Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-05-31.

MISSING IMAGE

Material Information

Title:
Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-05-31.
Physical Description:
Book
Language:
english
Creator:
Stanton, Melonie Lee
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Pharmaceutical Sciences, Pharmaceutics
Committee Chair:
Frye, Reginald F
Committee Members:
Langaee, Taimour
Butterweck, Veronika
Shuster, Jonathan J

Subjects

Subjects / Keywords:
Pharmaceutics -- Dissertations, Academic -- UF
Genre:
Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility:
by Melonie Lee Stanton.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Frye, Reginald F.
Electronic Access:
INACCESSIBLE UNTIL 2014-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044024:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 ORGANIC ANION TRA NSPORTING POLYPEPTID E (OATP) FAMILY: CONTRIBUTION OF GENE TIC VARIATION AND BO TANICAL INTERACTIONS TO VARIABILITY IN DRUG DISPOSITION AND RESP ONSE By MELONIE L. STANTON A DISSERTATION PRESENTED TO THE GRADU ATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Melonie L. Stanton

PAGE 3

3 Dedicated to the two loves of my life my husband, Matthew A. Stan ton and our son on the way, Wesley M. Stanton

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to thank my advisor Dr. Reginald Frye for his encouragement guidance, and support over the years. I will always be grateful for the opportunities he has given me. I woul d also like to thank Dr. Veronika Butterweck, Dr. Jon Shuster, and Dr. Taimour Langaee for serving on my committee and for sharing their expertise. I would like to thank the members of the Frye Lab, especially Mohamed Mohamed and Cheryl Galloway for thei r help and friendship over the years. I would like to acknowledge Dr. Mark Segal, Elaine Whidden, Brendan Kelly and the Shands Clinical Research staff for helping we with this project. It was truly a pleasure to work with them and I appreciate all of thei r effort I also wan t to thank everyone in the Department of Pharmacotherapy and Translational Research I have learned so much during my time here and feel very thankful to have worked with so many outstanding individuals. Special thanks to Randell Doty f or helping me develop as an educator and to Mariellen Moore for sharing this journey with me. Finally, I would like to thank my friends and family who have always been supportive, especially my Mom who first encouraged me to pursue a career in pharmacy. I would especially like to thank my husband. I feel truly blessed to have such without him. And to our son, who at this moment is kicking me with love and encouragement, thank y ou!

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 OVERVIEW OF DRUG TRANSPORTERS AND EFFECTS ON DRUG DISPOSITION AND RESPONSE ................................ ................................ ........... 13 Introduction ................................ ................................ ................................ ............. 13 Uptake Transporters of the Solute Carrier Superfamily ................................ .......... 14 Organic Anion Transporting Polypeptides ................................ ........................ 14 Organic Cation Transporters ................................ ................................ ............ 17 Organic Anion Transporters ................................ ................................ ............. 20 Efflux Transporters of the ATP Binding Cassette Superfamily ................................ 21 P Glycoprotein ................................ ................................ ................................ .. 21 Breast Cancer Resistance Protein ................................ ................................ ... 23 Multidrug Resistance Associated Proteins ................................ ....................... 25 Transporter Drug Metabolizing Enzyme Interplay ................................ ................... 26 Summary ................................ ................................ ................................ ................ 27 Study Objectives ................................ ................................ ................................ ..... 27 2 EFFECT OF OATP1B1 REDUCED FUNCTION CARRIER STATUS ON ATORVASTATIN RESPONSE ................................ ................................ ............... 31 Background ................................ ................................ ................................ ............. 31 Methods ................................ ................................ ................................ .................. 33 Study Population ................................ ................................ .............................. 33 Study Protocol ................................ ................................ ................................ .. 34 Inflammatory Marker Measuremen t ................................ ................................ .. 34 Genotyping ................................ ................................ ................................ ....... 35 Haplotype Assignments ................................ ................................ .................... 35 Statistical Analysis ................................ ................................ ............................ 36 Results ................................ ................................ ................................ .................... 36 Study Population Characteristics ................................ ................................ ...... 36 Atorvastatin Effects on Inflammation ................................ ................................ 37 Genetic Associations with Atorvastatin Response ................................ ............ 37

PAGE 6

6 Discussion ................................ ................................ ................................ .............. 37 3 VALIDATION AND APPLICATION OF A LIQUID CHROMATOGRAPHY TANDEM MASS SPECTROMETRIC METHOD FOR QUANTIFICATION OF THE DRUG TRANSPORT PROBE FEXOFENADINE IN HUMAN PLASMA USING 96 WELL FILTER PLATES ................................ ................................ ........ 47 Background ................................ ................................ ................................ ............. 47 Experimental ................................ ................................ ................................ ........... 49 Chemicals and Reagents ................................ ................................ ................. 49 Instrumentation and Chromatographic Conditions ................................ ........... 50 Standard Preparation ................................ ................................ ....................... 51 Sample Preparation ................................ ................................ .......................... 51 Calibration and Linearity ................................ ................................ ................... 52 Precision and Accuracy ................................ ................................ .................... 52 Selectivity and S tability ................................ ................................ ..................... 52 Matrix Effects and Extraction Efficiency ................................ ........................... 53 Application to Plasma Sampling ................................ ................................ ....... 53 Results and Discussion ................................ ................................ ........................... 54 Chromatography ................................ ................................ ............................... 54 Calibration and Linearity ................................ ................................ ................... 54 Precision and Accuracy ................................ ................................ .................... 54 Selectivity and Stability ................................ ................................ ..................... 55 Matrix Effects and Extraction Efficien cy ................................ ........................... 55 Application to Plasma Sampling ................................ ................................ ....... 55 Incurred Sample Reproducibility ................................ ................................ ....... 56 Summary ................................ ................................ ................................ ................ 56 4 EFFECTS OF GREEN TEA EXTRACT ON FEXOFENADINE PHARMACOKINETICS ................................ ................................ ........................... 61 Background ................................ ................................ ................................ ............. 61 Methods ................................ ................................ ................................ .................. 62 Study Participants ................................ ................................ ............................ 62 Study Design ................................ ................................ ................................ .... 63 Plasma Collection and Determination of Fexofenadine and EGCG ................. 64 Pharmacokinetic Analysis ................................ ................................ ................. 64 Statistical Analysis ................................ ................................ ............................ 65 Results ................................ ................................ ................................ .................... 65 Plasma Concentrations and Pharmacokinetics of Fexofenadine ...................... 65 Discussion ................................ ................................ ................................ .............. 66 5 CONCLUSION AND FUTURE DIRECTIONS ................................ ......................... 74 APPENDIX: SUPPLEMENTAL DATA FROM FEXOFENADINE GREEN TEA EXTRACT CLINICAL STUDY ................................ ................................ ....................... 77

PAGE 7

7 LIST OF REFERENCES ................................ ................................ ............................... 80 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 96

PAGE 8

8 LIST OF TABLES Table page 1 1 SLC and ABC transporters important to drug disposition and response ............. 28 1 2 Selected transporter mediated drug interactions ................................ ................ 29 2 1 Polymerase chain reaction primers ................................ ................................ .... 44 2 2 Mean difference of lipoprotein and inflammatory mar ker concentrati ons ............ 44 2 3 Mean difference of lipoprotein and inflammatory mar ker concentrations in non carriers and carriers of a reduced function OATP1B1 haplotype ................ 45 3 1 Intra a nd inter run precision and accuracy for fexofenadine quality control samples ................................ ................................ ................................ ............. 57 4 1 Effect of green tea extract on fexofenadine p harmacokinetics parameter s ........ 70 A 1 Individual fexofenadine pharmacokinetic parameters ................................ ......... 77 A 2 Subject demographics ................................ ................................ ........................ 78 A 3 Individual fexofenadine pharmacokinetic parameters for subjects who received half dose green tea extract ................................ ................................ .. 79

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Localization of selected uptake and efflux transporters ................................ ...... 30 2 1 Percent reduction in LDL in non carriers and carriers of a reduced function OATP1B1 haplotype ................................ ................................ ........................... 46 3 1 Chemical structures of fexofenadine and fex ofenadine d6 ................................ 58 3 2 Representative extracted ion chromatograms ................................ .................... 59 3 3 Concentration time profile for a study subject administered single o ral dose of fexofe nadine ................................ ................................ ................................ ... 60 4 1 Mean concentration time profile s for the control and green tea phases ............. 71 4 2 Individual, median, and interquartile range of fexofenadine AUC0 values in the control and green tea phases ................................ ................................ ....... 72 4 3 Individual, median, and interquartile range of fexofenadine C max values in the control and green tea phases ................................ ................................ ............. 73

PAGE 10

10 LIST OF ABBREVIATION S ABC ATP binding cassette transporter family AUC Area u nder the plasma concentration time curve BCRP Breast cancer resistance protein CL/F Apparent oral clearance C max Maximum concentration EGCG E pigallocatechin gallate ENA 78 E pithelial cell derived neutrophil activating peptide 78 protein HDL High density li poprotein hs CRP High sensitivity C reactive protein IL 1RA I nte rleukin 1 receptor, type 1 z Elimination rate constant LDL Low density lipoprotein MCP 1 M onocyte chemotactic protein 1 MRPs Multidrug resistance associated proteins OAT Organic anion transpo rters OCT Organic cation transporters OATP Organic anion transporting polypeptide P gp P glycoprotein SLC Solute carrier transporter family t max Time of maximum concentration TPO T hrombopoietin V ss Volume of distribution at steady state

PAGE 11

11 Abstract of Disser tation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ORGANIC ANION TR ANSPORTING POLYPEPTI DE (OATP) FAMILY: CONTRIBUTION OF GENE TIC VARIATION AND BOTANICAL INTERA CTIONS TO VARIABILITY IN DRUG DISPOSITION AND RESP ONSE By Melonie L. Stanton May 2012 Chair: Reginald Frye Major: Pharmaceutical Sciences Drug transport plays an important role in the disposition of many drug s through effects on abso rption, distribution, metabolism, and elimination Ultimately, these effects on pharmacokinetics contribute to variability in drug response. For instance, members of the organic anion transporting polypeptide (OATP) family which facilitate the uptake (abs orption and/or elimination) of a large variety of drug substrates are now increasingly being recognized as a key determinant of drug disposition and can have a critical impact on drug response. Consequently drugs are now screened during the development p rocess to identify drug transporter substrates. As more drugs are being recognized as substrates for OATP transport it is imperative that we fully understand the impact of these transporters on drug disposition and response. The goal of this work was to e valuate the effects of genetic variability and a botanical interaction on OATP mediated transport. First, we evaluated the effects of OATP1B1 polymorphisms on drug response by conducting a retrospective pharmacogenetic analysis of atorvastatin treated indi viduals. We hypothesized that OATP1B1 reduced function carrier status would be associated with diminished lipoprotein reduction and enhanced inflammatory

PAGE 12

12 marker reduction as compared to non carriers. However, we did not observe any association between OATP 1B1 reduced function carrier status and atorvastatin response. Next, we conducted a clinical pharmacokinetic study to evaluate the inhibitory effect of green tea extract on OATP mediated transport using the OATP probe fexofenadine. We hypothesize d that fex ofenadine exposure would be altered after a single dose of green tea e xtract due to decreased OATP mediated uptake. Interestingly, we observed significantly lower fexofenadine plasma concentrations in the presence of green tea extract suggesting inhibition of intestinal OATP mediated uptake. Fu ture research to investigate the role of green tea extract in transporter mediated interactions and the resulting clinical implications is warranted.

PAGE 13

13 CHAPTER 1 O VERVIEW OF DRUG TRAN SPORTERS AND EFFECTS ON DRUG DISPO SITION AND RESPONSE Introduction Drug transporters are membrane proteins expressed throughout the body that control the influx and efflux of many endogenous and exogenous substrates including drugs The primary role of these transporters is to transport n utrients and endogenous substrates and to protect the body from toxins. However, drugs that have structural characteristics similar to these substrates may also be transported. As a result, t hese transporters can have a significant impact on drug response as they can influence the absorption, distribution, metabolism, and elimination of drugs in the body. Through these influences on drug disposition, transporters can ultimately affect steady state concentrations and contribute to variability in drug respons e. Recognition of the important role of drug transport in drug disposition and response is increasing. Of particular interest is the variability in transporter function and expression, which may contribute to interindividual variability in drug disposition and response. Transporter function and expression may be altered in the presence of disease, genetic variation, or drug interactions due to concomitant drugs, foods, and dietary supplements. Drug transporters have been implicated in numerous drug drug in teractions, food drug interactions, and herb drug interactions (Han, 2011) For this reason, t he Food and Drug Administration ( FDA ) stated in the most recently published drug interaction guidance document, Drug Interaction Studies Study Design, Data Analysis, and Implications for Dosing and Label ing that drug transporter analysis will be an integral part of the drug evaluation process and called for improved methodologies to investigate drug transporter interactions (U.S. Department of Health and Human

PAGE 14

14 Services, 2012) Accordingly, the International Transporter Consortium (ITC), a partnership between representatives of the FDA, industry, and academia, have provided recommendations to identify new molecular entities that are substrates and/or inhibitors of drug transporters (Giacom ini et al., 2010) Most drug transporters can be classified into two families, either the Solute Carrier Superfamily (SLCs) or the ATP Binding Cassette Superfamily (ABCs). The ABC transporters are primary active transporters that have an ATP binding domai n and utilize ATP hydrolysis to transport substrates across membranes. Conversely, SLC transporters do not have ATP binding domains and transport by either facilitated diffusion, transport with the elect rochemical potential gradient or secondary active tr ansport using symport or antiport in the presence of active transport to transport against the concentration gradient. Uptake Transporters of the Solute Carrier Superfamily Organic Anion Transporting P olypeptides Organic anion transporting polypeptides (O ATPs) are one of the most widely investigated transporters due to their broad substrate specificity and important role in the disposition of many drugs. OATPs are classified into families and subfamilies based upon sequence homology, in which members of fa milies and subfamilies share grea ter than 40% and 60% sequence homology respectively The nomenclature used for the transporter proteins and genes is based upon the family/subfamily classification system (Hagenbuch and Meier, 2004) For instance OATP1B1 is member 1 of subfamily B in family 1 and OATP1B3 is member 3 of the same family and subfamily. Likewise, t he SLCO genes that encode for OATPs maintain the same nomenclature (e.g., SLCO1B3 encodes the OATP1B3 protein).

PAGE 15

15 The OATP transporters that have been found to be most c linically relevant a re OATP1B1 OATP1B3, OATP2B1, and OATP1A2. The OATP1B1 and OATP1B3 transporters which share 80% sequence homology, are both predominantly expressed on the sinusoidal membrane of hepatocytes (Konig et al., 2000a; Kon ig et al., 2000b) These transporters facilitate the hepatic uptake of drugs, which is a critical first step in elimination. OATP2B1 is expressed in hepatocytes as well as the intestines (Kullak Ublick et al., 2001; Kobayashi et al., 2003) and OATP1A2 is expressed in the brain, liver, kidney, and intestines (Kullak Ublick et al., 1995; Glaeser et al., 2007) OATP transporters that are expressed in the intestines facilitate dr ug absorption. The OATP transporters have some overlap in terms of substrate specificity and share many endogenous as well as exogenous substrates, most notably statins. For many statins, OATP transport is particular important as the site of action and el imination (metabolism) occur in the liver (Kalliokoski and Niemi, 2009) OATPs also transport bile acids, bilirubin, conjugated steroids, certain antidiabetic medications, and fexofenadine (Table 1 1). A number of compounds are also known to inhibit OATPs, such as cyclosporine, rifampin, erythromycin, and fr uit juices (Bailey et al., 2007; Niemi, 2007; Reitman et al., 2010) However, there are no known OATP inducers. Due to the broad substrate specificity and number of potential inhibitors of OATP, numerous drug in ter actions have been reported involving OATP mediated uptake in the intestines (absorption) and liver (elimination) For instance, the area under the concentration time curve ( AUC ) of the antihypertensive drug aliskiren was reduced by approximately 60% when a dministered with grapefruit, orange, or apple juice due to intestinal OATP inhibition (Tapaninen et al., 2010a; Tapaninen et al., 2010b; Rebello et

PAGE 16

16 al., 2011) Conversely, hepatic OATP inhibiti on may result in increa sed AUC s ince clearance is being inhibited due to reduced hepatic uptake. For instance several fold increases in statin exposure (AUC) have been observed in the presence of the known OATP inhibitor cyclosporine (Sim onson et al., 2004; Neuvonen et al., 2006) This magnitude of an effect on drug disposition can result in serious toxicities as systemic exposure is greatly increased Significant increases in statin exposure have also been reported in the presence of ge netic variation (Niemi et al., 2004; Pasanen et al., 2006; Ho et al., 2007; Pasanen et al., 2007; Deng et al., 2008) The SLCO1B1 521T>C SNP is associated with reduced OATP1B1 functi on resulting in increased systemi c exposure I n a clinical pharmacokinetic study, atorvastatin exposure (AUC) was 61% and 144% greater in heterozygous and homozygous carriers of the 521C allele respectively (Pasanen et al., 2007) A genome wide a ssociation study in the SEARCH trial evaluated approximately 300,000 markers in individuals wi th simvastatin induced myopathy and the 521C allele was attributed to over 60% of the myopathy cases (Link et al., 2008) In addition to statin toxicity, SLCO1B1 SNPs that are in linkage with 521T>C have also been associated with enhanced clearance of the anticancer drug methotrexate and increased risk of gastrointestinal (GI) toxicity in children being treated for leukemia (Trevio et al., 2009) However, in this case the 521C allele was associated with reduced clearance and thought to be protective against methotrexate GI toxicity. The 521T>C SNP has also been associated with signif icantly higher exposure of repaglinide (Niemi et al., 2005a; Kalliokoski et al., 2008b; Kalliokoski et al., 2008c) In a study of healthy volunteers who received a single oral dose of repaglinide, the AUC was 188% h igher in

PAGE 17

17 521CC carriers as compared to TT carriers (Niemi et al., 2005a) In another healthy volunteer study, the 521T>C was again found to be associated with increased AUC and there was a trend toward enhanced gluc ose lowering correlated to AUC (Kalliokoski et al., 2008b) Conversely, the SLCO1B1*1b haplotype, which is associated with enhanced uptake, has been associated with reduced exposure of repaglinide, consistent with i ncreased hepatic uptake (Kalliokoski et al., 2008a) Poly morphisms have also been identified in the SLCO1B3 SLCO2B1 and SLCO1A2 genes (Zar et al., 2008; Franke et al., 2009; Sissung et al., 2010) In a pharmacokinetic study in renal transplant patients receiving the im munosuppressant mycophenolate the SLCO1B3 334T>G SNP was evaluated and the GG genotype was found to be associated with lower oral clearance of the metabolite mycophenolic acid (Miura et al., 2007a) The investigato rs concluded that the SLCO1B3 334T>G SNP explains in part the high interindividual variability in mycophenolate pharmacokinetics. At this time, the function of SLCO1A2 SNPs and their effects on pharmacokinetics and drug response are not well understood (Franke et al., 2009) However, three SLCO1A2 SNPs within the promoter region show trends of altered clearance of the anticancer drug imatinib (Yamakawa et al., 2011) Organic Cation Transporters Organ ic cation transporters (OCTs), first identified in the kidney, are members of the SLC22A family. OCTs are primarily expressed in the kidney and liver and facilitate the influx of low molecular weight cations across the basolateral membranes of renal proxim al tubules and hepatocytes (Koepsell et al., 2007) OCT2 is considered to be kidney specific and OCT1 is liver specific, although OCT1 is also expressed in the intestines At the basolateral membrane of the renal proximal tubule, OCT2 fluxes drug

PAGE 18

18 from the blood into the tubule, which is the first step in active secretion prior to elimination from the kidney. Similarly, OCT1 is involved with the first step of hepatic elimination by fluxing drug from the blood into the hepatocytes. The final member, OCT3, is broad ly expressed but is not recognized as highly important in drug disposition and response as OCT2 and OCT1. The OCTs share some substrate specificity and transport creatinine, metformin, procainamide, oxaliplatin, as well as other drugs. OCT3 is involved wi th the transport of monoamine neurotransmitters. Rifampin, a pregnane X receptor agonist, has been identified as an OCT1 inducer (Cho et al., 2011) Drugs that have been identified as inhibitors include ci metidine, quinidine and pilsicainide (Koepsell et al., 2007; Ciarimboli, 2008) A number of drug interactions resulting in reduced renal clearance due to OCT inhibition have been reported. A case report of an interaction between the OCT inhibitors certirizine and pilsicainide has been described in which increased plasma concentrations of pilsi cainide resulted in severe arrhythmia in an individual with existing renal insufficiency (Tsuruoka et al., 2006) The authors then evaluated this interaction in a clinical pharmacokinetic study in healthy volunteers and observed reduced renal clearance for both certirizine (38% decrease) and pilsicainide (41% decrease ) when the drugs were coadministered (Tsuruoka et al., 2006) Many drug interactions with the OCT inhibitor cim etidine have also been reported. For example cimetidine inhibits renal clearance of the OCT substrate metformin. In a clinical pharmacokinetic study in healthy volunteers, the AUC of metformin was increased by 50% and renal clearance decreased by 27% afte r cimetidine administration (Somogyi et al., 1987)

PAGE 19

19 OC T2 has been found to be particularly important to the elimination of metformin as metformin is renally excreted primarily by active secretion. However, there is evidence that OCT1 is also significant to metformin elimination. P olymorphisms within SLC22A1 and SLC22A2 affect metformin disposition and response (Shu et al., 2007; Shu et al., 2008; Song et al., 2008; Becker et al., 2009; Chen et al., 2009) In a healthy volunteer study, individuals with ge notypes associated with reduced function OCT1 had higher metformin AUC and C max values as compared to indiv iduals with the reference genotype (Shu et al., 2008) The authors, Shu et al., also investigated the effect of OCT1 polymorphisms on plasma glucose levels in healthy volunteers during oral glucose tolerance testing (OGTT) when metformin is administered They found that both reference carriers and variant carriers o f OCT1 polymorphisms had similar glucose levels after OGTT in the absence of metformin. However, in the presence of metformin, the variant carriers had 17 % higher glucose AUCs as compared to the reference carriers. In addition, metformin produced significant reductions in glucose AUC as compared to the control phase in reference carriers, but not in variant carriers (Shu et al., 2007) Eff ects of OCT1 polymorphisms have also been evaluated in diabetic patients. In a study evaluating HbA1C in diabetic patients being treated with metformin, the OCT1 ANP rs622342 A>C was a ssociated with glucose lowering in that for each C allele, the reduction in HbA1C was 28% less (Becker et al., 2009) Likewis e, in another healthy volunteer study in an Asian population, OCT2 variant carriers (808G>T, 596C>T, and 602C>T) had significantly higher metformin AUC and C max values and lower renal clearance as compared to the reference carriers, which is consistent wit h reduced renal uptake (Song et al., 2008) Conversely in a similar study

PAGE 20

20 in a European and African ancestry population, the variant carriers of the 808G
PAGE 21

21 mediated by inhibition of OAT3 have been described in which methotrexate toxicity occurred with coadministration of ketoprofen (Thyss et al., 1986; Takeda et al., 2002) While OATs are evidently important in the disposition of many drugs that are dependent on renal clearance, there have be en no reports of the effects of OAT genetic variation on drug disposition. However, a genetic variant has been associated with blood pressure response to hydrochlorothiaz ide. The intergenic polymorphism between SLC22A6 and SLC22A8 which encode for OAT1 and OAT3, was evaluated in hypertensive patients receiving hydrochlorothiazide and greater blood pressure reduction was observed in the GG carriers versus the C allele carr iers (Han et al., 2011) The authors concluded that this polymorphism may affect the expression or function of OAT1 and OAT3 and that OATs may have a role in blood pressure regulation. Efflux Transporters of the ATP Binding Cassette Superfam ily P Glycoprotein P glycoprotein (P gp), also known as multidrug resistance protein, is the most studied member of the ABC superfamily. P gp was first recognized as an important determ inant of drug disposition as it s overexpression i s associated to multid rug resistance in cancer s (Sharom, 2008) Transport mediated by P gp can have a major impact on the disposition and response of its substrate drugs P gp is widely expressed throughout the body at tissue barriers and through efflux prevents the absorption and accumulation of toxins and drugs S pecifically, P gp is expressed on endothelial cells of the blood brain barrier (BBB) where it can reduce the accumulation of drugs in the brain, the apical surface of enterocytes where it can reduce intestinal absorption, as well as placenta where it may a ct to protect the fetus (Choudhuri and Klaassen, 2006) In

PAGE 22

22 addition to reducing absorpti on across biological barriers, P gp is also expre ssed on the lumen of renal proximal tubules and at the bile canaliculus in hepatocytes where it can facilitate elimination by effluxing drugs into the urine and bile, respectively (Zhou, 2008) P gp has broad substrate specificity, including anticancer drugs, antivirals, immunosupressants, antiepileptics, steroids, analgesics and antihypertensives (Zhou, 2008) The efficacy of these substrate drugs can be severely reduced as P gp can limit the absorption systemically and access to drug target sites. Verapamil, cyclosporine ritonavir and quinidine are known p gp in hibitor (Zhou, 2008) However drugs that can inhibit or modulate P gp are being developed f or the sole purpose of increasing the bi oavailability and efficacy of P gp substrate drugs P gp can also be induced by the pregnane X receptor (PXR) agonist rifampin (Urquhart et al., 2007) Drug interactions due to P gp inhibition and induction resulting in changes in pharmacokinetics and drug response have been reported For instance t he P gp inhibitor ritonavir has been shown to increase digoxin AUC by 86% and reduce renal clearance by 35% after coadministration of oral ritonavir and intravenous di goxin due to inhibition of P gp resulting in reduced renal tubular elimination (Ding et al., 2004) An interaction between the P gp inhibitor quinidine and the P gp substrate loperamid e in which respiratory depression occurred has also been re ported (Sadeque et al., 2000) L operamide is an opiate, but does not usua lly produce CNS effects as P gp prevents penetra tion into the CNS. In this case, quinidine inhibited P gp at the brain endothelium a nd allowed access of loperamide into the CNS as this interaction was not explained by changes in systemic loperamide concentrations.

PAGE 23

23 Genetic variation in the ABCB1 gene, which encodes P gp, has also been associated with drug disposition and response (Ieiri, 2012) The most studied SNP is 3435C>T, which is commonly evaluated with the 2677G>T and 1236C>T SNPs as a haplotype. As P gp has been implicated in resistance to antiepileptic drugs, the 3435C>T variation was evaluated in epileptic patients rec eiving phenobarbital (Lscher et al., 2009) The investigators observed equivalent phenobarbital serum concentrations among the CC, CT, and TT carriers, however, the variant homozygo tes (TT) had higher phenobarbital CSF concentrations versus the C carrie r s. Additionally, CC carriers were found to have greater seizure frequency than the variant carriers. In this case, the variant was shown to be associated with greater drug penetration into the CNS as evidenced by increased CSF concentrations and greater efficacy. However the observed associations with ABCB1 genetic variation have been inconsistent overall in various disease states and populations (Chinn and Kroetz, 2007) Breast Cancer Resistance Protein Breast Cancer Resi stance Protein (BCRP) is also associated with multidrug resis tance and was first identified in cancer cell lines (Doyle et al., 1998; Miyake et al., 1999) BCRP is expressed in the intestines, kidney, liver, placenta, brain endothelium, and mammary tissue (Choudhuri and Klaassen, 2006) Like P gp, BCRP also limits absorption across tissue barriers and facilitates elimination and thus is important to drug dispo sition and response There is considerable overlap in substrates between BCRP and P gp. BCRP substrates include anticancer drugs, antivirals, antibiotics, and statins (Choudhuri and Klaassen, 2006; Degorter et al., 2 012) Estrone and 17 estradiol are

PAGE 24

24 known inhibitors (Giacomini et al., 2010) There is also interest in the development of BCRP inhibitors, such as the investigational P gp/BCRP modulator elacridar. In a phase 1 study in cancer patients, the effect o f elacridar on the disposition of topotecan, a BCRP substrate, was studied (Kruijtzer et al., 2002) When topotecan was administered with e lacridar topotecan AUC and bioavailability increased by 140% and 97%, respe ctively These results are promising as efflux transporters can significantly influence the eff icacy of their substrate drugs, especially anticancer drugs. Genetic variation of the gen e that encodes BCRP, ABCG2 has also been shown to have effects on pharm acokinetics and efficacy (Ieiri, 2012) The effect of the most commonly studied ABCG2 SNP, 421C>A, on topotecan pharmacokinetics was evaluated, and the investigator s found that cancer patients carrying the variant allele had higher topotecan concentrations and bioavailability as compared to non carriers when topotecan was administered orally (Sparreboom et al., 2005) However, this effect was not observed when IV topotecan was administered indicating reduc ed BCRP efflux in the intestine (improved bioavailability) of variant allele carriers The effect of the 421C>A SNP on atorvastatin and rosuvastatin has also been studied (Keskitalo et al., 2009) This study was conducted in healthy volunteers who each received a single oral dose of atorvastatin and rosuvastatin on two separate occasions. The investigators observed significantly higher AUC values for both atorvast atin and rosuvastatin in the homozygote variants (AA). The magnitude of effect was greatest with rosuvastatin in which AA carriers had AUC values 100% and 14 4% higher than CA and CC carriers, respectively. Further, the 421A variant has been associated with greater reduction in

PAGE 25

25 LDL concentrations ( improved efficacy) in hypercholesterolemic patients who received rosuvastatin (Tomlinson et al., 2010) Multidrug Resistance Associated Proteins Multidrug Resistance Associated Proteins (MRPs) were first identified in cancer cell lines and like P gp and BCRP have been implicated in drug resistance to a wide variety of anticancer and antiviral drugs (Cole et al., 1992; Sharom, 2008) MRPs belong to the ABCC subfamily and include 9 members, however MRP2 has been the most studied in drug dispos ition MRP3 and MRP4 are also considered to be important drug transporters. MRPs are primarily expressed in the intestine, liver, kidney, and brain (Choudhuri and Klaassen, 2006) MRP2 is localized on the apical membrane of these sites, MRP3 on the basolateral membrane of hepatocytes and renal proximal tubules, and MRP4 on the basolateral membrane of hepatocytes and the apical membrane of r enal proximal tubules and the brain endothelium (Giacomini et al., 2010) MRP substrates include anticancer drugs, antivirals, glutathione and glucuronate conjugates, and bile acids (Choudhuri and Klaassen, 2006) Cyclosporine efavirenz, emtricitabine, and NSAIDs are known to inhibit MRPs while rifampin is known to induce (El Sheikh et al., 2007; Urquhart et al., 2007; Giacomini et al., 2010) MRP2 has been recognized as playing a role in drug drug interaction and clinically relevant polymorphisms have been discovered For instance, mycophenolate, a substrate of MRP2, has high interindividual vari ability in pharmacokinetics and some of this variability in part is due to variability in enterohepatic circulation of the metabolite mycophenolic acid. In a clinical study in patients receiving mycophenolate, it was observed that those who were also takin g NSAIDS did not have evidence of enterohepatic circulation of mycophenolic acid as compared to those w ho were not

PAGE 26

26 receiving NSAIDs (Fukuda et al., 2011) As NSAIDs have been shown to inhibit MRP2 efflux (El Sheikh et al., 2007) the authors suggested that MRP2 inhibition by NSAIDs was the mechanism of this pharmacokinetic interaction. The effect of the MRP2 24C>T SNP on mycophenolate pharm acokinetics was also evaluated (Lloberas et al., 2011) The investigators fo und that variant carriers had reduced mycophenolic acid exposure at steady state as compared to the CC carriers. This effect was only observed in patients who were receiving tacrolimus and sirolimus as part of their immunosuppressant regimen, not in those receiving cyclosporine. However, cyclosporine is a MRP2 inhibitor (Hesselink et al., 2005) and the authors concluded that cyclosporine masks the effect of the genetic variation. Transporter Drug Metabolizing Enzyme Interplay Due to the significant overlap in substrat es between transporters and metabolic enzymes, it is important to also consider interplay as transporters can affect metabolism (Benet, 2009) P gp efflux can affect intestinal absorption and therefore intestinal metabolism while OATP mediated uptake in the liver can affect hepatic metabolism. The effects of rifampin (P gp/CYP3A inducer and OATP inhibitor) on glyburide (substrate for P gp, CYP3A, and OATP) pharmacokinetics were evaluated in a clinical study in which intravenous rifampin was administered with glybu ride as a single dose before and after six days of oral rifampin (Zheng et al., 2009) Glyburide pharmacokinetics were analyzed before rifampin (control phase) and after the first IV rifampin dose, the six days of o ral rifampin (induction phase), and the repeated IV rifampin dose after the induction phase. As compared to the control phase, the AUC of glyburide and its metabolite were significantly increased after the single dose of IV rifampin due to hepatic OATP inh ibition (decreased clearance). Rifampin was then

PAGE 27

27 administered orally for six days, adequate time to induce P gp and CYP3A, and the AUC of glyburide and its metabolite were greatly reduced compared to the control phase due to induction of P gp and CYP3A (re duced bioavailability). Interestingly, when the IV rifampin dose was repeated, hepatic inhibition masked the effects of P gp/CYP3A induction and the AUC of glyburide and its metabolite were similar to the control phase. Summary In summary, the studies revi ewed illustrate the importance of the role of drug transporters in disposition and response. Drug transporters have been implicated in drug interactions resulting in either sub or supra therapeutic concentrations, and correspondingly reduced efficacy or i ncreased toxicity. Genetic variation can also be important as it can affect the expression and/or function of drug transporters As more drugs are being recognized as substrates for transport and the importance of transport is increasingly realized, it is critical that we fully understand the impact of these transporters. This understanding will ultimately help guide us in predicting clinical efficacy, toxicity, and drug interactions. The overall goal of this work was to evaluate the effects of botanical in teractions and genetic variability on OATP mediated transport. Study Objectives D etermine the effect of organic anion transporting polypeptide 1B1 (OATP1B1) reduced function carrier status on atorvastatin response. Our hypothesis was that reduced functio n carrier status would be associated with diminished lipoprotein reduct ion and enhanced inflammatory marker reduction as compared to non carriers. C haracterize the e ffect of green tea extract (epigallocatechin gallate) on OATP mediated drug transport by cond ucting a clinical pharmacokinetic study in healthy volunteers w ith the OATP probe fexofenadine We hypothesize d that fexofenadine ex posure would be changed after a single dose of green tea extract due to decreased OATP mediated uptake.

PAGE 28

28 Table 1 1 SLC and ABC transporters important to drug disposition and response Selected substrates Selected inhibitors Expression SLC transporters OATP1B1 Statins, repaglinide, valsartan, bilirubin, bile acids Cyclosporine, rifampin, ritonavir Liver OATP1B3 Fexofenad ine, telmisartan, statins, bile acids Cyclosporine, rifampin, ritonavir Liver OATP1A2 Fexofenadine, methotrexate, levofloxacin, statins, bile salts Naringin, rifampin, ritonavir Intestines, liver, kidney, brain OATP2B1 Fexofenadine, statins, glyburide Cy closporine, rifampin Liver, intestines OAT1 Zidovudine, lamivudine, tenofovir, ciprofloxacin Probenecid Kidneys, placenta OAT3 NSAIDs, furosemide, bumetanide Probenecid Kidneys, brain OCT1 Metformin, oxaliplatin Quinine, quinidine Liver, intestines OCT 2 Metformin, pindolol, ranitidine, varenicline Cimetidine, certirizine Kidneys ABC transporters ABCB1 Digoxin, loperamide, doxorubicin, paclitaxel Cyclosporine, quinidine Intestines, kidneys, liver, brain BCRP Mitoxantrone, methotrexate, topote can, imatinib, statins E strone, 17 estradiol, Intestines, liver, kidneys, brain, placenta, breast MRP2 Glutathione and glucuronide conjugates, methotrexate Cyclosporine, efavirenz, emtricitabine Liver, kidneys, intestines MRP3 Methotrexate, glucuronate conjugates Efavirenz, emtricitabine Liver, intestines MRP4 Adefovir, tenofovir, furosemide,topotecan Celecoxib, diclofenac Kidneys, liver

PAGE 29

29 Table 1 2 Selected transporter mediated drug interactions Involved transporter Perpetrator Victim drug Impact on victim drug Reference SLC transporters Hepatic OATP Cyclosporine Pravastatin AUC 890% (Neuvonen et al., 2006) Cyclosporine Rosuvastatin AUC 610% (Simonson et al., 2004) Rifampin Glyburide AUC 125% (single dose IV ) (Zheng et al., 2009) Intestinal OATP Grapefruit juice Fexofenadine AUC 52% (Glaeser et al., 2007) Grapefruit, orange and apple juice Aliskire n AUC 60% (Tapaninen et al., 2010a; Tapaninen et al., 2010b) OAT NSAIDs Methotrexate Renal CL 20% (Kremer and Hamilton, 1995) Probenecid Acyclovir AUC 40% ,Renal CL 32% OCT Certirizine Pilsicainide Renal CL 41% (Tsuruoka et al., 2006) Cimetidine Metformin AUC 50% ,Renal CL 27% ABC transporters P gp Ritonavir Digoxin AUC 86% ,Renal CL 35% (Ding et al., 2004) Itraconazole Fexofenadine AUC 178% Rifampin Glyburide AUC 63% (multi dose PO) (Zheng et al., 2009) BCRP Elacridar Topotecan AUC 140% (Kruijtzer et al., 2002) MRP NSAIDs Mycophenolate E nterohepatic circulation (Fukuda et al., 2011)

PAGE 30

30 Figure 1 1 Localization of selected uptake and efflux transporters

PAGE 31

31 CHAPTER 2 EFFECT OF OATP1B1 REDUCED FUNCTION CARRI ER STATUS ON ATORVASTATIN RESPONSE Background Hydroxymethylglutaryl coenzyme A (HMG CoA) reductase inhibitors, or statins, are widely used to treat dyslipidemia and reduce the risk of stroke and heart attack. While cardiovascular risk reduction is associa ted primarily with lowering low density lipoprotein (LDL) concentrations, recent evidence indicates that anti inflammatory effects also contribute to overall risk reduction (Albert et al., 2001; Waehre et al., 2004; Ridker et al., 2005; Zineh et al., 2006a; Zineh et al., 2008; Ridker et al., 2009; Carter, 2010; Lopez Pedrera et al., 2012; Pea et al., 2012) Statins modulate inflammation in atherosclerosis through actions on pro inflammatory cytokines, chemokines, an d growth factors. Recently, the JUPITER trial demonstrated that rosuvastatin reduced cardiovascular events in individuals with low baseline LDL values who achieved goal concentrations of the inflammatory biomarker high sensitivity C reactive protein (hs CR P) (Ridker et al., 2009) .In our study, we sought to determine whether atorvastatin decreases the concentrations of the inflammatory markers thrombopoietin (TPO), monocyte chemotactic protein 1 (MCP 1), interleukin 1 receptor, type I (IL 1RA), and epithelial cell derived neutrophil activating peptide 78 (ENA 78). These markers have been shown to be involved in inflammatory processes that contribute to cardiovascular disease. The cytokine IL 1 antagonist, IL 1RA, is r eleased during inflammation, can be modulated by statins, and may protect against coronary artery disease (CAD) and acute coronary syndrome (ACS) (Waehre et al., 2004; Kwaijtaal et al., 2005; Rothenbacher et al., 20 05; Wyss et al., 2010) MCP 1, a member of the CC chemokine family, is recognized as an angiogenic chemokine. MCP 1 acts as

PAGE 32

32 a potent monocyte attractant and has been associated with atherosclerosis, acute coronary syndrome, and coronary artery disease (Aiello et al., 1999; de Lemos et al., 2003; Martinovic et al., 2005) The CXC chemokine ENA 78 attracts and activates neutrophils and has been implicated in various inflammatory conditions, including diabetes, heart failure, ischemic stroke, and acute coronary syndrome (Damas et al., 2000; Zaremba et al., 2006; Hasani Ranjbar et al., 2008; Zineh et al., 2008) TPO is a humoral growth factor that enhances platelet activation an d adhesion and has been associated with unstable angina (Lupia et al., 2006) However, it is unknown how atorvastatin treatment alters these inflammatory markers acutely in a clinical setting. Additionally, variability in inflammatory marker changes should be considered as the response to statin treatment is highly variable (Zineh, 2007) The variability in response may be explained in part through genetic variation in hepatic uptake transporters, which has the potential to a ffect both pharmacokinetics and pharmacodynamics of statins. Statins are subject to extensive first pass metabolism and hepatic uptake. Hepatic uptake is facilitated by the hepatic organic anion transporting polypeptides (OATPs), particularly OATP1B1, whic h is encoded by the gene SLCO1B1 Polymorphisms in SLCO1B1 (e.g. 388A>G and 521T>C) have been shown to affect the disposition as well as drug response of statins and other OATP1B1 substrates (Niemi; Marzolini et al. 2004; Tachibana Iimori et al., 2004; Thompson et al., 2005; Maeda et al., 2006; Takane et al., 2006; Zhang et al., 2007; Link et al., 2008; Maeda and Sugiyama, 2008; Kalliokoski and Niemi, 2009; Romaine et al., 2010) In a pharmacokinetic study evaluat ing the 521T>C SNP, atorvastatin exposure, as measured by the area under the concentration time curve (AUC), was 61% and 144%

PAGE 33

33 greater in heterozygous and homozygous carriers of the variant allele, respectively (Pasa nen et al., 2007) Likewise, the 388A>G and 521T>C SNPs have been shown to be associated with an attenuated statin response, in terms of changes in LDL, total cholesterol, and high density lipoprotein (HDL) (Tachib ana Iimori et al., 2004; Thompson et al., 2005; Takane et al., 2006; Zhang et al., 2007) However, patients taking atorvastatin were only a small subset of a study evaluating the effect of the 521T>C SNP on statin response (Tachibana Iimori et al., 2004) While OATP1B1 SNPs have been shown to have a substantial impact on atorvastatin exposure, little is known about how these SNPs may affect response to atorvastatin, particularly an anti inflammatory response. We hypothesized that atorvastatin would reduce inflammatory marker concentrations and that atorvastatin response would be mitigated (lipoprotein mar kers) or enhanced (inflammatory markers) in OATP1B1 reduced function haplotype carriers as compared to the non carriers. The objective of this study was to determine the effect of atorvastatin treatment as well as OATP1B1 reduced function carrier status on lipoprotein (total cholesterol, low density lipoprotein, high density lipoprotein, and triglyceride) and inflammatory marker (high sens itivity C reactive protein (hs CRP), thrombopoietin (TPO), monocyte chemotactic protein 1 (MCP 1), interleukin 1 recepto r, type I (IL 1RA), and epithelial cell derived neutrophil activating peptide 78 (ENA 78)) concentrations in our study population of individuals without cardiovascular disease. Methods Study Population The study population and protocol have been described previously (Zineh et al., 2006b) Briefly, individuals were eligible for participation if they were at least 18 years of

PAGE 34

34 age and with out known coronary disease, symptomatic carotid artery disease, peripheral vascular disease, abdominal aortic aneurysm, diabetes mellitus, dyslipidemia requiring treatment, or Framingham 10 year cardiovascular disease risk greater than 20%. Additionally, i ndividuals were excluded for pregnancy, malignancy, liver transaminase levels greater than 2 times the upper limit of the laboratory reference range, active alcohol abuse, history of myositis, current treatment with systemic glucocorticoids or anti inflamm atory drugs, and previous treatment with any prescribed lipid lowering therapy. All participants provided written informed consent; the study protocol was approved by the University of Florida Institutional Review B oard. Study Protocol I ndividuals eligible for participation started a 2 week control phase in which no atorvastatin was administered and then a treatment phase in which they received atorvastatin 80 mg per day for 16 weeks. Study visits occurred every 4 weeks during the treatment phase. At these study visits, the participants were counseled to maintain their current level of diet and exercise and blood was drawn for biochemical analysis. Blood samples were collected in the fasting state at baseline, 8 and 16 weeks for low density lipoprotein ( LD L ) and high sensitivity C reactive protein ( hs CRP ) analyses in a clinical laboratory. Women of child bearing potential had to use a reliable form of contraception throughout the study and were given a pregnancy test at each study visit. Blood for DNA isol ation was collected from participants who consented to subsequent genetic analyses during the original study. Inflammatory Marker Measurement Blood hs CRP concentrations were determined by biochemical analysis in the Shands Hospital clinical laboratory. T hrombopoietin (TPO), monocyte chemotactic

PAGE 35

35 protein 1 (MCP 1), interleukin 1 receptor, type I (IL 1RA), and epithelial cell derived neutrophil activating peptide 78 (ENA 78) protein concentrations were measured in plasma using standard ELISA methods (R&D Sys tems Inc., Minneapolis, MN). To avoid diurnal variation in cytokine expression, blood samples were drawn between 7:00 am and 10:00 am. All samples were assayed in duplicate. Genotyping Genotypes of each subject were determined by polymerase chain reaction (PCR) with subsequent Pyrosequencing methods for the 388A>G (rs2306283) and 521T>C (rs4149056) single nucleotide polymorphisms (SNPs) within the SLCO1B1 g ene. The pyrosequencing PCR reaction contained approximately 50 10 T able 2 1. PCR conditions were: 95C for 2 min, followed by 45 cycles of 95C for 30 s, 58C for 30 s, and 72C for 30 s, and a final extension at 72C for 7 min. To detect polymorphisms, the PSQ 96A genotyping platform (Biotage AB, Uppsala, Sweden) was use was used for sequencing reactions. All subject samples were assayed in duplicate. Haplotype Assignments Genotypes were used to determine reduced function haplotype carrier st atus. SLCO1B1 haplotypes were determined based upon the 388A>G and 521T>C SNPs, with no variants as *1a or wild type, 388A>G SNP as *1b, 521T>C SNP as *5, and both 388A>G and 521T>C SNPs as *15. Haplotype estimates were inferred using the Bayesian method b ased program PHASE (Stephens et al., 2001; Stephens and Scheet,

PAGE 36

36 2005) For our analysis, we designated carriers of the *1a and *1b alleles as non carriers and the *5 and *15 alleles as reduced function carriers. St atistical Analysis Result s are expressed as mean difference standard deviation. The data were analyzed using the program SAS for Windows version 9.3 (SAS Institute, Cary, NC) Inflammatory marker concentrations at baseline and after atorvastatin treatmen t were compared using the two tailed paired t test. The Square and the two tailed unpaired t test were OATP1B1 reduced function carrier and non carrier groups. Measurements fro m week 8 were carried forward for subjects missing week 16 measurements (n=9). Variances we re compared by the F test. Differences were considered statistically significant if P was less than 0.0 5 Based upon the number of subjects in our study, it was esti mated that we were able to detect an effect size of 0.68 standard deviations for lipoprotein and inflammatory marker concentrations between baseline and after treatment in the entire study population and between the OATP1B1 reduced function carrier and non carrier groups, respectively, with 80% power and a level 5%. Results Study Population Characteristics The study population included 81 individuals with a mean age of 31.2 ( 13) years. The study population consisted of 64% females, 73% Caucasians, 10% Hi spanics, 7% Asians, 5% African Americans, and 5% self identified as "other race or ethnicity." Subjects were determined to be carriers or non carriers of a reduced function haplotype based upon their genotypes of the 388A>G and 521T>C SNPs in the SLCO1B1 g ene.

PAGE 37

37 There were 26 subjects (32%) classified as reduced function carriers and 55 subjects (68%) classified as non carriers. Atorvastatin Effects on Inflammation We compared lipoprotein and inflammatory marker concentrations at baseline and after atorvastat in treatment (Table 2 2). As expected, we detected significant decreases in total cholesterol (34%), l ow density lipoprotein (LDL) (55%), and triglyceride (27 %) concentrations over the treatment period. In addition, we detected a significant decrease in se rum thrombopoietin ( TPO ) (6%), h owever, there were no other significant changes in infl ammatory marker concentrations. Genetic Associations with Atorvastatin Response We compared the atorvastatin response by change in lipoprotein and inflammatory markers c oncentrations between the OATP1B1 reduced function haplotype carrier and non carrier groups (Table 2 3). We foun d no significant differences in change of total choles terol, LDL, HDL, or triglyceride concentrations. Total cho lesterol decreased by 33% and 36 % and LDL decreased by 54% and 56 % in the non carrier and carrier groups, respectively. Further, we did not detect any significant differences in change of high sensitivity C reactive protein ( hs CRP), epithelial cell derived neutrophil activating peptide 78 (ENA 78) monocyte chemotactic protein 1 (MCP 1), interleuk in 1 receptor, type I (IL 1RA), or thrombopoietin (TPO) concentrations. Discussion In this study, we hypothesized that atorvastatin would reduce inflammatory marker concentrations and that haplo types associated with reduced SLCO1B1 function would alter atorvastatin response. In our study, we observed a 6% decrease in serum thrombopoietin ( TPO ) concentrations after atorvastatin treatment, but we were unable to

PAGE 38

38 detect any other significant reductio ns in inflammatory marker concentrati ons Further, OATP1B1 reduced function haplotype carrier status did not alter atorvastatin mediated changes in lipoproteins or inflammatory markers. Previous studies have shown that statins exert pleiotropic effects, i ncluding modulating inflammation. The PRINCE study showed that pravastatin reduced concentrations of the inflammatory marker hs CRP by 16.9% and 13.1% after 24 weeks of treatment in primary and secondary prevention groups, respectively (Albert et al., 2001) Recently, results of the JUPITER trial revealed significant risk reduction (65%) of myocardial infarction, stroke, unstable angina, arterial revascularization, and cardiovascular death in individuals taking rosuvastatin who achieved a dual LDL (<70 mg/dl) and hs CRP (<2 mg/L) red uction goal (Ridker et al., 2009) Risk reduction attributed to hs CRP reduction was determined to be independent of LDL reduction and greater risk reduction (79%) was observed for individuals who had hs CRP levels less than 1 mg/L (Ridker et al., 2009) Likewise, dual LDL (<70 mg/dl) and hs CRP (<2 mg/L) reduction was also compared between atorvastatin and pravastatin treatment in an analysis of the PROVE IT TIMI 22 trial (Ridker et al., 2005) In this analysis, individuals who met both goals had a 28% lower risk of recurrent myocardial infarction and vascular death, and of those the majority received atorvastatin 80 mg daily. These studies have shown reductions in inflammation, as measured by the marker hs CRP, in individuals receiving statin treatment for primary and secondary prevention. In addition to hs CRP, other inflammatory markers are also of interest in statin treatment. We chose to measure the inflammatory markers thrombopoietin (TPO), monocyte chemotactic protein 1 (MCP 1), interleukin 1 receptor, type I (IL 1RA), and epithelial

PAGE 39

39 cell derived neutrophil activating peptide 78 (ENA 78) as these markers may be modulated by stat ins and have been associated with cardiovascular disease (Aiello et al., 1999; Damas et al., 2000; de Lemos et al., 2003; Waehre et al., 2004; Kwaijtaal et al., 2005; Martinovic et al., 2005; Rothenbacher et al., 20 05; Lupia et al., 2006; Zaremba et al., 2006; Zineh et al., 2006a; Hasani Ranjbar et al., 2008; Zineh et al., 2008; Wyss et al., 2010) In our study, atorvastatin did not significantly reduce inflammatory marker concentrations with the exception of TPO, in our population. Our population consisted of generally healthy individuals who likely did not have a high level of inflammation at baseline. Others studies that did show reductions in inflammatory marker concentrations did so in individuals who either ha d heart disease or were considered at risk for heart disease. In this study, subjects received high dose atorvastatin (80 mg) for 16 weeks, which we believe would be a sufficient dose and duration to observe an effect. In addition, there was considerable v ariability in both baseline and after treatment inflammatory marker concentrations in our study population and it could be that we were unable to detect smaller differences. Because of the high variability, we decided to investigate whether genetic variati on could explain variability in atorvastatin mediated changes in inflammatory maker concentrations. Statins elicit lipid lowering effects by inhibiting HMG CoA reductase, an integral enzyme in cholesterol synthesis. The sites of action and metabolism for s tatins are within the hepatocytes. OATP1B1 facilitates hepatic uptake of statins and largely determines statin concentrations within the liver. It stands to reason that factors that affect the function of OATP1B1 would also affect statin concentrations due to altered

PAGE 40

40 hepatic uptake. For instance, the 521T>C SNP within the SLCO1B1 gene is associated with reduced OATP1B1 hepatic uptake; Pasanen et al. demonstrated that the area under the concentration time curve (AUC) of atorvastatin was markedly higher in ca rriers of the 521T>C SNP as compared to non carriers (Pasanen et al., 2007) Furthermore, the increase in AUC of atorvastatin in individuals homozygous for the 521T>C variant (CC) was more than two fold higher as c ompared to the heterozygous (TC) individuals (Pasanen et al., 2007) The 521T>C SNP has also been implicated in atorvastatin drug interactions as being a determinant in the severity of the interaction (He et al., 2009) The ef fects of this SNP are not limited to atorvastatin as the pharmacokinetic profiles of other statins are also altered by SLCO1B1 SNPs (Ho et al., 2007; Choi et al., 2008; Deng et al., 2008) Considering the critical role of OATP1B1 in statin disposition and the evident effects of SLCO1B1 SNPs on transport function, the effects of SLCO1B1 SNPs on statin response is of utmost interest. Most recently, a genome wide association study in the SEARCH trial evaluated approxim ately 300,000 markers in individuals with simvastatin induced myopathy. The results implicated a single variant, the OATP1B1 521T>C SNP, and the investigators estimated over 60% of the myopathy cases were attributed to the 521C variant (Link et al., 2008) This finding was replicated in the Heart Protection Study, which also identified for simvastatin an association between the 521T>C SNP and myopathy as well as lipid lowering (Link et al., 2008) The effect of SLCO1B1 SNPs on statin response as measured by lipid lowering has been evaluated in other studies as well (Tachibana Iimori et al., 2004; Thompson et al., 2005; Takane et al., 2 006; Zhang et al., 2007) The 521T>C SNP alone and in

PAGE 41

41 combination with the 388A>G SNP has been associated with decreased pravastatin efficacy in patients with hypercholesterolemia and coronary heart disease (Takane et al., 2006; Zhang et al., 2007) Atorvastatin was included in a small retrospective analysis in which the investigators found that subjects with the 521C variant experienced a diminished statin response (total cholesterol lowering) as compared to subje cts without the variant allele (Tachibana Iimori et al., 2004) However, in this study, the majority of the subjects rec eived either simvastatin or pravastatin, and only a small percentage (15%) of the subjects received atorvastatin (Tachiba na Iimori et al., 2004) In a larger analysis from the Atorvastatin Comparative Cholesterol Efficacy and Safety Study (ACCESS), 43 SNPs associated with statin response, including SNPs within the SLCO1B1 gene, were evaluated in individuals receiving atorva statin or one of four other statins (Thompson et al., 2005) In the ACCESS study, the OATP1B1 SNP 359+97C>A (rs4149036) was found to be associated with changes in triglyceride and the OATP1B1 SNPs 1748 97G>C (rs414 9080) and 521T>C were associated with changes in HDL concentrations (Thompson et al., 2005) but neither was associated with LDL concentrations. However, the subjects were evaluated every 6 weeks over 24 weeks and statin doses were titrated until they achieved goal cholesterol levels, which may have masked poor responders. Due to limited data, there is still a lack in knowledge of how OATP1B1 SNPs affect atorvastatin response. In our study, we evaluated SLCO1B1 hapl otypes based upon the 388A>G and 521T>C SNPs. For our analysis, we grouped the OATP1B1*1a and *1b haplotypes as non carriers, and the *5 and *15 haplotypes as reduced function carriers. We felt that it was appropriate to group the haplotypes as non carrier s and carriers of reduced

PAGE 42

42 function haplotype since the *1b is generally associated with OATP1B1 function comparable to the *1a or wild type haplotype, and the *5 and *15 haplotypes are both associated with reduced OATP1B1 function. Many in vitro studies ha ve demonstrated comparable transport function between the OATP1B1*1a and *1b haplotypes (Tirona et al., 2001; Nozawa et al., 2002; Iwai et al., 2004; Kameyama et al., 2005; Ho et al., 2006) including similar trans port of statins (Kameyama et al., 2005; Ho et al., 2006) Conversely, in vivo pharmacokinetic studies with pravastatin have suggested an increase in transport is associated with the *1b haplotype (Mwinyi et al., 2004; Maeda et al., 2006) but these studies were small and results from one of them only showed a trend toward decreased pravastatin AUC that was not statistically significant (Mwinyi et al., 2004) We did not find an association between OATP1B1 reduced function carrier status and atorvastatin response in our study. As the previous study protocol was not designed to collect blood samples for pharmacokinetic analysis, we were unable to determine if there were any differences in atorvastatin exposure based upon OATP1B1 haplotype status. However, based on previous studies a relevant difference in exposure could be expected. Since the OATP1B1 reduced function 521T>C SNP has been s hown to dramatically increase systemic atorvastatin exposure (AUC) (Pasanen et al., 2007) we expected to observe altered atorvastatin response in our study population. However, we did not observe any effect of OA TP1B1 reduced function status on atorvastatin response, and there may be a few reasons for this. First, atorvastatin is transported by other transporters in addition to OATP1B1, including the hepatic uptake transporter, OATP2B1. In the presence of reduced function OATP1B1, atorvastatin

PAGE 43

43 uptake may be compensated for by other transporters. Also, we may have observed an altered response with a different statin, such as simvastatin, since OATP1B1 has shown substrate specific effects. Lastly, in our study popula tion, there were only two individuals who were homozygous for 521T>C variant (*5/*5 haplotype). In a previous clinical pharmacokinetic study, Pasanen et al. detected a difference in simvastatin acid AUC between subjects homozygous for the 521T>C variant (C C) and heterozygous (TC) or wild type (TT) subjects, but no difference when the TC and TT subjects were compared (Pasanen e t al., 2006) Differences in atorvastatin response may have been observed with more individuals homozygous for the 521T>C variant. In conclusion, atorvastatin treatment did not significantly reduce inflammatory marker concen trations in our study of health y individuals without cardiovascular disease Further, reduced function OATP1B1 haplotype carrier status did not have an effect on atorvastatin mediated changes in lipoprotein and inflammatory marker concentrations.

PAGE 44

44 Table 2 1 Polymerase chain reaction p r imers Polymorphism SLCO1B1 c.388 A>G Forward [BioTEG]TGGTGCAAATAAAGGGGAATA Reverse ATGTTGAATTTTCTGATGA SLCO1B1 c.521 T>C Forward [BioTEG]GGAATCTGGGTCATACATGTGG Reverse AAGCATATTACCCATGAAC Table 2 2 Mean d ifference of lipoprotein and i n flammatory marker concentrations from b aseline Measurement Baseline Treatment Mean Difference P value Total cholesterol 181 38. 9 119 26 .0 62 .1 2 8.8 <0.0001 LDL 101 31 .2 46 .1 19.7 55 .3 23 .3 <0.0001 HDL 60.8 1 7.5 59 .4 16.8 1.48 1 0.6 0 .2102 Triglycerides 96 .3 5 2.7 70.0 42 .4 26 .3 3 3.9 <0.0001 hs CRP 2.07 3.07 1.75 3.67 0.14 3.73 0.7311 ENA 78 1544 1556 1433 1581 111 690 0.1509 MCP 1 168 6 8.5 159 65 .4 9.45 56 .9 0.1385 IL 1RA 602 400 610 384 8.30 229 0.7455 TPO 34 8 159 328 151 20.5 81.4 0.026 Data expressed as mean standard deviation

PAGE 45

45 Table 2 3 Mean d ifference of lipoprotein and inflammatory marker concentrations from baseline in non carriers and carrie rs of a reduced function OATP1B1 ha plotype Measurement Non carriers (n=55) Carriers (n=26) P value Total cholesterol 60.4 28.5 65.6 29.8 NS LDL 54.3 23.7 57.4 22.7 NS HDL 0.24 10. 8 4.12 9.59 NS Triglycerides 28.9 30.4 20.8 40.4 NS hs CRP 0.43 4.00 1.34 2.80 NS ENA 78 99.1 584 137 888 NS MCP 1 5.63 45.3 17.6 76.2 NS IL 1RA 18.3 232 12.8 228 NS TPO 15.4 83.8 31.2 76.5 NS Data expressed as mean standard deviation

PAGE 46

46 Figure 2 1 Percent reduction in LDL in non carriers and carriers of a reduced function OATP1B1 haplotype

PAGE 47

47 CHAP TER 3 VALIDATION AND APPLI CATION OF A LIQUID C HROMATOGRAPHY TANDEM MASS SPECTROMETRIC M ETHOD FOR QUANTIFICA TION OF THE DRUG TRANSPORT PROBE FEXO FENADINE IN HUMAN PL ASMA USING 96 WELL FILTER PLATES 1 Background Fexofenadine is a histamine H1 receptor antagonist used therapeutically for the treatment of allergic rhinitis and chronic idiopathic urticaria (Devillier et al., 2008) ; it is given orally i n doses ranging from 30 to 180 mg/day. F exofenadine is predominantly eliminated unchanged in bile (80%) and urine (11%) (Devillier et al., 2008) ; approximately 5% is metabolized forming methyl ester (3.6%) and azacy clonol (1.5%) metabolites (Lippert et al., 1995) The major determinants of fexofenadine absorption and elimination are the activity of drug transporters located in the intestine and liver (Devillier et al., 2008) Specifically, fexo fenadine is a substrate of the transporters P glycoprotein (P gp) and the organic anion transporting polypeptides (OATP) OATP1A2 and OATP1B3 (Cvetkovic et al., 1999; Shimizu et al., 2005; Devillier et al., 2008; Mats ushima et al., 2008a) The absorption of fexofenadine in the intestine is limited by the efflux transporter P gp but is enhanced by the uptake transporter OATP1A2 (Cvetkovic et al., 1999) while the elimination of fexofenadine in the liver is dependent on the hepatic uptake transporter OATP1B3 (Shimizu et al., 2005) Thus, fexofenadine is used as a pharmacologic probe of human drug transporters to characterize transporter activity in interaction studies with concomitant drugs, foods, or herbal products (Wang et al., 2002; Dresser et al., 2005; Kharasch et al., 2005; Yasui Furukori 1 Reprinted with permission from Sta nton ML, Joy MS, and Frye RF (2010) Validation and application of a liquid chromatography tandem mass spectrometric method for quantification of the drug transport probe fexofenadine in human plasma using 96 well filter plates. J Chromatogr B Analyt Techno l Biomed Life Sci 878: 497 501.

PAGE 48

48 e t al., 2005; Shimizu et al., 2006; van Heeswijk et al., 2006; Bailey et al., 2007; Glaeser et al., 2007; Robertson et al., 2008) and to evaluate the effects of genetic variation or disease state on transporter activity and function (Yi et al., 2004; Niemi et al., 2005b; Shon et al., 2005) As drug transport is increasingly recognized as a critical pathway in the disposition of many drugs, there is a need for simple analytical methods for probes such as fexofenadine to facilitate evaluations of drug transport er activity Several HPLC methods for determination of fexofenadine in biologic fluid s have been reported (Coutant et al., 1991; Hofmann et al., 2002; Naidong et al., 2002; Fu et al., 2004; Uno et al., 2004; Nirogi et al., 2006; Emara et al., 2007; Isleyen et al., 2007; Miura et al., 2007b; Nirogi et al., 2007; Yamane et al., 2007; Bharathi et al., 2008; Pathak et al., 2008; Guo et al., 2009) A few methods use ultraviolet (Emara et al., 2007; Miura et al., 2007b) or fluorescence detection (Coutant et al., 1991; Uno et al., 2004; Pathak et al., 2008) but most methods for determination of fexof enadine in human plasma are based on HPLC with mass spectrometric detection (Hofmann et al., 2002; Isleyen et al., 2007) and tandem mass spectrometric detection (Naidong et al ., 2002; Fu et al., 2004; Nirogi et al., 2006; Nirogi et al., 2007; Yamane et al., 2007; Bharathi et al., 2008) because of better sensitivity and selectivity. Sample processing for almost all of the methods reported use costly solid phase extraction (SPE) with C18 cartridges (Hofmann et al., 2002) (Naidong et al., 2002; Fu et al., 2004; Nirogi et al., 2006; Nirogi et al., 2007; Yamane et al., 2007; Bharathi et al., 2008) The typical range of quantification for the MS based methods is 1 500 ng/ml and the run times range from 2 to 10 min. Most of the methods reported use structurally related compounds for the internal standard (e.g., diphenhydramine, loratadine,

PAGE 49

49 terfenadine) (Hofmann et al., 2002; Naidong et al., 2002; Nirogi et al., 2006; Isleyen et al., 2007; Miura et al., 2007b; Nirogi et al., 2007; Yamane et al., 2007; Bharathi et al., 2008) ; only the method by Fu et al. (Fu et al., 2004) use s a deuterated internal st andard (fexofenadine d6) but that method requires 0.5 ml of plasma for processing by SPE Protein precipitation in microcentrifuge tubes was used in a method reported recently by Guo et al., (Guo et al., 2009) but the oral hypogl ycemic drug glipizide was used as the internal standard. Here in we present the validation of a sensitive method for fexofenadine determination in human plasma by liquid chromatography tandem mass spectrometry The method has several advantages including r apid sample processing based on protein precipitation and filtration in a 96 well plate format, a deuterated internal standard (fexofenadine d6), a small sample volume requirement ( 100 l human plasma ) and a total run time of 2 min with isocratic elution. The method is suitable for determination of fexofenadine concentrations in clinical pharmacokinetic studies. E xperimental Chemicals and Reagents Fexofenadine (>98% chemical purity) was purchased from Sigma Aldrich Co. (St. Louis, MO, U.S.A) and the deutera ted internal standard fexofenadine d6 (>98% chemical and >99% isotopic purity) was purchased from Toronto Research Chemicals Inc. (North York, ON, Canada). Chemical structures are shown in Figure 3 1. Acetonitrile and methanol, HPLC grade, and formic acid analytical grade were purchased from VWR International, LLC (West Chester, PA, USA). Human EDTA plasma was obtained from the U F & Shands Hospital blood bank (Gainesville, FL, USA); plasma was screened for the presence of fexofenadine prior to use HPLC gr ade

PAGE 50

50 deionized water was obtained from a Barnstead Nanopure Diamond UV Ultrapure Water System (Dubuque, IA, USA). Instrumentation and Chromatographic C onditions The LC MS/MS system included a Surveyor HPLC autosampler, Surveyor MS quaternary pump and a TSQ Quantum Discovery triple quadrupole mass spectrometer (Thermo Scientific, San Jose, CA, USA ). The TSQ Quantum mass spectrometer was equipped with an electrospray ion source (ESI) with the ESI source spray set orthogonal to the ion transfer capillary tube. The autosampler temperature was maintained at 10C. The analytical column was a Gemini C18 502.0 mm, 5 m (Phenomenex Torrance, CA, USA ) The mobile phase consisted of deionized water and methanol (35:65, v/v) that contained 0.1% formic acid and 5mM amm onium acetate and was pumped at a flow rate of 0.2 ml/min. The mobile phase was degassed and filtered through a 0.22m Nylon 66 membrane prior to use. The MS/MS conditions were optimized by using an infusion system with a mixing tee. Fexofenadine (1 g/ml at 5 l/min) was infused in one line of a mixing tee while mobile phase was delivered at 0.2 ml/min in the other line. For quantification, the TSQ Quantum was operated in high resolution single reaction monitoring mode (H SRM ). The ESI was operated i n the positive mode at a spray voltage of 4.6kV and source CID 10V with a heated capillary temperature of 375 o C. Nitrogen was used as the sheath and auxiliary gas and the flow rates were set to 35 and 10 units (arbitrary), respectively. The argon collisio n gas pressure was set to 1.5 mTorr. The collision energy was 41 eV for fexofenadine and fexofenadine d6 (internal standard). Fexofenadine was monitored at m/z 502.3 171.0 and fexofenadine d 6 at m/z 508.3 177.0 .The instrument was operated in enhanced (high) resolution with

PAGE 51

51 peak width (FWHM) set to 0.2 m/z at Q1 and to 0.7 m/z at Q3. The scan time was 300 ms for each transition. S RM data were acquired and processed using ThermoFinnigan XCalibur software version 1.4, service release 1 (Thermo Scientific San Jose, CA, USA). Standard Preparation Fexofenadine stock solutions were prepared in methanol at concentrations of 1, 10 and 100 g/ml. Dilutions of these stock solutions were used to prepare calibration standards and quality control (QC) samples. The stock solution for the internal standard was prepared by dissolving fexofenadine d6 in methanol at a concentration of 1 g/ml and then further diluted in acetonitrile to a concentration of 35 ng/ml. These stock solutions were stored at 20C. Calibration s tandards were prepared at concentrations of 1, 2, 5, 25, 50, 100, 250 and 500 ng/ml by spiking blank human plasma with varying quantities of the standard solutions (1, 10 or 100 g/ml ). These standard solutions were also used to prepare blank human plasma at concentrations of 10, 150 and 400 ng/ml for the QC samples. Standards and quality control samples were stored at 20C until analysis. Sample Preparation A cetonitrile (300 l) containing the internal standard (10.5 ng) and then p lasma (100 l) were pipe tted in to a 96 USA). The filter plate was mixed briefly and then inverted for 5 minutes at room temperature Next, the filter plate was fitted with a vacuum collar and 1 ml collection plate before fil tration by vacuum pressure. The resulting filtrate was diluted with 400 l water and injected into the HPLC system (10 l).

PAGE 52

52 Calibration and Linearity Calibration standards over the concentration range of 1 500 ng/ml were analyzed in duplicate for three run s; the lowest standard was analyzed in triplicate. Back calculated concentration values for each standard were considered acceptable if both the percent relative standard deviation (R.S.D.%) and the relative error (RE%) were within 15% ; the lower limit of quantification (LLOQ) was acceptable if the R.S.D.% and R.E.% were within 20%. Precision and Accuracy The intra and inter run precision (R.S.D.%) and accuracy (R.E.%) of the assay were determined by analyzing QC samples at concentrations of 10, 150 and 4 00 ng/ml for three runs. Six of each QC level were analyzed for two separate runs and twelve of each QC level were analyzed for one run (n=24). The calculated mean concentration relative to the spiked concentration was used to express accuracy as the relat ive error (R.E.%). Means, standard deviations and R.S.D.% were calculated from the QC values and used to estimate the intra and inter run precision. Dilution integrity was determined by processing six replicates of a dilution QC (1,000 ng/ml) after a 10 f old dilution. The mean accuracy was expressed as R.E.%. Selectivity and Stability Selectivity was evaluated by processing and analyzing blank plasma samples obtained from six different sources. Carry over was evaluated by injections of mobile phase placed in several wells of the analysis set. The autosampler stability of processed samples was evaluated by analyzing QC samples immediately and 24 hours after processing. After the first analysis, the QC samples were stored in the autosampler at 10 C for at lea st 24 hours and then re analyzed. The measured concentrations from

PAGE 53

53 both analyses were then compared to determine any differences due to the storage conditions. The stability after freeze and thaw was evaluated with low and high concentration QC samples, wh ich were subjected to three freeze thaw cycles prior to processing. The effects were measured by the concentrations of each QC relative to a newly processed reference sample. Matrix Effects and Extraction Efficiency The potential for matrix effects (suppre ssion or enhancement of ionization) was evaluated qualitatively by standard post column infusion experiments (King et al., 2000) Processed blank plasma samples from six independent sources were injected during a constant post column infusion of fexofenadine. In addition, to determine the presence of matrix effects quantitatively, the respon se obtained from plasma samples (n=6) spiked after processing and mobile phase spiked with an equivalent amount of fexofenadine were compared. Responses obtained from the spiked fexofenadine solution were defined as 100%. Extraction efficiency at low and h igh QC concentrations (10 and 400 ng/ml) was determined by comparing fexofenadine response in plasma samples (n=6) spiked before and after extraction, which was defined as 100% recovery. Application to Plasma Sampling Fexofenadine pharmacokinetics were eva luated in a research volunteer with renal manifestations of systemic lupus erythematosus. The subject granted written informed consent and the study was approved by the Committee on the Protection of Human Subjects at the University of North Carolina. The study sought to evaluate fexofenadine as a P glycoprotein probe substrate because glucocorticoids are substrates of this protein and are utilized in combination therapies for lupus nephritis. The subject had been receiving prednisone 60 mg daily for 90 day s prior to the pharmacokinetics study.

PAGE 54

54 The subject received intravenous cyclophosphamide at the time of fexofenadine administration. The subject was receiving aspirin which is a known inducer of P glycoprotein; no known inhibitors were prescribed. Fexofena dine 60 mg (Allegra, Aventis Pharmaceuticals Inc., Bridgewater, NJ, USA) was administered orally with 8 ounces of water. Plasma was collected over 72 hours and stored at 70oC until analyzed. Results and Discussion Chromatography Representative extracted ion chromatograms of plasma samples are depicted in Fig. 2; Fig. 2A shows a blank plasma sample and Fig. 2B is a plasma sample spiked with fexofenadine at the LLOQ (1 ng/ml). Fig. 2C depicts a plasma sample obtained from a study subject after a single dose of fexofenadine 60 mg. A plasma sample spiked with the internal standard fexofenadine d6 is shown in Fig. 2D. The retention time for fexofenadine and fexofenadine d6 was 1.2 minutes. Calibration and Linearity The calibration curve was linear over a concen tration range of 1 500 ng/ml using weighted (1/y2) linear regression, which was determined to be the best fit. Duplicate calibration curves were analyzed for three runs and the mean calibration curve equation was y = 0.004069x 0.000071 0.000867 0.000 141. The correlation coefficient (r 2 ) was greater than 0.99. Precision and Accuracy The intra and inter run accuracy (within 8%) and precision (within 4.3%) of the back calculated concentrations for the QC samples demonstrated an accurate and reproduc ible method (Table 2 1). Dilution integrity was determined by processing six

PAGE 55

55 replicates of the dilution QC (1,000 ng/ml) after a 10 fold dilution. The accuracy and reproducibility was found to be acceptable with a mean accuracy of 0.4% (R.E.%) and precisio n of 3.9% (R.S.D.%). Selectivity and Stability No interfering peaks were observed for fexofenadine or fexofenadine d6 in the processed plasma samples from six different sources and there was no evidence of carry over. Autosampler stability was determined b y comparing results for samples that were analyzed immediately and 24 hours after processing. The samples analyzed 24 hours after processing were stored in the autosampler at 10 C and the concentrations found did not deviate by more than 10%. The effect of freeze and thaw was evaluated in QC samples subjected to three freeze thaw cycles and no degradation of fexofenadine was observed (i.e., less than a 10% difference in measured concentration). Matrix Effects and Extraction Efficiency Recovery of fexofenadi ne at low and high QC concentrations was measured by comparing the response ratios of plasma samples that were spiked before and after processing. The response in samples spiked after processing were considered to be 100%. We determined the recovery for fe xofenadine to be 93.6 6.5% at low and 95.3 10.3% at high concentrations. In addition, there was no evidence of a matrix effect as there was < 10% difference in the fexofenadine response. The post column infusion experiment supported a lack of matrix ef fect. Application to Plasma Sampling This method was used to support a fexofenadine pharmacokinetic study in which fexofenadine was used a probe for transporter activity in patients with glomerulonephritis The concentration time profile for a study subjec t after

PAGE 56

56 administration of fexofenadine 60 mg as a single oral dose is shown in Fig. 3 The concentration values were consistent with values reported in the literature (Devillier et al., 2008) The method was shown to be suitable for pharmacokinetic studies of fexofenadine in human subjects. Incurred Sample Reproducibility To confirm assay accuracy and precision, we reanalyzed 20 incurred plasma samples using the same procedures as the initial analysis. Percentage differences in concentration were calculated and used to determine the average fold change or mean ratio (MR), ratio limits (RLs), and limits of agreement (LsA). Statistical analysis of the results showed a MR of 1.01, RLs of 0.99 1.0 3 (acceptance range, 0.83 1.20), and LsA of 0.93 1.11 (acceptance range, 0.83 1.20). The acceptance ranges were met for both the RLs and LsA, demonstrating assay reproducibility. Summary We have validated a rapid, sensitive, selective, and reproducible LC MS/MS method for determination of fexofenadine in human plasma. The method uses protein precipitation and filtration in a 96 well format, which from start to finish takes less than an hour to process manually. The rapid sample processing combined with the total chromatographic run time of 2 min facilitates multiple runs per day for high throughput applications. The method is currently being used to support clinical pharmacokinetic studies with the drug transport probe fexofenadine.

PAGE 57

57 Table 3 1 Intra and i nter run precision (R.S.D.%) and accuracy (R.E.%) for fexofenadine quality control samples in human plasma. Concentration (ng/ml) Precision ( R S D %) Accuracy ( R E %) Nominal Found (mean SD) Intra run (N=12) 1 (LLOQ QC) 10 1.10 0.22 10.45 0.4 5 20.0 4.3 10.0 4.5 150 158.3 2.0 1.2 5.5 400 429.4 7.3 1.7 7.3 Inter run (N=24) 1 (LLOQ QC) 10 1.09 0.21 10.41 0.41 19.7 3.9 8.9 4.1 150 156.6 2.8 1.8 4.4 400 431.9 7.8 1.8 8.0

PAGE 58

58 Figure 3 1 Chemical structures of (A) fexofen adine and (B) fexofenadine d6 (internal standard)

PAGE 59

59 Figure 3 2 Representative extracted ion chromatograms of: (A) blank plasma (B) fexofenadine lower limit of quantitation (LLOQ; 1.00 ng/ml); (C) plasma sample from a subject obtained 48 hours after oral administration of fexofenadine 60 mg (concentration = 1.62 ng/ml ); and (D) fexofenadine d6 (ISTD)

PAGE 60

60 Figure 3 3 Concentration time profile for a study subject administered single oral dose of fexofenadine (60 mg)

PAGE 61

61 CHAPTER 4 EFFECTS OF GREEN TEA EXTRACT ON FEXOFENADINE PHAR MACOKINETICS Background Drug transport plays a major role in the elimination of many drugs and is an important pathway of drug clearance (Giacomini et al., 2010) A key family of drug transporters is the organic anion transporting p olypeptide (OATP) family, which facilitate the uptake (absorption and/or elimination) of a large variety of drug substrates. Recognitio n of the important role of OATP mediated transport in drug disposition is increasing. Many drug interactions thought to b e mediated by OATPs have been reported (Ha n, 2011) The antihistamine drug fexofenadine is used as an in vivo probe for drug transporter activity since it is minimally metabolized (approximately 5%) (Lippert et al., 1995) and predominantly transported by intestinal OATP1A2 and hepatic OATP1B3 (Cvet kovic et al., 1999; Shimizu et al., 2005) Fexofenadine has been used to characterize OATP mediated uptake in the presence of disease (Nolin et al., 2009) genetic variation (Akamine et al., 2010; Imanaga et al., 2011) and concomitant drug use (Yasui Furukori et al., 2005; Matsushima et al., 2008b; Yamada et al., 2009) Herb drug and food drug interactions are becoming increasingly important, as it is now estimated that up to 38% of Americans use complementary and alternative medicin es (Su and Li, 2011) with up to 25% specifically using herbs or dietary supplements (Wu et al., 2011) Likewise, OATP mediated food and herb drug interactions have been reported (Dresser et al., 2005; Fuchikami et al., 2006; Fan et al., 2008; Mandery et al., 2010) Green te a extract is a n herbal product commonly used for its purported antioxidant effects and health benefits. The effects of green tea extract on drug metabolism enzymes have been investigated in preclinical and clinical studies,

PAGE 62

62 however, little is known about t he effects of green tea extract on drug transporters (Donovan et al., 2004; Nishikawa et al., 2004; Chow et al., 2006; Netsch et al., 2006; Mohamed et al., 2010) In an in vitro model, green tea extract or more spe cifically epigallocatechin gallate (EGCG), the primary constituent in green tea extract, was reported to potently inhibit OATP2B1, which is expressed in the intestines and liver (Fuchikami et al., 2006) Moreover, in a recent report evaluating the effects of EGCG on cells expressing OATPs, EGCG was shown to inhibit OATP1B1 OAT P 2B1 and OATP1A2 mediated uptake, while the effect of EGCG on OATP1B3 mediated uptake was substrate dependent as both stimulation and inhi bition were observed (Roth et al., 2009) Based on these re sults, EGCG appears to have predominantly inhibitory effects on OATP mediated transport However, to our knowledge, these effects have not been investigated in a clinical study. The aim of this study was to determine the effect of green tea extract on fex ofenadine pharmacokinetics in order to characterize in vivo the effects of green tea extract on OAT P mediated uptake We investigated the effect of single dose green tea extract (EGCG 800 mg) on fexofenadine pharmacokinetics in healthy volunteers Methods Study Participants Eight healthy volunteers (four males and four females) who were 18 years of age or older were enrolled in this study after giving written informed consent. The mean ( standard deviation) age and body mass index of study participants we re 30.9 ( 16.2) years (range 20 58 years ) and 25.0 ( 2.2 kg/m 2 ) (range 22.4 29.2 kg/m 2 ) respectively Each study participant was deemed to be healthy by physical exam, routine laboratory

PAGE 63

63 tests, and review of their medical histories. This study was approve d by the University of Florida Institutional Review B oard. Study Design This was a randomized open label crossover study consisting of two phases, a control phase and the EGCG phase. The order of the control and EGCG phase s for each of the par ticipants wer e randomly assigned using SAS version 9.2 (SAS Institute, Cary, NC) The phases were separated by 7 to 21 days. For each of the two study visits, participants were admitted to the Shands Clinical Research Center (CRC) at 8:00 PM the evening prior to the do sing day During the study visits, participants received a single oral dose of fexofenadine hydrochloride 60 mg either alone or after a single oral dose of green tea extract (EGCG 800 mg) For this study, we used EGCG Green Tea Extract (393 mg EGCG per dos e) by Relentless Improvement LLC (Reno, NV) from a single lot. This product has been used previously in studies sponsored by the National Center for Complementary and Alternative Medicine (NCCAM) and was approved for use through their product integrity rev iew committee. Fexofenadine was administered at 9:00AM for each study visit and green tea extract was administered at 8:00 AM during the green tea phase study visit. The participants received light snacks at 11:00 PM the evening of admission, 7:00 AM and 1 1:00 AM on the dosing day and were permitted to eat full meals after 1:00 PM and for the remainder of their study visit Standardized meals and beverages were prepared and provided by the CRC Metabolic Kitchen. Study participants w ere asked to abstain from alcohol, fruit juices, herbal teas and supplements, and over the counter medications prior to and during the study period.

PAGE 64

64 Plasma Collection and Determination of Fexofenadine and EGCG Venous blood samples (7 ml) were drawn into EDTA blood collection tubes before and at 0.5, 1, 2, 3, 4, 5, 6, 9, 12, 15, and 24 hours after administration of fexofenadine. The blood samples were stored on ice and plasma was separated with 30 minutes of collection and then stored at 80 C until analyzed. Fexofenadine plasma con centrations were determined by a sensitive and specific liquid chromatography tandem mass spectrometry method developed in our laboratory (Stanton et al., 2010) The limit of quantitation (LOQ) for fexofenadine is 1.0 ng/mL using 100 l plasma and the within run and between run precision is less than 5%. Plasma sa mples from the EGCG phase did not have any interfering peaks in the fexofenadine assay. Pharmacokinetic Analysis Fexofenadine pharmacokinetic parameter values were estimated from the plasma concentration time data using standard noncompartmental methods (W inNonlin, PharSight Corp., Mountain View, CA, USA). The maximum plasma concentrations (C max ), the time C max occurs (t max ), and the last plasma c oncentration measured, or the 24 hour concentration (C 24 ), were obtained directly from the individual plasma con centration time profiles. The terminal elimination rate constant ( z ) was estimated by linear regression of the terminal phase of the logarithmic plasma concentration time curve. Terminal elimination half life (t ) was calculated by dividing 0.693 by z A rea under the plasma conce ntration time curve from 0 to 24 hours (AUC 0 24 ) was calculated with the linear log trapezoidal rule. The area under the plasma concentration time curve from 0 to infinity (AUC 0 ) was calculated as AUC 0 24 + C 24 / z The apparent oral

PAGE 65

65 clearance (CL/F) was calculated from the equation CL/F = Dose/AUC and the apparent volume of distribution at steady state (V ss ) was calculated from the equation V ss = CL MRT (mean residence time). Statistical Analysis The results are expressed as me an standard devi ation and mean differences between the control and green tea phases. A two sample method for crossover studies wa s used to compare the fexofenadine pharmacokinetics between the two phases. Two sided 95% confidence intervals were also comp uted. The sample size of n=8 allowed for detection of a difference of 1.17 SD in the raw log scale measurement for AUC at 80% power and level 5%. Differences were considered s tatistically significant if p was less than 0.05. Linear regression was used to rule out an order effect. Data was analyzed with SAS version 9.3 (SAS Institute, Cary, NC). Results Plasma Concentrations and Pharmacokinetics of Fexofenadine Fexofenadine pharmacokinetic parameters following a single oral dose of 60 mg of fexofenadine in both the control and green tea phases are summarized in Table 4 1 and mean plasma fexofenadine concentration time profile s are shown in Figure 4 1 Figures 4 2 and 4 3 depict fexofenadine AUC 0 and C max values respectively. The mean plasma concentration s of fexofenadine in the green tea phase were lower than those in the control phase (Figure 4 1 ). G reen tea ext ract (EGCG 800 mg) significantly decreased fexofenadine mean AUC 0 from 872 to 294 ug h/L (p = 0.0058) and mean C max from 146 to 50.2 ug/L (p = 0.0154) and increas ed its CL /F (p = 0.0086) and V ss (p =

PAGE 66

66 0.0158) as compared with the cont rol phase (Table 4 1). There were no significant differences in t max or t between the contr ol and green tea phases (Table 4 1). Discussion In this study, we invest igated the effect of green tea extract (EGCG 800 mg) on the pharmacokinetics of the OATP probe fexofenadine. To our knowledge, this is the first time the in vivo effects of EGCG on OATP mediated t ransport have been characterized. The results demonstrate th at coadministration of green tea extract altered the disposition of fexofenadine. In this study, green tea extract significantly decreased fexofenadine AUC 0 by 66 % and C max by 65 % with re lative increases in CL/F and V ss There were no significant changes in elimination rate or half life. These results indicate that green tea extract decreases the bioavailability of fexofenadine, most likely through inhibition of OATP mediated intestinal uptake. Other drug interaction studies have shown similar results to our study (reduced fexofenadine bioavailability) when intestinal OATP1A2 uptake is inhibited (Dresser et al., 2005; Qiang et al., 2009) In an in vitro experiment, grapefruit and orange juice were shown to potently inhibit OATP1A2 mediated uptake of fexofenadine (Dresser et al., 2002) The investigators then evaluated this interaction in a healthy volunteer study and found that the fruit juices markedly reduced fexofenadine bi oavailability with decreases in AUC and C max of 30% and 40%, respectively, and did not alter half life (Dresser et al., 2002) Further, fruit juice s have similar effects on the disposition of aliskiren and this inte raction is also thought to be mediated by intestinal inhibition of OATP1A2 and perhaps OATP2B1 (Tapaninen et al., 2010a; Tapaninen et al., 2010b; Rebello et al., 2011)

PAGE 67

67 EGCG has been shown to inhibit both OATP1A2 an d OATP2B1 mediated uptake in vitro (Roth et al., 2009) Additionally, EGCG was also shown to be a substrate of OATP1A2 (Roth et al., 2009) Some studies have shown that fexofenadine is a substrate for OATP2B1 uptak e (Nozawa et al., 2004; Ming et al., 2011) however other groups have been unable to demonstrate significant uptake of fexofenadine by OATP2B1 and OATP1A2 appears to be the major determinant of fexofenadine uptake i n the intestine (Dresser et al., 2005; Shimizu et al., 2005; Glaeser et al., 2007) If fexofenadine is a substrate for OATP2B1 mediated uptake in the intestine and if EGCG inhibits OATP2B1 in vivo, then we would sti ll expect reduced fexofenadine concentrations which is consistent with our results. EGCG has also been shown to inhibit P gp efflux in an in vitro study (Jodoin et al., 2002) Fexofenadine is a substrate for P gp efflux (Cvetkovic et al., 1999) and drug interactions involving changes in P gp transport have been reported (Ha mman et al., 2001; Shimizu et al., 2006; Kim et al., 2009; Yamada et al., 2009) However, when P gp efflux is inhibited, fexofenadine concentrations are significantly increased, not decreased. On the other hand when drug interactions result in P gp induct ion, fexofenadine concentrations, AUC, and C max are reduced as we observed in our study However, EGCG has only been shown to inhibit not induce P gp (Jodoin et al., 2002) and the current study involved only single dose EGCG administration The effects of EGCG on metabolic enzymes have also been studied. There have been no clinically significant effects of EGCG on major cytochrome P450 (CYP) enzymes (CYP3A4, CYP2D6, CYP2C9, and CYP1A2) (Donovan et al., 2004; Chow et al., 2006) but EGCG has been shown to i nhibit the UDP glucuronosyltransferase

PAGE 68

68 enzyme UGT1A1 (Mohamed et al., 2010) Yet, fexofenadine is predominantly eliminated unchanged with minimal metabolism (approximately 5%), so the interaction we observed cannot be explained by effects on metabolic enz ymes. Based upon the in vitro evidence of EGCG inhibition of OATP mediated uptake and our results, we believe that green tea extract reduces fexofenadine bioavailability by inhibition of intestinal OATP uptake, most likely due to OATP1A2 inhibition. Althou gh we did not observe any changes in half life, we cannot rule out the possibility that green tea extract also inhibits hepatic OATP uptake in vivo as we only used oral fexofenadine in our study. The results of our study have considerable clinical implicat ions as the disposition of many drugs is determined by OATP uptake. OATP1A2 is known to transport statins, antihypertensive drugs, antivirals, antibiotics, the anticancer drug methotrexate, and was recently identified to transport imatinib, a drug used to treat a number of different cancers (Kalliokoski and N iemi, 2009) The OATP1A2 mediated uptake of imatinib has been shown to be significantly inhibited by naringin the constituent in citrus juice that has been implicated in OATP1A2 inhibition, suggesting that imatinib may be vulnerable to drug interactions that inhibit OATP1A2 (Bailey et al., 2007; Yamakawa et al., 2011) In addition, t here have been a number of polymorphisms that have been identified in the SLCO1A2 gene, which encodes OATP1A2 (Franke et al., 2009) and SLCO1A2 SNPs that may affect the disposition of imatinib have recently been identified (Yamakawa et al., 2011) Considering that green tea extract is commonly used as a supplement and is currently under investigation for treatment in various cancers, the likelihood that green tea will be used with numerous concomitant medications is high. Also considering that currently available drugs and new molecular

PAGE 69

69 entities are increasingly being recognized as substrates for transport, the potential for adverse drug interactions is present. In conclusion, this study indi cates that green tea extract significantly alters fexofenadine pharmacokinetics, most likely as a result of OATP1A2 inhibition in the intestine These findings have clinical importance as green tea extract may alter the disposition of other transporter substrates. Further studies are warranted to evaluate the role of green tea extract in other potential drug interactions that may result in reduce d efficacy or increased toxicity.

PAGE 70

70 Table 4 1 Effect of green tea extract on fexofenadine pharmacokinetics parameters after a single 60mg oral dose of fexofenadine to 8 healthy volunteers Parameters Control phase EGCG phase Mean d ifference 95 % CI P value t max (h) 2.88 1.13 2.13 0.83 0.75 0.54 ( 1.68, 0.18) NS C max (ug/L ) 146 56.9 50.2 25.2 95.5 40.3 ( 165, 25.8) 0.0154 z (h 1 ) 0.0894 0.0 1 0.0895 0.02 0.0001 0.015 ( 0.026, 0.026 ) NS t (h) 7.82 0.79 8.05 1.60 0.23 1.22 ( 1.88 2.34 ) NS V ss (L) 452 132 1527 816 1076 457 ( 285, 1866 ) 0.0158 AUC 0 24 (ug h/L ) 812 289 269 133 544 193 ( 877, 210) 0.0072 AUC 0 (ug h/L ) 872 303 294 137 578 196 ( 916, 239) 0.0058 CL/F (L/h) 75.5 22.7 249 119 174 64.1 ( 62 .8, 285 ) 0.0086 Data expressed as mean standard deviation

PAGE 71

71 Fig ure 4 1 Mean ( standard deviation) concentration time profiles for the control and green tea phases

PAGE 72

72 Figure 4 2 Individual, median, and interquartile range of fexofenadine AUC0 va lues in the control and green tea phases

PAGE 73

73 Figure 4 3 Individual, median, and interquartile range of fexofenadine C max values in the control and green tea phases

PAGE 74

74 CHAPTER 5 CONCLUSION AND FUTUR E DIRECTIONS The goal of this research was to evaluate the ef fects of genetic variability and a botanical inte raction on drug disposition and response. This research has provided important new insight into the role of OATP mediated transport. Further, the results of this work will generate new hypotheses and researc h questions to investigate the effects of disease, genetic variation, and other concomitant drugs/herbs/foods on the function of OATP mediated transport. Fully understanding how these factors affect OATP mediated transport will ultimately help guide us in predicting clinical efficacy, toxicity, and drug drug interactions. First, we investigated the effect of genetic variability on OATP mediated uptake and drug response. Specifically, we evaluated the effect of SLCO1B1 the gene that encodes OATP1B1, reduced function haplotypes on atorvastatin response. OATP1B1 facilitates the hepatic uptake of atorvastatin, allowing for access to the site of action as well as elimination, and polymorphisms within SLCO1B1 have the potential to affect both the disposition and the response of statins and other substrate drugs. Therefore, we hy pothesized that OATP1B1 reduced function carrier status is associated with diminished lipoprotein reduction and enhanced inflammatory marker reduction. To test this hypothesis, we conducted a retrospective pharmacogenetic analysis in 81 normocholesterolemic individuals without cardiovascular disease who received atorvastatin 80 mg/day orally for 16 weeks. Genotypes of the 388A>G and 521T>C SNPs were determined for each subject and haplotypes were assigned and categorized as either a carrier or non carrier of a reduced function OATP1B1 haplotype. Percent changes of lipoprotein and inflammatory marker concentrations from baseline to week

PAGE 75

75 16 were determined and compared between OATP1B1 reduced f unction carrier and non carrier groups. In this analysis, we did not find an association between OATP1B1 reduced function carrier status and atorvastatin response. However, due to the design of the original clinical study, we did not have pharmacokinetic d ata and were not able to make any conclusions regarding the effect of the OATP1B1 reduced function carrier status on atorvastatin disposition and how that may relate to atorvastatin response. Also, this study was conducted in healthy individuals and may no t be representative of patients who are treated with statins. As OATP1B1 is an important determinant in the disposition of statins as well as many other substrate drugs, future research is still warranted to evaluate the effects of genetic variability on O ATP mediated uptake in other populations and other substrate drugs. Next we evaluated the effect of green tea extract (EGCG) on in vivo OATP mediated uptake. We hypothesized that EGCG inhibits in vivo OATP mediated uptake based on previous in vitro studie s demonstrating the inhibitory effects of EGCG on OATP mediated transport. This interaction, to our knowledge, has not been previously investigated in vivo. Thus, w e evaluated the in vivo effect of EGCG on OATP mediated transport for the first time in a cl inical pharmacokinetic drug interaction study with the OATP probe fexofenadine in healthy volunteers. In order to measure fexofenadine concentrations, we developed and validated a specifi c and sensitive LC/MS/MS assay (Chapter 2). The clinical study was a randomized open label crossover study consisting of a contro l phase and a green tea (EGCG) phase, in which the subjects received either a single dose of fexofenadine 60 mg alone or after a single dose of green tea extract (EGCG 800 mg). Blood samples were collected over 24 hours during each phase a nd

PAGE 76

76 fexofenadine pharmacokinetic parameters were compared between the two phases We found that fexofenadine plasma concentrations were significantly reduced in the green tea phase as compared to the control phase. Specifically, green tea extract reduced fexofenadine AUC 0 and C max and increased CL/F and V ss without change in t 1/2. These results show that green tea extract reduces fexofenadine bioavailability suggesting inhibition of intestinal OATP mediated uptake As OATP mediated transport is an important determinant of disposition and response for many drugs, these findings warrant further research to identify other potential drug interactions. I n conclusion, the effects of genetic variation and green tea extrac t on OATP mediated transport have been studied. Although we were unable to detect differences in atorvastatin response between OATP haplotype groups, further research is still warranted as genetic variation in OATP mediated transport has been shown to be i mportant in statins as well as other substrate drugs. However, w e did show that the botanical green tea extract alters the disposition of the OATP probe fexofenadine, suggesting inhibition of OATP mediated uptake in the intestine. Future research is needed to further evaluate the role of green tea extract and other botanicals in drug interactions as it could have significant clinical implications for drug therapy.

PAGE 77

77 APPENDIX SUPPLEMENTAL DATA FR OM FEXOFENADINE GREEN TEA EXTRACT CL INICAL STUDY Table A 1 Individual fexofenadine pharmacokinetic parameters Subject Control phase Green tea phase AUC 0 (ug h/L) C max (ug/L) AUC 0 (ug h/L) C max (ug/L) 1 786.26 110.41 332.72 63.51 2 740.96 116.56 431.81 75.63 3 603.07 105.19 140.91 30.28 4 581.94 90.9 7 529.64 89.14 5 1431.80 265.11 194.31 18.40 6 1117.76 181.98 281.54 48.27 7 1062.34 160.84 294.81 52.57 8 649.27 134.57 146.33 23.92

PAGE 78

78 Table A 2 Subject demographics Subject Age (yrs) Height (cm) Weight (kg) Race (self reported) 1 20 175.7 73. 2 White 2 20 170.5 74.2 African American 3 21 162.7 65.2 White, Hispanic 4 58 170.3 75.9 White 5 54 164.3 69.5 African American 6 21 163.4 77.9 White, Hispanic 7 33 169.1 64.0 Asian 8 20 170.1 66.4 White, Hispanic

PAGE 79

79 Table A 3 Individual fexofenadi ne pharmacokinetic parameters for subjects who received half dose green tea extract Parameter Subject A Control phase Green tea phase Subject B Control phase Green tea phase t max (h) 4.00 1.00 1.00 1.00 C max (ug/L) 45.71 62.86 189.75 154.07 z (h 1 ) 0.1016 0.0833 0.1140 0.1164 t (h) 6.82 8.32 6.08 5.95 V ss (L) 1233.00 1090.16 313.99 401.08 AUC 0 24 (ug h/L) 355.13 279.43 1102.02 737.21 AUC 0 (ug h/L) 391.34 303.69 1156.22 770.79 CL/F (L/h) 153.32 197.57 51.89 77.84

PAGE 80

80 LIST OF REFERENCES Aiello RJ, Bourassa PA, Lindsey S, Weng W, Natoli E, Rollins BJ, and Milos PM (1999) Monocyte chemoattractant protein 1 accelerates atherosclerosis in apolipoprotein E deficient mice. Arterioscler Thromb Vasc Biol 19: 1518 1525. Akamine Y, Miura M, Sunagawa S, Kagaya H, Yasui Furukori N, and Uno T (2010) Influence of drug transporter polymorphisms on the pharmacokinetics of fexofenadine enantiomers. Xenobiotica 40: 782 789. Albert MA, Danielson E, Rifai N, and Ridker PM (2001) Effect of statin the rapy on C reactive protein levels: the pravastatin inflammation/CRP evaluation (PRINCE): a randomized trial and cohort study. Jama 286: 64 70. Bailey DG, Dresser GK, Leake BF, and Kim RB (2007) Naringin is a major and selective clinical inhibitor of organic anion transporting polypeptide 1A2 (OATP1A2) in grapefruit juice. Clin Pharmacol Ther 81: 495 502. Becker ML, Visser LE, van Schaik RH, Hofman A, Uitterlinden AG, and Stricker BH (2009) Genetic variation in the organic cation transporter 1 is associated wi th metformin response in patients with diabetes mellitus. Pharmacogenomics J 9: 242 247. Benet LZ (2009) The drug transporter metabolism alliance: uncovering and defining the interplay. Mol Pharm 6: 1631 1643. Bharathi VD, Radharani K, Jagadeesh B, Ramulu G, Bhushan I, Naidu A, and Mullangi R (2008) LC MS MS Assay for Simultaneous Quantification of Fexofenadine and Pseudoephedrine in Human Plasma. Chromatographia 67: 461 466. Carter NJ (2010) Rosuvastatin: a review of its use in the prevention of cardiovascula r disease in apparently healthy women or men with normal LDL C levels and elevated hsCRP levels. Am J Cardiovasc Drugs 10: 383 400. Chen Y, Li S, Brown C, Cheatham S, Castro RA, Leabman MK, Urban TJ, Chen L, Yee SW, Choi JH, Huang Y, Brett CM, Burchard EG, and Giacomini KM (2009) Effect of genetic variation in the organic cation transporter 2 on the renal elimination of metformin. Pharmacogenet Genomics 19: 497 504. Chinn LW and Kroetz DL (2007) ABCB1 pharmacogenetics: progress, pitfalls, and promise. Clin Ph armacol Ther 81: 265 269. Cho SK, Yoon JS, Lee MG, Lee DH, Lim LA, Park K, Park MS, and Chung JY (2011) Rifampin enhances the glucose lowering effect of metformin and increases OCT1 mRNA levels in healthy participants. Clin Pharmacol Ther 89: 416 421.

PAGE 81

81 Choi J H, Lee MG, Cho JY, Lee JE, Kim KH, and Park K (2008) Influence of OATP1B1 genotype on the pharmacokinetics of rosuvastatin in Koreans. Clin Pharmacol Ther 83: 251 257. Choudhuri S and Klaassen CD (2006) Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters. Int J Toxicol 25: 231 259. Chow HH, Hakim IA, Vining DR, Crowell JA, Cordova CA, Chew WM, Xu MJ, Hsu CH, Ranger Moore J, and Alberts DS (2006) Effe cts of repeated green tea catechin administration on human cytochrome P450 activity. Cancer Epidemiol Biomarkers Prev 15: 2473 2476. Ciarimboli G (2008) Organic cation transporters. Xenobiotica 38: 936 971. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant C E, Almquist KC, Stewart AJ, Kurz EU, Duncan AM, and Deeley RG (1992) Overexpression of a transporter gene in a multidrug resistant human lung cancer cell line. Science 258: 1650 1654. Coutant JE, Westmark PA, Nardella PA, Walter SM, and Okerholm RA (1991) D etermination of terfenadine and terfenadine acid metabolite in plasma using solid phase extraction and high performance liquid chromatography with fluorescence detection. J Chromatogr 570: 139 148. Cundy KC (1999) Clinical pharmacokinetics of the antiviral nucleotide analogues cidofovir and adefovir. Clin Pharmacokinet 36: 127 143. Cvetkovic M, Leake B, Fromm MF, Wilkinson GR, and Kim RB (1999) OATP and P glycoprotein transporters mediate the cellular uptake and excretion of fexofenadine. Drug Metab Dispos 27 : 866 871. Damas JK, Gullestad L, Ueland T, Solum NO, Simonsen S, Froland SS, and Aukrust P (2000) CXC chemokines, a new group of cytokines in congestive heart failure -possible role of platelets and monocytes, in: Cardiovasc Res pp 428 436, Netherlands. d e Lemos JA, Morrow DA, Sabatine MS, Murphy SA, Gibson CM, Antman EM, McCabe CH, Cannon CP, and Braunwald E (2003) Association between plasma levels of monocyte chemoattractant protein 1 and long term clinical outcomes in patients with acute coronary syndro mes. Circulation 107: 690 695. Degorter MK, Xia CQ, Yang JJ, and Kim RB (2012) Drug transporters in drug efficacy and toxicity. Annu Rev Pharmacol Toxicol 52: 249 273. Deng JW, Song IS, Shin HJ, Yeo CW, Cho DY, Shon JH, and Shin JG (2008) The effect of SLCO1 B1*15 on the disposition of pravastatin and pitavastatin is substrate dependent: the contribution of transporting activity changes by SLCO1B1*15. Pharmacogenet Genomics 18: 424 433.

PAGE 82

82 Devillier P, Roche N, and Faisy C (2008) Clinical pharmacokinetics and phar macodynamics of desloratadine, fexofenadine and levocetirizine : a comparative review. Clin Pharmacokinet 47: 217 230. Ding R, Tayrouz Y, Riedel KD, Burhenne J, Weiss J, Mikus G, and Haefeli WE (2004) Substantial pharmacokinetic interaction between digoxin and ritonavir in healthy volunteers. Clin Pharmacol Ther 76: 73 84. Donovan JL, Chavin KD, Devane CL, Taylor RM, Wang JS, Ruan Y, and Markowitz JS (2004) Green tea (Camellia sinensis) extract does not alter cytochrome p450 3A4 or 2D6 activity in healthy vol unteers. Drug Metab Dispos 32: 906 908. Doyle LA, Yang W, Abruzzo LV, Krogmann T, Gao Y, Rishi AK, and Ross DD (1998) A multidrug resistance transporter from human MCF 7 breast cancer cells. Proc Natl Acad Sci U S A 95: 15665 15670. Dresser GK, Bailey DG, Le ake BF, Schwarz UI, Dawson PA, Freeman DJ, and Kim RB (2002) Fruit juices inhibit organic anion transporting polypeptide mediated drug uptake to decrease the oral availability of fexofenadine. Clin Pharmacol Ther 71: 11 20. Dresser GK, Kim RB, and Bailey DG (2005) Effect of grapefruit juice volume on the reduction of fexofenadine bioavailability: possible role of organic anion transporting polypeptides. Clin Pharmacol Ther 77: 170 177. El Sheikh AA, van den Heuvel JJ, Koenderink JB, and Russel FG (2007) Inter action of nonsteroidal anti inflammatory drugs with multidrug resistance protein (MRP) 2/ABCC2 and MRP4/ABCC4 mediated methotrexate transport. J Pharmacol Exp Ther 320: 229 235. Emara S, El Gindy A, Mesbah MK, and Hadad GM (2007) Direct injection liquid ch romatographic technique for simultaneous determination of two antihistaminic drugs and their main metabolites in serum. J AOAC Int 90: 384 390. Fan L, Zhang W, Guo D, Tan ZR, Xu P, Li Q, Liu YZ, Zhang L, He TY, Hu DL, Wang D, and Zhou HH (2008) The effect o f herbal medicine baicalin on pharmacokinetics of rosuvastatin, substrate of organic anion transporting polypeptide 1B1. Clin Pharmacol Ther 83: 471 476. Franke RM, Scherkenbach LA, and Sparreboom A (2009) Pharmacogenetics of the organic anion transporting polypeptide 1A2. Pharmacogenomics 10: 339 344. Fu I, Woolf EJ, and Matuszewski BK (2004) Determination of fexofenadine in human plasma using 96 well solid phase extraction and HPLC with tandem mass spectrometric detection. J Pharm Biomed Anal 35: 837 846.

PAGE 83

83 Fu chikami H, Satoh H, Tsujimoto M, Ohdo S, Ohtani H, and Sawada Y (2006) Effects of herbal extracts on the function of human organic anion transporting polypeptide OATP B. Drug Metab Dispos 34: 577 582. Fukuda T, Brunner HI, Sagcal Gironella AC, and Vinks AA (2011) Nonsteroidal anti inflammatory drugs may reduce enterohepatic recirculation of mycophenolic acid in patients with childhood onset systemic lupus erythematosus. Ther Drug Monit 33: 658 662. Giacomini KM, Huang SM, Tweedie DJ, Benet LZ, Brouwer KL, Chu X, Dahlin A, Evers R, Fischer V, Hillgren KM, Hoffmaster KA, Ishikawa T, Keppler D, Kim RB, Lee CA, Niemi M, Polli JW, Sugiyama Y, Swaan PW, Ware JA, Wright SH, Yee SW, Zamek Gliszczynski MJ, and Zhang L (2010) Membrane transporters in drug development, i n: Nat Rev Drug Discov pp 215 236, England. Glaeser H, Bailey DG, Dresser GK, Gregor JC, Schwarz UI, McGrath JS, Jolicoeur E, Lee W, Leake BF, Tirona RG, and Kim RB (2007) Intestinal drug transporter expression and the impact of grapefruit juice in humans Clin Pharmacol Ther 81: 362 370. Guo D, Zou J, Zhu Y, Lou S, Fan H, and Qin Q (2009) Measurement of fexofenadine concentration in micro sample human plasma by a rapid and sensitive LC MS/MS employing protein precipitation: application to a clinical pharma cokinetic study. Biomed Chromatogr Hagenbuch B and Meier PJ (2004) Organic anion transporting polypeptides of the OATP/ SLC21 family: phylogenetic classification as OATP/ SLCO superfamily, new nomenclature and molecular/functional properties. Pflugers Arc h 447: 653 665. Hamman MA, Bruce MA, Haehner Daniels BD, and Hall SD (2001) The effect of rifampin administration on the disposition of fexofenadine. Clin Pharmacol Ther 69: 114 121. Han HK (2011) Role of transporters in drug interactions. Arch Pharm Res 34: 1865 1877. Han YF, Fan XH, Wang XJ, Sun K, Xue H, Li WJ, Wang YB, Chen JZ, Zhen YS, Zhang WL, Zhou X, and Hui R (2011) Association of intergenic polymorphism of organic anion transporter 1 and 3 genes with hypertension and blood pressure response to hydroc hlorothiazide. Am J Hypertens 24: 340 346. Hasani Ranjbar S, Amiri P, Zineh I, Langaee TY, Namakchian M, Heshmet R, Sajadi M, Mirzaee M, Rezazadeh E, Balaei P, Tavakkoly Bazzaz J, Gonzalez Gay MA, Larijani B, and Amoli MM (2008) CXCL5 gene polymorphism asso ciation with diabetes mellitus, in: Mol Diagn Ther pp 391 394, New Zealand.

PAGE 84

84 He YJ, Zhang W, Chen Y, Guo D, Tu JH, Xu LY, Tan ZR, Chen BL, Li Z, Zhou G, Yu BN, Kirchheiner J, and Zhou HH (2009) Rifampicin alters atorvastatin plasma concentration on the bas is of SLCO1B1 521T>C polymorphism. Clin Chim Acta 405: 49 52. Hesselink DA, van Hest RM, Mathot RA, Bonthuis F, Weimar W, de Bruin RW, and van Gelder T (2005) Cyclosporine interacts with mycophenolic acid by inhibiting the multidrug resistance associated pr otein 2. Am J Transplant 5: 987 994. Hilgendorf C, Ahlin G, Seithel A, Artursson P, Ungell AL, and Karlsson J (2007) Expression of thirty six drug transporter genes in human intestine, liver, kidney, and organotypic cell lines. Drug Metab Dispos 35: 1333 134 0. Ho RH, Choi L, Lee W, Mayo G, Schwarz UI, Tirona RG, Bailey DG, Michael Stein C, and Kim RB (2007) Effect of drug transporter genotypes on pravastatin disposition in European and African American participants. Pharmacogenet Genomics 17: 647 656. Ho RH, Tirona RG, Leake BF, Glaeser H, Lee W, Lemke CJ, Wang Y, and Kim RB (2006) Drug and bile acid transporters in rosuvastatin hepatic uptake: function, expression, and pharmacogenetics. Gastroenterology 130: 1793 1806. Hofmann U, Seiler M, Drescher S, and From m MF (2002) Determination of fexofenadine in human plasma and urine by liquid chromatography mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 766: 227 233. Ieiri I (2012) Functional Significance of Genetic Polymorphisms in P glycoprotein (MD R1, ABCB1) and Breast Cancer Resistance Protein (BCRP, ABCG2). Drug Metab Pharmacokinet 27: 85 105. Imanaga J, Kotegawa T, Imai H, Tsutsumi K, Yoshizato T, Ohyama T, Shirasaka Y, Tamai I, Tateishi T, and Ohashi K (2011) The effects of the SLCO2B1 c.1457C > T polymorphism and apple juice on the pharmacokinetics of fexofenadine and midazolam in humans. Pharmacogenet Genomics 21: 84 93. Isleyen EAO, Ozden T, Ozilhan S, and Toptan S (2007) Quantitative Determination of Fexofenadine in Human Plasma by HPLC MS. Chr omatographia 66: S109 S113. Iwai M, Suzuki H, Ieiri I, Otsubo K, and Sugiyama Y (2004) Functional analysis of single nucleotide polymorphisms of hepatic organic anion transporter OATP1B1 (OATP C). Pharmacogenetics 14: 749 757. Jaehde U, Srgel F, Reiter A, S igl G, Naber KG, and Schunack W (1995) Effect of probenecid on the distribution and elimination of ciprofloxacin in humans. Clin Pharmacol Ther 58: 532 541.

PAGE 85

85 Jodoin J, Demeule M, and Beliveau R (2002) Inhibition of the multidrug resistance P glycoprotein act ivity by green tea polyphenols. Biochim Biophys Acta 1542: 149 159. Kalliokoski A, Backman JT, Neuvonen PJ, and Niemi M (2008a) Effects of the SLCO1B1*1B haplotype on the pharmacokinetics and pharmacodynamics of repaglinide and nateglinide. Pharmacogenet Ge nomics 18: 937 942. Kalliokoski A, Neuvonen M, Neuvonen PJ, and Niemi M (2008b) Different effects of SLCO1B1 polymorphism on the pharmacokinetics and pharmacodynamics of repaglinide and nateglinide. J Clin Pharmacol 48: 311 321. Kalliokoski A, Neuvonen M, Ne uvonen PJ, and Niemi M (2008c) The effect of SLCO1B1 polymorphism on repaglinide pharmacokinetics persists over a wide dose range. Br J Clin Pharmacol 66: 818 825. Kalliokoski A and Niemi M (2009) Impact of OATP transporters on pharmacokinetics. Br J Pharma col 158: 693 705. Kameyama Y, Yamashita K, Kobayashi K, Hosokawa M, and Chiba K (2005) Functional characterization of SLCO1B1 (OATP C) variants, SLCO1B1*5, SLCO1B1*15 and SLCO1B1*15+C1007G, by using transient expression systems of HeLa and HEK293 cells. Pha rmacogenet Genomics 15: 513 522. Keskitalo JE, Zolk O, Fromm MF, Kurkinen KJ, Neuvonen PJ, and Niemi M (2009) ABCG2 polymorphism markedly affects the pharmacokinetics of atorvastatin and rosuvastatin. Clin Pharmacol Ther 86: 197 203. Kharasch ED, Walker A, H offer C, and Sheffels P (2005) Evaluation of first pass cytochrome P4503A (CYP3A) and P glycoprotein activities using alfentanil and fexofenadine in combination. J Clin Pharmacol 45: 79 88. Kim K, Park P, and Park J (2009) Short term effect of quercetin on the pharmacokinetics of fexofenadine, a substrate of P glycoprotein, in healthy volunteers. Eur J Clin Pharmacol 65: 609 614. King R, Bonfiglio R, Fernandez Metzler C, Miller Stein C, and Olah T (2000) Mechanistic investigation of ionization suppression in electrospray ionization. J Am Soc Mass Spectrom 11: 942 950. Kobayashi D, Nozawa T, Imai K, Nezu J, Tsuji A, and Tamai I (2003) Involvement of human organic anion transporting polypeptide OATP B (SLC21A9) in pH dependent transport across intestinal apical m embrane. J Pharmacol Exp Ther 306: 703 708. Koepsell H and Endou H (2004) The SLC22 drug transporter family. Pflugers Arch 447: 666 676.

PAGE 86

86 Koepsell H, Lips K, and Volk C (2007) Polyspecific organic cation transporters: structure, function, physiological roles, and biopharmaceutical implications. Pharm Res 24: 1227 1251. Konig J, Cui Y, Nies AT, and Keppler D (2000a) A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane. Am J Physiol Gastrointest Liver Physiol 278: G 156 164. Konig J, Cui Y, Nies AT, and Keppler D (2000b) Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 275: 23161 23168. Kremer JM and Hamilton RA (1995) The effects of nonsteroidal antiinfl ammatory drugs on methotrexate (MTX) pharmacokinetics: impairment of renal clearance of MTX at weekly maintenance doses but not at 7.5 mg. J Rheumatol 22: 2072 2077. Kruijtzer CM, Beijnen JH, Rosing H, ten Bokkel Huinink WW, Schot M, Jewell RC, Paul EM, and Schellens JH (2002) Increased oral bioavailability of topotecan in combination with the breast cancer resistance protein and P glycoprotein inhibitor GF120918. J Clin Oncol 20: 2943 2950. Kullak Ublick GA, Hagenbuch B, Stieger B, Schteingart CD, Hofmann AF Wolkoff AW, and Meier PJ (1995) Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology 109: 1274 1282. Kullak Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fat tinger K, Meier PJ, and Hagenbuch B (2001) Organic anion transporting polypeptide B (OATP B) and its functional comparison with three other OATPs of human liver. Gastroenterology 120: 525 533. Kwaijtaal M, van Diest R, Bar FW, van der Ven AJ, Bruggeman CA, de Baets MH, and Appels A (2005) Inflammatory markers predict late cardiac events in patients who are exhausted after percutaneous coronary intervention, in: Atherosclerosis pp 341 348, Ireland. Laskin OL, de Miranda P, King DH, Page DA, Longstreth JA, Ro cco L, and Lietman PS (1982) Effects of probenecid on the pharmacokinetics and elimination of acyclovir in humans. Antimicrob Agents Chemother 21: 804 807. Link E, Parish S, Armitage J, Bowman L, Heath S, Matsuda F, Gut I, Lathrop M, and Collins R (2008) SL CO1B1 variants and statin induced myopathy -a genomewide study. N Engl J Med 359: 789 799. Lippert C, Ling J, Brown P, Burmaster S, Eller M, and Cheng L (1995) Mass balance and pharmacokinetics of MDL 16455A in healthy male volunteers [abstract]. Pharm Res 12: S390.

PAGE 87

87 Lloberas N, Torras J, Cruzado JM, Andreu F, Oppenheimer F, Snchez Plumed J, Gentil M, Brunet M, Ekberg H, Griny JM, and Group SPSS (2011) Influence of MRP2 on MPA pharmacokinetics in renal transplant recipients results of the Pharmacogenomic Sub study within the Symphony Study. Nephrol Dial Transplant 26: 3784 3793. Lopez Pedrera C, Ruiz Limn P, Valverde Estepa A, Barbarroja N, and Rodriguez Ariza A (2012) To cardiovascular disease and beyond: new therapeutic perspectives of statins in autoimmune diseases and cancer. Curr Drug Targets Lupia E, Bosco O, Bergerone S, Dondi AE, Goffi A, Oliaro E, Cordero M, Del Sorbo L, Trevi G, and Montrucchio G (2006) Thrombopoietin contributes to enhanced platelet activation in patients with unstable angina. J Am Coll Cardiol 48: 2195 2203. Lscher W, Klotz U, Zimprich F, and Schmidt D (2009) The clinical impact of pharmacogenetics on the treatment of epilepsy. Epilepsia 50: 1 23. Maeda K, Ieiri I, Yasuda K, Fujino A, Fujiwara H, Otsubo K, Hirano M, Watanabe T, Kitam ura Y, Kusuhara H, and Sugiyama Y (2006) Effects of organic anion transporting polypeptide 1B1 haplotype on pharmacokinetics of pravastatin, valsartan, and temocapril. Clin Pharmacol Ther 79: 427 439. Maeda K and Sugiyama Y (2008) Impact of genetic polymorp hisms of transporters on the pharmacokinetic, pharmacodynamic and toxicological properties of anionic drugs. Drug Metab Pharmacokinet 23: 223 235. Mandery K, Bujok K, Schmidt I, Keiser M, Siegmund W, Balk B, Konig J, Fromm MF, and Glaeser H (2010) Influence of the flavonoids apigenin, kaempferol, and quercetin on the function of organic anion transporting polypeptides 1A2 and 2B1. Biochem Pharmacol 80: 1746 1753. Martinovic I, Abegunewardene N, Seul M, Vosseler M, Horstick G, Buerke M, Darius H, and Lindemann S (2005) Elevated monocyte chemoattractant protein 1 serum levels in patients at risk for coronary artery disease. Circ J 69: 1484 1489. Marzolini C, Tirona RG, and Kim RB (2004) Pharmacogenomics of the OATP and OAT families. Pharmacogenomics 5: 273 282. Ma tsushima S, Maeda K, Hayashi H, Debori Y, Schinkel AH, Schuetz JD, Kusuhara H, and Sugiyama Y (2008a) Involvement of multiple efflux transporters in hepatic disposition of fexofenadine. Mol Pharmacol 73: 1474 1483. Matsushima S, Maeda K, Ishiguro N, Igarash i T, and Sugiyama Y (2008b) Investigation of the inhibitory effects of various drugs on the hepatic uptake of fexofenadine in humans. Drug Metab Dispos 36: 663 669.

PAGE 88

88 Ming X, Knight BM, and Thakker DR (2011) Vectorial transport of fexofenadine across Caco 2 c ells: involvement of apical uptake and basolateral efflux transporters. Mol Pharm 8: 1677 1686. Miura M, Satoh S, Inoue K, Kagaya H, Saito M, Inoue T, Suzuki T, and Habuchi T (2007a) Influence of SLCO1B1, 1B3, 2B1 and ABCC2 genetic polymorphisms on mycophen olic acid pharmacokinetics in Japanese renal transplant recipients. Eur J Clin Pharmacol 63: 1161 1169. Miura M, Uno T, Tateishi T, and Suzuki T (2007b) Determination of fexofenadine enantiomers in human plasma with high performance liquid chromatography. J Pharm Biomed Anal 43: 741 745. Miyake K, Mickley L, Litman T, Zhan Z, Robey R, Cristensen B, Brangi M, Greenberger L, Dean M, Fojo T, and Bates SE (1999) Molecular cloning of cDNAs which are highly overexpressed in mitoxantrone resistant cells: demonstrati on of homology to ABC transport genes. Cancer Res 59: 8 13. Mohamed M, Tseng T, and Frye R (2010) Inhibitory effects of commonly used herbal extracts on UGT1A1 enzyme activity. Xenobiotica 40: 663 669. Mwinyi J, Johne A, Bauer S, Roots I, and Gerloff T (2004 ) Evidence for inverse effects of OATP C (SLC21A6) 5 and 1b haplotypes on pravastatin kinetics. Clin Pharmacol Ther 75: 415 421. Naidong W, Shou WZ, Addison T, Maleki S, and Jiang X (2002) Liquid chromatography/tandem mass spectrometric bioanalysis using no rmal phase columns with aqueous/organic mobile phases a novel approach of eliminating evaporation and reconstitution steps in 96 well SPE. Rapid Commun Mass Spectrom 16: 1965 1975. Netsch MI, Gutmann H, Schmidlin CB, Aydogan C, and Drewe J (2006) Inductio n of CYP1A by green tea extract in human intestinal cell lines. Planta Med 72: 514 520. Neuvonen PJ, Niemi M, and Backman JT (2006) Drug interactions with lipid lowering drugs: mechanisms and clinical relevance. Clin Pharmacol Ther 80: 565 581. Niemi M Trans porter pharmacogenetics and statin toxicity. Clin Pharmacol Ther 87: 130 133. Niemi M (2007) Role of OATP transporters in the disposition of drugs. Pharmacogenomics 8: 787 802. Niemi M, Backman JT, Kajosaari LI, Leathart JB, Neuvonen M, Daly AK, Eichelbaum M Kivisto KT, and Neuvonen PJ (2005a) Polymorphic organic anion transporting polypeptide 1B1 is a major determinant of repaglinide pharmacokinetics. Clin Pharmacol Ther 77: 468 478.

PAGE 89

89 Niemi M, Kivisto KT, Hofmann U, Schwab M, Eichelbaum M, and Fromm MF (2005b ) Fexofenadine pharmacokinetics are associated with a polymorphism of the SLCO1B1 gene (encoding OATP1B1). Br J Clin Pharmacol 59: 602 604. Niemi M, Schaeffeler E, Lang T, Fromm MF, Neuvonen M, Kyrklund C, Backman JT, Kerb R, Schwab M, Neuvonen PJ, Eichelba um M, and Kivisto KT (2004) High plasma pravastatin concentrations are associated with single nucleotide polymorphisms and haplotypes of organic anion transporting polypeptide C (OATP C, SLCO1B1). Pharmacogenetics 14: 429 440. Nirogi RV, Kandikere VN, Shukl a M, Mudigonda K, Maurya S, and Komarneni P (2006) Simultaneous quantification of fexofenadine and pseudoephedrine in human plasma by liquid chromatography/tandem mass spectrometry with electrospray ionization: method development, validation and applicatio n to a clinical study. Rapid Commun Mass Spectrom 20: 3030 3038. Nirogi RV, Kandikere VN, Shukla M, Mudigonda K, Maurya S, and Komarneni P (2007) Quantification of fexofenadine in human plasma by liquid chromatography coupled to electrospray tandem mass spe ctrometry using mosapride as internal standard. Biomed Chromatogr 21: 209 216. Nishikawa M, Ariyoshi N, Kotani A, Ishii I, Nakamura H, Nakasa H, Ida M, Kimura N, Kimura M, Hasegawa A, Kusu F, Ohmori S, Nakazawa K, and Kitada M (2004) Effects of continuous i ngestion of green tea or grape seed extracts on the pharmacokinetics of midazolam. Drug Metab Pharmacokinet 19: 280 289. Nolin TD, Frye RF, Le P, Sadr H, Naud J, Leblond FA, Pichette V, and Himmelfarb J (2009) ESRD Impairs Nonrenal Clearance of Fexofenadine but not Midazolam. J Am Soc Nephrol Nozawa T, Imai K, Nezu J, Tsuji A, and Tamai I (2004) Functional characterization of pH sensitive organic anion transporting polypeptide OATP B in human. J Pharmacol Exp Ther 308: 438 445. Nozawa T, Nakajima M, Tamai I, Noda K, Nezu J, Sai Y, Tsuji A, and Yokoi T (2002) Genetic polymorphisms of human organic anion transporters OATP C (SLC21A6) and OATP B (SLC21A9): allele frequencies in the Japanese population and functional analysis. J Pharmacol Exp Ther 302: 804 813. Pa sanen MK, Fredrikson H, Neuvonen PJ, and Niemi M (2007) Different effects of SLCO1B1 polymorphism on the pharmacokinetics of atorvastatin and rosuvastatin. Clin Pharmacol Ther 82: 726 733. Pasanen MK, Neuvonen M, Neuvonen PJ, and Niemi M (2006) SLCO1B1 poly morphism markedly affects the pharmacokinetics of simvastatin acid. Pharmacogenet Genomics 16: 873 879.

PAGE 90

90 Pathak SM, Kumar AR, Musmade P, and Udupa N (2008) A simple and rapid high performance liquid chromatographic method with fluorescence detection for the estimation of fexofenadine in rat plasma -application to preclinical pharmacokinetics. Talanta 76: 338 346. Pea JM, Macfadyen J, Glynn RJ, and Ridker PM (2012) High sensitivity C reactive protein, statin therapy, and risks of atrial fibrillation: an explor atory analysis of the JUPITER trial. Eur Heart J 33: 531 537. Qiang F, Lee BJ, Lee W, and Han HK (2009) Pharmacokinetic drug interaction between fexofenadine and fluvastatin mediated by organic anion transporting polypeptides in rats. Eur J Pharm Sci 37: 413 417. Rebello S, Zhao S, Hariry S, Dahlke M, Alexander N, Vapurcuyan A, Hanna I, and Jarugula V (2011) Intestinal OATP1A2 inhibition as a potential mechanism for the effect of grapefruit juice on aliskiren pharmacokinetics in healthy subjects. Eur J Clin P harmacol Reitman ML, Chu X, Cai X, Yabut J, Venkatasubramanian R, Zajic S, Stone JA, Ding Y, Witter R, Gibson C, Roupe K, Evers R, Wagner JA, and Stoch A (2010) Rifampin's Acute Inhibitory and Chronic Inductive Drug Interactions: Experimental and Model Ba sed Approaches to Drug Drug Interaction Trial Design. Clin Pharmacol Ther Ridker PM, Danielson E, Fonseca FA, Genest J, Gotto AM, Jr., Kastelein JJ, Koenig W, Libby P, Lorenzatti AJ, Macfadyen JG, Nordestgaard BG, Shepherd J, Willerson JT, and Glynn RJ (2 009) Reduction in C reactive protein and LDL cholesterol and cardiovascular event rates after initiation of rosuvastatin: a prospective study of the JUPITER trial. Lancet 373: 1175 1182. Ridker PM, Morrow DA, Rose LM, Rifai N, Cannon CP, and Braunwald E (20 05) Relative efficacy of atorvastatin 80 mg and pravastatin 40 mg in achieving the dual goals of low density lipoprotein cholesterol <70 mg/dl and C reactive protein <2 mg/l: an analysis of the PROVE IT TIMI 22 trial. J Am Coll Cardiol 45: 1644 1648. Rizwan AN and Burckhardt G (2007) Organic anion transporters of the SLC22 family: biopharmaceutical, physiological, and pathological roles. Pharm Res 24: 450 470. Robertson SM, Davey RT, Voell J, Formentini E, Alfaro RM, and Penzak SR (2008) Effect of Ginkgo bilo ba extract on lopinavir, midazolam and fexofenadine pharmacokinetics in healthy subjects. Curr Med Res Opin 24: 591 599. Romaine SP, Bailey KM, Hall AS, and Balmforth AJ (2010) The influence of SLCO1B1 (OATP1B1) gene polymorphisms on response to statin ther apy. Pharmacogenomics J 10: 1 11. Roth M, Timmerman B, and Hagenbuch B (2009) Interaction of Green Tea Catechins with Organic Anion Transporting Polypeptides, in: Meeting Abstract Supplement

PAGE 91

91 Rothenbacher D, Brenner H, Mertens T, Hoffmann MM, Hoffmeister A, and Koenig W (2005) Prognostic value of interleukin 1 receptor antagonist gene polymorphism and cytomegalovirus seroprevalence in patients with coronary artery disease, in: BMC Cardiovasc Disord pp 10, England. Sadeque AJ, Wandel C, He H, Shah S, and Woo d AJ (2000) Increased drug delivery to the brain by P glycoprotein inhibition, in: Clin Pharmacol Ther pp 231 237, United States. Sharom FJ (2008) ABC multidrug transporters: structure, function and role in chemoresistance. Pharmacogenomics 9: 105 127. Shi mizu M, Fuse K, Okudaira K, Nishigaki R, Maeda K, Kusuhara H, and Sugiyama Y (2005) Contribution of OATP (organic anion transporting polypeptide) family transporters to the hepatic uptake of fexofenadine in humans. Drug Metab Dispos 33: 1477 1481. Shimizu M Uno T, Sugawara K, and Tateishi T (2006) Effects of itraconazole and diltiazem on the pharmacokinetics of fexofenadine, a substrate of P glycoprotein. Br J Clin Pharmacol 61: 538 544. Shon JH, Yoon YR, Hong WS, Nguyen PM, Lee SS, Choi YG, Cha IJ, and Shin JG (2005) Effect of itraconazole on the pharmacokinetics and pharmacodynamics of fexofenadine in relation to the MDR1 genetic polymorphism. Clin Pharmacol Ther 78: 191 201. Shu Y, Brown C, Castro RA, Shi RJ, Lin ET, Owen RP, Sheardown SA, Yue L, Burchard E G, Brett CM, and Giacomini KM (2008) Effect of genetic variation in the organic cation transporter 1, OCT1, on metformin pharmacokinetics. Clin Pharmacol Ther 83: 273 280. Shu Y, Sheardown SA, Brown C, Owen RP, Zhang S, Castro RA, Ianculescu AG, Yue L, Lo J C, Burchard EG, Brett CM, and Giacomini KM (2007) Effect of genetic variation in the organic cation transporter 1 (OCT1) on metformin action. J Clin Invest 117: 1422 1431. Simonson SG, Raza A, Martin PD, Mitchell PD, Jarcho JA, Brown CD, Windass AS, and Sch neck DW (2004) Rosuvastatin pharmacokinetics in heart transplant recipients administered an antirejection regimen including cyclosporine, in: Clin Pharmacol Ther pp 167 177, United States. Sissung TM, Baum CE, Kirkland CT, Gao R, Gardner ER, and Figg WD ( 2010) Pharmacogenetics of membrane transporters: an update on current approaches. Mol Biotechnol 44: 152 167. Somogyi A, Stockley C, Keal J, Rolan P, and Bochner F (1987) Reduction of metformin renal tubular secretion by cimetidine in man. Br J Clin Pharmac ol 23: 545 551.

PAGE 92

92 Song IS, Shin HJ, Shim EJ, Jung IS, Kim WY, Shon JH, and Shin JG (2008) Genetic variants of the organic cation transporter 2 influence the disposition of metformin. Clin Pharmacol Ther 84: 559 562. Sparreboom A, Loos WJ, Burger H, Sissung TM, Verweij J, Figg WD, Nooter K, and Gelderblom H (2005) Effect of ABCG2 genotype on the oral bioavailability of topotecan. Cancer Biol Ther 4: 650 658. Stanton ML, Joy MS, and Frye RF (2010) Validation and application of a liquid chromatography tandem mass s pectrometric method for quantification of the drug transport probe fexofenadine in human plasma using 96 well filter plates. J Chromatogr B Analyt Technol Biomed Life Sci 878: 497 501. Stephens M and Scheet P (2005) Accounting for decay of linkage disequili brium in haplotype inference and missing data imputation. Am J Hum Genet 76: 449 462. Stephens M, Smith NJ, and Donnelly P (2001) A new statistical method for haplotype reconstruction from population data. Am J Hum Genet 68: 978 989. Su D and Li L (2011) Tre nds in the use of complementary and alternative medicine in the United States: 2002 2007. J Health Care Poor Underserved 22: 296 310. Tachibana Iimori R, Tabara Y, Kusuhara H, Kohara K, Kawamoto R, Nakura J, Tokunaga K, Kondo I, Sugiyama Y, and Miki T (2004 ) Effect of genetic polymorphism of OATP C (SLCO1B1) on lipid lowering response to HMG CoA reductase inhibitors. Drug Metab Pharmacokinet 19: 375 380. Takane H, Miyata M, Burioka N, Shigemasa C, Shimizu E, Otsubo K, and Ieiri I (2006) Pharmacogenetic determ inants of variability in lipid lowering response to pravastatin therapy. J Hum Genet 51: 822 826. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, and Endou H (2002) Characterization of methotrexate transport and its drug interact ions with human organic anion transporters. J Pharmacol Exp Ther 302: 666 671. Tapaninen T, Neuvonen PJ, and Niemi M (2010a) Grapefruit juice greatly reduces the plasma concentrations of the OATP2B1 and CYP3A4 substrate aliskiren, in: Clin Pharmacol Ther p p 339 342, United States. Tapaninen T, Neuvonen PJ, and Niemi M (2010b) Orange and apple juices greatly reduce the plasma concentrations of the OATP2B1 substrate aliskiren. Br J Clin Pharmacol Thompson JF, Man M, Johnson KJ, Wood LS, Lira ME, Lloyd DB, Ba nerjee P, Milos PM, Myrand SP, Paulauskis J, Milad MA, and Sasiela WJ (2005) An association study of 43 SNPs in 16 candidate genes with atorvastatin response. Pharmacogenomics J 5: 352 358.

PAGE 93

93 Thyss A, Milano G, Kubar J, Namer M, and Schneider M (1986) Clinica l and pharmacokinetic evidence of a life threatening interaction between methotrexate and ketoprofen. Lancet 1: 256 258. Tirona RG, Leake BF, Merino G, and Kim RB (2001) Polymorphisms in OATP C: identification of multiple allelic variants associated with al tered transport activity among European and African Americans. J Biol Chem 276: 35669 35675. Tomlinson B, Hu M, Lee VW, Lui SS, Chu TT, Poon EW, Ko GT, Baum L, Tam LS, and Li EK (2010) ABCG2 polymorphism is associated with the low density lipoprotein chole sterol response to rosuvastatin. Clin Pharmacol Ther 87: 558 562. Trevio LR, Shimasaki N, Yang W, Panetta JC, Cheng C, Pei D, Chan D, Sparreboom A, Giacomini KM, Pui CH, Evans WE, and Relling MV (2009) Germline genetic variation in an organic anion transpo rter polypeptide associated with methotrexate pharmacokinetics and clinical effects. J Clin Oncol 27: 5972 5978. Tsuruoka S, Ioka T, Wakaumi M, Sakamoto K, Ookami H, and Fujimura A (2006) Severe arrhythmia as a result of the interaction of cetirizine and pi lsicainide in a patient with renal insufficiency: first case presentation showing competition for excretion via renal multidrug resistance protein 1 and organic cation transporter 2, in: Clin Pharmacol Ther pp 389 396, United States. U.S. Department of He alth and Human Services FaDA, Center for Drug Evaluation and Research (2012) Guidance for Industry: Drug Interaction Studies Study Design, Data Analysis, Implications for Dosing, and Labeling Recommendations. Uno T, Yasui Furukori N, Takahata T, Sugawara K and Tateishi T (2004) Liquid chromatographic determination of fexofenadine in human plasma with fluorescence detection. J Pharm Biomed Anal 35: 937 942. Urquhart BL, Tirona RG, and Kim RB (2007) Nuclear receptors and the regulation of drug metabolizing en zymes and drug transporters: implications for interindividual variability in response to drugs. J Clin Pharmacol 47: 566 578. van Heeswijk RP, Bourbeau M, Campbell P, Seguin I, Chauhan BM, Foster BC, and Cameron DW (2006) Time dependent interaction between lopinavir/ritonavir and fexofenadine. J Clin Pharmacol 46: 758 767. Waehre T, Yndestad A, Smith C, Haug T, Tunheim SH, Gullestad L, Froland SS, Semb AG, Aukrust P, and Damas JK (2004) Increased expression of interleukin 1 in coronary artery disease with dow nregulatory effects of HMG CoA reductase inhibitors, in: Circulation pp 1966 1972, United States. Wang Z, Hamman MA, Huang SM, Lesko LJ, and Hall SD (2002) Effect of St John's wort on the pharmacokinetics of fexofenadine. Clin Pharmacol Ther 71: 414 420.

PAGE 94

94 W u CH, Wang CC, and Kennedy J (2011) Changes in herb and dietary supplement use in the U.S. adult population: a comparison of the 2002 and 2007 National Health Interview Surveys. Clin Ther 33: 1749 1758. Wyss CA, Neidhart M, Altwegg L, Spanaus KS, Yonekawa K Wischnewsky MB, Corti R, Kucher N, Roffi M, Eberli FR, Amann Vesti B, Gay S, von Eckardstein A, Luscher TF, and Maier W (2010) Cellular actors, Toll like receptors, and local cytokine profile in acute coronary syndromes, in: Eur Heart J pp 1457 1469, En gland. Yamada S, Yasui Furukori N, Akamine Y, Kaneko S, and Uno T (2009) Effects of the P glycoprotein inducer carbamazepine on fexofenadine pharmacokinetics. Ther Drug Monit 31: 764 768. Yamakawa Y, Hamada A, Shuto T, Yuki M, Uchida T, Kai H, Kawaguchi T, and Saito H (2011) Pharmacokinetic impact of SLCO1A2 polymorphisms on imatinib disposition in patients with chronic myeloid leukemia. Clin Pharmacol Ther 90: 157 163. Yamane N, Tozuka Z, Sugiyama Y, Tanimoto T, Yamazaki A, and Kumagai Y (2007) Microdose cli nical trial: quantitative determination of fexofenadine in human plasma using liquid chromatography/electrospray ionization tandem mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 858: 118 128. Yasui Furukori N, Uno T, Sugawara K, and Tateis hi T (2005) Different effects of three transporting inhibitors, verapamil, cimetidine, and probenecid, on fexofenadine pharmacokinetics. Clin Pharmacol Ther 77: 17 23. Yi SY, Hong KS, Lim HS, Chung JY, Oh DS, Kim JR, Jung HR, Cho JY, Yu KS, Jang IJ, and Shi n SG (2004) A variant 2677A allele of the MDR1 gene affects fexofenadine disposition. Clin Pharmacol Ther 76: 418 427. Zaremba J, Skrobanski P, and Losy J (2006) The level of chemokine CXCL5 in the cerebrospinal fluid is increased during the first 24 hours of ischaemic stroke and correlates with the size of early brain damage. Folia Morphol (Warsz) 65: 1 5. Zar ZM, Eloranta JJ, Stieger B, and Kullak Ublick GA (2008) Pharmacogenetics of OATP (SLC21/SLCO), OAT and OCT (SLC22) and PEPT (SLC15) transporters in t he intestine, liver and kidney. Pharmacogenomics 9: 597 624. Zhang W, Chen BL, Ozdemir V, He YJ, Zhou G, Peng DD, Deng S, Xie QY, Xie W, Xu LY, Wang LC, Fan L, Wang A, and Zhou HH (2007) SLCO1B1 521T ->C functional genetic polymorphism and lipid lowering ef ficacy of multiple dose pravastatin in Chinese coronary heart disease patients. Br J Clin Pharmacol 64: 346 352.

PAGE 95

95 Zheng HX, Huang Y, Frassetto LA, and Benet LZ (2009) Elucidating rifampin's inducing and inhibiting effects on glyburide pharmacokinetics and bl ood glucose in healthy volunteers: unmasking the differential effects of enzyme induction and transporter inhibition for a drug and its primary metabolite, in: Clin Pharmacol Ther pp 78 85, United States. Zhou SF (2008) Structure, function and regulation of P glycoprotein and its clinical relevance in drug disposition. Xenobiotica 38: 802 832. Zineh I (2007) Pharmacogenetics of response to statins. Curr Atheroscler Rep 9: 187 194. Zineh I, Beitelshees AL, Welder GJ, Hou W, Chegini N, Wu J, Cresci S, Province MA, and Spertus JA (2008) Epithelial neutrophil activating peptide (ENA 78), acute coronary syndrome prognosis, and modulatory effect of statins. PLoS One 3: e3117. Zineh I, Luo X, Welder GJ, Debella AE, Wessel TR, Arant CB, Schofield RS, and Chegini N (2006a) Modulatory effects of atorvastatin on endothelial cell derived chemokines, cytokines, and angiogenic factors. Pharmacotherapy 26: 333 340. Zineh I, Welder GJ, De Bella AE, Arant CB, Wessel TR, and Schofield RS (2006b) Atorvastatin effect on circulating and leukocyte produced CD40 ligand concentrations in people with normal cholesterol levels: a pilot study. Pharmacotherapy 26: 1572 1577.

PAGE 96

96 BIOGRAPHICAL SKETCH Mel onie L. Stanton was born in West Palm Beach, Florida. She received her Pharm.D. degree from the University of Florida in 2006. The following fall, she began her graduate studies in the department of Pharmacotherapy and Translational Research at the Univers ity of Florida College of Pharmacy. She has also practiced as an inpatient pharmacist at Shands Hospital and the VA Medical Center in Gainesville, FL. She received her Ph.D. from the University of Florida in May 2012.