Regulation of Corneal Scar Formation by Transforming Growth Factor Beta and Connective Tissue Growth Factor

MISSING IMAGE

Material Information

Title:
Regulation of Corneal Scar Formation by Transforming Growth Factor Beta and Connective Tissue Growth Factor Roles of Proteolytic Processing and Development of a Gene Silencing Technique
Physical Description:
1 online resource (123 p.)
Language:
english
Creator:
Robinson, Paulette
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Genetics (IDP)
Committee Chair:
Schultz, Gregory S
Committee Co-Chair:
Lewin, Alfred S
Committee Members:
Hauswirth, William W
Baker, Henry V
Smith, Wesley C

Subjects

Subjects / Keywords:
cornea -- ctgf -- ribozyme -- scar -- sirna -- tgf-b
Genetics (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Previous research has demonstrated that corneal scarring following trauma, infection, or refractive surgery is the result of a complex cascade of multiple growth factors, cytokines, chemokines, and proteases that interact in multiple pathways to regulate key processes such as proliferation, migration, differentiation and synthesis of extracellular matrix by corneal cells. The transforming growth factor-beta (TGF-b) system has been shown to play a key role in the formation of scar tissue in the cornea and in other tissues in the body. Furthermore, connective tissue growth factor (CTGF) is a fibrogenic cytokine that is upregulated by TGF-b and serves as a downstream mediator of many of the fibrotic actions of TGF-b, including stimulation of synthesis of extracellular matrix and differentiation of fibroblasts into myofibroblasts. Previous studies suggest that CTGF is proteolytically processed by cultured skin fibroblasts and by some tissues into fragments that have different agonist and antagonist effects. To examine the role of proteolytic processing of CTGF in wound healing of the cornea, we analyzed both in vitro and in vivo models. To simulate corneal wound healing in vitro, human corneal fibroblasts (HCF) were stimulated with TGF-b1, and the production of CTGF was analyzed. In the conditioned media, two expected forms of CTGF were detected, the full-length 38 kDa protein and a 21 kDa fragment of CTGF. An unexpected immunoreactive 50 kDa protein was also detected in the media. In the cell extract, four forms of CTGF were detected, the full-length 38 kDa protein, 21 kDa, 18 kDa, and 13 kDa fragments. The 21 kDa fragment was identified as CTGF using tandem mass spectrometry. Based on this finding, we analyzed homogenates of unwounded whole eyes from mouse, rat and rabbit and individual eye structures from the rabbit using Western blots and found that the C-terminal 21 kDa and 25 kDa fragments were the dominant forms of CTGF. We next analyzed the expression of CTGF over the complete time course of corneal wound healing in the rat, and found at 12 hours after ablation, all CTGF forms (38 kDa, 25 kDa, and 21 kDa) were at their lowest concentration. At 11 days post ablation when corneal scarring is actively increasing, all three forms of CTGF (38 kDa, 25 kDa, and 21 kDa) were in the highest abundance. For example, at day 11, the 21 kDa CTGF fragment was 32.5-times higher abundance than it was at 12 hours after injury. These data suggest that the CTGF plays important role(s) in regulating corneal wound healing and understanding the production and biological role of the 21 kDa fragment of CTGF will be an important component of the CTGF system during early phases of corneal wound healing. Ribozymes and siRNAs can be used to selectively reduce the expression of target genes such as the profibrotic genes TGF-b1 and CTGF that cause corneal scarring and haze. Using a secreted alkaline phosphatase reporter assay, we identified two siRNAs that selectively targeted rat TGF-b1 or CTGF mRNAs which each produced a relative knockdown of at least 50% of the sAP reporter protein. We also tested ribozymes targeting either TGF-b1 or CTGF mRNAs, and found that both ribozymes produced at least a 25% knockdown of the target mRNAs when compared to the vector control. Since a long term goal of this research is develop a clinically useful therapy to reduce corneal scarring, we also tested the ability of these ribozymes to reduce target gene expression and corneal scarring in excimer laser-injured animal models. A key component of this therapeutic approach is to develop an effective method to deliver the ribozymes to corneal cells. The adeno-associated virus (AAV) vector has been successfully used to deliver genes and ribozymes to retinal cells of patients with selected forms of retinitis pigmentosa and to restore vision in those patients. However, recombinant single stranded AAV vectors usually take four to five days to express the transgenes. Therefore, we generated a self-complementary adeno-associated virus (scAAV) vector expressing the ribozyme and analyzed the efficiency and time course of transduction of rabbit corneal cells following excimer laser ablation. Using a scAAV vector expressing green fluorescent protein (scAAV-GFP), we found all cells types of the cornea (epithelial cells, stroma fibroblasts and endothelial cells) were transduced by the scAAV-GFP vector, with the greatest expression of GFP occurring at day 7. Finally, we applied the a scAAV vector expressing the CTGF ribozyme (scAAV-CTGF-Active-Rz) to the rat cornea after laser-ablation of the corneal epithelium, and we observed a 19% knockdown of CTGF protein on day 14. These findings support the concept that scAAV vector expressing ribozymes or other gene silencing molecules that target either TGF-b1 or CTGF could be used to therapeutically reduce corneal scar formation.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Paulette Robinson.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Schultz, Gregory S.
Local:
Co-adviser: Lewin, Alfred S.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044056:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 REGULATION OF CORNEAL SCAR FORMATION BY TRANSFORMING GROWTH FACTOR BETA AND CONNECTIVE TISSUE GROWTH FACTOR: ROLES OF PROTEOLYTIC PROCESSING AND DEV E L OP MENT OF A G ENE SILENCING TECHNIQUE By PAULETTE MARIE ROBINSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Paulette Marie Robinson

PAGE 3

3 To my amazing husband Ben tly Robinson and adorable son, Orion John Robinson

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my loving husband, Bently Robinson, for all of his love and support throughout this journey. Also, I thank my son, Orion John, for being the light of my life. I look forward to watching you grow and develop. My parents, Paul and J acqueline Kuznia, have supported me throughout all of the endeavors of my life and I am forever grateful. I thank my sister, brothers, and their significant others for their constant encouragement. I also would like to thanks my friends for keeping me sane I am extremely fortunate that they are there to always make me laugh. I thank my mentors, Dr. Gregory Schultz and Dr. Alfred Lewin, for their guidance and allowing me to work in th eir laboratories. I have enjoyed working with both of you and learning life and laboratory lessons. My experience in their labs was very fulfillin g and I am very appreciative. I also thank my other committee members, Dr. Clay Smith, Dr. Henry Baker, and Dr. William Hauswirth, for taking the time to meet with me to discuss my finding s and help me troubleshoot any problems that had arisen. I thank all of my lab mates both past and present in both the Schultz and Lewin labs for the countless hours of cam ara derie You made coming into work in the lab enjoyable and your assistance wit h my experiments was priceless. I have had the opportunity to learned that by teaching someone, yo u learn more yourself. I thank all of them (Craig Levoy, Dilan Patel, Joshua Vickers, Sara Rodriguez, Meera Dave, Tyler Smith, and Sriniwas Sriram) for working with me. I truly enjoyed working with each of them and they were a key component to acquiring all of the data th at is in this dissertation.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST O F TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 The Eye ................................ ................................ ................................ .................. 16 The Cornea ................................ ................................ ................................ ............. 16 Refractive Surgery Techniques ................................ ................................ ............... 18 Corneal Wound Healing ................................ ................................ .......................... 21 Corneal Scarring ................................ ................................ ................................ ..... 23 Roles of TGF ................................ ................................ ................................ ...... 24 Roles of CTGF ................................ ................................ ................................ ........ 26 Reduction of C orneal Scar Formation ................................ ................................ ..... 30 Gene Therapy ................................ ................................ ................................ ......... 31 Adeno associated Viral Vectors ................................ ................................ .............. 35 2 MATERIALS AND METHODS ................................ ................................ ................ 41 Antibody Sensitivity and Detection ................................ ................................ .......... 41 Sources of Growth Factors and Antibodies ................................ ...................... 41 SDS PAGE and Western Blots ................................ ................................ ......... 41 Human Corneal Fibroblast Cell Culture ................................ ............................ 42 TGF 1 Stimulation of CTGF ................................ ................................ ............ 43 SDS PAGE and Western Blots ................................ ................................ ......... 43 Immunoprecipitation and Identification of 21kDa CTGF Band ................................ 44 Identification of the Protease Class that Cleaves CTGF from HCF Extracts ........... 44 CTGF Proteolytic Processing In Vivo ................................ ................................ ...... 45 Mouse, Rat, and Rabbit Eye Homogenates ................................ ..................... 45 SDS PAGE and Western Blots of Whole Eye Homogenates ........................... 46 .......................... 47 Rat Corneal Ablation ................................ ................................ ........................ 47 In vitro Analysis of siRNAs ................................ ................................ ...................... 48 Production of Secreted Alkaline Phosphatase Target Expression Plasmid ...... 48 Human Embryonic Kidney 293 Cell Culture and Transfection of a Plasmid and siRNA ................................ ................................ ................................ ..... 49 In vitro Analysis of scAAV Ribozyme Vectors ................................ ......................... 49 scAAV TGF 1 Rz Plasmids Construction ................................ ....................... 49

PAGE 6

6 scAAV CTGF Rz Plasmids Construction ................................ .......................... 50 Human Embryonic Kidney 293 Cell Culture and Dual Transfection ................. 50 In vivo Anal ysis of scAAV GFP in Rabbit Corneas After Ablation ........................... 51 Delivery of scAAV GFP to Rabbit Corneas ................................ ................ 51 Direct Fluorescence Microscopy ................................ ................................ ...... 52 Image Analysis ................................ ................................ ................................ 52 In vivo Analysis of scAAV CTGF Active Rz in Rat Corneas After Ablation ............. 53 Rat Corneal Ablation and scAAV CTGF Active Rz Delivery ............................ 53 CTGF Protein Concentration (ELISA) ................................ ............................... 5 3 3 ROLE OF PROTEOLYTIC PROCESSING of CTGF THROUGHOUT WOUND HEALING ................................ ................................ ................................ ................ 60 Corneal Scar Formation ................................ ................................ .......................... 60 Connective Tissue Growth Factor ................................ ................................ ........... 60 Results ................................ ................................ ................................ .................... 61 Antibody Sensitivity and Detection ................................ ................................ ... 61 TGF 1 Stimulation of CTGF in HCF ................................ ................................ 61 Immunoprecipitat ion and Identification of the 21 kDa CTGF Fragment from HCF .. 63 Identification of the Protease Class that Cleaves CTGF from HCF Extracts ........... 63 Identification of a 21 kDa CTGF Fragment in Unwounded Rat, Rabbit, and Mouse Whole Eye Homogenates ................................ ................................ .. 64 Identification of a 21 kDa CTGF Fragment in Individual Eye Structures in the Rabbit Eye ................................ ................................ ............................... 64 .......................... 64 Immunoprecipitation and Identification of the 21 kDa CTGF Fragment from Rabbit Whole Eye Homogenates ................................ ................................ .. 65 Detection of CTGF Throughout Corneal Wound Healing in Rats ..................... 65 Discussion ................................ ................................ ................................ .............. 66 4 DEVLEOPMENT OF A THERAPEUTIC GENE SILENCING TECHNIQUE UTILIZING RIBOZYMES AND RNAi IN A SELF COMPLEMENTARY ADENO ASSOCIATED VIRAL VECTOR ................................ .............................. 83 Reduction of Scar Formation ................................ ................................ .................. 83 Gene Therapy ................................ ................................ ................................ ......... 83 In vitro Analysi s of Gene Silencing Techniques ................................ ................ 84 Using ................................ ................................ ....................... 85 Analysis of siRNAs targeting rat CTGF Using the Secreted Alkaline Phosphatase Assay ................................ ................................ ...................... 86 ................................ ................................ ......... 87 Delivery of scAAV GFP to Rabbit Corneas ................................ ...................... 88 Delivery of scAAV CTGF Active Rz to Rat Corneas after Ablation .................. 88 Discussion ................................ ................................ ................................ .............. 88

PAGE 7

7 5 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 103 CTGF Proteolytic Processing ................................ ................................ ................ 103 Reduction of Corneal Haze by Targeting Profibrotic Growth Factors ................... 104 LIST OF REFERENCES ................................ ................................ ............................. 107 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 123

PAGE 8

8 LIST OF TABLES Table page 2 1 Primary Antibodies ................................ ................................ ............................. 55 2 2 Rat siRNAs ................................ ................................ ................................ ......... 57 2 3 Ribozymes ................................ ................................ ................................ .......... 58

PAGE 9

9 LIST OF FIGURES Figure page 1 1 The Three Cellular Layers and Two Interfaces of the Cornea. ........................... 38 1 2 Demonstrates the Different CTGF Protein Modules and Domains of CTGF. ... 39 1 3 Schematic Diagram Illustrating the Deg radation of Target RNA by a Ribozyme and siRNA ................................ ................................ ......................... 40 2 1 Scheme of secreted alkaline phosphatase plasmid before the target gene is added. ................................ ................................ ................................ ................ 56 2 2 Scheme of scAAV vector before the ribozyme is added. ................................ .... 59 3 1 Detection of rCTGF using several different antibodies.. ................................ ..... 71 3 2 Western blot analysis of cell extracts from HCF cells stimulated with TGF 1. ................................ ................................ ................................ ........................... 72 3 3 Western blot analysis of conditioned media from HCF cells stimulated with TGF 1 ................................ ................................ ................................ ............... 73 3 4 Western blot analysis of immunoprecipitated CTGF from HCF cells stimulated wit h TGF 1 ................................ ................................ ....................... 74 3 5 Western blot analysis of in vitro processing of CTGF into the 21 kDa fragment.. ................................ ................................ ................................ ........... 76 3 6 Western blot analysis of in vivo CTGF from unwounded rabbit, rat and mouse whole eye homogenates. ................................ ................................ .................... 77 3 7 Western blot analysis of in vivo CTGF from unwounded rabbit eye structures .. 78 3 8 Analysis of transcriptional start sites of the CTGF RNA in adult mouse and ................................ ................................ ........... 79 3 9 S ilver stain analysis of a rabbit whole eye homogenates elution from an affinity column containing the hinge region monoclonal antibody. ...................... 80 3 10 Western blot analysis of CTGF throughout a time course of wound healing after ablation from rat corneal homogenates.. ................................ .................... 82 4 1 Analysis of six siRNAs targeting TGF 1 using a sAP reporter assay. d were statistically significant (0.01
PAGE 10

10 4 2 Analysis of five siRNAs targeting CT GF using a sAP reporter assay ................. 94 4 3 Analysis of scAAV TGF 1 Active Rz and scAAV TGF 1 Inactive Rz using a sAP reporter assay.. ................................ ................................ ........................ 96 4 4 Analysis of scAAV CTGF Active Rz and scAAV CTGF Inactive Rz using a sAP reporter assay. ................................ ................................ ......................... 97 4 5 Analysis of GFP expression in rabbit corneas treated with scAAV GFP after ablation using direct fluorescence microscopy. ................................ .................. 98 4 6 Relative levels of GFP fluorescence in rabbit corneas treated with scAAV GFP after ablation. ................................ ................................ ............................. 99 4 7 Analysis of GFP expression in rabbit corneas treated with scAAV GFP after ablation using direct fluorescence microscopy. ................................ .............. 101 4 8 Ratio of CTGF to total protein in rat corneas treated with scAAV CTGF Active Rz or PBS control after ablation at day 14. ................................ .......... 102

PAGE 11

11 LIST OF ABBREVIATION S AAV Adeno associated virus AEBSF 4 (2 Aminoethyl) benzenesulfonyl fluoride hydrochloride ANOVA analysis of variance sma alpha smooth muscle actin bp base pairs CCN cyr61, ctgf, nov proteins CTGF connective tissue growth factor D D iopter DNA D eoxyribonucleic acid dsRNA double stranded RNA g gram GFP green fluorescent protein HCF human corneal fibroblast IGF insulin like growth factor IgG Immunoglobulin G IL 1 Interluekin 1 kDa kilodalton L Liter LASEK laser subepithelial keratomileusis LASIK laser in situ keratomileusis ml milliliters MMP matrix metalloproteinases ng nanogram PRK photorefractive keratectomy

PAGE 12

12 rAAV recombinant adeno associated virus RISC R NA induced silencing complex RNA Ribonucleic acid RNAi RNA interference sAP secreted alkaline phosphatase scAAV self complementary adeno associated virus siRNA small interfering RNA TGF transforming growth factor beta TIMPs tissue inhibitors of metallop roteinases ug microgram ul microliter

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF CORNEAL SCAR FORMATION BY TRANSFORMING GROWTH FACTOR BETA AND CONNECTIVE TISSUE GROWTH FACTOR: ROLES OF PROTEOLYTIC PROCESSING AND DEV E L OP MENT OF A GENE SILENCING TECHNIQUE By Paulette Marie Robinson May 2012 Chair: Gregory Schultz Co Chair: Alfred Lewin Major: Medical Sciences Genetics Previous research has demonstrated that corneal scarring following trauma, infection, or refractive surgery is the result of a complex cascade of multiple growth factors, cytokines, chemokines, and proteases that interact in mul tiple pathways to regulate key processes such as proliferation, migration, differentiation and synthesis of extracellular matrix by corneal cells The transforming growth factor beta (TGF ) system has been shown to play a key role in the formation of sca r tissue in the cornea and in other tissues in the body Furthermore, connective tissue growth factor (CTGF) is a fibrogenic cytokine that is upregulated by TGF and serves as a downstream mediator of many of the fibrotic actions of TGF including stim ulation of synthesis of extracellular matrix and differentiation of fibroblasts into myofibroblasts. Previous studies suggest that CTGF is proteolytically processed by cultured skin fibroblasts and by some tissues into fragments that have different agonis t and antagonist effects. To examine the role of proteolytic processing of CTGF in wound healing of the cornea, we

PAGE 14

14 analyzed both in vitro and in vivo models. To simulate corneal wound healing in vitro human corneal fibroblasts (HCF) were stimulated with TGF 1, and the production of CTGF was analyzed. In the conditioned media, two expected forms of CTGF were detected, the full length 38 kDa protein and a 21 kDa fragment of CTGF An unexpected immuno reactive 50 kDa protein was also detected in the media In the cell extract, four forms of CTGF were detected, the full length 38 kDa protein, 21 kDa, 18 kDa, and 13 kDa fragments. The 21 kDa fragment was identified as CTGF us ing tandem mass spectrometry. Based on this finding, we analyzed homogenates of unwounded whole eyes from mouse, rat and rabbit and individual eye structures from the rabbit using Western blots and found that the C terminal 21 kDa and 25 kDa fragments were the dominant forms of CTGF. We next analyzed the expression of CTGF over the complete time course of corneal wound healing in the rat, and found at 12 hours after ablation, all CTGF forms (38 kDa, 25 kDa, and 21 kDa) were at their lowest concentration. At 11 days post ablation whe n corneal scarring is actively increasing, all three forms of CTGF (38 kDa, 25 kDa, and 21 kDa) were in the highest abundance. For example, at day 11, the 21 kDa CTGF fragment was 32.5 times higher abundance than it was at 12 hours after injury. These da ta suggest that the CTGF plays important role(s) in regulating corneal wound healing and understanding the production and biological role of the 21 kDa fragment of CTGF will be an important component of the CTGF system during early phases of corneal wound healing. Ribozymes and siRNAs can be used to selectively reduce the expression of target genes such as the profibrotic genes TGF 1 and CTGF that cause corneal scarring and haze Using a secreted alkaline phosphatase reporter assay, we identified two siRN As

PAGE 15

15 that selective ly targeted rat TGF 1 or CTGF mRNAs which each produced a relative knockdown of at least 50% of the sAP reporter protein We also tested ribozymes targeting either TGF 1 or CTGF mRNAs, and found that both ribozymes produced at least a 2 5% knockdown of the target mRNAs when compared to the vector control Since a long term goal of this research is develop a clinically useful therapy to reduce corneal scarring, we also tested the ability of these ribozymes to reduce target gene expression and co rneal scarring in excimer laser injured animal models. A key component of this therapeutic approach is to develop an effective method to deliver the ribozymes to corneal cells. The adeno associated virus (AAV) vector has been successfull y used to deliver genes and ribozymes to retinal cells of patients with selected forms of retinitis pigmentosa and to restore vision in those patients. However, recombinant single stranded AAV vectors usually take four to five days to express the transge nes. Therefore, we generated a self complementary adeno associated virus (scAAV) vector expressing the ribozyme and analyzed the efficiency and time course of transduction of rabbit corneal cells following excimer laser ablation. Using a scAAV vector exp ressing green fluorescent protein (scAAV GFP), we found all cells types of the cornea (epithelial cells, stroma fibroblasts and endothelial cells) were transduced by the scAAV GFP vector, with the greatest expression of GFP occurring at day 7. Finally, we applied the a scAAV vector expressing the CTGF ribozyme ( scAAV CTGF Active Rz ) to the rat cornea after laser ablation of the corneal epithelium, and we observed a 19% knockdown of CTGF protein on day 14. These findings support the concept that scAAV vec tor expressing ribozymes or other gene silencing molecules that target either TGF 1 or CTGF could be used to therapeutically reduce corneal scar formation.

PAGE 16

16 CHAPTER 1 INTRODUCTION The Eye More than 80% of the information we obtain from the external world is visually acquired 1 There are multiple components required for a clear complete picture to be produced. The cornea and lens re fract the light onto the retina, the receptor that converts the light into chemical and electric energy. This signal is then transmitted from the optic nerve to the brain and processed into a final visual image by the visual cortex. If any of these parts are damaged or fail to be in good working order, then the image will be distorted, and we will not be able to obtain the complete picture of all the information. The Cornea The cornea is a transparent, avascular tissue that functions as the gateway into the eye for external images. The cornea is an effective mechanical barrier that, in conjunction with tear films and the conjunctiva, protect against potential pathological agents. Corneal transparency and shape are critical for refraction. The cornea a nd tear film account for more than two thirds of the total refractive power of the eye 2 Any changes in the contour, smoothness, or total thickness of the cornea may result in a distorted image. The majority of corneal medical and surgica l treatments are geared towards restoration of corneal transparency, but recently, the abundance of refractive corrective surgeries have increased 3 The cornea consists of three cellular layers and two interfaces: epithelium, (Figure1 1 ) The epithelium is the outermost barrier layer that is composed of non keratinized, stratified squamous epithelia cells. It is able to prevent entry of pathogens but permits

PAGE 17

17 diffusion of like zone consisting of a random arrangement of collagen fibers and proteoglycans located at the interface of the epithelium and stroma in humans and some other mammals. The stroma, co nsisting of extracellular matrix, keratocytes (quiescent corneal fibroblast) and nerve fibers, accounts for more than 90% of the cornea. Only 2 to 3% of the total volume of the stroma is comprised of cellular components; the remaining portion consists of mostly extracellular matrix components collagen and glycosaminoglycans 4 comp osed mostly of collagen IV and laminin 5 6 and also contains fibronectin 7 to which the corneal endothelial cells are attached. The endothelium is made up of a single layer of mostly hexagonal endothelial cells that regulate the hydration of the cornea. The tigh diffusion of most nutrients into the stroma from the aqueous humor 8 9 Metabolic pump sites (Na + K + ATPase) are found on the basal lateral membrane regions between adjacent endothelial cells which transport Na + ions from the stroma to the aqueous humor 10 Thus, the capacity of a sheet of endothelial cells to pump ions is directly related to the size (density of cells) and shape (hexagonality) of the cells in an area 11 etabolic pump system allows for sufficient nutrient delivery into the stroma and epithelium. Damage and disruption of the corneal endothelial cell layer typically results in corneal edema, swelling and opacity 9 The endothelial cells are metabolically active and secretory, but they do not normally proliferate in humans 1 migration and enlargement of endothelial cells adjacent to the inj ury. However, as the

PAGE 18

18 cells enlarge to cover the injured area, the amount of basal lateral membrane area between adjacent cells decreases, which results in dramatically reduced density of pumps sites over an area of the cornea. When the density of endothe lial cells decline, corneal swelling 11 This swelling distorts the highly ordered orthogonal arrangement of the collagen la mellae and interferes with light waves passing through the cornea and causes the cornea to become opaque. Refractive Surgery Techniques The three most common causes of a distorted visual image are myopia, hyperopia and astigmatism. Myopia, also known as nearsightedness, is caused by the cornea being too curved, the lens being too powerful or the eye is too long. Myopia causes the light to focus anterior (inside) to the surface of the retina. Hyperopia, also known as farsightedness, is caused by the cor nea being too flat, the lens being too weak or the eye being too short. Hyperopia causes the light to focus posterior (outside) the eye, past the retina. Finally, astigmatism is caused by a cornea that is irregular in shape. The different curvatures of the cornea cause the light rays to have different focal points on different axes. For centuries, many people have used glasses and contact lens to reduce the level of ametropia, which is an inability for an image to focus on the retina. Recently, excim er laser surgery has been developed to alleviate the need for glasses and contacts to correct the level of ametropia. A survey of the members of the that approximately 948,266 refractive surgery procedures were performed in the United States during 2004 and 928,737 in 2005. The three most common excimer laser

PAGE 19

19 surgeries which modify the corn eal curvature are photorefractive keratectomy (PRK), laser in situ keratomileusis(LASIK), and laser subepithelial keratomileusis (LASEK). PRK is a surface ablation procedure that first employs the mechanical removal of the central epithelium followed by a predetermined depth of the stromal matrix and keratocytes. The wound is allowed to re epithelialize under the protective cover of a soft contact lens 12 PRK has been associated with postoperative pain which has been postulated to be due to the loss of the epithelial layer 13 Corneal haze is a frequent complication due to PRK, with approximately 3% of patients undergoing treatment for minimal to moderately high myopia experiencing corneal haze. Patient s with high levels of myopia that require deeper ablation of the stromal layer are at increased risk of developing clinically significant levels of corneal haze, which was reported to approach 15% by Seiler et al 14 In a long term study of 10 years, Alio et al recently found that 1.7% of patients who underwent PRK for myopia of less than 6 D had clinically significant corneal haze after 10 years, whereas 8.6% of eyes that underwent PRK for myopia of more than 6 D were found to have haze 15 A diopter (D) is the reciprocal of the focal length measured in meters and is used to describe optical power of the cornea. layer also contributes to the activation of the epithelial cells and secretion of collagen, which contributes t o the scattering of light that is visualized as haze. LASIK is an intrastromal ablation procedure that uses a microkeratome to create a hinged corneal flap that is lifted and the underlying stromal cells are ablated. After the stromal matrix and cells are ablated, the flap is replaced. LASIK is technically more challenging, but has become more popular, because vision usually returns within one

PAGE 20

20 day and there is minimal pain, because the nerve endings are less disrupted 16 17 18 The creation of a flap allows for maintenance of a central zone of normal cornea is incised and disrupted, there is direct contact between epithelial cells and stromal matrix, which leads to synthesis and secretion of collagen by the activated epithelial cells. As a result, a circumferential thin ring of haze is noted in LASIK patients at the edge of the corneal flap 19 Other flap related complications include free caps, incomplete pass of the microkeratome, flap wrinkles, epithelial in growth, flap melt interface debris and diffuse lamellar keratitis 20 21 22 When equal levels of correction are be ing performed, PRK stimulates a stronger fibrotic response compared to LASIK 23 The newest approach to refractive surgery is LASEK, which is a modified PRK technique that uses dilute a lcohol (usually 18 20%) to loosen the epithelial adhesion of the corneal stroma creating a flap, and then the stromal cells are ablated 22 After the stromal cells are ablated, the corneal flap is replaced. LASEK is used when a patient has a low corneal thickness indicating that they are not a good candidate for LASIK. The use of ethanol eliminates the need for a microkeratome, which decreases the cost and eliminates the risk of surgical complications. Whether the flap epithelial tissue is viable and able to reintegrate into the surface debate. In cell culture, Chen et al found a dose and time de pendent effect of alcohol on survival of epithelial cells with a concentration of 25% ethanol being the inflection point of epithelial survival. They found that the viability of human corneal epithelial cells dropped from 94.47% following a 20 second expo sures to 20% ethanol, to only 33.86%

PAGE 21

21 viability following a 20 second exposure to 25% ethanol 24 In vivo experiments showed that the epithelial cells of rabbit corneas exposed to 20% ethanol for 30 seconds had morphologic changes in cytoplasm and surface damage such as alterations of microvilli structure and focal disrup tion of intercellular junctions that was restricted to the superficial corneal epithelium 25 Deter mination of the effects of ethanol on human epithelial cells is difficult because the assessment of cell viability cannot be achieved merely by morphology. Therefore, the effect of 20% ethanol on corneal epithelium has not been fully resolved. Several comparative studies between the different refractive techniques have been done. Alio 26 compared PRK and LASIK outcomes in a ten year study and found that PRK patients developed haze during the first three months that usually subsides, although, 2.9% of patients had minor haze even after 10 years. Patients who received LA SIK never had worse than mild haze throughout the follow up. A meta analysis of PRK versus LASEK by Zh ao 27 found that there were different degrees of corneal haze after LASEK and PRK but there was no significant difference in visual acuity after the procedures. The severity of corneal haze was similar when comparing PRK and LASEK. Corneal Wound Healing After corneal trauma, stromal wound healing is the result a complex cascade of multiple growth factors, cytokines, chemokines and proteases. Directly after epithelial damage, the process of healing is initiated by multiple cy tokines and growth factors including, b ut not limited to, interleukin 1 (IL 1) 28 tumor necrosis factor alpha 29 bone morphogenic proteins 2 and 4 30 epidermal gro wth factor 31 platelet derived growth

PAGE 22

22 factor 32 and transforming growth factor beta (TGF 33 These wound healing mediators are released by the epithelial cells and/or the lacrimal gland. Keratocytes in normal, non injured corneal stromal tissue are often described as being quiescent because synthesis of proteins, DNA and RNA is very low. Following injury, quiescent keratocytes termed activated fibroblasts), which increase DNA, RNA and protein synthesis. For example, microarray analysis of rat corneas following PRK found that levels of 5,885 genes changed during the fir st 12 days of healing 11 Activated keratocytes play major roles in repairing corneal tissue after injury. Keratocytes adjacent to the injury undergo programmed cell death, termed apoptosis, creating a hypoce llular zone adjacent to the edge of the wound. The apoptosis of keratocytes peaks at four hours but may last up to one week or more after trauma 34 35 The two cytokine systems that induce corneal keratocyte apoptosis are the Fas receptor/Fas ligand system and the IL 1/ IL 1 receptor system 36 After the initial wave of keratocyte apoptosis, an increased number of cells die from necrosis, which is characterized by the loss of plasma membrane integrity and random DNA degradation 36 Beyond the zone of keratolysis, quiescent keratocytes become activated in response to growth factors and cytokines. Activated keratocytes are identified about 6 hours post injury by their increases of cell size and organelle content. Proliferation and migration of the activated keratocytes begins 12 to 24 hours after epithelial injury 37 The proliferating keratocytes give rise to activated keratocytes, fibroblasts, and myofibroblasts that repopulate the depleted stroma 38 39 40 41 42

PAGE 23

23 At 8 to 24 hours after injury, chemokines stimulate the attraction of inflammatory cells, such as macrophages/monocytes, T cells and polymorphonuclear cells 35 43 These cells begin removing remnants of damaged cells and extracellular matrix by phagocytosis and secretion of protease. Degradation and removal of damaged tissue is orchestrated by the plasminogen activator/plasmin system, matrix metalloproteinases (MMPs), and other enzymes 44 45 One to two weeks after injury, myofibroblasts appear in the anterior stroma 36 Keratocytes transform into myofibroblasts under the influence of TGF 46 Myofibroblasts are characterized by t heir high concentration of alpha smooth muscle actin ( SMA) and by elevated expression of cadherins and TGF 47 Myofibroblasts secrete many growth factors, including TGF of collagen stromal fibrils into a more normal, orderly arrangement are mediated by MMPs 48 Return of normal structure and function may take months, or even years, in sponse. Corneal Scarring Corneal scarring, which is described clinically as corneal haze, is a major cause of impaired vision. It was previously thought that corneal haze was caused by the irregular arrangement of large collagen fibers in the stromal laye r, which is different than the normal precise, repeating orthogonal orientation of collagen fibers that allows light rays to pass through the ECM without being scattered. Recently, the use of in vivo confocal microscopy revealed that the major reflective (light scattering) structures were actually activated fibroblasts and myofibroblast in the wound area 49 50 51 52 53 Furthermore, the highly reflective property of the activated fibroblasts was shown to be due to the loss of

PAGE 24

24 corneal crystallin proteins 50 that are present in high levels in the cytoplasm of quiescent, transparent keratocytes. Roles of TGF TGF almost all nucleated cells. In mammals, TGF ree isoforms, TGF TGF angiogenesis, wound healing, the immune response and tumor growth. TGF a wide variety of biochemical and biological responses depending on the t arget tissue. Normally, TGF covalently bound latency associated peptide (LAP) that must be released for activation 54 Several activators have been identified to activate latent TGF thrombos pondin 1, integrin v and acidification. One of multiple ways that p lasmin, MMP 2 and MMP 9 has been identified as an activator of TGF protease sensitive hinge region of the latent TGF large latent complex (LLC) from the ECM that then allows another protease to disrupt the TGF LAP complex 55 Thrombospondin 1 activates TGF the LAP TGF 56 Conditioned medium that contains latent TGF activated by mild acid treatment (pH4.5) that is thought to denature LAP that results in disruption of the LAP TGF 57 TGF effect o n many types of cells including Th1 cells, Th2 cells, cytotoxic T lymphocytes, macrophages, natural killer cells, B cells and polymorphonuclear leukocytes 58 Conversely, TGF

PAGE 25

25 accumulation of macrophages, granuloctyes and other cells at the site of inflammation 59 60 TGF 4 weeks of birth of multiple organ inflammatory syndrome involving the heart, skeletal muscle, lungs, liver, s tomach, pancreas, brain, eyes, salivary glands and other tissues 61 62 Studies of knockout mice clearly establishe TGF inflammatory pathway. As with the immune response, TGF suppress or promote tumor formation 63 64 65 The tumor suppressive activity comes from TGF cancers arise 64 TGF suppression o f telomerase 66 67 As a tumor progresses, TGF tumorigenesis by i nducing epithelial to mesenchymal transition using Smad dependent and independent pathways 68 69 In carcinoma cells, invasiveness and metastasis in late stage tumorigene sis appears to require TGF 70 TGF production of VEGF, which promotes the formation of vasculature to the tumor 71 During wound healing, TGF and fibroblasts and contributes to the inflammatory phase of wound healing 59 72 In fibrotic tissues, TGF 73 74 75 76 77 amplify production of extracellular matrix components including fibronectin, type I collagen, integrins, laminin, a nd glycosaminoglycans 78 79 80 81 82 and inhibit protease activity, resulting in decreased extracellular matrix degradation 83 84 85 TGF decreased synthesis of MMPs and increased synthesis of tissue inhibitors of metalloproteinases (TIMPs) by fibroblasts. Rapid induction of both TGF

PAGE 26

26 was observed, but an increase in TGF 86 The TGF promoting system in the eye. Increased levels of TGF tears 87 was found in patients fo llowing PRK, and TGF 88 Ninety days following PRK ablation, levels of mRNA precursors for all three isoforms of TGF TGF 89 The addition of TGF 1 to bovine corneas after LASIK flap creation was able to increase the adhesion of the stromal flap but caus ed the cornea to become opaque 90 In hum an corneal fibroblast (HCF), concentrations of 0.1ng/ml or higher significantly reduced cell migration and increased myofibroblast differentiation 91 Jester et al 92 found that the topical application of a neutralizing antibody to TGF 1 reduced levels of corneal haze in rabbits following lamellar keratectomy. Thus, TGF ocular scar formation. Roles of CTGF Connective tissue growth factor (CTGF) is a 38kDa, single chain, cysteine rich protein that is secreted through the Golgi apparatus 93 As shown in Figure 1 2 the overall structure of CTGF can be grouped into three major segments: the N terminal domain, the hinge region, and the C termin al domain. Furthermore, the structures of the N terminal and C terminal domains can be separated into four modules that have conserved amino acid sequences that are similar to other protein in the CCN super family. The N terminal domain contains an insul in like growth factor (IGFBP) binding module that is predicted to bind IGF, a von Willebrand factor type C repeat, which has been i mplicated as a binding site for TGF 94 The C terminal domain contains a thrombospondin type 1 module that is likely involved

PAGE 27

27 in binding to sulfated glycoconjugates 95 and the CT module, which is similar to that found in TGF derived growth factor, and nerve growth factor and allows dimerization of these proteins 96 98 Although hCTGF is glycosylated, the function of this modification has yet to be determined 93 These glycosylation sites are absent from all other orthologs, which suggests that the conserved function among species are in dependent of carbohydrate modifications of the protein. The hCTGF gene map spans approximately 3 kb and is organized into five exons and four introns 100 101 elements, including a unique TGF response element 1 00 101 Previous studies demonstrated the CTGF mRNA expression and protein lev els were increased after treatment with TGF 102 103 104 CTGF has been imp licated in numerous biological activities, including stimulation of cell migration, proliferation, extracellular matrix synthesis, adhesion, survival, differentiation, and apoptosis 105 106 107 108 CTGF was originally identified as a mitogen for fibroblasts that was present in conditioned media derived from cultures from human umbilical vein endothelial cells 109 110 111 Recent data also showed that CTGF is a key chemokine in development. The mRNA expression pattern of CTGF suggests that CTGF continually functions in the cardiovascular system, bone and cartilage associated mesenchyme and maturing layer VII neurons, but CTGF also produces a more transient function associated with the formation of cartilage, bone, tooth and cerebral nerve cells 112 113 114 115 116 117 CTGF knockout animals have interesting pathologies, including a failure of the rib cage to ossify which was due to a failure of the embryo to produce a specific bone inducing matrix and a failure of the chondrocytes to

PAGE 28

28 proliferate 118 Thus, during chondrogenesis, CTGF is important for cell proliferation and matrix remodeling. The initial evidenc e for important actions of CTGF in wound healing was shown in a study of cutaneous wound repair by Igarashi et al. 119 They fou nd CTGF mRNA was expressed in wounded skin but was absent in unwounded skin. Since that discovery, CTGF has been shown to dramatically increase synthesis of collagen, integrin, and fibronectin, when added to cultures of human skin fibroblasts, and to be h ighly elevated in biopsies and samples of numerous fibrotic human tissues, including lung, kidney and skin. In mice, subcutaneous injection of CTGF stimulates fibrosis and granulation 111 In addition, e xpression of CTGF increased significantly during corneal wound healing, and CTGF mediated the effect of TGF induction of collagen synthesis by corneal fibroblasts 104 Proteolytic processing of CTGF was first reported from Brigstock et al. 120 in pig uterine flushings. Since this discovery, 10 12 16 18 19 20 ,24 and 31 kDa fragments have been identified in d ifferent cell types, tissues and body fluids 121 122 123 124 125 115, 126 A 31 kDa fragment was found when HCF were grown on collagen coated plates and stimulated with TGF 1 126 In vivo the proteases that cleave CTGF and their cleavage sites are currently unknown. In vitro testing has shown that MMP 1, 3, 7, and 13 are able to cleave CTGF into smaller fragments, but none of these have been shown to cleave CTGF in v ivo. 127 Most recently, a family of serine proteases, the Kallikrein related peptidases, have been shown to be able to proteolytically process the CCN protein family members. Specifically, KLK12 and KLK14 were able to process CTGF into lower molecular weight forms 128

PAGE 29

29 Grotendorst and Duncan 129 found that the two individual domains of CTGF stimulate opposing biological functions, proliferation and differentiation. They used a baculovir us system to express either an N terminal (20 kDa) or a C terminal (18kDa) proteins, which were then added to fibroblast cultures. They found that the C terminal fragment increased DNA synthesis, whereas the N terminal fragment had no effect on DNA synthe sis. In contrast, N terminal fragment increased differentiation of fibroblasts to myofibroblasts, but the C terminal had no effect on myofibroblast induction 129 Thus, the N terminal and C terminal fragments had distinct and mutually opposing effects on cells, either stimulating proliferation (C terminal) or stimulating differentiation (N terminal). In the first clinical study to determine that the CTGF fragments induce different biological functions, Dziadzio et al. 130 found that the N terminal fragment of CTGF serves as a fibrotic marker for patients t hat have scleroderma. U nderstanding what regulates the proteolytic processing of 38 kDa CTGF are important unanswered questions of the CTGF biological system Proteolytic processing of protein precursors to generate multiple proteins with different biolo gical activities has been shown for several neuropeptides. For example, proopiomelanocortin precursor (POMC) can be proteolytically processed into three different endocrine hormones. Cleavage of POMC precursor in the anterior pituitary generates adrenal corticotrophin hormone (ACTH), which is the major hormone involved in regulation of steroid production. In the intermediate lobe of the pituitary, POMC is proteolytically cleaved into melanocyte stimulating hormones ( MSH), which regulates skin pigmen tation and appetite, and endorphin, which is involved in regulation of pain relief 112 Thus, proteolytic processing of proteins into multiple domains

PAGE 30

30 that have dramatically different biological effects (often mutually exclusive) is a well established biological phenomenon that adds another level of regulating cell response. Reduction of Corneal Scar Formation Scarring of the corneal may be due to many factors such as trauma, infection, and surgical procedures. Currently, no drugs are approved by the FDA with the clinical claim (or intended use) to reduce corneal scarring. After p hotorefractive keratectomy, the anti inflammato ry corticosteroid, dexamethasone, is often prescribed with the intent to reduce the formation of corneal haze. However, in a randomized, double blind clinical study, topical use of dexamethasone was found to have no significant reduction of corneal haze a fter three months of treatment 131 Mitomycin C is a nonspecific anticancer drug that is often used interoperatively to reduce corneal haze. The ra tionale for using mitomycin C relies on its potent cytostatic effects that arise from blocking DNA and RNA replication and protein synthesis. Although this treatment has been shown to reduce corneal fibrosis after glaucoma surgery, pterygia excision, trea tment of conjunctival and corneal intraepithelial neoplasia, it also may have some very damaging side effects. These side effects may include epithelial defects, stromal melting, and endothelial damage 132 133 Late side effect of mitomycin C have been reported, with some occurring as late as five years after treatment 134 Netto et al 135 reported that treatment of rabbit corneas following PRK with mitomycin C caused a 20% decrease in cel lularity of the anterior stroma at one month after PRK, which continued for the 6 months duration of the study. In a 6 month study of patients receiving PRK Nassiri et al found the postoperative prophylactic use of diluted intraoperative mitomycin C 0.0 2% solution caused substantial (9% decrease) corneal endothelial cell loss and the rate of cell loss was correlated with the duration of mitomycin C exposure 136 As previously

PAGE 31

31 mentioned, the endothelial cells migrate and enlarge to compensate for cell death, and the loss of cells decreases the ability of the endothelial cells to maintain homeostasis in the stroma due to a loss of ion pumps. Stromal swelling and opacity are some of the side effects of a loss of homeostasis between the stroma and endothelium. Further long term stu dies are necessary to determine the effects of mitomycin C on corneal wound healing. In summary, there is a major unmet clinical need for a drug treatment that can safely and consistently reduce the risk of vision degrading corneal scarring after refracti ve surgery or after other types of corneal injuries. Gene Therapy The lack of an effective anti scarring drug that does not also have potentially serious side effects justifies the development of drugs that specifically target either or both TGF at the molecular level. The utility of using a nucleic acid to modulate gene expression was first demonstrated by Paterson et al approximately 30 years ago 137 Multiple strategies have arisen to attenuate gene expression by interfering with cytosolic mRNA or translated protein. RNA interference (RNAi) uses nucleic acids to modulate gene expression. RNAi, a double stranded mRNA able to degrade a target mRNA, was first described in Caenorhadbitis elegans in 1998 by Andrew 138 and Craig Mello. The RNAi pathway begins with exogenous double stranded RNA (dsRNA) being processed by the RNAse III family member Dicer into small interfering RNA (siRNA) molecules that are 20 25 nucleotides long 139 The resulting siRNA is incorporated into the multi protein complex called RNA induced silencing complex (RISC). The incorporation of the siRNA into the RISC complex causes the sense strand of the double stranded siRNA to be cleaved 140 Once the sense strand is cleaved, the siRNA recognizes mRNAs with sequence

PAGE 32

32 complementarity 141 The target mRNA is then cleaved by a protein, Argonaute 2, within the RISC complex (Figure 1 3A ) This allows for silencing of the gene wi th sequence homology to the siRNA. Although siRNA is a relatively recent discovery, numerous in vitro and in vivo studies have been performed to assess the potential viability of RNAi as treatment. Several RNAi therapies have been tested in clinical trial s. Currently in Phase II clinical trials, ALN RSV01 developed by Alnylam Pharmaceuticals Inc. uses an siRNA that targets the nucleocapsid encoding gene of the respiratory syncytial virus and therefore inhibits viral replication in the lungs Another siR NA based treatment, Bevasiramb which was developed by Acuity Pharmaceuticals, targeted VEGF in treatment of age r elated macular degeneration 142 Bevasiramb reached Phase III clinical trial but the trials were discontinued in 2009 because the results were unlikely to meet their end point goal. Ribozymes are another method to selectively target genes to therapeutically reduce the gene expression. H ammerhead ribozymes are small self cleaving RNAs fewer than 40 nucleotides long and consists of two substrate binding arms and a conserved catalytic core which cleaves the site specific target mRNA 143 144 145 Ribozymes hybridize to a complementary target sequence, cleave a site specific substrate and release the cleavage product (Figure 1 3B ) A hammerhead ribozym e cleaves best after a NUX triplet where N can be any ribonucleotide, and X can be any ribonucleotide except guanosine (typically GUC, CUC or UUC) 146 It has been shown hammerhead ribozymes use Mg 2+ in a direct role during catalysis of the target mRNA 147 The chemical cleavage step is rapid. However, the rate limiting step is the release step,

PAGE 33

33 which can be accelerated if the hybridization arms of the ri bozyme are relatively short (five to six nucleotides) 146 Clinically, ribozymes have been explored in multiple small trials. Heptazyme TM untranslated region of hepatitis C virus and was found to inhibit viral replication up to 90% in cell culture 148 Phase I and II clinical trials of Heptazyme TM showed promise, but unfortunately, toxicological concerns were raised and the study was suspended 149 Several clinical trials utilizing ribozymes against HIV, specifically targeting the CD4+ T cells or CD34+ hematopoietic cells, have been completed or are underway 15 0 151 154 These trials have established the safety and feasibility of ribozyme based therapy, but, unfortunately, they have not been able to show an advantage for the protected cells. These clinical trials suggest th at ribozymes are an effective way to specifically reduce target gene expression in vitro and in vivo Ribozymes are excellent candidates for a gene therapy technique that targets TGF or CTGF because they exhibit site specific cleavage of target RNA. They also are catalytic, allowing ribozymes to rapidly cleave multiple copies of the target RNA, thereby requiring lower concentrations. Ribozymes are able to target both nuclear and cytoplasmic RNAs and also can discriminate against single base polymorphisms 155 A major obstacle to overcome when using ribozymes is that naked RNA has a half life of seconds in bodily fluids following injections or topical applications. Therefore, application of naked RNA ribozymes is not practical in vivo There are several techniques that may be used to overcome this obstacle. Modifying the nucleotides, stabilizes the ribozyme, increasing the half life from minutes to hours yet does not

PAGE 34

34 severely compromise the catalytic activity 156 Another way to circumvent the short half life of a ribozyme is to transduce cells with the gene encoding a ribozyme using a viral vector, which will continuously generate new ribozyme molecules in the cell. This is an approach we have taken as described in more detail in the Methods and Results sections. The use of siRNA hold s great promise as a therapeutic treatment to target both TGF and CTGF beca use siRNAs tend to be effective at low concentrations 155 and can specifically target those genes. A major concern about the use of both siRNA and ribozymes is the possibility of off target, non sequence specific effects. Recent data sugges t that the majority of experimentally verified off target effects are due to the matching of an off target mRNA to the 6 7 nucleotides in the so the siRNA 157 158 In contrast, ribozymes are much more sensitive to polymorphisms at the cleavage site (though relatively less so in the hybridizing arms, depending upon position) and have been used for discriminating between single nucleotide po lymorphisms 159 Two other major concerns facing the use o f siRNAs or ribozymes in vivo are tissue specificity and the ability to withstand degradation by nucleases. The use of viral vectors expressing the siRNA or ribozyme can overcome these issues. Rapid expression of one or both of these types silencing RNA is a key component of our strategy to reduce the formation of corneal fibrosis. The process of wound healing begins as soon as the injury occurs. Therefore, it is paramount to have the knockdown of TGF

PAGE 35

35 Adeno associated Viral Vectors Adeno associated virus (AAV) is a a non pathogenic, non enveloped, single stranded, parvovirus. The DNA genome of AAV is 4.7 kb and contains two main open reading frames, rep and cap that are sandwiched between 145 base long inverted termin 160 The rep gene encodes for four different proteins, two of which, rep68 and rep78 are required for viral DNA replication and transcriptional regulation 161 Wild type AAV is able to integrate into the host genome on chromosome 19; this is mediated by both r ep40 and rep52 proteins 161 The cap gene encodes for three viral capsid proteins, VP1, VP2, and VP3. Recently, the cap gene was discovered to encode a short reading frame designated AAP that is required for the assembly of capsids 162 Wild type AAV replication depends on the presence of co infection with either adenovirus or herpes simplex virus. The mechanism by which AAV2 enters the cells is by binding to cell surface heparin sulfate proteoglycans (HSPGs) as its primary receptor and uses integrin, v 5, or basic fibroblast growth factor as co receptors for internalization and endocytosis 163 164 165 AAV2 has the capacity to infect a broad range of cells, because most cells express HSPGs. Other serotypes of AAV lack HSPG binding sites on their capsids and bind to other cel l surface receptors. The virus particles are released from the endosome at a low pH 166 167 The released single stranded DNA is converted to a double stranded template by host machinery. Recombinant AAV (rAAV) is made by replacing the rep and cap genes with the gene of interest. In order to avoid contamination with wild type adenovirus, a helper virus free method is used to produce rAAV. This method entails cloning E4 and E2A genes from adenovirus into an adeno virus helper plasmid. This plasmid along with an

PAGE 36

36 AAV helper plasmid containi ng the rep and cap genes and a viral vector containing the gene of interest surrounded by the AAV terminal repeat elements are all transfected into HEK293 cells. The cell line provides the E1 protein which is another adenoviral protein essential for AAV replication 168 169 AAV is capable of infecting both dividing and non dividing cells and can produce long term gene expression. Mohan et al 170 showed selective in vivo gene delivery into rabbit keratocytes using rAAV with a lamellar flap technique. They compared the e xpression of two different genes galatosidase and chloramphenicol acetyltransferase using two different delivery techniques, plasmid transfection and AAV. They concluded from this study that rAAV is capable of delivering foreign genes into the cornea in vivo and the potency and duratio n of the transgene expression was greater using the AAV vector compared to a transfected plasmid. Finally, they found that rAAV was safe in the cornea, as no toxicity was noted. Liu et al found that rAAV1 transduce all cell types of the cornea and produ ced the most robust expression of GFP compared to AAV 2, 5, 7, and 8 171 Self complementary AAV (scAAV) uses the same vi ral capsid and proteins but during replication scAAV generates a double stranded DNA template by intramolecular base pairing as the result of a deletion to terminal resolutions sites from one terminal repeat (TR). Palindromic TRs serve as primers for host cell mediated synthesis of a dsDNA template that induces gene expression from the single stranded genome of the rAAV. scAAV have been shown to have a faster onset of gene expression because the scAAV DNA is transcribed rapidly 172 173 In the retina, scAAV expressing GFP had quicker expression (2 days) when compared to the rAAV (5 days) 173 In addition,

PAGE 37

37 scAAV generally have higher transduction efficiency than conventional rAAV vectors 174 For all these reasons we chose to construct scAAV expressing ribozymes targeting TGF 1 and CTGF and assess the effectiveness in reducing target gene expression in cell cultures and in animal models of corneal scarring

PAGE 38

38 Fig ure 1 1 The Three Cellular Layers and Two Interfaces of the Cornea. The epithelium is the outer most corneal layer (green) which allows for diffusion of basement membrane like zone in bet ween the epithelium and stroma. The stroma is the middle cornea cellular layer (purple) that contains mainly a true basement membrane between the stroma and endothelium The endothel ium is the inner most corneal layer (blue) that contains a single layer of cells that regulate corneal hydration. (unpublished Blalock)

PAGE 39

39 Figure 1 2 Demonstrates the Different CTGF Protein Modules and Domains of CTGF IGFB insulin like growth factor binding protein like module; VWC von Willebrand factor type C repeat module; TSP1 thrombospondin type 1 repeat module, and C terminal cystine knot module.

PAGE 40

40 Fig ure 1 3. Schematic Diagram Illustrating the Degradation of Target RNA by a Ribozyme and siRNA 175 (A ) Model for d egradation by the RNAi pathway. Double stranded RNA is cleaved by the endoribonuclease Dicer into siRNA, which is then recognized and unwound by RNA induced silencing complex ( RISC ) The complementary strand of siRNA is delivered to its target RNA by RIS C. The hybridized region of target RNA is then endonucleolytically cleaved by Argonaute 2 1 75 (B) Model for direct degradation of target RNA by a ribozyme 175 A) B)

PAGE 41

41 CH APTER 2 MATERIALS AND METHOD S Antibody Sensitivity and Detection Sources of Growth Factors and Antibodies Recombinant human (rh)CTGF was prepared by the Grotendorst laboratory using a baculovirus expression system 111 Antibodies were either purchased from US Biological ( Swampscott, MA ) and Santa Cruz Biotechnology (Santa Cruz CA) or produced from the University of Florida ICBR Monoclonal Core (Table 2 1). Donkey anti rabbit, donkey anti goat and donkey anti mouse secondary antibodies labeled with an infrared dye were purchased from Li cor Biosciences(Lincoln, NE) Strepavid in labeled with an infrared dye was also purchased from Li cor Biosciences. SDS PAGE and Western Blots Sensitivity of the different antibody detection during western blot was measured by making serial dilutions of the rhCTGF from 150 ng/well to 0 ng/well. The sample volume of the rhCTGF was 6.5ul. NuPAGE LDS sample buffer (Invitrogen, Carlsbad, CA) and NuPAGE reducing agent were added to the sample, 2.5ul and 1ul respectively. LDS c an be prepared by combining the following: 4.3 M Glycerol, 0.6 M Tris Base, 0.4 M Tris HCl, 0.3 M LDS, 2 mM EDTA, 0.075% of Serva Blue G250, 0. 0 25% of Phenol Red in ultrapure water. Samples were then boiled for 3 minutes. Samples were applied directly to 12% NuPAGE bis Tris gels (Invitrogen, Carlsbad, CA) To detect CTGF, gels were blotted onto polyvinylidene difluoride (PVDF) membranes using iBlot transfer system (Invitrogen) overnight at roo m temperature while shaking in Odyssey Blocking Buffer ( Li cor Biosciences ) Blots were incubated with primary antibody for 2 hours while shaking at

PAGE 42

42 room temperature. Antibodies were used at concentrations of 1.0ug IgG/ml for the US Biological and Santa Cruz polyclonal antibodies and 5.0ug IgG/ml for Hinge Region, C terminal and N terminal monoclonal antibodies in Odyssey Blocking Buffer containing 0.1% Tween 20 (Fisher Scientific Pittsburg, PA). Blots were then washed 4 times with 0.1% Tween 20 in phos phate buffered saline (PBS) for 5 minutes at room temperature while shaking. PBS can be made by combining the following: 0.2 M NaCl, 3 mM KCl, 12.6 mM Na 2 HPO 4 2 mM KH 2 PO 4 in 800ml ultrapure water an d adjusted to a pH 7.4. Blots were incubated for 2 hour s in infrared labeled secondary antibody from Li cor Biosciences diluted 1:10000 in Odyssey Blocking Buffer with 0.2% Tween 20 and 0.01% SDS. Blots were then washed 4 times with 0.1% Tween 20 in PBS for 5 minutes at room temperature while shaking. Band detection was performed using the Odyssey Infrared Imaging System (Li cor Biosciences). C terminal monoclonal and hinge region monoclonals antibodies were tested for specificity by using CTGF knockout and heterozygous CTGF mice embryo homogenates obtained from Dr. Leask CTGF Time Course from Human Corneal Fibroblasts Stimulated with TGF 1 Human Corneal Fibroblast Cell Culture Cultures of human corneal fibroblasts (HCF) were established by outgrowth from corneal explants as described previously 176 Briefly, epithelial and endothelial cells were removed from corneas, the stroma was cut into cubes of approximately 1 mm 3 placed in culture medium consisting of equal parts Dulbecco's Modif ied Eagle Medium (DMEM), with 4.5g/L Glucose and 1g/L L glutamine (Gibco BRL, Grand Island, NY ) Medium was supplemented with 10% heat inactivated normal calf serum and 1

PAGE 43

43 antibiotic antimycotic (Gibco BRL ). Cell s from cultures between passages 2 and 5 were used for all experiments. TGF 1 Stimulation of CTGF To stimulate the expression CTGF HCF were place in serum free medi um for 48 hours. After 48 hours, the medium was replaced by 5ng /ml of TGF 1 (Sigma, St. Louis, MO) in DMEM. At various time points (0, 1, 6, 12, 18, 24, 48 and 72 hrs) protein samples were collected from the medium and a protease inhibitor cocktail ( cocktail III from Calbiochem, Darmstadt, Germany) and 0.5mM EDTA were added to the medium Cell lysates were co llected with the addition of PBS supplemented with 0.1% Triton X 100 and the previously mentioned protease inhibitors cocktail. Samples were concentrated down using Centriprep Centrifugal Filter Unit with Ultracel 10 membrane (Millipore, Billerica, MA ). Concentrated m edia and extracts were stored at 20 o C until further analysis. Three biological replicates were performed per time point. SDS PAGE and Western Blots Polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS PAGE) wa s performed as described above. Detection for CTGF was performed as described above with the US Biological polyclonal antibody The intensity of each band was determined using the area under the curve function in the ImageJ software (U.S. National Instit ute of Health) A recombinant CTGF standard (concentration of 300 ng) was run on each gel, and the band intensity produced by that rCTGF was used to normalize the different western blots. The relative band intensities were compared for statistical signifi

PAGE 44

44 hoc using GraphPad Prism (GraphPad, La Jolla, CA ). A p value of <0.05 was considered significant Immunoprecipitation and Identification of 21kDa CTGF Band Immunoprecipitation of CTGF was conducted using Direct Immunoprecipitation Kit (Thermo Scientific Rockford, IL ). Briefly, the US Biological polyclonal antibody was coupled to AminoLink Plus Coupling Resin aliquots of same sample were a pplie d over the column to purify the CTGF from the cell culture extract. The five elutions were combined and then were concentrated using DNA 110 Speed Vac ( Thermo Scientific ) The concentrated immunoprecipited CTGF samples were rehydrated in 35ul of dH 2 O. T he sample was run on SDS PAGE as previously described. Silver staining was performed using SilverQuest Silver Stain (Invitrogen) specifically chosen because it was compatible with ma ss spectroscopy. The 38 and 21 kDa bands were cut out of the gel and then they were destained following ( Norristown, PA ) to perform tandem mass spectroscopy ( NanoLC MS/MS) Identification of the Protease Class that Cleaves CTGF from HCF Extracts To stimulate the expression CTGF and proteolysis HCF were place in serum free medi um for 48 hours. After 48 hours, the medium was replaced by 10 ng /ml of TGF in DMEM for 24 hours. Medium was removed and discard ed The HCF were r inse d three times with PBS The HCF were then scrap ed off the flask and collected in 1.5ml PBS. The collected cells were pelleted by centrifugation at 14,000 rpm for 10 minutes. Supe rnatant was collected and pellet was s olubilize d 0.1% TritonX 100 Stock concentrations of the following protease inhibitors were made as follows :

PAGE 45

45 AEBSF(100mM in water ), Aprotinin (80uM in water ), Bestatin (5mM in DMSO ), E 64 (1.5mM in DMSO ), Leupeptin ( 2mM in water ), EDTA (0.5M in water ) and Pepstatin (1mM in DMSO ). The proteases inhibitors were diluted to the above concentration to model the concentrations used in the protease inhibitor cocktail ( cocktail III) from Calbiochem When the assay was perfo rmed these stock solutions were diluted 1:1000. Recombinant CTGF (US Biological, Swampscott, MA ) was combined with the supernatant and incubated for 0 or 1 hour at 37 o C. Proteolysis was stopped by the addition of a protease inhibitor cocktail (Calbiochem ) and 0.5mM EDTA SDS PAGE and western was performed as previously described. Band detection was performed using the Odyssey Infrared Imaging System Band intensity was determined using the area under the curve function from ImageJ software (U.S. National Institute of Health) A recombinant CTGF standard (concentration of 300 ng) was run on each gel and the band intensity produced by that rCTGF was u sed to normalize the different western blots. Three biological replicates were performed. The relative band intensities were compared using student t test using GraphPad Prism A p value of <0.05 was considered significant The differences between the 0 hour and 1 hour of the normalized band intensities were assessed. Then the differences from different treatment groups were compared to the untreated by using student t test using GraphPad Prism A p value of <0.05 was considered significant CTGF Proteolytic Processing In Vivo Mouse, Rat, and Rabbit Eye Homogenates Frozen whole mouse, rat, and rabbit eyes were purchased from Pel Freeze Biologicals (Rogers, AR). Ten mouse eyes were frozen in liquid nitrogen and combined into a steel piston homogenizer. The eyes were shattered by the force placed on the

PAGE 46

46 piston. The eye homogenates were c ol lected by placing 0.1% Triton X 100 in PBS and a protease inhibitor cocktail III and 0.5 mM EDTA to the homogenizer and collecting all of the sample. Samples were centrifuged at 4000 rpm for 10 minutes to extract any pieces of tissue that were not homoge nized. Each species had 10 different eyes homogenized together to produce whole eye homogenates. The eye structures (cornea, retina, iris, sclerea, lens and vitreous) of the rabbit eye were individually dissected out of the eye. Ten of each of the eye s tructures were processed as described above. SDS PAGE and Western Blots of Whole Eye Homogenates SDS PAGE was performed as described above. To detect CTGF, gels were blotted onto polyvinylidene difluoride (PVDF) membranes using iBlot transfer system (I nvitrogen) room temperature while shaking in Odyssey Blocking buffer Blots were incubated with primary antibody, biotinylated US Biological rabbit anti CTGFfor 2 hours while shak ing at room temperature. The biotinylated antibody was used because the Li Cor secondary antibodies had been shown to have some off target secondary binding when working with animal samples. The biotinylated US Biological rabbit anti CTGF, biotinylated h inge region monoclonal, and biotinylated C terminal monoclonal were diluted to a concentration of 10ug/ml in Odyssey Blocking Buffer containing 0.1% Tween 20. Blots were then washed 4 times with 0.1% Tween 20in PBS for 5 minutes at room temperature while shaking. Blots were incubated for 20 minutes in infrare d labeled streptavidin diluted 1 : 5 ,000 in Odyssey Blocking Buffer with 0.2% Tween 20 and 0.01% SDS. Blots were then washed 4 times with 0.1% Tween 20 in PBS for 5 minutes

PAGE 47

47 at room temperature while sh aking. Band detection was performed using the Odyssey Infrared Imaging System. Rapid Amplification of cDNA Ends of Mouse and Rat RNA Total RNA was extracted from mouse and rat whole eyes using the RNA Bee Reagent (Tel INC, Lake Forest, CA) following and was performed by Liya Pi The mRNA was purified from the total RNA by using the RACE was performed using the SMARTer RACE cDNA Amplifica tion Kit ( Clonetech, Mountain View, CA) follows : Mouse CTGF 5' race primer: 5' GGC TTG GCA ATT TTA GGC GTC CGG AT 3' and Rat CTGF 5' race primer: 5' GGC TTG GCG ATT TTA GGT GTC CGG AT 3' Ba nds were identified on a 1% agarose gel. Rat Corneal Ablation Adult male Sprague Dawley rats were used for this study and the procedure was performed in accordance to the animal care guidelines published by the Institute for Laboratory Animal Research (Guide for the Care and Use of Laboratory Animals) 178 Using the technique that we previously described 104 p recise, reproducible, central corneal ablations were created in rat corneas using a Nidek EC 5000 Eximer laser (Nidek, Fremont, CA). Briefly, ra t s were anesthetized with isofluorane/oxygen inhalation, proparacaine eye drops were applied to achieve local anesthesia of corneas, and both eyes of each rat were ablated to a depth of 80 with creating a 4.4mm diameter central epithelium to stroma injury The ablation conditions were specifically designed to remove all of the corneal epithelial cell layers and some of the stroma to simulate PRK. B oth eyes of each rat were ablated The animals were sacrificed at 0, 1,

PAGE 48

48 6, 12, 18, 24 hours and 4, 7, 11, and 21 days after ablation. F our rat corneas per time point were col lected. A t the various time points after excimer laser ablation, the animals were euthanized, and the corneas were then excised. Corneas were homogenized using 1mL gla ss homogenizers in 0.1 % Triton X 100 in PBS and a protease inhibitor cocktail III and 0.5mM EDTA was added to each sample. SDS PAGE and western analysis were performed as described above. Each band intensity was determine d by using the area under the curve function in ImageJ s oftware (U.S. National Institute of Health) A recombinant CTGF standard (concentration of 300 ng) was run on each gel, and the band intensity produced by that rCTGF was used to normalize the separate western blots. The relative band intensities were compa red for statistical significance hoc using GraphPad Prism A p value of <0.05 was considered significant In vitro Analysis of siRNA s Production of Secreted Alkaline Phosphatase Target Expression Plasmid We have previously reported using the sec reted alkaline phosphatase (sAP) reporter system to test a ribozyme 177 The sAP reporter gene driven by an hEF1 HTLV p romoter was cloned into pBluescript and contained a multiple cloning site located upstream of the sAP reporter gene (Figure 2 1 ). Six siRNAs targeting rat TGF 1 and five siRNAs targeting rat CTGF were purchased from Ambion (Ambion, Carlsbad, CA) (Table 2 2) A target sequence, approximately 300 bp or less, containing the siRNA target sequence was cloned into a Nco I and Nsi I restriction site down stream of the sAP reporter gene. Sanger sequencing by UF Core was performed to confirm the insertion of the cor rectly oriented 300bp target sequence.

PAGE 49

49 Human Embryon ic Kidney 293 Cell Culture and Transfection of a Plasmid and siRNA Dulbecco's Modified Eagle Medium (DMEM), with 4.5g/L Glucose and 1g/L L was supplemented with 10% heat inactivated normal calf serum an d an antibiotic antimycotic and e xponentially growing human embryonic kidney 293 (HEK 293) cells were transfected with both the pBluescript sAP target plasmid and either an off target siRNA or a targeted siRNA. Turbofect reagent (Fermentas Inc.; Glen Burnie,MD, USA) was used for the dual transfection following the manufacturer s protocol. The concentration of the pBluescript sAP plasmid was held constant but three different concentrations of each siRNA (8, 20, and 40 nM) were tested. At three differe nt time points (24, 48 and 72 hours) after transfection, level of secreted alkaline phosphatase sAP activity was assessed using a colorometric assay, Quanti Blue TM (InvivoGen, San Diego, CA, USA ). Activity level s of the siRNAs were expressed as relative e xpression of secreted alkaline phosphatase compared to a off target controls siRNA Three replicates were performed for each time point and concentration of siRNA. Relative secreted alkaline phosphatase expression levels were analyzed for statistical si gnificance by student t test using Graphpad. A p value of <0.05 was considered significant In vitro Analysis of scAAV Ribozyme Vectors scAAV TGF 1 Rz Plasmids Construction Single stranded synthetic DNA oligonucleotides encoding ribozymes were chemicall y synthesized. The sequences were, TGF 1 Rz sense: G ATGAGTCC TGF 1 Rz anti sense: T C Table 2 3) Underlined

PAGE 50

50 The active and inactive ribozymes were annealed into scAAV plasmid backbone (Figure 2 2) using the SpeI and HindIII restriction sites. Ligated scAAV TGF 1 Active Rz and scA AV TGF 1 inactive Rz vector s were transform ed into E. coli (Agilent Technologies, Inc, Santa Clara, CA) The plasmid DNA was extracted from single colonies and t he correct orientation of the insertion w as verified by DNA sequencing by the Uni versity of Florida sequencing core To assure that the TRs were still in the vector, the vector was digested with SmaI and then run on a 0.6% agarose gel. scAAV CTGF Rz Plasmids Construction The scAAV CTGF Rz was cloned into the scAAV vector as described above. The sequences were, CTGF sense: 5 AGCTTGTCTGCT G CTAG TTTCGCGCCGAAGCGCT C ATCAGCAGACAAGCT plasmid. Human E mbryonic Kidney 293 Cell Culture and Dual Transfection Dulbecco's Modified Eagle Medium (DMEM), with 4.5g/L Glucose and 1g/L L was supplemented with 10% heat inactivated normal calf serum and an antibiotic antimycotic mixture and e xponentially growing H EK293 cells were transfected with both t he pBluscript sAP target plasmid and either a GFP control or the active or inactive ribozyme plasmid. Turbofect reagent was used for the dual transfection following the A ratio of 1:1 of th e plasmids (ribozyme vector: target vector) was transfected, and three (24, 48 and 72 hours) time points were assessed. Activity

PAGE 51

51 level of the ribozymes in the scAAV vectors were expressed as relative expression of secreted alkaline phosphatase compared to a control GFP plasmid. Three replicates were performed for each time point. Relative secreted alkaline phosphatase expression levels were analyzed for statistical significance by hoc using Graphpad A p value of <0.05 was cons idered significant. In vivo Analysis of scAAV GFP in Rabbit Corneas After Ablation Delivery of scAAV GFP to Rabbit Corneas The delivery efficiency of the green fluorescent protein (GFP) transgene packaged in scAAV serotype 1 was tested in live rabbit corneas. Adult male New Zealand white rabbits were used for this study and the procedure was performed in accordance to the animal care guidelines published by the Institute for Laboratory Animal Resea rch (Guide for the Care and Use of Laboratory Animals) 178 Briefly, rabbits were anesthetized with isofluorane/oxygen inhalation, proparacaine eye drops were applied to achieve local anesthesia of corneas, and both eyes of each rabbit were ablated to a depth of 125 with a Nidek EC 5000 Eximer las er(Nidek, Fremont, CA) creating a 6.0 mm diameter central epithelium to stroma injury. The ablation conditions were specifically designed to remove all of the corneal epithelial cell layers and some of the stroma to simulate PRK. The ablated areas of both eyes of each rabbit were exposed for 2 min with 60ul of 1x10 1 0 virus particles per milliliter applied on the cornea in phosphate buffered saline in a 10 mm diameter vacuum trephine. The animals w ere sacrificed at 0, 1, 2, 3, 4 7, 30 days and 6 months aft er vector application. Four rabbit corneas per time point were treated with scAAV. At the various time points after excimer laser ablation and transduction by the scAAV vector, the animals were euthanized, and the corneas were then excised.

PAGE 52

52 Direct Fluor escence Microscopy The corneas were fix ed overnight in 4 % paraformaldehyde After overnight fixation, the cornea s were bisected and the tissue was embedded in Tissue Tek OCT Compound (Sakura Finetek, Torrance, CA) and frozen by dipping into liquid nitroge n. Tissue sectioning was performed with a Leica CM 1850 cryostat(Leica, Buffalo Grove, IL) and 10 scope slides (Fisher Scientific ) for image analysis. Nucleic acids were stained with DAPI (Vector Laboratori es, Burlingame, CA) and direct GFP fluorescence (no immunostaining) in the corneal sections were analyzed by confocal microscopy (Leica TCS SP2 AOBS Spectral Confocal Microscope equipped with LCS Version 2.61, Build 1537 software). All images were taken wi th identical exposure settings with either 10 or 20 objective Image Analysis Images were analyzed using Optimas (Adept Turnkey, Sydney, Australia) Imaging software. A threshold for a positive cell was selected and all of the images were analyzed for that threshold of fluorescence. Each tissue section was analyzed by outlining the tissue and looking for threshold fluorescence. The area for fluores cence was expressed in percent area of total tissue. After averaging the score from images of each treatment, all samples were normalized to the time point with the highest expression being considered 100%. Levels of immunostaining determined by the Opt imas Imaging software were analyzed for statistical significance by ANOVA followed hoc (p<0.05) compared to 0 hour by using GraphPad prism.

PAGE 53

53 In vivo Analysis of scAAV CTGF Active Rz i n Rat Corneas After Ablation Rat Corneal Ablation and sc AAV CTGF Active Rz Delivery The rat corneal ablation was performed as previously described. The scAAV CTGF Active Rz vector was packed into AAV serotype 1. Five animals (2 eyes per animal) were ablated. After the ablation, the control eye was treated w ith 5 ul of PBS for two minutes and the experimental eye was treated with 5 ul of scAAV CTGF Active Rz at a concentration of 1 x 10 10 virus particles/ml. After 14 days, the animals were euthanized, and the corneas were then excised. Corneas were homogeni zed using 1mL gla ss homogenizers in 0.1% Triton X 100 in PBS and a protease inhibitor cocktail plus 0.5 mM EDTA was added to each sample. Total protein concentration was determined using the Bradford Assay (Bio Rad Laboratory Inc., Hercules, CA) and CTGF was determined by ELISA. C TGF Protein Concentration (ELISA) C TGF was measured in the conditioned medium of cul tured cells by capture sandwich ELISA as we reported previously. 104 Briefly, an ELISA plate was coated with rabbit anti human C TGF antibody (US Biological ) at a concentration of 2.0 g/mL in PBS overnight. Wells were washed four times with wash buffer (0.05% Tween 20 in PBS) an d incubated with blocking buffer (5% Tween 20 in PBS) for 1 hour at room temperature. The wells were washed four times with wash buffer. Then standard s ranging from 0 2000 ng/uL of CTGF or sample w ere added and incubated at room temperature for 2 hours. Af ter washing, biotinylated rabbit anti CTGF at a concentration of 300 ng/mL was added and incubated at room temperature in the dark for 2 hours; then washed with wash buffer, and streptavidin horseradish peroxidase was added and incubated at room temperatu re for 20 minutes. The wells were washed again and

PAGE 54

54 incubated with substrate solution (1:1 mixture of H 2 O 2 and tetramethylbenzidine). Absorbance at 405 nm was measured with a microplate reader. CTGF expression was expressed as CTGF protein to total protei n. CTGF expression was analyzed for statistical significance by comparing the sc AAV CTGF Rz to the PBS controls by using student t test using GraphPad Prism A p value of <0.05 was considered significant

PAGE 55

55 Table 2 1 Primary Antibodies Supplier Catalogue # Clone Host Immugen Target US Biological C7978 25C Polyclonal Rabbit Full length rCTGF Santa Cruz CTGF (L 20): sc 14939 Polyclonal Goat Human Internal Region ICBR Core 9 54 A7 Monoclonal Mouse Hinge region (181 197) ICBR Core 11 39 1 Monoclonal Mouse C terminus (247 260) ICBR Core 17 73 F1 Monoclonal Mouse N terminus (81 94) ? 181 197 247 260 81 94

PAGE 56

56 Figure 2 1 Scheme of secreted alkaline phosphatase plasmid before the target gene is added.

PAGE 57

57 Table 2 2 Rat siRNAs Target Gene siRNA # siRNA Target Sequence TGF 1 siRNA 90 gcaacaacgcaatctatg siRNA 88 ggagagccctggataccaa siRNA 41 gcaacacguagaacucua siRNA 92 ggagacggaauacagggcu siRNA 86 ggcuaccaugccacuuc siRNA 70 gguccuugcccucuacaac CTGF siRNA 36 ggcaaaaagtgcatccgga siRNA 37 cgggttaccaatgacaat siRNA 54 gggacacgaacucauuuag siRNA 56 cgaacucauuuagacuaua siRNA 83 gcgagaucaugaaaaagaa

PAGE 58

58 Table 2 3 Ribozymes Ribozyme Target Sequence Homolgy Ribozyme Sequence CTGF CC T GG T CCAGAC Mouse Active AGCTTGTCTGCT G ATGAGCGCTTCGGCGCGAAACCAGGA Rat Rabbit Inactive AGCTTGTCTGCT C ATGAGCGCTTCGGCGCGAAACCAGGA Human TGF 1 T CC T G T CCAAAC Mouse Active AGCTTGTTTGCT G ATGAGTCCTTCGGGACGAAACACTAGT Rat Rabbit Inactive AGCTTGTTTGCT C ATGAGTCCTTCGGGACGAAACACTAGT Human

PAGE 59

59 Fi gure 2 2 Scheme of scAAV vector before the ribozyme is added. scAAV vector

PAGE 60

60 CHAPTER 3 ROLE OF PROTEOLYTIC PROCESSING OF CTGF THROUGHOUT WOUND HEALING Corneal Scar Formation Corneal scarring is a major cause of haze and impaired vision. After corneal trauma, stromal scarring is the result a complex cascade of multiple growth factors, cytokines, chemokines, and proteases. Immediately after epithelial damage, the process of healing is initiated by multiple cytokines and growth factors, including interleukin 1 (IL 1), tumor necr and 4 (BMP2, BMP4), epidermal growth factor (EGF), platelet derived growth factor (PDGF), transforming growth factor beta(TGF and connective tissue growth factor (CTGF) 19 11 The TGF system has been established as a key scar promoting growth factor system 179 180 CTGF, a 38 kDa cy steine rich cytokine, is a down stream mediator of the fibrotic action of TGF The expression level of CTGF was found to be elevated in rat corneas after ablation 104 Connective Tissue Growth Factor The structure of CTGF is similar to other CCN proteins in that it contains a C terminal domain, Hinge region and N terminal domain. The N terminal domain contains two modules; the insulin like growth factor (IGFBP) binding module that is predicted to bind IGF, and the von Willebrand factor type C repeat, which has been i mplicated as a binding site for TGF 93 Within the C terminal domain, there are two modules; a thrombospondin type 1 module that is likely involved in binding to sulfated glyco conjugates 95 and the CT module, which is similar to that found in TGF platelet derived growth factor, and nerve growth factor and allows

PAGE 61

61 dimerization of these proteins 96 99 CTGF has been found in several fragmented forms in several different cell types, tissues and body fluids 121 122 123 124 125 115, 126 We hypothesize th at there will be fragmentation of CTGF in both the in vitro and in vivo corneal wound healing models. We also analyze unwounded whole eye homogenates. We further hypothesize that we will be able to elucidate the class of protease that cleaves CTGF in vit ro Results Antibody Sensitivity and Detection Sensitivity of each antibody was determined by running a standard curve of the recombinant CTGF protein. The polyclonal antibodies, Santa Cruz and US Biological had the greatest level of detection at 18.25 ng and 23 ng, respectively, of total CTGF protein. In respect to the mono clonal antibody detection, the h inge region antibody had the greatest level of detection at 50 ng of total CTGF protein, whereas, the C terminal and N terminal antibodies had the lowest level of detection at 100 ng of total CTGF protein (Figure 3 1). When the C termin al monoclonal antibody and the h inge region monoclonal antibodies probed heterozygous CTGF mice homogenates and homozygous CTGF knockout mice homogenates, they detect ed a 38 kDa band in only the heterozygous CTGF mice homogenates. Neither monoclonal detected a band at 38 kDa for the homozygous CTGF knockout mice homogenates. TGF 1 Stimulation of CTGF in HCF After the antibodies were tested on recombinant CTGF prot ein for sensitivity and specificity, a time course of CTGF expression from HCF after stimulation with TGF 1 was performed. HCF cells were serum starved for 48 hours and then stimulated with TGF 1. At 0, 1, 6, 12, 18, 24, 48, and 72 hours the media and cell extract were

PAGE 62

62 collected and analyzed by western blotting In the cell extracts (Fig ure 3 2 ) the full length (38 kDa) CTGF protein was detected at all time points from 0 hours to 72 hours with only a slight increase peaking at 18 hours. At 18 hours t here was 1.6 times more full length (38 kDa) CTGF than at 0 hour and was the difference not statistically significant. A 21 kDa CTGF fragment was detected 1 hour post stimulation and peaked 12 hours. The 21 kDa CTGF fragment was statistically significan tly different (p<0.05) when compared to 0, 1, and 72 hours, with the 12 hour being 37 times greater than the 0 hour time point. At 72 hours after stimulation, the detection level of the 21 kDa fragment returned to the 0 hour level. Finally, two other frag ments, 18 kDa and 13 kDa CTGF fragments were detected throughout the treatment times, 0 hours to 72 hours. There was statistically significant change in intensity of these two bands due to the cells being treated with TGF 1. Therefore, I conclude that th ese fragments are not produced in response to the addition of TGF 1 CTGF is a secreted protein, therefore, the conditioned media from the HCF stimulated with TGF 1 were analyzed (Figure 3 3). The full length (38 kDa) fragment protein was initially det ected at 6 hours and peaked at 24 hours post stimulation. When compared to 0 and 1 hours there was a least 1 7.9 times more full length (38 kDa) CTGF at 24 hours post stimulation (p<0.05). The 21 kDa CTGF fragment was also detected in the conditioned med ia. The 21 kDa CTGF fragment was detected 6 hours post stimulation and peak at 24 hours. When compared to 0, 1, 6 and 72 hours there was a least 10.3 times more 21 kDa fragment of CTGF at 24 hours post stimulation (p<0.05) which was a statistically signif icantly differ ence (p<0.05). The normalized band intensity of the 21 kDa fragment returned to that of the 0 hour time point at 72 hours.

PAGE 63

63 Finally, an unexpected 50 kDa band was detected in the conditioned media. The greatest detection occurred at the 0 time point and it was at least 2.6 fold higher than any of the other time points(p<0.05). Immunoprecipitation and Identification of the 21 k Da CTGF Fragment from HCF The CTGF from the 24 hour cell extract was purified by immunoprecipitation using the US Biological polyclonal antibody. The sample was analyzed by silv er stain and western. The full length (38kDa) and 21 kDa fragment were dete cted. The 21 kDa band was identified as CTGF by the sequence, LEDTFGPDPTMIR, using tandem mass spectrometry (Figure 3 4). Identification of the Protease Class that Cleaves CTGF from HCF Extracts In order to determine the protease class that cleaves CTGF from the 38 kDa full lengt h form into the 21 kDa fragment in HCF, a processing assay was conducted. HCF extracts were incubated with rCTGF for 0 or 1 hours with different protease inhibitors and the samples were analyzed by western blot (Fig ure 3 5 ). The only protease inhibitor that was able to inhibit the processi ng of CTGF from the 38 kDa full length for m into the 21 kDa fragment was p epstatin, an aspartic acid protease inhibitor. There was no difference in normalize d band intensity between the 0 a nd 1 hour time points (p =0.32 ). AEBSF, Aprotinin, Bestatin, E 64, Leupeptin, and EDTA were unable to inhibit the processing of full length (38 kDa) CTGF into the 21 kDa CTGF fragment when comparing the normalized band intensity of the 0 hour time point t o the 1 hour time point (p<0.05). Also, when the difference in the normalized band intensities of the untreated is compared individually to each treatment group, the group treated with pepstatin was significantly reduced (p<0.05).

PAGE 64

64 Identification of a 21 kDa CTGF Fragment in Unwounded Rat, Rabbit, and Mouse Whole Eye Homogenates To determine if the 21kDa fragment was unique to the HCF culture system, rabbit, rat, and mouse whole eyes were homogenized and analyze d by western blotting using three different antibodies. The US Biological polyclonal, hinge region monoclonal, and C terminal monoclonal all detected a 25 kDa and 21 kDa fragment in rabbit, rat and mouse unwounded whole eye homogenates (Fig ure 3 6 ). Interestingly, there was little 38 kDa full lengt h CTGF detected in any of homogenates from rats, rabbits or mice The 150 kDa and 75 kDa bands were due to the streptavidin label Licor dye binding off target. Identification of a 21 kDa CTGF Fragment in Individual Eye Structures in the Rabbit Eye To ana lyze what structure(s) in the eye was producing the 21 kDa CTGF fragment, rabbit eyes were dissected into individual eye structures (cornea, retina, iris, sclerea, lens and vitreous) and homogenized then analyzed by western blot. The cornea, retina, iris, sclerea, lens and vitreous all contained the 21 kDa band and the 25 kDa band (Fig ure 3 7 ). These 21 kDa and 25 kDa bands were identified by both the US Biological polyclonal and the C terminal monoclonal antibodies. The lens had at least 5 times as mor e 21 kDa CTGF fragment than any of the other structures because 6 ug of total protein from the lens were added as opposed to 30 ug of total protein from the other structures. To determine if the 21 kDa and 25 kDa CTGF fragments were not attributed to an rat RNA (Figure 3 8). The only PCR product that was produced was 791 bp

PAGE 65

65 corresponding to full length CTGF. No other bands were detected. Therefore, I conclude that only major RNA start site exists and that the smaller immune reactive proteins are the result of proteolytic processing. Immunoprecipitation and Identification of the 21 kDa CTGF Fragment from Rabbit Whole Eye Homogenates The CTGF from the rabbit whole eye homogenates was purified by immunoprecipitation using the hinge monoclonal antibody. The sample was analyzed by silver stain (Figure 3 9) and coomassie blue staining. The 25 kDa and 21 kDa CTGF fr agments were detected These fragments were sent for analysis by mass spectrometry. We were unable to identify this fragment as CTGF using tandem mass spectrometry. Detection of CTGF Throughout Corneal Wound Healing in Rats A time course of CTGF througho ut corneal wound healing in rats was performed by ablating normal rat corneas and collecting the corneas at 0, 1, 6, 12, 18, 24 hours and 3, 7, 11, 14 and 21 days (Figure 3 10). The homogenates of the rat corneas wer e analyzed by western blot. L ow level s of full length CTGF (38kDa) were detected throughout the wound healing process from 0 hours to 21 days. The normalized band intensity from day 11 post ablation was 1.6 times greater than the 0 hour time point. The lowest normalized band intensity from the 38 kDa full length CTGF occurred at 12 hours post ablation and was 3.7 times less than the day 11 time point. As previously men tioned, a 25 kDa CTGF fragment wa s detected in uninjured cornea. The greatest normalized band intensity for the 25 kDa CTGF fragment occurred 11 days post ablation and was 2.5 times(p<0.05) greater than the 0 hour time point. The 25 kDa

PAGE 66

66 CTGF fragment normalized band intensity at 11 days post ablation was 22.9 times greater than the 12 hour time point which had the lowest band intensity of the 25 kDa CTGF fragment(p<0.0001). A 21 kDa CTGF fragment was detected at the 0 hour time point and the peak level of detection occurred 11 days post ablation. The normalized band density of the 21 kDa CTGF fragment from day 11 was 32.5 ti mes greater than the 12 hour time point (p=0.0051). There were two other bands detected, 18 kDa and 13 kDa, but their signal was not very strong and they did not vary significantly throughout the wound healing process. Discussion In this study, we confir med the presence of several CTGF fragments (21, 18, and 13 kDa fragments) produced in HCF cultures stimulated with TGF 1. We found that the greatest amount of the 21kDa was found at 12 hours and 24 hours in the cell extract and media, respectively. The 18 kDa fragment and the 13 kDa fragments that were found in the cell extract did not have a significant change in concentration throughout the time course. We unexpectedly found a 50 kDa immunoreactive band that was not due to non specific binding of the secondary antibody. Steffen et al 125 found in human foreskin fibroblast, there was little to no CTGF found in the conditioned media. They also determined that the full length 38 kDa CTGF remained cell associated for at least 5 days after synthesis. This 50 kDa immunoreactive band could be from the CTGF still being associated with some extracellular matrix components. Several studies have shown pr ocessing of CTGF into fragments 115, 121 126, 181 Most recently, Tall et al 126 analyzed fragmentation patterns of CTGF from HCF grown on different extracellular matrix components (collagen, fibronectin, and vitronectin).

PAGE 67

67 They found a novel 31 kDa CTGF frag ment that lacked the N termin us when cells were grown on collagen. Since our experiments were preformed in plastic cell culture vials that were not treated with collagen, we did not see this same fragmentation pattern. Previously, Ball et al 121 looked at the presence of CTGF fragments during estrous and pregnancy in porcine uterine flushes. They found that in porcine uterine flushes there were four fragm ents present : 20, 18, 16 and 10 kDa. The full length CTGF as well as the processed forms of CTGF were in higher abundance at d ay 12 of pre gnancy than day 12 of the cycle. These authors were able to perform N terminal sequencing of the 20, 18, and 16 kDa fragments found in uterine flushings. They found that their 20 kDa fragment was processed at Asp 186 In a later paper, Ball et al 181 were able to model the processing of CTGF in utero and identified the processing site of the 20 kDa fragment as being Ala 181 Using tandem mass spectrometry, we identified our 21 kDa fragment from Leu 184 Arg 196 this area is located in the hinge re gion of CTGF. Once the 21 kDa fragment from the HCF culture system was identified, we chose to identify the class of protease that cleaves CTGF in this HCF model. In this study, we were able to identify that a pepstatin sensitive protease from HCF cell e xtracts was able to process rCTGF into the 21 kDa fragment. Previously, in vitro testing has shown that MMP 1, 3, 7, and 13 are able to cleave CTGF into smaller fragments when CTGF was associated with VEGF 127 Kallikrein related peptidases, which are secreted serine proteases, specifically, KLK12 and KLK14, have been show to process CTGF into smaller fragments 128 The MMP and Kallikrein related peptidases were identified by incubating only the enzyme and substrate together at their optimal conditions. While this could be indicative of the protease in some biological systems,

PAGE 68

68 we were ab le to identify the protease class that cleaves CTGF in our HCF system as an aspartic acid protease Further investigation is necessary to identify exactly which aspartic acid protease is responsible for cleaving CTGF but renin, cathepsin D and L have all been localized to the cornea 182 183 Interestingly, the level of ca thepsin D increased in severe burns of the anterior segment of the eye after three weeks 184 These findings lead us to evaluate the presence of CTGF in whole eye homogenates of mouse, rat and rabbit. In whole eye homogenates of mouse, rat and rabbit, we found that the 21 kDa fragment was present in the highest abundance and this fragment wa s identified as containing the C terminal domain of CTGF. We also found that a 25 kDa fragment was present and identified by the C terminal domain in mouse, rat and rabbit whole eye homogenates. The 75 kDa and 150 kDa bands were found to be due to non spe cific binding of the strepavidin conjugated Licor dye. We also examined CTGF expression in the individual eye structures in the rabbit. Once again, we found that the 21 kDa fragment was the pre dominant form of CTGF in all the structures and this 21 kDa fragment was identified by the C terminal monoclonal antibody. The lens produces this 21 kDa fragment in abundance because 6 times less total protein was loaded to the gel and there was a distinct band. CTGF expression in the lens was first documented ov er twenty years ago by Lee et al 185 but there has been very little published since then. Lee et al. analyzed the expression of CTGF mRNA from epithelial cells of patients with anterior polar cataracts. They found an increase d level of CTGF mRNA in patients who had anterior polar catar acts compared to patients who did not have anterior polar cataracts. In our study, t he 25 kDa fragment was also present in all of the individual eye structures as identified by the C terminal monoclonal antibody.

PAGE 69

69 Similarly, Ball et al. 121 found that the lower molecular weight fragments were the dominant form of CTGF in pig uterine flushings. CCNs 1, 3, and 4 have been show to have alternate splicing 186 We were able to determine that the lower molecular weight bands were not due to an alternate start site Harding et al 187 also found that there were no altern ate start site for CTGF in pig endometrium. Finally, we performed a time course looking at the protein expression and processing of CTGF during wound healing in the rat cornea after ablation. While Blalock et al 104 had previously analyzed the total concentration of CTGF protein using ELISA in the corneas of wounded rats we are the first to report the processing of CTGF during several time points in wounded rat corneas. Similar to the findings of Blalock et al 104 we found that during the first eighteen hours pos t wounding, there was very low levels of all forms of CTGF. The peak expression of all three forms of CTGF (38 kDa, 25 kDa, and 21 kDa) was at day 11 post ablation. One to two weeks after injury myofibroblast appear in the anterior stroma 36 CTGF has been shown to stimulate differentiation of cells into myofibroblast 105 Our data, taken with these two pieces of knowledge would indicate that the abundance of the 38 kDa, 25 kDa and 21 kDa fragments at day 11 play a role in corneal scar formation. From our data, the significance the proteolytic processing of CTGF throughout wound healing is not yet clear but we can hypothesize the role of the processing. Grotendorst et al 129 found that the C terminal fragment increased DNA synthesis, whereas the N terminal fragment had no effect on DNA synthesis. In contrast, N termina l fragment increased

PAGE 70

7 0 differentiation of fibroblasts to myofibroblasts, but the C terminal had no effect on myofibroblast induction. In summary, these data confirmed the presence of a 21 kDa CTGF fragment produced in HCF cultures stimulated with TGF 1. Results from studies using protease inhibitors determined that pepstatin was the only protease inhibitor able to reduce the processing of the full length (38 kDa) CTGF into the 21 kDa fragment, which indicates that the aspartic acid class of proteases is r esponsible for the cleavage in the HCF cultures. A 21 kDa fragment wa s found in the highest abundance in whole eye homogenates and this fragment was identified as containing the C terminal domain of CTGF. These data als o indicate the 21 kDa fragment wa s the dominant form of CTGF found in the whole eye homogenates and individual eye structure homogenates. These fragments were not the product of alternative start sites or splicing. And finally, the highest abundance of all forms of CTGF occurred at day 1 1 post wound healing.

PAGE 71

71 Figure 3 1. Detection of rCTGF using several different antibodies. Santa Cruz polyclonal, US Biological polyclonal, hinge region monoclonal, C terminal monoclonal, and N terminal monoclonal were all tested for sensitivity using a rCTGF. Specificity of the hinge region monoclonal and C terminal monoclonal were tested by analyzing the ability of the antibody to detect CTGF in heterozygous (+/ ) and homozygous ( / ) mouse tissue homogenates.

PAGE 72

72 B Figure 3 2 Western blot analysis of cell extracts from HCF cells stimulated with TGF 1 A) S hows a typical western blot of the time course was performed to look at expression of lower molecular weight forms of CTGF using the US Biological polyclonal antibody B) Q uantification of individual CTGF bands (38 kDa, 21 kDa, 18 kDa, and 13 kDa) were perform ed from replicate blots (n=3). Variation between blots were normalized by comparing each band to a rCTGF standard. Band intensities were compared by analysis of var ian ce hoc test with significance is indicated by a (p<0.05).

PAGE 73

73 B Figure 3 3 Western blot analysis of conditioned media from HCF cells stimulated with TGF 1. A) Shows a typical western blot of the time course was performed to look at expression of lower molecular weight forms of CTGF using the US Biological polyclonal antibody. B) Quantification of individual CTGF bands (38 kDa, 21 kDa, 18 kDa, and 13 kDa) were performed from replicate blots (n=3). Variation betwe en blots were normalized by comparing each band to a rCTGF standard. Band intensities were compared by analysis of var iance hoc test with significance of 0.01
PAGE 74

74 Figure 3 4 Western blot analysis of immunoprecipitated CTGF from HCF cells stimulated with TGF 1. The 21 kDa fragment (highlighted in the red box) was identified as CTGF from the LEDTFGPDPTMIR sequence located in the hinge region of CTGF. US Biological Column

PAGE 75

75

PAGE 76

76 C Figure 3 5 Western blot analysis of in vitro processing of CTGF into the 21 kDa fragment. A) Briefly, rCTGF was incubated for 0 or 1 hour with the HCF cell extract that was stimulated with TGF 1. To assess inhibition of processing, the rCTGF protein and cell extract was incubated with different pr otease inhibitors (Aprotinin, Bestatin, E64, EDTA, Leupeptin, AEBSF or Pepstatin) or no protease inhibitor. B) Relative quantification of the 0 hour and 1 hour time points of the 21 kDa band for ea ch protease inhibitor are shown. Band intensities were comp ared by student t test with significance of 0.01
PAGE 77

77 Figure 3 6 Western blot analysis of in vivo CTGF from unwounded rabbit, rat and mouse whole eye homogenates. Three different antibodies were used to detect the CTGF. The US B iological polyclonal antibody, the hinge region monoclonal antibody and the C terminal monoclonal antibody all had similar banding patterns identifying a 21 kDa and 25 kDa band. The upper molecular weight bands (75 kDa and 150 kDa) were due to off target bind of the strepavidin label ed Licor dye.

PAGE 78

78 Figure 3 7 Western blot analysis of in vivo CTGF from unwounded rabbit eye structures(cornea, retina, iris, sclaera, lens and vitreous). Two different antibodies were used to detect the CTGF. The US Biolo gical polyclonal antibody and the C terminal monoclonal antibody all had similar banding patterns identifying a 21 kDa and 25 kDa band in all tissue. The upper molecular weight bands (75 kDa and 150 kDa) were due to off target bind of the strepavidin lab e l ed Licor dye. Indicates that 5 times less total protein from the lens was loaded in the well.

PAGE 79

79 Figure 3 8 Analysis of transcriptional start sites of the CTGF RNA in adult mouse and full length transcript is 791bp.

PAGE 80

80 Figure 3 9 Silver stain analysis of a rabbit whole eye homogenates elution from an affinity column containing the hinge region monoclonal antibody.

PAGE 81

81 B

PAGE 82

82 Figure 3 10 Western blot analysis of CTG F throughout a time course of wound healing after ablation from rat corneal homogenates. A) Shows a typical western blot of the time course was performed to look at expression of lower molecular weight forms of CTGF using the US Biological polyclonal antibody. B) Quan tification of individual CTGF bands (38 kDa, 25kDa and 21 kDa) were performed from re plicate blots (n=4). Variation between blots were normalized by comparing each band to a rCTGF standard. The upper molecular weight band (75 kDa) w as due to off target bi nd of the strepavidin lab el ed Licor dye. Band intensities were compared by analysis of variance hoc test with significance of 0.01
PAGE 83

83 CHAPTER 4 DEVLEOPMENT OF A THERAPEUTIC GENE S ILENCING TECHNIQUE UTILIZING RIBOZYMES AND RNA I IN A SELF COMPLEM ENTARY ADENO ASSOCIATED VIRAL V ECTOR Reduction of Scar Formation There currently are no approved drugs that selectively reduce th e expression of genes causing corneal scarring and haze. Scarring of the cornea can be due to many factors such as trauma, infection and surgical p rocedures. Mitomycin C is a nonspecific anticancer drug that is used during some ocular surgeries to reduce scarring. Although this treatment has been shown to reduce fibrosis after other ocular treatments, it also may have very damaging side effects. These side effects can include epithelial defects, stromal melting, endothelial damage, and conjunctival thin ning 132 133 Thus, there is a need for an effective anti scarring drug that specifically targets fibrotic genes like TGF specific serious side effects that threaten vision. Gene Therapy Hammerhead ribozymes are small, self cleaving RNAs that contain a conserved catalytic core that cleaves the a specific targeted mRNA 188 143 144 siRNAs are another very common gene silencing technology. siRNAs are double stranded RNA mol ecules that are 19 25 nucleotides long 139 and are incorporated into the multi protein complex called the RNA Induced Silencing Complex or RISC. Within the R ISC complex, the sense s trand of the siRNA is degraded 140 Once the sense strand is cleaved, the siRNA recognizes mRNAs by sequence complementarity 141 The target mRNA is then cle aved which allows for silencing of the gene We used an adeno associated virus (AAV) vector, that allows with only a single application, delivery of these gene silencing techniques to the cornea AAV is a single stranded DNA virus that non pathogenic.

PAGE 84

84 Wild type virus integrates into chromosome 19 of the host genome 161 The recombinant AAV lacks the rep gene necessary for this integration, as well as the cap gene that encodes for the viral capsid proteins. The recombinant virus is made by replacing the rep and cap genes with the gene of interest drive n by a promoter sequence. Rapid expression of either a ribozyme or a siRNA, is a key component to reduce th e formation of corneal fibrosis because the initiation of wound healing is immediate after an injury. Self complementary AAV ( scAAV ) which is doub le stranded, has been shown to have a faster onset of gene expression because the scAAV DNA is transcribed into RNA rapidly 172 173 In addition, scAAV generally ha s higher transduction efficiency than conventional rAAV vectors 189 In this study, we investigate d the use of gene silencing tech nologies, ribozymes and siRNAs that target these profibrotic transcripts We hypothesized that we would be able to identify at least two siRNAs for each rat TGF or CTGF that had a relative knockdown of at least 50% using a secreted alkaline phosphatase reporter assay. We next hypothesized the ribozymes targeting either TG F or CTGF would have a significant knockdown when compared to the control vector. The scAAV should have a fast onset; therefore, we suspected that after 2 days GFP expression would be detected in the epithelial and stromal cells of the cornea. Finally we believed we would see a knockdown of CTGF protein after treating an ablated rat cornea with scAAV CTGF Active Rz. In vitro Analysis of Gene Silencing Techniques

PAGE 85

85 Using

PAGE 86

86 Analysis of siRNAs targeting rat CTG F Using the Secreted Alkaline Phosphatase Assay

PAGE 87

87

PAGE 88

88 Delivery of scAAV GFP to Rabbi t Corneas In order to determine the ability of a scAAV to infect the cornea, a scAAV expressing GFP was applied to the rabbit cornea after ablation. At several time points, 0, 1, 2, 3, 4 7, 30 and 6 months, the animals were scarified and corneas were fix ed and sectioned. Direct GFP fluorescence was analyzed by confocal microscopy (Figure 4 5). The GFP fluorescence was first detected 24 hours after application and the peak fluorescence detected occurred at 7 days. Day 7 fluorescence was 22 times greater than day 0 (p<0.05) Level of the fluorescence from 6 months w as unchanged from day 0 levels of fluorescence (Figure 4 6) The transgene was expressed in all cell types of the cornea: epithelium, keratocytes and endothelium (Figure 4 7) Delivery of s cAAV CTGF Active Rz to Rat Corneas after Ablation To determine the ability of the scAAV CTGF Active Rz to reduce CTGF in vivo we applied the scAAV CTGF Active Rz to the rat cornea after ablation. At 14 days the animals were scarified and corneas were homogenized. The CTGF concentration was determined using ELISA and was normalized by the total protein of the sample. After 14 days, the treated corneas had a significant knockdown (p<0.05) of 19% when compared to the PBS controls (Figure 4 8). Discus sion We previously showed the usefulness of using the sAP reporter assay to analyze knockdown by a CTGF ribozyme 177 Here, we were able to use the sA P reporter assay to identify 2 siRNAs that target either TGF 1 or CTGF by at least 50%. siRNAs 36 and siRNA 37 targeting CTGF showed the greatest relative knockdown of sAP at all time points (24, 48 and 72 hrs) and at all concentrations(8, 20, and 40 nM) Interestingly, some of the concentration of siRNAs 56 and 83 targeting CTGF had an increase in sAP

PAGE 89

89 when the control siRNA was added. Although the control siRNA was screen for complementarity to the target CTGF region, there may have been some off targe t antisense affects of the control siRNA reducing concentration of the sAP. For the siRNAs targeting TGF 1, siRNA 90 had the most significant knockdown at all time points ( 24, 48 and 72 hours) and at all concentrations (8, 20, and 40 nM). siRNA 70 had t he second greatest ability to target the TGF 1 sequence; it s significance was demonstrated at 24 hours for 20 and 40 nM and at 72 hours for 8, 20 and 40 nM. While this reporter system is not perfect, it allows for quick vetting of several siRNAs at diffe rent transfection time points and concentrations. We next used the sAP report assay to assess the relative knockdown of sAP due to the transfection of either the scAAV CTGF Active Rz vector or the scAAV TGF 1 Active Rz vector As previously mentioned, changing a single nucleotide in the catalytic core of the ribozyme will make it inactive. We also tested the inactive forms of these ribozymes (scAAV TGF 1 Inactive Rz and scAAV CTGF Inactive Rz) and a control plasmid that expressed GFP and not any form of ribozyme. For the ribozymes targeting TGF 1, we found that the scAAV TGF 1 Rz was able to statistically significantly reduce the relative sAP level at all time points (24 and 48 hours) by at least 22% when compared to the GFP control. At 48 hours, the scAAV TGF 1 Inactive Rz had an antisense quality of reducing the sAP relative expression compared to the GFP control. Even with this antisense quality, the scAAV TGF 1 Active Rz statistically significantly reduced the relative sAP expression by 13 % when compared to the scAAV TGF Active 1 Inactive Rz. For the ribozymes targeting CTGF, we found that the scAAV CTGF Active Rz was able to statistically significantly reduce the relative sAP level at all

PAGE 90

90 time points (24, 48 and 72 hours) by at least 9% when compared to the GFP control at 24 hours and a maximum of 30% at 72 hours. The scAAV CTGF Inactive Rz did not have an antisense quality. There have been several studies of gene targeting techniques t o target CTGF and TGF 1. The Schultz laboratory has shown the kinetic abilities and in vitro knockdown of endogenous mRNA and protein of both the CTGF and the TGF 1 ribozymes 190 177 We took these ribozy mes and inserted them into a scAAV vector and tested this vector in the sAP reporter assay to confirm that the ability to selectively knockdown the target would not be lost if it was put into a scAAV vector. Jester et al 92 used antibodies targeting TGF 1 to inhibit corneal fibrosis. They found that the anti bodies reduced the expression of fibronectin. This targeted method has not been pursued for two reasons : multiple doses of the antibody needed to be delivered and re epitheliazation of the cornea (which occurs within days of injury) may block the antibody et al. 191 were able to use siRNAs targeting CTGF to reduce the expression levels of fibronectin in corneal epithelium cells. These experiments were only preformed in vitro and not in vivo Chen et al. used a pyrrole imidazole polyamide to target the a ctivator protein 1 binding site of TGF 1 in a rat alkali burn model. They found that inhibition of this promoter site for TGF 1 by the pyrrole imidazole polyamide reduced the haze in the cornea. These data suggest that by using either a ribozyme or a s iRNA targeting TGF 1 or CTGF, we may be able to reduce scar formation in the cornea after ablation. We next looked at the delivery of the scAAV to the cornea by using the scAAV GFP v irus AAV has been show n to be able to deliver a transgene to the cor nea more

PAGE 91

91 efficiently than the transfection of a plasmid 170 We found t he GFP fluorescence was first detected 24 hours after application and the peak fluorescence detected occurred at 7 days. Day 7 fluorescence was 22 ti mes greater than day 0. Levels of the fluorescence from day 180 were statistically the same as day 0 levels of fluorescence. The transgene was expressed in all cell types of the cornea: epithelium, keratocytes and endothelium. We used the AAV 1 serotyp e that was shown to have the greatest expression levels of the GFP transgene in all cells in the cornea 192 In the retina, it was found that scAAV transgene expre ssion was detected at 2 days after injection 173 We found initial expression of the GFP transgene as early as 24 hours after transduction We finally analyzed the scAAV CTGF Active Rz ability to knockdown CTGF the rat cornea after ablation. Fourteen days after ablation, we found that the rat corneas treated with the scAAV CTGF Active Rz had a significant knockdown of CTGF at 19% when compared to the c ontrol corneas. The rat ablation model does not exhibit a robust scar formation and therefore, this scAAV CTGF Active Rz needs to be tested in the rabbit corneal ablation model to analyze it ability to reduce haze. In summary, we were able to test two d ifferent gene silencing techniques (ribozymes and siRNAs) using the sAP reporter assay. Additi onally, we were able to analyze the ability of the scAAV to transduce the cornea. Finally, we were able to show that a scAAV CTGF Active Rz delivered to the corn ea after ablation could reduce the level of CTGF. These data taken together show promise for siRNAs and ribozymes to be used to reduce scar formation in the cornea after injury.

PAGE 92

92

PAGE 93

93 Figure 4 1 Analysis of six siRNAs targeting TGF 1 using a sAP reporter assay. All of the data is reported as relative knockdown compared to a scramble siRNA. Three different time points after transfection (24, 48 and 72 hrs) were analyzed along with three different concentrations of siRNA (8, 20, and 40 nM). Relative reduction of sAP from the control compared to the siRNA treated group were compared by student t test with significance o f 0.01
PAGE 94

94 Figure 4 2 Analysis of five siRNAs targeting CTGF using a sAP reporter assay. All of the data is reported as relative knockdown compared to a scramble d siRNA. Three different time points after transfection (24, 48 and 72 hrs) were analyzed along with three different concentrations of siRNA (8, 20, and 40 nM). Relative reduction of sAP from the control compared to the siRNA treated group were compared by student t test with significance o f 0.01
PAGE 95

95 indicated by *** In a few cases, the siRNA caused an increase in sAP and were statistically significant (0.01
PAGE 96

96 Figure 4 3 Analysis of scAAV TGF 1 Active Rz and scAAV TGF 1 Inactive Rz using a sAP reporter assay. All of the data is reported as relative knockdown compared to a scAAV GFP. Two different time points after transfection(24 and 48 hours) were analyzed. Relative reduction of sAP from the control compared to the ribozyme treat ed groups were compared by ANOVA with significance o f 0.01
PAGE 97

97 Figure 4 4 Analysis of scAAV CTGF Active Rz and scAAV CTGF Inactive Rz using a sAP reporter assay. All of the data is reported as re lative knockdown compared to a scAAV GFP. Two different time points after transfection(24 and 48 hours) were analyzed. Relative reduction of sAP from the control compared to the ribozyme treated groups were compared by ANOVA with significance o f 0.01
PAGE 98

98 Figure 4 5 Analysis of GFP expression in r abbit corneas treated with scAAV GFP after ablation using dire ct fluorescence microscopy

PAGE 99

99 Figure 4 6 Relative levels of GFP fluorescence in ra bbit corneas treated with scAAV GFP after ablation. Statistical significance indicated with a (p<0.05)

PAGE 100

100 A

PAGE 101

101 B Figure 4 7 Analysis of GFP expression in rabbit corneas treated with scAAV GFP after ablation using direct f luorescence microscopy. Specifically the A) epithelium and B) endothelium are pictured.

PAGE 102

102 Figure 4 8 Ratio of CTGF to total protein in rat c orneas treated with scAAV CTGF Active Rz or PBS control after ablation at day 14 Statistical significance indicated with a (p<0.05).

PAGE 103

103 CHAPTER 5 CONCLUSIONS AND FUTURE DIRECTIONS CTGF Proteolytic Processing The proteolytic processing of CTGF into smaller fragments has been well documented, including CTGF being processed in the HCF wo und healing model 126 While we confir med processing in the HCF wound healing model, we also gained a further understanding abou t the processing of CTGF by elucidating the class of protease that cleaves CTGF into the 21 kDa fragment in vitro ( Figure 3 5) We were able to identify that the protease was an aspartic acid protease. Our next aim will be to determine the specific prote ase that cleaves the CTGF in vivo In unwounded whole eye homogenates (Figure 3 6) and individual structures of the eye (Figure 3 7) we found that CTGF was present primarily as the 21 kDa and 25 kDa fragments. We hypothesize that this 21 kDa fragment is the same fragment that we found in the HCF wound healing model. We would be able to confirm that it is the same fragment by having both peptides (the in vitro and in vivo 21 kDa fragments) sequenced using Edman degradation. This w ould not only confirm that the 21 kDa fragment is the same, it w ould also identify where CTGF is proteolytically processed. We have sent some of the fragments for Edman degradation but the sequence was not properly identified, possibly because of a low concentration of the f ragment when compared to total protein of the sample If even at hi gh concentrations of the 21 kDa fragment, Edman degradation does not produce a CTGF sequence then the cleavage site could be determined by using a site directed mutagenesis assay By altering one amino acid at a time, we could identify which amino acid is necessary in order for CTGF to be proteolytically processed into the 21 kDa form.

PAGE 104

104 We were also able to follow the production of CTGF fragments throughout wound healing in r at corneas after ablation (Figure 3 10) We were able to see fragmentation in the unwounded cornea at day 0 and by day 11 there was an increase in all forms of CTGF (38 kDa, 25 kDa, and 21 kDa). We identified these fragments using the US Biological pol yclonal antibody that targets the whole CTGF peptide. Therefore, we are unable to make any conclusions as to which domains were present in the 21 kDa fragment throughout wound healing in the cornea Previously, the N terminal of CTGF was shown to be elev ated in scleroderma patients 130 We would also like to analyze the presence of the N terminal and C terminal fragments during wound healing. These findings will better define the role of the fragments of CTGF throughout wound healing in the cornea. We m ade tremendous progress in analyzing the proteolytic processing of CTGF in both the in vitro and in vivo corn eal wound healing models. These experiments demonstrate the abundance of t he processed CTGF 21 kDa form in the unwounded cornea and these findings parallel the findings from Brigstock 120 that showed the lower molecular weight fragment were the primary form in porcine uterine flushings. The se findings have great importance for the area of wound healing, not only in the cornea, but throughout the diff erent tissues in the body because CTGF is a major player in the wound healing cascade. It is necessary to identify the role of the fragmentation, in order to gain a better understanding of scar formation in all tissues. Reduction of Corneal Haze by Targe ting Profibrotic Growth Factors The TGF 1 system which includes CTGF as a down stream mediator of TGF 1, has been shown to play a key role in the formation of haze in the cornea.

PAGE 105

105 Therefore, attenuating the activity of these two profibrotic genes could help reduce scar formation. We were abl e to quickly and efficiently analyze two forms of gene silencing techniques (siRNAs and ribozymes) for their ability to target TGF 1 or CTGF using a sAP reporter assay. We had success in finding at least two siRNAs that targeted either TGF 1 or CTGF and the ribozymes were able to target and cleave the TGF 1 or CTGF sequence (Figure 4 1, Figure 4 2, Figure 4 3, and Figure 4 4) Since naked mRNA has a short half life an alternate strategy for delivery of these ge ne silencing techniques is necessary. Encoding these gene silencing techniques in a scAAV would circumvent the problem of half life. We found that when the cornea is transduced by scAAV GFP, there was expression of GFP in all the layers of the cornea and the initiation of the expression began within 24 hour (Figur e 4 5, Figure 4 6, and Figure 4 7) T hese findings produce a greater understanding of when and where the scAAV transgenes are expressed. Therefore, we could express an y number of small genes (not just ribozymes or siRNAs) in the cornea to evaluate their ability to influence corneal scar formation. Finally, w e were also able to analyze the ability of scAAV CTGF Active Rz to reduce CTGF protein in the rat corneas 14 days after ablation (Figure 4 8) Unfortunately, scar formation in the rat cornea after ablation is not robust. Therefore, we would like to apply this scAAV CTGF Active Rz to the rabbit cornea after ablation, which is a standard model for corneal wound healing. Th ese ribozymes and siRNAs could be used in several different tissues to reduce scar formation because t he mRNA sequences of CTGF or TGF 1 are the same all tissues

PAGE 106

106 We also would like to analyze the ability of the siRNAs to reduce scar formation in the rabbit model. The siRNAs could be expressed in a scAAV as a short hairpin RNA (shRNA) that would be processed into the siRNA within the cell. We also have experience with iontophoresis of anti sense oligos into the cornea, therefore, the siRNAs could als o be delivered to the cornea using iontohphoresis. These future experiments will help our understanding of the roles of TGF 1 and CTGF in corneal wound healing. These results indicate that targeting CTGF and TGF 1 using either a ribozyme or siRNA may h elp reduce scar formation in the cornea. In conclusion, these findings have made significant progress in understanding the processing of CTGF in corneal wound healing and developing a gene silencing technique to target profibrotic growth factors.

PAGE 107

107 LIST OF REFERENCES 1. Yamada,N., Yanai,R., Inui,M., & Nishida,T. Sensitizing effect of substance P on corneal epithelial migration induced by IGF 1, fibronectin, or interleukin 6. Invest Ophthalmol. Vis. Sci. 46 833 839 (2005). 2. Chaudhuri,A., Hallett,P.E., & Parker,J.A. Aspheric curvatures, refractive indices and chromatic aberration for the rat eye. Vision Res. 23 1351 1363 (1983). 3. Choi,D.M., Thompson Jr,R.W., & Price Jr,F.W. Incisional refractive surgery Curr. Opin. Ophthalmol. 13 237 241 (2002). 4. Otori,T. Electrolyte content of the rabbit corneal stroma. Exp. Eye Res. 6 356 367 (1967). 5. Sawada,H., Konomi,H., & Nagai,Y. The basement membrane of bovine corneal endothelial cells in culture with beta aminopropionitrile: biosynthesis of hexagonal lattices composed of a 160 nm dumbbell shaped structure. Eur. J. Cell Biol. 35 226 234 (1984). 6. Grant,D.S. & Leblond,C.P. Immunogold quantitation of laminin, type IV collagen, and heparan sulf ate proteoglycan in a variety of basement membranes. J. Histochem. Cytochem. 36 271 283 (1988). 7. Fujikawa,L.S., Foster,C.S., Harrist,T.J., Lanigan,J.M., & Colvin,R.B. Fibronectin in healing rabbit corneal wounds. Lab Invest 45 120 129 (1981). 8. Noske,W., Levarlet,B., Kreusel,K.M., Fromm,M., & Hirsch,M. Tight junctions and paracellular permeability in cultured bovine corneal endothelial cells. Graefes Arch. Clin. Exp. Ophthalmol. 232 608 613 (1994). 9. Dawson,D.G., O'Brien,T.P., & Ed elhauser,H.F. Long term corneal keratocyte deficits after PRK and LASIK: in vivo evidence of stress induced premature cellular senescence. Am. J. Ophthalmol. 141 918 920 (2006). 10. Fischbarg,J. & Lim,J.J. Determination of the impedance locus of rabb it corneal endothelium. Biophys. J. 13 595 599 (1973). 11. Tuli,S., Goldstein,M., & Schultz,G.S. Modulation of Corneal Wound Healing in Cornea (eds. Krachmer,J.H., Mannis,J.M. & Holland,E.J.) 133 150 (Elsevier Mosby, Philadelphia, 2005). 12. Bar nes,S.D. & Azar,D.T. Laser subepithelial keratomileusis: not just another way to spell PRK. Int. Ophthalmol. Clin. 44 17 27 (2004).

PAGE 108

108 13. Taneri,S., Zieske,J.D., & Azar,D.T. Evolution, techniques, clinical outcomes, and pathophysiology of LASEK: review of the literature. Surv. Ophthalmol. 49 576 602 (2004). 14. Seiler,T. & McDonnell,P.J. Excimer laser photorefractive keratectomy. Surv. Ophthalmol. 40 89 118 (1995). 15. Alio,J.L. et al. Ten year follow up of photorefractive keratectomy for myopia of more than 6 diopters. Am. J. Ophthalmol. 145 37 45 (2008). 16. Carones,F., Fiore,T., & Brancato,R. Mechanical vs. alcohol epithelial removal during photorefractive keratectomy. J. Refr act. Surg. 15 556 562 (1999). 17. Shah,S., Sebai Sarhan,A.R., Doyle,S.J., Pillai,C.T., & Dua,H.S. The epithelial flap for photorefractive keratectomy. Br. J. Ophthalmol. 85 393 396 (2001). 18. Shahinian,L., Jr. Laser assisted subepithelial kera tectomy for low to high myopia and astigmatism. J. Cataract Refract. Surg. 28 1334 1342 (2002). 19. Netto,M.V. et al. Wound healing in the cornea: a review of refractive surgery complications and new prospects for therapy. Cornea 24 509 522 (2005). 20. Walker,M.B. & Wilson,S.E. Incidence and prevention of epithelial growth within the interface after laser in situ keratomileusis. Cornea 19 170 173 (2000). 21. Helena,M.C., Baerveldt,F., Kim,W.J., & Wilson,S.E. Keratocyte apoptosis after corn eal surgery. Invest Ophthalmol. Vis. Sci. 39 276 283 (1998). 22. Taneri,S., Feit,R., & Azar,D.T. Safety, efficacy, and stability indices of LASEK correction in moderate myopia and astigmatism. J. Cataract Refract. Surg. 30 2130 2137 (2004). 23. Nagano,T. et al. Stimulatory effect of pseudomonal elastase on collagen degradation by cultured keratocytes. Invest Ophthalmol. Vis. Sci. 42 1247 1253 (2001). 24. Chen,C.C., Chang,J.H., Lee,J.B., Javier,J., & Azar,D.T. Human corneal epithelial cell viability and morphology after dilute alcohol exposure. Invest Ophthalmol. Vis. Sci. 43 2593 2602 (2002). 25. Kim,S.Y., Sah,W.J., Lim,Y.W., & Hahn,T.W. Twenty percent alcohol toxicity on rabbit corneal epithelial cells: electron microscopic study. Co rnea 21 388 392 (2002). 26. Alio,J.L., Ortiz,D., Muftuoglu,O., & Garcia,M.J. Ten years after photorefractive keratectomy (PRK) and laser in situ keratomileusis (LASIK) for moderate to high myopia (control matched study). Br. J. Ophthalmol. 93 1313 1 318 (2009).

PAGE 109

109 27. Freathy,R.M. et al. Variants in ADCY5 and near CCNL1 are associated with fetal growth and birth weight. Nat. Genet. (2010). 28. Mohan,R.R. et al. Apoptosis in the cornea: further characterization of Fas/Fas ligand system. Exp. Eye Res. 65 575 589 (1997). 29. Mohan,R.R., Mohan,R.R., Kim,W.J., & Wilson,S.E. Modulation of TNF alpha induced apoptosis in corneal fibroblasts by transcription factor NF kappaB [In Process Citation]. Invest Ophthalmol. Vis. Sci. 41 1327 1336 (2000). 3 0. Mohan,R.R., Kim,W.J., Mohan,R.R., Chen,L., & Wilson,S.E. Bone morphogenic proteins 2 and 4 and their receptors in the adult human cornea. Invest Ophthalmol. Vis. Sci. 39 2626 2636 (1998). 31. Wilson,S.E., Chen,L., Mohan,R.R., Liang,Q., & Liu, J. Expression of HGF, KGF, EGF and receptor messenger RNAs following corneal epithelial wounding. Exp. Eye Res. 68 377 397 (1999). 32. Tuominen,I.S. et al. Human tear fluid PDGF BB, TNF alpha and TGF beta1 vs corneal haze and regeneration of corneal epithelium and subbasal nerve plexus after PRK. Exp. Eye Res. 72 631 641 (2001). 33. Jester,J.V., Huang,J., Petroll,W.M., & Cavanagh,H.D. TGFbeta induced myofibroblast differentiation of rabbit keratocytes requires synergistic TGFbeta, PDGF and integ rin signaling. Exp. Eye Res. 75 645 657 (2002). 34. Wilson,S.E., Liu,J.J., & Mohan,R.R. Stromal epithelial interactions in the cornea. Prog. Retin. Eye Res. 18 293 309 (1999). 35. Helena,M.C., Baerveldt,F., Kim,W.J., & Wilson,S.E. Keratocyte apoptosis after corneal surgery. Invest Ophthalmol. Vis. Sci. 39 276 283 (1998). 36. Wilson,S.E. et al. The wound healing response after laser in situ keratomileusis and photorefractive keratectomy: elusive control of biologic al variability and effect on custom laser vision correction. Arch. Ophthalmol. 119 889 896 (2001). 37. Netto,M.V. et al. Wound healing in the cornea: a review of refractive surgery complications and new prospects for therapy. Cornea 24 509 522 (2005 ). 38. Fini,M.E. Keratocyte and fibroblast phenotypes in the repairing cornea. Prog. Retin. Eye Res. 18 529 551 (1999). 39. Gan,L., Hamberg Nystrom,H., Fagerholm,P., & Van,S.G. Cellular proliferation and leukocyte infiltration in the rabbit corn ea after photorefractive keratectomy. Acta Ophthalmol. Scand. 79 488 492 (2001).

PAGE 110

110 40. Andresen,J.L. & Ehlers,N. Chemotaxis of human keratocytes is increased by platelet derived growth factor BB, epidermal growth factor, transforming growth factor alph a, acidic fibroblast growth factor, insulin like growth factor I, and transforming growth factor beta. Curr. Eye Res. 17 79 87 (1998). 41. Denk,P.O. & Knorr,M. The in vitro effect of platelet derived growth factor isoforms on the proliferation of bov ine corneal stromal fibroblasts depends on cell density. Graefes Arch. Clin. Exp. Ophthalmol. 235 530 534 (1997). 42. Musselmann,K., Kane,B.P., & Hassell,J.R. Isolation of a putative keratocyte activating factor from the corneal stroma. Exp. Eye Res. 77 273 279 (2003). 43. Wilson,S.E. et al. The wound healing response after laser in situ keratomileusis and photorefractive keratectomy: elusive control of biological variability and effect on custom laser vision correction. Arch. Ophthalmol. 119 8 89 896 (2001). 44. Woessner,J.F., Jr. Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J. 5 2145 2154 (1991). 45. McVicker,B.L. et al. The effect of ethanol on asialoglycoprotein receptor mediated phagocytosi s of apoptotic cells by rat hepatocytes. Hepatology 36 1478 1487 (2002). 46. Desmouliere,A., Geinoz,A., Gabbiani,F., & Gabbiani,G. Transforming growth factor beta 1 induces alpha smooth muscle actin expression in granulation tissue myofibroblasts and i n quiescent and growing cultured fibroblasts. J. Cell Biol. 122 103 111 (1993). 47. Jester,J.V., Barry,L.P., Cavanagh,H.D., & Petroll,W.M. Induction of alpha smooth muscle actin expression and myofibroblast transformation in cultured corneal keratocy tes. Cornea 15 505 516 (1996). 48. Chintala,S.K. et al. Matrix metalloproteinase gelatinase B (MMP 9) is associated with leaking glaucoma filtering blebs. Exp. Eye Res. 81 429 436 (2005). 49. Moller Pedersen,T., Li,H.F., Petroll,W.M., Cavanagh,H.D., & Jester,J.V. Confocal microscopic characterization of wound repair after photorefractive keratectomy. Invest Ophthalmol. Vis. Sci. 39 487 501 (1998). 50. Jester,J.V. et al. The cellular basis of corneal transparency: evidence for 'corneal crystallins'. J. Cell Sci. 112 ( Pt 5) 613 622 (1999). 51. Moller Pedersen,T. Keratocyte reflectivity and corneal haze. Exp. Eye Res. 78 553 560 (2004).

PAGE 111

111 52. Ivarsen,A., Laurberg,T., & Moller Peder sen,T. Characterisation of corneal fibrotic wound repair at the LASIK flap margin. Br. J. Ophthalmol. 87 1272 1278 (2003). 53. Piatigorsky,J. Review: A case for corneal crystallins. J. Ocul. Pharmacol. Ther. 16 173 180 (2000). 54. Annes,J.P., M unger,J.S., & Rifkin,D.B. Making sense of latent TGFbeta activation. J. Cell Sci. 116 217 224 (2003). 55. Taipale,J., Miyazono,K., Heldin,C.H., & Keski Oja,J. Latent transforming growth factor beta 1 associates to fibroblast extracellular matrix via latent TGF beta binding protein. J. Cell Biol. 124 171 181 (1994). 56. Schultz Cherry,S. & Murphy Ullrich,J.E. Thrombospondin causes activation of latent transforming growth factor beta secreted by endothelial cells by a novel mechanism. J. Cell Biol. 122 923 932 (1993). 57. Lyons,R.M., Keski Oja,J., & Moses,H.L. Proteolytic activation of latent transforming growth factor beta from fibroblast conditioned medium. J. Cell Biol. 106 1659 1665 (1988). 58. Prud'homme,G.J. Pathobiology of tr ansforming growth factor beta in cancer, fibrosis and immunologic disease, and therapeutic considerations. Lab Invest 87 1077 1091 (2007). 59. Wahl,S.M. et al. Transforming growth factor type beta induces monocyte chemotaxis and growth factor product ion. Proc. Natl. Acad. Sci. U. S. A 84 5788 5792 (1987). 60. Reibman,J. et al. Transforming growth factor beta 1, a potent chemoattractant for human neutrophils, bypasses classic signal transduction pathways. Proc. Natl. Acad. Sci. U. S. A 88 6805 6 809 (1991). 61. Shull,M.M. et al. Targeted disruption of the mouse transforming growth factor beta 1 gene results in multifocal inflammatory disease. Nature 359 693 699 (1992). 62. Kulkarni,A.B. & Karlsson,S. Transforming growth factor beta 1 knockout mice. A mutation in one cytokine gene causes a dramatic inflammatory disease. Am. J. Pathol. 143 3 9 (1993). 63. Ma,D.H. et al. In vitro antiangiogenic activity in ex vivo expanded human limboco rneal epithelial cells cultivated on human amniotic membrane. Invest Ophthalmol. Vis. Sci. 45 2586 2595 (2004). 64. Wakefield,L.M. & Roberts,A.B. TGF beta signaling: positive and negative effects on tumorigenesis. Curr. Opin. Genet. Dev. 12 22 29 (2 002).

PAGE 112

112 65. Galliher,A.J., Neil,J.R., & Schiemann,W.P. Role of transforming growth factor beta in cancer progression. Future. Oncol. 2 743 763 (2006). 66. Glick,A.B., Weinberg,W.C., Wu,I.H., Quan,W., & Yuspa,S.H. Transforming growth factor beta 1 suppresses genomic instability independent of a G1 arrest, p53, and Rb. Cancer Res. 56 3645 3650 (1996). 67. Yang,X. et al. Synergistic activation of functional estrogen receptor (ER) alpha by DNA methyltransferase and histone deacetylase inhibition in human ER alpha negative breast cancer cells. Cancer Res. 61 7025 7029 (2001). 68. Zavahir,F. et al. A study of the cellular response to orientated fibronectin material in healing extensor rat tendon. J. Mater. Sci. Mater. Med. 12 1005 1011 (2001). 69. Han,G. et al. Distinct mechanisms of TGF beta1 mediated epithelial to mesenchymal transition and metastasis during skin carcinogenesis. J. Clin. Invest 115 1714 1723 (2005). 70. Oft,M., Heider,K.H., & Beug,H. TGFbeta signaling is necessary for carcinoma cell invasiveness and metastasis. Curr. Biol. 8 1243 1252 (1998). 71. Benckert,C. et al. Transforming growth factor beta 1 stimulates vascular endothelial growth factor gene transcription in huma n cholangiocellular carcinoma cells. Cancer Res. 63 1083 1092 (2003). 72. Postlethwaite,A.E., Keski,O.J., Mosses,H.L., & Kang,A.H. Stimulation of the chemotactic migration of human fibroblasts by transforming growth factor J Exper Medicine 165 25 1 256 (1987). 73. Assoian,R.K., Frolik,C.A., Roberts,A.B., Miller,D.M., & Sporn,M.B. Transforming growth factor beta controls receptor levels for epidermal growth factor in NRK fibroblasts. Cell 36 35 41 (1984). 74. Leof,E.B. et al. Induction of c sis mRNA and activity similar to platelet derived growth factor by transforming growth factor beta: a proposed model for indirect mitogenesis involving autocrine activity. Proc Natl Acad Sci 83 2453 2457. ( 1986 ) 75. Soma,Y. & Grote ndorst,G.R. TGF beta stimulates primary human skin fibroblast DNA synthesis via an autocrine production of PDGF related peptides. J. Cell Physiol 140 246 253 (1989). 76. Ishikawa,O., LeRoy,E.C., & Trojanowska,M. Mitogenic effect of transforming growt h factor beta 1 on human fibroblasts involves the induction of platelet derived growth factor alpha receptors. J. Cell Physiol 145 181 186 (1990).

PAGE 113

113 77. Battegay,E.J., Raines,E.W., Seifert,R.A., Bowen Pope,D.F., & Ross,R. TGF beta induces bimodal proli feration of connective tissue cells via complex control of an autocrine PDGF loop. Cell 63 515 524 (1990). 78. Ignotz,R.A. & Massague,J. Transforming Growth Factor b Stimulates the Expression of Fibronectin and Collagen and Their Incorporation Into t he Extracellular Matrix. Journal Biological Chemistry 261 4337 4345. ( 1986 ) 79. Raghow,R., Postethwaite,A.E., Keski Oja,S., Moses,H.L., & Kang,A.H. Transforming growth factor beta increases levels of type I procollagen and fibronectin messenger RN As posttranscriptionally in cultured human dermal fibroblasts. J Clin Invest 79 1285 1289. ( 1987 ) 80. Roberts,A.B. et al. Transforming growth factor type beta: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc. Natl. Acad. Sci. U. S. A 83 4167 4171 (1986). 81. Varga,J. & Jimenez,S.A. Stimulation of normal human fi broblast collagen production and processing by transforming growth factor beta. Biochem. Biophys. Res. Commun. 138 974 980 (1986). 82. Penttinen,R.P., Kobayashi,S., & Bornstein,P. Transforming growth factor beta increases mRNA for matrix proteins bot h in the presence and in the absence of changes in mRNA stability. Proc. Natl. Acad. Sci. U. S. A 85 1105 1108 (1988). 83. Laiho,M., Saksela,O., Andreasen,P.A., & Keski Oja,J. Enhanced production and extracellular deposition of the endothelial type p lasminogen activator inhibitor in cultured human lung fibroblasts by transforming growth factor beta. J Cell Biol. 103 2403 2410 (1986). 84. Lund,L.R. et al. Transforming growth factor beta is a strong and fast acting positive regulator of the level of type 1 plasminogen activator inhibitor mRNA in WI 38 human lung fibroblasts. EMBO J. 6 1281 1286 (1987). 85. Kerr,L.D., Olashaw,N.E., & Matrisian,L.M. Transforming growth factor beta 1 and cAMP inhibit transcription of epidermal growth factor and oncogene induced transin RNA. J Biol. Chem. 263 16999 17005 (1988). 86. Werner,S. & Grose,R. Regulation of wound healing by growth factor s and cytokines. Physiol Rev. 83 835 870 (2003). 87. Vesaluoma,M., Teppo,A.M., Gronhagen Riska,C., & Tervo,T. Release of TGF beta 1 and VEGF in tears following photorefractive keratectomy. Curr. Eye Res. 16 19 25 (1997).

PAGE 114

114 88. Yoshino,K., Garg,R. Monroy,D., Ji,Z., & Pflugfelder,S.C. Production and secretion of TGF B by the human lacrimal gland. Curr. Eye Res. 615 624 (1996). 89. Chen,C. et al. Measurement of mRNAs for TGFbeta and extracellular matrix proteins in corneas of rats after PRK. Inv est Ophthalmol. Vis. Sci. 41 4108 4116 (2000). 90. Mi,S. et al. Adhesion of laser in situ keratomileusis like flaps in the cornea: Effects of crosslinking, stromal fibroblasts, and cytokine treatment. J. Cataract Refract. Surg. 37 166 172 (2011). 91. Wang,L. et al. Concentration dependent effects of transforming growth factor beta1 on corneal wound healing. Mol. Vis. 17 2835 2846 (2011). 92. Jester,J.V., Barry Lane,P.A., Petroll,W.M., Olsen,D.R., & Cavanagh,H.D. Inhibition of corneal fibrosis by topical application of blocking antibodies to TGF beta in the rabbit. Cornea 16 177 187 (1997). 93. Chen,Y., Segarini,P., Raoufi,F., Bradham,D., & Leask,A. Connective tissue growth factor is secreted t hrough the Golgi and is degraded in the endosome. Exp. Cell Res. 271 109 117 (2001). 94. Abreu,J.G., Ketpura,N.I., Reversade,B., & De Robertis,E.M. Connective tissue growth factor (CTGF) modulates cell signalling by BMP and TGF beta. Nat. Cell Biol. 4 599 604 (2002). 95. Bork,P. The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett. 327 125 130 (1993). 96. Murray Rust,J. et al. Topological similarities in TGF beta 2, PDGF BB and NGF define a superfamily of polypeptide growth factors. Structure. 1 153 159 (1993). 97. Moussad,E.E. & Brigstock,D.R. Connective tissue growth factor: What's in a name? Mol. Genet. Metab 71 276 292 (2000). 98. Leask,A. & Abraham,D.J. TGF beta signaling and the fibrotic response FASEB J. 18 816 827 (2004). 99. Moussad,E.E. & Brigstock,D.R. Connective tissue growth factor: What's in a name? Mol. Genet. Metab 71 276 292 (2000). 100. Grotendorst,G.R., Okochi,H., & Hayashi,N. A novel transforming growth factor beta response element controls the expression of the connective tissue growth factor gene. Cell Growth Differ. 7 469 480 (1996).

PAGE 115

115 101. Xin,L.W., Martinerie,C., Zumkeller,W., Westphal,M., & Perbal,B. Diffe rential expression of novH and CTGF in human glioma cell lines. Clin. Mol. Pathol. 49 M91 M97 (1996). 102. Brunner,A., Chinn,J., Neubauer,M., & Purchio,A.F. Identification of a gene family regulated by transforming growth factor beta. DNA Cell Biol. 10 293 300 (1991). 103. Querfeld,C., Sollberg,S., Huerkamp,C., Eckes,B., & Krieg,T. Pseudoscleroderma associated with lung cancer: correlation of collagen type I and connective tissue growth factor gene expression. Br. J. Dermatol. 142 1228 1233 (2 000). 104. Blalock,T.D. et al. Connective Tissue Growth Factor Expression and Action in Human Corneal Fibroblast Cultures and in Rat Corneas following Phototherapeutic Keratectomy. Invest Ophtahlmol Vis Sci 1879 1887 ( 2003 ) 105. Grotendorst,G.R. Connective tissue growth factor: a mediator of TGF beta action on fibroblasts. Cytokine Growth Factor Rev. 8 171 179 (1997). 106. Lau,L.F. & Lam,S.C. The CCN family of angiogenic regulators: the integrin connection. Exp. Cell Res. 24 8 44 57 (1999). 107. Ayer Lelievre,C. et al. Report and abstracts on the first international workshop on the CCN family of genes. Mol. Pathol. 54 105 120 (2001). 108. Perbal,B. NOV (nephroblastoma overexpressed) and the CCN family of genes: str uctural and functional issues. Mol. Pathol. 54 57 79 (2001). 109. Bradham,D.M., Igarashi,A., Potter,R.L., & Grotendorst,G.R. Connective tissue growth factor: a cysteine rich mitogen secreted by human vascular endothelial cells is related to the SRC i nduced immediate early gene product CEF 10. J. Cell Biol. 114 1285 1294 (1991). 110. Ryseck,R.P., Macdonald Bravo,H., Mattei,M.G., & Bravo,R. Structure, mapping, and expression of fisp 12, a growth factor inducible gene encoding a secreted cysteine rich protein. Cell Growth Differ. 2 225 233 (1991). 111. Frazier,K., Williams,S., Kothapalli,D., Klapper,H., & Grotendorst,G.R. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J. Invest Dermatol. 107 404 411 (1996). 112. Hook,V. et al. Proteases for processing proneuropeptides int o peptide neurotransmitters and hormones. Annu. Rev. Pharmacol. Toxicol. 48 393 423 (2008).

PAGE 116

116 113. Yamamoto,Y. et al. Possible roles of CTGF/Hcs24 in the initiation and development of ossification of the posterior longitudinal ligament. Spine (Phila Pa 1976. ) 27 1852 1857 (2002). 114. Friedrichsen,S. et al. CTGF expression during mouse embryonic development. Cell Tissue Res. 312 175 188 (2003). 115. Surveyor,G.A., Wilson,A.K., & Brigstock,D.R. Localization of connective tissue growth factor during the period of embryo implantation in the mouse. Biol. Reprod. 59 1207 1213 (1998). 116. Slee,R.B. et al. Differentiation dependent expression of connective tissue growth factor and lysyl oxidase messenger ribonucleic acids in rat granulosa cells. Endocrinology 142 1082 1089 (2001). 117. Leask,A., Holmes,A., Black,C.M., & Abraham,D.J. Connective tissue growth factor gene regulation. Requirements for its induction by transforming growth factor beta 2 in fibroblasts. J. Biol. Chem. 278 13008 13015 (2003). 118. Ivkovic,S. et al. Connective tissue growth factor coordinates chondrogenesis and angiogenes is during skeletal development. Development 130 2779 2791 (2003). 119. Igarashi,A., Okochi,H., Bradham,D.M., & Grotendorst,G.R. Regulation of connective tissue growth factor gene expression in human skin fibroblasts and during wound repair. Mol. Biol Cell 4 637 645 (1993). 120. Brigstock,D.R. et al. Purification and characterization of novel heparin binding growth factors in uterine secretory fluids. Identification as heparin regulated Mr 10,000 forms of connective tissue growth factor. J. Biol Chem. 272 20275 20282 (1997). 121. Ball,D.K. et al. Characterization of 16 to 20 kilodalton (kDa) connective tissue growth factors (CTGFs) and demonstration of proteolytic activity for 38 kDa CTGF in pig uterine luminal flushings [published erratu m appears in Biol Reprod 1998 Dec;59(6):1554]. Biol. Reprod. 59 828 835 (1998). 122. Denham,W. et al. Transient human gene therapy: a novel cytokine regulatory strategy for experimental pancreatitis. Ann. Surg. 227 812 820 (1998). 123. Boes,M. et al. Connective tissue growth factor (IGFBP rP2) expression and regulation in cultured bovine endothelial cells. Endocrinology 140 1575 1580 (1999). 124. Nishida,T. et al. Demonstration of receptors specific for connective tissue growth factor on a human chondrocytic cell line (HCS 2/8). Biochem. Biophys. Res. Commun. 247 905 909 (1998).

PAGE 117

117 125. Steffen,C.L. et al. Characterization of cell associated and soluble forms of connective tissue growth factor (CTGF) produced by fibroblast cells in vitro Growth Factors 15 199 213 (1998). 126. Tall,E.G., Bernstein,A.M., Oliver,N., Gray,J.L., & Masur,S.K. TGF {beta} stimulated CTGF Production is Enhanced by Collagen and Associated with Biogenesis of a Novel 31 kDa CTGF Form in Human Corneal Fibroblas ts. Invest Ophthalmol. Vis. Sci 5002 5011 (2010). 127. Hashimoto,G. et al. Matrix metalloproteinases cleave connective tissue growth factor and reactivate angiogenic activity of vascular endothelial growth factor 165. J. Biol. Chem. 277 36288 36295 (2002). 128. Guillon Munos,A. et al. Kallikrein related peptidase 12 hydrolyzes matricellular proteins of the CCN family and modifies interactions of CCN1 and CCN5 with growth factors. J. Biol. Chem. 286 25505 25518 (2011). 129. Grotendorst,G.R. & Duncan,M.R. Individual domains of connective tissue growth factor regulate fibroblast proliferation and myofibroblast differentiation. FASEB J. 19 729 738 (2005). 130. Dziadzio,M. et al. N terminal connective tissue growth factor i s a marker of the fibrotic phenotype in scleroderma. QJM. 98 485 492 (2005). 131. Gartry,D.S., Muir,M.G., Lohmann,C.P., & Marshall,J. The effect of topical corticosteroids on refractive outcome and corneal haze after photorefractive keratectomy. A prospective, randomized, double blind trial. Arch. Ophthalmol. 110 944 952 (1992). 132. Majmudar,P.A. et al. Topical mitomy cin C for subepithelial fibrosis after refractive corneal surgery. Ophthalmology 107 89 94 (2000). 133. Raviv,T., Majmudar,P.A., Dennis,R.F., & Epstein,R.J. Mytomycin C for post PRK corneal haze. J. Cataract Refract. Surg. 26 1105 1106 (2000). 134. Dougherty,P.J., Hardten,D.R., & Lindstrom,R.L. Corneoscleral melt after pterygium surgery using a single intraoperative application of mitomycin C. Cornea 15 537 540 (1996). 135. Netto,M.V. et al. Effect of prophylactic and therapeutic mitomycin C on corneal apoptosis, cellular proliferation, haze, and long term keratocyte density in rabbits. J. Refract. Surg. 22 562 574 (2006). 136. Nassiri,N., Farahangiz,S., Rahnavardi,M., Rahmani,L., & Nas siri,N. Corneal endothelial cell injury induced by mitomycin C in photorefractive keratectomy: nonrandomized controlled trial. J. Cataract Refract. Surg. 34 902 908 (2008).

PAGE 118

118 137. Paterson,B.M., Roberts,B.E., & Kuff,E.L. Structural gene identification and mapping by DNA mRNA hybrid arrested cell free translation. Proc. Natl. Acad. Sci. U. S. A 74 4370 4374 (1977). 138. Fire,A. et al. Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature 391 806 811 (199 8). 139. Bagasra,O. & Prilliman,K.R. RNA interference: the molecular immune system. J. Mol. Histol. 35 545 553 (2004). 140. Leuschner,P.J., Ameres,S.L., Kueng,S., & Martinez,J. Cleavage of the siRNA passenger strand during RISC assembly in human cells. EMBO Rep. 7 314 320 (2006). 141. Scherer,L.J. & Rossi,J.J. Approaches for the sequence specific knockdown of mRNA. Nat. Biotechnol. 21 1457 1465 (2003). 142. Tiemann,K. & Rossi,J.J. RNAi based therapeutics current status, challenges and prospects. EMBO Mol. Med. 1 142 151 (2009). 143. Ruffner,D.E., Stormo,G.D., & Uhlenbeck,O.C. Sequence requirements of the hammerhead RNA self cleavage reaction. Biochemistry 29 10695 10702 (1990). 144. Symons,R.H. Small catalytic RNAs. Annu. Rev. Biochem. 61 641 671 (1992). 145. Xu,R. et al. Activity identification of chimeric anti caspase 3 mRNA hammerhead ribozyme in vitro and in vivo. Sci. China C. Life Sci. 44 618 627 (2001). 146. Lewin,A.S. & Hauswirth,W.W. Ribozyme gene therapy: applications for molecular medicine. Trends Mol. Med. 7 221 228 (2001). 147. Steitz,T.A. & Steitz,J.A. A general two metal ion mechanism for catalytic RNA. Proc. Natl. Acad. Sci. U. S. A 90 6498 6502 (1993). 148. Popescu,F.D. New asthma drugs acting on gene expression. J. Cell Mol. Med. 7 475 486 (2003). 149. Peracchi,A. Prospects for antiviral ribozymes and deoxyribozymes. Rev. Med. Virol. 14 47 64 (2004). 150. Amado,R.G. et al. Anti human immunodeficiency virus hematopoietic progenitor cell delivered ribozyme in a phase I study: myeloid and lymphoid reconstitution in human immunodeficiency virus type 1 infected patients. Hum. Gene Ther. 15 251 262 (2004).

PAGE 119

119 151. MacPherson,J.L. et al. Long term survival and concomitant gene expression of ribozyme transduced CD4+ T lymphocytes in HIV infected patients. J. Gene Med. 7 552 564 (2005). 152. Michienzi,A. et al. RNA mediated inhibition of HIV in a gene therap y setting. Ann. N. Y. Acad. Sci. 1002 63 71 (2003). 153. Wong Staal,F., Poeschla,E.M., & Looney,D.J. A controlled, Phase 1 clinical trial to evaluate the safety and effects in HIV 1 infected humans of autologous lymphocytes transduced with a ribozyme that cleaves HIV 1 RNA. Hum. Gene Ther. 9 2407 2425 (1998). 154. Burnett,J.C. et al. Combinatorial latency reactivation for HIV 1 subtypes and variants. J. Virol. 84 5958 5974 (2010). 155. Tafech,A., Bassett,T., Sparanese,D., & Lee,C.H. Destroying RNA as a therapeutic approach. Curr. Med. Chem. 13 863 881 (2006). 156. Beigelman,L. et al. Chemical modification of hammerhead ribozymes. Catalytic activity and nuclease resistance. J. Biol. Chem. 270 25702 25708 (1995). 157. Han,J. et al. Molecular basis for the recognition of primary microRNAs by the Drosha DGCR8 complex. Cell 125 887 901 (2006). 158. Kim,H.H. et al. Photoprotective and anti skin aging effects of eicosapentaenoic acid in human skin in vivo. J. Lipid Res. 47 921 930 (2006). 159. Millington Ward,S. et al. A mutation independent therapeutic strategem for osteogenesis imperfecta. Antisense Nucleic Acid Drug Dev. 9 537 542 (1999). 160. Berns,K.I. & Giraud,C. Biology of adeno associated virus. Curr. Top. Microbiol. Immunol. 218 1 23 (1996). 161. Lu,Y. Recombinant adeno associated virus as delivery vector for gene therapy a review. Stem Cells Dev. 13 133 145 (2004). 162. Sonntag,F., Schmidt,K., & Kleinschmidt,J.A. A viral assembly factor promotes AAV2 capsid formation in the nucleolus. Proc. Natl. Acad. Sci. U. S. A 107 10220 10225 (2010). 163. Qing,K. et al. Human fibroblast growth factor receptor 1 is a co receptor for infection by adeno a ssociated virus 2. Nat. Med. 5 71 77 (1999). 164. Summerford,C. & Samulski,R.J. Membrane associated heparan sulfate proteoglycan is a receptor for adeno associated virus type 2 virions. J. Virol. 72 1438 1445 (1998).

PAGE 120

120 165. Zolotukhin,S. et al. R ecombinant adeno associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 6 973 985 (1999). 166. Bartlett,J.S., Wilcher,R., & Samulski,R.J. Infectious entry pathway of adeno associated virus and adeno associat ed virus vectors. J. Virol. 74 2777 2785 (2000). 167. Douar,A.M., Poulard,K., Stockholm,D., & Danos,O. Intracellular trafficking of adeno associated virus vectors: routing to the late endosomal compartment and proteasome degradation. J. Virol. 75 1824 1833 (2001). 168. Li,J., Samulski,R.J., & Xiao,X. Role for highly regulated rep gene expression in adeno associated virus vector production. J. Virol. 71 5236 5243 (1997). 169. Monahan,P.E. et al. Direct intramuscular injection with recombi nant AAV vectors results in sustained expression in a dog model of hemophilia. Gene Ther. 5 40 49 (1998). 170. Mohan,R.R., Schultz,G.S., Hong,J.W., Mohan,R.R., & Wilson,S.E. Gene transfer into rabbit keratocytes using AAV and lipid mediated plasmid D NA vectors with a lamellar flap for stromal access. Exp. Eye Res. 76 373 383 (2003). 171. Liu,J. et al. Different tropism of adenoviruses and adeno associated viruses to corneal cells: implications for corneal gene therapy. Mol Vis 14 2087 2096 (200 8). 172. McCarty,D.M. et al. Adeno associated virus terminal repeat (TR) mutant generates self complementary vectors to overcome the rate limiting step to transduction in vivo. Gene Ther. 10 2112 2118 (2003). 173. Kong,F. et al. Self complementa ry AAV5 vector facilitates quicker transgene expression in photoreceptor and retinal pigment epithelial cells of normal mouse. Exp. Eye Res. 90 546 554 (2010). 174. Natkunarajah,M. et al. Assessment of ocular transduction using single stranded and self complementary recombinant adeno associated virus serotype 2/8. Gene Ther. 15 463 467 (2008). 175. Tafech,A., Bassett,T., Sparanese,D., & Lee,C.H. Destroying RNA as a therapeutic approa ch. Curr. Med. Chem. 13 863 881 (2006). 176. Woost,P.G., Jumblatt,M.M., Eiferman,R.A., & Schultz,G.S. Growth factors and corneal endothelial cells: I. Stimulation of bovine corneal endothelial cell DNA synthesis by defined growth factors. Cornea 11 1 10. ( 1992 )

PAGE 121

121 177. Robinson,P.M., Blalock,T.D., Yuan,R., Lewin,A.S., & Schultz,G.S. Hammerhead ribozyme mediated knockdown of mRNA for fibrotic growth factors: transforming growth factor beta 1 and connective tissue growth factor. Methods Mol. Biol 820 117 132 (2012). 178. National Research Council Committee. Guide for the care and use of laboratory a nimals 8 1 246, ( 2011 ) .. 179. Border,W.A. et al. Natural inhibitor of transforming growth factor beta protects against scarring in experimental kidney disease. Nature 360 361 364 (1992). 180. Border,W.A. & Noble,N.A. Transforming growth factor beta in tissue fibrosis. N. Engl. J. Med. 331 1286 12 92 (1994). 181. Ball,D.K., Rachfal,A.W., Kemper,S.A., & Brigstock,D.R. The heparin binding 10 kDa fragment of connective tissue growth factor (CTGF) containing module 4 alone stimulates cell adhesion. J. Endocrinol. 176 R1 R7 (2003). 182. Sharma ,A., Bettis,D.I., Cowden,J.W., & Mohan,R.R. Localization of angiotensin converting enzyme in rabbit cornea and its role in controlling corneal angiogenesis in vivo. Mol. Vis. 16 720 728 (2010). 183. Zeeuwen,P.L. et al. The cystatin M/E cathepsin L balance is essential for tissue homeostasis in epidermis, hair follicles, and cornea. FASEB J. 24 3744 3755 (2010). 184. Reim,M., Bahrke,C., Kuckelkorn,R., & Kuwert,T. Investigation of enzyme activities in severe burns o f the anterior eye segment. Graefes Arch. Clin. Exp. Ophthalmol. 231 308 312 (1993). 185. Lee,E.H. & Joo,C.K. Role of transforming growth factor beta in transdifferentiation and fibrosis of lens epithelial cells. Invest Ophthalmol. Vis. Sci. 40 2025 2032 (1999). 186. Perbal,B. Alternative splicing of CCN mRNAs .... it has been upon us. J. Cell Commun. Signal. 3 153 157 (2009). 187. Harding,P.A., Surveyor,G.A., & Brigstock,D.R. Characterization of pig connective tissue growth factor (CTGF) cDNA, mRNA and protein from uterine tissue. DNA Seq. 8 385 390 (1998). 188. Uhlenbeck,O.C. A small catalytic oligoribonucleotide. Nature 328 596 600 (1987). 189. Natkunarajah,J., Osborne,V., & Holden,C. Allergic contact dermatitis to iodopropynyl butylcarbamate found in a cosmetic cleansing wipe. Contact Dermatitis 58 316 317 (2008).

PAGE 122

122 190. Blalock,T.D., Yuan,R., Lewin,A.S., & Schultz,G.S. Hammerhead ribozyme targeting connective tissue gro wth factor mRNA blocks transforming growth factor beta mediated cell proliferation. Exp. Eye Res. 78 1127 1136 (2004). 191. Sugioka,K. et al. Connective tissue growth factor cooperates with fibronectin in enhancing attachment and migration of corneal epithelial cells. Tohoku J. Exp. Med. 222 45 50 (2010). 192. Liu,J. et al. Different tropism of adenoviruses and adeno associated viruses to corneal cells: implications for corneal gene therapy. Mol. Vis. 14 2087 2096 (2008).

PAGE 123

123 BIOGRAPHICAL SK ETCH Paulette was born to Paul and Jacqueline Kuznia in Tampa, Florida. She went to high school at Poudre High School in Fort Collins, Colorado. Upon graduati on, she chose to return to Florida for college and enrolled at the Universi ty of Florida. She m ajored in microbiology and cell science and obtained a minor in c hemistry. After college, she was a research and development laboratory technician at Regeneration Technology Inc. in Alachua, Florida, where she gained experience in working in an industrial biotechnology laboratory She enjoyed her work there but she was only a temporary employee and she found a more permanent position as a Quality Control Analyst at Oxthera Inc. She realized that in order to succeed in industry she needed to i ncrease her knowledge base by continuing her education. Paulette was accepted to corneal wound healing with her mentors, Dr. Gregory Schultz and Dr. Alfred Lewin. Pau lette hopes to return to research and development in industrial biotechnology after obtaining her Ph. D.