<%BANNER%>

Role of Different Residues Involved in Atp Interaction by the Clamp Loader

Permanent Link: http://ufdc.ufl.edu/UFE0044339/00001

Material Information

Title: Role of Different Residues Involved in Atp Interaction by the Clamp Loader
Physical Description: 1 online resource (120 p.)
Language: english
Creator: Chiraniya, Ankita
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: aaa -- argfinger -- atp -- proteins -- sensor1 -- walkerb
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: DNA polymerases synthesize long stretches of DNA with high efficiency and processivity. This is made possible by ring-shaped proteins called sliding clamps, which topologically link the polymerases to DNA. The clamps need to be opened and loaded onto the DNA, which is done in an ATP-dependent manner by another set of proteins called clamp loaders. Clamp loaders belong to a vast super-family of proteins called AAA+ proteins. AAA+ proteins contain a highly conserved domain made of 200-250 amino acids called AAA+ domain, which includes several conserved motifs involved in ATP binding, ATP hydrolysis and other functions associated with the activity of the AAA+ protein. Some of the well-studied AAA+ motifs are the Walker A motif, which is involved in ATP binding, the Walker B motif which is involved in ATP hydrolysis and the Arg finger motif which is involved in sensing the bound ATP molecule and catalyzing ATP hydrolysis. Our central hypothesis is that, in addition to the classic functions carried out by the conserved AAA+ motifs; they are also involved in making conformational changes, which are required for an efficient clamp loading reaction. The clamp loading reaction involves multiple steps such as binding the clamp, opening the clamp, closing the clamp around DNA and releasing the clamp•DNA product. Some of these steps involve ATP binding while others involve ATP hydrolysis. We have made mutations in coding sequence of some of the conserved AAA+ motifs of bacterial (E. coli) and eukaryotic (S. cerevisiae) clamp loaders and analyzed the clamp loading reaction to determine whether the AAA+ motifs have any additional role besides the functions already known to be associated with them. Specifically, we have made mutations affecting the Walker B motif of the eukaryotic clamp loader and the Arg finger and Sensor 1 motifs in the bacterial clamp loader. We have used fluorescence based assays to monitor individual clamp loading steps such as clamp binding, clamp opening, DNA binding and ATP hydrolysis. Our data suggest that in addition to the classical function associated with the three motifs, they are also involved in making conformational changes required for clamp loading.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ankita Chiraniya.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Bloom, Linda B.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044339:00001

Permanent Link: http://ufdc.ufl.edu/UFE0044339/00001

Material Information

Title: Role of Different Residues Involved in Atp Interaction by the Clamp Loader
Physical Description: 1 online resource (120 p.)
Language: english
Creator: Chiraniya, Ankita
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: aaa -- argfinger -- atp -- proteins -- sensor1 -- walkerb
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: DNA polymerases synthesize long stretches of DNA with high efficiency and processivity. This is made possible by ring-shaped proteins called sliding clamps, which topologically link the polymerases to DNA. The clamps need to be opened and loaded onto the DNA, which is done in an ATP-dependent manner by another set of proteins called clamp loaders. Clamp loaders belong to a vast super-family of proteins called AAA+ proteins. AAA+ proteins contain a highly conserved domain made of 200-250 amino acids called AAA+ domain, which includes several conserved motifs involved in ATP binding, ATP hydrolysis and other functions associated with the activity of the AAA+ protein. Some of the well-studied AAA+ motifs are the Walker A motif, which is involved in ATP binding, the Walker B motif which is involved in ATP hydrolysis and the Arg finger motif which is involved in sensing the bound ATP molecule and catalyzing ATP hydrolysis. Our central hypothesis is that, in addition to the classic functions carried out by the conserved AAA+ motifs; they are also involved in making conformational changes, which are required for an efficient clamp loading reaction. The clamp loading reaction involves multiple steps such as binding the clamp, opening the clamp, closing the clamp around DNA and releasing the clamp•DNA product. Some of these steps involve ATP binding while others involve ATP hydrolysis. We have made mutations in coding sequence of some of the conserved AAA+ motifs of bacterial (E. coli) and eukaryotic (S. cerevisiae) clamp loaders and analyzed the clamp loading reaction to determine whether the AAA+ motifs have any additional role besides the functions already known to be associated with them. Specifically, we have made mutations affecting the Walker B motif of the eukaryotic clamp loader and the Arg finger and Sensor 1 motifs in the bacterial clamp loader. We have used fluorescence based assays to monitor individual clamp loading steps such as clamp binding, clamp opening, DNA binding and ATP hydrolysis. Our data suggest that in addition to the classical function associated with the three motifs, they are also involved in making conformational changes required for clamp loading.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ankita Chiraniya.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Bloom, Linda B.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0044339:00001


This item has the following downloads:


Full Text

PAGE 1

1 ROLE OF DIFFERENT RESIDUES INVOLVED IN ATP INTERACTION BY THE CLAMP LOADER By ANKITA CHIRANIYA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Ankita Chiraniya

PAGE 3

3 To my Parents and family

PAGE 4

4 TABLE OF CONTENTS page LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 15 AAA+ Proteins ................................ ................................ ................................ ........ 15 Structural Elements of the AAA+ Domain ................................ ......................... 15 ATP Driven Conformational Changes ................................ .............................. 18 Variation among AAA+ Proteins ................................ ................................ ....... 19 Clamp and Clamp Loaders ................................ ................................ ..................... 19 Structure of the Sliding Clamp ................................ ................................ .......... 20 Structure of the Clamp Loader ................................ ................................ ......... 21 Clamp Loading Reaction ................................ ................................ ......................... 23 Statement of Problem ................................ ................................ ............................. 24 Design of the Research Project ................................ ................................ .............. 26 Mutations used in this Study ................................ ................................ ............. 26 Assays used in this Study ................................ ................................ ................. 27 Significance of this Study in Medical Science ................................ ......................... 27 2 LITERATURE REVIEW ................................ ................................ .......................... 29 Clamp Loading Reaction ................................ ................................ ......................... 29 Events Coupled with ATP Binding ................................ ................................ .... 29 Events Coupled with ATP Hydrolysis ................................ ............................... 32 Previous work in Bloom laboratory ................................ ................................ ......... 33 Mutational Studies with AAA+ Proteins ................................ ................................ ... 36 3 MATERIALS AND METHODS ................................ ................................ ................ 37 Reagents and Oligonucleotides ................................ ................................ .............. 37 Reagents ................................ ................................ ................................ .......... 37 Oligonucleotide Substrates ................................ ................................ ............... 37 Proteins ................................ ................................ ................................ ................... 38 Replication Factor C (RFC) ................................ ................................ .............. 38 Expression vectors ................................ ................................ ..................... 38 Primers ................................ ................................ ................................ ....... 40 Protein Overexpression and Purification ................................ .................... 43

PAGE 5

5 Size exclusion Chromatography ................................ ................................ 44 Other Proteins ................................ ................................ ................................ .. 46 Steady State Assays ................................ ................................ ............................... 46 ATP Binding Assay ................................ ................................ ........................... 47 PCNA Binding Assay ................................ ................................ ........................ 48 Binding Assay ................................ ................................ ................................ 50 PCNA Opening Assay ................................ ................................ ...................... 51 Opening Assay ................................ ................................ .............................. 53 DNA Binding Assay ................................ ................................ .......................... 54 DNA DCC Based Assay ................................ ................................ ............ 54 DNA RhX Based Assay ................................ ................................ ............. 55 ATP Hydrolysis Assay ................................ ................................ ...................... 57 Pre Steady State PCNA Opening Ass ay ................................ ................................ 59 Assays Containing ATP S ................................ ................................ ...................... 59 4 MOTIF OF RFC ................................ ................................ ................................ ...... 60 Background Information ................................ ................................ .......................... 60 Results ................................ ................................ ................................ .................... 61 Equilibrium PCNA Binding ................................ ................................ ................ 61 PCNA Ring Opening ................................ ................................ ........................ 63 Equilibrium PCNA Opening in the Presence of 0.5 mM ATP ..................... 63 Equilibrium PCNA Opening in the Presence of Excess ATP ...................... 65 Pre steady State PCNA Opening ................................ ............................... 66 Equilibrium DNA Binding ................................ ................................ .................. 68 DNA DCC Based Assay ................................ ................................ ............ 68 DNA RhX Based Assay ................................ ................................ ............. 69 Equilibrium ATP Binding ................................ ................................ ................... 72 ATP Hydrolysis ................................ ................................ ................................ 74 Conclusions ................................ ................................ ................................ ............ 77 5 COMPLEX ARG FINGER MUTANTS ARE DEFECTIVE IN CLAMP OPENING 78 Background Information ................................ ................................ .......................... 78 Res ults ................................ ................................ ................................ .................... 80 Equilibrium Binding ................................ ................................ ........................ 80 Equilibrium Clamp Opening ................................ ................................ ........... 82 Conclusions ................................ ................................ ................................ ............ 84 6 1 MOTIF OF COMPLEX PROMOTES ATP DEPENDENT CONFORMATIONAL CHANGES .... 86 Background Information ................................ ................................ .......................... 86 Results ................................ ................................ ................................ .................... 88 Equilibrium DNA Binding ................................ ................................ .................. 88 ATP Hydrolysis ................................ ................................ ................................ 90

PAGE 6

6 Conclusions ................................ ................................ ................................ ............ 93 7 ATP S REDUCES CLAMP OPENING ................................ ................................ .... 95 Background Information ................................ ................................ .......................... 95 Results ................................ ................................ ................................ .................... 96 PCNA Binding ................................ ................................ ................................ .. 96 Equilibrium PCNA Opening ................................ ................................ .............. 97 Pre S teady State PCNA Opening ................................ ................................ ..... 9 8 Binding ................................ ................................ ................................ ........ 100 Opening ................................ ................................ ................................ ....... 101 Conclusions ................................ ................................ ................................ .......... 102 8 DISCUSSION AND FUTURE DIRECTIONS ................................ ........................ 104 Walker B Motif ................................ ................................ ................................ ...... 104 Arg Finger Motif ................................ ................................ ................................ .... 105 Sensor 1 Motif ................................ ................................ ................................ ....... 105 Final Thoughts ................................ ................................ ................................ ...... 106 Implications ................................ ................................ ................................ ........... 108 Future Studies ................................ ................................ ................................ ...... 110 LIST OF REFERENCES ................................ ................................ ............................. 112 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 120

PAGE 7

7 LIST OF TABLES Table page 3 1 Buffers used in RFC experiments. ................................ ................................ ...... 37 3 2 Buffers used in complex exper iments. ................................ ............................. 37 3 3 Expression vectors used for making RFC complex. ................................ ........... 38 3 4 Method used for making RFC expression vectors. ................................ ............. 39 3 5 Sequence of the primers used. ................................ ................................ ........... 40

PAGE 8

8 LIST OF FIGURES Figure page 1 1 The crystal structure of the AAA+ domain of NSF.. ................................ ............ 16 1 2 Essential residues involved in ATP hydrolysis. ................................ ................... 18 1 3 Ribbon diagrams of the sliding clamps ................................ ............................... 20 1 4 Ribbon diagrams of the clamp loaders.. ................................ ............................. 21 1 5 Ribbon diagrams of individual subunits. ................................ ............................. 22 1 6 Clamp loading reaction ................................ ................................ ...................... 24 2 1 Clamp loading reaction divided into two pha ses based upon ATP requirement. ................................ ................................ ................................ ...... 29 3 1 Representative maps of the final expression vectors used. ................................ 41 3 2 Representative map of the pCDFDuet 1 RFC2 expression vector.. ................... 42 3 3 Representative map of the pETDuet 1 RFC3(E118A)+RFC4(E115A) expression vector.. ................................ ................................ ............................. 42 3 4 Standard curve generated by separating protein standard molecular weight marke rs on Superose column. ................................ ................................ ............ 44 3 5 SDS PAGE analysis of fractions collected of RFC elution from Superose column.. ................................ ................................ ................................ .............. 45 3 6 Representati ve emission spectra showing ATP binding assay. .......................... 47 3 7 Representative emission spectra showing PCNA binding assay. ....................... 49 3 8 Represe ntative emission spectra showing binding assay.. .............................. 51 3 9 Representative emission spectra showing PCNA opening assay. ...................... 52 3 10 Re presentative emission spectra showing opening assay. ............................. 53 3 11 Representative emission spectra showing DNA DCC based binding assay.. .... 54 3 12 Representative emission spectra showing DNA RhX based binding assay.. ..... 56 3 13 Representative emission spectrum showing ATP hydrolysis assay.. ................. 57 3 14 A representative standard curve used in ATP hydrolysis assay. ........................ 58

PAGE 9

9 4 1 Sequence of the WB motif in each of the RFC subunits.. ................................ ... 60 4 2 Effect of WB Glu mutations on PCNA binding. ................................ ................... 62 4 3 Effect of WB Glu mutations on PCNA opening with 0.5 mM ATP. ...................... 64 4 4 Effect of RFC WB Glu mutations on PCNA opening with excess ATP.. ............. 65 4 5 Effect of RFC WB Glu mutations on rate of PCNA ring opening. ........................ 67 4 6 DCC based equilibrium DNA binding. ................................ ................................ 69 4 7 Effect of RFC WB Glu mutations on DNA binding in the absence of PCNA. ...... 70 4 8 Effect of RFC WB Glu mutations on DNA binding in the presence of PCNA.. .... 71 4 9 Effect of RFC WB EQ Glu mutations on ATP binding.. ................................ ...... 73 4 10 Effect of RFC WB Glu mutations on rate of ATP hydrolysis.. ............................. 75 4 11 Effect of RFC WB Glu mutations on rate of ATP hydrolysis. .............................. 76 5 1 Schematic diagram of the arrangement of ATP binding sites within the 3 complex. ................................ ................................ ................................ ............. 79 5 2 Effect of complex Arg finger mutations on clamp bind ing.. ........................... 81 5 3 Effect of complex Arg finger mutations on opening. ................................ ...... 83 6 1 Effect of the complex Sensor 1 Thr mutation on co the absence of .. ................................ ................................ ............................... 89 6 2 Effect of complex Sensor 1 Thr mutation on presence of .. ................................ ................................ ................................ .... 90 6 3 Effect of complex Sensor 1 Thr mutations on the rate of ATP hydrolysis in the absence of .. ................................ ................................ ............................... 91 6 4 Effect of complex Sensor 1 Thr mutations on rate of ATP hydrolysis in pr esence of ................................ ................................ ................................ ..... 92 7 1 Structure of ATP S. ................................ ................................ ............................ 95 7 2 Effect of ATP S on PCNA binding.. ................................ ................................ .... 96 7 3 Effect of ATP S on PCNA opening.. ................................ ................................ ... 97 7 4 Effect of ATP S on the rate of PCNA opening. ................................ ................... 99

PAGE 10

10 7 5 Effect of A TP S on binding ................................ ................................ ............ 100 7 6 Effect of ATP S on opening ................................ ................................ ........... 101

PAGE 11

11 LIST OF ABBREVIATION S AAA ATPases associated with diverse cellular activities AF488 A lexa Fluor 48 8 ATP S Adenosine O (3 thiotriphosphate) CPS C ounts per s econd DCC 7 diethylaminocoumarin 3 carboxylic acid, succinimidyl ester DTT D ithiothreitol EDTA E thylenediaminetetraacetic acid FRET F luorescence resonance energy transfer HEPES 4 (2 H ydroxyethyl)p iperazine 1 et h anesulfonic acid IPTG I sopropyl D 1 thiogalactopyranoside K d Dissociation constant MCS M ultiple cloning site MDCC N (2 (1 maleimidyl) ethyl) 7 (diethylamino)coumarin 3 carboxamide NAD Nicotinamide adenine dinucleotide ORC Origin recognitio n complex PAGE Poly acrylamide gel electrophoresis PCNA Proliferating cell nuclear antigen p/t DNA primer template DNA Pyrene N (1 pyrenyl)maleimide RFC R eplication factor C RhX X rhodamine isothiocyanate SDM Site directed mutagenesis SPR Surface plasmon r esonance SRH Second region of homology

PAGE 12

12 TNP O (2,4,6 trinitrophenyl) WA Walker A WB Walker B

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Deg ree of Doctor of Philosophy ROLE OF DIFFERENT RESIDUES INVOLVED IN ATP INTERACTION BY THE CLAMP LOADER By Ankita Chiraniya August 2012 Chair: Linda B. Bloom Major: Medical Sciences -Biochemistry and Molecular Biology DNA polymerases synthesize long str etches of DNA with high efficiency and processivity. This is made possible by ring shaped proteins called sliding clamps, which topologically link the polymerases to DNA. The clamps need to be opened and loaded onto the DNA, which is done in an ATP depende nt manner by another set of proteins called clamp loaders. Clamp loaders belong to a vast super family of proteins called AAA+ proteins. AAA+ proteins contain a highly conserved domain made of 200 250 amino acids called AAA+ domain, which includes several conserved motifs involved in ATP binding, ATP hydrolysis and other functions associated with the activity of the AAA+ protein. Some of the well studied AAA+ motifs are the Walker A motif, which is involved in ATP binding, the Walker B motif which is involv ed in ATP hydrolysis and the Arg finger motif which is involved in sensing the bound ATP molecule and catalyzing ATP hydrolysis. Our central hypothesis is that, in addition to the classic function s carried out by the conserved AAA+ motifs; they are also in volved in making conformational changes, which are required for an efficient clamp loading reaction. The clamp loading reaction involve s multiple steps such as binding the clamp, opening the clamp, closing roduct. Some of these steps

PAGE 14

14 involve ATP binding while others involve ATP hydrolysis. We have made mutations in coding sequence of some of the conserved AAA+ motifs of bacterial ( E. coli ) and eukaryotic ( S. cerevisiae ) clamp loaders and analyzed the clamp l oading reaction to determine whether the AAA+ motifs have any additional role besides the functions already known to be associated with them. Specifically, we have made mutations affecting the Walker B motif of the eukaryotic clamp loader and the Arg finge r and Sensor 1 motifs in the bacterial clamp loader. We have used fluorescence based assays to monitor individual clamp loading steps such as clamp binding, clamp opening, DNA binding and ATP hydrolysis. Our data suggest that in addition to the classical f unct ion associated with the three motifs they are also involved in making conformational changes required for clamp loading.

PAGE 15

15 CHAPTER 1 INTRODUCTION AAA+ Proteins The AAA+ (ATPases associated with diverse cellular activities) (1) family is a large, functionally diverse protein family and the members belong to the super family of ring shaped P loop ATPases (2) Conserv ed in all three domains of life, these proteins are macromolecular machines that use the energy released by ATP hydrolysis to remodel their target substrates in various ways (3) For example, AAA+ proteins are involved i n membrane fusion (NSF) (4) protein degradatio n (Clp/Hsp 100 family) (5) DNA replication (helicases, clamp loaders) (6) and the movement of microtubule motors (Dynein) (7) Their functional diversity is simplified by one unifying concept ; that upon nucleotide binding and hydrolysis, these enzymes undergo conforma tional changes that are ultimately responsible for their function. One characteristic feature of the AAA+ family of proteins is their assembly into oligomers, which is the biologically active form. Second feature is presence of a 200 250 amino acid ATP bin ding domain (AAA domain). This domain contains Walker A and Walker B motifs, which are the hallmark s of classic P loop NTPases and, additional motifs that distinguish it from P loop NTPases (reviewed in (8) ) (NTP refers to ATP or GTP) Structural Elements of the AAA+ Domain Conserved features of the AAA+ domain are shown in Figure 1 1, with the helices and stra nds as designated by Iyer and collegues (8, 9) The AAA+ domain is made of two sub domains, an N terminal / Rossman fold and a C terminal helical sub domain. The N terminal sub domain has a parallel sheet and contributes to the adenine ring binding pocket. The C terminal sub domain is composed of several

PAGE 16

16 helices and forms a partial lid over the nucleotide binding site. Several conserved motifs are an integral part of the AAA+ domain. The Walker A (WA) motif directly interacts with the phosphates o f ATP. The conserved lysine in the consensus sequence GXXXXGK[T/S] is crucial for ATP binding, and its mutation drastically reduces nucleotide binding and nucleotide dependent activities of AAA+ protein s (10) The Walker B (WB) motif also interacts with the ATP and the acidic residues of its hhhhDEXX sequence are crucia l for ATP hydrolysis. The aspartate residue coordinates Mg 2+ that is essential for ATP hydrolysis, and the Glu residue activates water for the hydrolysis reaction (9) Mutation of this Glu typically impairs ATP hydrolysis but not ATP bi nding (8, 11 13) Figure 1 1. The crystal structure of the AAA+ domain of NSF. The structure (PDB ID 1D2N) is presented as a model AAA+ domain. Approximate positions of the key elements are highlighted. A nu cleotide analogue (AMP PNP), shown in stick representation, is coordinated by Mg 2+ Figure is reprinted by permission from Macmillan Publishers Ltd: [ Nature Reviews Molecular Cell Biology ] (8) copyright (2005).

PAGE 17

17 Another conserved region called the second region of homology (SRH) is present C terminal to the W B motif. The SRH consists of two specific structural elements, S ensor 1 and the Arg finger, one at either end. These elements have been proposed to coordinate nucleotide hydrolysis and conformational changes between AAA+ subunits. Sensor 1 is found at the N terminus of SRH and a conserved polar residue (commonly an asparagine) is located between the WA and WB motifs. This residue is thought to distinguish between ADP and ATP (14) and mutation of this residue has been shown to impair ATP hydrolysis (15) The Arg finger is found at the C terminus of SRH and constitutes part of the nucleotide bin ding site of the adjacent subunit, so named because of a conserved Arg (14) The Arg finger motif plays an important role in sensing the bound ATP and promoting binding of the clamp loader to DNA (16) leading to catalysis of ATP hydrolysis (17) Mutation of the conserved Arg has been shown to impair hydrolysis but not ATP binding (17, 18) Sensor 2 is located near the C terminus of the AAA+ domain and its residues (conserved Arg ) also participate in nucleotide binding (19) The N linker domain is located at the N terminus of the AAA + domain and connects it to other (non AAA+) domains (8) The pore loop is believed to be involved in substrate binding. Various AAA+ residues interact a mong each other to coordinate efficient ATP binding and hydrolysis. Figure 1 2 (20) shows critical residues involved in ATP binding better nucleophile for in line attack on the phosphorus (20) Figure 1 2 also shows

PAGE 18

18 pr which interacts with the bound ATP. Figure 1 activates water molecule for ATP hydrolysis. T he magnesium ion is and oxygens from the and interacts with ATP in trans. Figure is reprinted by permission from Macmillan Publishers Ltd : [ Nature Structural & Molecular Biology ] (20) copyright (2008). ATP Driven Conformational Changes ATP binding and hydrolysis promote various conformational changes inside the oligomeric assembly of the AAA+ proteins. The proteins function by linking these changes to a number of mechano chemical actions on the target macromolecules (reviewed in (21) ). A cycle of ATP binding and hydrolysis defines a switch between two distinct conformational states of the protein, the active and inactive states. The intersubunit coupling that exists between the AAA+ assemblie s enable the proteins to propagate the conformational changes from one site to another (21) The interaction

PAGE 19

19 with various ligands at different steps of the reaction, further fine tune the conformational changes. Variation among AAA+ Proteins AAA+ proteins display a remarkable diversity of mecha nisms of action. At the core of this diversity is the AAA+ molecular motor, which has evolved differently in different proteins to adapt to the specific functions (reviewed in (22) ). To carry out an enormous variety of cellular functions, the AAA+ modules hav e undergone direct structural modifications at the amino acid sequence level. For example, the two sub domain architecture of the AAA+ domains is more conserved than the actual amino acid sequence (8) Another mechanism by which they have adopted different functions is through presence of additional domains at the amino and carboxyl termini of the conserved modu les. For example, clamp loaders have an additional sub domain, C terminal to the AAA+ domain, which oligomerizes to form a ring, which stabilizes the complex (23, 24) Finally, within the active AAA+ assembly, there are some examples of AAA+ modules that have degenerated into proteins that lack ATP binding and hydrolysis activity altogether. Examples of this class include the and bacterial clam p loader (23, 25) These modified subunits typically serve as modulators between active AAA+ ATPase subunits within an oligomeric complex (21) Clamp and Clamp Loaders One of the best characterized groups of AAA+ super family is the clamp loader. These multimeric complexes are an essential part of the DNA replication machinery. Chromosome replication requires a DNA polymerase that can rapidly duplicate thousands of nucleotides. In all organisms, the replicative pol ymerase is anchored to the DNA by a ring shaped clamp that encircles DNA and slides freely along the DNA.

PAGE 20

20 The closed circular structure of the ring shaped clamps requires an active mechanism to open and assemble them onto the DNA. T he clamp loader is an AA A+ enzyme which opens the clamps and loads them onto the replication fork in an ATP driven reaction (reviewed in (26) ). Functional and structural analyses indicate that the architecture and mechanism of clamps and clamp loaders are conserved across the three domains of life (6, 27, 28) In this study, the clamp and clamp loader of the bacterial Escherichia coli and the eukaryotic Saccharomyces cerevisiae were studied. Structure of the Sliding Clamp The eukaryotic proliferating cell nuclear antigen (PCNA) and prokaryotic beta ( ) clamps have unrelated amino acid sequences, yet th ey have striking structural similarities (29, 30) PCNA is a homotri mer, while is a homodimer ( Figure 1 3 ). Figure 1 3 Ribbon diagrams of the sliding clamps. A, S. cerevisiae clamp PCNA (PDB ID 3K4X) and B, E. coli clamp (PDB ID 3BEP). The clamps are structurally organized into six domains of similar fold arrang ed in a ring. A PCNA monomer is formed by covalently linking two domains (therefore a trimer), and a monomer is formed by covalently linking three domains (therefore a dimer). The subunits are arranged in a head to tail fashion imparting different front and back faces to the sliding clamps. The ribbon diagrams were rendered using pymol.

PAGE 21

21 Both clamps are ring shaped proteins made of crescent shaped protomers with a large central channel that can easily accommodate double stranded DNA (29, 31) Both clamps contain six globular domains of similar fold but differing primary sequence creating six fold pseudo symmetry. PCNA contains three interdomain interfaces, and contains two, which interact only through noncovalent bonds, an d can be opened by the clamp loader to allow DNA to pass into the center of the ring. Structure of the Clamp Loader The functional core of clamp loaders is composed of five subunits, each of which contains three structurally homologous domains joined by fl exible linkers (23, 24) ( Figure 1 4 ). Figure 1 4 Ribbon diagrams of the clamp loaders. A, S. cerevisiae clamp loader RFC (PDB ID 1SXJ) and B, E. coli clamp lo ader complex (PDB ID 3GLF) subunits is as follows : purple ; Rfc1, blue ; Rfc4, red ; Rfc3, green ; Rfc2 and yellow ; Rfc5. The color code used for complex subunits is as follows : purple ; blue ; and yellow ; S is shown in gray spheres. The ribbon diagrams were rendered using pymol.

PAGE 22

22 The N terminal domains (I & II) contain characteristic AAA+ motifs, and the C terminal domain (III) is unique to clamp loaders. The C terminal domai ns interact tightly terminal domains I and II interact loosely forming a ring shaped assembly of the five subunits. The clamp loaders are replication factor C (RFC) in S cerevisiae and gamma complex ( complex) in E. coli respectively. Figure 1 5 Ribbon diagrams of individual subunits. A, S. cerevisiae Rfc4 subunit (PDB ID 1SXJ) and B, E. coli subunit (PDB ID 3GLF). For clarity, only Domains I and II shared with AA A+ family are shown. The individual subunits are bound to ATP S (gray) and their interaction with crucial residues of different (green) S genta). The Arg finger interacts with the ATP of the (24) The ribbon diagrams were rendered using pymol. RFC consists of five different homologous subunits, and each subunit belongs to the AAA+ family (27) The subunits are referred to as either subunits A to E or 1 to 5. S ubunits 2 to 5 contain the three domain architecture ( Figure 1 5 ), wh ile subunit 1

PAGE 23

23 contains N and C terminal extensions to the three domains (24, 27) The N terminal extension shows homology to bacteria l DNA ligase (32) binds DNA nonspecifically in in vitro assays (33) and its function in vivo is unknown. Although each of the subunits likely binds ATP, the Rfc5 subunit contains mutations in the WB motif and lacks a transacting Arg finger so that it lacks ATPase activity (34) The complex consists of seven subunits, which are three copies of DnaX protein ( or ) and one copy each of and (reviewed in (35) ). The and subunits do not belong to the AAA+ family (36) and although and proteins, they do not bind ATP (37) Therefore, the ATPase activity resides only in the and subunits. Mixed clamp loaders containing both and subunits or containing only or subunits have been characterized (38, 39) The 3 compl ex, which lacks is sufficient to load clamps under experimental conditions (40) In this study, the 3 clamp loader has been used and referred to as wild type ( wt ) complex. Clamp Loading Reaction Clamp loading is a highly dynamic and rapid process. On the leading strand, where DNA synthesis is continuous, one clamp is required at each replication fork. On the lagging strand, where DNA is synthesized discontinuously, a clamp is needed for each Okazaki fragment synthesized. In E. coli where the replication fork progresses at rates o f at least 500 nt/s (41) clamp loading on the lagging strand must be rapid. The overall process of loading the clamps onto the DNA by the clamp loader involves many individual steps such as binding ATP, binding the clamp, opening the clamp, binding the DNA, closing the clamp arou nd the DNA and finally releasing the closed clamp onto the DNA ( Figure 1 6 ) (42) These steps involve many interactions of

PAGE 24

24 the clamp loader with its su bstrates, which are ATP, clamp and DNA at different points of the clamp loading reaction. After loading the clamp onto the DNA, the clamp loader needs to move away so that DNA polymerase can access the clamp. This means that initially the clamp loader mus t have a high affinity for the clamp and the DNA to bring these two macromolecules together and later after placing the clamp around DNA it brought about by the interaction with the appropriate ligands, which are ATP, clamp and the DNA. Figure 1 6 Clamp loading reaction. The reaction can be divided into two phases based on ATP requirements: 1 ) complex promoted by ATP binding, and 2 ) release of the clamp on DNA promoted by ATP hydrolysis. The diagram illustrates a structural model for RFC and PCNA based on crystal structures of clamp loaders and clamp s (24, 43, 44) Individual protein domains represented by spheres or ovals. Statement o f Problem The AAA+ superfamily is a large family of proteins involved in varied cellular functions. Structure function studies have been done with these proteins primarily by

PAGE 25

25 making mutation s in conserved residues and thus hoping to defin e their particular role in the function of the protein in question (8) On one hand, all AAA+ proteins share the conserved res idues and the roles played by them, while on the other hand proteins evolv ed for a particular cellular function have also incorporated changes not shared by other AAA+ proteins. These adaptations regulate the stability of the complex, their interaction wi th the substrates, the conformational changes and finally, the mechanism by which they manipulate their target macromolecules (reviewed in (21) ). In this study, we have analyzed the role of different conserved residues in the AAA+ domain of clamp loader. Our central hypothesis is that, in additi on to the known ATP binding/hydrolysis function s carried out by them, the conserved residues also play important roles in making conformational changes within the AAA+ assembly. Chapter 4 investigates the role of the r eaction by RFC. We have discovered a novel function for this residue. Our study shows that the WB motif is involved in making ATP dependent conformational changes required for clamp binding, opening and DNA binding. In addition to this, the WB motif is als o required for DNA dependent stimulation of ATP hydrolysis. Chapter 5 describes a novel role of the complex. Chapter 6 describes the role of the dependen t conformational changes in the complex. Taken together, our study shows that in the clamp loaders, the residues involved in interaction with ATP perform other tasks in addition to the roles previously assigned to them, which are mediating conformationa l changes in response to ligand binding.

PAGE 26

26 O (3 thiotriphosphate) (ATP S) on the clamp binding and opening reactions. ATP S is a non hydrolysable analogue of ATP and is commonly used to tes t reactions which involve ATP hydrolysis. Chapter 7 describes the difference between ATP and ATP S in the clamp binding and opening reactions by both RFC and complex. Our study shows that ATP S does not support all the conformational changes needed to o pen the clamp. Design of the Research Project Mutations used in this Study To study the role of various conserved residues, specific mutations were made. The conserved Glu (E) residue in the WB motif of RFC was mutated to Gln (Q) or Ala (A) to generate tw o types of WB mutants, referred to as WB EQ and WB EA mutant respectively. Mutations were made in the four active ATPase subunits, Rfc1 (Glu 425), Rfc2 (Glu 141), Rfc3 (Glu 118), and Rfc4 (Glu 115), thus generating quadruple mutants. Rfc5 contains a non co nsensus WB motif (hhhhNEAN instead of hhhhDEXX ) and lacks a trans acting Arg finger both of which reduce its ATPase activity. In addition, t he N terminal region of Rfc1 containing the first 283 residues, is not required for cell viability (45) and shows nonspecific DNA binding activity (33) All RFC complexes used in this study were deleted for this N terminal region and the complex containing no additional mutation s is referred to as wild type RFC. To study the role of the Arg finger motif in the clamp loading reaction by complex, two of the subunits and the subunit extend their Arg finger towards the ATP site of the neighboring subunit. Because of this functional asymmetry, two different types of

PAGE 27

27 mutants can be made. One containing the mutation in the subunits (R169A), and another in the These two mutants were used in our study. To study the role of the Sensor 1 motif in (T157A) in all three subunits. Assays used in this Study All the proteins used in our study were expressed in E. coli. The purified proteins were used to perform in vitro assays to determine the role of the AAA+ residues. The individual steps of the clamp loading reaction were monitored using several fluorescence based assays. We have used the fluorescence based assays to study the interactions and reactions both at equilibrium and in real time. Significance of this Study in Medical S cience The clamp loader plays an essential role in DNA replication and repair process. Given the importance of this function, there is a grow ing set of human diseases related to genetic alterations in human RFC. An example of these diseases is Wiliams Beuren syndrome, which is a developmental disorder with multiple system manifestations and is caused by heterozygosity for a chromosomal deletion of part of band 7q11.23 (46) The deletion involves approximately 25 genes including RFC2 subunit (46) In another example, a study was performed to identify Breast Cancer 1 (BRCA1) associated proteins (47) Among the DNA repair proteins found to be associated with this large protein complex, RFC1 RFC2 RFC4 complex was also identified. Addi tionally, Mutation and loss of expression of RFC3 subunit have also been associated with genomic instability and increased incidence of Gastric and Colorectal Cancers (48) And recently, an N terminal deletion in RFC1 subunit was found to be associated with Hutchinson

PAGE 28

28 Gil ford Progeria Syndrome (HGPS), which results in premature aging (49) Our study aims to provide further insight into the mechanism of clamp loading reaction, thus providing the knowledge to make corre lations between defects in DNA replication and diseases.

PAGE 29

29 CHAPTER 2 LITERATURE REVIEW Clamp Loading Reaction The clamp loading reaction requires several interactions of the clamp loader with ATP, the clamp and the DNA. It has been proposed that each inte raction promotes conformational changes within the clamp loader, which facilitates the next step of the reaction (35) At the very basic level, the clam p loading reaction can be divided into two complex promoted by ATP binding, and B) release of the clamp on DNA promoted by ATP hydrolysis ( Figure 2 1). Figure 2 1. Clamp loading reaction divided into two pha ses based upon ATP requirement. The diagram illustrates a structural model for RFC and PCNA based on crystal structures of clamp loaders and clamps (24) Spheres or ovals represent individual protein domains. Events Coupled with ATP Binding ATP binding promotes formation of the ternary complex. The clamp loader binds the clamp with high affinity in the presence of ATP. This has been shown for both RFC

PAGE 30

30 (34) and the complex (50) Based on structural data (23) it has been proposed that in the absence of ATP, the complex remains in a relatively closed state and which is the interacting element, is hidden by After binding ATP, the N terminal face of the complex opens up and allows to bind to (23) Both RFC (51, 5 2) and the complex (53) have been shown to open c lamps in the absence of ATP hydrolysis. R ecently, data from pre steady state analysis and kinetic modeling of S. cerevisiae RFC activities were used to propose a model in which the clamp loader binds two to three ATPs, followed by binding of the PCNA clamp and additional one to two ATPs (34) Upon binding, the PCNA complex undergoes slow activation steps leading to f ormation of the PCNA complex (54) A ddi tionally the complex has been shown to actively open the clamp, rather than stabilizing already open clamps present in solution (44) Therefore, clamp opening appears to be an active process enhanced by ATP and clamp binding, although it does not need ATP hydrolysis. PCNA opening has also been proposed to be independent of ATP hydrolysis based upon kin etic modeling (54) ure (24) the Arg replaced by crystallized with ATP S. finger mutation an d/or ATP S affect the conformational changes required for PCNA opening. After opening the clamp, the clamp loader binds primer template ( p/t ) DNA. Both ATP and clamp binding stimulate DNA binding. The complex binds DNA with low affinity in the presence o f ATP, and the binding is significantly enhanced in the presence of (55) Similarly, PCNA also enhances RFC binding to p/t DNA. Equilibrium measurement of RFC binding to DNA was made in the presence of ATP S and the

PAGE 31

31 dissociation constant ( K d ) was shown to be about six fold lower in the presence of PCNA (34) Mecha nistically, it makes sense for DNA binding to be stimulated by clamp binding. If this was not the case, the clamp loader alone might bind DNA with the same leading to releas complex will result in productive clamp loading onto the DNA, in contrast, in the case of without any cl amps being loaded. Another reason for this stimulation comes from the structural constraints. The clamp is a ring shaped structure and needs to be cracked open by the clamp loader in order to let the DNA pass through the ring. A clamp loader bound to DNA f irst cannot bind the clamp, however when bound to the clamp first, it opens the clamp forming an overall ring shaped assembly through which DNA can be threaded. Thus stimulation of DNA binding by clamp favors the binding of clamp e DNA over binding of clamp loader alone to the DNA leading to a productive clamp loading reaction. Structures of the S. cerevisiae RFC PCNA complex (24) and E. coli complex DNA complex (56) show how clamps and clamp loaders may interact during the clamp loading reaction as well as how clamp loaders bind DNA. The clamp loaders bind the clamp via the N terminal domains of the clamp loader subunits. One interface between adjacent monomers in the clamp is opened, possibly through movement both in and out of the plane of the ring formed by clamp monomers (57, 58) Individual clamp loader subunits adopt a conformation such that they spiral around an axis going from the C terminal to N terminal domains of the proteins in the complex. Duplex DNA

PAGE 32

32 at the 3 open side formed by the N terminal domains, and the spiraling conformation of the subunits matches the spiral of the DNA helix such that the clamp loader resembles a (24, 58) The s ingle stranded template overhang exits through the gap between the S. cerevisiae Rfc1 and Rfc5 subunits or the analogous E. coli and subunits (56, 59) Events Coupled with ATP Hydrolysis ATP hydrolysis promotes dissociation of the ternary complex leading to the AT P hydrolysis in the absence of DNA is significantly slower (60) The RFC ATPase rate is stimul ated up to ~20 fold by DNA alone and further as much as ~25 fold in the presence of both DNA and PCNA (34) RFC can hydrolyze up to four ATP molecules. Recent pre steady state ATPase analysis and kinetic modeling study (61) suggest that 3 to 4 ATP molecules are hydrolyzed after formation of the ternary complex. ATP hydrolysis promotes conformational changes leading to the closur e of PCNA around the DNA, which promotes release of 3 to 4 inorganic phosphate (P i ) molecules. Release of P i brings about further conformational changes lowering the affinity of RFC for PCNA DNA and release of the clamp around the DNA. The exact sequence o f events coupled with ATP hydrolysis is understood in more detail for the complex. The complex can hydrolyze up to 3 molecules of ATP. Pre steady state ATPase assays (62) have shown that, hydrolysis of 2 molecules of ATP is associated with conformational changes which reduce binding interactions with DNA, whereas hydrolysis of the third molecule is associated with conformational changes that retract the subunit an d release

PAGE 33

33 Therefore, the general mechanism of ATP hydrolysis and release of the clamp product appears to be the same. Both DNA and the clamp trigger ATP hydrolysis. Again this makes sense mechanistically, as if this was not the case then the clamp l oader would bind and hydrolyze ATP on its own. This will lead to a futile cycle of ATP hydrolysis without any clamps being loaded. The stimulation of ATP hydrolysis by the DNA and clamp ensures that a productive clamp loading takes place. Similarly, a defi ned temporal order for binding and releasing the clamp and DNA would increase the efficiency of the clamp loading reaction. For example, if the clamp loader were to release its grip on DNA prior to clamp closing, the DNA would slip out of the open clamp. T herefore, each interaction the clamp loader makes with the ligands, and the conformational changes induced by them play s an important role in ensuring that clamp loading reaction occurs in a defined and efficient manner. Previous work in Bloom laboratory W ork done by former members of the Bloom laboratory has contributed immensely to the current understanding in the field of clamp loading mechanism. Brandon Ason studied the interaction of complex with primed template DNA and showed that the DNA binds co mplex rapidly followed by ATP hydrolysis leading to a rapid dissociation of DNA from complex (63) Based on this work he proposed a model where complex state allows DNA binding and loading compared the clamp loading and ATP hydrolysis by co mplex in presence of primed

PAGE 34

34 template blunt end (elongation deficient DNA) (64) His results showed that the elongation proficient DNA is absolutely necessary to hydrolyze ATP and release clamp onto the DNA. Two former members, Christopher Williams and Anita Snyder worked extensively on the ATP binding and hydrolysis dependent interaction of complex with and DNA Christopher studied the pre steady state kinetics of ATP hydrolysis by complex (62) and showed that hydrolysis of 2 molecules of ATP is associated with conformational changes in the complex, which reduce binding interactions with DNA, whereas hydrolysi s of the third molecule of ATP is associated with conformational changes which retract s the subunit and release s the clamp Anita studied the effect of Arg finger complex on interaction with and DNA (16) Her results showed that interaction of the Arg finger motif with ATP bound to 1 has a larger role to play in interaction with while the interaction of the Arg finger motif with ATP bound t o 2 and 3 has a larger role to play in interaction with DNA, thus suggesting a mechanism where the and DNA binding activities of the complex are uncoupled. Stephen Anderson measured the clamp loading activities of different forms of complex, one co ntaining subunit ( 3 ) and one lacking it ( 3 (40) His results showed that the subunit plays a role in stabilizing the ATP induced conformational state of complex, which has a high affinity for DNA. Based on his studies, he suggested a mechanism for regulation of temporal orde r of clamp loading in complex, in which binding precedes DNA binding. Stephen also studied the pre steady state

PAGE 35

35 kinetics of clamp release by complex using a Fluoresecence resonance energy transfer (FRET) based assay (65) His results showed that complex releases the clamp prior to DNA and that DNA release may be coupled to clamp closing around the DNA. Followed up on these studies, Jennifer Thompson developed a N (1 pyrenyl)maleimide ( py rene) based binding assay. She also measured the kinetics of clamp and DNA binding by complex and showed that the ATP induced conformational changes involved in binding are different than those for DNA binding (6 6) Moving 488) based PCNA opening assay and measured the PCNA binding and opening by RFC (67) Her studies showed that RFC binds and opens PCNA rather than capturing and stabilizing open PCNA molecules in solution. Christopher Paschall developed an AF 488 based opening assay and measured opening by complex (44) His results showed a similar mechanism for complex, where the complex binds and opens rather than capturing and stabilizing open molecules in solution. And recently, Melissa Marzahn developed a N (2 (1 maleimidyl) ethyl) 7 (diethylamino) coumarin 3 carboxamide (MDCC) based P CNA binding assay (unpublished) and studied the effect of Walker A mutations on clamp loading activities of RFC (unpublished). Based on all these previous studies, our study aims to investigate the mechanism of clamp loading reaction in further detail.

PAGE 36

36 Mut ational Studies with AAA+ Proteins Given the important role the AAA+ proteins play in various cellular functions, they have been studied extensively. There are several studies in which the conserved residues were mutated and the effects were correlated wit h the function of the particular residue. For example, Glu but not nucleotide binding (reviewed in (8) ). Given this known function, mutations in the WB motif are often made, and resulting defects in AAA+ activities are assumed to be the result of deficiencies in NTPase activity only (10, 13, 68, 69) In a previous study with an archaeal clamp loader (12) WB mutation s were made in individual subunits, creating single mutants. Assuming that the mutation affects ATP hydrolysis only, individual steps of the clamp loading reaction were linked to ATP hydrolysis function by each RFC subunit. Acc ording to our hypothesis, the mutations may have affected conformational changes in addition to ATP hydrolysis leading to the observed effects on clamp loading. Our study aims to determine if there are other roles associated with the conserved residues in addition to the specific roles that have already been assigned to them. The strength of our study is that we can study each step of the camp loading reaction individually using different fluorescence based assays. Therefore, instead of studying the end pr oduct of the reaction such as the clamp loaded onto the DNA, we are able to determine exactly which step is affected by the particular mutation.

PAGE 37

37 CHAPTER 3 MATERIALS AND METHOD S Reagents and Oligonucleotides Reagents ATP was from Sigma Aldrich Co. (St. Lou O (3 thiotriphosphate) (ATP S) was from Roche Molecular Biochemicals. For RFC and complex experiments, ATP and ATP S solutions were prepared in 30 mM HEPES NaOH, pH 7.5 and 20 mM Tris HCl, pH 7.5 respectively. Buffers used for p rotein storage and enzyme assays are listed in Tables 3 1 and 3 2. For protein dilution, the repective storage buffers were used. Table 3 1. Buffers used in RFC experiments. RFC storage buffer PCNA storage buffer Assay buffer 30 mM HEPES NaOH, pH 7.5 30 mM HEPES NaOH, pH 7.5 30 mM HEPES NaOH, pH 7.5 300 mM NaCl 150 mM NaCl 150 mM NaCl 0.5 mM EDTA 0.5 mM EDTA 0.5 mM EDTA 2 mM DTT 2 mM DTT 2 mM DTT 10% glycerol 10% glycerol 2% glycerol 10 mM MgCl 2 Table 3 2. Buffers used in complex experiments complex storage buffer storage buffer Assay buffer 20 mm Tris HCl, pH 7.5 20 mm Tris HCl, pH 7.5 20 mm Tris HCl, pH 7.5 50 mM NaCl 50 mM NaCl 0.5 mM EDTA 0.5 mM EDTA 2 mM DTT 2 mM DTT 10% glycerol 10% glycerol 4% glycerol 8 mM MgCl 2 Olig onucleotide Substrates All the oligonucleotide substrates used in this study were purified and labeled by another member of the Bloom laboratory. Briefly, A 60 mer template TTC AGG TCA GAA GGG TTC TAT CTC TGT TGG CCA GAA TGT CCC TTT TAT TAC TGG TCG

PAGE 38

38 TGT and a 26 mer primer ACA CGA CCA GTA ATA AAA GGG ACA TT were end of the 60 mer. This amino linker was covalently labeled by X rhodamine isot hiocyanate (RhX) (Molecular Probes Inc., Eugene, OR) as described (55) For DNA 7 diethylaminocoumarin 3 carboxylic acid, succinimidyl ester (DCC) binding experiments, the template was labele d with DCC, end as described (40) .The primer was annealed to the template by incubating equal moles of both in a water bath at 80C and allowed to slowly cool to room temperature. Proteins Replication Factor C (RFC) Expression vectors In all R FC1 constructs, the first 283 residues were deleted and replaced with a ( His ) 10 tag and kinase motif (70) Some RFC constructs were obtained from M. TS). Expression vectors used to produce wild type and mutant RFC complexes in E. coli are listed in Table 3 3. Table 3 3. Expression vectors used for making RFC complex. RFC Complex Expression Vectors Coding Sequences References Wild type RFC pLANT/RIL p ET RFC1 and RFC5 RFC2 RFC3 and RFC4 (70) (70) RFC WB EQ pLANT/RIL pET pCDFDuet RFC1 and RFC5 RFC3 and RFC4 RFC2 TS TS MOD (unpublished) RFC WB EA pLANT/RIL pET pCDFDuet RFC1 and RFC5 RFC3 and RFC4 RFC2 TS TS TS

PAGE 39

39 The procedure for making the expression vectors in this study is described in detail in Table 3 4. All the parent constructs used were obtained from MOD. S ite directed mutagenesis (SDM) was done using the QuikChange mutag enesis kit 5. Table 3 4. Method used for making RFC expression vectors. RFC Construct made Expression Vector Parent Constructs Used Method RFC1 (E425Q)+ RFC5 pLANT/RIL RFC1+5 and RFC1 (E425Q) Both RFC1+5 and RFC1 (E425Q) were digested with AatII and PciI A 145bp fragment containing E425Q from RFC1 (E425Q) was ligated to 7100bp fragment from RFC1+5 RFC3 (E118Q)+ RFC4 (E115Q) pET RFC3 (E118Q)+ 4 and RFC4 (E115Q) Both RFC3 (E118Q)+4 an d RFC4 (E115Q) were digested with AflII and SacI A 560bp fragment containing E115Q from RFC4 (E115Q) was ligated to 8100 bp fragment from RFC3 (E118Q)+ 4 RFC1 (E425A)+ RFC5 pLANT/RIL RFC1+5 and RFC1 First, SDM was performed on RFC1 to make RFC1 (E425A). Nex t, both RFC1+5 and RFC1 (E425A) were digested with AatII and PciI A 145bp fragment containing E425A from RFC1 (E425A) was ligated to 7100bp fragment from RFC1+5

PAGE 40

40 Table 3 4. Continued. RFC Construct made Expression Vector Parent Constructs Used Method RFC2 (E141A) pCDFDuet RFC2 SDM was performed on RFC2 to make RFC2 (E141A). RFC3 (E118A)+ RFC4 (E115A) pET Duet1 RFC3 +4 First, both RFC3 and RFC4 were PCR amplified and individually cloned into a cloning vector, Litmus38i. Next, SDM were done on them to make RFC 3 (E118A) and RFC4 (E115A). Finally, Both RFC3 (E118A) and RFC4 (E115A) were cloned in a pET Duet1 expression vector Primers Table 3 5. Sequence of the primers used. Procedure RFC coding sequence Primers used PCR RFC3 ctcctcaagcttcatATGTCGACAAGTACAGAG CT GTTAAAGCCAACGTATAAcctaggggatccctcata RFC4 ctcctcacATGTCCAAAACTTTATCTTTGC CATAAACTAAATAATAAAGCCTGActgcagatacta Sequencing RFC1 TACGCACCAACGAATCTACAAC GGTTCAAGGAACTTTACACTGAAT CAACGAGATCTCAAAGGCATGG GAAGACTGCCACCAGTAAACC RFC2 ACYCDuetUP1 primer (N ovagen) DuetDOWN1 Primer (Novagen) RFC3 DuetUP2 primer (Novagen) T7 terminator primer RFC4 pET Upstream primer (Novagen) DuetDOWN1 Primer (Novagen) RFC5 GGACTTTCAAGATTCTAAGGATGG

PAGE 41

41 Representative vector maps for the expression vectors used to ma ke RFC cmplexes are shown in Figure 3 1. Detailed vector maps of pCDFDuet RFC2 and pET Duet1 RFC3(E118A)+RFC4(E115A) are shown in Figure 3 2 and 3 3 respectively. The detailed vector maps were generated using PlasmaDNA software (71) and show the positio n of the RFC coding sequence in the respective Multiple Cloning Site (MCS) of the vectors. At this point complete sequence of the pET based and pLANT/RIL based expression vectors are not known, therefore their detailed maps could not be generated. Figure 3 1. Representative maps of the final expression vectors used. A) Expression vectors used to make wt RFC complex (figure adapted from (70) ), B) Expression vectors used to make RFC WB EQ complex and C) Expr ession vectors used to make RFC WB EA complex.

PAGE 42

42 Figure 3 2. Representative map of the pCDFDuet 1 RFC2 expression vector. This vector was used to make wt RFC complex. The RFC2 coding sequence was cloned in MCS1 using NcoI and BamHI restriction sites.To make WB EQ and WB EA RFC complexes, E141Q and E141A mutations were made in this vector respectively. Figure 3 3. Representative map of the pETDuet 1 RFC3(E118A)+RFC4(E115A) expression vector. This vector was used to make WB EA RFC compl ex. RFC3(E118A) was cloned in MCS2 using NdeI and AvrII sites, and RFC4(E115A) was cloned in MCS1 using NcoI and PstI restriction sites.

PAGE 43

43 Protein Overexpression and P urification RFC purification Buffer A contains 30 mM HEPES (pH 7.5), 10% (v/v) glycerol, 0. 5 mM EDTA, 1 mM DTT and 0.04% Bio Lyte 3/10 ampholyte (Bio Rad). RFC purification Buffer B contains 30 mM HEPES (pH 7.5), 500 mM NaCl and 30 mM imidazole. The expression and purification method was derived from the procedure described (17) All RFC complexes were purified as follows. T wo (for WT) or three (for mutant) plasmids were co transformed into E. coli strain BL21(DE3). Antibiotics used for selection were Ampicillin (100 g/ml), Kanamycin (50 g/ml) and Streptomycin (50 g/ml). Streptomycin was used only for mutants (three vector transformation). Starter culture s w ere prepared by inoculating 3 ml LB medium containing appropriate antibiotics with one freshly transformed colony and grow n at 30C for ~12 h. Next, 100 ml LB containing appropriate antibiotics was inoculated with 1 ml s tarter culture and grown at 30C. Upon reaching an Optical density ( OD ) of 0.6, the cells were pelleted by centrifugation at 6690 x g for 10 min. The cell pellet was resuspended in 4 ml LB and used to inoculate 2.4 L LB, split into four flasks, containing appropriate antibiotics. The culture s w ere grown again at 30C. Upon reaching an OD of 0.8, the cells were cooled down to 15C and IPTG was added to a final concentration of 1 mM, followed by 18 h incubation at 15C. Cells were harvested by centrifugation at 5000 x g for 30 min and stored at 80C. For purification, the pellet was resuspended in 30 ml Buffer A containing 1 M NaCl and lysed using a French press at 14,000 p.s.i. The lysate was clarified by centrifugation at 18,900 x g for 30 min and slowly di luted with Buffer A to a final NaCl concentration of 150 mM. The diluted supernatant was applied to two 5 ml Hi trap SP columns (GE healthcare) attached in tandem and equilibrated with buffer A containing 150 mM NaCl. The p rotein was eluted in a 100 ml gra dient of 150 600 mM

PAGE 44

44 NaCl. Two peaks were obtained. The first peak at ~350 mM NaCl contained RFC sub complexes, while a later peak at ~450 mM NaCl contained the five subunit RFC complex. The fractions containing five subunit RFC complex were pooled and dial yzed overnight against Buffer B. The dialyzed protein was applied to a 1 ml Hi trap chelating column (GE healthcare) charged with NiSO 4 and equilibrated with Buffer B. Protein was eluted using a 10 ml gradient of 30 500 mM imidazole. The protein eluted in a single peak at ~450 mM imidazole. The fractions were pooled; dialyzed against RFC storage buffer and stored at 80C. The protein yield was typically 10 mg from 2.4 liters of E. coli culture. Size exclusion C hromatography Size exclusion chromatography was performed on wt RFC and WB EQ RFC to confirm that the RFC complex purified was a complete five subunit complex. Superose 12 10/300 GL column (GE Healthcare) was used. The column was equilibrated with RFC storage buffer and a mixture of protein standard molecular weight markers (Bio Rad) was separated on the column to generate a standard curve ( Figure 3 4). Figure 3 4. Standard curve generated by separating protein standard molecular weight markers on Superose column.

PAGE 45

45 Briefly, the protein standar ds were resuspended in RFC storage buffer and centrifuged at 10,000 x g for 10 min prior to loading onto the column. An elution volume of 30 mL was collected in 0.5 mL fractions at a flow rate of 0.5 mL/min. The peak heights (monitored by absorbance at 280 nm) were determined and their retention time (elution volume) was plotted against the log 10 of the molecular weight of the standards. The points were fit to a line and this standard curve was used to determine the size of proteins eluting from the RFC sam ples. The column was equilibrated again with RFC storage buffer and the purified RFC complex was loaded and eluted. The elution method was same as for the standards, except that the fraction volume was reduced to 0.3 ml. Two peaks were obtained. A small pe ak (peak 1) eluted in the void volume and a later larger peak (peak 2) eluted in the fractions corresponding exactly to the molecular weight of the five subunit RFC complex (218 kDa). Proteins collected in both peaks were analyzed by SDS Polyacrylamide gel electrophoresis ( PAGE ) ( Figure 3 5). Figure 3 5. SDS PAGE analysis of fractions collected of RFC elution f ro m Superose column. Lane 1 contains the protein size marker. Lane 2 contains previously purified RFC (loaded as standard). Lane 3 contains th e peak obtained in the void volume (peak 1) and lane 4 contains the pooled fractions obtained in a later eluting peak (peak 2).

PAGE 46

46 The SDS PAGE analysis showed that both the peaks contained pure RFC protein. The reason for some of the RFC eluting in void vol ume is not clear, but may be due to protein aggregation. For the assays used in this study, the RFC collected in peak 2 was used. Protein obtained in peak 1 corresponded to about 5% of the total protein obtained, an inconsequential amount, therefore size e xclusion chromatography was not performed with other RFC protein preparations as a purification step. The RFC concentration was determined with the Bio Rad Bradford assay using bovine serum albumin as standard. For calculating the molar concentration of RF C, an extinction coefficient of 162,120 M 1 cm 1 was used. Other Proteins complex containing the Arg laboratory as described ( 72) All the other proteins were expressed, purified and labeled by other members of the Bloom laboratory. These proteins included wt complex, wt pyrene labeled and AF 488 labeled as described (44) and wt PCNA, MDCC labeled PCNA and AF 488 labeled PCNA as described (43) complex containing T157A mutation was prepared by C. Paschall (unpublished). Steady S tate Assays All steady state measurements were made on a Qu antaMaster QM1 spectrofluorometer (Photon Technology International) equipped with a 75W arc lamp and emission monochromators with red sensitive Hamamatsu R928 photomultiplier tubes. All the assays were performed at room temperature using a quartz cuvette w ith a 3 x 3 mm light path (Hellma 105.251 QS). In all the equilibrium assays, the reagents were added in the cuvette, followed by mixing with a pipetman (approximately 30 s) and

PAGE 47

47 the data was recorded immediately after the mixing. Three independent experime nts were done for each assay (unless noted otherwise). The data obtained and standard deviations were graphed and fit using Kaleidagraph (43) The average value and standard deviation for three independen t calculations are reported. ATP Binding Assay To measure ATP binding, a fluorescent analogue of ATP, O (2,4,6 TrinitroPhenyl) (TNP) ATP was used. In TNP ATP, the fluorophore TNP is covalently attached to the ribose moiety and undergoes change in fl uorescence when ATP binds to another molecule (73) TNP ATP is hydrolyzable (74) In our assays, it was excited at 403 nm and emission spectra were measured over a wavelength range of 510 560 nm using a 8 nm bandpass. Representative emi ssion spectra are shown in Figure 3 6. Figure 3 6. Representative emission spectra showing ATP binding assay. The emission spectra recorded for 1 M TNP ATP before adding RFC (free) and after adding 3 M wt RFC (bound) are shown as blue and o range traces respectively. The spectra wer e corrected for both buffer background and dilution effect.

PAGE 48

48 To generate each point, emission spectra were recorded after reagents were sequentially added to the cuvette. First, assay buffer was measured for a back ground signal, then 1 M TNP ATP for unbound ATP, and then RFC, from 0 to 3 M (wt RFC) or from 0 to 1 M (mutant RFC) was added to measure the signal for bound ATP. Storage buffer was added instead of RFC to generate the 0 nM RFC point. After correcting f or buffer background the intensity of bound ATP was divided by the intensity for free ATP for each point. Each value at 545 nm was then divided by that obtained for 0 nM RFC, setting this point to 1, to account for the change in fluorescence due to dilutio n. All other points are relative to this value. The K d values for each were calculated using Equation 3 1, where ATP is the total concentration of ATP, RFC is the total concentration of RFC, I max is the maximum intensity, and I min is the minimum intensity: PCNA Binding Assay To measure PCNA binding, PCNA labeled with MDCC was used. The MDCC based PCNA binding assay was developed by Melissa Marzahn (unpublished). Briefly, Ser 43, which is located on the surfac e of PCNA to which RFC bin ds (24) was mutated to Cys making a triple Ser to Cys PCNA mutant. Cys 43 was covalently labeled with an environmentally sensitive fluo rophore, MDCC, to form PCNA MDCC. MDCC undergoes change in fluorescence intensity upon binding to RFC (43) MDCC labeled PCNA was excited at 420 nm and emission spectra were measured over a wavelength range of

PAGE 49

49 450 480 nm using a 3.5 nm bandpass. Representative emission spe ctra are shown in Figure 3 7. Figure 3 7. Representative emission spectra showing PCNA binding assay. The emission spectra recorded for 10 nM PCNA MDCC before adding RFC (free) and after adding 1 M wt RFC (bound) are shown as blue and orange traces res pectively. The spectra we re corrected for both buffer background and dilution effect. To generate each point, emission spectra were recorded after reagents were sequentially added to the cuvette. First, assay buffer with 500 M ATP was measured for a bac kground signal, then 10 nM PCNA MDCC for unbound PCNA, and then RFC, from 0 to 1 M was added to measure the signal for bound PCNA. Storage buffer was added instead of RFC to generate the 0 nM RFC point. After correcting for buffer background the intensity of bound PCNA was divided by the intensity for free PCNA for each point. Each value at 470 nm was then divided by that obtained for 0 nM RFC, setting this point to 1, to account for the change in fluorescence due to dilution. All other

PAGE 50

50 points are relative to this value. The K d values for each were calculated using Equation 3 2, where clamp is the total concentration of PCNA, clamp loader is the total concentration of RFC, I max is the maximum intensity, and I min is the minimum intensity: Binding Assay To measure binding, labeled with pyrene was used. Pyrene is also an environmentally sensitive fluorophore and undergoes change in fluorescence intensity upon binding to complex (66) Pyrene based binding assay was developed by Jennifer Thompson (66) Briefly, Gln 299, which is located on the surface of to which complex binds, was mutated to Cys making a double Gln to Cys mutant and Cys 299 was c ovalently labeled with pyrene. Pyrene labeled was excited at 345 nm and emission spectra were measured over a wavelength range of 355 435 nm using a 4 nm bandpass. Representative emission spectra are shown in Figure 3 8. To generate each point, emissio n spectra were recorded after reagents were sequentially added to the cuvette. First, assay buffer with 500 M ATP was measured for a background signal, then 10 nM pyrene for unbound and then complex, from 0 to 1 M was added to measure the signal f or bound Storage buffer was added instead of complex to generate the 0 nM complex point. After correcting for buffer background the intensity of bound was divided by the intensity for free for each point. Each value at 375 nm was then divided by that obtained for 0 nM complex, setting this point to 1, to account for the change in fluorescence due to dilution. All other points are relative to

PAGE 51

51 this value. The K d values for each were calculated using Equation 3 2, where clamp is the total concentr ation of clamp loader is the total concentration of complex, Imax is the maximum intensity, and Imin is the minimum intensity. Figure 3 8. Representative emission spectra showing binding assay. The emission spectra recorded for 10 nM pyrene before adding complex (free) and after adding 960 nM wt complex (bound) are shown as blue and orange traces respectively. The spectra we re corrected for both buffer background and dilution effect. PCNA Opening Assay To measure PCNA opening, PCNA label ed with AF488 was used. This assay was developed by Jennifer Thompson (67) in which three naturally occurring Cys residues on the surface of PCNA were converted to Ser to avoid any labeling at these sites. Two new Cys residues were introduced by mutating Ile 111 and Ile 181, which are located at the opening interface of PCNA. F inally, Cys 111 and Cys 181 were labeled with AF

PAGE 52

52 488. The AF 488 based opening assay takes advantage of the property that two fluorophores within close proximity will self quench. When RFC is added to AF488 labeled PCNA the fluorophores move away from ea ch other and the quenching is relieved (67) The assay was done similar to the PCNA binding assay except that AF488 labeled PCNA was excited at 495 nm and emission spectra were measured over a wavelength range of 505 545 nm using a 2.5 nm bandpass. The emission was recorded at 517 nm. K d values for each were calculated using Eq uation 3 2. Representative emission spectra are shown in Figure 3 9. Figure 3 9. Representative emission spectra showing PCNA opening assay. The emission spectra recorded for 10 nM PCNA AF488 before adding RFC (free) and after adding 1 M wt RFC (boun d) are shown as blue and orange traces respectively. The spectra we re corrected for both buffer background and dilution effect.

PAGE 53

53 Opening Assay Figure 3 10. Representative emission spectra showing opening assay. The emission spectra recorded for 10 nM AF488 before adding complex (free) and after adding 1 M wt complex (bound) are shown as blue and orange traces respectively. The spectra we re corrected for both buffer background and dilution effect. To measure opening, labeled with AF488 was used. This assay was developed by Christopher Paschall (44) and works on the same principle as the PC NA opening assay. Briefly, two surface Cys residues of were converted to Ser and two new Cys residues were introduced by mutating Arg 103 and Ile 305 to Cys. This allowed selective labeling of Cys 103 and Cys 305, which are located on the opening interfa ce of with AF 488. The assay was done similar to the binding assay except that AF488 labeled was excited at 495 nm and emission spectra were measured over a wavelength range of 505 545 nm using 2.5 nm bandpass. The emission was

PAGE 54

54 recorded at 517 nm. K d values for each were calculated using Equation 3 2. Representative emission spectra are shown in Figure 3 10. DNA Binding Assay DNA DCC Based Assay Figure 3 11. Representative emission spectra showing DNA DCC based binding assay. The emission spec tra recorded for 20 nM DNA DCC before adding RFC (free), after adding 1 M wt RFC (bound), and finally after adding 2 M PCNA are shown as blue, orange and green traces respectively. The spectra we re corrected for both buffer background and dilution effect To measure DNA binding, DNA was labeled with DCC. In this assay, DCC is binding of the clamp loader reports on the binding at p/t junction (40) The assay was done similar to the PCNA binding assay excep t that DNA DCC was excited at 440 nm and emission spectra were measured over a wavelength range of 460 510 nm using a 5 nm bandpass. Representative emission spectra are shown in Figure 3 11. First, assay

PAGE 55

55 buffer with 500 M ATP S was measured for a backgr ound signal, then 20 nM DNA DCC for unbound DNA, and then RFC, from 0 to 1 M was added to measure the signal for bound DNA. Finally, 2 M PCNA was added to the cuvette to measure the signal for bound DNA in presence of PCNA. Emission was recorded at 475 n m. K d values for each were calculated using Equation 3 2, except that clamp value was substituted by DNA value. DNA Rh X Based Assay For measuring DNA binding, an anisotropy based assay was also used. Primed template DNA was covalently labeled with X rhoda template end. The anisotropy of RhX increases when clamp loader binds p/t DNA RhX (55) Steady state anisotropy measurements were made with polarizers (Glan Thompson). S amples were excited at 585 nm with vertically and horizontally polarized light using a 8 nm bandpass and both horizontal and vertical emissions were monitored at 605 nm for 30 s and the average value was calculated. Representative spectra are shown in Figu re 3 12. Anisotropy values were calculated using a G factor, to account for polarization bias Equation 3 3, determined under the same experimental conditions: To generate each point, polarized emissions were recorded after reagents w ere sequentially added to the cuvette. First, assay buffer with 500 M ATP S was added for background signal, then 20 nM DNA RhX for the free DNA signal, then RFC from 0 to 1 M for the bound DNA, and then 2 M PCNA for the bound DNA signal in presence of PCNA were added. Anisotropy values were calculated using Equation 3 4, where I VV

PAGE 56

56 and I VH are vertical and horizontal intensities, respectively, when excited with vertically polarized light: K d values for each were calculated using Eq uation 3 2, except that clamp value was substituted by DNA value. For complex DNA RhX binding assay, similar experiments were done except that 25 nM DNA RhX was used. For the bound DNA signal, 0 to 1 M complex was added and for bound DNA in presence o f 4 M was added. Figure 3 12. Representative emission spectra showing DNA RhX based binding assay. For simplicity, only the spectra recorded after exciting the samples with vertically polarized light are shown. The horizontal and vertical emissi on spectra recorded for 20 nM DNA RhX before adding RFC (free) are shown as dark blue solid and light blue dotted traces respectively. The horizontal and vertical emission spectra recorded after adding 1 M RFC (free) are shown as dark orange solid and li ght orange dotted traces respectively. Finally, the horizontal and vertical emission spectra recorded after adding 2 M PCNA are shown dark green solid and light green dotted traces respectively. The spectra we re corrected for buffer background.

PAGE 57

57 ATP Hydro lysis Assay ATPase activity was measured using an enzyme coupled reaction in which the production of ADP is coupled to the depletion of NADH by p yruvate kinase (PK) and lactate dehydrogenase (LDH) (75, 76) The rate of NADH depletion was monitored by fluorescence spectrometry NADH was excited at 340 nm and emission was measured at 460 nm using a 2 nm bandpass. A representative spectrum is shown in Figure 3 13. Figure 3 13. Representative emission spectrum showing ATP hydrolysis assay. The emission spectrum was recorded for the sample containing 1 M DNA and all other reagents at specified concentratio ns except RFC for 100 s (not shown) followed by addition of wt RFC at 100 s and recording the spectrum for another 500 s (orange trace). The slope represents [ADP]/time. The ATPase activity was measured by continuously monitoring the oxidation of NADH to NAD + To the assay buffer, 1 mM phosphoenolpyruvate, 0.2 mg/mL NADH, 68 units/mL PK 99 units/mL LDH 0.5 mM ATP and varying concentrations of p/t DNA were added and mixed. For measuring the ATPase activ ity in presence of 1 M

PAGE 58

58 RFC or 0. 2 5 M complex. The reaction velocity was linearly fit to the slope of data recorded over a time period of 100 600 s. Storage buffe r was added instead of RFC or complex to obtain the dilution effect on NADH fluorescence. To calculate the concentration of ATP hydrolyzed/s, a standard curve was generated by adding all the above reagents except ATP, DNA and RFC or complex. Known quan tities (0 200 M) of ADP were added and the change in NADH fluorescence was measured (Figure 3 14). The ADP data was fit to a linear curve and the slope obtained was used to convert the slopes obtained from the ATPase data to nM ATP hydrolyzed/s. Figur e 3 14. A representative standard curve used in ATP hydrolysis assay. The curve was generated by adding known quantities of ADP to the sample containing all the reagents for coupled ATP hydrolysis assay except RFC, ATP and DNA. The slope represents fluores cence intensity/[ADP].

PAGE 59

59 Pre S teady State PCNA Opening Assay Stopped flow fluorescence measurements were made using a SX20MV stopped flow fluorometer (Applied Photophysic, Ltd.). Single mix experiments were performed mixing equal volumes of a solution of PC NA AF488 and ATP to a solution of RFC and ATP. The reaction was excited at 495 nm using a 3.7 nm bandpass and emission was measured using a 515 nm cut on filter. Measurements were collected for 5 s, and three or more individual kinetic traces were averaged Time courses were corrected for background by subtracting the signal for buffer. Three independent experiments were done and one is shown. The time courses were empirically fit using KaleidaGraph software to a single exponential Equation 3 5, in which a is the amplitude, k obs is the observed rate constant, and t is the reaction time. Assays Containing ATP S All the experiments with ATP S were done in a similar way to the experiments done with ATP except that, 0.5 M ATP was replaced with 0.5 M ATP S.

PAGE 60

60 CHAPTER 4 NOVEL FUNCTIONS FOR RESIDUE IN THE WB MO TIF OF RFC Background Information The S. cerevisiae clamp loader, RFC is a pentameric protein complex and a member of the AAA+ protein family. Like other AAA+ prote ins, RFC contains conserved residues in AAA+ motifs that interact with ATP, such as WA, WB, Sensor 1, Sensor 2 and Arg finger motifs. Studies with various P loop type NTPase s have shown that mutation of the but has no effect on ATP binding (8, 11 13) This study aims to determine if the RFC WB motif is involved in functions in addition to ATP hydrolysis. All five subunits of RFC, named Rfc1 to 5 likely bind ATP but only four can hydrolyze ATP. Rfc5 has a non does not have a contribution from the Arg finger motif and therefore does not hydrolyze ATP ( Figure 4 1). Figure 4 1. Sequence of the WB motif in each of th e RFC subunits. The sites sharing identical residues are shaded black and those sharing similar residues are shaded gray. Note that the WB motif in Rfc5 differs from the consensus sequence. RFC loads the S. cerevisiae sliding clamp, PCNA onto p/t junction s during replication. The clamp loading reaction involves binding PCNA, opening the PCNA ring

PAGE 61

61 binding DNA, closing the PCNA ring around the DNA and finally releasing the the presence of ATP and none of these steps require ATP hydrolysis (34) It is believed that each interaction RFC makes with ATP or other ligands such as PCNA or DNA leads to conformational changes within its pentameric assembly facilitating the next step of the clamp loading reaction (34, 35) We have made mut ations in the WB motif of subunits, Rfc1 to 4, creating two types of RFC mutants referred to as WB EQ and WB EA respectively. We have used fluorescence based assay s to stu dy each step of the clamp loading reaction. Our data shows that WB mutations affect ligand dependent conformational changes. Results Equilibrium PCNA Binding WB mutations in AAA+ proteins are known to affect ATP hydrolysis, but show no effect on ATP bindin g (8, 11 13) A s a result the activities related to ATP binding should only be affected if WB motif is involved in making conformational changes To test this hypothesis, we measured PCNA binding to RFC to determine if WB mutations have any effect on binding A fluorescence intensity based binding assay (43) was used to measure equilibrium binding of PCNA to RFC. Briefly, PCNA was labeled with an environmentally sen sitive fluorophore MDCC and the fluorescence of 10 nM MDCC labeled PCNA (PCNA MDCC) was measured in the presence of 0.5 mM ATP and increasing concentration s of RFC. Binding of RFC to PCNA MDCC increased the fluorescence of MDCC in a concentration dependen t manner as expected for an equilibrium binding reaction. The fold change in fluorescence intensity was plotted

PAGE 62

62 against RFC concentration and the data was fit to a quadratic equation (Equation 3 2) to obtain the equilibrium dissociation constant, K d ( Figur e 4 2). Figure 4 2. Effect of WB Glu mutations on PCNA binding. Binding of wt RFC (blue), WB EQ (green) and WB EA mutants (red) to PCNA MDCC was measured in the presence of ATP. The relative intensity of MDCC at 470 nm is plotted as a fun ction of RFC concentration for solutions containing 10 nM PCNA MDCC and 0.5 mM ATP. Data shown are the average of three independent experiments. Error bars represent standard deviation. A K d of 7.1 2 nM was calculated for the wt RFC binding to PCNA, whic h is in agreement within an order of magnitude with the K d value of 1.3 nM reported using Surface plasmon resonance (SPR) (51) Both of the WB mutants in RFC also exhibited similar binding to PCNA with K d values of 24.9 1.1 nM (WB EQ) and 27 12 nM (WB

PAGE 63

63 EA). These data show that WB mutations result in a ~4 fold de crease in the affinity of RFC for PCNA. More interestingly, the K d values for the mutants are similar to the K d obtained for wt RFC in absence of ATP, which is 28 8 nM (67) suggesting a defect in mutants in responding to ATP. PCNA Ring Opening As with PCNA binding, PCNA opening is also stimulated in the presence of ATP, but d oes not need ATP hydrolysis. To determine if the WB mutations affect PCNA opening also, the opening was measured by using a different fluorescence based assay (67) Briefly, the opening interface of PCNA was labeled with a self quenching fluorophore, AF488. Opening of the PCNA at the interface results in the fluorophores moving away from each other and relief of quench ing Equilibrium PCNA Opening in the Presence of 0.5 mM ATP The fluorescence of 10 nM AF488 labeled PCNA (PCNA AF488) was measured in presence of 0.5 mM ATP and increasing concentration of RFC. The fold change in f luorescence intensity was plotted against RFC concentration ( Figure 4 3). Two important types of information can be obtained from this assay. The relative values of AF488 intensity reflect the fraction of PCNA molecules in an open conformation, and the K d value calculated from the opening data is a measure of the binding affinity of RFC to the AF488 labeled PCNA. The fluorescence intensity of PCNA AF488 increased by a factor of about 2 at saturating concentrations of wt RFC. Surprisingly, the WB mutants ga ve only about a 1.2 fold increase in AF488 fluorescence. These data indicate that at equilibrium is formed with either of the WB mutant RFC complexes.

PAGE 64

6 4 Figure 4 3. Effect of WB Glu mutations on PCNA opening with 0.5 mM ATP. Binding of wt RFC (blue), WB EQ (green) and WB EA mutants (red) to PCNA AF488 was measured in the presence of ATP. The relative intensity of MDCC at 517 nm is plotted as a function of RFC concentration for solutio ns containing 10 nM PCNA AF488 and 0.5 mM ATP. Data shown are the average of three independent experiments. Error bars represent standard deviation. A K d of 10.8 4 nM was calculated for wt RFC in presence of ATP. The K d values calculated for the mutants were 39.6 27.3 nM (WB EQ) and 40 13 nM (WB EA). The K d values obtained for the mutants are about 4 fold greater than the K d value for wt RFC, but for both the wt and the mutants, they are similar to the values obtained by the PCNA binding assay ( Figure 4 2). The reason for the mutants show ing a higher K d may be that there is a large error in the ir calculated K d values due to the relatively small change in fluorescence. Therefore, these data indicate that RFC WB mutants have a

PAGE 65

65 lower affinity for PCNA tha n does wt RFC. The PCNA binding assay ( Figure 4 2) also indicated a lower affinity of the WB mutants for PCNA. Equilibrium PCNA Opening in the Presence o f Excess ATP The RFC WB mutants showed weaker opening of the PCNA ring ( Figure 4 3), and one possible explanation for this would be that the mutants bind ATP with decreased affinity As a result, they cannot open PCNA well. If this is true, then adding more ATP should stimulate PCNA opening by the mutants. To determine if that is true, the equilibrium PCN A opening assay was performed in a different manner. The opening of 10 nM PCNA AF488 by 250 nM RFC was measured in the presence of increasing concentration s of ATP. The fold change in emission intensity was plotted against ATP concentration ( Figure 4 4). Figure 4 4. Effect of RFC WB Glu mutations on PCNA opening with excess ATP. Binding of wt RFC (blue), the WB EQ mutant (green) and the WB EA mutant (red) to PCNA AF488 was measured in the presence of ATP at the concentrations indicated. The relati ve intensity of AF488 at 517 nm is plotted as a function of ATP concentration for solutions containing 10 nM PCNA AF488 and 250 nM each RFC. Data shown are the average of three independent experiments (wt and WB EQ mutant) and two independent experiments ( WB EA mutant). Error bars represent standard deviation.

PAGE 66

66 The mutants did not show any further opening at higher ATP concentrations. At all ATP concentrations measured the mutants showed ~1.2 fold change in the AF488 fluorescence, compared to ~2 fold change observed for the wt RFC. This suggests that, the poor PCNA opening is not because of a defect in ATP binding. Another interesting observation was that the same fraction of PCNA molecules are open for the mutants in the presence of ATP as for wt RFC in the absence of ATP (0 mM ATP). This suggests that with respect to the PCNA opening activity the WB mutants do not respond to ATP. Pre steady State PCNA Opening The RFC WB mutants showed weak opening of the PCNA ring ( Figure 4 3 and 4 4). To study the rate at which these mutants open the PCNA ring pre steady state opening was measured. RFC (final concentration 200 nM) and PCNA AF488 (final concentration 20 nM) w ere mixed rapidly using stopped flow in the presence of 0.5 mM ATP and the reaction was monitored i n real time. An apparent opening rate of 2.7 0.7 s 1 43.1 9.7 s 1 and 46.6 15 s 1 was calculated for the wt, WB EQ and WB EA RFC respectively ( Figure 4 5). The rate obtained for the wt is in agreement with the rate of 2.23 0.02 s 1 reported usin g a FRET based assay (77) It is important to note here that the rates obtained are apparent rates ( k obs ) of opening, in other words a combination of k on (rate of opening PCNA) and k off (rate of closing PCNA). Large k obs values may be observed due to a large k on or a large k off Therefore, a higher apparent rate for the WB mutants does not necessarily mean that they open PCNA faster; rather it indicates that they approach the PCNA equilibrium faster than wt RFC. The fluorescence intensity levels at reaction end points were the same as observed in steady state assays ( Figure 4 3).

PAGE 67

67 Figure 4 5. Effect of RFC WB Glu mutations on rate of PCNA ring opening. Stopped flow fluorescence measurements w ere made in which a solution of RFC and ATP was added to a solution of PCNA and ATP. Final concentrations after mixing were 20 nM PCNA AF488, 200 nM RFC and 0.5 mM ATP. Three independent experiments were done for wt RFC (blue trace), the WB EQ mutant (gree n trace), the WB EA mutant (red trace). Representative time courses are shown. The data for individual time courses fit to a single exponential rise (black traces), and the average values of the observed rate constants are given in the text. Taken together the PCNA opening data ( Figure 4 3, 4 4 and 4 5) suggest that the RFC WB mutations exert a large effect on PCNA opening.

PAGE 68

68 Equilibrium DNA Binding DNA binding by RFC requires ATP binding, but not hydrolysis (61) Therefore, we would not expect the WB muta tions to affect DNA binding. However, given that the WB Glu mutations affect other ATP dependent interactions, the effects of these mutations on DNA binding w ere measured. DNA binding is stimulated in the presence of PCNA (34, 72) therefore the effect of PCNA on DNA binding was also measured. In all the DNA binding assays, ATP S was used instead of ATP because p/t DNA triggers ATP hydrolysis, which leads to the release of PCNA and DNA. Thus, DNA binding can not be measured under equilibrium conditions in assays with ATP. DNA DCC Based Assay A 26/60 mer p/t DNA labeled with DCC was used (40) In this assay, the fluorophore, DCC is located at 3 nt away from the p/t junction and any change in the DCC fluorescence upon binding of the clamp load er reports on the binding at the p/t junction. To the cuvette, 0.5 mM ATP S, 20 nM DNA DCC, 0 1 M RFC and 2 M PCNA were added sequentially and the change in fluorescence intensity was recorded ( Figure 4 6). DNA binding was measured for wt RFC and the dat a collected in the absence and presence of PCNA w ere plotted separately. The K d values calculated were 33 nM and 16 nM in the absence and presence of PCNA respectively. The experiment was performed only once. Although, the DCC fluorescence changed with RF C in a concentration dependent manner and followed a binding curve, the end points with and without PCNA were very different. This may be due to the fact that DCC interacts differently with RFC with and without PCNA. If that is the case, then this assay ca nnot

PAGE 69

69 be used to compare DNA binding with and without PCNA. Therefore, another assay based on fluorescence anisotropy was used to measure the equilibrium DNA binding. Figure 4 6. DCC based equilibrium DNA binding. Binding of wt RFC to DNA wa s measured in the absence (blue) and presence (black) of PCNA. The relative intensity of DCC at 475 nm is plotted as a function of RFC concentration for solutions containing 20 nM DNA DCC, 0.5 mM ATP S and 2 M PCNA. Data shown represent single experiment. DNA Rh X Based Assay An assay based on anisotropy was used to measure the DNA binding of RFC. A 26/60 mer p/t DNA labeled with RhX was used (55) In this assay, the fluorophore, RhX is locat RFC

PAGE 70

70 binds the p/t DNA RhX. The DCC assay depends on the protein changing the environment of the fluorophore, and it i s possible that RFC binds differently than RFC PCNA. The RhX assay de pends on rotational motion of the fluorophore, so it is not likely dependent on the conformation of RFC vs large protein complexes Therefore, this assay was used to measure the effect of RFC WB mutation on DNA binding both in the absence and presence of PCNA ( Figure 4 7). Fig ure 4 7. Effect of RFC WB Glu mutations on DNA binding in the absence of PCNA. Binding of wt RFC (blue), WB EQ (green) and WB EA mutants (red) to DNA RhX was measured in the presence of AT P S. The anisotropy value of RhX at 605 nm is plotted as a function of RFC concentration for solutions containing 20 nM DNA RhX and 0.5 mM ATP S. Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 71

71 To the c uvette, 0.5 mM ATP S, 20 nM DNA RhX, 0 1 M RFC and 2 M PCNA were added sequentially and the polarized intensities were recorded. From these measurements, the anisotropies were calculated. The data collected for the absence and presence of PCNA are plotte d on separate graphs. Figure 4 8. Effect of RFC WB Glu mutations on DNA binding in the presence of PCNA. Binding of wt RFC (blue), WB EQ (green) and WB EA mutants (red) to DNA RhX was measured in the presence of ATP S and PCNA. The anisotr opy value of RhX at 605 nm is plotted as a function of RFC concentration for solutions containing 20 nM DNA RhX, 0.5 mM ATP S and 2 M PCNA. Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 72

72 Figure 4 7 an d 4 8 represent DNA binding in the absence and presence of PCNA respectively. The K d values calculated from DNA binding data in the absence of PCNA were 91 28 nM (wt RFC), 692 399 nM (WB EQ) and 1058 197 nM (WB EA). The WB mutants clearly show reduc ed binding to the p/t DNA. The K d values calculated from DNA binding data in the presence of PCNA were 37 13 nM (WT), 460 200 nM (WB EQ) and 1820 720 nM (WB EA). The K d obtained for wt RFC are slightly higher than 15 nM (without PCNA) and 5 nM (with PCNA) K d values reported using SPR assays (51) The differenc e may be due to different types of assays used in the two studies. Our data suggest that PCNA stimulates DNA binding by the wt RFC slightly, but in the case of WB mutants there is very little or no stimulation. These data support our PCNA opening results that, because the WB mutants are less efficient PCNA openers, the PCNA stimulation of DNA binding is also hampered. DNA binding experiments were performed in the presence of ATP S, which does not support PCNA opening to the full extent (discussed in C hapt er 7). Therefore, it is possible that the PCNA stimulation of DNA binding is greater for wt RFC, WB mutants or both. With that caveat, our DNA binding data indicates that WB mutations not only affect PCNA opening but also the downstream steps in the clamp loading reaction Equilibrium ATP Binding WB mutations do not affect ATP binding (8, 11 13) but given that all the clamp loading steps coupled with ATP binding are affected, ATP binding was also measured. For this a ssay, ATP labeled with a fluorophore TNP was used. Briefly, the fluorescence of 1 M TNP ATP was measured with increasing concentration of RFC. Binding of RFC

PAGE 73

73 to TNP ATP increased the fluorescence of TNP in a concentration dependent manner as expected for an equilibrium binding reaction ( Figure 4 9). Figure 4 9. Effect of RFC WB EQ Glu mutations on ATP binding. Binding of wt RFC (blue), and WB EQ (green) to TNP ATP was measured. The relative change in intensity of TNP at 545 nm is plotted as a function of RFC concentration for solutions containing 1 M TNP ATP. Data shown represent single experiment. The fold change in fluorescence intensity was plotted against RFC concentration and the K d was calculated. It is not known whether RFC binds f our or five ATP molecules, or whether the binding is co operative or non cooperative. Therefore, for simplicity, in the K d calculation, only one ATP binding site per RFC molecule was assumed. The K d values obtained were 48 nM and 15 nM for the wt and WB EQ RFC respectively. The assay required a very high concentration (more than 2 M) of protein,

PAGE 74

74 which was not attained in our protein preparations, and thus could not be repeated or performed with the WB EA mutant. With that caveat our data from a single ex periment with wt and WB EQ RFC suggest that, the WB mutation has little or no effect on ATP binding ATP Hydrolysis The WB Glu residue is believed to activate a water molecule for ATP hydrolysis; therefore, WB mutations are expected to result in weaker ATP hydrolysis. Steady state ATP hydrolysis was measured using PK / LDH coupled oxidation of NADH (75, 76) In this assay, one molecule of ADP formation corresponds to one molecule of NAD+ generated. We measured the conversion of NADH to NAD+ by following the decrease in fluorescence at 460 nm. A standard cu rve was generated by adding known amounts of ADP to the coupled enzyme system, and this curve was used to convert rates of ATP hydrolysis in fluorescence units per time to concentration units per time ( Figure 4 10). ATP hydrolysis was measured at 450 nM RF C and different concentrations of DNA. The assay contained 0.5 mM ATP, which is about 50 fold higher than the K m reported for wt RFC (78) The steady state hydrolysis rates obtained from ATPase data in the absence of DNA were 17.4 0.4 (wt), 15.3 2.1 (W B EQ) and 9.3 3.9 (WB EA) nMs 1 Hence, the basal rate of ATP hydrolysis does not appear to be affected by the mutations. On the other hand, the effect of the WB mutations on DNA stimulated ATPase activity was large. In assays with 2 M DNA, ATP hydrolys is rates were 125 20 (WT), 16 1 (WB EQ) and 11 1 (WB EA) nMs 1 While adding DNA exhibits a profound and concentration dependent stimulation of wt RFC ATPase activity, it does not stimulate that of the mutant complexes Based on fractions of RFC boun d at 2 M DNA calculated

PAGE 75

75 from K d data ( Figure 4 7), at 450 nM RFC and 2 M DNA, about 95% WT RFC should be bound to DNA and about 75% of the mutant complexes should be bound to DNA. Therefore, although the mutants showed weaker DNA binding, this cannot acc ount for the lack of DNA dependent stimulation of ATPase activity. Figure 4 10. Effect of RFC WB Glu mutations on rate of ATP hydrolysis. Rates of ATP hydrolysis were measured for wt RFC (blue), WB EQ mutant (green) and the WB EA mutant (red) i n the presence of 0.5 mM ATP and varying concentration of p/t DNA. The concentration of ATP hydrolyzed per second is plotted at several DNA concentrations for solutions containing 450 nM each RFC. Data shown are the average of three independent experiments Error bars represent standard deviation.

PAGE 76

76 Figure 4 11. Effect of RFC WB Glu mutations on rate of ATP hydrolysis. The data shown in Fig ure 4 10 are plotted here as a linear plot. The data shows increase in the rate of ATP hydrolysis as a func tion of DNA concentration in the case of wt RFC. The ATPase data obtained w ere also plotted in a linear plot on a separate graph ( Figure 4 11). This graph shows that the ATPase activity reaches saturation for wt RFC at the highest DNA concentration measure d. A K d value of 274 303 nM was calculated for the wt RFC binding DNA from the data shown in Figure 4 11. The large standard deviation value may be a result of measuring DNA binding indirectly from ATP hydrolysis rates in this assay This K d value is sim ilar to 91 20 nM obtained from the DNA binding data ( Figure 4 7), the slight difference may be a result of different assays

PAGE 77

77 used. Taken together, our data suggest that the RFC WB mutations affect DNA mediated stimulation of ATPase activity. Conclusions Our data shows that the RFC clamp loading steps, such as PCNA binding ( Figure 4 2), PCNA opening ( Figure 4 3 and 4 5) and DNA binding ( Figure 4 7), which involve ATP binding but not hydrolysis, are affected by the WB mutations. More importantly the vario us ligand mediated changes such as ATP stimulated PCNA ring opening ( Figure 4 4), PCNA stimulated DNA binding ( Figure 4 8) and DNA stimulated ATP hydrolysis ( Figure 4 10) have a large effect because of the WB mutations. The mutants appear to not respond t o respective ligands in the assays. Taken together, our data suggest a role of the WB motif in promoting ligand induced conformational changes. interacting with the ATP molecule via a br idging water molecule. This interaction possibly keeps other residues in optimal conformation to bind PCNA and DNA. As a result, a mutation in the Glu residue leads to weaker interaction with PCNA and DNA, as well as reduced ATP hydrolysis. In addition, th e two mutations in WB motif, WB EQ and WB EA show the same effect in all the activities measured, as reflected in their similar K d and rate of pre steady state reactions and ATP hydrolysis. This means that the WB Glu residue is essential in making the rig ht conformational changes and cannot function when changed to either Gln or Ala

PAGE 78

78 CHAPTER 5 COMPLEX ARG FINGER M UTANTS ARE DEFECTIVE IN CLAMP OPENING Background Information In the AAA + family members including the complex, subunits are arranged such t hat each of the ATP binding sites is located at a subunit subunit interface Furhermore, a conserved Arg residue or Arg finger from one subunit interacts with the ATP bound to the neighboring subunit (reviewed in (19) ). The Arg finger plays an important role in sensing the bound ATP and promoting DNA binding (16) Arg finger mutants have been shown to bind ATP well (72) but have impaired ATP hydrolysis (18, 72) The complex has three ATP binding sites, one in each subunit. subunits exte nd their Arg finger towards the ATP binding site of the adjacent subunit ( Figure 5 1) (16) Due to this structural arrangement, ATP bound with the first subunit, 1 interacts with the Arg finger of 2 interacts with the Arg finger of 1 subunit and that of 3 interacts with the Arg finger of 2 subunit. The 3 subunit also extends an Arg finger towards the subunit which does not bind ATP. We have mutated the Arg residue of the Arg finger motif to Ala Due to the asymmetry in interaction of Arg fingers with ATP, two types of mutants can be made. One containing the mutation in the ( 1 interface and another containing mutation in the subunits ( R169A), which affects both 1 2 and 2 3 interfaces. Previous studies have shown that these two classes of mutations have different effects on the interactions of the complex with and DNA. The ATP dependent int eraction with the clamp was reduced for R169A mutant s showed a reduction in DNA binding activity (16) However, the DNA bind ing assays were done using single

PAGE 79

79 stranded DNA. We have studied the effect of the Arg finger mutations on binding and opening, using fluorescence based assays. Our data show that the mutants do not open well. Figure 5 1. Schematic diagram of the arra ngement of ATP binding sites within the 3 complex. Each subunit possesses an ATP binding site that is located at the interface with an adjacent subunit. The subunit and each subunit contain a conserved SRH sequence motif, and the Arg finger pres ent in this motif extends toward the ATP binding site of the neighboring subunit. Mutation of Arg 158 to Ala in the subunit removes the Arg finger interaction with the ATP site in 1 and mutation of Arg 169 to Ala in the subunits removes the Arg fing er interactions with the ATP sites in 2 and 3 This figure was originally published in The Journal of Biological Chemistry. Mechanism of loading the Escherichia coli DNA polymer ase III sliding clamp: II. Uncoupling the beta and DNA binding activities of the gamma complex. J Biol Chem 2004; 279 :4386 439. the American Society for Biochemistry and Molecular Biology.

PAGE 80

80 Results Equilibrium Binding Anisotropy based assays have shown reduced binding activity in the case of (16) However, a limitation of this assay is that it is not sensitive at low nanomolar protein concentrations, wher e K d values are accurately determined. In our study, labeled with p yrene ( p yrene) was used in an equilibrium fluorescence emission intensity based assay to measure the effect of the mutations on binding. Briefly, the fluorescence of 10 nM pyrene wa s measured in presence of 0.5 mM ATP and increasing concentration s of complex. Binding of complex to increased the fluorescence of pyrene in a concentration dependent manner as expected for an equilibrium binding reaction. The fold change in fluores cence intensity was plotted against complex concentration and the data were fit ted to a quadratic equation to obtain the K d value ( Figure 5 2). For comparison, binding to wt complex in the absence of ATP was also measured. The calculated K d values w ere 0.9 0.3 and 191 33 n M in the presence and absence of ATP, respectively, showing that ATP increases the affinity of the complex for by at least 2 orders of magnitude. The K d values obtained in the presence and absence of ATP are in agreement wit h the values reported previously using a pyrene anisotropy based assay 0.1 0.05 nM and 151 6 nM respectively (16) At saturating concentrations of complex, th e quantum yield of pyrene is lower in the absence of ATP than in the presence. It has been shown previously that is not opened in the absence of ATP (79) T his indicates that the pyrene fluorescence is lower in the closed comple complex than in the open complex. (16, 55) Binding of the Arg finger mutants to pyrene was

PAGE 81

81 measured in the presence of ATP only. The K d values calculated from these titrations were 124 15 n M and 28 6 n M for the R169A mutant s, resp ectively. These values are also in agreement with the K d values reported previously, 51 4 n M and 10 8 n M for the R169A mutant s, respectively (16) Figure 5 2. Effect of complex Arg finger mutations on clamp binding. pyrene binding by wt complex with ATP (blue), wt complex without ATP (black), R169A mutant with ATP (red) was measured. The relative intensity of pyrene at 375 nm is plotted as a function of complex concentration for solutions containing 10 nM pyrene and 0.5 mM ATP (when present). Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 82

82 The K d values for the two mutants obtained in our studies are ~138 and ~30 fold greater than that for the wt complex, showing that the mutations greatly decrease the affinity of the complex for Additionally, at the saturation point, the total fold change in pyrene intensity for the mutants is similar to that for the wt complex in the absence of ATP, suggesting that the mutants may have a opening defect. Equilibrium Clamp Opening The complex does not open well in the absence of ATP (79) Also, in the absence of ATP the total fold change in pyrene intensity is less than in the presence of ATP in case of the wt complex ( Figure 5 2), suggesting that low pyrene intensity may be due to poor opening of The Arg finger mutants also show less change in the pyrene intensity compared to the wt complex ( Figure 5 2), suggesting that they may have a defect in opening. To test this, clamp opening was measured. An assay based on labeled with AF488 ( AF488) w as used (44) This assay works on the principle that two fluorophores in proximity quench each other. is labeled at the opening interface with two AF488 molecules, one on each monomer. When is closed, the fluorescence is quenched and when it is opened by the complex the quenching is relieved. Briefly, the fluorescence of AF488 was measured in th e presence of 0.5 mM ATP and increasing concentration s of complex ( Figure 5 3). The final concentration of AF488 used in the assay was 10 nM (wt), 2 nM ( R169A) respectively. The 35% increase in AF488 fluorescence, while the R169A mutant gave no measurable increase in AF488

PAGE 83

83 fluorescence at concentrations of 800 1000 n M clamp loader where binding approached saturation ( Figure 5 2). Figure 5 3. Effect of complex Arg finger mutations on opening. Binding of wt complex (blue), R169A mutant (red) to AF488 was measured in the presence of 0.5 mM ATP. The relative intensity of AF488 at 517 nm is plotted as a function of complex concentration for solutions containing 0.5 mM ATP and 10 nM (wt) 2 nM ( R169A) AF488 respectively. Data shown are the average of three (wt and R169A) independent experiments. Error bars represent standard deviation.

PAGE 84

84 Based on the relative AF488 intensities at saturation, the produced about 16% of the open complexes that the wt complex formed, and the R169A mutant produced less than 2% of the open complexes. The K d value calculated for the wt complex was 4.3 2.4 n M. The mutants did not show a measurable increase in AF488 intensity, therefore the data for the mutants were not fit to a binding curve. Together, these results show that the Arg finger mutants are defective in opening. Conclusions The complex Arg fi nger mutants bind three molecules of ATP as does the wt (72) Our results show that the mutants behave like wt complex without ATP with respect to binding ( Figure 5 2) and show a severely reduced opening (by a factor of 50 in the case of the R 169A mutant) which is again an ATP dependent activity. This suggests that interactions between the Arg fingers and the bound ATP molecules help to drive ATP dependent conformati onal changes in the complex that promote binding and opening. Previous work (16) has shown that the function of Arg finger at the 1 interface is important in interaction with while those at 1 2 and 2 3 are important for interaction with DNA. Our studies suggest that poor DNA binding may be due to poor opening, due to a defect in making optimal conformational changes required for both opening and DNA binding, or a combination of both. Previous work (25) has identified has been given to it (30) implying that maintains a rigid conformation while other

PAGE 85

85 subunits such as the three subunits and the subunit undergo conformational changes upon interaction with various ligands. Our data show that the mutation in the Arg finger motif of subunit has a larger effect on interaction with while the mutations in subunits have larger effect o n interaction with DNA. It is possible that the Arg finger motif of subunit interacts with ATP bound at 1 interface and promotes conformational changes responsible for binding via subunit. On the other hand, the Arg finger motifs of 1 and 2 su bunits interacts with ATP bound at 1 2 and 2 3 interface s and promote a different set of conformational changes responsible for opening.

PAGE 86

86 CHAPTER 6 RESIDUE IN THE SENSO R 1 MOTIF OF COMPLEX PROMOTES ATP DEPENDENT CONFORMATI ONAL C HANGES Background Information In all AAA+ proteins, the S ensor 1 motif is located at the N termin al end of the SRH loop. The S ensor 1 motif contains a polar residue which is most often Asn, as in S. cerevisiae RFC, but is sometimes Ser, His or, as in the E coli complex, Thr which interacts with the phosphate of ATP (reviewed in (8) ). In our study, we have mutated the Thr (T157) to Ala and analyzed the effect of the mutation on clamp loading. One proposed function for this residue is to sense ATP and mediate ATP dependent conformational changes (80) All clamp loading steps are stimulated in the presence of ATP T herefore if this is true, all the steps such as binding, opening, DNA binding and ATP hydrolysis will be affected by the T157A mutation. Another proposed function of this residue is to aid in ATP hydrolysis (15) If that is true, only the clamp loading steps coupled with ATP hydrolysis will be affected. However, it is also possibl e that defects in ATP induced conformational changes indirectly decrease ATPase activity. For example, DNA binding triggers ATP hydrolysis by the clamp loader, and if the Sensor 1 residue is required for ATP dependent DNA binding, then defective DNA bindin g would result in reduced ATP hydrolysis. Another recently proposed model, states that a polar residue is involved in keeping the WB Glu residue in an inactive conformation until the right substrate binds (20) In other words, the residue interacts with the WB Glu residue and moves Glu ou t of the catalytic position until DNA binds. If the n DNA dependent ATP hydrolysis activity will be affected by the T157A mutation.

PAGE 87

87 Also, in the case of the mutant, since Glu is not pulled out of the way, the DNA independent ATPase activity would be higher compared to wt complex. In our laboratory, the Thr residue was mutated in each of the three subunits to make the T157A mutant complex (Christopher Paschall, unpublished), and the effect of the mut ation on binding and opening was measured (Farzaneh Tondnevis, unpublished). Equilibrium binding and opening assays were performed and the following results were obtained. A p yrene based assay (described in C hapter 5) was used to measure binding and the K d values determined were 2 1 nM (wt) and 39 8 nM (mutant). Apart from showing a reduced affinity for the mutants also showed reduc tion in pyrene intensity at saturation levels. While the wt complex showed a ~2.5 fold increase in pyrene intens ity, the mutants showed only a ~2 fold increase. This suggests that the mutation not only affects the binding affinity for but it also affects the way the complex interacts with thus reducing the total change in pyrene intensity upon binding. To me asure clamp opening, the AF488 based assay (described in C hapter 5) was used and the K d values determined, were 2 1 nM (wt) and 67 12 nM (mutant). In addition to this, the total fold change in AF488 intensity was ~2.5 (wt) and ~1.2 (mutant). This dat a suggests that the mutation affects both the binding affinity to and the total number of molecules open at equilibrium. Altogether, the data showed that the Sensor 1 Thr mutation reduces both binding and opening. In this study, the effects on DNA bi nding and ATP hydrolysis were measured. Our data show that the mutation reduces both DNA binding and ATP hydrolysis.

PAGE 88

88 Results Equilibrium DNA Binding Given that the Sensor 1 Thr 157 to Ala mutation in the complex affects ATP dependent interactions, such a s binding and opening, effects of the mutation on DNA binding were also measured. DNA binding by the complex is stimulated in the presence of (55) therefore the effect of on DNA bin ding was also measured. The DNA RhX based anisotropy assay (described in Chapter 4) was used with final concentrations of 0.5 mM ATP S, 25 nM DNA RhX, 0 2 M complex and 4 M The data collected for DNA binding measured in the absence and presence of are plotted on separate graphs. Figure 6 1 and 6 2 represent DNA binding in the absence and presence of respectively. The K d values calculated from DNA binding data in the absence of were 164 72 nM (wt) and 1200 330 nM (T157A mutant). The T157A mu tant clearly shows reduced binding to the p/t DNA. The K d values calculated from DNA binding data in the presence of were 26 6 nM (wt) and 441 82 nM (T157A mutant). Our data suggest that reduces the DNA binding K d by a factor of six in the case of wt complex, but in the case of the T157A mutant the reduction in K d is only by a factor of 2.7. These data support our opening results that, because the mutant is a less efficient opener, the stimulation of DNA binding is also reduced. DNA binding experiments were performed in presence of ATP S, which does not support opening to the full extent (discussed in C hapter 7). Therefore, it is possible that in presence of ATP, the stimulation of DNA binding by is greater for the wt complex, T157A mut ant

PAGE 89

89 or both. With that caveat, our DNA binding data indicates that the T157A mutation not only affect s the opening but also the downstream steps in the clamp loading reaction. Figure 6 1. Effect of the complex S ensor 1 Thr mutation o n the absence of Binding of wt complex (blue) and the T157A mutant (green) to DNA RhX was measured in the presence of ATP S. The change in anisotropy of RhX at 605 nm is plotted as a function of complex concentration for sol utions containing 25 nM DNA RhX and 0.5 mM ATP S. Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 90

90 Figure 6 2. Effect of complex S ensor 1 Thr mutation on e presence of Binding of wt complex (blue) and the T157A mutant (green) to DNA RhX was measured in the presence of ATP S. The change in anisotropy of RhX at 605 nm is plotted as a function of complex concentration for solutions containing 25 nM DNA RhX, 0.5 mM ATP S and 4 M Data shown are the average of three independent experiments. Error bars represent standard deviation. ATP Hydrolysis O ne of the functions proposed for the S ensor 1 Thr residue is to aid in ATP hydrolysis by coordinating the wa ter molecule (15) ; therefore the T157A mutation is expected to result in weaker ATP hydrolysis. Steady state ATP hydrolysis was

PAGE 91

91 measured using the PK/LDH coupled oxidation of NADH assay (as described in C hapter 4). ATP hydrolysis was measured at 250 nM complex (wt and T157A mutant) and different concentrations of DNA ( Figure 6 3). The assay contained 0.5 mM ATP, which is about 50 fold higher than the K m reported for the wt complex (81) The steady state hydrolysis rates obtained from ATPase data in the absence of DNA, were 36 3 (wt) and 1.4 2.1 (T157A mutant) nMs 1 Figure 6 3. E ffect of complex S ensor 1 Thr mutations on the rate of ATP hydrolysis in the absence of Rates of ATP hydrolysis were measured for wt complex (blue) and the T157A mutant (green) in the presence of 0.5 mM ATP and varying concentration s of p/t DNA. The concentration of ATP hydrolyzed per second is plotted at several DNA concentrations for solutions containing 250 nM each complex. Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 92

92 Therefore, the mutati on reduces the basal rate of ATP hydrolysis by about 25 fold. With increasing DNA concentration, the rate of ATP hydrolysis increased for both the wt and the mutant complex reaching 129 25 (wt) and 136 7 (T157A mutant) nMs 1 in the presence of 1 M D NA ( Figure 6 4 ). Therefore, the maximal ATPase stimulation by DNA does not appear to be affected by the mutation. Figure 6 4. Effect of complex S ensor 1 Thr mutations on rate of ATP hydrolysis in presence of Rates of ATP hydrolysis we re measured for wt complex (blue) and the T157A mutant (green) in the presence of 0.5 mM ATP and varying concentration of p/t DNA. was added only in the 1 M DNA reaction mix, rest of the data is the same as shown in Figure 6 3. The concentration of AT P hydrolyzed per second is plotted at several DNA concentrations for solutions containing 250 nM each complex. Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 93

93 Another interesting observation was made when was added to the ATPase reaction mix containing 1 M DNA ( Figure 6 4). stimulates ATP hydrolysis by the wt complex (60) In our assay, the rates obtained from the ATPase data in the presence of 1 M DNA and 1 M were 880 25 (wt) and 16.7 4.1 (mutant) nMs 1 When compared to the data for ATPase rate in the presence of 1 M DNA alo ne, increased the rate of ATP hydrolysis by about seven fold in the case of wt complex. On the other hand, the rate of ATP hydrolysis by the mutant was decreased by about eight fold. The inhibitory effect of on the mutant ATPase activity may be becau se the mutant does not open well. As a result, when in presence of the mutant becomes trapped in the closed complex conformation which is unable to hydrolyze ATP. Conclusions Other studies have shown that the complex S ensor 1 Thr mutation reduc es binding and opening (Farzaneh Tondnevis, unpublished). Our data show that the mutation also affects other ATP dependent functions such as DNA binding and ATP hydrolysis. Taken together, all ATP dependent activities are reduced in the T157A mutant. Therefore, our study supports the model (80) that the S ensor 1 Thr residue is involved in making ATP dependent conformational changes. A defect in ATP dependent conformational changes is also predicted to reduce ATP hydrolysis, therefore, our data also supports another view (15) that the S ensor 1 Thr residue aids in ATP hydrolysis. A third model (20) predicts, that a polar residue keeps the WB Glu in an inactive conformation until DNA binds. If then DNA would stimulate ATP hydrolysis only in case of the wt complex, but not in the T157A mutant. Our data show DNA dependent stimulati on of

PAGE 94

94 ATP hydrolysis in the case of both the wt complex and the T157A mutant therefore, does not support the

PAGE 95

95 CHAPTER 7 ATP S REDUCES CLAMP OPEN ING Background Information ATP hydro a sulfur atom replacing one of the oxygen atoms linked to the phosphate ( Figure 7 1). The molecule has the same shape as ATP, but cannot be cleaved at the phosphate position by enzymes efficiently to release energy The rate of ATP S hydrolysis by complex is approximately 50,000 fold slower than ATP in case of the complex (53) ATP S is very widely used to study reaction mechanisms, which involve ATP hydrolysis (34, 82) ATP is substituted by AT P S in order to avoid any complications due to ATP hydrolysis. Both clamp binding and opening are stimulated by ATP binding but are not affected by hydrolysis T herefore these activities should not be affected by substitution of ATP by ATP S. We studied c lamp binding and opening in the presence of ATP S to determine if ATP S has an effect on these functions. Figure 7 1. Structure of ATP S.

PAGE 96

96 Results PCNA Binding The equilibrium PCNA binding assay (described in C hapter 4) was used to measure PCNA binding by wt RFC in the presence of ATP S ( Figure 7 2). Figure 7 2. Effect of ATP S on PCNA binding. Binding of wt RFC was measured in the presence of ATP (blue) or ATP S (orange) The relative intensity of MDCC at 470 nm is plotted as a functio n of RFC concentration for solutions containing 10 nM PCNA MDCC and 0.5 mM ATP or ATP S Data shown are the average of three independent experiments. Error bars represent standard deviation. The f inal concentration s of the reagents were 10 nM PCNA MDCC, 0 1 M RFC and 0.5 mM ATP or ATP S. The K d values obtained for these measurements were 7.1

PAGE 97

97 2 nM in the presence of ATP and 13.3 1.8 nM in the presence of ATP S. These values are slightly different within the range of standard deviation measured. Therefor e, ATP S appears to have littl e or no effect on PCNA binding. Equilibrium PCNA Opening The equilibrium PCNA opening assay (described in C hapter 4) was used to measure PCNA ring opening by wt RFC in the presence of ATP S ( Figure 7 3). The f inal concentratio n s of the reagents were 10 nM PCNA AF488, 0 1 M RFC and 0.5 mM ATP or ATP S. Figure 7 3. Effect of ATP S on PCNA opening. Opening of wt RFC was measured in the presence of ATP (blue) or ATP S (orange) The relative intensity of AF488 at 51 7 nm is plotted as a function of RFC concentration for solutions containing 10 nM PCNA AF488 and 0.5 mM ATP or ATP S Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 98

98 The K d values obtained for these mea surements were 10.8 4 nM in the presence of ATP and 5.8 2.6 nM in the presence of ATP S. The total fold change in AF488 intensity was approximately 2 fold (ATP) and 1.5 fold (ATP S). The K d value is a measurement of binding affinity; therefore, similar values suggest that the binding affinity of wt RFC for PCNA is not affected by ATP S. On the other hand, change in intensity is a measurement of the total number of open PCNA molecules at equilibrium; therefore, the data suggest that ATP S reduces the fra ction of PCNA molecules in an open conformation. Pre S teady State PCNA Opening Because the fraction of PCNA molecules open was reduced in equilibrium assays with ATP S, the rate of PCNA opening was measured to determine whether the equilibrium constant wa s altered by a decrease in the opening rate. A pre steady state opening assay (described in C hapter 4) was used. The final concentrations were 20 nM PCNA AF488, 200 nM wt RFC and 0.5 mM ATP or ATP S. An apparent opening rate of 2.7 0.7 s 1 and 1.9 0.1 s 1 was obtained in the presence of ATP and ATP S respectively ( Figure 7 4). The fluorescence intensity levels at reaction end points were the same as observed in the equilibrium assay ( Figure 7 3). These data suggest that ATP S has a small effect on the apparent rate of PCNA opening. The a pparent rate of PCNA opening ( k obs ) is a combination of the rate of PCNA opening ( k on ) and the rate of PCNA closing ( k off ). Therefore, t he difference observed in apparent rate in presence of ATP and ATP S may be due to a difference in the rate of PCNA opening, in the rate of PCNA closing, or a combination of both.

PAGE 99

99 Figure 7 4. Effect of ATP S on the rate of PCNA opening. Stopped flow fluorescence measurements were made in which a solution of wt RFC and AT P S was added to a solution of PCNA and ATP S. Final concentrations after mixing were 20 nM PCNA AF488, 200 nM RFC and 0.5 mM ATP or ATP S. Three and two independent experiments were done for ATP (blue trace) and ATP S (orange trace) respectively. Represe ntative time courses are shown. The data for individual time courses fit to a single exponential rise (black traces), and the average values of observed rate constants are given in the text.

PAGE 100

100 Binding Our data suggest that ATP S has a small effect on PCNA binding and a moderate effect on PCNA opening by RFC, to determine whether it has similar effects on binding and opening by complex, the equilibrium binding and opening by the wt complex were measured in the presence of ATP S. To measure binding, the equilibrium binding assay (described in C hapter 5) was used. Figure 7 5. Effect of ATP S on binding. Binding of wt complex to pyrene was measured in the presence of ATP (blue) or ATP S (orange). The relative intensity of pyrene at 375 nm is plotted as a function of complex concentration for solutions containing 10 nM p yrene and 0.5 mM ATP or ATP S. Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 101

101 The fluorescence of 10 nM pyrene was measured in the presence of increasing concentration of complex and 0.5 mM ATP or ATP S. The calculated K d values were 0.9 0.3 and 1.9 0.8 n M in the presence of ATP and ATP S, respectively ( Figure 7 5). Therefore, ATP S appears to have li ttle or no effect on binding. Opening To measure opening, the equilibrium opening assay (described in C hapter 5) was used. The fluorescence of 10 nM AF488 was measured in the presence of increasing concentrations of complex and 0.5 mM ATP or AT P S ( Figure 7 6). Figure 7 6. Effect of ATP S on opening. Binding of wt complex to AF488 was measured in the presence of ATP (blue) or ATP S (orange). The relative intensity of AF488 at 517 nm is plotted as a function of complex conc entration for solutions containing 10 nM AF488 and 0.5 mM ATP or ATP S. Data shown are the average of three independent experiments. Error bars represent standard deviation.

PAGE 102

102 The calculated K d values were 4.3 2.4 nM and 12 4 n M in the presence of ATP and ATP S respectively. These values are similar within the range of standard deviation measured. The total change in AF488 fluorescence intensity was approximately 4 fold and 3.5 fold in the presence of ATP and ATP S respectively. Therefore, ATP S does not affect the binding affinity of complex to AF488, but has a small effect on the number of open molecules at equilibrium. Conclusions Our data shows very little or no effect of ATP S on both PCNA and binding by the respective clamp loaders ( Figur es 7 2 and 7 5). In both the cases, the K d values are very similar in presence of ATP or ATP S. On the other hand, in case of PCNA and opening ( Figures 7 3, 7 4 and 7 6) the fold change in AF488 intensity is reduced in presence of ATP S, suggesting that it reduces the number of open molecules of both PCNA and An interesting observation is that the effect of ATP S on PCNA opening is approximately half of the effect of WB mutations. The WB mutations reduced clamp opening by approximately 5 fold while the ATP S reduced it by 2 fold. Also, PCNA opening was affected more (2 fold) than opening (1.5 fold). These differences may be due to the fact that RFC makes different interactions with PCNA compared to the complex makes with Altogether, our data show that ATP S reduces clamp opening. Because clamp opening does not require ATP hydrolysis, these data suggest that ATP S does not support all the conformational changes required for opening the clamp. This is an important observation, as ATP S is treated si analogue of ATP. Our data suggest that in spite of having a similar shape like ATP, it does not mimic all the conformational changes made by ATP. One possible mechanism

PAGE 103

103 for this may be because of the low electro negativity of sul f ur atom compared to oxygen. It is possible that the oxygen atom replaced by sulphur atom in case of ATP S is required to make interactions with important residues in the ATP binding site in order to promote proper conformational changes.

PAGE 104

104 CHAPTER 8 DIS CUSSION AND FUTURE D IRECTIONS We have studied the effect of single amino acid mutations in several key protein sequence motifs belonging to the mutation in RFC ( C c omplex ( C hapter 5) and the S complex ( C hapter 6). Our results show effects of these mutations on clamp loading activities that are not commonly associated with the proposed roles of these residues in the AAA+ domain. Walker B Mo tif The WB Glu residue is believed to act as a general base by deprotonating a water molecule and mak ing it more nucleophilic for catalysis of ATP hydrolysis (9) Classically, the WB motif has been associated only with ATP hydrolysis a nd not with ATP binding (8, 11 13) Our results show that clamp loading steps such as PCNA binding, PCNA opening and DNA binding which involve only ATP binding but no hydrolysis are also reduced in case of the WB m utants. Furthermore, ligand induced changes such as ATP stimulated PCNA opening, PCNA stimulated DNA binding and DNA stimulated ATP hydrolysis were affected significantly. Taken together, our results indicate that the WB motif Glu plays an important role in promoting conformational changes made by RFC upon binding the respective ligands. These changes are not dependent upon ATP hydrolysis but may require interaction of the WB Glu residue with other molecules such as water, magnesium ion, neighboring amino acid residues or substrates in the clamp loading reaction such as ATP, PCNA and DNA. It is also possible that the Glu residue is involved in coordination of the water molecule required for ATP hydrolysis indirectly. For example, the Glu residue may be loc ated too far away to interact with the

PAGE 105

105 phosphate of ATP on its own but may interact with the water molecule, which make hydrogen bond s with the phosphate. This positioning of the water molecule would not be possible in the absence of ATP. Further stud ies are needed to understand the exact mechanism by which the Glu residue contributes to making optimal conformational changes. Arg Finger Motif The Arg finger motif is believed to sense the phosphate of bound ATP (16) and to catalyze ATP hydrolysis (18, 72) The complex Arg finger mutants bind ATP well (17, 72) but show reduced and DNA binding (16) Our results show the effect of these mutations on binding and opening. In our studies, the mutants behaved as if they had a defect in ATP bind ing. ATP dependent opening activity was reduced by as much as six fold ( fold ( R 169A) in these mutants. Given that the mutants bind ATP well, our results indicate that they do not respond well to the bound ATP. Again, both binding and o pening are independent of ATP hydrolysis (53) ; ther efore our results suggest a role for the Arg finger motif in promoting ATP dependent conformational changes. One possible mechanism is that the interaction of the Arg finger motif with ATP promotes opening, and the loss of interaction after ATP hydrolys is leads to closure of the ring around DNA. Sensor 1 Motif T wo different model s have been proposed for the role of the Sensor 1 Thr residue. These are ; 1) to mediate ATP dependent conformational changes (80) and 2) to aid in ATP hydrolysis (15) keeps the WB Glu in inactive conform ation until DNA binds (20) Our studies with the

PAGE 106

106 complex T157A m utants show that the mutation affect s all ATP dependent activities such as binding, opening, DNA binding and ATP hydrolysis therefore supporting the first and the second model s. In addition to this, our data show DNA dependent stimulation of ATP hydro lysis in the case of the mutant therefore suggesting that the Final Thoughts Although our studies included different AAA+ motifs (WB, Arg finger and Sensor 1) and from different domains of life, suc h as eukaryotes (RFC) and bacteria ( complex), some very interesting common results were obtained. Our major conclusion is that the key AAA+ residues play an important role in promoting conformational changes in addition to the roles classically assigned to them. All the mutants studied showed a defect in the classic function linked to them, but at the same time they showed large effects on other activities attributable to conformational changes. For instance, the WB mutations showed a five fold reduction in PCNA ring opening activity, in addition to the expected defect in ATP hydrolysis. The Arg finger mutants showed six fold ( 50 fold ( R 169A) reduced opening in addition to a defect in ATP sensing. S imilarly, the Sensor 1 mutants showed 1.5 f old reduced DNA binding in addition to a defect in ATP hydrolysis. Another interesting observation was that all the mutations had a very large effect on clamp opening. For instance, the effect of WB mutations was 1.2 fold on DNA binding compared to as much as five fold on PCNA opening. The effect of Arg finger mutations on opening was as much as six fold ( fold ( R 169A). And, the effect of Sensor 1 mutations was 1.5 fold on DNA binding compared to two fold on

PAGE 107

107 opening. One possible explanat ion is that the mutations studied here have a larger effect on the conformational changes required for clamp opening than those required for DNA binding. Another common observation was that the studied residues are involved in sensing and responding to the various ligands at individual steps of the overall reaction. The conformational changes made after binding to a ligand facilitates the next step of the reaction. For instance, PCNA stimulated DNA binding (2.4 fold increase in binding affinity) in the case of wt RFC. Also, DNA stimulated ATP hydrolysis by seven fold in the case of wt RFC. Ligand binding induced changes are believed to be a mechanism to drive the reaction in a defined order (35) Our studies provide an insight into the possible mechanism behind the overall clamp loading reaction. For instance, the WB mutants are known to be defective in ATP hydrolysis, but our data showed that the defect c omes from the loss of DNA dependent stimulation of ATP hydrolysis. In other words, the basal ATP hydrolysis is not affected due to the mutation, but the level of hydrolysis in DNA bound state is reduced by as much as about ten fold. In the case of Arg fing er mutants, they are known to be defective in and DNA binding (16) but our data showed an effect on ATP dependent opening. Reduced opening possibly hampers dow nstream steps such as DNA binding and eventually ATP hydrolysis. A very interesting observation was that chang ing a single amino acid residue resulted in profound effects on the overall function of the proteins in question. Both the wt S. cerevisiae RFC an d the wt E. coli complex used in our studies are 200 250 KDa proteins comprised of ~2000 amino acids. The single mutations were made in individual ATPase subunits thus changing a total of three to four amino acids in the complexes,

PAGE 108

108 yet the effect of the mutations were quite significant. In the case of the RFC WB mutants, the PCNA opening activity was reduced five fold, while the ATP hydrolysis was reduced as much as eight fold. Similarly, the Arg finger mutations reduced opening by as much as 50 fold, w hile the Sensor 1 mutations reduced ATP hydrolysis by 50 fold. On one hand, these effects seem to be quite large, while on the other hand this explains why these residues are so well conserved in all the AAA+ proteins. Single amino acid change s in the key residues may result in partial or near complete loss of function; therefore nature has allowed few or no substitutions at these sites. Implications The AAA+ family is a huge family comprising of proteins involved in a myriad of cellular functions. These p roteins share various key residues belonging to the AAA+ domain, but at the same time they have some unique structural features to adapt to the particular function being carried out (reviewed in (21) ). They may have extra N or C terminal domains (clamp loaders (27) ), extra subunits ( and subunits in complex (83) ), subunits defective in a particular function ( and complex (25) and Rfc5 in RFC defective in ATPase activity (27) ) or different interaction s with substrates (DNA binding represses ATPase activity of ORC (84) ). Our results show an important role of the AAA+ residues in driving the conformational changes required for the clamp loading reaction. Although, ligand binding induced conformational changes are known to be one of the basic mechanisms behind the o verall function of AAA+ proteins, it is possible that the clamp loaders have evolved to link ligand binding to the conformational changes and the resulting mechano chemical transductions in a specific way to adapt to the clamp loading pathway. For instance involvement of the WB Glu residue in promoting

PAGE 109

109 conformational changes may be unique to the clamp loaders. Further studies are needed to understand how much this mechanism is shared among the various AAA+ proteins. For instance, does a mutation in WB aspa rtate residue cause similar effects? Or, does a similar mechanism exist in all AAA+ proteins, or only in the AAA+ proteins, which have with common substrates (Helicase, Polymerase), or only in clamp loaders, or just in RFC? These studies will provide furth er insight into the way the AAA+ proteins have evolved to elicit their specific cellular functions. Our studies involved the RFC WB motif and complex Arg finger and Sensor 1 motifs. The studies focused on very specific role s of these motifs in the clamp loading pathway. For instance, our data showed that the S. cerevisiae RFC WB Glu to Gln or Ala change reduced PCNA opening and ATP hydrolysis. Nonetheless, the results may be applicable to a wide variety of mechanisms in a wide variety of proteins. The AAA + proteins show a remarkable degree of conservation in their structural features and various mechanisms. The specific results obtained in our studies may hold true in case of other clamp loaders, similar AAA+ proteins or all AAA+ proteins. Our results als o provide a cautionary note against monitoring the end product of a multistep enzymatic reaction and extrapolating the results to the individual steps of the reaction. In previous studies, the WB mutation was made in individual subunits of archaeal RFC and assuming that the mutation affected ATP hydrolysis only, individual steps of the clamp loading reaction were assigned to each subunit (12) In another study, based on the assumption that Arg finger mutations affect only ATP hydrolysis, the Arg finger residues were mutated to Gln in RFC to help prevent ATP hydrolysis in the crystal (59)

PAGE 110

110 would suggest that the reason that PCNA is not open in the structure is that RFC Arg finger mutants are a lso defective in clamp opening. We have also studied the effect of ATP S on clamp loading steps ( C hapter 7). Our results show that ATP S reduces clamp opening, again cautioning against the assumption that ATP S affects only ATP hydrolysis and related func tions. Future Studies Our study showed the effect of various mutations on conformational changes and the role of the changes in driving the clamp loading reaction. A comparison of the structure of the wt and mutant proteins will further elucidate the under lying mechanism. X ray crystallography combined with computational analysis will help to understand the exact mechanism by which the AAA+ residues contribute to the conformational changes. For instance, some of the questions addressed may be to what extent do single amino acid mutation s change the overall structure of the protein? Are the changes confined to the site of mutation or are they transmitted to distant regions? How does the change affect the interaction of the clamp loader with the various ligand s? How does ligand binding affect conformational changes in the case of wt and mutants? Do the changes directly contribute to the defect in clamp loading activities? Our study focused on proteins harboring mutations in key conserved residue in all of the f unctional subunits. For instance, the RFC WB mutant harbored mutation in all four WB sites, thus making a quadruple mutant. Similarly, both the Arg finger and Sensor 1 complex mutants contained mutation in all three subunits, thus making a triple mutan t. It will be interesting to study the effect of similar mutations in single, double, triple or various combinations of the specific sites. These studies will address

PAGE 111

111 some questions like is the effect of single mutation l ess er than multiple mutations? Is t here a synergistic effect of multiple mutations? Do the multiple sites function independently or is there a defined sequence of action? Which subunit plays a more significant role in interaction with a specific ligand? Another very interesting area of stud y will be to understand if there is any link between the different residues studied here. For instance, a recently proposed model e conformation until DNA binds (20) The Sensor i s located in between Walker A and B motifs and is a likely candidate for Although our study does not support the Glu switch function for the complex Sensor 1 Thr residue, it will be interesting to see if there are any othe r residues acting as Glu switch possibly in the Sensor 1 motif or any other motifs. It is also possible that the Sensor 1 Thr residue does not act as a Glu switch in the complex or in all clamp loaders, but does so in other AAA+ proteins. On a similar no te, in the AAA+ domain, the Sensor 1 motif and the Arg finger motif are located at the N and C terminals of a common region called Second Region of Homology (SRH) respectively (14) A lso the Arg finger motif functions in trans; thus projecting into the neighbor senses ATP binding in a subunit and the conformational change is conveyed to the Sensor 1 motif via the SRH, leading to changes in the preceding subunit. It will be interesting to see if there is any cross talk between these different motifs and if there are any compensatory mutations that can be made at these sites.

PAGE 112

112 LIST OF REFERENCES 1. Erdmann, R., Wiebel, F. F., Flessau, A., Rytka, J., Beyer, A., Frhlich, K. U., and Kunau, W. H. (1991) PAS1, a yeast gene req uired for peroxisome biogenesis, encodes a member of a novel family of putative ATPases Cell 64 499 510 2. Beyer, A. (1997) Sequence analysis of the AAA protein family. Protein Sci. 6 2043 2058 3. Neuwald, A., Aravind, L., Spouge, J., and Koonin, E. (19 99) AAA+: A class of chaperone like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome research 9 27 43 4. Rowe, T., and Balch, W. E. (1997) Membrane fusion. Bridging the gap by AAA ATPases Nature 388 20 21 5. Kim, Y. I., Levchenko, I., Fraczkowska, K., Woodruff, R. V., Sauer, R. T., and Baker, T. A. (2001) Molecular determinants of complex formation between Clp/Hsp100 ATPases and the Clpp peptidase. Nat. Struct. Biol. 8 230 233 6. O'donnell, M., Onrust, R., De an, F. B., Chen, M., and Hurwitz, J. (1993) Homology in accessory proteins of replicative polymerases E. Coli to humans. Nucleic Acids Research 21 1 3 7. Burgess, S. A., Walker, M. L., Sakakibara, H., Knight, P. J., and Oiwa, K. (2003) Dynein structure an d power stroke. Nature 421 715 718 8. Hanson, P. I., and Whiteheart, S. W. (2005) AAA+ proteins: have engine, will work. Nat Rev Mol Cell Biol 6 519 529 9. Iyer, L. M., Leipe, D. D., Koonin, E. V., and Aravind, L. (2004) Evolutionary history and higher o rder classification of AAA+ ATPases J. Struct. Biol. 146 11 31 10. Babst, M., Wendland, B., Estepa, E. J., and Emr, S. D. (1998) The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function. EMBO J 17 2982 2993 11. Whiteheart, S. W., Rossnagel, K., Buhrow, S. A., Brunner, M., Jaenicke, R., and Rothman, J. E. (1994) N ethylmaleimide sensitive fusion protein: a trimeric ATPase whose hydrolysis of ATP is required for membrane fusion. J. Cell Biol. 126 9 45 954

PAGE 113

113 12. Seybert, A., and Wigley, D. B. (2004) Distinct roles for ATP binding and hydrolysis at individual subunits of an archaeal clamp loader. EMBO J 23 1360 1371 13. Sweeney, T. R., Cisnetto, V., Bose, D., Bailey, M., Wilson, J. R., Zhang, X., Belsh am, G. J., and Curry, S. (2010) Foot and Mouth Disease Virus 2C Is a Hexameric AAA+ Protein with a Coordinated ATP Hydrolysis Mechanism. J Biol Chem 285 24347 24359 14. Lupas, A. N., and Martin, J. (2002) AAA proteins. Curr. Opin. Struct. Biol. 12 746 75 3 15. Hattendorf, D. A., and Lindquist, S. L. (2002) Cooperative kinetics of both Hsp104 ATPase domains and interdomain communication revealed by AAA sensor 1 mutants. EMBO J 21 12 21 16. Snyder, A. K., Williams, C. R., Johnson, A., onnell M., and Blo om, L. B. (2004) Mechanism of loading the Escherichia coli DNA polymerase III sliding clamp: II. Uncoupling the beta and DNA binding activities of the gamma complex. J Biol Chem 279 4386 4393 17. Johnson, A., Yao, N. Y., Bowman, G. D., Kuriyan, J., and O donnell M. (2006) The Replication Factor C Clamp Loader Requires Arginine Finger Sensors to Drive DNA Binding and Proliferating Cell Nuclear Antigen Loading. J Biol Chem 281 35531 35543 18. Karata, K., Inagawa, T., Wilkinson, A. J., Tatsuta, T., and Ogur a, T. (1999) Dissecting the role of a conserved motif (the second region of homology) in the AAA family of ATPases Site directed mutagenesis of the ATP dependent protease FtsH J Biol Chem 274 26225 26232 19. Ogura, T., Whiteheart, S. W., and Wilkinson, A. J. (2004) Conserved arginine residues implicated in ATP hydrolysis, nucleotide sensing, and inter subunit interactions in AAA and AAA+ ATPases J. Struct. Biol. 146 106 112 20. between ATPase activity and ligand binding in AAA+ proteins. Nat Struct Mol Biol 15 1223 1227 21. Erzberger, J. P., and Berger, J. M. (2006) evolutionary relationships and structural mechanisms of AAA+ proteins Annu. Rev. Biophys. Biomol. Struct. 35 93 114

PAGE 114

114 22. Snider, J., Thibault, G., and Houry, W. A. (2008) The AAA+ superfamily of functionally diverse proteins. Genome Biol. 9 216 23. Jeruzalmi, D., O 'donnell M., and Kuriyan, J. (2001) Crystal structure of the processivity clamp loader gamma (gamma) complex of E. Coli DNA polymerase III. Cell 106 429 441 24. Bowman, G. D., O 'donnell M., and Kuriyan, J. (2004) Structural analysis of a eukaryotic sliding DNA clamp clamp loader complex. Nature 429 724 730 25. Guenther, B., Onrust, R., Sali, A., O 'don nell M., and Kuriyan, J. (1997) Crystal structure of the delta' subunit of the clamp loader complex of E. Coli DNA polymerase III. Cell 91 335 345 26. Davey, M. J., Jeruzalmi, D., Kuriyan, J., and O 'donnell M. (2002) Motors and switches: AAA+ machines w ithin the replisome. Nat Rev Mol Cell Biol 3 826 835 27. Cullmann, G., Fien, K., Kobayashi, R., and Stillman, B. (1995) Characterization of the five replication factor C genes of Saccharomyces cerevisiae Mol. Cell. Biol. 15 4661 4671 28. Cann, I. K., an d Ishino, Y. (1999) Archaeal DNA replication: identifying the pieces to solve a puzzle. Genetics 152 1249 1267 29. Krishna, T. S., Kong, X. P., Gary, S., Burgers, P. M., and Kuriyan, J. (1994) Crystal structure of the eukaryotic DNA polymerase processivit y factor PCNA. Cell 79 1233 1243 30. Johnson, A., and O M. (2005) Cellular DNA Replicases : Components and Dynamics at the Replication Fork. Annu. Rev. Biochem. 74 283 315 31. Stukenberg, P. T., Studwell Vaughan, P. S., and O 'donnell M. (1991) M echanism of the sliding beta clamp of DNA polymerase III holoenzyme. J Biol Chem 266 11328 11334 32. Burbelo, P. D., Utani, A., Pan, Z. Q., and Yamada, Y. (1993) Cloning of the large subunit of activator 1 (replication factor C) reveals homology with bact erial DNA ligases. Proc Natl Acad Sci USA 90 11543 11547 33. Gomes, X. V., Gary, S. L., and Burgers, P. M. (2000) Overproduction in Escherichia coli and characterization of yeast replication factor C lacking the ligase homology domain. J Biol Chem 275 14 541 14549

PAGE 115

115 34. Chen, S., Levin, M. K., Sakato, M., Zhou, Y., and Hingorani, M. M. (2009) Mechanism of ATP Driven PCNA Clamp Loading by S. Cerevisiae RFC. Journal of Molecular Biology 388 431 442 35. Bloom, L. B. (2009) Loading clamps for DNA replication a nd repair. DNA Repair (Amst) 8 570 578 36. Gulbis, J. M., Kazmirski, S. L., Finkelstein, J., Kelman, Z., O M., and Kuriyan, J. (2004) Crystal structure of the chi:psi subassembly of the Escherichia coli DNA polymerase clamp loader complex. Eur J Biochem 271 439 449 37. Tsuchihashi, Z., and Kornberg, A. (1989) ATP interactions of the tau and gamma subunits of DNA polymerase III holoenzyme of Escherichia coli J Biol Chem 264 17790 17795 38. Onrust, R., and O 'donnell M. (1993) DNA polymerase III accessory proteins. II. Characterization of delta and delta'. J Biol Chem 268 11766 11772 39. Pritchard, A. E., Dallmann, H. G., Glover, B. P., and mchenry C. S. (2000) A novel assembly mechanism for the DNA polymerase III holoenzyme dnax complex: associ ation of deltadelta' with D nax (4) forms D nax (3)deltadelta'. EMBO J 19 6536 6545 40. Anderson, S. G., Williams, C. R., O M., and Bloom, L. B. (2007) A function for the psi subunit in loading the Escherichia coli DNA polymerase sliding clamp. J Bio l Chem 282 7035 7045 41. Mok, M., and Marians, K. J. (1987) The Escherichia coli preprimosome and DNA B helicase can form replication forks that move at the same rate. J Biol Chem 262 16644 16654 42. Bloom, L. B. (2006) Dynamics of Loading the Escherichi a coli DNA Polymerase Processivity Clamp. Critical Reviews in Biochemistry and Molecular Biology 41 179 208 43. Marzahn, M. R., and Bloom, L. B. (2012) Improved solubility of replication factor C (RFC) Walker A mutants. Protein Expr Purif 83 135 144 44. Paschall, C. O., Thompson, J. A., Marzahn, M. R., chiraniya, A., Hayner, J. N., O M., Robbins, A. H., mckenna R., and Bloom, L. B. (2011) The Escherichia coli clamp loader can actively pry open the sliding clamp. J Biol Chem 286 42704 42714

PAGE 116

116 45. Uhlmann, F., Cai, J., Gibbs, E., O 'donnell M., and Hurwitz, J. (1997) Deletion analysis of the large subunit p140 in human replication factor C reveals regions required for complex formation and replicati on activities. J Biol Chem 272 10058 10064 46. Peoples, R., Franke, Y., Wang, Y. K., Prez Jurado, L., Paperna, T., Cisco, M., and Francke, U. (2000) A Physical Map, Including a BAC/PAC Clone Contig, of the Williams Beuren Syndrome Deletion Region at 7q11 .23. The American Journal of Human Genetics 66 47 68 47. Wang, Y., Cortez, D., Yazdi, P., Neff, N., Elledge, S. J., and Qin, J. (2000) BASC, a super complex of BRCA1 associated proteins involved in the recognition and repair of aberrant DNA structures. Ge nes Dev. 14 927 939 48. MS, Y. R. K., MD, S. Y. S., MD, S. S. K., MD, C. H. A., MD, S. H. L., and MD, N. J. Y. (2010) Mutational and expressional analysis of RFC3, a clamp loader in DNA replication, in gastric and colorectal cancers. Human Pathology 41 1 431 1437 49. Tang, H., Hilton, B., Musich, P. R., Fang, D. Z., and Zou, Y. (2012) Replication factor C1, the large subunit of replication factor C, is proteolytically truncated in Hutchinson Gilford progeria syndrome. Aging Cell 11 363 365 50. Naktinis, V ., Onrust, R., Fang, L., and O 'donnell M. (1995) Assembly of a chromosomal replication machine: two DNA polymerases, a clamp loader, and sliding clamps in one holoenzyme particle. II. Intermediate complex between the clamp loader and its clamp. J Biol Che m 270 13358 13365 51. Gomes, X. V. (2001) ATP Utilization by Yeast Replication Factor C. I. ATP mediated interaction with DNA and with proliferating cell nuclear antigen. Journal of Biological Chemistry 276 34768 34775 52. Gomes, X. V. (2001) ATP Utiliz ation by Yeast Replication Factor C. II. Multiple stepwise ATP binding events are required to load proliferating cell nuclear antigen onto primed DNA Journal of Biological Chemistry 276 34776 34783 53. Hingorani, M. M., and O 'donnell M. (1998) ATP bindi ng to the Escherichia coli clamp loader powers opening of the ring shaped clamp of DNA polymerase III holoenzyme. J Biol Chem 273 24550 24563 54. Sakato, M., O M., and Hingorani, M. M. (2012) A central swivel point in the RFC clamp loader control s PCNA opening and loading on DNA. Journal of Molecular Biology 416 163 175

PAGE 117

117 55. Bloom, L. B., Turner, J., Kelman, Z., Beechem, J. M., O 'donnell M., and Goodman, M. F. (1996) Dynamics of loading the beta sliding clamp of DNA polymerase III onto DNA. J Bi ol Chem 271 30699 30708 56. Simonetta, K. R., Kazmirski, S. L., Goedken, E. R., Cantor, A. J., Kelch, B. A., Mcnally, R., Seyedin, S. N., Makino, D. L., O 'donnell M., and Kuriyan, J. (2009) The Mechanism of ATP Dependent Primer Template Recognition by a Clamp Loader Complex. Cell 137 659 671 57. Kazmirski, S. L., Zhao, Y., Bowman, G. D., O M., and Kuriyan, J. (2005) Out of plane motions in open sliding clamps: molecular dynamics simulations of eukaryotic and archaeal proliferating cell nuclear a ntigen. Proc Natl Acad Sci USA 102 13801 13806 58. Miyata, T., Suzuki, H., Oyama, T., Mayanagi, K., Ishino, Y., and Morikawa, K. (2005) Open clamp structure in the clamp loading complex visualized by electron microscopic image analysis. Proc Natl Acad Sci USA 102 13795 13800 59. Bowman, G. D., Goedken, E. R., Kazmirski, S. L., O M., and Kuriyan, J. (2005) DNA polymerase clamp loaders and DNA recognition. FEBS Lett. 579 863 867 60. Onrust, R., Stukenberg P., and O 'donnell M. (1991) Analysis of the ATP ase Subassembl y Which Initiates Processive DNA Synthe sis by DNA Polymerase III Holoenzyme. J Biol Chem 266 21681 21686 61. Sakato, M., Zhou, Y., and Hingorani, M. M. (2012) ATP Binding and Hydrolysis Driven Rate Determining Events in the RFC Cataly zed PCNA Clamp Loading Reaction. Journal of Molecular Biology 416 176 191 62. Williams, C. R., Snyder, A. K., Kuzmic, P., O M., and Bloom, L. B. (2004) Mechanism of loading the Escherichia coli DNA polymerase III sliding clamp: I. Two distinct ac tivities for individual ATP sites in the gamma complex. J Biol Chem 279 4376 4385 63. Ason, B., Bertram, J. G., Hingorani, M. M., Beechem, J. M., O 'donnell M., Goodman, M. F., and Bloom, L. B. (2000) A model for Escherichia coli DNA polymerase III holoen zyme assembly at primer/template ends. DNA triggers a change in binding specificity of the gamma complex clamp loader. J Biol Chem 275 3006 3015 64. Ason, B. (2003) Mechanism of Loading the Escherichia coli DNA Polymerase III beta Sliding Clamp on DNA. Bo na fide primer/templates preferentially trigger the gamma complex to hydrolyze ATP and load the clamp Journal of Biological Chemistry 278 10033 10040

PAGE 118

118 65. Anderson, S. G., Thompson, J. A., Paschall, C. O., O M., and Bloom, L. B. (2009) Temporal C orrelation of DNA Binding, ATP Hydrolysis, and Clamp Release in the Clamp Loading Reaction Catalyzed by the Escherichia coli Biochemistry 48 8516 8527 66. Thompson, J. A., Paschall, C. O., O M., and Bloom, L. B. (2009) A slow ATP induc ed conformational change limits the rate of DNA binding but not the rate of beta clamp binding by the Escherichia coli gamma complex clamp loader. J Biol Chem 284 32147 32157 67. Thompson, J. A., Marzahn, M. R., O 'donnell M., and Bloom, L. B. (2012) Repl ication Factor C is a more e ffective Proliferati ng Cell Nuclear Antigen (PCNA) o pener than the Checkpoint Clamp Loader, Rad24 RFC. J Biol Chem 287 2203 2209 68. Weibezahn, J., Schlieker, C., Bukau, B., and Mogk, A. (2003) Characterization of a trap mutant of the AAA+ chaperone clpb J Biol Chem 278 32608 32617 69. Lee, S. H., Moon, J. H., Yoon, S. K., and Yoon, J. B. (2012) Stable Incorporation of ATP ase Subunits into 19 S Regulatory Particle of Human Proteasome Requires Nucleotide Binding and C terminal Tails. J Biol Chem 287 9269 9279 70. Finkelstein, J., Antony, E., Hingorani, M., and O 'donnell M. (2003) Overproduction and analysis of eukaryotic multiprotein complexes in Escherichia coli using a dual vector strategy. Analytical biochemistry 319 78 87 71. Angers Loustau, A., Rainy, J., and Wartiovaara, K. (2007) plasmaDNA : a free, cross platform plasmid manipulation program for molecular biology laboratories. BMC Mol Biol 8 77 72. Johnson, A. (2003) Ordered ATP Hydrolysis in the gamma Complex Clamp Lo ader AAA+ Machine. J Biol Chem 278 14406 14413 73. O (2,4,6 triphosphate, an analog of adenosine triphosphate. Biochim. Biophys. Acta 320 635 647 74 Cable, M. B., Feher, J. J., and Briggs, F. N. (1985) Mechanism of allosteric regulation of the Ca,Mg ATP ase of sarcoplasmic reticulum: studies with 5' adenylyl methylenediphosphate. Biochemistry 24 5612 5619

PAGE 119

119 75. Kornberg, A., and Pricer W. E. (1951) E nzymatic phosphorylation of adenosine and 2,6 diaminopurine riboside. J Biol Chem 193 481 495 76. Mcnally, R., Bowman, G. D., Goedken, E. R., O 'donnell M., and Kuriyan, J. (2010) Analysis of the role of PCNA DNA contacts during clamp loading. BMC Struct Biol 10 3 77. Zhuang, Z., Yoder, B. L., Burgers, P. M. J., and Benkovic, S. J. (2006) The structure of a ring opened proliferating cell nuclear antigen replication factor C complex revealed by fluorescence energy transfer. Proc Natl Acad Sci USA 103 2546 2551 78. Schmidt, S. L. G. (2001) ATP Utilization by Yeast Replication Factor C. III. The ATP binding domains of Rfc2, Rfc3 and Rfc4 are essential for DNA recognition and clamp loading J Biol Chem 276 34784 34791 79. Turner, J., Hingorani, M. M., Kelman Z., and O 'donnell M. (1999) The internal workings of a DNA polymerase clamp loading machine. EMBO J 18 771 783 80. Story, R. M., and Steitz, T. A. (1992) Structure of the recA protein ADP complex. Nature 355 374 376 81. Hingorani, M. M., Bloom, L. B., Goodman, M. F., and O 'donnell M. (1999) Division of labor -sequential ATP hydrolysis drives assembly of a DNA polymerase sliding clamp around DNA. EMBO J 18 5131 5144 82. Sanchez Berrondo, J., Mesa, P., Ibarra, A., Martinez Jimenez, M. I., Blanco, L., M endez, J., Boskovic, J., and Montoya, G. (2012) Molecular architecture of a multifunctional MCM complex. Nucleic Acids Research 40 1366 1380 83. Maki, S., and Kornberg, A. (1988) DNA polymerase III holoenzyme of Escherichia coli. II. A novel complex inclu ding the gamma subunit essential for processive synthesis. J Biol Chem 263 6555 6560 84. Klemm, R. D., Austin, R. J., and Bell, S. P. (1997) Coordinate binding of ATP and origin DNA regulates the ATP ase activity of the origin recognition complex. Cell 88 493 502

PAGE 120

120 BIOGRAPHICAL SKETCH Ankita Chiraniya was born in Bihar, India. She finished her schooling and Ambedkar Center for Biomedical research, New Delhi in 2004. In 2007, she j oi ned the graduate program in the College of Medicine, Department of Biochemistry and Molecular Biology (IDP) at the University of Florida. Her research was performed under the supervision of Dr. Linda Bloom in the Department of Biochemistry and Molecular Biology. She received her Ph.D. from the University of Florida in summer 2012.