Daxx Mitotic Function Plays a Pivotal Role in Chemotherapy Resistance and Cancer Progression


Material Information

Daxx Mitotic Function Plays a Pivotal Role in Chemotherapy Resistance and Cancer Progression
Physical Description:
1 online resource (134 p.)
Giovinazzi, Serena
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Molecular Cell Biology (IDP)
Committee Chair:
Ishov, Alexander M
Committee Members:
Chan, Edward K
Sugrue, Stephen P
Bungert, Jorg


Subjects / Keywords:
aneuploidy -- cancer -- daxx -- mitosis -- sac -- taxanes -- usp7
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation


Breast cancer accounts yearly for 200,000 newly diagnosed American women and loss of 40,000 of them, representing the number one killer in middle-aged women. Taxanes are considered among the most active chemotherapeutic agents for breast cancer treatment however intrinsic and acquired resistances to taxanes, limit the successful therapeutic outcomes of breast cancer patients. Thus it is crucial to identify mechanisms of resistance and predictive markers that would allow differentiation of patients in taxane responders or non-responders to improve patients overall and cancer-free survival. While seeking for additional markers of taxane response, we identified the novel role of protein Daxx in taxane sensitivity in experimental models and, importantly, in breast cancer patients (Chapter 3). Daxx, a ubiquitously expressed nuclear protein with relevant roles in transcription and cancer progression, acts as a mitotic checkpoint protein that ensures cell death upon exposure to taxanes. We have demonstrated that this function is mediated by Daxx mitotic partner Ubiquitin Specific processing Protease-7 (USP7). We found that USP7 has a crucial role in mitotic progression, regulating stability of mitotic checkpoint proteins CHFR, Aurora A kinase and Bub3. Results described in this dissertation show that decreased USP7 expression impairs response to taxanes in cancer cell lines (Chapter 4). In addition, here we show that Daxx-USP7 complex is fundamental for faithful chromosomes segregation in daughter cells. Decreased expression of USP7 leads to accumulation of several mitotic abnormalities and ultimately to aneuploidy, as we previously observed for Daxx (Chapter 5). In conclusion, this work identified a new biological role of Daxx and USP7 in mitosis where loss of these proteins can contribute to cancer initiation/progression and development of chemotherapy resistance. Thus, the study presented in this dissertation proposes Daxx and USP7 as predictive markers for taxane chemotherapy response to allow proper patient's stratification. In addition, by explaining one of the mechanisms of taxane resistance, this study allows rational choice of alternative therapeutic strategies to defeat breast cancer.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Serena Giovinazzi.
Thesis (Ph.D.)--University of Florida, 2012.
Adviser: Ishov, Alexander M.
Electronic Access:

Record Information

Source Institution:
Rights Management:
Applicable rights reserved.
lcc - LD1780 2012
System ID:

This item is only available as the following downloads:

Full Text




2012 Serena Giovinazzi 2


In loving memory of my mot her, Maria Rosaria Migliaccio 3


ACKNOWLEDGMENTS I owe my gratitude to all those people who have made th is dissertation possible. My deepest gratefulness goes to my ment or Dr. Ishov for always granting me guidance, patience and suppor t even during difficult times. He provided excellent mentorship and encouraged me to pursue my career goals. I am very grateful to t he members of my committ ee Dr. Bungert, Dr. Chan and Dr. Sugrue, for all their useful comments, s uggestions and constructive criticisms. I am obliged to my colleague and friend Dr Morozov who always offered support and represented a constant source of experienced help. I am truly indebted and thankful to who cont ributed to this work either by sharing reagents or providing precious collabo rative or administrative help. I want to thank the Interdisciplinary Pr ogram at the University of Florida for providing a striving environm ent and opportunities that I never had in my country. Most importantly, I am grateful to my family for the unconditional support, understanding and love, for never doubting my choices and dreams, even when I did. I would not have endured these years withou t my husband, Josh for his constants encouragements and tolerance. Josh, I will never thank you enough for being at my side during the worst times and being fo r me an unwavering pillar. I am very grateful to my parents: my father, Giuseppe Giovinazzi, my role model for hard work and personal sacrifices and my mother, Maria Rosaria Migliaccio, to whom this dissertation is dedicated, who was an exceptional example of integrity, strength and perseverance. 4


TABLE OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................4 LIST OF TABLES............................................................................................................8 LIST OF FI GURES..........................................................................................................9 LIST OF ABBR EVIATIONS...........................................................................................11 ABSTRACT ...................................................................................................................13 CHAPTER 1 INTRODUC TION....................................................................................................15 Breast C ancer .........................................................................................................15 Epidemiology and Risk Fact ors........................................................................16 Prognostic and Predict ive Fact ors....................................................................17 Breast Cancer Treatm ent.................................................................................18 Taxane Chem otherapy ...........................................................................................18 Taxanes Ac tivity...............................................................................................19 Taxanes and Mitoti c Checkpoi nts.....................................................................20 Predictive Markers for Taxane Re sponse.........................................................22 Protein Daxx: a Novel Player in Paclitaxel Resistanc e.....................................22 Daxx: an Enigmatic and Controversial Protein........................................................24 Daxx Structure..................................................................................................26 DHB Domain Characte rization of Daxx............................................................27 Daxx a Multifuncti onal Prot ein..........................................................................27 Daxx Role in Mitosis.........................................................................................29 Daxx Role in Carcinog enesis ...........................................................................30 2 MATERIAL A ND METHOD S..................................................................................32 Cell Cult ure.............................................................................................................32 Immuno-precipitation and Mass Spectrometry Analysi s.........................................32 Immunofluor esence................................................................................................33 Western Blotting .....................................................................................................33 Transient and Stabl e Deplet ions .............................................................................34 Time Lapse Mi croscopy..........................................................................................34 APC Assa y..............................................................................................................35 Mitotic Stages Assessment.....................................................................................35 Micronuclei Sc oring................................................................................................35 Colony Formati on Assa y.........................................................................................36 Immunohistochem istry............................................................................................36 Mouse Xen ografts...................................................................................................37 5


Metaphase Spreads and Karyotyp ing.....................................................................38 3 CELLULAR LEVELS OF DAXX CORRELA TE WITH TAXANE RESISTANCE......39 Introductory Remarks..............................................................................................39 Result s....................................................................................................................41 Duration of Mitotic Stages is A ffected in the Abs ence of Daxx.........................41 Cyclin B is Stabilized in Daxx -Depleted Cells Treated with Taxol...................42 Daxx is not Required for Activati on of the Anaphase Promotion Complex (APC) in vitro for Degradation of Mitotic Cyclins ...........................................42 Analysis of Mitosis Related Proteins upon Daxx Depletion..............................43 Daxx Dependent Tumor Response to Taxol...................................................44 Taxane-induced Mitotic Cata strophe in X enografts..........................................44 In Breast Cancer Patients, Daxx is a Predictive Factor for Paclitaxel Respons e......................................................................................................45 Summary of Result s.........................................................................................46 Discussio n..............................................................................................................46 4 DAXX INTERACTS WITH UBIQUITIN SPECIFIC PROTEASE-7, USP7, TO REGULATE MITOSIS AND CELLULAR TAXOL RESPO NCE.............................58 Introductory Remarks..............................................................................................58 Result s....................................................................................................................61 Daxx Mitotic Comp lex Isolat ion........................................................................61 Daxx Interacts with U SP7 in Mi tosis.................................................................62 Depletion of USP7 Causes Dela y of Early Mito tic Event s................................63 USP7 Depletion Destabil izes CHFR Pr otein....................................................64 Loss of USP7 Leads to Accumulation of Aurora A and Multipolar Spindles.....65 USP7 Depletion Elevates Taxane Re sistance that Can Be Attenuated with Aurora A inhibi tor MLN8054.......................................................................... 66 Summary of Result s.........................................................................................68 Discussio n..............................................................................................................69 5 DAXX AND USP7 ARE GUARDI ANS OF GENOMI C STABILI TY..........................83 Introductory Remarks..............................................................................................83 Result s....................................................................................................................86 USP7 Depletion Causes Genomic Inst ability ....................................................86 Loss of USP7 leads to increas e in micronucle i formati on..........................86 Loss of USP7 causes increase of lagging ch romosomes..........................87 Loss of USP7 promotes abnormal kary otype.............................................88 USP7 Interacts and Controls Stabi lity of SAC Pr otein B ub3.............................89 Summary of Result s.........................................................................................90 Discussio n..............................................................................................................90 6 SUMMARY, CONCLUSIONS AND FUTURE DIRE CTIONS..................................98 Summary and Conclusi ons.....................................................................................98 6


Future Direc tions..................................................................................................104 Examine the Mechanism of Daxx R epression in Resi stant Cells...................104 Validate Predictive Role of Protein USP7 as a Marker for Sensitivity to Taxane-based Chemotherapy in Breast Cancer Patients...........................105 Explore Use of Aurora A Inhibitors to Reverse Taxa ne Resistanc e...............106 Biochemical Characterization of Daxx and USP7 Mitotic Interaction..............106 Examine the Role of Daxx and U SP7 in Genomic Instabilit y..........................107 Determine whether USP7 Regulates stability and Interacts with Components of the SAC and Kinetoc hore...................................................108 LIST OF REFE RENCES.............................................................................................109 BIOGRAPHICAL SKETCH ..........................................................................................133 7


LIST OF TABLES Table page 4-1 List of USP7 peptides ident ified by mass s pectrometry......................................73 8


LIST OF FIGURES Figure page 3-1 Daxx-dependent stabili ty of cyc lin B. ..................................................................50 3-2 Depletion of Daxx pr olongs cyclin B stabilit y......................................................51 3-3 Daxx is not required for in vitro activati on of t he APC .........................................52 3-4 Analysis of mitosi s-related pr oteins ....................................................................53 3-5 Depletion of Daxx increases resist ance of experimental tumors to Taxol.........54 3-6 Daxx levels have reverse correlati on with taxane chemotherapy response in breast cancer patient s........................................................................................56 3-7 Model of Daxx -dependent Taxol respons e.......................................................57 4-1 Daxx interacts with USP7 in mi tosis...................................................................74 4-2 USP7 depletion results in stabiliz ation of cyclin B1 (cycB) in a p53 independent manner...........................................................................................75 4-3 USP7 depletion causes accumulation of mitotic cells in prometa-metaphase....76 4-4 USP7 depletion destabilizes CHFR protein........................................................77 4-5 USP7 depletion causes accumulation of multipolar cell divisions which are mediated by accumulation of Aurora A kinase, a CHF R substrate.....................78 4-6 Transient depletion of USP7 and Daxx leads to the accumulation of multipolar mitoses...............................................................................................80 4-7 Depletion of USP7 Des ensitizes Cells to Paclitaxel which can be rescued by Aurora A i nhibiti on..............................................................................................81 4-8 USP7/Daxx regulation of mi tosis and taxane resistanc e....................................82 5-1 USP7 depletion caus es genomic in stabili ty........................................................93 5-2 Loss of USP7 causes accu mulation of mi cronucle i............................................94 5-3 USP7 depletion causes mitotic abno rmalitie s.....................................................95 5-4 Depletion of USP7 lead s to increased aneuploi dy..............................................96 5-5 USP7 regulates stabilit y and interacts with Bub3...............................................97 9


6-1 Proposed model for Daxx and USP7 regulation of taxane response and genomic instab ility............................................................................................103 10


LIST OF ABBREVIATIONS APC Anaphase Prom oting Complex BRCA1 BReast CAncer type 1 susceptibility protein Bub1 Budding Uninhibited by Benzimidazoles 1 Bub3 Budding Uninhibited by Benzimidazoles 3 BubR1 Bub1-Related kinase Cdc20 Cell-Division Cycle protein 20 Cdc27 Cell-Division Cycle protein 27 CHFR CHeckpoint with Fo rkhead and Ring finger Daxx Death domain associated protein DHB Daxx Helical Bundle domain DMSO Dimethyl Sulfoxide DUB De-Ubiquitylating enzyme EDTA Ethylenediami netetraacetic Acid FACS Fluorescence Activated Cell Sorting HEp2 Cell line derived fr om human larynx carcinoma H1299 NSCLC cell line, p53 null HCT116 Colorectal carcinoma cell line HDAC2 Histone Deacethylase-2 IHC Immunohistochemistry IP Immunoprecipitation JNK Jun N-terminal kinase MCF10A Not transformed breast epithelial cell line Mad2 Mitotic Arrest Deficient-2 MCC Mitotic Checkpoint Complex 11


MDM2 Murine Double Minute-2 MN Micronuclei NMR Nuclear Magnetic Resonance NSCLC Non Small Cell Lung Carcinoma p53 Tumor protein 53 PTEN Phosphatas e and TENsin homolog SAC Spindle Assembly Checkpoint SDS-PAGE Sodium dodecyl sulfate-polyacrylamide gel electrophoresis TAP Tandem Affinity Purification Ub Uquitin USP7 Ubiquitin Specific processing Protease-7 USP7i USP7 Inhibitor 12


Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy DAXX MITOTIC FUNCTION PLAYS A PIVOTAL ROLE IN CHEMOTHERAPY RESISTANCE AND CANCER PROGRESSION By Serena Giovinazzi May 2012 Chair: Alexander M. Ishov Major: Medical Sciences Breast cancer accounts yearly for 200, 000 newly diagnosed American women and loss of 40.000 of them, repr esenting the number one killer in middle-aged women. Taxanes are considered among the most ac tive chemotherapeutic agents for breast cancer treatment however intrinsic and acquired resistances to taxanes, limit the successful therapeutic outcomes of breast cancer patients. Thus it is crucial to identify mechanisms of resistance and predictive mark ers that would allo w differentiation of patients in taxane responders or non-respond ers to improve patients overall and cancer-free survival. While seeking for additional markers of ta xane response, we identified the novel role of protein Daxx in taxane sensitivity in experimental models and, importantly, in breast cancer patients (Chapter 3). Daxx, a ubiquitously ex pressed nuclear protein with relevant roles in transcription and cancer progression, acts as a mitotic checkpoint protein that ensures cell deat h upon exposure to taxanes. We have demonstrated that this function is mediated by Daxx mitotic par tner Ubiquitin Specif ic processing Protease7 (USP7). We found that USP7 has a crucia l role in mitotic progression, regulating stability of mitotic checkpoint proteins CHFR, Aurora A kinase and Bub3. Results 13


described in this dissertation show that decreased USP7 expression impairs response to taxanes in cancer cell lines (Chapter 4). In addition, here we show that Daxx-USP7 complex is fundamental for faithful chromosomes segregation in daughter cells. Decreased expression of USP7 leads to accumulation of several mitotic abnormalitie s and ultimately to aneuploidy, as we previously observed for Daxx (Chapter 5). In conclusion, this work identified a new biological role of Daxx and USP7 in mitosis where loss of these proteins can cont ribute to cancer initiation/progression and development of chemotherapy resistance. Thus, the study presented in this dissertation proposes Daxx and USP7 as predictive markers for taxane chemotherapy response to allow proper patients stratification. In addition, by explaining one of the mechanisms of taxane resistance, this study allows rational choice of alternative t herapeutic strategies to defeat breast cancer. 14


CHAPTER 1 INTRODUCTION Breast Cancer Breast cancer refers to an abnorma l and malignant growth within the breast tissue. It is the oldest described tumor in humans, as cases of breast cancer were documented in an ancient Egyptian document. The Edwin Smith Pa pyrus, which dates circa 1650 BC, is part of a medical treatise that among 48 cases of trauma surgery 1, describes 8 cases of breast tu mors, referred as ulcers, treated by cauterization. In the manuscript also appears the co mment that "there is no cu re" for this disease. Indeed the belief that breast cancer wa s incurable dominated among physicians until the 19th century until when advances in su rgical practices concomitantly to introduction of clinical microscopy and c hemotherapy allowed the increase of the survival of breast cancer patients 1. However, in spite of the enormous progress achieved in the last 20 years in treatment and detection, breast cancer still represents the number one killer of middle-aged women wo rldwide (American Cancer Society). Most commonly, breast cancer originates from epithelial cells localized in the breast ducts, tubular structures that connect the lobules to the nipple to secrete milk (ductal carcinoma), or less frequently from cells lining the lobules or milk glands (lobular carcinoma). At the early stages, breast cancer is asym ptomatic. Therefore, the diagnosis of breast cancer starts with detection of anomalie s, generally a lump, during either clinical or a self breast examination, which is then confirmed by radiological exam (mammogram) and breast biopsy. At the la ter stages symptoms appear such as changes in the size, shape, or feel of the br east or nipple. In advanced breast cancer, 15


skin ulcers, leak of fluids from the nipple a nd pain or discomfort in the breast or armpit area may also appear. Epidemiology and Risk Factors About 1 in 8 U.S. women (jus t under 12%) will develop inva sive breast cancer over the course of her lif etime. Every year, breast canc er accounts for about 200.000 newly diagnosed American wom en and a loss of more than 40. 000 of them, representing the second most deadly cancer (American cancer society). According to the disease state, the 5 year survival is very different: for a non-in vasive (or in-situ) tumor the survival rates are the highest, about 97%; they are decr eased to 78% for a local invasive tumor and are down to 22% for an invasive/metasta tic cancer. These numbers highlight the importance amongst middle aged wom en of conducting routine screening. The incidence of breast cancer is 100 ti mes higher among women than men. This is mainly due to hormonal susceptibility of the female breast tissue and the changes in breast mass due to menarche, pregnancie s and menopause. Indeed the odds to being diagnosed with breast cancer are highly connected to reproduc tive risk factors such as early menarche, late menopause, use of contraceptives, first pregnancy after age 30 and breastfeeding history. Beside sex, there ar e other genetic factors that ma y increase the odds of being diagnosed with breast cancer. A bout 10% of all breast cancer cases have an inherited component 2. The first cause of familial breast canc er (about the 3% of hereditary breast cancer 2) is attributable to germline mutations in breast cancer susceptibility protein type 1 and 2 (BRCA1 and BRCA2) genes normally involved in DNA damage response and double strand brake repair 3. Women that are diagnosed with mutations in BRCA1 gene have a 51% risk of breast cancer and 25% ri sk of ovarian cancer by age 50, while 16


mutations in BRCA2 gene confer a 63% risk of breast cancer by age 70 4. Other genetic conditions associated with higher risk of breast cancer include the Li-Fraumeni syndrome-1, in which patients harbor germline mutation of the TP53 gene 5, 6. A number of other factors increase the risk of breast cancer such as mutation of genes ataxia telangiectasia mutated ( ATM ) 7 and phosphatase and tensin homolog ( PTEN which causes the Cowden disease) 8. Loss of these genes usually correlates with poor tumor prognosis. Also environmental risk factors are a ssociated with breast cancer, such as obesity, poor diet, smoking, alcohol consumpt ion, exposure to chemicals (pesticides, antibiotics or hormones) and ionizing radiations. Prognostic and Predictive Factors For the successful treatment of breast c ancer patients, it is fundamental to have available established prognostic and predictive factors to help clinicians select an optimal treatment option for a given patient. While prognostic factors may be able to predict the outcome and recovery from the disease, predictive factors instead are indicative of response to the therapy. The major prognostic factor for early breas t cancer is the lymph node involvement 9. A patient with negative nodes has the highest 5 y ear survival rate but it progressively decreases as the number of positive nodes increases 10. Of high clinical relevance Her2/neu and hormone receptor statuses (estrogen or pr ogesterone receptors ER or PR) have predictive an d prognostic features 9. The presence of ER or PR (about 45% of patients are ER and PR positive and about 30% are ER and PR negative) is indicative of higher 5 year survival rates; however it is also an indicator of higher chances of cancer recurrence. An ER or PR positive tumor will be also responsive to hormonal 17


therapy (eg. tamoxifen). Simila rly, the Human Epithelial growth factor Receptor-2 status (Her2), which is over-expressed in 20-25% of invasive breast cancer, is usually an indicator of tumor aggressiveness and poor outcome. Patients with tumors positive for Her2 are predicted to be responsive to DNA damaging agents. Her2-dependent tumors can also be treated with a humanized monoclonal antibody (Trastuzumab or Herceptin) against Her2 which inhibits the proliferation and survival of tumor cells. In spite of the success of t hese prognostic and predictive markers, it is still difficult to identify patients that are responsive to c hemotherapy. Particularly, there is a need to predict response to therapy among women with triple negative disease (ER, PR and Her2 negative). Breast Cancer Treatment After breast cancer diagnosis, the tr eatment chosen for each patient will be assessed according to tumor stage and the patients genetic background and it will include surgery (if tumor is operable) chemotherapy and/or radiotherapy. For patients with in situ breast cancer a lumpectomy, single or even double mastectomies (for patients with familial br east cancer) are among the surgical options. Radiation therapy may also be recommended after lumpectomy or mastectomy. Chemotherapy represents the only t herapeutic approach for inoperable breast cancer and it is the prefe rred treatment option for operable breast cancer patients either before or after surgical removal of the tumor. Taxane Chemotherapy A number of agents with estab lished cytotoxic activity are used in therapy; taxanes (paclitaxel (or Taxol) and docetaxel (Taxotere) are considered am ong the most active 11. 18


Taxol was first isolated from the Pacific yew, Taxus brevifolia in 1962. Its antitumor activity was immediately recognized, but due to the extremely low yield of drug obtained from the tree and the poor solubility, the in terest on the efficacy of this molecule was slow to rise 12. As the xenograft mouse model was introduced, the efficacy of Taxol in killing tumors prompted the introducti on of this drug in clinical trials in 1983 13. The successful entry of paclitaxel into clinical trials boosted an interest in understanding the mechanism of taxane-indu ced cell death. Wo rk done from Dr. Horwitz uncovered that paclit axel had a unique mechanism of action as it was found to act on microtubules 14, 15. However, later on, it was recognized that proteins targeted by this treatment, went beyond tubulin, acknowl edging that downstream targets of taxanes include mitotic checkpoint proteins 16. After the semi-syn thesis of Taxol was achieved, the use of this drug was approv ed for treatment of refracto ry ovarian cancer. From 1994 Taxol has been employed as chemotherapic agent for breast ov arian, colon and lung malignancies. In 2003 the American Chemical Society established that the discovery of Taxol was a National Historic Chemical Landmar k as life-saving co mpound in oncology 13. Taxanes Activity Although taxanes are successful in the select ive killing of tumor cells in clinical settings, current understanding of how this happens is controversial and incomplete. For a long time, apoptosis had been considered the main mechanism of cell death in response to taxane treatment. Currently, seve ral distinct models of therapy response are recognized 17-19, wherein different modes of tu mor cell death are likely determined by drug concentration 20 and genetic background of the cells within a tumor 21. 19


Taxanes bind to microtubles and inhibit their depolymerization and functions in both mitosis and interphase 14, 15, 22. At pharmacological concentrations, taxanes reversibly bind to a subunit of the tubulin heterodimers which forms microtubules; this accelerates polymerization and inhibits t he depolymerization of tubulin, disrupting microtubule dynamics. This event, in turn, activates a mitotic checkpoint which invokes mitotic arrest 23. This mitotic arrest does not persist indefinitely. After some period of time, cells usually undergo an aberrant exit fr om mitosis, characterized by the lack of metaphase, anaphase and cytokinesis. The nucl ear envelope is re-formed around individual chromosomes or groups of chromo somes producing large nonviable cells with multiple micronuclei, which are morphologica lly distinguishable from apoptotic cells. This type of cell death, known as mitotic ca tastrophe, is activat ed during mitosis as a result of deranged spindle formation couple d with blocks of different checkpoint mechanisms thus causing aberrant chromo some segregation and nuclear fragmentation 24-28. Taxanes and Mitotic Checkpoints Taxanes inhibit microtubules dynamics. But since the formation of the mitotic spindle, the attachment of kinetochores and correct chromosome partitioning all rely on microtubule dynamics, taxanes are also known as mitotic spindle poisons 29. The mitotic block observed upon taxane expo sure derives from activation of the Spindle Assembly Checkpoint (SAC) 19 which controls metaphase-anaphase transition by ensuring that all kinetochores are correctly attached to spindles before anaphase 23, 30, 31. When cells are exposed to conditions of prolonged mitotic stress in the presence of these toxins, the SAC is eventually inactivated and cells exit mitosis 32 as micronucleated or tetraploid 33. This abnormal mitotic exit is re ferred as mitotic slippage, or 20


mitotic catastrophe 34, 35 and is dependent upon the ubiquitination and proteolysis of cyclin B and Securin. Several mitotic checkpoint proteins, including MPS1, Survivin, CHFR, and members of Mad and Bub pr otein families (Mad1, Mad2, BubR1, Bub1 and Bub3), sense improper tension between kinetochores and microtubules of the mitotic spindle and transmit a signal to inhibit mitotic progr ession. Inactivation of these checkpoint proteins has been associated with ei ther increases in sensitivity or resistance to taxane treatment 36-40 and for Mad2 and BubR1 findings are controversial 36, 37, 41. The factors that determine pr olongation of mitotic block and, thus, resistance to treatment by taxanes, remain incompletely characterized. Inactivation of CHFR, mitoticassociated E3 ubiquitin ligase 42-44) which degrades the mitotic kinase Aurora A 45 leads to decreased sensitivity to mitotic spindle poisons 46. Down-regulation of breast cancer susceptibility gene 1 (BRCA1) by siRNA leads to increased taxane resistance in breast cancer cell line MCF-7 47. Another report describes the mi crotubule depolymerizing drug nocadozole to induce delay in mitotic exit upon depletion of p31comet in HeLa cells. p31comet acts in mitosis by counteracti ng spindle checkpoint function of Mad2 48. Thus, recent efforts have started to link sensitivity of tumor ce lls to taxane treatment with genetic defects in the cell cycle checkpoints in association with cancer chemotherapy. It has been suggested that inactivation of mitotic checkpoint proteins can contribute to the selective response of taxane treatment in vivo 49. However, mutations in known checkpoint proteins occur rather rarely 50, 51; thus broader studies are necessary to search for novel molecular targets of taxanes therapy. 21


Predictive Markers for Taxane Response Many cancer patients are resistant or become resistant to Taxol during drug administration 52-54. Over the last 30 years, basic research has provided invaluable support in developing therapeutic strategies, but unfortunately it has failed so far to understand how almost half of the patients develop therapy resistance 52, 53. Predicting and overcoming re sistance or incomplete response to these agents would represent a major improvement in the clinical management of breast cancer 55-57. Factors contributing to taxane resistance include: alteration in expression of tubulin or microtubules-associated proteins 58-60, multidrug-resistance 61, 62, deregulations in numerous cellular pathways 63 such as cell cycle control 64, cell proliferation 65, 66, apoptosis 67 and nuclear-cytoplasmic transport for both proteins and RNA 68, 69. Numerous studies support the evidence that SAC plays a pivotal role in taxane resistance. Spindle checkpoi nt defects have been described in increased sensitivity and resistance to paclitaxel and oftentim es results were controversial 36, 40, 41. Down-regulation of checkpoint proteins CHFR, survivin and Bub1 were shown to increase paclitaxel sensitivity 36, 38, 70. Conversely inactivati on of mitotic checkpoint proteins which lead to taxane resistance include BRCA1 47, Mad2 antagonist protein p31comet, 48 and Bub3 71. Among checkpoint proteins, Aurora A kinase has been linked to taxane resistance 72-74; it is amplified in breast cancer 75-77 and is over-expressed in several tumors 78-83 with poor prognosis 84-86. Protein Daxx: a Novel Player in Paclitaxel Resistance Daxx is 120 KDa highly conserved and ubiquitously expressed protein 87. We have found that sensitivity to paclitaxel treatment in breast cancer cell lines and mouse cells correlates with the level of Daxx, a ubiquitously expressed nuclear 22


protein. Upon paclitaxel exposure, cells with high levels of Daxx induce a transient mitotic block followed by mito tic catastrophe, while cells with low Daxx are blocked in prometaphase and continue proliferation after drug removal. While screening for Daxx expression in breast malignancy, we documen ted extensive heterogeneity of Daxx in primary breast c ancer specimens. Studies published from our laboratory showed correlation between Daxx and cellular response to paclitaxel 88. Cell lines with extreme level of Daxx: T47D (low level of Daxx, Daxx/actin = 1.0) and MDA MB 468 (high levels of Daxx Daxx/actin = 14.0) behaved very differently when exposed to paclitaxel. Results from colony formation assay showed a high survival rate of T47D cells (low level of Daxx) and low survival rate of MDA MB 468 cells (high level of Daxx) at all time-points tested. Thus, these data demonstrated that low levels of Daxx correla te with increased resistance to paxlitaxel treatment in breast cancer cell lines. To fu rther confirm this correlation, Daxx was depleted in MDA MB 468 breast cancer ce lls and HEp2 human epithelial carcinoma cells by stable expression of anti-Daxx shRNA. Depletion of Daxx by shRNAs reproduced the original finding that level of Daxx is critical for paclitaxel response 88. To this end it is essential to examine the function of Daxx as a novel mitotic checkpoint protein that determines sensitivity to paclitaxel and can be used as a predictive marker in selection of breast c ancer patients to receive taxane therapy. In addition, it will be important to determine the mechanism of this sensitivity by elucidating the role of Daxx in mitoti c progression. Identification of Daxx as a novel mitotic checkpoint release protein which determines resistance to taxanes, will aid in proper selection of patients to receive this ther apy and contribute to our understanding of 23


mechanisms that connect cell division, genome instability and breast cancer progression. Daxx: an Enigmatic and Controversial Protein The first description of protein Daxx dates back in 1997 when Yang et al. identified Daxx as a Fas death-domai n associating protein 89 in a yeast two-hybrid screen. The interaction between Daxx and the cytosolic portion of Fas was r eported to trigger a FADD-independent activation of the Jun N-te rminal kinase pathway, which in turn activated apoptosis. This report challenged the apoptosis field that not all the signals from the Fas receptor were mediated and translated in the cell by FADD. However reports which followed were unable to reproduce the same results 90. Data collected in mouse embryonic fibroblasts which were def icient in FADD or caspase-8 could not activate apoptosis thus suggesting that Da xx did not elicit a FADD independent pathway 91, 92. Most importantly other groups failed to reproduce Daxx and Fas interaction reporting also that t he apoptotic activation prompted by Daxx over-expression was not mediated by JNK 93. Contradictory evidence on the pro-apoptotic function of Daxx were also supported by the in vivo work done by the Leder group on Daxx knockout mouse. Loss of Daxx caused embryonic lethality by day 8.5-9, but quite unexpectedly it was not marked by proliferation abnormalities as la ck of a pro-apoptotic protein would. Conversely, Daxx knockout was characte rized by extensive apoptosis, supporting instead an anti-apoptotic function of Daxx 94, 95. In addition, to challenge the initial fi ndings, accumulating evidence, given by biochemical fractionations and immunofluorescence experiments, described Daxx as a nuclear protein 93, 96 with obvious ND10/PML body association in interphase cells 96. 24


Daxx binds to sumoylated PML via its two independent SUMO interaction motifs (SIMs) that results in Daxx accumulati on in the ND10/PML nuclear bodies 97, 98. In addition Daxx was found to co-localize at heterochromatin loci with ATRX a chromatin remodeling enzyme in a cell cycle dependent manner 99. Thus, these results raised the question on how a nuclear confin ed protein such as Daxx could trigger apoptosis by interacting with Fas, a membrane embedded protein. Indeed, Daxx localization has been object of a second di atribe. Using cellular biochemical fractionation of NIH-3T3 fibr oblasts, the Lalioti group showed that the majority of endogenous Daxx accumulated in the nuclear compartment while a minor part was detected in low-density microsomes 100. They also confirmed these finding by immunofluorescence staining, thus assuming t hat two distinct intr acellular Daxx pools may exist: one in the nucleus and another in the cytosol within low density microsomes. Intracellular localization of Daxx has al so been attributed to shuttling between cellular compartments in response to stresses 101-105 mainly to guarantee cell survival. Daxx was reported to re-locate from t he nucleus to the cytoplasm during glucose deprivation 105, 106, oxidative stress 105 and chemical hypoxia 102. These re-localization studies however were mostly done with ove r-expressed protein and were not supported by following studies. The fi rst conflicting report showed via biochemical separation that Daxx remains in the nucleus after expos ure to hydrogen peroxid e or UV treatment 107. The second, that we undertook, was done to analyze endogenous Daxx cellular localization using several cell lines, incl uding those that were reported to display cytoplasmic Daxx accumulation. None of the cell line, challenged wit h same or harsher stresses than those published, showed any redist ribution of Daxx fr om the nuclear to 25


cytosolic compartment by any means tested (immunofluorescence, time-lapse microscopy and biochemical fractionation) 108. Thus, while there is some tantalizing evidence to suggest existence and function of Daxx in the cytoplasm, more extensive studies of endogenous protein trafficking are required. Daxx spatiotemporal relocalization appears to occur within the nucleus in a cell cycle dependent manner 99 and in response to some stresses109. At the end of S-phase Daxx is relocalized from ND10 nuclear bodies to condensed heterochromatin by phosphorylated ATRX, a chroma tin remodeling protein 99. The biological role of this redistribution is still under in vestigation. It has been show that Daxx, along with other ND10-associated proteins can be released fr om ND10 into the nucleoplasm during heat shock and heavy metal exposure 109. Daxx has also been known to interact wit h the CENtromeric Protein-C (CENP-C) and relocalize to centromeres 110, 111. The function of this interaction has been recently uncovered in mouse cells 112 and will be discussed below. In summary, Daxx localization within t he nuclear compartment has been confirmed by a number of reports 113. Through its two independent SUMO interaction motifs (SIMs) Daxx binds to sumoylated PML in the ND10/PML nuclear bodies 97, 98. Daxx Structure Since its discovery, it was apparent that Daxx plays impo rtant roles in regulating a wide array of functions even if amidst some controversy. To orc hestrate these cellular processes, spanning from transcriptional regu lation to antiviral response which will be discussed in the next paragraphs, Daxx interacts with a long list of pr oteins (more than 50). However, the molecular mechanisms on how Daxx contributes to these disparate cellular functions, is unknown, mainly because the structural characterization of this 26


protein is poor. hDaxx is a 740-amino acid protein that was descr ibed to contain, a coiled coil region 111, a predicted "Pair of Amphiphatic Helices" (PAH) 114 and two SUMO interacting motifs (SIM) 97, 98. These poorly characterized domains have been used to set boundaries to design deletion constr ucts for Daxx to probe interaction with over 50 putative partner proteins 113. Future work was undoubtedly necessary for detailed and proper characterizati on of Daxx prot ein structure. DHB Domain Characterization of Daxx In collaboration with Dr. McIntosh, University of Vancouver Using NMR spectroscopy, we have demonstrated that the Cterminal half of Daxx is intrinsically disordered, whereas a folded domain is present at its N-terminus. This domain forms a left-handed four-helix bundle wit h topology which differs fr om the Sin3 PAH domains. This Daxx Helical Bundle (DHB) domain inte racts with the N-terminal residues of the tumor suppressor Ras-association domain family 1C (Rassf1C) which in turn folds into an amphipathic a-helix upon binding the Daxx domain. Indeed Daxx was reported to be able to recruit/sequester Rassf1C 115 in ND10 upon Rassf1C over-expression and the two proteins were shown to interact and regulate mitosis 116. Based on a proposed Daxx recognition motif as hydrophobic residues preceded by negatively-charged groups, we found that pepti de models of p53 and MDM2 also bound the DHB domain 117. This provides a structural foundation for understanding Daxx functions and molecular interactions. Daxx a Multifunctional Protein As described above, Daxx wa s identified as a proapoptotic Fas-interacting protein 89 and later demonstrated to have anti-apoptotic activity 94, 95, 118, is a ubiquitously expressed and highly conserved nuclear protein that also possesses intrinsic 27


transcription repression activity 119. Indeed the best characterized Daxx function is that of transcription co-repressor 120. Daxx does not bind directly to DNA but only indirectly 113. In several reports Daxx was described to be recruited through its SUMO interaction motifs, with sumoylated transcription factors 121-123 or chromatin modifiers such as HDAC2 124 and DNA methyltransferases 125. Some of these exam ples will be described in the next paragraphs. Daxx regulates also stability of p53 E3-ligase MDM2 through binding of Deubiquitinating Enzyme USP7 (also known as HAUSP) and hence can regulate p53mediated apoptosis. According to t he work initially published by Tang et al. 126, Daxx ultimately prevents MDM2 self-ubiquitination, enabling this E3 ligase to target p53 for proteolytic degradation 126, 127. Upon DNA damage Daxx-USP7-MDM2 complex dissociates so that MDM2 is destabiliz ed by self-ubiquitin ation and proteolitic degradation. This leads to stabilization and activation of p53. Daxx has also been described to interact with the CENtromeric Protein-C (CENPC) and localize to centromeres 110, 111. The functional significance of Daxx association with CEN/periCEN was dim until recent findings which identif ied Daxx-containing complex as a novel chaperone for histone H3.3 128, 129. This transcription-associated variant of histone H3 was recently shown to be enriched in repetitive regions of genome including telomeric and pericentromeric loci 129. Several studies have shown that Daxxmediated incorporation of H3.3 into MaSat in mouse cells correlates with transcription elevation from this region of genome 128 suggesting Daxx role in maintenance of heterochromatin structur e at these genomic loci 128. 28


Daxx Role in Mitosis Despite extensive characterization of Daxx intranuclear localization during interphase 90, 99 little is known about the localization of this protein in mitosis. It has been previously reported that the major Daxx housing domai n in interphase, ND10/PML bodies, undergoes dramatic changes during mi tosis with number of domains decreased 130-132 and protein composition of dom ains changed. ND10/PML bodies become depleted of Daxx, Sp100 and SUMO-1 concomitantly with a reported hyperphosphorylation of the PML protein 110, 133. As cells leave mitosis and re-enter G1, ND10 reform their interphase protein composit ion with Daxx reappearing at this domain 110. To analyze the localization of Daxx durin g mitosis, mouse cells were stained with Daxx antibodies, and DNA counterstained with Hoechst 33258. Localization of Daxx was evaluated and documented relative to stages of mitosis as determined by the degree of chromatin condensation and chromosome localization. In prophase Daxx is accumulated in a dot-like pattern characte ristic of ND10-the ma jor site of Daxx localization during interphase. The main transition of Daxx localization occurs when cells progress into prometaphase. Instead of a dot-like localiza tion, Daxx is visible in a pattern characteristic of mitotic spi ndles, where it remains during the end of prometaphase and part of metaphase (characterized by aligned chromosomes). Once cells proceed into anaphase (chromosome s eparation pattern), Da xx disappears from the mitotic spindle and remains diffuse during the end of mitosis 134. Another indication that Daxx may parti cipate in mitosis is the above mentioned interaction between Daxx and the intr insic kinetochore component CENP-C 111. Depletion of Ams2, a Daxx-like motif-containing GATA factor in S. pombe results in chromosome missegregation 135. 29


We found that Daxx-/embryos are developmentally retarded by day 8 and completely disintegrated by day 11.5 99. DNA staining of day 9.5 Daxx-/embryos revealed accumulation of mitotic cells in prometaphase and high level of apoptosis, while a dismal level of apoptotic cells and all mitotic stages were observed in Daxx+/+ embryos. Daxx+/+, Daxx +/and Daxx-/cell lines were collected from day 9.5 embryos; karyotyping of Daxx-/cells revealed high aneuploidy and genomic instability. All three tested Daxx-/cell lines were tri/tetraploid, wi th high heterogeneity in chromosome number between five metaphases analyzed for each of these cell lines. In general, a high level of genomic instability and aneuploidy is often observed upon depletion of mitotic checkpoint proteins 23, 136, confirming a potential function of Daxx in mitosis progression indicating prometaphase as a potential stage of Daxx activity. Daxx Role in Carcinogenesis Several reports show a connection wit h Daxx expression and carcinogenesis. Daxx over-expression has been documented within the stroma of prostate cancer samples 137. The role of Daxx in prostate cancer may be explained by Daxx functions as a co-repressor of the androgen receptor (AR) a hormone receptor essential for the homeostasis of prostate tissue 138. It was shown that Daxx can also negatively influence AR transcription activity in colon cancer cells 139 in a SUMO-dependent manner. Daxx decreased expression was found in tumor specimens of adenocarcinoma. The authors reported that this phenomenon can be explained by the loss of Daxx regulation of prolif eration and differentiation in colon cells 140. Another example of Daxx involvement in tumorigenesis, involves the protooncogene c-met, in which over-expression is documented in tumors, including breast cancer, and elevates metastatic potential. Ou r laboratory demonstrated that Daxx is a 30


repressor of c-met transcrip tion via HDAC2 recruitment/st abilization on c-met promoter. Inverse correlation between Daxx and c-Met in metastatic breast cancer specimens suggests potential function of Daxx as a c-met repressor during cancer progression 120. Thus, in breast cancer pathogenesis, reduced Da xx not only elevates taxane resistance 88, but also accelerates metastatic pr ogression via c-met up-regulation. A recent report also documented somati c mutations of Daxx gene in 25% of patients affected by pancreatic neuroendocrine tumors (PanNETs) 141. Among PanNETs the authors found collect ively 43% of tumor with mutated Daxx or its partner ATRX. Due to the reported activity of Daxx /ATRX complex in chromatin remodeling at repetitive G-rich sequences, like telomeres 112, 142, subsequent work was done to analyze telomere length in PanNETs 143. This study found that Daxx and ATRX mutations positively correlate with long telo meres, which were extended by alternative lengthening of telomeres (ALT), a mechani sm independent by the enzyme telomerase 143, 144. Taken together, these studies highlight Daxx role as tumor suppressor; further studies are needed to better characterize Daxx function in the process of carcinogenesis. 31


CHAPTER 2 MATERIAL AND METHODS Cell Culture HEp2, H1299 and HCT116 parental or p53-/cells were cultured in Dulbeccos modified Eagles medium (DMEM) supplem ented with 10% fetal bovine serum, 2 mM glutamine and 100 U/mL penicillin and 100 g/mL streptomycin (Gibco BRL, Carlsbad, CA) and grown in a humidified 5% CO2 incubator. MCF10A were obtained from American Type Culture Collection (ATCC, Manassas, VA) and we re cultured under recommended conditions. Taxol (Paclitaxel; Sigma, St Louis, MO, USA; 100 mM in dimethyl sulfoxide) was used at a final conc entration of 10 nM. Thymidine (Sigma) was dissolved in 1N NaOH for 1M stock and used at a final concentration of 2 mM. MLN8054 (Millennium Pharmaceuticals Inc., Cambridge, MA) was dissolved in DMSO at 5 mg/ml and used at 4 M final concentration. Immuno-precipitation and Mass Spectrometry Analysis Cells synchronized by DTB and blocked in 10nM Taxol were lysed 30 minutes at RT in lysis buffer consisting of 50 mM Tr is-HCL (pH 7.45), 150 mM NaCl, 1mM EDTA, 1% Triton X-100, in pres ence of 10 mM N-ethylmal eimide (Sigma), 5 mM iodoactetamide (Sigma), 1 mM phenylmethy lsulfonylfluoride (Calbiochem, EMD Chemicals, Gibbstown, NJ, USA), 1 mg/mL ap rotinin (Sigma), 1 mM leupeptin (Sigma), 1 mM pepstatin (Sigma). Lysate was then pr e-cleared by centrifugation at 1800g for 10 at RT and filtration trough 0.45 micron filter (Corning). Pre-cleared lysates (Input) were incubated with preconditioned FLAG magnetic beads for 3 hours at RT on end-over-end rotator. Beads were than wash ed four times with lysis buffer without protease inhibitors 32


and eluted by thrombin cleavage (1 enzyme uni t, New England Labs) for 30 in lysis buffer. Protein samples were then analyzed for ef ficiency of pull-down and co-IP by western blot analysis as described below. For Mass spectrometry analysis samples were loaded on Protean II precast gels 8-16% Tris-HCl (#161-1457, BioRad, Hercules, CA). Bands were then revealed with Novex colloidal blue staining kit (#LC6025, Invitrogen, Carlsbad, CA, USA). Immunofluoresence Immunofluoresence analysis was comp leted as previously described 116. Cells were fixed, permeabilized and then stained with the following primary antibodies: Daxx 5.14 monoclonal 99, PML 14 rabbit 96, USP7 (Bethyl labs, Montgomery, TX), Aurora A (Cell Signaling Technologies, Danvers, MA) and alpha-Tubulin (Sigma). Then labeling was done using appropriate FITCor Texa s Red-conjugated secondary antibodies (Invitrogen) and HOECHST (Sigma). Images were analyzed using Leica TCS SP5 confocal microscope. Western Blotting Protein samples were separated by 4-20% SDS-PAGE (Biorad), transferred to nitrocellulose membranes (Whatman, Da ssel, Germany) and blocked with 3% non-fat milk/PBS, 0.1% Tween (PBST). Primary antibodies to Daxx 677 rabbit (in house), USP7 rabbit (Bethyl labs), Cyclin B1 (Sant a Cruz Biotechnology, Santa Cruz, CA, USA), CHFR (Abcam, Cambridge, MA, USA), Au rora A (Cell signaling), Bub3 (BD Transduction Laboratories, Franklin Lakes, NJ, U SA), Actin (Sigma) or were diluted in 3% milk/PBST and incubated overnight at 4C. Membranes were then washed 3X with PBST for 1 hr at RT with appropriate secondar y antibody (Millipore, Billerica, MA, USA; 33


all 1:2,500). Membranes were then was hed with PBST and exposed using ECL reagent (Amersham, GE Healthca re, Pittsburg, PA, USA). Densit ometry analysis of cyclin B or CHFR and actin western blots was performe d using the Quantity One software from Bio-Rad. Transient and Stable Depletions For transient siRNA transfections smar t pools were purchased from Dharmacon and employed according manufacturer instructions. For stable depletion of HEp2, H1299 and MCF 10A cells a lentiviral expression system kindly provided by Peter M. Chumakov (Lerner Research In stitute, Cleveland 145 was used as previously described 116. shRNAs and Daxx 116, for control and USP7 were designed according to the Dharmacon siDESIGN algorithm. control shRNA was directed against base pairs 1262-1284 of SETDB1 (TCCTCTTTCTTATCCTCGTATGT). Time Lapse Microscopy Time lapse imaging of cells was performed according to 146. Briefly, control and Daxx-depleted HEp2 cells were stably transfected with GFP-histone H2B (gift of Dr. Duane Compton, Dartmouth) and analyzed by Leica TCS SP5 confocal microscope equipped with environmental chamber; images were taken ev ery 2 min. Mitotic stages were determined by three hallmark events including 1) first indication of chromatin condensation marked as late G2/prophase trans ition (T=0); 2) invagination of the nucleus marking the prophase/pro-metaphas e transition; and 3) beginning of chromosome segregation marking the metaphase/anaphase transition. Three experiments were completed for each sh RNA group with an average of 20-30 cells per experiment. 34


APC Assay Cellular pellets were resuspended in l ysis buffer (20mM Tris -HCl, pH 7.2, 2mM DTT, 0.25mM EDTA, 5mM KCl, 5mM MgCl2) on ice and subjected to 1,500psi N2 in a nitrogen disruption chamber. The lysate was spun for 15min at 15,000g. Supernatants were divided into single use aliquots and flash frozen in N2. For assays, extracts, on ice, were supplemented with an energy regener ating system (30U/m L rabbit creatine phosphokinase type I, 7.5mM creati ne phosphate, 1mM ATP, 1mM MgCl2, 0.1mM EGTA), non-destructible cyclin B, and cycloheximide. Proteins were then added in a final volume of 14mL. 35S-labeled substrate (1mL) wa s added; aliquots were made and shifted to 30C. Samples were quenched at the indicated times by the addition of sample buffer, resolved by SDS-PAGE and imaged using a Typho on phosphorimager (GE Healthcare). Mitotic Stages Assessment Cells were transiently depleted by contro l or USP7 siRNAs (Dharmacon, Thermo Fisher Scientific, Waltham, MA, USA). 72h post-transfection cells were fixed and than DNA stained with hoechst 33342. Mitotic stag es were determined by microscopy and were categorized as prophase-prometaphas e (P), metaphase (M) or anaphase (A) or telophase (T) according DNA morphology. Mitotic stages assessment for each sample was conducted counting at least 100 mitotic events per experiment. Micronuclei Scoring Cells stably depleted by control or USP7 shRNAs were grown on coverslips than fixed and stained for DNA according to immu nofluorescence proce dure. The criteria adopted for of micronuclei (MN) scoring were previously described 147, 148. MN score represent the number of MN per cell. For each sample at least 300 cells were counted. 35


Colony Formation Assay Cells exposed to control or 10 nM Taxol were originally plated on 3.5 cm dishes (Corning) for treatment. Follo wing exposure, cells were tr ypsinized and re-plated (in triplicates) at 1:1,000 dilution on six well plates (Corning, Lowell, MA) for colony formation analysis. Five to seven days afterwards, colonies were stained with crystal violet and counted. Immunohistochemistry For this study, twenty two women were identified with locally advanced HER-2 non-amplified breast cancer that were treated with standard taxane/anthracycline based neoadjuvant chemotherapy at H. Lee Moffitt C ancer Center. Initial core biopsy was performed for the diagnosis and all patient s underwent neoadjuvant chemotherapy followed by definitive surgery with either lumpectomy or mastectomy and axillary lymph node dissection. Two patients had invasive l obular carcinoma, one patient papillary carcinoma, while the remainder had invasi ve ductal carcinoma. Four tumors were hormone receptor negative and eighteen tumors were hormone receptor positive. Tissue blocks were obtained from initial biopsy (prior to neoadjuvant chemotherapy) to perform immunohistochemical staining for Daxx Slides were de-paraffinized with xylene and re-hydrated through decreasing concentrati ons of ethanol to water, including an intermediary step to quench endogenous peroxidase activity (3% hydrogen peroxide in methanol). For heat-induced antigen retrieval, sections were heated in a water bath at 95C while submerged in Trilogy buffer (Ce ll Marque, Hot Springs, AR) for 25 minutes and afterwards incubated with a universal protein blocker Sniper (Biocare Medical, Walnut Creek, CA) for 15 min, RT. Monoclonal mouse anti-Da xx 5.14 was added o/n at RT. Mach 2 goat anti-mouse-horse radish peroxidase-conjugated (Biocare Medical, 36


Walnut Creek, CA) was then added for 30 min, RT Detection of Daxx was achieved by incubating slides in 3 di aminobenzidine (Biocare Medica l, Walnut Creek, CA) for 15 min, RT. Slides were counterstained wit h hematoxylin (Vector Laboratories Inc., Burlingame, CA) for 10 sec and mounted with Cytoseal XYL (Richard-Allen Scientific, Kalamazoo, MI). Slides were analyzed us ing Leica DM2000 microscope and pictures were taken using Leica DFC480 CCD camera with Leica FireCam 1.7.1 software. For each specimen, at least one thousand cells were examined for Daxx expression, and the number of cells with an evident signal were recorded and categorized by the intensity of staining (0 for undetectable, 5 fo r highest) of Daxx multiplied by the percent of staining cells (Daxx score). Mouse Xenografts HEp2 xenografts were generated in Nu/Nu mi ce by subcutaneous injection of 5 x 106 HEp2 cells containing a 1:1 mixture of ma trigel (BD Bioscience)/DMEM suspension. Tumors were monitored daily and grow n to a volume of approximately 150 mm3 (day 79 after cell injection) before drug treatment Vehicle (1 part of 1:1 solution of 50% EtOH/Cremaphor EL (Sigma) to 10 parts of PBS) or 20 mg/kg Taxol (LC Laboratories, Woburn, MA; Paclitaxel stock = 25 mg /mL dissolved in EtOH/Cremaphor EL) was injected intraperitoneally (IP) every second day for a total of five injections. Up to fifteen animals were used for each experimental group. Tumor volume was measured by calipers and calculated on a daily bas is using the formula V= (1/6) a(b)2 where (a) and (b) are the measured length and width (millimeters) of the tumor, respectively. Increases or reductions in tumor size were determined according to the relative initial tumor size beginning on day one of injection. Experiment was terminated at day 15 of first drug injection or when tumor volume reaches 1000 mm3. 37


Metaphase Spreads and Karyotyping HEp2 and H1299 cells stably ex pressing control or USP7 shRNAs were treated with 50 ng/mL colcemid (Invitrogen, Carlsbad CA) for 2 hours. Similarly, MCF10A cells were treated with 50 ng/mL colcemid fo r 16 hours before proc eeding with metaphases preparations. Cells were collected and resu spended in a hypotonic solution of 2% KCl and 2% Na3C6H5O7 for 7 minutes at 37 C. Metaphase spreads were then prepared and stained with Giemsa-trypsin (G-band) procedure. Analysis was carried out using the OLYMPUS BX41 microscope equipped wit h a BASLER scA1400-17gmASI digital camera. Images were analyzed using the Applied Spectral Imaging (ASI) software V7.0.6.8860. Unless stated differently, fo r each experiment at least one-hundred metaphases for each sample were counted. 38


CHAPTER 3 CELLULAR LEVELS OF DAXX CORRELATE WITH TAXANE RESISTANCE Introductory Remarks Taxanes, a group of cytotoxic drugs which includes paclitaxel (Taxol) and docetaxel (Taxotere), are among the most successful anticancer agents for breast cancer chemotherapy 11, 18, 149. Taxanes affect microtubule stability, but mutations or alterations in tubulin occur very rarely in cancers 150. Taxane activity affects mainly mitotic checkpoints 16, 151 and leads to a prolonged arrest of cells in mitosis, that will eventually trigger cell death 21 by a mechanism still largely unknown 17, 152-154. Currently, many mitosis-related proteins have been scrut inized for their ability to affect taxane sensitivity, but like tubulin, many of thes e proteins are unaltered in cancer and cannot explain the majority of drug resistance s een in patients exposed to these compounds. Many breast cancer patients are resistant or become resistant to taxanes during drug administration 52-54. A number of studies have been carried out to determine a genomic profile that could be pred ictive for taxane treatment 63, 155-158. Despite the extensive efforts toward identification of predictive markers for taxane treatment in breast cancer, the clinical applications of results have been limited. This was partly due to lack of reproducibility of methods among several groups 159 but also to the fact that the loss of checkpoint genes involved in mito tis and taxane response rarely occurs in cancer 50, 51. In addition, these approaches do not acc ount for the fact that regulation of mitosis occurs largely at the post-translational level 160. Giovinazzi S, Lindsay CR, Morozov VM, Escobar-Ca brera E, Summers MK, Han HS, McIntosh LP, Ishov AM. Regulation of mitosis and taxane response by Daxx and Rassf1. Oncogene. 2012 Jan 5;31(1):13-26. doi: 10.1038/onc.2011.211. 39


Thus, predicting and overcoming resistance or incomplete response to these agents would represent a major improvement in the clinical m anagement of breast cancer 55-57. Functional screens have been directed at findi ng novel targets affecting sensitivity to Taxol and other compounds but it remains unclear whether these targets play a direct role in Taxol sensitization or offer pro gnostic value to clinicians 161. The existence of a mitotic stress checkpoint(s), separate in function from the SAC has been proposed in regard to cells that have been exposed to spindle toxins like Taxol 46. Thus, it is essential to identify these mito tic guardian proteins or pathways involved in Taxol sensitization/resistance because fore knowledge of these targets may prove useful for proper selection of patients for taxane-based chemotherapy. To this end, we sought to further understand the phenomenon of Daxx-dependent Taxol resistance related to mitosis and to determine its importance in tumors subjected to this type of chemotherapy. Intrinsic and acquired resistances to taxanes represent the most limiting factors to the successful treatment of breast cancer patients. Exploring the mechanism of Daxx-bas ed resistance, we observed that, upon Taxol treatment, cells with reduced level of Daxx remain in a prolonged mitotic arrest and complete cell division after Taxol removal, while cells with high levels of Daxx exit from Taxol-induced mitotic block as micro-nucleated cells incapable for proliferation in cell culture settings 88, 116. Daxx is a highly conserved and developm entally essential nuclear protein 94, 99, 108. Daxx is involved in numerous cellular pr ocesses such as transcriptional regulation 113, 40


anti-viral immunity 162, apoptosis 90, 95 and carcinogenesis 163, 164. Exploring the mechanism of Daxx-based resistance, we observed that, upon Taxol treatment, cells with reduced level of Daxx remain in a prolonged mitotic arrest and complete cell division after Taxol removal, while cells with high levels Daxx exit from Taxol-induced mitotic block as micro-nucleated cells incapa ble for proliferation in cell culture and xenograft settings 88, 116. Results Duration of Mitotic Stages is Affected in the Absence of Daxx Resistance to Taxol was observed in human breast cancer (MBA-MD-468) and human larynx carcinoma (HEp2) cells with experimentally reduced Daxx 88. To understand the function of Daxx in Taxol response, we utilized HEp2 cells expressing control or anti-Daxx short hairpin RNAs (shR NAs) (Figure 3-1a). We used this model cell line as taxane-based therapy is one of treatment options in head and neck cancer 165 and given the ability of HEp2 cells to recapitulate the Daxx-dependent Taxol response observed in breast cancer cell lines as shown previously 88. HEp2 cells were synchronized using a double thymidine block and released for cyclin B protein level analysis to monitor G2/M /G1 progression. Although control shRNA cells showed destruction of cyclin B by 9 h post-thymid ine release, Daxx-depleted cells showed prolonged stabilization of cyclin B at 9.5 h post-release, suggesting that Daxx is required for normal mitosis (Figure 3-1b). Next, we studied mitotic progression by timelapse microscopy in controland Daxxdepleted cells stably transfected with histone H2B-GFP. The occurrence of chromatin c ondensation in Daxx-depleted cells was more rapid, indicating faster progression of prophase compared with control cells (Daxx shRNA cells had average 7.5 min and control shRNA average 10.2 min). Contrarily, the 41


average prometaphase/metaphase timing of Daxx depleted cells (37.6 min) was longer than in control depleted cells (average 31.2 min). No differences in mitotic progression were observed in control shRNA compared with parental HEp2 cells (data not shown). The combination of these data suggests that depl etion of Daxx in human cells results in perturbation of normal mitosis, implying t hat Daxx is necessary for proper mitotic progression. Cyclin B is Stabilized in Daxx-Depleted Cells Treated with Taxol Cells with reduced Daxx display increased resistance to Taxol treatment because the majority of cells arrest in mitosis for longer period of time (and thus are able to complete normal division upon Taxol wash-out), while control cells exit mitosis towards micro-nucleated cells (and stop pr oliferation). A similar effe ct was previously observed upon cell exposure to low or high Taxol concentrations 88. We sought to understand the Taxol resistance phenomenon more in depth by analyzing the cyclin B levels in synchronized control, Daxxdepleted cells upon 10 nM Taxol treatment. Whereas cyclin B protein levels decreased by 13 hrs pos t-release in control cells, it was stabilized in Daxxdepleted cells (Figure 3-2). St abilized cyclin B upon Daxx depletion is a biochemical indication of cells arrested in mi tosis, while control cells exit mitosis by micronucleation, as confirmed morphologically for Daxx-depleted cells 88. Daxx is not Required for Activation of the Anaphase Promotion Complex (APC) in vitro for Degradation of Mitotic Cyclins To determine whether Daxx was required for the activity of mi totic E3 ubiquitine ligase APC/C or release from the spindle checkpoint, we utilized an in vitro system using mitotic extracts, which recapi tulates both of these activities 166. APC activity was determined by monitoring the destruction of radio-labeled Securin which remained 42


stable throughout all extracts derived from cells (contro lor Daxx -depleted) and confirmed an active spindle checkpoint (Fig ure 3-3a). During the incubation, extracts undergo a slow spontaneous release from spindle checkpoint-mediated inhibition. The loss of Daxx did not delay the kinetics of this release, suggesting that it is not required for direct activation of the APC upon checkpoint silencing. We tested this idea directly, by asking whether the Mad2 antagonist, p31Comet, was able to induce APC activity toward Securin in these extr acts. Addition of p31Comet to control as well as Daxx deficient mitotic extracts (produced from mi totic cells in either nocodazole or Taxol block) resulted in equal activation of the APC and subsequent destruction of Securin (Figure 3-3b) while addition of recombinant Da xx protein did not induce activation of the APC (data not shown). Taken together, thes e results imply that the prolonged mitotic arrest observed upon Daxx depletion is not due to an inability to activate the APC, at least in vitro However, as the mechanism(s) of spindle checkpoint silencing/release are poorly understood, we cannot exclude t hat Daxx may participate in an upstream event that is not recapitulated in our in vitro settings. Analysis of Mitosis Related Proteins upon Daxx Depletion Daxx exhibits transcrip tion repression activity 113; thus it could potentially regulate mitotic progression and Taxol sensitivity repressing mitotic checkpoint proteins. In this regard, Daxx depletion does not change ac cumulation of several mitosis-related proteins including Cdc27, Cdc20, and Mad2 (Figure 3-4a). No cell cycle specific changes of Daxx protein level were observed either (Figure 3-4b). The combination of these data may suggest that Daxx-mediated Taxol sensitivity is independent of the previously reported transcripti on repression activity of Daxx, at least for tested SACrelated proteins. 43


Daxx Dependent Tumor Response to Taxol Next, we sought to understand the import ance of Daxx in tumor response to Taxol using neoplasm generated by a xenograft system. Taxane-based therapy is one of treatment options in head and neck cancer 165; therefore, we assessed the antineoplastic activity of Taxol exerted on tumors generated from controlor Daxxdepleted HEp2 larynx carcinoma cells. By comparing the daily changes in tumor volume (beginning of treatment at approximately 150 mm3 of tumor) between Taxol and vehicle treated groups, we could determine regressi ons in tumor growth. Response to Taxolof control neoplasms compared to vehicle was markedly shar per due to the sudden drop in volume even after the first injection of drug. The regression trend was observed further after the 2nd-5th drug administration from day 411 (Figure 3-5a). This drug response, in contrast, was reduced in Daxx -depleted xenografts as the sizes of Taxoltreated tumors in these groups closely followed that of vehicle-administered tumors. The residual tumor size (calculated as a ratio of sizes between Taxol-injected to vehicleinjected tumors at the end of experiment ) of Daxx-depleted tumors after five administrations of Taxol averaged to be 0.65 while the residual size of control-depleted tumors was much smaller at 0.27 (Figure 3-5a). We concluded that tumors generated from Daxx-depleted cells had reduc ed response rate to Taxol administration compared to control-depleted tumors. Taxane-induced Mitotic Catastrophe in Xenografts We reasoned that the differential Taxol response of these tumor groups may, in part, be linked to the cellular outco mes as documented previously 88: Taxol-resistant cells arrest in a prolonged mitotic state with sustained cyclin B protein levels and continue cell division upon drug decay, while non-resistant cells exit mitosis forming 44


micronucleated cells incapable of entering nex t cycle. To address this possibility, we analyzed cellular morphology at tumor xenogra fts sections. Based on DNA staining, cells were categorized as 1) interphase, 2) mitosis, 3) apoptos is, and 4) micronuclei 88. In control shRNA xenografts, we observed an increased number of micronucleated cells (indication of Taxol response) after 2nd and 5th injections of Taxol, elevating to 50% at the end of treatment In contrast, the num ber of interphase and mitotic cells (indication of Taxol resistance) in Daxx-depleted xenogra fts remained high, while micronuclei were low (less than 10% at the end of tr eatment), suggesting that cells keep cycling (Figure 3-5 c). Occurrence of apoptotic cells was similar across all xenografts and increased marginally upon Taxol exposure. Thus, in current experimental settings, depletion of Daxx elevated resistance of experimental tumors to Taxol treatment, with majority of cells continuously cycling whil e tumors derived from control-depleted cells formed micronuclei and thus stop proliferation. In Breast Cancer Patients, Daxx is a Pr edictive Factor for Paclitaxel Response To address the clinical ramifications of Daxx regulation of taxane se nsitivity, twenty-two women with locally advanced HER-2 non-amplified breast c ancer who were treated with standard taxane and anthracycline based neoadjuv ant chemotherapy at H. Lee Moffitt Cancer Center were identified for this study. Patients were classified as either responders or non responders based on the clinical response measured with the longest diameter by physical examination performed by the treating physician at the time of encounter, with responders experie ncing >75% reduction. Daxx score was calculated based on the Daxx IHC staining intensity multiplied by the percent of staining cells. Based on the above definition of response, 10 patients were classified as responders and twelve as non-responders. Co mparison of pretreatment samples 45


between the responders and non-responders was performed using an independent sample t test. Responders to therapy had a higher mean Daxx score compared to nonresponders (Figure 3-6; p=0.06) This data suggested that Daxx score could predict the response to neoadjuvant taxane and anthra cycline based chemotherapy. The small sample size and the retrospective nature of the study are the main limitation of this finding that will be further validated in a future prospective study. Summary of Results In this chapeter, we presented several evid ences that levels of Daxx determine taxane resistance in 1) cell lines (see text), 2) mouse xenografts (Figure 3-5) and 3) breast cancer patients (Figure 3-6). Moreov er, we showed that this resistance is determined by Daxx-dependent r egulation of mitotic progression, as documented by 1) elevated stability of cyclin B (Figur es 3-1 and 3-2); 2) prolongation of prometa/metaphase stages of mitosis (see text ). We also found that Daxx does not affect directly APC, at least in in vitro setting (Figure 3-3), necessi tating in vivo study to pin Daxx function in mitosis and taxol resist ance. Studies presented in this chapter have established new roles for Daxx in cell cycl e progressionthe importance of which may be intensified because of its f unction as a trigger for Taxol sensitizationwhich adds to our understanding of mechanisms linking ce ll division, chemotherapy response and cancer progression. Discussion Taxane chemotherapy is considered am ong the most responsive treatment options for many cancer patients, either alone or as adjuvant in combination with anthracyclins 11. Nevertheless, large numbers of patients are resistant or become resistant to taxane therapy during treatment. The response rate of docetaxel is ~50% 46


even after the first-line chemotherapy adm inistration and decreases to 20-30% by secondor third-line administration 52, 53. Thus, development of new genomic prognosis factors and in-depth understandi ng of drug activity on both a cellular and organism levels are needed for optimizat ion of adjuvant therapy and proper patient stratification. Numerous studies have been carried out to det ermine a genomic profile that could be predictive to taxane treatment 155-159 while alternative appr oaches have sought to understand selective resistance to taxanes to decipher mechanisms which regulate responses 150, 167, 168. Inactivation of mitotic proteins can contribute to the selective response of taxane treatment in vivo 49. Divergent response to Taxol exposure is usually seen in cells deficient of mitotic che ckpoint proteins or other regulators of cell division. To date, loss of f unction of the majority of mi totic proteins, including Mad2, Bub1 and BubR1, and response to paclitaxel is controversial. Hence, identification of factors, that increase drug resistance upon i nactivation, is largely incomplete or uncharacterized. To this end, Daxx was verified as a novel regulator of Taxol response in cell culture conditions, animal models and primary human tumor specimens. Human breast cancer cells and larynx carcinoma HEp2 cells with experimentally modified levels of Daxx, show reduced responses to Taxol as previously described 88. A mouse xenograft system also recapitu lates our initial findings, becoming the first indication that Daxx could be important for t he fate of tumors exposed to taxane based chemotherapy (Figure 3-5, panels A and B). We also found t hat control groups displayed an increased amount of micronuc leation upon Taxol treatment, which may a ccount for the rapid loss of xenografts tumor volume observed in these regimental settings (Figure 3-5, panel C). 47


In contrast, Daxx-depleted tumors displa yed increased mitotic and interphase index (Figure 3-5, panel C), indicating that cells were capable to maintain mitotic block via elevated cyclin B stability (Figure 3-2) and continue proliferation after Taxol decay that happens fast in nude mice 169. Thus, mitotic cells from Daxx-depleted tumors can potentially reenter G1 after drug decay, pr oviding a working model for how cells or tumors devoid of either of these protein targets can su rvive chemotherapy treatment and proliferate (Model in Figure 3-7). The nature of Daxx function in cells is largely attributed to regulation of apoptosis or transcription. While this functionalit y is debatable in many circumstances, the prevailing idea of the role of Daxx is that of a modulator or adapt er of many cellular functions which are critical to cell vitality 113. Indeed, Daxx has bee n found critical and necessary for embryonic development in mice as Daxx-/embryo s exhibit extensive apoptosis and lethality by E11.5 99, 170. In addition to function in Taxol response, we also report an unexpected role of Daxx in the regulation of mito sis. In the absence of Daxx the duration of prophase and the prometaphase/metaphase transit ion is altered. Indeed, the stability of cyclin B protein is changed in the absence of Daxx as well (Figure 3-1). This may suggest that the activity of E3 ubiquitin ligase APC is altered in the abs ence of Daxx. We attempted to study the role of Daxx as direct regulator of APC usi ng an in vitro assay, but the results were undistinguishable (Figure 3-3), suggesting that cellular in vivo mitotic environment is necessary for proper execution of Daxx function in mitosis. Differential degradation of cyclin B in Daxx -depleted cells could also be due to mis-regulation of cyclin B on a different operationa l level, namely, the alterati on in stability of the APC 48


activator Cdc20 171. However, we found no differences in and accumulation of Cdc20 as well as Cdc27 and Mad2 (Figure 3-4). In ad dition our results indicate that upon Daxx depletion and taxane exposure both dynamics of degradation and/or accumulation of cyclin B levels are affected. Evidences presented in this chapter sugges t that Daxx represents a trigger for cellular Taxol sensitivity.These findings in addition to recently reported functions of Daxx repression of c-met oncogene expression 120 and Daxx mutation in tumors141, 143, may further uncover Daxx role in tumor progr ession. In the future, Daxx may serve as useful molecular marker for proper se lection of cancer patients for taxane chemotherapy. In order to achieve this goal, clinical studies additional to presented here (Figure 3-6) will be required examining t he status of Daxx expression in tumors before and after taxane treatment as well as studies in patients with an established history of taxane resistance. Daxx expr ession vary in breast cancer cell lines 88, but the mechanism of Daxx down-regulati on has largely been unstudied. 49


Figure 3-1. Daxx-dependent stability of cyc lin B. (a) Western blot analysis of Daxx depletion in HEp2 cells. (b) Controland Daxx depleted HEp2 cells were synchronized by a double thymidine block (0 h) and then released into normal media for progression through mitosis (6 h). Top: Western blot analysis of cyclin B protein stability. Bottom: Relative quantizat ion of cyclin B protein levels (normalized to actin). Cyclin B protein is stabilized longer in Daxxdepleted cells (at 9.5 h, post-thymidi ne release), indicating that Daxxdepleted cells are delayed in mitosis. Da ta show a representative experiment out of four. 50


Figure 3-2. Depletion of Daxx prolongs cyclin B stability. Western blot analysis of cyclin B protein stability in HEp2 controlor Daxx-siRNA cell s treated with Taxol for the indicated amount of time (6 h). Cells were synchronized using DTB and released (0 h) into normal media containing 10 nM Taxol. The bottom panel: densitometry analysis of cyclin B nor malized by actin; for each cell line, the cyclin B/actin ratio at 0 h set as 1.0. Whereas cyclin B protein levels rapidly decrease by 13 h post-thymidine release in control shRNA cells, cyclin B protein levels were stabilized longer in Daxxand Rassf1A-depleted cells (through 22 h, post-thymidine release) indicating that Daxx and Rassf1A depletion prolongs exit from mi tosis in response to Taxol exposure. Data show a representative ex periment out of three. 51


1 5 3 0 4 5 6 0 9 0Time (min) Control shRNA Daxx shRNA N o c o d a z o l ePaclitaxel1 5 3 0 4 5 6 0 9 0 1 5 3 0 4 5 6 0 9 0 Time (min) Control shRNA Daxx shRNA A B Figure 3-3. Daxx is not required for in vitr o activation of the APC. A) Extracts were generated from nocodazole-arrested cells expressing controlor DaxxshRNAs and the stability of the APC substrate Securin, labeled with 35S, was monitored by autoradiography. B) Extrac ts were generated as in (A) from cells treated with 10 M nocodazole or 10 nM Taxol (paclitaxel). The requirement for Daxx to activate the APC was tested by addition of the Mad2 antagonist p31 Comet. 52


Figure 3-4. Analysis of mitosis-related pr oteins. A) Analysis of mitotic checkpoint proteins in controland Daxx-deplet ed cell lines. Parental HEp2 cells and cells stably expressing control or tw o independent anti-Daxx shRNAs were analyzed by Western blot for levels of Cdc27, Cdc20, and Mad2; proteins levels are unchanged. B) Cell cycl e-dependent expression of Daxx. HEp2 cells were synchronized using a double thym idine block to arrest cells in the G1/S-boundary and then released and allow ed to progress through S, G2, M phase (0-11hr post thymidine release, compare with cyclin B dynamics on Figure 3-1). Daxx protein level sh owed no significant changes during cell cycle. 53


Figure 3-5. Depletion of Daxx increases resistance of experimental tumors to Taxol. Controlor Daxxdepleted tumors derived from injection of HEp2 cells into Nu/Nu mice were treated with vehicle or 20mg/kg Taxol. A) Table summarizing key statistical data generated from tumors exposed to vehicle or Taxol regimens. Relative tumor si zes for vehicle (A) or Taxol-treated tumors (B) were recorded at the end of treatment and the relative residual tumor volumes were calculated by dividing the values from (B) over (A). B) Graphs charting the changes in relative tumor size of control-or Daxxdepleted xenografts exposed to vehicle or Taxol. Asterisks at day number (x axis) denote time of inject ion of vehicle or Taxol (days 1, 3, 5, 7, 9). Note discrepancy in tumor growth in vehicle and Taxol treated tumors in control shRNA groups, while the rate of grow th in Daxx-shRNA group exposed to Taxol have reduced response. C) Treatme nt response at cellular level. Tumor xenografts were extracted 24 hours following the 2nd or 5th Taxol injection or at the end of experiment (day 15) and cellular response was analyzed based on appearance of chromatin (stained for DNA) by light microscopy and characterized as 1) inter phase, 2) mitotic, 3) micronucleated, and 4) apoptotic as described previously88. Control xenografts exhibited an increased number of mi cronucleated cells (indication of Taxol response), while Daxx-depleted xenografts show increased numbers of mitotic and interphase cells (ind ication of Taxol resistance and continuous proliferation) and correspondingly less micronuclei; numbe r apoptotic cells is similar among groups. 54




Figure 3-6. Daxx levels have reverse corre lation with taxane chemotherapy response in breast cancer patients. Twenty-two women with breast cancer who were treated with standard taxane and anthracycline based neoadjuvant chemotherapy were classified as either responders (up to 75% reduction of tumor size; 10 patients) or non-responder s (less than 75% reduction of tumor size; 12 patients). Daxx score was calculated based on the Daxx IHC staining intensity multiplied by the percent of staining cells. Comparison of pretreatment samples between the responders and non-responders was performed using an independent sample t test. Responders to therapy had a higher mean Daxx score compar ed to non-responders (p=0.06). 56


+Daxx -Daxx CycB degradation CycB stability Figure 3-7. Model of Daxx-dependent Taxol response. At pharmacological concentrations, Taxol reversibly inhibits micr otubule dynamics blocking cells in prometaphase. Cells that are sensitive to Taxol activate mitotic block only transiently, followed by cyclin B proteol ysis, micronuclei fo rmation, block of proliferation and cell death, while Daxx negative ce lls have a more prolonged prometaphase block due to elevated cyc lin B stability; they continue proliferation after drug decay/withdrawal and microtubule dynamics restoration--thus surviving chemotherapy. 57


CHAPTER 4 DAXX INTERACTS WITH UBIQUITIN SPECIFIC PROTEASE-7, USP7, TO REGULATE MITOSIS AND CELLULAR TAXOL RESPONCE Introductory Remarks Taxanes (paclitaxel and docetaxel) are pow erful drugs for breas t cancer treatment; however, a large number of patients are resist ant to this therapy for unknown reasons. Therefore it will be essential to develop pr ognostic tools and predictive markers to differentiate the patient population for appropriate chemotherapy selection. According to our model (Figure 3-7), Daxx deficient cells cannot resolve prometaphase/metaphase transition as efficiently as control cells. This would explain the observation that, upon tax anes treatment, cells with a low Daxx expression are protected from mitotic cata strophe and are able to complete mitosis and survive after taxane decay. Given high level of taxane resist ance in clinical conditions, we attempted to understand the role of Daxx in such re sistance and cell cycle regul ation (Chapter 3). We demonstrated that low levels of Daxx in duce stabilization of cyclin B which allows cells exposed to taxanes to stay in a pr olonged mitotic arrest and escape action of chemotherapy. Growing evidence describes mitosis as a dynamic process controlled by multiprotein complexes 172, 173. Considering the ability of Daxx to interact and recruit a wide variety of partners 113, it is highly probable th at additional proteins may participate in the Daxx-dependent checkpoint r egulation as well as contribute to taxane chemotherapy resistance. To this end, we used a functional proteomic approach to isolate Daxx-containing multiprotein complex upon paclitaxel tr eatment. The hypothesis was that the identification of a Daxx interacting mitotic network could speed up detection of new 58


markers of taxane resistance and lead to the development of new approaches to combat this resistance. Our proteomic analysis identified Ubiquitin Specific proc essing Protease-7 (USP7) as the most abundant protein in Daxx mitotic complex. USP7 is also known as Herpes-virus A ssociated Ubiquitin Spec ific Protease, or HAUSP, because it was first identified playing a role in antiviral response by interacting and regulating stability of a herpes virus E3-ubiquitin ligase 174-176. USP7 is a deubiquitylating enzyme or DUB 177, which, by catalyzing the removal of ubiquitin chains from substr ate proteins, rescue them from degradation. Due to the roles of its substrates, USP7 is involved in dis parate cellular processes, in normal or stressed conditions 127, 178-180. USP7 partakes in transcriptional regulation by stabilizing the transcription factor REST essential for the maintenance of neuronal stem/progenitor cells 181, 182. USP7 participates in DNA damage response by stabilizing Claspin 183, an adaptor protein that controls duration of stress checkpoint response 184. Deubiquitylating activity of USP7 has been shown to regulate mono-ubiquitylation of tumor suppressor PTEN 179 and transcription factor FOXO4 185, thus enabling nucleoplasm-cytosol shuttling of these proteins. USP7 has been described also in epigenet ic regulation due to its role in stabilization of PRC1 complex subunits (MEL18 and BMI1), and regulation of monoubiquitylation of the histone H2B 186-188. A recent study reported that USP7 can interact and increase the activity of DNMT1 in vitro though binding, suggesting that USP7 can play an important role in DMNT1-mediated epigenetic maintenance 189. 59


The interest on USP7 biological roles spiked when it was shown that USP7 regulates the fate of the tumor suppressor p53 190, 191. The Gu lab reported that USP7 directly interacts and stabilizes p53. Ho wever subsequent genetic studies demonstrated that this USP7 mediated regulation of p53 is not the predominant one in cells. Contrarily to what was expected, genetic inactivation of U SP7 in mice resulted in p53 stabilization, data not compatible with the noti on of p53 as major USP7 substrate 192, 193. Indeed, later on, it was demonstrated that U SP7, in association with Daxx, regulates p53 127, 191, 192, via MDM2 126, the E3 ubiquitin ligase that antagonize p53. In interphase, Daxx forms a bridge between USP7 and p53-specific E3 ligase MDM2 126, 127, 191, 192. In normal conditions, this ternary complex allows USP7 to remove the ubiquitin moieties from self-ubiquitylated MDM2. Stabiliz ed MDM2 in turn can ubiquitylate p53 and maintain the levels of this protein low thr oughout the cell cycle. In response to genotoxic stress Daxx-USP7-MDM2 ter nary complex promptly dissociates, inducing therefore MDM2 self-destruction and stabilization of p53. These results explain the early lethality observed in USP7 knockout mice (Embryonic day 3.5) where cells isolated from these embryos are characterized by loss of MDM2, abnormal accumulation of p53 with consequent cell proliferation arrest and apoptosis 194. However, deletion of p53 gene in USP7 knockout mice was not able to re scue USP7 induced embryonic lethality (contrarily to what was show n for MDM2 knockout mice 195), providing the genetic proof of the importance a p53-indepe ndent function of USP7 196, 197. Regarding the involvement in cancer progression, USP7 has been described as both tumor suppressor and oncogene 179, 185, 190, 191. Due to potential oncogenic properties, mostly attributed to p53 regulation, USP7 represented a promising anti60


neoplastic target. Indeed several specific US P7 inhibitors (USP7i) have been developed so far 198, 199 and are currently tested at the pre-clinical level. These drugs have shown to be potent anti-pr oliferative agents 199, 200 in several cancer cell lines but the therapeutical use of these USP7 inhibitors c an be limited by frequent inactivation of p53 gene in tumorigenesis and limited knowledge regarding alternative pathways controlled by USP7. In the current and the following chapter s (Chapter 4 and 5) we will demonstrate that USP7 and Daxx play a pivotal role in mitosis and their silencing contribute to genomic instability and chemotherapy response. He re we show that this newly identified Daxx and USP7 mitotic interaction occu rs and functions independently from p53. So far, participation of USP7 in mito sis has only been speculated. USP7 was shown to interact and stabiliz e checkpoint protein CHFR 178, but its direct involvement in mitotic regulation has not yet been demonstrated. Results Daxx Mitotic Complex Isolation We have previously shown that protein Daxx participates in mitosis regulation thus affecting taxane resistance 88, 134. In order to gain insights of Daxx function in this tightly controlled cell cycle stage, we isolated Daxx mitotic complex using the pOZ-FH-N expression vector for Tandem Affinity Purification (TAP) 201. The plasmid pOZ-FH-N coding for FLAG (F) and HA (H) tags was m odified to harbor a thrombin cleavage site (TCS) between the tags. For mitotic complex isolation, stable HEp2 cell lines expressing pOZ-F-TCS-H or pOZ-FTCS-H-Daxx were synchronized by double thymidine block (TDB) and released in Taxol to arrest cells in mitosis (95% by FACS analysis) to mimic conditions of Taxol treatment. Cell lysates were subjected to FLAG 61


immuno-precipitation (IP) fo llowed by thrombin cleavage. The eluted fractions were resolved by SDS-PAGE, colloidal Comassie st ained (Figure 4-1, panel A) and identical gel areas from Daxx or control IP s were sequenced by mass spectrometry. Daxx Interacts with USP7 in Mitosis The most abundant protein identified exclus ively in Daxx mitotic complex was the deubiquitylating enzyme USP7 127, 178, 179 (U biquitin-s pecific-processing p rotease 7, also known as HAUSP 202) (see Table 1). The association of Daxx and USP7 was previously published 126, 180; yet, neither mitotic-specific bindi ng between Daxx and USP7, or USP7 function in mitosis, were previously reported. This novel mitotic interaction is reproducible as confirmed by coimmunoprecipitation experiments (Figure 4-1) Mass spectrometry data was validated by FLAG IP in cellular system and protocol used for the complex is olation (Figure 4-1, panel B) where USP7 was pulled-down specific ally in FLAGDaxx IP but not FLAG only IP. These results were further validated by immunoprecipitation of endogenous Daxx in nocodazole arrested HEp2 cells (Figure 4-1, panel C). We were also able to prove reciprocal binding of USP7 and Daxx by immunoprecipitat ing endogenous USP7 in cells arrested in mitosis with both nocodazole (F igure 4-1, panel D, left) and Taxol (Figure 41, panel D, right). Our resu lts therefore strongly demons trate that Daxx and USP7 interact in mitosis. Interestingly this association occurs in cells arrested in prometaphase by Taxol, which keeps the spindle assemb ly check-point (SAC) active, or nocodazole which instead leaves the SAC inactivated. Thus Daxx and USP7 interaction occurs in prometaphase independently from the SAC activation status. 62


Depletion of USP7 Causes Delay of Early Mitotic Events We previously demonstrated t hat Daxx depletion causes stabilization of cyclin B1, blocking transiently cells in mitosis 116 (Figures 3-1 and 3-2). To test whether Daxx and USP7 cooperate to maintain this block, USP7 was depleted by siRNA in HEp2 cells (Figure 4-2, panel A). Cells were then syn chronized using a double thymidine block and released to monitor cyclin B protein leve ls during progression through G2/M/G1 stages. While cells transfected with control siRNA showed degradation of cyclin B by 9 hrs postthymidine release, USP7 depleted cells sh owed stabilization of cyclin B at 9-11 hrs post-release. Thus, as was shown for Daxx 134 in Chapter 3, depletion of USP7 also led to stabilization of cyclin B in mitosis (Figure 4-2, panel A). Since Daxx and USP7 were previously repor ted to be involved in the regulation of tumor suppressor p53 stability 127, 191, 192, via MDM2 de-ubiquitylation and stabilization 126, we tested whether p53 may be involved in Da xx and USP7 mitotic function. To this end USP7 was depleted in non-small lung carc inoma cell line H1299, which is p53 null 203. This cell line has similar levels of Da xx and USP7 compared to HEp2 cells (Figure 4-2). H1299 cells were then transfected with control or USP7 siRNAs and synchronized to monitor cyclin B stability as described above, in ce lls entering (7 hrs post DT release), progressing (9 hrs post DT rel ease) and exiting mitosis (11 hrs post DT release). Cyclin B was stabilized in H1299 cells upon USP7 depletion (Figure 4-2, panel B). Therefore we concluded that down-modulati on of either Daxx or USP7 causes cyclin B accumulation. In addition, as previously observed for Daxx 88, we now show that silencing of USP7 affects cyclin B stability independently from p53. We had previously shown that Daxx deple tion causes impaired mitotic progression and a transient mitotic block 134. Therefore we next sought to investigate how USP7 63


may affect cellular advancement though mito tic stages. Consistently to what was observed for Daxx, USP7 depletion does not increase mitotic index per se (data not shown) However, USP7 depletion resulted in an increase of prometaand metaphase stages (P/M) of mitosis. An increase in P/M index was observed in both HEp2 cells (Figure 4-3, panel A) and H1299 cells (Figur e 4-3, panel B). Therefore we concluded that USP7 silencing causes a p53-indepe ndent mitotic delay, in agreement with stabilization of cyclin B (Figure 4-2) and the effects documented for Daxx depletion 116 (Chapter 3). USP7 Depletion Destabilizes CHFR Protein USP7 has been reported to remove ubiquitin chain and increase stability of a mitotic checkpoint protein, the E3 ligase Checkpoint with Forkhead and Ring finger (CHFR) 178. Loss of CHFR expression was documented in up to 50% of tumor specimens from a variety of tissues including breast cancer 70, 204, 205. CHFR knockout mice are viable with high rates of spontaneous tumors due to the chromosomal instability and mitotic defects linked to accumulation of Aurora A 45, the key mitotic kinase that promotes bipolar spindle assembly 83, 206-208; it also controls mitosis by regulating cyclin B localization and stability 207, 209. To test whether mitotic function of USP7 is mediated by CHFR, we monitored this protein stability in HEp2 cells stably expressing control or USP7 shRNAs. Cells depleted by USP7 showed decrease in CHFR protein levels (0 hours) and a reduced stability of this protein upon protein synthesis block wit h cycloheximide (CHX, Fi gure 4-4, panel A). 64


Similarly, H1299 cells transiently depl eted of USP7 had reduced stability and decreased CHFR protein levels upon CHX tr eatment, compared to control depleted cells (Figure 4-4, panel B). Thus, USP7 depletion destabilizes mitotic E3 ligase CHFR independently from p53 cellular status. Loss of USP7 Leads to Accumulation of Aurora A and Multipolar Spindles CHFR is required for the maintenance of an early mitotic checkpoint essential to blocking mitotic progression through the met aphase stage while the cell is withstanding stresses 46, 210. Being a RING domain E3 ligase, CHFR binds and ubiquitylates one of the pivotal mitotic kinases, Aurora A 45, 204, 211 targeting this kinase for proteasomal degradation. We tested whether we could observe changes in accumulation of Aurora A upon depletion of USP7. An increase in Aurora A protein levels was observed in both HEp2 and H1299 cell lines up on depletion of USP7 (Figure 4-5, panel A). Upon depletion of USP7 in H1299 p53 null cells, the increment of Aurora A is noticeably higher that in p53 wild type HEp2 cells as shown by the quantification of Aurora A protein levels (Ratio Aurora A/Actin, Figur e 4-5 A). This difference may be explained by the G1-S block and apoptosis triggered by p53 accumulation upon USP7 depletion in HEp2 cells, while H1299 cells can progress through G1/S checkpoint, thus continuously accumulating Aurora A. Since Aurora A kinase governs faithful replication, separation/ localization of centrosomes and bipolar spindle assembly 212, we asked whether we could observe mitotic abnormalities in USP7 depleted cells. In agreement to what was reported for Au rora A amplification or accumulation 208, 213-215 we observed a significant increase of multi polar mitoses in cells with either stably 65


(Figure 4-5, panel B) or transiently (Figur e 4-6) depleted USP7 as shown by immunofluoresce staining for Aurora A and -tubulin. Although localization of Aurora A was preserved in cells lacking USP7, an increase in multipolar mitoses was observed in both HEp2 and H1299 cells. Transient depletion of Daxx revealed that multipolarity can be mediated by absence of either Daxx or USP7 with the highest effect observed with decreased levels of the latter (Figure 4-6) This result is in agreement with our hypothesis that Daxx may trigger U SP7 DUB activity in mitosis. We also observed an increase in overnum erary poles (>4 poles) in USP7 shRNA cell lines (Figure 4-5, panel C) potentially due to failed cytokynesis and centrosome over-replication in cells going through multiple cell divisions upon USP7 depletion (and, therefore, with elev ated Aurora A). In order to confirm this data in a non-tumorigenic cell line, we counted multipolar mitoses of human mammary epithelial cells, MCF10A, upon transient depletion with cell-permeable non-targeting control or USP7 siRNAs (Accell technology, Dharmacon). Analysis of up to four-hundred mitoses in MCF10A control or USP7 depleted cells confirmed data obtained in HEp2 and H129 9 cancer cell lines (not shown). USP7 Depletion Elevates Taxane Resist ance that Can Be Attenuated with Aurora A inhibitor MLN8054 In order to investigate t he existence of a correlation between USP7 and cellular response to paclitaxel, USP7 mRNA expr ession was analyzed across the NCI-60 cellline screen 216, 217. This expression profile was then correlated with sensitivity to paclitaxel. Analysis done by our collaborator Dr. Reinhold at the NHI -NCI, revealed that USP7 expression significantly correlates with paclitaxel response (P <0.05) in the NCI60 cell lines. 66


To investigate the role of USP7 in ta xane response, HEp2 cells stably expressing USP7 or control shRNAs were tested for paclitaxel induced cell death measured by colony formation assay. Increased survival of USP7 depleted cells was observed in comparison to cells expressing the control sh RNA (Figure 4-7). After 18 hours of taxol treatment only 7% of colonies in control cells survived, while USP7 depleted cells tolerated the same condition to a much hi gher extent showing a 25% survival rate. Therefore, experimental dow n-regulation of USP7 reduced sensitivity to paclitaxel treatment in HEp2 cells as it wa s previously shown for Daxx. Since Aurora A over-expression correla tes with poor patients outcomes 84-86 and resistance to taxanes 72-74, selective Aurora A inhibitors, such as MLN8054 218-220, have been developed. Use of these drugs in cells with overexpressed Aurora A has been shown to sensitize tumor cells to c hemotherapeutic agents including taxanes 221-223, even when spindle checkpoi nt proteins are absent 224. Thus, the potential of abrogating taxol resistance in combinatorial treatm ents with Aurora A kinase inhibitors are promising for clinical applications. Currently, MLN8054, as select ive inhibitor of Aurora A 218, 220, is in phase-I clinical trials in patients with advanced malignancies and solid tumors including breast cancer. Thus we chose this drug as an inhibitor of Aurora A to test whether it could override USP7 induced paclitaxel resistance. MLN 8054 was tested alone or in combination with Taxol in cells stably expressing control or USP7 shRNAs in colony formation assay (Figure 4-7). Cells expressing control or U SP7 depleted cells did not show significantly different response to MLN8054 alone; however a different outcome was observed when this drug was used in combination with Taxol. The drug combination did not synergize 67


in the killing of control depleted cells (8% survival in MLN8054+Taxol treatment vs 7% with Taxol alone), but it was effective in dimini shing taxol resistance in USP7 shRNA cells (17% survival in MLN8054+Taxol treatment vs 29% with Taxol alone, P=0.01). The combination of the two drugs was also mo re effective than MLN8054 alone in killing USP7 depleted cells (17% survival in MLN8054+Taxol treatment vs 25% with MLN8054 alone, P=0.05). Our results indicate that in the absence of USP7, functional inactivation of the mitotic spindle checkpoint using Aurora A kinase inhibitor, MLN8054, can elevate cellular taxol response and significantly decrease USP7-induced taxane resistance. Summary of Results In this chapter, we presented evidence that Daxx and USP7 interact in mitosis (Figure 4-1) and that this associati on determines mitotic progression and taxane resistance. For the first time we have s hown that DUB enzyme USP7 is involved in mitotic regulation as cells depleted by USP7 display 1) elevated stability of cyclin B (Figure 4-2); 2) prolongation of prometa/metaphase stages of mitosis (Figure 4-3); 3) decreased stability of mitotic E3 Ub ligase CHFR (Figure 4-4) with consequent accumulation of CHFR substrate Aurora A and multipolar mitotic spindles (Figure 4-5 and 4-6). We also found that ta xol response in 60 cancer cell lines correlates with levels of USP7 and that taxol resistance is el evated upon experimental depletion of USP7 (Figure 4-7), as it wa s shown in Chapter 3 and 88, 116 for Daxx. Moreover, we demonstrated and that this resistance can be at least partially attenuated by inhibition of Aurora A (Figure 4-7). Thus, studies presen ted in this chapter have established new roles for Daxx and USP7 in cell cycle pr ogression where absence of these molecules impairs cytotoxic activity of taxane administration (Model in Figure 4-8). 68


Discussion Daxx is a multifunctional protein that plays a pivotal role in both physiological and pathological cellular processes. We previously demonstrated that cells with low levels of Daxx have reduced sensitivity to taxanes (Chapter 3 and 88, 116), powerful chemotherapeutic agents, by pers isting in a pro-metaphase block that allows cells to escape taxane-induced cell death. In this chapter we dissected the mechanisms of Daxx-dependent taxanes resistance that also proves function of this protein in mitotic progression. We have shown that Daxx in teracts (Figure 4-1) and cooperates with Ubiquitin Specific processing Protease-7 (USP7) to regulate mitosis (Figures 4-2 and 43). We have demonstrated that depletion of USP7 delays early mitotic events as shown by accumulation of prometa/metaphases (F igure 4-3), biochemic ally confirmed by stabilization of cyclin B (Figure 4-2), as it was previously observed for Daxx 88, 116 (Chapter 3). Therefore our resu lts strongly indicate that Da xx and USP7 interact and cooperate in mitosis to ensure accurate mitotic progression. Tang et al demonstrated that in interphase ce lls, Daxx creates a bridge between USP7 and MDM2; moreover, upon Daxx binding, USP7 DUB activity toward MDM2 increases 126. But how Daxx activates USP7 is still unknown, mainly due to lack of biochemical characterization of USP7-Daxx binding. Recent developments in USP7 field showed that USP7 activity can be enhanced upon binding of co-factors. The metabolic enzyme (GMPS), a known USP7 associating enzyme, increases deubiquitylating activity up to 100-fold through binding of a "switching" loop in close proximity to USP7 catalytic domain 225. Thus we can speculate that Daxx may bind USP7 in a similar fashion to enhance its activity in mitosis. It is also plausible that Daxx contribution to this interaction is to recr uit USP7 substrates. Future studies are needed 69


to dissect Daxx and USP7 association in mitosis versus interphase In order to understand how Daxx and USP7 regulate mito tic progression we asked whether CHFR, a USP7 substrate, is involved. CHFR is a mitotic E3 ligase that targets checkpoint proteins for destruction during mitosis. Our results demonstrate that upon USP7 depletion stability of CHFR is reduc ed in both HEp2 and H1299 cells, indicating that this regulation occurs i ndependently from p53 (Figure 4-4). Genetic studies 45 demonstrated that the mitotic defects observed in CHFR depleted cells are mostly mediated by increased levels of one of its substrates, Aurora A kinase. In normal cells Aurora A kinase acti vity is required for centrosomes maturation and separation, thus bipolar spindle formation The phenotype of cells with high levels of Aurora A protein is mainly characteriz ed by multipolar mitoses. Hence, the next question we asked was whether Aurora A had accumulated in cells depleted by USP7 and if we could observe the associated phenotypes. Indeed, depletion of USP7 correlated with higher Aurora A protein leve ls compared to control depleted cells, in both p53 WT (HEp2) and p53 null (H1299) cell lines. H1299 cells accumulated Aurora A protein to an higher extent than HEp2 cells; this effect can be explained by absence of p53-mediated G1/S block that allows cell wi th over-amplified centrosomes to progress through cell cycle 226. Study of multipolar events, as result of Aurora A accumulation, revealed that USP7 depletion leads to a signi ficant increase of over-numerary spindle poles (Figure 4-5) in comparison to control depleted cells. We next sought to understand if a similar effect could be seen in Daxx depleted cells. Therefore we depleted HEp2 cells by s iRNA for non-targeting control, Daxx and USP7 and evaluated the multi polar phenotype. An increase of multipolar mitoses was 70


observed in both HEp2 and H1299 cell lines depleted by Daxx or USP7, compared to control siRNA treated cells (Figure 4-6). Ye t, the highest extent of multipolar phenotype was associated with USP7 silencing. These results can be partly due to the fact USP7 is known to stabilize Daxx in normal condition 227. Hence, USP7 depletion accounts for cumulative effects due to reduction in both proteins. In addition, loss of the complex component with enzymatic property (USP7) is more likely to produce the strongest multipolar phenotype. Results obtained from colony formation assa y with experimentally reduced levels of USP7 and in silico correlative analysis in the NCI60 platform, show that USP7 expression influences response to taxanes in cancer cell lines. Thus, these results indicate that USP7, as shown in Chapter 3 for Daxx, can be used as a predictive marker for taxane response in cancer patients. Therefore, Daxx and USP7 can be used for proper stratification of breast cancer patients to receive taxane-based treatment. We collected evidence that USP7, as well as Daxx 88, 134, is a regulator of taxane response. Previously, USP7 and Daxx were i dentified as regulators of p53 stability and as such proposed to regulate G1/S cell cycle arrest and apoptosis. In this chapter we demonstrated that another stage of cell cycle is regulated by Daxx and USP7 interaction. As shown in our model in Figur e 4-7, we propose that during normal mitotic progression Daxx activates USP7 for de-ubiquiti nation of mitotic E3 ligase CHFR, rescuing this protein from degradation. In turn, stabilized CHFR ubiquitylates and targets Aurora A for degradation, thus fine tuning the levels of this protein on the entrance of mitosis. Proper levels of Au rora A ensure bipolar spindle formation and normal mitotic progression guaranteed by ti mely degradation of cyclin B on the 71


metaphase/anaphase onset. Deregulation of U SP7 and/or Daxx reduces stability of CHFR, thus Aurora A accumulates. Stab ilization of Aurora A leads to cyclin B accumulation, potentially by two independent mechanisms. T he first one is controlled by the SAC which halts mitotic progression due to the inability to resolve multipolar mitoses. The second one relies on the ability of Aurora A to directly bind and stabilize cyclin B as part of checkpoint response 209. Finally, stabilization of cyclin B holds cells in mitosis. This allows cancerous cells exposed to taxanes to acquire a resistant trait by having a prolonged mitotic block and cont inue proliferation after drug decay and microtubule dynamics restoration, thus surviv ing chemotherapy (see model in Figure 37). In addition, we demonstrated that a selective small molecule inhibitor of Aurora A, MLN8054, can attenuate USP7-mediated taxa ne resistance, most likely through accelerated mitotic slippage toward micronucleation 33. Previously it was shown that knockdown of Aurora A by RNA interf erence enhanced the chemosensitivity of paclitaxel in pancreatic cancer cells 74. This evidence, together with our results, suggests that combinatorial drug regimens of taxanes with MLN8054 may improve the outcome of chemotherapy response in canc er patients. We also demonstrated that cytotoxic effects of combinat ion of Taxol and MLN8054 or Taxol alone are similar in control depleted cell lines. However, in USP7 depleted cells, the combinatorial treatment represents the most efficacious means to kill chemoresistant cells. The results presented here demonstrate a role for USP7 in mediating mitotic progression and taxane response mainly through regulation of Aurora A. 72


Table 4-1. List of USP7 peptides identified by mass spectrometry Position (aa) Sequence 847-854 DGPGNPLR 480-487 FDDDVVSR 941-948 LLEIVSYK 302-310 VLLDNVENK 875-882 KLYYQQLK 1024-1033 IQSLLDIQEK 746-755 IQDYDVSLDK 409-420 FMYDPQTDQNIK 756-784 ALDELMDGDIIVFQKDDPENDNSELPTAK Protein coverage by amino acid count: 102/1102 = 9.3% 73


Figure 4-1. Daxx interacts with USP7 in mitosis. (A) HEp2 cells stably expressing pOZ_F-TCSH or pOZ_F-TCS-H-Daxx were synchronized in mitosis as described in materials and methods. Cell lysates (Inputs) were immuno-precipitated with anti-FLAG-M2 magnetic beads. After extensive washes, complexes were eluted and resolved on SDS-PAGE and colloidal comassie stained. (B) Western blot analysis of immunoprecipitation experiment conducted as in (A). Cell lysates labeled as inputs (I), flow through (FT) and eluted samples (Elution) recovered by thrombin cleavage were immunoblotted with Daxx or USP7 antibodies. Mitotic interaction between Daxx and USP7 is reproducible. Representative experiment out of three. (C) Co-IP of USP7 with Daxx endogenous immunoprecipitation in HEp2 cells synchronized in mitosis by nocodazole exposure. (D) Co-IP of Daxx with USP7 endogenous immunoprecipitation in HEp2 cells synchronized in mitosis by nocodazole or Taxol exposure. Numbers below the blots represent the sample percentiles. 74


Figure 4-2. USP7 depletion results in stabilization of cyclin B1 (cycB) in a p53 independent manner. (A) Western blot analysis in HEp2 and H1299 cells to compare expression of p53, Daxx and USP7. HEp2 cells expr ess wild-type p53 while H1299 are p53 null but similar levels of Daxx and USP7 are expressed in both cell lines. B and C, left panels: Western blot analysis of HEp2 (B) or H1299 (C) cells synchronized by DTB and simultaneously transfected with either control or USP7 siRNAs. Samples were taken 72h posttransfection at 0, 7, 9 and 11 hours after DTB release to allow cells to progress through mitosis. Right panels: Relative quantization of cycB protein levels using actin as internal control for each timepoint. Data are normalized using control siRNA transfected cells. CycB is stabilized in USP7-depleted cells in a p53 independent manner. Data shows representative experiments out of three. 75


Figure 4-3. USP7 depletion causes accumula tion of mitotic cells in prometa-metaphase. HEp2 (A) and H1299 (B) cells were transfected with control or USP7 siRNAs. 72h post-transfection DNA was stai ned with hoechst 33342. Mitotic stages were distinguished according DNA mor phology. The left panels represent the frequencies of mitotic stages divided in to two groups: from prometaphase to metaphase (P-M, indicated by arrows) or from anaphase to cytodieresis (A-C, arrowheads). Upon USP7 depletion a dram atic increase of cells in P-M was observed. For each experiment count ed there were at least one hundred mitotic events ( SD, n=3). *P -Value<0.01; ** P-Value<0.02. 76


Figure 4-4. USP7 depletion destabilizes CHFR protein. We stern blot analysis of Hep2 cells (top) stably expressing contro l or USP7 shRNA and H1299 cells (bottom) transiently transfected with control or USP7 siRNAs exposed to 1 g/mL of cyclohexamide (CHX) for 2, 4, 6 or 8 hours. Depletion of USP7 causes the reduction of CHFR protein levels in both cell lines. 77


Figure 4-5. USP7 depletion causes accumulation of multipolar cell divisions which are mediated by accumulation of Aurora A kinase, a CHFR substrate. (A) Immunofluoresce staining of HEp2 and H1299 stable cell lines expressing shRNAs using Aurora A kinase and -tubulin to label spindle poles. Hoechst was used to stain DNA. The panels on the right represent the quantification of multipolar events over the total num ber of mitosis ( SD, n=3). Analysis was conducted counting at least 100 mi totic events for each experiment. (B) Immunofluoresce staining of Aurora A kinase, -tubulin and DNA in HEp2 and H1299 stably expressing USP7 shRNA. In USP7 depleted cells are observed multipolar divisions with overnumerary poles (n>4). Quantification of these events is presented on the right panel ( SD, n=3). (C) Representative Western blot analysis showing accumula tion of Aurora A kinase in HEp2 and H1299 cells depleted by USP7. Cells were synchronized by DTB and releases in growth media for 11 hours to progress through mitosis. Numbers represent quantification of Aurora A protein over internal control (actin). 78




Figure 4-6. Transient depletio n of USP7 and Daxx leads to the accumulation of multipolar mitoses. Graph represents t he quantification of multipolar events over the total number of mitosis in c ontrol, Daxx and USP7 siRNAs, in HEp2 and H1299 cells. For each experiment staining of Aurora A, -tubulin and DNA was performed to label spin dle poles and assess chromosomal segregation. A minimum of one hundr ed mitotic events were counted per experiment. Transient depletion of U SP7 and Daxx in HEp2 and H1299 cells causes increase of multipolar spindles. 80


Figure 4-7. Depletion of USP7 Desensitizes Cells to Paclitaxel which can be rescued by Aurora A inhibition. Percentage of col onies formed from co ntrolor USP7depleted HEp2 cells which were synchronized using a double thymidine block and then released and exposed to cont rol, 10nM taxol, 4uM MLN8054 and both drugs for 18 hours. After treatm ent, cells were replated for colony formation assay (SD, n=3). 81


Figure 4-8. USP7/Daxx regulat ion of mitosis and taxane resistance. Daxx activates USP7 for de-ubiquitination of mitotic E3 ligase CHFR; stabilization of CHFR elevates Aurora A ubiquitination and degr adation. Deregulat ion of USP7 or Daxx reduces stability of CHFR, thus a ccumulating Aurora A. It turns into stabilization of Cyclin B that holds cells in mitosis thus elevating survival upon taxanes treatment. Ub: ubiquitin. 82


CHAPTER 5 DAXX AND USP7 ARE GUARDIANS OF GENOMIC STABILITY Introductory Remarks As it was first postulated by the German biologist Theodor Boveri in 1902, the precise partitioning of duplicated chromosomes to daughter cells is essential for the development and survival of all organisms. Defects in segregation lead to aneuploidy, the state where entire chromosomes are gained or lost. Aneuploidy is a hallmark of the majority of tumor cells and several lines of ev idence indicate that it contributes to the evolution of cancer 228-232. Aneuploidy is also the l eading cause of spontaneous miscarriages and hereditary birth defects in humans 233, 234. In order to segregate correct ly the genetic material during mitosis, a sophisticated and well conserved system among all eukaryoti c cells tightly regulates cell division. During this process the dividing cell ensures that kinetochores of each chromatid are correctly attached to the bipolar spindle. Duri ng the initial formation of the mitotic plate, at the prometa/metaphase trans ition, many sister chromatids do not achieve the necessary biorientation. Some sister chro matids may be attached to microtubules irradiating from the same sp indle pole (known as syntelic a ttachments) or one chromatid may become attached at the same time wit h microtubules from the two opposite poles (known as merotelic attachment) 235. These abnormal attachments must be corrected so that until all chromosomes are under proper tension and bi-orientation, the metaphaseanaphase transition is delayed 236, 237. In eukaryotic cells this delicate mission is assigned to the Spindle Assembly Checkpoint (SAC) 30. To the SAC belongs a long list of proteins with checkpoint function identified by genetic screenings 238. These proteins can be categorized as sensors (Aurora B, 83


Mad1, Bub1 and Mps1) 239, 240 or as signal transducers (Cdc20 plus the Mitotic Checkpoint Complex or MCC, form ed by Mad2, Bub3 and BubR1 proteins) 241 or as effectors (anaphase promoti on complex/cyclosome APC/C) 234, 242, 243. In short, these molecules can sense lack or faulty tension, even on a single kinetochore, to produce a wait signal, preventing Cdc20 to associate and activate the APC/C. This system avoids segregational errors by inhibiting APC/CCdc20 mediated destruction of cyclin B and securin, thereby avoiding entrance in anaphase. Once all the kinetochore-microtubules attachments satisfy the SAC, Cdc20 can then bind and activate APC/C to ubiquiti nate cyclin B and securin for proteolytic degradation 30, 146. Drops in securin levels lift the inhibition on separase. This enzyme then cleaves the cohesin rings which hold sist er chromatids together to finally progress from metaphase to anaphase 244. Thus, maintenance of a functional SAC is fundamental for the genomic stability of cells. Genetic studies conducted with hypom orphic or heterozygous mouse models for the components of the SAC, demonstrated t hat these mice are characterized by aneuploidy 245-247 and increased rates of spontaneous (Mad2+/247, CENP-E+/248, 249, Bub1 hypomorphic 250, 251) or carcinogen-induced (Bub3 245 and BubR1 246) tumors. Surveillance, detection and correct ion of failed or improper microtubule/kinetochore attachment are ti ghtly regulated where recruitment of SAC components is hierarch ical and sequential 252. The protein Bub3 (budding uninhibited by benzimidazoles 3 homolog) 253 is a key SAC component that is immediately localized to unattached kinetochores 254. Here it recruits other co mponents of the MCC and the SAC sensor Bub1 to generate two inhibitory comp lexes that suppress the function of APC/C 84


by either sequestering or inhibiting Cdc20 respectively 255, 256. Another fundamental checkpoint function governed by Bub3 is to establish the formation of correct microtubules-kinetochore attachments c oordinating microtubule binding proteins 257, 258. Cells with reduced levels of Bub3 co mpromise localization of the other components of the SAC, Bub1 and BubR1 258, resulting in failed SAC activation 257. Due to inability to correctly attach and sens e improperly bound kinetochores-microtubules, reduced expression of Bub3 displays chromoso me segregation errors in the form of micronuclei 259 misaligned and lagging chromosomes 258. During the characterization of USP7 depl eted cell lines we noticed a peculiar phenotype. Cells lacking USP7 showed signs of chromosomal instability. These results were reminiscent of the aneuploidy we previ ously observed in cells isolated from Daxx knock out mouse embryos where extensive aneuploidy was observed in Daxx-/MEFs, compared to Daxx+/or +/+ MEFs which disp layed normal karyotype. This condition was observed in three independent Daxx-/MEF cell lines, suggesting Daxx may be important for accurate chromosomal separation. In this chapter we present evidence that USP7, as previously demonstrated for Daxx, causes genomic instability characte rized by abnormal chromosomes segregation, accumulation of micronuclei and increased aneuploidy. We demonstrated that these mitotic abnormalities may be mediated by reducti on of checkpoint protein Bub3 in USP7 depleted cells. Our results indicate that US P7 interacts with Bub3 in mitosis. This binding favors Bub3 stabilization as cells depleted by USP7 have reduced levels of Bub3. These effects are occurring in similar ex tents in cell lines harboring wild type or mutated p53. 85


Thus, results presented in this chapter pr ovide the first evidence that loss of USP7 leads to genomic instability by destabilizi ng a key mitotic checkpoint component in a p53 independent manner. Results USP7 Depletion Causes Genomic Instability While generating USP7 shRNA cells, we noticed several interphase nuclei abnormalities that are usually recognized as derived from mitotic segregational defects 260. Cells with reduced levels of USP7 have hi gh levels of nuclear blebs and micronuclei (MN) compared to control-depleted cells (Figure 5-1). In USP7 shRNA cells, a small sub-population of cells that is still positive for USP7 does not have nuclei abnormalities. Loss of USP7 leads to increase in micronuclei formation To study the significance of this observed nuclear abnormalities we decided to quantify the extent of micronuclei (MN) accu mulation. MN are the manifestation of chromosomal instability and are generated as a consequence of cellular exposure to genotoxic stresses or as resu lt of mitotic abnormalities 261. MN originate from chromosomal fragments or whole chromosomes that are not segregated during mitosis because they are not properly at tached to spindle microtubules 262. At the end of mitosis nuclear envelope reforms around the lost genet ic material in the cytoplasm, where MN appear as tiny nuclei by DNA staining 263. In mammalian cells, MN form during anaphase 264 from lagging chromosome fragments in case of failed repair of DNA double strand breaks 261 or whole chromosomes in case of defects in assembly of kinetochore proteins 265, 266, abnormal spindles 267, 268 or non-functional SAC 238, 260, 269, 270. 86


To statistically assess the accumulation of MN upon USP7 depletion compared to the control depleted cells, we adopted the previously established rules for MN scoring 148. The MN score represents the percentage of MN per cell, where as MN was considered each rounded DNA material in the cytosol, nonoverlapping with the nuclear material and not exceeding 1/3 of the volume of the nucleus. Only occasional MN were detected in HEp2 and H1299 control depleted ce ll lines (Figure 5-2, first panel in enlarged box); a dramatic increase of MN score was observed in USP7 depleted cell lines (Figure 5-2). In addition, the MN population was heterogeneous across the USP7 shRNA cells in regards of both size and number per cell, as shown by the pictures in three distinct fields (Figure 5-2). We coul d clearly distinguish two different MN subpopulations. The first one was characterized by multiple and larger MN (Figure 5-2, arrows). This type of MN usually arises from multipolar mitoses due to the inability of the cell to correctly partition groups of chromosomes. The increased incidence of multipolar events upon USP7 depletion and the underlyi ng mechanism were presented in Chapter 4 (Figure 4-5). The second one was represent ed by a small MN, often located between two interphase nuclei (Figure 5-2, arrowhead s). Since this type of MN derives from lagging chromosome at the anaphase onset, it is likely that other mitotic segregation problems (besides Aurora A induced multip olarity) may be encountered by cells with depleted USP7. Loss of USP7 causes increase of lagging chromosomes One of the mechanisms responsible for the MN formation is the presence of unattached or lagging chromosomes in anaphase 264. To better understand the nature of MN formation, immunofluorescence stai ning was done in control or USP7 depleted HEp2 cells. Cells were labeled with centro meric protein CENP-A and peri-centromeric 87


protein CENP-B to detect centromere s/kinetochores. Anaphas es with lagging chromosomes were detected in almost all mitotic events in HEp2 cells stably depleted of USP7 (80% of lagging chromosomes versus 10% of control shRNA cells, p=0.00002; Figure 5-3). This data, together with the MN scoring, strongly indicates that USP7 depletion causes significant chromosome mis-segregation that may be driven 1) by multipolarity due to accumulation of Aurora A, and 2) from lagging chromosomes in anaphase. Loss of USP7 promotes abnormal karyotype To understand in detail the role of USP7 in genomic instability HEp2 and H1299 cells stably expressing control or USP7 sh RNAs were karyotyped. Our expectation was to observe deviation from the cell line chromosomal modal numbers due to the high extent of micronucleati on and multipolarity in cells with silenced USP7. Karyotypes of the analyzed cell lines were nearly triploid for HEp2 cells with chromosomal modal number of 72 7.8, and nearly tetraploid for H1299 cells with chromosomal modal number of 94.2 12.5. However, upon US P7 depletion, a deviation from these numbers was obser ved. In USP7 depleted HEp2 cell line, the calculated chromosomal modal number was 73.1 15.2 The doubling of the standard deviation indicates an increased genomic instability in t hese cells. More dramatic were the effects in H1299 USP7 shRNA cell line, in which the modal number was reduced from 94.2 of the control to 85.1 chromosomes per cell. As well, the standard deviation of chromosomes modal number was increased almo st three-fold. Thus, consistently with the morphologic manifestati on of genomic instability (MN and lagging chromosomesFigures 5-2 and 5-3), the number of cells with gain or loss of chromosomes was increased in USP7 shRNA cells in both p53 positive and negative cells (Figure 5-4). 88


In order to confirm this data in a non-tumorigenic cell line, we analyzed karyotypes of human mammary epithelial ce lls, MCF10A, upon transient depletion with cell-permeable non-targeting control or USP7 siRNAs (Accell technology, Dharmacon). Analysis of up to one thousand metaphases in MCF10A control or USP7 depleted cells confirmed data obtained in HEp2 and H1299 c ancer cell lines: USP7 silencing causes almost a two-fold increase in aneuploidy. This data is in agreement with evidence previously collected from karyotyping of Daxx-/MEFs which were characterized by severe aneuploidy compared to normal kariotype displayed by Daxx +/+ MEFs. H ence, our data indicates a common role of Daxx and USP7 in mitotic regulation and maintenance of genomic stability. USP7 Interacts and Controls Stability of SAC Protein Bub3 USP7 loss induces high rates of unattac hed chromosome that may result from a change in stability of mitotic checkpoint prot eins. While we were screening for mitotic proteins which would have differential stabi lity upon USP7 depletio n, the interactome landscape of human DUBs was published 271. This report indicated that USP7, among other proteins, interacts with checkpoint prot ein Bub3 in HeLa cells. Bub3 protein levels were consistently low upon USP7 depletion, in both HEp2 and H1299 cells (Figure 5-5, panel A). These results are consistent wit h the increase of lagging chromosomes and MN (Figures 5-2 and 5-3) and the data previously published for Bub3 238. Indeed many reports indicate that Bub3 localizes to unat tached kinetochores to recruit and interact with other members of the M CC to maintain Cdc20 inactive until all kinetochores are correctly attached and ali gned to the mitotic plate 254, 257-259. Haplo-insufficiency of Bub3 leads to chromosomal mis-aggregat ion and chromosomal instability 241, 259. 89


To test USP7/Bub3 interaction, imm uno-precipitation experiments of endogenous USP7 were done in HEp2 cells synchronized in mitosis by either nocodazole or Taxol exposure. Cell lysates (Input) collected fr om synchronized cells were used in IP experiments with control IgG or USP7 ant ibodies conjugated to protein G magnetic beads (Dynabeads, Invitrogen). Bub3 was pull ed-down only with USP7 antibodies indicating that endogenous proteins, Bub3 and USP7, interact in vivo in cells arrested in mitosis. In addition the results suggest that this association occurs independently from the activation status of the SAC, since Bu b3 is co-immuno-precipitated with USP7 in both nocodazole (SAC off) and Taxol (SAC on) (Figure 5-5, panel B). Summary of Results Results presented in this chapter uncover a novel and pivotal function of USP7 in the maintenance of genomic stability. U pon USP7 depletion we observed mitotic abnormalities including 1) micronuclei accumu lation, 2) mis-shaped nuclei, 3) lagging chromosomes in anaphase and 4) karyotype inst ability. Our results suggest that these abnormalities are mediated by decreased leve ls of SAC component Bub3, interaction partner and potential substrate of USP7 in mitosis. Thus our results show that USP7 regulates mitosis by affecting stability of multiple checkpoint proteins: Bub3, CHFR and Aurora A, as described in Chapters 4 and 5. Discussion The work presented in this chapter indicate s that, as previously demonstrated for Daxx, USP7 is also essential in mainta ining genomic stability in mammalian cells, independently from the cell ti ssue of origin. Indeed analysi s of interphase cells with reduced expression of USP7 presented severa l manifestations of mitotic abnormalities 90


such as ill shaped nuclei, massive micronuc leation, nuclear buds and nucleoplasmic bridges (Figures 5-1 and 5-3). These events are generally considered as markers of genotoxic stress and are hallmarks of tumor cells due to the genomic instability of the cancerous growth. Closer analysis of mitotic figures revealed that loss of USP7 causes a wide array of mitotic abnormalities such as multipolar spindles (as show n in Chapter 4), increase of MN (Figure 5-2) and accumulation of laggi ng chromosomes (Figure 5-3). Collectively this data indicates that USP7 depletion causes genomic instability. Karyotype analysis of HEp2 and H1299 cells stably expr essing control or USP7 shRNAs revealed that USP7 depleted cells were more aneuploid than the control depleted cells (Figure 5-4); moreover, we rec apitulated the same re sults upon transient depletion of USP7 in non-tumorigenic MCF 10A breast epithelial cells (not shown). Next, we hypothesized that the loss of USP7 would cause genomic instability by deregulating proteins belonging to the SAC. To test this hypothesis we analyzed by western blot stability of several component s of the SAC (Mad2, Cdc20 and Cdh1, data not shown). Only Bub3 showed marked redu ction upon USP7 depletion in both HEp2 and H1299 cells. Prior studies RNAi and genet ic demonstrated that decreased Bub3 causes failure in activating the spindle check point machinery thus ablating the ability to correct or establish proper microtubules-kin etochores attachments. These findings may explain the observed mitotic abnormalities upon USP7 silencing. Hence, we can conclude that cells lacking USP7 are impaired in the spindle checkpoint assembly and signaling, dictated by decreas ed Bub3 protein. These cell s enter anaphase with sister chromatids improperly attached to the spi ndle poles. This explains the appearance of 91


lagging chromosomes, the increase in mi cronuclei and the aneuploid y, as reported in this chapter. Interestingly Bub3 and USP7 endogenous protei ns interact in mitosis as shown in Figure 5-5, suggesting that Bub3 could be a dire ct target of deubiquit inating activity of USP7. Thus the reduced levels of the c heckpoint protein Bub3 observed in USP7 depleted cells suggest that Bub3 ma y be a novel USP7 substrate. In conclusion, we identified a new biol ogical role of Daxx and USP7 in G2/M progression, which is independent from p53 cellular status. In this chapter, we presented novel evidence for a pivotal role fo r Daxx and USP7 in genomic stability thus indicating tumor suppressors function for th ese proteins. Recent findings of Daxx mutations in neuroendocrine pancreatic tumor and pediatric glioblastoma further confirm this notion. 92


Figure 5-1. USP7 depletion causes genomic instability. Analysis for USP7 (green) and DNA (blue) in HEp2 (A) and H1299 (B) ce ll lines stably expressing control or USP7 shRNAs. The majority of USP7 de pleted cells show genomic instability (micronucleation and irregular nuclear s hape, indicated by arrows) while USP7 positive cells (white arrowheads) do not. 93


Figure 5-2. Loss of USP7 causes accumula tion of micronuclei. Depletion of USP7 elevates micronuclei (MN) score in both p53 WT (HEp2) and null cell lines (H1299). Three representative fields show heterogeneity of MN size and number of MN per cell in USP7 shRNA cell lines. White arrowheads indicate single MN while white arrows point to groups of MN. Right: quantifications of MN accumulation over the total number of cells (MN score). For each experiment a minimum of 300 cells we re counted ( SD, n=3) and for the scoring of micronuclei the criteria previously described were adopted 148. 94


Figure 5-3. USP7 depletion causes mito tic abnormalities. USP7 depleted cells accumulate mitotic bridges and lagging chromosomes. Left: immunofluorescence staining of HEp2 ce lls labeled with centromeric marker CENP-A (red), CENP-B (green) and DNA (blue). Right: quantifications of lagging chromosomes over the total number of anaphases (lagging chromosomes %). For eac h experiment a minimum of 300 anaphases were counted ( SD, n=3) 95


Figure 5-4. Depletion of USP7 leads to increased aneuploidy. Metaphase chromosomal analysis of HEp2 (panel A) or H1299 ( panel B) cells stably deplete by control or USP7 shRNAs. Results were generated from 100 metaphases. Numbers represent samples weight ed average weighted s.d. 96


Figure 5-5. USP7 regulates stability and inte racts with Bub3. A) Protein levels of checkpoint protein Bub3 are decreased upon depletion of USP7 in HEp2 and H1299 cells. Numbers below the blot r epresent relative quantification of Bub3 signal over actin chosen as loading c ontrol. Representativ e western blots of three independent experiments. B) Immunoprecipitation experiments of endogenous USP7 in HEp2 cells synchronized in mitosis by nocodazole or Taxol exposure. Bub3 is pulled down only with USP7 antibody but not with IgG control. Numbers below the blots r epresent the sample percentile loaded. 97


CHAPTER 6 SUMMARY, CONCLUSIONS AND FUTURE DIRECTIONS Summary and Conclusions Breast cancer is the most common c ancer among middle aged women and ranks second in cancer-related mortality. With development of adjuvant therapies in breast cancer over the past 40 years, we are getti ng closer to a cure for breast cancer and efforts are continuing to find better treatm ents for metastatic breast cancer, which unfortunately remains incurable. The focus in research to prevent further metastatic incurable disease by selective and more effective therapy is needed to decrease mortality in breast cancer. Taxanes, a group of cytotoxic drugs which includes paclitaxel (Taxol) and docetaxel (Taxotere), are among the most successful anticancer agents for breast cancer chemotherapy 11, 18, 149. Taxane activity affects cell cycle at several key points, including mitotic checkpoint 16, 151 and leads to mitotic arre st that will eventually trigger cell death 21 by a mechanism still largely unknown 17, 152-154. Many breast cancer patients are resi stant or become resistant to Taxol during drug administration 52, 53. Indeed, intrinsic and acquired resistances to taxanes represent the most limiting factors to the successful treatment of breast cancer patients. Thus, predicting which patients will respond to tax ane therapy and which will not benefit but only experience the side effects of the chemotherapy, is critical. The scientific work presented in this dissertation was designed and executed for the characterization of taxane resistance ma chinery and to identify novel predictive markers that would allow differentiation of breast cancer patients for most suitable therapies and improve overa ll and cancer-free survival. 98


Seeking markers of taxane response, we id entified a novel role of nuclear protein Daxx in taxane sensitivity. During previous studies published by our laboratory, Daxx was identified as a novel regulator of paclit axel response in cell culture conditions 88. Breast cancer cell lines with low levels of Daxx expression were resistant to drug application and import antly this data was recapitulat ed upon Daxx deplet ion in primary mouse and human cells. In order to better understand this phenomen on we wanted to assess whether Daxx mediated taxane resistance could be reproduced also in breast cancer patients. To address the clinical ramifications of Daxx regulation of ta xane sensitivity, twenty-two women treated with standard taxane and anth racycline based neoadjuvant chemotherapy for locally advanced breast cancer were classified as either responders or non responders based on the clinical outco me. Responders to therapy had a higher mean Daxx score (calculated based on IHC stai ning intensity multiplied by the percent of staining cells) compared to non-responders, suggesting that Daxx could predict the response to taxane-based chemotherapy. Thus, the characterization of Daxx as novel biomarker predicting taxane re sponsiveness would be a crucia l addition to the available predictive markers for patient populations with early and metastatic breast cancer. In addition, we found that Daxx deplet ion affects normal mitotic progression, accumulating cells in prometaphase/metaphase via reduced degradation of mitotic cyclin B (Chapter 3 and reference 116). In the absence of Daxx, cells remain in a prolonged mitotic block, while wild type cells undergo a transient arrest in mitosis. The prolonged mitotic arrest allows cells with down-modulated Daxx to escape taxane action (model in figure 3-7). To understand the me chanism of how Daxx affects mitosis 99

PAGE 100

progression and taxane resistance, we isol ated Daxx mitotic co mplex and identified Ubiquitin Specific processi ng Protease-7 (USP7), a deubiquit ylating enzyme (DUB), as Daxx interacting protein in mitosis. D eubiquitinating enzyme USP7 has been described as both a tumor suppressor and an oncogene 179, 185, 190, 191. Due to potential oncogenic properties, mostly attributed to p53 regulation, USP7 r epresented a promising antineoplastic target 198, 199, 272. Earlier reports described that, in interphas e, Daxx bridges USP7 and p53-specific E3 ubiquitin ligase MDM2, to maintain low levels of tumor suppressor p53 in normal cells126, 127, 191, 192. Thus, USP7/Daxx interaction was associated to p53-dependent G1/S checkpoint regulation. However, in this di ssertation we presented evidence that Daxx and USP7 control another stage of cell cycle, mitosis, in a p53 independent manner. We found that USP7 deplet ion affects mitotic progression and taxane resistance similarly to Daxx inactivation, suggesting t hat both proteins are cooperating and functioning as new mitotic regulators assuring proper respons e to taxane treatment (Chapters 4). Their action regulates stability of several checkpoint proteins, such as E3 ubiquitin ligase CHFR and it substrate Aurora A (Chapter 4) and mitotic checkpoint protein Bub3 (Chapter 5). We have demonstr ated that cells with decrease expression of USP7 have reduced levels of Bub3 and CHFR but accumula te Aurora A. All these effectors are regulated directly or indirectly by USP7 and are involved in taxanes response. Cells or tumors over-expressing Aurora A (as we have shown in Chapter 4 uopn USP7 downmodulation) are resistant to paclitaxel administration 72, 74. As well, cells deficient in SAC protein Bub3 have been shown unresponsive to paclitaxel 71. Contrarily, cells that lack CHFR are more sensitive to taxanes 46, 273 that may contradict our model. Therefore, to 100

PAGE 101

assess the contribution of CHFR in USP7 m ediated mitotic anomalies, we tested the ability of USP7 depletion to accumula te Aurora A in CHFR null HCT116 colon carcinoma cell lines. Aurora A and cyclin B were both stabilized in p53 isogenic HCT116 cell lines (data not shown), thus indicating that CHFR contributes only partially to USP7-mediates stabilization of Aurora A in HEp2 and H1299 cells. Furthermore this data highlights the p53 and tiss ue independency of USP7 mitotic regulation. Thus, Daxx/USP7-mediated regulation of mitosis and sensitivity to taxane occurs through finetuning protein levels of checkpoint proteins Aurora A and Bub3 in agreement with previous reports. We previously reported that Daxx intera cts in mitosis with protein Rassf1. The major isoform of this gene, Rassf1A, has been implicated as a mitotic regulator and has been shown to interact with several key mito tic-related proteins, including Aurora A 274 and Cdc20 275, though the latter is debatable 276. However our results clearly show that the Daxx and USP7 effects are reproduced in several cell lines including H1299, which besides being defective for p53 expression, t hey are also Rassf1A null. Thus, although the mitotic interaction between Daxx and Rassf1A may regulate mitosis by some mechanism not yet identified, Daxx regulatio n of mitosis and taxanes response is most likely achieved via interaction with USP7. The role of chromosomal instability in affecting taxane sensitivity was also proposed 277. Indeed, clinical trials have been devot ed to determine the relationship of an unstable karyotype to taxanes response 278. Clinical evidence gathered from breast and ovarian cancer specimens strongly indicated that tumors which display severe chromosomal instability are less sensitive to paclitaxel. Moreover karyotypes of residual 101

PAGE 102

tumors with paclitaxel resistant phenoty pe were greatly more aneuploid than the responsive ones, indicating that a select ive pressure for this trait occurs 278. Current study provides evidence that t he loss of these two proteins leads to reduced response to taxanes and provides dual mechanistic explanation for this phenomenon. Results presented in Chapters 3 and 4 provide strong evidence of a new USP7/Daxx function in mitosis and response to the anti-mitotic drugs taxanes. Data presented in Chapter 5 indicate s that the loss of Daxx and USP7 are linked to genomic instability a determining factor in efficacy of taxane cytotoxic ity as well as a hallmark of cancer progression (Model in Figure 6-1). According to our current understanding, Daxx and USP7 control and safeguard mitosis. Any dysfunction in this checkpoint contributes to both cancer progression and taxane resistance in breast cancer (Model in Figure 6-1). This novel view on USP7/Daxx function warrants the use of th ese genes as novel markers of therapeutic resistance and highlights novel ta rgets for clinical intervention, such as Aurora kinase. This would allow proper breast cancer patie nts stratification and rational design of new clinical trials which may include combinatoria l use of taxanes and Aurora A inhibitors. In addition, this study offers insights on USP7 as a therapeutic target. Small molecule inhibitors of USP7 DUB activity were developed to activate G1/S block that supposes to trigger p53 mediated cell death 198, 200. Efficacy and employment of these drugs is limited by mutations or inactiva tion in p53 gene, occurring in >50% of human cancers, including breast cancer 279, 280. Our study demonstrated t hat silencing of USP7 correlates with taxane resistance, thus it warns for future clinical us e of USP7 inhibitors in combinatorial regimens with taxanes. 102

PAGE 103

In conclusion, our study provides new insights for therapeutic approaches and predictive markers which will help in reduci ng breast cancer mortality and will increase the likelihood of a cure. Figure 6-1. Proposed model fo r Daxx and USP7 regulation of taxane response and genomic instability. Decreased expression of USP7 and/or Daxx leads to down-modulation of two checkpoint proteins: CHFR and Bub3. On one hand, reduced CHFR allows Aurora A accumulati on which in turn causes multipolar mitoses (Chapter 4) and genomic instabili ty. Aurora A accumulation explains the observed taxanes resistance upon loss of Daxx and/or USP7 which can be reversed by administration of Aurora A inhibitors (Chapter 4). On the other hand, reduced levels of Bub3 lead to increase of unproperly attached and lagging chromosomes. This causes addi tional genomic instabi lity thus further contributing to Daxx/USP7 mediat ed taxanes resistance (Chapter 5). Ultimately loss of Daxx and or USP7 can contribute to cancer progression therapy unresponsiveness in breast cancer patients. 103

PAGE 104

Future Directions Research presented in this study disse cted USP7/Daxx-dependent mechanism of mitotic progression which affects response to microtubule poisonous drug administration, such as taxanes. This newly identified mechanism adds to our basic knowledge of cell cycle regulatio n machinery with the hope of offering rational and more effective treatments to defeat breast cancer. Th is contribution will be significant as it will rationally explore novel targeted and combinatorial regimens for treatment and will also aid in proper selection of breast cancer patients to receive taxane-based therapy. Examine the Mechanism of Daxx Repression in Resistant Cells In Chapter 3, we demonstrated that r eduction of Daxx expr ession can dictate paclitaxel resistance, at least in a subpopul ation of patients, suggesting Daxx as both biomarker and target in taxane sensitivity. Levels of Daxx proteins vary among breast cancer cell lines and patient specimens, w here high levels of Daxx are associated with taxane sensitive phenotypes and that low levels of Daxx are associated with resistance to taxanes opening questions of Daxx regul ation. Recently pub lished screening for Daxx mutation identified that Daxx gene is mutated in about 25% of pancreatic neuroendocrine tumors, 7.1% of adult glioblastoma, 7.7% of oligodendroglioma and 1% of medulloblastomas, however no mutations were detected in a cohort of 96 breast cancer patients 143, suggesting that variability of Daxx accumulation between patients is not due to Daxx gene mutations Thus, future work must be done to identify how repression of Daxx is achieved in breas t tumors. Understanding the mechanism which leads to this gene inactivation may indicate clinical approaches to counteract Daxx repression. 104

PAGE 105

Analysis of human Daxx pr omoter revealed three CpG reach islands, suggesting DNA methylation and epigenetic regulati on as a possible mechanism of Daxx repression. If this proves tr ue, we predict that the combi nation of paclitaxel with drugs that could elevate Daxx expression (demethylating agent 5-azacitidine/Vidaza or HDAC inhibitor SAHA-Vorinostat) may represent a successful combinatory treatment of therapy-resistant breast cancer patients. We postulate that de-repression of Daxx promoter should increase Daxx accumu lation and, in turn, restore taxane responsiveness both in cell lines and in patient settings. Therefore, an improved understanding of the mechanism of Da xx down-regulation may identify new combinatorial regimens to overcome taxane resistance. Preliminary data in MDA-MD-468 and T-47D cell lines suggest that Daxx is regulated at the transcriptional level. Th is may be proven true at least in a subpopulation of breast cancers, but it is possible that Daxx might be regulated at the protein level as well. Indeed, genetic inacti vation of USP7 was proven to destabilize Daxx protein, suggesting Daxx as a USP7 substr ate. Hence, it is plausible that USP7 negative tumors are affected also by reduced Daxx protein levels. Validate Predictive Role of Protein USP7 as a Marker for Sensitivity to Taxanebased Chemotherapy in Breast Cancer Patients In Chapter 4, we determi ned that Daxx interacts wit h USP7 in mitosis. We demonstrated that USP7 controls mitosis and taxane resistance similarly to what was observed for Daxx (Chapter 3) in cell lin es. Thus, we will next determine how USP7 contributes to the paclitaxe l treatment in mouse xenograft models. Then, it will be essential to determine whether USP7 and it s mitotic substrates can be used as 105

PAGE 106

predictive factors for taxane response by screening both preand post-treatment breast cancer specimens from pat ients with known outcomes to taxane-based treatment. Earlier reports described USP7 as under-expressed in breast cancer tumor specimens 272. Thus, similarly to what is pla nned for Daxx, the mechanism of USP7 repression in resistant cells and breast cancer patients will also be examined. Explore Use of Aurora A Inhibitors to Reverse Taxane Resistance Our working model presented in Chapter 4 (Figure 4-7), indicates that USP7/Daxx regulation of mitotic progression occurs th rough Aurora A. Aurora A is a putative oncogene 281, 282; its amplification in breast cancer 75-77, or over-expression in tumors 7883 correlates with poor patient outcomes 84-86 and resistance to taxanes 72-74. Silencing or inhibition of Aurora A kinase activity sensitizes tumor cells to chemotherapeutic agents including taxanes 221-223, suggesting that this gene can be targeted in new therapeutic approaches. Thus, th is essential mitotic kinase is a potential target to overcome taxane resistance. Our future work will test whether inhibition of Aurora A with inhibitors such as MLN8054 218, 220 and the newly developed MLN8237 283, both currently in phase I clinical trials, can override taxane resistance determined by USP7/Daxx. We already tested this hypothesi s at the cellular level (Figure 4-6) for MLN8054 and we will do the same for MLN8237. Then we will test these molecules in xenograft models to evaluate which drug can fully override Daxx/USP7 mediated resistance in combinatoria l settings with paclitaxel. Biochemical Characterization of D axx and USP7 Mitotic Interaction We plan to continue characterization of U SP7/Daxx mitotic interaction; this work will be useful in understanding Daxx modulatory function of USP7. To this end we will map by in vitro and in vivo pull-down assay Daxx and USP7 interacting domains. Next, 106

PAGE 107

we will perform NMR characterization of Daxx /USP7 interaction to observe potential conformational changes of USP7 upon Daxx binding. Experiments will be done in collaboration with Dr. McIntosh, University of Vancouver as we did previously for Daxx Helical Bundle (DHB) domain 117. These experiments will also be fundamental in determining Daxx function as modulator of USP7 enzymatic activity. Finally, we will characterize the role of Daxx post-translati onal modifications in regulation of USP7 interaction. To this end, we already mapped mitotic-specific phosphorylation residues of Daxx that, based on amino acid signature, may be modified by one of mitotic kinases. Studies in this direction may open another avenue in the modulation of Daxx/USP7dependent taxane response. Examine the Role of Daxx and USP7 in Genomic Instability In Chapter 4, we showed that reduced levels of Daxx and USP7 lead to an increase in multipolar mitose s mediated by Aurora A accumu lation. Cells that exit and survive such abnormal mitosis are affected by numerical chromosomal aberration. In Chapter 5, we demonstrated t hat cells silenced of USP7 are indeed characterized by genomic instability and that these karyotype abnormalities are induced by reduced levels of Bub3 and consequent lagging chromosomes in anaphase. Thus, it will be interesting to address wit h future work whether these two events that lead to genomic instability (accumulation of Aurora A and reduced levels of Bub3) are related or separate and compounding event s. Moreover, we will determine Daxx contribution to regulati on of Bub3 stability. 107

PAGE 108

Determine whether USP7 Regulates stabil ity and Interacts with Components of the SAC and Kinetochore Proper segregation of genetic material and cell death upon mitotic stresses both rely on competent mitotic checkpoint. We found that USP7 silencing reduces stability the SAC component Bub3, causing genetic instability and lack of response to microtubule poisonous drugs as taxanes. Thus, our study indicates that USP7 modulates the role of checkpoint proteins at kinetochor e. In the future, assessing whether USP7 is mediating stability of ot her components of the SAC or affects their localization and functionality will be essential in fully understanding the biological and pathological roles of this enzyme. It will be im portant to determine if USP7 regulates the kinetochore structure and func tion. Detailed microscopy study of inter-kinetochore distances and defects in kinetochoremicrotubule attachments will be undertaken. In conclusion, the study presented in this dissertation provides future directions that may prove useful in the identificati on of novel therapeutic markers and approaches that will help in treating br east cancer patients. 108

PAGE 109

LIST OF REFERENCES 1. Morrison, W.B. Cancer c hemotherapy: an annot ated history. J Vet Intern Med 24, 1249-1262 (2010). 2. Lynch, H.T., Silva, E., Snyder, C. & Lynch, J.F. Hereditary breast cancer: part I. Diagnosing hereditary breast cancer syndromes. Breast J 14 3-13 (2008). 3. Boulton, S.J. Cellular functions of the BRCA tumour-suppressor proteins. Biochem Soc Trans 34, 633-645 (2006). 4. Ford, D. & Easton, D.F. The genet ics of breast and ovarian cancer. Br J Cancer 72, 805-812 (1995). 5. Li, F.P., Fraumeni, J.F., Jr., Mulvihill, J.J., Blattner, W.A. et al. A cancer family syndrome in twenty-four kindreds. Cancer Res 48, 5358-5362 (1988). 6. Varley, J.M. Germline TP53 mu tations and Li-Fraumeni syndrome. Hum Mutat 21, 313-320 (2003). 7. Zhao, L., Gu, A., Ji, G., Zou, P. et al. The Association between ATM IVS 22-77 T>C and Cancer Risk: A Meta-Analysis. PLoS One 7 e29479 (2012). 8. Hollander, M.C., Blumenthal, G.M. & Dennis, P.A. PTEN loss in the continuum of common cancers, ra re syndromes and mouse models. Nat Rev Cancer 11, 289-301 (2011). 9. Cianfrocca, M. & Goldstein, L.J. Prognostic and predictive factors in earlystage breast cancer. Oncologist 9 606-616 (2004). 10. Fisher, B., Bauer, M., Wi ckerham, D.L., Redmond, C.K. et al. Relation of number of positive axillary nodes to t he prognosis of patients with primary breast cancer. An NSABP update. Cancer 52, 1551-1557 (1983). 11. O'Shaughnessy, J. Extending survival with chemotherapy in metastatic breast cancer. Oncologist 10 Suppl 3 20-29 (2005). 12. Wall, M.E. Camptothecin and taxol: discovery to clinic. Med Res Rev 18, 299-314 (1998). 13. Oberlies, N.H. & Kroll, D.J. Camptothecin and ta xol: historic achievements in natural products research. J Nat Prod 67, 129-135 (2004). 14. Schiff, P.B., Fant, J. & Horwitz, S.B. Promotion of microtubule assembly in vitro by taxol. Nature 277 665-667 (1979). 109

PAGE 110

15. Schiff, P.B. & Horwit z, S.B. Taxol stabilizes microtubules in mouse fibroblast cells. Proc Natl Acad Sci U S A 77, 1561-1565 (1980). 16. Wood, K.W., Cornwell, W.D. & Jackson, J.R. Past and future of the mitotic spindle as an oncology target. Curr Opin Pharmacol 1 370-377 (2001). 17. Gascoigne, K.E. & Taylor, S.S. How do anti-mitotic drugs kill cancer cells? J Cell Sci 122 2579-2585 (2009). 18. Higa, G.M. The microtubule as a breast cancer target. Breast Cancer 18, 103-119. 19. Matson, D.R. & Stukenberg, P.T. Sp indle poisons and cell fate: a tale of two pathways. Mol Interv 11, 141-150. 20. Liebmann, J.E., Cook, J.A. Lipschultz, C., Teague, D. et al. Cytotoxic studies of paclitaxel (Taxol) in human tumour cell lines. Br J Cancer 68, 1104-1109 (1993). 21. Morse, D.L., Gray, H., Payne, C.M. & Gillies, R. J. Docetaxel induces cell death through mitotic catastrophe in human breast cancer cells. Mol Cancer Ther 4 1495-1504 (2005). 22. Higa, G.M. The microtubule as a breast cancer target. Breast Cancer 18, 103-119 (2011). 23. Cleveland, D.W., Mao, Y. & Sullivan, K.F. Cent romeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell 112 407-421 (2003). 24. Kroemer, G., El-Deiry, W.S ., Golstein, P., Peter, M.E. et al. Classification of cell death: recommendations of t he Nomenclature Committee on Cell Death. Cell Death Differ 12 Suppl 2 1463-1467 (2005). 25. Chang, B.D., Xuan, Y ., Broude, E.V., Zhu, H. et al. Role of p53 and p21waf1/cip1 in senescence-like terminal proliferation arrest induced in human tumor cells by chemotherapeutic drugs. Oncogene 18, 4808-4818 (1999). 26. Roninson, I.B., Broude, E.V. & Ch ang, B.D. If not apoptosis, then what? Treatment-induced senescence and mito tic catastrophe in tumor cells. Drug Resist Updat 4 303-313 (2001). 27. Castedo, M., Perfettini, J. L., Roumier, T., Andreau, K. et al. Cell death by mitotic catastrophe: a molecular definition. Oncogene 23, 2825-2837 (2004). 110

PAGE 111

28. Castedo, M., Perfettini, J.L., Roumier, T., Valent, A. et al. Mitotic catastrophe constitutes a special case of apoptosis whose suppression entails aneuploidy. Oncogene 23, 4362-4370 (2004). 29. Abal, M., Andreu, J.M. & Baras oain, I. Taxanes: microtubule and centrosome targets, and cell cycle dependent mechanisms of action. Curr Cancer Drug Targets 3 193-203 (2003). 30. Musacchio, A. & Salmon, E.D. The sp indle-assembly checkpoint in space and time. Nat Rev Mol Cell Biol 8 379-393 (2007). 31. Rieder, C.L. Mitosis in vertebrates : the G2/M and M/A tr ansitions and their associated checkpoints. Chromosome Res 19 291-306. 32. Mantel, C., Guo, Y. Lee, M.R., Han, M.K. et al. Cells enter a unique intermediate 4N stage, not 4N-G1, after aborted mitosis. Cell Cycle 7 484-492 (2008). 33. Wysong, D.R., Chakravarty, A., Hoar K. & Ecsedy, J.A. The inhibition of Aurora A abrogates the mitotic delay induced by microtubule perturbing agents. Cell Cycle 8 876-888 (2009). 34. Brito, D.A. & Rieder, C.L. Mitotic checkpoint slippage in humans occurs via cyclin B destruction in the presence of an active checkpoint. Curr Biol 16, 1194-1200 (2006). 35. Brito, D.A., Yang, Z. & Rieder, C.L. Microtubu les do not promote mitotic slippage when the spindle assembly checkpoint cannot be satisfied. J Cell Biol 182 623-629 (2008). 36. Niikura, Y., Dixit, A., Scott, R., Perkins, G. et al. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol 178 283-296 (2007). 37. Sudo, T., Nitta, M., Saya, H. & Ueno, N.T. Dependence of paclitaxel sensitivity on a functional spindle assembly checkpoint. Cancer Res 64, 2502-2508 (2004). 38. Carvalho, A., Carmena, M. Sambade, C., Earnshaw, W.C. et al. Survivin is required for stable checkpoint acti vation in taxol-treated HeLa cells. J Cell Sci 116 2987-2998 (2003). 39. Lens, S.M., Wolthuis, R.M. Klompmaker, R., Kauw, J. et al. Survivin is required for a sustained spindle checkpoi nt arrest in response to lack of tension. Embo J 22, 2934-2947 (2003). 111

PAGE 112

40. Lee, E.A., Keutmann, M.K. Dowling, M.L., Harris, E. et al. Inactivation of the mitotic checkpoint as a determi nant of the efficacy of microtubuletargeted drugs in killing human cancer cells. Mol Cancer Ther 3 661-669 (2004). 41. Kienitz, A., Vogel, C., Morales, I., Muller, R. et al. Partial downregulation of MAD1 causes spindle checkpoint i nactivation and aneuploidy, but does not confer resistance towards taxol. Oncogene 24, 4301-4310 (2005). 42. Bothos, J., Summers, M.K. Venere, M., Scolnick, D.M. et al. The Chfr mitotic checkpoint protein functi ons with Ubc13-Mms2 to form Lys63linked polyubiquitin chains. Oncogene 22, 7101-7107 (2003). 43. Kang, D., Chen, J., Wong, J. & Fang, G. The checkpoint protein Chfr is a ligase that ubiquitinates Pl k1 and inhibits Cdc2 at the G2 to M transition. J Cell Biol 156 249-259 (2002). 44. Chaturvedi, P., Sudakin, V., Bobiak, M.L., Fisher, P.W. et al. Chfr regulates a mitotic stress pathway through its RING-finger domain with ubiquitin ligase activity. Cancer Res 62, 1797-1801 (2002). 45. Yu, X., Minter-Dykhouse, K., Malureanu, L., Zhao, W.M. et al. Chfr is required for tumor suppression and Aurora A regulation. Nat Genet 37, 401-406 (2005). 46. Scolnick, D.M. & Halazonetis, T.D. Ch fr defines a mitotic stress checkpoint that delays entry into metaphase. Nature 406 430-435 (2000). 47. Chabalier, C., Lamare, C., Racca, C., Privat, M. et al. BRCA1 downregulation leads to premature inac tivation of spindle checkpoint and confers paclitaxel resistance. Cell Cycle 5 1001-1007 (2006). 48. Xia, G., Luo, X., Habu, T., Rizo, J. et al. Conformation-specific binding of p31(comet) antagonizes the function of Mad2 in the spindle checkpoint. Embo J 23, 3133-3143 (2004). 49. Wassmann, K. & Benezra, R. Mitotic checkpoints: from yeast to cancer. Curr Opin Genet Dev 11, 83-90 (2001). 50. Cahill, D.P., Lengauer, C., Yu, J., Riggins, G.J. et al. Mutations of mitotic checkpoint genes in human cancers. Nature 392 300-303 (1998). 51. Haruki, N., Saito, H ., Harano, T., Nomoto, S. et al. Molecular analysis of the mitotic checkpoint genes BUB1 BUBR1 and BUB3 in human lung cancers. Cancer Lett 162 201-205 (2001). 112

PAGE 113

52. Crown, J., O'Leary, M. & Ooi, W. S. Docetaxel and paclitaxel in the treatment of breast cancer: a re view of clinical experience. Oncologist 9 Suppl 2 24-32 (2004). 53. Bonneterre, J., Spielman, M. Guastalla, J.P., Marty, M. et al. Efficacy and safety of docetaxel (Taxotere) in heavily pretreated advanced breast cancer patients: the French compa ssionate use programme experience. Eur J Cancer 35, 1431-1439 (1999). 54. Ravdin, P., Erban, J. & Overmoyer, B. Phase III comparison of docetaxel and paclitaxel in patients with metastatic breast cancer. Eur J Cancer suppl1:32 (2003). 55. Henderson, I.C., Berry, D.A., Demetri, G.D., Cirrincione, C.T. et al. Improved outcomes from adding sequent ial Paclitaxel but not from escalating Doxorubicin dose in an adjuvant chemotherapy regimen for patients with node-positive primary breast cancer. J Clin Oncol 21, 976983 (2003). 56. Aapro, M.S. Neoadjuvant therapy in breast cancer: can we define its role? Oncologist 6 Suppl 3 36-39 (2001). 57. Zhou, J. & Giannakakou, P. Targ eting microtubules for cancer chemotherapy. Curr Med Chem Anticancer Agents 5 65-71 (2005). 58. Berrieman, H.K., Lind, M.J. & Cawkwe ll, L. Do beta-tubulin mutations have a role in resistance to chemotherapy? Lancet Oncol 5 158-164 (2004). 59. Goncalves, A., Braguer, D. Kamath, K., Martello, L. et al. Resistance to Taxol in lung cancer cells associated with increased microtubule dynamics. Proc Natl Acad Sci U S A 98, 11737-11742 (2001). 60. Orr, G.A., Verdier-Pinar d, P., McDaid, H. & Horwitz, S.B. Mechanisms of Taxol resistance related to microtubules. Oncogene 22, 7280-7295 (2003). 61. Brooks, T.A., Minderman, H., O'Loughlin, K.L., Pera, P. et al. Taxanebased reversal agents modulate dr ug resistance mediated by Pglycoprotein, multidrug resistance protein, and breast cancer resistance protein. Mol Cancer Ther 2 1195-1205 (2003). 62. Chien, A.J. & Moasser, M.M. Cellular mechanisms of resistance to anthracyclines and taxanes in cancer: intrinsic and acquired. Semin Oncol 35, S1-S14; quiz S39 (2008). 113

PAGE 114

63. Villeneuve, D.J., Hembruff, S.L., Veitch, Z., Cecchetto, M. et al. cDNA microarray analysis of isogenic paclitax eland doxorubicin-resistant breast tumor cell lines reveals distinct drug-specific genetic signatures of resistance. Breast Cancer Res Treat 96, 17-39 (2006). 64. Quinn, J.E., Kennedy, R.D., Mullan, P.B., Gilmore, P.M. et al. BRCA1 functions as a differential modulator of chemotherapy-induced apoptosis. Cancer Res 63, 6221-6228 (2003). 65. Yu, D., Jing, T., Liu, B., Yao, J. et al. Overexpression of ErbB2 blocks Taxol-induced apoptosis by upregulat ion of p21Cip1, which inhibits p34Cdc2 kinase. Mol Cell 2 581-591 (1998). 66. Yu, D., Liu, B., Jing, T., Sun, D. et al. Overexpression of both p185c-erbB2 and p170mdr-1 renders breast cancer ce lls highly resistant to taxol. Oncogene 16, 2087-2094 (1998). 67. Wang, T.H., Wang, H.S. & Soong Y.K. Paclitaxel-induced cell death: where the cell cycle and apoptosis come together. Cancer 88, 2619-2628 (2000). 68. Darshan, M.S., Loftus, M.S. Thadani-Mulero, M., Levy, B.P. et al. Taxane-induced blockade to nuclear accumulation of the androgen receptor predicts clinical responses in metastatic prostate cancer. Cancer Res 71, 6019-6029 (2011). 69. Carbonaro, M., O'Brate, A. & Gi annakakou, P. Microtubule disruption targets HIF-1alpha mRNA to cytoplas mic P-bodies for translational repression. J Cell Biol 192 83-99 (2011). 70. Satoh, A., Toyota, M., Itoh, F., Sasaki, Y. et al. Epigenetic inactivation of CHFR and sensitivity to microtubule inhibitors in gastric cancer. Cancer Res 63, 8606-8613 (2003). 71. Xu, M., Takanashi, M., Oikawa, K., Nishi, H. et al. Identification of a novel role of Septin 10 in Paclitaxel-resi stance in cancers through a functional genomics screen. Cancer Sci (2012). 72. Anand, S., Penrhyn-Lowe, S. & Venkitaraman, A.R. AURORA-A amplification overrides the mitotic sp indle assembly checkpoint, inducing resistance to Taxol. Cancer Cell 3 51-62 (2003). 73. McGrogan, B.T., Gilmar tin, B., Carney, D.N. & McCann, A. Taxanes, microtubules and chemoresistant breast cancer. Biochim Biophys Acta 1785 96-132 (2008). 114

PAGE 115

74. Hata, T., Furukawa, T., Sunamura, M., Egawa, S. et al. RNA interference targeting aurora kinase a suppresses tumor growth and enhances the taxane chemosensitivity in human pancreatic cancer cells. Cancer Res 65, 2899-2905 (2005). 75. Miyoshi, Y., Iwao, K., Egawa, C. & Noguchi, S. Association of centrosomal kinase STK15/BTAK mRNA expression with chromosomal instability in human breast cancers. Int J Cancer 92, 370-373 (2001). 76. Staff, S., Isola, J., Jumppanen, M. & Tanner, M. Aurora-A gene is frequently amplified in basal-like breast cancer. Oncol Rep 23, 307-312. 77. Barr, A.R. & Gergely, F. Aurora-A: the maker and breaker of spindle poles. J Cell Sci 120 2987-2996 (2007). 78. Gritsko, T.M., Coppola, D., Paciga, J.E., Yang, L. et al. Activation and overexpression of centrosome kinase BTAK/Aurora-A in human ovarian cancer. Clin Cancer Res 9 1420-1426 (2003). 79. Katayama, H., Brinkley, W.R. & Sen, S. The Aurora kinases: role in cell transformation and tumorigenesis. Cancer Metastasis Rev 22, 451-464 (2003). 80. Li, D., Zhu, J., Firo zi, P.F., Abbruzzese, J.L. et al. Overexpression of oncogenic STK15/BTAK/Aurora A kinase in human pancreatic cancer. Clin Cancer Res 9 991-997 (2003). 81. Sakakura, C., Hagiwara, A., Yasuoka, R., Fujita, Y. et al. Tumouramplified kinase BTAK is amplified and overexpressed in gastric cancers with possible involvement in aneuploid formation. Br J Cancer 84, 824-831 (2001). 82. Sen, S., Zhou, H., Zhang, R.D., Yoon, D.S. et al. Amplification/overexpr ession of a mitotic kinase gene in human bladder cancer. J Natl Cancer Inst 94, 1320-1329 (2002). 83. Marumoto, T., Zhang, D. & Saya, H. Aurora-A a guardian of poles. Nat Rev Cancer 5 42-50 (2005). 84. Das, K., Lorena, P. D., Ng, L.K., Shen, L. et al. Aurora-A expression, hormone receptor status and clinical out come in hormone related cancers. Pathology 42, 540-546. 85. Jeng, Y.M., Peng, S.Y., Lin, C. Y. & Hsu, H.C. Overexpression and amplification of Aurora-A in hepatocellular carcinoma. Clin Cancer Res 10, 2065-2071 (2004). 115

PAGE 116

86. Lassus, H., Staff, S. Leminen, A., Isola, J. et al. Aurora-A overexpression and aneuploidy predict poor outcome in serous ovarian carcinoma. Gynecol Oncol 120 11-17. 87. Kiriakidou, M., Driscoll, D.A., Lopez -Guisa, J.M. & Strauss, J.F., 3rd Cloning and expression of primate Daxx cDNAs and mapping of the human gene to chromosome 6p2 1.3 in the MHC region. DNA Cell Biol 16, 1289-1298 (1997). 88. Lindsay, C.R., Scholz, A., Morozov, V.M. & Ishov, A.M. Daxx shortens mitotic arrest caused by paclitaxel. Cell Cycle 6 1200-1204 (2007). 89. Yang, X., Khosravi-Far, R., Chang, H.Y. & Baltimore, D. Daxx, a novel Fas-binding protein that activates JNK and apoptosis. Cell 89, 1067-1076 (1997). 90. Salomoni, P. & Khelifi, A.F. Daxx: death or survival protein? Trends Cell Biol 16, 97-104 (2006). 91. Juo, P., Kuo, C.J., Yuan, J. & Blenis, J. Essential requirement for caspase-8/FLICE in the initiation of the Fas-induced apoptotic cascade. Curr Biol 8 1001-1008 (1998). 92. Zhang, J., Cado, D., Chen, A., Kabra, N.H. et al. Fas-mediated apoptosis and activation-induced T-cell proliferat ion are defective in mice lacking FADD/Mort1. Nature 392 296-300 (1998). 93. Torii, S., Egan, D.A., Evans, R.A. & Reed, J.C. Human Daxx regulates Fas-induced apoptosis from nuclear PML oncogenic domains (PODs). EMBO J 18, 6037-6049 (1999). 94. Michaelson, J.S., Bader, D., Kuo, F., Kozak, C. et al. Loss of Daxx, a promiscuously interacting protein, resu lts in extensive apoptosis in early mouse development. Genes Dev 13, 1918-1923 (1999). 95. Michaelson, J.S. The Daxx enigma. Apoptosis 5 217-220 (2000). 96. Ishov, A.M., Sotnikov, A.G., Negorev, D., Vladimirova, O.V. et al. PML is critical for ND10 formation and recruits the PML-interacting protein daxx to this nuclear structure when modified by SUMO-1. J Cell Biol 147 221-234 (1999). 97. Santiago, A., Godsey, A. C., Hossain, J., Zhao, L.Y. et al. Identification of two independent SUMO-interacting mo tifs in Daxx: evolutionary conservation from Drosophila to humans and their biochemical functions. Cell Cycle 8 76-87 (2009). 116

PAGE 117

98. Lin, D.Y., Huang, Y.S ., Jeng, J.C., Kuo, H.Y. et al. Role of SUMOinteracting motif in Daxx SUMO modi fication, subnuclear localization, and repression of sumoylated transcription factors. Mol Cell 24, 341-354 (2006). 99. Ishov, A.M., Vladimirova, O.V. & Maul, G.G. Heterochromatin and ND10 are cell-cycle regulated and phosphoryl ation-dependent alternate nuclear sites of the transcription represso r Daxx and SWI/SNF protein ATRX. J Cell Sci 117 3807-3820 (2004). 100. Lalioti, V.S., Vergarajauregui, S., Pu lido, D. & Sandoval, I.V. The insulinsensitive glucose transporter, GLUT4, interacts physically with Daxx. Two proteins with capacity to bind Ubc9 and conjugated to SUMO1. J Biol Chem 277 19783-19791 (2002). 101. Jung, Y.S., Kim, H.Y., Lee, Y.J. & Kim, E. Subcellular localization of Daxx determines its opposing functions in ischemic cell death. FEBS Lett 581 843-852 (2007). 102. Jung, Y.S., Kim, H. Y., Kim, J., Lee, M.G. et al. Physical interactions and functional coupling between Daxx and sodium hydrogen exchanger 1 in ischemic cell death. J Biol Chem 283 1018-1025 (2008). 103. Junn, E., Taniguchi, H., Jeong, B.S., Zhao, X. et al. Interaction of DJ-1 with Daxx inhibits apoptosis signal -regulating kinase 1 activity and cell death. Proc Natl Acad Sci U S A 102 9691-9696 (2005). 104. Karunakaran, S., Diwakar, L., Saeed, U., Agarwal, V. et al. Activation of apoptosis signal regulating kinase 1 (ASK1) and translocation of deathassociated protein, Daxx, in substant ia nigra pars compacta in a mouse model of Parkinson's disease: pr otection by alpha-lipoic acid. FASEB J 21, 2226-2236 (2007). 105. Song, J.J. & Lee, Y.J. Role of the ASK1-SEK1-JNK1-HIPK1 signal in Daxx trafficking and ASK1 oligomerization. J Biol Chem 278 47245-47252 (2003). 106. Song, J.J. & Lee, Y.J. Trypt ophan 621 and serine 667 residues of Daxx regulate its nuclear export dur ing glucose deprivation. J Biol Chem 279 30573-30578 (2004). 107. Khelifi, A.F., D'Alcontre s, M.S. & Salomoni, P. Da xx is required for stressinduced cell death and JNK activation. Cell Death Differ 12, 724-733 (2005). 108. Lindsay, C.R., Giovinazzi, S. & Is hov, A.M. Daxx is a predominately nuclear protein that does not transloc ate to the cytoplasm in response to cell stress. Cell Cycle 8 (2009). 117

PAGE 118

109. Nefkens, I., Negorev, D.G., Ishov, A.M., Michaelson, J.S. et al. Heat shock and Cd2+ exposure regulate PML and Daxx release from ND10 by independent mechanisms that modify the induction of heat-shock proteins 70 and 25 differently. J Cell Sci 116 513-524 (2003). 110. Everett, R.D., Earnshaw, W.C. Pluta, A.F., Sternsdorf, T. et al. A dynamic connection between centrome res and ND10 proteins. J Cell Sci 112 ( Pt 20) 3443-3454 (1999). 111. Pluta, A.F., Earnshaw, W.C. & Goldberg, I.G. Interphase-specific association of intrinsi c centromere protein CE NP-C with HDaxx, a death domain-binding protein implicated in Fas-mediated cell death. J Cell Sci 111 ( Pt 14) 2029-2041 (1998). 112. Elsaesser, S.J. & Allis, C.D. HI RA and Daxx Constitute Two Independent Histone H3.3-Containing Pr edeposition Complexes. Cold Spring Harb Symp Quant Biol (2010). 113. Lindsay, C.R., Morozov, V.M. & Ishov, A.M. PML NBs (ND10) and Daxx: from nuclear structure to protein function. Front Biosci 13, 7132-7142 (2008). 114. Hollenbach, A.D., Sublett, J.E., McPherson, C.J. & Grosveld, G. The Pax3-FKHR oncoprotein is unrespons ive to the Pax3-associated repressor hDaxx. EMBO J 18, 3702-3711 (1999). 115. Kitagawa, D., Kajiho, H., Negishi, T., Ura, S. et al. Release of RASSF1C from the nucleus by Daxx degradation links DNA damage and SAPK/JNK activation. EMBO J 25, 3286-3297 (2006). 116. Giovinazzi, S., Lindsay, C.R., Morozov, V.M., Escobar-Cabrera, E. et al. Regulation of mitosis and taxane response by Daxx and Rassf1. Oncogene (2011). 117. Escobar-Cabrera, E., Lau, D.K., Giovinazzi, S., Ishov, A.M. et al. Structural Characterization of t he DAXX N-Terminal Helical Bundle Domain and Its Complex with Rassf1C. Structure 18, 1642-1653 (2010). 118. Michaelson, J.S. & Leder, P. RNAi reveals anti-apoptotic and transcriptionally repressive activities of DAXX. J Cell Sci 116 345-352 (2003). 119. Salomoni, P. & Pandolfi, P.P. Th e role of PML in tumor suppression. Cell 108 165-170 (2002). 120. Morozov, V.M., Massoll, N.A ., Vladimirova, O.V., Maul, G.G. et al. Regulation of c-met ex pression by transcription repressor Daxx. Oncogene 27, 2177-2186 (2008). 118

PAGE 119

121. Chang, C.C., Lin, D.Y., Fang, H.I., Chen, R.H. et al. Daxx mediates the small ubiquitin-like modifier-dependent transcriptional repression of Smad4. J Biol Chem 280 10164-10173 (2005). 122. Kuo, H.Y., Chang, C. C., Jeng, J.C., Hu, H.M. et al. SUMO modification negatively modulates the transcriptional activity of CREB-binding protein via the recruitment of Daxx. Proc Natl Acad Sci U S A 102 16973-16978 (2005). 123. Shih, H.M., Chang, C.C., Kuo, H.Y. & Lin, D.Y. Daxx mediates SUMOdependent transcriptional control and s ubnuclear compartmentalization. Biochem Soc Trans 35, 1397-1400 (2007). 124. Hollenbach, A.D., McPherson, C.J., Mientjes, E.J., Iyengar, R. et al. Daxx and histone deacetylase II associate with chromatin through an interaction with core histones and the chroma tin-associated protein Dek. J Cell Sci 115 3319-3330 (2002). 125. Puto, L.A. & Reed, J.C. Daxx represses RelB target promoters via DNA methyltransferase recruitment and DNA hypermethylation. Genes Dev 22, 998-1010 (2008). 126. Tang, J., Qu, L.K. Zhang, J., Wang, W. et al. Critical role for Daxx in regulating Mdm2. Nat Cell Biol 8 855-862 (2006). 127. Song, M.S., Song, S. J., Kim, S.Y., Oh, H.J. et al. The tumour suppressor RASSF1A promotes MDM2 self-ubiqu itination by disrupting the MDM2DAXX-HAUSP complex. EMBO J 27, 1863-1874 (2008). 128. Drane, P., Ouararhni, K., Depaux, A., Shuaib, M. et al. The deathassociated protein DAXX is a novel histone chaperone involved in the replication-independent deposition of H3.3. Genes Dev 24 1253-1265 (2010). 129. Goldberg, A.D., Banaszynski, L.A., Noh, K.M., Lewis, P.W. et al. Distinct factors control histone variant H3.3 localization at specific genomic regions. Cell 140 678-691 (2010). 130. Koken, M.H., Linares-Cruz, G., Quignon, F., Viron, A. et al. The PML growth-suppressor has an altered ex pression in human oncogenesis. Oncogene 10, 1315-1324 (1995). 131. Stuurman, N., de Graaf, A., Floore, A., Josso, A. et al. A monoclonal antibody recognizing nuclear ma trix-associated nuclear bodies. J Cell Sci 101 ( Pt 4) 773-784 (1992). 119

PAGE 120

132. Terris, B., Baldin, V., Dubois, S., Degott, C. et al. PML nuclear bodies are general targets for inflammation and cell proliferation. Cancer Res 55, 1590-1597 (1995). 133. Sternsdorf, T., Jensen, K. & Will, H. Evidence for covalent modification of the nuclear dot-associated proteins PML and Sp100 by PIC1/SUMO-1. J Cell Biol 139 1621-1634 (1997). 134. Giovinazzi, S., Lindsay, C.R., Morozov, V.M., Escobar-Cabrera, E. et al. Regulation of mitosis and taxane response by Daxx and Rassf1. Oncogene 135. Chen, E.S., Saitoh, S., Yanagida, M. & Takahashi, K. A cell cycleregulated GATA factor promotes cent romeric localization of CENP-A in fission yeast. Mol Cell 11, 175-187 (2003). 136. Chan, G.K. & Yen, T.J. The mitoti c checkpoint: a signaling pathway that allows a single unattached kinetochore to inhibit mitotic exit. Prog Cell Cycle Res 5 431-439 (2003). 137. Waghray, A., Schober, M. Feroze, F., Yao, F. et al. Identification of differentially expressed genes by seri al analysis of gene expression in human prostate cancer. Cancer Res 61, 4283-4286 (2001). 138. Mizuta, H. & Kuroda, Y. Cloning and functional characterization of a rat Daxx that functions as a cor epressor for the androgen receptor. Cell Biol Int 28, 609-614 (2004). 139. Lin, D.Y., Fang, H .I., Ma, A.H., Huang, Y.S. et al. Negative modulation of androgen receptor transcripti onal activity by Daxx. Mol Cell Biol 24 10529-10541 (2004). 140. Tzeng, S.L., Cheng, Y. W., Li, C.H., Lin, Y.S. et al. Physiological and functional interactions between Tcf4 and Daxx in colon cancer cells. J Biol Chem 281 15405-15411 (2006). 141. Jiao, Y., Shi, C., Ed il, B.H., de Wilde, R.F. et al. DAXX/ATRX, MEN1, and mTOR pathway genes are frequently al tered in pancreatic neuroendocrine tumors. Science 331 1199-1203 (2011). 142. Law, M.J., Lower, K.M ., Voon, H.P., Hughes, J.R. et al. ATR-X syndrome protein targets tandem repeats and influences allele-specific expression in a size-dependent manner. Cell 143 367-378 (2010). 143. Heaphy, C.M., de Wilde, R. F., Jiao, Y., Klein, A.P. et al. Altered telomeres in tumors with ATRX and DAXX mutations. Science 333 425 (2011). 120

PAGE 121

144. Yeager, T.R., Neumann, A.A., Englezou, A., Huschtscha, L.I. et al. Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res 59, 4175-4179 (1999). 145. Sablina, A.A., Budanov, A.V. Ilyinskaya, G.V., Agapova, L.S. et al. The antioxidant function of the p53 tumor suppressor. Nat Med 11, 1306-1313 (2005). 146. Meraldi, P., Draviam, V.M. & Sorger, P.K. Ti ming and checkpoints in the regulation of mitotic progression. Dev Cell 7 45-60 (2004). 147. Countryman, P.I. & Heddle, J.A. The production of micronuclei from chromosome aberrations in irradiated cultures of human lymphocytes. Mutat Res 41, 321-332 (1976). 148. Fenech, M., Chang, W.P., Ki rsch-Volders, M., Holland, N. et al. HUMN project: detailed description of the scoring criteria for the cytokinesis-block micronucleus assay using isolated human lymphocyte cultures. Mutat Res 534 65-75 (2003). 149. Ring, A.E. & Ellis, P.A. Taxanes in the treatment of early breast cancer. Cancer Treat Rev 31, 618-627 (2005). 150. Hari, M., Wang, Y., Veeraraghavan, S. & Cabral, F. Mutations in alphaand beta-tubulin that stabilize microtubules and confer resistance to colcemid and vinblastine. Mol Cancer Ther 2 597-605 (2003). 151. Rieder, C.L. & Maiato, H. Stuck in division or passing through: what happens when cells cannot satisfy the spindle assembly checkpoint. Dev Cell 7 637-651 (2004). 152. Chen, J.G. & Horwitz, S.B. Differ ential mitotic responses to microtubulestabilizing and -destabilizing drugs. Cancer Res 62, 1935-1938 (2002). 153. Holland, A.J. & Cleveland, D.W. Beyond genetics: surprising determinants of cell fate in antitumor drugs. Cancer Cell 14 103-105 (2008). 154. Gascoigne, K.E. & Taylor, S.S. Canc er cells display profound intraand interline variation following prolon ged exposure to antimitotic drugs. Cancer Cell 14, 111-122 (2008). 155. Chang, J.C., Wooten, E.C., Tsimelzon, A., Hilsenbeck, S.G. et al. Gene expression profiling for the prediction of therapeutic response to docetaxel in patients with breast cancer. Lancet 362 362-369 (2003). 156. Chang, J.C., Wooten, E.C., Tsimelzon, A., Hilsenbeck, S.G. et al. Patterns of resistance and incomplete response to docetaxel by gene expression profiling in breast cancer patients. J Clin Oncol 23, 1169-1177 (2005). 121

PAGE 122

157. Iwao-Koizumi, K., Matoba, R., Ueno, N., Kim, S.J. et al. Prediction of docetaxel response in human breast c ancer by gene expression profiling. J Clin Oncol 23, 422-431 (2005). 158. Miyoshi, Y., Kim, S.J., Akazawa, K., Kamigaki, S. et al. Down-regulation of intratumoral aromatase messenger RNA levels by docetaxel in human breast cancers. Clin Cancer Res 10, 8163-8169 (2004). 159. Mauriac, L., Debled, M. & MacGrogan, G. When will more useful predictive factors be ready for use? Breast 14, 617-623 (2005). 160. Nigg, E.A. Mitotic kinases as regulator s of cell division and its checkpoints. Nat Rev Mol Cell Biol 2 21-32 (2001). 161. Swanton, C., Marani, M. Pardo, O., Warne, P.H. et al. Regulators of mitotic arrest and cerami de metabolism are determinants of sensitivity to paclitaxel and other chemotherapeutic drugs. Cancer Cell 11, 498-512 (2007). 162. Saffert, R.T. & Kalejt a, R.F. Promyelocytic leukemia-nuclear body proteins: herpesvirus enemies, accomplices, or both? Future Virol 3 265277 (2008). 163. Heaphy, C.M., de Wilde, R. F., Jiao, Y., Klein, A.P. et al. Altered telomeres in tumors with ATRX and DAXX mutations. Science 333 425. 164. Jiao, Y., Shi, C., Ed il, B.H., de Wilde, R.F. et al. DAXX/ATRX, MEN1, and mTOR pathway genes are frequently al tered in pancreatic neuroendocrine tumors. Science 331 1199-1203. 165. De Mulder, P.H. The chem otherapy of head and neck cancer. Acta Otorhinolaryngol Belg 53, 247-252 (1999). 166. Summers, M.K., Pan, B., Mukhyala, K. & Jackson, P.K. The unique N terminus of the UbcH10 E2 enzyme controls the threshold for APC activation and enhances checkpoi nt regulation of the APC. Mol Cell 31, 544-556 (2008). 167. Wang, Y. & Cabral, F. Paclitaxel resistance in cells with reduced betatubulin. Biochim Biophys Acta 1744 245-255 (2005). 168. Hari, M., Yang, H., Zeng, C., Canizales, M. et al. Expression of class III beta-tubulin reduces microtubule a ssembly and confers resistance to paclitaxel. Cell Motil Cytoskeleton 56, 45-56 (2003). 169. Kubota, T., Matsuzaki, S.W., Hoshiya, Y., Watanabe, M. et al. Antitumor activity of paclitaxel against human breast carcinoma xenografts serially transplanted into nude mice. J Surg Oncol 64, 115-121 (1997). 122

PAGE 123

170. Michaelson, J.S., Bader D., Kuo, F., Kozak, C. et al. Loss of daxx, a promiscuously interacting protein, resu lts in extensive apoptosis in early mouse development [In Process Citation]. Genes Dev 13 1918-1923 (1999). 171. Nilsson, J., Yekezare, M., Minshull, J. & Pines, J. The APC/C maintains the spindle assembly checkpoint by targeting Cdc20 for destruction. Nat Cell Biol 10 1411-1420 (2008). 172. Herzog, F., Primorac I., Dube, P., Lenart, P. et al. Structure of the anaphase-promoting complex/cyclosome interacting with a mitotic checkpoint complex. Science 323 1477-1481 (2009). 173. Eytan, E., Braunstein, I., Ganoth, D., Teichner, A. et al. Two different mitotic checkpoint inhibitors of the anaphase-promoting complex/cyclosome antagonize the ac tion of the activator Cdc20. Proc Natl Acad Sci U S A 105 9181-9185 (2008). 174. Everett, R.D., Meredith M., Orr, A., Cross, A. et al. A novel ubiquitinspecific protease is dynamically associated with the PML nuclear domain and binds to a herpesvirus regulatory protein. EMBO J 16, 1519-1530 (1997). 175. Boutell, C., Canning, M., Orr, A. & Everett, R.D. Reciprocal activities between herpes simplex virus type 1 regulatory protein ICP0, a ubiquitin E3 ligase, and ubiquitin-specific protease USP7. J Virol 79, 12342-12354 (2005). 176. Canning, M., Boutell, C., Parkins on, J. & Everett, R.D. A RING finger ubiquitin ligase is protected fr om autocatalyzed ubiquitination and degradation by binding to ubiqui tin-specific protease USP7. J Biol Chem 279 38160-38168 (2004). 177. Wilkinson, K.D. Regulation of ubiquitin-dependent processes by deubiquitinating enzymes. FASEB J 11, 1245-1256 (1997). 178. Oh, Y.M., Yoo, S.J. & Seol, J.H. Deubiquitination of Chfr, a checkpoint protein, by USP7/H AUSP regulates its stability and activity. Biochem Biophys Res Commun 357 615-619 (2007). 179. Song, M.S., Salmena, L ., Carracedo, A., Egia, A. et al. The deubiquitinylation and localization of PTEN are regulated by a HAUSPPML network. Nature 455 813-817 (2008). 180. Tang, J., Qu, L., Pang, M. & Yang, X. Daxx is reciprocally regulated by Mdm2 and Hausp. Biochem Biophys Res Commun 393 542-545. 123

PAGE 124

181. Huang, Z., Wu, Q., Guryanova, O.A., Cheng, L. et al. Deubiquitylase HAUSP stabilizes REST and promotes maintenance of neural progenitor cells. Nat Cell Biol 13, 142-152 (2011). 182. Huang, Z., Zhou, W. & Bao, S. Role of deubiquitylase HAUSP in stem cell maintenance. Cell Cycle 10, 1182-1183 (2011). 183. Faustrup, H., Bekker-Jens en, S., Bartek, J., Lukas, J. et al. USP7 counteracts SCFbetaTrCPbut not APCCdh1-mediated proteolysis of Claspin. J Cell Biol 184 13-19 (2009). 184. Mailand, N., Bekker-Jensen, S., Bart ek, J. & Lukas, J. Destruction of Claspin by SCFbetaTrCP restrains Chk1 activation and facilitates recovery from genotoxic stress. Mol Cell 23 307-318 (2006). 185. van der Horst, A., de Vries-Smits, A.M., Brenkm an, A.B., van Triest, M.H. et al. FOXO4 transcriptional activity is regulated by monoubiquitination and USP7/HAUSP. Nat Cell Biol 8 1064-1073 (2006). 186. Sarkari, F., Sanchez-Alcaraz T., Wang, S., Holowaty, M.N. et al. EBNA1mediated recruitment of a histone H2B deubiquityl ating complex to the Epstein-Barr virus latent or igin of DNA replication. PLoS Pathog 5 e1000624 (2009). 187. van der Knaap, J.A., Kozhevniko va, E., Langenberg, K., Moshkin, Y.M. et al. Biosynthetic enzyme GMP synthetase cooperates with ubiquitinspecific protease 7 in transcriptional regulation of ecdysteroid target genes. Mol Cell Biol 30 736-744 (2010). 188. van der Knaap, J.A., Kumar, B. R., Moshkin, Y.M., Langenberg, K. et al. GMP synthetase stimulates histone H2 B deubiquitylation by the epigenetic silencer USP7. Mol Cell 17, 695-707 (2005). 189. Felle, M., Joppien, S., Nemeth, A., Diermeier, S. et al. The USP7/Dnmt1 complex stimulates the DNA methylati on activity of Dnmt1 and regulates the stability of UHRF1. Nucleic Acids Res 39, 8355-8365. 190. Li, M., Chen, D. Shiloh, A., Luo, J. et al. Deubiquitination of p53 by HAUSP is an import ant pathway for p53 stabilization. Nature 416 648-653 (2002). 191. Cummins, J.M. & Vogelstein, B. HAUSP is required for p53 destabilization. Cell Cycle 3 689-692 (2004). 192. Cummins, J.M., Rago, C., Kohli, M., Kinzler, K.W. et al. Tumour suppression: disruption of HAUSP gene stabilizes p53. Nature 428 1 p following 486 (2004). 124

PAGE 125

193. Li, M., Brooks, C.L., Kon, N. & Gu W. A dynamic role of HAUSP in the p53-Mdm2 pathway. Mol Cell 13, 879-886 (2004). 194. Kon, N., Kobayashi, Y., Li, M., Brooks, C.L. et al. Inactivation of HAUSP in vivo modulates p53 function. Oncogene 29, 1270-1279 (2009). 195. Montes de Oca Luna, R., Wagner, D. S. & Lozano, G. Rescue of early embryonic lethality in mdm2-defic ient mice by deletion of p53. Nature 378 203-206 (1995). 196. Kon, N., Zhong, J., Kobayashi, Y., Li, M. et al. Roles of HAUSP-mediated p53 regulation in central nervous system development. Cell Death Differ 18, 1366-1375. 197. Kon, N., Kobayashi, Y., Li, M., Brooks, C.L. et al. Inactivation of HAUSP in vivo modulates p53 function. Oncogene 29, 1270-1279. 198. Colland, F. The therapeutic potential of deubiquitinating enzyme inhibitors. Biochem Soc Trans 38, 137-143 (2010). 199. Colland, F., Formstecher, E., Jacq, X., Reverdy, C. et al. Small-molecule inhibitor of USP7/HAUSP ubiquitin pr otease stabilizes and activates p53 in cells. Mol Cancer Ther 8 2286-2295 (2009). 200. Nicholson, B. & Suresh Kumar, K.G. The multifaceted roles of USP7: new therapeutic opportunities. Cell Biochem Biophys 60, 61-68 (2011). 201. Nakatani, Y. & Ogryzko, V. Imm unoaffinity purification of mammalian protein complexes. Methods Enzymol 370 430-444 (2003). 202. Robinson, P.A., Lomonte P., Leek, Markham, A.F. et al. Assignment1 of herpesvirus-associated ubiquitin-specif ic protease gene HAUSP to human chromosome band 16p13.3 by in situ hybridization. Cytogenet Cell Genet 83, 100 (1998). 203. Maxwell, S.A. Two-di mensional gel analysis of p53-mediated changes in protein expression. Anticancer Res 14, 2549-2556 (1994). 204. Privette, L.M., Weier, J.F., Nguyen, H.N., Yu, X. et al. Loss of CHFR in human mammary epithelial cells causes genomic instability by disrupting the mitotic spindle assembly checkpoint. Neoplasia 10, 643-652 (2008). 205. Toyota, M., Sasaki, Y., Satoh, A., Ogi, K. et al. Epigenetic inactivation of CHFR in human tumors. Proc Natl Acad Sci U S A 100 7818-7823 (2003). 125

PAGE 126

206. Marumoto, T., Hirota, T ., Morisaki, T., Kunitoku, N. et al. Roles of aurora-A kinase in mitotic entry and G2 checkpoint in mammalian cells. Genes Cells 7 1173-1182 (2002). 207. Hirota, T., Kunitoku, N ., Sasayama, T., Marumoto, T. et al. Aurora-A and an interacting activator, the LIM pr otein Ajuba, are required for mitotic commitment in human cells. Cell 114 585-598 (2003). 208. Lukasiewicz, K.B., Greenwood, T.M., Negron, V.C., Bruzek, A.K. et al. Control of centrin stability by Aurora A. PLoS One 6 e21291. 209. Qin, L., Tong, T., Song, Y., Xue, L. et al. Aurora-A interacts with Cyclin B1 and enhances its stability. Cancer Lett 275 77-85 (2009). 210. Matsusaka, T. & Pines, J. Chfr acts with the p38 stress kinases to block entry to mitosis in mammalian cells. J Cell Biol 166 507-516 (2004). 211. Privette, L.M. & Petty, E.M. CHFR: A Novel Mitotic Checkpoint Protein and Regulator of Tumorigenesis. Transl Oncol 1 57-64 (2008). 212. Marumoto, T., Honda, S., Hara, T., Nitta, M. et al. Aurora-A kinase maintains the fidelity of early and late mitotic events in HeLa cells. J Biol Chem 278 51786-51795 (2003). 213. D'Assoro, A.B., Lingle, W.L. & Salis bury, J.L. Centrosome amplification and the development of cancer. Oncogene 21, 6146-6153 (2002). 214. Lingle, W.L., Lutz, W.H ., Ingle, J.N., Maihle, N.J. et al. Centrosome hypertrophy in human breast tumors: imp lications for genomic stability and cell polarity. Proc Natl Acad Sci U S A 95, 2950-2955 (1998). 215. Salisbury, J.L., D'Asso ro, A.B. & Lingle, W.L. Centrosome amplification and the origin of chromosomal instability in breast cancer. J Mammary Gland Biol Neoplasia 9 275-283 (2004). 216. Gmeiner, W.H., Rein hold, W.C. & Pommier, Y. Genome-wide mRNA and microRNA profiling of the NCI 60 cell-line screen and comparison of FdUMP[10] with fluorouracil, floxurid ine, and topoisomerase 1 poisons. Mol Cancer Ther 9 3105-3114. 217. Liu, H., D'Andrade, P., Fulmer-Smentek, S., Lorenzi, P. et al. mRNA and microRNA expression profiles of the NCI-60 integrated with drug activities. Mol Cancer Ther 9 1080-1091. 218. Hoar, K., Chakravarty, A., Rabino, C., Wysong, D. et al. MLN8054, a small-molecule inhibitor of Aurora A, causes spindle pole and chromosome congression defects leading to aneuploidy. Mol Cell Biol 27, 4513-4525 (2007). 126

PAGE 127

219. Huck, J.J., Zhang, M., McDonald, A., Bowman, D. et al. MLN8054, an inhibitor of Aurora A kinase, induc es senescence in human tumor cells both in vitro and in vivo. Mol Cancer Res 8 373-384 (2010). 220. Manfredi, M.G., Ecsedy, J.A., Meetze, K.A., Balani, S.K. et al. Antitumor activity of MLN8054, an orally active small-molecule inhibitor of Aurora A kinase. Proc Natl Acad Sci U S A 104 4106-4111 (2007). 221. Cammareri, P., Scopelliti, A., Todaro, M., Eterno, V. et al. Aurora-a is essential for the tumorigenic capacity and chemoresistance of colorectal cancer stem cells. Cancer Res 70, 4655-4665. 222. Sun, C., Chan, F., Briassouli, P. & Linardopoulos, S. Aurora kinase inhibition downregulates NF-kappaB and sensitises tumour cells to chemotherapeutic agents. Biochem Biophys Res Commun 352 220-225 (2007). 223. Scharer, C.D., Laycock, N., Osunkoya, A.O., Logani, S. et al. Aurora kinase inhibitors synergize with paclitax el to induce apoptosis in ovarian cancer cells. J Transl Med 6 79 (2008). 224. Morrow, C.J., Tighe, A., Johnson, V.L., Scott, M.I. et al. Bub1 and aurora B cooperate to maintain BubR1-mediated inhibition of APC/CCdc20. J Cell Sci 118 3639-3652 (2005). 225. Faesen, A.C., Dirac, A.M., Shanmugham, A., Ovaa, H. et al. Mechanism of USP7/HAUSP Activation by Its CTerminal Ubiquitin-like Domain and Allosteric Regulation by GMP-Synthetase. Mol Cell 44, 147-159. 226. Meraldi, P., Honda, R. & Nigg, E.A. Aurora-A overexpression reveals tetraploidization as a major route to centrosome amplification in p53-/cells. EMBO J 21, 483-492 (2002). 227. Tang, J., Qu, L., Pang, M. & Yang, X. Daxx is reciprocally regulated by Mdm2 and Hausp. Biochem Biophys Res Commun 393 542-545 (2010). 228. Rajagopalan, H. & Lengauer, C. Aneuploidy and cancer. Nature 432 338341 (2004). 229. Kolodner, R.D., Clevel and, D.W. & Putnam, C.D. Cancer. Aneuploidy drives a mutator phenotype in cancer. Science 333 942-943 (2011). 230. Kops, G.J., Weaver, B.A. & Clevel and, D.W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nat Rev Cancer 5 773-785 (2005). 231. Weaver, B.A. & Cleveland, D.W. Does aneuploidy cause cancer? Curr Opin Cell Biol 18, 658-667 (2006). 127

PAGE 128

232. Weaver, B.A. & Clevel and, D.W. The role of aneu ploidy in promoting and suppressing tumors. J Cell Biol 185 935-937 (2009). 233. Hassold, T. & Hunt, P. To err (mei otically) is human: the genesis of human aneuploidy. Nat Rev Genet 2 280-291 (2001). 234. Wei, Y., Multi, S., Yang, C.R., Ma, J. et al. Spindle assembly checkpoint regulates mitotic cell cycle progressi on during preimplantation embryo development. PLoS One 6 e21557 (2011). 235. Pinsky, B.A. & Biggins, S. The spindle checkpoint: tension versus attachment. Trends Cell Biol 15, 486-493 (2005). 236. Carmena, M. & Earnshaw, W.C. T he cellular geography of aurora kinases. Nat Rev Mol Cell Biol 4 842-854 (2003). 237. Maresca, T.J. & Salmon, E.D. We lcome to a new kind of tension: translating kinetochore mechanics into a wait-anaphase signal. J Cell Sci 123 825-835 (2010). 238. Rao, C.V., Yamada, H.Y., Y ao, Y. & Dai, W. Enhanced genomic instabilities caused by deregulat ed microtubule dynamics and chromosome segregation: a perspective from genetic studies in mice. Carcinogenesis 30, 1469-1474 (2009). 239. Elowe, S. Bub1 and BubR1: at the interface between chromosome attachment and the spindle checkpoint. Mol Cell Biol 31 3085-3093 (2011). 240. Kelly, A.E. & Funabiki, H. Corre cting aberrant kinetochore microtubule attachments: an Aurora B-centric view. Curr Opin Cell Biol 21, 51-58 (2009). 241. Sudakin, V., Chan, G.K. & Yen, T.J. Checkpoint inhibition of the APC/C in HeLa cells is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. J Cell Biol 154 925-936 (2001). 242. Peters, J.M. The anaphase promot ing complex/cyclosome: a machine designed to destroy. Nat Rev Mol Cell Biol 7 644-656 (2006). 243. Farr, K.A. & Cohen-Fi x, O. The metaphase to anaphase transition: a case of productive destruction. Eur J Biochem 263 14-19 (1999). 244. Losada, A., Hirano, M. & Hirano, T. C ohesin release is required for sister chromatid resolution, but not for condensin-mediated compaction, at the onset of mitosis. Genes Dev 16, 3004-3016 (2002). 128

PAGE 129

245. Babu, J.R., Jeganathan, K.B., Baker, D.J., Wu, X. et al. Rae1 is an essential mitotic checkpoint regulator that cooperates with Bub3 to prevent chromosome missegregation. J Cell Biol 160 341-353 (2003). 246. Dai, W., Wang, Q. Liu, T., Swamy, M. et al. Slippage of mitotic arrest and enhanced tumor development in mice with BubR1 haploinsufficiency. Cancer Res 64, 440-445 (2004). 247. Michel, L.S., Liberal, V., Chatterjee, A., Kirchwegger, R. et al. MAD2 haplo-insufficiency causes premature anaphase and chromosome instability in mammalian cells. Nature 409 355-359 (2001). 248. Weaver, B.A. & Clevel and, D.W. Aneuploidy: instigator and inhibitor of tumorigenesis. Cancer Res 67, 10103-10105 (2007). 249. Weaver, B.A., Silk, A.D., M ontagna, C., Verdier-Pinard, P. et al. Aneuploidy acts both oncogenically and as a tumor suppressor. Cancer Cell 11, 25-36 (2007). 250. Baker, D.J., Jin, F., Jeganathan, K.B. & van Deurse n, J.M. Whole chromosome instability caused by Bub1 insufficiency drives tumorigenesis through tumor suppressor gene loss of heterozygosity. Cancer Cell 16, 475-486 (2009). 251. Jeganathan, K., Malureanu, L ., Baker, D.J., Abraham, S.C. et al. Bub1 mediates cell death in response to chromosome missegregation and acts to suppress spontaneous tumorigenesis. J Cell Biol 179 255-267 (2007). 252. Chan, G.K., Liu, S.T. & Yen, T. J. Kinetochore structure and function. Trends Cell Biol 15, 589-598 (2005). 253. Hoyt, M.A., Totis, L. & Roberts, B. T. S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function. Cell 66, 507-517 (1991). 254. Martinez-Exposito, M.J., Kaplan, K.B., Copeland, J. & Sorger, P.K. Retention of the BUB3 checkpoint protein on lagging chromosomes. Proc Natl Acad Sci U S A 96 8493-8498 (1999). 255. Braunstein, I., Miniowitz, S., Moshe, Y. & Hershko, A. Inhibitory factors associated with anaphasepromoting complex/cylosome in mitotic checkpoint. Proc Natl Acad Sci U S A 104 4870-4875 (2007). 256. Tang, Z., Shu, H., Oncel, D., Chen, S. et al. Phosphorylati on of Cdc20 by Bub1 provides a catalytic mechanism fo r APC/C inhibition by the spindle checkpoint. Mol Cell 16 387-397 (2004). 129

PAGE 130

257. Logarinho, E. & Bousbaa, H. Kinetochore-microtubule interactions "in check" by Bub1, Bub3 and BubR1: The dual task of attaching and signalling. Cell Cycle 7 1763-1768 (2008). 258. Logarinho, E., Resende, T., Torres, C. & Bousbaa, H. The human spindle assembly checkpoint protein Bub3 is required for the establishment of efficient kinetochore-mi crotubule attachments. Mol Biol Cell 19, 1798-1813 (2008). 259. Kalitsis, P., Earle, E., Fowler, K. J. & Choo, K.H. Bub3 gene disruption in mice reveals essential mitotic spi ndle checkpoint function during early embryogenesis. Genes Dev 14, 2277-2282 (2000). 260. Gisselsson, D. Classification of chro mosome segregation errors in cancer. Chromosoma 117 511-519 (2008). 261. Fenech, M., Kirsch-Volders, M. Natarajan, A.T., Surralles, J. et al. Molecular mechanisms of micronucl eus, nucleoplasmic bridge and nuclear bud formation in mammalian and human cells. Mutagenesis 26, 125-132 (2010). 262. Cimini, D., Fioravanti, D., Salmon, E.D. & Degrassi, F. Merotelic kinetochore orientation versus chromoso me mono-orientatio n in the origin of lagging chromosomes in human primary cells. J Cell Sci 115 507-515 (2002). 263. Norppa, H. & Falck, G.C. What do human micronuclei contain? Mutagenesis 18, 221-233 (2003). 264. Hoffelder, D.R., Luo, L., Burke, N.A., Watkins, S.C. et al. Resolution of anaphase bridges in cancer cells. Chromosoma 112 389-397 (2004). 265. Bakhoum, S.F., Genovese, G. & Compton, D.A. Deviant kinetochore microtubule dynamics underlie chromosomal instability. Curr Biol 19, 1937-1942 (2009). 266. Bakhoum, S.F., Thompson, S.L., M anning, A.L. & Comp ton, D.A. Genome stability is ensured by temporal control of kinetochore-microtubule dynamics. Nat Cell Biol 11, 27-35 (2009). 267. Bakhoum, S.F. & Compton, D.A. Cancer: CINful centrosomes. Curr Biol 19, R642-645 (2009). 268. Zyss, D. & Gergely, F. Centrosome function in cancer: guilty or innocent? Trends Cell Biol 19, 334-346 (2009). 130

PAGE 131

269. Gisselsson, D., Hakanson, U., Stoller, P., Marti, D. et al. When the genome plays dice: circumvention of t he spindle assembly checkpoint and near-random chromosome segregation in multipolar cancer cell mitoses. PLoS One 3 e1871 (2008). 270. To-Ho, K.W., Cheung, H. W., Ling, M.T., Wong, Y.C. et al. MAD2DeltaC induces aneuploidy and promotes anchorage-independent growth in human prostate epithelial cells. Oncogene 27, 347-357 (2008). 271. Sowa, M.E., Bennett, E.J., Gygi, S.P. & Harper, J.W. Defining the human deubiquitinating enzyme interaction landscape. Cell 138 389-403 (2009). 272. Hussain, S., Zhang, Y. & Galardy, P.J. DUBs and cancer: the role of deubiquitinating enzymes as oncogenes, non-oncogenes and tumor suppressors. Cell Cycle 8 1688-1697 (2009). 273. Banno, K., Yanokura, M., Kawaguchi, M., Kuwabara, Y. et al. Epigenetic inactivation of the CHFR gene in cervical cancer contributes to sensitivity to taxanes. Int J Oncol 31, 713-720 (2007). 274. Rong, R., Jiang, L.Y., Sheikh, M.S. & Huang, Y. Mitotic kinase Aurora-A phosphorylates RASSF1A and modulates RASSF1A-mediated microtubule interaction and Mphase cell cycle regulation. Oncogene 26, 7700-7708 (2007). 275. Song, M.S., Song, S.J., Ayad, N.G., Chang, J.S. et al. The tumour suppressor RASSF1A regulates mito sis by inhibiting the APC-Cdc20 complex. Nat Cell Biol 6 129-137 (2004). 276. Liu, L., Baier, K., Dammann, R. & Pfeifer, G.P. The tumor suppressor RASSF1A does not interact with Cdc20, an activator of the anaphasepromoting complex. Cell Cycle 6 1663-1665 (2007). 277. Swanton, C., Tomlinson, I. & Down ward, J. Chromosomal instability, colorectal cancer and taxane resistance. Cell Cycle 5 818-823 (2006). 278. Swanton, C., Nicke, B., Schuett, M., Eklund, A.C. et al. Chromosomal instability determines taxane response. Proc Natl Acad Sci U S A 106 8671-8676 (2009). 279. Hollstein, M., Sidransky, D., Vogelstein, B. & Harris, C.C. p53 mutations in human cancers. Science 253 49-53 (1991). 280. Levine, A.J., Momand, J. & Finlay C.A. The p53 tumour suppressor gene. Nature 351 453-456 (1991). 131

PAGE 132

281. Zhou, H., Kuang, J., Zhong, L., Kuo, W.L. et al. Tumour amplified kinase STK15/BTAK induces centrosome amplification, aneuploidy and transformation. Nat Genet 20, 189-193 (1998). 282. Giet, R. & Prigent, C. Aurora/Ip l1p-related kinases, a new oncogenic family of mitotic serine-threonine kinases. J Cell Sci 112 ( Pt 21) 35913601 (1999). 283. Manfredi, M.G., Ecsedy, J.A., Chakravarty, A., Silverman, L. et al. Characterization of Alisertib (MLN8237), an investigational small-molecule inhibitor of aurora A kinase using nov el in vivo pharmacodynamic assays. Clin Cancer Res 17, 7614-7624. 132

PAGE 133

BIOGRAPHICAL SKETCH Serena Giovinazzi was born in 1980 in Ta ranto, Italy, second daughter of highschool teachers Giuseppe Giovinazzi and Maria Rosaria Migliaccio. Serena attended scientific high school with biology specialization and graduated in 1998. Then she graduated with honor s from the University of Bologna, Italy, in 2004 with a M.S. in pharmaceutical biotechnology. During the last year of college she worked on her research project for the master degree thesis at the Biochemistry & Molecular Biology Department of the Chiron/Novartis Vaccines Research Centre in Siena, Italy. After college graduation, from 2004 to 2007 Serena worked on several research projects as microbiologist at the Biochemistry & Molecula r Biology Department of the Chiron/Novartis Vaccines Research Centre in Siena, Italy, under the supervision of Dr. Renata Grifantini and Dr. Guido Grandi. In February 2007 she obtained a research fellowship at the Istituto Super iore di Sanit (ISS) in Rome Italy, which is the leading technical and scientific public body of the Italia n National Health Service, where she studied the role of a human micro-RNA cluster in cancer. Serena joined the University of Flori das IDP graduate school program in 2008 and pursed her Ph.D work in the laboratory of Dr Alexander Ishov studying Daxx function in cellular taxol response and mitosis. She has presented her work at several national and international conferences and published her research. Since 2005 Serena has been involved in tr aining new lab members and serving as teaching assistant for several cour ses in biological sciences. In 2004 Serena was awarded of the summa cum laude degree from University of Bologna for the achievements during her aca demic studies. She also received travel awards (in 2009, 2010 and 2011) from the graduate school, outstanding international 133

PAGE 134

student awards (in 2009 and 2011) from t he college of medicine at UFL, and the Medical Guild research incentive award in 2010 from University of Florida. 134