Anthrax Lethal and Edema Toxins Effects on Human Peripheral Cells


Material Information

Anthrax Lethal and Edema Toxins Effects on Human Peripheral Cells
Physical Description:
1 online resource (116 p.)
Chauncey, Kassidy M
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Immunology and Microbiology (IDP)
Committee Chair:
Southwick, Frederick S
Committee Members:
Baker, Henry V
Satoh, Minoru
Holliday, Lexie S
Moldawer, Lyle L


Subjects / Keywords:
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation


Bacillus anthracis is a gram-positive bacterium known to produce two toxins: edema toxin (ET) and lethal toxin (LT). ET is an adenylyl cyclase known to induce intracellular cAMP levels, while LT cleaves and inactivates members of the mitogen-activated protein kinase kinase family (MAPKK).We have shown the combination of anthrax ET and LT leads to a decrease in cAMP production, dependent on the levels of LT. Higher levels of LT (250ng/mL) lead to more inhibition of cAMP production. This inhibitory effect is shown across multiple cell lines. We also show an additional stimulant of cAMP, forskolin, is inhibited by anthrax LT, while also showing a dose dependent inhibitory response. The inhibition of cAMP production by LT requires proteolytic cleavage of MEKs, as inhibition of the protease activity of LT fails to inhibit cAMP production by ET. This inhibitory effect cannot be explained by secretion of either cAMP or the substrate ATP, as extracellular levels of cAMP or ATP are not increased after dual toxin treatment. This phenomenon also cannot be attributed to cell death, as cells are viable under all treatment conditions. Chemical inhibitors were employed to determine which specific MAPKK pathways were involved in the regulation of cAMP production. It was found that all 3 pathways must remain intact in order for production of cAMP. We find that inhibition of cAMP production by LT requires intact cells, as the production of cAMP is not inhibited in cell extracts treated with dual toxins, indicating a post-translational signaling mechanism downstream of the MAPKK pathways. We conclude that production of cAMP by adenylyl cyclases requires active mitogen-activated protein protein kinase pathways blocking of any of these pathways will lead to inhibition of cAMP production. We have also measured the transcriptional response of human peripheral monocytes after treatment with anthrax LT and have found multiple changes in the signaling pathways, outside of the well-known MAPKK pathways. These results will help to further elucidate the role of LT on immune cell inhibition during an anthrax infection. Additionally, treatment of human platelets with either LT or ET has no effect on platelets or their function. These findings can be explained by a failure in toxin binding to the platelet surface due to low levels of the anthrax receptors on human platelets. This is the first findings indicating that a defect in platelet function cannot explain the vascular collapse documented by persons who succumb to anthrax.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Kassidy M Chauncey.
Thesis (Ph.D.)--University of Florida, 2012.
Adviser: Southwick, Frederick S.
Electronic Access:

Record Information

Source Institution:
Rights Management:
Applicable rights reserved.
lcc - LD1780 2012
System ID:

This item is only available as the following downloads:

Full Text




2 2012 Kassidy M Chauncey


3 T o all who have provided their support knowledge, challenges and guidance along my journey


4 ACKNOWLEDGEMENTS First and foremost I would like to thank my mentor for his patience, and encouragement and positive outlook This thesis would not have been possible without his invaluable knowledge and continual support. I would like to thank the members of my supervisory committe e for their guidance and constructive input. Also, I would like to show my gratitude to my lab colleagues both past and present, for their technical support and assistance. I am forever grateful for my friends and family for their support and loving encou ragement throughout my academic career.


5 TABLE OF CONTENTS page ACKNOWLEDGEMENTS ................................ ................................ ................................ ......... 4 LIST OF TABLES ................................ ................................ ................................ ...................... 8 LIST OF FIGURES ................................ ................................ ................................ .................... 9 LIST OF ABBREVIATIONS ................................ ................................ ................................ .... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ ............. 14 Bacillus Anthracis History ................................ ................................ ................................ .. 14 Bacillus anthracis Microbiology ................................ ................................ ........................ 15 Anthrax Exposure ................................ ................................ ................................ .............. 16 Pathogenesis ................................ ................................ ................................ ................ 17 Capsule ................................ ................................ ................................ ....................... 18 Toxins ................................ ................................ ................................ ......................... 18 cAMP Signaling ................................ ................................ ................................ ................. 20 Mitogen Activated Protein Kinase Pathways ................................ ................................ ...... 24 Monocytes ................................ ................................ ................................ ......................... 26 Platelets ................................ ................................ ................................ .............................. 28 Effects of Anthrax Toxins on Peripheral Blood Cells ................................ .......................... 29 2 ANTHRAX LETHAL TOXIN'S INHIBITION OF ANTHRAX EDEMA TOXIN ............. 38 Overview ................................ ................................ ................................ ........................... 38 Materials and Methods ................................ ................................ ................................ ....... 38 Toxin Purification ................................ ................................ ................................ ....... 38 Chemicals Used ................................ ................................ ................................ ........... 39 Primary Cell Isola tion and Treatment with ET ................................ ............................. 39 Cell Culture ................................ ................................ ................................ ................. 39 Intracellular Cyclic AMP Levels ................................ ................................ ................. 40 Western Blot Analysis ................................ ................................ ................................ 40 Extracellu lar ATP and cAMP Measurement ................................ ................................ 40 LT Metalloprotease Inhibitor ................................ ................................ ....................... 41 HeLa Cell Extracts and cAMP Production ................................ ................................ ... 41 2 D gel analysis ................................ ................................ ................................ ........... 41 Results ................................ ................................ ................................ ............................... 42 Anthrax ET is Inhibited by Anthrax LT ................................ ................................ ....... 42 ................................ .... 43 LT Does Not Cause Release of ATP or cA MP ................................ ............................ 44 LT Does Not Inhibit cAMP production by EF in Cell Extracts ................................ .... 46 2 D Gel Analysis of ET and ET plus LT HeLa Cells ................................ ................... 47


6 Discussion ................................ ................................ ................................ .......................... 47 3 TRANSCRIPTIONAL ANALYSIS OF HUMAN MONOCYTES TO ANTHRAX LETHAL TOXIN ................................ ................................ ................................ ............... 63 Overview ................................ ................................ ................................ ........................... 63 Materials and Methods ................................ ................................ ................................ ....... 64 Monocyte Isolation and Toxin Treatment ................................ ................................ .... 64 Toxin Purification ................................ ................................ ................................ ....... 65 Monocyte Purit y and Apoptosis Analysis ................................ ................................ .... 65 MEK Cleavage ................................ ................................ ................................ ............ 66 RNA Isolation ................................ ................................ ................................ ............. 66 Microarray Procedure ................................ ................................ ................................ .. 66 Microarray A nalysis ................................ ................................ ................................ .... 67 Quantitative Real Time PCR (qRT PCR) ................................ ................................ .... 67 Results ................................ ................................ ................................ ............................... 68 Microarray Setup ................................ ................................ ................................ ......... 68 Monocyte Purity and Apoptosis ................................ ................................ ................... 68 Susceptibility to Anthrax LT ................................ ................................ ....................... 68 Unsupervised Analysis ................................ ................................ ................................ 69 Pathway Analysis ................................ ................................ ................................ ........ 69 Genes Associated with Monocyte Function ................................ ................................ 70 Microarray Validation by qRT PCR ................................ ................................ ............ 71 Discussion ................................ ................................ ................................ .......................... 72 4 ANTHRAX LETHAL AND EDEMA TOXINS FAIL TO DIRECTLY IMPAIR HUMAN PLATELET FUNCTION ................................ ................................ .................... 79 Overview ................................ ................................ ................................ ........................... 79 Material and Methods ................................ ................................ ................................ ......... 79 Platelet Isolation and Toxin Treatment ................................ ................................ ........ 79 Cell Culture ................................ ................................ ................................ ................. 80 Chemicals Used ................................ ................................ ................................ ........... 80 Toxins ................................ ................................ ................................ ......................... 80 Western Blot Analysis ................................ ................................ ................................ 81 Intracellular cAMP Measurements ................................ ................................ .............. 81 Measurement of P selectin ................................ ................................ .......................... 82 Toxin Binding and Internalization ................................ ................................ ............... 82 Anthrax Receptor Expression ................................ ................................ ...................... 82 Results ................................ ................................ ................................ ............................... 83 LT Activity in Human Platelets and HeLa cells ................................ ........................... 83 ET Activity in Human and Mouse Platelets ................................ ................................ 83 Toxin Binding and Internalization ................................ ................................ ............... 83 P selectin Expression After Toxin Treatment ................................ .............................. 84 Expression of Anthrax Receptors ................................ ................................ ................ 84 Discussion ................................ ................................ ................................ .......................... 85


7 5 FUTURE WORK ................................ ................................ ................................ ............... 90 Functional Impairment of Monocytes by Anthrax toxins ................................ .................... 90 Mechanism of cAMP Inhibition ................................ ................................ ......................... 91 LIST OF REFERENCES ................................ ................................ ................................ .......... 97 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ... 116


8 LIST OF TABLES Table page 1 1 Description of proteins excised for identification after treatments with ET + LT versus ET alone ................................ ................................ ................................ ............. 53 1 2 Description of proteins differentially expressed in HeLa cells after 4 hour treatment with dua l toxin LT +ET versus ET alone ................................ ................................ ....... 54 3 1 Predicted effects of LT on monocyte function ................................ ................................ 73 3 2 q RT PCR of LT induced genes ................................ ................................ .................... 74


9 LIST OF FIGURES Figure page 1 1 Anthrax toxins ................................ ................................ ................................ ............... 31 1 2 Mitogen Activated Protein Kinase Kinas e (MAPKK or MEK) signaling pathway. Kinases function by phosph orylating downstream components ................................ ...... 32 1 3 Regulation of adenylyl cyclases ................................ ................................ ..................... 33 1 4 Molecula r structure of adenylyl cyclase ................................ ................................ ........ 34 1 5 Isoforms of mammalian adenylyl cyclases ................................ ................................ ..... 35 1 6 Mon ocyte attachment and diapedesis ................................ ................................ ............. 36 1 7 Platelet function ................................ ................................ ................................ ............. 37 2 1 Effect s of anthrax LT and MAPKKs inhibitors on cAMP production after treatment with anthrax ET ................................ ................................ ................................ ............. 56 2 2 Effects of the inhibition of LT meta lloprotease activity on ET induced cAMP produ ction ................................ ................................ ................................ .................... 57 2 3 Effects of L T on the release of ATP or cAMP ................................ ................................ 58 2 4 Effects of anthrax LT and inhibition of MAPKKs on cAM P production by Forskolin (Fsk) ................................ ................................ ................................ .............................. 59 2 5 Adenylate cyclase activity of EF in HeLa cell ext racts ................................ ................... 60 2 6 EF activity in HeLa cell extracts with addition of LT ................................ .................... 61 2 7 Proteomic analysi s of anthrax treated HeLa cells ................................ ........................... 62 3 1 Monocyte purity, apop tosis, and susceptibility to LT ................................ ..................... 75 3 2 Unsupervised microarray analysis ................................ ................................ .................. 76 3 3 Supervised microarray analysis ................................ ................................ ..................... 78 4 1 Effects of L T and ET on human platelets ................................ ................................ ....... 87 4 2 Functional significance of ET and LT treated human platelet s and anthrax receptor detection ................................ ................................ ................................ ........................ 88 4 3 Anthrax receptor expression receptors ................................ ................................ .......... 89


10 5 1 Mechanism of cAMP inhibition ................................ ................................ ..................... 96


11 LIST OF ABBREVIATION S ATP Adenosine triphosphate: A nucleotide which performs many essential functions within the cell. It is also the substrate for cAMP cAMP Cyclic adenosine monophosphate: A second messenger chemical produced by adenylyl cyclase from ATP EF Edema factor : An exotoxin produced by B. anthracis and a known adenylyl cyclase which increases intracellular cAMP ERK Extracellular signal regulated kinases: Members of the MAPK family which are phosphorylated by MAPKK 1 and MAPKK 2 ET Edema toxin: The combination o f EF and PA Fsk Forskolin: A chemical produced in plants which increases intracellular cAMP levels JNK c Jun N terminal kinases: Members of the MAPK family which are phosphorylated by MAPKK 4 and MAPKK 7 LF Lethal factor: An exotoxin produced by B. anthrac is and a zinc dependent metalloprotease which cleaves the N terminus of MAPKKs LT Lethal toxin: The combination of LF and PA MAPKK/MEK Mitogen activated protein kinase kinas e: K inase s which phosphorylate downstream substrates typically at serine and threonine p38 p 38 mitogen activated protein kinases: Members of the MAPK family which are phosphorylated by MAPKK 3 and MAPKK 6 PA Protective antigen: An exotoxin produced by B. anthracis which binds to host cell receptors facilita ting entry of EF and/or LF


12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ANTHRAX LETHAL AND EDEMA TOXIN S EFFECTS ON HUMAN PE RIPHERAL CELLS By Kassidy M. Chauncey May 2012 Chair: Frederick Southwick Major: Medical Sciences Microbiology and Immunology Bacillus anthracis is a gram positive bacterium known to produce two toxins: edema toxin (E T) and lethal toxin (LT). ET is an adenylyl cyclase that increases intracellular cAMP levels, while LT cleaves and inactivates members of the mitogen activated protein kinase kinase family (MAPKK or MEK ) The effects of these toxins are typically studied i ndependent ly of one another. We have now investigated the effects of dual toxin treatment on multiple cell types. We found that treatment of cell s with both ET and LT diminished production of cAMP in a dose dependent manner and also showed forskolin, a st imulant of endogenous mammalian adenylyl cyclases was inhibited by anthrax LT. We sought to further elucidate how inhibition of the MAPKK signaling cascade attenuated cAMP We found that the proteolytic activity of LT was required for inactivation of aden ylyl cyclase activity The inhibition could not be explained by secretion of either cAMP itself or its substrate ATP, as extracellular l evels of cAMP and ATP were not increased after dual toxin treatment. Because LT inhibits the MAPKK pathway, we utilized specific MAPKK pathway inhibitors to further characterize which specific pathway or pathways (p38, JNK, or ERK) regulate d cAMP production. We found that all MAPKK pathways must remain functional in order for ET and endogenous adenylyl cyclases to generate significant increases in intracellular


13 cAMP concentrations. We also found that inhibition o f cAMP production by LT required intact cel ls, as the production of cAMP was not inhibited in cell ex tract s treated w ith dual toxins. These findings suggested LT may be acting via a post translational signaling mechanism downstream of the MAPKK pathways. To further c haracterize potential targets of cAMP inhibition by LT, 2D IGE was utilized to compare ET versus ET plus LT treated cells. Twenty eight candidate proteins were found to be differentially modified including actin regulatory, stress response, glycolytic and heat shock proteins. We conclude the production of cAMP by adenylyl cyclases re quire s the activation of all three MAPKK pathway s and we have identified a number of potential downstream protein candidates that may serve to regulate adenylyl cyclase activity. We have also measured the transcriptional response of human peripheral monocytes after treatment with a nthrax LT and have found multiple changes in the signaling pathways, outside of the well known MAPKK pathways. We confirmed monocyte susceptibility to anthrax LT and t hese results will help to further elucidate the role of LT on immune cell inhibition duri ng an anthrax infection Additionally, treatment of human platelets with either LT or ET has no effect on platelet s or their function. These findings can be explained by a failure of toxin to bind to the platelet surface due to low levels of the ant hrax re ceptors on human platelets. This is the fi rst finding indicating a nthrax toxin s do not directly impair human platelet function thus, the internal hemorrhage often observed in pe rsons who succumb to anthrax is attributed to other defects in hemostasis.


14 CHAPTER 1 INTRODUCTION Bacillus Anthracis History B. anthracis the causative agent of a nthrax, has laid the foundation for some of the most valuable scientific breakthroughs, along with some of the greatest human and animal threats. Anthrax is a zoonotic disease, in which sheep, horses, goats and cattle are the most susceptible animals [1 3] Anthrax infections have been documented as far back as 1491 B C in Egypt in which t he Old Testament references two plagues, the 5 th (the plague of cattle and livestock) and 6 th plagues (boils), believed to be caused by anthrax. Other historic references of anthrax describe cattle diseases in 500 B.C. in India, along with descriptions afflicting both livestock and people in ancient Greece from 1000 B.C. to 200 A.D. [4] Virgil, a Roman poet and scientist, wrote de scriptive accounts of anthrax occurring in the Rom an region of Noricum between 28 and 29 B.C. He termed the outbreak and addressed detailed occurrences: ore a garment made from the tainted wool, his limb was soon attacked by inflamed papules and a foul exudates, and if he delayed too long to remove the material a violent inflammation c overed the parts it had touched [5] Anthrax was utilized in the late 1800s by scientists to help test and establish critical concepts in both microbiology postulates in the late 1870s after Robert Koch identified the bacillus in blood smears, grew the bacterium in culture, and developed an animal model for infection [6 8] Anthrax also played a critical role in immunology in which t he first live bacterial vaccine was developed in cattle using an attenuated strain by Louis Pasteur in 1881 [9] During the 19 th century in Europe, many sheep workers were expose d to anthrax. Workers would be exposed to anthrax spores during the separation of wool, which le d to anthrax being


15 resulted in the establishment of disinfection stations and occupational regulations for anthrax [10] Mor e recent accounts of anthrax have occurred in 1979 in the former Soviet Union when anthrax was released by a military facility causing over 100 fatalities, and in 1957 in the United States, in which workers at a goat hair processing facility contracted inh alation anthrax, killing 4 individuals [11, 12] Anthrax has not been documented to be transmitted from person to person. Human cases of anthrax are typically associated with contact of infected animal by products such as wool, goat hair or hide. In the United States, anthrax is known to be endemic in Texas, Oklahoma, and Mississipp i [13] Currently, the biggest threat of anthrax is its use as a bioterrorist agent. Because inhalational anthrax is highly fatal and easily disseminated, its use in biological warfare is highly feare d In 2001, anthrax was released in the U.S. postal system and resulted in 11 cases of inhalation anthrax, 11 cases of cutaneous anthrax, and 5 fatalities [14] Bacillus a nthracis Microbiolog y B. a nthracis is a gram positive, non motile, rod shaped, bacillus that is non hemolytic when grown on sheep blood agar. The bacterium can be identified with staining using Other identification markers for anthrax include the presence of the protective antigen toxin, lysis by gamma phage, and capsule detection using fluorescent antibodies [15, 16] The optimal growth condit ions for B. anthracis is 35 C and t emperatures higher than 45 C lead to the loss of the capsule component yielding avirulent or attenuated strains [17] B. anthracis is also capable of undergoing sporulation under non optimal growth conditions specifically when infected host tissue is exposed to oxygen Although the bacterium can establish an infect ion if ingested, it is the spore form o f B. anthracis that is typically associated with disease in both humans and animals.


16 The spore structure of anthrax is metabolically inactive and is composed of multiple layers : an outer exosporium, followed by a spore coat, cortex, and finally the core nucleic acid can be found. The route of spore contact with a susceptible host dictates the form (cutaneous, inhalation, or indigestion) of disease, and is generally a good predictor of severity and outcome of infection. The spore form of anthrax is highly resistant to drying and most disinfectants, allowing it to survive for many decades or even centuries in harmful environmental conditions. The recommended method for decontamination of the spores is exposure to temperatures of at leas t 120 C for a minimum of 15 minutes [18] Typical human con tact with anthrax spores is through animal carcasses or by products from animals that have suc cumbed to the disease Interestingly, it has been shown that animal carcasses which have not been opened will result in little environmental contamination of spores [19] Anthrax Exposure Anthrax spores will infect animals, including humans, through a cutaneous, inhalational, or gastrointestinal route. Cutaneous anthrax is the most prevalent form of anthrax with >95% of reported cases being cutaneous [20, 21] Cutaneous anthrax is associated with the lowest mortality, and will usually remain localized to the dermis or subcutaneous tissue, although septicemia and toxemia may occur in severe cases If cutaneous anthrax is left untreated, there is a 20% mortality rate associated with this route of exposure while treated cases have <1% mortality rate [22, 23] The initial site of infection is believed to form at a pre existing lesion or abrasion in the skin followed by a one to seven day incu bation period after which a papule appears at the site of infection. After five to seven days of the initial papule formation, t he vesicle then ruptures, leaving a black, painless, ulcer like eschar. After two to three weeks the eschar will subside, leaving a scar at the site of the lesion.


17 Gastrointestinal anthrax occurs after ingestion of contaminated meat. It is believed that these cases involve ingestion of poorly cooked meat containing vegetative bacilli [24] This is the rarest form of anthrax, although under reporting of infection is believed to be common. Two to five days after initial in gestion of infected meat products, symptoms appear and can include fever, nausea, vomiting, abdominal pain and sometimes respiratory distress. Because gastrointestinal anthrax has such a broad range of symptoms, it is very difficult to diagnose early resu lting in mortality as high as 50% [25] The exact mechanism of how the bacilli penetrate the mucous membranes and enter the bloodstream remains unknown. Fatality from gastrointestin al anthrax occurs following tox emia, sepsis and shock, in which documented cases from the time of initial sy mptoms until death varies from two to five days [20, 26 28] A f ew cases of oropharyngeal (middle throat) anthrax have also been documented [29 32] The most feared form of anthrax is inhalational anthrax, due to its high mortality and hard like sympto B. anthracis spores are inhal ed into the lungs. Exposure typically occurs during occupational contact with air borne spores from infected animal by products, but the intentional release of anthrax spores has been docu mented. The onset of symptoms typically occur four to six days after spore inhalation and symptoms can include fever, chills, sweats, fatigue, nonproductive cough, muscle aches, and nausea or vomiting. The mild, initial phase of inhalation anthrax is follo wed by a sudden onset of more severe symptoms including dyspn ea, disorientation, cyanosis, followed by coma and death. Without treatment, death occurs in 90% of inhalational anthrax victims, while early intervention can lower fatality to 40% [24] Pathogenesis Death from anthrax is believed to be caused by toxin induced vascular collapse leading to hypoxia. Virul ent st rains of B. anthracis harbor two plasmids: pXO1 and pXO2. The pXO1


18 plasmid is 182 kb in size and encodes the tripartite toxin components: EF, L F and PA. The pXO2 plasmid is 96kb and encodes the anthrax capsule. Expression of both plasmids is regulated by a txA which is encoded on the pXO1 plasmid and has a positive effect on the transcription of the pXO2 gene regulators acpA and acpB [33] Plasmid expression is modulated by CO2 levels, which at high levels, can also directly activate acpA and acpB. Without either of these plasmids, B. anthracis shows extremely reduced virulence and culture filtrates from avirulent, uncapsulated strain are used in current human vaccine s [34 36] Capsule Virulent strains of B. anthracis express an anti phagocytic capsule comp osed of poly D glutamic acid. The capsule is expressed only in the presence of CO2 together with bicarbonate or serum and not during in vitro aerobic culturing conditions. When the isolated capsule is injected into animals, it has been shown to be excreted in an intact form, suggesting that the capsule is not antigeni c [37] T his non immunogenic capsule allows B. anthracis to evade the host immune system The role of the capsule is more crucial during the initial phases of infection, allowing the bacterium to establish an infection and disseminate from the initial site of infection while the toxins are more important during the later stages of anthrax [38, 39] Toxins B. anthracis secretes three exotoxins: protective antigen, edema factor, and lethal factor. The a nthrax toxin s are defined as A B toxins in which protective antigen serves as the B subunit and binds to host cell receptors, while edema factor and lethal factor serve as the catalytic subunits. Protective antigen (PA) is required for entry of the catalytic subunits and is termed edema toxin (ET) when administered in the presence of edema factor (EF), and is termed lethal toxin (LT) when the catalytic subunit lethal factor (LF) i s combined with PA. Many animal models have been used to study the effects of the toxins, incl uding studies on mice, guinea pig s,


19 sheep, rabbits, and primates. Dogs, cats, pigs, and birds are considered more resistant to anthrax than other animals [40 43] Protective antigen is an 83 kDa protein that binds to one of two host cellular receptors: tumor endothelial marker 8 (TEM8) and capillary morphogene s is gene 2 (CMG2) facilitating entry of EF and LF Both anthrax receptors share a von Willebrand domain which is required for PA binding although the von Willebrand domain is associated with binding to the extracellular matrix, the exact function of the se r eceptors is unknown. After PA binds to the host cell receptors, a 20 kDa portion of PA is cleaved by furin [44] After cleavage, the remainin g 63 kDa PA form s a heptameric pre pore, in which two to three subunits of EF and/or LF bind followed by clathirin mediated endocytosis and cell ular processing of the toxins within the acidic compartments of cells [45 48] Protonation of PA in the acidic endosomes leads to insertion of PA into the membrane and formation of the pore requir ed for translocation of EF/LF into the cytosol. Edema factor is an 89 kDa calcium dependent adenylate cyclase that increase s intracellular cyclic adenosine monophosphate (cAMP) levels. EF is encoded by the cya locus and requires binding of calmodulin for its catalytic activity [33, 49 55] The N terminus of EF is highly homologous to LF and has been shown to be essential for binding to PA The first accounts investigating edema toxin noted morphological changes in CHOK1A cells which were similar to cholera to xin, leading to the discovery that ET increases cAMP level s and posseses adenylate cyclase activity [54] The effects of ET are reversible and it has been shown that EF has a half life of less than two hours in the cytosol [54] Because of its anti phagocytic activities in both polymorphonuclear cells and macrop hages, ET is predic ted to play a more critical role in the early stages of infection [56, 57]


20 Lethal factor is a 90 kDa zinc dependent metalloprotease that cleaves MEKs thereby preventing downstream activation of the p38, JNK and ERK pathways. LT has been shown to c leave the N terminus of mitogen activated protein kinase kinases ( MAPKK) on e through seven with the except ion of MAPK K five [58 61] LF is encoded by the lef locus and mutations on its N terminus prevent binding to PA, while the C terminus contains its protease activity [62, 63] E arly studies with LT utilized mice, which show ed varying levels of cytotoxicity in vitro and varying degrees of susceptibility to LT [46, 64 69] It was later discovered that only certain strains of mice har boring the Nalp 1b gene are susceptible to the cytotoxic effects of LT [70] Investigations using human cells hav e shown LT blocks cytokine release in macrophages, increases apoptosis and cell permeability in endothelial cells, blocks neutrophil motility, and decreases proliferation and cytokine production of lymphocytes [64, 70 76] cAMP Signaling Cyclic adenosine monophosphate (cAMP) is a second messenge r that regulates a diverse range of cell processes including cell metabolism, gene expression, c ell division, exocytosis, and regulation of immune responses. cAMP is synthesized from ATP by adenylyl cyclase s and is one of the most diver se and complex second messengers discovered. cAMP was discovered by Dr. Earl Sutherland during his investigations on the mechanisms of hormone action, and is known to be involved in numerous regulatory and metabolic processes in various organisms including amoebas, bacteria, plants, and humans [77, 78] The initiation of mammalian cAMP production is through activation of a seven transmembrane spanning G protein coupled re ceptor ( GPCR) upon binding to its cognate ligand which includes epinephrine, dopamine, prostaglandin, prostaglandin E2 (PGE2), adenosine, and glucagon, among others [79] GPCR activation results in an exchange of GDP for GTP on a receptor


21 subunit (Figure 1 3 ) This activation is transient as GTP hydrolysis will return the G protein into an inactivated state This hydrolysis is accomplished through a regulator of G protein Signaling (RGS) which acts as a GTPase accelerating protein (GAP) [80] The primary effector component of the heterotrimeric G protein is the 40 46 kDa subunit s which can be further divided into two fa inhibitory [81] P roduction of cAMP by adenylyl cyclases is accomplished through binding of the s resulting in adenylyl cyclase activation and conversion of ATP to cAMP GPCR can also lead to the release of a subunit which results in inhibition of adenylyl cyclase s There are 10 known isoforms of mammalian adenylyl cyclases, nine of which encode a membrane bound form, while one encodes a soluble isoform. These isoforms are further divided into five distinct families: the calcium calmodulin sensitive forms (AC1, AC3 an d AC8), the AC6), the AC9 and lastly, the soluble adenylyl cyclase (Figure 1 5). The most recently identified soluble form is insensitive to activation by G proteins and forskolin. This isoform is found in the testis and is activated by bicarbonate [82] The st ructure of adenylyl cyclases is similar in that all isoforms contain two transmembrane domains and two cytoplasmic domains (Figure 1 4). There is little hom ology in the transmembrane domains between isoforms, but the catalytic domains of adenylyl cyclases display 50% 70% similarity between their amino acid sequences. There are two catalytic domains within adenylyl cyclases and both are required for enzyme act ivity [83] It has been shown that both t he C1a and C2a domains bind ATP, while the C1a domain contains more of a


22 catalytic activity while the C2a domain contains a more regulatory role [84] The catalytic domains come into close contact with each other upon activation through a conformation change in the enzyme. The catalytic domains have been shown to be bound by both or the pote nt chemical activator forskolin Forskolin is a potent activator of all mammalian isoforms of adenylyl cyclases, except AC9 and the soluble AC form s through interactions within a hydrophobic pocket at their catalytic interface [85] For AC2, AC4, AC5, AC6 and AC7 the effects of both C3, and AC8 show an additive effect [86] ot through direct competition with the [87] Production of cAMP is regulated through a feedback mechanism which results in the activation of phosphodiesterases ( PDEs) which degrade cAMP. These phosphodiesterase enzymes can be inhibited with treatment of 3 isobutyl 1 methylxanthine (IBMX). Production of cAMP leads to the activation of several downstream components. One well known downstream substrate is protein kinase A (PKA). PKA is a kinase with a wide range of downstre am targets and subsequent effects. Activated PKA can phosphorylate downstream substrates at serine and threonine residues, and has been shown to play a role in cAMP response element binding protein (CREB) activation [88] Other proteins activated by cAMP include the guanine exchange proteins EPAC 1 and EPAC 2. Activation of these proteins r esults in activation of the small Ras like GTPase Rap 1 [89] Another important component activated by cAMP include cyclic nucleotide gated ion channels nonselective cation channels that play a role in sensory tra nsduction as well as hormone release and chemotaxis [90]


23 Each gene encoding the various isoform s of mammalian adenylyl c yclases is located on a different chromosome, all likely to be expressed by different promoters during distinct conditions [91 94] Overstimulation of adenylyl cyclases has been associated with certain cancers including pituitary and thyroid adenomas [95, 96] On the other hand, decreased adenylyl cyclase activity is associated with decreased cognitive function including memory and learning [97, 98] Disregulation of adenylyl cyclases has also been observed in heart failure, longevity, and motor dysfunction [99 102] Because there is such diversity in adenylyl cyclase expression and regulation, identifying selective stimulators or inhibitors for each adenylyl cyclase has been a challenge Unraveling t he biochemical pathways underlying LT mediated inhibition of mammalian adenylyl cyclases promises to provide a new understanding of adenylyl cyclase regulation and may lead to new therapeutic approaches to a wide array of medical disorders. In regards to cAMP and immune cell function, increased cAMP levels exert anti inflammatory effects on immune cells. This suggests a mechanism utilized by pathogens which would impair the immune responses, facilitating the survival and proliferation of microbes. In leuko cytes, it has been shown that cAMP suppresses the pro inflammatory cytokines TNF IL 12, and inhibits production of the chemokine macrophage inflammatory protein 1 (MIP 1) [103] Phagocytosis is also suppressed in leukocytes, along with reactive oxygen intermediate release [ 104, 105] T cell proliferation has been shown to be inhibited by increased cAMP levels [106] The overall inhibition of immune cell function by increase d production of cAMP is utilized by num erous pathogens to help aid in their pathogenesis. Infectious microbes known to manipulate host cAMP levels in order to help successfully establish and maintain infections include Vi brio cholera, Bordetella pertussis, Pseudomonas


24 aeruginosa and Yersinia pestis T he gram negative bacteria V. cholera achieves its virulence through production of a toxin that ADP resulting in an irrepressible synthesis of cAMP by adenylyl cyclase [107] Another known ribosylating toxin produced by the gram negative bacteria Bordetell a p ertussis achieves increased cAMP levels through the ADP ribosylation of in unregulated production of cAMP [108] Aside from modifications on host regulatory components, many microbes produce toxins which are themselves adenylyl cyclases, capable of direct synthesis of cAMP when coupled to specific host cofac tors. These include the ExoY of Pseudomonas aeruginosa the adenylate cyclase of Yersinia pestis and the edema factor of Bacillus anthracis [54, 109, 110] Many p athogenic microbes utilize mechanisms which elevate cAMP levels, thus how l et hal toxin inhibits cAMP production is of great interest both clinically and physiologically. Mitogen Activated Protein Kinase P athways The MAPKK s are involved in a variety of host cell functions including cell proliferation, differentiation, migration, survival and immune responses. This pathw ay was first recognized in neurotransmitters to tyrosine kinase receptors resulting in a downstream phosphorylation cascade of three subsequent protein kinases: the MA PK kinase kinase (MAPKKK/MEKK), the MAPK kinase (MAPKK/M EK) and the MAP kinase (MAPK) (F igure 1 2) [111, 112] The MAPKs can be further divided in six groups: p38, extracellular regulated kinases (ERK1/2), Jun NH2 terminal kinases (JNK1/2/3), ERK7/8, ERK3/4, and ERK5. Three of these pathways, the p38 kina ses, the ERK1/2, and JNKs, are the most well known and widely studied pathways. The MAPK pathways are activated upon activation of receptor tyrosine kinases by their cognate ligands. This leads to activation of small GTPases of the Ras and Rho family amon g


25 other adaptor proteins, which subsequently pho sphorylate downstream MAPK. All kinases within the MAPK family con tain proline residues near the serine/t hreonine phosphorylation sites The specificity of phophorylation is maintained by docking sites, eithe r positively charged residues surrounded by hydrophobic residues or a Phe Xaa Phe Pro sequence [113, 114] Because the MAPK signaling pathways are so diverse and the levels of MAP kinas es do not fluctuate throughout the course of signal activation, the down regulat ion of these pathways is attrib uted to the action of serine/t hreonine phosphatases [115, 116] The ERK1/2 pathway has been shown to be activated by growth factors, serum cytokines, and microtubule disorganization [117 119] The two isoforms of the ERK pathway, ERK 1 and ERK2 show an 83% similarity in amino acid sequences. Both isoforms are shown to be expressed in all tissues. Over 150 substrate s have been identified for ERK, displaying a d iverse range of physiological functions ranging from regulation of the cell cycle, cell survival and apoptosis to cell differentiation and development. Two kinases, MEK1 and MEK2, have been identified as upstream activators of E RK1/2 which phosphorylate a con served Thr Glu Tyr motif with in the ERK activation loop allowing relocalization to the nucleus (Figure1 2). Inhibition of MEK1/2 will prevent activation of ERK1/2. The second pathway within the MAPK family includes the JNK pathway, named because of the role this pathway plays in the phosphorylation and activation of c jun, a transcription factor. Ten different isoforms of JNK have been identified, and they are activated by numerous stimuli including cytokines, UV irradiation, growth factor deprivation, and DNA damaging agents [1 20 123] The JNK pathway is phosphorylated by the upstream kinases MEK4 and MEK7 within an activation domain consisting of a Thr Pro Tyr motif (Figure 1 2) An important downstream effect of the JNK pathway is regulation of protein degradation. High er levels of


26 JNK are also presen t in several cancer cell lines, while long term activation of JNK has been shown to mediate cell apoptosis, whereas transient acti vation leads to cell survival [124] JNK has also been shown to play a role in T cell differentia tion [125, 126] T hese isoforms show only a 60% similarity in sequences and t he same stimuli that have been shown to activate the JNK pathway also activate the p38 pathway, which include environmental stress, inflammatory cytokines, and growth factors [127 129 ] Th e p38 pathway is activated by MEK3 and MEK6 and has over 25 known substrates (Figure 1 2). Previous studies have shown p38 plays an important role in macrophage and neutrophil respiratory burst activ ity, chemotaxis, adherence, apoptosis and T cell differen tiation and apoptosis [130 134] These kinases integrate and amplify signals with a wide variety of overlapping responses. L T cleaves the N terminus of all MEKs (except MEK5), thereby inactivating downstream pathways has been documented to have a wide range of effects on host cells. For example, LT has been documented to block cytokine release in macrophages, increase apoptosis and cell permeability in endothelial cells, block neutrophil motility, and decrease proliferation of lymphocytes [64, 70 75] Here, we are providing an additional role of LT in which cleavage of the MAPKKs inhibits cAMP production. To date, inhibition of the MEK pathways has not been shown to effect cAMP production. Monocytes Blood monocytes are mononuclear cells that play a major role in the host immune response through regulation of inflamm atory responses, secretion of cytokine and antimicrobial factors, and direct pathogen clearance [135] They compose an important component of the innate immune system, along with neutrophils, macrophages, and dendritic cells. Monocytes are highly


27 dynamic cells that are capable of differentiation into multiple effector cells with distinct antimicrobial functions. Two main subsets of monocytes have been defined. During inflammation, a subset of monocytes containing the chemokine receptor 2 (CCR2) traffic to sites of infection in res ponse to chemokine ligand 2 (CCL2) also known as monocyte chemotactic protein 1 (MCP1) and are referred to as inflammatory monocytes. The other subset of monocytes constitutively replenishes the tissue macrophage and dendritic cell pools in the absence of inflammation [136, 137] although more recent studies have shown some resident macrophages are maintained via local proliferation [138 140] In humans, these monocyte subsets are defined based on the surface expressio n of CD14 or CD16. CD14+CD16 monocytes express CCR2 and compose roughly 90% of the circul ating monocyte pool, while CD14 + CD16+ and CD14++CD16+ are considered monocytes and display anti viral responses [141] Monocytes are derived from monoblasts in the bone marrow which are differentiated from haematopoietic stem cells and circulate in the blood for 1 2 d ays before they migrate into tissues where they replenish the macrophage and dendritic pools [142 144] It is estimated that nearly 340 million monocytes leave the periphery daily [145] After monocytes leave the bone marrow a nd circulate throughout the periphery, they are recruited to various areas within the body, where their temporal localization dictate the type of cell they differentiate into, i.e. alveolar macrophages (lungs), kupffer cells (liver), microglia (brain), and os teoclasts (bone). The process by which monocytes migrate from the periphery to the tissues is termed diapedesis. Diapedesis begins with low affinity attachment of monocytes to the endothelial via selectins, followed by high affinity anchoring of monocytes via integrins. After attachment, monocytes chemotax through the endothelium towards a chemokine gradient (MCP 1, IL 8) to sites of infection (Figure 1 6) Here they are activated and depending on th e


28 surrounding microenvironment, differentiate into macrophages or dendritic cells to assist in clearance of invading pathogens. For differentiation into macrophages, granu locyte macrophage colony stimulating factor (GM CSF) has been shown to play a role in thi s process while IL 4 and GM CSF treated human peripheral monocytes have been shown to differentiate into dendritic cells. Platelets Platelets are anuclear fragments o f megakaryocytes that aid in hemostasis and are found only in mammals The function of the platelet prevent the loss of blood from the circulation. Platelets maintain the vascular integrity through the for mation of thrombi Platelets are 3.0 M in width and circulate for ~ 10 days before being cleared by the spleen [146] The events leading up to thrombosis is a highly regulated process, where a defect in platelet function can lead to severe bl ood loss or to diseases such acute myocardial infarction and ischemia Platelets are anuclear, so all of their mo lecular components must be pre synthesized. They harbor storage granules, termed alpha or dense granules, which provide important components required for their function including receptors (P selectin, glycoproteins) growth factors, coagulation proteins, integrins, and adhesion molecules. Upon activation, platelets begin to expand, release their granules, and bind to the plasma protein fibrinogen, forming a clot. Platelets can become activated, typically at sites of endothelial injury, by a number of agonists including adenosine diphosphate, thrombin, epinephrine, thromboxane A 2 serotonin, collagen, and prostaglandin E 2 The a ctivation of platelets by external stimuli is associated with a subsequent activation of the glycoprotein (GP) IIb IIIa recepto r, termed inside out signaling. GPIIb IIIa is also known as the fibrinogen receptor and its a ctivation results in an increased affinity for fibrinogen [147]


29 Fibrinogen is a circulating plasma glycoprotein that binds platelets through their GPIIb IIIa receptors. Binding of the GPIIb IIIa receptor also lead s to activation signals with in platelets, termed outside in signaling. This type of activation also requires integrin clustering [148] The formation of a clot can be divided into three main events: adhesion of platelets to the endothelium, activation of bound platelets, a nd aggregation of platelet s to form a thrombus (Figure 1 7 ). The initial low affinity interaction with platelets and the endothelium is through the platelet GPIb/IX/V with activated von Willebrand factor (vWF) on the endothelium. This initial interaction i integrins (GPIa IIa and GPIIb IIIa) leading to a firm adherence of platelets to collagen [149 150] Platelets are then activated following receptor ligation, along with the potent platelet stimulus thrombin. This activation leads to degranulation of vWF, fibrinogen and ADP, resulting in platelet ag gregation and formation of a platelet plug. The platelet cytoskeleton plays a major role during activation of platelets. Platelets circulate in the periphery as disc shaped cells and eventually become activated, spreading out and flattening over damaged a reas of endothelium. A major cytoskeleton component, actin, is the most abundant platelet protein. It forms 2000 5000 linear actin filaments in plat elets with over 2 million molecules of actin per platelet [151, 152 ] Pre vious studies with anthrax LT in neutrophils show LT indirectly sequesters actin from growing filaments, preventing formation of a functional actin cytoskeleton [76] Because of the major contribution actin plays during platelet activation, and the known inhibitory effects of LT of actin assembly, we sough t to determine the effects of anthrax LT on the platelet cytoskeleton. Effects of Anthrax Toxins on P e ripheral Blood Cells LT is shown to have an overall inhibitory effect on immune cells. Unlike murine cells, human cells fail to undergo rapid lysis by LT, but in many cases LT does induce cell cycle arrest,


30 resulting in a halt in cell proliferation. It has been shown that differentiated human monocytic cell lines (U 937, HL 60 and THP 1), along with activated human mononuclear cells, are susceptible to LT m ediated apoptosis over longer time periods (up to 24 hours) [153, 154] LT toxicity in dendritic cells varies with some reports showing re sistance to LT induced cell death up to 48 hours, while other reports of human DC show LT induced apoptosis [69, 155] ET has not been shown to induce cytotoxicity in DC, macroph ages, T cells, neutrophils, and human microvascular endothelial cells [156 161] Production of cAMP has not been associated with ce ll death, in fact increased cAMP levels has been associated with an in crease in macrophage survival, along with intricate pro and anti inflammatory effects on monocytes, DC and lymphocytes [162] Many in vivo studies with LT and ET suggest animals succumb to anthrax toxins via vascular collapse. Toxin treated animals have shown hemorrhaging lesions, increased heart rate, reduced cardi ac output and loss of circulatory fluids [68, 163 165] Because platelets play a critical role in maintaining hemostasis, the effects of ET and LT on platelet function have been previously investigated. It was revealed that LT decreases human blood clotting time and [16 6] Another study using rabbit platelets and ET shows decreased thrombin induced platelet aggregation and clotting [167] The exact effects anthrax toxins are playing on human platelets and their contribution to vascular collapse requires further investigation.


31 Figure 1 1. Anthrax toxins. B. anthracis secretes three exotoxins: protective antigen (PA), edema factor (EF) and lethal factor (LF). PA binds to the host cell, is cleaved by furin into its active conformation, and binds to h ost cell receptors leading to the formation of a heptamer complex. This complex is bound by LF and /or EF and is endocytosed into cells. The acidic compartments of the late endosomes induce a pore complex allowing EF/LF to enter the cell cytosol. Within the cytosol, LF cleaves the N terminus of mitogen activated protein kinase kinases, while EF increases intracellular levels of cAMP [168]


32 Figure 1 2. Mitogen Activated Protein Kinase Kinase (MAPKK or MEK ) signaling pathway Kinases function by phosphorylating downstream com ponents. There are 3 MAPK pathways which are activated by the MAPKK pathway. This includes the ERK pathway which is activated by MEK1/2, the JNK pathway which is activated by MEK4/7, and the p38 pathway which is activated by MEK3/6. These pathways play a m ajor role in response to stress and also contribute to cell growth, differentiation, apoptosis, and inflammation.


33 Figure 1 3 Regulation of adenylyl cyclases Adenylyl cy c lases are enzymes which produce cAMP from ATP and are embedded within the cell membrane. These enzymes are regulated by G protein coupled receptors. Upon receptor stimulation the heterotrimeric G protein complex dissociates into 2 subunits. An alpha subunit and a beta/gamma subunit. The G alpha subunit is the subunit which inter acts with adenylyl cyclases and can either activate or inhibit their activity. Inhi bitory G alpha subunits, denoted G alpha i bind to adenylyl cyclases inhibiting the production of cAMP, while G alpha stimulatory subunits, denoted G alpha s, induce product ion of cAMP.


34 Figure 1 4. Molecular structure of adenylyl cyclase. The general structures of the nine transmembrane mammalian adenylyl cyclases have a calculated mass of 120 150 kD. They contain an N terminal domain, two cytoplasmic catalytic doma i ns a nd twelve transmembrane domains. The catalytic domains are 50 70% similar in amino acid sequence between mammalian adenylyl cyclases Both catalytic domains are required for functional activity and activation of adenylyl cyclases involves a confirmation ch ange in which both the catalytic domains (C1a and C2a) are in close proximity The C1b and C2b domains are predicted to play a regulatory role as these domains are not required for catalytic activity [169]


35 Figure 1 5. Isoforms of mammalian adenylyl cyclases. Ten isoforms of mammalian adenylyl cyclases exist, with each being differentially regulated and/or expressed All isoforms except sAC are inhibited by P site inhibitors, whereas all but isoform 9 and the sAC are stimulated by forskolin [170]


36 Figure 1 6 Monocyte attachment and diapedesis. Endothelial cells express multiple receptors facilitating attachment of monocyt es (selectins, glycosaminoglycans) This low affinity adhesion (selectins CCR2 and CXCR2) is followed by an increase in adhesion receptor and firm adhesion. Once monocytes have adhered to the endothelial, they diapedis through the endothelial towards areas of high chemo kine production (MCP 1 and IL 8) Here, they replenish the macrophage and dendritic pool and function to assist in clearance of invading pathogens [171]


37 Figure 1 7 Platelet function Platelets are small anuclear fragments of megakaryocytes which play a role in hemostasis. Upon injury of vesicles, platelets bind to exposed proteins on the severed endothelium. After adhesion, platelets are activated and their actin cytoskeleton s begin to expand sealing off the area of injury. Platelets bind to fibrin, allowing stable aggregates to form and this is known as a clot.


38 CHAPTER 2 ANTHRAX LETHAL TOXIN 'S INHIBITION OF ANT HRAX EDEMA TOXIN Overview An extensive body of research has unraveled the mechanisms of inde pendent action s of lethal toxin and edema toxin ; however, the a ffect s of combined toxins has never been fully elucidated Our lab has found a very surprising effect after dual anthrax toxin treatment that has never been reported. We have found that treatme nt of human neutrophils and monocytes with lethal toxin and edema toxin combined leads to a decrease in cAMP production (unpublished data). To date, there has only been one study measuring cAMP levels after dual toxin treatment. This study concluded a low er level of cAMP production by ET after LT tr eatment, and attributed this result to a decrease in ET entry, due to binding of the same toxin component required for entry into cells [54] Another study has shown that mice found to be previously resistant to the effects of LT can b ecome susceptible after treatment with sublethal doses of ET [50] Other studies have found that dual toxin treatment worsens shock in a rat infusion model but no studies have focused on the underlying signaling events [163] Here, we determine the effects of dual toxin treatment on host signaling pathways and further elucidate the mechanisms behind these effects. Mater ials and Methods Toxin Purification Edema factor (EF) was expressed and purified from E. coli as previously described [172] Protective antigen (PA) and lethal factor (LF) were purifi ed from B. anthracis as previously described [173] Bri efly, culture media was filtered through a 0.22 M filter, followed by diethylaminoethyl cellulose (DEAE) anion exchang e chromatography. The toxins we re then


39 subjected to gel filtration and hydrophobic interaction fast protein liquid chromatography (FPLC ) and highly purified toxins were confirmed by coomassie blue staining. ET refers to the combination of EF plus PA while LT refers to the combination of LF plus PA. Chemicals Used Positive controls for cAMP include Forskolin (Fsk, Sigma Aldrich), and 3 isobutyl 1 meth ylaxthine (IBMX, Sigma Aldrich). MEK inhibitors included the p38 inhibitor SB203580 (Calbiochem), the Erk1/2 inhibitor s is PD98059 (Calbioc hem) U 0126 (Cell Signaling) and CI 1040 and the JNK inhibitor is SP6 00125 (Sigma). Antibodies used were anti MEK antibody (Cell Signaling) The metalloprotease inhibitor GM 6001 was obtained from Millipore. Primary Cell Isolation and Treatment with ET Human neutrophils and monocytes were purified using a Ficoll Hypaque gradient as previously described [72] For monocyte isolation, a negative selection antibody cocktail (Roche) was mixed with whole blood before separation over a Ficoll Hypaque gradient. The study followed US Department of Health and Human Ser vices guidelines and was approved by the Institutional Review Board at the University of Florida. Healthy volunteer donors ranged in age from 25 58 years old and included both males and females. Purified neutrophils and monocytes were re suspended in RPMI with L glutamine (Mediatech), and adjusted for 1 X 10 6 cells/ml Cells were treated with toxins for the indicated time points at 37C while gently rotating the cells to prevent clumping or cell activati on. Control cells wer e incubated with buffer alone. Al l isolated cells were used immediately after isolation and neutrophil studies were completed within five hours of blood drawing. Cell Culture glucose supplemented with 10% fetal b ovine serum (FBS) and 5% penicill in and streptomycin


40 (Cellgro ). THP 1 cells (ATCC) were grown in RPMI 1640 (Cellgro) supplemented with 10% fetal bovine serum (FBS) and 5% penicillin and streptomycin (Cellgro) and used at a concentration of 1 x 10 6 cells/mL. Intracellular Cyclic AMP Levels Cyclic AMP levels were determined using either an enzyme linked immunoassay (Amersham Biosciences or Arbor Assay ) or a cAMP Glo Assay (Promega), as previously described [158] Cells were treated with varying concentrations of ET as indicated for 2 hours or with 10M forskolin plu s 100M IBMX for 20 minutes All incubations were carried out at 37C. Cells were pelleted, lysed, and sonicated. Intracellular cAMP levels were measured in a 96 well plate and samples were run in duplicates. Western Blot Analysis Cell extracts were subje c t ed to western blot analysis using an antibody directed against the amino terminus MEK, as described previously [58] This antibody binds epitopes on the first seven amino acids of MEK, the region cleaved by LT, and loss of antibody reactivit y indicates proteolysis by LT. Cells were treated with toxins, as indicated, lysed in lysis buffer (1% Triton X 100, 50mM TrisCl, 150mM KCl, 50mM EDTA, 0.2% NaA2, 200mM imidazole, 100mM NaFl, 100mM Na3VO4) plus complete mini protease in hibitor cocktail tablet (Roche), sonicated, and 40ug total protein was loaded to gels. Gels were ran for 1 hour at 100 V and transf erred to a p olyvinylidene fluoride ( PVDF ) membrane. All blocking and antibody incubation was in Tris Buffered Saline and Tween 20 containing 5% milk. Extracellular ATP and cAMP Measurement HeLa cells were treated for 2 hours with buffer alone, 500ng/mL EF plus 5 00ng/mL PA or with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF at 37 C. For Triton samples, 0.1% Triton was added and cells were sonicated. All samples were pelleted at 800 x g for 30 seconds


41 and supernatant were collected, while cell pellets were lysed and sonicated. Both intracellular and extracellular levels of ATP was assayed using an ELITEN ATP assay (Promega) while cAMP was measured using an ELISA (Arbor Assays). LT Metalloprotease Inhibitor HeLa cells or THP 1 cells were treated 2 hours a t 37 C with buffer alone, 500ng/mL EF plus 5 00ng/mL PA, with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF or with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF which had been pre incubated for 10 minutes with 44uM GM 6001. Cells were assayed for intrace llular cAMP levels (Arbor Assays) or lysed and analyzed for MEK1 cleavage using Western Blot Analysis, as previously described above. HeLa Cell Extracts and cAMP Production HeLa cell extracts were prepared by sonication of cells. Extracts were incubated with varying concentrations (250ng or 500ng) of EF at varying time point (2 minutes, 10 minutes, 20 minutes). The optimal concentration and time point for cAMP production of 500ng for 10 minutes was used for dual toxin treatment experiments. For LT experiments, HeLa cells were pre treated with 500ng/mL LT for 2 hours. Cell extracts were then treated with buffer alone, 500ng EF, or 500ng EF plus 500ng LF and cAMP production was measured. 2 D gel analysis For 2 D analysis of HeLa cells, cells were t rea ted with either 500ng/mL EF plus 5 00ng/mL PA or with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF for 4 hours Inhibition of cAMP production wa s confirmed using an ELISA HeLa cells were lysed and 50 g each of Cy3 ET treated and Cy5 ET plus LT treat ed extracts were subjected to isoelectric focusing in a 24 cm pH 3 to 10 IPG strip at 10 k Volt for 98 kilovolt hours before analyzed in a 24 x 24 cm 8 to 16% SDS PAGE


42 Results Anthrax ET is Inhibited by Anthrax LT It is well known that ET increases intracellular cAMP levels, but here we show that this increase in cAMP is inhibited by LT. As the concentration of LT is increased, there is a dose dependent inhibition of cAMP production. HeLa cells were treated for 2 hours with 500ng/mL EF plus varying concentrations of LF (50ng/mL, 100ng/mL, 250ng/mL, and 500ng/mL) plus 2000ng/mL PA at 37 C. It is known that 2 3 subunits of EF and/or LF are capable of bind ing to PA [53] Previous studies investigating dual toxin treatment predicted a decrease in ET induced cAMP production due to decreased internalization of EF by competition with LF [54] In order to assure PA concentration was not a limiting factor in EF entry, a higher c oncentration (2000ng/mL) of PA was utilized. As the concentration of LF reaches 250ng/mL there is a maximum reduction in cAMP production (Figure 2 1A), as measu red by a competitive ELISA T o confirm our results using a n alternative assay, we employed an i ndirect assay to measure cAMP production through downstream activation of PKA. HeLa cells were treated for 2 hours wit h 500ng/mL EF plus 500ng/mL LF plus 5 00ng/mL PA at 37 C. We confirm that ET increases cAMP levels in HeLa cells, while addition of LT alon g with ET inhibits cAMP production by ET (Figure 2 1 B ). B ecause cAMP is derived from ATP and cells undergoing cell death may have reduced ATP levels, we next measured viability in HeLa cells after dual toxin treatment. We find that treatment with both 5 00n g/mL EF plus 5 00ng/mL PA or with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF after a 2 hour treatment does not induce cell death as cells from all conditions remain viable (Figure 2 1 C ). Cell death was measured using an MTT viability assay. We next sought to determine if inhibition of cAMP could be attributed to inhibition of the MEK pathways. Using chemical inhibitors to mimic the actions of LT inhibition of MAPKK, we


43 show that treatment with 3 different chemical inhibitors SB203580, U 0126, and CI 1040 also inhibit ET induced cAMP production (Figure 2 1D) SB203580 competitively inhibits the p38 signaling pathway while U 0126 and CI 1040 non competitively inhibit the ERK signaling pathway. Previous work in our lab has shown the JNK inhibitor also in hibits cAMP production (unpublished data) We conclude that an intact MAPKK signaling pathway positively regulates cAMP production by ET and when these pathways are inhibited, cAMP production is also inhibited. Because our results only focus on HeLa cells, an epithelial cancer cell line, we wanted to confirm our findings in other cell types. We tested LT inhibition of ET induced cAMP production in THP 1 cells, a h uman acute monocytic leukemia cell line and primary human monocytes. Both cell types were trea ted for 2 hours with buffer alone, 500ng/mL EF plus 5 00ng/mL PA or with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF (Figure 2 1 E and F). Primary human monocytes and THP 1 cells showed increased production of cAMP after treatment with ET, while cells tr eated with ET plus LT showed an inhibition in cAMP production. W e conclude inhibition of cAMP by LT is not dependent on cell type as this phenomenon is seem in primary human monocytes and THP 1 cells tivity LT is known to cleave MEK 1 7, with the exception of MEK5. Some studies have predicted that LT has additional activity outside of cleavage of MEKs so we next sought to alloprotease inhibitor GM 6001 was used to block LT activity. Previous studies have shown inhibition of LT activity after treatment with GM 6001 [174] HeLa cel ls were treated with buffer alone, ET, LT or LT that had been pre incubated for 10 minutes with 44 M GM 6001 to inactivate the metalloprote ase activity plus ET and intracellular cAMP levels were measured. As expected, ET


44 increased cAMP levels while dual toxin treatment inhibited this increase in cAMP. The ion of cAMP is through its metalloprotease activity. GM 6001 tr eated HeLa cells did not increase cAMP levels. The samples were run in duplicate each time and the duplicate samples were assayed for MEK1 cleavage. After dual toxin treatment, MEK1 had been cl eaved while in the presence of GM 6001, the levels of MEK1 returned to higher levels. This confirms the metalloprotease activity of LT had been inhibited in the presence of GM 6001. The same experiment was performed in THP n of cAMP production is through its metalloprotease activity (Figure 2 2C and D). LT Does Not Cause Release of ATP or cAMP LT is a zinc dependent metalloprotease that has been previously shown to open ATP connexin channels leading to release of ATP in mous e macrophages [175] Because ATP is the substrate for cAMP, we next sought to determ ine if LT caused a similar release of ATP in HeLa cells. HeLa cells were treated with buffer alone, 500ng/mL EF plus 5 00ng/mL PA or with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF at 37 C for 2 hours. An additional sample with 500ng/mL EF plus 5 00ng/mL PA was treated with 0.1% Triton X 100 and sonicated before cells were pelleted to show maximal levels of extracellular ATP. The extracellular and lysed pellets (intracellular) were collected and assay for ATP. The extracellular leve ls of ATP were approximately 0.5 M ATP in the control, ET and ET/LT samples, while treatment with ET/Triton showed ext racellular levels of ATP near 1 3 M (Figure 2 3A) The intracellular levels of ATP in the control, ET and ET/LT samples all showed similar levels again while the ET/Triton contained insignificant levels of intracellular ATP (Figure 2 3B) It can be concluded from this experime nt that dual toxin treatment does not lead to the release of ATP, thereby


45 depleting the substrate for cAMP. Therefore, ition of cAMP cannot be attributed to a depletion in the substrate ATP. We next sought to determine if LT was causing a release of cAMP, which could explain the lower levels of intracellular cAMP after treatment with LT A previous study has found that cA MP can be secreted out of cells [176] HeLa cells were treated with buffer alone, 500ng/mL ET or 500ng/mL ET plus 500ng/mL LT at 37 C for 2 hours. A fourth sample containing 500ng/mL ET was incubated for 2 hours at 37 C followed by the addition of 0.1% Tri tonX 100 and sonication. All samples were centrifuged, supernatants were collected, and pellets were lysed. Both intracellular and extracellular levels of cAMP were assessed. Intracellular levels of cAMP remained low in the control, ET/Triton, and dual tox in treated samples, while ET treatment caused a rise in c AMP levels as expected (Figure 2 3D) The extracellular levels of cAMP were increase d in bot h the ET and ET/Triton samples, while in the control and dual toxin treated samp les levels of cAMP were low er (Figure 2 3C) Based on these experimental results, we can conclude that dual toxin treated cells are not releasing cAMP into the extracellular media Forskolin Induced cAMP production is Inhibited by Anthrax LT To better understand the extent of cAMP inhibition, we induced cAMP by exposing cells to forskolin (Fsk), a known stimulus of mammalian adenylyl cyclases along with 3 isobutyl 1 methylxanthine (IBMX), a known phosodiesterase inhibitor HeLa cells were treated with buffer alone, 10uM Fsk plus 10 0uM IBMX, or for 2 hours with 500ng/mL LF plus 500ng/mL PA followed by 10uM Fsk plus 100uM IBMX for 20 minutes. cAMP levels were measured using a PKA based assay and revealed that LT is also capable of inhibiting Fsk induced cAMP (Figure 2 2A). We next det ermined if inhibition of cAMP by Fsk was dose dependent. HeLa cells were treated with buffer alone or increasing concentrations of LF (50ng/mL, 100ng/mL, 250ng/mL)


46 plus 500ng/mL PA for 2 hours followed by the addition of 10uM Fsk plus 100uM IBMX for 20 min utes. Intracellular cAMP levels were measured and showed a dose dependent inhibition of cAMP (Figure 2 2C). Next, inhibitors were used to determine if they too could block production of Fsk induced cAMP. HeLa cells were tr eated with buffer alone, 10 M Fsk plus 100 M I BMX or with 10 M Fsk plus 100M IBMX and one o f the following inhibitors: 100M SB203580, 20 M U 0126, or 100nM CI 1040. Intracellular levels of cAMP were measured and Fsk/IBMX induced cAMP levels as expected while samples containing Fsk/IBMX plus inhibitors all showed lo wer levels of cAMP (Figure 2 2B). These results indicate the inhibition of the MAPKK pathways, using chemical inhibitors or LT, leads to an inhibition in Fsk induced cAMP production. LT Does Not Inhibit cAMP production by EF in Cell Extracts Next, an in vitro assay was used to determine if LT could also inhibit cAMP production in cell extracts For these experimen ts, HeLa cell extracts were utilized First, cell e xtracts were treated for 2 minutes, 10 minutes, or 20 minutes with buffer alone, 250ng EF or 500ng EF and cAMP levels were assessed. It was found that opti mal production of cAMP by EF occured after a 10 minute incubation with 500ng EF (Figure 2 5 ) using extracts from an initial Hela cell concentration of 2 x 10 5 cel ls (Figure 2 6A ) This time and concentration of EF is consistent with a previous study measuring EF activity in vitro [54] After activity of EF in cell extracts was confirmed, HeLa cells were pelleted, sonicated then treated for 10 minutes with buffer alone, 500ng EF, 500ng EF plus 500ng LF, or with 500ng EF after pre treatment of HeLa cells with 500ng/mL LF plus 500ng/mL PA at 37 C for 2 hours. The control sample showed no production of cAMP, while EF induced high levels of cAMP, as expected. Surprisingly, Hela cells that had b een pre treated with LT still showed high levels of EF activity in cell extracts and extracts that contained both LF and EF had cAMP levels comparable to EF treated cell extracts alone (Figure


47 2 6B ). These unexpected results show that cells must remain int act and LF is incapable of inhibiting cAMP production in cell extracts. 2 D Gel Analysis of ET and ET plus LT HeLa C ells Because previous results indicated no inhibition of cAMP production by LT in cell extracts we predicted a potential post translation al modification may be playing a role in the ability of LT to inhibit of cAMP production. It is known that LT inhibits the MAPKK pathways which phosphorylate downstream components. With this in mind, a 2 D gel was employed to help identify intermediate proteins which exhibit a decrease in phosphorylation levels after dual bition of cAMP Hela cells were treated with either 500ng/mL EF plus 500ng/mL PA or with 500ng/mL EF plus 2000ng/mL PA plus 500ng/mL LF and subjected to isoelectric focusing before being run over SDS PAGE Results identified over 30 potential proteins (Tab le 1 1) These proteins are involved in a wide range of activities from transcriptional regulation, protein turnover, and regulation of the cytoskeleton to heat shock responses and glycolysis. Discussion The innate immune response is essential for successf ul clearance of invading pathogens. B. anthracis secretes the exotoxins ET and LT capable of impairing the host response during an anthrax infection. T he MAPKK signaling cascade is essential for successful production of host immune responses including oxid ative burst, pro in flammatory cytokine expression, and cell motility [72, 177] By cleaving all but one MAPKK, LT shuts down these signaling cascades. ET has also been shown to inhibit host cell responses including impairment of cytokine secretion phagocytosis and neutrophil chemokinesis [56, 178 180] Both ET and LT possess u nique catalytic activities that aid in B. anthracis survival within host cells. The current hypothesis on the effects of anthrax toxins is that i ncreased cAMP levels and inhibition of the MAPKK


48 signalin g cascade combine to decrease immune cell function and allow survival of B. anthracis within the host [181] During systemic anthrax infectio n s cells are exposed to both LT and ET. Studies to date have focused on the immunological consequences of either LT or ET. It is of interest that we now find that one toxin, LT, inhibits the actions of another, ET in a dose dependent manner (Figure 2 1A). This phenomenon cannot be attributed to cell death, as treatment for up to 4 hours with both toxins does not induce cell death (Figure 2 1C). One possible explanation for this effect could be that continuously hig h levels of cAMP induced by ET may be harmful to B. anthracis and therefore a mechanism to shut d own this production could provide a survival advantage. Because LT is known to block the M APKK pathway, it was intriguing to discover that blocking of the in dividual pathways via chemical inhibitors was able to block the production of cAMP. Both non competitive and competitive chemical inhibitors of ATP were employed to assure no indirect effects on cAMP production. We discovered that chemical inhibition of an y individual MAPKK pathway decreased cAMP production by ET suggesting that all three major pathways must be actively functioning to promote cAMP production (Figure 2 1D). The interaction between MAPKK pathways and cAMP is further supported by the observat ion that the ERK pathway can be activated by increased cAMP levels This finding suggests a potential feedback mechanism regulated by cAMP levels could be applicable to all MAPKK pathways [182, 183] Next, we determined if LT inhibition of cAMP affected mammalian adenylyl cyclases, in addition to ET, a bacterial adenylyl cylase. For these experiments, forskolin, a known inducer of mammalian adenylyl cyclase, was employed. Forskolin activates isoforms 1 8 of mammalian


49 adenylyl cyclases, while weakly activating isoform 9. Using HeLa cells, we found that LT inhibited forskolin induced cAMP levels and was dependent on the concentrations of LT (Figure 2 2C). We conclude that LT is capable of blocking not onl y ET induced cAMP levels, but also forskolin induced cAMP levels. Because the chemical inhibitors of the MAPKK pathway, SB203580, U 0126, and CI 1040, blocked ET induced cAMP production, we next determined if these inhibitors were also capable of blocking forskolin induced cAMP production. We found that all chemical inhibitors were able to block cAMP production induced by forskolin (Figure 2 2B). These experiments show that the MAPKK signal transduction pathways must remain intact in order to maintain succ essful production of cAMP by mammalian adenylyl cyclases. We are the first to report that the MAPKK pathways regulate the production of cAMP by both ET and forskolin. Mechanistically, it is important metalloprotease activity. Previous reports have indicated that LT can alter cell functions that are independent of its ability to cleave MAPKKs [184, 185] To address this concern, the metalloprotease activity of LT was blocked and cAMP levels were assessed It was found that pre treatment of LF with the metalloprotease activity GM 6001 blocked cleavage of MEK1, and also blocked its inhibitory effects on cAMP production (Figure 2 2C and Figure 2 2D). This finding is consistent with the hypothesis that cleava ge of MEKs is required fo r inhibition of cAMP production. Previous reports have shown LT is capable of inducing the release of ATP extracellularly. This study indicated that LT block s the phosphorylation of an ATP channel con nexin 43 that in turn, resulted in an opened channel and release of ATP [175] This release in ATP led to a six fold increase in extracellular levels. Because the s ubstrate for cAMP is ATP, it


50 was imperative to determine if these studies using mice macrophages would translate mechanistically to human cells. Using HeLa cells, we found that ATP was not being secre ted f rom cells, as previously shown in mice macrophages (Figure 2 3A). We therefore concluded that the intracellular ATP pools were not being depleted by LT (F igure 2 3B) and the decreased cAMP production could not be explained by a loss of substrate. Alon g with depleted ATP levels, it was essential to determine if LT induces a release of cAMP. Previous studies of skeletal muscle cells treated with forskolin, have demonstrated a release of cAMP into the extracellular medium [186] This c ould be a plausable explanation for why intracellular cAMP levels are decreased after LT treatment. Using HeLa cells, we found that LT did not cause a release of cAMP outside of cells (Figure 2 3C). We conclude that the effects of anthrax LT are not due to the depletion of either ATP or cAMP. In the hopes of unravel ing the mechanisms behind LT inhibition of cAMP production cell extracts were used. EF was capable of i nducing cAMP levels in cell extracts even in the presence of LF or in cell extracts that had been pre treated with LT (Figure 2 6B). The findings indicate that cells must remain intact in order for c AMP product ion to be inhibited by LT Our findings rais ed another possibility that LT inhibition of cAMP production could be mediated by post translation modifications of one or more regulatory proteins. To determine potential candidates for this process, 2DIGE gel s of HeLa cell extracts were analyzed. Twenty inhibition of cAMP (Table 1 1). These candidate proteins are involved in actin assembly, glycolysis, stress response, and heat shock responses. Of interest is a protein involved in the regulation of phosphatases known as immunoglobulin binding protein 1 (IGBP 1) Phosphatases are enzymes which remove phosphate groups from other proteins/enzymes. IGBP 1 is associated with a family of


51 seri ne/threonine phosphatases known as protein phosphatase 2A. T his family of phosphatases play a role in the regulation of various signal transduction cascades including MAPKK signaling, cell cycle regulation and cell morphology and development [187 193] EF has been shown to be associated with the endosomal membrane after translocation, while mammalian adenylyl cyclases remain within lipid rafts at the plasma membrane [194 197] By disrupting adenylyl cyclase localization with the membran e, LT may be diminishing enzyme activity It is interesting that multiple proteins w ere identified using 2DIGE that play a role in lipid transport, lipid metabolism, and membrane structure. These proteins include d annexin A1, apolioprotein L2, endoplasmic reticulum resident protein 29, and enoyl CoA hydratase. By disrupting the membrane structure required for successful enzyme activity, LT may be inactivating adenylyl cyclase activity. Both endosomes and lipid rafts are in close contact with the actin cytoskeleton. Multiple proteins involved in actin regulation were identified by 2DIGE after dual toxin treatment. These proteins included i soform 1 of LIM and SH3 domain protein 1 t ropomodulin 3 isoform b eta of LIM domain and actin binding protein 1 p irin isoform 1 of p lectin h eat shock protein beta 1 Src sub strate cortactin and isoform 2 of f ilamin A The se proteins modify the actin cytoskeleton by regulating actin elongation and the branching of actin filaments (Table 1 1). D isruption of these actin regulatory proteins after dual toxin treatment could be pr event ing adequate spatial localization of adenylyl cyclases, thereby rendering them inactive Here, we have identified numerous protein targets modified by dual toxin treatment. Further investigations into how these proteins contribute to cAMP regulation will help further our understanding of this complex process. The proteins identifie d here have the potential to


52 provide new therapeutic targets for the treatment of infections that utilize cAMP, and may also provide new treatment options for other diseases associated with aberrant cAMP responses.


53 Table 1 1 Description of proteins excised for identification after treatments with ET + LT versus ET alone. ID refers to the spot(s) sent for identification. Some spots were pulle d together to assure higher protein levels for the identification process ID Spot Number Average Ratio after ET + LT pI MW 1 533 1.04 5.52 81213 2 534 1.25 5.54 81529 3 1307 1.42 5.93 42715 3 1313 1.25 5.95 42715 4 1429 1.31 5.34 37775 4 1435 1.09 5.47 37775 5 1565 1.35 6.02 32915 5 1568 1.46 5.95 32915 6 1573 1.69 6.27 32862 6 1574 1.11 6.45 32705 7 1741 1.36 5.85 24537 7 1743 1.44 5.78 24468 7 1745 1.14 5.88 24676 8 1807 1.5 5.69 22804 8 1809 1.06 5.84 22777 8 1817 1.14 5.74 22645 9 1929 1.4 4.36 16806 9 1931 1.09 4.49 16774


54 Table 1 2 Description of proteins differentially expressed in HeLa cells after 4 hour treatment with dual toxin LT +ET versus ET alone Fold change Protein Accession Number MW Function 1.69 Isoform 1 of LIM and SH3 domain protein 1 IPI00000861 30 Regulation of dynamic actin based, cytoskeletal activities l.31 Tropomodulin 3 IPI00005087 40 Blocks the elongation and depolymerization of actin filaments 1.04 Isoform Beta of LIM domain and actin binding protein 1 IPI00008918 85 Increases actin stress fibers and inhibits membrane ruffling 1.50 Peroxiredoxin 4 IPI00011937 31 Regulates the activation of NF kappa B in the cytosol 1.42 Adenosylhomocysteinase IPI00012007 48 1.50 Serine/Arginine rich splicing factor 9 IPI00012340 26 Required for pre mRNA splicing 1.69 Pirin IPI00012575 32 May play a role in the regulation of cell migration 1.69 Isoform 1 of Heterogenous nuclear ribonucleoprotein H3 IPI00013877 37 __ 1.04 Isoform 1 of Plectin IPI00014898 532 Role in cytoskeleton structure 1.4 Prostaglandin E synthase 3 IPI00015029 19 Promoting disassembly of transcriptional regulatory complexes 1.31 Immunoglobulin binding protein 1 IPI00019148 39 Involved in regulation of phosphatases 1.50 Endoplasmic reticulum resident protein 29 IPI00024911 29 Processing of secretory proteins within the endoplasmic reticulum 1.50 Enoyl CoA hydratase IPI00024993 31 Lipid metabolism l.31 Cation dependent mannose 6 phosphate receptor IPI00025049 31 Transport of lysosomal enzymes to lysosomes


55 1.50 Heat shock protein beta 1 IPI00025512 23 Involved in stress resistance and actin organization 1.50 NADH dehydrogenase iron sulfur protein 3 IPI00025796 30 Functions in the transfer of electrons from NADH to the respiratory chain 1.04 Src substrate cortactin IPI00029601 62 Organization of the actin cytoskeleton and cell structure 1.69 Aldo keto reductase family 1 member C1 IPI00029733 37 Converts progesterone to its inactive form 1.46 Serine/threonine protein phosphatase PP1 beta catalytic subunit IPI000218236 37 Essential for cell division 1.46 Annexin A1 IPI00218918 39 Calcium/phospholipid binding protein which promotes membrane fusion and is involved in exocytosis 1.69 Glyceraldehyde 3 phosphate dehydrogenase IPI00219018 36 Role in glycolysis 1.69 L lactate dehydrogenase B chain IPI00219217 37 Role in glycolysis 1.69 Isoform M1 of Pyruvate kinase isozymes M1/M2 IPI00220644 58 Glycolytic enzyme 1.04 Isoform 2 of Filamin A IPI00302592 280 Promotes branching of actin filaments l.31 Serpin B6 IPI00413451 46 Protease inhibitor 1.04 Heat shock protein HSP 90 beta IPI0041676 83 Involved in stress response 1.69 Isoform 2 of Annexin A2 IPI00418169 40 Involved in heat stress response l.31 Isoform 2 of Suppressor of G2 allele of SKP1 homolog IPI00791573 38 Role in ubiquitination 1.46 Apolipoprotein L2 IPI00877964 37 Lipid transport


56 A.) B.) C.) D.) E.) F.) Figure 2 1. Effects of anthrax LT and MAPKKs inhibitors on cAMP production after treatment with anthrax ET. A.) Dose response of HeLa cells with increasing concentration of LT. Cells were treated with buffer alone (Control), 500ng/mL ET, or 500ng/mL ET with increasing concentration, 50ng/mL, 100ng/mL, 250ng/mL or 500ng/mL of LT. Error bars indicated the standard err or of means ( SEM ) of 3 different experiments. C.) cAMP levels after treatment of HeLa cells with buffer alone (Control), 500ng/mL ET or 500ng ET plus 500ng LT. B.) Percentage of viable HeLa cells after treatment with buffer alone (Control), 500ng/mL ET or 500ng ET plus 500ng LT. Error bars indicate the SEM of 2 experiments. D.) cAMP levels in HeLa cells after treatment with buffer alone (Control), 500ng/mL ET or 500ng ET plus inhibitors (SB203580, U 0126, or CI 1040). Error bars represent the SEM of 3 diffe rent experiments. E.) Confirmation of inhibition of cAMP in another cell line. cAMP levels in THP 1cells after treatment with buffer alone (Control), 500ng/mL ET or 500ng ET plus 500ng LT. D.) Confirmation of cAMP inhibition in primary cells. cAMP levels i n human monocytes after treatment with buffer alone (Control), 500ng/mL ET or 500ng ET plus 500ng LT.


57 A.) B.) C.) D.) Figure 2 2. Effects of the inhibition of LT metalloprotease activity on ET induced cAMP production. A.) HeLa cells were treated with buffer alone (Control), 500ng/mL ET, 500ng ET plus 500ng/mL LT, 500ng/mL ET plus 500ng/mL LT plus 44M GM 6001, or 500ng/mL ET plus 44 M GM 6001 and cAMP levels were determined. Error bars represent the SEM of 3 different experiments. B.) HeLa cells were treated with buffer alone (Control), 500ng/mL ET, 500ng ET plus 500ng/mL LT, 500ng/mL ET plus 500ng/mL LT plus 44M GM 6001, or 500ng/mL ET plus 44M GM 6001 and cleavage of MEK1 was measured using Western Blot analysis. C.) THP 1 cells were treated with buffer alone (Control), 500ng/mL ET, 500ng ET plus 500ng/mL LT, 500ng/mL ET plus 500ng/mL LT plus 44M GM 6001, or 500ng/mL ET plus 44M GM 6001 and cAMP levels were determined. Error bars represent the SEM of 3 different experiments. D.) THP 1 cells were treated with buffer alone (Control), 500ng/mL ET, 500ng ET plus 500ng/mL LT, 500ng/mL ET plus 500ng/mL LT plus 44M GM 6001, or 500ng/mL ET plus 44M GM 6001 and cleavage of MEK1 was measured using Western Blot analysis.


58 A.) B.) C.) D.) Figure 2 3. Effects of LT on the release of ATP or cAMP. A.) Extracellular ATP levels were measured in HeLa cells after treatment with buffer alone (Control), 500ng/mL ET, 500ng/mL ET plus 1% Triton, or 500ng ET plus 500ng LT. Error bars represent the SEM of 3 different experiments. B.) Intracellular ATP levels were measured in HeLa cells after treatment with buffer alone (Control), 500ng/mL ET, 500ng/mL ET plus 1% Triton, or 500ng ET plus 500ng/mL LT. Error bars represent the SEM of 3 different experiments C.) Extracellular cAMP levels were measured in HeLa cells after treatment with buffer alone (Control), 500ng/mL ET, 500ng/mL ET plus 1% Triton, or 500ng ET plus 500ng LT. Error bars represent the SEM of 3 different experiments. D.) Intracellular cAMP lev els were measured in HeLa cells after treatment with buffer alone (Control), 500ng/mL ET, 500ng/mL ET plus 1% Triton, or 500ng ET plus 500ng LT. Error bars represent the SEM of 3 different experiments.


59 A.) B.) C.) Figure 2 4. Effects of anthrax LT and inhibition of MAPKKs on cAMP production by Forskolin (Fsk). A.) cAMP levels in HeLa cells after treatment with buffer alone (Control), 10M Fsk or 10M Fsk plus 500ng LT. Error bars represent the SEM of 2 experiments. B) Inhibitio n of Fsk induced cAMP production by chemical inhibitor of MAPKKs in HeLa cells. HeLa cells were treated with buffer alone (Control), 10M Fsk or 10M Fsk plus inhibitors of MAPKKs (SB203580, U 0126, or CI 1040). C.) Dose response of HeLa cells treated with varying concentrations of LT. HeLa cells were treated with buffer alone (Control), 10M Fsk or 10M Fsk plus varying LT concentrations (50ng/mL, 100ng/mL, 250ng/mL or 500ng/mL). Error bars represent the SEM of 3 different experiments.


60 A.) B.) Figure 2 5. Adenylate cycla se activity of EF in HeLa cell e xtracts. A. ) and B.) Production of cAMP after treatment of HeLa cell extracts with buffer alone, 250ng/mL EF or 500ng/mL EF. cAMP levels were measured at 2 minutes, 10 minutes and 20 minutes af ter addition of EF showing highest activity of EF at a concentration of 500ng and at 20 minutes. Graphs show cAMP levels and are plotted in relation to time on the x axis (A) or treatment conditions (B). 0 10 20 30 40 50 60 2 minutes 10 minutes 20 minutes cAMP pmol/ 1 x 10^5 cells Hela Cell Extract Control EF 250ng EF 500ng 0 10 20 30 40 50 60 Control EF 250ng EF 500ng cAMP pmol/ 1 x 10^5 cells HeLa Cell Extract 2 minutes 10 minutes 20 minutes


61 A.) B .) Figure 2 6. EF activity in HeLa cell extracts with addition of LT. A.) cAMP produced in HeLa cell extract using increasing numbers of cells. Extracts were treated for 10 minutes with buffer a lone (Control) or 500ng/mL EF. B .) Production of cAMP after treatment of HeLa cell extrac ts for 10 minutes with buffer alone (Control), 500ng EF, 500ng EF plus 500ng LF, or pre treatment with LT for 2 hours followed by treatment of extracts with 500ng EF.


62 A.) B.) C.) Figure 2 7. Proteomic analysis of anthrax treated HeLa cells. A.) Gray scale image of ET treated HeLa cell total protein expressio n B.) Gray scale image of ET plus LT treated HeLa cell total protein expression C.) Gray scale image of spots excised for identification.


63 CHAPTER 3 TRANSCRIPTIONAL ANAL YSIS OF HUMAN MONOCY TES TO ANTHRAX LETHA L TOXIN Overview Monocytes play a pivotal role in clearance of infections by replenishing the macrophage and dendritic pools. Early studies using murine macrophages ha ve shown some strains which contain alterations in the kinesin motor protein Kif1C, show resistance to LT induced cytotoxicity [185, 198] The cytotoxicity induced in susceptible cells by LT is through inactivation of the MAPK, specifically the p38 pathway, causing cells to undergo apoptosis [199] Other studies using anthrax animal models have documented resistance to anthrax lethal toxin (L T) through depletion of host macrophages, suggesting that these cells play a critical role in anthrax LT induced lethality [66, 67] In human studies, the effects of LT on mononuclear cells have included suppress ion of cytokine responses by peripheral blood mononuclear cells, ind uction of macrophage apoptosis, and prevent ion of monocyte pro liferation and differentiation [153, 154, 200] Inhalation anthrax cases present clinical manifestations indicative of host immune collapse in humans and in nonhuman primate studies [201 203] However, more recent studies investigating human monocytes and macrophages have suggested human alveolar macrophages are resistant to LT, and undifferentiated human monocytic cell lines are resistant to LT induced death [153, 204] phages could help to explain the rapid onset of fatal symptoms and host demise during an inhalation anthrax infection, but the exact effects LT exerts on human monocytes, along with the mechanisms underlying the impairment of the host immune es, have yet to be fully determined.


64 The impact of LT on host gene expression will help to further elucidate the ways in which we treat and prevent anthrax. Studies using murine macrophages and LT have shown a broad range in transcriptional effects. This study concluded LT induced changes in macrophage inflammation, signaling, and transcription factors, along with changes in the immune response by macrophages including down regulation of CD137, shown to play a role in monocyte proliferation in response to LPS, and up regulation of plasminogen activator inhibitor type I, which results in fibrin deposits, massive imbalances in coagulation, and can lead to multiorgan failure [205, 206] This study is the first to determine direct human monocyte susceptibility, along with the analysis of the transcriptional responses, to anthrax LT. The mechanisms of LT impairment on human peripheral monocytes will help elucidate the roles monocytes contribute during the host im mune system collapse documented during an anthrax infection. The transcriptional analysis will serve to not only unravel the mechanisms behind the rapid onset of lethality documented in anthrax victims, but may provide new targets for controlling inflammation and enhancing host defense. Materials and Methods Monocyte Isolation and Toxin T reatment Human monocytes were isolated using a negative selection antibody technique followed by separation over a Ficoll gradient. Whole blood was collected by venous puncture from healthy human volunteers into 8mL vacutainer tubes containing Ficoll (BD Biosciences). The study followed US Department of Health and Human Services guidelines and was approved by the University of Florida Institutional Review Board. Healthy volunteers ranged in age from 24 58 years and included both male and females. Whole blood was incubated with a monocyte negative selection antibody (Stem Cell Technologies) for 20 min., centrifuged 1700 x g for 25 minu te s at


65 RT, no brake over. Monocytes were re suspended in 10mL RPMI (Mediatech) complete media, centrifuged at 250 x g for 9 min. to remove p latelets, and re suspended to 7 9 x 10 5 cells/mL in RPMI. Monocytes were used immediately following isolation. Monocyt es were treated with 500ng/mL LF and 500ng/mL PA for 4 hours at 37C while rotating in a cell inverter to prevent the cells from clumping. Toxin Purification Lethal factor ( LF ) and protective antigen ( PA ) were kind gifts from Dr. Conrad Quinn (Center for Disease Control) and purified as previously described [1 73] Both PA and LF were purified from culture supernatants of B. anthracis cultures. Bacterial culture media was filtered through a 0.22 M filter followed by diethylaminoethyl cellulose (DEAE) anion exchange chromatography. The toxins were then subjec ted to gel filtration and hydrophobic interaction fast protein liquid chromatography (FPLC), as previously described [173] Cultures of 15 liters were found to produce approximately 8mg of PA and 13mg of LF. Toxin purity was assessed using coomassie blue staining and yielded 90% purity. Monocyte Purity an d Apoptosis Analysis Monocyte apoptosis was assessed using Annexin V FLUOS Staining Kit (Roche), in Purified monocytes were inverted at 37C with 500ng/mL LF and 500ng/mL PA for 4 hours, stained with CD 14 Pac Blue (BD Biosciences), Annexin V Fluorescein and propidium iodide The cell population was gated first for CD14 Pac Blue followed by analysis of the relative amount of Annexin (FL1) and PI (FL2) using flow cytometry FACScan (BD) The same gating parameters were used for all samples and 10,000 cells were collected and analyzed by FCS Express (De Novo).


66 MEK Cleavage Purified monocytes were incubated at 37 C with 500ng/mL lethal toxin for 4 hours. Cells were lysed in lysis buffer (1% Triton X 100, 50mM TrisCl, 150mM KCl, 50mM EDTA, 0.2% NaA2, 200mM imidazole, 100mM NaFl, 100mM Na3VO4) plus complete mini protease in hibitor cocktail tablet (Roche), sonicated, and protein concentrations were determined using bicinchoninic assay (Pierce). Forty micrograms of protein was separated by 10% SDS PAGE gel (Pierce), transferred to a Polyvinylidene fluoride ( PVDF ) membrane (Bio rad) and probed for MEK1 (Upstate) at 1:1000 overnight at 4C, washed in TBS t and incubated with 1:10,000 goat anti rabbit (Sigma) for one h our at room temperature Membranes were washed, and detected using SuperSignal Chemiluminescence detection system (Pierce). Membranes were then stripped and probed overnight with 1:1000 MEK3 antibody (Santa Cruz). actin (Sigma) was used to check consist ent loading amounts. RNA Isolation Purified monocytes from 4 healthy volunteers were incubated at 37 C with media alone or with 500ng/mL LF plus 500ng/mL PA for 4 hours at 37C while rotating in a cell inverter to prevent the cell clumping. Total RNA was collected using RNAeasy mini kit (Qiagen) Samples were lysed, homogenized using the QIAshredder and ethanol was added provide optimal binding conditions. The lysate was loaded onto the RNeasy silica membrane and all contaminants were washed out of the co lumn. Pure concentrated RNA was eluted using 30L water. RNA quantity and quality was assessed using the A260/A280 ratio measured using NanoDrop (Thermo Scientific) technology. Microarray Procedure One hundred nanograms of total RNA was labeled using Affy metrix Gene Chip 3' IVT Express Kit for each replicate. Amplified labeled RNA was purified, fragmented, then


67 hybridized for 16 hours on Affymetrix Gene Chips (HG U133 plus 2.0) representing approximately 22,000 well characterized human genes. Arrays were washed using Affymetrix Gene Chip Fluidics Station FS450 and scanned using Gene Chip Scanner 3000 7G. Microarray Analysis Low level analysis was performed using dChip modeled based expression matrix (dChip 2007 (DNA Chip Analyzer), Build da te: Jan 4, 2008). Unsupervised analysis probes sets whose hybridization signal intensity exhibited a coefficient of variation of greater than 0.5 were analyzed by unsupervised hierarchical cluster analysis using algorithms implemented in dChip. Supervis ed analysis sig nificant probe sets between treatment groups were identified using a paired t test (by donor) at a significance threshold of p < 0.001. Leave one out cross validation using 4 prediction models was used to test the ability of probe sets sig nificant at p < 0.001 to distinguish between the treatment groups. Microarray analyses were done using dCHIP and BRB Array Tools by Richard Simon ( ArrayTools.html). The microarray data for this study was deposited in the Natio nal Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) [30] with accession numbers GSM848717 through GSM 848724. The microarray data are also available in a series with accession number GSE34407. Quantitative Real T ime PCR (qRT PCR) RNA was collected using RNAeasy mini kit (Qiagen), quantitated using a Nanodrop system (Thermo Scientific), and 233g total RNA was used for cDNA synthesis using Super Script III First Strand Synthesis (Invitrogen). cDNA was quantitated using SYBR Green Ju mp Start Taq Ready Mix (Sigma) and 10mM forward and 10mM reverse primers were used for each indicated reaction. Prim ers used were as follows: ACTB forward TCACCGAGCGCGGCT, ACTB reverse TAATGTCACGCACGATTTCCC, GAPDH forward


68 GGTGAAGGTCGGAGTCAACG, and GAPDH re verse AGAGTTAAAAGCAGCCCTGGTG. All other primers are listed in Table 3 1. Reactions were run on the MJR Opticon Continuous Fluorescence detector (Bio Rad) and analyzed with Opticon Monitor Software 1.08 (Bio Rad). Results Microarray S etup Human peripheral monocytes were treated for 4 hours with 500ng/mL LF + 500ng/mL PA or media alone, and microarray analysis was performed using four biological replicates from healthy volunteers. A total of 8 microarray hybridizations were employed and analyzed on Affymetr ix Gene Chips (HG U133 plus 2.0). The chips contained 54,675 probe sets and identified multiple differentially regulated pathways and genes by human peripheral monocytes after LT treatment. Monocyte Purity and A poptosis In order to first determine monocyt e cell purity, isolated cells were analyzed using flow cytometry and gated using forward and side scatter, along with the monocytic marker, CD14. It was found that monocytes were isolated with a >85% purity ( Fig u re 3 1A and 3 1B) Because previous reports have documented LT induced cell apoptosis, it was important to assure the transcriptional response of LT treated monocytes would be indicative of responses to LT outside an induction of apoptotic response genes. Th is was accomplished through the analysis of the necrosis and apoptosis markers, propidium iodide (PI) and Annexin V, on human peripheral monocytes. Using flow cytometry, it was found that human peripheral monocytes showed 99 % viability after a 4 hour treat ment of LT (Figure 3 1C and 3 1D) Susceptibility to Anthrax LT In order to explore the actions of LT on human peripheral monocytes, a Western Blot analysis was performed and MEK1, along with MEK3, cleavage was determined after a 4 hour


69 treatment with LT. It was found that human peripheral monocytes were susceptible to the actions of MEK cleavage by LT (Figure 3 1E) actin was used to assure equal loading controls. Unsupervised Analysis Unsupervised hierarch ical analysis was used to assess the noise in the array experiments. First, probe sets whose signal intensity varied most in the data set were selected by applying a variation filter. Probes sets which displayed a coefficient of variation of greater than 0 .5 were subjected to hierarchical analysis. The clustering dend r ogram showed the major node of separation between control and LT treated samp les (Figure 3 2A ). To identify specific genes responsive to LT treatment, a paired t test (by donor) was performed at a significance threshold of p < 0.001. Genes specified by 820 probe sets were found to be significant among the treatment groups. The hierarchical cluster pa ttern of the significant probe sets is shown (Figure 3 3A ). Of these probe sets, multiple gene products known to play a role in monocyte function were discovered (Figure 3 2B ). The ability of probe sets significant at p < 0.001 to function as a classifier between treatment groups (LT treated vs. control) was established by leave one out cross validation and Monte Carlo simulations. Using 4 different prediction models, the classifier performed flawlessly. Of the significant genes identified, many are known t o play a role in monocyte function (Figure 3 2C ). Pathway Analysis Using the Gene Set Expression Comparison Analysis, as implemented in BRB Array tools, the Biocarta pathways which were associated with the differentially regulated genes were identified. O ver 60 differentially regulated pathways were discovered in monocytes in response to LT treatment. As expected, the most significant pathway affected by LT treatment was the MAPK signaling pathway, with the p38 MAPK signaling pathway being most impacted wi th 103


70 genes affected (Figure 3 3 B ). Additional pathways altered by LT at the p < 0.001 significance level included the IL 18, Toll Like Receptor, IFN alpha, and G Protein Family signaling pathways. It is interesting to note that a previous study measurin g the transcriptional response of human alveolar macrophages to anthrax spores detected an activation of the TLR pathways [207] and our results indicated anthrax LT targets multiple genes within the TLR signaling pathway (Figure 3 3 B ). Genes Associated with Monocyte F unction RGS14 is a protein involved in the regulation of G protein signaling through attenuation of G protein heterotrimer signaling, thereby inactivating this signaling cascade. The Affymetrix microarrays revealed that RGS14 expression in LT treated monocytes sho wed a 6 fold increase in expression (Table 3 1). This is a potentially significant finding in that RGS14 inhibits G proteins important for chemotaxis. Therefore LT could be impairing chemotaxis not only by blocking Hsp27 phosphorylation through disruption of the P38 pathway [76] but also by inducing the over expression of RGS14, thereby inhibiting G protein mediated signaling required for actin based motility. RGS14 expression has been shown to be down regulated during the maturation of monocytes to dendritic cells [208] and over expression of this G protein regulator would be expected to block monocyte maturation. RGS14 levels are also known to decrease in dendritic cells exposed to Lei shmania major or Toxoplasma gondii suggesting that RGS14 down regulation may be an important step in a normal immune response, and up regulation of RGS14 [209] Three chemokine receptors were also altered after LT treatment, suggesting that LT may be inducing functional defects in monocyte response signaling. IL 8 receptor beta (CXCR2) was up regulated after LT treatment (Table 3 1). CX CR2 transduces signaling through a G protein


71 activated second messenger system. This receptor is important for monocyte transendothelial migration, and up regulation of CXCR2 could serve to enhance the delivery of monocytes to tissues.IL 1 receptor type II (IL 1R2), was found to be markedly down regulated. IL1 R2 is a decoy receptor for IL 1 that functions either at the cell surface or in a soluble form [210] The decreased e xpression of the decoy receptor would presumably increase IL 1a levels and increase the febrile response of the host potentially at least in part explaining the high fever that common accompanies systemic anthrax [21 1] CCR5 is a receptor for the monocyte chemokines RANTES and MIP. The down regulation of CCR5 by LT could reflect an inability of toxin treated monocytes to differentiate into macrophages [212] (Table 3 1). In addition to an alteration in the chemokine response by LT, an additional enzyme, heparanase (HPSE), was found to be decreased in LT treated human monocytes. This enzyme is an endoglycosidase that degrades he parin sulfate, resulting in disassembly of extracellular barriers required for cell migration [213] Heparanase has also been postu lated to play a role in inflammation [214] and our results showed a 2.6 fold decrease in heparanase gene expression (Table 3 1). One study ha s concluded that an in vivo siRNA against heparanase, along with an inhibitor of its enzymatic activity, results in a diminished inflammatory response [215] Thus LT mediated inhibition of heparanase expression could also contribute to the inhibition of the host immune response during an anthrax infection. Microarray Validation by qRT PCR In order to confirm the microarray data, an external verification method using quantitative real time PCR was utilized. The ei ght genes corresponding to RGS14, IL8RB, TLR5, PPM1H, CD47, SYK, CCR5, and IL1R2 were chosen for microarray confirmation due to their statistical significance and roles in immunity CCR5 and IL1R2 were confirmed to be down regulated at 4 hours after LT tre atment, reinforcing the microarray data, while the other six genes were up


72 regulated, again confirming the microarray data (Table 3 2). Results were performed in duplicates and fold values were normalized to GAPDH. Discussion There has been some conflictin g data suggesting monocytes, along with monocyte derived cells, are not susceptible to the actions of anthrax LT. One study utilized human monocytic cell lines and found that undifferentiated monocytic cells did not undergo LT induced cytotoxicity, while t he differentiated cells were susceptible [153] Another study investigating human alveolar macrophages (AM) found that these cells were relatively resistant to the actions of LT. This study ascertained that LT failed to suppress human AM cytokine responses cleave MEKs, and induce apoptosis [204] Our investigations show human peripheral monocytes are susceptible to the actions of anthrax LT and do not undergo LT mediated cytotoxicity after a four hour toxin treatment. We also find that LT induces several genes involved in previously unid entified pa thways including the TLR pathway, IFN alpha pathway, and G Protein family signaling pathways. The identification of several previously unappreciated gene products including RGS14, IL8 receptor beta, CD47, TNF ligand, IL 16, Syk, CCR5, and IL 1 receptor II adds to our understanding of how LT impacts the immune response. Our pathway analysis reveals that anthrax LT targets multiple normal immune regulatory pathway s that would be expected to protect the host against anthrax infection. Our findings should encou rage further investigation into how these pathways converg e functionally to impair normal monocyte function and these discoveries promise to provide many new insights into host defense and the regulation of inflammation.


73 Table 3 1. Predicted effects of LT on monocyte function Gene Microarray Effects RGS 14 5.61 Blockade of monocyte maturation to dendritic cells, inhibition of chemotaxis CXCR2 5.04 Increased monocyte transendothelial migration into tissues HPSE 2.58 Diminished inflammatory response CCR5 2.33 Reduced responsiveness to the inflammatory mediators RANTES, MIP1 beta IL1R2 12.5 Increased IL 1 alpha responsiveness and increased fever




75 Figure 3 1. Monocyte purity, apoptosis, and susceptibility to LT Red = CD14 plus monocytes. Green = CD14 lymphocytes. A.) Forward and side scatter analysis of purified fixed human monocytes showing the monocyte population as compared to total population. B.) CD14 Pacific Blue and forward scatter analysis of fixed purified human monocytes showing >85% monocytes. C.) PI and Annexin FITC analysis of CD14 plus monocytes after a 4 hour incubation showing 99.0% viable cells indicated in quadrant 3. D.) PI and Annexin FITC analysis of CD14 plus monocytes after a 4 hour LT treatment showing 99.1% viable cells indicated in quadrant 3. HeLa cells or human monocytes were left untreated or treated with 500ng/mL LT for 4 hours at 37C. Samples were lysed, ran on SDS PAGE, transferred to PVDF membrane, and probed with indicated antibodies. Both MEK3 and MEK1 we re cleaved by LT while control cells showed no MEK cleavage. actin loading controls shows equivalent loading of both control and LT treated cells.


76 Figure 3 2. Unsupervised microarray analysis A .) Hierarchical clustering dend r ogram showing similarities between expression patterns within each condition. Specimens were paired based on donor, using 4 separate donors as indicated in replica r1 through r4. B.) Significant genes (p < 0.001) up or down regulated after LT treatment, a long with their fold change, p value and probe ID. C.) Leave one out cross validation was used to calculate mis classification rate which yielded a 100% correct classification between pairs.


77 Figure 3 2. Continued


78 Figure 3 3. Supervised microarray analysis. A.) Hierarchical cluster analysis showing the 820 probe sets which were differentially expressed at the 0.001 significance level. The arrays clustering on the left are from control samples, whereas the cluster on the right shows the L T treated samples. Up regulated genes are shown in red and down regulated genes are shown in blue. B.) Biocarta pathway analysis showing the pathways most significantly affected by LT, along with the number of genes and p value within each pathway that wer e affected.


79 CHAPTER 4 ANTHRAX LETHAL AND E DEMA TOXINS FAIL TO DIRECTLY IMPAIR HUMA N PLATELET FUNCTION Overview Platelets are anuclear fragments of megakaryocytes that aid in hemostasis. Previous studies investigating rabbit platelets have shown that ET suppresses platelet aggregation, induces a rise in cAMP and activates Protein Kinase A (PKA) [167] Additional investigations have shown anthrax LT inhibits arachidonic acid induced who le blood aggregation, inhibits platelet P selectin expression, and increases mortality in mice receiving aspirin and rhodostomin [166] Other studies using anthrax animal models have documented severe hemostasis abnormalities including: hemorrhagic lesions, fibrin deposits, thrombocytopenia, increased prothrombin time, elevated activated partial thromboplastin time (APTT), vascular permeability pleural effusions, and decreased fibrinogen levels [65, 203] In human cases, hemorrhagic lesions, capillary and vascular lesions consisting of fibrin deposits, pleural effusion, blood vessel leakage, and disseminated intravascular coagulopathy (DIC) have been documented [202] These clinical manifestations suggest B. anthracis is capable of inducing severe defects in hemostasis; however, the exact mechanisms underlying these manifestations rem ain to be fully defined. Material and Methods Platelet Isolation and Toxin Treatment Human whole blood was collected by venous puncture from healthy volunteers into Aster Jandl anticoagulant, following US Department of Health and Human Services guidelines and approved by the University of Florida Institutional Review Board. Healthy volunteer donors (total of 6 subjects) ranged in age from 23 58 years, and included both males and females. Nine milliliters of whole blood was drawn into a 10cc syringe containi ng 1mL Aster Jandl


80 anticoagulant (85 mM sodium citrate, 69 mM citric acid, 111 mM glucose, pH 4.6) Human platelet rich plasma (PRP) was obtained by centrifugation of whole blood at 100 x g for 10 min and purified platelets were re suspended to 1 x 10 6 platelets/mL in Tyrode Hepes buffer ( 134 mM NaCl, 0.34 mM Na 2 HPO 4 2.9 mM KCl, 12 mM NaHCO 3 20 mM Hepes, 5 mM glucose, 1 mM MgCl 2 (pH 7.3) ) Platelets were treated with toxin as indicated. Up to 1g of ET and LT was used for a time of up to 12 hours. For mouse platelet studies, mice were anesthetized with CO 2, followed by cervical displacement. Cardiac puncture was performed and approximately 1mL of whole blood was obtained per mouse. PRP was obtained using the same methods as described above Cell Cultu re HeLa cells (ATCC) grams/L glucose supplemented with 10% fetal bovine serum (FBS) and 5% penicillin and streptomycin (Cellgro). Cells were grown to 75% confluence and used at a passage betwee n 5 20. THP 1 cells (ATCC) were grown in RPMI 1640 (Cellgro) supplemented with 10% fetal bovine serum (FBS) and 5% penicillin and streptomycin (Cellgro) and used at a concentration of 1 x 10 6 cells/mL. Chemicals Used Reagents used were thrombin receptor ag onist peptide (TRAP), forskolin (Fsk), and 3 isobutyl 1 methylxanthine (IBMX) (Sigma Aldrich), streptavidin conjugated DyLight 488 (Thermo Scientific), SB203580 (Calbiochem) and CD62P FITC (BD Bioscience). Toxins Lethal factor ( LF ) and protective antigen ( PA ) were kind gifts from Dr. Conrad Quinn (Center for Disease Control) and purified as previously described [173] Both PA and LF were purified from culture supernatants of B. anthracis cultures. Bacterial culture media was filtered


81 through a 0.22 M filter followed by diethylaminoethyl cellulose (DEAE) ani on exchange chromatography. The toxins were then subjected to gel filtration and hydrophobic interaction fast protein liquid chromatography (FPLC), as previously described [173] Cultures of 15 liters were found to produce approximately 8mg of PA and 13mg of LF. Toxin purity was assessed using coomassie b lue staining and yielded 90% purity. Edema factor (EF) was expressed and purified from E. coli and was a generous gift from Dr. Wei Jen Tang (University of Chicago) [53] E. coli cultures were induced for four hours with Isopropyl D thio galactoside ( IPTG ) and purified with a 50% Ni nitrilotriacetic acid resin, followed by Sepharose cation exchange purification and stored in 80C aliquots. Western Blot Analysis For Western blot analysis c ells were lysed in lysis buffer (1% Triton X 100, 50mM Tris H Cl, 150mM KCl, 50mM EDTA, 0.2% NaA2, 200mM imidazole, 100mM NaFl, 100mM Na3VO4) plus complete mini protease in hibitor cocktail tablet (Roche), sonicated, and protein concentrations were determined using bicinchoninic assay (Pierce). Forty micrograms of protein was separated by 10% SDS PAGE gel (Pierce), transferre d to a Polyvinylidene fluoride ( PVDF ) membrane (Bio rad) and probed for MEK1 (Upstate), TEM 8 (Abcam), or LRP6 (Santa Cruz). actin (Sigma) was used to assure equal loading amounts I ntracellular cAMP M easurements For cAMP analysis, platelets were treate d with cAMP agonists: 10M forskolin plus 100M IBMX for 20 minutes or varying concentrations of ET as indicated for 2 hours All incubations were carried out at 37C. Platelets were pelleted, lysed, and sonicated. Intracellular cAMP levels were measured using an enzyme linked immunoassay (Amersham Biosciences and Arbor Assays) a 96 well plate in duplicates following kit protocol [158]


82 Measurement of P selectin For P selectin expression, platelets were treated for 2 h ours with either 1000ng/mL EF, 1000ng/mL LT, 1000ng/mL PA, 1000ng/mL ET or 1000ng/mL LT at 37C for 2 hours or for 20 min at 37C with SB203580 (400M) or with Forskolin (10M) and IBMX (100M). Platelets were then stimulated with TRAP (30M) for 2 minutes, fixed in a 1:1 ratio of 3.7% formaldehyde probed for P selectin, and analyzed using FACScan ( BD) and FCS Express (De Novo) T he relative amount of FITC P selectin was determin ed using flow cytometry analysis using t he same gating parameters for all samples and a using a total of 10,000 cells. Toxin Binding and I nternalization PA was labeled with b iotin (Thermo Scientific), according to the manufacturer's instructions. THP 1 cells or human platelets were treated for 2 hours with 1000ng/mL PA biotin at 37C, 4C or with buffer alone. Cells were fixed in a 1:1 ratio of 3.7% formaldehyde, probed with F ITC streptavidin and analyzed using FACScan (BD) and FCS Express (De Novo) The relative amount of PA binding and internalization was determined using the same gating for either platelets or THP 1 cells. A total of 10,000 cells were analyzed. Anthrax Rece ptor E xpression For surface expression of LRP6 and TEM8/CMG2, human platelets or THP 1 cells were fixed in a 1:1 ratio of 3.7% formaldehyde incubated for 1 hour with primary antibodies against either isotype control, TEM8/CMG2 or LRP6, followed by the sec ondary Alex 488 anti rabbit IgG antibody. All experim ents were performed in triplicate, using a minimum of three platelet donors for each study. Results were analyzed using Accuri C6 (BD Biosciences) and FCS Express (De Novo) Fold changes in mean fluoresc ent intensity of anthrax receptors: TEM8/CMG2 and LRP6 in THP 1 cells and human platelets were determined by comparing each sample to its isotype control.


83 Results LT Activity in Human P latelets and HeLa cells HeLa cells were treated with 500ng/mL LT. Because LT is known to cleave the N terminus of MEK and prevent phosphorylation of a downstream substrate, Hsp27, a Western Blot was performed to determine LT activity. LT did not cleave MEK1 or prevent Hsp27 phosp horylation in human platelets (Figure 4 1A and 4 1B), while HeLa cells were susceptible to MEK1 cleavage after LT treatment (Figure 4 1B). ET Activity in Human and Mouse P latelets We next sought to determine the effects of ET on human and mouse platelets. It is well documented ET increases intracellular cAMP levels [54] ; thus, measurement of cAMP after ET treatment is an additional assay used to measure toxin entry and activity. Treatment of human platelets with increasing concentrations of ET, surprisingly, failed to increase intracellular cAMP levels, while platelets t reated with the positive control Fsk/IBMX, demonstrated at least a 5 fold increase in cAMP (Figure 4 1C). Mouse platelets also failed to show an increase in cAMP levels after a 500ng/mL treatment of ET, while the positive control lead to an increase in cAM P levels (Figure 4 1D). Based on these known anthrax toxin activities, we demonstrate here that anthrax LT and ET do not directly affect platelets. Toxin Binding and I nternalization To determine if a lack of cellular responses to anthrax toxin was due to i neffective toxin internalization or binding, a PA biotin conjugate was utilized. Purified platelets and THP 1 cells were treated with PA biotin at 4 C, to determine toxin binding, or 37 C, to determine toxin internalization. PA biotin was probed with str eptavidin FITC, followed by flow cytometry analysis. THP 1 cells showed an increase in PA binding at 4C and subsequent warming to 37C revealed internalization of the toxin (Figure 4 2C ), while purified platelets failed to exhibit PA


84 binding at 4C, or in ternalization at 37C (Figure 4 2B ). The failure of PA to bind to the platelet surface indicated a defect in anthrax toxin binding to its cognate receptor. P selectin Expression After Toxin T reatment To determine the direct functional significance of LT an d ET on platelet activation, we measured platelet P selectin expression after toxin treatment. P selectin is a glycoprotein that is for platelet activation [216] Platelets were treated with anthrax toxins, followed by activation with TRAP, a known P selectin stimulus, and P selectin levels were determined. Pre treatment with both Fsk/IBMX, that represents a positive control for ET by raising intracellular cAMP levels, and SB203580, whic h represents a positive control for LT by preventing activation of the p38 pathway, inhibited TRAP induced P selectin surface expression, while pre treatment with LT or ET failed to block TRAP induced P selectin expression on human platelets (Figure 4 2A). P selectin surface expression is an important component for shear induced aggregation and aggregate formation of platelets. These results indicate neither LT nor ET directly inhibit TRAP induced platelet activation. Expression of Anthrax R eceptors We next sought to determine if the anthrax receptors, TEM 8 or CMG 2, or the co receptor LRP6, were present on human platelets. LRP6 is required for anthrax toxin lethality and has been shown to play a role in toxin binding and internalization [217] Western blot analysis confirmed the presence of the anthrax receptors in human platelets (not shown). Flow cytometry was utilized to 1 cells were used as a positive control and showed significantly high levels of the anthrax receptors, TEM8 and CMG2, along the co receptor LRP6, compared to isotype control (Figure 3 2B), while human platelets exhibited low levels of TEM8/CMG2, and displayed no surface expression of LRP6 (Figure 4


85 3 C). Human platelets demonstrated two populations of TEM8/CMG2 surface expression. One population (47%) exhibited a 1.02 fold increase in TEM8/CMG2 expressio n, and a second population (53%) displayed a 9.00 fold increase in TEM8/CMG2 expression, while LRP6 expression was at a 1 .25 fold increase THP 1 cells exhibited a 39.5 fold increase in TEM8/CMG2 receptor expression and a 6.74 fold increase in LRP6 surface levels. We conclude human platelet do not express the anthrax co receptor LRP6, and have reduced surface expression of TEM8/CMG2. Discussion Hemostatic abnormalities have been well documented during anthrax infections, but the precise underlying mechanis ms have yet to be identified. Pathologic findings, including hemorrhagic lesions, fibrin deposits and prolonged clotting times, suggest a defect in platelet function [202, 203] Based on our extensive analysis of the interaction of anthrax toxin w ith human platelets, we conclude that both anthrax LT and ET do not have a direct effect on human platelet function. We demonstrate here that anthrax LT failed to cleave MEK1 and did not prevent phosphorylation of a downstream substrate, Hsp27, indicating LT has no direct effects on human platele ts. ET was also unable to increase intracellular cAMP levels, which is a well known activity of this toxin [54] Functional studies revealed that pre treatment of human platelets with LT or ET failed to inhibit TRAP induced P selectin surf ace expression, which is required for platelet aggregation [218] indicating that neither LT nor ET can directly impair platelet the component required for platelet aggregation. A nthrax PA failed to bind to human platelets, an initial event critical for entry of LT and ET. This led us to speculate whether human platelets expressed the anthrax toxin receptors. CMG2 and TEM8 are the two receptors known to facilitate toxin entry into cells, while LRP6, a


86 co receptor is also required for entry of the toxins [217, 219 221] We found human platelets exhibited low levels of the TEM8 and CMG2 anthrax receptors and displayed no surface expression of the co receptor LRP6 Anthrax LT and ET therefore, are not able to directly affect human platelets due to the fact that they lack the anthrax receptors. This indicates that the toxins are unable to enter into platelets and have no direct catalytic activity towards these cells. be indirectly contributing to the haemostatic abnormalities documented in anthrax victims. It has been reported that LT induces vascular dysfunction, depletes anti thrombin levels, induces a loss of cytoskeletal integrity, and disrupts the cadherin junctional complexes resulting in loss of intercellular contacts [222, 223] Additional anthrax proteolytic enzymes have also been identified from B. anthracis an d have been shown to play a role in: impairing fibrinolysis, decreasing plasma D dimer circulating levels, cleaving von Willebrand Factor, and impairing platelet aggregation, suggesting bacterial components outside of LT and ET are contributing to hemorrha ge and thrombosis during an anthrax infection [224] This is the first study to demonstrate that LT and ET do not have a direct effect on human platelet function. These findings should guide future investigators to focus on alternative mechanisms to explain defective hemostasis in s ystemic anthrax.


87 Figure 4 1 Effects of LT and ET on human platelets. (A) Western blot showing phosphorylated Hsp27 in human platelets treated with 500ng/mL LT for 4 hours at room temperature and stimulated with 30M TRAP for 2 minutes or left unstimulated Blots were stripped and re probed with a primary antibody to total Hsp27 to show equal loading. (B ) Western blot showing MEK1 in human p l atelets or HeLa cells treated with 500ng/mL LT for 4 hours at room temperature or left untreated Blots were stripped and re actin to show equal loading. (C and D) E nzyme linked immunoassay measuring intracellular cAMP levels in human platelets (C) treated with 50, 35 0, or 500 ng/mL ET for 2 hours at 37C Negative control platelets were treated with 500ng/mL EF or 500ng/mL PA for 2 hours at 37C. Positive control platelets were treated with Fsk (10M) and IBMX (100M) for 20 min at 37C. Mouse platelets (D) were treated with 500ng/mL E T for 2 hours at 37C Error bars indicate SEMs from three separate donors.


88 A.) B.) C.) Figure 4 2 Functional significance of ET and LT treated human platelet and anthrax receptor detection. (A) Flow cytometry measuring P selectin levels i n human platelets after 2 h our toxin treatment at 37C with either 1000ng/mL EF, 1000ng/mL LT, 1000ng/mL PA, 1000ng/mL ET or 1000ng/mL LT or for 20 min at 37C with SB203580 (400M) or with Forskolin (10M) and IBMX (100M). Platelets were then stimulated with TRAP (30M) for 2 minutes, fixed, probed for P selectin, and analyzed using FACScan (BD) and FCS Express (De Novo) (B and C ) Flow cytom etry measuring PA binding and i nternalization in THP 1 cells (C) or human platelets (B ) after 2 hour treatment with 1000ng/mL PA bioti n at 37C, 4C or buffer alone Cells were fixed in a 1:1 ratio of 3.7% formaldehyde, probed with FITC streptavidin and an alyzed using FACScan (BD) and FCS Express (De Novo)


89 A.) B.) C.) Figure 4 3 Anthrax receptor expression. Flow cytometry measuring anthrax receptor surf ace expression in THP 1 cells (B) or human platelets (A) Cells were fixed, probed for TEM8/CMG2, LRP6, or an isotype control, followed the secondary antibody anti rabbit Alexa488, and analyzed using Accuri C6 (BD Biosciences) and FCS Express (De Novo) (C ) Relative expression levels of mean fluorescent int ensity of anthrax receptors: TEM8/CMG2 and LRP6 in THP 1 cells and human platelets. The fold change in mean fluorescence intensities were calculated by comparing each sample to its isotype controls.


90 CHAPTER 5 FUTURE WORK Functional I mpairment of M onocytes by A nt hrax t oxins Peripheral blood monocytes play a pivotal role in linking the macrophage and dendritic pool s to the bone marrow. Monocytes are produced in the bone marrow, circulate in the periphery, and supply the tissues with mac rophages and dendritic cells (DCs). Mechanisms used to maintain the tissue pools of macrophages and dendritic cells include a continuous recruitment and differentiation of circulating peripheral blood monocytes. Recruitment of monocytes through the blood v essels from the circulation is termed diapedesis. Diapedesis occurs through two main steps: monocyte adhesion through integrin cross linking to the endothelium followed by migration from the periphery to the tissue. Previous studies have shown that ERK a nd the p38 pathways contribute to monocyte adhesion to the endothelium and subsequent activation [225, 226] This was accomplished through the activation of the ERK and p38 pathways following very late antigen 4 (VLA 4), LFA 1 (CD11a/CD18) and MAC 1 (CD11b/CD18) integrin binding and activation. During an anthrax infection, production of LT would block this MAPKK dependent activation leading to reduced recruitment of monocytes to areas of infection. Another important component of monocyte diapedesis is actin assembly. Previous studies using human neutrophils show LT inhibition of the p38 pathway leads to a sequest ering of an important actin component, Hsp27 [76] This leads to reduced neutrophil chemokinesis and chemotaxis. Other studies utilizing the p38 inhibitor SB203580 have shown decreased diapedesis in monocytes [227] This would indicate LT mediated blockage of monocyte diapedesis w ould subsequently reduce the recruitment of monocytes to areas of infection. Because LT production


91 by B. anthracis is also accompanied by ET, it would also be interesting to determine what role dual toxin treatment has on monocyte function Mechanism of cA MP Inhibition Many micro bes utilize cAMP to establish infections within a host. B. pertussis secretes an adenylate cyclase which is capable of inhibiting immune cell function, attributing to a lack in neutrophil response, an absence of fever, and a high in cidence of pneumonia [228] Without its adenylate cyclase toxin, B. pertussis has been shown to be avirulent in mouse models [229] Other studies usin g bacterial toxins which increase cAMP levels have shown inhibition of phagocytosis, decreased cytokine production, impaired chemotaxis, and decreased bacterial killing [230 233] We have shown LT inhibition of ET and f orskolin induced cAMP production. The mechanisms behind this inhibition would prove to have a broad impact on developing new treatment options for multiple pathogens which increase c AMP levels. Because LT inhibits the bacterial produced adenylyl cyclase of B. anthracis ET along with mammalian adenylyl cyclases, it seems the mechanism of inhibition would be a common component in both types of enzymes For in vitro activity, ET require s calmodulin in a calcium dependent manner [55] Looking at the requir ements for functional activity in both ET and mammalian adenylyl cyclase, a few common components are noted. Both adenylyl cyclases are regulated by calmod u l in sensitive to calcium and can be inhibited by nucleotid e analogues that mimic ATP. Add itionally, our results indicate the me chanism of cAMP inhibition is downstream of the MAPKK pathway. It is possible that the MA PKK pathway positively regulates cAMP production through calmodulin binding calcium concentration or an unknown intermediate component. Another possibly for cAMP inhibition by LT is through binding to the ATP site of adenylyl cyclases.


92 Here, we have shown that production of cAMP by ET and forskolin requires an intact MAPKK pathway. As LT concentrations were increased, cAMP levels were decr eased. This suggests that inhibition of the MAPKK pathways leads to a decrease in cAMP production. It was also shown that all chemical inhibititors of the MAPKK pathway inhibited cAMP production so the mechanism for this inhibition would have to be a compo nent downstream of all the pathways: p38, ERK and JNK. This is important in that all pathways are required for successful production of cAMP by both host mammalian adenylyl cyclases and the bacteria produced adenylyl cyclase ET. We also show t he substrate ATP, required for cAMP production, was not being secreted out of the cell but it may be possible that ATP is being prevented from binding to the adenylyl cyclases after MAPKK inhibition. ATP is required for successful production of cAMP. If LT is capable of causing a modification or induction of a component that bound to the substrate site of adenylyl cyclase, production of cAMP would be blocked. Previous studies have shown that blocking the substrate site on both ET and adenylyl cyclases block s p roduction of cAMP. The nucleotide analogue, adefovir, binds to the catalytic site of EF, blocking endog enous binding of the substrate ATP and inhibits cAMP production [52, 234, 235] Other studies show adenosine containing ligands capable of binding the ATP site on mammalian adenylyl cyclases block their catal ytic activity [235 239] Because these enzymes are able to be blocked at their site of ATP binding it may be possible that LT is causing a modification allowing binding to the catalytic site of adenylyl cyclases. We have also shown that cells must remain intact in order for LT to inhibit ET induced cAMP levels This may suggest membrane localization of adenylyl cyclases may be playing an important role in their regulation through an inter action between adenylyl cyclases and


93 membrane components. It has been predicted that after translocation out of the late endosomes, EF refolds in the cytosol side of the endosomal membrane, remaining associated with the membrane [240, 241] Mammalian adenylyl cyclases are also localized to the plasma membrane within li pid rafts [194 197] Th is could indicate LT is impairing these localization events required for both ET and mammalian adenylyl cyclases, possibly through a defect in cytoskeletal rearrangements. Remaining associated with the membrane may be a critical regulatory mechanism requir ed for adenylyl cyclases and through disruption of the actin cytoskeleton, this association may be diminished resulting in inactive enzyme activity. We have shown using 2 D DIGE analysis that over 30 proteins are differentially regulated after dual toxin t reatment, as compared to ET alone. The results yielded numerous proteins which were involved in actin regulation. This finding indicates a defect in the actin cytoskeleton through dysfunction of specific actin regulatory proteins after treatment with LT co uld be leading to diminished cAMP production Another possibility is a post translational event caused by LT which would be inhibiting the activity of ET. A potential intermediate protein may require phosphorylation by all three components of the MAPKK pathway in order for successful production of cAMP. C alcium play s a regulatory role in both ET and mammalian adenylyl cyclases The mamma lian adenylyl cyclase isoforms 1, 3 and 8 along with ET are se nsitive to regulation by calcium. One study investigating the effects of calcium on mammalian adenylyl cyclases activity in HeLa cells noted elevated calcium levels in HeLa cells treated with trichosanthin (TCS), a chemical which increases cytosolic calciu m, sup presses cAMP production through inhibition of adenylyl cyclase activity [242 244] The calcium requirements for EF have previously been studied. It is shown that physiological intracellular calcium levels or slightly elevated calcium


94 concentrations (0.1 0.4M) stimulate EF activity [245] Although, when calcium levels reach above 1M, EF activity is inhibited [172] If LT wa s causing an influx of calcium above physiological levels the inhibition of cAMP by LT could be explained. Calmodulin is a calcium sensor protein shown to regulate over 100 different proteins. In vitro activity of EF requires calmodulin for activity. The concentration of calmodulin for optimal [172] One study has shown LT requires calmodulin, as calmodulin inhibitors protect cells against the action of LT [246] LT may be sequestering calmodulin away from ET during intoxication, but no studies to date have investigated this mechanism. This could also explain inhibition of mammalian adenylyl cy c lases as isoforms 1,3 and 8 require calmodulin for their activity. Al though not all mammalian adenylyl cyclases require calmodulin, it may be possible that these isoforms could be contributing to the majority of cAMP production. Another relevant detail concerning LT inhibition of cAMP production is the fact that calmodulin contains phosphorylation sites shown to increase its affinity for its peptide [247] This is interesting in that EF and some mammalian adenylyl cyclases require calmodulin for activity. Another way LT may be blocking calmodu lin binding to adenylyl cyclases it the prevention of calmodulin phosphorylation via an intermediate component downstream of MAPKKs thereby, decreasing affinity for adenylyl cyclase Our results suggest a new area of investigation in which MAPKKs regulate the production of cAMP. These findings can potentially lead to new therapeutic interventions for pathogens manipulating host cAMP levels including V. cholera and E. coli as well as other diseases associated with overproduction of cAMP including certain cancers, heart failure, and neurodegenerative diseases. Our results indicate an overlap in which the MAPKK pathway


95 affects the important secondary messanger cAMP. We are the first to s how that an intact p38, JNK and ERK pathway are required for successful production of cAMP.


96 Figure 5 1 Mechanism of cAMP inhibition. Blocking the MAPKK signaling cascade leads to decreased production of cAMP. ET is an adenylyl cyclase which is blocked by LT and chemical inhibitors of the MEK pathway. Forskolin (Fsk) stimulates mammalian adenylyl cyclases (AC) and is also blocked by LT and chemical inhibitors.


97 LIST OF REFERENCES 1. CW Woods, K Ospanov, A Myrzabekov, M Favorov, B Plikaytis, DA Ashford: Risk factors for human anthrax among contacts of anthrax infected livestock in Kazakhstan Am J Trop Med Hyg 2004, 71 :48 52. 2. ME Hugh Jones, V de Vos: Anthrax and wildlife Rev Sci Tech 2002, 21 :359 83. 3. DC Dragon, DE Bader, J Mitchell, N Woollen: Natural dissemination of Bacillus anthracis spores in northern Canada Appl Environ Microbiol 2005, 71 :1610 5. 4. DM Klemm, WR Klemm: A history of anthrax J Am Vet Med Assoc 1959, 135 :4 58 62. 5. JH Dirckx: Virgil on anthrax Am J Dermatopathol 1981, 3 :191 5. 6. V Jay: The legacy of Robert Koch Arch Pathol Lab Med 2001, 125 :1148 9. 7. DM Morens: Characterizing a "new" disease: epizootic and epidemic anthrax, 1769 1780 Am J Public Health 2003, 93 :886 93. 8. D Zydowicz: Anthrax: a disease from antiquity visits the modern world Minn Med 1998, 81 :19 20. 9. PC Turnbull: Anthrax vaccines: past, present and future Vaccine 1991, 9 :533 9. 10. PS Brachman: Inhalation anthrax Ann N Y Acad Sci 19 80, 353 :83 93. 11. PS Brachman, SA Plotkin, FH Bumford, MM Atchison: An epidemic of inhalation anthrax: the first in the twentieth century. II. Epidemiology Am J Hyg 1960, 72 :6 23. 12. R Brookmeyer, N Blades, M Hugh Jones, DA Henderson: The statistical an alysis of truncated data: application to the Sverdlovsk anthrax outbreak Biostatistics 2001, 2 :233 47. 13. CC Penn, SA Klotz: Anthrax pneumonia Semin Respir Infect 1997, 12 :28 30. 14. Update: Investigation of bioterrorism related anthrax -Connecticut, 2001 MMWR Morb Mortal Wkly Rep 2001, 50 :1077 9. 15. BK De, SL Bragg, GN Sanden, KE Wilson, LA Diem, CK Marston, AR Hoffmaster, GA Barnett, RS Weyant, TG Abshire, et al: A two component direct fluorescent antibody assay for rapid identification of Bacillus anthracis Emerg Infect Dis 2002, 8 :1060 5. 16. CP Quinn, VA Semenova, CM Elie, S Romero Steiner, C Greene, H Li, K Stamey, E Steward Clark, DS Schmidt, E Mothershed, et al: Specific, sensitive, and quantitative enzyme linked immunosorbent assay for human immunoglobulin G antibodies to anthrax toxin protective antigen Emerg Infect Dis 2002, 8 :1103 10.


98 17. EW Koneman: Color atlas and textbook of diagnostic microbiology Philadelphia: Lippincott; 1979. 18. QN Myrvik, RS Weiser: Fundamentals of medical bacte riology and mycology 2nd edn. Philadelphia: Lea & Febiger; 1988. 19. FC Minett: Sporulation and viability of B. anthracis in relation to environmental temperature and humidity J Comp Pathol 1950, 60 :161 76. 20. W Dutz, E Kohout: Anthrax Pathol Annu 1971 6 :209 48. 21. M Schwartz: Cutaneous anthrax J Travel Med 2002, 9 :333. 22. JA Carucci, TW McGovern, SA Norton, CR Daniel, BE Elewski, S Fallon Friedlander, BD Lushniak, JS Taylor, K Warschaw, RG Wheeland: Cutaneous anthrax management algorithm J Am Acad Dermatol 2002, 47 :766 9. 23. P Khajehdehi: Toxemic shock, hematuria, hypokalemia, and hypoproteinemia in a case of cutaneous anthrax Mt Sinai J Med 2001, 68 :213 5. 24. TV Inglesby, T O'Toole, DA Henderson, JG Bartlett, MS Ascher, E Eitzen, AM Friedlander J Gerberding, J Hauer, J Hughes, et al: Anthrax as a biological weapon, 2002: updated recommendations for management JAMA 2002, 287 :2236 52. 25. M Doganay, A Almac, R Hanagasi: Primary throat anthrax. A report of six cases Scand J Infect Dis 1986, 18 :4 15 9. 26. ZA Kanafani, A Ghossain, AI Sharara, JM Hatem, SS Kanj: Endemic gastrointestinal anthrax in 1960s Lebanon: clinical manifestations and surgical findings Emerg Infect Dis 2003, 9 :520 5. 27. P Bhat, DN Mohan, H Srinivasa: Intestinal anthrax with b acteriological investigations J Infect Dis 1985, 152 :1357 8. 28. DR Nalin, B Sultana, R Sahunja, AK Islam, MA Rahim, M Islam, BS Costa, N Mawla, WB Greenough, 3rd: Survival of a patient with intestinal anthrax Am J Med 1977, 62 :130 2. 29. T Sirisanthana, AE Brown: Anthrax of the gastrointestinal tract Emerg Infect Dis 2002, 8 :649 51. 30. T Sirisanthana, N Navachareon, P Tharavichitkul, V Sirisanthana, AE Brown: Outbreak of oral oropharyngeal anthrax: an unusual manifestation of human infec tion with Bacillus anthracis Am J Trop Med Hyg 1984, 33 :144 50. 31. T Sirisanthana, KE Nelson, JW Ezzell, TG Abshire: Serological studies of patients with cutaneous and oral oropharyngeal anthrax from northern Thailand Am J Trop Med Hyg 1988, 39 :575 81.


99 32. N Navacharoen, T Sirisanthana, W Navacharoen, K Ruckphaopunt: Oropharyngeal anthrax J Laryngol Otol 1985, 99 :1293 5. 33. TM Koehler: Bacillus anthracis genetics and virulence gene regulation Curr Top Microbiol Immunol 2002, 271 :143 64. 34. G Personeu s, MS Cooper, RC Percival: Studies on an anthrax vaccine prepared from nonencapsulated variants of Bacillus anthracis Am J Vet Res 1956, 17 :153 6. 35. B Stewart, Y Zhang, CE Rose, Jr., JI Tokars, SW Martin, LH Franzke, MM McNeil: Health related quality of life in the Anthrax Vaccination Program for workers in the Laboratory Response Network Vaccine 30 :1841 6. 36. M Sterne: Avirulent anthrax vaccine Onderstepoort J Vet Sci Anim Ind 1946, 21 :41 3. 37. G Ivanovics: [Biology and antigenic structure of Bacil lus anthracis] Magy Tud 1958, 9 :17 33. 38. M Drysdale, S Heninger, J Hutt, Y Chen, CR Lyons, TM Koehler: Capsule synthesis by Bacillus anthracis is required for dissemination in murine inhalation anthrax EMBO J 2005, 24 :221 7. 39. S Heninger, M Drysdale, J Lovchik, J Hutt, MF Lipscomb, TM Koehler, CR Lyons: Toxin deficient mutants of Bacillus anthracis are lethal in a murine model for pulmonary anthrax Infect Immun 2006, 74 :6067 74. 40. L Andral, C Serie: [Case of symptomatic anthrax in a dog] Ann Inst Pasteur (Paris) 1954, 87 :738. 41. A Depaillat, J Lacoste, H Lombard: [Human anthrax and complex epizootic (cattle, swine, mink and dog)] Bull Acad Natl Med 1960, 144 :56 8. 42. C Redmond, GA Hall, PC Turnbull, JS Gillgan: Experimentally assessed public hea lth risks associated with pigs from farms experiencing anthrax Vet Rec 1997, 141 :244 7. 43. IF Keymer: Diseases of birds of prey Vet Rec 1972, 90 :579 94. 44. KR Klimpel, SS Molloy, G Thomas, SH Leppla: Anthrax toxin protective antigen is activated by a cell surface protease with the sequence specificity and catalytic properties of furin Proc Natl Acad Sci U S A 1992, 89 :10277 81. 45. L Abrami, M Lindsay, RG Parton, SH Leppla, FG van der Goot: Membrane insertion of anthrax protective antigen and cytoplas mic delivery of lethal factor occur at different stages of the endocytic pathway J Cell Biol 2004, 166 :645 51. 46. AM Friedlander: Macrophages are sensitive to anthrax lethal toxin through an acid dependent process J Biol Chem 1986, 261 :7123 6.

PAGE 100

100 47. C Pet osa, RJ Collier, KR Klimpel, SH Leppla, RC Liddington: Crystal structure of the anthrax toxin protective antigen Nature 1997, 385 :833 8. 48. E Santelli, LA Bankston, SH Leppla, RC Liddington: Crystal structure of a complex between anthrax toxin and its ho st cell receptor Nature 2004, 430 :905 8. 49. M Drysdale, A Bourgogne, SG Hilsenbeck, TM Koehler: atxA controls Bacillus anthracis capsule synthesis via acpA and a newly discovered regulator, acpB J Bacteriol 2004, 186 :307 15. 50. AM Firoved, GF Miller, M Moayeri, R Kakkar, Y Shen, JF Wiggins, EM McNally, WJ Tang, SH Leppla: Bacillus anthracis edema toxin causes extensive tissue lesions and rapid lethality in mice Am J Pathol 2005, 167 :1309 20. 51. VM Gordon, WW Young, Jr., SM Lechler, MC Gray, SH Leppla, EL Hewlett: Adenylate cyclase toxins from Bacillus anthracis and Bordetella pertussis. Different processes for interaction with and entry into target cells J Biol Chem 1989, 264 :14792 6. 52. RA Johnson, I Shoshani: Inhibition of Bordetella pertussis and Bacillus anthracis adenylyl cyclases by polyadenylate and "P" site agonists J Biol Chem 1990, 265 :19035 9. 53. P Kumar, N Ahuja, R Bhatnagar: Purification of anthrax edema factor from Escherichia coli and identification of residues required for binding to anthrax protective antigen Infect Immun 2001, 69 :6532 6. 54. SH Leppla: Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations of eukaryotic cells Proc Natl Acad Sci U S A 1982, 79 :3162 6. 55. SH Leppla: Bacil lus anthracis calmodulin dependent adenylate cyclase: chemical and enzymatic properties and interactions with eucaryotic cells Adv Cyclic Nucleotide Protein Phosphorylation Res 1984, 17 :189 98. 56. J O'Brien, A Friedlander, T Dreier, J Ezzell, S Leppla: E ffects of anthrax toxin components on human neutrophils Infect Immun 1985, 47 :306 10. 57. DL Confer, JW Eaton: Phagocyte impotence caused by an invasive bacterial adenylate cyclase Science 1982, 217 :948 50. 58. NS Duesbery, CP Webb, SH Leppla, VM Gordon, KR Klimpel, TD Copeland, NG Ahn, MK Oskarsson, K Fukasawa, KD Paull, et al: Proteolytic inactivation of MAP kinase kinase by anthrax lethal factor Science 1998, 280 :734 7. 59. R Pellizzari, C Guidi Rontani, G Vi tale, M Mock, C Montecucco: Anthrax lethal factor cleaves MKK3 in macrophages and inhibits the LPS/IFNgamma induced release of NO and TNFalpha FEBS Lett 1999, 462 :199 204.

PAGE 101

101 60. R Pellizzari, C Guidi Rontani, G Vitale, M Mock, C Montecucco: Lethal factor of Bacillus anthracis cleaves the N terminus of MAPKKs: analysis of the intracellular consequences in macrophages Int J Med Microbiol 2000, 290 :421 7. 61. G Vitale, R Pellizzari, C Recchi, G Napolitani, M Mock, C Montecucco: Anthrax lethal factor cleaves th e N terminus of MAPKKs and induces tyrosine/threonine phosphorylation of MAPKs in cultured macrophages Biochem Biophys Res Commun 1998, 248 :706 11. 62. TS Bragg, DL Robertson: Nucleotide sequence and analysis of the lethal factor gene (lef) from Bacillus anthracis Gene 1989, 81 :45 54. 63. CP Quinn, Y Singh, KR Klimpel, SH Leppla: Functional mapping of anthrax toxin lethal factor by in frame insertion mutagenesis J Biol Chem 1991, 266 :20124 30. 64. R Cordoba Rodriguez, H Fang, CS Lankford, DM Frucht: Anth rax lethal toxin rapidly activates caspase 1/ICE and induces extracellular release of interleukin (IL) 1beta and IL 18 J Biol Chem 2004, 279 :20563 6. 65. NC Culley, DM Pinson, A Chakrabarty, MS Mayo, SM Levine: Pathophysiological manifestations in mice ex posed to anthrax lethal toxin Infect Immun 2005, 73 :7006 10. 66. PC Hanna, D Acosta, RJ Collier: On the role of macrophages in anthrax Proc Natl Acad Sci U S A 1993, 90 :10198 201. 67. PC Hanna, BA Kruskal, RA Ezekowitz, BR Bloom, RJ Collier: Role of macr ophage oxidative burst in the action of anthrax lethal toxin Mol Med 1994, 1 :7 18. 68. SR Kuo, MC Willingham, SH Bour, EA Andreas, SK Park, C Jackson, NS Duesbery, SH Leppla, WJ Tang, AE Frankel: Anthrax toxin induced shock in rats is associated with pulm onary edema and hemorrhage Microb Pathog 2008, 44 :467 72. 69. SM Muehlbauer, TH Evering, G Bonuccelli, RC Squires, AW Ashton, SA Porcelli, MP Lisanti, J Brojatsch: Anthrax lethal toxin kills macrophages in a strain specific manner by apoptosis or caspase 1 mediated necrosis Cell Cycle 2007, 6 :758 66. 70. ED Boyden, WF Dietrich: Nalp1b controls mouse macrophage susceptibility to anthrax lethal toxin Nat Genet 2006, 38 :240 4. 71. A Agrawal, J Lingappa, SH Leppla, S Agrawal, A Jabbar, C Quinn, B Pulendran: Impairment of dendritic cells and adaptive immunity by anthrax lethal toxin Nature 2003, 424 :329 34. 72. RL During, W Li, B Hao, JM Koenig, DS Stephens, CP Quinn, FS Southwick: Anthrax lethal toxin paralyzes neutrophil actin based motility J Infect Dis 2005, 192 :837 45.

PAGE 102

102 73. JL Erwin, LM DaSilva, S Bavari, SF Little, AM Friedlander, TC Chanh: Macrophage derived cell lines do not express proinflammatory cytokines after exposure to Bacillus anthracis lethal toxin Infect Immun 2001, 69 :1175 7. 74. H Fang, R Cordoba Rodriguez, CS Lankford, DM Frucht: Anthrax lethal toxin blocks MAPK kinase dependent IL 2 production in CD4+ T cells J Immunol 2005, 174 :4966 71. 75. JE Kirby: Anthrax lethal toxin induces human endothelial cell apoptosis Infect Immun 2004, 72 :4 30 9. 76. RL During, BG Gibson, W Li, EA Bishai, GS Sidhu, J Landry, FS Southwick: Anthrax lethal toxin paralyzes actin based motility by blocking Hsp27 phosphorylation EMBO J 2007, 26 :2240 50. 77. AM Hofer, K Lefkimmiatis: Extracellular calcium and cAMP: second messengers as "third messengers"? Physiology (Bethesda) 2007, 22 :320 7. 78. JA Beavo, LL Brunton: Cyclic nucleotide research -still expanding after half a century Nat Rev Mol Cell Biol 2002, 3 :710 8. 79. GA Robison, RW Butcher, EW Sutherland: Cy clic AMP Annu Rev Biochem 1968, 37 :149 74. 80. B Zheng, YC Ma, RS Ostrom, C Lavoie, GN Gill, PA Insel, XY Huang, MG Farquhar: RGS PX1, a GAP for GalphaS and sorting nexin in vesicular trafficking Science 2001, 294 :1939 42. 81. AG Gilman: G proteins: tran sducers of receptor generated signals Annu Rev Biochem 1987, 56 :615 49. 82. J Buck, ML Sinclair, L Schapal, MJ Cann, LR Levin: Cytosolic adenylyl cyclase defines a unique signaling molecule in mammals Proc Natl Acad Sci U S A 1999, 96 :79 84. 83. WJ Tang, J Krupinski, AG Gilman: Expression and characterization of calmodulin activated (type I) adenylylcyclase J Biol Chem 1991, 266 :8595 603. 84. WJ Tang, AG Gilman: Construction of a soluble adenylyl cyclase activated by Gs alpha and forskolin Science 1995, 268 :1769 72. 85. G Zhang, Y Liu, AE Ruoho, JH Hurley: Structure of the adenylyl cyclase catalytic core Nature 1997, 386 :247 53. 86. RK Sunahara, CW Dessauer, AG Gilman: Complexity and diversity of mammalian adenylyl cyclases Annu Rev Pharmacol Toxicol 1996, 36 :461 80. 87. CW Dessauer, JJ Tesmer, SR Sprang, AG Gilman: Identification of a Gialpha binding site on type V adenylyl cyclase J Biol Chem 1998, 273 :25831 9.

PAGE 103

103 88. MR Montminy, GA Gonzalez, KK Yamamoto: Regulation of cAMP inducible genes by CREB Tr ends Neurosci 1990, 13 :184 8. 89. J de Rooij, FJ Zwartkruis, MH Verheijen, RH Cool, SM Nijman, A Wittinghofer, JL Bos: Epac is a Rap1 guanine nucleotide exchange factor directly activated by cyclic AMP Nature 1998, 396 :474 7. 90. S Balasubramanian, JW Lyn ch, PH Barry: The permeation of organic cations through cAMP gated channels in mammalian olfactory receptor neurons J Membr Biol 1995, 146 :177 91. 91. C Gaudin, CJ Homcy, Y Ishikawa: Mammalian adenylyl cyclase family members are randomly located on differ ent chromosomes Hum Genet 1994, 94 :527 9. 92. N Haber, D Stengel, N Defer, N Roeckel, MG Mattei, J Hanoune: Chromosomal mapping of human adenylyl cyclase genes type III, type V and type VI Hum Genet 1994, 94 :69 73. 93. D Stengel, J Parma, MH Gannage, N R oeckel, MG Mattei, R Barouki, J Hanoune: Different chromosomal localization of two adenylyl cyclase genes expressed in human brain Hum Genet 1992, 90 :126 30. 94. EC Villacres, Z Xia, LH Bookbinder, S Edelhoff, CM Disteche, DR Storm: Cloning, chromosomal m apping, and expression of human fetal brain type I adenylyl cyclase Genomics 1993, 16 :473 8. 95. J Parma, L Duprez, J Van Sande, P Cochaux, C Gervy, J Mockel, J Dumont, G Vassart: Somatic mutations in the thyrotropin receptor gene cause hyperfunctioning t hyroid adenomas Nature 1993, 365 :649 51. 96. L Vallar, A Spada, G Giannattasio: Altered Gs and adenylate cyclase activity in human GH secreting pituitary adenomas Nature 1987, 330 :566 8. 97. LR Levin, PL Han, PM Hwang, PG Feinstein, RL Davis, RR Reed: Th e Drosophila learning and memory gene rutabaga encodes a Ca2+/Calmodulin responsive adenylyl cyclase Cell 1992, 68 :479 89. 98. MS Livingstone, PP Sziber, WG Quinn: Loss of calcium/calmodulin responsiveness in adenylate cyclase of rutabaga, a Drosophila le arning mutant Cell 1984, 37 :205 15. 99. JA Chester, VJ Watts: Adenylyl cyclase 5: a new clue in the search for the "fountain of youth"? Sci STKE 2007, 2007 :pe64. 100. T Iwamoto, S Okumura, K Iwatsubo, J Kawabe, K Ohtsu, I Sakai, Y Hashimoto, A Izumitani, K Sango, K Ajiki, et al: Motor dysfunction in type 5 adenylyl cyclase null mice J Biol Chem 2003, 278 :16936 40.

PAGE 104

104 101. K Iwatsubo, S Minamisawa, T Tsunematsu, M Nakagome, Y Toya, JE Tomlinson, S Umemura, RM Scarborough, DE Levy, Y Ishikawa: Direct inhibition of type 5 adenylyl cyclase prevents myocardial apoptosis without functional deterioration J Biol Chem 2004, 279 :409 38 45. 102. S Okumura, DE Vatner, R Kurotani, Y Bai, S Gao, Z Yuan, K Iwatsubo, C Ulucan, J Kawabe, K Ghosh, et al: Disruption of type 5 adenylyl cyclase enhances desensitization of cyclic adenosine monophosphate signal and increases Akt signal with chroni c catecholamine stress Circulation 2007, 116 :1776 83. 103. S Gasperini, L Crepaldi, F Calzetti, L Gatto, C Berlato, F Bazzoni, A Yoshimura, MA Cassatella: Interleukin 10 and cAMP elevating agents cooperate to induce suppressor of cytokine signaling 3 via a protein kinase A independent signal Eur Cytokine Netw 2002, 13 :47 53. 104. M Nambu, M Morita, H Watanabe, Y Uenoyama, KM Kim, M Tanaka, Y Iwai, H Kimata, M Mayumi, H Mikawa: Regulation of Fc gamma receptor expression and phagocytosis of a human monoblas t cell line U937. Participation of cAMP and protein kinase C in the effects of IFN gamma and phorbol ester J Immunol 1989, 143 :4158 65. 105. C Makranz, G Cohen, F Reichert, T Kodama, S Rotshenker: cAMP cascade (PKA, Epac, adenylyl cyclase, Gi, and phospho diesterases) regulates myelin phagocytosis mediated by complement receptor 3 and scavenger receptor AI/II in microglia and macrophages Glia 2006, 53 :441 8. 106. EM Aandahl, P Aukrust, BS Skalhegg, F Muller, SS Froland, V Hansson, K Tasken: Protein kinase A type I antagonist restores immune responses of T cells from HIV infected patients FASEB J 1998, 12 :855 62. 107. D Cassel, T Pfeuffer: Mechanism of cholera toxin action: covalent modification of the guanyl nucleotide binding protein of the adenylate cycl ase system Proc Natl Acad Sci U S A 1978, 75 :2669 73. 108. T Katada, M Ui: Direct modification of the membrane adenylate cyclase system by islet activating protein due to ADP ribosylation of a membrane protein Proc Natl Acad Sci U S A 1982, 79 :3129 33. 1 09. TL Yahr, AJ Vallis, MK Hancock, JT Barbieri, DW Frank: ExoY, an adenylate cyclase secreted by the Pseudomonas aeruginosa type III system Proc Natl Acad Sci U S A 1998, 95 :13899 904. 110. LA Shevchenko, BN Mishankin: [Adenylate cyclase of the causative agent of plague: its purification and properties] Zh Mikrobiol Epidemiol Immunobiol 1987:15 20. 111. AJ Rossomando, DM Payne, MJ Weber, TW Sturgill: Evidence that pp42, a major tyrosine kinase target protein, is a mitogen activated serine/threonine prote in kinase Proc Natl Acad Sci U S A 1989, 86 :6940 3.

PAGE 105

105 112. Y Jiang, C Chen, Z Li, W Guo, JA Gegner, S Lin, J Han: Characterization of the structure and function of a new mitogen activated protein kinase (p38beta) J Biol Chem 1996, 271 :17920 6. 113. D Jacob s, D Glossip, H Xing, AJ Muslin, K Kornfeld: Multiple docking sites on substrate proteins form a modular system that mediates recognition by ERK MAP kinase Genes Dev 1999, 13 :163 75. 114. DA Fantz, D Jacobs, D Glossip, K Kornfeld: Docking sites on substra te proteins direct extracellular signal regulated kinase to phosphorylate specific residues J Biol Chem 2001, 276 :27256 65. 115. DR Alessi, N Gomez, G Moorhead, T Lewis, SM Keyse, P Cohen: Inactivation of p42 MAP kinase by protein phosphatase 2A and a pro tein tyrosine phosphatase, but not CL100, in various cell lines Curr Biol 1995, 5 :283 95. 116. R Pulido, A Zuniga, A Ullrich: PTP SL and STEP protein tyrosine phosphatases regulate the activation of the extracellular signal regulated kinases ERK1 and ERK2 by association through a kinase interaction motif EMBO J 1998, 17 :7337 50. 117. KW Wood, C Sarnecki, TM Roberts, J Blenis: ras mediates nerve growth factor receptor modulation of three signal transducing protein kinases: MAP kinase, Raf 1, and RSK Cell 1992, 68 :1041 50. 118. RH Chen, C Sarnecki, J Blenis: Nuclear localization and regulation of erk and rsk encoded protein kinases Mol Cell Biol 1992, 12 :915 27. 119. P Lenormand, C Sardet, G Pages, G L'Allemain, A Brunet, J Pouyssegur: Growth factors indu ce nuclear translocation of MAP kinases (p42mapk and p44mapk) but not of their activator MAP kinase kinase (p45mapkk) in fibroblasts J Cell Biol 1993, 122 :1079 88. 120. A Behrens, W Jochum, M Sibilia, EF Wagner: Oncogenic transformation by ras and fos is mediated by c Jun N terminal phosphorylation Oncogene 2000, 19 :2657 63. 121. A Behrens, M Sibilia, EF Wagner: Amino terminal phosphorylation of c Jun regulates stress induced apoptosis and cellular proliferation Nat Genet 1999, 21 :326 9. 122. Y Mizukami, K Yoshioka, S Morimoto, K Yoshida: A novel mechanism of JNK1 activation. Nuclear translocation and activation of JNK1 during ischemia and reperfusion J Biol Chem 1997, 272 :16657 62. 123. M Schreiber, A Kolbus, F Piu, A Szabowski, U Mohle Steinlein, J Tia n, M Karin, P Angel, EF Wagner: Control of cell cycle progression by c Jun is p53 dependent Genes Dev 1999, 13 :607 19.

PAGE 106

106 124. JJ Ventura, A Hubner, C Zhang, RA Flavell, KM Shokat, RJ Davis: Chemical genetic analysis of the time course of signal transduction by JNK Mol Cell 2006, 21 :701 10. 125. C Dong, DD Yang, C Tournier, AJ Whitmarsh, J Xu, RJ Davis, RA Flavell: JNK is required for effector T cell function but not for T cell activation Nature 2000, 405 :91 4. 126. C Dong, DD Yang, M Wysk, AJ Whitmarsh, RJ Davis, RA Flavell: Defective T cell differentiation in the absence of Jnk1 Science 1998, 282 :2092 5. 127. NW Freshney, L Rawlinson, F Guesdon, E Jones, S Cowley, J Hsuan, J Saklatvala: Interleukin 1 activates a novel protein kinase cascade that results i n the phosphorylation of Hsp27 Cell 1994, 78 :1039 49. 128. J Han, JD Lee, L Bibbs, RJ Ulevitch: A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells Science 1994, 265 :808 11. 129. K Ono, J Han: The p38 signal transduction pathway: activation and function Cell Signal 2000, 12 :1 13. 130. NL Diehl, H Enslen, KA Fortner, C Merritt, N Stetson, C Charland, RA Flavell, RJ Davis, M Rincon: Activation of the p38 mitogen activated protein kinase pathway arrests cell cycle progression and differentiation of immature thymocytes in vivo J Exp Med 2000, 191 :321 34. 131. C Merritt, H Enslen, N Diehl, D Conze, RJ Davis, M Rincon: Activation of p38 mitogen activated protein kinase in vivo selectively induces apoptosis of CD8(+) but not CD4(+) T cells Mol Cell Biol 2000, 20 :936 46. 132. SJ Ajizian, BK English, EA Meals: Specific inhibitors of p38 and extracellular signal regulated kinase mitogen activated protein kinase pathways block inducible nitric oxide synthase and tumor necrosis factor accu mulation in murine macrophages stimulated with lipopolysaccharide and interferon gamma J Infect Dis 1999, 179 :939 44. 133. J El Benna, J Han, JW Park, E Schmid, RJ Ulevitch, BM Babior: Activation of p38 in stimulated human neutrophils: phosphorylation of the oxidase component p47phox by p38 and ERK but not by JNK Arch Biochem Biophys 1996, 334 :395 400. 134. JM Ayala, S Goyal, NJ Liverton, DA Claremon, SJ O'Keefe, WA Hanlon: Serum induced monocyte differentiation and monocyte chemotaxis are regulated by th e p38 MAP kinase signal transduction pathway J Leukoc Biol 2000, 67 :869 75. 135. NV Serbina, T Jia, TM Hohl, EG Pamer: Monocyte mediated defense against microbial pathogens Annu Rev Immunol 2008, 26 :421 52. 136. R van Furth, ZA Cohn: The origin and kinet ics of mononuclear phagocytes J Exp Med 1968, 128 :415 35.

PAGE 107

107 137. R Van Furth, MC Diesselhoff den Dulk, H Mattie: Quantitative study on the production and kinetics of mononuclear phagocytes during an acute inflammatory reaction J Exp Med 1973, 138 :1314 30. 138. RT Sawyer, PH Strausbauch, A Volkman: Resident macrophage proliferation in mice depleted of blood monocytes by strontium 89 Lab Invest 1982, 46 :165 70. 139. JD Tarling, HS Lin, S Hsu: Self renewal of pulmonary alveolar macrophages: evidence from radi ation chimera studies J Leukoc Biol 1987, 42 :443 6. 140. L Landsman, C Varol, S Jung: Distinct differentiation potential of blood monocyte subsets in the lung J Immunol 2007, 178 :2000 7. 141. J Cros, N Cagnard, K Woollard, N Patey, SY Zhang, B Senechal, A Puel, SK Biswas, D Moshous, C Picard, et al: Human CD14dim monocytes patrol and sense nucleic acids and viruses via TLR7 and TLR8 receptors Immunity 33 :375 86. 142. DM Mosser: The many faces of macrophage activation J Leukoc Biol 2003, 73 :209 12. 143. GK Koski, LA Lyakh, NR Rice: Rapid lipopolysaccharide induced differentiation of CD14(+) monocytes into CD83(+) dendritic cells is modulated under serum free conditions by exogenously added IFN gamma and endogenously produced IL 10 Eur J Immunol 2001, 31 :3773 81. 144. R van Furth: Origin and turnover of monocytes and macrophages Curr Top Pathol 1989, 79 :125 50. 145. R van Furth, MM Diesselhoff den Dulk: Method to prove investigation of particles by macrophages with light microscopy Scand J Immunol 1980, 12 :265 9. 146. ML Thakur, MJ Welch, JH Joist, RE Coleman: Indium LLL labeled platelets: studies on preparation and evaluation of in vitro and in vivo functions Thromb Res 1976, 9 :345 57. 147. H Kashiwagi, MA Schwartz, M Eigenthaler, KA Davis, MH Gin sberg, SJ Shattil: Affinity modulation of platelet integrin alphaIIbbeta3 by beta3 endonexin, a selective binding partner of the beta3 integrin cytoplasmic tail J Cell Biol 1997, 137 :1433 43. 148. TM Leisner, JD Wencel Drake, W Wang, SC Lam: Bidirectional transmembrane modulation of integrin alphaIIbbeta3 conformations J Biol Chem 1999, 274 :12945 9. 149. RR Hantgan, DS Lyles, TC Mallett, M Rocco, C Nagaswami, JW Weisel: Ligand binding promotes the entropy driven oligomerization of integrin alpha IIb beta 3 J Biol Chem 2003, 278 :3417 26.

PAGE 108

108 150. RR Hantgan, C Paumi, M Rocco, JW Weisel: Effects of ligand mimetic peptides Arg Gly Asp X (X = Phe, Trp, Ser) on alphaIIbbeta3 integrin conformation and oligomerization Biochemistry 1999, 38 :14461 74. 151. VT Nachmia s: Cytoskeleton of human platelets at rest and after spreading J Cell Biol 1980, 86 :795 802. 152. JH Hartwig, M DeSisto: The cytoskeleton of the resting human blood platelet: structure of the membrane skeleton and its attachment to actin filaments J Cell Biol 1991, 112 :407 25. 153. A Kassam, SD Der, J Mogridge: Differentiation of human monocytic cell lines confers susceptibility to Bacillus anthracis lethal toxin Cell Microbiol 2005, 7 :281 92. 154. SG Popov, R Villasmil, J Bernardi, E Grene, J Cardwell, T Popova, A Wu, D Alibek, C Bailey, K Alibek: Effect of Bacillus anthracis lethal toxin on human peripheral blood mononuclear cells FEBS Lett 2002, 527 :211 5. 155. FJ Maldonado Arocho, JA Fulcher, B Lee, KA Bradley: Anthrax oedema toxin induces anthrax to xin receptor expression in monocyte derived cells Mol Microbiol 2006, 61 :324 37. 156. PJ Chou, CA Newton, I Perkins, H Friedman, TW Klein: Suppression of dendritic cell activation by anthrax lethal toxin and edema toxin depends on multiple factors including cell source, stimulus used, and function tested DNA Cell Biol 2008, 27 :637 48. 157. JE Comer, CL Galindo, F Zhang, AM Wenglikowski, KL Bush, HR Garner, JW Peterson, AK Chopra: Murine macrophage transcriptional and functional responses to Bacillu s anthracis edema toxin Microb Pathog 2006, 41 :96 110. 158. MA Crawford, CV Aylott, RW Bourdeau, GM Bokoch: Bacillus anthracis toxins inhibit human neutrophil NADPH oxidase activity J Immunol 2006, 176 :7557 65. 159. J Hong, RC Doebele, MW Lingen, LA Quil liam, WJ Tang, MR Rosner: Anthrax edema toxin inhibits endothelial cell chemotaxis via Epac and Rap1 J Biol Chem 2007, 282 :19781 7. 160. SR Paccani, F Tonello, R Ghittoni, M Natale, L Muraro, MM D'Elios, WJ Tang, C Montecucco, CT Baldari: Anthrax toxins suppress T lymphocyte activation by disrupting antigen receptor signaling J Exp Med 2005, 201 :325 31. 161. JN Tournier, A Quesnel Hellmann, J Mathieu, C Montecucco, WJ Tang, M Mock, DR Vidal, PL Goossens: Anthrax edema toxin cooperates with lethal toxin t o impair cytokine secretion during infection of dendritic cells J Immunol 2005, 174 :4934 41. 162. JM Park, FR Greten, A Wong, RJ Westrick, JS Arthur, K Otsu, A Hoffmann, M Montminy, M Karin: Signaling pathways and genes that inhibit pathogen induced

PAGE 109

109 macro phage apoptosis -CREB and NF kappaB as key regulators Immunity 2005, 23 :319 29. 163. X Cui, Y Li, X Li, MW Laird, M Subramanian, M Moayeri, SH Leppla, Y Fitz, J Su, K Sherer, et al: Bacillus anthracis edema and lethal toxin have different hemodynamic effe cts but function together to worsen shock and outcome in a rat model J Infect Dis 2007, 195 :572 80. 164. LE Watson, SR Kuo, K Katki, T Dang, SK Park, DE Dostal, WJ Tang, SH Leppla, AE Frankel: Anthrax toxins induce shock in rats by depressed cardiac ventr icular function PLoS One 2007, 2 :e466. 165. LE Watson, J Mock, H Lal, G Lu, RW Bourdeau, WJ Tang, SH Leppla, DE Dostal, AE Frankel: Lethal and edema toxins of anthrax induce distinct hemodynamic dysfunction Front Biosci 2007, 12 :4670 5. 166. JH Kau, DS S un, WJ Tsai, HF Shyu, HH Huang, HC Lin, HH Chang: Antiplatelet activities of anthrax lethal toxin are associated with suppressed p42/44 and p38 mitogen activated protein kinase pathways in the platelets J Infect Dis 2005, 192 :1465 74. 167. S Alam, M Gupta R Bhatnagar: Inhibition of platelet aggregation by anthrax edema toxin Biochem Biophys Res Commun 2006, 339 :107 14. 168. M Moayeri, SH Leppla: Cellular and systemic effects of anthrax lethal toxin and edema toxin Mol Aspects Med 2009, 30 :439 55. 169. M L Halls, DM Cooper: Regulation by Ca2+ signaling pathways of adenylyl cyclases Cold Spring Harb Perspect Biol 3 :a004143. 170. J Hanoune, N Defer: Regulation and role of adenylyl cyclase isoforms Annu Rev Pharmacol Toxicol 2001, 41 :145 74. 171. BJ Rollin s: Chemokines and atherosclerosis: what Adam Smith has to say about vascular disease J Clin Invest 2001, 108 :1269 71. 172. S Soelaiman, BQ Wei, P Bergson, YS Lee, Y Shen, M Mrksich, BK Shoichet, WJ Tang: Structure based inhibitor discovery against adenyly l cyclase toxins from pathogenic bacteria that cause anthrax and whooping cough J Biol Chem 2003, 278 :25990 7. 173. CP Quinn, CC Shone, PC Turnbull, J Melling: Purification of anthrax toxin components by high performance anion exchange, gel filtration and hydrophobic interaction chromatography Biochem J 1988, 252 :753 8. 174. SS Kocer, SG Walker, B Zerler, LM Golub, SR Simon: Metalloproteinase inhibitors, nonantimicrobial chemically modified tetracyclines, and ilomastat block Bacillus anthracis lethal factor activity in viable cells Infect Immun 2005, 73 :7548 57.

PAGE 110

110 175. SR Ali, AM Timmer, S Bilgrami, EJ Park, L Eckmann, V Nizet, M Karin: Anthrax toxin induces macrophage death by p38 MAPK inhibition but leads to inflammasome activation via ATP leakage Im munity 35 :34 44. 176. BJ Doore, MM Bashor, N Spitzer, RC Mawe, MH Saier, Jr.: Regulation of adenosine 3' :5' monophosphate efflux from rat glioma cells in culture* J Biol Chem 1975, 250 :4371 2. 177. L Abrami, N Reig, FG van der Goot: Anthrax toxin: the l ong and winding road that leads to the kill Trends Microbiol 2005, 13 :72 8. 178. KC Brittingham, G Ruthel, RG Panchal, CL Fuller, WJ Ribot, TA Hoover, HA Young, AO Anderson, S Bavari: Dendritic cells endocytose Bacillus anthracis spores: implications for anthrax pathogenesis J Immunol 2005, 174 :5545 52. 179. AC Hahn, CR Lyons, MF Lipscomb: Effect of Bacillus anthracis virulence factors on human dendritic cell activation Hum Immunol 2008, 69 :552 61. 180. SE Szarowicz, RL During, W Li, CP Quinn, WJ Tang, F S Southwick: Bacillus anthracis edema toxin impairs neutrophil actin based motility Infect Immun 2009, 77 :2455 64. 181. CH Serezani, MN Ballinger, DM Aronoff, M Peters Golden: Cyclic AMP: master regulator of innate immune cell function Am J Respir Cell M ol Biol 2008, 39 :127 32. 182. LL Dugan, JS Kim, Y Zhang, RD Bart, Y Sun, DM Holtzman, DH Gutmann: Differential effects of cAMP in neurons and astrocytes. Role of B raf J Biol Chem 1999, 274 :25842 8. 183. MR Vossler, H Yao, RD York, MG Pan, CS Rim, PJ Stor k: cAMP activates MAP kinase and Elk 1 through a B Raf and Rap1 dependent pathway Cell 1997, 89 :73 82. 184. AE Tucker, Salles, II, DE Voth, W Ortiz Leduc, H Wang, I Dozmorov, M Centola, JD Ballard: Decreased glycogen synthase kinase 3 beta levels and related physiological changes in Bacillus anthracis lethal toxin treated macrophages Cell Microbiol 2003, 5 :523 32. 185. JW Watters, K Dewar, J Lehoczky, V Boyartchuk, WF Dietrich: Kif1C, a kinesin like motor protein, mediates mouse macrophage resistance to anthrax lethal factor Curr Biol 2001, 11 :1503 11. 186. RO Godinho, VL Costa, Jr.: Regulation of intracellular cyclic AMP in skeletal muscle cells involves the efflux of cyclic nucleotide to the extracellular compartment Br J Pharmacol 2003, 138 :995 10 03. 187. J Chen, RT Peterson, SL Schreiber: Alpha 4 associates with protein phosphatases 2A, 4, and 6 Biochem Biophys Res Commun 1998, 247 :827 32.

PAGE 111

111 188. PT Cohen, ND Brewis, V Hughes, DJ Mann: Protein serine/threonine phosphatases; an expanding family FEBS Lett 1990, 268 :355 9. 189. AA Depaoli Roach, IK Park, V Cerovsky, C Csortos, SD Durbin, MJ Kuntz, A Sitikov, PM Tang, A Verin, S Zolnierowicz: Serine/threonine protein phosphatases in the control of cell function Adv Enzyme Regul 1994, 34 :199 224. 19 0. K Lechward, OS Awotunde, W Swiatek, G Muszynska: Protein phosphatase 2A: variety of forms and diversity of functions Acta Biochim Pol 2001, 48 :921 33. 191. M Nagao, H Shima, M Nakayasu, T Sugimura: Protein serine/threonine phosphatases as binding prote ins for okadaic acid Mutat Res 1995, 333 :173 9. 192. M Nishikawa, SB Omay, H Toyoda, I Tawara, H Shima, M Nagao, BA Hemmings, MC Mumby, K Deguchi: Expression of the catalytic and regulatory subunits of protein phosphatase type 2A may be differentially mod ulated during retinoic acid induced granulocytic differentiation of HL 60 cells Cancer Res 1994, 54 :4879 84. 193. S Zolnierowicz: Type 2A protein phosphatase, the complex regulator of numerous signaling pathways Biochem Pharmacol 2000, 60 :1225 35. 194. I L Buxton, LL Brunton: Compartments of cyclic AMP and protein kinase in mammalian cardiomyocytes J Biol Chem 1983, 258 :10233 9. 195. KA Fagan, KE Smith, DM Cooper: Regulation of the Ca2+ inhibitable adenylyl cyclase type VI by capacitative Ca2+ entry requi res localization in cholesterol rich domains J Biol Chem 2000, 275 :26530 7. 196. T Gao, TS Puri, BL Gerhardstein, AJ Chien, RD Green, MM Hosey: Identification and subcellular localization of the subunits of L type calcium channels and adenylyl cyclase in cardiac myocytes J Biol Chem 1997, 272 :19401 7. 197. C Huang, JR Hepler, LT Chen, AG Gilman, RG Anderson, SM Mumby: Organization of G proteins and adenylyl cyclase at the plasma membrane Mol Biol Cell 1997, 8 :2365 78. 198. RD McAllister, Y Singh, WD du B ois, M Potter, T Boehm, ND Meeker, PD Fillmore, LM Anderson, ME Poynter, C Teuscher: Susceptibility to anthrax lethal toxin is controlled by three linked quantitative trait loci Am J Pathol 2003, 163 :1735 41. 199. JM Park, FR Greten, ZW Li, M Karin: Macro phage apoptosis by anthrax lethal factor through p38 MAP kinase inhibition Science 2002, 297 :2048 51. 200. T Fukao: Immune system paralysis by anthrax lethal toxin: the roles of innate and adaptive immunity Lancet Infect Dis 2004, 4 :166 70.

PAGE 112

112 201. DJ Stear ns Kurosawa, F Lupu, FB Taylor, Jr., G Kinasewitz, S Kurosawa: Sepsis and pathophysiology of anthrax in a nonhuman primate model Am J Pathol 2006, 169 :433 44. 202. J Guarner, JA Jernigan, WJ Shieh, K Tatti, LM Flannagan, DS Stephens, T Popovic, DA Ashford BA Perkins, SR Zaki: Pathology and pathogenesis of bioterrorism related inhalational anthrax Am J Pathol 2003, 163 :701 9. 203. NA Twenhafel, E Leffel, ML Pitt: Pathology of inhalational anthrax infection in the african green monkey Vet Pathol 2007, 44 :716 21. 204. W Wu, H Mehta, K Chakrabarty, JL Booth, ES Duggan, KB Patel, JD Ballard, KM Coggeshall, JP Metcalf: Resistance of human alveolar macrophages to Bacillus anthracis lethal toxin J Immunol 2009, 183 :5799 806. 205. JE Comer, CL Galindo, AK Chopr a, JW Peterson: GeneChip analyses of global transcriptional responses of murine macrophages to the lethal toxin of Bacillus anthracis Infect Immun 2005, 73 :1879 85. 206. RM Mesters, N Florke, H Ostermann, J Kienast: Increase of plasminogen activator inhib itor levels predicts outcome of leukocytopenic patients with sepsis Thromb Haemost 1996, 75 :902 7. 207. M Dozmorov, W Wu, K Chakrabarty, JL Booth, RE Hurst, KM Coggeshall, JP Metcalf: Gene expression profiling of human alveolar macrophages infected by B. anthracis spores demonstrates TNF alpha and NF kappab are key components of the innate immune response to the pathogen BMC Infect Dis 2009, 9 :152. 208. GX Shi, K Harrison, SB Han, C Moratz, JH Kehrl: Toll like receptor signaling alters the expression of r egulator of G protein signaling proteins in dendritic cells: implications for G protein coupled receptor signaling J Immunol 2004, 172 :5175 84. 209. D Chaussabel, RT Semnani, MA McDowell, D Sacks, A Sher, TB Nutman: Unique gene expression profiles of huma n macrophages and dendritic cells to phylogenetically distinct parasites Blood 2003, 102 :672 81. 210. F Colotta, F Re, M Muzio, R Bertini, N Polentarutti, M Sironi, JG Giri, SK Dower, JE Sims, A Mantovani: Interleukin 1 type II receptor: a decoy target fo r IL 1 that is regulated by IL 4 Science 1993, 261 :472 5. 211. DB Jernigan, PL Raghunathan, BP Bell, R Brechner, EA Bresnitz, JC Butler, M Cetron, M Cohen, T Doyle, M Fischer, et al: Investigation of bioterrorism related anthrax, United States, 2001: epid emiologic findings Emerg Infect Dis 2002, 8 :1019 28. 212. DL Tuttle, JK Harrison, C Anders, JW Sleasman, MM Goodenow: Expression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1 J Virol 1998, 72 :4962 9.

PAGE 113

113 213. I Vlodavsky, A Eldor, A Haimovitz Friedman, Y Matzner, R Ishai Michaeli, O Lider, Y Naparstek, IR Cohen, Z Fuks: Expression of heparanase by platelets and circulating cells of the immune system: possible involvement in diapedesis and extravasation Invasion Metastasis 1992, 12 :112 27. 214. GG Vaday, O Lider: Extracellular matrix moieties, cytokines, and enzymes: dynamic effects on immune cell behavior and inflammation J Leukoc Biol 2000, 67 :149 5 9. 215. E Edovitsky, I Lerner, E Zcharia, T Peretz, I Vlodavsky, M Elkin: Role of endothelial heparanase in delayed type hypersensitivity Blood 2006, 107 :3609 16. 216. RJ Shebuski, KS Kilgore: Role of inflammatory mediators in thrombogenesis J Pharmacol Exp Ther 2002, 300 :729 35. 217. W Wei, Q Lu, GJ Chaudry, SH Leppla, SN Cohen: The LDL receptor related protein LRP6 mediates internalization and lethality of anthrax toxin Cell 2006, 124 :1141 54. 218. M Merten, P Thiagarajan: P selectin expression on platelets determines size and stability of platelet aggregates Circulation 2000, 102 :1931 6. 219. HM Scobie, GJ Rainey, KA Bradley, JA Young: Human capillary morphogenesis protein 2 functions as an anthrax toxin receptor Proc Natl Acad Sci U S A 2003, 10 0 :5170 4. 220. KA Bradley, J Mogridge, M Mourez, RJ Collier, JA Young: Identification of the cellular receptor for anthrax toxin Nature 2001, 414 :225 9. 221. S Liu, D Crown, S Miller Randolph, M Moayeri, H Wang, H Hu, T Morley, SH Leppla: Capillary morpho genesis protein 2 is the major receptor mediating lethality of anthrax toxin in vivo Proc Natl Acad Sci U S A 2009, 106 :12424 9. 222. JM Warfel, AD Steele, F D'Agnillo: Anthrax lethal toxin induces endothelial barrier dysfunction Am J Pathol 2005, 166 :18 71 81. 223. TG Popova, B Millis, C Bradburne, S Nazarenko, C Bailey, V Chandhoke, SG Popov: Acceleration of epithelial cell syndecan 1 shedding by anthrax hemolytic virulence factors BMC Microbiol 2006, 6 :8. 224. MC Chung, TG Popova, SC Jorgensen, L Dong, V Chandhoke, CL Bailey, SG Popov: Degradation of circulating von Willebrand factor and its regulator ADAMTS13 implicates secreted Bacillus anthracis metalloproteases in anthrax consumptive coagulopathy J Biol Chem 2008, 283 :9531 42. 225. ID McGilvray, Z Lu, R Bitar, AP Dackiw, CJ Davreux, OD Rotstein: VLA 4 integrin cross linking on human monocytic THP 1 cells induces tissue factor expression by a mechanism involving mitogen activated protein kinase J Biol Chem 1997, 272 :10287 94.

PAGE 114

114 226. ID McGilvray, Z Lu AC Wei, OD Rotstein: MAP kinase dependent induction of monocytic procoagulant activity by beta2 integrins J Surg Res 1998, 80 :272 9. 227. N Ashida, H Arai, M Yamasaki, T Kita: Distinct signaling pathways for MCP 1 dependent integrin activation and chemo taxis J Biol Chem 2001, 276 :16555 60. 228. LC Olson: Pertussis Medicine (Baltimore) 1975, 54 :427 69. 229. AA Weiss, EL Hewlett, GA Myers, S Falkow: Pertussis toxin and extracytoplasmic adenylate cyclase as virulence factors of Bordetella pertussis J Inf ect Dis 1984, 150 :219 22. 230. MJ Bergman, RL Guerrant, F Murad, SH Richardson, D Weaver, GL Mandell: Interaction of polymorphonuclear neutrophils with Escherichia coli. Effect of enterotoxin on phagocytosis, killing, chemotaxis, and cyclic AMP J Clin Inv est 1978, 61 :227 34. 231. MC Braun, J He, CY Wu, BL Kelsall: Cholera toxin suppresses interleukin (IL) 12 production and IL 12 receptor beta1 and beta2 chain expression J Exp Med 1999, 189 :541 52. 232. M Niemialtowski, W Klucinski, K Malicki, IS de Faundez: Cholera toxin (choleragen) polymorphonuclear leukocyte interactions: effect on migration in vitro and Fc gamma R dependent phagocytic and bactericidal activity Microbiol Immunol 1993, 37 :55 62. 233. MS O'Dorisio, GR Vandenbark, AF LoBuglio: Human monocyte killing of Staphylococcus aureus: modulation by agonists of cyclic adenosine 3',5' monophosphate and cyclic guanosine 3',5' monophosphate Infect Immun 1979, 26 :604 10. 234. Y Shen, NL Zhukovskaya, M I Zimmer, S Soelaiman, P Bergson, CR Wang, CS Gibbs, WJ Tang: Selective inhibition of anthrax edema factor by adefovir, a drug for chronic hepatitis B virus infection Proc Natl Acad Sci U S A 2004, 101 :3242 7. 235. RA Johnson, I Shoshani: Kinetics of "P" site mediated inhibition of adenylyl cyclase and the requirements for substrate J Biol Chem 1990, 265 :11595 600. 236. SM Yeung, RA Johnson: Irreversible inactivation of adenylyl cyclase by the "P" site agonist 2',5' dideoxy ,3' p fluorosulfonylbenzoyl ade nosine J Biol Chem 1990, 265 :16745 50. 237. VA Florio, EM Ross: Regulation of the catalytic component of adenylate cyclase. Potentiative interaction of stimulatory ligands and 2',5' dideoxyadenosine Mol Pharmacol 1983, 24 :195 202. 238. C Londos, J Wolff: Two distinct adenosine sensitive sites on adenylate cyclase Proc Natl Acad Sci U S A 1977, 74 :5482 6.

PAGE 115

115 239. J Premont, G Guillon, J Bockaert: Specific MG2+ and adenosine sites involved in a bireactant mechanism for adenylate cyclase inhibition and their p robable localization on this enzyme's catalytic component Biochem Biophys Res Commun 1979, 90 :513 9. 240. SK Kochi, I Martin, G Schiavo, M Mock, V Cabiaux: The effects of pH on the interaction of anthrax toxin lethal and edema factors with phospholipid vesicles Biochemistry 1994, 33 :2604 9. 241. C Guidi Rontani, M Weber Levy, M Mock, V Cabiaux: Translocation of Bacillus anthracis lethal and oedema factors across endosome membranes Cell Microbiol 2000, 2 :259 64. 242. J Li, X Xia, H Nie, MA Smith, X Zhu: PKC inhibition is involved in trichosanthin induced apoptosis in human chronic myeloid leukemia cell line K562 Biochim Biophys Acta 2007, 1770 :63 70. 243. Q Jiang, T Bai, S Shen, L Li, H Ding, P Wang: Increase of cytosolic calcium induced by trichosanthi n suppresses cAMP/PKC levels through the inhibition of adenylyl cyclase activity in HeLa cells Mol Biol Rep 38 :2863 8. 244. C Zhang, Y Gong, H Ma, C An, D Chen, ZL Chen: Reactive oxygen species involved in trichosanthin induced apoptosis of human chorioc arcinoma cells Biochem J 2001, 355 :653 61. 245. Y Shen, YS Lee, S Soelaiman, P Bergson, D Lu, A Chen, K Beckingham, Z Grabarek, M Mrksich, WJ Tang: Physiological calcium concentrations regulate calmodulin binding and catalysis of adenylyl cyclase exotoxin s EMBO J 2002, 21 :6721 32. 246. R Bhatnagar, Y Singh, SH Leppla, AM Friedlander: Calcium is required for the expression of anthrax lethal toxin activity in the macrophagelike cell line J774A.1 Infect Immun 1989, 57 :2107 14. 247. E Leclerc, C Corti, H Schmid, S Vetter, P James, E Carafoli: Serine/threonine phosphorylation of calmodulin modulates its interaction with the binding domains of target enzymes Biochem J 1999, 344 Pt 2 :403 11.

PAGE 116

116 BIOGRAPHICAL SKETCH Kassidy Chauncey was born in Dade City Florida. Kassidy grew up th e only daughter and middle child Kassidy began her higher educational career in 2003 at the University of South F lorida in Tampa, FL and transfe r r ed to the University of Florida where in May of 2006 she re ceived her BS in microbiology and cell s ciences. After graduation, Kassidy decided to enter the biomedical research field and began working at an infectious disease lab at the University of Florida. research interests flourished and she decided to continue an education in biomedical research and was accepted into the University of in the summer of 2007 During her first year ntinued to enjoy the challenges of research and was encouraged to apply for the PhD program, where she wa s accepted in the summer of 2008 and worked to obtain her PhD in immunology and microbiology. Kassidy has taken opportunities to teach a dual enrollment clas s to high school students, along with accepting continuous opportunities to educate high school teachers on biomedical research topics.