The Type III Secretion System of Pseudomonas aeruginosa

MISSING IMAGE

Material Information

Title:
The Type III Secretion System of Pseudomonas aeruginosa Applications and the Discovery of a Novel Cytotoxin
Physical Description:
1 online resource (141 p.)
Language:
english
Creator:
Neeld, Dennis Kyle
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Immunology and Microbiology (IDP)
Committee Chair:
Jin, Shouguang
Committee Members:
Giron, Jorge A
Zhou, Lei
Peck, Ammon B
Heaton, Marieta B

Subjects

Subjects / Keywords:
exos -- pseudomonas -- secretion
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Pseudomonas aeruginosa is an opportunistic pathogen responsible for causing diseases in immunocompromised individuals. Disease results from the production of numerous virulence factors, some of which are injected directly into host via the type III secretion system (T3SS). Recent breakthroughs in the field of cell biology have demonstrated that cells could be transformed back into a pluripotent state by the etopic expression of several transcription factors, however this is accomplished with the use of integrating oncogenic viral vectors. We therefore set out to develop a protein delivery system that could replace current methodologies, which would meet an emerging need in the cell biology field. Studies have demonstrated that proteins of interest could be delivered into the cytosol of a host eukaryotic cell by fusion to the first 54 amino acids of the type III effector Exoenzyme S (ExoS). In this work, we demonstrate for the first time, the ability to deliver functional nuclear proteins into mammalian cells using a strain of P. aeruginosa which is greatly diminished in cytotoxicity. Although the protein delivery strain was reduced in cytotoxicity for incubation with cells for less than 3 hours, longer times still resulted in cytotoxicity. Work presented in this study demonstrates that residual toxicity results from the injection of nucleoside diphosphate kinase (NDK) into host cells. Evidence presented in this work shows that NDK is not injected like traditional type III effectors, but instead is is secreted first into the extracellular environment via a type I secretion system (T1SS) and then translocated into the host cell by the T3SS. These results are evidence in support a newly emerging model of type III secretion whereby effectors are first secreted into from the bacteria, and then injected into the target cell. ExoS is a potent type III secreted toxin which has shown the ability to kill cancerous cells by inducing apoptosis. Since ExoS must be activated by eukaryotic 14-3-3 proteins, we examined if ExoS could be put under control of a cancer specific portein, murine double minute 2 (MDM2), by replacing the 14-3-3 binding domain with a domain for MDM2. Studies from this work show that while the manipulated form of ExoS was reduced in cytotoxicity, it still had a functional ADP-ribosylation domain, suggesting that MDM2 could play a role in the activation. As a whole, the results presented in this work demonstrate that P. aeruginosa can be utilized as a protein delivery system. They also identified a novel type III injected effector, which is injected into host cells via a novel mechanism. Finally, work presented here suggests that ExoS has the potential to be manipulated in such a fashion as to promote cancer cell specific killing.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Dennis Kyle Neeld.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Jin, Shouguang.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0043983:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 THE TYPE III SECRETION SYSTEM OF P seudomonas aeruginosa : APPLICATIONS AND THE DISCOVERY OF A NOVEL CYTOTOXIN By DENNIS KYLE NEELD A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Dennis Kyle Neeld

PAGE 3

3 To my wife and grandmother whose encouragement and support helped make me who I am today as a scientist

PAGE 4

4 ACKNOWLEDGMENTS It is with my deepest gratitude that I would like to thank my mentor, Dr. Shoug uang Jin, for allowing me to study in his laboratory and learn from him for the past five years. I w ould especially like to thank him for teaching me what it takes to be an exceptional scientist and for his constant patience, understanding, and concern for my wellbeing. He instilled in me two important characteristics a good scientist needs, a hard work ethic, and persistence. His wisdom taught me not only how to be successful in the laboratory, but in life as well. I would also like to thank the members of my supervisory committee, Dr. Jorge Giron, Dr. Lei Zhou, Dr. Ammon Peck, and Dr. Marieta Heaton for all of t heir constant support and ability to provide me with new ideas to move my research forward. I am thankful and fortunate to have had such outstanding scientists serve on my committee. I would also like to thank previous members of the Jin lab, Harald Messer, Candace Bichsel, Jinghua Jia, and Ying Zhang for all of their help and advice over the past years. Their help and support was a n integral part of making the graduate experience a pleasant one. I would also like to thank Dr. Paul Gulig for al l of his suggestions and wisdom, which have been very beneficial to my research and graduate career I also have to give thanks to Michael Paiva who got me into biomedical research by giving me my first opportunity as an undergraduate student and who also gave valuable advice about life and scientific research Also, I would like to acknowledge the rest of the outstanding members of the Molecular Genetics Department with whom I have had the privilege to work with. Personally, I would like to thank my family especially my wife Alice f or always supporting me in my pursuit of my PhD. Their support and strength have been very

PAGE 5

5 from the Gulig lab, who always made lunch an enter taining part of the day. Also, I need to thank my friend Dominick Almo dovar, who was instrumental in helping me learn to use photoshop and illustrator. Finally, I would like to acknowledge the daily email thread f or all of their support and being able to m ake me laugh when science gets you down. Doah!

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIS T OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 Pseudomonas aeruginosa ................................ ................................ ...................... 16 Basic M icrobiology ................................ ................................ ........................... 16 Role as a Human Pathogen ................................ ................................ ............. 16 Antibiotic Resistance ................................ ................................ ........................ 17 Pseudomonas aeruginosa Virulenc e Factors ................................ ......................... 18 Flagellum ................................ ................................ ................................ .......... 18 Quorum Sensing and Biofilms ................................ ................................ .......... 18 Type I Secretion System ................................ ................................ .................. 19 Other P. aeruginosa Secretion Systems ................................ ........................... 19 Exotoxin A ................................ ................................ ................................ ........ 20 Nucleoside Diphosphate Kinase ................................ ................................ ....... 21 Pseudomonas aeruginosa Type III Secretion System ................................ ............ 21 Type III Secretion System ................................ ................................ ................ 21 Structural Features of the T3SS ................................ ................................ ....... 22 Regulation of T3SS in P. aeruginosa ................................ ............................... 23 P. aeruginosa Type III Secreted Effectors ................................ ........................ 23 2 GENERAL MATERIALS AND METHODS ................................ .............................. 29 Bacterial Strains and Plasmids ................................ ................................ ............... 29 Eukaryotic Cell Culture ................................ ................................ ........................... 29 Bacterial Protein Secretion Assay ................................ ................................ ........... 30 Protein Injection Assay ................................ ................................ ........................... 30 3 BACTERIAL DELIVERY OF FUNCTIONAL NUCLEAR PROTEINS INTO DIFFERENTIATED CELLS ................................ ................................ ..................... 37 Background ................................ ................................ ................................ ............. 37 Materials and Methods ................................ ................................ ............................ 39 Generation of ExoS Cre Fusion Proteins ................................ ......................... 39

PAGE 7

7 Bacterial Expre ssion of ExoS Cre Fusion Proteins ................................ .......... 40 Bacterial Protein Secretion Assay ................................ ................................ .... 40 Protein Injection Assay ................................ ................................ ..................... 40 Immunostaining ................................ ................................ ................................ 41 Cytotoxicity Assay ................................ ................................ ............................ 41 galactosidase Staining of Te26 Cells ................................ ............................ 42 Cell Synchronization Protocol ................................ ................................ ........... 42 Flow Cytometry Determining Phases of Cell Cycle ................................ .......... 43 Results ................................ ................................ ................................ .................... 43 Generation of a P. aeruginosa Strain for Prot ein Delivery ................................ 43 Injection of Cre Recombinase Through the Bacterial Type III Secretion System ................................ ................................ ................................ .......... 44 Functional Analysis of Bacterially Delivered Cre Recombinase ....................... 45 Cell Cycle Influences Recombination by Bacterially Delivered Cre Recombinase ................................ ................................ ................................ 46 Discussion ................................ ................................ ................................ .............. 48 4 A NOVEL CYTOTOXIN REQUIRING BOTH TYPE I AND TYPE III SECRETION SYSTEMS FOR INTRACELLULAR DELI VERY ................................ ..................... 65 Background ................................ ................................ ................................ ............. 65 Materials and Methods ................................ ................................ ............................ 66 Generation of Flag Tagged NDK Constructs ................................ .................... 66 Protein Secre tion Assay ................................ ................................ ................... 67 Protein Injection Assay ................................ ................................ ..................... 67 Cytotoxicity Assay ................................ ................................ ............................ 68 Immunofluorescent Staining ................................ ................................ ............. 68 Results ................................ ................................ ................................ .................... 68 Strains Lacking Known Type III Secreted Effectors Still Cause Cytotoxicity .... 68 NDK is Secreted by Non Mucoid Strains of P. aeruginosa ............................... 70 NDK is Injected into Eukaryotic Cells in a T3SS Dependent Manner ............... 71 NDK is Cytotoxic to Eukaryotic Cells ................................ ................................ 72 Kinase Activity o f NDK is not Required for its Cytotoxicity ................................ 74 Secretion of NDK by the T1SS is Necessary for Injection ................................ 7 5 Type I Secreted NDK is Injected via a Functional T3SS ................................ .. 76 NDK Localizes to the Outer Membrane of P. aeruginosa ................................ 77 D iscussion ................................ ................................ ................................ .............. 78 5 THE USE OF EXOS AS A POTENTIAL ANTI CANCER THERAPY ...................... 97 Background ................................ ................................ ................................ ............. 97 Materials and Methods ................................ ................................ .......................... 100 Construction of ExoS Fusion Pro teins ................................ ............................ 100 Secretion Assay for ExoS P53 Fusion Proteins ................................ ............. 100 Protein Injection Assay ................................ ................................ ................... 101 Cell Viability Assay ................................ ................................ ......................... 101 Ras Modification Assay ................................ ................................ .................. 102

PAGE 8

8 Results ................................ ................................ ................................ .................. 102 Generation of ExoS P53 Fusion Proteins ................................ ....................... 102 Secretion and Injection of ExoS P53 Fusion Proteins via the T3SS ............... 103 ExoS P53 Fusion Proteins Show Reduced Cytotoxicity ................................ 104 ExoS P53 Fusion Protein ADP Ribosylate Ras ................................ .............. 105 3 3 Modifies Ras at a Slower Rate ................................ ................. 106 Discussion ................................ ................................ ................................ ............ 107 6 GENERAL DISCUSSION ................................ ................................ ..................... 116 Summary and Significance of Princip al Findings ................................ .................. 116 Delivery of Functional Nuclear Proteins via the Bacterial T3SS ..................... 116 Discovery of a Novel Cytotoxin ................................ ................................ ....... 117 Role of 14 3 3 Proteins in ExoS Activation ................................ ..................... 118 Future Dire ctions ................................ ................................ ................................ .. 120 Bacterial Delivered Proteins ................................ ................................ ........... 120 Translocation of NDK ................................ ................................ ..................... 121 The Role of 14 3 3 Proteins in ExoS Activation ................................ .............. 122 Final Remarks ................................ ................................ ................................ ....... 124 LIST OF REFERENCES ................................ ................................ ............................. 125 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 141

PAGE 9

9 LIST OF TABLES Table page 2 1 List of bacterial strains used in this study ................................ ........................... 32 2 2 List of plasmids used in this study ................................ ................................ ...... 33 2 3 List of primers used in this study ................................ ................................ ........ 35

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Diagram displaying the functional domains of ExoS.. ................................ ......... 28 3 1 Type III secretion profiles of three laboratory strains of P. aeruginosa ............... 52 3 2 ExoS injection into HeLa cells via the T3SS of P. aeruginosa .. .......................... 53 3 3 Viability of MEF cells following infection with P. aeruginosa strains.l. ................. 54 3 4 Construc ts containing variable regions of ExoS fused in frame with Cre recombinase.. ................................ ................................ ................................ ..... 55 3 5 Production of ExoS Cre fusion proteins by P. aeruginosa strain PAK J STY ... 56 3 6 Injection of ExoS Cre fusion proteins via the bacterial T3SS. ............................ 57 3 7 Bacterial delivere d Cre recombinase is functional ................................ ............. 58 3 8 galactosidase expression resulting from bacterial delivered Cre recombinase is dose dependent. ................................ ................................ ........ 59 3 9 Injection of ExoS54 Cre is dose dependent. ................................ ...................... 60 3 10 Synchronization of Te26 cells using a double thymidine block.. ......................... 61 3 11 Time line displaying the length of each phase of the Te26 cell cycle. ................ 62 3 12 Cell cycle influences the recombination efficiency of bacterial delivered Cre recombinase. ................................ ................................ ................................ ...... 63 3 13 Injection of ExoS54 Cre during various phases of the cell cycle. ....................... 64 4 1 Strains lacking type III effectors are cytotoxic ................................ .................... 83 4 2 Secretion of NDK from P.aeruginosa ................................ ................................ 84 4 3 Non mucoid strains of P.aeruginosa secrete NDK. ................................ ............ 85 4 4 Injection of NDK into eukaryotic cells is dependent on the T3SS. ...................... 86 4 5 Cytotoxicity resulting from expression of intracellular NDK.. .............................. 87 4 6 Secretion and injection of non P. aeruginosa derived NDKs. ............................. 88 4 7 Cytotoxicity resulting from stains that possess NDK. ................................ .......... 89

PAGE 11

11 4 8 NDK lacking the T1SS signal sequence is not readily secreted ......................... 90 4 9 Type I secretion of NDK is necessary for protein injection. ................................ 91 4 10 Type I secreted NDK can be i njected via a functional T3SS. ............................. 92 4 11 Type I secreted is not injected in t he absence of a functional T3SS ................... 93 4 12 NDK is localized to the bacterial outer membrane. ................................ ............. 94 4 13 NDK on the bacterial surface. ................................ ................................ ............. 95 4 14 Proposed mechanism explai ning NDK injection via the T3SS ............................ 96 5 1 Diagram illustrating ExoS P53 fusion proteins.. ................................ ................ 110 5 2 Secretion and injection of the ExoS P53 fusion proteins.. ................................ 111 5 3 Cytotoxicity of ExoS P53 fusion proteins. ................................ ......................... 112 5 4 ExoS P53 fusion protein cytotoxicity in MDM2 overexpressing cells.. .............. 113 5 5 Modification of Ras protein by the ExoS P53 fusion proteins. .......................... 114 5 6 Ras modification time course. ................................ ................................ ........... 115

PAGE 12

12 LIST OF ABBREVIATION S ADPRT ADP Ribosyltransferase domain BSA Bovine serum albumin CF Cystic fibrosis DMEM DNA Deoxyribonucleic acid EA Exotoxin A E. coli Escherichia coli ExoS Exoenzyme S ExoT Exoenzyme T ExoU Exoenzyme U ExoY Exoenzyme Y FBS Fetal bovine serum GAP GTPase activating protein GFP Green fluorescent protein iPS cell Induced pluripotent stem cell kD Kiladalton L broth Luria broth MDM2 Murine double minute 2 MEF Mouse embryonic fibrob last MLD Membrane localization domain MOI Multiplicity of infection NDK Nucleoside diphosphate kinase NDP Nucleotide diphosphate NGS Normal goat serum

PAGE 13

13 NTP Nucleotide triphosphate NLS Nuclear localization sequence OD Optical den si ty P. aeruginosa Pseudomona s aeruginosa PBS Phosphate buffered saline PI Propidium iodide PLA Phospholipase A 2 activity SOD Superoxide dismutase T1SS Type I secretion system T3SS Type III secretion system TCA Trichloroacetic acid X Gal 5 bromo 4 chloro indolyl D galactopyranoside

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE TYPE III SECRETION SY STEM OF P seudomonas aeruginosa : APPLICATIONS AND THE DISCOVERY OF A NOVEL CYTOTOXIN By Dennis Kyle Neeld May 2012 Chair: Shouguang Jin Major: Medical Sciences Immunology and Microbiology Pseudomonas aeruginosa is an opportunistic pathogen responsible for causing diseases in immunocompromised individuals. Disease results from the production of numerous virulence factors, some of which are injected directly into the host via the type III secretion system (T3SS). Recent breakthroughs in the field of cell biology have demonstrated that eukaryotic cells could be transformed back into a pluripotent state by the e c topic expression of several transcription factors, however this is accomplished with the use of integratin g oncogenic viral vectors. We therefore set out to develop a protein delivery system that could replace current methodologies, which would meet an emerging need in the field of cell biology Studies have demonstrated that proteins of interest could be deli vered into the cytosol of a host eukaryotic cell by fusion to the first 54 amino acids of the type III effector Exoenzyme S (ExoS). In this work, we demonstrate for the first time, the ability to deliver functional nuclear proteins into mammalian cells usi ng a strain of P. aeruginosa which is greatly diminished in cytotoxicity. Although the protein delivery strain was reduced in cytotoxicity for incubations with cells for less than 3 hours, longer times still resulted in cytotoxicity. Work presented in

PAGE 15

15 thi s study demonstrates that residual toxicity results from the injection of nucleoside diphosphate kinase (NDK) into host cells. Evidence presented in this work shows that NDK is not injected like traditional type III effectors, but instead is secreted first into the extracellular environment via a type I secretion system (T1SS) and then translocated into the host cell by the T3SS. These results are evidence in support of a newly emerging model of type III secretion whereby effectors are first secreted from t he bacteria, and then injected into the target cell. ExoS is a potent type III secreted toxin which has shown the ability to kill cancerous cells by inducing apoptosis. Since ExoS must be activated by eukaryotic 14 3 3 proteins, we examined if ExoS could b e put under control of a cancer specific p rotein murine double minute 2 (MDM2), by replacing the 14 3 3 binding domain with a domain for MDM2. Studies from this work show that while the manipulated form of ExoS was reduced in cytotoxicity, it still had a functional ADP ribosylation domain, suggesting that MDM2 could play a role in the activation. As a whole, the results presented in this work demonstrate that P. aeruginosa can be utilized as a protein delivery system. They also identified a novel type III injected effector, which is injected into host cells via a novel mechanism. Finally, work presented here suggests that ExoS has the potential to be manipulated in such a fashion as to promote cancer cell specific killing.

PAGE 16

16 CHAPTER 1 INTRODUCTION P seudomonas aeruginosa Basic Microbiology Pseudomonas aeruginosa is the most studied member of the genus Pseudomonas which belongs to the family Pseduomonadaceae. It is a ubiquitous gram negative bacillus that is found throughout the environment, as well as in many areas of hospitals ( 38 ) P. aeruginosa is classified as an obligate aerobe and typically nonfermentative ( 163 ) The ability to survive in many different environments results from the fact that it can use over 30 different organic compounds for growth and can grow at higher temperatures than most other enteri c organisms ( 116 163 ) Role as a Human Pathogen Although P. aeruginosa is found throughout the environment, it functions as an opportunistic pathogen that typically causes diseases in immunocompromised individuals such as patients suffering from HIV or patients undergoing chemotherapy ( 158 ) ( 166 ) Infections from this organi s m are also commonly observed in individuals who have suffered severe burn wounds ( 129 ) Surveillance s tudies have shown that P. aeruginosa is responsible for 11 13% of all nosocomial infections when a microbiological isolate was identi fiable, and that this percentage is higher in infections found in intensive care units (IC Us) ( 37 ) The types of infections common to P. aeruginosa include but ar e not limited to urinary tract infections, soft tissue infections, pneumonia and even ulcerative keratit i s ( 149 165 ) While P. aeruginosa is able to cause numerous types of infections it is well known for its ability to colonize the lungs of patients suffering from cystic fibrosis (CF) ( 72 ) CF

PAGE 17

17 is a genetic disease cause by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), which disrupt normal ion flow in lung epithelial cells ( 172 ) This resu lts in elevated levels of mucus, which prevents normal clearing of particles from the lungs ( 171 ) In 2004, it was reported that 57% of reported respiratory cultures from CF patients contained isolates of P. aeruginosa which highlight the importance of this organism in disease ( 37 ) One study has shown that the CFTR plays a role in the uptake and clearance of P. aeruginosa by lung epithelial cells. Additionally, it was shown that m utations in the CFTR gene prevent bacterial uptake and can promote conditions for chronic bacterial c olonization ( 127 ) Antibiotic Resistance One of the major reasons that P. aeruginosa infections are able to thrive in hospitals is due to the emergence of multidrug resistant strains. These strains can display resistance to multiple drugs such as ceftazidime, ciprofloxacin, imipenem, and tobramycin ( 118 ) Due to its low outer membrane permeability, P. aeruginosa is naturally resistant to most antibiotics ( 18 ) In addition, P. aeruginosa possesses multiple drug efflux pumps which function to remove antibiotics from the bacterial cytosol ( 97 ) Genetic mutations, as well as acquisition of novel resistance mechanisms through gene transfer or plasmid uptake, also contribute to the drug resistanc e seen in P. aerugionsa ( 18 ) As a result of the increasing emergence of resistant strains, new strategies for treating P. ae ruginosa infections are being developed. One such method is to treat infections using multiple drugs simultaneously, although studies are currently still examining the efficacy of such attempts ( 159 ) New strategies also include developing molecules that can target virulence factors such as the T3SS ( 2 ) A recent study has

PAGE 18

18 reported that utilization of a mouse monoclonal antibody against PcrV, a protein a t the tip of the needle, in combination with antibiotics was able to reduce disease in a mouse model of pneumonia when compared to the use of antibiotics alone ( 146 ) Studies have also identified small molecule inhibitors of ExoS, however these have not been used in animal studies ( 9 ) Pseudomonas aeruginosa Virulence Factors Flagellum P aeruginosa possesses a single polar flagellum that is utilized for motility and aids in biofilm formation ( 21 ) Studies have shown that the flagellum is responsible for stimulating Toll like receptor 5 located on the oute r surface of airway epithelial cells which results in the production of proinflammatory cytokines ( 1 ) The importance of the flagellum in virulence is highlighted by infections in several animal models, which show that strains lacking flagellum are greatly attenuated in toxicity ( 41 112 ) Observations from patients who are chronically infected with P. aeruginosa show approximately 39% of strains iso lated do not produce flagella ( 103 164 ) It is believed that after the initial colonizatio n of P. aeruginosa the bacteria down regulates expression of the flagella in an attempt to avoid the host immune system ( 12 174 ) Quorum Sensing and Biofilms Quorum sensing is a mechanism that bacteria utilize in order to communicat e with each other ( 47 ) P. aeruginosa has two defined quorum sensing pathways, the las and rhl systems ( 125 ) These systems w ork by producing small diffusible molecules, known as autoinducers, which are spread to surrounding bacteria and are responsible for binding to transcriptional activators and inducing expression of various genes ( 133 ) Quorum sens ing has been linked to the expression of toxins such as Exotoxin A and

PAGE 19

1 9 elastase ( 51 ) Additionally, studies have shown that the secreted autoinducers from P. aeruginosa are able to generat e an immune response in the host cells ( 145 ) Biofilms are highly organized bacterial communities encased in a polysacch aride coat ( 63 ) P. aeruginosa is well know for its ability to form biofilms in surgical implants and the lungs of CF patients ( 37 ) This type of growth is problematic due to the fact the polysaccharide coat protects the bacteria from antibiotics and other environmental stresses, which make it more difficult to treat the infections. Type I Secretion System P. aeruginosa is known to possess several type I secretion systems ( 17 ) These secretion systems are the most basic of the six known systems consisting of outer and inner membrane proteins connected by an adaptor protein. These systems are also commonly referred to as ABC transporters due to the fact the inner membrane proteins are ATP bind cassette proteins whic h provide energy for protein secretion ( 35 ) Substrates destined for secretion through this system possess a non cleavable secretion signal located in the C terminal portion of the protein ( 17 ) During secretion, the signal sequence interacts with a nucleotide binding domain located in the inner membrane protein and undergoes a conformational change which presumably generates the energy for protein secretion through the hydrolysis of ATP ( 17 ) P. aeruginosa utilizes these systems to secrete virulence factors such as alkaline proteases and NDK ( 101 ) Other P. aeruginosa Secretion Systems Six types of secretion systems have been identified in gram negative bacteria known as the type I through type VI secretion sys tems ( 64 ) While each of these systems are unique, they share a common function of transporting proteins across th e

PAGE 20

20 bacterial membranes. P. aeruginosa is known to possess type I, II, III, V, and VI secretion systems ( 101 ) The type II system is fairly conserved among gram negative bacteria and is responsible for secreting proteins into surrounding media ( 25 ) In P. aeruginosa the type II system is responsible fo r secreting the potent Exotoxin A ( 135 ) Type V secreted proteins are referred to as autotransporters due to the fact they encode a domain which forms a barrel for their own export f rom the bacteria ( 17 ) Type VI secretion systems are a recently discovered system. While there is still much to be learned about thes e systems, it has been shown that the P. aeruginosa system secretes a protein known as HcpI, which is able to generate an immune response in CF patients ( 115 ) Although P aeruginosa possess several secretion systems, all of which contribute to virulence, the most known of the se systems is the type III secretion system. Exotoxin A Exotoxin A (EA) is considered to be one the most potent toxins secreted by P. aeruginosa It is secreted via the t ype II secretion system, which is controlled by a quorum sensing mechanism ( 135 ) The toxicity of EA results from its ability to ADP ribosylate the eukaryotic elongation factor 2 protein, which ultimately leads to infected cells undergoing apoptosis ( 44 ) P. ae ruginosa secretes EA into the surrounding media, where it binds to the 2 macroglobulin receptor located on the surface of lung epithelial cells and is internalized ( 87 ) Increased levels of EA in bronchial secretions of CF patients correlate with severity of the disease demonstrating the role of this toxin in P. aeruginosa pathogenesis ( 94 )

PAGE 21

21 Nucleoside Diphosphate Kinase Nucleoside diph osphate kinase is a protein that is responsible for converting nucleotide diphos p hates (NDP) into nucleotide triphosph ates (NTP) by transfer of a terminal phosphate group ( 147 ) In P. aeruginosa NDK has been shown to be secreted via a type I secretion system, although the exact transporter has yet to be identified ( 80 ) Reports have shown that secreted NDK is cytotoxic to macrophag es, presumably through a mechanism where NDK disrupts extracellular ATP concentrations which eventually causes macrophages to undergo apoptosis ( 181 ) It has been reported t hat not all strains secrete NDK, but only the mucoid producing strains ( 181 ) Pseudomonas aeruginosa Type III Secretion System Type III Secretion Syste m The type III secretion system (T3SS) is a proteinacious needle that protrudes from the bacterial surface and is capable of delivering toxins, known as effectors, directly into the cytosol of eukaryotic cells ( 55 91 ) Many gram negative species such as Pseudomonas Yersinia and Shigella utilize this system in order to establish infection in host cells ( 32 107 121 ) The repertoire of effector molecules secreted by bacteria possessing the T3SS var ies greatly, with some causing the uptake of bacteria for intracellular survival and other s inducing apoptosis ( 27 ) This secretion system is not only limited to bacteria that cause disease s in mammals, as plant pathogens also utilize it for survival in a variety of p lant species ( 96 ) Bacteria are believed to have acquired the T3SS though horizontal gene transfer based on evidence which demonstrates that these systems are typically encoded in pathogenicity islands in the bacterial chromosome. Additionally, the regions encoding the T3SS can also be located on

PAGE 22

22 plasmids and bacteria can possess multiple systems located in different areas of the bacterial genome ( 59 ) Structural Features of the T3SS The T3SS is a macromolecular structure composed of more than 20 different proteins ( 168 ) At the core of the system is the basal body, which spans both bacterial membranes as well periplasmic space. It is composed of two ring like structures, one situated in the bacterial inner membrane and the other in the outer membrane linked together by a hollow inner rod ( 113 ) Interestingly, the basal body of the T3SS is very similar in structure and function to the flagell ar basal body suggesting that these two systems might be evolutionarily related ( 102 160 ) Upon an appropriate T3SS inducing stimulus, the basal body secretes proteins that make up the needle of th e T3SS. In P. aeruginosa the needle is composed of the PscF protein which generates needles that can range from 60 70nm in length and 6 7nm in width ( 73 122 ) Once the needle has been formed, the T3SS begins to secrete proteins that f or m the translocation complex located at the tip of the needle. This complex is composed of the Pc rV PopB, and PopD proteins in P. aeruginosa and is necessary for the injection of proteins into eukaryotic cells ( 62 ) PopB and PopD alone have been shown to form pores in lipid vesicles suggesting that these two proteins are responsible for pore formation when the bacteria come in contact with the host cell ( 57 ) PcvR is believed to control the pore size by facilitating t he interaction of PopB and PopD at the tip of the needle ( 57 ) Once the T3SS is completely assembled it begins to secrete effector molecules The number of effectors as well as their function varies greatly among bacterial species ( 27 148 ) However, despite their differences, all effectors are believed to

PAGE 23

23 encode a signal sequence which facilitates their secretion through the T3SS ( 154 ) It is not unusual for bacteria to express several effectors simultaneously, yet bacteria are able to secrete them in a p articular order. Recent work in Salmonella typhimurium has suggested that a cytoplasmic sorting platform exists in which effectors are loaded prior to secretion. Based on the loading order of proteins and the use of specialized chaperones the T3SS is able to recognize the order in which proteins should be exported ( 93 ) Regulation of T3SS in P. aeruginosa Although it is known that the contact with host cells and low extracellular calcium concentrations are able to induce the T3SS, the exact mechanism behind this is not completely resolved ( 62 ) However, there has been much research into the regulation of the T3SS and its products. In P aeruginosa a ll of the genes associated with the T3SS including structural components, chaperones, and secreted effectors, are all under control of the transcriptional activator ExsA, which is a member of the AraC family of activators ( 20 ) Transcription of T3SS related genes is closely tied with type III secretion. When the type III system is repressed, ExsA is bound to an anti activator ExsD, which blocks ExsA mediated transcription ( 177 ) However, under type III inducing conditions, an anti anti activator binds ExsD and frees ExsA to allow expression of type III secretion components ( 177 ) P. aeruginosa Type III Secreted Effectors P. aeruginosa possesses four known type III secreted effectors: Exoenzyme S (ExoS), Exoenzyme T (ExoT), Exoenzyme U (ExoU), and Exoenzyme Y (ExoY) ( 38 ) Compared to other type III containing bacteria such as Salmonella, this is a r elatively low number ( 27 ) Although P. aeruginosa has four effectors, strains usually only contain

PAGE 24

24 three. Sequencing of numerous strains of P. aeruginosa revealed that a vast ma jority contain s ExoT and ExoY. How ever, it has been shown that only 28 42% of strains contain ExoU, and 58 72 % of strains have ExoS, but none contain both ExoS and ExoU ( 42 ) Therefore strains either possess ExoS, ExoT, and ExoY or ExoU, ExoT, and ExoY. The type of cytotoxic response seen in infected cells usually depends on whether the strain s contain ExoU or ExoS, as these two toxins are the most cytotoxic. ExoU: ExoU is the largest type III secreted effector from P. aeruginosa comprised of 687 amino acids and possessing a molecular weight of approximately 74kD ( 43 ) It is regarded as one of the most potent toxins expressed by P. aeruginosa due to its phospholipase A 2 (PLA) activity which elicit s cyto toxicity through its ability to cleave fatty acids at the sn 2 position resulting in products which are stimulators of the inflammatory response ( 138 144 ) In order for ExoU to generate a toxic effect, it must be activated by the eukaryotic co factor superoxide dismutase (SOD) which interacts with specific amino acids located in the C terminal end of ExoU and induces a con formational change ( 140 ) ( 14 137 ) Interestingly, ExoU is ubiqui tin ated, although this does not appear to have a negative impact on the ability of the protein to induce toxicity ( 150 ) Recent evidence actually suggests that ubiquitination might play a role in the activation of ExoU ( 7 ) ExoT: ExoT is a 53 kD bifunctional to xin that shares 76 % amino acid sequence homology with ExoS. Like ExoS, it possess es both a N terminal GTPase activating protein domain (GAP) and a C terminal ADP ribosyltransferase domain (ADPRT) ( 53 82 ) The GAP domain of ExoT is responsible for causing rounding of the infected cell by disrupting the functions of Rho, Rac, and CDC42 ( 88 ) In addition, it has also been

PAGE 25

25 implicated in blocking cytokinesis by targeting RhoA ( 142 ) Studies have shown that the GAP domain of ExoT pl ays an inhibitory role in lung epithelial cell wound healing, which probably is a result of the disruption of the cellular cytoskeleton and focal adhesions ( 54 ) Similar to ExoS, the ADPRT domain of ExoT requires activation from eukaryotic 14 3 3 proteins ( 11 ) While both toxins share similar ADPRT domains, the substrates they target differ Exo S is known to induce apoptosis by ADP ribosylating Ras proteins however ExoT does not yet is still able to induce apoptosis although at a slower rate t han that by ExoS ( 152 ) The ADPRT of ExoT has been shown to target both CrkI and CrkII proteins, which results in inhibition of pha gocytosis and bacterial uptake by the infected cell (37). Although ExoT has the ability to induce toxicity on its own, ExoS and ExoU often mask its toxic effects ExoY: ExoY is th e smallest of the four type III secreted effectors encoded by P. aeruginosa w ith a molecular weight of 42 kD. It has been identified as an adenylate cyclase, with homology to other adenylate cyclases from both Bordetella pertussis and Bacillus anthracis ( 176 ) ExoY is responsible for altering cyclic AMP levels in infected cells, which ultimately lead to rounding and prevention of bacterial uptake ( 34 ) Like the other type III secreted effectors of P. aeruginosa ExoY needs to be activated by a eukaryotic co factor however, the identity of the factor is currently unknown ( 176 ) Recent studies have shown that the adenylate cyclase activity of ExoY is able to mediate bleb niche formations in infected cells, similar to ExoS, although the exact role this plays in pathogenesis is currently u nder investigation ( 75 )

PAGE 26

26 ExoS: ExoS is a 453 am ino acid protein comprised of several different function al domains that contribute to the cytotoxicity of infected cells (Figure 1 1) Located in the N terminus of ExoS is the signal sequence necessary for its secretion through the T3SS ( 10 ) Once injected into host cells, ExoS localizes to the cell membra ne via a leucine rich membrane localization domain (MLD) located from amino acids 51 72 ( 183 ) Studies have demonstrated that the MLD is also responsible for targeting ExoS to endosomes, which then transport it to the perinuclear region of the cell where it can interact with additional substrates ( 184 ) ExoS is a bifunctional toxin containing two cytotoxic domains, a N terminal GAP domain, and a C terminal ADPRT domain ( 56 130 ) The GAP domain i s responsible for targeting the small molecular weight GTP binding proteins (GTPases) Rho, Rac, and CDC42, which ultimately leads to the rounding and lifting of infected cell s ( 68 151 ) Typically, GTPase proteins cyc le between an inactive GDP bound form and an active GTP bound form, but the GAP domain of ExoS forces proteins to be in the inactive GDP bound state, thereby disrupting cell signaling ( 4 ) Unlike the GAP domain, the ADPRT domain requires activation from a eukaryotic co fa ctor identified as 14 3 3 proteins, in order to generate toxicity ( 48 ) These proteins play critical roles in cell signaling by facilitating a ctivities such as apoptosis, protein trafficking and cell division ( 114 ) The interaction of ExoS with 14 3 3 proteins is unique due to the fact it binds in the opposite orientation of most known 14 3 3 ligands ( 120 ) Additionally, ExoS does not rely on t he use of phosphoserine for binding whereas most known 14 3 3 binding partners do ( 66 175 ) While it is clear that ExoS must interact with 14 3 3 to activate the ADPRT domain, the exact mechanism of activation remains

PAGE 27

27 elusive. Based on the activities of 14 3 3 proteins, it is believed that these proteins induce a conformational change in the ADP RT, thereby rendering it active. Once activated, the ADPRT domain of ExoS ADP ribosylates various cell signaling proteins such as ezrin, moesin, vimentin, Ral, and Ras proteins ( 29 46 104 ) Of the known target proteins, the interaction with Ras is the most extensively studied. Ra s is a GTPase protein responsible for regulating critical cellular responses such as proliferation, differentiation, and apoptosis ( 141 ) ExoS is able to block catalyzed nucleotide exchange of Ras which inactivates it and leads to the inhibition of the ERK sur vival pathway ( 5 2 67 ) ExoS mediated cell death is complicated and still not completely understood. It has been de monstrated th at cells expressing a constitutively active form of Ras can be rescued from the effects of ExoS, suggesting that Ras inhibition is the major cause of ExoS related toxicity ( 76 ) However, it has also been shown that the JNK pathway is also responsible for toxicity, as expression of a dominant negative JNK in HeLa cells reduces ExoS mediated apoptosis ( 77 ) Since the ADPRT domain has so ma ny substrates, it is possible that the overall toxicity from ExoS does not come from disruption of just one pathway, but a combination of multiple pathways. Recent s tudies have also shown that the ADPRT of ExoS is able to promote bacterial penetration thro ugh tight junctions into the intestinal tract and aid in survival inside eukaryoti c cells, which highlight the complexity of ExoS induced toxicity in infected cells ( 8 119 )

PAGE 28

28 Figure 1 1. Diagram displaying the functional domains of ExoS. The green po rtion of ExoS represents the MLD domain. The blue segment corresponds to the GAP domain and the red portion is the ADPRT. Located in the back area is the C terminal 14 3 3 binding domain. The amino acids circled are the catalytic sites for GAP and ADPRT ac tivities.

PAGE 29

29 CHAPTER 2 GENERAL MATERIALS AND METHODS Bacterial Strains and Plasmids The bacterial strains and plasmids used throughout this entire work are listed in T able 2 1 and T able 2 2 respectively. All plasmid constructs synthesized were designed using the primers listed in T able 2 3. Detailed information regarding the cloning of each construct is listed in each upcoming chapter. Both E. coli and P. aeruginosa were grown by shaking in Luria (L) broth or on L agar plates at 37 C. The final concentration of P. aeruginosa E. coli Before both protein secretion and injection a ssays, P. aeruginosa strains were sub culture into 2mL of fresh L broth containing antibiotics. For infection assays, bacteria were cultured to early log phase, which corresponds to an optical density (OD) of 0.8 to 1.0. Eukaryotic Cell Culture Both HeLa and mouse embryonic fibroblast (MEF) cell lines were grown in a (DMEM) (Gibco) with the addition of 5 % fetal bovine serum (FBS). Te26 cells were cult ured in DMEM containing 10% FBS, and both H1299 and H1299 HDM2 were grown in DMEM with 5% CO 2 H1299 HDM2 cells were also cultured with 500 per ml of geneticin (G418) in order to select for the plasmid expressing the human form of the MDM2 protein. It should be noted that

PAGE 30

30 all serum used was heat inactivated. This prevented bacteria from being killed by complement components present in the serum. Bacterial Protein Secretion Assay P. aeruginosa strains were grown overnight in a 37C shaking incubator with L broth c ontaining antibiotics. The follo wing morning, bacteria were sub cultured and grown for 3 hours. Bacteri a were then collected and pelleted by centrifugation at 20,000 x sample loading buffer (BioRad). Samples were boiled for 10 minutes and then stored at 20C until use. When indicated, su pernatants were trichloroacetic acid (TCA) precipitated in order to improve visualization of protein on Western blots. This was accomplished by mixing the 1ml of Samples were then centrifuged a t 20,000xg for 10 minutes to pellet down protein. The l of acetone, followed by centrifugation at 20,000xg for 5 minutes. Supernatants were cleared, and the pellet was allowed to air dry at room temp erature for 10 minutes. The remaining pellet was then minutes. Protein Injection Assay Mammalian c ells were seeded at 70% confluency (8.4 x 10 5 cells) in 6 well plates in DMEM containing antibiotics the night before infection. Two hours prior to infection, the media was removed and cells were washed 2 times in PBS to remove residual antibiotics followed by addition of 1 ml of fresh DMEM lacking antibiotics. After chang ing the media, P. aeruginosa strains were grown unt il they reached early log phase. For an MOI 20, 2 x 10 7 CFU per ml of bacteria were incubated with the cells for

PAGE 31

31 the desired length of time. Following infection, bacteria were cleared by removing media and washing the cells twice in PBS. Cells were then harvested by incubation with 0.25% trypsin for 5 minutes at 37C and then pelleted by centrifugation at 500xg for 5 minutes. The supernatants were removed and the cells were washed in PBS 3 times in order to remove any bacteria still present. Cells were then subject to lysis by incubation with 0.25% Triton X 100 in PBS for 10 minutes on ice which only lyses mammalian cells Following lysis, the cells were centrifuged at 20,000xg for 2 minutes and the superna tant was mixed with S amples were then boiled for 10 minutes before storage at 20C

PAGE 32

32 Table 2 1. List of bacterial strains used in this study Strain Description Source of reference P. aeruginosa PAO1 Common laboratory strain ( 74 ) PAK Common laboratory strain David Bradley PAK J Derivative of PAK with enhanced T3SS ( 16 ) PAK pscF PAK J derivative with deletion of pscF This study PAK popD PAK J derivative with deletion of popD This study PAK exsA PAK J derivative with deletion of exsA This study PAK S PAK J derivative with deletion of exoS This study PAK T PAK J derivative with deletion of exoT This study PAK S T PAK J derivative with deletion of exoS and exoT This study PAK S TY PAK J derivative with deletion of exoS, exoT, and exoY This study PAK N S TY PAK J derivative with deletion of exoS, exoT, exoY, and popN This study PAK 7 PAK J NTSY with deletion of xcpQ, lasR, and lasI This study PAK 8 PAK 7 with deletion of ndk This study E. coli DH F $80% lacZ &M15 endA1 recA1 hsdR17 (r 'm+') supE44 thi 1 relA1 &( lacZYA argF ) U169 gyr A96 deo R (92) ( 61 ) S17 Strain expressing DNA mobilization genes This study

PAGE 33

33 Table 2 2 List of plasmids used in this study Plasmid Description Source of reference pUCP20 Escherichia Pseudomonas shuttle vector Ap r Cb r ( 170 ) pUCP18 Escherichia Pseudomonas shuttle vector Ap r Cb r ( 170 ) pEX18TC Vector containing sacB and Tc r for exconjugant selection ( 70 ) pEX18TC S pEX18TC containing 1kb regions upstream and downstream of exoS Tc r This stud y pEX18TC T pEX18TC containing 1kb regions upstream and downstream of exo T Tc r This study pEX18TC Y pEX18TC containing 1kb regions upstream and downstream of exo Y Tc r This study pExoS17 Cre 17 aa of ExoS fused to cre recombinase in pUCP20 Cb r ( 16 ) pExoS54 Cre 54 aa of ExoS fused to cre recombinase in pUCP20 Cb r ( 16 ) pExoS96 Cre 96 aa of ExoS fused to cre recombinase in pUCP20 Cb r ( 1 6 ) pExoS234 Cre 234 aa of ExoS fused to cre recombinase in pUCP20 Cb r ( 16 ) pExoS Cre Full length ExoS fused to cre recombinase in pUCP20 Cb r ( 16 ) pHW0224 exoS mutated at R146K E381A in pUCP18 Cb r ( 60 ) pHW00 29 Wild type exoS in pUCP18 Cb r ( 60 ) pPaNDK Flag tagged NDK from P. aeruginosa in pUCP20 Cb r This study pPaNDKH117Q pPaNDK with kinase null NDK Cb r This study pEcNDK Flag tagged NDK from E. coli in pUCP20 Cb r This study pHuNDK Flag tagged NDK of human origin in pUCP20 Cb r This study pCDNA3.1(+) Eukaryotic expression vector containing CMV promoter Ap r Invitrogen pJJ0322 exoS in pEGFP C1; Km r ( 78 ) pDNNDK ndk from P. aeruginosa in pCDNA3.1(+) Ap r This study pDNNDKH117Q pDNNDK with kinase null ndk mutant Ap r This study pEGFP 1 Constitutive mammalian expression vector containing egfp (CMV promoter); Km r BD Clontech pNDK133 133 aa of NDK with Flag tag in pUCP20 Cb r This study pExoSP53 P53 binding domain in place of ExoS 14 3 3 binding domain in pUCP20 Cb r This study pExoSPDIQ High affinity P53 binding domain in place of ExoS 14 3 3 binding domain in pUCP20 Cb r This study

PAGE 34

34 Table 2 2. Continued Plasmid Description Source of reference pExoS1E6N P53 null binding domain in place ExoS 14 3 3 binding domain in pUCP20 Cb r This study pExoS 14 3 3 Deletion of 14 3 3 binding domain of ExoS in pUCP20 Cb r This study pExoSRK ExoS containing catalytically inactive GAP domain This study

PAGE 35

35 Table 2 3 List of primers used in this study Primer ExoS Cre Fusions ExoS up GACGAATTCGGCGTCTTCCGAGTCACTGGAGGC ExoS17 dn GACGAGTCGTGCAATTCGACGGCGAAAGACGG ExoS54 dn GAGCTCGAGCAGCCCCTCACCCTTCGGCGCGTCC ExoS96 dn GACGAGCTCGGACATCAGCGCAGGCTGCGCGTC ExoS234 dn GACGAGCTCCTTGTCGGCCGATACTCTGCTGAC FullExoS dn GACGAGCTCGGCCAGATCAAGGCCGCGCATCCT Cre up GGAGCTCATGCCTAAGAAGAAACGAAAGATC Cre dn CGAGGTCGACGGTATCGATAAGCTTG T3SS deletions ExoS up 1. CAAGGAATTCGGATTATGCGGAGGGGTTGCCGGTG 2. GTTGAGATCTCCTGATGTTTCTCCGCCAGTCTAGGAA ExoS dn 1. GTCCAGATCTTGGCTCGGCAGCGGATCCGGGTGGAG 2. TGGAAAGCTTCGTCATCCTCAATCCGTACGGCAGGC ExoT up 1. GGAGGAATTCGAAGGGGTTGCGCAGGCCTGGCTCGTC 2. TGACGGATCCTGATGTTTCCCCGCCAGTCTAGGAACG ExoT dn 1. CGGAGGATCCCAAGGGGTGTCCGTTTTCATTTGCGCC 2. AGGTAAGCTTCCAGCGCCTGCGCCTGGGCCTCCTTG ExoY up 1. AACTGAATTCCGAGGATGTCGCCCTGCTCGACCATCGG 2. CCCAGGATCCAGGAGGCGCTCGACTTTTTCCAACGTA ExoY dn 1. ATAAGGATCCGGGCAGCGGCGAGATATCAGAAAACG 2. CGTTAAGCTTGAGATAGCCGAGCATGCTCAGGCCGTC NDK constucts PaNDK up GGAGAATTCGCGCCTGGCCA TCGCGGCGCAGATGG PaNDK dn GGACTGCAGTCACTTGTCGT CATCGTCCTTGTAGTCGCGA A TGCGCTCGCAGACTTCGGTA GCCGC EcNDK up ACCGGATCC CGCGACAGTGAAATTTGTCA TGCAATAGTC EcNDK dn ACCAAGCTTTCACTTGTCGTCATCGTCCTTGTAGTCACGGGT GCGCGGGCACACTTCGCCTTC HuNDK up ACCGGATCC CGCGACAGTGAAATTTGTCA TGCAATAGTC HuNDK dn ACCAAGCTTTCACTTGTCGTCATCGTCCTTGTAGTCTTCATA GACCCAGTCATGAGCACAAGA PaNDKpCDNA up ACCGGATCCGCCATGGCACTGCAACGCACCCTGTCCATCAT C PaNDKpCDNA dn ACCGAATTCTCAGCGAATGCGCTCGCAGACTTCGGTAGCCG C NDK133 dn GGAGAGCTCTCACTTGTCGTCATCGTCCTTGTAGTCGAAGA AGTAGGCGATCTCGCGAGCGG H117Q mutations NDKH117Q up CGAGAACGCCGTCCAGGGATCCGATTCCGAAGCTTCC NDKH117Q dn GGAAGCTTCGGAATCGGATCCCTGGACGGCGTTCTCG

PAGE 36

36 Table 2 3. Continued Primer ExoS P53 Fusions F ExoS R1 CAGGAATTCGAGTTGATGGTGGATCTGGGCCC ExoS P53 dn AGCAAGCTTTCAGTTCTCGGGCAGATGCTTCCACAGGTCGC TGAAGGTTTCCTGGCTATGGCCACTCTGCTCCCCCAG ExoS PDIQ dn AGCAAGCTTTCAGTTGCTCAGAAGCTGTGACCACCAATGTT CGAAGGTTTCCTGGCTATGGCCACTCTGCTCCCCCAG ExoS 1E6N dn AGCAAGCTTTCAGTTGCTGGTCAGCTGGGCCCAGTTATGTT CGAAGGTTTCCTGGCTATGGCCACTCTGCTCCCCCAG ExoS 3 3 dn AGCAAGCTTTCA CTGGCTATGGCCACTCTGCTCCCCCAG

PAGE 37

37 CHAPTER 3 BACTERIAL DELIVERY O F FUNCTIONAL NUCLEAR PROTEINS INTO DIFFERENTIATED CELLS Background Bacteria l pathogens are equipped with a plethora of virulence factors that enable them to modify eukaryotic cells and cause diseases in humans One common factor u tilized by man y gram negative pathogens is the type III secretion system (T3SS). The T3SS is a proteinacious needle that is used to deliver cytotoxins, known as effectors, directly from the bacteria into the cytosol of a host eukaryotic cell ( 31 50 ) While this system is highly conserved among b acteria, the secreted effectors can display diverse functions in eukaryotic cells ra nging from the ind uction of apoptosis to bacterial uptake ( 27 148 ) Although the effectors can differ greatly in function, they all contain a variable N terminal signal sequence that is responsible for guiding them through the T3SS ( 99 154 ) Pseudomonas aeruginosa is a gram negative opportunistic pathogen that is responsible for causing disease s in immunocompromised individuals, most notably those suffering from c ystic fibrosis or severe burn wounds ( 100 ) Disease results from production of a number of virulence factors, but most prominently from the T3SS. The T3SS of P. aeruginosa is highly regu lated, both at the transcriptional and translational levels and becomes activated during the course of infection when the bacteria come in contact with hos t cells, although the exact mechanism is not well characterized ( 177 ) P. aeruginosa contains four known type III secreted effectors, although strains only harbor three of them ( 62 ) Exoenzyme Y (ExoY) is an adenylate cyclase and Exoenzyme U (ExoU) is a poten t phos p ho lipase that breaks down eukaryotic cell walls The remaining effectors, Exoenzyme S (ExoS) and Exoenzyme T (ExoT) are highly homologous bi

PAGE 38

38 functional toxins that possess ADP ribosyltransferase activities (ADPRT) as well as GTPase activating protein (GAP) domains ( 33 ) Of these effectors, ExoS is the most studied and best characterized. Recent studies have demonstrated that functional proteins co uld be delivered into the cytosol of eukaryotic cells by fusing them to various lengths of the N terminus of ExoS ( 39 128 ) Specifically, ovalbumin fused to the first 54 amino acids of Exos was shown to be injected into the cells of a mouse, thereby inducing a CD8 + T lymphocyte response against the infected cells ( 40 ) Recent breakthroughs in the field of cell biology have demonstrated that terminally differentiated cells could be reprogrammed back into a pluripotent state by forced exogenous expression of four transcription factors: Oct4, Sox2, cMyc, and Klf4 ( 153 ) ( 180 ) While this technology holds tremendous potential for clinical therapies, there are some reservations. Current protocols for deriving induced pluripotent stem cells (i PS cells) rely on the use of integrating oncogenic viral vectors for transgene expression. Additional methods to overcome this such as DNA transfection and the use of purified proteins have had some success, although the efficiencies of reprogramming are m uch lower ( 143 179 186 ) Development of a simple and efficient protein delivery system would satisfy an emerging need in the field of cell biology. While it has been demonstrated that P. aeruginosa can be manipulated to deliver proteins of interest into the cytosol of eukaryotic cells, one has yet to demonstrate successful delivery of nuclear proteins. Cre recombinase is a widely used genetic tool in the field of molecular biology, especially for the purpose of generating conditional gene knockouts in animal models ( 108 ) It is a bacteriophage derived protein which excises DNA sequences that are

PAGE 39

39 flanked by loxP sites. For proper execution of its recombinase activity, C re must localize to the nucleus in order to come in contact with target D NA, making it a convenient assay system to demonstrate the delivery of nuclear proteins ( 139 ) In this study, we are the first to use P. aeruginosa to successfully deliver a functional nuclear protein into eukaryotic cells. We demonstrate that C re recombinase fused to the first 54 amino acids of ExoS is sufficient for delivery into host cells, and that this fusion protein is functional Results presented here also show that amount of protein delivered can be adjusted by manipulating either the du ration of infection or the multiplicity of infection (MOI). Our results also suggest that the cell cycle plays a role in the recombination efficiency. Taken together, results presented here demonstrate the P. aeruginosa is capable of delivering functional nuclear proteins into host cells thereby paving the way for future studies using this system to generate iPS cells Materials and Methods Generation of ExoS Cre Fusion Proteins The ExoS C re fusion proteins were generated by PCR amplification of v lengths of ExoS using the primers listed in Table 2 3 Each primer contained either an EcoRI or SalI restriction site for convenient cloning into the pUCP20 vector. Cre recombinase was PCR amplified to include an SV40 la r ge T antigen nuclear localization Table 2 3 The variable portion of ExoS and C re recombinase were subject to a triple ligation with the P. aeruginosa vector pUCP20 using EcoRI SalI and SacI restriction sites. Upon completion, constructs were confirmed using rest riction enzyme digestions as well as DNA sequencing.

PAGE 40

40 Bacterial Expression of ExoS Cre Fusion Proteins ExoS C re fusion proteins were electroporated into the P. aeruginosa strain PAK STY The strains were then grown in L and 5mM EGTA for 3 hours in a 37C shak ing incubator Bacteria were collected and pelleted by centrifugation at 20,000xg for 2 minutes. The supernatants were removed and b minutes. Bacterial lysates were then run on a 4 20% gradient SDS PAGE gel and subjected to Western blotting with an antibody against C re recombinase ( A bcam ab41104 ). Bacterial Protein Secretion Assay The bacteria strains PA01, PAK, and PAK J were grown in a shaker at 37C in L broth containing 5mM EGTA. Bacteria were collected and pelleted by centrifugation for protein sample buffer and boiled for 10 minutes. Samples were run on SDS PAGE gels and subjected to Western blotting with an anti ExoS antibody (generated from rabbits by Lampire Biological Laboratories INC) which is capable of detecting bot h ExoS and ExoT. Protein Injection Assay Te26 cells were seeded into 6 well plates at approximately 70 % confluency (8.4 x 10 5 cells) in medium containing antibiotic the night before infection. Two hours prior to infection, cells were washed twice in 1X PBS and replaced with medium containing no antibiotics. Bacterial strains were grown in L broth supplemented with carbenicillin at 37 C until the OD 600 reached 0.8. For an MOI of 50 5 x 10 7 CFU per ml of bacteria were incubated with Te26 cells for the indicated amount of time. Following infection, bacteria

PAGE 41

41 were washed away and cells were harvested by scraping. Cells were spun down at 500xg for 5 minutes and then washed with PBS for 3 times. After centrifugation, Te26 cell pellets were suspended in 100 l of protein loading buffer Samples were boiled for 10 minutes and subjected to Western blotting using an antibody against C re recombinase. Immunostaining MEF cells were infected with the P. aeruginosa strain PAK for 3 hours at an MOI of 20. Bacteria were cleared by removing the infection media and washing the cells 3 times in 1X PBS and then cells were fixed with 3.7% formaldehyde in PBS at room temperature for 15 minutes. The cells were the n washed 3 times with PBS and permeablized with 0.5% Trion X 100 in PBS. Cells were washed 3 times with PBS and blocked with 1% BSA in PBST for 30 minutes followed by incubation in the primary antibody for 2 ExoS 1:400). The ce lls were then incubated in the secondary for 1 Rabbit conjugated to fluorophore 488) and then washed 3 times in PBST before visualizing under a fluorescence microscope. Cytotoxicity Assay MEF cells were infected with either PAK J or PAK STY for 3 hours at MOIs 20, 100, and 500. Following infection, dead cells were removed by washing cells 3 times with PBS. The remaining cells were then collected by incubation with 0.25% trypsin for 5 minutes at 37C. The number of viable cells w as then counted under a microscope using a hemocytometer.

PAGE 42

42 galactosidase Staining of Te26 Cells Te26 cells were infected with PAK STY /pExoS54 Cre at various times and MOIs as listed above. Following infection, the media was removed and cells were washed twice with PBS to remove residual bacteria. The cells were then fixed for 5 minutes at room temperature in a 1% formaldehyde and 0.2% glutaraldehyd e in PBS solution. The cells were then washed 3 times and strained galactosidase with a solution containing 4mM K 4 Fe(CN) 6 4mM K 3 Fe(CN) 6 2mM MgCl 2 and 0.4 mg per ml of X gal at 37C for 16 hours. The cells were then rinsed two times with water and the number of blue cells was counted under the microscope. Cell Synchronization Protocol Cells were synchronized to the early S phase using a double thymidine block. Te26 cells were seeded at 25% confluency (3 x 10 5 cells) in DMEM containing antibiotics t he night before synchronization. The next morning, cells were washed 2 times with PBS and fresh media containing antibiotics and 2mM thymidine was added for 18 hours. Afterwards, cells were released from the first thymidine block by washing twice in PBS an d adding fresh media containing antibiotics for 9 hours. Cells were then washed once with PBS and the second thymidine block w as started by adding media containing antibiotics and 2mM thymidine for 17 hours. Cells were then released from the second thymidi ne block by washing the cells in PBS and adding fresh media containing antibiotics. For infections assays, cells were released from the second thymidine block into media lacking antibiotics. After the second block, cells are synchronized to the early S pha se and then proceed into M phase and the rest of the cell cycle.

PAGE 43

43 Flow Cytometry Determining Phases of Cell Cycle Te26 cells were double blocked in thymidine as described above. Following the block, cells were collected at various time points in order to de termine a time frame f or each phase of the cell cycle. DNA content was determined by propidium iodide (PI) staining, followed by flow cytometry of the cells. Te26 cells were collected by incubating cells for 5 minutes at 37C with 0.25% tr y psin. Cells were then fixed overnight at 4C in 70% ethanol. After fixation, cells were pelleted by centrifugation at 500xg for 5 minutes and 0.5 mg per ml of PI) for 30 minutes at room temperature in the dark. Cells were then subject to flow cytometry to determine the content of DNA. Results Generation of a P. aeruginosa S train for Protein D elivery The common laboratory strain of P. aeruginosa (PAO1) secretes relatively low amounts of the type III eff ectors under type III inducing conditions. Therefore, we set out to identify a strain that was elevated for type III secretion with the goal of using this as t he strain for protein delivery into eukaryotic cells. Various laboratory, as well as clinical and environmental strains, were tested for their ability to secrete type III effectors by collecting supernatants after the bacteria were cultured under type III inducing conditions for three hours. Supernatants were then run on SDS page gel and subjected to Western blotting with an antibody against ExoS, which detect s both ExoS and ExoT due to their high sequence homology ( 11 ) Figure 3 1 shows that another laboratory strain, PAK, secretes higher levels of type III effectors than PA01. Interestingly, an isolate of PAK that has been passaged in our lab for over 10 years (referred to as PAK J) displayed even hig h er se cretion of ExoS and ExoT. Quantitat ive ELISA assays from

PAGE 44

44 our laboratory have demonstrated that PAK J secretes more than 10 times the amount of ExoS as the standard PAK strain ( 84 ) However, the exact mechanism explaining this is currently under investigation. As a result of its elevated secretion, PAK J is able to cause significant cytotoxicity when cultured with mammalian cells primarily as a result of ExoS. ExoS is efficiently injected in nearly 100% of the c ell s it comes in contact with and localizes to the perinuclear and outer membranes, as can be seen in Fig ure 3 2 ( 89 ) PAK J possess es ExoS, ExoT, and ExoY, which account for most of the cytotoxicity associated wi th this strain. In order to have an efficient strain for protein delivery, it needs to be capable of prolonged incubations with mammalian cells. To accomplish this, all three secreted effectors were deleted by successive allelic exchange resulting in the P aeruginosa strain known as PAK STY Infection of MEF cells with PAK J at a MOI of 20 for three hours resulted in a 75% decrease in cell viability as compared to non infected control cells (Fig ure 3 3 ) Toxicity was further increased by infection with higher MOIs of PAK J as there was a 95% decrease in viability in cells incubated with this strain at an MOI of 500 Conversely, infection with PAK STY for three hours at an MOI of 20 resulted in only a 25% decrease in cell via bility, and increasing the M OI did not result in increased cytotoxicity (Fig ure 3 3) Therefore, based on these assays, we selected PAK STY as the strain to use for protein delivery. Injection of Cre Recombinase Through the Bacterial Type III Secretion System Cre recombinase is a b acteriophage derived protein that is frequently used for excising specific DNA sequences that are flanked by LoxP sites ( 117 ) The Cre Lox system was chosen because C re is a DNA interacting protein that must migrate to the

PAGE 45

45 nucleus in order to carry out its r ecombinase activity. Additionally, t his assay system is convenient because there are many reporter cell lines available. In order to determine the optimal signal sequence necessary for maxi m um injection of C re recombinase, we generated a series of fusion proteins consisting of various N terminal lengths of ExoS fused to C re, with a n in frame nuclear localization sequence at the fusion junction ( Fig ure 3 4 ) These constructs were then introduced into the PAK J STY strain and assayed for protein expression by growing the bacteria under type III inducing conditions for three hours Bacteria were then collected, lysed, and subject to Western blotting with an antibody against cre recombinase. As seen in Fig ure 3 5, all of the fusion proteins were synthesized at similar amounts with the exception of the f ull length ExoS fusion, which showed much lower production. To test f or protein injection, a human sarcoma cell line (Te26) was infected with the various strain s for three hours at an MOI of 100 Figure 3 6 shows that while the first 17 amino acids of ExoS appeared sufficient for injection of C re, the first 54 amino acids facilitated an increase in protein injection However, a dd ition of more than 54 amino acids resulted in reduced protein translocation T o demonstrate that ExoS54 Cre injection was dependent on the T3SS, we infected Te26 cells with a type III defective strain (PAK popD ) expressing this construct and observed no protein injection (Fig ure 3 6 ) Taken together, these results prove that ExoS54 C re injection into mammalian cells is type III secretion dependent. Functional Analysis of Bacterial ly Delivered Cre Recombinase In order to determine if bacterial delivered C re recombinase was functional, we utilized the Te26 cell line which contains an SV40 terminator flanked by LoxP sites preventing downstream expression of l acZ (Fig ure 3 7A ). If ExoS54 Cre was functional,

PAGE 46

46 the SV40 terminator would be excised allowing for l acZ expression, which can be galactosidase staining. Te26 cells w ere infected with PAK STY /pExoS54 Cre for 1 3 hours at various MOIs (20,100,500). Bacteria were then cleared and cells were allowed 48 hours to undergo recombination for l acZ expression and then were stained with a solution containing 5 bromo 4 chloro indolyl D galactopyranoside (X Gal) to assess galactosidase activity. As illustrated in Figure 3 7B infection with PAK STY / pExoS54 Cr e results in blue cells as a result of l acZ expression due to removal of the SV40 terminator. ga lactosidase activity is mainly observed in the nucleus which corresponds to the fact that fusion protein possesses a nuclear localization sequence (Fig ure 3 7B panel 4) The percentage of galactosidase positive cells increases in a dose dependent manner as increasing either the duration of infection or MOI results in an increase in the number of blue cells (Figure 3 8 ). Examining the amount of protein injected by Western blotting indicates that the increase in blue cel l corre lates with i ncreased protein injection (Figure 3 9). We also compared the amount of bacterial delivered C re recombinase to the amount produced by a lenti virus that had integrated into the Te26 cell chromosome. Although the lenti virus infected cells result in nearly 100% of the cell s staining positive for galactosidase (Figure 3 7 B panel 2 ), the amount of protein detected in those cells by Western blotting was undetectable (Figure 3 9). This is in contrast to the bacterial system, which is able to regulate the amount of protein inj ected by altering either the length of infection or MOI Cell Cycle Influences Recombination by Bacterial ly Delivered Cre Recombinase Immunofluorescent images above show that P. aeruginosa injects ExoS in nearly 100% of the cells it comes in contact with (Figure 3 2) However, infection with an MOI

PAGE 47

47 of 500 for three hours results in only about 42% of the cells staining positive for galactosidase (Figure 3 8) Additionally, the amount of injected protein at that MOI and time is much higher than that produc ed from lenti viral infected cells, yet viral infection results in nearly 100% of cells expressing galactosidase. It is plausible that in order for C re to exert its recombinase activity, the chromosome needs to be in a relaxed or unwound conformation much like the chromosomes are during the S phase of the cell cycle In order to examine this, Te26 cells were subject to a double thymidine block in order to orde r to synchronize cells to the G 1 /S phase. Upon release from the thymidine block, cells were collected at various time points and subjected to flow cytometry in order to determine the percentage of cells in each phase of the cell cycle and to gain an overall time for Te26 cells to go through the entire cell cy cle (Figures 3 10, 3 11). Infection with PAK STY /pExoS54 Cre at an MOI of 500 for three hours in unsynchronized Te26 cells results in approximately 45% of cells staining positive for galactosidase, which is proportional to the number of cells in S phas e ( Figures 3 8, 3 12) When Te26 cells are synchronized and infected during S phase, the number of galactosidase positive cells increases to approximately 75% which again, corresponds to almost exactly the number of cells in S phase (Figure 3 12) To ve rify this phenomenon was dependent on the chromosome structure and not differences in injected protein Te 26 were infected during various phases of the cell cycle (G 1 S and G 2 /M). The bacteria were cleared and cells were collected, lysed, and subject to W estern blotting. Figure 3 13 indicates that the amount of ExoS54 Cre injected during the G 1 and S phases was similar, suggesting the difference in galactosidase positive cells is not due to the amount of injected protein Interestingly, the amount o f protein

PAGE 48

48 injected during the G 2 /M phase was lower It is possible that the amount is lo w er because the protein is either degraded or lost during the cell division process that occurs during that time. Taken together, th ese data suggest that the chromosome structure plays a role in the efficiency of C re me diated recombination. Discussion The bacterial T3SS has the capacity to replace current methodologies being used for cellular reprogramming. Current protocols rely on the use of oncogenic viral vectors w hich become integrated into random areas of the reservations about the use in clinical applications Methods to bypass this, such as the use of purified proteins and transfection with plasmids, have yielded little success d ue to their extremely low efficiencies of reprogramming ( 143 179 186 ) In addition, these methods are very laborious and often times difficult to reproduce. In this study we demonstrate for the first time, the ability t o use the T3SS of P. aeruginosa to deliv er a functional nuclear protein into eukaryotic cells. After screening numerous strains in our possession for secretion of type III effectors, we identified a strain known as PAK J, which secretes more than 10 times the amount of protein as the typical laboratory strain of PAK (Fig ure 3 1) ( 84 ) Normally, incubati on of cells with this strain results in significant toxicity resulting from the secretion of type III effectors. However we were able to reduce cytotoxicity dramatically by deletion of these proteins thereby increasing the amount of time the bacteria cou ld be incubated with host cells (Figure 3 3). T o demonstrate the ability to deliver nuclear proteins into eu karyotic cells, we employed the use of the Cre LoxP system. Fusion of C re recombinase to various lengths of ExoS revealed that the N terminal 54 am ino acids was sufficient for maximum

PAGE 49

49 delivery into host cells (Fig ures 3 4, 3 6). Although majority of the fusion constructs were produced at similar levels by P. aeruginosa (Figure 3 5), they did not have the same levels of injection. Our results show that while less than 54 amino acids could deliver C re, more th a n 54 amino acids reduced the amount of injection. One possible explanation for this is that the fusions proteins containi ng more than the first 54 amino acids were too large to be exported through the type III apparatus. While the molecular weight of the largest construct (FullExoS Cre) is approximately 80 kD the largest protein secreted by P. aeruginosa is ExoU, having a m olecular mass of 74 kD ( 43 ) However, PAK J does not contain ExoU, but instead ExoS, which is the largest type III secreted protein by this strain having a mass of approximately 48 kD ( 10 ) Therefore it is reasonabl e to suggest that PAK J might have difficulty in secreting proteins larger than 50 kD due to the lack of appropriate chaperone proteins To demo nstrate functionality of the injected ExoS54 C re fusion protein, we employed the use of a Te26 reporter cell line that contains a transcriptional terminator flanked by loxP sites which inhibits l acZ expression. Infection with PAK J STY /pExoS54 C re at an MOI of 50 for three hours resulted in the appearance of ga lactosidase positive cells (Figure 3 7B). The percentage of positive cells was dose dependent, as increasing either the MOI of duration of infection resulted in increased amou nts of blue ce lls (Figure 3 8). galactosidase positive cells was accompanied by increased amounts of ExoS54 C re injection, suggesting that greater amounts of protein result in a higher percentage of cells undergoing C re mediated recombinat ion (Figure 3 9).

PAGE 50

50 galactosidase positive cells we were able to obtain with bacterial infection was 45% however infection of cells with a lenti virus expressing C re was able to achieve nearly 100 % Comparing the amount o f pro tein produced by the lenti virus infected cells to the quantity delivered by bacteria revealed that the bacteria were able to deliver a significantly higher amount (Figure 3 9). We reasoned that this discrepancy could be due to the fact that the lenti v irus is continually expressing a low level of protein, where as the bacterial system is delivering a concentrated amount that will eventually degrade over time. In an effort to increase the percentage of cells undergoing recombination, we examined whether t he phase s of the cell cycle have any impact on the recombination efficiency Since C re recombinase must interact with DNA to exert its activity, perhaps having the DNA in a more relaxed state, such as during the S phase of the cell cycle, would increase th e percentage of galactosidase. This was indeed the case, as infecting Te26 cells synchronized to the S phase of the cell cycle with bacteria increased the percentage of galactosidase positive cells to 75% as opposed to the 45% se en in unsynchronized cells (Figure 3 12). The galactosidase after infection in both synchronized and unsynchronized cells corresponded directly to the number of cells that were in S phase (Figure 3 12). This result was not depend ent on the amount of injected protein during each phase, as Western blotting indicated the similar amounts were injected in both the S and G 1 phases (Figure 3 13). The G 2 /M phase however, did show lower amounts of injected protein, probably resulting from the fact that cells are dividing and could potentially lose or breakdown the fusion protein.

PAGE 51

51 The results presented here clearly demonstrate a proof of concept for the use of bacteria as a protein delivery system. Evidence presented here shows that we were able to achieve a 75% recombination efficiency using the bacterial system. It might be possible to even increase this percentage by treating cells with proteasome inhibitors or even subjecting cells to multiple rounds of infection. Although u se of the lent i viru s is able to achieve nearly 100% recombination efficiency, the virus still inserts the gene of interest into the host cell chromosome. Using a bacterial system has the advantage in that it can be eliminated with the use of antibiotics, and the protei n delivered is transient ly expressed The strain developed here is dramatically reduced in cytotoxicity thereby allowing it to be incubated with minimal harmful effects. The data presented in this study is proof that bacteria can be utilized to deliver fun ctional nuclear proteins, paving the way for future studies using this system.

PAGE 52

52 Figure 3 1. Type III secretion profiles of three laboratory strains of P. aeruginosa Strains were grown under type III inducing conditions for 3 hours at 37 C. Bacteria were collected and then pelleted by centrifugation. Supernatants were collected and mixed with equal volumes of protein loading buffer and subject to Western blotting with an ExoS antibody which detects both ExoS and ExoT

PAGE 53

53 Figure 3 2. ExoS i njection into HeLa cells via the T3SS of P. aeruginosa MEF cells were infected with PAK J for one hour at an MOI of 20.Cells were then fixed and stained with an ExoS antibody followed by incubation with a FITC labeled secondary antibody. i.) visualization of injected ExoS protein ii.) staining of nuclei with a propidium iodide stain iii.) o verlay of injected ExoS and stained nuclei.

PAGE 54

54 Figure 3 3. Viability of MEF cells following infection with P. aeruginosa strains. MEF cells were infected with the indica ted strain of P aeruginosa for 3 hours at the indicated MOI. Floating cells were removed and remaining adhered cells were trypsinized and counted using a hemocytometer Data normalized to a non infected control.

PAGE 55

55 Figure 3 4. Constructs containing varia ble regions of ExoS fused in frame with C re recombinase. Various lengths of ExoS were PCR amplified and fused in frame with a nuclear localization sequence followed by C re recombinse

PAGE 56

56 Figure 3 5. Production of ExoS C re fusion proteins by P. aeruginosa strain PAK J STY Bacteria were grown under type III inducing conditions for 3 hours at 37 C. Bacteria were collected, pelleted, and the supernatants were removed. Pellets were lysed by adding protein sample buffer and subject to Western blotting with an antibody against C re recombinase.

PAGE 57

57 Figure 3 6. Injection of ExoS C re fusion proteins via the bacterial T3SS. Te26 cells were infected with strains expressing the various ExoS C re fusion proteins for 3 hours at an MOI of 100. Following infection, bacteri a were cleared and the cells were collected and lysed. Cell lysates were then subjected to Western blotting with an antibody recognizing C re recombinase.

PAGE 58

58 Figure 3 7. Bacterial delivered C re recombinase is functional. (A) Schematic illustrating the tr anscpritional terminator blocking l acZ expression in Te26 cells. (B) Infection of Te26 cells with PAK STY expressing ExoS54 cre. 1.) Non infected T226 cells. 2.) Te26 cells with lenti virus expressing cre recombinase. 3.) Infection with PAK STY express ing ExoS54 cre for 3 hours at an MOI of 50. 4.) Close up view of bacterial infected cell showing galactosidase.

PAGE 59

59 Figure 3 8. galactosidase expression resulting from bacterial delivered C re recombinase is dose dependent Te26 cells were incubated with PAK J STY expressing ExoS54 C re for various times and MOIs. Following infection, bacteria were stained for galactosidase and the number of positive cells w as counted.

PAGE 60

60 Figure 3 9. Injection of ExoS54 C re is dose dependent. Te 26 cells were infected with PAK J STY containing ExoS54 C re for various times and MOIs. Cells were collected, lysed and subject to western blotting with an anti C re antibody. Cells were also infected with 2 different doses of lenti virus expressing C re rec ombinase for 48 hours. The cells wer e then collected, lysed and subject to western blotting.

PAGE 61

61 Figure 3 10 Synchronization of Te26 cells using a double thymidine block. Te26 cells were synchronized using a double thymidine block and then released. Cells were collected at various time points post blocking and subjected to flow cytometry to determine the number of cells in each phase of the cell cycle.

PAGE 62

62 Figure 3 1 1 Time line displaying the length of each phase of the Te26 cell cycle. Based on the result s from the synchronizing of Te26 cells, a timeline was created to indicate the length of each phase of the cell cycle. This was the basis for infections during the different phases of the cell cycle.

PAGE 63

63 Figure 3 1 2 Cell cycle influences the recombination efficiency of bacterial delivered C re recombinase. Non synchronized cells were infected with PAK J STY expressing ExoS54 C re for 3 hours at an MOI of 500 and cells were then stained for galactosidase. Te26 cell synchronized to the S phase of the cell cycle were infected under the same conditions and also stained for galactosidase. Graph compares the number of galactosidase positive cells to the number of cells in S phase.

PAGE 64

64 Figure 3 13. Injection of ExoS54 C re during various phases of the cell cycle. Te26 cells were subject to a double thymidine block for synchronization. Afterwards, cells were infected at an MOI of 100 for 3 hours during the appropriate phase. Cells were collected, lysed, and subject to Western blotting with an antibody against C re recombinase.

PAGE 65

65 CHAPTER 4 A NOVEL CYTOTOXIN REQUIRING BOTH TYPE I AND TYPE III SECRETION SYSTEMS FOR INTRACELLULAR DELIVERY Background Pseudomonas aeruginosa is a gram negative oppor tunistic pathogen responsible for causing diseases in immunocompromised individuals, most notably those suffering from severe burns or cystic fibrosis ( 100 ) In order to maintain infection, P. aeruginosa relies on the production of numerous virulence factors, some of which are injected directly into host cells via the cell contact mediated T3SS ( 33 49 ) The T3SS is a proteinaceous needle, which translocates proteins, known as effect ors, directly from the bacterial cytoplasm into the host cell ( 65 ) The effectors secreted by the T3SS of P. aeruginosa E xoenzymes S, T, Y, and U, are the major contributors to cytotoxicity during the course of an infection ( 38 151 ) P. aeruginosa is able to inject copious amounts of protein in a relatively short period of time in order to fend off the host immune system. Our lab oratory has recent ly demonstrated that T3SS of P. aeruginosa could be harnessed to deliver functional nuclear proteins into pluripotent and differentiated cells by using a laboratory strain derived from PAK, known as PAK J, which displays a much higher secretion of effectors than any previously characterized strain s of P. aeruginosa ( 16 ) The strain used to delive r nuclear proteins, PAK J STY was devoid of all three known type III secreted exotoxins so as to reduce cytotoxicity to the host cells. Despite the depletion of the type III toxins, cytotoxic effects were still observed in cells after prolonged exposure t o the bacteria. In an effort to minimize toxicity from additional virulence factors, a strain was created from PAK J STY known as PAK J which is further defective in both type II secretion and quorum sensing. Although this strain had the major virulen ce factors

PAGE 66

66 removed, it too showed toxicity when incubated with cells. In contrast, mutants that are defective in the T3SS display greatly reduced cytotoxicity, suggesting the presence of additional effectors secreted by the T3SS, however these proteins onl y play a major role in virulence when the known effectors are absent. In an effort to identify additional type III secreted effectors, we found that nucleoside diphosphate kinase (NDK) is injected into HeLa cells by strains lacking ExoS, T, and Y. NDK is an ATP utilizing enzyme that is secreted by the T1SS in P. aeruginosa and has been shown to cause cytotoxicity when incubated with macrophages ( 80 181 ) The exa ct mechanism of toxicity is not currently understood, however, the working hypothesis is that NDK disrupts extracellular ATP concentrations that macrophages need for survival during the course of infection. In this report, we demonstrate for the first time that NDK is not only able to cause cytotoxicity when expressed in HeLa cells, but can also be translocated into host cells via the T3SS. Evidence is presented to support T1SS dependent NDK secretion followed by T3SS dependent injection into the host cells suggesting a novel route of injection for the NDK protein during host pseudomonas interaction. Materials and Methods Generation of Flag Tagged NDK Constructs The primers used to generate F lag tagged versions of NDK are listed in Table 2 3 Human and E.co li ndk genes were PCR amplified and cloned into the pUCP20 vector using Bam HI and Hind III restriction sites located at the end of each primer. ndk from P. aeruginosa was cloned in pUCP20 using Eco RI and Pst I restriction sites and was further cloned into the eukaryotic expression vector pCDNA3.1(+) using Bam HI and

PAGE 67

67 Eco RI sites. All constructs were verified using restriction enzyme digestions as well as DNA sequencing. Protein Secretion Assay Bacterial strains w ere grown overnight in 1.0 ml of L broth containing carbenicillin at 37 C. Overnight cultures were then inoculated at 5% into fresh L broth containing antibiotics for non type III inducing conditions and L broth plus antibiotics and 5mM EGTA for type III i nducing conditions. P. aeruginosa strains were grown in a shaking incubator at 37 C for three hours, after which bacteria were co llected and spun down at 20,000 xg. Bacterial supernatants were collected, mixed with equal volumes of protein sample buffer an d boiled for 10 minutes before subjecting to SDS PAGE analysis. Protein Injection Assay HeLa cells were seeded onto 6 well plates at approximately 70% confluency (8.4 x 10 5 cells) in medium containing antibiotic the night before infection. Two hours prior to infection, cells were washed twice in PBS and replaced with medium lacking antibiotics. Bacterial strains were grown in L broth supplemented with carbenicillin at 37 C until the OD 600 reached 0.8. For an MOI of 20, 2 x 10 7 CFU per ml were incubated with HeLa cells for 4 hours. Following infection, bacteria were washed and cells were harvested by trypsinization. Cells were spun down at 500xg for 5 minutes and then washed with PBS 3 .25% Triton X 100 and placed on ice for 10 minutes. Cell lysates were then centrifuged at 20,000xg for 2 minutes and the supernatants were mixed with equal amounts of 2x protein sample buffer. Samples were boiled for 10 minutes and then saved at 20 C unti l use.

PAGE 68

68 Cytotoxicity Assay Cells were infected with P. aeruginosa at indicated MOIs for indicated period of time as described above. Following infection, cells were washed three times with PBS to remove non adhered cells and then adhered cells were collecte d by incubating with 0.25% trypsin for 5 minutes. Cells were then mixed and viable cells were counted using a hemocytometer. Immunofluorescent Staining Overnight bacterial cultures were inoculated into fresh L broth at a 1:50 dilution and allowed to grow f or 2 hours at 37 C. 200 l of each bacterial strain was collected and pelleted by centrifugation at 20,000xg for 2 minutes. Pellets were washed once in PBS and suspended in a final volume of 100 To permeabilze bacteria, a 1% Triton X 100 was added for 5 minutes. Samples were then transferred to glass coverslips and blocked in a solution containing 3% BSA and 10% NGS in PBS for 1 hour at room temperature. Samples were then incubated with primary a FLAG 1:400) for one hour followed by 3 washes with PBS. Bacteria were then incubated with secondary antibody for 1 hour, washed in PBS, and stained with DAPI. Stained cells were then visualized under a fluorescent microscope. Results Strains Lacking Known Type III Secreted Effectors Still Cause Cytotoxicity Studies in our laboratory have demonstrated that P. aeruginosa is capable of delivering functional Cre recombinase to pluripotent and differentiated cells when it was fused to the first 54 amino acids of the type III effector ExoS ( 16 ) We generated a strain known as PAK J STY which is devoid of the three known type III secreted effectors, to use as the strain for protein delivery. Although this strain shows reduced cytotoxicity

PAGE 69

69 when incubated with cells for less than three hours, observat ions from longer infection times revealed this strain possesses residual toxicity. In an effort to determine the degree of cytotoxicity resulting from longer incubation times with PAK J STY we compared the number of HeLa cells that were adhered to tissue culture plates following infection by the wild type PAK J or PAK J STY Figure 4 1 shows that at 4 hours post infection, only 50 % of the cells were still adhered to the plate following incubation with PAK J STY whereas incubation with the wild type strain resulted in only 5% of cells still adhered. These results are in agreement with previous cytotoxicity studies, which showed P. aeruginosa strains lacking type III effectors caused high levels of LDH release from cells following infection ( 95 162 ) The T3SS is known to be a major virulence factor in P. aeruginosa infections, so a type III defective mutant was also incubated with HeLa cells. Cytotoxicity is dramatically reduced in HeLa cells incubated with PAK pscF as there is only a 10 % reduction in the amount of adhered cells compared w it h a non infected control (Figur e 4 1) These results suggest that the T3SS of P. aeruginosa even in the absence of k nown effectors, is still capable of causing toxicity. Although only four type III exotoxins have been identified in P. aeruginosa thus far, it is possible that additional proteins are secreted through the type III needle, especially in the absence of the m ajor effectors. To investigate this possibility, we screened the supernatants from wild type PAK J and a mutant strain PAK J S T Y N which lacks the type III secreted effectors as well as the cap protein of the needle, PopN Bacterial strains were grown unde r type III inducing condition and the supernatants were TCA precipitated, run on an SDS PAGE, and stained with Coomassie blue. The goal of this

PAGE 70

70 experiment was to identify novel protein bands that were present only in the strain lacking the type III sec rete d effectors. As seen in Figure 4 2 wild type PAK J, contains an upper segment of bands, corresponding to ExoS, T, and Y. PAK J S T Y N however, has an additional band present, indic ated by the bottom arrow in Figure 4 2 suggesting the protein is secreted in higher amounts. The PopN protein is believed to be the cap of the type III injectisome and its deletion results in a strain that constitutively secretes effector proteins ( 178 ) MassSpec analysis of the band revealed the protein to be nucleoside diphosphate kinase (NDK), a protein previously characterized to be secreted through the T1SS of P. aeruginosa ( 80 ) NDK is Secreted by Non Mucoid Strains of P. aeruginosa Previous reports have indicated that mucoid producing strains of P aeruginosa are able to secrete NDK through a T1SS dependent manner, whereas non mucoid strains such as the common laboratory strain PAO1 are not ( 181 ) Based on the results from Figur e 4 1, we set out to determine if NDK was secreted by the non mucoid strain PAK J, and whether the T3SS plays a role in the secretion process. To accomplish this, a plasmid containing a C terminal FLAG tagged form of the NDK from P. a eruginosa (pPaNDK) was introduced into various exotoxin deletion derivatives of PAK J. The purpose of testing these mutations was to assess if the known type III effectors have any role in the secretion of NDK. Protein secretion was determined by growing bacterial cells in L broth or L broth containing 5mM EGTA for 3 hours at 37 C. Bacterial supernatants were collected, run on an SDS PAGE gel, and subject ed to Western Blotting with an antibody agains t the FLAG tag. Figure 4 3 shows that all of the strains secreted similar amounts of NDK under type III inducing and non inducing conditions, suggesting the T3SS does not play a role in secretion of the protein. Additionally,

PAGE 71

71 deletion of exotoxins does not appear to have any affect on the secretion of NDK as all of the strains secrete similar levels. Further evidence suggesting that the T3SS does not have a role in the secretion of NDK is demonstrated by the observation that the type III defective mutant, PAK pscF secretes NDK at a mounts similar to strains possessing a functional T3SS. These results do, however, indicate that the non muc oi d strain PAK J is able to secrete NDK, presumably via its T1SS. NDK is Injected into Eukaryotic Cells in a T3SS Dependent Manner Althou gh the s ecr etion data in Figure 4 3 suggest that the T3SS does not play a role in the secretion of NDK, it was possible that the amount of NDK secreted by the T3SS was so low that no detectable difference could be observed between type I and III secreted p rotein usin g Western blotting. If NDK is secreted through the injectisome, then it should behave like other type III effectors and be injected into eukaryotic cells. We therefore used the same deletion strains harboring FLAG tagged NDK and incubated them with HeLa ce lls for three hours at MOI 20. Following i nfection, bacteria were cleared and the cells were lysed followed by Western Blotting with an anti FLAG antibody. Figure 4 4A shows that PAK STY injects the greatest amount of NDK into HeLa cells and the amount injected is reduce d as more exotoxins are present, with none being injected from the wild type PAK J strain. These results suggest that amount of NDK injected is negatively influenced by the presence of other known type III effectors. A functional T3SS is required for translocation as infection with PAK J pscF shows trace amounts of NDK injection. It is possible that the faint band represents NDK that was taken up by pinocytosis or by an additional unknown mechanism. To confirm these results were not cell t ype dependent, we carried out the same infection in H1299 cells and observed the same results (Figure 4 4B). Tak en together, the results in Figure

PAGE 72

72 4 4 show that NDK is secreted by a T1SS, yet injection into HeLa cells is dependent on a functional T3SS. Als o, the amount of NDK translocated into HeLa cells is elevated in bacteria lacking the type III effectors, suggesting these may play an inhibitory role, likely through competition, in the secretion of NDK under normal infection conditions. NDK is Cytotoxic to Eukaryotic Cells NDK has been reported to cause cytotoxicity in macrophages by disrupting ATP concentrations outside of the cell ( 181 ) however, it has not been determined whether bacterial NDK is capable of eliciting a cytotoxic response when expressed inside hos t cells. To examine this, NDK was cloned into a eukaryotic expression vector and co transfected into HeLa cells with a plasmid expressing GFP (pEGFP). If NDK generated a cytotoxic response, the number of GFP positive cells should be lower in samples that w ere co transfected with NDK when compared to cells transfected with GFP and pCDNA3.1 vector control. Forty eight hours post transfection, HeLa cells were collected and subjected to flow cytometry to quantify the amount of GFP positive cells. Figure 4 5 sho ws transfection with GFP and empty vector together resulted in 38% of HeLa cells expressing GFP, whereas co transfection with NDK and GFP resulted in a 12% reduction in the amount of GFP positive cells. GFP was also co transfected with a plasmid expressing the acute type III secreted cytotoxin ExoS, resulting in an 80% decrease in GFP positive cells compared to GFP and vector only transfected cells (Figure 4 5) Although NDK caused a significant reduction in the amount of GFP positive cells, the toxicity wa s not as robust as ExoS. This would suggest that NDK is not an acute toxin, but in the absence of other type III effectors it does play significant role in toxicity.

PAGE 73

73 To further assess the cytotoxicity resulting from NDK, we deleted the gene via homologous and quorum sensing (Table 2 1) in an effort to reduce cytotoxicity in eukaryotic cells. To determine if NDK expressing strains possess greater toxicity, HeLa cells were infected pPaNDK for five hours. Bacteria were then cleared by washing with PBS and fresh media containing antibiotics was applied to t he cells to eliminate any residual bacteria. Twenty four hours later, lifted cells were washed away and the remaining adhered cells were trypsinized and counted using a hemocytometer. Results from Figure 4 7 of 100 resulted in a 75% reduction in the number of adhered cells compared to % decrease in ndk gene restored toxicity, causing a sim strains do elicit a toxic response however, the toxicity is not as robust and the time necessary to cause toxicity is much longer compared to the type III secreted effector ExoS. These results not only indicate that strains possessing NDK result in higher toxicity toward eukaryotic cells, but that this response is delayed in comparison to other known type III secreted effectors. Previous reports have demonstrated that NDK from Mycobacte rium tuberculosis is also responsible for causing toxicity when incubated with eukaryotic cells ( 23 24 ) We were curious as to whether this was a general feature of NDKs or relevant only to P. aeruginosa and M. tuberculosis To examine this, NDKs from E.coli (pEcNDK) and

PAGE 74

74 humans (NM 23H2) (pHuNDK) were cloned into pUCP20 and transformed into P. aeruginosa NDKs from E. coli and P. aeruginosa share 60 percent amino acid homology while the human form is 42 percent homologous to P. aeruginosa ( 22 ) As shown in Figure 4 6 A, NDKs from E. coli and humans are also secreted from P. aeruginosa in a type III independent manner. Testing these strains for protein injection revealed that NDK from E.coli was injected at amounts similar to P. aeruginosa NDK, whereas the human form showed a much lower amount (Figure 4 6 B). Th e toxicity assay results in Figure 4 7 reveal that strains possessing E. coli and human NDKs also cause HeLa cells to detach from the monolayer, with 75% detaching from E. coli NDK and roughly 65% from the human form. Interestingly, the human form of NDK is secreted at levels similar to the other proteins however the amount injected is greatly reduced, possibly due to the lack of necessary signal for in jection from the type III needle. Although the human NDK causes a cytotoxic response, it is slightly reduced compared to that from E. coli and P. aeruginosa which probably arises from the observation that human NDK is not as readily injected. Based on these observations it is feasible that a relatively low amount of injected human NDK is necessary to elicit a cytotoxic response. When taken together, these res ults suggest that NDKs from E.coli and humans are able to generate a cytotoxic response when injected into eukaryotic cells. Kinase Activity of NDK is not Required for its Cytotoxicity Nucleoside diphosphate kinase is responsible for generating nucleotide triphosphates (NTPs) from nuclotide diphosphates (NDPs) by transfer of a terminal phosphate from an NTP to an NDP ( 147 ) To date, all known prokaryotic and eukaryotic NDKs possess a conserved histidine residue (H117) that becomes phosphorylated

PAGE 75

75 during the generation of NTPs ( 22 ) We therefore wanted to determine whether the phosphorylation was responsible for the toxicity elicited by NDK. To accomplish this, histidine H117 of the P. aeruginosa NDK was mutated to glutamine (H117Q) through site direc ted mutagenesis. As seen in Figure 4 5 co transfection of the mutant NDK (pNDKH117Q) with GFP resulted in an 18 percent reduction in the amount of GFP positive cells when compared to co transfection with the vector control. Surprisingly, the toxicity was greater in t he mutant than in the wild type, suggesting that toxicity from NDK is not linked to the kinase activity. Infection with the P. aeruginosa strain harboring the mutated NDK resulted in a tox ic effect similar to that of ot her NDK containing strains (Figure 4 7 ). Taken together, these assay results suggest that the toxicity from NDK on mammalian cells is independent of its kinase domain. Secretion of NDK by the T1SS is Necessary for Injection T o investigate if secretion of NDK by the T1SS was necessary for injection into HeLa cells by the T3SS, we generated a truncated version of NDK that is unable to be secreted through the T1SS (Fig ure 4 8 A). The truncated form lacks the last eight C terminal amino acids, which has previously been shown to be essential for T1SS dependent NDK secretion ( 80 ) background and tested for secretion under type III inducing condition as well as injection into HeLa cells. Figure 4 8 B shows that the full length NDK was secreted into the extracellular media whereas the truncated form showed only a faint band. This secretion was independent of type III inducing conditions, and was shown not to be a result of higher protein expression from the strain containing the full length protein, as the truncated form was produced at similar amounts (Figure 4 8 B). Although the truncated from of NDK appears to run at a higher molecular weight than the full length form,

PAGE 76

76 sequencing results confirm the protein sequence is correct. A possible explanation for this observation is that P. aeruginosa is somehow modifying the protein These results are in agreement with a previous report which demonstrated that NDK secretion through the T1SS is dependent on a DTEV amino acid motif located in the last 8 amino acids of the carboxyl terminus ( 80 ) To determine if NDK secretion is necessary for injection via the T3SS, bacterial stains containing both forms of NDK were incubated with HeLa cells at an MOI of 20 for 3 hours. As shown in Figure 4 9 only the full le ngth NDK was translocated into HeLa cells. The truncated protein showed faint or inconclusive bands suggesting these proteins are not readily injected into the host cells. Taken together, the above data suggest that type I secretion of NDK is necessary for injection by the T3SS. Type I Secreted NDK is Injected via a Functional T3SS Since the NDK type I secretion signal sequence is required for its type III mediated injection, it is possible that NDK is secreted into the extracellular space by the T1SS firs t, and then is somehow directed into the host cell by the T3SS. To test this possibility, a type III defective strain containing FLAG tagged NDK (PAK pscF / p PaNDK ) was incubated with HeLa cells alone or in combination with varying MOIs of a strain contain ing a functional T3SS but lacking NDK FLAG (PAK STY ) to investigate whether NDK pscF strain could be injected via the functional T3SS of the PAK STY Figure 4 10 A shows that HeLa cells incubated with both PAK ps cF and PAK STY resulted in higher levels of NDK FLAG injection in a PAK STY dose dependent manner when compared to infection with PAK pscF alone. Additionally, the same results were observed using another type III defective mutant, PAK exsA (Figure 4 10 B). ExsA is the master regulator of

PAGE 77

77 the T3SS, and deletion results in a type III defective mutant ( 177 ) To demonstra te these observations were dependent on a functional T3SS, the same experiment was carried out using two type III defective strains. Figure 4 11 shows that the amount of NDK FLAG present after infection with PAK pscF / PaNDK does not increase with the addi tion of PAK exsA demonstrating that the previously observed increase in NDK injection was dependent on a functional T3SS. Toget her, the data presented i n Figures 4 10 and 4 11 suggest s that type I secreted NDK can be injected into HeLa cells in the pres ence of a functional T3SS. NDK Localizes to the Ou ter Membrane of P. aeruginosa The results from experiments thus far suggest that NDK is secreted by the T1SS, yet requires a functional T3SS in order to be translocated into eukaryotic cells. In order for this to occur, NDK must come in contact with the bacterial outer membrane or with one of the components of the T3SS. We therefore carried out an experiment to determine if NDK was localized to the outer surface of P. aeruginos a. A strain harboring flag tag ged NDK (PAK J ST / pPaNDK) and another containing a flag tagged form of ExoS (PAK N /pHW0224) were grown under type III inducing condition s for three hours. ExoS was chosen as a control protein due to the fact there has been no documented evidence suggesting that it localizes with the bacterial surface. Following growth, bacterial strains were immunostained without permeabiliziation on glass coverslips with an anti F lag antibody and visualized under a fluorescent microscope. As seen in Figure 4 12 A the strain contain ing NDK stained positive, where as the strain containing ExoS did not. D API staining of the bacteria show that the lack of signal in the Ex oS possessing strain was not a result of a lack of bacteria Permeabilzing the bacterial strains before staining however, results in positive Flag staining for both

PAGE 78

78 suggesting that NDK is in fact localized to the bacterial outer surface (Figur e 4 12B) Hi gher magnification images of non permeabilzed NDK co ntaining strains reveal that the green signal is localized to the outer areas of the bacteria further suggesting that NDK is localized to the outer membrane (Figure 4 13) Discussion Previous studies, along with data presented here, clearly show that prolonged exposure to P. aeruginosa strains lacking type III effectors results in significant cytotoxicity ( 162 ) This toxicity is dependent on the T3SS, as infecting with strains lacking a functional T3SS are less cytotoxic. To date, only four exotoxins have been characterized in P. aeruginosa which is a relatively low n umber compared to other T3SS containing bacteria, such as Yersinia Salmonella and Shigella species ( 27 ) The goal of this study was to determine if any additional proteins are secreted through the T3SS in the absence of the known effectors. Examining secretions from a strain of P. aeruginosa lacking the type III secreted effectors and the wild type revealed that NDK was secreted at higher levels when grown under type III inducin g conditions. Previous r eports have shown that NDK is secreted via the T1SS of muco i d strains of P. aeruginosa however, no studies have demonstrated that NDK can be injected by the T3SS (80) While our results suggest that NDK is not secreted in a type II I dependent fashion, they do demonstrate a functional T3SS is necessary for the injection of NDK into eukaryotic cells. Our findings are the first to report that NDK is injected into cells by the T3SS and that intracellular expression of NDK results in a c ytotoxic response although not as robust as that seen by the type III secreted effector ExoS transfection and infection data demonstrate the kinase defective mutant generates as

PAGE 79

79 much toxicity as wild type (Figures 4 5, 4 7) It is therefore possible that NDK from P. aeruginosa possesses additional functional domains that are responsible for the cytotoxicity. In the case of M tuberculosis in addition to its kinase activity, NDK has also been show to possess GAP activity for Rho GTPases ( 23 151 ) NDK toxicity does not appear to be restricted to that of P. aeruginosa as a NDK defective P. aeruginosa complemented by NDK fro m E.coli or humans also displayed similar toxicity (Figure 4 5 ). Although the human form of NDK is not as readily injected as NDKs from P. aeruginosa and E.coli the toxicity was only slightly reduced (Figure 4 6 ) suggesting that only a small amount of NDK is necessary to generate a toxic response. Additionally, it is possible that expressing a functional NDK in P. aeruginosa results in the expression of additional unknown virulence mechanisms. Recent data from our laboratory show that P. aeruginosa strains expressing NDK are able to induce pro inflammatory cytokine expression in human alveolar epithelium cells (Unhuan Ha unpublished result ). These results were seen in strains expressing the NDK from P. aeruginosa, E. coli as well as human, but not in stra ins lacking NDK or lacking a functional T3SS, consistent with the current findings. NDK does not possess a canonical T3SS signal sequence, however, by making a truncated form of NDK that is unable to be secreted by the T1SS it was discovered that the sam e signal sequence is required for injection by the type III needle There are two possible explanations for this observation (i) a type III chaperone protein recognizes this sequence and guides it to the injectisome or (ii) NDK must be secreted into the ex tracellular milieu first, and then is injected by the type III needle. The data presented in this study support the second explanation. Our secretion data show that NDK is

PAGE 80

80 secreted in a type III independent fashion, suggesting that majority of the secreted protein results from the T1SS. Complementation studies revealed that NDK secreted from a T3SS defective mutant could be translocated into HeLa cells when incubated with a strain possessing a functional T3SS but lacking NDK ( Figure 4 10) Additionally, extracellular complementation studies with two type III defective mutants failed to show an increase in NDK translocation ( Figur e 4 11 ), further suggesting the critical role of T3SS in NDK delivery. The traditional model for type III injection suggests tha t effectors are injected directly from the bacterial cytoplasm into the host cell through the hollow needle ( 49 ) While the observations in this study are contrary to the classical model, they are not unprecedented. Vidal et al have published results on a similar ph enomenon involving cooperation of the type V secretion system with the T3SS. In their report, it was shown that EspC of E. coli was secreted into the extracellular environment through a type V secretion system and then translocated into epithelial cells by the T3SS ( 167 ) However, the exact mechanism behind this observation is unknown, altho ugh they suggested EspC was able to bind to the type III needle before being translocated. A recent publication by Akopyan et al demonstrated that the type III effectors of Yersinia pseudotuberculosis were located on the outer membrane surface of the bacte ria, as well as in the bacterial cytoplasm ( 3 ) They showed that effectors localized to the extracellular surface o f the bacteria could be injected into eukaryotic cells in a type III dependent fashion It was also shown that the signal required for injection from the bacterial cytoplasm was different from the sequence necessary for translocation from the bacterial sur face. While their findings do not discredit the traditional method of

PAGE 81

81 injection, they are evidence of an additional method by which effector molecules can be localized to the outer surface of the bacteria and be subsequently injected by the injectisome. Pe rhaps a specific signal sequence is needed for a protein to bind to the type III needle for injection to occur. This report shows that NDK from E.coli which is 60 percent homologous to that of P. aeruginosa is able to be secreted by the T1SS and injected into HeLa cells, whereas the human form can be secreted but not as readily injected. The human form is 42 percent homologous to P. aeruginosa and perhaps a lack of the necessary secretion sequence may account for its inability to be injected. Results pres ented in this study suggest that NDK is secreted into the surrounding media and then localizes to t he bacterial outer surface (Figur e 4 12). This data supports the idea of surface localized effectors possessing the ability to be translocated into host cells via the T3SS. Based on this data, along with the observation from others, we propose a model suggesting how NDK or other surface lo calized effectors might be injected into host cells (Figure 4 14) ( 3 167 ) During the course of infection, NDK is secreted by the T1SS and localizes to the bacterial outer membrane, where it can coat the bacteria l surface (Figure 4 14 panels A, B) As the bacteria come in close contact with the target cell, type III needles begin to form underneath the effector protein bound to the bacterial surface and forces the protein in to the host cell (Figure 4 14 panels C, D) This could be accomplished if NDK is able to bind to proteins located at the tip of the needle or can bind to the needle itself. In summary, results from this study have identified NDK as an additional protein in jected into eukaryotic cells by the T3SS. Although not as toxic as the known type III effectors, in the absence of said effectors, NDK is able to cause significant cytotoxicity.

PAGE 82

82 We have demonstrated that NDK is secreted by a T1SS, yet is injected into HeLa cells in the presence of a functional T3SS. These results suggest NDK is not translocated by the traditional method of type III injection, but instead injected by a newly emerging model that happens in cooperation with the traditional one ( 124 134 ) Further efforts are underway to determine the exact mechanism by which extracellular proteins can be injected by the T3SS and the mechanism by which the NDK causes toxic effect on host cells.

PAGE 83

83 Figure 4 1. Strains lacking type III effectors are cytotoxic HeLa cells were infected for 4 hours at an MOI of 50 with the indicated strains of P.aeruginos a Following infection, floating cells were removed and remaining cells were collected and counted using a hemocytomete r Samples normalized to non infected control. p=0.007 using students T test.

PAGE 84

84 Figure 4 2. Secretion of NDK from P.aeruginosa Bacteria were grown in 5mM EGTA for 3 hours. Bacteria were pelleted and super natants were collected and subjected to T CA precipitation for 3 hours. Samples were then run on an SDS PAGE and then stained with C oomassi blue.

PAGE 85

85 Figure 4 3. Non mucoid strains of P.aeruginosa secrete NDK. Bacterial strains containing pPaNDK were grown under type III inducing and non inducing conditions. Supernatants were collected and subjected to Western blotting with an antibody to the F lag tag.

PAGE 86

86 Figure 4 4. Injection of NDK into eukaryotic cells is dependent on the T3SS. (A) HeLa cells were infected with indicated bacterial strains for 3 hours at an MOI of 20. Cells were collected, lysed, and the resulting lysates were subjected to Western blotting with an anti F lag antibody. (B) Westen blot of H1299 cells infected with the same strains above under the same conditions.

PAGE 87

87 Figure 4 5. Cytotoxicity resulting from expression of intracellular NDK. (A) Cytotoxicity resulting from the expression NDK from P. aeruginosa from a eukaryoti c expression vector. Plasmids containing GFP and NDK were cotransfected into HeLa and 48 hours later, the number of GFP positive cells was quantified using flow cytometery. p=0.017 and **p=0.023 using students T test. (B) Results from part A normalized t o the vector control showing the percentage decrease of GFP positive cells.

PAGE 88

88 Figure 4 6. Secretion and injection of non P. aeruginosa derived NDKs (A) Bacteria were grown under type III inducing and non inducing conditions and supernatants were subject to Western blotting with an antibody to the F lag tag. (B) HeLa cells were infected at an MOI 20 for 3 hours with the strains listed above. Cells wer e then collected, lysed, and subject to Western blotting with an anti F lag antibody. Membranes were stripped and re probed with an anti actin antibody to serve as a loading control.

PAGE 89

89 Figure 4 7. Cytotoxicity resulting from stains that possess NDK. HeL a cells were infected with bacterial strains for 5 hours at an MOI of 100. The bacteria were removed and cells were incubated for 16 hours in media containing antibiotics. Floating cells were removed and the remainder of adhered cells were collected and co unted using a hemocytometer. Data is normalized to the no infection control.

PAGE 90

90 Figure 4 8 NDK lacking the T1SS signal sequence is not readily secreted. (A) Cartoon illustrating the NDK133 protein containing a C terminal F lag tag. (B) Bacterial strains were grown in L broth or L broth containing 5mM EGTA for 3 hours. Supernatants were collected, run on an SDS PAGE gel, and probed with an antibody against the F lag tag. Bottom panel shows whole bacterial cells that were lysed in protein sample loa ding buffer.

PAGE 91

91 Figure 4 9. Type I secretion of NDK is necessary for protein injection. Bacteria were incubated with HeLa cells at an MOI 20 for 3 hours and cell lysates were probed with an antibody against the F lag tag. Membrane was stripped and re probed with actin as a loading control.

PAGE 92

92 Figure 4 10. Type I secreted NDK can be injected via a functional T3SS. (A) A type III defective mutant containing flag tagged NDK pPaNDK) was incubated with increasing MOIs of a strain lacking NDK, but containing a functional T3SS pUCP20). (B) Another type III defective strain containing flag tagged NDK C pUCP20) was incubated with increasing MOIs of a strain lacking NDK, but c ontaining a functional T3SS pUCP20) Cells were collected, lysed, and subjected to Western blotting with an anti F lag antibody. Membranes were stripped and re probed with actin to serve as a loading control.

PAGE 93

93 Figure 4 11. Type I secreted is not injec ted in the absence of a functional T3SS. A type III defective mutant containing flag tagged NDK pPaNDK) was incubated with increasing MOIs of a strain lacking NDK and lacking a functional T3SS C pUCP20). Following infection for 3 hours, HeLa cel ls were collected, lysed, and subject to Western blotting with an anti F lag antibody. Membranes were re probed with actin antibody to serve as a loading control.

PAGE 94

94 Figure 4 12. NDK is localized to the bacterial outer membrane. (A) Bacterial strains were sub cultured for 2 hours and placed on glass coverslips. Bacteria were then immunostained without permeabilization with an anti F lag antibody and also treated with DAPI. (B) Strains were cultured under the same conditions above except they wer e permeabilized with 1% Trition X 100 before staining with anti Flag antibody and DAPI.

PAGE 95

95 Figure 4 13. NDK on the bacterial surface. Bacterial cultures were prepared as listed in Fig. 4 12 and viewed under the 100X objective for a close up view. The bact eria were stained with DAPI and the green is NDK probed with an anti F lag antibody. This shows NDK is located in patches around the bacteria outer surface

PAGE 96

96 Figure 4 14. Proposed mechanism explaining NDK injection via the T3SS. (A) P. aeruginosa s ecretes NDK via its T1SS during the course of infection. (B) Secreted NDK binds to the bacterial outer surface and as bacteria approach the eukaryotic cell type III needles begin to form (C). (D) Magnified view showing that NDK binds to the type III needle as they are formed and is pushed by the needle into the host cell.

PAGE 97

97 CHAPTER 5 THE USE OF EXOS AS A POTENTIAL ANTI CANCER THERAPY Background Pseudomonas aeruginosa i s a gram negative opportunistic pathogen that is responsible for causing diseases in immunocompromised individuals ( 62 ) Al though P. aeruginosa possesses an arsenal of virulence factors, the T3SS is one of the most extensively studied. Toxicity is generated from the T3SS as a result of the injection of effector molecules from the bacteria directly into the cytosol of the host cell ( 50 ) Currently, P. aeruginosa is known to possess four effectors: ExoS, ExoT, ExoU, and ExoY ( 38 ) Of these effectors, ExoS is the most studied and well characterized ExoS is a bi functional toxin possessing C terminal GAP and ADPRT domains ( 6 ) The GAP domain causes the rounding and lifting of infected cells due to its ability to disrupt cytoskelleton proteins such as Rho, Rac, and CDC42, while the ADPRT domain ADP ribosylates multiple host cell target proteins ( 5 28 ) Studies have shown that while the GAP domain of ExoS is able to cause cytotoxicity on its own, the activity of the ADPRT domain is dependent on the interaction with eukaryotic 14 3 3 proteins through a C terminal 14 3 3 binding domain ( 182 ) Once activated, the APRT domain of ExoS is able to induce apoptosis in cells as earl y as three hours post infection ( 78 81 ) ExoS is capable of generating toxicity in a broad population of cell types ranging from macrophages to cancer cells, with very few resistant cell lines being characterized thereby making it an attractive candidate for an anti cancer molecule ( 110 131 ) The use of bacteria and their products is not a novel conce pt in the area of cancer research ( 71 ) Current cancer treatments rely on the use of chemotherapeu tic agen ts which must be able to reach tumors via the bloodstream. However, due to the poor

PAGE 98

98 vasculature of most tumors, drug delivery can be problematic ( 15 132 ) Bacteria provide a unique solution to the drug delivery issue because they are a ble to adapt to their surroundings and can survive in the often hypo oxygenic tumor environment. Live attenuated strains of Salmonella typhimurium have been developed that can specifically target tumors and effectively reduce their burden in mice ( 98 185 ) However, the same reduction observed in mice has not been replicated in human clinical trials ( 157 ) While the use of live attenuated strains is an emerging field in cancer research, there has been much focus on the use of bacterial toxins as anti cancer agents. Two predominantly studied toxins are Exotoxin A (EA) from P. aeruginosa and diptheria toxin from Corynebacterium diptheriae Both toxins are mono ADP ribosyltransferase enzymes that target elongation fac tor 2 (eFF2) and disrupt protein synthesis in eukaryotic cells ultimately leading to apoptosis ( 30 169 ) These toxins are members of the AB family consisting of a cytotoxic domain (A domain) and binding or translocation domain (B domain) ( 13 ) During infection, these proteins are secreted by the bacteria, and through binding of the B domain with a eukaryotic cell recept or, are taken up by endocytosis ( 36 ) To target cancer cells, the binding domain of EA has been replaced with binding doma ins for cancer specific markers. Additionally, the binding domain has b e e n replaced with an antibody to target cancer specific cells ( 83 ) There have been numerous phase 1 trials with recombinant forms of EA and some have yielded success leading to upcoming phase 2 trials ( 90 173 ) While EA is a promising therapeutic agent for the treatment of cancer, the use of recombinant toxins do hav e some drawbacks. Using antibody conjugated toxins could lead to the production of antibodies against the drug itself. Also, there is the issue of

PAGE 99

99 identifying novel cancer specific markers located on the tumor cells to ensure that drugs cause minimal damage to normal cells. Synthesizing a toxin that could not only target cancerous cells but also specifically be activated in the se cells would be a great discovery for the field of cancer research Inactivation of the p53 transcription factor is found in nearly half of all reported cancer cases ( 58 ) Murine double minute 2 ( MDM2 ) functions as a negative regulator of p53 by inhibiting the ability of p53 to bind to the transcriptional machinery of the host cell, or by ubiquintinating p53 and targeting it for degradation via the proteasome ( 26 105 ) MDM2 is a protein upregulated in several forms of cancers such as lung, colon, and stomach making it an attractive target for this study ( 155 ) MDM2 is known to inhibit p53 by bind ing to a 15 amino acid sequence located in the p53 transactivation domain, which is believed to induce a conformational change ( 92 136 ) This binding between p53 and MDM2 is mostly composed of hydrophobic and electrostatic interactions, s imilar to the interaction between 14 3 3 and ExoS ( 106 120 ) The p53 binding domain for MDM2 is comprised of an alpha helix which fits into a binding cleft in MDM2 composed of alpha helices ( 92 ) ExoS is believed to be activated via a conformational change and b ased on the similarities it shares with MDM2 p53 interaction we hypothe siz e that ExoS could be put under control of MDM2 by replacing the 14 3 3 binding domain of ExoS with the p53 binding domain o f MDM2. In this preliminary study, results are presented from experiments that attempt to put ExoS under control of MDM2, a protein that is over expressed in about 10% of all reported cancer cases ( 156 ) The goal was to de monstrate that ExoS could induce cytotoxicity in an MDM2 dependent manner thereby providing a proof of principle

PAGE 100

100 demonstrating that a toxin could be placed under control of a protein highly expressed in certain forms of cancer While the results of these experiments were contrary to our initial hypothesis, they do reveal some interesting and novel insight s into the role 14 3 3 proteins play in the activation of ExoS. Materials and Methods Construction of ExoS Fusion Proteins The ExoS P53 fusion proteins we re synthesized using the primers listed in Table 2 3. The p53, PDIQ, and 1E6N binding sequences were incorporated into the primers. The template DNA used to synthesize these constructs contained an amino acid substitution at position 146 of ExoS which rend ers the GAP domain catalytically inactive. Following PCR, the fusion proteins were cloned into the pUCP20 vector with EcoRI and HindIII 3 3 was created with the primers listed in Table 2 3 and was cloned into pUCP20 with EcoR I and HindIII restriction sites. All of the constructs were confirmed by restriction enzyme digestions and DNA sequencing. Secretion Assay for ExoS P53 Fusion Proteins Bacterial strains were grown overnight in 1.0 ml of L broth containing carbenicillin at 37 C. Overnight cultures were then inoculated at 5% into fresh L broth containing antibiotics for non type III inducing conditions and L broth plus antibiotics and 5mM EGTA for type III inducing conditions. P. aeruginosa strains were grown in a shaking inc ubator at 37 C for three hours, after which bacteria were collected and spun down at 20,000 xg. Bacterial supernatants were collected, mixed with equal volumes of protein sample buffer and boiled for 10 minutes before subjecting to SDS PAGE analysis. Supern atants were run on SDS PAGE gels and subject to Western blotting with an antibody recognizing ExoS.

PAGE 101

101 Protein Injection Assay C ells were seeded into 6 well plates at approximately 70 % confluency (8.4 x 10 5 cells) in medium containing antibiotic the night be fore infection. Two hours prior to infection, cells were washed twice in 1X PBS and replaced with medium containing no antibiotics. Bacterial strains were grown in L broth supplemented with carbenicillin at 37 C until the OD 600 reached 0.8. For an MOI of 5 0, 5 x 10 7 CFU per ml of bacteria were incubated with eukaryotic cells for the indicated amount of time. Following infection, bacteria were washed away and cells were harvested by scraping. Cells were spun down at 500xg for 5 minutes and then washed with P BS for 3 times. Cells were lysed by incubating in 0.25% Triton X 100 in PBS for 10 minutes on ice. Following lysis, cells were centrifuged at 20,000xg for 2 minutes. The supernatants were collected and mixed r 10 minutes. Lysates were run on SDS PAGE gels and subject to Western blotting with an antibody recognizing ExoS. Cell Viability Assay The assay used to measure cell viability was the Invitrogen LIVE/DEAD viability/cytotoxicity kit for mammalian cells (ca talogue number L 3224). Cells were infected for 3 hours at an MOI of 20 with the indicated bacterial strains. Bacteria were cleared by washing cells 3x with PBS and then cells were collected by incubation with 0.25% trypsin for 5 minutes. The cells were th en pelleted by centrifugation at 400xg for 5 which 1 (component B), for 45 minutes at room temperature. Samples were then on a glass coverslip and viewed under a fluorescent microscope.

PAGE 102

102 Ras Modification Assay HeLa cells were seeded into 6 well plates at approximately 70 % confluency (8.4 x 10 5 cells) in medium containing antibiotic the nigh t before infection. Two hours prior to infection, cells were washed twice in 1X PBS and replaced with medium containing no antibiotics. Bacterial strains were grown in L broth supplemented with carbenicillin at 37 C until the OD 600 reached 0.8. For an MOI of 50, 5 x 10 7 CFU per ml of bacteria were incubated with HeLa cells for the indicated amount of time. Following infection, bacteria were removed by washing cells 3x in PBS a nd cells were collected by scra ping. The cells were pelleted by centrifugation at 400xg for 5 minutes and then lysed by adding to Western blotting with an antibody that recognizes all 3 isoforms of Ras ( BD Transduction Laboratories anti Ras 610001) Results Generation of ExoS P53 Fusion Proteins ExoS requires binding to eukaryotic 14 3 3 proteins via its C terminal 14 3 3 binding domain in order to elicit a cytotoxic response in host cells ( 48 ) While ExoS is a well characterized protein, the role in which 14 3 3 proteins play in facilitating the toxic response is still poorly understood. In an effort to put ExoS under control of a cancer specific pr otein we made several ExoS fusion proteins in which the 14 3 3 binding domain had been replaced with various forms of the p53 binding domain for MDM2 (Fig ure 5 1). The p53 binding domain for MDM2 has been well characterized and is similar in amino acid length to the 14 3 3 binding domain of ExoS ( 120 ) The interaction of MDM2 with the p53 transactivation domain is composed of mainly hydrophobic and electrostatic interactions, similar to the interactions between ExoS and 14 3 3 ( 92 ) An

PAGE 103

103 ExoS fusion protein w as synthesized so that the p53 binding domain would be in frame with ExoS and replace the C terminal 14 3 3 binding domain (Fig ure 5 1). Additionally, we generated a construct containing a mutated sequence of the p53 binding domain known as PDIQ, which has been shown to have five times greater affinity for MDM2 ( 126 ) As a control construct, ExoS was fused to a p53 binding domain which had been mutated so that it was no longer capable of interacting with MDM2 (ExoS 1E6N ) ( 126 ) To ensure that any cytotoxic effec ts observed were from the ADPRT domain, t he GAP domain in all of the constructs was rendered catalytically via an amino acid substitution at position 146 ( 56 ) Secretion and Injection of ExoS P53 Fusion Proteins via the T3SS Following construction, ExoS P53 fusion genes were introduced into the PAK STY background and assayed for secretion St rains were grown under type III inducing conditions for three hours and supernatants were collected and subjected to Western blotting with an antibody against ExoS. Figure 5 2 A shows that all of the ExoS P 53 fusion constructs were secreted at levels similar to the wild type ExoS (pHW0029 and PAK J lanes ). To demonstrate that the GAP domain does not play a role in the secretion process, a plasmid expressing ExoS with a mutated GAP domain P ) was tested, which also showed similar secretion level s to the wild type protein. The same strains were also tested for their ability to inject the fusion protein s into mammalian cells. HeL a cells were incubated with the bacterial strains for three hours at an MOI 20. The b acteria were cleared, and the cell lysates were subject to Western blotting. As illustrated in Fig ure 5 2B, all of the ExoS fusion proteins were translocated at similar amounts compared to the native ExoS. Taken together, these results show

PAGE 104

104 that altering the 14 3 3 binding domain of ExoS do es not int erfere with ability of the protein to be secreted or injected into eukaryotic cells ExoS P53 Fusion Proteins Show Reduced Cytotoxicity In order to determine if the ExoS P53 fusion constructs were able to elicit a cytotoxic response in an MDM2 de pendent fashion, we employed the use of two MEF cell lines one deficient in p53 and the other deficient in p53 / MDM2 / MDMX / Deletion of MDM2 alone is embryonic lethal however, in combination with deletion of p53 embryos survive ( 79 111 ) Both cell lines were incubated with bacterial strains expressing the ExoS P53 fusion proteins for three hours at an MOI of 20. Following infection, bacteria were cleared and the number of viable cells was determined Figure 5 3 shows that strains expressing the ExoS P53 fusion proteins failed to elicit a cytotoxic response in eit her cell line as robust as wild type ExoS (pHW0029). Additionally, all of the ExoS P53 constructs appeared to cause similar levels of toxicity that appeared to be independent of MDM2 expression. While these constructs were not as toxic as native ExoS, they did appear to generate slightly elevated levels of cell death compared with infection from a strain expressing a form of ExoS that has both cytotoxic domains inactivated (pHW0224). To confirm these results, we carried out similar infections in the p53 / MDM2 / and MDMX / cell line and compa red them to infections in a cell line that overexpresses MDM2 via a eukaryotic expression plasmid (H1299 HDM2 cells). As observed in the previous infections, all of the ExoS P53 constructs failed to generate a cytotoxic response as great as ExoS (Fig ure 5 4 ) They did however, cause more toxicity than infection with the ExoS mutant although it appeared independent of MDM2 (Fig ure 5 2 ). Taken together, these results demonstrate that while the ExoS P53 fusion proteins lack

PAGE 105

105 th e potency of the wild type ExoS, they do appear to generate a marginal toxic response independent o f the presence of MDM2. ExoS P53 Fusion Protein ADP Ribosylate Ras The ADPRT domain of ExoS has been shown to induce apoptosis in cells by ADP ribosylating the cell signaling protein Ras ( 86 ) However toxicity occurs only after ExoS is activated by its eukaryotic co factor, 14 3 3 Infections with P. aeruginosa strains harboring mutations in the ADPRT or 14 3 3 binding domain of ExoS prevent the modification of Ras, result ing in dramatically reduced cytotoxicity ( 69 ) Although cytotoxicity assays suggested the ExoS P53 fusion constructs were not responding to MDM2, it is possible that MDM2 is not as efficient at activating ExoS as the native activator, 14 3 3. We therefore wanted to examine if the low level toxicity produced by the ExoS P53 fusion proteins was a result of a f unctional ADPRT domain To test this, strains containing the ExoS P53 fusion proteins were incubated with HeLa cells for three hours at an MOI of 20. Lysates from infected cells were run on an SDS PAGE and probed with an antibody against Ras. Previous studies have demonstrated that the molecular weight of Ras is increased by approximately 2kD following ADP ribosylation from ExoS, making a con venient assays system for testing the functionality of the ADPRT domain ( 109 ) Infection with PAK J PAK STY /pHW0029 and PAK STY /pExoSRK result ed in the modification of Ras, where as infection with ExoS containing an inactive ADPRT did not (Fig ure 5 5 ) All of the ExoS P53 proteins displayed the ability to modify Ras suggesting they possess a functional ADPRT. This phenomenon was dependent on a functional T3SS, as infection with a type III defective strain expressing the ExoS PDIQ fusion protein (PA K D /pExoSPDIQ) was unable to modify Ras (Fig ure 5 5 ).

PAGE 106

106 Interestingly, a control construct lacking the GAP domain and 14 3 3 binding domain (pExoS 14 3 3) was also able to modify Ras (Fig ures 5 1 5 5 ) It has been well documented that perturbing the 14 3 3 binding results in a form of ExoS that is unable to ADP ribosylate Ra s however, no studies have been conducted in which the entire 3 3 protein, we tested the ability of this protein to be secreted and injected into cells. Results from those experiments confirm that Exo S 3 3 was secreted and injected at levels comparable to the wild type ExoS ( Figures 5 2,5 3 ) Taken together, these results demonstrate that the ExoS P53 fus ion proteins do possess a functional ADPRT domain even in the absence of 14 3 3 binding. Additionally, they show that a form of ExoS lacking the 14 3 3 binding domain is still able to modify Ras. 3 3 Modifies Ras at a Slower Rate Majority of the to xicity associated with ExoS results from the ADP ribosylation of Ras ( 67 ) 3 3 was able to ADP ribosylate Ras like the wild type form, yet it does not generate as robust of a cytotoxic effect ExoS is able to induce toxicity in eukaryotic cells within as litt le as 30 minutes post infection ( 81 ) Based on this, we examined the modification of Ras in HeLa cells at various time points post infection with PAK J STY /pExoSRK or PAK J STY 3 3. As seen in Fig ure 5 6 PAK J STY /pExoSRK is able to completely modify Ras by 30 minutes post 3 3 is able to cause some modification of Ras by 3 0 minutes, it is not to the extent by ExoSRK until 120 minutes post infection. Based on 3 3 modifies Ras at a slower rate which might account at least in part, for its reduction in cytotoxicity.

PAGE 107

107 Discussion The overall goal of this preliminary study was to demonstrate that the A D PRT domain of ExoS could be placed under control of a cancer specific protein. In an effort to accomplish this, the 14 3 3 binding domain of ExoS was replaced with the p53 binding domain for MDM2. Two variations of this construct were created with one containing a mutated p53 domain which possesses five times greater affinity for MDM2 (ExoS PDIQ) and the other containing a mutated sequence which can no longer bind MDM2 (1E6N) (Fig ure 5 1 ) These constructs were readily secreted and injected into eukaryotic cells by P. aeruginosa demonstrating that disruption of the 14 3 3 binding domain does not alter these processes (Fig ure 5 2 ) Our prediction was that both the ExoS p53 and ExoS PDIQ con structs would induce cytotoxicity at levels comparable to wild type ExoS in an MDM2 dependent fashion, whereas the ExoS 1E6 N would not due to its inability to interact with MDM2 ( 126 ) Infection assays in cells lacking MDM2 and cells expressing MDM2, demonstrate that the ExoS fusion proteins were greatly attenuated in cytotoxicity compared to the wild type ExoS (Fig ure 5 3 ). These results also suggest that the toxicity observed from the ExoS P53 fusion proteins was not likely to be MDM2 dependent The se results were also confirmed by doing similar infections between an MDM2 null cell line, and a cell line overexpressing MDM2 from a eukaryotic expression plasmid (Fig ure 5 4 ). While we failed to see the results we predicted, we did observe that the ExoS P53 fusions cause d slightly higher toxicity in cells than infection with a P. aeruginosa stain expressing a GAP and ADPRT deficient ExoS ( Figures 5 3, 5 4 ) Since ExoS elicits apoptosis in cells by ADP ribosylating the small signaling molecule Ras, we con ducted experiments to determine if the ExoS P53 fusion proteins had functional ADPRT

PAGE 108

108 domains. Interestingly, infection experiments in HeLa cells revealed the all three ExoS P53 proteins were able to modify Ras as efficiently as wild type ExoS however thes e proteins failed to induce the same level of toxicity in the course of a three hour infection (Fig ure 5 5 ). Another striking observation made was that our control construct lacking the 14 3 3 binding domain was also able to modify Ras. As is the case with the ExoS P53 3 3 is less toxic than the wild type form. This observation is interesting because it is the first time that anyone has demonstrated that removal of t he 14 3 3 binding domain from the full length ExoS protein is still able to ADP ribosylate Ras. Henriksson et al have demonstrated that 14 3 3 proteins are required for the inhibition o f Ras by ExoS ( 69 ) In their study, an ExoS protein comprised of amino acids 88 453 was able to modify Ras, whereas a from lacking the 14 3 3 binding (ExoS 88 426) domain was not. However, a study by Pederson et al, demonstrated that ExoS lacking the MLD but conta ining the 14 3 3 binding domain, was unable to modify either membrane bound or cytosolic forms of Ras ( 123 ) The MLD of ExoS is located from amino acids 52 72, so perhaps the reason that Henriks s on et al did not observe ADP ribosylation of Ras with their E xoS 88 426 protein was because it lacked the MLD ( 69 ) Taken together with the results from this work, it appears as though ExoS might need both the 14 3 3 binding domain and the MLD in order to cause maximum toxicity This could explain why toxicity assays from Henriksson et al using ExoS 88 453 showed lower levels of cytotoxicity than similar assays from our laboratory ( 78 ) The exact role of 14 3 3 proteins play in activating ExoS is still unclear. Currently, there are three classifications for the actions of 14 3 3 proteins binding to target

PAGE 109

109 proteins: i) induction of a confor mational change in the target protein, ii) occlusion of a sequence specific regions of the target protein, and iii) function as a scaffold to promote binding between two proteins ( 19 161 ) The current hypothesis is that 14 3 3 proteins bind to ExoS and induce a conformational change mak ing the ADPRT active ( 120 ) However, evidence presented here sugge sts the 14 3 3 protein s might be acting as scaffold to facilitate interactions with Ras. Time course assays revealed that ExoS 14 3 3 not only ADP ribosylates Ras but that it takes 90 minutes longer to reach the same levels of modification that wild type ExoS does in 30 minutes (Fig ure 5 6 ). Perhaps only the kinetics of the toxicity is changed in the ExoS 14 3 3 construct, given that it merely takes longer to reac h the same levels as the native form since it is missing a protein that facilitates binding to the target molecule. The question still remains as to how the ExoS P53 fusion proteins are able to modify Ras. Perhaps MDM2 is playing a role and the assays pref ormed thus far are not sensitive to detect a difference. Although ExoS 1E6N was predicted to have low toxicity, it displayed levels similar to both ExoS P53 and ExoS PDIQ. We cannot rule out the possibility that other cellular proteins are binding to these constructs and activating them. Also, based on the observations from the ExoS 14 3 3 protein, we cannot rule out the possibility that the ADPRT domain is constitutively active, yet needs a protein to promote binding to its target Ras. This could explain w hy the ExoS P53 fusion proteins were able to modify Ras. More studies are needed to resolve the role of 14 3 3 proteins in the activation of ExoS. Once there is a firm understanding, it might be possible to harness ExoS to promote efficient killing of canc erous cells.

PAGE 110

110 Figure 5 1. Diagram illustrating ExoS P53 fusion proteins. ExoS P53 fusions were synthesized to contain a p53 binding sequence in place of the wild type ExoS 14 3 3 binding domain. ExoS P53 has the native p53 binding sequence for MDM2, while PDIQ has a 5 t ime greater affinity binding sequence for MDM2. The 1E6N sequence is mutated to prevent p53 binding with MDM2. Additionally we made a control construct lacking the 14 3 3 binding domain of ExoS. All synthesized constructs contained a mutated GAP domain to ensure any toxicity seen was resulting from the ADPRT domain.

PAGE 111

111 Figure 5 2. Secretion and injection of the ExoS P53 fusion proteins. (A) Secretion assay results from strains possessing the ExoS P53 fusion constructs. Bacteria were grown for 3 hours under type III inducing conditions and supernatants were collected and probed with an antibody against ExoS. (B) Injection of ExoS P53 proteins in HeLa cells. Cells were infected for 3 hours at an MOI of 20 and then collected and lysed. Lysates we re run on a SDS PAGE gel and probed with an anti ExoS antibody.

PAGE 112

112 Figure 5 3. Cytotoxicity of ExoS P53 fusion proteins. A p53 knockout cell line and a p53, MDM2, and MDM2 knockout cell line were infected with the indicated bacterial strains for 3 hour s at an MOI of 20. Following infection, bacteria were cleared and the cells were stained for live and dead cells using a live/dead cell viability assay. The number of live versus dead cells were counted under a fluorescent microscope using a hem o cytometer.

PAGE 113

113 Figure 5 4. ExoS P53 fusion protein cytotoxicity in MDM2 overexpressing cells. The p53, MDM2, and MDMX knockout cell line and the H1299 HDM2 cell line, which overexpresses MDM2, were infected with the indicated bacterial strains at an MOI of 20 for 3 hours. Following infection, bacteria were cleared and the cells were stained for live and dead cells using a live/dead cell viability assay. The number of live versus dead cells were counted under a fluorescent microscope using a hemocytometer.

PAGE 114

114 Figure 5 5. Modification of Ras protein by the ExoS P53 fusion proteins. HeLa cells were infected with the above strains at an MOI of 20 for 3 hours. Bacteria were then cleared and cells were collected and lysed. Cell lysates were run on a SDS PAGE gel and subject to Western blotting with an antibody that detects all 3 isoforms of the Ras.

PAGE 115

115 Figure 5 6. Ras modification time course. HeLa cells were infected with either PAK J STY /pExoSRK or PAK J STY /pExoS 014 3 3 at an MOI of 20 for various times. At each time point, the bacteria were cleared and the cells were collected and lysed. Cell lysates were subject to Western blotting with an antibody recognizing Ras.

PAGE 116

116 CHAPTER 6 GENERAL DISCUSSION Summary and Significance of Principal Findings Delivery of Functional Nuclear Proteins via the Bacterial T3SS Previous results from our laboratory have demonstrated that our derivate of the P. aeruginosa laboratory strain PAK known as PAK J, is able to secrete 10 times the amoun t of effectors as the common strain of PAK ( 84 ) We utilized this strain to deliver functional nuclear proteins into eukaryotic cells by fusing the N terminal 54 amino acids of ExoS to C re recombinase. While it has been demonstrated that bacteria possessing a T3SS can be used to deliver proteins into the cytosol of mammalian cells, we are the first to demonstrate the delivery of nuclear proteins ( 39 128 ) Our delivery strain was substantially reduced in cytotoxicity as a result of chromosomally deleting the three T3SS exotoxins (Fig ure 3 3) Additionally, we demons trated that the ExoS54 Cre fusion protein was functional by infecting a specialized cell line which contains the l acZ gene blocked by a loxP flanked transcr i ptional terminator (Fig ure 3 7A) Our re sults showed that increasing either the MOI or duration of infection galactosidase positive cells resulting from an increase in the amount of injected fusion protein (Fig ure 3 8) galactosidase positive cells we we re able to achieve with bacterial i nfection was 45 % whereas infection with a lenti virus expressing cre result ed in almost 100% of the cells staining positive. Results presented in this work demonstrated that the amount of C re delivered by bacteria was mu ch greater than that produced from the virus however, the lenti virus continually expresses protein following integration of the vector into the host genome whereas

PAGE 117

117 bacterial delivered protein is only transient (Fig ure 3 9) With synchronization of Te26 c ells prior to bacterial infection galactosidase positive cells to 75% which corresponded to the number of cells that were in S phase of the cell cycle (Fig ure 3 12) This suggests that cell cycle plays a role in t he recombination efficiency probably resulting from the DNA being more readily accessible to the C re protein. The significance of th is work is the development of a protein delivery system that could meet some of the current challenges faced in the field of molecular cell biology. Current methods for cellular reprogramming and transdifferentiation of cells rely on the use of integrating viral vectors, which cause reservations about their clinical use ( 153 180 ) The bacterial system is unique in that it can deliver transient amounts of protein that can be altered based on infection time and MOI. Additionally, the bacterial system can be eliminated with use of antibiotics, so there are no lingering effects. Other methods used for cellular reprogramming have tried the use of purified proteins, however this is costly, laborious and often a tedious procedure ( 187 ) The bacterial system solves this issue because the bacteria produce the proteins of interest While there is still room for improvement in our system, the research presented here is the first step in creating a system that can one day be utilized in a clinical setting. Discovery of a Novel Cytotoxin While the strain we generated for protein de l ivery PAK STY caused few harmful effects to cells during incubations of 4 hours or less longer incubation times resulted in cytotoxicity (Fig ure 4 1) In an effort to determine the cause of this toxicity, we identified NDK as a protein that is injected into eukaryotic cells in the absence of the known type III secreted ef fectors (Fig ure 4 4 ) The work presented in this study showed

PAGE 118

118 that NDK is able to elicit a cytotoxic response when expressed in eukaryotic cells, and that this toxicity is independent of the kinase domain (Fig ure 4 5) While it has been well documented tha t type I secreted NDK is able to extracellulary elicit a toxic response in macrophages, we are the first to demonstrate toxicity from injected NDK ( 181 ) Our init ial findings reaffirmed that NDK is secreted by the T1SS, yet needs a functional T3SS for efficient injection ( 80 ) Extracellular complementation assays using two bacterial strains demonstrat ed that NDK secreted into the extracellular media via the T1SS of a type III defective strain could be injected into cells by the T3SS of a stain lacking NDK (Fig ure 4 10) Conducting these assays using two type III mutant strains failed to show injection of NDK demonstrating the necessity of the T3SS (Fig ure 4 11) Additionally, expression of a truncated form of NDK lacking the type I secretion signal failed to be injected into HeLa cells suggesting NDK must be secreted into the extracellul ar space before it is injected (Fig ure 4 9) This study not only identified an additional effector injected via the T3SS of P. aeruginosa but it also serves as evidence in support of newly emerging mod el for type III secretion in which effectors located outside of the ba cteria can be translocated into host cells via the T3SS. This work demonstrates that NDK is localized to the outer membrane of P. aeruginosa suggesting that it binds to the bacteria before it is injected (Fig ures 4 12, 4 13) Identifying NDK as a novel cy totoxin could prove helpful in the clinical setting as it could be utilized as a target for therapeutic intervention during P. aeruginosa infections. Role of 14 3 3 Proteins in ExoS Activation One aim of this study was to explore the use of ExoS as an ant i cancer agent Although bacterial toxins are currently being utilized for cancer treatments, ExoS is a

PAGE 119

119 unique toxin in that it requires activation from a eukaryotic signaling protein in order to generate cytotoxicity ( 48 ) We therefore attempted to place ExoS under control of MDM2, a protein that is typically overexpressed in certain forms o f cancers with the goal of generating MDM2 specific killing in cancerous cells. To accomplish this, the 14 3 3 binding domain of ExoS was replaced with variations of the p53 binding sequence for MDM2 (Fig ure 5 1) Infections assays using cell lines either possessing or lacking MDM2 demonstrated that the ExoS P53 fusion proteins did elicit a toxic effect however, it was greatly reduced compared to infection from the wild type form of E xoS and appeared to be independent of MDM2 ( Figures 5 3, 5 4) Interestin gly, we discovered that these fusion proteins did have functional ADPRT domain s as was evident by their ability to modify Ras proteins (Fig ure 5 5) Another noteworthy observat ion was that a form of ExoS lacking the 14 3 3 binding domain had the ability t o modify Ras. It has been well documented that disturbing the 14 3 3 binding domain of ExoS results in reduced cytotoxicity and the inability to ADP ribosylate Ras, however these studies were carried out using a form of ExoS that is lacking the first 88 am ino acids ( 69 ) It was later shown that deletion of the MLD, located from amino acids 51 72, prevented the ADP ribosylation of Ras and reduced cytotoxicity ( 123 ) In this study we are the first to demonstrate that a full length form of ExoS lacking the 14 3 3 binding domain, is still able to ADP ribosylate Ras, although this happens at a much slower rate compared to infection with the wild type form (Fig ure 5 6) Perhaps this observation was over looked due to the fact earlier studies examining the roles of 14 3 3 proteins used truncated forms of ExoS lacking the MLD. Based on these initial results, it appears as though the ADPRT does not need 14

PAGE 120

120 3 3 for activation, but possibl y as a chaperone to facilitate binding to its target proteins. 3 3 modified Ras at a slower rate than the wild type form. Taken together, results from this work and previous results suggest that ExoS mig ht need both the MLD and the 14 3 3 binding domain to achieve maximum cytotoxicity. As a whole the results presented in chapter 5 showed that forms of ExoS containing the binding domain of p53 for MDM2 were able to elicit toxicity and ADP ribosylate Ras p roteins. Also, this cytotoxicity was reproduced with a fo r m of ExoS lacking the 14 3 3 binding domain. While the mechanism behind 14 3 3 activation of ExoS is still elusive, these results provide new insight into the mechanism explaining ExoS mediated toxi city and pose intriguing questions about the interactions between these proteins. Future Directions Bacterial Delivered Proteins Our initial studies utilizing P. aeruginosa for protein delivery demonstrated that we could successfully deliver functional nu clear proteins into mammalian cells. The ultimate goal of this project was to develop a delivery system for cellular reprogramming and transdifferentiation of cells. Since our initial studies, our laboratory h as shown that MyoD fused to the first 54 amino acids of ExoS was not only delivered into MEF cells, but that it was functional and able to t ransform these cells into myocytes. Current work in the laboratory is focused on developing an infection protocol to optimize this process. Work has also begun on generating iPS cells by delivering Oct4 fused to the first 54 amino acids of ExoS into neural progenitor cells as s tudies have shown these cells only require the expression of Oct4 for transformation back in to a pluripotent state ( 85 )

PAGE 121

121 Once we have worked out the conditions necessary to accomplish this, we will attempt to deliver the c omplete set of transcription factors necessary to transform MEF cells into iPS. A dditional research will be conducted to render the delivery strain less toxic. Our current strain lacks the T3SS secreted effectors, and shows minimal toxicity at infection times less than three hours. Our lab has identified NDK as an additional cytotoxin that is injected into host cells via the T3SS. Using the strain PAK times up to almost 7 hours before toxic effects are seen. Through additional screening, it is possible to identify additional factors that will render our delivery strain less virulent. Translocation of NDK O ur initial studies suggest that NDK is first secreted into the surrounding medium, and then translocated into cells via the T3SS. Based on evidence from several laboratories, and results presented in this work, it is hypothesized that toxins localize to th e bacterial outer surface, and then are injected in a type III dependent fashion One question that needs to be examined is whether NDK is able to bind to components of the type III apparatus. The most likely candidates would be tip proteins of the translo con such as PopB or PopD however, it is possible that NDK could bind with PscF, the type III needle protein as was suggested with the E.coil protein EspC ( 167 ) Binding of NDK to components of the needle complex would support our hypothesis that NDK is bound to the membrane and then pushed into the host cell while the needles are assembling Another question to resolve is why the human form of NDK is not readily injected. One step to answering that question would be to determine if the human form is located on the outer surface of P. aeruginosa Perhaps it lacks the necessary signal sequence to locate to the outer membrane. It is also possible that it does bind to the outer membrane

PAGE 122

122 but lacks the ability to interact with the needle or translocon Resolving this question might aid in identifying the signal sequence necessary for type III media ted injection of NDK Our results suggest that intracellular NDK is cytotoxic to cells, although the mechanism behind which this occurs is unknown. P. aeruginosa stains lacking type III effectors have been implicated in facilitating inflammasome mediated c ytotoxicity through activation of caspase 1 so it is possible that NDK is one of the factor s responsible ( 45 ) Future studies will be conducted to determine if strains lacking NDK are able to stimulate act ivation of capsae 1. Additionally, studies should be conducted looking at activation of caspase 3 to see if somehow NDK is causing apoptosis. Finally, it would be interesting to examine if this mechanism of NDK injection is only observed in the PAK J strai n. Previous reports have indicated that another laboratory strain of P. aeruginosa PA01, is unable to secrete NDK. It is possible that there is something different about PAK that allows for NDK secretion. For reasons that still remain unclear, our laborat ory has demonstrated that PAK is able to secrete elevated levels of type III effectors compared to PAO1, so perhaps all secretion systems are elevated in PAK To address this question, complementation studies could be conducted to see if PAK J secreted NDK could be injected by a functional T3SS from PA01. Alternatively, these same experiments could be conducted with PAK J and other type III containing bacteria such as Yersinia or Shigella to see if the T3SS from other bacterial species is capabl e of injecti ng NDK into mammalian cells. The Role of 14 3 3 Proteins in ExoS Activation Preliminary r esults presented in this study showed that ExoS fusions proteins in which the 14 3 3 binding domain had been replaced with p53 binding sequence for

PAGE 123

123 MDM2 were still able to ADP ribosylate Ras. This same observation was seen with an ExoS protein which had the 14 3 3 binding domain removed. Future experiments will 3 3 is able to modify Ras. Numerous studies have shown that ExoS lacking am ino acids 426 4 31 are unable to bind 14 3 3 proteins and modify Ras, however our construct lack ing amino acids 420 453 and does Future experiments will be p er 3 3 is indeed unable to bind 14 3 3 proteins. To examine if MDM2 is really playing a role in activating the ExoS P53 constructs, we will employ the use of an in vitro ADP ribosylation assay which is widely used when studying the ADPRT of ExoS This assay works by combining purified ExoS, Ras, 14 3 3 proteins, and a source of NAD. When 14 3 3 is present, the molecular weight of Ras on an SDS PAGE will be increased due to modification however, when 14 3 3 is missing from the reaction, Ras remains unmodified. Utilizing this assay with purified MDM2 and the ExoS P53 fu sion proteins should provide insight into whether MDM2 is indeed directly required for activating the ADPRT. This same experiment can also be used to verify that our 3 3 does not need 14 3 3 binding for the activation of the ADPRT. To that end, t h e first thing that needs to be determined is if 14 3 3 proteins really induce a conformational change in ExoS or simply act as adaptor protein s for its substrates. If 14 3 3 proteins turn out to act as scaffolds, then perhaps changing the 14 3 3 binding d omain will not be helpful for targeting cancer cells. It is possible however, 3 3 is in a conformation that renders the ADPRT constitutive ly active although not as toxic as the wild type. If this turns out to be the case, then we can focu s

PAGE 124

124 on how to make ExoS more responsive to activation from MDM2. This could be tested by moving the p53 binding domains to different areas in the C terminal portion of ExoS to hopefully identify a form with enhanced responsiveness Final Remarks The work pre sented in this study demonstrated that we could utilize P. aeruginosa as a protein delivery system. It also presented the discovery a novel cytotoxin that requires the cooperation of two different bacterial secretion systems for injection into host cells. However, the exact nature by which this toxin induces cell death and the detailed mechanism explaining injection into the host cell remain elusive. Finally, preliminary results indicated that modifications of the 14 3 3 binding domain of ExoS do not necess arily disrupt the ability of the APDRT to modify proteins, but can alter the severity of the cytotoxic response. Taken together, this study shows how P. aeruginosa could be utilized as a tool for cellular reprogramming, the discovery of a novel toxin that is injected via a newly emerging model for type III secretion, and the possibility that 14 3 3 proteins might play a role in ExoS toxicity that was previously unknown.

PAGE 125

125 LIST OF REFERENCES 1. Adamo, R., S. Sokol, G. Soong, M. I. Go mez, and A. Prince. 2004. Pseudomonas aeruginosa flagella activate airway epithelial cells through asialoGM1 and toll like receptor 2 as well as toll like receptor 5. Am J Respir Cell Mol Biol 30: 627 634. 2. Aiello, D., J. D. Williams, H. Majgier Baranowsk a, I. Patel, N. P. Peet, J. Huang, S. Lory, T. L. Bowlin, and D. T. Moir. 2010. Discovery and characterization of inhibitors of Pseudomonas aeruginosa type III secretion. Antimicrob Agents Chemother 54: 1988 1999. 3. Akopyan, K., T. Edgren, H. Wang Edgren, R. Rosqvist, A. Fahlgren, H. Wolf Watz, and M. Fallman. Translocation of surface localized effectors in type III secretion. Proc Natl Acad Sci U S A 108: 1639 1644. Epub 2011 Jan 1610. 4. Aktories, K. 2011. Bacterial protein toxins that modify host regulatory GTPases. Nat Rev Microbiol 9: 487 498. 5. Aktories, K., G. Schmidt, and I. Just. 2000. Rho GTPases as targets of bacterial protein toxins. Biol Chem 381: 421 426. 6. Alaoui El Azher, M., J. Jia, W. Lian, and S. Jin. 2006. ExoS of Pseudomonas aeruginosa induces apoptosis through a Fas receptor/caspase 8 independent pathway in HeLa cells. Cell Microbiol 8: 326 338. 7. Anderson, D. M., K. M. Schmalzer, H. Sato, M. Casey, S. S. Terhune, A. L. Haas, J. B. Feix, and D. W. Frank. 2011. Ubiquitin and ubiquitin modified proteins activate the Pseudomonas aeruginosa T3SS cytotoxin, ExoU. Mol Microbiol 82: 1454 1467. 8. Angus, A. A., D. J. Evans, J. T. Barbieri, and S. M. Fleiszig. 2010. The ADP ribosylation domain of Pseudomonas aeruginosa ExoS is required for membrane bleb niche formation and bacterial survival within epithelial cells. Infect Immun 78: 4500 4510. 9. Arnoldo, A., J. Curak, S. Kittanakom, I. Chevelev, V. T. Lee, M. Sahebol Amri, B. Koscik, L. Ljuma, P. J. Roy, A. Bedalov, G. Giaever, C. Nislow, A. R. Merrill, S. Lory, and I. Stagljar. 2008. Identification of small molecule inhibitors of Pseudomonas aeruginosa exoenzyme S using a yeast phenotypic screen. PLoS Genet 4: e1000005. 10. Barbieri, J. T. 2000. Pseudomonas aeruginosa exoenzyme S, a bifunctional type III secreted cytotoxin. Int J Med Microbiol 290: 381 387. 11. Barbieri, J. T., and J. Sun. 2004. Pseudomonas aeruginosa ExoS and ExoT. Rev Physiol Biochem Pharmacol 152: 79 92.

PAGE 126

126 12. Bardoel, B. W., S. v an der Ent, M. J. Pel, J. Tommassen, C. M. Pieterse, K. P. van Kessel, and J. A. van Strijp. 2011. Pseudomonas evades immune recognition of flagellin in both mammals and plants. PLoS Pathog 7: e1002206. 13. Barth, H. 2004. Uptake of binary actin ADP ribosyl ating toxins. Rev Physiol Biochem Pharmacol 152: 165 182. Epub 2004 Sep 2011. 14. Benson, M. A., S. M. Komas, K. M. Schmalzer, M. S. Casey, D. W. Frank, and J. B. Feix. 2011. Induced conformational changes in the activation of the Pseudomonas aeruginosa typ e III toxin, ExoU. Biophys J 100: 1335 1343. 15. Bernardes, N., R. Seruca, A. M. Chakrabarty, and A. M. Fialho. Microbial based therapy of cancer: current progress and future prospects. Bioeng Bugs 1: 178 190. Epub 2009 Dec 2002. 16. Bichsel, C., D. K. Neeld, T. Hamazaki, D. Wu, L. J. Chang, L. Yang, N. Terada, and S. Jin. Bacterial delivery of nuclear proteins into pluripotent and differentiated cells. PLoS 6: e16465. 17. Bleves, S., V. Viarre, R. Salacha, G. P. Michel, A. Filloux, and R. Voulhoux. 2010. Protein secretion systems in Pseudomonas aeruginosa: A wealth of pathogenic weapons. Int J Med Microbiol 300: 534 543. 18. Breidenstein, E. B., C. de la Fuente Nunez, and R. E. Hancock. 2011. Pseudomonas aeruginosa: all roads lead to resistance. Trends Mic robiol 19: 419 426. 19. Bridges, D., and G. B. Moorhead. 2005. 14 3 3 proteins: a number of functions for a numbered protein. Sci STKE 2005: re10. 20. Brutinel, E. D., C. A. Vakulskas, and T. L. Yahr. 2009. Functional domains of ExsA, the transcriptional activator of the Pseudomonas aeruginosa type III secretion system. J Bacteriol 191: 3811 3821. 21. Campodonico, V. L., N. J. Llosa, M. Grout, G. Doring, T. Maira Litran, and G. B. Pier. 2010. Evaluation of flagella and flagellin of Pseudomonas aeruginosa as vaccines. Infect Immun 78: 746 755. 22. Chakrabarty, A. M. 1998. Nucleoside diphosphate kinase: role in bacterial growth, virulence, cell signalling and polysaccharide synthesis. Mol Microbiol 28: 875 8 82. 23. Chopra, P., H. Koduri, R. Singh, A. Koul, M. Ghildiyal, K. Sharma, A. K. Tyagi, and Y. Singh. 2004. Nucleoside diphosphate kinase of Mycobacterium tuberculosis acts as GTPase activating protein for Rho GTPases. FEBS Lett 571: 212 216.

PAGE 127

127 24. Chopra, P. A. Singh, A. Koul, S. Ramachandran, K. Drlica, A. K. Tyagi, and Y. Singh. 2003. Cytotoxic activity of nucleoside diphosphate kinase secreted from Mycobacterium tuberculosis. Eur J Biochem 270: 625 634. 25. Cianciotto, N. P. 2005. Type II secretion: a prot ein secretion system for all seasons. Trends Microbiol 13: 581 588. 26. Clegg, H. V., K. Itahana, and Y. Zhang. 2008. Unlocking the Mdm2 p53 loop: ubiquitin is the key. Cell Cycle 7: 287 292. 27. Coburn, B., I. Sekirov, and B. B. Finlay. 2007. Type III secre tion systems and disease. Clin Microbiol Rev 20: 535 549. 28. Coburn, J., and D. M. Gill. 1991. ADP ribosylation of p21ras and related proteins by Pseudomonas aeruginosa exoenzyme S. Infect Immun 59: 4259 4262. 29. Coburn, J., R. T. Wyatt, B. H. Iglewski, an d D. M. Gill. 1989. Several GTP binding proteins, including p21c H ras, are preferred substrates of Pseudomonas aeruginosa exoenzyme S. J Biol Chem 264: 9004 9008. 30. Collier, R. J. 2001. Understanding the mode of action of diphtheria toxin: a perspective on progress during the 20th century. Toxicon 39: 1793 1803. 31. Cornelis, G. R. 2006. The type III secretion injectisome. Nat Rev Microbiol 4: 811 825. 32. Cornelis, G. R. The type III secretion injectisome, a complex nanomachine for intracellular 'toxin' de livery. Biol 391: 745 751. 33. Cornelis, G. R., and F. Van Gijsegem. 2000. Assembly and function of type III secretory systems. Annu Rev Microbiol 54: 735 774. 34. Cowell, B. A., D. J. Evans, and S. M. Fleiszig. 2005. Actin cytoskeleton disruption by ExoY and its effects on Pseudomonas aeruginosa invasion. FEMS Microbiol Lett 250: 71 76. 35. Delepelaire, P. 2004. Type I secretion in gram negative bacteria. Biochim Biophys Acta 1694: 149 161. 36. Deng, Q., and J. T. Barbieri. 2008. Molecular mechanisms of the cytotoxicity of ADP ribosylating toxins. Annu Rev Microbiol 62: 271 288. 37. Driscoll, J. A., S. L. Brody, and M. H. Kollef. 2007. The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections Drugs 67: 351 368. 38. Engel, J., and P. Balachandran. 2009. Role of Pseudomonas aeruginosa type III effectors in disease. Curr Opin Microbiol 12: 61 66. Epub 2009 Jan 2023.

PAGE 128

128 39. Epaulard, O., M. Derouazi, C. Margerit, R. Marlu, D. Filopon, B. Polack, and B Toussaint. 2008. Optimization of a type III secretion system based Pseudomonas aeruginosa live vector for antigen delivery. Clin Vaccine Immunol 15: 308 313. Epub 2007 Dec 2019. 40. Epaulard, O., B. Toussaint, L. Quenee, M. Derouazi, N. Bosco, C. Villiers R. Le Berre, B. Guery, D. Filopon, L. Crombez, P. N. Marche, and B. Polack. 2006. Anti tumor immunotherapy via antigen delivery from a live attenuated genetically engineered Pseudomonas aeruginosa type III secretion system based vector. Mol Ther 14: 656 6 61. Epub 2006 Sep 2027. 41. Feldman, M., R. Bryan, S. Rajan, L. Scheffler, S. Brunnert, H. Tang, and A. Prince. 1998. Role of flagella in pathogenesis of Pseudomonas aeruginosa pulmonary infection. Infect Immun 66: 43 51. 42. Feltman, H., G. Schulert, S. Kh an, M. Jain, L. Peterson, and A. R. Hauser. 2001. Prevalence of type III secretion genes in clinical and environmental isolates of Pseudomonas aeruginosa. Microbiology 147: 2659 2669. 43. Finck Barbancon, V., J. Goranson, L. Zhu, T. Sawa, J. P. Wiener Kroni sh, S. M. Fleiszig, C. Wu, L. Mende Mueller, and D. W. Frank. 1997. ExoU expression by Pseudomonas aeruginosa correlates with acute cytotoxicity and epithelial injury. Mol Microbiol 25: 547 557. 44. Fitzgerald, D., and I. Pastan. 1993. Pseudomonas exotoxin and recombinant immunotoxins derived from it. Ann N Y Acad Sci 685: 740 745. 45. Franchi, L., J. Stoolman, T. D. Kanneganti, A. Verma, R. Ramphal, and G. Nunez. 2007. Critical role for Ipaf in Pseudomonas aeruginosa induced caspase 1 activation. Eur J Immunol 37: 3030 3039. 46. Fraylick, J. E., M. J. Riese, T. S. Vincent, J. T. Barbieri, and J. C. Olson. 2002. ADP ribosylation and functional effects of Pseudomonas exoenzyme S on cellular RalA. Biochemistry 41: 9680 9687. 47. Frederix, M., and A. J. Downie. 2011. Quorum sensing: regulating the regulators. Adv Microb Physiol 58: 23 80. 48. Fu, H., J. Coburn, and R. J. Collier. 1993. The eukaryotic host factor that acti vates exoenzyme S of Pseudomonas aeruginosa is a member of the 14 3 3 protein family. Proc Natl Acad Sci U S A 90: 2320 2324. 49. Galan, J. E., and A. Collmer. 1999. Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284: 1322 1328. 50. Galan, J. E., and H. Wolf Watz. 2006. Protein delivery into eukaryotic cells by type III secretion machines. Nature 444: 567 573.

PAGE 129

129 51. Gamb ello, M. J., S. Kaye, and B. H. Iglewski. 1993. LasR of Pseudomonas aeruginosa is a transcriptional activator of the alkaline protease gene (apr) and an enhancer of exotoxin A expression. Infect Immun 61: 1180 1184. 52. Ganesan, A. K., T. S. Vincent, J. C. Olson, and J. T. Barbieri. 1999. Pseudomonas aeruginosa exoenzyme S disrupts Ras mediated signal transduction by inhibiting guanine nucleotide exchange factor catalyzed nucleotide exchange. J Biol Chem 274: 21823 21829. 53. Garrity Ryan, L., S. Shafikhani, P. Balachandran, L. Nguyen, J. Oza, T. Jakobsen, J. Sargent, X. Fang, S. Cordwell, M. A. Matthay, and J. N. Engel. 2004. The ADP ribosyltransferase domain of Pseudomonas aeruginosa ExoT contributes to its biological activities. Infect Immun 72: 546 558. 54. Geiser, T. K., B. I. Kazmierczak, L. K. Garrity Ryan, M. A. Matthay, and J. N. Engel. 2001. Pseudomonas aeruginosa ExoT inhibits in vitro lung epithelial wound repair. Cell Microbiol 3: 223 236. 55. Ghosh, P. 2004. Process of protein transport by the type III secretion system. Microbiol Mol Biol Rev 68: 771 795. 56. Goehring, U. M., G. Schmidt, K. J. Pederson, K. Aktories, and J. T. Barbieri. 1999. The N terminal domain of Pseudomonas aeruginosa exoenzyme S is a GTPase activating protein for Rho GTPases. J B iol Chem 274: 36369 36372. 57. Goure, J., A. Pastor, E. Faudry, J. Chabert, A. Dessen, and I. Attree. 2004. The V antigen of Pseudomonas aeruginosa is required for assembly of the functional PopB/PopD translocation pore in host cell membranes. Infect Immun 72: 4741 4750. 58. Greenblatt, M. S., W. P. Bennett, M. Hollstein, and C. C. Harris. 1994. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 54: 4855 4878. 59. Groisman, E. A., and H. Ochman. 1996. Pa thogenicity islands: bacterial evolution in quantum leaps. Cell 87: 791 794. 60. Ha, U., and S. Jin. 2001. Growth phase dependent invasion of Pseudomonas aeruginosa and its survival within HeLa cells. Infect Immun 69: 4398 4406. 61. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557 580. 62. Hauser, A. R. 2009. The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nat Rev Microbiol 7: 654 665. 63. Haussler, S. 2010. Multicellular signall ing and growth of Pseudomonas aeruginosa. Int J Med Microbiol 300: 544 548.

PAGE 130

130 64. Hayes, C. S., S. K. Aoki, and D. A. Low. 2010. Bacterial contact dependent delivery systems. Annu Rev Genet 44: 71 90. 65. Hayes, C. S., S. K. Aoki, and D. A. Low. Bacterial contact dependent delivery systems. Annu 44: 71 90. 66. Henriksson, M. L., M. S. Francis, A. Peden, M. Aili, K. Stefansson, R. Palmer, A. Aitken, and B. Hallberg. 2002. A nonphosphorylated 14 3 3 binding motif on exoenzyme S that is functional in vivo. Eur J Biochem 269: 4921 4929. 67. Henriksson, M. L., R. Rosqvist, M. Telepnev, H. Wolf Watz, and B. Hallberg. 2000. Ras effector pathway activation by epidermal growth factor is inhibited in vivo by exoenzyme S ADP ribosylation of Ras. Biochem J 347: 217 222. 68. Henriksson, M. L., C. Sundin, A. L. Jansson, A. Forsberg, R. H. Palmer, and B. Hallberg. 2002. Exoenzyme S shows selective ADP ribosylation and GTPase activating protein (GAP) activities towards small GTPases in vivo. Biochem J 367: 617 628. 69 Henriksson, M. L., U. Troller, and B. Hallberg. 2000. 14 3 3 proteins are required for the inhibition of Ras by exoenzyme S. Biochem J 349: 697 701. 70. Hoang, T. T., R. R. Karkhoff Schweizer, A. J. Kutchma, and H. P. Schweizer. 1998. A broad host range F lp FRT recombination system for site specific excision of chromosomally located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: 77 86. 71. Hoffman, R. M. 2009. Tumor targeting amino acid auxotrophic Salmonella typhimurium. Amino Acids 37: 509 521. Epub 2009 Mar 2017. 72. Hogardt, M., and J. Heesemann. 2010. Adaptation of Pseudomonas aeruginosa during persistence in the cystic fibrosis lung. Int J Med Microbiol 300: 557 562. 73. Hoiczyk, E., and G. Blobel. 2001. Po lymerization of a single protein of the pathogen Yersinia enterocolitica into needles punctures eukaryotic cells. Proc Natl Acad Sci U S A 98: 4669 4674. 74. Holloway, B. W., V. Krishnapillai, and A. F. Morgan. 1979. Chromosomal genetics of Pseudomonas. Microbiol Rev 43: 73 102. 75. Hritonenko, V., J. J. Mun, C. Tam, N. C. Simon, J. T. Barbieri, D. J. Evans, and S. M. Fleiszig. 2011. Adenylate cyclase activity of Pseudomonas aeruginosa ExoY can mediate bleb niche formation in epithelial cells and contributes to virulence. Microb Pathog 51: 305 312.

PAGE 131

13 1 76. Jansson, A. L., L. Yasmin, P. Warne, J. Downward, R. H. Palmer, and B. Hallberg. 2006. Exoenzyme S of Pseudomonas aeruginosa is not able to induce apoptosis when cel ls express activated proteins, such as Ras or protein kinase B/Akt. Cell Microbiol 8: 815 822. 77. Jia, J., M. Alaoui El Azher, M. Chow, T. C. Chambers, H. Baker, and S. Jin. 2003. c Jun NH2 terminal kinase mediated signaling is essential for Pseudomonas ae ruginosa ExoS induced apoptosis. Infect Immun 71: 3361 3370. 78. Jia, J., Y. Wang, L. Zhou, and S. Jin. 2006. Expression of Pseudomonas aeruginosa toxin ExoS effectively induces apoptosis in host cells. Infect Immun 74: 6557 6570. Epub 2006 Sep 6511. 79. Jon es, S. N., A. E. Roe, L. A. Donehower, and A. Bradley. 1995. Rescue of embryonic lethality in Mdm2 deficient mice by absence of p53. Nature 378: 206 208. 80. Kamath, S., M. L. Chen, and A. M. Chakrabarty. 2000. Secretion of nucleoside diphosphate kinase by mucoid Pseudomonas aeruginosa 8821: involvement of a carboxy terminal motif in secretion. J Bacteriol 182: 3826 3831. 81. Kaufman, M. R., J. Jia, L. Zeng, U. Ha, M. Chow, and S. Jin. 2000. Pseudomonas aer uginosa mediated apoptosis requires the ADP ribosylating activity of exoS. Microbiology 146: 2531 2541. 82. Kazmierczak, B. I., and J. N. Engel. 2002. Pseudomonas aeruginosa ExoT acts in vivo as a GTPase activating protein for RhoA, Rac1, and Cdc42. Infect Immun 70: 2198 2205. 83. Kellner, C., W. K. Bleeker, J. J. Lammerts van Bueren, M. Staudinger, K. Klausz, S. Derer, P. Glorius, A. Muskulus, B. E. de Goeij, J. G. van de Winkel, P. W. Parren, T. Valerius, M. Gramatzki, and M. Peipp. 2011. Human kappa light chain targeted Pseudomonas exotoxin A -identifying human antibodies and Fab fragments with favorable characteristics for antibody drug conjugate development. J Immunol Methods 371: 122 133. 84. Kim, J., K. Ahn, S. Min, J. Jia, U. Ha, D. Wu, and S. Jin. 2005 Factors triggering type III secretion in Pseudomonas aeruginosa. Microbiology 151: 3575 3587. 85. Kim, J. B., V. Sebastiano, G. Wu, M. J. Arauzo Bravo, P. Sasse, L. Gentile, K. Ko, D. Ruau, M. Ehrich, D. van den Boom, J. Meyer, K. Hubner, C. Bernemann, C. Ortmeier, M. Zenke, B. K. Fleischmann, H. Zaehres, and H. R. Scholer. 2009. Oct4 induced pluripotency in adult neural stem cells. Cell 136: 411 419. 86. Koch Nolte, F., S. Adriouch, P. Bannas, C. Krebs, F. Scheuplein, M. Seman, and F. Haag. 2006. ADP ribos ylation of membrane proteins: unveiling the secrets of a crucial regulatory mechanism in mammalian cells. Ann Med 38: 188 199.

PAGE 132

132 87. Kounnas, M. Z., R. E. Morris, M. R. Thompson, D. J. FitzGerald, D. K. Strickland, and C. B. Saelinger. 1992. The alpha 2 macro globulin receptor/low density lipoprotein receptor related protein binds and internalizes Pseudomonas exotoxin A. J Biol Chem 267: 12420 12423. 88. Krall, R., G. Schmidt, K. Aktories, and J. T. Barbieri. 2000. Pseudomonas aeruginosa ExoT is a Rho GTPase act ivating protein. Infect Immun 68: 6066 6068. 89. Krall, R., Y. Zhang, and J. T. Barbieri. 2004. Intracellular membrane localization of pseudomonas ExoS and Yersinia YopE in mammalian cells. J Biol Chem 279: 2747 2753. Epub 2003 Nov 2743. 90. Kreitman, R. J., D. R. Squires, M. Stetler Stevenson, P. Noel, D. J. FitzGerald, W. H. Wilson, and I. Pastan. 2005. Phase I trial of recombinant immunotoxin RFB4(dsFv) PE38 (BL22) in patients with B cell malignancies. J Clin Oncol 23: 6719 6729. Epub 2005 Aug 6711. 91. Kub ori, T., Y. Matsushima, D. Nakamura, J. Uralil, M. Lara Tejero, A. Sukhan, J. E. Galan, and S. I. Aizawa. 1998. Supramolecular structure of the Salmonella typhimurium type III protein secretion system. Science 280: 602 605. 92. Kussie, P. H., S. Gorina, V. Marechal, B. Elenbaas, J. Moreau, A. J. Levine, and N. P. Pavletich. 1996. Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain. Science 274: 948 953. 93. Lara Tejero, M., J. Kato, S. Wagner, X. Liu, and J. E. Galan. 20 11. A sorting platform determines the order of protein secretion in bacterial type III systems. Science 331: 1188 1191. 94. Lau, G. W., D. J. Hassett, and B. E. Britigan. 2005. Modulation of lung epithelial functions by Pseudomonas aeruginosa. Trends Microb iol 13: 389 397. 95. Lee, V. T., R. S. Smith, B. Tummler, and S. Lory. 2005. Activities of Pseudomonas aeruginosa effectors secreted by the Type III secretion system in vitro and during infection. Infect Immun 73: 1695 1705. 96. Lewis, J. D., D. S. Guttman, and D. Desveaux. 2009. The targeting of plant cellular systems by injected type III effector proteins. Semin Cell Dev Biol 20: 1055 1063. 97. Lister, P. D., D. J. Wolter, and N. D. Hanson. 2009. Antibacterial resistant Pseudomonas aeruginosa: clinical impac t and complex regulation of chromosomally encoded resistance mechanisms. Clin Microbiol Rev 22: 582 610.

PAGE 133

133 98. Low, K. B., M. Ittensohn, T. Le, J. Platt, S. Sodi, M. Amoss, O. Ash, E. Carmichael, A. Chakraborty, J. Fischer, S. L. Lin, X. Luo, S. I. Miller, L. Zheng, I. King, J. M. Pawelek, and D. Bermudes. 1999. Lipid A mutant Salmonella with suppressed virulence and TNFalpha induction retain tumor targeting in vivo. Nat Biotechnol 17: 37 41. 99. Lower, M., and G. Schneider. 2009. Prediction of type III secreti on signals in genomes of gram negative bacteria. PLoS One 4: e5917. 100. Lyczak, J. B., C. L. Cannon, and G. B. Pier. 2000. Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist. Microbes Infect 2: 1051 1060. 101. Ma, Q., Y. Zhai, J. C. Schneider, T. M. Ramseier, and M. H. Saier, Jr. 2003. Protein secretion systems of Pseudomonas aeruginosa and P fluorescens. Biochim Biophys Acta 1611: 223 233. 102. Macnab, R. M. 2004. Type III flagellar protein export and flagellar assembly. Biochim Biophys Acta 1694: 207 217. 103. Mahenthiralingam, E., M. E. Campbell, and D. P. Speert. 1994. Nonmotility and phagocytic resistance of Pseudomonas aeruginosa isolates from chronically colonized patients with cystic fibrosis. Infect Immun 62: 596 605. 104. Maresso, A. W., M. R. Baldwin, and J. T. Barbieri. 2004. Ezrin/radixin/moesin proteins are high affinity targets for ADP ribosylation by Pseudomonas aeruginosa ExoS. J Biol Chem 279: 38402 38408. Epub 32004 Jul 38412. 105. Marine, J. C., and G Lozano. 2010. Mdm2 mediated ubiquitylation: p53 and beyond. Cell Death Differ 17: 93 102. 106. Masters, S. C., K. J. Pederson, L. Zhang, J. T. Barbieri, and H. Fu. 1999. Interaction of 14 3 3 with a nonphosphorylated protein ligand, exoenzyme S of Pseudom onas aeruginosa. Biochemistry 38: 5216 5221. 107. Matsumoto, H., and G. M. Young. 2009. Translocated effectors of Yersinia. Curr Opin Microbiol 12: 94 100. 108. Matthaei, K. I. 2007. Genetically manipulated mice: a powerful tool with unsuspected caveats. J P hysiol 582: 481 488. Epub 2007 May 2010. 109. McGuffie, E. M., D. W. Frank, T. S. Vincent, and J. C. Olson. 1998. Modification of Ras in eukaryotic cells by Pseudomonas aeruginosa exoenzyme S. Infect Immun 66: 2607 2613. 110. McGuffie, E. M., J. E. Fraylick, D. J. Hazen Martin, T. S. Vincent, and J. C. Olson. 1999. Differential sensitivity of human epithelial cells to Pseudomonas aeruginosa exoenzyme S. Infect Immun 67: 3494 3503.

PAGE 134

134 111. Montes de Oca Luna, R., D. S. Wagner, and G. Lozano. 1995. Rescue of early embryonic lethality in mdm2 deficient mice by deletion of p53. Nature 378: 203 206. 112. Montie, T. C., D. Doyle Huntzinger, R. C. Craven, and I. A. Holder. 1982. Loss of virulence associated with absence of flagellum in an isogenic m utant of Pseudomonas aeruginosa in the burned mouse model. Infect Immun 38: 1296 1298. 113. Moraes, T. F., T. Spreter, and N. C. Strynadka. 2008. Piecing together the type III injectisome of bacterial pathogens. Curr Opin Struct Biol 18: 258 266. 114. Morris on, D. K. 2009. The 14 3 3 proteins: integrators of diverse signaling cues that impact cell fate and cancer development. Trends Cell Biol 19: 16 23. Epub 2008 Nov 2020. 115. Mougous, J. D., M. E. Cuff, S. Raunser, A. Shen, M. Zhou, C. A. Gifford, A. L. Good man, G. Joachimiak, C. L. Ordonez, S. Lory, T. Walz, A. Joachimiak, and J. J. Mekalanos. 2006. A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus. Science 312: 1526 1530. 116. Murray, P. R., G. S. Kobayashi, M. A. Pfaller, and K. S. Rosenthal. 1994. Medical Microbiology, 2nd ed. Mosby Year Books INC, St. Louis, Missouri. 117. Nagy, A., L. Mar, and G. Watts. 2009. Creation and use of a cre recombinase transgenic database. Methods Mol Biol 530: 365 378. 118. Obritsch, M. D., D. N Fish, R. MacLaren, and R. Jung. 2004. National surveillance of antimicrobial resistance in Pseudomonas aeruginosa isolates obtained from intensive care unit patients from 1993 to 2002. Antimicrob Agents Chemother 48: 4606 4610. 119. Okuda, J., N. Hayashi, M. Okamoto, S. Sawada, S. Minagawa, Y. Yano, and N. Gotoh. 2010. Translocation of Pseudomonas aeruginosa from the intestinal tract is mediated by the binding of ExoS to an Na,K ATPase regulator, FXYD3. Infect Immun 78: 4511 4522. 120. Ottmann, C., L. Yasmi n, M. Weyand, J. L. Veesenmeyer, M. H. Diaz, R. H. Palmer, M. S. Francis, A. R. Hauser, A. Wittinghofer, and B. Hallberg. 2007. Phosphorylation independent interaction between 14 3 3 and exoenzyme S: from structure to pathogenesis. EMBO J 26: 902 913. Epub 2007 Jan 2018. 121. Parsot, C. 2009. Shigella type III secretion effectors: how, where, when, for what purposes? Curr Opin Microbiol 12: 110 116.

PAGE 135

135 122. Pastor, A., J. Chabert, M. Louwagie, J. Garin, and I. Attree. 2005. PscF is a major component of the Pseud omonas aeruginosa type III secretion needle. FEMS Microbiol Lett 253: 95 101. 123. Pederson, K. J., R. Krall, M. J. Riese, and J. T. Barbieri. 2002. Intracellular localization modulates targeting of ExoS, a type III cytotoxin, to eukaryotic signalling prote ins. Mol Microbiol 46: 1381 1390. 124. Perrett, C. A., and D. Zhou. Type three secretion system effector translocation: one step or two? Front 2: 50. Epub 2011 Mar 2016. 125. Pesci, E. C., J. P. Pearson, P. C. Seed, and B. H. Iglewski. 1997. Regulation of la s and rhl quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179: 3127 3132. 126. Phan, J., Z. Li, A. Kasprzak, B. Li, S. Sebti, W. Guida, E. Schonbrunn, and J. Chen. 2010. Structure based design of high affinity peptides inhibiting the interaction of p53 with MDM2 and MDMX. J Biol Chem 285: 2174 2183. 127. Pier, G. B., M. Grout, and T. S. Zaidi. 1997. Cystic fibrosis transmembrane conductance regulator is an epithelial cell receptor for clearance of Pseudomonas aeruginosa from the lung. Proc Natl Acad Sci U S A 94: 12088 12093. 128. Polack, B., S. Vergnaud, M. H. Paclet, D. Lamotte, B. Toussaint, and F. Morel. 2000. Protein delivery by Pseudomonas type III secretion syst em: Ex vivo complementation of p67(phox) deficient chronic granulomatous disease. Biochem Biophys Res Commun 275: 854 858. 129. Pruitt, B. A., Jr., A. T. McManus, S. H. Kim, and C. W. Goodwin. 1998. Burn wound infections: current status. World J Surg 22: 135 145. 130. Riese, M. J., U. M. Goehring, M. E. Ehrmantraut, J. Moss, J. T. Barbieri, K. Aktories, and G. Schmidt. 2002. Auto ADP ribosylation of Pseudomonas aeruginosa ExoS. J Biol Chem 277: 12082 12088. Epub 12002 Jan 12030. 131. Rucks, E. A., and J. C. Olson. 2005. Characterization of an ExoS Type III translocation resistant cell line. Infect Immun 73: 638 643. 132. Ryan, R. M., J. Green, and C. E. Lewis. 2006. Use of bacteria in anti cancer therapies. Bioessays 28: 84 94. 133. Sadikot, R. T., T. S. Blackw ell, J. W. Christman, and A. S. Prince. 2005. Pathogen host interactions in Pseudomonas aeruginosa pneumonia. Am J Respir Crit Care Med 171: 1209 1223. 134. Sal Man, N., M. A. Croxen, and B. B. Finlay. Translocation of effectors: revisiting the injectosome model. Future 6: 483 484.

PAGE 136

136 135. Sandkvist, M. 2001. Type II secretion and pathogenesis. Infect Immun 69: 3523 3535. 136. Sasaki, M., L. Nie, and C. G. Maki. 2007. MDM2 binding induces a conformational change in p53 that is opposed by heat shock protein 90 and precedes p53 proteasomal degradation. J Biol Chem 282: 14626 14634. 137. Sato, H., J. B. Feix, and D. W. Frank. 2006. Identification of superoxide dismutase as a cofactor for the pseudomonas type III toxin, ExoU. Biochemistry 45: 10368 10375. 138. Sato, H., D. W. Frank, C. J. Hillard, J. B. Feix, R. R. Pankhaniya, K. Moriyama, V. Finck Barbancon, A. Buchaklian, M. Lei, R. M. Long, J. Wiener Kronish, and T. Sawa. 2003. The mechanism of action of the Pseudomonas aeruginosa encoded type III cytotoxin, ExoU. EMB O J 22: 2959 2969. 139. Sauer, B., and N. Henderson. 1988. Site specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci U S A 85: 5166 5170. 140. Schmalzer, K. M., M. A. Benson, and D. W. Frank. 2010. Acti vation of ExoU phospholipase activity requires specific C terminal regions. J Bacteriol 192: 1801 1812. 141. Scita, G., P. Tenca, E. Frittoli, A. Tocchetti, M. Innocenti, G. Giardina, and P. P. Di Fiore. 2000. Signaling from Ras to Rac and beyond: not just a matter of GEFs. EMBO J 19: 2393 2398. 142. Shafikhani, S. H., and J. Engel. 2006. Pseudomonas aeruginosa type III secreted toxin ExoT inhibits host cell division by targeting cytokinesis at multiple st eps. Proc Natl Acad Sci U S A 103: 15605 15610. 143. Si Tayeb, K., F. K. Noto, A. Sepac, F. Sedlic, Z. J. Bosnjak, J. W. Lough, and S. A. Duncan. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding rep rogramming factors. BMC 10: 81. 144. Sitkiewicz, I., K. E. Stockbauer, and J. M. Musser. 2007. Secreted bacterial phospholipase A2 enzymes: better living through phospholipolysis. Trends Microbiol 15: 63 69. 145. Smith, R. S., R. Kelly, B. H. Iglewski, and R P. Phipps. 2002. The Pseudomonas autoinducer N (3 oxododecanoyl) homoserine lactone induces cyclooxygenase 2 and prostaglandin E2 production in human lung fibroblasts: implications for inflammation. J Immunol 169: 2636 2642.

PAGE 137

137 146. Song, Y., M. Baer, R. Sri nivasan, J. Lima, G. Yarranton, C. Bebbington, and S. V. Lynch. 2011. PcrV antibody antibiotic combination improves survival in Pseudomonas aeruginosa infected mice. Eur J Clin Microbiol Infect Dis. 147. Spooner, R., and O. Yilmaz. Nucleoside diphosphate k inase: a pleiotropic effector in microbial colonization under interdisciplinary characterization. 148. Stavrinides, J., H. C. McCann, and D. S. Guttman. 2008. Host pathogen interplay and the evolution of bacterial effectors. Cell Microbiol 10: 285 292. Epub 2007 Nov 2021. 149. Stern, G. A. 1990. Pseudomonas keratitis and contact lens wear: the lens/eye is at fault. Cornea 9 Suppl 1: S36 38; discussion S39 40. 150. Stirling, F. R., A. Cuzick, S. M. Kelly, D. Oxley, and T. J. Evans. 2006. Eukaryotic localizatio n, activation and ubiquitinylation of a bacterial type III secreted toxin. Cell Microbiol 8: 1294 1309. 151. Sun, J., and J. T. Barbieri. 2004. ExoS Rho GTPase activating protein activity stimulates reorganization of the actin cytoskeleton through Rho GTPas e guanine nucleotide disassociation inhibitor. J Biol Chem 279: 42936 42944. 152. Sundin, C., B. Hallberg, and A. Forsberg. 2004. ADP ribosylation by exoenzyme T of Pseudomonas aeruginosa induces an irreversible effect on the host cell cytoskeleton in vivo. FEMS Microbiol Lett 234: 87 91. 153. Takahashi, K., and S. Yamanaka. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126: 663 676. Epub 2006 Aug 2010. 154. Tampakaki, A. P., V. E. Fadoulo glou, A. D. Gazi, N. J. Panopoulos, and M. Kokkinidis. 2004. Conserved features of type III secretion. Cell Microbiol 6: 805 816. 155. Toledo, F., and G. M. Wahl. 2007. MDM2 and MDM4: p53 regulators as targets in anticancer therapy. Int J Biochem Cell Biol 39: 1476 1482. Epub 2007 Apr 1478. 156. Toledo, F., and G. M. Wahl. 2006. Regulating the p53 pathway: in vitro hypotheses, in vivo veritas. Nat Rev Cancer 6: 909 923. 157. Toso, J. F., V. J. Gill, P. Hwu, F. M. Marincola, N. P. Restifo, D. J. Schwartzentruber, R. M. Sherry, S. L. Topalian, J. C. Yang, F. Stock, L. J. Freezer, K. E. Morton, C. Seipp, L. Haworth, S. Mavroukakis, D. White, S. MacDonald, J. Mao, M. Sznol, and S. A. Rosenberg. 2002. Phase I study of the intravenous administration of attenuated Salmonella typhimurium to patients with metastatic melanoma. J Clin Oncol 20: 142 152.

PAGE 138

138 158. Traill, Z. C., R. F. Miller, N. Ali, and P. J. Shaw. 1996. Pseudomonas aeruginosa bronchopulmonary infection in patients with advanced human immunodefici ency virus disease. Br J Radiol 69: 1099 1103. 159. Traugott, K. A., K. Echevarria, P. Maxwell, K. Green, and J. S. Lewis, 2nd. 2011. Monotherapy or combination therapy? The Pseudomonas aeruginosa conundrum. Pharmacotherapy 31: 598 608. 160. Van Gijsegem, F., C. Gough, C. Zischek, E. Niqueux, M. Arlat, S. Genin, P. Barberis, S. German, P. Castello, and C. Boucher. 1995. The hrp gene locus of Pseudomonas solanacearum, which controls the production of a type III secretion system, encodes eight proteins relate d to components of the bacterial flagellar biogenesis complex. Mol Microbiol 15: 1095 1114. 161. van Heusden, G. P. 2005. 14 3 3 proteins: regulators of numerous eukaryotic proteins. IUBMB Life 57: 623 629. 162. Vance, R. E., A. Rietsch, and J. J. Mekalanos. 2005. Role of the type III secreted exoenzymes S, T, and Y in systemic spread of Pseudomonas aeruginosa PAO1 in vivo. Infect Immun 73: 1706 1713. 163. Vasil, M. L. 1986. Pseudomonas aeruginosa: biology, mechanisms of virulence, epidemiology. J Pediatr 108: 800 805. 164. Veesenmeyer, J. L., A. R. Hauser, T. Lisboa, and J. Rello. 2009. Pseudomonas aeruginosa virulence and therapy: evolving translational strategies. Crit Care Med 37: 1777 1786. 165. Venier, A. G., T. Lavigne, P. Jarno, F. L'Heriteau, B. Coignard A. Savey, and A. M. Rogues. 2012. Nosocomial urinary tract infection in the intensive care unit: when should Pseudomonas aeruginosa be suspected? Experience of the French national surveillance of nosocomial infections in the intensive care unit, Rea Rais in. Clin Microbiol Infect 18: E13 15. 166. Vento, S., F. Cainelli, and Z. Temesgen. 2008. Lung infections after cancer chemotherapy. Lancet Oncol 9: 982 992. 167. Vidal, J. E., and F. Navarro Garcia. 2008. EspC translocation into epithelial cells by enteropa thogenic Escherichia coli requires a concerted participation of type V and III secretion systems. Cell Microbiol 10: 1975 1986. Epub 2008 Jun 1910. 168. Wang, Y., L. Zhang, W. L. Picking, W. D. Picking, and R. N. De Guzman. 2008. Structural dissection of th e extracellular moieties of the type III secretion apparatus. Mol Biosyst 4: 1176 1180. 169. Weldon, J. E., and I. Pastan. 2011. A guide to taming a toxin -recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer. FEBS J 278: 4683 4700.

PAGE 139

139 170. West, S. E., H. P. Schweizer, C. Dall, A. K. Sample, and L. J. Runyen Janecky. 1994. Construction of improved Escherichia Pseudomonas shuttle vectors derived from pUC18/19 and sequence of the region required for their replication in Pse udomonas aeruginosa. Gene 148: 81 86. 171. Williams, B. J., J. Dehnbostel, and T. S. Blackwell. 2010. Pseudomonas aeruginosa: host defence in lung diseases. Respirology 15: 1037 1056. 172. Wine, J. J. 1999. The genesis of cystic fibrosis lung disease. J Clin Invest 103: 309 312. 173. Wolf, P., and U. Elsasser Beile. 2009. Pseudomonas exotoxin A: from virulence factor to anti cancer agent. Int J Med Microbiol 299: 161 176. Epub 2008 Oct 2023. 174. Wolfgan g, M. C., J. Jyot, A. L. Goodman, R. Ramphal, and S. Lory. 2004. Pseudomonas aeruginosa regulates flagellin expression as part of a global response to airway fluid from cystic fibrosis patients. Proc Natl Acad Sci U S A 101: 6664 6668. 175. Yaffe, M. B. 200 2. How do 14 3 3 proteins work? -Gatekeeper phosphorylation and the molecular anvil hypothesis. FEBS Lett 513: 53 57. 176. Yahr, T. L., A. J. Vallis, M. K. Hancock, J. T. Barbieri, and D. W. Frank. 1998. ExoY, an adenylate cyclase secreted by the Pseudomon as aeruginosa type III system. Proc Natl Acad Sci U S A 95: 13899 13904. 177. Yahr, T. L., and M. C. Wolfgang. 2006. Transcriptional regulation of the Pseudomonas aeruginosa type III secretion system. Mol Microbiol 62: 631 640. Epub 2006 Sep 2021. 178. Yang, H., Z. Shan, J. Kim, W. Wu, W. Lian, L. Zeng, L. Xing, and S. Jin. 2007. Regulatory role of PopN and its interacting partners in type III secretion of Pseudomonas aeruginosa. J Bacteriol 189: 2599 2609. Epub 2007 Jan 2519. 179. Yu, J., K. Hu, K. Smuga Otto S. Tian, R. Stewart, Slukvin, II, and J. A. Thomson. 2009. Human induced pluripotent stem cells free of vector and transgene sequences. Science 324: 797 801. Epub 2009 Mar 2026. 180. Yu, J., M. A. Vodyanik, K. Smuga Otto, J. Antosiewicz Bourget, J. L. Fra ne, S. Tian, J. Nie, G. A. Jonsdottir, V. Ruotti, R. Stewart, Slukvin, II, and J. A. Thomson. 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science 318: 1917 1920. Epub 2007 Nov 1920. 181. Zaborina, O., N. Misra, J. Kostal, S. Kamath, V. Kapatral, M. E. El Idrissi, B. S. Prabhakar, and A. M. Chakrabarty. 1999. P2Z Independent and P2Z receptor mediated macrophage killing by Pseudomonas aeruginosa isolated from cystic fibrosis patients. Infect Immun 67: 5231 5242.

PAGE 140

140 182. Zhang, L., H Wang, D. Liu, R. Liddington, and H. Fu. 1997. Raf 1 kinase and exoenzyme S interact with 14 3 3zeta through a common site involving lysine 49. J Biol Chem 272: 13717 13724. 183. Zhang, Y., and J. T. Barbieri. 2005. A leucine rich motif targets Pseudomonas aeruginosa ExoS within mammalian cells. Infect Immun 73: 7938 7945. 184. Zhang, Y., Q. Deng, and J. T. Barbieri. 2007. Intracellular localization of type III delivered Pseudomonas ExoS with endosome vesicles. J Biol Chem 282: 13022 13032. 185. Zhao, M., M. Yang, X. M. Li, P. Jiang, E. Baranov, S. Li, M. Xu, S. Penman, and R. M. Hoffman. 2005. Tumor targeting bacterial therapy with amino acid auxotrophs of GFP expressing Salmonella typhimurium. Proc Natl Acad Sci U S A 102: 755 760. Epub 2005 Jan 2011. 186. Zh ou, H., S. Wu, J. Y. Joo, S. Zhu, D. W. Han, T. Lin, S. Trauger, G. Bien, S. Yao, Y. Zhu, G. Siuzdak, H. R. Scholer, L. Duan, and S. Ding. 2009. Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell 4: 381 384. Epub 2009 Ap r 2023. 187. Zhou, H., S. Wu, J. Y. Joo, S. Zhu, D. W. Han, T. Lin, S. Trauger, G. Bien, S. Yao, Y. Zhu, G. Siuzdak, H. R. Scholer, L. Duan, and S. Ding. Generation of Induced Pluripotent Stem Cells Using Recombinant Proteins.

PAGE 141

141 BIOGRAPHICAL SKETCH Dennis Neeld was born in DeLand, Florida in 1984. After completing high school, Dennis enrolled at the University of Florida where he received a B achelor of S cience degree in m icrobiology and c ell s ciences in May of 2007. He began his graduate work at the University of Florida in August 2007 in the Interdisciplinary Program in Biomedical Sciences. In 2008 he joined the laboratory of Dr. Shouguang Jin where he studied bacterial pathogenesis caused by the type III secretion system. After completing his PhD in 2012, Dennis plans to pursue a post doctoral fellowship in immunology related research and eventually one day run his own laboratory.