<%BANNER%>

Understanding and Preventing Autoimmune Beta Cell Destruction

Permanent Link: http://ufdc.ufl.edu/UFE0043968/00001

Material Information

Title: Understanding and Preventing Autoimmune Beta Cell Destruction Protection Provided by Mt-Nd2a
Physical Description: 1 online resource (133 p.)
Language: english
Creator: Lightfoot, Yaima Luzardo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: autoimmunity -- diabetes
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Mitochondria are indispensable in the life and death of many types of eukaryotic cells. In pancreatic beta cells, mitochondria play an essential role in insulin secretion, a hormone that regulates blood glucose levels. Unregulated blood glucose is a hallmark symptom of diabetes. The onset of type 1 diabetes (T1D) is preceded by autoimmune-mediated destruction of beta cells. Predisposition for T1D is in part determined by genetic factors. While many of the proposed causative genes for T1D impact immune function/regulation, the contribution of T1D-susceptibility or resistance genes at the beta cell level cannot be excluded at this time. Particularly, the effect of T1D-associated sequence variation in the mitochondrial DNA (mtDNA) and the role of mitochondria in human beta cell death have not been assessed. Therefore, the importance of mitochondria in immune destruction of the human beta cell line, betaLox5, and two derivative cell lines was investigated. Specifically, the contribution of two mitochondrial alleles, mt-ND2a/c, to the response of these cell lines to pro-death effectors was examined. Previously, our group defined a mutation in the mouse mitochondrial gene mt-Nd2 that prevents T1D. A single nucleotide transversion, C4738A (mouse) and C5178A (man), causes an amino acid change that is associated with T1D resistance. Although the mouse mt-Nd2a allele has been shown to decrease mitochondrial reactive oxygen species (mtROS) production after damage, no published data exist on the protective mechanism provided by the human ortholog, mt-ND2a. Similar to islet cells, beta Lox5 cells express common T1D autoantigens, are targeted by autoreactive effectors, and die by mechanisms implicated in disease progression. Thus, this human beta cell line is a practical source of human beta cells for cytotoxicity assays. Cytoplasmic hybrids (cybrids) encoding either mt-ND2c (beta Lox5-ND2c) or mt-ND2a (beta Lox5-ND2a) were developed after depleting beta Lox5 cells of their mtDNA, followed by fusion with donor platelets. Compared to beta Lox5-ND2c, beta Lox5-ND2a was more resistant to cytokines, Fas-induced killing, as well as autoreactive CD8+ T cells. Resistance correlated with lower levels of mtROS generation. These results indicate that, like in the mouse, mt-ND2a protects human beta cells from insults associated with T1D by suppressing mtROS production in response to pro-death signals.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yaima Luzardo Lightfoot.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Mathews, Clayton Elwood.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0043968:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043968/00001

Material Information

Title: Understanding and Preventing Autoimmune Beta Cell Destruction Protection Provided by Mt-Nd2a
Physical Description: 1 online resource (133 p.)
Language: english
Creator: Lightfoot, Yaima Luzardo
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2012

Subjects

Subjects / Keywords: autoimmunity -- diabetes
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Mitochondria are indispensable in the life and death of many types of eukaryotic cells. In pancreatic beta cells, mitochondria play an essential role in insulin secretion, a hormone that regulates blood glucose levels. Unregulated blood glucose is a hallmark symptom of diabetes. The onset of type 1 diabetes (T1D) is preceded by autoimmune-mediated destruction of beta cells. Predisposition for T1D is in part determined by genetic factors. While many of the proposed causative genes for T1D impact immune function/regulation, the contribution of T1D-susceptibility or resistance genes at the beta cell level cannot be excluded at this time. Particularly, the effect of T1D-associated sequence variation in the mitochondrial DNA (mtDNA) and the role of mitochondria in human beta cell death have not been assessed. Therefore, the importance of mitochondria in immune destruction of the human beta cell line, betaLox5, and two derivative cell lines was investigated. Specifically, the contribution of two mitochondrial alleles, mt-ND2a/c, to the response of these cell lines to pro-death effectors was examined. Previously, our group defined a mutation in the mouse mitochondrial gene mt-Nd2 that prevents T1D. A single nucleotide transversion, C4738A (mouse) and C5178A (man), causes an amino acid change that is associated with T1D resistance. Although the mouse mt-Nd2a allele has been shown to decrease mitochondrial reactive oxygen species (mtROS) production after damage, no published data exist on the protective mechanism provided by the human ortholog, mt-ND2a. Similar to islet cells, beta Lox5 cells express common T1D autoantigens, are targeted by autoreactive effectors, and die by mechanisms implicated in disease progression. Thus, this human beta cell line is a practical source of human beta cells for cytotoxicity assays. Cytoplasmic hybrids (cybrids) encoding either mt-ND2c (beta Lox5-ND2c) or mt-ND2a (beta Lox5-ND2a) were developed after depleting beta Lox5 cells of their mtDNA, followed by fusion with donor platelets. Compared to beta Lox5-ND2c, beta Lox5-ND2a was more resistant to cytokines, Fas-induced killing, as well as autoreactive CD8+ T cells. Resistance correlated with lower levels of mtROS generation. These results indicate that, like in the mouse, mt-ND2a protects human beta cells from insults associated with T1D by suppressing mtROS production in response to pro-death signals.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yaima Luzardo Lightfoot.
Thesis: Thesis (Ph.D.)--University of Florida, 2012.
Local: Adviser: Mathews, Clayton Elwood.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-11-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2012
System ID: UFE0043968:00001


This item has the following downloads:


Full Text

PAGE 1

1 UNDERSTANDING AND PREVENTING AUTOIMMUNE BETA CELL DESTRUCTION: PROTECTION PROVIDED BY mt ND2 a By YAMA LUZARDO LIGHTFOOT A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Yama Luzardo Lightfoot

PAGE 3

3 To my Family

PAGE 4

4 ACKNOWLEDGEMENTS I am grateful to have an extensive list of individuals whose contributions have facilitated the completion of my dissertation. Most importantly, I would like to thank my mentor, Dr. Clayton E. Mathews, for his patience guidance, and endless support during the last four years. Dr. Mathews is never too busy to teach and inspire ; as demonstrated by his willingness to drive ten hours within a twelve hour period to attend my wedding ceremony, he is truly invested in both the professional and personal growth of his students The members of the Mathews lab have been just as instrumental in my graduate career. Dr. Jing Chen taught me her excellent cell culture techniques, for that I am very gra teful. Dr. Terri C. Thayer although having successfully completed her pre doctoral training in the lab and moving abroad, continues to be a source of counsel and an excellent example to follow. I am also thankful to my committee members, Dr. Maria B. Gr ant, Dr. Michael J. Haller, Dr. Laurence M orel, and Dr. Shannon M. Wallet for their suggestions and constructive criticisms. Drs. Morel and Wallet were especially helpful in editing my dissertation early to allow its timely completion. Dr. Wallet, in add ition to h aving shared her knowledge of immunology, has also become a friend. My friends and family have moti vated me and kept me focused when it was most needed. Professionally, my parents have led by example and have encouraged me to reach and exceed my goals. My grandparents, Isabel and Mario Acosta, deserve special thanks for their never ending pride and support. I am also very fortunate to have a wonderful husband to share these accomplishments with. Joe has been the main driving force pushing me t o achieve my professional objectives through his love and support. He has a great sense of adventure and I cannot wait to spend the rest of our lives creating new and exciting experiences.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDG EMENTS ................................ ................................ ............................... 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURE S ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 16 Type 1 Diabetes ................................ ................................ ................................ ...... 16 Cellular Effectors in T1D Development ................................ ................................ ... 17 Molecular Mechanisms of Cell Death ................................ .......................... 18 In vitro CTL Mediated Killing of Pancreatic Islets ................................ ........... 20 Cell Lines for in vitro CTL Studies ................................ ................................ .. 22 Soluble Mediators in T1D ................................ ................................ ........................ 27 Reactive Oxygen Species and Proinflammatory Cytokines ............................ 27 In vitro Cytokine Induced Cell Killing ................................ ........................... 30 Immunomodulatory Effects of Cytokines ................................ ........................ 32 Mitochondria and the Mechanisms of Cell Death ................................ .................... 33 Genetics of Autoimmune T1D ................................ ................................ ................. 35 2 ROLE OF THE MITOCHONDRIA IN IMMUNE MEDIATED APOPTOTIC DEATH OF THE HUMAN PANCREATIC CELL LINE Lox5 ............................... 42 Introduction ................................ ................................ ................................ ............. 42 Materials and Methods ................................ ................................ ............................ 44 Cell Line and Reagents ................................ ................................ .................. 44 Genera tion of Lox5 0 Cells and Cybrid Lox5 Cells ................................ .... 45 Cell Death Assays ................................ ................................ .......................... 46 Nitric Oxi de Detection ................................ ................................ ..................... 47 Oxidative Stress Analysis ................................ ................................ ............... 48 Caspase Activity and Inhibition Assays ................................ .......................... 48 Flow Cytometry ................................ ................................ .............................. 48 Immunofluoresc ence ................................ ................................ ...................... 49 Statistical Analysis ................................ ................................ .......................... 4 9 Results ................................ ................................ ................................ .................... 49 Agonistic Activation of Fas Kills Lox5 Cells by Caspase Dependent Apoptosis ................................ ................................ ............................. 49

PAGE 6

6 Proinflammatory Cytokine Induced Killing of Lox5 Cells Occurs Through Caspase Dependent and Independent Apoptosis and Necrosis ....... 50 Mitochondrial DNA Deficient Lox5 Cells are Resistant to Cytokine Killing but Sensitive to Fas ................................ ................................ ............. 53 Discussion ................................ ................................ ................................ .............. 54 3 REDUCED MITOCHON DRIAL REACTIVE OXYGEN SPECIES PRODUCTION AND INCREASED RESISTANCE TO CELL DEATH SIGNALS AFFORDED BY mt ND2 a ................................ ................................ ................................ .................. 70 Introduction ................................ ................................ ................................ ............. 70 Materials and Methods ................................ ................................ ............................ 72 Cell Line and Reagents ................................ ................................ .................. 72 Genera tion of Lox5 ND2 c and Lox5 ND2 a Cells ................................ ......... 72 Cell Death Assays ................................ ................................ .......................... 74 Detection of Mitochondrial Reactive Oxygen Species Production .................. 75 Statistical Analysis ................................ ................................ .......................... 75 Results ................................ ................................ ................................ .................... 75 mt ND2 c and mt ND2 a Alleles in the Lox5 Nuclear Background ................... 75 mt ND2 a Protects Human Cells from Immune Mediated Destruction .......... 76 Lower Reactive Oxygen Species Production by Lox5 ND2 a Cells in Response to Proinflammatory Cytokines and Fas Receptor Activation ................................ ................................ ............................. 77 mt ND2 a does not Confer Heightened Resistance to Oxidative Stress .......... 77 Caspase Inhibition Fully Rescues Survival in Response to Agonistic Fas Ligation but not Proinflammatory Cytokines ................................ ........ 78 Discussion ................................ ................................ ................................ .............. 78 4 AUTOREACTIVE CYTOTOXIC T LYMPHOCYTE MEDIATED KILLING OF HUMAN CELLS IN VITRO ................................ ................................ ................... 91 Introduction ................................ ................................ ................................ ............. 91 Materials and Methods ................................ ................................ ............................ 93 Cell L ine and Reagents ................................ ................................ .................. 93 HLA Typing and Autoantigen Expression of lox5 ................................ ......... 93 Flow Cytometry ................................ ................................ .............................. 94 Chromium Release Assay ................................ ................................ .............. 94 Statis tical Analysis ................................ ................................ .......................... 95 Results ................................ ................................ ................................ .................... 95 Lox5 Cells Express T1D Autoantigens and Encode the Common HLA A*0201 Allele ................................ ................................ ....................... 95 Diabetogenic CTLs Re cognize and Kill Lox5 Cells ................................ ....... 96 mt ND2 a Protects Human Cells from CTL Killing ................................ ......... 97 Discussion ................................ ................................ ................................ .............. 97 5 CONCLUSION AND SIGNIFICANCE ................................ ................................ ... 105

PAGE 7

7 BIBLIOGRAPHY ................................ ................................ ................................ ......... 109 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 132

PAGE 8

8 LIST OF TABLES Table page 1 1 Human cell lines ................................ ................................ .............................. 38 1 2 Utility of human cell lines for in vitro cytotoxicity assays ................................ .. 39

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Oxidative stress induced cell dysfunction and death ................................ ....... 40 2 1 Lox5 cells are susceptible to Fas monoclonal antibody after rhIFN priming ................................ ................................ ................................ ................ 60 2 2 rhIFN alone causes arrested proliferation. ................................ ........................ 60 2 3 Fas induced killing is caspase dependent. ................................ ......................... 61 2 4 Cytokine induced cell death is partially caspase depende n t ............................. 62 2 5 Cytokine treatment of Lox5 cells induces the expression of Heat Shock Proteins. ................................ ................................ ................................ ............. 63 2 6 rhTNF alone does not inhibit proliferation of Lox5 cells ................................ .. 63 2 7 Apoptosis and DNA repair protein expression of cytokine treated Lox5 cells. .. 64 2 8 Lox5 cells die by apoptosis and necrosis after cytokine treatment with and without pan caspase inhibition. ................................ ................................ ........... 65 2 9 Cytokine treatment of Lox5 promotes nuclear translocation of Apoptosis Inducing Factor. ................................ ................................ ................................ .. 66 2 10 Inhibition of Cathepsin B or Bax translocation does not prevent cytokine mediated Lox5 cell death. ................................ ................................ ................. 67 2 11 Confirmation of mtDNA depletion in Lox5 0 cells. ................................ ........... 68 2 12 Functional mitochondria are require d for cytokine killing of Lox5 ..................... 69 3 1 Sequencing data of Lox5 cybrid cell clones ................................ ...................... 84 3 2 Confirmation of mtDNA reconstitution in Lox5 ND2 c and Lox5 ND2 a cells ..... 85 3 3 mt ND2 a protects against proinflammatory cytokine and death receptor mediated cell death. ................................ ................................ ........................... 86 3 4 Reduced mitochondrial ROS production in Lox5 ND2 a cells in response to pro death signals. ................................ ................................ ............................... 87 3 5 mt ND2 a does not enhance the antioxidant capacity of Lox5 ND2 a cells. ......... 88

PAGE 10

10 3 6 Pan caspase inhibition fails to rescue Lox5 ND2 a cells from proinflammatory cytokine mediated cell death but protects against Fas receptor activation. ................................ ................................ ............................. 89 3 7 Proposed mechanism of protection conferred by mt ND2 a in human cells ...... 90 4 1 The human cell line Lox5 expresses T1D autoantigens and is primed for immune surveillance ................................ ................................ ......................... 102 4 2 Lox5 cells are susceptible to cytotoxic T cell killing by HLA A0201 restricted IGRP reactive CD8 + T cells ................................ ................................ .............. 103 4 3 mt ND2 a protects against cytotoxic T cell killing by HLA A0201 restricted IGRP reactive CD8 + T cells. ................................ ................................ ............. 104

PAGE 11

11 LIST OF ABBREVIATION S m Mitochondrial membrane potential ADP Adenosine diphosphate AIF Apoptosis inducing factor APC Antigen presenting cell ATP Adenosine triphosphate BB DP BioBreeding diabetes prone CAD Caspase activated deoxyribonuclease CML Cell mediated lymphocytotoxicity CTL Cytotoxic T lymphocyte Cyt c Cytochrome c DC Dendritic cell DMPK Dystrophia myotonica protein kinase Endo G Endonuclease G ER Endoplasmic reticulum FADD Fas Associated Death Domain FPIR First phase insulin release GAD Glutamic acid decarboxylase GLUT Glucose transporter GSH Glutathione GSIS Glucose stimulated insulin secretion GSSG Oxidized glutathione H 2 O 2 Hydrogen peroxide HLA Human leukocyte antigen HMGB1 High mobility group box 1

PAGE 12

12 HSP H eat shock protein IAP Inhibitor of apoptosis ICA Islet cell antibod y IFN Interferon gamma IGRP Glucose 6 phosphatase catalytic subunit related protein IL 1 Interleukin 1 beta IL 1R Interleukin 1 receptor INS Insulin i NOS Inducible form of nitric oxide synthase K ATP ATP sensitive potassium [ channel ] MHC Major histocompatibility complex MODY Maturity onset diabetes of the young MOMP Mitochondrial outer membrane permeabilization mtDNA Mitochondrial DNA mtROS Mitochondrial ROS MTT 3 (4,5 Di methyl thiazol 2 yl) 2,5 di phenyl tetrazolium bromide NO Nitric oxide NOD Non obese diabetic OH Hydroxyl radical OVA Ovalbumin PBMC Peripheral Blood Mononuclear Cell PFA Paraformaldehyde PHHI P ersistent hyperinsulinemic hypoglycemia of infancy PPI Preproinsulin PTPRN Protein tyrosine phosphatase, receptor type, N

PAGE 13

13 RIP Rat insulin promoter RNS Reactive nitrogen species ROS Reactive oxygen species siRNA Small interfering RNA SNP Single nucleotide polymorphism SO 2 Superoxide STZ Streptozotocin SUR Sulfonylurea receptor T1D Type 1 diabetes TCA Tricarboxylic acid cycle TCR T cell receptor TMRM Tetramethylrhodamine methyl ester TNF Tumor necrosis factor alpha TRAIL Tumor necrosis factor related apoptosis inducing ligand VNTR Variable number of tandem repeats ZnT8 Solute carrier family 30, member 8 Z VAD FMK Pan caspase inhibitor

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy UNDERSTANDING AND PREVENTING AUTOIMMUNE BETA CELL DESTRUCTION: PROTECTION PROVIDED BY mt ND2 a By Yama Luzardo Lightfoot May 2012 Chair: Clayton E. Mathews Major: Immunology and Microbiology Mitochondria are indispensable in the life and death of many types of eukaryotic cells. In pancreatic cells, mitochondria play an essential role in insulin secretion a hormone that regulates blood glucose levels. Unregulated blood glucose is a hallmar k symptom of diabetes. The onset of t ype 1 diabetes (T1D) is preceded by autoimmune mediated destruction of cells. Predisposition for T1D is in par t determined by genetic factors While many of the proposed causative genes for T1D impact immune functio n / regulation, the contribution of T1D susceptibility or resistance genes at the cell level cannot be excluded at this time. Particularly the effect of T1D associated sequence var iation in the mitochondrial DNA (mtDNA ) and the role of mitochondria in human cell death ha ve not been assessed. T he refore, the importance of mitochondria in immune destruction of the human cell line, Lox5, and two derivative cell lines was investigated Specifically the contribution of two mitochondrial alleles mt ND2 a /c to the response of these ce ll lines to pro death effectors was examined

PAGE 15

15 Previously, our group defined a mutation in the mouse mitochondrial gene mt Nd2 that prevents T1D. A single nucleotide transversion, C4738A (mouse) and C 5178 A (man) causes an amino acid change that is associated with T1D res istance. Although the mouse mt Nd2 a allele has been shown to decrease mitochondrial reactive oxygen species ( mt ROS) production after damage, no published data exist on th e protective mechanism provided by the hum an ortholog mt ND 2 a Similar to islet cells, Lox5 cells express common T1D autoantigens are targeted by autoreactive effectors, and die by mechanisms implicated in disease progression Thus, this human cell line is a practical source of human cells for cytotoxicity assays. Cytoplasmic hybrids (cybrids) encoding either mt ND2 c ( Lox5 ND2 c ) or mt ND2 a ( Lox5 ND2 a ) were developed after depleting Lox5 cells of their mtDNA followed by fusion with donor platelets C ompared to Lox5 ND2 c Lox5 ND2 a was more resistant to cytokines, Fas induced killing as well as autoreactive CD8 + T cells Resistance correlated with lower levels of mt ROS generation. These results indicate that, like in the mouse mt ND2 a protects human cells from insults associated with T1D by suppressing mtROS production in response to pro death signals.

PAGE 16

16 CHAPTER 1 LITERATURE REVIEW Type 1 Diabetes Type 1 d iabetes (T1D) is a chronic, multifactorial disorder that results from interp lay of genetic and environmental factors. T1D accounts for 5 10% of reported cases of diabetes, representing approximately 2 million individuals in the United States. Autoimmune attack and functional inhibition of the insulin producing cells in the pancreas leads to the inability of cells to metabolize glucose, and thus results the hallmark clinical symptom of diabetes: abnormally high blood glucose levels. During the course of the disease, T lymphocytes become reactive to cell ant igens and islet cell antibodies produced by B cells are also detected. High titers of autoantibodies correlate with T1D, making them valuable prognostic markers for disease risk. Subsequent to the measurement of autoantibodies against cell antigens, a decline in first phase insulin release (FPIR) can be measured in those at risk for developing T1D, allowing further susceptibility to be determined [1] However, the development o f the destructive pathological lesion, known as insulitis, and the steps leading to T1D in hu mans are not well understood. Identification and study of i mmune cell infiltration in T1D patients has been problematic [2] As a result, the majority of our knowledge of the pathology of T1D stems from animal models that develop insulin requiring diabetes ei ther spontaneous autoimmune or experimentally induced, as well as from in vitro studies using primary islets and cell lines, from human and murine sources. In vitro experiments are particularly advantageous when assessing the specific contributions of i ndividual effector molecules and molecular pathways to cell destruction. A breakdown of self tolerance renders cells susceptible to an arsenal of immune cells and their killing

PAGE 17

17 mechanisms; each must then be analyzed independently in order to formula te targeted treatment options. Cellular Effectors in T1D Development Immunohistological examination of pancreatic tissues from patients with T1D has demonstrated that, in contrast to the animal models of spontaneous T1D, insulitis is a rare event in humans [2] ; when present, the following cell types have been identified in the islets: lymphocytes that con sisted mostly of CD8 + T cells but include B cells as well as CD4 + T cells, macrophages, and dendritic cells (DCs) [3 6] Unfortunately, human samples with established T1D do not delineate the successive events that culminate in autoreactive lymphocyte activation and cell killing, and only recently has informati on emerged on the nature of insulitis in T1D free autoantibody positive organ donors [2,6 ,7] To understand T1D development, the key mechanisms in destructive insulitis have been studied in great depth using non obese diabetic (NOD) mice and BioBreeding diabetes prone (BB DP) rats. NOD mice spontaneously develop autoimmune T1D Female NOD mice develop spontaneous T1D at a high rate (~90%). A similar rate is observed in both sexes of BB DP rats [8] Macrophages, DCs, B cells, and T cells of different subtypes are found in NOD islets during the early stages of insulitis. Not surprisingly, splenocytes from diabetic and prediabetic NOD mice transfer T1D to immuno deficient NOD (NOD Scid ) mice [9] Similarly, athymic nude NOD.Cg Foxn1 nu (NOD Nude ) mi ce do not develop T1D [10] thereby providing evidence that T cells are required for T1D onset in this mouse model. Adoptive transfer of T1D by injection of splenic cell subsets into immunodeficient NOD.CB17 Prkdc scid (NOD Scid ) mice

PAGE 18

18 substantiated that CD8 + T cells in the absence of CD4 + T cells cannot cause disease, and that CD4 + T cells are able to transfer T1D withou t CD8 + T cells only when isolated from donors with active disease [11] As expected, T cell depletion using a regimen of anti CD3 or Anti thymocyte globulin prevents T1D and results in remission of recent onset T1D in NOD mice [12,13] These studies have established T1D as a T cell mediated disorder in animal models. Nevertheless, other cell types are also involved in the initiation and maintenance of destructive insulitis. Macrophages contribute to T1D by secre ting proinflammatory cytokines and chemokines that help recruit and activate lymphocytes, and DCs participate in antigen specific autoreactive cell activation [14 16] B cells, in addition to their antibody secreting actions, are important antigen presenting cells (APCs). Mouse and human studies have demonstrated a role of B cells as AP Cs in T1D [17,18] In contrast, the presence of autoantibodies, while useful markers for T1D risk [19] as they indicate autoreactive T cell activation, do not appear to be directly pathogenic to cells [20,21] Molecular Mechanisms of Cell Death Fas/FasL and perforin/granzyme pathways in T1D : Activated CD8 + cytotoxic T lymphocytes (CTLs) are armed with several molecular mechanisms to lyse and kill target cells; current theory portends that the two major pathways are 1) Fas L on lymphocytes interacting with Fas on target cells, and 2) cytoplasmic granule release of perforin and granzyme molecules. Individual cel l types differ in the mechanism of cell death induced by the interaction of FasL on the CTL with Fas on the target cell [22] Type I cells activate a cascade of proteases, known as caspases, that cleave apoptotic s ubstrates independent of the mitochondria. Conversely in type II cells an amplification

PAGE 19

19 of the caspase cascade requires cleavage of the BH3 protein Bid and death occurs intrinsically. Cleaved Bid translocates to the mitochondria, leading to cytochrome c release which results in the formation of the apoptosome and downstream activation of effector caspases [23] Bid deficient C57BL/6 mouse islets are resistant to Fas induced apoptosis in vitro [24] T herefore, based on the above criteria, cells were classified as type II cells. However, th e signaling decision has now been shown to be dependent on the level of Fas receptor expressed on the cell surface [25] cells upregulate Fas expression on the cell surface after cytokine treatment [26 29] ; as a result, both type I and II signaling may occur within cells in vivo I posit that the local inflammatory conditions determine the death signals by impacting both the autoreactive CTLs as well as the cells U pon anti gen recognition CTLs release perforin and granzyme directed at the target cell. Perforin is required for the proapoptotic actions of granzyme, a serine protease that activates effector caspases and promotes the intrinsic pathway of apoptosis. Dispersed mouse and human islets die by caspase dependent apoptosis when perforin and granzyme are added together, but by osmotic lysis (necrosis) when perforin is added alone at high concentrations [30] The Fas/FasL and perforin pathways have been implicated in human T1D. Pancreata from T1D patients stain positive for Fas expression on cells and FasL on infiltrating cells [31] Further evi dence exists for a role of the Fas/FasL pathway in the pathogenesis of T1D based on in vivo studies using the NOD mouse model of the disease. Specific cell disruption of Fas signaling via the expression of a dominant negative point mutation in a death d omain of the Fas receptor (Fas cg ) [32] or a

PAGE 20

20 dominant negative form of Fas Associated Death Domain (FADD) [33] both resulted in delayed T1D progression and decreased incidence at 210 an d 250 days, respectively. N eutralizing the actions of FasL prevented the reoccurrence of autoimmunity that is normally seen after syngeneic islet transplantation into di abetic NOD mice [34] The importance of perforin for T1D progression has been analyzed in NOD mice as well. Despite the observation that perforin deficient NOD.Pzf / mice develop insulitis to a similar extent as littermate controls, T1D incidence is significantly reduced and disease onset is delayed [35] Nonetheless, the exact contribution of each pathway has been shown to differ depending on the disease model used and whether cell killing is tested in vivo or using pr imary islets and cell lines in vitro In vitro CTL Mediated Killing of Pancreatic Islets Little is known about the mechanisms involved in the killing of human islets by autoreactive CTLs. Preproinsulin specific CTLs required cell to cell contact to selectively lyse cells in dispersed human islet preparations; however, the mechanism of killing was not investigated further [36] Thus far, mechanistic studies involving CTL killing of human islets have been accomplished using viral specific CTL clones and human islets pulsed with the appropriate viral peptide [37] Peptide specific, human leukocyte antigen ( HLA ) restricted killing of huma n islets was found to be perforin dependent, with Fas mediated killing only observed after pretreatment with proinflammatory cytokines. Interestingly, pan caspase inhibition failed to protect human islets from CTL mediated killing, indicating that perfori n mediated killing of islets by CTLs occurs through non apoptotic mechanisms when apoptosis is blocked [37] Indeed, although Fas/FasL as well as perforin and granzyme B induced apoptosis in

PAGE 21

21 cells was found to be dependent on the proapoptotic BH3 only protein Bid [24,30] Bid deficient NOD mice develop insulitis and progress to T1D at a similar rate as wild type NOD mice [38] CTL effector mechanisms important for cell destruction have been widely studied in vitro with the use of diabetes prone NOD mice that are transgenic for T cell receptors (TCR) of diabetes causing T cell clones. This technique has allowed researchers to overcome the difficulty of isolating autoreactive T cells from wild type NOD mice due to t heir low precursor frequency. Specifically, CD8 + CTLs derived from NOD.Cg Tg (TcraTcrbNY8.3) [NOD NY8.3] mice that recognize an epitope of glucose 6 phosphatase catalytic subunit related protein [ G6PC2 or IGRP], a T1D cell autoantigen, have been widely used for such studies [39 41] Initially, NOD NY8.3 T cells were found to kill islets exclusively via Fas [42] but further studies demonstrated that NOD NY8.3 T cells effectively destroy islets from Fas deficient NOD mice [NOD.MRL Fas lpr (NOD Fas lpr )]. However, autoreactive T cells from NOD8.3 mice lacking perforin (NOD NY8.3 Prf1 / ) were unable to lyse NOD Fas lpr islets [43] Similar results were observed when a non cell target cell line was pulsed with IGRP peptide [43] suggesting that both the perforin/granzyme p athway and the Fas/FasL pathway can be utilized by NOD8.3 CTLs to exert their diabetogenic potential When these data are considered along with the studies with the viral antigen described above, one could propose that the antigen recognized may dictate t he mechanism of killing and not the target cell itself. The importance of the Fas and p erforin pathways has also been investigated in vitro with islets expressing ovalbumin (OVA) under the control of the insulin promoter

PAGE 22

22 (RIP mOVA) as targets and OVA specific OT I CTLs as effector cells [44] Again, CTL mediated cell death was predominantly perforin dependent and, in the absence of perforin, the OVA specific CTLs failed to lyse Fas deficient islets. Taken together, these results demonstrate that in vitro systems, despite providing support for the involvement of specific pathways in CTL mediated cell killing, do not necessarily account for the redundancy in CTL effector mechanisms existing in vivo Cell L ines for in vitro CTL S tudies Primary islets are composed of a mixture of hormone producing cells; however, only cells are selectively destroyed in T1D. Thus, cell lines represent valuable tools in understanding and preventing autoimmune cell destruction. Rodent cell lines have proven most us eful in immunological studies due to the inherent phenotypic instability that limits their use in functional studies [45] With the use of murine cell lin es, our group found that the previously described NOD derived cell line, NIT 1 [46] is susceptible to the diabetogenic AI4 CD8 + T cell clone, while a similarly derived cell line, NIT 4, only differing in the allotype of mt Nd2 a which is associated with decreased basal mitochondrial ROS production [47,48] is resistant to killing [49] Because IFN priming of NIT 4 cells rendered them susceptible to AI4 CTL killing [49] and IFN treatment has been shown to upregulate major histocompatibility complex ( MHC ) Class I and surface Fas expression [50] it is possible that AI4 CTL killing is Fas dependent, but we have ye t to test the exact mechanism. GAD65 546 554 specific CTLs have also been used to lyse NIT 1 cells [51] ; however, due to the lack of GAD65 expression by the cell line, NIT 1 cells required transfection with GAD65 prior to killing. The authors concluded that killing was perforin dependent

PAGE 23

23 as the GAD65 546 554 reactive CTLs expressed perforin but not FasL, and the transfected NIT 1 cells had undetectable levels of Fas. The apparent dominance of perforin over the Fas/FasL pathway in the killing of cell lines in vitro remains to be confirmed with inhibition studies. Additionally, the type of cell death triggered by Fas ligation and cytotoxic granules, whether apoptosis or necrosis, demands attention. Significantly less work has occurred with human cell lines Similar to what is expected with rodent cell lines, t he ideal in vitro cell model should remain stable with passages and maintain insulin secretion in response to glucose stimulation, as well as preserve the expression of other cell specific marke rs and autoantigens [52] Given the differences between primary rodent and human ce lls, several human cell lines have been established. These cell lines are HP62 [53] CM [54] NES2Y [55] Lox5 [56] NAKT 15 [57] and EndoC H1 [58] ( Table 1 1) As discussed below, most of the human cell lines available do not serve as models of normal cell function but have proven useful for specific in vitro assays (Table 1 2). The recently developed insulin secreting EndoC H1 cell line represe nts a promising tool for both immunological and functional studies, as these cells maintained glucose stimulated insulin secretion (GSIS) after 75 passages [58] EndoC H1 cells were generated from human fetal pancreas cells that were transduced to express the SV40 T antigen under the control of the rat insulin promoter; as a result, only insulin producing cells become immortalized. The reversibly immortalized NAKT 15 cell line [57] was initially reported to be a functional human cell line that displayed molecular characteristics of pancreatic cells, maintained insulin secretion, and reversed

PAGE 24

24 chemically induced diabetes in mice. Unfortunately, since the initial report, no further studies have been published. Created two decades ago, the HP62 cell line was obtained from the transfection of human islet cells with a plasmid vector encoding SV40 viral DNA [53] Early passages of these cells secreted glucagon and somatostatin (passage 3); insulin was later detected, but secretion or synthesis alone, was short l ived (passages 6 and 7 respectively). Interferon gamma ( IFN ) pri ming of HP62 led to an increase in the expression of HLA Class II molecules [53] suggesting a possible application of this cell line in immunological studies. Consequently, the HP62 cell line has since been used to study the cytotoxic ity and modulatory effects of cytokines on the expression of adhesion molecules that facilitate T effector target cell contact [59,60] Due to its endocrine lineage, HP62 cells have also been useful in confirming the expression and functionality of endotoxin receptors measured in isolated human islets [61] Previously, sera from T1D patients containing islet cell antibodies (ICA) failed to react with th is cell line [62] casting doubt on its antigenicity and cell likeness. Still, along with the human insulinoma cell line, CM [54] HP62 cell s have continued to be tested as cells in cytotoxicity assays, with responses similar to those of primary islet cells [63 65] The CM cell line was generated from a patient with a malignant pancreatic insulinoma [54] Although CM cells lose insulin secretion with long term passage, the cell line retains many cell specific characteristics [66,67] CM cells grown in medium containing high glucose stimulated proliferative response s of T cells isolated from T1D patients to a greater extent when compared to control subjects; the same pattern was not observed in low glucose conditions [68] but the findings further suggested their

PAGE 25

25 usefulness in cell mediated lymphocytotoxicity ( CML ) assays. Indeed, glutamic acid decarboxylase ( GAD ) specific CD8 + T cell clones expanded from T1D patients lysed CM and HP62 in 51 Cr release assays [65] The mechanism of CTL killing was not elucidated; however, transfection of the cell lines with B7 H4, a n inhibitory co signal molecule expressed on the cell surface, decreased the percent specific lysis measured, indicating the GAD reactive T cells killed the cells by a mechanism requiring direct cell contact. The CM insulinoma cell line has been valuable as a cel l model in a wide range of in vitro assays [63 65,68 76] but not without criticism [77,78] In addition to poor GSIS, several chromosomal abnormalities were noted in CM cells. While genetic defects in the CM cell line are not surprising due to their tumorigenic source [79] these cells are likely most beneficial when analyzing killing mechanisms utilized by autoreactive immune effectors to destroy human cells, rather than in functional assays. Another pancreatic cell line, NES2Y, was d erived from the islets of a patient with persistent hyperinsulinemic hypog lycemia of infancy (PHHI). S imilar to the cells of PHHI patients, NES2Y cells constitutively secrete insulin due to loss of function mutations resulting in defective ATP sensitive potassium (K ATP ) channel activity [55] NES2Y cells also lack expression of the homeodomain transcription factor, PDX 1 [55] These cells have been useful in determining the contribution of normal calcium signaling and PDX 1 expression/function within the cells [80 83] Transfection studies with genes encoding the K ATP channel subunits [sulfonylurea receptor (SUR) 1 and Kir6.2] and PDX 1 not only rescued GSIS and glucose regulated insulin promoter activity [84] but also highlighted the requirement of both SUR1 and Kir6.2 for K ATP channel function

PAGE 26

26 [82] as well as the role of PDX 1 in the control of insulin gene transcription upon glucose stimulation [80] The functional outcomes of mutatio ns in the PDX 1 gene, associated with maturity onset diabetes of the young (MODY), have also been studied in NES2Y cells transfected to express normal or mutant forms of th is gene [85,86] Despite the aforementioned dysfunctions, NES2Y cells have been utilized as human cells in cell death assays. Mechanisms of fatty acid induced toxicity, unrelated to T1D but linked to cel l death in type 2 diabetes were previously teste d in these cells [87,88] In the context of T1D, NES2Y membranes successfully induced proliferation of autoreactive T cells isolated from new onset T1D pat ients that were selected for granule membrane reactivity [89] and NES2Y cells, like CM cells, have been used to study regulatory components that protect against ap optotic stimuli, namely tumor necrosis factor related apoptosis inducing ligand ( TRAIL ) [75,76] Efforts are still underway to create a physiologically relevant cell line from NES2Y cells [90] ; nonetheless, the continued expression of cell antigens [89] by this cell line makes it an attractive potenti al target of autoreactive CTLs. Transformation with oncogenes and enhanced telomerase activity (SV40 T antigen, Ras val12 and hTRT) of adult pancreatic islets enriched for cells led to the development of the Lox5 cell line [56] Lox5 cells are not responsive to h igh glucose challenge with increasing passage number; however, the cell line can be manipulated to regain cell function [91,92] Interestingly, independent of secretory function, late passage cells express HLA Class I molecules on their cell surface that can be fu rther induced by IFN and maintain the expression of autoantigens recognized by T cells in human T1D, such as insulin (low), IA 2, IGRP, GAD65, GAD67, and ZnT8 ( Chapter 4 ).

PAGE 27

27 Similarly, Fas receptors were measured on the cell surface of the Lox5 cell line adding to its worth as a CTL target. To mimic Fas mediated CTL killing of human cells, Lox5 cells were incubated with IFN (to increase surface Fas) and CH 11, a human anti Fas antibody, and it was found that these cells died by caspase dependent apo ptosis after Fas stimulation [29] As will be shown later (Chapter 4) Lox5 are also lysed by IGRP reactive CD8 + T cells. Therefore, direct CTL killing mechanisms can be tested with the Lox5 cell line Soluble Mediators in T1D Reactive Oxygen Species and Proinflammatory Cytokines Prior to the advent of animal models that develop spontaneous autoimmune diabetes, investigators seeking to destroy cells and induce insulin requiring di abetes would do so using alloxan or streptozotocin (STZ). Both alloxan and STZ are free radical generators that are selectively toxic to cells due to their structural resemblance to glucose. These compounds gain entry into murine cells via Glucose tr ansporter 2 (GLUT2) (Fig. 1 1: #1) [93] Once inside the cell, oxidative reactions occur with thio containi ng enzymes such as glucokinase ( F ig. 1 1: #1 and #2) and aconitase resulting in impaired glucose sensing, mitochondrial dysfun ction, and necrotic cell death (Fig. 1 1: #3) [94 97] The findings that alloxan induced cytotoxicity could be prevented by antioxidants [98 100] and that cell death consequent to ST Z exposure could be partially prevented with superoxide dismutase [101] were instrumental in our understanding of cell susceptibility to both oxidative and immune mediated stress. This led to the observation that in comparison to other tissues, cells had reduced or absent activity of anti oxidants [102 107] The explanation for the low levels of

PAGE 28

28 antioxidants in cell s remains unclear, as upregulation of antioxidants in these cells does not have a significant impact on glucose stimulated insulin secretion [105,108 110] However, the reduction of defenses against oxidative stre ss results in cells being exquisitely sensitive to ROS damage caused by toxins or inflammation. There is a preponderance of evidence indicating that cell dysfunction can result from inflammation induced oxidative stress. Free radical mediated cell d ysfunction and death can be due to either murder (exogenous) or suicide (endogenous). The source of exogenous reactive oxygen species ( ROS ) or reactive nitrogen species (RNS) production is likely activated macrophages, which are present in high numbers in the preclinical insulitic infiltrates [111,112] The oxidative burst of activated macrophages can destroy co cultured islet cells [113,114] through the release of highly reactive oxygen species [e.g.; superoxide (SO 2 ), hydroxyl radical ( OH), nitric oxide (NO)] The initial c ytotoxic effects of NO are thought to be mediated via the destruction of intracellular iron con electron transport chain, resulting in the reduction of energy metabolism [115 118] The impact of NO in decreasing ATP production blunts insulin se cretion and induces necrosis (Fig. 1 1: #4) [119,120] Potent tissue damaging oxygen radicals can be derived from free cytosolic Fe 2+ by the Fenton reaction as well as through arachidonic acid metabolism, which destroy organelle membranes and membrane associated enzymes via lipid peroxidation [121] Additional cytotoxic free radicals in the prediabetic state are l ikely generated within the cells themselves in response to cytotoxic mixtures of monokines and lymphokines [122 124] Post mortem pancreatic tissue samples from patients with T1D demonstrate

PAGE 29

29 increased interferon alpha (IFN ) expression, and interferon gamma (IFN ) secreting lymphocytes have been identifi ed in the islets [125] Tumor Necrosis Factor alpha ( TNF ) and Interleukin 1 beta ( IL 1 ) producing macrophages and DCs have been detected in patients with recent onset T1D [126] In the NOD mouse and the BB DP rat, the expression of monokines such as IL 1 IFN TNF and type 1 cytokines including IFN TNF IL 2, and IL 12 have been reported to associate with destructive insulitis [127] Islet infiltrating CD4 + and CD8 + T cells are source s of cytokines, particularly the potent macrophage activator IFN IFN pot ent i ates the effects of IL 1 and TNF which impair the function of rodent and human cells individually, and are highly cytotoxic when combined [122,128,129] This toxicity mediated by the combined action of monokines and IFN has been attributed to the induction of NO synthase (iNOS) and the subsequent pr oduction of NO [130,131] Cytokines synergize to activate NF kB, the major transcription factor for iNOS expression (Fig. 1 1: #5) [107] Use of transgenic mouse models has shown that cell overexpression of iNOS and the ensuing elevation of islet NO, kills cells independent of insulitis [132] (Fig. 1 1: #4). Recent work suggests that the superoxide producing phagocyte NADPH Oxidase (NOX) is expressed in cells [133 135] NOX can be a ctivated in response to proinflammatory cytokines resulting in ROS production and cell damage and death [133] Cytokines can also generate potent cytotoxic aldehyde moieties (malondialdehyde, butanal, pentanal, 4 hydroxynonenal, and hexanal) capable of lipid peroxidation [136] perhaps through the activation of NOX or excessive mitochondrial ROS production [137]

PAGE 30

30 In vitro Cytokine I nduced Cell Killing As mentioned above, of the cytokin es identified in vivo in vitro cytokine killing experiments have focused on the individual and combined actions of IFN IL 1 and TNF Of note, when cultured with whole islets, cytokines are not specifically cytostatic or cytotoxic towards cells [125,127] Although this might dispute the cytotoxic role of cytokines in vivo it is possible that in vivo cell specific autoreactive cells at very close proximity to their intended target, the cells, could produce significant damage by secreting cytokines In vitro cytokine media ted destruction of mouse islets occurs through NO dependent necrosis with some contribution from apoptosis (Fig. 1 1: #5, 6) [138] When compared to untreated whole mouse islets, a six da y incubation period with IFN IL 1 and TNF led to about a 13% survival rate in wild type mouse islets, versus a 98% survival of iNOS knockout (iNOS / ) islets. Only after nine days in culture did cytokines reduce iNOS / islet viability to about 82%; survival in the wild type islets at day nine was 8% of untreated cells. When iNOS / cells were purified and treated with cytokines, very little, if any, necrosis was measured, suggesting that apoptosis accounted for the s mall reduction in viability noted in the mouse islets after the nine days in cytokine containing media [138] In comparison, IL 1 alone can kill rat islets via NO dependent necrosis [139] The inhibitory effect of cytokines on human islets was also shown to correlate with NO production [140,141] However, preventing iNOS function was insufficient to prevent human cell death [141] This is likely a result of higher expression of the stress protein heat shock protein 70 (HSP70) i n human islets

PAGE 31

31 compared to rodent islets [142] as heat shock alone can prevent cytokine induced rat islet inhibition and NO toxicity [143,144] Collectively, cytokine killing assays with isolated islets suggest that cells die by necrosis as well as apoptosis. To understand the cytotoxicity of cytokines specifically on cells, the described studies have also been performed with cell lines. We have used a human cell line to study the cell death pathways activated after cytokine (TNF and IFN ) incubation. In addition to NO independent necrotic cell death, caspase de pendent and caspase independent apoptosis was detected. All forms of cell death appeared to be depen dent on functional mitochondria as mitochondrial DNA (mtDNA) deficient cells were resistant to cytokine killing [29] The human islet cell line HP62, as well as the human insulinoma cell CM, were treated with the cytokines TNF or IFN but not in combination. Only TNF was cytotoxic to HP62 (~15% cell death) but not to CM, and the mechani sm of killing remains un resolved [64] Other groups have reported that treatment of murine cell lines with cytokines can trigger different apoptotic pathways. For instance, two studies proved that the cell lines INS 1 and NIT 1 ( rat and mouse derived respectively) died by caspase dependent apoptosis [145,146] As well, another mouse cell line, MIN6, activates caspases in response to cytokine incubation [147] In addition, NO produced in MIN6 cells with cytokine treatment e licited the unfolded protein response [148] implic ating endoplasmic reticulum (ER) stress mediated apoptosis in cytokine induced cell death. Alternatively, when investigated using cytokine treated INS 1 cells, induction of ER stress was not observed [149]

PAGE 32

32 Interestingly, in a recent report, several strategies were employed to analyze cytokine induced cell death of two INS 1 derived cell lines [150] The authors compared t he type of cell death induced by cytokines to the apoptotic cell death known to be prompted by camptothecin and found that cytokine induced cell destruction is not an apoptotic process. Therefore, in vitro cytokines are capable of activating a multitud e of cell death pathways that, although not the same in all the models used, ultimately lead to the common outcome of cell demise. The common denominator in all in vitro models outlined, however, is necrotic cell death. Thus necrosis, a potent promoter of inflammation, might be the most relevant cell death pathway triggered by cytokines in the context of T1D. Immunomodulatory Effects of Cyt okines In addition to being cytotoxic [151] cytokines are able to control the type of immune response mounted [152] and prime cells for heightened immu ne surveillance and clearance. To date there are a considerable number of reports that have sought to identify the impac t of a single cytokine in T1D. Overexpression of IFN in cells using a transgenic approach with the rat insulin promoter ( RIP IFN ) in the non autoimmune diabetes prone C57BL6 mouse strain, resulted in cell dysfunction, death, and onset of diabetes [153] While non autoimmun e prone RIP IFN transgenic mice exhibit cell dysfunction but do not develop spontaneous T1D [154] in the NOD background, cell specific overexpression of IFN precipitates T1D [155] Similarly, i n NOD mice, disruption of the gene encoding IFN does not prevent T1D development [156] but cell specific transgenic ex pression of IFN under the control of the rat insulin promoter ( RIP IFN ) stimulates insulitis and

PAGE 33

33 T1D only in immune competent animals [157] This supports a role for interferons in promoting cell recognition and killing by cellular effectors in vivo with IFN being seemingly more potent in eliciting an immune response in the absence of a predisposing immune system Indeed, viral induced IFN production represents a potential envir onmental factor linked with T1D [158] On the other hand, d isruption of IL 1 signaling protects in vitro against IFN and TNF induced mouse islet cell death, but does not alter spontaneous T1D incidence [159,160] TNF also implicated in T1D pathogenesis, has been shown to promot e different disease outcomes depending on the timing of expression [161] This effect may now be explained by recent data indicating that TNF boost s regulatory T cells (Tregs) in vivo [162] Mitochondria and the Mechanisms of Cell Death M itochondria are required for proper cell function Functionally and structurally sound mitochondria are essential for GSIS [163,164] However, these organelles are also important as regulators of cell death. Apoptotic stimuli lead to proapoptotic Bcl family member activation, mitochondrial membrane permeabilization and the release of proapoptotic pr oteins like cytochrome c, apoptosis inducing factor (AIF), as well as endonuclease G (Endo G). Proapoptotic Bcl family members include Bax, Bak, Bid, Bim, Bad, and PUMA. Anti apoptotic members such as Bcl 2, and Bcl XL hold these proteins in check. Cons istent with this, human islets overexpressing Bcl 2 show increased resistance to the combined actions of IFN IL 1 and TNF as measured by decreased DNA fragmentation, cell death, and cell dysfunction after a 5 day incubation period [165] Similarly, knockdown of the proapoptotic member Bim with

PAGE 34

34 small interfering RNA ( siRNA ) technology dec reased IFN and TNF induced cell death of dispersed human islet cells and INS 1E cells [166] Cytokine induced INS 1E cell death was reduced by 10% with Bim knockdown. Bim knockdown also rescued viability of p rimary rat cells and dispersed human islets incubated with IFN and TNF by 10% & 7%, respectively. Treatment of INS 1E cells with the combination of IFN and IL 1 for 24 h led to cell death that was prevented by knocking down the proapoptotic Bcl member PUMA (20% to 15% death) but not Bim [167] Together, these studies support an important role for the mitochondria in cell death through the differential activation of pro and anti apoptotic Bcl family members by distinct stimuli. The experiments and results described clearly demonstrate that variations in key treatment conditions, such as incubation period or cytokine concentration, occur and may account for some of the discrepancies mentioned previously. Cell are sure to exist connecting the different effectors, as well as the modes of death. Therefore, the time point where death is investigated is likely as important as the mechanism of induction. Also known as prog rammed cell death, apoptosis is an energy requiring process. Consequently, mitochondria, being the powerhouses of the cell, can control the form of cell death through their supply of energy. Endogenous inhibitors of mitochondrial respiration and producti on of ATP via oxidative phosphorylation, such as NO, lead to modest decreases in cellular ATP concentrations that may result in a switch from apoptosis to necrosis in metabolically suppressed cells (i.e. cells in pre T1D) that have already been signaled for apoptotic cell death. Mitochondria are also major sources of cellular ROS, and mitochondrial respiratory chain inhibition induces ROS

PAGE 35

35 production from complexes I and III. Cellular ROS, regardless of where they are produced, can lead to caspase depend ent apoptosis in cells [137] However, although not tested in cells, high leve ls of hydrogen peroxide (H 2 O 2 ) have been shown to inhibit caspases [168,169] and promote necrosis. Therefore, excessive or continued mitochondrial ROS production represents another mechanism by which mitochondria may determine the fate of the cell and the choice of death mechanism Genetics of Autoimmune T1D The contribution of i nheritance in the development of early onset diabetes was noted decades ago [170] However o ur current classification of T1D as a complex polygenic disease is a result of candidate gene testing and genome wide associatio n studies that have identified over 40 chromosomal regions linked with T1D susceptibility [171] The highest genetic risk for T1D is encoded within the HLA Class II region. C l ass II HLA (DP, DR and DQ) molecules present antigen to CD4 + T cells a process not only important for immune activation, but also tolerance induction. The specific amino acid residues in or impacting the structure of the binding pocket of these molecules determine the ir peptide binding function [172] For instance, non aspartic acid residues at 57 of DQB are associate d with susceptibility to T1D [173] with the protective 57Asp being linked to increased MHC Class II dimers [174] Class I HLA alleles, although to a lesser extent, also associate with T1D risk [175 177] Disease related variants might be involved in the presentation of self antigen to autoreactive T cells [178] but their exact role is not well understood. Candidate gene studies have identified several other non HLA loci that predispose to or protect against, T1D progression These include variants within the insulin gene

PAGE 36

36 ( INS ), sin gle nucleotide polymorphisms (SNPs) in the protein tyrosine phosphatase, non receptor type 22 ( PTPN22 ) gene variants in cytotoxic T lymphocyte associated protein 4 ( CTLA4 ) and interleukin 2 receptor alpha ( IL2RA ) [171] AMACO [179] ICAM1 [180] as well as the mitochondrially encoded gene mt ND2 [181] INS gene determine the risk or protective variants. Class I VNTR alleles (length of 26 63 repeats) are associated with susceptibility, whereas the class III VNTR alleles (140 210 repeats) are linked with protection Class III VNTR alleles allow for higher INS expression in the thymus compared to the class I VNTR alleles [182,183] Tissue specific protein expression in the thymus is required for central tolerance, therefore, lower insulin in the thymus leads to improper clearance of autorea ctive T cells during development. The PTPN22 CTLA4 and IL2RA genes are involved in T cell mediated responses. Interestingly, the T1D associated SNP in the PTPN22 gene results in gain of function inhibition of T cell signaling [184] that disturbs tolerance induction. The CTLA4 gene product is also a negative regulator of T cell activation but little is known about the role of the T1D associated polymorphism. IL2RA encodes the subunit of the IL 2 receptor through which IL 2 signaling occurs While IL 2 signaling is important for both effector and regulatory T cell functions, studies in the NOD mouse model of T1D indicate that disease alleles correlate with impaired regulatory T cell function [185] In addition, a n mtDNA encoded susceptibility SNP in mt ND2 and mt Nd2 has been identified both in human s and in animal models, respectively [181,186] The risk allele ( mt Nd2 c ) leads to higher mitochondrial ROS production in NOD [48] ; thus, the protection afforded by the resistant allele ( mt Nd2 a ) was found to be due to decreased

PAGE 37

37 mitochondrial ROS (mtROS) generation the level of the cell [47,49] Although the C to A nucleotide substitution that results in a leucine to methionine amino acid change likely has the same effect of reduced mt ROS production in humans, the mechanism remains to be tested. Here, the human cell line Lox5 was employed to investigate the contributions of mt ND2 a

PAGE 38

38 Table 1 1. Human cell l ines Cell Line Cell Origin Insulin GSIS Method Ref. HP62 Pancreatic Islets Early Early SV40 T antigen [53] CM Insulinoma Yes Early Malignant Insulinoma Subculture [54] NES2Y PHHI Islets Yes No Continual Islet Cell Subculture [55] NISK9 PHHI Islets Yes Yes NES2Y transfected with Kir6.2, SUR1, and PDX 1 [84] Lox5 Adult Cells Yes Early Floxed SV40 T antigen, Ras val12 and hTERT [56] NAKT 15 Pancreatic Islets Yes Yes Floxed SV40 T antigen, hTERT, and EGFP [57] EndoC H1 Fetal Pancreas Yes Yes RIP SV40 T antigen, and hTERT [58] PHHI, persistent hyperinsulinemic hypoglycemia of infancy; GSIS, glucose stimulated insulin secretion

PAGE 39

39 Table 1 2. Utility of human cell lines for in vitro cytotoxicity assays Cell Line T Cell Assays/ Direct Killing Killing Mechanism Cytokine Sensitivity Killing Mechanism Ref. HP62 CD56+ NKT cell target; TRAIL N/T IFN + TNF N/T [59,63 ,64] CM T1D T cell stimulation; CD56 + NKT cell target; TRAIL TRAIL death inhibited by Bcl 2 & XIAP TNF ROS [63,64 ,68,70 ,74 76] NES2Y Granule specific T cell stimulation; TRAIL TRAIL death inhibited by Bcl 2 & XIAP N/T N/T [75,76 ,89] NISK9 N/T N/T N/T N/T Lox5 Fas FasL Caspase dependent IFN + TNF Caspase dependent/ independent; ROS [29] NAKT 15 N/T N/T N/T N/T EndoC H1 N/T N/T N/T N/T TRAIL, Tumor Necrosis Factor Related Apoptosis Inducing Ligand; N/T, Not Tested; ROS, Reactive Oxygen Species; XIAP, X linked Inhibitor of Apoptosis Protein TRAIL, Tumor Necrosis Factor Related Apoptosis Inducing Ligand; N/T, Not Tested; ROS, Reactive Oxygen Species; XIAP, X linked Inhibitor of Apoptosis Protein

PAGE 40

40 Figure 1 1. Oxidative stress induced cell dysfunction and death. 1. Alloxan (A) is a cytotoxic ROS generating glucose analogue that preferentially accumulates in cells via the GLUT2 glucose transporter. Alloxan prevents glucose stimulated insulin secretion by inhibiting glucokinase activity, the enzyme responsible for the rate limiting step of glucose catabolism, as well as enzymes associated with mitochondrial ATP production. ROS are generated in a cyclic reaction between alloxan and its reduced product, dialuric acid (AH 2 ). Autoxidation of dialuric acid generates superoxide radicals (O 2 ), hydrogen peroxide (H 2 O 2 ), and, in the presence of a metal catalyst through the Fenton reaction, hydroxyl radicals (OH ). 2. Glutathione (GSH) is consumed within the cell for redox cycling, thereby producing oxidized glutathione (GSSG). However, because cells display low glutathione reductase activity, cells are unable to maintain redox balance and undergo necrotic cell death 3. cells also exhibit low levels of catalase and glutathione peroxidase, the main H 2 O 2 inactivating enzyme s, which contribut es to the high susceptibility of cells to ROS. 4. Exogenous Nitric Oxide (NO) production promotes cell dysfunction by preventing increases in ATP/ADP ratios through the inhibition of aconitase, a tricarboxylic acid (TCA) cycle enzyme and complex IV of the electron transport chain NO causes necrotic cell death. 5. The combination of IL1 and IFN leads to the induction of NFkB responsive stress genes such as inducible Nitric Oxide

PAGE 41

41 Synthase (iNOS) by the cell, further driving dy sfunction and necrosis by endogeneous NO production. 6. When added together, IL1 IFN and TNF result in increased mitochondrial ROS production, thereby activating caspases which cause changes in the mitochondrial membrane potential ( m) and mitochondrial membrane permeabilization (7) this allows the release of proapoptotic proteins such as cytochrome c (Cyt c) and amplification of the caspase cascade via the apoptosome (Cyt c, Apaf 1, and Caspase 9). Ultimately, effector caspases (Ca spase 3) activate Caspase Activated Deoxyribonuclease (CAD), a DN A degrading enzyme. DNA cleavage promotes apoptotic cell death. 6 Mitochondrial ROS production induced by the interaction of TNF with TNFR1 or FasL with Fas contributes to Caspase 8 activ ation, potentiating of the caspase cascade. 2012 Yama Luzardo Lightfoot

PAGE 42

42 CHAPTER 2 ROLE OF THE MITOCHON DRIA IN IMMUNE MEDIATED APOPTOTIC D EATH OF THE HUMAN PANCREATIC CELL LINE L ox 5 Introduction Insulin dependent, or type 1 diabetes m ellitus (T1D) results as a consequence of the specific autoimmune destruction of the pancreatic islet cells. While better understood in animal models, the exact progression to T1D in humans remains elusive, in part due to the limited human pancreatic sa mples available for research and the fact that the islets collected are obtained postmortem resulting in variable quality and functional capacity [187] Consequently, animals that develop diabetes spontaneously and resemble the human form of the disease, like the NOD mouse and the BB DP rat, as well as cell lines derived from murine sources, are heavily relied upon for a mechanistic understanding of the pathogenesis of the disorder [8] Studies performed using animal models of T1D as well as primary human donor islets have proposed several direct and indirect mechanisms of cell destruction. For instance, in the NOD mouse, insulitis begins with the activation of m acrophages and DCs within the pancreatic islets. These resident specialized antigen presenting cells locally produce chemokines and cytokines that recruit and activate autoreactive T and B lymphocytes [14] Additionally, soluble mediators, such as cytokines and free radicals, both RNS and ROS produced by the infiltrating immune cells a nd the cell themselves, can lead to cell death. In previous studies, IL 1 IFN TNF and type 1 cytokines (IFN TNF IL 2, and IL 12) were found to correlate with destructive insulitis in the T1D prone NOD mouse and the BB rat [127] Pancreatic samples from patients with T1D

PAGE 43

43 were also shown to contain the cytokines IFN and IFN TNF producing lymphocytes, as well as TNF and IL 1 expressing macrophages and DCs [125] In vitro studies on the cytotoxicity of cytokines to cells suggest that individual proinflammatory cytokines can either enhance or inhibit insulin secretion depending on dose and length of exposure. However, when added in combinations, IL 1 IFN and TNF induce death and dysfunction of both human and ro dent islets [188] The impact of cytokines on mouse and rat islets is mainly through NO medi ated necrosis with minor contributions of apoptosis [138,188 197] Studies reporting observations after exposing human islets to cytokines have been less clear, likely due to differences in experimental systems [198] as well as the health of the isolated human islets used [199,200] Taken together, it is rational to propose that when treated with cytokines, human islets die by both necrotic and apoptotic mechanisms. Furthermore, cytokines can either alone or in combination change the surface of islet cells, thereby enhancing the potential for immune surveillance by cytotoxic T cells (CTLs) Predictably, molecules elevated by cytokines, such as MHC class I and Fas, have been correlated with destructive insulitis in both m ice and human s [3] cell surface remodeling by cytokines, combined with th e fact that T1D is considered to be a T cell dependent disorder, imply that, in vivo cytokines are responsible for providing an inflammatory environment conducive for T cell recognition and destruction of the insulin producing cells. In this proinflammat ory milieu, recognition of autoantigens by CTL s leads to direct cell lysis. CTL specific killing mechanisms that are thought to be involved in cell destruction include the Fas/FasL pathway and perforin/granzyme release. In cytotoxic assays using a po pulation of NOD derived, autoreactive CD8 + T

PAGE 44

44 cells specific for an epitope of IGRP a known T1D autoantigen [39,41] NOD islets were killed only when at least one of these pathways was left intact [42,43] Most of these studies have been performed using both cells and CTLs derived from animal models. Yet, the appreciated genetic and immunopathologic differences between animal models of the disease and humans attest that diabetogenesis in humans could be distinctive and highlights the need for a human cell line that can be used for the study of death in the context of autoimmune mediated destruction In this report, the usefulness of a cell line derived from purified adult cells, Lox5 [56] was tested in assays of cell death; the mitochondrial contributions to human cell killing by immune effectors were in vestigated as well Lox5 cells were exposed to direct killing by an activating human Fas antibody, CH 11 in addition to indirect killing by the proinflammatory cytokines IFN and TNF The data presented show that similar to primary islets and cell lines derived from animals, Lox5 cells are killed after ligation of Fas by caspase dependent apoptosis, whereas these cells die by caspase dependent and independent apoptosis together with necrosis after incubation with TNF and IFN Importantly, Lox5 cells depleted of their mitochondrial DNA (mtDNA) were resistant to proinflammatory cytokine induced killing, implicating a role for mitochondria associated cell death mechanisms in th e progression to T1D in humans. Materials and Methods Cell Line and Reagents The Lox5 cell line was kindly provided by Dr. Fred Levine ( Sanford Children s Health Research Center, Sanford Burnham Medical Research Institute, La Jolla, CA) Lox5 cells were maintained in low glucose (1 mg/mL) DMEM (Cellgro, Manassas, VA),

PAGE 45

45 s upplemented with 10% FBS (HyClone, Fisher Scientific, Pittsburgh, PA), 1% MEM non essential amino acids (Cellgro), 1% penicillin streptomycin (Gemini Bio Products, West Sacramento, CA) solution, 0.02% BSA (Sigma, St. Louis, MO ) and 15 mM HEPES (Cellgro) (V C DMEM). Recombinant human IFN was obtained from BD Biosciences (San Jose, CA). Recombinant human TNF and recombinant IL 1 were purchased from R&D Systems (Minneapolis, MN). Fas agonistic antibody (Clone CH 11 ) was purchased from Millipore (Temecula, CA). A monoclonal antibody to HMGB1 was acquired from Abcam Inc. (Cambridge, MA). An antibody to hCD95 (Fas) PE Cy5 and the isotype control were purchased from BD Biosciences. Annexin V APC and propidium iodide (PI) were purchased f rom Invitrogen (Carl sbad, CA). Generation of Lox5 0 Cells and Cybrid Lox5 Cells Lox5 0 cells were cultured in high glucose (4.5 mg/mL) DMEM (Cellgro) supplemented with 10% FBS (HyClone, Fisher Scientific), 1 mM sodium pyruvate (Sigma), 50 mg/L Uridine (Sigma), and 1% penicillin streptomycin (Gemini Bio Products). mtDNA was depleted by culturing cells in the above medium supplemented with 100 ng/m L Ethidium Bromide (EtBr) for 6 months. Depletion of mtDNA was confirmed by: 1) PCR; 2) confocal microscop y imaging; 3) failure of Lox5 0 cells to survive in pyr uvate and uridine free medium. Cybrid Lox5 cells were generated as descri b ed before [201] Briefly, cybrid cells were made by fusi ng Lox5 0 cells with mtDNA donor platelets from a healthy individual under the presence of 50% (W/V) polyethylene glycol 1500 (Roche). Cells were cultured in the medium for Lox5 0 cells during the first 3 days after fusion and then in selective medium (uridine and pyruvate free DMEM supplemented with 10%

PAGE 46

46 dialyzed FBS, Penicillin and Streptomycin). After selection for 3 weeks, surviving cybrid cells were cultured in DMEM for Lox5, as described above, without pyruvate and uridine. Cybrid cells were cloned usin g cloning cylinders (Corning, Corning, NY) when visible co lonies appeared in the culture. Cell Death Assays Lox5, 0 and cybrid cells were seeded in twelve well Corning Costar culture plates (Fisher Scientific) at a density of 5x10 4 cells per well in a to tal of 500 L and allowed to adhere for 24 h. The cells were then incubated with rhTNF (2000 U/mL) and rhIFN (1000 U/mL) for 48 h. Lox5, 0 and cybrid cells were also cultured in the presence of Fas activating antibody CH 11 (0.5 g/mL) with and wit hout rhIFN (1000 U/mL). Cell viability was examined using the MTT assay, PI uptake, and externalization of phosphatidylserine ( PS) by Annexin V APC staining. Percent cell survival after cytokine or Fas antibody treatment was measured by determining the ability of the live cells to reduce yellow MTT, 3 (4,5 Di methyl thiazol 2 yl) 2,5 di phenyl tetrazolium bromide (Sigma), to insoluble purple formazan crystals. The cells were treated w ith MTT solution (0. 5 mg/mL) for 2 h at 37 C 5% CO 2 Excess solution was remov ed and the formazan crystals were then resuspended in acid isopropanol (0.04 N HCl in isopropanol). The optical density of the product was measured at a wavelength of 560 nm and background subtracted at 670 nm. Lox5 cells were analyzed on a BD LSR Fortes sa flow cytometer using the BD FACSDiva software ( BD Biosciences) and FlowJo analysis software (Tree Star, Inc., Ashland, OR). Cellular apoptosis was determined by double staining with PI and Annexin V APC (dead apoptotic) o r single positive Annexin V APC (live apoptotic)

PAGE 47

47 while necrotic cells were identifie d as PI single positive cells. kit (Trevigen Inc, Gaithersburg, MD) was used to evaluate DNA damage in treated and untreated Lox5 cells based on DNA tail shape and migration pattern. In addition, the ApoGlow Assay Kit (Lonza, Rockland, ME) was employed to distinguish between the different forms of cell death (apoptosis or necrosis), as well as to determine the effects of specif ic treatments on Lox5 proliferation. The Proteome Profiler Human Apoptosis Array Kit (R&D Systems) was utilized to measure the expression of proteins involved in apoptosis and DNA repair. Passive release of high mobility group box 1 (HMGB1) protein by ne crotic cells was determined Western Blot. Briefly, Lox5 cells were treated as described and 40 L of the supernatant of each well was removed without disturbing the attached cells. The supernatant was concentrated by ultracentrifugation (100,000 x g for 30 min at 4C), separated by SDS PAGE and then transferred to a nitrocellulose membrane (Bio Rad Laboratories, Hercules, CA). HMGB1 was detected by chemiluminescence (SuperSignal West Pico Chemiluminescent Substrate Kit, Thermo Scientific, Waltham, MA) Nitric Oxide Detection The amount of nitric oxide (NO) released by Lox5 cells after cytokine treatment was indirectly measured using the Griess Reaction as previously described [195] The optical density was read using a SpectraMax M5 plate reader (Mole cular Devices, Sunnyvale, CA).

PAGE 48

48 Oxidative Stress Analysis Glutahione (GSH) levels were detected and quantified with the GSH Glo Glutathione Assay (Promega, Madison, WI) after a 24 h incubation with rhTNF (2000 U/mL) and rhIFN (1000 U/mL). Caspase Activity and Inhibition Assays Caspase 8 and C aspase 3 activities were measured using a commercially av ailable caspase detection kit (Cell Technology, Inc, Palo Alto, CA) as per the Briefly, Caspase 8 (FAM LETD FMK) or C aspase 3 (FAM DEVD FMK) specific carboxyfluorescein (FAM) labeled peptide fluoromethyl ketone (FMK) caspase i nhibitors were incubated with 48 h cytokine treated, 24 h and 48 h Fas treated, or untreated control Lox5 cells for 1 h at 37 C Cells containing bound inhibitor were analyzed by flow cytometry on the FL1 channel. In some cases, the cells were treated with 50 M of the pan caspase inhibitor (Z VAD FMK), purchased from Calbiochem (San Diego, CA), for 1 h prior to treatment. Z VAD FMK was also added after 24 h of incubation to maintain caspases inactive. Pretreatment for 1 h with the specific inhibitor CA 074 (20 M & 5 M ) (Sigma) was used to inhibit the lysosomal protease Cathepsin B. Bax translocation into the mitochondria was inhibited with 100 M of the peptide V5 (Calbiochem). Flow Cytometry Cytokine treated and untreated Lox5 cells were analyzed for Fas surface expression by standard flow techniques. In brief, Lox5 cells were treated with increasing concentrations of rhIFN (250, 500, and 1000 U/mL) overnight stained for 1 h at 4 C and washed to remove excess unbound an tibody before analysis.

PAGE 49

49 Immunofluorescence Lox5 cells were incubated with cytokines as described. Cells were fixed with 2% paraformaldehyde (PFA) for 10 min utes at room temperature (RT), permeabilized with 100% ice cold methanol for 10 min utes then blocked with 10% Normal Goat Serum (NGS) for 40 min utes at RT with single PBS washes between each step and two washes before adding the antibody. Lox5 cells were conjugated with AIF antibody (R&D Systems) for 1 h at 37 C washed 3 times, then stained wit h FITC conjugated anti rabbit IgG (1:200) for 60 min utes in the dark. Before visualization, cells were washed and slides were covered using 4 ,6 diamidino 2 phenylindole (DAPI) containing mounting medium. A Zeiss Axioskop Microscope was used to visualize and image the cells. Images were analyzed using ImageJ/Fiji (National Institute of Health). Statistical A nalysis Unless stated otherwise, data are shown as mean SEM. Sig nificance was determined by a t test for two group comparisons ( GraphPad Prism 5 f or Mac OS X, La Jolla, CA ). Results Agonistic Activation of Fas Kills Lox5 Cells by Caspase Dependent Apoptosis Lox5 cells were incubated for 48 h with an Fas monoclonal antibody ( CH 11 ) alone or in combination with rhIFN The combination of CH 11 an d rhIFN induced death of Lox5 cells (Fig. 2 1A), while neither CH 11 nor rhIFN were alone effective. rhIFN was required for Fas induced cell death as it increased Fas expression on the cell surface, even at the lowest level of IFN tested (Fig. 2 1B). Because Lox5 cells treated with rhIFN had a reduction in absorbance with the MTT assay, the ApoGlow

PAGE 50

50 assay was performed to distinguish between inhibition o f proliferation and cell death. By measuring the amount of available ATP wit hin the cells, as well as the relative ADP:ATP ratio and comparing the results to untreated controls, t he ApoGlow assay can distinguish between healthy, metabolically active cells (no change or higher ATP levels and no in crease in ADP levels), apoptotic ce lls (lower ATP levels and incre ase in ADP:ATP ratio), necrotic cells (lower ATP levels and marked increase in ADP:ATP ratio), and cells that are not proliferating similar to untreated control (lower ATP levels with no change in ADP:ATP ratio). rhIFN tre atment of Lox5 cells lowered ATP levels with little or no c hange in the ADP: ATP ratios corresponding with arrested prolif eration (Fig. 2 2). To determine the mechanism of Fas induced killing of Lox5 cells, caspase activity was assayed. Caspases 8 and 3 were shown to be active after only 24 h of treatment (Fig. 2 3A). The p an caspase inhibitor Z VAD FMK (50 M) was added to cells 1 h prior to and again 24 h after initiation of rhIFN and CH 11 treatment. When compared to rhIFN control samples, caspase inhibition increased cell survival to control levels (Fig. 2 3B) and eliminated DNA damage (Fig. 2 3C). These data clearly implicate caspase induced apoptosis as the necessary pathway in Fas mediated killing of Lox5 cells. Proin flammatory Cytokine Induced Killing of Lox5 Cells Occurs Through Caspase Dependent and Independent Apoptosis and Necrosis Lox5 cells were also susceptible to proinflammatory cytokine mediated cell death. Treatment of these cells with the combination of rhTNF and rhIFN for 48 h caus ed significant killing (Fig. 2 4 ); however neither of these cytokines alone was sufficient to kill Lox5 cells. Similar to NOD derived NIT 1 cells, the addition of IL 1

PAGE 51

51 to the combination is dispensable [202,203] Consequently, NO was not detected in the supernatant when measured indirectly via the Greiss R eaction (Data Not Shown) In addition, both untreated and cytokine treated Lox5 cells were found to contain high levels of Heat Shock Proteins (HSPs), specif ically HSP70 and HSP27 (Fig. 2 5 ), which have been shown to protect cells against proinflammatory cytokine indu ction of iNOS and subsequent production of NO [72,190,191,196,204] Because rhIFN was shown to inhibit Lox5 proliferation the effect of rhTNF on the prol iferation of these cells w as tested using a tritiated thymidine ( 3 H TdR) incorporation assay. In contrast to rhIFN TNF did not affect proliferation, as rhTNF treated cells (5000 U/mL) incorporated the same amount of 3 H TdR after 48 h compared to untreated cells ( Fig. 2 6 ). Treatment of Lox5 cells with rhIFN and rhTNF resulted in the activation of Caspases 8 and 3 (Fig. 2 4 B). Confirmed pan caspase inhibition failed to co mpletely prevent death (Fig. 2 4C & D), suggesting that cytokines kill th ese cells by multiple pathways. Accordingly, flow cytometr y and Comet assay analyses of cytokine induced Lox5 killing indicated that these cells die by apoptosis and necrosis (Fig. 2 4A & C). Although caspase inhibition significantly improved Lox5 viabi lity when measured by the MTT assay, levels did not reach rhIFN control (Fig. 2 4 D) and DNA dam age was still observed (Fig. 2 4 C). Analyses of changes in the expression of proteins involved in apoptosis and DNA repair demonstrated that the p rotein levels of phosphorylated p53 (S15) increase d with pan caspase inhibition (Fig. 2 7 ), indicating an enhanced effort to repair DNA damage. Cytokine mediated c ell death in Lox5 cells was preceded by an increase in the

PAGE 52

52 proapoptotic protein SMAC/Diablo (Fig. 2 7 ). SMAC/Diablo contribute s to the caspase cascade by binding to inhibitors of apoptosis (IAPs), such as XIAP [205] As a result, P ro caspase 3 levels decrease, while cleav ed effector C aspase 3 levels increase (Fig. 2 7 ). Apoptotic and necrotic Lox5 cell death s after cytokine treatment and caspase inhibition were further analyzed by the ApoGlow assay and detection of passively released High Mobility Group 1 (HMGB1). The ApoGlow assay showed signatures of apoptosis, as mea sured by 1) reductions in ATP levels of cytokine treated groups with and without pan caspase inhibition compared to rhIFN con trols, and 2) a significant increase in the ADP:ATP ratio s that did not differ in rhTNF and rhIFN treated cells with and without caspase inhibition (Fig. 2 8 A). These results indicate that the improved viability measured by the MTT assay after pan caspase inhibition was not biologically significant and apoptosis was still taking place via caspase independent mechanisms In contra st, HMGB1 has been demonstrated to only be released during primary necrosis [139,206,207] Thus, cytokine induced n ecrosis was confirmed by the presence of HMGB1 only in the supernatant of cytokine treated Lox5 cells, compared to untreated and rhIFN control cells (Fig. 2 8 B). Expectedly, caspase inhibition did not prevent necrotic cell death, as observed by the persistent release of HMGB1 in Z VAD FMK treated cells (Fig. 2 8B). To examine the contribution of caspase independent, proapoptotic molecules, Apoptosis Inducing Fact or (AIF) localization was visualized by immunofluorescence AIF is normally found within intact mitochondria and translocates to the nucleus to effect apoptosis independent of the caspase cascade. Compared to rhIFN controls, more

PAGE 53

53 AIF was present in the nucleus of rhIFN and rhTNF treated cells (Fig. 2 9 ). This suggests that AIF is involved in proinflammatory cytokine mediated Lox5 cell death Inhibition studies to further understand the mechanisms of Lox5 cell death showed that these do not depend o n Bax translocation, or Cathepsin B activity ( Fig. 2 10 ). Therefore, cytokines trigger apoptotic cell death pathway s in Lox5 mediated through the activation of caspase dependent mechanisms as well as caspase independent mechanisms. In addition, cytokin es also lead to necrotic Lox5 cell death. Mitochondrial DNA Deficient Lox5 Cells are Resistant to Cytokine Killing but Sensitive to Fas To study the role of the mitochondria in cytokine induced killing of Lox5 cells, the cell lin e was depleted of mt DNA ( Lox5 0 ) using low levels of EtBr. PCR and confocal imaging of the cells confirmed successful depletion of the mtDNA (Fig. 2 11 ). Treated and untreated Lox5 cells amplified primers specific for the human Catalase gene (Fig. 2 11 A), but only untreated cells amplified mtDNA specific primers (Fig. 2 11 B). A mitochondrial marker, TMRM, was used to identify the mitochondria, and PicoG reen was used as a DNA dye to identify cytoplasmic and nuclear DNA. Co localization of the red TMRM and green PicoG reen in the untreated cells was indicative of the presence of DNA in the mitochondria (Fig. 2 11 C). However, EtBr treated cells did not co localize the fluorescent dyes (Fig. 2 11 D). Viability of Lox5 0 cells after cytokine treatment was measured by the MTT as say and confirmed by flow cytometry analysis of PI exclusion and negative Annexin V staining Although the MTT assay correlates viability and cell number with succinate dehydrogenase activity, a mitochondrial protein complex, this member of the electron

PAGE 54

54 t ransport chain is comprised of four nuclear encoded proteins. Thus, the assay functions normally in mtDNA deficient cells, as previously described [208,209] Lox5 0 cells were found to be resistant to cytokine mediated cell death but sensitive to Fas induced killing (Fig. 2 12 A), supporting activation of the extrinsic pathway by Fas versus the intrinsic pathway by proinflammatory cytokines. mtDNA sufficient Lox5 Cybrid cells were sensitive to Fas ligation and add back of mtDNA resulted in regained susceptibility to pro inflamm atory cytokines (Fig. 2 12 A). Pan caspase inhibition was able to prevent Fas induced cell death in 0 and cybrid cells (Fig. 2 12 A). Because the mitochondrial electron transport chain is the main source of ROS in cells, the redox state of the parental ce ll line, Lox5, after cytokine treatment w as analyzed Reductions in available GSH were observed after 24 h of cytokine treatment of Lox5 cells (Fig. 2 12 B) when no changes in cell survival have been noted. Discussion A human cell line that can be expa nded and maintained indefinitely would be a useful tool for advancing our understanding of the autoimmune pancreatic cell destruction that precedes T1D development in man. Such a model cell would also provide an in vitro system to test pharmacological i nhibitors or genetic manipulations intended to block killing by autoimmune effectors, as well as non invasively study the impact of immunosuppressive agents, hyperglycemia, or h yperlipidemia To date, there have been publications detailing the production of six human derived cell lines. These lines are NAKT 15 [57] CM and HP62 [63 68,73,75,76] NES Y2 [210] EndoC H1 [58] and Lox5 [56,92,211 214] ; however, only Lox5 is readily available to the scientific community. This study sought to determine the value of this already established,

PAGE 55

55 human pancreatic cell derived line, Lox5, in assays aimed at elucidating the role of mitochondria in human cell apoptosis induced by immune insults. The Fas/FasL pathway has been associated with the development of T1D in animal models and in humans [3,31,215 217] Although a utoreactive T cell clones from transgenic mice lysed Fas deficient islets, presumably due to perforin release, perforin deficient T cells had similar diabetogenic potential as the wild type clones when transferring disease to immunodeficient NOD mice [3,39] These findings suggest that redundant mechanisms eliminate cells during autoimmune attack. To mimic direct killing by diabetogenic effectors, the cell line was incubated with an activating Fas monoclonal antibody for 48 h. The 48 h treatment period was chosen to obtain a significant amount of cell death while still having the required cell numbers to perform functional assays, such as measuring caspase activity in the apoptotic and live cells. In addition, because Lox5 cells prol iferate well, longer incubation times in 12 well plates leads to death even in untreated cells. Similar to primary islets from human and mouse as well as rodent derived cell lines, Lox5 cells required IFN priming for sufficient surface Fas expression a nd subsequent ligation by the antibody (Fig. 2 1), supporting the role of proinflammatory cytokines in providing an environment favorable for cell killing [218] Moreover, Fas dependent apoptosis in Lox5 cells was found to be caspase mediated (Fig. 2 3). mtDNA deficient Lox5 0 cells, which are deficient in the electron transport cha in subunits of Complexes I, III, and IV that are encoded b y the mtDNA, were sensitive to Fas ligation due to the extrinsic activation of caspases (Fig. 2 12 A). This is in accordance with the extrinsic T ype I model of Fas mediated apoptosis that proceeds

PAGE 56

56 independent of the mitochondria [219] and with Fas mediated killing mechanisms previously identified in the NIT 1, NOD insulinoma cells, and primary NOD islets [118,220] These results indicate that Lox5 cells are susceptible to direct killing by immune effectors and die by a relevant pathway in T1D Proinflammatory cytokine exposure of primary rat or mouse pancreatic islets as well as the RIN and INS1 cell lines established from rat results in functional inhibition and death that is highly dependent upon the production of NO [194] with small contributions of apoptosis only after long term culture with cytokines [138] In mouse cell lines, killing due to IFN 1 treatment is less dependent on NO producti on and in some cell lines is NO independent [221,222] In human islets, timing of treatment as well as cytokine combination and dose are critical [193,198] To test if Lox5 cells are also vulnerable to proinflammatory cytokines, the cells were cultured with IFN TNF 1 in combination. T he combination of IFN and TNF led to the most significant level of Lox5 cell death by both apoptosis and necrosis (Fig. 2 4 ). Cytokines promoted both necrosis and caspase dependent and independent apoptosis of Lox5 cells that was independent NO, potentially due to the pr ese nce of HSP27 and HSP70 (Fig. 2 5 ), confirming that cytokines can activate a range of pro death mechanisms in cells [118,122,125,131,138,192,198,220,221,223 227] Beta cell mitochondria play a key role in insulin secretion [228] and may be important in cell death. Apoptosis inducing stimuli result in the mitochondrial membrane permea bility transition (PT) that leads to the release of c ytochrome c (Cyt c) and other proapoptotic molecules. PT and Cyt c release generally precede the

PAGE 57

57 disruption of mitochondrial inner membrane potential ( m ) and mitochondrial function [229] In addition, mitochondrial release of proapoptotic molecules potentiates the activation cascade of c aspases [230] Although caspases are involved in the killing of Lox5 cells by proi nflammatory cytokines (Figs. 2 4 & 2 8 ), other pathways are also impli cated, as the pan caspase inhibitor, Z VAD FMK, failed to completely prevent death in th ese cells (Figs. 2 4 C&D, & 2 8 A ). Necrosis was shown to contribute to Lox5 c ytokine induced death (Figs. 2 4 A & 2 8 B ) and could have accounted for the above results; however, DNA damage, which is indicative of apoptosis, was still observed with pan caspase inhi bited cells (Figs. 2 4 C & 2 7 ). Therefore, caspase independent mechanisms of apoptosis were investigated. Apoptosis Inducing Factor (AIF) is a caspase independ ent, proapoptotic molecule that acts through its release from the mitochondria and subsequent translocation to the nucleus, where it binds DNA and causes chromatin condensation [231,232] In order to determine if AIF is involved in cytokine killing of Lox5 cells, treated cells were visualized for AIF localization. The ratio of nuclear localized AIF to cytoplasmic AIF was sign ificantly increased in cytokine treated cells (Fig. 2 9 ). This difference persisted in Z VAD FMK pre treated Lox5 cells, supporting a role for AIF in IFN and TNF cytotoxicity. Other caspase independent proapoptotic pathways were studied for their role in cytokine mediated Lox5 cell death. Cathepsin B has been shown to contribute to TNF induced apoptosis in other cell types [233] ; however, Cathepsin B inhibition with CA 074 failed to rescue Lox5 survival after cytokine treatment. In fact, at the published concentration of 20 M [233] CA 074 exacerbated cytokine killing and caspase activation ( Data Not Shown). At the highest non toxic concentration of 5 M, CA 074

PAGE 58

58 did not increase survival (Fig. 2 10) Recently, Bax dependent mitochondrial permeabilization was identified as a proapoptotic signal in human islets after cytokine treatment [198] ; nonetheless, preventing Bax translocation into the mitochondria was insufficient to prevent death in Lox5 cells ( Fig. 2 10 ). mtDNA deficient Lox5 0 cells were not killed by IFN and TNF treatment but mtDNA sufficient Lox5 C ybrid cells were sensitive to cytokine i nduce d cell death (Fig. 2 12 A). This is consistent with a recent report that de monstrated intrinsic apoptosis was activated during cytokine treatment of human islets [198] Therefore, because functional mitochondria were found to be required for rhIFN and rhTNF ki lling and mitochondria are a major source of ROS, the cells were tested for signs of oxidative stress. GSH levels after cytokine treatment indicated oxidative stress in Lox5 (Fig. 2 12 B), demonstrating that cytokine treatment tilts the redox balance towa rds oxidation, likely du e to increased mt ROS production. The susceptibility of isolated human islets to killing in vitro by proinflammatory cytokines has been the focus of significant hypothesis testing, while study of the mechanisms of Fas killing of huma n islets has been less intense [234] Post mortem histological analysis of pancreas from patients with T1D have demonstrated that within the insulitis, CD8 + T cells express cell surface FasL suggesting a role for Fas in cell destruction during disease development [235] Information on how Fas kills islets has been derived from studies using mouse islets with no clear published mechanism using human islets. Mouse studies indicated Fas activated caspases. The enclosed studies are the first demonstra tion of a mechanism for Fas mediated apoptosis of human cells, and clearly indicate that Fas activates the extrinsic pathway for apoptosis in Lox5

PAGE 59

59 cells (Fig s. 2 3 & 2 12 ). It remains to be investigated whether this is a shared mechanism with primary human islets The ultimate effector molecule resulting from a cytokine attack on primary islets is NO [193] In contrast to primary human islets, Lox5 cells do not produce NO when exposed to the combination of IL 1 TNF and IFN In the absence of NO production, IL 1 TNF and IFN can activate a range of pro death pathways, including caspase dependent apoptosis and necrosis, in isolated primary human islets [198,234] Lox5 cells undergo both necrosis and caspase dependent apoptosis after treatment with TNF and IFN However, IL 1 yet, its addition is supe rfluous for killing of Lox5 cells. In summary, Lox5 is a partially dedifferentiated cell line that produces lower level s of insulin than primary islets and has blunted glucose stimulated insulin secretion. This cell line and its derivative line, Lox5 0 have been established as unlimited sources of human cells that are inappropriate to study mechanisms of cell function ; however they can be used for the study of autoimmune cell death as well as mitochondrial contributions to death. These c ells are primed by proinflammatory cytokines for Fas indu ced caspase dependent apoptosis and are susceptible to cytokine mediated apoptosis and necrosis through mitochondrial mechanisms that are both caspase dependent and independent. In conclusion, thes e cells will likely be beneficial when analyzing methods of killing employ ed by autoimmune effector cells

PAGE 60

60 Figure 2 1. Lox5 cells are susceptible to Fas monoclonal antibody after rhIFN priming. A) Lox5 cells were treated with rhIFN alone or the combination of Fas antibody clone CH 11 (0.5 g/mL) and rhIFN (1000 U/mL) for 48 h. Viability was measured by the MTT assay. ** den otes statistical significance, P < 0.005. B) Overnight priming of Lox5 cells with rhIFN increases the expression of surface Fas similarly with 250 U/mL ( blue line), 500 U/mL ( magenta line), or 1000 U/mL ( green line) of rhIFN compared to untreated control cells (black line). Figure 2 2. rhIFN alone causes arrested proliferation. Lox5 ce lls were treated with rhIFN (1000 U/mL) for 48 h. Cell death profile was analyzed by the ApoGlow assay. denotes statistical difference P < 0.05, and **P < 0.005

PAGE 61

61 Figure 2 3. Fas induced killing is caspase dependent. A) Lox5 cells were primed overnight with rhIFN (1000 Fas antibody clone CH 11 (0.5 g/mL) for an additional 24h before the activities of Caspases 8 and 3 were measured by FACS analysis. Increased Caspase 8 and 3 a ctivities were noted after only 24 h of Fas stimulation. A representative plot is shown. ( B & C) Lox5 cells were treated with rhIFN Fas antibody clone CH 11 (0.5 g/mL) and rhIFN (1000 U/mL) for 48 h with and without pan caspase inhibition with Z VAD FMK (50 M x 2). Viability was measured by the MTT assay B). *** denotes statistical significance with a P value < 0.0001. NS denotes no statistical difference. DNA damage after treatment with and without caspase inhibition w as assessed by the Comet Assay C).

PAGE 62

62 Figure 2 4 Cytokine induced cell death is partially caspase dependent. (A, B, C & D) Lox5 cells were treated with the combination of rhTNF (2000 U/mL) and rhIFN (1000 U/mL) for 48 h with and without pan caspase inhibition with Z VAD FMK (50 M x 2). The cell death profile ( A), as well the activities of Caspases 8 and 3 ( B), were measured by FACS analysis. A representative plot is shown. DNA damage and death wer e assessed via the Comet Assay ( C) and the MTT As say ( D), respectively. ** denotes statistical significance with a P value < 0.005.

PAGE 63

63 Figure 2 5. Cytokine treatment of Lox5 cells induces the expression of Heat Shock Proteins. Lox5 cells were treated with the combination of rhTNF (2000 U/mL) and rhIF N (1000 U/mL) for 24 h with and without pan caspase inhibition with Z VAD FMK (50 M). The Proteome Profiler Human Apoptosis Array Kit was used for protein detection. denotes statistical si gnificance with a P value < 0.0 5 P < 0.05, and NS denotes no statistical difference. Figure 2 6 rhTNF alone does not inhibit proliferation of Lox5 cells. Lox5 cells were treated with rhTNF (5000U/mL) for 48 h. Proliferation was determined by the amount of tritiated thymidine ( 3 H TdR) incorporated by the cells. NS denotes no statistical difference.

PAGE 64

64 Figure 2 7 Apoptosis and DNA repair protein expression of cytokine treated Lox5 cells. Lox5 cells were treated with the combination of rhTNF (2000 U/mL) and rhIFN (1000 U/mL) f or 24 h with and without pan caspase inhibition with Z VAD FMK (50 M). The Proteome Profiler Human Apoptosis Array Kit was used for protein detection. Proteins of interest are shown. denotes statistical si gnificance with a P value < 0.0 5 P < 0.05, and NS denotes no statistical difference.

PAGE 65

65 Figure 2 8 Lox5 cells die by apoptosis and necrosis after cytokine treatment with and withou t pan caspase inhibition. (A & B) Lox5 cells were treated with the combination of rhTNF (2000 U/mL) and rhIFN (10 00 U/mL) for 48 h with and without pan caspase inhibition with Z VAD FMK (50 M x 2). A) Viability wa s analyzed by the ApoGlow Assay. denotes statistical significance with a P value < 0.05 ***P < 0.0005 NS denotes no statistical difference. B) The supernatant was analyz ed for passive HMGB1 release +: Lox5 cell lysate /positive control, 1: Untreated Control, 2: rhIFN 3: rhIFN + rhTNF 4: rhIFN + rhTNF + Z VAD FMK.

PAGE 66

66 Figure 2 9 Cytokine treatment of Lox5 promotes nuclear translocation of Apoptosis Inducing Factor. Lox5 cells were treated with the combination of rhTNF (2000 U/mL) and rhIFN (1000 U/mL) for 48 h with and without pan caspase inhibition with Z VAD FMK (50 M x 2). Immunofluorescence (IF) analysis shows increased AIF transl ocation to the nucleus in cytokine treated cells. Representative images are shown. White arrows indicate cells with high nuclear AIF staining. *denotes statistical significance with a P value < 0.05. NS denotes no statistical difference.

PAGE 67

67 Figure 2 10. Inhibition of Cathepsin B or Bax translocation does not prevent cytokine mediated Lox5 cell death. Lox5 cells were treated with the combination of rhTNF (2000 U/mL) and rhIFN (1000 U/mL) for 48 h with and without Cathepsin B inhibition with CA 074 ( 5 M) or inhibition of Bax translocation with peptide V5 (100 M). NS denotes no statistical difference.

PAGE 68

68 Figure 2 11 Confirmation of mt DNA depletion in Lox5 0 cells. A) PCR primers specific for a segment of the Catalase gene (CAT) were used as a positive control. Genomic DNA from both EtBr (100 ng/mL) treated and untreated cell cultures exhibited robust amplification with the CAT primer pair (product length: 292 bp). B) Using primers that a re specific for the human mtD NA, no mtDNA amplification was seen in the EtBr treated cells, while the untreated cells produced a band of the appropriate size (product length: 2372 bp). C) Confocal images of untreated Lox5 cells using the fluorescent probes PicoG reen (Green DNA) and TMRM (Red mitochondrial membrane potential). Untreated cells exhibit co localization (Orange) of these dyes in the cytoplasm. D) Confocal images of EtBr treated (100 ng/mL) Lox5 cells ( Lox5 0 ) using the fluorescent probes PicoG reen (Green DNA) and T MRM (Red mitochondrial membrane potential). These treated cells exhibit mitochondrial membrane potential but no cytoplasmic positivity for PicoGreen

PAGE 69

69 Figure 2 12 Functional mitochondria are required for cytokine killing of Lox5. A) Lox5 0 cells (empty bars) and Lox5 cybrid cells (gray bars) were treated with rhTNF (2000 U/mL) and rhIFN (1000 U/mL) or with CH 11 (0.5 g/mL) and rhIFN (1000U/mL) for 48 h. Z VAD FMK (50 M x 2) was used to inhibit caspase activity. Viability was measure d by the MTT assay. Only mtDNA sufficient cells were killed by cytokines. *** denotes statistical significance with a P value < 0.0001 compared to rhIFN control. NS denotes no statistical difference when compared to rhIFN control. B) Changes in GSH levels were measured after a 24 h incubation period with rhTNF (2000 U/mL) and rhIFN (1000 U/mL), with and without pan caspase inhibition. ** denotes statistical significance with a P value < 0.01 compared to rhIFN control.

PAGE 70

70 CHAPTER 3 REDUCED MITOCHONDRIAL REACTIVE OXYGEN SPECIES PRODUCTION A ND INCREASED RESISTANCE TO CELL DEATH SIGNAL S AFFORDED BY mt ND2 a Introduction Insulin dependent type 1 diabetes (T1D) is a complex autoimmune disorder modulated by genetic susceptibility and environmental triggers Clinical studies as well as those using animal models have strongly linked genetic factors with T1D [236,237] In addition to susceptibility loci in the nuclear genome such as in HLA Class II and the insulin gene ( INS ) [171,236] a mitochondrial polymorphism ha s been linked to autoimmune diabetes [49,181] Mutations in mitochondrial DNA (mtDNA) can lead to diabetes result ing from cell dysfuncti on and impaired insulin secretion [238] ; however, only a single nucleot ide polymorphism (SNP) in the mitochondrial gene for NADH dehydrogenase 2 ( mt ND2 ) has been associated with autoimmune diabetes in humans and in T1D prone NOD mice [49,181,186,239] In humans, mt ND2 c is present at a higher frequency in T1D patients than in controls [181] The C to A SNP causes an amino acid change from leucine to methionine. Previously, the corresponding C to A transversion (and Leu to Met substitution) in the mouse mt Nd2 gene was found to result in lower mitochondrial ROS production [47] rather than increased resistance to oxidative damage as originally proposed [181] Additionally immune cells ar e not affected by the SNP; instead, the cells exhibit enhanced resistance to T cell mediated lysis [49] Due to the similarities of the human and mouse genotypes, it might be expected that the protective phenotype of mt ND2 a is also a consequence of reduced mitochondrial ROS production by the cells

PAGE 71

71 In contrast to the mt ND2 SNPs, the known nuclear DNA loci influence T1D risk through direct or indirect modu lation of the immune response. For instance, among the non HLA susceptibility regions, polymorphisms in the INS gene [240] and the gene encoding lymphoid specific phosphatase LYP ( PTPN22 ) [241] contribute most to T1D sensitivity. Allelic differences within the variable number of tandem repeats (VNTR) locus of the INS gene determine the level expression of INS mRNA in the thymus [182,183] The pro tective class III VNTR correlates with higher levels of INS message in the thymus where central tolerance to self antigens is established; thus, the risk allele may not allow efficient negative selection of insulin reactive thymocytes to take place due to the lower expression of INS mRNA. In the case of PTPN22 the pathogenic variant is also associated with other autoimmune disorders [242] The gain of function mutation of LYP results in decreased T cell receptor (TCR) signaling [184,243] which could then lead to thymocyte hyporesponsiveness during development and, consequently, inefficient deletion of autoreactive T cells in the thymus Mitochondrial mutations are commonly studied using cytoplasmic hybrid (cybrid) technology [244] Cybrids are developed by fusion of mtDNA deficient ( 0 ) cell line s with platelets of donors harboring the mutation of interest. Here, cybrid cell technology was employed to study the impact of the mt ND2 c and mt ND2 a alleles in cell death. Lox5 ND2 c and Lox5 ND2 a cell lines were generated from the human cell line, Lox5 [29,56,91] The present study confirm ed the protective phenotype of mt ND2 a in human cells and test ed the hypothesis that resistance results from lower levels of mitochondrial ROS generation. Lox5 ND2 a cells resisted killing by proinflammatory cytokines and death receptor activation compared to Lox5 ND2 c Similar to what was

PAGE 72

72 found in the mouse [47,49] the data presented suggest that protection is attributed to a failure of mitochondria to increase ROS production in response to proapoptotic stimuli Materials and Methods Cell Line and Reagents The Lox5 cell line was kindly provided by Dr. Fred Levine ( Health Research Center, Sanford Burnham Medical Research Institute, La Jolla, CA) Lox5 cells were maintained as described before in low glucose (1 mg/mL) DMEM (Cellgro, Manassas, VA), supplemented with 10% FBS (HyClone, Fisher Scientific, Pittsburgh, PA), 1% MEM non essential amino acids (Cellgro), 1% penicillin streptomycin (Gemini Bio Products, West Sacramento, CA) solution, 0.02% BSA (Sigma, St. Louis, MO ) and 15 mM HEPES (Cellgro) (VC DMEM) [29] Recombinant human IFN was purchased from BD Biosciences (San Jose, CA). Recombinant human TNF was acquired from R&D Systems (Minneapolis, MN). Fas agonistic antibody (Clone CH 11) was purch ased from Millipore (Temecula, CA). Annexin V APC, propidium iodide (PI), MitoSox Red, DiOC 6 Quant iT PicoGreen dsDNA reagent, and MitoTracker Deep Red 633 were purchased from Invitrogen (Carlsbad, CA). Generation of Lox5 ND2 c and Lox5 ND2 a Cells Lox5 0 cells were generated and maintained as previously described [29] Briefly, m itochondrial DNA (mtDNA) was depleted by culturing cells in Lox5 medium supplemented with 100 ng/m L E thidium Bromide (EtBr) for 6 months. Depleti on of mtDNA was confirmed by failure to amplify an mtDNA PCR product, confocal microscopy imaging, and failure of Lox5 0 cells to survive in pyruvate and uridin e free medium.

PAGE 73

73 From Lox5 0 cells, c ybrid Lox5 cells were generated as described before [201] In short cybrid cells were made by fusion of Lox5 0 cells with mtDNA donor platelets from healthy individual s, selected for highest possibility to express either the C or A allele of mt ND2 (Caucasian and Chinese, respectively) under the presence of 50% (W/V) polyethylene glycol 1500 (Roche). Cells were cultured in the medium for Lox5 0 cells (pyruvate and uridine supplemented) during the first 3 days after the fusion and then in selective medium (uridine and pyruvate free DMEM supplemented with 10% dialyzed FBS, Penicillin and Streptomycin). After selection for 3 weeks, surviving cybrid cells were cultured in DMEM for Lox5 without pyru vate and uridine. Cybrid cells were cloned using cloning cylinders (Corning, Corning, NY) when visible colonies appeared in the culture. Reconstitution of mtDNA was confirmed by confocal microscopy, and ability to expand the cells in the absence of pyruv ate and uridine supplementation and PCR amplification of a region of the mtDNA For confocal visualization, cells were stained with MitoTracker Deep Red (10 M) in phenol red free media at 37 C for 30 minutes. PicoGreen (1 L/mL) was added for 2 minutes to stain DNA. After washing, Lox5 ND2 c and Lox5 ND2 a cells were maintained in phenol red free media for the duration of the experiment. To determine the mt ND2 allotype, DNA was extracted from cells. A fragment was amplifie d using PCR primer pair 4451F ( GGTTATACCCTTCCCGTACTA) 6029R ( CCAGCTCGGCTCGAAT ) and visualized with an agarose DNA gel. The DNA bands were cut from the gel and purified using the Purelink kit ( Invitrogen ) Amplified DNA fragments were sequenced using the 4451F 6029R primers. The cybrid cell line developed from the Caucasian platelet donor expressed the C allele and was

PAGE 74

74 designated Lox5 ND2 c The cybrid cell line developed from the Chinese platelet donor expressed the A allele and was designated Lox5 ND2 a Cell Death Assays Lox 5 ND2 c and Lox5 ND2 a cells were seeded in to twelve well Corning Costar culture plates (Fisher Scientific) at a density of 5x10 4 cells per well in a total of 500 L and allowed to adhere overnight The cells were then incubated with rhTNF (2000 U/mL ) and rhIFN (1000 U/mL) for 48 h. Lox5 ND2 c and Lox5 ND2 a cells were also cultured with Fas activating antibody CH 11 (0.5 g/mL) and rhIFN (1000 U/mL) as IFN priming of the parental cell line was previously found to be required for adequate surface Fas expression [29] In some experiments, the cells were treated with 50 M of the pan caspase inhibitor (Z VAD FMK), purchased from Calbiochem (San Diego, CA), which wa s added 1 h prior to treatment. Z VAD FMK was also added after 24 h of incubation to maintain caspases inactive. Cell viability was examined by propidium iodide (PI) uptake and externalization of phosphatidylserine (PS) by Annexin V APC staining. T he ant ioxidant cap acity of the cybrid cell lines Lox5 ND2 c and Lox5 ND2 a w as challenged by seed ing the cells as described above followed by treatment with increasing concentrations of exogenous H 2 O 2 (Sigma, St. Louis, MO ) for 48 h. The following concentration s were tested: 0, 100, 200, 250, 300, 350, 400, 500, 1000, and 5000 M. Viability was also measured by PI uptake and PS externalizat ion by Annexin V APC staining. Lox5 ND2 c and Lox5 ND2 a cells were analyzed on a BD LSR Fortessa flow cytometer using the BD FACSDiva software (BD Biosciences) and FlowJo analysis

PAGE 75

75 software (Tree Star, Inc., Ashland, OR). Cellular apoptosis was determined by double staining with PI and Annexin V APC (dead apoptotic) or single staining by Annexin V APC (live apoptot ic) while necrotic cells were identified as PI single positive cells. Detection of Mitochondrial Reactive Oxygen Species Production Lox5 ND2 c and Lox5 ND2 a cells were incubated with rhTNF and rhIFN or agonistic Fas antibody and rhIFN as described a bove. After 48 h, MitoSox Red was added to the cells at a final concentration of 2.5 M and allowed to detect mitochondrial ROS (mtROS) for 20 minutes at 37 C. DiOC 6 dye (20 nM final) was also added to the cells during the last 15 minutes of culture to determine the mitochondrial membrane potential of the cells. After washing, the fluorescence of the dyes was measured by flow cytometry on the BD LSR Fortessa. MitoSox Red is rel eased from the mitochondria of dead cells and binds to nuclear DNA resulting in very strong fluorescence; therefore o nly live cells were selected to quantify MitoSox Red fluorescence [245] To do this, DiOC 6 positive, or live cells with mitochondrial membrane potential, were gated and the MitoSox Red mean fluorescence intensity was then measured. Statistical A nalysis Unless stated otherwise, data are prov ided as mean SEM. Significance was determined by a t test for two group comparisons (GraphPad Prism 5 for Mac OS X, La Jolla CA); when appropriate, paired t tests were performed. Results mt ND2 c and mt ND2 a Alleles in the Lox5 Nuclear Background Two cybrid cell lines generated from different platelet donors and mtDNA deficient Lox5 0 cells were selected f or sequencing. The DNA base pair at position 5,178 within the NADH dehydrogenase subunit 2 gene ( mt ND2 ) demonstrated that one of the

PAGE 76

76 cell lines h arbored the C allele, while the other cell line encoded the A allele (Fig. 3 1) The cell lines were then named Lox5 ND2 c or Lox5 ND2 a respectively, according to the mt ND2 allotype. Confocal imaging of the cybrid cell lines confirmed that both contained similar mtDNA per mitochondria as the parental cell line (Fig. 3 2). Thus, viability assays with Lox5 ND2 c or Lox5 ND2 a were performed to determine the contribution of each allele in the response to cell death s ignals m t ND2 a Protects Human Cells from Immune Mediated Destruction The mt ND2 c and mt ND2 a encoding cell lines were treated with IFN and TNF for 48 h using methods identical to those performed with the parental cell line [29] Cell viability was reduced in both Lox5 ND2 c and Lox5 ND2 a after proinflammatory cytokine exposure (Fig. 3 3A). However, over 80% of Lox5 ND2 a cells survived the combination of IFN and TNF in contrast to the 44% killing observed in Lox5 ND2 c cells. Similarly, when compared with Lox5 ND2 c cells, less Lox5 ND2 a cells were killed by CH 11 with IFN priming (Fig. 3 3A). Mitochondrial function is dependent on its membrane potential. C hanges in mitochondrial membrane potential of Lox5 ND2 c and Lox5 ND2 a cells after incubation with proinflammatory cytokines or Fas antibody w e re measured with DiOC 6 staining No significant changes in the mitochondrial membrane potential of Lox5 ND2 a cells after IFN and TNF were observed. On the other hand Lox5 ND2 c cells experienced a significant drop in mitochondrial membrane potential after IFN and TNF treatment (Fig. 3 3B). R eductions in both cell lines were measured after Fas killing ; how ever, after treatment a significantly greater percentage of Lox5 ND2 a cells were able to maintain higher membrane potential when compared to Lox5 ND2 c (Fig. 3 3B).

PAGE 77

77 Lower Reactive Oxygen Species Production by Lox5 ND2 a Cell s in Response to Pro inflammatory Cytokines and Fas Receptor Activation Mitochondrial ROS production, as measured by MitoSox Red staining, was quantified in pro inflammatory cytokine or CH 11 treated DiOC 6 positive (DiOC 6 High) cybrid cells Cells with high DiOC 6 fluorescence staining were found to be mostly Annexin V and PI negative (Fig. 3 4A). In live cells, mitochondrial ROS production was observed in both Lox5 ND2 c and Lox5 ND2 a cells after IFN and TNF incubation but a significantly lower induction was measured in treated Lox5 ND2 a cells (Fig. 3 4B). Similarly, higher levels of mt ROS were produced by Lox5 ND2 c cells after Fas killing compared to Lox5 ND2 a cells (Fig. 3 4B). These data suggest that mtROS production precedes the loss of mitochondrial membrane potential in cells. Of note, basal mt ROS generation was also found to be 30% higher in Lox5 ND2 c than in Lox5 ND2 a ( Fig. 3 4B) This is consistent with studies in the mouse where mitochondria isolated from mice expressing mt Nd2 c produced 30% more mtROS than mitochondria from the other strains tested [48] Th e finding further supports the hypothe sis that mt ND2 a and mt Nd2 a result in similar phenotypes in humans and mice, respectively, and that the protection seen in Lox5 ND2 a is due to the A allele SNP of mt ND2 mt ND2 a does not Confer Heightened Resistance to Oxidative Stress To test whether in addition to lower endogenous mt ROS production the A allele variant of mt ND2 also protects against oxidative damage, Lox5 ND2 c and Lox5 ND2 a cells were incubated with increasing concentrations of e xo genous H 2 O 2 Lox5 ND2 a cells did not demonstrate elevated resistance to ROS (Fig. 3 5 A ). In agreement with

PAGE 78

78 the higher levels of mtROS produced by Lox5 ND2 c with IFN alone compared to Lox5 ND2 a (Fig. 3 4B), when the c ybrids were incubated with IFN and exogenous H 2 O 2 more L ox5 ND2 a cells survived higher concentrations of H 2 O 2 (Fig. 3 5B). Caspase Inhibition Fully Rescues Survival in Response to Ago nistic Fas Ligation but not Pro inflammatory Cytokines As seen with the parental cell line [29] IFN and TNF treatment activates caspases in Lox5 ND2 c cells and pan caspase inhibition partially prevents cytotoxicity (Fig. 3 6A). On the other hand, viability of Lox5 ND2 a was unchanged after pro inflammatory cyto kine killing in the presence of Z VAD FMK (Fig. 3 6A). Both cell lines were protected from Fas killing when Z VAD FMK (Fig. 3 6B) was also included in the culture media. Like in Lox5 cells [29] activation of the Fas pathway leads to caspase dependent cell death in Lox5 ND2 c and Lox5 ND2 a cells. Discussion More than 40 chromosomal loci have been associated with T1D susceptibility or resistance [171] Although some regions that determine risk have been narrowed to include only a single gene understanding the impact of a given gene to the d isease is very difficult due to possible interactions between multiple loci To date, the only mitochondrial gene correlate d with autoimmune diabetes encodes NADH dehydrogenase 2 ( mt ND2 ) In mice, two closely related strains were previously crossed to study the interaction of the nuclear and mitochondrial genomes in the diabetogenic process [48,49,186] ALR mice are resistant to spontaneous and alloxan induced T1D. mt Nd2 a differentiates the mtDNA of ALR mice from the T1D susceptible NOD mitochondrial genome, which encodes mt Nd2 c Because mtDNA is maternally inh erited, NOD mice were mated with ALR females as described before [48] to obtain a

PAGE 79

79 conplastic mouse strain, NOD.mt ALR In the presence of a fully diabetogenic environment, mt Nd2 a did not prevent spontaneous T1D onset [49] However, the kinetics of T1D transfer by an autoreactive CD8 + T cell clone was altered by mt Nd2 a and autoreactive CD4 + T cells did not transfer disease [49] Furthermore, cells from the NOD.mt ALR mice exhibited resistance to lysis in cell mediated lymphotoxicity (CML) assays [ 49] These data demonstrated that, in mice, protection is at cell level and nuclear mitochondrial genome interactions dictate T1D susceptibility. To understand the contribution of the human mt ND2 variants, cybrid cell lines with identical nucle ar genomes but differing in their mtDNA were generated from a human cell line (Figs. 3 1 and 3 2) Lox5 ND2 c and Lox5 ND2 a cells were exposed to pro death factors that are cytotoxic to the parental Lox5 cell line (Fig. 3 3) [29] Consistent with the previous observation that IFN and TNF killing is dependent on functional mitochondria [29] Lox5 N D2 a cells were very well protected from proinflammatory cytokine induced death (Fig. 3 3A). Less than 20% of the mt ND2 a encoding cells were killed by this treatment, whereas more than 40% of Lox5 ND2 c cells did not survive incubation with IFN and TNF (Fig. 3 3A). On the other hand, because mtDNA deficient Lox5 0 cells were susceptible to Fas killing, Fas mediated cell death in the parental cell line was believed to occur extrinsically, or independent of the mitochondria [29] Surprisingly, Lox5 ND2 a cells were also better protected from agonistic Fas antibody treatment compared to Lox5 ND2 c cells (Fig. 3 3 A ). In both Lox5 ND2 c and Lox5 ND2 a the health of the cells correlated with mitochondrial constitution as determined by the ability to resist changes in the membrane potential of the mitochondria (Fig. 3 3B ).

PAGE 80

80 Animal studies indicate that mt Nd2 a protects cells because basal and stimulate d mitochondrial ROS production is reduced in cells of this allotype compared to cells expressing mt Nd2 c [48] Mitochondrial ROS generation in live cells can be determined with the indicator MitoSox Red with an emission wavelength of 580 nm (red) when it reacts with mt ROS but MitoSox Red is also highly fluorescent when bound to DNA [245] To determine the amount of mt ROS produced in Lox5 ND2 c and Lox5 ND2 a MitoSox Red fluorescence was measured in cells that maintained mitochondrial membrane potential (Fig. 3 4A) with and without treatment. As hypothesiz ed, Lox5 ND2 a cells generated significantly lower mt ROS in response to both proinflammatory cytokines and Fas receptor activation (Fig. 3 4B). In addition, basal levels of mitochondrial ROS were 30 % lower in Lox5 ND2 a compared to Lox5 ND2 c (Fig. 3 4B). This is identical to the differences observed in mice; mitochondria isolated from conplastic ALR.mt NOD produce 30% more basal mtROS than NOD.mt ALR mitochondria [48] As Lox5 ND2 a cells were more resistant to mitochondrial membrane potential reductions, the cell lines were assayed for susceptibility to exogenous ROS to test if mt ND2 a also modifies the antioxidant capacity of cells Lox5 ND2 c and Lox5 ND2 a cells were exposed to H 2 O 2 for 48 h and viability measured. mt ND2 a did not confer increased resistance to exogenous H 2 O 2 (Fig. 3 5 A ) Both cell lines responded equally to H 2 O 2 alone but more Lox5 ND2 a cells survived w hen cultured with H 2 O 2 and IFN (Fig. 3 5 B ) suggesting that the mtROS produced by Lox5 ND2 c with IFN treatment (Fig. 3 4B) has an additive effect with the exogenously added ROS These results

PAGE 81

81 indicate that mt ND2 a controls mitochondrial ROS production but does not elevate resistance to oxidative stress. Despite the observation that Fas mediated Lox5 cell death was seemingly due to extrinsic activation of the caspase cascade [29] Lox5 ND2 a ce lls were better protected than Lox5 ND2 c cells from Fas killing (Fig. 3 3A) suggesting that in mtDNA sufficient cells mitochondria may also play a role in Fas induced death. To elucidate whether the cell death mechanisms activated in the cybrid cell l ines differ from those identified in Lox5 [29] Lox5 ND2 c and Lox5 ND2 a cells were killed by proinflammatory cytokines and Fas antibody in the presence or absence of the pan caspase inhibitor, Z VAD FMK. As it was noted with caspase inhibition of cytokine treated Lox5 cells [29] Lox5 ND2 c were killed by the combination of IFN and TNF through caspase depe ndent and independent mechanisms (Fig. 3 6A). Adding Z VAD FMK to the cytokine containing media significantly rescued viability of Lox5 ND2 c but not to IFN control levels. However, pa n caspase inhibition did not improve cell survival of Lox5 ND2 a (Fig. 3 6A) indicating that the small percentage of Lox5 ND2 a cell death measured after IFN and TNF treatment is only a consequence of caspase independent mechanisms of death. On the other hand, both cell lines were similarly re scued from Fas killing with pan caspase inhibition (Fig. 3 6B). Proinflammatory cytokines have been shown to activate multiple pathways of cell death in cells that vary with the model system and specific treatment parameters [24,29,148 150,198,246] Proinflammatory cytokine combinations and cell culture conditions that favor the involve ment of the mitochondria in cell death can either induce the intrinsic (mitochondria dependent) apoptotic pathway via the activation of

PAGE 82

82 pro death molecules that permeabilize the mitochondria and allow the release of cytotoxic factors [198] or amplify extrinsic signals, i.e. TNF receptor activation, through the cleavage of Bid [24] Furthermore increasing the antio xidative defense capacity of cell mitochondria prevents proinflammatory cytokine induced damage to the mitochondria and cell death [29] implicating mtROS as the initiating signal in mit ochondrial dependent cell apoptosis Fas killing of cells appears to be more straightforward. cells were previously demonstrated to behave as Type II cells, in which amplification of the caspase cascade through Bid is required for death induction [24] However, in t he absence of functional mitochondria human cells are killed by Fas through the action of caspases [29] T ogether with the aforementioned observations, t he results presented here contr ibute to our understanding of the sequence of events that culminate in cell death in response to pro death signals. In summary, w hen human cells encoding mt ND2 c are incubated with IFN and TNF mtROS are produced and mitochondrial damage occurs resulting in activation of the caspase cascade (Fig. 3 7). However, the protective A allele of mt ND2 dampens mitochondrial ROS production in response to proinflammatory cytokines, and the caspase cascade does not become activated (Fig. 3 7). T herefore, the signaling cascade with proinflammatory cytokine treatment is proposed to be as follows: 1) intrinsic pathway activation, 2) induction of mtROS production, 3) mitochondrial damage, and 4) caspase cascade activation Feedback mechanisms likely promote the amplification of this process. In addition, concurrent damage also takes place via caspase independent cell death pathways and necrosis [29] As a result of the lower

PAGE 83

83 levels of mt ROS in Lox5 ND2 a the cells are also more resistant to Fas killing because amplification of the caspase cascade through the mitochondria is weakened (Fig. 3 7). Thus, Fas receptor mediated cell death transpires in this sequence: 1) extrinsic pathway activ ation, 2) activation of caspase cascade, 3) cleavage of Bid and mitochondrial signaling, 4) mtROS production, and 5) amplification of the caspase cascade. These studies demonstrate that a SNP in the mitochondrial genome can modify human cells to resist killing by insults associated with T1D progression by suppressing mt ROS generation.

PAGE 84

84 Figure 3 1. Sequencing data of Lox5 cybrid cell clones. Cybrid cell lines developed from two healthy platelet donors in the Lox5 background were sequenced for their mt ND2 allotype. One of the cybrid cell lines expressed the C allele (A), and the other the A allele (B).

PAGE 85

85 Figure 3 2. Confirmation of mtDNA reconstitution in Lox5 ND2 c and Lox5 ND2 a cells. Confocal images of untreated Lox5 cells (A) using the fluor escent probes PicoG reen (Green DNA) and MitoTracker Red (Red mitochondrial membrane potential). Like the parent cell line, Lox5 ND2 c (B) and Lox5 ND2 a (C) cells exhibit co localization (Orange) of these dyes in the cytoplasm.

PAGE 86

86 Figure 3 3. mt ND2 a prot ects against pro inflammatory cytokine and death receptor mediated cell death. A) Lox5 ND2 c ( black bars) and Lox5 ND2 a (white bars) cells were treated with the combinations of rhTNF (2000 U/mL) and rhIFN (1000 U/mL), or rhIFN (1000 U/mL) and CH 11 (0.5 g/mL) for 48 h. Viability was measured by flow cytometry B) Mitochondrial membrane potential was determined by the staining intensity of the dye DiOC 6 **** denotes statistical significance with a P valu e < 0.0001 *** P value < 0.0005 ** P value < 0.001, and P value < 0.05 NS denotes no statistical d ifference Red asterisks represent statistical comparison of the specified cell line to its IFN control, while black asterisks are used to compare the two cell lines.

PAGE 87

87 Figure 3 4. Reduced mitochondrial ROS production in Lox5 ND2 a cells in response to pro death signals Lox5 ND2 c ( black bars) and Lox5 ND2 a (white bars) cells were treated with the combinations of rhTNF (2000 U/mL) and rhIFN (1000 U/mL), or rhIFN (1000 U/mL) and CH 11 (0.5 g/mL) for 48 h. Mitochondrial ROS production was measured by flow cytometry analysis of MitoStox Red staining (B) in DiOC 6 positive, live cells (A). *** denotes statistical significance with a P value < 0.0001, ** P value < 0.005 and P val ue < 0.05 NS denotes no statistical difference. Red asterisks are used for statistical comparison of the specified cell line to its untreated control, while black asterisks are used to compare the two cell lines.

PAGE 88

88 Figure 3 5. mt ND2 a does not enhance the antioxidant capacity of Lox5 ND2 a cells. A) Lox5 ND2 c (filled circles) and Lox5 ND2 a (empty circles) cells were treated with increasing concentrations of H 2 O 2 for 48 h and viability was measured by flow cytometry. B ) Viability was also measured with the addition of rhIFN (1000 U/mL). ** denotes statistical significance with a P value < 0.0 005, ** P value < 0.01, and P < 0.05

PAGE 89

89 Figure 3 6 Pan caspase inhibition fails to rescue Lox5 ND2 a cells from pro inflammatory cytokine mediated cell death but protects against Fas receptor activation. A) Lox5 ND2 c (black bars) and Lox5 ND2 a (white bars) cells were treated with the combinations of rhTNF (2000 U/mL) and rhIFN (1000 U/mL), or (B) rhIFN (1000 U/mL) and CH 11 ( 0.5 g/mL) for 48 h, with and without pan caspase inhibition with the inhibitor Z VAD FMK (50 M x 2) and cell death was measured by flow cytometry ** denotes statistical significance with a P value < 0.005. NS denotes no statistical difference.

PAGE 90

90 Figure 3 7. Proposed mechanism of protection conferred by mt ND2 a in human cells Pro inflammatory cytokines lead to an increase in mitochondrial ROS production, which activates the caspase cascade as well as casp ase independent mechanisms (i.e. AIF translocation to the nucleus [29] ). In human cells expressing mt ND2 a mitochondrial ROS generation is blunted, thus, the caspase cascade fails to be activated and only caspase independent mechanisms kill the cells. Conversely, while human cell death mediated by activation of the Fas death receptor can occur in the abs ence of functional mitochondria [29] amplification of the caspase cascade through the mitochondria takes place in mtDNA sufficient cells. Lower mitochondrial ROS production in mt ND2 a en coding human cells allows for elevated mitochondrial health and stability, thereby diminishing the amplification step and increasing resistance to Fas killing when compared to cells that express mt ND2 c 2012 Yama Luzardo Lightfoot mt ND2 a

PAGE 91

91 CHAPTER 4 AUTOREACTIVE CYTOTOX IC T LYMPHOCYTE MEDIATED KILLING OF HUMAN CELLS IN VITRO Introduction Autoimmune diabetes is believed to be a T cell mediated disorder in man as well as the NOD mouse and BB DP rat [247] Specifically, cytotoxic CD8 + T cells are considered the final effectors in the progression to type 1 diabetes (T1D) T1D prone NOD mice that are deficient in major histocompatibility complex (MHC ) class I do not develop T1D or insulitis [248] In humans, the common HLA A2 and HLA B27 haplotype s associate with T1D risk [175,177] Moreover, w hen HLA A 020 1 is transgenically expressed in NOD mice, T1D onset is accelerated [249] While direct evidence for the impact of T cells in T1D development only exists in mice [10 12,250] autoreactive effector CD8 + T cells that recognize cell derived antigens can be detected in humans [6,178] One of these epitopes, IGRP 265 273 ( islet specific glucose 6 phosphatase catalytic subunit related protein) elicits a T cell response in NOD mice and in humans [251,252] U nderstanding how diabetogenic or T1D causing, cytotoxic T lymphocytes (CTLs) recognize and tar get human cells is essential to the advancement of the field Identification of mechanisms of cell death specific to cells could lead to the development of immunotherapies that halt cell dysfunction and declines in cell mass yet are not globally suppressive However, detection and isolation of autoreactive CD8 + T cells for in vitro cell mediated lymphocytotoxicity ( CML ) assays is difficult due to the low frequency of these cells in the periphery as well as their potential low affinity for self pe ptides [253]

PAGE 92

92 CTL killing mechanisms of hu man islets have been previously analyzed using viral specific CTLs and peptide pulsed dispersed islets [37] Although the islet cells were specifically lysed, peptide pulsing does not allow for cell specificity as all the cells within the islets will present the peptide of interest In addition, it is likely that the affinity of these CTLs for viral peptides does not represent the weak interaction between autoreactive T cell rec eptor s (TCR s ) on CTLs and cell antigens [25 3] The system tested here represents an in vitro model to study CTL mechanisms important in T1D development. In this study, Lox5 cells were shown to express relevant T1D autoantigens, including IGRP and the class I molecule HLA A 0 2 01 To circumvent the difficulties of obtaining diabetogenic human CTLs and to ensure killing of cells only, the human cell line Lox5 [29,56,91] was exposed to human CD8 + T cells transfected to express a TCR that recognizes the T1D autoantigen IGRP 265 273 presented in the context of HLA A02 [251] Consequently, the se transfected CTLs specifically lysed Lox5 cells Additionally, genetic manipulation of Lox5 cells can be used to determine the impact of polymorphisms expressed at the cell level To this end, Lox5 cells encoding the protective mt ND2 a allele or the susceptib ility mt ND2 c allele [181] were also u sed as targets in CML assays. Mouse cell lines that harbor the protective allele ( mt Nd2 a ), resist killing by autoreactive CTLs [49] As expected from the studies in mice [49] and from previous work using the cybrid cell lines (Chapter 3 and [49] ), Lox5 ND2 a cells were significantly protected from killing by IGRP 265 273 reactive CTLs.

PAGE 93

93 Materials and Methods Cell Line and Reagents The Lox5 cell line was kindly provided by Dr. Fred Levine ( Health Research Center, Sanford Burnham Medical Research Institute, La Jolla, CA) Cybrid cell lines were derived from Lox5 0 cells (Chapter 3 and [29] ). Lox5, Lox5 ND2 c and Lox5 ND2 a cells were maintained as described before [29] IGRP transfected and mock transfected CD8 + T cells were obtained in collaboration with Dr. Todd Brusko (Diabetes Center of Excellence, University of Florida, Gainesville, FL ) Briefly, CD8 + T cells sorted from human peripheral blood mononuclear cell s ( PBMCs ) were transfected with either a non TCR encoding lentiviral vector or a multicistronic lentivirus encoding the and chains of a diabetogenic TCR specific for IGRP 265 273 in the context of HLA A 0 2 01 [251] TCR expression is optimized by linking the and chains with furin/2A self cleaving peptides. The lentiviral vectors also contain a GFP reporter gene that allow s for post transfection sorting and enrichment of the CD8 + T cells of interest. CTLs were expanded and activated in vitro before cryopreservation. These effector cells were thawed immediately before use. Recombinant human IFN and FITC conjugated HLA A2 antibody were purchased from BD Biosciences (San Jose, CA). IGRP 265 273 peptide was synthesized by EZBiolab (Carmel, IN). HLA Typing and Autoantigen Expression of lox5 HLA typing of L ox5 was performed by Dr. Massimo Trucco Hospital of Pittsburgh Histocompatibility Center, Pittsburgh, PA), using the SSP UniTray High Resolution Kit (Dynal Biotech Invitrogen ), and LABType SSo Typing Tests Kit (One Lambda, Inc. Canoga Park, CA ), as per the manufacturers The

PAGE 94

94 exp ression of T1D autoantigens in L ox5 cells was compared to that of human islets by reverse transcriptase PCR (RT PCR). Aliquots of snap frozen human islets were obtained from the Islet Cell Resource Center at the University of Alabama School of Medicine. RNA was isolated from human islet preparations (HP 58 HP 60 ) as well as Lox5 cells. cDNA was synthesized by RT PCR. Autoantigen expression was assessed using primers purchased from SuperArray Bioscience (Frederick, MD ). The primer pairs used for this analysis were specific for Glucose 6 phosphatase, catalytic, 2 ( G6PC2 or IGRP), Insulin ( INS ), Dystrophia myotonica protein kinase ( DMPK ), Islet cell autoantigen 1 ( ICA1 or ICA69), protein tyrosine phosphatase, receptor type, N ( PTPRN or IA 2), Solute carr ier family 30, member 8 ( SLC30A8 or ZnT8), as well as glutamic acid decarboxylase 1 and 2 ( GAD1 and GAD2 ). A primer set for GAPDH demonstrated strong amplification for all three samples. Flow Cytometry IFN treated and untreated Lox5 cells were analyzed for HLA A 2 expression by standard flow techniques. In brief, Lox5 cells were treated with low doses of rhIFN (50, 100, and 200 U/mL) overnight, stained for 1 h at 4 C and washed to remove excess unbound antibody before analysis. Lox5 ND2 c and Lox5 ND2 a cells were analyzed on a BD LSR Fortessa flow cytometer using the BD FACSDiva software (BD Biosciences) and FlowJo analysis software (Tree Star, Inc., Ashland, OR). Chromium Release Assay Cell lines that were IFN primed overnight or lef t untreated we re loaded with 10 Ci/mL sodium chromate ( 51 Cr) for 3 h at 37 C in culture media. In some cases, 51 Cr loaded cells were pulsed with IGRP 265 273 peptide for 30 minutes and excess peptide

PAGE 95

95 removed by washing in DMEM media. Transfected CTLs were thawed and d iluted to the desired effector:target (E:T) ratio. The CTLs were incubated with 2 x 10 4 target cells per well in triplicate for 16 h The supernatant was harvested and reactivity counted with a gamma counter [Wizard 1470 (Perkin Elmer)] The r emaining target cells were lysed with 2% SDS harvested and reactivity counted with the gamma counter T otal 51 Cr was determined by: supernatant counts plus counts in the SDS lysate. The percentage specific 51 Cr release was calculated by the following e quation: % specific lysis = [ 51 Cr counts supernatant /( 51 Cr counts supernatant + 51 Cr counts SDS lysate ) 100] spontaneous lysis. Spontaneous lysis was calculated by the % 51 Cr release in the absence of effector cells. To compare the susceptibility of Lox 5 ND2 c and Lox5 ND2 a cells to antigen specific lysis by IGRP reactive CTLs, % specific lysis by mock transfected CD8 + T cells was subtracted from % specific lysis by IGRP transfected CTLs. Statistical A nalysis Unless stated otherwise, data are shown as mean SEM. Significance was determined by a t test for two group comparisons (GraphPad Prism 5 for Mac OS X, La Jolla, CA); when appropriate, paired t tests were performed. Results Lox5 Cells Express T1D Autoan tigens and Encode the Common HLA A 0201 Allele The HLA typing of Lox5 demonstrated that the cells encode the HLA alleles HLA A0201/2501, HLA B0801/3801, C0701/1203, and DRB0301/1001. PCR amplification with primer sets specific for Glucose 6 phosphatase, catalytic, 2 ( G6PC2 or IGRP), Insulin ( INS ), Dystrophia myotonica protein kinase ( DMPK ), Islet cell autoantigen 1

PAGE 96

96 ( ICA1 or ICA69), protein tyrosine phosphatase, receptor type, N ( PTPRN or IA 2), Solute carrier family 30, member 8 ( SLC30A8 or ZnT8), as well as glutamic acid decarboxylase 1 and 2 ( GAD1 and GAD2 ) demonstrated that, similar to primary human pancreatic islet samples (HP58 and HP60), Lox5 cells express ed autoantigens relevant in the pathogenesis of T1D (Fig. 4 1 A ). Strong expression of all antigens, save insulin, was observed in Lox5 cells. Interestingly, autoantigen expression in the primary islets was inconsistent (Fig. 4 1A). Antigen specific recognition of target cells by activated CTLs requires peptide presentation in the context of HLA Class I molecules. To test if Lox5 cells can be primed for CTL recognition, the cell line was treated with low concentrations of IFN and t he expression level of HLA A 0 2 was measured by flow cytometry. At all the IFN doses tested (50, 100, and 200 U/mL), the HLA Class I expression of Lox5 cells was significantly induced (Fig. 4 1B). Diabetogenic CTLs Recognize and Kill Lox5 Cells Lox5 ce lls were incubated for 16 h with IGRP reactive HLA 020 1 restricted TCR transduced human CD8 + T cells. Compared to non antigen specific lysis of the cell line, CTLs transfected to recognize IGRP 265 273 in the context of HLA A02 01 were significantly more cytotoxic towards Lox5 cells (Fig. 4 2A). The percent lysis of IGRP specific CTLs peaked at the highest E:T ratio (25:1) and was reduced at lower E:T ratios (Fig. 4 2A and 2B ). Overnight IFN priming of Lox5 cells enhanced kill ing, whereas pulsing the cells with IGRP 265 273 did not significantly increase lysis of IFN primed Lox5 cells.

PAGE 97

97 mt ND2 a Protects Human Cells from CTL Killing A cybrid cell line, developed from Lox5 cells and encoding the T1D resistance associated mt ND2 a allele, was previously shown to be less susceptible to proinflammatory cytokines and to Fas receptor activation (Chapter 3). To test whether mt ND2 a also protects human from killing by autoreactive CTLs, Lox5 ND2 c and Lox5 ND2 a cells were used as targets in a chromium release assay as described above with the parental cell line. Again, a 25:1 E:T ratio demonstrated significant IGRP specific lysis for both cell lines (Fig. 4 3). However, Lox5 ND2 a cells were consistently less sensitive to kil ling than Lox5 ND2 c at all E:T ratios (Fig. 4 3). Discussion To date, no cure exists for T1D in humans. However, the most effective t reatments in terms of slowing loss of cell mass and function after T1D, are represent ed by global immunosuppressive therapies or regimens that target either T cells (anti CD3) or B cells (anti CD20) [18,254 256] The rationale behind conducting these trials has been greatly supported by studies using the well established NOD model to understand the pathogenesis of the disease [237] as well as the success of immunotherapies that deplete or modulate adaptive immune cells in preventing or reversing T1D in animal systems [12,13,257,258] In humans, a pathological lesion, termed insulitis, can sometimes be identified in postmortem examination of recent onset patients [259] providing indirect evidence for the influence of immune cells in T1D. Detailed analyses of the insulitic infiltrates indicate that CD8 + T cells are the most abundant immune cell type present during insulitis [5,6] Nonetheless, functional data proving that CD8 + T cells gain cytotoxic, autoreactive function in humans is lacking.

PAGE 98

98 Given the s pecificity of cell destruction in autoimmune diabetes, considerable efforts have focused on identifying the cell proteins recognized by self reactive immune effectors [52] A better understanding of why and how tolerance to these autoantigens is lost, along with the mechanisms employed by CTLs to destroy cells is key to the dev elopment of tissue specific immunotherapies. Here, a human cell line that expresses several of the known T1D autoantigens (Fig. 4 1A) was used as a target for cytotoxic CD8 + T cells that recognize IGRP 265 273 in the context of HLA A 02 01 [178,251,252] IGRP specific CD8 + T cells are not only present in the peripheral blood of T1D patients [178] but also within the islets of recent onset and longstandin g T1D patients [6] These data suggest that IGRP is an important autoantigen in T1D. Previously, express ion of the death receptor Fas was detected on the cell surface of Lox5 cells [29] T he leve l of Fas was inducible by IFN [29] indicating that the cells could be primed for heightened immune surveillance and potentially lysed by CTLs In addition to upregulation of death rece ptor s inflammation promotes MHC Class I hyperexpression in Lox5 (Fig. 4 1B), which is associated with viral and non viral T1D in humans [6,260] Because Lox5 cells express IGRP and present antigens in the context of HLA A0201 (Fig. 4 1A & B) IGRP 265 273 reactive CTLs effectively lysed these cells K illing was significantly greater when Lox5 was incubated with the IGRP transfected CTLs versus the mock transfected T cells (Fig. 4 2A) suggesting that the autoreactive CTLs lysed Lox5 in an antigen specific manner As Lox5 were efficiently lysed in the CML assays the system was expanded to include cell lines that were genetically modified to harbor mitochondrial haplotypes that contain mt ND2 a or mt ND2 c (Chapter 3). From mitochondrial D NA depleted Lox5

PAGE 99

99 0 cells, two cybrid cell lines, Lox5 ND2 a and Lox5 ND2 c were developed to study the contribution of a mitochondrial single nucleotide polymorphism (SNP) in the gene encoding NADH dehydrogenase 2 ( mt ND2 ) The C5178A transversion in mt ND2 correlates with T1D protection in mice and humans (Chapter 3 and [49,181,186,239] ). When Lox5 ND2 c and Lox5 ND2 a cells were incubated with IGRP specific CTL s robust killing of Lox5 ND2 c similar to that observed in the parental Lox5 line, was measured (Fig. 4 3). In contrast, CML assays where Lox5 ND2 a was combined with IGRP reactive CTLs confirmed that, in agreement with mt Nd2 a in mouse [49] mt ND2 a prevented CTL lysis of human cells (Fig. 4 3). Individual analysis of each cell line showed that, like with the parental cell line, CTL killing was more pronounced with IGRP transfecte d cells than with mock transfected CTLs (Data Not Shown). CTL lysis of human cells could occur through one, or a combination, of the following mechanisms: 1) FasL on the C TLs activating the Fas receptor on the target cells, 2) cyto toxic granule release of perforin, granzyme and granulysin molecules into the cells, 3) production of proinflammatory cytokines (soluble or membrane bound) by the CTLs, or 4) damage induced reactive oxygen species (ROS) production within the cells. Previou s mechanistic studies with Lox5 and its derivative cell lines provide some indications as to what the most likely pathway s activated during CTL killing at the time point measured are (Chapter 3 and [29] ) With the exception of cytotoxic granule killing, the other mechanisms of cell death have been explored with Lox5. Significant cell death of Lox5, Lox5 ND2 c and Lox5 ND2 a cells is observed after 48 h of proinflammatory cytokine treatment as well as with agonistic antibody activation of the Fas receptor in combination with IFN

PAGE 100

100 (Chapter 3 and [29] ) Fas induced cell death of Lox5 can be measured as early as 24 h after treatment provided that the cells have been previously primed overnight with IFN (Data Not Shown). However, with incubation times shorter than a 48 h period only live apoptotic cells are detected with proinflammatory cytokines Therefore, it is unlikely that the 16 h CML assa y allows for these pathways to promote significant death in the cells. In fact, analysis of 51 Cr release by Lox5 incubated with Fas antibody and IFN for 16 h did not show measurable differences over untreated c ontrols (Data Not Shown). Nonetheless, the involvement of proinflammatory cytokines cannot be ruled out, as production of these soluble effectors by the CTLs at very close proximity to the cells could increase the local concentration to levels greater than those used in the in vitro assays (Chapter 3 and [29] ), thereby causing more cell damage and death. Perforin is required for the proapoptotic actions of granzyme [261] Human islets incubated with perforin and granzyme B for 16 h show signs of apoptosis as measured by DNA fra gmentation while perforin alone appears to induce necrotic cell death of mouse islets [30] ROS are implicated in the cytotoxicity of granzyme Data from studies using the chronic myelogenous leukemia cell line K562 suggest that granzyme A induces mitochondrial ROS (mtROS) production and caspase independent cell death [262 ] In this study, Lox5 ND2 a cells were better protected the Lox5 ND2 c cells from CTL killing (Fig. 4 3). Resistance to triggers of cell death in Lox5 ND2 a was found to be due to decreased mtROS production within the cells (Chapter 3); therefore, IGRP specific lysis of the cell lines may be due to perforin/granzyme. Consistent with the results reported, assuming that both granzyme A and B contribute equally to cytotoxicity, Lox5 ND2 a cells are not expected to be completely resistant to killing but

PAGE 101

101 the lower levels of mtROS should result in higher viability compared to Lox5 ND2 c cells. These cell lines provide an excellent tool to further study the cytotoxic mechanisms important in T1 D. Although only IGRP 265 273 reactive CD8 + T cells were used to kill the human cell line Lox5 other antigen specific effector cells can also be tested because Lox5 cell express several relevant T1D autoantigens. In conclusion, Lox5 can be utilize d as a target for diabetogenic CTLs not only in studies aiming to understand mechanisms of killing, but also in high throughput assays that test protective molecules, as well as in studies analyzing the contribution of the cell to its own demise.

PAGE 102

102 Figure 4 1. The human cell line Lox5 expresses T1D autoantigens and is primed for immune surveillance A) Expression of T1D autoantigens was analyzed in Lox5 cells as well as in equivalent amounts of human islet preparations (HP60, HP58) B) Overn ight priming of Lox5 cells with low levels of rhIFN increases the expression of HLA A2 molecules compared to untreated control cells. ** denotes statistical significance with a P value < 0.005, P value < 0.05.

PAGE 103

103 Figure 4 2. Lox5 cells are susceptibl e to cytotoxic T cell killing by HLA A0201 restricted IGRP reactive CD8 + T cells. A) Lox5 cells were incubated with purified CD8 + T cells that were transfected to express a TCR specific for the T1D autoantigen IGRP at a 25 to 1 effector to target ratio. In some cases, Lox5 were primed overnight with rh IFN and/or pulsed with IGRP peptide for 30 minutes prior to killing. B) Effector to target ratios (E:T) of 10 t o 1 and 1 to 1 were also tested. ** denotes statistical si gnificance with a P value < 0.01, P value < 0.05. NS denotes no statistical difference.

PAGE 104

104 Figure 4 3 mt ND2 a protects against cytotoxic T cell killing by HLA A0201 restricted IGRP reactive CD8 + T cells. Lox5 ND2 c (black bars) and Lox5 ND2 a (white bars) cells were incubated with purified CD8 + T cells that were transfected to express a TCR specific for the T1D autoantigen IGRP at 25 : 1 10: 1, and 1:1 effector to target ratio s (E:T) Shown here is killing without rh IFN priming or IGRP peptide pulsing. Non specific killing by mock transfected T cells was subtracted from total killing by the IGRP transfected CTLs. denotes statistical significance with a P value < 0.05. NS denotes no statistical difference.

PAGE 105

105 CHAPTER 5 CONCLUSION AND SIGNIFICANCE Type 1 diabetes (T1D) characterized by insulin deficiency result ing from a n autoimmune mediated loss of cell mass and/or function, is clinically manifested as chronic hyperglycemia and acc ompanying metabolic disorders. A primary goal in the field of T1D research has been to identify the mechanisms by which the insulin secreting pancreatic islet cells are functionally inhibited and killed, as well as susceptibility and protective genetic components that may alter diseas e progre ssion in at risk populations. Because the pathological process begins years before clinical diagnosis, e arly detection of risk is crucial in the prevention of deadly complications such as ketoacidosis [263] Equally important is de termining genetic factors that modify cell function and fate in the face of immune insults occurring during disease progression and after islet replacement therapy Genetic remodeling of cells to resist destruction prior to transpl antation could enable long term graft function and minimize the need for and toxicity associated with systemi c immunosuppression, thereby extending the promise of insulin independence to patients other than those with end stage disease [264] Mitochondria are the main sources of energy in eukaryotic cells and are also key regulators of the cell death process. Not surprisingly, mutations in the mitochondrial genome are associated with a range of disea ses, including diabetes [264] However, naturally occurring polymorphisms in mitochondria l DNA (mtDNA) can also lead to desirable phenotypes like longevity and resistance to T1D [181,265 267] A single nucleotide polymorphism (SNP) in the mitochondrially encoded gene NADH dehydrogenase subunit 2 ( mt ND2 ) has been linked with a reduced incidence of T1D in

PAGE 106

106 humans [181] The C/A nucleotide change at position 5178 of mt ND2 causes a leucine to methionine substitution and is found at a lower frequency in T1D patients than in controls [181] The A allele in the orthologous mt Nd2 mouse gene also protects cells from death induced by immune mediators and toxic compounds [49,268] Previous in vitro and in vivo studies suggest that resistance to T1D in the mouse is due to lower oxidative stres s in response to pro death stimuli [268] T he data presented here in indicat e that, similar to the observation with murine systems mt ND2 a protects human cells from destruction by decreasing endogenous mitochondrial reactive oxygen species (mtROS) production when signaled for death. Cytoplasmic hybrid cells, or cybrids, can be created by re introducing m tDNA into cells previously depleted of native mtDNA. This technology has been a central tool in understanding the effects of disease specific mtDNA mutations. Here, the impact of mt ND2 allotypes in the context of T1D has been investigated through the use of cybrid cell technology. From mtDNA depleted Lox5 cells, two cybrid cell lines, Lox5 ND2 c and Lox5 ND2 a were developed. The parental cell line was first found to be susceptible to pro inflammatory cytokine and Fas induced death [29] While Fas mediated cell death occurred in the absence of mtDNA, functional mitochondria were required for optimal pro inflammatory cytokine killing; suggesting th at these organelles are especially important in the cellular response to soluble mediators that are believed to exert their cytotoxicity through the induction of ROS gene ration within the target cell. Indeed, signs of oxidative stress were evident in earl y time points in IFN and TNF treated Lox5 cells before death could be detected [29]

PAGE 107

107 Using the same experimental conditions as with Lox5 cells Lox5 ND2 c and Lox5 ND2 a cells were tested for susceptibility to cytokine and Fas induced death. While, similar to the C allele containing parental cell line, Lox5 ND2 c cells were significantly killed by IFN and TNF (>40% cell death) Lox5 ND2 a cells were more resistant to cytokine induced death (~15% killing) Measurements of mitochondrial ROS production after incubation with IFN and TNF demonstrated that the protective allele resulted in diminished ROS production and resistance to changes in mitochondrial membrane pote ntial. Reduced mitochondrial membrane potential is indicative mitochondrial damage, which may result in the release of apoptogenic factors and loss of oxidative phosphorylation. In agreement with the finding that Fas FasL signaling in Lox5 can occur inde pendent of the mitochondria [29] both Lox5 ND2 c and Lox5 ND2 a cells were killed by Fas receptor activation. However, when compared with Lox5 ND2 c cells, Lox5 ND2 a cells were more resistant to Fas killing and generated a significantly lower level of mitochondrial ROS. These results suggest that in the presence of pro death factors capable of signaling extrinsically, polymorphisms in the mitochondria determine whether ampl ification of the death pathway takes place consequently increasing susceptibi lity or resistance of the cell to the insult. Moreover mt ND2 a was also protective against autoreactive CD8 + T cells, which may utilize a range of cytotoxic mechanisms. Since the classification of T1D as an autoimmune disorder, most studies have focused on the abnor malities of the immune system that lead to cell destruction. The work described here establishes an active role of the cell in T1D development and

PAGE 108

108 encoura ge s further identification of genetic components that change how cells respond to autoimmune attack. Defining these protective pathways may lead to the design of superior cells suitable for transplantation with minimal or no immunosuppression. In add ition, therapies that mimic the downstream effects of the protective mechanisms identified may prevent progression to T1D in individuals at risk.

PAGE 109

109 BIBLIOGRAPHY 1. Schatz D, Cuthbertson D, Atkinson M, Salzler MC, Winter W, et al. (2004) Pre servation of C peptide secretion in subjects at high risk of developing type 1 diabetes mellitus -a new surrogate measure of non progression? Pediatr Diabetes 5: 72 79. 2. In't Veld P (2011) Insulitis in human type 1 diabetes: The quest for an elusive lesi on. Islets 3: 131 138. 3. Hanafusa T, Imagawa A (2008) Insulitis in human type 1 diabetes. Ann N Y Acad Sci 1150: 297 299. 4. Itoh N, Hanafusa T, Miyazaki A, Miyagawa J, Yamagata K, et al. (1993) Mononuclear cell infiltration and its relation to the expres sion of major histocompatibility complex antigens and adhesion molecules in pancreas biopsy specimens from newly diagnosed insulin dependent diabetes mellitus patients. J Clin Invest 92: 2313 2322. 5. Willcox A, Richardson SJ, Bone AJ, Foulis AK, Morgan NG (2009) Analysis of islet inflammation in human type 1 diabetes. Clin Exp Immunol 155: 173 181. 6. Coppieters KT, Dotta F, Amirian N, Campbell PD, Kay TW, et al. (2012) Demonstration of islet autoreactive CD8 T cells in insulitic lesions from recent onset and long term type 1 diabetes patients. J Exp Med 209: 51 60. 7. In't Veld P, Lievens D, De Grijse J, Ling Z, Van der Auwera B, et al. (2007) Screening for insulitis in adult autoantibody positive organ donors. Diabetes 56: 2400 2404. 8. Mathews CE (2005) Utility of murine models for the study of spontaneous autoimmune type 1 diabetes. Pediatr Diabetes 6: 165 177. 9. Bendelac A, Carnaud C, Boitard C, Bach JF (1987) Syngeneic transfer of autoimmune diabetes from diabetic NOD mice to healthy neonates. Require ment for both L3T4+ and Lyt 2+ T cells. J Exp Med 166: 823 832. 10. Makino S, Harada M, Kishimoto Y, Hayashi Y (1986) Absence of insulitis and overt diabetes in athymic nude mice with NOD genetic background. Jikken Dobutsu 35: 495 498. 11. Christianson SW, Shultz LD, Leiter EH (1993) Adoptive transfer of diabetes into immunodeficient NOD scid/scid mice. Relative contributions of CD4+ and CD8+ T cells from diabetic versus prediabetic NOD.NON Thy 1a donors. Diabetes 42: 44 55. 12. Chatenoud L, Thervet E, Prim o J, Bach JF (1994) Anti CD3 antibody induces long term remission of overt autoimmunity in nonobese diabetic mice. Proc Natl Acad Sci U S A 91: 123 127.

PAGE 110

110 13. Parker MJ, Xue S, Alexander JJ, Wasserfall CH, Campbell Thompson ML, et al. (2009) Immune depletion with cellular mobilization imparts immunoregulation and reverses autoimmune diabetes in nonobese diabetic mice. Diabetes 58: 2277 2284. 14. Eizirik DL, Colli ML, Ortis F (2009) The role of inflammation in insulitis and beta cell loss in type 1 diabetes. N at Rev Endocrinol 5: 219 226. 15. Diana J, Gahzarian L, Simoni Y, Lehuen A (2011) Innate immunity in type 1 diabetes. Discov Med 11: 513 520. 16. Thayer TC, Delano M, Liu C, Chen J, Padgett LE, et al. (2011) Superoxide production by macrophages and T cells is critical for the induction of autoreactivity and type 1 diabetes. Diabetes 60: 2144 2151. 17. Wong FS, Wen L, Tang M, Ramanathan M, Visintin I, et al. (2004) Investigation of the role of B cells in type 1 diabetes in the NOD mouse. Diabetes 53: 2581 2587. 18. Pescovitz MD, Greenbaum CJ, Krause Steinrauf H, Becker DJ, Gitelman SE, et al. (2009) Rituximab, B lymphocyte depletion, and preservation of beta cell function. N Engl J Med 361: 2143 2152. 19. Zhang L, Eisenbarth GS (2011) Prediction and pr evention of Type 1 diabetes mellitus. J Diabetes 3: 48 57. 20. Petersen JS, Marshall MO, Baekkeskov S, Hejnaes KR, Hier Madsen M, et al. (1993) Transfer of type 1 (insulin dependent) diabetes mellitus associated autoimmunity to mice with severe combined i mmunodeficiency (SCID). Diabetologia 36: 510 515. 21. Martin S, Wolf Eichbaum D, Duinkerken G, Scherbaum WA, Kolb H, et al. (2001) Development of type 1 diabetes despite severe hereditary B lymphocyte deficiency. N Engl J Med 345: 1036 1040. 22. Scaffidi C Fulda S, Srinivasan A, Friesen C, Li F, et al. (1998) Two CD95 (APO 1/Fas) signaling pathways. EMBO J 17: 1675 1687. 23. Luo X, Budihardjo I, Zou H, Slaughter C, Wang X (1998) Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondr ia in response to activation of cell surface death receptors. Cell 94: 481 490. 24. McKenzie MD, Carrington EM, Kaufmann T, Strasser A, Huang DC, et al. (2008) Proapoptotic BH3 only protein Bid is essential for death receptor induced apoptosis of pancreati c beta cells. Diabetes 57: 1284 1292. 25. Meng XW, Peterson KL, Dai H, Schneider P, Lee SH, et al. (2011) High cell surface death receptor expression determines type I versus type II signaling. J Biol Chem.

PAGE 111

111 26. Darville MI, Eizirik DL (2001) Cytokine induc tion of Fas gene expression in insulin producing cells requires the transcription factors NF kappaB and C/EBP. Diabetes 50: 1741 1748. 27. Yamada K, Takane Gyotoku N, Yuan X, Ichikawa F, Inada C, et al. (1996) Mouse islet cell lysis mediated by interleukin 1 induced Fas. Diabetologia 39: 1306 1312. 28. Amrani A, Verdaguer J, Thiessen S, Bou S, Santamaria P (2000) IL 1alpha, IL 1beta, and IFN gamma mark beta cells for Fas dependent destruction by diabetogenic CD4(+) T lymphocytes. J Clin Invest 105: 459 468. 29. Lightfoot YL, Chen J, Mathews CE (2011) Role of the mitochondria in immune 6: e20617. 30. Estella E, McKenzie MD, Catterall T, Sutton VR, Bird PI, et al. (2006) Granzyme B me diated death of pancreatic beta cells requires the proapoptotic BH3 only molecule bid. Diabetes 55: 2212 2219. 31. Moriwaki M, Itoh N, Miyagawa J, Yamamoto K, Imagawa A, et al. (1999) Fas and Fas ligand expression in inflamed islets in pancreas sections of patients with recent onset Type I diabetes mellitus. Diabetologia 42: 1332 1340. 32. Savinov AY, Tcherepanov A, Green EA, Flavell RA, Chervonsky AV (2003) Contribution of Fas to diabetes development. Proc Natl Acad Sci U S A 100: 628 632. 33. Allison J, T homas HE, Catterall T, Kay TW, Strasser A (2005) Transgenic expression of dominant negative Fas associated death domain protein in beta cells protects against Fas ligand induced apoptosis and reduces spontaneous diabetes in nonobese diabetic mice. J Immuno l 175: 293 301. 34. Suarez Pinzon WL, Power RF, Rabinovitch A (2000) Fas ligand mediated mechanisms are involved in autoimmune destruction of islet beta cells in non obese diabetic mice. Diabetologia 43: 1149 1156. 35. Kgi D, Odermatt B, Seiler P, Zinkern agel RM, Mak TW, et al. (1997) Reduced incidence and delayed onset of diabetes in perforin deficient nonobese diabetic mice. J Exp Med 186: 989 997. 36. Skowera A, Ellis RJ, Varela Calvio R, Arif S, Huang GC, et al. (2008) CTLs are targeted to kill beta c ells in patients with type 1 diabetes through recognition of a glucose regulated preproinsulin epitope. J Clin Invest 118: 3390 3402. 37. Campbell PD, Estella E, Dudek NL, Jhala G, Thomas HE, et al. (2008) Cytotoxic T lymphocyte mediated killing of human p ancreatic islet cells in vitro. Hum Immunol 69: 543 551.

PAGE 112

112 38. Mollah ZU, Wali J, McKenzie MD, Krishnamurthy B, Graham KL, et al. (2011) The pro apoptotic BH3 only protein Bid is dispensable for development of insulitis and diabetes in the non obese diabetic mouse. Apoptosis 16: 822 830. 39. Anderson B, Park BJ, Verdaguer J, Amrani A, Santamaria P (1999) Prevalent CD8(+) T cell response against one peptide/MHC complex in autoimmune diabetes. Proc Natl Acad Sci U S A 96: 9311 9316. 40. Verdaguer J, Yoon JW, An derson B, Averill N, Utsugi T, et al. (1996) Acceleration of spontaneous diabetes in TCR beta transgenic nonobese diabetic mice by beta cell cytotoxic CD8+ T cells expressing identical endogenous TCR alpha chains. J Immunol 157: 4726 4735. 41. Lieberman SM Evans AM, Han B, Takaki T, Vinnitskaya Y, et al. (2003) Identification of the beta cell antigen targeted by a prevalent population of pathogenic CD8+ T cells in autoimmune diabetes. Proc Natl Acad Sci U S A 100: 8384 8388. 42. Amrani A, Verdaguer J, Ande rson B, Utsugi T, Bou S, et al. (1999) Perforin independent beta cell destruction by diabetogenic CD8(+) T lymphocytes in transgenic nonobese diabetic mice. J Clin Invest 103: 1201 1209. 43. Dudek NL, Thomas HE, Mariana L, Sutherland RM, Allison J, et al. (2006) Cytotoxic T cells from T cell receptor transgenic NOD8.3 mice destroy beta cells via the perforin and Fas pathways. Diabetes 55: 2412 2418. 44. McKenzie MD, Dudek NL, Mariana L, Chong MM, Trapani JA, et al. (2006) Perforin and Fas induced by IFNgamm a and TNFalpha mediate beta cell death by OT I CTL. Int Immunol 18: 837 846. 45. Hohmeier HE, Newgard CB (2004) Cell lines derived from pancreatic islets. Mol Cell Endocrinol 228: 121 128. 46. Hamaguchi K, Gaskins HR, Leiter EH (1991) NIT 1, a pancreatic beta cell line established from a transgenic NOD/Lt mouse. Diabetes 40: 842 849. 47. Gusdon AM, Votyakova TV, Mathews CE (2008) mt Nd2a suppresses reactive oxygen species production by mitochondrial complexes I and III. J Biol Chem 283: 10690 10697. 48. Gu sdon AM, Votyakova TV, Reynolds IJ, Mathews CE (2007) Nuclear and mitochondrial interaction involving mt Nd2 leads to increased mitochondrial reactive oxygen species production. J Biol Chem 282: 5171 5179. 49. Chen J, Gusdon AM, Piganelli J, Leiter EH, Mat hews CE (2011) mt Nd2(a) Modifies resistance against autoimmune type 1 diabetes in NOD mice at the level of the cell. Diabetes 60: 355 359.

PAGE 113

113 50. Thomas HE, Darwiche R, Corbett JA, Kay TW (1999) Evidence that beta cell death in the nonobese diab etic mouse is Fas independent. J Immunol 163: 1562 1569. 51. Rasche S, Busick RY, Quinn A (2009) GAD65 Specific Cytotoxic T Lymphocytes Mediate Beta Cell Death and Loss of Function. Rev Diabet Stud 6: 43 53. 52. Mallone R, Brezar V, Boitard C (2011) T cell recognition of autoantigens in human type 1 diabetes: clinical perspectives. Clin Dev Immunol 2011: 513210. 53. Soldevila G, Buscema M, Marini V, Sutton R, James RF, et al. (1991) Transfection with SV40 gene of human pancreatic endocrine cells. J Autoimmu n 4: 381 396. 54. Gueli N TA, Palmieri G, Carmenini G, Delpino A, Ferrini U (1987) In vitro growth of a cell line originated from a human insulinoma. Journal of experimental & clinical cancer research 6: 281. 55. Macfarlane WM, Cragg H, Docherty HM, Read ML, James RF, et al. (1997) Impaired expression of transcription factor IUF1 in a pancreatic beta cell line derived from a patient with persistent hyperinsulinaemic hypoglycaemia of infancy (nesidioblastosis). FEBS Lett 413: 304 308. 56. Halvorsen TL, Leib owitz G, Levine F (1999) Telomerase activity is sufficient to allow transformed cells to escape from crisis. Mol Cell Biol 19: 1864 1870. 57. Narushima M, Kobayashi N, Okitsu T, Tanaka Y, Li SA, et al. (2005) A human beta cell line for transplantation ther apy to control type 1 diabetes. Nat Biotechnol 23: 1274 1282. 58. Ravassard P, Hazhouz Y, Pechberty S, Bricout Neveu E, Armanet M, et al. (2011) A inducible insulin secretion. J Clin In vest 121: 3589 3597. 59. Soldevila G, Buscema M, Doshi M, James R, Bottazzo G, et al. (1991) Cytotoxic effect of IFN gamma plus TNF alpha on human islet cells. J Autoimmun 4: 291 306. 60. Vives M, Soldevila G, Alcalde L, Lorenzo C, Somoza N, et al. (1991) Adhesion molecules in human islet beta cells. De novo induction of ICAM 1 but not LFA 3. Diabetes 40: 1382 1390. 61. Vives Pi M, Somoza N, Fernndez Alvarez J, Vargas F, Caro P, et al. (2003) Evidence of expression of endotoxin receptors CD14, toll like re ceptors TLR4 and TLR2 and associated molecule MD 2 and of sensitivity to endotoxin (LPS) in islet beta cells. Clin Exp Immunol 133: 208 218. 62. Muoz A, Gallart T, Gomis R (1992) Analysis of islet cell antibodies reactivity to a human islet cell line. J E ndocrinol Invest 15: 109 112.

PAGE 114

114 63. Ou D, Metzger DL, Wang X, Pozzilli P, Tingle AJ (2002) beta cell antigen specific CD56(+) NKT cells from type 1 diabetic patients: autoaggressive effector T cells damage human CD56(+) beta cells by HLA restricted and non H LA restricted pathways. Hum Immunol 63: 256 270. 64. Ou D, Metzger DL, Wang X, Huang J, Pozzilli P, et al. (2002) TNF related apoptosis inducing ligand death pathway mediated human beta cell destruction. Diabetologia 45: 1678 1688. 65. Ou D, Wang X, Metzge r DL, Ao Z, Pozzilli P, et al. (2006) Suppression of human T cell responses to beta cells by activation of B7 H4 pathway. Cell Transplant 15: 399 410. 66. Cavallo MG, Dotta F, Monetini L, Dionisi S, Previti M, et al. (1996) Beta cell markers and autoantige n expression by a human insulinoma cell line: similarities to native beta cells. J Endocrinol 150: 113 120. 67. Baroni MG, Cavallo MG, Mark M, Monetini L, Stoehrer B, et al. (1999) Beta cell gene expression and functional characterisation of the human insu linoma cell line CM. J Endocrinol 161: 59 68. 68. Monetini L, Cavallo MG, Barone F, Valente L, Russo M, et al. (1999) T cell reactivity to human insulinoma cell line (CM) antigens in patients with type 1 diabetes. Autoimmunity 29: 171 177. 69. Schwingshack l A, Blasko I, Steiner E, Pozzilli P, Cavallo MG, et al. (1998) Sex steroids do not prevent amylin induced apoptosis in human cells. Exp Cell Res 241: 265 268. 70. Cavallo MG, Monetini L, Valente L, Barone F, Beales P, et al. (1997) Glutathione protects a human insulinoma cell line from tumor necrosis factor alpha mediated cytotoxicity. Int J Clin Lab Res 27: 44 47. 71. Ou D, Jonsen LA, Metzger DL, Tingle AJ (1999) CD4+ and CD8+ T cell clones from congenital rubella syndrome patients with IDDM recognize ove rlapping GAD65 protein epitopes. Implications for HLA class I and II allelic linkage to disease susceptibility. Hum Immunol 60: 652 664. 72. Burkart V, Liu H, Bellmann K, Wissing D, Jaattela M, et al. (2000) Natural resistance of human beta cells toward ni tric oxide is mediated by heat shock protein 70. J Biol Chem 275: 19521 19528. 73. Dorff G, Meyer G, Krone D, Pozzilli P, Zuhlke H (2002) Neuronal NO synthase and its inhibitor PIN are present and influenced by glucose in the human beta cell line CM and in rat INS 1 cells. Biol Chem 383: 1357 1361.

PAGE 115

115 74. Monetini L, Barone F, Stefanini L, Petrone A, Walk T, et al. (2003) Establishment of T cell lines to bovine beta casein and beta casein derived epitopes in patients with type 1 diabetes. J Endocrinol 176: 143 150. 75. Ou D, Wang X, Metzger DL, Robbins M, Huang J, et al. (2005) Regulation of TNF related apoptosis inducing ligand mediated death signal pathway in human beta cells by Fas associated death domain and nuclear factor kappaB. Hum Immunol 66: 799 809. 7 6. Ou D, Wang X, Metzger DL, James RF, Pozzilli P, et al. (2005) Synergistic inhibition of tumor necrosis factor related apoptosis inducing ligand induced apoptosis in human pancreatic beta cells by Bcl 2 and X linked inhibitor of apoptosis. Hum Immunol 66 : 274 284. 77. Jonnakuty C, Gragnoli C (2007) Karyotype of the human insulinoma CM cell line -beta cell model in vitro? J Cell Physiol 213: 661 662. 78. Gragnoli C (2008) The CM cell line derived from liver metastasis of malignant human insulinoma is not a valid beta cell model for in vitro studies. J Cell Physiol 216: 569 570. 79. Cavallo MG, Pozzilli P, Misiti S, Baroni MG (2008) Insulinoma CM cell line as in vitro model for beta cell. J Cell Physiol 216: 568. 80. Macfarlane WM, Shepherd RM, Cosgrove KE, James RF, Dunne MJ, et al. (2000) Glucose modulation of insulin mRNA levels is dependent on transcription factor PDX 1 and occurs independently of changes in intracellular Ca2+. Diabetes 49: 418 423. 81. Macfarlane WM, Campbell SC, Elrick LJ, Oates V, Berm ano G, et al. (2000) Glucose regulates islet amyloid polypeptide gene transcription in a PDX1 and calcium dependent manner. J Biol Chem 275: 15330 15335. 82. Macfarlane WM, O'Brien RE, Barnes PD, Shepherd RM, Cosgrove KE, et al. (2000) Sulfonylurea recept or 1 and Kir6.2 expression in the novel human insulin secreting cell line NES2Y. Diabetes 49: 953 960. 83. Cosgrove KE, Straub SG, Barnes PD, Chapman J, Sharp GW, et al. (2004) Y 26763: ATP sensitive K+ channel activation and the inhibition of insulin rele ase from human pancreatic beta cells. Eur J Pharmacol 486: 133 139. 84. MacFarlane WM, Chapman JC, Shepherd RM, Hashmi MN, Kamimura N, et al. (1999) Engineering a glucose responsive human insulin secreting cell line from islets of Langerhans isolated from a patient with persistent hyperinsulinemic hypoglycemia of infancy. J Biol Chem 274: 34059 34066.

PAGE 116

116 85. Macfarlane WM, Frayling TM, Ellard S, Evans JC, Allen LI, et al. (2000) Missense mutations in the insulin promoter factor 1 gene predispose to type 2 diab etes. J Clin Invest 106: 717. 86. Weng J, Macfarlane WM, Lehto M, Gu HF, Shepherd LM, et al. (2001) Functional consequences of mutations in the MODY4 gene (IPF1) and coexistence with MODY3 mutations. Diabetologia 44: 249 258. 87. Frstova V, Kopska T, Jame s RF, Kovar J (2008) Comparison of the effect of individual saturated and unsaturated fatty acids on cell growth and death induction in the human pancreatic beta cell line NES2Y. Life Sci 82: 684 691. tory effect of unsaturated fatty acids on saturated fatty acid cells: activation of caspases and ER stress induction. Cell Physiol Biochem 27: 525 538. 89. Tree TI, O'Byrne D, Tremble JM, MacFarlane WM, Haskins K, et al. (2000) Evidence for recognition of novel islet T cell antigens by granule specific T cell lines from new onset type 1 diabetic patients. Clin Exp Immunol 121: 100 105. 90. Adams GG, Uddin A, Vives Pi M, Pujol Borrell R, James RF (2009) Characterisatio n of the NES2Y cell line and its use in the production of human glucose responsive insulin producing (hGRIP) cell lines by cell cell fusion. Islets 1: 117 123. 91. de la Tour D, Halvorsen T, Demeterco C, Tyrberg B, Itkin Ansari P, et al. (2001) Beta cell d ifferentiation from a human pancreatic cell line in vitro and in vivo. Mol Endocrinol 15: 476 483. 92. Itkin Ansari P, Geron I, Hao E, Demeterco C, Tyrberg B, et al. (2003) Cell based therapies for diabetes: progress towards a transplantable human beta cel l line. Ann N Y Acad Sci 1005: 138 147. 93. Lenzen S, Brand FH, Panten U (1988) Structural requirements of alloxan and ninhydrin for glucokinase inhibition and of glucose for protection against inhibition. Br J Pharmacol 95: 851 859. 94. Lenzen S, Tiedge M Panten U (1987) Glucokinase in pancreatic B cells and its inhibition by alloxan. Acta Endocrinol (Copenh) 115: 21 29. 95. Lenzen S, Freytag S, Panten U (1988) Inhibition of glucokinase by alloxan through interaction with SH groups in the sugar binding si te of the enzyme. Mol Pharmacol 34: 395 400. 96. Lenzen S, Munday R (1991) Thiol group reactivity, hydrophilicity and stability of alloxan, its reduction products and its N methyl derivatives and a comparison with ninhydrin. Biochem Pharmacol 42: 1385 1391

PAGE 117

117 97. Lenzen S, Mirzaie Petri M (1992) Inhibition of aconitase by alloxan and the differential modes of protection of glucose, 3 O methylglucose, and mannoheptulose. Naunyn Schmiedebergs Arch Pharmacol 346: 532 536. 98. Grankvist K, Marklund S, Sehlin J, T ljedal I B (1979) Superoxide dismutase, catalase and scavengers of hydroxyl radicals protect against toxic action of alloxan on pancreatic islet cells in vitro Biochemical Journal 182: 17 25. 99. Grankvist K, Marklund SL, Taljedal IB (1981) CuZn superoxide dismutase, Mn superoxide dismutase, catalase and glutathione peroxidase in pancreatic islets and other tissues in the mouse. Biochem J 199: 393 398. 100. Grankvist K, Marklund S, Taljedal IB (1981) Superoxide dismutase is a prophylactic aga inst alloxan diabetes. Nature 294: 158 160. 101. Asplund K, Grankvist K, Marklund S, Taljedal IB (1984) Partial protection against streptozotocin induced hyperglycaemia by superoxide dismutase linked to polyethylene glycol. Acta Endocrinol (Copenh) 107: 390 394. 102. Lenzen S, Drinkgern J, Tiedge M (1996) Low antioxidant enzyme gene expression in pancreatic islets compared with various other mouse tissues. Free Rad Biol Med 20: 463 466. 103. Tiedge M, Lortz S, Drinkgeer J, Lenzen S (1997) Relation between antioxidant enzyme gene expression and antioxidative defense status of insulin producing cells. Diabetes 46: 1733 1742. 104. Tiedge M, Lortz S, Munday R, Lenzen S (1998) Complementary action of antioxidant enzymes in the protection of bioengineered insuli n producing rinm5f cells against the toxicity of reactive oxygen species. Diabetes 47: 1578 1585. 105. Mathews CE, Leiter EH (1999) Constitutive differences in anti oxidant defense status distinguish Alloxan Resistant (ALR/Lt) and Alloxan Susceptible (ALS/ Lt) mice. Free Radical Biology and Medicine 27: 449 455. 106. Mathews CE, Leiter EH (1999) Resistance of ALR/Lt Islets to free radical mediated diabetogenic stress is inherited as a dominant trait. Diabetes 48: 2189 2196. 107. Mathews CE, Suarez Pinzon WL, Baust JJ, Strynadka K, Leiter EH, et al. (2005) Mechanisms Underlying Resistance of Pancreatic Islets from ALR/Lt Mice to Cytokine Induced Destruction. J Immunol 175: 1248 1256. 108. Chen H, Li X, Epstein PN (2005) MnSOD and catalase transgenes demonstrat e that protection of islets from oxidative stress does not alter cytokine toxicity. Diabetes 54: 1437 1446.

PAGE 118

118 109. Li X, Chen H, Epstein PN (2006) Metallothionein and catalase sensitize to diabetes in nonobese diabetic mice: reactive oxygen species may have a protective role in pancreatic beta cells. Diabetes 55: 1592 1604. 110. Mathews CE, Graser RT, Savinov AY, Serreze DV, Leiter EH (2001) Unusual resistance of ALR/Lt beta cells to autoimmune destruction: Role for beta cell expressed resistance determinant s. Proc Natl Acad Sci 98: 235 240. 111. Foulis AK, McGill M, Farquharson MA (1991) Insulitis in type 1 (insulin dependent) diabetes mellitus in man -macrophages, lymphocytes, and interferon gamma containing cells. J Pathol 165: 97 103 issn: 0022 3417. 112. Foulis AK (1996) The pathology of the endocrine pancreas in type 1 (insulin dependent) diabetes mellitus. APMIS 104: 161 167. 113. Kroncke KD, Kolb Bachofen V, Berschick B, Burkart V, Kolb H (1991) Activated macrophages kill pancreatic syngeneic islet cel ls via arginine dependent nitric oxide generation. Biochem Biophys Res Commun 175: 752 758. 114. Schwizer RW, Leiter EH, Evans R (1984) Macrophage mediated cytotoxicity against cultured pancreatic islet cells. Transplantation 37: 539 544. 115. Sandler S, E izirik DL, Sternesjo J, Welsh N (1994) Role of cytokines in regulation of pancreatic B cell function. Biochem Soc Trans 22: 26 30. 116. Corbett JA, McDaniel ML (1994) Reversibility of interleukin 1 beta induced islet destruction and dysfunction by the inhi bition of nitric oxide synthase. Biochem J 299 ( Pt 3): 719 724. 117. Scarim AL, Heitmeier MR, Corbett JA (1997) Irreversible inhibition of metabolic function and islet destruction after a 36 hour exposure to interleukin 1beta. Endocrinology 138: 5301 5307 118. Augstein P, Heinke P, Salzsieder E, Grimm R, Giebel J, et al. (2008) Dominance of cytokine over FasL induced impairment of the mitochondrial transmembrane potential (Deltapsim) in the pancreatic beta cell line NIT 1. Diab Vasc Dis Res 5: 198 204. 1 19. Steer SA, Scarim AL, Chambers KT, Corbett JA (2005) Interleukin 1 Stimulates beta Cell Necrosis and Release of the Immunological Adjuvant HMGB1. PLoS Med 3: e17. 120. Hughes KJ, Chambers KT, Meares GP, Corbett JA (2009) Nitric oxides mediates a shift f rom early necrosis to late apoptosis in cytokine treated {beta} cells that is associated with irreversible DNA damage. Am J Physiol Endocrinol Metab 297: E1187 E1196.

PAGE 119

119 121. Rabinovitch A, Suarez WL, Thomas PD, Strynadka K, Simpson I (1992) Cytotoxic effects of cytokines on rat islets: evidence for involvement of free radicals and lipid peroxidation. Diabetologia 35: 409 413. 122. Rabinovitch A, Sumoski W, Rajotte RV, Warnock GL (1990) Cytotoxic effects of cytokines on human pancreatic islet cells in monolaye r culture. J Clin Endocrinol Metab 71: 152 156. 123. Nerup J, Mandrup Poulsen T, Helqvist S, Andersen HU, Pociot F, et al. (1994) On the pathogenesis of IDDM. Diabetologia 37 Suppl 2: S82 89. 124. Corbett JA, McDaniel ML (1995) Intraislet release of interl eukin 1 inhibits beta cell function by inducing beta cell expression of inducible nitric oxide synthase. J Exp Med 181: 559 568. 125. Rabinovitch A, Suarez Pinzon WL (1998) Cytokines and their roles in pancreatic islet beta cell destruction and insulin dep endent diabetes mellitus. Biochem Pharmacol 55: 1139 1149. 126. Uno S, Imagawa A, Okita K, Sayama K, Moriwaki M, et al. (2007) Macrophages and dendritic cells infiltrating islets with or without beta cells produce tumour necrosis factor alpha in patients w ith recent onset type 1 diabetes. Diabetologia 50: 596 601. 127. Rabinovitch A (1998) An update on cytokines in the pathogenesis of insulin dependent diabetes mellitus. Diabetes Metab Rev 14: 129 151. 128. Rabinovitch A, Suarez Pinzon WL, Sorensen O, Bleac kley RC (1996) Inducible nitric oxide synthase (iNOS) in pancreatic islets of nonobese diabetic mice: identification of iNOS expressing cells and relationships to cytokines expressed in the islets. Endocrinology 137: 2093 2099. 129. Rabinovitch A, Suarez Pinzon W, El Sheikh A, Sorensen O, Power RF (1996) Cytokine gene expression in pancreatic islet infiltrating leukocytes of BB rats: expression of Th1 cytokines correlates with beta cell destructive insulitis and IDDM. Diabetes 45: 749 754. 130. Mand rup Poulsen T, Corbett JA, McDaniel ML, Nerup J (1993) What are the types and cellular sources of free radicals in the pathogenesis of type 1 (insulin dependent) diabetes mellitus? Diabetologia 36: 470 471. 131. Corbett JA, Kwon G, Turk J, McDaniel ML (199 3) IL 1 beta induces the coexpression of both nitric oxide synthase and cyclooxygenase by islets of Langerhans: activation of cyclooxygenase by nitric oxide. Biochemistry 32: 13767 13770.

PAGE 120

120 132. Takamura T, Kato I, Kimura N, Nakazawa T, Yonekura H, et al. (1 998) Transgenic mice overexpressing type 2 nitric oxide synthase in pancreatic beta cells develop insulin dependent diabetes without insulitis. J Biol Chem 273: 2493 2496. 133. Oliveira HR, Verlengia R, Carvalho CR, Britto LR, Curi R, et al. (2003) Pancrea tic beta cells express phagocyte like NAD(P)H oxidase. Diabetes 52: 1457 1463. 134. Morgan D, Oliveira Emilio HR, Keane D, Hirata AE, Santos da Rocha M, et al. (2007) Glucose, palmitate and pro inflammatory cytokines modulate production and activity of a p hagocyte like NADPH oxidase in rat pancreatic islets and a clonal beta cell line. Diabetologia 50: 359 369. 135. Newsholme P, Morgan D, Rebelato E, Oliveira Emilio HC, Procopio J, et al. (2009) Insights into the critical role of NADPH oxidase(s) in the nor mal and dysregulated pancreatic beta cell. Diabetologia 52: 2489 2498. 136. Suarez Pinzon WL, Strynadka K, Rabinovitch A (1996) Destruction of rat pancreatic islet beta cells by cytokines involves the production of cytotoxic aldehydes. Endocrinology 137: 5 290 5296. 137. Mehmeti I, Gurgul Convey E, Lenzen S, Lortz S (2011) Induction of the intrinsic apoptosis pathway in insulin secreting cells is dependent on oxidative damage of mitochondria but independent of caspase 12 activation. Biochim Biophys Acta 1813 : 1827 1835. 138. Liu D, Pavlovic D, Chen MC, Flodstrom M, Sandler S, et al. (2000) Cytokines induce apoptosis in beta cells isolated from mice lacking the inducible isoform of nitric oxide synthase (iNOS / ). Diabetes 49: 1116 1122. 139. Steer SA, Scarim AL, Chambers KT, Corbett JA (2006) Interleukin 1 stimulates beta cell necrosis and release of the immunological adjuvant HMGB1. PLoS Med 3: e17. 140. Corbett JA, Sweetland MA, Wang JL, Lancaster JR, McDaniel ML (1993) Nitric oxide mediates cytokine induced inhibition of insulin secretion by human islets of Langerhans. Proc Natl Acad Sci U S A 90: 1731 1735. 141. Rabinovitch A, Suarez Pinzon W, Strynadka K, Schulz R, Lakey J, et al. (1994) Human pancreatic islet beta cell destruction by cytokines is independ ent of nitric oxide production. J Clin Endocrinol Metab 79: 1058 1062. 142. Welsh N, Margulis B, Borg LA, Wiklund HJ, Saldeen J, et al. (1995) Differences in the expression of heat shock proteins and antioxidant enzymes between human and rodent pancreatic islets: implications for the pathogenesis of insulin dependent diabetes mellitus. Mol Med 1: 806 820.

PAGE 121

121 143. Scarim AL, Heitmeier MR, Corbett JA (1998) Heat shock inhibits cytokine induced nitric oxide synthase expression by rat and human islets. Endocrinolo gy 139: 5050 5057. 144. Bellmann K, Wenz A, Radons J, Burkart V, Kleemann R, et al. (1995) Heat shock induces resistance in rat pancreatic islet cells against nitric oxide, oxygen radicals and streptozotocin toxicity in vitro. J Clin Invest 95: 2840 2845. 145. Grunnet L, Aikin R, Tonnesen M, Paraskevas S, Blaabjerg L, et al. (2009) Proinflammatory cytokines activate the intrinsic apoptotic pathway in beta cells. Diabetes 58: 1807 1815. 146. Irawaty W, Kay TW, Thomas HE (2002) Transmembrane TNF and IFNgamma induce caspase independent death of primary mouse pancreatic beta cells. Autoimmunity 35: 369 375. 147. Sarkar SA, Kutlu B, Velmurugan K, Kizaka Kondoh S, Lee CE, et al. (2009) Cytokine mediated induction of anti apoptotic genes that are linked to nuclear factor kappa B (NF kappaB) signalling in human islets and in a mouse beta cell line. Diabetologia 52: 1092 1101. 148. Oyadomari S, Takeda K, Takiguchi M, Gotoh T, Matsumoto M, et al. (2001) Nitric oxide induced apoptosis in pancreatic beta cells is mediate d by the endoplasmic reticulum stress pathway. Proc Natl Acad Sci U S A 98: 10845 10850. 149. Akerfeldt MC, Howes J, Chan JY, Stevens VA, Boubenna N, et al. (2008) Cytokine induced beta cell death is independent of endoplasmic reticulum stress signaling. D iabetes 57: 3034 3044. Cell Death in Response to Pro Inflammatory Cytokines Is Distinct from Genuine Apoptosis. PLoS One 6: e22485. 151. Gusdon AM, Corbett JA, Mathews CE ( 2006) Type 1 diabetes: Islet inflammation the contribution of cytokines and beta cells. Drug Discovery Today: Disease Mechanisms 3: 367 372. 152. Jun HS, Yoon CS, Zbytnuik L, van Rooijen N, Yoon JW (1999) The role of macrophages in T cell mediated autoim mune diabetes in nonobese diabetic mice. J Exp Med 189: 347 358. 153. Stewart TA, Hultgren B, Huang X, Pitts Meek S, Hully J, et al. (1993) Induction of type I diabetes by interferon alpha in transgenic mice. Science 260: 1942 1946. 154. Pelegrin M, Devedj ian JC, Costa C, Visa J, Solanes G, et al. (1998) Evidence from transgenic mice that interferon beta may be involved in the onset of diabetes mellitus. J Biol Chem 273: 12332 12340.

PAGE 122

122 155. Alba A, Puertas MC, Carrillo J, Planas R, Ampudia R, et al. (2004) IF N beta accelerates autoimmune type 1 diabetes in nonobese diabetic mice and breaks the tolerance to beta cells in nondiabetes prone mice. J Immunol 173: 6667 6675. 156. Hultgren B, Huang X, Dybdal N, Stewart TA (1996) Genetic absence of gamma interferon de lays but does not prevent diabetes in NOD mice. Diabetes 45: 812 817. 157. Sarvetnick N, Shizuru J, Liggitt D, Martin L, McIntyre B, et al. (1990) Loss of pancreatic islet tolerance induced by beta cell expression of interferon gamma. Nature 346: 844 847. 158. Devendra D, Eisenbarth GS (2004) Interferon alpha -a potential link in the pathogenesis of viral induced type 1 diabetes and autoimmunity. Clin Immunol 111: 225 233. 159. Thomas HE, Irawaty W, Darwiche R, Brodnicki TC, Santamaria P, et al. (2004) IL 1 receptor deficiency slows progression to diabetes in the NOD mouse. Diabetes 53: 113 121. 160. Schott WH, Haskell BD, Tse HM, Milton MJ, Piganelli JD, et al. (2004) Caspase 1 is not required for type 1 diabetes in the NOD mouse. Diabetes 53: 99 104. 161. Christen U, Wolfe T, Mhrle U, Hughes AC, Rodrigo E, et al. (2001) A dual role for TNF alpha in type 1 diabetes: islet specific expression abrogates the ongoing autoimmune process when induced late but not early during pathogenesis. J Immunol 166: 7023 703 2. 162. Grinberg Bleyer Y, Saadoun D, Baeyens A, Billiard F, Goldstein JD, et al. (2010) Pathogenic T cells have a paradoxical protective effect in murine autoimmune diabetes by boosting Tregs. J Clin Invest 120: 4558 4568. 163. Maechler P, Wollheim CB (20 00) Mitochondrial signals in glucose stimulated insulin secretion in the beta cell. J Physiol 529 Pt 1: 49 56. 164. Wiederkehr A, Wollheim CB (2006) Minireview: implication of mitochondria in insulin secretion and action. Endocrinology 147: 2643 2649. 165. Rabinovitch A, Suarez Pinzon W, Strynadka K, Ju Q, Edelstein D, et al. (1999) Transfection of human pancreatic islets with an anti apoptotic gene (bcl 2) protects beta cells from cytokine induced destruction. Diabetes 48: 1223 1229. 166. Barthson J, Germa no CM, Moore F, Maida A, Drucker DJ, et al. (2011) Tumor necrosis factor {alpha} and interferon {gamma} induce pancreatic {beta} cell apoptosis through STAT1 mediated Bim activation. J Biol Chem.

PAGE 123

123 167. Gurzov EN, Germano CM, Cunha DA, Ortis F, Vanderwinden JM, et al. (2010) p53 up regulated modulator of apoptosis (PUMA) activation contributes to pancreatic beta cell apoptosis induced by proinflammatory cytokines and endoplasmic reticulum stress. J Biol Chem 285: 19910 19920. 168. Borutaite V, Brown GC (2001) Caspases are reversibly inactivated by hydrogen peroxide. FEBS Lett 500: 114 118. 169. Hampton MB, Orrenius S (1997) Dual regulation of caspase activity by hydrogen peroxide: implications for apoptosis. FEBS Lett 414: 552 556. 170. Harris H (1949) The fam ilial distribution of diabetes mellitus: a study of the relatives of 1241 diabetic propositi. Annals of Human Genetics 15: 25. 171. Polychronakos C, Li Q (2011) Understanding type 1 diabetes through genetics: advances and prospects. Nat Rev Genet 12: 781 7 92. 172. Ettinger RA, Papadopoulos GK, Moustakas AK, Nepom GT, Kwok WW (2006) Allelic variation in key peptide binding pockets discriminates between closely related diabetes protective and diabetes susceptible HLA DQB1*06 alleles. J Immunol 176: 1988 1998. 173. Todd JA, Bell JI, McDevitt HO (1987) HLA DQ beta gene contributes to susceptibility and resistance to insulin dependent diabetes mellitus. Nature 329: 599 604. 174. Ettinger RA, Liu AW, Nepom GT, Kwok WW (2000) Beta 57 Asp plays an essential role in the unique SDS stability of HLA DQA1*0102/DQB1*0602 alpha beta protein dimer, the class II MHC allele associated with protection from insulin dependent diabetes mellitus. J Immunol 165: 3232 3238. 175. Fennessy M, Metcalfe K, Hitman GA, Niven M, Biro PA, e t al. (1994) A gene in the HLA class I region contributes to susceptibility to IDDM in the Finnish population. Childhood Diabetes in Finland (DiMe) Study Group. Diabetologia 37: 937 944. 176. Demaine AG, Hibberd ML, Mangles D, Millward BA (1995) A new mark er in the HLA class I region is associated with the age at onset of IDDM. Diabetologia 38: 623 628. 177. Robles DT, Eisenbarth GS, Wang T, Erlich HA, Bugawan TL, et al. (2002) Millennium award recipient contribution. Identification of children with early o nset and high incidence of anti islet autoantibodies. Clin Immunol 102: 217 224. 178. Velthuis JH, Unger WW, Abreu JR, Duinkerken G, Franken K, et al. (2010) Simultaneous detection of circulating autoreactive CD8+ T cells specific for different islet cell associated epitopes using combinatorial MHC multimers. Diabetes 59: 1721 1730.

PAGE 124

124 179. Eller E, Vardi P, Daly MJ, Babu S, Roberts C, et al. (2004) IDDM17: polymorphisms in the AMACO gene are associated with dominant protection against type 1A diabetes in a Be douin Arab family. Ann N Y Acad Sci 1037: 145 149. 180. Ma J, Mllsten A, Przny M, Falhammar H, Brismar K, et al. (2006) Genetic influences of the intercellular adhesion molecule 1 (ICAM 1) gene polymorphisms in development of Type 1 diabetes and diabetic nephropathy. Diabet Med 23: 1093 1099. 181. Uchigata Y, Okada T, Gong JS, Yamada Y, Iwamoto Y, et al. (2002) A mitochondrial genotype associated with the development of autoimmune related type 1 diabetes. Diabetes Care 25: 2106. 182. Vafiadis P, Bennett S T, Todd JA, Nadeau J, Grabs R, et al. (1997) Insulin expression in human thymus is modulated by INS VNTR alleles at the IDDM2 locus. Nat Genet 15: 289 292. 183. Pugliese A, Zeller M, Fernandez A, Zalcberg LJ, Bartlett RJ, et al. (1997) The insulin gene is transcribed in the human thymus and transcription levels correlated with allelic variation at the INS VNTR IDDM2 susceptibility locus for type 1 diabetes. Nat Genet 15: 293 297. 184. Fiorillo E, Orr V, Stanford SM, Liu Y, Salek M, et al. (2010) Autoimmune associated PTPN22 R620W variation reduces phosphorylation of lymphoid phosphatase on an inhibitory tyrosine residue. J Biol Chem 285: 26506 26518. 185. Yamanouchi J, Rainbow D, Serra P, Howlett S, Hunter K, et al. (2007) Interleukin 2 gene variation impairs regulatory T cell function and causes autoimmunity. Nat Genet 39: 329 337. 186. Mathews CE, Leiter EH, Spirina O, Bykhovskaya Y, Gusdon AM, et al. (2005) mt Nd2 Allele of the ALR/Lt mouse confers resistance against both chemically induced and autoi mmune diabetes. Diabetologia 48: 261 267. 187. Imagawa A, Hanafusa T, Tamura S, Moriwaki M, Itoh N, et al. (2001) Pancreatic biopsy as a procedure for detecting in situ autoimmune phenomena in type 1 diabetes: close correlation between serological markers and histological evidence of cellular autoimmunity. Diabetes 50: 1269 1273. 188. Eizirik DL, Mandrup Poulsen T (2001) A choice of death -the signal transduction of immune mediated beta cell apoptosis. Diabetologia 44: 2115 2133. m M, Sandler S (2001) Cytokine induced inhibition of insulin release from mouse pancreatic beta cells deficient in inducible nitric oxide synthase. Biochem Biophys Res Commun 281: 396 403.

PAGE 125

125 190. Bellmann K, Jaattela M, Wissing D, Burkart V, Kolb H (1996) He at shock protein hsp70 overexpression confers resistance against nitric oxide. FEBS Lett 391: 185 188. 191. Bellmann K, Wenz A, Radons J, Burkart V, Kleemann R, et al. (1995) Heat shock induces resistance in rat pancreatic islet cells against nitric oxide, oxygen radicals and streptozotocin toxicity in vitro. J Clin Invest 95: 2840 2845. 192. Chambers KT, Unverferth JA, Weber SM, Wek RC, Urano F, et al. (2008) The role of nitric oxide and the unfolded protein response in cytokine induced beta cell death. Di abetes 57: 124 132. 193. Corbett JA, Sweetland MA, Wang JL, Lancaster JR, McDaniel ML (1993) Nitric oxide mediates cytokine induced inhibition of insulin secretion by human islets of Langerhans. Proc Natl Acad Sci U S A 90: 1731 1735. 194. Johannesen J, Ka rlsen AE, Pociot F, Roenn SG, Nerup J (2003) Strain dependent rat iNOS promoter activity -correlation to identified WT1 transcription factor binding site. Autoimmunity 36: 167 175. 195. Mathews CE, Suarez Pinzon WL, Baust JJ, Strynadka K, Leiter EH, et al. (2005) Mechanisms Underlying Resistance of Pancreatic Islets from ALR/Lt Mice To Cytokine Induced Destruction. J Immunol 175: 1248 1256. 196. Scarim AL, Heitmeier MR, Corbett JA (1998) Heat shock inhibits cytokine induced nitric oxide synthase expression by rat and human islets. Endocrinology 139: 5050 5057. 197. Thomas HE, Irawaty W, Darwiche R, Brodnicki TC, Santamaria P, et al. (2004) IL 1 receptor deficiency slows progression to diabetes in the NOD mouse. Diabetes 53: 113 121. 198. Grunnet LG, Aikin R, Tonnesen MF, Paraskevas S, Blaabjerg L, et al. (2009) Proinflammatory cytokines activate the intrinsic apoptotic pathway in beta cells. Diabetes 58: 1807 1815. 199. Bottino R, Balamurugan AN, Bertera S, Pietropaolo M, Trucco M, et al. (2002) Preservation of human islet cell functional mass by anti oxidative action of a novel SOD mimic compound. Diabetes 51: 2561 2567. 200. Bottino R, Balamurugan AN, Tse H, Thirunavukkarasu C, Ge X, et al. (2004) Response of human islets to isolation stress and the effect o f antioxidant treatment. Diabetes 53: 2559 2568.

PAGE 126

126 201. Chen J, Hattori Y, Nakajima K, Eizawa T, Ehara T, et al. (2006) Mitochondrial complex I activity is significantly decreased in a patient with maternally inherited type 2 diabetes mellitus and hypertro phic cardiomyopathy associated with mitochondrial DNA C3310T mutation: a cybrid study. Diabetes Res Clin Pract 74: 148 153. 202. Stephens LA, Thomas HE, Kay TW (1997) Protection of NIT 1 pancreatic beta cells from immune attack by inhibition of NF kappaB. J Autoimmun 10: 293 298. 203. Stephens LA, Thomas HE, Ming L, Grell M, Darwiche R, et al. (1999) Tumor necrosis factor alpha activated cell death pathways in NIT 1 insulinoma cells and primary pancreatic beta cells. Endocrinology 140: 3219 3227. 204. Dai T Patel Chamberlin M, Natarajan R, Todorov I, Ma J, et al. (2009) Heat shock protein 27 overexpression mitigates cytokine induced islet apoptosis and streptozotocin induced diabetes. Endocrinology 150: 3031 3039. 205. Holcik M, Korneluk RG (2001) XIAP, the guardian angel. Nat Rev Mol Cell Biol 2: 550 556. 206. Scaffidi P, Misteli T, Bianchi ME (2002) Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature 418: 191 195. 207. Zong WX, Ditsworth D, Bauer DE, Wang ZQ, Thompson CB (200 4) Alkylating DNA damage stimulates a regulated form of necrotic cell death. Genes Dev 18: 1272 1282. 208. Cunha Oliveira T, Rego AC, Cardoso SM, Borges F, Swerdlow RH, et al. (2006) Mitochondrial dysfunction and caspase activation in rat cortical neurons treated with cocaine or amphetamine. Brain Res 1089: 44 54. 209. Domingues AF, Esteves AR, Swerdlow RH, Oliveira CR, Cardoso SM (2008) Calpain mediated MPP+ toxicity in mitochondrial DNA depleted cells. Neurotox Res 13: 31 38. 210. Macfarlane WM, Cragg H, Docherty HM, Read ML, James RF, et al. (1997) Impaired expression of transcription factor IUF1 in a pancreatic beta cell line derived from a patient with persistent hyperinsulinaemic hypoglycaemia of infancy (nesidioblastosis). FEBS Lett 413: 304 308. 211. Ball AJ, Abrahamsson AE, Tyrberg B, Itkin Ansari P, Levine F (2007) HES6 reverses nuclear reprogramming of insulin producing cells following cell fusion. Biochem Biophys Res Commun 355: 331 337. 212. Demeterco C, Itkin Ansari P, Tyrberg B, Ford LP, Jarvis RA, et al. (2002) c Myc controls proliferation versus differentiation in human pancreatic endocrine cells. J Clin Endocrinol Metab 87: 3475 3485.

PAGE 127

127 213. Itkin Ansari P, Demeterco C, Bossie S, de la Tour DD, Beattie GM, et al. (2000) PDX 1 and cell cell cont act act in synergy to promote delta cell development in a human pancreatic endocrine precursor cell line. Mol Endocrinol 14: 814 822. 214. Wang S, Beattie GM, Mally MI, Lopez AD, Hayek A, et al. (1997) Analysis of a human fetal pancreatic islet cell line. Transplant Proc 29: 2219. 215. Chervonsky AV, Wang Y, Wong FS, Visintin I, Flavell RA, et al. (1997) The role of Fas in autoimmune diabetes. Cell 89: 17 24. 216. Su X, Hu Q, Kristan JM, Costa C, Shen Y, et al. (2000) Significant role for Fas in the pathoge nesis of autoimmune diabetes. J Immunol 164: 2523 2532. 217. Suarez Pinzon WL, Power RF, Rabinovitch A (2000) Fas ligand mediated mechanisms are involved in autoimmune destruction of islet beta cells in non obese diabetic mice. Diabetologia 43: 1149 1156. 218. Amrani A, Verdaguer J, Thiessen S, Bou S, Santamaria P (2000) IL 1alpha, IL 1beta, and IFN gamma mark beta cells for Fas dependent destruction by diabetogenic CD4(+) T lymphocytes. J Clin Invest 105: 459 468. 219. Barnhart BC, Alappat EC, Peter ME (20 03) The CD95 type I/type II model. Semin Immunol 15: 185 193. 220. Augstein P, Bahr J, Wachlin G, Heinke P, Berg S, et al. (2004) Cytokines activate caspase 3 in insulinoma cells of diabetes prone NOD mice directly and via upregulation of Fas. J Autoimmun 23: 301 309. 221. Cetkovic Cvrlje M, Eizirik DL (1994) TNF alpha and IFN gamma potentiate the deleterious effects of IL 1 beta on mouse pancreatic islets mainly via generation of nitric oxide. Cytokine 6: 399 406. 2000) Nitric oxide production and Fas surface expression mediate two independent pathways of cytokine induced murine beta cell damage. Diabetes 49: 39 47. 223. Eizirik DL, Sandler S, Welsh N, Cetkovic Cvrlje M, Nieman A, et al. (1994) Cytokines suppress hu man islet function irrespective of their effects on nitric oxide generation. J Clin Invest 93: 1968 1974. 224. Gysemans C, Callewaert H, Overbergh L, Mathieu C (2008) Cytokine signalling in the beta cell: a dual role for IFNgamma. Biochem Soc Trans 36: 328 333. 225. Rabinovitch A, Suarez Pinzon WL, Strynadka K, Schulz R, Lakey JR, et al. (1994) Human pancreatic islet beta cell destruction by cytokines is independent of nitric oxide production. J Clin Endocrinol Metab 79: 1058 1062.

PAGE 128

128 226. Soldevila G, Buscema M, Doshi M, James RF, Bottazzo GF, et al. (1991) Cytotoxic effect of IFN gamma plus TNF alpha on human islet cells. J Autoimmun 4: 291 306. 227. Suk K, Kim S, Kim YH, Kim KA, Chang I, et al. (2001) IFN gamma/TNF alpha synergism as the final effector in au toimmune diabetes: a key role for STAT1/IFN regulatory factor 1 pathway in pancreatic beta cell death. J Immunol 166: 4481 4489. 228. Jitrapakdee S, Wutthisathapornchai A, Wallace JC, MacDonald MJ (2010) Regulation of insulin secretion: role of mitochondrial signalling. Diabetologia 53: 1019 1032. 229. Kluck RM, Bossy Wetzel E, Green DR, Newmeyer DD (1997) The release of cytochrome c from mitochondria: a primary site for Bcl 2 regulation of apoptosis. Science 275: 1132 1136. 230. Cai J, Yang J, J ones DP (1998) Mitochondrial control of apoptosis: the role of cytochrome c. Biochim Biophys Acta 1366: 139 149. 231. Cand C, Cecconi F, Dessen P, Kroemer G (2002) Apoptosis inducing factor (AIF): key to the conserved caspase independent pathways of cell death? J Cell Sci 115: 4727 4734. 232. Cand C, Vahsen N, Garrido C, Kroemer G (2004) Apoptosis inducing factor (AIF): caspase independent after all. Cell Death Differ 11: 591 595. 233. Li JH, Pober JS (2005) The cathepsin B death pathway contributes to TN F plus IFN gamma mediated human endothelial injury. J Immunol 175: 1858 1866. 234. Thomas HE, McKenzie MD, Angstetra E, Campbell PD, Kay TW (2009) Beta cell apoptosis in diabetes. Apoptosis 14: 1389 1404. 235. Foulis AK (2008) Pancreatic pathology in type 1 diabetes in human. Novartis Found Symp 292: 2 13; discussion 13 18, 122 129, 202 123. 236. Noble JA, Erlich HA (2012) Genetics of type 1 diabetes. Cold Spring Harb Perspect Med 2: a007732. 237. Thayer TC, Wilson SB, Mathews CE (2010) Use of nonobese diab etic mice to understand human type 1 diabetes. Endocrinol Metab Clin North Am 39: 541 561. 238. Maassen JA, 'T Hart LM, Van Essen E, Heine RJ, Nijpels G, et al. (2004) Mitochondrial diabetes: molecular mechanisms and clinical presentation. Diabetes 53 Supp l 1: S103 109.

PAGE 129

129 239. Mathews CE, Graser RT, Bagley RJ, Caldwell JW, Li R, et al. (2003) Genetic analysis of resistance to Type 1 Diabetes in ALR/Lt mice, a NOD related strain with defenses against autoimmune mediated diabetogenic stress. Immunogenetics 55: 491 496. 240. Barratt BJ, Payne F, Lowe CE, Hermann R, Healy BC, et al. (2004) Remapping the insulin gene/IDDM2 locus in type 1 diabetes. Diabetes 53: 1884 1889. 241. Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, et al. (2004) A functional variant o f lymphoid tyrosine phosphatase is associated with type I diabetes. Nat Genet 36: 337 338. 242. Siminovitch KA (2004) PTPN22 and autoimmune disease. Nat Genet 36: 1248 1249. 243. Vang T, Congia M, Macis MD, Musumeci L, Orr V, et al. (2005) Autoimmune asso ciated lymphoid tyrosine phosphatase is a gain of function variant. Nat Genet 37: 1317 1319. 244. King MP, Attardi G (1989) Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation. Science 246: 500 503. 245. Mukhopadhyay P, R ajesh M, Hask G, Hawkins BJ, Madesh M, et al. (2007) Simultaneous detection of apoptosis and mitochondrial superoxide production in live cells by flow cytometry and confocal microscopy. Nat Protoc 2: 2295 2301. 246. Collier JJ, Fueger PT, Hohmeier HE, New gard CB (2006) Pro and antiapoptotic proteins regulate apoptosis but do not protect against cytokine mediated cytotoxicity in rat islets and beta cell lines. Diabetes 55: 1398 1406. 247. Roep BO (2003) The role of T cells in the pathogenesis of Type 1 dia betes: from cause to cure. Diabetologia 46: 305 321. 248. Serreze DV, Leiter EH, Christianson GJ, Greiner D, Roopenian DC (1994) Major histocompatibility complex class I deficient NOD B2mnull mice are diabetes and insulitis resistant. Diabetes 43: 505 509. 249. Marron MP, Graser RT, Chapman HD, Serreze DV (2002) Functional evidence for the mediation of diabetogenic T cell responses by HLA A2.1 MHC class I molecules through transgenic expression in NOD mice. Proc Natl Acad Sci U S A 99: 13753 13758. 250. Ser reze DV, Chapman HD, Varnum DS, Gerling I, Leiter EH, et al. (1997) Initiation of autoimmune diabetes in NOD/Lt mice is MHC class I dependent. J Immunol 158: 3978 3986.

PAGE 130

130 251. Unger WW, Pinkse GG, Mulder van der Kracht S, van der Slik AR, Kester MG, et al. ( 2007) Human clonal CD8 autoreactivity to an IGRP islet epitope shared between mice and men. Ann N Y Acad Sci 1103: 192 195. 252. Takaki T, Marron MP, Mathews CE, Guttmann ST, Bottino R, et al. (2006) HLA A*0201 restricted T cells from humanized NOD mice re cognize autoantigens of potential clinical relevance to type 1 diabetes. J Immunol 176: 3257 3265. 253. Bulek AM, Cole DK, Skowera A, Dolton G, Gras S, et al. (2012) Structural basis for the killing of human beta cells by CD8(+) T cells in type 1 diabetes. Nat Immunol 13: 283 289. 254. Bougneres PF, Carel JC, Castano L, Boitard C, Gardin JP, et al. (1988) Factors associated with early remission of type I diabetes in children treated with cyclosporine. N Engl J Med 318: 663 670. 255. Herold KC, Hagopian W, A uger JA, Poumian Ruiz E, Taylor L, et al. (2002) Anti CD3 monoclonal antibody in new onset type 1 diabetes mellitus. N Engl J Med 346: 1692 1698. 256. Herold KC, Gitelman SE, Masharani U, Hagopian W, Bisikirska B, et al. (2005) A single course of anti CD3 monoclonal antibody hOKT3gamma1(Ala Ala) results in improvement in C peptide responses and clinical parameters for at least 2 years after onset of type 1 diabetes. Diabetes 54: 1763 1769. 257. Chatenoud L, Primo J, Bach JF (1997) CD3 antibody induced domin ant self tolerance in overtly diabetic NOD mice. J Immunol 158: 2947 2954. 258. Hu CY, Rodriguez Pinto D, Du W, Ahuja A, Henegariu O, et al. (2007) Treatment with CD20 specific antibody prevents and reverses autoimmune diabetes in mice. J Clin Invest 117: 3857 3867. 259. Foulis AK, Liddle CN, Farquharson MA, Richmond JA, Weir RS (1986) The histopathology of the pancreas in type 1 (insulin dependent) diabetes mellitus: a 25 year review of deaths in patients under 20 years of age in the United Kingdom. Diabet ologia 29: 267 274. 260. Foulis AK, Farquharson MA, Meager A (1987) Immunoreactive alpha interferon in insulin secreting beta cells in type 1 diabetes mellitus. Lancet 2: 1423 1427. 261. Trapani JA, Smyth MJ (2002) Functional significance of the perforin/g ranzyme cell death pathway. Nat Rev Immunol 2: 735 747. 262. Martinvalet D, Dykxhoorn DM, Ferrini R, Lieberman J (2008) Granzyme A cleaves a mitochondrial complex I protein to initiate caspase independent cell death. Cell 133: 681 692.

PAGE 131

131 263. Elding Larsson H, Vehik K, Bell R, Dabelea D, Dolan L, et al. (2011) Reduced prevalence of diabetic ketoacidosis at diagnosis of type 1 diabetes in young children participating in longitudinal follow up. Diabetes Care 34: 2347 2352. 264. Charles MA, Selam JL (2004) Benef its and risks of solitary islet transplantation for type 1 diabetes using steroid sparing immunosuppression. Diabetes Care 27: 1249 1250; author reply 1250 1241. 265. Yao YG, Kong QP, Zhang YP (2002) Mitochondrial DNA 5178A polymorphism and longevity. Hum Genet 111: 462 463. 266. Kokaze A, Ishikawa M, Matsunaga N, Yoshida M, Sekine Y, et al. (2004) Longevity associated mitochondrial DNA 5178 A/C polymorphism and blood pressure in the Japanese population. J Hum Hypertens 18: 41 45. 267. Takagi K, Yamada Y, Gong JS, Sone T, Yokota M, et al. (2004) Association of a 5178C ->A (Leu237Met) polymorphism in the mitochondrial DNA with a low prevalence of myocardial infarction in Japanese individuals. Atherosclerosis 175: 281 286. 268. Chen J, Gusdon AM, Mathews CE ( 2011) Role of genetics in resistance to type 1 diabetes. Diabetes Metab Res Rev 27: 849 853.

PAGE 132

132 BIOGRAPHICAL SKETCH Yama Luzardo Lightfoot was born in Camagey, Cuba to Isaac C. Luzardo and Mara A. Acosta. In 1997 she moved with her father, stepmother Blanca, and brother, Isaac, to Miami, Florida. In 2003, Yama graduated from South Miami Senior High School in the top ten of a graduating class of over 500 students. The fall semester of that s ame year, she began her undergraduate degree p rogram in m icrobiology and cell s cience at the University of Florida as a Florida Academic Scholar. During this time, Yama also worked as a substitute teacher at Baby Gator Child Development and Research Cent er and as a technician in the laboratory of Dr. Robert A. Burne in the Oral Biology Department of the College of Dentistry. In the summer semester of her junior year, Yama was selected into the University Scholars Program, which provided funding for her u ndergraduate research project in the Burne laboratory focused on investigating the mechanisms governing Streptococcus mutans gene expression and virulence. until graduating with honors in the spring of 2007. Due to the excellent mentorship and opportunities to present and publish data in the Burne lab, Yama remained interested in research and wished to continue to develop as a scientist by joining the Interdisciplinary Program (IDP) in Biomedical Sciences in the College of Medici ne at the University of Florida. Upon acceptance into the program in the fall of 2007, Yama was awarded the Alumni Graduate Fellowship, which provides Graduate Research Assistant support for four years. While in the IDP, she joined t he laboratory of Dr. Clayton E. Mathew s to investigate the pathogenesis of t ype 1 diabetes. By pursuing a Ph.D. studying

PAGE 133

133 autoimmune diabetes, Yama redirected her career path to focus on her long lasting interest in the disease that has affected her mothe r since the age of eleven. During her graduate studies, Yama married Joseph A. Lightfoot, whom she met while the two attended the University of Florida as undergraduate students. After graduation, Yama plans to remain in academic research and hopes to become a leadin g investigator in the field of t ype 1 diabetes.