The Role of Suppressor of Cytokine Signaling-1 in Maintaining Regulatory T Cell Homeostasis.

MISSING IMAGE

Material Information

Title:
The Role of Suppressor of Cytokine Signaling-1 in Maintaining Regulatory T Cell Homeostasis.
Physical Description:
1 online resource (92 p.)
Language:
english
Creator:
Collins, Erin Louise
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
Larkin Iii, Joseph
Committee Members:
Kima, Peter E
Johnson, Howard M
Yamamoto, Janet K
Langkamp-Henken, Bobbi

Subjects

Subjects / Keywords:
autoimmunity -- socs -- tregs
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Suppressor of cytokine signaling-1 deficient mice (SOCS1-/-) die of a T cell mediated inflammatory, autoimmune disease by 3 weeks of age. In SOCS1-/- mice inflammation mediates excessive interferon (IFN) ? signaling and leukocyte infiltration resulting in the destruction of many vital organs. Significantly, numerous mouse models of inflammatory autoimmune disease have been associated with a deficiency in Foxp3+ regulatory T cells (Tregs). Indeed, SOCS1-/- mice possessed a reduction in peripheral Tregs, despite enhanced thymic development, suggesting a perturbed peripheral cytokine environment. Notably, SOCS1-/- lymphocytes have dysregulated cytokine production, including reduced capacity to make interleukin (IL) 2, which is required for the survival of Tregs. The adoptive transfer of SOCS1+/+ Tregs or CD4+ T lymphocytes mediated an increased, yet limited survival in the SOCS1-/- mice. However, the adoptive transfer of CD4+ T lymphocytes in conjunction with SOCS1-KIR, a mimetic peptide sufficient to partially restore SOCS1 function, resulted in 30% of the mice living beyond 5 weeks. Moreover, the combined treatment mediated a decrease in leukocytic infiltration into vital organs, IFN?, and effector T cell frequency. Additionally, the decrease in inflammation was associated with an increase in the peripheral Foxp3+ regulatory T cell population. Collectively, these results suggest that the CD4+ T cell/SOCS1-KIR treatment promoted long-term survival of the SOCS1-/- mice partly by restoring peripheral Tregs. Furthermore, these data propose a relationship between SOCS1 and the peripheral stability of Tregs under inflammatory conditions.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Erin Louise Collins.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Larkin Iii, Joseph.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0044020:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 THE ROLE OF SUPPRESSOR OF CYTOKINE SIGNALING 1 IN MAINTAINING REGULATORY T CELL HOMEOSTASIS By ERIN LOUISE COLLINS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Erin Louise Collins

PAGE 3

3 To my family, Ted, Emily, Christy, Rachel, and Dodger Thank you for your endless encouragement and support

PAGE 4

4 ACKNOWLEDGMENTS I offer thanks to many people, whose assistance was essential in the completion of my degree. I would first l ike to thank my mentor, Dr. Joseph Larkin III, for taking me into his la b, for his financial and moral support, and for pushing me as I develop my scientific future I would also like to thank Dr. Howard Johnson for his invaluable insight and discussion that helped me understand the details of my work and kept me on track thr ough my graduate studies. To the other members of my graduate committee, to thank Drs. Peter Kima, Janet Yamamoto, and Bobbi Langkamp Henken for their patience, time, and helpful suggestions throughout my time in graduate school. This research wo uld not have been completed without the aid of the members of the Larkin lab. Ken Lau has provided all kinds of assistance that would take pages to address But what I thank him most for is being a great friend and helping me through all of the trials I f aced in graduate school regardless of how awkward the situations might be I would also like to thank Tenisha Wilson O ur long discussion s about research and life have kept me grounded as I have progressed in my final years of grad uate school. Patrick B enitez and I were founding members of the Larkin lab and we have spent long hours troubleshooting various techniques that now run smoothly W ithout his aid the Larkin lab and my project would surely not be as great as it stands today. I would also like t o thank past and present members of the Johnson lab. Lindsey Jager and Rea Dabelic have been critical to my success in graduate school and my project. They have both spent long hours teaching me various techniques that have been essential to my research. I give much thanks to my graduate friends Algevis Wrench, Tyler Culpepper and Cory Krediet. All of you have stood by me through the

PAGE 5

5 ups and downs of my graduate student career with steady support. I really can not thank you all enough. Finally, I would like to thank my family My best friend Amanda who I consider my sister, has been attached to my hip, or phone, si nce we were undergraduate s T he support she has given me during my time in graduate school regarding my life and my career has helped me more than words can describe My parents, Ted and Emily, my sister, Christy, and my niece, Rachel, have pushed and supported me in every decision I have ever made All of my accomplishments have been for them, and I would not have done it w ithout their love and understanding through every challenge I take on Each and every person mentioned here has been irreplaceable and absol utely necessary for my growth and development in graduate school and life.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 15 Immune Regulation ................................ ................................ ................................ 15 Suppressor of Cytokine Signaling ................................ ................................ ........... 17 SOCS1 ................................ ................................ ................................ ............. 18 Role of SOCS1 in Autoimmunity ................................ ................................ ...... 19 Effects of SOCS1 Deficiency ................................ ................................ ............ 20 Regulatory T Cells ................................ ................................ ................................ .. 20 Treg Transcription Factor Foxp3 ................................ ................................ ...... 21 Role of Tregs in Immune Regulation ................................ ................................ 23 Treg Associated Molecules ................................ ................................ .............. 24 Effects of Treg Deficiency ................................ ................................ ................. 26 Project Rationale and Design ................................ ................................ ................. 27 2 AS SESS THE PRESENCE OF TREGS IN SOCS1 / MICE ................................ .. 33 Background ................................ ................................ ................................ ............. 3 3 Results ................................ ................................ ................................ .................... 35 SOCS1 / Mice are Deficient in Peripheral Foxp3+ Tregs. ............................... 35 Thymic Development of SOCS1 / Tregs Does Not Contribute to Peripheral Deficiency. ................................ ................................ ................................ ..... 36 Treg Deficiency is Cor related to Dysregulated Cytokine Production. ............... 36 Summary ................................ ................................ ................................ ................ 37 3 DEVELOPMENT OF TREATMENT TO DECREASE DISEASE SEVERITY IN SOCS1 / MICE ................................ ................................ ................................ ...... 45 Background ................................ ................................ ................................ ............. 45 Results ................................ ................................ ................................ .................... 46 Combined SOCS1+/+ CD4+ T Cell Adoptive Transfer and SOCS1 KIR Mimetic Treatment Delays Lethal Disease. ................................ ................... 46

PAGE 7

7 CD4+/SOCS1 KIR Treatment Increased Weight Gain, Delayed Leukocyte SOCS1 / Mice. ................................ ................................ ............................. 47 Summary ................................ ................................ ................................ ................ 48 4 EX AMINATION OF TREG POPULATION IN TREATED SOCS1 / MICE .............. 56 Background ................................ ................................ ................................ ............. 56 Results ................................ ................................ ................................ .................... 58 Treatment of SOCS1 / Mi ce with CD4+/SOCS1 KIR Treatment Restores Foxp3+ Treg Peripheral Frequency and Decreases Peripheral Effector CD4+ T Cells. ................................ ................................ ................................ 58 CD4+/S OCS1 KIR Treatment Confers Enhanced Foxp3+ Treg Peripheral Homeostasis and Reverses Lymphopenia in SOCS1 / Mice. ...................... 59 Enhanced Survival of Other SOCS1 / Mouse Models Correlates with Maintained Treg Homeostasis. ................................ ................................ ...... 60 SOCS1 Deficient Tregs Experience Lineage Spe cific Transcription Factor Plasticity. ................................ ................................ ................................ ....... 61 Summary ................................ ................................ ................................ ................ 63 5 DISCUSSION ................................ ................................ ................................ ......... 73 6 MATERIALS AND METHODS ................................ ................................ ................ 77 Mice ................................ ................................ ................................ ........................ 77 Genotyping ................................ ................................ ................................ ............. 77 Magnetic Cell Separation ................................ ................................ ........................ 78 Flow Cytometry ................................ ................................ ................................ ....... 79 Peptide Synthesis ................................ ................................ ................................ ... 79 In vivo Mouse Treatments ................................ ................................ ....................... 80 RNA Isolation and RT qPCR ................................ ................................ .................. 80 Cytokine Secretion Analysis ................................ ................................ ................... 81 Histology ................................ ................................ ................................ ................. 81 Bone Marrow Chimeras ................................ ................................ .......................... 81 Transcription Factor Analysis ................................ ................................ .................. 82 Statistical Analysis ................................ ................................ ................................ .. 82 LIST OF REFE RENCES ................................ ................................ ............................... 84 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 92

PAGE 8

8 LIST OF TABLES Table page 6 1 Primers used and/or discussed in this study. ................................ ..................... 83

PAGE 9

9 LIST OF FI GURES Figure page 1 1 Suppressor of cytokine signaling conserved structure ................................ ........ 30 1 2 Inhibition of cytokine signaling by suppressor of cytokine signaling 1 ................ 31 1 3 Defects in regulatory T cells cause increased susceptibility to autoimmunity ..... 32 2 1 Tr egs constitutively express more SOCS1 mRNA than conventional T cells ..... 40 2 2 SOCS1 / mice are deficient in peripheral Foxp3+ regulatory T cells ................. 41 2 3 Periperal Foxp3+ Treg deficiency in SOCS1 / mice is not due to inadequate thymic development ................................ ................................ ............................ 43 2 4 Dysregulated cytokine production by SOCS1 / lymphocytes is correlated to a reduction in peripheral Tregs ................................ ................................ ........... 44 3 1 SOCS1 KIR restores partial function of SOCS1 in the absence of the endogenous protein ................................ ................................ ............................ 50 3 2 Schematic diagram of mouse treatment strategies performed on SOCS1 / mice ................................ ................................ ................................ .................... 51 3 3 Survival curve of SOCS1 / mice receiving treatment ................................ ......... 52 3 4 CD4+/SOCS1 KIR treatment increases the overall health of 2 week old SOCS1 / mice ................................ ................................ ................................ ... 53 3 5 CD4+/SOCS1 KIR treatment prevents leukocyte infiltration into the heart and liver of 2 week old SOCS1 / mice ................................ ................................ ...... 54 4 1 Treatment of SOCS1 / mice w ith CD4+/SOCS1 KIR treatment increases peripheral Tregs and decreases activated CD4+CD25+Foxp3 cells ................. 66 4 2 CD4+/SOCS1 KIR treatme nt increases total, CD4+, and CD4+Foxp3+ peripheral lymphocyte numbers in SOCS1 / mice ................................ ............. 67 4 3 SOCS1 / / mice have a sustained peripheral Treg population ................... 69 4 4 SOCS1 KO Bone marrow chimerashave a sustained peripheral Treg population ................................ ................................ ................................ ........... 70 4 5 No leukocytic infiltration present in SOCS1 KO bone marrow chimeras ............. 71 4 6 SOCS1 deficient Tregs experience lineage specific transcription factor instability upon IFN stimulation ................................ ................................ ......... 72

PAGE 10

10 LIST OF ABBREVIATION S APCs Antigen Presenting Cells CD Cluster of Differentiation CIS Cytokine inducible Scr homology 2 containing protein Cre Crerecombinase CTL Cytotoxic T cell CTLA 4 Cyt otoxic T Lymphocyte Antigen 4 C terminus Caboxyl terminus DC Dendritic Cells DMSO D imethyl sulfoxide DT Diphtheria toxin DTR Diphtheria toxin receptor EAE Experimental Autoimmune Encephalomyelitis ELISA Enzyme linked immunosorbent assay EPO Erythropoietin ESS Extended SH2 sequence Foxp3 Forkhead box p3 GFP Green fluorescent protein GM CSF Granulocyte macrophage colony stimulating factor H&E Hematoxylin and eosin HPLC High performance liquid chromatography IBD Inflammatory bowel disease IFN Interferon IL In terleukin ip Intraperitoneal

PAGE 11

11 IPEX immunodysregulationpolyendocrinopathyenteropathy X linked syndrome iTr35 IL35 producing suppressor cell iTreg Inducible regulatory T cell JAK Janus Kinase KIR Kinase inhibitory region KO Knock out LN Lymph node MACS Magnetic activated cell sorting MHC Major Histocompatibility Complex MS Multiple sclerosis NOD Non obese diabetic nTreg Natural regulatory T cell N terminus Amino terminus PBS Phosphate buffered saline qPCR Quantitative PCR RA Rheumatoid arthritis RA R related orphan receptor gamma t SCID Severe Combined Immuno Deficiency SH2 Src homology 2 SLE Systemic lupus erythe matosus SOCS Suppressor of cytokine signaling STAT Signal Transducer and Activator of Transcription T1D Type 1 diabetes Tbet T box transcri ption factor

PAGE 12

12 TCR T Cell Receptor TGF Transforming Growth Factor T h1 T h elper 1 Th2 T helper 2 Th3 T helper 3 Th17 T helper 17 Tr1 Type 1 regulatory T cell Treg Regulatory T cell WT Wild Type YFP Yellow fluorescent protein

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF SUPPRESSOR OF CYTOKINE SIGNALING 1 IN MAINTAINING REGULATORY T CELL HOMEOSTASIS By Er in Louise Collins May 2012 Chair: Joseph Larkin, III Major: Microbiology and Cell Science Suppressor of cytokine signaling 1 deficient mice (SOCS1 / ) die of a T cell mediated inflammatory, autoimmune disease by 3 weeks of age. In SOCS1 / mice inflammation mediates excessive interferon (IFN) signaling and leukocyte infiltration resulting in the destruction of many vital organs. Significantly, numerous mouse models of inflammatory autoimmune disease have been associated with a deficiency in Foxp3+ regulatory T cells (Tregs) Indeed, SOCS1 / mice possessed a reduction in peripher al Tregs, despite enhanced thymic development. Notably, SOCS1 / lymphocytes have dy sregulated cytokine production, including reduced capacity to make interleukin (IL) 2, which is required for the survival of Tregs. The adoptive transfer of SOCS1+/+ Tregs or CD4+ T lymphocytes mediated an increased, yet limited survival in the SOCS1 / mice. However, the adoptive transfer of SOCS1+/+ CD4+ T lymphocytes in conjunction with SOCS1 KIR, a mimetic peptide sufficient to partially restore SOCS1 function, resulted in 30% of the mice living beyond 5 weeks of age Moreover, the combined treatment mediated a decrease in leukocytic infiltration into vital organs, IFN and effector T cell frequency. Additionally, the decrease in inflammation was associated with an incre ase in the peripheral Foxp3+ regulatory T cell population. Collectively, these results suggest

PAGE 14

14 that the CD4+ T cell/SOCS1 KIR treatment promoted long term survival of the SOCS1 / mice partly by d ecreasing inflammation and restoring peripheral Tregs. In fa ct, our results show that SOCS1 deficiency allows for the instability of lineage specific transcription factors in Tregs. Furthermore, these data propose a relationship between SOCS1 and the peripheral stability of Tregs under inflammatory conditions

PAGE 15

15 CHA PTER 1 INTRODUCTION Immune Regulation The immune system is an intricate web of immune cells, cytokines, and signaling cascades that our body uses to defend against potential pathogens These invaders include bacte ria, viruses, and large parasites ,all of w hich can cause infection and subsequent inflammation in our tissues. Inflammation is a mechanism of innate and adaptive immunity that is achieved by the increased movement of various immune ce lls to the site of infection or tissue damage A proper inflamm atory response is designed to begin with quick and accurate identification of the foreign antigen. Upon proper identification, the antigen should be eliminated from the host by specific immune cells. Finally cells that have been specifically activated b y antigen should quickly clear immune waste from the site of inflammation. If cells cannot follow this procedure it can lead to excessive inflammation, damag ing host tissues. In addition to defending against invading pathogens, our immune system has devel oped the ability to identify and eliminate host cells that have gone rogue and cause complications in our bodies. These host cells may be auto reactive immune cells that have been poorly educated during their developmen t and have specificity to self antigens The inability of our body to prevent the development and activation of auto reactive cells contributes to autoimmunity. Although inflammation is a necessary property of an immune response, excessive inflammation, due to faulty immune cell function, can trigger autoimmunity. Autoimmunity is the failure of our immune system to tolerate self (Khoruts and Fraser, 2005) Therefore, autoimmune cells will attack host tissues and cells by recognizing

PAGE 16

16 self antigens as foreign. In orde r to prevent autoimmunity, our immune system has developed a set of checkpoints to eliminate cells that can potentially be precursors to autoimmunity. More specifically, these are checkpoints are put in place to eliminate, or stop, auto reactive T cells w hich are one of the agents contributing to autoimmunity. Although our immune system has a series of mechanisms to prevent autoimmunity, there are times when these regulatory mechanisms fail. This leads to the development of autoimmune diseases like type 1 diabetes (T1D), inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), and multiple sclerosis (MS) (Buckner, 2010) Central and peripheral tolerance mechanisms are measures by which our immune system prevents development of autoimmuni ty by T cells. Central tolerance occurs during the thymic development of T cells. During t hymic development, T cells that play an important role in cell mediated immunity, undergo a stringent education and selection process Throughoutthis selection pro cess they are exposed to various antigens, both foreign and self, and develop an exclusive specificity to one particular antigen. T cells that are reactive to self antigens are eliminated during negative selection via programmed cell death, b efore export into the periphery After the developmental selection process has occurred, and cells have moved into the periphery, peripheral tolerance mechanisms ensure reliability of immune cells. In the periphery, the suppressors of cytokine signaling (SOCS) protei ns regulate cells responsiveness to cytokines (Kubo et al., 2003) In addition to cytokine regulation cells with the ability to suppress immune responses, regulatory T cells (Tregs) can regulate cells at the site of inflammation (Miyara and Sakaguchi, 2007)

PAGE 17

17 Suppressor of Cytokine Signaling Suppressor of cyto kine signaling (SOCS) and cytokine inducible SH2 protein (CIS) are a family of intracellular proteins that are involved in modulating immune responses by reducing cytokine responsiveness by the cell (Yoshimura et al., 2007) There are 8 members of the CIS/SOCS protein family; CIS, SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS6, and SOCS7 (Krebs and Hilton, 2001) The members of this family have si milar structure, all containing a carboxy terminal domain, Src homology 2 ( SH2 ) domain, and a mino terminal domain (Figure 1 1 ). The carboxy terminal domain of SOCS proteins is known a s the SOCS box. The SOCS box is composed of 40 amino acids. The SOCS box mediates degradation of proteins that are associated through the amino terminal regions. The SOCS box has three alpha helices bound to an E3 ubiquitin ligase complex. When combine d with an E1 ubiquitin activating enzyme, and E2 ubiquitin conj ugating enzyme this complex polyubiquitinate s the SOCS binding partner and target s the receptor complex for proteasomal degradation (Zhang et al., 2001) The SH2 domain of the SOCS proteins binds to phosphotyrosine residues on the target protein leading to inhibition of signal transd uction There is also a unique amino extended SH2 sequence ( N ESS ) domain that is next to the SH2 domain. This domain is a 15 residue alpha helix that directly contacts the phosphotyrosine binding loop (Krebs and Hilton, 2001; Yoshimura et al., 2007; Croker and Kiu 2008) Lastly, there is the amino terminal domain. This region contains the kinase inhibitory region (KIR) in SOCS1 and SOCS3. The KIR region is constituted of 12 amino acids. KIR is required for the inhibition of the Janus kinas ( JAK )phosphorylati on activity. JAK enzymatic activity is blocked when KIR is lodged into the catalytic cleft

PAGE 18

18 preventing subsequent phosphorylation and stopping the signaling cascade (Croker and Kiu, 2008) SOCS proteins mediate their function through the three protein domains mentioned above: the SOCS BOX, SH2, and KIR regions of the protein. These three domains allow the SOCS proteins to modulate cytokine responsiveness by the cell Each member of the SOCS protein family is induced by and inhibits numerous cytokines. A lthough the various members of the SOCS family inhibitdifferent cytokines they possess similar means of supp ression. SOCS1 SOCS1 is one of the more heavily studied SOCS proteins. It is a cytokine inducible negative regulator of the Janus kinas/signal transducer and activator of transcription (JAK/STAT) cytokine signaling pathway. Interleukin 2 ( IL2 ) IL3, erythropoietin ( EPO ) granulocyte /monocyte colony stimulating factor ( GM CSF ) and IFN are a subset of cytokines that can induce and inturn be inhibited by SOCS1 in a negative feedback fashion (Alexander et al., 1999) As shown in Figure 1 2 SOCS1 can stop signaling in the JAK/STAT pathways in two ways. As mentioned before SOCS1 can inhibit cytokine signaling by target ing the complex for degradation or by impeding phosphorylation of the JAKsand STATs (Croker and Kiu, 2008) Bo th of these signaling prevention methods utilized by SOCS1obstructs the transcription of cytokine responsive genes that can lead to further inflammation, proliferation, and cytokine production by the cell. In addition to the inhibition of cytokine signalin g, SOCS1 is also required during the development and differentiation of T cells. In fact, SOCS1 expression is vital for normal development in the thymus SOCS1 is highly expressed in the thymus and is

PAGE 19

19 necessary for proper T cell selection (Zhan et al., 2009) Increased SOCS1 expression in the thymus likely bec ause it can prevent the effects of inflammatory cytokines produced by thymocytes that can perturb the selection process. The role of SOCS1 has recently been studied in terms of its role in the differentiation of CD4+ T cell subsets (Palmer and Restifo, 2009) Since p olarization into a T helper linea ge is driven by a specific c ytokine milieu, it is logical that a protein such as SOCS1 would have an effect on the differentiation process of these cells. Moreover studies have proven that SOCS1 is required for the differentiation of CD4+ T cells into th e T h 17 phenotype due to the ability of SOCS1 to inhibit the contradictory effects of IFN (Tanaka et al., 2008) Thus, SOCS1 plays a critical role in modulation of cytokine signals that can influence the development and differentiation of T cells. Role of SOCS1 in Autoimmunity SOCS1 is an essential re gulator of immune responses because it is involved in inhibiting the signaling of a wide variety of immune cytokines. Since SOCS1 has an obvious role in maintaining immune homeostasis it has been of par ticular interest to see if SOCS1 abnormalities are ass ociated with autoimmune diseases. In fact, it was found that SOCS1 expression is reduced in NZBxNZW F1 mice, the murine lupus model (Sharabi et al., 2009) Additionally, e xpression of SOCS1 is also altered in human patients with rheumatoid arthritis or systemic lupus (Tsao et al., 2008) It is also suggested that decrea sed levels of induction of SOCS1 may play a role in determining the course of EAE in mice (Stark and Cross, 2006) Supporting studies across a broad range of autoimmune diseases suggest that SOCS1 plays a role in the onset or progression of autoimmunity.

PAGE 20

20 Effects of SOCS1 Deficiency The requirement of SOCS1 in maintaining immune homeostasis is supported in m ice with a deficiency in SOCS1 as they experience severe T cell mediated autoimmunity and die by 3 weeks of age (Marine et al., 1999) Manifestations of SOCS1 knock out (KO) disease include autoimmune arthritis joint inflammation and severe growth retardation. It is known that the n eonatal defects in SOCS1 / mice are caused by excessive IFN signali ng This was determined by creating SOCS1 / IFN / mice and finding that these mice experience delayed autoimmunity (Alexander et al., 1999) In addition, treatment of SOCS1 / mice with anti IFN antibodies ameliorated disease and allowed for extended survival of these mice, confirming the causative role of IFN in this disease. T cell specific SOCS1 / mice and SOCS1 / / mice also experience perturbed thymic selection of CD4+CD8 and CD4 CD8+ thymocytes Moreover it has been shown that increases in Treg selection can occur i n thymocytes deficient in SOCS1 (Zhan et al., 2009) Although Treg numbers are higher in the periphery of these mice, they still succumb to autoimmunity suggesting the requirement of SOCS1 in Treg function or stability (Zhan et al., 2009) In fact, s tudies looking at T cells deficient in SOCS1 have shown Tregs require SOCS1 to maintain a stable phenotype and suppressor functions (Takahashi et al., 2011) Phenotype, or lineage, stability is a method of SOCS1 regulation that goes beyond the traditional man ipulation of cytokine signaling. T hus it is important to examine the role of SOCS1 in Tregs further. Regulatory T C ells One of the key players in c ontrolling our immune system is regulatory T cells. The initial discovery of Tregs occurred when a subset CD4+ T cells was found that

PAGE 21

21 constitutively expressed the IL2 receptor alpha chain, cluster of differentiation 25 (CD 25), and cytotoxic T lymphocyte antigen 4 (CTLA4) (Rudensky, 20 11) These cells were originally thought to be subset of constantly activated T cells that served as a sink depriving other immune cells of resources to promote inflammation. The suppressive function of these Tregs was elucidated when they were adopt ively transferred into day 3 thymectomized mice. These thymectomized mice suffer from systemic inflammation .H owever, the addition of this suppressive subset of cells protected mice from inflammation (Asano et al., 1996) In vitro studies of these suppressor cells suggested that they were anergic, being unable to proliferate or produce IL2 upon T cell receptor (TCR) stimulation (Papiernik et al., 1998) Yet when put into lymphopenic mice they expanded vigorously (Cozzo et al., 2003) Tregs were finally accepted as a distinct suppressor T cell population after CD4+ cells were activated to induce CD25 but they were un able to rescue day 3 thymectomized mice from inflammation (Suri Payer et al., 1998) These findings proposed that CD4+CD25+ Tregs were a thymically derived and had a true suppressive function. Treg Transcription Factor Foxp3 As various subsets of T helper cells have transcription factors that are specific to the ir lineage, Tregs also possess this trait. Forkhead box p3 (Foxp3) is the tr anscription factor that identifiesTregs (Hori et al., 2003; Khattri et al., 2003) Foxp3 was found to be associated to Tregs after a loss of function mutation, in this X chromosome encoded transcription factor ,lead to multi organ autoim munity in humans This extreme inflammatory disorder in humans is called immunody s regulationpolyendocrinopathyenteropathy X linked syndrome (IPEX). Like humans suffering from IPEX, mice with the Foxp3 mutation also suffer from a

PAGE 22

22 comparable disease that h as been named scurfy (Blair et al., 1994; Chatila et al., 2000; Wildin et al., 2001; McGinness et al., 2006; Torgerson and Ochs, 2007) These data establish an important role for the Foxp3 transcription factor in the maint enance of immune homeostasis. Initial studies of the scurfy mouse revealed that the inflammatory disease caused by a Foxp3 mutation was T cell mediated. T cell mediated autoimmunity lead to the notion that a Foxp3 mutation could be impairing Treg function or development This was confirmed when bone marrow from Foxp3 knockout and Foxp3 sufficient mice was mixed 1:1 and transferred into a depleted mouse. In the chimeric mouse ,Foxp3 sufficient donor cells were the only cells that developed into CD4+CD25+ c ells in the thymus (Fontenot et al., 2003; Hori et al., 2003) This showed the importance of Foxp3 in the development of thymically derived nTregs. The above studies support the role of Foxp3 in Treg development but the requirement of Foxp3 in Treg function was still unclear. This wa s address ed by studying mice, which still promoted Foxp3 expression but did not have a functional Foxp3 protein. These mice harbored a green fluorescent protein (GFP) coding DNA sequence knocked in the Foxp3 locus (Gavin et al., 2007) Studies within these mice exposed Foxp3 as un necessary for the survival /development of Treg precursors, but it was required for the suppressor function of Tregs. Additiona l ly, high expression of Foxp3 was required to maintain the molecular markers of Tregs that are essential to their function and longevity. Studies supported this by showing lower l evels of Foxp3 were correlated with reduced expression of CD25 and CTLA4 (Wan and Flavell, 2007) Likewise, Foxp3 reverses cell features that wo uld be detrimental to Treg function. This

PAGE 23

23 is shown when Foxp3 binds to RAR related orphan receptor gamma t (ROR t), a transcription factor speci fic to T helper 17 (Th17) cells, and inhibits the expression of IL17 and a Th17 phenotype (Zhou et al., 2008) These studies confirm the importance of Foxp3 expression in not only development but also in the suppressive functions and phenotype stability of Tregs. Role of Tregs in Immune R egulation Although thymic development of T cells works to eliminate auto reactive T cells, some auto reactive cells slip past the stringent selection process and reside in the periphery (Miller, 2002; Sprent and Kishimoto, 2002) This is where Tregs play an important role in preventing autoimmunity. Tregs control immune responses and main tain immune homeostasis by inhibit ing lymphocyte activation and subsequent autoimmunity. The early peripheral role of Tregs is clear in the scurfy (Brunkow et al., 2001) and in the Day 3 thymectomized mouse (Min e t al., 2003) as these mice both lack early Treg populations The early deficiency in Tregs causes severe autoimmunity and even death in these mice. The presence of a Treg population is required toregulate immune homeostasis, during the development of the peripheral T cell repertoire, In addition to the role of Tregs in the development of the peripheral T cell repertoire, they also play a role in maintaining immune homeostasis throughout the lifetime of an individual (Lahl et al., 2007) This was established by the elimination of Tregs which possess the human diphtheria toxin receptor (DTR) expressed under control of the Foxp3 locus (Foxp3DTR mice) (Kim et al., 2007) Treg elimination was attai ned in Foxp3DTR mice by the administration of diphtheria toxin (DT). Mice receiving DT from birth suffered from a disease similar to scurfy mice, where adult mice experienced autoimmunity characterized by lymphoproliferative disease within 3 weeks.

PAGE 24

24 Moreo ver, antibody mediated T cell depletion of CD4+ T cells in conjunction with Treg deficiency prevented autoimmune disease onset (Kim et al., 2007) These results suggested that in the absence of Tregs, activation of autoreactive CD4+ T cells is what drove proliferation of adaptive cells of the immune system. Furthermore, the requirement of Tregs throughout the life of an individual was essential for immune regulation. Treg Associated Molecules Various cytokines and cell surface molecules play a fundamental role in the survival and suppressive function of Tregs. Tregs are able to suppress using soluble anti inflammatory cytokines; for example IL10, IL35, and (TGF are the three most heavily studied T reg cytokines (Collison et al., 2007; Vignali et al., 2008; Collison et al., 2009) The three anti inflammatory cytokines used by Tregs to suppress seem to hav e much overlap in function. Tregs also suppress immune responses via cell to cell contact using cytotoxic T lymphocyte antigen 4 (CTLA4) (Sojka et al., 2009) In addition to these Treg associated inhibitory cytokines/molecules Tregs also require IL2 for peripheral maintenance/survival (Malek et al., 2008) IL10 is a homodimeric cytokineproduced by a wide variety of cells and has a wide range of inhibitory actions. Th e regulatory ac tivity of IL10 mainly a ffects APCs however IL10 also functions as an inhibitor of T helper 1 (Th1)responses (Moore et al., 2001; Mosser and Zhang, 2008) IL10 deficient mice do not develop autoimmunity but they do develop colitis in response to some intestinal bacteria (Khn et al., 1993) In experimental autoimmune encephalomyelitis (EAE), a mouse model of MS IL10 deficient mice experience intensified disease. IL10 made by Tregs is associated with the remiss ion phase of EAE, and adoptive transfer of Tregs can prevent EAE via IL10

PAGE 25

25 signaling IL10 is also involved in the generation of the Tr1 induced Treg population, which also produces IL10 (Allan et al., 2008) TGF can in hibit Th1 and T helper 2 (Th2) responses, T cell proliferation, aid in nTreg maintenance (Marie et a l., 2006; Li et al., 2007) TGF has been connected to Tregs suppressive function in type 1 diabetes (T1D) and inflammatory bowel disease (IBD) (Fahln et al., 2005; Tonkin and Haskins, 2009) F urthermore, depletion of TGF with anti TGF antibodies results in diminished Treg function in both humans and mice (Joetham et al., 2007; Strauss et al., 2007) TGF deficient mice succumb to spontaneous autoimmunity by 5 weeks of age characterized by a dysregulated inflammatory response (Letterio et al., 1996; Kobayashi et al., 1999) In addition to its suppressive function TGF can also induce the regulatory T cell subset, Th3. IL35 is the most recently discovered suppressive cytokine of Tregs and can inhibit Th1, Th2, and Th17 responses. IL35 is a heterodimeric cytokine (Collison et al., 2007) This cytokine is required for optimal regulatory function in vivo as Tregs deficient in either chain of the cytokine are unable to effectively suppress T cell proliferation and inhi bit inflammatory bowel disease ( IBD ) (Collison et al., 2007) Whether or not this cytokine has the ability to inhibit all T cell, B cell, and APC subsets has yet to be determined. L ike IL10 a regulatory T cell population called iTr35 cells (Collison et al., 2010) CTLA4 (cytotoxic T lymphocyte antigen 4) plays an important immunoregulatory r ole the immune system, particularly in Tregs as it mediates contact dependent suppression (Sojka et al., 2009) CTLA4 is present on T cells and is similar to the CD28 costimulatory protein as it binds to CD80 and CD86 on APCs In contrast to CD28,

PAGE 26

26 CTLA4 transmits an inhibitory signal to the cell (Walke r and Sansom, 2011) CTLA4 is found intracellularly in Tregs and is an important aspect of their contact dependent suppressive function. In fact, CTLA4 deficient Tregs are unable to control expansion of CD4+ T cells in a lymphopenic environment and ca nnot prevent colitis. These CTLA4 deficient Tregs also failed to suppress cytokine production associated with T cell expansion (Sojka et al., 2009) These results show the significance of CTLA4 in the regulatory capabilities of Tregs. Although IL2 is not an anti inflammatory cytokine or suppressive molecule used by Tregs, it is necessary for the irexpansion and survival. IL2 is also necessary for the development of T cell memory as well as being required for the development and maintenance of Tregs in the thymus and periphery (Malek et al., 2008) Production of IL2 is achieved when antigen binds to the TCR of conve ntional T cells. Although Tregs cannot produce their own IL2, they require it to expand and maintain suppressive function. IL2 helps to maintain Treg homeostasis by the downstream phosphorylation of STAT5 which leads to the upregulation of Foxp3 heighteni ng suppressive function (Malek et al., 2008 ) In the absence of IL2 Tregs have reduced suppressive capabilities and decreased survival. Effects of T reg Deficiency An underlying cause of autoimmunity is thought to be due to a deficiency in Tregs, either in numbers, function, or the presence of effector cell s resistance to Tregs ( Figure 1 3 ) This reduction in Tregs may not be systemic and may be rest ricted to the site of inflammation. There are many plausible causes for a Treg deficiency. A disturbed population of Tregs in the periphery could be due to a defect in the selection of Tregs, leading to fewer cells in the periphery. A pro inflammatory e nvironment can

PAGE 27

27 also hinder Tregs from eliciting their suppressive function. Regardless ofhow a Treg deficiency develops, the inability of Tregs to suppress leads to the development of excessive inflammation and eventual autoimmunity. Although s ome studies examining the correlation of Tregs and autoimmunity have not shown significant results regarding Treg populations these results are debatable due to the limitations in tissue availability for examination Despite the varied results from these studies, lo w levels of Tregs arecorrelatedwith various autoimmune diseases such as type 1 diabetes (Tonkin and Haskins, 2009) Additionally, the adoptive transfer of Tregs has proven successful in preventing autoimmunity in mouse models of S LE, MS, IBD, and T1D (Brusko et al., 2008) autoimmunity, there has been much research on finding novel ways to develop therapeutic strategies using Treg cells. Project Rationale and Design The maintenance of immune homeostasis is critical for a healthy immune system. O ne should be able to mount a robust immune response and shut it down upon clearance of the pathogen The appropriate regulation of an immune response inhibits excessive inflammation, which could potentially lead to autoimmunity. Immune cells can be regulated in the periphery by both cytokine and peripheral regulation mechanisms. SOCS 1 plays a critical role in the modulation of cytokine signaling intracellularly. A deficiency in SOCS1 causes excessive inflammation resulting in a severe autoimmune disease leading to death by 21 days in mice (Marine et al., 1999) In addition to immune regulation by SOCS1, Tregs also play an essent ial role in maintaining immune homeostasis. A deficiency in Tregs allows for disrupted regulation

PAGE 28

28 of immune cells further leading to autoimmunity (Wing and Sakaguchi, 2010) Furthermore, mice with a genetic mutation rendering their Tregs nonfunctional suffer from autoimmunity resulting in death (Brunkow et al., 2001) The impo rtance of both the SOCS1 and Treg immune regulatory mechanisms cannot be ignored .H owever the relationship between these two pathways has not been fully examined. We hypothesize that SOCS1 plays an essential role in the maintenance of Tregs The purpose of this study was to analyze the effects of SOCS1 deficiency on Treg homeostasis. The first goal of this project was to a ssess the presence of Tregs in SOCS1 / mice Since SOCS1 deficient mice suffer from a severe autoimmune disease due to excessive infl ammation, we wanted to examine whether disease was caused by a deficiency in Tregs. The second goal of this project was to d evelop a treatment to decrease inflammation in SOCS1 / mice Due to the early onset of severe autoimmunity and death by 3 weeks of SOCS1 / mice, we wanted to develop a treatment strategy to reduce inflammation and prolong life of our mouse model. By doing this we will have an increased window of time for examination of cell populations. The third goal of this project was to e xami ne the Treg population in treated SOCS1 / mice We wanted to examine Tregs post treatmentbecause the excessive inflammation of the untreated mouse may be detrimental to the SOCS1 deficient Treg population. This work is designed to determine the role th at SOCS1 plays in the maintenance of a peripheral Treg population. By understanding the interplay between the SOCS1 and Treg immune regulatory pathways one can further examine the

PAGE 29

29 mechanism by with SOCS1 regulates the regulators. SOCS1 can potentially be used as a target for the development of Treg specific therapeutics.

PAGE 30

30 Figure 1 1 Suppressor of cytokine signaling conserved structure. The SOCS family of proteins have a relatively conserved structure. SOCS proteins possess a SH2 domain that binds to phosphotyrosines on the cytokine receptor blocking transcription factor binding. They also have a SOCS BOX region, which can target receptor complexes for proteasomal deg radation. SOCS1, SOCS3, and possibly SOCS5 have a kinase inhibitory region (KIR) that can bind to the activation loop of janus kinases (JAKs) to inhibit JAKs ability to phosphorylate. All of these regions of the SOCS protein work to inhibit cytokine sign als.

PAGE 31

31 Figure 1 2 Inhibition of cytokine signaling by suppressor of cytokine signaling 1. Upon JAKs can phosphorylate themselves o nean other and the receptor. STATs bind to the phosphorylated receptor and then homo or hetero dimerize and move into the nucleus to initiate the transcription of cytokine specific genes. One of these genes is for the SOCS1 protein. Upon upregulation, SOCS1 can inhibit cytokine signaling by inhibiting phosphoryla tion of the JAKs or by targeting the receptor complex for degradation.

PAGE 32

32 Figure 1 3. D efects in regulatory T cells cause increased susceptibility to autoimmunity. Defects in Tregs include deficiency in number/percentage, lack of suppressor function, and resistance of effector cells to be ing suppressed. Any one, or a combination, of these defects promote the development of autoimmunity.

PAGE 33

33 CHAPTER 2 ASSESS THE PRESENCE OF TREGSINS OCS1 / MICE Background Thymic development, as mentioned previously, i s an important aspect of the immune system that allows for proper development of T cells to ensure elimination of auto reactive cells that could potential induce autoimmunity (Miller, 2002; Aspinall et al., 2010) Upon export from the thymus, T cells should have specificity to foreign antigen without being auto reactive. Regulatory T cells can develop in two accepted ways. Tregs can develop in the thymus with conventional T cells and are termed natural Tregs (nTreg) or they can be induced in the periphery from nave CD4+ T cells and are termed induced Tregs (iTreg). Regulatory T cellsdevelop in the thymus in a manner slightly different tha n conventional T cells. While conventional T cells are targeted f or deletion when their TCR has self antigen specificity, Tregs are not targeted for deletion. The n Treg TCR is specific for host antigens (Caton et al., 2004; Cabarrocas et al., 2006) T cells that have a host antigen specific TCR and also express the Treg transcription factor forkhead box p3 (Fo xp3) will not be deleted during negative selection in the thymus (Bettini and Vignali, 2010) Instead, these Foxp3+ T cells will be released into the periphery with suppressive function, being denoted as nTregs. Although they are released from the thymus slightly later than conventional T cells the thymic development of Tregs is critical in earl y immune repertoire development This fact is confirmed by day 3 thymectomized mice that die of severe inflammation due to a lack of Tregs This is because the t hymus is removed before Treg s can be export ed ( Suri Payer et al., 1998) The presence of Tregs early on in the periphery is required to prevent autoimmunity/inflammation.

PAGE 34

34 In addition to Tregs that develop naturally in the thymus, Tregs can also be induced from nave T cells in the periphery. The di stinction between nTreg and iTreg is site their of development and antigen specificity. Unlike nTregs, iTregs do not require costimulation to become activated. This is due to the cytokine environment present when this Treg subset develops. iTregs are al so different from nTregs in that they do n ot have TCR specificity to self antigens. Infact iTregs have specificity for non self antigens similar to that of effector T cells, and they become suppressor cells at the site of inflammation (Belk aid et al., 2002; Suvas et al., 2004; Suffia, 2006; Belkaid, 2008) Both nTregs and iTregs play an important role in maintaining immune homeostasis (Vignali et al., 2008; Betts et al., 2012) nTregs control autoreactive T cells responding to self antigens. Conve rsely, iTregs are usually found at the site of inflammation and suppress inflammation in response to non self antigens. There are three types of iTregs currently recognized: type 1 regulatory cells (Tr1) (Tang and Bluestone, 2008) T helper 3 T cells (Th3) (Vignali et al., 2008) and IL35 producing suppressor cells (iTr35) (Collison et al., 2010) .E ach of these subsets require a unique cytokine environment to facilitate induction. Tr1 cells do not express Foxp3, are induced by IL10 and suppress via IL10 and TGF (Mandapathil and Whiteside, 2011) Th3 cells are induced by TGF and express both Foxp3 and TGF after transformation (Xu et al., 2003) Lastly, iTr35 cells express Foxp3 are induced by and produce IL35 (Collison et al., 2010; Gravano and Vignali, 2011) Although these iTreg subtypes are developed differently, they all possess the ability to control the development of excessive inflammation/ autoimmunity.

PAGE 35

35 Regardless of the means of Treg development, their presence is necessary for the maintenance of immune homeostasis. A deficiency in Tregs allows for the development of autoimmunity. In this chapter, we identify a deficiency in Tregs in SO CS1 / mice, which succumb to lethal autoimmunity by 21 days. The experiments provide evidence suggesting Treg deficiency in SOCS1 / mice is likely not due to poor thymic development, but rather dysregulation of the peripheral cytokine environment. Resul ts SOCS1 / Mice are Deficient in P eripheral Foxp3+ Tregs. Tregs are critical inhibitors of inflammation. Without this ability to alleviate inflammation autoimmunity can develop. Since SOCS1 / mice die of an inflammation mediated autoimmune disease, we wanted to examine the presence of Tregs in the periphery of SOCS1 deficient mice at 2 weeks of age. Tregs are CD4+CD25+Foxp3+ cells. We initially examined SOCS1 expression in WT CD4+CD25 conventional T cells and WT CD4+CD25+ Tregs. As shown in Figure 2 1 WT CD4+CD25+ Tregs express more Foxp3 mRNA than conventional T cells. These Tregs also express more SOCS1 mRNA than the CD4+CD25 T cells. We observed that the frequency of Tregs is reduced from 11% to 8% in the lymph nodes and 13% to 5% in the spleen f rom WT and SOCS1 deficient mice respectively (Figure 2 2). Furthermore, despite the comparable absolute numbers in the lymph nodes of total and CD4+ T cells in 2 week old WT and SOCS1 / mice, th ere is a significant decrease of the absolute number of Tre gs in SOCS1 / mice when compared to WT littermate controls in (6.6x10 4 versus1.5x10 5 ; p =.02 ; Figure 2 2A). Consistent with previous studies, SOCS1 / mice are lymphopenic with total and CD4+ lymphocytes in spleens of 2 week old SOCS1 / mice being signif icantly reduced in c ontrast to WT controls (Figure 2 2B). Notably,

PAGE 36

36 there was a reduction in Treg numbers in the spleen of SOCS1 / mice to WT (2x10 4 versus 1.2x10 5 ; p =.0003; Figure 2 2B). Together these results show the importance of SOCS1 in Tregs and t hat SOCS1 / mice have both a frequency and numeric deficiency in secondary lymphoid organs. Thymic D evelopment of SOCS1 / Tregs Does Not Contribute to Peripheral D eficiency. The thymus plays a vital role in the development of the peripheral T cell reper toire, and more importantly in the early establishment of peripheral Tregs. We next determined whether the peripheral reduct ion of Tregs was due to defective development in the thymus. Consistent with previous studies, analysis of the thymus by flow cyto metry shows higher frequencies of mature CD4+CD8 and CD8+CD4 lymphocytes in SOCS1 / mice in comparison to WT mice at 2 weeks of ag e (Figure 2 3A) (Zhan et al., 2009; 2009) The increase in mature lymphocytes could be attributed to a decrease in immature CD4+CD8+ thymocytes (85% WT to 32% KO) and a decrease in total thymocytes (4.8x10 7 WT versus 1.5x10 7 KO; p = .0001; Figure 3 3C). Regardless of the reduction of total thymocytes in SOCS1 / mice the numbers of CD4+CD8 and CD4+CD8 Foxp3+ Tregs were comparable betwee n SOCS1 / and WT mice (Figure 2 3C). In fact, Foxp3+ Treg percentage was also compara ble in WT and SOCS1 / (Figure 2 3B) and t hese Tregs are CD4+CD8 (Figure 2 3A). Collectively th is data suggest s that improper thymic development of Tregs is not likely a contribu ting factor in the peripheral deficiency of Tregs in the SOCS1 / mice. Treg Deficiency is Correlated to Dysregulated Cytokine P roduction. Since SOCS1 is an inhibitor of cytokine signaling, we next examined the cytokine production of lymphocyt es in the ab sence of SOCS1. Ex vivo analysis of IL2 (which is

PAGE 37

37 essential for T reg survival) and pro inflammatory cytokines IL17 and IFN show no significant difference between SOCS1 / and WT littermates at 2 weeks (Figure 2 4). We next measured the ability of lympho cytes collected from 2 week old SOCS1 / and WT mice to produce IFN IL17 and IL2 by EL ISA. As seen in Figure 2 4, there is no statistical difference between unstimulated lymphocytes. However, stimulated SOCS1 / lymphocytes have a dysregulated cytokine production characterized by decreased production of IL17 and increased production in IFN in comparison to WT contro ls (Figure 2 4). Strikingly, SOCS1 / lymphocytes produce significantly less IL2 than WT lymphocytes upon TCR stimulation. These results c ollectively show that lymphocytes deficient in SOCS1 have an enhanced capacity to produce IFN and a reduced ability to produce IL17 and IL2. Thus suggesting that the lack of cytokine regulation is likely c ontributing to the peripheral reduction of Tregs in SOCS1 / mice. Summary SOCS1 / mice succumb to severe T cell mediated autoimmunity resulting in death by 21 days (Marine et al., 1999) This disease is characterized by leukocytic infiltration into vital organs, excessive IFN production, and extreme lymphocyte activ ation. In addition to the previously addressed indicators of SOCS1 / disease, this study has shown that SOCS1 deficient mice also suffer from lymphopenia, particularly in peripheral Foxp3+ Tregs (F igure 2 2). The deficiency in peripheral Tregs is i n con trast to previous studies utilizing T cell specific deficiency of SOCS1 (Zhan et al., 2009) Since we saw this deficiency in peripheral Tregs we further examined the thymus of SOCS1 / mice, as the development of thymically derived Tregs is critical for healthy peripheral homeostasis early on. Strikingly, we found increased percentages and

PAGE 38

38 numbers of Tregs in the thymus of SOCS1 / mice in comparison to their WT littermate controls (Figure 2 3). These results were consistent with previous studies examining the thymic development of Tregs in T cell specific SO CS1 deficient mice (Zhan et al., 2009) Our findings su ggest that the Treg deficiency seen in the SOCS1 / mouse was not due to thymic development but rather from a peripheral influence. The peripheral cytokine environment influences cells to elicit their function. In T cells for example, various cytokines p resent upon T cell activation can guide the cell to differentiate into various T cell subsets such as, Th1, Th2, Th17 or iTreg. Once differentiated, cells may require cytokines that are critical for their survival. Tregs, for example, require the presenc e of IL2 in order to survive (Vignali et al., 2008) Moreover, the presence of cytokines which are associated with inflammation have recently be en shown to cause plasticity of T cell subtypes (Zhou et al., 2009a) Due to the importance of the cytokine environment for th e maintenance of Tregs, we then decided to examine the cytokine profiles of lymphocytes deficient in SOCS1. Our studies revealed an increased capacity of SOCS1 / cells to produce IFN upon TCR stimulation in comparison to SOCS1 sufficient lymphocytes. These results were consistent with studies showing a predominant Th1 bias in SOCS1 / mice that was determined by excessive IFN production (Alexander et al., 1999) (Figure 2 4). In addition to the excessive ability of SOCS1 / lymphocytes to produce IFN we found a decreased ability to produce IL17 (Figure 2 4). This is expected due to the reciprocal relationship of IL17 an d IFN One of the most striking findings was the inability of SOCS1 / mice to produce IL2, a cytokine required for Treg survival, to the same extent as SOCS1+/+ mice (Figure 2 4). Together these results conclusively show that

PAGE 39

39 SOCS1 / mice suffer from dys regulation of several cytokines, one of which (IL2) is required for survival and peripheral expansion of Tregs

PAGE 40

40 Figure 2 1. Tregs constitutively express more SOCS1 mRNA than conventional T cells. Comparison of Foxp3 and SOCS1 relative expression between WT CD4+CD25+ and CD4+CD25 lymphocytes. Axillary, brachial, inguinal, superficial cervical, and mesenteric lymph nodes were isolated from WT mice followed by magnetic separation of CD4+CD25+ and CD4+CD25 T lymphocytes. Graph showing relative ex pression of Foxp3 and SOCS1 in CD4+CD25 and CD4+CD25+ lymphocytes relative to actin. Data shown is representative of 4 independent experiments. Statistical comparisons between CD4+CD25 and CD4+CD25+ cell fractions were performed using unpaired, two tai led t test with statistical significance denoted by asterisks. *, p p 05

PAGE 41

41 Figure 2 2. SOCS1 / mice are deficient in peripheral Foxp3+ regulatory T cells. (A) Axillary,brachial, inguinal, superficialcervical, and mesentericlymph nodes were isolatedfromSOCS1 / (n=12)or WT littermate controls (n=12) at 2 weeks.Top: Histogram showing percentages of CD4+Foxp3+lymphocytes in SOCS1 / and littermate controls. Bottom: Graphs showing absolutenumbers of total,CD4+,andCD4+Foxp3+ lymphocytes. Each do t is representative of an individual mouse with averages denoted by lines. (B) Spleens were isolated from mice indicated in A. Top: Histogram comparing percentages of CD4+Foxp3+lymphocytes in SOCS1 / and littermate controls Bottom: Graphs showing absolut e numbers of total,CD4+,andCD4+Foxp3+ lymphocytes. Each dot is representative of an individual mouse with averages denoted by lines. Statistical comparisons between WT and SOCS1 / mice were performed using unpaired, two tailed t test with statistical signi ficance denoted by asterisks. *, p p

PAGE 42

42

PAGE 43

43 Figure 2 3. Periperal Foxp3+ Treg deficiency in SOCS1 / mice is not due to inadequate thymic development. WT (n=14) and SOCS1 / (n=11) micewere sacrificed at 2 weeks afterbirth T hymii were removed and analyzed. (A) Dot plotsshowing CD4 versus CD8expression in total (top) and Foxp3+ (bottom) thymocytes. (B) Histograms showing Foxp3 expression in CD4+CD8 thymocytes. (C) Graphs showing absolute cell numbers of total, CD4+CD8 and CD4 +CD8 Foxp3+ thymocytes. Each dot represents an individual mouse with lines denoting averages. Statistical comparisons between WT and SOCS1 / mice were performed using unpaired, two tailed t test with statistical significance denoted by asterisks. ***, p

PAGE 44

44 Figure 2 4. Dysregulated cytokine production by SOCS1 / lymphocytes is correlated to a reduction in peripheral Tregs. Dysregulated cytokine production by SOCS1 / lymphocytes. Single cell lymph node suspensions were isolated from SOCS1 / (n= 4)or WT littermate controls (n=7) at 2 weeks .Analysisof the production of IFN IL17, or IL2 cytokine message and/or protein by cells ex vivo or after culture, in the presence or absence of TCR stimulatio n Left: Graphs showing mRNA expression of IFN IL 2 and IL17 relative to actin. Graphs showing production of IFN IL2, and IL17 by SOCS1 / and WT lymphocytes in the absence (middle) or presence (right) of TCR stimulation. Statistical comparisons between WT and SOCS1 / mice were performed using unp aired, two tailed t test with statistical significance denoted by asterisks. *, p p p

PAGE 45

45 CHAPTER 3 DEVELOPMENT OF TREAT MENT TO DECREASE DIS EASE SEVERITY IN SOC S1 / MICE Background SOCS1 is able to control hyperactive cytokine signali ng which has been associated with the onset and pathogenes is of autoimmune disease However, in situations where this regulation goes awry development of autoimmunity can occur in the form of MS, RA or IBD. In SOCS1 / mice the developm ent of autoimmunity is so severe it leads to death by 3 weeks of age. B ecause regulation of cytokine signals is so critical in maintaining immune homeostasis SOCS1 and their mimetics could serve as a potential treatment option to delay autoimmunity in the SOCS1 deficient mouse model Mimetics of the SOCS1 kinase inhibit ory region, SOCS1 KIR, have been developed by the lab of Dr. H.M. Johnson. SOCS1 KIR is the 12 residue sequence that makes up the endogenous SOCS1 kinase inhibitory region (Waiboci et al., 2007) SOCS1 KIR (sequence: DTHFRTFRSHSDYRRI) has a lipophilic palmitoyl lysine and arginine group that allows uptake into the cell to act intracellularly SOCS1 KIR acts by inhibiting intr acellular tyrosine kinases just as the endogenous SOCS1 kinase inhibitory region does (Figure 3 1 ). This mimetic peptide induced STAT1 phosphorylation by binding to the autophosphorylation site of JAK2 (Waiboci et al., 2007) SOCS1 KIR has also been shown to be an effective treatment of Experimental Autoimmune Encephalomyelitis (EAE), which is the mouse model for MS (Jager et al., 2011) In this chapter, we develop a treatment using the SOCS1 KIR mimetic peptide in combination with SOCS1+/+ CD4+ T cell adoptive transfer The CD4+/SOCS1 KIR combined treatmentworked to both prolong life and significantly redu ce inflammation in

PAGE 46

46 the SOCS / mouse. The effects of the combined treatment allow ed us to further examine SOCS1 deficiency on target Treg populations in the absence of severe inflammation early on. Results Co mbined SOCS1+/+ CD4 + T Cell Adoptive Transfer and SOCS1 KIR Mimetic Treatment Delays Lethal D isease. Regulatory T cells play a critical role in maintaining immune homeostasis in mice. Due to a deficiency in peripheral Tregs in SOCS1 / mice we then examined whether adoptive transfer of CD4+ T cells (10% Tregs) into SOCS1 / mice could delay the onset of t he disease. We adoptively transferred magnetically sorted SOCS1 WT CD4+CD25+ Tregs or CD4+ Tcells into SOCS1 / mice 48 hours after birth (Figure 3 2). As seen in Figure 3 3 A, the adoptive transfer of either SOCS1 sufficient CD4+CD25+ Tregs or total CD4+ T cells offered a significant, but limited, increase in survival of SOCS1 / mice ( p = 0. 002). The kinase inhibitory region of SOCS1 is involved in inhibition of cytokine signals. Due to the dysregulation seen in SOCS1 deficient cells we suspected that b y restoring SOCS1 kinase inhibitor y function we could delay morbidit y in SOCS1 / mice. We used a 16 amino acid peptide mimicking the KIR region of SOCS1, SOCS1 KIR, which contains a lipophilic group that allows the peptide to enter the cell and work intr acellularly. We then treated SOCS1 / mice with 10 g/g of mouse weight daily to examine its ability to prevent disease lethality. Treatment of SOCS1 / mice with SOCS1 KIR resulted in an increase in the lifespan that was similar to the adoptive transfer of C D4+ T cells or Tregs (Figure 3 3 A). T he control peptide, SOCS1 KIR2A, containing a two alanine substitution in critical regions of KIR function has no effect on

PAGE 47

47 SOCS1 / mouse survival (data not shown). Jointly, these data show that SOCS1 KIR elicit s a peptide specific effect on increasing the lifespan of SOCS1 / mice. B ecause treatment with CD4+ T cell /C D4+CD25+ Treg or SOCS1 KIR peptide facilitated a similar increased survival of SOCS1 / mice we next examined whether a combination of these treat ments could further enhance the surviv al of SOCS1 / mice. Figure 3 3 B shows that the combined treatment of CD4+T cells and SOCS1 KIR (CD4+/SOCS1 KIR treatment) indeed mediated an enhanced survival. In fact, SOCS1 / mice receiving the treatment had a maxi mum life span of 77 days rather than the 17 days seen in the untreated mice. Collectively, this shows that CD4+/SOCS1 KIR treatment could extend the lifespan of 20% of the treated SOCS1 / mice beyond 30 days which is3 fold more than CD4+ T cells or SOCS 1 KIR treated mice with lifespan extended to 24 days CD4 + /SOCS1 KIR Treatment Increased W eight Gain, Delayed Leukocyte Infiltration into Heart and Liver, and Reduced Serum IFN L evels in SOCS1 / M ice. Since SOCS1 / disease is characterized by stunted growth, leukocytic infiltration into vital organs, and aberrant IFN signaling, we determined the effect of CD4+/SOCS1 KIR treatment in these specific areas. CD4+ T cell, CD4+CD25+ Treg, and SOCS1 KIR treated SOCS1 / mice all experienced a statistically significant increase in weight and improved overall appearance in comparison to unt reated SOCS1 / mice (Figure 3 4 ). We next examined the effect of the CD4+/SOCS1 KIR treatment on leukocytic infiltrati on in the heart and liver by performing h emotoxylin a nd eosin staining of the heart and liver of WT, SOCS1 / and CD4+/SOCS1 KIR tr eated SOCS1 / mice. Figure 3 5 A shows that SOCS1 / mice have infiltration and damage in 100% of tissues examine d In contrast, SOCS1 / mice receiving the CD4+/SOCS1 KIR

PAGE 48

48 tre atment had reduced leukocytic infiltration in 40 percent of heart tissue and 20 percent of liver tissue that was examined. We then examined the sera collected from mice at 2 weeks of age to assess the presence of inflammatory cytokines by ELISA. Despite IL17 levels being unaffected by the combined treatment, IFN was significantly lower in SOCS1 / mice receiving the combined treatment in comparison to untreated SOCS1 / mice ( p =0.0292; Figure 3 5 B). Thus there is a correlation between long term surviva l and healthy tissues in CD4+/SOCS1 KIR treated SOCS1 / mice. Together, these data propose that CD4+/SOCS1 KIR treatment not only significantly prolongs the lives of SOCS1 / mice but it also reduces leukocytic infiltration and IFN production. Summary I n this chapter we develop a therapy to enhance the survival of SOCS1 / mice that die by 3 weeks of age. Although Tregs are able to suppress autoimmunity when adoptively transferred into mouse models of inflammation, Tregs or CD4+ T cells alone were only able to mediate a limited but significant increase in survival (Figure 3 3A). Likewise Treatment with the SOCS1 KIR peptide could only enhance survival similar to the T cell/Treg adoptive transfer treatment strategy (Figure 3 3A).We then performed a co mbined treatment of SOCS1 KIR and adoptive transfer of SOCS1+/+ CD4+ T cells. Strikingly, our CD4+/SOCS1 KIR treatment enhanced the survival of SOCS1 / mice from 100% death by 18 days to a maximum life span of 77 days (Figure 3 3 B ). In addition to an i ncreased lifespan SOCS1 / mice receiving combined treatm ent experienced enhanced overall health, which is noted by increased weight and healthier appearance when compared to untreated SOCS1 / controls (Figure 3 4). The long term survival that was observ ed in SOCS1 / mice receiving the combined treatment was correlated to reduced leukocytic infiltration into the heart and liver as well as a

PAGE 49

49 significant reduction in serum IFN (Figure 3 5). These results suggest that the CD4+/SOCS1 KIR treatments mediate d improved survival of SOCS1 / mice by reducing IFN signaling thus deferring destruction of vital organs by infiltrating leukocytes.

PAGE 50

50 Figure 3 1 SOCS1 KIR restores partial function of SOCS1 in the absence of the endogenous protein. SOCS1 KIR, a mi metic peptide of the kinase inhibitory region of SOCS1, successfully inhibits cytokine signaling b y inhibiting phosphorylation of JAKs.

PAGE 51

51 Figure 3 2. Schematic diagram of mouse treatment strategies performed on SOCS1 / mice. Asingle cell suspension of splenocytes obtained from 6 8 week old WT mice was enriched for CD4+ or CD4+CD25+ T lymphocytes by magnetic separation (MiltenyiBiotec). 5 x 10 5 CD4+ or CD4+CD25+ T lymphocytes cells were injected into SOCS1 / pups bi weekly starting on day 2 after birth in the presence or absence of dail y ip injection s of SOCS1 KIR (10 g /g).

PAGE 52

52 Figure 3 3 Survival curve of SOCS1 / mice receiving treatment. (A) Kaplan Meier curve showing survival of SOCS 1 / (black square; n=9), mice receiving injection of 5 x 10 5 purifie d CD4+CD25+ Tregs (ip ) twice a week (green diamond; n=5), mice receiving injection of 5 x 10 5 purified CD4+ T cells (ip ) twice a week (blue square; n=12), or daily SOCS1 KIR peptide (10 g/g) treatment (red triangle, n=7) (B) Kaplan Meier curve showing su rvival of SOCS 1 / (black square; n=7) or CD4 + /SOCS1 KIR treatment(purple triangles, n=12).Numbers of mice in each group are indicated in parentheses. Mice were euthanized when moribund. SOCS1 / survival curve is being compared to various treatment surviv al curves by Mantel Cox comparison. Statistical significance denoted by asterisks. *, p ; **, p 0 5

PAGE 53

53 Figure 3 4 CD 4+/ SOCS1 KIR treatment increases the overall health of 2 week old SOCS1 / mice (A) Graph showing average daily weights of SOCS1 / mice untreated (n=16), receiving 5 x 10 5 WT Tregs (n=6), 5 x 10 5 WT CD4 + T cells (n=12), SOCS1 KIR peptide treatment (n=7), CD4 + /SOCS1 KIR treatment(n=12), or WT littermate controls (n=9) over a two week period. (B) Photographs of 2 week old SOCS1 / m ice, SOCS1 / mice receiving dual treatment, and WT littermate controls. Shown are two photos each depicting the range of visual appearance under each condition. Statistical significance denoted by asterisks. ***, p 00 5

PAGE 54

54 Figure 3 5. CD4+/SOCS1 KIR trea tment prevents leukocyte infiltration into the heart and liver of 2 week old SOCS1 / mice. (A) Photographs of H&E stains at 20x magnification depicting heart and liver tissues of 2 week old SOCS1 / SOCS1 / mice receiving dual treatments, or littermate c ontrol mice. Photographs shown of H&E stained liver and heart of untreated SOCS1 / (n=8) and WT (n=7) mice are representative of 100% of samples analyzed. Photographs shown of H&E stained liver and heart of SOCS1 / mice receiving combined treatments are representative of 2 out of 5 mice in regard to heart samples and 1 out of 5 mice in regards to liver tissue. Please note that these percentages are consistent with SOCS1 / mice with extended survival. (B) Graphs showing IFN and IL17 levels within the sera of 2 week old WT (n=7) or SOCS1 / mice with (n=8) and without (n=10) CD4+/SOCS1 KIR treatment. IFN and IL17 cytokine levels were analyzed by ELISA. Statistical comparisons between WT and SOCS1 / mice were performed using u npaired, two tailed t test with statistical significance denoted by asterisks. *, p

PAGE 55

55

PAGE 56

56 CHAPTER 4 EXAMINATION OF TREG POPULATION IN T REATED SOCS1 / MICE Background Foxp3 expression is accepted as Treg specific cell marker As long as Foxp3 is exp ress ed Tregs can develop and possess suppressive function with the capability of reversing severe inflammation or autoimmunity. However, recent studies have clarified what happens when once conventional Tregs fail to maintain Foxp3 exp ression. These stu dies involve Crerecombinase (Cre) mediated deletion of the Foxp3 allele in fully nger expressing Foxp3, undergo cell divisi ons and lose characteristic Treg markers (Yang et al., 2008; Sharma et al., 2010) Moreover, ex Tregs acquire the ability to begin producing effector T cell cytokines such as IL17, IFN and IL4. In fact, when t hese ex Tregs are transferred into lymphopenic hosts with out functional Tregs they cause tissue lesions and wasting disease, similar to the adoptive transfer of conventional T cells. These findings ignited an important question on whether or not Tregs, l ike other T cell subtypes have phenot ype plasticity. Another concern was whether inflammatory conditions could influence loss of Foxp3 expression in Tregs, converting them to potentially pathogenic effector cells. Recent studies have proposed wavering answer s to the question on Treg stability Treg phenotype in stability f irst came from an in vitro study showing that Tregs expos ed to IL1 and IL6 down regulate Foxp3 and beg in producing IL17, a Th17 signature cytokine (Yang et al., 2008) In another study, Tregs expressing GF P Foxp3, expressed GFP, but not Foxp3 following exposure to an inflammatory environment (Hori, 2011) This wou ld suggest that upon inflammatory

PAGE 57

57 conditions that Foxp3 expression might diminish allowing for an unstable Treg phenotype. To further investigate induction and loss of Foxp3 exp ression one study used GFP and y ellow fluorescent protein (YFP) reporters for Foxp3. In these studies cells that are currently Foxp3+ Tregs are expressing both GFP and YFP but cells that are no longer expressing Foxp3 are only YFP+ cells The population of YFP+ GFP cells that stopped expressing Foxp3, are referred to as Ex Tregs displayed effector T cell functions, such as production of IFN and IL17, and had the ability to stimulate autoimmune inflammation in diabetes prone NOD mice (Zhou et al., 2009 ) A nother group used a similar model with inducible Treg cells in knock in mice that ha d GFP and YFP reporter s at the Foxp3 locus. In contrast to the previous study, a nalysis of these mice reveal ed an extremely stable expression of Foxp3 in Treg cells under various immune conditions Included werebasal conditions lymphopenia, and L isteria infection. In addition to the conservation of Foxp3 expression in these Tregs, they did not produce IL17 or IFN when transferred into autoimmune prediabetic, lymphoreplete NOD mice (Rubtsov et al., 2010) T c ell plasticity is the swapping of a T cell lineage when presented with a certain cytokine milieu. For example Th17 cells expressing ROR transcription factor, transcription fac tor. Moreover, it has been implicated that Foxp3+ Tregs, when in the appropriate cytokine microenvironment, may experience a loss of Foxp3 expression (Zhou et al ., 2009 ) Furthermore, loss of Foxp3 expression may allow for the expression of pro inflammatory T cell transcription factors that can promote the

PAGE 58

58 Phenotype stability is particularly important nTregs, which are specific for s elf antigen. nTregs must maintain a stable phenotype to not transition into auto reactive T cells. Therefore, in order to maintain immune homeostasis and prevent autoimmunity, i t is critical that Tregs remain functional and not develop this plastic phen otype at sites of inflammation Because it is evident that inflammation can have a detrimental effect on Tregs, it was essential for us to further examine the effects of the combined treatment on the peripheral Treg population of SOCS1 / mice. In this ch apter we observe the restoration of the peripheral Foxp3+ Treg population as well as a decrease in the percentage of CD4+CD25+Focp3 effector T cells. Additionally, we found that the enhanced survival and reduced inflammation of SOCS1 / IFN / and SOCS1 KO bone marrow chimeras was correlated to a maintained peripheral Treg population. Lastly, we examined the levels of mRNA for lineage specific transcription factors in Foxp3+ Tregs Results confirm, upon culturing in vitro with IFN SOCS1 deficien t Foxp3+ Treg s experience transcription factor plasticity. Results Treatment of SOCS1 / M ice with CD4 + /SOCS1 KIR Treatment R estores Foxp3 + Treg Peripheral Frequency and Decreases Peripheral E ffector CD4 + T C ells. Since SOCS1 / mice are lymphopenic and have a significant reduction in peripheral Foxp3+ Tregs (refer to Figure 2 2), we next determined whether the delayed organ infiltration and decrease in IFN with CD4+/SOCS1 KIR treatment was due to restoration of Treg homeostasis. Indeed, a statisti cally significant increase in the frequency of Tregs was seen in the lymph nodes of SOCS1 / mice with combined treatment in comparison to untreated SOCS1 / mice ( p =0.05; Figure 4 1 A/C).

PAGE 59

59 Furthermore, a statistically significant decrease in the frequency of CD4+CD25+Foxp3 effector cells was observed in the spleens of SOCS1 / mice with treatment ( p =0.05; Figure 4 1 B/C). These results collectively confirm that CD4+/SOCS1 KIR treatment increased Foxp3+ Treg frequency and decreased activated CD4+ effector T cells in SOCS1 / mice. CD4 + /SOCS1 KIR Treatment Confers Enhanced Foxp3+ Treg Peripheral Homeostasis and Reverses L ymphopenia in SOCS1 / M ice. Since autoimmunity has been attributed to a defect in Tregs and lymphopenia, we next determined whether the inc reased survival we saw in SOCS1 / mice receiving treatment was due to homeostatic resto ration of lymphocytes. Figure 4 2 illustrates that CD4+/SOCS1 KIR treatment on SOCS1 +/+ mice creates no differences in total cell numbers, CD4+ lymphocytes, or CD4+Fox p3+ Tregs in secondary lymphoid organs. Despite t he lack of differences in SOCS1+/+ mice with combined treatment, SOCS1 / mice receiving treatment had a significant increase in the total, and CD4+ lymphocytes of peri pheral lymphoid organs (Figure 4 2 top and middle). Likewise, SOCS1 / mice experienced enhanced CD4+Foxp3+ Tregs in the lymph nodes upon combined treatment (Figure 4 2 bottom). Interestingly, CD4+ T cell and CD4+CD25+ Treg transfer or SOCS1 KIR alone was unable to mediate this homeostatic re storation (data not shown). This data together s uggests that CD4+/SOCS1 KIR treatment was successful in facilitating the reversal of lymphopenia in SOCS1 / mice. Additionally SOCS1 / mice receiving combined treatment had significantly increased Foxp3+ Tregs in lymph nodes compared to untreated SOCS1 / controls.

PAGE 60

60 Enhanced Survival of Other SOCS1 / Mouse Models Correlates with Maintained Treg Homeostasis SOC S 1 / mice receiving the CD4+/SOCS1 KIR treatment experience enhanced survival due to decreased inflammation and increased peripheral Treg homeostasis. Other SOCS1 deficient mouse models, such as the SOCS1 / IFN / mice, do not experience peri lethal death that is associated with the traditional global SOCS1 deficient mouse. Due to this enhanced survival, we examined the peripheral Treg population in SOCS1 / IFN / and SOCS1 / bone marrow chimeric mice. Figure 4 3 shows a sustained CD4+Foxp3+ Treg population in the lymph node (A ) and spleen (B ) of SOCS1 / IFN / mice (10% and 25%) when compare d t o littermate controls (8% and 19 % at 6 8 weeks of age ) Thus, it is concluded that SOCS1 / IFN / mice, which do not experience autoimmunity early on, have a sustained peripheral regulatory T cell population. Importantly, SOCS1 / IFN / mice are unab le to produce IFN in the early onset autoimmunity seen in the conventional global SOCS1 / mouse We developed SOCS1deficient bone marrow chimeras in order to account for this genetic difference. Bone marrow chimeras were generated by let hally irradiating C57BL/6 mice and reconstituting them with 5x10 5 enriched stem cells from 2 week old SOCS1 / (KO) mice and littermate controls (WT). 8 weeks post transfer mice were sacrificed for analysis. Inte restingly, w e sawa comparable percentage of CD4+Foxp3+ regulatory T cells in the lymph node and spleen of either SOCS1 WT or SOCS1 KO bone marrow chimeras (Figure 4 4A) Treg percentages were supported with similar absolute numbers of CD4+Foxp3+ regulatory T cells in the lymph nodes and spleen o f SOCS1 KO and SOCS1 WT b one marrow chimeras (Figure 4 4 B). Since the SOCS1 KO bone

PAGE 61

61 marrow chimeric mice experienced a sustained Treg population, we further assessed the state of inflammation in these mice by looking at organ infiltration. Figure 4 5 show s that mice receiving SOCS1 KO bone marrow cells did not experience leukocytic infiltration into the heart and liver at 8 weeks post transfer. Lack of infiltration indicates that severe inflammation is not yet occurring in the bone marrow chimeras at this time point. This data shows that SOCS1 deficient Treg numbers and percentages were similar in comparison to control mice in both the SOCS1 / IFN / and SOCS1 KO bone marrow chimera models. Moreover, both of these models of SOCS1 deficiency have delayed onset of autoimmune inflammation and increased survival when compared to the traditional SOCS1 / mouse. This suggests that the enhanced survival of these other mouse models of SOCS1 deficiency is correlated to a sustained peripheral regulatory T cell popu lation. SOCS1 Deficient Tregs Experience Lineage Specific Transcription Factor Plasticity Foxp3 expression is required for the suppressive function of regulatory T cells (Zheng and Rudensky, 2007) Additionally, the expression of T cell lineage specific transcription factors is influenced by the cytok ine environment (Zhou et al., 2009 ; Murphy and St ockinger, 2010) Due to this emerging trend of T cell lineage plasticity we examined the expression of transcription factors specific to Th1, Th17, and Treg cells in CD4+CD25+ regulatory T cells isolated from SOCS1 / IFN / mice. After magnetic separ ation, isolated Tregs were examined ex vivo and after being cultured with TCR stimulation in the presence and absence of 100 U/ml IFN the cytokine responsible for peri lethal death of SOCS1 / mice. After 48 hours cells were collected a nd RNA isolation and RT qPCR were performed to measure the levels ofmRNA expression of

PAGE 62

62 Foxp3 (Treg), Tbet (Th1), and ROR t (Th17) transcription factors specific for various T cell lineages. Initial isolation of CD4+CD25+ cells from either SOCS1 / IFN / mice or littermate controls showed that the CD25+ T cell fraction expressed higher levels of Foxp3 than the CD25 T cell fraction indicating that the CD25+ population was indeed predominantly regulatory T cells before being cultured (Figu re 4 6A). Figur e 4 6 B shows that although ex vivo SOCS1 / CD25+ cells express significantly less Foxp3 than WT controls, the addition of IFN significantly increases Foxp3 expression in SOCS1 / CD25+ T cells whereas the Foxp3 expression in the WT CD25+ cells remains th e same. Since Foxp3 expression seemed less stable in SOCS1 deficient Tregs upon the addition of the pro inflammatory cytokine IFN we then examined Th1 specific transcription factor Tbet under the same conditions. Both ex vivo and IFN stimulating condi tions showed a significantly higher Tbet expression in SOCS1 / Tregs in com parison to WT Tregs (Figure 4 6 C left). Heightened Tbet expression suggested that the SOCS1 / cells have a Th1 bias, even in the regulatory T cell population. We next examined T h17 specific transcription factor ROR t to determine if differences were also present in the expression of this lineage specific marker. As expected ex vivo SOCS1 / Tregs cells expressed less ROR t in comparison to WT (Figure 4 6 C right), this is consiste nt with previously studies showing the reciprocal relationship of Tbet and ROR t (Zhou et al., 2009 ) However upon IFN stimulation there was no significant difference in the expression of ROR t between SOCS1 WT and deficient Tregs, although ROR t expression did decrease in WT Tregs in the presence of IFN (Th1 specific cytokine). Together these data show that Tregs defi cient in SOCS1 have a dysregulation in lineage specific transcription factors upon stimulation with Th1 pro

PAGE 63

63 inflammatory cytokines This dysregulation in the presence of IFN suggests plasticity in SOCS1 deficient regulatory T cells could contribute to th e absence of Treg homeostasis during SOCS1 KO disease. Summary Due to the severe inflammatory environment of SOCS1 / mice, we suspected that the reduced Treg maintainance in the periphery was caused by excessive inflammation. As stated previously, upon t reatment of SOCS1 / mice with the CD4+/SOCS1 KIR treatment we saw reduced inflammation. Since combined treatment of SOCS1 / mice successfully decreased disease severity /inflammation we then examined the per ipheral T cell populations present in these m ice SOCS1 sufficient mice,with or without combined treatment, had no significant differences in effector T cell or Treg populations in secondary lymphoid organs (Figure 4 1) This consistency is likely because WT mice do not suffer from lymphopenia, thu s expansion and effects of adoptive transfer are not seen. SOCS1 / mice, which are lymphopenic, did in fact experience a modified peripheral T cell repertoire following CD4+/SOCS1 KIR treatment. This modified peripheral T cell repertoire of treated SOCS 1 / mice included increased percentage of Foxp3+ Tregs in the lymph nodes and decreased percentage of effector T cells in the spleen (Figure 4 1). In addition to a percentage increase of Foxp3+ Tregs, we also saw a significant numeric increase in Tregs i n the lymphnodes in relation to untreated SOCS1 / controls (Figure 4 2 A ). Interestingly, we also revealed a reversal of the lymphopenia that was associated with disease in the SOCS1 / mouse. Total and CD4+ T cell numbers were significantly amplified in the lymph node and spleen of SOCS1 / mice getting the combined treatment (Figure 4 2)

PAGE 64

64 In addition to the traditional global SOCS1 / mouse we examined SOCS1 / IFN / mice as well as SOCS1 KO bone marrow chimeras for the presence of a peripheral Treg p opulation. Because SOCS1 / IFN / mice experience delayed autoimmunity and reduced inflammation early in life, we examined whether reduced inflammation in this model of SOCS1 deficiency also provided maintenance of the SOCS1 / Treg population. In fact we saw that Tregs were present in the lymph nodes and spleen of these mice Furthermore, no significant difference was seen in the Treg percentage of SOCS1 deficient and WT mice (Figure 4 3) SOCS1 / IFN / mice cannot produce IFN which is responsible for the aggressive disease seen early on in the global SOCS1 / mouse. To further examine the effects of SOCS1 deficiency on the peripheral Treg population we developed bone marrow chimeras which still possess the ability of producing a Th1 inflammatory response We show that at 8 weeks post bone marrow transfer, not only are Tregs present in both percentage and absolute number in the lymph node and spleen of both SOCS1 KO and WT bone marrow chimeras, but that this presence was correlated to the absence of inflammation (Figure 4 4/5). These studies strongly suggest that an enhancement in survival, and decrease in inflammation during SOCS1 deficiency is correlated to a sustained Treg population. As previously mentioned the peripheral cyto kine environment plays a vital role in the differentiation and maintenance of T cells (Z hou et al., 2009 ) Inflammation has be en shown to affect the stability of not only effector T cell but also the regulatory T cell lineage (Josefowicz and Rudensky, 2009; Pillai et al., 2011) Since SOCS1 plays a critical role in regulating the effects of various cytokines, including IFN we explored the possibility that the deficiency in Tregs was due to lineage plasticity caused by

PAGE 65

65 dysregulated transcription factor expression Our data indicates, upon culturing with Th1 pro inflammatory cytokine IFN that magnetically isolated Tregs experience a dysregulation of lineage specific transcription factors in the absence of SOCS1 ( Figure 4 6). Upregulation of Tbet, a Th1 cell specific transcription factor, upon IFN stimulation suggests that regulatory T cells (like effector T cells ) have a Th1 bias when cells are SOCS1 deficient. These results propose a likely plasticity of SOCS1 / Tregs, and that they may be shifting from a traditional regulatory phenotype into a pro inflammatory type of cell.

PAGE 66

66 Figure 4 1 Treatment of SOCS1 / mice with CD4 + /SOCS1 KIR treatment increases peripheral Tregs and decreases activated CD4 + CD25 + Foxp3 cells. Flow cytometry analysis was performed on lymph node and spleen isolated from 2 week old WT or SOCS1 / mice with and without CD4 + /SOCS1 KIR treatment. Foxp3 vs. CD25 dot plot of CD4 + cells present in (A) lymph nodes or (B) spleen. (C) Bar graphs showing percentage of CD4 + CD25 + Foxp3 + Tregs and CD4 + CD25 + Foxp3 e ffector cells in SOCS1 / mice with or without treatment. Statistical comparisons between SOCS1 / mice with or without treatment were performed using unpaired, two tailed t test with statistical significance denoted by asterisks. *, p 5 mice in each group.

PAGE 67

67 Figure 4 2 CD4 + /SOCS1 KIR treatmentincreases total, CD4 + and CD4 + Foxp3 + peripheral lymphocyte numbers in SOCS1 / mice. ( A ) Graphs showing absolutenumbers of total,CD4 + ,andCD4 + Foxp3 + lym phocytes present in the lymph nodes of two week old SOCS1 / and WT littermate control mice with or without CD4 + /SOCS1 KIR treatmentand WT 6 8 week old adult mice. ( B ) Graphs showing total, CD4 + and CD4 + Foxp3 + splenocytes present in mice denoted in ( A ) Eac h dot is representative of an individual mouse with averages denoted by lines. Statistics were performed using unpaired, two tailed t test comparing treated to untreated SOCS1 / mice at 2wk s with statistical significance denoted by asterisks. *, p *, p 0 .005; ***, p

PAGE 68

68

PAGE 69

69 Figure 4 3 SOCS1 / / mice have a sustained peripheral Treg population ( A ) Axillary,brachial, inguinal, superficialcervical, and mesentericlymph nodes were isolatedfromSOCS1 / / (n=3 )or SOCS1 +/+ / littermate controls (n=2 ) at 6 8 weeks.Histogram showing percentages of CD4 + Foxp3 + lymphocytes in SOCS1 / / and littermate controls. (B) Spleens were isolated from mice indicated in ( A ) Histogram comparing percentages of CD4 + Foxp3 + splen ocytes in SOCS 1 / / and littermate controls

PAGE 70

70 Figure 4 4 SOCS1 KO Bone marrow chimerashave a sustained peripheral Treg population Axillary,brachial, inguinal, superficialcervical, and mesentericlymph nodes or spleen were isolatedfrom C57BL/6 mice receiving SOCS1 KO (n=6 )or SOCS1 WT (n=5 ) bone marrow 8 weeks post transfer .Histogram showing percentages of CD4 + Foxp3 + Tregs in lymph nodes (left) and spleen (right) in SOCS1 KO and SOCS1 WT bone marrow chimeras (B) Graphs showing absolutenumbers of CD4 + Foxp3 + regula tory T cells in lymph node and spleens of mice denoted in (A)

PAGE 71

71 Figure 4 5 No leukocytic infiltration present in SOCS1 KO bone marrow chimeras six weeks post transfer (A) Photographs of H&E stains depicting heart and liver tissues at 20x magnificatio n of SOCS1 WT or SOCS1 KO mice 8 weeks post transfer Photographs shown of H&E stained liver and heart of irradiated C57B /6 mice receiving SOCS1 KO (N=6 ) and SOCS1 WT (N=5 ) bone m arrow are representative of 100% of samples analyzed.

PAGE 72

72 Figure 4 6. SOCS1 deficient Tregs experience lineage specific transcription factor instability upon IFN stimulation. Lymph nodes and spleen were isolated from SOCS1 / IFN / (n=3 )or SOCS1 +/+ IFN / littermate controls (n=2 ) at 6 8 weeks and CD4+CD25+ Tregs were magnet ically purified. Cells were analyzed ex vivo or after culture in the presence of TCR stimulation (3 g/ml anti CD3 and 1 g/ml anti CD28) and 100U/ml IFN for the production of Foxp3, Tbet, and ROR t message. ( A ) Graphs showing mRNA expression of Foxp3in the CD25+ or CD25 cell fractions ( B ) Graphs showing mRNA expression of Foxp3in the CD25+ cell fraction ex vivo and after TCR stimulation ( C ) Graphs showing mRNA expression of Tbet and Ror tin the CD25+ cell fraction ex vivo and after TCR stimulation Expression is relative to actin. Statistical comparisons between mice were performed using unpaired, two tailed t test with statistical significance denoted by aster isks. *, p p

PAGE 73

73 CHAPTER 5 DISCUSSION It is accepted that SOCS1 and Tregs p lay a critical role in maintaining immune homeostasis. Mice with a deficiency in either of these two regulatory mechanisms suffer from sever e autoimmunity and eventual death by a T cell mediated disease similar to one another (Marine et al., 19 99; Brunkow et al., 2001) In this project we begin to address the interrelationship of these two regulatory pathways We examine the peripheral population of Tregs in mice with a global deficiency in SOCS1. Our data shows that SOCS1 / mice, suffer ing from severe autoimmunity, do not have a maintained peripheral population of Tregs. Furthermore, the deficiency of Tregs is not due to faulty thymic development. Upon further examination, we expose that SOCS1 / lymphocytes not only have a Th1 bias, p roducing pro inflammatory cytokine IFN but that they also have a reduced capacity to produce IL2. IL2 is an essential survival cytokine for Tregs. The reduced ability of SOCS1 / lymphocytes to make IL2, and increased production of IFN propose that t he peripheral cytokine environment of SOCS / mice is a likely cause of Treg deficiency. SOCS1 / mice die of lethal autoimmune disease by 3 weeks of age (Marine et al., 1999) Because of this early and excessive inflammation, it is hard to examine the SOCS1 deficient Tregs in this mouse model. In or der to combat this difficulty, we developed a treatment strategy that allowed for the enhanced survival and reduction of inflammation in SOCS1 / mice. This treatment involved the adoptive transfer of SOCS1+/+ CD4+ T cells in combination with the SOCS1 KI R mimetic peptide. The combined treatment allowed for a significant increase in survival of the SOCS1 / mice prolonging the life of 30% of the mice past 24 days whereas 100% of untreated mice

PAGE 74

74 were dead by 18 days. Strikingly, the survival we observed with our combined treatment is comparable to the survival of SOCS box deficient mice, suggesting that we are successful in the partial restoration of SOCS1 function (Zhang et al., 2001) In addition to enhanced survival of treated SOCS1 / mice, combined treatment significantly reduced the leukocytic infiltrates into the heart and liver as well as decreased serum IFN levels. Together t hese data suggest that our CD4+/SOCS1 KIR combined treatment was able to ameliorate disease in SO CS1 / mice, providing us with a less severe model of inflammation to examine SOCS1 deficient Tregs. Since combined treatment was able to successfully reduce disease severity in SOCS1 / mice we now examined the effects of reduced inflammation on the SOCS 1 deficient Treg population. Our results demonstrate an increase in the percentages and absolute numbers of Treg in the lymph nodes of SOCS1 / mice receiving our combined treatment when compared to the untreated controls. In addition to the increase in the peripheral Treg population, treated SOCS1 / mice experienced a reduced percentage of effector T cells. These results further propose that inflammation was reduced in SOCS1 / mice receiving the combined treatment. The inability of SOCS1 Tregs to per sist in the inflammatory environment of the SOCS1 / mouse suggests that SOCS1 plays a role in the maintenance of Tregs during inflammation. To confirm the role of SOCS1 in the maintenance of a Treg population during inflammation we examined two other SOC S1 deficient mouse models. The first mouse model examined was the SOCS1 / IFN / mouse. This mouse does not suffer from early onset autoimmunity (Alexander et al., 1999) Our data supports the notion that in absence of IFN and excessive autoimmunity Tregs are present in the peripheral

PAGE 75

75 lymphoid organs. We also examined the presence of Tregs in SOCS1 KO and WT bone marro w chimeras. Previous studies have shown that SOCS1 KO bone marrow chimeras do not experience the early onset autoimmunity seen in the global SOCS1 / mouse (Metcalf et al., 2003) As suspected in the absence of excessive inflam mation Foxp3+ Tregs are present in the peripheral lymphoid organs of SOCS1 KO bone marrow chimeras. Moreover, t he absence of autoimmunity was confirmed in the bone marrow chimeric mice by examining infiltration into vital organs by histology. Histology shows no infiltration in the heart and liver of mice receiving SOCS1 KO or WT bone marrow cells Lastly, due to the essential role that SOCS1 plays in the modulation of cytokine signaling and T cell differentiation we examined the effects of Th1 inflamma tion on SOCS1 / Tregs (Ta naka et al., 2008; Palmer and Restifo, 2009) Our results confirmed that SOCS1 deficiency results in the instability of lineage specific transcription factors, Foxp3 and Tbet, in Tregs upon stimulation with IFN These results are novel in that it suggests a role for SOCS1 in the preservation of the Treg phenotype. The suppressive anti inflammatory phenotype of Tregs is important in safeguarding immune homeostasis. During times of inflammation, Tregs must rema in stable in order to regulate an immune response when clearance is necessary. The inability of Tregs to modulate this immune clearance can lead to excessive inflammation resulting in autoimmunity. The i nstability of the Treg phenotype during inflammatio n may also result in Tregs transitioning into auto reactive effector T cells, enhancing the immune response at the site of inflammation.

PAGE 76

76 The results of this project collectively reveal a role for S OCS1 in the maintenance of Treg homeostasis especially d uring time s of heightened inflammation The importance of Tregs and SOCS1 in conserving immune homeostasis has been proven time and again H owever the discovery of their joint i mportance is recent. This data supports the hypothesis that in the absence o f SOCS1 Tregs are less fit to survive during inflammation. Moreover, SOCS1 deficient Tregs are likely less fit because of the inability of the cell to inhibit the influences of pro inflammatory cytokines. The i nfluences of these cytokines can lead to th e instability of lineage specific transcription factors, perhaps resulting in phenotype plasticity of SOCS1 deficient Tregs These studies give insight into the relationship of the SOCS1 and Treg immune regulatory pathways. Although additional studies ex amining this interrelationship would be required, the m odification of immune responsiveness by either manipulation of Tregs or SOCS1 could prove to be an innovative way to develop therapeutics for autoimmunity in the future.

PAGE 77

77 CHAPTER 6 MATERIALS AND METHODS Mice SOCS1 +/ mice on a C57BL/6 genetic background were purchased from the St. Jude Animal facility (Memphis, TN)and mated in the University of Florida Cancer and Genetics Animal Facility, generating SOCS1 / SOCS1+/ and SOCS1+/+(WT) mice. SOCS 1+/ / mice used for generation of SOCS1 / / / mice were purchased from Jackson labs (Bar Harbor, ME). C57BL/6 mice used in adoptive transfers and bone marrow chimeras were purchased from Jackson Labs (Bar Harbor, ME). Mice we re maintained in sterile micro isolators under specific pathogen free conditions at the University of Florida Cancer and Genetics Animal Facility. Mice undergoing various treatments were weighed daily and general health assessed. Mice becoming morbid or exhibiting a 20% weight loss were euthanized. Procedures described in manuscript were approved by the University of Florida Institutional Animal Care and Use Committee (IACUC) and experiments were performed in strict accordance to the approved protocols. G enotyping Quantitative PCR was used to determine the presence of the SOCS1 gene in mice. Tail clips (1mm) isolated from 1 week old SOCS1+/+, SOCS1+/ or SOCS1 / mice were degraded using the DNAeasy Blood and Tissue Kit (Qiagen, Valencia, CA). ABsolute QPCR SYBR Green Mix (ABgene Epsom, Surrey, UK) and primers specific for SOCS1 (F GACACTCACTTCCGCACCTT GAAGCAGTTCCGTTGGCGACT Actin (F CCACAGCACTGTAGGGTTTA Actin R ATTGTCTTTCTTCTGCCGTTCTC

PAGE 78

78 (200nM) were used to amplify relative amounts of DNA on a PTC 200 Peltier Thermal Cycler with a CHROMO 4 Continuous Flourescence Detector (BIORAD, Hercules, CA, USA). The amplification was performed by one 15 minute cycle at 95C which was required for enzyme activation; followed by forty seven cycles of denaturation (95C, 15s), annealing (57C; 30s), and extension (72C, 30s). Phenotype of mice was determined by relative expression of SOCS1. Melting curve analysis was performed to confirm amplicon s pecificity. The fold change in expression was BIORAD software. Magnetic Cell Separation CD4+ and CD4+CD25+ T lymphocytes were enriched using either a CD4+ or CD4+CD25+ T cell i solation kit (MiltenylBiotec, BergischGladbach, Germany) of pooled lymph node (axillary, inguinal, brachial, mesenteric, and superficial cervical) and spleen was obt ained from mice followed by magnetic activated cell sorting (MACS) column enrichment performed under aseptic conditions. The enriched CD4+ T cell population was obtained via MACS column negative selection using CD4 T cell isolation kit (MiltenyiBiotec). I n the case of CD4+CD25+ T cell enrichment, an enriched CD4+ lymphocyte population was first obtained through MACS column negative selection, followed by MACS column positive selection of CD4+CD25+ cells according to manufactures instructions. The purities for the enriched CD4+ and CD4+CD25+

PAGE 79

79 Flow Cytometry Single cell suspensions of pooled lymph nodes (LN) (axillary, inguinal, brachial, mesenteric, and superficial cervical), spleen, and thymus cells were stained with th e following mAbs for flow cytometric analysis: anti CD4 Pacific Blue (RM4 5; BD PharMingen, San Diego, CA), anti CD8a Alexa Flour 700 (53 6.7; BD PharMingen), anti CD25 APC (PC61; BD PharMingen), and anti CD45R(B220) FITC (RA3 6B2; eBioscience, San Diego CA) Ab. Foxp3 intracellular staining was performed as previously described (Larkin et al., 2008) Briefly, cells were fixed and permeabilized using the reagents provided with the anti Foxp3 PE (FJK 16s; eBioscience) or anti Foxp3 FITC (FJK 16s; eBioscience ) Ab. 50,000 100,000 live events were collected on a LSRII (BD PharMingen) and analyzed using FlowJo software (Tree Star, San Carlos, CA). The absolute numbers of cells recovered from various organs was determined by multiplying the total number of cells isolated from various tissues by the percentage of total cells bearing a lineage specific marker denoted by flow cytometry. Peptide Synthesis Peptides SOCS1 KIR ( 53 DTHFRTFRSHSDYRRI) and SOCS1 KIR2A ( 53 DTH A RT A RSHSDYRRI) were synthesized using conventional fluorenylmethylcarbonyl chemistry as previously described (Szente et al., 1994) using an Applied Biosystems 431A automated peptide synthesizer (Applied Biosystems, Carlsbad, CA). Using a semi automated protocol (Thiam et al., 1999) a lipophilic group (palmitoyl lysine) for cell penetration was added to the N terminus as a final step. Peptides were characterized using mass spectrometry and purified by high performance liquid chromatography (HPLC). Peptides were dissolved in DMSO or PBS (Sigma Aldrich, St. Louis MO) prior to use.

PAGE 80

80 In vivo Mouse Treatments Intraperitoneal injections of SOCS1 / or WT (SOCS1+/+) littermate mice with SOCS1 lymphocytes (5 x 10 5 ) began 24 hours after birth. IP injections of S OCS1 KIR were performed daily, while lymphocyte adoptive transfers were performed twice weekly. In some experiments SOCS1 RNA Isolation and RT qPCR Total RNA was extracted from the lymph nodes of S OCS1 / m ice, WT age matched littermates or magnetically separated CD4+CD25 and CD4+CD25+ T lymphocytes using the SV Total RNA Isolation System (Promega, Corp., Madison, WI, USA). The concentrations and purity of the total RNA were determined using a S martSpecPlus Spectrophotometer (BioRad, Hercules, CA, USA). Quality and integrity of the total RNA was assessed by a 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA) and a RNA integrity number of 7 or greater was routinely obtained. Firs t strand cDNA synthesis was performed using ImProm II Reverse Transcription System (Promega, Corp., Madison, WI, USA). iQ SYBR Green Supermix(Bio Rad, Hercules, CA, USA) and gene specific primers (Table 6 1) at 200nM were used to amplify relative amounts of cDNA on a PTC 200 Peltier Thermal Cycler with a CHROMO 4 Continuous Flourescence Detector (BIORAD, Hercules, CA, USA). The amplification was performed by one 5 minute cycle at 95 C which was required for enzyme activation; followed by fifty one cycles of denaturation (95C, 15s), annealing (55C of 57C; 30s), and extension (72C, 30s). Melting curve analysis was performed to confirm amplicon specificity. The fold change in expression was calculated using the 2

PAGE 81

81 Cytokine Secretion A nalysis Lymph nodes were isolated from SOCS1 / mice and WT littermates, followed by the generation of single cell suspensions. 2x10 5 cells were plated with or without 3 g/ml anti CD3 and 1 g/mLanti CD2 8 (BD Biosciences, San Diego, CA). After 72 hours supernatants were collected from wells. Cytokine ELISAs were subsequently performed, as previously described (Lau et al., 2011) on harvested supernatants. IL 2 (555148) ELISA kits, c apture (555068) and detection (555067) mAb for IL 17A, and cytokine standard for IFN were obtained from BD Biosciences. IL17 c ytokine standard (14 8171 80),and IFN 7313 85) and detection (13 7311 85) mAbs were purchased from eBioscience Histology Histology and immuno histochemistry was performed under the advisement of the University of F lorida histology core lab. Heart and liver were isolated from treated and untreated two week old SOCS1+/+ and SOCS1 / mice or SOCS1 KO and SOCS1 WT bonemarrow chimeras 6 weeks post transfer and stored for 24 hours in PBS containing 2% paraformaldehyde. O rgans were subsequently transferred into 70% ethanol for long term storage. Organs were paraffin embedded, sectioned at a thickness of 3 m, 2500 Microscope equipped with an Optronics color camera and MagnaFire software (Optronics, Goleta, CA). Bone Marrow Chimeras Bone marrow was removed from the femur and tibia bones of SOCS1 WT and SOCS1 KO mice at 2 weeks of age and washed. Progenitor cells were purified using

PAGE 82

82 BD IMag mou se hematopoietic progenitoc (stem) cell purification kit (BD Biosciences, San Diego, CA). 24 hours post lethal irradiation (850 RAD) C57BL/6 mice were reconstituted with 5x105 enriched hematopoietic stem cells from SOCS1 WT and SOCS1 KO donor mice. Mice were maintained in sterile micro isolators under specific pathogen free conditions at the University of Florida Cancer and Genetics Animal Facility. Mice undergoing irradiation were given .2 mg/ml Neomycin Sulfate in drinking water, weighed daily, and gen eral health assessed. Mice becoming morbid or exhibiting a 20% weight loss were euthanized. Chimeric mice were sacrificed 8 weeks post transfer for analysis. Transcription Factor Analysis Lymph nodes and spleen were isolated from SOCS1 / / and SOCS / mice, followed by the generation of single cell suspensions. CD4+CD25+ T lymphocytes were isolated using the CD4+CD25+ T cell isolation kit (MiltenylBiotec ) as previously described. 1 x10 5 CD4 +CD25+ Tregs were plated with 3 g/ml anti CD3 and 1 g /mLanti CD28 (BD Biosciences, San Diego, CA) with or After 72 hours cells were collected from wells and RNA isolation and RT were performed as described abov e Statistical Analysis Graph Pad Prism v.5 was used to calculate the statistically significance differences between different groups using unpaired two Kaplan Meier survival curve type experiments, Mantel Cox or two way AN OVA analyses significant and is indicated within figures

PAGE 83

83 T able 6 1. Primers used and/or discussed in this study. Primer Sequence Temperature ( C) Actin F: 5' CCT TCC TTC TTG GGT ATG CA 3 R: 5' GGA GGA GCA ATG ATC TTG AT 3' 55 55 Foxp3 F: 5' TCTGTGGCCTCAATGGACAA 3 R: 5' GAAGAACTCTGGGAAGGAACTA 3 55 55 IFN F: 5' AACTATTTTAACTCAAGTGGCAT 3 R: 5' AGGTGTGATTCAATGACG 3 55 55 IL2 F: 5' TGCCCAAGCAGGCCACAGAA 3 R: 5' GTGTTGTCAGAGCCCTTTAG 3 55 55 IL17A ROR F: 5' ACTCTCCACCGCAATGA 3 R: 5' CTCTTCAGGACCAGGAT 3 ACAGCCACTGCATTCCCAGTT T 3 R: 5' TCTCGGAAGGACTTGCAGACA T 3' 55 55 63 63 SOCS1 Tbet F: 5' GACACTCACTTCCGCACCTT 3 R: 5' GAAGCAGTTCCGTTGGCGACT 3 F: GGGAGAACTTTGAGTCCA GAAGGTCGGGGTAGAAA 57 57 55 55

PAGE 84

84 LIST OF REFERENCES Alexander, W.S., Starr, R., Fenner, J.E., Scott, C.L., Handman, E., Sprigg, N.S., Corbin, J.E., Cornish, A.L., Darwiche R., Owczarek, C.M., et al. (1999). SOCS1 is a critical inhibitor of interferon gamma signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98 597 608. Allan, S.E., Broady, R., Gregori, S., Himmel, M.E., Locke, N., Roncarolo, M.G., Bacchetta, R., and Levings, M.K. (2008). CD4+ T regulatory cells: toward therapy for human diseases. Immunol Rev 223 391 421. Asano, M., Toda, M., and Sakaguchi, N. (1996).Autoimmune disease as a consequence of developmental abnormality o f a T cell subpopulation. J. Exp. Med. 184, 387 396. Aspinall, R., Pitts, D., Lapenna, A., and Mitchell, W. (2010). Immunity in the elderly: the role of the thymus. J. Comp. Pathol. 142 Suppl 1 S111 5. Belkaid, Y. (2008). Role of Foxp3 positive regulatory T cells during infection. Eur. J. Immunol. 38 918 921. Belkaid, Y., Piccirillo, C.A., Mendez, S., Shevach, E.M., and Sacks, D.L. (2002). CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 420 502 507. Bettini, M.L., an d Vignali, D.A.A. (2010).Development of thymically derived natural regulatory T cells. Ann. N. Y. Acad. Sci. 1183 1 12. Betts, R.J., Prabhu, N., Ho, A.W.S., Lew, F.C., Hutchinson, P.E., Rotzschke, O., Macary, P.A., and Kemeny, D.M. (2012). Influenza A vir us infection results in a robust, antigen responsive, and widely disseminated Foxp3+ regulatory T cell response. Journal of Virology 86 2817 2825. Blair, P.J., Bultman, S.J., Haas, J.C., Rouse, B.T., Wilkinson, J.E., and Godfrey, V.L. (1994). CD4+CD8 T c ells are the effector cells in disease pathogenesis in the scurfy (sf) mouse. The Journal of Immunology 153 3764 3774. Brunkow, M.E., Jeffery, E.W., Hjerrild, K.A., Paeper, B., Clark, L.B., Yasayko, S.A., Wilkinson, J.E., Galas, D., Ziegler, S.F., and Ram sdell, F. (2001). Disruption of a new forkhead/winged helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat. Genet. 27 68 73. Brusko, T.M., Putnam, A.L., and Bluestone, J.A. (2008). Human regulatory T cells: ro le in autoimmune disease and therapeutic opportunities. Immunol Rev 223 371 390. Buckner, J.H. (2010). Mechanisms of impaired regulation by CD4+CD25+FOXP3+ regulatory T cells in human autoimmune diseases. Nat Rev Immunol 10 849 859.

PAGE 85

85 Cabarrocas, J., Cassan C., Magnusson, F., Piaggio, E., Mars, L., Derbinski, J., Kyewski, B., Gross, D. A., Salomon, B.L., Khazaie, K., et al. (2006). Foxp3+ CD25+ regulatory T cells specific for a neo self antigen develop at the double positive thymic stage. Proceedings of the National Academy of Sciences 103 8453 8458. Caton, A.J., Cozzo, C., Larkin, J., Lerman, M.A., Boeste anu, A., and Jordan, M.S. (2004).CD4+CD25+ regulatory T cell selection. Ann. N. Y. Acad. Sci. 1029 101 114. Chatila, T.A., Blaeser, F., Ho, N., Lederman, H.M., Voulgaropoulos, C., Helms, C., and Bowcock, A.M. (2000). JM2, encoding a fork head related protein, is mutated in X linked autoimmunity allergic disregulation syndrome. J. Clin. Invest. 106 R75 81. Collison, L.W., Chaturvedi, V., Henderson, A.L., G iacomin, P.R., Guy, C., Bankoti, J., Finkelstein, D., Forbes, K., Workman, C.J., Brown, S.A., et al. (2010). IL 35 mediated induction of a potent regulatory T cell population. Nature Immunology 11 1093 1101. Collison, L.W., Pillai, M.R., Chaturvedi, V., a nd Vignali, D.A.A. (2009). Regulatory T Cell Suppression Is Potentiated by Target T Cells in a Cell Contact, IL 35 and IL 10 Dependent Manner. J. Immunol. 182 6121 6128. Collison, L.W., Workman, C.J., Kuo, T.T., Boyd, K., Wang, Y., Vignali, K.M., Cross, R., Sehy, D., Blumberg, R.S., and Vignali, D.A.A. (2007). The inhibitory cytokine IL 35 contributes to regulatory T cell function. Nature 450 566 569. Cozzo, C., Larkin, J., and Caton, A.J. (2003). Cutting edge: self peptides drive the peripheral expansio n of CD4+ CD25+ regulatory T cells. The Journal of Immunology 171 5678. Croker, B., and Kiu, H. (2008).SOCS regulation of the JAK/STAT signalling pathway. S EMCDB 19, 414 422. Fahln, L., Read, S., Gorelik, L., Hurst, S.D., Coffman, R.L., Flavell, R.A., and Powrie, F. (2005). T cells that cannot respond to TGF beta escape control by CD4+CD25+ regulatory T cells. J Exp Med 201 737 746. Fontenot, J.D., Gavin, M.A., and Rudensky, A.Y. (2003). Foxp3 programs the development and function of CD4+ CD25+ regulatory T cells. Nature Immunology 4 330 336. Gavin, M.A., Rasmussen, J.P., Fontenot, J.D., Vasta, V., Manganiello, V.C., Beavo, J.A., and Rudensky, A.Y. (2007). Foxp3 dependent programme of regulatory T cell differentiation. Nature 445 771 775. Gravano, D.M., and Vignali, D.A.A. (2011). The battle against immunopathology: infectious tolerance mediated by regulatory T cells. Cell.Mol. Life Sci.

PAGE 86

86 Hori, S. (2011). Regulatory T cell plasticity: beyond the controversies. Trends Immunol. 32 295 300. Hori, S., Nomura, T., and Sakaguchi, S. (2003).Control of regulatory T cell development by the transcription factor Foxp3. Science 299 1057 1061. Jager, L.D., Dabelic, R., Waiboci, L.W., Lau, K., Haider, M.S., Ahmed, C.M.I., Larkin Iii, J., David, S., and Johnson, H.M. (20 11). The kinase inhibitory region of SOCS 1 is sufficient to inhibit T helper 17 and other immune functions in experimental allergic encephalomyelitis. Journal of Neuroimmunology 232 108 118. Joetham, A., Takeda, K., Takada, K., Taube, C., Miyahara, N., Ma tsubara, S., Matsubara, S., Koya, T., Rha, Y. H., Dakhama, A., et al. (2007 ). Naturally occurring lung CD4+CD25+ T cell regulation of airway allergic responses depends on IL 10 induction of TGF beta. The Journal of Immunology 178 1433 1442. Josefowicz, S. Z., and Rudensky, A. (2009). Control of Regulatory T Cell Lineage Commitment and Maintenance. Immunity 30 616 625. Khattri, R., Cox, T., Yasayko, S. A., and Ramsdell, F. (2003). An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nature Immunol ogy 4 337 342. Khoruts, A., and Fraser, J.M. (2005).A causal link between lymphopenia and autoimmunity. Immunology Letters 98 23 31. Kim, J.M., Rasmussen, J.P., and Rudensky, A.Y. (2007). Regulatory T cells prevent catastrophic autoimmunity throughout th e lifespan of mice. Nature Immunology 8 191 197. Kobayashi, S., Yoshida, K., Ward, J.M., Letterio, J.J., Longenecker, G., Yaswen, L., Mittleman, B., Mozes, E., Roberts, A.B., Karlsson, S., et al. (1999). Beta 2 microglobulin deficient background ameliorat es lethal phenotype of the TGF beta 1 null mouse. The Journal of Immunology 163 4013 4019. Krebs, D.L., and Hilton, D.J. (2001). SOCS proteins: negative regulators of cytokine signaling. Stem Cells 19 378 387. Kubo, M., Hanada, T., and Yoshimura, A. (200 3).Suppressors of cytokine signaling and immunity. Nature Immunology 4 1169 1176. Khn, R., Lhler, J., Rennick, D., Rajewsky, K., and Mller, W. (1993). Interleukin 10 deficient mice develop chronic enterocolitis. Cell 75 263 274. Lahl, K., Loddenkemper C., Drouin, C., Freyer, J., Arnason, J., Eberl, G., Hamann, A., Wagner, H., Huehn, J., and Sparwasser, T. (2007). Selective depletion of Foxp3+ regulatory T cells induces a scurfy like disease. J Exp Med 204 57 63.

PAGE 87

87 Larkin, J., Rankin, A.L., Picca, C.C., Riley, M.P., Jenks, S.A., Sant, A.J., and Caton, A.J. (2008).CD4+CD25+ regulatory T cell repertoire formation shaped by differential presentation of peptides from a self antigen. J. Immunol. 180 2149 2157. Lau, K., Benitez, P., Ardissone, A., Wilson, T.D ., Collins, E.L., Lorca, G., Li, N., Sankar, D., Wasserfall, C., Neu, J., et al. (2011). Inhibition of type 1 diabetes correlated to a Lactobacillus johnsonii N6.2 mediated Th17 bias. J. Immunol. 186 3538 3546. Letterio, J.J., Geiser, A.G., Kulkarni, A.B. Dang, H., Kong, L., Nakabayashi, T., Mackall, C.L., Gress, R.E., and Roberts, A.B. (1996). Autoimmunity associated with TGF beta1 deficiency in mice is dependent on MHC class II antigen expression. J. Clin. Invest. 98 2109 2119. Li, M.O., Wan, Y.Y., and Flavell, R.A. (2007). T Cell Produced Transforming Growth Factor and Th17 Cell Differentiation. Immunity 26 579 591. Malek, T.R., Yu, A., Zhu, L., Matsutani, T., Adeegbe, D., and Bay er, A.L. (2008).IL 2 family of cytokines in T regulatory cell development and homeostasis. J. Clin. Immunol. 28 635 639. Mandapathil, M., and Whiteside, T.L. (2011). Targeting human inducible regulatory T cells (Tr1) in patients with cancer: blocking of ad enosine prostaglandin E 2cooperation. Expert Opin. Biol. Ther. 11 1203 1214. Marie, J.C., Liggitt, D., and Rudensky, A.Y. (2006).Cellular mechanisms of fatal early onset autoimmunity in mice with the T cell specific targeting of transforming growth factor beta receptor. Immunity 25 441 454. Marine, J.C., Topham, D.J., McKay, C., Wang, D., Parganas, E., Stravopodis, D., Yoshimura, A., and Ihle, J.N. (1999). SOCS1 deficiency causes a lymphocyte dependent perinatal lethality. Cell 98 609 616. McGinness J.L., Bivens, M. M.C., Greer, K.E., Patterson, J.W., and Saulsbury, F.T. (2006). Immune dysregulation, polyendocrinopathy, enteropathy, X linked syndrome (IPEX) associated with pemphigoidnodularis: a case report and review of the literature. J. Am. Acad. Dermatol. 55 143 148. Metcalf, D., Mifsud, S., Di Rago, L., and Alexander, W.S. (2003).The lethal effects of transplantation of Socs1 / bone marrow cells into irradiated adult syngeneic recipients.Proceedings of the National Academy of Sciences 100 8436 Miller, J.F.A.P. (2002). The discovery of thymus function and of thymus derived lymphocytes.Immunol Rev 185 7 14. Min, B., McHugh, R., Sempowski, G.D., Mackall, C., Foucras, G., and Paul, W.E. (2003). Neonates support lymphopenia induced proliferation. Immunity 18 131 140.

PAGE 88

88 Miyara, M., and Sakaguchi, S. (2007). Natural regulatory T cells: mechanisms of suppression. Trends in Molecular Medicine 13 108 116. Moore, K.W., de Waal Malefyt, R., Coffman, R.L., and O'Garra, A. (2001). Interleukin 10 and the int erleukin 10 receptor. Annu. Rev. Immunol. 19 683 765. Mosser, D.M., and Zhang, X. (2008). Interleukin 10: new perspectives on an old cytokine. Immunol Rev 226 205 218. Murphy, K.M., and Stockinger, B. (2010). Effector T cell plasticity: flexibility in the face of changing circumstances. Nature Immunology 11 674 680. Palmer, D.C., and Restifo, N.P. (2009). Suppressors of cytokine signaling (SOCS) in T cell differentiation, maturation, and function. Trends Immunol. 30 592 602. Papiernik, M., de Moraes, M.L. Pontoux, C., Vasseur, F., and Pnit, C. (1998). Regulatory CD4 T cells: expression of IL 2R alpha chain, resistance to clonal deletion and IL 2 dependency. Int. Immunol. 10 371 378. Pillai, M.R., Collison, L.W., Wang, X., Finkelstein, D., Rehg, J.E., Bo yd, K., Szymczak Workman, A.L., Doggett, T., Griffith, T.S., Ferguson, T.A., et al. (2011).The plasticity of regulatory T cell function. J. Immunol. 187 4987 4997. Rubtsov, Y.P., Niec, R.E., Josefowicz, S., Li, L., Darce, J., Mathis, D., Benoist, C., and Rudensky, A.Y. (2010). Stability of the Regulatory T Cell Lineage in Vivo. Science 329 1667 1671. Rudensky, A.Y. (2011). Regulatory T cells and Foxp3.Immunol Rev 241 260 268. Sharabi, A., Sthoeger, Z.M., Mahlab, K., Lapter, S., Zinger, H., and Mozes, E. (2009). A tolerogenic peptide that induces suppressor of cytokine signaling (SOCS) 1 restores the aberrant control of IFN gamma signaling in lupus affected (NZB x NZW)F1 mice. Clin.Immunol. 133 61 68. Sharma, M.D., Hou, D. Y., Baban, B., Koni, P.A., He, Y. Chandler, P.R., Blazar, B.R., Mellor, A.L., and Munn, D.H. (2010). Reprogrammed Foxp3+ regulatory T cells provide essential help to sup port cross presentation and CD8+ T cell priming in naive mice. Immunity 33 942 954. Sojka, D.K., Hughson, A., and Fowe ll, D.J. (2009). CTLA 4 is required by CD4+CD25+ Treg to control CD4+ T cell lymphopenia induced proliferation. Eur. J. Immunol. 39 1544 1551. Sprent, J., and Kishimoto, H. (2002).The thymus and negative selection.Immunol Rev 185 126 135.

PAGE 89

89 Stark, J.L., an d Cross, A.H. (2006).Differential expression of suppressors of cytokine signaling 1 and 3 and related cytokines in central nervous system during remitting versus non remitting forms of experimental autoimmune encephalomyelitis. Int. Immunol. 18 347 353. Strauss, L., Bergmann, C., Szczepanski, M., Gooding, W., Johnson, J.T., and Whiteside, T.L. (2007). A unique subset of CD4+CD25highFoxp3+ T cells secreting interleukin 10 and transforming growth factor beta1 mediates suppression in the tumor microenvironme nt. Clin.Cancer Res. 13 4345 4354. Suffia, I.J. (2006). Infected site restricted Foxp3+ natural regulatory T cells are specific for microbial antigens. Journal of Experimental Medicine 203 777 788. Suri Payer, E., Amar, A.Z., Thornton, A.M., and Shevach, E.M. (1998). CD4+CD25+ T cells inhibit both the induction and effector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. The Journal of Immunology 160 1212 1218. Suvas, S., Azkur, A.K., Kim, B.S., Kumaraguru, U., and Rouse, B.T. (2004). CD4+CD25+ regulatory T cells control the severity of viral immunoinflammatory lesions. The Journal of Immunology 172 4123 4132. Szente, B.E., Soos, J.M., and Johnson, H.W. (1994). The C terminus of IFN gamma is sufficient for intra cellular function. Biochem.Biophys. Res. Commun. 203 1645 1654. Takahashi, R., Nishimoto, S., Muto, G., Sekiya, T., Tamiya, T., Kimura, A., Morita, R., Asakawa, M., Chinen, T., and Yoshimura, A. (2011). SOCS1 is essential for regulatory T cell functions b y preventing loss of Foxp3 expression as well as IFN and IL 17A pro duction. J. Exp. Med. 208 2055 2067. Tanaka, K., Ichiyama, K., Hashimoto, M., Yoshida, H., Takimoto, T., Takaesu, G., Torisu, T., Hanada T., Yasukawa, H., Fukuyama, S., et al. (2008). Loss of suppressor of cytokine signaling 1 in helper T cells leads to defective Th17 differentiation by enhancing antagonistic effects of IFN gamma on STAT3 and Smads. J. Immunol. 180 3746 3756. Tang, Q., a nd Bluestone, J.A. (2008). The Foxp3+ regulatory T cell: a jack of all trades, master of regulation. Nature Immunology 9 239 244. Thiam, K., Loing, E., Verwaerde, C., Auriault, C., and Gras Masse, H. (1999). IFN gamma derived lipopeptides: influence of li pid modification on the conformation and the ability to induce MHC class II expression on murine and human cells. J. Med. Chem. 42 3732 3736. Tonkin, D.R., and Haskins, K. (2009). Regulatory T cells enter the pancreas during suppression of type 1 diabetes and inhibit effector T cells and macrophages in a TGF dependent manner. Eur. J. Immunol. 39 1313 1322.

PAGE 90

90 Torgerson, T.R., and Ochs, H.D. (2007). Immune dysregulation, polyendocrinopathy, enteropathy, X linked: forkhead box protein 3 mutations and lack of regulatory T cells. Journal of Allergy and Clinical Immunology 120 744 750. Tsao, J. T., Kuo, C. C., and Lin, S. C. (2008). The analysis of CIS, SOCS1, SOSC2 and SOCS3 transcript levels in peripheral blood mononuclear cells of systemic lupus erythematosu s and rheumatoid arthritis patients. Clin. Exp. Med. 8 179 185. Vignali, D.A.A., Collison, L.W., and Workman, C.J. (2008). How regulatory T cells work. Nat Rev Immunol 8 523 532. Waiboci, L.W., Ahmed, C.M., Mujtaba, M.G., Flowers, L.O., Martin, J.P., Haid er, M.I., and Johnson, H.M. (2007). Both the suppressor of cytokine signaling 1 (SOCS 1) kinase inhibitory region and SOCS 1 mimetic bind to JAK2 autophosphorylation site: implications for the development of a SOCS 1 antagonist. The Journal of Immunology 1 78 5058 5068. Walker, L.S.K., and Sansom, D.M. (2011).The emerging role of CTLA4 as a cell extrinsic regulator of T cell responses. Nat Rev Immunol 11 852 863. Wan, Y.Y., and Flavell, R.A. (2007). Regulatory T cell functions are subverted and converted ow ing to attenuated Foxp3 expression. Nature 445 766 770. Wildin, R.S., Ramsdell, F., Peake, J., Faravelli, F., Casanova, J.L., Buist, N., Levy Lahad, E., Mazzella, M., Goulet, O., Perroni, L., et al. (2001). X linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat. Genet. 27 18 20. Wing, K., and Sakaguchi, S. (2010). Regulatory T cells exert checks and balances on self tolerance and autoimmunity. Nature Immunology 11 7 13. Xu, D., Liu, H., K omai Koma, M., Campbell, C., McSharry, C., Alexander, J., and Liew, F.Y. (2003). CD4+CD25+ regulatory T cells suppress differentiation and functions of Th1 and Th2 cells, Leishmania major infection, and colitis in mice. J. Immunol. 170 394 399. Yang, X.O. Nurieva, R., Martinez, G.J., Kang, H.S., Chung, Y., Pappu, B.P., Shah, B., Chang, S.H., Schluns, K.S., Watowich, S.S., et al. (2008). Molecular antagonism and plasticity of regulatory and inflammatory T cell programs. Immunity 29 44 56. Yoshimura, A., N aka, T., and Kubo, M. (2007).SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol 7 454 465. Zhan, Y., Davey, G.M., Graham, K.L., Kiu, H., Dudek, N.L., Kay, T.W.H., and Lew, A.M. (2009). SOCS1 negatively regulates the production of Fox p3+ CD4+ T cells in the thymus. Immunology and Cell Biology 87 473 480.

PAGE 91

91 Zhang, J.G., Metcalf, D., Rakar, S., Asimakis, M., Greenhalgh, C.J., Willson, T.A., Starr, R., Nicholson, S.E., Carter, W., and Alexander, W.S. (2001). The SOCS box of suppressor of c ytokine signaling 1 is important for inhibition of cytokine action in vivo. Proceedings of the National Academy of Sciences 98 13261. Zheng, Y., and Rudensky, A.Y. (2007).Foxp3 in control of the regulatory T cell lineage. Nature Immunology 8 457 462. Zho u, L., Chong, M.M.W., and Littman, D.R. (2009 ). Plasticity of CD4+ T Cell Lineage Differentiation. Immunity 30 646 655. Zhou, L., Lopes, J.E., Chong, M.M.W., Ivanov, I.I., Min, R., Victora, G.D., Shen, Y., Du, J., Rubtsov, Y.P., Rudensky, A.Y., et al. (2008). TG F beta induced Foxp3 inhibits TH 17 cell differentiation by antagonizing RORgammat function. Nature 453 236 240. Zhou, X., Bailey Bucktrout, S.L., Jeker, L.T., Penaranda, C., Martnez Llordella, M., Ashby, M., Nakayama, M., Rosenthal W., and Blu estone, J.A. (2009 ). Instability of the transcription factor Foxp3 leads to the generation of pathogenic memory T cells in vivo. Nature Immunology 10 1000 1007.

PAGE 92

92 BIOGRAPHICAL SKETCH Erin Louise Collins was born in Port Huron, Michigan in 1985. In 2003 Erin graduated from Port Huron High School. Following high school, she attended Bowling Green State University for her undergraduate studies, completing a Bachelor of Science degree in microbiology in the spring of 2007. I nspired by research topics revolving around benchside to bedside translational studies, she received her Ph.D. from the University of Florida in t he spring of 2012, focusing on s uppressors of cytokine signaling 1 and regulatory T cells. She plans to pursu e a career in biomedical research.