at 30 C and E. coli at 37 C. Unless otherwise specified, cultures were supplemented with the following antibiotics: 10 g ml 1 tetracycline (Tc10); 50 g ml 1 kanamycin (Km50); 50 g ml 1 gentamycin (Gm50); 400 g ml 1 carbenicillin (Cb400). Coral mucus was collected from apparently healthy colonies of Acropora palmata at Looe Key Reef, Florida (24 81

PAGE 95

95 described ( Ritchie, 2006 ) To prepare mucus as a growth medium, samples were pre filtered through glass fiber filter followed by filtration through a 0.22 m MCE filter. Aliquots of the sample were then size fractionated using VivaSpin 15 spin dialysis assemblies (Sartorium St edim Biotech, Goettingen, Germany). High molecular weight fractions were brought up to volume in filter sterile artificial seawater (FSW; Red Sea Coral Pro Salt, Eilat, Israel) as described previously ( Krediet et al., 2009a ) Strain and Plasmid Construction Primer sequences and descriptions are listed in Table 5 2. In general, genomic DNA was isolated from S. marcescens PDL100 using a GenElute Bacterial Genomic DNA Extraction Kit (Sigma Aldrich, St. Louis, MO). Plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA), and PCR products were purified using the Illustra GFX PCR DNA and Gel Band kit (GE Healthcare, Piscataway, NJ). To construct the gacA disruption mutant, a 283 bp internal fragment of gacA from PDL100 was amplified using primers CJK136 and CJK138 (Table 5 2) and the resulting PCR product was initially cloned into pCR2.1 (Invitrogen Carlsbad, CA ) to make pCJK19, confirmed by M13F/R PCR and directionally subcloned into the EcoRI SalI site o f pVIK112 to make pCJK20. All constructed plasmids were transformed into chemically competent or electrocompetent E. coli into PDL100 by tri parental conjugation with pRK600 as a helper plasmid. Single crossover insertion m utation was confirmed by PCR with CJK12 and the lacZ primer from pVIK112, BA184 and DNA sequencing at the Arizona State University Sequencing Core Facility. The gacA::lacZ insertion/disruption mutation in PDL100 (strain CJKgacA3) was complemented by first amplifying full length gacA from the genomic DNA using primers

PAGE 96

96 CJK12 and CJK18. The 956 bp PCR product was cloned into pCR2.1 to make pCJK21 and subcloned into pBBR1 MCS5 digested with EcoRI and treated with calf intestinal phosphatase (NEB Ispwich, MA ) to yield pCJK22. The construction of pCKJ22 was confirmed by PCR using primers BA974 and CJK18. As a negative control, pBBR1 MCS5 vector was also moved into both S. marcescens PDL100 wild type and CJKGacA3. To construct the P csrB luxCDABE reporter, the promoter region of PDL100 csrB containing the predicted upstream activation sequence (UAS) was first amplified using primers CJK64 and CJK87 ( Kulkarni et al., 2006 ) The resulting 384 bp PCR product was cloned into pCR2.1 (making pCJK8) and then subcloned into the EcoRI site of pSB377, resulting in plasmid pCJK9. The plasmids pCJK22 and pCJK9 were incompatible in S. marcescens so therefore, the plasmids were electroporated into an isogenic uvrY33::kan E. coli RG133. To cross complement the E. coli uvrY mutant, the PDL100 gacA complementation vector pCJK22 was electro porated into E. coli RG133 pCJK9. As a vector control, the original pBBR1 MCS5 vector was also electroporated into the isogenic E. coli RG133 pCJK9. Competitive Fitness on Coral M ucus Overnight cultures of S. marcescens PDL100 and CJKGacA3 were grown from glycerol stock in marine broth to an approximate OD 600 of 0.935 and cultures were serially diluted 10 fold and mixed 1:1 at 10 4 cfu ml 1 Strains were individually and co inoculated at starting concentrations of 10 2 cf u ml 1 into filter sterile crude (total) mucus, high molecular weight (> 5 kDa) fractioned mucus, and low molecular weight (< 5 kDa) fractioned mucus from Acropora palmata Individual and co inoculated cultures were performed in triplicate and cultures we re dilution plated on marine agar supplemented

PAGE 97

97 with tetracycline (Tc) 10 g ml 1 at 0, 12, 24, 48, 72, and 96 hours. Competitive fitness assays on each media type were repeated at least twice. To distinguish between wild type and mutant colonies, individu al colonies were patched onto selective media (marine agar supplemented with Tc10 and kanamycin Km50) to select for the gacA mutant. Swarming M otility Swarming motility assays were performed on S. marcescens wild type and CJKGacA3 mutant strain as well as the complemented strain on AB swarm agar as described previously ( Alagely et al., 2011 ) Overnight cultures were grown to stationary phase and s ubcultured 1:100 in marine broth for two hours and 5 l were spotted on the center of the AB swarm agar plate. Swarming plates were incubated at 30 C overnight and photographed with a Cannon Eos Rebel Xsi digital camera. Images of swarming motility prese nted were corrected for auto levels in Adobe Photoshop. Biofilm F ormation Biofilm formation was tested in S. marcescens PDL100 wild type, CJKGacA3 and CJKGacA3 pCJK22. As a control, both wild type and CJKGacA3 with the pBBR1 MCS5 vector were tested. Ce lls of each strain were diluted 1:100 from overnight LB cultures into 2 ml Colony Forming Antigen (CFA) medium ( Evans et al., 1977 ) Cultures were incubated at room temperature at 100 rpm for six hours followe d by static incubation at room temperature for 72 hours. After incubation, the biofilms were stained with 500 l of 1% crystal violet (in ethanol) for 15 minutes and washed with 3x with running DI water. The stained biofilms were photographed with a Cann on Eos Rebel Xsi digital camera. Images of biofilms presented were corrected in Adobe Photoshop using auto default settings.

PAGE 98

98 Virulence in a Model P olyp Aiptasia pallida Individual polyp infections with PDL100 wild type and CJKGacA3 were performed as described previously ( Krediet et al., 2012b ) Individual polyps (stalk length approximate ly 1 cm) were transferred from the stock tanks into wells of six well plates (Corning Scientific, Corning, NY) with 10 ml of filter sterilized (0.22 m) ASW. Polyps were acclimated in the wells for 24 hours at room temperature on a tabletop rotary shaker at 70 rpm. For inoculations with individual strains, overnight cultures grown in marine broth were washed three times in filter sterile ASW and diluted to approximately 10 8 10 7 and 10 6 cfu ml 1 ; the water in the wells was replaced with 10 ml of these su spensions. For un infected polyps, the well water was replaced with 10 ml of filter sterile ASW. The polyps were monitored for disease signs and were photographed daily with a Cannon Eos Rebel Xsi digital camera. Images of polyps presented were correct ed in Adobe Photoshop using auto default settings. Luciferase Assays Two overnight cultures of each strain were grown in LB with appropriate antibiotics diluted 1/100 in L Cultures were diluted to an OD 600 of 0.3, and then diluted 1/25000 and aliquoted into a black polystyrene 96 well plate (in quadruplicate). Luminescence and OD 600 were measured with Victor 3 (Perkin Elmer, Shelton, CT) every hour for twelve hours and the expression of the complemented mutant was compared to the wild type and mutant reporter strains. Luminescence was measured as counts per second (CPS) and was expressed as average CPS/OD 600 on a log scale.

PAGE 99

99 Quantitative RT PCR (qRT PCR) Total RNA was extracted from overnight cultures of S. marcescens PDL100 wild type and CJKGacA3 (OD 600 = 1.1) using a GenElute Total RNA Purification Kit (Simga Aldrich, St. Louis, MO). DNA was removed with a DNA Free Kit (Applied Biosystems, Carlsbad, CA). cDNA was synthesized using iScript cDNA sysnthesis kit (Bio Rad, Hercules, CA). Quantitative PCRs were performed in a reaction volume of 50 l containing 1x iQ SYBR Green Supermix (Bio Rad, Hercules, CA) 200 nM each forward and reverse primers (Table 5 2), and 5 ng of cDNA. DNA concentrations were determined with the Nanodrop spectrophotomter. Amplification and detection of DNA were performed in four biological replications and two technical replicate s for each biological replicate with the iCycler detection system (Bio Rad) with optical grade 96 well PCR plates and optical film. The reaction conditions were 50 C for 2 minutes and 95 C for 10 minutes, followed by 45 cycles of 95 C for 15 seconds and 6 0 C for 1 minute. Data analysis was conducted with the software supplied by Bio Rad and data are presented as fold change in expression based on the comparative C T method using 16S rRNA gene expression as a reference ( Livak and Schmittgen, 2001 ; Schmittgen and Livak, 2008 ) Results Regulation of csrB in a gacA Dependent M anner The small regulatory RNA csr ( rsm ) are the evolutionarily conserved targets of GacA orthologs ( Romeo, 1998 ; Babitzke and Romeo, 2007 ; Brencic et al., 20 09 ) Even though GacA orthologs can bind within the promoters of the horizontally acquired virulence genes ( Teplitski et al., 2006b ) most of the downstream regulatory effects are

PAGE 100

100 thought to be mediated by the Csr post transcriptional regulatory system ( Heeb and Haas, 2001 ; Timmermans and Van Melderen, 2010 ) To confirm the evolutionarily conserved functions of GacA and to validate the constructed S. marcescens gacA mutant, the regulation of csrB in a gacA dependent manner wa s tested. The amino acid sequence of S. marcescens GacA was compared to other characterized orth o logs of GacA and conserved functional domains were identified through sequence homology ( Figure 5 1 ). Luminescence of a P csrB luxCDABE reporter plasmid, pCJK 9 was tested in the wild type S. marcescens PDL100 and the gacA mutant CJKGacA3. A 10 fold decrease in luminescence in the csrB reporter was observed in the gacA mutant as compared to the wild type (Figure 5 2 A). The P csrB luxCDABE reporter plasmid, pCJK9 was similarly regulated in the heterologous host E. coli (Figure 5 2 B) and the introduction of the wild type copy of gacA borne on a low copy number plasmid complemented the mutation (Figure 5 2 B). The vector alone did not affect luminescence in the reporter (Figure 5 2 B). The csrB expression peaked during early log phase (OD 600 ~ 0.2), which occurred 7 8 hours after dilution and luminescence of the reporter remained constant for the duration of the assay as cultu re densities incre ased (Figure 5 2 B). The cloned promoter region of PDL100 csrB contained the predicted upstream activation sequence (UAS) necessary for proper GacA binding to the csrB promoter (Figure 5 3, Kay et al., 2006 ; Kulkarni et al., 2006 ) To further validate the regulation of csrB in a gacA dependent manner quantitative RT PCR experiments were performed. In late log cultures, the accumulation of the csrB transcript was significantly reduced in the gacA mutant compared to the wild type (Figure 5 3 C; t=3.896, dF= 4 p=0.0087). These results and

PAGE 101

101 the previous report demonstrating functionality of the S. marcescens PDL100 gacA borne on a low copy number plasmid ( Cox et al., 2012 ) suggest that S. marcescens PDL100 carries a functional copy of gacA which is disrup ted in the CJKGacA3 mutant. Contribution of gacA to Fitness of the Pathogen on Coral M ucus To test how gacA contributes to the efficient utilization of coral mucus by S. marcescens competitive fitness experiments were carried out on crude (total) and size fractionated mucus from A. palmata When grown individually, the wild type and the gacA mutant grew similarly and reached the same final densities on the crude and high molecular weight coral mucus (Figure 5 4 ). However, within the 1:1 co cultures on cr ude mucus and high molecular weight coral mucus, the gacA mutant dominated the culture after 12 hours of growth and continued throughout the re st of the growth curve (Figure 5 4B and D). The wild type was not competitive against the mutant on crude mucus or high molecular weight mucus and represented only 5 10% of the overall population. On low molecular weight fractionated mucus, the two strains grew sim ilarly in monocultures (Figure 5 4 E). However, in their co culture, the competitive fitness of the wi ld type increased and was nearly equal with the gacA mutant (Figure 5 4 F). This suggests that the efficiency of the utilization of high molecular weight fraction of the mucus glycoprotein is dependent on the gacA mediated regulatory pathways, while the Ga cA regulon is dispensable during growth on the low molecular weight fraction. Surface Swarming Motility and Biofilm F ormation In addition to indirectly regulating carbon metabolism through CsrA, GacA is known to regulate swarming motility and biofilm forma tion ( Goodier and Ahmer, 2001 ; Parkins et al., 2001 ; Whistler and Ruby, 2003 ; Teplitski et al., 2006a ; Gauthier et al., 2010 ) Swarming assays on AB soft (0.4%) agar plates revealed that S. marcescens

PAGE 102

102 PDL100 swarms in a branc hing dendritic pattern ( Figure 5 5A, Alagely et al., 2011 ) The gacA mutant was also capable of surface spreading but with an altered architecture o f the swarm colony (Figure 5 5 B), which lacked the th ree dimensionality and extensive dendritic pattern. The swarming phenotype was complemented in trans by the plasmid borne gacA while a pBBR1 MCS5 vector did not alter the swarming behavior of the mutant (Figure 5 5C and D). The disruption of gacA reduced the ability of the strain to form biofilms on glass (but not on polystyrene). After 72 hours of incubation, biofilms stained with crystal violet were significantly reduced in the gacA mutant compared to the wi ld type (Figure 5 6A and B). Just as with th e swarming phenotype, complementation with the wild type copy of gacA fully restored biofilm formati on to wild type levels (Figure 5 6 D) and the addition of the empty pBBR1 vector had no effect on biofilm formation in the gacA mutant (Figure 5 6 C). Virulence in a Model Polyp Aiptasia pallida Aiptasia pallida is a model Cnidarian and has been proposed as a model to study cellular and molecular biology of corals and their associa ted microbes ( Weis et al., 20 08 ; Krediet et al., 2012b ) The hypothesis that GacA regulates virulence behaviors in the coral pathogen was tested by infecting individual polyps at three doses of both wild type and the gacA muta nt (Figure 5 7 ). As S. marcescens PDL100 is a necrotizing pathogen, mortality was defined as complete degradation of the Aiptasia polyp. After 24 hours of incubation at the highest concentration (10 8 cfu ml 1 ) the polyps compressed their stalks, retracte d their tentacles and exhibited darkening of the tissue in response to infection by both the wild type and the mutant. These responses were seen to a lesser degree at the 10 7 cfu ml 1 treatment and rarely at the 10 6 cfu ml 1 concentration (Figure

PAGE 103

103 5 7 ). T here was no significant difference in virulence of the two strains after seven days of incubation. Both polyps infected with 10 8 cfu ml 1 succumbed to infection after 24 hours, while no mortality at each of the lower concentrations was observed. These da ta suggest that the LD 50 for the mutant is equal to the wild type, which has been previously estimated at 5 x 10 7 cfu ml 1 ( Krediet et al., 2012b ) Discussion Virulen ce mechanisms of coral pathogens often vary with the type of disease manifestation the pathogen causes. For example, the well characterized coral bleaching pathogen Vibrio shiloi relies on a series of virulence mechanisms in order to fully cause disease. The pathogen first employs flagella dependent chemotaxis toward the mucus of Oculina patagonica ( Banin et al., 2000 ) Che motaxis toward mucus is also critical for virulence of the bleaching and necrotizing coral pathogen Vibrio coralliilyticus ( Meron et al., 2009 ) Once attracted to coral mucus, V. shiloi adhesin galactosides on the coral surface, then penetrates into the epidermal cells, differentiates into a vi able but non culturable state, multiplies within the cells of the polyp, and finally produces toxins that inhibit photosynthesis, bleac h and lyse the symbiotic zooxanthellae ( Banin et al., 2000 ; Rosenberg and Falkovitz, 2004 ) The coral pathogen V. coralliilyticus causes both bleaching and coral tissue necrosis through production of a tempe rature regulated zinc metalloprotease ( Sussman et al., 2009 ; Kimes et al., 2011 ) The pathogen inhibits photosystem II in zooxanthellae, causes paling of the coral tissue and spreads tissue lesions across the colony culminating in mortality, although the exact mechanism is not fully understood ( Sussman e t al., 2008 ) Unlike Vibrios, which induce coral bleaching at least under some conditions, S. marcescens PDL100 is strictly a necrotizing pathogen of corals. The strain PDL100 is

PAGE 104

104 not the only S. marcescens that can infect corals, as infections by other strains of the pathogen were recently demonstrated ( Sutherland et al., 2011 ) Even though the ability to cause a disease in corals appears to be common in strains of S. marcescens the mechanisms by which it c auses the disease are not at all clear. Serratia marcescens is a multi host opportunistic pathogen capable of infecting invertebrates, animals, and humans. When S. marcescens first colonizes the intestinal mucous lining of Caenorhabditis elegans and Droso phila melanogaster the pathogen adheres to the epithelial cells, with the O antigen playing a key role in resistance to host defenses ( Kurz and Ewbank, 2000 ; Kurz et al., 2003 ; Nehme et al., 2007 ) Once attached to the epithelial cells, the pathogen produces cytotoxins that lead to tis sue necrosis ( Carbonell et al., 2000 ) Serratia marcescens also strongly adheres to human bladder epithelial cells using type I fimbriae and upon adherence, produces the ShlA hemolysin ( Hertle and Schwarz, 2004 ) This pore forming toxin triggers microtubule dependent invasion of S. marcescens into host epithelial cells and is the primary fa ctor inducing lysis of epithelial cells in order to release bacteria ( Hertle and Schwarz, 2004 ; Krzyminska et al., 2012 ) This type of viru lence mechanism of cell invasion and progressive cell lysis is important for development of S. marcescens infections in both invertebrate and vertebrate hosts. In addition to adhering directly to mucous lined epithelial cells, S. marcescens and other ente ric bacteria can also adhere to components of mucus ( Jackson et al., 2001 ; Laux et al., 2005 ) Understanding virulence mechanisms of this pathogen in multiple hosts will reveal evolutionarily conserved mechanisms of host invasion and will shed light onto the potential mechanisms used to infect corals.

PAGE 105

105 The coral pathogen Serratia marcescens PDL1 00 as well as other environmental and human isolates of S. marcescens are able to degrade components of mucus from Acropora palmata ( Krediet et al., 2009a ) However, S. marcescens PDL100 appears distinct from other Serratia strains in it s ability to efficiently degrade mucus, potentially utilizing a different pattern of regulating enzymes involved in mucus degradation ( Krediet et al., 2009b ; Krediet et al., 2009a ) Moreover, PDL100 was able to outco mpete randomly chosen commensal bacteria when grown on coral mucus ( Krediet et al., 2009b ) The mechanisms involved in these interactions are unclear, but understanding them is critical to understanding the ecology of the pathogen on the surface of corals. In orde r to investigate potential mechanisms that modulate interactions between coral commensal bacteria and S. marcescens PDL100 on the coral surface, the hypothesis that gacA played a role in competitive fitness on coral mucus was tested. GacA was found to con trol competitive fitness on high molecular weight versus low molecular weight fractions of coral mucus. In competition assays the gacA mutant was more fit on high molecular weight mucus of Acropora palmata When the wild type and gacA mutant strains were grown on low molecular weight fractions of coral mucus, the competitive fitness of the wild type increased and led to a relatively equal proportion of each strain in the culture (competitive index = 0.083). Protease activities (as measured on skim milk a gar plates) were not different in the mutant and the wild type (data not shown), thus the degradation of the proteinaceous backbone of mucus is not the likely explanation of the observed phenotype, even though gacA orthologs are known to

PAGE 106

106 control proteases in other bacteria ( Ovadis et al., 2004 ; Cui et al., 2008 ; Gauthier et al., 2010 ) The increased fitness of the gacA mutant is reminiscent of the phenotype of the E. coli uvrY ( gacA ) mutant ( Pernestig et al., 2003 ) E. coli uvrY mutant was more fit than the wild type in a complex laboratory medium (LB) over a ten day period; however, the wild type dominated the culture when grown on minimal media with glucos e or other glycolytic substrates as the sole carbon source ( Pernestig et al., 200 3 ) As GacA orthologs up regulate csrB which controls the intracellular availability of the RNA binding protein CsrA, a mutation in gacA can alter the carbon flow in the cell through the shift of metabolic pathways to use both glycolytic and gluconeog enic carbon sources. CsrA activates the genes of the glycolysis pathway and represses the genes involved in gluconeogenesis, in a post transcriptional manner ( Romeo, 1998 ) Minimal media with glycolytic carbon sources allowed for wild type advantage over the uvrY mutant while media containing c arbon sources entering downstream of glycolysis led to a growth advantage of the uvrY mutant in E. coli ( Pernestig et al., 2003 ) It is therefore logical to hypothesize that the low molecular weight fraction of coral mucus contains mostly glycolytic carbon sources whereas total molecular weight and high molecular weight fractions i nclude carbon sources associated with gluconeogenesis. The mutation in gacA in S. marcescens PDL100 led to significant differences in surface colonization abilities between the wild type and mutant. These differences are consistent with the reports in o ther bacteria, and indicate an important function for gacA in modulating surface associated behaviors in the pathogen. Virulence is often proteobacteria ( Lapouge et al., 2008 ; Gauthier et al., 2010 )

PAGE 107

107 however, we did not observe a reduction in virulence when both wild type and mutant were individually infected onto A. pallida polyps. Even though GacA does not seem to control virulence in the Aiptasia polyp model, i t is not entirely clear whether the same phenotype will be obtained in Acropora palmata Control of virulence and other proteobacteria as the regulation by GacA is indirect ( Heeb and Haas, 2001 ; Lapouge et al., 2008 ) This report is the first attempt to define regulatory cascades involved in virulence of a necrotizing coral pathogen. Even though it was not directly involved in virulence in a surrogate model, this study revealed a critical role for the S. marcescens PDL100 gacA in controlling behaviors involved in surface colonization (biofilm formation and surface swarming) as well as efficient utilization of the surface mucopolysaccharide of the host coral.

PAGE 108

108 Table 5 1. Bacterial strains and plamids Isolate or strain Relevant characteristic(s) a Source or reference Escherichia coli isolates F lac lac ZYA arg F) U169 rec A1 end A1 hsd R17 (rk mk+) pho A sup thi 1 gyr A96 rel A1 Invitrogen pir 434 derivative containing the pir gene ( Macinga et al., 1995 ) Serratia marcescens isolates Serratia marcescens PDL100 Coral pathogen isolated from white pox lesion, ATCC BAA 632, Tet R ( Patterson et al., 2002 ) Serratia marcescens CJKGacA3 PDL100 with disruptional mutant in gacA ; gacA::lacZ, Km R This study Plasmids pRK600 ColE1 replicon with RK2 tra genes, conjugation helper plasmid, Cm R ( Karunakaran et al., 2005 ) pCR2.1 TOPO Cloning vector; Km R Invitrogen pBBR1 MCS5 Gm Cloning vector, Gm R ( Kovach et al., 1995 ) pVIK112 kan lacZY for t ranscriptional fusions, Km R ( Kalogeraki and Winans, 1997 ) pSB377 Promoter probe plasmid with 5.8 kb luxCDABE cassette, Cb R ( Winson et al., 1998 ) pCJK8 pCR2.1 csrB from PDL100, Km R This Study pCJK9 PDL100 csrB promoter cloned into EcoRI site upstream of luxCDABE cassette of pSB337, Cb R This Study pCJK19 internal region of gacA amplified from PDL100 and cloned into pCR2.1, Km R This Study pCJK20 internal region of gacA from pCJK19 subcloned into EcoRI/SalI site of pVIK112, Km R This Study pCJK21 full length gacA amplified from PDL100 and cloned into pCR2.1. Km R This Study pCJK22 full length gacA from PDL100 from pCJK21 subcloned into EcoRI site of pBBR1 MCS5, Gm R This study a Cb R carbenicillin resistance; Cm R chloramphenicol resistance; Gm R gentamicin resistance; Km R kanamycin resistance; Tet R tetracycline resistance

PAGE 109

109 Table 5 2. Primers used for PCR Primer name Sequence Description/Target DNA Primers M13F GTAAAACGACGGCCAG lacZY forward primer M13R CAGGAAACAGCTATGAC lacZY reverse primer CJK12 GGAGATTTTTCCTTGATTAGCGTTCT gacA full length forward primer, S. marcescens PDL100 CJK18 TCGTCACGCAAAAGAACATTATATC gacA full length reverse primer, S. marcescens PDL100 CJK136 CATCATGTTGACTATCCATACTGAAAATC gacA internal forward primer, S. marcescens PDL100 CJK138 GTCGAC ACTGCTCCGAGATCTCATTCACTT gacA internal reverse primer, SalI site on 5' end, S. marcescens PDL100 CJK64 ACCGAATCCGAGATGACGATGGT P csrB forward primer S. marcescens PDL100 CJK87 GCTTTCCTGCTCCGCCGGTT P csrB reverse primer S. marcescens PDL100 CJK63 GATGGGCATGTTCGTCAACGG csrB reverse primer, S. marcescens PDL100 BA974 CGTATGTTGTGTGGAATTGTGAGCGG lacZY forward primer BA184 GATGTGCTGCAAGGCGATTAAGTTG lacZY reverse primer qPCR Primers CJK164 TCATCCTGACGCGGTTCCTCA csrB forward primer CJK165 GAGATGCCCAGGATGTTTCAGGATAG csrB reverse primer CJK166 GGTGTAGCGGTGAAATGCGTAGAGA 16S rRNA gene forward primer CJK167 GACATCGTTTACAGCGTGGACTACCA 16S rRNA gene reverse primer

PAGE 110

110 Figure 5 1. Clustal W Alignment of deduced GacA protein from S. marcescens PDL100 (top row) and other characterized GacA orthologs. All GacA orthlogs share the predicted phosphorylation site (D54, ), residues that interact with the phosphorylation site (D8 9, P58, G59, I60, T82, E86, S103, A107; circled star ( ) and I170 L175 region ( ) that anchors the turn helix DNA binding domain. Alignment and presence of predicted conserved residues are based on sequence homology to well ch aracterized GacA orthologs ( Tepli tski and Ahmer, 2004 ; Tomenius et al., 2005 ) S. marcescens PDL100 gacA nucleotide sequence is deposited in GenBank under accession number EU595544.1

PAGE 111

111 Figure 5 2 Regulation of csrB in a gacA dependent manner in S. marcescens To test the gacA dependent regulation of csrB the region spanning the predicted csrB promoter from PDL100 was cloned upstream of a promoterless luxCDABE cassette to make pCJK9 and a luminescence driven bioassay was used to quantify expression of the P csrB promoter in PDL100 (A) and in an isogenic E. coli uvrY mutant (C). The luminescent r eporter was moved into wild type, the gacA mutant, and the gacA mutant complemented in trans (pCJK22) in both S. marcescens and E. coli Overnight cultures were grown in LB, subcultured to an OD600 = 0.3 and further diluted 1/25,000 (the complemented muta nts were additionally diluted 1/10 to normalize initial luminescence to that of the mutant strains). Cultures were inoculated into wells of a 96 well black clear bottom polystyrene microtiter plate. Plates were incubated at 30C for S. marcescens and 37 C for E. coli and luminescence

PAGE 112

112 and corresponding A 595 (B and D) readings were measured every hour for 12 hours. Averages of two biological replicates and four technical replicates are plotted; error bars are standard error. Mutants in both S. marcescens and E. coli showed at least 10 fold reduction in luminescence, which was restored through complementation with gacA from S. marcescens PDL100. Experiments were repeated three times and data from one representative experiment are shown. Further quantifica tion of the reduced csrB expression in the CJKGacA3 mutant was confirmed through quantitative RT PCR of cDNA from four independent cultures of both PDL100 and CJKGacA3. There was a significant decrease in the fold change in csrB expression in CJKGacA3 com pared to PDL100 using 16S rRNA gene as an internal reference (t=3.896, dF= 4 p=0.0087).

PAGE 113

113 Figure 5 3 Serratia marcescens PDL100 csrB (A) Primers used to amplify full length csrB and the upstream promoter regions are underlined and the corresponding sequences are listed in Table 2. Full length csrB was amplified using primers CJK64 (red letters) and CJK63 (orange letters). The upstream promoter region of csrB was amplified using primers CJK64 and BA87 (blue letters), which contained the predicted upstream activation sequence (UAS) where GacA binds ( Suzuki et al., 2002 ; Teplitski et al., 2003 ; Kulkarni et al., 2006 ) The predicted transcriptional start site of csrB is indicated by a black star ( ). (B) Secondary structure prediction for CsrB 103.80) and repeated sequence elements (AGG) that may facilitate CsrA binding ( based on Babitzke and Romeo, 2007 ) The repeated elements are shown in blue type. It is of note that repeated sequence elements were located in loop segments or in single stranded segments between stem loops respectively. RNA sequence was folded using the mfold Web Server ( http://mfold.rna.albany.edu/?q=mfold/RNA Folding Form ). Recommended default constraints were modified only to allow for a maximum

PAGE 114

114 distance between paired bases to be 30. Secondary folding of csrB is subject to constraint parameters and the

PAGE 115

115 Figure 5 4 Competitive fitness of S. marcescens PDL100 and CJKGacA3. To test the importance of gacA regulation of metabolism for growth of S. marcescens on coral mucus, both wild type and CJKGacA3 were grown both individually and in co culture on mucus of Acropora palmata For competition experiments, overnight cultures were serially diluted and mixed 1:1. Cultures in (A) crude (total) mucus of A. palma ta (C) high molecular weight (> 5 kDa) fraction of A. palmata mucus, or (E) low molecular weight (< 5 kDa) fraction of A. palmata mucus were inoculated at 10 2 cfu ml 1 Cultures were incubated at 30C with shaking. To enumerate cells, at 12, 24, 48, 72, and 96 hours cultures were dilution plated onto marine agar supplemented with Tc10. Averages of three biological replications of the experiment (three independent cultures) are shown, error bars are standard error. In all three mucus types, both strains grew similarly in monocultures. To estimate the percentage of each strain within co culture (competitive fitness), colonies were patched onto marine agar supplemented with Tc10 and Km50 to differentiate between the wild type and the disruption mutant. T he relative proportion of the wild type is shown as the gray portion of the stacked column. Competitive fitness experiments were repeated at least twice and, and averages are shown (error bars are standard error). On crude (total) mucus (B) and high mole cular weight fraction of the mucus (D) the wild type was not competitive against the mutant (competitive index = 1.169 and 0.939, respectively). However, the competitive fitness of the wild type was increased on low molecular weight fraction of mucus (F) and was as competitive as the mutant (competitive index = 0.082).

PAGE 116

116 Figure 5 5 GacA regulation of swarming motility in S. marcescens PDL100 and CJKGacA3. Swarming of S. marcescens PDL100 on AB 0.4% agar is shown in panel A. Individual cultures of a CJKGacA3 (B), CJKGacA3 with pBBR1 MCS5 (C), and CJKGacA3 complemented with a wild type copy of gacA pCJK22 (D) were grown in marine broth, diluted 1:100 and grown for two hours. After incubation, 5 l were spotted onto an AB 0.4% swarm agar plate and incubated at 30C overnight. The gacA3 mutant and mutant with empty vector show reduced swarming while the complemented strain restores swarm architecture to wild type level. The experim ents were repeated three times; data from one representative experiment are shown.

PAGE 117

117 Figure 5 6 Biofilm formation in S. marcescens PDL100 and CJKGacA3. To test the importance of gacA for biofilm formation in S. marcescens individual cultures of S. marcescens PDL100 (A), CJKGacA3 (B), CJKGacA3 with empty pBBR1 MCS5 (C), and CJKGacA3 complemented with pCJK22 (D) were grown in marine broth at 30C overnight and dilution 1:100 into CFA medium. Dilutions were incubated at room temperature (22 24C) with shaking (70 rpm) for six hours followed by 72 hours statically. Biofilms were stained with 1% crystal violet in ethanol and photographed. These results were reproducible with biological replicates repeated in three individual assays,. The experiments w ere repeated three times (four independent cultures for each experiment) although quantification of the stained biofilm by A 595 measurement was highly variable due to residual crystal violet in the glass tube not associated with the biofilm. Data from one representative experiment are shown.

PAGE 118

118 Figure 5 7 Survivorship of Aiptasia pallida polyps infected with S. marcescens Ten fold dilutions of overnight cultures of S. marcescens PDL100 and CJKGacA3 were inoculated into microtiter plate wells with Ai ptasia pallida Infections were maintained at room temperature (22 24C) with illumination. Due to limitations in the number of polyps available a total of 14 A. pallida polyps were used to test the virulence of S. marcescens PDL100 over a seven day peri od. Two polyps were used per dilution. Polyps were scored da ily for disea se signs or mortality. Both strains appear equally virulent, causing 100% mortality when polyps were infected at 10 8 cfu ml 1 No polyp mortality was observed at the lower concentrations over the seven day period.

PAGE 119

119 CHAPTER 6 P RELIMINARY CHARACTERIZATION OF CHITINASE GENES FROM Serratia m arcescens PDL100 Introduction Corals form a dynamic symbiosis consisting of the animal polyp, photosynthetic dinoflagellates, and their ass ociated microbiota ( Rohwer et al., 2002 ; Knowlton and Rohwer, 2003 ; Rosenberg et al., 2007 ) Excess photosynthate from the zooxanthellae is transferred to the coral and is secreted from specialized cells in the form of mucus, a sulfated glycoprotein decorated with oligosaccharide side chains ( Ducklow and Mitchell, 1979 ; Meikle et al., 1987 ; Brown a nd Bythell, 2005 ) The major saccharides present in coral mucus are D arabinose, D mannose, and N acetyl D glucosamine, with smaller amounts of D galactose ( Meikle et al., 1 987 ; Jatkar et al., 2010 ; Tremblay et al., 2011 ) This mucus serves as a nutrient source for bacteria and a foundation for carbon cycling on coral reefs ( Wild et al., 2004 ) Serratia marcescens PDL100 is a multi host opportunistic pathogen able to infect Caribbean Acroporid corals. Early colonization and infection by the pathogen is dependent on effi cient adherence to and utilization of coral mucus. Recent studies have shown that catabolic enzymes are differentially regulated in S. marcescens D glucopyranos idase, and N acetyl D glucosaminidase (chitinase) were significantly increased during growth on Acropora palmata mucus ( Krediet et al., 2009b ; Krediet et al., 2009a ) galactopyranos idase was recently shown to be important for growth and competitive fitness of the pathogen on coral mucus ( Krediet et al., 2012a ) Chitin is one of the most abundant polymers in the oceans and many bacteria, including Serratia marcescens

PAGE 120

120 possess genes that encode chitinases to degrade chitin as a carbon source ( Bhowmick et al., 2007 ) Chitin has been of considerable interest in regards to biocontrol agents ( Ovadis et al., 2004 ) carbon cycling in the oceans by marine bacteria ( Bassler et al., 1991 ; Pruzzo et al., 2008 ) and genetic exchange and natural competence ( Meibom et al., 2005 ; Hunt et al., 2008 ) The most well studied bacterial chitinases originate from strains of S. marcescens and many have been characterized at the gene level ( Gal et al., 1997 ; Gal et al., 1998 ; Suzuki et al., 1998 ; Ruiz Sanchez et al., 2005 ) The crystal structure of ChiA from S. marcescens has also been determined ( Vaaje Kolstad et al., 2005 ) Corals have been known to produce c hitinases as a defense response to fungal infection in order to break down the chitinous cell walls of the invading pathogen ( Douglas et al., 2007 ) Chitin is an available substrate in coral mucus but the role that chitinases play in the ability o f opportunistic coral pathogens to bind to and utilize coral mucus remains unclear. In this study, chitinase genes of Serratia marcescens PDL100 were hypothesized to be critical for growth and competitive fitness on coral mucus. To test this hypothesis, two chitinase genes ( chiA and chiB ) in S. marcescens PDL100 were identified and characterized. Individual disruption mutants were constru cted in each gene and upon verification of the mutations, the hypothesis that chitinase activity was important for the ability of the pathogen to establish within the coral mucus and for competitive fitness in this environment.

PAGE 121

121 Materials and Methods Bacter ia were maintained at 80 C in 35% (v/v) glycerol in LB (Fisher Scientific, Atlanta, GA) or marine broth (Difco Becton, Dickinson and Company, Franklin Lakes, NJ). Isolated colonies were recovered on LB or marine agar (1.5%) plates with or without antibio tics as described below. Serratia strains were routinely grown at 30 C and E. coli at 37 C. Unless otherwise specified, cultures were supplemented with the following antibiotics: 10 g ml 1 tetracycline (Tc10); 50 g ml 1 kanamycin (Km50); 50 g ml 1 gentamycin (Gm50). Coral mucus was collected from apparently healthy colonies of Acropora palmata at Looe Key Reef, Florida (24 81 described ( Ritchie, 2006 ) To prepare mucus as a growth medium, samples were sequentially filtered and size fractionated as described previously ( Krediet et al., 2009a ) Primer sequences and descriptions are listed in Table 6 1. In general, genomic DNA was isolat ed from S. marcescens PDL100 using a GenElute Bacterial Genomic DNA Extraction Kit (Sigma Aldrich, St. Louis, MO). Plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA), and PCR products were purified using the Illustra GFX PCR DNA and Gel Band kit (GE Healthcare, Piscataway, NJ). To construct the chiA disruption mutant, a 408 bp internal fragment of chiA from PDL100 was amplified using primers CJK157 and CJK159, and the resulting PCR product was initially cloned into pCR2.1 (In vitrogen Carlsbad, CA ) to make pJM1, confirmed by M13F/R PCR and directionally subcloned into the EcoRI SalI site of pVIK112 to make pJM2. To make the chiB disruption mutant, a 403 bp internal fragment of chiB from PDL100 was amplified using primers CJK160 and CJK162,

PAGE 122

122 cloned into pCR2.1 to make pNG1 and subcloned into pVIK112 as above to make pNG2. All constructed plasmids were transformed into chemically competent or electrocompetent E. coli pi r and when necessary, moved into PDL100 by tri parental conjugation with pRK600 as a helper plasmid. Single crossover insertion mutation was confirmed by PCR with either CJK155 ( chiA ) or CJK3 ( chiB ) and the lacZ primer from pVIK112, BA184 and DNA sequenci ng at the Arizona State University Sequencing Core Facility. The chitinase ::lacZ insertion/disruption mutations in PDL100 was complemented by first amplifying full length chitinase genes from the genomic DNA using primers CJK155 and CJK156 ( chiA ) or CJK3 and CJK5 ( chiB ). The PCR products were cloned into pCR2.1 to make pJM3 and pNG3 respectively and subcloned into pBBR1 MCS5 digested with EcoRI and treated with calf intestinal phosphatase (N ew England Biolabs, Ipswich, MA ) to yield pJM4 and pNG4 respectiv ely. The complementation vectors construction were verified using the forward primers from the chitinase genes paired with a lacZY reverse primer from the pVIK112 vector, BA184. As a negative control, pBBR1 MCS5 vector was also moved into both S. marcesc ens PDL100 wild type and each of the disruption mutants. In vitro chitinase assays were performed on cells of S. marcescens and Vibrio coralliilyticus grown on both marine broth and crude (total) mucus from Acropora palmata at 30C using nitrophenyl N ace tyl D glucosaminide as described previously ( Miller, 1972 ; Krediet et al., 2009b ; Krediet et al., 2009a ) Preliminary Results An initial test of chitinase activity in overnight cultures of two opportunistic coral pathogens Serratia marcescens and Vibrio coralliilyticus revealed that S. marcescens

PAGE 123

123 PDL100 shows strong chitinase activity when grown in general laboratory media compared to V. coralliilyticus (Figure 6 1; t= 29.195, dF= 3.89 p<0.0001). These results are consistent with previously reported findings in isolates of S. marcescens ( Ovadis et al., 2004 ; Ruiz Sanchez et al., 2005 ) When grown on crude (total) mucus from Acropora palmata at 30 C the chitinase activity in both strains increased by more than double but PDL100 still displayed significantly higher leve ls of activity as compared to V. coralliilyticus (Figure 6 1; t = 11.251 dF= 4.67 p= 0.0001). Primers for amplification of chitinase genes from S. marcescens PDL100 were designed based on sequence homology of Serratia marcescens DB11 and characterized chitinase A ( chiA GenBank ID EU753246) and chitinase B ( chiB GenBank ID L38484) from S. marcescens isolates ( Gal et al., 1998 ) Final plasmids constructs chitinase disruption mutants were confirmed were confirmed by PCR and DNA sequencing (Figure 6 2). Discussion and Future Directions The opportunistic, multi host pathogen Serratia marcescens PDL100 possesses a t least two chitinase genes that appear to be strongly active on coral mucus from Acropora palmata and are consistent with previous characterization of these genes in other isolates of S. marcescens ( Gal et al., 1997 ; Gal et al., 1998 ; Ruiz Sanchez et al., 2005 ) Now that individual disruption mutations in both chiA and chiB have been constructed the role of these genes in the ability of S. marcescens PDL100 to e stablish within coral mucus and utilize chitin as a substrate for growth in order to gain a competitive advantage over the coral associated microbiota can be tested. Due to the increased chitinase activity on coral mucus in this pathogen, it is logical to hypothesize that these enzymes are critical to growth and survival on coral mucus. These two

PAGE 124

124 genes will be further characterized for their role in chitin degradation and competitive fitness of the pathogen on coral mucus. Phenotypic consequences of each of the individual mutations will be assessed through agar plate assays as well as quantitatively using nitrophenyl chitin substrates as described in the Materials and Methods. For agar plate assays, Marine agar will be supplemented with 0.05% wt/vol ethyl ene glycol chitin and 0.01% trypan blue as described in ( Thompson et al., 2001 ) Bacterial cultures w ill be spotted onto the agar plate and incubated at 30 C and will be monitored for a zone of clearing surrounding the cells against a blue background. Chitinase activity will be quantified by measuring the diameters of the zones of clearing and comparing mutant strains to the wild type. Restoration of chitinase activity will be assessed through complementation of the individual mutants with full copies of the respective chitinase genes harbored on pBBR1 MCS5 ( chiA : pJM4 and chiB : pNG4). Through these ass ays it is anticipated that mutations in chiA and chiB will lead to decreased chitinase activity when grown on coral mucus but these activities should be restored through complementation in trans The chitinase proteins will be analyzed through SDS PAGE and zymogram analysis. Excreted proteins in culture supernatant will be concentrated using a VivaSpin 10 spin dialysis column with a mole cular weight cut off of 10 kDa (Sartorium Stedim Biotech, Goettingen, Germany). Concentrated proteins will be analyzed b y SDS PAGE under reducing conditions on 10% polyacrylamide gels as previous described ( Thompson et al., 2 001 ) The SDS will then be removed and the proteins reactivated with a casein EDTA protocol and chitinase activities will be detected using fluorescent chitin substrate (4 methylubmelliferyl D diacetylchitobioside; Sigma)

PAGE 125

125 added to the gel. This substra te detects both endo and ex o chitinase enzyme types. From these experiments, the effects of disruption mutations of chitinase genes of S. marcescens PDL100 during growth on coral mucus will be elucidated. In addition to characterization of the in dividual chitinase genes, the role that these genes play in the competitive fitness of the pathogen on coral mucus will be assessed. S. marcescens PDL100 produces high levels of chitinases upon growth on coral mucus, and this chitinase activity may provid e the pathogen a competitive advantage over the resident microbiota present on the coral surface. To test this, individual cultures of wild type and chitinase mutants as well as 1:1 co cultures will be grown on high weight coral mucus (which is likely to contain chitin polymers) as previously described ( Krediet et al., 2012a ) As these mutations a re lacZY fusions, there is a potential that the mutants will maintain their ability to compete on coral mucus. Chitin is not the only constituent in coral mucus and these fusions confer added ability to degrade galactoside, which is also abundant in A. palmata mucus ( Meikle et al., 1987 ; Krediet et al., 2009b ; Krediet et al., 2009a ; Krediet et al., 2012a ) Therefore, a control strain that shows high levels of lacZY expression will be tested in parallel for its ability to compete against wild type S. marcescens PDL100 on coral mucus. Upon completion of these experiments this study will have comprehensively characterized two chitinase genes isolated from S. marcencens PDL100 and demonstrated the role chitin degradation plays in the ability of this coral pathogen to gro w and compete in the coral mucus environment. Future directions of this research will include screening coral associated bacteria for potential interference of chitinase activity in S. marcescens PDL100. Similar screens have already been done for other

PAGE 126

126 c atabolic enzymes induced in PDL100 during growth on coral mucus, and these enzymes proved to be important for competitive fitness and other early colonization behaviors of the pathogen ( Krediet et al., 2012a ) These screens can be done in a high throughput fashion using agar medium supplemented with ethylene glycol chitin and indicator dyes such as trypan blue as described above. Candidate coral commensal strains will then be further characterized and the mechanism of inhibition explored. Chitinases have also been shown to be involved in virulence in S. marcescens ( Kurz et al., 2003 ; Grimont and Grimont, 2006 ) and it is possible that chitinolytic activities associated with this pathogen aid in inf ection of corals. To test this, chitinase mutants can be inoculated onto individual Aiptasia pallida polyps and corresponding lethality at different concentrations compared to wild type S. marcescen s

PAGE 127

127 Table 6 1. Primers used for PCR Primer name Sequence Description/Target M13F GTAAAACGACGGCCAG lacZY forward primer M13R CAGGAAACAGCTATGAC lacZY reverse primer CJK155 AATGGACAACGCGGGAACTCTTAT chiA full length forward primer CJK156 AGACAGGAGGAAATGCTGAAGGATT chiA full length reverse primer CJK157 AAGAGATCGAAGGCAGTTTCCAGG chiA internal forward primer CJK159 GTCGAC CCTTCATCAGCAGCACATAGGTTTC chiA internal reverse primer, SalI site on 5' end CJK3 GTCGAC GAATTCGTTCACGCTGAACGTTGGC chiB full length forward primer, SalI site on 5' end CJK5 GATGTCTACAGCCTGATGGGCCGC chiB full length reverse primer CJK160 CGGAAGTAGACGGTTTCATCGCC chiB internal forward primer CJK162 GTCGAC GGCGCTCGACACTCCTACAATCAT chiB internal reverse primer SalI site on 5' end BA184 GATGTGCTGCAAGGCGATTAAGTTG lacZY reverse primer

PAGE 128

128 Figure 6 1. Chitinase activities of Serratia marcescens PDL100 and Vibrio coralliilyticus All cu ltures were grown overnight in A) marine broth or B) crude (total) mucus from Acropora palmata Averages of three biological and four technical replications are sown. Error bars are standard error. There was a significant difference in chitinase activity between the two strains on marine broth (t= 29.195, dF= 3.89 p<0.0001) and coral mucus ( t= 1 1.251, dF= 4.67 p=0.0001).

PAGE 129

129 Figure 6 2. PCR amplification and molecular cloning of chiB from S. marcescens PDL100. Full length chiB and an internal region of chiB were PCR amplified from S. marcescens PDL100 genomic DNA (panel A lanes 1 and 5 resp ectively). Primers CJK3 and CJK5 were used to amplify full length chiB and primers CJK160 and CJK162 were used to amplify the internal region of chiB PCR products were initially cloned into pCR2.1 (lanes 2 and 6) and full length chiB was subcloned into pBBR1 MCS5 ( Kovach et al., 1995 ) predigested with EcoRI (panel C) and confirmed by PCR (panel A lane 3). The internal re gion of chiB was subcloned into pVIK112 ( Kalogeraki and Winans, 1997 ) which was predigested with EcoRI/SalI (panel B) and the final constr u ct was PCR confirmed (panel A lane 7). A disruption mutant in chiB was constructed using the pVIK112 chiB internal (pNG2) construct in PDL100 and the mutant was confirmed by PCR with primers CJK3 and BA184 (panel A lane 9 = WT PDL100 with no product; lane 10 = chiB mutant with positive PCR product). Negative controls for PCR (no DNA template added) are shown in panel A ; lanes 4, 8, 11, and 12 respectively

PAGE 130

130 CHAPTER 7 CONCLUSIONS AND FUTURE DIRECTIONS Coral reefs are valuable ecosystems and are vital to the overall health and sustainability of near shore marine systems. The goods and services originating from these ecosystems support local economies and represent a wide array of benefits to society ( Johns et al., 2001 ) Coral reefs, however, are facing ever increasing environmental stressors, limiting their pro ductivity and ultimately leadi ng to their demise. The studies presented here investigated how the biology of the corals, their interactions with other organisms, and environmental cues contribute to the complexity of coral reef microbial ecology. The majority of organisms that cause coral diseases are not dedicated pathogens, but are opportunistic Opportunistic pathogens attack a host only when the host is stress ed and its defenses are compromised. Coral diseases caused by these pathogens are no w widespread. Several opportunistic pathogens of corals were recently identified including Aurantimonas coralicida for white plague type II ( Denner et al., 2003 ) Vibrio shiloi for bleaching of Oculina patagonica ( Kushmaro et al., 1996 ; Kushmaro et al., 1997 ) Serratia marc escens for white pox disease ( Patterson et al., 2002 ; Patterson Sutherland and Ritchie, 2004 ) Aspergillus sydowii for sea fan disease ( Geiser et al., 1998 ) and Vibrio coralliilyticus for bleaching and lysis of Pocillopora damicornis ( Ben Haim and Rosenberg, 2002 ; Ben Haim et al., 2003b ) and white syndrome in Pacific corals ( Sussman et al., 2008 ) but it is not yet clear how native coral microbiota interact with invading pathogens and how these native coral associated microorganisms may function in protecting the coral host from an attack by opportunistic pathogens. Lack of such knowledge makes it impossible to devise effective strategies

PAGE 131

131 to manage and control coral pathogens. The ability to bridge this gap in knowledge will lead to the development of sustainable manag ement practices based on the utilization of beneficial native coral associated bacteria. Serratia marcescens relies on glycosidases and chitinases that are differential ly regulated during growth on coral mucus ( Krediet et al., 2009b ; Krediet et al., 2009a ) and the current studies presented here characterized six coral associated strains capable of interfering with metabolic enzymatic activities and decreasing the overall growth of S. marcescens on coral mucus. Interference of enzymatic activities was cell associated and dependent on co culturing of commensals and the pathogen. In addition to inhibiting enzymatic activities in S. marcescens that are involved in coral mucus utilization the coral associated bact eria also inhibited swarming motility in the pathogen. The results of this study demonstrate that coral associated bacteria affect the co regulation of metabolic activities and swarming motility, and thus, S. marcescens PDL100 ability to compete in the co ral mucus environment. The global regulator GacA was found to control competitive fitness on high molecular weight versus low molecular weight fractions of coral mucus. In competition assays the gacA mutant was more fit on high molecular weight mucus of Acropora palmata while on low molecular weight mucus the wild type was as competitive as the mutant, consistent with previous studies ( Pernestig et al., 2003 ; Teplitski et al., 2006b ) The mutation in gacA in S. marcescens PDL100 led to significant differences in surface colonization abilities between the wild type and mutant. These differences are consistent with reports in other bacteria, and indicate an important function for gacA in modulating surface associated behavi ors in the pathogen, although we did not observe a role in S. marcescens virulence in a polyp

PAGE 132

132 model. Understanding the genes regulated during early colonization and infection by Serratia marcescens is critical to the overall understanding of potentially e volutionarily conserved virulence mechanisms in opportunistic pathogens. It is now clear that interactions among host associated bacterial communities are critical for overall health and success of the coral holobiont but our understanding of the in situ i nteractions are still very much incomplete. Serious strides have been made in the study of the microbial ecology of corals and other well studied hosts in terms of bacterial enumeration ( Garren and Azam, 2010 ) visualizing bacteria in situ using fluorescence in situ hybridization FISH ( Ainsworth and Hoegh Guldberg, 2009 ; Sharp et al., 2011 ) coral disease diagnostics ( rev. Pollock et al., 2011 ) and bacterial community analysis using next generation sequencing ( Wegley et al., 2007 ; Dinsdale et al., 2008 ; Thurber and Correa, 2011 ) These breakthroughs allow us to constrain our focus to critical pieces of the coral holobiont and the microbial interactions that det ermine the structure and function. Coral reefs face an uncertain future and much research is still needed if we are to preserve these fragile ecosystems. Recent reviews have addressed critical needs and questions in order to enhance our understanding of h ost associated microbial communities. While the field has made significant progress in the last few years, many of these questions should be revisited ( Bourne et al., 2009 ; Teplitski and Ritchie, 2009 ; Ainsworth et al., 2010 ; Robinson et al., 2010 ; Garren and Azam, 2012b ) We pose some of these questions here: 1. What i s the link between host associated microbial communities and disease?

PAGE 133

133 The beneficial and pathogenic roles of bacteria and viruses of corals are now beginning to be understood as a result of advanced genetic and microscopic techniques that have been applied to the coral holobiont. We recommend that research continue to focus on identification and characterization of causative agents of disease. Our understanding of coral diseases is dependent on the ability to study the individual pathogens and their inter actions with the coral microbiota. New studies using genomic and transcriptomic approaches will not only identify members of the microbial community associated with both healthy and diseased corals but also conserved functions/services important to the health and stability of the coral holobiont. 2. How do host associated microbial comm unities assemble within their respective hosts? This question is rooted in our understanding of coral immunity and how corals select potentially beneficial microbial partners and are able to select against potential pathogens. This ability may be dependen t on lectins and other immune proteins produced by the coral ( Kvennefors et al., 2008 ) More research is require d to fully deduce how corals recognize potential symbionts from pathogens. Recent research suggests that coral microbes co habitat through temporal and preferential degradation of available carbon sources in coral mucus. This is one potential mechanism t o allow coral associated bacteria, as well as invading pathogens, to gain a foothold in the coral mucus environment. Other exciting mechanisms to structure the microbial communities that need to be further explored include antimicrobial production (e.g. Rypien et al., 2010 ; Kvennefors et al., 2012 ) and cell to cell signaling ( Alagely et al., 2011 ; Golberg et al., 2011 ) 3. How do host associated microbial communities respond to disturbance?

PAGE 134

134 Significant shifts in the composition of microbial communities on coral have been observed in response to environmental stressors and bacterial infection ( Bourne et al., 2008 ; Sunagawa et al., 2009b ; Meron et al., 2011 ) The ability of the resident microbes to respond to disturbance and recover will no doubt depend on the type and intensity of the disturbance. Research focused on community members shared among healthy corals across different environmental conditions both spatially and temporally will be critical to our ability to measure of the resilience of the coral holobiont in response to disturbance. 4. How can our understand ing of coral associated microbes be applied to mitigate the effects of coral disease by opportunistic pathogens? In this review, we have seen the potential benefits that specific members of the coral microbiota offer the host. There is potential for using such strains as probiotics by inoculating corals grown in aquaculture that are destined for transplantation on the reef. The microbial community associated with aquaculture grown corals is inherently different from the natural community experienced on th e reef, which allows for pre inoculation with beneficial microbes that may offer increased immune functions to the host in the field ( rev. Teplitski and Ritchie, 2009 ) It is also possible to use newly gained knowledge about such beneficial bacteria t as early indicators of ecosystem health. Ultimately, effective mitigation of coral diseases is dependent on proper management of coral reef ecosystems, which means limiting potential anthropogenic inputs such as nutrient influx that will promote growth of opportunistic pathogens. 5. How can we study the in situ interactions on corals in the face of rapid coral decline?

PAGE 135

135 Nucleic acid based techniques (e.g. fluorescence in situ hybridization, FISH) coupled with high speed laser confocal microscopy have opened new doors into the study of the in situ spatial distribution of microbes and their interactions on the coral surface ( Ainswort h and Hoegh Guldberg, 2009 ; Sharp et al., 2010 ; Sharp et al., 2011 ; Garren and Azam, 2012a ) These technologies will only enhance our ability to study coral associated microbial interactions on the coral surface and validate observations observed in vivo and in vitro Up until recently, investigations into antimicrobial and other inhibitory compounds by coral associated bacteria were limited to in vitro studies. Alagely et al. ( 2011 ) deployed resin chemical traps on coral colonies and were able to isolate hydrophobic inhibitory compou nds effective against S. marcescens PDL100. Similar studies are needed to demonstrate the presence and importance of these compounds in the coral mucus environment. 6. How can the use of model organisms enhance our study of microbial interactions within the coral holobiont? A recent increase in the amount of progress being done in fields of molecular, cell and developmental biology is largely due to the intense study of a few well characterized model organisms. These organisms were originally chosen due to s pecific properties that made them amenable to quick and intense experimentation in the laboratory. Model organisms generally have fast growth rates, which allow for rapid culture in the laboratory. Often, clonal or inbreed populations are available which are susceptible to genetic manipulation and biochemical and microscopic analyses ( Weis et al., 2008 ) Early work in model systems has paved the way for new technologies such as genomics, and improved microscopy methods, which allows for a deeper understanding of complex interactions.

PAGE 136

136 Until recently, the model systems approach had not been adapted to the field of coral biology. With all the success of other model systems, Weis et al. ( 2008 ) argue for a shift to intense focus on one or more model organisms. The tropical anemone Aiptasia pallida has been nominated as a model organism for coral study. Like the major reef building corals, Aiptasia is an anthozaon that is also symbiotic with dinoflagellates of the genus Symbiodinium ( Weis et al., 2008 ) The advantages of Aiptasia as a model organism for the study of coral biology are similar to those of many other model organisms. While the availability of natural corals for study in the laboratory is rapidly declining, Aiptasia can be grown in large numbers in any laboratory. A st andout advantage of this model organism is that it can be fully cleared of symbionts by temperature shock, maintained in a symbiont free state for prolonged periods of time, and re infected with a variety of Symbiodinium strains ( Weis et al., 2008 ) Aiptasia has recently been shown to serve as a surrogate host for infection by a number of opportunistic coral pathogens including Serratia marcescens and Vibrio spp. ( Krediet et al., 2012b ) The study of coral associated microbial communities and coral disease is an exciting and uncertain field. It is estimated that upwards of 35% of coral reefs have already been lost or are at risk of collapse within the next 15 20 years ( Bourne et al., 2009 ) Significant discoveries can be made with multi and interdisciplinary research initiatives to rapidly accelerate our understanding through both laboratory and field studies. Embracing recent techniques and knowledge gained in the biomedical field and f rom work on historically well studied model systems will be essential for the

PAGE 137

137 advancement of the field necessary for the preservation of these economically and ecologically important ecosystems.

PAGE 138

138 APPENDIX SUPPLEMENTAL MATERAL TO CHAPTER 4 Characterization and Complementation of S. marcescens CK2A4 To characterize galatosidase deficient Mariner transposon mutants, their total genomic DNA was isolated from overnight cultures with a GenElute Bacterial Genomic DNA Extraction Ki t (Sigma Aldric h, St. Louis, MO instructions. Genomic DNA (5 g) was digested with RsaI (N ew England Biolabs, Ipswich, MA ) for four hours at 37 C run on a 0.9% agarose gel in TAE buffer, and the DNA fragments of 1 4 Kb were excised from the gel and purified with the Illustra GFX PCR DNA/Gel Band Purification kit (GE Lifesciences, Buckinghamshire, UK). The purified DNA fragments were incubated with T4 DNA ligase (New England Biolabs) under the conditions that favor intra molecular ligati on at 14 C overnight and resulting DNA circles were subjected to inverse GGCTTGAACGAATTGTTAGGTGGC CGGCCGCGTAATACGACTCACTA C, 5 min; 35 cycles of 94 C, 1 min; 53 C, 1 min; 72 C, 2 min; final extension at 72 C, 10 min). iPCR products were cloned into pCR2.1 TOPO (Invitrogen, Carlsbad, CA ), transformed into chemically competent E. coli DH5 and sequenced with M13F/R primers at the University of Florida Biotechnology Core Facility. In an attempt to complement the transposon mutation in CK2A4, the entire malEFG operon was PCR amplified from genomic DNA of S. marcescens PDL100 with primers CJK102 GACCCACTATTACCGCGAAACGTC and CJK103 TCGATACCCTGATCTACGCCGC an d HiFi Platinum Taq polymerase (Invitrog en, Carlsbad, CA ). The 4.8 Kbp PCR product was cloned into pCR2.1, generating plasmid

PAGE 139

139 (pCJK16) and subsequently sub cloned into pBAD18 kan and pBBR1 kan using EcoRI to generate plasmids pCJK17 and pCJK18, which were transformed into chemically competent E. coli DH5 Th ese plasmid s were moved into CK2A4 through tri parental mating using pRK600 as a helper plasmid. The complementation vector as well as kV, 0.2 cm cuvette, E. coli malE, malF or malG mutants using a using a Bio Rad MicroPulser (Bio Rad Laboratories, Hercules, CA ). Restoration of enzyme activities in the mutants was tested with Miller assays for each enzyme. Transductions of Individual malE malF and malG Mutants Because plasmids containing S. marcescens PDL100 operon did not to complement CK2A4, E. coli mutants in malE, malF and malG were constructed. Individual E. coli BW2 5113 mutants were obtained through the Keio Collection ( Baba et al., 2006 ) As E. coli strain BW2 5113 is lac ( Hayashi et al., 2006 ) each of the mutants was transduced into strain W3110 ( lac + ) using phage P 1 ( Lennox, 1955 ; Ikeda and Tomizawa, 1965 ) These mutants were used for the complementation experiments using pCJK17 and pCJK18 plasmids and for the phenotypic assays. Enzyme activities of galactosidase, N acetyl D glycopyranosidase, and D glucopyranosidase were tested for wild type and mutant strains of both S. marcescens and E. coli ( Miller, 1972 ) Preliminary Characterization of Inhibitory Compounds from Exiguobacterium sp. 33G8 In order to begin to determine the type of inhibitory compounds produced by Exigobacterium sp. 33G8 in co culture, cell free supernatant from the 33G8 PDL100 co incubation experiment was extracted by flash ion exchange chromatography followed by C18 resin chromatography. At the time of extraction the OD 600 of the 33G8 culture was

PAGE 140

140 ~1.5. 500 ml of the culture were pelleted at 14,000 rpm for 10 minutes using an Avanti J 26 XP centrifug e (Beckman Coulter, Atlanta, GA ), the supernatant was transferred to a new centrifuge tube and centrifuged at 14,000 rpm for 10 minutes to remove all of the cells. The cell free supernatant was applied to an ion exchange resin column (DOWEX 50 W, Sigma Aldrich, St. Louis, MO ). The flow through was then subject to reverse phase Silica C 18 flash chromatography (Alltech Associates, Inc., Deerfield, IL ) in sequence. Fo r both chromatographies, resin bed volume was 10 ml. DOWEX 50W ion exchange resin was charged with 10 bed volumes of HPLC water prior to the application of the sample. The reverse phase Si C 18 resin was first washed in reagent ethanol and then equilibrat ed in 10 bed volumes of HPLC water. Substances bound to the ion exchange resin were eluted with 3 bed volumes of 2N NH 4 OH as in ( Clark et al., 2011 ) The reverse phase Si C 18 column was eluted with 3 bed volumes of 100% isopropanol. The NH 4 OH eluent was lyophilized and NH 4 OH was further sublimated for 48 hrs using a Freezone 18 freeze d rie r (Labconco, Kansas City, MO ) and extracted in 4 ml of reagent ethanol and the remaining salts were dissolved in 1 ml HPLC water. The isopropanol eluent from the reverse phase Si C 18 resin was rotary evaporated using a Collegiate Rotavapor V 500 (Bchi L aboratories, Postfach, Switzerland) over water bath at 45 C and the remaining water was lyophilized. The yellowish residue in the boiling flask was first extracted with isopropanol, then with water:methanol (50:50 vol/vol). Serial dilutions of these samp les were used in bioassays.

PAGE 141

141 Figure A 1. Inhibition of the S. marcescens galactosidase activity by coral commensal bacteria. From a screen of over 300 coral commensal isolates approximately 8% were shown capable of inhibiting galactosidase activity in S. marcescens PDL100. The inhibitory strains were further narrowed down to six isolates [ B) Photobacterium sp. 33G2 C) P. damselae 33G4 D) Exiguobacterium sp. 33G8 E) P. leiognathi 33C4 F) P. leiognathi 33E3 and G) Vibrio h arveyi 34B3 ]. Their identity was confirmed by sequencing fragments of 16S rRNA genes. To validate their inhibitory activities, the isolates were first streaked across a glycerol artificial seawater agar (GASWA) plate supplemented with X gal 40 g ml 1 Then strains of S. marcescens (PDL100: coral pathogen, MG1: rotten cucumber isolate, and ATCC 43422: human throat isolate) were cross streaked perpendicular to the coral commensal. As a control, PDL100 and MG1 cultures were spotted onto GASWA supplemented with X gal 40 g ml 1 Plates were then incubated for 16 hrs at 30 C. Each of the coral commensals was able to inhibit enzymatic activity in PDL100 and MG1; ATCC 43422 does not produce significant levels of galactosidase. Plates were imaged with a Ca nnon Eos Rebel Xsi digital camera. Images were corrected for auto levels in Adobe Photoshop. The screen was conducted once, with three independent cultures of each coral isolate. Data from a representative experiment are shown.

PAGE 142

142 Figure A 2. Preliminary characterization of inhibitory compounds produced by Exiguobacterium sp. 33G8 in co culture with S. marcescens PDL100. After six hour co culture with PDL100, cell free culture supernatant from 33G8 was subject to ion exchange chromatograph y (DOWEX 50 W), and the flow through was re chromatographed using reverse phase Si C18. Substances retained on the ion exchange column were eluted with three bed volumes of 2N NH4OH. Reverse phase Si C18 column was eluted with three bed volumes of isopro panol. Eluents were dried, and re extracted with either ethanol and water (ion exchange eluent, A and B) or isopropanol and water:methanol (reverse phase Si C18 eluent, C and D). Each extract was serially diluted (3 fold) and co incubated with S. marcesc ens for six hours. The highest dilution corresponds to 1.5 ml of the extracted culture. Upon glucopyranosidase activity was assayed. Consistent inhibitory activity was associated with the ethanol soluble extract of the io n ex change eluent ( A). Preliminary characterization of the activities was done once; enzymatic assays were conducted with four technical replicates (standard errors are shown).

PAGE 143

143 LIST OF REFERENCES Ainsworth, T.D., and Hoegh Guldberg, O. (2009) Bacterial communities closely associated with coral tissues vary under experimental and natural reef conditions and thermal stress. Aquat Biol 4 : 289 296. Ainsworth, T.D., Thurber, R.V., and Gates, R.D. (2010) The future of coral reefs: a microbial perspective. Tren ds Ecol & Evol 25 : 233 240. Alagely, A., Krediet, C.J., Ritchie, K.B., and Teplitski, M. (2011) Signaling mediated cross talk modulates swarming and biofilm formation in a coral pathogen Serratia marcescens ISME J 5 : 1609 1620. Amcheslavsky, A., Jiang, J., and Ip, Y.T. (2009) Tissue damage induced intestinal stem cell division in Drosophila Cell Stem Cell 4 : 49 61. Anthony, K.R.N., Maynard, J.A., Diaz Pulido, G., Mumby, P.J., Marshall, P.A., Cao, L., and Hoegh Guldberg, O. (2011) Ocean acidification and warming will lower coral reef resilience. Global Change Biol 17 : 1798 1808. Ashida, H., Ogawa, M., Kim, M., Mimuro, H., and Sasakawa, C. (2012) Bacteria and host interactions in the gut epithelial barrier. Nature Chem Biol 8 : 36 45. Austin, B., Austin, D. Sutherland, R., Thompson, F., and Swings, J. (2005) Pathogenicity of vibrios to rainbow trout ( Oncorhynchus mykiss Walbaum) and Artemia nauplii Environ Microbiol 7 : 1488 1495. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M. et al. (20 06) Construction of Escherichia coli K 12 in frame, single gene knockout mutants: the Keio collection. Mol Syst Biol 2 : 2006.0008. Babitzke, P., and Romeo, T. (2007) CsrB sRNA family: sequestration of RNA binding regulatory proteins. Curr Opin Microbiol 10 : 156 163. Banin, E., Ben Haim, Y., Fine, M., Israely, T., and Rosenberg, E. (2000) Virulence mechanisms of the coral bleaching pathogen Vibrio shiloi Proc 9th International Coral Reef Symposium, Bali, Indonesia, 23 27 October 2000 2 : 1261 1266. Bassler, B.L., Yu, C., Lee, Y.C., and Roseman, S. (1991) Chitin utilization by marine bacteria. Degradation and catabolism of chitin oligosaccharides by Vibrio furnissii J Biol Chem 266 : 24276 24286. Bauer, W.D., Mathesius, U., and Teplitski, M. (2005) Eukaryotes deal with bacterial quorum sensing. ASM News 71 : 129 135. Ben Haim, Y., and Rosenberg, E. (2002) A novel Vibrio sp. pathogen of the coral Pocillopora damicornis Mar Biol 141 : 47 55.

PAGE 144

144 Ben Haim, Y., Zicherman Keren, M., and Rosenberg, E. (2003a) Temperature regulated bleaching and lysis of the coral Pocillopora damicornis by the novel pathogen Vibrio coralliilyticus Appl Environ Microbiol 69 : 4236 4242. Ben Haim, Y., Thompson, F.L., Thompson, C.C., Cnockaert, M.C., Hoste, B., Swings, J., and Rosenberg, E. ( 2003b) Vibrio coralliilyticus sp. nov., a temperature dependent pathogen of the coral Pocillopora damicornis Int J Syst Evol Microbiol 53 : 309 315. Bhowmick, R., Ghosal, A., and Chatterjee, N.S. (2007) Effect of environmental factors on expression and act ivity of chitinase genes of vibrios with special reference to Vibrio cholerae J Appl Microbiol 103 : 97 108. Boris, S., and Barbes, C. (2000) Role played by lactobacilli in con trolling the population of vaginal pathogens. Microbes and Infect 2 : 543 546. Bourne, D., Iida, Y., Uthicke, S., and Smith Ke une, C. (2008) Changes in coral associated microbial communities during a bleaching event. ISME J 2 : 350 363. Bourne, D.G., Garren, M., Work, T.M., Rosenberg, E., Smith, G.W., and Harvell, C.D. (2009) Microbia l disease and the coral holobiont. Trends Microbiol 17 : 554 562. Brencic, A ., and Lory, S. (2009) Determination of the regu lon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA. Mol Microbiol 72 : 612 632. Brencic, A., McFarland, K.A., McManus, H.R., Castang, S., Mogno, I., Dove, S.L., and Lory, S. (2009) Th GacS/GacA signal transduction system of Pseudomonas aeruginosa acts exclusively through its control over the transcription of the RsmY and RsmZ regulatory small RNAs. Mol Microbiol 73 : 434 445. Broadbent, A.D., Jones, G.B., and Jones, R.J. (2002) D MSP in corals and benthic algae from the Great Barrier Reef. Estuarine Coastal and Shelf Science 55 : 547 555. Brown, B.E., and Bythell, J.C. (2005) Perspectives on mucus secretion in reef corals. Mar Ecol Prog Ser 296 : 291 309. Brown, R.N., and Gulig, P.A. (2008) Regulation of f atty acid metabolism by FadR is essential for Vibrio vulnificus to cause infection of mice. J Bacteriol 190 : 7633 7644. Bythell, J.C., and Wild, C. (2011) Biol ogy and ecology of coral mucus release. J Exp Mar Biol Ecol 408 : 88 93. Carbonell, G.V., Della Colleta, H.H.M., Yano, T., Darini, A.L.C., Levy, C.E., and Fonseca, B.A.L. (2000) Clinical relevance and virulence fa ctors of pigmented Serratia marcescens FEMS Immunol Med Microbiol 28 : 143 149.

PAGE 145

145 Cerveny, K.E., DePaola, A., Duckworth, D.H., and Guli g, P.A. (2002) Phage therapy o f local and systemic disease caused by Vibrio vulnificus in iron dextran treated mice. Infect Immun 70 : 6251 6262. Cervino, J.M., Hayes, R.L., Polson, S.W., Polson, S.C. Goreau, T.J., Martinez, R.J., and Smith, G.W. (2004) Relationship of Vibrio species infection and elevated temperatures to yellow blotch/band disease in Caribbean corals. Appl Environ Microbiol 70 : 6855 6864. Cervino, J.M., Thompson, F.L., Gomez Gil, B., Lorence, E.A., Goreau, T.J., Hayes, R.L. et al. (2008) The Vibrio core group induces y ellow band disease in Caribbean and Indo Pacific reef building corals. J Appl Mic robiol 105 : 1658 1671. Chavez, R.G., Alvare z, A.F., Romeo, T., and Georgell is, D. (2010) The physiological stimulus for the BarA sensor kinase. J Bacteriol 192 : 2009 2012. Chimetto, L.A., Brocchi, M., Thompson, C.C., Ma rtins, R.C.R., Ramos, H.R., and Thompson, F.L. (2008) Vibrios dominate as cultur a ble nitrogen fixing bacteria of the Brazilian coral Mussismilia hispida Sys Appl Microbiol 31 : 312 319. Choi, K.H., Kumar, A., and Schweizer, H.P. (2006) A 1 0 min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. J Microbiol Methods 64 : 391 397. Clark, L.F., Johnson, J.V., and Horenstein, N .A. (2011) Identification of a gene c lus ter that initiates azasugar b iosynthesis in Bacillus amyloliquefaciens Chembiochem 12 : 2147 2150. Cline, K., Wernerwashburne, M., Andrews, J., and K eegstra, K. (1984) Thermolysin is a suitable protease for probing the surface of intact pea c hloroplasts. P lant Physiol 75 : 675 678. Cox, C.E., Zaragoza, W.J., Krediet, C.J., and Teplits ki, M. (2012) Bioassays for the detection of compounds that disrupt biofilm fo proteobacteria. In Biofouling Methods Dobretsov, S. (ed): Wiley Blackwell, p. 416. Crossland, C.J. (1987) In situ release of mucus and DOC lipid from the corals Acropora variabilis and Stylophora pistillata in different light regimes. Coral Reefs 6 : 35 42. Cui, Y., Chatterjee, A., Yang, H., and Chatterjee, A.K. (2008) Regulatory network controlling extracellular proteins in Erwinia carotovor a subsp. carotovora: FlhDC, the master regulator of flagellar genes, activates rsmB regulatory RNA production by affecting gacA and hexA (lrhA) expression. J Bacteriol 190 : 4610 4623.

PAGE 146

146 Cunning, J.R., Thurmond, J.E., Smith, G.W., Weil, E., an d Ritchie, K.B. (2008) A survey of Vibrios associated with healthy and Yellow Band diseased Montastraea faveolata Proc 11th International Coral Reef Sym posium, Ft Lauderdale, Florida, 7 11 July 2008 1 : 206 210. Datsenko, K.A., and Wanner, B.L. (2000) One step in activatio n of chromosomal genes in Escherichia coli K 12 using PCR products. Proc Natl Acad Sci U S A 97 : 6640 6645. Davis, R.H. (2004) The age of model organisms. Nature Reviews Genetics 5 : 69 76. D'Costa, V.M., McGrann, K.M., Hughes, D.W., and Wright, G.D. (2006 ) Sampling the antibiotic resistome. Science 311 : 374 377. Denner, E.B.M., Smith, G.W., Busse, H.J., Schumann, P., Narzt, T., Polson, S.W. et al. (2003) Aurantimonas coralicida gen. nov., sp nov ., the causative agent of white plague type II on Caribbean scleractinian corals. Int J Sys t Evol Microbiol 53 : 1115 1122. Dharmani, P., Srivastava, V., Kissoon Singh, V., and Chadee, K. (2009) Role of i ntesti nal mucins in innate host defense mechanisms against p athogens. J Innate Immun 1 : 123 135. Dinsdale, E.A., Pantos, O., Smriga, S., Edwards, R.A., An gly, F., Wegley, L. et al. (2008) Microbial ecology of four coral atolls in the Northern Line Islands. PLoS ONE 3 : e1584. Douglas, N.L., Mullen, K.M., Talmage, S.C., and Harvell, C.D. (20 07) Exploring the role of chitinolytic enzymes in the sea fan coral, Gorgonia ventalina Mar Biol 150 : 1137 1144. Ducklow, H.W., and Mitchell, R. (1979) Composition of Mucus Released by Coral Reef Coelenterates. Limnol Oceanog r 24 : 706 714. Efrony, R., Atad, I., and Rosenberg, E. (2009) Phage therapy of cor al white plague disease: properties of phage BA3. Curr Microbiol 58 : 139 145. Efrony, R., Loya, Y., Bacharach, E., and Rosenberg, E (2007) Phage therapy of coral disease. Coral Reefs 26 : 7 13. Ellner, S.P., Jones, L.E., Mydlarz, L.D., and Harvell, C.D. (2 007) Within host disease ecology in the sea fan Gorgonia ventalina : mode ling the spatial immunodynamics of a coral pathogen interaction. Am Nat 170 : E143 161. Evans, D.G., Evans, D.J., Jr., and Tjoa, W (1977) He magglutination of human group A erythrocytes by enterotoxigenic Escherichia coli isolated from adults with diarrhea: correlation with colonization factor. Infect Immun 18 : 330 337.

PAGE 147

147 Fabich, A.J., Jones, S.A., Chowdhury, F.Z., Cernosek, A ., Anders on, A., Smalley, D. et al. (2008) Comparison of carbon nutriti on for pathogenic and commensal Escherichia coli strains in the mouse intestine. Infect Immun 76 : 1143 1152. Gal, S.W., Choi, J.Y., Kim, C.Y., Cheong, Y.H., Choi, Y.J., Bahk, J.D. et al. (1997) Isolation and characterization of the 54 kDa and 22 kDa chitinase genes of Serratia marcescens KCTC2172. Fems Microbiol Lett 151 : 197 204. Gal, S.W., Choi, J.Y., Kim, C.Y., Cheong, Y.H., Choi Y.J., Lee, S.Y. et al. (1998) Cloning of the 52 kDa chitinase gene from Serratia marcescens KCTC2172 and its proteolytic cleavage into an active 35 kDa enzyme. Fems Microbiol Lett 160 : 151 158. Garre n, M., and Azam, F. (2010) New method for counting bacteria associated with coral m ucus Appl Environ Microbiol 76 : 6128 6133. Garren, M., and Azam, F. (2012a) Corals shed bacte ria as a potential mechanism of resilience to organic matter enrichment. ISME J 6 : 1159 1165. Garren, M., and Azam, F. (2012b) New directions i n coral reef microbial ecology. Environ Microbiol 14 : 833 844. Gauthier, J.D., Jones, M.K., Thiaville, P., Joseph, J.L., Sw ain, R.A., Krediet, C.J. et al. (2010) Role of GacA in virulence of Vibrio vulnificus Microbiol 156 : 3722 3733. Geffen, Y., and Rosenberg, E. (2005) Stress induced rap id release of antibacterials by scleractinian corals. Mar Biol 146 : 931 935. Geiser, D.M., Taylor, J.W., Ritchie, K.B., and Smit h, G.W. (1998) Cause of sea fan death in the West Indies. Nature 394 : 137 138. Gibson, G.R., and R oberfroid, M.B. (1995) Dietary modulation of the human c olon ic microbiota introducing the concept of p rebiotics. J Nutrition 125 : 1401 1412. Givskov, M., Eberl, L., and Molin, S. (1997) Control of exoenzyme production, motility and cell differentiation in Serratia lique faciens FEMS Microbiol Lett 148 : 1 15 122. Golberg, K., Eltzov, E., Shnit Orland, M., Marks, R.S., and Kushmaro, A. (2011) Characterization of quorum sensing signals in coral associated bacteria. Microbial Ecol 61 : 783 792. Goodier, R.I., and Ahmer, B.M. ( 2001) SirA orthologs affect both motility and virulence. J Bacteriol 183 : 2249 2258. Goodman, A.L., Merighi, M., Hyodo, M., Ventre, I., Filloux, A., and Lory, S. (2009) Direct interaction between sensor kinase proteins med iates acute and chronic disease ph enotypes in a bacterial pathogen. Genes & Develop 23 : 249 259.

PAGE 148

148 Grimont, F., and Grimont, P.A. (2006) The Genus Serratia In The Prokaryotes Dworkin, M., Falkow, S., Rosenberg, E., Schlei fer, K.H., and Stackebrandt, E. (eds). New York: Springer, pp. 219 244. Grys, T.E., Siege, M.B., Lathem, W.W., and Welch R.A. (2005) The StcE protease contributes to intimate adherence of enterohemorrhagic Escherichia coli O157: H7 to host cells. Infect Immun 73 : 1295 1303. Gulig, P.A., Bourdage, K.L., and Starks, A.M (2005) Molecular p athogenesis of Vibrio vulnificus J Microbiol 43 Spec No : 118 131. Guzman, L.M., Belin, D., Carson, M.J., and Beckwi th, J. (1995) Tight regulation, modulation, and high level expression by vectors containing the arabinose P BAD promoter. J Bacteriol 177 : 4121 4130. Hayashi, K., Morooka, N., Yamamoto, Y., Fujita, K., Is ono, K., Choi, S. et al. (2006) Highly accurate genome sequences of Escherichia coli K 12 strains MG1655 and W3110. Mol Syst Biol 2 : 2006 0007. Heeb, S., and Haas, D. (2001) Regulatory roles of the GacS/GacA two component system in plant associated and other gram negative bacteria. Mol Plant Microbe Interact 14 : 1351 1363. Hemmrich, G., Miller, D.J., and Bosch, T.C.G. (2007) T he evolution of immunity: a low life perspective. Trends in Immunol 28 : 449 454. Hertle, R., and Schwarz, H. (2004) Serratia marcescens internalization and repl ication in human bladder epithelial cells. B MC Infectious Diseases 4 Hoch, J.A. (2000) Two component and phosphorelay signal transduction. Curr O pinion Microbiol 3 : 165 170. Hoegh Guldberg, O., Mumby, P.J., Hooten, A.J., Steneck, R.S., Greenfield P., Gomez, E. et al. (2007) Coral reefs under rapid climate change and ocean acidification. Science 318 : 1737 1742. Holmstrom, C., and Kjelleberg, S. (19 99) Marine Pseudoalteromonas species are associated with higher organisms and produce biologically ac tive extracellular agents. Fems Microbiol Ecol 30 : 285 293. Hosmer, D.W., and Lemeshow, S. (1999) Applied Survival Analysis New York: Wiley & Sons. Hudson, J.A., Billington, C., Carey Smith, G., and Gre ening, G. (2005) Bacteriophages as biocontrol agents in food. J Food Protect 68 : 426 437. Hunt, D.E., Gevers, D., Vahora, N.M., and Polz, M.F. (2 008) Conservation of the chitin utilization pathway in th e Vibrionaceae. Appl Environ Microbiol 74 : 44 51.

PAGE 149

149 Iguchi, A., Shinzato, C., Foret, S., and Miller, D.J. (2011) Identification of fast evolving genes in the scleractinian c oral Acropora using comparative EST a nalysis. PLoS ONE 6 (6) : e20140 Ikeda, H., and T omizawa, J.I. (1965) Transducing fragme nts in generalized transduction by phage P1. I. Molecular origin of the fragments. J Mol Biol 14 : 85 109. Inoue, H., Nojima, H., and Okayama, H. (1990) Hi gh efficiency transformation of Escherichia coli with plasmids. Gene 96 : 23 28. Jackson, T.A., Boucias, D.G., and Thaler, J.O. (2001) Pathobiology of amber disease, caused by Serratia s pp., in the New Zealand grass grub, Costelytra zealandica. J Invertebr Pathol 78 : 232 243. Jatkar, A.A., Brown, B.E., Bythell, J.C., Guppy, R., Morris, N.J., and Pea rson, J.P. (2010) Coral Mucus: the properties of i ts constituent m ucins. Biomacromolecules 11 : 883 888. Jensen, M.A., Faruque, S.M., Mekalanos, J.J., and Levin B.R. (2006) Modeling the role of bacteriophage in the control o f cholera outbreaks. Proc Natl Acad Sci U S A 103 : 4652 4657. Johns, G.M., Leeworthy, V.R., Bell, F.W., Bonn, M.A. in association with Hazen and Sawyer Environmental Engineers and Scienti sts, F.S.U.a.N., and Yang, G.P. (2001) Socioeconomic study of reefs in southeast Florida. In. Brow ard County, P.B.C., Miami Dade County, Monroe Co unty, Florida Fish and Wildlife Conservation Commission, National Oceanic and Atmospheric Administration (ed): Hazen and Sawyer, PC, p. 348. Jonas, K., Edwards, A.N., Simm, R., R omeo, T., Romling, U., and Mel efors, O. (2008) The RNA binding protein CsrA controls cycli c di GMP metabolism by directly regulating the expression of GGDEF proteins. Mol Microbiol 70 : 236 257. Jones, M.K., Warner, E.B., and Oliver, J.D. (2008a) csrA inhib its the formation of biofilms by Vibrio vulnificus Appl Environ Microbiol 74 : 7064 7066. Jones, S.A., Jorgensen, M., Chowdhury, F.Z., Rodgers, R., Hartline, J., Leatham, M.P. et al. (2008b) Glycogen and maltose utilization by Escherichia coli O157:H7 in the mouse intestine. Infect Immun 76 : 2531 2540. Kalivoda, E.J., Stella, N.A., O'Dee, D.M., Nau, G.J., and Shanks, R.M. (2008) The cyclic AMP dependent catabolite repression system of Serratia marcescens mediates biofilm formation through regulation of typ e 1 fimbriae. Appl Environ Microbiol 74 : 3461 3470. Kalogeraki, V.S., and Winans, S.C. (1997) Suicide p lasmids containing promoterless reporter genes can simultaneously disrupt and cr eate fusions to target genes of diverse bacteria. Gene 188 : 69 75.

PAGE 150

150 Karuna karan, R., Mauchline, T.H., Hosie, A.H., and Poole, P.S. (2005) A family of promoter probe vectors incorporating autofluor escent and chromogenic reporter proteins for studying gene expression in Gram negative bacteria. Microbiol 151 : 3249 3256. Kay, E., Du buis, C., and Haas, D. (2005) Three smal l RNAs jointly ensure secondary metabolism and biocontrol in Pseudomonas fluorescens CHA0. Proc Natl Acad Sci U S A 102 : 17136 17141. Kay, E., Humair, B., Denervaud, V., Riedel, K., Spahr, S., Eberl, L. et al. (2006) Two GacA dependent small RNAs modulate the quorum sensing response in Pseudomonas aeruginosa J Bacteriol 188 : 6026 6033. Kim, M., Ashida, H., Ogawa, M., Yoshikawa, Y., Mimur o, H., and Sasakawa, C. (2010a) Bacterial interactions with the host e pithelium. Cell Host & Microbe 8 : 20 35. Kim, Y.M., Bouras, N., Kay, N.N.V., and Strel kov, S.E. (2010b) Inhibition of photosynthesis and modification of the wheat le af proteome by Ptr ToxB: A host specific toxin from the fungal pathogen Pyrenophora tritici repentis Proteomics 10 : 2911 2926. Kimes, N.E., Grim, C.J., Johnson, W.R., Hasan, N.A., T all, B.D., Kothary, M.H. et al. (2011) Temperature regulation of virulence factors in the pathogen Vibrio coralliilyticus ISME J 6 : 835 846. Kirkwood, M., Todd, J.D., Rypien, K.L., and Johnston, A.W.B. (2010) The opportunistic coral pathogen Aspergillus sydowii contains dddP and makes dimethyl sulfide from dimethylsulfoniopropionate. ISME J 4 : 147 150. Klaus, J.S., Janse, I., Heikoop, J.M., Sanford, R.A ., and Fouke, B.W. (2007) Coral microbial communities, zooxanthellae and mu cus along gradients of seawater depth and coastal pollution. Environ Microbiol 9 : 1291 1305. Klose, K.E. (2000) The suckling mouse model of cholera. Trends Microbiol 8 : 189 191. Knowlton, N., and Rohw er, F. (2003) Multispecies microbial mutualisms on coral feefs: the host as a h abitat. Am Nat 162 : S51 S62. Koenig, J.E., Bourne, D.G., Curtis, B., Dlutek, M., Sto kes, H.W., Doolittle, W.F., and Boucher, Y. (2011) Coral mucus associated Vibrio integrons i n the Great Barrier Reef: genomic hotspots for environmental adaptation. ISME J 5 : 962 972. Kooperman, N., Ben Dov, E., Kramarsky Winter, E., Barak, Z., and Kushmaro, A. (2007) Coral mucus associated bacterial commun ities from natural and aquarium environm ents. FEMS Microbiol Lett 276 : 106 113. Koropatnick, T.A., Engle, J.T., Apicella, M.A., Stabb, E.V., Goldman, W.E., and McFall Ngai, M.J. (2004) Microbial factor mediated development in a host bacterial mutualism. Science 306 : 1186 1188.

PAGE 151

151 Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M ., and Peterson, K.M. (1995) 4 new d erivat ives of the broad host range c loning vector pBBR1mcs, c arrying d ifferent a ntibiotic r esistance c assettes. Gene 166 : 175 176. Krediet, C.J., Ritchie, K.B., and Teplitski, M. (2009a) Cata bolite control in a coral white pox pathogen, Serratia marcescens PDL100. Dis Aquat Organ 87 : 57 66. Krediet, C.J., Ritchie, K.B., Alagely, A., and Teplitsk i, M. (2012a) Members of native coral microbiota thwart coloniza tion of coral mucu s by an opportunistic pathogen. ISME J in review Krediet, C.J., Zaragoza, W.J., Alagely, A., Ritchie, K.B., and Teplitski, M. (2012b) Aiptasia pallida : a surrogate model polyp susce ptible to infections with coral opportunistic pathogens. Appl Environ Microbiol in review Krediet, C.J., Ritchie, K.B., Cohen, M., Lipp, E.K., Sutherland, K.P., and Teplit ski, M. (2009b) Utilization of m ucus from the c oral Acropora palmata by the pathogen Serratia marcescens and by e nvironmental and c oral c ommensal b acteria. Appl Environ Microbiol 75 : 3851 3858. Krzyminska, S., Ochocka, K., and Kaznowski, A. (2012) A potosis of epithelial cells and macrophages due to nonpigmented Serratia marcescens strains. Sci World J 2012 : 1 8. Kulkarni, P.R., Cui, X., Wi lliams, J.W., Stevens, A.M., and Kulkarni, R.V. (2006) Prediction of CsrA regulating small RNAs in bacteria and their experimental verification in Vibrio fischeri Nucleic Acids Res 34 : 3361 3369. Kuntz, N.M., Kline, D.I., Sandin, S.A., and Rohwer, F. ( 200 5) Pathologies and mortality rates caused by organic carbon and nutrient stressors in thr ee Caribbean coral species. Mar Ecol Prog Ser 294 : 173 180. Kurtz, J., and Franz, K. (2003) Innate defence: evid ence for memory in invertebrate immunity. Nature 425 : 3 7 38. Kurz, C.L., and Ewbank, J.J. (2000) Caenorhabditis elegans for the stu dy of host pathogen interactions. Trends Microbiol 8 : 142 144. Kurz, C.L., Chauvet, S., Andres, E., Aurouze, M., Vallet, I., Michel, G.P. et al. (2003) Virulence factors of the human opportunistic pathogen Serratia marcescens identified by in vivo screening. EMBO J 22 : 1451 1460. Kushmaro, A., and Kamarsky Winter, E. (2004) Bacteria as a source of coral nutrition. In Coral health and diseases Rosenberg, E. and Loya, Y. (eds). New York: Springer Verlag, pp. 231 241. Kushmaro, A., Loya, Y., Fine, M., and Rosenberg, E. (1996) Bacterial infection and coral bleaching. Nature 380 : 396 396.

PAGE 152

152 Kushmaro, A., Rosenberg, E., Fine, M., and Loya, Y (1997) Bleaching of the coral Oculina patagonica by Vibrio AK 1. Mar Ecol Prog Ser 147 : 159 165. Kushmaro, A., Banin, E., Loya, Y., Stackebrandt, E., and Rosenberg, E. (2001) Vibrio shiloi sp. nov., the causative agent of bleaching of the coral Oculina patagonica Int J Syst Evol Microbiol 51 : 1383 1388. Kvennefors, E.C., Leggat, W., Hoegh Guldberg, O., Degnan, B. M., and Barnes, A.C. (2008) An ancient and variable mannose binding lectin from the coral Acropora millepora binds both pathogens and symbionts. Dev Comp Immunol 32 : 1582 1592. Kvennefors, E.C., Sampayo, E., Kerr, C., Vieira, G., Roff, G., and Barnes, A.C. (2012) Regulation of bacterial communities through anti microbial activity by the cora l c olobiont. Microbial Ecol 63 : 605 618. Lapouge, K., Schubert, M., Allain, F. H.T., and Haas, D. (2008) Gac/Rsm signal proteobacteria: from R NA recognition to regulation of social behaviour. Mol Microbiol 67 : 241 253. Laux, D.C., Cohen, P.S., and Conway, T. (2005) Role of the mucus layer in bacterial coloni zation of the intestine. In Colonization of Mucosal Surfaces Nataro, J.P., Cohen, P.S., Mobley, H.L.T., and Weiser, J. N. (eds). Washington, D.C.: ASM Press. Leatham, M.P., Banerjee, S., Autieri, S.M., Mercado L ubo, R., Conway, T., and Cohen, P.S. (2009) P recolonized human commensal Escherichia coli strains serve as a barrier to E. coli O157:H7 growth in the streptomycin treated mouse intestine. Infect Immun 77 : 2876 2886. Lennox, E.S. (1955) Transduction of linked ge netic characters of the host by bacteriophage P1. Virology 1 : 190 206. Lesser, M.P., Bythell, J.C., Gates, R.D., Johnston e, R.W., and Hoegh Guldberg, O. (2007) Are infectious diseases really killing corals? Alternative interpretations of the experimental and ecological data. J Exp Mar Bi ol Ecol 346 : 36 44. Little, A.F., van Oppen, M.J., and Willis, B.L. (2004) Fle xibility in algal endosymbioses shapes growth in reef corals. Science 304 : 1492 1494. Livak, K.J., and Schmittgen, T.D. (2001) Analysis of rela tive gene expression data using rea l time quantitative PCR and the 2(T)( Delta Delta C) method. Methods 25 : 402 408. Looney, E.E., Sutherland, K.P., and Lipp, E.K. (2010) Eff ects of temperature, nutrients, organic matter and coral mucus on the survival of the coral pathogen, Serratia marces cens PDL100. Environ Microbiol 12 : 2479 2485.

PAGE 153

153 Macinga, D.R., Parojcic, M.M., and Rather, P.N. (1995) Identification and analysis of aarP a transcriptional activator of the 2' N acetyltransferase in Providencia stuartii J Bacteriol 177 : 3407 3413. Mao Jon es, J., Ritchie, K.B., Jones, L.E ., and Ellner, S.P. (2010) How microbial community composition regulates coral disease d evelopment. Plos Biology 8 (3) : e1000345 Marhaver, K.L., Edwards, R.A., and Rohwer, F. (200 8) Viral communities associated with healthy and bleaching corals. Environ Microbiol 10 : 2277 2286. McDaniel, L.D., Young, E., Delaney, J., Ruhnau, F., Ritchie, K. B., and Paul, J.H. (2010) High f requency of h orizontal g ene t ransfer in the o ceans. Science 330 : 50 50. McGuckin, M.A., Lind en, S.K., Sutton, P., and Florin, T.H. (2011) Mucin dynamics and enteric pathogens. Nature Reviews Microbiol 9 : 265 278. Meibom, K.L., Blokesch, M., Dolganov, N.A., Wu, C.Y., and Schoolnik, G. K. (2005) Chitin induces natural competence in Vibrio cholerae Science 310 : 1824 1827. Meikle, P., Richards, G.N., and Ye llowlees, D. (1987) Structural determination of the oligosaccharide side chains from a glycoprotein isolated from the mucus of the c oral Acropora f ormosa J Biol Chem 262 : 16941 16947. Meikle, P., Richards, G.N., and Ye llowlees, D. (1988) Structural investigations on the m ucus from 6 s pecies of c oral. Mar Biol 99 : 187 193. Meron, D., Atias, E., Kruh, L.I., Elifantz, H., Minz, D., Fin e, M., and Banin, E. (2011) The impact of reduced pH on the microbi al community of the coral Acropora eurystoma ISME J 5 : 51 60. Meron, D., Efrony, R., Johnson, W.R., Schaefer, A.L., Morris, P.J., Rosen berg, E. et al. (2009) Role of flagella in virulence of the c oral p athogen Vibrio coralliilyticus Appl Environ Microbio l 75 : 5704 5707. Miller, D.J., Hemmrich, G., Ball, E.E., Hayward, D.C., Khal turin, K., Funayama, N. et al. ( 2007) The innate immune repertoire in Cnid aria ancestral complexity and stochastic gene loss. Genome Biol 8 : R59.51 R59.13. Miller, J.H. (1972) Experiments in Molecular Genetics Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Molchanova, V.I., Ovodova, R.G., Ovodov, Y.S., Elki n, Y.N., and Fernandez Santana, V. (1985) Studies of the polysaccharide moiety o f corallan, a glycoprotein from Pse udopterogorgia americana Carbohydrate Res 141 : 289 293.

PAGE 154

154 Mullen, K.M., Peters, E.C., and Harvell, C.D. (2004) Coral resistance to disease. In Coral health and disease Rosenberg, E. and Loya, Y. (eds). New York: Springer Verlag, pp. 377 399. Muller, E.M., Rogers, C.S., Spitzack, A.S., and van Woe sik, R. (2008) Bleaching increases likelihood of disease on Acropora palmata (Lamarck) in Hawksnest Bay, St John, US Virgin Islands. Coral Reefs 27 : 191 195. Mumby, P.J., and Steneck, R.S. (2008) Coral reef management and conservation in light of rapidly evolving ecological paradigms. Trends Ecol Evol 23 : 555 563. Mumby, P.J., Hastings, A., and Edwards, H.J. (2007) T hresholds and the resilience of Caribbean coral reefs. Nature 450 : 98 101. Mydlarz, L.D., Jon es, L.E., and Harvell, C.D. (2006) Innate immunity environmental drivers, and disease ecology of marine and freshwater invertebrates. Annu Rev Ecol Evol Syst 37 : 251 288. Mydlarz, L.D., Holthouse, S.F., Peters, E.C., an d Harvell, C.D. (2008) Cellular responses in sea fan corals: granular amoebocytes reac t to pathogen and climate stressors. PLoS ONE 3 : e1811. Nehme, N.T., Liegeois, S., Kele, B., Giammarinaro, P., Pr adel, E., Hoffmann, J.A. et al. (2007) A model of bacterial intestinal infections in Dros ophila melanogaster Plos Pathogens 3 : 1694 1709. Ochman, H., Gerber, A.S., and Hartl, D.L. (1988) Gen etic applications of an inverse polymerase chain reaction. Genetics 120 : 621 623. Olivier, V., Queen, J., and Satchell, K.J. (2009) Successf ul small intes tine colonization of adult mice by Vibrio cholerae requires ke tamine anesthesia and accessory toxins. PLoS ONE 4 : e7352. Ovadis, M., Liu, X., Gavriel, S., Ismailov, Z., Chet, I., and Chernin, L. (2004) The global r egulator g enes from b iocontrol s train Serr atia plymuthica IC1270: cloning, s equencing, and f unctional s tudies. J Bacteriol 186 : 4986 4993. Palmer, C.V., Mydlarz, L.D., and Willis, B.L. (2008) E vidence of an inflammatory like response in non normally pigmented tissues of two scleractinian corals. Proc Ro yal Soc B Biol Sci 275 : 2687 2693. Park, D., and Forst, S. (2006) Co regulation of mot ility, exoenzyme and antibiotic production by the EnvZ OmpR FlhDC FliA pathway in Xenorhabdus nematophila Mol Microbiol 61 : 1397 1412. Parkins, M.D., Ceri, H., an d Storey, D.G. (2001) Pseudomonas aeruginosa GacA, a factor in multihost virulence, is also essential for biofilm formation. Mol Microbiol 40 : 1215 1226.

PAGE 155

155 Patterson, K.L., Porter, J.W., Ritchie, K.B., Polson, S.W., M ueller, E., Peters, E.C. et al. (2002) Th e etiology of white pox, a lethal disease of the Caribbean elkhorn coral, Acropora palmata Proc Natl Acad Sci U S A 99 : 8725 8730. Patterson Sutherland, K., and Ritchie, K.B. (2004) White p ox disease of the Caribbean e lkhorn c oral, Acropora palmata In Coral health and diseases R osenberg, E., and Loya, Y. (eds). New York: Springer Verlag, pp. 289 300. Pernestig, A.K., Melefors, O., and Georgellis, D. (2001 ) Identification of UvrY as the cognate response regulator for the BarA sensor kinase in Escherichi a coli J Biol Chem 276 : 225 231. Pernestig, A.K., Georgellis, D., Romeo, T., Suzuki, K., Tomenius, H., Normark, S., and Melefors, O. (2003) The Escherichia coli Ba rA UvrY two component system is needed for efficient switching between glyc olytic and glucon eogenic carbon sources. J Bacteriol 185 : 843 853. Pitsouli, C., Apidianakis, Y., and Perr imon, N. (2009) Homeostasis in infected epithelia: s tem c ells t ake the l ead. Cell Host & Microbe 6 : 301 307. Pollock, F.J., Morris, P.J., Willis, B.L., and Bourne, D.G (2011) The Urgent Need for Robust Coral Disease Diagnostics. PLoS Pathogens 7( 10) : e1002183. Pruss, B.M., Campbell, J.W., Van Dyk, T.K., Zhu, C ., Kogan, Y., and Matsumura, P. (2003) FlhD/FlhC is a regulator of anaer obic respiration and the Entner Doudoroff pathway through induction of the methyl accepting chemotaxis protein Aer. J Bacteriol 185 : 534 543. Pruzzo, C., Vezzulli, L., and Colwell, R.R. (2008) Global impact of Vibrio cholerae interactions with chitin. Environ Microbiol 10 : 1400 1410. Rai na, J.B., Tapiolas, D., Willis, B.L., and Bourne, D.G. (2009) Coral associated b acteria and t heir r ole in the b iogeochemical c ycling of s ulfur. Appl Environ Microbiol 75 : 3492 3501. Raina, J.B., Dinsdale, E.A., Willis, B.L., and Bourne, D.G. (2010) Do the organic sulf ur compounds DMSP and DMS drive coral microbial associations? Trends Microbiol 18 : 101 108. Rajamani, S., Bauer, W.D., Robinson, J.B., Farrow, J.M., Pe sci, E.C., Teplitski, M. et al. (2008) The v itamin r iboflavin and i ts d erivative l umichrome a ctivate the LasR b acterial q uorum s ensing r eceptor. Mol Plant Microbe Interact 21 : 1184 1192. Rasmussen, T.B., and Givskov, M. (2006) Quorum s ensing inhibitors: a bargain of effects. Microbiol Sgm 152 : 895 904. Reed, K.C., Muller, E.M., and van Woesik, R. (2010) Coral immunology and resistance to disease. Dis Aquat Org 90 : 85 92.

PAGE 156

156 Reitzel, A.M., Sullivan, J.C., Traylor Knowles, N., an d Finnerty, J.R. (2008) Genomic survey of candidate stress response genes in the estuarine anemone Nematostella vectensis Bio l Bull 214 : 233 254. Reshef, L., Koren, O., Loya, Y., Zilber Rosenberg, I ., and Rosenberg, E. (2006) The coral probiotic hypothesis. Environ Microbiol 8 : 2068 2073. Ritchie, K.B. (2006) Regulation of microbial populat ions by coral surface mucus and mucus associated bacteria. Mar Ecol Prog Ser 322 : 1 14. Ritchie, K.B., and Smith, G.W. (2004) Microbi al communities of coral surface mucopolysaccharide layers. In Coral health and diseases Rosenberg, E., and Loya, Y. (eds). New York: Springer Verlag, pp. 259 264. Ritchie, K.B., Holley, R.A., McGrath, T., an d Smith, G.W. (1996) INT linked dehydrogenase activity in the surface mucopo lysaccharide layers of Bahamian scleractinian corals. Proc Symp Nat Hist Bahamas 6 : 18 27. Robinson, C.J., Bohannan, B.J., and Young, V.B. (2010) From structure to function: the ecology of host associated microbial communities. Microbiol Mol Biol Rev 74 : 453 476. Rohwer, F., Seguritan, V., Azam, F., and Knowlton, N. (2 002) Diversity and distribu tion of coral associated bacteria. Mar Ecol Prog Ser 243 : 1 10. Romeo, T. (1998) Global regulation by the small RNA b inding protein CsrA and the non coding RNA molecule CsrB. Mol Microbiol 29 : 1321 1330. Romeo, T., Gong, M., Liu, M.Y., and Brun Zinkernagel A.M. (1993) Identification and molecular characterization of csrA a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cel l size, and surface properties. J Bacteriol 175 : 4744 4755. Rosenberg, E., and Falkovitz, L. (2004) The Vibrio shiloi / Oculina patagonica model system of coral bleaching. Annu Rev Microbiol 58 : 143 159. Rosenberg, E., and Zilber Rosenberg, I. (2008) From bacterial bleaching to the hologenome theory of evolution. Proc 11th Inte rnational Coral Reef Symposium, Ft Lauderdale, Florida, 7 11 July 2008 : 1 5. Rosenberg, E., and Zilber Rosenberg, I. (2011) Symbiosis and Development: The Hologenome Concept. Birth Defects Research Part C Embryo Today Reviews 93 : 56 66. Rosenberg, E., Kor en, O., Reshef, L., Efrony, R., and Zilber Rosenberg, I. (2007) The role of microorganisms in coral health, disease and evolution. Nat Rev Microbiol 5 : 355 362.

PAGE 157

157 Ruiz Sanchez, A., Cruz Camarillo, R., Salcedo H ernandez, R., Ibarra, J.E., and Barboza Corona, A.E. (2005) Molecular cloning and purification of an endochitinase from Serratia marcescens (Nima). Mol Biotechnol 31 : 103 111. Rypien, K.L., Ward, J.R., and Azam, F. (2010) Antago nistic interactions among coral associated bacteria. Environ Microbiol 12 : 2 8 39. Sambrook, J., and Russell, D.W. (2001) Molecular Cloning: A laboratory manual Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Santos, S.R., Taylor, D.J., Kinzie, R.A., 3rd, Hidaka, M. Sakai, K., and Coffroth, M.A. (2002) Molecular phylogeny of symbiotic dinofl agellates inferred from partial chloroplast large subunit (23S) rDNA sequences. Mol Phylogenet Evol 23 : 97 111. Savage, D.C. (1977) Microbial ecology of the gastrointestinal tract. Annu Rev Microbiol 31 : 107 133. Schmittgen, T. D., and Livak, K.J. (2008) Anal yzing real time PCR data by the comparative C(T) method. Nat Protoc 3 : 1101 1108. Schulenburg, H., and Ewbank, J.J. (2004) Diversity and specificity in the interaction between Caenorhabditis elegans and the pathogen Serratia marcescens BMC Evol Biol 4 : 49. Shao, C.P., and Hor, L.I. (2000) Metalloprotease is not essential for Vibrio vulnificus virulence in mice. Infect Immun 68 : 3569 3573. Sharon, G., and Rosenberg, E. (2008) Bacterial growth on coral m ucus. Curr Microbiol 56 : 481 488. Sharp, K.H., Distel, D., and Paul, V.J. (2011 ) Diversity and dynamics o f bacterial communities in early life stages of the Caribbean coral Porites astreoides ISME J 6 : 790 801 Sharp, K.H., Ritchie, K.B., Schupp, P.J., Ritson Williams, R., a nd Paul, V.J. (2010) Bacterial a cquisition in j uveniles of s everal b roadcast s pawning c oral s pec ies. PLoS ONE 5 : e10898 Shinzato, C., Shoguchi, E., Kawashima, T., Hamada, M. Hisata, K., Tanaka, M. et al. (2011) Using the Acropora digitifera genome t o unders tand coral responses to environmental change. Nature 476 : 320 U382. Shnit Orland, M., and Kushmaro, A. (2009) Coral mucus associated bacteria: a possible first line of defense. FEMS Microbiol Ecol 67 : 371 380. Silva, A.J., Pham, K., and Benitez, J.A. (2003) Haemagg lutinin/protease expression and mucin gel penetration in El Tor biotype Vibrio cholerae Microbiol Sgm 149 : 1883 1891.

PAGE 158

158 Skindersoe, M.E., Ettinger Epstein, P., Rasmussen, T.B., Bjarnsholt, T., de Nys, R., and Givskov, M. (2008) Quorum sensing antagonism from marine organisms. Mar Biotechnol 10 : 56 63. Smith, G.W., and Hayasaka, S.S. (1982) Nitrogenase activity associated with Zostera marina from a North Carolina estuary. Can J Microbiol 28 : 448 451. Smith, G.W., Kozuchi, A.M., and Hayasaka, S.S (1 982) Heavy metal sensitivity of seagrass bacteria. Botanica Marina XXV : 19 24. Srinivasan, S., and Fredricks, D.N. (2008) The human vaginal bacterial biota and bacterial vaginosis. Interdiscip Perspect Infect Dis 2008 : 1 22 Sunagawa, S., Wilson, E.C., Thaler, M., Smith, M.L., C aruso, C., Pringle, J.R. et al. (2009a) Generation and analysis of transcriptom ic resources for a model system on the rise: the sea anemone Aiptasia pallida and its dinoflagellate endosymbiont. BMC Genomics 10 : 258. Sunagawa, S., DeSantis, T.Z., Piceno, Y.M., Brodie, E.L. DeSalvo, M.K., Voolstra, C.R. et al. (2009b) Bacterial diversity and White Plague Disease associa ted community changes in the Caribbean coral Montastraea faveolata ISME J 3 : 512 521. Sussman, M., Loya, Y., Fine M., and Rosenberg E. (2003) The marine fireworm Hermodice carunculata is a winter reservoir a nd spring summer vector for the coral bleaching pathogen Vibrio shiloi Environ Microbiol 5 : 250 255. Sussman, M., Willis, B.L., Victor, S., and Bour ne, D.G. (2008) Coral pathogens identified for white syndrome (WS) episootics in the Indo Pacific. PLoS ONE 3 : e2393. Sussman, M., Mieog, J.C., Doyle, J., Victor, S., Willis B.L., and Bourne, D.G. (2009) Vibrio zinc metalloprotease causes photoinactiva tion of cora l endosymbionts and coral tissue lesions. PLoS ONE 4 : e4511. Sutherland, K.P., Porter, J.W., and Torres, C. (2004) Disease and immunity in Caribbean and Indo Pacific zooxanthellate corals. Mar Ecol Prog Ser 266 : 273 302. Sutherland, K.P., Shaban, S., Joyner, J.L., Porter, J. W., and Lipp, E.K. (2011) Human pathogen shown to cau se disease in the threatened elk horn coral Acropora palmata PLoS ONE 6 : e23468. Sutherland, K.P., Porter, J.W., Turner, J.W., Thomas, B. J., Looney, E.E., Luna, T.P. et al. (2010) Human sewage identified as likely sou rce of whtie pox disease of the threatened Caribbean elkhorn coral, Acropora palmata Environ Microbiol 12 : 1121 1131.

PAGE 159

159 Suzuki, K., Suzuki, M., Taiyoji, M., Nikaidou, N., and Wat anabe, T. (1998) Chitin binding protein ( CBP21) in the culture supernatant of Serratia marcescens 2170. Biosci Biotechnol Biochem 62 : 128 135. Suzuki, K., Wang, X., Weilbacher, T., Pernestig, A.K., Mele fors, O., Georgellis, D. et al. (2002) Regulatory circuitry of the Csr A/CsrB and BarA/UvrY syst ems of Escherichia coli J Bacteriol 184 : 5130 5140. Szabady, R.L., Yanta, J.H., Halladin, D.K., Schofield, M.J., and Welch, R.A. (2011) TagA is a secreted protease of Vibrio cholerae that specifically cleaves mucin glycoproteins. Microbiol Sgm 157 : 516 525. Tait, K., Hutchison, Z., Thompson, F.L., and Munn, C. B. (2010) Quorum sensing signal production and inhibition by coral associated vibrios. Environ Microbiol Reports 2 : 145 150. Tan, B., Jackson, T.A., and Hurst, M.R. (2006) Virulence of Serratia strains against Costelytra zealandica Appl Environ Microbiol 72 : 6417 6418. Tan, M.W., Rahme, L.G., Sternberg, J.A., Tompkins, R.G., and Ausubel, F.M. (1999) Pseudomonas aeruginosa killing of Caenorhabditis elegans used to identify P aeruginosa virulence factors. Proc Natl Acad Sci U S A 96 : 2408 2413. Taylor, M.W., Radax, R., Steger, D., and Wagner, M. (2007) Sponge associated microorganisms: Evolution, ecology, and biotechnological potential. Microbiol Mol Biol Rev 71 : 295 347 Teplitski, M., and Ahmer, B.M.M. (2004) The control of secondary metabolism, motility, and virulence by the two component regulatory system BarA/SirA of Salmonella and other proteobacteria. Global Regulatory Networks in Enteric Bacteria : 107 132. Teplitski, M., and Compton, G. (2006) Aquatic microbial bio films: A learning tool for high school biology. In Annual Meeting of American Society for Microbiology Orlando, FL. May 1, 2006. Teplitski, M., and Ritchie, K. (2009) How feasible is the biological control of coral diseases? T rends Ecol Evol 24 : 378 385. Teplitski, M., Goodier, R.I., a nd Ahmer, B.M. (2003) Pathways leading from BarA/SirA to m otility and v irulence g ene e xpression in Salmonella J Bacteriol 185 : 7257 7265. Teplitski, M., Al Agely, A., and Ahmer, B.M.M. (2006a) C o ntribution of the SirA regulon to biofilm formation in Salmonella enterica serovar Typhimurium. Microbiol Sgm 152 : 3411 3423. Teplitski, M., Goodier, R.I., and Ahmer, B.M. (2006b) Ca tabolite repression of the SirA regulatory cascade in Salmonella enterica Int J Med Microbiol 296 : 449 466.

PAGE 160

160 Teplitski, M., Wright, A.C., and Lorca, G. (2009) Biolog ical approaches for controlling shellfish associated pathogens. Curr Opin Biotechnol 20 : 185 190. Thompson, S.E., Smith, M., Wilkinson, M.C., and Pee k, K. (2001) Id entification and characterization of a chitinase antigen from Pseudomonas aeruginosa strain 385. Appl Environ Microbiol 67 : 4001 4008. Thurber, R.L.V., and Correa, A.M.S. (2011) Viruses of reef building scleractinian corals. J Exp Mar Biol Ecol 408 : 102 11 3. Timmermans, J., and Van Melderen, L. (2010) Post transcriptional global r egulation by CsrA in bacteria. Cell Mol Life Sci 67 : 2897 2908. Toguchi, A., Siano, M., Burkart, M., and Harshey, R .M. (2000) Genetics of swarming motility in Salmonella enterica s erovar typhimurium: critical role for lipopolysaccharide. J Bacteriol 182 : 6308 6321. Tomenius, H., Pernestig, A.K., Mendez Catala, C.F., G eorgellis, D., Normark, S., and Melefors, O. (2005) Genetic and functional characterization of the Escherichia coli BarA UvrY two component system: point muta tions in the HAMP linker of the BarA sensor give a dominant negative phenotype. J Bacteriol 187 : 7317 7324. Tremblay, P., Grover, R., Maguer, J.F., Legendre, L ., and Ferrier Pages, C. (2012) Autotrophic carbon bud get in coral t issue: a new 13C based model of photosynthate translocation. J Exp Biol 215 : 1384 1393. Tremblay, P., Weinbauer, M.G., Rottier, C., Guerard el, Y., Nozais, C., and Ferrier Pages, C. (2011) Mucus composition and bacter ial communities associated with the tissue and skeleton of three scleractinian corals maintained under culture conditions. Journal Mar Biol Assoc UK 91 : 649 657. Tripp, H.J., Kitner, J.B., Schwalbach, M.S., Da cey, J.W.H., Wilhelm, L.J., and Giovannoni, S.J. (2008) SAR11 marine bac t eria require exogenous reduced sulphur for growth. Nature 452 : 741 744. Vaaje Kolstad, G., Horn, S.J., van Aalten, D.M.F., S ynstad, B., and Eijsink, V.G.H. (2005) The non catalytic chitin binding protein CBP21 from Serratia marcescens is essential for chit in degradation. J Biol Chem 280 : 28492 28497. Vacelet, E., and Thomassin, B. (1991) Microbial utilization of coral mucus in long term in situ incubation over a coral reef. Hydrobiologia 211 : 19 32. Ventre, I., Goodman, A.L., Vallet Gely, I., Vasseur, P., Soscia, C., Molin, S. et al. (2006) Multiple sensors control reciprocal expression of Pseudomonas aeruginosa regulatory RNA and virulence genes. Proc Natl Acad Sci U S A 103 : 171 176.

PAGE 161

161 Veron, J.E.N. (2000) Corals of the World : Australian Institute of Marin e Science. Veron, J.E.N. (2011) Ocean acidification and coral reefs: an emerging big picture. Diversity 3 : 262 274. Veron, J.E.N., Hoegh Guldberg, O., Lenton, T.M., L ough, J.M., Obura, D.O., Pearce Kelly, P. et al. (2009) The coral reef crisis: The critic a l importance of < 350 ppm CO2. Mar Poll Bull 58 : 1428 1436. Verstraeten, N., Braeken, K., Debkumari, B., Fauvart, M., Fransaer, J., Vermant, J., and Michiels, J. (2008) Living on a surface: swarming and biofilm formation. Trends Microbiol 16 : 496 506. Vid al Dupiol, J., Ladriere, O., Meistertzheim, A.L., Foure, L., Adjeroud, M., and Mitta, G. (2011a) Physiological responses of the scleractinian coral Pocillopora damicornis to bacterial stress from Vibrio coralliilyticus J Exp Biol 214 : 1533 1545. Vidal Dupiol, J., Ladriere, O., Destoumieux Garzon, D., Sautiere, P.E., Meistertzheim, A.L., Tamb utte, E. et al. (2011b) Innate immune responses of a scleractinian coral to v ibriosis. J Bi ol Chem 286 : 22688 22698. Vollmer, S.V., and Palumbi, S.R. (2002) Hy bridization and the evolution of reef coral diversity. Science 296 : 2023 2025. Vollmer, S.V., and Kline, D.I. (2008) Natural disease re sistance in threatened staghorn corals. PLoS ONE 3 : e3718. Wang, Q., Frye, J.G., McClelland, M., and Harsh ey, R.M. (2004) Gene expression patterns during swarming in Salmonella typhimurium : genes specific to surface growth and putative new motility and pathogenicity genes. Mol Microbiol 52 : 169 187. Ward, J.R. (2007) Within colony variation in inducibility of coral disease r esistance. J Exp Mar Biol Ecol 352 : 371 377. Wegley, L., Edwards, R., Rodriguez Brito, B., Liu, H., and Rohwer, F. (2007) Metagenomic analysis of the microbial comm unity associated with the coral Porites astreoides Environ Microbiol 9 : 2707 2719. Weil, E., Ritchie, K.B., Croquer, A., Cunning, J.R., and Smith, G.W. (2008) Inoculation of Vibrio spp. onto Montastraea faveolata fragments to determine p otential pathogenicity. Proc 11th International Coral Reef Symposium, Ft Lauderdale, Florida, 7 11 July 200 8 1 : 202 205. Weis, V.M. (2008) Cellular mechanisms of Cnidari an bleaching: stress causes the collapse of symbiosis. J Exp Biol 211 : 3059 3066.

PAGE 162

162 Weis, V.M., Davy, S.K., Hoegh Guldberg, O., Rodriguez Lanetty, M., and Pringle, J.R. (2008) Cell biology in mode l systems as the key to understanding corals. Trends Ecol Evol 23 : 369 376. Whistler, C.A., and Ruby, E.G. (2003) GacA regulates symbiotic colonization t raits of Vibrio fischeri and facilitates a beneficial association with an animal host. J Bacteriol 185 : 7202 7212. Wild, C., Naumann, M., Niggl, W., and Haas, A. (20 10) Carbohydrate composition of mucus released by scleractinian warm and cold water reef corals. Aquatic Biol 10 : 41 45. Wild, C., Huettel, M., Klueter, A., Kremb, S.G., Ras heed, M.Y., and Jorg ensen, B.B. (2004) Coral mucus functions as an energy carrie r and particle trap in the reef ecosystem. Nature 428 : 66 70. Williamson, N.R., Fineran, P.C., Leeper, F.J., and Salmond, G.P.C. (2006) The biosynthesis and regulation of bacterial prodiginines. Nature Rev Microbiol 4 : 887 899. Willner, D., Thurber, R.V., and Rohwer, F. (200 9) Metagenomic signatures of 86 microbial and viral metagenomes. Environ Microbiol 11 : 1752 1766. Winson, M.K., Swift, S., Hill, P.J., Sims, C.M., Griesmayr, G., Bycroft, B.W. et al. (1998) Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and pr omoter probe plasmids and mini Tn5 constructs. FEMS Microbiol Lett 163 : 193 202.

PAGE 163

163 BI OGRAPHICAL SKETCH Cory Jon Krediet was born in 1984, in Oklahoma City, Oklahoma. The elder of two children, he grew up in Chicago, IL, graduating from Glenbard North High School in 2002. He earned his Bachelor of Arts degree in b iology and German from Dr ew University in 2006, graduating summa cum laude with specialized honors in b iology. During his undergraduate career, Cory conducted original research as part of a Research Experience for Undergraduates (REU) program sponsored by the National Science Foundation. Working at Shoals Marine Laboratory in the Gulf of Maine, he investigated gro wth and mortality trade offs in the Jonah crab, Cancer borealis That undergraduate experiences also led him to study coral reef ecology in the Egyptian Red Sea and in Belize. Co ry began his Master of Science degree in the interdisciplinary ecology in the laboratory of Dr. Max Teplitski at the University of Florida in the fall of 2006. During his thesis research, Cory characterized an isolate of Serratia marcescens capable of c ausing disease on Elkhorn coral, Acropora palmata and its relatedness to other environmental and human isolates. He used phenotypic and genetic analyses to associated bacter ia. The results of his M.Sc. thesis were published in two peer reviewed journals and presented at the 11 th International Coral Reef Symposium held in Resources and Environm ent in 2009. Throughout the coral pathogen S. marcescens PDL100 in order to better understand the

PAGE 164

164 mechanisms the pathogen employs to infect its coral host and to investigate the interac tions that occur on the surface of corals between the resident coral associated bacteria and invading opportunistic pathogens. In addition to his lab work at UF, Cory has participated in annual coral spawning research trips to the FL Keys to work at the M ote Marine Laboratory Tropical Research Laboratory. There with scientists from around the world, Cory studied the highly synchronized spawning events of several coral species and the various effects inoculation of both environmental and pathogenic bacteri a had on coral larvae and juvenile corals Cory also participated in an NSF sponsored summer fellowship (East Asia and Pacific Summer Institutes, EAPSI) during the summer of 2010 and worked at the Australian Institute of Marine Science He worked under t he mentorship of Dr. David Bourne to engineer a strain of Vibrio coralliilyticus with fluorescent proteins in order to visualize the pathogen during the coral infection process. Cory has also kept in contact with his alma mater, Drew University, and has s erved as co instructor for a tropical marine ecology course taught in Belize. Adding to his accolades, this year Cory was awarded both the HHMI Science for Life Graduate Mentorship Award and the UF/ CALS Jimmy G. Cheek Gradu ate Student Medal of Excellence for his work mentoring undergraduate students in the Teplitski lab After graduation from the University of Florida in August 2012 Cory will continue working in the field of coral microbiology as a post doctoral fellow at Stanford University. Working in the lab of Dr. John Pringle in the Department of Genetics Cory will focus his work on the emerging model organism, Aiptasia pallida and will study early onset and maintenance of symbiosis between the polyp host and zooxanthellae.